Reduction of nonspecific hybridization by using novel base-pairing schemes

CHIRON CORPORATION, EMERYVILLE, CA,

UNITED STATES OF AMERICA

inventors:

COLLINS Mark, WALNUT CREEK, CA

HORN Thomas, BERKELEY, CA,

SHERIDAN Patrick, SAN LEANDRO, CA

WARNER Brian, MARTINEZ, CA

URDEA Michael, ALAMO, CA

USA

Date of filing: 30.08.1995

Priority: August 30, 1994 (08 / 298,073),

USA

International Application Number: PCT / US95 / 11115

International Publication Number WO 96/06950

The present invention relates generally to nucleic acid chemistry and hybridization assays. More specifically, the present invention provides methods for generating more target-specific signals in nucleic acid hybridization assays, minimizing background noise primarily derived from non-specific hybridization.

Nucleic acid hybridization assays are commonly used in genetic research, biomedical research, and clinical diagnosis. In a nucleic acid hybridization assay, a single-stranded nucleic acid to be analyzed is hybridized to a labeled single-stranded nucleic acid probe and the resulting labeled duplexes are detected. Various variants of this basic scheme have been developed to increase accuracy, facilitate separation of duplexes to be selected from other materials, and / or multiply the detected signal.

The present invention relates to a method for reducing background noise in any nucleic acid hybridization assay. Generally, background noise generated by currently known techniques results from an undesirable interaction of the various polynucleotide components used in a given assay, that is, an interaction that produces a signal that has nothing to do with the presence or amount of the nucleic acid to be analyzed. The invention can be used with many different assays. in which various hybridization steps are performed to generate a detectable signal that correlates with the presence or amount of a polynucleotide to be analyzed.

Such an assay is described in detail in U.S. Patent Application No. 4,868,105 to Urdea et al., Which is incorporated herein by reference. This assay involves the use of a two-part capture system designed to bind the polynucleotide to be analyzed to a solid support, as well as a two-part labeling system designed to connect the detectable label to the analyte to be detected or quantified. The two-part capture system uses capture probes linked to a solid support as well as capture extender molecules that hybridize to a segment of both the capture probes and the analyzing polynucleotide. The two-part labeling system uses labeled extender molecules that hybridize to a segment of the polynucleotide to be analyzed, as well as labeled probes that hybridize to the labeled extender molecules and contain or bind a detectable label. The advantage of such a system is that many hybridization steps have to take place so that the label can be detected to correlate with the presence of the molecule to be analyzed, if two different hybridization reactions are required to capture the analyte and similarly two different hybridization reactions are required. play to mark the molecule to be analyzed. However, there are many different ways in which a detectable signal can be generated such that it has nothing to do with the presence or amount of the molecule being analyzed, and these will be discussed in more detail below.

Another example of an assay in which the present invention is well applicable is the signal multiplication method described in Urdea et al., U.S. Patent No. 4,868,105, the disclosure of which is incorporated herein by reference. In this method, the signal is amplified through amplification multimers, which polynucleotides are made to include a first segment that specifically hybridizes to the labeled extenders, and includes many identical second segments that specifically hybridize to a labeled probe. The rate of multiplication is theoretically proportional to the number of iterations of the second segment. Multimers can be linear or branched. Branched multimers may have the shape of a fork or comb, but comb-type multimers are preferred.

One method for solving the problem of interfering background noise in nucleic acid hybridization assays is described in WO95 / 16055, wherein at least two capture extenders and / or two or more tag extenders must bind to a tag molecule to produce a detectable signal. To further reduce background noise, the assay is conducted under conditions that favor the formation of multicomponent complexes.

Another approach proposed to enhance target dependence in a hybridization assay is described in EPA Patent 70,685 to Heller et al. It describes a homogeneous hybridization process in which a non-radiation energy transfer occurs between adjacent probes; two separate events must occur in order for the target signal to be generated, thus enhancing the accuracy of the detection.

It is a further object of the present invention to enhance the detection and quantification accuracy of the polynucleotides to be analyzed in hybridization assays. The method of the present invention enhances both the sensitivity and specificity of such assays by reducing the frequency of signal generation occurring in the absence of the target and does not increase the time or cost relative to current assay configurations.

The object of the present invention, namely the reduction of background noise and the detection and quantification of analytical molecules, has been achieved in nucleic acid hybridization methods, in part by using nucleoside variants which generate base pairs by unnatural hydrogen bonds. Hereinafter, the unnatural base pair is a base pair formed between other nucleotide units and not between adenosine (A), thymidine (T), cytidine (C), guanosine (G) or uridine (U). Such an unnatural nucleoside base pair is formed between isocytosine (isoC) and isoguanine (isoG). IsoC and isoG can create a base pair with standard geometry (i.e., a Watson-Crick base pair) but create hydrogen bonds that are not found between cytosine (C) and guanine (G). (Formula I; Formula II)

Leach et al. Applied molecular mechanics, molecular dynamics, and free energy perturbation calculations to study the structure and stability of the isoC * isoOG base pair [Leach et al., J.Am. Soc., 114, 3675-3683 (1992). Tor et al. Disclose a method in which a modified isoC in a DNA template controls the incorporation of an isoG analog into the transcribed RNA product [Tor et al., J.Am. Chem. Soc.

4461-4467 (1993). Switzer et al., Study the conditions under which the base pair formed between isoC and isoG can be incorporated into DNA and RNA by DNA and RNA polymerases (Switzer and Biochemistry 32: 10489-10496 (1993)).

al

" · · · · · * • the·· ·"· · · * · · ·

The introduction of a new base pair into DNA oligomers offers the opportunity to more accurately control hybridization.

The present invention relates to methods and kits for the detection of nucleic acids to be analyzed in a sample. The methods generally provide an improvement in nucleic acid hybridization assays, such as in situ hybridization assays, Southern biota, Northern biota, dota biota, and polymerase chain reactions. More specifically, the methods result in an improvement in the solution phase sandwich hybridization assays, which include binding of the analyte to a solid support, labeling of the analyte, and detecting the presence of the label on the support. Preferred methods include the use of amplification multimers which allow the binding of significantly more labels in the molecule probe complex to be analyzed, thereby enhancing the sensitivity and specificity of the assay.

The present invention relates to a method of incorporating one or more nucleotide units capable of forming base pairs other than adenosine (A), thymidine (Τ), cytidine (C), guanosine (G) or uridine (U) into components of the nucleic acid hybridization assay. non-targeted hybridizing oligonucleotide segments, i.e., universal segments. This use of such nucleotide units results in unique base-pairing schemes that are · 4 · 7 4 * • * ··· * · · · · · · · · · · · · «·· · * results in an increase in binding specificity between universal segments.

The present invention relates to an assay in which at least one first nucleotide unit which is not A, T, C, G or U but which is capable of forming a base pair with another nucleotide unit other than A, T, C, G or U is incorporated into the assay. nucleic acid sequences which are complementary to the nucleic acid sequences of the test components which are other than the target molecule. For the base pair between two such nucleotide units, the following examples (III to VI) are provided. wherein R is a backbone that allows these bases to form a base pair with a complementary nucleotide unit when incorporated into a polynucleotide, R 'may be, for example, hydrogen, methyl, a- or β-propynyl, bromine, fluorine, iodine or similar. The incorporation of such nucleotide units into so-called universal sequences, i.e., sequences that are not involved in hybridization with the analyzing molecule, greatly reduces non-specific hybridization. In one preferred embodiment, the first and second nucleotide units alternately comprise isocytidine and isoguanosine as shown in Figure III. formula.

The invention further provides an assay in which the complex T between the molecule to be analyzed and the carrier bound probes_ml the melting temperature of a • V

<img file="HUT77754A_D0001.tif" />

- 9 or more distinct capture extender molecules and / or label extender and amplifier or preamplifier extender modifier, significantly lower than complex T formed between labeled probes and amplifier_Ra2melting temperature. In this regard, the assay is performed under conditions that favor the formation of hybrid complexes. The conditions are then changed during the assay to destabilize T_ml hybrid complexes.

The invention further relates to a method for carrying out hybridization assays which combine the aforementioned techniques, i.e., incorporating nucleotide units other than A, T, C, G or U into the universal segments of the assay components and wherein the T_ml hybrid complexes have a much lower melting point than T_m2 melting temperature of hybrid complexes.

The invention also relates to a novel process for the synthesis of isoguanosine or 2'-deoxyisoguanosine.

Finally, the invention relates to kits containing the components required for the described and patented tests.

BRIEF DESCRIPTION OF THE DRAWINGS FIG.

Figure 1 is a dia10 gram of a solution-phase sandwich hybridization assay used previously in the literature in which the universal sequences are indicated by bold lines.

Figure 2 shows the binding of probes to double-stranded DNA, in which bold lines denote the universal sequences.

Figure 3 illustrates the use of probes and competimers containing non-natural nucleotides to block non-specific hybridization.

The definitions and nomenclature used herein are summarized below.

Before describing the present invention in detail, it should be understood that the present invention is not limited to specific assay forms, materials, or reagents, as these may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing certain embodiments only, and is not intended to limit the scope of the invention.

Reference is made in this specification and the following claims to a number of definitions, the meanings of which are given below:

As used herein, the terms polynucleotide and oligonucleotide generally refer to polydeoxyribonucleotide (containing 2-deoxy-D-ribose), polyribonucleotide (containing D-ribose), and include any other type of polynucleotide that is a purine or pyrimidine base N- or C-glycoside and other non-nucleotide backbone polymers, such as polyamide (e.g., peptide nucleic acid (PNAk)) and polymorpholino (commercially available as Ne-Virals, Inc., Corvalis, Oregon, Neugene ™ polymers) and other synthetic sequence-specific nucleic acid polymers, provided that the polymers contain nucleobases in a configuration that allows base pairing and base accumulation, such as that found in DNA and RNA, for example. We do not intend to distinguish between polynucleotide and oligonucleotide terms in terms of length, and use these terms interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms apply to double-stranded and single-stranded DNA as well as double-stranded and single-stranded RNA, DNA: RNA hybrids, and hybrids formed between PNAs and DNA or RNA, and. apply to modifications of the known type, such as labels known to those skilled in the art, methylation, caps, replacement of naturally occurring nucleotides with an analog, internucleotide modifications such as by uncharged bonds (e.g., methylphosphonates, phosphotriesters, carbamates, etc.), with negatively charged bonds (e.g., phosphorothioates, phosphorodithioates, .. etc.) and positively charged bonds (such as aminoalkyl12 phosphoramidates, aminoalkyl phosphotriesters), units containing linking units such as proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators containing units (such as acridine, psoralen, etc.), units containing chelators (such as metals, radioactive isotopes, boron, oxidative metals, etc.), alkylated units, modified bond units (such as alpha-anomeric nucleic acids, etc.) and unmodified forms of the polynucleotide or oligonucleotide.

It will be appreciated that in the following the terms nucleoside and nucleotide refer to units containing not only known purine and pyrimidine bases, but also other heterocyclic bases which have been modified. Such modifications include methylated purines or pyrimidines, acylated purines or pyrimidines and other heterocycles. Modified nucleosides or nucleotides may be modifications to the sugar moiety, e.g., in which one or more hydroxy groups are replaced by a halogen atom, an aliphatic group, or as ethers, amines, etc. functionalized. The term nucleotide unit is intended to encompass nucleosides and nucleotides.

Further, modifications of the nucleotide units include rearrangement, linkage, substitution, or other functionalities on the purine or pyrimidine base that form hydrogen bonds with a suitable complementary pyrimidine or purine. The resulting modified nucleotide unit is capable of forming base pairs with other such modified nucleotide units, but not with the A, T, C, G or U nucleotides. Standard AT and GC pairs are formed under conditions that allow the formation of hydrogen bonds in thymidine N³-H and C⁴-oxy group and adenosine N¹- and C²-NH2; and cytidine C²-oxy, N³- and C⁴-NH2 group and guanosine C²NH₂, N³-H and C⁶-oxy groups. Thus, for example, guanosine (2-amino-6-oxy-9-pD-ribofuranosylpurine) can be modified to produce isoguanosine (2-oxy-6-amino-9-pD-ribofuranosylpurine). These modifications result in a nucleoside base that is no longer capable of effectively forming base pairs with cytosine. However, modification of cytosine (1βD-ribofuranosyl-2-oxy-4-aminopyrimidine) to give isocytosine (Ι-β-D-ribofuranosyl-2-amino-4-oxypyrimidine) yields a modified nucleotide which it is no longer able to form base pairs effectively with guanosine, but it forms base pairs with isoguanosine. Isocytosine is available from Sigma Chemical Company (St. Louis, MO); isocytidine may be prepared by the method described by Switzer et al., 1993, (Switzer et al., Biochemistry 32, 10489-10496, and citations therein); 2'-deoxy-5-methylisocytidine can be prepared by the method of Tor et al., Tor et al., J.Am. Chem. Soc. 115, 4461-4467 (1993), and citations therein]; isoguanine nucleotides; or

Switzer et al., Mantsch et al., 1993, Biochemistry 32: 10489-10496; Mantsch et al., 1993, Biochem. 14, 5593-5601, and citations therein] or by the method described below. In III. The unnatural base pairs described in Formula II, hereinafter referred to as κ and π, are described by Piccirilli et al., 2,6-diaminopyrimidine and its complement (1-methylpyrazolo [4,3] -pyrimidine-5,7- (4H, 6H) -dione Other such modified nucleotide units capable of forming specific base pairs have been described by Leach et al., and Switzer et al., J.Am., et al., Nat. 343: 33-37 (1990). . Chem. Soc. 1992, 114, 3675-3683; Switzer et al., Biochemistry 32: 10489-10496 (1993)], and those which are apparent to one of ordinary skill in the art.

The term polynucleotide to be analyzed refers to a single-stranded or double-stranded nucleic acid molecule; which contains a target nucleotide sequence. Elemental nucleic acids can be derived from a variety of sources, such as biological fluids or solids, food, environmental materials, etc., and can be prepared by a variety of methods for hybridization analysis, such as proteinase K / SDS, chaotropic salts, or the like. The term polynucleotide to be analyzed is used interchangeably with the term molecule to be analyzed, nucleic acid to be analyzed, and target.

Hereinafter, the term target region or target nucleotide sequence refers to a probe binding region in the target molecule. The target sequence term refers to a sequence by which the probe forms a stable hybrid under the desired conditions.

Hereinafter, the term probe refers to a structure in a polynucleotide as defined above, comprising a nucleic acid sequence that is complementary to the nucleic acid sequence in the target molecule. Polynucleotide regions of the probes may be DNA and / or RNA and / or synthetic nucleotide analogs.

Obviously, binding sequences do not need to be perfectly complementary to form stable hybrids. In many cases stable hybrids result in mismatches in less than 10% of the bases, neglecting loops of four or more nucleotides. Accordingly, the term complementary as used herein refers to an oligonucleotide that forms stable duplex complement under the assay conditions and generally has a homology of about 90% or greater.

The term nucleic acid multimer or amplification multimer refers herein to a linear or branched polymer comprising either the same repeating single-stranded oligonucleotide segment or different single-stranded polynucleotide segments each containing a region complementary to a nucleic acid in a candidate probe; the oligonucleotide segments may be derived from DNA, RNA, modified nucleotides, or combinations thereof. The sequence, length, and composition of at least one of the segments allow specific binding to a candidate probe; in addition, at least the sequence, length, and composition of one segment allow it to specifically bind to a labeling extender or pre-amplifier. Typically, such segments will generally contain between 15 and 50, preferably between 15 and 30 nucleotides, and their GC content will vary between 20 and 80%. The total number of oligonucleotide segments in the multimer may be between 3 and 1000, more typically between 10 and 100, and most typically about 50 ... The multimeric oligonucleotide sequences may be directly covalently linked to one another via phosphodiester linkages or via intervening linking agents such as nucleic acid, amino acid, carbohydrate or polyol bridges or other crosslinking agents capable of crosslinking nucleic acids or modified nucleic acids. Alternatively, the multimer may comprise oligonucleotide segments that are not covalently linked but otherwise linked, such as by hybridization. Such a multimer is described, for example, in U.S. Patent No. 5,175,270 to Nielsen et al. The linkage may be at the ends of the segment (either in the normal 3 '-5' orientation or in a random orientation) and / or at one or more internal nucleotides in the strand. In linear multimers, the individual segments are linked end-to-end to form linear polymers. In one type of branched multimer, three or more oligonucleotide segments arise from a single point, forming a branched structure. The starting point may be another nucleotide segment or a multifunctional molecule to which at least three segments may be covalently linked. In another type, there is an oligonucleotide segment backbone with one or more appendages with oligonucleotide segments. The latter type of multimers have a fork-type, comb-type or combination fork-comb structure where

<img file="HUT77754A_D0002.tif" />

comb-type multimers are preferred multimers of the present invention. These are polynucleotides having a linear backbone with side chains extending from the backbone. Dependent segments are generally bound to a modified nucleotide or other organic moiety having appropriate functional groups to which the oligonucleotides may be conjugated or otherwise attached. The multimer may be completely linear, fully branched, or a combination of linear and branched portions. Generally, there are at least two branching points in the multimer, more preferably three, most preferably between 5 and 30, although in some embodiments there may be more. The multimer may comprise one or more double-stranded sequences. Further information on multimer synthesis and specific multimer structures can be found in U.S. Patent No. 5,124,246 to Urdean et al.

PCT Publication No. WO92 / 02526 describes comb-type multimers which are particularly preferred in the present invention and which comprise a linear backbone and protruding side chains; the backbone has a segment that provides a specific hybridization site for the analyte nucleic acid or nucleic acid bound to the analyte nucleic acid, while the protruding side chains contain iterations of a segment which

<img file="HUT77754A_D0003.tif" />

provides a specific hybridization site for a candidate probe.

As noted above, a pre-amplification molecule can also be used which can serve as a linker between labeled extender molecules and amplification multimers, thus more amplifying and thus more labels are bound to a given target-probe complex. The pre-amplifying molecules may be linear or branched and typically contain 30-3000 nucleotides. In a preferred embodiment, the pre-amplifying molecule binds to at least two different labeled extender molecules such that the final accuracy of the assay is enhanced (i.e., because a number of hybridization events are required to form the probe-target complex).

Hereafter, the term biological sample refers to a sample of tissue or fluid isolated from an individual, including, but not limited to, plasma, serum, spinal fluid, semen, lymphatic, external sections of the skin, respiratory, digestive and genital organs. , tears, saliva, milk, blood cells, tumors, organs, and components of in vitro cell cultures (including, without limitation, cells, or virally infected cells, conditioned media and cellular components derived from the growth of recombinant cells in culture medium). The method of the present invention is a preferred use in the detection and / or quantification of nucleic acids: (a) from viral nucleic acids such as hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), human; immunodeficiency virus (HIV) and herpes virus families, including herpes zoster (chicken pox), herpes simplex I&amp;I, cytomegalovirus, EpsteinBarr virus, and recently isolated Herpes VI virus; (b) bacterial nucleic acid such as from Chlamydia, Mycobacterium tuberculosis, etc .; and (c) a number of human sequences of interest.

As used herein, the term "non-specific hybridization" refers to events when a segment of a first polynucleotide that is to be hybridized to a segment of a selected second polynucleotide generates an error, i.e., a situation where the label can be detected by the target analyte molecule. .távollétében. The use of the term hybridizing excludes non-Watson-Crick base pairs.

As used herein, the term non-specific binding is used to refer to events in which a polynucleotide binds to a solid support or other component of the assay system through an interaction, which may be direct or indirect, that does not involve hydrogen bonding to the carrier-bound nucleotides.

• · · · · · • · · · · · ··*· ··· ·· ♦ ·

In preferred embodiments shown in Figure 1, the following terms may be used in the hybridization assay described. It should be noted that in Figure 1, the universal sequences are indicated by bold lines for clarity.

Labeling extender molecules (LEs), also referred to hereinafter as labeling extenders, contain complementarity regions for the polynucleotide to be analyzed and for the amplification multimer (AMP). When using a pre-amplifier (not shown), labeled extender molecules bind to this intermediate species rather than directly to the amplification multimer. When neither a pre-amplifier nor an amplifier is used, the labeled extender molecules bind directly to a sequence in the labeled probe (LP). Thus, the tagging extender molecules are single-stranded polynucleotide chains having an L1-labeled nucleic acid sequence complementary to a sequence of the polynucleotide to be analyzed, and a second universal region having a multimeric recognition sequence L-2 complementary to the tagging pr M1 segment, amplification multimer or pre-amplifier.

Labeled probes (LPs) are designed to either multiply the labeled extender or, if an amplification fusion multimer is used in the assay, the multiplication probes (LPs). · ··· ·· · · mer to a repeating segment of an oligonucleotide. Thus, the LPs contain an L-3 nucleic acid sequence complementary to an M-2 nucleic acid sequence that is located in the repeating oligonucleotide units of the multimer, or is structured to bind to a label that is directly or indirectly to produce a detectable signal.

Capture extender molecules (CEs), also referred to as capture extenders, bind to the analyzing polynucleotide and capture probes, which in turn bind to a solid support. Thus, the capturing extender molecules are single-stranded polynucleotide chains having a first region of a polynucleotide sequence comprising a region of nucleic acid sequence Cl, which is complementary to a sequence of the analyte molecule, and a second non-complementary region having a region C-2. capture probe sequence. The Cl and L1 sequences are not identical non-complementary sequences, but they are complementary to physically different sequences of the molecule being analyzed.

Clamping probes (CPs) bind to clamping extenders and a solid support. Thus, as shown in Figure 1, the C-3 nucleic acid sequence of the capture probes is complementary to C-2 and covalently binds (or is capable of covalently binding) to a solid support.

• · · · ♦ · • · · · · ♦ ···· ··· ·· » ·

Liquid-phase hybridization assays using the system shown in Figure 1 are performed as follows. The single-stranded nucleic acid to be analyzed is incubated under capture hybridization conditions with the capture extenders and the labeling extenders. The product obtained is a nucleic acid complex formed between the polynucleotide to be analyzed bound to the capture extenders and the labeling extenders. This complex may then be added under hybridization conditions to a solid phase containing probes bound to its surface; however, in a preferred embodiment, the initial incubation is performed in the presence of support-bound capture probes. The product obtained contains the solid phase bound complex through the capture molecules and the capture probes. The solid phase is then separated from the unbound material by the bound complex. Optionally, then, an amplification multimer, preferably a comb-type multimer, as described above. adding to the solid phase assay molecule probe complex under hybridization conditions to allow the multimer to hybridize to the LEs; when using pre-amplification probes, the solid phase assay molecule probe complex is incubated with pre-amplification probes either with the amplification multimer or preferably with the amplification multimer before incubation. The resulting solid phase complex is then separated by washing from any unbound pre-amplifier and / or multimer 24. Labeled probes are then added under conditions that allow them to hybridize with LEs or, if amplification multimers are used, with repetitive oligonucleotides of the multimer. The resulting solid phase labeled nucleic acid complex is then washed to remove unbound oligonucleotide and weighed. It should be noted that the components shown in Figure 1 are not necessarily dimensioned and that amplification multimers, when used, contain much more repetitive oligonucleotide segments than those shown (as explained above), all of which were designed to bind a candidate test.

In particular, the present invention is directed to eliminating sources of background noise by minimizing the interaction between capture probes and capture extender molecules with labeled probes, labeled extender molecules, and amplifiers, reducing the likelihood that improper units will bind to carrier-bound capture probes. .

Hybridization between complementary oligonucleotide sequences is based on the condition that the purine and pyrimidine nucleotides contained therein are capable of forming stable base pairs. Between the five natural nucleotides, adenosine (A), guanosine (G), thymidine (T), cytidine (C), and uridine (U), base pairs of GC and AT (U) .. purine pyrimidine are formed. GC Base Pair Binding Energy ··· · · · · · · · · · · · · · ·

- 25 higher than the AT base pair since the former has three hydrogen bonds and the latter has only two as shown in Figure VII. and I.

Thus, in a conventional solution-phase nucleic acid sandwich assay, the oligonucleotide molecules are designed to contain nucleic acid sequences that are complementary and, consequently, hybridize to the nucleic acid sequences contained in the other assay components or the target analyte as described above. The method of the invention can reduce non-specific hybridization by incorporating non-natural nucleotide units into the universal oligonucleotide segments of probe components capable of generating special base pairs. In addition, the method of the invention reduces the non-specific binding of the test components by separating the detectably labeled test components that bind to the presence and / or amount of a target analyte from those that specifically bind and contribute to the background noise of the assay.

The present invention relates to a hybridization assay in which nucleotide units other than A, T, C, G, and U, capable of forming specific base pairs, are incorporated into the hybridizing segment of oligonucleotides of the assay components. is not specific for the target analyte molecule and is therefore less likely to form stable hybrids with target-specific probe sequences or with external non-target nucleic acid sequences. Thus, as shown in Figure 1, these nucleotide units can be inserted into the complementary nucleic acid sequences C-2 / C-3, L-2 / M-1 and L-3 / M-2. The oligonucleotide sequences of the components of the assay system that are complementary to the nucleic acid segments of the target molecule to be analyzed are prepared from naturally occurring nucleotides (i.e., A, T, C, G, U). Oligonucleotide segments containing nucleotide units can be prepared by replacing naturally occurring nucleotides by 15-100% with the corresponding nucleotide unit. Preferably, every third to fourth base in the oligonucleotide is replaced by a nucleotide unit capable of forming specific base pairs. One skilled in the art will recognize that as the number of replacement nucleotide units increases, the degree of non-specific hybridization decreases. However, complete replacement requires at least two new base pairs in order to maintain sufficient sequence diversity to exclude non-specific hybridization between the universal sequences.

In one embodiment of the invention, the target-independent signal generation is targeted by configuring a hybridization assay system configured to: the C-2 / C-3 or L-2 / M-1 hybrid is T_ml The melting temperature of the L-3 / M-2 hybrid should be substantially lower than that of the hybrid. This procedure was designed based on the principles that T_ml at least about 5 ° C, preferably at least 10 ° C, more preferably at least 20 ° C lower than T_m2 melting temperature.

This stability difference is exploited by performing the assay under stringent conditions which first_ml and T_m2 hybrid complexes. The rigor of the assay is changed in a subsequent step of the assay, which allows for the separation of the target analyte molecule from the capture probes and the physical separation of the labeled probes bound to the amplifier from the target.

The stringency can be controlled by changing a parameter that is a thermodynamic variable. Such variables are well known to those skilled in the art, such as formamide concentration, salt concentration, chaotropic salt concentration, pH (hydrogen ion concentration), amount of organic solvent, and temperature. Preferred stringency-influencing parameter: pH and salt concentration: A test step is performed at pH η or salt concentration that destabilizes the complex between the capture probe / capture extender and destabilizes the marker extender / amplifier (or pre- 28 ·· »· *» Hybrid amplifier). Adding the substrate is an advantageous step to practice strictness. Thus, in a preferred embodiment, the hybridization assay is performed under conditions that favor the stability of the hybrid complexes formed between all assay components, and then, after addition of the labeled substrate, the stringency is altered to destabilize the hybrid complexes, e.g. the probe / probe extender or the marker extender / amplifier (pre-amplifier) ​​complex and the like, provided that the candidate probe is not released from the marker extender or amplifier.

Another embodiment of the invention provides means by which the above-mentioned embodiment of the invention can be influenced by configuring the hybridization assay so that the T_ml complementary nucleotide sequences forming hybrid complexes are shorter than those of T_m2 form hybrid complexes. It will be obvious to those skilled in the art that the possibility of sequence diversity is reduced for shorter complementary nucleotide sequences. However, this diversity can be maintained by introducing a non-natural base pair, such as the isoC-isoOG base pair, into the complementary sequences.

It will be apparent to one skilled in the art that the greater the difference in T_ml and T_m2 • 1

- 29 the greater the efficiency of this technique in suppressing background noise. Thus, it will be apparent to one skilled in the art that a temperature difference of less than 10 ° C, or even less than 5 ° C, allows for a reduction in background noise, albeit to a lesser extent.

The method of the present invention, which incorporates non-natural nucleotide units into hybridizing oligonucleotide sequences to enhance the specificity of hybridization with a target molecule to be analyzed, can be used in a variety of applications.

In the basic or amplified solid phase nucleic acid sandwich assay, a number of different capture probes are applied to a solid surface. Most often, the surface available for non-specific binding is controlled by incubating the surface with, for example, salmon sperm or calf DNA. However, the presence of this DNA enhances the potential of the assay components to hybridize specifically to the solid support and thereby enhances background noise. Replacement of these natural DNAs with non-natural synthetic DNAs minimizes non-specific hybridization and non-specific binding.

Preferably, these nucleotides are prepared by providing short oligonucleotides with 3 'tails using nucleotide mixtures using techniques known to those of ordinary skill in the art. Alternatively, short oligonucleotides of near random sequence containing unnatural nucleotides may be linked to form polynucleotides. Branched DNA sequences are preferably used for this purpose. For example, the -TNVN-TNVN-J-TNVN block sequence in which F is isoC and J is isoG can be prepared and chemically coupled to form a polymer. The advantage of this approach over enzymatic 3 'tailing is the elimination of homopolymer / homooligomer sequences.

Another application in which hybridizing oligonucleotides containing unnatural nucleotide units can be used is the design of antisense compounds. Antisense compounds are as defined in the literature (Ching et al., 1989, Proceedings of the National Academy of Sciences, USA 86: 10006-10010; Broder et al., Ann. Int. Med. 113: 604-618 (1990); Loreau et al., 1990, FEBS Letters 274: 53-56; and PCT Publication Nos. WO91 / 11535, WO91 / 09865, WO91 / 04753, WO90 / 13641, WO91 / 13080 and WO91 / 06629] are oligonucleotides which bind to the mRNA and render it inactive or prevent the formation of mRNA responsible for the formation of the particular protein. Conventional antisense molecules are generally capable of reacting with a variety of different oligonucleotide species. However, due to their length (typically 30 nucleotide units in the oligonucleotide sequences), these antisense molecules pose a problem due to their non-specific hybridization with non-targeted molecular species. One solution is to use short hybridization regions between multiple probes and the target; to amplify the entire complex, short dimerization domains were used between probes as described by Distefano et al., J.Am. Chem. Soc. 1992, 114, 1006-1007. The dimerization domains can be designed to have tails of complementary sequence containing non-natural nucleotide units, thereby providing highly efficient and specific binding to the target analyte without enhancing non-specific hybridization to the non-target analyte. The concept is illustrated in Figure 2 with a double-stranded target DNA target.

As shown in Figure 2, strand clamping can be used to cleave double-stranded DNA. AT-rich superhelical voltage-gated promoter sequences that are S1 nuclease-sensitive and therefore partially single-stranded are particularly preferred sites for the use of this type of antigen. Short oligonucleotides can be used to maximize specificity; their binding energy to the target can be enhanced by joining them to form an oligonucleotide network.

In this construct, short universal sequences that do not form stable base pairs in the absence of the target contain isoC and isoG to limit the non-specific hybridization of the probes to human sequences. By binding probes 1, 2, and 3 to the target, the universal sequences will be close enough to each other to significantly increase their effective concentration. The universal sequences then form pairs, resulting in further enhancement of binding. RNA targets can also be used in this approach.

The SELEX process disclosed in Gold et al., U.S. Patent No. 5,270,163; Tuerk et al., Science 249: 505-510 (1990); Szostak and others:

Natur 346: 818-822 (1990); Joyce, Gene 82: 83-87 (1989)] can be used to select RNA and DNA sequences which recognize and bind to a target molecule by virtue of their shape. The term aptamer (or nucleic acid antibody) is hereinafter used to refer to such single-stranded or double-stranded DNA or single-stranded RNA molecules (PCT Buffers WO92 / 14843, WO91 / 19813 and WO / 05285, which are incorporated herein by reference). Targeted Molecules refers to a term, refers to proteins, polysaccharides, oligonucleotides, or other macromolecules, and small molecules, such as a drug, to distinguish it from the term.

- The 33 cracks, metabolites, toxins and the like to which aptamers were designed to bind.

In the SELEX process, an oligonucleotide is prepared in which n-membered, preferably randomized, nucleotides form a randomomeric pool of oligonucleotides and are bordered by two polymerase chain reaction (PCR) primers. The construct is then contacted with a target molecule under conditions that favor binding of the oligonucleotides to the target molecule. Oligonucleotides that bind to the target molecule have the following properties: (a) can be separated from oligonucleotides that do not bind to the target molecule using conventional techniques for separation, i.e., filtration, centrifugation, chromatography, or the like; (b) dissociate from the target molecule; and (c) be amplified by standard PCR techniques to generate a pool of ligand-enriched oligonucleotides. Further steps of binding, separation, dissociation, and amplification are performed until an aptamer having the desired binding affinity, specificity, or both is obtained. When producing such aptamers, the selected base pairs are replaced with unnatural base pairs to reduce the likelihood that aptamers will hybridize to human nucleic acids.

The present invention can be used in at least two general ways in SELEX. First, isoG and isoC can be inserted into the pool sequences of the random DNA sequence. The number of possible randomeric structures that recognize proteins or other important biomolecules can be increased by synthesizing DNA strands from six or more nucleotides instead of the usual four, i.e., A, T, C, and G. This, in turn, improves the chances of identifying sequences that bind to the target molecule with greater affinity and / or specificity.

In SELEX, selected conserved oligonucleotide sequences may undesirably hybridize to cellular sequences. This non-specific hybridization can be reduced by using non-natural bases in the selection process. Nucleotides that are not recognized by human RNA and DNA polymerases, but are recognized by certain phage and bacterial polymerases, are particularly useful in this application.

Another application of the present invention in the SELEX process is to provide a final aptamer construct that has minimal non-specific hybridization. For example, aptamers having predetermined binding affinity, specificity, or other target molecule recognition characteristics are selected from RNA or DNA sequence pools using the SELEX procedure. These target molecule recognition characteristics are determined by the secondary structure of the aptamer, which is partly determined by the formation of intramolecular oligonucleotide hybrid complexes. By determining the secondary structure of aptamer, one of ordinary skill in the art will recognize that the specificity of base pairs in certain intramolecular hybrid complexes is highly desirable to maintain secondary structure, and consequently, aptamer target molecule recognition and binding properties, i.e., will be GC or AT pairs. There will be other base pairs in these intramolecular hybrid complexes, such as the base pairing portion of the stem loop, which may be replaced by any other pair of complementary nucleotides, hereinafter referred to as NNs.¹ are called base pairs without changing the secondary structure of aptamer.

The selected NN¹ base pairs and simple substitution of the GC and CG base pairs with iso-C-iso-G or iso-GizoG base pairs reduce non-specific hybridization to non-targeted oligonucleotide sequences. Because the isoC-isoOG base pair is isoenergetic with the CG base pair, the dominant shape of the molecule and the strength of the hairpin structures will be very similar. One iso-energetic base pair with the AU base pair is highly desirable to replace those base pairs where the winning sequences show a strong preference for AU or UA over C-G. These substitutions have the effect of rendering the aptamer much more specific to the target molecule, limiting their potential for unwanted hybridization with cellular RNA or DNA sequences.

In the basic processes, the selected base pairs are replaced with isoC-isoC or base isoC-isoC. In the final construct, the isoC-isoGG base pairs may contain ribonucleotides, oligodeoxyribonucleotides. A chimeric aptamer molecule (which contains both ribonucleotides and deoxyribonucleotides) can be chemically prepared. Alternatively, ribo-isoGTP and ribo-isoCTP (with appropriate 2 'protection) can be used to prepare aptamer by transcription of in vitro DNA templates containing iso-C and iso-G.

Other applications in which the present invention may be employed include, for example, in situ hybridisation, reducing non-specific binding in hybridization assays and polymerase chain reactions (PCR).

In situ hybridization is not sensitive enough to detect a single molecule of the target analyte. In situ PCR (Bagasra et al., 1993, J. Immunological Methods 158, 131-145) was developed to achieve the required sensitivity; however, quantification is not as sensitive as in the PCR method. Alternatively, multiple extender probes are used to determine the target mo

<img file="HUT77754A_D0004.tif" />

they are tied to a slack. Marker extenders bind both pre-amplifiers and amplifiers. When used, the pre-amplifiers form a bridge between the labeled extenders and the amplifiers. The amplifiers bind the labeled probes, which are then preferably detected by luminescence (or fluorescence if sensitivity is high enough). As before, the universal sequences L-2 / M-1 and M-2 / L-3 contain short oligonucleotides, which optimally contain 15-30% iso-C and iso-G to reduce human sequences. undesirable hybridization. A fourth base pair can be used to further reduce the presence of natural bases in these sequences.

As noted above, non-specific binding as well as non-specific hybridization can be reduced using non-natural base pairs. Random polymers or near random block copolymers of 6-8 different nucleotides can be used to prevent non-specific binding of the amplifier and labeled probes to the cellular components having high affinity for the polynucleotides. Thus, non-specific binding can be prevented without risking the growth of non-specific hybridization by introducing natural sequences from calves or salmon, as is usually the case.

It will be apparent to one skilled in the art that the same strategy can be used for biotech assays, such as dota biota, southern biota and northern biota, to reduce probe hybridisation to solid supports.

The present invention can be used in many different ways in PCR and other exponential amplification technologies. For example, in network-based PCR, after first amplifying the target molecule to be analyzed and then diluting to thousands of times, it is common to use a 5 'overhang on one primer for capture and a 5' overhang on the other primer for labeling. A spacer that cannot be read by the polymerase can be inserted so that the protruding ends remain single-stranded (Newton et al., Nucleic Acids Research 21: 1155-1162 (1993)). At these 5 'overhangs, the generic sequences can be prepared to contain modified base pairs to reduce the initiation of replication of non-target molecules. Indeed, the presence of icodC or isodG as the first base at the 5 'overhang may be used instead of the currently used spacers; the polymerase is unable to read isodC or isodG because there is no isodGTP or isodCTP that can be inserted. Since the polymerase can add T to the polymer at low frequency, if it finds isodG in the primer, it is preferable to use isoC as the first base at the 5 'overhang.

In the practice of the present invention, unless otherwise indicated, conventional synthetic chemistry, biochemistry, molecular biology and the like are known to those skilled in the art. These techniques are described in detail in the literature [Sambrook et al., Molecular

Cloning: A Laboratory Manual; Cold Spring Harbor Press, Cold Spring Harbor, NY (1989); Oligonucleotide Synthesis, Eds .; MJ Gait (1984); Nucleic Acid Hybridization, BD Hames &amp; amp; SJ Higgins (1984); and Methods in Enzymology series].

The foregoing and the following patent applications and publications are hereby incorporated by reference.

It is to be understood that although the invention will be described by reference to specific embodiments thereof, the foregoing description and the following examples are illustrative only and in no way limit the scope of the invention. Modifications within the scope of the invention will be apparent to one of ordinary skill in the art.

In the examples below, we have attempted to provide accurate numerical values ​​(i.e., quantities, temperatures, etc.), but there may be experimental errors and discrepancies. A., Thermometer • · · · · · · · ··········

- The temperature of 40 is always given in ° C, and unless otherwise stated, the pressure is always near atmospheric.

Synthesis of isoguanosine and 2'-deoxyisoguanosine

Some methods for the synthesis of isoguanosine or 2'-deoxyisoguanosine have been described. For example, 2'-isoguanosine was synthesized as follows: 1) 2'-deoxyadenosine from 2'-deoxyadenosine (N^xoxide) by direct photolysis under alkaline conditions (Switzer et al., 1993, Biochemistry 32, 10489-10496); 2) from 2-chloro-2'-deoxyadenosine by direct photolysis under alkaline conditions [Seela et al., Helvetica Chim. Acta

75: 2298-2306 (1992)]; and 3) chemically from 6-amino-1- (2'-deoxybeta-D-erythropentofuranosyl) -1H-imidazole-4-carbonitrile [AICA 2 'deoxynucleoside] which is reacted with benzoyl isocyanate and then reacted with ammonia to give the pyrimidine. ring fitting (Kazimierczuk et al., 1991, Helvetica Chimica Acta 74, 17421748).

However, since 2'-deoxyadenosine (N¹conversion of 2'-deoxyisoguanosine to 2'-deoxyisoguanosine cannot be easily scaled up, a convenient chemical route has been developed for the preparation of 2'-deoxyisoguanosine by the readily available 2¹deoxyribonucleoside starting material.

Several methods have been described for the nucleoside of 2 '-deoxyguanosine 2,6-diaminopurine and N⁶for the conversion of alkyl-2,6-diaminopurine to nucleoside on special, convertible 2 'to 41 deoxyguanosine derivatives, e.g.⁶via phenyl-2'-deoxyguanosine (MacMillan et al., Tetrahedron 47: 2603-266 (1991)); Gao et al., J. Org.

Chem., 57, 6954-6959 (1992); Xu et al., Tetrahedron 48

1729-1740 (1992). In addition, Fathi et al⁶a convenient synthesis of -phenyl-2'-deoxyguanosine by a process in which 2'-deoxyguanosine is treated with trifluoroacetic anhydride / pridine and then displaced in situ with phenol. Alternatively, O⁶introduction of phenyl units into 2'-deoxyguanosine has already been described by Reese et al., J. Chem. Soc., Perkin Trans. I, 1263-1271 (1984)], where O⁶- (4-Toluenesulfonyl) -2'-deoxyguanosine is treated with trimethylamine followed by phenol to effect the displacement of 0- (4-toluenesulfonyl) to give the O⁶-fenil2'-deoxyguanosine. An isoguanosine-like compound was prepared from 2- (methylmercapto) -6-amino-pyrazolopyrimidine ribonucleoside by S-oxidation to give the product 2- (methylsulfonyl) -6-amino-pyrazolopyrimidine ribonucleoside, which was displaced by the isoguanol analogue of sodium hydroxide. Cottam et al., Nucleic Acids Research 11: 871-882 (1983).

Transformation of the 2-amino group in guanosine and 2'-deoxyguanosine with alkylnitrites has also been described. These include 2-halo (Nair et al., Synthesis 670672 (1982)) and 2- (methylmercapto) -6-chloropurine. ribonucleoside [Triveldi: Nucleic Acid Chemistry, ed.

• · · • ♦ * • · ·

42 Townsend et al., Wiley Inter-Science, Vol. 4, pp. 269-273 (1991)] in radical reactions. O⁶- by oxidation of (pnitrophenylethyl) -3'5'-O-di-t-butyldimethylsilane-2'-deoxyguanosine with pure pentyl nitrite 0⁶(p-nitrophenylethyl) -3'5'-O-di-TBDMS-2'-deoxyxanthosine was prepared [Steinbrecher et al., Angew. Chem. Int. Ed. Engl. 32: 404-406 (1993)].

A procedure for the synthesis of 2'-deoxyisoguanosine by Seela et al., Helv. Chim. Acta 77: 622-630 (1994). In the first step, the 2 'deoxyguanosine is converted to 2-amino-2' deoxyadenosine. In the second step, 2-amino-2'-deoxyadenosine is deaminated by diazotization of the 2-amino group with sodium nitrite to give 2'-deoxyisoguanosine.

The process described below and patented is set forth in Scheme VIII. A compound of formula wherein R¹ is hydrogen, hydroxy, sulfhydryl, halogen, amino, alkyl, allyl and -OR² wherein R² represents an alkyl, allyl, silyl or phosphate group, having the following steps:

a. reacting a compound of formula I with a reagent capable of protecting both the 3 'and 5' hydroxy groups;

b) reacting the product of step (a) with a reagent which is capable of reacting O;⁶to convert an oxy unit into a functional group, · · • ·

43 which is sensitive to nucleophilic substitution, thereby producing a functionalized 0⁶ unit;

c) oxidizing the 2-amino group obtained in step b);

d) reacting the product of step (c) with a nucleophilic reagent to replace the⁶ unit; and

e) reacting the product of step (d) with a reagent which is capable of deprotecting the protected 3 'and 5' hydroxy groups.

Conversion of guanosine or 2'-deoxyguanosine to isoguanosine or 2'-deoxy-isoguanosine can be accomplished by protecting the hydroxy groups on the sugar moiety with a suitable reagent such as TBDMS, benzoyl chloride, acetic anhydride, or the like. As noted above, one or more hydroxy groups on the sugar moiety may be substituted with halogen atoms, aliphatic groups, or functionalized in the form of ethers, amines, and the like. The product is isolated and then isolated in step 0⁶is modified so that it can be replaced by a suitable nucleophilic group. Such a substituted group may be, for example, CH3-S-C6H4-O⁶-, C6H₅-SALT₂-SHE⁶-, C6H5-O⁶-, 4-nitro-C6H₅-0⁶-, 2,4,6-trinitroC₆H₂-O- or similar groups.

The 2-amino group is then transformed into an oxy function with an alkylnitrite or a suitable agent, as known in the art [Nair]. et al., Synthesis 670-672 (1982); Triveldi, Nucleic Acid Chemistry, Townsend, et al., Wiley Inter-Science Vol. 4, pp. 269-273 (1991); Steinbrecher et al., Angew. Chem. Int. Ed. Engl. 32: 404-406 (1993)]. The product is then reacted with a suitable nucleophilic reagent such as NH₄OH, or other aminoalkyl, aminoaryl, amino-heteroalkyl, amino-heteroaryl group having a terminal -NH₂, -SH-, -COOH or the like replacing the modified O⁶ detached group. The protecting group may be removed from the protected hydroxy groups, for example, by treatment with alkali or fluoride.

Hereinafter, O⁶- (4-Methylthiophenyl) group will be an example of interchangeable groups. However, this is used only to illustrate certain embodiments and is not intended to limit the scope of the invention in any way.

The N⁶alkylated isoguanosine derivatives can be readily synthesized using an alkylamine as nucleophilic reagent. For example, hexanediamine can be used in O⁶- (4-methylthiophenyl), substituted with N⁶- (6-aminohexyl) isoguanosine. Protecting the amino-hexyl group (such as the trifluoroacetamido derivative) and then converting it into a phosphoramidite reagent results in a functionalizable isoguanosine analog which can be incorporated at any desired position into an oligonucleotide for further post-synthetic modifications. Thus, it is possible to specifically label the isoguanosine unit unit in the selected isoguanosine / isocytidine pairs. It is also possible that isoguanosine has a series of N⁶is synthesized which carry the desired function, O⁶A - (4-methylthiophenyl) group simply by a suitably terminated nucleophilic group such as -COOH, SH, -NH₂ or a similar group, the derivatives are readily prepared.

Furthermore, the 0²- (4-Methylthiophenyl) -2'-deoxyxanthosine, in the form of fully protected phosphoramidite (O²- (4-Methylthiophenyl) -5'-O-DMT-3'O- (BCE-diisopropylphosphoramidite) -2'-deoxyxanthosine) can be used as a convertible derivative after incorporation into an oligonucleotide. The 0²- (4-Methylthiophenyl) -2'-deoxyxanthosinone in O²- Substitution of (4-methylthiophenyl) after synthesis with one alkyldiamine or another functionalized alkylamine, N⁶results in oligonucleotides containing (aminoalkyl) -2'-deoxyisoguanosine. The isoguanosine derivative so prepared may be the site of introduction of a label or other reporter molecule, specifically in the functionalized isoguanosine group.

The approach of synthesis

As shown in Scheme A, the synthesis of 2'-deoxyisoguanosine is carried out in five steps, starting from 2'-deoxyguanosine, as follows:

<img file="HUT77754A_D0005.tif" />

1) 2'-deoxyguanosine 3 ', 5'-O- (t-butyldimethylsilyl)₂2'-deoxyguanosine [Ogilvie et al., Can. J. Chem., 51, 3799-3807 (1973)] by purification by recrystallization;

2) O⁶- (4-Toluenesulfonyl) -3 ', 5' -O-TBDMS₂Conversion to -2 '-deoxyguanosine;

3) The 0⁵is replaced by a suitable phenol group such as 4- (methylthio) phenol or pentachlorophenol using the Reese procedure to give the O⁶- (4-methylthio) phenyl 3 ', 5' -O-TBDMS₂-2'-deoxyguanosine (Reese et al., J. Chem. Soc., Perkin Trans. I, 1263-1271 (1984)];

4) oxidation of the 2-amino function to the oxy function with tert-butyl nitrite under neutral reaction conditions to give O⁶- (4-methylthio) phenyl-3 ', 5' -O-TBDMS₂-2 '-deoxixanthosine [Steinbrecher et al., Angew. Chem. Int. Ed. Engl. 32: 404-406 (1993)]; then

5) O²- (4-Methylthiophenyl) is replaced by ammonium hydroxide at high temperature to give 3 ', 5'-O-TBDMS₂-2'-deoxy-izoguanozint. The preparation of isoguanosine from guanosine can be carried out according to a similar scheme described in Scheme A.

The reaction scheme

The material thus obtained is identical in all respects (TLC, HPLC, UV, and NMR) to an authentic sample,

···· · ♦ · · * (prepared by Switzer Preparation 47, et al., Biochemistry 32: 10489-10496 (1993)).

Isocitidine or 2'-deoxyisocytidine derivatives

Derivatives of isocytidine or 2'-deoxyisocytidine in which the glycosidic bond is stabilized against contact with dilute acid during oligonucleotide synthesis may be prepared. Derivatives of N-amidine for 2'-deoxyadenosine have been described [McBride et al., J.Am. Chem. Soc. 108, 2040-2048 (1986); Froehler et al., Nucleic Acids Research 11: 8031-8036 (1983);

Pudlo et al., Bioorg. Med. Chem. Lett. 4: 1025-1028 (1994)]. The Ν²- (N, N-Di (X) formamidino-2'-deoxyisocytidine was synthesized by the following procedure: In the example, X is n-butyl, but X can be C2-C10 alkyl, aryl, heteroaryl and heteroalkyl or similar.

N-di-n-butylformamide dimethyl acetal is prepared by transaminating N, N-methylformamide with di-n-butylamine (McBride et al., J.Am. Chem. Soc.

2040-2048 (1986); Froehler et al., Nucleic Acids

Research 11: 8031-8036 (1983); Pudlo et al., Bioorg.

Med. Chem. Lett. 4: 1025-1028 (1994)]. Ten mmol / l 2'-deoxy-5-methylisocytidine was suspended in 100 ml of methanol and 10 mmol / l of N, N-di-n-butylformamide dimethylacetal was added. Stir for 2 hours with clear solution • »•»

- 48 · * * ·· 4 · · · · «» · • · * · «·· # ·· ·· we get. Thin layer chromatography developed on 60H silicate using 10% methanol in dichloromethane shows complete consumption of starting material. Water (10 mL) was added to decompose the reagent and the solvents were removed under reduced pressure to give crude N - (N, N-dibutylformamidino) -2'-deoxycytidine (3.8 g). This derivative can be directly converted to 5'-O-DMT-N²(N, N-dibutylformamidino) -2'-deoxyisocytidine for incorporation into oligonucleotides.

Other isocytidine derivatives may be prepared which contain functionalized substituents that allow detectable labels to be incorporated at a specific position of an oligonucleotide. For example, 5-alkylated 2'-deoxyuridine derivatives such as 5- [N- (6-trifluoroacetaminohexyl) -3 (E) acrylamido] -2'-deoxyuridine have been described [Ruth: Oligodeoxynucleotides with Reporter Groups Attached to the Base, 255 -282. pp. ed. Eckstein, Oligonucleotides and Analogues, IRL Press (1991)]. Such derivatives at position 5 were found not to interfere with base pair hybridization. The chemistry described by Ruth can also be used to prepare 5- [N- (6-trifluoroacetaminohexyl) -3 (E) -acrylamido] -2'-deoxyisocytidine, resulting in a functionalized isocytidine which may have a detectable label on the selected isoguanosine * isocytidine base pairs.

c · · ft · · «tt *« &lt;· ··

These and other 5-position derivatives of isocytidine and 2 'deoxyisocytidine have a further stabilizing effect on the formation of base pairs. Examples of such derivatives include: 5-p-propynyl [Froehler et al., Tetrahedron Lett. 34, 1003-1006 (1993)], 5-β-propenyl or other 5-alkylisocytidine or 2'-deoxyisocytidine derivatives.

Kits for carrying out the nucleic acid hybridization assays of the invention comprise at least one hybridizing oligonucleotide probe, a segment capable of forming a hybrid complex with the molecule to be analyzed, and a means for detecting the hybrid complex and at least one hybridizing oligonucleotide. probe contains a first nucleotide unit which under conditions under which conditions AT and GC base pairs are formed, they cannot efficiently form base pairs with adenosine (A), thymidine (T), cytidine (C), guanosine (G) or uridine (U). The reagents are contained in a separate container inside the kit. The kit may further comprise a denaturing agent for denaturing the molecule to be analyzed, hybridization buffers, wash solutions, enzyme substrates, negative and positive controls, and a description of how the assay is performed.

Oligonucleotides of the invention are solid-phase direct oligonucleotide synthesis, enzymatic ligation methods and solution-phase chemical synthesis methods.

- with 50 binations [No. U.S. Patent Application Serial No. 07 / 813,588].

The synthesis of the oligonucleotides can be performed using an automated DNA synthesizer (Perkin Elmer / Applied Biosystems model 380B). Β-Cyanoethyl-type phosphoramidite chemistry, including 5'-phosphorylation, was performed using PHOSTEL ™ reagent (DMT-O-CH₂CH₂-(SALT₂) CH₂CH₂-OP (iPr₂) (-O-CH)₂CH₂CN)), in which DMT represents dimethoxytrityl group, iPr isopropyl group. The manufacturer's standard procedure was used, with no difference noted.

First Example

Background noise caused by aspecific hybridization of target-specific extender sequences with generic assay components

To determine how background noise is caused by cross-hybridization between target-specific extender sequences and generic assay components, an amplified DNA hybridization assay was performed to quantify phage M13 using a pool of capture extenders and labeling extenders as shown in Figures 1, 2. and Figure 3.

First Spreadsheet

<td>seq. fate z.</td><td>Clamp Extender, Pool A</td>

<td> 1</td><td>ATTGCGAATAATAATTTTTTCACGTTGAAATC</td>

<img file="HUT77754A_D0006.tif" />

- 52 ·· • »

4 ·· »• ·· * ·« Ι «« · «·»? ·> ·· »· · · · ··· ··· *

<td> 16</td><td>ACGAGGGTAGCAACGGCTACA TTAGGCATAGGACCCGTGTCT</td>

<td> 17</td><td>GCGACCTGCTCCATGTTACTTAGCC TTAGGCATAGGACCCGTGTCT</td>

<td> 18</td><td>CTCAGCAGCGAAAGACAGCATCGGA TTAGGCATAGGACCCGTGTCT</td>

<td> 19</td><td>ATCATAAGGGAACCGAACTGACCAA TTAGGCATAGGACCCGTGTCT</td>

<td> 20</td><td>CCACGCATAACCGATATATTCGGTC TTAGGCATAGGACCCGTGTCT</td>

<td> 21</td><td>TACAGACCAGGCGCATAGGCTGGC TTAGGCATAGGACCCGTGTCT</td>

<td> 22</td><td>AAACAAAGTACAACGGAGATTTGTATCA TTAGGCATAGGACCCGTGTCT</td>

<td> 23</td><td>CACCAACCTAAAACGAAAGAGGCGA TTAGGCATAGGACCCGTGTCT</td>

<td> 24</td><td>AAAATACGTAATGCCACTACGAAGG TTAGGCATAGGACCCGTGTCT</td>

For illustration purposes, a space separates the 3 'non-target binding region from the target binding region in each probe.

The assay is essentially WO95 / 16055 PCT. as described in this publication. Briefly, after hybridizing overnight at 63 ° C in microtiter wells containing capture probes complementary to the non-target binding regions of the capture extenders, the plates were kept at room temperature for 10 minutes, washed twice with 0.1X SSC buffer (15 mmol / L sodium). chloride, 1.5 mM sodium citrate, pH 7.0), 0.1% sodium dodecyl sulfate. A 15x3 (15 arm, each with 3 alkaline phosphatase probe binding sites) branched DNA amplifier (10 fmol) complementary to the 3 'non-target region of the labeled extender was added to the wells and incubated for 30 minutes at 53 ° C. cool and wash as described above. For an alkaline phosphatase assay (200 fmol) a

After addition to wells 53 and incubation for an additional 15 minutes at 53 ° C, the plates were cooled again and washed as described above. Three additional washes are performed with 0.1xSSC buffer. Signals were detected on a Chiron luminometer after 20 minutes in a Lumiphos 530 (Lumigen) dioxetane phosphate substrate solution. The results are shown in Table 4.

. Spreadsheet

Non-specific binding background noise

<td>Clamping extender pool</td><td>Signal (+ phage M13)</td><td>Noise (phage -M13)</td>

<td>Only the pool</td><td> 293,306, 337, 359</td><td> 1,1, 0,9, 1,1, 2,0</td>

<td>Side A + Side B</td><td> 390, 393, 379, 376</td><td> 103, 130, .436, 172</td>

Adding B pool clamp extenders does not increase the clear signal size, but increases the noise level by nearly a hundred times. Computerized analysis of the sequences used shows that Pool 8 sequence B has a strong homology to the branching DNA amplifying T20LLA2 sequence (including the nine-membered oligo (dA) oligo (dT)), while the B pool nine has a strong homology shows the BLA3c sequence of the branching DNA amplifier.

The present invention relates to hybridization-dependent assay background noise. Nucleotide sequences are prepared which are interrupted by nucleotides that do not form stable base pairs with natural nucleobases and thereby inhibit the hybridization of these sequences with natural sequences. Ideally, every third or fourth base in a universal sequence may be a modified nucleotide that does not pair with A, C, G, or T (U) bases. C * G base pairs can be used to reduce the length of universal sequences using isoenergetic base pairs. Statistical arguments show that this may reduce the frequency of unwanted cross-hybridization between the universal sequences and between the universal sequences and the non-target sequences in the sample, as well as between the universal sequences and the target-specific sequences in the extender probes. The length of the universal sequences can be further reduced to form stable hybrids based on the multi-tooth form (see WO95 / 16055). Each universal sequence may be designed to be at least 6, preferably 8, nucleotides in length: capture probe, capture extender tails, marker extender tails, amplifiers, labeled probes, and pre-amplifiers (if necessary).

Second Example

Specificity and potency of isoC-isoOG base pairs

To determine the specificity and potency of the isoC-isoOG base pairs, the following oligonucleotides were performed:

1) 5 '(L) CA CCA CTT TCT CC (T) 3' (SEQ ID NO: 25)

2) 5 '(L) CA CFA CTT TCT CC (T) 3' (SEQ ID NO: 26)

3) 3 '(T) GT GGT GAA AGA GG 5' (SEQ ID NO: 27)

4) 3 '(T) GT GJT GAA AGA GG 5' (SEQ ID NO: 28)

5) 5 'CA CTA CTT TCT CC 3' (SEQ ID NO: 29)

For these oligonucleotides, the hybrid portion of the core consists of thirteen oligonucleotides. Nucleotides in the formation of base pairs are in parentheses. L = primary amine, F = isoC, J = isoG. Melting point analysis was performed on a Cary 3E spectrophotometer in 3xSSC (0.45 M sodium chloride, 0.045 M sodium citrate), pH 7.9. Co-incubated oligonucleotides are present at a concentration of about 1.5 gmol / L. AT_m value in dA₂₆₀/ dT was calculated from the maximum of the temperature curve. The results in Table 4 show that the isoC * isoOG base pair is isoenergetic with the natural C * G base pair.

4th Spreadsheet

The isoC * isoOG base pairing is T_m Analyze

<td>Fit / Bad Fit, Paired Oligonucleotides</td><td>T_mi</td><td>T_m2</td><td>Avg T_m</td>

<td>C * G fit, 1 * 3</td><td> 60</td><td> 60</td><td> 60</td>

<img file="HUT77754A_D0007.tif" />

<td>isoC * isoOG fit, 2 * 4</td><td> 60</td><td> 61</td><td> 60</td>

<td>isoC * G bad fit, 2 * 3</td><td> 52</td><td> 52</td><td> 52</td>

<td>isoG * C bad fit, 1 * 4</td><td> 52</td><td> 52</td><td> 52</td>

<td>G * T bad fit, 3 * 5</td><td> 50</td><td> 49</td><td> 49</td>

<td>isoG * T bad fit, 4 * 5</td><td> 53</td><td> 53</td><td> 53</td>

Accordingly, universal sequences containing approximately equimolar amounts of C, G, isoC, isoG, At and T may be shorter than sequences containing only At, T, C, and G at approximately equimolar ratios. This limits the possibility of cross-reactivity with the natural, non-target sequences in the sample, as well as the LE and CE target binding sequences, which are more or less restricted to containing At, T (U), C, and G.

The data also show the specificity of the isoC * isoOG base pairs. The isoC * G and isoC * C pairs behave poorly. In the classic case, the degree of destabilization at ° C is close to the percentage of poor fit. So the T_mat about 7.5 ° C, one of 13 nucleotides can be predicted to be mismatched (7.5% mismatch). The observed change of 8 ° C when comparing the C * G or isoC * isoG matches to the bad matches is similar to the change for the A, T, C, and G codes for a bad match.

<img file="HUT77754A_D0008.tif" />

The isoG exists in at least two tautomeric forms, the keto and enol forms. The keto form occurs more frequently in aqueous solvents and the enol form occurs more frequently in organic solvents (Sepiol et al., Zeitschrift für Naturforschung 31C, 3610370 (1976)). The enol tautomer of isoG, in principle, is capable of forming two hydrogen bonds with dT, resulting in a base pair analogous to A * T base pair. If the enol tautomer is present at a sufficiently high level in the hybridization buffer, the specificity of the isoC * isoOG base pair is limited. However, for the isoG * T mismatch, the observed T_m value is 53 ° C, which is essentially the same as for other bad fits.

These data support the conclusion that the enol tautomer is present in very low concentrations in the 3X SSC at pH 7.9 or, if present, at 7-8 ° C lower._mcreates a hybrid equal to the value of the isoC-isoG hybrid. G * T mismatch control with T_m about 49 ° C. This is slightly lower than we expected for the average G * T bad fit, but is close to the isoG-Τ bad fit value.

One skilled in the art will appreciate that having another base pairing combination (i.e., 8 bases, 4 pairs), whether iso-energetic with C * G or not, further enhances the specificity of base pairing with the universal sequences. In this case, we can even eliminate At, T, C, and G from the universal chair-

<img file="HUT77754A_D0009.tif" />

sequences which. However, if these bases are slightly present, this increases the degree of diversity between the possible universal sequences, allowing one to design universal sequences that show the least possible interaction with each other.

For example, with a 4-base code, only two pairs of universal 15-membered oligonucleotides can be designed that do not have any three-membered cross-hybrid. That is, the addition of a third pair to the 15-membered sequences results in at least 3 nucleotides in cross-hybrid. With a six-base code, 8 pairs of 15-member sequences can be designed without any three-membered Watson-Crick type hybrid. With an eight-base code, 19 such pairs can be designed from 15-membered oligonucleotides.

EXAMPLE 3

Effect of pH on isoC * isoOG base pair formation

To study the behavior of isoC * isoOG base pairs as a function of pH, T_m analysis with the oligonucleotides given in Example 2. The effect of pH on the T of the oligonucleotides containing the isoC * isoOG base pair was determined_m (SEQ ID NOs: 2 and 4) and oligonucleotides containing the C * G base pair T_m (n = 2 or 3) at a salt concentration of 0.5 M and an oligonucleotide of about 1.5 pmol / L, the results are shown in Table 5.

5th Spreadsheet

The pH sensitivity of the isoC * isoOG base pair is T_m Analyze

<td>Hybrid paired oligonucleotides</td><td>PH</td><td>Imi</td><td>^Tm2</td><td>1m3</td><td>Avg T_m</td>

<td>izoG * izoC, 2 * 4</td><td> 7,9</td><td> 60</td><td> 60</td><td> 62</td><td> 61</td>

<td>isog * isoC, 2 * 4</td><td> 5,1</td><td> 62</td><td> 59</td><td> 60</td><td> 60</td>

<td>IzoG * izoC, 2 * 4</td><td> 9,5</td><td> 53</td><td> 51</td><td> 52</td><td> 52</td>

<td>G * C, 1 * 3</td><td> 9,5</td><td> 52</td><td> 52</td><td></td><td> 52</td>

Oligonucleotide hybrids are generally stable at pH 5 to 10. Below pH 5, C and A protonate, and above pH 10 G and T begin to lose their imino protons. Thus, below pH 5 and above pH 10, nucleic acid hybrids show reduced stability. Table 2 shows that the isoC * isoOG base pair has normal acid stability. However, both the isoC * isoG hybrid and the G * C hybrid show unusual changes at -9 ° C_m when the pH changes to 1.6. This is probably due to the very small size.

In principle, the SELEX protocol can be used to select hybrids that exhibit even greater pH sensitivity [Gold et al., U.S. Patent No. 5,270,163; Tuerk et al., Science 249,

505-510 (1990); Szostak et al., Natur 346: 818-822 (1990); Joyce, Gerie, 82, 83-87 (1989)], whereby populations of DNA and RNA randomers can be selected based on binding at neutral pH and on the basis that they are dissociated from the target sequence in a slightly alkaline or slightly acidic medium. Following amplification, the selection process can be iteratively repeated. After the final iteration, clones with the desired pH sensitivity can be cloned and sequenced. These sequences can be synthesized and selected to perform best in a direct competition assay.

In mild alkalis, lability can be exploited in the current amplified DNA assay format to reduce background noise in the assay. With a capture probe with sufficient basic lability, the target will come up to the surface and be detected in another hole. The background is lagging. Binding extender binding, according to the method described in WO96 / 16055, reduces background noise caused by the release of molecules that specifically bind to probe probes through the capture extenders.

Because we may not want to release the alkaline phosphatase probes bound to the non-specifically bound amplifiers, we prefer to use the capture probe capture extender hybrids which have significantly higher base lability (i.e., higher T)._mvalue at a given pH (η) as the amplifying and labeled probe and the amplifying and labeled extender hybrids. Alternatively, the L-2 / M-2 hybrid of Figure 1 may be a base-sensitive hybrid. In each case, the M-2 / L-3 hybrid must be more air-stable; otherwise, the candidate probe bound to the non-specifically bound amplifiers would be released.

As noted above, we may even consider moving the liberated target to fresh wells for reading. However, it would be advantageous if the released solution could be read in the well in which it was formed. This would eliminate the need for additional pipetting steps and eliminate the inaccuracies associated with further fluid transfer steps. There are many ways to avoid transfer between wells, as described below.

To further increase the specificity of the assay, the specific release of the target can be coupled to cover the background on the surface. In this case, transfer to another medium may be necessary. For example, the surface of the solid support may be coated with labeled probe inhibitors and / or various luminescence inhibitors, absorbers or quenchers. One currently used surface coating is poly (phleys). Phenylalanine is a known inhibitor of alkaline phosphatase, a particularly preferred label. Other inhibitors of alkaline phosphatase, such as tryptophan and cysteine, can also be incorporated into the polymer peptide envelope. Examples of luminescence inhibitors include low-quantum yield compounds, e.g.

<img file="HUT77754A_D0010.tif" />

a compound that gives off heat rather than light after colliding with a dephosphorylated dioxetane.

There are at least two other simple ways to make the detection of the released solution more selective to avoid transferring the released target to another well. Target-bound markings can be read in solution by not making the solid phase accessible to the visualization reagents or by masking the solid phase signal generating reactions that occur on the solid surface. Isolation of the solid phase from subsequent visualization steps can be accomplished by adding a water-immiscible oil heavier than water to the reaction mixture. This oil will cover the bottom of the vessel while allowing the essential solution for us to float to the surface. For simple colorimetric detection by visual chemical reflection measurements, an opaque substance must be added to the oil to provide a neutral background for visualization.

For chemiluminescence detection, an optically opaque material may be added to the oil. When a solid white material such as titanium dioxide is used, light emitted from the floating aqueous layer is emitted from the container for detection. Dissolving a dark solid or dye molecule in the oil can also be used to mask the stationary phase. Even if the oil solution does not completely isolate the solid phase from the visualization reagents, the suspended solids or dissolved inks can block the transmission of this light from the surface.

It is also possible that a stationary phase can be painted with a dye that blocks light emission in reactions that occur near the surface. This is particularly simple for a colored bead as a solid phase, which is contained in an opaque hole.

4th Example

The effect of the salt on the isoC * isoOG base pair is neutral and alkaline

P^H_zn

To investigate the behavior of the isoC * isoOG base pair as a function of salt concentration, T_m analysis with the oligonucleotides used in Example 2. The effect of salt concentration on T_m in oligonucleotides containing the complementary isoC * isoOG base pair (SEQ ID NO: 2 and 4) and the C * G base pair (SEQ ID NO: 1 and 3) (n = 3) at pH 7.9 or 9, At 5 values ​​using 1.6 gm of the oligonucleotide, the results are shown in Table 6.

In the classic case, the polynucleotide is about 16-17 ° C_m show a change in each log change in salt concentration. Oligonucleotides often show somewhat reduced salt dependence. 10-11 CT calculated for the isoC * isoOG hybrid_m per hang change in salt, pH = 7.9 ································································································································································································ · · ·· · is the change expected for a 13-membered oligonucleotide. However, the change at pH 9.5 is only about 3 ° C for the isoC * isoG hybrid and 5 degrees for the C * G hybrid for a hanging salt concentration change, which is surprisingly low.

This can also be exploited for specific target release. Generally, low salt concentrations are used to specifically target the target. Often, much of the background is liberated.

6th Spreadsheet

Stability of isoC * isoOG as a function of salt concentration

<td>Hybrid, Paired oligonucleotide</td><td>Salt (Mol / 1)</td><td>PH</td><td>Avg T_m(° C)</td><td>dT_m^m4th dlog [Well]</td>

<td>isoc * izoG, 2 * 4</td><td> 0,5</td><td> 7,9</td><td> 61</td><td></td>

<td>izoC * izoG, 2 * 4</td><td> 0,17</td><td> 7,9</td><td> 56</td><td> 10-11</td>

<td>izoC * izoG, 2 * 4</td><td> 0, 5</td><td> 9,5</td><td> 52</td><td></td>

<td>izoC * izoG, 2 * 4</td><td> 0,17</td><td> 9,5</td><td> 50</td><td> 3</td>

<td>C * G, 1 * 3</td><td> 0,5</td><td> 9,5</td><td> 52</td><td></td>

<td>C * G, 1 * 3</td><td> 0,1</td><td> 9,5</td><td> 48,5</td><td> 5</td>

Since the melting point of the isoC * isoOG base pair is salt-independent to slightly alkaline pH η, there is no further advantage in lowering the salt concentration and increasing the pH. Thus, high salt concentrations (which are also advantageous for alkaline phosphatase) can be used to liberate and minimize background release.

• · · · · • · · · · • · · ♦ · ···· ··· ··

As explained in Example 3, the SELEX procedure can be used to find DNA or RNA sequences that exhibit enhanced salt independence during melting at any selected pH.

5th Example

Effect of base pair mismatch on hybridization

In the previous examples, it has been shown that an oligomer containing isoG base pairs forms specific pairs with its isoC-containing complement. An isoGO-containing oligomer is destabilized by about 7-8 ° C when hybridized to an oligomer containing a single iso-G * T or iso-G * C mismatch. Typically, there is about a ten-fold decrease in binding to T_m every 10 ° C change.

The effect of poor fitting of two bases on the binding of a 13-member hybrid was estimated using the probes shown in Table 7.

7th Spreadsheet

<td>Seq. Ref.</td><td>Sequence'¹'</td>

<td> 30</td><td>5 'GATGTGGTTGTCGTACTTTTTTTGACACTCCACCAT</td>

<td> 31</td><td>5 'GATGTGGTTGTCGTACTTTTTTTGACAFTCCJCCAT</td>

<td> 32</td><td>Alk Phosph. - CTACACCAACAGCATGAA 5 '</td>

<td> 33</td><td>3 'TCACTAAGTACCACCTCACAG</td>

<td> 34</td><td>5 'AGTGATTCATGGTGGAGTGTCTCTCTTGGAAAGAAAGTGAT</td>

<td> 35</td><td>3 'GAGAACCTTTCTTTCACTX</td>

• · · · · · • · · · · · ···· ··· ·· · · ¹ F = isoC, J = isoG, alk. phosphate. = alkaline phosphatase, X = spacer sequence containing an amine linkage to the solid support.

Label 32, the alkaline phosphatase oligonucleotide conjugate, was prepared as described (Urdea et al., 1988, Nucleic Acids Research 16: 4937-4955). The labeled probe 32 was hybridized with the control probe 30 to give the alkaline phosphatase probe 30 * 32. The labeled probe 32 is hybridized with the modified probe 31 to produce the isoC, isoG-alkaline phosphatase probe 31 * 32.

The capture probe 35 is coupled to microtiter wells as described (PCT Publication No. WO93 / 13224, which is hereby incorporated by reference) to form a solid support for hybridization. This capture extender is complementary to the alkaline phosphatase assay 30x32 and partially complementary to the alkaline phosphatase assay 31x32. Probe 33 is a computer polymer that is capable of binding to the capture extender and blocks binding of any alkaline phosphatase probe.

The following incubations are carried out for 30 minutes at 53 ° C in about 1 M sodium chloride:

(1) 250 fmol probe 34 in wells containing 1 mM immobilized probe;

(2) 250 fmol probe 34 + 5 pmol probe 33, wells containing 1 pmol immobilized probe 35;

(3) 5 pmol probe 33 in wells containing 1 pmol immobilized probe 35;

(4) buffer only.

Wash the wells twice as described in Example 1 with 0.1XSSC, 0.1% SDS, and for each of the above incubations, perform a second incubation for 15 minutes under the same conditions as follows:

(1) 25 fmol probe 30 + 500 attomol probe 32;

(2) 25 fmol probe 31 + 500 attomol probe 32;

(3) 500 attomol probe 32; and (4) buffer only.

Wash plates twice as above and wash three times with 10 mM MgCl2 in the same buffer.₂again, 1 mmol / l ZnCl₂and 0.1% Brij-35. Incubate for 25 minutes with Lumiphos Plus (Lumigen) and read on a Chiron luminometer.

The resulting hybrids are shown in Figure 3, where Z, exemplified by isoC and isoG, is a non-natural nucleotide. The 33 probe, the competitor, forms 21 base pairs with the capture extender and is capable of blocking the binding of alkaline phosphatase probes. The modified probe * labeled probe (31 * 32) is capable of hybridizing with the capture extender, generating 11 base pairs and two mismatches (e.g., G * isoC, isoG * T). The control probe * labeled probe (30 * 32) can generate 13 base pairs with the clamp extender.

As shown in Table 8, the capture extender forms a strong hybrid with the control probe * labeled probe (30 * 32) (sample 1 = 399 relative light units (RLU)). Preincubating the capture extender with a 20x molar excess of competitor reduces sample background noise to about one-tenth of background noise (30 RLU). The modified probe * labeled probe (31 * 32) shows 40 times less hybridization (Sample 3 = 9 RLU) with the capture extender than the control probe * labeled probe (30 * 32). The two mismatches caused a 40-fold change in hybridization. This is what is expected for 2 bad fits that all destabilize T by 7-8 ° C_m value (7x8 = 56 times). The use of this competitor and the mismatched alkaline phosphatase assay (Sample 4 = 0.4 RLU) reduces background noise by about 1000. Sample 5 is a control and essentially gives no background noise (0.1 RLU). This was expected since probe 32 has no detectable homology to the capture extender.

8th Spreadsheet

Effect of poor base pair fit on hybridization

<td>Sample line.</td><td>First hybridization</td><td>Second hybridization</td><td>Avg RLU (n = 6)</td><td> 1+</td>

<td> 1</td><td> 34 + 35</td><td> 30+32</td><td> 399</td><td> 7</td>

<td> 2</td><td> 33+34+35</td><td> 30 + 32</td><td> 30</td><td> 9</td>

<td> 3</td><td> 34 + 35</td><td> 31 + 32</td><td> 9</td><td> 6</td>

<td> 4</td><td> 33+34+35</td><td> 31 + 32</td><td> 0,4</td><td> 4</td>

<td> 5</td><td> 34 + 35</td><td> 32</td><td> 0,1</td><td> 11</td>

·

- 69 ¹RLU = relative light unit ² % CV = SD / Avg. x 100

In hybridization assays, the use of competimers for all clamping extenders makes no sense, as there are typically 5 to 10 clamping extenders per assay. In addition, this example shows that preincubation with the competimer was not as effective as simply using 15% base substitution, i.e., replacing two of the 13 bases in the universal sequences. It is expected that 30% base substitution (3 out of 10) will reduce to about one thousandth the specific non-specific hybridization of an otherwise accurate base pair (30% poor fit corresponds to a change of about 30 ° C)._m-in; there is an approximately ten-fold decrease in binding at every 10 ° C_m change).

6th Example

Chemical synthesis of 2'-deoxyisoguanosine

Synthesis of 2'-deoxyisoguanosine from 2'-deoxyguanosine is carried out as follows.

First Step 2 2'-Deoxyguanosine monohydrate (50 mmol) and imidazole (200 mmol) were dried by co-evaporation with 500 ml of dimethylformamide and the residue was dissolved in 500 ml of dimethylformamide. To this solution was added 150 mmol of t-butyldimethylsilyl chloride and the reaction mixture was stirred for 18 hours at room temperature. Methanol (30 ml) was added and after 25 minutes the solvents were removed under reduced pressure. The solvents were removed by evaporation to a residue of 1 L CH₂cl₂wash with 1 L of 5% sodium bicarbonate and 1 L of 80% saturated sodium chloride, the organic phase is washed with₂SALT₄Dry, filter and evaporate to dryness to give 30 g of crude product which is directly dissolved in 2 liters of hot ethanol. Cool slowly to 20 ° C and store for 20 hours at 4 ° C to give pure 3 ', 5'-TBDMS₂-2'-deoxyguanosine (65% yield).

. Step 12 12 mmol of 3 ', 5'-TBDMS₂-2'-Deoxyguanosine was suspended in CH (125 mL, 150 mmol triethylamine and 100 mg N, N-dimethylaminopyridine).₂cl₂-in. 40 mmol of 4-toluenesulfonyl chloride was added at 0 ° C and the reaction was incubated for 20 hours at room temperature. By this time all solids dissolved and a slightly yellow solution was obtained. The reaction was quenched with 50 mL of 5% sodium bicarbonate with stirring for 1 hour. The reaction mixture was treated with 300 mL of CH₂cl₂and washed with 300 ml of 5% sodium bicarbonate and 300 ml of 80% saturated sodium chloride, the organic phase is washed with₂SALT₄dried, filtered and evaporated to dryness to give 8.9 grams of crude product. Flash chromatography on silica gel, 1-4% methanol / CH₂cl₂ using a gradient of 7.95 grams pure 0⁶- (4-Toluenesulfonyl) -3 ', 5' -O-TBDMS₂-2 '-deoxyguanosine (11 mmol) was obtained.

»» &lt;

«

- 71 Step 3 Twelve grams (17 mmol) of O⁶- (4-Toluenesulfonyl) -3 ', 5' -O-TBDMS2-2 'deoxyguanosine is suspended in 300 ml of acetonitrile. Methylpyrrolidine (17 mL) was then added to the reaction mixture and the suspension was stirred for one hour to give a clear solution. TLC analysis shows that all starting materials have been converted to baseline material. 11 g of 4- (methylthio) phenol (85 mmol) are added and the solution is stirred for 60 hours. After evaporation to a small volume, 600 ml of ethyl acetate are added. This solution was extracted with 3 x 400 mL of 0.3 M sodium hydroxide and 400 mL of 80% saturated sodium chloride, then the organic phase was dried over Na2SO4, filtered and evaporated to dryness to give 11.55 grams of crude product. Flash chromatography on silica gel using 4-5% methanol / CH2Cl2 gradient 8.16 grams O⁶- (4-Methylthio) phenyl) -3 ', 5'-O-TBDMS2-2'-deoxyguanosine (11 mmol) was obtained.

4th Step Four Four grams 0⁶- (4-methylthio) phenyl) -3 ', 5'-0TBDMS₂-2'-Deoxyguanosine (6.5 mmol) was dissolved in 65 mL CH₂C1₂at 0 ° C, 6.5 ml of tert-butyl nitrite were added dropwise. The solution was allowed to warm to room temperature while gas (N₂) is evolving. After 40 minutes, when the TLC analysis showed that the starting material was completely consumed and a new, slower migration point appeared, the excess t-butyl nitrite was removed by evaporation under reduced pressure with 2 x 100 ml of toluene. The crude residue was purified by flash silica gel chromatography with 4-5% methanol / CH₂cl₂ using a gradient of 2.75 grams 0⁶(4-methylthio) phenyl-3 ', 5' -O-TBDMS₂-2 '-deoxixanthosine (4.45 mmol) was obtained.

5th Example All purified 2.75 grams O⁶- (4-methylthio) phenyl-3 ', 5' -O-TBDMS₂-2'-Deoxyxanthosine (4.45 mmol) was dissolved in methanol (50 mL). Concentrated aqueous ammonium hydroxide was added and the mixture was heated in a sealed tube at 100 ° C for 4 hours. After cooling, the solvents were removed by evaporation under reduced pressure with ethanol to give 1.8 g of crude product (3.6 mmol). Purification by recrystallization from hot ethanol yielded pure 3 ', 5'-o-TBDMS₂A sample of -2'-deoxyisoguanosine was obtained. This material is identical in all respects (UV, TLC, NMR, and MS) to the sample produced by a published photolytic method (Switzer et al., 1993, Biochemistry 32, 10489-10496).

7th Example

Control of Aspect Specific Hybridization of Amplifying and Alkaline Phosphatase Assay to Clamping Extenders

A. Preparation of an isoC, isoG bDNA amp and isoC, isoG ap probe

A 15-fold comb-like amplification multimer (amp) was prepared as previously described in PCT Publication No. WO92 / 02526. Arms for comb ·· «···

- 73 were ligated with a 12 nucleotide linker and T4 DNA ligase as described. The alkaline phosphatase (ap) probe is prepared from an oligonucleotide containing an amino functional group as described in U.S. Patent No. 5,124,246. The sequences used are as follows:

<td>Sequence (5 '-&gt; 3')</td><td>Sequence ID</td>

<td>AGT FAJ CGC FGT AFC AAJ TJC….</td><td>AMP repetitive sequence</td>

<td>ATC ACG AAC TCA TCA CGA ACT C</td><td>AMP leader sequence</td>

<td>GFA FTT GJT ACJ GCG FTJ ACT ... L</td><td>AP probe sequence</td>

F = isoC, J = isoG, L = long chain amine

B. Preparation of capture extender (CE) sequences

Extender (CE) capturing targets are prepared for TNF-alpha, interleukin-2, interleukin-4, interleukin-6 and interferon-gamma (IFNγ) using standard phosphoramidite methods. The probe extender sequences tested are as follows:

TNF alpha CE pool

TCCAGCTGGAAGACCCCTCCCAGATAGATGGGCZCTCTTGGAAAGAAAGTGAT

CGATTGATCTCAGCGCTGAGTCGGTCACCCTTCZCTCTTGGAAAGAAAGTGAT

TGCCCAGACTCGGCAAAGTCGAGATAGTCGGGCZCTCTTGGAAAGAAAGTGAT

CCTCCTCACAGGGCAATGATCCCAAAGTAGACCZCTCTTGGAAAGAAAGTGAT

CAGGGGAGGCGTTTGGGAAGGTTGGATGTTCGTZCTCTTGGAAAGAAAGTGAT

TGTCTGAAGGAGGGGGTAATAAAGGGATTGGGGZCTCTTGGAAAGAAAGTGAT

CAATTCTCTTTTTGAGCCAGAAGAGGTTGAGGGZCTCTTGGAAAGAAAGTGAT

AAGTTCTAAGCTTGGGTTCCGACCCTAAGCCCCZCTCTTGGAAAGAAAGTGAT

7140th tnf.21

7141st tnf.22

7142nd tnf.23

7143rd tnf.24

7144th tnf.25

7145th tnf.26

7146th tnf.27

7147th tnf.28

CE side of IL-6

<td> - 74 -</td><td> ·· ·»*&gt;·· « • · ·· · · · ·· • · · · · · · • ··-»·· · ···· ··· ·· * ··</td>

<td>CTGGACAGCTCTGGCTTGTTCCTCACTACTCTCZCTCTTGGAAAGAAAGTGAT</td><td>7270.il6.15</td>

<td>CTGCAGGAACTGGATCAGGACTTTTGTACTCATZCTCTTGGAAAGAAAGTGAT</td><td>7271.il6.16</td>

<td>GGTGGTTATTGCATCTAGATTCTTTGCCTTTTTZCTCTTGGAAAGAAAGTGAT</td><td>7272.il6.17</td>

<td>CGTCAGCAGGCTGGCATTTGTGGTTGGGTCAGGZCTCTTGGAAAGAAAGTGAT</td><td>7273.il6.18</td>

<td>GTCCTGCAGCCACTGGTTCTGTGCCTGCAGCTTZCTCTTGGAAAGAAAGTGAT</td><td>7274.il6.19</td>

<td>CTTAAAGCTGCGCAGAATGAGATGAGTTGTCATZCTCTTGGAAAGAAAGTGAT</td><td>7275.il6.20</td>

<td>CCGAAGAGCCCTCAGGCTGGACTGCAGGAACTCZCTCTTGGAAAGAAAGTGAT</td><td>7276.il6.21</td>

IFNy CE Pool

<td>CATCGTTTCCGAGAGAATTAAGCCAAAGAAGTTZCTCTTGGAAAGAAAGTGAT</td><td>8013.infg.1</td>

<td>GAGCTGAAAAGCCAAGATATAACTTGTATATTTZCTCTTGGAAAGAAAGTGAT</td><td>8014.infg.2</td>

<td>GCAGTAACAGCCAAGAGAACCCAAAACGATGCAZCTCTTGGAAAGAAAGTGAT</td><td>8015.infg.3</td>

<td>AAGGTTTTCTGCTTCTTTTACATATGGGTCCTGZCTCTTGGAAAGAAAGTGAT</td><td>8016.infg.4</td>

<td>TACATCTGAATGACCTGCATTAAAATATTTCTTZCTCTTGGAAAGAAAGTGAT</td><td>8017.infg.5</td>

<td>CAAAATGCCTAAGAAAAGAGTTCCATTATCCGCZCTCTTGGAAAGAAAGTGAT</td><td>8018.infg.6</td>

CE side of IL-2

<td>GAGTTGAGGTTACTGTGAGTAGTGATTAAAGAGZCTCTTGGAAAGAAAGTGAT</td><td>8428.il-2: l</td>

<td>AAGACAGGAGTTGCATCCTGTACATTGTGGCAGZCTCTTGGAAAGAAAGTGAT</td><td>8429.Í1-2.2</td>

<td>TGTTTGTGACAAGTGCAAGACTTAGTGCAATGCZCTCTTGGAAAGAAAGTGAT</td><td>8430.Í1-2.3</td>

<td>GTGTTTTCTTTGTAGAACTTGAAGTAGGTGCACZCTCTTGGAAAGAAAGTGAT</td><td>8431.Í1-2.4</td>

<td>GTAAATCCAGMAGTAAATGCTCCAGTTGTAGCTZCTCTTGGAAAGAAAGTGAT</td><td>8432.Í1-2.5</td>

IL-4 CE Pool

<td>ACACTTTGAATATTTCTCTCTCATGATCGTCTTZCTCTTGGAAAGAAAGTGAT</td><td>8720.il, 4:15</td>

<td>TCAAAAACTCATAAATTAAAATATTCAGCTCGAZCTCTTGGAAAGAAAGTGAT</td><td>8721.il to 4.16</td>

<td>TATAAATATATAAATACTTAAAAAATAAAGCTAZCTCTTGGAAAGAAAGTGAT</td><td>8722.il, 4:17</td>

<td>TAGATTCTATATATACTTTATTTTATGATGAGTZCTCTTGGAAAGAAAGTGAT</td><td>8723.il, 4:18</td>

Note: Z = triethylene glycol spacer • ·

<img file="HUT77754A_D0011.tif" />

C. Procedure for the Measurement of Non-Specific Hybridization (NSH) between CE and amp and CE and ap

A total of 100 femtomoles from each capture extender probe, or a pool containing 100 femtomole from each capture extender, was incubated for one hour in the microtiter wells at 53 degrees. After washing twice with wash liquid A (0.1xSSC, 0.1% SDS), the wells are incubated for 30 minutes in an amplifying diluent, +/- in non-isoC, isoC (described in WO95 / 16055) or isoC. , iso (see Example 7A). After two additional washes with wash liquid A, the wells were incubated for 15 minutes in amp diluent (5xSSC, 50% protenase-K-digested horse serum) containing either the non-isoC, iso-gp assay (WO95 / 16055) or isoG contains the p probe (Example 7A).

The following definitions are used: AP NSB = background of ap test when CE is not present. Amp NSB = background of amp and ap probe in the absence of CE minus ap NSB. AP NSH = RLU from CE sample without amp minus ap NSB. AMP NSH = RLU from CE sample, - AP NSH - AMP NSB - AP NSB.

D. Results

Five specific CE probes are assayed for background non-specific hybridization using 100 fmol per well. The results are shown in the table below.

<td>Oligo Trial #</td><td>AMP NSH</td><td>iC AMP NSH</td><td>AP NSH</td><td>iC AP NSH</td>

<td> 7273</td><td> 11,2</td><td> (0,2)</td><td> 6,1</td><td> (0,2)</td>

<td> 7274</td><td> 1,2</td><td> (0,1)</td><td> 0,1</td><td> (0,2)</td>

<td> 7144</td><td> 13, 1</td><td>- | K. SHE 1_</td><td> 0,1</td><td> (0,2)</td>

<td> 8015</td><td> 37,4</td><td> 0,1</td><td> (0,0)</td><td> (0,2)</td>

<td> 8018</td><td> 0,2</td><td> (0,1)</td><td> 0,1</td><td> (0,1)</td>

<td></td><td>AMP NSB:</td><td>iC AMP NSB:</td><td>AP NSB:</td><td>iC AP NSB</td>

<td>no DNA</td><td> 1,1</td><td> 0, 6</td><td> 0,7</td><td> 0,5</td>

Values ​​in parentheses are less than zero RLU.

AMP = non-isoC, isoG amp, iC AMP = isoC, isoG amp, AP = nemizoC, isoG ap, iC AP = isoC, isoGG ap.

Non-specific binding background in the absence of CE probes (AP-NSB and AMP-NSB) is negligible (<= 1 RLU) for each amp and ap probe. Three of the extenders show strong (> 10 RLU) cross-reactivity with the used amp probe, which is not observed with the isoC, isoG amp. One probe shows 6 RLU cross-reactivity with the AP test used, which is not observed with the isoC, isoG AP test. In all cases, NSH is negligible with the isoC, isoG probe. RLU values ​​less than 1.0 are insignificant relative to NSB.

Five pools from CE probes were tested for their non-specific hybridization background with the same molecules. The results are shown below.

<td>Oligo CE pool</td><td>AMP NSH</td><td>iC AMP NSH</td><td>AP NSH</td><td>iC AP NSH</td>

<img file="HUT77754A_D0012.tif" />

<td>(CE number)</td><td></td><td></td><td></td><td></td>

<td>IL-2 (5)</td><td> 2,3</td><td> 0,2</td><td> 1,2</td><td>She fc She</td>

<td>IL-4 (4)</td><td> (0,2)</td><td> 0,2</td><td> 0, 0</td><td>She fc, She</td>

<td>IL-6 (7)</td><td> 16, 0</td><td> 0,2</td><td> 4,7</td><td>She fc She</td>

<td>TNF (8)</td><td> 14,6</td><td> 0,0</td><td>She She</td><td> 0,3</td>

<td>IFNg (6)</td><td> 34, 9</td><td> (0,1)</td><td> 0,2</td><td> 0,1</td>

<td></td><td>AMP NSB:</td><td>ic AMP NSB</td><td>AP NSB:</td><td>iC AP NSB:</td>

<td>No DNA</td><td> 1,7</td><td> 1,1</td><td> 0,4</td><td> 0,5</td>

For the meaning of abbreviations, see the explanatory text in the previous table.

Again, the result is that the NSB of all amp and ap probes is negligible relative to NSH. Four of the five pools show significant amp NSH in the range of Rs 2, 3 to 349.9, while none of the CE pools show significant NSH (&lt;1) with the isoC, isoG amp. Two of the pools show significant NSH with the ap probe, while none of the pools show significant interaction with the isoC, iso isoGp probe. In this experiment, a total of 30 CE sequences were tested for cross-reactivity.

One skilled in the art, having the ability to introduce new base pairs in hybridization assays, will find that replacing the amp leader sequence with an isoC, isoOG leader sequence is expected to result in the isoC, isoOG amp- lower NSH values ​​are available.

Ε. Total dose response curve of IL-2 and IL-6 with isoC, isoCG amp and ap

Complete dose-response curves were prepared by serial dilution of human cells with IL-2 and IL-6 mRNA. The limit of detection was calculated from the number of cells at which delta = zero. The delta value is determined as follows: pose. RLU-2 std. dev .- (neg. RLU + 2 std. dev). The results are summarized in the table below.

<td>test</td><td>Current limit of detection</td><td>Isocyanate / G limit of detection</td><td>The improvement degree</td>

<td>IL-2</td><td> 41000</td><td> 3000</td><td> 12,6</td>

<td>IL-6</td><td> 34000</td><td> 11000</td><td> 3,0</td>

Sensitivity increased to 12.6-fold in the IL-2 assay and tripled in the IL-6 assay using isoC / G amp and ap instead of the current molecule having natural sequences. The greater the noise than the natural sequences, the greater the improvement in the assay.

The present invention provides new methods for generating a more target-dependent signal in solution-phase sandwich hybridization assays. In addition, a novel method for the preparation of 2'-deoxyisoguanosine has been described ···· · · · · · · · ·

- 79 ra. Although the preferred embodiments of the present invention have been described in some detail, it will be understood that modifications may be made without departing from the spirit and scope of the present invention as defined by the appended claims.