Human monoclonal antibody against a costimulatory signal transduction molecule ailim and pharmaceutical use thereof

HUMAN MONOCLONAL ANTIBODY AGAINST A COSTIMULATORY SIGNAL TRANSDUCTION MOLECULE AILIM AND PHARMACEUTICAL USE THEREOF 5

Technical. Field

The present invention relates to human antibodies which bind to AILIM (activation inducible lymphocyte immunomodulatory molecule, also referred to .as ICOS (inducible co-.stimulafr) ; human monoclonal' .10 antibodies which bind to AILIM or a portion thereof;. DNA encoding', .said human monoclonal antibody or a portion thereof,or a portion . of said DNA; cells, (including genetic recombinant cells) producing said human monoclonal antibody or a portion thereof; human monoclonal' ’ antibody or a ,portion thereof produced by said genetic. recombinant 15 cells, pharmaceutical composition comprising said human monoclonal antibody or a portion thereof; pharmaceutical composition comprising antibody to AILIM for treating disorders related to the delayed allergy;' method for identifying, quantitating or assaying substances that bind to AILIM or AILIM ligand; and kit used for said method

Background Art

A livingbody of mammals has immune response systems that excludes pathogenic microorganisms (viruses, bacteria, parasites, .etc.) or ...^fore19nbodies (both are called antigen״ in .the following) that have ^;25 invaded the living body. One of them is called natural immune response system, another acquired immune response system. The former is an exclusion mechanism comprising phagocytosis by phagocytes . (polymorphonuclear leukocytes, monocytes, macrophages, etc.) , attack by natural killer (NK) cells, and non-specific recognition such as 30 opsonization of antigen by complements. The latter, acquired immune response system, is an exclusion mechanism by lymphocytes (mainly, T cells and B cells) that acquired the specificity to the antigen (namely, activated lymphocytes). B cells that acquired antigen specificity attack the antigen existing outside of the cells through 35 production of antibodies specific to the antigen. T cells that acquired antigen specificity (namely, activated.! cells) are

WO 01/87981 PCT/JPO1/04035 <

' ' '2 / classified into helper T cells and cytotoxic T cells (cytotoxic lymphocyte, CTL) . The helper T cells regulate'a differentiation of. B cells and a'production of antibodies, and destroy the antigen cooperating with phagocytes. The latter, CTLs attack virus-infected 5 cells .and so on by themselves (Experimental Medicine: SUPPLEMENT, .Bio .Science Term Library, Immunity״, Yodosha, pp.14-17 (1995)).

This acquisition of antigen specificity by T cells (namely, activation of T cells) is initiated through recognition by T cells the antigen, presented by antigen-presenting cells (APC) such as 10 . macrophage,. B cells, or. dendritic cells. Antigen-presenting cells .process the antigens so incorporated and present these processed antigens through binding them to major histocompatibility complex (MHC) . T cells receive primary signal .for activation :of the . cells (oracquisition of specificity) by recognizing the processed antigens 15 presented by antigen-presenting cells, through a complex between T cell receptor (TcR) and CD3 antigen existing on the surface of the cell membrane (TcR/CD3 .complex) .

. However, the TcR/CD.3 complex-mediated primary signal alone cannot activate T cells sufficiently and leads to unresponsiveness 20 or clonal anergy, so that the cells can not react with any stimulation, received thereafter. The autocrine of interleukin 2. (IL-2) is necessary for T cells to be activated, to be differentiated into antigen . . specific T cell clones, and to be proliferated. In clonal anergy, T cells are inactivated due to.no production of IL-2 and such and 25 no cell division. Namely, the activation of.T cells accompanied by production of cytokines such as IL-2 requires the secondary signal׳ following.the first signal through TcR/CD3 complex. Thissecondary signal is called costimulatory signal.

T cells receive this secondary signal and transmit it into the 30 cells by interacting (cell adhesion) with molecules other than MHC on antigen-presenting, cells through molecules other than TcR/CD3 complex on־the-T cell surface. This secondary signal avoids cell anergy (clonal anergy) and activates the cells.

Although some part of the mechanism of the secondary signal 35 transmission between antigen-presenting .cells and lymphocytes such as T.cells, have not yet been elucidated in detail, studies so far

WO 01/87981 PCT/JP01/04035 ' . . . 3 .

have revealed, that.an important factor for the secondary signal, transmission is the,interaction of CD28 (also named Tp44, T44,or 9.3 antigen) , which is a cell surface molecule expressed mainly on . T cells and thymus cells, with CD80 (also named B7-1, B7, BB1, or

B7/BB1.) , which is a cell surface molecule expressed on antigen-presenting cells (macrophages, monocytes, .dendritic cells, etc.) and with CD86 (also.named B7-.2 or B70) , which is also a cell surface molecule on antigen-presenting cells (namely, cell adhesion through the binding between these molecules) . Moreover, it has been experimentally elucidated that the interaction of Cytolytic T lymphocyte associated antigen 4 (CTLA-4) , whose expression is thought to be enhanced depending on the secondary signal, with the CD80 (B7-1) and CD86 (B7-2) (namely, cell adhesion through the binding between these molecules) also plays an important role in the regulation of

15. T cell activation by the secondary signal. In other words, the regulation of T cell activation by the transmission of the׳ secondary signal involves at least the interaction between CD28 and CD80/CD86, ' the enhancement of. CTLA-4 expression, which is thought to depend on ' the interaction, and the interaction between CTLA-4 and CD80/CD86.

²θ ׳ CD28 is known to be a costimulator molecule transmitting the secondary signal (costimulatory signal) required for the activation of T cells and for the avoidance of anergy. The. secondary signal . transmitted by binding this molecule to .costimulator molecules , CD80 (B7-1) and CD86 (B7-2), on antigen-presenting cells (cell adhesion through the binding between .these molecules) ,' stabilizes mRNA of Thl-type׳cytokines and consequently promotes production by T cells of a large amount of Thl-type cytokines such as.IL-2, IFNy, and TNFct. The expression of CTLA-4 is induced by the primary signal transmitted through TcR/CD3, and the expression is also .enhanced by the secondary 30־ signal transmitted by the binding between CD28 and CD80. It is being revealed that CTLA-4 receives these signals to work to inhibit T cell function, which is contrary to the activation of T cells by the secondary signal transmitted by CD28.

Human CD28 and CTLA-4 are type I glycoproteins whose molecular weights are 44 kD and 41 to 43 kD, respectively. Both have an immunoglobulin-like domain, belong to the immunoglobulin superfamily,.

WO 01/87981 PCT/JP01/04035

.י ; . ' . ' ' - 4 : ' ׳ .י' and have both function, as a cell adhesion molecule and function as a signal transmission.molecule.

Human CD28 forms a homodimer with a disulfide bond while CTLA-4 exists as a monomer. Both CD28 and CTLA— 4 genes are located at 2q33 on human chromosome and 1C on mouse chromosome, and are composed of four (4) exons. Human CD28 and CTLA-4 are composed of 220 and 223 amino acids, respectively, including the leader sequences, and amino acid homology between them'is 20 to .30%.

The ligands for CD28 and CTLA-4 are CD80 (B7-1) and.CD86 (B7-2) in human and mice. ׳ CTLA-4 has about 20 times as.high affinity to both Ligands as CD28, It has been elucidated that the amino acid sequence' structures MYPPPY (Met-Tyr-Pro-Pro-Pro-Tyr) conserved through' .animal species is important for the. binding of CD2 8 and ,.CTLA-4 to' CD80 (B7-1) . It has also been reported that, when CD28 is stimulated, .15 .PI3 kinase (phosphoinositide 3 kinase, PI3K) associates with' the phosphorylated tyrosine residue in a partial sequence YMNM (Tyr-Met-Asn-Met) of CD28 and that CD28 plays an important role in intracellular signal transmission through this YxxM״ structure. Furthermore, it has-been reported that-CTLA-4 also has a sequence .20 . represented by ,״YxxM,״ namely YVKM (Tyr-Val-Lys-Met) ״ in its cytoplasmic region and. that,. after being stimulated, SYP associate's.

. with this ,sequence.

. CD28 is expressed specifically in thymocytes and.peripheral . blood T cells , and CTLA-4 is expressed specifically in activated T 25 cells (Cell Engineering: SUPPLEMENT, Handbook of Adhesion Molecule, Shuj.unsha, pp. 93-102 (1994) ; ibid. pp. 120-136; Experimental Medicine: SUPPLEMENT, BIO SCIENCE Term Library, Immunity, Yodosha, pp.94-98 .(1995) ; Experimental Medicine: SUPPLEMENT, BIO SCIENCE Term Library, Intracellular Signal Transduction, Yodosha, pp.58-59 (1997); Nihon 30 Rinsho, Vol.55, N0.6, pp.215-220 (1997)).

In the regulation of T cell function (the activation and the inhibition □f function of T cells), the importance of interactions among multiple molecules such as costimulator molecules (CD28, CD80 (B7-1) , CD86 (B7-2) , etc.) and CTLA-4, which cooperates with them, 35, has thus been, recognized, and this has been drawn attention to the ' relationship between these molecules and diseases, and the treatment

WO 01/87981 PCT/JPO1/04035 , of diseases by'regulating ־the function of. these molecules.

As described above, although a living body activates its acquired immune response system against antigens that are foreign bodies to . the living body (self), it also has immunological tolerance so as 5 to show no immune response against its own component (autoantigen) .

If immunological tolerance breaks down by some reason, immune response' to the. autoantigen occurs, autoantigen-reactive T cells are induced by the same mechanism as mentioned above to fall into abnormal state of immunity, and various autoimmune diseases are caused.

In other words, since non-stimulated antigen presenting cells , (APC) in normal tissues do not express costimulatory molecules when the immune system of a living body .is normal,. T cells are in the unresponsiveness state to maintain immunological tolerance even.if • autoantigen-reactive T cells, which reacts with autoantigen, exist. 15 It has been suggested that in abnormal state of immunity, more autoantigen-reactive T cells are activated due to abnormal excess and continuous expression of costimulatbry molecules to thereby cause autoimmune diseases.

• '. From such viewpoints recently, many attempts, .to treat various 20 autoimmune diseases by modulating the transmission of costimulatory signals, for example, the above-mentioned signal transmission between ׳ CD28/CTLA-4 and CD80/CD86, are proposed.

The results of ,such attempts have not yet clarified in detail the mechanism of the T cell , activation by . interaction, between^:25 costimulatory molecules and the related molecules . ' Other unknown molecules may be involved in this mechanism.

Recently, there has been identified a novel co-stimulatory molecule like the above-described CD28 and CTLA-4, which is thought to carry out the transduction of a second signal (co-stimulatory signal) 30 essential for the activation of lymphocytes such as T cells, and functional regulation coupled with said signal ' of activated lymphocytes such as activated T cells. This molecule has been designated as AILIM (activation inducible lymphocyte immunomodulatory molecule) (in humans, mice and rats: Int.Immunol., Vol. 12, No. 1, 35 p.51-55, 2000), also referred to as ICOS (inducible co-stimulator) (in humans: Nature, Vol'. 397, No.6716, p.263-266, 1999)).

On the other hand, novel molecules celled B7h, B7RP-1, GL50 or LICOS which are ligands (AILIM ligands) interacting with this costimulatory transmission molecule AILIM (ICOS) have been identified very recently (Nature. Vol. 402, No. 6763, pp. 827832,1999; Nature Medicine, Vol.5, No.12, pp.1365-1369,1999; J. Immunology, Vol.164, pp. 1653-1657,2000; Curr. Biol., Vol. 10, No. 6, pp. 333-336,2000) .

The identification of these two kinds of novel molecules, namely AILIM (ICOS) andB7RP-l (B7h, GL50, LICOS), as the signal transduction pathway for the costimulatory signal essential for the above activation of lymphocytes such as T cells, and the control of the function of activated T cells, revealed that there is the novel third pathway by the interaction between AILIM (ICOS) and B7RP-1 (B7h, GL50, LICOS), besides the known first and second signal pathways which are already known transduction pathway between CD28 and CD80 (B7-1)/CD86 (B7-2) , and that between CTLA4 and CD80 (B71)/CD 86 (B7-2) .

Studies on the biological functions of these novel molecules, the function control of lymphocytes, such as T cells, through this third costimulatory signal transduction by the molecules, and the relationship between the novel signal transduction and diseases are in progress (J. Immunol., 166 (1), pp. 1,2001; J. Immunol., 165 (9), pp. 5035,2000; Biochem. Biophys. Res. Commun., 276 (1), pp. 335,2000; Immunity, 13 (1), pp.95, 2000; J. Exp. Med., 192(1), pp.53, 2000; Eur.

J. Immunol., 30 (4), pp. 1040,2000; WO 01/15732).

Summary of the Invention

In accordance with a first of its aspects, the present disclosure provides a human monoclonal antibody or portion thereof that binds to human AILIM, wherein a V region DNA encoding a heavy chain variable region of said human monoclonal antibody or portion thereof is from human immunoglobulin heavy chain V gene segment 102 or 3-13.

6a

Also, the present disclosure provides a human monoclonal antibody or portion thereof that binds to human AILIM, wherein a V region DNA encoding a light chain variable region of said human monoclonal antibody or portion thereof is from human immunoglobulin light chain V gene segment L5 or A27.

Further, the present disclosure provides a human monoclonal antibody or portion thereof that binds to human AILIM, wherein a heavy chain variable region of said human monoclonal antibody or portion thereof comprises an amino acid sequence selected from the group consisting of: (a) amino acids from position 20 through 117 of SEQ ID NO:28, (b) amino acids from position 20 through 117 of SEQ ID NO:28 in which one to ten amino acid residues are deleted, substituted, or added, (c) amino acids from position 20 through 116 of SEQ ID NO: 32, (d) amino acids from position 20 through 116 of SEQ ID NO:32 in which one to ten amino acid residues are deleted, substituted, or added, (e) amino acids from position 20 through 116 of SEQ ID NO:36, and (f) amino acids from position 20 through 116 of SEQ ID NO: 36, in which one to ten amino acid residues are deleted, substituted, or added.

Yet further, the present disclosure provides a human monoclonal antibody or portion thereof that binds to human AIIM, wherein a light chain variable region of said human monoclonal antibody or portion thereof comprises an amino acid sequence selected from the group consisting of: (a) amino acids from position 23 through 116 of SEQ ID NO: 30, (b) amino acids from position 23 through 116 of SEQ ID NO:30 in which one to ten amino acid residues are deleted, substituted, or added, (c) amino acids from position 21 through 116 of SEQ ID NO:34, (d) amino acids from position 21 through 116 of SEQ ID NO: 34 in which one to ten amino acid residues are deleted, substituted, or added, (e) amino acids from position 21 through 116 of SEQ ID NO:38, and (f) amino acids from position 21 through 116 of SEQ ID NO:38 in which one to ten amino acid residues are deleted, substituted, or added.

6b

In accordance with a second of its aspects, the present disclosure provides a purified human antibody or portion thereof that binds to human AILIM, wherein a V region DNA encoding a heavy chain variable region of the human antibody or portion thereof is from human immunoglobulin heavy chain V gene segment 1-02 or 3-13.

Also, provided by this aspect is a purified human antibody or portion thereof that binds to human AILIM, wherein a V region DNA encoding a light chain variable region of the human antibody or portion thereof is from human immunoglobulin light chain V gene segment L5 or A27.

Further provided by this second aspect is a purified human antibody or portion thereof that binds to human AILIM, wherein a heavy chain variable region of the human antibody or portion thereof comprises an amino acid sequence selected from the group consisting of: (a) amino acids from position 20 through 117 of SEQ ID NO:28, (b) amino acids from position 20 through 117 of SEQ ID NO:28 in which one to ten amino acid residues are deleted, substituted, or added, (c) amino acids from position 20 through 116 of SEQ ID NO: 32, (d) amino acids from position 20 through 116 of SEQ ID NO:32 in which one to ten amino acid residues are deleted, substituted, or added, (e) amino acids from position 20 through 116 of SEQ ID NO:36, and (f) amino acids from position 20 through 116 of SEQ ID NO: 36, in which one to ten amino acid residues are deleted, substituted, or added.

Yet, further, provided is a purified human antibody or portion thereof that binds to human AILIM, wherein a light chain variable region of the human antibody or portion thereof comprises an amino acid sequence selected from the group consisting of: (a) amino acids from position 23 through 116 of SEQ ID NO:30, (b) amino acids from position 23 through 116 of SEQ ID NO:30 in which one to ten amino acid residues are deleted, substituted, or added, (c) amino acids from position 21 through 116 of SEQ ID NO:34, (d) amino acids from position 21 through 116 of SEQ ID NO: 34 in which one to ten amino acid residues are deleted, substituted, or added, (e) amino acids from position 21 through 116 of SEQ ID NO: 38, and

6c 147448/1 (f) amino acids from position 21 through 116 of SEQ ID NO:38 in which one to ten amino acid residues are deleted, substituted, or added.

In accordance with a third aspect there is provided by the present disclosure a cell that produces the human antibody or portion thereof, or the human monoclonal antibody or portion thereof, as defined herein. The antibody may be a fused cell obtained by fusing a mammalian B cell and myeloma cell.

Also provided by the present disclosure is a pharmaceutical composition comprising the human antibody or portion thereof or the human monoclonal antibody or portion thereof, as defined herein and a pharmaceutically acceptable carrier.

Passages of the description which are no longer in ambit of the claims do not constitute part of the invention.

Disclosure of the Invention

Specifically, an objective of the present invention is to reveal biological functions of the novel molecule AILIM, considered, like CD28andCTLA-4, as a molecule which transmits these secondary signal (costimulatory signal) essential for the activation of lymphocytes, such as T cells, and which controls the functions of activated lymphocytes, such as activated T cells, by working with the signal; to reveal relationships between the expression of AILIM and diseases; and to provide a method and a pharmaceutical which inhibit the development of the various diseases dependent on the expression pattern of AILIM or which treat the diseases by controlling the biological functions of the AILIM using the medical and pharmaceutical methods.

WO 1)1/87981 PCT/JP01/04035 . 7 ' .. 7 ' 7 (for example, a drug such as a monoclonal antibody and a low molecular. ' . compound).

To achieve the above-described purposes, the present inventors have actively pursued studies on human antibodies (particularly human' 7 monoclonal antibodies) against mammalian AILIMs (particularly human ; \

AILIM) ,.and as a result, by immunizing transgenic mice prepared using ' genetic recombination techniques so as to produce human antibodies with AILIM (specifically cell membrane .fraction of cells expressing '7 . human AILIM)., succeeded, first in the' world in preparing a variety of monoclonal antibodies which bind to human AILIM, particularly, those .which bind to human AILIM that regulate signal transduction mediated by human AILIM.

Since antibodies (particularly monoclonal,antibodies) of this invention.are derived from humans, they do not induce any severe immune * rejection due to the immunogenicity against humans. , HAMA (human ? ' anti-mouse antigenicity) , in.the host at all, which has been a big problem ,(side effect) in,therapy using antibody pharmaceuticals comprising antibodies derived from non-human mammals .such. as mice, and thus dramatically enhancing the value of antibody as medicine.

. .Therefore, human antibodies (particularly human monoclonal 7' antibodies) which bind to mammalian AILIMs (particularly human AILIM) of this invention and pharmaceutical compositions comprising said . . .humanantibodies (particularlyhumanmonoclonalantibodies) areuseful as drugs to control, with.no induction of immune rejection due to ^: .

HAMA in the host, various physiological reactions related to the .' transduction of co-stimulatory signal .to AILIM-expressing. cells' . mediated by AILIM,(for example, proliferation of AILIM-expressing cells, cytokineproductionbyAILIM-expressingcells, immunecytolysis or apoptosis of AILIM-expressing cells, and. activity to induce antibody-dependent cytotoxicity to AILIM-expressing cells, and so on) , and/or are also useful as drugs to suppress .and prevent development of symptoms and/or progress of various disorders related to the signal transduction mediatedby said AILIM, and as medicine to treat or prevent said disorder.

Specifically, pharmaceutical compositions according to th.i s' invention are able to. control (suppress or stimulate) proliferation ׳.

WO 01/87981 PCT/JP01/04035 ' X 8׳ . . ' of AILIM-expressing cells or production of cytokine (for example,

- interferohY or interleukin 4, etc.') by AILIM-expressing cells, thereby . enabling suppression of various pathological conditions and treatment or prevention. of various, disorders caused by diverse physiological . phenomena related.to signal transduction mediated by AILIM.

Use of pharmaceutical compositions according to this invention enables suppression, prevention, and/or treatment of, for example, various disorders (for. example, rheumatoid arthritis, multiple • sclerosis, autoimmune thyroiditis,'allergic contact-typedermatitis,.

. chronic inflammatory, dermatosis such as lichen planus, systemic lupus erythematosus, insulin-dependent diabetes mellitus, psoriasis ,etc.) classified into autoimmune or allergic disorders .' (particularly autoimmune disease and delayed allergy caused by cellular immunity) ; arthropathia (for example, rheumatoid arthritis (RA) and

15. osteoarthritis (OA)), inflammation (e. g. hepatitis) ; graft versus host reaction (GVH reaction) ; graft versus host disease (GVHD) ; immune rejection accompanying transplantation (homoplasty or heteroplasty) .of a tissue.(tissues such as .skin, cornea, bone, etc. ) or organ (liver , heart, lung, kidney, pancreas, etc.) ; immune response triggered by:

a foreign antigen or autoantigen (for example , production of antibodies . against said antigen, cell proliferation, production of cytokines) ; ' and disorders possibly caused by. the abnormal intestinal immunity (specifically inflammatory intestinal disorders (particularly.clone disease and ulcerative colitis) and alimentary allergy).

Furthermore, in the field of suppression/treatment of immune rejection accompanying transplantation of above-described tissues and organs, it is possible .to augment the suppressive .effect on transplant -rejection of known immunosuppressant by using the :pharmaceutical composition of this invention together with said.drugs >30׳ which have been utilized for suppression of immune rejection in such a transplantation treatment.

Moreover, the pharmaceutical' composition of the present invention can be applied for treating or preventing, any inflammatory diseases to which various steroids are indicated as antiphlogistic.

The pharmaceutical composition of the present invention can be . applied to inflammatory disease for example ,^,'inf lamination accompanying wo 01/87981 . PCT/JPO1/04035 various arthritis. (for example, rheumatoid arthritis, osteoarthritis), ־ pneumonia, hepatitis (including viral hepatitis)) inflammation ' accompanying infectious diseases, inflammatory bowel diseases, . intestinal enteritis, nephritis (inflammation, accompanying '5 glomerular nephritis, nephrofibrosi.s) , .gastritis, angiitis, ^; pancreatitis, peritonitis, bronchitis, myocarditis, cerebritis, , , inf !animation in postischemic reperfusion injury (myocardial ischemic .reperfusion in jury) , inf !animation attributed to immune reject! on after. transplantation of tissue and organ, burn ,.various'׳skin inflammation 10 (psoriasis, allergic contact-type dermatitis, lichen planus which is chronic inf lammatory skin disease) , inf !animation in multiple organ ׳ failure, inflammation after operation of PTCA or PTCR, and inflammation accompanying arteriosclerosis, and autoimmune .thyroiditis.

In addition, by using a method for.identifying substances that 15 bind to AILIMor AILIM ligand, which is one of the present inventions , it becomes possible to screen to select'pharmaceuticals (chemical . synthetic compounds or antibodies), with potential activity to treat various disorders by binding to AILIM or AILIM ligands to regulate . signal .transduction mediated by interaction of them. ... .

³θ . . Specifically, the present invention is the invention described from the following (1) to (108).

'1) ׳). A.human antibody which binds to AILIM.' (2) The human antibody of (1) ,.wherein said AILIM'is. derived .׳ J :from human.

. (3) A human monoclonal antibody which binds to AILIM or a portion thereof. ' (4) The human monoclonal antibody or a portion thereof of (3) , wherein said AILIM is derived from human.

(5) The human monoclonal antibody or a portion thereof of (3) or (4), wherein said human monoclonal antibody has an activity.to ^;inhibit a signal transduction into a' cell mediated by AILIM.

(6) The human monoclonal antibody or a portion thereof of (5) , wherein said activity to. inhibit a signal transduction is . (a) or (b) of. the followings:

^!5 activity to inhibit proliferation of AILIM-expressing.) cells., or ‘.

WO 01/87981 ' ' .. ' ¹⁰ ' ' .’.

(h) ׳ activity to inhibit cytokine production from

AILIM-expressing cells.

• (7) The human monoclonal , antibody or a portion thereof of (6 )־ , wherein said cytokine is one of the .cytokines produced by Thl-type or Th2-type T cell.

(8) . The human monoclonal antibody or a portion thereof of (7) wherein said cytokine is interferon γ or interleukin 4.

(9) The human monoclonal antibody or a portion thereof of (5) , , . wherein said human monoclonal antibody has an activity to prevent :

10. .mixed lymphocyte reaction. .>

. (10) The human monoclonal antibody or a portion thereof of (3) or (4) , wherein said human monoclonal antibody has an activity to'.׳ induce signal transduction into a .cell mediated by AILIM.; ' (11) The human monoclonal antibody or a portion thereof of .(10) 15 wherein said'activity to induce signal transduction is (a) or (b) of the followings:

(a) activity to induce prolif eration of AILIM-expressing cells ,' , or . .

.(b) activity to induce cytokine production from 20 AILIM-expressing cells.

(12) The humanmonoclonal antibody or a portion thereof of (11) , wherein said cytokine is ׳.one of the cytokines produced by Thl-type . or Th2-rtype T.cell. ־ (13) The humanmonoclonal antibody or a portion thereof of (12) , 25 ,wherein said cytokine is interferon γ or .interleukin 4.

(14) The human monoclonal antibody or a portion thereof of (3) ^or (4) , wherein said human monoclonal antibody has an activity to .:׳ :induce antibody-dependent cytotoxicity to AILIM-expressing cells., and/or immune cytolysisor apoptosis of AILIM-expressing cells. ’ (15) The human monoclonal antibody or a portion thereof of (3) or (4) , wherein the binding rate constant (ka) between said monoclonal antibody and AILIM is .1.0 x .10³ (1/M. Sec) or more. .

(16) . The human monoclonal antibody or a portion thereof of (15) , .' wherein said binding rate constant (ka) is 1.0 x 10⁴ (1/M.Sec) ormore.

(17) The humanmonoclonal antibody or a portion thereof of (16), wherein said binding rate constant'(ka). is 1.0. x 10^s (1/M. Sec) or more. '

WO 01/87981 PCT/JP01/04035 ' . ’ .' , ' ' . ' ¹¹'. ..' (18) The human monoclonal antibody or .a portion thereof of (3) or (4), wherein the dissociation rate constant (kd) between said monoclonal' antibody and AILIM is 1.0 x 1Ό³. (1/Sec) or less.

(19) The human mono clonal antibody or aportion thereof of (18) , : 5 .wherein said dissociation rate constant (kd) is 1.0 x IO1) ⁴־/Sec) or less. ... ׳ . ':.'.

(20) The human monoclonal antibody or a portion thereof of (19) , .wherein said dissociation rate constant (kd) is 1.0 x lO1) ⁵־/Sec) or less .

1° (21) The human monoclonal antibody or a portion thereof of (3) or .(4) ,wherein the dissociation constant ;.(Kd).between said monoclonal.

• antibody.and AILIM is ,1.0 x 10⁶־ (M) or less.

(22) The humanmonoclonal antibody or a portion thereof of (21) י wherein said dissociation constant (Kd) is 1.0.x 10⁷־ ’(M) or less . ' .^! (23) The human monoclonal antibody or a portion thereof of (22) , wherein said dissociation constant' (Kd) is 1.0 x 10⁸־ (M) or less.' (24) The human monoclonal antibody or a portion thereof of (23) , wherein said dissociation constant (Kd) is 1.0 x 10'⁹ (M) or less.

(25) The human monoclonal antibody or a portion thereof of (4) ,,.

^-0 wherein a V.region DNA encoding a heavy chain variable region of said : . human monoclonal antibody is derived, from either the human immunoglobulin heavy chain V gene segment 1-02 or 3-13.

(26) The.human monoclonal antibody or a portion thereof of (4) , wherein a V region DNA encoding a light chain variable region of said human monoclonal ׳antibody is derived from either the human, immunoglobulin light, chain V gene segment L5 or A27.

(27) The human monoclonal antibody or a portion thereof of (25) or (25) , wherein a V region DNA encoding a heavy chain variable region of said human monoclonal antibody is derived from either the human immunoglobulin heavy chain V gene segment 1-02 or 3-13, and wherein a V region DNA encoding a light , chain variable region of said human monoclonal antibody is derived from either the'human immunoglobulin 1 light chain V gene segment L5 or A27. .

(28) . The human monoclonal antibody or aportion thereof of (27) , wherein the V region DNA encoding a heavy chain variable region of said human monoclonal antibody is derived from thehuman immunoglobulin

WO 01/87981 . PCT/JP01/04035

. ., יי '־: _: '12 ' ./ . ' heavy chain V gene segment 1-02, and the V region'DNA encoding a light chain variable region of said human monoclonal antibody is derived from the human immunoglobulin light chain V gene segment L5.

(29) The human monoclonal antibody or a portion thereof of (27) wherein theV region DNA encoding a heavy chain variable region of said human monoclonal antibody is derived from the human immunoglobulin heavy chain .V gene segment 3-13 , and the V region DNA' encoding a light chain variable region, of said human monoclonal antibody.is derived . from the human immunoglobulin light chain V gene segment A27.

1°. . (30) The human monoclonal antibody or a portion thereof of (4 j , :,

..wherein a heavy chain variable region of . said human monoclonal antibody / has an amino .acid sequence defined in any of the'following (a) through (a) amino acid sequence comprising amiiio acids .from position .

20 through 117 of .SEQ ID NO: 28, . ' .

(b) amino acid sequence comprising amino .acids from position 20 through 117 of SEQ ID NO: 28 in which one or more amino acid residues, . are deleted or substituted, . or to which one or more amino acid res idues are inserted or added.

. (c) amino acid.sequence.comprising amino acids from position .

. 20 through 116 of SEQ ID NO: 32, . .

(d) amino, acid sequence comprising amino acids from position through.116 of SEQ ID NO:. 32 in which one.or.more amino acid residues :

־ are deleted or substituted, or to which one or more amino acid residues . are inserted .'or .added. .' .(e) amino acid sequence comprising amino a.cids from position through.116 of SEQ. ID NO: 36, or / ^r . . I י (f) amino acid sequence comprising amino acids from position through 116 of SEQ ID NO: 36 , in which one or more amino acid.residues .

30. are deleted or substituted, or to which one or more amino acid residues . are inserted or added. . . .' . .

(31) The human monoclonal antibody or a portion thereof of (4), , wherein a heavy chain polypeptide of said human monoclonal antibody . has an amino acid sequence defined in any of the following (aj through .׳. 35 / .(f): . ' ־ .

(a) amino acid sequence comprising amino acids from position

WO 01/87981 PCT/JP01/04035 ' 13 יי .'J..

through 470 of SEQ ID NO: .28, (b) . amino acid sequence comprising, amino acids from position ' 20 through 470 of SEQ׳ID NO: 28 in which one or more amino acid residues are deleted or substituted, or to which one or more amino acid residues' .5 are inserted or added.

(c) amino acid sequence comprising amino acids from position .20 through 470 of. SEQ ID NO: . 32 , ,י א './ (d) amino acid sequence comprising amino acids from position.' ; .20 through 470 of SEQ ID NO: 32 in which one or more amino acid residues' . are deleted or substituted, or to which one or more amino.acid residue's are inserted .or added.

(e) amino acid sequence comprising amino acids from position .

through 470 of SEQ ID NO: 36, or (f) amino acid sequence comprising amino acids from position 15. 20 through 470 of SEQ ID NO: 36 in which one or more amino acid residues are deleted or substituted, or to which one or.more amino acid residues' are inserted or added.

(32) The human monoclonal antibody or a portion thereof of (4) , wherein a light chain variable'region of said human monoclonal antibody ,.

has an amino acid־ sequence defined in any of the following (a) through' ׳ .' ^(f)-^: ' ' ' .' + - 'א' א' ? אאי^;' '׳' א^ (a) amino, acid sequence comprising amino acids from position ..

through 116 of SEQ ID NO: 30, (b) amino acid sequence comprising amino .acids from position.'

23 through 116.of SEQ ID NO: 30 in which one or more amino acid residues ׳ are deleted or substituted, or to which one or more amino acid residues . ׳

׳. are inserted or added. . .'.א:. ;׳' (c) amino acid sequence comprising amino acids from position .

through 116.of SEQ ID NO: 34, .?

(d) amino acid sequence comprising amino acids from position through 116 of SEQ ID NO: 34 in which one or more amino acid residues are deleted or substituted, or to which one or more amino acid residues are inserted or added.

(e) amino acid, sequence comprising amino acids'from position

21 through 116 of SEQ ID NO: 38, or . . *'¹. ׳ ' ״, (f) . amino acid sequence, comprising amino acids from position -

WO 01/87981 . PCT/JP01/04035 . .14 through 116 of SEQ ID NO: 38 in which one.or more amino acid residues are deleted or substituted, □r to.which one or more amino acid residues are .inserted or added. .

(33) The human monoclonal antibody or a portion thereof of (4) , .5 . wherein a light chain polypeptide, of said human monoclonal .antibody • has an amino acid sequence defined in any of the,following (a) through־. <f) : ' / _י / '.Λ‘/־ ,.:'ל '־ ' ' י' . '^: ' י: ''־ .,' (a) , amino acid sequence comprising amino acids from position ' , 23 through 236 of SEQ ID NO: 30, ־'־θ (b) amino acid sequence comprising amino acids from position through 236 of SEQ ID NO: 30 in which one ormore amino acid residues are deleted or substituted, or to which one or more amino acid residues are inserted.or added.

.(c) amino acid sequence.comprising amino, acids from position.:

21 through 236 of SEQ ID NO:34׳, ^: (d) amino acid sequence comprising amino acids from position' through 236 of SEQ ID NO: 34 in which one or more amino acid residues ׳ ' .are.deleted or substituted, or to which one or more amino acid residues ׳ are inserted or added.

..²θ (^e) amino acid sequence comprising amino acids from position ^;.

through 236 of SEQ ID NO: 38,. or (f) amino acid sequence.comprising amino acids from.position. ..

through 236 of SEQ ID NO: 3 8 .in which one or more amino acid residues. are deleted or substituted, or to which one or more amino acid residues •25 are inserted or added. . .:

(34) ?The human monoclonal antibody or a portion thereof of (4) , wherein said human monoclonal antibody has the . following ' . characteristics (a) and (b).: ' (a) a heavy chain variable region has an amino acid sequence comprising the amino acid sequence from amino acid 20 through 117 . according to SEQ ID NO: 28, and (b) ^a light chain variable region has an amino acid sequence comprising the amino.acid sequence from amino acid 23 through 116 ^: . . according to SEQ ID NO: 30.

35. (35) The human monoclonal antibody or a portion thereof of (4) ,.

• . wherein said human , monoclonal antibody has ׳ the .':following .

WO 01/87981 ' PCT/JPO1/04035

./. ' 15> . ' ' י' י .

characteristics (a) and (b): . . .

. (a), a heavy chain polypeptide has an amino acid sequence from amino acid 20 through 470 according to SEQ ID NO: 28, .and . (k) a light chain polypeptide has an amino acid sequence from amino acid 23 through 236 according, to SEQ ID NO: 30.

(36) The human monoclonal antibody or a portion thereof of (4) , wherein, said human monoclonal antibody . has the following, characteristics, (a) and .(b).: . J (a) a heavy chain variable region has an amino acid sequence

10. . comprising the amino acid sequence from, amino acid 20 through 116 according to SEQ. ID NO: 32, and (b) a light chain variable region has an amino acid sequence comprising the amino acid sequence from amino acid 21 through 116 according to. SEQ ID NO: 34. . .

¹⁵ . (37) The human monoclonal antibody or a portion thereof of (4) , .wherein said 'human monoclonal antibody has the following . characteristics (a) and (b):

_<(a) _ a heavy chain polypeptide has an amino' acid sequence. , comprising the amino acid sequence from.amino acid 20 through 470 .' according to SEQ ID NO: 32, .and . (b) a light chain polypeptide has an amino acid sequence . comprising the amino acid sequence from amino acid 21 through 236 .according to SEQ ID NO: 34. .

(3 8 ) The human monoclonal antibody or a portion thereof of (4, ;

wherein said human monoclonal antibody has' the following / characteristics (a) and (b):

־ (a) a:heavy chain variable region has an amino acid sequence׳, comprising the amino acid sequence from amino acid .20 through •116 according to SEQ ID NO: 36, and .

³⁰ ׳ ^a light chain variable region has an amino acid sequence .comprising the amino acid sequence from amino acid 21 through.116 according to SEQ ID NO: '38.

(39). The humahmonoclonal antibody or a portion thereof of (.4) , . wherein said human monoclonal, antibody has the following characteristics (a) and (b).:

(a) a-heavy .chain polypeptide has an amino'acid sequence.- . WO 01/87981 PCT/JP01 /04035 .

' 16 comprising the amino acid sequence' from amino acid 20.through 470 according to SEQ ID NO: 36, and (b.) a light, chain polypeptide has . an amino .acid sequence, comprising, the amino acid sequence from amino acid 21 through 236 according to SEQ ID NO: 38.

(40) .The human monoclonal antibody or a portion thereof of any one of (3) through (29) , wherein said human monoclonal antibody is', a monoclonal, antibody derived .from a transgenic־ non-human mammal' capable of producing־ human antibodies .'.

1θ (41) The human monoclonal antibody or a portion thereof of (40 ) , wherein said human monoclonal.'.antibody is obtained by immunizing . transgenic non-human mammal capable of producing human antibody with AILIM-expressing cells, membrane fractions derived from said cells, . .whole molecules constituting AILIM. or a'portion thereof, or genes

-..15 encoding AILIM or a portion thereof.'׳ (42) The human monoclonal antibody or a portion thereof of (40) or (41), wherein said transgenic non-human mammal .is . a ;transgenic mouse.־ (43) A DNA or a portion thereof encoding a polypeptide selected from the group consisting of (a) through (f).below:

(a) a polypeptide comprising the amino acid sequence from amino acid 20 through 117 according to SEQ ID NO: 28, ' .:: . !

:(b) a polypeptide comprising the amino acid sequence from amino acid 23 through 116 according to SEQ ID NO: 30, : 25 (c) a polypeptide comprising the amino acid sequence from amino acid 20 through 116 according to SEQ ID NO: 32,. (d) a polypeptide comprising the amino acid sequence.from amino acid 21 through 116 according to SEQ ID NO: 34,.

. (e) a polypeptide comprising the amino acid sequence from amino acid 20 through 116 according to- SEQ ID NO: 36,.and (f) a polypeptide comprising the amino acid sequence from amino acid 21 through 116 according to SEQ ID NO: 38.

(44) A DNA or a portion thereof encoding a polypeptide selected from ־he group consisting of (a) through (f) below: ' ³⁵ <^a> a polypeptide comprising the amino acid sequence from amino acids •20 through 470 according to SEQ'. ID NO; . 28, • WO 01/87981 PCT/JP01/04035 . ' .- . 17 . ' . ’ ' . 'Λ'-.

(b) a polypeptide comprising the amino acid sequence from amino י . ^vacids 23 through 236 according to SEQ ID NO: 30, . (c) a.polypeptide comprising the amino acid sequence from aminp ' acids 20 through 470 according to SEQ ID NO: 32, ¹ .

(d) a polypeptide comprising the amino acid sequence.from amino acids 21 through 236 according to SEQ ID NO: 34, .(e) a polypeptide comprising the amino acid sequence from amino ' acids,20 through 470 according to SEQ. ID NO: 36, and . .’. ׳ . ’ '? '!

.. . (f) a polypeptide comprising the amino acid sequence from amino ׳ '.

acids 21 through 236 according to SEQ ID NO: 38.

(45) A DNA or a portion thereof 'selected, from the group ! . ׳. consisting of (a) through (f) below:

(a) a.DNA comprising the nucleotide sequence from nucleotides'; י :.׳ 126 through 419 according to SEQ ID NO: 27, .' ' (b) a DNA comprising the nucleotide sequence from nucleotides

105through 386 according to SEQ ID NO: 29_r (c) a DNA comprising the nucleotide sequence from nucleotides ׳

151 through 441 according to SEQ ID NO: 31, . !

(d) a DNA comprising the nucleotide sequence from nucleotides ¹

88 through 375 .according to SEQ ID NO: 33,/ ‘ Λ ,, (e) a DNA comprising the nucleotide sequence from nucleotides

153 through 443 according to SEQ ID NO: 35, and ' (f) a DNA comprising the nucleotide sequence from nucleotides . ׳.

through 380 according to SEQ IO NO: 37.' (46) A DNA or a portion thereof selected from a group consisting of (a) through (f) below: ׳ .

(a) a DNA comprising the nucleotide sequence from nucleotides .69.through 1481 according to.SEQ ID NO: 27, (b) a DNA comprising the nucleotide sequence from nucleotides

39 through 749 according to SEQ ID NO: 29, (c) a DNA comprising the nucleotide, sequence from nucleotides through 1506 defined in .SEQ ID NO: 31, (d) a DNA comprising the nucleotide sequence from nucleotides through 738 according to SEQ ID NO: 33,. '

35. (θ) a DNA comprising the nucleotide sequence!from nucleotides '.

through 1508 according to SEQ ID NO: 35, and .!.- . '.!&lt;''

.. .,.'!'&lt;&lt;'!;?!' - ' !!' .;..' !i-. . . !/'''!'!.!&lt;

WO 01/87981 PCT/JP01/04035

-. . ׳. ,־. ¹⁸ ' (f) a DNA.comprising the nucleotide sequence from nucleotides through 743 according to SEQ ID NO: 37.^: :

(47) A vector comprising the DNA of_;any one of (43) through (46). . . :/ . / ’ . '. ^; :/ \ . 5 . (48) The vector of (47) comprising a DNA according to any of, .the following (a) through (c) : '.', (a) a DNA comprising the nucleotide sequence.from nucleotides׳

126 through. 419 according :to SEQ ID .NO: 27-, (b) a DNA comprising the nucleotide sequence from nucleotides • .10 •151 through 441 according to SEQ ID NO: 31, or (c) a DNA comprising the nucleotide sequence from nucleotides ,153 through 443 according to SEQ ID NO: 35.

(49) The vector of (47) comprising a DNA according to any of the following (a) through (c) :

15.׳ , (a) a DNA comprising the nucleotide sequence from nucleotides through 1481 according to SEQ ID .NO: 27, ' .

,(b) . a DNA.comprising the nucleotide sequence from nucleotides .94 through1506.׳ according to .SEQ ID NO: '31, .or (c) a DNA comprising the nucleotide sequence from nucleotides

96 .through 1508 according to SEQ ID NO: 35. . .' ׳ (50) The vector of (47) comprising a DNA according to any of the following .(a) ,through (c).: ־ ' :

(a). a DNA comprising the nucleotide sequence from nucleotides ;

' 105 through. 386 according to SEQ ID NO: 29, . 25 ׳ ׳ (b) a DNA comprising the nucleotide sequence from nucleotides through 37.5 according to SEQ ID. NO: 33, or ,(c) a DNA comprising the nucleotide sequence from nucleotides' .through 380 according to SEQ,ID NO: 37.

,(51) The vector of (47) comprising a DNA according to any of

.. 30 the following (a) through (c) :

(a) a DNA comprising the nucleotide sequence from nucleotides .39 through 749 according to SEQ ID NO: 29,.

(b) a DNA comprising the nucleotide sequence from nucleotides through 738 according to SEQ ID :NO : 33, or ³⁵ (^c) a DNA comprising the nucleotide sequence from nucleotides ' .33 through . 743 according ,to SEQ ID NO: 37. ' ׳’ . .

J

X>.XX X> ׳.>. ' . X: X> ^Λ . . .

.׳. ' :: . .>״ . 'X X י . . . .. - ; .

X.' '. י ' ' ' י:'''' י ' ' : . ' ׳ ''

JPO1/04035׳,WO 01/87981 PCT

¹ ' ' .י^,,'* . ' '׳ ¹⁹ - x ' '

. יי'' . . ־ . '. . ' . .

(52) The vector of (47) comprising a DNA according to the following (a) and (b): . X (a) . a,DNA comprising the nucleotide sequence, from nucleotides

126 through 419 according to SEQ ID NO: 27, and ;(b) a DNA comprising the nucleotide sequence from nucleotides .

105 through 386 according to SEQ ID NO: 29.

. (53) The vector . of (47) comprising a _׳DNA according, to the ; following (a) and (b) :

(a) ' a DNA comprising.the nucleotide'sequence from nucleotides

69 through 1481 according to SEQ'.'ID NO:' 27, and ., . .

(b) a DNA.comprising the nucleotide sequence from nucleotides ' 39 through .749 according, to SEQ ID NO: 29.

.(5.4) The vector of (47) comprising a DNA according to the ., following (a) and (b) : . . . ' ..X :

.15׳ (a) a DNA comprising the nucleotide sequence from nucleotides .׳ . .151 through 441 according to SEQ ID NO: 31, .and ' (b) a DNA comprising the .nucleotide sequence from nucleotides 88 through 375 according to SEQ ID NO: 33.

(55) The vector of (47) comprising a DNA according to the '20 'following (a) and (bj:' (a) a DNA comprising the nucleotide sequence from nucleotides X' through 1506.according to SEQ ID NO: 31,. and ^: (b) . a DNA comprising the nucleotide sequence from nucleotides .׳ through 738 according to SEQ ID NO: 33.

(56). .The vector of (47) comprising a DNA according to the following (a) and (b);

(a) a DNA comprising the nucleotide sequence from nucleotides

'.. 153 through 44.3 according to SEQ ID NO: 35, and (b) a DNA comprising the nucleotide sequence from nucleotides ';

.30 93 through 380 according to SEQ ID NO: 37.

(57). The vector of (47) comprising a DNA according to the following (a) arid (b) : .

(a) a DNA comprising the nucleotide sequence from nucleotides' :

. 96 through 1508 according to SEQ ID NO: 35,;and (b) a DNA comprising, the nucleotide sequence from nucleotides 33 through 743 according to SEQ ID NO: 37.

<img file="IL147448A_D0001.tif" />

. WO 01/87981 . PCT/JPO1/04035

- י . . . י' '.20 (58) A cell producing a human monoclonal antibody of any one of (3) through (42).

(59) The cell of (58) , wherein said cell is a fused cell obtained: by fusing B cell, derived from a mammal capable of producing said human monoclonal.antibody,, and myeloma cell derived from a mammal.

(60) A genetic recombinanthost transformed by transferring a DNA described below.in (a) or a vector comprising said DNA, a DNA described below in׳ (b) or a vector comprising said DNA, or both DNAs described below in (a) and (b) or a vector comprising, both. of said .

. DNAs: . ' (a) , -a DNA encoding a heavy chain polypeptide or a portion thereof , of a monoclonal antibody which binds to human AILIM; or (b) . a DNA encoding a light chain polypeptide or a portion thereof of a monoclonal antibody which binds to human AILIM. ־ ¹⁵ . (61) The genetic, ־recombinant host of (60) , ;wherein said, monoclonal antibody is a human monoclonal antibody.

(62) . The genetic recombinant host of (60) or (61) , wherein said, host is a mammalian cell. .

(63) The genetic recombinant host of ;(60) or (.61) , wherein said .

host is .a. mammalian fertilized egg.

(64) The genetic recombinant host of any one of (60) through (63) , :wherein said heavy chain .polypeptide is one of the heavy chain : polypeptides selected from the group consisting of the following (a) ' through (c):

25־ (e) a heavy chain polypeptide comprising the amino acid sequence ' from amino acids. 20 through 117 according to SEQ ID NO: 28, . (b) aheavy chain polypeptide comprising the amino acid sequence from amino acids 20 through ,116 according to SEQ ID NO:' 32, and . (c) aheavy chainpolypeptide comprising the amino acid sequence .

from amino acids 20 through ;116 according to SEQ ID NO: 36.

(65) The genetic recombinant host of any one of (60) through (63) , wherein said heavy chain polypeptide is one of the heavy chain., polypeptide selected from the group consisting of the following (a) through .(c) :

(a) a heavy chainpolypeptide comprising the amino acid sequence from amino acids 20 through 470 according to SEQ ID NO: 28,

WO 01/87981 PCT/JP01/04035

יי י־ 1^ (b) . a heavy chain polypeptide comprising the amino acid sequence from amino, acids 20 through 470 according to SEQ ID NO.: 32, and.

(c) a heavy chain polypeptide comprising the amino acid sequence . from amino acids.20.through 470 according to SEQ .ID NO: 36. ' ⁵ (66) The genetic recombinanthost of any one of (60) through .(63) , ׳ wherein.said light chain polypeptide is one of the׳ light chain . polypeptide selected from the'group consisting of the following (a) ; . through (c) :

(a) a heavy chain polypeptide comprising the amino acid sequence from amino acids 23 through 116 according to SEQ ID. NO: 30;

(b) aheavy chain polypeptide comprisingthe amino acidsequence from amino acids 21 through 116 according to SEQ ID NO: 34, and (c) aheavychainpolypeptidecomprisingtheaminoacidsequence from amino acids 21 through 116 according to. SEQ ID .NO: 38. ^; :¹⁵. (θ⁷) The genetic recombinant host of any one of(60) through (63) , wherein said light chain polypeptide is one of the .light chain' polypeptide selected, from .the group consisting of the following (a) ; through (c) :

(a) alightchainpolypeptidecomprisingtheaminoacidsequence from amino acids 23. through 236 according to SEQ ID NO: 30, (b) . a light chain polypeptide .comprising the amino acid sequence. 1. from amino acids 21 through 236 according to SEQ ID .NO:34, and .(c) a light chain polypeptide comprisingthe amino acid.sequence from ;

. amino acids 21 through 23.6 according to SEQ ID NO: 38. ' (68) :

The genetic recombinant host of any one of (60) through (63) , wherein said heavy chain and light chain polypeptides are those defined below in (a) and (b) , respectively: . .

(a) aheavy chain polypeptide comprising the amino acid sequence from amino acids.20 through 117 according to SEQ ID NO: 28, and (t>) a light chain polypeptide comprising the amino acid sequence from amino acids 23 through 116 according to SEQ ID NO: 30.

(69) The genetic recombinant host :of any one of (60) through (63) , wherein said heavy chain and light chain polypeptides are those • defined . below in . (a.) and (b) , respectively:

(a) aheavy chain polypeptide comprising the amino acid sequence from amino, acids 20 through 470 according to SEQ. ID .NO: 28,. and.

WO 01/87981 PCT/JPO1/04035 . 22 .

(b) a light chain polypeptide comprising the amino acid sequence from amino acids 23 through 236 according to SEQ. ID‘NO: 30.

(70) The genetic recombinant host of any one of (60) through .(63) , .wherein said heavy chain and light chain polypeptides are those defined below in (a) and (b), respectively:

(a) aheavy chain polypeptide comprising the amino acid sequence .from amino acids 20 through 116 according to SEQ ID׳ NO: 32, and - (b) .a light chain polypeptide comprising the amino acid sequence . from.־amino., acids .21 .through 116’ according to SEQ ID NO: 34.

o (71) .The genetic recombinant host of any .one of (60) through ־ (63) , wherein said heavy chain and light chain polypeptides.are those׳ defined below in (a) and (b) , respectively: .' (a) aheavy chain polypeptide comprising the aminoacid sequence' from amino acids.20 through'470 according to SEQ ID NO: 32,. and ⁵ (h) a light chain polypeptide comprising the amino acid sequence from amino acids 21 through 236 according.to SEQ ID NO: 34.

(72) The genetic recombinant host of any one of (60) through (63) , wherein said heavy chain and light chain polypeptides are those defined below in (a). and . (b), respectively:

θ (a) aheavy chain polypeptide comprising the amino acid sequence :' from amino acids 20 through 116 according to SEQ ID NO: 36, and'.

.(b) a light chain polypeptide comprising the amino acid sequence ., from amino acids .21 through '116 according to SEQ. ID NO: 38.

. 73) ־) The genetic recombinant host of any one of (60) through ׳ 63) נ) , wherein said heavy chain and light chain polypeptides are those defined below, in (a) and (b), respectively:

(a) aheavy chain polypeptide comprising the amino acid sequence from amino acids 20 through 470 according to .SEQ ID NO: 36, and (b) a light chain polypeptide comprising the amino acid sequence from .amino acids 21 through 236 according to SEQ ID NO: 38.

(74) The genetic recombinant host of any one of .(60) through .(63) , wherein the DNA encoding said heavy chain polypeptide is a DNA defined in . any of following (a) through (c) : ? . ’ (a) a DNA comprising the nucleotide sequence from nucleotides .126 through 419 according to SEQ ID NO: 27, (b) . a DNA comprising the nucleotide׳ sequence^;from nucleotides

WO 01/87981 PCT/JP01/04035 . ' . . ., 23 . '/י.'. .י;

151 through 441 according to SEQ ID NO: 31, and '. . ' ־ : (c). a DNA comprising the nucleotide sequence from nucleotides ׳. '

153 .through 443 according to ,SEQ ID. NO:. :35. .

. . (75.) The genetic recombinant host of any .one of (.60) through (63) , wherein the DNA encoding said heavy .chain polypeptide is a DNA defined .in any of .following (a) through (c):

(a) a DNA qomprising the nucleotide sequence, from nucleotides ׳ through 1481 according to SEQ ID NO: 27, .(b) a DNA comprising the nucleotide .sequence, from nucleotides

94 through 1506 according to SEQ ID NO: 31, and .

(c) a DNA comprising the nucleotide sequence from nucleotides .

through 1508 according to SEQ ID NO: 35.

(76) The genetic recombinant host of any one of (60) through' .

(63) , wherein the DNA encoding said light chain polypeptide is a DNA. . .

15. defined in any of following (a) through (c):

(a) a DNA comprising the nucleotide sequence from nucleotides

105 through 386 according to SEQ ID NO: 29, (b) a DNA comprising.the nucleotide sequence from nucleotides' . 88 through 375 according to SEQ ID NO: 33, and .20 ,(c) . a DNA comprising the nucleotide.sequence from nucleotides ^:.

through 380 according to SEQ ID NO: 37.

(77) The genetic recombinant host of any one of .(60) through.

(63) , wherein the DNA encoding said light chain polypeptide, is. a DNA ' as defined'in any of following , (a) through (c) : .

. 25־ (a) . a DNA comprising the nucleotide sequence from nucleotides ־ through 749 according to SEQ ID NO: 29, , (b). a DNA comprising the nucleotide sequence from nucleotides ׳

28.through 738 according to SEQ ID NO: 33, and (c) a.DNA comprising the nucleotide sequence from nucleotides . 33 through 743 according to SEQ ID NO: 37.

(78) The genetic recombinant host of any.one of (60) through.

(63) , wherein the DNA encoding said heavy chain polypeptide ,is׳ a DNA describedbelowin (a) , and the DNA encoding said light chain polypeptide, is a DNA as described .below' in (b): .

•35 (a) a DNA comprising the nucleotide sequence from nucleotides

.. .126 through. 419 according .to SEQ ID NO: 27, and ,.: ... :.>? '

WO 01/87981 PCT/.ΓΡΟ 1/()4035 . •24 (b) a DNA comprising the nucleotide sequence, from nucleotides

105 through 386 according to SEQ ID NO: 29.

(79) The genetic recombinant host of any one of (60) through .' • .(63) , wherein the DNA encoding said heavy chain polypeptide is the ' .5 DNA.described below in (a) , .and the DNA encoding said light chain polypeptide is the DNAdescribed below in (b): ׳ \ (a) . a DNA comprising .the nucleotide sequence from nucleotides through 1481 according to SEQ ID NO: 27, and ;. . .

(b) a DNA comprising the nucleotide sequence from nucleotides ׳ .10 . 39 through 749 according to SEQ ID NO: 29.

(80) The genetic'recombinant host of any one of (60) through (63) , wherein the DNA encoding said heavy chain polypeptide is the :) DNA described below in (a), and the DNA encoding said light chain ' . polypeptide is the DNA described. below'in (b):

. ¹⁵ (a) a.DNA comprising the nucleotide sequence from nucleotides־'

151 through. 441 according to SEQ ID NO: 31, .and (b) a DNA comprising the nucleotide. sequence from nucleotides .

through 375 V SEQ ID NO: 33. :

. (81) The genetic recombinant host of any one of (60) through ' 63) 20 ־ ) , wherein the DNA encoding said heavy , chain polypeptide is the ׳ _: DNA described below in (a) , and the DNA encoding said light chain . : polypeptide is the DNA.described below in (b):.

(a) a DNA comprising the nucleotide sequence from nucleotides .- 94 through 1506 according to SEQ ID NO: 31, and. '

25. (b) a DNA,comprising .the nucleotide sequence from nucleotides through 738 according to SEQ ID NO: 33. &lt;

(82) The genetic recombinant host of any one of (60) through (63) , wherein the DNA encoding said heavy chain polypeptide is the

DNA described below in (a) , and the DNA encoding said light chain polypeptide is the DNA described below in (b): ׳'׳' (a) a DNA comprising the nucleotide .sequence from nucleotides

153 through 443 according to SEQ ID NO: 35,. and' (b) . a DNA comprising the nucleotide sequence from nucleotides through 380 according to SEQ ID NO: 37. ׳ , ³⁵ (83) The genetic recombinant host of any one of (60) through (63), wherein, the DNA.encoding said heavy chain polypeptide. is the^: ' . .

WO 01/87981 PCT/JP01/04035

יי ' / ^: . 25 ;

DNA described below in (a) , and the DNA encoding said light chain. ' . polypeptide is the DNA described below in (b) : ' (a) a DNA comprising the nucleotide sequence from nucleotides .

through 1508 according to SEQ ID NO: 35,. and (b) . a DNA comprising. the nucleotide, sequence from nucleotides ' 33 through 743 according to SEQ ID NO: 37.

(84) A human monoclonal antibody or a portion thereof produced by a genetic recombinant host (provided excluding the case where said / host is a fertilized egg) of any one of (6.0) through .(62) , or of any. .^;10 one of (64) through (83) . -.

.(85)׳ A pharmaceutical composition comprising the'.^; human//./י antibody of .(1) or (2) , and a pharmaceutically acceptable carrier. . ״ (86) . A pharmaceutical composition comprising, the human ' monoclonal antibody or a portion thereof of any one of ;(3) to (42), / ׳ 15 and a pharmaceutically acceptable carrier. ' (87) A pharmaceutical composition comprising a human monoclonal antibody or a portion thereof of (84) , and a pharmaceutically acceptable, carrier. ' ./.

(88) The pharmaceutical composition of any one of (85) through /.

.20 (87) , wherein saidpharmttceutical composition is used to inhibit signal ׳ transduction into the cell mediated by AILIM.

(39) . The pharmaceutical composition of anyone of.(85 )through 87)׳) , wherein said pharmaceutical composition is used to prevent . proliferation of .AILIM-expressing cells.

²⁵ &lt;⁹⁰' The pharmaceutical composition of any one of (85) through (87), wherein said pharmaceutical composition is used to prevent . production of a cytokine from AILIM—expressing, cells.

(91) The pharmaceutical .composition of any one of (85) through .(87) , wherein said pharmaceutical composition is used to induce signal / transduction into a cell mediated by AILIM.

(92) The pharmaceutical composition.of any one of (85) through (87) , . wherein said pharmaceutical composition is.used to induce proliferation of AILIM-expressing cells. • (93) . The pharmaceutical composition of any one of (85) through 35 (87) , wherein said pharmaceutical composition is used to induce production of a cytokine from AILIM—expressing cells./ ;

WOOl/87981 PCT/JPO1 /04035 .'.''י ' 26 : י - ' ?

(94) The pharmaceutical composition of.any one of (85) ״through (87), wherein said pharmaceutical composition is used to induce antibody-dependent cytotoxicity against .י AILIM-expres sing. cells, . and/or.immune cytolysis or apoptosis of״ AILIM-expressing cells.

⁵ .(95) A pharmaceutical composition for preventing,treating, or prophylaxis of delayed type allergy, comprising a substance having an activity in .modulating signal transduction mediated by AILIM, and a pharmaceutically acceptable carrier.

(96) The pharmaceutical .composition of .(95), wherein the 10 substance is a protein substance.

(97) The pharmaceutical composition of. (96),, wherein the protein : substance is selected from the group consisting of:

a) an antibody which binds to AILIM pr a portion thereof; ׳.’

b) a polypeptide comprising the whole or a portion of ah.

extracellular region of AILIM; ' '

c) a fusion polypeptide comprising the whole or a portion of an extracellular region of AILIM, and the whole or a portion of a constant region of immunoglobulin heavy chain; and

d) a polypeptide which binds to AILIM.

²⁰ (98) The pharmaceutical composition.of (97)wherein.said :

antibody that binds .to AILIM is the human antibody ?of (1) or (2) (99) . The pharmaceutical composition of (97), wherein said . antibody that binds to AILIM is the human monoclonal antibody of . any one of (3) through (42).

²⁵ ' (100) The pharmaceutical composition of (97), wherein said antibody against AILIM is the human monoclonal antibody of (84) (101) The pharmaceutical composition of (95) , wherein the substance is a non-protein substance . . ' . (102) The pharmaceutical composition of (101), .wherein the^; non-protein substance is DNA, RNA, or a chemically synthesized compound.

(103) A method for identifying substances that bind to AILIM or AILIM ligand comprising the following processes: :

(a) preparing an insoluble . carrier on which the entire 35 extracellular, region of AILIM or a portion thereof is immobilized;

: (b) preparing a polypeptide comprising the whole extracellular .’- -;

WO 01/87981 PCT/JP01/04035 region of AILIM ligand or apportion thereof labeled with a. labeling ' material that emit a .detectable signal;

‘ (c) reacting the insoluble .carrier in process(a) with the. ׳.'. polypeptide in process (b) ;

³ ' (d) reacting the insoluble carrier of ״ process (a) , .the . polypeptide of process (b) and said substance.to each other, in any arbitrary orders;

(e) detecting the signal emitted from said. labeling material ' contained in the complex produced in process (c) , ahdthesignal emitted ': 10 from said labelingmaterial contained in the complex.produced in process (d), respectively; and (f) comparing the.magnitude of each of signals detected in .process (e) . ׳ .(104) A method for identifying substances that bind to AILIM or AILIM ligand comprising the following.processes :

(a) preparing an insoluble carrier on which the entire extracellular region of AILIM ligand or a. portion thereof ' is : immobilized;

..(b) preparing a polypeptide comprising the whole extracellular / region of AILIM.or a portion thereof labeled with a labeling material . that emit a detectable signal; . ..;/ (c) reacting the insoluble carrier in process (a) with the polypeptide .in process '(b) ; , (d) reacting the insoluble .carrier, of process (a) , the . ׳ 25 .polypeptide of process (b) and said substance to each other in any arbitrary orders; ./ (e.) detecting the signal emitted from said labeling material contained in the complex produced in process (c) , and the signal emitted' from said labeling material contained in the complex produced in process . (d), respectively; and (f) comparing the magnitude of each of signals detected in / process (e).

.(105) The method of (103) or (104) ,:wherein said polypeptide comprising the whole extracellular region of AILIM or a portion thereof 35 is a fusion polypeptide comprising a polypeptide, comprising the whole ¹extracellular region of .^AILIM or .a portion thereof,' and the whole

WO 01/87981 PCT/JP01/04035 . ' .28 constant region of immunoglobulin heavy chain .or a portion thereof.

(106) The method of (103) or (104) , wherein .said polypeptide comprising the whole extracellular region of AILIM ligand or a portionthereof is a fusion polypeptide comprising a polypeptide, comprising the whole extracellular region of AILIM ligand or. a portion thereof , and the whole constant region, of .immunoglobulin heavy chain or a portion ' -.thereof.

. (107) The method of any one of (103) through (106) , wherein said AILIM is a human AILIM. . .

¹⁰ . (108). The method- of any one of .(103) through (107) ,/wherein''

'.said AILIM ligand is a human AILIM ligand.:

The present inventions are described in. detail,herein below by defining terminologiesof the present invention.

Herein, mammal means human, bovine, goat, rabbit) mouse,rat, 15 hamster, and guinea pig; preferred is human, rabbit, rat, hamster, or mouse and particularly preferred is human, rat, hamster, or mouse.

The term mammals other than humans and non-human mammals used herein, are synomic to each other, meaning all mammals other, than humans defined above. ־.

. 2θ ' The term amino acids used herein, means every amino acid ’ existing in nature, preferably those described according to the ' alphabetical three letters system or single letter system as shown below:

./ glycine (Gly/G) , alanine (Ala/A) , valine : (Val/V.) , leucine ' 25״ (Leu/L), . isoleucin'e (Ile/I) , serine (Ser/S), threonine (Thr/T) , ' . aspartic acid )(Asp/D) , glutamic acid ' (Glu/E), asparagine (Asn/N).,. glutamine(Gln/Q) , lysine(Lys/K), arginine (Arg/R), cysteine (Cys/C), methionine (Met/M), phenylalanine (Phe/F), tyrosine' (Tyr/Y), . tryptophan (Trp/W) , histidine. (His/H), proline (Pro/P).

The term.AILIM used herein is the abbreviation for Activation Inducible Lymphocyte Immunomodulatory Molecule, indicating a mammalian cell surface molecule haying the structure and function ץ as already described in a previous report, more preferably a human-derived AILIM in particular (for example, International .

Immunology ,.Vol, 12, No. l,p. 51-55; GenBank Access ion Number: BAA82129 (human), BAA82128 (rat), BAA82127 (rat variant), and BAA82126 .

WO 01/87981 PCT/JPO1/04035

; '. יי':' ^; י . ־' '?' 29 י י' . . . . .

? (mouse)) .

Alternatively ,this AILIM is also referred to as I COS (Unexamined Published Japanese Patent Application (JP-A) No. Hei 11-29599, ' International Patent Application No. WO98/38216), and rhese 5. abbreviations indicate the same ,molecule.

.: AILIM ligand used.herein means, a gell. surface molecule which', interacts with said '.co-stimulatory' molecule AILIM (I.COS) ,.'׳ and is referred to as B7h, B7RP-1, GL50 or LICOS (Nature, Vol. 402, No. 6763, p.827-832, 1999 ; Nature Medicine, Vol. 5, No. 12, p.1365-1369, 1999 ; ' 10 J. Immunology, Vol; 164, p.1653-1657, .2000; Curr. Biol. Vol. 10, No?

6, p. 333-336, 2000) . &lt;:י.־?.-' .־. .

Moreover, AILIM' usedherein also includes a polypeptide having substantially the same amino acid sequence as that of AILIM of each.' mammal described in the references, and particularly preferably, that 15 . of human AILIM. Furthermore, a human AILIM variant which is similar׳ to the rat AILIM variant already reported (GenBank Accession Number: ? BAA82127) : is also included in AILIM of this invention.

AILIM ligand used herein is also defined .to have a similar meaning as above.

Herein, polypeptides having essentially identical amino acid.

sequence means variant polypeptides as described below.

That is, as long as these variant polypeptides have biological properties essentially equivalent, to the natural.type AILIM . (particularly preferably the human-derived AILIM), they are 25 polipeptides of this invention. : Like those havingamino acid sequence of the natural type AILIM, in which a plurality of amino acid residues, preferably 1 to 10 amino acid residues, most preferably Ito 5 amino acid residues are deleted and/or modified, and to which a plurality of amino acid residues, preferably 1 to 10 amino acid residues, most 30 preferably 1 to. 5 amino acid residues are added. .

Furthermore, they may be variant polypeptides having plurality of these substitution, deletion, modification and addition of amino acid residues in the molecule.

AILIMligand if1 this invention is also def ined to have a similar 35׳ meaning as above.

AILIM (particularly human AILIM) and AILIM ligand (particularly

WO 01/87981 PCT/JP01/04035 / ³⁰ :י'' ל' י ־ human AILIM ligand) in this invention can be prepared by, in addition to. gene recombinant technique, appropriately using well-known methods' in this technical field such as chemical synthesis method, cell culture method, etc. or these methods with modifications.

-צ .Such substitution, deletion, or insertion of amino.acids can be achieved according to the usual method (Experimental Medicine : SUPPLEMENT, Handbook of Genetic Engineering1992) ״); and so on). . .

. . . Examples of methods for producing mutant. polypeptides as mentioned above are synthetic oligonucleotide . 'site-directed10 mutagenesis (gapped duplex.method) , point mutagenesis by which a point mutation is introduced at random by treatment with nitrite or sulfite, the method by which a deletion mutant is prepared with Bal31 enzyme and.the like, cassette mutagenesis, linker scanning method, miss.

. incorporation method, mismatch primer method, DNA segment synthesis 15 . method, etc.

Synthetic oligonucleotide site-directed mutagenesis (gapped duplex method) can be, for example, performed as follows. The region desired to be mutagenized is cloiied into M13 phage vector having amber ;׳ .mutation.to prepare.the single-stranded phage ;DNA. After RF I DNA . 20 , of M13 vector without .amber .mutation is linearized,by .restriction. Ύ . enzyme treatment, DNA is mixed with the single-stranded phage DNA ‘ . mentioned above, denatured, and annealed thereby forming gapped' ., ' duplex DNA.״ . A synthetic oligonucleotide into which mutations,are ל . introduced is . hybridized with the gapped duplex DNA and the ;

..closed-circular double-stranded DNAs are prepared by. the reactions with DNA polymerase and DNA ligase. E. coli mutS cells, deficient in mismatch repair activity,. are transfected with.this.DNA. E. coli' cells without suppressor activity are infected with the grown phages, .. and only phages without amber.mutation are screened. .

3θ The method by which a point mutation is introduced with nitrite utilizes, for example the principle as mentioned below. If DNA is treated with nitrite, bases are deaminated to change adenine into -. hypoxanthine, .cytosine into uracil, and'guanine into xanthine. If deaminated DNA is introduced into cells-, A:T and G:C״ are replaced with G:C. and A:T״, respectively, because hypoxanthine, uracil, and xanthine form a base^pair with cytosine, adenine, and' thymine, ':׳ ־ . ׳ . ' ־ .a ן . .. . - ..., . ' ־

WO 01/87981 respectively, in the DNA replication. Actually, single-stranded DNA׳ fragments treated with nitrite .are hybridized with.gapped duplex.

DNA״, and. thereafter mutant strains.: are separated .by manipulating’/ in the same way as synthetic oligonucleotide site-directedmutagenesis (gapped duplex method).

In addition, AILIM herein also includes a portion of said AILIM. Herein', a portion means a polypeptide comprising any partial.

. ״sequence .of the above-defined AILIM amino acid sequence.

Preferably, said portion indicates the extracellular region .

of above-defined AILIM (particularly preferably a human AILIM) or any portion thereof. .

AILIM ligand״.in this invention is also defined to have a similar meaning as above.

Portion״ of said AILIM (preferably the extracellular region 15 of AILIM or any portion thereof) can be prepared according to well-known methods in this technical field as described below or according to their modified methods by genetic recombination technique or chemical ’ synthesis method, or by suitably, cleaving AILIM .(particularly pref erably a ' human AILIM) isolated by cell culture method using 20 proteolytic enzymes ,etc. ’

Portion of AILIM ligand can be also prepared by similar methods ' as. described above. ׳ '!Human antibody of ,this invention is a human antibody which ׳ . . binds to the above-defined AILIM or a portion, thereof (particularly 25 preferably a human-derivedAILIM or a portion thereof) . Specifically, it means a human—derived polyclonal antibody (human polyclonal antibody, human antiserum) or human—derivedmonoclonal antibody (human monoclonal antibody).

Human monoclonal antibody of this invention is a human 30 monoclonal antibody which binds .to the above-defined AILIM or a portion .thereof (particularly preferably a human-derived'AILIM or a portion thereof) . . '.'.'

More specifically, all the regions comprising.the variable.and . constant regions of the heavy chain (H-chain), and the variable and. 35 .constant ׳ regions of the light chain (L-chain) consist of human immunoglobulin derived from gene encoding said human immunoglobulin. :.'

WO.111/87981 PCT/JPO1/04035

' // ^ר .י' '³²

L-chain is .exemplified by human κ chain or human λ chain.

' Human monoclonal'antibody which binds to AILIM (particularly, pref erably.a human-derived AILIM) of this invention or a portion thereof is a human monoclonal antibody having characteristic defined in any of aforementioned (5). through (.42) or .(84) .

. More specifically, .it includes various' human, monoclonal: ’ . antibodies having . various characteristics .:. and industrial ;applicability as described in examples and drawings below.

A preferred embodiment of human monoclonal antibody of this invention is a human monoclonal antibody which binds to AILIM or a portion thereof defined in any of aforementioned (5) through .;(42) / /. ''/ or (84) . יי. ;.'./׳

Most pref erable embodiment is a human monoclonal antibody which׳ . binds to human AILIM-as. described ,in (30) or (39)., ///''.׳׳/.; ‘

Human monoclonal^-antibody, of .this invention can be prepared.

by immunizing following,transgenic non-human mammals producing human antibody with any of the immunogens (antigens) described below.

(a) a .natural cell or artificially established cell line expressing, aforementioned AILIM (particularly, preferably a human-derived AILIM) on the cell surface;

(b) a. genetic recombinant cell prepared using genetic recombination techniques so as to. express above-defined . AILIM ׳ (particularly preferably a human-derived AILIM) on the cell surface;׳ :

(c) a cell lysate obtainedby solubilizing cells aforementioned .25 in (a) or (b) , or a polypeptide fragment of AILIM (particularly ' . Preferably a.human-derived AILIM). purified from said .cell lysate;

(d) a genetic recombinant cell prepared' using genetic / .recombination techniques so as toexpress a portion (particularly preferably the extracellular region or any preferable peptide thereof) of above-defined AILIM (particularly preferably a human-derived AILIM) as a soluble polypeptide; .

(e) . a.culture supernatant obtained by culturing the genetic ׳^-׳ recombinant cell aforementioned in (d) , or .an extracellular region.

.polypeptide (soluble AILIM)^- of AILIM (particularly preferably a human-derived AILIM) purified from said culture supernatant; or . - .(f) . a portion ׳ (particularly . preferably the extracellular .

־ WO 01/87981 . PCT/JP01/04035

' ': / . . 33 . ־ . ? ' region or any preferable peptide thereof) of . chemically synthesized . AILIM (particularly.preferably a human-derived AILIM).

.Furthermore, monoclonal antibody.of this.invention .can be also • obtained from culture supernatant by culturing a genetic recombinant . host [herein; .said host is an eukaryotic cell other than fertilized eggs (preferably mammalian cells such as CHO, lymphocytes, and myeloma :

• cells).]., which can be prepared by transforming a host with cDNAs . .(preferably a vector containing.said cDNAs) encoding each of the heavy. . . and light chains of such a humanmonoclonal antibody of this invention 10 using genetic recombination techniques , and which produces genetic . recombinant human monoclonal antibody.

Specifically, the monoclonal antibody of this, invention can be obtained by culturing genetic recombinant host described in any ׳ '. of aforementioned (60) through (62) or (64) through (80) of this 15 invention . (herein, ׳ said host is an .eukaryotic cell other'than a fertilized-egg (preferably mammalian cells such as CHO, lymphocytes, i and myeloma cells) )'. . .

In addition, human monoclonal antibody.of this invention may׳ be a human monoclonal antibody having any isotype belonging to IgG 20 (IgGl, IgG2, IgG3 and’lgG4), IgH, IgA (IgAl and IgA2), IgD.or IgE.

Preferably, said.monoclonal antibody belongs to IgG (IgGl, IgG2, IgG3 and IgG4), more preferably IgGl, IgG2 or IgG4.

.Human monoclonal antibody of this invention can.be prepared .by immunizing transgenic non-human mammal producing human antibody. / 25 such as human׳ antibody-producing transgenic mouse described below .

׳. with any of the immunogens (antigens) aforementioned in (a) through • (f) according to known commonly used manufacturing method.

That is, for example, said transgenic non-human mammal producing human antibody is immunized with said antigen in combination with 30 Freund's adjuvant as the occasion demands. Polyclonal antibody can be obtained from sera collected from said immunized animal. Monoclonal' antibody can be manufactured by preparing fusion cells (hybridomas) .from said antibody-producing cells isolated from said immunized animal andmyeloma cells with no autoantibody-producing ability,. and cloning )5. said hybridomas. to select a clone producing the monoclonal antibody • with a specific affinity to the antigen used for immunizing the mammal;

. WOD1/87981 /. PCT/JP01/04035

' ' ׳ ' . ³⁴

More specifically, monoclonal antibody can be prepared as . .^; described below. That is, said human antibody-producing transgenic. ׳. non-human mammal (particularly preferably human antibody-producing ' transgenic mouse״) is immunized by injecting any of the immunogens aforementioned in (a) through .(c) intradermally, intramuscularly, . .

intravenously, into the footpad, or intraperitoneally once to several .'.times, or transplanting said .immunogen into said mammal.׳ Usually',/ ‘.

. immunizations are performed once, to four times every one to fourteen' , days after the first immunization. Antibody-producing cells are obtained from the.mammal so immunized in about one to five days after the last immunization.' 'The frequency and interval of immunizations /can be appropriately arranged depending on, e.g., property of the.

immunogen used. ' '.;;&lt;

Hybridomas . that‘ secrete a human monoclonal antibody can׳be' ' . ,15 prepared by the method of :Kohler and Milstein .(Nature, Vol.256, • pp.495-497 . (1975) ) and by its modified method. Namely, hybridomas : are prepared by fusing.antibody-producing cells .contained in a spleen, .lymph, node, .bone- marrow., or tonsil .'obtained from. the. human . antibody-producing transgenic non-human mammal immunized as mentioned . above, preferably ., a spleen, ' with myelomas without autoantibody-producing ability, which are derived from, preferably, ' . .

. a mammal such as a mouse, rat, guinea pig, hamster, rabbit, or human, /'/'־׳ or more preferably, a mouse, rat, or human. . .

For example, mouse-derived myeloma P3/X63-AG8.653 (ATCC No.

CRL-1580) , P3/NSI/l-Ag4-l (NS-1), P3/X63-Ag8.U׳l (P3U1),. SP2/0-Agl4 . (Spz./0, Sp2) , NSO, PAI, F0, or BW5147, rat-derived myeloma 210RCY3-Ag. 2.3 . ,׳or human-derived myeloma U-266AR1, GM1500-6TG-A1-2 , UC729-6, CEM-AGR, D1R11, or CEM-T15 can be used as a myeloma used for the cell fusion.'' ³θ Cells producingmonoclonal antibodies (for example, hybridomas) can be screened by cultivating the cells, for example, in microtiter . plates and by measuring the reactivity of the culture supernatant ^; in the. well in which hybridoma growth is observed, to the immunogen used for the immunization mentioned above, for example, by enzyme immunoassay such as radio immunoassay (RIA) and enzyme-linked׳?׳. ׳/ immuno-solvent assay (ELISA) . .

י WO 01/87981 PCT/JP01/04035

'ל '. ' , ' 35 . The monoclonal antibodies can be produced from hybridomas by cultivating the hybridomas in vitro or in vivo such as in the ascites fluid of a mouse, rat, guinea pig/ hamster, or rabbit, preferably a mouse or rat, more preferably moused and isolating the antibodies' • 5 from the resulting the culture supernatant or ascites fluid of a mammal.

Monoclonal antibodies of this invention can be manufactured on a large scale by the following method: .

(1) genes (cDNAs, etc.) encoding .each □f the'heavy and light'X chains of said monoclonal antibody are. cloned from said hybridomas; X Χθ .. (2) cloned genes encoding each of the heavy and light. chains are inserted into separate vectors or a single vector to prepare the • expression vector;

. (3) said expression vector is transferred into a fertilised, egg of a desired non-human mammal (such.as goat);

¹5 (4) said fertilized egg transferred with the gene is transplanted into the uterus of a foster mother to obtain a chimeric' • non-human animal;

.(5) by further mating said chimeric goat with another non-human mammal, a transgenic non-human mammal (cattle, goat, sheep or swine) ^:20 with genes encoding each of said heavy and light chains incorporated: : into the endogenous gene is produced; and . (.6) from the milk of said transgenic .,non-human mammal, .monoclonal antibody derived from said human monoclonal antibody gene is obtained.on a large scale (Nikkei Science, April, 1997, p.78-84).

²⁵ Cultivating in vitro the cells producing the monoclonal antibodies can be performed depending on, e.g. , the property of cells י to be cultured,׳ the object of a test study, and the various conditions of a cultivating method, by using known nutrient media.or any nutrient media derived from known basal media for growing, maintaining, and storing the hybridomas to produce monoclonal antibodies in culture .supernatant. . . . !

Examples of basal media are low calcium concentration media such as Ham'F12 medium, MCDB153 medium, or low calcium concentration . MEM medium, and high calcium concentration media such as MCDB10 4 medium, .

:MEMmedium,D-MEM medium, RPMI 1640 medium, ASF104 medium, or RD medium. '? The basal media can contain, for example, sera, hormones, cytokines, .

WOOl/87981 PCT/JPOl/04035 ' ' . 36 and/or various inorganic or organic substances dependingon the objective.

Monoclonal antibodies can be isolated and ,purified from the culture supernatant or ascites fluid mentioned above by saturated ammonium sulfate precipitation, euglobulin precipitation method, , caproic acidmethod,, caprylic acidmethod, ion exchange chromatography ״ (DEAE or DE52) , affinity chromatography using anti-imrr.unoglobulin . column or protein A,column.

Human monoclonal antibody of this invention includes human 10 monoclonal antibodies consisting of the heavy chain .and/or light chain of which .amino acid sequence for .each chain have one or more amino . , acid residues deleted, substituted or added. '

Herein, more amino acid, residues״ means a plurality of. amino ' ^!: acids, specifically 1 to .10 amino acid residues, preferably 1. to 5 / 15 amino acid residues.

A partial modification.(deletion, substitution, insertion or addition) as described above can be .introduced into the amino acid sequence of human monoclonal antibody of this invention by partial . alteration of base sequence encoding said amino acid sequence. This, 20 partial alteration of base sequence can be introduced by'standard method using known site-specific mutagenesis technique (Proc. Natl( ~ . . Acad. Sci. USA, Vol. 81, p.5662-5666, 1984).

. Transgenic human antibody-producing non-human mammal״, particularly, human antibody-producing transgenic mouse which is a. :25 . preferred embodiment, . can be prepared according to pnbl i ־ ..literature (Nature Genetics, Vol; 7, p.13-21, 1994;.Nature Genetics, . Vol. 15, ,p.146-156, 1997; Published Japanese .Translation of , International Publication No. Hei 4-504365; Published Japanese . Translation of Publication No. Hei 7-509137; Nikkei Science, June, ³⁰ p.40-50, 1995; International Patent. Publication No. WO9.4/25585;.

. Nature, Vol. 368, p. 856-859 , 1994; and Published Japanese Translation of. Publication No. Hei 6-500233, etc.)

Specifically, said human antibody-producing transgenic mice ' can be prepared, for example, using techniques consisting of the .

3.5 following processes: ׳ ' . :

.(1) preparing a knockout mousewhich endogenous immunoglobulin

ל '. י-.'. . . . ל . י

WO 01/87981 PCT/JP01/D4035 .י' 37 י' ' . י ' X ' ' י .׳.. . . . . .׳ . ¹ . ־ י' . . . . . י . . . ' X ' . י x '.,י' heavy chain gene is functionally inactivated by substituting at least : a portion of gene locus of the mouse endogenous immunoglobulin heavy '׳ chain with a.drug tolerance marker gene (such as neomycin tolerance ^; ' 1 gene) by homologous recombination;

. (2) preparing a.knockout mouse which endogenous immunoglobulin ׳ light chain gene (particularly the K->,chain'.gene) is functionally : inactivated by substituting at least a portion of gene locus of the mouse endogenous immunoglobulin light chain with a drug tolerance '־' marker . gene (such as . neomycin tolerance gene) by homologous . ' recombination;. ';.

;(3) preparing a .transgenic mouse, which desired’region of ,the' . human immunoglobulin heavy chain gene locus is incorporated into the ¹׳ mouse chromosome using a vector represented by the yeast artificial ;: X chromosome (YAC) . capable of carrying a giant gene;. ' >

: (4) preparing a transgenic mouse which desired region of the human immunoglobulin light chain gene locus (particularly the K chain ,. gene) is incorporated into the mouse chromosome using a vector represented by the yeast artificial chromosome (YAC) capable of .: carrying a giant gene; and

2θ (5) preparing a transgenic mouse, which endogenous . :.' . ' . immunoglobulin heavy and light chains gene loci are both functionally inactivated and which .chromosome is incorporated with the desired regionsof both of the human immunoglobulin heavy and light chains gene loci by mating knockout and transgenic mice aforementioned in ., .25 (1) through (4) .in :arbitrary orders.'

The above-described ',knockout mouse can be prepared by. substituting the suitable region of ׳ the mouse .endogenous immunoglobulin gene locus with a foreign marker gene (such as neomycin . ‘ tolerance gene) based on homologous recombination to inactivate said gene locus so as not to be rearranged. For the inactivation using ' said homologous recombination, for example,'a method referred to as .' positive negative selection (PNS) can be used (Nikkei Science, May, P • 52-62 , 1994)X .־.:

Functional inactivation of the immunoglobulin heavy chain gene ’.ל locus can be achieved, for. example, by introducing a lesion into a . part of the J- or C-region (for. example, Cg region) . And functional ׳ י \ י, י י. י י י ׳. י י. . .' <’ . ; . י י . _ר . יל ‘ , . ,, .' '' ל. ' ⁰'‘י* י r ** י > *,י'^,״ . . ^r י .*4 - י . . i‘ *r ΐ! I, ־ ־ ׳«fl _ י.^,,' .1> .י’¹ י ץ* י ) . «,. ־־ V ^,*.'.ו . \ . . V י, ך ϊί ׳ Ά J' י *« י k(*' י * .'¹.יי*'*‘ ׳ י » t! , ^{1 f} ) . ! *! , '* »»,«’,*.,.. '־ >' יי ־׳ . ־..;..:'- ; :-.Λ:.;'.':.. ־.' :׳.' ’ ־ י.Λ: ..,U; ,;,. י?,,. '.׳. י.'״ :- י י.;:;. .,׳>,.; ׳׳

WO 01/87981 PCT/JP01/04035

. ' .7 ' '. . . , 38 י.'..

inactivation.of the immunoglobulin light chain (for. example, K chain) . can be achieved, for example, by introducing a lesion into a part.

' . of J- or C-region, or a region extending over J-. and.C-regions. ' A transgenic mouse can be prepared according to the method as usually used for producing a transgenic animal (for example, see Newest

Manual of Animal Cell Experiment״, LIC press, Chapter'7, pp.361-408,' (1990)). Specifically, for example, the .HPRT-negative ' (hypoxanthine-guanine phosphoribosyltransferase gene'deficient) ES cell (embryonic .stem cell) derived from'a .normal.mouse blastocyst 1.0 . .is fused with yeast containing the YAC vector inserted with the geneencoding said human immunoglobulin heavy chain/gene locus or light! chain gene locus or a portion thereof and the HPRT gene using spheroclast . fusion method. ES cells whose mouse endogenous gene is integrated with said foreign gene are selected by HAT selection method. Then,

15. the ES cells screened are microinjected into a fertilized egg obtained ' from another normal mouse (blastocyst) (Proc. Natl. Acad. Sci. USA, ,Vol.77, No.12, pp.73.80-7384 (1980) ; U.S. Pat. No. 4,873,191) . The . blastocyst is .transplanted into, the .uterus of another normal mouse as the foster mother. Then, chimeric transgenic mice are born from ^: . the foster mother mouse. By mating the chimeric transgenic mice with .normal mice, heterogeneic transgenic mice, are obtained. . By mating . the heterogeneic transgenic mice with .each other, homogeneic transgenic mice are obtained according to Mendel׳s laws.

The portion of a monoclonal antibody used in the present 25 invention means .a׳ partial region of the above-mentioned human monoclonal antibody of the present invention, and specifically, includes. F (ab2 (׳, Fab׳, Fab, Fv (variable fragment of antibody) , sFv, dsFv (disulfide stabilized Fv) , or. dAb (single domain antibody) (Exp. Opin. Ther. Patents, Vol.6, No.5, pp.441-456 (1996)).

F (ab ״2 (׳ and Fab ״׳ can be produced by treating immunoglobulin (monoclonal antibody) with a protease such as. pepsin and papain, and means an antibody fragment generated by digesting immunoglobulin near the disulfide bonds in the hinge regions existing.between each of the two H chains. For example, papain cleaves IgG upstream of the 35 disulfide bonds in the hinge regions existing between .each, of the . two H chains to generate two homologous antibody fragments in which

WO 01/87981 PCT/iPOl/04035

.. 39 .. ־.' . .

..an.L chain composed of V! (L chain variable region) and C_L (L chain constant region)׳, and an H.chain fragment composed of V_H (H chain variable region) and .C_Hyi (yl region in the constant region .of H chain) are connected at .their C terminal regions through a disulfide bond. Each . 5 of such two homologous'antibody fragments is called Fab ׳. Pepsin also ..cleaves IgG downstream of the disulfide bonds in the'hinge regions existing between each of the two H chains to generate an antibody V fragment slightly׳ larger than the fragment in which the two above-mentioned Fab ׳. are connected at the hinge region. This antibody ' 10 fragment is called.F(ab2(׳.

Binding rate constant (ka)״ herein means a value indicating' --סרט binding strength (degree) of said monoclonal antibody to the target antigen calculated based on the antibody antigen reaction kinetics. ?

. Dissociation .rate ;constant (kd) .״. means, a value .indicating the '׳ 15 .dissociation strength. (degree) of said monoclonal antibody from the .

target antigen. Dissociation constant (Kd) ״ is a value obtained by dividing said dissociation rate constant (kd) ״ by said binding rate constant (ka) value. ,These constants are used to represent the affinity of said monoclonal antibody to antigen and its activity to 20 neutralize antigen. , . Said constants can be analyzed according to various methods,. . and can be easily analyzed using a commercial assay kit BiacoreX ^:(Amersham.Pharmacia) or a similar kit according to.the manual and experimental method attached to saidkit. ka, kd and Kd values obtained ¹.25. using said kit are expressed in 1/M.Sec,^: 1/Sec and M (mol) units, J respectively. .Higher ka values indicate stronger antigen binding activity, of monoclonal antibody tested,'and smaller Kd values show stronger antigen neutralizing activity of antibody.

Human monoclonal antibody of this invention includes those 30 having the ka, kd or Kd value as shown in following (1) through (3) : .

(1) human monoclonal antibody which binds to human AILIM or . a portion thereof with the binding rate constant (ka) of 1.0 x 1.0⁴ (1/M. Sec) or more,. preferably 1.0 x 10^s (1/M^ Sec) or more. . .

• (2) human monoclonal antibody which binds to human AILIM or ' 35. a portion thereof with, the dissociation rate constant (kd). of'1.0 .

. X 101) . ⁴־/Sec) or less, pref erably 1,0 x 101) ⁵־/Sec) or less. ־

WO 01/87981 PCT/JPOl/04035 . י'; '.־ 40 ׳, (3) human monoclonal antibody which has a׳ reactivity to human AILIM or a portion thereof with the dissociation constant (Kd) of l.OxlO⁷־ (M).or less, preferably 1.0 xlO⁸־(M) or less andmorepreferably 1.0 x 10⁹־ (M) or less.

In this case, each value of ka, kd and Kd described׳ above is״ expected to slightly fluctuate .depending on various conditions at the time of measurement with a margin of error but with practically nofluctuation in indexes in general. &lt;

Monoclonal antibody—producing cell׳ or genetic recombinant׳ 10 human monoclonal antibody-producing genetic recombinant host of this invention (herein, said host is a cell excluding fertilized egg) . means any cell producing aforementioned human monoclonal antibody of this invention.

Specifically, for example, it includes cells described in any; ׳ .15. of following (1) through (3) , but״ is not limited to them:

.(1) human monoclonal antibody-producing B cell obtained by immunizing aforementioned human antibody-producing transgenic non-human mammal with the above—defined immunogen (antigen) and , collecting the cell from said immunized animal.

' . (2) aforementioned fusion cell (hybridoma) resulted by fusion of the.human monoclonal antibody-producing B cell thus obtained with a myeloma cell derived from mammal.

(3) genetic recombinant human monoclonal antibody-producing 7 genetic recombinant cell obtained by. transforming a cell excluding .

said B cell and.hybridoma (for example, CHO (Chinese hamster ovarian) ^celi׳ .BHK fbaby hamster kidney) cell, lymphocyte such as myeloma) . with the gene encoding said human monoclonal antibody (gene encoding the heavy chain or that encoding the light chain, orboth genes) isolated '-' from said human monoclonal antibody-producing B cell or, human

3.0 monoclonal antibody-producing fusion cell (hybridoma).

Herein, the genetic . recombinant human monoclonal antibody-producing genetic recombinant cellaforementioned in (3) namely means a .genetic recombinant cell producing the genetic . recombinant of human monoclonal antibody generated by the B cell 35 .described above in (1) orthe hybridoma aforementioned in (2). ;

And, host in genetic recombinant host of this., invention '.

WO 01/87981 PCT/JPO1/04035 .

'ל ' -'-⁰ ל / ' ⁴¹ יי י י ־includes, in addition to various mammalian cells as described above, :.

: fertilized eggs of any non-human mammals, (goat, swine, sheep, .cattle, ' .

etc.). By transferring a gene (gene encoding the heavy chain or that' encoding the light chain, or both genes) .encoding any monoclonal :

antibody (preferably human monoclonal antibody) to human AILIM:of this invention into this fertilized egg, a genetic' recombinant fertilized egg of this invention canbe obtained. This 'generic recombinant fertilized egg is used to prepare transgenic animals for.

. manufacturing the aforementioned protein from the milk on a large ./scale (Nikkei Science, April, 1997, p.78-84). ' . (

A substance ,composing, the present invention,'?specifically .' /?'ל.־ יי a substance having an activity in modulating the signal transduction⁷ .mediated by AILIM, and more, specifically a substance having an ^; 1 activity in inhibiting proliferation of AILIM-expressing cells, or ^Λ,;^; in inhibiting production of. a cytokine,by AILIM-expressing cells״ .

• means a natural substance present in.the nature, or a artificially prepared arbitrary substance.

Substance related to substance, binding to AILIN'׳ and substance binding to AILIM ligand herein also means any.natural . substance in nature or any artificially prepared substance.. ..,;

. . Here, the, signal transduction mediated by. AILIM means the . . signal transduction through AILIM, leading to a change of an arbitrary :phenotype in the. AILIM-expressing cells : (cell׳ proliferation, '. activation of cells, inactivation of cells, apoptosis, and/or a change of an ability for producing an arbitrary cytokine from AILIM-expressing cells).

The substance can be mainly, classified into a protein, substance and a .non-protein׳substance.

Examples of the protein substances are the following . } . polypeptide, antibody (a polyclonal antibody, a monoclonal antibody, • or a portion of a monoclonal antibody, and particularly preferably :the human antibody mentioned above).

When the. substance, is an antibody, the substance is preferably a monoclonal antibody . . When the substance is a monoclonal antibody, . .35 the substance includes, not only a non-human mammal derived monoclonal • 1. . ¹ . . ׳.

antibody, but also a recombinant chimeric monoclonal antibody,.׳ a

WO 01/87981 PCT/JP01/04035

י' ’ . / ' 42 .recombinant humanized monoclonal antibody and human monoclonal . antibody. '

Here, the recombinant chimeric monoclonal antibody is a monoclonal antibody prepared by genetic engineering, and specifically ' 5 means a chimeric antibody such as mouse/human chimeric monoclonal . antibody whose variable regions are .derived from immunoglobulin of ' an non-human mammal (mouse,־ rat, hamster, .etc.'.) '.and whose constant regions are derived from human immunoglobulin.

The humanized monoclonal antibody (CDR-grafted antibody) ״ of 10 the present invention'is a monoclonal antibody prepared by genetic engineering and specifically means a humanized monoclonal antibody־׳ wherein a portion or the whole of the complementarity determining . regions of the hypervariable region are derived from the complementarity determining regions of the hypervariable region from' G 15 a monoclonal antibody of an non-human mammal (mouse, rat, hamster, ׳ ' etc. ) , the framework regions of the variable region.are derived from the framework regions of the variable region from human immunoglobulin, and the .constant region is derived from human a constant region from immunoglobulin. . ׳ ׳ , The complementarity determining regions of the hypervariable ., region exists in the hypervariable region in the variable region of ’ an antibody and means three regions which directly and complementary : ’ binds to an antigen (complementarity-determining residues, CDR1, CDR2, and CDR3). The framework regions of the variable region mean four 25 comparatively conservedregions lying upstream, downstream or between the three complementarity determining regions (framework region, FR1 ,.: . FR2 ,. FR3 , and FR4) . .

In other words, a humanized monoclonal antibody means that in. wh'ich all the regions except a portion or the . whole of the 30 complementarity determining regions of the hypervariable regionof anon-human mammal—derived monoclonal antibody have been replaced with their corresponding regions derived from a human immunoglobulin.

The constant; region derived from human immunoglobulin has the amino acid sequence inherent in each isotype such as IgG (IgGl, IgG2, 35 IgG3, IgG4) , IgM, IgA, IgD, and IgE. The constant region of a humanized • monoclonal antibody in tjie present invention can be. that from human ^:

WO 01/87981 PCT/JPO1/04035 ⁴³ ’. : ''.'.' immunoglobulin belonging to any isotype. . Preferably, it is the constant region of human IgG.' The framework, regions of the constant region derived from human immunoglobulin are not particularly limited.

When the substance of the present invention is a.polypeptide, ׳ the substance includes the following polypeptide, a fragment of the ''. polypeptide (an oligopeptide), a fusion polypeptide, a chemically' ^;' modified one thereof. .Examples of an oligopeptide are a peptide comprising.5 to 30 amino acids, preferably 5 to 20 amino acids. The / ! .chemical modification can be designed depending on various purposes’ .¹⁰י for example, the,., increased half-life' in ..blood in the case of'.

. administering in vivo, or the increased . tolerance against' the degradation or increased absorption in digestive tract at the oral .

.'administration.''

Examples of the polypeptide are as follows: ־ . (1) Apolypeptide comprising the whole or a portion of an extracellular . . region of AILIM;.

. (2) A fusion polypeptide comprising the whole or-a portion of an ׳ extracellular region of AILIM and the whole or a portion of. a constant region of immunoglobulin heavy chain; or׳ .20 (3) A polypeptide which binds to AILIM. .׳

Examples, of.,.the non-protein״ are. DNA> RNA, and .a.chemically : : ^,‘י synthesized compound.;׳

Here, DNA״ means DNA comprising a partial nucleotide sequence ' . of the DNA or chemically modified DNA thereof ״ useful as an antisense 25 DNA pharmaceutical designed based on a nucleotide sequence of DNA (including cDNA and genomic DNA) encoding the above AILIM (preferably.

. .human AILIM) . Specifically the '.antisense DNA ' can inhibit transcription of DNA encoding the AILIM into mRNA, or translation of the mRNA into a protein by .hybridizing DNA or RNA encoding AILIM. , . ³θ The partial nucleotide sequence as referred to here indicates a partial nucleotide sequence comprising an arbitrary number.of , nucleotides in an arbitrary region. The partial nucleotide sequence consists of. 5 to 100 consecutive nucleotides, preferably 5 to 70 ;.

. consecutive nucleotides, more, preferably 5 to 50 consecutive nucleotides, and Stillmore preferably 5 to 30 consecutive nucleotides

When the DNA is used as an antisense DNA pharmaceutical, the'

WO 01/87981 PCT/JP01/04035

.׳, ; ' . . 44 .' .

DNA sequence can.be modified chemically in part for extending the half-life (stability) of the blood concentration of .׳ the .DNA . administered to^ patients, for increasing the intracytoplasmic-membrane permeability of the DNA, or for increasing 5 the degradation resistance or.the absorption of the orally administered . DNA in the digestive.organs. The! chemical modification includes, for example, the modification of the phosphate bonds, the.riboses, the . nucleotide bases,'the sugar moiety, the .3 ״ end and/or the 5' end in the structure .of the oligonucleotide DNA/ / . The modification of phosphate bond includes, for. .example > the conversion of one or more of the bonds to phosphodiester bonds (D-oligo) , phosphorothioate bonds, phosphorodithioate bonds (S-oligo) , methyl phosphonate (MP-oligo) , phosphoroamidate bonds,. non-phasphate bonds or methyl phosphonothioate bonds, or combinations thereof. The 15 modification of the ribose includes, for. example, the conversion to.

^,-fluororibose or 2 ^,-O-methylribose. The modification of the. nucleotide base includes, for example, the . conversion to . 5-propynyluracil or 2-aminoadenine. יי

Here, RNA means RNA comprising a partial nucleotide sequence I 20 ' of the RNA or chemically modified RNA thereof״ useful as an antisense RNA pharmaceutical designed based on a nucleotide sequence of' RNA׳ encoding the above AILIM (preferably human AILIM) . The antisense RNA . can inhibit transcription of DNA encoding the AILIM into mRNA, or . translation of themRNAintodproteinby.hybridizingDNAorRNAencoding' 25 AILIM. .־.'.־.'.

The partial nucleotide sequence as referred to here indicates a partial nucleotide sequence comprising an arbitrary number of . nucleotides in an arbitrary region. The partial nucleotide sequence consists of 5 to 100 consecutive nucleotides, preferably 5 to 70 30 consecutive ' nucleotides, more preferably 5 to 50 consecutive, nucleotides , and still more preferably 5 to 30 consecutive nucleotides .

The sequence of antisense RNA can be modified chemically in' part for extending the half-life (stability) of the blood concentration of the RNA administered to patients, for' increasing the 35 intracytoplasmic-membrane permeability of the RNA, or for increasing the degradation resistance or the absorption of the orally administered

WO 01/87981 . PCT/JP01/04035

/-,/ . . ' .45 ־ י .י . • .RNA in the digestive'organ. An example',.of .chemical modification is the chemical modification applied to the. above antisense DNA׳..

. Examples of a chemically synthesized compound״ are an arbitrary compound except for the above DNA, RNA. and protein substances , having .

the molecular weight of about 100 to about 1000, preferably a compound having the molecular weight of about .100 to about 800 , and more' preferably the. molecular weight of about .100 to about 600 .׳/;' ־

A polypeptide included in the definition . of . the above. .: substance means a portion (a fragment) of a polypeptide chain .10 constituting AILIM (preferably human AILIM) , preferably the whole .. or a portion of an extracellular region of the polypeptide constituting . AILIM (1 to 5 amino, acids may be optionally added into the N-t.erminus '. . _;and/or C-terminus of the .region) . .׳ .'

AILIM involving in the present invention is a transmembrane .

molecule penetrating cell membrane, comprising 1 or 2 polypeptide .. chains. ' .'׳

Here, a.transmembrane.protein״ means a protein that connects ' ן . with membrane through the hydrophobic peptide region penetrating the lipid bilayer of the membrane once or several times and whose structure

20. is, as a whole, composed of three main regions, that is, extracellular region, .transmembrane region, and cytoplasmic region, as seen in many receptors or cell surface molecules. . Such a transmembrane protein . .

constitutes each receptor or cell surface'molecule in :the form of . / / a monomer, homodimer, heterodimer or oligomer with another chain(s) .25 having the same or different amino acid sequence.

Here, an extracellular region״ means the whole or a portion from the partial structure (partial region) ,from the entire structure of. the above-mentioned transmembrane protein ׳ where the. partial structure exists outside of the membrane. In other words, it means the whole or a portion of the region of the transmembrane protein except the region incorporated into the membrane (transmembrane region) and the region existing in .,.the cytoplasm: following . the transmembrane'.region' (cytoplasmic region) .

A fusionpolypeptide״ included in the above protein substance״ :

means a fusion polypeptide comprising the whole or a portion of an' ' . extracellular region of a polypeptide constituting AILIM׳ (preferably ¹

WOOl/87981 PCT׳JP01/04()35 ? 46 ? ' \ ' human AILIM) , and .the whole or a portion of .’a constant region of ' immunoglobulin heavy chain. (Ig, preferably human Ig) ״. Preferably, the fusion polypeptide is a fusion polypeptide with an extracellular region of AILIM and a portion of a constant region of human IgG heavy i chain and particularly preferably, a fusion .:polypeptide ofan.' extracellular region of AILIM and a region (Fc) of human IgG heavy chain comprising a hinge-region, CH2 domain and CH3 domain. As IgG,? IgGl is preferable, and as AILIM, human, mouse, or rat AILIM is .preferable (preferably human).

The whole or a :portion of a constant region of human' immunoglobulin (Ig) heavy chain used herein means.the constant region ' or. the Fc region of human-derived immunoglobulin heavy chain (H chain) as described, or a portion thereof. The immunoglobulin can be any? .

immunoglobulinbelonging to any class and any subclass. Specifically,' .15 examples of the immunoglobulin are IgG (IgGl, IgG2,IgG3, and IgG4) ,׳ ;׳

IgM, IgA (IgAl and IgA2) , IgD, andlgE. Preferably, the immunoglobulin is IgG (IgGl, IgG2, IgG3 , or IgG4) , or IgM. Examples of particularly. ׳' pref erable immunoglobulin of the present invention are those belonging to- human-derived IgG (IgGl , IgG2 , . IgG3? or IgG4) . ?

. Immunoglobulin.has a Y-shaped structural unit in which four chains composed of two homologous light chains (L chains) and two homologous heavy chains (H chains)' are connected through disulfide ־ ?

? bonds (S-S bonds).; The. light- chain is composed of the light chain . variable .region (VJ. and the . light chain constant region (C_L) . The

25. heavy chain is composed of the heavy chain variable region .(V_a) and the heavy chain .constant region (C_B) .

The heavy chain constant region׳ is composed of some domains having the amino acid sequences inherent in each class (IgG, IgM, IgA, IgD, and IgE) and each subclass (IgGl, IgG2, IgG3, and IgG4? .

IgAl,. and IgA2) ..

The heavy chain of IgG (IgGl, IgG2,. IgG3, and IgG4) is composed of V_a, CHI domain, hinge region, CH2 domain, and CH3. domain in this ׳ order from N terminus.

Similarly, the heavy chain Of IgGl is composed of V_a, cy!l domain, . ' hinge region, Cy!2 domain, and 0γ!3 domain in this order fromN terminus .

. ^The .^heavy. chain of IgG2 is composed ,of V_H, C־f₂l domain, hinge region, ׳

WO 01/87981 PCT/JP01/04035

G/22 domain, and 0γ₂3 domain in.this order from N terminus. ׳ The heavy . chain of IgG3 is composed of V_B, Cy₃l domain, hinge region, Cy₃2 domain, and Cy₃3 domain in this, order from N terminus. The heavy chain of IgG.4 is composed of V_H0 _׳γ₄1 domain, hinge, region, Cy₄2 domain, and’ -0/43,. צ domain in this order from N terminus.

Theheavychainof IgA is composed of V_B, Cal domain, hinge region ,

Ca2 .domain, and Ca3 domain in this order from N terminus.

Similarly, the heavy chain of IgAl is composed of V_H, Ca!l domain, hinge region, Ca!2 domain, and Ca!3 domain in this order fromN terminus.

The heavy chain of IgA2 is composed of V_B, Ca₂l domain, hinge region, Ca₂2 domain, and Ca₂3 domain in this order from N terminus׳.

. The heavy chain of IgD is composed of V_a, c51 domain, hinge region, C52 domain, and C53 domain in this order from N terminus.

The heavy chain of IgM is composed of V_H, Όμΐ domain,Χμ2 domain, 15 Cg3 domain, and 0μ4 domain in this order from N terminus and have no hinge region as seen in IgG, IgA, and IgD.

The heavy chain of IgE is composed of V_B, C81 domain, Cs2 domain., C£3 domain, and C£4domain in this .order from N terminus and have no hinge region as seen in IgG, IgA, and IgD.

’2° If, for example, IgG is treated with papain, it is cleaved, at the slightly N .-terminal side beyond the disulfide bonds existing in the hinge region where, the disulf ide bonds connect the two heavy chains to generate two homologous Fab, in which aheavy chain fragment composed of V_B and CHI is connected with one light chain through a disulfide.

bond, and one Ec, in which two homologous heavy chain fragments composed of the hinge region, CH2 domain, .and CH3 domain are connected through disulfide bonds (See Immunology Illustrated, original 2nd ed., Nankodo,. pp.65-75 .(1992); and Focus of Newest Medical Science 'Recognition Mechanism of Immune System״׳, Nankodo, pp.4-7 ,(1991) ;

30. and so on) ..

Namely, a portion of a constant region of immunoglobulin heavy chain mentioned above means a portion of a constant region of an immunoglobulin heavy chain having the structural characteristics as mentioned above, arid preferably, is.the constant region without Cl 35 domain, or the Fc region. Specifically, example thereof is the region composed of hinge region, C2 domain, and C3 domain.from each of IgG,־

-.1 . /&lt;.:./

WO 01/87981 PCT/JPO1/04035 \ . . 48 .

IgA, and IgD, and is the region .composed of C2 domain, C3 domain, . and C4 domain from each.of IgM and igE. A particularly preferable example thereof is the Fc region of human-derived IgGl.

The fusion polypeptide mentioned above has the advantage that the fusion polypeptide .can be purified extremely easily by. using affinity column chromatography.using the property of protein A, which, binds specifically to the immunoglobulin fragment because the.fusion . .polypeptide of the present invention has a portion of a constant region!

(for example Fc) of an immunoglobulin such as IgG as mentioned above 10 as a fusion partner. Moreover, since various antibodies against the.

Fc of various immunoglobulins are available, an .immunoassay for the fusion polypeptides can be easily performed with antibodies .against' the Fc,. .

A polypeptide which binds to . AILIM is included in a 15 . polypeptide״ included in the definition .of the above substance.

Specific examples of a polypeptide which binds to AILIM are.

the whole or a portion of .a polypeptide constituting known B7h, B7RP-1, . GL50 or a molecule called LICOS which are ligands interacting with AILIM (Nature, Vol/402,'No. 6763., pp. 8271999 ,832־; 'Nature Medicine, •20 . Vol. 5, No. 12 , pp. 1365-1369,1999 ; J. Immunology, Vol. 164 , pp. 1653-1657, 2000; Curr. Biol., Vol.10 No 6, pp.333-336, 2000).

Preferably, the polypeptide is a polypeptide comprising the whole or a portion of an extracellular region of the .above ligands' (B7h, B7RP-1, GL50,. LICOS), or a fusion polypeptide comprising .the . 25 polypeptide, and the whole or a portion of a', constant. region of . immunoglobulin heavy chain (preferably human immunoglobulin) . Here, . .the terms, an extracellular region and a constant region of .immunoglobulin heavy chain״ have the same meaning as the above.

The polypeptide, a portion of the polypeptide (fragment), and 30 fusion polypeptide mentioned above can be produced not only by recombinant DNA technology as mentioned below but also׳ by a. method well known in the art such as a chemical synthetic method and a cell . culture method, or a modified method thereof. .

' , The antibody״ of the present invention can be. a polyclonal 35 antibody (antiserum) or a monoclonal antibody against mammalian AILIM (particularly preferably human AILIM) defined above, and preferably ;

WO 01/87981 PCT/JPO1/04035 .

'. ’ a monoclonal antibody.

Specifically the antibodyis an antibody having an.activity, in inhibiting proliferation of AILIM-expressing cells by biding to AILIM, or inhibiting production of interferonγ or interleukin 4 by'

AILIM-expressing cells through biding to AILIM.

Delayed type allergy״ herein this allergy mediated by cellular . immunity (particularly mediated by Thl-type T cell), that is, the allergy is mediated by T cell sensitized with antigen (memory T cell memorizing antigen) and is referred to any allergy, which takes approximately 24 to 48 hours to exhibit allergic reaction accompanied with inflammation caused by said memory T cell when the living organism . sensitized with an antigen is re-contacted with the same antigen.

This,delayed type allergy includes'allergy to an infectious׳ pathogenic antigen such as tuberculin allergy derived from ,.

Mycobacterium tuberculosis,׳ a transient Jones-Mote׳ delayed type/ allergy to a minute quantity of protein, contact allergy to chemicals such as picryl chloride or plant toxin such as lacquer, or allergy related to.graft rejection to graft observed in.the allograft.

Pharmaceutical composition.herein means a composition useful as a drug comprising as the effective ingredients antibody (preferably .human antibody), whichbinds to AILIM (preferably human AILIM): or . a portion thereof, or monoclonal antibody (preferably human monoclonal. \ antibody) or a portion thereof and a pharmacologically acceptable ׳'׳ ' ,'carrier׳״.', '>.:.

The pharmaceutically acceptable carrier includes a.excipient,.

a diluent, an expander, a . decomposition agent, a stabilizer, a preservative, a.buffer, an emulsifier, an aromatic, a colorant, a sweetener, a viscosity increasing agent, a flavor,', a. solubility , increasing agent, or other additives.

3θ Using one or more of such carriers,., a pharmaceutical composition can be formulated into tablets, pills, powders, granules, inj ections, solutions, capsules, troches, elixirs, suspensions, emulsions, or . . syrups. .

The pharmaceutical composition can be administered orally or parenterally. Other forms for parenteral administration include a solution for . external application, .:suppository for rectal

WOOJ/87D81 . PCT/JPO1/04035 ' ⁵θ 'י . ' ./ administration,.and pessary, prescribed by the.usual method, which . comprises one .or more, active ingredient. ׳ ׳

The dosage can vary depending on the age, sex, weight, and symptom of .a patient, effect of treatment,administration route, period of 5 treatment, or the kind of active ingredient (polypeptide or antibody .mentioned above) contained in the pharmaceutical composition. Usually, the pharmaceutical composition can be administered to an.

-- adult in a dose of 10 |ig to 100.0׳ mg (or 10 |jg׳ to 500 mg) per one administration. .Depending on various conditions ,'the dosage less than ' . 10 that׳mentioned above may be sufficient in some cases, and the dosage more than that mentioned above may be necessary, in other cases.

In particular, the injection can be produced by dissolving or suspending the antibody in a non-toxic, pharmaceutically acceptable .carrier such as physiological saline or commercially a'va 11 ahi!=>. 15 ׳distilledwater for injection with adjusting a concentration to 0.1 pg antibody/ml carrier to 10 mg antibody/nil carrier.

. The in j ection thus produced can be administered to a human patient ו in.needof treatment in a dose of .1'pg to 100 mg/kg body weight, preferably 50 pg to 50 mg/kg body weight once or more times a day.'. Examples of • 20 administration route are medically appropriate administration routes such as intravenous injection, subcutaneous injection, intradermal / injection, intramuscular injection, orintraperitoneal injection, +

... preferably, intravenous׳'injection. ../' +

The injection can also be prepared into a non-aqueous diluent . .25 (for example, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and alcohol such as ethanol) , suspension, or emulsion.

The injection can .be sterilized by filtration with a .bacteria-non-penetrated filter, by mixing bacteriocide, or by irradiation. The in j ection can be produced in the form that is prepared 30 . uponuse. . Namely, it is freeze-dried to be a sterile solid composition, and can be dissolved in sterile distilled water for inj ection or another .

solvent before use. . .

Pharmaceutical, compositions comprising, the human antibodies °f. this invention are useful as. pharmaceutical-preparations, without . 35 inducing host immunorej.ection due to HAMA (human anti—mouse antibody) , . to control a variety of biological reactions (e.g., proliferation

WO 01/87981 PCT/JPO1/04035

יי . 51•’ of cells expressing AILIM, cytokine production by cells expressing.' AILIM,. immune cytolysis or death (apoptosis) of cells expressing AILIM . and others) that are associated with AILIM-mediated'transduction of costimulatory signal (secondary signal). to AILIM-expressing,.cells, ' 5 and/or as pharmaceutical preparations to.treat or prevent various .' diseases by suppressing and inhibiting the onset and/or progress of diseases associated with AILIM-mediated signal transduction.

'.The term immune cytolysis״ herein indicates a biological.

phenomenon as follows.

1θ Lysis of the cell . (cytolysis) can be induced by an antibody./ (particularly cell-lysing antibody) as-well as by binding with killer cells. The cell-lysing antibody is a cytotoxic antibody, which particularly has lysing activity on cells such as immune cells , tissue.. cell.or sperms . When the antibody binds to the cell-surface antigen ,..

it causes a cytotoxic effect on the .cell or induces cytolysis in the ¹presence of the complement.

This immune cytolysis is induced by the action of the complement in conjunction with specific binding of the antibody to cell-surface, antigen. The antibody bound to the surface antigen activates Cl complement (Cl). Subsequently cell damage sites are formed through a series of complement-fixation reactions with C2.to C9 complements (C2-C9)., and then cellular contents are released from the cells thereby lysing the cells.

The term antibody-dependent cellular cytotoxicity herein ’ indicates a biological event that is also abbreviated as ADCC, ״. and ; is a cytotoxic action on target cells by effector cells such, as .

lymphocytes, macrophages or polymorphonuclear leucocytes, which requires not only effector cells and target cells but also an antibody participating in the induction of the cytotoxic ,.event.׳

5θ .The term mixed lymphocyte reaction herein means a biological phenomenon abbreviated as MLR. The reaction is also referred to ¹as mixed leukocyte reaction.

Allogenic leukocytes or lymphocytes derived from distinct individuals are mixed with each other and cultured for several days, ׳ 35 thereby allowing blast formation of the cells and DNA synthesis in the cells (i.e., .cell proliferation). This reaction is referred.

WO01/87y81 PCT/JP01 /04055 . l.⁵² ' to: as MLR. (allogenic MLR) .

DNAsyrithesis (cell proliferation) can be analyzed by arresting' . proliferation of either of the.lymphocytes. The arrest can be ' accomplished by treatment with irradiation or mitomycin. Analysis can be carried out by measuring the amount of .DNA synthesized in the other lymphocyte. i

The amountof synthesized DNA can .be analyzedby measuring incorporation of thymidine, labeled with radioisotope such as tritium, . into the nucleus of the cell. &lt;

DNA encoding AILIM .(particularly preferably human AILIM) of ׳ ׳ the present invention can be obtained according to a commonly used method by using procedures for cloning cDNA from mRNA encoding AILIM; . ל .procedure for isolating genomic DNA.and splicing them; procedure for '.' preparing the DNA by PCR using a cDNA sequence or mRNA׳ sequence as .a template; or procedure for chemically synthesizing the DNA.

DNA encoding the AILIM ligand in accordance with the present‘ invention can also be obtained in the same manner as described above.

DNA encoding AILIM (particularly preferably the human AILIM) of the present invention can be prepared by cutting (digesting) DNA . comprising DNA encoding AILIM prepared as such with appropriate restriction enzymes,. and'.as required, ligating the resultant DNA . .fragment with a linker DNA or tag by using an appropriate DNA polymerase : or the like. The DNA encoding AILIM ligand.can also be prepared in the same ,manner.

²⁵ An exemplary method will be shown below to clone the cDNA encoding ־ AILIM .(particularly preferably- the '.human'AILIM; the protein is .

' hereinafter referred to as the protein of interest) from the. mRNA. A DNA encoding AILIM ligand can also be cloned in the same manner. First, messenger RNA encoding the protein of interest is prepared .

from tissues or cells expressing and producing the protein of interest.

mRNA can be prepared isolating total RNA by a׳ known'method such as quanidine-thiocyanate method (Chirgwin, J.M. et al. , Biochemistry,' Vol.18,p5294, 1979) , hot phenol method, or AGPCmethod, and subj ecting it to affinity chromatography using oligo—dT cellulose or poly—U

Sepharose'.

,,. . Then,׳ with the mRNA obtained as a template, cDNA is.synthesized,. . .י

WO 01/87981 PCT/JP01/04035 for example, by a well-known method using reverse transcriptase such ' as the method of Okayama et al. (Mol. .Cell. Biol. V01.2, p. 161 .(1982) ;

ibid. V01.3 ,p. 280 (1983)) or the method of Hoffman et al. (Gene Vol25 .׳, p.263 (19 83)) , and converted into double-stranded cDNA. '. A cDNA library ' ' .5 is preparedby transformings, coli. with plasmidvectors ,.phage vectors ' or cosmid vectors having this .cDNA' or by transfecting E. coli . after in vitro packaging. . '.

The plasmid vectors used in this. invention are,not limited as ., long as they are replicated and maintained in hosts. Any phage vectors .

that can be replicated in hosts can also be used. Examples of usually . ' ' .used cloning vectors are p־JC19 , XgtlO ,. Xgtll, and so on., . When; the ' vector is applied to immunological screening as mentioned below,, the .

vector having a promoter that can express a gene encoding the polypeptide ‘ .of the present invention in a host is preferably used'. . ' . ־ •*•5 cDNA can be inserted into a plasmid by, for example, the method of Maniatis et al. (Molecular Cloning, A Laboratory Manual, second edition, Cold Spring Harbor Laboratory > p.1.53, 1989). cDNA can be inserted into a phage vector by, for example, the method of Hyunh . etal. (DNA cloning, a practical approach, Vol. 1, p . 49 .(1985)) . These .

;20 methods can be simply performed by using a commercially available . cloning kit. (for example, a product from Takara Shuzo). The recombinant plasmid or phage, vector thus obtained is introduced into , appropriate, host cells such as a prokaryote (for example, E.Icoli: XLlBlue MRF ׳ , DH5a, HB101, MC1061/P3 , etc.) .',

Examples of a method for introducing a plasmid into a host are . calcium chloride method, calcium chloride/rubidium, chloride method described in Molecular Cloning, A Laboratory Manual, (second edition, Cold Spring Harbor Laboratory, p.1.74 (1989) ) , and electroporation ^;method. Phage vectors can be introduced into host cells by, for example, 30 a method in which the phage DNAs are introduced into grown hosts after in vitro packaging. In vitro packaging can be easily performed with, a commercially available in vitro packaging kit (for example, a product from Stratagene or Amersham).

The cDNA encoding the polypeptide of. the present invention can 35 be isolated from the cDNA library so prepared according to the method . . mentioned above by combining general. cDNA screening methods. ' ;

.WO 01/87981 PCT/.ΓΡΟ 1/04035 ׳ ./ ' 54. . . > ־ .

For example, a clone'comprising the'desired cDNA can be screened by a known, colony hybridization method (Crunstein et al. Proc. Natl.' Acad. Sci. USA, Vol.72, p.3961 (1975) ) or plaque hybridization method (Molecular Cloning, A Laboratory Manual, second edition, Cold Spring

Harbor. Laboratory, p.2.108 (1989)) using ³²?-labeled chemically synthesized oligonucleotides as probes, which.are corresponding to / the amino acid sequence of the polypeptide of the present invention.׳ ׳ ' Alternatively, a clone having a DNA.fragment encoding a specific region withinthe polypeptide of .the present invention can be screened by 10 .amplifying the region by. PCR״with- synthetic PCRprimers. ¹

When a cDNA library prepared using a cDNA expression vector (for .example, λΖΑΡΙΙ phage vector) is used,., the desired clone can, be screened by the antigen-antibody reaction using an antibody against the polypeptide :of the present invention. A screening method using

PCR method is preferably used when many clones are subjected to screening.

The nucleotide sequence of the DNA thus obtained canbedetermined ’ by Maxam-Gilbert method (Maxam et al,. Proc. Natl. Acad:' Sci. USA, Vol.7.4, p.560 (1977)) or ' the dideoxynucleotide synthetic .. chain.:. .20 termination method using phage M13 (Sanger et al. Proc. Natl.: Acad. ^;

Sci. USA, Vol.74 , pp.5463-5467 (1977)), The whole or a portion.of 7 the gene encoding the polypeptide of ’ the present invention can be . obtained by excising the clone . obtained as mentioned above with restriction, enzymes, and so on.

²⁵ The. DNA encoding the polypeptide of the present invention can be isolated from the genomic DNA derived from the cells expressing the polypeptide, of the present invention as mentioned .above by. the following.methods.

Such cells are solubilized preferably by SDS or proteinase K, ׳ 30 and the DNAs.ar.e deproteinized by repeating phenol extraction. RNAs are digested preferably with ribonuclease.' The DNAs obtained are . partially digested with appropriate restriction enzymes, and the DNA . fragments obtained are amplified with appropriate phage or cosmid to generate aiibrary. Then, clones having the desired sequence are 35 detected, for example, by. using.radioactively labeled DNA probes, . and the whole or a .portion of the gene encoding the polypeptide of . . '. .'׳׳ ״'.,' '׳iL^; 0 > ''״ '.;.׳/ ; ״ : ;>.>-.'..'.־./ ׳

י. , . . י' י . ־ . * . ־ .' ־ ' ' ־ ‘ .- ־.'.־..־ - ' . . - ^V. ־ ־ ׳‘ י ־ . I < .׳.״<־ .'. 'ל. '־ C . .ך:־ >’.־ V'י < 5 --'ך -/ י. .’' .

WO 01/87981 PCT/JP0.1/04035

י'' י' ' '55 .

. ,the present invention is obtained from the clones by excision .with ' restriction enzyme and so on.

Preparation .of DNA encoding the protein of interest by PCR can . be carried out by .using known mRNA or. cDNA encoding the protein of' . 5 interest as the template according to a usual.method (PCR techniques . for gene amplification - fundamental and new technologies KYORITSU SHUPPAN, 1992, etc.)'.

The DNA encoding the protein of interest can also be chemically synthesized, by the usual method, based on the nucleotide sequence 10 . encoding the protein of interest.

. AILIM of the invention (particularly preferably the human AILIM)'־ ׳/-. or a portion thereof (preferably, the extracellular region) car. be . . prepared as a recombinant protein according to a usual method with commonly used genetic recombination techniques, using DNA obtained _;

15. by cutting DNA encoding AILIM (cDNA or intron-containing genomic DNA) ^:based on the method illustrated above with appropriate restriction . enzymes to give a DNA fragment encoding the AILIM, and then as required, ligating the resultant DNA fragment with a linker DNA or tag, by using .an appropriate DNA polymerase or the like.

20. The AILIM ligand (particularly preferablythe human AILIM ligand) ' or a portion thereof (preferably, the extracellular region) can be .prepared in the same, manner.

A specific example is illustrated.below; Namely, the DNA prepared as described above is.inserted into a vector, which will .25. be described later in detail, to yield an expression vector. Then the expression ,vector is ,used to transform a host cell as described below .to obtain, a transformant. The transformant is cultured and .' allowed to produce the protein of interest into the culture supernatant . ' Theproteinof. interest in the culture supernatant can easily be purified 30 by using column chromatography .and such. .

There is no particular limitation on the.type of expression / vector for the production of the recombinant AILIM (or its extracellular region) , as far as the vector is replicated and,maintained or produced ־ ’ . ' . . .J autonomously in any of various hosts such as prokaryotic cells' and/or 35. eukaryotic cells. Such expression vectors include plasmid vectors . and phage vectors (Cloning Vectors: A Laboratory Manual, Elsevier,.

WO 01/8798] . PCT/JPO1/04035 .56 . New York, 1985).

The expression vector can easily be prepared by ligating .th DNA encoding AILIM (or its extracellular region) with a vector fo recombination available in the art (plasmid DNA ׳.and. bacteriophag .5 DNA) by the usual method.. Specific examples of the vectors fo recombination usedareE. coli-derivedplasmids such as pBR322,pBR325 pUC12, pUC13, and pUC19, yeast-derived plasmids such as pSH19 an pSH15, and Bacillus subtilis-derived plasmids such as pUBllO, pTP5 and pC194. Examples of phages are a bacteriophage such as λ phage 10 andananimalor insectvirus (pVL1393,Invitrogen) such as. a retrovirus, vaccinia virus, and nuclear polyhedrosis virus.

Plasmid vectors are useful, when a DNA encoding AILIM of thi invention(particularly preferably the human. AILIM) or its soluble extracellular region is intended to be expressed in a host cell ah( .15 thereby expressing .the AILIM on the. surface of the host cell, 0: alternatively the soluble extracellular region of the AILI1 . (particularly preferable the human AILIM) is intended to be produced There is no particular limitation on such plasmid vectors, as faj .as the vectors can express the gene encoding AILIM (particularly 20 preferably the human AILIM) or its soluble extracellular region anc produce the encoded protein in various host cells such as prokaryotic cells and/or eukaryotic cells. ' For example, such plasmids include pMAL C2, pcDNA3.1 (-),pEF-B׳OS (Nucleic Acid Research/Vol. 18, p. 5.322, 1990 ; etc.) ,.pME18S (Handbook for genetic engineering, Experimental 25 Medicine, supplement, 1992'; etc.)., etc. ' ־

When bacteria, particularly E. coli are used.as host cells, .’ .an expression vector is generally comprised of, at least, a promoter-operator region, an initiation codon, the DNA encoding the protein of the present invention, termination codon, terminator region 30 and replicon. ;

When yeast, animal, cells, or insect cells are used as hosts, an expression vector is preferably comprised of, at least, a promoter, an initiation codon, the- DNA encoding the AILIM (particularly . . preferably human AILIM) of the present invention.or its extracellular 35 region, and a termination codon. It may also comprise the DNA encoding .a signal peptide,: enhancer sequence, 5׳- and 3 ׳-untranslated region .WO 01/87981 PCT/JP01/04035

57 .' ( ״.' . .

:of the.gene encoding the AILIM of the present invention, splicing ^: ’ junctions, polyadenylation site,־ selectable marker region, and replicon. The expression vector may also contain, .if required, a gene • for gene amplification (marker) that is,usually used. ' ⁵ A promoter-operator region to express.the AILIM (particularly . preferably human AILIM) of the present invention or its extracellular.' region in bacteria comprises a. .promoter, an operator, ' and' a Shine-Dalgarno (SD) sequence (for example, AAGG) . . For example, when the host, is Escherichia , it preferably comprises Trp promoter , lac ; Λθ promoter, recA.promoter, XPL promoter, Ipp promoter, tac promoter, or.the like. 7 .־ . :

Examples of a promoter to express the AILIM (particularly. ¾-7 preferably human AILIM) of the present invention or its extracellular region in yeast are PH05 promoter, PGK promoter, GAP promoter, ADH . ' 15 promoter, and so on. When.the host is Bacillus, examples thereof are.

SL01 promoter, SP02 promoter, pen? promoter and so on.

When the host is. a eukaryotic cell, such as a mammalian cell, examples thereof are SV40-derivedpromoter, retrovirus promoter, heat shock promoter, and so on. As a matter of course, the.promoter is .20 . not limited to the aboye examples. . In addition, to use.an enhancer .׳ is effective'.׳for expression.

A preferable initiation codon is ,.'for ..example, a .methionine .׳

'. codon' (ATG)'.

The commonly used termination codon (for example, TAG, TGA,. 7.

TAA, and so on) is illustrated as a termination codon.

Usually used natural or synthetic terminators are used as a terminator region.

A replicon means a DNA capable , of replicating the whole DNA . sequence in host cells, and includes a natural plasmid ,an artificially modified plasmid (DNA fragment prepared from a natural plasmid) , a., synthetic plasmid, and so on. Examples of a preferable plasmids are pBR322 or its artificial derivatives (DNA fragment obtainedby treating PBR322 with appropriaterestriction enzymes) for E. coli,.yeast 2 μ plasmid or yeast chromosomal DNA for yeast, and pRSVneo ATCC.37198, >.' 35 pSV2dhfr ATCC 37145, pdBPV-MMTneo ATCC ,37224, pSV2neo ATCC 37149, i . pSV2bsr, etc ..for mammalian .cells.

WO 01/87981 PCT/JP01/04035

/?'/ ., ׳ ״''’.' 58 . '

An .enhancer sequence, polyadenylation site, and . splicing .

junction that are usually.used in the art ,׳.such as those derived from' .

. SV40 can be also used. . .

A selectable marker usually used can be used according to the usual method. Examples thereof are resistance'.genes for antibiotics, ' such as tetracycline, ampicillin,,or kanamycin, and thymidine kinase .

gene. ?.'./? ־. ///.’./

Examples of .a gene for gene, amplification are dihydrofolate?

reductase (DHFR) gene, thymidine kinase gene, ׳neomycin resistance?-, . .TO gene, glutamate synthase gene, adenosine deaminase gene,.ornithine .

decarboxylase gene, hygromycin-B-phophctransferase gene, aspartate transcarbamylase gene, etc.

The expression vector of the present invention can be prepared by continuously and circularly linking at least the above-mentioned promoter, initiation codon, DNA encoding the protein of the present invention, termination codon, and terminator region, to an appropriate replicon. If desired, appropriate DNA fragments (for example, linkers,' )? restriction sites generated with.other restriction enzyme),can be used.by the usual .method such as digestion with a restriction .enzyme?

' or ligation using T4 . DNA ligase. . ' /./.

Transformants of the present invention can be. prepared by ?

. introducing the׳expression vector mentioned above into host cells.

Host cells used, in the present invention are not limited as ? long as they are compatible with an expression vector mentioned above/ : 25 .and can be transformed. Examples thereof are various cells such as . natural cells or .artificially established recombinant cells usually used in technical field of the present invention (for example, bacteria (Escherichia and Bacillus') _t yeast (Saccharomyces; Pichia,' etc.) , animal cells, or insect cells.

. . E. coli or animal cells are preferably used. Specific examples ., are E. coli (DH50C, DH10B, TB1, HB1Q1, XL-2Blue, etc. ) , mouse-derived cells (COP, L, C127, Sp2/0, NS-1, NIH 3T3, etc.),. rat-derived cells,

.. Hamster-derived cells (BHK, CHO, etc.) , monkey-derived cells (COS1, COS3, COS7, CV1, Velo, etc.) , and human-derived cells (Hela, diploid . fibroblast-derived cells, - myeloma, Namalwa, etc.). ' .

An expression vector can. be introduced (transformed / .׳.

WO 01/87981 PCT/JPO1/04035 .' ' ' ' 59 ' . / / .

(transduced)) into host cells by known method. .

Transformation can be performed,, for example.,' according to the. method.of Cohen.et al. (Proc. Natl. Acad. Sci. USA, Vol.69, p'.211O .(1972)) , protoplast method (Mol. Gen. Genet., Vol. 168 ,p. Ill (1979)), .׳ . 5 or competent method (J. Mol. Biol. ,.Vol.56, p.209 (1971)) .when the: hosts are bacteria' (¢., coli, Bacillus subtilis, etc.), the method' ־of Hinnen.et al. (Proc. Natl. Acad. Sci. USA, Vol.75, p. 1927 .(1978) )., . . ' or lithium method (J. Bacteriol., Vol.153, p.163 (1983)) when the ? host is Sacctiaromyces cerevisiae, the method of Graham (Virology,

Vol.52, p.456 (1973).) when the hosts are animal cells, and the.method. ⁷of Summers et al. (Mol. .Cell'. Biol., Vol.3, pp.2156-2165 (1983)) when ' Xi the hosts are insect cells. '. .. ^,-//.::

The extracellular region of the.AILIM (particularly preferably / ' X human AILIM) of the present invention (soluble AILIM) can be produced by cultivating transformants (in the following this term includes ' transductants) comprising an expression vector prepared as mentioned above in nutrient media. AILIM ligand can be produced in the same way.

The nutrient media preferably comprise carbon source, inorganic 20 nitrogen source, or organic nitrogen source necessary for the growth of host cells (transformants). Examples of the carbon source are glucose, dextran., soluble starch, and sucrose, and examples of the inorganic or organic nitrogen source are ammonium salts, nitrates, amino acids, corn steep liquor, peptone, casein, meet extract׳, soy &lt; 25 bean cake, and potato׳extract. If desired, they may comprise other . nutrients׳. (for example,. an inorganic salt (for example, calcium . chloride,. sodium dihydrogenphosphate, and magnesium chloride), vitamins, antibiotics .(for example, tetracycline, neomycin, ampicillin, kanamycin, etc.).

³θ Cultivation is performed by a method known in. the art. ׳

Cultivation conditions such as temperature, pH of the media, and cultivation time are selected appropriately so that the protein of the present invention is overproduced.

Specific media and cultivation conditions used depending on 35 host cells are illustrated below, but are not limited thereto.

• .When the hosts are bacteria, actinomycetes,. yeasts, filamentous ׳ ' ׳..’ .י.^,''^, ׳'.'.י^L' ; - ¹ י'.י. ל►.* '־ל ί־*”/ ׳.>< .' י.;^,־׳,.;. יי. ׳־'וי« .< י ./' * ¹ . ,_־*X ץ'.‘ ׳. 1 י * י‘'. . :־“A.',!./'׳ . .״'/.J י יי '4׳ τ

־. /&lt;- / '/ . .ז&lt;.ף.://;/ J ////// ״_;./ל /:// &lt;/./¥// ii///'׳

WO 01/87981 .. PCT/JPO 1/04035 ;

/7'' ' י', /. . 60 ' י fungi, liquid media comprising the nutrient source mentioned above are appropriate. The media with pH 5 to 8 are preferably used.

When, the host is E. coli , examples of preferable media are LB ־ media, M9 media (Miller et al. Exp. Mol. .Genet. ,’.Cold Spring Harbor.' ' . Laboratory, p. 431 (1972)) , YT media, .etc., / Using these media, cultivation can be performed usually at 14 to 43 °C for .about 3 to ' . .24 hours with aeration and .stirring, if necessary.

When the host is Bacillus, cultivation can be performed usually • at 30 to 40 :°C for about 16.to 96 hours with aeration and stirring, 10 if necessary. .,

When the host is yeast, examples of media are Burkholder minimal media (Bostian, Proc. Natl. Acad. Sci. USA, Vol.77, p.4505 (1980)) The pH of the media is preferably 5 to '8. Cultivation can be performed ׳. .usually at 20 to 35°C for about 14to 144 hours.with aeration and stirring,' . .15 if necessary.

When the host is. an animal cell, examples of media are MEM media containing about 5 to 20% fetal bovine serum (Science, Vol. 122 , p. 501 ,(1952) ), DMEM media. (Virology, Vol.8, p.396 (1959)) , RPMI1640 media . (J. Am. Med. Assoc. , Vol. 199, p.519 (1967)) , 199 media (Proc. Soc. ..

Exp. Biol. ,Med., Vol.73, p.l (1950)) , HamF12 media, etc. The pH of the media is preferably about 6 to 8.' Cultivation can be performed usually at about 30 to 40°C for about.15 to 72 hours with aeration . and stirring, if necessary.

when, the host is an insect .cell, an example of media is Grace ׳s 25 . /media containing fetal bovine serum (Proc. Natl .Acad. Sci.USA, Vol. 82, p.8404 (1985)).- The pH thereof is preferably about 5to 8. Cultivation י .' can be performed usually at about 20 to 40°C for 15 to 100 hours with ; aeration and stirring,.if necessary.

The .extracellular region (soluble AILIM) of AILIM of the 30 invention (particularly preferably the human AILIM) .can be produced by culturing the above-mentioned transformed cells (particularly, animal cell or E. coli) and allowing the secretion of the protein in the culture supernatant. Namely, a . . culture filtrate . (supernatant) is obtained by the method such, as filtration or 35 centrifugation of the obtained culture, and the polypeptide of polypeptide fragment of the present invention is purified and isolated

VVO 01/8798.1 PCT/JP01/04035.

61 י ' from the culture filtrate by the usual method commonly used in order to purify and isolate a natural or synthetic protein.

. Examples of the isolation and purification method are a method ' utilizing specific affinity, such as.affinity chromatography, amethod ¹ 5 utilizing solubility, such as salting out and solvent precipitation method,, a method utilizing the difference in molecular weight, such as. dialysis,, ultrafiltration, gel filtration, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis, a method utilizing . charges,, such as ion exchange chromatography and hydroxylapatite'1 10 chromatography, amethod utilizing the difference in hydrophobicity, such as reverse phase high performance liquid chromatography, and ^רa method utilizing the difference in isoelectric' point, such as isoelectric focusing.

. .When the protein of interest exists in the periplasm or cytoplasm of cultured transformants, first, the fungus bodies or cells are. ׳ harvested by the usual method such as filtration or centrifugation and suspended in appropriate buffer. After the cell wall and/or cell membrane of׳ the cells and so on are disrupted by the.method such as lysis with sonication, lysozyme, and freeze-thawing, the membrane ל ,20 fraction comprising the polypeptide of the present invention is obtained by the method such as centrifugation or filtration. The . membrane fraction is solubilized with a detergent such as Triton-X100 ׳ to obtain the crude extract. Finally, the polypeptide, or ׳ the ׳ polypeptide fragment is isolated and purified from the crude extract ' 25 by the usual method as illustrated above.

In the present invention, the term insoluble carrier means a carrier which is used to immobilize polypeptides on them by physical adsorption or chemical linking. For example, the carrier can.be (1) plate, test tube, tube, or the like having internal space, bead/ ball, 30 filter, membrane, or the like made of water-insoluble materials including plastics such as polystyrene resin, polycarbonate resin, silicon resin or nylon resin, or glass, and (2) insoluble.carrier used׳ in affinity chromatography such as cellulose carrier, agarose carrier, polyacrylamide carrier, dextran carrier, polystyrene carrier, polyvnylalcohol carrier, poly amino acid carrier, porous silica.

carrier, .etc, . ,״ :. . ‘

WO 01/87981 : PCT/JP01/04035 .62 . . ' . . / .

.The labeling'substance capable of giving detectable, signal״ .' in accordance with the present invention includes , for example, enzyme, fluorescent material, .' luminescent, material, .biotin, avidin- or radioisotope, more specifically, enzymes such as peroxidase (e!g. , ׳ horseradish peroxidase), alkaline phosphatase,, β—D—galactosidase glucoseoxidase, glucose-6-phosphate dehydrogenase, alcohol dehydrogenase, . malate dehydrogenase, ,penicillinase, catalase ׳ apo-glucose oxidase, urease, luciferase, acetylcholine esterase . etc.; fluorescent materials such as .fluorescein^: isothiocyanate, ¹ 10 - phycobilin protein, rare earth metal chelating agents, dansyl chloride, . tetramethyl. rhodamine isothiocyanate, etc.; radioisotopes such as H׳ C, ²⁵I,.¹³¹.!., etc.; biotin, avidin, .and luminescent material. ׳ Among them, radioisotope or. fluorescent material can give .detectable signal even when used alone. On the .other hand, when used . 15 alone, enzyme, luminescent material,. biotin or avidin provide no ' detectable signal, butwhen allowed to reactwith one ormore substances, it can provide detectable signal. For example, when the .label .is an enzyme, at least a substrate is necessary for the detection.׳ , Various types of substrates can be used depending on the type of method 20 formeasuring enzyme activity (colorimetry , fluoroscopy, methodusing bioluminescence or chemical luminescence, etc.) . For example, when .

. the label is peroxidase, hydrogen peroxide can be used as a substrate. / Alternatively,. when the label is biotin, avidin or enzyme-modified .: avidin is commonly used but is.not limited to them.' As required, . 25. a variety of luminescent substances cari be utilized depending on the ' : . type of substrate to be used.'

Any of the above-mentioned labels can be utilized in the present ,invention. However, preferred label is an enzyme such as peroxidase or biotin with consideration given to sensitivity of detection or ;

assay as well as the convenience of manipulation.

A method for identifying a substance capable of binding to AILIM or AILIM ligand in accordance with the invention is constructed' based on the principle. of immunoassay. ^; '

Specifically, the principles of various methods as described .35 in Immunoassay (3^rd Edition., eds. , Eiji Ishikawa et al, Igakushoiri, 1987) can be applied. . . .'.

<img file="IL147448A_D0002.tif" />

WO 01/87981 . PCT/JP01/04035 ' 63 /

Examples of principles preferably used include solid-phase one-antibody method, liquid-phase two-antibody method, solid-phase . two-antibody method, sandwich method, and one-pot method as described m Examined Published Japanese Patent Application JJP-B) . No. Hei . 2-39747 . Further, assay method employing antigen-antibody reaction ' is exemplified by EMIT method . (enzyme multiplied immunoassay technique) , enzyme channeling immunoassay, enzyme modulator mediated ^:enzyme immunoassay (EMMIA) , enzyme inhibitor immunoassay, immunoenzymometric assay, enzyme enhanced immunoassay and proximal.

linkage immunoassay.

In the present invention, any of such principles of immunoassay maybe selected properly in accordance with the purpose. However, with consideration given to the convenience of procedure, and/or economic advantage, and.particularly clinical versatility, the,. / 15 principle . of sandwich method, one-pot method, .or solid-phase one-antibody method, more preferably sandwich method or one-pot method is pref erably utilized ,. Particularly pref erred is sandwich method'¹ using multi-well microtiter plate having many'wells such as 96-well . microplate, or one-pot method, using beads.on which polypeptide, is 20 immobilized and also using a counterpart labeled with enzyme such . as peroxidase or . withbiotin.

Brief Description of the Drawings ' Figure 1 .shows respective reactivities of anti-human' IgG . 25 . antibody, anti-human IgK antibody and anti-human IgFc antibody'to . the human anti-human AILIM monoclonal antibody , analyzed by cell ELISA using a flow cytometer. .׳ '׳.

Panels (a) to (1) show respective results of the assays indicated below.

Panel (a) : result of assay in which biotin-labeled anti-human . IgG antibody as a secondary antibody was added in the absence of primary antibody into the microplate where wild-type HPB-ALL cells had been plated. '

Panel (bj : result of assay in which biotin-labeled anti-human 35 IgK antibody as a secondary antibody was added in the absence of primary . ., . . antibody into the microplate where wild-type. HPB.-ALL cells had been /. .?

WO 01/87981 ׳. . . PCT/JPO1/04035 י

'...'.י. . . plated.Panel (c) :. ׳result'of assay in which biotin-labeled anti-human .IgFc antibody as a secondary antibody:was added in the absence of ,. primary antibody :into the microplate where-wild-type HPB-ALL.cells 5 had been plated.

Panel . .(d) :. result of assay in which human anti-human AILIM monoclonal antibody JMab-136. was used as a-primary- antibody and biotin-labeled anti-human IgG antibody, was used as a secondary antibody. .' ־'־θ Panel (e) : result of assay in which human anti-human . AILIM monoclonal .antibody, JMab-136 was׳ used as a primary antibody and biotin—labeled anti—human IgK .antibody was used as a secondary ,antibody. .'. .,.Panel (f): result of assay in which human anti-human AILIM monoclonal antibody JMab-136 was used as a primary antibody and biotin-labeled anti-human IgFc antibody was used as a secondary ־. antibody.

Panel (g): ״result of assay in which human anti-human AILIM : monoclonal antibody JMab-138 was used as a primary antibody and 20 biotin-labeled anti-human IgG, antibody was .used as a secondary ', ״ ‘ antibody. , .- '״^; י

Panel (h) : result of assay in which human anti-human AILIM ; monoclonal antibody JMab-138 was used .as a primary antibody and biotin—labeled anti—human IgK antibody was used as a secondary 25 antibody.

Panel (i) : result of assay , in., which human anti-human AILIM monoclonal- antibody JMab-138 was used as a primary antibody and biotin-labeled anti—human IgFc antibody was used as a secondary .antibody.

3θ Panel (j): result of assay in which human anti-human AILIM monoclonal antibody JMab-139 was used as a primary antibody and . .bbotin-labeled anti-human. IgG . antibody was. used as a secondary antibody.

Panel (k): result of assay in which human anti-human. AILIM 35 monoclonal antibody JMab-139 was used as a primary antibody and ׳ Biotin-labeled, anti-human IgK- antibody was; used as a secondary

WO 01/87981 PCT/JP01/04035 ' . 65 '' antibody.,

Panel (1): result of assay in which human. anti-human. AILIM monoclonal antibody JMab-139 .was used as׳ a primary antibody '.and ׳ biotin-labeled . anti-human IgFc antibody ..was used as a secondary 5 antibody.

The curve:with,open symbols in each panel corresponds to the result of assay.in which human anti-KLH monoclonal antibody was used., as the control .antibody. .'.

Figure 2 shows a calibration curve with respect to human IgG :10 monoclonal antibody (standard material) assayed by sandwitch ELISA using anti-human.IgG.antibody.

The vertical axis indicates ׳ fluorescence intensity,. and' the - . ' horizontal axis indicates the concentration of the standard material. ...

Figure 3 shows binding activities of various mouse anti-human

AILIMmonoclonal antibodies to human AILIM-overexpressing recombinant CHO cells or wild-type CHO cells.' . The.vertical' axis indicates fluorescence intensity.as an index' of binding activity to the recombinant cells , and the horizontal axis indicates the concentration of the antibody added.

The term CHO in the figure indicates the result of a binding assay to the wild-type CHO cell, and human indicates the result, of a binding assay to the human AILIM-overexpressing recombinant CHO cell. י'.:'.,.'' .־

Figure 4 shows binding activities .of various human anti-human 25 AILIM monoclonal antibodies or human anti-KLH monoclonal antibodies . as a negative control to human AILIM-overexpressing recombinant CHO .cells or wild-type CHO cells.

The vertical axis indicates fluorescence intensity as an index of binding activity to the recombinant cells, and the horizontal axis 30 indicates.the .concentration of the. antibody added.

The term CHO in the figure indicates the result of a binding assay to the wild-type CHO cell, and human indicates the result of a binding assay to the human AILIM-overexpressing recombinant CHO ^c®11. ’ ׳ ׳ ־'.' ''

Figure 5 shows binding activities׳ of various human anti-human

AILIMmonoclonal antibodies to human AILIM-overexpressing recombinant

WO 01/87981 P.CT/jP01/04035 ' , . 66 ' ' ' '

CHO cells or wild-type CHO cells.

The vertical axis indicates fluorescence intensity as an index ' of binding.activity to the recombinant cells , and the horizontal axis indicates the concentration of the antibody:added.־ ,5 The term CHO״ in the figure, indicates the result of a binding . ' assay to the wild-type CHO cell, and human indicates the result of a binding assay to the human AILIM-overexpressing recombinant CHO ¹ יcell.

Figure 6 shows ,binding activities of various human anti-human

AILIMmonoclonal antibodies to human AILIM-overexpressing recombinant

CHO cells .or wild-type CHO cells. ׳

The vertical axis, indicates fluorescence intensity as an index of binding activity to the recombinant cells, and the horizontal axis'. ' indicates. the concentration of the antibody added.

' The term CHO in the figure indicates the result, of a binding ’: / assay to the wild-type CHO cell, and human indicates the result of a binding assay to the human AILIM-overexpressing recombinant CHO cell.

Figure 7 shows binding activities of rat anti-human AILIM monoclonal antibodies to mouse AILIM-overexpressing recombinant CHO.

cells or wild-type CHO cells. . :

The vertical axis indicates fluorescence intensity as an index :

. of binding activity to the recombinant cells, and the horizontal axis indicatesthe concentration of the antibody.added.

25. . The term CHO in the figure indicates. the result of a binding assay to the wild-type CHO cell , and mouse indicates the. result of a binding assay to the mouse AILIM-overexpressing recombinant CHO., cell. .

Figure .8 shows binding activities of various human anti—human 30.. AILIM monoclonal antibodies or human anti-KLH monoclonal antibodies as a negative control to mouse AILIM-overexpressing recombinant CHO cells or wild-type CHO cells.

The vertical axis indicates fluorescence intensity as an index . of binding activity to the recombinant cells, and the horizontal axis indicates the concentration of the antibody added.

׳ . The term CHO in the figure indicates the result of a binding

*. ׳.'.' ' ,. . ' ' ' , ^:. . . . , ‘ ־ .׳ , ., ’, ׳ _ ' | . .'*.־־ ׳*.׳...?>.. i.*.. /׳: /'⁴‘ : ׳'.׳.:׳η¹ ׳.«ν'¹ //;::;.׳.י־.^,. ׳'j γ.',,'1 ‘ '־- ”י’'^,'⁵‘'*׳ ’‘׳”ך/־ !'?- “’^,.’ ^דז־7 .^ל'.*'״ י' יי’ י י,γ ,¹ ״ -.-.׳. -. ־-' ־.״ .> “'׳>

WO 01/87981 PCT/JPO1/04035 . ; ' ' ׳ . '-־ ' .' ⁶⁷ ; ' ' ’ ״ ־ ׳ . / assay to the wild-type CHO cell, and '^,mouse״, indicates the result of a binding assay to the mouse AILIM-overexpressing recombinant CHO . cell. ' ״ , ׳ . Figure 9 shows binding activities of various human ־.anti-humari • 5 AILIMmono'clonal antibodies to mouse AILIM-overexpressing recombinant ׳. . CHO cells or wild-type CHO cells. . . ;

- The vertical axis indicates, fluorescence intensity as an index .׳ . of.binding activity to. the recombinant cells , and the horizontal axis . ^: ' indicates the concentration of the antibody added. +

The term CHO in the figure indicates the result of a.binding assay to the wild-type CHO ,cell, and.mouse indicates the result of a binding assay to the mouse AILIM-overexpressing recombinant CHO ' .cell.'. . /.' . ..׳.

Figure 10 shows binding, activities of various human anti-human ;

AILIMmonoclonal antibodies tomouse AILIM-overexpressingrecombinant

CHO cells .or wild-type CHO cells .

The vertical axis indicates fluorescence intensity as'an index . of binding activity to .the recombinant cells, and the horizontal axis. indicates the concentration of the antibody added.

2Q The term CEO in the figure indicates the result of a binding, assay to the wild-type CHO cell,. and mouse indicates the result of binding assay to the mouse AILIM-overexpressing recombinant CHO .״' cell ,..'.'י''.' י'

Figure ;11. shows binding activities of various mouse anti-rat ' 25 AILIM monoclonal antibodies to rat AILIM-overexpressing recombinant . CHO cells or.wild-type CHO‘ cells.

The vertical axis indicates fluorescence intensity as an index.

of binding activity to the recombinant ;cells , .and the horizontal axis . indicates the concentration of the antibody added.

The term CHO in the figure indicates the result of a binding assay to the wild-type CHO cell, and rat indicates the result of a binding assay to the rat AILIM-overexpressing recombinant CHO cell.

Figure 12. shows binding activities of various human ahti-human AILIM monoclonal antibodies or human anti-KLH 'mono clonal antibodies 35 as a negative control to rat AILIM-overexpressing recombinant CHO . . ־ cells or wild-type CHO cells. : . . . ׳ .

WO 01/87981 PCT/JP01/04035 ⁶⁸ ' י ־ . '

The vertical axi.s indicates fluorescence intensity as an index ל י. . of binding activity to the recombinant .cells , and the horizontal axis ל indicates the concentration of the antibody'added.

The term CHO in the figure indicates the result of a binding לי assay to the wild-type.CHO cell, and rat indicates the result , of ' . . .a binding assay to the rat AILIM-overexpressing recombinant CHO cell. '

Figure 13 shows binding activities of various human anti-human AILIM monoclonal antibodies to rat AILIM-overexpressing recombinant CHO cells or wild-type CHO cells.

, 10 The vertical axis indicates fluorescence intensity as an index , of binding activity to the recombinant cells , and the horizontal axis ' . indicates the concentration of the antibody added.

The term CHO״ in the figure indicates the result .of a binding לל • assay to the wild-type CHO cell, and rat indicates the result of a binding assay.to the rat AILIM-overexpressing recombinant CHO cell. .

Figure 14 shows binding activities of various human anti-humanAILIM monoclonal antibodies to rat AILIM-overexpressing recombinant CHO cells or wild-type CHO cells.

The vertical axis indicates fluorescence intensity as an index pf binding activity to the recombinant cells, and the horizontal axis ^J . . indicates the concentration of the antibody added.

The term CHO .in.the figure indicates the result of a.binding . ל assay to the wild-type CHO cell, and rat indicates the result of ' ל a binding assay to the-rat AILIM-overexpressing recombinant CHO cell.

.ל Figure 15 shows proliferation activity of T cells derived from . .a normal healthy person donor A in the assay for the activity of transducing costimulatory signal by various mouse anti-human AILIM monoclonal antibodies using a microplate coated with anti-human CD3

- monoclonal antibody together with mouse anti-human AILIM monoclonal . .

antibody.

The vertical axis indicates the amount of cellular incorporation of [³H] thymidine, as an index of. the degree of cell,proliferation, and ׳ ' the horizontal axis indicates the concentration of mouse anti-human.

AILIM monoclonal antibody. ,. .

Figure 16 shows proliferation activity of T cells derived from ,'

..a- normal healthy person :donor A .in the assay for the activity of

WO (M/87981 י PCT/JPO1/04035 ' . . - 69 . / .transducing costimulatory signal by various human anti-human AILIM monoclonal antibodies using a. microplate coated with anti-human CD3 ' ' monoclonal antibody together with human anti-human AILIM monoclonal antibody . . .

. , The vertical axis indicates the amount of cellular incorporation .of [³H] thymidine as an index of the degree of cell proliferation, and. . the horizontal axis indicates the concentration of human anti-human AILIM monoclonal antibody.

Figure 17 .shows proliferation activity of .T.cells derived from ' a normal healthy person donor B״ in the assay for.the activity of . transducing costimulatory signal by various mouse anti-human AILIM' .. monoclonal antibodies using a microplate coated with anti-human CD3 . monoclonal antibody together with mouse, anti-human' AILIM monoclonal antibody. . .

The vertical axis indicates the amount of cellular incorporation '.

of [³H] thymidine as.an index of the degree of cell proliferation, and the horizontal axis indicates the. concentration ^,of mouse anti-human AILIM monoclonal antibody.

In this figure, JHC1indicated result of assay in'which . 20 anti-human CETP monoclonal antibody was used as the negative control, instead of the mouse anti-human AILIM monoclonal antibody.

Figure 18 ^:shows proliferation activity of T cells derived from a normal healthy person donor B״ in the assay for the activity of . transducing costimulatory signal by various human anti-human AILIM monoclonal antibodies using a microplate coated with anti-human CD3 .monoclonal antibody- together, with human anti-human AILIM monoclonal '. antibody. י '

The vertical axis indicates the amount of cellular incorporation of [ H] thymidine as an index of-the degree of cell proliferation, and ‘ the horizontal axis indicates the concentration of human anti-human AILIM monoclonal antibody.'

In this figure, anti-KLH indicates result of assay in which human anti-KLH monoclonal antibody was used as the negative control, ׳. instead of the human anti—human AILIM monoclonal antibody.

³⁵ Figure 19 shows proliferation activity of T cells derived from a normal healthy person donor B.in the assay for the activity of . .

WO 01/87981 PCT/JPO1/04035 ⁷⁰ .-- .

transducing costimulatory signal by various human anti-human AILIM monoclonal antibodies using a microplate coated with anti-human CD3 • monoclonal antibody together with human anti-human AILIM monoclonal antibody. &lt; ' , ,

The vertical axis indicates the amount of cellular incorporation ' of [ H] thymidine as an index of the degree of cell proliferation, and the horizontal axis indicates the concentration of human anti—human : ' AILIM. monoclonal antibody.

In this figure, anti-KLH indicates result of assay in which human anti-KLH monoclonal antibody was used as the negative control , . instead of the human anti-human AILIM monoclonal antibody.

• Figure 20 shows proliferation activity of T cells derived from X X a normal healthy person donor C in the assay for the. activity of :

transducing costimulatory signal by various mouse anti-human AILIM monoclonal antibodies using a microplate coated with anti-human CD3 ¹ . monoclonal antibody together with mouse anti-human AILIM monoclonal antibody.

The vertical axis indicates the amount of cellular incorporation . °f [ H] thymidine as an index of the degree of cell proliferation, and 20 the horizontal axis indicates'the concentration of mouse anti-human ’,. AILIM monoclonal antibody. ' > .

: In this, figure, JHC1״ indicates result of assay in'which

2nti human CETP monoclonal antibody was used as the negative control , instead of the mouse anti-human AILIM monoclonal antibody.

Figure 21 shows proliferation activity of T cells derived, from . a normal healthy person donor C in ,the assay for the activity of transducing costimulatory signal by various human anti-human AILIM . monoclonal antibodies using a microplate coated with anti-human CD3. . monoclonal antibody together with human anti-human AILIM monoclonal 30 antibody. .

The vertical axis indicates the amount of cellular incorporation of [ H] thymidine as an index of the degree of cell proliferation, and the horizontal axis indicates the concentration of human anti-human AILIM monoclonal antibody. .

. . In this figure, anti-KLH indicates result of assay in which .human anti-KLH monoclonal antibody was¹ used as the ;negative control, - ,

<img file="IL147448A_D0003.tif" />

WO 01/87981 PCT/JPO1/04035

' ' .י,'.'.'.''' 71 ' . . ‘ ' ' instead of. the human anti-human AILIM monoclonal antibody.

Other notations are as follows : .

124״: human anti-human AILIM monoclonal antibody JMabl24.

126״: human anti-human AILIM monoclonal antibody JMabl26.

127:- human anti-human AILIM monoclonal antibody JMabl27. .

Figure 22 shows proliferation activity of T cells derived from . a normal-.healthy person 'donor C״ in the assay for the.activity, of transducing costimulatory signal, by various human anti-human'AILIM monoclonal antibodies using a microplate coated'with anti-human CD3 10 monoclonal antibody together with human anti-human AILIM monoclonal antibody.

The vertical axis indicates the amount of cellular incorporation of [ H] thymidine as an index of the degree of cell proliferation, and? the horizontal axis indicates the concentration of human anti-human . 15 AILIM monoclonal antibody.

. In this figure, anti-KLH indicates result of assay in which human anti-KLH monoclonal.antibody was used as the negative control, ¹instead of the human anti-human AILIM monoclonal ant.ibpdy,

Other'notations are as follows: ' ²⁰ 128: human anti-human AILIM monoclonal antibody JMabl28.

. 135: human anti-human. AILIM monoclonal antibody TMabi 3.5 , 136: human anti-human AILIM monoclonal antibody JMabl36.

. Figure 23 shows proliferation activity of T,cells derived from, a normal healthy, person donor C in the assay for the activity of 25 transducing costimulatory signal by various human anti-human AILIM monoclonal antibodies using a microplate coated with anti-human CD3 monoclonal antibody together with human anti-human AILIM monoclonal antibody. '. '.

The vertical axis indicates the amount of cellular incorporation 30 of [ H] thymidine as an index of the degree of cell proliferation, and the horizontal axis indicates the concentration of human anti-human AILIM monoclonal antibody.

In .this figure, anti-KLH indicates result of assay.in which human anti-KLH monoclonal antibody was used as the negative, control, 35 .instead of the human anti-human AILIM monoclonal, antibody.

Other notations are as- follows: ' .

W0 01/87981 PCT/JP01/04035 ' ^: . 72 . ' י ' . ' י. ' יי' י

137 '.׳:. human׳ anti-human AILIM monoclonal antibody JMabl37. 138: human anti-human AILIM monoclonal antibody JMabl38.

139: human.anti-human .AILIM monoclonal’antibody JMabl39:

. Figure 24 shows proliferation activity of T cells derived from a normal healthy person donor C in .the assay for the activity of transducing costimulatory signal by various human anti-human AILIM monoclonal antibodies using a microplate coated with anti-human CD3 monoclonal antibody together with human anti-7human AILIM monoclonal antibody. '. ׳...

The.vertical axis indicates the amount of cellular incorporation .

of. [³H] thymidine as an index of the degree of cell proliferation, and the horizontal axis indicates the concentration of human anti-human AILIM monoclonal antibody.

In this figure, anti-KLH״ .indicates result of assay ,in which’.

human anti—KLH monoclonal antibody was used as the negative control, instead of the .human anti—huma:n .AILIM monoclonal antibody.

Other notations areas follows: '

140: human anti-human AILIM monoclonal antibody. JMabl4:0 . ,141׳., human ,anti-human AILIM monoclonal antibody JMabl41.

׳. Figure 25 shows proliferation activity of T cells derived from a normal healthy person donor D in the assay for the activity of transducing costimulatory, signal by various mouse anti-human AILIM monoclonal antibodies using a microplate coated with anti-human CD3 . monoclonal antibody together with mouse anti-human AILIM monoclonal' antibody. . '

The vertical axis indicates the amount of cellular incorporation' of [ H] thymidine as an index of the degree of cell proliferation, and the horizontal axis indicates the concentration of mouse anti-human AILIM monoclonal antibody.

-³⁰ In'this figure, JHC1״ .indicates result of assay in. which anti-human CETP monoclonal antibody was used as the negative control, instead of the mouse anti—human AILIM monoclonal antibody.

Figure 26 shows proliferation activity of T cells derived, from a normal healthy person' donor D in the assay for the activity of 35 transducing costimulatory signal by various human anti-human AILIM ' monoclonal antibodies using a microplate coated with anti-human CD3 '1 'י ..r :’>f Ά (?(*.־־'. ^'7• י ..יו'll ?'.-i! . . t ' .״’,'״ ',. ';־' .

V /..־' .‘־י‘^, ,־,*’.־ .’-.־; ?י '-.‘*.ν+l.‘‘.^.׳ י׳־ו. ׳-׳.״.־.״.׳Λ V .ί ^/ך ‘ . ..׳ VS .,. , ־,Λ'׳־־א'< . .־.׳ ^A’־V. ^,'.י > יי . .-S ־'.: .,יי‘. . .־ WS ^fc> י “ * י Γ יי '.־. . י- , ־ ’.־ ..גי. י י -Λ -.. ». י .י י .־.' ?' ־ ־ .י . .5 ־- z.i ‘ .,, r ‘. «Λ ’. ;* ,!Κ. κ ׳. ' .^,'Λ׳:4 . ' י 3 .׳ ,V.; > י. . ?י,!.! א. .-5, . ’ . י Λ . *־'.'״־ .'׳.

WO 91/87981 .' . PCT/JP01/04035 ' 7 : 73 , . '.?

.monoclonal antibody together with .human'anti-human AILIM monoclonal׳ antibody.

The vertical axis indicates the amount of cellular incorporation ׳ .of [³H] thymidine as an index of the.degree of cell proliferation, and ^Ί5 the horizontal axis indicates the concentration of human anti-human . AILIM monoclonal antibody. .', ׳ In this .figure,׳. anti-KLH״ indicates' result of assay in which׳ . human anti—KLH monoclonal antibody was used as the negative control, '׳.׳ instead of the human anti—human AILIM monoclonal antibody.

Other notations are as follows:

124: human anti-human AILIM monoclonal antibody JMabl24. 126״: human anti-human AILIM monoclonal antibody JMabl26. 127: human anti-human AILIM monoclonal antibody JMabl27. .

Figure 27 shows proliferation activity of T cells derived.from .'׳ a normal healthy person donor D in the assay, for the activity of transducing costimulatory signal by various human anti-human. AILIM monoclonal antibodies using a microplate coated'with anti-human CD3' ׳ monoclonal antibody together with human anti-human AILIM monoclonal .: antibody.

The׳vertical axis indicates the amount of cellular incorporation of [ H] thymidine as an index .of the degree of cell proliferation, and ’ the horizontal axis indicates the concentration of mouse anti-human

:. AILIM monoclonal antibody.

In this figure, anti-KLH indicates result of assay in which human anti—KLH monoclonal antibody was used as the negative control, .instead.of the human anti—human.AILIM monoclonal antibody.

Other notations are as follows:.

128״: human anti-human AILIM monoclonal antibody JMabl28.

135״: human anti-human'AILIM monoclonal antibody JMabl35. ' .

. .136: human anti-human AILIM monoclonal antibody JMabl3'6.

Figure 28 shows proliferation activity of T cells derived from a normal healthy person donor D״ in the assay for the activity of transducing costimulatory signal by .-various human anti-human AILIM .

. monoclonal antibodies using a microplate coated with anti-human CD3 .monoclonal antibody together with human anti-human AILIM monoclonal

.. antibody. '. 7 .׳

׳.,.י ‘ . '. ' ?. '. . . / •.- . '. . ‘ . ‘ . ' ’, :,. ^a . . . ־ יי.' . . . ׳ ^u . ‘ i λ&lt;.¹ ^־־. * &lt;-^;י¹4יי λ ‘״../7./ . , ־^: / V. ..',,'.׳:.. י.Λ י.׳ ״

WO DI/87981 PCT/JP01/04035

'י' ץ ' י .־ . 74&lt; י' י, . '־ . .

The vertical axis indicates the amount of cellular incorporation:: of [³H] thymidine ,as an index of the degree of cell proliferation,. and the horizontal axis indicates the concentration of human anti-human 'י

AILIM monoclonal antibody,.

'5 In this figure, anti-KLH indicates result of assay in which/ human anti—KLH monoclonal antibody was used as the negative control instead of the human anti-human AILIM monoclonal antibody.

Other notations are as follows:

137: human anti-human AILIM monoclonal. antibody JMabl37. .

,¹⁰ .138״: . human anti-human AILIM monoclonal- antibody JMabl3 8.-.

139 . ־: human anti-human AILIM monoclonal antibody JNabl39. ׳ /

Figure 29 shows proliferation activity of T cells derived from ' / /' i a normal healthy person donor D in the assay .for the activity of-./'>: ׳/ ׳ transducing costimulatory signal by various human anti-human AILIM ׳: / 15 monoclonal antibodies using a microplate coated with anti-human CD3 monoclonal antibody together with human anti-human AILIM monoclonal antibody.

The vertical axis indicates the amount of cellular incorporation of [ H] thymidine as .an index, of the degree of :cell proliferation, and ' 20 the horizontal axis indicates the concentration of human anti-human .

AILIM monoclonal antibody. . . .

In this figure, anti-KLH indicates result of assay in which ׳ human anti-KLH monoclonal antibody was used as the negative control , instead of the human anti—human AILIM monoclonal׳antibody.

Other notations are as follows: ' .,. 140: human anti-human AILIM monoclonal antibody JMabl40.

141: human anti-human.AILIM monoclonal antibody JMabl41.

Figure 30 shows.proliferation activity of T cells derived from / a normal healthy person donor E in the assay for the activity of.

transducing costimulatory signal by various mouse anti-human AILIM monoclonal antibodies using a microplate coated with anti-human CD3 ' monoclonal-antibody together with mouse anti-human AILIM monoclonal antibody.

The vertical axis indicates the amount of cellular incorporation . 35 . of [ H] thymidine as an index of the degree of cell proliferation, and the horizontal axis indicates, the concentration of mouse anti-human '

WO 01/87981 PCT/JP01/04035 .

י' / - . . . ⁷⁵ .. ' ' '

AILIM monoclonal .antibody.

In this figure, JHC1״ indicates result of assay in. which anti-human CETP .monocl'onal antibody was used as the negative control,' . instead of the mouse anti-human AILIM monoclonal antibody.

5־ Figure 31 shows proliferation activity of T cells derived from a normal healthy.person donor E״ in the assay for the activity of . . transducing costimulatory signal by various human anti-human AILIM ._: monoclonal antibodies .using a microplate.'coated- with anti-human CD3 monoclonal antibody together with human-anti-human. AILIM monoclonal''. -.-.10 antibody.

' The vertical axis indicates the amount of cellular incorporation י' ' of [³H] thymidine as:an index of the degree of cell proliferation, and the horizontal axis indicates the concentration of human anti-human AILIM monoclonal antibody. ’ . '

-^5 I¹¹ this figure, anti-KLH indicates .result of assay in which human anti-KLH monoclonal antibody was used as the negative control/ .instead of the human anti-human AILIM monoclonal, antibody. : Other notations are.as follows: :

124״: human .anti-human AILIM monoclonal antibody ״JMabl2 4 . ' 2θ 126:. human anti-human AILIM monoclonal antibody JMab 126. .

127:. humari anti-human AILIM monoclonal antibody. JMabl27.

Figure 32 shows proliferation activity of T cells derived from .' a normal healthy person donor E in the assay for.the activity of' transducing costimulatory signal by various human, anti-human AILIM 25 monoclonal antibodies using a microplate coated with anti -human CD3 monoclonal antibody together with human anti-human AILIM monoclonal antibody.'

The vertical axis indicates the amount of cellular incorporation of [ H] thymidine as an index of the degree of cell proliferation, and 30 the horizontal axis indicates the concentration of human anti-human' ־' AILIM monoclonal' antibody.

In this figure, anti-KLH indicates result of assay in which human anti-KLH monoclonal antibody was used as the negative control, instead of the human anti-human .AILIM monoclonal antibody.

Other notations are as follows: .

.128: human anti-human AILIM monoclonal antibody JMabl28.

WO 01/87981 . 76 :

1.35: human anti-human AILIM monoclonal antibody JMabl3.5. / . 136: human anti-human AILIM monoclonal antibody JMabl36. '

Figure 33 shows proliferation activity of T cells derived from ' a normal healthy person donor. E in the assay for the activity of.

.5 transducing costimulatory signal by various-human anti-human AILIM * monoclonal antibodies using a microplate coated with anti-human CD3 . monoclonal antibody .together with .human anti-human AILIM monoclonal ל' ל antibody. '.'.'.;.

The vertical axis indicates the amount of cellular incorporation ׳ of [³H] thymidine as an index of the degree of cell’proliferation, and . . . the horizontal axis indicates the concentration of human anti-human '

AILIM monoclonal antibody.

In this figure, anti-KLH indicates result of assay in which .

; ' . human anti-KLH monoclonal antibody was used as the negative control, .׳ . . .15 instead of the human anti-human AILIM ׳.monoclonal antibody. .

Other notations are as follows: .

137: human anti-human AILIM monoclonal antibody JMabl37.

138:. human anti-human AILIM monoclonal antibody JMabl38. .139״: human anti-human AILIM monoclonal antibody JMabl39.

.: Figure 34 shows proliferation activity of T cells derived from

a. normal healthy person donor E in the assay for. the activity of 'transducing costimulatory signal by various human anti-human AILIM . monoclonal antibodies using a microplate .coated with anti-human CD3 monoclonal antibody together with human anti-human AILIM monoclonal ׳'. ׳ antibody, . The vertical axis indicates the amount of cellular incorporation • of [³H] thymidine as an index of the degree of cell proliferation, and the horizontal axis indicates the.concentration of human anti-human AILIM monoclonal antibody . .

³θ In this figure, anti-KLH indicates result of assay in which human anti-KLH monoclonal antibody was used as the negative control, . instead of the human anti-human .AILIM monoclonal antibody. ,

Other, notations’are as follows: .

140: human anti-human AILIM monoclonal׳ antibody JM3h 4 ך η &lt;

³⁵ .141: human anti-human AILIM.monoclonal antibody JMabl41. ' ' Figure 35 shows .proliferation activity ,of . T'cells derived from '

VVOOI/87981 PCT/JP01/04035 ' . .77 .ל.־..;.....

a normal healthy person donor D in׳the assay for the activity of various mouse anti-human AILIM monoclonal antibodies to transduce' costimulatory signal, when a solution of mouse anti-human ' AILIM. monoclonal antibody (in liquid phase) was added alone to a microplate ' . coated, with anti-human CD3 monoclonal antibody. .

The vertical axis indicates the amount of cellular incorporation of [³H] thymidine as an index of the degree of cell proliferation, and the horizontal axis indicates the concentration of mouse anti-human

AILIM monoclonal 'antibody.

¹⁰׳. In this figure, JHC1 indicates result of assay in which ., anti-human . CETP monoclonal antibody was used as the negative control, instead of the mouse anti—human AILIM monoclonal antibody. ' . Figure 36 shows proliferation activity of T cells derived from . a normal healthy person donor D in the assay for the'activity of' 15 ,various human anti-human AILIM monoclonal antibodies to transduce ׳ costimulatory signal when a solution of human anti-human AILIM monoclonal antibody (in liquid phase) was added .alone to a microplate .' coated with anti-human CD3 monoclonal antibody.

. The vertical axis indicates the amount of cellular incorporation 20 of [³H] thymidine as an index of the degree of cell proliferation, and ,thehorizontal axis indicates the concentration of human anti-human .' AILIM monoclonal antibody,.

In this figure, anti-KLH indicates result of assay in which human anti-KLH monoclonal antibody was used as the negative control, 25 instead of the human anti—human AILIM monoclonal antibody.

Other notations are as follows:

124: human anti-human AILIM monoclonal antibody JMabl24.

125: human anti-human AILIM monoclonal antibody JMabl25.

126: human anti-human AILIM monoclonal' antibody JMabl26.

Figure 37 shows proliferation activity of T cells derived from a normal healthy person donor D in the assay for the activity of various human anti-human AILIM monoclonal antibodies to transduce costimulatory signal when a solution of human anti-human AILIM monoclonal antibody (in liquid phase) was added alone to a microplate coated with anti-human CD3. monoclonal antibody;

The vertical axis indicates the amount of cellular incorporation.

<img file="IL147448A_D0004.tif" />

WO 01/87981 PCT/JPI) 1/04035

.. 78 /.

of [³H] thymidine as an index of the degree of cell proliferation,'and . the horizontal axis indicates the concentration of human anti-humah AILIM monoclonal antibody.

In this figure,_;anti-KLH״ indicates result of assay in which . human anti-KLH monoclonal antibody was used as the negative control, instead of the. human anti-human AILIM monoclonal antibody.

. Other notations are as follows: :

128: human anti-human AILIM monoclonal antibody JMabl28.

. . 135: human anti-human AILIM monoclonal' antibody .JMabl35.ⁱ. . Αθ 136: human anti-human AILIM monoclonal antibody'JMabl36 .

' Figure 38 shows proliferation activity of T cells derived from a normal healthy person donor D in the .assay for the activity of various human anti-human AILIM monoclonal antibodies to transduce costimulatory signal .when a solution of human anti-human AILIM 15 monoclonal antibody (in liquid phase) was added alone to a microplate. .

coated with anti-human CD3 monoclonal antibody.

The vertical axis indicates the amount of cellular incorporation.׳ . of [ H] thymidine as an index of the degree of cell proliferation, and , the horizontal axis indicates the concentration of human anti-human :׳ 20 AILIM monoclonal antibody. .. .

. .In this figure, anti-KLH indicates result of .assay in which . human anti—KLH monoclonal antibody wals used as the negative control, instead of the human anti—human AILIM monoclonal antibody.

.'' Other notations are as follows:

?5. . 137: human anti-human AILIM monoclonal antibody JMabl37.

138: human anti-human AILIM monoclonal antibody JMabl38. 139: human anti-human AILIM monoclonal antibody JMabl39.

־ Figure 39 .shows proliferation activity of T cells derived from ! a normal healthy person donor D in the assay for the activity of 30. various,human anti-human AILIM monoclonalantibodies to transduce . costimulatory .׳ signal when a solution of human anti-human AILIM monoclonal antibody (in liquid phase) was added alone to a microplate coated with anti-human CD3 monoclonal antibody.

The.vertical axis indicates the amount of cellular incorporation 35 of [³H] thymidine as an index of the degree of cell proliferation, and the horizontal axis, indicates the concentration of .human anti-human ' V ‘״' '*' לין */' , י Λ-' *’ ' *־ ץ. .'ί j* י‘,','י ׳-’: ,'.f'־, ‘׳/'.I'. !’‘י. /״ ’ ׳ ^tf '־־'* ^י_י-/.'' ־'־λ י ' יי &lt;'. ''ן' ז,.). י ’.־ י', י י .׳ י ₎־ ., י :Η.׳.׳?״YyTtyy-'yyy&amp;yyy ;?־,״/ ־.,.,^,*ל

WO01/8798J . PCT/JPDl/04035

י ⁷⁹ ־

AILIM monoclonal antibody.

In׳ this figure, anti-KLHindicates result of assay'in which . human anti-KLH monoclonal antibody was used as the negative control,' . instead of the human anti—human AILIM monoclonal antibody.

׳ Other notations are as׳ follows: ,

140: human anti-human AILIM monoclonal antibody TMahl40 ? .

141: .human anti-human AILIM monoclonal antibody JMabl41. . Figure 40 shows the amount of IFN-γ produced in the culture supernatant of T cells derived from a normal healthy person donor

B, ״ .which were cultured in a microplate coated with mouse anti-human ' AILIM monoclonal antibody together with anti-human CD3 monoclonal . antibody.

The vertical axis indicates the concentration of IFN-γ, and the :׳'i horizontal, axis indicates the concentration of the mouse anti-human .15 AILIM monoclonal antibody.

In this figure, JHC1 indicates result of assay in which ׳ ^anti-human CETP monoclonal antibody was used as the negative control, . instead of the'mouse anti-human AILIM monoclonal,antibody. . :'.'.''

Figure 41 shows the amount of IFN-γ produced in the culture ' supernatant of T cells derived from a.normal healthy person donor . ,B,which were cultured in a microplate coated with human anti-human

AILIM monoclonal antibody together with anti-human CD3 monoclonal, antibody.

, The vertical axis.indicates the concentration of IFN-γ, and the horizontal axis indicates the.concentration of the mouse anti-human . AILIM monoclonal antibody.

In this figure, anti-KLH indicates result of assay in which ' human anti-KLH monoclonal antibody was used as the negative control, > . instead of the.human anti-human AILIM monoclonal antibody.

. Figure 42 shows the amount of IFN-ή׳ produced in the culture supernatant of T cells derived.from a normal healthy person donor B, which were cultured in a microplate coated with human anti-human AILIM monoclonal antibody together with anti-human CD3 monoclonal antibody .־;

The vertical axis indicates the concentration of IFN-γ, and the • horizontal axis indicates, the concentration of the mouse anti-human .

WO 01/87981 PCT/JP01/04035

' ־ ' // ' ' . 80. '. ;י .

AILIM monoclonal antibody.

_; In this figure, anti-KLH indicates result of assay inwhich ; human anti-KLH monoclonal antibody was. used as the negative control;

instead of the human anti-human AILIM monoclonal .antibody. ־

5. Figure 43 shows the. amount. of IFN-γ produced in the culture ' supernatant of T.cells derived from a normal, healthy person 'Monor ' C, ״ which were cultured in a microplate coated with mouse anti-human AILIM monoclonal antibody together with anti-human CD3 monoclonal antibody. ׳.

The vertical axis indicates the concentration of IFN-γ, and the horizontal axis indicates the concentration of the mouse anti-human . AILIM monoclonal.antibody.

In this figure, JHC1 indicates result of assay in which anti-human CETP monoclonal antibody .was used as the negative control.,¹.' instead of the mouse anti-human AILIM monoclonal.antibody.

. .Figure 44 shows the amount of IFN-γ produced in the culture .^:supernatant. of T cells derived from a normal healthy person donor : C, which .׳were culturedin,a microplate.coated .with human anti-human ‘י AILIM monoclonal antibody together with anti-human CD3 monoclonal 20 . antibody.

The vertical axis indicates the concentration of IFN-γ, and the horizontal axis Indicates the concentration of the mouse anti-human

AILIM monoclonal antibody.

Inthis/figure, anti-KLH indicates result of assay in.which : 25 human anti—KLH monoclonal antibody was used as the negative control, instead of the.human anti-human AILIM monoclonal antibody.

Other notations are as follows:

124: human anti-human AILIM monoclonal antibody JMabl24. .125״:' human anti-human AILIM monoclonal antibody JMabl25.

'126: human anti-human AILIM monoclonal antibody JMabl25.

Figure 45 shows the amount of IFN-γ produced in the culture supernatant of T cells derived from a normal healthy person donor

C, which were cultured in a microplate coated with human anti-human . AILIM monoclonal antibody together'with anti-human CD3 monoclonal

35. antibody.

The vertical axis indicates the. concentration of IFN-γ, and the.

WO 01/87981 PCT/JP01/04035 . ' ' 81 horizontal :axis., indicates the. concentration of the mouse anti-human AILIM monoclonal antibody. ׳; '

In this figure, anti-KLH״ indicates result of assay in which human anti-KLH monoclonal antibody was used as the' negative control , .

.5 instead of the human anti-human AILIM monoclonal antibody. . V ' .

. Other notations are as .follows : ׳ '. '

128'': human anti-human AILIM monoclonal antibody JMabl28.

135: human anti-human AILIM monoclonal.antibody JMabl35. ' 136: human anti-human AILIM monoclonal׳ antibody JMabl36. ^; . .Figure 46. shows the'amount of IFN-γ produced in the culture ״ ' supernatant of T cells derived from a normal healthy person donor . C,״ which were cultured in a microplate coated with human anti-human . . AILIM monoclonal antibody together with anti-human CD.3 monoclonal . antibody. .׳: .־', . The vertical axis indicates the concentration of IFN-γ, and the'', .־ ' .horizontal axis indicates the .concentration of the mouse anti-human ׳. .AILIM monoclonal antibody. _; . ׳?. , ׳

In this׳ figure, anti-KLH indicates.result of assay .in which י' human anti-KLH monoclonal antibody,was used as the negative control, instead of the human, anti-human AILIM monoclonal antibody.

Other notations are as׳ follows: :.

137: human anti-human AILIM monoclonal antibody JMabl37. .

”138: human anti-human AILIM monoclonal antibody JMabl38. ...

139:. human anti-human AILIM monoclonal antibody JMabl39. '

2.5 Figure 47 shows the amount of IFN-⁷/ produced in the culture supernatant of.T.cells.derived from a normal healthy person donor ־ C, ״ which were cultured in a microplate coated with human anti-human .'. AILIM monoclonal antibodytogether with anti-human CD3 monoclonal antibody.

³θ The vertical axis indicates the concentration of IFN-γ, and the . .horizontal axis indicates the concentration of the mouse anti-human AILIM monoclonal antibody.

In this figure, anti-KLH indicates result of assay in which . human anti-KLH monoclonal antibody _was used as the negative control, )־ instead of the human anti-human AILIM monoclonal antibody.' . Other notations are as follows:

WO 01/87981 PCT/JPO1/04035 ⁸² '^ύ .14.0: human. anti-human AILIM monoclonal antibody JMabl4Q, / 141: human anti-human AILIM monoclonal antibody JMabl4!, . Figure 48 shows the inhibitory, effect on .T cell proliferation :. in the case .of culturing T cells from'a normal healthy person donor 5 A , with PBMC of a normal healthy person donor D by various test samples in the proliferation test of the. T cells. through the mixed . .lymphocyte reactions (MLR) . .

The vertical axis indicates the amount of incorporation of .[³H] '׳ thymidine as an index showing a level of cell proliferation, and the' ׳ 10 horizontal axis shows the concentration of the test samples.

Each description in the figures;shows the following.

. CD80 + 86״: The mixture of anti-CD80 antibody and anti-CD86 antibody ' mlgGl: Anti—human CD34/IgGl mouse monoclonal antib.ody

CTLA4-Ig: Human CTLA4-IgFc chimeric molecule .

^,SA12: Anti-human AILIM mouse monoclonal antibody .

Figure 49 shows the inhibitory .effect on T cell proliferation in the case of culturing T cells from a normal healthy person donor A , with PBMC of a normal healthy person donor D by various human anti-human AILIM monoclonal antibodies in the proliferation test of •20 the T .cells through the mixed .lymphocyte reactions (MLR) .

The vertical axis indicates the amount of incorporation of [³H] thymidine as an index .showing a level of cell proliferation,' and the' ..horizontal axis shows the concentration of the test.samples. '

Other notations are as follows:

anti-KLH: human anti-KLH monoclonal antibody as a negative ^! .control. ..':.י.'.־ . JMab-124: human anti-humanAILIMmohoclonal antibody JMabl24. ;

126: human anti-human AILIM monoclonal antibody JMabl26.: 127: human anti-human AILIM monoclonal antibody . JMabl27.

128: human anti-human AILIM monoclonal antibody JMabl28.

.135:. human anti-human AILIM monoclonal antibody JMabl35. _;136: human anti-human AILIM monoclonal antibody JMabl36. 137: human anti—human AILIM monoclonal antibody JMabl37. Figure 50 shows the inhibitory effect on T cell proliferation 35 inthe case of culturing T cells from a normal healthy person donor ' D, with.PBMC of a normal healthy person donor B by various test .

///>1' ¾/

WO 01/87981 PCT/JP01/040J5 ' . 83 ' ' samples in the proliferation' test of the T cells through the.mixed ' lymphocyte reactions (MLR) . .

The vertical axis indicates the amount of incorporation of [³H] thymidine as an index showing a level of cell, proliferation, and the ;5 . horizontal, axis shows the. concentration of the test samples.

.Each description in the figures shows the following.

CD80 + 8 6״: The mixture of anti-CDBO antibody and anti-CD86 antibody mlgGl; Anti-human.CD34/IgGl mouse monoclonal antibody CTLA4-Ig: Human CTLA4-IgFc chimeric molecule

SA12״: Anti-human AILIM mouse.monoclonal antibody . Figure 51 shows the inhibitory effect on T cell proliferation in the.case of.culturing T cells from a normal healthy person donor .:D, with PBMC of a normal healthy person donor B by various human .anti-human AILIM monoclonal antibodies in the proliferation test of ;

.15 the T cells through the mixed lymphocyte reactions (MLR).

The vertical axis indicates the amount of incorporation .of [³H] thymidine as an index showing a level of cell proliferation, and the horizontal axis shows the concentration of the test samples. ' Other notations are as follows:׳.

.anti-KLH:׳ human anti-KLH monoclonal antibody as a negative ' ־ . .control. ; . ' :

JMab-124 : human anti-human AILIMmonoclonal antibody JMabl24 .

126״: human anti-human AILIM monoclonal antibody JMabl26.

127: human anti-human AILIM monoclonal antibody JMab 127. .

²⁸ 128: human anti-human AILIM monoclonal antibody JMabl28.

135:. human anti-human AILIM ׳monoclonal antibody JMabl35.

.136: human anti-human AILIM monoclonal antibody JMabl36. ;

137; human anti-human AILIM monoclonal antibody JMabl37. .

Figure 52 shows the inhibitory effect on T cell proliferation in the case of culturing. T cells from a normal healthy person donor C, with PBMC of a normal healthy person donor A' by various test samples in the proliferation test of the T cells through the mixed lymphocyte reactions (MLR). ' ׳ ;

The vertical axis indicates the amount of incorporation of [³H] 35 thymidine as an index showing a level of cell proliferation, and the . horizontal axis shows.the concentration of the.test samples. \

W.O 1)1/87981 . PCT/JP01/04035 ' ''י, . '. 84 י/' .

Each description in׳ the figures'shows.'the following.

CD80. + 86: The.mixture of .anti-CD80 antibody and anti-CD8 6 antibody ; mlgGl: Anti-human CD34/IgGl. mouse monoclonal antibody . CTLA4-Ig: Human CTLA4-IgFc chimeric molecule . . .

'5. SA12: Anti-human AILIM mouse monoclonal antibody; '

Figure 53 shows the inhibitory effect on T cell proliferation ,in the case of culturing. T cells from a . normal'healthy person donor ' C, with PBMC of a normal healthy person donor A by various human ,anti-human AILIM monoclonal antibodies in the proliferation test of .10. the T cells through the mixed lymphocyte reactions .'(MLR) .

The vertical axis indicates the amount of incorporation of .[³HJ ' thymidine as an index showing a level of cell proliferation, and the / horizontal .axis shows the concentration'of the’test samples.

,.Other notations are as follows: . . :

15. anti-KLH״: human anti-KLH monoclonal antibody as a negative '^! . control. , ׳.׳.

JMab-124: human anti-humaii AILIMmonoclonal antibody JMabl24. t 126״: human anti-human AILIM monoclonal 'antibody JMabl26.

127: human anti-human AILIM monoclonal antibody JMabl27,'.

.'²⁰128 . ' י: human anti-human AILIM monoclonal antibody JMabl28.’

135: human anti-human AILIM monoclonal antibody JMabl35..

136: human anti-human AILIM monoclonal antibody JMabl36.:..

137: human anti-human AILIM' monoclonal antibody JMabl37.׳׳ '

Figure 54 shows the inhibitory effect on T cell proliferation

׳. in the case of culturing T׳ cells from a normal.healthy person donor E, with PBMC of a normal healthy person donor G by various test , samples in’the ,proliferation test of the T cells ,through' the .mixed .lymphocyte reactions (MLR).

The vertical axis indicates the amount of incorporation of .[³Hj 3Ό thymidine as an index showing a level of cell proliferation, and the horizontal axis shows the concentration of the test samples.

.Each description in the figures shows the following. . . , .:control mlgG: Anti-human CD34/IgGl mouse monoclonal antibody CD80 + 86 Ab: The mixture of anti-CD80 antibody and anti-CD86 antibody .

SA12: Anti-human.AILIMmouse monoclonal antibody

CTLA4-Ig: Human.CTLA4-IgFc. chimeric molecule . . ׳

WO 01/87981 ' י PCT/JFO1/04035

,... יו י', . . . ׳ י'?''.'^,'' ' ' . ' ' ־ י⁸⁵ י .,'' / ־ י' '

Figure 55 shows the inhibitory effect.on T cell׳proliferation ׳ in the case of culturing T cells from a normal healthy’person donor . E, with PBMC. of a normal healthy person ,donor. G by various human ' anti-human AILIM monoclonal antibodies in the proliferation test of . . 5 the T cells through the mixed lymphocyte reactions (MLR).

The vertical axis indicates the amount, of incorporation of [³H] thymidine as an index showing a level of cell proliferation, and the horizontal axis shows the concentration of the test samples.

Other' notations ;are as follows: ׳'

Ιθ . anti-KLH,: human anti-KLH monoclonal antibody as a negative / control.

JMab-136: human anti-human AILIMmonoclonal antibody JMabl36. 138: human anti-human AILIM monoclonal antibody JMabl38. . 139״: human anti-human AILIM monoclonal antibody JMabl39.

.140״:. human anti-human AILIM monoclonal/antibody JMabl40. .

141: human anti-human AILIM monoclonal antibody.JMabl41. Figure 56 shows the inhibitory effect on T cell proliferation .' in the case of culturing T cells from a normal healthy person donor F, with PBMC of a normal healthy person donor E by various test .

samples in the proliferation test.of the T cells through the mixed ' lymphocyte reactions (MLR).

The vertical axis indicates the amount of incorporation of [³H] / thymidine as an index showing a level of cell proliferation, and the horizontal axis. shows the.concentration of the test samples.

Each description in the figures shows the following, control mlgG:. Anti-human CD34/IgGl mouse monoclonal antibody.

CD80 + 86 Ab״ : The mixture of anti-CD80 antibody and anti-CD86 antibody ׳ SA12״: Anti-human AILIM mouse monoclonal antibody

CTLA4-Ig: Human CTLA4-IgFc chimeric;molecule ²θ Figure 57 shows the. inhibitory effect on T cell proliferation in.the case of culturing T cells from a normal healthy person donor .’ F, with PBMC of a normal healthy person donor.E by various test samples in the proliferation test of the T cells through the. mixed '.lymphocyte reactions .(MLR). .

The vertical axis indicates the amount of incorporation of [³H] thymidine as an index showing a level of cell proliferation, and the ;

WO 01/8798] PCT/JPO 1/04035 horizontal axis shows the concentration .of the test samples. :--/ . Each description in .the figures shows' the. following. ' anti-KLH: human anti-KLH monoclonal antibody as a negative control.

. JMab-136: human anti-human AILIMmonoclonal antibody TMahi 717

138: human anti—human AILIM monoclonal antibody JMabl38.

. 139 human anti-human AILIM monoclonal antibody Twah 1 7 Q _ 140: human anti-human AILIM monoclonal antibody JMabl'4Q_: ':. 141״: human anti-human AILIM monoclonal antibody. JMabl41'

Figure .58 shows the inhibitory effect on T cell proliferation ^: .'י . in the case of culturing T cells from a normal healthy person donor G i with PBMC of a normal healthy person donor F by various test ' ' samples in the proliferation test of the T cells through the mixed' ' .,lymphocyte reactions (MLR) . :

The vertical axis indicates the amount of incorporation of [³H] .

,thymidine .as an index showing a level of cell proliferation, and the horizontal axis shows theconcentration of the test samples. .

Each description in the figures shows the following. 'י י control mlgG״: Anti-human CD34/IgGl mouse monoclonal antibody' . . CD80 + 86 Ab.״ : The mixture of anti-CD80 antibody and. anti-CD86 antibody / SA12: Anti-human AILIM mouse monoclonal antibody CTLA4-Ig: Human CTLA4-IgFc chimeric molecule .Figure 59 shows the inhibitory effecton T cell proliferation . . in. the case of culturing T cells from a normal healthy .person donor

25. G, with PBMC of a normal healthy person donor F by various test/ samples in the proliferation test of the T cells through the mixed . .lymphocyte reactions . (MLR) . . '. ׳’ ', .

The vertical axis indicates the amount of incorporation of [³H] . thymidine as an index showing a level.of cell proliferation, and the 50 horizontal axis shows the concentration of the test samples.

Each description in_: the figures shows the following.

anti-KLH: human anti-KLH monoclonal antibody as a negative control., .

JMab-136human anti-human AILIMmonoclonal antibody JMabl36 .׳ '5. 138: human anti-human AILIM monoclonal antibody JMabl38. י

139: human anti-human AILIM monoclonal antibody JMabl39.

WOOl/87981 PCT/JP01/04035 ' 87:. ' , ׳ /' .

140״:'human anti-human AILIM monoclonal antibody JMabl40. ' '141״: human anti׳־-human AILIM monoclonal antibody JMabl41. Figure 60 shows the .inhibitory .effect .of various'control test ’ substances on the. proliferation of T cells in the assay using mixed.

'5 lymphocyte reaction (MLR) . T cells from a normal healthy person donor A were co-cultured with PBMCs from a normal' healthy person donor D pre-cultured in the presence of human CTLA4-Ig chimeric molecule. .

The vertical axis indicates the amount.of cellular incorporation of .[³H] thymidine as an index of the degree of :cell proliferation,.and Γ 10 the horizontal axis indicates the concentrations of test substances. . Each description in the figures shows the following.

CD80 + 86 : The mixture of anti-CD80 antibody and anti-CD86 antibody i mlgGl: Anti-human CD34/IgGl mouse monoclonal antibody

SA12״: Anti-human'AILIM mouse monoclonal antibody !5 Figure 61 shows the inhibitory effect of various human anti-human . AILIM monoclonal antibodies on the proliferation of T cells in the' assay using mixed lymphocyte reaction (MLR). T cells from a'normal healthy person donor A״ were co-cultured with PBMCs from a normal .: healthy person donor D״ pre-cultured in the presence of human CTLA4-Ig 20 chimeric molecule.

The vertical axis indicates the.amount of cellularincorporation׳ of [³Hj thymidine as an.index of the degree of cell proliferation, and . . the horizontal axis indicates the concentrations of test substances.

Other notations' are as follows:

anti-KLH:. human anti-KLH monoclonal antibody as a negative . control. '

JMab-124: human anti-human AlLIMmonoclonal antibody JMabl24.

126: human anti-human AILIM monoclonal antibody JMabl26.

127״: human anti-human AILIM monoclonal antibody JMabl27.

³⁰ 128״: human anti-human AILIM monoclonal antibody JMabl28.

135: human anti-human AILIM.monoclonal antibody JMabl35. 136; human anti-human AILIM monoclonal antibody JMabl36.

. 137:. human anti-human AILIM monoclonal antibody JMabl37. Figure 62 shows the inhibitory effect of various control test substances on the proliferation of T cells in the assay using mixed lymphocyte reaction (MLR) . T cells from a normal healthy person donor

WO 01/87981 PCT/JP01/04035 'י. θ8 '..י ..

D״ were co-cultured .with PBMCs from a normal healthy person donor . B״ pre-cultured in the presence of human CTLA4-Ig. chimeric molecule. ^: ' The vertical axis indicates the amount of cellular incorporation ^:of [³H] thymidine as an index of the degree of cell proliferation, and 5 the horizontal axis indicates the concentrations of test substances.

Each description in the figures shows the following.

. CD80 .+ 86״: The mixture.of anti-CD80 antibody and anti-CD86 antibody . ’ mlgGl: Anti-human CD34/IgGl mouse monoclonal antibody SA12: Anti-human AILIM mouse monoclonal,antibody

'.10׳ . Figure 63 shows the inhibitoryeffect of various human anti-humari. '.;

'. AILIM monoclonal :antibodies on .the proliferation of T cells in the assay using mixed lymphocyte reaction (MLR). . T cells from a normal healthy person donor.D״ were co-cultured with PBMCs from a normal,, healthy person donor B pre-cultured in the presence of human CTLA4-Ig .’ 15 chimeric molecule.’

The vertical axis indicates the amount of cellular incorporation . of [³H] thymidine as an index of the degree of cell proliferation, and, the horizontal axis’indicates the concentrations of test substances . Other notations are as follows:

. anti-KLH: human anti-KLH monoclonal antibody as a negative, . -control.

. JMab-124: humananti-humanAILIMmonoclonal antibody JMabl24. .

126: human anti-humanAILIM.monoclonal antibody JMabl26. ¹ ׳’ .127: human’anti-humari AILIM monoclonal .antibody JMabl27.

. ²⁵ 128״: ;human anti-human AILIM monoclonal antibody JMabl28.

135: human.anti-human AILIM monoclonal antibody JMabl35.

.136: human anti-humanAILIM monoclonal aritibody JMabl36.

’137״: human anti-human AILIM monoclonal .antibody JMabl37, Figure 64 shows the inhibitory effect of various control test .30 substances on the proliferation of T cells in the assay using mixed lymphocyte reaction (MLR) . T cells from a normal healthy person donor C were co-cultured with PBMCs from a normal healthy person donor A pre-cultured in the presence of human CTLA4-Ig chimeric molecule. !

The vertical axis indicates the amount of cellular incorporation.

. 35 . of [ H] thymidine as an index of the degree of cell proliferation, and : the horizontal axis indicates the concentrations of test substances , . :

^; : . /'¹.''/ύλΐΐ׳:?: ’r ׳ ./,.לΜ: ' '”?//,.: ' ’ ׳,!.׳': יי/.׳' י: .: j

WO 01/87981 PCT/JP01/04035 ' . י' ' ל. . . ' X

Each description in the figures shows the followingX CD80 4- 86״: The mixture.of anti-CD80 antibody and anti-CD86 antibody. mlgGl: Anti-human CD34/IgGl .mouse monoclonal antibodyX.

SA12״.: Anti-human AILIM mouse monoclonal antibodyX ' . .5 . Figure 65 shows the inhibitory effect of various human anti-human . ..

AILIM monoclonal antibodies on the. proliferation of T cells in the .

. . assay using mixed lymphocyte reaction ' (MLR). T cells from a normal healthy person donor C were co-cultured with PBMCs from a normal . healthy person donor A״ pre-cultured in the presence of human CTLA4-Ig . 10 chimeric molecule.

• The vertical axis indicates the amount of cellular incorporation of [³H] thymidine as an index of the degree of cell proliferation, and' ל the horizontal axis indicates the concentrations of test substances !, : Other notations are as.follows:

anti-KLH: human anti-KLH monoclonal antibody as a negative control. . ל

JMab-124״ : human anti-human AILIMmonoclonal antibody JMabl24. ' X 126: human anti-human AILIM monoclonal antibody JMabl26. :׳

127 : human, anti-human AILIM monoclonal antibody !JMabl27 ..'

2θ128” ־: human anti-human AILIM monoclonal antibody JMabl28.

135: human anti-human AILIM monoclonal antibody JMabl35.

136״: human anti-human'AILIM monoclonal antibody JMabl36. X . .137: human anti-human AILIM monoclonal antibody JMabl37. ^:

Figure 66 shows the inhibitory effect of various control test substances on the proliferation.of T cells in the assay using mixed ^:lymphocyte reaction (MLR) . T cells from a normal healthy person donor E were, co-cultured with PBMCs from a normal healthy person donor G pre-cultured in the presence of human CTLA4-Ig chimeric molecule. ׳ The vertical axis indicates the amount of cellular incorporation of [ H]thymidine as an index of the degreeof cell proliferation, and the horizontal axis indicates the concentrations of test substances.

Each description in.the. figures shows the following. .

control mlgG: Anti-human CD34/IgGl mouse monoclonal antibody CD80 + 8 6 Ab ״.:.The mixture of anti-CD80 antibody and anti-CD8 6 antibody

SA12: Anti—human AILIM mouse monoclonal antibody

Figure 67 showsthe inhibitory, effect of various human anti-human .ל ' . ־ .χ χ. ‘ ' X. ’* - ׳ . ׳.,׳ ל י * ‘ . .//.

,X; .' .’. X‘,.XX.'*^:־X ׳;ל־-.'X'.^;׳ X XΛ; י לל /י‘, x XXXX.;.׳ ' .,׳ ־ X’, ל X. ..,־ X ;?״χ׳! ׳.‘x ’. X X X.־.׳.

X .־«.ד ׳יגל. ־. aMT*לי .ל .,:.></< ־ XX' . ’-'^,.ל ־. .י י. , XXXh. ג. ל-־;ללל7. ../. . י, ל. - : ‘ל ?>.״ ?י . ־ י ». ΧχΧ, ל- X .לל־ *’־ * ־,’ ל. ־.^,. /.י>.‘: ., X . -־. , ״ . .ך.;tj). Μ־ ־ Λ..« 'ί, .^,.J .י. _י . . :,π'.;.. /.זי־ ־.־^, לל-.^,‘־ .־ '!';Λ. .! .ל־. .ן־‘ '.י. ־ / V.ל ; ־׳'>'׳ ’.’׳ t '.,.. .. 1 . ,. ל,. .' -. ל ץ/ ?,v'J.׳‘' .־לי .*ל ל. ׳

WO 01/87981 . PCT/JP01/04035

J :

AILIM monoclonal antibodies on the proliferation :of'T .cells in the ‘ assay.using mixed lymphocyte reaction (MLR) . T cells from a normal healthy person donor E״ were co-cultured with PBMCs from a normal healthy person donor G pre-cultured in the presence of human CTLA4-Ig chimeric .molecule. .׳ ' ’ .The vertical axis indicates the amount of cellular incorporation '

'.: of [³H]thymidine as an index of. the degree of cell-proliferation, arid the horizontal axis indicates the concentrations of test substances. . Other notations are as follows:.

. Λθ. anti-KLH: human anti-KLH monoclonal antibody as a negative control.

JMab-136: human anti-human AILIMmonoclonal antibody JMablSS. :

138: human anti-human AILIM monoclonal antibody JMabl38. 139: human anti-human AILIM monoclonal antibody JMabl39.

140: human, anti-human AILIM monoclonal antibody. JMabl4Q. ;

141: human anti-human AILIM monoclonal antibody JMabl41. ׳ Figure 68.shows the inhibitory effect of various control test substances on the proliferation of T cells in the assay using mixed : lymphocyte.reaction (MLR) . T cells from a normal healthy person donor . 20 G were co-cultured with PBMCs from, a normal healthy person donor' F pre-cultured in the presence of human CTLA4-Ig chimeric molecule.

The vertical.axis indicates the amount of cellular incorporation : of [⁴H] thymidine as an index of .the degree of cell proliferation , and the horizontal axis indicates the concentrations of test substances. , ²⁵ . ' Each description in the figures shows the following.

control mlgG: Anti-human CD34/IgGl mouse monoclonal antibody :”CD8Q + 86 Ab״: The mixture of anti-CD80 antibody and anti-.CD86 antibody SA12: ,Anti-human AILIM mouse monoclonal antibody

Figure 69 shows the inhibitory effect of various human anti-human

AILIM monoclonal antibodies on the proliferation, of T cells in the assay using mixed lymphocyte reaction (MLR) . T.cells from a normal healthy person donor G״ were co-cultured. with PBMCs from a normal healthy person donor F:pre-cultured in the presence of human CTLA4-Ig .

. chimeric molecule. ,. .

The vertical axis indicates the amount of cellular incorporation .

of [³H]thymidine as an index of the, degree of cell proliferation, and . ; ' .

,:.'/¹'׳;.?.' ׳ / Λ . ; . .'. .. ‘1־' י' . . . י . .

; 4: GGi-.:.'//1/א,

WO 01/87981 PCT/JPO1/0403 5

: _;. \⁹¹ ' ' . ^: ' ' ' - 'י' . . י / the horizontal:axis indicates the concentrations of test substances.

Other notations are as follows:

anti-KLH״: human anti-KLHmonoclonal antibody as a negative control. . ^: '5 . JMab-136 : human anti-human AILIMmonoclonal antibody JMabl36.

. 138: human anti-human AILIM monoclonal antibody. JMahl38 .

. 139 ״.: human . anti-human; AILIM monoclonal antibody TMah 139.'׳

140. :human anti-human AILIM monoclonal . :antibody JMabl40 .

.. 141: human anti-human AILIM monoclonal antibody JMabl41. :.

Figure. 70 shows ADCC-inducing activity of various human anti-human AILIM monoclonal antibodies and control antibodies where .wild-type CHO cells were used as the target cells.

The vertical axis indicates the rate of. cytotoxicity caused.

. by ADCC-inducing activity of .antibody, ' and the horizontal axis -15 indicates the concentration of antibody.'

Figure 71 shows ADCC-inducing activity of various human anti-human AILIM monoclonal antibodies and control'antibody where : human .AlLIM-overexpressing recombinant .CHO cells were used as the ^:., target cells.

The vertical axis indicates the frequency of cell damage resulted from the ADCC-inducing activity of antibody, and the horizontal axis indicates the concentration of antibody. . '־)

Figure.72 shows the inhibitory effect of anti-AILIM antibody' ' on delayed.allergy.

The vertical axis indicates the size of redness measured as ־ an index of the onset of delayed allergy, and the horizontal axis indicates the type of test sample given to animal subjects.

.Figure 73 shows proliferation .activity of monkey T cells in the assay to determine the activity of various human anti-human AILIM 30 monoclonal antibodies to.transduce, costimulatory signal, using a microplate coated with human anti-human AILIM monoclonal antibody together with anti-human CD3 monoclonal antibody.

. Th®, vertical axis indicates the amount of cellular incorporation of [ H] thymidine as an index of the degree of cell proliferation, and 35 the horizontal axis indicates the concentration of the human anti-human ׳ . . AILIM monoclonal antibody . .

WO 01/87981 .J;..'... 92 ' י' . ’ '

^.ⁿ this figure, anti-KLH indicates result of assay in which human anti-KLH monoclonal antibody was used as the negative control, ' instead of the human anti-human AILIM monoclonal antibody.׳ ׳' Figure 74 shows, inhibitory activity of ’the negative control•5 . antibody against binding between soluble AILIM ligands (hB7h-IgFc) and soluble .AILIM (AILIM-IgFc) of various concentrations. ' ־The vertical axis־ indicates absorbance as an. index for the ^: . inhibitory activity, and the horizontal axis indicates the . concentration of soluble .AILIM.

Figure 75.shows.inhibitory activity of anti AILIM antibody . against binding between soluble AILIM ligands (hB.7h-IgFc) and soluble' AILIM (AILIM-IgFc) of various concentrations .

The vertical axis indicates absorbance as an index for the. inhibitory activity, . and the horizontal axis indicates' the concentration of soluble AILIM. ׳

Figure76׳ shows inhibitory activity of anti AILIM antibody at ' various concentrations against binding .between soluble AILIM ligands (hB7h-IgFc) and soluble AILIM (AILIM-IgFc).

The vertical axis indicates absorbance as an index for the inhibitory activity, and. .the horizontal ^:. axis .. indicates the ' ׳. . concentration .of soluble AILIM.

Figure 77 shows inhibitory activity of various human anti-humari !

AILIM monoclonal antibodies to human T cell proliferation in the assay ..׳ to .determine the activity of transducing costimulatory signal using .25 a microplate coated with soluble human AILIM ligand (hB7h-IgFc) together with anti-human CD3 monoclonal antibody.

The vertical axis indicates the amount of cellular incorporation of [ H] thymidine as an index of the degree of cell proliferation, and • the horizontal axis indicates the concentration of antibody.

3θ . Figure 78 shows inhibitory activity of various human anti-human AILIM monoclonal antibodies to monkey T; cell proliferation in the . assay to determine the activity of transducing costimul.atory signal ^: . using,a microplate coated with soluble human .AILIM ligand (hB7h-IgFc) together with anti-human CD3 monoclonal antibody.

The vertical axis indicates the amount of cellular incorporation of [³H] thymidine as an index .of the degree of cell proliferation, and .'

WO 01/87981 PCT/JPO1/04035

':?/. . . . ׳. ,₉₃ ' ' the horizontal axis indicates'the concentration.,of antibody.;

.Best Mode for Carrying out the Invention

The present, invention is illustrated in more detail below with reference to Examples, but is not .to be construed' as .being limited' י י ' . thereto. ./'.

Example 1 Preparation of immunogen <1-1> Preparation .of recombinant cell expressing human AILIM ׳ .10 Two types of recombinant cells (CHO cell ־.and HPB-ALL cell) overexpressing human AILIM were prepared according to the method as described in earlier applications (JP-A No. Hei 11-29599 and . WO98/38216) , as well as in.a previous report (Int. Immunology, Vol12, J < No.l, p.51-55, 2000) of one of the ,present inventors, Tez.uka.

15׳ .Specifically, the .method is as follows:.'

A cDNA (GenBank Accession Number: AB023135 (cDNA); BAA82129 (amino acid )) containing the full-length ORF encoding human AILIM : ':'' was inserted into a vector pEF-neo. Then the resulting recombinant' expression vector was introduced into Chinese hamster ovary cells .20 (CHO cell) and cells of a human thymoma line; HPB-ALL, according to . a commonly used method using electroporation (960gF, 320V) witha ' Gene Pulser (BioRad). Respective cells were cultured in RPMI1640 medium containing Geneticin (0.8mg/ml;. Gibco BRL) and 10% FCS'.to select':’. .drug-resistant transformed cells. .

,25 <l-2> Selection of recombinant HPB-ALL cells over.expressing human

AILIM ' . י .. ' ., '. ׳

Culture of the .'drug-resistant HPB-ALL cells selected in <1-1> .:.' described above were'centrifuged to give cell pellets.' A mouse , . anti-human AILIM monoclonal antibody named SA12״ (mouse anti-human 30 JTT-1 antigen monoclonal antibody), which had been established and reported previously (JP-A .11-29599 (Example 12) and WO98/38216 . . (Example 12)) by the present inventors , was added to the cell pellet ׳׳ (concentration: antibody solution (lOgg/ml) diluted with EDTA-BSA/PBS : was added at a ratio of ΙΟΟμ.1/10⁵ cells) . The resulting mixtures were incubated at 4 C for 30 minutes. The cells were, washed twice with '' . . , above-mentioned EDTA-BSA/PBS .(200μ1) , and then phycoerythrin-labeled ; .J‘y.’>; ;־*5*...'־:׳ .: .-*.׳<<.Λ». ./¹-J ׳.Λ ,;.,.־.' ,./.;?־ יΛ: μ'λ ־־;< /?׳. ' t-' ;-.־״ >;'.'.״ יי.' .י

WO 01/87984 PCT/JPO1/04035 . streptavidin (SA-ΡΕ; ΙΟΟμΙ of 500-fold diluted solution) ,was added ' thereto. Resulting mixtures were' incubated: at 4°C for 30 minutes. ' .After.incubation, cells were washed 3.times with EDTA-BSA/PBS, and cell suspensions were prepared.

Expression levels of human AILIM of respective cell's in the ׳ ^c.^e^־^־ . suspensions were analyzed׳ in' a flow׳ cytometer, FACSort . (Beckton-Dichirison), to' select recombinant :ΗΡΒ-ALL cells ..overexpressing human AILIM. Selected cells were cultured to'.

confluence in.RPMI1640 medium containing .10¾ FCS and G41.8 (Img/ml) , 10 <l-3׳> Selection of recombinant CHO cells overexpressing human AILIM .

Culture.'.of ..the drug-resistant CHO cells selected in <1-1> , described, above were centrifuged to give cell pellets. ' The .,above-mentienedmouse anti-humanAILIMmonoclonal antibody SA12 , which had been labeled with FITC, was added to .each cell pellet (antibody . 15 solution (lOOflg/ml) diluted with EDTA-BSA/PBS) . Resulting mixtures were incubated at 4 C for 30 minutes. Cells were washed with above-mentioned EDTA-BSA/PBS, and then cell suspensions were prepared by adding EDTA-BSA/PBS (500μ1) to the cell pellets.

Expression levels of human AILIM of respective .cells in the ’’ 20 cell׳ suspensions were analyzed in a flow cytometer; FACSort (Beckton-Dichinson), , to . select . recombinant ΗΡΒ-ALL cells overexpressing human AILIM. Selected cells were cultured to : confluence in RPMI 1640 medium containing 10% FCS and G418 (lmg/ml) . <l-4> Preparation of immunogen from ΗΡΒ-ALL cells overexpressing human ׳ 25 ׳ AILIM .״

The ΗΡΒ-ALL cells overexpressing human AILIM, which had been obtained in <l-2> described above, were centrifuged. Recovered cell pellet was washed 4 times with phosphate buffer (PBS; Nikken Seibutsu) . and then resuspended in a protease inhibitor-containing buffer 30 (containing25mMHEPES (pH7.4) , lOmMMgCl?, 0.25MSucrose, andprotease inhibitor ׳ (lOU/ml Aprotinine, 2μg/ml Pepstatin, 50μg/ml Leupeptin, and 0.35mg/ml PMSF)) . Cell suspension was treated in a Potter-type homogenizer , and centrifuged at a low speed ־ (at 1,500rpm at 4°C for ' 10 minutes). Subsequently, resulting supernatant was subjected to. 35 ultracentrifugation (under 100,000g at 4°C for 1 hour) . Precipitated membrane fraction was recovered, and suspended in phosphate buffer׳

WO 01/87981 ' PCT/JP01/04035 ' ';יי. ־' ' ' ³⁵ י (concentration of the membrane fraction was adjusted so that 1ml PBS ׳ contains membrane fraction derived from IxlO⁷ cells); The suspension ' was stored at-80°C. ״The suspension containing cell membrane fraction was used as the antigen (immunogen) .to prepare human antibody of'the ' '.5' . present invention, which will be described later.

,<l-5> Preparation of immunogen from CHO cells overexpressing human ' '.AILIM . ־' . י' '.

The CHO cells overexpressing human AILIM, which hadbeen obtained ' in <l-3> described above, were : dispersed with a scraper and were':' .

centrifuged. . Recovered cell pellet was washed 4 times with phosphate ; buffer (PBS; Nikken Seibutsu) and . then resuspended in a protease inhibitor-containing buffer.(containing 25mM HEPES (pH7.4) , 10mMMgCl₂, ^:0.25M Sucrose, and protease inhibitor (lOU/ml Aprotinine, 2gg/ml Pepstatin, 50gg/ml Leupeptin, and 0.35mg/ml PMSF)) The cell suspension.was treated in a Potter-type homogenizer,, and centrifuged at a low speed (at l,500rpm at 4°C for' 10 minutes). Subsequently, . . resulting supernatant was. subjected to ultracentrifugation (under ׳ 100,000g at' 4C for !:hour). Precipitated membrane fraction was recovered, and .'suspended in phosphate buffer, (concentration of the ^; membrane fraction was adjusted so that 1ml PBS contains: membrane ,, fraction derived from l*10⁷ cells) . The suspension was stored at-80°G. ¹The suspension containing cell membrane fraction was used as the.antigen (immunogen) to prepare.human antibody of the present invention, which .will be described later.

.': '.׳ ׳־־ . ';'. ’ . . ,׳ . ..׳.' .' ׳ '7 25.

. Example 2 Preparation of hybridoma producing human anti-human AILIM ’monoclonal antibody .In the present Example, preparation of monoclonal antibody was carried out according to a typical method as described in Experimental

Medicine (supplement) ,Handbook for Cell Technology״ (eds., T. Kuroki et al., Yodosha, pp.66-74, 1992) and Experimental Manual for Monoclonal Antibody״ (T. Ando et al., Kodansha, 1991).׳.

Cell .membrane fraction prepared from . recombinant. cells overexpressing human AILIM provided in Example 1 was used as the 35 immunogen of. human. AILIM.

Animals subj ected to immunization were human antibody-producincr ״ .'

<img file="IL147448A_D0005.tif" />

WO 01/87981 PCT/JP01/04035 'ל 96 ל.ל ' . ' transgenic mice created by above-described method (Nature Genetics, ׳ V01.7, p.13-21., 1994; Nature Genetics, Vol.15, p.146-156, 1997; Published Japanese Translation of International Application.No. Hei.

4-504365; Published Japanese.Translatipn of International Application . :

•5 No. Hei 7-509137; Nikkei Science, June, pp. 40-50 , 1995 ; etc.) . ילל . Multi-well microplates were used for cell culture.

<2-l> Immunization and preparation of hybridoma .

Either of the immunogens (ΙΟΟμΐ/mouse/administration) prepared . ל in<l-4> (derived from HPB-ALL) andin<l-5> (derivedfromCHO) described . 10 above was given to the above-mentioned human antibody-producing transgenic mouse. The immunogen, was injected together wit Freund׳s complete adjuvant (ICN/CAPPEL) in the footpad as primary immunization (day 0) . .'.'./. ’ 'ל . After primary immunization, either of the two immunogens was ' 15 additionally injected to the footpad at 1-week interval as secondary and/or tertiary immunization. In the same manner, injection was ,. further carried out for final immunization two days before preparation of lymphocytes, which is described below.

Two days after final immunization, lymphocytes were prepared 20 from (subinguinal and subgenual) lymph nodes and spleens of respective .\ . transgenic mice subjected td immunization. The lymphocytes andmouse myeloma cells P3/X63-AG8.653 (ATCC No. CRL-1580) were mixed at a ratio of 5:1, and polyethylene glycol 1500 (Boehringer Mannheim) was added thereto as a fusion agent. Then, the mixture was diluted with 10 volumes. ' .. .25 of serum-free basal medium EX-CELL301 (JRH Bioscience).

Subsequently, the mixed cells were washed with the basal medium and . . then suspended in HAT medium (IL of basal medium contained 13.61 mg of. hypoxanthine, 176 ^,gg of aminopterin, and 3.88 mg.of thymidine). The cells were plated on 96-well microplates and cultured for 10-14 30 days to complete cell fusion. The cell fusion treatment yielded many hybridomas.

<2-2> Screening of human monoclonal antibody-producing hybridoma

A number of hybridomas prepared in <2-l> described above were .ל י screened with cell ELISA as described below to select hybridomas producing human monoclonal antibody against human AILIM.

. Respective recombinant HPB-ALL. cells and .recombinant CHOcells ' * ‘‘¹ ל.^,. / . .. ׳. יל^,־; ' ’. , V ,. .־’ ;.*.'&lt; .,- ׳ - ’ . .&lt;..,׳ ^:ל- .־׳.. -ל.־ .- - ־;. ׳־. j .'

*. .ין,'^, ..ל..־, ל ל, י,* י ׳ י י . ל ל. ל י_; י, “ .׳׳׳ . .. ’ ״^, י . ‘ . / . ל ל . , . ל י ״: ־,־.־ ^י. ~ י . י י . .י .׳ . . .’.'.. י י /.*,.־׳.־. .־׳.׳ * . «׳ ’ \ \ / י, ל • ׳ .־_־/.'״ * י.'. ל. ״.״‘ל. ״ '.’.\' ϊ ץ‘ . :׳ל־ל -,..-. ,..'>׳. י.,'ל_/: י? 1. ל-..־..; ;;?־ י. .י< ''._v ־ v. O‘:. ל־י; . ΪΆ *י; ־ < ל ל־.׳'\ל^;' ל־. ־ י ‘ * Ϊ ,. .״ י -׳ל ״' ל ל* . לל י ילך.,, 'י - י -״ .<׳ - . ל .' X׳' ’.Μ +Λ Λ ל/.,ל '.‘לויל י . . * . . I . > . . י . י י .־ I.. 1 _ . י' .׳ ־־ . . . . ז .«.< . י U .V ־ .־ 1¢ .»'. ־ . .ע ן * ' ־. י ’ . ΙΛ י ־ן י-*.-,. - . ־ .'I ־!

WO 01/87981 PCT/JPO1/04035 ' .' ' ' , 97 ..

overexpressing human AILIM, which are described above, were.plated in each well: of ELISA 96-well microplates (1x10^s cell /well). Incubation :was carried out at 37°C for 2 days.

• ' Subsequently, supernatant of each well was discarded, samples of supernatant of each hybridoma culture was. added thereto (50gl/.well) ,. and the'mixture, was incubated for 1 hour; After the reaction was completed, the mixed sample solution was .discarded and each well was.

washed 3 times.with PBS containing. 1% BSA (Sigma).

Subsequently, . peroxidase-conjugated goat .anti-human • 10 immunoglobulin (Fc). antibody (50μ1 of the.2000-fold dilute.per well; Ameircan Corex; 1% BSA/PBS) was added to each well in order to detect the heavy chain of human immunoglobulin.'(human monoclonal antibody) in the hybridoma supernatant. The mixturewas incubated at room ׳ temperature for 1 hour.

On the other hand; peroxidase-conjugated goat anti-human immunoglobulin K chain antibody (50μ1 of the 2000-fold dilute per well) was added to each well in order to detect the light chain of human immunoglobulin (human monoclonal antibody) in the.hybridoma : supernatant. The mixture was incubated at room temperature for 15 20 minutes.

The anti-human IgFc antibody or anti-human IgK antibody was removed from ,each well of the microplates, and then the plates were washed 3 times, with PBS containing 1% BSA. Tetramethylbenzidine . : . (3,3 ׳5,5, ׳ ,'-tetramethylbenzidine . (TMB).,ΙΟΟμΙ/well, BIO-RAD) was added to each well, and the resulting mixture, was incubated at room temperature for.15 minutes.

Subsequently, IN,¾304 was.added to each well (50μ1/νβ11) to quench the .reaction. The reaction was monitored for absorbance at a wavelength of 450nm.by a microplate reader (Model 3550 Microplate .

Reader, BIO-RAD). .,

Control ELISA experiment was performed, in the same manner as described above by. using the following items:

• (1) Wild-type HPB-ALL cells, instead of human AILIM.expressing recombinant HPB-ALL cells;' (3) Wild-type CHO cells, instead of human AILIM expressing recombinant CHO cells; , ..׳.

WO.81/87981 PCT/JP01/04035 , . ₉₈ ' (3) Mouse monoclonal antibodies against human AILIM (SA12 or .SG430; JP-A11-29599 (Example 12) andWO98/38216 (Example 12)) instead of hybridoma supernatant;

(4) Human monoclonal antibody against KLH (keyhole limpet hemocyanin, :PIERCE) instead of hybridoma supernatant.

The human anti-KLH monoclonal antibody was prepared according

.. to the., same manner: as described above , in <2-l>,. by immunizing above-mentioned human antibody-producing transgenic mice with .KLH (keyhole limpet hemocyanin, PIERCE). .

Many hybridomas producing human monoclonal antibody capable;

. of bindingto human AILIM were selected by said screening.

. <2-3> Primary cloning of hybridoma ? ,'i

Many types of hybridoma monoclones were established from the ' .' . various hybridomas (parental cell lines) , which had been selected .

.15 . in <2-2> described above, producing human monoclonal antibody, against״ ^: human AILIM by the following assay procedure.

Respective hybridomas selected in <2-2> described above were . :plated in 24-well microplates. Cell count of hybridoma in each well , was determined by pipetting. Subsequently, 10% fetal calf serum (FCS; Trace Bioscience PTY) , 1% penicillin/streptomycin (Sigma) , 1% :;^HT Supplement (Gibco BRL) and 2.5% T-STIM Culture Supplement .(Collaborative Biomedical Products) were added to EX-CELL301 medium .

’ , (JRH Bioscience) containing 4,0 mM L-glutamine and lipid. The resulting modified medium was used to dilute,hybridomas to 1x10״ 25. cells/ml and the cells were suspended in each well.

Cell suspension (300. |11 or 600 μΐ) of .each well was combined and mixed well with :the modified medium. (150 ml or 300 ml) , and then ?

. a 200-μ1 aliquot of the cell suspension was added to.each well of ׳ multiple 96-well microplates such that each well contained 4 cells.'

3.0 of the hybridoma. The above-mentioned modified medium (50ml or 100ml) was freshly added to the remaining cell suspension, which was mixed . . well, and then the resulting cell suspension was added to each well . of other freshly prepared multiple 96-well microplates such that each . well contained 2 cells of the hybridoma. : .

Cultivation was continued for 1 to 2 weeks . After cultivation, single colonies derived from a single hybridoma were found in many . WO 01/87981 PCT/JP01/04035 . ' . . . . 99 ' .

.. wells. ׳

With the cell ELISA as described above in <2-2>, it was verified that human monoclonal antibody against human AILIM was produced in ' the'culture supernatant in each well containing'the colony.

<2-4> Secondary cloning of hybridoma

Subcloning (secondary cloning) of each clone from the various hybridoma clones obtained in <2-3> describedabove was performed according to .the same .method as described above in <2-3>. ' . Cell density of each well in a 96-well microplate was adjusted .10. to 1 cell/well in the.present experiment.

The screening yielded many hybridoma.monoclones producing human// • monoclonal antibody against human AILIM. Part of the clones included . were as below: '.

(Clone name) ¹⁵ AIF34 (JMabl24), AIF182 (JMab-126)., AIF348 (JMab-127) ,

AIF620 (JMab-128), AIF1052 (JMab-135) , AIH5D3 . (JMab-136), ' AIH386 (JMab-137) , AII289 (JMab-138) ,. AII394 (JMab-139) , י ' AII488 (JMab-140) ,'׳ AIJ40 (JMab-141) , '. : /,'.׳

The names shown above are used through the present application , ' namely in all Examples described below including .the present Example, and in Figures and Tables containing the assay result obtained in '’. this ,Example'.

Example 3 Analysis of properties of monoclonal antibody <3-l> Analyses of the heavy chain and light chain 'י

By using ELISA and flow cytometry describedbelow, it was verified that the monoclonal antibody against human AILIM produced by each ׳; hybridoma clone, which had been cloned in <2-4> described above, was indeed a human monoclonal antibody.

The recombinant HPB-ALL cells overexpressing human AILIM, which . had been prepared in Example 1,. were plated in each v-shaped well of microplate (3x1(/ cell/well). Cells were cultured at 37°C in RPMI1640 medium containing 10% FCS. .

After the culture was completed, the plate was centrifuged (at ' 35 1 800 ׳rpm.for 2 minutes), to precipitate the cells, and then the resulting supernatant .was discarded. ,. Subsequently,, supernatant ׳ sample

WO 01/87981 PCT/JP0i/04()35 ''-A¹⁰⁰ ' י .׳ ' Λי'.'.' ־ . ' . (50gl/well) from the culture of eachhybridoma cloned in<2-4> described. above, or mouse anti-human AILIM monoclonal antibody SA12 (2μς/50μ1) or alternatively human anti-KLH monoclonal antibody, (50gl/well) as a control antibody.was added to.each well. ;,The mixture was.reacted for 30 minutes in a refrigerator. , After reaction, the sample solution was discarded and .each well was washed with phosphate buffer (0.5% . .

' BSA-PBS containing 5mM EDTA) . . ' /.'׳

Subsequently, any one of the secondary antibodies below was added to each well (diluted 1000 times with the above phosphate buffer

10. and added at a quantity of 50 μΙ/well). in order to.suspend the’cells.' The suspension was reacted for 30 minutes in a refrigerator. / ';(Secondary antibody).

Biotin-labeled anti-human IgG antibody (Zymed) ; /J

Biotin-labeled anti-human IgG antibody'(Protos); . ,’.,-.

15.. . Biotin-labeled anti-human IgFc antibody (ΞΥ Laboratories) ; or .' .'

Biotin-labeled anti-human IgK antibody (Vector).

After reaction, the secondary antibody was discarded and each well of the plate was washed with the above-mentioned phosphate buffer. Subsequently, phycoerythrin-labeled streptavidin (Streptavidih-PE;

Pharmingen; diluted 500 time with the above-mentioned phosphate buff er ,':. and added at a ,quantity of 50 μΐ/well) was added to each well. The . mixture was reacted for 30 minutes in a refr-igerator. After reaction, .

, each well was washed with the above-mentionedphosphate buffer. Then, ׳ . the above-mentioned phosphate buffer was added to each well . - 25 .(200gl/well). in order, to suspend the cells.

Analysis was performed to determine the reactivity of. the anti-human AILIM monoclonal antibody in the culture, supernatant of ! each hybridoma clone to the HPB-ALL cells overexpressing human AILIM . in each well.;־,

Control assay was performed in the same manner as described above by using following items:

, . (1) . Wild-type HPB-ALL cells , instead of human AILIM expressing י ' recombinant HPB-ALL cells; .'.. ' .

(2) Human monoclonal antibody against KLH (keyhole limpet . .35 ; hemocyanin, PIERCE) instead of hybridoma supernatant.

The human anti-KLH monoclonal antibody was prepared according ' : , '.

?י’׳:'; ,י''־' ־. , .' י י <>- .,/.' ׳י-;'.’'. ' י;'.' .>.'. ;. ;׳ - י.,-. .י.'.,. י י, . ״ . י י י.:. ..< .׳<<, ־ י י י'.' י .

־ . 1 . . . י , י . י י - ־י' . י‘ , . ’ י .' י י ' . . ' , ' . ' ‘ . ' ’ . ,. . , . 4 . . •

; .י &lt;. י , . , . ; י. . . .׳ ;j '־t. ־ ־. .&lt; . .־ . ־ , י׳ . י 1 י : . ~ - .

.. \ .* -::'.Λ I’-®״{.!. יי י',:.‘. ,:.' .ו «־.־.. . י

WO 01/87981 PCT/JPO1/04035

א. ' . . ' ¹⁰¹ ..

to the same manner as described above in <2-l>, by immunizing the above-mentioned human antibody-producing transgenic mice 'with KLH (keyhole limpet hemocyanin, PIERCE). .

Based on the result, all of the hybridoma clones described above ' .5 in <2-4> were verified to be human monoclonal antibodies consisting, of human-derived heavy chain and human-derived κ light chain.

An example of the result is illustrated in Figure 1, which involves . ' assay result for hybridoma clones AIH5D3 ( JMab-136) , AII2B9 (JMab-13’8) and AII394 (JMab-139),.

10. <3-2> Isotyping of . human monoclonal antibody

The isotype was determined for each of the human anti-human ’ AILIM monoclonal antibodies produced by the hybridomas that .had been i . cloned in <2-4> and analyzed in <3-l> described above. Determination'׳ was carried out using a Human Monoclonal Antibody Isotyping Kit 15 (American Qualex) according to the experimental:protocol attached to the kit.

All the׳ human anti-human AILIM monoclonal .antibodies were determined to be IgG2/K.

²θ . Example 4 Preparation of humanmonoclonal antibody against human AILIM (human anti-human AILIM monoclonal antibody) on large scale and׳ its . purification . .

<4-l>.Method 1

Cells of each hybridoma clone producing human anti-human AILIM' י 25 .monoclonal antibody, which had been prepared in <2—4> described above, were added, to a tissue culture flask (5.0ml, ׳ FALCON) , and cultured in ASF104 medium. (Aj inomoto). containing 10% Ultra Low Bovine IgG FBS : (GIBCO-BRL) ;to be.confluence under an. atmosphere of 5% C0₂ at 37°C.' .

Subsequently, the whole culture liquid was transferred into ' 30 . a new tissue culture flask (750ml, FALCON) , and the cells were cultured in AS Fl 04 medium (Ajinomoto) containing 10% Ultra. Low Bovine IgG FBS (GIBCO-BRL) to. be confluent under an atmosphere of 5% CO₂ at 37°C.

to 20 days after the culture, the culture supernatant of eachhybridoma was recovered and transferred into a 50-ml polypropylene 35 conical tube (FALCON). The tube was centrifuged under 500xg for 5 ״minutes. ..':־. '.'i'.

WOOl/87981 PCT/JP01/04035 • ' ' ' 102

Subsequently, .resulting.centrifugal supernatant was filtered through a. Sterilization Filter Unit (NALGEN), and the filtrate'was recovered.

The filtrate was loaded onto a HiTrap Protein G column (HiTrap 5 affinity column Protein G; Amersham Pharmacia), pre-equilibrated with phosphate buffer (30ml) at a flow rate of 3 ml/min.

Subsequently, the column was washed with phosphate buffer (20ml). , and then the antibody of interest was eluted by loading lOOmM citrate buffer (pH2.0) onto- the column at. a low rate of about 1ml/min.

. 10 Subsequently, the eluted solution was neutralized.with a solution (pH9.0) of 75.0mM ,Tris-HCl, and then filtered through a׳ filter (Millipore) to remove white precipitate. The resulting filtrate was . dialyzed against phosphate buffer (overnight)'and filtered through a filter .(Millipore). Thus purified anti-AILIM.human monoclonal .15 antibody was obtained from each hybridoma line.

Protein concentration was determined from the absorbance at ׳. A280 measured by using a photospectrometer . (lA280 ⁼l .'41mg/ml) .

<4-2> Method 2 '

Cells of each hybridoma clone, which had been prepared in <2-4> 20, described above,: were conditioned, in ASF104 medium (Ajinomoto) containing 10% Ultra Low Bovine IgG FBS (GIBCO-BRL) (l-2xl0⁶ Cells/ml each) , and were plated and cultured in Integra Cell Line 1000 (INTEGRA / CL1000, INTEGRA BIOSCIENCE). 7 to.10 days after cultivation, when' the cell density, reached. l*10⁸ . cells/ml, ־the supernatant of each .25 hybridoma culture was recovered.

. ,Each culturesupernatant was ,loaded onto a HiTrap Protein G ' column (HiTrap affinity column Protein G; Amersham ' Pharmacia) pra־־equilibratedwithphosphatebuffer (30ml). at a flow rate of 3ml/min.

Subsequently, the column was washed with phosphate buffer (20ml) , .30 and then lOOmM citrate buffer (pH2.0) was loaded onto the column at a flow rate of about lml/min to elute the antibody. Then, a solution (pH9.0) of 750mM Tris-HCl was added to neutralize the eluted solution, . and the resulting solution was filtered through a filter (Millipore) to remove white precipitate. ' The resulting filtrate was dialyzed ,35 against phosphate buffer (overnight) and then filtered through a filter ׳ (Millipore). .״Thus purified anti-AlLlM human monoclonal antibody was ׳'

WO 01/87981 PCT/JPO1/04035 ; ' .

. 103. . ' J י ' ' obtained from each hybridoma' line.

Example 5 Reactivity of human anti-human AILIM monoclonal antibody; ; to human AILIM, and cross-reactivity of that to mouse AILIM and rat' ־ AILIM '״' י '

Purified various human anti-human AILIM monoclonal antibodies , above were analyzed for . their reactivity to human AILIM as well as cross-reactivity to mouse AILIM.and rat AILIM by utilizing cell ELISA ' . . .method. י:/־' io <5-l> Establishment of. ELISA system to ,determine IgG antibody . concentration and preparation of calibration curves ' ' ':י . Because all the above-mentioned purified human anti-human AILIM / monoclonal antibodies were :IgG. (IgG2) antibody, ELISA system was . ’ ,established to determine the concentration of IgG antibody.

Goat anti-human IgG (Fcj antibody (1.2 μς/ml inPBS; ΙΟΟμΙ/well;

Organon Teknika) was added to each well of a 9β-well ELISA microplate (Nunc) . The plate was incubated at room temperature for 2 hours'to . adsorb the anti-IgG. (Fc) antibody on the microplate. Subsequently, -בט-י^ supernatant was discarded, and the plate was.washed 3 times with phosphate buffer (PBS) containing 0.05% Tween20., A blocking reagent ' (PBS containing. 0.5% bovine serum albumin'.(BSA) and 0.1% Tween2'0) was added to each well (200gl/well) and the plate was incubated at .

. room temperature for 2 hours to block the anti-IgG (Fc) antibody-free . ׳ י sites on theplate. Then, the blocking reagent was discarded, and each well was' washed twice with PBS.

Human-derivedIgG2antibody(50gl/well; TheBindingSite) , which . was used as a standard.antibody, was . added .at various' concentrations . (0 to 10.0ng/ml) to respective wells of the plate and. the plate was incubated at room temperature for 2 hours. Surplus solutions of ' .

standard antibody were removed and each well was washed’3 times with . phosphate buffer containing 0.05% Tween20.

Subsequently, peroxidase-conjugated goat anti-human IgG/.K • antibody was added to each'well (4,000 times diluted, 100 μΐ/well,

Protos.) ,. and the plate, was incubated at room temperature for 1 hour.

The supernatant was discarded and the .microplate,was washed . .3.times with, phosphate buffer 'containing 0.05% Tween20. ' A buffer . ;

WO 01/87981 . PCT/JP01/04035 .

' ' '104 ½ - .

containing substrate ,(composition: .ortho-phenylenediamine (O-phenylenediamine, OPD; 20mg)/citrate-phosphate buffer (pH 5.0,' 50 ml)/aqueous solution of 30% hydrogenperoxide (15μ1)) was added toeachwell (ΙΟΟμΙ/well) and theplate was. incubated at room temperature .5 for about 7 minutes. .

Subsequently, 2M,sulfuric acid was added to each well (50gl/well) to stop’the reaction. . Calibration curves were made (Figure 2) based on the values of absorbance measured at a wavelength of 490 nm by • using a microplate reader.

־¹־(} Control assays were performed with culture medium alone or BSA solution alone as a test substance in the same manner as described . above. .'.׳.

<5-2> Analyses for the reactivity of various purified human anti-human־ AILIM monoclonal antibodies to human AILIM as well as for' .cross-reactivity 'of 'that . to mouse'AILIM and rat AILIM <5-2-l> Preparation . of'reagents י י

Reagents to be used in this cell ELISA were prepared as follows: Preparation of recombinant CHO cell overexpressing mouse ' AILIM .

Recombinant CHO. cells .overexpressing mouse AILIM were prepared and obtained in the same manner as described above in <1-1> and <l-3>.' .cDNA (GenBankAccessibnNumber: AB023132 (cDNA) ; BAA82126 (amino acid)) containing the full-length ORF of mouse AILIM was inserted into a vector pEF-neo, and then the resulting recombinant expression .25. vector was- introduced into Chinese hamster ovary cells (CHO cell) ' by a commonly used method for electroporation (960 gF, 320 V)' using a Gene. Pulser. (BioRad) . The cells were cultured in RPMI1640 medium containing. Geneticin (0.8mg/ml; Gibco BRL) and 10% FCS to select drug-resistant transformed cells, thereby obtaining mouse 30 AILIM-overexpressirig recombinant CHO. cells.

^<'5^-2-l-2> Preparation of recombinant CHO cell overexpressing-rat AILIM ;_ Recombinant CHO cells overexpressing rat AILIM were prepared and obtained in the same manner as described above in <1-1> and <l-3>.

A cDNA (GenBank Accession Number: AB023134 (cDNA); BAA82128 . 35 (amino acid)) containing the full-length ORF of rat AILIM was inserted ³־πΧο ^{a vec}.tor pEF-neo, and then the resulting recombinant expression

WO.OJ/87981 PCT/JPO] /04035 ) '.

' .!'(,. ' . . . .׳ 105 . :. . ' ' ’ vector was introduced into Chinese hamster ovary cells (CHO cell) by a commonly used method for electroporation (960 gF, 320 V.) using ' ,.a Gene Pulser '(BioRad) . The cells were cultured in RPMI 1640 medium' 'י' containing Geneticin (0.,8mg/ml; Gibco BRL) and 10% FCS to select . 5 drug-resistant transformed' cells, .thereby obtaining rat.

AILIM-overexpressing. recombinant CHO. cells. ' .

^<5-2-l-3> Preparation of monoclonal antibody against mouse. AILIM׳:

The recombinant CHO cells .overexpressing mouse AILIM, which ’ '׳'' had been prepared in <5-2-l-l> described above were homogenized, and ׳ subj ected to ultracehtrifugation . (100., 000x g ) . Resulting pellet containing cell membrane fraction was recovered and then suspended . in PBS. Resulting cell membrane fraction was injected together with . Freund's complete. adjuvant to Wistar rats in the footpad for primary immunization (day 0) . The antigen of cell membrane fraction was 17 15 . further given to the rats into the footpad on the 7^th day, 14^th :day )' and 28^th day after the .primary, immunization. The .lymph node cells ' ־were collected from them .2 days after the final immunization.

The lymph node cells and mouse myeloma cell PAI (JCR No.S0113;

Res. Disclosure, Vol.217, pi.155, 1982). were combined׳ at a ratio of״:'

5:1. The cells were fused to each other by using polyethylene glycol. ׳.

4000 (Boehringer Mannheim), as a fusion agent to'prepare monoclonal antibody-producinghybridomas. ' Selectionof hybridomas was achieved׳ :־. ׳ . by culturing them in ASF104 medium (Ajinomoto) containing HAT,'10% fetal calf serum and aminopterin.

Reactivity of rat monoclonal antibody in the culture supernatant

.. of each hybridoma to mouse AILIM was determined by reacting the culture supernatant with the above-mentioned CHO cells expressing mouse AILIM and then measuring the fluorescence intensity of cells .stained'with :.. FITC-labeled anti-rat;IgG (Capped) in a EPICS-ELITE flow cytometer.

The screening yielded multiple hybridomas' producing, monoclonal antibody halving reactivity against mouse AILIM.׳

Among them, a hybridoma line was named B10.5. Cells of this hybridoma . were intraperitoneally . injected (10⁶ . to 10⁷ ׳ . cells/0.5ml/mouse) to ICR nu/nu mice (female, 7׳ to.8— weeks old) . 10 to 20 days after the, injection, the ascites, was collected from each .':' . mouse by laparotomy under anesthesia according to a commonly used. ’.' ״

1.7 . ־7'_;:.- .( 7 .: 7/7 . י'..' 'ג,.'/-:^: ,;./. ,.) ..I).: ) '7-7 ,)7.:..: ^:'). ¾))): ..

¹. .: . ) . .(.’ .. :/ .'. .( ( * . .'. . . ' .. .'־ .׳. . ' ־׳־. '.;.'.. .'. .. י, .-. ' -־ ־! / 1-.-.7 //7/1://1./!11/1 ?( . /1״( (1 .- ׳'׳ ׳ •.

WO 01/87981 . . PCT/J'POl/04035 . ' ' . 106 . - . .?.'.,:' י ״ method. The rat anti-mouse AILIM monoclonal antibody BIO. 5 (IgGl) was prepared from the ascites on a large scale.

The reactivity of the antibody to human,.mouse and rat. AILIM Concentrations of humananti-human AILIM monoclonal antibody' andcontrol antibody to be used in the ELISA described below were * ' determined based on the ELISA and calibration curves in <5-l>described ''.

above. .’־ ־

Each cells 7) ׳xlC³ cells/well) of the recombinant CHO cell ' overexpressing human AILIM. prepared in Example •1., the recombinant •10 CHO cell overexpressing mouse AILIM prepared in <5-2-l-l>, described' above, and the recombinaht CHO cell over expressing rat AILIM prepared in <5-2-l-2> described above were plated in wells of 96-well ELISA .;; microplates and cultured to be confluent at 37°C. ; /':// 'Ϊ ׳ .Subsequently,. the supernatant was discarded, and then'any. one''',.. .

of the purified various human anti-human AILIM monoclonal antibodies or control antibody prepared above were added to each well (antibody ׳ concentrations: antibody of 200μg/ml was .diluted, with.PBS containing?

. 1% BSA, 3 times, 3² times, 3³ times, 3⁴.׳times, 3^s times', ׳3⁶.׳times,-.3⁷ times, 3⁶ times, 3⁹ times, 3¹⁰ times, 3¹¹ times, and 3¹², times) in a.

quantity of 50gl/well, and the plates were reacted at room temperature for2hours. The solutions of the monoclonal antibodies were discarded, and each well was washed 3 times with phosphate buffer containing 1% BSA (Sigma) . ׳

Subsequently, horseradish peroxidas.e-cpnjugated anti-human i 25 IgG (Fc) antibody was added to each well' (dilutedl, 000 times,5.0gl/well; American Qualex) , and the plates were incubated at room temperature for 1 hour.

Surplus solution of the labeled antibody was.discarded and the' ' . microplates were washed 3 times with phosphate buffer containing 1% ׳

BSA. Buffer containing substrate (composition:

ortho-phenylenediamine. (O-phenylenediamine, OPD; ;

20mg)/citrate-phosphate buff er.(pH 5.0, 50 ml)/aqueous solution of 30% hydrogen peroxide .(15μ1) ) was ־added to each well (ΙΟΟμΙ/well) : and the plates were incubated at room temperature for about 7 minutes,.

Subsequently, 2M sulfuric acid was added to each well (50μ1^611) to stop the reaction. Absorbance was measured at a wavelength of 490

WO 01/8798.1 . PCT/JPO1/0403? .

' -¹⁰⁷ י'''^, . nm by using a.microplate reader (Bio-Rad) . .- Control .ELISA assay was performed with'the following control:־ . antibodies to׳ evaluate the above—mentioned antibodies in ,the same manner as described above:

1) . ⁵י) Mouse monoclonal antibody SA12 or SG430 against human AILIM (JP-A 11-29599 (Example 12) and WO98/38216 (Example 12));

. (2) Rat monoclonal antibody BIO. 5 againstmouse AILIM (<5-2-ί-3>. ’ described above);

(3) Mouse monoclonal antibody JTT2 against rat AILIM (monoclonal .

antibody produced ׳ by .a hybridoma,' , which 'has been deposited. internationally on October 11, 1996 , under the international accession. .׳,/ number FERM BP-5708 in The National Institute of Bioscience and .. ׳ ;

Human-Technology, The Agency of Industrial Science .and Technology,'. .

The Ministry of International Trade' and. Industry)) , which is .an ' ׳. . ' : 15 . international depositary authority under the Budapest Treaty; . JP-A

11-29599 (Examples 1 and 2) and WO98/38216 (Examples 1 and 2)). . .

(4) The above-prepared human monoclonal antibody against KLH : (keyhole limpet hemocyanin, PIERCE) instead of hybridoma supernatant

Control ELISA experiment was performed in. the same manner as : •20 . described above using wild-type CHO cell shown below, instead of. .AILIM-expressing recombinant CHO cell. .'...

The result is shown in Figures: 3 to14.

Based on the result obtained, 50%-effective concentration .(ED50.:ng/ml) was calculated as an index for the reactivity of each .

human anti -human AILIM .. monoclonal antibody ' to human AILIM (recombinant CHO cell overexpressing, human AILIM) , . mouse AILIM.:

:. (recombinant CHO cells overexpressing mouse AILIM),. or rat AILIM ' (recombinant CHO cell overexpressing rat AILIM) '. The results obtained ;׳/ by the calculation are shown below. ..י‘.׳׳ ³⁰ (A) ED50 for CHO over-expressing human AILIM . AIF34 (JMab-124): 5.3ng/ml . . '

AIF182 (JMab—126): 3.6ng/ml AIF348 ,(JMab—127) : 9 . Ing/ml . ׳ AIF620 . (JMab-12 8) : 10 . lng/ml ³⁵ . AIF1052 (JMab-135) : 2. Ong/ml ל ־ .. .: AIH5D3 (JMab-136) : 7.5ng/ml'.ל^:: יי ::ליל ל ל ?'.'.;.’> ׳ .

<img file="IL147448A_D0006.tif" />

WO 01/87981

AIH386 (JMab-137): 9.6ng/ml

AII289־ (JMab-138): 10,.5ng/ml. .

AII394 (JMab-139): 10.6nc/ml

AII48.8 (JMab-140): 11.Ong/ml

AIJ 40 (JMab-141): 3.7ng/ml

SA 12: 1.8ng/ml

SG430: . 1.2ng/ml (3) ED50 for CHO overexpressing mouse AILIM

AIF 34 (JMab-124). 42ng/ml . AIF348 (JMab-127.) : 81ng/ml , AIF620 (JMab-128): lOOng/ml .

AII289 (JMab-138): 53ng/ml AII394 (JMab-139): 60ng/ml AII488 (JMab-140):.70ng/ml . .

¹⁵ (C) ED50 for CHO overexpressing rat AILIM . AIF 34 (JMab-124): 45ng/ml

AIF348 (JMab-127): 62ng/ml ' .

. AIF620 (JMab-128): 97ng/ml . .

AII289 (JMab-138): 57ng/ml

AII394 (JMab-139): 90ng/ml

AII488. (JMab-140): 90ng/ml

The result showed that the human anti-human AILIM monoclonal antibodies of the present invention exhibited significantly high specificities to human AILIM, ²⁵ Further, it has been revealed that 6 types of human anti-human

AILIM monoclonal antibodies ' (shown above in. (B) and (C)) are reactive to both mouse AILIM and rat . AILIM (binding capability,. cross-reactivity). , ³.θ Example 6 Determination of affinity and neutralizing activity of human anti-human AILIMmonoclonal antibody against the antigen (human AILIM) Association rate constant (ka) , dissociation rate constant (kd) and dissociation constant (Kd) with respect to the reaction between each of the purified various human anti-human AILIM monoclonal ’ ;.

antibodies prepared above and human AILIM were determined, using a . commercially available kit Biacore X .'(Amersham Pharmacia). י

WO 01/87981 PCT/JPG 1/04035 ' ' ' 109 <6-l> Preparation of antigen to be immobilized on sensor chip ' Antigen to be immobilized on sensor chip in the kit was prepared as a recombinant chimeric antigen (hereinafter. referred to as human .AILIM-IgFc״) . consisting of the extracellular region of human AILIM.

and the constant region (Fc) of human IgGl.'

Human AILIM-IgFc was. prepared by further purifying the antigen obtained according to the method as described in earlier applications ' (JP-A 11-29599 (Example 16 (2).) and WO98/38216 (Example 16 (2)) by one of the present inventors, Tezuka.

The culture supernatant of recombinant cells producing the human

AILIM-IgFc was loaded onto a HiTrap Protein G column (HiTrap.affinitycolumn.Protein G; Amersham-Pharmacia) pre-equilibrated with phosphate ' buffer (30ml) at a flow rate of 3ml/min to adsorb the human AILIM-IgFc in the culture supernatant on the column. ' ‘ . .

Subsequently, the column was washed with phosphate buffer (20ml),' and then lOOmM citrate buffer (pH2.0) was loaded onto the column at: a flow rate of : about lml/min to : elute the human AILIM-IgFc. ' Subsequently, the eluted solution was neutralized with a solution (pH9.0) of 750mM Tris-HCl, and then dialyzed against phosphate buffer .20 (overnight) . Then, the solution dialyzed was filtered through a . filter (Millipore) . Thus purified anti-human AILIM-IgFc was , obtained.

Protein concentration was determined from the absorbance at A_28o measured by using a photospectrometer (1A_28O =lmg/ml) . . The ' 25 concentration of human AILIM-IgFc was determined to be 0.28mg/ml.

Purified chimericprotein consisting of the extracellular region ;

• of ratAILIM and the constant region (Fc) of human IgGl (rat AILIM-IgFc; JP-A 11-29599 (Example 16 (2)) and WO98/38216 (Example 16 (2)) was also prepared according to the same manner as described above. The concentration of the rat AILIM-IgFc obtained was determined to be 0.45mg/ml.

<6-2> Determination of affinity and neutralizing activity . Experimental procedures except for immobilization of antigen (human AILIM-IgFc) on the sensor chip, which is described below, were 35 based on the instruction manual and experimental protocol attached . to the. commercially available , assay. ;kit Biacore X '

WO 01/87981 PCT/JP01/04035 \ . .110 (Amersham-Pharmacia) .

HBS buffer., (containing 0.01M׳ HEPES, 0.15MNaCl, 3mM EDTA and 0.005-ί detergent P20, (pH7.0)) was allowed to flow through a Flow . .Cell-1 attached to the kit.at a flow rate of 5gl/min. Subsequently, a'solution (15μ1) containing 0.005M NHS (N-hydroxysuccinimide) and'. 0.2MEDC (N-ethyl-N¹ -,(dimethylaminopropyl) ‘ carbodi imide) was added to activate carboxyl groups of CM coated on the surface of the sensor ^{: chi}P. .י .i. .

Subsequently, 23μ1 of human AILIM-IgFc solution' (10)lg/1nl;

dissolved in lOmM sodium acetate buffer (pH 5.0)) was'added to the . to immobilize the human AILIM-IgFc on the sensor chip. Subsequently, unreacted activated carboxyl groups were blocked by adding 35μ1 of IM ethanol amine hydrochloride. The amounts of human AILIM-IgFc immobilized by the immobilization treatment performed twice was

2,444RU. (resonance unit) and 2,213RU, respectively. . The unit, RU, corresponds to the mass per unit area; lRU=lpg/mm².

Flow Cell-2 , which is a reference flow cell, was subjected to .

. . .־/ the capping treatment in the absence of human AILIM-IgFc in the same : manner as described above. .

Phosphate buff er was allowed to flow through the flow cell (sensor chip) at a flow rate of 20μ1/ιηίη, and each of purified human anti-human AILIM monoclonal antibodies , which had been prepared in the Example above, was added thereto (10 to 50μg/ml, 60μ1)-.

Standard condition for the measurement was: association phase 25 for 3.minutes and dissociation phase for 10 minutes .Respective amounts of antibody bound to and released from the antigen were monitored over time to obtain a sensorgram. Dissociation of antibody'from the . antigen.was achieved by running PBS through.the sensor chip at a flow rate of 20μ1/π1ίη.

³⁰ .Based on the resulting sensorgram ׳data, association rate ;

constant (ka) , dissociation rate constant (kd) and dissociation constant (Kd; Kd=kd/ka) were.computed by using the analytical software (BIAevaluation 3.0) attached to the kit

The affinity.and the neutralizing activity of mouse monoclonal .' 35 antibodies SA12 and SG430 to .the human AILIM prepared in the Example described above were also analyzed.in the same manner.as described

WO 01/87981 PCT/JPO1/04035

111 'above.

Respective values obtained are shown below.

<td></td><td> &lt;clone</td><td> name&gt;</td><td> &lt;ka (1/M.Sec)&gt;</td><td> &lt;kd [1/Sec] &gt;.׳'</td><td> &lt;Kd (Μ) &gt;</td>

<td></td><td> AIF 34</td><td> (JMab-124)</td><td> 1.6xl0⁴</td><td> Ι.ΟχΙΟ⁴־</td><td> 6.3χ.10⁹־^,</td>

<td> .5</td><td> . AIF182</td><td> (JMab-126) '</td><td> 3.2xl0⁴ י</td><td> 2.8χ!0⁵־</td><td> 8.8x1ο¹⁰־</td>

<td></td><td> AIF348</td><td> (JMab-127)</td><td> ' 1.9x1ο⁴</td><td> 6.4 'יxl0־^s . .</td><td>⁹־3.4χ10 ,..</td>

<td></td><td> AIF620 '</td><td> (JMab-128.)</td><td> l.lxlO⁴</td><td>⁴־l.lxlO ,</td><td> Ι.ΟχΙΟ⁸־</td>

<td></td><td> AIF1052</td><td> (JMab-13 5)</td><td> 1.6x1ο⁴</td><td> 6.3x1ο⁵־</td><td> 3.9χ10⁹־</td>

<td></td><td> AIH5D3</td><td> .(JMab-136)</td><td> 2.8x1ο⁴.</td><td> 4.9x1ο⁵־</td><td> 8Χ1Ο¹⁰־</td>

<td> 10</td><td> AIH386</td><td> (JMab-13 7)'</td><td> 1.2Χ10⁵</td><td> '. 3.1x1οי י ⁴־</td><td> 2.6x1ο⁹־</td>

<td></td><td> AII2.89</td><td> . (JMab-13.8)</td><td> 3.7χ10⁴</td><td>⁵־4.2x1ο..</td><td> l.lxlO⁹־</td>

<td></td><td> ' AII394</td><td> (JMab-139) .</td><td> 3.1x1ο⁴</td><td> 2.4x1ο⁵־</td><td> 7.7x1ο¹⁰־</td>

<td></td><td> AII488</td><td> (JMab-140)'</td><td> 2.3Χ10⁴ .</td><td> . ⁵־3.5χ10 , .</td><td> 1.5x1ο⁹־'</td>

<td></td><td> Al J 40</td><td> (JMab-141).</td><td> 1.9 x1ο⁴</td><td> ' ' 1.9Χ10⁵־.</td><td>⁹־Ι.ΌχΙΟ .</td>

<td> 15</td><td> SA 12</td><td></td><td> 7.8Χ10³</td><td> 7.9χ10⁵־</td><td> Ι.ΟχΙΟ“³</td>

<td></td><td> SG430</td><td></td><td> 2.2χ10⁴</td><td> 1.5x1ο⁴־</td><td> 6.8Χ10⁹־</td>

The result shows that all of the human anti-human AILIMmonoclonal antibodies and anti-human AILIM mouse monoclonal antibodies exhibit markedly high binding affinity and neutralizing activity to. human 20 AILIM.' .

Example 7 Activity of human anti-human AILIM monoclonal antibody to ' transduce costimulatory signal inhuman T cell

It was analyzed. whether.or not the human, anti-human AILIM 25 monoclonal antibodies in accordance with ;the present invention had׳, the capability of controlling (enhancing and/or inhibiting) human T cell responses (production of cytokines such as IFN-7 and IL-4, cell proliferation, etc.j, in other words, whether or not the antibodies exhibited regulatory activity on cellular transduction of 30 AILIM-mediated costimulatory signal. Analysis was performed based on the amount of cytokines (IFhHy and IL-4) produced in human T cell's as well as the degree of human T cell proliferation׳as. an index. <7-l> .Dilution of antibody.

Anti-human CD3 monoclonal antibody .OKT3 (ATCC CRL-8001) was .׳ 35 diluted with phosphate buffer (PBS) to final concentration of 8pg/ml.

. Each of the various human anti-human AILIMmonoclonal antibodies '-'

1. י

WO 01/87981 . . PCT/JPO1/04035 . . 112 ' ',', ' prepared above wasdiluted with PBS'to a final concentration of 4 Ομς/πιΐ. \ The antibody solutions were further diluted with. PBS to prepare various . concentrations of .antibodies (40gg/ml-0.0049μ9/π11) .

<7-2> Coating of microplate with antibody.

⁵ ׳ Each well of 96-well microplates was coated with (1) anti-human '

CD3.monoclonal antibody OKT3. .^g/ml; 25μ1 to each well) and any one ' . of the various ׳.human anti-human AILIM monoclonal antibodies ׳ . (40μg/ml-0.0049μg/ml; 25μ1 to each well) , ori (2) anti-human CD3 monoclonal antibody OKT3 ^g/ml; 25μ1 to each well) alone. Theplates were incubated at 37 C for 2 hours. . Subsequently, the antibody solutions were discarded, and each well was washed 3 .times with .PBS. After the wash,. RPMI1640 medium containing 10% FCS was added to each, well (ΙΟΟμΙ/well) , and the plates were incubated at 37°C for 1 hour. . '. Thus, respective wells of. the plates were coated with the antibodies ' ׳ . 15־ mentioned above .in (1) or. (2) .

Control experiments were carried out in the same manner by using plates coated with the following respective monoclonal antibodies as control antibodies instead of the human anti-human AILIMmonoclonal' antibodies .

²⁰ (1) Mouse monoclonal antibody SA12 or SG430 against human AILIM (JP-A.11-29599 (Example 12) and WO98/38216 (Example 12).) ;

(2) Mouse anti-human CETP monoclonal antibody JHCl' (also ^: referred to. as JMabl09; JP-A 9-20800) ; and״.

(3) Human anti-KLH monoclonal antibody (also referred to as .

JMab23; the above-mentioned Example). ^f'

The microplates coated with the antibodies were used in the following assays. ׳.

<7-3> Preparation of human.T cell suspension- .

Peripheral blood was collected from each normal healthy persons (5 persons; donor A, B, C, D and E) . Fraction containing mononuclear .

cells waspreparedby density-gradient centrifugation using LymphoPrep ; (Nycomed) . Human T cells were separated from the human mononuclear cell fraction according to the manual for experimental procedure by i .using a Pan-T cell Isolation Kit (Miltenyi) and Magnetic Sorter. T ' ׳ .35 . cell count was determined using a hemacytometer. Human T cells were suspended׳in. RPMI1640 medium containing 10% FCS to prepare human T . .:׳

WO 01/8798] . . . . PCT/JPO.l/04035 ' . . ' , / 113 cell suspension (l*10⁶ cell/ml).

<7-4> Cell culture . :

(1) Culture using microplate coated with anti-human CD3 antibody and anti-human AILIM antibody ׳ .5 Human T cell,suspension (donor A, B, C,.D or E; ΙΟΟμΐ/well;

1*10 cells/well) was added to each well of the microplate coated with .the antibody mentioned above and the plate was incubated at 37^cC for 3 days in a CO2 incubator.

.׳' . After cultivation, aliquots of the resulting culture supernatants (50μ1) were, stored at -20°C and then used in the assay :

.described later (assay for IFNy) . Aftersampling .aliquots of the ‘ culture supernatants, respective microplates were used for the following.assay:

(2) Culture using microplate coated with anti-human CD3 antibody alone .

Human T cell suspension (donor D; ΙΟΟμΙ/well; lxlO^s cells/well) was added to each well of themicroplates coated with the above-mentioned antibody, and then any one of the various human anti-human AILIM / monoclonal antibodies was added thereto .(25μ1 of the antibody of '. 40μg/ml-0.0049μg/ml). The plates were incubated at 37°C for 3 days . in a CO2 incubator. ' <7-5> Determination of proliferation activity of T cell

Methyl . [³H] thymidine (0.5μ0ΐ/κβ11; Amersham-Pharmacia) was added to each well of the plates after incubation, and the plates were incubated at 37 G for 6 hours in a-CO2 incubator. After incubation, .25 cells were trapped on,GF/C filters (Packard) using Cell Harvester.

Subsequently, the filters were dried at 40°C for 3 hours or longer, and then Microscinti 0 (20μ1/_νβ11; Packard) was added thereto. ,. . . Radioactivity of ³H incorporated of the cells trapped on the filters . ' .

.was measured by a β-counter (TOP COUNT) to analyze the degree of T ,30 cell proliferation after.cultivation.

Results are shown in Figures 15 to .39.

Result of this assay showed that human! cells were significantly . proliferated depending on the concentration of the cells when microplates were coated with anti-human AILIM.monoclonal antibody . 35 (human monoclonal antibody or mouse monoclonal antibody) together :.

with .anti-human CD3 antibody. . Further, there were some, differences

WO 01/87981 . PCT/JP01/04035

‘ 114 י. .

in the degree of .cell proliferation among the donors.'

On the other hand, human T cells did not grow significantly, when plates had been coated with.anti-human CD3 antibody alone and anti-human AILIM monoclonal antibody (human monoclonal antibody , or mouse monoclonal antibody) in solution (liquid phase) was used during culturing the .cells .

<7-6> Quantification of IFNY in culture supernatant of. T cell

For respective cultures.of T cells (donors B and C) described . in (1) of <7-4>, the amounts of IFNy in the culture supernatants were determined by a commercially available human IFNy ELISA KIT (Amersham-Pharmacia; Endogen).

Results.are shown in Figures 40 to 47.

Result of this assay showed that the production of IFNy increased' significantly depending on the concentration of . anti-human AILIM ' 15 monoclonal antibody (human monoclonal antibody or mouse monoclonal antibody)

Example 8 Regulatory activity of human ariti-human AILIM monoclonal antibody on mixed lymphocyte reaction (MLR) ²⁰ Itwas tested whether or not thehuman'anti-human AILIMmonoclonal ^; antibodies of the present invention were capable of controlling (enhancing and/or inhibiting) T cell responses (production of cytokines such as IFN^y and IL-4, cell proliferation, etc.) , in other . words, capable . of regulating the transduction of . AILIM-mediated 25 costimulatory signal into cells, by analyzing the activity (namely, DNA synthesis in cells) of controlling T cell proliferation associated with allogenic mixed lymphocyte .reaction (allogenic MLR) as an index. ׳ <8-l> Preparation of human PBMC and'T cell ־ Peripheralblood (200ml) collected from' each normal healthy persons (7 persons;'donor A, B, C, D; E, F and G) was dispensed on the layers of Lymphoprep (15ml; Nycomed) in microtubes (50ml; Falcon) . After centrifugation (at IGOOrpm.for 10 minutes) , intermediate layers ^:were recovered. ' Recovered cells were diluted 2 times' or further with : 35 phosphate buffer, and then centrifuged (at l,800rpm for 10 minutes) .

Thus, PBMC (peripheral blood mononuclear cell; 2^χ1Ο³χ10^Β cell) was

WO 01/87981 PCT/JPO 1/04035.

115 . ' ’ prepared. . Cell count was determined by using a hemacytometer. An aliquot of the cells to be used in MLR assay (.1.08x10® cell /9 microplates) were taken and kept on ice. Remaining cells were used ׳ for the separation of T cells .described below.

.5 . PanT Isolation kit (Miltenyi Biotech) was used for the separation א . .of T cells' from PBMC. According to the manual attached to the kit, remaining PBMCs were added to.the solution attached to the kit, and ' the solution was incubated. Subsequently, cells were washed with ' PBS containing 5mM EDTA and 0.5% BSA. and then re-suspended in PBS.

Subsequently, thecell. suspension was added to a Positive Selection ,'Column VS+ (Miltenyi Biotech) swollen with PBS, andunadsorbed fraction was recovered. Further, PBS was loaded onto the column, and the wash ' solution ׳.was recovered. The same treatment was repeated once. Recovered solutions were combined together to give a T cell fraction.

After centrifugation of the'T cell fraction , cells were re-suspended. ' in PBS . . Cell count of the resulting.T cells was determined by using ' a hemacytometer. The cells were.used in the following assay.

<8-2> Mixed lymphocyte reaction (MLR)

As described above, two signaling pathways . one between CD28 and CD80 .(B7-1)/CD86.(B7-2). and the' other between CTLA4 and .

CD80 (B7-1)/CD86 (B7-2) , for which comparatively detailed analysis have .been previously made, are known as costimulatory signaling.pathways required for .the activation of lymphocytes such as T cell, .etc.

' Namely, the .proliferation of .T cell; in response to mixed , lymphocyte reaction (MLR) can.be induced by .the. signal transduction through each of the two known pathways. .

Thus, by using the substances indicated below; test of this. invention was conducted to analy ze (1) the inhibition of MLRby blocking . the CTLA4-mediated signaling pathway ; (2). the inhibition of MLR by .

blocking the CD80' (B7-1) /CD86 (B7-2) -mediated signaling pathway; (3) the inhibition of MLR by blocking both CTLA4-mediated pathway.and CD80 (B7-1)/CD86 (B7-2) -mediated signaling pathway; (4) the inhibition of MLR by blocking the tertiary signaling pathway associated with AILIM; and (5) the ihhibition of MLR by blbcking'both CTLA4-mediated pathway and AILIM-mediated pathway. /

Following test substances were used.

WOOl/87981 PCT/JPO1/04035

-. .116׳ ' י / ־ י ' : f (1) Human anti-human AILIM monoclonal antibody (prepared in,' the Example described above) ;

(2) .Mouse anti-human AILIM monoclonal antibody SAI2 (same as ’ in the above Example);

(3) Human anti-KLH monoclonal antibody (negative control.

same as.in the above Example) ; .&lt; / '־ ' (4) Mouse׳ IgG antibody (anti-human CD34;,negative control;

,. Immunotech) ;'.‘.’׳'. .׳. י.

(5) A mixture of anti-human . CD80 monoclonal antibody ' (Pharmingen) and anti-human CD86 monoclonal antibody (Pharmingen) ; '.and (6) Human CTLA4-IgFc chimera molecule׳ (Ancell) ,

Mixed lymphocyte reaction (MLR) was conducted on the following combinations using.PBMCs and T cells prepared from the donors described above in8> ׳-L>. ' ־ . /' (i) T cell (donor A) . /PBMC :(donor D) . . ' (ii) T cell (donor .D) /PBMC (donor B) /(iii) T cell (donor. C) /PBMC (donor A) (iv)' T cell (donor E) /PBMC (donor G) ²⁰ ' (v) T cell (donor F) /PBMC (donor E) (vi) T cell (donor G) /PBMC (donor F). ' '

The concentrations-of PBMCs and T cells to be used in .the test׳ were adjusted as described below. . '

PBMCs were suspended in PBS, and then transferred into culture’ .

-dishes (60 mm). The cells were subjected to X-ray irradiation (50

Gy) with an irradiator (Hitachi MEDICO) . . Cells were recovered, /.'''/ centrifuged and then added to PRMI1640 medium containing 10% FCS. .Cell count was adjusted to 2X10⁵ cells/50gl.

.'Resulting T cells from each donor were also added to PRMI1640 medium containing 10% FCS and the cell count was adjusted to 1X10⁵εβ113/50μ1.

<8-2-l> Inhibition of MLR by human anti-human AILIMmonoclonal antibody

PRMI1640 medium containing’10% FCS was added to each well of ' a 96-well microplate having U-shaped wells.' A solution of׳ human ' /׳ 35 anti-human AILIM monoclonal antibody, or mouse anti-human AILIM .monoclonal.antibody SA12 was diluted with PRMI1640.mediun1 containing / >/

WO 01/87981 PCT/JPO1/04035 ' 117 , 10% FCS to prepare’solutions with various concentrations of the antibody .

Diluted antibody solutions were added to the wells, ('final ' concentration: 0, 0.31, 1.25, 5 and 20μς/πι1) . Subsequently, T cells (50μ1) were added־to the wells. The plate was incubated at 37°C for

5. 1 hour in a.CO2 incubator (NAPCO) . After the reaction was completed, PBMCs (50μ1) derived from a different donor were added to the wells to initiate MLR., '. .

When MLR was conducted-using an antibody other than human anti-human AILIM antibody (described above in.(3). to (6)) as the test'!

substance, T cells derived.-from a different donor were allowed to', '/ ' :react after the incubation of PBMCs with the .test .substance. . . On the fifth day of the culture, tritium-labeled thymidine . (³Η-Thymidine; 20μ1; ^Ci/well) diluted with PRMI1640 medium ' containing 10% FCS was added to each well. Cultivation was continued .15 foroneday. After the culture was completed, the cells were harvested .

using a Cell Harvester (Packard) . Radioactivity of ³H incorporated. .' • .of the cells.was measured in a β-counter (TOPCOUNT; Packard) to analyze the .rate of T cell proliferation after .the culture. ;

. Results are ;shown in Figures .48 to 59.

. 20 <8-2-2> Inhibition of MLRby human anti-human AILIMmonoclonal antibody in MLR system where. CTLA4-mediated ^,. signaling pathway has been. : ' previously blocked

PRMI1640 medium containing 10%FCS was added to each well of . a 96-well microplate having U-shaped wells. A solution of, human ''.

anti-human׳ AILIM monoclonal antibody or' mouse anti-human AILIM.' ?

. monoclonal antibody SA12 was diluted with PRMI1640 medium containing 10% FCS to prepare solutions with various concentrations of the antibody. The. diluted antibody solutions were added to the wells, (final concentration.: 0, 0.31, 1.25, 5 and 20gg/ml) . Subsequently, T cells ;

(50μ1) were added>to the.wells. The plate was incubated at 37°C'for.

hour in a CO2 incubator (NAPCO) .

' In addition to the culture of the T cells, PBMCs (in RPMI1640 medium containing 10% FCS) derived from other donors: were cultured independently after adding human CTLA4-IgFc to the PBMCs. Cultivation ' 35 was performed at 37 °C for 1 hour in. . a CO₂ incubator (NAPCO). , .Concentration of CTLA4-IgFc,was adjusted to 20μg/ml at the start of

WO 01/87981 PCT/JPO1/04035 . :113 . . ׳ .'

-the MLR. .. 'י

Subsequently, PBMCs (50μ1) were.added to the T cell culture , .described above to initiate MLR.

When MLR׳was conducted using an antibody other than.human 'anti-human AILIM antibody (described above in (.3) to (,5)) as the test substance, T cells derived from a. different .donor were allowed to ' . .react after the. incubation of PBMCs, which had been .cultured in the' ׳ presence of CTLA4-IgFc, with the test substance. .׳ &lt;

. On the fifth day of the;culture, tritium-labeled' thymidine .'. .10 (³Η-Thymidine; 20μ1; . 1μθΐ/γβ11)diluted with . PRMI1640 medium . ׳ containing 10% FCS was added to each well. . Cultivation was continued foroneday. After the culture was completed, the cells were harvested by using a Cell Harvester (Packard) . Radioactivity of ³H.incorporated . of the cells was.measured in a β-counter (TOP COUNT; Packard) to;analyze ' the׳ rate of T cell proliferation after the .culture. ..

Results are. shown in. Figures 60 to 69.

. The results obtained from.the two tests described above are: summarized as follows:

(1) CTLA4-IgFc blocks the CTLA-4-mediated signal transduction, . 20 and thereby inhibiting the allogenic MLR-induced proliferation of

T cell. .

(2) Anti-CD80 antibody and anti-CD86 antibody inhibit the signal; ’ , transduction mediated by CD80/CD86, which is a ligand for CTLA4 and ' CD28 , and thereby inhibiting the allogenic MLR-induced proliferation;

of T cell.־ ' (3) A monoclonal antibody against human AILIM, like CTLA4-IgFc , . ^an^f“CD80 antibody and anti-CD86 antibody, significantly inhibits the allogenic MLR-induced T cell proliferation associated with the AlLIM-mediated .signal .transduction . in an .antibody concentration-dependent manner.

In other words, .these results show that a tertiary pathway .mediated;by AILIM and the ligand thereof in addition to the known pathways mediated by CTLA4/CD80/CD86 and mediated by CD28/CD80/CD86 .exist׳ as a costimulatory signaling pathways' required for T. cell 35 activation, as well as that the AILIM-mediated signaling pathway is inhibited by. antibody .againstAILIM. : . . '

WO 01/87981 PCT/JP01/04035

Λ . /׳

Furthermore, it raises the possibility that contribution of ' AILIM-mediated pathway to the signal transduction may be comparable . . to those of CTLA4/CD80/.CD86-mediated pathway. and. CD28/CD80/CD86-mediated pathway.

5. - ..י:׳. ' ׳ .־׳: k .>'

Example 9 ' Activity of human anti-human AILIM monoclonal ,antibody to induce antibody-dependent cellular cytotoxicity (ADCC)

Biological activities caused by antibodies include induction: of antibody-dependent cellular cytotoxicity (ADCC). ADCC is .a . .10 cytotoxic action that requires the antibody in addition to. effector !? cells and target cells , that induces damage, on. the target cells induced . /. by the . effector cells such as lymphocyte, macrophage or .ל .polymorphonuclear'leucocyte. . . . / :&lt; :/

The activity of the anti-human.AILIM monoclonal antibody :of :

the present invention to induce ADCC was analyzed as follows:

⁵¹Cr (0.1 mCi/10.⁶ cells; Amersham-Pharmacia) was added to. the culture of human AILIM-overexpressing recombinant HPB-ALL. cells prepared in the Example described above, and the mixture was incubated ׳ at37°C for2hours. The cells were washed 8 times with RPMI1640 medium.

.The isotope-labeled cells obtained were used as target cells.

Control.experiments wereperformedusing wild-typehuman HPB-ALL :. ,־ : cells labeled with the isotope as control cells in the same manner..; as described above. , .

' By using Lymphosepar I (IBL), PBMC fractions were separated' 25 from- peripheral blood collected from normal healthy persons. The resulting human PBMCs were used as effector cells.

The.target cells (lxl0⁴,cells/well; 25pl/well) were plated on each well of a.96-well microplate (Nunc) having U-shaped wells/ . Subsequently, any one of various concentrations .of human anti-human ' , 30 . AILIM monoclonal antibodies diluted with RPMI1640 medium containing 5% FBS (0.0001-1’. Ogg/ml; 25gl/well) , the medium alone (25gl/well) • or 1% Nonidet P-40 (25gl/well; detergent having cell-lysing activity) .was added to each well and the plate was incubated at room temperature for 20 minutes.

. Cultivation was carried out using anti-human CD3 monoclonal antibody OKT3 (ATCC CRL-8001) as a positive control antibody instead ; .

יי' י' ' / .' ,.-'..

WO 1)1/87981 . PCT/JP01/04035 .

120 .

of anti-human AILIM antibody in the same manner.as described above. ׳ Subsequently, the effector cells (E/T ratio=50; 1x10^{s 1}• cells/well; 50gl/well) were added to .each well and the.plate was incubated at 37 C for 16 hours under an atmosphere of 5% CO₂ in an 5 . incubator. ,

After cultivation, samples were centrifuged (at l,500rpm at

C for 10 minutes). Resulting ' supernatant . was . recovered.׳ .Radioactivity in the centrifugal supernatant was measured by a . γ-counter. The radioactivity represents the amount of ³¹Cr released. 10 ' from the cells into the culture supernatant by the .damage of cell' . > membrane by ADCC. ׳. .' '.

Percentage.of cell membrane damage (percentage cell lysis), which was caused by ADCC induced by anti-AILIM antibody or anti-CD3 ' : antibody , was determined.under an assumption that the. radioactivity 15 observed with the medium alone corresponds to. 0% with respect to the cell membrane damage (0) and that with Nonidet corresponds to 100¾ with respect to the cell membrane damage.

Results are' shown, in Figures 70 and 71: ''''

The result of . the test showed that human'anti-human AILIM:

monoclonal antibody of the present invention exhibited ADCC-inducing activity in a concentration-dependent, manner.

Example 10 Determination of gene and amino acid, sequences of human . anti-human AILIM monoclonal antibody, and analysis of the same 25. Sequences of cDNAs encoding the heavy chains as well as cDNAs encoding the light chains of. various human anti-human AILIM monoclonal ' antibodies, which had been prepared in the Example described above, were determined as described below. Structural features of the genes were also analyzed.¹

By using Quick Prep mRNA Purification Kit . (Amersham-Pharmacia) , ' '.

P01yA⁺RNAs. were extracted and purified from each of hybridomas (clones: AIH5D3 (JMab-136) , ΑΪΙ289 (JMab-1.38) and AII394 (JMab-139)) , which .

. produce human monoclonal antibody against human. AILIM prepared in' the ,Example, described above:

The hybridoma cells were suspended in a cell lysis buffer (Lysis Buffer) , and lysed by usinga syringe to solubilize them. Oligo (dT) ^:

WO 01/8798.1 \ PCT/JPO1/04035 .

. '׳ '. ¹²¹' י ’ - ' ' resin was added to the solubilized material and the mixture was shaken׳ . gently. Subsequently, Oligo (dT) resin was washed, and then P01yA^fRNA . .was .eluted with Elution Buffer. Eluted PolyA^RNA was precipitated, with ethanol, .and then dissolved in Tri.s-EDTAbuffer. Concentration . '5 of P.01yA⁺RNA obtained was determined . by ;absorbance at a wavelength -.: of 260nm. .' . Double-stranded cDNA was synthesized by using P01yA*RNA as, a -. ..template according to M-MLV Reverse. Transcriptase method using a . commercially available cDNA synthesis kit . (GIBCOBRL). and synthetic ?

.oligo DNA Notl-T (SEQ ID NO: 1) as a primer.

Specifically, single-stranded cDNA was synthesized in a solution (about 50μ1) containing P01yA⁺RNA (about 5μ^) purified from the hybridomas as a template, the primer (about 40 0 pmole). and M-MLV Reverse '.Transcriptase at 37°C for 1 hour. Subsequently, dNTP, DNApolymerase 15 I, RNaseH, DNA ligase, buffer and distilled water were-added to the reaction solution (4μ1), and the mixture was incubated at 16°C for .2 hours to synthesize double—stranded cDNA. The resulting . double-stranded cDNA was extracted with phenol/chloroform and then 'י ,. precipitated with .ethanol.

. Subsequently , EcoRI linker DNA (about 300 pmole) and DNAligase (Ligation High; 33μ1; TOYOBO) was added to the solution containing . the double-stranded cDNA in TE buffer (about 50μ1) and, the mixture . was incubated at 16 C for about .80 minutes to ligate the cDNA with . the linker DNA. The. linker DNA used was a double-stranded DNA ,. 25 consisting of oligo DNA (20adp; SEQ ID NO: 2) and oligo DNA (24adp; ;

SEQ ID NO: 3) , which had been 5 ^,—phosphorylated and annealed to each ' , ׳ other by a commonly :used method. .

The DNA ligate was extracted with phenol/chloroform, and then ' precipitated with ethanol. Subsequently, the DNA reactant was ' 30 digested with a commercially available restriction enzyme Notl (TOY.OBO) , and then ^: incubated with' a commercially available ATP solution (GIBCO BRL) and T4 kinase (TOYOBO) at 37°C for 30 minutes to phosphorylate the .5' end ,thereof.

The resulting'DNA was precipitated with ethanol-, and then ׳ . .35 י fractionated by polyacrylamide gel electrophoresis. Apiece of gel . , containing DNA of about 500bp to2000bp was cut out. Cutting of.the . j

WOOJ/87981 PCT/JPO1/04035 : .122 . ' . , . gel .was carried out while the DNA stained with ethidium bromide was. being visualized by irradiating UV light in a photographic device. ' The gel cut off was crushed and then suspended in TE buffer. The suspension was- centrifuged and the resulting supernatant was ' 5 . recovered. .

' The DNA recovered was ligated to a commercially available lambda ' phage־vector,lEXcell .(0.25gg; AmershamPharmacia) in the presence .of commercially, available DNA Ligase (Ligation High; TOYOBO) . (at 16°C for 30 minutes) . In the next step, the DNA ligate was packaged into lambda phage using a commercially available lambda phage packaging . kit Gigapack III Gold (STRATAGENE) and .the resulting phage particles ,were infected to E. coli NM522 as a host to prepare a cDNA library. All the manipulations were carried out according to the experimental . protocol attached to .the kit.

Subsequently,. the cDNA library was screened by a plaque hybridization method (Maniatis et al., Molecular Cloning: A Labolatory Manual, ״ Cold Spring Harbor Laboratory, Cold Spring Harbor, , . New York) 'as follows: '

The cDNA library (IxlO⁴ plaques) was plated on. agar plates and replica filters thereof were prepared by using Hybond-N nylon membranes .

. (Amersham Pharmacia). These, replica filters were׳ subjected to hybridization treatment using probes labeled by using γ^3ζΡ-ΑΤΡ in a 'י . . hybridization buffer according to the plaque hybridization method.

Probes used were HIGLC (SEQ ID NO: 4) for antibody light chain and

45. NHCc2 (SEQIDNO: 5) for antibody heavy chain. Single-plaque isolation was carried out from־the positive clones obtained in the primary . screening and secondary screening.

Each of heavy chain and light chain of the antibody was amplified by PCR using a single PCR primer and Taq PCR kit (TAKARA) by utilizing . phage suspension from each positive clone as' a template DNA. A pair of primers used for :antibody light chain were ExcellE־ (SEQ ID NO:, 6) and ckll7 (SEQ ID NO: .7) , and a pair of primers used for antibody .

,. heavy chain were' ExcellE (SEQ ID NO: 6) and NHCc2 (SEQ ID NO: 5) .

The resulting PCR products were fractionated־according to a usual' ¹35 method using agarose gel electrophoresis. Pieces of gel containing . DNAs of about 600bp corresponding to the heavy chain and light chair. .

WO DI/87981 PCT/JP01/04035 '

־ . ., ' ' 123. ־ were cut out. Nucleotide sequences of the DNAs purified, from the gel wereanalyzedby using a DNA Sequencer (373A; PE-AppliedBiosystems) , ABI PRISM Sequencing Software (PE-Applied Biosystems) and AB I PRISM. ' Auto Assembler (PE-Applied Biosystems) . DNA from each positive clone was verified.to have sufficient length of nucleotide sequence.

XPhage from the plaque of each positive clone was infected to

E. coli NP66 for in-vivo excision of plasmid DNA of interest, and , the resulting.filamentous phages were plated on.ampicillin-containing .plates to give colonies. Subsequently, plasmid DNAs were recovered'^;.

and purified from the colonies by a commonly used.method, and E. coli' JM109 was transformed with the plasmids. Subsequently , the .

• transformed, cells were plated on ampicillin-containing nutrient agar plates to form colonies. . .

Subsequently, bacterial suspension in ampicillin-containing .15 LB medium derived from each colony was transferred to a liquid nutrient . medium and the bacteria were cultured .at 37°C for 24 hours. .The. bacteria were harvested from the.culture,. and then the plasmid DNA . : was purified by. a plasmid purification kit (Quiagen) . Each of the ׳ plasmid DNAs was digested with restriction enzymes EcoRI/Notl to verify.

. .the presence of vector .DNA and insert DNA (heavy chain .cDNA or light . chain cDNA). .

Each nucleotide sequence of cDNA encoding heavy chain and antibody light chain of the antibody, which was inserted in each purified, plasmid, was determined by a commonly used method using DNA Sequencer ' 25 . (377A; PE-Applied . Biosystems), ABI PRISM Sequencing Software . (PE-Applied Biosystems) and ABI PRISM Auto Assembler (PE-Applied' . Biosystems) ..'

Primers used for the sequence determination were as follows: <Primers used'for the determination of.heavy chain cDNA> '

M13R primer (SEQ ID NO: 8; STRATAGENE) , ExcellE (SEQ ID-NO:

6) , 136H (SEQ ID NO:9), 138/9H (SEQ ID NO: 10), AILIMHC1 (SEQID

NO: 11), HCcl ’ (SEQ ID NO: 12), NHCc2 (SEQ ID NO: 5), HCc7 (SEQID

NO: 13) , HCc8 (SEQ ID NO: 14), HCc3 (SEQ ID NO: 15) ,. HCc4 (SEQID

NO: 16) , HCc6 (SEQ ID NO: 17), HIGHC (SEQ ID NO: 18), 'HCc9 (SEQID

NO: 19), HCc5 (SEQ ID NO: 20) and polyA (SEQ ID NO: 21)., <Primers used-.for the determination of light chain cDNA> ' ', .׳

WO 01/87981 PCT/JP01/04035

/. 124 .

M13R primer (SEQ ID NO: 8; STRATAGENE), ExcellE (SEQ ID NO:

6) , AILIMLC1 (SEQ ID NO: 22) , . AILIMLC2 (SEQ ID NO:. 23) , LCcl (SEQ IDNO:.24), ckll7 (SEQ ID NO: 7) , HIGLC (SEQ. ID NO: 4) , LCc2 (SEQ ID NO: 25), HIK (SEQ ID NO: 26), and polyA (SEQ ID NO: 21).

.3. Sequence Listing. shown below contains cDNA sequence.encoding • heavy chain and cDNA sequence encoding light chain of human monoclonal ' antibody against human AILIM, which are' produced by .each hybridoma X ,mentioned above, as well as amino acid sequences deduced from the / cDNA sequences .

Clone AIH5D3 (JMab-136) <Heavy chain> . ל . <

DNA sequence: SEQ ID NO: 27 (signal sequence: nucleotide number ׳ j 69 to 125, V region: nucleotide number 126 to 419) .

Amino, acid sequence: SEQ ID NO: 28 (comprising signal sequence: ' 15 .amino acid number 1 to 19, variable region: amino acid number 20 to ¹¹⁸) ' . . '.'.'י.

CLight chain> ־׳//ל. .' ל..

. DNA sequence: SEQ IDNO: 29 (signal sequence: nucleotide number .39 to 104, V region: nucleotide number .105.to 386) ^;\/.

2θ. Amino acid sequence: SEQ ID NO: 30 (comprising signal sequence: \‘׳״.' ' amino acid number 1 to.22, variable region: amino acid number 23 to .

116) ' ' :./ .’ /' . Clone AII289 (JMab-138) . <Heavy chain>

25. DNA sequence: SEQ ID NO: 31 (comprising signal sequence:

nucleotide.number 94 to 150, V.region: nucleotide number 151 to 441)

Amino acid sequence: .SEQ ID NO: 32 (comprising signal sequence: . '/' ' amino acid number 1 to 19, variable region: amino acid number .20 to Π6) י'.' ל .' ' - . ' . . . ///.

KLight chain>

DNA. sequence:. .SEQ ID NO: 33 (comprising .signal. sequence: nucleotide number 28. to 87, V region: nucleotide number 88 to.375)

Amino acid sequence: SEQ ID NO: 34 (comprising'signal sequence: / amino acid number 1 to .20, variable region: amino acid number 21 to

/// 'י.;:' ⁴ .־' . . (¹¹⁸35

..' .'.; ' . (139-Clone AII394 (JMab '׳ .׳ .' X ^,”, Χ. X ־ . '> ׳ ‘Χ ־' '׳ '־X' ' / . ‘ 'XX. .? ־’ ׳ '־ ׳׳'' ./X' '. , . ־ X .*׳,’. .,־'-*?.׳ / ’ 'X -X'/

;־χ .^, ., .׳X . .. .,׳ ׳ , ׳'.־ ־? ..־ ׳׳ . /׳. ׳ ; , ׳ . x x * .׳ χ . ־ י ./׳ .'־.' •

Χ;:χχ/׳. ο/ .’’.׳-׳ ;,'χΧ; > ״ '־ ׳/ -׳.,״'־/:ל X ^זי*-לי X.^,,. ׳ ־־ ל -Χ/χΧ.χΧ χχ׳Χχ׳*X<_/ ₍ χ.Χ- ’-'ΧχΧ\Χ׳x

. ״/;־. , לי' .'.־- : ’* .1 ' .'־.־ /־'.ל־ ׳'.'./. ^r//.'׳, χ .&lt;.. .Λ.'-. .'. . '.'. ׳Λ.־.DX’X

׳: ־ .ל. ל ' ל. ז . /.;י -. .v. ׳ . ־r ./ '/. Λ/.'. ת״ל. ־ נ/,./.ל־־/.';. ν . . י. /־ .׳'. .. . / . \. . . .־.: ..'Χ. - '־' ' ' ־

WO 01/87981 PCT/JP01/04035

׳ י 125

CHeavy chain> '.

DNA sequence: SEQ ID NO; 35 (signal sequence: nucleotide number 96 to 152, V region: nucleotide number 153 to 443)

Amino acid sequence: SEQ ID NO: 36 (comprising signal sequence': 5., amino acid number 1 to 19, variable region: amino acid number 20 to

.י. .' ' ׳ י' ' ' >. י.' ' (116 .<Light chain>

DNA sequence: SEQ ID NO: 37 (signal sequence: nucleotide number 33 to 92, V region: nucleotide number 93 to. 380)

Amino acid sequence: SEQ ID NO: 38 (comprising signal .sequence:

amino acid number ! to 20, variable region: amino acid number 21 to ׳ Ί16) .

By using analytical software for gene sequence,. the library

V BASE Sequence for human immunoglobulin, variable region genes •15 ' constructed by Tomlinson et al. (Immunol. Today, Vo.1.16, No.5, p. 237-242, 1995) was searched for each of the DNA sequences determined herein.

Result showed that the V-region genes of the respective heavy chain and light ,chain of the above-mentioned, human monoclonal .20 antibodies consisted of the following, segments.׳ :

<Eeavy chain .V-region gene> . clone AIH5D3 (JMab-136): 1-02 '.clone AII289 (JMab-138): 3-13' clone AII394 (JMab-139) : 3-13 '.’.?', .

,25׳ , <Light.chain V-regiongene>

clone AIH5D3 (JMab-136): L5 . .

clone AII289 (JMab-138): A27 clone AII394 (JMab-139): A27 . ³⁰ Example 11 Inhibitory effect of human anti-human AILIM monoclonal antibody on delayed-type hypersensitivity (DTH)

The biological system of immune response, the function of which is to eliminate harmful antigens (pathogenic microorganisms such as virus, bacteriumandparasite, foreignbody, etc. ) tothelivingbodies, ;35 . and.can be broadly, divided into congenital immunity and acquired , immunity. . , .^!. 'יי .'.״.; ;. ..׳.־ .,

WO 01/87981 PCT/JPO1/04035 .' . 126

The former .is. a system of elimination based on non-specific recognition including phagocytosis by phagocytes (polymorphonuclear leukocyte, monocyte, macrophage, etc.) , attack by natural killer, (NK) cells, and. opsonization of. antigen by complement,. etc.

The latter, acquired immune.response, is a system of׳elimination by lymphocytes :(mainly, T cell and B cell) which acquired specificity (activation) to the antigen.

Further, acquired immune response can broadly _;be divided into cellular immunity and humoral immunity.

.10 Unlike antibody-dependent humoral immunity, cellular immunity is an immune, response expressed in general by the direct, action of T cell on an antigen as.the target. Cellular immunity is known to be involved in immune response to virus or tumor, immune response ׳ ,./induced after transplantation of tissue or organ, hypersensitivity 15 to some drugs, and some of autoimmune diseases.

Most typical phenomenon belonging to cellular immunity is. the well-known tuberculin allergy (almost synonymous with tuberculin hypersensitivity). Tuberculin allergy is a delayed allergy, -triggered by the infection by tubercle bacillus. The allergy is due .

to the infection by tubercle bacillus and can be induced by causing immune response by intracutaneously injecting, to a living body, . tuberculin protein , produced in culture supernatant of tubercle bacillus.

' Delayed .allergy is an allergy mediated by Τ'cell (memory T cell 25 memorizing antigen) sensitizedwith an antigen’. . The allergy is called delayed type,׳' because it takes 24 to 48 hours for a living body sensitized with the antigen to express allergic response with inflammation induced by the .memory T cell when contacted again with the׳ antigen. .׳ .'

2D The phenomenon of tuberculin allergy, which is a representative of delayed allergies, has generally been utilized in tuberculin test״ to diagnose whether or not sensitization by the. infection of tubercle bacillus has already been established in an animal. . Specifically,:? the test is conducted as follows: purified tuberculin (purified protein derivative; PPD; Q.l'ml of the derivative of 0.05gg/0.1ml , , (2.5TU) for general, diagnostic use), which is,tuberculin protein

WO 01/87981 . . PCT/JP01/04035 . . 127 purified from .the culture of tubercle .bacillus, is .:intracutaneously given to an animal; the major axis.of skin redness at the injection : site is measured 48 hours after the injection; 'and the presence of _! . . infection of tubercle bacillus can be diagnosed based on the major axis measured. If the major axis.of the redness is shorter than 4mm, ׳ then the subject is negative; irit is within the;range'of .4-9mm then . .the subject is false positive; and if it is 10mm or longer then the subject is decided positive.

Delayed allergies associated with cellular immunity include, . .-10 for example, Jones-Mote type hypersensitivity transiently induced . by a small amount of protein or the like', contact allergy to drugs such as picryl chloride or plant toxins such as.Japanese lacquer, or allergy associated with graft rejection (e.g., allogenic ,graft) ׳ as well as the above-mentioned allergy, to antigen from infectious 15 pathogen such as tuberculin allergy caused, by tubercle bacillus . described above.

In this test, ,the inhibitory effect of anti-AILIM antibody on .' • delayed-type hypersensitivity׳ (delayed allergy), was .evaluated by , ג utilizing the above-mentioned tuberculin test. . The test was .

conducted as follows:

Each of cynqmolgus monkeys (male, body weight: 6.C-8.5kg, Environmental Biological Life Science Research Center Inc.; 3. . .,individuals in each group) , which had been sensitized with BCG (Bacille ׳ tie Calmette et Guerin) , which is an attenuated live bacterium of 25 יי bovine-type :tubercle bacillus, was anesthetized with ketamine ' hydrochloride (lOmg/kg, intramuscular injection),;and then any one of the test samples: indicated below was intracutaneously given with ' a quantity of 0,1ml to each injection site (6 injection . ' sites/individual) in the chest., The distances between the injection״ 30 sites of the sample were 3 cm or longer.

(1) 1:1 mixed solution of human anti-human AILIM monoclonal . antibody (JMab-136; 0.2mg; l(^g at each injection site) and tuberculin . (4gg/lml of physiological saline) ;', (2) .1:1 .mixed solution of human anti-human AILIM monoclonal •35. antibody (JMab-136; 2mg; 100μg at each injection site) and tuberculin ^g/lml of .physiologic^ saline) .; ; &lt;. . ;

. .''' ’ ‘ . . ¹ . . . ’'.' , ־ ; - .י : . ' . ‘ . , יי . . . .יי ־ . '.' ‘ ' , ‘ . * . . '.*. '' . Λ.-'.ν: . ' ν>^:λ.-Ε׳::./׳^'χ;;1 /״,//;/־'.׳ .-//-/. :' .״:.;:;./> ,. /'>.ל:1.' ,'־י//;// ., . λ» «. _v ־י..1• ..-. .־-- .‘.x., . .׳ j . . . . ‘. - . i ^f '< .ך. י*.; . .j - . '.י,‘. - -. .־. .־ i־, .-U> . .־.'. I״ .ri .ί ״ '.׳

WO 01/87981 PCT/JP01/04035

’ י' . / ' ' י' 128 ' • (3) phosphate buffer (PBS (-)) as a control;

1:1. (4)׳ mixed solution of a commercially available steroidal' ' anti-inflammatory agent, Prednisolone (0 .2mg; 10gg at each injection׳ site) and tuberculin (4gg/lml of physiological.saline) as a positive . control; ' I . .

(5) 1:1 mixed solution of human anti—KLH monoclonal antibody (Example <2-2>; 0.2mg; 10gg at each injection site) and tuberculin .׳ (4gg/lml of physiological saline), as a negative control.

hours after injection of each sample, the major axis and minor axis .of redness at each inj ection site were measured to determine .; the ,area of the redness.

The result is shown in Figure. 72. . . j

The result showed that redness due to. delayed allergy was ' י significantly inhibited in any groups subjected to injection of the ' 15 anti-AILIM antibodies, as .compared with the control and negative control groups. The inhibitory effect was comparable to that of the' steroidal anti—inflammatory drug used as a positive control.

Example 12 Analysis for the expression of AILIM in various tissues.

of patients with graft versus host disease (GVHD) ־

Expression of AILIM in a variety of tissues obtained of biopsy from patients,. who were recipients subjected to transplantation of . . , . allogenic graft from donors ,and had been diagnosed clinically to be. . affected, with acute or chronic graft versus host disease (GVHD) after׳ .

the transplantation, was analyzed by a commonly used method. Tissues׳, were stained with HE and human anti-human AILIM monoclonal antibody ' (JMab-36) prepared in׳ the Example described above.

Analysis was carried out using 33 samples form various tissues &lt; .collected from acute GVHD patients (28 cases) as. well, as 5 samples .: 30 from chronic GVHD.patient (5 cases).

Results were as follows: AILIM-positive reaction was found in of 29 samples of skin.tissue; in 1 of 3 samples of stomach tissue; י .and in 1 of 1 sample of colon tissue; which were, all obtained from .'׳ : acute GVHD patients. AILIM-positive reaction was found in 1 of 3 ' samples of skin tissue; in 2 of 2 samples of colon tissue; which were: all obtained from, chronic GVHD patients. Further,. AILIM-positive

I. ¹

WO 01/8798] PCT/JP01/04035 .

:. . 129 ' reaction was found in 10 of 13 samples in which significant lymphocyte . infiltration had been observed.

. Example 13 Activity of human anti-human AILIM monoclonal antibody 5׳ .to transduce costimulatory signal in monkey T cell ' . The experiment' .conducted in Example 7 has demonstrated that . ^-the human anti-human AILIM .monoclonal antibodies of the present invention are capable of enhancing the proliferation of human T cell ׳ . via controlling the human T .cell response, specifically, controlling the transduction of AILIM-mediated costimulatory signal to the cell,.

In this test? it was analyzed whether or not the human.monoclonal/ antibodies exhibit activity of enhancing cell proliferation of monkey ' T cell by the same method as described in Example 7.

<13-1> Dilution of antibody ־; . /:

. ,¹⁵ Anti-human.CD3 monoclonal antibody SP34 (BD-Pharmingen). was diluted with phosphate buffer (PBS) to a final concentration of lgg/ml.

. The above-prepared human anti-human AILIM monoclonal antibody ' JMAbl36 was diluted with PBS to a final concentration of 40gg/ml.

. The antibody solutions were further diluted with PBS to prepare various 20 concentrations of antibodies (40μg/ml-0.064gg/ml).

.^<13-2> Coating of microplate with antibody . Each well of 96-well microplates was coated with anti-human .; CD3 monoclonal antibody SP34 (lgg/ml; 25μ1 to each well) and the human. . anti-human AILIM monoclonal antibody JMAbl36 (40μς/πύ-0.064gg/ml;

25μ1 to each well) . . The plates were incubated at 37°C for 2 hours.

Subsequently, the antibody solutions were discarded, and each well was washed 3 .times with PBS. After .the wash, RPMI1640 .medium containing 10% FCS was added to each well (ΙΟΟμΓ/well) , and the plates were incubated at 37 C forl hour. Thus respective wells of the plates were coated with the antibodies mentioned above. .

Control experiments were carried out in.the same manner using plates coated with human anti—KLH monoclonal antibody (JMab23;see the previousExamples) as control antibodies instead of the human anti-human AILIM monoclonal antibodies.

The microplates coated with the antibodies were. used in the . ;

. following assays. ׳׳': .: ' ' . . .

WOOl/87981 PCT/JP01/04035

יי , , . : 130 ' ־ י' 'י י' <13-3>, Preparation of monkey T cell suspension

Peripheral blood was collected from cynoraolgus monkeys and mononuclear cells were fractionatedby density gradient centrifugation using NycoPrepl.077A' (Nycomed). According to the experimental manual, monkey T cells ׳ were separated from the cyr.omolgus monkey mononuclear cells by using anti-human CD4 . antibody M-T477 .

(BD-Pharmingen) , anti-human CD8 antibody RPA-.T8 '.(BD-Pharmingen); / anti-mouse IgG microbead (Miltenyi) and aMagneti'c Sorter. T cell / ' count was determined using a hemacytometer. Monkey T cells .were ''.'’.

suspended in RPMI1640 medium containing 10% FCS. Thus monkey T cell ל - suspension (IxlO⁶ cell /ml) was prepared.

<13-4> Cell culture (1) Culture using microplate coated with anti-human CD3 antibody and anti-human AILIM antibody /5 Simian T cell suspension was added to each.well .of a microplate coated with the antibody mentioned above and the plate was incubated, at 37°C for 2 days in a C0₂ incubator.

.After the culture was completed, respective microplates were used,in the following assays:

<13-5> Determination of proliferation activity of T cell ל ' .:

Meixhyl [³־H] thymidine (0.5gCi/well. Amersham-Pharmacia) was added to each well of the plates after incubation, and the plates . were incubated at 37 C for 6 hours in a C0₂ incubator. After incubation, ' the cells were trapped, on GF/C filters (Packard) by using a Cell .ל25 Harvester. Subsequently, the filters were dried at 40°C for 3 hours '.;.;.־־ or longer, and then Microscinti 0 (20|il/well; Packard), was added thereto. ׳ Radioactivity of ³H incorporated in.the cells trapped on the. filters was measured by a β-counter (TOP COUNT) to analyze the degree of T cell proliferation after the’ culture. ' ' - ³θ The result is shown in Figures 73.

: . The result of this assay showed .that simian T cells were significantly prolif erated depending on the concentration of the cells when microplates were coated with anti-human AILIM monoclonal antibody' (human monoclonal antibody or mouse monoclonal antibody) together 35 with anti-human CD3 antibody.

. ,. The result also suggests . that the human anti-human . AILIM . .

WO 01/87981 PCT/JPO 1/04035 &lt;

131 . . . ' monoclonal antibodies of the present.invention can bind to monkey , AILIM and have the.activity to regulate the function of monkey AILIM.

Example 14 Establishment of method for identifying and quantifying ^: substances capable of binding to AILIM or AILIM ligand

A method .of, ELISA (Enzyme-linked Immuno solvent assay) was . established to identify or quantify a substance capable of binding' ' to AILIM (!COS) or AILIM. ligand (B7h/B7RPl/GL50/LICOS) . .

The principle of the method described below in detail as an . 10 example .is based on estimating, by ELISA, the degree of inhibition ׳'.

' . on the binding between soluble human AILIM.(hAILIM-IgFc) and soluble ׳..? ׳ human AILIM ligand (hB7h-IgFc) caused by the substance.

<141־־> Sample ׳

The following samples were used:' . /.!;.

.15 (!) Streptavidin-HRP .(Southern Biotechnology Associates,

Inc.);

(2) Soluble :human AILIM ligand (fusion protein between the.

extracellular region of human B7h and the constant region of human . IgGl) ; . :

. 20 The protein was.prepared by the method described below in <14-2>; ־ (3) Biotin-labeled soluble AILIM-IgFc;

The AILIM-IgFc was prepared, by further purifying the :antigen obtained according to the same -method as described in earlier applications (JP-A 11-29599 (Example 16 (2)) and WO98/38216 (Example . 16 (2))) of one of the present inventors, Tezuka;

(4) Human, anti-human AILIM monoclonal antibody (JMab-136; י described above); ’' (5) Human anti-KLH monoclonal . antibody (negative control . antibody; JMab-23;. described above) ;

30. (6) Phosphate buffer (PBS (־);Nikken Seibutsu);' (7) PRMH640; medium (Nikken Seibutsu);. ׳ (8) Fetal־calf serum (FCS; JRH-Bioscience);

’ (9) . 30%. Bovine serum albumin . (BSA; Sigma) ; , . (10) Tween20 (BioRad) ; ' . ..i • 35 (11) TMB⁺ substrate chromogen (Dako) .

.<14-2> Preparation of soluble human AILIM ligand (fusion protein

WO 01/87981 PCT/JP01/04035

. ’־' /. .י .' ' י '¹³² י י י'.-. י' ' ׳ י (hB7h-IgFc) of the extracellular region of human B7h and the constant, region of human IgGl) . Total RNA.was prepared from human peripheral blood-derived mononuclear cells in the same manner .as described in the Example above; ..

. . 5 cDNA was. synthesized from the obtained total RNA (5gg) as a template and by using Superscript Preamplification System for First Strand ' cDNA Synthesis (GIBCO-BRL).

Subsequently, 5'primer ־ (5 —GAGGTCTCCGCCCTCGAGATGCGGCTGGGCAGTCC—3'., SEQ ID NO: 39) having .Xhol : restriction site and 3'primer -.

(5 ^,-CACAGGACAGCCAGGGGATCCCACGTGGCCGCG-3 ' , SEQIDNO: 40) havingBamHT restriction site at their respective ends were designed and synthesized i to amplify cDNA encoding the extracellular region of human AILIM ligand 1' ׳: (hB7h) by PCR. By using the cDNA as a template and the primer pair,

PCR was conducted.to prepare a DNA having . .Xhol and BamHI at respective ׳' ends .thereof containing cDNA encoding’the’, extracellular region of human B7h. The resulting PCR products were digested with Xhol and . BamHI, and fractioned by agarose gel electrophoresis to isolate a . band corresponding to about 720-bp cDNA fragment, that was predicted .

to encode the extracellular region of interest. .The isolated cDNA ;

fragment was subcloned into plasmid pBluescript II SK (+) (Stratagene) . pre-digested with .Xhol and BamHI. It was verified that the cDNA fragment contained the portion encoding the extracellular region of human B7h by sequencing analysis, using an automated.fluorometric DNA . .

.25 sequencer (Applied Biosystems). !

On the other hand, DNA encoding Fc of human IgGl as a. fusion' י , . partner was prepared as a BamHI-Xbal DNA fragment (about 1.3kb) by .. digesting a plasmid (see. Cell, Vol.61, p.1303-1313 ' 1990; prepared by Dr. Seed et al. , at the Massachusetts General Hospital) with BamHI and Xbal. This fragment contained exons encoding the hinge regions.

of human IgGl, Cyl2, and Cyl3.

Th.e XhoI-BamHI fragment encoding the extracellular region of human B7h ( h B7h) , and the BamHI-Xbal fragment containing exons encodingFc,(abbreviatedas IgFc) of human IgGl, preparedas described &lt;;

above, were subcloned into a plasmidpBluescript II SK (+) (Stratagene) ' _: ־’ ' pre-digested .with Xhol. and Xbal,. . ^,.'.^,י ־<.>' ' ' ,־ י’. . r . ,.'.¹. . , - . ־ . ־ ' ' ' ‘ ’. ' י.''.'’ ־ ’ . י.^,.^,.

. ' 1 . . ₍ ’ t ' ' .’ . ׳..,;. .י . 1. ־ י י, ־ . . - ' , . ־ יל . A? A :*־. ־. :-, - ‘.i ״* ;A.'׳׳ ־'.< ' A .׳? י־'/- .:'.״i‘. .'. > .־.'. י , ., . J;, ‘ ״>:, ן.< v ;..; :׳ י,'^,׳> +.ϊ;. ך.:,' Λ; ':.י .:A;'''‘';‘'!'׳

WO 01/87981 PCT/JPU1/04035

133 ' י ' '

Subsequently, the plasmid was digested with Xhol and Xbal to prepare a DNA fragment about 1.8-kb containing fusion DNA between the extracellular region of human B7h and human IgFc. By using T4 DNA ligase, this, fusion DNA fragment was inserted,into an expression vector pME18S (Medical Immunology, Vol.20, No.l, p.27-32, 1990, and . Handbook for Genetic Engineering, Experimental Medicine, supplement, Yodosha,pp. 101-107, 1992) between Xhol and-Xbal sites,.to construct ' a plasmid phB7h-IgFc.

Monolayer COS7 cells . (ATCC CRL-1651) cultured to be sub-confluent in DMEM medium containing 10% fetal’׳^,calf serum and ampicillin,, were transformed with the.' plasmid phB7h-IgFc by electroporation to yield transformed cells.

The transformed cells were allowed to expresshB7h-IgFc by culturing them in serum-free ASF104 medium for 72 hours.

HB7h-IgFc was purified by using a Protein G Sepharose affinity column (Amersham Pharmacia) as follows:

The above-mentioned culture supernatant was centrifuged to . obtain centrifugal supernatant. The resulting supernatant was loaded . onto a .Protein G Sepharose affinity column pre-equilibrated with a •20 binding buffer. Subsequently, the column was washed with the binding buffer, and then elution was performed with an elution buffer. The eluted solution was recovered and then dialyzed against phosphate , buffer. The.outer dialyzing buffer was changed twice or more. . Thus . purified hB7h-IgFc was obtained.' <14-3> Dilution of antibody and soluble human AILIM (hAILIM-IgFc) and reaction thereof

Original solutions (20μg/ml) of anti-human AILIM monoclonal antibody . (JMab-136) and. human anti-KLH' monoclonal antibody (JMab-23) as a negative control antibody were diluted in a'series 30 of 11 levels; and each sample (200μ1) was combined and mixed well with 200μ1 of RPMI1640 medium containing 10% FCS.' Thus various concentrations of antibody solutions were prepared. Biotin-labeled hAlLIM-IgEc (ΣμΙ/tube; final concentration ^g/ml) was added to each . of the prepared solutions with various concentrations. The resulting .35 solutions were mixed well and incubated at room temperature for 30 minutes

WO 0.1/87981 . PCT/JP01/0403? '

‘ . '. י' ¹34 <14-4> Assay .for the activity of anti-AILIM .monoclonal antibody to inhibit the .binding between hAILIM-IgFc and’ hB7h-IgFc hB7h-IgFc was added to each well of a 96-well. microplate (δθμΐ/well (800ng/well)) . The plate was sealed and then incubated 5 at 37 C for 1 hour. Solution was removed from each well, and the wells were washed 3 times with PBS (120μ1). Subsequently; PBS containing .0.5% BSA (ίθθμΐ/well) was added to each well to block the .unreacted sites. . ׳The plate was sealed and incubated at 37°C for 1 ^,.hour. After incubation, the solution was removed, and then the wells' 10 were washed 3 times with PBS' (120μ1). ' Subsequently, each sample’ . (50gl/well) prepared in <14-3> was added to the wells. The plate . was sealed and incubated at 37°C for 1. hour. Solution was removed from each well. The wells were washed 3.times with RPMI164.0 medium containing 10% FCS (120μ1) pre-heated at 37°C. ’ . Subsequently, PBS 15 containing 3.7% formalin (ΙΟΟμΙ/well) was added to each well, and the plate was incubated on ice for 5 minutes. . Solution was removed' from each well, and .the wells were washed 3 times with 0.1% Tween20 . (120μ1) . Subsequently, Streptavidin-HRP (50μ1/Νβ11) was added to ' .each well. The.plate was sealed and incubated at room temperature ׳ -.20 for 30 minutes. Solution was removed from each well, and the plate was washed 3 times with . PBS containing 0.1% Tween20 (120μ1) . Subsequently, TMB⁺ substrate chromogen (50μ1/Νβ11) was added to each .well and the plate was incubated at room temperature for 20 minutes. .Subsequently, 2N sulfuric acid (50gl/well) was added to each well 25 to stop the reaction. Absorbance . of each.well .was measured at a wavelength of 450nm by a THERMO max (Molecular Devices).

Results, are shown׳ in Figures 74 to 76. '

The results showed that anti-AILIM antibody had the activity .of inhibiting the binding between hAILIM-IgFc and hB7h-IgFc in a' 30 dosage-dependent manner.

Accordingly, this Example indicates that ah assay system . illustrated by the present method can be utilized to screen and identify substances capable of binding to AILIM or AILIM ligand (for example, ' antibody or synthetic low molecular weight compound) .

'. , ' . . . : . '׳ ׳; 'gxagyle 15 Activity of human anti-human AILIM monoclonal antibody. ^:

WO 01/87981 ! PCT/JP01/04035

׳: . ¹³⁵ to inhibit ths proliferation of human T cell associated with the transduction of AILIM-AILIM ligand-mediated costimulatory signal

It was analyzed whether or not the anti-human AILIM monoclonal ' . antibodies of the present invention had regulating activity on the .. 5 . transduction of signal mediated by AILIM on the surface of human T׳ cell, based on the measurement of inhibitory effect ,of the human.: anti-human AILIM monoclonal antibody on cell proliferation induced by contacting human T cell with AILIM ligand (B7h/B7RPl/GL50/LICOS) ./: <15-1> Dilution of antibody

10. Anti-human CD3 monoclonal antibody OKT3 (ATCC CRL-8001). .was ,.

: diluted with phosphate buffer (PBS) to a final concentration of 3μg/ml.

The soluble human AILIM ligand (hB7h-lgFc) prepared above was diluted with PBS to a final concentration of 4C^g/ml. The antibody solutions were further diluted with PBS to prepare various 15 concentrations of antibodies (40μς/πι1-0.064gg/ml) . ׳ <15-2> Coating of microplate with antibody . Each well of 96-well microplates was :coated with (1) anti-humari ;

. .CD3 monoclonal antibody OKT3 ^g/ml; 25μ1 in each well) andhB7h-lgFc i (40μg/ml-0.064μg/ml; 25μ1 in each well). The plates were incubated : 20 at. 37°C for 2 hours. Subsequently,. the antibody .solutions, were ’ discarded, and each well was washed 3 times with PBS. After the wash, .

RPMI1640 medium containing 10% FCS was added to each well (ΙΟΟμΙ/well) , :

. .and the plates were incubated at 37°C for 1 hour. Thus respective ' . .wells ,of the' plates were coated.

<15-3> Preparation of human T cell suspension

Peripheral blood was collected from normal healthy persons and the mononuclear ,cells were fractionated by density-gradient centrifugation using .LymphoPrep (Nycomed),. According to the experimental manual, human T cells were separated from the human 30 mononuclear cells by using.a Pan-T cell Isolation Kit (Miltenyi) and a Magnetic Sorter. T cell count was determined by using a hemacytometer. Human T cells were suspended in.a RPMI1640 medium '

־. containing 10%. FCS supplied, with human anti-human AILIM. monoclonal j antibody. JMabl36 (20gg/ml) .; HumanT cell suspension (IxlO⁶ cells/ml)' 35 prepared was incubated at room temperature for 30 minutes.

' Human anti-KLH monoclonal antibody JMAb 23 (20μg/mϊ) was used '

WO 01/87981. PCT/JP01/04035 :

. as a negative, control antibody. '. . <15-4> Cell culture

In the same manner as described above,׳ human T. cell suspension ''י (ΙΟΟμΙ/well; ixlO⁵ cells/well) was added to each well of a micrcplate '. .5 -׳ coated with anti-human CD3 antibody arid hB7h-IgFc, and the plate was incubated at 37°C for 3. days in a CO₂ incubator. ל <15—5> Determination .of proliferation activity, of T :cell ’ ׳

Methyl [³H]thymidine (0.5gCi/well; Amersham-Pharmacia) was added to each well of׳ the plates after cultivation, and the plates .10 were incubated at 3 7°C for 6 hours in a C02 incubator. After incubation, the cells were trapped on.GF/C filters (Packard) by using a Cell . ., Harvester. Subsequently, the filters were dried at 40°C for 3 hours. ' . or longer, and then Micros cinti 0 (20gl/well; Packard) was added thereto.

. Radioactivity of ³H incorporated in the cells trapped on the filters .

was measured by a β-counter (TOP COUNT) to analyze the degree of T ׳ . .cell proliferation after the culture.' I. .׳

The result is shown in Figures 77.

The result obtained in this test showed that human T cells grew significantly depending on the .concentration of human B7h-IgFc (in 20 the assay .using the negative control antibody) . . In׳ addition, the

- anti-human. AILIM monoclonal antibody. significantly inhibited the .

• proliferation of human T cells. ׳.

.:. Example 16 Activity of human anti-human AILIM monoclonal antibody. ²⁸ to inhibit the proliferation of monkey T cell associated with, the' transduction of AILIM—AILIM ligand—mediated costimulatory signal The same test was conducted by using monkey T cells instead ׳

,. of human T -cells used, in Example-15 described above.

<16-1> Dilution of antibody and others '

Anti-human CD3 monoclonal antibody SP34 (BD-Pharmingen) was diluted with phosphate buffer (PBS) to a final concentration of lgg/ml. The human B7h-IgFc prepared above was diluted with PBS to a.

-fina.1 concentration of 40gg/ml. The antibody solution was further׳ diluted with PBS to prepare various concentrations. of the antibody .׳.׳' 35 (40gg/ml0.0064־gg/ml).

16-2> ׳> Coating, of.microplate with antibody .׳.?.,ל;. .'.ל.\. לל :'׳:'.־

WO 01/87983 PCT/JPO1/04035 ; .

137 .,

Each well of 96-well microplates was coated with (1) anti-human CD3 monoclonal antibody SP34 (BD-Pharmingen) .(Igg/ml; 25μ1 in'each well) and human B7h-IgFc (40gg/ml-0.0064gg/ml; 25μ1 in each well) . The plates were. incubated at 37°C for 2 hours. Subsequently, the 5 antibody solution was discarded, and each well was washed 3 times with PBS. After the wash, RPMI1640 medium containing 10% FCS.was added to each well (ΙΟΟμΙ/well), and the plates were incubated at 37°C for 1 hour. Thus, respective wells, ofthe plates were coated with the antibody. . ' ־.

<16-3> Preparation of monkey T cell suspension .

Peripheral blood was collected from cynomolgus monkeys. A. fraction containingmononuclear cells was prepared by densify-grgH-i ^nt centrifugation using NycoPrepl. 077A (Nycomed). According to the experimental manual, monkey T cells were separated from the cynomolgus 15 monkey mononuclear cells by using anti-human CD4 antibody M-T477 (BD-Pharmingen), anti-human CD8 antibody RPA-T8. (BD-Pharmingen) , . anti-mouse IgG microbead (Miltenyi) and a Magnetic Sorter. T cell ; count was determined by using a hemacytometer. Monkey T cells were suspended in RPMI1640 medium containing .human. anti-human AILIM 20 monoclonal antibody JMab-136 (20μg/ml) and 10% FCS to prepare monkey. .

T cell suspension .(1x10^s cells/ml) . The suspension was incubated at room temperature for 30 minutes.

Human anti-KLH monoclonal antibody JMab-23 (20pg/ml) was used as a negative control antibody. .

<16-4> Cell, culture

In the same manner as described above, monkey T cell suspension (ΙΟΟμΙ/well; lxlO⁵ cells/well) was added,to each well of a microplate coated with anti-human CD3 antibody and hB7h-IgFc, and the plate was incubated at 37°C for 3 days in a C02 incubator.

<16-5> Determination of activity of T cell proliferation

Methyl [³H]thymidine (0.5gCi/well;. Amersham-Pharmacia) was added to each well of the plates after the cultivation, and the plates were incubated at 37°C for, 6 hours in a C0₂ incubator. After the incubation., the cells were trapped on GF/C filters (Packard) by using 35 a Cell Harvester. . Subsequently, the filters were dried at 40°C for . 3 . hours or longer , and tjien .Microscinti 0 (2Ogl/well; Packard), was.

WO 01/87981 PCT/JP01/04035 . .

.. ' : 138 .י ־י' ' added .thereto. ..Radioactivity of ³H incorporated into the cells trapped on the filters was measured by a β-counter (TOP COONT) to .analyze the degree of T cell proliferation after the culture.

The' result, is shown in Figure 78'.

'5 The result obtained in this test showed that monkey T cellsgrew significantly depending on the concentration of human B7h-IgFc . (in the ass.ay using the negative control antibody) . In addition, .the anti-human AILIMmonoclonal antibody significantly inhibited the proliferation monkey T cells. .

Industrial Applicability

The human monoclonal antibodies of the invention capable of . binding to.human AILIM are of human origin, and therefore these antibody induces no serious immunorej ection due to antigenicity to human, i. e.,' '.

HAMA (Human anti-mouse antigenicity) inahost, which has been a serious' therapeutic problem (side effect) in antibody pharmaceutical preparations comprising non-human mammal-derived antibody such as mouse-derived antibody . The antibody of the invention is thus of great value as an antibody pharmaceutical. ׳

Thus, the human monoclonal antibody of the invention against . AILIM (particularly human AILIM)' and pharmaceutical compositions comprising the human monoclonal antibody do not induce host ,. immunorejection caused by HAMA at all; and thus can be used as ׳ pharmaceutical preparations capable of controlling a variety of biological reactions (e.g., proliferation of cells expressing AILIM, cytokine production by AILIM-expressing cells, immune cytolysis or cell death (apoptosis) of cells expressing AILIM, and activity of inducing antibody-dependent, damage of cells expressing AILIM) associated with the transduction of AILIM-mediated costimulatory :' signal (secondary signal) to cells expressing AILIM; and/or can be used to treat or prevent various diseases associated with the transduction of the AILIM-mediated signal, controlling and inhibiting the onset and/or progress of the diseases.

Specifically, by providing pharmaceutical preparations containing the human anti-AILIM monoclonal antibody .of the invention

- or a portion thereof as an active ingredient, it is possible to inhibit ׳׳. ,

WO 01/8798] PCT/JP01/04035

' י ( י . 139 or treat and prevent, for. example, avariety of diseases (e.g. , .

.rheumatoid arthritis, ׳.multiple'sclerosis, autoimmune thyroiditis, ־ allergic contact dermatitis, lichen planus as a chronic inflammatory :skindisease, systemic lupus erythematosus, insulin dependent diabetes ^:' 5 mellitus. and. psoriasis, etc. )' classified into autoimmune diseases ^or allergic diseases (particularly, autoimmune diseases and delayed • ־ י; allergies by cellular immunity) ; .arthropathies (e.g. , rheumatoid ' arthritis (RA) , osteoarthritis (OA).) , inflammation (e.g. ,hepatitis) ; graft versus host reaction (GVH reaction) ; graft versus host disease 10 (graft versus host disease; GVHD) ; immunorejection associated with transplantation (allogenic graft or heterogenous graft) of tissues' (tissues such as skin, cornea and bone) or organs (liver, heart, lung, ' 7 kidney, pancreas., etc.) ; immune response to foreign antigen or self

׳.antigen (for example, production of antibody against the antigen,'.׳/'^;/ ׳ 15 cell proliferation, cytokine production, etc.); and diseases that . are potentially caused by abnormality in gut immunity (specifically, inflammatory bowel disease (particularly, Crohn's disease׳ and ulcerative colitis); and alimentary allergy, etc.

The pharmaceutical compositions in accordance with the present. . 20 invention make it possible to treat or prevent some inflammations ' for.which various steroidal drugs are used as anti-inflammatory drugs, for example, inflammation associated with various arthritides. (rheumatoid arthritis, .osteoarthritis, etc.) , pneumonia, hepatitis /: (including viral hepatitis) , inflammation associated with infectious 25 diseases, inflammatory׳ bowel disease, enteritis, nephritis/ (glomerular nephritis, inflammation associated with kidney fibrosis, gastritis, vasculitis, pancreatitis, peritonitis, bronchitis, . myocarditis, encephalitis, inflammation .associated with ischemia-reperfusion injury (myocaridial . ischemia-reperfusion ׳ 30 injury, etc.), inflammation associated with immunorejection after transplantation of tissues or organs, scald, various skin inflammations (psoriasis, allergic contact dermatitis ,׳lichen planus as a chronic inflammatory skin disease) , inflammation associated with. . multiple organ failure, inflammation after operation of PTCA or PTCR,

35; and inflammation associated. with atherosclerosis, autoimmune . thyroiditis,׳ etc. . . ' .^S- ./&lt; . ..'

<img file="IL147448A_D0007.tif" />

WO 01/87981 PCT/JPO1/04035 . /

(. ' . . ( '־.' '־.'140 . יי/ י .1 ' ('. י ' .

In .addition, with respect to the above-mentioned inhibition. and treatment of immunorejection associated with transplantation of tissues pr organs as described above, the pharmaceutical compositions . m accordance with the present invention can be used in conjunction with known immunosuppressant used to,inhibit the immunorejection in/־’ . transplantation therapy thereby increasing the effect of the known drug .to inhibit the graft rejection.

Further, by the use of the method of identifying substances ׳ j capable of binding to AILIM or AILIM ligand, which is within the.scope ’ .10 of the present invention, it; is possible to control7.the .signal)' .

transduction associated with the interaction between AILIM and AILIM / . ligand through the. binding to AILIM or AILIM ligand, and thereby '־ achieving screening and selection of pharmaceutical agents (synthetic chemical compound and antibody) having potential activity to treat .)') 15 the above-mentioned various diseases.

' Sequence Listing Free Text . /.

' -SEQ ID NO: 1 /.׳'

Other Information: Description of Artificial Sequence.־ 20. Artificially synthesized primer sequence, Notl-T.,

SEQ ID NO: 2. ) ..־(: י'.־' י ' י.

Other Information: Description, of- Artificial Sequence: . Artificially synthesized linker sequence, 20adp .').

SEQ ID NO: 3 . ־ ( . ' יי' '״. .׳

25..- .. Other Information: Description of )/Artificial/ Sequence: Artificially synthesized linker sequence, 24adp.

SEQ ID NO: 4;

Other Information: Description of Artificial Sequence: ׳ .Artificially synthesized primer sequence, HIGLC.).

.SEQ ID NO: 5 . Other Information: Description of ' Artificial ־ Sequence: Artificially synthesized primer'sequence, NHCc2. '.

/ SEQ ID NO: 6 .'.')...־.. ')//’'.///;') . .Other Information: Description' of Artificial Sequence: '׳

Artificially synthesized primer sequence, ExcellE. ' ^! SEQ ID־ NO.:'7 '.')) ' >:.; . )/.)..

WO 01/87981 PCT/JP01/04035 '

י'-'' ' 141' ' . י ' .

Other. Information: Description of Artificial Sequence‘: Artificially synthesized primer sequence, ckll7._; . SEQ ID NO: 8 ' :

Other Information: Description, of Artificial .Sequence: . 5 Artificially synthesized primer sequence, M13R. SEQ ID NO: 9 'י

Other .Information: .Description .of Artificial Sequence: Artificially synthesized primer'.sequence, .13 6H. .^:.&lt;

.SEQ ID NO: 10 .,'1

Other Information: Description of. 'Artificial' Sequence: Artificially synthesized.primer sequence, 138/9H.

:. SEQ ID- NO: 11 . . . ’

Other Information: Description of Artificial Sequence:

,Artificially synthesized primer sequence, AILIMHC1. .15 SEQ ID NO: 12 ־

Other Information: Description of Artificial Sequence: Artificially synthesized primer sequence, HCcl, ,

SEQ ID NO: 13 '

Other Information: Description: of Artificial . Sequencer 20 Artificially synthesized primer, sequence, HCc7.

'. SEQ ID NO: 14 ' ⁷ '..''

Other Information: Description of Artificial 'Sequence:' Artificially synthesized primer sequence, HCc8. ..

' SEQ ID NO: 15 .- /

Other Information: Description of Artificial .Sequence:

Artificially synthesized, primer sequence, HCc3.

'. SEQ ID NO: 16 ' . ' Other Information: Description of. Artificial Sequence:' Artificially synthesized primer ,sequence, HCc4.

.. SEQ ID NO: 17 .

Other Information: Description of Artificial Sequence: Artificially synthesized primer sequence, HCc6.

. SEQ ID NO: 18 '

Other 'Information: Description of Artificial Sequence: .35 Artificially, synthesized primer sequence, HIGHC. .

SEQ ID NO: 19 . . י' .' ., ?

WO 01/87981 PCT/JP01/04035

' .: ל' י; ״ . 142' '

Other Information: ,Description of .Artificial Sequence;

. Artificially synthesized primer sequence, HCc9 . SEQ ID NO: 20

Other Information: Description ' of Artificial Sequence: .5 Artificially synthesized primer sequence, HCc5.

SEQ ID NO: 21 .' : .,Other . Information:'יDescription׳ . of Artificial . Sequence: Artificially synthesized primer sequence, polyA.

. SEQ ID NO: 22 ' . 77.-;( ? '׳. '.

1θ״ Other Information: Description, of Artificial Sequence: Artificially.synthesized.primer sequence, AILIMLC1.

.'־. SEQ ID NO: 23

Other Information: Description of Artificial. Sequence:

. Artificially .synthesized primer sequence, AILIMLC2. ‘ ' 1 ׳ ' 15 SEQ ID NO: 24 ' ' . .' .

Other Information: Description of Artificial Sequence:

'.Artificially .synthesized primer sequence, LCcl.'.:

SEQ ID NO:. 25 :

Other Information: Description of Artificial Sequence: ׳ . 20. Artificially synthesized primer sequence, LCc2.

. ..'^:. SEQ ID NO: - 26 . ;' ' . ' , '

Other. Information: Description of . Artificial Sequence: Artificially synthesized primer sequence, .ΗΪΚ. ' .־'־\'SEQ ID NO: 39 ־ . .

;25 Other. Information: Description ׳ of Artificial Sequence: ׳: Artificially synthesized primer sequence ' . ' SEQ ID NO.: 40

Other. .Information: .Description of Artificial Sequence: Artificially . synthesized primer sequence ' . ' '7 /2

SEQUENCE LISTING <110> Japan Tobacco, Inc.

<120> Human Monoclonal Antibody Against A Costimulatory Signal Transduction Molecule AILIM And Pharmaceutical Use Thereof <130> J1-A0101Y1P .

<140>

<141>

<150> JP P2000-147116 <151> 2000-05-18 <150> JP P2001-99508

30־03־2001 <151>

<160> 40 i <170> Patentin Ver. 2.1 i י <210> 1 <211> 45 : <212> DNA <213> Artificial Sequence

35-01\01370774 /2 <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, Notl-T.

<220>

<221> primer_bind <222> (1).(45) <400> 1 aactggaagc ttcagcggcc gcagagattt tttttttttt ttttt 45 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized linker sequence, 20adp.

<400> 2 cgtggtgtca tggcactgcg 20

35-01\01370774 /2 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized linker sequence, 24adp.

<400> 3 aattcgcagt gccatgacac cacg <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, HIGLC.

<220>

<221> primer_bind <222> (1) . . (23)

35-01\01370.774 /2 gtctgctttg ctcagcgtca ggg <400> 4 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, NHCc2.

<220>

<221> primer_bind <222> (1).(21) <400> 5 caccggttcg gggaagtagt c <210> 6 <211> 21 <212> DNA <213> Artificial Sequence

35-01\01370774 /2 <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, ExcellE.

<220>

<221> primer_bind <222> (1).(21) <400> 6 ggtgacacta tagaatacag g <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, ckll7.

<220>

<221> primer_bind <222> (1).(25) <400> 1

35-01\01370774 /2 gcaggcacac aacagaggca gttcc <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, M13R.

<220>

<221> primer_bind <222> (1).(20) <400> 8 cacaggaaac agctatgacc 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220>

35-01\01370774 *149 <223> Description of Artificial Sequence:Artificially synthesized primer sequence, 136H.

<220>

<221> primer_bind <222> (1) . . (21) <400> 9 cctggacaag ggcttgagtg g <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, 138/9H.

<220>

<221> primer_bind <222> (1).(21) <400> 10 acaggaaaag gtctggagtg g 21

35-01\01370774 /2 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, AILIMHC1.

<220>

<221> primer_bind <222> (1) . .(21) <400> 11 acagtaatac acggccgtgt c 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220>

<223>. Description of Artificial Sequence:Artificially

35-01\01370774 /2 synthesized primer sequence, HCcl.

<220>

<221> primer_bind <222> (1).(21) <400> 12 gactacttcc ccgaaccggt g <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, HCc7.

<220>

<221> primer_bind <222> (1).(22) <400> 13 gtggcaggac cgtcagtctt cc 22

01370774\01־35 /2 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, HCc8.

<220>

<221> primer_bind <222> (1). (24) <400> 14 aagaggaaga ctgacggtcc tgcc <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, HCc3.

35-01\01370774 /2 <220>

<221> primer_bind <222> (1). (23) <400> 15 ccgttgtgca ccaggactgg etg 23 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, HCc4.

<220>

<221> primer_bind <222> (1).(23) <400> 16 tgcacttgta ctccttgccg ttc 23

35-01\01370774 /2 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, HCc6.

<220>

<221> primer_bind <222> (1).(23) <400> 17 cagccggaga acaactacaa gac <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, HIGHC.

35-01\01370774 /2 <220>

<221> primer_bind <222> (1).(22) <400> 18 tcttgtagtt gttctccggc tg <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, HCc9.

<220>

<221> primer_bind <222> (1).(22) <400> 19 tacttcccag gcacccagca tg <210> 20

35-01\01370774

־156147448/2 <211> 23 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, HCc5.

<220>

<221> primer_bind <222> (1).(23) <400> 20 atgctgggtg cctgggaagt atg 23 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, polyA.

<220>

35-01\01370774 /2 <221> primer_bind <222> (1).(21) <400> 21 tcaaactatc ggccttgctg g <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, AILIMLC1.

<220>

<221> primer_bind <222> (1).(21) <400> 22 tagcctggta tcagcagaaa c 21 <210> 23 <211> 21

35-01\01370774

־ <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, AILIMLC2.

<220>

<221> primer_bind <222> (1).(21) <400> 23 gtttctgctg ataccaggct a <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, LCcl.

<220>

<221> primer_bind

35-01)01370774 /2 <222> (1).(22) <400> 24 gcaccatctg tcttcatctt cc <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, LCc2.

<220>

<221> primer_bind <222> (1).(21) <400> 25 caaagagctt caacagggga g <210> 26 <211> 20 <212> DNA

35-01\01370774

־160־ <213> Artificial Sequence <220>

<223> Description of Artificial Sequence:Artificially synthesized primer sequence, HIK.

<220>

<221> primer_bind <222> (1).(20) <400> 26 aggctggaac tgaggagcag 20 <210> 27 <211> 1616 <212> DNA <213> Homo sapiens <220>

<221> 5'UTR <222> (1).(68) <220>

<221> CDS <222> (69).(1481)

35-01\01370774 /2 <220>

<td> &lt;221&gt;</td><td> 3'UTR</td>

<td> &lt;222&gt;</td><td> (1482).(1616)</td>

<220>

<td> &lt;221&gt;</td><td> sig_peptide</td>

<td> &lt;222&gt;</td><td> (69).(125)</td>

<400> 27 gaattcgcag tgccatgaca ccacgcatct gtcctctaga gaatcccctg agagctccgt tcctcacc atg gac tgg acc tgg agg ate etc ttc ttg gtg gca gca gee 110

Met Asp Trp Thr Trp Arg He Leu Phe Leu Vai Ala Ala Ala

10

<td rowspan="2"> aca Thr 15</td><td rowspan="2"> gga gee Gly Ala</td><td rowspan="2"> cac tee His Ser</td><td colspan="3"> cag gtg cag etg gtg</td><td colspan="4"> cag tet ggg get</td><td rowspan="2"> gag Glu</td><td rowspan="2"> gtg Val 30</td><td rowspan="2"> 158</td>

<td> Gin Vai 20</td><td> Gin</td><td> Leu Vai</td><td> Gin 25</td><td> Ser</td><td> Gly</td><td> Ala</td>

<td> aag</td><td> aag cct</td><td> ggg gee</td><td> tea gtg</td><td> aag</td><td> gtc tee</td><td> tgc</td><td> aag</td><td> get</td><td> tet</td><td> gga</td><td> tac</td><td> 206</td>

<td> Lys</td><td> Lys Pro</td><td> Gly Ala 35</td><td> Ser Vai</td><td> Lys</td><td> Vai Ser 40</td><td> Cys</td><td> Lys</td><td> Ala</td><td> Ser</td><td> Gly 45</td><td> Tyr</td><td></td>

<td> acc</td><td> ttc acc</td><td> ggc tac</td><td> tat atg</td><td> cac</td><td> tgg gtg</td><td> ega</td><td> cag</td><td> gee</td><td> cct</td><td> gga</td><td> caa</td><td> 254</td>

<td> Thr</td><td> Phe Thr</td><td> Gly Tyr</td><td> Tyr Met</td><td> His</td><td> Trp val</td><td> Arg</td><td> Gin</td><td> Ala</td><td> Pro</td><td> Gly</td><td> Gin</td><td></td>

35-01\01370774 /1

55 60

<td colspan="3"> ggg ctt gag</td><td rowspan="2"> tgg atg gga Trp Met Gly</td><td colspan="3"> tgg ate aac cct</td><td rowspan="2"> cac His</td><td colspan="3"> agt ggt ggc aca</td><td rowspan="2"> aac Asn</td><td rowspan="2"> 302</td>

<td> Gly</td><td> Leu</td><td> Glu 65</td><td> Trp</td><td> He Asn 70</td><td> Pro</td><td> Ser Gly 75</td><td> Gly</td><td> Thr</td>

<td> tat</td><td> gca</td><td> cag</td><td> aag ttt cag</td><td> ggc</td><td> agg gtc</td><td> acc</td><td> atg</td><td> acc agg</td><td> gac</td><td> acg</td><td> tcc</td><td> 350</td>

<td> Tyr</td><td> Ala</td><td> Gin</td><td> Lys Phe Gin</td><td> Gly</td><td> Arg Val</td><td> Thr</td><td> Met</td><td> Thr Arg</td><td> Asp</td><td> Thr</td><td> Ser</td><td></td>

<td></td><td> 80</td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td>

<td> ate</td><td> age</td><td> aca</td><td> gcc tac atg</td><td> gag</td><td> etg age</td><td> agg</td><td> etg</td><td> aga tcc</td><td> gac</td><td> gac</td><td> acg</td><td> 398</td>

<td> lie</td><td> Ser</td><td> Thr</td><td> Ala Tyr Met</td><td> Glu</td><td> Leu Ser</td><td> Arg</td><td> Leu</td><td> Arg Ser</td><td> Asp</td><td> Asp</td><td> Thr</td><td></td>

<td> 95</td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td> 110</td><td></td>

<td> gcc</td><td> gtg</td><td> tat</td><td> tac tgt geg</td><td> agg</td><td> acg tat</td><td> tac</td><td> tat</td><td> gat agt</td><td> agt</td><td> ggt</td><td> tat</td><td> 446</td>

<td> Ala</td><td> val</td><td> Tyr</td><td> Tyr Cys Ala</td><td> Arg</td><td> Thr Tyr</td><td> Tyr</td><td> Tyr</td><td> Asp Ser</td><td> Ser</td><td> Gly</td><td> Tyr</td><td></td>

<td></td><td></td><td></td><td> 115</td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td> 125</td><td></td><td></td>

<td> tac</td><td> cat</td><td> gat</td><td> get ttt gat</td><td> ate</td><td> tgg ggc</td><td> caa</td><td> ggg</td><td> aca atg</td><td> gtc</td><td> acc</td><td> gtc</td><td> 494</td>

<td> Tyr</td><td> His</td><td> Asp</td><td> Ala Phe Asp</td><td> He</td><td> Trp Gly</td><td> Gin</td><td> Gly</td><td> Thr Met</td><td> Val</td><td> Thr</td><td> Val</td><td></td>

<td></td><td></td><td></td><td> 130</td><td></td><td> 135</td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td>

<td> tet</td><td> tea</td><td> gcc</td><td> tcc acc aag</td><td> ggc</td><td> cca teg</td><td> gtc</td><td> ttc</td><td> ccc etg</td><td> geg</td><td> 1 ccc</td><td> tgc</td><td> 542</td>

<td> Ser</td><td> Ser</td><td> Ala</td><td> Ser Thr Lys</td><td> Gly</td><td> Pro Ser</td><td> Val</td><td> Phe</td><td> Pro Leu</td><td> Ala</td><td> Pro</td><td> Cys</td><td></td>

145 150 155

35-01\01370774 /1

<td colspan="2"> tcc agg age</td><td colspan="3"> acc tcc gag</td><td colspan="5"> age aca geg gcc etg ggc</td><td rowspan="2"> tgc Cys</td><td colspan="2"> etg gtc</td><td rowspan="2"> aag Lys</td><td rowspan="2"> 590</td>

<td> Ser</td><td> Arg Ser 160</td><td> Thr</td><td> Ser</td><td> Glu</td><td> Ser 165</td><td> Thr Ala</td><td> Ala</td><td> Leu</td><td> Gly 170</td><td> Leu</td><td> Val</td>

<td> gac</td><td> tac ttc</td><td> CCC</td><td> gaa</td><td> ccg</td><td> gtg</td><td> acg gtg</td><td> teg</td><td> tgg</td><td> aac</td><td> tea</td><td> ggc</td><td> get</td><td> etg</td><td> 638</td>

<td> Asp 175</td><td> Tyr Phe</td><td> Pro</td><td> Glu</td><td> Pro 180</td><td> Val</td><td> Thr Val</td><td> Ser</td><td> Trp 185</td><td> Asn</td><td> Ser</td><td> Gly</td><td> Ala</td><td> Leu 190</td><td></td>

<td> acc</td><td> age ggc</td><td> gtg</td><td> cac</td><td> acc</td><td> ttc</td><td> cca get</td><td> gtc</td><td> eta</td><td> cag</td><td> tcc</td><td> tea</td><td> gga</td><td> etc</td><td> 686</td>

<td> Thr</td><td> Ser Gly</td><td> Val</td><td> His 195</td><td> Thr</td><td> Phe</td><td> Pro Ala</td><td> Val 200</td><td> Leu</td><td> Gin</td><td> Ser</td><td> Ser</td><td> Gly 205</td><td> Leu</td><td></td>

<td> tac</td><td> tcc etc</td><td> age</td><td> age</td><td> gtg</td><td> gtg</td><td> acc gtg</td><td> CCC</td><td> tcc</td><td> age</td><td> aac</td><td> ttc</td><td> ggc</td><td> acc</td><td> 734</td>

<td> Tyr</td><td> Ser Leu</td><td> Ser 210</td><td> Ser</td><td> Val</td><td> Val</td><td> Thr Val 215</td><td> Pro</td><td> Ser</td><td> Ser</td><td> Asn</td><td> Phe 220</td><td> Gly</td><td> Thr</td><td></td>

<td> cag</td><td> acc tac</td><td> acc</td><td> tgc</td><td> aac</td><td> gta</td><td> gat cac</td><td> aag</td><td> CCC</td><td> age</td><td> aac</td><td> acc</td><td> aag</td><td> gtg</td><td> 782</td>

<td> Gin</td><td> Thr Tyr 225</td><td> Thr</td><td> Cys</td><td> Asn</td><td> Val</td><td> Asp His 230</td><td> Lys</td><td> Pro</td><td> Ser</td><td> Asn 235</td><td> Thr</td><td> Lys</td><td> Val</td><td></td>

<td> gac</td><td> aag aca</td><td> gtt</td><td> gag</td><td> ege</td><td> aaa</td><td> tgt tgt</td><td> gtc</td><td> gag</td><td> tgc</td><td> cca</td><td> ccg</td><td> tgc</td><td> cca</td><td> 830</td>

<td> Asp</td><td> Lys Thr 240</td><td> Val</td><td> Glu</td><td> Arg</td><td> Lys 245</td><td> Cys Cys</td><td> Val</td><td> Glu</td><td> Cys 250</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td></td>

<td> gca</td><td> cca cct</td><td> gtg</td><td> gca</td><td> gga</td><td> ccg</td><td> tea gtc</td><td> ttc</td><td> etc</td><td> ttc</td><td> CCC</td><td> cca</td><td> aaa</td><td> ccc</td><td> 878</td>

<td> Ala</td><td> Pro Pro</td><td> Val</td><td> Ala</td><td> Gly</td><td> Pro</td><td> Ser Val</td><td> Phe</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys</td><td> Pro</td><td></td>

35-01\01370774 '147448/1

<td> 255</td><td> 260</td><td> 265</td><td> 270</td>

<td> aag</td><td> gac acc etc atg ate tcc</td><td> egg acc cct gag</td><td> gtc acg tgc gtg gtg 926</td>

<td> Lys</td><td> Asp Thr Leu Met lie Ser</td><td> Arg Thr Pro Glu</td><td> Val Thr Cys Val Val</td>

<td></td><td> 275</td><td> 280</td><td> 285</td>

<td> gtg</td><td> gac gtg age cac gaa gac</td><td> ccc gag gtc cag</td><td> ttc aac tgg tac gtg 974</td>

<td> Val</td><td> Asp Val Ser His Glu Asp</td><td> Pro Glu Val Gin</td><td> Phe Asn Trp Tyr Val</td>

<td></td><td> 290</td><td> 295</td><td> 300</td>

<td> gac</td><td> ggc gtg gag gtg cat aat</td><td> gcc aag aca aag</td><td> cca egg gag gag cag 1022</td>

<td> Asp</td><td> Gly Val Glu Val His Asn</td><td> Ala Lys Thr Lys</td><td> Pro Arg Glu Glu Gin</td>

<td></td><td> 305</td><td> 310</td><td> 315</td>

<td> ttc</td><td> aac age acg ttc cgt gtg</td><td> gtc age gtc etc</td><td> acc gtt gtg cac cag 1070</td>

<td> Phe</td><td> Asn Ser Thr Phe Arg Val</td><td> Val Ser Val Leu</td><td> Thr Val Val His Gin</td>

<td></td><td> 320 325</td><td></td><td> 330</td>

<td> gac</td><td> tgg etg aac ggc aag gag</td><td> tac aag tgc aag</td><td> gtc tcc aac aaa ggc 1118</td>

<td> Asp</td><td> Trp Leu Asn Gly Lys Glu</td><td> Tyr Lys Cys Lys</td><td> Val Ser Asn Lys Gly</td>

<td> 335</td><td> 340</td><td> 345</td><td> 350</td>

<td> etc</td><td> cca gcc ccc ate gag aaa</td><td> acc ate tcc aaa</td><td> acc aaa ggg cag ccc 1166</td>

<td> Leu</td><td> Pro Ala Pro lie Glu Lys</td><td> Thr lie Ser Lys</td><td> Thr Lys Gly Gin Pro</td>

<td></td><td> 355</td><td> 360</td><td> 365</td>

35-01\01370774 /1

<td rowspan="2"> cga gaa Arg Glu</td><td rowspan="2"> cca Pro</td><td colspan="12"> cag gtg tac acc etg ccc cca tee egg gag gag atg acc</td><td rowspan="2"> 1214</td>

<td> Gin 370</td><td> Val</td><td> Tyr</td><td> Thr Leu</td><td> Pro 375</td><td> Pro</td><td> Ser</td><td> Arg</td><td> Glu</td><td> Glu 380</td><td> Met</td><td> Thr</td>

<td> aag aac</td><td> cag</td><td> gtc</td><td> age</td><td> etg</td><td> acc tgc</td><td> etg</td><td> gtc</td><td> aaa</td><td> ggc</td><td> ttc</td><td> tac</td><td> ccc</td><td> age</td><td> 1262</td>

<td> Lys Asn</td><td> Gin 385</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr Cys 390</td><td> Leu</td><td> Val</td><td> Lys</td><td> Gly</td><td> Phe 395</td><td> Tyr</td><td> Pro</td><td> Ser</td><td></td>

<td> gac ate</td><td> gee</td><td> gtg</td><td> gag</td><td> tgg</td><td> gag age</td><td> aat</td><td> ggg</td><td> cag</td><td> ccg</td><td> gag</td><td> aac</td><td> aac</td><td> tac</td><td> 1310</td>

<td> Asp lie 400</td><td> Ala</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu Ser 405</td><td> Asn</td><td> Gly</td><td> Gin</td><td> Pro 410</td><td> Glu</td><td> Asn</td><td> Asn</td><td> Tyr</td><td></td>

<td> aag acc</td><td> aca</td><td> cct</td><td> ccc</td><td> atg</td><td> etg gac</td><td> tee</td><td> gac</td><td> ggc</td><td> tee</td><td> ttc</td><td> ttc</td><td> etc</td><td> tac</td><td> 1358</td>

<td> Lys Thr 415</td><td> Thr</td><td> Pro</td><td> Pro</td><td> Met 420</td><td> Leu Asp</td><td> Ser</td><td> Asp</td><td> Gly 425</td><td> Ser</td><td> Phe</td><td> Phe</td><td> Leu</td><td> Tyr 430</td><td></td>

<td> age aag</td><td> etc</td><td> acc</td><td> gtg</td><td> gac</td><td> aag age</td><td> agg</td><td> tgg</td><td> cag</td><td> cag</td><td> ggg</td><td> aac</td><td> gtc</td><td> ttc</td><td> 1406</td>

<td> Ser Lys</td><td> Leu</td><td> Thr</td><td> Val 435</td><td> Asp</td><td> Lys Ser</td><td> Arg</td><td> Trp 440</td><td> Gin</td><td> Gin</td><td> Gly</td><td> Asn</td><td> Val 445</td><td> Phe</td><td></td>

<td> tea tgc</td><td> tee</td><td> gtg</td><td> atg</td><td> cat</td><td> gag get</td><td> etg</td><td> cac</td><td> aac</td><td> cac</td><td> tac</td><td> acg</td><td> cag</td><td> aag</td><td> 1454</td>

<td> Ser Cys</td><td> Ser</td><td> Val 450</td><td> Met</td><td> His</td><td> Glu Ala</td><td> Leu 455</td><td> His</td><td> Asn</td><td> His</td><td> Tyr</td><td> Thr 460</td><td> Gin</td><td> Lys</td><td> •</td>

<td> age etc Ser Leu</td><td> tee Ser</td><td> etg Leu</td><td> tet Ser</td><td> ccg Pro</td><td> ggt aaa Gly Lys</td><td> tga</td><td colspan="3"> gtgccacggc</td><td colspan="3"> cggcaagccc</td><td></td><td> 1501</td>

35-01\01370774

I /1 ccgctcccca ggctctcggg gtcgcgtgag gatgcttggc acgtaccccg tgtacatact

1561 tcccaggcac ccagcatgga aataaagcac ccagcgctgc cctggaaaaa aaaaa

1616 <210> 28 <211> 470 <212> PRT <213> Homo sapiens <400> 28

<td> Met</td><td> Asp</td><td> Trp</td><td> Thr</td><td> Trp</td><td> Arg</td><td> He</td><td> Leu</td><td> Phe</td><td> Leu</td><td> Val</td><td> Ala</td><td> Ala</td><td> Ala</td><td> Thr</td><td> Gly</td>

<td> 1</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td><td></td>

<td> Ala</td><td> His</td><td> Ser</td><td> Gin</td><td> Val</td><td> Gin</td><td> Leu</td><td> Val</td><td> Gin</td><td> Ser</td><td> Gly</td><td> Ala</td><td> Glu</td><td> Val</td><td> Lys</td><td> Lys</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td> Pro</td><td> Gly</td><td> Ala</td><td> Ser</td><td> Val</td><td> Lys</td><td> Val</td><td> Ser</td><td> Cys</td><td> Lys</td><td> Ala</td><td> Ser</td><td> Gly</td><td> Tyr</td><td> Thr</td><td> Phe</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td> ־</td>

<td> Thr</td><td> Gly</td><td> Tyr</td><td> Tyr</td><td> Met</td><td> His</td><td> Trp</td><td> Val</td><td> Arg</td><td> Gin</td><td> Ala</td><td> Pro</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td> Glu</td><td> Trp</td><td> Met</td><td> Gly</td><td> Trp</td><td> .He</td><td> Asn</td><td> Pro</td><td> His</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Asn</td><td> Tyr</td><td> Ala</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td> Gin</td><td> Lys</td><td> Phe</td><td> Gin</td><td> Gly</td><td> Arg</td><td> Val</td><td> Thr</td><td> Met</td><td> Thr</td><td> Arg</td><td> Asp</td><td> Thr</td><td> Ser</td><td> He</td><td> Ser</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td> Thr</td><td> Ala</td><td> Tyr</td><td> Met</td><td> Glu</td><td> Leu</td><td> Ser</td><td> Arg</td><td> Leu</td><td> Arg</td><td> Ser</td><td> Asp</td><td> Asp</td><td> Thr</td><td> Ala</td><td> Val</td>

35-01)01370774 /1

<td colspan="2"> Tyr Tyr Cys</td><td rowspan="2"> Ala Arg</td><td rowspan="2"> Thr Tyr Tyr 120</td><td rowspan="2"> Tyr Asp Ser Ser</td><td rowspan="2"> Gly 125</td><td rowspan="2"> Tyr</td><td rowspan="2"> Tyr</td><td rowspan="2"> His</td>

<td></td><td> 115</td>

<td> Asp Ala</td><td> Phe</td><td> Asp lie</td><td> Trp Gly Gin</td><td> Gly Thr Met Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser</td>

<td> 130</td><td></td><td></td><td> 135</td><td> 140'</td><td></td><td></td><td></td><td></td>

<td> Ala Ser</td><td> Thr</td><td> Lys Gly</td><td> Pro Ser Val</td><td> Phe Pro Leu Ala</td><td> Pro</td><td> Cys</td><td> Ser</td><td> Arg</td>

<td> 145</td><td></td><td></td><td> 150</td><td> 155</td><td></td><td></td><td></td><td> 160</td>

<td> Ser Thr</td><td> Ser</td><td> Glu Ser</td><td> Thr Ala Ala</td><td> Leu Gly Cys Leu</td><td> Val</td><td> Lys</td><td> Asp</td><td> Tyr</td>

<td></td><td></td><td> 165</td><td></td><td> 170</td><td></td><td></td><td> 175</td><td></td>

<td> Phe Pro</td><td> Glu</td><td> Pro Val</td><td> Thr Val Ser</td><td> Trp Asn Ser Gly</td><td> Ala</td><td> Leu</td><td> Thr</td><td> Ser</td>

<td></td><td></td><td> 180</td><td></td><td> 185</td><td></td><td> 190</td><td></td><td></td>

<td> Gly Val</td><td> His</td><td> Thr Phe</td><td> Pro Ala Val</td><td> Leu Gin Ser Ser</td><td> Gly</td><td> Leu</td><td> Tyr</td><td> Ser</td>

<td></td><td> 195</td><td></td><td> 200</td><td></td><td> 205</td><td></td><td></td><td></td>

<td> Leu Ser</td><td> Ser</td><td> Val Val</td><td> Thr Val Pro</td><td> Ser Ser Asn Phe</td><td> Gly</td><td> Thr</td><td> Gin</td><td> Thr</td>

<td> 210</td><td></td><td></td><td> 215</td><td> 220</td><td></td><td></td><td></td><td></td>

<td> Tyr Thr</td><td> Cys</td><td> Asn Val</td><td> Asp His Lys</td><td> Pro Ser Asn Thr</td><td> Lys</td><td> Val</td><td> Asp</td><td> Lys</td>

<td> 225</td><td></td><td></td><td> 230</td><td> 235</td><td></td><td></td><td></td><td> 240</td>

<td> Thr Val</td><td> Glu</td><td> Arg Lys</td><td> Cys Cys Val</td><td> Glu Cys Pro Pro</td><td> Cys</td><td> Pro</td><td> Ala</td><td> Pro</td>

<td></td><td></td><td> 245</td><td></td><td> 250</td><td></td><td></td><td> 255</td><td></td>

<td> Pro Val</td><td> Ala</td><td> Gly Pro</td><td> Ser Val Phe</td><td> Leu Phe Pro Pro</td><td> Lys</td><td> Pro</td><td> Lys</td><td> Asp</td>

<td></td><td></td><td> 260</td><td></td><td> 265</td><td></td><td> 270</td><td></td><td></td>

<td> Thr Leu</td><td> Met</td><td> He Ser</td><td> Arg Thr Pro</td><td> Glu Val Thr Cys</td><td> Val</td><td> Val</td><td> Val</td><td> Asp</td>

<td></td><td> 275</td><td></td><td> 280</td><td></td><td> 285</td><td></td><td></td><td></td>

<td> Val Ser</td><td> His</td><td> Glu Asp</td><td> Pro Glu Val</td><td> Gin Phe Asn Trp</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td>

<td> 290</td><td></td><td></td><td> 295</td><td> 300</td><td></td><td></td><td></td><td></td>

<td> Val Glu</td><td> Val</td><td> His Asn</td><td> Ala Lys Thr</td><td> Lys Pro Arg Glu</td><td> Glu</td><td> Gin</td><td> Phe</td><td> Asn</td>

35-01\01370774 /1

305 310 315320

Ser Thr Phe Arg Val Val Ser Val Leu Thr Val Val His Gin Asp Trp

325 330335

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro

340 345350

Ala Pro lie Glu Lys Thr He Ser Lys Thr Lys Gly Gin Pro Arg Glu

355 360365

Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn

370 375380

Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser AspHe

385 390 395400

Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr LysThr

405 410415

Thr Pro Pro Met Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

420 425430

Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys

435 440445

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu

450 455460

Ser Leu Ser Pro Gly Lys

465470 <210> 29 <211> 974

35-01\01370774

־169 <212> DNA <213> Homo sapiens <220>

<221> 5'UTR <222> (1).(38) <220>

<221> CDS <222> (39).(749) <220>

<221> 3'UTR <222> (750).(974) <220>

<221> sig_peptide <222> (39).(104) <400> 29 gaattcgcag tgccatgaca ccacggtcag gacacagc atg gac atg agg gtc ccc 56

Met Asp Met Arg Val Pro

5 ' get cag etc etg ggg etc etg etg etc tgg ttc cca ggt tcc aga tgc 104

Ala Gin Leu Leu Gly Leu Leu Leu Leu Trp Phe Pro Gly Ser Arg Cys

35-01\01370774 •170147448/1

<td></td><td> 10</td><td> 15</td><td> 20</td>

<td> gac ate cag</td><td> atg acc cag</td><td> tet cca tet tee gtg</td><td> tet gca tet gta gga 152</td>

<td> Asp He Gin</td><td> Met Thr Gin</td><td> Ser Pro Ser Ser Val</td><td> Ser Ala Ser Val Gly</td>

<td> 25</td><td></td><td> 30</td><td> 35</td>

<td> gac aga gtc</td><td> acc ate act</td><td> tgt egg geg agt cag</td><td> ggt att age agg ttg 200</td>

<td> Asp Arg Val</td><td> Thr He Thr</td><td> Cys Arg Ala Ser Gin</td><td> Gly He Ser Arg Leu</td>

<td> 40</td><td></td><td> 45</td><td> 50</td>

<td> tta gee tgg</td><td> tat cag cag</td><td> aaa cca ggg aaa gee</td><td> cct aaa etc etg ate 248</td>

<td> Leu Ala Trp</td><td> Tyr Gin Gin</td><td> Lys Pro Gly Lys Ala</td><td> Pro Lys Leu Leu He</td>

<td> 55</td><td> 60</td><td> 65</td><td> 70</td>

<td> tat gtt gca</td><td> tee agt ttg</td><td> caa agt ggg gtc cca</td><td> tea agg ttc age ggc 296</td>

<td> Tyr Val Ala</td><td> Ser Ser Leu</td><td> Gin Ser Gly Val Pro</td><td> Ser Arg Phe Ser Gly</td>

<td></td><td> 75</td><td> 80</td><td> 85</td>

<td> agt gga tet</td><td> ggg aca gat</td><td> ttc act etc acc ate</td><td> age age etg cag cct 344</td>

<td> Ser Gly Ser</td><td> Gly Thr Asp</td><td> Phe Thr Leu Thr He</td><td> Ser Ser Leu Gin Pro</td>

<td></td><td> 90</td><td> 95</td><td> 100 .</td>

<td> gaa gat ttt</td><td> gca act tac</td><td> tat tgt caa cag get</td><td> aac agt ttc ccg tgg 392</td>

<td> Glu Asp Phe</td><td> Ala Thr Tyr</td><td> Tyr Cys Gin Gin Ala</td><td> Asn Ser Phe Pro Trp</td>

<td> 105</td><td></td><td> 110</td><td> 115</td>

35-01\01370774

147448/1

<td colspan="2"> acg ttc ggc</td><td colspan="2"> caa ggg acc</td><td colspan="7"> aag gtg gaa ate aaa ega act gtg</td><td rowspan="2"> get. Ala</td><td rowspan="2"> gca Ala</td><td rowspan="2"> 440</td>

<td> Thr Phe 120</td><td> Gly</td><td> Gin Gly</td><td> Thr</td><td> Lys 125</td><td> Val Glu</td><td> He</td><td> Lys</td><td> Arg 130</td><td> Thr</td><td> Val</td>

<td> cca tet</td><td> gtc</td><td> ttc ate</td><td> ttc</td><td> ccg</td><td> cca tet</td><td> gat</td><td> gag</td><td> cag</td><td> ttg</td><td> aaa</td><td> tet</td><td> gga</td><td> 488</td>

<td> Pro Ser</td><td> Val</td><td> Phe He</td><td> Phe</td><td> Pro</td><td> Pro Ser</td><td> Asp</td><td> Glu</td><td> Gin</td><td> Leu</td><td> Lys</td><td> Ser</td><td> Gly</td><td></td>

<td> 135 act gcc</td><td> tet</td><td> gtt gtg</td><td> 140 tgc</td><td> etg</td><td> etg aat</td><td> aac</td><td> 145 ttc</td><td> tat</td><td> CCC</td><td> aga</td><td> gag</td><td> 150 gee</td><td> 536</td>

<td> Thr Ala</td><td> Ser</td><td> Val Val</td><td> Cys</td><td> Leu</td><td> Leu Asn</td><td> Asn</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Ala</td><td></td>

<td> aaa gta</td><td> cag</td><td> 155 tgg aag</td><td> gtg</td><td> gat</td><td> aac gcc</td><td> 160 etc</td><td> caa</td><td> teg</td><td> ggt</td><td> aac</td><td> 165 tcc</td><td> cag</td><td> 584</td>

<td> Lys Val</td><td> Gin</td><td> Trp Lys</td><td> Val</td><td> Asp</td><td> Asn Ala</td><td> Leu</td><td> Gin</td><td> Ser</td><td> Gly</td><td> Asn</td><td> Ser</td><td> Gin</td><td></td>

<td> gag agt</td><td> gtc</td><td> 170 aca gag</td><td> cag</td><td> gac</td><td> 175 age aag</td><td> gac</td><td> age</td><td> acc</td><td> tac</td><td> 180 age</td><td> etc</td><td> age</td><td> 632</td>

<td> Glu Ser</td><td> Val</td><td> Thr Glu</td><td> Gin</td><td> Asp</td><td> Ser Lys</td><td> Asp</td><td> Ser</td><td> Thr</td><td> Tyr</td><td> Ser</td><td> Leu</td><td> Ser</td><td></td>

<td> age acc</td><td> 185 etg</td><td> acg etg</td><td> age</td><td> aaa</td><td> 190 gca gac</td><td> tac</td><td> gag</td><td> aaa</td><td> 195 cac</td><td> aaa</td><td> gtc</td><td> tac</td><td> 680</td>

<td> Ser Thr</td><td> Leu</td><td> Thr Leu</td><td> Ser</td><td> Lys</td><td> Ala Asp</td><td> Tyr</td><td> Glu</td><td> Lys</td><td> His</td><td> Lys</td><td> Val</td><td> Tyr</td><td></td>

<td> 200 gcc tgc</td><td> gaa</td><td> gtc acc</td><td> cat</td><td> 205 cag</td><td> ggc etg</td><td> age</td><td> teg</td><td> 210 CCC</td><td> gtc</td><td> aca</td><td> aag</td><td> age</td><td> 728</td>

<td> Ala Cys</td><td> Glu</td><td> Val Thr</td><td> His</td><td> Gin</td><td> Gly Leu</td><td> Ser</td><td> Ser</td><td> Pro</td><td> Val</td><td> Thr</td><td> Lys</td><td> Ser</td><td></td>

35-01\01370774 /1

215 220 225 230 ttc aac agg gga gag tgt tag agggagaagt gcccccacct gctcctcagt 779

Phe Asn Arg Gly Glu Cys tccagcctga ccccctccca tcctttggcc tctgaccctt tttccacagg ggacctaccc 839 ctattgcggt cctccagctc atctttcacc tcacccccct cctcctcctt ggctttaatt 899 atgctaatgt tggaggagaa tgaataaata aagtgaatct ttgcaaaaaa aaaaaaaaaa 959 aatctctgcg gccgc 974 <210> 30 <211> 236 <212> PRT <213> Homo sapiens <400> 30

Met Asp Met Arg Val Pro Ala Gin Leu Leu Gly Leu Leu Leu Leu Trp

10 15

Phe Pro Gly Ser Arg Cys Asp He Gin Met Thr Gin Ser Pro Ser Ser

25 30

Val Ser Ala Ser Val Gly Asp Arg Val Thr lie Thr Cys Arg Ala Ser

35-01\01370774

4045

Gin Gly He Ser Arg Leu Leu Ala Trp Tyr Gin Gin Lys Pro Gly Lys

5560

Ala Pro Lys Leu Leu He Tyr Val Ala Ser Ser Leu Gin Ser Gly Val

70 7580

Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

9095

He Ser Ser Leu Gin Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gin Gin

100 105.110

Ala Asn Ser Phe Pro Trp Thr Phe Gly Gin Gly Thr Lys Val Glu He

115 120125

Lys Arg Thr Val Ala Ala Pro Ser Val Phe He Phe Pro Pro Ser Asp

130 135140

Glu Gin Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu AsnAsn

145 150 155160

Phe Tyr Pro Arg Glu Ala Lys Val Gin Trp Lys Val Asp Asn AlaLeu

165 170175

Gin Ser Gly Asn Ser Gin Glu Ser Val Thr Glu Gin Asp Ser Lys Asp

180 185190

Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr

195 200205

Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gin Gly Leu Ser

210 215220

Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys

225 230235

35-01\01370774 /1 <210> 31 <211> 1708 <212> DNA <213> Homo sapiens <220>

<221> 5'UTR <222> (1). . (93) <220>

<221> CDS <222> (94).(1506) <220>

<221> 3'UTR <222> (1507). (1708) <220>

<221> sig_peptide <222> (94) . . (150) <400> 31 gaattcgcag taccatgaca ccacgggagc cccagccttg ggattcccaa gtgtttgtaa 60

35-01)01370774

-צדן147448/!

tcagtgatca ggactgagca cacaggactc acc atg gag ttg ggg etg age tgg 114

Met Glu Leu Gly Leu Ser Trp

<td colspan="3"> gtt ttc ett</td><td colspan="2"> gtt get ata tta</td><td colspan="2"> gaa ggt</td><td rowspan="2"> gtc Val</td><td colspan="4"> cag tgt gag gtg</td><td rowspan="2"> cag Gin</td><td rowspan="2"> etg Leu</td><td rowspan="2"> 162</td>

<td> Val</td><td> Phe</td><td> Leu 10</td><td> Val Ala</td><td> lie Leu</td><td> Glu 15</td><td> Gly</td><td> Gin</td><td> Cys</td><td> Glu 20</td><td> Val</td>

<td> gtg</td><td> gag</td><td> tet</td><td> ggg gga</td><td> ggc ttg</td><td> gta</td><td> cag</td><td> cct</td><td> ggg</td><td> ggg</td><td> tcc</td><td> etg</td><td> aga</td><td> etc</td><td> 210</td>

<td> Val</td><td> Glu</td><td> Ser</td><td> Gly Gly</td><td> Gly Leu</td><td> Val</td><td> Gin</td><td> Pro</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Leu</td><td> Arg</td><td> Leu</td><td></td>

<td></td><td> 25</td><td></td><td></td><td> 30</td><td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td></td>

<td> tcc</td><td> tgt</td><td> gca</td><td> gee tet</td><td> gga ttc</td><td> acc</td><td> ttc</td><td> agt</td><td> age</td><td> tac</td><td> gac</td><td> atg</td><td> cac</td><td> tgg</td><td> 258</td>

<td> Ser</td><td> Cys</td><td> Ala</td><td> Ala Ser</td><td> Gly Phe</td><td> Thr</td><td> Phe</td><td> Ser</td><td> Ser</td><td> Tyr</td><td> Asp</td><td> Met</td><td> His</td><td> Trp</td><td></td>

<td> 40</td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td>

<td> gtc</td><td> ege</td><td> caa</td><td> get aca</td><td> gga aaa</td><td> ggt</td><td> etg</td><td> gag</td><td> tgg</td><td> gtc</td><td> tea</td><td> get</td><td> att</td><td> ggt</td><td> 306</td>

<td> Val</td><td> Arg</td><td> Gin</td><td> Ala Thr</td><td> Gly Lys</td><td> Gly</td><td> Leu</td><td> Glu</td><td> Trp</td><td> Val</td><td> Ser</td><td> Ala</td><td> He</td><td> Gly</td><td></td>

<td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td>

<td> act</td><td> get</td><td> ggt</td><td> gac aca</td><td> tac tat</td><td> cca</td><td> ggc</td><td> tee</td><td> gtg</td><td> aag</td><td> ggc</td><td> ega</td><td> ttc</td><td> acc</td><td> 354</td>

<td> Thr</td><td> Ala</td><td> Gly</td><td> Asp Thr</td><td> Tyr Tyr</td><td> Pro</td><td> Gly</td><td> Ser</td><td> Val</td><td> Lys</td><td> Gly</td><td> Arg</td><td> Phe</td><td> Thr</td><td></td>

<td></td><td> ׳</td><td></td><td> 75</td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td>

<td> ate</td><td> tcc</td><td> aga</td><td> gaa aat</td><td> gcc aag</td><td> aac</td><td> tcc</td><td> ttg</td><td> tat</td><td> ett</td><td> caa</td><td> atg</td><td> aac</td><td> age</td><td> 402</td>

<td> He</td><td> Ser</td><td> Arg</td><td> Glu Asn</td><td> Ala Lys</td><td> Asn</td><td> Ser</td><td> Leu</td><td> Tyr</td><td> Leu</td><td> Gin</td><td> Met</td><td> Asn</td><td> Ser</td><td></td>

35-01\01370774 /1

<td></td><td> 90</td><td> 95</td><td> 100</td>

<td> etg aga</td><td> gcc ggg gac</td><td> acg get gtg tat tac tgt</td><td> gta aga gat aat agg 450</td>

<td> Leu Arg</td><td> Ala Gly Asp</td><td> Thr Ala Val Tyr Tyr Cys</td><td> Val Arg Asp Asn Arg</td>

<td> 105</td><td></td><td> 110</td><td> 115</td>

<td> aag gtg</td><td> acc cac gag</td><td> cac tac tac tac tac ggt</td><td> atg gac gtc tgg ggc 498</td>

<td> Lys Val</td><td> Thr His Glu</td><td> His Tyr Tyr Tyr Tyr Gly</td><td> Met Asp Val Trp Gly</td>

<td> 120</td><td></td><td> 125 130</td><td> 135</td>

<td> caa ggg</td><td> acc acg gtc</td><td> acc gtc tee tea gcc tee</td><td> acc aag ggc cca teg 546</td>

<td> Gin Gly</td><td> Thr Thr Val</td><td> Thr Val Ser Ser Ala Ser</td><td> Thr Lys Gly Pro Ser</td>

<td></td><td> 140</td><td> 145</td><td> 150</td>

<td> gtc ttc</td><td> ccc etg geg</td><td> ccc tgc tee agg age acc</td><td> tee gag age aca geg 594</td>

<td> Val Phe</td><td> Pro Leu Ala</td><td> Pro Cys Ser Arg Ser Thr</td><td> Ser Glu Ser Thr Ala</td>

<td></td><td> 155</td><td> 160</td><td> 165</td>

<td> gcc etg</td><td> ggc tgc etg</td><td> gtc aag gac tac ttc ccc</td><td> gaa ccg gtg acg gtg 642</td>

<td> Ala Leu</td><td> Gly Cys Leu</td><td> Val Lys Asp Tyr Phe Pro</td><td> Glu Pro Val Thr Val</td>

<td></td><td> 170</td><td> 175</td><td> 180</td>

<td> teg tgg</td><td> aac tea ggc</td><td> get etg acc age ggc gtg</td><td> cac acc ttc cca get 690</td>

<td> Ser Trp</td><td> Asn Ser Gly</td><td> Ala Leu Thr Ser Gly Val</td><td> His Thr Phe Pro Ala</td>

<td> 185</td><td></td><td> 190</td><td> 195</td>

35-01\01370774

-m147448/1

<td rowspan="2"> gtc eta Val Leu 200</td><td rowspan="2"> cag Gin</td><td rowspan="2"> tcc tea Ser Ser</td><td colspan="7"> gga etc tac tcc etc age age gtg gtg</td><td rowspan="2"> acc Thr</td><td rowspan="2"> gtg Val 215</td><td rowspan="2"> 738</td>

<td> Gly 205</td><td> Leu Tyr Ser</td><td> Leu</td><td> Ser 210</td><td> Ser</td><td> Val</td><td> Val</td>

<td> ccc tcc</td><td> age</td><td> aac ttc</td><td> ggc</td><td> acc cag acc</td><td> tac</td><td> acc</td><td> tgc</td><td> aac</td><td> gta</td><td> gat</td><td> cac</td><td> 786</td>

<td> Pro Ser</td><td> Ser</td><td> Asn Phe</td><td> Gly</td><td> Thr Gin Thr</td><td> Tyr</td><td> Thr</td><td> Cys</td><td> Asn</td><td> Val</td><td> Asp</td><td> His</td><td></td>

<td> aag ccc</td><td> age</td><td> 220 aac acc</td><td> aag</td><td> gtg gac aag</td><td> 225 aca</td><td> gtt</td><td> gag</td><td> ege</td><td> aaa</td><td> 230 tgt</td><td> tgt</td><td> 834</td>

<td> Lys Pro</td><td> Ser</td><td> Asn Thr</td><td> Lys</td><td> Val Asp Lys</td><td> Thr</td><td> Val</td><td> Glu</td><td> Arg</td><td> Lys</td><td> Cys</td><td> Cys</td><td></td>

<td> gtc gag</td><td> tgc</td><td> 235 cca ccg</td><td> tgc</td><td> 240 cca gca cca</td><td> cct</td><td> gtg</td><td> gca</td><td> gga</td><td> 245 ccg</td><td> tea</td><td> gtc</td><td> 882</td>

<td> Val Glu</td><td> Cys</td><td> Pro Pro</td><td> Cys</td><td> Pro Ala Pro</td><td> Pro</td><td> Val</td><td> Ala</td><td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td></td>

<td> ttc etc</td><td> 250 ttc</td><td> ccc cca</td><td> aaa</td><td> 255 ccc aag gac</td><td> acc</td><td> etc</td><td> atg</td><td> 260 ate</td><td> tcc</td><td> egg</td><td> acc</td><td> 930</td>

<td> Phe Leu</td><td> Phe</td><td> Pro Pro</td><td> Lys</td><td> Pro Lys Asp</td><td> Thr</td><td> Leu</td><td> Met</td><td> lie</td><td> Ser</td><td> Arg</td><td> Thr</td><td></td>

<td> 265 cct gag</td><td> gtc</td><td> acg tgc</td><td> gtg</td><td> 270 gtg gtg gac</td><td> gtg</td><td> age</td><td> 275 cac</td><td> gaa</td><td> gac</td><td> ccc</td><td> gag</td><td> 978</td>

<td> Pro Glu</td><td> Val</td><td> Thr Cys</td><td> Val</td><td> Val Val Asp</td><td> Val</td><td> Ser</td><td> His</td><td> Glu</td><td> Asp</td><td> Pro</td><td> Glu</td><td></td>

<td> 280 gtc cag</td><td> ttc</td><td> aac tgg</td><td> 285 tac</td><td> gtg gac ggc</td><td> gtg</td><td> 290 gag</td><td> gtg</td><td> cat</td><td> aat</td><td> gcc</td><td> 295 aag</td><td> 1026</td>

<td> Val Gin</td><td> Phe</td><td> Asn Trp</td><td> Tyr</td><td> Val Asp Gly</td><td> Val</td><td> Glu</td><td> Val</td><td> His</td><td> Asn</td><td> Ala</td><td> Lys</td><td></td>

35-01\01370774 /1

300 305 310

<td> aca</td><td> aag</td><td> cca</td><td> egg</td><td> gag</td><td> gag</td><td> cag</td><td> ttc</td><td> aac</td><td> age</td><td> acg</td><td> ttc</td><td> cgt</td><td> gtg</td><td> gtc</td><td> age</td><td> 1074</td>

<td> Thr</td><td> Lys</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Phe</td><td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td></td>

<td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td><td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td>

<td> gtc</td><td> etc</td><td> acc</td><td> gtt</td><td> gtg</td><td> cac</td><td> cag</td><td> gac</td><td> tgg</td><td> etg</td><td> aac</td><td> ggc</td><td> aag</td><td> gag</td><td> tac</td><td> aag</td><td> 1122</td>

<td> Val</td><td> Leu</td><td> Thr</td><td> Val</td><td> Val</td><td> His</td><td> Gin</td><td> Asp</td><td> Trp</td><td> Leu</td><td> Asn</td><td> Gly</td><td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td></td>

<td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td><td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td>

<td> tgc</td><td> aag</td><td> gtc</td><td> tcc</td><td> aac</td><td> aaa</td><td> ggc</td><td> etc</td><td> cca</td><td> gcc</td><td> ccc</td><td> ate</td><td> gag</td><td> aaa</td><td> acc</td><td> ate</td><td> 1170</td>

<td> Cys</td><td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Lys</td><td> Gly</td><td> Leu</td><td> Pro</td><td> Ala</td><td> Pro</td><td> He</td><td> Glu</td><td> Lys</td><td> Thr</td><td> He</td><td></td>

<td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td><td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td></td>

<td> tcc</td><td> aaa</td><td> acc</td><td> aaa</td><td> ggg</td><td> cag</td><td> ccc</td><td> ega</td><td> gaa</td><td> cca</td><td> cag</td><td> gtg</td><td> tac</td><td> acc</td><td> etg</td><td> ccc</td><td> 1218</td>

<td> Ser</td><td> Lys</td><td> Thr</td><td> Lys</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> Gin</td><td> Val</td><td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro</td><td></td>

<td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td><td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td>

<td> cca</td><td> tcc</td><td> egg</td><td> gag</td><td> gag</td><td> atg</td><td> acc</td><td> aag</td><td> aac</td><td> cag</td><td> gtc</td><td> age</td><td> etg</td><td> acc</td><td> tgc</td><td> etg</td><td> 1266</td>

<td> Pro</td><td> Ser</td><td> Arg</td><td> . Glu</td><td> Glu</td><td> Met</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td><td></td>

<td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td><td></td><td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td><td></td>

<td> gtc</td><td> aaa</td><td> ggc</td><td> ttc</td><td> tac</td><td> ccc</td><td> age</td><td> gac</td><td> ate</td><td> gcc</td><td> gtg</td><td> gag</td><td> tgg</td><td> gag</td><td> age</td><td> aat</td><td> 1314</td>

<td> Val</td><td> Lys</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td><td> He</td><td> Ala</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td><td></td>

395 400 405

35-01\01370774 /1

<td rowspan="2"> ggg cag ccg Gly Gin Pro</td><td> gag aac aac tac aag acc aca cct</td><td colspan="2"> ccc atg etg gac tcc</td><td rowspan="3"> 1362</td>

<td> Glu Asn Asn Tyr Lys Thr Thr Pro</td><td> Pro Met Leu</td><td rowspan="2"> Asp Ser</td>

<td> 410</td><td> 415</td><td> 420</td>

<td> gac ggc tcc</td><td> ttc ttc etc tac age aag etc acc</td><td> gtg gac aag</td><td> age agg</td><td> 1410</td>

<td> Asp Gly Ser 425</td><td> Phe Phe Leu Tyr Ser Lys Leu Thr 430</td><td> Val Asp Lys 435</td><td> Ser Arg</td><td></td>

<td> tgg cag cag</td><td> ggg aac gtc ttc tea tgc tcc gtg</td><td> atg cat gag</td><td> get etg</td><td> 1458</td>

<td> Trp Gin Gin 440</td><td> Gly Asn Val Phe Ser Cys Ser Val 445 450</td><td> Met His Glu</td><td> Ala Leu 455</td><td></td>

<td> cac aac cac</td><td> tac acg cag aag age etc tcc etg</td><td> tet ccg ggt</td><td> aaa tga</td><td> 1506</td>

<td> His Asn His</td><td> Tyr Thr Gin Lys Ser Leu Ser Leu 460 465</td><td> Ser Pro Gly</td><td> Lys 470</td><td></td>

<td> gtgccacggc</td><td> cggcaagccc ccgctcccca ggctctcggg</td><td> gtegegtgag</td><td> gatgettgge</td><td> 1566</td>

<td> acgtaccccg</td><td> tgtacatact tcccaggcac ccagcatgga</td><td> aataaagcac</td><td> ccagcgctgc</td><td> 1626</td>

<td> cctgggcccc</td><td> tgcnaaaaaa aaaaaaaaaa aaaaaaaaaa</td><td> aaaaaaaaaa</td><td> aaaaaaaaaa</td><td> 1686</td>

aaaaaaaaat ctctgcggcc gc

1708 <210> 32

35-01\01370774 /1 <211> 470 <212> PRT <213> Homo sapiens <400> 32

<td colspan="3"> Met Glu Leu 1</td><td> Gly</td><td colspan="2"> Leu Ser 5</td><td colspan="2"> Trp Val</td><td colspan="2"> Phe Leu 10</td><td> Val</td><td> Ala</td><td> He</td><td> Leu</td><td> Glu 15</td><td> Gly</td>

<td> Val</td><td> Gin</td><td> Cys</td><td> Glu</td><td> Val</td><td> Gin</td><td> Leu</td><td> Val</td><td> Glu</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Leu</td><td> Val</td><td> Gin</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td> Pro</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Leu</td><td> Arg</td><td> Leu</td><td> Ser</td><td> Cys</td><td> Ala</td><td> Ala</td><td> Ser</td><td> Gly</td><td> Phe</td><td> Thr</td><td> Phe</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td> Ser</td><td> Ser</td><td> Tyr</td><td> Asp</td><td> Met</td><td> His</td><td> Trp</td><td> Val</td><td> Arg</td><td> Gin</td><td> Ala</td><td> Thr</td><td> Gly</td><td> Lys</td><td> Gly</td><td> Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td> Glu</td><td> Trp</td><td> Val</td><td> Ser</td><td> Ala</td><td> He</td><td> Gly</td><td> Thr</td><td> Ala</td><td> Gly</td><td> Asp</td><td> Thr</td><td> Tyr</td><td> Tyr</td><td> Pro</td><td> Gly</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td> Ser</td><td> Val</td><td> Lys</td><td> Gly</td><td> Arg</td><td> Phe</td><td> Thr</td><td> He</td><td> Ser</td><td> Arg</td><td> Glu</td><td> Asn</td><td> Ala</td><td> Lys</td><td> Asn</td><td> Ser</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td> Leu</td><td> Tyr</td><td> Leu</td><td> Gin</td><td> Met</td><td> Asn</td><td> Ser</td><td> Leu</td><td> Arg</td><td> Ala</td><td> Gly</td><td> Asp</td><td> Thr</td><td> Ala</td><td> Val</td><td> Tyr</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td> Tyr</td><td> Cys</td><td> Val</td><td> Arg</td><td> Asp</td><td> Asn</td><td> Arg</td><td> Lys</td><td> Val</td><td> Thr</td><td> His</td><td> Glu</td><td> His</td><td> Tyr</td><td> Tyr</td><td> Tyr</td>

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

<td> Tyr</td><td> Gly</td><td> Met</td><td> Asp</td><td> Val</td><td> Trp</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Thr</td><td> Thr</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser</td>

<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>

<td> Ala</td><td> Ser</td><td> Thr</td><td> Lys</td><td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Pro</td><td> Leu</td><td> Ala</td><td> Pro</td><td> Cys</td><td> Ser</td><td> Arg</td>

<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td>

<td> Ser</td><td> Thr</td><td> Ser</td><td> Glu</td><td> Ser</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Leu</td><td> Gly</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Asp</td><td> Tyr</td>

35-01\01370774 /1

<td colspan="2"> Phe Pro Glu Pro</td><td rowspan="2"> Val</td><td colspan="2"> Thr Val Ser Trp Asn Ser Gly Ala Leu</td><td rowspan="2"> Thr</td><td rowspan="2"> Ser</td>

<td></td><td> 180</td><td> 185</td><td> 190</td>

<td> Gly Val His</td><td> Thr</td><td> Phe</td><td> Pro Ala Val Leu</td><td> Gin Ser Ser Gly Leu</td><td> Tyr</td><td> Ser</td>

<td> 195</td><td></td><td></td><td> 200</td><td> 205</td><td></td><td></td>

<td> Leu Ser Ser</td><td> Val</td><td> Val</td><td> Thr Val Pro Ser</td><td> Ser Asn Phe Gly Thr</td><td> Gin</td><td> Thr</td>

<td> 210</td><td></td><td></td><td> 215</td><td> 220</td><td></td><td></td>

<td> Tyr Thr Cys</td><td> Asn</td><td> Val</td><td> Asp His Lys Pro</td><td> Ser Asn Thr Lys Val</td><td> Asp</td><td> Lys</td>

<td> 225</td><td></td><td></td><td> 230</td><td> 235</td><td></td><td> 240</td>

<td> Thr Val Glu</td><td> Arg</td><td> Lys</td><td> Cys Cys Val Glu</td><td> Cys Pro Pro Cys Pro</td><td> Ala</td><td> Pro</td>

<td></td><td></td><td> 245</td><td></td><td> 250</td><td> 255</td><td></td>

<td> Pro Val Ala</td><td> Gly</td><td> Pro</td><td> Ser Val Phe Leu</td><td> Phe Pro Pro Lys Pro</td><td> Lys</td><td> Asp</td>

<td></td><td> 260</td><td></td><td> 265</td><td> 270</td><td></td><td></td>

<td> Thr Leu Met</td><td> He</td><td> Ser</td><td> Arg Thr Pro Glu</td><td> Val Thr Cys Val Val</td><td> Val</td><td> Asp</td>

<td> 275</td><td></td><td></td><td> 280</td><td> 285</td><td></td><td></td>

<td> Val Ser His</td><td> Glu</td><td> Asp</td><td> Pro Glu Val Gin</td><td> Phe Asn Trp Tyr Val</td><td> Asp</td><td> Gly</td>

<td> 290</td><td></td><td></td><td> 295</td><td> 300</td><td></td><td></td>

<td> Val Glu Val</td><td> His</td><td> Asn</td><td> Ala Lys Thr Lys</td><td> Pro Arg Glu Glu Gin</td><td> Phe</td><td> Asn</td>

<td> 305</td><td></td><td></td><td> 310</td><td> 315</td><td></td><td> 320</td>

<td> Ser Thr Phe</td><td> Arg</td><td> Val</td><td> Val Ser Val Leu</td><td> Thr Val Val His Gin</td><td> Asp</td><td> Trp</td>

<td></td><td></td><td> 325</td><td></td><td> 330</td><td> 335</td><td></td>

<td> Leu Asn Gly</td><td> Lys</td><td> Glu</td><td> Tyr Lys Cys Lys</td><td> Val Ser Asn Lys Gly</td><td> Leu</td><td> Pro</td>

<td></td><td> 340</td><td></td><td> 345</td><td> 350</td><td></td><td></td>

<td> Ala Pro He</td><td> Glu</td><td> Lys</td><td> Thr He Ser Lys</td><td> Thr Lys Gly Gin Pro</td><td> Arg</td><td> Glu</td>

<td> 355</td><td></td><td></td><td> 360</td><td> 365</td><td></td><td></td>

<td> Pro Gin Val</td><td> Tyr</td><td> Thr</td><td> Leu Pro Pro Ser</td><td> Arg Glu Glu Met Thr</td><td> Lys</td><td> Asn</td>

35-01\01370774 /1

370 375380

Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser AspHe

385 390 395400

Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr LysThr

405 410415

Thr Pro Pro Met Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

420 425430

Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys

435 440445

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu

450 455460

Ser Leu Ser Pro Gly Lys

465470 <210> 33 <211> 948 <212> DNA <213> Homo sapiens <220>

<221> 5'UTR <222> (1).(27) <220>

35-01)01370774 /1 <221> CDS <222> (28).(738) <220>

<221> 3'UTR <222> (739) . . (948) <220>

<221> sig_peptide <222> (28) . . (87) <400> 33 gaattcgcag tgccatgaca ccacgcc atg gaa acc cca gcg cag ett etc ttc 54

Met Glu Thr Pro Ala Gin Leu Leu Phe

<td></td><td> 1</td><td> 5</td>

<td> etc etg.eta etc tgg etc</td><td> cca gat acc</td><td> acc gga gaa att gtg ttg acg 102</td>

<td> Leu Leu Leu Leu Trp Leu</td><td> Pro Asp Thr</td><td> Thr Gly Glu lie Val Leu Thr</td>

<td> 10 15</td><td></td><td> 20 25</td>

<td> cag tet cca ggc acc etg</td><td> tet ttg tet</td><td> cca ggg gaa aga gcc acc etc 150</td>

<td> Gin Ser Pro Gly Thr Leu</td><td> Ser Leu Ser</td><td> Pro Gly Glu Arg Ala Thr Leu</td>

<td> 30</td><td></td><td> 35 40</td>

<td> tcc tgc agg gcc agt cag</td><td> aat att aga</td><td> age age tac tta gcc tgg tac 198</td>

<td> Ser Cys Arg'Ala Ser Gin</td><td> Asn lie Arg</td><td> Ser Ser Tyr Leu Ala Trp Tyr</td>

35-01\01370774 /1

<td></td><td> 45</td><td> 50</td><td> 55</td>

<td> cag</td><td> cag aaa cct ggc</td><td> cag get ccc ggg etc etc ate</td><td> tat ggt gca tee 246</td>

<td> Gin</td><td> Gin Lys Pro Gly</td><td> Gin Ala Pro Gly Leu Leu He</td><td> Tyr Gly Ala Ser</td>

<td></td><td> 60</td><td> 65</td><td> 70</td>

<td> age</td><td> agg gcc act ggc</td><td> ate cca gac agg ttc agt ggc</td><td> agt ggg tet ggg 294</td>

<td> Ser</td><td> Arg Ala Thr Gly</td><td> He Pro Asp Arg Phe Ser Gly</td><td> Ser Gly Ser Gly</td>

<td></td><td> 75</td><td> 80 85</td><td></td>

<td> aca</td><td> gac ttc act etc</td><td> acc ate age aga etg gag cct</td><td> gaa gat ttt gca 342</td>

<td> Thr</td><td> Asp Phe Thr Leu</td><td> Thr He Ser Arg Leu Glu Pro</td><td> Glu Asp Phe Ala</td>

<td> 90</td><td></td><td> 95 100</td><td> 105</td>

<td> gtg</td><td> tat tac tgt cag</td><td> cag ttt ggt age tea cct atg</td><td> tgc agt ttt ggc 390</td>

<td> Val</td><td> Tyr Tyr Cys Gin</td><td> Gin Phe Gly Ser Ser Pro Met</td><td> Cys Ser Phe Gly</td>

<td></td><td> 110</td><td> 115</td><td> , 120</td>

<td> cag</td><td> ggg acc aag etg</td><td> gag ate aaa cga act gtg get</td><td> gca cca tet gtc 438</td>

<td> Gin</td><td> Gly Thr Lys Leu</td><td> Glu He Lys Arg Thr Val Ala</td><td> Ala Pro Ser Val</td>

<td></td><td> 125</td><td> 130</td><td> 135</td>

<td> ttc</td><td> ate ttc ccg cca</td><td> tet gat gag cag ttg aaa tet</td><td> gga act gcc tet 486</td>

<td> Phe</td><td> lie Phe Pro Pro</td><td> Ser Asp Glu Gin Leu Lys Ser</td><td> Gly Thr Ala Ser</td>

<td></td><td> 140</td><td> 145</td><td> 150</td>

35-01\01370774 /1

<td colspan="2"> gtt gtg</td><td rowspan="2"> tgc Cys</td><td rowspan="2"> etg etg Leu Leu</td><td rowspan="2"> aat Asn</td><td colspan="5"> aac ttc tat ccc aga gag gcc aaa</td><td rowspan="2"> gta Val</td><td rowspan="2"> cag Gin</td><td rowspan="2"> 534</td>

<td> Val</td><td> Val 155</td><td> Asn 160</td><td> Phe Tyr Pro</td><td> Arg Glu 165</td><td> Ala</td><td> Lys</td>

<td> tgg</td><td> aag</td><td> gtg</td><td> gat aac</td><td> gcc</td><td> etc</td><td> caa teg ggt</td><td> aac tcc</td><td> cag</td><td> gag</td><td> agt</td><td> gtc</td><td> 582</td>

<td> Trp</td><td> Lys</td><td> Val</td><td> Asp Asn</td><td> Ala</td><td> Leu</td><td> Gin Ser Gly</td><td> Asn Ser</td><td> Gin</td><td> Glu</td><td> Ser</td><td> Val</td><td></td>

<td> 170</td><td></td><td></td><td></td><td> 175</td><td></td><td></td><td> 180 .</td><td></td><td></td><td></td><td> 185</td><td></td>

<td> aca</td><td> gag</td><td> cag</td><td> gac age</td><td> aag</td><td> gac</td><td> age acc tac</td><td> age etc</td><td> age</td><td> age</td><td> acc</td><td> etg</td><td> 630</td>

<td> Thr</td><td> Glu</td><td> Gin</td><td> Asp Ser</td><td> Lys</td><td> Asp</td><td> Ser Thr Tyr</td><td> Ser Leu</td><td> Ser</td><td> Ser</td><td> Thr</td><td> Leu</td><td></td>

<td></td><td></td><td></td><td> 190</td><td></td><td></td><td> 195</td><td></td><td></td><td></td><td> 200</td><td></td><td></td>

<td> acg</td><td> etg</td><td> age</td><td> aaa gca</td><td> gac</td><td> tac</td><td> gag aaa cac</td><td> aaa gtc</td><td> tac</td><td> gcc</td><td> tgc</td><td> gaa</td><td> 678</td>

<td> Thr</td><td> Leu</td><td> Ser</td><td> Lys Ala</td><td> Asp</td><td> Tyr</td><td> Glu Lys His</td><td> Lys Val</td><td> Tyr</td><td> Ala</td><td> Cys</td><td> Glu</td><td></td>

<td></td><td></td><td></td><td> 205</td><td></td><td></td><td> 210</td><td></td><td></td><td> 215</td><td></td><td></td><td></td>

<td> gtc</td><td> acc</td><td> cat</td><td> cag ggc</td><td> etg</td><td> age</td><td> teg ccc gtc</td><td> aca aag</td><td> age</td><td> ttc</td><td> aac</td><td> agg</td><td> 726</td>

<td> Val</td><td> Thr</td><td> His</td><td> Gin Gly</td><td> Leu</td><td> Ser</td><td> Ser Pro Val</td><td> Thr Lys</td><td> Ser</td><td> Phe</td><td> Asn</td><td> Arg</td><td></td>

<td></td><td></td><td> 220</td><td></td><td></td><td></td><td> 225</td><td></td><td> 230</td><td></td><td></td><td></td><td></td>

gga gag tgt tag agggagaant gcccccacct gctcctcagt tccagcctga 778

Gly Glu Cys ccccctccca tcctttggcc tctgaccctt tttccacagg ggacctaccc ctattgcggt 838

35-01\01370774 •186 cctccagctc atctttcacc tcacccccct cctcctcctt ggctttaatt atgctaatgt 898 tggaggagaa tgaataaata aagtgaatct ttgcacctgt gaaaaaaaaa <210> 34 <211> 236 <212> PRT <213> Homo sapiens <400> 34

<td colspan="2"> Met Glu Thr Pro Ala</td><td rowspan="2"> Gin Leu</td><td rowspan="2"> Leu</td><td colspan="2"> Phe Leu Leu Leu Leu Trp Leu</td><td rowspan="2"> Pro</td>

<td> 1</td><td> 5</td><td> 10</td><td> 15</td>

<td> Asp Thr Thr Gly</td><td> Glu</td><td> He Val</td><td> Leu</td><td> Thr Gin Ser</td><td> Pro Gly Thr Leu</td><td> Ser</td>

<td> 20</td><td></td><td></td><td></td><td> 25</td><td> 30</td><td></td>

<td> Leu Ser Pro Gly</td><td> Glu</td><td> Arg Ala</td><td> Thr</td><td> Leu Ser Cys</td><td> Arg Ala Ser Gin</td><td> Asn</td>

<td> 35</td><td></td><td></td><td> 40</td><td></td><td> 45</td><td></td>

<td> lie Arg Ser Ser</td><td> Tyr</td><td> Leu Ala</td><td> Trp</td><td> Tyr Gin Gin</td><td> Lys Pro Gly Gin</td><td> Ala</td>

<td> 50</td><td></td><td> 55</td><td></td><td></td><td> 60</td><td></td>

<td> Pro Gly Leu Leu</td><td> lie</td><td> Tyr Gly</td><td> Ala</td><td> Ser Ser Arg</td><td> Ala Thr Gly He</td><td> Pro</td>

<td> 65</td><td></td><td> 70</td><td></td><td> 75</td><td></td><td> 80</td>

<td> Asp Arg Phe Ser</td><td> Gly</td><td> Ser Gly</td><td> Ser</td><td> Gly Thr Asp</td><td> Phe Thr Leu Thr</td><td> He</td>

<td></td><td> 85</td><td></td><td></td><td> 90</td><td> 95</td><td></td>

<td> Ser Arg Leu Glu</td><td> Pro</td><td> Glu Asp</td><td> Phe</td><td> Ala Val Tyr</td><td> Tyr Cys Gin Gin</td><td> Phe</td>

<td> 100</td><td></td><td></td><td></td><td> 105</td><td> 110</td><td></td>

<td> Gly Ser Ser Pro</td><td> Met</td><td> Cys Ser</td><td> Phe</td><td> Gly Gin Gly</td><td> Thr Lys Leu Glu</td><td> He</td>

35*01X01370774 /1

115 120125

Lys Arg Thr Val Ala Ala Pro Ser Val Phe He Phe Pro Pro Ser Asp

130 135140

Glu Gin Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu AsnAsn

145 150 155160.

Phe Tyr Pro Arg Glu Ala Lys Val Gin Trp Lys Val Asp Asn AlaLeu

165 170175

Gin Ser Gly Asn Ser Gin Glu Ser Val Thr Glu Gin Asp Ser Lys Asp

180 185190

Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr

195 200205

Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gin Gly Leu Ser

210 215220

Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys

225 230235 <210>

<211>

1673 <212>

DNA <213>

Homo sapiens <220>

<221>

5'UTR <222>

(1).(95)

35-01)01370774 /1 <220>

<221> CDS <222> (96). (1508) <220>

<221> 3'UTR <222> (1509). (1673) <220>

<221> sig_peptide <222> (96).(152) <400> 35 gaattcgcag tgccatgaca ccacggtgga gccccagcct tgggattccc aagtgtttgt 60 attcagtgat caggactgaa cacacaggac tcacc atg gag ttg ggg etg age 113

Met Glu Leu Gly Leu Ser 15 tgg gtt ttc ett gtt get ata tta gaa ggt gtc cag tgt gag gtg cag161

Trp Val Phe Leu Val Ala He Leu Glu Gly Val Gin Cys Glu ValGin

1520 etg gtg gag tet ggg gga ggc ttg gta cag cct ggg ggg tee etg aga209

Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Arg

35-01\01370774

<td rowspan="2"> etc tcc Leu Ser 40</td><td rowspan="2"> tgt gca Cys Ala</td><td colspan="6"> gcc tet gga ttc acc ttc agt age tac gac</td><td rowspan="2"> atg Met</td><td rowspan="2"> cac His</td><td rowspan="2"> 257</td>

<td> Ala</td><td> Ser Gly Phe 45</td><td> Thr Phe</td><td> Ser</td><td> Ser 50</td><td> Tyr Asp</td>

<td> tgg gtc</td><td> ege caa</td><td> get</td><td> aca gga aaa</td><td> ggt etg</td><td> gag</td><td> tgg</td><td> gtc tea</td><td> get</td><td> att</td><td> 305</td>

<td> Trp Val</td><td> Arg Gin</td><td> Ala</td><td> Thr Gly Lys</td><td> Gly Leu</td><td> Glu</td><td> Trp</td><td> Val Ser</td><td> Ala</td><td> He</td><td></td>

<td> 55</td><td></td><td></td><td> 60</td><td></td><td> 65</td><td></td><td></td><td></td><td> 70</td><td></td>

<td> ggt act</td><td> get ggt</td><td> gac</td><td> aca tac tat</td><td> cca ggc</td><td> tcc</td><td> gtg</td><td> aag ggc</td><td> ega</td><td> ttc</td><td> 353</td>

<td> Gly Thr</td><td> Ala Gly</td><td> Asp</td><td> Thr Tyr Tyr</td><td> Pro Gly</td><td> Ser</td><td> Val</td><td> Lys Gly</td><td> Arg</td><td> Phe</td><td></td>

<td></td><td></td><td> 75</td><td></td><td> 80</td><td></td><td></td><td></td><td> 85</td><td></td><td></td>

<td> acc ate</td><td> tcc aga</td><td> gaa</td><td> aat gcc aag</td><td> aac tcc</td><td> ttg</td><td> tat</td><td> ett caa</td><td> atg</td><td> aac</td><td> 401</td>

<td> Thr He</td><td> Ser Arg</td><td> Glu</td><td> Asn Ala Lys</td><td> Asn Ser</td><td> Leu</td><td> Tyr</td><td> Leu Gin</td><td> Met</td><td> Asn</td><td></td>

<td></td><td> 90</td><td></td><td></td><td> 95</td><td></td><td></td><td> 100</td><td></td><td></td><td></td>

<td> age etg</td><td> aga gcc</td><td> ggg</td><td> gac acg get</td><td> gtg tat</td><td> tac</td><td> tgt</td><td> gta aga</td><td> gat</td><td> aag</td><td> 449</td>

<td> Ser Leu</td><td> Arg Ala</td><td> Gly</td><td> Asp Thr Ala</td><td> Val Tyr</td><td> Tyr</td><td> Cys</td><td> Val Arg</td><td> Asp</td><td> Lys</td><td></td>

<td></td><td> 105</td><td></td><td> 110</td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td>

<td> agg acg</td><td> gtg acc</td><td> cac</td><td> gag cac tac</td><td> tac tac</td><td> tac</td><td> ggt</td><td> atg gac</td><td> gtc</td><td> tgg</td><td> 497</td>

<td> Arg Thr</td><td> Val Thr</td><td> His</td><td> Glu His Tyr</td><td> Tyr Tyr</td><td> Tyr</td><td> Gly</td><td> Met Asp</td><td> Val</td><td> Trp</td><td></td>

35-01\01370774 /1

<td rowspan="2"> ggc caa Gly Gin 135</td><td rowspan="2"> ggg Gly</td><td rowspan="2"> acc acg Thr Thr</td><td colspan="7"> gtc acc gtc tcc tea gcc tcc acc aag</td><td rowspan="2"> ggc Gly</td><td rowspan="2"> cca Pro 150</td><td rowspan="2"> 545</td>

<td> Val 140</td><td> Thr Val Ser</td><td> Ser</td><td> Ala 145</td><td> Ser</td><td> Thr</td><td> Lys</td>

<td> teg gtc</td><td> ttc</td><td> ccc etg</td><td> geg</td><td> ccc tgc tcc</td><td> agg</td><td> age</td><td> acc</td><td> tcc</td><td> gag</td><td> age</td><td> aca</td><td> 593</td>

<td> Ser Val</td><td> Phe</td><td> Pro Leu</td><td> Ala</td><td> Pro Cys Ser</td><td> Arg</td><td> Ser</td><td> Thr</td><td> Ser</td><td> Glu</td><td> Ser</td><td> Thr</td><td></td>

<td> geg gcc</td><td> etg</td><td> 155 ggc tgc</td><td> etg</td><td> gtc aag gac</td><td> 160 tac</td><td> ttc</td><td> ccc</td><td> gaa</td><td> ccg</td><td> 165 gtg</td><td> acc</td><td> 641</td>

<td> Ala Ala</td><td> Leu</td><td> Gly Cys</td><td> Leu</td><td> Val Lys Asp</td><td> Tyr</td><td> Phe</td><td> Pro</td><td> Glu</td><td> Pro</td><td> Val</td><td> Thr</td><td></td>

<td> gtg teg</td><td> tgg</td><td> 170 aac tea</td><td> ggc</td><td> 175 get etg acc</td><td> age</td><td> ggc</td><td> gtg</td><td> cac</td><td> 180 acc</td><td> ttc</td><td> cca</td><td> 689</td>

<td> Val Ser</td><td> Trp</td><td> Asn Ser</td><td> Gly</td><td> Ala Leu Thr</td><td> Ser</td><td> Gly</td><td> Val</td><td> His</td><td> Thr</td><td> Phe</td><td> Pro</td><td></td>

<td> get gtc</td><td> 185 eta</td><td> cag tcc</td><td> tea</td><td> 190 gga etc tac</td><td> tcc</td><td> etc</td><td> age</td><td> 195 age</td><td> gtg</td><td> gtg</td><td> acc</td><td> 737</td>

<td> Ala Val</td><td> Leu</td><td> Gin Ser</td><td> Ser</td><td> Gly Leu Tyr</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Ser</td><td> Val</td><td> Val</td><td> Thr</td><td></td>

<td> 200 gtg ccc</td><td> tcc</td><td> age aac</td><td> ttc</td><td> 205 ggc acc cag</td><td> acc</td><td> tac</td><td> 210 acc</td><td> tgc</td><td> aac</td><td> gta</td><td> gat</td><td> 785</td>

<td> Val Pro</td><td> Ser</td><td> Ser Asn</td><td> Phe</td><td> Gly Thr Gin</td><td> Thr</td><td> Tyr</td><td> Thr</td><td> Cys</td><td> Asn</td><td> Val</td><td> Asp</td><td></td>

<td> 215 cac aag</td><td> ccc</td><td> age aac</td><td> 220 acc</td><td> aag gtg gac</td><td> aag</td><td> 225 aca</td><td> gtt</td><td> gag</td><td> ege</td><td> aaa</td><td> 230 tgt</td><td> 833</td>

<td> His Lys</td><td> Pro</td><td> Ser Asn</td><td> Thr</td><td> Lys Val Asp</td><td> Lys</td><td> Thr</td><td> Val</td><td> Glu</td><td> Arg</td><td> Lys</td><td> Cys</td><td></td>

35-01\01370774 /1

235 240 245

<td colspan="2"> tgt gtc</td><td rowspan="2"> gag Glu</td><td rowspan="2"> tgc Cys 250</td><td colspan="2"> cca ccg</td><td colspan="7"> tgc cca gca cca cct gtg gca gga</td><td rowspan="2"> ccg Pro</td><td rowspan="2"> tea Ser</td>

<td> Cys</td><td> Val</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Ala 255</td><td> Pro</td><td> Pro Val</td><td> Ala</td><td> Gly 260</td>

<td> gtc</td><td> ttc</td><td> etc</td><td> ttc</td><td> ccc</td><td> cca</td><td> aaa</td><td> ccc</td><td> aag</td><td> gac</td><td> acc etc</td><td> atg</td><td> ate</td><td> tcc</td><td> egg</td>

<td> Val</td><td> Phe</td><td> Leu 265</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys</td><td> Pro 270</td><td> Lys</td><td> Asp</td><td> Thr Leu</td><td> Met 275</td><td> He</td><td> Ser</td><td> Arg</td>

<td> acc</td><td> cct</td><td> gag</td><td> gtc</td><td> acg</td><td> tgc</td><td> gtg</td><td> gtg</td><td> gtg</td><td> gac</td><td> gtg age</td><td> cac</td><td> gaa</td><td> gac</td><td> ccc</td>

<td> Thr</td><td> Pro 280</td><td> Glu</td><td> Val</td><td> Thr</td><td> Cys</td><td> Val 285</td><td> Val</td><td> Val</td><td> Asp</td><td> Val Ser 290</td><td> His</td><td> Glu</td><td> Asp</td><td> Pro</td>

<td> gag</td><td> gtc</td><td> cag</td><td> ttc</td><td> aac</td><td> tgg</td><td> tac</td><td> gtg</td><td> gac</td><td> ggc</td><td> gtg gag</td><td> gtg</td><td> cat</td><td> aat</td><td> gcc</td>

<td> Glu 295</td><td> Val</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Trp 300</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td><td> Val Glu 305</td><td> Val</td><td> His</td><td> Asn</td><td> Ala 310</td>

<td> aag</td><td> aca</td><td> aag</td><td> cca</td><td> egg</td><td> gag</td><td> gag</td><td> cag</td><td> ttc</td><td> aac</td><td> age acg</td><td> ttc</td><td> cgt</td><td> gtg</td><td> gtc</td>

<td> Lys</td><td> Thr</td><td> Lys</td><td> Pro</td><td> Arg 315</td><td> Glu</td><td> Glu</td><td> Gin</td><td> Phe</td><td> Asn 320</td><td> Ser Thr</td><td> Phe</td><td> Arg</td><td> Val 325</td><td> Val</td>

<td> age</td><td> gtc</td><td> etc</td><td> acc</td><td> gtt</td><td> gtg</td><td> cac</td><td> cag</td><td> gac</td><td> tgg</td><td> etg aac</td><td> ggc</td><td> aag</td><td> gag</td><td> tac</td>

<td> Ser</td><td> Val</td><td> Leu</td><td> Thr 330</td><td> Val</td><td> Val</td><td> His</td><td> Gin</td><td> Asp 335</td><td> Trp</td><td> Leu Asn</td><td> Gly</td><td> Lys 340</td><td> Glu</td><td> Tyr</td>

1025

1073

1121

35-01\01370774 /1

<td colspan="3"> aag tgc aag gtc</td><td rowspan="2"> tcc Ser</td><td colspan="2"> aac aaa ggc</td><td rowspan="2"> etc Leu</td><td rowspan="2"> cca gcc Pro Ala</td><td colspan="2"> ccc ate</td><td colspan="2"> gag aaa</td><td rowspan="2"> acc Thr</td><td rowspan="2"> 1169</td>

<td> Lys</td><td> Cys</td><td> Lys Val 345</td><td> Asn Lys</td><td> Gly 350</td><td> Pro</td><td> lie 355</td><td> Glu</td><td> Lys</td>

<td> ate</td><td> tcc</td><td> aaa acc</td><td> aaa</td><td> ggg cag</td><td> ccc</td><td> ega</td><td> gaa cca</td><td> cag</td><td> gtg</td><td> tac</td><td> acc</td><td> etg</td><td> 1217</td>

<td> lie</td><td> Ser</td><td> Lys Thr</td><td> Lys</td><td> Gly Gin</td><td> Pro</td><td> Arg</td><td> Glu Pro</td><td> Gin</td><td> Val</td><td> Tyr</td><td> Thr</td><td> Leu</td><td></td>

<td></td><td> 360</td><td></td><td></td><td> 365</td><td></td><td></td><td></td><td> 370</td><td></td><td></td><td></td><td></td><td></td>

<td> ccc</td><td> cca</td><td> tcc egg</td><td> gag</td><td> gag atg</td><td> acc</td><td> aag</td><td> aac cag</td><td> gtc</td><td> age</td><td> etg</td><td> acc</td><td> tgc</td><td> 1265</td>

<td> Pro</td><td> Pro</td><td> Ser Arg</td><td> Glu</td><td> Glu Met</td><td> Thr</td><td> Lys</td><td> Asn Gin</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td></td>

<td> 375</td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td>

<td> etg</td><td> gtc</td><td> aaa ggc</td><td> ttc</td><td> tac ccc</td><td> age</td><td> gac</td><td> ate gcc</td><td> gtg</td><td> gag</td><td> tgg</td><td> gag</td><td> age</td><td> 1313</td>

<td> Leu</td><td> Val</td><td> Lys Gly</td><td> Phe</td><td> Tyr Pro</td><td> Ser</td><td> Asp</td><td> lie Ala</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu</td><td> Ser</td><td></td>

<td></td><td></td><td></td><td> 395</td><td></td><td></td><td></td><td> 400</td><td></td><td></td><td></td><td> 405</td><td></td><td></td>

<td> aat</td><td> ggg</td><td> cag ccg</td><td> gag</td><td> aac aac</td><td> tac</td><td> aag</td><td> acc aca</td><td> cct</td><td> ccc</td><td> atg</td><td> etg</td><td> gac</td><td> 1361</td>

<td> Asn</td><td> Gly</td><td> Gin Pro</td><td> Glu</td><td> Asn Asn</td><td> Tyr</td><td> Lys</td><td> Thr Thr</td><td> Pro</td><td> Pro</td><td> Met</td><td> Leu</td><td> Asp</td><td></td>

<td></td><td></td><td> 410</td><td></td><td></td><td></td><td> 415</td><td></td><td></td><td></td><td> 420</td><td></td><td></td><td></td>

<td> tcc</td><td> gac</td><td> ggc tcc</td><td> ttc</td><td> ttc etc</td><td> tac</td><td> age</td><td> aag etc</td><td> acc</td><td> gtg</td><td> gac</td><td> aag</td><td> age</td><td> 1409</td>

<td> Ser</td><td> Asp</td><td> Gly Ser</td><td> Phe</td><td> Phe Leu</td><td> Tyr</td><td> Ser</td><td> Lys Leu</td><td> Thr</td><td> Val</td><td> Asp</td><td> Lys</td><td> Ser</td><td></td>

<td></td><td></td><td> 425</td><td></td><td></td><td> 430</td><td></td><td></td><td></td><td> 435</td><td></td><td></td><td></td><td></td>

<td> agg</td><td> tgg</td><td> cag cag</td><td> ggg</td><td> aac gtc</td><td> ttc</td><td> tea</td><td> tgc tcc</td><td> gtg</td><td> atg</td><td> cat</td><td> gag</td><td> get</td><td> 1457</td>

<td> Arg</td><td> Trp</td><td> Gin Gin</td><td> Gly</td><td> Asn Val</td><td> Phe</td><td> Ser</td><td> Cys Ser</td><td> Val</td><td> Met</td><td> His</td><td> Glu</td><td> Ala</td><td></td>

35-01\01370774 /1

440 445 450 ctg cac aac cac tac acg

Leu His Asn His Tyr Thr

455 460 cag aag age etc tee

Gin Lys Ser Leu Ser ctg tet ccg ggt aaa 1505

Leu Ser Pro Gly Lys tga gtgccacggc cggcaagccc ccgctcccca ggctctcggg gtegegtgag 1558 gatgettgge acgtaccccg tgtacatact tcccaggcac ccagcatgga aataaagcac 1618 ccagcgctgc cctgggcccc tgcgaaaaaa aaaaaaaaaa aatctctgcg geege

1673 <210> 36 <211> 470 <212> PRT <213> Homo sapiens <400> 36

Met Glu Leu Gly Leu Ser Trp Vai Phe Leu Vai Ala lie Leu Glu Gly

1015

Vai Gin Cys Glu Vai Gin Leu Vai Glu Ser Gly Gly Gly Leu Vai Gin

2530

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe

4045

Ser Ser Tyr Asp Met His Trp Vai Arg Gin Ala Thr Gly Lys Gly Leu

35-01\01370774 /1

<td> 50</td><td> 55</td><td> 60</td>

<td> Glu Trp Val Ser</td><td> Ala He Gly Thr Ala</td><td> Gly Asp Thr Tyr Tyr Pro Gly</td>

<td> 65</td><td> 70</td><td> 75 80</td>

<td> Ser Val Lys Gly</td><td> Arg Phe Thr lie Ser</td><td> Arg Glu Asn Ala Lys Asn Ser</td>

<td></td><td> 85</td><td> 90 95</td>

<td> Leu Tyr Leu Gin</td><td> Met Asn Ser Leu Arg</td><td> Ala Gly Asp Thr Ala Val Tyr</td>

<td> 100</td><td> 105</td><td> 110</td>

<td> Tyr Cys Val Arg</td><td> Asp Lys Arg Thr Val</td><td> Thr His Glu His Tyr Tyr Tyr</td>

<td> 115</td><td> 120</td><td> 125</td>

<td> Tyr Gly Met Asp</td><td> Val Trp Gly Gin Gly</td><td> Thr Thr Val Thr Val Ser Ser</td>

<td> 130</td><td> 135</td><td> 140</td>

<td> Ala Ser Thr Lys</td><td> Gly Pro Ser Val Phe</td><td> Pro Leu Ala Pro Cys Ser Arg</td>

<td> 145</td><td> 150</td><td> 155 160</td>

<td> Ser Thr Ser Glu</td><td> Ser Thr Ala Ala Leu</td><td> Gly Cys Leu Val Lys Asp Tyr</td>

<td></td><td> 165</td><td> 170 175</td>

<td> Phe Pro Glu Pro</td><td> Val Thr Val Ser Trp</td><td> Asn Ser Gly Ala Leu Thr Ser</td>

<td> 180</td><td> 185</td><td> 190</td>

<td> Gly Val His Thr</td><td> Phe Pro Ala Val Leu</td><td> Gin Ser Ser Gly Leu Tyr Ser</td>

<td> 195</td><td> 200</td><td> 205</td>

<td> Leu Ser Ser Val</td><td> Val Thr Val Pro Ser</td><td> Ser Asn Phe Gly Thr Gin Thr</td>

<td> 210</td><td> 215</td><td> 220</td>

<td> Tyr Thr Cys Asn</td><td> Val Asp His Lys Pro</td><td> Ser Asn Thr Lys Val Asp Lys</td>

<td> 225</td><td> 230</td><td> 235 240</td>

<td> Thr Val Glu Arg</td><td> Lys Cys Cys Val Glu</td><td> Cys Pro Pro Cys Pro Ala Pro</td>

<td></td><td> 245</td><td> 250 255</td>

<td> Pro Val Ala Gly</td><td> Pro Ser Val Phe Leu</td><td> Phe Pro Pro Lys Pro Lys Asp</td>

5-01\01370774 /1

<td colspan="2"> Thr Leu Met</td><td rowspan="2"> lie Ser</td><td rowspan="2"> Arg Thr Pro 280</td><td rowspan="2"> Glu Val Thr Cys</td><td rowspan="2"> Val 285</td><td rowspan="2"> Val</td><td rowspan="2"> Val</td><td rowspan="2"> Asp</td>

<td></td><td> 275</td>

<td> Val Ser</td><td> His</td><td> Glu Asp</td><td> Pro Glu Val</td><td> Gin Phe Asn Trp</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td>

<td> 290</td><td></td><td></td><td> 295</td><td> 300</td><td></td><td></td><td></td><td></td>

<td> Val Glu</td><td> Val</td><td> His Asn</td><td> Ala Lys Thr</td><td> Lys Pro Arg Glu</td><td> Glu</td><td> Gin</td><td> Phe</td><td> Asn</td>

<td> 305</td><td></td><td></td><td> 310</td><td> 315</td><td></td><td></td><td></td><td> 320</td>

<td> Ser Thr</td><td> Phe</td><td> Arg Val</td><td> Val Ser Val</td><td> Leu Thr Val Val</td><td> His</td><td> Gin</td><td> Asp</td><td> Trp</td>

<td></td><td></td><td> 325</td><td></td><td> 330</td><td></td><td></td><td> 335</td><td></td>

<td> Leu Asn</td><td> Gly</td><td> Lys Glu</td><td> Tyr Lys Cys</td><td> Lys Val Ser Asn</td><td> Lys</td><td> Gly</td><td> Leu</td><td> Pro</td>

<td></td><td></td><td> 340</td><td></td><td> 345</td><td></td><td> 350</td><td></td><td></td>

<td> Ala Pro</td><td> He</td><td> Glu Lys</td><td> Thr He Ser</td><td> Lys Thr Lys Gly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu</td>

<td></td><td> 355</td><td></td><td> 360</td><td></td><td> 365</td><td></td><td></td><td></td>

<td> Pro Gin</td><td> Val</td><td> Tyr Thr</td><td> Leu Pro Pro</td><td> Ser Arg Glu Glu</td><td> Met</td><td> Thr</td><td> Lys</td><td> Asn</td>

<td> 370</td><td></td><td></td><td> 375</td><td> 380</td><td></td><td></td><td></td><td></td>

<td> Gin Val</td><td> Ser</td><td> Leu Thr</td><td> Cys Leu Val</td><td> Lys Gly Phe Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td><td> He</td>

<td> 385</td><td></td><td></td><td> 390</td><td> 395</td><td></td><td></td><td></td><td> 400</td>

<td> Ala Val</td><td> Glu</td><td> Trp Glu</td><td> Ser Asn Gly</td><td> Gin Pro Glu Asn</td><td> Asn</td><td> Tyr</td><td> Lys</td><td> Thr</td>

<td></td><td></td><td> 405</td><td></td><td> 410</td><td></td><td></td><td> 415</td><td></td>

<td> Thr Pro</td><td> Pro</td><td> Met Leu</td><td> Asp Ser Asp</td><td> Gly Ser Phe Phe</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Lys</td>

<td></td><td></td><td> 420</td><td></td><td> 425</td><td></td><td> 430</td><td></td><td></td>

<td> Leu Thr</td><td> Val</td><td> Asp Lys</td><td> Ser Arg Trp</td><td> Gin Gin Gly Asn</td><td> Val</td><td> Phe</td><td> Ser</td><td> Cys</td>

<td></td><td> 435</td><td></td><td> 440</td><td></td><td> 445</td><td></td><td></td><td></td>

<td> Ser Val</td><td> Met</td><td> His Glu</td><td> Ala Leu His</td><td> Asn His Tyr Thr</td><td> Gin</td><td> Lys</td><td> Ser</td><td> Leu</td>

<td> 450</td><td></td><td></td><td> 455</td><td> 460</td><td></td><td></td><td></td><td></td>

<td> Ser Leu</td><td> Ser</td><td> Pro Gly</td><td> Lys</td><td></td><td></td><td></td><td></td><td></td>

35-01\01370774 /1

465 470 <210> 37 <211> 970 <212> DNA <213> Homo sapiens <220>

<221> 5'UTR <222> (1) . . (32) <220>

<221> CDS <222> (33).(743) <220>

<221> 3'UTR <222> (744).(970) <220>

<221> sig_peptide <222> (33). . (92) <400> 37

35-01)01370774 /2 gaattcgcag tgccatgaca ccacggggaa cc atg gaa acc cca gcg cag ctt 53

Met Glu Thr Pro Ala Gin Leu

5

<td> etc</td><td> ttc</td><td> etc</td><td> etg</td><td> eta</td><td> etc</td><td> tgg</td><td> etc</td><td> cca</td><td> gat</td><td> acc</td><td> acc</td><td> gga</td><td> gaa</td><td> att</td><td> gtg</td><td> 101</td>

<td> Leu</td><td> Phe</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Trp</td><td> Leu</td><td> Pro</td><td> Asp</td><td> Thr</td><td> Thr</td><td> Gly</td><td> Glu</td><td> He</td><td> Val</td><td></td>

<td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td><td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td>

<td> ttg</td><td> acg</td><td> cag</td><td> tet</td><td> cca</td><td> ggc</td><td> acc</td><td> etg</td><td> tet</td><td> ttg</td><td> tet</td><td> cca</td><td> ggg</td><td> gaa</td><td> aga</td><td> gcc</td><td> 149</td>

<td> Leu</td><td> Thr 25</td><td> Gin V</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Thr 30</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Pro 35</td><td> Gly</td><td> Glu</td><td> Arg</td><td> Ala</td><td></td>

<td> acc</td><td> etc</td><td> tcc</td><td> tgc</td><td> agg</td><td> gcc</td><td> agt</td><td> ' cag</td><td> agt</td><td> att</td><td> age</td><td> age</td><td> age</td><td> tcc</td><td> tta</td><td> gcc</td><td> 197</td>

<td> Thr</td><td> Leu</td><td> Ser</td><td> Cys</td><td> Arg</td><td> Ala</td><td> Ser</td><td> Gin</td><td> Ser</td><td> He</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Leu</td><td> Ala</td><td></td>

<td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td>

<td> tgg</td><td> tac</td><td> cag.</td><td> cag</td><td> aaa</td><td> cct</td><td> ggc</td><td> cag</td><td> get</td><td> ccc</td><td> ggg</td><td> etc</td><td> etc</td><td> ate</td><td> ttt</td><td> ggt</td><td> 245</td>

<td> Trp</td><td> Tyr</td><td> Gin</td><td> Gin</td><td> Lys</td><td> Pro</td><td> Gly</td><td> Gin</td><td> Ala</td><td> Pro</td><td> Gly</td><td> Leu</td><td> Leu</td><td> He</td><td> Phe</td><td> Gly</td><td></td>

<td> -</td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td>

<td> gca</td><td> tcc</td><td> age</td><td> agg</td><td> gcc</td><td> act</td><td> ggc</td><td> ate</td><td> cca</td><td> gac</td><td> agg</td><td> ttc</td><td> agt</td><td> ggc</td><td> agt</td><td> ggg</td><td> 293</td>

<td> Ala</td><td> Ser</td><td> Ser</td><td> Arg</td><td> Ala</td><td> Thr</td><td> Gly</td><td> He</td><td> Pro</td><td> Asp</td><td> Arg</td><td> Phe</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td></td>

<td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td>

<td> tet</td><td> ggg</td><td> aca</td><td> gac</td><td> ttc</td><td> act</td><td> etc</td><td> acc</td><td> ate</td><td> age</td><td> aga</td><td> etg</td><td> gag</td><td> ept</td><td> gaa</td><td> gat</td><td> 341</td>

Ser Gly Thr Asp Phe Thr Leu Thr He Ser Arg Leu Glu Pro Glu Asp /1

<td></td><td> 90</td><td> 95</td><td> 100</td>

<td> ttt gca</td><td> gtg tat</td><td> tac tgt cag cag ttt</td><td> ggt age tea cct atg tgc agt 389</td>

<td> Phe Ala 105</td><td> Val Tyr</td><td> Tyr Cys Gin Gin Phe HO</td><td> Gly Ser Ser Pro Met Cys Ser 115</td>

<td> ttt ggc</td><td> cag ggg</td><td> acc aag etg gag ate</td><td> aaa ega act gtg get gca cca 437</td>

<td> Phe Gly 120</td><td> Gin Gly</td><td> Thr Lys Leu Glu He 125</td><td> Lys Arg Thr Val Ala Ala Pro 130 135</td>

<td> tet gtc</td><td> ttc ate</td><td> ttc ccg cca tet gat</td><td> gag cag ttg aaa tet gga act 485</td>

<td> Ser Val</td><td> Phe He</td><td> Phe Pro Pro Ser Asp ׳ 140</td><td> Glu Gin Leu Lys Ser Gly Thr 145 150</td>

<td> gcc tet</td><td> gtt gtg</td><td> tgc etg etg aat aac</td><td> ttc tat ccc aga gag gcc aaa 533</td>

<td> Ala Ser</td><td> Val Val 155</td><td> Cys Leu Leu Asn Asn 160</td><td> Phe Tyr Pro Arg Glu Ala Lys 165</td>

<td> gta cag</td><td> tgg aag</td><td> gtg gat aac gcc etc</td><td> caa teg ggt aac tee cag gag 581</td>

<td> Val Gin</td><td> Trp Lys 170</td><td> Val Asp Asn Ala Leu 175</td><td> Gin Ser Gly Asn Ser Gin Glu 180</td>

<td> agt gtc</td><td> aca gag</td><td> cag gac age aag gac</td><td> age acc tac age etc age age 629</td>

<td> Ser Val 185</td><td> Thr Glu</td><td> Gin Asp Ser Lys Asp 190</td><td> Ser Thr Tyr Ser Leu Ser Ser .195</td>

35-01)01370774 /1

<td rowspan="2"> acc Thr 200</td><td rowspan="2"> etg Leu</td><td rowspan="2"> acg Thr</td><td rowspan="2"> etg Leu</td><td colspan="7"> age aaa gca gac tac gag aaa cac aaa gtc</td><td rowspan="2"> tac Tyr</td><td rowspan="2"> gcc Ala 215</td><td rowspan="2"> 677</td>

<td> Ser</td><td> Lys Ala Asp 205</td><td> Tyr</td><td> Glu Lys 210</td><td> His</td><td> Lys</td><td> Val</td>

<td> tgc</td><td> gaa</td><td> gtc</td><td> acc</td><td> cat</td><td> cag ggc etg</td><td> age</td><td> teg ccc</td><td> gtc</td><td> aca</td><td> aag</td><td> age</td><td> ttc</td><td> 725</td>

<td> Cys</td><td> Glu</td><td> Val</td><td> Thr</td><td> His</td><td> Gin Gly Leu</td><td> Ser</td><td> Ser Pro</td><td> Val</td><td> Thr</td><td> Lys</td><td> Ser</td><td> Phe</td><td></td>

<td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td> 225</td><td></td><td></td><td></td><td> 230</td><td></td><td></td>

aac agg gga gag tgt tag agggagaagt gcccccacct gctcctcagt773

Asn Arg Gly Glu Cys tccagcctga ccccctccca tcctttggcc tctgaccctt tttccacagg ggacctaccc833 ctattgcggt cctccagctc atctttcacc tcacccccct cctcctcctt ggctttaatt893 atgctaatgt tggaggagaa tgaataaata aagtgaatct ttgcaaaaaa aaaaaaaaaa953 aaaatctctg cggccgc970 <210> 38 <211> 236 <212> PRT <213> Homo sapiens

35-01X01370774

- 147448/2 <400> 38

Met Glu Thr Pro Ala Gin Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro

1015

Asp Thr Thr Gly Glu lie Vai Leu Thr Gin Ser Pro Gly Thr Leu Ser

2530

Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gin Ser

4045 lie Ser Ser Ser Ser Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ala

5560

Pro Gly Leu Leu lie Phe Gly Ala Ser Ser Arg Ala Thr Gly lie Pro

70 7580

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr He

9095