Lymphotoxin nucleic acid encoding it vectors incorporating the nucleic acid and cells transformed therewith and methods of obtaining lymphotoxin
47 claims: 15 independent, 32 dependent
- 1WE CLAIM :1. A recombinant nucleic acid construct comprising: (i) nucleic acid encoding lymphotoxin as depicted in Fig. 2A hereof, or (ii) nucleic acid as obtainable by hybridization with that depicted in Fig. 2A hereof, and encoding a, lymphotoxin polypeptide: or (iii) nucleic acid encoding a lymphotoxin polypeptide which has substanlial structural homology with at least a portion of the lymphotoxin amino acid sequence depicted in Fig. 2A hereof;said lymphotoxin polypeptide in (ii) or (iii) displaying preferential cytotoxic activity of, and/or immunological cross-reactivity with, and/or the ability to compete for lymphotoxin cell surface receptors with, cytotoxic lymphotoxin.
- 4A recombinant nucleic acid construct according to any one of claims 1. 2 and 3 wherein the lymphotoxin amino acid sequence encoded differs from that of Fig. 2A by virtue of amino acid deletion, substitution or insertion.
- 5A recombinant nucleic acid construct according to any one of claims 14־ wherein said nucleic acid encodes leucyl amino-terminal lymphotoxin.
- 6A recombinant nucleic acid construct according to any one of claims 15־ wherein said nucleic acid encodes a human allele of the Fig. 2A sequence.
- 7A recombinant nucleic acid construct according to any one of claims 15־ wherein the nucleic acid encodes a non-human animal lymphotoxin.
- 12A recombinant nucleic acid construct according to claim It wherein said site comprises lys־lys or lysarg.
- 32A recombinant nucleic acid construct according to any one of the preceding claims, in the lorm of a replicable vector.
- 40A method according to daim 39 wherein the cell is a yeast or a non-human mammalian cell, said nucleic acid encodes human prelymphotoxin, and lymphotoxin having variant glycosylation with respect 10 to lymphotoxin produced in homologous cellsis recovered from the culture.
- 41A method according to daim 39 wherein the cell is a prokaryote.
- 42A polypeptide as obtainable by the method of any one of claims 39 to 41, which is unglycosylated or is has variant glycosylation with respect to lymphotoxin produced in homologous cells, and which displays preferential cytotoxic activity of cytotoxic lymphotoxin and/or the ability to compete with cytotoxic lymphotoxin for lymphotoxin cell surface receptors.
- 46A diagnostic or screening probe (or lymphotoxin nucleic acid comprising nucleic add which is hybridizable with the nucleic add depicted in Fig. 2A hereof, and covalently labelled with a detectable 30 substance. 4
Independent claims15
269 paragraphs in 34 sections, as filed
Background
This application was divided from IL 75318 and relates to variant lymphokines. In particular, it relates to variant lymphotoxin and derivatives thereof. More particularly, It relates to a recombinant nucleic acid construct encoding lymphotoxin.
Lymphotoxin was first identified as a biological factor with anticellular activity on neoplastic cell lines. An activity identified as lymphotoxin and obtained from mitogen-stimulated lymphocytes is associated with a spectrum of cytotoxic activities ranging from cytostasis of certain tumor cell lines to marked cytolysis of other transformed cells. However, lymphotoxin activity is characterized by little or no anticellular activity on primary cell cultures and normal cell lines tested. This putative ______ discriminating anticellular property of lymphotoxin led to in vivo studies which suggest that lymphotoxin may have a potent antitumor activity.
Lymphotoxin is the term applied to what has been described as a family of molecules. Lymphotoxin molecules have been
F:\11000\0\25483 identified as glycoproteins divided into five molecular weight classes, each of which in turn is heterogenous with respect to charge. The human alpha (MW 70-90,000) and beta (MW 25-50,000) classes appear to predominate in most lymphocyte supernatants. The alpha MW classes can be separated by charge into at least seven subclasses, while the beta subclass has been separated into two distinct subclasses (G. Granger et ab <sup>1n</sup> Mozes et ab, Ed., 1981, Cellular Responses to Molecular Modulators pp 287-310). Also identified have been complex (MW >200,000) and gamma (MW 10-20,000) lymphotoxin forms. The various lymphotoxin forms and classes differ from one another in their stability and kinetics of appearance in culture. Furthermore, they may aggregate together with the complex class under conditions of low ionic strength. The lower molecular weight classes of lymphotoxins have been disclosed to be relatively unstable and weakly cell lytic compared to the higher molecular weight classes (Hiserodt et ab, 1976, Cell. Immun. 26: 211; Granger et ab in De Week et ab Ed., 1980 Biochemical Characterization of Lymphokines pp 279-283). Gamma class activity has not been studied extensively because of its instability (G. Granger etab, 1978 Cellular Immunology 38: 388-402). The beta class also has been reported to be unstable (Walker etab, J. of Immun. 116[3]: 807-815 [March 1976]).
It should be understood that lymphokine terminology is not uniform. At present, the names given to cell culture products are largely a function of the cells which are believed to elaborate the product and the performance of the products in biological assays. However, these products remain poorly characterized in large measure because many studies have been conducted with partially pure preparations and because the assays used to characterize the products are not molecule-specific and in any case are subject to considerable variation. The true identity of the various cytotoxic factors will remain unknown in the absence of standard terminology based on clearly assayable distinguishing characteristics such as amino acid sequences or immune epitopes. As examples of other names
3499Y given to cytotoxic cell culture products are tumor necrosis factor,
NK cell cytotoxic factor, hemorrhagic necrosis factor and macrophage cytotoxin or cytotoxic factor.
Copending and commonly assigned U.S. Patent No. 4,920,196, and EP 100.641A (published Feb. 15, 1984) describe amino acid sequences for a human lymphotoxin isolated from the human lymphoblastoid cell line RPMI-1788.
Hayashi et al_., EP 132.125A (published Jan. 23, 1985) describe recovering a protein from a rabbit following stimulation of its reticuloendothelial system. The protein was reported to have antitumor activity and the N-terminal amino acid sequence Ser-Ala-Ser-Arg-Ala-Leu-Ser-Asp-Lys-Pro-Leu-Ala-His-Val-Val-Ala-Asn15 Pro-Gln-Val-G1u-Gly-Gln-Seu-Gln-Trp-Leu.
Copending and commonly assigned U.S. Patent No. 4,650,674, discloses the purification and recombinant synthesis of a cytotoxic human polypeptide identified as tumor necrosis factor 20 and having the N-terminal amino acid sequence Val-Arg-Ser-Ser-SerArg־Thr-Pro-Ser-Asp־Lys-Pro-Val־Ala-His-Val-Val-Ala-Asn-Pro.
Ohnishi et al. (U.S. Patent 4,481,137) discloses obtaining a 7-9,000 MW substance named 0Β<sub>χ3</sub> from BALL-1 cell culture that suppresses the growth of tumor cells and that has an Ala-Ala N-terminus.
According to Toth and Granger, Mol. Immun. 16: 671-679 (1979), neither the removal of sialic acid from lymphotoxin30 containing lymphocyte supernatants by neuraminodase treatment nor the addition of N-acetyl-glucosamine, galactose, lactose, mannose, a-methyl-mannoside or fucose to the supernatants had any affect on <sup>1n</sup> vitro lytic activity. Toth et al_. thus concluded that simple sugars do not appear to play a role in the activity of their lymphotoxin. However, Toth et ab also observe that saccharides
3499Y
V play an important role in the action of other lymphokines and concluded that they could not exclude the participation of more complicated forms of oligo saccharides in the cytotoxic activity of
1ymphotoxi n.
Subsequently, Proctor, KIostergaard and Granger (Clinical Research, 1982, 30(1): 55A) reported that human lymphocytes, when activated by PHA in the presence of tunicamycin (to inhibit the addition of N-linked carbohydrate moieties to lymphotoxin 10 molecules), released biologically inert lymphotoxin. According to these authors, immunochemical studies revealed that while the carbohydrate moiety of lymphotoxin was not needed for its transport and release by the activated lymphocyte into the supernatant, the carbohydrate was needed in order to have effective target cell 15 destruction because the carbohydrate was responsible for the appropriate conformation of the lymphotoxin molecule(s).
rwa 1 (וי. 1י I ., ___Chem, 253.1 G87-691 (1984), .111(1 El’ 1 , (JOO, 64 I describe the purification oC I yiiipliotox i 11 from a human iymphoblastoid cell line. CAl.uo: 1.19,136x describee a lymphotoxin preparation purified from Syrian hamster. Belgian Patent Application 090,016 ((.'Λ 1 0 1 :1 84 82) describes the preparation of variant pi 01:0 i n!1 by protein engineering techniques .
Other literature that should be studied in connection with this application includes Evans, Cancer Immunol. Immunother. 12: 20 181-190 (1982); Lee et ak, Cell. Immun. 48: 166-181 (1979);
De Week et al. Ed., (1980) Biochemical Characterization of Lymphokines pp 279-312; Khan et al. Ed. (June 30, 1982) Human Lymphokines pp 459-477; Aggarwal et al., Presentation at the 3rd International Lymphokine workshop in Haverford, PA., August 1-5
1982; Ransomet a£., Cancer Research £3: 5222-5227 (Nov. 1983);
Kull etak, J. of Immun. 126(4): 1279-1283 (April 1981); J.
Sawada, et al., Jpn. J. Exp. Med. 46: 263-267 ( 1976); G. Granger et al., Cell. Immunol. 3B: 388-402 (1978); J. Rundel1 et al., Immunopharmacology £; 9-18 (1981); G. Granger et al., J.
Lymphokine Res. £: 45-49 (1982); N. Ruddle et al., Lymphokine
Res. J2: 23-31 (1983); M. Mitsuhashi et al., U.K. Patent Application 2,106,117; II. Enomoto, European Patent Application 87.087A; B.
Wil 1iamson et ak, P.N.A.S. USA 80:5397-5401 ( 1983) and S. Wright etak, J. Immunol. 126: 1516-1521 (1981).
.Μ00Υ
The lymphotoxin (or substances identified as lymphotoxin) obtained heretofore from lymphocyte culture are present in low concentrations, on the order of 0.05-2xl0<sup>6</sup> units/1 in supernatants of RPMI-1788 cells or primary lymphocytes. The amounts harvested 5 often vary considerably, and primary lymphocytes are expensive. An economical method for producing lymphotoxin is needed (Yamamoto et al., J. of Biological Response Modifiers [1] 76-87 [1984]).
Prior methods also fail to produce lymphotoxin which is 0ן homogeneous as to amino acid sequence, an important feature for drug utilities. Lymphotoxin recovered from cell line culture exhibits amino terminal heterogeneity, probably due to proteolytic processing.
Cultures of primary lymphocytes, e.g. from adenoids or peripheral blood, must 15 necessarily contain the cells of many donors for reasons of econoiny. However, the products of these cells will reflect genetic variation among the donors so that the resulting lymphotoxin may in fact be a mixture of allelic species. Obviously, the proportions and identities of such alleles will be unknown from lot-to-lot. A 20 method is needed for producing lymphotoxin that is uniform as to its amino acid sequence.
Prior methods also are limited to the production of lymphotoxin having primary amino acid sequences corresponding to 25 those found in nature. Substituting, deleting or inserting different amino acids in these sequences would require extensive and costly chemical modifications, if such could be accomplished at all. Methods are needed for easily introducing variations into the amino acid sequences of lymphotoxin.
Although the antitumor effects and apparent therapeutic value of lymphotoxin activity have been reported in the literature since 1968, lymphotoxin has not been studied in extensive clinical protocols or commercialized due to the small quantities and <sup>35</sup> heterogenous nature of the lymphotoxin made available through prior
3499Y methods. Methods are needed to economically prepare quantities of lymphotoxin adequate for clinical studies.
Rabbit antisera has been described in the literature which is capable of neutralizing the cytolytic activity of various cytotoxins, including substances identified as lymphotoxin (Yamamoto eta!. Cell. Immun. 38: 403-416 (1978); Gatelyetab, Cell. Immun. 27: 82-93 (1976); Hiserodt et al., J. of Immun. 119(2): 374-380 (1977); Zacharchuk et £1_., P.N.A.S. USA 80: 6341-6345 (October 1983); Ruddle et al., Lymphokine Research 2U) 23-31 (1983); Manne! et ab, Infection and Immunity 33(1): 156-164 (1981); Wallach et£b E. De Maeyer et ab Ed. The Biology of the Interferon System pp 293-302 (Pub. September 1983) and Stone-Wolff et ab, J. Exp. Med. 159: 828-843 (March 1984). Since this antisera is polyclonal it contains a multiplicity of antibodies directed against the immunogen lymphotoxin. Any one or more of these antibodies is acting to neutralize the lymphotoxin activity. Further, the literature reports generally are unclear as to the molecular identity of the substance responsible for lymphotoxin activity that was used as the immunogen. What is needed for diagnosis and immunoaffinity purification procedures is a monospecific antibody directed against a clearly and unambiguously identified lymphotoxin molecule. It is an objective of this invention to provide such an antibody.
It is a further object herein to provide methods for economically synthesizing a lymphotoxin form in a composition wherein the primary amino acid sequence of substantially all of the lymphotoxin molecules is the same.
It is another object to produce predetermined variations in the amino acid sequence of a lymphotoxin form, more specifically, amino acid deletions, insertions, substitutions, or combinations thereof.
3499Y
-רSummary of the Invention
The objectives of this invention have been accomplished by 5 the successful recombinant expression of protein having lymphotoxin activity. This lymphotoxin species, which is described herein in terms of its activity and natural or variant amino acid sequence, is henceforth referred to as lymphotoxin. Surprisingly, the DNA encoding lymphotoxin has been identified notwithstanding the minute 10 levels of lymphotoxin expressed in homologous cells and uncertainty as to the time at which messenger RNA encoding lymphotoxin appears in homologous“celIs. Also surprisingly, biologically active lymphotoxin is expressed in recombinant cells that do not glycosylate the lymphotoxin (or that would not be expected to do so 15 in the same fashion as homologous cells) and the lymphotoxin so expressed is recovered having a substantially uniform amino acid sequence, without N-terminal enzymatic hydrolysis. DNA encoding lymphotoxin is expressed in cell cultures in copious quantities exceeding 0.1 to IxlO^<sup>1</sup> units/1iter of culture lysate.
The lymphotoxin that is expressed by a recombinant host cell will depend upon the DNA employed to encode the lymphotoxin or its precursors as well as upon the host cell selected. The nucleic acid sequences employed herein for lymphotoxin synthesis are novel. 25 They are characterized by nucleotide sequences that differ from the native or natural sequence in one or more of the following ways: The DNA is free of introns, in the case of human lymphotoxin the intron present between nucleotides 284 and 285 (Fig. 2a); the DNA is free of nucleic acid encoding other proteins of the organism from 30 which the DNA originated; the nucleic acid encoding lymphotoxin is ligated into a vector; and/or the nucleic acid is capable of hybridizing to nucleic acid encoding lymphotoxin provided, however, that such hybridizing nucleic acid does not have the nucleotide sequence of natural DNA or RNA encoding lymphotoxin.
3499Y
־8־
Mutant nucleic acids encoding lymphotoxin are the product of recombinant manipulations. Silent mutations in the 5' untranslated or translated nucleic acid for lymphotoxin are provided in order to enhance expression levels in selected hosts, e.g. by reducing the probability of stem-and-loop messenger RNA structures in the 5' regions of the nucleic acid, or by substituting host-preferred codons for those found in natural nucleic acid isolates.
Mutations in the nucleic acids which are expressed rather than silent enable the preparation of lymphotoxin species having the amino acid sequence of native lymphotoxin or primary sequence variants thereof with amino acid sequences differing from the native lymphotoxin. The mutant lymphotoxin is recovered as such or is further processed by the host cell to obtain the desired lymphotoxin species.
These nucleic acids or nucleic acids that hybridize therewith, or fragments thereof, are labelled and used in hybridization assays for the identification or determination of genetic material encoding lymphotoxin.
In processes for the synthesis of lymphotoxin, DNA which encodes lymphotoxin is ligated into a vector, the vector used to transform host cells, the host cells cultured and lymphotoxin recovered from the culture. This general process is used to synthesize lymphotoxin having the amino acid sequence of native lymphotoxin or to construct novel lymphotoxin variants, depending upon vector construction and the host cell chosen for transformation. The lymphotoxin species which are capable of synthesis herein include leucyl amino-terminal lymphotoxin, histidyl amino-terminal lymphotoxin, pre lymphotoxin, and lymphotoxin variants including (a) fusion proteins wherein a heterologous protein or polypeptide is linked by a peptide bond to the amino and/or carboxyl-terminal amino acids of lymphotoxin, (b) lymphotoxin
3499Y fragments, especially fragments of pre lymphotoxin in which any amino acid between -34 and +23 is the amino-terminal amino acid of the fragment, (c) lymphotoxin mutants wherein one or more amino acid residues are substituted, inserted or deleted, (d) methionyl or modified methionyl (such as formyl methionyl or other blocked methionyl species) amino-terminal derivatives, and/or (e) unglycosylated or variantly glycosylated species of all of the foregoing.
If a mammalian cell is transformed with nucleic acid encoding lymphotoxin operably ligated to a eucaryotic secretory leader (including the native lymphotoxin secretory leader), or if nucleic acid which encodes lymphotoxin is operably ligated in a vector to a procaryotic or yeast secretory leader which is recognized by the host cell to be transformed (usually the organism from which the leader sequence was obtained), the host transformed with the vector and cultured, then nonmethionylated amino terminal lymphotoxin species ordinarily are recovered from the culture.
If DNA encoding lymphotoxin is operably ligated into a vector without a secretory leader sequence and then used to transform a host cell, the lymphotoxin species which are synthesized are generally substituted with an amino-terminal methionyl or modified methionyl residue such as formyl methionyl.
Methods are provided whereby in vitro mutagenesis of the nucleic acid encoding lymphotoxin leads to the expression of lymphotoxin variants not heretofore available. First, N-terminal methionyl or modified.methionyl lymphotoxin is expressed by host cells transformed with nucleic acid encoding lymphotoxin which is directly expressed, i.e., which is not operably linked to a secretory leader sequence.
Secondly, in vitro, site-specific, predetermined or random mutagenesis is employed to introduce deletions, substitutions and/or
3499Y insertions into the nucleic acid that encodes lymphotoxin. Lymphotoxin fusions are produced in this manner. The iymphotoxin derivatives obtained upon expression of mutant nucleic acid exhibit modified characteristics.
Finally, unglycosylated or variantly glycosylated lymphotoxins are provided as novel lymphotoxin species. Ungiycosylated lymphotoxin is produced by prokaryotic expression of DNA encoding lymphotoxin. Variantly glycosylated lymphotoxin species are the product of recombinant culture in transformed higher eukaryotic, ordinarily mammalian, cells.
The lymphotoxin produced herein is purified from culture supernatants or lysates by immunoaffinity adsorption using
Insolubilized lymphotoxin-neutralizing antibody. This antibody, which is most efficiently produced in monoclonal cell culture, is raised in mice by immunization with alum-adsorbed lymphotoxin.
The lymphotoxin of this invention is combined for therapeutic use with physiologically innocuous stabilizers and excipients and prepared in sterile dosage form as by lyophilization in dosage vials or storage in stabilized aqueous preparations. Alternatively, the lymphotoxin is incorporated into a polymer matrix for implantation into tumors or surgical sites from which tumors have been excised, thereby effecting a timed-release of the lymphotoxin in a localized high gradient concentration.
The therapeutic compositions herein are administered in therapeutically effective doses by implantation, injection or 30 infusion into animals, particularly human patients, that bear malignant tumors.
3499Y
104zy//z. .
10A «γγατεμεντ OF THEJ divisional , .. _
In accordance with the presentYiHvenEron there is provided * . - —y-— ״,.^..aer־u3T:.־--recombinant nucleic add construct comprising:
(i) nucleic add encoding lymphotoxin as depicted in Rg. 2A hereof, * (ii) nucleic acid as obtainable by hybridization with that depicted in Rg. 2A hereof, and encoding a (HO niclei^ad^encoding a lymphotoxin polypeptide which has substantial structural homology with at least a portion of the lymphotoxin amino add sequence depicted in Rg. 2A hereof;
said lymphotoxin polypeptide in (ii) or (Si) displaying preferential cytotoxic activity of, andtor anmunological cross-reactivity with, and/or the ability to compete for lymphotoxin cell surface receptors with, cytotoxic lymphotoxin.
The Invention further provides a vector, a ceil, and a method .f culturing the cell, allowing lymphotoxin to accumulate and recovering the lymphotoxin provided that said lymphotoxin does not have the amino acid sequence 1 to 171 or 24 to 171 of figure 2A hereof.
Brief Description of the Drawings
Fig. la depicts a DMA sequence and its putative amino acid sequence encoding a lymphotoxin fragment.
Fig. lb demonstrates the construction of synthetic ONA encoding the Fig. la fragment.
Fig. 2a shows the complete amino acid sequence for pre lymphotoxin, its coding DNA plus 5' and 3' flanking untranslated regions.
Fig. 2b illustrates a method of constructing an expression vector for methionyl leucyl amino-terminal lymphotoxin and its amino terminal methionyl derivatives.
Fig. 3 shows a method of constructing an expression vector for methionyl histidyl amino-terminal lymphotoxin.
Fig. 4 depicts the amino acid sequences for human, murine and bovine lymphotoxin, and the consensus mammalian lymphotoxin residues.
Figs. 5a and 5b depict the construction of a plasmid encoding a fusion of lymphotoxin and a bacterial signal sequence.
ץ
Detailed Description
Lymphotoxin is defined for the purposes of this application as a biologically active polypeptide having a region demonstrating substantial structural amino acid homology with at least a portion of the lymphotoxin amino acid sequence shown in Fig. 2a. Biological activity is defined as preferential, cytotoxic activity as defined below, immunological cross-reactivity with a cytotoxic lymphotoxin or the ability to compete with cytotoxic lymphotoxin for lymphotoxin cell surface receptors. In the latter two instances the lymphotoxin need not be cytotoxic per se. Immunologically cross-reactive mutants are useful as immunogens for raising anti-lymphotoxin in
3499Y animals, e.g. for the preparation of immunoassay reagents, while non-cytotoxic competitive mutants find utility as labelled reagents in competitive-type immunoassays for biologically active lymphotoxin.
Preferential cytotoxic activity is defined as the preferential destruction or growth inhibition of tumor cells in vivo or <sup>חו</sup> vitro when compared to normal cells under the same conditions. Destruction of tumor cells by lysis in vitro or necrosis in vivo is the preferred assay endpoint, although cytostasis or antiproliferative activity also is used satisfactorily.
Suitable assays for detecting the anticellular activities of lymphotoxin are described in B. Aggarwal, et al., 1984, J. Biol. Chem. 259 (1), 686-691 and E. Carswell, et ab, 1975, Proc. Natl. Acad. Sci. USA 72, 3666-3670.
Lymphotoxin specific activity is defined herein in terms of target cell lysis, rather than cytostasis. One unit of lymphotoxin is defined as the amount required for 50 percent lysis of target cells plated in each well as is further described in Example 1. However, other methods for determining cytotoxic activity are acceptable.
Substantial structural homology generally means that greater than about 60 percent, and usually greater than about 70 percent of the amino acid residues in the polypeptide are the same or conservative substitutions for the corresponding residue(s) in the sequence of Fig. 2a.
Not all of the sequence of a lymphotoxin polypeptide need be homologous with the Fig. 2a sequence. Only a portion thereof need be homologous with any portion of the Fig. 2a sequence so long as the candidate exhibits the required biological activity. Generally, homology should be demonstrable for regions of about from 20 to 100 amino acid residues, recognizing that occasional gaps may
3499Y need to be introduced in order to maximize the homology.
Less homology is required for polypeptides to fall Within the definition if the region of homology with the Fig. 2a sequence 5 is not in one of the lymphotoxin key regions, i.e. regions that are important for cytotoxic activity. The key regions of the Fig. 2a sequence are believed to be about residues 162-171, 52-83 and 127-148.
Lymphotoxin is defined to specifically exclude human tumor necrosis factor or its natural animal analogues (D. Pennica et al_., Nature 312:20/27 December, 1984, pp. 724-729 and B. Aggarwal et al_., J. Biol. Chem. 260[4]: 2345-2354 [1985]).
5י Structurally similar refers to dominant characteristics of the amino acid side chains such as basic, neutral or acid, hydrophilic or hydrophobic, or the presence or absence of steric bulk. Substitution of one structurally similar amino acid for another generally is known in the art as a conservative substitution.
A significant factor in establishing the identity of a polypeptide as lymphotoxin is the ability of antisera which are capable of substantially neutralizing the cytolytic activity of 25 substantially homogeneous, lymphoblastoid (or natural) lymphotoxin to also substantially neutralize the cytolytic activity of the polypeptide in question. However it will be recognized that immunological identity and cytotoxic identity are not necessarily coextensive. A neutralizing antibody for the lymphotoxin of Fig. 2a 30 may not bind a candidate protein because the neutralizing antibody happens to be directed to a site on lymphotoxin that merely neighbors a region that is critical to lymphotoxin cytotoxic activity, but which acts as a neutralizing antibody by steric hinderance of the lymphotoxin active site. A candidate protein 35 mutated in this innocuous region might no longer bind the
3499Y
-Vl.
neutralizing antibody, but it would nonetheless be lymphotoxin in terms of substantial homology and biological activity.
Lymphotoxin obtained by culture of lymphoblastoid cell lines has been determined to have the following characteristics: A molecular weight of 20,000 or 25,000, depending upon the degree of glycosylation and N-terminal heterogeneity; glycosylation at Asn+62 (Fig. 2a); a tendency to aggregate, particularly to organize into multimers; an isoelectric point of about 5.8; pH lability (a loss of >50 percent of cytolytic activity when stored for 24 hours in ammonium bicarbonate buffer at 10 ug/ml concentration with pH levels less than about 5 or greater than about 10); and substantial losses in activity upon incubation in aqueous solution for 5 min. at 80״C. Two lymphoblastoid lymphotoxin molecular weight species have been identified. The 25,000 da species of lymphoblastoid lymphotoxin has an amino-terminal leucine residue. Polypeptides having the primary amino acid sequence of the 25,000 da species are called leucyl amino-terminal lymphotoxin. The 20,000 da species of lymphoblastoid lymphotoxin is characterized by an ami no-terminal histidine and corresponding sequences are termed histidyl amino-terminal lymphotoxin. It is important to observe that these characteristics describe the native or wild type human lymphotoxin obtained from lymphoblastoid cell cultures. While lymphotoxin as defined herein includes native, glycosylated lymphotoxin, other related cytotoxic polypeptides many fall within the scope of the definition. For example, the glycosylation ordinarily associated with an animal lymphotoxin may be modified upon expression in a heterologous recombinant eukaryotic host cell, thereby bringing the modified lymphotoxin outside of the molecular weights or isoelectric point established for human lymphoblastoid lymphotoxin. Lymphotoxin which is entirely unglycosylated is produced in recombinant bacterial culture with its molecular weight, isoelectric point and other characteristics correspondingly modified. In addition, post-translational processing of pre lymphotoxin from a first animal species in a cell line derived from another animal species may
3499Y result in a different amino-terminal residue than is ordinarily the case for the first animal species. Similarly, the mutagenesis procedures provided herein, for example, will enable one to vary the amino acid sequence and N-terminus of lymphotoxin, thereby modifying the pH stability, isoelectric point and the like.
The translated amino acid sequence for human lymphotoxin is described in Fig. 2a. Note that this sequence includes a 34 residue presequence which is believed to be removed during normal processing of the translated transcript in human cells (herein, together with its mutants, pre lymphotoxin), resulting in the leucyl amino terminal species. The histidyl amino-terminal species is homologous to the leucyl amino-terminal species except that the first 23 amino acids of the leucyl amino-terminal species are absent. All three species, i.e. pre lymphotoxin, leucyl amino-terminal lymphotoxin and histidyl ami no-terminal lymphotoxin, as well as their methionyl, modified methionyl, mutant and unglycosylated forms, are included within the scope of lymphotoxin. The unglycosylated leucyl and histidyl ami no-terminal species will have lower molecular weights than described above for the homologous species from lymphoblastoid cells.
Pre lymphotoxin is a species of lymphotoxin included within the foregoing definition. It is characterized by the presence of a signal (or leader) polypeptide at the amino terminus of the molecule. Generally, the native signal polypeptide of lymphotoxin is proteolytically cleaved from lymphotoxin as part of the secretory process in which the protein is secreted from the cell. The signal peptide may be microbial or mammalian (including the native, 34 residue presequence), but it preferably is a signal which is homologous to the host cell. Some signal-lymphotoxin fusions are not recognized or processed by the host cell into N-terminal met-free lymphotoxin. Such fusions containing microbial signals have utility for example as lymphotoxin immunogens.
3499Y
Note that the language capable of cytotoxic activity means that lymphotoxin includes polypeptides which can be converted, as by enzymatic hydrolysis, from an inactive state analogous to a zymogen to a polypeptide fragment which exhibits the desired <sup>5</sup> biological activity. The language capable of in vitro or in vivo cytotoxic activity is intended to embrace noncytotoxic polypeptides which can be converted, as by enzymatic hydrolysis, from an inactive state analogous to a zymogen to a polypeptide fragment which exhibits the definitional biological activity. Typically, inactive precursors will be fusion proteins in which lymphotoxin is linked by a peptide bond at its carboxyl terminus to another protein or polypeptide. The sequence at this peptide bond or nearby is selected, so as to be susceptible to proteolytic hydrolysis to release lymphotoxin, either in vivo or, as part of a manufacturing protocol, in vitro. Typical linking sequences are lys-lys or arg-lys. The nonlymphotoxin component to such a prolymphotoxin is preferably a homologous protein so as to minimize the immunogenicity of the fusion. The homologous protein should be innocuous and not bind to cell surfaces. The lymphotoxin that is so generated then will exhibit the definitionally-required cytotoxic activity.
While lymphotoxin ordinarily means human lymphotoxin, lymphotoxin from sources such as murine, porcine, equine or bovine is included within the definition of lymphotoxin so long as it 25 otherwise meets the standards described above for homologous regions and biological activity. For example, bovine and murine lymphotoxins have been found to be highly (about 80 percent) homologous with human lymphotoxin. Lymphotoxin is not species specific, e.g., human lymphotoxin is active on mouse tumors and neoplastic cell lines. Therefore, lymphotoxin from one species can be used in therapy of another.
Lymphotoxin also includes multi meric forms. Lymphotoxin spontaneously aggregates into multimers, usually dimers or higher <sup>35</sup> multimers. Multimers are cytotoxic and accordingly are suitable for
3499Y
Juse in in vivo therapy. Lymphotoxin is expressed in recombinant hosts as a monomer. However, lymphotoxin thereafter tends to spontaneously form multimers. Homogeneous multimers or a mixture of different multimers are therapeutically useful.
Variant lymphotoxins include predetermined or targeted,
i.e. site specific, mutations of the Fig. 2a molecule or its fragments. Variant lymphotoxins are defined as polypeptides otherwise meeting the defined characteristics of lymphotoxin but which are characterized by an amino acid sequence that differs from that of Fig. 2a, whether by omission, substitution or insertion of residues. The nonhuman lymphotoxins described herein, and alleles of human lymphotoxin, are to be considered variant lymphotoxins, as are site-directed mutants having no natural counterpart. The objective of mutagenesis is to construct DNA that encodes lymphotoxin as defined above but exhibits characteristics that modify the biological activity of natural lymphotoxin or facilitate the manufacture of lymphotoxin. For example, the lysine +89 codon is mutated in order to express a histidine residue in place of the lysine residue. The histidine +89 is no longer hydrolyzed by trypsin (which generally cleaves proteins at an arg-X or lys-X bond). Protease resistance is expected to confer greater biological half life on the mutant than is the case for lymphotoxin having the sequence of Fig. 2a (or a fragment thereof). Other lymphotoxin lysine or arginine residues may be mutated to histidine, for example lysine +28, lysine +19 or arginine +15.
As discussed above, certain regions of the lymphotoxin molecule exhibit substantial homology with a similarly-active protein designated tumor necrosis factor. Amino acid residues in and immediately flanking these substantially homologous regions are preferred for mutagenesis directed to identifying lymphotoxin mutants that exhibit variant biological or cytotoxic activity. Such mutants are made by methods known per se and then screened for the desired biological activity, e.g. increased cytotoxicity towards the
3499Y particular neoplasm being treated or, in the case of lymphotoxin species intended for immunization of animals, the ability to elicit a more potent immune response. Examples of such lymphotoxin.. variants are as follows: Ala+168 is mutated to a branched chain amino acid (val, ile, or leu); a hydrophobic amino acid (e.g., phe, val, ile or leu) is inserted between thr+163 and val+164; tyrosine substituted for thr+163; lysine substituted for ser+82; isoleucine, leucine, phenylalanine, valine or histidine substituted for ser+42; glutamine, tryptophan, serine or histidine substituted for lys+84; ser+82 deleted; a hydrophobic di-or tripeptide fused to leu+171; aspartic acid or lysine substituted for thr+163; ala-lys inserted between glu+127 and pro+128; lysine or glycine substituted for ser+70; tyrosine substituted for thr+69; arginine or histidine substituted for lys+28; arginine or lysine substituted for his+32; proline, serine, threonine, tyrosine or glutamic acid substituted for asp+36; tyrosine, methionine or glutamic acid substituted for ser+38; threonine, tyrosine, histidine, or lysine substituted for ser+61; aspartic acid, serine or tyrosine substituted for gly+124; arginine, lysine, tyrosine, tryptophan or proline substituted for his+135; aspartic acid substituted for thr+142; and lysine or threonine substituted for gln+146.
A particularly desirable group of mutants are those in which the methionine residues at human lymphotoxin residues +20, +120 and +133 are deleted or, preferably, substituted for by the corresponding residues found in the lymphotoxins of other species such as are described elsewhere herein. For example met+20, +120 and +133 are substituted by threonine, serine and valine, respectively. These are the corresponding residues in bovine lymphotoxin. The substitution is effected in the manner described in Example 9 except that met+133 is mutated to val by a further step of mutagenesis using M13 Mp8 phage in accord with methods known per se. This mutant animal species-hybrid lymphotoxin DNA is used in place of the leucyl amino-terminal DNA of Example 7 and expressed as a fusion. Following known procedures, cyanogen bromide is used
3499Y to cleave the STII signal from the hybrid lymphotoxin and the mature leucyl ami no-terminal lymphotoxin variant recovered.
Other useful variant lymphotoxins are those in which residues from tumor necrosis factor are substituted for corresponding lymphotoxin residues to produce hybrid tumor necrosis factor-lymphotoxin variants. A representative example is the substitution of the first 8, 9 or 10 residues of mature tumor necrosis factor (e.g., val-arg-ser-ser-ser-arg-thr-pro-ser-asp-) for the first 27 residues of leucyl amino-terminal lymphotoxin. This variant is more likely to be N-terminal demethionylated upon direct expression in £. coli.
While the mutation site is predetermined, it is unnecessary that the mutation per se be predetermined. For example, in order to optimize the performance of the mutant histidine +89 lymphotoxin, random mutagenesis is conducted at the codon for lysine +89 and the expressed lymphotoxin mutants screened for the optimal combination of cytotoxic activity and protease resistance.
Lymphotoxin also may contain insertions, usually on the order of about from 1 to 10 amino acid residues, or deletions of about from 1 to 30 residues. Substitutions, deletions, insertions or any subcombination may be combined to arrive at a final construct. Insertions include amino or carboxyl-terminal fusions, e.g. a hydrophobic extension added to the carboxyl terminus. Preferably, however, only substitution mutagenesis is conducted. Obviously, the mutations in the encoding DNA must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Extracts of L. coli transformed with vectors containing DNA encoding lymphotoxin mutants having a deletion of the last 16 carboxy terminal amino acids or deletion of the first about 33 amino terminal residues of leucyl amino-terminal lymphotoxin exhibited no cytotoxic activity. However, the reasons for lack of activity are
3499Y
-Zunot known and could have been any of those set forth in Example 1 infra.
Not all mutations in the ONA which encodes the lymphotoxin 5 will be expressed in the ultimated product of recombinant cell culture. For example, a major class of DNA substitution mutations are those DNAs in which a different secretory leader has been substituted for the Fig. 2a secretory leader, either by deletions within the 34 residue leader or by substitutions, which exchange of TO most or all of the native leader for a leader more likely to be recognized by the intended host. For example, in constructing a procaryotic expression vector the Fig. 2a secretory leader is deleted in favor of the bacterial alkaline phosphatase or heat stable enterotoxin II leaders, and for yeast the Fig. 2a leader is 15 substituted in favor of the yeast invertase, alpha factor or acid phosphatase leaders. This is not to imply, however, that the human secretory leader is not recognized by hosts other than human cell lines. When the secretory leader is recognized by the host, the fusion protein consisting of lymphotoxin and the leader ordinarily 20 is cleaved at the leader-lymphotoxin peptide bond in the same event that leads to secretion of the lymphotoxin. Thus, even though a mutant DNA is used to transform the host the resulting product lymphotoxin may be either a fused or native lymphotoxin, depending upon the efficacy of the host cell in processing the fusion.
Another major class of DNA mutants that are not expressed as lymphotoxin variants are nucleotide substitutions made to enhance expression, primarily by avoiding stem-loop structures in the transcribed mRNA ( EPO App. No. 0 075 444 A2) or to provide codons that are more readily transcribed by the selected host, e.g. the well-known E^. coli preference codons for E. £211 expression.
The mutant nucleic acid is made by known methods per se (A. <sup>35</sup> Hui et aL, 1984, The EMBO Journal 3/3): 623-629; J. Adelman
3499Y
-ζι et. ab, 1983, DHA 2(3): 183-193; U.K. Patent Application 2,130.219A; G. Winter et al_., 1982, Nature 299: 756-758; and R. Wallace et al., 1981, Nucleic Acids Research 9(15): 3647-3656). These methods include M13 phage mutagenesis, synthesis of the mutant lymphotoxin gene as described in Example 1 et seq. or other methods as are or will become known in the art.
Nucleic acid encoding lymphotoxin is any DNA or RNA sequence that encodes a polypeptide falling within the definition of lymphotoxin herein, whether or not the nucleotide sequences thereof correspond to the sequences found in nature. In addition, nucleic acid is included within the scope herein that is capable of hybridizing under at least low stringency conditions to nucleic acid encoding lymphotoxin, even if the hybridizing nucleic acid does not encode a protein otherwise meeting the definitional requirements for lymphotoxin. An example of the latter would be a probe that, because of the short length of polypeptide that it encodes, is incapable of expressing a biologically active lymphotoxin. The nucleic acid encoding lymphotoxin or capable of hybridizing therewith is prepared by organic synthesis, substantially as shown in Example 1, or obtained from natural sources by probing genomic or cDNA libraries as shown in the Examples.
The lymphotoxin of this invention is made by a process generally entailing the transformation of a host with a vector bearing the nucleic acid that encodes the desired lymphotoxin. A vector is a replicable DNA construct. Vectors are used herein to amplify DNA or to express DNA which encodes lymphotoxin. An expression vector is a DNA construct in which a DNA sequence encoding lymphotoxin is operably linked to a suitable control sequence capable of effecting the expression of lymphotoxin in a suitable host. Such control sequences include a transcriptional promoter, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences which control termination of transcription and translation.
3499Y
The vector may be a plasmid, a virus (including phage), or an integratable DMA fragment (i.e., integratable into the host genome by recombination). Once transformed into a suitable host, the vector replicates and functions independently of the host genome, or may, in some instances, integrate into the genome itself. In the present specification, plasmid and vector are sometimes used interchangeably as the plasmid is the most commonly used form of vector at present. However, all other forms of vectors which serve an equivalent function and which are, or become, known 10 in the art are suitable for use herein.
Suitable vectors will contain replicon and control sequences which are derived from species compatible with the intended expression host. Transformed host cells are cells which 15 have been transformed or transfected with lymphotoxin vectors constructed using recombinant DNA techniques. Transformed host cells ordinarily express lymphotoxin. The expressed lymphotoxin will be deposited intracellularly or secreted into either the periplasmic space or the culture supernatant, depending upon the 20 host cell selected.
DNA regions are operably linked when they are functionally related to each other. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it 25 is expressed as a preprotein which participates in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation. Generally, operably linked 30 means contiguous and, in the case of secretory leaders, contiguous and in reading phase.
Suitable host cells are prokaryotes, yeast or higher eukaryotic cells. Prokaryotes include gram negative or gram <sup>35</sup> positive organisms, for example E. coli or Bacilli. Higher
3499Y
־ eukaryotic cells include established cell lines of mammalian origin as described below. A preferred host cell is the phage resistant
£. coli W3110 (ATCC 27,325) strain described in the Examples, ' although other prokaryotes such as j:. coli B, _E. coli X1776 (ATCC θ 31,537), E. coli 294 (ATCC 31,446), pseudomonas species, or Serratia Marcesans are suitable.
Prokaryotic host-vector systems are preferred for the expression of lymphotoxin. A plethora of suitable microbial vectors <sup>10</sup> are available. Generally, a microbial vector will contain an origin of replication recognized by the intended host, a promoter which will function in the host and a phenotypic selection gene, for example a gene encoding proteins conferring antibiotic resistance or supplying an auxotrophic requirement. Similar constructs will be <sup>15</sup> manufactured for other hosts. £. coli is typically transformed using pBR322, a plasmid derived from an L. coli species (Bolivar, et al ., 1977, Gene b 95). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells.
Expression vectors must contain a promoter which is recognized by the host organism, but cloning vectors need not. The promoter generally is homologous to the intended host. Promoters most comnonly used in recombinant DNA construction include the <sup>25</sup> β-lactamase (penicillinase) and lactose promoter systems (Chang et ab, 1978, Nature, 275: 615; and Goeddel et ab , 1979, Nature 281: 544), a tryptophan (trp) promoter system (Goeddel et al_., 1980, Nucleic Acids Res. 8: 4057 and EPO App. Publ. No. 36,776) and the tac promoter [H. De Boer et ab, Proc. Nat'l. Acad. Sei. U.S.A.
<sup>30</sup> 80: 21-25 (1983)]. While these are the most commonly used, other known microbial promoters are suitable. Details concerning their nucleotide sequences have been published, enabling a skilled worker operably to ligate them to DNA encoding lymphotoxin in plasmid vectors (Sieben!ist et ab, 1980, Cell 20: 269) and the DNA <sup>35</sup> encoding lymphotoxin. At the present time the preferred vector is a
3499Y pBR322 derivative containing the £. coii alkaline phosphatase promoter with the trp Shine-Dalgarno sequence. The promoter and
Shine-Dalgarno sequence are operably linked to the DNA encoding the lymphotoxin, i.e., they are positioned so as to promote transcription of lymphotoxin mRNA from the DNA.
In addition to prokaryates, eukaryotic microbes such as yeast cultures are transformed with lymphotoxin-encoding vectors. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms, although a number of other strains are commonly available. Yeast vectors generally will contain an origin of replication from the 2 micron yeast plasmid or an autonomously replicating sequence (ARS), a promoter, DNA encoding lymphotoxin (including in particular human pre lymphotoxin), sequences for polyadenylation and transcription termination and a selection gene. A suitable plasmid for lymphotoxin expression in yeast is YRp7, (Stinchcomb et al., 1979, Nature, 282: 39; Kingsman et ab, 1979, Gene, 7j 141; Tschemper et ab, 1980, Gene, 10: 157). This plasmid already contains the trpl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, 1977, Genetics, 85: 12). The presence of the trpl lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
Suitable promoting sequences in yeast vectors include the promoters for metal!othionein, 3-phosphoglycerate kinase (Hitzeman et ab, 1980, J. Biol. Chem., 255: 2073) or other glycolytic enzymes (Hess et al_., 1968, J. Adv. Enzyme Reg., 7_t 149; and Holland et al., 1978, Biochemistry, 17: 4900), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. Suitable
3499Y vectors and promoters for use in yeast expression are further described in R. Hitzeman et al., EPO Publn. No. 73,657.
Other promoters, which have the additional advantage of 5 transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned metallothionein and glyceraldehyde-3-phosphate dehydrogenase, as well as enzymes 10 responsible for maltose and galactose utilization. In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector 3' of the lymphotoxin coding sequences to provide polyadenylation of the mRNA and termination.
In addition to microorganisms, cultures of cells derived from multicellular organisms may also be used as hosts. This, however, is not preferred because of the excellent results obtained thus far with lymphotoxin expressing microbes. In principal, any 20 higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture. However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years [Tissue Culture, Academic Press, Kruse and Patterson, editors 25 (1973)]. Examples of useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and WI38, BHK, COS-7 and MOCK cell lines. Expression vectors for such cells ordinarily include (if necessary) an origin of replication, a promoter located upstream from the gene to be expressed, along with a ribosome 30 binding site, RNA splice site (if intron-containing genomic DNA is used), a polyadenylation site, and a transcriptional termination sequence.
The transcriptional and translational control sequences in 35 expression vectors to be used in transforming vertebrate cells are
3499Y often provided by viral sources. For example, commonly used promoters are derived from polyoma, Adenovirus 2, and most preferably Simian Virus 40 (SV40}. The early and late promoters are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (Fiers et al♦, 1978, Nature<sup>11</sup>, 273: 113). Smaller or larger SV40 fragments may also be used, provided the approximately 250 bp sequence extending from the Hind III site toward the Bgl I site located in the viral origin of replication is included. Further, it is also possible, and often desirable, to utilize the human genomic promoter, control and/or signal sequences normally associated with lymphotoxin, provided such control sequences are compatible with the host cell systems.
An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g. Polyoma, Adenovirus, VSV, or BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient. Lymphotoxin is prepared without an ami no-terminal methionyl by transformation of higher eukaryotic cells with the human pre lymphotoxin DNA.
In selecting a preferred host mammalian cell for transfection by vectors which comprise DNA sequences encoding both lymphotoxin and dihydrofolate reductase (DHFR), it is appropriate to select the host according to the type of DHFR protein employed. If wild type DHFR protein is employed, it is preferable to select a host cell which is deficient in DHFR thus permitting the use of the DHFR coding sequence as a marker for successful transfection in selective medium which lacks hypoxanthine, glycine, and thymidine. An appropriate host cell in this case is the Chinese hamster ovary (CHO) cell line deficient in DHFR activity, prepared and propagated as described by Urlaub and Chasin, 1980, Proc. Natl. Acad. Sci. (USA) 77: 4216.
3499Y
On the other hand, if DNA encoding DHFR protein with low binding affinity for methotrexate (MTX) is used as the controlling sequence, it is not necessary to use DHFR resistant cells. Because the mutant DHFR is resistant to MTX, MTX containing media can be used as a means of selection provided that the host cells are themselves MTX sensitive. Most eukaryotic cells which are capable of absorbing MTX appear to be methotrexate sensitive. One such useful cell line is a CHO line, CH0-K1 (ATCC No. CCL 61).
Transformed host cells are cells which have been transformed or transfected with lymphotoxin vectors constructed using recombinant DNA techniques. Transformed host cells ordinarily express lymphotoxin. The expressed lymphotoxin ordinarily is deposited intracellularly.
Lymphotoxin is recovered from recombinant culture in nonsecreting cells by lysing the cells and removing particulate matter by centrifugation or the like. Lymphotoxin secreting cells are separated from culture supernatant by centrifugation. The contaminated lymphotoxin solution is then purified by the methods referred to above or by immunoaffinity as described in Example 4 below. The lymphotoxin is purified to levels suitable for pharmacological use and placed into conventional dosage forms, e.g. vials or syringes. Mixtures of lymphotoxin variants are employed, e.g. a bank of cytotoxic mutant lymphotoxin species. Lymphotoxin optimally is lyophilized for long term storage, or it may be placed in aqueous solution with stabilizers and excipients, for example isotonic saline, and administered to patients as disclosed by B. Aggarwal et al., European Patent Application 100641.
Lymphotoxin compositions are administered to tumor-bearing animals. The route of administration is in accord with known methods, e.g. intravenous, intraperitoneal, subcutaneous, intramuscular, intralesional infusion or injection of sterile lymphotoxin solutions, or by timed release systems described below.
3499Y
Lymphotoxin is administered intralesionally, i.e., by direct injection into solid tumors. In the case of disseminated tumors such as leukemia, administration is preferably intravenous or into the lymphatic system. Tumors of the abdominal organs such as ovarian cancer are advantageously treated by intraperitoneal infusion using peritoneal dialysis hardware and peritoneum-compatible solutions. Ordinarily, however, lymphotoxin is administered continuously by infusion although bolus injection is acceptable.
Lymphotoxin desirably is administered from an implantable timed-release article. Examples of suitable systems for proteins having the molecular weight of lymphotoxin dimers or trimers include copolymers of L-glutamic acid and gamma ethyl-L-glutamate (U. Sidman et al_., 1983, Biopolymers 22 (1): 547-556), poly (2-hydroxyethyl-methacryl ate) (R. Langer et al_., 1981, J. Biomed. Mater. Res. 15: 167-277 and R. Langer, 1982, Chem. Tech. 12: 98-105) or ethylene vinyl acetate (R Langer et ,Id.). Lymphotoxin-containing articles are implanted at surgical sites from which tumors have been excised. Alternatively, lymphotoxin is encapsulated in semi permeable microcapsules or liposomes for injection into the tumor. This mode of administration is particularly useful for surgically inexcisable tumors, e.g. brain tumors.
The amount of lymphotoxin that is administered will depend, for example, upon the route of administration, the tumor in question and the condition of the patient. It will be necessary for the therapist to titer the dosage and modify the route of administration as required to obtain optimal cytotoxic activity towards the target tumor, as can be determined for example by biopsy of the tumor or diagnostic assays for putative cancer markers such as carcinoembryonic antigen, in view of any recombinant toxicity encountered at elevated dosage. Ordinarily, recombinant lymphotoxin dosages in mice at about from 50 to 200 ug/kg body weight/day by intravenous administration have been found to be substantially
3499Y nontoxic and efficacious in vivo. Obviously, the dosage regimen will vary for different animals.
A method is provided herein for obtaining lymphotoxin<sup>5</sup> neutralizing antibody. Neutralizing antibody is defined as antibody that is capable of immunologically binding lymphotoxin as defined herein in such a way as to substantially reduce its activity in cytostatic or cytolytic lymphotoxin activity assays such as the murine L929 assay described below. The fact that the antibody is capable of neutralizing lymphotoxin activity does not mean that the antibody must bind directly to the lymphotoxin active or receptor binding site. The antibody may still substantially neutralize lymphotoxin activity if it sterically binds to a region which adjacent to the critical site, i.e., adjacent in the sense of conformationally adjacent and not necessarily adjacent from the point of view of amino acid sequence.
In attempting to prepare a neutralizing monoclonal antibody against lymphotoxin, it proved difficult to immunize mice in a 20 fashion such that lymphotoxin neutralizing antibody is generated or raised in the animals. Neither immunization with lymphoblastoid lymphotoxin nor glutaraldehyde cross-linked lymphotoxin resulted in any detectable neutralizing antibody in the serum of immunized mice, even though the mice did raise non-neutralizing anti-lymphotoxin antibody detectable by enzyme immunoassay. However, immunization with a lymphotoxin-alam (aluminum hydroxide or alumina, ATgO^.SHgO) adsorption complex will raise neutralizing antibody even in animals which had failed to generate the activity prior to immunization with the alum complex. Preparation of alum and its use in the production of antiserum are disclosed in C. Williams, et aL,eds., 1967, Methods in Immunology and Immunochemistry I, pp 197-229.
Fusions of spleen cells from animals producing neutralizing <sup>35</sup> antibody with murine myeloma cells are made. On the average, about
3499Y to 100 clones will have to be screened to identify one which synthesizes neutralizing antibody. The process for screening the clones for the desired activity is routine and well within the skill of the ordinary artisan, and can be reproduced with minimal experimental effort.
The serum, plasma or IgG fractions from the immunized animal, as well as immunoglobulins secreted by hybridomas generated from the spleen or lymph cell of immunized animals, are all
0ן satisfactory for use herein. In a preferred embodiment the neutralizing antibody is obtained essentially free of other anti-lymphotoxin antibody in hybridoma culture.
The neutralizing antibody is immobilized by adsorption to
5ן surfaces, e.g., thermoplastics such as polystyrene, or covalently bound to matrices such as cyanogen bromide-activated Sepharose. It then is used in immunoassays or in immunoaffinity purification. Since the antibody is a neutralizing antibody it is most likely only to adsorb or detect biologically active lymphotoxin or fragments thereof. The antibody is particularly useful in immunoradiometric (sandwich) immunoassays in concert with a non-neutralizing anti-lymphotoxin monoclonal antibody or a polyclonal antiserum which contains non-neutralizing anti-lymphotoxin. The immunoassay is conducted using either the neutralizing or non-neutralizing antibody as the labelled component, which labelling is effective with a detectable substance such as a fluorescent, chemiluminescent or radioisotopic label in accord with methods known in the art. For competitive-type lymphotoxin immunoassays, lymphotoxin is labelled in the same fashion. Chloramine-T radioiodination is suitable for both lymphotoxin and lymphotoxin antibody tracer preparation, or the method described in J. KIostergaard et al., Mol. Immun. 18: 455 (1980) is used.
In order to simplify the Examples certain frequently occurring methods will be referenced by shorthand phrases.
3499Y
Plasmids are designated by a low case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are commercially available, are publically available on an unrestricted basis, or can be constructed from such available plasmids in accord with published procedures. In addition, other equivalent plasmids are known in the art and will be apparent to the ordinary artisan.
Digestion of DNA refers to catalytic cleavage of the DNA with an enzyme that acts only at certain locations in the DNA. Such enzymes are called restriction enzymes, and the sites for which each is specific is called a restriction site. Partial digestion refers to incomplete digestion by a restriction enzyme, i.e., conditions are chosen that result in cleavage of some but not all of the sites for a given restriction endonuclease in a DNA substrate. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements as established by the enzyme suppliers were used. Restriction enzymes commonly are designated by abbreviations composed of a capital letter followed by other letters and then, generally, a number representing the microorganism from which each restriction enzyme originally was obtained. In general, about 1 ug of plasmid or DNA fragment is used with about 1 unit of enzyme in about 20 μΐ of buffer solution. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37*C are ordinarily used, but may vary in accordance with the supplier's instructions. After incubation, protein is removed by extraction with phenol and chloroform, and the digested nucleic acid is recovered from the aqueous fraction by precipitation with ethanol. Digestion with a restriction enzyme infrequently is followed with bacterial alkaline phosphatase hydrolysis of the terminal 5' phosphates to prevent the two restriction cleaved ends of a DNA fragment from circularizing or forming a closed loop that would impede insertion of another DNA fragment at the restriction site.
3499Y
Unless otherwise stated, digestion of plasmids is not followed by 5' terminal dephosphorylation. Procedures and reagents for dephosphorylation are conventional (T. Maniatis et ab, 1982/
Molecular Cloning pp. 133-134).
Recovery or isolation of a given fragment of DNA from a restriction digest means separation of the digest on polyacrylamide gel electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA. This procedure is known generally. For example, see R. Lawn et ab, 1981, Nucleic Acids Res. 9.:6103-6114, and D. Goeddel et al., 1980, Nucleic Acids Res. 8:4057.
Southern Analysis is a method by which the presence of DNA sequences in a digest or DNA-containing composition is confirmed by hybridization to a known, labelled oligonucleotide or DNA fragment. For the purposes herein, unless otherwise provided, Southern analysis shall mean separation of digests on 1 percent agarose, denaturation and transfer to nitrocellulose by the method of E. Southern, 1975, J. Mob Biol. 98:503-517, and hybridization as described by T. Maniatis et ab, 1978, Cell 15:687-701,
Transformation means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosoma1 element or chromosomal integrant. Unless otherwise provided, the method used herein for transformation of E. coli is the CaC!<sub>2</sub> method of Mandel et ab, 1970, J. Mol, Biol. 53:154.
Ligation refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (T. Maniatis et ab, Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase (ligase) per 0.5 <sub>u</sub>g of approximately
3499Y equimolar amounts of the DNA fragments to be ligated.
Preparation of DNA from transformants means isolating plasmid DNA from microbial culture. Unless otherwise provided, the alkaline/SDS method of Maniatis et ab, Id. p. 90., may be used.
Oligonucleotides are short length single or double stranded polydeoxynucleotides which are chemically synthesized by the method incorporated by reference into Example 1, and then purified on polyacrylamide gels.
All literature citations are expressly incorporated by reference.
EXAMPLE 1
Purification and Sequencing of Lymphotoxin
The human lymphoblastoid cell line RPMI-1788 (ATCC No. CCL-156) was grown in 15L spinner flasks to a cell density of 4xl0<sup>5</sup> cells per ml using a serum free culture medium (RPMI-1640). Lymphotoxin was induced 10-20 fold (to 500-1000 lymphotoxin units/ml, determined as described below) over basal levels by the inclusion of 20 ng/ml of phorbol myristate acetate in the serum free RPMI-1640 medium. After 65 h of culture, the cells were harvested by filtration, and the lymphotoxin activity in the filtrate was absorbed to controlled pore glass beads (Electronucleonics) in a column (5 cm x 20 cm), equilibrated with 5mM phosphate buffer (pH 7.4) and eluted with 50 percent ethylene glycol in 5ml-1 phosphate buffer (pH 7.4). 0.1 mM phenylmethyl sulfonyl fluoride (PMSF), a protease inhibitor, and 1 mM sodium azide, for inhibition of microbial growth, were included in all buffers throughout the purification. The eluate from glass beads contained 84,000 units of lymphotoxin/mg protein. This was followed by DEAE cellulose chromatography, Lentil Lectin Sepharose chromatography, and
3499Y preparative native PAGE as described in B. Aggarwal, et al., 1984,
J. Biol. Chem. 259 (1): 686-691. Homogeneity of the protein responsible for cytotoxic activity was determined by SDS-PAGE, reverse-phase HPLC on a Lichrosorb RP-18 column and by amino terminal sequencing.
This lymphotoxin preparation contained greater than 95 percent by weight of the leucyl amino-terminal lymphotoxin having an approximate molecular weight of 25,000 on SDS-PAGE. The theoretical 10 molecular weight of the protein component of the N-terminal leucyl species is 18,664 daltons; the remaining approximately 6,500 daltons was attributed to a glycosyl side chain at Asn<sup>+</sup>62, and perhaps other 0-1 inked sugar residues. The tissue culture supernatant contained putative multimers of this species (60,000 Da by TSK-HPLC or 64,000 15 Da by Sephadex G-100 chromatography).
The remaining 5 percent of the lymphotoxin mixture was the N-terminal histidyl species having a molecular weight of about 20,000. Both species exhibit substantially the same cytolytic 20 activity, at least within the limits of the variation inherent in the murine fibroblast cell lysis assay described below.
Tryptic digestion of the intact lymphotoxin molecules yielded only a few fragments. Histidyl amino-terminal lymphotoxin 25 was digested into two fragments between amino acid positions 89 and 90, while the leucyl ami no-terminal tryptic digestion yielded four fragments cleaved between positions 15 and 16, 19 and 20, and 89 and 90.
Micro-sequencing by the Edman degradation technique yielded sequence information on the intact molecule and also on the fragments produced by tryptic cleavage.
Further sequence information was provided by fragments of 35 lymphotoxin produced by carboxypeptidase P and chymotrypsin
3499Y §digestion, acetic acid digestion and cyanogen bromide cleavage. Nearly the entire sequence of the human lymphotoxin was determined by this method. 156 contiguous residues were determined from the amino terminus. It was clear from this sequencing information that the difference between the two lymphotoxin species was the presence of 23 amino-terminal residues in the leucyl amino-terminal species which were not found in the histidyl amino-terminal species. The carboxyl terminal sequence beyond the first three residues proved to be difficult to determine because of certain peptide bonds present in this region and the hydrophobic nature of the residues.
A synthetic gene was designed which would code for the protein sequence to the extent determined by micro-sequencing. The gene design incorporated a general E_. coli codon bias, that is, rarely used £. coli codons were not used in the sequence. Human preference codons were substituted where no £. coli codon bias was apparent. This bias was chosen to aid in expression in £. col ו , and also so that the synthetic gene would be useful as a probe to identify the natural DNA sequence from human cDNA or genomic libraries. The unique restriction sites Xbal, BamHI, Hindlll, and Bglll were designed into the sequence to aid in the construction of the fragments and to allow for future manipulation of the gene.
The 58 original oligomers designed for the synthetic lymphotoxin gene were synthesized by the solid phase phosphite method of M. Matteucci et al_., 1981, J. Amer. Chem. Soc. 103: 3185-3190 and S. Beaucage et al_., 1981, Tet. Letters 22: 1859-1862. The size of these oligomers ranged from 16 bases to 20 bases and is shown in Fig. la. Overlaps between oligomers were 6 bases in length and designed to be unique. The entire gene was assembled as shown in Fig. lb.
The gene was constructed in three separate pieces. The first, Segment A, was 117 base pairs in length and represented the 5' coding region for the amino terminal end of the leucyl
3499Y amino-terminal species. Segment B represented the DNA encoding the middle of the lymphotoxin molecule and was 145 base pairs in length. Segment C, at 217 base pairs in length, was believed .to encode all but 16 amino acid residues at the lymphotoxin carboxy terminus. The oligomers required to synthesize each of the segments were purified by electrophoresis and then pooled. The relatively small size of each oligomer (that is, 16 to 20 bases) was chosen to reduce errors in synthesis.
10־ Each group of oligomers was phosphorylated in a reaction containing 20 mM Tris-HCl (pH 7.5), 10 mM MgC^, 20 mM dithiothreitol, 0.5 mM ATP, and 15 units of T4 polynucleotide kinase in a volume of 50 ul; approximately 50 pmol of each oligomer was contained in the reaction. After 30 minutes at 37°C, the reaction was heated to 65°C to destroy kinase activity, and then allowed to slowly cool to 20°C over the period of one hour. The phosphorylated oligomers were then ligated by the addition of 10 units of T4 DNA ligase and the reaction was allowed to proceed for 2 hours at 20״C. The ONA ligase was heat inactivated and then the ligated oligomers were digested for 3 hours at 37°C with restriction endonucleases which recognized the designed terminal sites (e.g., Xbal and BamHI for segment A). Fragments for each segment were isolated by electrophoresis on a 7 percent polyacrylamide gel. Fragments of the correct mobility were identified for each segment by ethidium bromide staining and electroeluted from the gel. pFIFtrp69 (D. Goeddel et al., 1980, Nature 287: 411-416 or Crea et al., European Patent Application 0048970) was digested with Xbal and BamHI and the large vector fragment isolated by 6 percent polyacrylamide gel electrophoresis. About 50 ng of segment A was ligated to the pFIFtrp69 fragment. Similarly, segment B was ligated into BamHI and Hindlll digested pBR322, and segment C was ligated into Hindlll and Bglll digested pLeIFA-125-1 (D. Goeddel et ab, 1980, Nuc. Acids Res. 8: 4057-4073). The ligation reaction mixtures were transformed into £. coli ATCC 31446 and the resulting recombinant plasmids were characterized by restriction endonuclease analysis and
3499Y
DNA sequencing by the Maxam and Gilbert chemical degradation method. Five of six segment A clones contained the designed sequence. Four segment B and four segment C plasmids were isolated, and all of these inserts had the correct sequences. Each segment 5 was isolated by digestion with restriction endonucleases which recognized the terminal sites and then ligated into the plasmid vector pFIFtrp69 digested with Xbal and Bglll. The resulting recombinant plasmid, pLTXBl, was characterized by sequencing the inserted Xbal-Bglll fragment, which contained the sequence presented 10 in Fig. la.
To determine if the synthetic gene would indeed produce biologically active lymphotoxin, the £. coli pLTXBl transformants were grown in minimal media under conditions to de-repress the trp 15 promoter and allow expression of the synthetic lymphotoxin gene.
Cultures were grown to an optical density of 1.0 at 550 nanometers and harvested by centrifugation. The cell pellet was suspended in one-tenth volume, and then lysed by sonication.
Lymphotoxin activity was determined by the modified cell-lytic assay of B. Spofford, 1974, J. Immunol. 112: 2111. Briefly, mouse L-929 fibroblast cells were grown in microtiter plates in the presence of actinomycin D. After 12-18 hours, 0.125 ml of serially diluted sample to be assayed for lymphotoxin is added 25 to each well. After 18 hours, the plates were washed and the lysis of the cells induced by lymphotoxin was detected as adhering to the plates by staining the plates with a 1 percent solution of crystal violet in methanol:water (1:4 v/v). The intensity of stain was observed both visually as well as spectrophotometrically at absorbance of 450 nm and 570 nm transmission using a Dynatech spectrophotometer. The cells plated in a microtiter well with culture medium alone were set at 0 percent lysis whereas those with 3M guanidine hydrochloride solution provided an end point for 100 percent lysis. One unit of lymphotoxin is defined as the amount <sup>35</sup> required for 50 percent cell lysis out of 12,000 cells plated in
3499Y each well. Note that other assays of cytotoxic activity also may be used. For example see B. Aggarwal et al., in Thymic Hormones and
Lymphokines, 1983, ed. A. Goldstein, Spring Symposium on Health
Sciences, George Washington Univ. Medical Center (the A549 cell line <sup>5</sup> referred to in this material is available from the ATCC as CCL185).
Culture lysates showed undetectable cytolytic activity in the murine cell assay described above. Control lysates from gamma interferon expressing cultures did contain gamma interferon activity. This result suggested that the synthetic gene did not encode an active 10 lymphotoxin. There were several possible explanations for this.
For example: (1) the E_. coli degraded the lymphotoxin, (2) the lymphotoxin gene was not transcribed in L. coli, (3) the lymphotoxin message was not translated in £. coli, (4) the protein did not have the proper sequence due to a protein sequencing error, or (5) the 16 15 residue carboxy terminal sequence or a portion thereof was actually necessary for activity or for proper configuration of the lymphotoxin molecule.
EXAMPLE 2 20
Procedure for Obtaining cDNA Encoding Lymphotoxin
RNA was isolated from a culture of a non-adherent cell fraction of human peripheral blood lymphocytes 48 hours after 25 induction with phorbol myristate acetate (10 ng/ml), staphylococcal enterotoxin B (1 ug/ml) and thymosin a-1 (S. Berger et al_., 1979, Biochemistry 18: 5143-5149). This culture was producing 400 units of lymphotoxin activity/ml of supernatant. The mRNA was concentrated by adsorption to immobilized oligo dT, eluted and cDNA 30 prepared by reverse transcription (P. Gray et al_., 1982, Nature 295: 503-508). Reverse transcriptase was used to make a cDNA copy of the messenger RNA by standard methods, a second strand was prepared (also by standard methods) by Klenow treatment, and the cDNA was treated with S-l nuclease to remove the hairpin loop. In 35 order to insert this cDNA into a vector the ends were ligated to an
3499Y adaptor or linker so as to create 5' and 3' restriction enzyme sites or, preferably, cohesive termini! for a predetermined restriction enzyme site. The oligonucleotide 5' HO-AATTCATGCGTTCTTACAG
GTACGCAAGAATGTC-P 5' was used for this purpose. The oligonucleotide was ligated to the cDNA and the cDNA reisolated by polyacrylamide gel electrophoresis. xgtlO, a publicly available phage (or its substantial equivalent, xgtll, which is available from the ATCC), was digested with EcoRI and the linear fragment recovered (M. Wickens et aj., 1978, J.Biol.
0ן Chem. 253: 2483-2495). The Tinkered reverse transcript and the xgtlO digest were ligated and the ligation mixture used to transfect £. coli C-600 or other known host susceptible to ג phage infection. Approximately 10,000 recombinant phage were plated on a 15 cm plate and screened by a low-stringency plaque hybridization method (T.
<sub>5ו</sub> Maniatis et ah, 1978, Cell 15: 687-701 and P. Gray et al., PNAS 80: 5842-5846) using a ^-labelled probe prepared from Segment A of Fig. la by the method of J. Taylor et al., 1976, Biochem.
Biophys. Acta 442: 324-330 in which calf thymus DNA primers were used (PL Biochemicals). Duplicate nitrocellulose filters were 20 hybridized by the low stringency method with 5x10? cpm of the probe in 20 percent formamide. The filters were washed twice in 0.3 M sodium chloride, 0.03 M sodium citrate, and 0.1 percent sodium dodecyl sulfonate (SDS) at 37״C.
Two phage hybridized with the probe and were plaque purified. The purified phage hybridized with both the Segment A probe and a probe prepared from Segment B. The cDNA inserts of the two hybridizing phage, xLTl and xLT2, were subcloned into M13mp8 and sequenced by the dideoxy chain termination method (A. Smith, 1980,
Methods in Enzymology 65: 560-580). The insert in xLT2 was only about 600bp and did not contain the entire 3' coding region for lymphotoxin. The insert in xLTl contained the entire coding region for leucyl amino-terminal lymphotoxin plus a 650 bp 3' untranslated region (containing a consensus polyadenylation signal) and codons for 18 amino acids amino terminal to the leucyl terminus. Since
3499Y
Uthis did not constitute the entire lymphotoxin coding region an additional ^Zp-iabelled probe was prepared from the cDNA insert of xLTl and used to screen an additional 25,000 recombinant xgtlO phage at high stringency (see T. Huynh et ah, 1984, in Practical
Approaches in Biochemistry IRL Press, Oxford). Twelve additional hybridizing phage were isolated and the sequence of the longest insert, from xLTU, is presented in Fig. 2a. The longest open reading frame was translated starting at the first observed ATG. Numbers above each line refer to amino acid position and numbers 10 below each line refer to nucleotide position. The leucyl residue labelled 1 represents the first residue sequenced of leucyl amino-terminal lymphotoxin (Fig. la) and is presumably the first amino terminal residue of the mature species of lymphotoxin. The first 34 residues represent a signal sequence. Residues 156-171 had 15 not been determinable by protein sequencing of lymphotoxin, but instead were imputed from the nucleotide sequence.
EXAMPLE 3
Construction of a Hybrid Synthetic Gene/Natural cDNA
Expression Vector for Leucyl Amino-Terminal Lymphotoxin
This construction is shown in Fig. 2b. pLTXBl (containing the inactive synthetic gene) was partially digested with EcoRl and 25 PstI, and a 685 bp fragment containing DNA encoding 125 N-terminal residues of lymphotoxin was recovered. A partial PstI digest was performed because of the presence of an additional PstI site at residue 10 (Fig. la). A 301 bp fragment containing DNA encoding the C-terminal 51 amino acids of lymphotoxin was isolated by digesting 30 the subcloned cDNA of xLTl with EcoRl and PstI (these sites are shown above in Fig. 2a at nucleotide positions 554 and 855). These fragments were isolated by electrophoresis on 5 percent polyacrylamide and electroelution. The fragments were ligated into pBR322 which had been digested with EcoRl and dephosphorylated with 35 bacterial alkaline phosphatase to reduce background transformants.
3499Y
The resulting expression plasmid, pLTtrpl, was characterized as to proper orientation and sequence by restriction endonuclease digestion and DNA sequencing. Leucyl amino-terminal lymphotoxin was expressed by transforming E_. coli 31446 with pLTtrpl and culturing the transformants in medium containing tetracycline at 37°C for 4-6 hours until an OD. of 1.0 was reached. The cell lysates contained cytotoxic activity. The leucyl amino terminus of the expressed lymphotoxin species was found to be substituted with a blocked methionyl residue. It is believed that the product of this synthesis is the formyl methionyl rather than methionyl species.
EXAMPLE 4
Immunoaffinity Purification of Lymphotoxin
A murine monoclonal cell line secreting anti-lymphotoxin (Example 8) was grown in mice and purified from ascites fluid by ion exchange chromatography. The anion exchange eluate was coupled to cyanogen bromide activated Sepharose at a concentration of 2 mg/ml resin. A 20 ml column was equilibrated consecutively with TBS (containing 0.05 M Tris-HCl, pH 7.0, 0.15 M sodium chloride, and 2mM EDTA); then with elution buffer (containing 0.1 M acetic acid, pH 4.5, 150 mM sodium chloride); and finally with TBS. A 40 percent saturated ammonium sulfate precipitate of pLTtrpl-transformed £. coli sonicated lysate (previously clarified by centrifugation) was suspended in 0.1 M Tris-HCl, pH 7.4, and 5 mM EDTA and loaded onto the column at a rate of one column volume per hour. Following extensive washing with TBS containing 0.05 percent Tween-20, specifically bound material was eluted with the elution buffer, the pH immediately adjusted to 7.8 with 0.1 volume 1 M Tris-HCl, pH 8.5, and stored at 4״C. The specific activity of this purified lymphotoxin was 2-10x10? units/mg, as measured in the above murine L-929 assay,
The eluate contained most of the activity loaded onto the
3499Y /2 column. The majority of the total eluate protein migrated as a single band under both reducing and nonreducing conditions in SDS-polyacrylamide gel electrophoresis. The mobility of this band corresponds to approximately 18,000 MW, which is consistent with the predicted value of 18,664 MW for unglycosylated leucyl-amino terminal lymphotoxin based on the deduced amino acid sequence. To further characterize its biological activities, the purified recombinant lymphotoxin was tested for cytolytic activity in vitro and antitumor activity in vivo.
EXAMPLE 5
In Vivo Biological Activity of Recombinant Lymphotoxin
Recombinant and lymphoblastoid lymphotoxin were tested in an in vivo tumor necrosis assay. MethA(a) sarcomas were grown for 7-10 days in susceptible mice [BALB/C x C57Bl/6f1 or CB6fl], and the tumors then directly injected with Example 4 lymphotoxin, lymphoblastoid lymphotoxin (prepared and purified as described above) or control samples. After 20-24 hours, the mice were sacrificed, the tumors removed and histologically scored for the extent of necrosis. As shown in Table 1, both recombinant and lymphoblastoid lymphotoxin caused significant necrosis of MethA(a) sarcoma in vivo. Control samples did not induce necrosis of the MethA(a) sarcomas.
3499Y
TABLE 1
NECROSIS OF MethA(a) SARCOMA IN VIVO BY RECOMBINANT AND NATURAL LYMPHOTOXTR
<td></td><td> Treatment</td><td> Number of Mice Sarcoma Necrosis Score +++ +++</td>
<td></td><td> Buffer 1 control</td><td> 3</td>
<td> 10</td><td> Lymphoblastoid Lymphotoxin, 25,000 units</td><td> 4---</td>
<td></td><td> Lymphoblastoid Lymphotoxin, 10,000 units</td><td> 4---</td>
<td> 15</td><td> Recombinant Lymphotoxin, 200,000 units</td><td> 14 2 2 -</td>
<td></td><td> Recombinant Lymphotoxin, 25,000 units</td><td> 3--1</td>
<td></td><td> Recombinant Lymphotoxin, 10,000 units</td><td> 3 - 1 -</td>
<td> 20</td><td> Buffer 2 Control</td><td> 9</td>
Lymphoblastoid lymphotoxin was injected dissolved in buffer (O.O1 M Tris-HCl, 0.05 Μ (ΝΗ<sub>4</sub>)<sub>2</sub>Η00β, pH 8.0) and recombinant lymphotoxin was injected dissolved in Buffer 2 (0.15 M NaCl, 0.1 H sodium acetate and 0.1 M Tris-HCl, pH 7.8).
The absence of carbohydrate on recombinant lymphotoxin does not appear to affect biological activity, since the specific activity of lymphotoxin produced by recombinant culture (2-10xl0<sup>7</sup> units/mg) is approximately the same as that reported for lymphoblastoid lymphotoxin (4x10? units/mg).
The recombinant lymphotoxin activity also exhibited thermo!abi1ity similar to natural lymphotoxin, i.e., inactivation in <sup>35</sup> aqueous solution after heating for 1 hour at 80°C.
3499Y
EXAMPLE 6
Construction of an Expression Vector for Methionyl
Histidyl Amino-Terminal Lymphotoxin
Construction of a plasmid which directs the expression in E_. coli of methionyl histidyl amino-terminal lymphotoxin is outlined in Fig. 3. A synthetic oligonucleotide was inserted into the expression plasmid so as to encode an initiator methionine codon adjadent to the histidyl codon of histidyl amino terminal lymphotoxin (residue 24 of Figure 2a). This was performed by isolating a 4630 bp vector fragment from pLTtrpl by Xbal and Clal digestion, preparative 1 percent agarose gel electrophoresis, and electroelution. A 570 bp BamHI-Clal fragment containing most of the lymphotoxin coding sequence was also isolated from pLTtrpl in the same fashion. Two synthetic oligonucleotides were synthesized by methods discussed previously and mixed with oligonucleotides 6, 7, 52 and 53 of Figure la. Approximately 50 pmol of each oligonucleotide was treated with polynucleotide kinase as described in Example 1. The oligonucleotides were annealed and then ligated with a mixture of the 570 bp BamHI-Clal fragment and the 4630 bp Xbal-Clal vector fragment. The ligation mixture was transformed into L. coli ATCC 31446 and recombinants were selected on the basis of resistance to tetracycline. Plasmid p20KLT was recovered from one of the transformants. Plasmid p20KLT was characterized by restriction enzyme and DNA sequence analysis.
EXAMPLE 7
Preparation of Cytotoxic Lymphotoxin Fusion Variant
A plasmid containing DNA encoding a fusion of lymphotoxin with a bacterial protein was constructed by cloning a sequence coding for a bacterial signal sequence adjacent to the structural
3499Y gene for lymphotoxin. The sequence of the gene for the heat-stable
Enterotoxin II (STII) of £. coli has been characterized (R.N. Picken et al.<sub>t</sub> 1983, Infection and Immunity 42: 269-275) and encodes a 23 amino acid signal sequence which directs the secretion of the STII into the periplasmic space of £. coli.
The plasmid pWM501 (Picken et al., 1983, Infection and Immunity 42[1]: 269-275) contains the heat-stable enterotoxin (STII) gene. A portion of the DNA which encodes the STII gene was recovered from pWM501 using the following steps. pWM501 was digested with Rsal and the 550 bp DNA fragment was isolated. This gene fragment was ligated to the phage M13mp8 (J. Messing et al. in the Third Cleveland Symposium on Macromolecules: Recombinant DNA, Ed. A. Walton, Elsevier, Amsterdam [1981] pp 143-153) that had been previously digested with Smal. The ligated DNA was used to transform £. coli JM101, a commercially available strain for use with the M13 phage. Clear plaques were recovered. The double stranded M13mp8 STII Rsa derivative was isolated from an £. coli JM101 infected with this phage using standard procedures (J. Messing et a£. op cit). By the use of the M13mp8 subcloning procedure just described the approximately 550 base pair fragment containing the STII leader gene is now bounded by a series of different restriction endonuclease sites provided by the phage. The M13mp8 STII Rsa derivative then was digested with EcoRI and Pst I and a ONA fragment slightly larger than the 550 bp DNA fragment was isolated.
The EcoRI-PstI fragment was subcloned into pBR322. This was accomplished by digesting pBR322 with EcoRI and PstI and isolating the vector. The isolated vector was ligated to the EcoRI-PstI DNA fragment. This DNA mixture was used to transform £. coli ATCC 31446 and tetracycline resistant colonies selected. A plasmid was isolated from a resistant £. coli colony and designated pSTII-partial.
pSTI!-partial was digested with MnlI and BamHI and a 180 bp
3499Y fragment containing the STII Shine-Dalgarno sequence, the STII signal sequence, and the first 30 codons of the mature STII gene was isolated. The 180 bp DNA fragment was ligated to a plasmid containing the trp promoter. One such plasmid, pHGH207-l, has been <sup>5</sup> described previously (H. de Boer et al., 1982, in: Promoters:
Structure and Function, Eds. R. Rodreguez et al. Chamberlin, Praeger Pub., New York, NY, pp 462-481). A derivative of this plasmid, pHGH207-l*, wherein the EcoRI site 5’ to the trp promoter had been converted to EcoRI* by filling in with DNA polymerase I (DNA pol I) 10 and joining the blunt ends by ligation (S. Cabilly et al_., 1984, Proc. Natl. Acad. Sci. USA 81: 3273-3277) was used in this example. The trp promoter-containing plasmid was digested with Xbal and treated with DNA pol I and all four dNTPs to fill in the protruding sequence. The DNA preparation was then digested with 15 BamHI and the vector-containing fragment isolated. This vector fragment then was ligated to the 180 bp STII signal-containing DNA fragment isolated above. The ligation mixture was used to transform £. coli ATCC 31446 to ampicillin resistance. A plasmid designated STII-leader was isolated from an ampicillin resistant colony.
An M13 phage containing STII encoding sequences was first constructed by ligating the 180 bp Xbal-BamHI fragment of pSTIIleader into Xbal and BamHI digested M13mpl0. The resulting phage DNA, pSTI!-shuttle, was characterized by restriction endonuclease 25 analysis and nucleotide sequencing. LT encoding sequences were then introduced into this vector by ligating the Hpal-EcoRI 700 bp fragment of pLTtrpl into Smal-EcoRI digested pSTII-shuttle replicative form (RF, double stranded) DNA; Smal and Hpal sites are both blunt ended and ligated together (resulting in the loss of both 30 sites). The resulting phage DNA, M13-STII-LT, was characterized and then utilized for mutagenesis as follows: the primer 5' p CAAATGCCTATGCACTGCCAGGCGTAGG was kinased and mixed with the template (M13-STII-LT) in the presence of ligase buffer and Xbal-EcoRI digested M13mpl0 RF DNA (to promote priming of DNA, as 35 reported by J.P. Adelman et al_., 1983, DNA 2: 183-193); the
3499Y
A7 mixture was heated to 95״C and then allowed to anneal at room temperature for 30 minutes and then placed on ice for 30 minutes. Al 1 four deoxynucleotide triphosphates were then added along with ATP, T4 DNA Ligase, and the large fragment (Klenow) of £. coli DNA polymerase I. The mixture was incubated 1 hour at 14<sup>e</sup>C and then used to transfect competentJE. coli JM101, a commercially available strain, or any other M13 phage host. Correctly mutagenized phage were identified by hybridization screening utilizing the Pradiolabeled-primer as a probe. The resulting phage ST-LT-mut was characterized by DNA sequence analysis. Replicative form DNA was prepared from this phage and used for isolation of a 761 bp Xbal-EcoRI fragment containing DNA for the STII signal sequence adjacent to the coding sequence of Leucyl-amino terminal lymphotoxin. This DNA was ligated with Xbal-BamHI digested p20KLT (the large 4285 bp vector fragment) and the 375 bp EcoRI-BamHI fragment of pBR322. The resulting plasmid, pST18LT, was characterized by restriction mapping and DNA sequencing. A similar construction was prepared that encoded a fusion of the STII signal ami no-terminal to the histidine residue of histidyl amino-terminal lymphotoxin. The resulting plasmids were transformed into L. coli ATCC 31446. Plasmids pSTLTlS and pSTLT16 were recovered. They were confirmed to encode the STII fusion by restriction enzyme analysis and dideoxy sequencing. E_. coli transformed with plasmids pSTLT18 or pSTLT16 synthesize STII signal sequence fusions with leucyl amino-terminal and histidyl amino-terminal lymphotoxin as determined to be consistent with the calculated molecular weights by gel electrophoresis. The £. coli lysates containing these fusion proteins exhibited cytotoxic activity.
3499Y βEXAMPLE 8
Method for Making Monoclonal Murine Antibody
Capable of Neutralizing Lymphotoxin
Purified lymphoblastoid lymphotoxin obtained in Example 1 was dialyzed against phosphate buffered saline (PBS). 200 gg of lymphotoxin/ml were contained in the dialysate. Glutaraldehyde was added to the dialysate to a concentration of 70mM glutaraldehyde, the mixture incubated for 2 hours at room temperature, more glutaraldehyde added to bring its total added concentration up to 140 mM, incubation continued for another 6 hours and the mixture then dialyzed against PBS. 50 gg of the glutaraldehyde cross-linked lymphotoxin (hereafter, polylymphotoxin) and 0.5 ml of Freund's complete adjuvant was injected subcutaneously into mice (strain BALB/c). After one week, the mouse was booster immunized with 50 gg of polylymphotoxin and 0.5 ml of Freund's incomplete adjuvant, half intramuscularly and half into the peritoneal cavity. Serum was harvested after 7 days and assayed for anti-lymphotoxin activity by an ELISA assay.
The ELISA assay was conducted as follows: A buffered solution of purified lymphotoxin was placed in microtiter wells and permitted to coat the wells with about 100 ng of lymphotoxin each. The unadsorbed lymphotoxin solution was aspirated from the wells. 50 gl of appropriately diluted test sample was combined with 100 gl PBS containing 5 mg/ml bovine serum albumin (PBS-BSA buffer) and added to each well, incubated for 2 hours at room temperature, washed with PBS containing 0.05 percent Tween 20, 100 gl of horse radish peroxidase-labelled goat anti-mouse IgG in PBS-BSA buffer added to each well and incubated for 1 hour. Each well was washed with PBS containing 0.05 percent Tween 20 and then citrate phosphate buffer, pH5, containing 0.1 mg o-phenylene diamine/ml (substrate solution) and aqueous 30 percent (at a proportion of 4 gl of 30 percent v/v Hg02 per 10 ml of substrate solution) was
3499Y added to each well. The wells were incubated for 30 min., the reaction stopped with 50 μΐ 2.5M sulfuric acid and adsorbance measured at 492 nm. Wells which showed adsorbance greater than 1
0.0. were considered anti-lymphotoxin positive.
Test samples also were assayed for the ability to neutralize the cytolytic activity of lymphotoxin in the murine L929 assay. Serum harvested from immunized animals or hybridoma supernatants were diluted as required into RPMI-1640 medium containing 10 percent fetal bovine serum and about 100 lymphotoxin units/ml and plated into microtiter wells containing cultured L929 cells as is otherwise conventional in the cytolysis assay. In the control, all cells were lysed. Neutralizing antibody was detected by failure of the lymphotoxin to lyse L929 cells.
The animal immunized with glutaraldehyde-polymerized lymphotoxin raised antibodies which were active in the ELISA assay, but no serum neutralizing activity was detected.
A suspension containing 100 ug lymphotoxin and 1 ml of a 1.64 percent w/v suspension of aluminum hydroxide [(Al(OH)-j] was prepared and used to immunize the same mouse. The mouse was injected with 100 μΐ of the suspension intramuscularly and 400 μΐ intraperitoneally. After one week the mouse was injected intravenously with 10 ug of unpolymerized and unadsorbed lymphoblastoid lymphotoxin in 100 μΐ of PBS. A test of a 1/80 dilution of the animal's serum three days later indicated the presence lymphotoxin neutralizing antibody.
The spleen from this animal was harvested. 3xl0<sup>7</sup> spleen cells were fused with 5x10? murine niyeloma cells and plated into microtiter wells containing HAT medium and about 3000 peritoneal macrophages/microtiter well according to the procedure of S. Fazekas De St. Groth, 1980, J. Immunol. Meth. 35: 1-21. Hybridomas from wells containing supernatants which were positive in the above ELISA
3499Y assay were grown in 1 ml volume of DMEM medium with 20 percent fetal calf serum, 10 percent MCTC-135 medium, 5 x 10<sup></sup> M betamercaptoethanol and HAT, distributed into microtiter wells at a statistical average of one cell per well and then cultured in a 1 or
5 ml volume of the same medium. Supernatants were thereafter assayed for neutralizing antibody. Statistically, about 2 percent of the ELISA positive hybridomas from the aluminum hydroxide immunization synthesized neutralizing antibody. High affinity lymphotoxin antibody optionally is selected from this group of 10 hybridomas.
EXAMPLE
Site-Specific Mutagensis of Lymphotoxin 15
The method of Example 3 is followed exactly in this example except that segment 6 of the synthetic oligonucleotide was modified to have the sequence 5<sup>,</sup>CTCAACTCTGCACCCA3' and its complementary strand (segment 53) modified to have the sequence
3'AGACGTGGGTCGTCGT5'.
The modified oligonucleotides are annealed to the remaining oligonucleotides and ligated into the expression vector as described in Example 6. This vector contains a 2 bp substitution which changed the lysine +28 codon from lysine to histidine. The histidine mutant is expressed upon transformation of £. coli ATCC 31446.
Other site-directed mutants are prepared in the same fashion, preferably selecting codons so as to not introduce an EcoRI restriction site that would require the use of a partial EcoRI restriction digest in the digestion of pLTXBl called for in Example
3. Nor should the mutations introduce additional Xbal or BamHI sites into Fragment A (see Fig. lb), BamHI or Hindlll sites into
Fragment 8 or Hindlll or Bglll sites into Fragment C. Otherwise,
3499Y partial digestions will be required to properly assemble the pLTXBl mutant; digestion to completion would yield a deletion mutant rather than the substitution mutant that is the objective in this case.
Example 10
Identification of Genomic DNA Encoding Murine and Bovine Lymphotoxin; Amino Acid Sequence of Murine and Bovine Lymphotoxin
The murine and bovine lymphotoxin genes were isolated from genomic-λ libraries. The human lymphotoxin cDNA fragment
קר (PvuII-EcoRI, 600bp) was radiolabeled with P by nick translation and used as a probe to screen a murine genomic DNA-λ library (M600 strain murine genomic DNA in xCharon4A, T. Maniatis et al_., Molecular Cloning, p. 31, 1982) and, independently, a bovine genomic DNA library (EP 88622A). Hybridization was performed at low stringency in 20 percent formamide (Gray and Goeddel P.N.A.S. USA
80: 5842-5846 [1983]) and filters were washed twice in an aqueous solution of 0.3M sodium chloride, 0.03M sodium citrate and 0.1 percent SDS. Several phage that hybridized with the human lymphotoxin probe were plaque purified (T. Maniatis et ak, Cell 15; 687-701 [1978]). Phage DNA was prepared (T. Maniatis et al.,
Cell 15: 687-701 [1978]), digested with restriction endonucleases and analyzed by Southern hybridization. A 3500 bp EcoRI murine DNA fragment and a 2200bp EcoRI bovine DNA fragment each hybridized with the human lymphotoxin probe. These DNA fragments were subcloned into plasmid pBR322 and then sequenced by the di deoxy chain-termination method (A.J.H. Smith Methods in Enzymology 65: 560-580 [1980]). The deduced protein sequence of murine and bovine lymphotoxin, along with that of human lymphotoxin for comparison, is presented in Fig. 4.
3499Y
EXAMPLE 11
Expression of Lymphotoxin in Yeast
Under the Control of the ADH Promoter
Plasmid pLTtrpl is digested with Xbal in order to open the plasmid at the Xbal site just proximal to the lymphotoxin start codon. The Xbal cohesive terminii are blunted by the Klenow fragment of £. coli DNA polymerase I with four dNTPs. An EcoRI
0ן adaptor
OH 5' <sup>,</sup>־AATTCCCGGG 3' <sub>r</sub>GGGCCC-P 5' 3’ OH is ligated to the blunted plasmid fragment, the protruding 5' <sup>15</sup> hydroxyl termini! phosphorylated using polynucleotide kinase, the ligation mixture used to transform £. coli ATCC 31446 and a plasmid pLTtrplRl identified by restriction analysis that contains an additional EcoRI site proximal to the lymphotoxin start codon. Plasmid pLTtrplRl is isolated, digested with EcoRI and the <sup>2</sup>θ lymphotoxin DNA-containing fragment SP recovered.
Plasmid pFRPn (EP 60,057A) is digested with EcoRI, treated with alkaline phosphatase to prevent recircularization, ligated to the SP lymphotoxin fragment using T4 DNA ligase and the ligation <sup>25</sup> mixture then used to transform £. coli ATCC 31,446. Ampicillin resistant colonies yield two series of plasmids having the SP insert in opposite orientations as determined by restriction analysis on agarose electrophoresis gels. Plasmids are purified from £. coli transformants and used to transform yeast having the trpl mutation <sup>3</sup>θ (for example yeast strain RH218, unrestricted ATCC deposit No. 44076) to the trp<sup>+</sup> phenotype. Plasmids oriented such that the start codon of segment SP is located adjacent to the alcohol dehydrogenase promoter fragment are found to transform the yeast to lymphotoxin expression. Lymphotoxin is recovered from extracts of OE the yeast transformants. The plasmid stability in large scale
3499Y fermentations can be improved by employing an expression plasmid containing the 2 micron origin of replication in place of the pFRPn chromosomal origin of replication (ars 1) and a compatible host strain (J. Beggs, 1978, Nature 275: 104-109).
EXAMPLE 12
Expression of Lymphotoxin in Mammalian Cells xLTll (Example 2) is digested with EcoRl and the lymphotoxin-containing DNA fragment (the reverse transcript) recovered. Plasmid pEHER (EP 117,060A) is digested with EcoRl, treated with calf intestinal alkaline phosphatase, and ligated to the EcoRl-linkered reverse transcript of xLTll. The resulting plasmids grown on £. coli ATCC 31446 (EP 117.060A) and designated pEHERLT I and pEHERLT II. They contained the lymphotoxin DNA in opposite orientations as determined by restriction analysis on polyacrylamide gels. These plasmids are used to transfect and select CHO DHFR-DUX-B11, CHO 1 and Ltk־cells.
Tissue culture cells are transfected by mixing 1 ug of pEHERLT I or pEHERLT II as prepared above with 10 pg rat carrier DNA in a volume of 250 μΐ, 0.25 M CaC12״ followed by dropwise addition of 250 μΐ HEPES buffered saline (280 mM MaCl, 1.5 mM Na<sub>2</sub>P0<sub>4</sub>, 50 mM HEPES, pH 7.1). After 30 minutes at room temperature, the solution is added to tissue culture cells growing in 60 mm plastic tissue culture dishes. CHO 1, CHO DHFR-DUX-B11, and Ltk’cells are used. The dishes contain 3 ml culture medium appropriate to the host cell.
For CHO 1 and CHO DHFR-DUX-B11 cells, the medium is Ham F-12 media (Gibco) supplemented with 10 percent calf serum, 100 μ/ml penicillin 100 μς/ιηΐ streptomycin, and 2 pmM L-glutamine. For the Ltk־cell line, the medium is Dulbecco modified Eagle's medium (DMEM) supplemented as above.
3499Y /2
After 3-16 hours, the medium is removed and the cells are washed with 20 percent glycerol in phosphate buffered saline. Fresh medium is added to each plate and the cells are incubated for 2 more days.
Selection of transfected host cells is carried out by trypsinizing the cells after 2 days growth (which comprises treating the cells with sterile trypsin 0.5 mg/ml containing 0.2 mg/ml EDTA) and adding about 3xl0<sup>5</sup> cells to 10 mm tissue culture plates with selective media. For dhfr cells the medium is a formulation of (F-12 GIBCO) medium lacking glycine, hypoxanthine, and thymidine (GHT־ medium). For DHFR<sup>+</sup> host cells, methotrexate (100 - 1000 nM) is added to the normal growth medium. Controls are run using transfection conditions with no plasmid and with plasmid pFD-11 (EP 117.060A) containing normal OHFR. Colonies arising from cells which take up and express the DHFR plasmid are apparent within 1-2 weeks. Transformants are identified that express mature lymphotoxin.
The foregoing description might include matter which is not claimed but which is retained herein lor the sake 01'completeness,
Contents34
17 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17
67 members in 25 offices
Priority claims12
| Document | Office | Kind | Date |
|---|---|---|---|
| 61650284 | United States of America | A | |
| 61650284 | United States of America | A | |
| 61650384 | United States of America | A | |
| 61650384 | United States of America | A | |
| 73231285 | United States of America | A | |
| 73231285 | United States of America | A | |
| 7531885 | Israel | A | |
| 7531885 | Israel | A | |
| IL19850075318 | – | – | – |
| US19840616502 | – | – | – |
| US19840616503 | – | – | – |
| US19850732312 | – | – | – |
Members67
| Document | Office | Kind | |
|---|---|---|---|
| DK241385D0 | Denmark | D0 | |
| PT80573A | Portugal | A | |
| IL75318D0 | Israel | D0 | |
| GR851317B | Greece | B | |
| IE851321L | Ireland | L | |
| IE930589L | Ireland | L | |
| DK241385A | Denmark | A | |
| FI852143L | Finland | L | |
| NO852173L | Norway | L | |
| AU4320385A | Australia | A | |
| EP0164965A2 | European Patent Office (EPO) | A2 | |
| HUT37814A | Hungary | A | |
| PL253739A1 | Poland | A1 | |
| JPS6156197A | Japan | A | |
| ZA854135B | South Africa | B | |
| PT80573B | Portugal | B | |
| EP0164965A3 | European Patent Office (EPO) | A3 | |
| ES8802182A1 | Spain | A1 | |
| YU91985A | Yugoslavia, later Serbia and Montenegro (until 2006) | A | |
| RO93651A | Romania | A | |
| RO93651B | Romania | B | |
| AU599303B2 | Australia | B2 | |
| US4959457A | United States of America | A | |
| RO100383B1 | Romania | B1 | |
| NZ212207A | New Zealand | A | |
| NZ226980A | New Zealand | A | |
| RO100383A2 | Romania | A2 | |
| HU204085B | Hungary | B | |
| PL155410B1 | Poland | B1 | |
| EP0509553A1 | European Patent Office (EPO) | A1 | |
| IL104297D0 | Israel | D0 | |
| EP0164965B1 | European Patent Office (EPO) | B1 | |
| AT95243T | Austria | T | |
| ATE95243T1 | Austria | T1 | |
| DE3587597D1 | Germany | D1 | |
| AR245219A1 | Argentina | A1 | |
| BG60256B1 | Bulgaria | B1 | |
| BG60256B2 | Bulgaria | B2 | |
| DE3587597T2 | Germany | T2 | |
| IL75318A | Israel | A | |
| FI93025B | Finland | B | |
| FI93025C | Finland | C | |
| IE63487B1 | Ireland | B1 | |
| DK56995A | Denmark | A | |
| JPH07250692A | Japan | A | |
| JPH07291995A | Japan | A | |
| YU47735B | Yugoslavia, later Serbia and Montenegro (until 2006) | B | |
| NO179075B | Norway | B | |
| NO179075C | Norway | C | |
| JP2521703B2 | Japan | B2 | |
| SK278333B6 | Slovakia | B6 | |
| SK393085A3 | Slovakia | A3 | |
| DK171531B1 | Denmark | B1 | |
| CZ393085A3 | Czechia | A3 | |
| US5683688A | United States of America | A | |
| CZ283148B6 | Czechia | B6 | |
| DK172382B1 | Denmark | B1 | |
| IL104297AThis record | Israel | A | |
| JP2804237B2 | Japan | B2 | |
| US5824509A | United States of America | A | |
| CA1340641C | Canada | C | |
| EP0509553B1 | European Patent Office (EPO) | B1 | |
| AT195323T | Austria | T | |
| ATE195323T1 | Austria | T1 | |
| DE3588225D1 | Germany | D1 | |
| US6177543B1 | United States of America | B1 | |
| DE3588225T2 | Germany | T2 |
4 legal events, as the office reported them to INPADOC
Over the term
Point at a mark for the eventEvents
| Event | Code | |
|---|---|---|
| Patent renewedKB | KB | |
| Patent renewedKB | KB | |
| Patent renewedKB | KB | |
| Patent grantedGrantedFF | FF |
Numbers
- Publication, DOCDB
- 104297
- Publication, EPODOC
- IL104297
- Application
- 104297
- Application, DOCDB
- 10429785
- Application, EPODOC
- IL19850104297
Titles
- English
- Lymphotoxin nucleic acid encoding it vectors incorporating the nucleic acid and cells transformed therewith and methods of obtaining lymphotoxin
Classification
- IPC, 8
- C07K14 52
- C12N
- C12N1 19
- C12N5 10
- C12N15 19
- C12N15 63
- C12P21 02
- C12Q1 68
