Nitrogenous aromatic ring compounds

NITROGEN-CONTAINING AROMATIC DERIVATIVES

Technical Field

The present invention relates to novel compounds which are effective for prevention and treatment of various diseases associated with abnormal angiogenesis, and to medical compositions such as angiogenesis inhibitors and antitumor agents comprising the novel compounds . Background Art

Angiogenesis is an essential biological phenomenon for fetal vascular formation and morphological and functional development of organs. New blood vessels are assembled through several processes including endothelial cell migration, proliferation and tube formation, and the participation of mast cells, lymphocytes, interstitial cells and the like has been shown to be important in this process (J. Folkman and Y. Shing, J. Biol. Chem., 267, 10931, 1992). In adult individuals, physiological angiogenesis occurs during the female estrous cycle, but pathological increase in angiogenesis in adult individuals is known to be connected with onset or progression of various diseases. Specific diseases associated with abnormal angiogenesis include cancer, rheumatoid arthritis, atherosclerosis, diabetic retinopathy, angioma, psoriasis, and the like

FP01 00 (J. Folkman, N. Engl. J. Med., 333, 1757, 1995). In particular, the literature has indicated angiogenesis dependency for solid tumor growth, and angiogenesis inhibitors are therefore promising as new therapeutic agents for intractable solid tumors (J. Folkman, J. Natl. Cancer Inst., 82, 4, 1990).

The prior art includes compounds based on a urea structure, described in W099/00357 and WOOO/43366. WO99/00357 mentions biphenylurea derivatives which have an inhibiting action on raf kinase and an antitumor effect, but their angiogenesis-inhibiting effect is not disclosed. WOOO/43366 describes quinoline derivatives and quinazoline derivatives which exhibit a weak karyomorphism-altering effect on A375 human melanoma cells in vitro and an antiproliferative effect on י endothelial cells stimulated by vascular epithelial growth factor (VEGF), and which thus have an antitumor effect, but their effect on angiogenic factors other than VEGF is not disclosed.

Disclosure of the Invention

As mentioned above, it is ardently desired to provide angiogenesis-inhibiting compounds which are useful as drugs. However, clinically effective compounds that exhibit excellent angiogenesisinhibiting effects and high usefulness as medicines have not yet been discovered.

It is an object of the present invention to investigate and discover angiogenesis-inhibiting compounds which (1) exhibit antitumor activity through a powerful angiogenesis-inhibiting effect or a powerful angiogenesis-inhibiting and cancer cells growthinhibiting effect, (2) are highly useful as drug materials in terms of their properties, biokinetics and safety, and (3) are useful for amelioration, prevention and treatment of various diseases associated with abnormal increase in angiogenesis.

As a result of much diligent research in light of the circumstances described above, the present inventors have succeeded in synthesizing novel compounds represented by the following general formula (I) and their salts or hydrates, and have completed the present invention upon discovering that the compounds of general formula (I) and their salts or hydrates exhibit an excellent angiogenesis-inhibiting effect.

Specifically, the present invention relates to:

a compound represented by the following general formula:

<img file="IL155447A_D0001.tif" />

(ii)

[wherein A is a group represented by the formula:

<img file="IL155447A_D0002.tif" />

[wherein W is a carbon atom; Ra13 is a hydrogen atom; Re12 is a cyano group ora group represented by the formula:

0 0

Uc-N-O-V’12 kc&amp;#1470;O&amp;#1470;Va12 or C-N-V312 ? &gt;/a13 ? &gt; ^a13 (wherein V«12 and '/013are each independently a hydrogen atom, a Cr6 alkyl group which may have one or more substituents selected from [group A], a C2.6 alkenyl group which may have one or more substituents selected from [group A], a C2.6 alkynyl group which may have one or more substituents selected from [group A], a C3.8 alicyclic hydrocarbon group which may have one or more substituents selected from [group A], a ¾.,4 aryl group which may have one or more substituents selected from [group A], a 5- to 14-membered heterocyclic group which may have one or more substituents selected from [group A] or a 5- to 14-membered aromatic heterocyclic group which may have one or more substituents selected from [group A]); and Ra11 is a group represented by the formula

-Va21.va22.va23 (wherein Va21 is a 01-6 alkylene group which may have one or more substituents selected from [group A], a single bond ora group represented by the formula:

xXa ; Va22 is a single bond, an oxygen atom, a sulfur atom, -CO-, -SO-, -SO2-, -CONRa14-, -SO2NRa14-, -NRa14SO2-, -NRa14CO- or-NRa14- (wherein Ra14 is a hydrogen atom, a 06_&amp;#1503; alkyl group which may have one or more substituents selected from [group A] or a C3.8 alicyclic hydrocarbon group which may have one or more substituents selected from [group A]); and Va23 is a hydrogen atom, aC^g alkyl group which may have one crmore substituents selected from [group A], a C2.6 alkenyl group which may have one or more substituents selected from [group A], a C2.6 alkynyl group which may have one or more substituents selected from [group A], a ¾.0 alicyclic hydrocarbon group which may have one or more substituents selected from [group A], a C6.14 aryl group which may have one or more substituents selected from [group A], a 5- to 14-membered heterocyclic group which may have one or more substituents selected from [group A] or a 5- to 14-membered aromatic heterocyclic group which may have one or more substituents selected from [group A])];

X is an oxygen atom or a sulfur atom;

E and Y represent as follows:

(1) E is a group represented by the formula -NR2-, and Y is a phenyl group which may have one or more substituents selected from [group A], a pyridyl group which may have one or more substituents selected from [group A] or a group represented by the formula:

<img file="IL155447A_D0003.tif" />

(wherein W11 and W12 are each independently a carbon atom which may have one or more substituents selected from [group A] or a nitrogen atom);

(2) E is a single bond, and Y is a group represented by the formula:

<img file="IL155447A_D0004.tif" />

(wherein W13 is a carbon atom which may have one or more substituents selected from [group A] or a nitrogen atom), which may have one or more substituents selected from [group A];

R1 and R2 are each independently a hydrogen atom, a C^g alkyl group which may have one or more substituents selected from [group A], a C2.5 alkenyl group which may have one or more substituents selected from [group A], a C2_g alkynyl group which may have one or more substituents selected from [group A], a C3.8 alicyclic hydrocarbon group which may have one or more substituents selected from [group A], a C2.7 acyl group which may have one or more substituents selected from [group A] or a C2.7 alkoxycarbonyl group which may have one or more substituents selected from [group A]; and

Z is a group represented by the formula -Z11-z12 (wherein Z11 is a single bond, an oxygen atom, a sulfur atom, -CO-, -S02- or a 0.,.6 alkylene group which may have one or more substituents selected from [group A] and Z12 is a hydrogen atom, a alkyl group which may have one or more substituents selected from [group A], a C2^ alkenyl group which may have one or more substituents selected from [group A], a C2.8 alkynyl group which may have one or more substituents selected from [group A], a C3^ alicyclic hydrocarbon group which may have one or more substituents selected from [group A], a C6.14 aryl group which may have one or more substituents selected from [group A], a 5- to 14-membered heterocyclic group which may have one or more substituents selected from [group A], a 5- to 14-membered aromatic heterocyclic group which may have one or more substituents selected from [group A] or a group represented by the formula:

<img file="IL155447A_D0005.tif" />

(wherein Z31, Z33and !34are each independently a methylene group, -CO-, -NH- or-O-, andZ32 is a single bond, a methylene group, -CO-, -NH- or .O.))], a pharmaceutically acceptable salt or a hydrate thereof, wherein [group A] has the following members:

(1) halogens, (2) hydroxyl, (3) thiol, (4) nitro, (5) nitrile, (6) oxo, (7) azido, (8) guanidino, (9) hydrazino, (10) isocyano, (11) cyanate, (12) isocyanate, (13) thiocyanate, (14) isothiocyanate, (15) nitroso, (16) carbamido (ureido),(17)formyl, (18) 06_&amp;#1503; imidoyl, (19)optionally halogenated orhydroxylatedC^galkyl groups, C2.6alkenyl groups, C2^ alkynyl groups, C3^ cycloalkyl groups, C3.6 cycloalkenyl groups, C3^ cycloalkynyl groups, C^ alkoxy groups, C2.6 alkenyloxy groups, C2i alkynyloxy groups, C3.6 cycloalkyloxy groups, C1^ alkylthio groups, CM alkenylthio groups, C2.6 alkynylthio groups, C3i cycloalkylthio groups or 01-5 alkylenedioxy groups, (20) C6.14 aryl groups, (21) 5- to 14-membered heterocyclic groups, (22) carboxyl, (23) trifluoromethyl, (24) C6.14 aryl-C-i.6 alkyl groups, (25) 5-to 14-membered heterocyclic Cv6 alkyl groups or (26) the group represented by the formula -V5«1 -V1«2 -\jxx3 .yxx4 (wherein V.«1. V5«2 and V5«3 are each independently 1) a single bond, 2) oxygen, 3) sulfur, 4) -CO-, 5) -SO-, 6) -SO2-, 7) -NR5«1-, 8) -CONR5«1-, 9) -NR^CO-, 10) -SC^NR5«1-, 11) -NR&gt;«1SO2-, 12) -O-CO-, 13) -0(0)0-, 14) -NR5«^(&amp;#9633;)&amp;#9633;-, 15) -NR^’C^JNR5«2-, 16) -O-CiOJNR5«1-, 17) 0(0)0-, 18) a Cv6 alkylene group, 19) a C2.6 alkenyl group, 20) a 01-6 alkynyl group, 21) a C3.8 alicyclic hydrocarbon group, 22) a CB.14 aryl group, 23) a 5- to 14-membered heterocyclic group or 24) a 5- to 14membered aromatic heterocyclic group: and V5«4, Rxx1 and R5«2 are each independently 1) hydrogen, 2) a C1.6 alkyl group, 3) a C2.6 alkenyl group, 4) a alkynyl group, 5) a C3.8 alicyclic hydrocarbon group, 6) a C6.14 aryl group, 7) a 5-to 14-membered heterocyclic group, 8) a 5- to 14-membered aromatic heterocyclic group or 9) a C^g alkoxy group.

In a second aspect, the invention relates to a compound represented by the following general formula:

<img file="IL155447A_D0006.tif" />

[wherein Z22 is a C6.14 aryl group which may have one or more substituents selected from [group A] in claim 1, a 5- to 14-membered heterocyclic group which may have one or more substituents selected from [group A] in claim 1 or a 5- to 14-membered aromatic heterocyclic group which may have one or more substituents selected from [group A] in claim 1; R300 and R301 have the same definitions as R300 and R301 in claim 3; Vd13 is a group selected from the group consisting of the formulas:

<img file="IL155447A_D0007.tif" />

C=N , I—C-N~O-Va12 and &lt; ^813 (wherein Va12and Va13 have the same definitions as Va12and Va13in claim 1); Vd11 is a Ο1-6 alkylene group which may have one or more substituents selected from [group A] in claim 1 or a group represented by the formula;

; and Vd12 is (1) a group represented by the formula -NRd11Rd12 (wherein Ra11 and Rd12 are eadh a hydrogen atom, a alkyl group which may have one or more substituents selected from [group A] in claim 1, a C3.8 alicyclic hydrocarbon group which may have one or more substituents selected from [group A] in claim 1, a Cg_14 aryl group which may have one or more substituents selected from [group A] in olaim 1, a 5- to 14-membered heterocyclic group which may have one or more substituents selected from [group A] in claim 1 or a 5- to 14-membered aromatic heterocyclic group which may have one or more substituents selected from [group A] in claim 1), or (2) a 5- to 14membered heterocyclic group which may have one or more substituents selected from [group A] in claim 1], a pharmaceutically acceptable salt or a hydrate thereof.

The invention further relates to pharmaceutical compositions including the foregoing compounds and also relates to the use of said compounds for the manufacture of a prophylactic or therapeutic agent for a disease for which angiogenesis inhibition is effective, of an angiogenesis inhibitor, of an antitumor agent, of a therapeutic agent for angioma, of a cancer metastasis inhibitor, of a therapeutic agent for retinal neovascularization, of a therapeutic agent for an inflammatory disease selected from deformant arthritis, rheumatoid arthritis, psoriasis and delayed hypersensitivity reaction, of a therapeutic agent for atherosclerosis, of a therapeutic agent for a pancreatic cancer, a gastric cancer, a colon cancer, a breast cancer, a prostate cancer, a lung cancer, a renal cancer, a brain tumor, a blood cancer or an ovarian cancer, and of an angiogenesis inhibition-based antitumor agent.

The next page is numbered 41, version 2

FP01 00 group and (4) the formula -vxl-Vx2-Vx22-Vx3 (wherein Vxl, V and v are each independently a single bond, an oxygen atom, a sulfur atom, -CO-, -SO-, -SO2-, -NRX1-, CONRX1-, -NRX1CO-, -SO2NRx1-, -NRx1SO2-, -O-CO-, -0(0)0-, -NRX1C(O)O&amp;#1470;, -NRX1C (0) NRX2-, -O&amp;#1470;C (0) NRX1-, 0(0)0-, an optionally substituted C1-6 alkylene group, an optionally substituted C2_6 alkenyl group, an optionally substituted C2-g alkynyl group, an optionally substituted C3-8 alicyclic hydrocarbon group, an optionally substituted C6 aryl group, an optionally substituted 5- to 14-membered heterocyclic group or an optionally substituted 5- to 14-membered aromatic heterocyclic group; and Vx3, RX1 and Rx2 are each independently a hydrogen atom, an optionally substituted C!_6 alkyl group, an optionally substituted C2 alkenyl group, an optionally substituted C2 alkynyl group, an optionally substituted C3_8 alicyclic hydrocarbon group, an optionally substituted C6-14 aryl group, an optionally substituted 5- to 14-membered heterocyclic group, an optionally substituted 5- to 14membered aromatic heterocyclic group or an optionally substituted C!-6 alkoxy group)], a salt thereof or a hydrate of the foregoing;

&lt;3&gt; a compound according to &lt;2&gt;, a salt of the compound or a hydrate of the foregoing, wherein X is an oxygen atom or a sulfur atom;

FP01 00 &lt;4&gt; a compound according to &lt;2&gt; or &lt;3&gt;, a salt of the compound or a hydrate of the foregoing, wherein Z is an optionally substituted cyclopropyl group, an optionally substituted 2-thiazolyl group or a group represented by the formula:

(wherein Z13 is a nitrile group, a methylsulfonyl group or a -NHCOCH3 group);

&lt;5&gt; a compound according to any one of &lt;2&gt; to &lt;4&gt;, a salt of the compound or a hydrate of the foregoing, wherein E is a group represented by the formula -NR2(wherein R2 has the same definition as R2 in &lt;2&gt;), and Y is an optionally substituted phenyl group, an optionally substituted pyridyl group or a group represented by the formula:

<img file="IL155447A_D0008.tif" />

(wherein W11 and W12 are each independently an optionally substituted carbon atom or a nitrogen atom); &lt;6&gt; a compound according to any one of &lt;2&gt; to &lt;4&gt;, a salt of the compound or a hydrate of the foregoing, wherein E is a single bond, and Y is a further optionally substituted group represented by the formula:

FP01 00

<img file="IL155447A_D0009.tif" />

(wherein W13 is an optionally substituted carbon atom or a nitrogen atom);

&lt;7&gt; a compound according to any one of &lt;2&gt; to &lt;6&gt;, a salt of the compound or a hydrate of the foregoing, wherein A is a group represented by the formula:

<img file="IL155447A_D0010.tif" />

[wherein W is an optionally substituted carbon atom or a nitrogen atom; Ral3 is a hydrogen atom, a halogen atom, an optionally substituted C1-6 alkyl group, an optionally substituted C!-6 alkoxy group, an amino group or a nitro group; Ral2 is a cyano group or a group represented by the formula:

C-N-O-Va12 L SO2-N-Va12 L SO2&amp;#1470;Va12 kc-O-Va12 &gt; ^a13 ? ^a13 5 25 &amp;#943; θ0 μΝ_ν311.νΒ&amp;#912;2 l.&amp;#1470; N-Va11—N-Va12 L_c_N_Va11_Va12 ,. L_£_N_va12

Qa13 pΓ ^3 (wherein Val1 is -CO- or -SO2~; and Val2, Val3 and Val4 are each independently a hydrogen atom, an optionally

FP01 00 substituted C!-6 alkyl group, an optionally substituted C2-6 alkenyl group, an optionally substituted C2 alkynyl group, an optionally substituted C3_8 alicyclic hydrocarbon group, an optionally substituted C6 aryl group, an optionally substituted 5&amp;#1524; to 14-membered heterocyclic group or an optionally substituted 5- to 14-membered aromatic heterocyclic group); and RaU is a group represented by the formula -Va21-Va22-Va23 (wherein Va21 is an optionally substituted C1-6 alkylene group, a single bond or a group represented by the formula:

&amp;#1497; 22 = ; V is a single bond, an oxygen atom, a sulfur atom, -CO-, -SO-, -SO2-, -CONRa14-, -SO2NRa14-, -NRal4SO2&amp;#1470;, NRal4CO- or -NRa14- (wherein Ral4 is a hydrogen atom, an optionally substituted C!-6 alkyl group or an optionally substituted C3_8 alicyclic hydrocarbon group) ; and Va23 is a hydrogen atom, an optionally substituted C1-6 alkyl group, an optionally substituted C2-6 alkenyl group, an optionally substituted C2-6 alkynyl group, an optionally substituted C3-8 alicyclic hydrocarbon group, an optionally substituted C6 aryl group, an optionally substituted 5- to 14-membered heterocyclic group or an optionally substituted 5- to 14-membered aromatic heterocyclic group)];

&lt;8&gt; a compound according to any one of &lt;2&gt; to &lt;6&gt;, a

FP01 00 salt of the compound or a hydrate of the foregoing, wherein A is a group represented by the formula:

<img file="IL155447A_D0011.tif" />

(wherein W is an optionally substituted carbon or a nitrogen atom; and Ral1, Ral2 and Ral3 have the same definitions as Ral1, Ral2 and Ral3 in &lt;7&gt;) ;

&lt;9&gt; a compound according to any one of &lt;2&gt; to &lt;6&gt;, a salt of the compound or a hydrate of the foregoing, wherein A is a further optionally substituted group represented by the formula:

<img file="IL155447A_D0012.tif" />

[wherein W is an optionally substituted carbon atom or a nitrogen atom; and Abl1 is (1) an optionally substituted 5- to 14-membered heterocyclic group or (2) 15 a group represented by the formula:

<img file="IL155447A_D0013.tif" />

FP01 00 (wherein Vbn and Vbl2 are each independently a single bond, -S02&amp;#1470;, -NHCO- or a group represented by the formula -(CH2)b-CO- (wherein b is an integer of 0 to 6) ; Rbl3 is a single bond, an optionally substituted C!-6 alkylene group, an optionally substituted C3-8 alicyclic hydrocarbon group or an optionally substituted 5- to 14-membered heterocyclic group; and RbU and Rbl2 are each independently a hydrogen atom, a hydroxyl group, a halogen atom, an optionally substituted C!-6 alkyl group, an optionally substituted C2 alkenyl group, an optionally substituted C2_6 alkynyl group, an optionally substituted C3-8 alicyclic hydrocarbon group, an optionally substituted C6-14 aryl group, an optionally substituted 5- to 14-membered aromatic heterocyclic group or an optionally substituted 5- to 14-membered heterocyclic group)];

&lt;10&gt; a compound according to any one of &lt;2&gt; to &lt;6&gt;, a salt of the compound or a hydrate of the foregoing, wherein A is a group represented by the formula:

<img file="IL155447A_D0014.tif" />

[wherein W is an optionally substituted carbon or a

FP01 00 nitrogen atom; Rcl3 is (1) a hydrogen atom, (2) a cyano group, (3) a halogen atom, (4) a formyl group, (5) an optionally substituted C!-6 alkyl group, (6) a group represented by the formula:

A/c22 —vc21-nC) &amp;#1524; ^V23 (wherein Vc21 is -CO- or a methylene group; Vc22 and Vc23 are each independently a hydrogen atom, an optionally substituted C!-6 alkyl group, an optionally substituted C2-6 alkenyl group, an optionally substituted C2 alkynyl group, an optionally substituted C3 alicyclic hydrocarbon group, an optionally substituted 5- to 14membered heterocyclic group, an optionally substituted

5- to 14-membered aromatic heterocyclic group or an optionally substituted C6-14 aryl group), or (7) a group represented by the formula -Vc21-O-Vc22 (wherein Vc21 and Vc22 have the same definitions as Vc21 and Vc22 above) ; R is a hydrogen atom, an optionally substituted C1-6 alkyl group or an optionally substituted C3 alicyclic hydrocarbon group; and Rcl1 is a group represented by the formula -VcU-Vcl2-Vc13 (wherein Vcl1 is a single bond, an oxygen atom, an optionally substituted benzene ring, an optionally substituted 5- to 14-membered aromatic heterocyclic group or -CO-; Vcl2 is a single bond, an oxygen atom or an optionally substituted C!-6 alkylene group; and Vcl3 is (1) an optionally substituted C!-6

FP01 00 alkyl group, (2) an optionally substituted C2-e alkenyl group, (3) an optionally substituted C2 alkynyl group, (4) an optionally substituted C3-g alicyclic hydrocarbon group, (5) a hydroxyl group, (6) a carboxyl group, (7) an optionally substituted C2-7 alkoxycarbonyl group, (8) an optionally substituted 5- to 14-membered heterocyclic group, (9) an optionally substituted 5- to 14-membered aromatic heterocyclic group, (10) an optionally substituted C6-!4 aryl group, (11) a group represented by the formula -NRc21Rc22 (wherein Rc21 and Rc22 are each independently a hydrogen atom or an optionally substituted C!-6 alkyl group), or (12) a hydrogen atom)];

&lt;11&gt; a compound represented by the following general formula:

<img file="IL155447A_D0015.tif" />

(ilia)

R \ /V 0 N

[wherein R1, R2 and Z12 have the same definitions as R1, R2 and Z12 in &lt;2&gt;, but Z12 is not a pyrazolyl group; Yal is a group represented by the formula:

FP01 00

<img file="IL155447A_D0016.tif" />

(wherein W31 and W32 are each independently an optionally substituted carbon atom or a nitrogen atom; R300 and R3Q1 are each independently a hydrogen atom, a halogen atom, a cyano group, a nitro group, an amino group, an optionally substituted C!_6 alkyl group, an optionally substituted C3-8 alicyclic hydrocarbon group, an optionally substituted C!-6 alkoxy group, an optionally substituted C2-7 alkoxycarbonyl group, a formyl group, a group represented by the formula ^-C-N-V300

301^ &amp;#1497; (wherein V300 and V3Q1 are each independently a hydrogen atom or an optionally substituted C1-6 alkyl group), or an optionally substituted C2 acyl group) ; and Ral1 and Ral2 have the same definitions as Ral1 and Ral2 in &lt;7&gt;, with the exception of the following compounds (1) and (2) : (1) a compound wherein Ral2 is a group represented by the formula:

&amp;#941; 0 ?—SO2&amp;#1470;&amp;#1470;N&amp;#1470;Va12 . ^_N_0_va12 ya13 * ya13 (wherein Val2 and Val3 have the same definitions as Val2 and Val3 in &lt;7&gt;), R1 and R2 are hydrogen atoms and Z12 is

FP01 00 a C6-14 aryl group, a 6- to 14-membered heterocyclic group or a 6- to 14-membered aromatic heterocyclic group; (2) a compound wherein Ral2 is a group selected from the group consisting of the formulas:

USO2-V12 Lc-O-V2’&amp;#1470; p-N-V-v.12

Va13 j-N-Va11-N-Va12 L_N_Va11.va12 g

L13 J/314 &amp;#1500; I 1&amp;#1504;&amp;#1523; &gt;—C^N“Va va13 va14 ya13 — ξ ^13 (wherein Val1, Val2, Val3 and Va&amp;#1524; have the same definitions as Val1, Val2, Val3 and Val4 in &lt;7&gt;) , R2 is a hydrogen atom and Z12 is (a) a C6.14 aryl group, (b) a 5to 14-membered heterocyclic group, (c) a 5- to 14membered aromatic heterocyclic group, (d) a C!-6 alkyl group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, (e) a C2 alkenyl group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, (f) a C2 alkynyl group substituted with a 5- to

10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, or (g) a C3-8 alicyclic hydrocarbon group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group], a salt thereof or a hydrate of the foregoing;

&lt;12&gt; a compound according to &lt;11&gt;, a salt of the compound or a hydrate of the foregoing, wherein Ral1 is a methyl group, a 2-methoxyethyl group or a group

FP01 00 represented by the formula:

<img file="IL155447A_D0017.tif" />

<img file="IL155447A_D0018.tif" />

(wherein Ra53 is a methyl group, a cyclopropylmethyl group or a cyanomethyl group; Ra51 is a hydrogen atom, a fluorine atom or a hydroxyl group; and Ra52 is a 1pyrrolidinyl group, a 1-piperidinyl group, a 4morpholinyl group, a dimethylamino group or a diethylamino group);

&lt;13&gt; a compound according to &lt;11&gt; or &lt;12&gt;, a salt of the compound or a hydrate of the foregoing, wherein Z12 is a methyl group, an ethyl group, a cyclopropyl group, a 2-thiazolyl group or a 4-fluorophenyl group;

&lt;14&gt; a compound according to any one of &lt;11&gt; to &lt;13&gt;, a salt of the compound or a hydrate of the foregoing, wherein Yal is a group represented by the formula:

<img file="IL155447A_D0019.tif" />

(wherein Ra61 is a hydrogen atom, a methyl group, a trifluoromethyl group, a chlorine atom or a fluorine atom);

&lt;15&gt; a compound according to any one of &lt;11&gt; to &lt;14&gt;, a salt of the compound or a hydrate of the foregoing,

FP01 00 wherein Ral2 is a cyano group or a group represented by the formula -CONHRa62 (wherein Re62 is a hydrogen atom, an optionally substituted C!-6 alkyl group, an optionally substituted C3-8 alicyclic hydrocarbon group, an optionally substituted C1-6 alkoxy group or an optionally substituted C3-8 cycloalkoxy group);

&lt;16&gt; a compound represented by the following general formula:

<img file="IL155447A_D0020.tif" />

[wherein Z21 is a hydrogen atom, an optionally substituted C1-5 alkyl group, an optionally substituted 02-6 alkenyl group, an optionally substituted 02-6 alkynyl group or an optionally substituted C3-8 alicyclic hydrocarbon group; Ral20 is a cyano group or a group represented by the formula:

0 0 kc&amp;#1470;N&amp;#1470;O-Va12 Ls02-N-Va12 L SO2-Va12 ^&amp;#1470;C-O-V312 F0-Va15 5 5 ^a135 , 00 N_va11.Va12 l.N-Va11—N&amp;#1470;Va12 |_£_N—Va11_Va12 ,.

^13 ^13 14&amp;#1497;&amp;#1470;,|&amp;#1509; * I ?^ * ^ya &amp;#1504;&amp;#1497;&amp;#1493;* (wherein Val5 is an optionally substituted C1-6 alkyl group, an optionally substituted C2-6 alkenyl group, an optionally substituted C2-6 alkynyl group or an

FP01 00 optionally substituted C3-8 alicyclic hydrocarbon group, and VaU, Val2, Val3 and Val4 have the same definitions as Val1, Val2, Val3 and Val4 in &lt;7&gt;) ; R300 and R301 have the same definitions as R300 and R301 in &lt;11&gt;; and Ral1 has the same definition as RaU in &lt;7&gt;, with the exception of a compound wherein Ral20 is a group selected from the group consisting of the formulas:

0 i-so^v&amp;#1524; U-o-v’2 H-n-V-V’2 j-O-V” * 1 ^13

L.N_va11.va12 Ln-Va11—N&amp;#1470;Va12 N va12 /3 va13 Va14 &amp;#1497; va13 (wherein val1, val2, Val3 and Val4 have the same definitions as Val1, Val2, Val3 and Val4 in &lt;7&gt;, and Val5 is as defined above), and Z21 is (a) a C2-g alicyclic hydrocarbon group, (b) a C1-6 alkyl group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, (c) a C2_6 alkenyl group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, or (d) a C2 alkynyl group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group], a salt thereof or a hydrate of the foregoing; &lt;17&gt; a compound represented by the following general formula:

FP01 00

<img file="IL155447A_D0021.tif" />

[wherein Z22 is an optionally substituted C6-14 aryl group, an optionally substituted 5- to 14-membered heterocyclic group or an optionally substituted 5- to 14-membered aromatic heterocyclic group; R300 and R301 have the same definitions as R300 and R301 in &lt;11&gt;; Vdl3 is a group selected from the group consisting of the formulas :

C=N i-C-N-O-V312 i-SO2-N-Va12 &amp;#1497; &amp;#1497; \/al3 &amp;#1497; ^a13 (wherein Val2 and Val3 have the same definitions as Val2 and Val3 in &lt;7&gt;) ; VdU is an optionally substituted C1-6 alkylene group or a group represented by the formula:

xXx ; and Vdl2 is (1) a group represented by the formula NRdllRd12 (wherein Rdn and Rdl2 are each a hydrogen atom, an optionally substituted C!-6 alkyl group, an optionally substituted C3-8 alicyclic hydrocarbon group, an optionally substituted C6 aryl group, an optionally substituted 5- to 14-membered heterocyclic group or an optionally substituted 5- to 14-membered

FP01 00 aromatic heterocyclic group), or (2) an optionally substituted 5- to 14-membered heterocyclic group], a salt thereof or a hydrate of the foregoing;

&lt;18&gt; a compound represented by the following general formula:

r300

<img file="IL155447A_D0022.tif" />

[wherein R1, R2 and Z12 have the same definitions as R1, R2 and Z12 in &lt;2&gt;; Wu is an optionally substituted carbon atom or a nitrogen atom; R300 has the same definition as R300 in &lt;11&gt;; Ral1 has the same definition as R11 in &lt;7&gt;; and Ral20 has the same definition as Ral20 in &lt;16&gt;, with the exception of the following compounds (1) and (2) : (1) a compound wherein Ral20 is a group represented by the formula:

&gt; 0 ks02&amp;#1524;N&amp;#1470;Va12 . C—Μ-Ο’-ξ/312 &lt; ^a13 (wherein Val2 and Val3 have the same definitions as Val2 and Val3 in &lt;7&gt;), R1 and R2 are hydrogen atoms and Z12 is a C6-14 aryl group, a 6- to 14-membered heterocyclic group or a 6- to 14-membered aromatic heterocyclic group; (2) a compound wherein Ral20 is a group selected from the group consisting of the formulas:

FP01 00 ^-C&amp;#1470;N-Va12 ? J.a13

Ο θ &amp;#943; tso2-v12 I—c-o-v312 p-N-V-v.12 p-v.’5 \l,a13 L_N_vaH.va12 L-N_va11_N_val2 ri&amp;#1470;!.&amp;#1507; &amp;#1524;&amp;#1470; (wherein Val1, Val2, Val3 and Va&amp;#1524; have the same definitions as Val1, Val2, Val3 and Val4 in &lt;7&gt;, and Val5 has the same definition as Val5 in &lt;16&gt;), R2 is a hydrogen atom and Z12 is (a) a C6-14 aryl group, (b) a 5to 14-membered heterocyclic group, (c) a 5- to 14membered aromatic heterocyclic group, (d) a C!.6 alkyl group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, (e) a C2-6 alkenyl group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, (f) a C2 alkynyl group substituted with a 5- to

10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, or (g) a C3_8 alicyclic hydrocarbon group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group], a salt thereof or a hydrate of the foregoing;

&lt;19&gt; a compound represented by the following general formula:

Xy1

<img file="IL155447A_D0023.tif" />

FP01 00

[wherein W41 and W are each independently an optionally substituted carbon atom or a nitrogen atom, but W4! and W are not both nitrogen atoms; Xyl is an optionally substituted group selected from the group consisting of the following formulas:

Π Z12 0 (wherein Z12 has the same definition as Z12 in &lt;2&gt;, and W11 is an optionally substituted carbon atom or a nitrogen atom) ; and Abl1 has the same definition as Abl1 in &lt;9&gt;], a salt thereof or a hydrate of the foregoing; &lt;20&gt; a compound represented by the following general formula:

Rc\13 (Illi)

[wherein Rcl3 has the same definition as Rcl3 in &lt;10&gt;; Xy2 is an optionally substituted group selected from the group consisting of the following formulas:

&amp;#1470;0

Z12

A A2 'N^N (wherein Z12, R1 and R2 have the same definitions as Z12,

FP01 00

R1 and R2 in &lt;2&gt;, and W11 is an optionally substituted carbon atom or a nitrogen atom) ; and Rcl1 and Rcl2 have the same definitions as Rcl1 and Rcl2 in &lt;10&gt;, with the exception of the following compounds (1) and (2): (1) a compound wherein R1 and R2 are hydrogen atoms and Z12 is (a) a C6 aryl group, (b) a 5- to 14-membered heterocyclic group, (c) a C!-6 alkyl group substituted with a 5- to 14-membered aromatic heterocyclic group, a

5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, (d) a C2-6 alkenyl group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, (e) a C2-6 alkynyl group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, or (f) a C3_8 alicyclic hydrocarbon group substituted with a 5- to 10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group; (2) a compound wherein Xy2 is a group represented by the formula:

<img file="IL155447A_D0024.tif" />

<img file="IL155447A_D0025.tif" />

(wherein Z12 is (a) a Cg-14 aryl group, (b) a 5- to 14membered heterocyclic group, (c) a 5- to 14-membered aromatic heterocyclic group, (d) a C1-6 alkyl group substituted with a 5- to 10-membered heterocyclic group

FP01 00 or a C5-10 alicyclic hydrocarbon group, (e) a C2-6 alkenyl group substituted with a 5- to 10-membered heterocyclic group or a C5-!0 alicyclic hydrocarbon group, (f) a C2-6 alkynyl group substituted with a 5- to

10-membered heterocyclic group or a C5-10 alicyclic hydrocarbon group, or (g) a C3-8 alicyclic hydrocarbon group)], a salt thereof or a hydrate of the foregoing; &lt;21&gt; a compound according to &lt;10&gt; or &lt;20&gt;, a salt of the compound or a hydrate of the foregoing, wherein Rcl1 is a group represented by the formula:

[wherein Vfn is a single bond, an optionally substituted C!-6 alkylene group or a group represented by the formula:

; and Vfl2 is (1) a hydrogen atom, (2) a hydroxyl group, (3) an optionally substituted 5- to 14-membered heterocyclic group, (4) an optionally substituted 5- to 14-membered aromatic heterocyclic group, (5) an optionally substituted C6-14 aryl group or (6) a group represented by the formula -NRf21Rf22 (wherein Rf21 and Rf22 are each independently a hydrogen atom or an optionally substituted C!-6 alkyl group)];

FP01 00 &lt;22&gt; a compound represented by the following general formula:

<img file="IL155447A_D0026.tif" />

[wherein X has the same definition as X in &lt;2&gt;; R300 and R301 have the same definitions as R300 and R301 in &lt;11&gt;; and A31 is a group selected from the group consisting of the formulas:

<img file="IL155447A_D0027.tif" />

(wherein Rcl3 has the same definition as Rcl3 in &lt;10&gt;; W, RaU and Ral3 have the same definitions as W, Ral1 and Ral3 in &lt;7&gt;; AbU has the same definition as Abl1 in &lt;9&gt;; Rcl2 has the same definition as Rcl2 in &lt;10&gt;; and ReU is a group represented by the formula:

<img file="IL155447A_D0028.tif" />

(wherein Vfn and Vfl2 have the same definitions as Vm and Vfl2 in &lt;21&gt;, but Vfl2 is not a hydrogen atom)) ], a salt thereof or a hydrate of the foregoing;

&lt;23&gt; a compound represented by the following general

FP01 00 formula:

<img file="IL155447A_D0029.tif" />

[wherein Z12, R1 and R2 have the same definitions as Z12,

R1 and R2 in &lt;2&gt;; R300 and R301 have the same definitions as R300 and R301 in &lt;11&gt;; and A32 is a group selected from the group consisting of the formulas:

<img file="IL155447A_D0030.tif" />

(wherein Rcl3 has the same definition as Rcl3 in &lt;10&gt;; W,

Ral1, Ral2 and Ral3 have the same definitions as W, Ral1,

Ral2 and Ral3 in &lt;7&gt;; Abl1 has the same definition as AbU in &lt;9&gt;; and Rcl1 and Rcl2 have the same definitions as Rcl1 and Rcl2 in &lt;10&gt;) ], a salt thereof or a hydrate of the foregoing;

&lt;24&gt; a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt of the compound or a hydrate of the foregoing, wherein said compound is a compound selected from N-(4-(6-cyano (3-(4pyridyl)propoxy) quinolyl)oxyphenyl)-N'-(4methoxyphenyl)urea, N-(4-(6-cyano (2-(1,2,3-triazol

FP01 00

2-yl)ethoxy) quinolyl)oxyphenyl)-Ν' -(4fluorophenyl)urea, N-(4-(6-cyano (2-(1,2,3-triazol-lyl)ethoxy) quinolyl)oxyphenyl)-Ν' -(4fluorophenyl)urea, N-(4-(6-cyano (2-(1,2,3-triazol-2yl)ethoxy) quinolyl)oxyphenyl)-Ν' -(2,4difluorophenyl)urea, N-(4-(6-cyano (2-(1,2,3-triazol1-yl)ethoxy) quinolyl)oxyphenyl)-Ν' -(2,4difluorophenyl)urea, N-(4-(6-cyano (2-methoxyethoxy)-

4-quinolyl)oxyphenyl)-Ν' -(4-fluorophenyl)urea, N-(4-(6cyano (2-methoxyethoxy) quinolyl)oxyphenyl)-Ν' (1,3-thiazol yl)urea, N-(4-(6-cyano (2methoxyethoxy) quinolyl)oxyphenyl)-N'-(3cyanophenyl)urea, N-(4-(6-cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'-(2-(methylsulfonyl)phenyl)urea, N- (4-(6-cyano (2-methoxyethoxy) quinolyl)oxyphenyl)-Ν'-cyclopropylurea, N-(4-(6-cyano-

7-(2-methoxyethoxy) quinolyl)oxy fluorophenyl)-N'(1,3-thiazol yl)urea, N-(4-(6-cyano (2methoxyethoxy) quinolyl)oxy fluorophenyl)-N'cyclopropylurea, N-(4-(6-cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'-cyclopropylmethylurea, N- (4- (6cyano (3-(morpholin yl)propoxy)quinolin yloxy) -2fluorophenyl)-Ν'-(2,4-difluorophenyl)urea, N-(4-(6cyano (3&amp;#1524;(diethylamino)propoxy) quinolyloxy)phenyl)-Ν' -(4-fluorophenyl)urea, N- (4 - (6cyano (3-(4-morpholino)propoxy)-4

FP01 00 quinolyl)oxyphenyl)-Ν' -(4-fluorophenyl)urea, N-(4-(6cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-Ν'-(3-(methylsulfonyl)phenyl)urea, N-(4(6-cyano (3-(diethylamino)propoxy) quinolyl)oxy-2fluorophenyl)-N'-(2,4-difluorophenyl)urea, N- (4 - (6cyano (3-(1-(4-ethylpiperazino)) propoxy)-4quinolyl)oxyphenyl)-Ν' -(4-methoxyphenyl)urea, N-(4- (6cyano (3-cyanopropoxy) quinolyl)oxy-2fluorophenyl)-Ν' -(2,4-difluorophenyl)urea, N-(4-(6cyano (2-(methylsulfonyl)ethoxy) quinolyl)oxy-2fluorophenyl)-Ν' -(2, 4-difluorophenyl)urea, N-(4-(6cyano (2-(methylsulfonyl)ethoxy)-4quinolyl)oxyphenyl)-Ν' -(4-fluorophenyl)urea, N-(4-(6cyano (2-methoxyethoxy) quinolyl)oxyphenyl)-Ν' phenylurea, N-(4-(6-cyano (2-methoxyethoxy)-4quinolyl)oxy fluorophenyl)-Ν' -(2,4difluorophenyl)urea, N-(4- (6-cyano (3methoxycarbonylpropoxy) quinolyl)oxyphenyl)-Ν' -(4methoxyphenyl)urea, N-(4-(6-cyano (3-carboxypropoxy)4-quinolyl)oxyphenyl)-Ν' -(4-methoxyphenyl)urea, N-(4(6-cyano (2-(2-hydroxyethoxy)ethoxy)-4quinolyl)oxyphenyl)-Ν'-(4-methoxyphenyl) urea, N-(4-(6cyano (3-(diethylamino)propoxy)-4quinolyloxy)phenyl)-Ν' -(3-(methylsulfonyl)phenyl)urea, N-(4-(6-cyano (3-(4-morpholino)propoxy)-4quinolyl)oxyphenyl)-Ν' -(3-(methylsulfonyl)phenyl)urea,

FP01 00

N-(4- (6-cyano (3-(diethylamino)propoxy)-4quinolyloxy)phenyl)-N'-phenylurea, N-(4-(6-cyano (3(4-morpholino)propoxy) quinolyl)oxyphenyl)-Ν' phenylurea, N-(4-(6-cyano (3-(4-morpholino)propoxy)4-quinolyl)oxyphenyl)-N'-(2-oxo-l,2,3,4-tetrahydro6&amp;#1470;quinolyl)urea, N-(4-(6-cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-Ν'-(3-acetamidophenyl)urea, N-(4(6-cyano benzyloxy quinolyl)oxy fluorophenyl)-Ν' (2,4-difluorophenyl)urea, N-(4 - (6-cyano (2methoxyethoxy) quinolyl)oxy fluorophenyl)-Ν' -(4fluorophenyl)urea, N-(4-(6-cyano (2-methoxyethoxy)-4quinolyl)oxy fluorophenyl)-Ν'-phenylurea, 4- (4- ( (4fluoroanilino)carbonyl)aminophenoxy) (2methoxyethoxy) quinolinecarboxamide, 7-(2methoxyethoxy) (4-((1,3-thiazol-2ylamino)carbonyl)aminophenoxy) quinolinecarboxamide, 4-(4-( (anilinocarbonyl) amino) fluorophenoxy) (2methoxyethoxy) quinolinecarboxamide, 4- (4- ( (4fluoroanilino)carbonyl)aminophenoxy) methoxy-6quinolinecarboxamide, 4-(4((cyclopropylamino)carbonyl)aminophenoxy) (2methoxyethoxy) quinolinecarboxamide, 7-methoxy (4((1,3-thiazol ylamino)carbonyl)aminophenoxy)-6quinolinecarboxamide, 4- (4- ( (2,4difluoroanilino)carbonyl)amino fluorophenoxy)-7methoxy quinolinecarboxamide, 4-(431

FP01 00 ((cyclopropylamino)carbonyl)aminophenoxy) methoxy-6quinolinecarboxamide, 4-(5-((anilinocarbonyl)amino)-2pyridyloxy) methoxy quinolinecarboxamide, 4-(4(anilinocarbonyl)aminophenoxy) methoxy-6quinolinecarboxamide, 4-(4(anilinocarbonyl)aminophenoxy) (2-methoxyethoxy)-6quinolinecarboxamide, 4- (4- ((2,4difluoroanilino)carbonyl)amino fluorophenoxy) (2methoxyethoxy) quinolinecarboxamide, 4- (4- ( (4fluoroanilino)carbonyl)amino fluorophenoxy) (2methoxyethoxy) quinolinecarboxamide, 7-(2methoxyethoxy) (4-((1,3-thiazol-2ylamino)carbonyl)amino fluorophenoxy)-6quinolinecarboxamide and 4-(4-((4fluoroanilino)carbonyl)amino fluorophenoxy)-7methoxy quinolinecarboxamide;

&lt;25&gt; a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt of the compound or a hydrate of the foregoing, wherein said compound is a compound selected from N-(4-(6-cyano (2methoxyethoxy) quinolyl)oxy fluorophenyl)-Ν'-(4fluorophenyl)urea, N-(2-chloro ((6-cyano ((1methyl piperidyl)methoxy) quinolyl)oxy)phenyl)-N'cyclopropylurea, N- (4-((6-cyano (((2R)-3(diethylamino) hydroxypropyl)oxy)-4quinolyl)oxy)phenyl)-Ν' -(4-fluorophenyl)urea, N-(4-((6

FP01 00 cyano (((2R) hydroxy (1-pyrrolidino)propyl)oxy)4-quinolyl)oxy)phenyl)-Ν'-(4-fluorophenyl)urea, N-{4[6-cyano (2-hydroxy pyrrolidin-l-yl-propoxy)quinolin yloxy] methylphenyl}-N'-cyclopropyl-urea, 4-(4-(4-fluoroanilino)carbonyl) methylaminophenoxy)7-methoxy quinolinecarboxamide, 4-(3-chloro-4(cyclopropylaminocarbonyl)aminophenoxy) methoxy-6quinolinecarboxamide, 4- (3-chloro-4(cyclopropylaminocarbonyl)aminophenoxy) (2methoxyethoxy)-β-quinolinecarboxamide, N6-cyclopropyl4-(3-chloro (((cyclopropylamino)carbonyl)amino) phenoxy) methoxy quinolinecarboxamide, N6-(2methoxyethyl) (3-chloro-4(((cyclopropylamino)carbonyl)amino)phenoxy) methoxy-

6-quinolinecarboxamide, N6-(2-pyridyl) (3-chloro-4( ( (cyclopropylamino)carbonyl)amino)phenoxy) methoxy-

6-quinolinecarboxamide, N6-(2-fluoroethyl) (3-chloro4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7methoxy quinolinecarboxamide, N6-methoxy (3-chloro4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7methoxy quinolinecarboxamide, N6-methyl (3-chloro4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7methoxy quinolinecarboxamide, N6-ethyl (3-chloro-4(((cyclopropylamino)carbonyl)amino)phenoxy) methoxyβ-quinolinecarboxamide, 6-carbamoyl (1- ethylcarbamoyl-lH-indol yloxy) methoxyquinoline, 6

FP01 00 carbamoyl methoxy (1-propylcarbamoyl-ΙΗ-indol-5yloxy)quinoline, 6-carbamoyl methoxy [1-(1methyl)ethylcarbamoyl-lH-indol yloxy]quinoline, N4(4-{4-[(anilinocarbonyl)amino] chlorophenoxy}-2pyridyl)-l-methyl piperidinecarboxamide, Nl-phenyl-3chloro [(2-{[(l-methyl piperidyl)carbonyl]amino}-4pyridyl)oxy]-ΙΗ indolecarboxamide, N4-[4- (3-chloro-4{[(4-fluoroanilino)carbonyl]amino}phenoxy) pyridyl]l-methyl piperidinecarboxamide, 1-(2-chloro {6-[4(2-diethylaminoethoxy)-phenyl]-7H-pyrrolo[2,3-

d]pyrimidin yloxy}phenyl) cyclopropylurea, l-{2chloro [6-[4-((2R) hydroxy diethylaminopropoxy)phenyl]-7H-pyrrolo[2,3-d]pyrimidin yloxy]-phenyl}-3cyclopropylurea, 1-(2-chloro {6-[4-((2R) hydroxy-3pyrrolidinopropoxy)-phenyl]-7H-pyrrolo[2,3-d]pyrimidin4-yloxy}-phenyl) cyclopropylurea and 1-(2-chloro-4{6-[4-(2-diethylaminopropoxy)-phenyl]-7H-pyrrolo[2,3d]pyrimidin yloxy}phenyl) cyclopropylurea;

&lt;26&gt; a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt of the compound or a hydrate of the foregoing, wherein said compound is a compound selected from .4-(3-chloro-4(cyclopropylaminocarbonyl)aminophenoxy) methoxy-6quinolinecarboxamide, 4- (3-chloro-4(ethylaminocarbonyl)aminophenoxy) methoxy-6quinolinecarboxamide, N6-methoxy (3-chloro-434

FP01 00 (((cyclopropylamino)carbonyl)amino)phenoxy) methoxy-

6-quinolinecarboxamide, 4-(3-chloro-4(methylaminocarbonyl)aminophenoxy) methoxy-6quinolinecarboxamide and N6-methoxy (3-chloro (((ethylamino)carbonyl)amino)phenoxy) methoxy-6quinolinecarboxamide;

&lt;27&gt; a medicament (a drug) comprising as an active ingredient, a compound according to any one of &lt;1&gt; to &lt;6&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;28&gt; an angiogenesis inhibiting activity-based medicament (an angiogenesis inhibiting activity-based drug) comprising as an active ingredient, a compound according to any one of &lt;1&gt; to &lt;6&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;29&gt; a pharmaceutical composition comprising a compound represented by the general formula:

[wherein A is an optionally substituted 5- to 14membered aromatic heterocyclic group; X is an oxygen atom, a sulfur atom, -SO- or -SO2; Y is an optionally substituted C6-14 aryl group, an optionally substituted

5- to 14-membered aromatic heterocyclic group or an

FP01 00 optionally substituted C!-6 alkylene group; E is a single bond or -NR2-; R1 and R2 are each independently a hydrogen atom, an optionally substituted C1-6 alkyl group, an optionally substituted C2 alkenyl group, an optionally substituted C2 alkynyl group, an optionally substituted C3-8 alicyclic hydrocarbon group, an optionally substituted C2 acyl group or an optionally substituted C2 alkoxycarbonyl group; and Z is a group represented by the formula -Zn-Z12 (wherein Zn is a single bond, an oxygen atom, a sulfur atom, -CO-, -S02or an optionally substituted C1-6 alkylene group and Z12 is a hydrogen atom, an optionally substituted C!-6 alkyl group, an optionally substituted C2 alkenyl group, an optionally substituted C2 alkynyl group, an optionally substituted C3.8 alicyclic hydrocarbon group, an optionally substituted C6 aryl group, an optionally substituted 5- to 14-membered heterocyclic group, an optionally substituted 5- to 14-membered aromatic heterocyclic group or a group represented by the formula:

z?1

32&amp;#1491;\ (wherein Z31, Z33 and Z3&lt;! are each independently a methylene group, -CO-, -NH- or , and Z32 is a single

FP01 00 bond, a methylene group, -CO-, -NH- or )), with the proviso that A may be optionally substituted with 1 to 6 groups, each selected from the group consisting of (1) a cyano group, (2) a halogen atom, (3) a nitro group and (4) the formula -Vx1-Vx2-Vx22-Vx3 (wherein Vxl, Vx2 and Vx22 are each independently a single bond, an oxygen atom, a sulfur atom, -CO-, -SO-, -SO2&amp;#1470;, -NRX1-, CONRX1~, -NRX1CO-, -SO2NRx1-, -NRx1SO2&amp;#1470;, -O&amp;#1470;CO&amp;#1470; ,&amp;#1470;C(O)O&amp;#1470;, -NRX1C(O)O-, -NRX1C (0) NRX2-, -0&amp;#1470;C (0) NRX1-, -0&amp;#1470;C(0)0&amp;#1470;, an optionally substituted C!_6 alkylene group, an optionally substituted C2_6 alkenyl group, an optionally substituted C2-6 alkynyl group, an optionally substituted C3-8 alicyclic hydrocarbon group, an optionally substituted C6-14 aryl group, an optionally substituted 5- to 14-membered heterocyclic group or an optionally substituted 5- to 14-membered aromatic heterocyclic group; and Vx3, RX1 and Rx2 are each independently a hydrogen atom, an optionally substituted C!-6 alkyl group, an optionally substituted C2-6 alkenyl group, an optionally substituted C2-6 alkynyl group, an optionally substituted C3-8 alicyclic hydrocarbon group, an optionally substituted C6-14 aryl group, an optionally substituted 5- to 14-membered heterocyclic group, an optionally substituted 5- to 14membered aromatic heterocyclic group or an optionally substituted C!-5 alkoxy group)], a pharmacologically

FP01 00 acceptable salt thereof or a hydrate of the foregoing, together with a pharmacologically acceptable carrier; &lt;30&gt; a prophylactic or therapeutic agent for a disease for which angiogenesis inhibition is effective, comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;31&gt; an angiogenesis inhibitor comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;.

&lt;32&gt; an antitumor agent comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;33&gt; a therapeutic agent for angioma (an angioma treatment agent) comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing; &lt;34&gt; a cancer metastasis inhibitor comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;35&gt; a therapeutic agent for retinal neovascularization or diabetic retinopathy (a retinal neovascularization treatment agent or diabetic retinopathy treatment

FP01 00 agent) comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;36&gt; a therapeutic agent for an inflammatory disease (an inflammatory disease treatment agent) comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;37&gt; a therapeutic agent for an inflammatory disease selected from deformant arthritis, rheumatoid arthritis, psoriasis and delayed hypersensitivity reaction (an inflammatory disease treatment agent for deformant arthritis, rheumatoid arthritis, psoriasis or delayed hypersensitivity reaction) comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;38&gt; a therapeutic agent for atherosclerosis (an atherosclerosis treatment agent) comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;39&gt; a therapeutic agent for a pancreatic cancer, a gastric cancer, a colon cancer, a breast cancer, a prostate cancer, a lung cancer, a renal cancer, a brain tumor, a blood cancer or an ovarian cancer (a

FP01 00 pancreatic cancer treatment agent, a gastric cancer treatment agent, a colon cancer treatment agent, a breast cancer treatment agent, a prostate cancer treatment agent, a pulmonary cancer treatment agent, a renal cancer treatment agent, a brain tumor treatment agent, a blood cancer treatment agent or an ovarian cancer treatment agent) comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;40&gt; an angiogenesis inhibition-based antitumor agent comprising as an active ingredient, a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;41&gt; a prophylactic or therapeutic method for a disease for which angiogenesis inhibition is effective, comprising administering to a patient, a pharmacologically effective dose of a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing;

&lt;42&gt; The use of a compound according to &lt;1&gt; or &lt;2&gt;, a pharmacologically acceptable salt thereof or a hydrate of the foregoing for the manufacture of a prophylactic or a therapeutic agent for a disease for which angiogenesis inhibition is effective.

Best Mode for Carrying Out the Invention

The previous page is numbered 7, version 2

Best Mode for Carrying Out the Invention

The present invention will now be explained in greater detail.

Several of the structural formulas given for compounds throughout the present specification will represent a specific isomer for convenience, but the invention is not limited to such specific isomers and encompasses all isomers and isomer mixtures, including geometric isomers, asymmetric carbon-derived optical isomers, stereoisomers and tautomers, implied by the structures of the compounds. Moreover, the compounds of the invention also include those that have been metabolized in the body by oxidation, reduction, hydrolysis, conjugation or the like, and still exhibit the desired activity, while the invention further encompasses all compounds which undergo metabolism such as oxidation, reduction, hydrolysis, etc. in the body to produce the compounds of the invention. Solvates, including those with water, are also encompassed by the invention.

The terms used throughout the present specification will now be defined.

The term halogen atom as used throughout the present specification refers to halogen atoms such as fluorine, chlorine, bromine and iodine, with fluorine, chlorine and bromine being preferred.

The term C!-6 alkyl group as used throughout the

FP01 00 present specification refers to a linear or branched alkyl group of 1 to 6 carbons, and as specific examples there may be mentioned methyl, ethyl, n-propyl, ipropyl, n-butyl, i-butyl, sec-butyl, t-butyl, n-pentyl, i-pentyl, sec-pentyl, t-pentyl, neopentyl, 1methylbutyl, 2-methylbutyl, 1,1-dimethylpropyl, 1,2dimethylpropyl, n-hexyl, i-hexyl, 1-methylpentyl, 2methylpentyl, 3-methylpentyl, 1,1-dimethylbutyl, 1,2dimethylbutyl, 2,2-dimethylbutyl, 1,3-dimethylbutyl,

2,3-dimethylbutyl, 3,3-dimethylbutyl, 1-ethylbutyl, 2ethylbutyl, 1,1,2-trimethylpropyl, 1,2,2trimethylpropyl, 1-ethyl-l-methylpropyl and l-ethyl-2methylpropyl, preferably methyl, ethyl, n-propyl, ipropyl, n-butyl, i-butyl, sec-butyl, t-butyl, n-pentyl, i-pentyl, sec-pentyl, t-pentyl, neopentyl, 1methylbutyl, 2-methylbutyl, 1,1-dimethylpropyl, 1,2dimethylpropyl, n-hexyl and i-hexyl, more preferably methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, sec-butyl, t-butyl, n-pentyl, i-pentyl, sec-pentyl, tpentyl, neopentyl, 1-methylbutyl, 2-methylbutyl, 1,1dimethylpropyl and 1,2-dimethylpropyl, even more preferably methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, sec-butyl and t-butyl, and most preferably methyl, ethyl, n-propyl and i-propyl.

The term C!-6 alkylene group as used throughout the present specification refers to a divalent group

FP01 00 derived by removing one hydrogen atom from the aforementioned C!-6 alkyl group, and as specific examples there may be mentioned methylene, ethylene, methylethylene, propylene, ethylethylene, 1,1dimethylethylene, 1,2-dimethylethylene, trimethylene, 1-methyltrimethylene, 1-ethyltrimethylene, 2methyltrimethylene, 1,1-dimethyltrimethylene, tetramethylene, pentamethylene and hexamethylene.

The term C2-6 alkenyl group as used throughout the present specification refers to a linear or branched alkenyl group of 2 to 6 carbons, and it is a substituent with a double bond in a C!-6 alkyl group of 2 or more carbons. As specific examples there may be mentioned ethenyl, 1-propen-l-yl, 2-propen-l-yl, 3propen-l-yl, 1-buten-l-yl, l-buten yl, l-buten yl, l-buten yl, 2-buten-l-yl, 2-buten yl, 1-methyl-lpropen-l-yl, 2-methyl-l-propen-l-yl, l-methyl propen-

1- yl, 2-methyl propen-l-yl, 1-methyl-l-buten-l-yl, 2methyl-l-buten-l-yl, 3-methyl-l-buten-l-yl, l-methyl-2buten-l-yl, 2-methyl buten-l-yl, 3-methyl buten-lyl, l-methyl buten-l-yl, 2-methyl buten-l-yl, 3methyl buten-l-yl, 1-ethyl-l-buten-l-yl, 2-ethyl-lbuten-l-yl, 3-ethyl-l-buten-l-yl, l-ethyl buten-l-yl,

2- ethyl buten-l-yl, 3-ethyl buten-l-yl, l-ethyl-3buten-l-yl, 2-ethyl buten-l-yl, 3-ethyl buten-l-yl,

1,1-dimethyl-l-buten-l-yl, 1,2-dimethyl-l-buten-l-yl,

FP01 00

1.3- dimethyl-l-buten-l-yl, 2,2-dimethyl-l-buten-l-yl,

3.3- dimethyl-l-buten-l-yl, 1,l-dimethyl buten-l-yl,

1.2- dimethyl buten-l-yl, 1,3-dimethyl buten-l-yl,

2.2- dimethyl buten-l-yl, 3,3-dimethyl buten-l-yl,

1,l-dimethyl buten-l-yl, 1,2-dimethyl buten-l-yl,

1.3- dimethyl buten-l-yl, 2,2-dimethyl buten-l-yl,

3.3- dimethyl buten-l-yl, 1-penten-l-yl, 2-penten-l-yl,

3-penten-l-yl, 4-penten-l-yl, l-penten yl, 2-penten-

2- yl, 3-penten yl, 4-penten yl, l-penten yl, 2penten yl, 1-methyl-l-penten-l-yl, 2-methyl-l-penten1-yl, 3-methyl-l-penten-l-yl, 4-methyl-l-penten-l-yl, l-methyl penten-l-yl, 2-methyl penten-l-yl, 3methyl penten-l-yl, 4-methyl penten-l-yl, 1-methyl-

3- penten-l-yl, 2-methyl penten-l-yl, 3-methyl-3penten-l-yl, 4-methyl penten-l-yl, l-methyl penten1-yl, 2-methyl penten-l-yl, 3-methyl penten-l-yl,

4- methyl penten-l-yl, l-methyl-l-penten yl, 2methyl-l-penten yl, 3-methyl-l-penten yl, 4-methyl-

1- penten yl, l-methyl penten yl, 2-methyl-2penten yl, 3-methyl penten yl, 4-methyl penten-

2- yl, l-methyl penten yl, 2-methyl penten yl,

3- methyl penten yl, 4-methyl penten yl, 1methyl penten yl, 2-methyl penten yl, 3-methyl-

4- penten yl, 4-methyl penten yl, 1-methyl-lpenten yl, 2-methyl-l-penten yl, 3-methyl-l-penten-

3-yl, 4-methyl-l-penten yl, l-methyl penten yl,

FP01 00

2-methyl penten yl, 3-methyl penten yl, 4methyl penten yl, 1-hexen-l-yl, l-hexen yl, 1hexen yl, l-hexen yl, l-hexen yl, l-hexen yl, 2-hexen-l-yl, 2-hexen yl, 2-hexen yl, 2-hexen yl,

2- hexen yl, 2-hexen yl, 3-hexen-l-yl, 3-hexen yl,

3- hexen yl, preferably ethenyl, 1-propen-l-yl, 2propen-l-yl, 3-propen-l-yl, 1-buten-l-yl, l-buten yl, l-buten yl, l-buten yl, 2-buten-l-yl, 2-buten yl, 1-methyl-l-propen-l-yl, 2-methyl-l-propen-l-yl, 1methyl propen-l-yl, 2-methyl propen-l-yl, 1-methyl1-buten-l-yl, 2-methyl-l-buten-l-yl, 3-methyl-l-buten-

1- yl, l-methyl buten-l-yl, 2-methyl buten-l-yl, 3methyl buten-l-yl, l-methyl buten-l-yl, 2-methyl-3buten-l-yl, 3-methyl buten-l-yl, 1-ethyl-l-buten-l-yl,

2- ethyl-l-buten-l-yl, 3-ethyl-l-buten-l-yl, l-ethyl-2buten-l-yl, 2-ethyl buten-l-yl, 3-ethyl buten-l-yl, l-ethyl buten-l-yl, 2-ethyl buten-l-yl, 3-ethyl-3buten-l-yl, 1,1-dimethyl-l-buten-l-yl, 1,2-dimethyl-lbuten-l-yl, 1,3-dimethyl-l-buten-l-yl, 2,2-dimethyl-lbuten-l-yl, 3,3-dimethyl-l-buten-l-yl, 1,l-dimethyl-2buten-l-yl, 1,2-dimethyl buten-l-yl, 1,3-dimethyl-2buten-l-yl, 2,2-dimethyl buten-l-yl, 3,3-dimethyl-2buten-l-yl, 1,l-dimethyl buten-l-yl, 1,2-dimethyl-3buten-l-yl, 1,3-dimethyl buten-l-yl, 2,2-dimethyl-3buten-l-yl and 3,3-dimethyl buten-l-yl, more preferably ethenyl, 1-propen-l-yl, 2-propen-l-yl, 3

FP01 00 propen-l-yl, 1-buten-l-yl, l-buten yl, l-buten yl, l-buten yl, 2-buten-l-yl, 2-buten yl, 1-methyl-lpropen-l-yl, 2-methyl-l-propen-l-yl, l-methyl propen1-yl, 2-methyl propen-l-yl, 1-methyl-l-buten-l-yl, 2methyl-l-buten-l-yl, 3-methyl-l-buten-l-yl, l-methyl-2buten-l-yl, 2-methyl buten-l-yl, 3-methyl buten-lyl, l-methyl buten-l-yl, 2-methyl buten-l-yl and 3methyl buten-l-yl, and most preferably ethenyl, 1propen-l-yl, 2-propen-l-yl, 3-propen-l-yl, 1-buten-l-yl, l-buten yl, l-buten yl, l-buten yl, 2-buten-l-yl and 2-buten yl.

The term C2-6 alkynyl group as used throughout the present specification refers to a linear or branched alkynyl group of 2 to 6 carbons, and it is a substituent with a triple bond in a C!-6 alkyl group of 2 or more carbons. As specific examples there may be mentioned ethynyl, 1-propyn-l-yl, 2-propyn-l-yl, 3propyn-l-yl, 1-butyn-l-yl, l-butyn yl, l-butyn yl, l-butyn yl, 2-butyn-l-yl, 2-butyn yl, 1-methyl-lpropyn-l-yl, 2-methyl-l-propyn-l-yl, l-methyl propyn1-yl, 2-methyl propyn-l-yl, 1-methyl-l-butyn-l-yl, 2methyl-l-butyn-l-yl, 3-methyl-l-butyn-l-yl, l-methyl-2butyn-l-yl, 2-methyl butyn-l-yl, 3-methyl butyn-lyl, l-methyl butyn-l-yl, 2-methyl butyn-l-yl, 3methyl butyn-l-yl, 1-ethyl-l-butyn-l-yl, 2-ethyl-lbutyn-l-yl, 3-ethyl-l-butyn-l-yl, l-ethyl butyn-l-yl,

FP01 00

2- ethyl butyn-l-yl, 3-ethyl butyn-l-yl, l-ethyl-3butyn-l-yl, 2-ethyl butyn-l-yl, 3-ethyl butyn-l-yl,

1.1- dimethyl-l-butyn-l-yl, 1,2-dimethyl-l-butyn-l-yl.,

1.3- dimethyl-l-butyn-l-yl, 2,2-dimethyl-l-butyn-l-yl,

3.3- dimethyl-l-butyn-l-yl, 1,l-dimethyl butyn-l-yl,

1.2- dimethyl butyn-l-yl, 1,3-dimethyl butyn-l-yl,

2.2- dimethyl butyn-l-yl, 3,3-dimethyl butyn-l-yl, 1,l-dimethyl butyn-l-yl, 1,2-dimethyl butyn-l-yl,

1.3- dimethyl butyn-l-yl, 2,2-dimethyl butyn-l-yl,

3.3- dimethyl butyn-l-yl, 1-pentyn-l-yl, 2-pentyn-l-yl,

3- pentyn-l-yl, 4-pentyn-l-yl, l-pentyn yl, 2-pentyn-

2- yl, 3-pentyn yl, 4-pentyn yl, l-pentyn yl, 2pentyn yl, 1-methyl-l-pentyn-l-yl, 2-methyl-l-pentyn1-yl, 3-methyl-l-pentyn-l-yl, 4-methyl-l-pentyn-l-yl, l-methyl pentyn-l-yl, 2-methyl pentyn-l-yl, 3methyl pentyn-l-yl, 4-methyl pentyn-l-yl, 1-methyl-

3- pentyn-l-yl, 2-methyl pentyn-l-yl, 3-methyl-3pentyn-l-yl, 4-methyl pentyn-l-yl, l-methyl pentyn1-yl, 2-methyl pentyn-l-yl, 3-methyl pentyn-l-yl,

4- methyl pentyn-l-yl, l-methyl-l-pentyn yl, 2methyl-l-pentyn yl, 3-methyl-l-pentyn yl, 4-methyl-

1- pentyn yl, l-methyl pentyn yl, 2-methyl-2pentyn yl, 3-methyl pentyn yl, 4-methyl pentyn-

2- yl, l-methyl pentyn yl, 2-methyl pentyn yl,

3- methyl pentyn yl, 4-methyl pentyn yl, 1methyl pentyn yl, 2-methyl pentyn yl, 3-methyl-

FP01 00

4-pentyn yl, 4-methyl pentyn yl, 1-methyl-lpentyn yl, 2-methyl-l-pentyn yl, 3-methyl-l-pentyn-

3-yl, 4-methyl-l-pentyn yl, l-methyl pentyn yl, 2-methyl pentyn yl, 3-methyl pentyn yl, 4methyl pentyn yl, 1-hexyn-l-yl, l-hexyn yl, 1hexyn yl, l-hexyn yl, l-hexyn yl, l-hexyn yl, 2-hexyn-l-yl, 2-hexyn yl, 2-hexyn yl, 2-hexyn yl, 2-hexyn yl, 2-hexyn yl, 3-hexyn-l-yl, 3-hexyn yl and 3-hexyn yl, preferably ethynyl, 1-propyn-l-yl, 2propyn-l-yl, 3-propyn-l-yl, 1-butyn-l-yl, l-butyn yl, l-butyn yl, l-butyn yl, 2-butyn-l-yl, 2-butyn yl, 1-methyl-l-propyn-l-yl, 2-methyl-l-propyn-l-yl, 1methyl propyn-l-yl, 2-methyl propyn-l-yl, 1-methyl1-butyn-l-yl, 2-methyl-l-butyn-l-yl, 3-methyl-l-butyn-

1- yl, l-methyl butyn-l-yl, 2-methyl butyn-l-yl, 3methyl butyn-l-yl, l-methyl butyn-l-yl, 2-methyl-3butyn-l-yl, 3-methyl butyn-l-yl, 1-ethyl-l-butyn-l-yl,

2- ethyl-l-butyn-l-yl, 3-ethyl-l-butyn-l-yl, l-ethyl-2butyn-l-yl, 2-ethyl butyn-l-yl, 3-ethyl butyn-l-yl, l-ethyl butyn-l-yl, 2-ethyl-3&amp;#1470;butyn-l-yl, 3-ethyl-3butyn-l-yl, 1,1-dimethyl-l-butyn-l-yl, 1,2-dimethyl-lbutyn-l-yl, 1,3-dimethyl-l-butyn-l-yl, 2,2-dimethyl-lbutyn-l-yl, 3,3-dimethyl-l-butyn-l-yl, 1,l-dimethyl-2butyn-l-yl, 1,2-dimethyl butyn-l-yl, 1,3-dimethyl-2butyn-l-yl, 2,2-dimethyl butyn-l-yl, 3,3-dimethyl-2butyn-l-yl, 1,l-dimethyl butyn-l-yl, 1,2-dimethyl-3

FP01 00 butyn-l-yl, 1,3-dimethyl butyn-l-yl, 2,2-dimethyl-3butyn-l-yl and 3,3-dimethyl butyn-l-yl, more preferably ethynyl, 1-propyn-l-yl, 2-propyn-l-yl, 3propyn-l-yl, 1-butyn-l-yl, l-butyn yl, l-butyn yl, l-butyn yl, 2-butyn-l-yl, 2-butyn yl, 1-methyl-lpropyn-l-yl, 2-methyl-l-propyn-l-yl, l-methyl propyn1-yl, 2-methyl propyn-l-yl, 1-methyl-l-butyn-l-yl, 2methyl-l-butyn-l-yl, 3-methyl-l-butyn-l-yl, l-methyl-2butyn-l-yl, 2-methyl butyn-l-yl, 3-methyl butyn-lyl, l-methyl butyn-l-yl, 2-methyl butyn-l-yl and 3methyl butyn-l-yl, even more preferably ethynyl, 1propyn-l-yl, 2-propyn-l-yl, 3-propyn-l-yl, 1-butyn-l-yl, l-butyn yl, l-butyn yl, l-butyn yl, 2-butyn-l-yl and 2-butyn yl, and most preferably ethynyl, 1propyn-l-yl, 2-propyn-l-yl and 3-propyn-l-yl,

The term C3.8 cycloalkyl group as used throughout the present specification refers to a cyclic alkyl group of 3 to 8 carbons, and as specific examples there may be mentioned cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl, with cyclopropyl being preferred.

The term C3-8 cycloalkenyl group as used throughout the present specification refers to a cyclic alkenyl group of 3 to 8 carbons, and as specific examples there may be mentioned cyclopentenyl and cyclohexenyl.

The term C3_8 cycloalkynyl group as used

FP01 00 throughout the present specification refers to a cyclic alkynyl group of 3 to 8 carbons, and as a specific example there may be mentioned cyclohexynyl.

The term C3 cycloalkyloxy group as used throughout the present specification corresponds to the aforementioned C3-8 cycloalkyl group having an oxygen atom bonded at the end, and as specific examples there may be mentioned cyclopropyloxy, cyclobutyloxy, cyclopentyloxy and cyclohexyloxy.

The term C3-8 alicyclic hydrocarbon group as used throughout the present specification refers to a cyclic hydrocarbon of 3 to 8 carbons, and it is a substituent whose definition includes that of the aforementioned C3-8 cycloalkyl group, C3-8 cycloalkenyl group and C3-8 cycloalkynyl group, with cyclopropyl being preferred.

The term C!-6 alkoxy group as used throughout the present specification refers to a substituent wherein the aforementioned C!-6 alkyl group is bonded to an oxygen atom, and as specific examples there may be mentioned methoxy, ethoxy, n-propoxy, i-propoxy, nbutoxy, i-butoxy, sec-butoxy, t-butoxy, n-pentyloxy, ipentyloxy, sec-pentyloxy, t-pentyloxy, neopentyloxy, 1methylbutoxy, 2-methylbutoxy, 1,1-dimethylpropoxy, 1,2dimethylpropoxy, n-hexyloxy, i-hexyloxy, 1methylpentyloxy, 2-methylpentyloxy, 3-methylpentyloxy,

FP01 00

1,1-dimethylbutoxy, 1,2-dimethylbutoxy, 2,2dimethylbutoxy, 1,3-dimethylbutoxy, 2,3-dimethylbutoxy,

3,3-dimethylbutoxy, 1-ethylbutoxy, 2-ethylbutoxy,

1.1.2- trimethylpropoxy, 1,2,2-trimethylpropoxy, 1ethyl-l-methylpropoxy and l-ethyl methylpropoxy, preferably methoxy, ethoxy, n-propoxy, i-propoxy, nbutoxy, i-butoxy, sec-butoxy, t-butoxy, n-pentyloxy, ipentyloxy, sec-pentyloxy, t-pentyloxy, neopentyloxy, 1methylbutoxy, 2-methylbutoxy, 1,1-dimethylpropoxy, 1,2dimethylpropoxy, n-hexyloxy and i-hexyloxy, more preferably methoxy, ethoxy, n-propoxy, i-propoxy, nbutoxy, i-butoxy, sec-butoxy, t-butoxy, n-pentyloxy, ipentyloxy, sec-pentyloxy, t-pentyloxy, neopentyloxy, 1methylbutoxy, 2-methylbutoxy, 1,1-dimethylpropoxy and

1.2- dimethylpropoxy, even more preferably methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, i-butoxy, secbutoxy and t-butoxy, and most preferably methoxy, ethoxy, n-propoxy and i-propoxy.

The term C2-7 acyl group as used throughout the present specification refers to a substituent wherein a carbonyl group is bonded to the end of the aforementioned C!-6 alkyl group, C2 alkenyl group or C2-6 alkynyl group or phenyl group, and as specific examples there may be mentioned acetyl, propionyl, butyryl, isobutyryl, valeryl, isovaleryl, pivaloyl, hexanoyl, octanoyl, acryloyl, methacryloyl, crotonyl

FP01 00 and benzoyl, preferably acetyl, propionyl, butyryl, isobutyryl, valeryl, isovaleryl, pivaloyl, hexanoyl, octanoyl, acryloyl, methacryloyl, crotonyl and benzoyl, more preferably acetyl, propionyl, butyryl, isobutyryl, valeryl, isovaleryl, pivaloyl, hexanoyl, octanoyl and benzoyl, even more preferably acetyl, propionyl, butyryl, isobutyryl and benzoyl, and most preferably acetyl, propionyl and benzoyl.

The term C2 alkoxycarbonyl group as used throughout the present specification refers to a substituent wherein a carbonyl group is bonded to the aforementioned C!-6 alkoxy group, and as specific examples there may be mentioned methoxycarbonyl, ethoxycarbonyl, n-propoxycarbonyl, i-propoxycarbonyl, sec-propoxycarbonyl, n-butoxycarbonyl, i-butoxycarbonyl,

1,2-dimethylpropoxycarbonyl and 2-ethylpropoxycarbonyl.

The term n- as used throughout the present specification indicates a normal type or primary substituent, sec- indicates a secondary substituent, t- indicates a tertiary substituent and i- indicates an iso type substituent.

The term C!-6 alkylenedioxy group as used throughout the present specification refers to a substituent having oxygen atoms at each end of a divalent group derived by removing one more hydrogen atom from a C!-6 alkyl group, and as specific examples

FP01 00 there may be mentioned methylenedioxy, ethylenedioxy, propylenedioxy, butylenedioxy, pentylenedioxy and hexylenedioxy.

The term C6-14 aryl group as used throughout the present specification refers to an aromatic ring group of 6 or 14 carbons, and as specific examples there may be mentioned benzene, pentalene, indene, naphthalene, azulene, heptalene, biphenylene, indacene, acenaphthylene, fluorene, phenalene, phenanthrene and anthracene, and preferably benzene, pentalene, indene, naphthalene and azulene.

The term hetero atom as used throughout the present specification refers to, specifically, an oxygen atom, sulfur atom, nitrogen atom, phosphorus, arsenic, antimony, silicon, germanium, tin, lead, boron, mercury or the like, and preferably an oxygen atom, sulfur atom or nitrogen atom.

The term 5- to 14-membered aromatic heterocyclic group as used throughout the present specification refers to an aromatic cyclic group having 5 to 14 atoms forming the cyclic ring and including at least one hetero atom such as nitrogen, sulfur or oxygen among the atoms forming the cyclic ring. As specific examples there may be mentioned nitrogen-containing aromatic heterocycles such as pyrrole, pyridine, pyridone, pyridazine, pyrimidine, pyrazine, pyrazole,

FP01 00 imidazole, triazole, tetrazole, indole, isoindole, indolizine, purine, indazole, quinoline, isoquinoline, quinolizine, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline, pteridine, imidazopyridine, imidazotriazine, pyrazinopyridazine, acridine, phenanthridine, carbazole, carbazoline, perimidine, phenanthroline, phenacene, oxadiazole, benzimidazole, pyrrolopyridine, pyrrolopyrimidine and pyridopyrimidine; sulfur-containing aromatic heterocycles such as thiophene and benzothiophene; oxygen-containing aromatic heterocycles such as furan, pyran, cyclopentapyran, benzofuran and isobenzofuran; and aromatic heterocycles comprising 2 or more hetero atoms selected from among nitrogen, sulfur and oxygen, such as thiazole, thiadizole, isothiazole, benzoxazole, benzothiazole, benzothiadiazole, phenothiazine, isoxazole, furazan, phenoxazine, pyrazoloxazole, imidazothiazole, thienofuran, furopyrrole, pyridoxazine, furopyridine, furopyrimidine, thienopyrimidine and oxazole. As examples of the 5- to 14-membered aromatic heterocyclic group there may be mentioned preferably, pyridine, pyridone, pyrimidine, imidazole, indole, quinoline, isoquinoline, quinolizine, phthalazine, naphthyridine, quinazoline, cinnoline, acridine, phenacene, thiophene, benzothiophene, furan, pyran, benzofuran, thiazole, benzthiazole.

FP01 00 phenothiazine, pyrrolopyrimidine, furopyridine and thienopyrimidine, more preferably pyridine, thiophene, benzothiophene, thiazole, benzothiazole, quinoline, quinazoline, cinnoline, pyrrolopyrimidine, pyrimidine, furopyridine and thienopyrimidine.

The term 5- to 14-membered non-aromatic heterocyclic group as used throughout the present specification refers to a non-aromatic cyclic group having 5 to 14 atoms forming the cyclic ring and including at least one hetero atom such as nitrogen, sulfur or oxygen among the atoms forming the cyclic ring. As specific examples there may be mentioned nonaromatic heterocycles such as pyrrolidinyl, pyrrolinyl, piperidinyl, piperazinyl, N-methylpiperazinyl, imidazolinyl, pyrazolidinyl, imidazolidinyl, morpholinyl, tetrahydropyranyl, azetidinyl, oxetanyl, oxathiolanyl, pyridone, 2-pyrrolidone, ethyleneurea,

1,3-dioxolane, 1,3-dioxane, 1,4-dioxane, phthalimide and succinimide. As examples of the 5- to 14-membered non-aromatic heterocyclic group there may be mentioned preferably, pyrrolidinyl, piperidinyl and morpholinyl, and more preferably pyrrolidinyl, piperidinyl, morpholinyl and pyrrole.

The term 5- to 14-membered heterocyclic group as used throughout the present specification refers to an aromatic or non-aromatic cyclic group having 5 to 14

FP01 00 atoms forming the cyclic ring and including at least one hetero atom such as nitrogen, sulfur or oxygen among the atoms forming the cyclic ring, which is a 5to 14-membered aromatic heterocyclic group in the former case and a 5- to 14-membered non-aromatic heterocyclic group in the latter case. Specific examples of the 5- to 14-membered heterocyclic group therefore include specific examples of the 5- to 14membered aromatic heterocyclic group and specific examples of the 5- to 14-membered non-aromatic heterocyclic group.

As the 5- to 14-membered heterocyclic group there may be mentioned preferably pyrrolidinyl, piperidinyl, morpholinyl, pyrrole, pyridine, pyridone, pyrimidine, imidazole, indole, quinoline, isoquinoline, quinolizine, phthalazine, naphthyridine, quinazoline, cinnoline, acridine, phenacene, thiophene, benzothiophene, furan, pyran, benzofuran, thiazole, benzothiazole, phenothiazine and carbostyryl, more preferably pyrrolidinyl, piperidinyl, morpholinyl, pyrrole, pyridine, thiophene, benzothiophene, thiazole, benzothiazole, quinoline, quinazoline, cinnoline and carbostyryl, and even more preferably thiazole, quinoline, quinazoline, cinnoline and carbostyryl.

The term 6- to 14-membered aromatic heterocyclic group as used throughout the present specification

FP01 00 refers to those substituents defined by 5- to 14membered aromatic heterocyclic group which have 6 to 14 atoms forming the cyclic ring. As specific examples there may be mentioned pyridine, pyridone, pyrimidine, indole, quinoline, isoquinoline, quinolizine, phthalazine, naphthyridine, quinazoline, cinnoline, acridine, benzothiophene, benzofuran, thiazole, benzothiazole and phenothiazine.

The term 6- to 14-membered heterocyclic group as used throughout the present specification refers to those substituents defined by 5- to 14-membered heterocyclic group which have 6 to 14 atoms forming the cyclic ring. As specific examples there may be mentioned piperidinyl, piperazinyl, N-methylpiperazinyl, morpholinyl, tetrahydropyranyl, 1,4-dioxane and phthalimide.

The term C6-14 aryl-C!-6 alkyl group [= aralkyl group] as used throughout the present specification refers to a C1-6 alkyl group substituted at substitutable positions with a C6-14 aryl group, and as specific examples there may be mentioned benzyl, phenethyl, 3-phenylpropyl, 4-phenylbutyl, 5phenylpentyl, β-phenylhexyl, 1-naphthylmethyl, 2naphthylmethyl, 1- naphthylethyl, 2-naphthylethyl, 1naphthylpropyl and 2- naphthylpropyl, preferably benzyl, phenethyl, 3-phenylpropyl, 4-phenylbutyl, 5

FP01 00 phenylpentyl, 6-phenylhexyl, 1-naphthylmethyl, 2naphthylmethyl, 1-naphthylethyl, 2-naphthylethyl, 1naphthylpropyl and 2-naphthylpropyl, more preferably benzyl, phenethyl, 3-phenylpropyl, 4-phenylbutyl, 5phenylpentyl, β-phenylhexyl, 1-naphthylmethyl, 2naphthylmethyl, even more preferably benzyl, phenethyl,

3-phenylpropyl, 4-phenylbutyl, and most preferably benzyl and phenethyl.

The term 5- to 14-membered heterocyclic-C1-s alkyl group as used throughout the present specification refers to a &amp;#1524;C!_6 alkyl group substituted at substitutable positions with a 5- to 14-membered heterocyclic group, and as specific examples there may be mentioned 2-pyridylmethyl, 3-pyridylmethyl and 2quinolinomethyl.

A leaving group in the sense used throughout the present specification may be any group commonly known as a leaving group in chemical synthesis, with no special restrictions, and as specific examples there may be mentioned halogen atoms such as chlorine, bromine and iodine; alkylthio groups such as methylthio, ethylthio and propylthio; arylthio groups such as phenylthio, toluylthio and 2-pyridylthio; alkylsulfonyloxy groups such as methanesulfonyloxy, trifluoromethanesulfonyloxy, ethanesulfonyloxy and propanesulfonyloxy; arylsulfonyloxy groups such as

FP01 00 benzenesulfonyloxy and p-toluenesulfonyloxy; alkanoyloxy groups such as acetoxy and trifluoroacetoxy; alkoxy groups such as methoxy, ethoxy and propoxy; alkylamino groups such as methylamino, ethylamino, propylamino and butylamino; dialkylamino groups such as dimethylamino, diethylamino, dipropylamino, methylethylamino, ethylpropylamino and methylpropylamino; and substituted phosphoryloxy groups such as diphenoxyphosphoryloxy. Preferred are halogen atoms such as chlorine, bromine and iodine, and trifluoromethanesulfonyloxy.

The term optionally substituted as used throughout the present specification is synonymous with optionally having one or more substituents in any desired combination at substitutable positions, and as specific examples of substituents there may be mentioned (1) halogens, (2) hydroxyl, (3) thiol, (4) nitro, (5) nitrile, (6) oxo, (7) azido, (8) guanidino, (9) hydrazino, (10) isocyano, (11) cyanate, (12) isocyanate, (13) thiocyanate, (14) isothiocyanate, (15) nitroso, (16) carbamido (ureido), (17) formyl, (18) C!-6 imidoyl, (19) optionally halogenated or hydroxylated C1-6 alkyl groups, C2-5 alkenyl groups, C2 alkynyl groups, C3-6 cycloalkyl groups, C3-6 cycloalkenyl groups, C3-6 cycloalkynyl groups, C!-6 alkoxy groups, C2 alkenyloxy groups, C2-6 alkynyloxy groups, C3-6

FP01 00 cycloalkyloxy groups, C1-6 alkylthio groups, C2-6 alkenylthio groups, C2 alkynylthio groups, C3 cycloalkylthio groups or C!-6 alkylenedioxy groups, (20) C6-14 aryl groups, (21) 5- to 14-membered heterocyclic groups, (22) carboxyl, (23) trifluoromethyl, (24) C6-!4 aryl-C1-6 alkyl groups, (25) 5- to 14-membered heterocyclic C1-6 alkyl groups or (26) the group represented by the formula -Vxxl -Vxx2 -Vxx3 -Vxx4 (wherein Vxx1, Vxx2 and Vxx3 are each independently 1) a single bond, 2) oxygen, 3) sulfur, 4) -CO-, 5) -SO-, 6) -S02-,

7) -NRXX1-, 8)-CONRxx1-, 9)

-NRXX21CO-, 10) -SO2NRxx1-, 11) -NRxx1SO2-, 12) -O-CO-, 13) -0(0)0-, 14) -NRXX1C (0) 0-, 15) -NRXX1C (0) NRXX2-, 16) -0C(0)NRxxl-, 17) 0(0)0-, 18) a C!-6 alkylene group, 19) a C2 alkenyl group, 20) a C1-6 alkynyl group, 21) a C3 alicyclic hydrocarbon group, 22) a C6-14 aryl group, 23) a 5- to 14-membered heterocyclic group or 24) a 5- to 14-membered aromatic heterocyclic group; and Vxx4, Rxxl and Rxx2 are each independently 1) hydrogen, 2) a C!-6 alkyl group, 3) a C2 alkenyl group, 4) a 01-¢ alkynyl group, 5) a C3-8 alicyclic hydrocarbon group, 6) a C6-14 aryl group, 7) a 5- to 14-membered heterocyclic group,

8) a 5- to 14-membered aromatic heterocyclic group or

9) a C1-6 alkoxy group.)

Thus, optionally substituted means optionally substituted with a substituent, specific examples of

FP01 00 which are hydroxyl; thiol; nitro; morpholino; thiomorpholino; halogens such as fluorine, chlorine, bromine and iodine; nitrile; azide; formyl; alkyl groups such as methyl, ethyl, propyl, isopropyl and butyl; alkenyl groups such as vinyl, allyl and propenyl; alkynyl groups such as ethynyl, butynyl and propargyl, alkoxy groups corresponding to lower alkyl groups, such as methoxy, ethoxy, propoxy and butoxy; halogenoalkyl groups such as fluoromethyl, difluoromethyl, trifluoromethyl and fluoroethyl; hydroxyalkyl groups such as hydroxymethyl, hydroxyethyl and hydroxypropyl; guanidino; formimidoyl;

acetoimidoyl; carbamoyl; thiocarbamoyl; carbamoylalkyl groups such as carbamoylmethyl and carbamoylethyl;

alkylcarbamoyl groups such as methylcarbamoyl and dimethylcarbamoyl; carbamide; alkanoyl groups such as acetyl; amino; alkylamino groups such as methylamine, ethylamino and isopropylamino; dialkylamino groups such as dimethylamino, methylethylamino and diethylamino;

aminoalkyl groups such as aminomethyl, aminoethyl and aminopropyl; carboxy; alkoxycarbonyl groups such as methoxycarbonyl, ethoxycarbonyl and propoxycarbonyl; alkoxycarbonylalkyl groups such as methoxycarbonylmethyl, ethoxycarbonylmethyl, propoxycarbonylmethyl, methoxycarbonylethyl, ethoxycarbonylethyl and propoxycarbonylethyl;

FP01 00 alkyloxyalkyl groups such as methyloxymethyl, methyloxyethyl, ethyloxymethyl and ethyloxyethyl; alkylthioalkyl groups such as methylthiomethyl, methylthioethyl, ethylthiomethyl and ethylthioethyl; aminoalkylaminoalkyl groups such as aminomethylaminomethyl and aminoethylaminomethyl; alkylcarbonyloxy groups such as methylcarbonyloxy, ethylcarbonyloxy and isopropylcarbonyloxy; arylalkoxyalkoxyalkyl groups such as oxymethyl and benzyloxyethyloxyethyl; hydroxyalkoxyalkyl groups such as hydroxyethyloxymethyl and hydroxyethyloxyethyl; arylalkoxyalkyl groups such as benzyloxymethyl, benzyloxyethyl and benzyloxypropyl; quaternary ammonio groups such as trimethylammonio, methylethylmethylammonio and triethylammonio; cycloalkyl groups such as cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl; cycloalkenyl groups such as cyclopropenyl, cyclobutenyl, cyclopentenyl and cyclohexenyl; aryl groups such as phenyl, pyridinyl, thienyl, furyl and pyrrolyl; alkylthio groups such as methylthio, ethylthio, propylthio and butylthio; arylthio groups such as phenylthio, pyridinylthio, thienylthio, furylthio and pyrrolylthio; aryl lower alkyl groups such as benzyl, trityl and dimethoxytrityl; substituted sulfonyl groups such as sulfonyl, mesyl and p-toluenesulfonyl; aroyl groups

FP01 00 such as benzoyl; halogenoaryl groups such as fluorophenyl and bromophenyl; and oxyalkoxy groups such as methylenedioxy.

The term C!-6 imidoyl group as used throughout the present specification refers to, for example, formimidoyl, hexaneimidoyl, succinimidoyl, or the like.

Throughout the present specification, when ring A is a 5- to 14-membered heterocyclic group, it is preferably one selected from among pyridine, pyrimidine, pyridopyrimidine, isoquinoline, phthalazine, quinoline, quinazoline, pyrimidopyrimidine, quinoxaline, pyridopyridine, pyrrolopyridine, pyrrolopyrimidine, indole, pyrazolopyridine, pyrazolopyrimidine, thienopyridine, thienopyrimidine, benzothiazole, thiazolopyridine, thiazolopyrimidine, benzimidazole, imidazopyridine, imidazopyrimidine, thiazole, imidazole, pyrazole, benzofuran, furopyridine, furopyrimidine, benzoxazole, oxazolopyridine, oxazolopyrimidine, pyridopyrimidin one, pyrazine, pyridazine, pyridone, pyrimidone, oxyindole, pyrazoloquinazoline, pyrazoloquinoline, pyrroloquinazoline, pyrroloquinoline, isoindolin-l-one, isoazaindolin-l-one, isoflavone, benzopyran one, benzimidazolin one, 1,3-dioxo-l,3dihydroisoindole, 2,3-dihydro-pyrrolopyridin one,

2,3-dihydro-pyrroloquinolin one, imidazol one, benzene, naphthalene, oxazole, isoxazole, isothiazole

FP01 00 and quinazolin one. There may be mentioned as preferred groups, quinoline, pyridine, pyrrolopyrimidine, pyrimidine, quinazoline, pyridopyridine, pyridopyrimidine, pyrazolopyrimidine, thiazolopyridine, furopyridine and thienopyrimidine, and as more preferred groups, quinoline, pyridine, pyrrolopyrimidine, thienopyrimidine, pyrimidine and furopyridine, although there is no limitation to these.

In cases where Y is a group with a hetero atom, such as a 5- to 14-membered heterocyclic group, the invention naturally encompasses compounds wherein a substituent such as X or Tgl is bonded at the hetero atom.

Production methods for the compounds of the invention will now be described. Various methods may be imagined for production of compounds of the invention represented by general formulas (I) and (II) with synthesis carried out by ordinary chemical synthesis means, and the following are representative examples of methods for their production. [Representative production methods]

[Production Method 1]

A&amp;#1470;/U + (a-01) (a02&amp;#1470;)

In formula (a-01),

<img file="IL155447A_D0031.tif" />

(I)

U represents a leaving group.

FP01 00

The other symbols have the same definitions as above.

The leaving group may be, for example, a halogen or a trifluoromethanesulfonyl group. There are no particular restrictions on the solvent used for the reaction, though it is preferably one with low reactivity for the starting materials, and as examples there may be mentioned 1-methylpyrrolidone, dimethylformamide, chlorbenzene, and the like. An organic or inorganic base may also be added. The reaction time may be from 10 minutes to 30 hours, and the reaction temperature from room temperature to reflux temperature.

In the following formulas for the representative production methods Z, R300 , R301, W, W11, R1, R2 and Y have the same definitions as above; Xsal is an oxygen or sulfur atom; Rsa4 has the same definition as R2 above; Rsa5 is an optionally substituted C1-6 alkyl group or optionally substituted C1-6 aryl group; compound (a-6) is compound (a-61) or compound (a-62); Rsa70 is an optionally substituted C!-6 alkyl group; G1 is an optionally substituted nitrogen atom or oxygen atom; U is a leaving group; n and s are each integers of 0 to 6; Rsa90 is a nitro or amino group; Rsa82 is an aminoprotecting group such as t-butoxycarbonyl or benzyl; and Rsal, Rsa2, Rsa3, Rsa50, Rsa60, Rsa71 and Rsa80 independently are defined as substituents selected from

FP01 00 among the substituents for ring &amp;#902; mentioned above.

[Production method 2-1]

Representative production method for compound (G2) represented by:

<img file="IL155447A_D0032.tif" />

(wherein the symbols have the same definitions given above):

<img file="IL155447A_D0033.tif" />

(wherein the symbols have the same definitions given above .)

FP01 00

<img file="IL155447A_D0034.tif" />

(a-6) (a-10)

<img file="IL155447A_D0035.tif" />

<img file="IL155447A_D0036.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step A-l&gt; &lt;Step A-2&gt;

Steps of cyclization from an aniline derivative (a-1) to a quinolone derivative (a-3). The synthesis may be carried out by the known method reported in Tetrahedron, 53, 1743(1997).

&lt;Step A-l&gt;

Specifically, an aniline derivative having any desired substituents (a-1) may be reacted with an orthoester derivative such as trimethyl orthoformate or triethyl orthoformate and Meldrum acid in an alcohol such as ethanol to obtain compound (a-2). The reaction temperature may be from room temperature to reflux temperature, and the reaction time from 10 minutes to hours.

&lt;Step A-2&gt;

FP01 00

Compound (a-2) is then heated in a mixed solvent of phenyl ether, biphenyl, etc. or Dowtherm A to obtain compound (a-3). The reaction temperature may be from 40°C to reflux temperature, and the reaction time from 10 minutes to 30 hours.

&lt;Step A-3&gt;

Chlorination step. Compound (a-3) may be reacted with a chlorinating agent such as phosphorus oxychloride or thionyl chloride to obtain compound (a4). The reaction solvent used may be phosphorus oxychloride, thionyl chloride, benzene, toluene or the like, the reaction temperature from room temperature to reflux temperature, and the reaction time from 10 minutes to 30 hours.

&lt;Step A-4&gt;

Step of reacting compound (a-4) with compound (a42) to obtain a nitro compound (a-5). The reaction solvent may be 1-methylpyrrolidone, dimethylformamide, chlorbenzene, 2,6-lutidine, or the like. The reaction may be conducted with addition of a base, for example, an organic base such as diisopropylethylamine or 2,6lutidine, or an inorganic base such as potassium carbonate. The reaction time may be from 10 minutes to 30 hours and the reaction temperature from room temperature to reflux temperature.

&lt;Step A-42&gt;

FP01 00

Step of reacting compound (a-4) with compound (a43) to obtain an amino compound (a-61). The reaction solvent used may be 1-methylpyrrolidone, dimethylsulfoxide, or the like. A base such as sodium hydride may be used for the reaction. The reaction time may be from 10 minutes to 30 hours and the reaction temperature from room temperature to reflux temperature. &lt;Step A-5&gt;

Step of reduction reaction of the nitro compound (a-5) to an amino compound (a-61). This may be carried out under conditions commonly employed for reduction of nitro groups to amino groups. Specifically, there may be mentioned reduction with iron-ammonium chloride, iron-hydrochloric acid or iron-acetic acid, or catalytic reduction with palladium hydroxide-hydrogen. The reaction solvent may be methanol, ethanol, tetrahydrofuran, dimethylformamide or the like, and catalytic reduction may be conducted at ordinary pressure or under pressurization. The reaction time may be from 10 minutes to 30 hours and the reaction temperature from room temperature to reflux temperature. &lt;Step A-6&gt;

Step of alkylation of the amino compound (a-61). The amino compound (a-61) may be reacted with an aldehyde derivative or ketone derivative and the

FP01 00 resultant imine reduced with a reducing agent such as sodium cyanoborohydride to obtain compound (a-62).

Alternatively, the amino compound (a-61) may be reacted with an acid chloride derivative or acid anhydride in the presence of a base and then reduced with a reducing agent such as lithium aluminum hydride to obtain compound (a-62) . &lt;Step A-7&gt;

Step of reacting a carbamate derivative (a-81) with the amino derivative (a-61) or compound (a-62) to obtain a urea derivative (a-10). The reaction solvent used may be chloroform, toluene, acetonitrile, dimethylformamide, dimethylsulfoxide or the like. The reaction time may be from 10 minutes to 30 hours and the reaction temperature from below freezing to reflux temperature. The reaction may also be conducted with addition of an organic base such as sodium hydride, triethylamine or pyridine or an inorganic base such as potassium carbonate or sodium carbonate.

&lt;Step A-8&gt;

Step of reacting an isocyanate derivative (a-82) with the amino derivative (a-61) or compound (a-62) to obtain compound (a-7). The reaction solvent used may be chloroform, toluene, acetonitrile, dimethylformamide, dimethylsulfoxide or the like. The reaction time may be from 10 minutes to 30 hours and the reaction

FP01 00 temperature from below freezing to reflux temperature. The reaction may also be conducted with addition of an organic base such as sodium hydride, triethylamine or pyridine or an inorganic base such as potassium carbonate or sodium carbonate. &lt;Step A-9&gt;

Step of reacting compound (a-7) and compound (a83) in the presence of a base such as pyridine to obtain a urea derivative (a-10). The reaction solvent used may be dimethylsulfoxide, dimethylformamide, tetrahydrofuran or the like, the reaction time from 10 minutes to 30 hours and the reaction temperature from 0°C to reflux temperature. &lt;Step A-10&gt;

Step of reacting a carbamating reagent (a-84) such as phenylchloroformate with the amino compound (a-61) or compound (a-62) to obtain a carbamate derivative (a9), The reaction may be conducted using a base such as pyridine. The reaction solvent used may be dimethylsulfoxide, dimethylformamide, tetrahydrofuran or the like, the reaction time from 10 minutes to 30 hours, and the reaction temperature from 0°C to reflux temperature. &lt;Step A-ll&gt;

Step of reacting an amine derivative (a-85) with the carbamate derivative (a-9) to obtain a urea

FP01 00 derivative (a-10). The reaction may be conducted using a base such as triethylamine. The reaction solvent used may be dimethylsulfoxide, dimethylformamide or the like, the reaction time from 10 minutes to 30 hours, and the reaction temperature from room temperature to reflux temperature.

[Production Method 2-2]

Alternative production method to compound (a-10):

<img file="IL155447A_D0037.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step A-12&gt;

Step of reacting a phenol derivative (a-12) having urea as a part of its structure, with a 4chloroquinoline derivative (a-4) to obtain the target compound (a-11) by one direct step. The reaction solvent used may be 1-methylpyrrolidone, dimethylformamide, chlorbenzene, or the like. The reaction may be conducted with addition of a suitable base, for example, an organic base such as diisopropylethylamine, or an inorganic base such as potassium carbonate or sodium hydride. The reaction

FP01 00 time may be from 10 minutes to 30 hours and the reaction temperature from room temperature to reflux temperature.

[Production Method 2-3]

Alternative production method to compound (a-5) and compound (a-61):

<img file="IL155447A_D0038.tif" />

(a-5) (2a-2)

<img file="IL155447A_D0039.tif" />

(a-5) (2a2) (3&amp;#1470;a-5) (wherein the symbols have the same definitions given above.) &lt;Step 2A-1&gt;

Step of reacting a pyridine derivative (2a-l) with compound (a-5) to obtain compound (2a-2). The reaction may be conducted using a base such as potassium carbonate. The reaction solvent used may be dimethylformamide or the like, the reaction time from 10 minutes to 30 hours and the reaction temperature from room temperature to reflux temperature. &lt;Step 2A-2&gt;

Step of converting a quinolone (a-5) to a thioquinolone (2a-3). A sulfide reagent such as sodium

FP01 00 sulfide, phosphorus pentasulfide or the like may be reacted with the quinolone (a-5) to obtain the corresponding thioquinolone. The reaction solvent used may be diglyme, the reaction temperature from room temperature to reflux temperature, and the reaction time from 10 minutes to 30 hours.

&lt;Step 2A-3&gt;

Step of reacting the thioquinolone (2a-3) with compound (2a-4) to obtain compound (2a-5). The reaction solvent used may be dimethylformamide or the like, the reaction temperature from room temperature to reflux temperature, and the reaction time from 10 minutes to 30 hours. An appropriate base such as pyridine may also be used.

<img file="IL155447A_D0040.tif" />

(2a-7) (2a-8)

<img file="IL155447A_D0041.tif" />

(wherein the above.) &lt;Step 2A-4&gt;

Step of (2a-10) (2a-9) symbols have the same definitions given reacting a hydroxypyridine derivative (2a

FP01 00

6) with compound (a-4) to obtain compound (2a-7). The solvent used may be 1-methylpyrrolidone, dimethylformamide, chlorbenzene, or the like. The reaction may be conducted with addition of a suitable base, for example, an organic base such as diisopropylethylamine, or an inorganic base such as potassium carbonate. The reaction time may be from 10 minutes to 30 hours, and the reaction temperature from room temperature to reflux temperature.

&lt;Step 2A-5&gt;

Step of palladium coupling reaction between compound (2a-7) and an imine derivative to obtain compound (2a-8). The reaction may be conducted using a solvent such as toluene, a catalyst, for example, a palladium derivative such as tris(dibenzylideneacetone)dipalladium(0) or a phosphine derivative such as 2,2'-bis(diphenylphosphino)-1,1'binaphthyl), and a base such as t-butoxypotassium. The reaction temperature may be from about 50°C to reflux temperature, and the reaction time from about 1 hour to 10 hours.

&lt;Step 2A-6&gt;

Step of obtaining an amino derivative (2a-9) from compound (2a-8). The reaction is conducted using ethanol, water or the like, with the action of an acid such as hydrochloric acid. The reaction temperature

FP01 00 may be from 0°C to about 100°C, and the reaction time from 10 minutes to about 10 hours.

&lt;Step 2A-7&gt;

Step of dechlorination of compound (2a-9) to obtain compound (2a-10). This may be accomplished by catalytic reduction or the like using palladium carbonhydrogen. The reaction solvent may be methanol, ethanol, tetrahydrofuran, or the like, and catalytic reduction may be conducted at ordinary pressure or under pressurization. Triethylamine or the like may also be used as a base. The reaction time may be from 10 minutes to 30 hours and the reaction temperature from room temperature to re temperature.

<img file="IL155447A_D0042.tif" />

^883

Rsa? O^(CH2)-NH2 (a-3) (wherein the symbols have the same definitions given above.) &lt;Step 2A-8&gt;

A step of converting a quinolone compound (a-3) into a 4-aminoalkoxyquinoline (2a-ll). An Nalkylphthalimide derivative may be reacted with compound (a-3) and deprotection accomplished with hydrazine hydrate or the like to obtain the target compound (2a-ll). The solvent used may be

FP01 00 dimethylformamide, tetrahydrofuran or the like, the reaction temperature from room temperature to reflux temperature, and the reaction time from 10 minutes to 30 hours. Potassium carbonate or the like may also be used as the base.

[Production Method 2-4]

Alternative production method to compound (a-4):

<img file="IL155447A_D0043.tif" />

[.

<img file="IL155447A_D0044.tif" />

(wherein the symbols have the same definitions given above .) &lt;Step 3A-1&gt;

Step of obtaining an enamine (3a-l). Diethyl ethoxymethylenemalonate may be reacted with an aniline derivative (a-1) to obtain compound (3a-l). The reaction proceeds without a solvent. The reaction temperature may be about 100°C, and the reaction time from 30 minutes to several hours. &lt;Step 3A-2&gt;

Step of cyclization. Compound (3a-l) may be heated from about 200°C to about 260°C in a biphenyl

FP01 00 ether/biphenyl mixed solvent for cyclization to obtain the target compound (3a-2). The reaction time may be from 30 minutes to 10 hours.

&lt;Step 3A-3&gt;

Step of chlorination. The same procedure as in &lt;Step A-3&gt; may be carried out to obtain the chlorinated compound (3a—3) from compound (3a-2).

[Production Method 3]

Representative production method for compound (G3) represented by:

<img file="IL155447A_D0045.tif" />

(wherein the symbols have the same definitions given above)

<img file="IL155447A_D0046.tif" />

(a-4) (b-1) (wherein the symbols have the same definitions given above.) &lt;Step B-l&gt;

Step of reacting compound (a-4) with an indole

FP01 00 derivative (b-2) to obtain compound (b-1). The reaction may be conducted under the same conditions as for &lt;Step A-4&gt; above.

&lt;Step B-2&gt;

Step of obtaining a urea derivative (b-3) from compound (b-1). The reagent used may be the aforementioned isocyanate derivative (a-82) or carbamate derivative (a-81). The reaction may be conducted under the same conditions as for &lt;Step A-7&gt;, &lt;Step A-8&gt; and &lt;Step A-9&gt; above.

r30°

<img file="IL155447A_D0047.tif" />

<img file="IL155447A_D0048.tif" />

(b-5) symbols have the same definitions given introducing a substituent at the 3(b-4) (wherein the above.) &lt;Step B-3&gt;

Step of position of the indole. Compound (b-4) may be reacted with a halogenating agent such as N-chlorosuccinimide or N-bromosuccinimide, or with phosphorus oxychloride or a thionyl chloride/dimethylformamide mixed reagent to obtain compound (b-5). The reaction solvent used may be 2-propanol, tetrahydrofuran, acetonitrile, dimethylformamide or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time

FP01 00 from 10 minutes to 30 hours.

[Production Method 4-1]

Representative production method for compound (G41) represented by:

<img file="IL155447A_D0049.tif" />

(G4-1) (wherein the symbols have the same definitions given above)

<img file="IL155447A_D0050.tif" />

(wherein the symbols have the same definitions given above.)

General formula (G4-1) may be synthesized according to the process described in WO97/02266,

or Journal of Medicinal Chemistry, 1996,

Vol.39, No.12, 2285-2292.

&lt;Step C-l&gt;

FP01 00

Step of synthesizing an imidate. Ethyl cyanoacetate may be reacted with hydrochloric acid in a solvent such as dioxane to obtain the target imidate compound (c-2). The reaction temperature is preferably from near 0°C to room temperature, and the reaction time may be from a few hours to several days. &lt;Step C-2&gt;

Step of synthesizing an amidine. Compound (c-2) may be reacted with ammonia gas in ethanol to obtain the target amidine compound (c-3). The reaction temperature may be from near 0°C to room temperature, and the reaction time may be several hours. &lt;Step C-3&gt;

Step of synthesizing a pyrrole derivative.

Compound (c-3) may be reacted with an a-haloketone derivative (c-31) in ethanol to obtain the target pyrrole derivative (c-4). The reaction temperature may be from room temperature to reflux temperature, and the reaction time from a few hours to several days. &lt;Step C-4&gt;

Ring-closing reaction of pyrrole ring to pyrrolopyrimidine ring. Compound (c-4) may be reacted with formamide and formic acid to obtain the target compound (c-5). The solvent used may be dimethylformamide. The reaction temperature may be from near 100°C to reflux temperature, and the reaction

FP01 00 time from a few hours to several days.

&lt;Step C-5&gt;

Step of chlorination. The same procedure as in &lt;Step A-3&gt; may be carried out to obtain the target chlorinated compound (c-6).

<img file="IL155447A_D0051.tif" />

(C-70) (c-8) ci

<img file="IL155447A_D0052.tif" />

(c-10) (wherein the symbols have the same definitions given above.) &lt;Step C-6&gt;

Reaction for introduction of substituent at 5position of a pyrrole derivative (c-70). Compound (c70) may be reacted with compound (c-71) in the presence of 2,β-lutidine, in darkness under a nitrogen atmosphere, to obtain the target compound (c-8). The reaction solvent used may be dichloromethane or the like, the reaction temperature from 0°C to room temperature, and the reaction time from 1 hour to 30 hours .

&lt;Step C-7&gt;

The same procedure as in &lt;Step C-4&gt; may be carried out to obtain compound (c-9).

&lt;Step C-8&gt;

FP01 00

The same procedure as in &lt;Step A-3&gt; may be carried out to obtain compound (c-10).

[Production Method 4-2]

Representative production method for compound (G42) represented by:

<img file="IL155447A_D0053.tif" />

Rsa2 (wherein the symbols have the same definitions given above .)

<img file="IL155447A_D0054.tif" />

(20-4)

<img file="IL155447A_D0055.tif" />

(2C-5)

<img file="IL155447A_D0056.tif" />

(20-3)

<img file="IL155447A_D0057.tif" />

(20-6)

<img file="IL155447A_D0058.tif" />

(20-7) (wherein the symbols have the same definitions given above.) &lt;Step 2C-1&gt;

Step of chlorination. Compound (2c-l) may be reacted with thionyl chloride to obtain the target compound (2c-2). The reaction solvent used may be

FP01 00 thionyl chloride, the reaction temperature may be reflux temperature, and the reaction time from a few hours to several days. &lt;Step 2C-2&gt;

Rearrangement from carboxylic acid to a carbamate derivative (2c-3). The carboxylic acid derivative (2c2) may be reacted with tert-butanol, benzyl alcohol, trimethylsilyl alcohol or the like in the presence of diphenylphosphoryl azide and triethylamine to obtain the target carbamate derivative (2c-3). The reaction solvent used may be tert-butanol, benzyl alcohol, dimethylformamide, toluene or the like, the reaction temperature from room temperature to reflux temperature, and the reaction time from 10 minutes to 30 hours. &lt;Step 2C-3&gt;

Iodination reaction. The target compound (2c-4) may be obtained by using a base to generate an anion at the 3-position of pyridine, reacting iodine therewith to obtain an iodinated compound, and then conducting decarbamating reaction. The reaction solvent for the iodination may be tetrahydrofuran, diethyl ether or the like, the reaction temperature from -78°C to room temperature, and the reaction time from 10 minutes to 30 hours. The base used may be n-butyllithium or the like, and a base such as Ν,Ν,Ν',Ν'tetramethylethenediamine may also be added as

FP01 00 appropriate. The reaction solvent used for the decarbamating reaction may be water, an alcohol or the like, as an acid there may be used aqueous hydrobromic acid, aqueous hydrochloric acid or the like, the reaction temperature may be from room temperature to reflux temperature, and the reaction time may be from 1 minute to several hours.

&lt;Step 2C-4&gt;

The same procedure as in &lt;Step A-4&gt; may be carried out to obtain the target compound (2c-5) . &lt;Step 2C-5&gt;

Coupling reaction between the iodo compound (2c-5) and an acetylene derivative. The iodo compound may be reacted with (trimethyl)acetylene in the presence of tetrakis(triphenylphosphine) palladium, copper (I) iodide or the like to obtain the target compound (2c-6). The reaction solvent used may be dimethylformamide or the like, the reaction temperature from room temperature to reflux temperature, and the reaction time from 10 minutes to 30 hours.

&lt;Step 2C-6&gt;

Cyclization reaction. Compound (2c-6) may be heated in the presence of copper (I) iodide to obtain the target cyclized compound (20-7). The reaction solvent used may be dimethylformamide or the like, the reaction temperature from 80°C to reflux temperature,

FP01 00 and the reaction time from 5 minutes to 10 hours.

[Production Method 4-3]

Alternative production method to compound (2c-7) in Production Method 4-2:

(2c-91)

<img file="IL155447A_D0059.tif" />

(2c-B) (2c-90) H (2c-92) (wherein the symbols have the same definitions given above.) &lt;Step 2C-7&gt;

Conversion of ketone (2c-8) to thioketone (2c-90).

Synthesis may be carried out by the same procedure as in &lt;Step 2A-2). &lt;Step 2C-8&gt;

Synthesis may be carried out by the same procedure as in &lt;Step 2A-3&gt;.

[Production Method 5-1]

Representative production method for compound (G51) represented by:

<img file="IL155447A_D0060.tif" />

|l / J /N psaS' (G5-1)

FP01 00 (wherein the symbols have the same definitions given above.)

<img file="IL155447A_D0061.tif" />

<img file="IL155447A_D0062.tif" />

. H2N N' (d-3)

<img file="IL155447A_D0063.tif" />

<img file="IL155447A_D0064.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step D-l&gt;

The same procedure as in &lt;step A-4&gt; may be carried out to obtain the target compound (d-2). &lt;Step D-2&gt;

Step of amination of chloro group. The 2chloropyrimidine derivative (d-2) may be reacted with ammonia to obtain the target amino compound (d-3). The reaction solvent used may be ethanol, tetrahydrofuran or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 10 minutes to 30 hours.

&lt;Step D-3&gt;

Reduction of nitro compound (d-3) to amino compound (d-4). The same procedure as in &lt;Step A-5&gt; may be carried out to obtain the target amino compound (d-4) .

FP01 00 &lt;Step D-4&gt;

The same procedure as in &lt;Step A-7&gt; may be carried out to obtain the target urea compound (d-5).

«&amp;#1497;.» ? &amp;#1497; rY~N0&amp;#1470; ηΓ'&amp;#1470;&amp;#1524; fl -------&amp;#1470;&amp;#1523; ΓΧ -------- Π.

CI&amp;#1523;^N&amp;#1523;^NH2. CI'ZXNZXNH2. N nh2 (d-7) (d-8) (d-9) ,z

&amp;#905;1 ___________—N k1

. Rsa\ ? V n^nh2 (d-10) (wherein the symbols have the same definitions given above.) &lt;Step D-6&gt;

The same procedure as in &lt;Step A-4&gt; may be carried out to obtain the target compound (d-8), &lt;Step D-7&gt;

Step of dechlorination and nitro group reduction. The target compound (d-9) may be obtained under common catalytic reduction conditions with palladium hydroxide-hydrogen or the like. The reaction solvent used may be methanol, ethanol, tetrahydrofuran, dimethylformamide or the like, and catalytic reduction may be conducted at ordinary pressure or under pressurization. The reaction time may be from 10 minutes to 30 hours and the reaction temperature from room temperature to reflux temperature.

&lt;Step D-8&gt;

FP01 00

The same procedure as in &lt;Step A-7&gt; may be carried out to obtain the target urea compound (d-10). [Production Method 5-2]

Representative production method for compound (G52) represented by:

<img file="IL155447A_D0065.tif" />

(wherein the symbols have the same definitions given above.)

<img file="IL155447A_D0066.tif" />

<img file="IL155447A_D0067.tif" />

7 N Dsa1 0^ E (wherein the symbols have the same definitions given above.) &lt;Step 2D-1&gt;

Decarbamating reaction. Compound (2d-l) may be reacted with an acid to obtain the target amine derivative (2d-2). The solvent used may be water, dioxane, tetrahydrofuran, methanol, ethanol or the like, the reaction temperature from room temperature to reflux temperature and the reaction time from 10 minutes to 30 hours. The acid used may be hydrochloric

FP01 00 acid, hydrobromic acid, trifluoroacetic acid, or the like.

&lt;Step 2D-2&gt;

Compound (2d-2) may be used in the same procedure from &lt;Step D-6&gt; to &lt;Step D-8&gt; of Production Method 5-1 to obtain a urea derivative (2d-3).

[Production Method 6]

Alternative production method for compounds (G6-1), (G6-2) and (G6-3) represented by:

/Y—NH2 /Y—no2 xsa1 xsa1 Q|

A A A (G6-1) (G6-2) (G6-3) (wherein the symbols have the same definitions given above.)

<img file="IL155447A_D0068.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step E-l&gt;

Coupling reaction between iodo compound and ethyl acrylate. Compound (e-1) may be reacted with ethyl acrylate in the presence of a catalyst such as

FP01 00 palladium acetate and a tertiary amine such as tributylamine, to obtain the target compound (e-2). The reaction solvent used may be dimethylformamide or the like, the reaction temperature from 100°C to reflux temperature, and the reaction time from 5 minutes to 30 hours.

&lt;Step E-2&gt;

Reduction of double bond, followed by cyclization and nitro group reduction. Compound (e-2) may be reacted in the presence of palladium carbon-hydrogen for reduction of the double bond, cyclization and nitro group reduction. The reaction solvent used may be methanol, ethanol, tetrahydrofuran, dimethylformaldehyde or the like, and catalytic reduction may be conducted at ordinary pressure or under pressurization. The reaction time may be from 10 minutes to 30 hours and the reaction temperature from room temperature to reflux temperature. &lt;Step E-3&gt;

Isomerization of double bond by light irradiation followed by cyclization. The reaction solvent used may be methanol or the like, with light irradiation performed in the presence of 2'-acetonaphthone to obtain the target compound (e-4). The reaction time may be from 10 minutes to 30 hours.

FP01 00 ci

<img file="IL155447A_D0069.tif" />

ci l^sal υιλνηνο2

<img file="IL155447A_D0070.tif" />

<img file="IL155447A_D0071.tif" />

(2e-4) (2e-2)

<img file="IL155447A_D0072.tif" />

<img file="IL155447A_D0073.tif" />

(wherein the symbols have the same definitions given above .) &lt;Step 2E-1&gt;

Nitration reaction. Compound (2e-l) may be reacted with sulfuric acid and fuming nitric acid to obtain the target compound (2e-2). The reaction solvent used may be sulfuric acid, fuming nitric acid or the like, the reaction temperature from 0°C to room temperature, and the reaction time from 10 minutes to 30 hours.

&lt;Step 2E-2&gt;

Rearrangement of nitro group. Compound (2e-2) may be reacted with sulfuric acid to obtain the target compound (2e-3). The reaction solvent used may be sulfuric acid or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 10 minutes to 30 hours. &lt;Step 2E-3&gt;

The target nitro compound (2e-4) may be obtained by nucleophilic substitution of compound &lt;2e-3&gt; using any desired nitro group-containing nucleophilic agent

FP01 00 and 1-methylpyrrolidone, dimethylformamide, chlorbenzene or the like as the reaction solvent. The reaction may be conducted with addition of an appropriate base, for example, an organic base such as diisopropylethylamine, or an inorganic base such as potassium carbonate. The reaction time may be from 10 minutes to 30 hours and the reaction temperature from room temperature to reflux temperature.

&lt;Step 2E-4&gt;

Reduction of nitro group to amino group. The same procedure as in &lt;Step A-5&gt; may be carried out to obtain the target compound (2e-5). &lt;Step 2E-5&gt;

Condensation of a carboxylic acid and the diamine (2e-5). The diamine compound (2e-5) may be reacted with a carboxylic acid to obtain the target compound (2e6&amp;#1470;). The reaction solvent used may be pyrophosphoric acid or the like, the reaction temperature from room temperature to reflux temperature, and the reaction time from 10 minutes to 30 hours. Polyphosphoric acid, phosphorus pentoxide or the like may be used as a dehydrating agent.

FP01 00

<img file="IL155447A_D0074.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step 3E-1&gt;

This synthesis may be carried out according to the process described in Journal of Heterocyclic Chemistry, 35, 1313(1998). An a-haloketone derivative (3e-l) may be reacted with malononitrile to synthesize compound (3e-2). The reaction solvent used may be dimethylformamide or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 30 minutes to about 30 hours. Diethylamine may be used as the base. &lt;Step 3E-2&gt;

Step of forming furopyrimidine ring. Compound (3e-2) may be heated at about 200°C in formamide with addition of acetic anhydride to obtain the target compound (3e-3). The reaction time may be about a few hours .

&lt;Step 3E-3&gt;

Bromination reaction. Compound (3e-3) may be

FP01 00 reacted with dibromomethane and isoamyl nitrite to obtain the target bromo compound (3e-4) . The reaction solvent used may be dibromomethane, the reaction temperature from room temperature to reflux temperature, and the reaction time from 30 minutes to 30 hours.

&lt;Step 3E-4&gt;

The same procedure as in &lt;Step A-4&gt; may be carried out to obtain compound (3e-5) .

<img file="IL155447A_D0075.tif" />

(3e-9) (wherein the symbols have the same definitions given above.) &lt;Step 3E-5&gt;

The same procedure as in out to obtain compound (3e-7) &lt;Step 3E-6&gt;

The same procedure as in out to obtain compound (3e-8) &lt;Step 3E-7&gt;

The same procedure as in out to obtain compound (3e-9) &lt;Step A-l&gt; may be carried &lt;Step A-2&gt; may be carried &lt;Step A-3&gt; may be carried

FP01 00

<img file="IL155447A_D0076.tif" />

(4e-1) (wherein the substituent Rsal0° is optionally substituted phenylamino or optionally substituted benzyl amino). Synthesis of this compound is described in Journal of Medicinal Chemistry, 40, 3601(1997).

<img file="IL155447A_D0077.tif" />

(wherein the substituent Rsa101 is fluorine, optionally substituted amino, optionally substituted C1-6 alkoxy or optionally substituted C2-7 acylamino). Synthesis of this compound is described in Journal of Medicinal Chemistry, 39, 1823(1996).

[Production Method 7]

Representative production method for compound (II) represented by:

<img file="IL155447A_D0078.tif" />

(II) (wherein the symbols have the same definitions given above .) (1) Compound (a-01) represented by the formula:

FP01 00 A (a01&amp;#1470;) (wherein the symbols have the same definitions given above) may be synthesized utilizing common hitherto known organic reactions. As compound (a-01) there may be used compounds (c-6), (c-10), (2c-4), (d-1), (d-2), (d-7), (3e-4), (2e-4), (3e-9), (4e-l), (4e-2) or (4e-3) described in the aforementioned production methods 4-1,

4-2, 5-1, 5-2 and 6.

Compound (II) may be produced using compound (a01) under the reaction conditions described in &lt;Step A4&gt; to &lt;Step A-ll&gt; in Production Method 2-1 above, the reaction conditions described in Production Method 2-2 above, the reaction conditions described in Production Method 2-3 above and the reaction conditions described in Production Method 3 above.

(2)

V &amp;#1524;&amp;#1524; Ax /NH2 (a-04) xNO2 (a-03) κ &amp;#1509;

A Y (wherein the symbols have the same definitions given above.)

The urea derivative (II) may be obtained using compound (a-03) or (a-04) with an appropriate combination of the conditions in &lt;Step A-5&gt; to &lt;Step A11&gt; in Production Method 2-1. Specifically, compound (a-03) or (a-04) may be, for example, (2c-7), (20-92),

FP01 00 (e-4), (3e-5), (e-3) or (e-6).

[Production Method 8-1]

Representative synthesis method for compound represented by:

<img file="IL155447A_D0079.tif" />

(wherein the symbols have the same definitions given above.)

<img file="IL155447A_D0080.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step 0-l&gt;

Step of reductive amination. An aldehyde derivative may be reductively reacted with compound (o1) to obtain the target compound (0-2) . The reaction solvent used may be acetic acid, tetrahydrofuran, dichloroethane, dichloromethane, methanol or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 30 minutes to 30 hours. The

FP01 00 reducing agent used may be sodium triacetoxyborohydride, sodium borohydride, or the like.

&lt;Step O-2&gt;

Carbamating step. Compound (0-2) may be reacted with a chloroformate derivative to obtain the target compound (0-3). The reaction solvent used may be tetrahydrofuran, dichloromethane or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 30 minutes to 30 hours. Pyridine, triethylamine or the like may be used as the base.

&lt;Step O-3&gt;

Step of reducing nitro group to amino group. The same procedure as in &lt;Step A-5&gt; may be carried out to obtain compound (0-4). &lt;Step O-4&gt;

Intramolecular cyclization step. The target compound (0-5) may be obtained by reacting the amino group and carbamate group in the molecule. The reaction solvent used may be tetrahydrofuran, dimethylformamide, dimethylsulfoxide, acetonitrile or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 30 minutes to 30 hours. Sodium hydride, pyridine, triethylamine or the like may be used as the base.

[Production Method 8-2]

FP01 00

Alternative production method for compound (0-5) .

<img file="IL155447A_D0081.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step 0-5&gt;

Step of reducing nitro group to amino group. The same procedure as in &lt;Step A-5&gt; may be carried out to obtain the target diamine compound (0-6). &lt;Step 0-6&gt;

Intramolecular cyclization step. The target compound (0-5) may be obtained by condensing the two amino groups in the molecule using phosgene, triphosgene, l-ethyl (3-dimethylaminop'ropyl) carbodiimide hydrochloride, (1H-1,2,3-benzotriazol-lyloxy) (tri(dimethylamino)) phosphonium hexafluorophosphate, l-ethyl (3dimethylaminopropyl)carbodiimide hydrochloride, 1,1carbonyldiimidazole or the like as the condensing agent. The reaction solvent used may be tetrahydrofuran, dimethylformamide, dimethylsulfoxide, acetonitrile or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 30 minutes to 30 hours. Sodium hydride, pyridine, triethylamine or the like may be appropriately used as the base.

FP01 00

[Production Method 9]

Conversion of substituent on ring A of compound (II) represented by

R1

α.^ γ &amp;#1509; Z (ii) 0 (wherein the symbols have the same definitions given above.)

This may be accomplished by appropriately employing common organic reactions such as oxidation, reduction, esterification, amidation, protection, deprotection, hydrolysis, dehydration, rearrangement, nucleophilic reaction, nucleophilic substitution or aromatic electrophilic substitution.

Specifically, the substituent conversion on ring A may be carried out by the methods shown below, for example. In addition, (1) the following reactions may be appropriately combined, (2) their products may be used as intermediates as well as final products, and (3) the reactions may be used not only for conversion of substituents directly bonded to ring A, but also for conversion of substituents at positions not directly bonded to but within substituents on ring A. [Production Method 10]

FP01 00

<img file="IL155447A_D0082.tif" />

<img file="IL155447A_D0083.tif" />

<img file="IL155447A_D0084.tif" />

(h-3)

<img file="IL155447A_D0085.tif" />

(h-4) (wherein G! is an optionally substituted nitrogen atom or oxygen atom, and the remaining symbols have the same definitions given above.) &lt;Step H-l&gt;

Reduction of ester compound (h-1) to alcohol compound (h-2). The reducing agent used may be lithium borohydride, lithium aluminum hydride or the like, the reaction solvent diethyl ether, tetrahydrofuran or the 10 like, the reaction temperature from 0°C to reflux temperature and the reaction time from 10 minutes to 30 hours . &lt;Step H-2&gt;

Oxidation of alcohol compound (h-2) to aldehyde 15 compound (h-3). The oxidizing agent used may be manganese dioxide, pyridium chlorochromate (PCC), pyridium dichromate (PDC) or the like, the reaction solvent chloroform, dichloromethane, toluene or the

FP01 00 like, the reaction temperature from 0°C to reflux temperature and the reaction time from 30 minutes to 30 hours .

&lt;Step H-3&gt;

Reductive amination reaction. Compound (h-4) may be obtained by reaction of an amino derivative with the aldehyde derivative (h-3) to form an imine, followed by reduction with sodium cyanoborohydride or the like. The reaction solvent used may be methanol, tetrahydrofuran or the like, the reaction time from 10 minutes to 30 hours and the reaction temperature from 0°C to reflux temperature.

<img file="IL155447A_D0086.tif" />

<img file="IL155447A_D0087.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step H-4&gt;

Reduction of an ester compound (h-5) to an alcohol compound (h-6). The same procedure as in &lt;Step H-l&gt; may be carried out to synthesize the target compound (h-6) .

FP01 00 &lt;Step H-5&gt;

Oxidation of alcohol compound (h-6) to an aldehyde compound (h-7). The same procedure as in &lt;Step H-2&gt; may be carried out to synthesize the target compound (h-7) . &lt;Step H-6&gt;

Reductive amination reaction. The same procedure as in &lt;Step H-3&gt; may be carried out to obtain the target compound (h-8) from compound (h-7).

<img file="IL155447A_D0088.tif" />

(h-9) (h-10) (wherein the symbols have the same definitions given above.) &lt;Step H-7&gt;

Reduction of cyano group to aminomethyl group.

The target compound (h-10) may be obtained from compound (h-9) by common catalytic reduction (palladium-carbon, palladium hydroxide-hydrogen or the like). The reaction solvent used may be tetrahydrofuran, methanol, ethanol or the like. The reaction time may be from 10 minutes to 30 hours, and the reaction temperature from 0°C to reflux temperature.

f

Trifluoroacetic acid, hydrochloric acid or the like may be added as an acid.

[Production Method 10-2]

FP01 00 0 7

&amp;#1524;.»Uf'-pA-N'&amp;#1470; r“™00c-_1 \&amp;#1497;&amp;#1503;

<img file="IL155447A_D0089.tif" />

(2M) (wherein the symbols have the same definitions given above.) &lt;Step 2H-1&gt;

Step of hydrolyzing ester in compound (2h-l) to obtain compound (2h-2). A base such as potassium hydroxide, sodium hydroxide, calcium carbonate, sodium carbonate or the like may be used for the reaction. The reaction time may be from 10 minutes to 30 hours, and the reaction temperature from 0°C to reflux temperature. The solvent used may be water, tetrahydrofuran or the like.

&lt;Step 2H-2&gt;

Synthesis of amide derivative (2h-3) by condensation of carboxylic acid and amine derivative Compound (2h-3) may be obtained by reacting compound (2h-2) and an amine derivative in the presence of a condensing agent. As condensing agents there may be used l-ethyl (3-dimethylaminopropyl) carbodiimide hydrochloride, (1H-1,2,3-benzotriazol-lyloxy) (tri(dimethylamino)) phosphonium hexafluorophosphate, or the like. The reaction time

FP01 00 may be from 10 minutes to 30 hours, and the reaction temperature from 0°C to reflux temperature. The solvent used may be dimethylformamide, tetrahydrofuran, or the like. &lt;Step 2H-3&gt;

Synthesis of ester (2h-4) by condensation of carboxylic acid and an alcohol. Compound (2h-3) may be obtained by reaction of compound (2h-2) and an alcohol derivative in the presence of a condensing agent. As the condensing agent there may be used l-ethyl (3dimethylaminopropyl) carbodiimide hydrochloride, or the like. The reaction time may be from 10 minutes to 30 hours, and the reaction temperature from 0°C to reflux temperature. The solvent used may be dimethylformamide, tetrahydrofuran, or the like.

<img file="IL155447A_D0090.tif" />

<img file="IL155447A_D0091.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step 2H-4&gt;

Step of obtaining compound (2h-6) by hydrolysis of ester in compound (2h-5). The same procedure as in &lt;Step 2H-1&gt; may be carried out to synthesize compound (2h-6) from compound (2h-5).

FP01 00 &lt;Step 2H-5&gt;

Synthesis of amide derivative (2h—7) by condensation of carboxylic acid derivative (2h-6) and amino derivative. The same procedure as in &lt;Step 2H-2&gt; may be carried out to synthesize compound (2h-7) from compound (2h-6).

<img file="IL155447A_D0092.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step 2H-6&gt;

Step of obtaining nitrile derivative (2h-9) by dehydration of carbamoyl compound (2h-8). The reaction solvent used may be tetrahydrofuran, diethyl ether or the like, the dehydrating agent used may be thionyl chloride, trifluoroacetic anhydride, dicyclohexyl carbodiimide or the like, and the base used may be pyridine, triethylamine or the like. The reaction temperature may be from 0°C to reflux temperature, and the reaction time from 30 minutes to 30 hours. [Production Method 10-3]

FP01 00

<img file="IL155447A_D0093.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step 3H-1&gt;

Step of acylating amino group. Compound (3h-l) may be reacted with an acid chloride, acid anhydride or the like to obtain the target compound (3h-2). The reaction solvent used may be tetrahydrofuran or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 10 minutes to hours. Triethylamine or the like may be used as the base.

<img file="IL155447A_D0094.tif" />

(wherein the symbols have the same definitions given

FP01 00 above.) &lt;Step 3H-20&gt;

Acylation step. Compound (3h-3) may be reacted with an acid chloride, acid anhydride or the like to obtain the target compound (3h-4). The reaction solvent used may be tetrahydrofuran, pyridine or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 10 minutes to 30 hours. Triethylamine, pyridine or the like may be used as the base. &lt;Step 3H-21&gt;

Cyclization reaction. The reaction solvent used may be dimethylformamide or the like, the reaction temperature from 100°C to reflux temperature, and the reaction time from 10 minutes to 30 hours. Potassium carbonate or the like may be used as the base.

<img file="IL155447A_D0095.tif" />

<img file="IL155447A_D0096.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step 3H-3&gt;

Sulfonamidation step. Compound (3h-5) may be reacted with a sulfonyl chloride derivative to obtain

FP01 00 the target compound (3h-6). The reaction solvent used may be tetrahydrofuran, dimethylformamide or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 10 minutes to 30 hours.

Triethylamine, pyridine or the like may be used as the base .

<img file="IL155447A_D0097.tif" />

(3h-7)

<img file="IL155447A_D0098.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step 3H-4&gt;

De-benzyloxycarbonylation step. Compound (3h-8) may be obtained from compound (3h-7) by ordinary catalytic reduction (palladium-carbon, palladium hydroxide-carbon and hydrogen, etc.). The solvent used may be tetrahydrofuran, methanol, ethanol or the like. The reaction time may be from 10 minutes to 30 hours and the reaction temperature from 0°C to reflux temperature. Trifluoroacetic acid, hydrochloric acid or the like may be added as an acid. [Production Method 11]

FP01 00

<img file="IL155447A_D0099.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step I-l&gt;

Rearrangement of carboxylic acid to amino derivative (i-2). A carboxylic acid derivative (i-1) may be reacted with benzyl alcohol in the presence of diphenylphosphoryl azide and triethylamine to obtain compound (i-2) from compound (i-1). The reaction solvent used may be benzyl alcohol, dimethylformamide, toluene or the like, the reaction temperature from room temperature to reflux temperature, and the reaction time from 10 minutes to 30 hours.

&lt;Step I-2&gt;

The same procedure as in &lt;Step A-4&gt;, &lt;Step A-5&gt;

and &lt;Step A-7&gt; may be carried out to synthesize compound (i-3)’ from compound (i-2).

<img file="IL155447A_D0100.tif" />

(wherein the symbols have the same definitions given

FP01 00 above.) &lt;Step I-3&gt;

Step of rearrangement of carbamoyl group to amino group. An amino compound (i-5) may be obtained from compound (i-4) by reaction with a base such as bromine water, sodium hydroxide or the like. The reaction solvent used maybe water or the like, the reaction temperature from room temperature to reflux temperature, and the reaction time from 10 minutes to 10 hours. [Production Method 12-1]

<img file="IL155447A_D0101.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step M-l&gt;

Conversion of methylthio group to methylsulfone group. Compound (m-1) may be reacted with a peracid to obtain the target compound (m-2). The peracid used may be 3-chloroperbenzoic acid, the reaction solvent methylene chloride, chloroform or the like, the reaction time from 10 minutes to 30 hours and the reaction temperature from 0°C to room temperature. [Production Method 12-2]

FP01 00

<img file="IL155447A_D0102.tif" />

(2m-1) (2rn2&amp;#1470;) (wherein the symbols have the same definitions given above.) &lt;Step 2M-1&gt;

Step of introducing substituent into aromatic ring by electrophilic reaction. An electrophilic reagent may be reacted with compound (2m-l) to obtain compound (2m-2) The electrophilic reagent used for the reaction may be, as specific examples, Vilsmeier reagent (which may be prepared from dimethylformamide or Nmethylformanilide and phosphorus oxychloride), Nchlorosuccinimide, N-bromosuccinimide, a combination of acyl chloride and a Lewis acid (for example, aluminum chloride, titanium tetrachloride, etc.) or a reagent represented by the formula / =N+ Γ

These allow introduction of formyl, chloro, bromo, acyl and dimethylaminomethyl groups, respectively. The reaction solvent used maybe dimethylformamide, acetonitrile, dichloromethane, toluene or the like. The reaction temperature may be from 0°C to reflux

FP01 00 temperature, and the reaction time from 10 minutes to 30 hours.

[Production Method 13]

<img file="IL155447A_D0103.tif" />

(q-1) fa2&amp;#1470;) (wherein the symbols have the same definitions given above .) &lt;Step Q-l&gt;

Step of deprotection of hydroxyl-protecting group of compound (q-1). The reaction may be conducted in the same manner as the conventional method for deprotection of a phenol group protected with a benzyl group. Specifically, the reagent used may be, for example, trifluoroacetic acid-thioanisole, palladium hydroxide-hydrogen, platinum oxide-hydrogen, or the like. The reaction solvent used may be trifluoroacetic acid, dimethylformamide or the like, the reaction time from 10 minutes to 30 hours and the reaction temperature from room temperature to reflux temperature.

<img file="IL155447A_D0104.tif" />

(q-3) fa4&amp;#1470;) (wherein Rsa90 is an amino or nitro group, and the other

FP01 00 symbols have the same definitions given above.) &lt;Step Q-2&gt;

Step of deprotection of hydroxyl-protecting group of compound (q-3). The reaction may be conducted under the same conditions as in &lt;Step Q-l&gt; above.

[Production Method 14]

<img file="IL155447A_D0105.tif" />

(r-1) (r-3) (wherein the symbols have the same definitions given above.) &lt;Step R-l&gt;

Step of reacting compound (r-1) with an electrophilic reagent such as an alkyl halide derivative (r-2) to obtain compound (r-3). The reaction solvent used may be dimethylformamide, dimethylsulfoxide, tetrahydrofuran or the like, the reaction time from 10 minutes to 30 hours, and the reaction temperature from 0°C to reflux temperature. The reaction may also employ a base, and specifically, for example, potassium carbonate, cesium carbonate or the like.

As specific examples for the alkyl halide derivative (Rsa71-U) in the reaction there may be mentioned (1) alkylthio halide derivatives represented by the formula: Rsa80S-(CH2)S-C1 (wherein s is an integer

FP01 00 of 1-6, and the other symbols have the same definitions given above), (2) alkyl halide derivatives represented by the formula: Br-(CH2)S-Cl (wherein s is an integer of 1-6), (3) propylene oxide derivatives represented by the formula:

<img file="IL155447A_D0106.tif" />

U (wherein U is a leaving group), (4) compounds represented by the formula:

/-y(CH2)s—U N J ^3382/ (wherein U is a leaving group, Rsa82 is an aminoprotecting group such as t-butoxycarbonyl or benzyl, and s is an integer of 1-6), and (5) alkyl halide derivatives substituted with C!-6 alkoxy groups.

<img file="IL155447A_D0107.tif" />

(r4&amp;#1470;) (r-5) (wherein Rsa73 is hydrogen or 2(trimethylsilyl)ethoxymethyl, and the other symbols have the same definitions given above.

&lt;Step R-2&gt;

Step of reaction with a phenol derivative (r-4) to introduce the substituent Rsa71. The substituent Rsa71

FP01 00 may be introduced by the same procedure as in &lt;Step R1&gt;.

<img file="IL155447A_D0108.tif" />

(r-7) H) (wherein the symbols have the same definitions given above.) &lt;Step R-3&gt;

Step of triflating the hydroxyl group. Compound (r-6) may be reacted with a triflating reagent such as paranitrophenyl triflate or the like to obtain the target compound (r-7). The reaction solvent used may be dimethylformamide or the like, the reaction temperature from 0°C to reflux temperature and the reaction time from 10 minutes to 30 hours. Potassium carbonate or the like may be used as a base.

&lt;Step R-4&gt;

Step of converting the triflate group to a cyano group. Compound (r-7) may be reacted with a cyanating reagent such as zinc cyanide (Zn(CN)2) or the like to obtain the target compound (r-8). The catalyst used may be tetrakistriphenylphosphine palladium. The reaction solvent used may be dimethylformamide, the reaction temperature from room temperature to reflux temperature, and the reaction time from 10 minutes to

FP01 00 hours.

<img file="IL155447A_D0109.tif" />

<img file="IL155447A_D0110.tif" />

(wherein the symbols have the same definitions given above.) &lt;Step R-5&gt;

Step of reacting compound (r-3) which has a thioether group in substituent Rsa71, with an oxidizing agent such as 3-chloroperbenzoic acid to obtain compound (2r-2). The reaction solvent used may be methylene chloride, chloroform or the like, the reaction time from 10 minutes to 30 hours and the reaction temperature from 0°C to room temperature. &lt;Step R-6&gt;

Step of reacting a nucleophilic agent with compound (r-3) having a leaving group, for example, a halogen atom such as chlorine, bromine or iodine or a methanesulfonyloxy group, or an epoxide group or the like in substituent Rsa71, to obtain compound (2r-l) or compound (2r-4). Specific examples of nucleophilic agents which may be used include nitrogen-containing

FP01 00 aromatic derivatives such as triazole or imidazole, amine derivatives such as morpholine or pyrrolidine, and alcohol derivatives, phenol derivatives, thiol derivatives and the like.

The reaction solvent used may be dimethylformamide, tetrahydrofuran, or the like, the reaction time from 10 minutes to 30 hours and the reaction temperature from 0°C to reflux temperature, and potassium carbonate, sodium hydride or the like may be used as a base. &lt;Step R-7&gt;

<img file="IL155447A_D0111.tif" />

(r-90) R5Oe2/ (wherein Rsa82 is an amino-protecting group such as tbutoxycarbonyl or benzyl, and the remaining symbols have the same definitions given above.)

Compound (r-90) or compound (r-91) wherein the amino group protected with a protecting group may be subjected to amino-deprotection reaction, and the deprotected amino group then alkylated.

(1) Amino-deprotecting step. The deprotecting reagent used may be trifluoroacetic acid, hydrochloric acid or the like. When the protecting group is benzyl, the deprotecting reaction may be conducted by common catalytic reduction (palladium hydroxide-hydrogen or

FP01 00 the like). The solvent used may be trifluoroacetic acid, methanol, ethanol or the like. The reaction time may be from 10 minutes to 30 hours and the reaction temperature from 0°C to reflux temperature.

(2) Step of alkylating deprotected amino group.

The deprotected amino derivative may be reacted with an aldehyde derivative or ketone derivative to form an imine, which is then reduced with a reducing agent such as sodium cyanoborohydride to obtain compound (2r-3). The reaction solvent used may be methanol, tetrahydrofuran or the like, the reaction time from 10 minutes to 30 hours, and the reaction temperature from 0°C to reflux temperature.

[Production Method 15]

Alternative synthesis method for compound represented by:

<img file="IL155447A_D0112.tif" />

(wherein the symbols have the same definitions given above .) (P-2)

Rsa71-OH NCY^1 psa71 II .I &amp;#1524; nh2 * 'O&amp;#1523;^xNH2 (p-1) (P-3) (wherein the symbols have the same definitions given

<img file="IL155447A_D0113.tif" />

FP01 00 above .) &lt;Step P-l&gt;

Compound (p-1) may be reacted with an alcohol derivative (p-2) in the presence of a base such as sodium hydride to obtain compound (p-3). The synthesis may be carried out by reaction in a solvent such as 1methylpyrrolidone or Ν,Ν-dimethylformamide. The reaction time may be from 10 minutes to 30 hours, and the reaction temperature from 0°C to reflux temperature. [Production Method 16]

Alternative synthesis method for compound represented by:

<img file="IL155447A_D0114.tif" />

(P-6) (wherein the symbols have the same definitions given above.)

<img file="IL155447A_D0115.tif" />

<img file="IL155447A_D0116.tif" />

(P-6) (wherein the symbols have the same definitions given above .) &lt;Step P-2&gt;

Reaction for obtaining carbamate derivative. It

FP01 00 may be obtained by reacting an amino derivative with phenyl chloroformate. The reaction solvent used may be tetrahydrofuran, dimethylformamide or the like, the reaction temperature from 0°C to reflux temperature, and the reaction time from 30 minutes to 30 hours.

The reaction is carried out while appropriately protecting the reactive functional groups such as amino, hydroxyl and carboxyl.

As amino-protecting groups there may be used any groups conventionally known as protecting groups for amino groups in organic synthesis, with no particular restrictions, and as specific examples there may be mentioned substituted or unsubstituted lower alkanoyl groups such as formyl, acetyl, chloroacetyl, dichloroacetyl, propionyl, phenylacetyl, phenoxyacetyl and thienylacetyl; substituted or unsubstituted lower alkoxycarbonyl. groups such as benzyloxycarbonyl, tbutoxycarbonyl and p-nitrobenzyloxycarbonyl; substituted lower alkyl groups such as methyl, t-butyl, 2,2,2-trichloroethyl, trityl, p-methoxybenzyl, pnitrobenzyl, diphenylmethyl and pivaloyloxymethyl; substituted silyl groups such as trimethylsilyl and tbutyldimethylsilyl; substituted silylalkoxyalkyl groups such as trimethylsilylmethoxymethyl, trimethylsilylethoxymethyl, tbutyldimethylsilylmethoxymethyl and t122

FP01 00 butyldimethylsilylethoxymethyl; or substituted or unsubstituted benzylidene groups such as benzylidene, salicylidene, p-nitrobenzylidene, m-chlorbenzylidene,

3,5-di(t-butyl) hydroxybenzylidene and 3,5-di(tbutyl)benzylidene.

These protecting groups may be removed by ordinary methods such as hydrolysis or reduction, depending on the type of protecting group used.

As hydroxyl-protecting groups there may be used any groups conventionally known as protecting groups for hydroxyl groups in organic synthesis, with no particular restrictions, and as specific examples there may be mentioned lower alkylsilyl groups such as trimethylsilyl and t-butyldimethylsilyl; lower alkoxymethyl groups such as methoxymethyl and 2methoxyethoxymethyl; tetrahydropyranyl; aralkyl groups such as benzyl, p-methoxybenzyl, 2,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl and trityl; acyl groups such as formyl and acetyl; lower alkoxycarbonyl groups such as t-butoxycarbonyl, 2-iodoethoxycarbonyl and 2,2,2-trichloroethoxycarbonyl; alkenyloxycarbonyl groups such as 2-propenyloxycarbonyl, 2-chloro-2propenyloxycarbonyl, 3-methoxycarbonyl-2propenyloxycarbonyl, 2-methyl propenyloxycarbonyl, 2butenyloxycarbonyl and cinnamyloxycarbonyl; and aralkyloxycarbonyl groups such as benzyloxycarbonyl, p

FP01 00 methoxybenzyloxycarbonyl, o-nitrobenzyloxycarbonyl and p-nitrobenzyloxycarbonyl.

These protecting groups may be removed by ordinary methods such as hydrolysis or reduction, depending on the type of protecting group used.

As carboxyl-protecting groups there may be used any groups conventionally known as protecting groups for carboxyl groups in organic synthesis, with no particular restrictions, and as specific examples there may be mentioned linear or branched lower alkyl groups of 1-4 carbons such as methyl, ethyl, isopropyl and tbutyl; halogeno lower alkyl groups such as 2-iodoethyl and 2,2,2-trichloroethyl; lower alkoxymethyl groups such as methoxymethyl, ethoxymethyl and isobutoxymethyl; lower aliphatic acyloxymethyl groups such as butyryloxymethyl and pivaloyloxymethyl; 1-lower alkoxycarbonyloxyethyl groups such as 1methoxycarbonyloxyethyl and 1-ethoxycarbonyloxyethyl, aralkyl groups such as benzyl, p-methoxybenzyl, 0nitrobenzyl and p-nitrobenzyl; benzhydryl, phthalidyl, and the like.

These protecting groups may be removed by ordinary methods such as hydrolysis or reduction, depending on the type of protecting group used.

There are no particular restrictions on esters of the carboxyl groups so long as they are ones commonly

FP01 00 used in organic synthesis, and they include physiologically acceptable esters which are hydrolyzed under physiological conditions. As specific examples there may be mentioned alkyl groups of 1 to 6 carbons, aryl groups of 6 to 12 carbons, aralkyl groups of 7 to 20 carbons such as benzyl, heteroarylalkyl groups of 7 to 20 carbons, 4-methoxybenzyl, alkanoyloxyalkyl groups such as acetoxymethyl, propionyloxymethyl or pivaloxymethyl, alkoxycarbonyloxyalkyl groups such as methoxycarbonyloxymethyl ethoxycarbonyloxymethyl or 2methoxycarbonyloxyethyl, (5-methyl oxo-l,3-dioxo-4yl)-methyl, and the like.

The solvents to be used for the invention are not particularly restricted so long as they do not impede the reaction and are solvents commonly used in organic synthesis, and as examples there may be mentioned lower alcohols such as methanol, ethanol, propanol and butanol, polyalcohols such as ethyleneglycol and glycerin, ketones such as acetone, methylethyl ketone, diethyl ketone and cyclohexanone, ethers such as diethyl ether, isopropyl ether, tetrahydrofuran, dioxane, 2-methoxyethanol and 1,2-dimethoxyethane, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate, ethyl acetate, isopropyl acetate, butyl acetate and diethyl phthalate, halogenated hydrocarbons such as dichloromethane,

FP01 00 chloroform, carbon tetrachloride, 1,2-dichloroethane, trichloroethylene and tetrachloroethylene, aromatic compounds such as benzene, toluene, xylene, monochlorbenzene, nitrobenzene, indene, pyridine, quinoline, collidine and phenol, hydrocarbons such as pentane, cyclohexane, hexane, heptane, octane, isooctane, petroleum benzine and petroleum ether, amines such as ethanolamine, diethylamine, triethylamine, pyrrolidine, piperidine, piperazine, morpholine, aniline, dimethylaniline, benzylamine and toluidine, amides such as formamide, Nmethylpyrrolidone, N,N-dimethylimidazolone, N,Ndimethylacetamide and N,N-dimethylformamide, phosphoric/phosphorous amides such as hexamethylphosphosphoric triamide and hexamethylphosphorous triamide, and water, as well as other commonly used solvents, either alone or in mixtures of two or more, with no particular restrictions on the solvent ratio.

There are no particular restrictions on bases uses so long as they are commonly known as bases for organic synthesis, and as specific examples there may be mentioned sodium carbonate, sodium bicarbonate, potassium carbonate, sodium hydride, potassium hydride, t-butoxypotassium, pyridine, dimethylaminopyridine, trimethylamine, triethylamine, N,N

FP01 00 diisopropylethylamine, N-methylmorpholine, Nmethylpyrrolidine, N-methylpiperidine, N,Ndimethylaniline, 1,8-diazabicyclo[5,4,0]undeca ene (DBU), pyridine, 4-dimethylaminopyridine, picoline, lutidine, quinoline, isoquinoline, sodium hydroxide, potassium hydroxide, lithium hydroxide, butyllithium, and sodium or potassium alcoholates such as sodium methylate, potassium methylate and sodium ethylate.

As specific examples of halogenating agents to be used there may be mentioned halogenating agents conventionally used for synthesis of acid halides, for example, phosgene, diphosgene (phosgene dimer), triphosgene (phosgene trimer), thionyl chloride, thionyl bromide, phosphorus trichloride, phosphorus tribromide, phosphorus oxychloride, phosphorus pentachloride, trichloromethyl chloroformate and oxalyl chloride, as well as Vilsmeier reagents obtained by reacting these halogenating agents with acid amides or phosphoric amides.

There are no particular restrictions on reducing agents so long as they are ones commonly used in organic synthesis, and as examples there may be mentioned contact hydrogenating catalysts such as NaBH4, LiBH4, Zn(BH4)2, Me4NBH (OAc) 3, NaBH3CN, Selectride, Super Hydride (LiBHEt3), LiAlH4, DIBAL, LiAlH (t-BuO)3, Red&amp;#1470;al and binap, as well as platinum, palladium, rhodium,

FP01 00 ruthenium, nickel, and the like.

After completion of the reaction, purification may be accomplished by any desired ordinary treatment method, such as column chromatography using silica gel or an adsorption resin, or recrystallization from a suitable solvent.

Throughout the present specification, the term pharmacologically acceptable salt is not particularly restrictive on the type of salt, and as examples of such salts there may be mentioned inorganic acid addition salts such as hydrochloric acid salts, sulfuric acid salts, carbonic acid salts, bicarnobate salts, hydrobromic acid salts and hydriodic acid salts; organic carboxylic acid addition salts such as acetic acid salts, maleic acid salts, lactic acid salts, tartaric acid salts and trifluoroacetic acid salts; organic sulfonic acid addition salts such as methanesulfonic acid salts, hydroxymethanesulfonic acid salts, hydroxyethanesulfonic acid salts, benzenesulfonic acid salts, toluenesulfonic acid salts and taurine salts; amine addition salts such as trimethylamine salts, triethylamine salts, pyridine salts, procaine salts, picoline salts, dicyclohexylamine salts, N,N'-dibenzylethylenediamine salts, N-methylglucamine salts, diethanolamine salts, triethanolamine salts, tris(hydroxymethylamino)methane

FP01 00 salts and phenethylbenzylamine salts; and amino acid addition salts such as arginine salts, lysine salts, serine salts, glycine salts, aspartic acid salts and glutamic acid salts.

The dosage of a medicine according to the invention will differ depending on the severity of symptoms, patient age, gender and weight, administration form and type of disease, but administration may usually be from 100 pg to 10 g per day for adults, either at once or in divided doses.

There are no particular restrictions on the form of administration of a medicine according to the invention, and it may usually be administered orally or parenterally by conventional methods.

Common excipients, binders, glossy agents, coloring agents, taste correctors and the like, and if necessary stabilizers, emulsifiers, absorption promoters, surfactants and the like, may also be used for formulation, with inclusion of components ordinarily used as starting materials for formulation of pharmaceutical preparations by common methods.

Examples of such components which may be used include animal and vegetable oils (soybean oil, beef tallow, synthetic glycerides, etc.), hydrocarbons (liquid paraffin, squalane, solid paraffin, etc.), ester oils (octyldodecyl myristate, isopropyl myristate,

FP01 00 etc.), higher alcohols (cetostearyl alcohol, behenyl alcohol, etc.), silicone resins, silicone oils, surfactants (polyoxyethylene fatty acid esters, sorbitan fatty acid esters, glycerin fatty acid esters, polyoxyethylenesorbitan fatty acid esters, polyoxyethylene hydrogenated castor oil, polyoxyethylenepolyoxypropylene block copolymer, etc.), water-soluble polymers (hydroxyethyl cellulose, polyacrylic acid, carboxyvinyl polymer, polyethyleneglycol, polyvinylpyrrolidone, methyl cellulose, etc.), alcohols (ethanol, isopropanol, etc.), polyhydric alcohols (glycerin, propyleneglycol, dipropyleneglycol, sorbitol, etc.), sugars (glucose, sucrose, etc.), inorganic powders (silicic anhydride, aluminium magnesium silicate, aluminium silicate, etc.), purified water and the like. For pH adjustment there may be used inorganic acids (hydrochloric acid, phosphoric acid, etc.), alkali metal salts of inorganic acids (sodium phosphate, etc.), inorganic bases (sodium hydroxide, etc.), organic acids (lower fatty acids, citric acid, lactic acid, etc.), alkali metal salts of organic acids (sodium citrate, sodium lactate, etc.), and organic bases (arginine, ethanolamine, etc.). If necessary, preservatives, antioxidants and the like may also be added.

The compounds of the invention exhibit powerful in

FP01 00 vitro inhibition of 1) invasive tube formation by vascular endothelial cells induced by a combination of angiogenic factors, 2) tube formation by vascular endothelial cells specifically induced by single angiogenic factors, and 3) receptor kinases for various angiogenic factors. Among these compound groups having such activity there were also found compounds that inhibit proliferation of cancer cells. Invasion and tube formation by endothelial cells are an important process in angiogenesis, and therefore compounds with inhibiting action against them exhibit angiogenesisinhibiting effects. In addition, angiogenesis in the body is known to depend not on a single angiogenic factor but rather on the additive and synergistic effect of multiple angiogenic factors ((1) Koolwijk P, van Erck MGM, de Vree WJA, Vermeer MA, Weich HA, Hane maaijer R, van Hinsbergh VWM. Cooperative effect of TNF-alpha, bFGF and VEGF on the formation of tubular structures of human microvascular endothelial cells in a fibrin matrix. Role of urokinase activity. J. Cell Biol. 1996, 132, ?1177-1188.; (2) Tallquist MD, Soriano P, Klinghoffer RA. Growth factor signaling pathways in vascular development. Oncogene 1999, 18, P7917-7932.) . Thus, the compounds of the invention which inhibit tube formation induced by multiple angiogenic factors produced by cancer cells and the like are expected to

FP01 00 exhibit powerful angiogenesis inhibition in vivo, and should be highly useful as angiogenesis inhibitors.

The biochemical activity of the compounds of the invention and their function and effect as medicines (angiogenesis-inhibiting activity, antitumor activity, etc.) may be evaluated by the methods described below.

The following is a list of abbreviations used in the pharmacological test examples described below. &lt;List of Abbreviations&gt; DNA: Deoxyribonucleic Acid VEGFR2: Vascular Endothelial Growth Factor Receptor 2 human placenta: human placenta Hepes: N-[2-Hydroxyethyl]piperazine-N'-[2-ethanesulfoni c acid] MgCl2: Magnesium chloride MnCl2: Manganese chloride Na3VO4: Sodium Orthovanadate (V) ATP: Adenosine 5'-Triphosphate EDTA: Ethylenediaminetetraacetic acid htrf: Homogenous Time-Resolved Fluorescence FGFR1: Fibroblast Growth Factor Receptor 1 PDGFRp: Platelet-Derived Growth Factor Receptor β HGFR: Hepatocyte Growth Factor Receptor EGFR: Epidermal Growth Factor Receptor Tris : Tris(hydroxymethyl) aminomethane NaCl: Sodium chloride

FP01 00

BSA: Bovine Serum Albumin

HRP: Horseradish peroxidase

EGTA: Ν,Ν,Ν',Ν'-Tetraacetic acid

SDS: Sodium Dodecyl Sulfate

NP-40: Nonidet P-40

PCR: Polymerase Chain Reaction

RT-PCR: Reverse Transcription-Polymerase Chain Reaction

RNA: Ribonucleic Acid cDNA: complementary DNA

0RNA: complementary RNA dNTP: dATP, dCTP, dGTP, dTTP

UTP: Uridine 5'-Triphosphate

CTP: Cytidine 5'-Triphosphate dATP: 2'-Deoxyadenosine 5'-Triphosphate dCTP: 2'-Deoxycytidine 5'-Triphosphate dGTP: 2'-Deoxyguanosine 5'-Triphosphate dUTP: 2'-Deoxyuridine 5'-Triphosphate

GAPDH: Glyceraldehyde 3-Phosphate Dehydrogenease

FBS: Fetal Bovine Serum

PBS: Phosphate Buffered Saline

MTT:(3-[4,5-Dimethlythiazol yl]-2,5-diphenyltetrazoli urn bromide; Thiazolyl blue

DMSO: Dimethyl Sulfoxide

PDGF: Platelet-Derived Growth Factor

EGF: Epidermal Growth Factor

FGF2: Fibroblast Growth Factor 2

FP01 00

VEGF: Vascular Endothelial Growth Factor

HGF: Hepatocyte Growth Factor TNF-a: Tumor Necrosis Factor alpha FCS: Fetal Bovine Serum (Fetal Calf Serum) EGM-2: Endothelial cell Growth Medium-2 Pharmacological Test Example 1: Inhibition against invasive tube formation by vascular endothelial cells in response to stimulation by angiogenic factor mixture Human Umbilical Vein Endothelial Cells (HUVECs) were isolated according to a reported method (Shinseikagaku Jikken Koza [New Biochemistry Experiment Lectures], Saibo Baiyo Gijutsu [Cell Culturing Techniques], p.197-202), and were cultured in a 5% CO2 incubator (37°C) using EGM-2 medium (purchased from Clonetics Corp.) until the cells reached confluency. After adding 0.4 ml of bovine fibrinogen (purchased from Sigma Co.) to the inner well of a Transwell culturing plate (purchased from Coster Inc.), it was hardened with 0.7 units/ml of thrombin (purchased from Sigma Co.). The HUVECs were recovered using trypsinEDTA and then suspended in human endothelial serum free medium basal growth medium (hereinafter abbreviated as SFM, purchased from GIBCO BRL), and 0.4 ml of the cell suspension (1.4 x 105 cells) was seeded onto the hardened fibrin gel and cultured for approximately 4 hours in a 5% CO2 incubator (37°C). After 4 hours,

FP01 00 there was added to the outer chamber of the Transwell

1.5 ml of an SFM solution containing a mixture of angiogenic factors {10 ng/ml EGF (purchased from GIBCO BRL), 30 ng/ml FGF2 (purchased from GIBCO BRL), 75 ng/ml VEGF (purchased from Wako Pure Chemical Industries Co., Ltd.), 50 ng/ml HGF (purchased from R&amp;D Co.) and 7.5 ng/ml TNF-a (purchased from Genzyme Corp.) [The concentrations of the angiogenic factors differed slightly according to the HUVEC lot.]} and a diluted test substance, and culturing was carried out in a 5% CO2 incubator (37°C) . On the 2nd and 4th days after adding the test substance, the medium was exchanged with 1.5 ml of freshly prepared SFM solution containing the angiogenic factor mixture and test substance. Upon aspirating off the culture supernatant in the inner well on the 6th day after the initial addition of the test substance, 0.4 ml of a 3.3 mg/ml MTT solution dissolved in PBS (purchased from Sigma Corp.) was added and culturing was performed for approximately 1 hour in a 5% CO2 incubator (37°C) . The number of tubes formed in the fibrin gel stained with MTT was scored based on microscope observation. Specifically, the number of tubes formed in the absence of the test substance was designated as +++, while - was assigned if absolutely no tubes formed. The number of tubes formed in the presence of the test substance was scored on the 5

FP01 00 level scale of +++, ++, +, +/-, - to evaluate the strength of inhibition of the test substance.

FP01 00

Table 1 [Pharmacological Test Example 1: Inhibition against invasive tube formation by vascular endothelial cells in response to stimulation by angiogenic factor mixture]

<td> Example No.</td><td> 0.01 μΜ</td><td> 0.1 μΜ</td><td> 1.0 μΜ</td>

<td> 25</td><td> ++</td><td> ־/ +</td><td> + /_</td>

<td> 53</td><td> ++ +</td><td> + /-</td><td> -</td>

<td> 55</td><td> +++</td><td> + /-</td><td> +/-</td>

<td> 72</td><td> +++</td><td> -</td><td> -</td>

<td> 74</td><td> ++</td><td> -</td><td> -</td>

<td> 75</td><td> +++</td><td> +/-</td><td> -</td>

<td> 81</td><td> ++</td><td> -</td><td> -</td>

<td> 100</td><td> ++</td><td> +/-</td><td> +/-</td>

<td> 153</td><td> ־/ +</td><td> -</td><td> -</td>

<td> 172</td><td> +</td><td> +/-</td><td> +/-</td>

<td> 189</td><td> + /-</td><td> -</td><td> -</td>

<td> 212</td><td> + /-</td><td> -</td><td> -</td>

<td> 245</td><td> + /-</td><td> -</td><td> -</td>

<td> 298</td><td> ־/ +</td><td> -</td><td> -</td>

<td> 316</td><td> ־/+</td><td> -</td><td> -</td>

<td> 348</td><td> ־/ +</td><td> -</td><td> -</td>

<td> 368</td><td> -</td><td> -</td><td> --</td>

<td> 374</td><td> +/-</td><td> -</td><td> -</td>

<td> 404</td><td> -</td><td> -</td><td> -</td>

<td> 415</td><td> +/-</td><td> -</td><td> -</td>

<td> 422</td><td> +</td><td> -</td><td> -</td>

Pharmacological Test Example 2: Inhibition against sandwich tube formation by vascular endothelial cells

FP01 00 in response to stimulation by angiogenic factor

Human Umbilical Vein Endothelial Cells (HUVECs) were isolated by the same method as in Pharmacological Test Example 1, and were cultured in a 5% CO2 incubator (37°C) using EGM-2 medium (purchased from Clonetics Corp.) until the cells reached confluency.

An ice-cooled mixture of collagen:5x RPMI

1640:reconstitution buffer (all purchased from Nitta Gelatin, Inc.) at 7:2:1 was dispensed at 0.4 ml into each well of a 24-well plate, and then stationed for 40 minutes in a 5% CO2 incubator (37°C) for gelling. The HUVECs were recovered using trypsin-EDTA and then suspended in human endothelial serum free medium (SFM, purchased from GIBCO BRL) containing added angiogenic factors [20 ng/ml FGF2 (purchased from GIBCO BRL) and 10 ng/ml EGF (purchased from GIBCO BRL), or 25 ng/ml VEGF (purchased from Wako Pure Chemical Industries Co., Ltd.) and 10 ng/ml EGF, or 30 ng/ml HGF (purchased from R&amp;D Co.) and 10 ng/ml EGF], and the cell suspension was added at 0.4 ml to each well (with the cell counts differing slightly according to the HUVEC lot), and cultured overnight in a 5% CO2 incubator (37°C) . On the following day, the medium on the upper layer was aspirated off, and then 0.4 ml of an ice-cooled mixture of collagen:5x RPMI 1640: reconstitution buffer (all purchased from Nitta Gelatin, Inc.) at 7:2:1 was

FP01 00 superposed into each well prior to stationing for 4 hours in a 5% CO2 incubator (37°C) for gelling. After adding 1.5 ml of an SFM solution containing each of the aforementioned angiogenic factors and a diluted test substance onto the upper layer, culturing was performed in a 5% CO2 incubator (37°C). Upon aspirating off the culture supernatant in each well on the 4th day after addition of the test substance, 0.4 ml of a 3.3 mg/ml MTT solution dissolved in PBS (purchased from Sigma Corp.) was added to each well and culturing was performed for approximately 2 hours in a 5% CO2 incubator (37°C). The tubes formed in the collagen gel of each well were stained by the MTT, the tube images were loaded into a computer (Macintosh), and the total length of the tubes was determined by image analysis software MacScope (purchased from Mitani Corp.). The ratio of the total length of the tubes formed in the well containing the test substance with respect to the total length of the tubes formed in the well containing no test substance was expressed as a percentage, and the concentration of each test substance required for 50% inhibition of tube formation (IC50) was determined from the ratio value.

FP01 00

Table 2 [Pharmacological Test Example 2: Inhibition against sandwich tube formation by vascular endothelial cells in response to stimulation by VEGF]

<td> Example No.</td><td> IC50 (ΠΜ)</td><td> Example No.</td><td> IC₅₀ (nM)</td>

<td> 1</td><td> 310</td><td> 12</td><td> 44</td>

<td> 19</td><td> 28</td><td> 23</td><td> 100</td>

<td> 53</td><td> 9.9</td><td> 55</td><td> 35</td>

<td> 59</td><td> 170</td><td> 65</td><td> 5.9</td>

<td> 70</td><td> 58</td><td> 72</td><td> 22</td>

<td> 74</td><td> 5.9</td><td> 75</td><td> 1.4</td>

<td> 81</td><td> 1.8</td><td> 100</td><td> 6.3</td>

<td> 108</td><td> 4.9</td><td> 116</td><td> 8.1</td>

<td> 121</td><td> 42</td><td> 127</td><td> 7.5</td>

<td> 129</td><td> 40</td><td> 137</td><td> 10</td>

<td> 153</td><td> 0.02</td><td> 155</td><td> 1.4</td>

<td> 157</td><td> 0.9</td><td> 159</td><td> 0.6</td>

<td> 186</td><td> 23</td><td> 189</td><td> 0.3</td>

<td> 198</td><td> 1.5</td><td> 202</td><td> 15</td>

<td> 204</td><td> 0.9</td><td> 211</td><td> 0.3</td>

<td> 215</td><td> 22</td><td> 224</td><td> 26</td>

<td> 249</td><td> 1.6</td><td> 253</td><td> 40</td>

<td> 256</td><td> 36</td><td> 265</td><td> 0.6</td>

<td> 266</td><td> 0.6</td><td> 283</td><td> 36</td>

<td> 289</td><td> 4.6</td><td> 296</td><td> 34</td>

<td> 298</td><td> 0.7</td><td> 299</td><td> 1.0</td>

FP01 00

Table 2 (continued)

<td> 300</td><td> 7.5</td><td> 304</td><td> 0.3</td>

<td> 308</td><td> 5.2</td><td> 314</td><td> 4.2</td>

<td> 316</td><td> 1.0</td><td> 320</td><td> 2.5</td>

<td> 325</td><td> 1.0</td><td> 326</td><td> 1.0</td>

<td> 327</td><td> 56</td><td> 346</td><td> 25</td>

<td> 368</td><td> 5.4</td><td> 372</td><td> 44</td>

<td> 374</td><td> 3.0</td><td> 381</td><td> 4.7</td>

<td> 382</td><td> 4.6</td><td> 386</td><td> 10</td>

<td> 404</td><td> 2.8</td><td> 405</td><td> 28</td>

<td> 408</td><td> 39</td><td> 415</td><td> 3.8</td>

<td> 419</td><td> 10</td><td> 422</td><td> 4.8</td>

<td> 433</td><td> 5.6</td><td> 436</td><td> 22</td>

<td> 440</td><td> 1.4</td><td> 441</td><td> 3.6</td>

<td> 442</td><td> 7.2</td><td> 444</td><td> 5.5</td>

<td> 445</td><td> 6.2</td><td> 446</td><td> 4.0</td>

<td> 450</td><td> 4.5</td><td> 454</td><td> 3.7</td>

<td> 455</td><td> 7.8</td><td> 463</td><td> 26</td>

<td> 490</td><td> 26</td><td> 492</td><td> 7.2</td>

<td> 493</td><td> 9.0</td><td> 494</td><td> 9.3</td>

<td> 497</td><td> 4.6</td><td> 503</td><td> 6.4</td>

<td> 504</td><td> 4.6</td><td> 505</td><td> 8.9</td>

<td> 518</td><td> 1.3</td><td> 520</td><td> 1.5</td>

<td> 521</td><td> 0.5</td><td> 578</td><td> 13</td>

FP01 00

Pharmacological Test Example 3: Measurement of inhibition against receptor tyrosine kinase activity This assay is used to determine inhibition of a test substance on tyrosine kinase activity. DNA coding for the cytoplasmic domain of VEGFR2 is obtained by total cDNA synthesis (Edwards M, International Biotechnology Lab 5(3), 19-25, 1987) or by cloning. Expression in an appropriate expression system can produce a polypeptide with tyrosine kinase activity. The cytoplasmic domain of VEGFR2 obtained by expression of recombinant protein in, for example, insect cells has been found to exhibit intrinsic tyrosine kinase activity. For VEGFR2 (Genbank Accession No. L04947), the 1.7 kb DNA fragment described by Terman et al. (Oncogene, 6(9), 1677-1683, 1991), coding for the cytoplasmic domain, beginning with lysine 791 and including the termination codon, was isolated from a human placental cDNA library (purchased from Clontech Laboratories, Inc.) and cloned in a Baculovirus expression vector (pFastBacHis, purchased from GIBCO BRL). The recombinant construct was transfected into insect cells (Spondoptea frugiperda9 (Sf9)) to prepare a recombinant Baculovirus. (Instructions for preparation and use of recombinant Baculovirus may be found in standard texts, such as Bac-To-Bac Baculovirus Expression System (GIBCO BRL).) The

FP01 00 cytoplasmic fragment starting from lysine 398 (FGFR1, Genbank Accession No. X52833), the cytoplasmic fragment starting from lysine 558 (PDGFRp, Genbank Accession No. M21616) or the cytoplasmic fragment starting from lysine 974 (HGFR, Genbank Accession No. J02958) may be cloned and expressed by the same method for use in assays for other tyrosine kinases. EGFR was purchased from Sigma Co. (Product No. E-2 645) .

For expression of the VEGFR2 tyrosine kinase, Sf9 cells were infected with the VEGFR2 recombinant virus and collected after 48 hours. The collected cells were rinsed with ice-cooled phosphate buffered saline (PBS) and then resuspended using 20 ml of ice-cooled Lysis Buffer (50 mM Tris-HCl (pH 8.5), 5 mM 2-mercaptoethanol, 100 mM KC1, 1 mM phenylmethylsulfonyl fluoride, 1% (v/v) NP-40) per 1.5 x 108 cells. The suspension was centrifuged at 12,000 rpm for 30 minutes at 4°C and the supernatant was obtained.

The supernatant was added to a Ni-NTA agarose column (3 ml, purchased from Qiagen) equilibrated with Buffer A {20 mM Tris-HCl (pH 8.5), 5 mM 2mercaptoethanol, 500 mM KC1, 20 mM imidazole, 10% (v/v) glycerol}. The column was washed with 30 ml of Buffer A, and then with 6 ml of Buffer B {20 mM Tris-HCl (pH 8.5), 5 mM 2-mercaptoethanol, IM KC1, 10% (v/v) glycerol}, and finally with 6 ml of Buffer A. After

FP01 00 washing, it was eluted with 6 ml of Buffer C {20 mM Tris-HCl (pH 8.5), 5 mM 2-mercaptoethanol, 100 mM KC1, 100 mM imidazole, 10% (v/v) glycerol}. The eluate was placed on a dialysis membrane (purchased from Spectrum Laboratories) and dialyzed with a dialysis buffer {20 mM Tris-HCl (pH 7.5), 10% (v/v) glycerol, 1 mM dithiothreitol, 0.1 mM Na3VO4, 0.1 mM EGTA}. After dialysis, it was supplied for SDS-electrophoresis, and the recombinant protein (His6-VEGFR2, cytoplasmic domain of VEGFR2 fused with 6 histidine residues at the N-terminus) detected at a molecular weight of approximately 100 kDa with Coumassie Brilliant Blue staining was assayed using BSA (bovine serum albumin, purchased from Sigma Co.) as the standard substance, and stored at -80°C until use. Using the same method for the cytoplasmic domains of FGFR1, PDGFR3 and HGFR yielded respective recombinant proteins fused with 6 histidine residues at the N-termini (His6-FGFR1, His6PDGFR3 or His6-HGFR).

The tyrosine kinase reaction was conducted as follows. In the case of VEGFR2, for example, 10 pl of a kinase reaction solution {200 mM Hepes (pH 7.4), 80 mM MgC12, 16 mM MnC12, 2 mM Na3VO4}, 250 ng of biotinbound poly(Glu4:Tyrl) (biotin-poly(GT), purchased from CIS Diagnostics Co.) (6 pl of a 15-fold dilution with distilled water), 15 ng of H1s6-VEGFR2 (10 pl of a 240

FP01 00 fold dilution with 0.4% BSA solution) and the test substance dissolved in dimethylsulfoxide (4 μ&amp;#912; of a 100-fold dilution with 0.1% BSA solution) were added into each well of a 96-well round-bottom plate (NUNC Co., Product No. 163320), to a total of 30 μ&amp;#912;. Next, 10 μ&amp;#912; of 4 μΜ ATP (diluted with distilled water) was added prior to incubation at 30°C for 10 minutes, and then 10 μ&amp;#912; of 500 mM EDTA (pH 8.0) was added.

The tyrosine phosphorylated biotin-poly(GT) was measured by the Homogenous Time-Resolved Fluorescence (HTRF) method (Analytical Biochemistry, 269, 94-104, 1999). Specifically, the kinase reaction solution was transferred to a 96-well black half-plate (Product No. 3694, Coster, Inc.), 7.5 ng of europium cryptatelabeled anti-phosphotyrosine antibody (Eu(K)-PY20, purchased from CIS Diagnostics Co.) (25 μ&amp;#912; of a 250fold dilution with 20 mM Hepes (pH 7.0), 0.5 M KF, 0.1% BSA solution) and 250 ng of XL665-labeled streptavidin (XL665-SA, purchased from CIS Diagnostics Co.) (25 μ&amp;#912; of a 62.5-fold dilution with 20 mM Hepes (pH 7.0), 0.5 M KF and 0.1% BSA solution) were added thereto, the mixture was allowed to stand at room temperature for 30 minutes, and then the fluorescent intensity was measured at 665 nm and 620 nm under irradiation with an excitation wavelength of 337 nm using a Discovery HTRF Microplate Analyzer (Packard Co.). The tyrosine

FP01 00 phosphorylation rate for the biotin-poly (GT) was expressed as the delta F% value as described in the HTRF Standard Experiment Methods text by CIS Diagnostics Co. The delta F% value in the presence of the test substance was determined as a ratio (%) with the delta F% value with addition of His6-VEGFR2 in the absence of the test substance defined as 100% and the delta F% value in the absence of both the test substance and His6-VEGFR2 defined as 0%. This ratio (%) was used to calculate the test substance concentration required for 50% inhibition of VEGFR2 kinase activity (IC50) .

Measurement of inhibition against FGFR1, EGFR and HGFR kinase activity was conducted using 15 ng of His6FGFR1, 23 ng of EGFR and 30 ng of His6-HGFR, respectively, according to the tyrosine kinase reaction and HTRF method described above.

Measurement of inhibition against PDGFR3 kinase activity was conducted using 50 ng of His6-PDGFRp according to the tyrosine kinase reaction described above, followed by detection of tyrosine phosphorylated biotin-poly(GT) by the following method.

Specifically, the kinase reaction solution was added to a 96-well streptavidin-coated plate (Product No. 15129, Pierce Chemical) and incubated at room temperature for 30 minutes. After rinsing 3 times with

FP01 00

150 μ&amp;#912; of a rinsing solution {20 mM Tris-HCl (pH 7.6), 137 mM NaCI, 0.05% Tween-20, 0.1% BSA}, 70 μ&amp;#912; of antiphosphotyrosine (PY20)-HRP conjugate (Product No. P11625, Transduction Laboratories) {2000-fold dilution with 20 mM Tris-HCl (pH 7.6), 137 mM NaCI, 0.05% Tween20, 1% BSA} was added thereto and incubation was performed at room temperature for 1 hour. After incubation, it was rinsed 3 times with 150 μ&amp;#912; of the rinsing solution, and 100 μ&amp;#912; of TMB Membrane Peroxidase Substrate (Product No. 50 03, Funakoshi Co., Ltd.) was added to initiate the reaction. After stationing at room temperature for 10 minutes, 100 μ&amp;#912; of 1 M phosphoric acid was added to suspend the reaction, and the absorbance at 450 nm was measured with a microplate reader (BIO KINETICS READER EL304, Bio-Tek Instruments). The absorbance ratio in the presence of the test substance was determined with respect to 100% as the absorbance with addition of His6-PDGFRP and no test substance, and 0% as the absorbance without addition of the test substance or His6-PDGFRp. This absorbance ratio was used to calculate the test substance concentration required for 50% inhibition of PDGFRp kinase activity (IC50) .

FP01 00

Table 3 [Pharmacological Test Example 3: Inhibition against VEGFR2 kinase]

<td> Example No.</td><td> IC₅₀ (nM)</td><td> Example No.</td><td> IC50 (nM)</td>

<td> 1</td><td> 51</td><td> 10</td><td> 4.9</td>

<td> 14</td><td> 2.7</td><td> 15</td><td> 8.7</td>

<td> 21</td><td> 4.3</td><td> 30</td><td> 22</td>

<td> 31</td><td> 17</td><td> 33</td><td> 6.9</td>

<td> 34</td><td> 3.4</td><td> 25</td><td> 5.5</td>

<td> 36</td><td> 14</td><td> 37</td><td> 22</td>

<td> 43</td><td> 18</td><td> 54</td><td> 15</td>

<td> 55</td><td> 29</td><td> 65</td><td> 15</td>

<td> 99</td><td> 8.6</td><td> 100</td><td> 9.6</td>

<td> 111</td><td> 21</td><td> 116</td><td> 4.2</td>

<td> 121</td><td> 8.7</td><td> 143</td><td> 70</td>

<td> 159</td><td> 25</td><td> 173</td><td> 356</td>

<td> 178</td><td> 12</td><td> 182</td><td> 71</td>

<td> 183</td><td> 29</td><td> 184</td><td> 59</td>

<td> 187</td><td> 14</td><td> 208</td><td> 9.2</td>

<td> 252</td><td> 31</td><td> 253</td><td> 23</td>

<td> 259</td><td> 16</td><td> 260</td><td> 11</td>

<td> 262</td><td> 9.5</td><td> 265</td><td> 6.2</td>

<td> 266</td><td> 5.4</td><td> 283</td><td> 26</td>

<td> 314</td><td> 5.3</td><td> 316</td><td> 6.4</td>

<td> 346</td><td> 4.6</td><td> 348</td><td> 4.6</td>

<td> 350</td><td> 43</td><td> 353</td><td> 2.2</td>

<td> 356</td><td> 1.4</td><td> 364</td><td> 8.1</td>

<td> 365</td><td> 5.4</td><td> 368</td><td> 3.0</td>

<td> 374</td><td> 8.4</td><td> 375</td><td> 16</td>

<td> 381</td><td> 2.6</td><td> 382</td><td> 9.0</td>

<td> 387</td><td> 4.1</td><td> 394</td><td> 15</td>

<td> 398</td><td> 3.5</td><td> 404</td><td> 6.5</td>

<td> 410</td><td> 2.2</td><td> 413</td><td> 3.2</td>

<td> 435</td><td> 22</td><td> 437</td><td> 9.9</td>

<td> 441</td><td> 2.8</td><td> 449</td><td> 2.2</td>

<td> 463</td><td> 5.9</td><td> 465</td><td> 13</td>

<td> 556</td><td> 14</td><td></td><td></td>

FP01 00

Pharmacological Test Example 4: Inhibition on cancer cell and normal cell growth

Cancer cells (for example, KP-4 human pancreatic cancer cells) or normal cells (for example, IEC-18 rat ileal epithelial cells) were subcultured in RPMI 1640 medium containing 10% FBS (purchased from Nissui Pharmaceutical Co., Ltd.) every 3-4 days, and cells in the growth phase were used. After recovering the cells using trypsin-EDTA, the cells were counted and a 0.1 ml cell suspension of each diluted with 10% FBS-containing RPMI 1640 medium (to 2 x 103 cells/well for KP-4 and 8 x 102 cells/well for IEC18) was spread onto a 96-well plate for cell culturing. Culturing was performed overnight in a 5% CO2 incubator (37°C) , and then a 0.1 ml solution of the test substance diluted with 10% FBScontaining RPMI 1640 was added and culturing was continued in a 5% CO2 incubator (37°C). On the 3rd day after addition of the test substance, 0.05 ml of a 3.3 mg/ml MTT solution (purchased from Sigma Co.) was added, and culturing was continued in the 5% CO2 incubator (37°C) for approximately 2 hours. After aspirating off of the culture supernatant and DMSO dissolution of the formazan produced in each well, the absorbance of each well was measured using an MTP-32 plate reader (Corona Electric) at a measuring wavelength of 540 nm and a

FP01 00 reference wavelength of 660 nm. The absorbance ratio in the substance-added well was determined as a percentage with respect to the absorbance of the well without addition of the test substance, and this ratio was used to calculate the test substance concentration required for 50% inhibition of cell growth (IC50) . Pharmacological Test Example 5; Effect of L6 (Rat myoblasts) on PDGF-dependent growth

L6 (rat myloblasts) were subcultured in 10% FBScontaining D-MEM medium (purchased from Nissui Pharmaceutical Co., Ltd.) every 3-4 days, and cells in the growth phase were used. The cells were recovered using trypsin-EDTA and rinsed once with 10% FBS-free DMEM medium, and the cells were counted. After spreading 0.1 ml of a cell suspension diluted with 10% FBS-free D-MEM medium onto a Type I collagen-coated 96well tissue culturing plate at 5 x 103 cells/well, culturing was performed overnight in a 5% CO2 incubator (37°C) . On the following day, 0.05 ml of a solution of the test substance diluted with 10% FBS-free D-MEM medium was added, with almost simultaneous addition of 0.05 ml of a 40 nM PDGF solution (10 nM final concentration), and culturing was continued in the 5% CO2 incubator (37°C) . On the 3rd day after addition of the test substance, 0.01 ml of WST-1 solution (purchased from Wako Pure Chemical Industries Co.,

FP01 00

Ltd.) was added to each well, and culturing was continued in the 5% CO2 incubator (37°C) for approximately 3 hours until coloration. The absorbance of each well was measured using an MTP-32 plate reader (Corona Electric) at a measuring wavelength of 415 nm and a reference wavelength of 660 nm. The absorbance ratio in the substance-added well was determined as a percentage with respect to the absorbance of the well without addition of the test substance, and this ratio was used to calculate the test substance concentration required for 50% inhibition of cell growth (IC50) . Pharmacological Test Example 6: Analysis of mRNA expression by DNA microarray/quantitative PCR

1. Extraction of total RNA from sample

The cells were cultured at 37°C either in 5% CO2 or under low (1%) oxygen conditions. In the case of HUVEC, for example, EGM-2 medium (purchased from Clonetics Corp.) was used for culturing at 37°C under 5% CO2 conditions. At a prescribed time after reaction with the test substance, the cells were lysed using TRIZOL reagent (purchased from GIBCO BRL) according to the manufacturer's protocol. Specifically, it was accomplished as follows. A 1 ml portion of TRIZOL reagent is added per 10 cm2 culturing area, and pipetting is carried out several times to collect the cells. After centrifuging the sample, the obtained

FP01 00 supernatant is allowed to stand at room temperature for 5 minutes, and then chloroform (purchased from Junsei Chemical Co., Ltd.) is added in a proportion of 0.2 ml with respect to 1 ml of TRIZOL reagent used. The solution is vigorously shaken and stirred for 15 seconds and allowed to stand at room temperature for 23 minutes, and then centrifuged (12,000 x g, 10 min, 4°C). After centrifugation, the aqueous layer is transferred to a fresh tube, isopropyl alcohol | (purchased from Wako Pure Chemical Industries Co., Ltd.) is added in a proportion of 0.5 ml to 1 ml of TRIZOL reagent used, and the mixture is allowed to stand at room temperature for 10 minutes and then centrifuged (12,000 x g, 10 min, 4°C). The obtained precipitate is rinsed with 75% ethanol (purchased from Wako Pure Chemical Industries Co., Ltd.) and then airdried and supplied as total mRNA for the following procedure.

2. Quantitation of RNA

The RNA may be quantitated by techniques such as Northern blotting analysis, DNA microarray, RT-PCR, quantitative PCR and the like, with DNA microarray and quantitative PCR being preferred. Explanations of these techniques are provided below, but are not intended to be limitative on the invention.

1) Quantitation with a DNA microarray (Schena M.

FP01 00 et al., Science, 270 (5235), 467-70, 1995 and Lockhart, D.J. et al., Nature Biotechnology, 14 (13), 1675-1680, 1996) is carried out in the following manner.

, [1] cDNA synthesis and biotin labeling

The initially obtained RNA was used as template to synthesize double-stranded cDNA with a Superscript Choice System (purchased from GIBCO BRL) and T7-d(T)24 primer, and then this cDNA was used as template for synthesis of biotinylated cRNA.

Specifically, 5 pg T7-d(T)24 primer, 1 x first strand buffer, 10 mM DTT, 500 pM dNTP mix and 20 unit/pl Superscript II Reverse Transcriptase were added to 10 pg of RNA, and reaction was conducted at 42°C for 1 hour to synthesize single-stranded cDNA. Next, 1 x second strand buffer, 200 pM dNTP mix, 67 U/ml DNA ligase, 270 U/ml DNA polymerase I and 13 U/ml RNaseH were added and reaction was conducted at 16°C for 2 hours to synthesize double-stranded cDNA. Finally, 67 U/ml T4 DNA polymerase I was added for reaction at 16°C for 5 minutes, after which 10 pl of 0.5 M EDTA (purchased from Sigma Co.) was added to suspend the reaction.

The obtained cDNA was purified with phenol/chloroform (purchased from Ambion, Inc.), and an RNA Transcript Labeling Kit (purchased from Enzo Diagnostics, Inc.) was used for labeling with

FP01 00 biotinylated UTP and CTP according to the manufacturer's protocol. The reaction product was purified with an RNeasy column (purchased from Qiagen), and then heating was performed for 35 minutes at 94°C in 200 mM Tris acetate (pH 8.1), 150 mM magnesium acetate and 50 mM potassium acetate, for fragmentation of the cRNA.

[2] DNA microarray (GeneChip) hybridization and measurement

The fragmented cRNA is hybridized with a GeneChip (purchased from Affymetrix Corp.) Hu6800/Human Cancer G110 Array or an equivalent product, in 100 mM MES, IM sodium salt, 20 mM EDTA, 0.01% Tween20, for example, at 45°C for 16 hours. After hybridization, the GeneChip is rinsed and dyed according to protocol EukGE-WS2 included with the Affymetrix fluidics station or the optimum protocol for the array used. The dyeing is carried out using streptavidin-phycoerythrin (purchased from Molecular Probe) and biotinylated antistreptavidin goat antibody (purchased from Vector Laboratories). The dyed GeneChip is scanned using an HP argon-ion laser confocal microscope (purchased from Hewlett Packard Co.), and the fluorescent intensity is measured. The fluorescence was measured with excitation at 488 nm and emission at 570 nm.

All of the quantitative data analysis was carried

FP01 00 out using GeneChip software (purchased from Affymetrix Corp.) or Genespring (purchased from Silicon Genetics). For RNA quantitation, the average of the difference (perfect match hybridization signal - mismatch signal) is determined for each probe family, and the gene expression is judged as having significantly increased or decreased if the value is 5 or greater and the RNA quantities are disparate under 2 conditions, and preferably if they are disparate by a factor of 1.8 or greater.

2) Quantitation by quantitative PCR is conducted in the following manner.

Quantitative PCR is accomplished in the following manner using SYBR Green (purchased from Applied Biosystems) and an ABI Prism 7700 Sequence Detection System (purchased from Perkin-Elmer Applied Biosystems) or an equivalent apparatus.

The procedure is carried out by the two stages of reverse transcription and PCR reaction. In the reverse transcription of the first stage, dNTP, oligo d(T)!6 primer, RNase Inhibitor and Multiscribe Reverse Transcriptase (purchased from Perkin-Elmer Applied Biosystems) are added to the obtained RNA, the temperature is kept at 25°C for 10 minutes, and then heating is effected at 48°C for 30 minutes. The reaction is suspended by heating at 95°C for 5 minutes.

FP01 00

The obtained cDNA is then supplied to the PCR reaction of the second stage. The PCR reaction is carried out in a reaction system comprising, for example, 4 ng cDNA, 1 χ SYBR PCR buffer, 3 mM MgC12, 200 μΜ each dATP, dCTP and dGTP, 400 μΜ dUTP, 200 nM primer pair, 0.01 U/μΙ AmpErase UNG and 0.025 U/μΙ Ampli Taq Gold DNA Polymerase (purchased from PerkinElmer Applied Biosystems). The reaction was conducted under conditions with 50°C for 2 minutes and 95°C for 10 minutes followed by 40 cycles of 95°C for 20 seconds, 55°C for 20 seconds and 72°C for 30 seconds. The primers and probes are designed using Primer Expression (purchased from Perkin-Elmer Applied Biosystems) or equivalent software. The different test substances are compared while compensating the quantitative values based on the mRNA level of a housekeeping gene having low transcription level fluctuation, preferably GAPDH, in each specimen. Pharmacological Test Example 7: Evaluation of in vivo angiogenesis-inducing activity using mouse dorsal air sac model

[1] Construction of VEGF (Vascular Endothelial Growth Factor) expression vector

PCR was conducted using a human placenta cDNA library (purchased from Toyobo Co., Ltd.) as the template and the VEGF sequences

FP01 00 &amp;#1523; CCGGATCCATGAACTTTCTGCTG3 &amp;#1523; and

5&amp;#1523;GTGAATTCTGTATCGATCGTT3&amp;#1523; as primers. After completion of the PCR reaction, the 5' ends were phosphorylated and an approximately 600 bp DNA band was separated by 1.2% agarose gel electrophoresis. After polymerization by self-ligation, the cDNA was cut with EcoRI and BamHI and inserted into the EcoRI and BamHI sites of vector pUC19. This was used to transform E. coli JM83, and plasmids were recovered from the transformed clones. A VEGF cDNA fragment was cut out of the plasmids with Hindlll and EcoRI and then inserted into an expression vector containing the neomycin resistance gene.

[2] Preparation of VEGF high-expressing strain

After overnight culturing of KP-1 human pancreatic cancer cells (3 x 106 cells) with 10% FCS-containing RPMI 1640 medium, an Effectene Transfection Reagent Kit (purchased from Qiagen) was used for introduction of 3 pg of VEGF expression vector into the KP-1 cells.

After culturing in 10% FCS-containing RPMI 1640 medium also containing 600 pg/ml of Geneticin, the highexpressing drug-resistant cells were selected as VEGF high-expressing KP-1 cells (KP-l/VEGF).

[3] Measurement of VEGF level in culture supernatant

The KP-l/VEGF cells were prepared to 5 x 105 cells/ml, and 0.5 ml thereof was dispensed into each

FP01 00 well of a 24-well plate and cultured at 37°C for 24 hours. The culture supernatants were collected and the VEGF levels thereof measured using a VEGF measuring kit (purchased from IBL Co., Ltd.) for confirmation of high expression.

[4.] Evaluation of in vivo angiogenesis-inducing activity using mouse dorsal air sac model

Millipore rings (purchased from Nihon Millipore) were sealed with 0.45 pm Durapore™ filter membranes (purchased from Nihon Millipore) to create chambers. KP-l/VEGF human pancreatic cancer cells (3 x 105) suspended in 0.17 ml of collagen gel were injected into each chamber through the injection port, and the chambers were sealed. Approximately 10 ml of air was then injected in the dorsal skin of 6-week-old C57BL/6N female mice under anesthesia to produce pouches, and the prepared chambers were transplanted therein. About 6 hours after completing transplantation, a test substance suspended in 0.5% methyl cellulose was orally administered (0.1 ml/10 g body weight), and this was continued once a day for the next 4 days.

On the 4th day after transplanting the chambers, 0.2 ml of 51Or (Amersham Pharmacia)-labeled mouse erythrocytes (2.5 x 106 cpm/ml) were injected through the caudal veins of each of the mice with the transplanted chambers. After a prescribed period, the

FP01 00 skin in contact with the chamber was excised and frozen, the section in direct contact with the chamber was precisely cut off, and the radioactivity was measured with a γ-counter. The blood volume was calculated from the radioactivity and used as an index of the in vivo angiogenesis-inducing activity. The angiogenesis volume was recorded as this measured blood volume minus the blood volume obtained with transplantation of a chamber containing only collagen gel. The experiment was conducted using 10 mice in the control (solventadministered) group and 5 mice in each compoundadministered group.

Pharmacological Test Example 8: Evaluation of antitumor activity on KP-l/VEGF cells in subcutaneous xenograft models

VEGF high-expressing pancreatic cancer cells (KP1/VEGF) suspended in PBS at a concentration of 1 χ 107 cells/ml were transplanted under the right flank skin of 6-week-old female Balb/c (nu/nu) mice in a volume of 0.1 ml. When the tumor volume reached approximately 100 mm3, the test substance was orally administered over a period of 2 weeks with a schedule of 5 days per week. The test substance was suspended in 0.5% methyl cellulose for an administered volume of 0.1 ml/10 g body weight. The tumor size was measured twice a week using a micrometer caliper. The tumor volume was

FP01 00 determined by measuring the long and short diameters of the tumor with a micrometer caliper, and calculating 1/2 x (long diameter x short diameter x short diameter). The experiment was conducted using 10 mice in the control (solvent-administered) group and 5 mice in each test substance-administered group.

Pharmacological Test Example 9: Evaluation of tumor growth, cancerous ascites accumulation and survival period in orthotopic transplantation models of pancreatic cancer

After abdominal section of 6- to 7-week-old female Balb/c (nu/nu) mice under anesthesia and exposure of the pancreases, VEGF high-expressing pancreatic cancer cells (KP-l/VEGF) suspended in PBS at a concentration of 1 x 107 cells/ml were directly transplanted into each pancreas head at a volume of 0.1 ml. Upon the 4th week after transplantation, the test substance was orally administered over a period of 10 weeks with a schedule of 5 days per week. The test substance was suspended in 0.5% methyl cellulose for an administered volume of 0.1 ml/10 g body weight. Body weight was periodically measured twice per week during the test period, and the presence of ascites accumulation was recorded based on appearance. The survival period was based on tabulating the number of mice which died up until completion of the experiment. Tumor weight was

FP01 00 measured in individuals suitable for postmortem autopsy. The experiment was conducted using 8 to 10 mice per group.

Industrial Applicability

According to the present invention, it is possible to provide novel compounds that exhibit (1) powerful inhibiting action against invasive tube formation by vascular endothelial cells induced by an angiogenic factor mixture comprising Epidermal Growth Factor (EGF)/VEGF/Fibroblast Growth Factor 2 (FGF2)/Hepatocyte Growth Factor (HGF)/Tumor Necrosis Factor alpha (TNF-a), (2) powerful inhibiting action against tube formation by vascular endothelial cells specifically induced by single angiogenic factors (for example, VEGF, FGF, HGF and other such factors), and 3) powerful inhibiting action against receptor kinases for various angiogenic factors. It is further possible to provide novel compounds which are highly useful as medicines.

Among the group of compounds with the action of (1) to (3) described above there may also be provided a group of compounds with tumor cell growth-inhibiting action.

Incidentally, angiogenesis in the body is known to depend not on a single angiogenic factor but rather on the additive and synergistic effect of multiple angiogenic factors ((1) Koolwijk P, van Erck MGM, de

FP01 00

Vree WJA, Vermeer MA, Welch HA, Hane maaijer R, van Hinsbergh VWM. Cooperative effect of TNF-alpha, bFGF and VEGF on the formation of tubular structures of human microvascular endothelial cells in a fibrin matrix. Role of urokinase activity. J. Cell Biol. 1996, 132, P1177-1188.; (2) Tallquist MD, Soriano P, Klinghoffer RA. Growth factor signaling pathways in vascular development. Oncogene 1999, 18, P7917-7 932 .) .

Thus, the compounds of the invention which inhibit tube formation induced by multiple angiogenic factors produced by cancer cells and the like are expected to exhibit powerful angiogenesis inhibition in vivo, and should be highly useful as angiogenesis inhibitors. Moreover, the compounds of the invention may be useful as prophylactic or therapeutic agents for diseases for which angiogenesis inhibition is effective, and specifically as angiogenesis inhibitors, antitumor agents, angioma treatment agents, cancer metastasis inhibitors, retinal neovascularization treatment agents, diabetic retinopathy treatment agents, general inflammatory disease treatment agents, inflammatory disease treatment agents for deformant arthritis, rheumatoid arthritis, psoriasis, delayed hypersensitivity reaction and the like, or atherosclerosis treatment agents, and particularly as antitumor agents, based on their angiogenesis

FP01 00 inhibition.

(Examples)

The present invention will now be explained in further and more concrete detail through the following examples, with the implied understanding that these examples are in no way limitative on the invention. [Production Examples] Production Example 1 2-(3-Chloropropyl)-1,2,3-triazole (Production Example 1-A) 1-(3-Chlorcpropyl)-1,2,3-triazole (Production Example 1-B)

A suspension of sodium hydride (1.55 g, 30.8301 mmol, 60% in oil) in hexane was allowed to stand, and after removing the supernatant, dimethylformamide (25 ml) was added thereto to form a suspension and 1H-

1,2,3-triazole (1.5 ml, 25.8867 mmol) was added dropwise while cooling on ice. This was stirred at room temperature for 5 minutes to thorough dissolution, and then l-bromo chloropropane (2.82 ml, 28.4754 mmol) was added and the mixture was stirred at room temperature for 8 hours. After adding water while cooling on ice, the mixture was extracted with diethyl ether and then with ethyl acetate, washed with saturated brine and dried over anhydrous magnesium sulfate, the solvent was distilled off under reduced

FP01 00 pressure, and the isomers were separated by NH silica gel column chromatography (hexane-ethyl acetate) and purified to obtain low polarity 2-(3-chloropropyl)-

1,2,3-triazole (0.429 g, 2.9466 mmol, 11.38%) and high polarity 1-(3-chloropropyl)-1,2,3-triazole (0.910 g, 6.2504 mmol, 24.15%) as colorless oils.

2-(3-chloropropyl)-1,2,3-triazole (Production Example 1-A) 1H-NMR Spectrum (CDC13) δ(ppm) : 2.42 (2H, tt, J = 6.4 Hz, 6.4 Hz), 3.54 (2H, t, J = 6.4 Hz), 4.64 (2H, t, J = 6.4 Hz), 7.61 (2H, s).

1-(3-chloropropyl)-1,2,3-triazole (Production Example 1-B) 1H-NMR Spectrum (CDC13) δ(ppm) : 2.41 (2H, m), 3.52 (2H, d, J = 6.0 Hz), 4.60 (2H, d, J = 6.4 Hz), 7.61 (1H, d, J = 0.8 Hz), 7.72 (1H, d, J = 0.8 Hz).

Production Example 2 l-Chloro (4-pyridyl)propane

3-(4-Pyridyl) propanol (2.68 g, 19.3724 mmol) was dissolved in dichloromethane (100 ml), triphenylphosphine (5.6 g. 21.3096 mmol) was added, and then N-chlorosuccinimide (2.6 g, 19.3724 mmol) was gradually added while cooling on ice prior to stirring overnight. After distilling off the solvent under reduced pressure, the residue was dissolved in ethyl acetate and extracted with IN hydrochloric acid. Upon

FP01 00 neutralization with saturated sodium bicarnobate water, the mixture was extracted with ethyl acetate, washed with saturated brine and dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure to obtain the title compound (2,375 g, 15.2605 mmol, 78.77%) as a yellowish-brown oil. This was used without further purification for the following reaction.

1H-NMR Spectrum (CDC13) δ(ppm) : 2.11 (2H, m), 2.80 (2H, t, J = 7.6 Hz), 3.54 (2H, t, J =6.4 Hz), 7.14 (2H, dd, J = 1.6 Hz, 4.4 Hz), 8.52 (2H, dd, J = 1.6 Hz, 4.4 Hz) .

Production Example 3

4-Amino fluorophenol

3-Fluoro nitrophenol (5.0 g, 31.83 mmol) was dissolved in ethyl acetate (50 ml) and tetrahydrofuran (75 ml), and then palladium carbon (2.0 g) was added and the mixture was stirred for 8.5 hours at room temperature under a hydrogen atmosphere. The catalyst was filtered off, the filtrate was washed with ethanol, the solvent was distilled off under reduced pressure and the obtained crystals were washed with addition of hexane:ethanol = 1:1. The crystals were filtered out, washed with diethyl ether and dried by aspiration to obtain the title compound (1.62 g, 12.74 mmol, 40.61%) as light yellow crystals.

FP01 00 1H-NMR Spectrum (DMSO-d5) δ(ppm) : 4.35 (1H, brs),

6.32 (1H, dd, J = 2.4 Hz, 8.4 Hz), 6.39-6.45 (1H, m) , 6.57 (1H, dd, J = 8.4 Hz, 10.4 Hz). Production Example 4 N-(2,4-Difluorophenyl)-N'-(2-fluoro-4hydroxyphenyl) urea

4-Amino fluoronitrophenol (500 mg, 3.9333 mmol) was dissolved in tetrahydrofuran (15 ml), 2,4-difluoro isocyanate (0.56 ml, 4.7199 mmol) was added dropwise, and the mixture was heated to reflux for 1 hour under a nitrogen atmosphere. After allowing the mixture to cool, the solvent was distilled off under reduced pressure, and the obtained crystals were washed with addition of hexane:ethanol = 1:1. The crystals were filtered out, washed with hexane:ethanol = 1:1 and dried by aspiration to obtain the title compound (960 mg, 3.4016 mmol, 86.48%) as light violet crystals. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 6.54 (1H, m), 6.60 (1H, ddd, J = 2.4 Hz, 2.4 Hz, 8.8 Hz), 7.00 (1H, m),

7.27 (1H, ddd, J = 2.8 Hz, 9.0 Hz, 11.6 Hz), 7.69 (1H,

m), 8.07 (1H, ddd, J = 6.0 Hz, 9.0 Hz, 9.0 Hz), 8.53 (1H, s), 8.72 (1H, s), 9.56 (1H, s). Production Example 5

7-Benzyloxy cyano (4-nitrophenoxy)quinoline

To the 7-benzyloxy chloro cyanoquinoline (2.60 g, 8.83 mmol) described in W098/13350 there were added

FP01 00

4-nitrophenol (2.46 g, 17.&amp;#1512; mmol) and lutidine (2.06 ml, 17.7 mmol), and the mixture was heated and stirred at 155-158°C for 2 hours. After returning the reaction system to room temperature, it was dissolved in tetrahydrofuran, saturated sodium bicarnobate water was added and stirred therewith for 10 minutes, the mixture was concentrated under reduced pressure, the precipitated solid was filtered out and subjected to silica gel column chromatography (Fuji Silysia NH Type, eluent - hexane:ethyl acetate = 50:50 -» ethyl acetate alone), the fraction containing the target substance was concentrated and the obtained solid was washed with diethyl ether. It was then dried under reduced pressure to obtain the title compound (1.84 g, 4.63 mmol, 52.6%).

1H-NMR Spectrum (DMSO-dg) δ (ppm) : 5.48 (2H, s) , 6.89 (1H, d, J=6.1Hz), 7.30-7.60 (8H, m), 7.78 (1H, s), 8.36-8.41 (2H, m), 8.80 (1H, s), 8.85 (1H, d, J=6.1Hz).

Production Example 6

4-(4-Aminophenoxy) (benzyloxy) cyanoquinoline

Iron powder (0.6 g), ammonium chloride (1.4 g), ethanol (100 ml) and water (30 ml) were added to the 7benzyloxy cyano (4-nitrophenoxy)quinoline obtained in Production Example 5,. and the mixture was stirred at 90°C for 2.5 hours. The reaction system was returned to room temperature and then filtered with celite, the

FPO1 — 4 0 21 — 0 0 filtrate was subjected to liquid separation, and the organic layer was washed with water and saturated brine in that order, dried over sodium sulfate and then concentrated to dryness under reduced pressure to obtain 1.31 g of a crude product containing the target substance. The crude product was used directly for the following reaction. (Production Example 7).

1H-NMR Spectrum(CDC13) 6(ppm):3.75 (2H, br), 5.35 (2H, s), 6.46 (1H, d, J=5.2Hz), 6.752) 6.78&amp;#1470;H, m), 6.94-6.97 (2H, m), 7.35 (1H, d, J=7.6Hz), 7.42 (2H, t, J=6.8Hz), 7.50-7.55 (3H, m), 8.63 (1H, d, J=5.2Hz), 8.72 (1H, s). Production Example 7

7-Benzyloxy cyano-4nitrophenoxy)quinoline

The 7-benzyloxy chloro cyanoquinoline (8.82 g, 30.0 mmol) described in WO98/13350 was suspended in 1methylpyrrolidone (30 ml), and then 3-fluoro-4nitrophenol (5.18 g, 33.0 mmol) and N,Ndiisopropylethylamine (3.88 g, 30.0 mmol) were added and the mixture was heated and stirred at 110°C for 4 hours. After returning the reaction system to room temperature, water was added and a solid precipitated. The obtained solid was filtered out, washed with water, methanol and ethyl acetate and dried at 60°C to obtain the title compound (4,98 g, 12.0 mmol, 40%) as colorless crystals.

FP01 00 1H-NMR Spectrum(CDC13) δ(ppm) : 5,37 (2H, s), 6.73 (1H, d, J = 5.2 Hz), 7.07-7.13 (2H, m) , 7.33-7.45 (3H, m) , 7.50-7.56 (2H, m), 7.60 (1H, s), 8.21-8.27 (1H, m) ,

8.55 (1H, s) , 8.83 (1H, d, J = 5.2 Hz). Production Example 8

7-Benzyloxy cyano-4aminophenoxy)quinoline

The 7-benzyloxy cyano (3-fluoro-4nitrophenoxy)quinoline (5.30 g, 12.8 mmol) obtained in Production Example 7, iron (3.57 g, 64.0 mmol) and ammonium chloride (6.85 g, 128 mmol) were suspended in an ethanol (120 ml)-water (30 ml) mixed solvent, and the suspension was heated and stirred at 100°C for 3 hours. After completion of the reaction, the reaction mixture was filtered with celite and washed in an ethyl acetate (500 ml)-Ν,Ν-dimethylformamide DMF (50 ml) mixed solvent. The organic layer was washed with water and saturated brine, dried over magnesium sulfate and concentrated. The obtained solid was recrystallized from an ethyl acetate-hexane mixed solvent and then dried to obtain the title compound (2.53 g, 6.56 mmol, 51%) as light brown crystals. 1H-NMR Spectrum (CDC13) δ(ppm) :3.80 (2H, brs), 5.35 (2H, s), 6.48 (1H, d, J = 5.3 Hz), 6.78-6.90 (3H, m), 7.32-7.44 (3H, m), 7.51 (1H, s), 7.52-7.56 (2H, m) , 8.66 (1H, d, J = 5.3 Hz), 8.69 (1H, s) .

FP01 00

Production Example 9

6-Cyano (2-methoxyethoxy) (4-nitrophenoxy)quinoline

A mixture of 4-chloro 7- (2methoxyethoxy)quinoline (3 g), 4-nitrophenol (3.17 g) and 2,6-lutidine (2.7 ml) was heated and stirred in an oil bath at 155°C for 1.5 hours. After completion of the reaction, ethyl acetate was added, and the precipitated solid was filtered out. The solid was washed with IN sodium hydroxide water and then with water and dried to obtain 1.8 g of the title compound. 1H-NMR (DMSO&amp;#1470;d6) δ (ppm) : 3.36 (3H, s), 3.76-3.79 (2H, m) , 4.41-4.44 (2H, m) , 6.85 (1H, d, J= 5.2 Hz), 7.54 (2H, d, J= 9.2 Hz), 7.68 (1H, s), 8.37 (2H, d, J9.2 &amp;#1470; HZ), 8.74 (1H, s), 8.83(1H, d, J= 5.2 Hz). Production Example 10

4-(4-Aminophenoxy) cyano (2-methoxyethoxy)quinoline

6-Cyano (2-methoxyethoxy) (4nitrophenoxy)quinoline (1.8 g), iron (1.8 g) and ammonium chloride (3.6 g) were suspended in an ethanol (30 ml)-water (7 ml) mixed solvent and the suspension was heated and stirred at 80°C for 2 hours. After completion of the reaction, the reaction mixture was filtered with celite and washed in ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate and concentrated. The obtained solid was washed with ether and dried to obtain 1.2 g

FP01 00 of the title compound.

1H-NMR (DMSO-d6) δ(ppm): 3.36 (3H, s), 3.75-3.78 (2H, m), 4.38-4.41 (2H, m), 5.19 (2H, brd) , 6.45 (IH, d, J= 5.2 Hz), 6.65 (2H, d, J= 8.8 Hz), 6.93 (2H, d, J- 8.8 Hz), 7.59 (IH, s), 8.68 (IH, d, J= 5.2 HZ), 8.71 (IH, s). Production Example 11 6-Cyano (3-fluoro nitrophenoxy) (2methoxyethoxy)quinoline

4-Chloro cyano (2-methoxyethoxy)quinoline (1.7 g) and 3-fluoro nitrophenol (2.0 g) were suspended in chlorobenzene (20 ml), and the suspension was heated to reflux for 6 hours. After completion of the reaction, the solvent was distilled off, ethyl acetate was added, and a solid precipitated. The solid was filtered out and washed with ether, washed with IN sodium hydroxide water and with water, and then dried to obtain 1.55 g of the title compound.

1H-NMR (DMSO-d6) δ (ppm) : 3.38 (3H, s) , 3.78-3.81 (2H, m) , 4.44-4.47 (2H, m), 7.02 (IH, d, J= 5.2 Hz), 7.337.37&amp;#1470; (IH, m), 7.69 (IH, dd, J=2.8 Hz, J=12 Hz), 7.72 (IH, s) ,

8.33 (IH, t, J= 8.8 HZ), 8.75 (IH, s) , 8.88 (IH, d, J=

5.2 Hz) .

Production Example 12

4-(4-Amino fluorophenoxy) cyano (2methoxyethoxy)quinoline

The title compound (1.23 g) was obtained from the

FP01 00 nitro compound (1.55 g) obtained in Production Example 11, in the same manner as Production Example 10.

1H-NMR (DMSO-d6) δ (ppm): 3.38 (3H, s), 3.78-3.81 (2H, m) , 4.42-4.44 (2H, m), 5.25-5.27 (2H, brd), 6.54 (1H, d, J=

5.2 Hz), 6.87-6.89 (2H, m), 7.10-7.14 (1H, m), 7.62 (1H, s), 8.72 (1H, d, J= 5.2 HZ), 8.74 (1H, s). Production Example 13 6-Cyano7&amp;#1470;-methoxy (4-nitrophenoxy)quinoline

A mixture of 4-chloro cyano methoxyquinoline (0.35 g) obtained in the same manner as Production Example 7, 4-nitrophenol (0.36 g) and 2,6-lutidine (0.25 ml) was heated and stirred in an oil bath at 170°C. After completion of the reaction, water and ethyl acetate were added to the reaction mixture for extraction. The organic layer was washed with an aqueous saturated sodium bicarnobate solution and saturated brine, dried over magnesium sulfate and concentrated. The obtained residue was passed through an NH silica gel column (Fuji Silysia Chemical), eluted with a solvent (ethyl acetate:hexane = 1:2) and concentrated to obtain 0.2 g of the title compound. 1H-NMR(DMSO-d6) δ(ppm): 4.06 (3H, s), 6.87 (1H, d, J=

5.6 Hz), 7.54 (2H, d, J= 8.8Hz), 7.65 (1H, s), 8.36 (2H, d, 1= 8.8Hz), 8.75 (1H, s), 8.84(1H, d, J= 5.6Hz). Production Example 14 4-(4-Aminophenoxy) cyano methoxyquinoline

FP01 00

The title compound (0.17 g) was obtained from 6cyano methoxy (4-nitrophenoxy)quinoline (0.2 g) in the same manner as Production Example 10. 1H-NMR (DMSO-dg) δ(ppm): 4.06 (3H, s), 5.15-5.20 (2H, m) ,

6.46 (1H, d, J= 5.6 Hz), 6.66 (2H, d, J- 8:8Hz), 6.93 (2H, d, J= 8.8 Hz), 7.56 (1H, s), 8.69 (1H, d, J= 5.6Hz), 8.71 (1H, s) . Production Example 15 6-Cyano (3-fluoro nitrophenoxy)7&amp;#1470;-methoxyquinoline

The title compound (0.33 g) was obtained from 4chloro cyano methoxyquinoline (0.5 g) obtained in the same manner as Production Example 7, in the same manner as Production Example 13. 1H-NMR (DMSO-dg) δ(ppm): 4.07 (3H, s), 7.00 (1H, d, J=

5.2 Hz), 7.30-7.34 (1H, m) , 7.65 (1H, dd, J= 2.8 Hz, J= 12 Hz), 7.66 (1H, s), 8.30 (1H, t, J= 8.8 Hz), 8.72(1H, s) , 8.87 (1H, d, J= 5.2Hz) . Production Example 16 4-(4-Amino fluorophenoxy) cyano methoxyquinoline

The title compound (0.24 g) was obtained from 6cyano (3-fluoro nitrophenoxy) methoxyquinoline (0.32 g) in the same manner as Production Example 10. 1H-NMR (DMSO-dg) δ(ppm) : 4.06 (3H, s) , 5.26 (2H, brs),

6.54 (1H, d, J= 5.2 Hz), 6.85-6.91 (2H, m), 7.11 (1H, dd, J= 2.0 Hz, J= 11.2 Hz), 7.59 (1H, s), 8.72 (1H, d, J= 5.2Hz), 8.73 (1H, s).

FP01 00

Production Example 17

Phenyl N-(4-(6-cyano (2-methoxyethoxy) quinolyl) oxyphenyl)carbamate

The 4-(4-aminophenoxy) cyano (2methoxyethoxy)quinoline (3.354 g, 10.0 mmol) obtained in Production Example 10 was dissolved in dimethylformamide (35 ml) under a nitrogen atmosphere, and then the solution was cooled in an ice water bath, pyridine (2.43 ml, 30.0 mmol) and phenyl chloroformate (1.38 ml, 11.0 mmol) were added in that order, and the mixture was stirred at room temperature for 3 hours. Water (40 ml) was added to the reaction solution and the precipitated crystals were filtered out. The filtrate was extracted with ethyl acetate, and the organic layer was washed with water and saturated brine and dried over anhydrous sodium sulfate. The drying agent was filtered off, and the crystals obtained by concentration under reduced pressure were combined with the previous crystals, suspended in hexane-ethyl acetate (5:1) and stirred overnight, after which the crystals were filtered out and dried under reduced pressure to obtain the title compound (4.334 g, 9.52 mmol, 95.2%) as light brown crystals.

1H-NMR Spectrum (CDC13) δ(ppm): 3.53 (3H, s), 3.91 (2H, t, J=4.4Hz), 4.38 (2H, t, J=4.4Hz), 6.49 (1H, d, J=5.2Hz), 7.07 (1H, br), 7.17-7.32 (5H, m) , 7.40-7.45

FP01 00 (2H, m), 7.44 (1H, s), 7.59 (2H, d, J=8.8Hz), 8.67 (1H, d, J=5.6Hz), 8.70 (1H, s). Production Example 18 Phenyl N-(4- (6-cyano (2-methoxyethoxy)-quinolyl)oxy2-fluorophenyl)carbamate

The 4-(4-amino fluorophenoxy) cyano (2methoxyethoxy)quinoline (2500 mg) obtained in Production Example 12 was dissolved in 20 ml of dimethylformamide and 1.7 ml of pyridine, and the solution was cooled to 0°C under a nitrogen atmosphere. After adding 0.97 ml of phenyl chlorocarbonate to the solution, it was stirred at room temperature for 2 hours. Ethyl acetate and water were added to the reaction solution for distribution, and the organic layer was washed with water and saturated brine in that order, dried over anhydrous sodium sulfate and then concentrated under reduced pressure to obtain 3.7 g of a residue. This was dissolved in tetrahydrofuran, and then n-hexane was added and the precipitated solid was filtered out to obtain 2.2 g of the title compound as light brown crystals (67% yield) .

1H-NMR Spectrum (CDC13) δ(ppm) : 3.36 (3H, s), 3.893.94 (2H, m), 4.34-4.39 (2H, m), 6.52 (1H, d, J=5.6Hz), 7.01-7.06 (2H, m), 7.21-7.30 (4H, m), 7.40-7.45 (2H, m),

7.49 (1H, s), 8.26 (1H, brs), 8.66 (1H, s), 8.70 (1H, d, J=5.6Hz).

FP01 00

Production Example 19 Phenyl N-(4-(6-cyano methoxy quinolyl)oxyphenyl) carbamate

The 4-(4-aminophenoxy) cyano methoxyquinoline (747 mg) obtained in Production Example 14 was dissolved in 7 ml of dimethylformamide and 0.34 ml of pyridine, and the solution was cooled to 0°C under a nitrogen atmosphere. After adding 0.34 ml of phenyl chlorocarbonate to the solution, it was stirred at room temperature for 2 hours. Ethyl acetate and water were added to the reaction solution, and the precipitated solid was filtered out to obtain 590 mg of the title compound as light brown crystals (56% yield). 1H-NMR Spectrum (DMSO-dg) δ(ppm) : 4.04 (3H, s) , 6.52 (1H, d, J=5.6Hz), 7.20-7.30 (5H, m) , 7.40-7.46 (2H, m), 7.60 (1H, s), 7.62-7.68 (2H, m), 8.72 (1H, d, J=5.6Hz), 8.75 (1H, s), 10.4 (1H, brs). Production Example 20 6-Chloro (4-nitrophenoxy)pyrimidine

After adding 4,6-dichloropyrimidine (750 mg) to a suspension of 4-nitrophenol (700 mg) and sodium hydride (60%)(200 mg) in dimethylformamide (13 ml) at 0°C, the mixture was heated and stirred at 80°C for 1.5 hours. The reaction solution was poured into saturated brine and extracted with ethyl acetate. The organic layer was dried over magnesium sulfate and then concentrated.

FP01 00

The obtained residue was passed through an NH silica gel column (Fuji Silysia Chemical), eluted with a solvent (ethyl acetate-hexane = 1-4) and concentrated to obtain 700 mg of the title compound.

1H-NMR(DMSO-dg) δ(ppm): 7.08 (1H, d, J= 0.8 Hz), 7.30-

7.37 (2H, m), 8.32-8.36 (2H, m), 8.60 (1H, d, J= 0.8 Hz) .

Production Example 21

4-(4-Amino fluorophenoxy) hydroxyquinoline-6carbonitrile

After adding 26 ml of trifluoroacetic acid and 2.6 ml of thioanisole to 2.6 g of 7-benzyloxy cyano (3fluoro nitrophenoxy)quinoline 2.6g, the mixture was stirred at 70-72QC for 15 hours and returned to room temperature, and then the reaction system was concentrated, saturated sodium bicarnobate water and methanol were added to the residue, and the precipitated yellow crystals were filtered out. Drying yielded 2.61 g of crystals. To 640 mg of the crystals there were added 950 mg of iron, 1.8 g of ammonium chloride, 10 ml of ethanol, 10 ml of tetrahydrofuran, and 10 ml of water, the mixture was refluxed for 1 hour, the reaction system was filtered with celite, ethyl acetate and water were added to the filtrate for liquid separation and extraction, and the organic layer was concentrated to dryness to obtain 355 mg of the title

FP01 00 compound.

1H-NMR Spectrum: (DMSOd6) 5.22(2H, s) , 6.42 (1H, d, J=5.8Hz), 6.80-6.90 (2H, m), 7.08 (2H, d, J=12.0Hz), 8.60-8.65 (2H, m), 11.60 (lH,brs) Production Example 22 Phenyl 3-methylsulfonylpheny!carbamate l-Amino methylthiobenzene (1.27 ml, 10 mmol) was dissolved in tetrahydrofuran (10 ml) , and then triethylamine (1.46 ml, 10.5 mmol) and phenyl chloroformate (1.32 ml, 10.5 mmol) were added dropwise in that order at room temperature under a nitrogen atmosphere and the mixture was stirred overnight. The reaction solution was distributed between ethyl acetate and water, and the organic layer was washed with saturated brine and dried over anhydrous sodium sulfate. After distilling off the solvent and drying under reduced pressure, the residue was dissolved in dichloromethane (50 ml), and 3-chloroperbenzoic acid (4.93 g, 20 mmol) was gradually added while cooling in an ice water bath. An aqueous saturated solution of sodium thiosulfate was added to the reaction solution, and then the insoluble portion was filtered off, and extraction with ethyl acetate was followed by washing with an aqueous saturated solution of sodium carbonate and drying over anhydrous sodium sulfate. The solvent was distilled off, and the residue was purified by

FP01 00 silica gel column chromatography (ethyl acetate-hexane =1:1) to obtain the title compound (2.545 g, 8.74 mmol, 87.4%) as white crystals.

1H-NMR Spectrum (CDC13)δ(ppm): 3.07 (3H, s), 7.18-7.29 (4H, m) , 7.40-7.44 (2H, m) , 7.55 (1H, t, J=8.0Hz), 7.68 (1H, d, J=8.0Hz), 7.80 (1H, d, J=8.0Hz), 8.05 (1H, s). Production Example 23 4-[(2,2-Dimethyl-4,6-dioxo[1,3]dioxane-5ylidenemethyl)-amino] methoxybenzonitrile

4-Amino chlorobenzonitrile (3 g) was dissolved in l-methyl pyrrolidone (10 ml), and then sodium methoxide (2.12 g) was added and the mixture was heated and stirred for 7 hours at 100°C. The reaction solution was poured into an aqueous saturated solution of ammonium chloride and extracted with ethyl acetate, and the organic layer was dried over magnesium sulfate and concentrated. The obtained residue was subjected to NH silica gel column chromatography and eluted with a solvent (ethyl acetate:n-hexane = 1:2) to obtain an aniline compound (1.26 g). The aniline compound (1.26 g) was heated to reflux in ethanol together with ethoxymethylene-Meldrum acid (1.7 g). The solid which precipitated after 2 hours was filtered out, washed with ethanol and then dried to obtain the title compound (1.9 g).

1H-NMR Spectrum (DMSO-d6) δ (ppm) : 1.66 (6H, s) , 3.94 (3H,

FP01 00

s), 7.21-7.26 (1H, m) , 7.46-7.50 (1H, m) , 7.72 (1H, d, J=8.4Hz), 8.70 (1H, s) . Production Example 24

7-Methoxy oxo-1,4-dihydroquinoline carbonitrile

4-[(2,2-Dimethy1-4,6-dioxo[1,3]dioxane-5ylidenemethyl) amino] methoxybenzonitrile (1.9 g) was heated for cyclization in the same manner as Production Example 457-3, to obtain the title compound (1.08 g) as a solid.

1H-NMR Spectrum (DMSO-dg) δ(ppm) : 3.96 (3H, s) , 6.02 (1H, d, J=7.6Hz), 7.06 (1H, s), 7.89 (1H, d, J=7.6Hz),

8.30 (1H, s).

Production Example 25 6-Methoxycarbonyl methoxy (5-indolyloxy)quinoline

After mixing methyl 4-chloro methoxyquinoline-6carboxylate (described in W00050405, p.34, 8.5 g, 33.77 mmol), 5-hydroxyindole (7 g), diisopropylethylamine (8.9 ml) and N-methylpyrrolidone (8.9 ml), the mixture was heated and stirred at 130°C for 5 hours and then at 150°C for 8 hours. After standing to cool, the solution was adsorbed onto silica gel and purified with a silica gel column (hexane-ethyl acetate system). Ethanol, diethyl ether and hexane were added to the obtained yellow oil, and crystals precipitated after a period of standing. The crystals were filtered out, washed with diethyl ether and hexane and then dried by

FP01 00 aspiration to obtain light yellow crystals (3.506 g, 10.06 mmol, 29.80%).

1H-NMR Spectrum(DMSO-d6)δ(ppm) : 3.86(3H,s),

3.97(3H,s),6.38(1H,d,J = 5.2Hz),6.46(1H,s),6.98(1H,d,J = 8.8Hz) , 7.44-7.52(4H,m),8.60-8.65 (2H,m),11.29(1H,s) . Production Example 26

7-(2-Methoxyethoxy) oxo-l,4-dihydro-6quinolinecarboxylic acid

The 7-methoxy oxo-l, 4-dihydroquinoline-6carbonitrile (8.0 g) described in WO9813350 was used to obtain the title compound (6.3 g) by the same procedure as in Production Example 152-1.

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 3.33(3H, s), 3.713.73(2H, m), 4.21-4.22(2H, m), 6.28(1H, d, J=7.2Hz), 7.15(1H, s), 8.59(1H, d, J=7.2Hz), 8.4O(1H, s) [Examples] Example

N-(4-(6-Cyano (3-(4-pyridyl)propoxy)-4quinolyl)oxyphenyl-N'-(4-methoxyphenyl)urea

The sodium 6-cyano (4-((4methoxyanilino)carbonyl) aminophenoxy) quinolinolate (200 mg) synthesized in Example 87 was dissolved in dimethylformamide (4 ml), and then potassium carbonate (130 mg, 0.9400 mmol), potassium iodide (3 mg) and 1chloro (4-pyridyl)propane (80 mg, 0.5159 mmol) were added and the mixture was heated and stirred at 80°C

FP01 00 for 5 hours and 30 minutes. After allowing the mixture to stand and adding saturated brine, it was extracted with ethyl acetate, washed with saturated brine and dried over anhydrous magnesium sulfate, the solvent was distilled off under reduced pressure, and the residue was purified by NH silica gel column chromatography (ethyl acetate-methanol system). The obtained crystals were suspended in ethanol, the suspension was diluted with diethyl ether, and the crystals were filtered out, washed with diethyl ether and dried by aspiration to obtain the title compound (60 mg) as light yellow crystals .

<td>¹H-NMR Spectrum (DMSO-d₆)</td><td> δ(ppm) :</td><td> ; 2.17 (2H, d), 2.84</td>

<td> (2H, t, J = 7.8 Hz), 3.70</td><td> (3H, s),</td><td> 4.28 (2H, t, J = 6.2</td>

<td> Hz), 6.51 (1H, d, J = 5.2</td><td> Hz), 6.86</td><td> (2H, d, J = 9.0 Hz),</td>

<td> 7.22 (2H, d, J = 9.0 Hz),</td><td> 7.29 (2H,</td><td> d, J = 6.0 Hz) ,</td>

<td> 7.35 (2H, d, J = 9.0 Hz),</td><td> 7.57 (1H,</td><td> s), 7.58 (2H, d, J</td>

<td> = 9.0 Hz), 8.46 (2H, d, J</td><td>.0 Hz)</td><td> , 8.49 (1H, s), 8.71</td>

<td> (1H, d, J = 5.2 Hz), 8.74</td><td> (1H, s),</td><td> 8.76 (1H, s).</td>

Example

N-(4-(6-Cyano (4-picolyloxy)-quinolyl)oxyphenyl)-Ν'(4-methoxyphenyl)urea

The sodium 6-cyano (4-((4methoxyanilino)carbonyl) aminophenoxy) quinolinolate (100 mg) synthesized in Example 87 was dissolved in dimethylformamide (2 ml), and then potassium carbonate

FP01 00 (97 mg, 0.7018 mmol), potassium iodide (3 mg) and 4picolyl chloride (40 mg, 0.2462 mmol) were added and the mixture was heated and stirred at 80°C for 3 hours. After allowing the mixture to stand and adding water, it was extracted with ethyl acetate, washed with saturated brine and dried over anhydrous magnesium sulfate, the solvent was distilled off under reduced pressure, and the residue was purified by NH silica gel column chromatography (ethyl acetate-methanol system). The obtained crystals were suspended in acetone, the suspension was diluted with diethyl ether, and the crystals were filtered out, washed with diethyl ether and dried by aspiration to obtain the title compound (30 mg) as light yellow crystals.

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 3.70 (3H, s), 5.54 (2H, s), 6.53 (1H, d, J = 5.2 Hz), 6.86 (2H, d, J = 8.8 Hz), 7.22 (2H, d, J = 8.8 Hz), 7.36 (2H, d, J = 8.8 Hz),

7.52 (2H, d, J = 6.4 Hz), 7.59 (2H, d, J = 8.8 Hz), 7.66 (1H, s) , 8.55 (1H, brs), 8.63 (2H, d, J = 6.0 Hz),

8.72 (1H, d, J = 5.2 Hz), 8.81 (1H, brs), 8.82 (1H, s). Example

N-(4-(6-Cyano (3-picolyloxy) quinolyl)oxyphenyl)Ν' -(4-methoxyphenyl)urea

The sodium 6-cyano (4-((4methoxyanilino)carbonyl) aminophenoxy) quinolinolate (200 mg) synthesized in Example 87 was used for

FP01 00 reaction in the same manner as Example 2 to obtain the title compound (68 mg).

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 3.70 (3H,s), 5.50 (2H,s), 6.54 (1H, d, J= 5.0 Hz), 6.86 (2H, d, J = 8.8 Hz), 7.22 (2H, d, J = 8.8 Hz), 7.35 (2H, d, J = 8.8 Hz),

7.49 (2H, dd, J = 4.8 Hz, 7.6 Hz), 7.58 (2H, d, J = 8.8 Hz), 7.74 (1H, s), 7.95 (1H, d, J = 7.6 Hz), 8.49 (1H, s), 8.59 (1H, dd, J = 1.6, Hz, 4.8 Hz), 7.83-8.80 (3H, m) .

Example

N-¢4- (6-Cyano (2-(1,2,3-triazol yl)ethoxy)-4quinolyl)oxyphenyl)-N'-(4-fluorophenyl)urea (Example 4-

A)

N-(4 - (6-Cyano (2-(1,2,3-triazol-l-yl)ethoxy)-4quinolyl)oxyphenyl)-N'-(4-fluorophenyl)urea (Example 4-

B) _

The N-(4-(6-cyano (2-chloroethoxy)quinolyl)oxyphenyl)-N4)-&amp;#1523;-fluorophenyl)urea (210 mg, 0.4403 mmol) synthesized in Example 90 was dissolved in N,N-dimethylformamide (2.5 ml), and then potassium carbonate (180 mg, 1.3209 mmol), potassium iodide (15 mg) and 1H-1,2,3-triazole (0.078 ml, 1.3209 mmol) were added and the mixture was heated and stirred at 60°C for 20 minutes and then at 65°C for 3 hours. After cooling, tetrahydrofuran and ethyl acetate were added, the mixture was washed with saturated brine and dried

FP01 00 over anhydrous magnesium sulfate, the solvent was distilled off under reduced pressure, and the isomers were separated by silica gel column chromatography (ethyl acetate-methanol system). The crystals of the low polarity isomer were suspended in ethanol and then washed with ethanol, filtered and dissolved in dimethylsulfoxide, after which the solution was diluted with ethanol and the precipitated crystals were filtered out, washed with ethanol and then with diethyl ether and dried by aspiration. The crystals of the high polarity isomer were suspended in ethanol, washed with ethanol, filtered out, washed with ethanol and then with diethyl ether and dried by aspiration. These yielded colorless crystals of low polarity N-(4-(6cyano (2-(1,2,3-triazol yl)ethoxy)-4quinolyl)oxyphenyl)-N4)-&amp;#1523;-fluorophenyl)urea (37 mg, 0.0703 mmol, 16.02%) and high polarity N-(4-(6-cyano-7(2-(1,2,3-triazol-l-yl) ethoxy) quinolyl)oxyphenyl)N4)-&amp;#1523;-fluorophenyl)urea (62 mg, 0.1182 mmol, 26.85%). Low polarity isomer (Example 4-A) 1H-NMR Spectrum (DMSO&amp;#1470;d6) δ(ppm) : 4.81 (2H, t, J =

4.6 Hz), 4.92 (2H, t, J = 4.6 Hz), 6.52 (1H, d, J = 5.2

Hz), 7.11 (2H, t, J = 8.8 Hz), 7.22 (2H, d, J = 8.8 Hz),

7.46 (2H, dd, J = 5.0 Hz, 8.8 Hz), 7.59 (2H, d, J = 8.8

Hz), 7.65 (1H, s), 7.80 (2H, s), 8.71 (1H, s), 8.72 (1H, d, J = 5.2 Hz), 8.77 (1H, s), 8.86 (1H, s).

FP01 00

High polarity isomer (Example 4-B) 1H-NMR Spectrum (DMSO-dg) δ(ppm) : 4.72 (2H, t, J = 4.8 Hz), 4.93 (2H, t, J = 4.8 Hz), 6.53 (1H, d, J = 5.2 Hz), 7.11 (2H, t, J = 8.4 Hz), 7.23 (2H, d, J = 8.8 Hz),

7.46 (2H, dd, J = 4.4 Hz, 8.4 Hz), 7.59 (2H, d, J = 8.8 Hz), 7.64 (1H, s), 7.77 (1H, s), 8.18 (1H, s), 8.73 (1H, d, J = 5.2 Hz), 8.73 (1H, s) , 8.75 (1H, s), 8.83 (1H, s) .

Example

N- (4 - (6-Cyano (2-(1,2,3&amp;#1470;triazol yl)ethoxy)-4quinolyl)oxyphenyl)-Ν'-(4-methoxyphenyl)urea (Example

5-A)

N-(4-(6-Cyano (2-(1,2,3-triazol-l-yl)ethoxy)-4quinolyl)oxyphenyl)-Ν'-(4-methoxyphenyl)urea (Example

5-B)

The N- (4-(6-cyano (2-chloroethoxy)-4quinolyl)oxyphenyl)-N4)-&amp;#1523;-methoxyphenyl) urea (300 mg, 0.6136 mmol) synthesized in Example 91 was used for reaction in the same manner as Example 4 to obtain low polarity N-(4-(6-cyano (2-(1,2,3-triazol-2yl)ethoxy) quinolyl)oxyphenyl)-Ν'-(4methoxyphenyl)urea (87 mg, 0.1652 mmol, 26.93%) and high polarity N-(4-(6-cyano (2-(1,2,3-triazol-lyl)ethoxy) quinolyl)oxyphenyl)-N4)-&amp;#1523;methoxyphenyl) urea (83 mg, 0.1576 mmol, 25.69%) as colorless crystals.

FP01 00

Low polarity isomer (Example 5-A) 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 3.70 (3H, s) , 4.81 (2H, t, J = 5.0 Hz), 4.92 (2H, t, J = 5.0 Hz), 6.52 (1H, d, J = 5.4 Hz), 6.86 (2H, d, J = 8.8 Hz), 7.21 (2H, d, J = 9.2 Hz), 7.35 (2H, d, J = 8.8 Hz), 7.57 (2H, d, J =

9.2 Hz), 7.65 (1H, s), 7.80 (2H, s), 8.49 (1H, s), 8.71 (1H, s), 8.72 (1H, d, J = 5.4 Hz), 8.73 (1H, s).

High polarity isomer (Example 5-B) 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 3.70 (3H, s) , 4.72 (2H, t, J = 5.2 Hz), 4.93 (2H, t, J = 5.2 Hz), 6.53 (1H, d, J = 5.2 Hz), 6.85 (2H, d, J = 9.0 Hz), 7.21 (2H, d, J = 9.0 Hz), 7.35 (2H, d, J =9.0 Hz), 7.57 (2H, d, J = 9.0 Hz), 7.64 (1H, s), 7.77 (1H, s), 8.18 (1H, s), 8.49 (1H, s), 8.72 (1H, d, J = 5.2 Hz), 8.73 (1H, s) , 8.75 (1H, s) .

Example

N-(4- (6-Cyano (2-(1,2,3-triazol yl)ethoxy)-4quinolyl)oxy fluorophenyl)-N'-(2,4difluorophenyl)urea (Example 6-A)

N-(4-(6-Cyano1,2,3)-2)-7&amp;#1470;-triazol yl)ethoxy)-4quinolyl)oxy fluorophenyl)-N'-(2,4difluorophenyl)urea (Example 6-B)

Sodium hydride (35 mg, 0.8774 mmol, 60% in oil) was suspended in Ν,Ν-dimethylformamide (2.5 ml), and then 1H-1,2,3-triazole (0.051 ml, 0.8774 mmol) was added while cooling on ice and the mixture was stirred

FP01 00 at room temperature for 15 minutes to complete dissolution. After then adding N-(4-(6-cyano (2chloroethoxy) quinolyl)oxyphenyl)-Ν'-(2,4difluorophenyl)urea (225 mg, 0.4386 mmol) and potassium iodide (10 mg), the mixture was heated and stirred at 50°C for 10 hours. Upon cooling, tetrahydrofuran and ethyl acetate were added, the mixture was washed with saturated brine and dried over anhydrous magnesium sulfate, the solvent was distilled off under reduced pressure, and the isomers were separated by silica gel column chromatography (hexane/ethyl acetate/methanol system). The crystals of the low polarity isomer were dissolved in dimethylsulfoxide, the solution was diluted with ethanol, and the precipitated crystals were filtered out, washed with ethanol and then with diethyl ether and dried by aspiration. The crystals of the high polarity isomer were further purified by NH silica gel column chromatography (hexane/ethyl acetate system), and the obtained crystals were suspended in ethanol, washed with ethanol and hexane, and then filtered out, washed with hexane and dried by aspiration. This yielded pink crystals of low polarity N- (4-(6-cyano (2-(1,2,3-triaz01 yl)ethoxy)-4quinolyl)oxy fluorophenyl)-Ν'- (2,4difluorophenyl)urea (15 mg, 0.0275 mmol, 6.27%) and colorless crystals of high polarity N-(4-(6-cyano (2

FP01 00 (1,2,3-triazol-l-yl)ethoxy) quinolyl)oxy-3fluorophenyl)-N2,4)-&amp;#1523;-difluorophenyl)urea (30 mg, 0.0550 mmol, 12.54%).

Low polarity isomer (Example 6-A)

<td>¹H-NMR Spectrum (DMSO-d₆)</td><td> δ(ppm) : 4.82</td><td> (2H, t, J =</td>

<td> 4.8 Hz), 4.92 (2H, t, J =</td><td> 4.82 Hz), 6.63</td><td> (1H, d, J =</td>

<td> 5.0 Hz), 7.05 (1H, m), 7.</td><td> 14 (1H, d, J - 9</td><td> .6 Hz), 7.32</td>

<td> (1H, m), 7.40 (1H, m) , 7.</td><td> 66 (1H, s), 7.80</td><td> (2H, s), 8.11</td>

<td> (1H, m), 8.26 (1H, t, J =</td><td> 9.6 Hz), 8.70 (</td><td> 1H, s), 8.75</td>

<td> (1H, d, J = 5.0 Hz) , 8.99</td><td> (1H, s), 9.07 (</td><td> 1H, s) .</td>

High polarity isomer (Example 6-B) 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.73 (2H, t, J =

5.2 Hz), 4.93 (2H, t, J = 5.2 Hz), 6.63 (1H, d, J = 5.2 Hz), 7.05 (1H, m), 7.15 (1H, m), 7.32 (1H, ddd, J = 2.8 Hz, 8.8 Hz, 11.6 Hz), 7.40 (1H, dd, J = 2.8 Hz, 11.6 Hz), 7.66 (1H, s), 7.77 (1H, s), 8.11 (1H, m), 8.18 (1H, s), 8.26 (1H, t, J = 8.8 Hz), 8.74 (1H, s), 8.75 (1H, d, J = 5.2 Hz), 8.99 (1H, d, J = 2.2 Hz), 9.07 (1H, d, J =

2.2 Hz) .

Example

N-(4-(6-Cyano (3-(morpholin yl) propoxy) quinolyl) oxyphenyl)-N1-(4-methoxyphenyl)urea

The sodium 6-cyano (4-((4methoxyanilino)carbonyl) aminophenoxy) quinolinolate (100 mg) synthesized in Example 87 was dissolved in dimethylformamide (2.5 ml), and then potassium

FP01 00 carbonate (65 mg, 0.4690 mmol) and l-chloro-3(morpholin yl)propane (38 mg, 0.2345 mmol, J. Am. Chem. Soc. 67, 736 (1945)) were added and the mixture was heated and stirred at 80°C for 2 hours. After allowing the mixture to stand and adding saturated brine, it was extracted with ethyl acetate, the extract was washed with saturated brine and dried over anhydrous magnesium sulfate, the solvent was distilled off under reduced pressure, and the residue was purified by NH silica gel column chromatography (ethyl acetate-methanol system). The obtained crystals were suspended in ethyl acetate, the suspension was diluted with diethyl ether, and the crystals were filtered out, washed with diethyl ether and dried by aspiration to obtain the title compound (120 mg) as light yellow crystals .

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 1.99 (2H, m) , 2.38 (4H, brs), 2.49 (2H, m), 3.57 (4H, t, J = 4.6 Hz), 3.70 (3H, s), 4.33 (2H, t, J = 6.2 Hz), 6.51 (1H, d, J = 5.6 Hz), 6.86 (2H, d, J - 9.2 Hz), 7.22 (2H, d, J = 9.2 Hz),

7.35 (2H, d, J = 9.2 Hz), 7.58 (2H, d, J = 9.2 Hz),

7.59 (1H, s), 8.49 (1H, s), 8.71 (1H, d, J = 5.6 Hz),

8.74 (1H, s), 8.75 (1H, s).

Example

N-(4 - (6-Cyano (3-(1,2,3-triazol yl)propoxy)-4quinolyl)oxyphenyl)-Ν' -(4-methoxyphenyl)urea

FP01 00

The title compound was obtained from the sodium 6cyano (4-((4-methoxyanilino) carbonyl)aminophenoxy)7-quinolinolate synthesized in Example 87 and 2-(3chloropropyl)1,2,3-triazole, by the same procedure as in Example 7. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 2.41 (2H, m), 3.70 (3H, s), 4.29 (2H, t, J = 6.0 Hz), 4.68 (2H, t, J = 6.6 Hz), 6.52 (IH, d, J = 5.2 Hz), 6.86 (2H, d, J = 8.8 Hz),

7.22 (2H, d, J = 8.8 Hz), 7.35 (2H, d, J = 8.8 Hz),

7.54 (IH, s), 7.58 (2H, d, J = 8.8 Hz), 7.78 (2H, s),

8.49 (IH, s), 8.71 (IH, d, J = 5.2 Hz), 8.74 (IH, s),

8.77 (IH, s) . Example

N-(4-(6-Cyano (3-(1,2,3-triazol-l-yl)propoxy)-4quinolyl)oxyphenyl)-Ν'-(4-methoxyphenyl)urea

The title compound was obtained from the sodium 6cyano (4-((4-methoxyanilino)carbonyl)aminophenoxy)-7quinolinolate synthesized in Example 87 and 1-(3chloropropyl)-1,2,3-triazole, by the same procedure as in Example 7. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 2,41 (2H, m) , 3.70 (3H, s), 4.28 (2H, t, J = 6.0 Hz), 4.63 (2H, t, J = 6.6 Hz), 6.52 (IH, d, J = 5.4 Hz), 6.86 (2H, d, J = 8.8 Hz), 7.22 (2H, d, J = 8.8 Hz), 7.35 (2H, d, J = 8.8 Hz), 7.57 (IH, s), 7.58 (2H, d, J = 8.8 Hz), 7.73 (IH, s), 8.19 (IH, s), 8.49 (IH, s), 8.72 (IH, d, J = 5.4 Hz),

FP01 00

8.74 (1H, s) , 8.77 (1H, s) .

Example

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-NF-(4-fluorophenyl)urea

4-(4-Aminophenoxy) (2-methoxyethoxy)-6cyanoquinoline (109 mg, 0.325 mmol) was dissolved in toluene (5 ml) while heating, and then 4-fluorophenyl isocyanate (0.057 ml, 0.488 mmol) was added and the mixture was heated to reflux for 1 hour. After cooling, the precipitated crystals were filtered out, washed with ethyl acetate and dried under reduced pressure to obtain the title compound (148 mg, 0.311 mmol, 96.4%) as white crystals.

1H-NMR Spectrum (DMSO&amp;#1470;d6) δ(ppm): 3.36 (3H, s), 3.763.79 (2H, m), 4.41-4.43 (2H, m), 6.52 (1H, d, J=5.2Hz), 7.11 (2H, t, J=9.0Hz), 7.23 (2H, d, J=9.0Hz), 7.46 (2H, q, J=4.8Hz), 7.57-7.62 (3H, m), 8.71-8.76 (3H, m), 8.82 (1H, s) .

Example

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl) oxyphenyl)-N'-(2-pyridyl) urea

Phenyl N-(4-(6-cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)carbamate (104 mg, 0.228 mmol) was dissolved in dimethylsulfoxide (1 ml), and then 2aminopyridine (43 mg, 0.457 mmol) was added and the mixture was heated at 85°C for 3 hours while stirring.

FP01 00

After cooling, ethyl acetate and water were added for distribution, and the organic layer was washed with saturated brine and dried over anhydrous sodium sulfate. After filtering off the drying agent and concentrating under reduced pressure, ethyl acetate-hexane was added to the residue and the precipitated crystals were filtered out and dried under reduced pressure to obtain the title compound (86 mg, 0.189 mmol, 82.7%) as white crystals .

1H-NMR Spectrum (DMSO&amp;#1470;d6) δ(ppm): 3.36 (3H, s), 3.75-

3.78 (2H, m), 4.39-4.42 (2H, m), 6.53 (1H, d, J=5.2Hz), 6.99 (1H, m), 7.18 (1H, d, J=8.4Hz), 7.26 (2H, d, J=9.2Hz), 7.56 (1H, d, J=8.4Hz), 7.62 (1H, s), 7.687.77 (3H, m), 8.26 (1H, d, J=5.2Hz), 8.72 (1H, d, J=5.2Hz), 8.77 (1H, s), 9.89 (1H, brs).

Example

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-Ν'-(1,3-thiazol yl)urea

The title compound (37 mg, 0.08 mmol, 34.4%) was obtained as light brown crystals from phenyl N-(4-(6cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)carbamate (106 mg, 0.233 mmol) by the same procedure as in Example 11.

1H-NMR Spectrum (DMSO-d6) δ(ppm): 3.36 (3H, s), 3.75-

3.79 (2H, m) , 4.40-4.43 (2H, m), 6.53 (1H, d, J=5.6Hz), 7.10 (1H, d, J=3.2Hz), 7.72 (1H, d, J=8.8Hz), 7.37 (1H,

FP01 00

m), 7.57-7.67 (3H, m), 8.72 (1H, d, J=5.2Hz), 8.77 (1H, s), 9.53 (1Hr brs) .

Example

N- (4- (6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-Nf-(4-hydroxyphenyl)urea

The title compound (52 mg, 0.110 mmol, 43.0%) was obtained as light brown crystals from phenyl N-(4-(6cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)carbamate (117 mg, 0.257 mmol) by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 3.36 (3H, s) , 3.77-

3.79 (2H, m), 4.41-4.43 (2H, m), 6.51 (1H, d, J=5.2Hz),

6.67 (2H, d, J=8.0Hz), 7.15-7.25 (3H, m) , 7.57 (2H, d, J=8.0Hz), 7.62 (1H, s), 8.37 (1H, s), 8.703) 8.76&amp;#1470;H, m), 9.05 (1H, s) .

Example

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'-(3-methoxyphenyl)urea

The title compound (50 mg, 0.103 mmol, 39.2%) was obtained as white crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (120 mg, 0.263 mmol) by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-dg) δ(ppm): 3.36 (3H, s), 3.72 (3H, s), 3.76-3.79 (2H, m), 4.39-4.43 (2H, m), 6.506.57 (2H, m), 6.93 (1H, d, J=8.0Hz), 7.14-7.19 (2H, m) ,

7.24 (2H, d, J=8.8Hz), 7.59 (2H, d, J=8.8Hz), 7.62 (1H,

FP01 00

s), 8.69-8.73 (2H, m), 8.76 (1H, s) , 8.80 (1H, s). Example

N- (4- (6-Cyano2)-7&amp;#1470;-methoxyethoxy)-4quinolyl) oxyphenyl)-Ν'-(3-hydroxyphenyl) urea

The title compound (25 mg, 0.053 mmol, 23.7%) was obtained as light brown crystals from phenyl N-(4-(6cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)carbamate (102 mg, 0.234 mmol) by the same procedure as in Example 11.

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 3.36 (3H, s) , 3.75-

3.79 (2H, m), 4.40-4.43 (2H, m), 6.36 (1H, d, J=9.2Hz),

6.52 (1H, d, J=5.2Hz), 6.79 (1H, d, J=8.0Hz), 7.00-7.06 (2H, m), 7.23 (2H, d, J=9.2Hz), 7.58 (2H, d, J=8.8Hz),

7.62 (1H, s), 8.59 (1H, s), 8.71 (1H, d, J=4.8Hz), 8.76 (1H, s), 9.31 (1H, brs).

Example

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-Ν'-(2-hydroxyphenyl)urea

The title compound (78 mg, 0.166 mmol, 69.9%) was obtained as light brown crystals from phenyl N-(4-(6cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)carbamate (108 mg, 0.237 mmol) by the same procedure as in Example 11.

1H-NMR Spectrum (DMSO&amp;#1470;d6) δ(ppm): 3.36 (3H, s), 3.76-

3.79 (2H, m), 4.402) 4.43&amp;#1470;H, m), 6.52 (1H, d, J=5.6Hz), 6.69-6.85 (3H, m), 7.22 (2H, d, J=8.8Hz), 7.57-7.62 (3H,

FP01 00

m), 7.99 (1H, d, J=8.0Hz), 8.34 (1H, br), 8.71 (1H, d, J=5.2Hz), 8.76 (1H, s), 9.62 (1H, brs). Example N- (4-(6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'-(ΙΗ imidazolyl)urea

After dissolving 2-aminoimidazole (132 mg, 1.0 mmol) in a dimethylformamide (2 ml) and water (1 ml) mixed solvent, triethylamine (0.42 ml, 3.0 mmol) and phenyl chloroformate (0.14 ml, 1.1 mmol) were added at room temperature, and the mixture was stirred for 10 minutes. After further adding 4-(4-aminophenoxy) (2methoxyethoxy) cyanoquinoline (168 mg, 0.5 mmol), the mixture was stirred overnight. The reaction solution was diluted with ethyl acetate (30 ml) and then washed with water (10 ml x 2) and saturated brine (10 ml), and the organic layer was dried over anhydrous sodium sulfate. The drying agent was filtered off, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent - ethyl acetate:ethanol = 95:5) to obtain the title compound (20 mg, 0.045 mmol, 8.98%) as white crystals.

1H-NMR Spectrum (DMSO-dg) δ(ppm): 3.36 (3H, s), 3.76&amp;#1470;

3.79 (2H, m), 4.40-4.43 (2H, m), 6.53 (1H, d, J=5.2Hz), 6.70 (1H, s), 7.24 (2H, d, J=8.8Hz), 7.57-7.67 (3H, m) ,

8.72 (1H, d, J=5.6Hz), 8.76 (1H, s).

FP01 00

Example

N- (4- (6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'- (2,4-difluorophenyl)urea

The title compound (136 mg, 0.277 mmol, 87.7%) was obtained as white crystals from 4-(4-aminophenoxy)-7(2-methoxyethoxy) cyanoquinoline (106 mg, 0.316 mmol) by the same procedure as in Example 10.

1H-NMR Spectrum (DMSO-d6) d(ppm): 3.36 (3H, s), 3.76-

3.79 (2H, m) , 4.40-4.43 (2H, m), 6.52 (1H, d, J=5.2Hz),

7.04 (1H, m), 7.23-7.34 (3H, m) , 7.573) 7.62&amp;#1470;H, m) ,

8.06 (1H, m), 8.52 (1H, s), 8.71 (1H, d, J=5.6Hz), 8.76 (1H, s), 9.16 (1H, s).

Example

N- (4- (6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N* 1-(3&amp;#1470;cyanophenyl)urea

The title compound (38 mg, 0.079 mmol, 33.1%) was obtained as light yellow crystals from phenyl N-(4-(6cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)carbamate (109 mg, 0.239 mmol) by the same procedure as in Example 11.

1H-NMR Spectrum (DMSO-dg) δ(ppm): 3.36 (3H, 5),3.76-

3.79 (2H, m), 4.40-4.43 (2H, m), 6.52 (1H, d, J=5.2Hz), 7.26 (2H, d, J=8.8Hz), 7.41 (1H, d, J=6.4Hz), 7.49 (1H, t, J=8.0Hz), 7.55-7.62 (3H, m), 7.68 (1H, dd, J=1.2, 8.8Hz), 7.97 (1H, s), 8.71 (1H, d, J=6.4Hz), 8.76 (1H, s), 9.00 (1H, s), 9.05 (1H, s).

FP01 00

Example

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl) oxyphenyl)-N'-(2-fluorophenyl)urea

The title compound. (75 mg, 0.159 mmol, 48.8%) was obtained as white crystals from 4-(4-aminophenoxy)-7(2-methoxyethoxy) cyanoquinoline (109 mg, 0.325 mmol) by the same procedure as in Example 10.

1H-NMR Spectrum (DMSO-d6) δ(ppm): 3.36 (3H, s), 3.76-

3.79 (2H, m), 4.40-4.43 (2H, m), 6.52 (1H, d, J=5.2Hz), 7.01 (1H, m), 7.13 (1H, t, J=8.0Hz), 7.20-7.27 (3H, m) ,

7.55-7.63 (3H, m), 8.14 (1H, t, J=8.0Hz), 8.56 (1H, brs), 8.72 (1H, d, J=6.4Hz), 8.76 (1H, s), 9.22 (1H, s). Example

N- (4- (6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-Ν'-(3-(methylsulfonyl)phenyl)urea

Diisopropylethylamine (0.057 ml, 0.328 mmol) and phenyl N-[3-(methylsulfonyl)phenyl]carbamate (96 mg, 0.328 mmol) were reacted with 4-(4-aminophenoxy) (2methoxyethoxy) cyanoquinoline (100 mg, 0.298 mmol), and the title compound (120 mg, 0.225 mmol, 75.6%) was obtained as white crystals by the same procedure as in Example 34.

1H-NMR Spectrum(DMSO-d5) δ(ppm): 3.19 (3H, s), 3.36 (3H, s), 3.76-3.79 (2H, m), 4.40-4.43 (2H, m), 6.53 (1H, d, J=5.6Hz), 7.26 (2H, d, J=8.8Hz), 7.50-7.69 (6H, m) , 8.16 (1H, brs), 8.72 (1H, d, J=5.2Hz), 8.76 (1H, s),

FP01 00

8.95 (1H, s) , 9.15 (1H, s).

Example

N-(46)&amp;#1470;-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'-(3-(methylsulfanyl)phenyl)urea

The title compound (210 mg, 0.420 mmol, 98.9%) was obtained as white crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (193 mg, 0.424 mmol) by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 2.43 (3H, s), 3.36 (3H, s), 3.76-3.79 (2H, m) , 4.40-4.43 (2H, m), 6.52 (1H, d, J=5.2Hz), 6.83 (1H, d, J=7.2Hz), 7.14-7.24 (4H, m) , 7.48 (1H, s), 7.58-7.61 (3H, m), 8.71 (1H, d, J=5.2Hz), 8.75 (1H, s), 9.62 (1H, s), 9.76 (1H, s). Example

N- (4- (6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'-cyclopropylurea

The title compound (145 mg, 0.347 mmol, 80.9%) was obtained as white crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (195 mg, 0.428 mmol) by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 0.4 (2H, brs), 0.63 (2H, d, J=6.8Hz), 2.53 (1H, m), 3.36 (3H, s), 3.76-3.79 (2H, m) , 4.40-4.43 (2H, m), 6.42 (1H, s), 6.48 (1H, d, J=5.2Hz), 6.97 (2H, d, J=9.2Hz), 7.53 (2H, d, J=9.2Hz), 7.60 (1H, s), 8.44 (1H, s), 8.70 (1H, d, J=4.8Hz), 8.74 (1H, s) .

FP01 00

Example

N- (4- (6-Cyano (2-methoxyethoxy) -4quinolyl)oxyphenyl)-Ν'-(4-fluoro hydroxyphenyl)urea

The title compound (132 mg, 0.270 mmol, 78.9%) was obtained as light yellow crystals from phenyl N-(4-(6cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)carbamate (156 mg, 0.343 mmol) by the same procedure as in Example 11.

1H-NMR Spectrum (DMSO-d6) δ(ppm): 3.36 (3H, s), 3.76-

3.79 (2H, m), 4.40-4.43 (2H, m), 6.52 (1H, d, J=5.6Hz), 6.57 (1H, m), 6.62 (1H, m), 7.23 (2H, d, J=8.8Hz), 7.57 (2H, d, J=8.8Hz), 7.62 (1H, s), 7.98 (1H, m), 8.12 (1H, s), 8.71 (1H, d, J=5.6Hz), 9.40 (1H, s), 10.47 (1H, s). Example

N-(4-(6-Cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-Ν'-(1,3-thiazol2&amp;#1470;-yl)urea

Phenyl N-(4(6-cyano (2-methoxyethoxy)-4quinolyl)oxy fluorophenyl)carbamate (200 mg) and 2aminothiazole (85 mg) were dissolved in 1 ml of dimethylformamide, and then 0.12 ml of triethylamine was added thereto and the mixture was heated and stirred at 90°C for 2 hours. After cooling, water was added and the precipitated solid was filtered out and washed with ethyl acetate to obtain 110 mg of the title compound as light brown crystals (57% yield).

1H-NMR Spectrum (DMSO-dg) δ(ppm) : 3.37 (3H, s),

FP01 00

3.75-3.80 (2H, m) , 4.40-4.45 (2H, m), 6.63 (1H, d, J=5.6Hz), 7.14 (1H, d, J=3.2Hz), 7.16-7.20 (1H, m) ,

7.39 (1H, d, J=3.2Hz), 7.42-7.47(1H, m), 7.64 (1H, s), 8.21-8.27 (1H, m), 8.74-8.76 (2H, m) Example

N- (4- (6-Cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-N'-cyclopropylurea

The title compound (83 mg, 0.190 mmol, 61.3%) was obtained as white crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)carbamate (147 mg, 0.310 mmol) by the same procedure as in Example 25.

1H-NMR Spectrum (DMSO-dg) δ(ppm) : 0.40 (2H, br) , 0.610.66 (2H, m), 2.53 (1H, m), 3.36 (3H, s), 3.76-3.79 (2H, m), 4.40-4.43 (2H, m), 6.58 (1H, d, J=5.6Hz), 6.79 (1H, d, J=2.0Hz), 7.08 (1H, dd, J=2.0, 10.4Hz), 7.32 (1H, dd, J=2,4, 11.6Hz), 7.62 (1H, s) , 8.18-8.22 (2H, m), 8.718.74 (2H, m).

Example

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'-cyclopropylmethylurea

The title compound (144 mg, 0.333 mmol, 96.6%) was obtained as white crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (157 mg, 0.345 mmol) by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 0.16-0.18 (2H, m),

FP01 00

0.39-0.43 (2H, m), 0.94 (1H, m), 2.97 (2H, t, J=6.4Hz), 3.36 (3H, s), 3.76-3.79 (2H, m), 4.40-4.43 (2H, m) , 6.22 (1H, m), 6.49 (1H, d, J=5.6Hz), 7.17 (2H, d, J=8.8Hz), 7.52 (2H, d, J=8.8Hz), 7.61 (1H, s), 8.60 (1H, s), 8.70 (1H, d, J=5.2Hz), 8.75 (1H, s) .

Example

N- (4-(6-Cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-N'-cyclopropylmethylurea

The title compound (83 mg, 0.190 mmol, 61.3%) was obtained as white crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)carbamate (147 mg, 0.310 mmol) by the same procedure as in Example 25.

1H-NMR Spectrum (DMSO-d6) δ(ppm): 0.16-0.18 (2H, m), 0.41-0.46 (2H, m), 0.94 (1H, m), 2.99 (2H, t, J=6.0Hz), 3.36 (3H, s), 3.76-3.79 (2H, m), 4.40-4.43 (2H, m), 6.58 (1H, d, J=5.6Hz), 6.71 (1H, t, J=5.6Hz), 7.08 (1H, d, J=9.2Hz), 7.33 (1H, dd, J=2.8, 11.6Hz), 7.63 (1H, s),

8.24 (1H, t, J=9.2Hz), 8.38 (1H, s), 8.55-8.59 (2H, m). Example

N-(4-(6-Cyano (3-(morpholin yl) propoxy)-4quinolyloxy) fluorophenyl)-N'- (2,4difluorophenyl)urea

N-(4-(6-Cyano hydroxyquinolin yloxy)-2fluorophenyl)-N-(2,4-difluorophenyl)urea (100 mg, 0.2220 mmol) was used for reaction in the same manner

FP01 00 as Example 7 to obtain the title compound (35 mg, 0.0606 mmol, 27.30%) as light yellow crystals.

1H-NMR Spectrum (DMSO-dg) δ(ppm) : 1.99 (2H, m), 2.38 (4H, brs), 2.50 (2H, t, J = 7.2 Hz), 3.57(4H, t, J =

4.6 Hz), 4.33 (2H, t, J = 6.4 Hz), 6.62 (1H, d, J = 5.4 Hz), 7.06 (1H, m), 7.15 (1H, m), 7.32 (1H, ddd, J = 2.8 Hz, 8.8 Hz, 11.6 Hz), 7.41 (1H, dd, J = 2.8 Hz, 11.6 Hz), 7.61 (1H, s), 8.12 (1H, m), 8.27 (1H, dt, J = 2.0 Hz, 9.2 Hz), 8.74 (1H, s), 8.74 (1H, d, J = 5.4 Hz), 8.99 (1H, m), 9.07 (1H, m).

Example

N-(4-(6-Cyano (3-(diethylamino)propoxy)-4quinolyloxy)phenyl)-N'-(4-fluorophenyl)urea

The title compound (69 mg, 0.131 mmol, 51.9%) was obtained as light brown crystals from sodium 6-cyano-4(4-((4-fluoroanilino)carbonyl)aminophenoxy)-7quinolinolate (110 mg, 0.252 mmol) by the same procedure as in Example 7.

1H-NMR Spectrum (DMSO&amp;#1470;d6) δ(ppm): 0.95 (6H, t, J=7.2Hz), 1.89-1.95 (2H, m), 2.44-2.49 (4H, m), 2.58-2.62 (2H, m) ,

4.31 (2H, t, J=6.0Hz), 6.51 (1H, d, J=5.2Hz), 7.11 (2H, t, J=8.4Hz), 7.23 (2H, d, J=8.8Hz), 7.44-7.48 (2H, m),

7.56-7.57 (2H, m) , 7.60 (1H, s), 8.71 (1H, d, J=5.2Hz), 8.74-8.76 (2H, m), 8.85 (1H, s).

Example

N-(4-(6-Cyano (3-(4-morpholino)propyl)-4203

FP01 00 quinolyl)oxyphenyl)-N'-(4-fluorophenyl)urea

The title compound (73 mg, 0.135 mmol, 53.5%) was obtained as light brown crystals from sodium 6-cyano-4(4-((4-fluoroanilino)carbonyl)aminophenoxy)-7quinolinolate (110 mg, 0.252 mmol) by the same procedure as in Example 7.

1H-NMR Spectrum (DMSO&amp;#1470;d6) δ(ppm): 1.99 (2H, t, J=6.4Hz),

2.30-2.60 (6H, m), 3.55-3.58 (4H, m), 4.31-4.34 (2H, m), 6.51 (1H, d, J=5.2Hz), 7.11 (2H, t, J=8.8Hz), 7.23 (2H, d, J=9.2Hz), 7.44-7.48 (2H, m), 7.57-7.60 (3H, m), 8.70-8.75 (3H, m), 8.82 (1H, s).

Example

N-(4-(6-Cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-Nf-(2-pyridyl)urea

The title compound (210 mg, 84% yield) was obtained as light brown crystals from phenyl N-(4-(6cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)carbamate (250 mg) and 2-aminopyridine (100 mg), in the same manner as Example 25. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 3.36 (3H, s),

3.75-3.80 (2H, m), 4.39-4.45 (2H, m), 6.64 (1H, d, J=5.2Hz), 7.00-7.05 (1H, m), 7.15-7.19 (1H, m), 7.37-

7.47 (2H, m), 7.64 (1H, s), 7.50-7.80 (1H, m), 8.258.30 (1H, m), 8.31-8.37 (1H, m), 8.74 (1H, d, J=5.2Hz),

8.76 (1H, s), 9.87 (1H, s) Example 33

FP01 00

N-(46)&amp;#1470;-Cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-Ν'-(3-(methylsulfanyl)phenyl)urea The title compound (100 mg, 61% yield) was obtained as light brown crystals from phenyl N-(4-(6cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)carbamate (160 mg) and 3(methylthio) aniline (88 mg),, in the same manner as Example 25.

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 2.43 (3H, s), 3.36 (3H, s), 3.75-3.80 (2H, m), 4.40-4.45 (2H, m), 6.62 (1H, d, J=5.6Hz), 6.86-6.89 (1H, m) , 7.11-7.17 (2H, m) , 7.20-7.25 (1H, m) , 7.37-7.43 (1H, m) , 7.47 (1H, s) ,

7.63 (1H, s), 8.21-8.28 (1H, m), 8.66 (1H, brs), 8.73-

8.76 (2H, m), 9.11-9.13 (1H, m) Example

N-(4-(6-Cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-N'-(3-(methylsulfonyl) phenyl)urea 4-(4-Amino fluorophenoxy) cyano (2methoxyethoxy)quinoline (106 mg) and phenyl N-(3(methylsulfonyl)phenyl)carbamate (96 mg) were added to 5 ml of toluene, and then 0.06 ml of diisopropylethylamine was added and the mixture was heated to reflux for 3 hours. After cooling, ethyl acetate was added and the precipitated insoluble portion was filtered out. The filtrate was concentrated, the resulting residue was dissolved in

FP01 00 tetrahydrofuran, toluene was added, and the precipitated solid was filtered out to obtain 13 mg of the title compound as light brown crystals (8% yield). 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 3.20 (3H, s), 3.35 (3H, s), 3.75-3.80 (2H, m), 4.38-4.43 (2H, m), 6.63 (1H, d, J=5.2Hz), 7.14-7.17 (1H, m), 7.39-7.45 (1H, m), 7.51-7.61 (2H, m) 7.62-7.70 (2H, m), 8.16-8.27 (2H, m), 8.73-8.76 (3H, m), 9.47-9.49 (1H, m) Example

N-(4-(6-Cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-Ν'- (2-fluorophenyl)urea

4-(4-Amino fluorophenoxy) cyano (2methoxyethoxy)quinoline (100 mg) was added to 4.5 ml of toluene, and the mixture was heated to reflux. After then adding 2-fluorophenyl isocyanate (0.05 ml), the mixture was further heated to reflux for 1 hour. After cooling, the precipitated solid was filtered out and washed with ethyl acetate/toluene = 1/1 to obtain 100 mg of the title compound as light brown crystals (72% yield). 1H-NMR Spectrum (DMSO-dg) δ(ppm) : 3.37 (3H, s),

3.75-3.80 (2H, m) , 4.402) 4.45&amp;#1470;H, m) , 6.62 (1H, d, 5.6Hz), 6.97-7.05 (1H, m), 7,11-7.18 (1H, m) , 7.21-7.28 (1H, m), 7.38-7.45 (1H, m), 7.64 (1H, s), 8.14-8.20 (1H, m), 8.26-8.33 (1H, m), 8.73-8.76 (2H, m), 9.06 (1H, brs) , 9.14 .(1H, brs)

FP01 00

Example

N-(4-(6-Cyano methoxy quinolyl)oxyphenyl)-Ν'- (2,4difluorophenyl)urea

4-(4-Aminophenoxy) cyano methoxyquinoline (180 mg) was added to 5.5 ml of toluene, and the mixture was heated to reflux. After then adding 2,4-difluorophenyl isocyanate (0.12 ml), the mixture was further heated to reflux for 1 hour. After cooling, the precipitated solid was filtered out and washed with ethyl acetate/toluene = 1/1 to obtain 195 mg of the title compound as light brown crystals (70% yield). 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.05 (3H, s) , 6.52 (1H, d, J = 5.2 Hz), 7.01-7.08 (1H, m), 7.21-7.34 (3H, m) , 7.56-7.62 (3H, m) , 8.02-8.10 (1H, m), 8.52(1H, s),

8.72 (1H, d, J=5.2Hz), 8.76 (1H, s), 9.18 (1H, s). Example

N-(4-(6-Cyano methoxy quinolyl) oxyphenyl)-Ν'phenylurea

4-(4-Aminophenoxy) cyano methoxyquinoline (148 mg) was added to 5.5 ml of toluene, and the mixture was heated to reflux. After then adding phenyl isocyanate (0.08 ml), the mixture was further heated to reflux for 1 hour. After cooling, the precipitated solid was filtered out and washed with ethyl acetate/toluene = 1/1 to obtain 150 mg of the title compound as light brown crystals.

FP01 00 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.05 (3H, s) , 6.50-6.54 (1H, m) , 6.96 (t, 1H, 7.2Hz), 7.23 (2H, d, J=9.2Hz), 7.27 (2H, d, J=7.2Hz), 7.44 (2H, d, J=7.2Hz),

7.56-7.62 (3H, m), 8.68-8.77 (3H, m), 8.83 (1H, brs). Example

N-(4-(6-Cyano methoxy quinolyl)oxyphenyl)-N'-(1butyl)urea

4- (4-Aminophenoxy) cyano methoxyquinoline (150 mg) was added to 2.5 ml of toluene and 2.5 ml of acetonitrile, and the mixture was heated to reflux. After then adding n-butyl isocyanate (0.12 ml), the mixture was further heated to reflux for 1 hour. After cooling, the precipitated solid was filtered out and washed with ethyl acetate/toluene = 1/1 to obtain 110 mg of the title compound as light brown crystals (55% yield). 1H-NMR Spectrum (DMSO-dg) δ(ppm) : 0.88 (3H, t, J=7.6Hz), 1.25-1.45 (4H, m), 3.04-3.11 (2H, m), 4.05 (3H, s), 6.13 (1H, t, J=5.6Hz), 6.49 (1H, d, J=5.6Hz), 7.16 (2H, d, J=9.2Hz), 7.52 (2H, d, J=9.2Hz), 7.58 (1H, s), 8.55 (1H, s), 8.71 (1H, d, J=5.6Hz), 8.75 (1H, s) Example

N-(4-(6-Cyano methoxy quinolyl)oxyphenyl)-N'-(4fluorophenyl)urea

4-(4-Aminophenoxy) cyano-7methoxyethoxyquinoline (150 mg) was added to 5,0 ml of

FP01 00 toluene and 2.5 ml of acetonitrile, and the mixture was heated to reflux. After then adding 4-fluorophenyl isocyanate (0.12 ml), the mixture was further heated to reflux for 1 hour. After cooling, the precipitated solid was filtered out and washed with ethyl acetate/toluene = 1/1 to obtain 150 mg of the title compound as light brown crystals (68% yield).

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.05 (3H, s), 6.52 (IH, d, J=5.6Hz), 7.08-7.14 (2H, m), 7.23 (2H, d, J=8.8Hz), 7.43-7.49 (2H, m), 7.56-7.61 (3H, m), 8.71-

8.76 (3H, m), 8.85 (IH, s) Example

N-¢4-(6-Cyano methoxy quinolyl)oxyphenyl)-N* 1 -(2pyridyl)urea

Phenyl N-(4-(6-cyano methoxy-4quinolyl)oxyphenyl)carbamate (150 mg) and 2aminopyridine (69 mg) were dissolved in 1 ml of dimethylsulfoxide, and the solution was heated and stirred at 80°C for 1.5 hours. After cooling, water was added, and the precipitated solid was filtered out and washed with ethyl acetate to obtain 82 mg of the title compound as light brown crystals (54% yield).

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.05 (3H, s), 6.54 (IH, d, J=5.6Hz), 6.98-7.03 (IH, m), 7.26-7.30 (2H, m) , 7.45-7.52 (IH, m), 7.60 (IH, s), 7.63-7.78 (3H, m),

8.25-8.30 (IH, m), 8.73 (IH, d, J=5.6Hz), 8.78 (IH, s),

FP01 00

9.59 (1H, s), 10.67 (1H, s) Example

N- (4-(6-Cyano methoxyethoxy quinolyl)oxyphenyl)-N'(3-pyridyl)urea

The title compound (32 mg, 32% yield) was obtained as light brown crystals from phenyl N-(4-(6-cyano-7methoxy quinolyl)oxyphenyl)carbamate (100 mg) and 3aminopyridine (46 mg), in the same manner as Example 40. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.05 (3H, s) , 6.53 (1H, d, J=5.2Hz), 7.22-7.34 (3H, m), 7.57-7.63 (3H, m) , 7.91-7.96 (1H, m), 8.17-8.20 (1H, m), 8.59-8.63 (1H, m),

8.73 (1H, d, J=5.2Hz), 8.76 (1H, s), 8.91 (1H, brs), 9.00 (1H, brs). Example

N-(4-(6-Cyano methoxyethoxy quinolyl)oxyphenyl)-N'(4-pyridyl)urea

The title compound (45 mg, 30% yield) was obtained as light brown crystals from phenyl N-(4-(6-cyano-7methoxy quinolyl)oxyphenyl)carbamate (150 mg) and 4aminopyridine (69 mg), in the same manner as Example 40. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.05 (3H, s), 6.54 (1H, d, J=5.2Hz), 7.26 (2H, d, J=9.0Hz), 7.43 (2H, d, J=7.0Hz), 7.57-7.64 (3H, m), 8.35 (2H, d, J=7.0Hz), 8.71-8.77 (2&amp;#1523;H, m) , 9.05 (1H, brs), 9.16 (1H, brs). Example

N-(4-(6-Cyano (3&amp;#1470;(diethylamino)propoxy)-4210

FP01 00 quinolyl) oxyphenyl)-N'- (4-methoxyphenyl) urea

The title compound (10 mg) was obtained from sodium 6-cyano (4-((4methoxyanilino)carbonyl)aminophenoxy) quinolinolate (131 mg) by the same procedure as in Example 7. 1H-NMR(CDC13) δ(ppm): 2.02-2.15 (2H, m), 2.27 (6H, s),

2.54 (2H, t, J=7.4 Hz), 3.80 (3H, s),4.28(2H, t, J=7.4 Hz), 6.42 (1H, d, J=5.3 Hz), 6.80 (1H, brs), 6.90 (2H, d, J=9.3 Hz), 7.03(lH, brs), 7.08 (2H, d, J=9.3 Hz),

7.28 (2H, d, J=9.3 Hz), 7.46(1H, s), 7.48 (2H, d, J=

9.3 HZ), 8.62 (1H, d, J=5.3 Hz), 8.66 (1H, s) Example

N-[4-(6-Cyano (2-(dimethylamino)ethoxy)-4quinolyl)oxyphenyl)-Ν'-(4-methoxyphenyl)urea

The title compound (110 mg) was obtained from sodium 6-cyano (4-((4methoxyanilino)carbonyl)aminophenoxy) quinolinolate (145 mg), by the same procedure as in Example 7. 1H-NMR(DMSO-d6) δ(ppm): 2.28 (6H, s), 2.76 (2H, t, J=5.3 Hz), 3.70 (3H, s),4.37(2H, t, J=5.3Hz), 6.51 (1H, d, J=5.4 Hz), 6.86 (2H, d, J=8.7 Hz), 7.21 (2H, d, J=8.7 Hz), 7.35 (2H, d, J=8.7 Hz), 7.58 (2H, d, J= 8.7 Hz), 7.62(1H, s), 8.50 (1H, s), 8.72 (1H, d, J= 5.4 Hz), 8.75(2H, s) Example

N- (4-(6-Cyano (3-(1-pyrrolidino)propoxy)-4211

FP01 00 quinolyl)oxyphenyl-N'-(4-methoxyphenyl)urea N- (4-(6-Cyano (3-chloropropoxy)-4quinolyl)oxyphenyl)-N4)-&amp;#1523;-methoxyphenyl)urea (140 mg) was dissolved in dimethylformamide, pyrrolidine (163 μ&amp;#912;) was added, and the mixture was heated and stirred at 80°C for 6 hours. The reaction solution was poured into saturated brine and extracted with ethyl acetate. The organic layer was dried over magnesium sulfate and concentrated. The residue was passed through NH silica gel (Fuji Silysia Chemical) and eluted with a solvent (ethyl acetate), and then further eluted with another solvent (ethyl acetate:methanol = 10:1) and concentrated to obtain 31 mg of the title compound.

1H-NMR (DMSO-d6) δ(ppm) : 1.67-1.73 (4H, m) , 1.96-2.04 (2H, m), 2.44-2.49 (4H, m), 2.61 (2H, t, J= 6.8 Hz), 3.72 (3H, s), 4.34 (2H, t, J=6.4 Hz), 6.53 (1H, d, J=5.2 Hz), 6.88 (2H, d, J=8.8 Hz), 7.23 (2H, d, J=9.2 Hz), 7.37 (2H, d, J=8.8 Hz), 7.60 (1H, s) , 7.61 (2H, d, J=9.2 Hz), 8.63 (1H, brs), 8.73 (1H, d, J= 5.2 HZ),

8.76 (1H, s), 8.88 (1H, brs).

Example

N-(4- (6-Cyano (3-(1-piperidino)propoxy)-4quinolyl)oxyphenyl)-Ν'-(4-methoxyphenyl)urea

The title compound (67 mg) was obtained from sodium 6-cyano (4-((4methoxyanilino)carbonyl)aminophenoxy) quinolinolate

FP01 00 (156 mg), by the same procedure as in Example 7. 1H-NMR (DMSO-d6) δ(ppm): 1.30-1.57(6H, m), 1.93-2.03 (2H, m), 2.31-2.53(6H, m), 3.72 (3H, s),4.33(2H, t, J=6.5 Hz),

6.52 (1H, d, J=4.9 Hz), 6.87 (2H, d, J=8.9 Hz), 7.23 (2H, d, J=8.9 Hz), 7.38 (2H, d, J=8.9 Hz), 7.577.63(3H, m),8.53(lH, brs), 8.72 (1H, d, J=4.9 Hz), 8.76(1H, s), 8.79(1H, brs) Example N-(4- (6-Cyano (2-(1-pyrrolidino)ethoxy) -4quinolyl)oxyphenyl)-N'-(4-methoxyphenyl)urea

The title compound (54 mg) was obtained from sodium 6-cyano (4-((4methoxyanilino)carbonyl)aminophenoxy) quinolinolate (188 mg), by the same procedure as in Example 7. 1H-NMR(DMSO-d6) δ(ppm): 1.684)1.74&amp;#1470;H, m), 2.584)2.65&amp;#1470;H, m), 2.93(2H, t, J=6.4 Hz), 3.72(3H, s),4.40(2H, t, J=6.4 Hz), 6.53(1H, d, J5.7&amp;#1470;&amp;#1470; Hz), 6.88 (2H, d, J=9.1

Hz), 7.24 (2H, d, J=9.1 Hz), 7.37 (2H, d, J=9.1 Hz),

7.60 (2H, d, J=9.1 Hz), 7.62(1H, s), 8.52 (1H, s), 8.73 (1H, d, J=5.7 Hz), 8.77 (2H, s)

Example

N-(4-(6-Cyano (3-(diethylamino)propoxy)-4quinolyl)oxyphenyl)-N'-(4-methoxyphenyl)urea

The title compound (45 mg) was obtained from sodium 6-cyano (4-((4methoxyanilino)carbonyl)aminophenoxy) quinolinolate

FP01 00 (134 mg), by the same procedure as in Example &amp;#906;. 1H-NMR (DMSO-d6) δ(ppm): 0.97(6H, t, J=7.8Hz ), 1.881.96(2H, m), 2.43-2.53 (4H, m), 2.61(2H, t, J=7.8 Hz),

3.72 (3H, s),4.33(2H, t, J=7.8 Hz), 6.53(1H, d, J=5.2

Hz), 6.88 (2H, d, J=8.8 Hz), 7.24 (2H, d, J=8.8 Hz),

7.38 (2H, d, J=8.8 Hz), 7.533)7.63&amp;#1470;H, m), 8.55(1H, s),

8.73 (1H, d, J=5.2 Hz), 8.76 (1H, s), 8.8O(1H, s) Example

N-(4-(6-Cyano (3-(dimethylamino)propoxy)-4quinolyl)oxy fluorophenyl)-N'-(2,4difluorophenyl)urea

The title compound (35 mg) was obtained from sodium 6-cyano (4-((2,4difluoroanilino)carbonyl)amino fluorophenoxy)-7quinolinolate (100 mg), by the same procedure as in Example 7.

1H-NMR (DMSO-d6) δ (ppm) : 1.94-2.01(2H, m) , 2.43 (2H, t, J=7.2 Hz), 2.50(6H, s),4.33(2H, t, J7.2=&amp;#1470; Hz), 6,64 (1H, d, J=5.2 Hz), 7.04-7.46 (4H, m), 7.61 (1H, s) , 8.098.34(2H, m), 8.74-8.78 (2H, m) ,9.06(lH, brs), 9.14 (lH,brs).

Example

N- (4-(6-Cyano (3-(diethylamino)propoxy)-4quinolyl)oxy fluorophenyl)-N'-(2,4difluorophenyl)urea

The title compound (43 mg) was obtained from

FP01 00 sodium 6-cyano (4-((2,4difluoroanilino)carbonyl)amino fluorophenoxy)-7quinolinolate (95 mg), by the same procedure as in Example 7.

1H-NMR (DMSO-dg) δ (ppm) : 0.97 (6H, t, J=7.8Hz ), 1.881.98(2H, m), 2.45-2.52 (4H, m) , 2.61(2H, t, 5=1.8 Hz), 4.33(2H, t, 5=1.8 Hz), 6.63(1H, d, J=5.9 Hz), 7.037.45(4H, m), 7.60 (1H, s), 8.09-8.17 (1H, m), 8.28(1H, t, J=11.5Hz), 8.74-8.78(2H, m), 9.03(lH, brs), 9.11(1H, brs) .

Example

N- (4- (6-Cyano (4-(dimethylamino)butoxy)-4quinolyl)oxyphenyl)-N'-(4-methoxyphenyl)urea

N- (4-(6-Cyano (4-chlorobutoxy)-4quinolyl)oxyphenyl)-N'-(4-methoxyphenyl)urea (120 mg) was dissolved in dimethylformamide (3 ml), and then a 50% dimethylamine solution (93 pl) was added and the mixture was heated and stirred at 70°C for 5 hours. The reaction solution was poured into saturated brine and extracted with ethyl acetate, and the organic layer was dried over magnesium sulfate and concentrated. The residue was passed through NH silica gel (Fuji Silysia Chemical) and eluted with a solvent (ethyl acetate), and then further eluted with another solvent (ethyl acetate:methanol = 10:1) and concentrated. The obtained solid was passed through Merck Silica Gel

FP01 00 using tetrahydrofuran, and after eluting the insoluble portion with tetrahydrofuran and ethyl acetate, it was further eluted with solvents (tetrahydrofuran:methanol: triethylamine = 10:1:1, ethyl acetate:methanol:triethylamine = 10:1:1) and concentrated to obtain 10 mg of the title compound as a solid.

1H-NMR (DMSO-d6) δ(ppm) : 1.71-1.78 (2H, m), 1.82-1.91 (2H, m), 2.42 (6H, s), 2.64-2.72 (2H, m), 3.72 (3H, s),

4.33 (2H, t, J=6.0 Hz), 6.54 (1H, d, J=5.2 Hz), 6.88 (2H, d, J=8.8 Hz), 7.23 (2H, d, J=8.8 Hz), 7.37 (2H, d, J=8.8 Hz), 7.60 (2H, d, J=8.8 Hz), 7.61 (1H, s) , 8.64 (1H, brs), 8.73 (1H, d, J= 5.2 Hz), 8.78 (1H, s), 8.91 (1H, brs).

Example

N- (4- (6-Cyano (4-morpholinobutoxy)-4quinolyl)oxyphenyl.)-N' methoxyphenyl) urea

The title compound (11 mg) was obtained from N-(4(6-cyano (4-chlorobutoxy) quinolyl)oxyphenyl)-N'(4-methoxyphenyl)urea (110 mg), in the same manner as Example 51.

1H-NMR(DMSO-d6) δ(ppm): 1,65-1.77 (2H, m), 1.841.93&amp;#1470; (2H, m), 2.32-2.48 (6H, m), 3.51-3.66 (4H, m), 3.72 (3H, s), 4.33 (2H, t, J=6.0 Hz), 6.53 (1H, d, J=4.8 Hz), 6.88 (2H, d, J=8.4 Hz), 7.24 (2H, d, J=8.4 Hz), 7.37 (2H, d, J=8.4 Hz), 7.60 (2H, d, J=8.4 Hz), 7.61 (1H, s),

FP01 00

8.57 (1H, brs), 8.73 (1H, d, J= 4.8 Hz), 8.78 (1H, s),

8.82 (1H, brs) .

Example

N- (4- (6-Cyano (3-(1-(4-ethyl)piperazino)propoxy)-4quinolyl)oxyphenyl)-N'-(4-methoxyphenyl)urea

The title compound (16 mg) was obtained from N-(4(6-cyano (3-chloropropoxy) quinolyl)oxyphenyl)-Ν'(4-methoxyphenyl)urea (150 mg), in the same manner as Example 51.

1H-NMR(DMSO-d6) δ(ppm): 0.98 (3H, t, J= 7.2Hz), 1.91&amp;#1470; 2.06 (2H, m), 2.26-2.48 (12H, m) , 3.72 (3H, s), 4.33 (2H, t, J= 6.0 Hz), 6.53 (1H, d, J= 5.2 Hz), 6.88 (2H, d, J= 8.8 Hz), 7.23 (2H, d, J= 8.8 Hz), 7.37 (2H, d, J= 8.8 Hz), 7.59 (1H, s), 7.60 (2H, d, J= 8.8 Hz), 8.58 (1H, brs), 8.73 (1H, d, J= 5.2 HZ), 8.76 (1H, s), 8.83 (1H, brs).

Example

N-(4-(6-Cyano (2-(4-morpholino)ethoxy)-4quinolyl)oxy fluorophenyl)-N'-(2,4difluorophenyl)urea

The title compound (10 mg) was obtained from sodium 6-cyano (4-((2,4difluoroanilino)carbonyl)amino fluorophenoxy)-7quinolinolate (200 mg), by the same procedure as in Example 7.

1H-NMR (DMSO-dg) δ(ppm): 2.56 (4H, t, J= 4.4 Hz), 2.83

FP01 00 (2H, t, J= 5.6 Hz), 3.59 (4H, t, J- 4.4 Hz), 4.43 (2H, t, J= 5.6 Hz), 6.64 (1H, d, J=5.2 Hz), 7.04-7.10 (1H, m), 7.14-7.19 (1H, m), 7.30-7.36 (1H, m), 7.42 (1H, dd, J= 2.8 Hz, J= 12 Hz), 7.66 (1H, s), 8.10-8.16 (1H, m),

8.28 (1H, t, J= 9.2 HZ), 8.75 (1H, s) , 8.76 (1H, d, J=

5.2 Hz), 9.02-9.05 (1H, m) , 9.09-9.13 (1H, m) .

Example

N-(4-(6-Cyano (3-cyanopropoxy) quinolyl)oxy-2fluorophenyl)-N'-(2,4-difluorophenyl)urea

The title compound (15 mg) was obtained from sodium 6-cyano (4-((2, 4difluoroanilino)carbonyl)amino fluorophenoxy)-7quinolinolate (300 mg), in the same manner as Example 7. 1H-NMR (DMSO-d6) δ(ppm): 2.14-2.21 (2H, m), 2.73 (2H, t, J= 7.2 Hz), 4.38 (2H, t, J= 6.4 Hz), 6.65 (1H, d, J=5.2 Hz), 7.04-7.11 (1H, m), 7.15-7.19 (1H, m), 7.31-7.37 (1H, m), 7.43 (1H, dd, J= 2.8 Hz, J= 11.6 Hz), 7.67 (1H, s), 8.10-8.16 (1H, m), 8.29 (1H, t, J= 9.2 HZ), 8.77 (1H, d, J= 5.2 Hz), 8.79 (1H, s), 9.03-9.06 (1H, m), 9.11-9.14 (1H, m).

Example

N-(4 Cyano (2-(methylthio)ethoxy quinolyl)oxy-2fluorophenyl)-Ν'-(2,4-difluorophenyl)urea

The title compound (95 mg) was obtained from sodium 6-cyano (4-((2,4difluoroanilino)carbonyl)amino fluorophenoxy)-7218

FP01 00 quinolinolate (130 mg), in the same manner as Example 7. 1H-NMR (DMSO&amp;#1470;d6) δ (ppm) : 2.25 (3H, s) , 2.99 (2H, t, J= 6.0 Hz), 4.49 (2H, t, J= 6.0 Hz), 6.64 (1H, d, J=5.2 Hz), 7.04-7.11 (1H, m), 7.15-7.19 (1H, m), 7,30-7.37 (1H, m), 7.43 (1H, dd, J= 2.4 Hz, J= 11.6 Hz), 7.66 (1H, s), 8.09-8.17 (1H, m), 8.29 (1H, t, J= 9.2 Hz), 8.76 (1H, d, J= 5.2 Hz), 8.77 (1H, s), 9.01-9.05 (1H, m) , 9.09-9.13 (1H, m).

Example

N- (4- (6-Cyano (2-(methylsulfonyl)ethoxy)-4quinolyl)oxy fluorophenyl)-N'-(2,4difluorophenyl)urea

N- (4 Cyano (2-(methylthio)ethoxy-4quinolyl)oxy fluorophenyl)-Ν'-(2,4difluorophenyl)urea (84 mg) was dissolved in a methanol (1 ml) and methylene chloride (5 ml) mixed solvent, 2 equivalents of meta-perbenzoic acid was added while stirring at 0°C, and the mixture was stirred for 30 minutes. The reaction solution was poured into a saturated aqueous sodium bicarbonate solution and extracted with ethyl acetate, and the organic layer was dried over magnesium sulfate and then concentrated. The residue was passed through NH silica gel (Fuji Silysia Chemical), eluted with a solvent (ethyl acetate:hexane = 10:1) and concentrated to obtain 21 mg of the title compound.

FP01 00 1H-NMR (DMSO-dg) δ(ppm): 3.02 (3H, s), 3.79 (2H, t, J= 4.8 Hz), 4.67 (2H, t, J= 4.8 Hz), 6.67 (1H, d, J=5.2 Hz), 7.04-7.10 (1H, m), 7.15-7.19 (1H, m) , 7.31-7.34 (1H, m), 7.43 (1H, dd, J= 2.8 Hz, J= 12 Hz), 7.73 (1H, s), 8.10-8.16 (1H, m), 8.28 (1H, t, J= 9.2 HZ), 8.79 (1H, d, J= 5.2 Hz), 8.81 (1H, s) , 9.02-9.05 (1H, m), 9.11-9.14 (1H, m).

Example

N-(4- (6-Cyano (2-(methylthio)ethoxy)-4quinolyl)oxyphenyl)-Ν'-(4-fluorophenyl)urea

The title compound (112 mg) was obtained from sodium 6-cyano (4-((2,4difluoroanilino)carbonyl)amino fluorophenoxy)-7quinolinolate (300 mg), in the same manner as Example 7. 1H-NMR(DMSO-d6) δ(ppm): 2.25 (3H, s), 2.99 (2H, t, J= 6.0 Hz), 4.49 (2H, t, J= 6.0 Hz), 6.54 (1H, d, J=5.2 Hz), 7.13 (2H, t, J= 8.8 Hz), 7.25 (2H, d, J= 8.8 Hz), 7.46-7.51 (2H, m), 7.61 (2H, d, J= 8.8 Hz), 7.65 (1H, s), 8.74 (1H, d, J= 5.2 Hz), 8.78 (1H, s), 8.82 (1H, brs), 8.91 (1H, brs).

Example

N- (4-(6-Cyano (2-(methylsulfonyl)ethoxy)-4quinolyl)oxyphenyl)-N'-(4-fluorophenyl)urea

The title compound (11 mg) was obtained from N-(4(6-cyano (2-(methylthio)ethoxy)-4quinolyl)oxyphenyl)-N4)-&amp;#1523;-fluorophenyl)urea (100 mg),

FP01 00 in the same manner as Example 56.

1H-NMR (DMSO-d6) δ (ppm) : 3.20 (3H, s) , 3.79 (2H, t, J=

5.6 Hz), 4.69 (2H, t, J= 5.6 Hz), 6.57 (1H, d, J=5.2 Hz), 7.13 (2H, t, J= 8.8 Hz), 7.25 (2H, d, J= 8.8 Hz), 7.46-7.52 (2H, m), 7.62 (2H, d, J= 8.8 Hz), 7.72 (1H, s), 8.76 (1H, d, J= 5.2 Hz), 8.82 (1H, s), 8.90 (1H, brs), 8.99 (1H, brs). Example

N- (4- (6&amp;#1470;Chloro5,7&amp;#1470;-dimethoxy quinolyl)oxy-2fluorophenyl)-Ν'-(2,4-difluorophenyl)urea

The title compound (173 mg) was obtained from 4(4-amino fluorophenoxy) chloro-5,7dimethoxyquinoline (235 mg) and 2,4-difluorophenyl isocyanate, in the same manner as Example 10. 1H-NMR(DMSO-d6) δ(ppm): 3.93 (3H, s) , 4.07 (3H, s),

6.67 (1H, d, J= 5.2 Hz), 6.91-6.96 (1H, m), 7.00 (1H, s), 7.03-7.09 (1H, m), 7.20 (1H, dd, J= 2.8 Hz, J= 8.0 Hz), 7.30-7.37 (1H, m), 8.08-8.20 (2H, m), 8.69 (1H, d, J= 5.2 Hz), 9.01 (1H, brd, J= 2.0 Hz), 9.04 (1H, brd, J= 2.0 Hz). Example

N-(4-(6-Cyano methoxy quinolyl)oxy fluorophenyl)Ν'- (2,4-difluorophenyl)urea

The title compound (130 mg) was obtained from 4(4-amino fluorophenoxy) cyano methoxyquinoline (238 mg) and 2,4-difluorophenyl isocyanate, in the same

FP01 00 manner as Example 10.

1H-NMR (DMSO-d6) δ(ppm) : 4.08 (3H, s) , 6.64 (1H, d, J=

5.2 Hz), 7.04-7.10 (1H, m), 7.15-7.19(1H, m), 7.31-7.37 (1H, m), 7.43 (1H, dd, J= 2.8 Hz, J= 12 Hz), 7.63 (1H, s), 8.13 (1H, dt, J= 6.4 Hz, J= 9.2 Hz), 8.29 (1H, t, J= 9.2 Hz), 8.77 (1H, d, J= 5.2 Hz), 8.78 (1H, s), 9.05 (1H, brs), 9.13 (1H, brs).

Example

N-(4-(6-Cyano methoxy quinolyl)oxyphenyl)-N'-(4methoxyphenyl)urea

The title compound (55 mg) was obtained from 4amino(4-aminophenoxy) cyano methoxyquinoline (170 mg) and 4-methoxyphenyl isocyanate, in the same manner as Example 10. 1H-NMR(DMSO-d6) δ(ppm): 3.72 (3H, s), 4.07 (3H, s),

6.54 (1H, d, J= 5.2 Hz), 6.88 (2H, d, J= 8.8 Hz),7.24 (2H, d, J= 8.8 Hz), 7.37 (2H, d, J= 8.8 Hz), 7.60(2H, d, J= 8.8 Hz), 7.61 (1H, s), 8.62 (1H, brs), 8.74(1H, d, J= 5.2 Hz), 8.78 (1H, s), 8.87 (1H, brs).

Example

N- (4-(6-Cyano (2-(4-morpholino)ethoxy)-4quinolyl)oxyphenyl)-N'-(4-methoxyphenyl)urea

The title compound was obtained from sodium 6cyano (4-((4-methoxyanilino)carbonyl)aminophenoxy)-7quinolinolate, in the same manner as Example 7. 1H-NMR(DMSO-d6) δ(ppm): 2.50-2.55 (4H, m), 2.87 (2H, t,

FP01 00

J= 5.6 Hz), 3.57 (4H, t, J= 4.4 Hz), 3.60 (3H, s) , 4.38 (2H, t, J= 5.6 Hz), 6.85 (2H, d, J= 8.8 Hz), 7.02 (1H, s), 7.06 (1H, d, J= 5.2 Hz), 7.21 (2H, d, J= 8.8 Hz), 7.36 (2H, d, J= 8.8 Hz), 7.58 (2H, d, J= 8.8 Hz), 8.65 (1H, s), 8.68 (1H, brs), 8.73 (1H, d, J= 5.2 Hz), 8.92 (1H, brs) Example

N- (4- (6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'-cyclohexylurea

The title compound (25 mg) was obtained from 4-(4aminophenoxy) cyano (2-methoxyethoxy)quinoline (60 mg) and cyclohexyl isocyanate, in the same manner as Example 10.

1H-NMR (DMSO&amp;#1470;d6) δ (ppm) : 1.12-1.24 (3H, m), 1.26-1.38 (2H, m), 1.51-1.59 (1H, m), 1.63-1.72 (2H, m), 1.78-

1.86 (2H, m), 3.38 (3H, s), 3.42-3.52 (1H, m) , 3.78-

3.80 (2H, m),4.42-4.44 (2H, m), 6.18 (1H, brd, J= 8.0 Hz), 6.50 (1H, d, J= 5.2 Hz), 7.18 (2H, d, J= 9.2 Hz),

7.53 (2H, d, J= 9.2 Hz), 7.63 (1H, s), 8.55 (1H, brs),

8.72 (1H, d, J= 5.2 Hz), 8.77 (1H, s).

Example

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl) oxyphenyl)-N1-phenylurea

4-(4-Aminophenoxy) cyano (2methoxyethoxy)quinoline (600 mg) was suspended in toluene (15 ml), and the suspension was heated to

FP01 00 reflux for dissolution, after which phenyl isocyanate (292 μ&amp;#912;) was added dropwise and the mixture was heated to reflux for 30 minutes. After cooling, the precipitated solid was filtered out, washed with ether and ethyl acetate and dried to obtain 760 mg of the title compound.

1H-NMR (DMSO&amp;#1470;d6) δ(ppm): 3.38 (3H, s), 3.78-3.81 (2H, m) ,

4.42- 4.45 (2H, m), 6.54 (1H, d, J= 5.2 Hz), 6.98 (1H, t, J= 7.2 Hz), 7.24-7.31 (4H, m), 7.47 (2H, d, J= 7.2 Hz),

7.62 (2H, d, J= 8.8 Hz), 7.64 (1H, s) , 8.74 (1H, d, J=

5.2 Hz), 8.79 (1H, s), 8.85 (1H, brs), 8.99 (1H, brs). Example

N- (4- (6-Cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-N'-(2,4-difluorophenyl)urea

4-(4-Amino fluorophenoxy) cyano (2methoxyethoxy)quinoline (352 mg) was suspended in toluene (20 ml) and the suspension was heated to reflux for dissolution, after which 2,4-difluorophenyl isocyanate (236 μ&amp;#912;) was added dropwise and the mixture was heated to reflux for 30 minutes. After cooling, the precipitated solid was filtered out, washed with ether and ethyl acetate and dried to obtain 380 mg of the title compound.

1H-NMR(DMSO-d6) δ(ppm): 3.38 (3H, s), 3.78-3.81 (2H, m) ,

4.42- 4.46 (2H, m), 6.64 (1H, d, J= 5.2 Hz), 7.04-7.11 (1H, m) , 7.15-7.19 (1H, m), 7.31-7.37 (1H, m), 7.43 (1H,

FP01 00 dd, J= 2.8 Hz, J= 8.0 Hz), 7.66 (1H, s), 8.13 (1H, dt, J= 6 Hz, J= 9.2 Hz), 8.28 (1H, t, J- 9.2Hz), 8.76 (1H, d, J= 5.2 Hz), 8.77 (1H, s), 9.05 (1H, brs), 9.13 (1H, brs) . Example

N-(4-(6-Cyano2)-7&amp;#1470;-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-N'-(methoxyphenyl) urea

The title compound (570 mg) was obtained from 4(4-amino fluorophenoxy) cyano (2methoxyethoxy)quinoline (620 mg) and 4-methoxyphenyl isocyanate, in the same manner as Example 10. 1H-NMR(DMSO-dg) δ(ppm): 3.38 (3H, s), 3.73 (3H, s), 3.78-3.81 (2H, m) , 4.43-4.45 (2H, m), 6.63 (1H, d, J=

5.2 Hz), 6.89 (2H, d, J= 8.8 Hz), 7.13-7.17 (1H, m) , 7.37 (2H, d, J= 8.8 Hz), 7.41 (1H, dd, J= 2.8 Hz, J=

11.6 Hz), 7.65 (1H, s), 8.28 (1H, t, J= 8.8 Hz), 8.60 (1H, brs), 8.76 (1H, d, J= 5.2 Hz), 8.77 (1H, s), 8.94 (1H, brs). Example

N-(4-(6-Cyano (methoxyethoxy) quinolyl)oxyphenyl)N'-(4-methoxyphenyl) urea

The title compound (450 mg) was obtained from 4(4-aminophenoxy) cyano (2-methoxyethoxy)quinoline (890 mg) and 4-methoxyphenyl isocyanate, in the same manner as Example 10. 1H-NMR(DMSO-d6) δ(ppm): 3.36 (3H, s), 3.70 (3H, s),

FP01 00

3.76-3.79 (2H, m) , 4.40-4.42 (2H, m) , 6.51 (IH, d, J=

5.6 Hz), 6.86 (2H, d, J= 8.8 Hz), 7.22 (2H, d, J= 8.8 Hz), 7.35 (2H, d, J= 8.8 Hz), 7.58 (2H, d, J= 8.8 Hz),

7.62 (IH, s), 8.53 (1H, brs), 8.71 (IH, d, J= 5.6 Hz), 8.76 (IH, s), 8.80 (IH, brs). Example

N-((4-Pyrimidyl)oxyphenyl)-Ν'-(4-methoxyphenyl)urea Palladium hydroxide (20 mg) was added to solution of 6-chloro (4-nitrophenoxy)pyrimidine (300 mg) in an ethyl acetate (10 ml)-methanol (10 ml) mixed solvent, and the mixture was stirred for 13 hours at room temperature under a hydrogen atmosphere at normal pressure. The reaction solution was filtered, the filtrate was concentrated, and the residue was passed through NH silica gel (Fuji Silysia Chemical). Elution was performed with a solvent (ethyl acetate:hexane = 1:2) to obtain 70 mg of 4-(4-aminophenoxy)pyrimidine. The title compound (107 mg) was obtained from the obtained 4-(4-aminophenoxy)pyrimidine (70 mg) and 4methoxyphenyl isocyanate, in the same manner as Example

10.

1H-NMR (DMSO-d6) δ (ppm) : 3.72 (3H, s) , 6.87 (2H, d, J=

8.8 Hz), 7.09 (IH, dd, J= 1.6 Hz, J- 5.6 Hz), 7.12 (2H, d, J= 8.8 Hz), 7.36 (2H, d, J= 8.8 Hz), 7.51 (2H, d, J=

8.8 Hz), 8.56 (IH, s), 8.66 (IH, d, J= 5.6 HZ), 8.748.76 (2H, m).

FP01 00

Example

N- (4- (6-Cyano (3-methoxycarbonylpropoxy)-4quinolyl) oxyphenyl)-N'- (4-methoxyphenyl) urea

The title compound was obtained from sodium 6cyano (4-((4-methoxyanilino)carbonyl)aminophenoxy)-7quinolinolate, in the same manner as Example 7.

1H-NMR (DMSO-d6) δ(ppm): 2.09 (2H, tt, J= 6.4 Hz, J= 6.4 Hz), 2.56 (2H, t, J= 6.4 Hz), 3.62 (3H, s), 3.71 (3H, s), 4.31 (2H, t, J= 6.4 Hz), 6.52 (1H, d, J= 5.2 Hz),

6.86 (2H, d, J= 8.8 Hz), 7.22 (2H, d, J= 8.8 Hz), 7.35 (2H, d, J= 8.8 Hz), 7.57 (2H, d, J= 8.8 Hz), 7.59 (1H, s), 8.50 (1H, s), 8.72 (1H, d, J= 5.2 Hz) 8.74 (1H, s), 8.75 (1H, s).

Example

N- (4- (6-Cyano (3-carboxypropoxy)-4quinolyl)oxyphenyl)-Ν'-(4-methoxyphenyl)urea

N- (4-(6-Cyano (3-methoxycarbonylpropoxy)-4quinolyl)oxyphenyl)-N4)-&amp;#1523;-methoxyphenyl)urea (100 mg) was added to a methanol (16 ml) and 2N aqueous sodium hydroxide (3 ml) mixed solvent, and the mixture was heated and stirred at 80°C for 35 minutes. The reaction solution was filtered, and then 1.2 ml of aqueous 5N hydrochloric acid was added. The precipitated solid was filtered out and washed with methanol and then ether to obtain 50 mg of the target substance as a light yellow solid.

FP01 00 1H-NMR (DMSO-d6) δ(ppm): 2.05 (2H, tt, J= 6.4 Hz, J= 6.4 Hz), 2.47 (2H, t, J= 6.4 Hz), 3.70 (3H, s), 4.31 (2H, t,

J= 6.4 Hz), 6.52 (1H, d, J= 5.2 Hz), 6.86 (2H, d,J=

8.8 Hz), 7.22 (2H, d, J= 8.8 Hz), 7.35 (2H, d, J=8.8

Hz), 7.57 (2H, d, J= 8.8 Hz), 7.59 (1H, s) , 8.50(1H,

S), 8.71 (1H, d, J= 5.2 Hz) 8.75 (1H, s), 8.76 (1H, s). Example

N- (4- (6-Cyano (2-(2-hydroxyethoxy)ethoxy) quinolyl) oxyphenyl)-Ν'-(4-methoxyphenyl)urea

The title compound was obtained from sodium 6cyano (4-((4-methoxyanilino)carbonyl)aminophenoxy)-7quinolinolate, in the same manner as Example 7.

1H-NMR (DMSO-d5) δ(ppm) : 3.544) 3.57&amp;#1470;H, m), 3.72 (3H, s),

3.87-3.90 (2H, m), 4.41-4.45 (2H, m), 4.62-4.65 (1H, m),

6.54 (1H, d, J=5.2 Hz), 6.87 (2H, d, J=8.8 Hz),7.24 (2H, d, J=8.8 Hz), 7.38 (2H, d, J=8.8 Hz), 7.60 (2H,d,

J=8,8 Hz), 7.64 (1H, s), 8.62 (1H, brs), 8.74 (1H, d, J= 5.2 Hz), 8.78 (1H, s), 8.87 (1H, brs).

Example

N-(4-(6-Cyano (3-(diethylamino)propoxy)-4quinolyloxy)phenyl)-N(3-(methylsulfonyl)phenyl)urea

The title compound (8.8 mg, 0.015 mmol, 6.0%) was obtained as light brown crystals from N ((6-cyano-7hydroxy quinolyl)oxy)phenyl-N 3)-&amp;#1523;(methylsulfonyl)phenyl)urea (119 mg, 0.25 mmol), by the same procedure as in Example 7.

FP01 00 1H-NMR Spectrum (DMSO-dg) δ (ppm) : 0.95 (6H, t, J=7.2Hz), 1.87-1.95 (2H, m) , 2.40-2.70 (6H, m), 3.18 (3H, s),

4.29- 4.33 (2H, m), 6.51 (1H, d, J=5.2Hz), 7.25 (2H, d, J=8.8Hz), 7.49-7.68 (6H, m), 8.16 (1H, brs), 8.71 (1H, d, J=5.2Hz), 8.75 (1H, s), 9.02 (1H, brs), 9.21 (1H, brs) .

Example

N-(4-(6-Cyano (3-(4-morpholino)propoxy) - 4quinolyl)oxyphenyl)-N'-(3-(methylsulfonyl)phenyl)urea

The title compound (81 mg, 0.135 mmol, 53.7%) was obtained as light yellow crystals from N ((6-cyano-7hydroxy quinolyl)oxy)phenyl-N 3)-&amp;#1523;(methylsulfonyl)phenyl)urea (119 mg, 0.25 mmol), by the same procedure as in Example 7. 1H-NMR Spectrum (DMSO-dg) δ(ppm): 1.95-2.04 (2H, m) , 2.34-2.60 (6H, m), 3.18 (3H, s), 3.54-3.60 (4H, m),

4.30- 4.36 (2H, m), 6.52 (1H, d, J=5.2Hz), 7.25 (2H, d,

J=8.8Hz), 7.50-7.68 (6H, m), 8.16 (1H, s), 8.72 (1H, d,

J=5.2Hz), 8.75 (1H, s), 8.95 (1H, s), 9.15 (1H, s).

Example

N- (4- (6-Cyano (3-(diethylamino)propoxy)-4quinolyloxy)phenyl)-N1-phenylurea

The title compound (70 mg, 0.137 mmol, 27.5%) was obtained as light brown crystals from sodium 4-(4((anilinocarbonyl) amino)phenoxy) cyano-7quinolinolate (210 mg, 0.50 mmol), by the same

FP01 00 procedure as in Example 7. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 0.95 (6H, t, J=7.2Hz), 1.85-1.95 (2H, m), 2.40-2.55 (4H, m), 2.60 (2H, t, J=6.8Hz), 4.31 (2H, t, J=6.0Hz), 6.51 (1H, d, J=5.2Hz),

6.96 (1H, m), 7.22-7.30 (4H, m), 7.45 (2H, d, J=8.0Hz),

7.56-7.61 (3H, m), 8.70-8.72 (2H, m), 8.75 (1H, s),

8.84 (1H, s).

Example

N-(4-(6-Cyano (3-(4-morpholino)propoxy)-4quinolyl)oxyphenyl)-N'-phenylurea

The title compound (67 mg, 0.128 mmol, 51.0%) was obtained as light yellow crystals from sodium 4-(4((anilinocarbonyl) amino)phenoxy) cyano-7quinolinolate (105 mg, 0.25 mmol), by the same procedure as in Example 7. 1H-NMR Spectrum (DMSO-d6) δ (ppm): 1.92-2.02 (2H, m), 2.35-2.57 (6H, m), 3.55-3.57 (4H, m), 4.30-4.34 (2H, m) , 6.51 (1H, d, J=5.6Hz), 6.96 (1H, t, J=7.2Hz), 7.22-7.30 (4H, m), 7.45 (2H, d, J=7.6Hz), 7.58-7.61 (3H, m), 8.69-8.72 (2H, m), 8.75 (1H, s), 8.83 (1H, s). Example

N- (4- (6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'~(1H-[d]imidazol yl)urea

The title compound (71 mg, 0.14 mmol, 64.7%) was obtained as white crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (101

FP01 00 mg, 0.222 mmol), by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-dg) δ(ppm): 3.36 (3H, s), 3.753.79 (2H, m), 4.40-4.43 (2H, m), 6.54 (1H, d, J=5.2Hz), 7.04-7.07 (2H, m), 7.26 (2H, d, J=8.8Hz), 7.34-7.37 (2H, m) , 7.62 (1H, s), 7.73 (2H, d, J=8.8Hz), 8.72 (1H, d, J=5.2Hz), 8.77 (1H, s). Example

N-(4-(6-Cyano-7~(2-methoxyethoxy)-4quinolyl)oxyphenyl)-Ν'-(2-oxo-l,2,3,4-tetrahydro-6quinolinyl)urea

The title compound (70 mg, 0.134 mmol, 60.9%) was obtained as white crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (100 mg, 0.220 mmol), by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO&amp;#1470;d6) δ(ppm): 2.38-2.43 (2H, m) , 2.81-2.85 (2H, m), 3.36 (3H, s), 3.75-3.79 (2H, m),

4.40-4.43 (2H, m), 6.51 (1H, d, J=5.2Hz), 6.76 (1H, d,

J=8.4Hz), 7.16 (1H, dd, J=2.0, 8.4Hz), 7.22 (2H, dd,

J=8.8Hz), 7.30 (1H, s), 7.58 (2H, d, J=8.8Hz), 7.62 (1H,

s), 8.52 (1H, s), 8.71 (1H, d, J=5.2Hz), 8.75 (2H, s), 9.95 (1H, s) . Example

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-Ν'-(4-acetamidephenyl)urea

The title compound (100 mg, 0.197 mmol, 89.6%) was obtained as white crystals from phenyl N-(4-(6-cyano-7

FP01 00 (2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (100 mg, 0.220 mmol), by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 2.00 (3H, s), 3.36 (3H, s), 3.76-3.79 (2H, m), 4.40-4.43 (2H, m), 6.52 (1H, d, J=5.2Hz), 7.23 (2H, d, J=8.8Hz), 7.35 (2H, d, J=8.8Hz), 7.46 (2H, d, J=8.8Hz), 7.58 (2H, d, J=8.8Hz),

7.62 (1H, s), 8.59 (1H, s), 8.72 (1H, d, J=5.2Hz), 8.76 (1H, s), 8.77 (1H, s), 9.80 (1H, s).

Example

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-Ν'-(3-acetamidephenyl)urea

The title compound (95 mg, 0.186 mmol, 84.9%) was obtained as white crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (100 mg, 0.220 mmol), by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 2.02 (3H, s) , 3.36 (3H, s), 3.76-3.79 (2H, m), 4.40-4.43 (2H, m), 6.52 (1H, d, J=5.6Hz), 7.15-7.20 (3H, m), 7.23 (2H, d, J=8.8Hz), 7.59 (2H, d, J=8.8Hz), 7.62 (1H, s), 7.76 (1H, s), 8.71-8.76 (4H, m), 9.90 (1H, s). Example

N- (4- (6-Cyano benzyloxy quinolyl)oxy-2fluorophenyl)-Ν'-(2,4-difluorophenyl)urea

N- (2,4-Difluorophenyl)-Ν'-(2-fluoro-4hydroxyphenyl)urea (227 mg, 0.8058 mmol) and 4-chloro-

6-cyano benzyloxyquinoline (250 mmol, 0.8482 mmol)

FP01 00' were used for reaction in the same manner as the second method in Example 86, and after cooling, extraction and washing with water, the solvent was distilled off under reduced pressure and the obtained crystals were suspended in diethyl ether, washed and filtered. They were then dissolved in tetrahydrofuran and filtered with silica gel, and the solvent was distilled off under reduced pressure. These crystals were then suspended in diethyl ether, washed with water and filtered, and then washed with diethyl ether and dried by aspiration to obtain the title compound (70 mg, 0.1295 mmol, 16.07%) as light brown crystals.

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 5.45 (2H, s), 6.63 (1H, d, J = 5.4 Hz), 7.05 (1H, m), 7.15 (1H, m), 7.297.46 (5H, m), 7.54 (2H, d, J = 7.6 Hz), 7.71 (1H,s),

8.11 (1H, dt, J = 6.0 Hz, 9.2 Hz), 8.27 (1H, d, J= 9.2

Hz), 8.74 (1H, d, J = 5.4 Hz), 8.77 (1H, s), 8.99(1H,

s) , 9.07 (1H, s) .

Example

N- (4 - (7- (Benzyloxy) cyano quinolyl)oxyphenyl-N,-(2thiazolyl)urea

The title compound (3.19 g, 6.46 mmol, 91%) was obtained as light brown crystals from 4-(4aminophenoxy) (benzyloxy) cyanoquinoline (2.61 g, 7.10 mmol) and phenyl N-(2-thiazolyl)carbamate (1.88 g,

8.54 mmol), by the same procedure as in Example 34.

FP01 00 1H-NMR Spectrum (DMSO-d6) 5(ppm): 5.47 (2H, s) , 6.55 (1H, d, J = 5.3 Hz), 7.12 (1H, d, J = 3.5 Hz), 7.29 (2H, d, J = 8.7 Hz), 7.36-7.58 (6H, m), 7.65 (2H, d, J = 8.7Hz), 7.72 (1H, s), 8.74 (1H, d, J = 5.3 Hz), 8.80 (1H, s), 9.18 (1H, s) .

Example

N-(4-(6-Cyano hydroxy quinolyl)oxyphenyl)-N'-(2thiazolyl)urea

The N-(4-(7-(benzyloxy) cyano-4quinolyl)oxyphenyl-N2)-&amp;#1523;-thiazole)urea (3.09 g, 7.66 mmol) obtained in Example 82 was dissolved in trifluoroacetic acid (25 ml) and thioanisole (4.50 ml,

38.3 mmol), and the mixture was stirred at 65°C for 15 hours. The reaction solution was concentrated under reduced pressure, and then a 5% aqueous sodium bicarbonate solution and diethyl ether were added to the resulting residue, the mixture was stirred, and the crystals were filtered out and washed with water and diethyl ether and then dried under reduced pressure. The crude product was suspended in a hexane-ethyl acetate mixed solvent and subjected to sonication, after which the crystals were filtered, washed with diethyl ether and blow-dried at room temperature to obtain the title compound (1.94 g, 4.80 mmol, 63%) as yellow crystals.

1H-NMR Spectrum (DMSO-dg) δ(ppm): 6.44 (1H, d, J = 5.2

FP01 00

Hz), 7.12 (1H, d, J = 3.7 Hz), 7.28 (2H, d, J = 7.8 Hz),

7.39 (1H, d, J = 3.7 Hz), 7,42 (1H, s), 7.64 (2H, d, J = 7.8 Hz), 8.65 (1H, d, J = 5.2 Hz), 8.68 (1H, s) , 9.14 (1H, 3) .

Example

N- (4 - (6-Cyano (3-(diethylamino)propoxy)-4quinolyloxy)phenyl-N'-(2-thiazolyl) urea

The title compound (26 mg, 0.0503 mmol, 20%) was obtained as colorless crystals from the N-(4-(6-cyano-

7-hydroxy quinolyl)oxyphenyl)-N2)-&amp;#1523;-thiazolyl)urea (101 mg, 0.250 mmol) obtained in Example 83, by the same procedure as in Example 7.

1H-NMR Spectrum (CDC13) δ(ppm): 1.05 (6H, t, J = 7.2 Hz), 2.03-2.12 (2H, m), 2.58 (4H, q, J = 7.2 Hz), 2.71 (2H, t, J = 7.0 Hz), 4.28 (2H, t, J = 6.2 Hz), 6.47 (1H, d, J = 5.3 Hz), 6.92 (1H, d, J = 3.7 Hz), 7.17 (2H, d, J = 8.8 Hz), 7.43 (1H, d, J = 3.7 Hz), 7.47 (1H, s),

7.67 (2H, d, J = 8.8 Hz), 8.65 (1H, d, J = 5.3 Hz),

8.67 (1H, s).

Example

N-(4-(6-Cyano (3-(4-morpholino)propoxy)-4quinolyl)oxyphenyl)-Ν'-(2-thiazolyl)urea

The title compound (19 mg, 0.0358 mmol, 14%) was obtained as colorless crystals from the N-(4-(6-cyano7-hydroxy quinolyl)oxyphenyl)-Ν'-(2-thiazolyl)urea (101 mg, 0.250 mmol) obtained in Example 83, by the

FP01 00 same procedure as in Example &amp;#906;.

1H-NMR Spectrum (CDC13) δ(ppm): 2.08-2.16 (2H, m) , 2.46-2.52 (4H, m),2.62 (2H, t, J = 7.0 Hz), 3.70-3.76 (4H, m), 4.30 (2H, t, J = 6.2 Hz), 6.47 (1H, d, J = 5.3 Hz), 6.92 (1H, d, J = 3.7 Hz), 7.17 (2H, d, J = 8.8 Hz),

7.42 (1H, d, J = 3.7 Hz), 7.48 (1H, s), 7.67 (2H, d, J = 8.8 Hz), 8.66 (1H, d, J = 5.3 Hz), 8.69 (1H, s). Example

N-(4-(6-Cyano benzyloxy quinolyl)oxyphenyl)-N'-(4methoxyphenyl)urea

After adding toluene (60 ml) and acetonitrile (30 ml) to 4-amino(4-aminophenoxy) (benzyloxy)-6cyanoquinoline (1.0 g) and refluxing the mixture to dissolution, 4-methoxyphenyl isocyanate (0.53 ml) was added while continuing reflux. After stirring for 1 hour with reflux, additional 4-methoxyphenyl isocyanate (0.30 ml) was added. This was further stirred for 40 minutes with reflux and returned to room temperature. The precipitated crystals were filtered out and washed with a mixed solvent of toluene: acetonitrile = 1:1 to obtain the title compound (0.60 g) as light brown crystals. The crystals which precipitated from the washing solution were filtered out to obtain more of the title compound (0.20 g) as light brown crystals. 1H-NMR Spectrum (CDCI3) δ(ppm): 3.73 (3H, s), 5.98 (2H, s), 6.56 (1H, d, J=5.2Hz), 6.89 (2H, d, J=9.3Hz), 7.24

FP01 00 (2H, d, J=9.3Hz), 7.33-7.65 (9H, m), 7.72 (1H, s) , 8.74 (1H, d, J=5.2Hz), 8.82 (1H, s), 8.89 (1H, brs), 9.19 (1H, brs). Example

N-(4-(6-Cyano benzyloxy quinolyl)oxyphenyl)-N * -(4methoxyphenyl)urea

After adding 1-methylpyrrolidone (3.4 ml) and diisopropylethylamine (3.6 ml, 20.78 mmol) to N-(4hydroxyphenyl)-N(4-methoxyphenyl) urea (4.25 g, 16.46 mmol), the mixture was heated and stirred at 130°C to complete dissolution, and then 4-chloro cyano-7benzyloxyquinoline (5.10 g, 17.32 mmol) was added and the mixture was stirred at 130°C for 1.5 hours and at 150°C for 1 hour. Upon addition of diisopropylethylamine (1.2 ml, 6.93 mmol), the mixture was further stirred for 1 hour. After cooling and adding tetrahydrofuran and ethyl acetate, the mixture was washed with saturated sodium bicarnobate water and saturated brine and dried over magnesium sulfate, and the solvent was distilled off under reduced pressure. The obtain crystals were washed with diethyl ether/hexane, acetonitrile/diethyl ether/hexane, methanol and dimethylsulfoxide/water, in that order. The obtained crystals were dissolved in tetrahydrofuran, filtered with silica gel (200 cc silica gel) and flushed with 3000 ml of tetrahydrofuran, and the

FP01 00 solvent was distilled off under reduced pressure. The crystals were then washed with diethyl ether, acetonitrile and diethyl ether:ethanol = 5:1 and dried by aspiration to obtain the title compound (3.70 g, 7.1627 mmol, 43.52%) as brown crystals.

Example

Sodium 6-cyano (4-((4-methoxyanilino)carbonyl) aminophenoxy) quinolinolate

Trifluoroacetic acid (122 ml) and thioanisole (11.7 ml) were added to N-(4-(6-cyano benzyloxy-4quinolyl)oxyphenyl)-N4)-&amp;#1523;-methoxyphenyl)urea (12.2 g), and the mixture was stirred at 50°C overnight and at 40°C for 24 hours. Upon confirming disappearance of the starting materials, the reaction system was concentrated under reduced pressure, tetrahydrofuran and saturated sodium bicarnobate water were added, and the precipitated yellow crystals were filtered and dried under reduced pressure to obtain the title compound (6.8 g). Ether was further added to the filtrate and the precipitated yellow crystals were filtered out and dried under reduced pressure to obtain more of the title compound (2.0 g).

1H-NMR Spectrum (CDC13) δ(ppm): 3.72 (3H, s), 6.56 (1H, d, J=6.1Hz), 6.88 (2H, d, J=8.7Hz), 7.23 (2H, d, J=8.7Hz), 7.37 (2H, d, J=8.7Hz), 7.44 (1H, s), 7.60 (2H, d, J=8.7Hz), 8.57(1H, s), 8.67 (1H, d, J=6.1Hz), 8.70

FP01 00 (1H, s), 8.82 (1H, s).

Example

Sodium 6-cyano (4-((4-fluoroanilino)carbonyl) aminophenoxy) quinolinolate

4-(4-Aminophenoxy) (benzyloxy) cyanoquinoline (7.776 g, 21.2 mmol) was dissolved in a toluene (400 ml) and acetonitrile (200 ml) mixed solvent, and then 4-fluorophenyl isocyanate (3.68 ml, 31.7 mmol) was added and the mixture was heated to reflux at 120°C for 1 hour. The reaction solution was concentrated under reduced pressure, the residue was suspended in tetrahydrofuran (150 ml), and then hexane (150 ml) was added, sonication was performed, and the precipitated crystals were filtered out and dried under reduced pressure to obtain N-(4-(7-(benzyloxy) cyano-4quinolyl)oxyphenyl)~N'-(4-fluorophenyl)urea (9.81 g,

19.4 mmol, 91.9%) as light brown crystals. These were dissolved in trifluoroacetic acid (100 ml) and thioanisole (9.13 ml, 77.7 mmol) under a nitrogen atmosphere, and the solution was stirred at 60°C for 12 hours. The reaction solution was concentrated under reduced pressure, and after adding tetrahydrofuran (50 ml) and then IN aqueous sodium hydroxide (150 ml) and water (150 ml) to the residue, the mixture was stirred and the precipitated crystals were filtered out and washed with water, diethyl ether and ethyl acetate and

FP01 00 dried at 70°C to obtain the title compound (3.646 g, 8.36 mmol, 43.0%) as yellow crystals.

negative ESI-MS 413 (M-Na)

Example

Sodium 6-cyano (4-(2,4-difluoroanilino)carbonyl) amino fluorophenoxy) quinolinolate

A mixture of the 7-benzyloxy compound (1.1 g) obtained in Example 81, trifluoroacetic acid (10 ml) and thioanisole (1 ml) was heated and stirred in an oil bath at 63-67°C for 16 hours. After completion of the reaction, the reaction solution was concentrated, a saturated aqueous sodium bicarbonate solution was added, and the precipitated solid was filtered out. The obtained solid was washed with water, ether and ethyl acetate and dried to obtain the title compound in a quantitative amount.

1H-NMR (DMSO-dg) δ(ppm): 6.54 (1H, d, J=5.6 Hz), 7.047.10 (1H, m), 7.14-7.17 (1H, m), 7.31-7.36 (1H, m),

7.40 (1H, dd, J=2.8 Hz, J=12 Hz), 7.44 (1H, s) , 8.108.16 (1H, m), 8.27 (1H, t, J= 8.8 HZ), 8.67 (1H, s),

8.68 (1H, d, J= 5.2 Hz), 8.99-9.03(1H, m), 9.07-9.11(1H, m) .

Example

N-(4-(6-Cyano (2-chloroethoxy) quinolyl)oxyphenyl)N'~ (4-fluorophenyl)urea

N-(4-(6-Cyano hydroxy quinolyl)oxyphenyl)-N &amp;#1523;

FP01 00 (4-fluorophenyl)urea (400 mg, 0.9166 mmol) was dissolved in dimethylformamide (5.0 ml), and then 1bromo chloroethane (0.12 ml, 1.4479 mmol) and potassium carbonate (200 mg, 1.4479 mmol) were added and the mixture was heated and stirred at 55°C for 4 hours. After cooling, tetrahydrofuran and ethyl acetate were added, the mixture was washed with saturated brine and dried over anhydrous magnesium sulfate, the solvent was distilled off under reduced pressure, and the residue was subjected to NH silica gel column chromatography (ethyl acetate-methanol system). The obtained crystals were suspended in diethyl ether, the suspension was diluted with hexane, and the crystals were filtered out, washed with hexane and dried by aspiration to obtain the title compound (331 mg, 0.6941 mmol, 75.72%) as light yellow crystals. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.07 (2H, t, J = 5.2 Hz), 4.59 (2H, t, J = 5.2 Hz), 6.54 (IH, d, J = 5.6 Hz), 7.12 (2H, t, J = 9.0 Hz), 7.24 (2H, d, J = 9.0 Hz), 7.44-7.48 (2H, m), 7.59 (2H, d, J = 9.0 Hz), 7.65 (IH, s), 8.72 (IH, s), 8.73 (IH, d, J = 5.6 Hz), 8.78 (IH, s), 8.82 (IH, s).

Example

N-(4-(6-Cyano (2-chloroethoxy) quinolyl)oxyphenyl)N1 -(4-methoxyphenyl)urea

The title compound (501 mg, 1.0247 mmol, 87.39%)

FP01 00 was obtained as yellow crystals from N-(4-(6-cyano-7hydroxy quinolyl)oxyphenyl)-N 4)-&amp;#1523;-methoxyphenyl)urea (500 mg, 1.1725 mmol), in the same manner as Example 90. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 3.70 (3H, s) , 4.06 (2H, t, J = 5.0 Hz), 4.59 (2H, t, J = 5.0 Hz), 6.53 (1H, d, J = 5.6 Hz), 6.86 (2H, d, J = 9.2 Hz), 7.22 (2H,d,

J = 9.2 Hz), 7.35 (2H, d, J = 9.2 Hz), 7.58 (2H, d, J = 9.2 Hz), 7.65 (1H, s), 8.55 (1H, m), 8.73 (1H, d, J=

5.6 Hz), 8.78 (1H, m), 8.88 (1H,s).

Example

N-(4-(6-Cyano (2-chloroethoxy) quinolyl)oxyphenyl)Ν' -(2,4-difluorophenyl)urea

The title compound (227 mg, 0.4426 mmol, 66.45%) was obtained as light yellow crystals from N-(4-(6cyano hydroxy quinolyl)oxyphenyl)-Ν'-(2,4difluorophenyl)urea (300 mg, 0.6661 mmol), in the same manner as Example 90. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.07 (2H, t, J = 5.0 Hz), 4.59 (2H, t, J = 5.0 Hz), 6.64 (1H, d, J = 5.4 Hz), 7.06 (1H, m), 7.16 (1H, m), 7.32 (1H, ddd, J = 2.8 Hz, 8.8 Hz, 11.6 Hz), 7.41 (1H, dd, J = 2.8 Hz, 11.6 Hz), 7.67 (1H, s), 7.93 (1H, s), 8.12 (1H, m), 8.27 (1H, dt, J = 4.0 Hz, 9.2 Hz), 8.76 (1H, d, J = 5.4 Hz), 8.77 (1H, s), 8.97-9.09 (1H, m). Example

N-(4-(6-Cyano (4-chlorobutoxy) quinolyl)oxyphenyl)242

FP01 00

N 4) - &amp;#1523;-methoxyphenyl) urea

N- (46) &amp;#1470;-Cyano hydroxy quinolyl)oxyphenyl)-N'(4-methoxyphenyl)urea (200 mg), potassium carbonate(65 mg) and l-bromo chlorobutane (81 μ&amp;#912;) were suspended in dimethylformamide (3 ml), and the suspension was heated and stirred for 1 hour and 50 minutes. The reaction solution was poured into saturated brine and extracted with ethyl acetate. After drying the organic layer over magnesium sulfate, it was passed through NH silica (Fuji Silysia Chemical) and washed in ethyl acetate, and the filtrate was concentrated. The obtained solid was washed with ether and dried to obtain 110 mg of the title compound.

1H-NMR(DMSO-de) δ(ppm): 1.96-2.00 (4H, m), 3.72 (3H, s), 3.77-3.80 (2H, m), 4.33-4.37 (2H, m), 6.53 (1H, d, J=5.2 Hz), 6.88 (2H, d, J=8.8 Hz), 7.23 (2H, d, J=8.8 Hz), 7.38 (2H, d, J=8.8 Hz), 7.60 (2H, d, J=8.8 Hz),

7.62 (1H, s), 8.65 (1H, brs), 8.73 (1H, d, J= 5.2 HZ), 8.77 (1H, s) , 8.90 (1H, brs).

Example

N-(4-(6-Cyano (3-chloropropoxy)-4quinolyl) oxyphenyl)-Ν'-(4-methoxyphenyl) urea

The title compound (310 mg) was obtained from N(4-(6-cyano hydroxy quinolyl)oxyphenyl)-N 4)-&amp;#1523;methoxyphenyl)urea (500 mg) and l-chloro iodopropane (188μ1), by the same procedure as in Example 93.

FP01 00 1H-NMR (DMSO-d6) δ (ppm) : 2.28-2.35 (2H, m) , 3.72 (3H, s) , 3.86-3.90 (2H, m), 4.41-4.45 (2H, m), 6.54 (1H, d, J=5.2 Hz), 6.88 (2H, d, J=8.8 Hz), 7.24 (2H, d, J=8.8 Hz), 7.38 (2H, d, J=8.8 Hz), 7.61 (2H, d, J=8.8 Hz), 7.65 (1H, s), 8.66 (1H, brs), 8.74 (1H, d, J= 5.2 HZ),

8.79 (1H, s), 8.91 (1H, brs).

Example

N-(4- (7-(Benzyloxy) cyano quinolyl)oxyphenyl)-Nf(3-(methylsulfonyl)phenyl)urea

After dissolving 4-(4-aminophenoxy) (benzyloxy)-

6-cyanoquinoline (919 mg, 2.5 mmol) in dimethylsulfoxide (10 ml), phenyl N-(3(methylsulfonyl)phenyl)carbamate (801 mg, 2.75 mmol) was added and the mixture was heated at 85°C for 2 hours. The reaction solution was diluted with ethyl acetate and then washed with IN aqueous sodium hydroxide (10 ml), water (20 ml x 2) and saturated brine (10 ml) and dried over anhydrous sodium sulfate. After filtering off the drying agent, the filtrate was concentrated under reduced pressure and the residue was suspended in ethyl acetate (30 ml), after which hexane (30 ml) was added, sonication was performed and the precipitated crystals were filtered out and dried under reduced pressure to obtain the title compound (1.43 g, 2.5 mmol, quantitative) as light brown crystals. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 3.18 (3H, s), 5.44

FP01 00 (2H, s), 6.53 (1H, d, J=5.2Hz), 7.24 (2H, d, J=8.8Hz), 7.37 (1H, d, J=8.0Hz), 7.44 (2H, t, J=7.2Hz), 7.45-7.69 (8H, m), 8.16 (1H, s) , 8.71 (1H, d, J=5.2Hz), 8.78 (1H, s), 9.12 (1H, s), 9.31 (1H, s).

Example

N-(47)&amp;#1470;-(Benzyloxy) cyano quinolyl)oxyphenyl)-Ν'phenylurea

The title compound (1.126 g, 2.3 mmol, 92.5%) was obtained as light brown crystals from 4-(4aminophenoxy) (benzyloxy) cyanoquinoline (919 mg, 2.5 mmol) and phenyl isocyanate (0.298 ml, 2.75 mmol), by the same procedure as in Example 10.

1H-NMR Spectrum (DMSO-d6) δ(ppm): 5.45 (2H, s), 6.53 (1H, dd, J=1.6, 5.2Hz), 6.96 (1H, dd, J=6.0, 7.2Hz), 7.23 (2H, d, J=7.6Hz), 7.27 (2H, dd, J=7.2, 7.6Hz), 7.37 (1H, d, J=7.2Hz), 7.42-7.47 (4H, m), 7.54 (2H, d, J=8.0Hz), 7.60 (2H, dd, J=1.2, 8.8Hz), 7.70 (1H, s), 8.71 (1H, dd, J=1.6, 5.2Hz), 8.78 (1H, d, J=1.2Hz), 8.88 (1H, brs), 9.02 (1H, brs).

Example

N-(4-((6-Cyano hydroxy quinolyl)oxy)phenyl)-N’-(3(methylsulfonyl)phenyl)urea

After dissolving N-(4-(7-(benzyloxy) cyano-4quinolyl)oxyphenyl)-Ν'-(3-(methylsulfonyl)phenyl)urea (1.43 g, 2.5 mmol) in trifluoroacetic acid (10 ml) and thioanisole (1.17 ml, 10 mmol) under a nitrogen

FP01 00 atmosphere, the solution was stirred at 65°C for 19 hours. The reaction solution was concentrated under reduced pressure, and after adding 5% aqueous sodium bicarbonate (30 ml) and ethyl acetate (50 ml) to the obtained residue and stirring, the precipitated crystals were filtered out, washed with water and ethyl acetate and dried under reduced pressure. The organic layer of the filtrate was separated, washed with saturated brine and dried over anhydrous sodium sulfate, and then concentrated under reduced pressure to obtain a yellow crystalline residue. This was combined with the previous crystals, suspended in ethyl acetate (40 ml) and subjected to sonication, and then the crystals were filtered out, washed with diethyl ether and dried at 60°C to obtain the title compound (862 mg, 1.8 mmol, 72.7%) as yellow crystals.

1H-NMR Spectrum (DMSO-d5) δ(ppm) : 3.18 (3H, s) , 6.43 (1H, d, J=5.2Hz), 7.22-7.25 (3H, m), 7.43 (1H, s), 7.48-7.68 (5H, m), 8.16 (1H, s), 8.63 (1H, d, J=5.2Hz), 8.67 (1H, s), 9.36 (1H, s), 9.55 (1H, s).

Example

Sodium 4-(4-((anilinocarbonyl)amino)phenoxy) cyano-7quinolinolate

The title compound (811 mg, 1.94 mmol, 83.8%) was obtained as yellow crystals from N-(4-(7-(benzyloxy)-6cyano quinolyl)oxyphenyl-N&amp;#1523;-phenylurea (1.126 g, 2.31

FP01 00 mmol), by the same procedure as in Example 87. 1H-NMR Spectrum (DMSO-d5) δ(ppm): 6.26 (1H, d, J=5.2Hz),

6.96 (1H, m), 7.18-7.29 (5H, m), 7.45 (2H, d, J=8.4Hz), 7.57 (2H, d, J=8.0Hz), 8.50-8.51 (2H, m), 8.74 (1H, s) ,

8.86 (1H, s).

Example

N-(4-(6-Cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-N'-phenylurea

The title compound was obtained from 4-(4-amino-3fluorophenoxy) cyano (2-methoxyethoxy)quinoline and phenyl isocyanate, in the same manner as Example 10. 1H-NMR(DMSO-d6) δ(ppm): 3.38 (3H, s), 3.78-3.81 (2H, m) , 4.42-4.45 (2H, m), 6.64 (1H, d, J= 5.2 Hz), 7.00 (1H, t, J= 7.2 Hz), 7.15-7.19 (1H, m), 7.31 (2H, t, J= 7.2 Hz),

7.42 (1H, dd, J=2.8 Hz, J=12 Hz), 7.48 (2H, d, J= 7.2 Hz), 7.66 (1H, s), 8.28 (1H, t, J= 8.8 HZ), 8.72 (1H, brs), 8.76 (1H, d, J= 5.2 Hz), 8.78(1H, s), 9.15(1H, brs) . Example

N- (4- (6-Cyan0 (2-methoxyethoxy) quinolyl) oxy-2fluorophenyl)-N* 1-(4-fluorophenyl)urea

The title compound was obtained from 4-(4-amino-3fluorophenoxy) cyano (2-methoxyethoxy)quinoline and 4-fluoro phenyl isocyanate, in the same manner as Example 10.

1H-NMR(DMSO-d6) δ(ppm): 3.38 (3H, s), 3.78-3.81 (2H, m) ,

FP01 00

4.42-4.45 (2H, m), 6.64 (1H, d, J=5.2 Hz), 7.12-7.18 (3H, m), 7.42 (1H, dd, J=2.8 Hz, J=12 Hz), 7.46-7.51 (2H, m), 7.65 (1H, s), 8.25 (1H, t, J=9.2 Hz), 8.71 (1H, brs), 8.76 (1H, d, J= 5.2 HZ), 8.77 (1H, s) , 9.18 (1H, brs) . Example

N- (1H-Benzo[d] imidazol yl) -N'-.(4- (6-cyano (2methoxyethoxy) quinolyl)oxyphenyl)urea (Example 101-

A) _

N-(1H-Benzo[d]imidazol yl)-Ν'-(4-(6-cyano (2methoxyethoxy) quinolyl)oxyphenyl)urea (Example 101-

B) _

A mixture of the title compounds (Example 101-A) and (Example 101-B) (77.5 mg, 0.157 mmol, 71.4%) was obtained as white crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (100 mg, 0.220 mmol), by the same procedure as in Example 11. The mixture of (Example 101-A) and (Examplel01-B) 1H-NMR Spectrum (DMSO-d6) δ (ppm): 3.36 (3H, s), 3.76-

3.79 (2H, m), 4.40 .43 (2H, m) , 6.53 (1H, d, J=5.6Hz), 6.99-7.62 (6H, m), 7.82 (2/5H, s), 7.91 (3/5H, s), 8.08 (3/5H, s), 8.13 (2/5H, s), 8.59-8.79 (5H, m), 12.26 (3/5H, s), 12.29 (2/5H, s). Example

N- (4- (6-Cyano (2-methoxyethoxy) -4quinolyl)oxyphenyl)-Ν'-(2-oxo-2,3-dihydro-lH248

FP01 00 benzo[d]imidazol yl)urea

The title compound (104.2 mg, 0.204 mmol, 93.0%) was obtained as white crystals from phenyl N-(4-(6cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)carbamate (100 mg, 0.220 mmol), by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 3.36 (3H, s), 3.76-

3.79 (2H, m), 4.40-4.43 (2H, m), 6.52 (1H, d, J=5.2Hz),

6.81 (2H, s), 7.22 (2H, d, J=8.0Hz), 7.31 (1H, s), 7.58 (2H, d, J=8.0Hz), 7.62 (1H, s), 8.53 (1H, s) , 8.71-8.76 (3H, m), 10.41 (1H, s), 10.50 (1H, s) . Example

N- (4- (6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-Ν'-(2-0X0-2,3-dihydro-l,3benzoxazol yl)urea

The title compound (101 mg, 0.197 mmol, 89.9%) was obtained as gray crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (100 mg, 0.220 mmol), by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO&amp;#1470;d6) δ(ppm): 3.37 (3H, s), 3.76-

3.39 (2H, m), 4.40-4,43 (2H, m), 6.52 (1H, d, J=5.2Hz),

6.91 (1H, dd, J=2.0, 8.8Hz), 7.17 (1H, d, J=8.4Hz),

7.24 (2H, d, J=8.8Hz), 7.48 (1H, s), 7.59 (2H, d, J=8.8Hz), 7.62 (1H, s) , 8.71-8.77 (3H, m), 8.-81 (1H, s) ,

11.53 (1H, s). Example 104

FP01 00

N-(4-(6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-Ν'-(2-0X0-2,3-dihydro-l, 3benzoxazol yl)urea

The title compound (111 mg, 0.217 mmol, 98.8%) was obtained as gray crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (100 mg, 0.220 mmol), by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-d6) δ (ppm): 3.37 (3H, s), 3.76-

3.79 (2H, m) , 4.40-4.43 (2H, m), 6.52 (IH, d, J=5.2Hz), 6.99 (IH, d, J=8.4Hz), 7.07 (IH, dd, J=2.0, 8.4Hz),

7.24 (2H, d, J=8.8Hz), 7.56-7.63 (4H, m), 8.72 (IH, d, J=5.2Hz), 8.74 (IH, s), 8.76 (IH, s), 8.82 (IH, s), 11.46 (IH, s). Example

N- (4- (6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-Ν'-(2-0X0-2,3-dihydro-lH-5indolyl)urea

The title compound (69 mg, 0.135 mmol, 61.7%) was obtained as gray crystals from phenyl N-(4-(6-cyano-7(2-methoxyethoxy) quinolyl)oxyphenyl)carbamate (100 mg, 0.220 mmol), by the same procedure as in Example 11. 1H-NMR Spectrum (DMSO-dg) δ (ppm): 3.36 (3H, s), 3.45 (2H, s), 3.76-3.79 (2H, s), 4.40-4.43 (2H, m), 6.51 (IH, d, J=5.2Hz), 6.72 (IH, d, J=8.4Hz), 7.17 (IH, dd, J=2.0, 8.4Hz), 7.22 (2H, d, J=8.8Hz), 7.37 (IH, s), 7.58 (2H, d, J=8.8Hz), 7.62 (IH, s), 8.49 (1H, s), 8.71 (IH, d,

FP01 00

J=5.2Hz), 8.74 (1H, s), 8.75 (1H, s), 10.23 (1H, s). Example

N- (46)&amp;#1470;-Cyano (3-hydroxypropoxy)-4quinolyl)oxyphenyl)-N'~(4-fluorophenyl)urea

The title compound (64 mg, 0.135 mmol, 54.2%) was obtained as light yellow crystals from sodium 6-cyano4-(4-( (4-fluoroanilino)carbonyl)aminophenoxy)-7quinolinolate (109 mg, 0.250 mmol), by the same procedure as in Example 7. 1H-NMR Spectrum (DMSO-d6) δ (ppm): 1.97 (2H, t, J=6.0Hz), 3.63 (2H, m), 4.34 (2H, t, J=6.0Hz), 4.63 (1H, t, J=5.2Hz), 6.51 (1H, d, J=5.2Hz), 7.11 (2H, t, J=8.8Hz), 7.23 (2H, d, J=8.8Hz), 7.44-7.47 (2H, m) ,

7.57-7.60 (3H, m), 8.70-8.75 (3H, m), 8.82 (1H, s). Example

N-(4-(6-Cyano (3-(methylsulfanyl)propoxy)-4quinolyloxy)phenyl)-Ν'-(4-fluorophenyl)urea

The title compound (37 mg, 0.074 mmol, 29.5%) was obtained as light brown crystals from sodium 6-cyano-4(4-((4-fluoroanilino)carbonyl)aminophenoxy)-7quinolinolate (109 mg, 0.250 mmol), by the same procedure as in Example 7. 1H-NMR Spectrum (DMSO-ds) δ (ppm) : 2.08-2.12 (5H,.m),

2.69 (2H, t, J=7.2Hz), 4.36 (2H, t, J=6.0Hz), 6.52 (1H, d, J=5.2Hz), 7.11 (2H, t, J=8.8Hz), 7.23 (2H, d, J=8.8Hz), 7.44-7.48 (2H, m) , 7.57-7.60 (3H, m), 8.71

FP01 00

8.76 (3H, m), 8.82 (1H, s) .

Example

N- (4-(6-Cyano (3-(methylsulfonyl)propoxy)-4quinolyloxy)phenyl)-Ν'-(4-fluorophenyl)urea

The title compound (70 mg, 0.131 mmol, 52.4%) was obtained as light brown crystals from sodium 6-cyano-4(4- ( (4-fluoroanilino)carbonyl)aminophenoxy)-7quinolinolate (109 mg, 0.250 mmol), by the same procedure as in Example 7.

1H-NMR Spectrum (DMS0-d6) δ (ppm): 2.27 (2H, m), 3.04 (3H, s), 3.21-3.37 (2H, m), 4.41 (2H, t, J=6.4Hz), 6.53 (1H, d, J=5.2Hz), 7.11 (2H, t, J=8.8Hz), 7.23 (2H, d, J=8.8Hz), 7.44-7.48 (2H, m), 7.57-7.61 (3H, m), 8.71-

8.73 (2H, m), 8.77 (1H, s) , 8.82 (1H, s) .

Example

N- (4-(6-Cyano (3-(2-oxotetrahydro-lH-lpyrrolyl) propoxy) quinolyloxy)phenyl) -N'-(4fluorophenyl)urea

The title compound (11.2 mg, 0.021 mmol, 8.3%) was obtained as light yellow crystals from sodium 6-cyano4-(4-( (4-fluoroanilino)carbonyl)aminophenoxy)-7quinolinolate (109 mg, 0.250 mmol), by the same procedure as in Example 7.

1H-NMR Spectrum (DMSO-dg) δ (ppm): 1.93 (2H, m), 2.03 (2H, t, J=6.0Hz), 2.19 (2H, t, J=8.0Hz), 3.37-3.42 (4H, m), 4.27 (2H, t, J=6.0Hz), 6.51 (1H, d, J=5.2Hz), 7.11

FP01 00 (2H, t, J=8.8Hz), 7.23 (2H, d, J=8.8Hz), 7.44-7.48 (2H, m), 7.55 (1H, s) , 7.58 (2H, d, J=8.8Hz), 8.70-8.73 (2H, m) , 8.75 (1H, s) , 8.82 (1H, s).

Example

N- (4- (6-Cyano (3-(1,3-dioxo-2,3-dihydro-lH-2isoindolyl)propoxy) quinolyloxy)phenyl)-N'-(4fluorophenyl)urea

The title compound (416 mg, 0.692 mmol, 69.2%) was obtained as light yellow crystals from sodium 6-cyano4- (4- ( (4-fluoroanilino)carbonyl)aminophenoxy)-7quinolinolate (436 mg, 1.00 mmol), by the same procedure as in Example 7.

1H-NMR Spectrum (DMSO-d6) δ (ppm): 2.17 (2H, t, J=5.6Hz), 3.84 (2H, t, J=6.4Hz)', 4.32 (2H, t, J=6.0Hz),

6.51 (1H, d, J=5.2Hz), 7.11 (2H, t, J=8.8Hz), 7.23(2H, d, J=9.2Hz), 7.44-7.48 (2H, m), 7.52 (1H, s), 7.58(2H, d, J=8.8Hz), 7.78-7.84 (4H, m), 8.69-8.73 (3H, m),8.82 (1H, s) .

Example

N-(3-(6-Cyano (3-fluoro ((4fluoroanilino)carbonyl)aminophenoxy)-7quinolyl)oxypropyl)methanesulfonamide

The title compound (73 mg, 0.129 mmol, 51.3%) was obtained as light brown crystals from sodium 6-cyano-4(3-fluoro ((4-fluoroanilino)carbonyl)aminophenoxy)-7quinolinolate (114 mg, 0.25 mmol), by the same

FP01 00 procedure as in Example 7. 1H-NMR Spectrum (DMSO-dg) δ (ppm): 2.02 (2H, t, J=6.4Hz), 2.91 (3H, s), 3.20 (2H, q, J=6.4Hz), 4.34 (2H, t, J=6.4Hz), 6.62 (1H, d, J=5.2Hz), 7.12-7.38 (4H, m) ,

7.40 (1H, dd, J=2.8, 11.6Hz), 7.44-7.48 (2H, m), 7.61 (1H, s), 8.24 (1H, t, J=9.2Hz), 8.62 (1H, d, J=2.0Hz),

8.74 (1H, s), 8.75 (1H, s), 9.09 (1H, s).

Example

4-(4-((4-Fluoroanilino)carbonyl)aminophenoxy) (2methoxyethoxy) quinolinecarboxamide

The N- (4-(6-cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N4)-&amp;#1523;-fluorophenyl)urea (360 mg, 0.762 mmol) obtained in Example 10 was dissolved in dimethylsulfoxide (4.5 ml), and then 5N aqueous sodium hydroxide (1.5 ml) was added and the mixture was heated at 80°C while stirring for 60 minutes. The reaction solution was cooled in an ice water bath, 2N hydrochloric acid (3.75 ml) was added for neutralization, and then the mixture was diluted with water (21 ml) and the precipitated crude crystals were filtered out. These were suspended in ethanol (20 ml) and subjected to sonication, and upon filtering out the crystals they were dried under reduced pressure to obtain the title compound (214 mg, 0.436 mmol, 57.3%) as gray crystals.

1H-NMR Spectrum (DMSO-d6) δ (ppm): 3.34 (3H, s), 3.78

FP01 00

3.81 (2H, m), 4.38-4.41 (2H, m), 6.46 (1H, d, J=5.6Hz), 7.11 (2H, d, J=8.8Hz), 7.23 (2H, d, J=8.4Hz), 7.46 (2H, m), 7.54 (1H, s), 7.58 (2H, d, J=8.8Hz), 7.80 (1H, s) ,

7.82 (1H, s), 8.64 (1H, d, J=5.6Hz), 8.75 (1H, s), 8.78 (1H, s), 8.83 (1H, s).

Example

7-(2-Methoxyethoxy) (4-((1,3-thiazol ylamino)carbonyl) aminophenoxy) quinolinecarboxamide The title compound (181 mg, 0.377 mmol, 42.6%) was obtained as gray crystals from the N-(4-(6-cyano (2methoxyethoxy) quinolyl)oxyphenyl)-N1,3)-&amp;#1523;-thiazol-2yl)urea (409 mg, 0.886 mmol) obtained in Example 12, by the same procedure as in Example 112.

1H-NMR Spectrum (DMSO-d6) δ (ppm): 3.35 (3H, s), 3.78-

3.81 (2H, m), 4.39-4.42 (2H, m), 6.47 (1H, d, J=5.2Hz), 7.11 (1H, brs), 7.26 (2H, d, J=8.8Hz), 7.37 (1H, d, J=3.2Hz), 7.55 (1H, s), 7.62 (2H, d, J=8.8Hz), 7.80 (1H, s), 7.82 (1H, s), 8.65 (1H, d, J=5.2Hz), 8.78 (1H, s), 9.10 (1H, s).

Example

4 ((Anilinocarbonyl)amino) fluorophenoxy (2methoxyethoxy) quinolinecarboxamide

The title compound (21 mg, 0.043 mmol, 19.1%) was obtained as brown crystals from the N-(4-(6-cyano (2methoxyethoxy) quinolyl)oxy fluorophenyl)-N&amp;#1523;phenylurea (106 mg, 0.224 mmol) obtained in Example 99,

FP01 00 by the same procedure as in Example 112. 1H-NMR Spectrum (DMSO-d6) δ (ppm): 3.35 (3H, s), 3.78-3.81 (2H, m), 4.39-4.42 (2H, m), 6.55 (1H, d, J=5.2Hz), 6.98 (1H, t, J=7.6Hz), 7.13 (1H, d, J-8.4HZ), 7.29 (2H, t, J=7,6Hz), 7.39 (1H, dd, J=2.4, 12.0Hz), 7.45 (2H, d, J=8.4Hz), 7.56 (1H, s), 7.82 (2H, brs), 8.25 (1H, m),

8.63 (1H, s), 8.67 (1H, d, J=5.2Hz), 8.76 (1H, s), 9.06 (1H, s) .

Example

4-(4-( (4-Fluoroanilino)carbonyl)aminophenoxy)-7methoxy quinolinecarboxamide

The title compound (201 mg, 0.450 mmol, 49.2%) was obtained as gray crystals from the N-(4-(6-cyano-7methoxy quinolyl) oxyphenyl)-N4)-&amp;#1523;-fluorophenyl)urea (391 mg, 0.913 mmol) obtained in Example 39, by the same procedure as in Example 112.

1H-NMR Spectrum (DMSO-d6) δ (ppm): 4.02 (3H, s), 6.53 (1H, d, J=5.2Hz), 7.11 (2H, t, J=8.8Hz), 7.24 (2H, d, J=8.8Hz), 7.44-7.48 (2H, m), 7.51 (1H, s), 7.59 (2H, d, J=8.8Hz), 7.75 (1H, s), 7.87 (1H, s), 8.68-8.70 (2H, m),

8.85 (1H, s), 8.95 (1H, s).

Example

4-(4-((Cyclopropylamino)carbonyl)aminophenoxy) (2methoxyethoxy) quinolinecarboxamide

The title compound (71 mg, 0.163 mmol, 45.4%) was obtained as light brown crystals from the N-(4-(6256

FP01 00 cyano (2-methoxyethoxy) quinolyl)oxyphenyl) -N'cyclopropylurea (150 mg, 0.358 mmol) obtained in Example 23, by the same procedure as in Example 112. 1H-NMR Spectrum (DMSO-dg) δ (ppm): 0.40-0.44 (2H, m) , 0.62-0.66 (2H, m), 2.43-2.48 (1H, m), 3.36 (3H, s),

3.80-3.83 (2H, m), 4.40-4.43 (2H, m) , 6.43-6.46 (2H, m),

7.18 (2H, d, J=8.8Hz), 7.53-7.67 (3H, m), 7.81 (1H, s),

7.83 (1H, s), 8.46 (1H, s) , 8.-65 (1H, d, J=5.6Hz), 8.79 (1H, s) .

Example N ((6-Cyano methoxy quinolyl)oxy)phenyl)-N'-(1,3thiazol yl)urea

The title compound (390 mg, 0.934 mmol, 93.4%) was obtained as white crystals from 4-(4-aminophenoxy)-6cyano methoxyquinoline (291 mg, 1.0 mmol) and 2phenoxycarbamoylamino-1,3-thiazole (264 mg, 1.2 mmol), by the same procedure as in Example 36. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 4.05 (3H, s), 6.52 (1H, d, J=5.2Hz), 7.11 (1H, br), 7.27 (2H, d, J=8.8Hz), 7.37 (1H, d, J=3.2Hz), 7.59 (1H, s), 7.62 (2H, d, J=8.8Hz), 8.72 (1H, d, J=5.2Hz), 8.77 (1H, s), 9.12 (1H, s) . Example 7-Methoxy (4-((1,3-thiazol-2ylamino)carbonyl)aminophenoxy) quinolinecarboxamide

The title compound (195 mg, 0.448 mmol, 52.8%) was

FP01 00 obtained as gray crystals from the N ( (6-cyano-7methoxy quinolyl) oxy)phenyl-N' - (1,3-thiazol-2yl)urea (354 mg, 0.848 mmol) obtained in Example 117, by the same procedure as in Example 112.

1H-NMR Spectrum (DMSO-d6) δ (ppm): 4.02 (3H, s), 6.47 (1H, d, J=5.2Hz), 7.10 (1H, br), 7.25 (2H, d, J=8.8Hz), 7.36 (1H, d, J=3.6Hz), 7.50 (1H, s), 7.62 (2H, d, J=8.8Hz), 7.73 (1H, s) , 7.85 (1H, s), 8.64 (1H, d, J=5.2Hz), 8.67 (1H, s) , 9.45 (1H, s). Example

4- (4- ((2,4-Difluoroanilino)carbonyl)amino-3fluorophenoxy) methoxy quinolinecarboxamide

The title compound (36 mg, 0.448 mmol, 29.4%) was obtained as light pink crystals from the N-(4-(6-cyano7-methoxy quinolyl)oxy fluorophenyl)-N2,4)-&amp;#1523;difluorophenyl)urea (118 mg, 0.254 mmol) obtained in Example 61, by the same procedure as in Example 112. 1H-NMR Spectrum (DMSO-dg) δ (ppm): 4.02 (3H, s) , 6.56 (1H, d, J=5.2Hz), 7.06 (1H, m), 7.12 (1H, m), 7.33 (1H, m), 7.39 (1H, dd, J=2.8, 11.6Hz), 7.51 (1H, s), 7.73 (1H, s), 7.84 (1H, s), 8.11 (1H, m), 8.25 (1H, t, J=9.2Hz), 8.65 (1H, s), 8.66 (1H, d, J=5.2Hz), 8.99 (1H, s), 9.06 (1H, s). Example

N ((6-Cyano methoxy quinolyl)oxy)phenyl-N'cyclopropylurea

FP01 00

The title compound (293 mg, 0.783 mmol, 59.8%) was obtained as white crystals from 4-(4-aminophenoxy)-6cyano methoxyquinoline (381 mg, 1.308 mmol), by the same procedure as in Example 36. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 0.40-0.44 (2H, m), 0.62-0.67 (2H, m) , 2.53-2.58 (1H, m), 4.07 (3H, m), 6.44 (1H, d, J=2.0Hz), 6.51 (1H, d, J=5.6Hz), 7.19 (2H, d, J=8.8Hz), 7.56 (2H, d, J=8.8Hz), 7.60 (1H, s), 8.48 (1H, s), 8.73 (1H, d, J=5.6Hz), 8.77 (1H, s). Example 4-(4-((Cyclopropylamino)carbonyl)aminophenoxy)-7methoxy quinolinecarboxamide

The title compound (79 mg, 0.201 mmol, 26.9%) was obtained as gray crystals from the N ((6-cyano-7methoxy quinolyl)oxy)phenyl-N &amp;#1523;-cyclopropylurea (279 mg, 0.745 mmol) obtained in Example 120, by the same procedure as in Example 112. 1H-NMR Spectrum (DMSO-d6) δ (ppm): 0.40-0.43 (2H, m), 0.62-0.64 (2H, m) , 2.42-2.45 (1H, m), 4.02 (3H, s), 6.42-6.44 (2H, m), 7.16 (2H, d, J=8.0Hz), 7.49 (1H, s),

7.53 (2H, d, J=8.0Hz), 7.72 (1H, s), 7.84 (1H, s), 8.45 (1H, s), 8.63 (1H, d, J=5.6Hz), 8.67 (1H, s). Example

N- (4-(5,6-Dimethyl 7H-pyrrolo[2,3d]pyrimidyl) oxyphenyl)-N'-(4-fluorophenyl)urea

4-(4-Aminophenoxy)-5,6-dimethyl-7H-pyrrolo[2,3-d]259

FP01 00 pyrimidine was dissolved in toluene (16 mg)(0.8 ml) and acetonitrile (0.5 ml) under reflux, and then 4fluorophenyl isocyanate (7.9 μΜ) was added. The mixture was stirred for 1 hour and returned to room temperature, and then the reaction system was concentrated, diethyl ether was added to the residue, and the resulting crystals were filtered out. The crystals were washed with diethyl ether to obtain the title compound (5 mg).

MS m/z 392(M + H) 1H-NMR (DMSO-dg) δ (ppm) : 2.29(3H, s), 2.31(3H, s), 7.007.16 (4H, m), 7.38-7.50 (4H, m) , 8.10(lH, s), 8.50(2H, s), 11.75(1H, s)

The intermediates were synthesized in the following manner. Production Example 122-1 4-(Nitrophenoxy)-5,6-dimethyl-7H-pyrrolo[2,3-d]pyrimidine

After adding para-nitrophenol (121 mg), potassium carbonate (133 mg) and dimethylformamide (1 ml) to the 4-chloro-5,6-7H-pyrrolo[2,3-d]-pyrimidine (88 mg) described in Journal of Medicinal Chemistry, 1996, Vol.39, No.12, 2285-2292, the mixture was stirred at 135-140°C for 72 hours. This was returned to room temperature, water was added, extraction was performed with a tetrahydrofuran and ethyl acetate mixed solution,

FP01 00 and then the organic layer was washed with saturated brine, dried over anhydrous sodium sulfate and concentrated to dryness. The obtained crystals were washed with diethyl ether to obtain the title compound (90 mg).

MS m/z 285(M + H) 1H-NMR(DMSO-d5) δ (ppm) : 2.28(3H, s), 2.32(3H, s) , 7.50(2H, d, 0=9.5 Hz), 8.20(1H, s), 8.30(2H, d, 0=9.5 Hz), 11.98(1H, s) Production Example 122-2 4-(Aminophenoxy)-5,6-dimethyl-7H-pyrrolo[2,3-d]pyrimidine

After adding iron powder (0.1 g), ammonium chloride (0.2 g), ethanol (4 ml) and water (1 ml) to the 4- (nitrophenoxy)-5,6-dimethyl-7H-pyrrolo[2,3-d]pyrimidine (80 mg) synthesized by the intermediate synthesis method described above, the mixture was stirred at 75-82°C for 1.5 hours. After returning the reaction system to room temperature and adding tetrahydrofuran (3 ml) and ethyl acetate (3 ml), the mixture was filtered with celite, the filtrate was subjected to liquid separation, and the organic layer was washed with water and saturated brine in that order, dried over sodium sulfate, concentrated to dryness under reduced pressure and washed with diethyl ether to obtain the title compound (22 mg).

FP01 00

MS m/z 255(M + H) 1H-NMR(DMSO&amp;#1470;d6) δ (ppm) : 2.27 (3H, s), 2.29(3H, s), 4.905.00 (2H, m) , 6.52-6.88 (4H, m) , 8,O6(1H, s), 11.66(1H, s) Example 4-(4-(3,4-Dihydroquinazolin one yl)phenyloxy)-6,7dimethoxyquinoline

6,7-Dimethoxy (4-(2aminophenyl)methylaminophenyloxy)quinoline (40 mg, 0.0996 mmol) was dissolved in dimethylformamide (0.5 ml), 1,1&amp;#1523;-carbonyldiimidazole (19 mg, 0.1196 mmol) was added, and the mixture was stirred at 70°C for 8 hours. After cooling to room temperature, the reaction solution was diluted with tetrahydrofuran, water was added, and the mixture was extracted with ethyl acetate, washed with saturated brine and dried over anhydrous magnesium sulfate, after which the solvent was distilled off under reduced pressure. The residue was purified with a silica gel column (ethyl acetatemethanol system) and recrystallized with hexane-diethyl ether to obtain the title compound (3 mg, 0.0070 mmol, 7.05%) as colorless crystals.

1H-NMR (CDC13) δ(ppm) : 4.06 (6H, s), 4.89 (2H, s), 6.57 (1H, d, J = 5.2 Hz), 6.77 (1H, d, J = 7.6 Hz),

6.87 (1H, brs), 7.03 (1H, t, J = 7.6 Hz), 7.14 (1H, d, J = 7.6 Hz), 7.23 (3H, m, covered by CDC13) , 7.44 (1H,

FP01 00

s), 7.48 (2H, d, J=8.8 Hz), 7.55 (1H, s), 8.52 (1H, d, J = 5.2 Hz) ,

The intermediates were synthesized in the following manner. Production Example 123-1

6,7-Dimethoxy (4-(2nitrophenylmethylimino)phenyloxy)quinoline

6,7-Dimethoxy (4-aminophenyloxy)quinoline (500 mg, 1.6873 mmol) was dissolved in tetrahydrofuran (64 ml), and after adding 2-nitrobenzaldehyde (320 mg, 2.1091 mmol) and acetic acid (0.58 ml), sodium triacetoxyborohydride (720 mg, 3.3746 mmol) was further added and the mixture was stirred at room temperature for 11 hours and 30 minutes. Water and saturated sodium bicarbonate were added, the mixture was extracted with ethyl acetate, washed with saturated brine and dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. The obtained crystals were washed with hexane-diethyl ether, filtered out, washed with hexane and dried by aspiration at room temperature to obtain the title compound (453 mg) as light yellow crystals.

1H-NMR (CDC13) δ(ppm) : 4.06 (6H, s) , 6.54 (1H, d, J = 5.2 Hz), 7.25 (2H, d, J = 8.4 Hz), 7.40 (2H, d, J = 8.4 Hz), 7.44 (1H, s), 7.57 (1H, s), 7.65 (1H, dd, J = 7.6, 8.0 Hz), 7.77 (1H, dd, J = 7.6, 7.6 Hz), 8.10 (1H, d, J

FP01 00 = 8.0 Hz), 8.33 (1H, d, J = 7.6 Hz), 8.51 (1H, d, J = 5.2 Hz), 9.01 (1H, s). Production Example 123-2

6,7-Dimethoxy (4-(2nitrophenylmethylamino)phenyloxy)quinoline

After adding tetrahydrofuran (2 ml), ethanol (2 ml) and chloroform (1 ml) to 6,7-dimethoxy (4-(2nitrophenylmethyl-imino)phenyloxy)quinoline (200 mg, 0.4657 mmol) and heating the mixture to complete dissolution, sodium borohydride (35 mg, 0.9314 mmol) was added and the mixture was heated to reflux for 1 hour and 30 minutes. After cooling to room temperature, water was added, the mixture was extracted with ethyl acetate, washed with saturated brine and dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified with an NH silica gel column (hexane-ethyl acetate system) to obtain the title compound (151 mg, 0,3500 mmol, 75.15%) as a yellow oil.

1H-NMR (CDC13) δ(ppm) : 4.04 (6H, s),4.46 (1H, brs), 4.76 (2H, d, J = 4.8 Hz), 6.42 (1H, d, J = 5.2 Hz),

7.64 (2H, d, J = 8.8 Hz), 6.99 (2H, d, J = 8.8 Hz),

7.40 (1H, s), 7.47 (1H, dd, J = 7.2, 7.2 Hz), 7.57 (1H,

s), 7.62 (1H, dd, J - 7.2, 7.6 Hz), 7.71 (1H, d, J =

7.6 Hz), 8.10 (1H, d, J = 7.2 Hz), 8.45 (1H, d, J = 5.2 Hz) .

FP01 00

Production Example 123-3

6,7-Dimethoxy (4-(2aminophenylmethylamino)phenyloxy)quinoline

6,7-Dimethoxy (4-(2nitrophenylmethylamino)phenyloxy)quinoline (150 mg, 0,35 mmol) was dissolved in ethanol (2.8 ml) and water (0.7 ml), and then iron powder (78 mg, 1.4 mmol) and ammonium chloride (150 mg, 2.8 mmol) were added and the mixture was heated to reflux for 1 hour. After cooling to room temperature, the reaction solution was diluted with tetrahydrofuran and water, and the insoluble portion was filtered off. The filtrate was distilled off under reduced pressure, and then the residue was purified with a silica gel column (ethyl acetate system), the obtained amorphous substance was solidified with hexane and ethyl acetate, and the obtained crystals were washed with hexane-ethyl acetate, filtered out, washed with hexane and dried by aspiration at room temperature to obtain the title compound (80 mg, 0.1993 mmol, 56.93%) as milky white crystals.

1H-NMR (CDC13) δ(ppm) : 3.78 (1H, brs), 4.05 (3H, s), 4.06 (3H, s), 4.15 (2H, brs), 4.26 (2H, s), 6.44 (1H, d, J = 5.2 Hz), 6.74-6.81 (4H, m), 7.06 (2H, d, J = 8.8 Hz), 7.16-7.22 (2H, m), 7.42 (1H, s), 7.60 (1H, s), 8.46 (1H, d, J = 5.2 Hz).

FP01 00

Example

N-(4-(2-Phenylpyridin yl)oxyphenyl)-N'-(4fluorophenyl)urea

4-(2-Phenylpyridin yl)oxyaniline (110 mg, 0.42 mM) was added to ethyl acetate (10 ml), and then parafluorophenyl isocyanate (0.56 ml, 4.9 mM) was added while stirring, which was continued for 30 minutes. After adding n-hexane (20 ml) to the reaction solution, the solvent was partially distilled off under reduced pressure and the precipitating solid was filtered out to obtain the target substance (98 mg) as a gray solid. 1H-NMR (DMSO-d6) δ(ppm): 6.81 (1H, dd, J= 5.6 Hz, J= 2.4 Hz), 7.10-7.20 (4H, m), 7.42-7.52 (6H, m), 7.57 (2H, d, J= 8.8 Hz) 8.01 (2H, d, J= 8.4 Hz), 8.53 (1H, d, J= 5.6 Hz) , 8.74 (1H, s), 8.80 (1H, s) .

The starting material and intermediate were synthesized in the following manner. Production Example 124-1 4-(2-Phenylpyridin yl)oxyaniline 4-Chloro phenylpyridine 1.0 g (5.5 mM), paranitrophenol (1.68 g, 12 mM), Hunig's base (diisopropylethylamine, 5 ml) and 1-methylpyrrolidone (10 ml) were stirred at 160°C for 20 hours. Water was added, extraction was performed with ethyl acetate, and the organic layer was washed 5 times with water. The solvent was distilled off under reduced pressure and

FP01 00 the residue was purified by silica gel chromatography (hexane: ethyl acetate = 4:1) to obtain 490 mg of 4-(4nitrophenoxy) phenylpyridine as a light yellow solid. 1H-NMR (DMSO&amp;#1470;d6) δ(ppm) : 7.081) 7,14&amp;#1470;H, m) , 7.40-7.53 (5H, m), 7.74 (1H, s) , 8.07-8.13 (2H, m) 8.34 (2H, d, J= 8.8 Hz), 8.68 (1H, dd, J= 5.6 Hz , J= 1.2Hz).

4-(4-nitrophenoxy) phenylpyridine (490 mg), iron powder (1 g), ammonium chloride (2 g), ethanol (10 ml), dimethylformamide (10 ml) and water (5 ml) were stirred at 100°C for 10 minutes. The mixture was filtered with celite, water was added to the filtrate, and extraction was performed with ethyl acetate. The organic layer was washed 5 times with water, and then the solvent was distilled off under reduced pressure to obtain 4-(2phenylpyridin yl)oxyaniline (460 mg) as a brown oil. 1H-NMR(DMSO-d6) δ(ppm): 5.12-5.16 (2H, m), 6.65 (2H, d, J= 8.8Hz), 6.74 (1H, dd, J= 5.6Hz , J= 2.4Hz), 6.89 (2H, d, J= 8.8Hz), 7.38 (1H, d, J= 2.4Hz), 7.40-7.52 (3H, m) , 7.98 (2H, d, J= 8.0 Hz), 8.48 (1H, d, J= 5.6 Hz). Example

N- (43)&amp;#1524;-Phenylpyridin yl)oxyphenyl)-N'-(4fluorophenyl)urea

Ethyl acetate (10 ml) was added to 4-(3phenylpyridin yl)oxyaniline (84 mg, 0.32 mM), and then parafluorophenyl isocyanate (0.54 ml, 4.7 mM) was added while stirring, which was continued for 40

FP01 00 minutes. After adding NH type silica gel to the reaction solution, the solvent was distilled off under reduced pressure to adsorb the reaction product onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, for column purification (chloroform:methanol = 10:1). After adding ethyl acetate and n-hexane to the obtained residue, the solvent was distilled off under reduced pressure to obtain the target compound (82 mg) as a light yellow amorphous substance.

1H-NMR (DMSO-d6) δ(ppm): 6.69 (1H, dd, J= 5.6 Hz, J= 1.6 Hz), 7.06-7.15 (4H, m), 7.37-7.54 (7H, m), 7.64 (2H, d, J= 7.6 Hz), 8.38 (1H, dd, J= 5.6 Hz, J= 1.6Hz), 8.51 (1H, d, J= 1.6 Hz), 8.70 (1H, s), 8.75 (1H, s).

The starting material and intermediate were synthesized in the following manner. Production Example 125-1

4- (3-Phenylpyridin yl)oxyaniline 4-Chloro phenylpyridine (200 mg, 1.06 mM) , paranitrophenol (440 mg, 3.18 mM), Hunig's base (isoPr2EtN, diisopropylethylamine, 1 ml) and 1methylpyrrolidone (2 ml) were stirred at 160°C for 2 hours. Water was added, extraction was performed with ethyl acetate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel chromatography (hexane: ethyl acetate = 4:1, and

FP01 00 then 2:1) to obtain 4-(4-nitrophenoxy) phenylpyridine (150 mg) as a light yellow oil.

1H-NMR(CDC13) δ(ppm): 6.98 (1H, d, J= 5.6Hz), 7.12 (2H, d, J= 9.2Hz), 7.37-7.48 (3H, m) , 7.50-7.56 (2H, m) 8.24 (2H, d, J= 9.3 Hz), 8.55 (1H, d, J= 5.6 Hz), 8.71 (1H, s) .

4-(4-Nitrophenoxy) phenylpyridine (150 mg), iron powder (300 mg), ammonium chloride (600 mg), ethanol (5 ml), dimethylformamide (5 ml) and water (2.5 ml) were stirred at 100°C for 15 minutes. The mixture was filtered with celite, water was added to the filtrate, and extraction was performed with ethyl acetate. The organic layer was washed 5 times with water, and then the solvent was distilled off under reduced pressure to obtain 4-(3-phenylpyridin yl)oxyaniline (84 mg) as a yellow oil. 1H-NMR(CDC13) δ(ppm): 6.65-6.74 (3H, m) , 6.88 (2H, d, J= 8.8Hz), 7.36-7.50 (3H, m), 7.64 (2H, d, J= 8.8Hz),

8.34 (1H, dd, J= 5.GHz, J= 0.8Hz), 8.54 (1H, s). Example

N-(3-(6,7-Dimethoxyquinolin yl)oxypropyl)-N'-(4fluorophenyl.)urea

6,7-Dimethoxy (3-aminopropoxy)quinoline 150 mg (0.57 mM) and ethyl acetate (20 ml) were stirred at room temperature, and then 4-fluorophenyl isocyanate (0.078 ml, 0.68 mM) was added and the mixture was

FP01 00 further stirred for 15 minutes. The precipitated solid was filtered out to obtain the target substance (92 mg) as a white solid.

1H-NMR (DMSO-d6) δ (ppm) : 2.03 (2H, tt, J= 6.0Hz, J= 6.0Hz), 3.36 (2H, t, J= 6.0Hz), 3.89 (3H, s), 3.91 (3H, s), 4.27 (2H, t, J= 6.0Hz), 6.29 (1H, t, J= 6.0Hz),

6.88 (1H, d, J= 5.2Hz), 7.00-7.07 (2H, m), 7.31 (1H, s), 7.34-7.41 (3H, m), 8.47 (1H, s), 8.51 (1H, d, J= 5.2Hz).

The starting material and intermediate were synthesized in the following manner. Production Example 126-1

6,7-Dimethoxy (3-aminopropoxy)quinoline

6,7-Dimethoxy hydroxyquinoline (4.0 g, 19.5 mM), N-(3-bromopropyl)phthalimide (5.8 g, 21.5 mM), potassium carbonate (5.4 g, 39 mM) and DMF dimethylformamide (20 ml) were stirred at 60°C for 1.5 hours. Water, ethyl acetate and tetrahydrofuran were added to the reaction solution for extraction. The solid which precipitated after standing for a period was filtered out to obtain N-(3-(6,7-dimethoxyquinolin4-yloxy)propyl)phthalimide (1.1 g).

1H-NMR(DMSO-d6) δ(ppm): 2.22 (2H, tt, J= 6.0Hz, J= 6.0Hz), 3.82 (3H, s), 3.86 (2H, t, J= 6.0Hz), 3.90 (3H, s), 4.29 (2H, t, J= 6.0Hz), 6.82 (1H, d, J= 5.2Hz), 7.27 (1H, s), 7.31 (1H, s) , 7.77-7.84 (4H, m), 8.49 (1H, d, J= 5.2Hz).

FP01 00

N- (3-(6,7-Dimethoxyquinolin-4yloxy)propyl)phthalimide (600 mg, 1.53 mM), hydrazine monohydrate (300 mg, 6.12 mM), ethanol (5 ml), methanol (5 ml) and tetrahydrofuran (5 ml) were stirred for 2 hours under reflux. The solvent was distilled off under reduced pressure, and the residue was purified by silica gel chromatography (Fuji Silysia NH Type Silica Gel, chloroform:methanol = 20:1) to obtain the target substance (150 mg) as a brown oil.

1H-NMR(DMSO-d5) δ(ppm): 1.93 (2H, tt, J= 6.0Hz, J= 6.0Hz), 2.77 (2H, t, J= 6.0Hz), 3.88 (3H, s), 3.91 (3H, 5), 4.29 (2H,t, J= 6.0Hz), 6.89 (1H, d, J= 5.2Hz), 7.31 (1H, s), 7.34 (1H, s), 8.51 (1H, d, J- 5.2Hz).

Example

N-(4-(6-Cyano ((l-methylpiperidin yl)methoxy)-4quinolyl)oxy fluorophenyl)-Ν'-(4-fluorophenyl)urea After dissolving 6-cyano (4-(4fluoroanilinocarbonyl)amino fluorophenoxy)quinolin-701 sodium salt (222 mg), potassium carbonate (162 mg) and 3-chloromethyl-l-methylpiperidine hydrochloride (86 mg) in dimethylformamide (1.7 ml) and stirring the mixture overnight at 70-80°C, water was added, and extraction was performed with a tetrahydrofuran and ethyl acetate mixed solvent prior to concentration under reduced pressure and purification of the residue with NH Silica (Fuji Silysia Chemical). The obtained

FP01 00.

solid was washed with ether and dried to obtain the title compound (10 mg).

MS Spectrum:544(M+l) 1H-NMR Spectrum: (DMSOd6) 1.30-2.70 (12H, m), 4.17 (2H, d, J=6.7Hz), 6.61 (IH, d, J=5.0Hz), 7.06-7.18 (3H, m) , 7.36-7.50 (3H, m),7.60 (IH, s,), 8.20-8.28 (IH, m),

8.63 (IH, s,) ,8.74 (IH, d, J=5.0Hz), 8.75 (IH, s,), 9.10 (IH, s,) Example

N-(3-(5, 6-Dimethyl 7H&amp;#1470;pyrrolo [2,3d] pyrimidyl)oxyphenyl)-N'-(4-fluorophenyl)urea

After dissolving 4-amino(3-aminophenoxy)-5,6dimethyl-7H-pyrrolo[2,3-d]-pyrimidine (27 mg) in toluene (1 ml) and acetonitrile (0.5 ml) under reflux, 4-fluorophenyl isocyanate (13.3 μΜ) was added. Upon stirring for 1 hour, the mixture was returned to room temperature and the precipitated crystals were filtered out to obtain the title compound (26 mg).

MS (ESI) m/z 392(M + 1) 1H-NMR(DMSO-d6) δ (ppm) : 2.31(3H, s), 2.46-2.50(3H, m) , 6.78-7.48 (8H, m) , 8.14(1H, s), 8.52(1H, s) , 8.82(1H,

s), 11.79(1H, s)

The intermediates were synthesized in the following manner. Production Example 128-1

4-(3&amp;#1470;Nitrophenoxy)-5,6-dimethyl-7H-pyrrolo[2,3-d]272

FP01 00 pyrimidine

After adding 3-nitrophenol (243 mg), potassium carbonate (268 mg) and dimethylformamide (2 ml) to the 4-chloro-5,6-dimethyl-7H-pyrrolo[2r3-d]-pyrimidine (177 mg) described in Journal of Medicinal Chemistry, 1996, Vol.39, No.12, 2285-2292, the mixture was stirred at 120-130°C for 72 hours. This was returned to room temperature, water was added, extraction was performed with a tetrahydrofuran and ethyl acetate mixed solution, and then the organic layer was washed with saturated brine, dried over anhydrous sodium sulfate and concentrated to dryness. The obtained crystals were washed with diethyl ether to obtain the title compound (130 mg).

MS (ESI) m/z 285(M + 1) 1H-NMR (DMSO-d6) δ (ppm) : 2.31 (3H, s), 2.46-2.50 (3H, m ), 7.70-8.18(5H, m), 11.89 (1H, s) Production Example 128-2 4-(3-Aminophenoxy)-5,6-dimethyl-7H-pyrrolo[2,3-d]pyrimidine

After adding iron powder (0.12 g), ammonium chloride (0.24 g), ethanol (5 ml) and water (1 ml) to the 4- (3-nitrophenoxy)-5,6-dimethyl-7H-pyrrolo[2,3-d]pyrimidine (110 mg) synthesized by the intermediate synthesis method described above, the mixture was stirred at 80-90°C for 3 hours. After returning the

FP01 00 reaction system to room temperature and adding tetrahydrofuran (3 ml) and ethyl acetate (3 ml), the mixture was filtered with celite, the filtrate was subjected to liquid separation and extraction with ethyl acetate, and the organic layer was washed with water and saturated brine in that order. It was then dried over sodium sulfate, concentrated to dryness under reduced pressure and washed with diethyl ether to obtain the title compound (37 mg).

1H-NMR (DMSO-dg) δ (ppm) : 2.27(3H, s), 2.29(3H, s), 5.15-

5.24 (2H, m), 6.28 (1H, d, J=8.1Hz) , 6.32(1H, s), 6.40 (1H, d, J=8.1Hz) ,7.01 (1H, t, J=8.1Hz), 8.12(1H, s), 11.72 (1H, s).

Example

N ((6, 7-Dimethoxy quinolyl)oxy) pyridyl-N' phenylurea

6-((6,7-Dimethoxy4&amp;#1470;-quinolyl)oxy) pyridylamine (59.5 mg, 200 mmol) and phenyl isocyanate (26.2 mg, 220 mmol) were stirred in N,N-dimethylformamide (1 ml) at room temperature for 18 hours. After diluting the reaction solution with ethyl acetate, it was washed with water and saturated brine, the organic layer was dried over anhydrous magnesium sulfate, the drying agent was filtered off and the filtrate was distilled off under reduced pressure. The obtained crude product was suspended in ethyl acetate, the suspension was

FP01 00 diluted with hexane, and the crystals were filtered out and washed with ethyl acetate and then blow-dried to obtain the title compound (68 mg, 163 mmol, 82%) as colorless crystals.

1H-NMR Spectrum: (DMSOd6) 3,90 (3H, s) , 3.95 (3H, s),

6.55 (1H, d, J = 5.2 Hz), 6.96-7.02 (1H, m), 7.26-7.32 (3H, m), 7.40 (1H, s), 7.41 (1H, s), 7.47 (2H, d, J =

8.4 Hz), 8.14 (1H, dd, J = 2.8, 8.8 Hz), 8.35 (1H, d, J = 2.8 Hz), 8.55 (1H, d, J = 5.2 Hz), 8.89 (1H, s) , 8.99 (1H, s) .

The intermediates were synthesized in the following manner. Production Example 129-1

6,7-Dimethoxy ((5-nitro pyridyl)oxy)quinoline

6,7-Dimethoxy-l,4-dihydro quinolinone (4.10 g, 20.0 mmol), 2-bromo nitropyridine (4.46 g, 22,0 mmol) and potassium carbonate (5.53 g, 40.0 mmol) were heated and stirred at 70°C for 3 hours in N,Ndimethylformamide (20 ml). The reaction solution was diluted with ethyl acetate, the insoluble portion was filtered off, and after washing with water and saturated brine and drying the organic layer over anhydrous magnesium sulfate, the drying agent was filtered off and the filtrate was distilled off under reduced pressure. The obtained crude product was subjected to silica gel column chromatography (eluent:

FP01 00 ethyl acetate), and the fraction containing the target substance was concentrated, suspended in ethyl acetate and diluted with hexane, after which the crystals were filtered out, washed with hexane and then blow-dried to obtain the title compound (2.23 g, 6.81 mmol, 34%) as yellow crystals.

1H-NMR Spectrum: (CDC13) 3.95 (3H, s), 4.06 (3H, s), 7.07 (1H, d, J = 5.2 Hz), 7.16 (1H, s), 7.26 (1H, d, J = 8.8 Hz), 7.49 (1H, s), 8.60 (1H, dd, J = 2.8, 8.8 Hz),

8.74 (1H, d, J = 5.2 Hz), 9.08 (1H, d, J = 2.8 Hz). Production Example 129-2

6-((6,7-Dimethoxy quinolyl) oxy)-3&amp;#1470;pyridinamine

6,7-Dimethoxy ((5-nitro pyridyl)oxy)quinoline (654 mg, 2.00 mmol), iron powder(559 mg, 10.0 mmol) and ammonium chloride (1.07 g, 20.0 mmol ) were heated and stirred in ethanol (20 ml)-water (5 ml) at 80°C for 20 minutes. After completion of the reaction, the reaction mixture was filtered with celite and washed in ethyl acetate. After washing the organic layer with water and saturated brine and drying over anhydrous magnesium sulfate, the drying agent was filtered out and the filtrate was distilled off under reduced pressure. The obtained crude product was suspended in ethyl acetate, the suspension was diluted with hexane, and the crystals were filtered out and washed with ethyl acetate and then blow-dried to obtain the title

FP01 00 compound (380 mg, 1.28 mmol, 64%) as light yellow crystals .

1H-NMR Spectrum: (CDC13) 3.73 (2H, s), 4.02 (3H, s), 4.04 (3H, s), 6,61 (1H, d, J = 5.2 Hz), 6.96 (1H, d, J = 8.8 Hz), 7.18 (1H, dd, J = 2.8, 8.8 Hz), 7.41 (1H, s),

7.53 (1H, s), 7.85 (1H, d, J = 2.8 Hz), 8.54 (1H, d, J = 5.2 Hz).

Example

N ((6,7-Dimethoxy quinolyl)oxy) pyridyl-N,-(4fluorophenyl)urea

The title compound (67 mg, 154 mmol, 77%) was obtained as colorless crystals from 4-fluorophenyl isocyanate (30.1 mg, 220 mmol), by the same procedure as in Example 129.

1H-NMR Spectrum: (DMSOd6) 3.89 (3H, s), 3.95 (3H, s), 6.79 (1H, d, J = 5.0 Hz), 7.112) 7.16&amp;#1470;H, m), 7.29 (1H, d, J = 8.6 Hz), 7.39 (1H, s) , 7.41 (1H, s), 7.457.51&amp;#1470; (2H, m), 8.13 (1H, dd, J = 2.6, 8.6 Hz), 8.34 (1H, d, J = 2.6 Hz), 8.55 (1H, d, J = 5.0 Hz), 8.93 (1H, s) , 8.99 (1H, s) .

Example

N ((6,7-Dimethoxy quinolyl)oxy) pyridyl-N'-(1,3thiazol yl)urea

The 6-((6,7-dimethoxy quinolyl)oxy)-3pyridinamine (89.1 mg, 300 mmol) obtained in Example 129 and phenyl N-(2-thiazolyl)carbamate (79.3 mg, 360

FP01 00 mmol) were stirred in dimethyl sulfoxide (1 ml) at 85°C for 1 hour. After diluting the reaction solution with ethyl acetate, it was washed with water and saturated brine, the organic layer was dried over anhydrous magnesium sulfate, the drying agent was filtered off and the filtrate was distilled off under reduced pressure. The obtained crude product was suspended in ethyl acetate, the suspension was diluted with hexane, and the crystals were filtered out and washed with ethyl acetate and then blow-dried to obtain the title compound (88 mg, 208 mmol, 69%) as colorless crystals. 1H-NMR Spectrum: (DMSOd6) 3.89 (3H, s) , 3.95 (3H, s),

6.81 (1H, d, J = 5.2 Hz), 7,12 (1H, d, J = 3.6 Hz),

7.31 (1H, d, J = 8.8 Hz), 7.36-7.40 (2H, m), 7.42 (1H, s), 8.18 (1H, dd, J = 2.8, 8.8 Hz), 8.37 (1H, d, J = 2.8 Hz), 8.56 (1H, d, J = 5.2 Hz), 9.30 (1H, s). Example

4-(5-((Anilinocarbonyl)amino) pyridyloxy) methoxy6-quinolinecarboxamide

The title compound (59 mg, 137 mmol, 78%) was obtained as colorless crystals from 4-((5-amino-2pyridyl)oxy) methoxy quinolinecarboxamide (55.0 mg, 177 mmol), by the same procedure as in Example 129.

<td>¹H-NMR Spectrum: (DMSOd₆)</td><td> 4.04 (3H, s), 6.86 (1H,</td><td> d, J</td>

<td> = 5.2 Hz), 6.96-7.02 (1H,</td><td> m), 7.26-7.34 (3H, m),</td><td> 7.47</td>

<td> (2H, d, J = 7.6 Hz), 7.54</td><td> (1H, s), 7.74 (1H, s),</td><td> 7.86</td>

FP01 00 (1H, s), 8.15 (1H, dd, J = 2.8, 8.8 Hz), 8.36 (1H, d, J = 2.8 Hz), 8.55 (1H, s) , 8.75 (1H, d, J = 5.2 Hz), 8.90 (1H, s), 9.01 (1H, s) .

The intermediates were synthesized in the following manner.

Production Example 132-1

7-Methoxy ((5-nitro pyridyl)oxy)-6quinolinecarboxamide

The title compound (93.0 mg, 273 mmol, 5%) was obtained as yellow crystals from 7-methoxy oxo-l,4hydroxy quinolinecarboxamide (1.09 g, 5.00 mmol) derived by hydrolysis of the 7-methoxy oxo-l,4dihydro quinolinecarboxamide described in WO98/13350, by the same procedure as in Example 129.

1H-NMR Spectrum: (CDC13) 4.15 (3H, s) , 5.92 (1H, s), 7.21 (1H, d, J = 5.2 Hz), 7.35 (1H, d, J = 9.2 Hz),

7.63 (1H, s), 7.79 (1H, s), 8.62 (1H, dd, J = 2.8, 8.8 Hz), 8.94 (1H, d, J = 5.2 Hz), 8.96 (1H, s), 9.02 (1H, d, J = 5.2 Hz).

Production Example 132-2

4-((5-Amino pyridyl)oxy) methoxy-6quinolinecarboxamide

7-Methoxy ((5-nitro pyridyl) oxy)-6quinolinecarboxamide (93.0 mg, 273 mmol), iron powder (76.0 mg, 1.36 mmol) and ammonium chloride (146 mg, 2.73 mmol ) were heated and stirred in ethanol (4 ml)

FP01 00 water (1 ml) at 80°C for 20 minutes. After completion of the reaction, the reaction mixture was filtered with celite and washed in an ethyl acetate-tetrahydrofuran mixed solvent. After washing the organic layer with water and saturated brine and drying over anhydrous magnesium sulfate, the drying agent was filtered out and the filtrate was distilled off under reduced pressure. The obtained crude product was subjected to silica gel column chromatography (eluent - ethyl acetate:methanol = 20:1), and the fraction containing the target substance was concentrated, suspended in ethyl acetate and diluted with hexane, after which the crystals were filtered out, washed with hexane and then blow-dried to obtain the title compound (61.0 mg, 197 mmol, 72%) as yellow crystals.

1H-NMR Spectrum: (DMSOd6) 4.03 (3H, s) , 6.60 (1H, d, J = 5.4 Hz), 7.04 (1H, d, J = 8.4 Hz), 7.18 (1H, dd, J = 2.6, 8.4 Hz), 7.50 (1H, s), 7.68 (1H, d, J = 2.6 Hz), 7.73 (1H, s), 7.86 (1H, s), 8.61 (1H, s) , 8.67 (1H, d, J = 5.4 Hz).

Example

N- (4 - (6-Cyano ((3-methylsulfonyl)propoxy)-4quinolyl)oxy fluorophenyl)-Ν'-(4-fluorophenyl)urea The title compound (67 mg) was obtained from 6cyano {4-[4-fluoroanilinocarbonyl]amino-3fluorophenoxy}quinolin ol sodium salt (100 mg) in the

FP01 00 same manner as Example 7.

1H-NMR (DMSO-dg) δ(ppm): 2.24-2.32(2H, m) , 3.05(3H, s),

3.30-3.35(2H, m), 4.42 (2H, t, J= 6 Hz), 6.63 (1H, d, J= 5.6 Hz), 7.11-7.15 (3H, m), 7.40 (1H, dd, J= 2.8 Hz, J= 8.0 Hz), 7.44-7.48 (2H, m), 7.63(1H, s), 8.218.26(1H, m) , 8.64(1H, br), 8.75 (1H, d, J= 5.6Hz), 8.77 (1H, s), 9.10 (1H, br) .

Example

N-(4-(6-Cyano ((3-methylthio)propoxy) quinolyl)oxy2-fluorophenyl)-Ν'-(4-fluorophenyl)urea

The title compound (30 mg) was obtained from 6cyano {4-[4-fluoroanilinocarbonyl]amino-3fluorophenoxy}quinolin ol sodium salt (100 mg), in the same manner as Example 7.

1H-NMR(DMSO-d6) δ(ppm) : 2.09(3H, s), 2.06-2.14(2H, m) , 2.67(2H, t, J= 7.2 Hz), 4.37 (2H, t, J= 6 Hz), 6.62 (1H, d, J= 5.2 Hz), 7.10-7.15 (3H, m), 7.39 (1H, dd, J= 2.8 Hz, J= 7.6 Hz), 7.44-7.48 (2H, m) , 7.6O(1H, s) , 8.218.26(1H, m) , 8.65(1H, br), 8.74 (1H, d, J= 5.2 Hz),

8.75 (1H, s), 9,12(1H, brd, J= 3.2 Hz).

Example

N-(4- (6-Cyano (3-(ethoxycarbonyl)propoxy)-4quinolyl)oxy fluorophenyl)-Ν'-(4-fluorophenyl)urea The title compound (850 mg) was obtained from 6cyano {4-[4-fluoroanilinocarbonyl]amino-3fluorophenoxy}quinolin ol sodium salt (1.0 g), in the

FP01 00 same manner as Example 7.

1H-NMR (DMSO-d6) δ(ppm): 1.17(3H, t, J= 7.2 Hz), 2.052.13(2H, m), 2.53(2H, t, J= 7.2 Hz), 4.07(2H, q, J= 7.2 Hz), 4.31 (2H, t, J= 6.4 Hz), 6.61 (1H, d, J= 5.2 Hz),

7.10-7.15 (3H, m), 7.40 (1H, dd, J= 2.8 Hz, J= 7.6 Hz), 7.44-7.48 (2H, m), 7.6O(1H, s), 8.22-8.27 (1H, m), 8.64(1H, br), 8.74 (1H, d, J= 5.2 Hz), 8.74 (1H, s), 9.10(1H, br).

Example

N- (4- (6-Cyano (3-carboxypropoxy) quinolyl)oxy-2fluorophenyl)-Ν'-(4-fluorophenyl)urea

N- (4-(6-Cyano (3-(ethoxycarbonyl)propoxy)-4quinolyl)oxy fluorophenyl)-Ν'-(4-fluorophenyl)urea (800 mg) was dissolved in methanol (45 ml), 2N NaOH water (15 ml) was added, and the mixture was heated and stirred for 40 minutes at 80°C. After completion of the reaction, the reaction solution was poured into ice water and neutralized with IN HC1, and the precipitated solid was filtered out. The obtained solid was washed with water and dried to obtain 230 mg of the title compound.

1H-NMR(DMSO-d6) δ(ppm): 2.01-2.08 (2H, m), 2.46 (2H, t, J= 7.6 Hz), 4.30 (2H, t, J= 6.4 Hz), 6.61 (1H, d, J= 5.2 Hz), 7.10-7.15 (3H, m), 7.39 (1H, dd, J= 2.8 Hz, J= 8.0 Hz), 7.44-7.48 (2H, m), 7.59(1H, s), 8.21-8.26(1H, m), 8.66(1H, br), 8.73 (1H, d, J= 5.2 Hz), 8.74 (1H, s),

FP01 00

9.13(1H, br) .

Example

N-(4-(6-Cyano (3((cyclopropylamino)carbonyl)propoxy) quinolyl)oxy-2fluorophenyl)-N'-(4-fluorophenyl) urea

N-(4-(6-Cyano (3-carboxypropoxy) quinolyl)oxy2-fluorophenyl)-N4)-&amp;#1523;-fluorophenyl)urea (100 mg) was dissolved in dimethylformamide (3 ml), and then 1ethyl (3-dimethylaminopropyl)-carbodiimide (44 mg) and 1-hydroxy-lH-benzotriazole (35 mg) were added while stirring on ice and the mixture was stirred at room temperature for 30 minutes. Cyclopropylamine (16 μ&amp;#912;) was then added and the mixture was stirred at room temperature for 18 hours. After completion of the reaction, the reaction solution was poured into IN sodium hydroxide water and extracted with ethyl acetate, and the obtained organic layer was washed with saturated brine and dried over magnesium sulfate. The organic layer was concentrated, and the obtained solid was washed with ether and a small amount of ethyl acetate to obtain 38 mg of the title compound.

1H-NMR (DMSO&amp;#1470;d6) δ(ppm): 0.34-0.38(2H, m) , 0.54-0.59(2H, m), 1.99-2.06(2H, m), 2.25(2H, t, J= 7.2 Hz), 2.562.63(1H, m), 4.27(2H, t, J= 6.4 Hz), 6.60 (1H, d, J= 5.2 Hz), 7.10-7.15 (3H, m), 7.39 (1H, dd, J= 2.8 Hz, J= 8.0 Hz), 7.44-7.49 (2H, m), 7.59(1H, s), 7.95(1H, brd,

FP01 00

J= 3.6 Hz), 8.21-8.25 (1H, m), 8.67(1H, br) , 8.73 (1H, d, J= 5.2 Hz), 8.74 (1H, s), 9.15(1H, br).

Example

N- (4- (6-Cyano (3-((piperidine)carbonyl)propoxy)-4quinolyl)oxy fluorophenyl)-N'-(4-fluorophenyl)urea

The title compound (33 mg) was obtained from N-(4(6-cyano (3-carboxypropoxy) quinolyl)oxy-2fluorophenyl)-Ν'-(4-fluorophenyl)urea (100 mg) by the same procedure as in Example 137.

1H-NMR (DMSO-d6) δ(ppm): 1.38-1.60(6H, m) , 2.01-2.09(2H, m) , 2.53(2H, t, J= 7.2 Hz), 3.39-3.46(4H, m), 4.31(2H, t, J= 6.0 Hz), 6.61 (1H, d, J= 5.2 Hz), 7.10-7.15 (3H, m), 7.40 (1H, dd, J= 2.4 Hz, J= 8.0 Hz), 7.43-7.49 (2H, m), 7.61(1H, s), 8.20-8.27(1H, m) , 8.7O(1H, br), 8.73 (1H, d, J= 5.2 Hz), 8.74 (1H, s), 9.17(1H, br).

Example

N- (4- (6-Cyano (3-((dimethylamino)sulfonyl)propoxy)-4quinolyl)oxy fluorophenyl)-Ν'-(4-fluorophenyl)urea

The title compound (35 mg) was obtained from 6cyano {4-[4-fluoroanilinocarbonyl]amino-3fluorophenoxy}quinolin ol sodium salt (100 mg), in the same manner as Example 7.

1H-NMR(DMSO-d6) δ(ppm): 2.19-2.27(2H, m), 2.80(6H, s),

3.26-3.31 (2H, m), 4.41(2H, t, J= 6.4 Hz), 6.63 (1H, d, J= 5.2 Hz), 7.10-7.16 (3H, m), 7.40 (1H, dd, J= 2.8 Hz, J= 7.6 Hz), 7.44-7.49 (2H, m) , 7.61 (1H, s) , 8.21

FP01 00

8.27(1H, m) , 8.68(1H, br), 8.75 (1H, d, J= 5.2 Hz), 8.77 (1H, s), 9.15(1H, br). Example N- (4- (6-Cyano (3((cyclopropylamino)sulfonyl)propoxy)4&amp;#1470;-quinolyl)oxy-2fluorophenyl)-N'-(4-fluorophenyl)urea

The title compound (31 mg) was obtained from 6cyano {4-[4-fluoroanilinocarbonyl]amino-3fluorophenoxy}quinolin ol sodium salt (100 mg), in the same manner as Example 7. 1H-NMR (DMSO-d6) δ (ppm): 0.51-0.63(4H, m), 2.17-2.25 (2H, m) , 3.15-3.22 (1H, m), 3.26-3.33(2H, m), 4.42(2H, t, J= 6.0 Hz), 6.63 (1H, d, J= 5.2 Hz), 7.10-7.16 (3H, m),

7.40 (1H, dd, J= 2.8 Hz, J= 8.0 Hz), 7.44-7.48 (2H, m) , 7.56(1H, brd, J= 2.8 Hz), 7.61 (1H, s), 8.21-8.27 (1H, m), 8.63-8.66(1H, m) , 8.75 (1H, d, J= 5.2 Hz), 8.77 (1H, s) ,

9.11-9.13(1H, m). Example

N-(4-(7-Benzyloxy-6&amp;#1470;cyano-4&amp;#1470;quinolyl)oxy-2fluorophenyl)-N'-(2-thiazolyl)urea

Phenyl N-(4-(6-cyano benzyloxy quinolyl)oxy-2fluorophenyl)carbamate (6.93 g) and 2-aminothiazole (2.75 g) were dissolved in dimethylformamide (70 ml), and then diisopropylethylamine (4.8 ml) was added and the mixture was heated and stirred at 90°C for 2 hours. After cooling, water was added and the precipitated

FP01 00 solid was filtered out and washed with ethyl acetate to obtain 5.53 g of the title compound as light brown crystals (79% yield).

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 5.46 (2H, s), 6.63 (1H, d, J=5.2Hz), 7.13-7.19 (2H, m) , 7.33-7.48 (5H, m),

7.54 (2H, d, J=6.8Hz), 7.72 (1H, s), 8.21-8.27 (1H, m) ,

8.73-8.78 (2H, m)

The intermediates were synthesized in the following manner. Production Example 141-1 Phenyl N- (4-(6-cyano benzyloxy quinolyl)oxy-2fluorophenyl)carbamate

The 7-benzyloxy cyano (3-fluoro-4aminophenoxy) quinoline (9.45 g) synthesized in Production Example 8 was dissolved in dimethylformamide (70 ml) and pyridine (5.9 ml), and the mixture was cooled to 0°C under a nitrogen atmosphere. After adding phenyl chlorocarbonate (3.4 ml), the mixture was stirred for 2 hours. Water was added to the reaction solution, and the precipitated crystals were filtered out and triturated in tetrahydrofuran and toluene to obtain 6.93 g of the title compound as light brown crystals (56% yield). 1H-NMR Spectrum (CDC13) δ(ppm) : 5.36 (2H, s) , 6.53 (1H, d, J=5.3), 6.98-7.05 (2H, m), 7.17-7.47 (9H, m), 7.51-7.58 (3H, m), 8.67-8.71 (2H, m)

FP01 00

Example

N-[4-(6-Cyano [3-(morpholin yl)propoxy]-4quinolyl)oxy fluorophenyl]-Ν' -(2-thiazolyl)urea

N- (4 - (6-Cyano hydroxyquinolyl)oxy-2fluorophenyl)-N(2-thiazolyl)urea (150 mg) was dissolved in dimethylformamide (3 ml), and then potassium carbonate (150 mg) and l-chloro (morpholin4-yl)propane (70 mg) were added and the mixture was heated and stirred at 60°C for 2 hours. After cooling, water was added, extraction was performed with ethyl acetate, the organic layer was washed with saturated brine and dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by NH silica gel column chromatography (ethyl acetate-methanol system) to obtain the title compound (20 mg). 1H-NMR Spectrum (DMSO&amp;#1470;d6) δ(ppm) : 1.94-2.04 (2H, m), 2.34-2.52 (6H, m), 3.54-3.61 (4H, m), 4.34 (2H, t,

J=6.2Hz), 6.61 (1H, d, J=5.6Hz), 7.12-7.20 (2H, m),

7.37-7.47 (2H, m), 7.61 (1H, s), 8.21-8.27 (1H, m) ,

8.73-8.76 (2H, m)

The intermediates were synthesized in the following manner. Production Example 142-1

N- (4 - (6-Cyano hydroxy quinolyl)oxy fluorophenyl)N' - (2-thiazolyl)urea

FP01 00

The N- (4-(7-benzyloxy cyanoquinolyl) oxy-2fluorophenyl)-N'-(2-thiazolyl)urea (5.53 g) synthesized in Example 141 was dissolved in TFA (55 ml), and then thioanisole (5.5 ml) was added and the mixture was heated and stirred at 70°C for 6 hours. After cooling the reaction solution and concentrating it under reduced pressure, sodium bicarnobate water and methanol were added and the precipitated crystals were filtered. These were washed with diethyl ether to obtain 3.63 g of the title compound (80% yield). 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 6.50 (1H, d, J=5,6Hz), 7.12-7.19 (2H, m), 7.35-7.45 (3H, m), 8.198.27 (1H, m), 8.61-8.66 (2H, m) Example

N- (4 - (6-Cyano3)-7&amp;#1470;-(diethylamino)propoxy)-4quinolyl)oxy fluorophenyl-N'-(2-thiazolyl)urea

The N-(4-(6-cyano hydroxy quinolyl)oxy-2fluorophenyl)-N2)-&amp;#1523;-thiazolyl)urea (150 mg) synthesized in Example 142 was dissolved in dimethylformamide (2.5 ml), and then potassium carbonate (150 mg) and 1chloro (diethylamino)propane (80 mg) were added and the mixture was heated and stirred at 60°C for 2 hours. After cooling, water was added, extraction was performed with ethyl acetate, the organic layer was washed with saturated brine and dried over anhydrous sodium sulfate, and the solvent was distilled off under

FP01 00 reduced pressure. The residue was purified by NH silica gel column chromatography (ethyl acetatemethanol system) to obtain the title compound (10 mg). 1H-NMR Spectrum (DMSO-dg) δ(ppm) : 0.95 (6H, t, J=7.0Hz), 1.85-1.96 (2H, m), 2.40-2.65 (6H, m), 4.32 (2H, t, J=6.0Hz), 6.62 (1H, d, J=5.2Hz), 7,12-7.20 (2H, m), 7.36-7.48 (2H, m), 7.59 (1H, s), 8.20-8.24 (1H, m),

8.73-8.77 (2H, m) Example N- (4- (6-Cyano (2-methoxyethoxy) -4quinolyl)oxyphenyl)-N'-(3-methylisoxazol yl)urea

The 4- (4-aminophenoxy) cyano (2methoxyethoxy)quinoline (100 mg) synthesized in Production Example 10 and phenyl N-(3-methylisoxazol-5yl)carbamate (81 mg) were added to toluene (5 ml), then diisopropylethylamine (0.88 ml) was added and the mixture was heated and stirred at 100°C for 2 hours. After cooling, the precipitated crystals were filtered and washed with an ethyl acetate: toluene (1:1) mixed solvent to obtain the title compound (102 mg). 1H-NMR Spectrum (DMSO&amp;#1470;d6) δ(ppm) : 2.16 (3H, s), 3.36 (3H, s), 3.76-3.79 (2H, m), 4.40-4.44 (2H, m), 5.95 (1H, s), 6.52 (1H, d, J=5.2Hz), 7.26 (2H, d, J=9.2Hz), 7.58-

7.64 (3H, m), 8.71 (1H, d, J=5.2Hz), 8.76 (1H, s), 9.04 (1H, brs) .

The intermediates were synthesized in the

FP01 00 following manner.

Production Example 144-1

N-(3-Methylisoxazol yl)carbamate

5-Amino methylisoxazole (1 g) purchased from

Aldrich Co. was dissolved in tetrahydrofuran (40 ml) and pyridine (1.5 ml), and after cooling to 0°C under a nitrogen atmosphere, phenyl chlorocarbonate (1.4 ml) was added and the mixture was stirred at room temperature for 1.5 hours. Water was added, extraction was performed twice with ethyl acetate, and then the organic layers were combined, washed with water and saturated brine in that order, dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was recrystallized from ethyl acetate and n-hexane to obtain the title compound (450 mg, 20% yield).

1H-NMR Spectrum (CDC13) δ(ppm) : 2.27 (3H, s) , 6.03 (1H, s), 7.16-7.30 (3H, m), 7.37-7.44 (2H, m), 7.81 (1H, brs) Example

N- (4- (6-Cyano (2-methoxyethoxy)-4quinolyl)oxyphenyl)-N'-(5-methylisoxazol3&amp;#1524;-yl)urea The 4-(4-aminophenoxy) cyano (2methoxyethoxy)quinoline (100 mg) synthesized in Production Example 10 and phenyl N-(5-methylisoxazol-3yl)carbamate (72 mg) were added to toluene (5 ml), and

FP01 00 then diisopropylethylamine (0.50 ml) was added and the mixture was heated to reflux for 2 hours. After cooling, the precipitated crystals were filtered and washed with an ethyl acetate/toluene (1/1) mixed solvent to obtain the title compound (120 mg).

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 2.36 (3H,s), 3.37 (3H, s) 3.75-3.78 (2H, m) , 4.37-4.43 (2H, m), 6.50-6.54 (2H, m), 7.26 (2H, d, J=8.8Hz), 7.56-7.63 (3H, m), 8.72 (1H, d, J=5.6Hz), 8.76 (1H, s), 8.99 (1H, brs), 9.51 (1H, brs)

The intermediates were synthesized in the following manner. Production Example 145-1 N-(5-Methylisoxazol yl)carbamate 3-Amino methylisoxazole (1.00 g) purchased from Aldrich Co. was dissolved in tetrahydrofuran (20 ml) and pyridine (1.5 ml), and after cooling to 0°C under a nitrogen atmosphere, phenyl chlorocarbonate (1.4 ml) was added and the mixture was stirred at room temperature for 2 hours. Water was added, extraction was performed twice with ethyl acetate, and then the organic layers were combined, washed with water and saturated brine in that order, dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was triturated with diethyl ether and n-hexane to obtain the title compound (1.54 g) (68%

FP01 00 yield).

1H-NMR Spectrum (CDC13) δ(ppm) : 2.42 (3H, s) , 6.56 (1H, s), 7.15-7.30 (3H, m), 7.36-7.43 (2H, m), 8.18 (1H, brs)

Example

N-(4-(6-Cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-Ν'-(2-oxo-l,2,3, 4-tetrahydro-6quinolinyl)urea

The title compound (64 mg) was obtained from phenyl N-(4-(6-cyano (2-methoxyethoxy)-4quinolyl)oxy fluorophenyl) carbamate (65 mg), in the same manner as Example 25.

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 2.38-2.45 (2H, m) , 2.81-2.90 (2H, m), 3.36 (3H, s), 3.75-3.79 (2H, m), 4.40-4.43 (2H, m), 6.61 (1H, d, J=5.2), 6.77 (1H, d, J=8.4Hz), 7.10-7.18 (2H, m), 7.30(lH, brs), 7.36-7.42 (1H, m), 7.63 (1H, s), 8.23-8.29 (1H, m), 8.60 (1H, brs), 8.73-8.76 (2H, m), 8.92-8.94 (1H, m), 9.97 (1H, brs) Example

4-(4-(Anilinocarbonyl)aminophenoxy) methoxy-6quinolinecarboxamide

The N-(4-(6-cyano methoxy quinolyl) oxyphenyl)N&amp;#1523;-phenylurea (100 mg) synthesized in Example 37 was dissolved in dimethylsulfoxide (3 ml) at 80°C, and then 5N aqueous sodium hydroxide was added and the mixture

FP01 00 was heated and stirred for 2 hours. The reaction solution was neutralized with IN hydrochloric acid, and the precipitated crystals were filtered out and washed with ethanol to obtain the title compound (60 mg). 1H-NMR Spectrum (DMSO-dg) δ(ppm) : 4.03 (3H, s) , 6.56 (1H, d, J=6.0Hz), 6.96 (1H, t, J=7.6Hz), 7.22-7.30 (4H, m), 7.45 (2H, d, J=7.6Hz), 7.52 (1H, s), 7.59-7.62 (2H, m), 7.76 (1H, brs), 7.87 (1H, brs), 8.69-8.73 (2H, m), 8.76 (1H, brs), 8.90 (1H, brs) Example

4-(4-(Anilinocarbonyl)aminophenoxy) (2methoxyethoxy) quinolinecarboxamide

The title compound (54 mg) was obtained from the N-(4-(6-cyano (methoxyethoxy) quinolyl)oxyphenyl)N&amp;#1523;-phenylurea (95 mg) synthesized in Example 65, in the same manner as Example 147. 1H-NMR Spectrum (DMSO-dg) δ(ppm) : 3.35 (3H, s) , 3.75-3.81 (2H, m), 4.37-4.41 (2H, m), 6.46 (1H, d, J=5.2), 6.96 (1H, t, J=7.6), 7.21-7.30 (4H, m) , 7.45 (2H, d, J=8.4Hz), 7.55 (lH,s), 7.59 (2H, d, J=8.8Hz),

7.81 (1H, brs), 7.82 (1H, brs), 8.65 (1H, d, J=5.2), 8.77-8.79 (2H, m), 8.91 (1H, brs) Example

4-(4-( (2,4-Difluorophenyl)carbonyl)amino-3fluorophenoxy) (2-methoxyethoxy)-6quinolinecarboxamide

FP01 00

The title compound (35 mg) was obtained from the

N- (4- (6-cyano (,2-methoxyethoxy) quinolyl) oxy-2fluorophenyl)-N'-(2,4-difluorophenyl) urea (100 mg) synthesized in Example 66, in the same manner as

Example 147.

1H-NMR Spectrum (DMSO-dg) δ(ppm) :3.34 (3H, s), 3.78-

3.81 (2H, m), 4.39-4.42 (2H, m), 6.56 (1H, d, J=5.2Hz), 7.03-7.17 (2H, m), 7.28-7.43 (2H, m), 7.56 (1H, s),

7.81 (2H, brs), 8.08-8.16 (1H, m), 8.28-8.29 (1H, m) , 8.67 (1H, d, J=5.2), 8.76 (1H, s), 9.00-9.09 (2H, m) Example

4-(4-( (4-Fluoroanilino)carbonyl)amino fluorophenoxy)7-(2-methoxyethoxy) quinolinecarboxamide

The title compound (25 mg) was obtained from the N- (4- (6-cyano (2-ethoxyethoxy) quinolyl) oxy-2fluorophenyl)-N4)-&amp;#1523;-fluorophenyl)urea (58 mg) synthesized in Example 100, in the same manner as Example 147.

1H-NMR Spectrum (DMSO-d5) δ(ppm) : 3.34 (3H,s), 3.78-

3.81 (2H, m), 4.39-4.42 (2H, m), 6.56 (1H, d, J=5.2Hz), 7.10-7.17 (3H, m), 7.36-7.50 (3H, m), 7.56 (1H, s),

7.82 (2H, brs), 8.19-8.26 (1H, m), 8.64-8.69 (2H, m), 8.76(1H, s) , 9.13-9.15 (1H, m)

Example

7-(2-Methoxyethoxy) (4-((1,3-thiazol-2ylamino)carbonyl)amino fluorophenoxy)-6294

FP01 00 quinolinecarboxamide

The title compound (18 mg) was obtained from the N-(4-(6-cyano (2-methoxyethoxy) quinolyl)oxy-2fluorophenyl)-N1,3)-&amp;#1523;-thiazol yl)urea (100 mg) synthesized in Example 25, in the same manner as Example 147.

1H-NMR Spectrum (DMSO-dg) δ(ppm) : 3.34 (3H, s) , 3.78-3.81 (2H, m), 4.39-4.42 (2H, m), 6.57 (1H, d, J=5.2Hz), 7.12-7.19 (2H, m), 7.39 (1H, d, J=3.6Hz), 7.41-7.46 (1H, m), 7.57 (1H, s), 7.82 (1H, brs), 8.218.25 (1H, m), 8.68 (1H, d, J=5.2Hz), 8.76 (lH,s), 9.06 (1H, brs) Example

4-(4-((4-Fluoroanilino)carbonyl)amino fluorophenoxy)7-methoxy quinolinecarboxamide

The title compound (25 mg) was obtained from 6carbamoyl (4-amino fluorophenoxy)-7methoxyquinoline (50 mg), in the same manner as Example 10.

1H-NMR Spectrum (DMSO-d6) δ(ppm) :4.02 (3H, s), 6.55 (1H, d, J=5.6Hz), 7.09-7.18 (3H, m) , 7.35-7.41 (1H, m), 7.43-7.49 (2H, m), 7.51 (1H, s), 7.74 (1H, brs), 7.85 (1H, brs), 8.18-8,26 (1H, m), 8.61-8.68 (3H, m), 9.099.12 (1H, m)

The starting compounds were synthesized in the following manner.

FP01 00

Production Example 152-1

7-Methoxy oxo-l,4-dihydroquinoline carboxylic acid

Glycerol (20 ml) and potassium hydroxide (KOH, 3.0 g) were added to the 7-methoxy-4&amp;#1470;oxo&amp;#1470;l,4dihydroquinoline carbonitrile (2 g) of Production Example 24, and after heating and stirring at 160°C for 3 hours, water (40 ml) was added and the mixture was heated at 80°C for 30 minutes. After cooling, 2N hydrochloric acid was added to acidity and the precipitated insoluble portion was filtered out, washed with water and then dried under reduced pressure to obtain the title compound (1.6 g).

1H-NMR Spectrum (DMSO-d6) δ(ppm) :4.87 (3H, s) , 6.14 (1H, d, J=6.0Hz), 7.04 (1H, s) , 7.98 (1H, d, J=6.0), 8.40 (1H, s) Production Example 152-2

7-Methoxy chloroquinoline carbonyl chloride

Thionyl chloride (10 ml) and a small amount of dimethylformamide (DMF) were added to 7-methoxy oxo1,4-dihydroquinoline carboxylic acid (2.0 g), and the mixture was heated to reflux for 2 hours. After concentrating under reduced pressure, azeotropic distillation was performed twice with toluene to obtain the title compound (2.7 g).

1H-NMR Spectrum (CDC13) δ(ppm) : 4.20 (3H, s), 7.807.90 (1H, m), 8.41 (1H, s), 8.90-9.00 (2H, m)

FP01 00

Production Example 152-3

7-Methoxy chloroquinoline carboxamide

7-Methoxy chloroquinoline carbonyl chloride (2.7 g) was dissolved in tetrahydrofuran (150 ml), and the solution was cooled to 0°C. After adding 30% ammonia water (5 ml), the mixture was stirred at room temperature for 30 minutes. Water was added, extraction was performed 3 times with ethyl acetate, and then the organic layers were combined, washed with water and saturated brine, dried over sodium sulfate and dried under reduced pressure to obtain the title compound (1.35 g). 1H-NMR Spectrum (DMSO-dg) δ(ppm) : 4.03 (3H, s) , 7.56-7.66 (2H, m), 7.79 (1H, brs), 7.88 (1H, brs), 8.46-8.49 (1H, m), 8.78-8.82 (1H, m) Production Example 152-4 6&amp;#1470;Carbamoyl (3-fluoro nitrophenoxy)-7methoxyquinoline

The title compound (1.1 g) was obtained from 7methoxy chloroquinoline carboxamide (1.23 g), in the same manner as Example 7. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.03 (3H, s), 6.96 (1H, d, J=5.2Hz), 7.25-7.30 (1H, m), 7.57 (1H, s), 7.61-7.66 (1H, m), 7.74 (1H, brs), 7.84 (1H, brs), 8.25-8.32 (1H, m), 8.49 (1H, s), 8,80 (1H, d, J=5.2Hz) Production Example 152-5

FP01 00

6-Carbamoyl (4-amino fluorophenoxy)-7methoxyquinoline

The title compound (540 mg) was obtained from 6carbamoyl (3-fluoro nitrophenoxy)-7methoxyquinoline (1.08 g), in the same manner as Production Example 10. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 4.01 (3H, s) , 5.19-5.23 (2H, m), 6.44 (IH, d, J=5.2), 6.83-6.89 (2H, m), 7.05-7.10 (1H, m), 7.47 (1H, s) , 7.71 (1H, brs),

7.83 (IH, brs), 8.60-8.66 (2H, m) Example 1- (2-Chloro {6- [4-(2-diethylaminoethoxy)-phenyl]-7Hpyrrole[2,3-d]pyrimidin yloxy]phenyl)-3cyclopropylurea

1-{2-Chloro [6-[4-(2-diethylaminoethoxy)phenyl] (2-trimethylsilanylethoxymethyl)-7Hpyrrolo[2,3-d]pyrimidin yloxy]-phenyl}-3cyclopropylurea (40 mg, 0.0601 mmol) was dissolved in 1 ml of tetrahydrofuran, and then 0.5 ml (8.3 equivalents) of tetrabutylammonium fluoride (IM tetrahydrofuran solution) was added dropwise and the mixture was refluxed for 2 hours. After returning to room temperature, 3 ml of water was added, the mixture was allowed to stand for 3 hours, and the precipitating crystals were filtered out, washed with water and ether:hexane = 1:1 and dried under reduced pressure to

FP01 00 obtain 22 mg of the title compound.

MS Spectrum(ESI):535(M+l), 1H-NMR Spectrum: (DMSOd6) 0.40-0.54(2H,m),0.700.80(2H,m), 1.06(6H,t, J=7.8Hz) 2.55-2.70(5H,m), 2.88(2H,t, J=7.8Hz), 4.18(2H,t, J=7.8Hz), 7.01(lH, d, J=1.7Hz), 7.12(2H, d, J=8.4Hz), 7.23(1H, d, J=2.5Hz), 7.27(1H, dd, J=8.8Hz, J'=2.5Hz ), 7.41(1H, d, J=2.5Hz),7.97(2H, d, J=8.4Hz), 8.0K1H, s) , 8.24(1H, d, J=8.8Hz), 8.36(1H, s),12.68(lH, brs)

The intermediates were synthesized in the following manner. Production Example 153-1 2-Amino4)-5&amp;#1470;-benzyloxyphenyl)-lH-pyrrole carboxylic acid ethyl ester

After adding 700 ml of ethanol to 50,7 g of ethyl 2-amidinoacetate hydrochloride (a publicly known compound described in Liebigs Ann. Chem., 1895(1977)), the mixture was stirred at room temperature, 22.3 g of sodium ethoxide (1 equivalent with respect to ethyl 2amidinoacetate hydrochloride) was added, and the mixture was stirred for 15 minutes under a nitrogen atmosphere. To this there was added 49.9 g of 1-(4benzyloxyphenyl) bromoethanone (publicly known compound described in Journal of Heterocyclic Chemistry, vol.2, 310(1965) and Journal of Medicinal Chemistry, vol.17, 55(1974)), and the mixture was stirred for 36

FP01 00 hours at room temperature under a nitrogen atmosphere.

Water was added, ethyl acetate was used for liquid separation and extraction, and then the organic layer was dried over sodium sulfate and concentrated to dryness to obtain 56.7 g of the title compound.

1H-NMR Spectrum: (DMSOdg) 1.32 (3H, t, J=7,3Hz),4,10(2H,q, J=7.3Hz ),5.08(2H, s,), 5.62(2H, s) , 6.30 (1H, d, J=2.2Hz), 6.95 (2H, d, J=7.9Hz),7.28-7.47 (7H, m), 10.67 (lH,brs) Production Example 153-2 6-(4-Benzyloxyphenyl)-7H-pyrrolo[2, 3-d]pyrimidin 01

After adding 84 ml of formic acid, 338 ml of formamide and 169 ml of dimethylformamide to 56.7 g of the ethyl 2-amino (4-benzyloxyphenyl)-lH-pyrrole-3carboxylate synthesized in Production Example 153-1, the mixture was stirred at 140°C for 48 hours and then allowed to stand at room temperature for 24 hours. The precipitated solid was filtered out and dried under reduced pressure to obtain 41 g of the title compound. 1H-NMR Spectrum: (DMSOdg) 5.12(2H, s), 6.78 (1H, s),7.03(2H, d, J=7.0Hz), 7.28-7.47(5H, m), 7.73(2H, d, J=7.0Hz), 7.82(1H, s),11.80(1H,brs), 12.20 (1H,brs) Production Example 153-3 6-(4-Benzyloxyphenyl) chloro-7H-pyrrolo[2,3d]pyrimidine

After adding 200 ml of phosphorus oxychloride to

FP01 00 g of the 6-(4-benzyloxyphenyl)-7H-pyrrolo[2,3d]pyrimidin 01 synthesized in Production Example 1532, the mixture was stirred at 140°C for 3 hours and the reaction mixture was cooled to room temperature and the reaction mixture was concentrated. Ice water was added to the residue, and liquid separation and extraction were performed with an ethyl acetate: tetrahydrofuran (5:1) mixed solvent. The organic layer was washed with water and saturated brine, dried over sodium sulfate and concentrated to dryness to obtain 12 g of the title compound.

1H-NMR Spectrum: (DMSOd6) 5.18(2H, s),6.97(lH, d, J=2.4Hz),7.12(2H, d, J=7.5Hz), 7.30-7.50(5H, m) , 7.94(2H, d, J=7.5Hz), 8.7O(1H, s) , 12.90 (1H, brs.) Production Example 153-4

6- (4-Benzyloxyphenyl) chloro (2trimethylsilanylethoxy-methyl)-7H-pyrrolo[2,3d]pyrimidine

After adding 0.381 g (1.3 equivalents) of sodium hydride (60% dispersion, Aldrich) to a solution of 2.46 g of the 6-(4-benzyloxyphenyl) chloro-7H-pyrrolo[2,3d]pyrimidine synthesized in Production Example 153-3 in dimethylformamide (30 ml), the mixture was stirred at room temperature for 40 minutes, 1.68 ml (1.3 equivalents) of 2-(chloromethoxy)ethyltrimethylsilane was added, the mixture was stirred at room temperature

FP01 00 overnight, and then 20 ml of water and 1 ml of acetic acid were added and liquid separation and extraction were performed with an ethyl acetate: tetrahydrofuran (5:1) mixed solvent. The organic layer was dried over sodium sulfate, concentrated and subjected to NH silica gel column chromatography (ethyl acetate) to obtain

2.83 g of the title compound.

1H-NMR Spectrum: (DMSOd6) -0.10(9H, s), 0.84(2H,t, J=8.0Hz), 3.62(2H,t, J=8.0Hz),5.20(2H, s), 5.61(2H, S),6.81(1H, s), 7.19(2H, d, J=7.7Hz), 7.33-7.52(5H, m) , 7.88(2H, d,. J=7.7Hz), 8.7O(1H, s) Production Example 153-5

4-[6-(4-Benzyloxyphenyl) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy] chlorophenylamine

After adding 12 ml of dimethylsulfoxide to the 6(4-benzyloxyphenyl) chloro (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidine synthesized in Production Example 153-4, 141 mg (1.5 equivalents) of sodium hydride (60% dispersion, Aldrich) and 507 mg (1.5 equivalents) of 4amino chlorophenol were added while stirring, and stirring was then continued at room temperature for 10 minutes and then at 135-140°C for 4 hours. The mixture was returned to room temperature, water was added, and liquid separation and extraction were performed with an

FP01 00 ethyl acetate:tetrahydrofuran (5:1) mixed solvent. The organic layer was dried over sodium sulfate, concentrated and subjected to NH silica gel column chromatography (hexane-ethyl acetate) to obtain 1.20 g of the title compound.

1H-NMR Spectrum: (DMSOd6) -0.90(9H, s), 0.85(2H,t, J=8.0Hz), 3.61(2H,t, J=8.0Hz),5.18(2H, s), 5.34(2H, s), 5.59(2H, s),6.64(lH, s,), 6.85(1H, d, J=8.0Hz),6.956.99(1H, m ), 7.15-7.20(3H, m ), 7.30-7.55 (5H, m ),7.7K2H, d, J=8.0Hz), 8.41(1H, d, J=1.4Hz) Production Example 153-6

1-{4-[6-(4-Benzyloxyphenyl) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy] chlorophenyl} cyclopropylurea

After dissolving 334 mg of the 4-[6-(4benzyloxyphenyl) (2-trimethylsilanylethoxymethyl)-7Hpyrrolo[2,3-d]pyrimidin yloxy] chlorophenylamine synthesized in Production Example 153-5 in 4 ml of dimethylformamide, 0.066 ml (1.4 equivalents) of pyridine and 0.102 ml (1.4 equivalents) of phenyl chlorocarbonate were added, and after stirring at room temperature for 2.5 hours, 0.09 ml (2.2 equivalents) of cyclopropylamine was added and the mixture was stirred overnight. Water was added, liquid separation and extraction were performed with ethyl acetate, and the organic layer was washed with saturated brine, dried

FP01 00 over sodium sulfate, concentrated and subjected to silica gel column chromatography (hexane-ethyl acetate) to obtain 330 mg of the title compound.

MS Spectrum(ESI): 656(M+l),678(M+23), 1H-NMR Spectrum: (DMSOd6) -0.09(9H, s), 0.40-0.46(2H,m), 0.63-0.70(2H,m), 0.87(2H,t, J=7.8Hz), 2.43-2.62(lH,m), 3.62(2H,t, J=7.8Hz),5.20(2H, s), 5.60(2H, s),6.75(lH, s), 7.15-7.53 (9H, m), 7.73(2H, d, J=8.6Hz), 7.94(1H, s), 7.93(1H, s), 8.18(1H, d, J=9.0Hz), 8.4K1H, d, J=1.8Hz) Production Example 153-7

1-{2-Chloro [6-(4-hydroxyphenyl) (2trimethylsilanylethoxymethyl)-7H-pyrrolo [2,3d]pyrimidin yloxy] phenyl} cyclopropylurea

After dissolving 260 mg of the l-{4-[6-(4benzyloxyphenyl) (2-trimethylsilanylethoxymethyl)-7Hpyrrolo[2,3-d]pyrimidin yloxy] chlorophenyl}-3cyclopropylurea synthesized in Production Example 153-6 in 10 ml of ethanol and 5 ml of tetrahydrofuran, 100 mg of platinum oxide was added and the mixture was stirred overnight at room temperature and normal pressure under a hydrogen atmosphere. It was then filtered with celite and concentrated under reduced pressure. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate) to obtain 160 mg of the title compound.

FP01 00 1H-NMR Spectrum: (DMSOd6) -0.09(9H, s), 0.40-0.46(2H,m) ,

0.63-0.70(2H,m), 0.86(2H,t, J=8.1Hz), 2.53-2.62(lH,m),

3.62(2H,t, J=8.1Hz), 5.58(2H, s,) , 6.67(1H, 8,),

6.90(2H, d, J=8.2Hz), 7.13-7.22 (2H, m) , 7.43-7.47(1H,

m),7.60(2H, d, J=8.2Hz), 7.93(1H, s) , 8.17(1H, d, J=9.1Hz), 8.4O(1H, s), 9.38(lH,brs) Production Example 153-8 1-{2-Chloro [6-[4-(2-diethylamino hydroxypropoxy)phenyl] (2-trimethylsilanylethoxymethyl)-7Hpyrrolo[2,3-d]pyrimidin yloxy]-phenyl}-3cyclopropylurea

After dissolving 113 mg of the 1-(2-chloro [6(4-hydroxyphenyl) (2-trimethylsilanylethoxymethyl)7H-pyrrolo[2,3-d]pyrimidin yloxy] phenyl)-3cyclopropylurea synthesized in Production Example 153-7 in 1 ml of dimethylformamide, 120 mg (3.5 equivalents) of 2-chloroethyldiethylamine hydrochloride and 138 mg (5 equivalents) of potassium carbonate were added and the mixture was stirred at 80°C for 15 hours. The mixture was then returned to room temperature, water was added, and liquid separation and extraction were performed with ethyl acetate. The organic layer was dried over sodium sulfate, concentrated and subjected to NH silica gel column chromatography (hexane-ethyl acetate) to obtain 40 mg of the title compound.

MS Spectrum(ESI):665(M+l),

FP01 00 1H-NMR Spectrum: (DMSOd6) -0.09(9H, s), 0.40-0.47(2H,m), 0.63-0.70(2H,m), 0.87(2H,t, J=8.9Hz), 0.99(6H,t, J=8.0Hz) 2.52-2.62(5H,m), 2.80(2H,t, J=8.0Hz), 3.62(2H,t, J=8.9Hz), 4.10(2H,t, J=8.0Hz), 5.60(2H, s,), 6.72(1H, s), 7.08(2H, d, J=8.1Hz), 7.17(1H, d, J=3.2Hz), 7.21(1H, dd, J=3.2, 8.4Hz), 7.46(1H, d,

J=3.2Hz),7.71(2H, d, J=8.1Hz), 7.94(1H, s,), 8.18(1H, d, J=8.4Hz), 8.40(lH, s, )

Example

1-(2-Chloro {6-[4-(2-(1-pyrrolidino)ethoxy)-phenyl]7H-pyrrolo[2,3-d]pyrimidin yloxy]phenyl)-3cyclopropylurea

The title compound (13 mg) was obtained from 25 mg of 1-{2-chloro [6-[4-(2-pyrrolidinoethoxy)-phenyl]-7(2-trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]-phenyl} cyclopropylurea, in the same manner as Example 153. MS Spectrum(ESI):533(M+l), 1H-NMR Spectrum: (DMSOd6) 0.40-0.45(2H,m),0.600.70(2H,m), 1.65-1.72(4H,m), 2.47-2.60(5H,m,covered by DMSO peak), 2.70(2H,t, J=7.6Hz), 4.12(2H,t, J=7.6Hz), 6.82(1H, s), 7.02(2H, d, J=8.5Hz), 7.13(1H, d, J=2.6Hz), 7.17(1H, dd, J=2.6, 8.5Hz), 7.41(1H, d, J=2.6Hz),7.87(2H, d, J=8.5Hz), 7.91(1H, s), 8.14(1H, d, J=8.5Hz), 8.26(1H, s),12.59(lH, brs) Production Example 154-1

FP01 00

1-{2-Chloro [6-[4-(2-(1-pyrrolidino)ethoxy)-phenyl]7-(2-trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea

The title compound (27 mg) was obtained from 86 mg of the 1-{2-chloro [6-(4-hydroxyphenyl) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2, 3d]pyrimidin yloxy] phenyl} cyclopropylurea synthesized in Production Example 153-7, using 104 mg of 1-(2-chloroethyl)pyrrolidine hydrochloride and 126 mg of potassium carbonate, in the same manner as Production Example 153-8. MS Spectrum(ESI):663(M+l), 1H-NMR Spectrum: (DMSOd6) -0.09(9H, s), 0.40-0.44 (2H,m), 0.61-0.69 (2H,m), 0.85(2H,t, J=8.0Hz), 1.61-1.76(4H,m), 2.44-2.61(5H,m, covered by DMSO peak), 2.86(2H,t, J=8.0Hz), 3.61(2H,t, J=8.0Hz), 4.13(2H,t, J=8.0Hz), 5.79(2H, s), 6.72(1H, s), 7.09(2H, d, J=8.7Hz), 7.15(1H, d, J=8.7Hz), 7.20(lH, dd, J8.7 ,2.5&amp;#1470;&amp;#1470;Hz), 7.44(1H, d, J=2.5Hz),7.71(2H, d, J=8.7Hz), 7.93(1H, s), 8.16(1H, d, J=8.7Hz), 8.39(1H, s) Example 1-(2-Chloro {6-(4-(2-(1-pyrrolidino)propoxy)phenyl]7H-pyrrolo[2,3-d]pyrimidin yloxy}phenyl)-3cyclopropylurea

The title compound (11 mg) was obtained from 28 mg of l-{2-chloro [6-[4-(2-(l307

FP01 00 pyrrolidino)propoxy)phenyl] (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea, in the same manner as Example 153.

MS Spectrum(ESI):547(M+l), Production Example 155-1 1-{2-Chloro [6-[4-(3-(1-pyrrolidino)propoxy)phenyl]7-(2-trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea

The title compound (28 mg) was obtained from 96 mg of the 1-{2-chloro [6-(4-hydroxyphenyl) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy] phenyl} cyclopropylurea synthesized in Production Example 153-7, using 146 mg of 1-(3-chloropropyl)pyrrolidine, 150 mg of potassium carbonate and 15 mg of potassium iodide, in the same manner as Production Example 153-8.

MS Spectrum(ESI):677(M+l), 1H-NMR Spectrum: (DMSOd6) -0.09 (9H, s), 0.39-0.47(2H,m), 0.63-0.70(2H,m), 0.87(2H,t, J=8.0Hz), 1.63-1.73(4H,m), 1.88-1.96(2H,m), 2.40-2.62(7H, m, covered by DMSO peak), 3.61(2H,t, J=8.1Hz), 4.09(2H,t, J=6.6Hz), 5.60(2H, s), 6.72(1H, s), 7.08(2H, d, J=8.9Hz), 7.16(1H, d, J=2.6Hz), 7.2K1H, dd, J=2.4, 8.9Hz), 7.46(1H, d, J=2.6Hz),7.71(2H, d, J=8.9Hz), 7.95(1H, s) , 8.18(1H, d, J=8.9Hz), 8.40(lH, s)

FP01 00

Example

1-{2-Chloro [6-[4-((2R) hydroxy-3diethylaminopropoxy)phenyl]-7H-pyrrolo[2,3-d]pyrimidin4-yloxy]phenyl} cyclopropylurea

The title compound (11 mg) was obtained from 22 mg of 1-{2-chloro [6-[4-((2S) hydroxy-3diethylaminopropoxy)phenyl] (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea, in the same manner as Example 153.

MS Spectrum(ESI):565(M+l), 1H-NMR Spectrum: (DMSOd6) 0.40-0.47(2H,m),0.630.70(29,m), 0.96(69,t, J=6.6Hz) 2.45-2.63(79,m,covered by DMSO peak), 3.80-4.10(39,m), 6.93(19, s,), 7.04(2H, d, J=8.6Hz), 7.15(19, d, J=2.2Hz), 7.19(19, dd, J=2.2, 8.6Hz), 7.43(19, d, J=2.2Hz),7.88(29, d, J=8.69z), 7.93(19, s), 8.16(19, d, J=8.69z), 8.28(19, s), 12.60(19, brs)

Production Example 156-1

1-{2—Chloro-4—[6-[4-((2S) hydroxy-3diethylaminopropoxy)phenyl] (2trimethylsilanylethoxymethyl) pyrrolo[2,3d]pyrimidin yIoxy]phenyl} cyclopropylurea

After dissolving 75 mg of the 1-{2-chloro [6- (4hydroxyphenyl) (2-trimethylsilanylethoxymethyl)-7Hpyrrolo[2,3-d]pyrimidin yloxy] phenyl}-3

FP01 00 cyclopropylurea synthesized in Production Example 153-7 in 1 ml of dimethylformamide, 91 mg (3 equivalents) of (2S)- (+)-glycidyl p-toluenesulfonate and 92 mg (5 equivalents) of potassium carbonate were added, and the mixture was stirred at 75°C for 8 hours. After returning it to room temperature, the reaction system was filtered with a Kiriyama funnel, 0.1 ml of diethylamine was added to the filtrate, and the mixture was stirred at 70°C for 8 hours. Water was then added, and liquid separation and extraction were performed with ethyl acetate and tetrahydrofuran. The organic layer was concentrated and subjected to NH silica gel column chromatography (hexane-ethyl acetate) to obtain 24 mg of the title compound. MS Spectrum(ESI):695 (M+l) , 1H-NMR Spectrum: (DMSOdg) -0.09 (9H, s), 0.39-0.47(2H,m), 0.63-0.70(2H,m), 0.86(2H,t, J=8.3Hz), 0.97(6H,t, J=7.0Hz), 2.38-2.60(7H,m), 3.61(2H,t, J=8.3Hz), 3.834.11(3H,m), 4.82(1H, brs), 5.59(2H, s), 6.73(1H, s), 7.08(2H, d, J=8.5Hz), 7.18(1H, d, J=2.7Hz), 7.21(1H, dd, J=2.7, 8.5Hz), 7.45(1H, d, J=2.7Hz),7.71(2H, d, J=8.5Hz), 7.94(1H, s,), 8.18(1H, d, J=8.5Hz), 8.4O(1H, s,) Example l-{2-Chloro [6-[4-((2R) hydroxy-3diethylaminopropoxy)phenyl] (2310

FP01 00' trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea

The title compound (11 mg) was obtained from 22 mg of 1-{2-chloro [6-[4-((2R) hydroxy-3diethylaminopropoxy)phenyl] (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea, in the same manner as Example 153. MS Spectrum(ESI):565(M+l) , 1H-NMR Spectrum: (DMSOd6) 0.40-0.47(2H,m), 0.630.70(2H,m), 0.96(6H,t, J=6.6Hz) 2.45-2.63 (7H,m, covered by DMSO peak), 3.80-4.10(3H,m), 6.93(1H, s,), 7.04(2H, d, J=8.6Hz), 7.16(1H, d, J=2.2Hz), 7.19(1H, dd, J=2.2, 8.6Hz), 7.43(1H, d, J=2.2Hz) , 7.89(2H, d, J=8.6Hz), 7.94(1H, s), 8.16(1H, d, J=8.6Hz), 8.28(1H, s) 12.6O(1H, brs) Production Example 157-1 1-{2-Chioro [6-[4-((2R) hydroxy-3diethylaminopropoxy)phenyl] (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea

The title compound (62 mg) was obtained from 127 mg of l-{2-chloro [6-(4-hydroxyphenyl) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy] phenyl} cyclopropylurea, using 154 mg of (2R)- (-)-glycidyl p-toluenesulfonate, 155 mg

FP01 00 of potassium carbonate and 0.15 ml of diethylamine, in the same manner as Production Example 153-9.

MS Spectrum(ESI):695(M+l), 1H-NMR Spectrum: (DMSOd6) -0.09(9H, s) , 0.39-0.47(2H,m), 0.63-0.70(2H,m), 0.86(2H,t, J=8.3Hz), 0.97(6H,t, J=7.0Hz) 2.38-2.60(7H,m, covered by DMSO peak), 3.61(2H,t, J=8.3Hz), 3.83-4.11(3H,m), 4.82(1H, brs), 5.60(2H, s), 6.73(1H, s), 7.09(2H, d, J=8.5Hz), 7.16(1H, d, J=2.7Hz), 7.20(lH, dd, J=2.7, 8.5Hz), 7.45(1H, d, J=2.7Hz),7.71(2H, d, J=8.5Hz), 7.94(1H, s), 8.18(1H, d, J=8.5Hz), 8.4O(1H, s) Example

1-(2-Chloro {6-[4-((2 S) hydroxy-3pyrrolidinopropoxy)phenyl]-7H-pyrrolo[2,3-d]pyrimidin4-yloxy]phenyl} cyclopropylurea

The title compound (14 mg) was obtained from 30 mg of 1-{2-chloro [6-[4-(2-hydroxy-3pyrrolidinopropoxy)phenyl] (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea, in the same manner as Example 153. MS Spectrum(ESI):563(M+l) , 1H-NMR Spectrum: (DMSOd6) 0.40-0.47(2H,m), 0.600.70(2H,m), 1.62-1.74(4H,m), 2.40-2.70(7H,m, covered by DMSO peak), 3.88-4.10(3H,m),4 .92(1H, brs) 6.94(1H, s), 7.04(2H, d, J=8.6Hz), 7.15(1H, d, J=2.4Hz), 7.20(lH, dd,

FP01 00

J=2.4, 8.6Hz), 7.44(1H, d, J=2.4Hz), 7.88(2H, d, J=8.6Hz), 7.94(1H, s,) , 8.16(1H, d, J=8.6Hz), 8.28(1H, s) 12.6O(1H, brs) Production Example 158-1 1-{2-Chloro [6-[4-(2S) hydroxy-3pyrrolidinopropoxy)phenyl] (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea

The title compound (30 mg) was obtained from 81 mg of 1-{2-chloro [6-(4-hydroxyphenyl) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy] phenyl} cyclopropylurea, using 98 mg of (2S)- ( + )-glycidyl p-toluenesulfonate, 99 mg of potassium carbonate and 0.1 ml of pyrrolidine, in the same manner as Production Example 153-9.

MS Spectrum(ESI):693(M+l), 1H-NMR Spectrum: (DMSOdg) -0.09 (9H, s), 0.40-0.46 (2H,m), 0.62-0.70(2H,m), 0.87(2H,t, J=8.4Hz), 1.62-1.72(4H,m), 2.40-2.68(7H,m, covered by DMSO peak), 3.62(2H,t, J=8.4Hz), 3.90-4.10(3H,m), 4.92(1H, brs), 5.60(2H, s,), 6.72(1H, s,), 7.10(2H, d, J=8.8Hz), 7.17(1H, d, J=2.4Hz), 7.21(1H, dd, J=2.4, 8.8Hz), 7.46(1H, d, J=2.4Hz),7.71(2H, d, J=8.8Hz), 7.95(1H, s), 8.18(1H, d, J=8.8Hz), 8.4K1H, s) Example

1-(2-Chloro2))-4]-6}-4&amp;#1470;R) hydroxy-3313

FP01 00 pyrrolidinopropoxy)phenyl]

4-yloxy]phenyl} cyclopropylurea

The title compound (24 mg) was obtained from 70 mg of 1-{2-chloro [6-[4-(2-hydroxy-3pyrrolidinopropoxy)phenyl] (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea, in the same manner as Example 153.

MS Spectrum(ESI):563(M+l), 1H-NMR Spectrum: (DMSOd6) 0.40-0.47(2H,m), 0.600.70(2H,m), 1.73-1.87(4H,m), 2.49-2.60(7H,m, covered by DMSO peak), 3.94-4.19(3H,m),4 .92(1H, brs) 6.94(1H, d, J=1.2Hz), 7.06(2H, d, J=8.6Hz), 7.15-7.22(2H,m), 7.43(1H, d, J=2.4Hz),7.91(2H, d, J=8.6Hz), 7.96(1H, s), 8.17(1H, d, J=8.6Hz), 8.29(1H, s) 12.61(1H, brs) Production Example 159-1

1-{2-Chloro [6-[4-((2R) hydroxy-3pyrrolidinopropoxy)phenyl] (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea

The title compound (72 mg) was obtained from 128 mg of 1-{2-chloro [6-(4-hydroxyphenyl) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea, using 155 mg of (2R)- (-)-glycidyl p-toluenesulfonate, 156 mg of potassium carbonate and 0.13 ml of pyrrolidine, in

FP01 00 the same manner as Production Example 153-9. MS Spectrum(ESI) :693(M+l) , 1H-NMR Spectrum: (DMSOd6) -0.09(9H, s) , 0.40-0.46(2H,m), 0.60-0.70(2H,m), 0.87(2H,t, J=8.4Hz), 1.62-1.72 (4H,m), 2.40-2.68(7H,m, covered by DMSO peak), 3.61 (2H,t, J=8.4Hz), 3.90-4.10(3H,m), 4.92(1H, brs,), 5.60(2H, s,), 6.72(1H, s), 7.09(2H, d, J=8.8Hz), 7.16(1H, d, J=2.4Hz), 7.20(lH, dd, J=2.4, 8.8Hz), 7.45(1H, d,

J=2.4Hz),7.71(2H, d, J=8.8Hz), 7.95(1H, s), 8.18(1H, d, J=8.8Hz), 8.4O(1H, s)

Example 1-(2-Chloro {6-[4-(2-diethylaminopropoxy)phenyl]-7Hpyrrolo[2,3-d]pyrimidin yloxy}phenyl)-3cyclopropylurea

The title compound (2 mg) was obtained from 17 mg of l-{2-chloro [6-[4-(2-diethylaminopropoxy)phenyl]7-(2-trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea, in the same manner as Example 153. MS Spectrum(ESI):549(M+l), Production Example 160-1 4-[4-(4-Amino chlorophenoxy) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yl]phenol

After dissolving 255 mg of the 4-[6-(4benzyloxyphenyl) (2-trimethylsilanylethoxymethyl)-7H

FP01 00 pyrrolo[2,3-d]pyrimidin yloxy] chlorophenylamine synthesized in Production Example 153-5 in 10 ml of ethanol and 3 ml of tetrahydrofuran, 100 mg of platinum oxide was added and the mixture was stirred overnight at room temperature under normal pressure in a hydrogen atmosphere. After filtering with celite, the filtrate was concentrated under reduced pressure. The residue was subjected to silica gel column chromatography (hexane-ethyl acetate) to obtain 105 mg of the title compound.

1H-NMR Spectrum: (DMSOd6) -0.09(9H, s), 0.83(2H,t, J=7.8Hz), 3.52(2H,t, J=7.8Hz) , 5.33(2H, s), 5.54(2H, s) , 6.55(1H, s), 6.83(1H, d, J=8.8Hz), 6.88(2H, d, J=8.8Hz), 6.94(1H, dd, J=2.4, 8.8Hz), 7.17(1H, d, J=2.4Hz), 7.58(2H, d, J=8.8Hz), 8.35(1H, s),9.84(lH,brs) Production Example 160-2

2-Chloro [6-[4-(3-diethylaminopropoxy)phenyl] (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenylamine

After dissolving 47 mg of the 4-[4-(4-amino-3chlorophenoxy) (2-trimethylsilanylethoxymethyl)-7Hpyrrolo[2,3-d]pyrimidin yl]phenol synthesized in Production Example 160-1 in 0.5 ml of dimethylformamide, there were added 56 mg (3.1 equivalents) of (3chloropropyl)diethylamine hydrochloride and 94 mg (7 equivalents) of potassium carbonate, and the mixture

FP01 00 was stirred at 80°C for 24 hours. It was then returned to room temperature, water was added, and liquid separation and extraction were performed with an ethyl acetate:tetrahydrofuran (5:1) mixed solvent. The organic layer was dried over sodium sulfate, concentrated and subjected to NH silica gel column chromatography (hexane-ethyl acetate) to obtain 49 mg of the title compound.

Ms Spectrum(ESI):596(M+l) ,

Production Example 160-3

1-{2-Chloro [6-[4-(3-diethylaminopropoxy)phenyl]-7(2-trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenyl} cyclopropylurea

After dissolving the 2-chloro [6- [4-(3diethylaminopropoxy)phenyl] (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]phenylamine synthesized in Production Example 160-2 in 0.6 ml of dimethylsulfoxide, 23 mg of phenyl cyclopropylcarbamate was added and the mixture was stirred at 80°C for 1.5 hours. After further adding 75 mg of phenyl cyclopropylcarbamate and stirring at 100°C for 5 hours, 70 mg of the same reagent was added prior to stirring overnight. The mixture was then returned to room temperature, water was added, and liquid separation and extraction were performed with an ethyl acetate:tetrahydrofuran (5:1)

FP01 00 mixed solvent. The organic layer was dried over sodium sulfate, concentrated and subjected to NH silica gel column chromatography (hexane-ethyl acetate) to obtain 18 mg of the title compound. MS Spectrum(ESI):679(M+l), Example 1-(4-Fluorophenyl) [4-(6-phenyl-7H-pyrrolo[2,3d]pyrimidin ylsulfanyl)thiazol ylurea

After adding 323 mg of iron powder, 12 ml of ethanol and 2.4 ml of water to 4-(5-nitrothiazol-2ylsulfanyl) phenyl-7H-pyrrolo[2,3-d]pyrimidine, the mixture was stirred at 80°C for 10 minutes and then returned to room temperature, after which 7.5 ml of potassium carbonate was added, the mixture was filtered with celite, and ethyl acetate and water were added to the filtrate for liquid separation and extraction. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, filtered with plug cotton and concentrated to dryness to obtain 310 mg of a solid. The solid was dissolved in 10 ml of tetrahydrofuran, 10 ml of toluene and 10 ml of acetonitrile under reflux, and then 0.1 ml of 4fluorophenyl isocyanate was added and the mixture was stirred for 2 hours. It was then returned to room temperature, and the reaction system was concentrated, subjected to silica gel column chromatography and dried

FP01 00 to obtain 33 mg of the title compound.

1H-NMR Spectrum: (DMSOd6) 6.71(1H, s, ) , 7.12(2H,

m),7.36-7.52(5H, m), 7.62(1H, s), 7.92(2H, d, J=8.1Hz),

8.55(1H, s),9.12(lH, s), 1O.24(1H, s), 12.82(lH,brs) The intermediates were synthesized in the following manner.

Production Example 161-1 6-Phenyl-7H-pyrrolo[2,3-d]pyrimidine thiol

After adding 6.19 g of phosphorus pentasulfide, 6.24 g of sodium bicarbonate and 25 ml of diglyme to 2.45 g of the 6-phenyl-7H-pyrrolo[2,3-d]pyrimidin 01 described in WO97/02266 and and stirring the mixture for 1 hour, an additional 3 g of phosphorus pentasulfide and 3 g of sodium bicarbonate were added and the mixture was stirred for 1 hour. There were further added another 3 g of phosphorus pentasulfide and 3 g of sodium bicarbonate, and the mixture was stirred for 1 hour. It was then returned to room temperature, water was added, the mixture was stirred for 10 minutes, and the precipitated crystals were filtered out, washed with water and dried to obtain 2.5 g of the title compound.

1H-NMR Spectrum: (DMSOd6) 7.05 (1H, d, J=2.1Hz), 7.32 (1H, t, J=7.9Hz), 7.43 (2H, t, J=7.9Hz), 7.88 (2H, d, J=7.9Hz),8.05 (1H, s),12.68(1H,brs), 13.36(lH,brs) Production Example 161-2

FP01 00

4-(5-Nitrothiazol ylsulfanyl) phenyl-7Hpyrrolo[2,3-d]pyrimidine

After adding 1.06 g of 2-bromo nitrothiazole and 15 ml of dimethylformamide to 6-phenyl-7H-pyrrolo[2,3d]pyrimidine thiol, the mixture was stirred at room temperature for 3 hours, and then 0.45 ml of pyridine was added and the mixture was stirred overnight. Water was added, and the precipitated crystals were filtered out, blow-dried and dried under reduced pressure to obtain 1.20 g of the title compound.

1H-NMR Spectrum: (DMSOd6) 7.26(1H, J=2.4Hz), 7.367.54(3H, m), 8.01 (2H, d, J=7.8Hz), 8.90(lH, S,),8.94(1H, s,),13.11(1H,brs), Example 1-[5-(6-Phenyl-7H-pyrrolo[2,3-d]pyrimidin-4ylsulfanyl)-3&amp;#1470;thiazol ylurea

After adding 265 mg of phenyl 2-thiazoylcarbamate and 10 ml of dimethylsulfoxide to 354 mg of 5-(6phenyl-7H-pyrrolo[2,3-d]pyrimidin ylsulfanyl)-2thiophenylamine, the mixture was stirred at 80°C for 2 hours. Ethyl acetate and water were added for liquid separation and extraction, the organic layer was concentrated and subjected to silica gel column chromatography and dried, and the obtained solid was washed with ether to obtain 170 mg of the title compound.

FP01 00 1H-NMR Spectrum: (DMSOd6) 6.55(1H,brs), 6.94(1H, d,

J=4.2Hz), 7.05(lH, d, J=1.9Hz), 7.26(1H, d, J=4.2Hz),

7.28-7.50(4H, m) , 7.82-7.90 (3H, m) ,8.49(lH, s),

1O.42(1H, brs), 12.54(1H,brs)

The intermediates were synthesized in the following manner. Production Example 162-1

4- (5-Nitro thiophenylsulfanyl) phenyl-7Hpyrrolo[2,3-d]pyrimidine

After adding 1.05 g of 2-bromo nitrothiophene, 0.95 g of potassium carbonate and 15 ml of dimethylformamide to the 6-phenyl-7H-pyrrolo[2,3d]pyrimidine thiol synthesized in Production Example 161-1 and stirring the mixture overnight at room temperature, water was added and the precipitated crystals were filtered out, blow-dried and dried under reduced pressure to obtain 1.30 g of the title compound. 1H-NMR Spectrum: (DMSOd6) 7.08(lH, s), 7.40 (1H, t, J=8.0Hz), 7.48 (2H, t, J=8.0Hz), 7.56 (1H, d, J=4.1Hz), 7.98 (2H, d, J=8.0Hz), 8.16 (1H, d, J=4.1Hz), 8.7O(1H, s),1 2.68(lH,brs) Production Example 162-2

5- (6-Phenyl-7H-pyrrolo[2,3-d]pyrimidin ylsulfanyl)thiophen y!amine

After adding 543 mg of iron powder, 1.06 g of ammonium chloride, 10 ml of dimethylformamide, 20 ml of

FP01 00 ethanol and 5 ml of water to the 4-(5-nitro-2thiophenylsulfanyl) phenyl-7H-pyrrolo[2,3d]pyrimidine synthesized in Production Example 162-1, the mixture was stirred at 90°C for 2 hours, 30 ml of tetrahydrofuran was added, and then the mixture was returned to room temperature and filtered with celite, and ethyl acetate and water were added to the filtrate for liquid separation and extraction. The organic layer was dried over anhydrous sodium sulfate, filtered with plug cotton and concentrated to dryness to obtain 435 mg of the title compound.

MS Spectrum(ESI):325(M+l) 1H-NMR Spectrum: (DMSOd6) 5.98 (1H, d, J=4.2Hz),6.24(2H, s), 6.27 (1H, d, J=2.0Hz), 7.00 (1H, d, J=4.2Hz),7.307.50(3H, m), 7.80 (2H, d, J=7.6Hz), 8.46(1H, s), 12.63(lH,brs) Example

4-{4-[3- (4-Fluorophenyl)ureido]phenoxy)-7H-pyrrolo[2,3d]pyrimidine carboxylic acid ethyl ester

After dissolving 90 mg of ethyl 4-(4aminophenoxy)-7H-pyrrolo[2,3-d]pyrimidine carboxylate in 3 ml of toluene and 1 ml of acetonitrile at 110°C, 16.6 pl of 4-fluorophenyl isocyanate was added and the mixture was stirred for 1 hour under reflux. After standing at room temperature, the precipitated crystals were filtered out and dried to obtain 110 mg of the

FP01 00 title compound.

1H-NMR Spectrum: (DMSOd6) 1.31(3H, t, J=7.9 Hz),

4.32(2H, q, J=7.9 Hz), 7.07-7.54(9H, m), 8.42(1H, s),

8.72(1H, s), 8.76(1H, s),13.03(lH,brs)

The intermediates were synthesized in the following manner. Production Example 163-1 4-¢4-Nitrophenoxy)-7H-pyrrolo[2,3-d]pyrimidine-6carboxylic acid ethyl ester

After adding 390 mg of 4-nitrophenol, 703 mg of potassium carbonate and 8.7 ml of dimethylformamide to 577 mg of the 4-chloroethoxycarbonyl-7H-pyrrolo[2,3d]pyrimidine described in WO9702266(Al) and stirring the mixture at 120°C for 4 hours, 40 mg of 4nitrophenyl was further added and the mixture was stirred for 1.5 hours. After returning the mixture to room temperature, water was added, liquid separation and extraction were performed with an ethyl acetatetetrahydrofuran mixed solvent, and the organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, filtered with plug cotton and concentrated to dryness to obtain a solid which was then washed with ether to obtain 520 mg of the title compound.

1H-NMR Spectrum: (DMSOd6) 1.33 (3H, t, J=7.9 Hz), 4.35(2H, q, J=7.9 Hz),7.28(lH, s), 7.56-7.64(2H, m),

FP01 00

8.30-8.38 (2H, m), 8.46(1H, s),13.21 (lH,brs) Production Example 163-2

4-(4-Aminophenoxy)-7H-pyrrolo[2,3-d]pyrimidine-6carboxylic acid ethyl ester

After adding 110 mg of iron powder, 220 mg of ammonium chloride, 10 ml of ethanol and 2 ml of water to 4-(4-nitrophenoxy)-7H-pyrrolo[2,3-d]pyrimidine-6carboxylic acid ethyl ester, the mixture was stirred at 80-85°C for 2.5 hours. After returning the mixture to room temperature, 20 ml of tetrahydrofuran was added, the mixture was stirred for 5 minutes and filtered with celite, and 100 ml of ethyl acetate and 50 ml of water were added to the filtrate for liquid separation and extraction. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, filtered with plug cotton and concentrated to dryness to obtain 90 mg of the title compound.

1H-NMR Spectrum: (DMSOdg) 1.31(3H, t, J=7.9 Hz), 4.31(2H, q, J=7.9Hz), 5.10(2H, s), 6.56-6.62(2H, m), 6.86-9.92 (3H, m), 8.4O(1H, s),12.98(lH,brs) Example

4-(4-[3-(4-Fluorophenyl)ureido]phenoxy)-7H-pyrrolo[2,3d]pyrimidine carboxylic acid

After adding 7 ml of ethanol, 7 ml of water and 31 mg of lithium hydroxide monohydrate to 75 mg of the 4{4-[3-(4-fluorophenyl)ureido]phenoxy)-7H-pyrrolo[2,3324

FP01 00

d]pyrimidine carboxylic acid ethyl ester synthesized in Example 163 and stirring the mixture at 40-45°C for hours, it was neutralized with 2N HC1 and concentrated to dryness to obtain 40 mg of the title compound.

1H-NMR Spectrum: (DMSOd6) 6.83(1H, s),7.06-7.16(2H, m), 7.19(2H, m) , 7.44-7.48 (2H, m), 7.51(2H, d, J=8.0Hz), 8.39(1H, s), 8.72(1H, s), 8.76(1H, s),12.88(lH,brs) Example

4-{4-[3-(4-Fluorophenyl)ureido]phenoxy)-7H-pyrrolo [2,3d]pyrimidine carboxylic(3-diethylaminopropyl)amide

After adding 1 ml of dimethylformamide, 47 μ&amp;#912; of triethylamine, 18.5 μ&amp;#912; of diphenylphosphoryl azide and 8.2 μ&amp;#912; of 1-methylpiperazine to 12 mg of the 4-{4-[3(4-fluorophenyl)ureido]phenoxy)-7H-pyrrolo[2,3d]pyrimidine carboxylic acid synthesized in Example 164, the mixture was stirred overnight at room temperature. Water was added, and the mixture was subjected to liquid separation and extraction with an ethyl acetate-tetrahydrofuran mixed solvent and to NH silica gel column chromatography (ethyl acetatemethanol) to obtain 27 mg of the title compound.

1H-NMR Spectrum: (DMSOd6) 2.18(3H, s), 2.28-2.48(4H, m), 3.58-3.70 (4H, m), 6.56(1H, s), 7.06-7.56 (8H, m), 8.36(1H, d, J=1.7 Hz), 8.78(1H, s), 8.84(1H, s), 12.67(lH,brs)

FP01 00

Example

4-{4-[3- (4-Fluorophenyl)ureido]phenoxy)-7H-pyrrolo[2,3d]pyrimidine carboxylic(3-diethylaminopropyl)amide

After adding 0.8 ml of dimethylformamide, 21 μ&amp;#912; of triethylamine, 9.5 μ&amp;#912; of diphenylphosphoryl azide (DPPA) and 6.5 μ&amp;#912; of 4-(3-aminopropyl)morpholine to 12 mg of the 4-{4-[3-(4-fluorophenyl)ureido]phenoxy}-79pyrrolo[2,3-d]pyrimidine carboxylic acid synthesized in Production Example 164, the mixture was stirred at room temperature for 2 days. Saturated aqueous ammonium chloride solution was added, liquid separation and extraction were performed with an ethyl acetatetetrahydrofuran mixed solvent, and the organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, filtered with plug cotton and concentrated to dryness to obtain 9 mg of the title compound.

MS Spectrum(ESI):534(M+l) 1H-NMR Spectrum: (DMSOd6) 1.62-1.74(2H, m), 2.202.42(69, m), 2.88-2.98 (2H, m), 3.46-3.62 (49, m), 7.067.56(99, m), 8.34(19, s), 8.84-8.90(29, m), 12.68(19,brs) Example 1-(4-Fluorophenyl) [4-(6-hydroxymethyl-7Hpyrrolo[2,3-d]pyrimidin yloxy)phenyl]urea

After adding 9 ml of tetrahydrofuran to 55 mg of

FP01 00 the 4-{4-[3-(4-fluorophenyl)ureido]phenoxy)-7Hpyrrolo[2,3-d]pyrimidine carboxylic acid ethyl ester synthesized in Example 163 and stirring the mixture, 25 mg of lithium aluminum hydride was added at room temperature and the mixture was stirred for 2 days. Water was then added, liquid separation and extraction were performed with an ethyl acetate-tetrahydrofuran mixed solvent, and the organic layer was filtered with celite and concentrated to dryness to obtain 35 mg of the title compound.

MS Spectrum(ESI):394(M+l),416(M+23) 1H-NMR Spectrum: (DMSOd6) 4.55(2H, d, J=6.7 Hz), 5.32 (1H, t, J=6.7 Hz),6.84(lH, s), 7.06-7.55 (8H, m), 8.22(1H, s), 8,74(1H, s), 8.76(1H, s),12.11 (lH,brs) Example

1-(4-Fluorophenyl) [4-(6-formyl-7H-pyrrolo[2,3d]pyrimidin yloxy)phenyl]urea

After adding 3 ml of chloroform and 50 mg of manganese dioxide to 18 mg of 1-(4-fluorophenyl) [4(6-hydroxymethyl-7H-pyrrolo[2,3-d]pyrimidin-4yloxy)phenyl]urea, the mixture was stirred overnight at room temperature. Tetrahydrofuran and ethyl acetate were added to the reaction system, and the mixture was filtered with celite and concentrated to dryness to obtain 16 mg of the title compound.

1H-NMR Spectrum: (DMSOd6) 6.82(1H, s), 7.03-7.60(8H, m),

FP01 00

8.46(1H, s), 8.71(1H, s) , 8.75(1H, s) , 9.86(1H, s),13.08(1H,brs) Example

1-(4-Fluorophenyl) [4-(6-morpholin ylmethyl-7Hpyrrole[2,3-d]pyrimidin yloxy)phenyl]urea

After adding 0.5 ml of tetrahydrofuran, 10 pl of morpholine and 26 mg of triacetoxyborohydride to the 1(4-fluorophenyl) [4-(6-formyl-7H-pyrrolo[2,3d]pyrimidin yloxy)phenyl]urea synthesized in Example 168, the mixture was stirred overnight at room temperature. The reaction system was subjected to liquid separation and extraction with a tetrahydrofuran-ethyl acetate mixed solvent, and then dried over anhydrous sodium sulfate and concentrated to dryness to obtain 5 mg of the title compound. MS Spectrum(ESI):463(M+l) Example 1-(4-Fluorophenyl) {4-[6-(4-methyl-1piperazylmethyl)-l-7H-pyrrolo[2,3-d]pyrimidin-4yloxy]phenyl}urea

After adding 0.4 ml of tetrahydrofuran, 11 pl of 1-methylpiperazine and 23 mg of sodium triacetoxyborohydride to the 1-(4-fluorophenyl) [4(6-formyl-7H-pyrrolo[2,3-d]pyrimidin-4yloxy)phenyl]urea synthesized in Example 168, the mixture was stirred overnight at room temperature. The

FP01 00 reaction system was subjected to liquid separation and extraction with a tetrahydrofuran-ethyl acetate mixed solvent, and then dried over anhydrous sodium sulfate and concentrated to dryness to obtain 5 mg of the title compound.

MS Spectrum(ESI):476(M+l)

Example 1-(4-Fluorophenyl) [4-(6-phenyl-7H-pyrrolo[2,3d]pyrimidin yloxy)phenyl]urea

After dissolving 40 mg of 4-(6-phenyl-7Hpyrrolo[2,3-d]pyrimidin yloxy)phenylamine in 4.5 ml of toluene and 4.5 ml of acetonitrile at 110°C, 4fluorophenyl isocyanate (16.6 μ&amp;#912;) was added and the mixture was stirred for 1 hour. After returning the mixture to room temperature, the precipitated crystals were filtered out and dried to obtain 37 mg of the title compound.

MS Spectrum(ESI):440(M+l),462(M+23) 1H-NMR Spectrum: (DMSOd6) 7.02(lH, s), 7.06-7.52 (11H, m), 7.94 (2H, d, J=8.0Hz), 8.28(1H, s),8.77(lH, s), 8.79(1H, s), 12.68(1H,brs)

The intermediates were synthesized in the following manner. Production Example 171-1 4-(4-Nitrophenoxy) phenyl-7H-pyrrolo[2,3-d]pyrimidine

After adding 123 mg of 4-nitrophenol, 136 mg of

FP01 00 potassium carbonate and 1.5 ml of dimethylformamide to 113 mg of the 4-chloro phenyl-7H-pyrrolo[2,3d]pyrimidine described in WO97/02266 and and stirring the mixture for 15 hours at 130-135°C, and additional 60 mg of 4-nitrophenol and 75 mg of potassium carbonate were added and the mixture was stirred for 6 hours. After returning the mixture to room temperature, water was added, liquid separation and extraction were performed with an ethyl acetatetetrahydrofuran mixed solvent, and the solid obtained by concentration to dryness was washed with ether to obtain 112 mg of the title compound.

1H-NMR Spectrum: (DMSOd6) 7.13(1H, s), 7.37 (1H, t, J=7.7 Hz), 7.47 (2H, t, J=7.7 Hz), 7.56-7.61 (2H, m) , 7.74-8.00(2H, m) , 8.30-8.38 (3H, m),12.82(1H,brs) Production Example 171-2

4-(6-Phenyl-7H-pyrrolo[2,3-d]pyrimidin-4yloxy)phenylamine

After adding 110 mg of iron powder, 220 mg of ammonium chloride, 10 ml of ethanol and 2 ml of water to 110 mg of 4-(4-nitrophenoxy) phenyl-7Hpyrrolo[2,3-d]pyrimidine, the mixture was stirred at 80-85°C for 2.5 hours. After returning the mixture to room temperature, 20 ml of tetrahydrofuran was added, and the mixture was stirred for 5 minutes and filtered with celite, after which 100 ml of ethyl acetate and 50

FP01 00 ml of water were added to the filtrate for liquid separation and extraction. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, filtered with plug cotton and concentrated to dryness to obtain 90 mg of the title compound.

MS spectrum(ESI) m/z 303(M + 1) 1H-NMR Spectrum: (DMSOd6) 5.04(2H,brs) 6.572) 6.61&amp;#1470;H, m) , 6.84-6.90 (3H, m), 7.34 (1H, t, J=7.7 Hz), 7.45 (2H, t, J=7.7 Hz), 7.87 (2H, t, J=7.7 Hz),8.26(1H,s) 12.61(lH,brs) Example

1-(3-Fluorophenyl) [4-(6-phenyl-7H-pyrrolo[2,3d]pyrimidin yloxy)phenyl]urea

The title compound (24 mg) was obtained by reacting 3-fluorophenyl isocyanate (14 μ&amp;#912;) with 36 mg of 4-(6-phenyl-7H-pyrrolo[2,3-d]pyrimidin-4yloxy)phenylamine, in the same manner as Example 171. MS Spectrum(ESI):440(M+l),462(M+23) 1H-NMR Spectrum: (DMSOd6) 7.02(lH, s,), 7.08-7.54 (11H, m), 7.94 (2H, d, J=8.0Hz), 8.28(1H, S,),8.88(1H, s,), 9.00(lH, s,), 12.68(1H,brs) Example l-Cyclopropyl [4-(6-phenyl-7H-pyrrolo[2,3d]pyrimidin yloxy)phenyl]urea

After adding 30 mg of phenyl cyclopropylcarbamate

FP01 00 and 0.5 ml of dimethylsulfoxide to 40 mg of 4-(6phenyl-7H-pyrrolo[2,3-d]pyrimidin yloxy)phenylamine, the mixture was stirred at 80°C for 4 hours. The mixture was returned to room temperature, water was added, liquid separation and extraction were performed with ethyl acetate, and the solid obtained by concentration to dryness was washed with ether to obtain 6 mg of the title compound.

1H-NMR spectrum: (DMSOd6) 0.30-0.40(2H,m), 0.550.65(2H,m), 2.43-2.57(lH,m,coverd by DMSO peak), 6.2O(1H, brs), 6.60 (2H,d,J=8.90 Hz), 6.83(1H, s), 6.876.91 (1H, m), 7.10-7.16 (1H, m), 7.30-7.50 (3H, m), 7.90 (2H, d, J=8.1Hz), 8.26(1H,d,J=0.4 Hz),8.92(lH, brs,), 12.60 (1H,brs) Example

1-[4-(6-Phenyl-7H-pyrrolo[2,3-d]pyrimidin-4yloxy)phenyl] (thiazol yl)urea

After adding 492 mg of phenyl 2-thiazoylcarbamate to 520 mg of 4-(6-phenyl-7H-pyrrolo[2,3-d]pyrimidin-4yloxy)phenylamine, the mixture was stirred at 80°C for 4 hours. The precipitated crystals were filtered out and washed with ethyl acetate and tetrahydrofuran to obtain 275 mg of the title compound.

1H-NMR Spectrum: (DMSOd6) 7.03(lH, d, J=2.0Hz), 7.1O(1H, d, J=3.0Hz), 7.18-7.50 (7H, m) , 7.54 (2H, d, J=8.7Hz), 7.74 (2H, d, J=8.0Hz), 8.29(1H, s,),9.10(lH, s,),

FP01 00

12.69 (lH,brs)

Example 1-(4-Fluorophenyl) [2-fluoro (6-phenyl-7Hpyrrolo[2,3-d]pyrimidin yloxy)phenyl]urea

The title compound (26 mg) was obtained from 36 mg of 2-fluoro (6-phenyl-7H-pyrrolo[2,3-d]pyrimidin-4yloxy)phenylamine, in the same manner as Example 171. 1H-NMR Spectrum: (DMSOdJ 7.05-7.18 (4H, m) , 7.30-7.50 (6H, m),7.94 (2H, d, J=8.1Hz), 8.21(1H, t,

J=10.4Hz),8.32(1H, s), 8.55(1H, d, J=1.9Hz), 9.09(lH, s), 12.73 (1H,brs)

The intermediates were synthesized in the following manner. Production Example 175-1 4-(3-Fluoro nitrophenoxy) phenyl-7H-pyrrolo[2,3d]pyrimidine

After adding 328 mg of 3-fluoro nitrophenol, 0.22 ml of 2,6-lutidine and 0.9 ml of Nmethylpyrrolidine to 360 mg of the 4-chloro phenyl7H-pyrrolo[2,3-d]pyrimidine described in WO97/02266 and and stirring the mixture overnight at 130°C, it was returned to room temperature, water was added, the precipitated solid was filtered out and washed with water and diethyl ether, and the collected solid was dried to obtain 112 mg of the title compound. 1H-NMR Spectrum: (DMSOd6) 7.14(1H, s), 7.34-7.44 (2H,

FP01 00

m) , 7.48 (2H, t, J=7.8 Hz), 7.73 (1H, dd, J=2.5 Hz,

11.8 Hz), 7.89(2H, d, J=7.8 Hz), 8.28(1H, t, J=8.5 Hz),

8.40(lH, d, J=1.3 Hz) , 12.87 (1H,brs)

Production Example 175-2

4-(6-Phenyl-7H-pyrrolo[2,3-d]pyrimidin-4yloxy)phenylamine

The title compound (118 mg) was obtained from 125 mg of the 4-(3-fluoro nitrophenoxy) phenyl-7Hpyrrolo[2,3-d]pyrimidine synthesized by the intermediate synthesis method described above, in the same manner as Production Example 171-2. 1H-NMR Spectrum: (DMSOd6) 5.10(2H, s), 6.784) 7.04&amp;#1470;H, m), 7.37 (1H, t, J=7.9 Hz), 7.47(2H, t, J=7.9 Hz), 7.92(2H, d, J=7.9Hz), 8.38(1H, s),12.67(lH,brs) Example 1-(3-Fluorophenyl) [2-fluoro (6-phenyl-7Hpyrrolo[2,3-d]pyrimidin yloxy)phenyl]urea

The title compound (27 mg) was obtained from 33 mg of 2-fluoro (6-phenyl-7H-pyrrolo[2,3-d]pyrimidin-4yloxy)phenylamine, in the same manner as Example 171. 1H-NMR Spectrum: (DMSOd6) 6.78(1H, dt, J=3.3, 9.5Hz),7.06-7.52 (8H, m), 7.97 (2H, t, J=8.2Hz), 8.1K1H, t, J=9.5Hz) ,8.42 (1H, s) , 8.62(1H, s) , 8.62(1H, s), 9.28(1H, s), 12.73(1H,brs)

Example 1-[2-Fluoro (6-phenyl-7H-pyrrolo[2,3-d]pyrimidin-4334

FP01 00 yloxy)phenyl]-3&amp;#1470;(thiazol yl)urea

The title compound (27 mg) was obtained from 42 mg of 2-fluoro (6-phenyl-7H-pyrrolo[2,3-d]pyrimidin-4yloxy)phenylamine, in the same manner as Example 171. 1H-NMR Spectrum: (DMSOd6) 7.06-7.16 (3H, m) , 7.12-7.44 (3H, m) , 7.47 (2H, t, J=8.1Hz),7.96 (2H, d, J=8.1Hz), 8.12(1H, t, J=9.1Hz),8.32(1H, s), 8.96(1H, brs), 1O.78(1H, brs), 12.73 (1H,brs) Example 54)-6]&amp;#1470;-Hydroxyphenyl)-7H-pyrrolo[2,3-d]pyrimidin-4yloxy]indole-l-carboxylic ethylamide

After dissolving 30 mg of 5-(6-(4benzyloxyphenyl) (2-trimethylsilanylethoxymethyl)-7Hpyrrolo[2,3-d]pyrimidin yloxy]indole-l-carboxylic ethylamide in 1 ml of trifluoroacetic acid and 0.1 ml of thioanisole, the mixture was stirred at 50-55°C. The mixture was then returned to room temperature, saturated sodium bicarnobate water was added to alkalinity, and liquid separation and extraction were performed with an ethyl acetate-tetrahydrofuran (5:1) mixed solvent. The organic layer was concentrated, 1 ml of tetrahydrofuran and 1 ml of 2N aqueous sodium hydroxide were added to the residue, and the mixture was stirred at room temperature for 5 minutes. After neutralization with IN hydrochloric acid, liquid separation and extraction were performed with an ethyl

FP01 00 acetate-tetrahydrofuran (5:1) mixed solvent. The organic layer was concentrated and the residue was subjected to silica gel column chromatography (hexaneethyl acetate) to obtain 5 mg of the title compound.

MS Spectrum(ESI):468(M+55); (M+Na+MeOH) 1H-NMR Spectrum: (DMSOd6) 1.18(3H,t, J=6.7Hz), 3.203.50 (2H, m, covered by H2O peak ), 6.67 (1H, d,

J=3.5Hz),6.78(1H, s,), 6.83(2H, d, J=8.4Hz), 7.12(1H, dd, J=2.2, 8.4Hz), 7.44(1H, d, J=2.2Hz), 7.74(2H, d, J=8.4Hz), 7.89(1H, d, J=3.3Hz), 8.16-8.22(2H, m ), 8.25(1H, d, J=8.4Hz), 9.80(lH, brs,), 12.45(1H, brs), Example

6-(4-Benzyloxyphenyl) (ΙΗ indolyloxy)-7Hpyrrolo[2,3-d]pyrimidine

After dissolving 1.5 ml of tetrahydrofuran in 22 mg of 5-[6-(4-benzyloxyphenyl) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]-indole-l-carboxylic ethylamide, a 1M solution of tetrabutylammonium fluoride in tetrahydrofuran was added and the mixture was refluxed for 2 hours. After returning it to room temperature, water was added and the precipitated crystals were filtered out and subjected to silica gel column chromatography (hexane-ethyl acetate) to obtain 2 mg of the title compound.

1H-NMR Spectrum: (DMSOd6) 5.17(2H, s), 6.40-6.43(1H,

FP01 00

m), 6.8O(1H, s,), 6.93(1H, dd, J=2.5, 8.8Hz), 7.10(2H, d, J=8.8Hz), 7.30-7.50 (8H, m ), 7.83(2H, d, J=8.8Hz),

8.2O(1H, s), 11.19(1H, brs), 12.51(1H, brs),

The intermediates were synthesized in the following manner. Production Example 179-1 6-(4-Benzyloxyphenyl) (ΙΗ indolyloxy) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidine

After adding 1.9 ml of dimethylformamide, 180 mg of 5-hydroxyindole and 112 mg of potassium carbonate to 190 mg of 6-(4-benzyloxyphenyl) chloro (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidine, the mixture was stirred at 135-140°C for 4 hours. After returning it to room temperature, water was added, and liquid separation and extraction were performed with an ethyl acetate:tetrahydrofuran (5:1) mixed solvent. The organic layer was concentrated and subjected to NH silica gel column chromatography (hexane-ethyl acetate) to obtain 90 mg of the title compound. MS Spectrum(ESI):563(M+l) 1H-NMR Spectrum: (DMSOd6) -0.09(9H, s), 0.87(2H,t, J=8.4Hz), 3.62(2H,t, J=8.4Hz) 5.19(2H, s), 5.59(2H, S),6.42-6.46(lH, m), 6.65(1H, s), 6.83(2H, d, J=8.4Hz), 6.97(1H, dd, J=2.6, 8.6Hz), 7.16(2H, d, J=8.6Hz), 7.32337

FP01 00

7.50(8H, m ), 7,70(2H, d, J=8.6Hz),8.37(1H, d, J=1.7Hz),

11.21(1H, brs).

Production Example 179-2

5-[6-(4-Benzyloxyphenyl) (2trimethylsilanylethoxymethyl)-7H-pyrrolo[2,3d]pyrimidin yloxy]indole-l-carboxylic ethylamide

After dissolving 5-(4-benzyloxyphenyl) (1H-5indolyloxy) (2-trimethylsilanylethoxymethyl)-7Hpyrrolo[2,3-d]pyrimidine (81 mg) in 1 ml of dimethylformamide, 7 mg of sodium hydride (60% dispersion) was added, the mixture was stirred at room temperature for 5 minutes, and then 31 mg of phenyl ethylcarbamate was added and the mixture was stirred for another 2 hours. Water was then added, and ethyl acetate was used for liquid separation and extraction. The organic layer was concentrated and subjected to silica gel column chromatography (hexane-ethyl acetate) to obtain 62 mg of the title compound.

MS Spectrum(ESI):634(M+l),688(M+55);(M+Na+MeOH) 1H-NMR Spectrum: (DMSOdg)-0.09(9H, s, ), 0.87(3H,t, J=8.5Hz), 1.20(2H,t, J=6.7Hz), 3.10-3.70(4H, m, covered by H20 peak ),5.20(2H,s), 5.60(2H,s), 6.67(1H, S,), 6.7O(1H, d, J=3.8Hz), 7.12-7.20 (3H, m ), 7.307.52(6H, m ), 7.72(2H, d, J=9.0Hz),7.91(1H, d, J=3.8Hz), 8.23(1H, t, J=5.9Hz), 8.29(1H, d, J=9.0Hz), 8.38(1H, s) Example 180

FP01 00

N-[4-(2-Cyclopropyl methylimidazo[4,5-b]pyridin-4yl)oxyphenyl]-N1 -(4-fluorophenyl)urea

N- [4- (2-Cyclopropyl-3H-imidazo[4,5-b]pyridin-4yl)oxyphenyl]-N'-(4-fluorophenyl) urea (25 mg), iodomethane (13 mg), potassium carbonate (26 mg) and dimethylformamide (5 ml) were stirred at 70°C for 20 minutes. Water was added, extraction was performed with ethyl acetate, and then silica gel was added to the extract and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel and purified by column chromatography (ethyl acetate, followed by ethyl acetate:methanol = 10:1) to obtain 3 mg of the target substance as a white powder.

1H-NMR (CDC13) δ (ppm): 1-.13-1.19 (2H, m) , 1.28-1.35 (2H, m) , 2.03-2.11 (1H, m), 3.95 (3H, s), 6.43 (1H, d, J= 5.6Hz), 6.95-7.04 (4H, m), 7.26-7.35 (4H, m), 8.19 (1H, d, J= 5.6Hz).

Example

N-[4-(2-Butylaminopyridin yl)oxyphenyl]-Ν' -(4fluorophenyl)urea

4-(4-Aminophenoxy) butylaminopyridine (54 mg), p-fluorophenyl isocyanate (34.5 mg) and tetrahydrofuran (5 ml) were stirred at room temperature for 2.5 hours. After adding NH type silica gel to the reaction solution, the solvent was distilled off under reduced

FP01 00 pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (hexane:ethyl acetate = 1:1, followed by ethyl acetate). The solvent was distilled off under reduced pressure and the residue was solidified with ethyl acetate-hexane to obtain 15 mg of the target substance as a light yellow powder.

1H-NMR (DMSO-d6) δ(ppm): 0.87 (3H, t, J= 7.2Hz), 1.30 (2H, tq, J= 7.2Hz, 7.2Hz), 1.44 (2H, tt, J= 7.2Hz, 7.2Hz), 3.16 (2H, q, J= 7.2Hz), 5.80 (1H, d, J= 2.0Hz), 6.09 (1H, ddd, J= 5.0Hz, 2.0Hz, 2.0Hz), 6.45 (1H, dd, J= 5.0Hz, 5.0Hz), 7.03-7.18 (4H, m), 7.43-7.55 (4H, m), 7.83 (1H, dd, J= 5.0Hz, 2.0Hz), 8.70 (1H, s), 8.74 (1H, s) .

The intermediate was synthesized in the following manner.

Production Example 181-1

4-(4-Aminophenoxy) butylaminopyridine

After dissolving 80 mg of 4-(4-aminophenoxy)-2butyrylaminopyridine in 8 ml of tetrahydrofuran, 67 mg of lithium aluminum hydride was added while stirring at room temperature, and the mixture was stirred at 70°C for 10 minutes. Water was added, extraction was performed with ethyl acetate, and then silica gel was added to the extract and the solvent was distilled off

FP01 00 under reduced pressure. The silica gel was charged into a dry column packed with silica gel and purified by column chromatography (ethyl acetate) to obtain 54 mg of the target substance as a brown oil.

1H-NMR(CDC13) δ(ppm): 0.93 (3H, t, J= 7.2Hz), 1.40 (2H, tg, J= 7.2Hz, 7.2Hz), 1.56 (2H, tt, J= 7.2Hz, 7.2Hz), 3.14 (2H, q, J= 7.2Hz), 5.82 (1H, d, J= 2.0Hz), 6.14 (1H, dd, J= 6.0Hz, 2.0Hz), 6.662) 6.74&amp;#1470;H, m), 6.86-6.94 (2H, m), 7.87 (1H, d, J= 6.0Hz) .

Example

N-(4-Fluorophenyl)-N* 1-{4-[(7-0x0&amp;#1470;5,6,7,8&amp;#1470; tetrahydro[1,8] naphthyridin yl)oxy]phenyl}urea

47)]&amp;#1470;-Oxo-5,6,7,8-tetrahydro[1,8]naphthyridin-4yl)oxy]aniline (43 mg), p-fluorophenyl isocyanate (28 mg), tetrahydrofuran (5 ml) and dimethylformamide (2 ml) were stirred at room temperature for 30 minutes. Water was added dropwise at room temperature until precipitation of crystals, and these were filtered out to obtain 48 mg of the target substance as white crystals .

1H-NMR (DMSO-d6) δ(ppm): 2.50 (2H, t, J= 8.0Hz), 2.91 (2H, t, J- 8.0Hz), 6.24 (1H, d, J= 6.0Hz), 7.03-7.35 (4H, m) , 7.40-7.55 (4H, m), 7.94 (1H, d, J= 6.0Hz), 8.70 (1H, s), 8.74 (1H, s), 10.48 (1H, s) .

The intermediates were synthesized in the following manner.

FP01 00

Production Example 182-1 4-Chloro iodo pyridinamine

A solution of 10 g of the publicly known compound tert-butyl N-(4-chloro pyridyl)carbamate, 16.6 ml of N,N,N',N1-tetramethylethylenediamine and 200 ml of tetrahydrofuran was cooled to -75°C, and then 42 ml of n-butyllithium (2.6M solution in hexane) was added dropwise over a period of 30 minutes while stirring. After stirring for 1 hour at -75°C, a solution of 28 g of iodine in 28 ml of tetrahydrofuran was added dropwise over a period of 30 minutes. After completion of the dropwise addition, stirring was continued for another 30 minutes at -75°C, and then the mixture was returned to room temperature, aqueous sodium bisulfate was added and extraction was performed with ethyl acetate. NH type silica gel was added to the extract, the solvent was distilled off under reduced pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (hexane:ethyl acetate = 3:1). The solvent was distilled off under reduced pressure, 48% HBr water was added to the residue, and the mixture was stirred at 100°C for 5 minutes. After adding ice water and 5 N sodium hydroxide water to the reaction solution, the precipitated solid was filtered out to obtain 7.4 g

FP01 00 of a light yellow solid. 1H-NMR (DMSO-d6) δ(ppm) : 6.50 (2H, bs) , 6.72 (1H, d, J= 5.6Hz), 7.82 (1H, d, J= 5.6Hz). Production Example 182-2 3-Iodo (4-nitrophenoxy) pyridinamine 4-Chloro iodo pyridinamine (1.0 g) , pnitrophenol (1.1 g) , diisopropylethylamine (1.0 ml) and N-methyl pyrrolidone (2 ml) were stirred at 170°C for 17 hours. After returning the reaction solution to room temperature, water was added and extraction was performed with ethyl acetate. NH type silica gel was added to the extract, the solvent was distilled off under reduced pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (hexane: ethyl acetate = 3:1). The solvent was distilled off under reduced pressure, and then ethyl acetate and hexane were added to the residue for solidification to obtain 540 mg of light yellow crystals .

1H-NMR(DMSO-d6) δ(ppm): 6.22 (1H, d, J= 5.2Hz), 6.37 (2H, brs), 7.19 (2H, d, J= 9.2Hz), 7.87 (1H, d, J= 5.2Hz), 8.26 (2H, d, J= 9.2Hz). Production Example 182-3 Ethyl (E) [2-amino (4-nitrophenoxy) pyridyl]-2343

FP01 00 propenoate

3-Iodo (4-nitrophenoxy) pyridinamine (500 mg), ethyl acrylate (0.3 ml), palladium (II) acetate (30 mg), tributylamine (0.66 ml) and dimethylformaldehyde (5 ml) were stirred at 130°C for 20 minutes. After returning the reaction solution to room temperature, water was added and extraction was performed with ethyl acetate. NH type silica gel was added to the extract, the solvent was distilled off under reduced pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (hexane:ethyl acetate = 3:1). The solvent was distilled off under reduced pressure to obtain 330 mg of the target substance as a yellow oil.

1H-NMR(CDC13) δ(ppm): 1.31 (3H, t, J= 7.2Hz), 4.25 (2H, q, J= 7.2Hz), 5.01 (2H, s), 6.18 (1H, d, J= 6.0Hz), 6.57 (1H, d, J= 16Hz), 7.12-7.19 (2H, m), 7.73 (1H, d, J= 16Hz), 7.99 (1H, d, J= 6.0Hz), 8.24-8.32 (2H, m) . Production Example 182-4

47)]&amp;#1470;-Oxo-5,6,7,8-tetrahydro[1,8]naphthyridin-4yl)oxy]aniline

Ethyl (E) [2-amino (4-nitrophenoxy)-3pyridyl] propenoate (330 mg), palladium-carbon (10%, aqueous, 100 mg), methanol (5 ml) and tetrahydrofuran (5 ml) were stirred overnight at under a hydrogen

FP01 00 atomsphere at 1 atmosphere. The palladium-carbon was filtered off, the filtrate was distilled off under reduced pressure, and then the residue was purified by silica gel column chromatography (ethyl acetate, followed by ethyl acetate:methanol = 5:1) to obtain 43 mg of a white solid.

1H-NMR (DMSO-dg) δ(ppm): 2.49 (2H, t, J= 8.0Hz), 2.89 (2H, t, J= 8.0Hz), 5.09 (2H, s), 6.15 (1H, dd J= 6.0Hz, 2.0Hz), 6.58 (2H, dd, J= 8.4Hz, 2.0Hz), 6.79 (2H, dd, J= 8.4Hz, 2.0Hz), 7.89 (1H, dd, J= 6.0Hz, 2.0Hz), 10.38(1H, s).

Example

N-(4-Fluorophenyl)-N'- (4-[(7-oxo-7,8dihydro[1,8]naphthyridin yl)oxy]phenyl}urea

N-(4-Fluorophenyl)-N'-{4-[(7-oxo-7,8-dihydro[1,8] naphthyridin yl)oxy]aniline (30 mg), p-fluorophenyl isocyanate (0.016 ml) and dimethylformamide (6 ml) were stirred at 70°C until disappearance of the starting materials. After returning the reaction solution to room temperature, water was added dropwise and the precipitated solid was filtered out to obtain 22 mg of a light brown solid.

1H-NMR(DMS0-d6) δ(ppm): 6.35 (1H, d, 5.6Hz), 6.54 (1H, d, J= 10Hz), 7.05-7.20 (4H, m), 7.40-7.60 (4H, m), 8.14 (1H, d, J= 10Hz), 8.29 (1H, d, J= 5.6Hz), 8.70 (1H, s), 8.78 (1H, s), 12.13 (1H, s) .

FP01 00

The intermediates were synthesized in the following manner. Production Example 183-1

4- (4-Nitrophenoxy) 0X0-7,8-dihydro[l,8]naphthyridine Ethyl (E) [2-amino (4-nitrophenoxy)-3pyridyl] propenoate (350 mg), 2'-acetonaphthone (50 mg) and methanol (80 ml) were irradiated for 4 hours while stirring, and the precipitated solid was filtered out to obtain 156 mg of a light yellow solid.

1H-NMR (DMSO-d6) δ (ppm) : 6.57 (1H, d, J=9.6Hz), 6.70 (1H, d, J= 5.6Hz), 7.46 (2H, d, J= 8.0Hz), 8.05 (1H, d, J= 9.6Hz), 8.33 (2H, d, J= 8.0Hz), 8.42 (1H, d, J= 5.6Hz), 12.31 (1H, s) .

Production Example 183-2

47)]&amp;#1470;-Oxo-7,8-dihydro[1,8]naphthyridin yl)oxy]aniline 4- (4-Nitrophenoxy) 0X0-7,8dihydro[1,8]naphthyridine (156 mg), iron powder (300 mg), ammonium chloride (600 mg), dimethylformamide (2 ml), ethanol (1 ml) and water (1 ml) were stirred at 100°C for 20 minutes. The mixture was filtered with celite, and then water and ethyl acetate were added for extraction. The organic layer was washed 4 times with aqueous ammonium chloride solution and then dried over magnesium sulfate. The drying agent was filtered off and the solvent was distilled off under reduced pressure to obtain 30 mg of the target substance as a

FP01 00 light yellow solid.

1H-NMR (DMSO-d6) δ(ppm): 5.19 (2H, brs), 6.29 (1H, d, J= 5.6Hz), 6.51 (1H, d, J= 9.6Hz), 6.30 (2H, d, J= 8.0Hz), 6.87 (2H, d, J= 8.0Hz), 8.12 (1H, d, J= 9.6Hz), 8.25 (1H, d, J= 5;6Hz), 12.10 (1H, s) . Example

Ethyl (E) [2-[(cyclopropylcarbonyl)amino] (4-{[(4fluoroanilino)carbonyl]amino}phenoxy) pyridyl]-2propenoate

Ethyl (E) [2-amino (4-{[(4fluoroanilino)carbonyl] amino]phenoxy) pyridyl]-2propenoate (200 mg), cyclopropanecarbonyl chloride (58 mg), triethylamine (0.1 m), tetrahydrofuran (4 ml) and dimethylformamide (1 ml) were stirred at room temperature for 20 minutes. A small amount of water was added dropwise and the precipitated solid was filtered out to obtain 130 mg of a faint yellow solid. 1H-NMR (DMSO-d6) δ(ppm) : 0.74 (4H, m) , 1.21 (3H, t, J= 7.2Hz), 1.88-1.95 (1H, m), 4.14 (2H, q, J= 7.2Hz), 6.53 (1H, d, J= 5.6Hz), 6.90 (1H, d, J= 16Hz), 7.07-7.19 (4H, m) , 7.40-7.48 (3H, m), 7.55 (2H, d, J= 8.0Hz), 8.21 (1H, d, J= 5.6Hz), 8.72 (1H, s), 8.81 (1H, s), 10.61 (1H, s) .

The intermediates were obtained in the following manner.

Production Example 184-1 Ethyl (E) [2-amino (4-aminophenoxy) pyridyl]-2347

FP01 00 propenoate

Ethyl (E) [2-amino (4-nitrophenoxy)-3pyridyl] propenoate (350 mg), iron powder (700 mg), ammonium chloride (1.4 g), dimethylformamide (7 ml), ethanol (2 ml) and water (2 ml) were stirred at 100°C for 20 minutes. The mixture was filtered with celite, and then water and ethyl acetate were added for extraction. The organic layer was washed 5 times with aqueous ammonium chloride solution and then dried over magnesium sulfate. The drying agent was filtered off and the solvent was distilled off under reduced pressure to obtain 230 mg of the target substance as a light yellow solid.

1H-NMR(CDC13) δ(ppm): 1.33 (3H, t, J= 7.2Hz), 3.68 (2H, brs), 4.26 (2H, q, 7.2Hz), 4.87 (2H, bs), 6.02 (IH, d, J= 6.0Hz), 6.68 (IH, d, J= 16Hz), 6.70 (2H, d, J= 8.8Hz), 6.87 (2H, d, J= 8.8Hz), 7.82 (IH, d, J= 6.0Hz), 7.85 (IH, d, J= 16Hz). Production Example 184-2 Ethyl fluoroanilino)carbonyl]amino}phenoxy) pyridyl]-2propenoate

Ethyl(E) [2-amino (4-aminophenoxy) pyridyl]2-propenoate (230 mg), p-fluorophenyl isocyanate (0.11 ml) and tetrahydrofuran (6 ml) were stirred at room temperature for 30 minutes. After adding NH type

FP01 00 silica gel to the reaction solution, the solvent was distilled off under reduced pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (ethyl acetate). The solvent was distilled off under reduced pressure to obtain 200 mg of a white solid. 1H-NMR (DMSO-d6) δ(ppm): 1.22 (3H, t, J= 7.2Hz), 4.14 (2H, q, J= 7.2Hz), 5.83 (1H, d, J= 5.6Hz), 6.41 (2H, brs), 6.62 (1H, d, J= 16Hz), 7.04-7.14 (4H, m), 7.407.53 (4H, m), 7.72 (1H, d, J= 16Hz), 7.79 (1H, d, J= 5.6Hz), 8.69 (1H, s), 8.75 (1H, s) .

Example

N-(4-Fluorophenyl)-Ν' -[4-(lH-pyrrolo[2,3-b]pyridin-4yloxy)phenyl]urea

After dissolving 90 mg of 4-(IH-pyrrolo[2,3b]pyridin yloxy)aniline in ethyl acetate at room temperature, 0.05 ml of parafluorophenyl isocyanate was added dropwise. The precipitated white crystals were filtered out to obtain 65 mg of the target substance. 1H-NMR (DMSO-d6) δ(ppm): 6.21 (1H, d, J= 3.6Hz), 6.38 (1H, d, J= 5.6Hz), 7.08-7.18 (4H, m), 7.34 (1H, d, J= 3.6Hz), 7.43-7.56 (4H, m), 8.06 (1H, d, J= 5.6Hz), 8.72 (1H, s), 8.76 (1H, s), 11.72 (1H, s) .

The intermediates were obtained in the following manner.

FP01 00

Production Example 185-1

4-(4-Nitrophenoxy) [2-(1,1,1-trimethylsilyl)-1ethynyl] pyridineamine

4-(4-Nitrophenoxy) iodo-pyridineamine (1.5 g) , (trimethylsilyl)acetylene (1.5 ml), tetrakis(triphenylphosphine) palladium(O) (480 mg), copper (I) iodide (80 mg), dimethylformamide (3 ml) and triethylamine (3 ml) were stirred at 100°C for 35 minutes. After returning the mixture to room temperature, water was added and extraction was performed with ethyl acetate. NH type silica gel was added to the extract, the solvent was distilled off under reduced pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (hexane:ethyl acetate = 4:1). The solvent was distilled off under reduced pressure, and ethyl acetate and hexane were added to the residue for solidification to obtain 560 mg of the target substance as a faint brown powder.

1H-NMR (DMSO-d6) δ(ppm) : 0.30 (9H, s) , 6.60 (1H, d, J= 5.6Hz), 6.67 (2H, brs), 7.47 (2H, d, J= 8.0Hz), 8.24 (1H, d, J= 5.6Hz), 8.52 (2H, d, J= 8.0Hz).

Production Example 185-2 4-(4-Nitrophenoxy)-IH-pyrrolo[2,3-b]pyridine

FP01 00

4- (4-Nitrophenoxy) (2-(1,1,1-trimethylsilyl)-1ethynyl] pyridinamine (560 mg), copper (I) iodide (680 mg) and dimethylformamide (5 ml) were stirred for 25 minutes under reflux. After filtering out the insoluble portion, NH type silica gel was added to the reaction solution, the solvent was distilled off under reduced pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (hexane:ethyl acetate = 2:1, followed by 1:1). The solvent was distilled off under reduced pressure to obtain 84 mg of a light yellow solid.

1H-NMR(DMSO-dg) δ(ppm): 6.14 (1H, d, J= 3.6Hz), 6.78 (1H, d, J= 5.2Hz), 7.28 (2H, d, J= 9.2Hz), 7.43 (1H, d, J= 3.6Hz), 8.21 (1H, d, J= 5.2Hz), 8.27 (2H, d, J= 9.2Hz), 11.92 (1H, brs). Production Example 185-3

4- (1H-Pyrrolo[2,3-b]pyridin yloxy)aniline

4-(4-Nitrophenoxy)-IH-pyrrolo[2,3-b]pyridine (84 mg), iron powder (160 mg), ammonium chloride (320 ml), dimethylformamide (4 ml), ethanol (2 ml) and water (2 ml) were stirred at 100°C for 15 minutes. The mixture was filtered with celite, and then water and ethyl acetate were added for extraction. The organic layer was washed 5 times with aqueous ammonium chloride

FP01 00 solution and then dried over magnesium sulfate. The drying agent was filtered off and the solvent was distilled off under reduced pressure to obtain 230 mg of the target substance as a brown oil.

1H-NMR (CDC13) δ(ppm): 6.41 (1H, d, J= 3.6Hz), 6.42 (1H, d, J= 5.6Hz), 6.74 (2H, d, J= 8.8Hz), 7.00 (2H, d, J= 8.8Hz), 7.20 (1H, d, J=3.6Hz), 8.11 (1H, d, J= 5.6Hz), 10.00 (1H, brs). Example

Nl-Cyclopropylcarbonyl-Nl-[3-(1-ethynyl) (4-{[(4fluoroanilino)carbonyl]amino}phenoxy) pyridyl]-1cyclopropanecarboxamide

After adding 57 mg of cyclopropanecarbonyl chloride to a solution of N-(4-{[2-amino (1-ethynyl)4-pyridyl]oxy}phenyl)-N'-(4-fluorophenyl)urea (100 mg), triethylamine (0,12 ml) and tetrahydrofuran (5 ml) while stirring at room temperature, stirring was continued for 1.5 hours. After adding NH type silica gel to the reaction solution, the solvent was distilled off under reduced pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (ethyl acetate). The organic solvent was distilled off under reduced pressure, and methanol and water were added to the residue for solidification to obtain 15 mg of the

FP01 00 target substance as a white powder.

1H-NMR(DMSO-d6) δ(ppm): 0.978) 1.03&amp;#1470;H, m) , 1.932.02&amp;#1470; (2H, m), 4.75 (1H, s), 6.74 (1H, d, J= 5.6Hz), 7.08&amp;#1470;

7.20 (4H, m), 7.42-7.49 (2H, m), 7.56 (2H, d, J= 8.8Hz),

8.35 (1H, d, J= 5.6Hz), 8.72 (1H, s), 8.81 (1H, s).

The intermediates were obtained in the following manner.

Production Example 186-1

3- (1-Ethynyl) (4-nitrophenoxy) pyridineamine

4-(4-Nitrophenoxy) [2-(1,1,1-trimethylsilyl)-1ethynyl] pyridineamine (560 mg), tetrabutylammonium fluoride (1.0 M solution in tetrahydrofuran, 1 ml) and tetrahydrofuran (2 ml) were stirred at room temperature for 10 minutes. Aqueous ammonium chloride solution and ethyl acetate were added for extraction, and the extract was passed through a glass filter coated with silica gel. The silica gel was thoroughly washed with ethyl acetate and the ethyl acetate was distilled off under reduced pressure to obtain 400 mg of the target substance as a brown powder.

1H-NMR(DMSO-d5) δ(ppm): 4.52 (1H, s), 6.23 (1H, d, J= 5.6Hz), 6.46 (2H, brs), 7.24 (2H, d, J= 7.2Hz), 7.94 (1H, d, J= 5.6Hz), 8.27 (2H, d, J= 7.2Hz).

Production Example 186-2

4- (4-Aminophenoxy) (1-ethynyl) pyridinamine

3-(1-Ethynyl) (4-nitrophenoxy) pyridinamine

FP01 00 (400 mg), iron powder (800 mg), ammonium chloride (1.6 g), dimethylformamide (3 ml), ethanol (1 ml) and water (1 ml) were stirred at 100°C for 30 minutes. The mixture was filtered with celite, and then water and ethyl acetate were added to the filtrate for extraction. The organic layer was washed 5 times with aqueous ammonium chloride solution and then dried over magnesium sulfate. The drying agent was filtered off and the solvent was distilled off under reduced pressure to obtain 260 mg of the target substance as a brown solid.

1H-NMR(CDC13) δ(ppm): 3.63 (1H, s) , 3.64 (2H, brs), 5.12 (2H, brs), 5.95 (1H, d, J= 5.6Hz), 6.69 (2H, dd, J= 6.4Hz, 2.0Hz), 6.91 (2H, dd, J= 6.4Hz, 2.0Hz), 7.81 (1H, d, J= 5.6Hz) .

Production Example 186-3

N-(4-{[2-Amino (1-ethynyl) pyridyl]oxy}phenyl)-N1 (4-fluorophenyl)urea

4-(4-Aminophenoxy) (1-ethynyl) pyridinamine (260 mg), para-fluorophenyl isocyanate (0.13 ml) and tetrahydrofuran (5 ml) were stirred at room temperature for 20 hours. Water was added to the reaction solution, the tetrahydrofuran was distilled off, and then a small amount of ethyl acetate was added and the precipitated solid was filtered off to obtain 20 mg of a light brown solid.

FP01 00 1H-NMR(DMSO-d6) δ(ppm): 4.53 (1H, s) , 5.80 (1H, d, J=

5.6Hz), 6.22 (2H, brs), 7.00-7.15 (4H, m), 7.40-7.53 (4H, m), 7.76 (1H, d, J= 5.6Hz), 8.69 (1H, s), 8.73 (1H,

s) .

Example

Nl-Cyclopropyl [(2-{[4-(4hydroxypiperidino)butanoyl]amino]-4&amp;#1470;pyridyl)oxy]-1H-1indolecarboxamide

Phenyl N-cyclopropylcarbamate (120 mg) was added to a solution of 260 mg of 5-[ (2-{ [4-(4hydroxypiperidino)butanoyl] amino} pyridyl)oxy]indole, 53 mg of sodium hydride (60% in oil) and 5 ml of dimethylformamide while stirring at room temperature. After stirring for 10 minutes, water was added and extraction was performed with ethyl acetate. NH type silica gel was added to the ethyl acetate layer, the solvent was distilled off under reduced pressure and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and purification was performed by column chromatography (chloroform:methanol = 30:1). The solvent was distilled off under reduced pressure, and the residue was dissolved in ethyl acetate and washed twice with IN aqueous sodium hydroxide. After drying over sodium sulfate, the solvent was distilled off under reduced pressure to obtain 20 mg of the

FP01 00 target substance as a white powder.

1H-NMR (DMSO-d6) δ(ppm): 0.57-0.64 (2H, m) , 0.68-0.75 (2H, m), 1.24-1.34 (2H, m) , 1.55-1.67 (4H, m), 1.83-

1.94 (2H, m) , 2.17 (2H, t, J= 7.2Hz), 2.28 (2H, t, J= 7.2Hz), 2.55-2.66 (2H, m), 2.73-2.80 (1H, m), 3.30-3.40 (1H, m), 4.47 (1H, d, J= 3.6Hz), 6.62(1H, dd, J= 5.6Hz, 2.4Hz), 6.64 (1H, d, J- 3.6Hz), 7.04 (1H, dd, J= 8.8Hz, 2.4Hz), 7.36 (1H, d, J= 2.4Hz), 7.61 (1H, d, J= 2.4Hz), 7.87 (1H, d, J- 3.6Hz), 8.12 (1H, d, J= 5.6Hz), 8.258.30 (2H, m), 10.40 (1H, s) .

Example

Nl-(2-Fluoroethyl) [(2-{[4-(4hydroxypiperidino)butanoyl] amino} pyridyl)oxy]-1H-1indolecarboxamide

The target substance was obtained using phenyl N(2-fluoroethyl)carbamate, in the same manner as Example 188.

1H-NMR(DMSO-d6) δ(ppm) : 1.242) 1.35&amp;#1470;H, m) , 1.57-1.67 (4H, m), 1.88 (2H, t, J= 10.4Hz), 2.17 (2H, t, J= 7.2Hz), 2.28 (2H, t, J= 7.2Hz), 2.56-2.55 (2H, m), 3.30-3.40 (1H, m), 3.55 (1H, q, J= 4.8Hz), 3.61 (1H, q, J= 4.8Hz), 4.48 (1H, d, J= 4.0Hz), 4.52 (1H, t, J= 4.8Hz), 4.64 (1H, t, J= 4.8Hz), 6.62 (1H, dd, J= 5.6Hz,

2.4Hz), 6.70 (1H, d, J= 3.6Hz), 7.05 (1H, dd, J= 8.8Hz,

2.4Hz), 7.38 (1H, d, J= 2.4Hz), 7.62 (1H, d, J= 2.4Hz),

7.95 (1H, d, J= 3.6Hz), 8.12 (1H, d, J= 5.6Hz), 8.28

FP01 00 (1H, d, J= 8.8Hz), 8.44-8.49 (1H, m) , 10.41 (1H, s) .

Example

Nl-Phenyl4)-4]}-2)]-5&amp;#1470;-hydroxypiperidino) butanoyl]amino} pyridyl)oxy]-IH-l-indolecarboxamide

The target substance was obtained using phenyl isocyanate, in the same manner as Example 187. 1H-NMR (DMSO-dg) δ(ppm): 1.24-1.35 (2H, m) , 1.57-1.67 (4H, m), 1.84-1.96 (2H, m), 2.18 (2H, t, J= 6.8Hz), 2.29 (2H, t, J= 6.8Hz), 2.56-2.66 (2H, m), 3.30-3.40 (1H, m), 4.48 (1H, d, J= 4,4Hz), 6.65 (1H, dd, J= 5.6Hz, 2.4Hz), 6.77 (1H, d, J= 3.6Hz), 7.09 (1H, dd, J= 8.8Hz, 2.4Hz), 7.10-7.16 (1H, m), 7.35-7.41 (2H, m), 7.43 (1H, d, J= 2.4Hz), 7.62-7.67 (3H, m), 8.102) 8.15&amp;#1470;H, m), 8.27 (1H, d, J= 8.8Hz), 10.10 (1H, s) , 10.42 (1H, s) . Example Nl-Cyclopropyl [(2-{[2-(4hydroxypiperidino)acetyl]amino} pyridyl)oxy]-1H-1indolecarboxamide

The target substance was obtained using 5-[ (2-{ [2(4-hydroxypiperidino)acetyl]amino} pyridyl)oxy]indole, in the same manner as Example 188. 1H-NMR(DMSO-d6) δ(ppm): 0.58-0.63 (2H, m), 0.69-0.75 (2H, m) , 1.35-1.45 (2H, m), 1.66-1.74 (2H, m), 2.172.25 (2H, m), 2.64-2.72 (2H, m), 2.72-2.80 (1H, m) , 3.04 (2H, s), 3.38-3.49 (1H, m), 4.57 (1H, d, J= 4.4Hz), 6.65 (1H, d, J= 3.6Hz), 6.68 (1H, dd, J= 5.6Hz,2.4Hz),

FP01 00

7.05 (1H, dd, J= 8.8Hz, 2.4Hz), 7.38 (1H, d, J= 2.8Hz),

7.59 (1H, d, J= 2.8Hz), 7.87 (1H, d, J= 3.6Hz), 8.15 (1H, d, J= 5.6Hz), 8.27-8.82 (2H, m) , 9.85 (1H, s).

The intermediate was obtained in the following manner. Production Example 190-1

5-[(2-{[2-(4-Hydroxypiperidino)acetyl]amino)-4pyridyl)oxy]indole

Bromoacetyl chloride (2.14 g) was added to a solution of 2.0 g of Nl-cyclopropyl [(2-amino-4pyridyl)oxy]-lH-l-indolecarboxamide, 2.3 ml of triethylamine and 20 ml of tetrahydrofuran while stirring at room temperature. After stirring for 30 minutes, water was added and extraction was performed with ethyl acetate. The extract was passed through a glass filter coated with silica gel. The silica gel was thoroughly washed with ethyl acetate, and then the ethyl acetate layers were combined and subjected to distillation under reduced pressure to obtain 900 mg of a greenish-brown oil. The 900 mg of oil was stirred at 70°C for 35 minutes together with 640 mg of 4hydroxypiperidine, 1.2 g of potassium carbonate and 20 ml of dimethylformamide. Water was added and extraction was performed with ethyl acetate. The extract was washed 3 times with water and once with brine, and then passed through a glass filter coated

FP01 00 with silica gel. The silica gel was washed thoroughly with ethyl acetate, and the solvent was distilled off under reduced pressure to obtain 530 mg of the target substance as a light yellow powder.

1H-NMR (DMSO-d6) δ(ppm) : 1.35-1.47 (2H, m) , 1.68-1.75 (2H, m), 2.21 (2H, t, J= 10.00Hz), 2.64-2.74 (2H, m), 3.03 (2H, s), 3.40-3.50 (1H, m), 4.57 (1H, d, J= 4.0Hz), 6.42 (1H, s), 6.63 (1H, dd, J= 5.6Hz, 2.4Hz), 6.86 (1H, dd, J= 8.8Hz, 2.4Hz), 7.30 (1H, s), 7.42 (1H, d, J= 2.4Hz), 7.45 (1H, d, J= 8.8Hz), 7.59 (1H, d, J= 2.4Hz), 8.12 (1H, d, J= 5.6Hz), 9.81 (1H, s), 11.25 (1H, s) . Example

Nl-(2-Fluoroethyl) [(2-{[2-(4hydroxypiperidino)acetyl]amino] pyridyl)oxy]-1H-1indolecarboxamide

The target substance was obtained using 5-[(2-{ [2(4-hydroxypiperidino)acetyl]amino}-4pyridyl)oxy]indolephenyl and N-(2-fluoroethyl)carbamate, in the same manner as Example 187.

1H-NMR(DMSO-d6) δ(ppm): 1.35-1.45 (2H, m), 1.66-1.74 (2H, m), 2.21 (2H, t, J= 10.0Hz), 2.65-2.72 (2H, m) , 3.04 (2H, s) , 3.38-3.50 (1H, m), 3.55 (1H, q, J= 4.8Hz), 3.62 (1H, q, J= 4.8Hz), 4.52 (1H, t, J= 4.8Hz), 4.56 (1H, d, J= 4.4Hz), 4.64 (1H, t, J= 4.8Hz), 6.67 (1H, dd, J= 5.6Hz, 2.4Hz), 6.70 (1H, d, J= 3.6Hz), 7.06 (1H, dd, J= 8.8Hz, 2.4Hz), 7.40 (1H, d, J= 2.4Hz), 7.60 (1H, d,

FP01 00

J- 2.4Hz), 7.95 (1H, d, J= 3.6Hz), 8.15 (1H, d, J=

5.6Hz), 8.30 (1H, d, J= 8.8Hz), 8.47 (1H, t, J= 4.8Hz),

9.85 (1H, s) .

Example

Nl-Cyclopropyl [(2-([3-(4hydroxypiperidino)propionyl]amino} pyridyl) oxy]-1H-1indolecarboxamide

The target substance was obtained using 5-[ (2-{ [3(4-hydroxypiperidino)propionyl]amino]-4pyridyl)oxy]indole, in the same manner as Example 187. 1H-NMR (DMSO-d6) δ(ppm): 0.58-0.64 (2H, m), 0.70-0.76 (2H, m) , 1.29-1.91 (2H, m), 1.62-1.72 (2H, m), 1.952.06 (2H, m), 2.38-2.58 (4H, m), 2.63-2.73 (2H, m),

2.70-2.80 (1H, m), 3.35-3.46 (1H, m) , 4.51 (1H, s) ,

6.61-6.66 (2H, m), 7.04 (1H, dd, J= 8.8Hz, 2.4Hz), 7.36 (1H, d, J= 2.4Hz), 7.59 (1H, d, J= 2.4HZ), 7.87 (1H, d,

J- 3.6Hz), 8.13 (1H, d, J= 5.6Hz), 8.25-8.30 (2H, m), 10.77 (1H, s).

The intermediate was obtained in the following manner. Production Example 192-1 5-[(2-([3-(4-Hydroxypiperidino)propionyl]amino]-4pyridyl)oxy]indole

3-Bromopropionyl chloride (1.4 ml) was added to a solution of 2.0 g of Nl-cyclopropyl [(2-amino-4pyridyl)oxy]-IH-l-indolecarboxamide, 2.3 ml of

FP01 00 triethylamine and 80 ml of tetrahydrofuran, while stirring on ice. After stirring for 10 minutes, stirring was continued at room temperature for 10 minutes, water was added and extraction was performed with ethyl acetate. The extract was passed through a glass filter coated with silica gel. The silica gel was thoroughly washed with ethyl acetate, and then the ethyl acetate layers were combined and subjected to distillation under reduced pressure to obtain 1.7 g of a faint yellow oil. A 900 mg portion of the oil was stirred at 70°C for 30 minutes together with 470 mg of 4-hydroxypiperidine, 880 mg of potassium carbonate and 10 ml of dimethylformamide. Water was added and extraction was performed with ethyl acetate. NH type silica gel was added to the ethyl acetate layer, the solvent was distilled off under reduced pressure and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and purification was performed by column chromatography (chloroform:methanol = 100:3). The solvent was distilled off under reduced pressure to obtain 170 mg of the target substance as a white powder. 1H-NMR(DMSO-d6) δ(ppm): 1.292) 1.42&amp;#1470;H, m), 1.62-1.72 (2H, m), 2.00 (2H, t, J= 7.2Hz), 2.37-2.55 (4H, m), 2.62-2.72 (2H, m), 3.35-3.46 (1H, m), 4.52 (1H, d, J= 4.0Hz), 6.42 (1H, s), 6.59 (1H, dd, J= 5.6Hz, 2.4Hz),

FP01 00

6.85 (1H, dd, J=8.8Hz, 2.4Hz), 7.29 (1H, s), 7.41 (1H, d, J= 2.4Hz), 7.44 (1H, d, J= 8.8Hz), 7.59 (1H, d, J=

2.4Hz), 8.10 (1H, d, J= 5.6Hz), 10.74 (1H, s) , 11.22 (1H, s) .

Example

Nl- (2-Fluoroethyl) ({2-[(4-piperidylcarbonyl)amino]4-pyridyl}oxy)-lH indolecarboxamide

After dissolving 160 mg of Nl-(2-fluoroethyl)-5[(2-{[(l-tert-butyloxycarbonyl-4piperidyl)carbonyl]amino} pyridyl) oxy]-1H-1indolecarboxamide in 10 ml of trifluoroacetic acid, the solution was stirred at room temperature for 10 minutes. Ethyl acetate and sodium bicarnobate water were added to alkalinity for liquid separation. The ethyl acetate layer was washed once with brine and dried over magnesium sulfate. The solvent was distilled off under reduced pressure to obtain 86 mg of a colorless powder. 1H-NMR (DMSO-d6) δ(ppm): 1.60-1.73 (2H, m), 1.83-1.91 (2H, m) , 2.65-2.73 (1H, m), 2.77-2.87 (2H, m), 3.223.32 (2H, m), 3.55 (1H, q, J= 5.2Hz), 3.62 (1H, q, J= 5.2Hz), 4.52 (1H, t, J= 5.2Hz), 4.64 (1H, t, J= 5.2Hz), 6.67 (1H, dd, J= 5.6Hz, 2.4Hz), 6.70 (1H, d, J= 3.6Hz),

7.05 (1H, dd, J= 8.8Hz, 2.4Hz), 7.38 (1H, d, J= 2.4Hz),

7.59 (1H, d, J= 2.4Hz), 7.96 (1H, d, J= 3.6Hz), 8.16 (1H, d, J= 5.6Hz), 8.29 (1H, d, J= 8.8Hz), 8.49 (1H, t,

J= 5.2Hz), 10.59 (1H, s).

FP01 00

The intermediates were obtained in the following manner.

Production Example 193-1

Nl-(2-Fluoroethyl) [(2-{[(1-tert-butyloxycarbonyl-4piperidyl)carbonyl]amino} pyridyl)oxy]-1H-1indolecarboxamide

Nl-(2-Fluoroethyl) [(2-amino pyridyl)oxy]-1H1-indolecarboxamide (500 mg), 1-tertbutyloxycarbonylpiperidine carboxylic acid (440 mg), benzotriazol-l-yloxytris(dimethylamino)phosphonium hexafluorophosphate (Bop Reagent) (840 mg) , triethylamine (0.44 ml) and dimethylformamide (10 ml) were stirred at room temperature for 17 hours. Water was added, extraction was performed with ethyl acetate, NH type silica gel was added to the extract, the solvent was distilled off under reduced pressure and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (hexane:ethyl acetate = 1:1). The solvent was distilled off under reduced pressure to obtain 160 mg of the target substance as a white powder.

1H-NMR (DMSO&amp;#1470;d6) δ(ppm) : 1.282) 1.40&amp;#1470;H, m), 1,36 (9H, s) , 1.64-1.72 (2H, m), 2.54-2.80 (3H, m), 3.55 (1H, q, J= 5.2Hz), 3.61 (1H, q, J= 5.2Hz), 3.86-3.96 (2H, m), 4.52 (1H, t, J= 5.2Hz), 4.64 (1H, t, J= 5.2Hz), 6.66 (1H, dd,

FP01 00

J= 5.6Hz, 2.4Hz), 6.70 (1H, d, J= 3.6Hz), 7.05 (1H, dd, J= 8.8Hz, 2.4Hz), 7.38 (1H, d, J= 2.4Hz), 7.59 (1H, d, J= 2.4Hz), 7.95 (1H, d, J= 3.6Hz), 8.14 (1H, d, J= 5.6Hz), 8.28 (1H, d, J= 8.8Hz), 8.48 (1H, t, J= 5.2Hz), 10.49 (1H, s). Example

Nl-(2-Fluoroethyl) [(2-{[(1-methyl piperidyl) carbonyl]amino) pyridyl)oxy] -IH-l-indolecarboxamide

Nl-Cyclopropyl ({2-[(4-piperidylcarbonyl)amino]4-pyridyl}oxy)-ΙΗ indolecarboxamide (70 mg), formaldehyde (37% in water, 0.1 ml), acetic acid (20 mg) and tetrahydrofuran (5 ml) were stirred at room temperature for 5 minutes, and then 70 mg of sodium triacetoxyborohydride was added prior to additional stirring for 10 minutes. Sodium bicarnobate water was added and extraction was performed with ethyl acetate. The extract was passed through a glass filter coated with NH type silica gel. The silica gel was thoroughly washed with ethyl acetate, and the ethyl acetate layers were combined and subjected to distillation under reduced pressure to obtain 40 mg of a colorless powder. 1H-NMR (DMSO&amp;#1470;d6) δ(ppm): 1.45-1.56 (2H, m) , 1.59-1.68 (2H, m), 1.73-1.83 (2H, m), 2.09 (3H, s), 2.30-2.40 (1H, m), 2.69-2.77 (2H, m), 3.56 (1H, q, J= 5.2Hz), 3.62 (1H, q, J= 5.2Hz), 4.52 (1H, t, J= 5.2Hz), 4.64 (1H, t, J= 5.2Hz), 6.65 (1H, dd, J= 5.6Hz, 2.4Hz), 6.70 (1H, d, J=

FP01 00

3.6Hz), 7.05 (1H, dd, J= 8.8Hz, 2.4Hz), 7.38 (1H, d, J2.4Hz), 7.60 (1H, d, J= 2.4Hz), 7.95 (1H, d, J= 3.6Hz),

8.13 (1H, d, J= 5.6Hz), 8.29 (1H, d, J= 8.8Hz), 8.48 (1H, t, J= 5.2Hz), 10.41 (1H, s) .

Example Nl-Cyclopropyl ({2-[(4-piperidylcarbonyl)amino]-4pyridyl}oxy)-ΙΗ indolecarboxamide

The target substance was obtained using Nlcyclopropyl [(2-{[(l-tert-butyloxycarbonyl-4piperidyl)carbonyl]amino} pyridyl)oxy]-1H-1indolecarboxamide, in the same manner as Example 193. 1H-NMR (DMSO-d6) δ(ppm) : 0.59-0.66 (2H, m) , 0.67-0.75 (2H, m), 1.30-1.43 (2H, m), 1.54-1.62 (2H, m), 2.362.45 (2H, m), 2.45-2.54 (1H, m), 2.73-2.80 (1H, m), 2.86-2.94 (2H, m), 6.60-6.67 (2H, m), 7.04 (1H, dd, J= 8.8Hz, 2.4Hz), 7.36 (1H, d, J= 2.4Hz), 7.60 (1H, d, J= 2.4Hz), 7.92 (1H, d, J= 2.4Hz), 8.13 (1H, d, J- 5.6Hz), 8.29 (1H, d, J= 8.8Hz), 8.34 (1H, s), 10.36 (1H, s) .

The intermediates were obtained in the following manner. Production Example 195-1 Nl-Cyclopropyl [(2-{[(l-tert-butyloxycarbonyl-4piperidyl)carbonyl]amino} pyridyl)oxy]-1H-1indolecarboxamide

The target substance was obtained using Nlcyclopropyl [(2-amino pyridyl)oxy]-1H-1365

FP01 00 indolecarboxamide, in the same manner as Production

Example 193-1.

1H-NMR (DMSO&amp;#1470;d6) δ(ppm) : 0.59-0.64 (2H, m) , 0.70-0.75

<td></td><td> (2H,</td><td> m), 1.28</td><td>.42 (11H,</td><td> m) ,</td><td> 1.64-1.71 (2H, m), 2.55-</td>

<td> 5</td><td> 2.82</td><td> (4H, m),</td><td> 3.87-3.97</td><td> (2H,</td><td> m), 6.64-6.68 (2H, m),</td>

<td></td><td> 7.03</td><td> (IH, dd,</td><td> J= 8.8Hz,</td><td> 2.4Hz</td><td> ), 7.36 (IH, d, J= 2.4Hz),</td>

<td></td><td> 7.59</td><td> (IH, d,</td><td> J= 2.4Hz),</td><td> 7.87</td><td> (IH, d, J= 3.6Hz), 8.14</td>

<td></td><td> (IH,</td><td> d, J= 5.</td><td> 6Hz), 8.27</td><td> (IH,</td><td> s) , 8.29 (IH, d, J= 8.8Hz),</td>

10.48 (IH, s).

Example 196

Nl-Cyclopropyl [(2-{[(l-methyl piperidyl) carbonyl]amino} pyridyl)oxy] -IH-l-indolecarboxamide

The target substance was obtained using Nlcyclopropyl ({2-[(4-piperidylcarbonyl)amino]-415 pyridyljoxy)-ΙΗ indolecarboxamide, in the same manner as Example 194.

<td></td><td>¹H-NMR (DMSO-d₆) δ (ppm) :</td><td> 0.59-0.65 (2H,</td><td> m) , 0.70-0.76</td>

<td></td><td> (2H, m), 1.43-1.56 (2H,</td><td> m), 1.59-1.68</td><td> (2H, m), 1.70-</td>

<td></td><td> 1.81 (2H, m), 2.09 (3H,</td><td> s), 2.30-2.40</td><td> (IH, m), 2.69-</td>

<td> 20</td><td> 2.80 (3H, m), 6.62-6.70</td><td> (2H, m), 7.04</td><td> (IH, dd, J= 8.8Hz,</td>

<td></td><td> 2.4Hz), 7.36 (IH, d, J=</td><td> 2.4Hz), 7.59 (</td><td> IH, d, J= 2.4Hz),</td>

<td></td><td> 7.87 (IH, d, J= 3.6Hz),</td><td> 8.13 (IH, d, J</td><td> = 5.6Hz), 8.27-</td>

<td></td><td> 8.83 (2H, m), 10.41 (IH</td><td> , s) .</td><td></td>

Example

Nl-Phenyl [(2-{[(l-methyl piperidyl)carbonyl] amino} pyridyl)oxy]-IH-l-indolecarboxamide

FP01 00'

The target substance was obtained using Nl-phenyl5- ({2-[(4-piperidylcarbonyl)amino] pyridyl}oxy)-1H-1indolecarboxamide, in the same manner Example 194. 1H-NMR(DMSO-d6) δ(ppm): 1.44-1.56 (2H, m) , 1.591.67&amp;#1470; (2H, m), 1.73-1.82 (2H, m), 2.09 (3H, s) , 2.30-2.44 (1H, s), 2.69-2.76 (2H, s), 6.66-6.70 (1H, m), 6.77 (1H, d, J= 3.6Hz), 7.07-7.15 (2H, m), 7.35-7.45 (3H, m), 7.607.68 (3H, m), 8.10-8.18 (2H, m), 8.27 (1H, d, J= 8.8Hz), 10.10 (1H, s), 10.42 (1H, s) .

The intermediates were obtained in the following manner. Production Example 197-1 Nl-Phenyl [(2-amino pyridyl)oxy]-1H-1indolecarboxamide

After adding 28 mg of sodium hydride (60% in oil) to a solution of 3.0 g of 5-[(2-amino pyridyl)oxy]lH-indole in dimethylformamide at room temperature and stirring the mixture for 5 minutes, 1.6 g of phenyl isocyanate was added and the mixture was stirred for 20 minutes. Water was added, extraction was performed with ethyl acetate and the organic layer was washed with water, and then silica gel was added and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel and purified by column chromatography (ethyl acetate), to obtain 3.4 g of a colorless powder.

FP01 00 1H-NMR (DMSO-dg) δ(ppm): 5.77 (1H, d, J=2.4Hz), 5.85 (2H, s), 6.14 (1H, dd, J= 5.6Hz, 2.4Hz), 6.75 (1H, d, J= 4.0Hz), 7.06 (1H, dd, J= 8.8Hz, 2.4Hz), 7.13 (1H, dd, J- 8.0Hz, 8.0Hz), 7.36-7.43 (3H, m), 7.64 (2H, d, J8.0Hz), 7.77 (1H, d, J= 5.6Hz), 8.10 (1H, d, J= 4.0Hz), 8.25 (1H, d, J= 8.8Hz), 10.08 (1H, s) .

Production Example 197-2

Tert-butyl 4-{[(4-{[1-(anilinocarbonyl)-lH indolyl] oxy} pyridyl)amino]carbonyl} piperidine carboxylate

The target substance was obtained using Nl-phenyl5-[(2-amino pyridyl)oxy]-IH-l-indolecarboxamide, in the same manner as Production Example 193-1.

1H-NMR(DMSO-dg) δ(ppm): 1.38-1.41 (11H, m), 1.64-1.72 (2H, m), 2.52-2.75 (3H, m), 3.87-3.97 (2H, m), 6.68 (1H, dd, J= 5.6Hz, 2.4Hz), 6.77 (1H, d, J= 3.6Hz), 7.09 (1H, dd, J= 8.8Hz, 2.4Hz), 7.13 (1H, dd, J= 7.2Hz, 7.2Hz), 7.38 (2H, dd, J= 7,2Hz, 7,2Hz), 7.43 (1H, d, J= 2.4Hz), 7.61 (1H, d, J= 2.4Hz), 7.65 (2H, d, J= 7.2Hz), 8.13 (1H, d, J= 3.6Hz), 8.15 (1H, d, J= 5.6Hz), 8.27 (1H, d, J= 8.8Hz), 10.10 (1H, s), 10.50 (1H, s) .

Production Example 197-3

Nl-Phenyl ({2-[(4-piperidylcarbonyl)amino]-4pyridyl}oxy)-IH-l-indolecarboxamide

The target substance was obtained using tert-butyl 41]}-4)]}&amp;#1470;-(anilinocarbonyl)-lH indolyl]oxy}-2pyridyl)amino] carbonyl} piperidine carboxylate, in

FP01 00 the same manner as Example 193.

1H-NMR (DMSO&amp;#1470;d6) δ(ppm): 1.32-1.43 (2H, m), 1.55-1.63 (2H, m), 2.37-2.53 (3H, m), 2.88-2.95 (2H, m), 6.67 (1H, dd, J= 5.6Hz, 2.4Hz), 6.77 (1H, d, J= 3.6Hz), 7.09 (1H, dd, J= 8.8Hz, 2.4Hz), 7.13 (1H, dd, J= 7.2Hz, 7.2Hz), 7.38 (2H, dd, J= 7.2Hz, 7.2Hz), 7.43 (1H, 2.4Hz), 7.627.67 (3H, m), 8.13 (1H, d, J= 3.6Hz), 8.15 (1H, d, J= 5.6Hz), 8.27 (1H, d, J= 8.8Hz), 10.10 (1H, bs), 10,40 (1H, s) .

Example

Nl-Phenyl {[2-({[(1-cyclopropylmethyl)-4piperidyl]carbonyl}amino) pyridyl]oxy}-1H-1indolecarboxamide

The target substance was obtained using Nl-phenyl5-((2-[(4-piperidylcarbonyl)amino] pyridyl}oxy)-1H-1indolecarboxamide and cyclopropanecarboxyaldehyde, in the same manner as Example 194.

1H-NMR(DMSO-d6) δ(ppm): 0.002) 0.06&amp;#1470;H, m), 0.39-0.45 (2H, m), 0.72-0.82 (1H, m) , 1.46-1.59 (2H, m), 1.601.70 (2H, m), 1.80-1.90 (2H, m), 2.10 (2H, d, J= 6.0Hz), 2.33-2.43 (1H, m), 2.90-3.00 (2H, m), 6.67 (1H, dd, J= 5.6Hz, 2.4Hz), 6.76 (1H, d, J= 3.6Hz), 7.06-7.16 (2H, m), 7.35-7.45 (3H, m), 7.60-7.68 (3H, m), 8.12 (1H, d, J=3.6Hz), 8,14 (1H, d, J= 5.6Hz), 8.27 (1H, d, J= 8.8Hz), 10.09 (1H, s), 10.40 (1H, s).

Example 199

FP01 00

N4 - (4-{4-[ (Anilinocarbonyl)amino] chlorophenoxy}-2pyridyl) methyl piperidinecarboxamide

After dissolving 120 mg of t-butyl 4-{ [(4-(4[(anilinocarbonyl)amino] chlorophenoxy}-2pyridyl)amino]carbonyl}-l-piperidine carboxylate in 5 ml of trifluoroacetic acid, the solution was stirred at room temperature for 5 minutes. Sodium bicarnobate water and 5N aqueous sodium hydroxide were added and extraction was performed with ethyl acetate. The extract was washed with brine and dried over sodium sulfate. The drying agent was filtered off, and the solvent was distilled off under reduced pressure. After adding 5 ml of tetrahydrofuran, 26 mg of acetic acid, 92 mg of sodium triacetoxyborohydride and 0.5 ml of formaldehyde (37% in water) to the residue, the mixture was stirred at room temperature for 10 minutes. Sodium bicarnobate water and 5N aqueous sodium hydroxide were added to the reaction solution, and extraction was performed with ethyl acetate. The extract was washed with brine and then passed through a glass filter coated with NH type silica gel. The silica gel was washed thoroughly with ethyl acetate, the ethyl acetate layers were combined and subjected to distillation under reduced pressure, and the residue was solidified with ethyl acetate and hexane to obtain 80 mg of a colorless powder.

FP01 00 1H-NMR (DMSO-d6) δ(ppm): 1.48-1.62 (2H, m) , 1.62-1.72 (2H, m) , 1.76-1.86 (2H, m), 2.12 (3H, s) , 2.34-2.44 (1H, m) , 2.72-2.81 (2H, m), 6.68 (1H, dd, J= 5.6Hz, 2.4Hz), 6.98 (1H, dd, J= 7.2Hz, 7.2Hz), 7.15 (1H, dd, J= 8.8Hz, 2.4Hz), 7.29 (2H, dd, J= 7.2Hz, 7.2Hz), 7.38 (1H, d, J= 2.4Hz), 7.46 (2H, d, J= 7.2Hz), 7.66 (1H, d, J= 2.4Hz), 8.17 (1H, d, J= 5.6Hz), 8.22 (1H, d, J= 8.8Hz), 8.38 (1H, s), 9.42 (1H, s), 10.49 (1H, s) .

Production Example 199-1 t-Butyl 4-({[4-(4-amino chlorophenoxy)-2pyridyl]amino]carbonyl) piperidinecarboxylate 2-Amino (4-amino chlorophenoxy)pyridine (600 mg), l-t-butyloxycarbonylpiperidine carboxylic acid (700 mg), benzotriazol-1yloxytris(dimethylamino)phosphonium hexafluorophosphate (Bop Reagent) (1.4 g), triethylamine (0.71 ml) and dimethylformamide (10 ml) were stirred at 60°C for 3.5 hours and then at room temperature for 19 hours. Water was added to the reaction solution, extraction was performed with ethyl acetate and the organic layer was washed with water, after which silica gel was added and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (hexane:ethyl acetate = 1:1, followed by ethyl acetate) to obtain 660 mg of a

FP01 00 reddish-brown powder.

1H-NMR(DMSO-d6) δ(ppm): 1.30-1.45 (11H, m) , 1.65-1.74 (2H, m), 2.56-2.76 (3H, m), 3.88-4.03 (2H, m), 5.37 (2H, s), 6.59 (1H, dd, J= 5.6Hz, 2.4Hz), 6.82-6.88 (2H, m), 6.07 (1H, d, J= 2.4Hz), 7.57 (1H, d, J= 2.4Hz), 8.12 (1H, d, J= 5.6Hz), 10.48 (1H, s) . Production Example 199-2 t-Butyl 4-{ [ (4-{3-chloro [(phenoxycarbonyl) amino]phenoxy} pyridyl)amino]carbonyl}-Ipiperidinecarboxylate

After adding 0.21 ml of phenyl chloroformate to a solution of 660 mg of t-butyl 4-({[4-(4-amino-3chlorophenoxy) pyridyl]amino}carbonyl) piperidine carboxylate, 0.14 ml of pyridine and 10 ml of tetrahydrofuran while stirring at room temperature, the mixture was further stirred for 13 hours. Water was added to the reaction solution, extraction was performed with ethyl acetate and the organic layer was washed with water, after which silica gel was added and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (hexane: ethyl acetate = 1:1, followed by ethyl acetate) to obtain 500 mg of a colorless oil.

1H-NMR(DMSO-d6) δ(ppm) : 1.30-1.45 (11H, m) , 1.67-1.77

FP01 00 (2H, m), 2.58-2.80 (3H, m), 3.88-4.00 (2H, m) , 6.71 (1H, dd, J= 5.6Hz, 2.4Hz), 7.17-7.28 (4H, m) , 7.37-7.46 (3H, m) , 7.67 (1H, d, J= 2.4Hz), 7.79 (1H, d, J= 8.8Hz), 8.20 (1H, d, J= 5.6Hz), 9.78 (1H, bs), 10.58 (1H, s) . Production Example 199-3 t-Butyl 4-{[(4-{4-[(anilinocarbonyl)amino]-3chlorophenoxy} pyridyl)amino]carbonyl}-!piperidinecarboxylate t-Butyl 4-{[(4-{3-chloro [(phenoxycarbonyl) amino]phenoxy} pyridyl)amino]carbonyl} piperidine carboxylate (250 mg), aniline (84 mg) and dimethylformamide (3 ml) were stirred at 130°C for 70 minutes. The mixture was returned to room temperature, water was added and extraction was performed with ethyl acetate. Silica gel was added to the extract, the solvent was distilled off under reduced pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with silica gel, and column purification was performed (hexane:ethyl acetate = 1:1, followed by ethyl acetate). The solvent was distilled off under reduced pressure to obtain 120 mg of a colorless oil.

1H-NMR (DMSO-d6) δ(ppm): 1.28-1.45 (11H, m) , 1.67-1.75 (2H, m), 2.57-2.80 (3H, m), 3.87-4.03 (2H, m), 6.69 (1H, dd, J= 5.6Hz, 2.4Hz), 6.93 (1H, dd, J= 7.2Hz, 7.2Hz), 7.15 (1H, dd, J8.8 &amp;#1470;Hz, 2.4Hz), 7.28 (2H, dd, J= 7.2Hz,

FP01 00

7.2Hz), 7.39 (1H, d, J- 2.4Hz), 7.45 (2H, d, J= 7.2Hz),

7.64 (1H, d, J= 2.4Hz), 8.18 (1H, d, J= 5.6Hz), 8.21 (1H, d, J= 8.8Hz), 8.36 (1H, s), 9.33 (1H, s), 10.55 (1H, s) .

Example

N4-[4- (3-Chloro {[(cyclopropylamino)carbonyl] amino}phenoxy) pyridyl]-l-methyl-4piperidinecarboxamide

The target substance was obtained using t-butyl 4({[4-(3-chloro {[(cyclopropylamino) carbonyl]aminojphenoxy) pyridyl]amino}carbonyl)-1piperidine carboxylate, in the same manner as Example 199.

1H-NMR (DMSO-d6) δ(ppm): 0.38-0.48 (2H, brs), 0.60-0.70 (2H, m), 1.50-1.85 (6H, m) , 2.11(3H, s), 2.33-2.45 (1H, m) , 2.45-2.58 (1H, m), 2.70-2.80 (2H, m), 6.66 (1H, dd,

J= 5.6Hz, 2.4Hz), 7.09 (1H, dd, J= 8.8Hz, 2.4Hz), 7.16 (1H, d, J=2.4Hz), 7.32 (1H, d, J= 2.4Hz), 7.62 (1H, s), 7.93 (1H, s), 8.16 (1H, d, J= 5.6Hz), 8.20 (1H, d, J= 8.8Hz), 10.46 (1H, s).

The intermediates were obtained in the following manner.

Production Example 200-1 t-Butyl {[(cyclopropylamino)carbonyl]amino}phenoxy)-2pyridyl]amino}carbonyl) piperidinecarboxylate

FP01 00

The target substance was obtained using cyclopropylamine with the starting material synthesized in Production Example 199-2, in the same manner as

Production Example 199-3.

1H-NMR (DMSO-d6) δ(ppm): 0.38-0.44 (2H, m), 0.60-0.68 (2H, m), 1.30-1.44 (11H, m), 1.67-1.74 (2H, m), 2.502.80 (4H, m), 3.88-4.00 (2H, m), 6.67 (1H, dd, J= 5.6Hz, 2.4Hz), 7.09 (1H, dd, J= 8.8Hz, 2.4Hz), 7.16 (1H, d, J= 2.4Hz), 7.32 (1H, d, J= 2,4Hz), 7.61 (1H, s), 7.93 (1H, s), 8.16 (1H, d, J= 5.6Hz), 8.20 (1H, d, J= 8.8Hz), 10.54 (1H, s) .

Example

N4-[4-(3-Chloro {[ (4fluoroanilino)carbonyl]amino}phenoxy) pyridyl]-4piperidinecarboxamide

After dissolving 320 mg of t-butyl 4-{ [4-(3chloro {[ (4-fluoroanilino) carbonyl]amino}phenoxy)-2pyridyl]amino)carbonyl) piperidinecarboxylate in 10 ml of trifluoroacetic acid, the solution was stirred at room temperature for 5 minutes. Ethyl acetate and sodium bicarnobate water were added to alkalinity for liquid separation. The ethyl acetate layer was washed once with brine and then dried over magnesium sulfate. The solvent was distilled off under reduced pressure to obtain 240 mg of a colorless powder.

1H-NMR (DMSO-dgj δ (ppm) : 1.36-1.48 (2H, m) , 1.58-1.66 (2H,

FP01 00

m), 2.39-2,58 (3H, m) , 2.89-2.98 (2H, m) , 6.ξ&gt;&amp;#906; (1H, dd,

J= 5.6Hz, 2.4Hz), 7.09-7.18 (3H, m), 7.38 (1H, d, J=

2.4Hz), 7.44-7.50 (2H, m), 7.66 (1H, d, J= 2.4Hz), 8.15 (2H, m), 8.38 (1H, s), 9.48 (1H, s), 10.44 (1H, s) .

The intermediates were obtained in the following manner.

Production Example 201-1 t-Butyl fluoroanilino)carbonyl]amino}phenoxy)-2pyridyl]amino}carbonyl-l-piperidinecarboxylate

The target substance was obtained using parafluoroaniline with the starting material synthesized in Production Example 199-2, in the same manner as Production Example 199-3.

1H-NMR (DMSO-dg) δ(ppm): 1.32-1.46 (11H, m), 1.66-1.75 (2H, m) , 2.56-2.78 (3H, m), 3.88-4.00 (2H, m) , 6.69 (1H, dd, J= 5.6Hz, 2.4Hz), 7.10-7.18 (3H, m), 7.38 (1H, d, J= 2.4Hz), 7.43-7.50 (2H, m), 7.64 (1H, d, J= 2.4Hz), 8.17-8.23 (2H, m), 8.37 (1H, s), 9.45 (1H, s), 10.55 (1H, s) .

Example

N4-[4-(3-Chloro {[(4fluoroanilino)carbonyl]amino}phenoxy) pyridyl]-1methyl piperidinecarboxamide

The target substance was obtained using N4-[4-(3chloro {[(4-fluoroanilino)carbonyl]amino}phenoxy)-2376

FP01 00 pyridyl] piperidinecarboxamide, in the same manner as

Example 199.

1H-NMR (DMSO-d6) δ(ppm): 1.48-1.60 (2H, m), 1.62-1.70 (2H, m), 1.74-1.83 (2H, m), 2.11 (3H, s) , 2.33-2.43 (1H, m), 2.70-2.78 (2H, m), 6.68 (1H, dd, J= 5.6Hz, 2.4Hz), 7.10-7.20 (3H, m), 7.39 (1H, d, J- 2.4Hz), 7.44-7.50 (2H, m), 7.65 (1H, d, J= 2.4Hz), 8.16-8.23 (2H, m), 8.33 (1H, s), 9.41 (1H, s), 10.47 (1H, s) .

Example

Nl-(4-{4-[(Anilinocarbonyl)amino] chlorophenoxy}-2pyridyl) (l-methyl piperidyl)acetamide

The target substance was obtained using tert-butyl 4-{2-[(4-{4-[(anilinocarbonyl)amino] chlorophenoxy}2-pyridyl)amino] oxoethyl} piperidine carboxylate, in the same manner as Example 199.

1H-NMR(DMSO-d6) δ(ppm) : 1.10-1.20 (2H, m) , 1.50-1.70 (3H, m), 1.72-1.80 (2H, m), 2.08 (3H, s), 2.24 (2H, d, J= 6.8Hz), 2.63-2.72 (2H, m), 6.66 (1H, d, J= 5.6Hz, 2.4Hz), 6.97 (1H, dd, J= 7.2Hz, 7.2Hz), 7.14 (1H, dd, J= 8.8Hz, 2.4Hz), 7.28 (2H, dd, J= 7.2Hz, 7.2Hz), 7.39 (1H, d, J- 2.4Hz), 7.47 (2H, d, J= 7.2Hz), 7.68 (1H, d, J= 2.4Hz), 8.16 (1H, d, J= 5.6Hz), 8.20 (1H, d, J= 8.8Hz), 8.40 (1H, s), 9.42 (1H, s), 10.48 (1H, s) .

The intermediates were obtained in the following manner.

Production Example 203-1

FP01 00 tert-Butyl 4-(2-{[4-(4-amino chlorophenoxy)-2pyridyl]amino) oxoethyl) piperidinecarboxylate 2-Amino (4-amino chlorophenoxy)pyridine (1,0 g), Bop reagent (1.9 g), triethylamine (1.2 ml), 2-[l(tert-butoxycarbonyl) piperidyl]acetic acid (1.0 g) and dimethylformamide (10 ml) were stirred at 60°C for 2 hours and then at room temperature for 18 hours. Water was added to the reaction solution, and extraction was performed with ethyl acetate. Silica gel was added to the extract solution and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (hexane: ethyl acetate = 1:1) to obtain 570 mg of a light brown oil.

1H-NMR (DMSO-dg) δ (ppm) : 0.95-1.07 (2H, m) , 1.36 (9H, s) , 1.53-1.62 (2H, m), 1.30-1.43 (1H, m), 2.25 (2H, d, J= 7.2Hz), 2.55-2.75 (2H, m), 3.80-3.92 (2H, m), 5.37 (2H, s), 6.58 (1H, dd, J= 5.6Hz, 2.4Hz), 6.80-6.90 (2H, m) , 7.07 (1H, d, J= 2.4Hz), 7.61 (1H, d, J= 2.4Hz), 8.11 (1H, d, J= 5.6Hz), 10.43 (1H, s) .

Production Example 203-2 tert-Butyl 4-{2-[(4-{4-[(anilinocarbonyl) amino]-3chlorophenoxy] pyridyl)amino] piperidine carboxylate

Phenyl chloroformate (210 mg) was added dropwise

FP01 00 to a solution of 570 mg of tert-butyl 4-(2-((4-(4amino chlorophenoxy) pyridyl]amino} oxoethyl)-1piperidinecarboxylate, 110 mg of pyridine and 5 ml of dimethylformamide while stirring at room temperature, and the mixture was further stirred for 30 minutes. Water was added and extraction was performed with ethyl acetate. The organic layer was washed twice with water and once with brine, and then silica gel was added and the solvent was distilled off under reduced pressure. This was then charged into a dry column packed with silica gel and purification was performed by column chromatography (hexane:ethyl acetate = 1:1, followed by ethyl acetate), to obtain 440 mg of tert-butyl 4-{2[ (4-{3-chloro [(phenoxycarbonyl)amino]phenoxy}-2pyridyl)amino] oxoethyl} piperidinecarboxylate as a light yellow oil. After adding 71 mg of aniline and 5 ml of dimethylformamide to the oil, it was stirred at 130°C for 15 minutes. The reaction solution was returned to room temperature, NH type silica gel was added, the solvent was distilled off under reduced pressure and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (hexane:ethyl acetate = 1:1), The solvent was distilled off under reduced pressure to obtain 180 mg of the target substance.

FP01 00 1H-NMR (DMSO-d6) δ (ppm) : 0.94-1.06 (2H, m), 1.36 (9H, s), 1.53-1.61 (2H, m), 1.80-1.92 (1H, m), 2.27 (2H, d, J= 6.8Hz), 2.55-2.75 (2H, m), 3.80-3.90 (2H, m), 6.67 (1H, dd, J= 5.6Hz, 2.4Hz), 6.98 (1H, dd, J= 7.2Hz, 7.2Hz), 7.15 (1H, dd, J= 8.8Hz, 2.4Hz), 7.28 (2H, dd, J= 7.2Hz, 7.2Hz), 7.39 (1H, d, J= 2.4Hz), 7.45 (2H, d, J= 7.2Hz), 7.67 (1H, s), 8.17 (1H, d, J- 5.6Hz), 8.21 (1H, d, J= 8.8Hz), 8.36 (1H, s), 9.38 (1H, s), 10.50 (1H, s) . Example

Nl-Phenyl [(2-{[2&amp;#1470;(l-methyl-4piperidyl)acetyl]amino} pyridyl)oxy]-1H-1indolecarboxamide

The target substance was obtained using tert-butyl 4-{2-[ (4-{[1-(anilinocarbonyl)-ΙΗ indolyl]oxy)-2pyridyl)amino] oxoethyl}-l-piperidinecarboxylate, in the same manner as Example 199.

1H-NMR(DMSO-d6) δ(ppm): 1.08-1.20 (2H, m) , 1.48-1.66 (3H, m) , 1.71-1.80 (2H, m), 2.07 (3H, s), 2.22 (2H, d, J= 7.2Hz), 2.62-2.69 (2H, m) , 6.65 (1H, dd, J= 5.6Hz, 2.4Hz), 6.77 (1H, d, J= 3.6Hz), 7.07-7.16 (2H, m), 7.38 (2H, dd, J= 7.2Hz, 7.2Hz), 7.43 (1H, d, J= 2.4Hz), 7.60-7.68 (3H, m), 8.10-8.17 (2H, m) , 8.27 (1H, d, J= 8.8Hz), 10.09 (1H, s), 10.43 (1H, s) .

The intermediates were obtained in the following manner.

Production Example 204-1

FP01 00 tert-Butyl 4-{2- [ (4-{[1-(anilinocarbonyl)-1H-5indolyl]oxy) pyridyl)amino] oxyethyl}-1piperidinecarboxylate

Nl-Phenyl [(2-amino pyridyl)oxy]-1H-1indolecarboxamide (500 mg), 2-[1-(tert-butoxycarbonyl)4-piperidyl]acetic acid (350 mg), benzotriazol-1yltris(dimethylamino)phosphonium hexafluorophosphate (640 mg), triethylamine (0.4 ml) and dimethylformamide (5 ml) were stirred at 60°C for 1 hour and then at room temperature for 19 hours. Water was added to the reaction solution and extraction was performed with ethyl acetate. The organic layer was washed twice with water and once with brine, and then silica gel was added and the solvent was distilled off under reduced pressure. The silica gel was then charged into a dry column packed with silica gel and purification was performed by column chromatography (hexane:ethyl acetate = 1:1, followed by ethyl acetate), to obtain 220 mg of a colorless oil.

1H-NMR (DMSO-d6) 6 (ppm) : 0.92-1.08 (2H, m) , 1.36 (9H, s) , 1.50-1.62 (2H, m), 1.77-1.90 (1H, m), 2.24 (2H, d, J= 6.8Hz), 2.55-2.77 (2H, m), 3.78-3.93 (2H, m), 6.66 (1H, dd, J= 5.6Hz, 2.4Hz), 6.77 (1H, d, J= 3.6Hz), 7.08-7.16 (2H, m), 7.35-7.46 (3H, m), 7.60-7.68 (3H, m), 8.108.18 (2H, m), 8.27 (1H, d, J= 8.8Hz), 10.09 (1H, s), 10.44 (1H, s).

FP01 00

Example

Nl-Phenyl chloro [(2-{[(l-methyl-4piperidyl)carbonyl]amino} pyridyl)oxy]-1H-1indolecarboxamide

After dissolving 260 mg of tert-butyl 4-{[ (4-{[1(anilinocarbonyl) chloro-lH indolyl]oxy}-2pyridyl)amino]carbonyl} piperidinecarboxylate in 5 ml of trifluoroacetic acid, the solution was stirred at room temperature for 5 minutes. Sodium bicarnobate water and 5N aqueous sodium hydroxide were added, and the mixture was extracted with ethyl acetate and dried over magnesium sulfate. The drying agent was filtered off and the solvent was distilled off under reduced pressure to obtain 200 mg of Nl-phenyl chloro [ (2{[(4-piperidyl)carbonyl]amino] pyridyl)oxy]-1H-1indolecarboxamide as a faint yellow solid. After adding 0.5 ml of formaldehyde (37% in water), 170 mg of sodium triacetoxyborohydride, 50 mg of acetic acid and 5 ml of tetrahydrofuran to the solid, the mixture was stirred at room temperature for 10 minutes. Sodium bicarnobate water and 5N aqueous sodium hydroxide were added, extraction was performed with ethyl acetate, and the extract was washed once with brine. The obtained ethyl acetate solution was passed through a glass filter coated with NH type silica gel. The silica gel was washed with ethyl acetate, and the solvent was

FP01 00 distilled off under reduced pressure to obtain 210 mg of a faint yellow oil. The oil was solidified from a hexane and ethyl acetate mixed solvent to obtain 90 mg of a powder.

1H-NMR(DMSO-dg) δ(ppm): 1.44-1.56 (2H, m), 1.60-1.68 (2H, m), 1.73-1.82 (2H, m) , 2.09 (3H, s) , 2.30-2.45 (1H, m), 2.70-2.76 (2H, m) , 6.69 (1H, dd, J= 5.6Hz, 2.4Hz), 7.14 (1H, dd, J= 7.2Hz, 7.2Hz), 7.22 (1H, dd, J= 8.8Hz, 2.4Hz), 7.34-7.42 (3H, m), 7.60-7.66 (3H, m), 8.17 (1H, d, J= 5.6Hz), 8.33 (1H, d, J= 8.8Hz), 8.38 (1H, s), 10.12 (1H, s), 10.45 (1H, s).

The intermediates were obtained in the following manner.

Production Example 205-1

5-[(2-Amino pyridyl)oxy] chloro-lH-l-indole

5-[(2-Amino pyridyl)oxy]-IH-l-indole (1.0 g), Nchlorosuccinimide (650 mg) and isopropanol (20 ml) were stirred at 80°C for 25 minutes. Water was added to the reaction solution and extraction was performed with ethyl acetate. The extract was passed through a glass filter coated with NH type silica gel. The silica gel was washed with ethyl acetate, and the solvent was distilled off under reduced pressure to obtain 1.3 g of a reddish-brown oil.

1H-NMR(DMSO-d6) δ(ppm): 5.73 (1H, d, J= 2.4Hz), 5.82 (2H, s), 6.13 (1H, dd, J= 5.6Hz, 2.4Hz), 6.93 (1H, dd,

FP01 00

J- 8.8Hz, 2.4Hz), 7.15 (1H, d, J= 2.4Hz), 7.48 (1H, d,

J= 8.8Hz), 7.58 (1H, d, J= 2.4Hz), 7.75 (1H, d, J=

5.6Hz), 11.48 (1H, s).

Production Example 205-2

Nl-Phenyl [(2-amino pyridyl)oxy] chloro-lH-lindolecarboxamide

Phenyl isocyanate was added dropwise to a solution of 1.3 g of 5-[(2-amino pyridyl)oxy] chloro-lH-lindole, 180 mg of sodium hydride and 15 ml of dimethylformamide, and the mixture was stirred for 20 minutes. Water was added to the reaction solution and extraction was performed with ethyl acetate. Silica gel was added to the extract and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel and purification was performed by column chromatography (hexane:ethyl acetate = 1:1, followed by ethyl acetate), to obtain 380 mg of a light red oil.

1H-NMR(DMSO-d6) δ(ppm): 5.79 (1H, d, J= 2.4Hz), 5.89 (2H, s), 6.16 (1H, dd, J= 5.6Hz, 2.4Hz), 7.12-7.20 (2H, m), 7.28 (1H, d, J= 2.4Hz), 7.35-7.42 (2H, m), 7.64 (2H, d, J= 8.0Hz), 7.79 (1H, d, J= 5.6Hz), 8.31 (1H, d, J= 8.8Hz), 8.35 (1H, s), 10.09 (1H, s).

Production Example 205-3 tert-Butyl 4-{ [ (4-{[1-(anilinocarbonyl) chloro-lH-5indolyl]oxy) pyridyl)amino]carbonyl}-1384

FP01 00 piperidinecarboxylate

The target substance was obtained using Nl-phenyl5-[(2-amino pyridyl)oxy] chloro-lH-lindolecarboxamide, in the same manner as Production Example 204-1. 1H-NMR (DMSO-d6) δ(ppm): 1.30-1.43 (11H, m), 1.65-1.73 (2H, m) , 2.55-2.75 (3H, m), 3.87-4.00 (2H, m), 6.70 (1H, dd, J= 5.6Hz, 2.4Hz), 7.14 (1H, dd, J= 7.2Hz, 7.2Hz), 7.22 (1H, dd, J= 8.8Hz, 2.4Hz), 7.32-7.42 (3H, m) , 7.60-7.67 (3H, m), 8.17 (1H, d, J= 5.6Hz), 8.32 (1H, d, J= 8.8Hz), 8.38 (1H, s), 10.12 (1H, s), 10.53 (1H, s) . Example

N-(4-Fluorophenyl)-Ν'- (4-{[2-(2-oxotetrahydro-lH-lpyrrolyl) pyridyl]oxy}phenyl)urea

N-(4-Fluorophenyl)-Ν' - (4-{ [2-(4chlorobutyrylamino) pyridyl]oxy}phenyl)urea (56 mg), potassium carbonate (46 mg) and dimethylformamide (2 ml) were stirred at 150°C for 15 minutes. Water and ethyl acetate were added for extraction, and the extract was passed through a glass filter coated with silica gel. The silica gel was washed with ethyl acetate, and the organic layer was distilled off under reduced pressure. Ethyl acetate and hexane were added to the residue, and the precipitated solid was filtered out to obtain.21 mg of a faint brown powder. 1H-NMR(DMSO-d6) (5ppm): 1.98 (2H, tt, J= 7.6Hz, 7.6Hz),

FP01 00

2.50 (2H, t, J= 7.6Hz), 3.95 (2H, t, J= 7.6Hz), 6.70 (1H, d, J= 5.6Hz), 7.05-7.15 (4H, m), 7.45 (2H, dd, J=

8.4Hz, 5.2Hz), 7.52 (2H, d, J= 9.2Hz), 7.84 (1H, s),

8.22 (1H, d, J= 5.6Hz), 8.77 (1H, s), 8.83 (1H, s).

The intermediates were obtained in the following manner. Production Example 206-1 4-{ [2 - (4-Chlorobutyrylamino) pyridyl]oxy}aniline 2-Amino (4-nitrophenoxy)pyridine (300 mg), 4chlorobutyryl chloride (0.18 ml), triethylamine (0.77 ml), dimethylformamide (1 ml) and tetrahydrofuran (1 ml) were stirred at room temperature for 10 minutes, and then silica gel was added to the reaction solution, the solvent was distilled off under reduced pressure and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with silica gel, for column purification (hexane: ethyl acetate = 3:1, followed by 2:1 and 1:1). The solvent was distilled off under reduced pressure, and then 300 mg of iron powder, 600 mg of ammonium chloride, 2 ml of DMF, 1 ml of ethanol and 1 ml of water were added to 150 mg of the resulting residue and the mixture was stirred at 100°C for 20 minutes. After filtration with celite, water and ethyl acetate were added for extraction. The organic layer was washed 5 times with aqueous ammonium chloride solution and then

FP01 00 dried over magnesium sulfate. The drying agent was filtered off and the solvent was distilled off under

<td> reduced pressure to obtain 110 mg of the</td><td> target</td>

<td> substance as an oil.</td><td></td>

<td>¹H-NMR (DMSO-d₆) δ(ppm): 1.95 (2H, tt, J=</td><td> 6.8Hz, 6.8Hz),</td>

<td> 2.48 (2H, t, J= 6.8Hz), 3.62 (2H, t, J=</td><td> 6.8Hz), 5.10</td>

<td> (2H, brs), 6.55 (1H, dd, J= 5.6Hz, 1.2Hz</td><td> ), 6.59 (2H, d,</td>

<td> J= 8.4Hz), 6.79 (2H, d, J= 8.4Hz), 7.57</td><td> (1H, d, J=</td>

1.2Hz), 8.09 (1H, d, J= 5.6Hz).

Production Example 206-2

N-(4-Fluorophenyl)-N'~(4-{[2-(4-chlorobutyrylamino)-4pyridyl]oxyjphenyl)urea

4-{ [2- (4-Chlorobutyrylamino) pyridyl]oxy}aniline (100 mg), p-fluorophenyl isocyanate (0.037 ml) and tetrahydrofuran (3 ml) were stirred at room temperature for 25 minutes. Water and ethyl acetate were added to the reaction solution for extraction, NH type silica gel was added to the extract, the solvent was distilled off under reduced pressure and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with NH type silica gel, and column purification was performed (hexane:ethyl acetate = 1:1, followed by ethyl acetate and ethyl acetate:methanol = 10:1). The solvent was distilled off under reduced pressure to obtain 56 mg of the target substance as a white solid.

FP01 00 1H-NMR(DMSO-d6) δ(ppm): 1.95 (2H, tt, J= 7.2Hz, 7.2Hz), 2.46 (2H, t, J= 7.2Hz), 3.62 (2H, t, J= 7.2Hz), 6.63 (1H, d, J= 5.6Hz), 7.04-7.16 (4H, m) , 7.40-7.48 (2H, m), 7.51 (2H, d, J= 8.8Hz), 7.62 (1H, s), 8.15 (1H, d, J= 5.6Hz), 8.71 (1H, s), 8.76 (1H, s), 10.52 (1H, brs). Example N- [4yl)oxyphenyl]-N* 1 -(2-thiazolyl)urea

4- (2-Cyclobutanecarbonylaminopyridin-4yl)oxyaniline (130 mg), phenyl N-(2-thiazolyl)carbamate (110 mg) and dimethylsulfoxide (3 ml) were stirred at 80°C for 30 minutes. Water and ethyl acetate were added to the reaction solution for extraction, and the ethyl acetate layer was washed 5 times with aqueous ammonium chloride solution and then dried over magnesium sulfate. The drying agent was filtered off, the solvent was distilled off under reduced pressure, ethyl acetate was added to the residue and the precipitated solid was filtered out to obtain 130 mg of the target substance as a light brown solid.

1H-NMR(DMSO-d6) δ(ppm) : 1.68 (1H, m), 1.80-1.93 (1H, m) , 1.95-2.10 (2H, m), 2.05-2.18 (2H, m) , 3.25-3.35 (1H, m), 6.64 (1H, d, J= 5.6Hz), 7.06-7.17 (3H, m), 7.36 (1H, d, J= 1.6Hz), 7.56 (2H, d, J= 8.0Hz), 7.66 (1H, s) , 8.14 (1H, d, J= 5.6Hz), 9.15 (1H, brs), 10.29 (1H, 3).

The intermediates were obtained in the following

FP01 00 manner .

Production Example 207-1 Nl-Cyclobutanecarbonyl&amp;#1470;Nl-[4-(4-nitrophenoxy)-2pyridyl] cyclobutanecarboxamide

2-Amino (4-nitrophenoxy)pyridine (1.0 g), cyclobutyryl chloride (1.1 g), triethylamine (1.9 ml) and tetrahydrofuran (20 ml) were stirred at room temperature for 40 minutes. After adding water and ethyl acetate for extraction, the extract solution was distilled off under reduced pressure and the residue was purified with a column (hexane:ethyl acetate = 1:1) packed with NH type silica gel. The purified product was further purified by silica gel chromatography (hexane:ethyl acetate = 4:1, followed by 3:1). The initially eluted substance was the target substance, of which 720 mg was obtained as a colorless oil. 1H-NMR (DMSO&amp;#1470;d6) δ(ppm): 1.628) 1.96&amp;#1470;H, m), 2.10-2.23 (4H, m) , 3.35-3.45 (2H, m), 7.20 (1H, d, J= 5.6Hz), 7.23 (1H, s), 7.40 (2H, d, J= 9.2Hz), 8.33 (2H, d, J= 9.2Hz), 8.49 (1H, d, J= 5.6Hz).

The second eluted substance was 2cyclobutanecarbonylamino (4-nitrophenoxy)pyridine, of which 560 mg was obtained as white crystals. 1H-NMR(DMSO-d6) δ(ppm): 1.66-1.80 (1H, m), 1.80-1.94 (1H, m), 1.98-2.20 (4H, m), 3.26-3.36 (1H, m), 6.83 (1H, d, J= 5.6Hz), 7.38 (2H, d, J= 9.2Hz), 7.81 (1H, s),

FP01 00

8.27 (1H, d, J= 5.6Hz), 8.31 (2H, d, J= 9.2Hz).

Production Example 207-2

4-(4-Aminophenoxy) cyclobutanecarbonylaminopyridine Nl-Cyclobutanecarbonyl-Nl-[4-(4-nitrophenoxy)-2pyridyl] cyclobutanecarboxamide (720 mg), iron powder (1.4 g), ammonium chloride (2.4 g), dimethylformamide (52 ml), ethanol (2 ml) and water (2 ml) were stirred at 100°C for 15 minutes. The mixture was filtered with celite, and then water and ethyl acetate were added for extraction. The organic layer was washed 5 times with aqueous ammonium chloride solution and then dried over magnesium sulfate. The drying agent was filtered off, the solvent was distilled off under reduced pressure, ethyl acetate and hexane were added to the residue and the precipitated solid was filtered out to obtain 130 mg of a solid.

1H-NMR (DMSO-d6) δ(ppm): 1.68-1.80 (1H, m), 1.80-1.93 (1H, m), 1.96-2.19 (4H, m), 3.23-3.34 (1H, m), 5.10 (2H, brs), 6,55 (1H, d, J= 5.6Hz), 6.59 (2H, d, J= 8.4Hz), 6.79 (2H, d, J= 8.4Hz), 7.61 (1H, s) , 8.07 (1H, d, J= 5.6Hz), 10.22 (1H, brs).

Example

Nl-[4-{[(Cyclopropylamino)carbonyl]amino}-3chlorophenoxy] pyridyl] cyclopropanecarboxamide 2-Amino (4-amino chlorophenoxy)pyridine (2.6 g), cyclopropanecarbonyl chloride (2.3 g),

FP01 00 triethylamine (4.6 ml) and tetrahydrofuran (30 ml) were stirred at room temperature for 10 minutes. Water was added, extraction was performed with ethyl acetate, and the mixture was dried over magnesium sulfate. The drying agent was filtered off and the solvent was distilled off under reduced pressure to obtain 3.69 g of a brown oil. A 900 mg portion of the obtained oil was stirred together with 0.37 ml Of triethylamine and 10 ml of tetrahydrofuran, while 0.3 ml of phenyl chloroformate was added dropwise at room temperature. After stirring for 15 minutes, 1 ml of cyclopropylamine was added and stirring was continued for 22 hours. Silica gel was added to the reaction solution, the solvent was distilled off under reduced pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (hexane:ethyl acetate = 1:1, followed by ethyl acetate) to obtain 38 mg of the target substance as a brown solid.

1H-NMR (DMSO-d6) δ(ppm): 0.402) 0.52&amp;#1470;H, m), 0.60-0.70 (2H, m), 0.70-0.85 (4H, m), 1.91-2.00 (1H, m), 2.502.70 (1H, m), 6.67 (1H, dd, J= 5.6Hz, 2.8Hz), 7.11 (1H, dd, J= 8.4Hz, 2.8Hz), 7.17 (1H, d, J= 2.8Hz), 7.33 (1H, d, J= 2.8Hz), 7.61 (1H, d, J= 2.8Hz), 7.94 (1H, s), 8.18 (1H, d, J= 5.6Hz), 8.20 (1H, d, J= 8.4Hz), 10.84

FP01 00 (IH, s) .

The intermediates were obtained in the following manner. Production Example 208-1 2-Amino (4-amino-3&amp;#1470;chlorophenoxy)pyridine

The publicly known compound 2-amino-4chloropyridine (5.0 g), 4-amino chlorophenol (11 g), sodium hydride (60% in oil) (3.1 g) and dimethylsulfoxide (80 ml) were stirred at 160°C for 9.5 hours. Water was added, extraction was performed with ethyl acetate, and the extract solution was washed 5 times with water. The extract solution was then passed through a glass filter coated with silica gel. The silica gel was washed with ethyl acetate, the ethyl acetate layers were combined, and the solvent was distilled off under reduced pressure to obtain 5.1 g of a dark violet solid. 1H-NMR(DMSO-d6) δ(ppm): 5.32 (2H, s), 5.72 (IH, s), 5.86 (2H, bs), 6.07 (IH, d, J- 6.4Hz), 6.83 (2H, s), 7.01 (IH, s), 7.72 (IH, d, J= 6.4Hz).

Example

Nl-[5-Bromo (4-{[(cyclopropylamino)carbonyl]amino}-3chlorophenoxy) pyridyl] cyclopropanecarboxamide

A mixture of 67 mg of Nl-[5-bromo (4-amino-3chlorophenoxy) pyridyl]-Nl-cyclopropylcarbonyl)-1cyclopropanecarboxamide, 52 mg of pyridine and 5 ml of ____________________________________________________________________________________________J

FP01 00 dimethylformamide was cooled to 0°C, and 54 mg of phenyl chloroformate was added. After 40 minutes, 80 mg of cyclopropanecarbonyl chloride was added and the mixture was stirred at 60°C for 20 minutes. The mixture was returned to room temperature, water was added, and extraction was performed with ethyl acetate. Silica gel was added to the extract solution and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (hexane: ethyl acetate = 1:1). Methanol was added to the residue to obtain 11 mg of the target substance as a white solid.

1H-NMR (DMSO-d6) δ(ppm): 0.40 (2H, brs), 0.55 (2H, m), 0.72 (4H, brs), 1.90 (1H, brs), 2.55 (1H, brs), 7.11 (1H, d, J= 9.2Hz), 7.19 (1H, s), 7.38 (1H, s) , 7.56 (1H, s), 7.96 (1H, s), 8.22 (1H, d, J= 9.2Hz), 8.42 (1H, s), 10.94 (1H, s).

The intermediates were obtained in the following manner. Production Example 209-1 2-Amino bromo4)-4&amp;#1470;-amino chlorophenoxy)pyridine 2-Amino (4-amino chlorophenoxy)pyridine (1.0 g), N-bromosuccinimide (0.78 g) and isopropanol (10 ml) were stirred for 15 minutes under reflux. The mixture was returned to room temperature, water was added, and

FP01 00 extraction was performed with ethyl acetate. Silica gel was added to the extract solution and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (hexane:ethyl acetate - 2:1, followed by 1:1, ethyl acetate) to obtain 400 mg of the target substance as a brown oil.

1H-NMR (DMSO-d6) δ(ppm): 5.39 (2H, brs), 5.68 (1H, s), 6.06 (2H, brs), 6.85 (1H, s) , 6.86 (1H, d, J= 2.4Hz), 7.09 (1H, d, J= 2.4Hz), 7.90 (1H, s).

Production Example 209-2

Nl-[5-Bromo (4-amino chlorophenoxy) pyridyl]-Nlcyclopropylcarbonyl) cyclopropanecarboxamide

Cyclopropanecarbonyl chloride (260 mg) was added to a solution of 400 mg of 2-amino bromo (4-amino3-chlorophenoxy)pyridine, 0.53 ml of triethylamine and 5 ml of tetrahydrofuran while stirring at room temperature. After 40 minutes, silica gel was added to the reaction solution and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (hexane:ethyl acetate = 2:1, followed by 1:1, ethyl acetate) to obtain 67 mg of the target substance. 1H-NMR (DMSO-d6) δ(ppm) : 0.66-1.00 (8H, m) , 1.85-1.96

FP01 00 (2H, m), 5.45 (2H, brs), 6.77 (1H, s), 6.84 (1H, d, J=

8.8Hz), 6.92 (1H, dd, J= 8.8Hz, 2.8Hz), 7.17 (1H, d, J=

2.8Hz), 8.66 (1H, s).

Example

NI-[4-(3,5-Dichloro-4{[(cyclopropylamino)carbonyl]amino}phenoxy) pyridyl]1-cyclopropanecarboxamide

Phenylchloroformate (110 mg) was added to a solution of 96 mg of NI-[4-(4-amino-3,5dichlorophenoxy) pyridyl]-Nl-cyclopropylcarbonyl)-1cyclopropanecarboxamide, 0.076 ml of pyridine and 5 ml of dimethylformamide while stirring. After continuing stirring for 30 minutes, 0.5 ml of cyclopropylamine was added and the mixture was heated at 70°C for 10 minutes. The mixture was returned to room temperature, water was added, and extraction was performed with ethyl acetate. Silica gel was added to the extract solution and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (ethyl acetate). Methanol was added to the residue for solidification to obtain 4.8 mg of the target substance as a light brown solid.

1H-NMR(DMSO-d6) δ(ppm) : 0.42 (2H, s), 0.57-0.66 (2H, m) , 0.70-0.83 (4H, m), 1.92-2.01 (1H, m) , 2.43-2.53 (1H, m), 6.62 (1H, s), 6.71 (1H, d, J= 5.6Hz), 7.39 (2H, s),

FP01 00

7.69 (1H, s), 7.89 (1H, s), 8.22 (1H, d, J= 5.6Hz),'

10.89 (1H, s).

The intermediates were obtained in the following manner.

Production Example 210-1

2-Amino (4-amino-3,5-dichlorophenoxy)pyridine

2-Amino (4-amino chlorophenoxy)pyridine (700 mg), N-chlorosuccinimide (0.44 g) and isopropanol (10 ml) were stirred at 80°C for 1 hour. The mixture was returned to room temperature, water was added, and extraction was performed with ethyl acetate. Silica gel was added to the extract solution and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (ethyl acetate), to obtain 120 mg of a brown oil.

1H-NMR(DMSO-d6) δ(ppm): 5.47 (2H, brs), 5.73 (1H, d, J= 2.4Hz), 5.90 (2H, brs), 6.09 (1H, dd, J= 5.6Hz, 2.4Hz), 7.13 (2H, s), 7.75 (1H, d, J= 5.6Hz).

Production Example 210-2

Nl-[4-(4-Amino-3,5-dichlorophenoxy) pyridyl]-Nlcyclopropylcarbonyl) cyclopropanecarboxamide

Cyclopropanecarbonyl chloride (93 mg) was added to a solution of 120 mg of 2-amino (4-amino-3,5dichlorophenoxy)pyridine, 0.19 ml of triethylamine and

FP01 00 ml of tetrahydrofuran while stirring at room temperature. After 20 minutes, silica gel was added to the reaction solution and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (ethyl acetate) to obtain 120 mg of a brown oil.

1H-NMR (DMSO&amp;#1470;d6) δ(ppm): 0.82-0.98 (8H, m), 1.861.96&amp;#1470; (2H, m), 5.55 (2H, brs), 6.95 (1H, dd, J= 5.6Hz, 2.4Hz), 7.03 (1H, d, J= 2.4Hz), 7.24 (2H, s), 8.38 (1H, d, J= 5.6Hz) .

Example 211 *

N1-Cyclopropyl ({2-[di(cyclopropylcarbonyl)amino]-4pyridyl}oxy)-lH-l-indolecarboxamide

Cyclopropanecarbonyl chloride (51 mg) was added to a solution of 100 mg of Nl-cyclopropyl [(2-amino-4pyridyl)oxy]-ΙΗ indolecarboxamide and 49 mg of triethylamine in tetrahydrofuran at 0°C. After 20 minutes of stirring, silica gel was added to the reaction solution, the solvent was distilled off under reduced pressure, and the reaction product was adsorbed onto the silica gel. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (hexane:ethyl acetate = 1:1, followed by ethyl acetate), after which water was added to the residue to obtain 19 mg of the

FP01 00 target substance as a white solid.

1H-NMR (DMSO-d6) δ(ppm): 0.57-0.63 (2H, m), 0.68-0.75 (2H, m) , 0.83-0.96 (6H, m), 1.86-1.94 (2H, m), 2.732.80 (1H, m), 6.66 (1H, d, J= 3.6Hz), 6.91 (1H, d, J= 5.6Hz), 6.98 (1H, d, J= 2.4Hz), 7.08 (1H, dd, J= 9.2Hz, 2.4Hz), 7.41 (1H, d, J= 2.4Hz), 7.87 (1H, d, J= 3.6Hz), 8.26-8.32 (2H, m), 8.38 (1H, d, J= 5.6Hz).

The intermediates were obtained in the following manner. Production Example 211-1 5-[(2-Amino pyridyl)oxy]-lH-indole 2-Amino chloropyridine (2.0 g), 5-hydroxyindole (4.1 g), sodium hydride (60% in oil, 1.25 g) and dimethylsulfoxide (20 ml) were stirred at 160°C for 9.5 hours. Water was added, extraction was performed with ethyl acetate, and purification was performed by silica gel column chromatography (hexane: ethyl acetate = 1:1, ethyl acetate). The solvent was distilled off under reduced pressure, a small amount of ethyl acetate was added to the residue and the solid was filtered out to obtain 490 mg of a light brown solid.

1H-NMR(DMSO-d6) δ(ppm): 5.72 (1H, d, J= 2.0Hz), 5.78 (2H, brs), 6.10 (1H, d, J= 5.6Hz), 6.41 (1H, d, J= 2.0Hz), 6.82 (1H, d, J= 8.4Hz), 7.25 (1H, s), 7.367.7.44 (2H, m), 7.73 (1H, d, J= 5.6Hz), 11.15 (1H, s). Production Example 211-2

FP01 00

Nl-Cyclopropyl [(2-amino pyridyl)oxy]-1H-1indolecarboxamide

After adding 28 mg of sodium hydride (60% in oil) to a solution of 150 mg of 5-[(2-amino pyridyl)oxy]IH-indole in dimethylformamide at room temperature and stirring for 5 minutes, the mixture was cooled to 0°C, 124 mg of phenyl N-cyclopropylcarbamate was added and the mixture was further stirred for 30 minutes. Water was added, extraction was performed with ethyl acetate, the organic layer was washed 3 times with water and once with aqueous ammonium chloride solution, and then silica gel was added and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel and purification was performed by column chromatography (hexane:ethyl acetate = 1:1, followed by ethyl acetate), to obtain 2.4 g of a colorless powder.

1H-NMR (DMSO-d6) δ(ppm) : 0.57-0.64 (2H, m) , 0.68-0.76 (2H, m), 2.72-2.79 (1H, m), 5.74 (1H, d, J= 2.4Hz), 5.83 (2H, brs), 6.12 (1H, dd, J= 5.6Hz, 2.4Hz), 6.64 (1H, d, J= 3.6Hz), 7.01 (1H, dd, J= 9.2Hz, 2.4Hz), 7.32 (1H, d, J= 2.4Hz), 7.75 (1H, d, J= 5.6Hz), 7.84 (1H, d, J= 3.6Hz), 8.24 (1H, s), 8.25 (1H, d, J= 9.2Hz).

Example Nl-Cyclopropyl ({2-[(cyclopropylcarbonyl.)amino]-4pyridyl}oxy)-ΙΗ indolecarboxamide

FP01 00

Nl-Cyclopropyl ({2[di(cyclopropylcarbonyl)amino] pyridyl}oxy)-1H-1indolecarboxamide (190 mg), ammonium chloride (660 mg), dimethylformamide (5 ml), water (5 ml) and ethanol (5 ml) were stirred at 100°C for 1 hour. Water and ethyl acetate were added for extraction, and the extract was washed 6 times with water. After drying over magnesium sulfate, the drying agent was filtered off and the solvent was distilled off under reduced pressure. Ethyl acetate was added to the residue and the precipitated solid was filtered out to obtain 66 mg of a white powder.

1H-NMR (DMSO-d6) δ (ppm) : 0.57-0.64 (2H, m), 0.66-0.78 (6H, m), 1.88-1.98 (1H, m), 2.72-2.80 (1H, m), 6.636.69 (2H, m), 7.04 (1H, d, J= 8.8Hz), 7.36 (1H, s),

7.56 (1H, s), 7.87 (1H, d, J= 3.6Hz), 8.14 (1H, d, J=

5.6Hz), 8.26 (1H, d, J- 8.8Hz), 8.28 (1H, s), 10.55 (1H, s) .

Example

Nl-Cyclopropyl {[2-(2,5-dioxotetrahydro-lH-lpyrrolyl) (Example

Nl-Cyclopropyl {[2-(diacetylamino) pyridyl]oxy}-1H1-indolecarboxamide (Example 213-B)

Nl-Cyclopropyl {[2-(acetylamino) pyridyl]oxy}-1H-1indolecarboxamide (Example 213-C)

FP01 00

Nl-Cyclopropyl [(2-amino pyridyl)oxy]-1H-1indolecarboxamide (830 mg), succinic anhydride (270 mg)and toluene (30 ml) were refluxed together for 30 minutes. After adding 50 ml of acetic anhydride and 82 mg of sodium acetate to the reaction solution, the mixture was stirred at 80°C for 15 minutes. The solvent was distilled off under reduced pressure, and the residue was purified by silica gel chromatography (ethyl acetate). The second eluted substance was Nlcyclopropyl {[2-(2,5-dioxotetrahydro-lH-l-pyrrolyl)4-pyridyl]oxy)-IH-l-indolecarboxamide, of which 440 mg was obtained as a colorless powder. (Example 213-A) 1H-NMR (DMSO-d6) δ(ppm): 0.57-0.63 (2H, m), 0.70-0.75 (2H, m) , 2.70-2.80 (1H, m) , 2.71 (4H, s), 6.66 (1H, d, J= 3.6Hz), 6.76 (1H, d, J- 2.4Hz), 7.03 (1H, dd, J= 5.6Hz, 2.4Hz), 7.10 (1H, dd, J= 9.2Hz, 2.4Hz), 7.43 (1H, d, J= 2.4Hz), 7.87 (1H, d, J= 3.6Hz), 8.29 (1H, s), 8.30 (1H, d, J= 9.2Hz), 8.42 (1H, d, J= 5.6Hz).

The first eluted substance was a mixture of Nlcyclopropyl {[2-(diacetylamino) pyridyl]oxy]-1H-1indolecarboxamide and Nl-cyclopropyl {[2(acetylamino) pyridyl]oxy]-lH indolecarboxamide. The mixture was purified by, silica gel chromatography (chloroform:methanol = 50:1). The first eluted substance was Nl-cyclopropyl {[2-(diacetylamino)-4401

FP01 00 pyridyl]oxy)-ΙΗ indolecarboxamide, of which 45 mg was obtained as a white powder.

(Example 213-B) 1H-NMR (DMSO&amp;#1470;d6) δ (ppm): 0.57-0.63 (2H, m) , 0.70-0.75

<td> (2H, m), 2.13 (6H, s), 2</td><td> .74-2.80 (1H, m)</td><td> , 6.66 (</td><td> 1H, d,</td>

<td> J= 3.6Hz), 6.96 (1H, dd,</td><td> J= 5.6Hz, 2.4Hz</td><td> ), 6.99</td><td> (1H, d,</td>

<td> J= 2.4Hz), 7.09 (1H, dd,</td><td> J= 9.2Hz, 2.4Hz</td><td> ), 7.43</td><td> (1H, d,</td>

<td> J= 2.4Hz), 7.87 (1H, d,</td><td> J= 3.6Hz), 8.28</td><td> (1H, s),</td><td> 8.30</td>

<td> (1H, d, J= 9.2Hz), 8.38</td><td> (1H, d, J= 5.6Hz</td><td></td><td></td>

The second eluted substance was Nl-cyclopropyl-5{[2-(acetylamino) pyridyl]oxy}-ΙΗ indolecarboxamide, which was solidified from ethyl acetate-hexane to obtain 28 mg.

(Example 213-C) 1H-NMR(DMSO-d6) δ(ppm): 0.57-0.63 (2H, m), 0.700.75&amp;#1470; (2H, m) , 2.00 (3H, s), 2.72-2.80 (1H, m), 6.62 (1H,d,

J= 5.6Hz, 2.4Hz), 6.65 (1H, d, J= 3.6Hz), 7.04 (1H,dd,

J= 9.2Hz, 2.4Hz), 7.36 (1H, d, J= 2.4Hz), 7.60 (1H,s),

7.87 (1H, d, J= 3.6Hz), 8.13 (1H, d, J= 9.2H), 8.258.30 (2H, m), 10.47 (1H, s) .

Example

N1-Cyclopropyl {[2-({[2chloroethylamino]carbonyl}amino) pyridyl]oxy}-1H-1indolecarboxamide

Nl-cyclopropyl [(2-amino pyridyl)oxy]-1H-1indolecarboxamide (400 mg), 2-chloroethyl isocyanate

FP01 00 (150 mg) and tetrahydrofuran (5 ml) were stirred at 80°C for 1,5 hours. The mixture was returned to room temperature, silica gel was added, and the solvent was distilled off under reduced pressure. The silica gel was charged into a dry column packed with silica gel, and purification was performed by column chromatography (hexane:ethyl acetate = 1:1, followed by ethyl acetate) to obtain 280 mg of a colorless powder.

1H-NMR (DMSO-d6) δ(ppm): 0.57-0.63 (2H, m), 0.70-0.75 (2H, m), 2.73-2.80 (1H, m), 3.42 (2H, q, J= 6.0Hz), 3.61 (2H, t, J= 6.0Hz), 6.52 (1H, dd, J= 5.6Hz, 2.4Hz), 6.65 (1H, d, J= 3.6Hz), 6.85 (1H, d, J= 2.4Hz), 7.04 (1H, dd, J= 8.8Hz, 2.4Hz), 7.35 (1H, d, J= 2.4Hz), 7.86 (1H, d, J= 3.6Hz), 8.04 (1H, d, J= 5.6Hz), 8.27 (1H, s) , 8.28 (1H, d, J= 8.8Hz), 8.34 (1H, brs), 9.19 (1H, s). Example

Nl-(2-Fluoroethyl) ({2-[(cyclopropylcarbonyl)amino]4-pyridyl}oxy)-IH-l-indolecarboxyamide

Cyclopropanecarbonyl chloride (330 mg) was added to a solution of 400 mg of Nl-(2-fluoroethyl) [(2amino pyridyl)oxy]-IH-l-indolecarboxamide and 0.53 ml of triethylamine in tetrahydrofuran at room temperature. After stirring for 15 minutes, water and ethyl acetate were added for extraction. The extract was dried over magnesium sulfate and then passed through a glass filter coated with silica gel. The solvent was

FP01 00 distilled off under reduced pressure to obtain 490 mg of an oil. After adding 1.5 g of ammonium chloride, 10 ml of dimethylformamide, 10 ml of water and 10 ml of ethanol to the residue, the mixture was stirred at 110°C for 1.5 hours. After returning it to room temperature, water was added and extraction was performed with ethyl acetate. Silica gel was added to the extract solution, and the solvent was distilled off under reduced pressure for adsorption onto the silica gel. The silica gel was charged into a dry column packed with silica gel and purification was performed by column chromatography (ethyl acetate). Ethyl acetate and hexane were added to the residue for solidification to obtain 180 mg of the target substance as a white solid.

<td>¹H-NMR (DMSO-d₆)</td><td> δ (ppm) :</td><td> 0.64-0.80</td><td> (4H,</td><td> m), 1.88-1.97</td>

<td> (1H, m), 3.50-3</td><td> .65 (2H,</td><td> m), 4.52</td><td> (1H,</td><td> t, J= 4.8Hz),</td>

<td> 4.64 (1H, t, J=</td><td> 4.8Hz),</td><td> 6.65 (1H,</td><td> dd,</td><td> J= 5.6Hz, 2.4Hz),</td>

<td> 6.69 (1H, d, J=</td><td> 3.6Hz),</td><td> 7.05 (1H,</td><td> dd,</td><td> J= 8.8Hz, 2.4Hz),</td>

<td> 7.38 (1H, d, J=</td><td> 2.4Hz),</td><td> 7.57 (1H,</td><td> d,</td><td> J= 2.4Hz), 7.95</td>

<td colspan="2"> (1H, d, J= 3.6Hz), 8.14</td><td> (1H, d, J^:</td><td> = 5.</td><td> 6Hz), 8.27 (1H, d,</td>

<td> J= 8.8Hz), 8.47</td><td> (1H, t,</td><td> J= 5.6Hz)</td><td> , 10</td><td> .77 (1H, s).</td>

The intermediates were obtained in the following manner.

Production Example 215-1

Nl-(2-Fluoroethyl) [(2-amino pyridyl)oxy]-1H-1404

FP01 00 indolecarboxamide

Sodium hydride (60% in oil) (360 mg) was added to a solution of 2.0 g of 5-[(2-amino pyridyl)oxy]-lHf indole in 30 ml of dimethylformamide at room temperature. After stirring for 5 minutes, the mixture was placed in an ice bath and 1.8 g of phenyl N-(2- : fluoroethyl)carbamate was added while cooling. The mixture was returned to room temperature and stirred‘ for 30 minutes, after which water was added and extraction was performed with ethyl acetate. The extract was passed through a glass filter coated with silica gel. The ethyl acetate layer was washed once with sodium bicarnobate water and dried over magnesium sulfate. The drying agent was filtered off to obtain 1.93 g of a faint brown powder. 1H-NMR(DMSO-d5) δ(ppm): 3.52-3.64 (2H, m), 4.52 (1H, t, J= 4.8Hz), 4.64 (1H, t, J= 4.8Hz), 5.75 (1H, d, J= 2.4Hz), 5.82 (2H, brs), 6.12 (1H, dd, J=5.6Hz, 2.4Hz),

6.68 (1H, d, J= 3.6Hz), 7.02 (1H, dd, J= 8.8Hz, 2.4Hz),

7.33 (1H, d, J= 2.4Hz), 7.76 (1H, d, J= 5.6Hz), 7.92 (1H, d, J= 3.6Hz), 8.26 (1H, d, J= 8.8Hz), 8.44 (lH,i t,

J= 5.2Hz) . Example 216 N1-Cyclopropyl (42)-2]}&amp;#1470;-oxotetrahydro-lH-l- ( pyrrolyl) pyridyl]oxy}-lH indolecarboxamide

Sodium hydride (60% in oil) (19 mg) was added to a

FP01 00 solution of 130 mg of 5-(4-{ [2-(2-oxotetrahydro-lH-lpyrrolyl) pyridyl]oxy}-lH-l-indole in dimethylformamide at room temperature, and then 82 mg of phenyl N-cyclopropylcarbamate was added. After stirring for 10 minutes, water was added and extraction was performed with ethyl acetate. Silica gel was added to the extract solution and the solvent was distilled off for adsorption onto the silica gel. The silica gel was charged into a dry column packed with silica gel and purification was performed by column chromatography (hexane:ethyl acetate = 1:1, followed by ethyl acetate). Ethyl acetate and hexane were added to the residue for solidification to obtain 25 mg of the target substance as a white solid.

1H-NMR (DMSO-d6) δ(ppm): 0.58-0.63 (2H, m), 0.68-0.75 (2H, m), 1.97 (2H, tt, J= 6.4Hz, 6.4Hz), 2.47 (2H, t, J= 6.4Hz), 2.73-2.80 (1H, m), 3.94 (2H, t, J= 6.4Hz),

<td> 6.65</td><td> (1H, d, J= 3.6Hz),</td><td> 6.71</td><td> (1H,</td><td> dd, J= 5.6Hz, 2.4Hz),</td>

<td> 7.04</td><td> (1H, dd, J= 8.8Hz,</td><td> 2.4Hz</td><td> י ,(</td><td> .36 (1H, d, J= 2.4Hz),</td>

<td> 7.81</td><td> (1H, d, J= 2.4Hz),</td><td> 7.86</td><td> (1H,</td><td> d, J= 3.6Hz), 8.22</td>

<td> (1H,</td><td> d, J= 5.6Hz), 8.27</td><td> (1H,</td><td> brs)</td><td> , 8.28 (1H, d, J=</td>

8.8Hz).

The intermediates were obtained in the following manner.

Production Example 2161&amp;#1470;

5- (4-{[2- (2-Oxotetrahydro-lH-l-pyrrolyl)-4

FP01 00 pyridyl]oxy}-1H indole 4-Bromobutyryl chloride (0.8 ml) was added to a solution of 1.0 g of Nl-cyclopropyl [(2-amino-4pyridyl)oxy]-IH-l-indolecarboxamide, 1.1 ml of triethylamine and 20 ml of tetrahydrofuran at room temperature. After stirring for 20 minutes, water was added and extraction was performed with ethyl acetate. The extract was passed through a glass filter coated with silica gel. After adding 950 mg of 4hydroxypiperidine, 1.7 g of potassium carbonate and 10 ml of dimethylformamide to the obtained oil, the mixture was stirred at 70°C for 20 minutes. Water was added, extraction was performed with ethyl acetate, silica gel was added to the extract solution, and the solvent was distilled off under reduced pressure for adsorption onto the silica gel. The silica gel was charged into a dry column packed with silica gel and purification was performed by column chromatography (hexane:ethyl acetate = 1:1, followed by ethyl acetate). The first eluted substance was the target substance, of which 130 mg was obtained as a white solid.

1H-NMR(DMSO&amp;#1470;d6) δ(ppm): 1.97 (2H, tt, J= 6.4Hz, 6.4Hz), 2.46 (2H, t, J= 6.4Hz), 3.93 (2H, t, J= 6.4Hz), 6.42 (IH, s), 6.66 (IH, d, 5.6Hz), 6.85 (IH, d, J= 8.8Hz), 7.29 (IH, s), 7.42 (IH, s), 7.44 (IH, d, J= 8.8Hz), 7.80 (IH, s), 8.18 (IH, d, J= 5.6Hz), 11.05 (IH, s).

FP01 00

The second eluted substance was 5-[(2-([4-(4hydroxypiperidino)butanoyl]amino} pyridyl)oxy]indole, of which 520 mg was obtained as a light brown oil. 1H-NMR(DMSO&amp;#1470;d6) δ(ppm) : 1.25-1.35 (2H, m) , 1.55-1.67 (4H, m), 1.85-1.95 (2H, m), 2.17 (2H, t, J= 6.8Hz), 2.28 (2H, t, J= 6.8Hz), 2.57-2.67 (2H, m) , 3.15 (1, d, J= 3.6Hz), 3.30-3.42 (1H, m), 4.48 (1H, d, J= 3.6Hz), 6.42 (1H, s), 6.57 (1H, dd, J= 5.6Hz, 2.4Hz), 6.85 (1H, dd, J= 8.8Hz, 2.4Hz), 7.29 (1H, d, J= 2.4Hz), 7.40-7.43 (2H, m), 7.60 (1H, d, J= 2.4Hz), 8.09 (1H, d, J= 5.6Hz), 10.37 (1H, s), 11.23 (1H, s). Example

1- (46] &amp;#1470;-Cyano (3-diethylaminopropoxy)-4quinolyloxy]2-fluorophenyl) (4-fluorophenyl)urea

After dissolving 480 mg of 6-cyano {4-[4fluoroanilinocarbonyl]amino fluorophenoxy}quinolin-701 sodium salt in 5 ml of dimethylformamide, 350 mg of potassium carbonate and 204 mg of 3chloropropyldiethylamine were added and the mixture was heated and stirred at 65°C for 7 hours. After standing to cool, water was added and extraction was performed with ethyl acetate and tetrahydrofuran, after which the solvent was distilled off under reduced pressure and the residue was purified by NH silica gel column chromatography (ethyl acetate-methanol system) to obtain 135 mg of the title compound.

FP01 00 1H-NMR Spectrum (DMSO-d6) δ(ppm): 0.96(6H, t,J=7.0Hz) 1.93(2H,quint, J=7.0Hz) ,2.45-2.53(4H,m),2.61 (2H, t, J=7.0Hz), 4.32(2H, t, J=7.0Hz), 6.62(1H, d, J=5.3Hz), 7.10-7.19 (3H, m), 7.41(1H, dd, J=12.3Hz, J'=2.8 Hz), 7.46-7.52 (2H, m), 7.60 (1H, s) , 8.25(1H, t, J=9.0Hz),8.68(1H, d, J=2.0Hz), 8.76-8.78 (2H, m),9.16 (1H, s)

The intermediates were synthesized in the following manner. Production Example 217-1 1-(4-[7-Benzyloxy cyano quinolyloxy]-2fluorophenyl) (4-fluorophenyl)urea

After adding 210 mg of toluene and 20 ml of acetonitrile to 6.95 g of the 7-behzyloxy cyano (3fluoro aminophenoxy)quinoline obtained in Production Example 8, the mixture was heated to reflux. Next, 2.67 ml of 4-fluorophenyl isocyanate was added and the mixture was further heated to reflux for 1 hour. After cooling, the precipitated solid was filtered out and dried under reduced pressure to obtain 7.45 g of the title compound.

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 5.4 9 (2H, s) , 6.61 (1H, d, J=5.4Hz), 7.05-7.57(11H, m), 7.54(1H, s),8.24 (1H, t, 9.5Hz), 8.63 (1H, s), 8.72(1H, d, J=5.4Hz), 8.77 (1H, s), 9.10 (1H, s) Production Example 217-2

FP01 00

6-Cyano~4- (4-[4-fluoroanilinocarbonyl]amino-3fluorophenoxy)quinolin ol sodium salt

A mixture of 1,7 g of 1-(4-[7-benzyloxy-6cyanoquinolin yloxy] fluorophenyl) (4fluorophenyl)urea, 17 ml of trifluoroacetic acid and 1.7 ml of thioanisole was placed in an oil bath and heated and stirred for 20 hours at 70°C. After completion of the reaction, the reaction solution was concentrated, a saturated aqueous sodium bicarbonate solution and methanol were added, the mixture was stirred for 30 minutes, and the precipitated solid was filtered out. The obtained solid was dried under reduced pressure to obtain 1.15 g of the title compound. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 6.62 (1H, d, J=5.3Hz), 7.18-7.68(7H, m), 8.24 (1H,t,J=8.5 Hz), 8.708.86 (3H, m), 9.20 (1H, s) Example

1- (4-[6-Cyano (3-morpholine propoxyl) -4quinolyloxy] fluorophenyl) (4-fluorophenyl) urea

The title compound (205 mg) was obtained using 450 mg of 6-cyano (4-[4-fluoroanilinocarbonyl]amino-3fluorophenoxy)quinolin ol sodium salt, 5 ml of dimethylformamide, 328 mg of potassium carbonate and 194 mg of 4-(3-chloropropyl)morpholine, in the same manner as Example 217. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 2.01(2H,quint,

FP01 00

J-6.9Hz) ,2.36-2.44 (4H,m), 2.48-2.54 (2H,covered by DMSO peak),3.58 (4H, t, J=4.0Hz), 4.35(2H, t, J=6.9Hz), 6.64(1H, d, J=5.3Hz), 7.10-7.19 (3H, m), 7.41(1H, dd, J=2.9, 12.3Hz), 7.44-7.52 (2H, m), 7.63 (1H, s) , 8.25(1H, t, J=8.9Hz),8.64(1H, d, J=2.0Hz), 8.74-8.78(2H, m),9.20(lH, s) Example

1- (4-[6-Cyano (3-diethylaminopropoxy) quinolyloxy]-

2- fluorophenyl) phenylurea

After dissolving 179 mg of 6-cyano (4-[4anilinocarbonylamino] phenoxy)quinolin ol sodium salt in 2 ml of dimethylformamide, 135 mg of potassium carbonate and 79 mg of 3-chloropropyldiethylamine were added and the mixture was heated and stirred overnight at 65-75°C. After standing to cool, water was added, extraction was performed with ethyl acetate and tetrahydrofuran and the extract was dried over sodium sulfate, after which the solvent was distilled off under reduced pressure and the residue was purified by NH silica gel column chromatography (ethyl acetatemethanol system) to obtain 60 mg of the title compound. 1H-NMR Spectrum (DMSO-d6) δ(ppm): 0.94(6H,t,J=7.2Hz) 1.92(2H,quint, J=7.2Hz), 2.43-2.55(4H,covered by DMSO peak),2.60 (2H, t, J=7.2Hz), 4.42(2H, t, J=7.2Hz), 6.62(1H, d, J=5.0Hz), 6.98(1H,t,J=7.2 Hz), 7.12-7.18(1H, m), 7.29 (2H,t,J=7.2Hz), 7.4O(1H, dd, J=ll.9Hz,J'=2.8

FP01 00

Hz), 7.46(2H,d,J=7.2 Hz), 7.59(1H, s), 8.26(1H, t, J=9.0Hz), 8.67(1H, s), 8.72-8.78(2H, m), 9.16 (1H, s) The intermediates were synthesized in the following manner. Production Example 219-1 1- (4-[7-Benzyloxy cyano quinolyloxy]-2fluorophenyl) phenylurea

After adding 1.90 g of the 7-benzyloxy cyano-4(3-fluoro aminophenoxy)quinoline obtained in Production Example 8 to 60 ml of toluene and 30 ml of acetonitrile, the mixture was heated to reflux. Next, 0.76 ml of phenyl isocyanate was added and the mixture was further heated to reflux for 1 hour. After cooling, the precipitated solid was filtered out and dried under reduced pressure to obtain 1.65 g of the title compound. 1H-NMR Spectrum (DMSO-d6) δ(ppm) : 5.45 (2H, s), 6.62 (1H, d, J=5.4Hz), 6.95-7.57(12H, m), 7.71(1H, s),8.27 (1H, t, 9.2Hz), 8.66 (1H, s), 8.74(1H, d, J=5.4Hz), 8.78 (1H, s), 9.09(lH, s) Production Example 219-2 6-Cyano (4-[4-anilinocarbonylamino]-3fluorophenoxy)quinolin ol sodium salt

A mixture of 1.64 g of 1-(4-[7-benzyloxy cyano-

4-quinolyloxy] fluorophenyl) phenylurea, 16 ml of trifluoroacetic acid and 1.6 ml of thioanisole was placed in an oil bath and heated to reflux at 65-72°C

FP01 00 for 14 hours. After completion of the reaction, the reaction solution was concentrated, a saturated aqueous sodium bicarbonate solution and methanol were added, the mixture was stirred for 30 minutes, and the precipitated solid was filtered out. The obtained solid was dried under reduced pressure to obtain 1.35 g of the title compound.

1H-NMR Spectrum (DMSO-d6) δ(ppm) : 6.41 (1H, d, J=5.1Hz), 6.98(1H,t,J=7.1 Hz) , 7.11(1H,d,J=7.1Hz),7.207.40(4H, m), 7.45(2H, d, J=7.1Hz),8.24 (lH,t,J=8.0 Hz),8.55(lH, s),8.57(lH, d, J=5.1Hz), 8’.66(1H, s),9.10(lH, s), Example l-{4-[6-Cyano (3-morpholino propoxyl)-4quinolyloxy] fluorophenyl} phenylurea

The title compound (301 mg) was obtained using 505 mg of 6-cyano (4-[4-anilinocarbonylamino] phenoxy)quinolin ol sodium salt, 5 ml of dimethylformamide, 380 mg of potassium carbonate and 195 mg of 4-(3chloropropyl)morpholine, in the same manner as Example 217.

1H-NMR Spectrum (DMSO-d6) δ(ppm): 1.99(2H,quint, J=6.8Hz) ,2.33-2.52(4H,m), 2.48-2.54(2H,covered by DMSO peak),3.58 (4H, t, J=4.2Hz), 4.32(2H, t, J=6.8Hz), 6.62(1H, d, J=5.3Hz), 6.98(1H,t, J7.2&amp;#1470; Hz),7.12-7.48(6H, m), 7.6O(1H, s) , 8.26(1H, t, J=8.5Hz),8.64(1H, d,

FP01 00

J=1.5Hz ), 8.72-8.78(2H, m),9.06 (1H, s)

Example

N-[4-(6-Cyano [3-(dimethylamina) propoxy]-4quinolyloxy) phenyl]-Ν' -(4-fluorophenyl)urea

The title compound (20 mg) was obtained from 100 mg of 6-cyano (4-[(4fluoroanilino)carbonyl]aminophenoxy)quinolin ol sodium salt, by the same procedure as in Example 7. 1H-NMR Spectrum (DMSO-d5) δ(ppm): 1.97(2H,quint, J=7.1Hz) 2.18 (6H, s, ), 2.42 (2H, t, J=7.1Hz), 4.32(2H, t, J=7.1Hz), 6.54(1H, d, J=5.6Hz), 7.05-7.65(9H, m), 8.63(1H, d, J=5.6Hz), 8.76 (1H, s) 8.80 (1H, s). 8.88 (1H, s) Example

N-(5-(6,7-Dimethoxyquinolin yloxy)pyridin yl)-N'~ phenylurea

5-(6,7-Dimethoxyquinolin yloxy)pyridin ylamine (29.7 mg, 0.100 mmol) and phenyl isocyanate (13.1 mg, 0.110 mmol) were stirred in dimethylformamide (1 ml) at room temperature for 18 hours. The reaction solution was distributed between ethyl acetate and water, the organic layer was washed with water and saturated brine and dried over anhydrous magnesium sulfate, the drying agent was filtered off and the filtrate was distilled off under reduced pressure. The obtained crude product was subjected to silica gel column chromatography

FP01 00 (eluent - ethyl acetate:methanol = 20:1), and the fraction containing the target substance was concentrated, suspended in ethyl acetate and diluted with hexane, after which the crystals were filtered out, washed with hexane and then blow-dried to obtain the title compound (30.4 mg, 0.073 mmol, 73%) as colorless crystals .

1H-NMR Spectrum (DMSO-d6) δ (ppm) : 3.95 (3H, s) , 3.96 (3H, s), 6.53 (1H, d, J = 5.4 Hz), 7.00-7.06 (1H, m), 7,287.35 (2H, m), 7.41 (1H, s), 7.50-7.56 (3H, m), 7.767.82 (2H, m), 8.30-8.33 (1H, m), 8.49 (1H, d, J = 5.4 Hz), 9.56 (1H, s), 10.04 (1H, s) .

The intermediates were synthesized in the following manner. Production Example 222-1 2-Chloro iodopyridin ol

After dissolving 2-chloro hydroxypyridine (5.00 g, 38.6 mmol) and sodium iodide (5.79 g, 38.6 mmol) in dimethylformamide (70 ml), Chloramine T (10.9 g, 38.6 mmol) was added while cooling on ice, and then the mixture was stirred at room temperature for 1 hour. Upon adding 2N aqueous hydrochloric acid (19.3 ml, 38.6 mmol) after the reaction, the reaction solution was distributed between ethyl acetate and water, the organic layer was washed with water and saturated brine and dried over anhydrous magnesium sulfate, the drying