Antibodies that bind cell-associated CA 125/O722P and methods of use thereof

(56)

References cited:

WO-A-00/36107

WO-A2-02/06317

WO-A-2004/005470 US-A- 5 976 818 • NUSTAD K ET AL: Specificity and affinity of 26 monoclonal antibodies against the CA 125 antigén: First report from the ISOBM TD-1 workshop, TUMOR BIOLOGY, vol. 17, no. 4, 1996, pages 196-219, XP009054890, ISSN: 1010-4283 • NAP M ET AL: IMMUNOHISTOCHEMICAL CHARACTERIZATION OF 22 MONOCLONAL ANTIBODIES AGAINST THE CA125 ANTIGÉN: 2ND REPORT FROM THE ISOBM TD-1 WORKSHOP, TUMOR BIOLOGY, KARGER, BASEL, CH, vol. 17, no. 6, 1996, pages 325-331, XP008037327, ISSN: 1010-4283 • O’BRIEN TIMOTHY J ET AL: The CA 125 gene: An extracellular superstructure dominated by repeat sequences, TUMOR BIOLOGY, vol. 22, no. 6, November 2001 (2001-11), pages 348-366, XP002953298, ISSN: 1010-4283 • SINGLETON J ET AL: CHARACTERIZATION OF ANTIBODIES TO CA 125 THAT BIND PREFERENTIALLY TO THE CELL-ASSOCAITED FORM OF THE ANTIGÉN, TUMOR BIOLOGY, KARGER, BASEL, CH, vol. 27, no. 3,1 April 2006 (2006-04-01), pages 122-132, XP009070942, ISSN: 1010-4283, DÓI: 10.1159/000092717

ΕΡ 2 891 666 Β1

Elisenstrasse 3

80335 München (DE)

Note: Within nine months ofthe publication ofthe mention ofthe grant ofthe European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations. Notice of opposition shall nőt be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention).

Printed by Jouve, 75001 PARIS (FR)

ΕΡ 2 891 666 Β1

Description

1. FIELD OF THE INVENTION [0001] The present invention provides antibodies, and antigen-binding fragments of antibodies, that preferentially bind cell-associated CA 125/O772P polypeptides relatíve to shed CA 125/O772P polypeptides and pharmaceutical compositions thereof. The present disclosure further provides methods of preventing, managing, treating or ameliorating one or more symptoms associated with a CA 125/O772P-related disorder. In particular, the present disclosure provides methods of preventing, managing, treating, or ameliorating one or more symptoms associated with a cell proliferative disorder. Fór example, the present disclosure provides methods of preventing, managing, treating or ameliorating one or more symptoms associated with cancer. In a preferred embodiment, the present disclosure provides methods of preventing, managing, treating or ameliorating one or more symptoms of ovarian cancer. The present invention alsó provides compositions fór use in treating a cell proliferative disorder as CA 125/O772P-related disorder, and the present disclosure provides articles of manufacture fór use in preventing, managing, treating or ameliorating one or more symptoms associated with a CA 125/O772P-related disorder, fór example cancer, e.g., ovarian cancer. The present disclosure still further provides methods fór diagnosing a CA 125/O772P-related disorder or predisposition to developing such a disorder.

2. BACKGROUND OF THE INVENTION [0002] The high molecular weight polypeptide referred to as CA 125 can be detected in approximately 80% of all patients with ovarian carcinomas (see Kabawat et al., Am. J. Clin.Pathol. 79:98-104 (1983); and Gadducci et al., Gynecol. Oncol. 44:147-154 (1992)). CA 125 is present on the surface of tumor cells, and elevated secreted, or shed, forms of CA 125 are present in approximately 80-90% of ovarian cancer patients.

[0003] Antibodies directed against CA 125 have been produced and utilized fór the determination of CA 125 concentrations and fór purification of CA 125 from cell culture médium. See, e.g., Bast et al., J. Clin. Invest. 68(5):1331-1337 (1981); Krantzet al., J. Cell. Biochem. (Suppl.) 12(E):139 (1988); U.S. Patent Nos. 4,921,790, 5,059,680, and 5,976,818; and JP11014626.

[0004] In addition to antibodies fór monitoring the presence of CA 125, U.S. Patent Nos. 5,858,361 and 6,241,985 describe anti-idiotypic anti-CA 125 antibodies as therapeutic agents.

[0005] Compositions comprising antibodies fór therapy and diagnosis of cancer, in particular ovarian cancer are disclosed in WO 00/36107 and W00206317 . Nustad et al., Tumor Bioi. 17:196:219 (1996) identifies two major antigenic domains on CA 125 and on this basis classifies 26 monoclonal antibodies which were tested fór specificity and affinity intő three groups: C125-like, M11-like and a single antibody OV 197. Nap et al., Tumor Bioi. 17:325-331 (1996) is concerned with an immunohistochemical characterization of 22 monoclonal antbodies against the CA125 antigén. [0006] Despite the above, CA 125-related disorders such as ovarian cancer remain a major problem and, as such, a great need exists fór methods and compositions fór the treatment of such disorders.

[0007] Citation or identification of any reference in this or any other section of this application shall nőt be construed as an admission that such reference is available as prior art to the present invention.

3. SUMMARY OF THE INVENTION [0008] The present invention is directed to the isolated antibody as claimed in claim 1, the pharmaceutical composition as claimed in claim 7, and the isolated antibody fór use as claimed in claims 8 and 9. The present invention is based, in part, on the recognition that the events that produce shed CA 125/O772P alsó leave a portion ofthe extracellular region ofthe CA 125/O772P amino acid sequence in cell-associated form, i.e., alsoyield cell-associated CA 125/O772P. [0009] The present invention is further based, in part, on the recognition that antibodies, and antigén binding antibody fragments, that preferentially bind cell-associated CA 125/O772P relatíve to shed CA 125/O772P can be generated, and that such antibodies, or antigen-binding antibody fragments, can, fór example, be utilized to prevent, manage, treat or ameliorate a CA 125/O772P-related disorder or one or more symptoms of a CA 125/O772P-related disorder such as a cell proliferative disorder, fór example, cancer, e.g., ovarian cancer.

[0010] In a first aspect, the present invention provides an isolated antibody, or an antigén binding antibody fragment, that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide as defined in the claims. Alsó provided is an isolated antibody or antigen-binding antibody fragment that binds to the peptide of Figure 1. Such antibodies and antigen-binding antibody fragments ofthe invention are useful fór a variety of therapeutic, prophylactic, diagnostic, and purification purposes as described herein.

[0011] An antibody or antigen-binding antibody fragment ofthe invention is one that binds the peptide of SEQ ID NO: 1 or SEQ ID NO:2 and preferentially binds cell-associated CA 125/O772P, wherein the antibody or antigen-binding

ΕΡ 2 891 666 Β1 antibody fragment of the invention binds the non-repeat region depicted in SEQ ID NO:1 or SEQ ID NO:2. In another embodiment ofthe present disclosure, the antibody orantigen-binding antibody fragment ofthe disclosure binds a repeat region depicted in SEQ ID NO:1 or SEQ ID NO:2.

[0012] In a first embodiment, the antibody or antigen-binding antibody fragment ofthe invention exhibits, in an ELISA Competition Assay, less than about25%, less than about20%, less than about 15%, less than about 10%, or less than about 5% inhibition of binding to the peptide of Figure 1 (SEQ ID NO: 1) in the presence of a 25-fold (weight/weight) excess of shed CA125/O772P overthe peptide of Figure 1 (SEQ ID NO: 1) and/or, in a second embodiment, the antibody or antigen-binding antibody fragment of the invention exhibits, in a Flow Cytometry Competition Assay, an IC₅₀, as measured by percent-positive cells, of at least about 0.05 mg/ml, at least about 0.25 mg/ml, at least about 0.5 mg/ml, at least about 0.75 mg/ml, or at least about 1.0 mg/ml shed CA 125/O772P. In a third embodiment, the antibody or antigen-binding antibody fragment ofthe disclosure binds the peptide of Figure 1, bút does nőt detectably bind shed CA 125/O772P polypeptide.

[0013] An antibody, orantigen-binding antibody fragment, that satisfies any one of these three embodiments constitutes an antibody or antigen-binding antibody fragment that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide.

[0014] Among the antibodies and antigen-binding antibody fragments of the invention are, antibodies or antigenbinding antibody fragments that bind the peptide of Figure 1 (SEQ ID NO: 1) with a K_d of less than about 100nM, less than about 10nM, less than about 1nM, less than about 100pM, or less than about 10pM as measured by the BIAcore Affinity Assay, which is described in Section 6.4, herein below.

[0015] Among the preferred embodiments of the antibodies or antigen-binding antibody fragments of the disclosure are antibodies or antigen-binding antibody fragments that mediate lysis of CA 125/O772P-positive tumor cells in an antibody-dependent cellular cytotoxicity (ADCC) assay. Such antibodies or antigen-binding antibody fragments include, fór example, ones that mediate at least about 10% lysis of CA 125/O772P-positive tumor cells in an ADCC assay at a 50: 1 effector:target ratio at a concentration of 5 μg antibody or antigén binding fragment per ml; mediate at least about 20% lysis of CA 125/O772P-positive tumor cells in an ADCC assay at a 50: 1 effector:target ratio at a concentration of 5 μg antibody or antigen-binding fragment per ml; mediate at least about 10% lysis of CA 125/O772P-positive tumor cells in an ADCC assay at a 50:1 effector:target ratio at a concentration of 5.0 μg antibody or antigen-binding fragment permi; mediate at least about 10% lysis of CA 125/O772P-positive tumor cells in an ADCC assay at a 25:1 effector:target ratio at a concentration of 5 μg antibody or antigen-binding antibody fragment per ml; mediate at least about 10% lysis of CA 125/O772P-positive tumor cells in an ADCC assay at a 12.5:1 effector:target ratio at a concentration of 5 μg antibody orantigen-binding antibody fragment per ml; mediate at least about 10% lysis of CA 125/O772P-positive tumor cells in an ADCC assay at a 12.5:1 effector:target ratio at a concentration of 0.5 μg antibody or antigen-binding antibody fragment per ml; or that mediate at least about 10% lysis of CA 125/O772P-positive tumor cells in an ADCC assay at a: 12.5: 1 effector:target ratio at a concentration of 50 ng antibody or antigen-binding antibody fragment per ml.

[0016] Preferred embodiments of the disclosure alsó include antibodies or antigen-binding antibody fragments that mediate lysis of CA 125IO772P-positive tumor cells in a complement-dependent cytotoxicity (CDC) assay. Such antibodies or antigen-binding antibody fragments include, fór example, ones that mediate lysis in a rangé of about 15% lysis at 5 μg/ml to about 95% lysis at about 0.1 μg/ml antibody or antigen-binding antibody fragment concentration.

[0017] Preferred embodiments of the antibodies or antigen-binding antibody fragments of the invention alsó include antibodies and antigen-binding antibody fragments that inhibit CA 125/O772P-positive tumor growth.

[0018] In one particular embodiment, an antibody of the disclosure is a monoclonal antibody produced by hybridoma 4E7 (ATCC® Accession No. PTA-5109), or by hybridoma 7A11 (ATCC® Accession No. PTA-5110), or by hybridoma 7C6 (ATCC® Accession No. PTA-5111), or by hybridoma 7F10 (ATCC® Accession No. PTA-5112), or by hybridoma 7G10 (ATCC® Accession No. PTA-5245), or by hybridoma 7H1 (ATCC® Accession No. PTA- 5114), or by hybridoma 8A1 (ATCC® Accession No. PTA-5115), or by hybridoma 8B5 (ATCC® Accession No. PTA-5116), or by hybridoma 8C3 (ATCC® Accession No. PTA-5246), or by hybridoma 8E3 (ATCC® Accession No. PTA -5118), or by hybridoma 8G9 (ATCC® Accession No. PTA-5119), or by hybridoma 15C9 (ATCC® Accession No. PTA- 5106), or by hybridoma 16C7 (ATCC® Accession No. PTA-5107), or by hybridoma 16H9 (ATCC® Accession No. PTA-5108), or by hybridoma

117.1 (ATCC® Accession No. PTA-4567), or by hybridoma 325.1 (ATCC® Accession No. PTA-5120), or by hybridoma

368.1 (ATCC® Accession No. PTA-4568), or by hybridoma 446.1 (ATCC® Accession No. PTA-5549), or by hybridoma

501.1 (ATCC® Accession No. PTA-4569), or by hybridoma 621.1 (ATCC® Accession No. PTA-5121), or by hybridoma

633.1 (ATCC® Accession No. PTA-5122), or by hybridoma 654.1 (ATCC® Accession No. PTA-5247), or by hybridoma

725.1 (ATCC® Accession No. PTA-5124), or by hybridoma 776.1 (ATCC® Accession No. PTA-4570).

[0019] In another particular embodiment, an antibody or antigen-binding antibody fragment ofthe disclosure is an antibody orantigen-binding antibody fragment that competes with the monoclonal antibody produced by hybridoma 4E7 (ATCC® Accession No. PTA-51 09), or by hybridoma 7A11 (ATCC® Accession No. PTA-5110), or by hybridoma 7C6 (ATCC® Accession No. PTA-5111), or by hybridoma 7F10 (ATCC® Accession No. PTA-5112), or by hybridoma 7G10 (ATCC® Accession No. PTA-5245), or by hybridoma 7H1 (ATCC® Accession No. PTA-5114), or by hybridoma 8A1

ΕΡ 2 891 666 Β1 (ATCC® Accession No. PTA-5115), or by hybridoma 8B5 (ATCC® Accession No. PTA-5116), or by hybridoma 8C3 (ATCC® Accession No. PTA-5246), or by hybridoma 8E3 (ATCC® Accession No. PTA-5118), or by hybridoma 8G9 (ATCC® Accession No. PTA-5119), or by hybridoma 15C9 (ATCC® Accession No. PTA-5106), or by hybridoma 16C7 (ATCC® Accession No. PTA-5107), or by hybridoma 16H9 (ATCC® Accession No. PTA-5108), or by hybridoma 117.1 (ATCC® Accession No. PTA-4567), or by hybridoma 325.1 (ATCC® Accession No. PTA-5120), or by hybridoma 368.1 (ATCC® Accession No. PTA-4568), or by hybridoma 446.1 (ATCC® Accession No. PTA-5549), or by hybridoma 501.1 (ATCC® Accession No. PTA-4569), or by hybridoma 621.1 (ATCC® Accession No. PTA-5121), or by hybridoma 633.1 (ATCC® Accession No. PTA-5122), or by hybridoma 654.1 (ATCC® Accession No. PTA-5247), or by hybridoma 725.1 (ATCC® Accession No. PTA-5124), or by hybridoma 776.1 (ATCC® Accession No. PTA-4570) fór binding to cellassociated CA 125/O772P. Antibodies orantigen-binding antibody fragments ofthe invention are considered to compete fór binding if they compete fór binding in an ELISA Cross-Competition Assay and/or a FACS Cross Competition Assay. An antibody or antigen-binding antibody fragment is considered to compete fór binding in an ELISA Cross-Competition Assay or a FACS Cross-Competition Assay if the IC₅₀ fór the competitor antibody or antigen-binding fragment is a concentration no more than about 100-fold above the concentration ofthe antibody orantigen-binding antibody fragment. In a preferred embodiment, the IC₅₀ of the competitor antibody or antigen-binding antibody fragment is a concentration no more than about 10-fold above the concentration ofthe antibody or antigen-binding fragment. In a more preferred embodiment, the IC₅₀ of the competitor antibody or antigen-binding antibody fragment is a concentration no more than about equimolar with the concentration of the antibody or antigen-binding antibody fragment.

[0020] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a

117.1 light chain polypeptide variable region (117.1 L) comprising the amino acid sequence depicted in SEQ ID NO:27 (117.1 L). In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a 117.1 heavy chain polypeptide variable region (117.1H) comprising the amino acid sequence depicted in SEQ ID NO:28 (117.1 H). In still another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:27 (117.1L) and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:28 (117.1H).

[0021] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a

368.1 light chain polypeptide variable region (368.1 L) comprising the amino acid sequence depicted in SEQ ID NO:29 (368.1 L). In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a 368.1 heavy chain variable region (368.1 H) comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H). In still another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:29 (368.1 L) and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H).

[0022] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a

501.1 light chain polypeptide variable region (501.1L) comprising the amino acid sequence depicted in SEQ ID NO:31 (501.1L). In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a 501.1 heavy chain variable region (501.1H) comprising the amino acid sequence depicted in SEQ ID NO:32 (501.1H). In still another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:31 (501.1L) and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:32 (501.1H).

[0023] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a

776.1 light chain polypeptide variable region (776.1 L) comprising the amino acid sequence depicted in SEQ ID NO:33 (776.1 L). In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a 776.1 heavy chain variable region (776.1 H) comprising the amino acid sequence depicted in SEQ ID NO:34 (776.1 H). In still another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:33 (776.1 L) and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:34 (776.1 H).

[0024] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a

725.1 light chain polypeptide variable region (725.1 L) comprising the amino acid sequence depicted in SEQ ID NO:54. In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a 725.1 heavy chain variable region (725.1 H) comprising the amino acid sequence depicted in SEQ ID NO:53. In still another particular embodiment, an antibody orantigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:54 and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:53.

[0025] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a 16H9 light chain polypeptide variable region ( 16H9L) comprising the amino acid sequence depicted in SEQ ID NO:56. In yet another particular embodiment, an antibody or antigen-binding fragment ofthe invention is one that comprises a

501.1 heavy chain variable region (16H9) comprising the amino acid sequence depicted in SEQ ID NO:55. In still

ΕΡ 2 891 666 Β1 another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptidevariable region comprising the amino acidsequencedepicted in SEQ ID NO:56and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:55.

[0026] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:27 (117.1 L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H), SEQ ID NO:32 (501.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55 (16H9H).

[0027] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:29 (368.1 L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H), SEQ ID NO:32 (501.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55 (16H9H) [0028] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosedis one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:31 (501.1L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1H), SEQ ID NO:32 (501.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55 (16H9H) [0029] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:33 (776.1 L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H), SEQ ID NO:32 (501.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53(725.1 H), or SEQ ID NO:55 (16H9H).

[0030] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:54 (725.1 L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H), SEQ ID NO:32 (501.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55 (16H9H).

[0031] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:33 (16H9L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H), SEQ ID NO:32 (501.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55 (16H9H).

[0032] The antibodies can include, bút are nőt limited to, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, humanized antibodies, humán antibodies, bispecific antibodies, tri-specific antibodies, multi-specific antibodies, diabodies, tribodies, single-chain antibodies or anti -idiotypic antibodies. In a preferred embodiment, an antibody of the invention is a monoclonal antibody that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide.

[0033] The antigen-binding antibody fragments can include, bút are nőt limited to, Fab fragments, F(ab’)₂ fragments, disulfide-linked F_vS, single-chain F_vS, variable light chain polypeptide (VL)-containing fragments, variable heavy chain polypeptide (VH)containing fragments, or complementarity-determining region (CDR)-containing fragments, and fragments of any of the antibodies listed above. Further, the antibodies and antigen-binding antibody fragments can be of any immunoglobulin eláss. Fór example, the antibodies of the invention can be IgG, IgM, IgE, IgD, IgA or IgY eláss antibodies. The antibodies of the invention can alsó be of any isotype. Fór example, an antibody can be of an IgG^ lgG₂, lgG₃, lgG₄, lgA₁ or lgA₂ heavy chain isotype.

[0034] Still further, the antibodies can, tor example, comprise a variable light chain region, tor example, a κ or λ light chain variable region, a variable heavy chain region, or a CDR thereof, inserted within a framework region. Fór example, an antibody of the invention can comprise a Cy1 constant region or a C-/4 constant region.

[0035] In another aspect, the present disclosure provides hybridoma cells that produce a monoclonal antibody of the invention. In one embodiment, a hybridoma of the present invention is hybridoma 4E7 (ATCC® Accession No. PTA5109), hybridoma 7A11 (ATCC® Accession No. PTA-5110), hybridoma 7C6 (ATCC® Accession No. PTA-5111), hybridoma 7F10 (ATCC® Accession No. PTA-5112), hybridoma 7G10 (ATCC® Accession No. PTA-5245), hybridoma 7H1 (ATCC® Accession No. PTA-5114), hybridoma 8A1 (ATCC® Accession No. PTA-5115), hybridoma 8B5 (ATCC® Accession No. PTA-5116), hybridoma 8C3 (ATCC® Accession No. PTA-5246), hybridoma 8E3 (ATCC® Accession No. PTA-5118), hybridoma 8G9 (ATCC® Accession No. PTA-5119), hybridoma 15C9 (ATCC® Accession No. PTA-5106), hybridoma 16C7 (ATCC® Accession No. PTA-5107), hybridoma 16H9 (ATCC® Accession No. PTA-5108), hybridoma

117.1 (ATCC® Accession No. PTA- 4567), hybridoma 325.1 (ATCC® Accession No. PTA-5120), hybridoma 368.1 (ATCC®Accession No. PTA-4568), hybridoma 446.1 (ATCC® Accession No. PTA-5549), hybridoma 501.1 (ATCC® Accession No. PTA-4569), hybridoma 621.1 (ATCC® Accession No. PTA- 5121), hybridoma 633.1 (ATCC® Accession No. PTA-5122), hybridoma 654.1 (ATCC® Accession No. PTA-5247), hybridoma 725.1 (ATCC® Accession No. PTA5124), or hybridoma 776.1 (ATCC® Accession No. PTA-4570).

[0036] In another embodiment, a hybridoma of the present disclosure is a hybridoma that produces monoclonal antibodies that compete with the monoclonal antibody produced by hybridoma 4E7 (ATCC® Accession No. PTA-5109), hybridoma 7A11 (ATCC® Accession No. PTA-5110), hybridoma 7C6 (ATCC® Accession No. PTA-5111), hybridoma

ΕΡ 2 891 666 Β1

7F10 (ATCC® Accession No. ΡΤΑ-5112), hybridoma 7G10 (ATCC® Accession No. PTA-5245), hybridoma 7H1 (ATCC® Accession No. PTA-5114), hybridoma 8A1 (ATCC® Accession No. PTA-5115), hybridoma 8B5 (ATCC® Accession No. PTA-5116), hybridoma 8C3 (ATCC® Accession No. PTA-5246), hybridoma 8E3 (ATCC® Accession No. PTA-5118), hybridoma 8G9 (ATCC® Accession No. PTA-5119), hybridoma 15C9 (ATCC® Accession No. PTA-5106), hybridoma 16C7 (ATCC® Accession No. PTA-5107), hybridoma 16H9 (ATCC®Accession No. PTA-5108), hybridoma 117.1 (ATCC® Accession No. PTA-4567), hybridoma 325.1 (ATCC® Accession No. PTA-5120), hybridoma 368.1 (ATCC® Accession No. PTA-4568), hybridoma 446.1 (ATCC® Accession No. PTA-5549), hybridoma 501.1 (ATCC® Accession No. PTA-4569), hybridoma 621.1 (ATCC® Accession No. PTA-5121), hybridoma 633.1 (ATCC® Accession No. PTA5122), hybridoma 654.1 (ATCC® Accession No. PTA-5247), hybridoma 725.1 (ATCC® Accession No. PTA-5124), or hybridoma 776.1 (ATCC® Accession No. PTA-4570) fór binding to cell-associated CA 125 /O772P. Antibodies are considered to compete fór binding if they compete fór binding in an ELISA CrossCompetition Assay and/or a FACS Cross-Competition Assay. An antibody or antigén binding antibody fragment is considered to compete fór binding in an ELISA CrossCompetition Assay or a FACS Cross-Competition Assay if the IC₅₀ fór the competitor antibody or antigenbinding fragment is a concentration no more than about 100-fold above the concentration ofthe antibody or antigenbinding antibody fragment. In a preferred embodiment, the IC₅₀ ofthe competitor antibody or antigen-binding antibody fragment is a concentration no more than about 10-fold above the concentration of the antibody or antigén binding fragment. In a more preferred embodiment, the IC₅₀ ofthe competitor antibody or antigén binding antibody fragment is no more than about equimolar with the concentration of the antibody or antigen-binding antibody fragment.

[0037] In yet another aspect, the present disclosure provides an isolated nucleic acid molecule that comprises a nucleotide sequence that encodes an antibody or antigen-binding antibody fragment ofthe invention. In another aspect, the present disclosure provides a fusion polypeptide comprising an antibody or an antigen-binding antibody fragment disclosed, i.e., one that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide, operably linked to a heterologous agent. In one embodiment of a fusion polypeptide, the antibody, or antigenbinding antibody fragment, and the heterologous agent are operably linked via a covalent linkage, such as a peptide bond ordisulfide bond. In another embodiment,a fusion polypeptide, the antibody, or antigen-binding antibody fragment, and the heterologous agent may operably be linked via non-covalent linkage. In another embodiment of a fusion polypeptide disclosed, the heterologous agent comprises an amino acid sequence or a radioisotope. In various non-limiting embodiments, the heterologous agent of the fusion polypeptide of the invention comprises a cytotoxic agent or a detectable, e.g., imaging, agent.

[0038] Alsó disclosed are analogs ofthe antibodies, antigen-binding antibody fragments and fusion polypeptides of the invention that preferentially bind cell-associated CA 125/O772P relatíve to shed CA 125/O772P as defined in the claims. In one embodiment, such an analóg exhibits increased affinity fór cell-associated CA 125/O772P relatíve to that of a corresponding pre-modified antibody, antigen-binding antibody fragments and fusion polypeptide. In another embodiment, such an analóg exhibits an increased serum half-life compared to a corresponding pre-modified antibody, antigen-binding antibody fragments and fusion polypeptide. Fór example, among the analogs ofthe invention are analogs ofthe monoclonal antibody produced hybridoma 4E7 (ATCC® Accession No. PTA-5109), orby hybridoma 7A11 (ATCC® Accession No. PTA-5110), or by hybridoma 7C6 (ATCC® Accession No. PTA-5111), or by hybridoma 7F10 (ATCC® Accession No. PTA-5112), or by hybridoma 7G101 (ATCC® Accession No. PTA-5245), or by hybridoma 7H1 (ATCC® Accession No. PTA-5114), or by hybridoma 8A1 (ATCC® Accession No. PTA-5115), or by hybridoma 8B5 (ATCC®

Accession No. PTA-5116), or by hybridoma 8C3 (ATCC® Accession No. PTA-5246), or by hybridoma 8E3 (ATCC®

Accession No. PTA-5118), or by hybridoma 8G9 (ATCC® Accession No. PTA-5119), or by hybridoma 15C9 (ATCC® Accession No. PTA-5106), or by hybridoma 16C7 (ATCC® Accession No. PTA-5107), or by hybridoma 16H9 (ATCC®

Accession No. PTA-5108), or by hybridoma 117.1 (ATCC® Accession No. PTA-4567), or by hybridoma 325.1 (ATCC®

Accession No. PTA-5120), or by hybridoma 368.1 (ATCC® Accession No. PTA-4568), or by hybridoma 446.1 (ATCC®

Accession No. PTA-5549), or by hybridoma 501.1 (ATCC® Accession No. PTA-4569), or by hybridoma 621.1 (ATCC®

Accession No. PTA-5121), or by hybridoma 633.1 (ATCC® Accession No. PTA-5122), or by hybridoma 654.1 (ATCC®

Accession No. PTA-5247), or by hybridoma 725.1 (ATCC® Accession No. PTA-5124), or by hybridoma 776.1 (ATCC®

Accession No. PTA-4570).

[0039] In another aspect, the present disclosure provides a pharmaceutical composition comprising an antibody, an antigen-binding antibody fragment, fusion polypeptide, or analóg ofthe invention, that is, one that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide, and a pharmaceutically acceptable carrier. Alsó provided is a method of preparing a pharmaceutical composition comprising admixing an antibody or antigen-binding antibody fragment ofthe invention with a pharmaceutically acceptable carrier.

[0040] In still another aspect, an articleof manufacture is provided comprising packaging matéria! and a pharmaceutical composition ofthe invention contained within the packaging matériái, said pharmaceutical composition in aform suitable fór administration to a subject, preferably a humán. In one embodiment, the article of manufacture further comprises printed instructions and/or a label regarding the useor administration ofthe pharmaceutical composition. The instructions and/or label can, fór example, suggest a dosing régimén fór the prevention or treatment of one or more symptoms of a

EP 2 891 666 Β1

CA 125/O772P-related disorder, such as a cell proliferative disorder, fór example cancer, e.g., ovarian, uterine, breast, or lung cancer.

[0041] Alsó disclosed are methods fór preventing, treating, managing or ameliorating a symptom of a CA 125/O772Prelated disorder, comprising: administering to a subject in need of such prevention, treatment, management, or amelioration, an antibody or antigen-binding fragment of an antibody in an amount sufficient to prevent, treat, manage, or ameliorate a symptom of the cell proliferative disorder, wherein said antibody or antigen-binding antibody fragment preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P.

[0042] In one embodiment, such methods relate to prevention, treatment, management, or amelioration of a symptom of a cell proliferative disorder. In another embodiment, such methods relate to prevention, treatment, management, or amelioration of a symptom of a cancer. In yet another embodiment, such methods relate to prevention, treatment, management, or amelioration of a symptom ofcervical cancer, uterine cancer, breast cancer or lung cancer. In a preferred disclosure, such methods relate to prevention, treatment, management, or amelioration of a symptom of ovarian cancer. [0043] In one embodiment of such methods, the antibody or antigen-binding fragment administered is a monoclonal antibody or antigen-binding monoclonal antibody fragment. In another embodiment ofthe disclosure, the antibody or antigén binding antibody fragment is administered at a dosage concentration of from about 5μg/kg to about 10mg/kg, preferably from about 2C^g/kg to about 5mg/kg, and more preferably from about 10C^g/kg to about 5mg/kg.

[0044] In yet another embodiment of, the methods are practiced as part of a combination cancer therapy. Such combination cancer therapy can include, fór example, administration of a chemotherapeutic agent, e.g., paclitaxel orcisplatin. Such combination cancer therapy can alternatively include, bút is nőt limited to, radiation therapy.

[0045] Alsó provided is a method to assist in identifying an antibody or antigen-binding antibody fragment that preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P. In one embodiment, a method to assist in identifying an antibody or antigen-binding antibody fragment that preferentially binds cell-associated CA 125/O772P comprises contacting an antibody or antigen-binding antibody fragment with a peptide comprising cell-associated CA 125/O772P (e.g., a cell-associated CA125/O772P polypeptide or even the full length CA 125/O772P polypeptide) in the presence of shed CA 125/O772P (preferably an excess amount (weight/weight) of shed) under conditions that allow binding of the antibody or antigen-binding antibody fragment to either said peptide comprising cell-associated CA 125/O772P or shed CA 125/O772P. After incubating, the shed CA 125/O772P (with or without antibody or antigenbinding antibody fragment bound) and unbound antibody or antigen-binding antibody fragment are removed, and the amountof antibody or antigen-binding antibody fragment bound to the peptide comprising cell-associated CA 125/O772P is measured. If the antibody or antigen-binding antibody fragment from such method satisfies anyone of the three embodiments set forth above fór preferentially binds, then said antibody, or antigen-binding antibody fragment, is one that preferentially binds cell-associated CA 125/O772P polypeptide relate to shed CA 125/O772P polypeptide. In a preferred embodiment, the ratio of shed CA 125/O772P to cell-associated CA 125/O772P in the reaction mixture is about 25:1 (wt/wt). As part of this method, cell-associated CA 125/O772P can be immobilized on a solid surface. Fór example, the method can be performed in an ELISA formát.

[0046] In still another embodiment, the disclosure provides a method to assist in identifying an antibody, or antigenbinding antibody fragment, that preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P comprises contacting the antibody, or antigen-binding fragment, with a peptide comprising cell-associated CA 125/O772P and shed CA 125/O772P (preferably an excess amount (weight/weight) of shed), e.g., about a 25-fold excess amount (wt/wt), under conditions that allow binding ofthe peptide comprising cell-associated CA 125/O772P to the antibody or antigen-binding antibody fragment, removing unbound peptide comprising cell-associated CA 125/O772P, measuring the amount of peptide comprising cell-associated CA 125/O772P bound by the antibody, or antigen-binding fragment, and comparing the amount measured to the amount of peptide comprising cell-associated CA 125/O772P the antibody or antigen-binding antibody fragment can bind in the absence of such amount of shed CA 125/O772P (i.e., a lesser amount). If the antibody or antigen-binding antibody fragment from such method satisfies anyone of the three embodiments set forth above fór preferentially binds, then said antibody or antigen-binding antibody fragment is one that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide. As part of this method the antibody, or antigen-binding antibody fragment can be immobilized on a solid surface, fór example, the method can be performed in an ELISA formát.

[0047] In yet another embodiment, the disclosure provides a method to assist in identifying an antibody, or antigenbinding antibody fragment, that preferentially binds cell-associated CA 125/O772P comprises contacting the antibody, or antigen-binding fragment, with a cell that expresses CA 125/O772P and with an amount, e.g., at least about 0.05 mg/ml, of shed CA 125/O772P (preferably an excess of amount (wt/wt) of shed) under conditions that allow binding of the CA 125/O772P to the antibody or antigen-binding antibody fragment, removing unbound cells, measuring the amount of cells expressing CA 125/O772P bound by the antibody, or antigen-binding fragment, and comparing the amount measured to the amount of cells expressing CA 125/O772P that binds the antibody or antigen-binding antibody fragment in the absence of such amountof (/'.e., a lesser amount) shed CA 125/O772P. If the antibody or antigen-binding antibody fragment from such method satisfies anyone of the three embodiments set forth above fór preferentially binds, then

ΕΡ 2 891 666 Β1 said antibody or antigen-binding antibody fragment is one that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide. Such a method can, fór example, be performed wherein the measuring is performed by flow cytometry techniques, including, e.g., fluorescence activated cell sorting (FACS). Alsó disclosed are methods fór diagnosing a CA 125/O772P-related disorder or predisposition to a CA 125/O772P-related disorder.

3.1. Terminology [0048] As used herein, the term analóg in the context of an antibody or antigen-binding antibody fragment or fusion polypeptide ofthe invention refers to an antibody, antigen-binding antibody fragment or fusion polypeptide that is modified relatíve to a corresponding antibody, antigen-binding antibody fragment or fusion polypeptide ofthe invention (referred to in this context as a pre-modified antibody, antigen-binding antibody fragment or fusion polypeptide ofthe invention) prior to the modification present in the analóg, bút which still preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P as claimed.

[0049] Affinity (K_d) of an antibody or antigen-binding antibody fragment ofthe invention is determined by the affinity assay described in Section 6.4, below.

[0050] The term antibody ofthe invention,as used herein, refers toan antibody that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide as claimed. Likewise, the term antigen-binding antibody fragment of the invention, as used herein, refers to an antigen-binding antibody fragment that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide as defined in the claims. An antibody or antigen-binding antibody fragment is considered an antibody or antigén binding fragment ofthe invention even if it binds a CA 125/O772P polypeptide, i.e., a pre-shed CA 125/O772P polypeptide, as long as such antibody or antigen-binding antibody fragment nonetheless preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P as defined in the claims. Due to the fact, as discussed below, that cell-associated CA 125/O772P, prior to CA 125/O772P shedding, is present as part of pre-shed CA 125/O772P, it is noted that antibodies that preferentially bind cell-associated CA 125/O772P can alsó bind pre-shed CA 125/O772P. Thus, independently of whether or nőt an antibody or antigen-binding antibody fragment binds CA 125/O772P, it is considered an antibody or antigen-binding antibody fragment ofthe invention so long as itsatisfies the criteria setforth herein fór preferentially binds CA 125/O772P polypeptide relatíve to shed CA 125/O772P. It is further noted that, unless otherwise indicated, the terms antibody and immunoglobulin are utilized interchangeably.

[0051] The term Antibody-Dependent Cellular Cytotoxicity assay (ADCC assay) as used herein, refers to the ADCC assay described in Section 6.5, below. As such, an antibody or antigen-binding antibody fragment that mediates lysis of CA 125/O772P-positive tumor cells in an ADCC assay is one that is considered positive when tested in the ADCC assay described in Section 6.5, below.

[0052] The term about, as used herein, unless otherwise indicated, refers to a value that is no more than 10% above or below the value being modified by the term. In the event a nucleic acid or amino acid sequence length is the value being modified, the resulting modified value will be an integer that is no more than 10% above or below the original length. Further, instances wherein 10% ofthe length being modified by this term results in a value that must be less than 1, then it is understood that, as used herein, that the modified length is 1 nucleotide or amino acid residue more or less than the original value.

[0053] As used herein, the term binds to in the context of antibody-antigen binding, e.g., in the context ofan antibody or antigen-binding antibody fragment that preferentially binds cell-associated CA 125/O772P, refers to antibodies or antigen-binding antibody fragments that specifically bind to a particular antigén (e.g., cell-associated CA 125/O772P) and do nőt specifically bind to other antigens. Preferably, an antibody or antigen-binding antibody fragment is one that binds CA 125/O772P with a specificity of at least 5 OD/microgram of antibody as determined by an ELISA Specificity Assay, or is considered positive in a Flow Cytometry Specificity Assay. A peptide or polypeptide that binds to an antigén may bind to other peptides or polypeptides with loweraffinity as determined by, e.g., immunoassays, BIAcore, Scatchard analysis or other assays known in the art. Antibodies or fragments that specifically bind to an antigén may be crossreactive with related antigens. Preferably, antibodies or fragments that bind to an antigén do nőt cross-react with other antigens. See, e.g., Fundamental Immunology Second Edition, Paul, ed., Raven Press (1989) at pages 332-336 fór a discussion regarding antibody specificity. Preferably, an antibody or antigen-binding antibody fragment ofthe invention is one that binds the peptide of Figure 1 with a K_d of less than about 100 nM, and more preferably binds the peptide of Figure 1 with a K_d of less than about 5 nM, all as measured by the BIAcore Affinity Assay, which is described in Section

6.4. It is noted that an antibody that preferentially binds cell-associated CA 125/O772P may yet alsó represent an antibody that specifically binds CA 125/O772P, including shed CA 125/O772P, relatíve to other, non-CA 125/O772P antigens. Finally, it is noted that the terms specifically and immunospecifically, as used herein, unless otherwise noted, are used interchangeably.

[0054] ELISA Specificity Assay: This assay, as used herein, refers to the ELISA assay described

ΕΡ 2 891 666 Β1 [0055] in Section 6.2, below. An antibody (or antigen-binding antibody fragment) is considered positive in this assay (/'.e., is specific fór CA 125/O772P) if it exhibits an absorbance of at least 5 to greater than 30 OD/microgram antibody. [0056] Flow Cytometry Specificity Assay: This assay, as used herein, refers to the flow cytometry assay described in Section 6.2, below. Antibodies (or antigen-binding antibody fragments) are considered positive (i.e., are specific fór CA 125/O772P) if they exhibit a Flow Cytometry Specificity Assay result within the following positive cell ranges: less than 5% positive NIH/3T3 cells, and at least 60% positive NIH/3T3 cells producing a SEQ ID NO:2 polypeptide; and/or less than 25% positive SK-OV3 cells and at least 80% positive OVCAR-3 cells.

[0057] The terms competes fór binding, and competes with as used herein the context of two antibody species or antigen-binding antibody fragment species (orcombinations thereof) are used interchangeably. Afirst antibody or antigenbinding antibody fragment is considered to compete with a second antibody or antigen-binding antibody fragment if the first antibody or antigen-binding antibody fragment competes with the second in an ELISA CrossCompetition Assay and/ or a FACS Cross-Competition Assay.

[0058] ELISA Cross-Competition Assay: This assay, as used herein, refers to the ELISA assay described in Section 7.0, below. An antibody or antigen-binding antibody fragment is considered to compete fór binding in this assay if the IC₅₀ fór the competitor antibody or antigen-binding antibody fragment is a concentration no more than about 100-fold above the concentration of the antibody or antigen-binding antibody fragment.

[0059] FACS Cross-Competition Assay: This assay, as used herein, refers to the FACS assay described in Section 7.0, below. An antibody or antigen-binding antibody fragment is considered to compete fór binding in this assay if the IC₅₀ fór the competitor antibody or antigen-biding antibody fragment is a concentration no more than about 100-fold above the concentration of the antibody or antigen-binding antibody fragment.

[0060] The term CA 125/O772P or CA 125/O772P polypeptide, as used herein refers to the pre-shed CA 125/O772P, transmembrane polypeptide that, once shed, yields shed CA 125/O772P polypeptide and cell-associated CA 125/O772P polypeptide. The amino acid sequence reported in the literature as thefull-length sequence of CA 125/O772P polypeptide has recently been shown to nőt, in fact, represent the full-length CA 125/O772P sequence. In particular, see, e.g., \NO 02/06317 (PCT/US01/22635), and US 2003/0124140, which disclose a polypeptide referred to as O772P. The amino acid sequence of O772P includes an extension over what was previously thought to be full-length CA 125. Because the polypeptide is referred to in the art as CA 125 or as O772P, it is referred to herein as CA, 125/O772P.

[0061] As used herein, the term CA 125/O772P-related disorder refers to a disorderthat involves or is characterized by the presence of a differential level of cell-associated CA 125/O772P relatíve to a corresponding normál state and/or an overabundance of shed CA 125/O722P relatíve to a corresponding normál state. Fór example, in the case of ovarian cancer, a higher level of cell-associated or shed CA 125/O772P is observed relatíve to the level observed in a normál (e.g., non-cancerous) state. The differential level of cell-associated and/or shed CA 125/O772P can either be causative or indicative of the disorder.

[0062] As used herein, the term cell-associated CA 125/O772P refers to a CA 125/O772P extracellular polypeptide species that remains in cell-associated form however transiently, e.g., prior to turn-over, aftera portion ofthe pre-shed CA 125/O772P polypeptide is released as shed CA 12510772P. Fór example, a cell-associated CA 125/O772P species is a CA 125/O772P extracellular polypeptide species that remains in cell-associated form on the surface of OVCAR-3 cell line cells (HTB-161; ATCC®) or humán ascites cells after a portion ofthe CA 125/O772P polypeptide is released as shed CA 125/O772P. A CA 125/O772P cell-associated polypeptide species is present within amino acid residues 1 to 708 of SEQ ID NO: 1 and within amino acid residues 1 to 711 of SEQ ID NO:2. Moreover, CA 125/O772P may be cleaved at a protease cleavage site located at amino acid residues 659-665 of SEQ ID NO:2. See O’Brien et al., Tumour Bioi. 23(3):154-169 (2002). As such, a cell-associated CA 125/O772P polypeptide may include amino acid residues 659-711 ofSEQ ID NO:2.

[0063] The term Complement-Dependent Cytotoxicity assay (CDC Assay) as used herein refers to the CDC assay described in Section 6.5, below. As such, an antibody or antigen-binding antibody fragment that mediates tumor cell lysis in a CDC assay is one that is considered positive when tested in the CDC assay described in Section 6.5, below. [0064] As used herein, the terms disorder and disease are used interchangeably to referto a condition in a subject. [0065] As used herein, the term fragment in the phrase antigen-binding antibody fragment refers to a peptide or polypeptide comprising an amino acid sequence of at least about 5 contiguous amino acid residues, at least about 10 contiguous amino acid residues, at least about 15 contiguous amino acid residues, at least about 20 contiguous amino acid residues, at least about 25 contiguous amino acid residues, at least about 40 contiguous amino acid residues, at least about 50 contiguous amino acid residues, at least about 60 contiguous amino residues, at least about 70 contiguous amino acid residues, at least about 80 contiguous amino acid residues, at least about 90 contiguous amino acid residues, at least about 100 contiguous amino acid residues, at least about 110 contiguous amino acid residues, or at least about 120 contiguous amino acid residues, of the amino acid sequence of another polypeptide, e.g., an antibody that preferentially binds cell-associated CA 125/O772P.

[0066] The term hőst cell as used herein refers to the particular cell, including a mammalian cell or other eukaryotic cells, or prokaryotic cells, said cells, fór example, transformed or transfected with a nucleic acid molecule or infected

ΕΡ 2 891 666 Β1 with viruses, phagemid or bacteriophage and the progeny or potential progeny of such a cell. Progeny of such a cell may nőt be identical to the parent cell transfected with the nucleic acid molecule due to mutations or environmental influences or additional recombinant manipulations that may occur in succeeding generations or integration ofthe nucleic acid molecule intő the hőst cell genome.

[0067] As used herein, the term hybridizes under stringent conditions describes conditions fór hybridization and washing under which nucleotide sequences at least 75% identical to each other typically remain hybridized to the complement of each other. Such stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley & Sons (1989-2002) at sections 6.3.1-6.3.6. In one, nonlimiting example stringent hybridization conditions are hybridization at 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.1XSSC, 0.2% SDS at about 68°C. In a preferred, non-limiting example stringent hybridization conditions are hybridization in 6XSSC at about 45°C, followed by one or more washes in 0.2XSSC, 0.1 % SDSat50-65°C (i.e., one or more washes at50°C, 55°C, 60°Cor65°C). Itisunderstoodthatin certain embodiments the nucleic acids of the disclosure do nőt include nucleic acid molecules that hybridize under these conditions solely to a nucleotide sequence consisting of only A or T nucleotides.

[0068] As used herein, the term isolated in the context of a peptide, polypeptide, fusion protein, antibody or antigenbinding antibody fragment refers to a peptide, polypeptide, fusion protein, antibody or antigen-binding antibody fragment which is substantially free of cellular matéria! or contaminating proteins from the cell or tissue source from which it is derived or obtained, or substantially free of Chemical precursors or other Chemicals when chemically synthesized. The language substantially free of cellular matéria! or contaminating protein includes preparations of a peptide, polypeptide, fusion protein, antibody or antigen-binding antibody fragment in which the peptide, polypeptide, fusion protein, antibody or antigen-binding antibody fragment is separated from cellular components ofthe cells from which it is isolated or recombinantly produced. Thus, a peptide, polypeptide, fusion protein, antibody or antigen-binding antibody fragment that is substantially free of cellular matéria! or contaminating protein includes preparations of a peptide, polypeptide, fusion protein, antibody or antigen-binding antibody fragment having less than about 30%, about 20%, about 10%, or about 5% (by dry weight) of other protein. When the peptide, polypeptide, fusion protein, antibody or antigen-binding antibody fragment is recombinantly produced, it is alsó preferably substantially free of culture médium, i.e., culture médium represents less than about 20%, about 10%, or about 5% of the volume of the protein preparation. When the peptide, polypeptide, fusion protein, antibody or antigen-binding antibody fragment is produced by Chemical synthesis, it is preferably substantially free of Chemical precursors or other Chemicals, i.e., it is separated from Chemical precursors or other Chemicals which are involved in the synthesis of the peptide, polypeptide, fusion protein, antibody or antigenbinding antibody fragment. Accordingly, such preparations of a peptide, polypeptide, fusion protein, antibody or antigenbinding antibody fragment have less than about 30%, about 20%, about 10%, about 5% (by dry weight) of Chemical precursors or compounds other than the peptide, polypeptide, fusion protein, antibody or antigen-binding antibody fragment of interest.

[0069] As used herein, the term isolated in the context of nucleic acid molecules refers to a nucleic acid molecule which is separated from other nucleic acid molecules which are present in the natural cellular source ofthe nucleic acid molecule. Alternatively, an isolated nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular matériái, or culture médium when produced by recombinant techniques, or substantially free of Chemical precursors or other Chemicals when chemically synthesized.

[0070] As used herein, the terms manage, managing and management referto the beneficial effects that a subject derivesfrom an agent, e.g., an antibody, antigen-binding antibody fragment or fusion polypeptide ofthe invention, which does nőt result in a cure ofthe disease. In certain embodiments, a subject is administered one or more such agents to manage a disorder so as to prevent or slow the progression or worsening of the disorder.

[0071] As used herein, the term monoclonal antibody refers to an antibody that is derived from a single cellular clone, including any eukaryotic, prokaryotic, or phage clone, and is nőt dependent upon the method by which it is produced. Therefore, a monoclonal antibody can refer to a composition comprising a population of antibodies that each bind to a single epitope wherein said composition lacks antibodies that bind a different epitope than the single epitope to which the population of antibodies bind. It isnoted, of course, that in certain instances, a single epitope is present in a polypeptide at multiple positions. In such instances, although the monoclonal antibody may bind to multiple positions, it is, nonetheless, still considered to be binding to a single epitope.

[0072] As used herein, the terms nucleic acids and nucleotide sequences include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), combinations of DNA and RNA molecules or hybrid DNAIRNA molecules, and analogs of DNA or RNA molecules. Such analogs can be generated using, fór example, nucleotide analogs, which include, bút are nőt limited to, inosine or tritylated bases. Such analogs can alsó comprise DNA or RNA molecules comprising modified backbones that lend beneficial attributes to the molecules such as, fór example, nuclease resistance or an increased ability to cross cellular membranes. The nucleic acids or nucleotide sequences can be single-stranded, double-stranded, may contain both single-stranded and double-stranded portions, and may contain triple-stranded portions, bút preferably are double-stranded DNA.

ΕΡ 2 891 666 Β1 [0073] The term operably linked as used herein the context of a fusion polypeptide refers to any covalent or noncovalent interaction that connects the antibody or antigen-binding antibody fragment to the heterologous agent. The operable linkage can be direct or indirect.

[0074] Fór example, an amino acid sequence can be present between the antibody (or antigen-binding antibody fragment) and the heterologous agent.As used herein, an antibody, antigen-binding antibody fragment, fusion polypeptide, or analóg that preferentially binds cell-associated CA 125/O772P, preferentially binds cell-associated CA 125/O772P polypeptide, preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P or preferentially binds CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide refers to an antibody or antigenbinding antibody fragment that is positive when tested in an ELISA Competition Assay or a Flow Cytometry Competition Assay, as described herein. Preferably, the antibody or antigen-binding antibody fragment is one that is positive in both an ELISA Competition Assay and a Flow Cytometry Competition Assay, as described herein.

[0075] ELISA Competition Assay: This assay, as used herein, refers to the ELISA assay described in Section 6.3, below. An antibody (or antigen-binding antibody fragment) is considered positive in this assay (that is, preferentially binds cell-associated CA 125/O772P) if it exhibits less than about 25% inhibition of binding at 25-fold w/w excess of shed CA 125/O772P over the peptide of Figure 1 (SEQ ID NO: 1).

[0076] Flow Cytometry Competition Assay: This assay, as used herein, refers to the flow cytometry assay described in Section 6.3, below. An antibody (or antigen-binding antibody fragment) is considered positive (that is, is considered to preferentially bind cell-associated CA 125/O772P) if it exhibits an IC₅₀, as measured by percent-positive cells, of at least 0.05 mg/ml shed CA 125/O772P, that is, if it requires at least 0.05 mg/ml shed CA 125/O772P to reduce the percentpositive cells in the Flow Cytometry Competition Assay by half.

[0077] As used herein, the terms prevent, preventing and prevention referto the impedition ofthe recurrence or onset of a CA 125/O772P-related disorder or one or more symptoms of a CA 125/O772P-related disorder in a subject. [0078] A used herein, a protocol includes dosing schedules and dosing regimens. The protocols herein are methods of use and include prophylactic and therapeutic protocols.

[0079] As used herein, the term shed CA 125/O772P polypeptide refers to a CA 125/O772P extracellular polypeptide sequence that becomes separated and released from CA 125/O772P polypeptides expressed on the surface of cells expressing CA 125/O772P, leaving a cell-associated CA 125/O772P species remaining on the cell surface, however transiently. The term, as used herein, refers to a species of shed CA 125/O772P found in humán serum and/or OVCAR3 (HTB-161; ATCC) cell line culture supernatant. Such shed CA 125/O772P polypeptides can beobtained via the protocol of de los Frailes et al., Tumour Bioi. 14/(1) 18-29 (1993), using humán ascites or OVCAR-3 supernatants. Alternatively, shed CA 125/O772P polypeptides can be obtained via commercial sources such as Fitzgerald Industries International (Concord, MA), Scripps Laboratories (La Jolla, CA), or United States Biochemical Corp (Cleveland, OR).

[0080] As used herein, the terms subject and patient are used interchangeably. As used herein, the terms subject and subjects referto an animal, preferably a mammal including a non-primate (e.g., a cow, pig, horse, donkey, goat, camel, cat, dog, guinea pig, rat, mouse, sheep) and a primate (e.g., a monkey, such as a cynomolgous monkey, gorilla, chimpanzee, and a humán), preferably a humán. In one embodiment, the subject is a subject with cancer, fór example, ovarian cancer.

[0081] As used herein, the terms treat, treatment and treating referto the amelioration of a CA 125/O772P-related disorder that results from the administration of one or more antibodies, antigen-binding antibody fragments, fusion polypeptides or analogs.

[0082] The term pharmaceutically acceptable as used herein means a composition, e.g., a carrier, excipient, orsalt, approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia fór use in animals, and more particularly, in humans.

4. BRIEF DESCRIPTION OF THE DRAWINGS [0083]

FIG. 1: Depicts the amino acid sequence ofCA 125/O772P 3-repeat(SEQ ID NO:1). Italicized residuesfrom amino acid 14 to amino acid 452 represent repeat regions. Each ofthe three repeats within the 14-452 repeat region are delineated by verticallines and arrows as shown. Underlined residues represent the transmembrane-proximal nonrepeat region. The sequence that follows the underlined residues is nőt part of CA 125/O772P and includes a carboxy-Myc-His tag.

FIG: 2: Depicts the amino acid sequence of CA 125/O772P 3-repeat TM (SEQ ID NO:2). Italicized, underlined residues, i.e., from amino acid 14 to amino acid 452, represent repeat regions. Each ofthe three repeats within the 14-452 repeat region are delineated by vertical lines and arrows as shown. Underlined non-italicized residues, i.e., from amino acid 453 to amino acid 711, represent the transmembrane-proximal non-repeat region. Nonunderlined italicized residues, i.e., from amino acid 712 to amino acid 738, represent the transmembrane domain. Residues in

ΕΡ 2 891 666 Β1 bőid, i.e., from amino acid 739 to amino acid 769, represent a cytoplasmic region. The sequence that follows the bőid residues is nőt part of CA 125/O772P and includes a carboxy-Myc-His tag.

FIG. 3: Shows a representative plotfrom a FACS competition assay ofshed CA 125/O772P concentrations versus percent positive cells fór, in this instance, 117.1 antibody and M11 antibody control (squares). As shown, M11 can be competed fór binding to OVCAR-3 cells even at low concentrations ofshed CA 125/O772P (IC₅₀ = 0.003mg/ml) while 117.1 cannot be competed, even at high concentrations ofshed CA 125/O772P (IC₅₀ greaterthan 1mg/ml). FIG. 4: Shows a representative plot from an ADCC assay of percent lysis versus antibody concentration fór 117.1 antibody (average of 4 separate donors). As shown in the figure, antibody 117.1 mediates specific lysis of OVCAR3 cells in a dose-dependent manner.

FIG.5A: Depicts the nucleotide sequence (SEQ ID NO:35) that encodes the variable light chain region of monoclonal antibody 117.1. The nucleotide sequence that encodes leader sequence is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG.5B: Depicts the nucleotide sequence (SEQ ID NO:36) that encodes the variable heavy chain region of monoclonal antibody 117.1. The nucleotide sequence that encodes leader sequence is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG. 5C: Depicts the amino acid sequence (SEQ ID NO:27) ofthe variable light chain region of monoclonal antibody

117.1. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG. 5D: Depicts the amino acid sequence (SEQ ID NO:28) ofthe variable heavy chain region of monoclonal antibody

117.1. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG.6A: Depicts the nucleotide sequence (SEQ ID NO:37) that encodes the variable light chain region of monoclonal antibody 368.1. The nucleotide sequence that encodes leader sequence is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG.6B: Depicts the nucleotide sequence (SEQ ID NO:38) that encodes the variable heavy chain region of monoclonal antibody 368.1. The nucleotide sequence that encodes leader sequence is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG.6C: Depicts the amino acid sequence (SEQ ID NO:29) ofthe variable light chain region of monoclonal antibody

368.1. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG. 6D: Depicts the amino acid sequence (SEQ ID NO:30) ofthe variable heavy chain region of monoclonal antibody

368.1. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG.7A: Depicts the nucleotide sequence (SEQ ID NO:39) that encodes the variable light chain region of monoclonal antibody 501.1. The nucleotide sequence that encodes leader sequence is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG.7B: Depicts the nucleotide sequence (SEQ ID NO:40) that encodes the variable heavy chain region of monoclonal antibody 501.1. The nucleotide sequence that encodes leader sequences are double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG.7C: Depicts the amino acid sequence (SEQ ID NO:31) ofthe variable light chain region of monoclonal antibody

501.1. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG. 7D: Depicts the amino acid sequence (SEQ ID NO:32) ofthe variable heavy chain region of monoclonal antibody

501.1. Leader sequences is double underlined, and CDR sequences are single underlined.

FIG.8A: Depicts the nucleotide sequence (SEQ ID NO:41) that encodes the variable light chain region of monoclonal antibody 776.1. The nucleotide sequence that encodes leader sequence is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG. 8B: Depicts the nucleotide sequence (SEQ ID NO:42) that encodes the variable heavy chain region of monoclonal antibody 776.1. The nucleotide sequences that encode leader sequences is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG.8C: Depicts the amino acid sequence (SEQ ID NO:33) ofthe variable light chain region of monoclonal antibody

776.1. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG.8D: Depicts the amino acid sequence (SEQ ID NO:34) ofthe variable heavy chain region of monoclonal antibody

776.1. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG. 9A: Depicts the nucleotide sequence (SEQ ID NO:52) that encodes the variable light chain region of monoclonal antibody 725.1. The nucleotide sequence that encodes leader sequence is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG.9B: Depicts the nucleotide sequence (SEQ ID NO:57) that encodes the variable heavy chain region of monoclonal antibody 725.1. The nucleotide sequences that encode leader sequences is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG.9C: Depicts the amino acid sequence (SEQ ID NO:54) ofthe variable light chain region of monoclonal antibody

725.1. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG.9D: Depicts the amino acid sequence (SEQ ID NO:53) ofthe variable heavy chain region of monoclonal antibody

ΕΡ 2 891 666 Β1

725.1. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG. 10A: Depicts the nucleotide sequence (SEQ ID NO:59) that encodes the variable light chain region of monoclonal antibody 16H9. The nucleotide sequence that encodes leader sequence is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG. 10B: Depicts the nucleotide sequence (SEQ ID NO:58) that encodes the variable heavy chain region of monoclonal antibody 16H9. The nucleotide sequences that encode leader sequences is double underlined, and the nucleotide sequences that encode CDR sequences are single underlined.

FIG. 10C: Depicts the amino acid sequence (SEQ ID NO:56) ofthe variable light chain region of monoclonal antibody 16H9. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG. 10D: Depicts the amino acid sequence (SEQ ID NO:55) ofthe variable heavy chain region of monoclonal antibody 16H9. Leader sequence is double underlined, and CDR sequences are single underlined.

FIG. 11: Depicts the results of a western biot analysis of OVCAR-3 supernatents. Antibody concentration and detection are indicated in the working example presented, below, in Section 6.7. 3 Rpt Ptn in each biot refers to lanes containing O772P 3- repeat recombinant polypeptide; the remainderofthe lanes in each biot contain OVCAR3 conditioned or control média. The particular antibody tested is indicated at the bottom of each biot (i.e., M11, OC125, 776.1 and 368.1 antibodies). Molecular weight markers are indicated on left of figure.

FIG. 12: In vivő evaluation of ¹³¹l-labeled 776.1. NCR nulnu mice bearing OVCAR-3 tumors were treated with either saline, 100 /μθί [¹³¹l]776.1 lgG1,300 /μθί [¹³¹l] 776.1 lgG1, or 17 μg unlabeled 776.1 lgG1 (same protein dose as in the 300 /μθί [¹³¹l]776.1 lgG1 group). Treatment was a single dose administered intravenously on day o. The specific activity of [1311)776.1 was 15 mCi/mg with an immunoreactivity of 51 % post-labeling. Results are shown as mean tumor volume+/-SD fór 10 mice totál per group. Mean tumor size at the beginning of treatment was 199 mm³ fór all groups.

5. DETAILED DESCRIPTION OF THE INVENTION [0084] The present invention is based, in part, on the recognition that the events that produce shed CA 125/O772P alsó leave a portion ofthe extracellular region ofthe CA 125/O772P amino acid sequence in cell-associated form, i.e., alsó yield cell-associated CA 125/O772P. The invention described in detail herein is based, in part, on the recognition that antibodies, and antigen-binding antibody fragments, fusion polypeptides and analogs that preferentially bind cellassociated CA 125/O772P relatíve to shed CA 125/O772P can be generated, and that such antibodies, antigen-binding antibody fragments, fusion polypeptides and analogs can, fór example, be utilized to prevent, manage, treat, orameliorate a CA 125/O772P-related disorderorone or more symptoms of a CA 125/O772P-related disordersuch as a cell proliferative disorder, fór example, cancer, e.g., ovarian cancer.

[0085] As discussed throughout, the antibodies and antigen-binding antibody fragments of the invention are those that preferentially bind cell-associated CA 125/O772P as defined in the claims. Likewise the fusion polypeptides and analogs ofthe invention alsó preferentially bind cell-associated CA 125/O772P as defined in the claims. As alsó noted herein, due to the fact that cell-associated CA 125/O772P, prior to CA 125/O772P shedding, is present as part of preshed CA 125/O772P, it is noted that antibodies, antigen-binding antibody fragments and fusion polypeptides of the invention can alsó bind pre-shed CA 125/O772P. Thus, while nőt wishing to be bound by any particular mechanism or theory thereof, it is noted that the methods described in this section can be effectuated by binding of the administered antibody, antigen-binding antibody fragments or fusion polypeptides of the invention to pre-shed CA 125/O772P in addition to, or instead of, their binding to cell-associated CA 125/O772P.

5.1. Antibodies and Antigen-Binding Antibody Fragments [0086] In a first aspect, the present invention provides an isolated antibody, or an antigen-binding antibody fragment, that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide as defined in the claims. Such antibodies and antigen-binding antibody fragments ofthe invention are useful fór a variety of therapeutic, prophylactic, diagnostic, and purification purposes as described herein.

[0087] An antibody or antigen-binding antibody fragment of the invention is one that binds SEQ ID NO: 1 or SEQ ID NO:2 and which preferentially binds cell-associated CA 125/O772P, wherein the antibody or antigen-binding antibody fragment ofthe invention binds the non-repeat region depicted in SEQ ID NO: 1 orSEQ ID NO:2. In another embodiment of the present disclosure, the antibody or antigen-binding antibody fragment of the invention binds a repeat region depicted in SEQ ID NO:1 orSEQ ID NO:2.

[0088] In a first embodiment, the antibody or antigen-binding antibody fragment ofthe invention exhibits, in an ELISA Competition Assay, less than about 25%, less than about 20%, less than about 15%, less than about 10%, or less than about 5% inhibition of binding to the peptide of Figure 1 in the presence of a 25-fold (weight/weight) excess of shed CA 125/O772P over the peptide of Figure 1 and/or, in a second embodiment, the antibody or antigen-binding antibody

ΕΡ 2 891 666 Β1 fragment ofthe invention exhibits, in a Flow Cytometry Competition Assay, an IC₅₀, as measured by percent-positive cells, of at least about 0.05 mg/ml, at least about 0.1 mg/ml, at least about 0.25 mg/ml, at least about 0.5 mg/ml, at least about 0.75 mg/ml, or at least about 1.0 mg/ml shed CA 125/O772P. In a third embodiment, the antibody or antigenbinding antibody fragment ofthe disclosure binds the peptide of Figure 1, butdoes notdetectably bind shed CA125/O772P polypeptide. An antibody, antigen-binding antibody fragment, that satisfies anyone of these three embodiments constitutes an antibody or antigen-binding antibody fragment that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide according to the disclosure. In the invention,the first and/orthe second embodiment is mandatory.

[0089] Among the antibodies and antigen-binding antibody fragments ofthe invention are antibodies or antigen-binding antibody fragments that bind the peptide of Figure 1 (SEQ ID NO: 1) with a K_d of less than about 100 nM, less than about 10 nM, less than about 1 nM, less than about 100 pM, or less than about 10 pM as measured by the BIAcore Affinity Assay, which is described in Section 6.4., herein below.

[0090] Among the preferred embodiments of the antibodies or antigen-binding antibody fragments of the disclosure are antibodies or antigen-binding antibody fragments that mediate lysis of CA 125/O772P-positive tumor cells in an ADCC assay. Such antibodies or antigen-binding antibody fragments include, fór example, those that mediate at least about 10%, at least about 20%, at least about 30%, at least about 40% or at least about 50% lysis of CA 125/0772Ppositive tumor cells in an ADCC assay at a 50:1 effector:target ratio at a concentration of 5 μg antibody or antigenbinding fragment per ml; mediate at least about 10%, at least about 20%, at least about 30%, at least about 40% or at least about 50% lysis of CA 125/O772P-positive tumor cells in an ADCC assay at a 25: 1 effector:target ratio at a concentration of 5 y„g antibody or antigen-binding fragment per ml; mediate at least about 10%, at least about 20%, at least about 30%, at least about 40% or at least about 50% lysis of CA 125/O772P-positive tumor cells in an ADCC assay at a 12.5: 1 effector:target ratio at a concentration of 5 μg antibody or antigen-binding fragment per ml; mediate at least about 10%, at least about 20%, at least about 30%, at least about 40% or at least about 50% lysis of CA 125/O772Ppositive tumor cells in an ADCC assay at a 12.5:1 effector:target ratio at a concentration of 0.5 μg antibody or antigenbinding fragment per ml; or mediate at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50% lysis of CA 125/O772P-positive tumor cells in an ADCC assay at a 12.5: 1 effector:target ratio at a concentration of 50 ng antibody or antigen-binding fragment per ml.

[0091] Preferred embodiments of the disclosure alsó include antibodies or antigen-binding antibody fragments that mediate lysis of CA 125/O772P-positive tumor cells in a complement-dependent cytotoxicity (CDC) assay. Such antibodies or antigen-binding antibody fragments include, fór example, those that mediate lysis in a rangé of about 15% lysis at 5μg/ml to about 95% lysis at 0.1 μg/ml.

[0092] Preferred embodiments of the antibodies or antigen-binding antibody fragments of the invention alsó include antibodies and antigen-binding antibody fragments that inhibit CA 125/O772P-positive tumor growth. Fór example, such antibodies or antigen-binding antibody fragments are those that, preferably, inhibit CA 125/O772P-positive tumor growth in such animal models as the ones described in Treskes et al., Búr. J. Cancer. 30A(2):183-187 (1994); Ahmad et al., Oncol. Rés. 11(6):273-280 (1999); and Kievit et at., Int. J. Radiat. Oncol. Bioi. Phys. 38(2):419-428 (1997), and the OVCAR-3 xenograft tumor animal model described in Section 6.8, below.

[0093] In one particular embodiment, an antibody of the disclosure is a monoclonal antibody produced by hybridoma 4B7 (ATCC® Accession No. PTA-5109), or by hybridoma 7A11 (ATCC® Accession No. PTA-5110), or by hybridoma 7C6 (ATCC® Accession No. PTA-5111), or by hybridoma 7F10 (ATCC® Accession No. PTA-5112), or by hybridoma 7G10 (ATCC® Accession No. PTA-5245), or by hybridoma 7H1 (ATCC® Accession No. PTA-5114), or by hybridoma 8A1 (ATCC® Accession No. PTA-5115), or by hybridoma 8B5 (ATCC® Accession No. PTA-5116), or by hybridoma 8C3 (ATCC® Accession No. PTA- 5246), or by hybridoma 8E3 (ATCC® Accession No. PTA-5118), or by hybridoma 8G9 (ATCC® Accession No.PTA-5119), or by hybridoma 15C9 (ATCC® Accession No. PTA-5106), or by hybridoma 16C7 (ATCC® Accession No. PTA-5107), or by hybridoma 16H9 (ATCC® Accession No. PTA-5180), or by hybridoma

117.1 (ATCC® Accession No. PTA-4567), or by hybridoma 325.1 (ATCC® Accession No. PTA-5120), or by hybridoma

365.1 (ATCC® Accession No. PTA-4568), or by hybridoma 446.1 (ATCC® Accession No. PTA-5549) Accession No. PTA-4569), or by hybridoma 501.01 (ATCC® Accession No. PTA-4569), or by hybridoma 621.1 (ATCC® Accession No. PTA-5121), or by hybridoma 633.1 (ATCC® Accession No. PTA-5122), or by hybridoma 654.1 (ATCC® Accession No. PTA-5247), or by hybridoma 725.1 (ATCC® Accession No. PTA-5124), or by hybridoma 776.1 (ATCC® Accession No. PTA-4570).

[0094] In another particular embodiment, an antibody or antigen-binding antibody fragment of the disclosure is an antibody or antigen-binding antibody fragment that competes with the monoclonal antibody produced by hybridoma 4E7 (ATCC® Accession No. PTA-5109), or by hybridoma 7A11 (ATCC® Accession No. PTA-5110), or by hybridoma 7C6 (ATCC® Accession No. PTA-5111), or by hybridoma 7F10 (ATCC® Accession No. PTA-5112), or by hybridoma 7G10 (ATCC® Accession No. PTA-5245), or by hybridoma 7H1 (ATCC® Accession No. PTA-5114), or by hybridoma 8A1 (ATCC® Accession No. PTA-5115), or by hybridoma 8B5 (ATCC® Accession No. PTA -5116), or by hybridoma 8C3 (ATCC® Accession No. PTA-5246), or by hybridoma 8E3 (ATCC® Accession No. PTA-5118), or by hybridoma 8G9

ΕΡ 2 891 666 Β1 (ATCC® Accession No. ΡΤΑ-5119), or by hybridoma 15C9 (ATCC® Accession No. PTA-5106), or by hybridoma 16C7 (ATCC® Accession No. PTA-5107), or by hybridoma 16H9 (ATCC® Accession No. PTA-5108), or by hybridoma 117.1 (ATCC® Accession No. PTA-4567), or by hybridoma 325.1 (ATCC® Accession No. PTA-5120), or by hybridoma 368.1 (ATCC® Accession No. PTA-4568), or by hybridoma 446.1 (ATCC® Accession No. PTA-5549), or by hybridoma 501.1 (ATCC® Accession No. PTA-4569), or by hybridoma 621.1 (ATCC® Accession No. PTA-5121), or by hybridoma 633.1 (ATCC® Accession No. PTA-5122), or by hybridoma 654.1 (ATCC® Accession No. PTA-5247), or by hybridoma 725.1 (ATCC® Accession No. PTA-5124), or by hybridoma 776.1 (ATCC® Accession No. PTA-4570) fór binding to cellassociated CA 125/O772P. Antibodies or antibody-binding antibody fragments of the disclosure are considered to compete fór binding if they compete fór binding in an ELISA Cross-Competition Assay and/or a FACS Cross-Competition Assay. An antibody or antigen-binding antibody fragment is considered to compete fór binding in an ELISA CrossCompetition Assay óra FACS Cross-Com petition Assay ifthe IC₅₀forthe competitorantibodyor antigen-binding fragment is a concentration no more than about 100-fold above the concentration of the antibody or antigen-binding antibody fragment. In a preferred embodiment, the IC₅₀ of the competitor antibody or antigen-binding antibody fragment is a concentration no more than about 10-fold above the concentration of the antibody or antigen-binding fragment. In a more preferred embodiment, the IC₅₀ of the competitor antibody or antigen-binding antibody fragment is no more than about equimolar with the concentration of the antibody or antigen-binding antibody fragment.

[0095] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:27 (117.1 L). In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:28 (117.1H). In still another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:27 (117.1 L) and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:28 (117.1H).

[0096] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:29 (368.1 L). In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H). In still another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:29 (368.1 L) and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1H).

[0097] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:31 (501.1L). In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:32 (501. 1H). In still another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:31 (501.1L) and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:32 (501,1H).

[0098] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:33 (776.1 L). In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:34 (776.1 H). In still another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:33 (776.1 L) and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:34 (776.1H).

[0099] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a

725.1 light chain polypeptide variable region (725.1 L) comprising the amino acid sequence depicted in SEQ ID NO:54. In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a 725.1 heavy chain variable region (725.1 H) comprising the amino acid sequence depicted in SEQ ID NO:53. In still another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:54 and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:53.

[0100] In another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a 16H9 light chain polypeptide variable region (16H9L) comprising the amino acid sequence depicted in SEQ ID NO:56. In yet another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a 16H9 heavy chain variable region (16H9) comprising the amino acid sequence depicted in SEQ ID NO:55. In still another particular embodiment, an antibody or antigen-binding fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:56 and a heavy chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:55.

ΕΡ 2 891 666 Β1 [0101] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:27 (117.1L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H), SEQ ID NO:32 (501.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55 (16H9H).

[0102] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:29 (368.1 L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:28 (117.1H), SEQ ID NO:32 (501.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55 (16H9H).

[0103] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:31 (501.1L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:28 (117.1H), SEQ ID NO:30 (368.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55(16H9H).

[0104] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:33 (776.1 L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:28 (117.1H), SEQ ID NO:30 (368.1H), SEQ ID NO:32 (501.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55 (16H9H).

[0105] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:54 (725.1 L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H), SEQ ID NO:32 (501.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55 (16H9H).

[0106] In another particular embodiment, the antibody or antigen-binding antibody fragment disclosed is one that comprises a light chain polypeptide variable region comprising the amino acid sequence depicted in SEQ ID NO:33 (16H9L) and a heavy chain variable region comprising the amino acid sequence depicted in SEQ ID NO:30 (368.1 H), SEQ ID NO:32 (501.1H), SEQ ID NO:34 (776.1H), SEQ ID NO:53 (725.1H), or SEQ ID NO:55 (16H9H).

[0107] In one particular embodiment, an antibody or antigen-binding antibody fragment disclosed may comprise a variable light chain region comprising anyone, two or three VL CDRs depicted in Table 1, [0108] Table 2, Table 3, Table 4, Table 5 and Table 6. In another particular embodiment, an antibody or antigenbinding antibody fragment disclosed may comprise a variable heavy chain region comprising anyone, two or three VH CDRs depicted in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6. In yet another particular embodiment, an antibody or antigen-binding antibody fragment disclosed maycomprise a variable light chain region comprising anyone, two or three VL CDRs depicted in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6 and a variable heavy chain region comprising anyone, two or three VH CDRs depicted in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6. [0109] In a preferred embodiment, an antibody orantigen-binding antibody fragment disclosed may comprise a variable light chain region comprising any two or three VL CDRs depicted in Table 1; or any two or three VL CDRs depicted in Table 2; or any two or three VL CDRs depicted in Table 3; or any two or three VL CDRs depicted in Table 4; or any two or three VL CDRs depicted in Table 5; or any two or three VL CDRs depicted in Table 6. In another preferred embodiment, an antibody or antigen-binding antibody fragment disclosed may comprise a variable heavy chain region comprising any two or three VH CDRs depicted in Table 1; or any two or three VH CDRs depicted in Table 2; or any two or three VH CDRs depicted in Table 3; or any two or three VH CDRs depicted in Table 4; or any two or three VH CDRs depicted in Table 5; or any two or three VH CDRs depicted in Table 6.

[0110] In yet another preferred embodiment, an antibody orantigen-binding antibodyfragmentdisclosed maycomprise a variable light chain region and a variable heavy chain region, said variable light chain region comprising any two or three VL CDRs depicted in Table 1 and said variable heavy chain region comprising any two or three VH CDRs depicted in Table 1; or said variable light chain region comprising any two or three VL CDRs depicted in Table 2 and said variable heavy chain region comprising any two or three VH CDRs depicted in Table 2; or said variable light chain region comprising any two or three VL CDRs depicted in Table 3 and said variable heavy chain region comprising any two or three VH CDRs depicted in Table 3; or said variable light chain region comprising any two or three VL CDRs depicted in Table 4 and said variable heavy chain region comprising any two or three VH CDRs depicted in Table 4; or said variable light chain region comprising any two or three VL CDRs depicted in Table 5 and said variable heavy chain region comprising any two or three VH CDRs depicted in Table 5; or said variable light chain region comprising any two or three VL CDRs depicted in Table 6 and said variable heavy chain region comprising any two or three VH CDRs depicted in Table 6. [0111] Fór example, an antibody or antigen-binding antibody fragment can comprise a VL1 domain comprising any of the VL1 CDRs depicted in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6; an antibody or antigen-binding antibody fragment can comprise a VL2 domain comprising any of the VL2 CDRs depicted in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6; oran antibody or, antigen-binding antibody fragment can comprise a VL3 domain comprising any ofthe VL3 CDRs depicted in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6; an antibody or antigen-binding antibody fragment can comprise a VL1 domain and a VL2 domain comprising any of the VL11 CDRs and VL2 CDRs depicted in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6; an antibody or antigen-binding antibody fragment

ΕΡ 2 891 666 Β1 can comprise a VL1 domain and a VL3 domain comprising any of the VL1 CDRs and VL3 CDRs depicted in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6; an antibody or antigen-binding antibody fragment can comprise a VL2 domain and a VL3 domain comprising any ofthe VL2 CDRs and VL3 CDRs depicted in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6; and an antibody orantigen-binding antibody fragment can comprise a VL1 domain, a VL2 domain and a VL3 domain comprising any of the VL1 CDRs, VL2 CDRs and VL3 CDRs depicted in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6.

TABLE 1

CDR Sequences Of 117.1

<td> CDR</td><td> Sequence</td><td> SEQIDNO</td>

<td> VH1</td><td> GFSLSTPGMGVG</td><td> 3</td>

<td> VH2</td><td> HIWWDDFKRDNP ALKS</td><td> 4</td>

<td> VH3</td><td> VDGNFLSWYFDV</td><td> 5</td>

<td> VL1</td><td> RSSQSLVHSNGNTYLH</td><td> 6</td>

<td> VL2</td><td> KVSNRFS</td><td> 7</td>

<td> VL3</td><td> SQSRYVPET</td><td> 8</td>

TABLE 2

CDR Sequences Of 368.1

<td> CDR</td><td> Sequence</td><td> SEQIDNO</td>

<td> VH1</td><td> GYSFTGFYMH</td><td> 9</td>

<td> VH2</td><td> YVSCYTGATTYTQ KFKG</td><td> 10</td>

<td> VH3</td><td> EGDYYSMDF</td><td> 11</td>

<td> VL1</td><td> RSSQSLERTNGNTYLH</td><td> 12</td>

<td> VL2</td><td> KVSSRFS</td><td> 13</td>

<td> VL3</td><td> SQTTHGPPT</td><td> 14</td>

<td colspan="3"> TABLE 3 CDR Sequences Of 501.1</td>

<td> CDR</td><td> Sequence</td><td> SEQIDNO</td>

<td> VH1</td><td> GYIFTDYGMN</td><td> 15</td>

<td> VH2</td><td> CINTYTGETIYSDDFRG</td><td> 16</td>

<td> VH3</td><td> GNYRDAIDY</td><td> 17</td>

<td> VL1</td><td> KASQDIKSYLS</td><td> 18</td>

<td> VL2</td><td> YATTLAD</td><td> 19</td>

<td> VL3</td><td> LHHDESPFT</td><td> 20</td>

<td colspan="3"> TABLE 4 CDR Sequences Of 776.1</td>

<td> CDR</td><td> Sequence</td><td> SEQIDNO</td>

<td> VH1</td><td> GYTFTDYNIH</td><td> 21</td>

<td> VH2</td><td> YIYPYNGVSDYNQNF</td><td> 22</td>

<td> VH3</td><td> RWDFGSGYYFDY</td><td> 23</td>

<td> VL1</td><td> RASSSVIYMC</td><td> 24</td>

<td> VL2</td><td> GTSTLAS</td><td> 25</td>

<td> VL3</td><td> QQWSSNPFT</td><td> 26</td>

ΕΡ 2 891 666 Β1

TABLE 5

CDR Sequences Of 725.1

<td> CDR</td><td> Sequence</td><td> SEQIDNO</td>

<td> VH1</td><td> GYSFTNYGMN</td><td> 60</td>

<td> VH2</td><td> WINAYIGEPTY ADDFKG</td><td> 61</td>

<td> VH3</td><td> GGNSLDF</td><td> 62</td>

<td> VL1</td><td> RASSSVSSIH</td><td> 63</td>

<td> VL2</td><td> ATSNLAS</td><td> 64</td>

<td> VL3</td><td> QQWSIDPAT</td><td> 65</td>

TABLE 6

CDR Sequences Of 16H9

<td> CDR</td><td> Sequence</td><td> SEQIDNO</td>

<td> VH1</td><td> GFNIKDTYMH</td><td> 66</td>

<td> VH2</td><td> RIDPANGNTKYDPKFQG</td><td> 67</td>

<td> VH3</td><td> SDIYYGNPGGFAY</td><td> 68</td>

<td> VL1</td><td> TASSSVSSSYLH</td><td> 69</td>

<td> VL2</td><td> STSNLAS</td><td> 70</td>

<td> VL3</td><td> HQYHRSPFT</td><td> 71</td>

[0112] The antibodies and antigen-binding antibody fragments disclosed herein are nőt, and generally do nőt compete with, OC125-like antibodies, M11-like antibodies or the OV 197 antibody, as defined in Nustad et al., Tumor Bioi. 17:196:219 (1996). In one embodiment, the antibodies and antigen-binding fragments are nőt, and generally do nőt compete with, the OC 125-derived or VK-8-derived single chain antibodies described in WO 03/076465.

[0113] The antibodies can include, bút are nőt limited to, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, humanized antibodies, humán antibodies, bi-specific antibodies, tri-specific antibodies, multi-specific antibodies, single chain antibodies, disulfide-linked F_vS, single-chain F_vS, or anti-idiotypic antibodies. In a preferred embodiment, an antibody ofthe invention is a monoclonal antibody that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide. Multispecific antibodies may be specific fór different epitopes of cell-associated CA 125/O772P or may be specific fór both a cell-associated CA 125/O772P epitope as well as fór a heterologous epitope, such as a heterologous polypeptide or solid support matériái. See, e.g., Tutt et al., J. Immunoi. 147(1):60-69 (1991); Kostelny et al., J. Immunoi. 148(5):1547-1553 (1992); and U.S. Patent Nos. 4,474,893, 4,714,681,4,925,648, 5,573,920,5,601,819,5,798,229,5,855,866, 5,869,620, 5,897,861, 5,959,084, 6,106,833,

6,248,332,6,258,358,6,303,755, and 6,420,140.

[0114] The antigen-binding antibody fragments disclosed can include, bút are nőt limited to, Fab fragments, F(ab’)₂fragments, variable light chain polypeptide (VL)containing fragments, variable heavy chain polypeptide (VH)-containing fragments, or complementarity determining region (CDR)-containing fragments.

[0115] Further, the antibodies and antigen-binding antibody fragments disclosed can be of any immunoglobulin eláss. Fór example, the antibodies can be IgG, IgM, IgB, IgD, IgA or IgY eláss antibodies. The antibodies can alsó be of any isotype. Fór example, an antibody can beofan IgG^ lgG₂, lgG₃, lgG₄, lgA₁ or lgA₂ heavy chain isotype. Preferably an antibody is of an lgG₁ isotype.

[0116] Still further, the antibodies or antigen-binding antibody fragments, can comprise one or more CDRs, e.g., CDR sequences as described herein, inserted within naturally occurring or consensus framework regions, preferably humán framework regions. Further, the antibodies or antigen-binding antibody fragments can comprise a variable light chain, fór example, arora light chain variable region, and/or a variable heavy chain as described herein, inserted within naturally occurring or consensus framework regions, preferably humán framework regions. Such framework regions are well known to those of skill in the art, e.g., can comprise a Cy1 constant region or a C-/4 constant region.

[0117] The antibodies or antigen-binding antibody fragments that preferentially bind to cell-associated CA 125/O772P may be from any animal origin including birds, e.g., chickens, and mammals, including non-primates (e.g., a cow, pig, horse, donkey, goat, camel, cat, dog, guinea pig, rat, mouse, sheep) and primates (e.g., a monkey, such as a cynomolgous monkey, gorilla, chimpanzee, and a humán). Preferably, the antibodies and antigen-binding antibody fragments that preferentially bind to cell-associated CA 125/O772P are chimeric, humán, or humanized antibodies, including monoclonal antibodies, or antigen-binding antibody fragments. As used herein, humán antibodies or antigen-binding antibody fragments include antibodies or antigen-binding antibody fragments having the amino acid sequence of a humán im18

EP 2 891 666 Β1 munoglobulin, and include, fór example, antibodies or antigen-binding antibody fragments isolated from humán immunoglobulin libraries orfrom mice that express antibodies from humán genes.

[0118] In another aspect, the present disclosure provides hybridoma cells that produce a monoclonal antibody as disclosed. In one embodiment, a hybridoma may be a hybridoma 4E7 (ATCC® Accession No. PTA-5109), hybridoma 7A11 (ATCC® Accession No. PTA-5110), hybridoma 7C6 (ATCC® Accession No. PTA-5111), hybridoma 7F10 (ATCC® Accession No. PTA-5112), hybridoma 7G10 (ATCC® Accession No. PTA- 5245), hybridoma 7H1 (ATCC® Accession No. PTA-5114), hybridoma 8A1 (ATCC® Accession No. PTA-5115), hybridoma 8B5 (ATCC® Accession No. PTA-5116), hybridoma 8C3 (ATCC® Accession No. PTA-5246), hybridoma 8E3 (ATCC® Accession No. PTA- 5118), hybridoma 8G9 (ATCC® Accession No. PTA-5119), hybridoma 15C9 (ATCC® Accession No. PTA-5106), hybridoma 16C7 (ATCC® Accession No. PTA-5107), hybridoma 16H9 (ATCC® Accession No. PTA-5108), hybridoma 117.1 (ATCC® Accession No. PTA-4567), hybridoma 325.1 (ATCC® Accession No. PTA-5120), hybridoma 368.1 (ATCC® Accession No. PTA4568), hybridoma 446.1 (ATCC® Accession No. PTA-5549), hybridoma 501.1 (ATCC® Accession No. PTA-4569), hybridoma 621.1 (ATCC® Accession No. PTA-5121), hybridoma 633.1 (ATCC® Accession No. PTA-5122), pybridoma

654.1 (ATCC® Accession No. PTA-5247), hybridoma 725.1 (ATCC® Accession No. PTA-5124), or hybridoma 776.1 (ATCC® Accession No. PTA-4570).

[0119] In another embodiment, a hybridoma may be a hybridoma that produces monoclonal antibodies that compete with the monoclonal antibody produced by hybridoma 4E7 (ATCC® Accession No. PTA-5109), hybridoma 7A11 (ATCC® Accession No. PTA-5110), hybridoma 7C6 (ATCC® Accession No. PTA-5111), hybridoma 7F10 (ATCC® Accession No. PTA-5112), hybridoma 7G1O (ATCC® Accession No. PTA-5245), hybridoma 7H1 (ATCC® Accession No. PTA5114), hybridoma 8A1 (ATCC® Accession No. PTA-5115), hybridoma 8B5 (ATCC® Accession No. PTA-5116), hybridoma 8C3 (ATCC® Accession No. PTA-5246), hybridoma 8E3 (ATCC® Accession No. PTA-5118), hybridoma 8G9 (ATCC® Accession No. PTA-5119), hybridoma 15C9 (ATCC® Accession No. PTA-5106), hybridoma 16C7 (ATCC® Accession No. PTA-5107), hybridoma 16H9 (ATCC® Accession No. PTA-5108), hybridoma 117.1 (ATCC® Accession No. PTA-4567), hybridoma 325.1 (ATCC® Accession No. PTA-5120), hybridoma 368.1 (ATCC® Accession No. PTA4568), hybridoma 446.1 (ATCC® Accession No. PTA-5549), hybridoma 501.1 (ATCC® Accession No. PTA-4569), hybridoma 621.1 (ATCC® Accession No. PTA-5121), hybridoma 633.1 (ATCC® Accession No. PTA-5122), hybridoma

654.1 (ATCC® Accession No.PTA-5247), hybridoma 725.1 (ATCC® Accession No. PTA-5124), or hybridoma 776.1 (ATCC® Accession No. PTA-4570) fór binding to cell-associated CA 125/O772P.

5.2 Fusion Polypeptides [0120] In another aspect, a fusion polypeptide is provided comprising an antibody or an antigen-binding antibody fragment, that is, one that preferentially hinds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide, operably linked to a heterologous agent. Fusion polypeptides alsó preferentially bind cell-associated CA 125/O772P. In one embodiment of a fusion polypeptide, the antibody, or antigen-binding antibody fragment, and the heterologous agent may be operably linked via a covalent linkage, such as a peptide bond or disulfide linkage. In another embodiment of a fusion polypeptide ofthe invention, the antibody, or antigen-binding antibody fragment, and the heterologous agent may be operably linked via non-covalent linkage. The heterologous agent can be linked to the amino terminus, carboxyl terminus, or at any point along the contiguous sequence ofthe antibodies or antigenbinding antibody fragments. The operable linkage need nőt be directly between the antibody or antigen-binding antibody fragment and the heterologous agent, bút can, fór example, occur through a linker or spacer agent or sequence.

[0121] The heterologous agent may comprise an amino acid sequence or a radioisotope. The heterologous agent of the fusion polypeptide can comprise a cytotoxic agent or a detectable agent.

[0122] Fusion polypeptides can, fór example, be used in generating antibodies or antigen-binding antibody fragments of the invention. Alternatively, fusion polypeptides can be utilized as part of the methods of prevention or treatment described herein. Still further fusion polypeptides ofthe invention can be utilized as part of in vivő and in vitro immunoassays and purification methods using methods known in the art. See e.g., PCT publication Number WO 93/21232; U.S. Patent Nos. 5,314,995, 5,474,981,5,514,558, 6,362,317, and 6,403,769; Nakamura etal., Imunol. Lett. 39(1):91-99 (1993); Gillies et al., Proc. Natl. Acad. Sci. USA. 89(4):1428-1432(1992): and Feli etal., J. Immunoi. 146(7):2446-2452 (1991) [0123] In instances where the heterologous agent is a polypeptide, the heterologous polypeptide is generally at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 amino acids.

[0124] In one embodiment, the fusion polypeptides comprise antibodies or antigen-binding antibody fragments that preferentially bind cell-associated CA 125/O772P operably linked to a heterologous agent that provides a potential therapeutic benefit. Fór example, an antibody or an antigen-binding fragment thereof that preferentially binds cell-associated CA 125/O772P may be operably linked to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, an agent, óra radioactive ion, e.g., alphaemitters. See, e.g., U.S. Patent Nos. 5,624,827, 5,643,573, 5,789,554,

ΕΡ 2 891 666 Β1

5,824,782, 5,994,151,6,042,829,6,074,644,6,099,842,6,132,722, 6,187,287, 6,197,299, and 6,207,805. Acytotoxin or cytotoxic agent includes any agent that is detrimental to cell growth or cell viability. Examples ofa cytotoxin or cytotoxic agent include, bút are nőt limited to, paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Other agents which have a potential therapeutic benefit include, bút are nőt limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cisdichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), maytansinoids and anti-mitotic agents (e.g., vincristine and vinblastine) and radioactive matériái, including, bút nőt limited to, bismuth (²¹³Bi), carbon (¹⁴C), chromium (⁵¹Cr), cobalt(⁵⁷Co), fluorine (¹⁸F), gadolinium (¹⁵³Gd, ¹⁵⁹Gd), gallium (⁶⁸Ga, ⁶⁷Ga), germanium (⁶⁸Ge), holmium (¹⁶⁶Ho), indium (¹¹⁵ln, ¹¹³ln, ¹¹²ln,¹¹¹ In), iodine (¹³¹1,¹²⁵l, ¹²³l,¹²¹1), lanthanum (¹⁴⁰La), lutetium (¹⁷⁷Lu), manganese (⁵⁴Mn), molybdenum (Mo), palládium (¹⁰³Pd), phosphorous ³²P), praseodymium ¹⁴²Pr), promethium ¹⁴⁹Pm), rhenium ¹⁸⁶Re, ¹⁸⁸Re), rhodium ¹⁰⁵Rh), ruthemium (⁹⁷Ru), samarium ¹⁵³Sm), scandium (⁴⁷Sc), selenium (⁷⁵Se), strontium (⁸⁵Sr), sulfur³⁵S), technetium (⁹⁹Tc), thallium ²⁰¹Ti), tin (¹¹³Sn, ¹¹⁷Sn), tritium ³HJ, xenon (¹³³Xe), ytterbium (¹⁶⁹Yb, ¹⁷⁵Yb), yttrium (⁹⁰Y), and zinc (⁶⁵Zn).

[0125] Further, the antibody or antigen-binding antibody fragment can be conjugated to a therapeutic agent or drug moiety. Therapeutic agents or drug moieties are nőt to be construed as limited to classical Chemical therapeutic agents. Fór example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, fór example, a toxin such as abrin, ricin A, pseudomonas exotoxin (i.e., PE-40), or diphtheria toxin; ricin, gelonin, and pokeweed antiviral protein, a protein such as tumor necrocis factor, interferons including, bút nőt limited to, α-interferon (IFN-a),p-interferon (IFN-β), nerve growth factor (NGF), piatelet derived growth factor (PDGF), tissue plasminogen activator (TPA), an apoptotic agent (e.g., TNF-a, TNF-,β, AIM I as disclosed in PCT Publication No. WO 97/33899), AIM II (see, PCT Publication No. WO 97/34911), Fás Ligand (Takahashi et al., J. Immunoi., 6:1567-1574, 1994), and VÉGI (PCT Publication No. WO 99/23105), a thrombotic agent or an anti-angiogenic agent (e.g., antistatin or endostatin), óra biological response modifiersuch as, fór example, a lymphokine (e.g., interleukin-1 (IL-1 ), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophage colony stimulating factor (GM-CSF), and granulocyte colony stimulating factor (G-CSF)), macrophage colony stimulating factor (M-CSF), or a growth factor (e.g., growth hormoné (GH)); proteases, or ribonucleases.

[0126] Fusion polypeptides can, alternatively, be used diagnostically to, e.g., monitor the development or progression of cancer or tumor as part of a clinical testing procedure, fór example to determine the efficacy of a given treatment régimén, such as where the antibody is coupled to a detectable agent. Examples of detectable agents include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals, and nonradioactive paramagnetic metál ions. The detectable agent may be coupled or conjugated either directly to the antibody or indirectly, through an intermediate (such as, fór example, a linker known in the art) using techniques known in the art. See, e.g., U.S. Patent Nos. 4,741,900, 5,693,764,

5,776,095,6,008,002,6,013,531,6,110,750, 6,124,105, 6,197,523, and 6,225,050.

[0127] Non-limiting examples of suitable enzymes that can be conjugated to an antibody or antigen-binding antibody fragment include ,8-lactamases, ,8- galactosidases, phosphatases, peroxidases, reductases, esterases, hydrolases, isomerases and proteases, such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; non-limiting examples of suitable prosthetic group complexes include streptavidinlbiotin and avidinibiotin. Non-limiting examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, green fluorescent protein, red fluorescent protein, dansyl chloride or phycoerythrin; a non-limiting example ofa luminescentmaterial includes luminol. Non-limiting examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive matéria! include ¹²⁵l, ¹³¹l, ¹¹¹ In, ^99mTc, or⁹⁰Y.

[0128] The present disclosure alsó encompasses antibodies or antigen-binding fragments thereof that preferentially bind to cell-associated CA125/O772Pfused to marker sequences, such as a peptide tofacilitate purification. Fór example, a marker amino acid sequence can be a hex a-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, manyofwhich are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA. 86(3):821-824 (1989), fór instance, histidine, e.g., hex a-histidine, provides fór convenient purification ofthe fusion protein. Other peptide tags useful fór purification include, bút are nőt limited to, the hemagglutinin HA tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell. 37(3):767-778 (1984)) and the flag tag (Brizzard et al., Biotechniques. 16(4):730-735 (1994)). Preferably, such tags or marker sequences are cleaved from the fusion polypeptide prior to use, e.g., use as part of a therapeutic method.

ΕΡ 2 891 666 Β1 [0129] An antibody or an antigen-binding fragment thereof that preferentially binds cell-associated CA 125/O772P can alsó, fór example, be operably linked to a second antibody to form an antibody heteroconjugate as described in U.S. Patent No. 4,676,980.

[0130] Techniques fór operably linking moieties to antibodies are well known, see, e.g., Arnon et al., Monoclonal Antibodies Fór Immunotargeting Of Drugs In Cancer Therapy, in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al., eds., Alán R. Liss, Inc. (1985) at pages 243-256; Hellstrom et al., Antibodies Fór Drug Delivery, in Controlled Drug Delivery (2nd Ed.), Robinson et al., eds., Marcel Dekker, Inc. (1987) at pages 623-653; Thorpe, Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review, in Monoclonal Antibodies ’84: Biological And Clinical Applications, Pinchera et al., eds., Editrice Kurtis (1985) at pages 475-506; Order et al., Analysis, Results, And Future Prospective Of The Therapeutic Use Of Rádió labeled Antibody In Cancer Therapy, in Monoclonal Antibodies Fór Cancer Detection And Therapy, Baldwin et al., eds., Academic Press (1985) at pages 303-316; Thorpe et al., Immunoi. Rév. 62:119-158 (1982); and U.S. Patent Nos. 5,639,879,5,744,119,5,773,001, and 6,441,163.

[0131] Methods fór fusing orconjugating polypeptides to the constant regions of antibodies are known in the art. See, e.g., U.S. Patent Nos. 5,336,603, 5,622,929, 5,359,046, 5,349,053,5,447,851,5,648,218,5,723,125, 5,783,181, 5,908,626, 5,844,095, 5,112,946, 6,030,613,6,086,875,6,194,177,6,238,667,6,262,026, and 6,277,375; EP 307,434; EP 367,166; EP 394,827; PCT publication WO 91/06570; Ashkenazi et al., Proc. Natl. Acad. Sci. USA. 88(23):10535-10539 (1991); Traunecker et al., Natúré. 331(6151):84-86 (1988); Zheng et al., J. Immunoi. 154(0):5590-5600(1995) and Vie et al., Proc. Natl. Acad. Sci. USA. 89(23): 11337-11341 (1992).

5.3. Analogs [0132] Alsó included among the antibodies, antigen-binding antibody fragments, and fusion polypeptides are antibody, antigen-binding antibody fragment, and fusion polypeptide analogs that preferentially bind cell-associated CA 125/O772P relatíve to shed CA 125/O772P as defined in the claims. Fór example, among the analogs disclosed are analogs ofthe monoclonal antibody produced by hybridoma 4E7 (ATCC® Accession No. PTA-5109), hybridoma 7A11 (ATCC® Accession No. PTA-5110), hybridoma 7C6 (ATCC® Accession No. PTA-5111), hybridoma 7F10 (ATCC® Accession No. PTA-5112), hybridoma 7G10 (ATCC® Accession No. PTA-5245), hybridoma 7H1 (ATCC® Accession No. PTA-5114), hybridoma 8A1 (ATCC® Accession No. PTA-5115), hybridoma 8B5 (ATCC® Accession No. PTA-5116), hybridoma 8C3 (ATCC® Accession No. PTA-5246), hybridoma 8E3 (ATCC® Accession No. PTA-5118), hybridoma 8G9 (ATCC® Accession No. PTA-5119), hybridoma 15C9 (ATCC® Accession No. PTA-5106), hybridoma 16C7 (ATCC® Accession No. PTA-5107), hybridoma 16H9 (ATCC® Accession No. PTA-5108), hybridoma 117.1 (ATCC® Accession No. PTA-4567), hybridoma 325.1 (ATCC® Accession No. PTA-5120), hybridoma 368.1 (ATCC® Accession No. PTA-4568), hybridoma

446.1 (ATCC® Accession No. PTA- 5549), hybridoma 501.1 (ATCC® Accession No. PTA-4569), hybridoma 621.1 (ATCC® Accession No. PTA-5121), hybridoma 633.1 (ATCC® Accession No. PTA-5122), hybridoma 654.1 (ATCC® Accession No. PTA-5247), hybridoma 725.1 (ATCC® Accession No. PTA-5124), hybridoma 776.1 (ATCC® Accession No. PTA-4570), or analogs of antigen-binding antibody fragments thereof.

[0133] Such an analóg possesses at least one ofthe following structural features: (a) an amino acid sequence that is preferably at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% identical to the amino acid sequence of the pre-modified antibody, antigen-binding antibody fragment, orfusion polypeptide; (b) is encoded by a nucleotide sequence that hybridizes under stringent conditions to the complement of a nucleotide sequence encoding at least 5 contiguous amino acid residues, at least about 10 contiguous amino acid residues, at least about 15 contiguous amino acid residues, at least about 20 contiguous amino acid residues, at least about 25 contiguous amino acid residues, at least about 40 contiguous amino acid residues, at least about 50 contiguous amino acid residues, at least about 60 contiguous amino residues, at least about 70 contiguous amino acid residues, at least about 80 contiguous amino acid residues, at least about 90 contiguous amino acid residues, at least about 100 contiguous amino acid residues, at least about 110 contiguous amino acid residues, or at least about 120 contiguous amino acid residues of the amino acid sequence of the pre-modified antibody, antigen-binding antibody fragment, or fusion polypeptide; or (c) is encoded by a nucleotide sequence that is at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% identical to the nucleotide sequence encoding the pre-modified antibody, antigen-binding antibody fragment, orfusion polypeptide.

[0134] In a specific embodiment, an analóg of an antibody, antigen-binding antibody fragment, orfusion polypeptide that preferentially binds cell-associated CA 125/O772P comprises an amino acid sequence that is preferably at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, orat least about 99% identical to the amino acid sequence ofthe monoclonal antibody produced by hybridoma

ΕΡ 2 891 666 Β1

4Ε7 (ATCC® Accession No. ΡΤΑ-5109), hybridoma 7Α11 (ATCC® Accession No. PTA-5110), hybridoma 7C6 (ATCC® Accession No. PTA-5111), hybridoma 7F10 (ATCC® Accession No. PTA-5112), hybridoma 7G10 (ATCC® Accession No. PTA-5245), hybridoma 7H1 (ATCC® Accession No. PTA-5114), hybridoma 8A1 (ATCC® Accession No. PTA-5115), hybridoma 8B5 (ATCC® Accession No. PTA-5116), hybridoma 8C3 (ATCC® Accession No. PTA-5246), hybridoma 8E3 (ATCC® Accession No. PTA-5118), hybridoma 8G9 (ATCC® Accession No. PTA-5119), hybridoma 15C9 (ATCC® Accession No. PTA-5106), hybridoma 16C7 (ATCC® Accession No. PTA- 5107), hybridoma 16H9 (ATCC® Accession No. PTA-51 08), hybridoma 117.1 (ATCC® Accession No. PTA-4567), hybridoma 325.1 (ATCC® Accession No. PTA5120), hybridoma 368.1 (ATCC® Accession No. PTA-4568), hybridoma 446.1 (ATCC® Accession No. PTA- 5549), hybridoma 501.1 (ATCC® Accession No. PTA-4569), hybridoma 621.1 (ATCC® Accession No. PTA-5121), hybridoma

633.1 (ATCC® Accession No. PTA-5122), hybridoma 654.1 (ATCC® Accession No. PTA-5247), hybridoma 725.1 (ATCC® Accession No. PTA- 5124), orhybridoma 776.1 (ATCC® Accession No. PTA-4570).

[0135] Preferably, the analogs include less than about 25, less than about 20, less than about 15, less than about 10, less than about 5, less than about 4, less than about 3, or less than about 2 amino acid substitutions, additions or deletions, or combinations thereof, relatíve to the original molecule. iii a preferred embodiment, the analogs have conservative amino acid substitutions made at one or more amino acid residues predicted to be non-essential (i.e., amino acid residues which are nőt critical fór the antibody to specifically and preferentially, bind to cell-associated CA 125/O772P). A conservative amino acid substitution is one in which the amino acid residue is replaced with an amino acid residue, mimic or analóg having a side chain with a similar charge or polarity. Families of amino acid residues having side chains with similar charges have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidicside chains (e.g., aspartic acid, glutamic acid), uncharged polarside chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolarside chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0136] Moreover, the analogs can include additions and/or be, at least in part, generated from deletions relatíve to the original molecule. Additions and/or deletions can be of any identity or combination so long as the structural criteria fór analogs of the invention setforth above are satisfied.

[0137] To determine the percent identity of two amino acid sequences orof two nucleic acid sequences, the sequences are aligned fór optimál comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence fór optimál alignment with a second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical overlapping positions/total number of positions x 100%). In one embodiment, the two sequences are the same length.

[0138] The determination of percent identity between two sequences can alsó be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized fór the comparison of two sequences is the algorithm of Kariin et al., Proc. Natl. Acad. Sci. USA. 87(6):2264-2268 (1990), as modified in Kariin et al., Proc. Natl. Acad. Sci. USA. 90(12):5873-5877 (1993). Such an algorithm is incorporated intő the BLASTN and BLASTX programs of Altschul et al., J. Mól. Bioi. 215(3):403-410 (1990). BLAST nucleotide searches can be performed with the BLASTN nucleotide program parameters set, e.g., fór score=100, word length=12 to obtain nucleotide sequences homologous to nucleic acid molecules of the present disclosure. BLAST protein searches can be performed with the BLASTX program parameters set, e.g., to score=50, word length=3 to obtain amino acid sequences homologous to a protein molecule of the present disclosure. To obtain gapped alignments fór comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Rés. 25(17):3389-3402 (1997). Alternatively, PSI-BLAST can be used to perform an iterated search which detects distant relationships between molecules (ld.). When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., of BLAST X and BLASTN) can be used. Another preferred, non-limiting example of a mathematical algorithm utilized fór the comparison of sequences is the algorithm of Myers and Miller (Myers et al., Comput. Appl. Biosci. 4(1):11-17 (1988)). Such an algorithm is incorporated in the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program fór comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0139] The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically only exact matches are counted.

[0140] An analóg can alsó referto an antibody, antigen-binding antibody fragment orfusion polypeptide of the disclosure that has been modified by the attachment, e.g., covalent attachment, of any type of molecule to a corresponding premodified antibody or antigen-binding antibody fragment, and which still preferentially binds cell-associated CA 125/O772P. Fór example, and nőt by way oflimitation, an antibody, antigen-binding antibody fragment orfusion polypeptide can be modified by glycosylation, acetylation, alkylation, esterification, lipidation, formylation, pegylation, phospho22

ΕΡ 2 891 666 Β1 rylation, amidation, derivatization by protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Further, an analóg can contain one or more non-classical amino acids. Non-classical amino acids include bút are nőt limited to the D-isomers ofthe common amino acids, a-amino isobutyric acid, 4-aminobutyric acid (4-Abu), 2-aminobutyric acid (2- Abu), 6-amino hexanoic acid (Ahx), 2-amino isobutyric acid (2-Aib), 3-amino propionoic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid, tbutylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, B-alanine, Eluoro-amino acids, designer amino acids such as B-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in generál.

[0141] In one embodiment, an analóg exhibits increased affinity fór cell-associated CA 125/O772P relatíve to that of a corresponding pre-modified antibody, antigen-binding antibody fragment or fusion polypeptide. In another specific embodiment, an antibody, antigen-binding antibody fragment or fusion polypeptide that preferentially binds cell-associated CA 125/O772P has an increased serum half-life relatíve to a corresponding pre-modified antibody, antigen-binding antibody fragment orfusion polypeptide. Fór example, an analóg can exhibita half-life in an animal, preferablya mammal and most preferably a humán, of greater than about 1 day, greater than about 2 days, greater than about 3 days, greater than about 7 days, greater than about 10 days, preferably greater than about 15 days, greater than about 25 days, greater than about 30 days, greater than about 35 days, greater than about 40 days, or greater than about 45 days. [0142] To prolong the serum circulation of antibodies, antigen-binding antibody fragments or fusion polypeptides in vivő, fór example, inért polymer molecules such as high molecular weight polyethylene glycol (PEG) can be attached to the antibodies, antigen-binding antibody fragments orfusion polypeptides with orwithout a multifunctional linker either through site-specific conjugation ofthe PEG to the amino- orcarboxyl-terminus ofthe antibodies, antigen-binding antibody fragments or fusion polypeptides or via epsilon-amino groups present on lysine residues. Linear or branched polymer derivatization that results in minimál loss of biological activity is preferred. The degree of conjugation can be closely monitored by SDS-PAGE and mass spectrometry to ensure proper conjugation of PEG molecules to the antibodies. Unreacted PEG can be separated from antibody-, antigenbinding antibody fragment- orfusion polypeptide-PEG conjugates by size-exclusion or by ionexchange chromatography. PEG-derivatized antibodies, antigen-binding antibody fragments and fusion polypeptides can be tested fór binding activity as well as fór in vivő efficacy using methods known to those of skill in the art, fór example, by immunoassays described herein.

[0143] Antibodies or antigen-binding antibody fragments having an increased half-life in vivő can alsó be generated by introducing one or more amino acid modifications (i.e., substitutions, insertions or deletions) intő an IgG constant domain, or FcRn binding fragment thereof (preferably a Fe or hinge-Fe domain fragment). See, e.g., PCT Publication No. WO 98/23289 and U.S. Patent No. 6,277,375.

5.4. Nucleic Acid Molecules [0144] In yet another aspect, the present disclosure provides an isolated nucleic acid molecule that comprises a nucleotide sequence that encodes an antibody or antigen-binding antibody fragment, fusion polypeptide, or analóg thereof, of the disclosure.

[0145] In one embodiment, a nucleic acid molecule encodes an antibody, antigen-binding antibody fragment, fusion polypeptide, or analóg thereof, that comprises at least one, preferably two or three, ofthe light chain CDRs listed in Table 1, Table 2, Table 3, Table 4, Table 5 or Table 6. Fór example, a nucleic acid molecule can comprise a nucleotide sequence of SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:52, or SEQ ID NO:59 that encodes at least one, preferentially two or three, of said light chain CDRs.

[0146] In another embodiment, a nucleic acid molecule encodes an antibody, antigen-binding antibody fragment, fusion polypeptide, or analóg thereof, that comprises at least one, preferably two or three, of the heavy chain CDRs listed in Table 1, Table 2, Table 3, Table 4, Table 5 and Table 6. Fór example, a nucleic acid molecule can comprise a nucleotide sequence of SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:57 or SEQ ID NO:58 that encodes at least one, preferentially two or three of said heavy chain CDRs.

[0147] In another embodiment, a nucleic acid molecule disclosed comprises a nucleotide sequence that encodes an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg thereof that comprises a variable light chain polypeptide sequence shown in FIG. 5C, FIG. 6C, FIG. 7C, FIG. 8C, FIG. 9C or FIG. 10C. Fór example, a nucleic acid molecule can comprise the nucleotide sequence of SEQ ID NO:35 (117.1), SEQ ID NO:37 (368.1), SEQ ID NO:39 (501.1), SEQ ID NO:41 (776.1), SEQ ID NO:52 (725.1) or SEQ ID NO:59 (16H9).

[0148] In yet another embodiment, a nucleic acid molecule disclosed comprises a nucleotide sequence that encodes an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg thereof that comprises a variable heavy chain polypeptide sequence shown in FIG. 5D, FIG. 6D, FIG. 7D, FIG. 8D,. FIG. 9DorFIG. 10D. Fór example, a nucleic acid molecule can comprise the nucleotide sequence of SEQ ID NO:36 (117.1), SEQ ID NO:38 (368.1), SEQ ID NO:40 (501.1), SEQ ID NO:42 (776.1), SEQ ID NO:57 (725.1) or SEQ ID NO:58 (16H9).

[0149] Among the nucleic acid molecules are nucleic acid molecules that are degenerate variants, or that hybridize under stringent conditions to the complement of a nucleic acid molecule having a nucleotide sequence encoding an

ΕΡ 2 891 666 Β1 antibody or antigen-binding antibody fragment of the invention. Fór example, in one embodiment, a nucleicacid molecule is one that hybridizes under stringent conditions to the complement of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:52, SEQ ID NO:57, SEQ ID NO:58, or SEQ ID NO:59. Preferably, such hybridizing nucleic acid molecules of the invention encode an antibody or antigen-binding antibody fragment disclosed herein.

5.5. Pharmaceutical Compositions [0150] In another aspect a pharmaceutical composition comprising an antibody or an antigen-binding antibody fragment, tusion polypeptide, analóg or nucleic acid molecule as disclosed, and a pharmaceutically acceptable carrier is provided.

[0151] Preferably, a pharmaceutical composition comprises an antibody, antigen-binding antibody fragment, tusion polypeptide, or analóg that exhibits a K_d of less than about 100 nM, less than about 10 nM, less than about 1 nM, less than about 100 pM, or less than about 10 pM tor the peptide of Figure 1 (SEQ ID NO: 1) as measured by the BIAcore Affinity Assay, as described in Section 6.4. Alternatively, a pharmaceutical composition can comprise an antibody, antigen-binding antibody fragment, tusion polypeptide, or analóg or nucleic acid molecule of the invention that mediates lysis of a CA 125/O772P-positive tumor cell. Most preferably, a pharmaceutical composition comprises an antibody, antigen-binding antibody fragment, tusion polypeptide, analóg or a nucleic acid molecule disclosed herein that encodes a polypeptide that inhibits CA 125/O772P-positive tumor growth, either by itself orwhen conjugated to a cytotoxic agent. [0152] In one embodiment, the antibody or antigen-binding antibody fragment of the invention, orafusion polypeptide or analóg thereof, is conjugated to a cytotoxic agent useful in treating the cell-proliferative disease such as those cytotoxic agents recited in Section 5.2, hereinabove. In a particular embodiment, the cytotoxic agent is a radioisotope. In a further particular embodiment, the radioisotope is selected from the group consisting of ¹²⁵l, ¹³¹l, ¹¹¹ln, ^99mTc and ⁹⁰Y.

[0153] The term carrier refers to a diluent, adjuvant (e.g., Freund’s adjuvant (complete or incomplete», excipient, stabilizing agent, preservatives, binder, or vehicle tor administration of an antibody, antigen-binding antibody fragment, tusion polypeptide, or analóg of the invention. Pharmaceutical carriers can be sterilé liquids, such as water and oils, including those of petróleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline Solutions and aqueous dextrose and glycerol Solutions can alsó be employed as liquid carriers, particularly tor injectable Solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, mait, rice, flour, chalk, silica gél, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can alsó contain minor amounts ofwetting or emulsifying agents, or pH buffering agents. These compositions can take the form of Solutions, suspensions, emulsions, tablets, pilis, capsules, powders, sustained-release formulations and the like. Órai formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in Remington: The Science &amp; Practice of Pharmacy, 20th edition, Gennaro, ed., Lippincott (2000).

[0154] In a preferred embodiment, the pharmaceutical compositions are sterilé and in suitable form tor administration to a subject, preferably an animal subject, more preferably a mammalian subject, and most preferably a humán subject. [0155] In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment. This may be achieved by, tor example, and nőt by way of limitation, local infusion, by injection, or by means of an implant, said implant being of a porous, non-porous, or gelatinous matériái, including membranes, such as sialastic membranes, orfibers. Preferably, when administering pharmaceutical compositions, care must be taken to use materials to which the antibodies, antigen-binding antibody fragments, tusion polypeptides or analogs in the pharmaceutical composition or compositions do nőt adsorb.

[0156] In another embodiment, the pharmaceutical composition can be present and delivered in a vesicle, in particular a liposome (see, e.g., Langer, Science249(4976): 1527-1533(1990); Treatetal., in Liposomes intheTherapyof Infectious Disease and Cancer, Lopez-Berest et al., eds., Liss (1989) at pages 353-365; Lopez-Berestein et al., ibid., at pages 317-327; Lopez-Berestein et al., ibid., generally; and U.S. Patent Nos. RE35.338, 5,662,931,5,759,519,5,879,713,6,027,726, 6,099,857, 6,132,764, 6,245,427, 6,284,375, 6,350,466, and 6,417,326). [0157] In yet another embodiment, the composition can be present and delivered in a controlled release or sustained release system. In one embodiment, a pump may be used to achieve controlled or sustained release (see, e.g., Langer, Science 249(4976):1527-1533 (1990); Sefton, Crit. Rév. Biomed. Eng. 14(3):201-40 (1987); Buchwald et al., Surgery. 88(4):507-516 (1980); Saudek et al., N. Engl. J. Med. 321(9):574-579 (1989); and U.S. Patent Nos. 5,720,720 and 6,352,683). In another embodiment, polymeric materials can be used to achieve controlled or sustained release of the antibodies, antigen-binding antibody fragments, tusion polypeptides or analogs of the disclosure or fragments thereof (see, e.g., Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Prés., Boca Raton, Florida (1974) Medical Applications of Controlled Release, Langer et at., eds., CRC Press (1974); Controlled Drug Bioavailability, Drug

ΕΡ 2 891 666 Β1

Product Design and Performance, Smolen et al., eds., Wiley (1984); Ranger et al., J. Macromol. Sci. Rév. Macromol. Chem. 23:61 (1983); Levy et al., Science. 228(4696):190-192 (1985); During et at., Ann. Neurol. 25(4):351-356 (1989); Howard et al., J. Neurosurg.71(1):105-112 (1989); U.S. Patent Nos. 5,128,326,

5,679,377,5,863,985,5,912,015,5,916,597, 5,989,463, 5,994,492, 6,011,011, 6,020,004,

6,066,325,6,180,608,6,190,702,6,214,966, 6,221,958, 6,221,977, 6,267,981, 6,362,276,

6,365,173,6,375,985,6,394,997, and 6,399,103; and PCT Publication No. WO 99/20253). Examples of polymers used in sustained release formulations include, bút are nőt limited to, poly(2-hydroxy ethyl methacrylate), poly(methyl methacrylate), poly(acrylic acid), poly(ethylene-co-vinyl acetate), poly(methacrylic acid), polyglycolides (PLG), polyanhydrides, poly(N-vinyl pyrrolidone), poly(vinyl alcohol), polyacrylamide, poly(ethylene glycol), polylactides (PLA), poly(lactide-co-glycolides) (PLGA), and polyorthoesters.

[0158] Apharmaceutical composition isformulated to be compatible with its intended routeof administration. Examples of routes of administration include, bút are nőt limited to, e.g., parenteral (e.g., intravenous, intradermal, intramuscular, subcutaneous), órai, intranasal, inhalation, trans dermal (topical), transmucosal, and rectal administration. In a specific embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted fór intravenous, subcutaneous, intramuscular, órai, intranasal or topical administration to humán beings. In a preferred embodiment, a pharmaceutical composition isformulated in accordance with routine procedures fór subcutaneous administration to humán beings. Typically, compositions fór intravenous administration are Solutions in sterilé isotonic aqueous buffer. Where necessary, the composition may alsó include a solubilizing agent and a local anesthetic to ease pain at the site ofthe injection.

[0159] If the pharmaceutical compositions are to be administered topically, the compositions can be formulated in the form of, e.g., an ointment, cream, transdermal patch, lotion, gél, shampoo, spray, aerosol, solution, emulsion, or other form well-known to one of skill in the art. See, e.g., Remington: The Science &amp; Practice of Pharmacy, 20th edition, Gennaro, ed., Lippincott (2000). Fór non-sprayable topical dosageforms, viscous to semi-solid orsolid forms comprising a carrier or one or more excipients compatible with topical application and having a dynamic viscosity preferably greater than water are typically employed. Suitable formulations include, without limitation, Solutions, suspensions, emulsions, creams, ointments, powders, liniments, salves, and the like, which can be, if desired, sterilized or mixed with auxiliary agents (e.g., preservatives, stabilizers, wetting agents, buffers, orsalts) fór influencing various properties, such as, fór example, osmotic pressure. Other suitable topical dosage forms include sprayable aerosol preparations wherein the active ingredient, preferably in combination with a solid or liquid inért carrier, is packaged in a mixture with a pressurized volatile (e.g., a gaseous propellant, such as freon), or in a squeeze bottle. Moisturizers or humectants can alsó be added to pharmaceutical compositions and dosage forms if desired. Examples of such additional ingredients are well known in the art.

[0160] If the pharmaceutical compositions are to be administered intranasally, the compositions can be formulated in an aerosol form, spray, mist or in the form of drops. In particular, agents fór use according to the present invention can be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin fór use in an inhaler or insufflator may be formulated containing a powder mix ofthe compound and a suitable powder base such as lactose orstarch.

[0161] If the pharmaceutical compositions are to be administered orally, the pharmaceutical compositions can be formulated orally in the form of, e.g., tablets, capsules, cachets, gelcaps, Solutions, suspensions and the like. Tablets or capsules can be prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc orsilica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well-known in the art. Liquid preparations fór órai administration may take the form of, fór example, Solutions, syrups or suspensions, or they may be presented as a dry product fór constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated ediblefats); emulsifying agents (e.g., lecithin oracacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol orfractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates orsorbic acid). The preparations may alsó contain buffer salts.flavoring, coloring and sweetening agents as appropriate. Preparations fór órai administration may besuitably formulated fór slow release, controlled release or sustained release of a prophylactic or therapeutic agent(s).

[0162] The pharmaceutical compositions may be formulated fór parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations fór injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The pharmaceutical compositions may take such forms as suspensions, Solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form fór constitution with a

ΕΡ 2 891 666 Β1 suitable vehicle, e.g., sterilé pyrogen-free water, before use.

[0163] The pharmaceutical compositions may alsó be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.

[0164] In addition to the formulations described previously, the compositions may alsó be formulated as a depót preparation. Such long acting formulations may be administered by implantation (fór example, subcutaneously or intramuscularly) or by intramuscular injection. Thus, fór example, the pharmaceutical compositions may be formulated with suitable polymeric or hydrophobic materials (fór example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, fór example, as a sparingly soluble salt.

[0165] Generally, the ingredients of pharmaceutical compositions are supplied either separately or mixed together in unit dosage form, fór example, as a dry lyophilized powder or water free concentrate in a hermetically sealed Container such as an ampoule orsachette indicating the quantity of active agent. Where the pharmaceutical composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterilé pharmaceutical grade water or saline. Where the pharmaceutical composition is administered by injection, an ampoule of sterilé water fór injection or saline can be provided so that the ingredients may be mixed prior to administration.

[0166] Fór antibodies, antigen-binding antibody fragments, fusion polypeptides, and analogs of the invention, the dosage administered to a subject is generally from about 5 μg/kg to about 10 mg/kg, more preferably from about 20 μg/kg to about 5 mg/kg of the subject’s body weight, most preferably from about 100 μg/kg to about 5mg/kg. The dosage can be administered up to about 6 treatments over a period of weeks to months, as determined by the administering physician. Generally, humán antibodies have a longer half-life within the humán bodythan antibodies from otherspecies due to the immuné response to the foreign polypeptides. Thus, lowerdosages and lessfrequent administration of humán antibodies are often possible. Further, the dosage and frequency of administration of antibodies of the invention or fragments thereof may be reduced by enhancing uptake and tissue penetration of the antibodies by modifications such as, fór example, lipidation.

[0167] The precise dose to be employed in the formulation will alsó depend on the route of administration, and the seriousness of the condition, and should be decided according to the judgment of the practitioner and each patient’s circumstances in view of published clinical studies. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.

[0168] In one embodiment, a pharmaceutical composition is packaged in a hermetically sealed Container such as an ampoule or sachette indicating the quantity of the antibody, antigen-binding antibody fragment, fusion polypeptide or analóg. In another embodiment, a pharmaceutical composition is supplied as a dry sterilized lyophilized powder or water free concentrate in a hermetically sealed Container and can be reconstituted, e.g., with water or saline to the appropriate concentration fór administration to a subject. In yet another embodiment, a pharmaceutical composition is suspended in liquid form in a hermetically sealed Container indicating the quantity and concentration of the antibody, antigen-binding antibody fragment, fusion polypeptide or analóg.

[0169] A pharmaceutical composition may be supplied in a hermetically sealed Container at a unit dosage of at least about 5 mg, more preferably at least about 1 mg, more preferably at least about 2 mg, 5 mg, 10 mg, 15 mg, 25 mg, 35 mg, 45 mg, 50 mg, 75 mg, 100 mg, 200 mg, 300 mg, 400 mg, or 500 mg. When supplied in liquid form, the pharmaceutical composition may be supplied in such a sealed Container in a concentration of at least 1 mg/ml.

[0170] Alsó disclosed is a method of preparing a pharmaceutical composition of the invention, comprising admixing an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg of the invention with a pharmaceutically acceptable carrier.

5.6. Articles of Manufacture [0171] In still another aspect, an article of manufacture comprising packaging matéria! and a pharmaceutical composition disclosed herein contained within the packaging matériái, said pharmaceutical composition in a form suitable fór administration to a subject, preferably a humán, or in a formát that can be diluted or reconstituted fór administration to the subject is disclosed. In one embodiment, the article of manufacture further comprises printed instructions and/or a label directing the use or administration of the pharmaceutical composition. The instructions and/or label can, fór example, suggest a dosing régimén fór the prevention ortreatment of one or more symptoms of a CA 125/O772P-related disorder, such as a cell proliferative disorder, fór example cancer, e.g., ovarian, uterine, breast, or lung cancer. Thus, instructions and/or label can provide informational matéria! that advises the physician, technician or subject on how to appropriately prevent, manage, treat or ameliorate a CA 125/O772P-related disorder or one or more symptoms of said disorder, fór example, a cell proliferative disorder, such as cancer, e.g., ovarian cancer.

[0172] As with any pharmaceutical product, the packaging matéria! and Container of the articles of manufacture are designed to protect the stability of the product during storage and shipment. More specifically, an article of manufacture is provided comprising packaging matériái, such as a box, bottle, tűbe, vial, Container, sprayer, insufflator, intravenous (i.v.) bag, envelope and the like; and at least one unit dosage form of a pharmaceutical composition of the invention

ΕΡ 2 891 666 Β1 contained within said packaging matéria!.

5.7. Methods of Identifying Antibodies and Antigen-Binding Antibody Fragments that Preferentially Bind CellAssociated CA 125/O772P [0173] Alsó disclosed is a method to assist in identifying an antibody or antigen-binding antibody fragment that preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P. In one embodiment, a method fór identifying an antibody or antigen-binding antibody fragment that preferentially binds cell-associated CA 125/O772P comprises contacting an antibody or antigen-binding antibody fragment with a peptide comprising cell-associated CA 125/O772P in the presence ofshed CA 125/O772P under conditions that allow binding ofthe antibody or antigen-binding antibody fragment to either said peptide comprising cell-associated CA 125/O772P or shed CA 125/O772P. After incubating, the shed CA 125/O772P (with or without antibody or antigen-binding antibody fragment bound) and unbound antibody or antigen-binding antibody fragment are removed, and the amount of antibody or antigen-binding antibody fragment bound to the peptide comprising cell-associated CA 125/O772P is measured. Ifthe antibody or antigen-binding antibody fragment of the method satisfies anyone of the three embodiments set forth above fór preferential binding, then said antibody or antigen-binding antibody fragment is one that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide. In a preferred embodiment, the ratio ofshed CA 125/O772P to cell-associated CA 125/O772P to cell-associated CA 125/O772P in the reaction mixture is about 25:1 (wt/wt.). As part of this method, cell-associated CA 125/O772P can be immobilized on a solid surface. Fór example, the method can be performed in an ELISA formát.

[0174] Alsó disclosed is a method to assist in identifying an antibody, or antigen-binding antibody fragment, that preferentially binds cell-associated CA 125/O772P comprises contacting an antibody, or antigen-binding fragment, with a peptide comprising cell-associated CA 125/O772P and shed CA 125/O772P (e.g., about a 25- fold (weight/weight) excess amount), under conditions that allow binding ofthe peptide comprising cell-associated CA 12510772P to the antibody or antigen-binding antibody fragment, removing unbound peptide comprising cell-associated CA 125/O772P, measuring the amount of peptide comprising cell-associated CA 125/O772P bound by the antibody, or antigen-binding fragment, and comparing the amount measured to the amount of peptide comprising cell-associated CA 125/O772P the antibody or antigen-binding antibody fragment can bind in the absence of such amount of shed CA 125/O772P. If the antibody or antigen-binding antibody fragment ofthe method satisfies anyone ofthe three embodiments set forth above fór preferentially binds, then said antibody or antigen-binding antibody fragment is one that preferentially binds cellassociated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide. As part of this method the antibody, or antigen-binding antibody fragment can be immobilized on a solid surface, fór example, the method can be performed in an ELISA formát. The teaching provided herein, coupled with standard techniques well known to those of skill in the art, can be utilized in practicing such methods fór Identification of antibodies, or antigen-binding antibody fragments, as disclosed. Fór example, among the assays that can be utilized in identifying such antibodies or antigen-binding antibody fragments is the ELISA Competition Assay described in Section 6 and its subsections, below.

[0175] Alsó disclosed is a method to assist in identifying an antibody, or antigen-binding antibody fragment, that preferentially binds cell-associated CA 125/O772P comprises contacting an antibody, or antigen-binding fragment, with a cell that expresses CA 125/O772P and with an amount, e.g., at least about 0.05 mg/ml, ofshed CA 125/O772P under conditions that allow binding of the CA 125/O772P to the antibody or antigen-binding antibody fragment, removing unbound cells, measuring the amount of cells expressing CA 125/O772P bound by the antibody, or antigen-binding fragment, and comparing the amount measured to the amount of cells expressing CA 125/O772P that binds the antibody or antigen-binding antibody fragment in the absence of such an amount of shed CA 125/O772P. If the antibody or antigen-binding antibody fragment of the method satisfies anyone of the three embodiments set forth above fór preferentially binds, then said antibody or antigen-binding antibody fragment is one that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide. Such a method can, forexample, be performed wherein the measuring is performed by flow cytometry techniques, including, e.g., fluorescence activated cell sorting. The teaching provided herein, coupled with standard techniques well known to those of skill in the art, can be utilized in practicing such methods fór Identification of antibodies, or antigen-binding antibody fragments, ofthe invention. Fór example, among the assays that can be utilized in identifying such antibodies or antigen-binding antibody fragments are the Flow Cytometry Competition Assay in Section 6 and its subsections, below.

[0176] Alsó provided are antibodies and antigen-binding antibody fragments that preferentially bind cell-associated CA 125/O772P and that are specific fór CA 125/O772P. Antibodies that are specific fór CA 125/O772P can routinely be identified by, fór example, utilizing the ELISA Specificity Assay and the Flow Cytometry Specificity Assay described, below, in Section 6 and its subsections. As such, methods are provided fór identifying antibodies and antigen-binding antibodyfragments that are specific fór CA 125/O772P and which alsó preferentially bind cell-associated CA 125/O772P. In one such method, first, an antibody or antigen-binding antibody fragment that is specific fór CA 125/O772P is identified, e.g., by utilizing a ELISA Specificity Assay and/or a Flow Cytometry Specificity Assay. The antibody or antigen-binding

ΕΡ 2 891 666 Β1 antibody fragment is then tested fór an ability to preferentially bind cell-associated CA 125/O772P utilizing, e.g., one of the methods described herein.

[0177] Alsó among the embodiments are antibodies and antigen-binding antibody fragments that preferentially bind cell-associated CA 125/O772P and that bind the peptide of Figure 1 (SEQ ID NO: 1) with a K_d of less than about 100 nM, less than about 10 nM, less than about 1 nM, less than about 100 pM, or less than about 10 pM as measured by the BIAcore Affinity Assay, which is described in Section 6.4. Such antibodies can routinely be identified by, fór example, adopting the ELISA Affinity Assay described below in Section 6 and its subsections. As such, the methods are provided fór identifying antibodies and antigen-binding antibody fragments that preferentially bind cell-associated CA 125/O772P and alsó bind cell-associated CA 125/O772P with at least a certain minimum level of affinity. In one such embodiment, first, an antibody or antigen-binding antibody fragment is identified that preferentially binds cell-associated CA125/O772P utilizing, e.g., one of the methods described herein. The antibody or antigen-binding antibody fragment is then tested fór an ability to bind cell-associated CA 125/O772P (or a peptide comprising the same) with a K_d of less than about 100 nM, less than about 10 nM, less than about 1 nM, less than about 100 pM, őrless than about 10 pM, utilizing, fór example, one ofthe techniques described herein.

[0178] Alsó disclosed are antibodies and antigen-binding antibody fragments that preferentially bind cell-associated CA 125/O772P and that exhibit an ability to mediate lysis of CA 125/O772P-positive cells, e.g., tumor cells. Such antibodies and antigen-binding antibody fragments can routinely be identified by, fór example, performing the ADCC and/or CDC assays described below in Section 6 and its subsections. As such, the present invention provides methods fór identifying antibodies or antigen-binding antibody fragments that preferentially bind cell-associated CA 125/O772P and which alsó exhibit an ability to mediate lysis of CA 125/O772P-positive cells. In one such embodiment, an antibody or antigen-binding antibody fragment is identified that preferentially binds cell-associated CA 125/O772P utilizing, e.g., one of the methods presented herein. The antibody or antigen-binding antibody fragment is then tested fór an ability to mediate lysis of CA 125/O772P-positive cells via, fór example, an ADCC and/or CDC assay as described herein. [0179] Embodiments ofthe present disclosure alsó include antibodies and antigen-binding antibody fragments that preferentially bind CA 125/O772P and that exhibit an ability to inhibit or slow growth of CA 125/O772P-positive tumors. Such antibodies can routinely be identified by, fór example, performing in vivő assays previously described, such as those found in Treskes et al., Eur. J. Cancer. 30A(2):183-187 (1994); Ahmad et al., Oncol. Rés. 11(6):273-280 (1999); and Kievit et al., Int. J. Radiat. One. Bioi. Phys. 38(2):419-428 (1997). As such, the present disclosure alsó provides methods fór identifying antibodies or antigen-binding antibody fragments that preferentially bind CA 125/O772P and which alsó exhibit an ability to inhibit growth ofCA 125/O772P-positive tumor cells. In one such embodiment, an antibody or antigen-binding antibody fragment may be identified that preferentially binds cell-associated CA 125/O772P utilizing, e.g., one ofthe methods presented herein. The antibody or antigen-binding antibody fragment is then tested fór an ability to inhibit growth ofCA 125/O772P-positive tumor cells via, fór example, testing the antibody or antigen-binding antibody fragment in a system such as one ofthe in vivő systems described in the citations above.

5.8. Methods of Preventing, Treating, Managing, or Ameliorating a Symptom of a CA125/O772P-Related Disorder [0180] The present disclosure provides methods fór prevention, treatment, ormanagementofa CA 125/O772P-related disorder, or amelioration of a symptom of a CA 125/O772P-related disorder. Fór example, the present invention provides methods fór the prevention, treatment, management, or amelioration of a symptom of a cell proliferative disorder, by administering to a subject in need of such prevention, treatment, management, or amelioration an amount of an antibody, antigen-binding antibody fragment, or analóg effective to effectuate the desired outcome in the subject.

[0181] As discussed throughout, the antibodies and antigen-binding antibody fragments disclosed are those that preferentially bind cell-associated CA 125/O772P. Likewise the fusion polypeptides and analogs disclosed herein alsó preferentially bind cell-associated CA 125/O772P. As alsó noted herein, due to the fact that cell-associated CA 125/O772P, prior to CA 125/O772P shedding, is present or part of CA 125/O772P, it is noted that antibodies, antigenbinding antibody fragments, fusion polypeptides, and analogs can alsó bind CA 125/O772P. Thus, while notwishing to be bound by any particular mechanism ortheory thereof, it is noted that the methods described in this section can be effectuated, at least in part, by binding ofthe administered antibody, antigen-binding antibody fragments, fusion polypeptides, or analogs fór the invention to pre-shed CA 125/O772P in addition to, or instead of, their binding to post-shed cellassociated CA 125/O772P.

[0182] In one embodimentof this disclosure, the methods relate to prevention, treatment, management, or amelioration of a symptom of a cancer. Fór example, these methods relate to prevention, treatment, management, or amelioration of a symptom of cancers or cancer-associated disorders, said cancers including bút nőt limited to such cancers as carcinomas, sarcomas, myelomas, leukémiás, lymphomas and mixed type cancers. In a particular embodiment, such methods relate to prevention, treatment, management, or amelioration of ovarian cancer, cervical cancer, uterine cancer, breast cancer or lung cancer, or a symptom thereof. In a preferred embodiment of such methods ofthe invention, such methods relate to prevention, treatment, management, or amelioration of a symptom of ovarian cancer.

ΕΡ 2 891 666 Β1 [0183] In another embodiment, the present disclosure provides a methodfortreating a CA 125/O772P-related disorder, or ameliorating a symptom thereof, comprising administering to a subject in need of such treatment or amelioration, an antibody, antigen-binding fragment of an antibody, fusion polypeptide or analóg ofthe disclosure in an amount sufficient to treat the cell proliferative disorder or ameliorate a symptom thereof. The CA 125/O772P-related disorder can, fór example, be a cell proliferative disorder such as cancerand can include, e.g., ovarian, cervical cancer, uterine cancer, breast cancer or lung cancer. Such an embodiment is preferably practiced where the antibody, antigen-binding antibody fragment, fusion polypeptide or analóg of the disclosure is conjugated to a cytotoxic agent useful in treating the cellproliferative disease such as those agents recited in Section 5.2. In a particular embodiment, the cytotoxic agent is a radioisotope. In a further particular embodiment, the radioisotope may be selected from the group consisting of ¹²⁵l, ¹³¹l, ¹¹¹ln, ^99mTc and ⁹⁰Y. Such an embodiment can be practiced as part of a combination cancer therapy, by, fór example, further administering a chemotherapeutic agent, such as paclitaxel or cisplatin, or radiation treatment to the subject.

[0184] Alsó provided is a method fór preventing a CA 12510772P-related disorder or a symptom of a CA 125/O772Prelated disorder, comprising administering to a subject in need of such prevention, an antibody, antigen-binding fragment of an antibody, fusion polypeptide or analóg disclosed in an amount sufficient to prevent the CA 125/O772P-related disorder, or a symptom thereof. The CA 125/O772P-related disorder can, fór example, be a cell proliferative disorder such as cancer and can include, e.g., ovarian, cervical cancer, uterine cancer, breast cancer or lung cancer.

[0185] In additional embodiments, the CA 125/O772P-related disorder may be a boné cancer, fór example, Ewing’s sarcoma, osteosarcoma, rhabdomyosarcoma, or another soft-tissue sarcoma. In another embodiment, the CA 125/O772P-related disorder may be a brain tumor, fór example, oligodendroglioma, ependymoma, menengioma, lymphoma, schwannoma, or medulloblastoma. fu another embodiment, the CA 125/O772P-related disorder may be a breast cancer, fór example, ductal carcinoma in situ ofthe breast. In another embodiment, the CA 125/O772P-related disorder may be an endocrine system cancer, fór example, adrenal, pancreatic, parathyroid, pituitary, or thyroid cancers. In another embodiment, the CA 125/O772P-related disorder is a gastrointestinal cancer, fór example, anal, colorectal, esophogeal, gallbladder, gastric, liver, pancreatic, orsmall intestine cancer. In another embodiment, the CA 125/O772Prelated disorder may be a gynecological cancer, fór example, cervical, endometrial, uterine, fallopian tűbe, gestational trophoblastic disease, choriocarcinoma, ovarian, vaginái, orvulvar cancer. In another embodiment, the CA 125/O772Prelated disorder may be a head and neck cancer, fór example, laryngeal, oropharyngeal, parathryroid or thyroid cancer. In another embodiment, the CA 125/O772P-related disorder may be a leukemic cancer, fór example, acute lymphocytic leukémia, acute myelogenous leukémia, chronic lymphocytic leukémia, chronic myelogenous leukémia, hairy cell leukémia, or a myeloproliferative disorder. In another embodiment, the CA 125/O772P-related disorder is a lung cancer, fór example, a mesothelioma, a non-small cell lung cancer, or a small cell lung cancer. In another embodiment, the CA 125/O772P-related disorder may be a lymphoma, fór example, AIDS-related lymphoma, cutaneous T cell lymphoma, Hodgkin’s disease, or non-Hodgkin’s disease. In another embodiment, the CA 125/O772P-related disorder may bemetastatic cancer. In another embodiment, the CA 125/O772P-related disorder is a myeloma, fór example, a multiple myeloma. In another embodiment, the CA 125/O772P-related disorder may be a pediatric cancer, fór example, a brain tumor, Ewing’s sarcoma, leukémia (e.g., acute lymphocytic leukémia or acute myelogenous leukémia), liver cancer, a lymphoma (e.g., Hodgkin’s lymphoma or non-Hodgkin’s lymphoma), neuroblastoma, retinoblastoma, a sarcoma (e.g., osteosarcoma, rhabdomyosarcoma or other soft-tissue sarcomas), orWilms’ Tumor. In another embodiment, the CA 125/O772P-related disorder may be penile cancer. In another embodiment, the CA 125/O772P-related disorder may be prostate cancer. In another embodiment, the CA 125/O772P-related disorder may be a skin cancer, fór example, cutaneous T cell lymphoma, mycosis fungoides, Kaposi’s sarcoma, or melanoma. In another embodiment, the CA 125/O772P-related disorder is testicular cancer. In another embodiment, the CA 125/O772P-related disorder may be a thyroid cancer, fór example, papillary, follicular, medullary, anaplastic, or undifferentiated thyroid carcinoma. In another embodiment, the CA 125/O772P-related disorder may be a urinary tract cancer, fór example, bladder, kidney, or urethral cancer. In another embodiment, the CA 125/O772P-related disorder or cancer-related condition may be ataxia-telangiectasia, carcinoma of unknown primary origin, Li-Fraumeni syndrome, or thymoma.

[0186] In one embodiment of such methods ofthe disclosure, an antibody or antigen-binding fragment is administered. In another embodiment, a monoclonal antibody or antigen-binding monoclonal antibody fragment is administered. Typically, the antibody or antigen-binding antibody fragment may be administered at a dosage concentration of about 5μg/kg to about 10mg/kg, more preferably from about 2C^g/kg to about 5mg/kg, and most preferably from about 10C^g/kg to about 5mg/kg of the subject’s body weight.

[0187] In generál, the methods described herein can be utilized via administration of a pharmaceutical composition as disclosed. The toxicity and/or efficacy ofthe compositions administered according to the particular protocols practiced can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., fordetermining the LD₅₀ (the dose lethal to 50% of the population) and the ED₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD₅₀/ED₅₀. Compositions that exhibit large therapeutic indices are preferred. While compositions that exhibit

ΕΡ 2 891 666 Β1 toxic sídé effects may be used, it is preferable that a delivery system be utilized that targets such compositions to the site of affected tissue, e.g., ovarian tissue, thereby reducing sídé effects.

[0188] Data obtained from the cell culture assays and animal studies can be used in formulating a rangé of dosage of compositions fór use in humans. The dosage of such compositions lies preferably within a rangé that results in circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage may vary within this rangé depending upon the dosage form employed and the route of administration utilized. Fór any agent used in the methods of the disclosure, the therapeutically effective dose can be estimated initially from cell culture assays. Adósé may beformulated in animal models to achieve a circulating plasma concentration rangé that includes the IC₅₀ (i.e., the concentration of the compound that achieves a half-maximal inhibition of one or more symptoms) as determined in cell culture assays, e.g., proliferation assays. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, fór example, by high performance liquid chromatography.

[0189] Various delivery systems are known and can be used to administer an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg disclosed , e.g., encapsulation in liposomes (see, e.g., Langer, Science 249(4976):1527-1533 (1990); Treat etal., in Liposomes in theTherapyof Infectious Diseaseand Cancer, Lopez-Berestein et al., eds., Liss (1989) at pages 353-365), microparticles, microcapsules, or recombinant cells capable of expressing the antibody, antigen-binding antibody fragment, fusion polypeptide or analóg is disclosed.

[0190] Methods of administering an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg of the disclosure, or pharmaceutical composition comprising same include, bút are nőt limited to, parenteral (e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous administration), epidural, or mucosal (e.g., intranasal and órai) routes of administration. See, e.g., U.S. Patent Nos. 5,679,377, 5,702,727,5,783,193,5,817,624,6,074,689, 6,156,731, 6,174,529, 6,187,803, 6,331,175, and 6,387,406. In a specific embodiment, an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg of the disclosure, or a pharmaceutical composition thereof may be administered intramuscularly, intravenously, or subcutaneously. The compositions may be administered by any convenient route, fór example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., órai mucosa, rectal and intestinal mucosa, etc.) and may alsó be administered together with other biologically active agents. Administration can be systemic or local. In addition, pulmonary administration can alsó be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent. See, e.g., U.S. Patent Nos. RE37.525, 5,290,540, 5,855,913, 5,874,064, 5,934,272,5,985,309,5,985,320,6,019,968, 6,165,463, 6,358,530, and 6,402,733 and PCT Publication No. WO 99/66903. In one embodiment, an antibody, a fusion protein, a conjugated molecule, or a pharmaceutical composition can be administered using Alkermes AIRTM pulmonary drug delivery technology (Alkermes, Inc., Cambridge, MA).

[0191] In one preferred embodiment, the pharmaceutical composition may be formulated in accordance with routine procedures so that it is adapted fór intravenous administration to humán beings. Typically, pharmaceutical compositions fór intravenous administration are Solutions in sterilé isotonic aqueous buffer. Where necessary, the composition may alsó include a solubilizing agent and a local anesthetic to ease pain at the site of the injection.

[0192] In another specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment. This may be achieved by local infusion, injection, or by means of an implant, said implant being of a porous, non-porous, orgelatinous matéria!.

[0193] In yet another embodiment, the methods may be practiced as part of a combination therapy, fór example, a combination cancer therapy. Such combination cancer therapy can include, fór example, administration of a chemotherapeutic agent, e.g., cisplatin, ifosfamide, paclitaxel, taxanes, a topoisomerase I inhibitor (e.g., CPT-II, topotecan, 9-AC, or GG-211), gemcitabine, mitomycin, emetine, etopside, tenopside, vincristine, vinblastine, colchicin, doxordubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, vinorelbine, oxaliplatin, 5-fluorouracil (5-FU), leucovorin, vinorelbine, temodal, or taxol. Such combination cancer therapy can alternatively or additionally include, bút is nőt limited to, radiation therapy.

[0194] The use of the term combination therapy or combination cancer therapy does nőt limit the order in which agents or treatments are administered to a subject with a CA 125/O772P-related disorder. Fór example, the agents of the combination therapy can be administered concurrently, sequentially in any order or cyclically to a subject. In a preferred embodiment, the two or more components ofthe combination therapy are administered to a subject concurrently. The term concurrently is nőt limited to the administration of two or more agents at exactly the same time, bút rather it is meant that the agents are administered to a subject in a sequence and within a time interval such that the agents can act together to provide an increased benefit than ifthey were administered otherwise.

[0195] The agents to be administered as part of combination therapy methods can, fór example, be administered to a subject in the same pharmaceutical composition. Alternatively, the agents ofthe combination therapies can be administered to a subject in separate pharmaceutical compositions, by the same or different routes of administration.

ΕΡ 2 891 666 Β1

5.9. Methods of Diagnosing a CA 125/O772P-Related Disorder [0196] In another aspect, the present disclosure alsó provides methods fór diagnosing a CA 125/O772P-related disorder or predisposition to a CA 125/O772P-related disorder. In one embodiment, labeled antibodies, antigen-binding antibody fragments, fusion polypeptides, and analogs of the disclosure can be used fór diagnostic purposes to detect, diagnose, or monitor a CA 125/O772P-related disorder such as cancer.

[0197] Fór example, antibodies, antigen-binding antibody fragments, fusion polypeptides, and analogs ofthe disclosure can be used to assay cell-associated CA 125/O772P levels in a biological sample using classical immunohistological methods as described herein oras known to those of skill in the art (see, e.g., Jalkanen et al., J. Cell. Bioi. 101(3):976-984 (1985); Jalkanen et al., J. Cell. Bioi. 105(6 Pt 2):3087-3096 (1987». Other antibody-based methods useful fór detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include, fór example, enzyme labels, such as, alkaline phosphatase, glucose oxidase; radioisotopes, such as iodine (¹²⁵l, ¹³¹l), carbon (¹⁴C), sulfur (³⁵S), tritium (³H), indium (¹¹ln), and technetium (^99mTc); luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine.

[0198] One aspect is the detection and diagnosis of a predisposition to cancer, in particular, ovarian cancer, in a humán. In one embodiment, diagnosis comprises: a) administering (fór example, parenterally, subcutaneously, or intraperitoneally) to a subject an amount of a labeled antibody, antigen-binding antibody fragment, fusion polypeptide, or analóg that preferentially binds cell-associated CA 125/O772P effective fór diagnosis, and b) detecting the labeled antibody, antigen-binding antibody fragment, fusion polypeptide, or analóg in the subject in order to make said diagnosis. In accordance with this embodiment, the antibody, antigen-binding fragment, fusion polypeptide, or analóg is preferably labeled with an imaging moiety which is detectable using an imaging system known to one of skill in the art. Background level can be determined by various methods including, comparing the amount of labeled molecule detected to a standard value previously determined fór a particular system.

[0199] Presence of the labeled molecule can be detected in the subject using methods known in the art fór in vivő scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method fór detecting a particular label. Methods that may be used in the diagnostic methods ofthe invention include, bút are nőt limited to, computed tomography (CT), whole body scan such as positron emission tomography (PÉT), magnetic resonance imaging (MRI), and sonography.

[0200] In a specific embodiment, the molecule is labeled with a radioisotope and is detected in the subject using a radiation responsive surgical instrument (see, e.g., U.S. Patent No. 5,441,050). In another embodiment, the molecule is labeled with a fluorescent compound and is detected in the subject using a fluorescence responsive scanning instrument.

In another embodiment, the molecule is labeled with a positron emitting metál and is detected in the subject using PÉT. In yet another embodiment, the molecule is labeled with a paramagnetic label and is detected in the subject using MRI. [0201] It will be understood in the art that the size and weight ofthe subject, as well as the type ofthe imaging system used, will determine the type and quantity of imaging moiety needed to produce useful diagnostic images. In the case of a ^99mTc-containing radioisotope moiety, fór a humán subject, the quantity of radioactivity injected will normally rangé from about 5 to 20 millicuries. The labeled antibody, antigen-binding antibody fragment, fusion polypeptide, or analóg will then preferentially accumulate at the location of cells which exhibit a cell-associated CA 125/O772P polypeptide. In vivő tumor imaging is described in Burchiel et al., Immunopharmacokinetics of Rádió labeled Antibodies and Their Fragments, in Tumor Imaging: The Radiochemical Detection of Cancer, Burchiel etal., eds., Masson Publishing Inc. (1982) atChapter13.

[0202] Depending on several variables, including the type of label used and the mode of administration, the time interval following the administration fór permitting the labeled molecule to preferentially concentrate at sites in the subject and fór unbound labeled molecule to be cleared to background level may be about 6 to 48 hours or about 6 to 24 hours or about 6 to 12 hours. In another embodiment the time interval following administration is about 5 to 20 days or about 5 to 10 days.

[0203] In one embodiment, monitoring ofaCA125/O772P-related disorder, e.g., cancer, can becarriedout by repeating the imaging method at several time points, fór example, at one month after initial diagnosis, at six months after initial diagnosis, and/or at one year after initial diagnosis, and so forth.

[0204] Included are methods of diagnosing or monitoring cancer comprising administering to a subject in need of such diagnosis or monitoring an amount of the labeled antibody, antigen-binding antibody fragment, fusion polypeptide, or analóg that preferentially binds cell-associated CA 125/O772Psufficient fór detection, and detecting the labeled antibody, antigen-binding antibody fragment, fusion polypeptide, or analóg bound to an organ or tissue ofthe subject. Furthermore, methods of detecting cell-associated CA 125/O772P in a biological sample comprising contacting a labeled antibody, antigen-binding antibody fragment, fusion polypeptide, oranalog that preferentially binds cell-associated CA 125/O772P, and detecting antibody, antigen-binding antibody fragment, fusion polypeptide, or analóg bound to the sample are

ΕΡ 2 891 666 Β1 provided.

[0205] In these embodiments, the amount of labeled molecule bound to cell-associated CA 125/O772P can then be compared to a standard amount orto a control, orto the amount previously detected in the subject at an earlier time point.

5.10. Methods of Producing Antibodies [0206] Antibodies of the invention can be produced by any method known in the art fór the synthesis of antibodies, fór example, by hybridoma technology, Chemical synthesis or preferably, by recombinant expression techniques. [0207] Polyclonal antibodies can be produced by various procedures well known in the art. Fór example, a humán CA 125/O772P comprising a cell-associated CA 125/O772P polypeptide can be administered to various hőst animals including, bút nőt limited to, rabbits, mice, rats, and horses, to induce the production ofsera containing polyclonal antibodies specific fór the humán antigén. Various adjuvants may be used to increase the immunological response, depending on the hőst species, and include bút are nőt limited to, Freund’s (complete or incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful humán adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are alsó well known in the art.

[0208] Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybrid om a, recombinant, and phage display technologies, or a combination thereof. Fór example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught in Harlow et al..Antibodies: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press (1988); or Hammerling et at., Monoclonal Antibodies and T-Cell Hybridomas, Elsevier (1981) at pages 563-681).

[0209] Methods fór producing and screening fór specific antibodies using hybridoma technology are routine and well known in the art. Briefly, in one example, mice can be immunized with a CA 125/072 polypeptide, e.g., a cell-associated CA 125/O772P polypeptide and once an immuné response is detected, e.g., antibodies specific fór the antigén are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells, fór example, cells from cell line SP2/0-Ag14 available from the ATCC (Accession No. CRL-1581). Hybridomas are selected and cloned by limiting dilution. The hybridoma clones are then assayed by methods known in the art fór cells that secrete antibodies capable of binding a cell-associated CA 125/O772P. Ascites fluid, which generally contains high levels of antibodies, can be generated by injecting mice with positive hybridoma clones.

[0210] Methods are provided of generating monoclonal antibodies as well as antibodies produced by such methods comprising culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse immunized with a CA 125/O772P polypeptide, e.g., a cellassociated CA 125/O772P polypeptide, with myeloma cells, and then screening the hybridomas resulting from thefusion fór hybridoma clones that secrete an antibody able to bind to the CA 125/O772P polypeptide, e.g., a cell-associated CA 125/O772P polypeptide.

[0211] Antibody fragments which recognize specific epitopes may be generated by any technique known to those of skill in the art. Fór example, Fab and F(ab’)₂ fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab’)₂fragments). F(ab’)₂ fragments contain the variable region, the light chain constant region and the CHI domain ofthe heavy chain. Further, the antibodies ofthe present invention can alsó be generated using various phage display methods known in the art.

[0212] In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. Phage expressing an antigén binding domain that binds to a CA 125/O772P polypeptide antigén can be selected or identified with antigén, e.g., using labeled antigén or antigén bound or captured to a solid surface or bead. Examples of phage display methods that can be adapted so they can be used to make or identify the antibodies of the present invention include those disclosed in Brinkmann et al., J. Immunoi. Methods. 182(1):41-50 (1995); Ames et al., J.Immunoi. Methods. 184(2):177-186 (1995); Kettleborough et al., Eur. J. lmmunol.24(4):952-958 (1994); Persicetal., Gene. 187(1):9-18 (1997); Burton et at., Adv. Immunoi. 57:191-280 (1994); PCT publication Nos. WO 91/10737 and WO 95/15982; EP 853,661; and U.S. Patent Nos. 5,223,409, 5,403,484,5,427,908,5,516,637,5,571,698,5,580,717, 5,658,727,5,667,988,5,698,426,5,712,089, 5,733,743,

5,780,225, 5,789,208, 5,821,047, 5,885,793,5,969,108,6,096,551,6,140,470, 6,376,170, 6,265,150 and 6,335,163. [0213] As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including humán antibodies, or a desired antigén binding fragment, and expressed in a hőst, including mammalian cells, insect cells, plánt cells, yeast, and bacteria, e.g., as described below. Techniques to recombinantly produce Fab, Fab’ and F(ab’)₂ fragments can alsó be employed using methods known in the art such as those disclosed in U.S. Patent Nos. 5,595,898, 5,698,417, and 6,204,023; ’Mullinax et al., BioTechniques. 12(6):864-869 (1992); Sawai et al., Am. J. Repród. Immunoi. 34(1):26-34 (1995); and Better et al.,

ΕΡ 2 891 666 Β1

Science. 240(4855):1041- 1043 (1988).

[0214] Το generate whole antibodies, PCR primers including VH or VL nucleotide sequences, a restriction site, and a flanking sequence to protect the restriction site can be used to amplify the VH orVL sequences in scF_v clones. Utilizing cloning techniques known to those of skill in the art, the PCR amplified VH domains can be cloned intő vectors expressing a VH constant region, and the PCR amplified VL domains can be cloned intő vectors expressing a VL constant region, e.g., humán kappaor lambda constant reg ions. Preferably, the vectors fór expressing the VH orVL domains can comprise an EF-1apromoter, a secretion signal, a cloning site fór the variable domain, constant domains, and a selection marker such as neomycin. The VH and VL domains may alsó be cloned intő one vector expressing the necessary constant regions. The heavy chain expression vectors and light chain expression vectors are then co-transfected intő cell lines to generate stable or transient cell lines that express full-length antibodies, e.g., IgG, using techniques known to those of skill in the art.

[0215] Fór somé uses, particularly in vivő use of antibodies in humans and in vivő detection assays, it may be preferable to use chimeric, humán ized, orcompletely humán antibodies. A chimeric antibody is a molecule in which different portions of the antibody are derived from immunoglobulin molecules from different species. Fór example, and nőt by way of limitation, a chimeric antibody may have light and/or heavy chain variable regions derived from a murine antibody and light and/or heavy chain constant regions derived from a humán immunoglobulin. Methods fór producing chimeric antibodies are known in the art. See, e.g., Morrison, Science. 229(4719):1202-1207 (1985); Oi et al., BioTechniques. 4(3):214-221 (1986); Gillies et al., J. Immunoi. Methods. 125(1-2):191-202 (1989); andU.S.PatentNos. 4,816,397, 4,816,567, and 5,807,715.

[0216] A humanized antibody is an antibody that comprises a humán framework, including a humán constant region, and one or more CDRs from an antibody of a non-human species, e.g., a murine species. Such humanized antibodies can routinely be generated utilizing a variety of techniques known in the art including, fór example, CDR-grafting (EP 239,400; PCT Publication No. WO 91/09967; and U.S. Patent Nos. 5,225,539,5,530,101, 5,585,089,5,766,886, 5,859,205,6,180,370, and 6,407,213), veneering or resurfacing (U.S. Patent No. 5,639,641; EP 519,596; Padlan, Mól. Immunoi. 28(4/5):489-498 (1991); Studnicka et al., Protein Eng. 7(6):805-814 (1994); and Roguska et al., Proc. Natl. Acad. Sci. USA. 91(3):969-973 (1994)), and chain shuffling (U.S. Patent Nos. 5,565,332 and 6,455,253). In a preferred embodiment, humanized antibodies comprise a CDR having an amino acid sequence of anyone of the CDRs listed in Table 1, Table 2, Table 3, Table 4, Table 5 or Table 6 and humán framework regions. Often, framework residues in the framework regions will be substituted with the corresponding residue from the CDR donor antibody to altér, preferably improve, antigén binding. These frameworksubstitutions are identified by methods well known in the art, e.g., by modeling ofthe interactions ofthe CDR and framework residues to identify framework residues important fór antigén binding and sequence comparison to identify unusual framework residues at particular positions. See, e.g., U.S. Patent Nos. 5,585,089, 5,770,196, and 5,869,619; and Riechmann et al., Natúré. 332(6162):323-327 (1988.

[0217] Completely or fully humán antibodies are desirable fór therapeutic treatment of humán subjects. Humán antibodies can be made by a variety of methods known in the art, including the phage display methods described above using antibody libraries derived from humán immunoglobulin sequences. See alsó U.S. Patent Nos. 4,444,887,4,716,111, 5,916,771,5,939,598, 6,075,181,6,114,598,6,150,584,6,162,963,6,235,883; PCT publication WO 98/46645; and EP 463,151.

[0218] Humán antibodies can alsó be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, bút which can express humán immunoglobulin genes. Fór example, the humán heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination intő mouse embryonic stem cells. Alternatively, the humán variable region, constant region, and diversity region may be introduced intő mouse embryonic stem cells in addition to the humán heavy and light chain genes. The mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately orsimultaneously with the introduction of humán immunoglobulin loci by homologous recombination. In particular, homozygous deletion ofthe JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected intő blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring which express humán antibodies. The transgenic mice are immunized in the normál fashion with a selected antigén, e.g., all or a portion of a CA 125/O772P polypeptide, such as a cell-associated CA 125/O772P polypeptide. Monoclonal antibodies directed against the antigén can be obtained from the immunized, transgenic mice using conventional hybridoma technology. The humán immunoglobulin trans genes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo eláss switching and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgB antibodies. Fór an overview of this technology fór producing humán antibodies, see Lonberg et al., Int. Rév. Immunoi. 13(1):65-93 (1995). Fór a detailed discussion of this technology fór producing humán antibodies and humán monoclonal antibodies and protocols fór producing such antibodies, see, e.g., U.S. Patent Nos. 5,413,923, 5,625,126,5,633,425,5,569,825,5,661,016, 5,545,806, 5,814,318, 5,939,598, 6,075,181, 6,091,001,6,114,598,6,150,584, and 6,162,963. In addition, companies such as Abgenix, Inc. (Fremont, CA) and Genpharm (San Jose, CA) can be engaged to provide humán antibodies directed against a selected antigén using technology

ΕΡ 2 891 666 Β1 similar to that described above.

[0219] Completely humán antibodies which recognize a selected epitope can be generated using a technique referred to as guided selection. In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely humán antibody recognizing the same epitope. See, e.g., Jespers et al., Bio/Technology. 12(4):899-903 (1994).

[0220] Further, the antibodies that specifically bind to an antigén can, in turn, be utilized to generate anti-idiotype antibodies that mimic an antigén using techniques well known to those skilled in the art, and anti-anti-idiotype antibodies that bind to the antigén can be prepared there from. See, e.g., Greenspan et al., FASBB J.7(5):437-444 (1993); and Nisonoff, J. Immunoi. 147(8):2429-2438 (1991).

5.11. Recombinant Expression of Antibodies and Polypeptides [0221] Recombinant expression of an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg that preferentially binds cell-associated CA 125/O772P can be accomplished using an expression vector comprising a polynucleotide that encodes the antibody, antigen-binding antibody fragment, fusion polypeptide or analóg disclosed herein. Once a polynucleotide encoding an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg has been obtained, the vector fór the production of the antibody, antigen-binding antibody fragment, fusion polypeptide or analóg may be produced by recombinant DNA technology using techniques well-known in the art. See, e.g., U.S. Patent Nos. 4,816,567, 5,545,405, and 6,331,415.

[0222] Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody, antigen-binding antibody fragment, fusion polypeptide or analóg coding sequences and appropriate transcriptional and translational control signals. These methods include, fór example, in vitro recombinant DNA techniques, synthetic techniques, and in vwogeneticrecombination. The disclosure, therefore, provides replicable vectors comprising a nucleotide sequence encoding an antibody disclosed herein, antigen-binding antibody fragment disclosed , fusion polypeptide or analóg disclosed, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody or a portion thereof, or a heavy or light chain CDR, operably linked to a promoter. Such vectors may alsó include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., EP 216,846, EP 323,997, and U.S. Patent No. 5,122,464), and the variable domain of the antibody may be cloned intő such a vector fór expression of the entire heavy chain, the entire light chain, or both the entire heavy and light chains.

[0223] The expression vector is transferred to a hőst cell by conventional techniques and the transformed or transfected cells are then cultured by conventional techniques, under conditions that are conducive to, or permit, the production of an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg of the disclosure. Included are hőst cells containing a vector or polynucleotide encoding an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg disclosed or fragment thereof, or a heavy or light chain thereof, or portion thereof, or a single chain antibody disclosed, which polynucleotide molecule is operably linked to a heterologous promoter. In preferred embodiments fór the expression of double-chained antibodies, vectors encoding both the heavy and light chains may be co-expressed in the hőst cell fór expression of the entire immunoglobulin molecule, as detailed below.

[0224] Avariety of host-expression vectorsystems may be utilized to express the antibodies, antigen-binding, antibody fragments, fusion polypeptides oranalogs disclosed (see, e.g., U.S. Patent No. 5,807,715). Such host-expression Systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, bút alsó represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express antibodies antigen-binding, antibody fragments, fusion polypeptides or analogs of the disclosure in situ. These include, bút are nőt limited to, microorganisms such as bacteria (e.g., E. coli or B. subtillis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody, antigen-binding antibody fragment, fusion polypeptide or analóg coding sequences; yeast (e.g., Saccharomyces cervisiae, Pichia pastoris, or Pichia maetlanolica) transformed with recombinant yeast expression vectors containing antibody, antigen-binding antibody fragment, fusion polypeptide or analóg coding sequences; insect cell systems transfected with recombinant vírus expression vectors (e.g., baculovirus) containing antibody, antigen-binding antibody fragment, fusion polypeptide or analóg coding sequences; plánt cell systems transfected with recombinant vírus expression vectors (e.g., cauliflower mosaic vírus, CaMV; tobacco mosaic vírus, orTMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody, antigen-binding antibody fragment, fusion polypeptide or analóg coding sequences; or mammalian cell systems (e.g., COS, CRO, BHK, 293, NSO, or 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus laté promoter or the vaccinia vírus 7.5K promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells, especially fór the expression of whole recombinant antibody molecule, are used fór the expression of a recombinant antibody molecule. Fór example, mammalian cells such as Chinese hamster ovary (CRO) cells, in conjunction with a vector such as the major intermediate early gene promoter element from humán cytomegalovirus are an effective expression system fór antibodies (Foecking et al., Gene.

ΕΡ 2 891 666 Β1

45(1):101-105 (1986) and Cockett et al., Bio/Technology. @:662-667 (1990). In a specific embodiment, the expression of nucleotide sequences encoding antibodies, antigen-binding antibody fragments, fusion polypeptides or analogs are regulated by a constitutive promoter, inducible promoter, cell type or tissue specific promoter.

[0225] In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended fór the antibody, antigen-binding antibody fragment, fusion polypeptide or analóg being expressed. Fór example, when a large quantity ofsuch a protein is to be produced, e.g., fór the generation of pharmaceutical compositions of an antibody molecule, vectors which direct the expression of high levels of protein products that are readily purified may be desirable. Such vectors include, bút are nőt limited to, the E. coli expression vector pUR278 (Ruther et al., EMBO J. 2(10):1791-1794 (1983)), in which the antibody coding sequence may be ligated individually intő the vector in frame with the lacZ coding region so that a fusion protein is produced; pIN vectors (Inouye et al., Nucleic Acids Rés. 13(9):3101-3110 (1985); Van Heeke et al., J. Bioi. Chern. 264(10):5503-5509 (1989)); and the like. pGEX vectors may alsó be used to express foreign polypeptides as fusion proteins with glutathione 5-transferase (GST) (Hakes et al., Anal. Biochem. 202(2):293-298 (1992)). In generál, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to mátrix glutathione agarose beadsfollowed by elution in the presence offree glutathione. The pGEX vectors are designed to include thrombin orfactor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.

[0226] In an insect system, Autographa californica nuclear polyhedrosis vírus (AcNPV) is used as a vector to express foreign genes. The vírus grows in Spodoptera frugiperda cells. The antibody coding sequence may be cloned individually intő nonessential regions (fór example, the polyhedrin gene) ofthe vírus and placed under control of an AcNPV promoter (fór example, the polyhedrin promoter). See, e.g., Kumar et al., Biosci. Rep. 19(3):227-234 (1999).

[0227] In mammalian hőst cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the antibody, antigen-binding antibody fragment, fusion polypeptide or analóg coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the laté promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivő recombination. Insertion in a non-essential region ofthe viral genome (e.g., region E1 or E3) will result in a recombinant vírus that is viable and capable of expressing the antibody molecule infected hosts (see, e.g., Logan et al., Proc. Natl. Acad. Sci. USA. 81(12):3655-3659 (1984)). Specific initiation signals may alsó be required fór efficient translation of inserted coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in frame with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see, e.g., Bittér etal., Methods Enzymol. 153:516-544 (1987)).

[0228] In addition, a hőst cell strain which modulates the expression of the inserted sequences, or modifies and processes the gene product in a specific desired fashion may be utilized. Such modifications (e.g., glycosylation) and Processing (e.g., cleavage) of protein products may be im portant fór the function ofthe protein. Different hőst cells have characteristic and specific mechanisms fór the post-translational Processing and modification of proteins and gene products. Appropriate cell lines or hőst systems can be chosen to ensure the correct modification and Processing of the foreign protein expressed. To this end, eukaryotic hőst cells which possess the cellular machinery fór proper Processing ofthe primary transcript, glycosylation, and phosphorylation ofthe gene product may be used. Such mammalian hőst cells include, bút are nőt limited to, CHO, VERŐ, BHK, Hela, COS, MDCK, 293, 3T3, W138, BT483, Hs578T, HTB2, BT20 and T47D, NSO (a murine myeloma cell line that does nőt endogenously produce any immunoglobulin chains), CRL 7030 and HsS78Bst cells.

[0229] Fór long-term, high-yield production of recombinant proteins, stable expression ofthe protein is preferred. Fór example, cell lines which stably express the antibody molecule may be engineered. Ratherthan using expression vectors which contain viral origins of replication, hőst cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter sequences, enhancer sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction ofthe foreign DNA, engineered cells may be allowed to grow fór 1-2 days in an enriched média, and then switched to a selective média. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid intő their chromosomes and grow to form foci which in turn can be cloned and expanded intő cell lines. This method may advantageously be used to engineer cell lines which stably express the antibody molecule.

[0230] A number of selection systems may be used, including bút nőt limited to, the herpes simplex vírus thymidine kinase (Wigler et al., Cell ..11(1):223-232 (1977)), hypoxanthineguanine phosphoribosyltransferase (Spring et al., Biochim. Biophys. Acta. 2118(2):158-162 (1994», and adenine phosphoribosyltransferase (Lowy et al., Cell. 22(3):817-823 (1980)) genes can be employed in tk-, hgprt- or aprt- cells, respectively. Alsó, antimetabolite resistance can be used as the hasis of selection fór the following genes: dhfr, which confers resistance to methotrexate (Wigler et at., Proc. Natl. Acad. Sci. USA. 77(6):3567-3570 (1980); O’Hare et al., Proc. Natl. Acad. Sci. USA. 78(3):1527-1531 (198)); gpt, which confers resistance to mycophenolic acid (Mulligan et al., Proc. Natl. Acad. Sci. USA. 78(4):2072-2076 (1981»; neo,

ΕΡ 2 891 666 Β1 which confers resistance to the aminoglycoside G-418 (Wu et al., Biotherapy. J(1):87-95 (1991); Tolstoshev, Ann. Rév. Pharmacol. Toxicol. 33:573-596 (1993); Mulligan, Science. 260(5110):926-932 (1993); and Morgan et al., Alm. Rév. Biochem. 62:191-217 (1993)); and hygro, which confers resistance to hygromycin (Santerre et al., Gene 300-3):147-156 (1984)). Methods commonly known in the art of recombinant DNA technology may be routinely applied to select the desired recombinant clone, and such methods are described, fór example, in Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley &amp; Sons (1989-2002); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press (1990); Chapters 12 and 13 of Current Protocols in Humán Genetics, Dracopoli et al., eds., John Wiley &amp; Sons (1994); and Colbere-Garapin et al., J. Mól. Bioi. 150(1):1-14(1981).

[0231] The expression levels of an antibody, antigen-binding antibody fragment or fusion polypeptide molecule can be increased by vector amplification (fór a review, see Bebbington etal., The UseofVectors Based on Gene Amplification fór the Expression of Cloned Genes in Mammalian Cells in DNA Cloning, Vol. 3, Academic Press (1987)). When a marker in the vector system expressing antibody is amplifiable, increase in the level of inhibitor present in culture of hőst cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production ofthe antibody will alsó increase (Crouse et al., Mól. Cell. Bioi. 3(2):257-266 (1983)).

[0232] The hőst cell maybe co-transfected with two expression vectors of the disclosure, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should preferably be placed before the heavy chain to avoid an excess oftoxicfree heavy chain (Proudfoot, Natúré. 322(6079):562-565 (1986); and Kohler, Proc. Natl. Acad. Sci. USA. 77(4):2197-2199 (1980)). The coding sequences fór the heavy and light chains may comprise cDNA or genomic DNA, or a combination thereof. [0233] Once an antibody, antigen-binding antibody fragment, fusion polypeptide or analóg ofthe disclosure has been produced by recombinant expression, it may be purified by any method known in the art fór purification of an immunoglobulin molecule, fór example, by chromatography (e.g., ion exchange, affinity, particularly by affinity fór the specific CA 125/O772P antigén after initial Protein A purification, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique fór the purification of proteins. Further, the antibodies or fragments thereof disclosed herein may be fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification.

[0234] The following examples are presented by way of illustration.

6. EXAMPLES [0235] The results provided herein demonstrate that an extracellular portion of CA 125/O772P remains in cell-associated form after a portion of the CA 1251/O772P polypeptide is released as shed CA 125/O772P. In particular, the presence of cell-associated CA 125/O772P is demonstrated via the successful generation and characterization of several antibodies that preferentially bind the cell-associated CA 125/O772P species relatíve to the shed CA 125/O772P species. In addition to preferential binding, the results presented herein deseribe antibodies that exhibit a high degree of specificity fór CA 125/O772P and affinity fór the cell-associated CA 125/O772P antigén. Still further, the results presented herein demonstrate that such antibodies can function to mediate lysis of CA 125/O772P-positive tumor cells.

6.1. Antibody Generation [0236] The experiments provided herein deseribe the generation of monoclonal antibodies against an extracellular portion ofCA125/O772P. As demonstrated insubsequentsubsections, antibodies generated via such techniques include ones that are specific fór CA 125/O772P, preferentially bind cell-associated CA 125/O772P, exhibit a high degree of affinity fór cell-associated CA 125/O772P, and can function to mediate lysis of CA 125/O772P-positive tumor cells.

Antigén and Antigen-Expressing Constructs:

[0237] Expression constructs were generated fór expressing CA 125/O772P antigén fór use in antibody production. The first antigén, designated O772P 3-repeat (FIG. 1; SEQ ID NO:1), to be expressed included the carboxyl-most three tandem repeats ofthe extracellular domain of CA 125//O772P, up to, bút nőt including, the CA 12510772P transmembrane sequence. The second antigén, designated O772P 3-repeat TM (FIG. 2; SEQ ID NO:2), to be expressed included the carboxyl-most three tandem repeats of the extracellular domain of CA 125/O772P as well as the transmembrane and cytoplasmic sequence depicted in FIG. 2. In particular, sequences encoding each ofthe antigens were sub cloned intő pSecTag2B vectors (Invitrogen). The vector encodes an lg kappa signal sequence forsecretion and myc and 6xhis tags fordetection and purification of expressed protein.

EP 2 891 666 Β1

Antigén Expression:

[0238] Recombinant antigén was produced by transiently transfecting suspension CHO-KI cells with the constructs described above. Media used fór the transfection was ProCHO CDM (BioWhittaker mc. Walkersville, MD) with GS supplements (JRH Biosciences Lenexa, KS). To produce a liter of matériái, 2 mg ofthe transfection reagent Clonfection™ (Clontech, Palo Alto, Ca) was rehydrated, diluted intő 24 ml of trans feet ion média and incubated 15 minutes with 125 μg of DNA in the same média. The transfection mixture was added to 450 ml of transfection média containing 1.25 x 10⁹ suspension CHO-K1 cells and incubated 4 hours at 37°C on an orbital shaker. Following the incubation, 500 ml of ProCHO 4-CDM with GS supplements, penicillin-streptomycin and 10% ultra low IgG FBS (Life Technologies Rockville, MD) was added to the transfected cells and the culture was transferred intő roller bottles. Samples were collected on day 3 and cultures were harvested on day 7.

Antigén Purification:

[0239] Transfection supernatant was concentrated to 250 ml using a Millipore Pellicon system with a 50K cut-off membráné. 2 ml Talon resin (Clontech, Palo Alto, CA), obtained from the TALON Purification kit (cat# K1253-1), was transferred to a 2 ml column and was washed with 20 ml 1X wash/extraction buffer (supplied with the kit, pH 7.0). Concentrated sample was then loaded onto the column at a flow rate of 1 ml/min. The column was then washed with 15 ml extraction/wash buffer. Bound protein was then eluted with 4x1 ml elution buffer (50 mM Na Phosphate, 300 mM NaCI, 150 mM imidizole, pH 7.0). One-half ml fractions were collected and analyzed by SDS-P AGE and visualized using Coomassie Brilliant Blue G-250. Fractions containing O772P 3-repeat recombinant protein were further purified by Con-A Sepharose chromatography. One ml Con A Sepharose (Vector Laboratories, Inc., cat# AC-1003, lót# K0425) was transferred to a 15 ml conical centrifuge tűbe and washed with 10 ml 1X phosphate-buffered saline (PBS), pH 7.2. Wash buffer was removed by centrifugation. Fractions from TALON purification containing O772P 3-repeat protein were diluted 1: 1 with 1X PBS, pH 7.2 and added to the washed ConA Sepharose and rotated overnight at 4°C. The resin slurry was then transferred to as ml gravity-flow column and washed with 10 ml 1X PBS, pH 7.2. Samples were eluted with 0.6M methyl a-Dmannopyranoside in 1X PBS, pH 7.2 in 0.5 ml fractions in a totál volume of 6 ml. Fractions were analyzed by SDS-PAGE and visualized using Coomassie Brilliant Blue G-250. Fractions containing pure O772P 3-repeat protein were combined and dialyzed against 2L 1X PBS, pH 7.2 and stored at 4°C.

Immunization:

[0240] BALB/c mice were immunized intraperitoneally (i.p.) on Days 0, 21, 42, and 63. The first injection was with NIH:OVCAR-3 (ATCC HTB-161) cells and subsequent injections were with O772P 3-repeat protein without a transmembrane domain. Complete Freund’s adjuvant was used fór the first protein injection and incomplete Freund’s adjuvant was used fór the remaining injections. Serum was collected on days 35, 56, and 77 and analyzed by ELISA and flow cytometry as described below. Mice with the best serum titers were selected fór cell fusion. On day one and two prior to fusion, the selected mice were boosted with mammalian expressed O772P 3-repeat protein i.p. and intravenously (i.v.). The day before the fusion the mice were boosted i.v.

Hybridoma production:

[0241] The mouse spleen was removed and spleen cells were harvested by mincing with forceps and straining the cells through a sieve. Cells were washed twice in IMDM médium and cell counts were performed. P3X63Ag8.653 mouse myeloma cells (ATCC CRL-1580) in lóg phase growth were harvested, washed twice in IMDM médium and cells were counted. Spleen cells and myeloma cells, were mixed together in a ratio of 5: 1 and centrifuged at 200 x g fór 5 minutes. After aspiration, the pellet was loosened by tapping the bottom ofthe tűbe. One ml of a 50% solution of PEG (m.w. 1450) was added drop by drop over a period of 30 seconds and then the pellet was mixed gently fór 30 seconds using a pipette. The resulting suspension was allowed to stand undisturbed fór another 30 seconds. Five ml of IMDM were added over a period of 90 seconds followed by another 5 ml immediately. The resulting cell suspension was left undisturbed fór 5 minutes. Following centrifugation, the cells were resuspended in HAT médium (IMDM containing 10% FBS, 2 mM Lglutamine, 0.6% 2-mercaptoethanol (0.04% solution), hypoxanthine, aminopterin, thymidine, and 10% ORIGENO Hybridoma Cloning Factor (IGEN International, Gaithersburg, MD)) to a concentration of 5x10⁵ cells per ml and plated at 0.2 ml or 1x10⁵ cells per well intő 96 well plates. Plates were incubated at 37°C in a 7% CO₂ atmosphere with 100% humidity. Seven days after fusion, the média was removed and replaced with IMDM containing 10% FBS, 2 mM Lglutamine, 0.6% 2-mercaptoethanol stock (0.04%), hypoxanthine and thymidine. Ten to fourteen days after fusion, the supernatant was taken from wells with growing hybridoma colonies and tested fór binding to CA 125/O772P as discussed herein.

ΕΡ 2 891 666 Β1

Purification of antibodies from hybridoma supernatants:

[0242] One-half ml protein G resin (Sigma, St. Louis, MO) was packed intő a 5 ml disposable column (Bio-Rad, Hercules, CA). The column was pre-equilibrated with 20 ml binding buffer (20 mM PBS, pH 7.0). The hybridoma supernatant was loaded onto the column at a flow rate less than 0.5 ml/min. The column was then washed with 20 ml binding buffer at a flow rate of 1 ml/min. Alternatively, prepacked Protein G columns were used (Amersham Pharmacia Biotech). The antibody was then eluted with 3 ml elution buffer (0.1 M glycine, pH 2.7). 0.5 ml fractions were collected intő 1 ml tubes containing 50 μΙ 1M Tris, pH 9.0. Samples were dialyzed against PBS (0.5 L) and concentrated to approximately 1 mg/ml protein.

Antibody concentrations in hybridoma supernatants:

[0243] Concentrations of antibody were determined using Easy-Titer Mouse IgG Assay Kit. (Pierce Biotechnology, Rockford, IL). Briefly, Mouse IgG whole molecule standard (Pierce Biotechnology, Rockford, IL) was diluted to 500 ng/ml in dilution buffer (supplied with the kit). This standard was serially diluted 1:2 six times in dilution buffer to generate a standard curve. Twenty μΙ of each standard was added to corresponding wells in a 96-well plate. Dilutions of hybridoma supernatant (20 μΙ) were alsó added to the plate. Duplicate wells were done fór each standard and sample. Twenty μΙ of polystyrene beads (supplied with the kit) were added to each well, the samples were mixed, the plate was sealed, and was incubated on a plate shakerfor 5 minutes at room temperature. 100 μΙ of Blocking reagent from the kit was then added to each well. The plate was again shaken fór 5 minutes at room temperature. The absorbance was then read at 405 nm on a Vmax plate reader (Molecular Devices Corp., Sunnyvale, CA) and a 4 paraméter fit was used to generate the standard curve.

6.2. CA 125/O772P Specificity [0244] The results presented herein demonstrate that antibody production via the techniques described above resulted in generation of antibodies specific fór CA 125/O772P.

ELISA Specificity Assay

Methods:

[0245] Ninety-six well plates were incubated and coated with 100 μΙ (per well) of 1 μg/ml O772P 3-repeat protein (SEQ ID NO:1) (affinity-purified) in bicarbonate buffer (0.2 M Na2CO3/NaHCO₃, pH 9.6, Sigma) overnight at 4°C. On the next day, the plates were washed with 200 μ11 x PBST (Ix phosphate-buffered saline (PBS), 0.05% Tween 20) three times and blocked with 100 μΙ of1 x PBST containing 1 % bovine serum albumin (BSA)for2 hours at 37°C. After washing the plates with 1 x PBST three times, murine anti-CA 125/O772P selected hybridoma-produced antibodies (0.04 mg/ μΙ) were added to the plates (individual wells). After 1 hour incubation at 37°C, the plates were then washed with 1 x PBST three times. Fór signal detection, 100 μΙ of HRP (horseradish peroxidase)-conjugated sheep antimouse IgG (1 :2000 dilution intő 1 x PBST + 1 % BSA; Amersham Biosciences) was added to each well and incubated fór 1 hour at 37°C. The plates were again washed three times with 1x PBST. Finally, 100 μΙ of a mixture of TMB (3, 3’,5, 5’tetramethylbenzidine) substrate and H₂O₂ (1: 1 ratio, KPL Kirkguard Perry Laboratories) was added intő each well and after a 5 minute incubation, the absorbance was measured at 405 nm with a plate reader (Molecular Devices Corp., Sunnyvale, CA). The assay was done in triplicate fór each selected O772P hybridoma-produced antibody and data was collected and analyzed as a kinetic assay, measured over a 5 minute time period. Average values were calculated and presented. Controls fór blank and individual reagents were alsó included in each experiment.

Results:

[0246] Table 7, below, presents the ELISA Specificity Assay results fór four selected anti-CA 125/O772P hybridomaproduced antibodies (117.1, 368.1, 501.1, 776.1). The table alsó shows the ELISA Specificity Assay results fór two commercially available CA 125/O772P antibodies (OC125 and MII, Dako Corp., Carpinteria, CA). An antibody (orantigenbinding antibody fragment) is considered positive in this assay (i.e., is specific fór CA 125/O772P) if it exhibits an absorbance of at least 5 to greater than 30 OD/microgram antibody. These results demonstrate that each ofthe tested antibodies is specific fór CA 125/O772P. It is noted, as demonstrated, below, that, although OC125 and M11 are considered specific fór CA 125/O772P, neither antibody preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P. SD = standard deviation.

ΕΡ 2 891 666 Β1

TABLE 7

<td> Ab name</td><td> absorbance (OD)</td><td> SD</td><td> absorbance (OD)^g</td>

<td> OC 125</td><td> 0.73</td><td> 0.003</td><td> 18</td>

<td> M11</td><td> 0.974</td><td> 0.008</td><td> 24</td>

<td> 117.1</td><td> 0.619</td><td> 0.033</td><td> 15</td>

<td> 368.1</td><td> 1.293</td><td> 0.004</td><td> 32</td>

<td> 501.1</td><td> 0.856</td><td> 0.005</td><td> 21</td>

<td> 776.1</td><td> 1.178</td><td> 0.043</td><td> 29</td>

[0247] The results in Table 8, below, show absorbance data fór twenty additional antibodies generated using the techniques described above. As shown by the absorbance data, each of these antibodies is alsó specific fór CA 125/O772P.

TABLE 8

<td> Ab name</td><td> absorbance (OD)^g Ab</td>

<td> 325.1</td><td> 24</td>

<td> 446.1</td><td> 27</td>

<td> 621.1</td><td> 27</td>

<td> 633.1</td><td> 18</td>

<td> 654.1</td><td> 22</td>

<td> 725.1</td><td> 25</td>

<td> 8G9</td><td> 22</td>

<td> 7F10</td><td> 19</td>

<td> 8A1</td><td> 18</td>

<td> 8C3</td><td> 23</td>

<td> 15C9</td><td> 28</td>

<td> 8E3</td><td> 18</td>

<td> 8B5</td><td> 18</td>

<td> 7G10</td><td> 20</td>

<td> 16C7</td><td> 22</td>

<td> 7C6</td><td> 23</td>

<td> 7H1</td><td> 26</td>

<td> 16H9</td><td> 22</td>

<td> 7A11</td><td> 22</td>

<td> 4E7</td><td> 19</td>

Flow Cytometry Specificity Assay:

Method:

[0248] Cells (OVCAR-3 (ATCC Accession No. HTB-161), SK-OV3 (ATCC Accession No. HTB-77), NIH/3T3 (ATCC Accession No. CRL-1658), and NIH/3T3 cells transfected with a sequence that expresses O772P 3-repeat protein (SEQ ID NO:2)) were removed from culture plates by digestion with trypsin (0.25%). The cells were counted and viability was assessed by trypan blue (0.2%) exclusion. Cells were then centrifuged (500xg, 5 min) and resuspended in FACS buffer

ΕΡ 2 891 666 Β1 (1χ DPBS containing 1 % BSA and 0.1 % sodium azide) to a concentration between 5-10x10⁷ cells/ml. Cells were then distributed at a volume of 100 μΙ/well intő 96-well round bottom plates and centrifuged at 500xg fór 3 minutes. Antibody supernatant was removed by aspiration, and 50μΙ hybridoma supernatants diluted to 1 μg/ml and 0.5 μg/,ul in FACS buffer and was added to each well containing cells. Murine IgG 1 kappa (Sigma, St. Louis, MO) (either 2.0, 1.0, 0.5,0.1 μg/μl) was included as a negative control and OC125 and M11 (DAKO Corp, Carpinteria, CA) were included as positive Controls. Plates were incubated fór 30 minutes at 4°C with rocking. Cells were subsequently washed 2 times with FACS buffer (200 μΙ/well), with centrifugation and buffer aspiration following each wash. Goat anti-mouse IgG (Fc)-biotin (Sigma, St. Louis, MO) was diluted 1: 1 000 in FACS buffer and 50μΙ was added to each well containing cells. Plates were incubated 30 minutes at 4°C with rocking. Cells were then washed with FACS buffer as above. Streptavidin-AlexaFour 488 (Molecular Probes, Eugene, OR) was diluted 1:1000 intő F ÁCS buffer and 50 μΙ was added to each well containing cells. Plates were then incubated 30 minutes at 4°C with washing. Cells were then washed with F ÁCS buffer, as above. Cells were then resuspended in 1 ml of FACS buffer and transferred to Falcon 2052 tubes and analyzed on a Becton-Dickinson Immunocytometry Systems FACSCalibur flow cytometer (San Jose, CA).

Results:

[0249] Table 9, below, presents the Flow Cytometry Specificity Assay results from four selected anti-CA 125/O772P hybridoma-produced antibodies (117.1,368.1,501.1,776.1). The table alsó shows the Flow Cytometry Specificity Assay results fór the commercially available OC125 and M11. The NIH/3T3 cells and the SK-OV3 cells (an ovarian cancer cell line) were considered negative Controls because neither produces CA 125/O772P.

[0250] Antibodies (or antigen-binding antibody fragments) are considered positive (that is, are specific fór CA 125/O772P) if they exhibit a Flow Cytometry Specificity Assay result within the following positive cell ranges: less than about 5% positive NIH/3T3 cells, and at least about 60% positive NIH/3T3 cells producing a SEQ ID NO:2 polypeptide; or less than about 25% positive SK-OV3 cells and at least about 80% positive OVCAR-3 cells. (nd- nőt determined) [0251] These results demonstrate that each of the tested antibodies is specific fór CA 125/O772P. It is noted, as demonstrated, below, that, although OC125 and M11 are considered specific fór CA 125/O772P, neither of these two antibodies preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P.

TABLE 9

<td colspan="5"> Antibody % % positive - NIH/3T3 O772P 3- % positive-NIH/3T3 % positive-OVCAR-3 % positive - SKpositive repeat OV3</td>

<td> OC 125 (1 μθ/ml)</td><td> nd</td><td> nd</td><td> 98</td><td> 16</td>

<td> OC 125 (0.1 μΙ/ml)</td><td> nd</td><td> nd</td><td> 85</td><td> 10</td>

<td> M11 (1 μ9/ιτιΙ)</td><td> 84</td><td> 0.1</td><td> 98</td><td> 17</td>

<td> M11 (0.1 μθ/ml)</td><td> nd</td><td> nd</td><td> 91</td><td> 11</td>

<td> 117.1 (2 μθ/ml)</td><td> 83</td><td> 0.1</td><td> 93</td><td> 6</td>

<td> 117.1 (0.5 μθ/ml)</td><td> 63</td><td> 0</td><td> nd</td><td> nd</td>

<td> 386.1 (0.1 μθ/ml)</td><td> 86</td><td> 0.2</td><td> 89</td><td> 5</td>

<td> 386.1 (2 μθ/ml)</td><td> 75</td><td> 0.2</td><td> nd</td><td> nd</td>

<td> 501.1 (0.5 μθ/ml)</td><td> 89</td><td> 0</td><td> 95</td><td> 5</td>

<td> 501.1 (2 μθ/ml)</td><td> 85</td><td> 0.2</td><td> nd</td><td> nd</td>

<td> 776.1 (0.5 μθ/ml)</td><td> 86</td><td> 0</td><td> 94</td><td> 9</td>

ΕΡ 2 891 666 Β1 (continued)

<td colspan="5"> Antibody % % positive - NIH/3T3 O772P 3- % positive-NIH/3T3 % positive-OVCAR-3 % positive - SKpositive repeat OV3</td>

<td> 776.1 (0.1 μθ/ml)</td><td> 84</td><td> 0</td><td> nd</td><td> nd</td>

[0252] The results provided in Table 10, below, present OVCAR-3/SK-OV3 data tor twenty additional antibodies generated as described above demonstrating that these antibodies, too, are specific tor CA 125/O772P.

TABLE 10

<td colspan="3"> Ab name % positive- OVCAR-3 (0.5 μg/ml) % positive - SK-OV3 (2.0 μg/ml)</td>

<td> 325.1</td><td> 98</td><td> 6</td>

<td> 446.1</td><td> 94</td><td> 5</td>

<td> 621.1</td><td> 97</td><td> 9</td>

<td> 633.1</td><td> 89</td><td> 9</td>

<td> 654.1</td><td> 86</td><td> 8</td>

<td> 725.1</td><td> 96</td><td> 10</td>

<td> 8G9</td><td> 97</td><td> 4</td>

<td> 7F10</td><td> 96</td><td> 3</td>

<td> 8A1</td><td> 97</td><td> 3</td>

<td> 8C3</td><td> 97</td><td> 3</td>

<td> 15C9</td><td> 95</td><td> 3</td>

<td> 8E3</td><td> 95</td><td> 1</td>

<td> 8B5</td><td> 94</td><td> 1</td>

<td> 7G10</td><td> 96</td><td> 2</td>

<td> 16C7</td><td> 96</td><td> 3</td>

<td> 7C6</td><td> 96</td><td> 3</td>

<td> 7H1</td><td> 96</td><td> 0</td>

<td> 16H9</td><td> 96</td><td> 3</td>

<td> 7A11</td><td> 94</td><td> 1</td>

<td> 4E7</td><td> 97</td><td> 2</td>

6.3. Compétition Assays Demonstrate the successful Production of Antibodies that Preferentially Bind CA 125I0772P [0253] The results presented herein demonstrate that antibodies produced via the techniques described above can generate antibodies that preferentially bind cell-associated CA 125/O772P relatíve to shed CA 125/O772P. The fact that such antibodies can be generated alsó demonstrates, tor the first time, that cell-associated CA 125/O772P polypeptides exist, i.e., that an extracellular portion of CA 125/O772P remains in cell-associated form, however transiently, áttér a portion of the CA 125/O772P polypeptide is released as shed CA 125/O772P.

ELISA Compétition Assay:

Method:

[0254] Ninety-six well plates were coated with 100 μΙ (per well) of 1 μg/ml O772P 3- repeat (SEQ ID NO:1) polypeptide

ΕΡ 2 891 666 Β1 (affinity-purified) in bicarbonate buffer (0.2 M Na₂CO₃1 NaHC03, pH 9.6, Sigma) overnightat4 DC. On the nextday, the plates were washed with 200 μΙ X PBST (1 X phosphate buffered saline (PBS), 0.05% Tween 20) three times and blocked with 100 μΙ of 1 X PBST containing 1 % bovine serum albumin (BSA) fór 2 hours at 37°C. After washing with 1 X PBST three times, selected anti-CA 125/O772P hybridoma-produced antibodies at indicated concentrations (e.g., 0.04 μg/ml) were added to wells that had been pre-incubated fór 20-30 minutes with excess amounts (e.g., 10-50 fold w/w) ofshed CA 125/O772P (Fitzgerald Industries International, Concord, MA; Scripps Laboratories, La Jolla, CA; and/or United States Biological Corp.). After 1 hour incubation at 37 DC, the plates were then washed with 1 X PBST three times. Fór signal detection, 100 μΙ of HRP conjugated sheep anti-mouse IgG (1:2000 dilution intő 1 X PBST + 1 % BSA, Amersham Biosciences) was added to each well and incubated fór 1 hour at 37°C. The plates were washed again with 1 X PBST three times. Finally, 100 μΙ of a mixture of TMB substrate and H₂O₂ (1: 1 ratio, KPL) was added intő each well and the absorbance was measured at 405 nm with a plate reader (Molecular Devices Corp., Sunnyvale, CA). The assay was done in triplicate fór each selected antibody and average values were calculated and presented. The percent inhibition compared to no competition was calculated fór individual antibodies based on average values. Controls fór blank and individual reagents were alsó included in each experiment.

Results:

[0255] Table 11, below, presentsthe ELISACompetition Assay results forfourselected anti-CA 125/O772P hybridomaproduced antibodies (117.1, 368.1, 501.1, 776.1). The table alsó shows the ELISA Competition Assay results fór the commercially available CA 125/O772P antibody (OC125; DAKO Corp., Carpenteria, CA). An antibody (or antigen-binding antibody fragment) is considered positive in this assay (that is, preferentially binds cell-associated CA 125/O772P if it exhibits less than about 25% inhibition of binding at25-fold (w/w) excess shed CA 125/O772P. These results demonstrate that each of antibodies 117.1,368.1,501.5 and 776.1 preferentially binds cell-associated CA 125/O772P. These results alsó demonstrate that OC125 antibodyfails to preferentially bind cell-associated CA 125/O772P. (SD-standard deviation)

ΕΡ 2 891 666 Β1

LLI ι

ω &lt;

Η

<td> Μ-» C φ ο φ ο.</td><td> inbibition of binding</td><td> 66</td><td> 94</td><td> 30</td><td> 96</td><td> 96</td>

<td></td><td></td><td> CM</td><td></td><td> (0</td><td> CM</td><td></td>

<td> ο</td><td></td><td> O</td><td> ©</td><td></td><td> ©</td><td> ©</td>

<td rowspan="2"> (0</td><td></td><td> o</td><td> ©</td><td> ©</td><td> ©</td><td> ©</td>

<td></td><td> ó</td><td> ó</td><td> Ó</td><td> ó</td><td> ó</td>

<td></td><td> §</td><td></td><td></td><td></td><td></td><td></td>

<td> C9</td><td> §</td><td></td><td></td><td></td><td></td><td></td>

<td> 0_</td><td> χ</td><td></td><td></td><td></td><td></td><td></td>

<td> CM</td><td> ο</td><td></td><td></td><td></td><td></td><td></td>

<td> l·-</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> l·-</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> ο</td><td> ι_</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td rowspan="3"> ►etitc cess</td><td></td><td></td><td> 10</td><td> 10</td><td> r-</td>

<td> &gt;</td><td></td><td></td><td></td><td> (0</td><td> r-</td>

<td> φ</td><td> ©</td><td> ©</td><td> σ&gt;</td><td> ©</td><td> ©</td>

<td> ο</td><td> “ χ</td><td> ó</td><td> ó</td><td> ó</td><td> Ó</td><td> ó</td>

<td> C</td><td> Ε ω</td><td></td><td></td><td></td><td></td><td></td>

<td> φ</td><td> ο</td><td></td><td></td><td></td><td></td><td></td>

<td> Λ</td><td> ο</td><td></td><td></td><td></td><td></td><td></td>

<td> ο ω Δ Φ</td><td> epeat</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> ο</td><td></td><td></td><td></td><td></td><td></td>

<td> Μ-» C φ ο</td><td> tion ding</td><td> 10</td><td></td><td> ©</td><td> 10</td><td></td>

<td> φ ο.</td><td> hibi bim</td><td> 0)</td><td></td><td></td><td></td><td></td>

<td></td><td> c</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td></td><td> O)</td><td> 00</td><td></td>

<td> ο</td><td></td><td> ©</td><td> ©</td><td> ©</td><td> ©</td><td></td>

<td> (0</td><td></td><td> © ó</td><td> © ó</td><td> © ó</td><td> © ó</td><td> ó</td>

<td></td><td> σ</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> ο</td><td></td><td></td><td></td><td></td><td></td>

<td> &lt;</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> ο</td><td> 10 CM</td><td></td><td></td><td></td><td></td><td></td>

<td> D</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Φ £</td><td> ° ΊΓ</td><td></td><td></td><td></td><td></td><td></td>

<td> (Λ</td><td> ω</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> φ φ</td><td></td><td></td><td> co</td><td> 10</td><td> r-</td>

<td> &gt;</td><td> a- 8</td><td></td><td> 10</td><td> co</td><td> co</td><td> r-</td>

<td> Φ</td><td> c x</td><td> ©</td><td> 10</td><td> co</td><td> r-</td><td> O)</td>

<td> Ο</td><td> o</td><td> ó</td><td> ó</td><td></td><td> ó</td><td> ó</td>

<td> C</td><td> o §</td><td></td><td></td><td></td><td></td><td></td>

<td> φ</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Δ</td><td> Q- 5</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> CM</td><td></td><td></td><td></td><td></td><td></td>

<td> Ο</td><td> r-</td><td></td><td></td><td></td><td></td><td></td>

<td> ω</td><td> r-</td><td></td><td></td><td></td><td></td><td></td>

<td> Δ</td><td> o</td><td></td><td></td><td></td><td></td><td></td>

<td rowspan="2"> Φ</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> 10</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> CM</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td> co</td><td> co</td><td></td><td> 10</td><td> co</td>

<td> ο</td><td></td><td> ©</td><td> co</td><td> ©</td><td> ©</td><td></td>

<td rowspan="2"> (0</td><td></td><td> ©</td><td> ©</td><td> ©</td><td> ©</td><td> ©</td>

<td></td><td> ó</td><td> ó</td><td> ó</td><td> ó</td><td> ó</td>

<td> φ</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> ο</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> φ</td><td></td><td rowspan="2"> co</td><td> O)</td><td> co</td><td> (0</td><td> 00</td>

<td></td><td></td><td></td><td> O)</td><td> 10</td><td> r-</td>

<td></td><td></td><td></td><td> (0</td><td> CM</td><td> 00</td><td></td>

<td> ο</td><td></td><td> ó</td><td> ó</td><td></td><td> Ó</td><td></td>

<td> Δ</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Φ</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> &gt; D</td><td></td><td> 10 CM</td><td></td><td></td><td></td><td></td>

<td> Δ</td><td></td><td></td><td></td><td> 00</td><td></td><td> (0</td>

<td></td><td></td><td rowspan="2"> o o</td><td></td><td> (0</td><td> ©</td><td> r-</td>

<td> C</td><td></td><td></td><td> co</td><td> 10</td><td> r-</td>

<td> Φ</td><td></td><td></td><td></td><td></td><td></td><td></td>

ΕΡ 2 891 666 Β1 [0256] The results presented in Table 12, below, present CA 125/O772P competitor data fór twenty additional antibodies generated via the techniques described above demonstrating that these antibodies, too, represent antibodies that preferentially bind cell-associated CA 125/O772P.

TABLE 12

<td> Ab name</td><td> % inh. binding w/shed CA 125/0772 competitor (25-fold excess))</td>

<td> 325.1</td><td> 2</td>

<td> 446.1</td><td> 7</td>

<td> 621.1</td><td> 2</td>

<td> 633.1</td><td> 7</td>

<td> 654.1</td><td> 9</td>

<td> 725.1</td><td> 7</td>

<td> 8G9</td><td> 7</td>

<td> 7F10</td><td> 6</td>

<td> 8A1</td><td> 8</td>

<td> 8C3</td><td> 5</td>

<td> 15C9</td><td> 5</td>

<td> 8E3</td><td> 4</td>

<td> 8B5</td><td> 6</td>

<td> 7G10</td><td> 3</td>

<td> 16C7</td><td> 3</td>

<td> 7C6</td><td> 2</td>

<td> 7H1</td><td> 4</td>

<td> 16H9</td><td> 0</td>

<td> 7A11</td><td> 5</td>

<td> 4E7</td><td> 7</td>

Flow Cytometry Competition Assay:

Method:

[0257] NIH:OVCAR-3 (ATCC Accession No. HTB-161) cells were removed from culture plates by digestion with trypsin (0.25%). Cells were then counted and viability was assessed by trypan blue (0.2%) exclusion. Cells were then centrifuged (500xg, 5 min) and resuspended in FACS buffer (1 X DPBS containing 1 % BSA and 0.1 % sodium azide) to a concentration between 5-10x10⁷ cells/ml. Cells were then distributed (ΙΟΟμΙ/well) intő 96- well round bottom plates and centrifuged 500xg fór 3 minutes. Supernatants were removed by aspiration. Hybridoma supernatants were diluted to 0.2 μg/ml of antibody in FACS buffer. CA 125 (Fizgerald Industries International, Concord, MA) wasdiluted to 1000 μg/ml, 500 μg/ml, 200 μg/ml, 60 μg/ml, 20 μg/ml, 6 μg/ml, or2 μg/ml in FACS buffer. Thirty μΙ antibody solution was incubated with 30 μΙ diluted CA 125 or buffer alone fór 30 minutes at 4°C. 50 μΙ ofthe mixture was added to each well containing cells. Murine IgG 1 kappa (Sigma, St. Louis MO) and M11 (DAKO Corp, Carpinteria, CA) were included as negative and positive Controls, respectively. Plates were incubated fór 30 minutes at 4°C with rocking. Cells were subsequently washed 2 times with FACS buffer (200 μΙ/well), with centrifugation and aspiration of buffer following each wash. Goat anti-mouse IgG (Fc)-biotin (Sigma, St. Louis, MO) was diluted 1: 1000 in FACS buffer and 50 μΙ was added to each well containing cells. Plates were incubated 30 min at4°C with rocking. Cells were then washed with F ÁCS buffer as above. StreptavidinAlexa-Four 488 (Molecular Probes, Eugene, OR) was diluted 1: 1000 intő FACS buffer and 50 μΙ was added to each well containing cells. Plates were then incubated 30 minutes at 4°C with washing. Cells were then washed with FACS buffer, as above. Cells were then resuspended in 1 ml of FACS buffer and transferred to Falcon 2052 tubes and analyzed on a Becton-Dickinson Immunocytometry Systems F ACSCaliburflow cytometer (San Jose, CA). Percent positive cells

ΕΡ 2 891 666 Β1 was plotted as a function of CA 125/O772P concentration using GraphPad plotting software. IC₅₀ determinations, expressed as the concentration of shed CA 125/O772P at which 50 % inhibition of binding is seen, were made using a linear regression analysis.

Results:

[0258] FIG. 3 shows a representative plot of shed CA 125/O772P concentration versus percent positive cells fór, in this instance, 117.1 antibody and M11 antibody control (squares). [0288] Table 13, below, presents a summary of Flow Cytometry Competition Assay results. An antibody (or antigen-binding antibody fragment) is considered positive (that is, is considered to preferentially bind cell-associated CA 125/O772P if it exhibits an IC₅₀, as measured by percentpositive cells, of at least about 0.05 mg/ml shed CA 125/O772P.

[0259] The results shown in Table 13, below, demonstrate that each of 117.1,501.1,776.1,8C3, 16H9, 325.1,633.1 and 725.1 antibodies preferentially binds cell-associated CA 125/O772P. It is noted that the results in Table 13 alsó demonstrate that the OC125 and M11 antibodies do nőt preferentially bind cell-associated CA 125/O772P.

TABLE 13

<td> antibody</td><td> IC₅₀ (mg/ml CA 125) function of% positive cells</td>

<td> OC 125</td><td> 0.005</td>

<td> M11</td><td> 0.01</td>

<td> 117.1</td><td> &gt;1.0</td>

<td> 368.1</td><td> nd</td>

<td> 501.1</td><td> 0.13</td>

<td> 776.1</td><td> 0.19</td>

<td> 8C3</td><td> &gt;0.5</td>

<td> 16H9</td><td> &gt;0.5</td>

<td> 325.1</td><td> 0.36</td>

<td> 621.1</td><td> &gt;0.5</td>

<td> 633.1</td><td> 0.18</td>

<td> 725.1</td><td> 0.42</td>

<td> 446.1</td><td> nd</td>

<td> 654.1</td><td> nd</td>

<td> 8G9</td><td> nd</td>

<td> 7F10</td><td> nd</td>

<td> 8A1</td><td> nd</td>

<td> 15C9</td><td> nd</td>

<td> 8E3</td><td> nd</td>

<td> 8B5</td><td> nd</td>

<td> 7G10</td><td> nd</td>

<td> 16C7</td><td> nd</td>

<td> 7C6</td><td> nd</td>

<td> 7H1</td><td> nd</td>

<td> 7A11</td><td> nd</td>

6.4. Affinity [0260] The results presented herein demonstrate that among the antibodies generated that preferentially bind CA

ΕΡ 2 891 666 Β1

125/Ο772Ρ, are antibodies that exhibit a high degree of affinity fór cell-associated CA 125/O772P

BIAcore Affinity Assay: Methods:

[0261] A GM5 BIAcore biosensor chip was docked intő the BIAcore X instrument and activated with 55 μΙ of 1: 1 NHS/EDC at room temperature. O772P 3-repeat region protein and BSA at 10 μg/ml in 0.05 M acetate buffer, pH 4.5, were immobilized onto the flow cell (FC) 1 and FC2 ofthe activated chip, respectively, at aflow rate of 5 μΙ/min to achieve a resonance response of 1000-2000 RD. The chip was then blocked by injection of 55 μΙ of ethanolamine-HCI, pH 8.5, and followed with washing 5 times with 50 mM NaOH-l M NaCI. To measure the binding of anti-O722P mAbs to the O772P 3-repeat region immobilized to the chip, 30 μΙ of anti-O722P mAbs at varying concentrations in BIAcore running buffer (HBS-EP, Cat. #1001-080, BIAcore, Piscataway, NJ) were injected over the sensor surface at a flow rate of 5 μΙ/min. Following completion of the injection phase, dissociation was monitored in BIAcore running buffer at the same flow rate fór 360 seconds. The surface was regenerated between injections using 30 μΙ of 50 mM NaOH-1 M NaCI. Individual sensorgrams were analyzed using BIAevaluation.

BIAcore Affinity Assay: Results:

[0262] Table 14, below, presents a summary of BIAcore Affinity Assay results fór 117.1,368.1,501.1 and 776.1 antibodies, as well as fór M11 and OC125 antibodies. As shown in the table, each of antibodies 117.1,368.1,501.1, 776.1, 4E7, 7C6, 7F10, 7G10, 7H1, 8A1, 8B5, 8C3, 8E3, 15C9, 16C7, 16H9, 325.1, 621.1, 633.1 and 725.1 bind with high affinity to CA 125/O772P polypeptide.

TABLE 14

<td> antibody</td><td> K_d(nM)</td>

<td> M11</td><td> 1.6</td>

<td> OC125</td><td> 4</td>

<td> 117.1</td><td> 12</td>

<td> 368.1</td><td> 0.7</td>

<td> 501.1</td><td> 70</td>

<td> 776.1</td><td> 0.4</td>

<td> 4E7</td><td> 30</td>

<td> 7A11</td><td> nd</td>

<td> 7C6</td><td> 73</td>

<td> 7F10</td><td> 3.7</td>

<td> 7G10</td><td> 47</td>

<td> 7H1</td><td> 69</td>

<td> 8A1</td><td> 2.8</td>

<td> 8B5</td><td> 32</td>

<td> 8C3</td><td> 5.0</td>

<td> 8E3</td><td> 33</td>

<td> 8G9</td><td> 14</td>

<td> 15C9</td><td> 14</td>

<td> 16C7</td><td> 44</td>

<td> 16H9</td><td> 3.9</td>

<td> 325.1</td><td> 15</td>

<td> 446.1</td><td> nd</td>

<td> 621.1</td><td> 40</td>

ΕΡ 2 891 666 Β1 (continued)

<td> antibody</td><td> K_d(nM)</td>

<td> 633.1</td><td> 26</td>

<td> 654.1</td><td> 190</td>

<td> 725.1</td><td> 2.6</td>

6.5. Functional Assays:

[0263] The results presented herein demonstrate that among the antibodies generated that preferentially bind cellassociated CA 125/O772P are antibodies that can function to mediate lysis of CA 125/O772P-positive tumor cells.

ADCCAssay:

Method:

[0264] Humán leukocytes were isolated from peripheral blood of normál donors by a Histopaque-1077 gradient centrifugádon procedure (Sigma Co., St. Louis, MO) and used as effector cells. In U-bottom, 96-well plates, OVCAR-3 target cells (5 X 10³ /well) were mixed with Histopaque-purified humán leukocytes at effector-to-target (E/T) ratios of 12.5: 1 to 50: 1 in the absence or presence of varying concentrations of monoclonal antibodies in a totál volume of 120 μΙ of RPMI 1640 supplemented with 10% FBS. The plates were incubated at 37°C in a humidified 5% CO₂ atmosphere. Target cells and effector cells without the testing antibody were used as negative Controls. Following 16 -18 hr. incubation, 50 μΙ aliquots of culture supernatant were collected and assayed fór lactate dehydrogenase activity in flat-bottom, 96well plates using the Cytotox 96 Non-radioactive Cytotoxicity Assay Kit (Promega Co., Madison, Wl) according to manufacturer’s instructions. Percent lysis of tumor cells was calculated as follows: % Cytotoxicity = (experimental release effector spontaneous release - target spontaneous release )/(target maximum release - target spontaneous release) x 100. The results were expressed as mean percentage lysis ± S.D. of replicate samples.

Results:

[0265] FIG. 4 shows a representative plot of percent lysis versus antibody concentration fór 117.1 antibody (average of 4 separate donors). As shown in the figure, 117.1 antibody mediates lysis of OVCAR-3 ovarian cancer cells in a dosedependent manner

CDC Assay:

[0266] In U-bottom, 96-well plates, OVCAR-3 target cells (2x104/well) are mixed with humán orguinea pig complement diluted 15:1,20:1,25:1 in the absence or presence of varying concentrations of antibody in a totál volume of 120 μΙ of RPMI 1640 supplemented with 10% PBS. The plates are incubated at 37°C in a humidified 5% CO₂ atmosphere. Target cells without antibody are used as negative Controls. Following 4 hr. incubation, 50 μΙ aliquots of culture supernatant are collected and assayed fór lactate deyhdrogenase activity in flat-bottom, 96-well plates using the Cytotox 96 Nonradioactive Cytotoxicity Assay Kit (promega Co., Madison, Wl) according to the manufacturer’s instructions. Percentage lysis of tumor cells is calculated as follows: % Cytotoxicity = (experimental release-effector spontaneous release - target spontaneous release)/(target maximum release - target spontaneous release) x 100. Results are expressed as mean percentage lysis ± S.D. of replicate samples.

6.6. Sequences of Antibodies that Preferentially Bind Cell-Associated CA 125/O772P [0267] The results presented herein provide the amino acid and nucleotide sequences fór the variable regions of six ofthe monoclonal antibodies described herein: 117.1,368.1,501.1,776.1,725.1 and 16H9, including CDR sequences.

Methods:

[0268] Hybridoma cells were harvested and pelleted at 1800 rpm fór 10 minutes at 4°C. One ml of TRIzol (Invitrogen) was added per 107 cells and totál RNA was processed. Two hundred μΙ of chloroform per 1 ml of TRIzol Reagentwas added, shaken vigorously by hand fór 15 sec. and centrifuged at 12,000 x g fór 15 minutes at 4°C. The aqueous phase

ΕΡ 2 891 666 Β1 containing the RNA was transferred to a fresh tűbe and precipitated by adding 500 μΙ of isopropyl alcohol per 1 ml of TRIzol Reagent used fór the initial homogenization. The RNA pellet was washed once with 70% EtOH and briefly airdried before being resuspended in DEPC water. Three f-tg of totál RNA were treated with 10 units of calf intestinal phosphatase (CIP) fór 1 hour at 50° C to remove the 5’ phosphates. This step eliminated truncated mRNA and nonmRNA from subsequent steps. Dephosphorylated RNA was treated with 0.5 units of tobacco acid pyrophosphatase (TÁP) fór 1 hour at 37° C to remove the 5’ cap structure from intact, full length mRNA. The GeneRacer RNA Oligo (5’CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA-3’; SEQ ID NO:43) was ligated to the 5’ end of the mRNA using 5 units ofT4 RNA Ligásé fór 1 hour at 37° C. The ligated mRNA was reverse-transcribed using 5 units of AMV-Reverse Transcriptase and the GeneRacer Oligo dT Primer (5’GCTGTCAACGATACGCTACGTAACGGCATGACAGTG( T)₁₈-3’; SEQ ID NO:44) fór 1 hour at 42° C to create cDNA with known priming sites at the 5’and 3’ ends. The 5’ ends were amplified using a gene-specific 3’ primer located in the constant region ofthe desired gene (heavy chain 5’ -AYCTCCACACACAGGRRCCAGTGGATAGAC (SEQ ID NO:45), light chain 5’-GGATACAGTTGGTGCAGCATC-3’ (SEQ ID NO:46)) and the GeneRacer 5’ Primer homologous to the GeneRacer RNA Oligo (5’CGACTGGAGCACGAGGACACTGA-3’; SEQ ID NO:47). The PCR reaction was carried out using 2 f.ll of cDNA by denaturing the template at 94° C fór 5 min. and then denaturing at 94° C fór 30 sec., annealing at 55° C fór 30 sec., elongating at 72° C fór 1 minute fór 30 cycles and elongating fór a final cycle at 72° C fór 7 min. on a GeneAmp 9700 PCR System. Bands of interest were gél purified using the Qiagen Gél Purification Kit and cloned using the TOPO-4 Cloning Kit (Invitrogen). Resultant isolated colonies were screened by PCR fór insert ofthe correct size in a GeneAmp 9700 machine. PCR was performed by lysing the bacteria at 94° C fór 8 min, then denaturing at 94° C fór 30 sec., annealing at 55° C fór 30 sec., elongating at 72° C fór 1-4 minutes fór 25 cycles and elongating fór a final cycle at 72° C fór 7 min. Primers used fór screening were: sense, 5’-ATTAACCCTCACTAAAGGGA-3’ (SEQ ID NO:48) or 5’-TAATACGACTCACTATAGGG-3’ (SEQ ID NO:49), antisense heavy or light chain constant region primers (see above). Positive clones were grown in a 4 ml overnight culture to amplify the clone and a SNAP Miniprep (Invitrogen) was performed. Clones were then sequenced using the BigDye (Perkin Elmer) chemistry in a GeneAmp 9700 PCR System fór 25 cycles by denaturing the DNAfor 10 sec. at94° C, annealing the primer (5’-ATTAACCCTCACTAAAGGGA3’ (SEQ ID NO:50) or 5’TAATACGACTCACTATAGGG- 3’ (SEQ ID NO:51)) at 50° Cfór 5 sec. and elongating the primer fór 4 min. at 72° C. The reactions were then passed over a DyeEx Column (Qiagen) and sequenced on an Applied Biosystems 310 automated DNA sequencer.

Results:

[0269] Nucleic acid sequences that encode the variable regions of six monoclonal antibodies that preferentially bind cell-associated CA 125/O772P were obtained and are depicted in FIGS 5-10. In particular, FIGS. 5A, 6A, 7A, 8A, 9A and 10A depict the nucleotide sequences that encode the variable light chain regions of monoclonal antibodies 117.1, 368.1, 501.1, 776.1, 725.1 and 16H9, respectively, while FIGS. 5B, 6B, 7B, 8B, 9B and 10B depict the nucleotide sequences that encode the variable heavy chain regions of monoclonal antibodies 117.1,368.1,501.1,776.1,725.1 and 16H9, respectively. The nucleotide sequences that encode leader sequences are double underlined, and the nucleotide sequences that encode CDR sequences are underlined.

[0270] Amino acid sequences ofthe variable regions of six monoclonal antibodies that preferentially bind cell-associated CA 125/O772P were obtained and are depicted in FIGS. 5-10. In particular, FIGS. 5C, 6C, 7C, 8C, 9C and 10C depict the amino acid sequences ofthe variable light chain regions of monoclonal antibodies 117.1,368.1,501.1,776.1,

725.1 and 16H9, respectively, while FIGS. 5D, 6D, 7D, 8D, 9D and 10D depict the amino acid sequences of variable heavy chain regions of monoclonal antibodies 117.1, 368.1, 501.1, 776.1, 72S.1 and 16H9, respectively. Leader sequences are double underlined, and CDR sequences are underlined. It is noted that the leader sequences do nőt become part of the mature antibodies, and, as such, are nőt considered a part of the variable regions of the antibodies.

6.7. Western Biot Analysis of OVCAR-3 Supernatents [0271] The working example presented herein provides a western biot analysis designed to test directly the ability of antibodies 368.1 or 776.1 to bind shed CA 125/O772P. The data presented herein directly demonstrates that neither the 368.1 northe 776.1 antibody recognize the high molecular weight species corresponding to shed CA 125/O772P. In contrast, antibodies OC 125 and M11 did recognize this high molecular weight species, while all ofthe antibodies tested bind strongly to the control 3-repeat-containing recombinant O772P polypeptide. Thus, these data provide additional confirmation that the 368.1 and the 776.1 antibodies preferentially bind cell-associated CA 125/O772P polypeptide.

Methods:

[0272] Media (RPMI supplemented with 10% fetal bovine serum) from cultured OVCAR-3 cells was removed and

ΕΡ 2 891 666 Β1 replaced with fresh supplemented média. Aliquots of conditioned média were removed at 1 hour, 6 hours, 24 hours, 48 hours and 72 hours. Supplemented média was used as the time 0 point.

[0273] A 4-12% Bis-Tris (Invitrogen) gél was loaded with 10 μΙ of conditioned média from each time point and separated by electrophoresis fór 45 minutes at 200 volts. Purified O772P 3-repeat polypeptide was loaded as a positive control at 100 ng, 10 ng and 1.0 ng.

[0274] Proteins were transferred to a nitrocellulose membráné fór one hour at 30 volts and then blocked overnight in non-fat milk at4°C. Primary antibodies were broughtto 400 μg/ml in PBS and then diluted 1:1000 in non-fat milk (OC125 Dako #M3519, M11 Dako #M3520). The blots were washed in PBS/Tween three times fór 10 min. The secondary antibody (anti -mouse IgG F c-specific, Sigma #B-7 410) was diluted 1: 1000 in non-fat milk and incubated fór 1 hour at room temperature. Washes were performed as above. NeutraAvidin-HRP (Molecular Probes #A-2664) was diluted 1:1000 in PBS/Tween and incubated at room temperature fór 15 minutes. The blots were washed in a large volume of PBS-Tween and visualized by chemiluminescence (30 sec. exposure).

Results:

[0275] To determine if 368.1 or 776.1 antibody binds to shed CA 125/O772P polypeptide, a western biot analysis was performed on the supernatant of cultured OVCAR-3 cells, which are known to shed CA 125/O772P from their surface. Such an analysis tests the antibodies’ ability to bind shed CA 125/O772P directly.

[0276] As shown in FIG. 11, the results of the western analysis demonstrate that neither the 368.1 nor the 776.1 antibody recognize the high molecularweight species that corresponds to shed CA 125/O772P. In contrast, antibodies M11 and OC 125, that is, antibodies that do nőt preferentially bind cell-associated CA 125/O772P, did recognize this high molecular weight species. All four of the antibodies tested bind strongly to the control 3-repeat-containing recombinant O772P polypeptide, O772P 3-repeat, which contains extracellular domain sequences that are immediately adjacent to the CA 125/O772P transmembrane domain. Thus, these data provide additional confirmation that the 368.1 and the 776.1 antibodies preferentially bind cell-associated CA 125/O772P polypeptide.

6.8. Radiolabeled 776.1 Antibody Slows Tumor Growth [0277] The results presented herein demonstrate that radiolabeled 776.1 antibody successfully slows tumor growth in an animal model fór humán ovarian cancer.

Methods:

Animals [0278] Female NCr nu/nu (nude) mice (Taconic Farms, Germantown, N.Y.) 6-7 weeks old were used fór all studies. All animals were given food and water ad libitum.

Tumor Cell Implantation [0279] Fór efficacy studies, the OVCAR-3 humán ovarian carcinoma cell line was used fór the model of humán ovarian cancer. The OVCAR-3 cell line (Hamilton, et al., Cancer Rés. 43:5379-5389 (1983)); was derived from an ovarian adenocarcinoma of humán origin and was purchased from ATCC (Catalog # HTB-161). OVCAR-3 cells were maintained in RPMI-1640 supplemented with 10% FBS at 37°C in 5% CO2. OVCAR-3 expresses the tumor-associated CA 125/O772P on the cell surface. OVCAR-3 xenografts were subcutaneously implanted and grown as ectopic tumors in immune-deficient NCr nude. mice. The major criterion forsubcutaneous OVCAR-3 tumor growth was to achieve 150-250 mm³ tumors by two weeks post implantation, at which time experimental therapy would begin.

[0280] In order to facilitate subcutaneous tumor formation, the OVCAR-3 line was serially propagated in vivő within the peritoneal cavities of NCr nu/nu mice (Burbridge etal., Int. J. Oncol.li: 1155-1162 (1999); Guichard et al., Clin. Cancer Rés. 2: 3222-3228 (2001)). Prior to subcutaneous implantation, 10 x 106 in vitro cultured OVCAR-3 cells (passage 32) in 0.9% saline were injected i.p. intő NCr nu/nu mice (passage 1). Seven weeks later tumor cells were harvested by peritoneal lavage and 5 x 10⁶ cells were injected intő a new set of recipients (passage 2). Four weeks later the cells were harvested by peritoneal lavage and passaged once more and 5 x 106 cells were injected intő a new set of recipients (passage 3). After three weeks passage 3 cells were harvested and assayed fór CA 125/O772P expression and viability. [0281] Fór the rádió immunotherapeutic studies, passage 3 cells were implanted fór subcutaneous tumor growth. Passage 3 cells were routinely&gt; 95% viable and retained high levels of CA 125/O772P expression as confirmed byflow cytometry. Fór ectopic, solid tumor growth, cells were resuspended to a final concentration of 15 x 10⁶ cells/ml in a mixture of Matrigel (Matrigel, BD Biosciences: Lót #005002, 14.6mg/mL) and 0.9% saline with the final Matrigel con49

ΕΡ 2 891 666 Β1 centration being 7.3mg/mL. Mice were injected with 0.2 ml volume ofthe cell suspension fór a final dose of 3 x 10⁶ cells. The cell suspensions were injected subcutaneously on the ventral sídé ofthe abdominal area using a 23-gauge needle. The injection site was rendered aseptic by swabbing with sterilé gauze in 70% ethanol. Approximately 10 days postimplantation palpable tumors were measured with electronic calipers (Fowler Instruments) across two perpendicular dimensions. Mice were sorted intő groups of 10 based on tumor volume. Fór all groups within a study, there were no significant differences between mean tumor volumes. Tumor measurements and observation were recorded twice a week. Tumor volume was calculated using the standard formula (Length x Width²) x 0.5.

Coupling of 776.1 to ¹³¹lodine [0282] Murine lgG1 776.1 was iodinated at Perkin-Elmer by the modified IODO-GEN method (Visser et al., J. Nucl. Med. 42: 509-519 (2001)) which is an efficient means of coupling high doses of 1311 to a monoclonal antibody while minimizing both Chemical and radiation induced damage. Ten microliters of a 1.41 mg/ml solution of ascorbic acid pH 5.0 was added to 10 mCi of ¹³¹l and the mixture was incubated fór one minute. This was followed by the addition of 100 μΙ 0.5M phosphate pH 7.4. 0.5 mg of 776.1 mAb was then added (calculated using the antibody concentration to establish the volume required). This was followed by the addition of 35 μΙ of a 1 mg/ml solution of IODO-GEN in acetonitrile. After a 3 minute incubation, 100 μΙ of a solution of ascorbic acid (25 mg/ml, pH 5.0) was added. After another 5 minutes, 100 μΙ of 0.1 % murine serum albumén (MSA) in 50 mM PBS was added. After another 4 minute incubation,¹³¹1 incorporation was analyzed by instant thin layer chromatography (ITLC) in normál saline. Unincorporated iodine was removed by separation using Sephadex G-25 chromatography with pre-packed NAP-10 columns (Amersham-Pharmacia) with PBS containing 0.1 % MSA as buffer. All procedures were performed at room temperature. Purified mAb was analyzed fór free iodine content again by ITLC, and was considered suitable if free iodine was &lt;5% ofthe totál iodine present.

Immunoreactivity of radiolabeled 776.1 by ELISA [0283] The immunoreactivity of rádió labeled 776.1 was determined by ELISA assay. Immunion 4 (Dynatech) 96 well plates were coated with 100 μΙ per well of O772P 3-repeat with a hemagglutinin (HA) tag (affinity-purified) at 1 μg/ml in DPBS overnight at 4°C. The next day, the plates were blocked with 200 μΙ per well of blocking buffer (1X PBS with 1 % BSA) fór 1 hour at room temperature. Unlabeled and radiolabeled 776.1 were diluted to 3μg/ml in blocking buffer and added to the first row of the blocked plate in triplicate at 150μΙ. per well; 100μΙ of blocking buffer was added to the remaining wells. Antibodies were then serially diluted threefold fór a totál of 7 dilutions. The plate was incubated fór 1 hour at room temperature followed by three washes with DPBS containing 0.05% Tween-20 (pBST; 200μΙ per well). Fór signal detection, 100μΙ of HRP-conjugated goat anti-mouse IgG (Amersham Biosciences Piscataway, NJ), diluted 1 :2000, was added to each well and incubated fór 1 hour at room temperature. The plates were washed three times with PBST and the HRP conjugate was detected by adding a mixture of TMB (KPL) substrate and H₂O₂(1: 1 ratio; 100 μΙ/well). Plates were incubated fór 10 minutes and the absorbance was measured at 650nm using a plate reader (Molecular Devices). Immunoreactivity was determined by comparing the concentrations of rádió labeled and unlabeled antibody where 50% saturation was achieved.

Single-dose radioimmunotherapy (RIT) with [¹³¹l]1776.1 [0284] Mice bearing established OVCAR-3 tumors (ideally ranging in volume from 150 mm³ to 250 mm³) were administered a single i.v. injection of [¹³¹1]776.1 (mouse lgG1) in 0.2 ml 0.9% sodium chloride. Fór all studies, groups of 10 mice received either 100 or300 μθί of [¹³¹1]776.1 in 0.9% sodium chloride. Control groups consisted of mice injected with 0.9% sodium chloride alone or unlabeled 776.1 at a dose equivalent to the protein dose given in the high-dose radiolabeled 776.1 group. Tumors were measured two times per week. Mice were sacrificed when the tumor volume was greaterthan 10% of their body weight.

Results:

[0285] [¹³¹1]776.1 lgG1 antibody, administered as a single, intravenous dose in an OVCAR-3 xenograft tumor model of humán ovarian cancer, was effective in slowing tumor growth compared with IgG 1 control in three studies at the 300 μθί dose, and in two of three studies at the 100 μθί dose. See FIG. 12 fór a summary of one of the studies. Compared with saline control, [¹³¹l]776.1 lgG1 was effective in slowing tumor growth in two of three studies at both the 100 μθί and 300 μθί doses. In two of three studies, [¹³¹1]776.1 lgG1 at the 300 μθί dose demonstrated tumor regression, defined as achieving a mean tumor volume less than the starting tumor volume at the beginning of the study. In one study, no statistical slowing of tumor growth was observed fór either [¹³¹l]776.1 IgG 1 treatment group compared with saline control and no regression was observed fór the 300 μθί [1311J776.1 lgG1 dose group. Starting mean tumor volumes at the

ΕΡ 2 891 666 Β1 beginning ofthis particular study were, however, significantly largerthan in the remaining two studies.

[0286] Similar results were obtained using a [⁹⁰Y]776.1 radiolabeled antibody. In particular, a significant reduction in tumor growth (p&lt; 0.05) was observed. In three of four studies, significant reduction in growth was observed at both 50 μθί and 150 μθί doses ofthe antibody. In these same three studies, regression of tumor growth was observed at the highest dose of [⁹⁰Y]776.1, and the effect on tumor growth was equal to, or better than 3 doses of 6 mg/kg cisplatin.

7.0. ANTIBODY/ANTIGEN-BINDING ANTIBODY FRAGMENT COMPETITION ASSAYS

ELISA Cross-Competition Assay [0287] Antibodies to be tested are biotinylated using the EZ-Link Sulfo-NHS-LC-Biotinylation Kit (pierce Biotechnology, Rockford, IL), according to the manufacturer’s instructions, followed by removal of unreacted biotinylation reagent by dialysis against 1L phosphate-buffered saline with 2 buffer changes at 4°C fór 48 hours. Ninety-six well plates are coated with 100 μΙ (per well) of 1 μg/ml 3 rpt-0772P in bicarbonate buffer (0.2 M NazCO₃/NaHCO₃, pH 9.6, Sigma) overnight at 4°C.

[0288] The next day, the plates are washed three times with 200 μΙ x PBST (1x phosphate-buffered saline (PBS), 0.05% Tween 20) and blocked with 100 μΙ of 1 x PBST containing 1 % bovine serum albumin (BSA) fór 1 hour at room temperature. After three washes with 1 x PBST, a titration curvefrom 0- to 1000-fold excess competitor antibody (relatíve to the labeled antibody added at a later step) in 95 μΙ 1 x PBST + 1 % BSA which is added to the plate in separate wells and incubated fór 1 hour at 37°C. Biotinylated antibody is then added in 5 μΙ 1 x PBST + 1 % BSA, and incubated fór an additional 1 hour at room temperature. The concentration of biotinylated antibody added is that concentration at which 70% maximai binding of O772P 3-rpt protein is achieved in the absence of competitor using the detection conditions described below. The amountof antibody added isdependent upon the binding characteristics and is routinely determined empirically in pilot studies.

[0289] The plates are then washed three times with 1 x PBST. Fór signal detection, 100 μΙ of Streptavidin-HRP (1 :4000-1:8000 dilution intő 1 x PBST + 1 % BSA, Southern Biotechnology Associates, Inc. (Birmingham, Alabama)), is added intő each well and incubated fór 1 hour at room temperature. The plates are then washed three times with 1 x PBST. Finally, 100 μΙ mixture of TMB substrate and H₂O₂ (1:1 ratio, KPL) is added intő each well and the absorbance is measured at 405 run with a plate reader (Molecular Devices Corp., Sunnyvale, CA). The assay is done in triplicate fór each antibody and average values are calculated.

[0290] Non-specific competition is determined using normál mouse lgG1 in piacé of specific competitor. Controls fór blankand individual reagents, as well asself-competition, are alsó included in each experiment. Percent inhibition (minus non-specific competition) is plotted as afunction of competitor competition, and the IC₅₀, orthe concentration of competitor at which 50% competition is observed is determined.

FACS Cross-Competition Assay ^{* 30} [0291] Antibodies to be tested are biotinylated using the EZ-Link Sulfo-NHS-LCBiotinylation Kit (Pierce Biotechnology, Rockford, IL), according to the manufacturer’s instructions, followed by removal of unreacted biotinylation reagent by dialysis against IL phosphate-buffered saline with 2 buffer changes at 4°C fór 48 hours. Cultured OVCAR-3 cells are harvested and washed in FACS buffer (1 x Dulbecco’s phosphate-buffered saline (DPBS), 0.05% NaN3, 2% BSA). Competition assays are prepared in 96 well plates in a 50 μΙ totál volume.

[0292] A titration from 0- to 100-fold excess of unlabeled competitor antibody (relatíve to the biotinylated antibody added at a later step) in 20 μΙ is added to 25 μΙ of OVCAR-3 cells (4 x 105) suspended in FACS buffer (in separate wells), thoroughly mixed, dispensed intő a 96 well plate, and incubated atroom temperaturefor30 minutes. Five microliters of biotinylated antibody in FACS buffer are then added to each well containing cells, thoroughly mixed, and incubated at room temperature fór an additional 30 minutes. The amount of antibody used is the minimál concentration at which maximai binding of OVCAR-3 cells, expressed as percent positive cells, is achieved. The amount of antibody added is dependent upon the binding characteristics and is routinely determined empirically in pilot studies.

[0293] Cells are then collected and washed twice with 200 μΙ of FACS buffer. Fór signal detection, cells are incubated with 50 μΙ of 1 μg/ml fór FITC-conjugated streptavidin (prepared with FACS buffer, Molecular Probes, Eugene, OR) fór minutes at room temperature. After washing twice with 200 μΙ of FACS buffer, cells from individual wells are then resuspended in 400 μΙ of FACS buffer and Subjected to F ÁCS analysis. FACS analysis was performed according to manufacturer’s recommendation using FACScan instrumentation and Cell Quest software (Becton Dickinson). The data obtained at each experimental condition represent 10,000 events. Controls fór blank and individual reagents, and self competition are alsó performed fór each experiment. Percent inhibition (minus non-specific competition), orthe reduction in the percent-positive staining OVCAR-3 cells, is plotted as a function of competitor competition, and the IC₅₀, or the concentration of competitor at which 50% competition is observed, is determined.

ΕΡ 2 891 666 Β1 [0294] An antibody is considered to compete if the IC₅₀ tor the competitor is at a concentration no more than about 100-fold above the labeled antibody. More preferably, an antibody is considered to compete if the IC₅₀for the competitor is at a concentration no more than about 10-fold above the labeled antibody. More preferably, an antibody is considered to compete if the IC₅₀ tor the competitor is at a concentration no more than about equimolar to the labeled antibody.

8.0. HYBRIDOMA DEPOSITS [0295] Hybridoma 117.1, secreting monoclonal antibody 117.1 was deposited on August 2,2002, with the American Type Culture Collection (ATCC®), 10801 University Boulevard, Manassass, Virginia 20110-2209, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-4567.

[0296] Hybridoma 368.1 secreting monoclonal antibody 368.1 was deposited on August 2, 2002, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-4568.

[0297] Hybridoma 501.1, secreting monoclonal antibody 501.1 was deposited on August 2, 2002, with the ATCC® under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-4569.

[0298] Hybridoma 776.1, secreting monoclonal antibody 776.1 was deposited on August 2, 2002, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-4570.

[0299] Hybridoma 15C9 secreting monoclonal antibody 15C9 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-5106.

[0300] Hybridoma 16C7 secreting monoclonal antibody 16C7 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty-on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-5107.

[0301] Hybridoma 16H9 secreting monoclonal antibody 16H9 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-510S.

[0302] Hybridoma 4E7 secreting monoclonal antibody 4E7 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number 5109.

[0303] Hybridoma 7 A11 secreting monoclonal antibody 7 A11 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-5110.

[0304] Hybridoma 7C6 secreting monoclonal antibody 7C6 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-5111.

[0305] Hybridoma 7F10 secreting monoclonal antibody 7F10 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-5112.

[0306] Hybridoma 7G10 secreting monoclonal antibody 7G10 was deposited on June 4,2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number 5245.

[0307] Hybridoma 7H1 secreting monoclonal antibody 7H1 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-5114.

[0308] Hybridoma 8A1 secreting monoclonal antibody 8A1 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-5115.

[0309] Hybridoma 8BS secreting monoclonal antibody 8BS was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number PTA-5116.

[0310] Hybridoma 8C3 secreting monoclonal antibody 8C3 was deposited June 4, 2003, with the ATCC®, under the provisions ofthe Budapest Treaty on the International Recognition of the Deposit of Microorganisms tor the Purpose of Patent Procedures, and assigned accession number 5246.

[0311] Hybridoma 8E3 secreting monoclonal antibody 8E3 was deposited on April 3, 2003, with the ATCC®, under the provisions ofthe Budapest Treaty on the International Recognition ofthe Deposit of Microorganisms tor the Purpose

ΕΡ 2 891 666 Β1 of Patent Procedures, and assigned accession number PTA-5118.

[0312] Hybridoma 8G9 secreting monoclonal antibody 8G9 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms fór the Purpose of Patent Procedures, and assigned accession number PTA-5119.

[0313] Hybridoma 325.1 secreting monoclonal antibody 325.1 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms fór the Purpose of Patent Procedures, and assigned accession number PTA-5120. Hybridoma 325.1 secreting monoclonal antibody

325.1 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms fór the Purpose of Patent Procedures, and assigned accession number PTA-5120.

[0314] Hybridoma 621.1 secreting monoclonal antibody 621.1 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms fór the Purpose of Patent Procedures, and assigned accession number PTA-5121.

[0315] Hybridoma 633.1 secreting monoclonal antibody 633.1 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms fór the Purpose of Patent Procedures, and assigned accession number PTA-5122.

[0316] Hybridoma 654.1 secreting monoclonal antibody 654.1 was deposited June 4, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms fór the Purpose of Patent Procedures, and assigned accession number 5247.

[0317] Hybridoma 725.1 secreting monoclonal antibody 725.1 was deposited on April 3, 2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms fór the Purpose of Patent Procedures, and assigned accession number PTA-5124.

[0318] Hybridoma 446.1 secreting monoclonal antibody 446.1 was deposited on September25,2003, with the ATCC®, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms fór the Purpose of Patent Procedures, and assigned accession number PTA-5549. Alsó disclosed are the following:

1. An isolated antibody, or an antigen-binding antibody fragment, that preferentially binds cell-associated CA 125/0772P polypeptide relatíve to shed CA 125/O772P polypeptide.

2. The isolated antibody, or the antigen-binding antibody fragment, of 1, wherein the antibody or antibody fragment, in an ELISA Competition Assay, exhibits less than about 25% inhibition of binding to the peptide of Figure 1 in the presence of a 25-fold (weight/weight) excess of shed CA 125/O772P over the peptide of Figure 1.

3. The isolated antibody, or the antigen-binding antibody fragment, of 2, wherein the antibody or antibody fragment, in an ELISA Competition Assay, exhibits less than about 20% inhibition of binding to the peptide of Figure 1 in the presence of a 25-fold (weight/weight) excess of shed CA 125/O772P over the peptide of Figure 1.

4. The isolated antibody, or the antigen-binding antibody fragment, of 3, wherein the antibody or antibody fragment, in an ELISA Competition Assay, exhibits less than about 15% inhibition of binding to the peptide of Figure 1 in the presence of a 25-fold (weight/weight) excess of shed CA 125/O772P over the peptide of Figure 1.

5. The isolated antibody, or the antigen-binding antibody fragment, of 4, wherein the antibody or antibody fragment, in an ELISA Competition Assay, exhibits less than about 10% inhibition of binding to the peptide of Figure 1 in the presence of a 25-fold (weight/weight) excess of shed CA 125/O772P over the peptide of Figure 1.

6. The isolated antibody, or the antigen-binding antibody fragment, of 5, wherein the antibody or antibody fragment, in an ELISA Competition Assay, exhibits less than about 5% inhibition of binding to the peptide of Figure 1 in the presence of a 25-fold (weight/weight) excess of shed CA 125/O772P over the peptide of Figure 1.

7. The isolated antibody, or the antigen-binding antibody fragment, of 1, wherein the antibody or antibody fragment, in a Flow Cytometry Assay, exhibits an IC₅₀, as measured by percent-positive cells, of at least about 0.05 mg/ml shed CA 125/O772P.

8. The isolated antibody, or the antigen-binding antibody fragment, of 7, wherein the antibody or antibody fragment, in a Flow Cytometry Assay, exhibits an IC₅₀, as measured by percent-positive cells, of at least about 0.25 mg/ml shed CA 125/O772P.

9. The isolated antibody, or the antigen-binding antibody fragment, of 8 wherein the antibody or antibody fragment,

ΕΡ 2 891 666 Β1 in a Flow Cytometry Assay, exhibits an IC₅₀, as measured by percent-positive cells, of at least about 0.5 mg/ml shed CA 125/O772P.

10. The isolated antibody, orthe antigen-binding antibody fragment, of 9, wherein the antibody or antibody fragment, in a Flow Cytometry Assay, exhibits an IC₅₀, as measured by percent-positive cells, of at least about 0.75 mg/ml shed CA 125/O772P.

11. The isolated antibody, orthe antigen-binding antibody fragment, of 10, wherein the antibody or antibody fragment, in a Flow Cytometry Assay, exhibits an IC₅₀, as measured by percent-positive cells, of at least about 1.0 mg/ml shed CA 125/O772P.

12. The isolated antibody, orthe antigen-binding antibody fragment, of 1, wherein the antibody or antibody fragment binds the peptide of Figure 1, bút does nőt detectably bind shed CA 125/O772P.

13. The isolated antibody of 1, wherein the antibody is an IgG eláss antibody.

14. The isolated antibody of 13, wherein the antibody is an lgG₁ isotype.

15. The isolated antibody of 1, wherein the antibody is a monoclonal antibody.

16. The isolated antibody of 15, wherein the antibody is a chimeric monoclonal antibody.

17. The isolated antibody of 16, wherein the chimeric monoclonal antibody comprises a Cy1 constant region.

18. The isolated antibody of 16, wherein the chimeric monoclonal antibody comprises a C-/4 constant region.

19. The isolated antibody of 1, wherein the antibody is a humanized monoclonal antibody.

20. The isolated antibody of 15, wherein the antibody is a humán monoclonal antibody.

21. The isolated antibody of 1, wherein the antibody is a bi-specific antibody.

22. The isolated antibody of 1, wherein the antibody is a multi-specific antibody.

23. The isolated antibody of 1, wherein the antibody is a chimeric antibody.

24. The isolated antibody of 1, wherein the antibody is a single chain antibody, a disulfide-linked F_vs, a single chain

F_vs, or an anti-idiotypic antibody.

25. The antigen-binding antibody fragment of 1, wherein the antigen-binding antibody fragment is a Fab fragment, a F(ab’)₂ fragment, a VL-containing fragment, a VH-containing fragment, or a complementary-determining region (CDR)-containing fragment.

26. A monoclonal antibody produced by hybridoma 4E7 (ATCC® Accession No. PTA-5109), 7A11 (ATCC® Accession No. PTA-5110), 7C6 (ATCC® Accession No. PTA-5111), 7F10 (ATCC® Accession No. PTA-5112), 7G10 (ATCC® Accession No. PTA-5245), 7H1 (ATCC® Accession No. PTA-5114), 8A1 (ATCC® Accession No. PTA-5115), 8B5 (ATCC® Accession No. PTA-5116), 8C3 (ATCC® Accession No. PTA-5246), 8E3 (ATCC® Accession No. PTA5118), 8G9 (ATCC® Accession No. PTA-5119), 15C9 (ATCC® Accession No. PTA-5106), 16C7 (ATCC® Accession No. PTA-5107), 16H9 (ATCC® Accession No. PTA-5108), 117.1 (ATCC® Accession No. PTA-4567), 325.1 (ATCC® Accession No. PTA-5120), 368.1 (ATCC® Accession No. PTA-4568), 446.1 (ATCC® Accession No. PTA-5549),

501.1 (ATCC® Accession No. PTA-4569), 621.1 (ATCC® Accession No. PTA-5121), 633.1 (ATCC® Accession No. PTA-5122), 654.1 (ATCC® Accession No. PTA-5247), 725.1 (ATCC® Accession No. PTA-5124), or 776.1 (ATCC® Accession No. PTA-4570).

27. A monoclonal antibody that competes with binding of the monoclonal antibody of 26.

28. A hybridoma as deposited as hybridoma 4E7 (ATCC® Accession No. PTA-5109), 7A11 (ATCC® Accession No. PTA-5110), 7C6 (ATCC® Accession No. PTA-5111), 7F10 (ATCC® Accession No. PTA-5112), 7G10 (ATCC® Ac54

ΕΡ 2 891 666 Β1 cession No. ΡΤΑ-5245), 7Η1 (ATCC® Accession No. PTA-5114), 8A1 (ATCC® Accession No. PTA-5115), 8B5 (ATCC® Accession No. PTA-5116), 8C3 (ATCC® Accession No. PTA-5246), 8E3 (ATCC® Accession No. PTA5118), 8G9 (ATCC® Accession No. PTA-5119), 15C9 (ATCC® Accession No. PTA-5106), 16C7 (ATCC® Accession No. PTA-5107), 16H9 (ATCC® Accession No. PTA-5108), 117.1 (ATCC® Accession No. PTA-4567), 325.1 (ATCC® Accession No. PTA-5120), 368.1 (ATCC® Accession No. PTA-4568), 446.1 (ATCC® Accession No. PTA-5549),

501.1 (ATCC® Accession No. PTA-4569), 621.1 (ATCC® Accession No. PTA-5121), 633.1 (ATCC® Accession No. PTA-5122), 654.1 (ATCC® Accession No. PTA-5247), 725.1 (ATCC® Accession No. PTA-5124), or 776.1 (ATCC® Accession No. PTA-4570).

29. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a light chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:27.

30. The isolated antibody, or antigen-binding antibody fragment of 1, wherein the antibody or antigen-binding antibody fragment comprises a light chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:29.

31. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a light chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:31.

32. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a light chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:33.

33. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a light chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:54.

34. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a light chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:56.

35. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:28.

36. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:30.

37. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:32.

38. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:34.

39. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:53.

40. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:55.

41. The isolated antibody, or antigen-binding antibody fragment, of 29, wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in

ΕΡ 2 891 666 Β1

SEQ ID ΝΟ:28.

42. The isolated antibody, or antigen-binding antibody fragment, of 30, wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:30.

43. The isolated antibody, or antigen-binding antibody fragment, of 31, wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:32.

44. The isolated antibody, or antigen-binding antibody fragment, of 32 wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:34.

45. The isolated antibody, or antigen-binding antibody fragment, of 33, wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:53.

46. The isolated antibody, or antigen-binding antibody fragment, of 34 wherein the antibody or antigen-binding antibody fragment comprises a heavy chain variable region that comprises the amino acid sequence depicted in SEQ ID NO:55.

47. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes a variable chain region ofthe antibody or antigen-binding antibody fragment of any of 29 to 40.

48. The nucleic acid molecule of 41, wherein the nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:35, 36, 37, 38, 39, 40, 41,42, 52, 57, 58 or 59.

49. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody, or antigen-binding antibody fragment binds the peptide of Figure 1 with a K_d of less than about 100nM as measured in a BIAcore Affinity Assay.

50. The isolated antibody, or antigen-binding antibody fragment, of 49, wherein the antibody, or antigen-binding antibody fragment binds the peptide of Figure 1 with a K_d of less than about 10nM as measured in a BIAcore Affinity Assay.

51. The isolated antibody, or antigen-binding antibody fragment, of 50, wherein the antibody, or antigen-binding antibody fragment binds the peptide of Figure 1 with a K_d of less than about 1 nM as measured in a BIAcore Affinity Assay.

52. The isolated antibody, or antigen-binding antibody fragment, of 51, wherein the antibody, or antigen-binding antibody fragment binds the peptide of Figure 1 with a K_d of less than about 100pM as measured in a BIAcore Affinity Assay.

53. The isolated antibody, or antigen-binding antibody fragment, of 52, wherein the antibody, or antigen-binding antibody fragment binds the peptide of Figure 1 with a K_d of less than about 10pM as measured in a BIAcore Affinity Assay.

54. The antibody or antigen-binding antibody fragment of 1, wherein the antibody or antigen-binding antibody fragment is modified by amino acid substitution, deletion, or addition, or a combination thereof, and has the same or an increased affinity fór cell-associated CA 125/O772P relatíve to that of a corresponding unmodified antibody or antigen-binding antibody fragment.

55. The isolated antibody, or antigen-binding antibody fragment, of 1, wherein the antibody or antigen-binding antibody fragment is modified by amino acid substitution, deletion, or addition, óra combination thereof, and wherein the antibody or antigen-binding antibody fragment exhibits the same or an increased serum half-life compared to a corresponding unmodified antibody or antigen-binding antibody fragment.

ΕΡ 2 891 666 Β1

56. The isolated antibody, orthe antigen-binding antibody fragment, of 1, wherein the antibody or antibody fragment mediates lysis of a CA 125/O772P-positive tumor cell in an ADCC assay.

57. The isolated antibody, orthe antigen-binding antibody fragment, of 56, wherein the antibody or antibody fragment mediates at least about 10% lysis of a CA 125/O772P-positive tumor cell in an ADCC assay at a 50:1 effector:target ratio at a concentration of 5.0 /xg antibody or antigen-binding fragment per ml.

58. The isolated antibody, orthe antigen-binding antibody fragment, of 56, wherein the antibody or antibody fragment mediates at least about 10% lysis of a CA 125/O772P-positive tumor cell in an ADCC assay at a 25:1 effector:target ratio at a concentration of 5.0 /xg antibody or antigen-binding fragment per ml.

59. The isolated antibody, orthe antigen-binding antibody fragment, of 56, wherein the antibody or antibody fragment mediates at least about 10% lysisof a CA 125/O772P-positive tumor cell in an ADCC assay at a 12.5:1 effector:target ratio at a concentration of 5.0 /xg antibody or antigen-binding fragment per ml.

60. The isolated antibody, orthe antigen-binding antibody fragment, of 56, wherein the antibody or antibody fragment mediates at least about 10% lysisof a CA 125/O772P-positive tumor cell in an ADCC assay at a 12.5:1 effector:target ratio at a concentration of 50 ng antibody or antigen-binding fragment per ml.

61. The isolated antibody, orthe antigen-binding antibody fragment, of 1, wherein the antibody or antibody fragment mediates lysis of a CA 125/O772P-positive tumor cell in an complement-dependent cytotoxity (CDC) assay.

62. The isolated antibody, orthe antigen-binding antibody fragment, of 61, wherein the antibody or antibody fragment mediates in a rangé from about 15% lysis at 5 /xg/ml antibody or antigen-binding antibody fragment to about 95% lysis at about 0.1 /xg/ml antibody or antigen-binding antibody fragment.

63. The isolated antibody, orthe antigen-binding antibody fragment, of 1, wherein the antibody or antibody fragment inhibits CA 125/O772P-positive tumor growth.

64. Apharmaceutical composition comprising an antibody oran antigen-binding antibody fragment that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide, and a pharmaceutically acceptable carrier.

65. A pharmaceutical composition comprising a monoclonal antibody or an antigen-binding monoclonal antibody fragment that preferentially binds cell-associated CA 125/O772P polypeptide relatíve to shed CA 125/O772P polypeptide, and a pharmaceutically acceptable carrier.

66. An article of manufacture comprising packaging matéria! and a pharmaceutical composition comprising an antibody, oran antigen-binding antibody fragment, that preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P, and a pharmaceutically acceptable carrier contained within the packaging matériái, said pharmaceutical composition in a form suitable fór administration to a subject.

67. The article of manufacture of 66, further comprising printed instructions regarding the use or administration of the pharmaceutical composition.

68. The article of manufacture of 67, wherein the instructions suggest a dosing régimén fór the prevention or treatment of one or more symptoms of a CA 125/O772P-related disorder.

69. The article of manufacture of 67, wherein the instructions suggest a dosing régimén fór the prevention or treatment of one or more symptoms of a cell proliferative disorder.

70. The article of manufacture of 69, wherein the instructions suggest a dosing régimén fór the prevention or treatment of one or more symptoms of a cancer.

.The article of manufacture of 70, wherein the instructions suggest a dosing régimén fór the prevention or treatment of one or more symptoms of ovarian cancer.

72. The article of manufacture of 66, further comprising a label regarding the use or administration of the pharma57

EP 2 891 666 Β1 ceutical composition.

73. The article of manufacture of 66, wherein the label suggests a dosing régimén fór the prevention or treatment of one or more symptoms of a CA 125/O772P-related disorder.

74. The article of manufacture of 73, wherein the label suggests a dosing régimén fór the prevention or treatment of one or more symptoms of a cell proliferative disorder.

75. The article of manufacture of 74, wherein the label suggests a dosing régimén fór the prevention or treatment of one or more symptoms of a cancer.

76. The article of manufacture of 75, wherein the label suggests a dosing régimén fór the prevention or treatment of one or more symptoms of ovarian cancer.

77. A fusion polypeptide comprising an antibody, or an antigen-binding antibody fragment, which preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P, operably linked to a heterologous agent.

78. A method fór ameliorating a symptom of a CA 125/O772P-related disorder, comprising: administering to a subject in need of said amelioration, an antibody or antigen-binding fragment of an antibody in an amount sufficient to ameliorate a symptom ofthe cell proliferative disorder, wherein said antibody or antigen-binding antibody fragment preferentially binds cell-associated CA 125/O772P relatíve to shed CA 125/O772P.

79. The method of 78, wherein the CA 125/O772P-related disorder is a cell proliferative disorder.

80. The method of 79, wherein the cell proliferative disorder is cancer.

81. The method of 80, wherein the cancer is cervical or uterine cancer.

82. The method of 80, wherein the cancer is breast or lung cancer.

83. The method of 80, wherein the cancer is ovarian cancer.

84. The method of 78, wherein the antibody or antigen-binding antibody fragment is a monoclonal antibody or antigen-binding monoclonal antibody fragment.

85. The method of 78, wherein the antibody or antigen-binding antibody fragment is administered at a dose from about 5 ytg/kg to about 10 mg/kg.

86. The method of 78, wherein the method is practiced as part of a combination cancer therapy.

87. The method of86, wherein the combination cancer therapy further comprises administration ofa chemotherapeutic agent to the subject.

88. The method of 87, wherein the chemotherapeutic agent is paclitaxel or cisplatin.

89. The method of 86, wherein the combination cancer therapy comprises radiation therapy.

90. The method of 78, wherein the antibody is selected from the group consisting of 325.1, 621.1, 633.1, 654.1, 725.1,8G9, 7F10, 8A1,8C3, 15C9, 8E3, 8B5, 7G10,16C7, 7C6, 7H1, 16H9, 7A11,4E7, 117.1,368.1,446.1,501.1 and 776.1.

91. A method to assist in identifying an antibody, or antigen-binding antibody fragment, that preferentially binds cellassociated CA 125/O772P, comprising:

(a) incubating an antibody or antigen-binding antibody fragment with a peptide comprising cell-associated CA 125/O772P in the presence of shed CA 125/O772P under conditions that allow binding of the antibody or antigen-binding antibody fragment to said peptide comprising cell-associated CA 125/O772P or shed CA 125/O772P;

ΕΡ 2 891 666 Β1 (b) removing shed CA 125/O772P and antibody or antigen-binding antibody fragment nőt bound to said peptide comprising cell-associated CA 125/O772P;

(c) measuring the amount of antibody or antigen-binding antibody fragment bound to said peptide comprising cell-associated CA 125/O772P; and (d) comparing the amount in (c) to the amount of antibody or antigen-binding antibody fragment that binds to said peptide comprising cell-associated CA 125/O772P in the absence ofthe shed CA 125/O772P.

92. The method of 91, wherein the peptide comprising cell-associated CA 125/O772P is immobilized on a solid surface.

93. The method of 92, wherein the method is performed in an ELISA formát.

94. The method of 91, wherein the shed CA 125/O772P and peptide comprising cell-associated CA 125/O772P are present at about a 25:1 (wt/wt) ratio of shed CA 125/O772P to peptide comprising cell-associated CA 125/O772P.

95. A method to assist in identifying an antibody, or antigen-binding antibody fragment, that preferentially binds cellassociated CA 125/O772P, comprising:

(a) contacting an antibody, or antigen-binding fragment, with a peptide comprising cell-associated CA 125/O772P in the presence of shed CA 125/O772P under conditions that allow binding of the peptide comprising cellassociated CA 125/O772P to the antibody or antigen-binding antibody fragment;

(b) removing unbound peptide comprising cell-associated CA 125/O772P;

(c) measuring the amount of peptide comprising cell-associated CA 125/O772P bound by the antibody, or antigen-binding fragment, and (d) comparing the amount measured in (c) to the amount of peptide comprising cell-associated CA 125/O772P the antibody or antigen-binding antibody fragment binds in the absence of shed CA 125/O772P.

96. The method of 95, wherein the amount of shed CA 125/O772P is about a 25-fold (weight/weight) excess amount.

97. The method of 95, wherein the antibody, or antigen-binding antibody fragment is immobilized on a solid surface.

98. The method of 97, wherein the method is performed in an ELISA formát.

99. A method to assist in identifying an antibody, or antigen-binding antibody fragment, that preferentially binds cellassociated CA 125/O772P, comprising:

(a) contacting an antibody, or antigen-binding fragment, with a cell that expresses CA 125/O772P in the presence of an amount of shed CA 125/O772P under conditions that allow binding ofthe CA 125/O772P to the antibody or antigen-binding antibody fragment;

(b) removing unbound cells;

(c) measuring the amount of cells expressing CA 125/O772P bound by the antibody, or antigen-binding fragment, and (d) comparing the amount measured in (c) to the amount of cells expressing CA 125/O772P that binds the antibody or antigen-binding antibody fragment in the absence of said amount of shed CA 125/O772P.

100. The method of 99, wherein the amount of shed CA 125/O772P is at least about 0.5 mg/ml.

101. The method of 99, wherein measuring is performed by flow cytometry.

102. The method of 99, wherein the measuring is performed by fluorescence activated cell sorting.

103. A hybridoma that can secrete an antibody of 1.

104. The isolated antibody or antigen-binding fragment of 1 conjugated to a cytotoxic agent.

105. The isolated antibody or antigen-binding fragment of 104, wherein the cytotoxic agent is a radioisotope.

106. The isolated antibody or antigen-binding fragment of 105, wherein the radioisotope is selected from the group

ΕΡ 2 891 666 Β1 consisting of ¹²⁵l, ¹³¹l, ¹¹¹ln, ^99mTc and ^9θΥ.

107. The monoclonal antibody of 26 or27, which is conjugated to a cytotoxic agent.

108. The monoclonal antibody of 107, wherein the cytotoxic agent is a radioisotope.

109. The monoclonal antibody of 108, wherein the radioisotope is selected from the group consisting of ¹²⁵l, ¹³¹l, ¹¹¹ In, ^99mTc and ⁹⁰Y.

110. The pharmaceutical composition of 64 or 65, wherein the antibody or antigen-binding fragment is conjugated to a cytotoxic agent.

111. The pharmaceutical composition of 110, wherein the cytotoxic agent is a radioisotope.

112. The pharmaceutical composition of 111 wherein the radioisotope is selected from the group consisting of ¹²⁵l, 131|, min, ^99mTc and ⁹°Y.

113. The method of 78, wherein the antibody or antigen-binding fragment is conjugated from a cytotoxic agent.

114. The method of 113, wherein the cytotoxic agent is a radioisotope.

115. The method of 114, wherein the radioisotope is selected from the group consisting of ¹²⁵l, ¹³¹l, ¹¹¹ln, ^99mTc and Y.

116. A monoclonal antibody selected from the group consisting of 325.1, 621.1, 633.1, 654.1, 725.1, 8G9, 7F10, 8A1,8C3, 15C9, 8E3, 8B5, 7G10, 16C7, 7C6, 7H1, 16H9, 7A11.4E7, 117.1,368.1,446.1,501.1, and 776.1, oran antigen-binding antibody fragment thereof.

117. An antibody or antigen-binding antibody fragment that competes with binding of a monoclonal antibody of 116.

118. A pharmaceutical composition comprising a monoclonal antibody selected from the group consisting of 325.1, 621.1,633.1,654.1,725.1,8G9, 7F10, 8A1,8C3, 15C9, SE3, 8B5, 7G10,16C7, 7C6, 7H1, 16H9, 7A11,4E7, 117.1, 368.1,446.1,501.1, and 776.1, oran antigen-binding antibody fragment thereof, and a pharmaceutically acceptable carrier.

119. An isolated antibody or antigen-binding antibody fragment that binds to the peptide of Figure 1.

SEQUENCE LISTING [0319] &lt;110&gt; Euro-Celtique S.A.

&lt;120&gt; ANTIBODIES THAT BIND CELL-ASSOCIATED CA 125/0772P AND METHODS OF USE

THEREOF &lt;130&gt; 6750-214-228 &lt;140&gt; To be assigned &lt;141&gt; 2003-10-15 &lt;150&gt; 60/485,986 &lt;151&gt; 2003-07-10 &lt;150&gt; 60/418,828 &lt;151&gt; 2003-10-12 &lt;160&gt; 71 &lt;170&gt; FastSEQ fór Windows Version 4.0 &lt;210&gt; 1 &lt;211&gt; 748 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

EP 2 891 666 B1 &lt;223&gt; CA 125/0772Ρ 3-repeat &lt;400&gt; 1

<td> Alá Alá Gin 1 5 10 15</td><td> Pro</td><td> Alá</td><td> Arg</td><td> Arg</td><td> Alá</td><td> Arg</td><td> Arg</td><td> Thr</td><td> Lys</td><td> Leu</td><td> Phe</td><td> Thr</td><td> His</td>

<td> Arg Ser Ser 20 25 30</td><td> Val</td><td> Ser</td><td> Thr</td><td> Thr</td><td> Ser</td><td> Thr</td><td> Pro</td><td> Gly</td><td> Thr</td><td> Pro</td><td> Thr</td><td> Val</td><td> Tyr</td>

<td> Leu Gly Alá 35 40 45</td><td> Ser</td><td> Lys</td><td> Thr</td><td> Pro</td><td> Alá</td><td> Ser</td><td> Ile</td><td> Phe</td><td> Gly</td><td> Pro</td><td> Ser</td><td> Alá</td><td> Alá</td>

<td> Ser His Leu 50 55 60</td><td> Leu</td><td> Ile</td><td> Leu</td><td> Phe</td><td> Thr</td><td> Leu</td><td> Asn</td><td> Phe</td><td> Thr</td><td> Ile</td><td> Thr</td><td> Asn</td><td> Leu</td>

<td> Arg Tyr Glu 65 70 75 80</td><td> Glu</td><td> Asn</td><td> Met</td><td> Trp</td><td> Pro</td><td> Gly</td><td> Ser</td><td> Arg</td><td> Lys</td><td> Phe</td><td> Asn</td><td> Thr</td><td> Thr</td>

<td> Glu Arg Val 85 90 95</td><td> Leu</td><td> Gin</td><td> Gly</td><td> Leu</td><td> Leu</td><td> Arg</td><td> Pro</td><td> Leu</td><td> Phe</td><td> Lys</td><td> Asn</td><td> Thr</td><td> Ser</td>

<td> Val Gly Pro 100 105 110</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Gly</td><td> Cys</td><td> Arg</td><td> Leu</td><td> Thr</td><td> Leu</td><td> Leu</td><td> Arg</td><td> Pro</td><td> Glu</td>

<td> Lys Asp Gly 115 120 125</td><td> Glu</td><td> Alá</td><td> Thr</td><td> Gly</td><td> Val</td><td> Asp</td><td> Alá</td><td> Ile</td><td> Cys</td><td> Thr</td><td> His</td><td> Arg</td><td> Pro</td>

<td> Asp Pro Thr 130 135 140</td><td> Gly</td><td> Pro</td><td> Gly</td><td> Leu</td><td> Asp</td><td> Arg</td><td> Glu</td><td> Gin</td><td> Leu</td><td> Tyr</td><td> Leu</td><td> Glu</td><td> Leu</td>

<td> Ser Gin Leu 145 150 155</td><td> Thr 160</td><td> His</td><td> Ser</td><td> Ile</td><td> Thr</td><td> Glu</td><td> Leu</td><td> Gly</td><td> Pro</td><td> Tyr</td><td> Thr</td><td> Leu</td><td> Asp</td>

<td> Arg Asp Ser 165 170 175</td><td> Leu</td><td> Tyr</td><td> Val</td><td> Asn</td><td> Gly</td><td> Phe</td><td> Thr</td><td> His</td><td> Arg</td><td> Ser</td><td> Ser</td><td> Val</td><td> Pro</td>

<td> Thr Thr Ser 180 185 190</td><td> Thr</td><td> Gly</td><td> Val</td><td> Val</td><td> Ser</td><td> Glu</td><td> Glu</td><td> Pro</td><td> Phe</td><td> Thr</td><td> Leu</td><td> Asn</td><td> Phe</td>

<td> Thr Ile Asn 195 200 205</td><td> Asn</td><td> Leu</td><td> Arg</td><td> Tyr</td><td> Met</td><td> Alá</td><td> Asp</td><td> Met</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Gly</td><td> Ser</td>

<td> Leu Lys Phe 210 215 220</td><td> Asn</td><td> Ile</td><td> Thr</td><td> Asp</td><td> Asn</td><td> Val</td><td> Met</td><td> Lys</td><td> His</td><td> Leu</td><td> Leu</td><td> Ser</td><td> Pro</td>

<td> Leu Phe Gin 225 230 235</td><td> Arg 240</td><td> Ser</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Alá</td><td> Arg</td><td> Tyr</td><td> Thr</td><td> Gly</td><td> Cys</td><td> Arg</td><td> Val</td>

<td> Ile Alá Leu 245 250 255</td><td> Arg</td><td> Ser</td><td> Val</td><td> Lys</td><td> Asn</td><td> Gly</td><td> Alá</td><td> Glu</td><td> Thr</td><td> Arg</td><td> Val</td><td> Asp</td><td> Leu</td>

<td> Leu Cys Thr 260 265 270</td><td> Tyr</td><td> Leu</td><td> Gin</td><td> Pro</td><td> Leu</td><td> Ser</td><td> Gly</td><td> Pro</td><td> Gly</td><td> Leu</td><td> Pro</td><td> Ile</td><td> Lys</td>

<td> Gin Val Phe 275 280 285</td><td> His</td><td> Glu</td><td> Leu</td><td> Ser</td><td> Gin</td><td> Gin</td><td> Thr</td><td> His</td><td> Gly</td><td> Ile</td><td> Thr</td><td> Arg</td><td> Leu</td>

<td> Gly Pro Tyr 290 295 300</td><td> Ser</td><td> Leu</td><td> Asp</td><td> Lys</td><td> Asp</td><td> Ser</td><td> Leu</td><td> Tyr</td><td> Leu</td><td> Asn</td><td> Gly</td><td> Tyr</td><td> Asn</td>

ΕΡ 2 891 666 Β1

<td> Glu</td><td> Pro</td><td> Gly</td><td> Pro</td><td> Asp</td><td> Glu</td><td> Pro</td><td> Pro</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Lys</td><td> Pro</td><td> Alá</td><td> Thr</td><td> Thr</td>

<td> 305</td><td> 310</td><td> 315</td><td> 320</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Phe</td><td> Leu</td><td> Pro</td><td> Pro</td><td> Leu</td><td> Ser</td><td> Glu</td><td> Alá</td><td> Thr</td><td> Thr</td><td> Alá</td><td> Met</td><td> Gly</td><td> Tyr</td><td> His</td><td> Leu</td>

<td> 325</td><td> 330</td><td> 335</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Lys</td><td> Thr</td><td> Leu</td><td> Thr</td><td> Leu</td><td> Asn</td><td> Phe</td><td> Thr</td><td> He</td><td> Ser</td><td> Asn</td><td> Leu</td><td> Gin</td><td> Tyr</td><td> Ser</td><td> Pro</td>

<td> 340</td><td> 345</td><td> 350</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asp</td><td> Met</td><td> Gly</td><td> Lys</td><td> Gly</td><td> Ser</td><td> Alá</td><td> Thr</td><td> Phe</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Glu</td><td> Gly</td><td> Val</td><td> Leu</td>

<td> 355</td><td> 360</td><td> 365</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> His</td><td> Leu</td><td> Leu</td><td> Arg</td><td> Pro</td><td> Leu</td><td> Phe</td><td> Gin</td><td> Lys</td><td> Ser</td><td> Ser</td><td> Met</td><td> Gly</td><td> Pro</td><td> Phe</td>

<td> 370</td><td> 375</td><td> 380</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Tyr</td><td> Leu</td><td> Gly</td><td> Cys</td><td> Gin</td><td> Leu</td><td> He</td><td> Ser</td><td> Leu</td><td> Arg</td><td> Pro</td><td> Glu</td><td> Lys</td><td> Asp</td><td> Gly</td><td> Alá</td>

<td> 385</td><td> 390</td><td> 395</td><td> 400</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Alá</td><td> Thr</td><td> Gly</td><td> Val</td><td> Asp</td><td> Thr</td><td> Thr</td><td> Cys</td><td> Thr</td><td> Tyr</td><td> His</td><td> Pro</td><td> Asp</td><td> Pro</td><td> Val</td><td> Gly</td>

<td> 405</td><td> 410</td><td> 415</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Gly</td><td> Leu</td><td> Asp</td><td> He</td><td> Gin</td><td> Gin</td><td> Leu</td><td> Tyr</td><td> Trp</td><td> Glu</td><td> Leu</td><td> Ser</td><td> Gin</td><td> Leu</td><td> Thr</td>

<td> 420</td><td> 425</td><td> 430</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> His</td><td> Gly</td><td> Val</td><td> Thr</td><td> Gin</td><td> Leu</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Val</td><td> Leu</td><td> Asp</td><td> Arg</td><td> Asp</td><td> Ser</td><td> Leu</td>

<td> 435</td><td> 440</td><td> 445</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Phe</td><td> He</td><td> Asn</td><td> Gly</td><td> Tyr</td><td> Alá</td><td> Pro</td><td> Gin</td><td> Asn</td><td> Leu</td><td> Ser</td><td> He</td><td> Arg</td><td> Gly</td><td> Glu</td><td> Tyr</td>

<td> 450</td><td> 455</td><td> 460</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> He</td><td> Asn</td><td> Phe</td><td> His</td><td> He</td><td> Val</td><td> Asn</td><td> Trp</td><td> Asn</td><td> Leu</td><td> Ser</td><td> Asn</td><td> Pro</td><td> Asp</td><td> Pro</td>

<td> 465</td><td> 470</td><td> 475</td><td> 480</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Ser</td><td> Ser</td><td> Glu</td><td> Tyr</td><td> He</td><td> Thr</td><td> Leu</td><td> Leu</td><td> Arg</td><td> Asp</td><td> He</td><td> Gin</td><td> Asp</td><td> Lys</td><td> Val</td>

<td> 485</td><td> 490</td><td> 495</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Thr</td><td> Leu</td><td> Tyr</td><td> Lys</td><td> Gly</td><td> Ser</td><td> Gin</td><td> Leu</td><td> His</td><td> Asp</td><td> Thr</td><td> Phe</td><td> Arg</td><td> Phe</td><td> Cys</td>

<td> 500</td><td> 505</td><td> 510</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Val</td><td> Thr</td><td> Asn</td><td> Leu</td><td> Thr</td><td> Met</td><td> Asp</td><td> Ser</td><td> Val</td><td> Leu</td><td> Val</td><td> Thr</td><td> Val</td><td> Lys</td><td> Alá</td>

<td> 515</td><td> 520</td><td> 525</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Phe</td><td> Ser</td><td> Ser</td><td> Asn</td><td> Leu</td><td> Asp</td><td> Pro</td><td> Ser</td><td> Leu</td><td> Val</td><td> Glu</td><td> Gin</td><td> Val</td><td> Phe</td><td> Leu</td>

<td> 530</td><td> 535</td><td> 540</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asp</td><td> Lys</td><td> Thr</td><td> Leu</td><td> Asn</td><td> Alá</td><td> Ser</td><td> Phe</td><td> His</td><td> Trp</td><td> Leu</td><td> Gly</td><td> Ser</td><td> Thr</td><td> Tyr</td><td> Gin</td>

<td> 545</td><td> 550</td><td> 555</td><td> 560</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Val</td><td> Asp</td><td> He</td><td> His</td><td> Val</td><td> Thr</td><td> Glu</td><td> Met</td><td> Glu</td><td> Ser</td><td> Ser</td><td> Val</td><td> Tyr</td><td> Gin</td><td> Pro</td>

<td> 565</td><td> 570</td><td> 575</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Thr</td><td> Gin</td><td> His</td><td> Phe</td><td> Tyr</td><td> Leu</td><td> Asn</td><td> Phe</td><td> Thr</td><td> He</td><td> Thr</td>

<td> 580</td><td> 585</td><td> 590</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asn</td><td> Leu</td><td> Pro</td><td> Tyr</td><td> Ser</td><td> Gin</td><td> Asp</td><td> Lys</td><td> Alá</td><td> Gin</td><td> Pro</td><td> Gly</td><td> Thr</td><td> Thr</td><td> Asn</td><td> Tyr</td>

<td> 595</td><td> 600</td><td> 605</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> Arg</td><td> Asn</td><td> Lys</td><td> Arg</td><td> Asn</td><td> He</td><td> Glu</td><td> Asp</td><td> Alá</td><td> Leu</td><td> Asn</td><td> Gin</td><td> Leu</td><td> Phe</td><td> Arg</td>

<td> 610</td><td> 615</td><td> 620</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asn</td><td> Ser</td><td> Ser</td><td> He</td><td> Lys</td><td> Ser</td><td> Tyr</td><td> Phe</td><td> Ser</td><td> Asp</td><td> Cys</td><td> Gin</td><td> Val</td><td> Ser</td><td> Thr</td><td> Phe</td>

<td> 625</td><td> 630</td><td> 635</td><td> 640</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Arg</td><td> Ser</td><td> Val</td><td> Pro</td><td> Asn</td><td> Arg</td><td> His</td><td> His</td><td> Thr</td><td> Gly</td><td> Val</td><td> Asp</td><td> Ser</td><td> Leu</td><td> Cys</td><td> Asn</td>

<td> 645</td><td> 650</td><td> 655</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Phe</td><td> Ser</td><td> Pro</td><td> Leu</td><td> Alá</td><td> Arg</td><td> Arg</td><td> Val</td><td> Asp</td><td> Arg</td><td> Val</td><td> Alá</td><td> He</td><td> Tyr</td><td> Glu</td><td> Glu</td>

<td> 660</td><td> 665</td><td> 670</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Phe</td><td> Leu</td><td> Arg</td><td> Met</td><td> Thr</td><td> Arg</td><td> Asn</td><td> Gly</td><td> Thr</td><td> Gin</td><td> Leu</td><td> Gin</td><td> Asn</td><td> Phe</td><td> Thr</td><td> Leu</td>

<td> 675</td><td> 680</td><td> 685</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asp</td><td> Arg</td><td> Ser</td><td> Ser</td><td> Val</td><td> Leu</td><td> Val</td><td> Asp</td><td> Gly</td><td> Tyr</td><td> Ser</td><td> Pro</td><td> Asn</td><td> Arg</td><td> Asn</td><td> Glu</td>

<td> 690</td><td> 695</td><td> 700</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Leu</td><td> Thr</td><td> Gly</td><td> Asn</td><td> Ser</td><td> Alá</td><td> Asp</td><td> He</td><td> Gin</td><td> His</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Arg</td><td> Ser</td>

<td> 705</td><td> 710</td><td> 715</td><td> 720</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Leu</td><td> Glu</td><td> Gly</td><td> Pro</td><td> Arg</td><td> Phe</td><td> Glu</td><td> Gin</td><td> Lys</td><td> Leu</td><td> He</td><td> Ser</td><td> Glu</td><td> Glu</td><td> Asp</td>

<td> 725</td><td> 730</td><td> 735</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Asn</td><td> Met</td><td> His</td><td> Thr</td><td> Gly</td><td> His</td><td> His</td><td> His</td><td> His</td><td> His</td><td> His</td><td></td><td></td><td></td><td></td>

<td> 740</td><td> 745</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

&lt;210&gt;2 &lt;211&gt; 809 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence

ΕΡ 2 891 666 Β1 &lt;220&gt;

&lt;223&gt; CA 125/0772Ρ 3-repeat ΤΜ &lt;400&gt;2

ΕΡ 2 891 666 Β1

<td colspan="3"> Alá Alá Gin Pro</td>

<td> 1 5</td><td> 10 15</td><td></td>

<td> Arg</td><td> Ser Ser</td><td> Val</td>

<td colspan="2"> 20 25 30</td><td></td>

<td> Leu</td><td> Gly Alá</td><td> Ser</td>

40 45

<td colspan="3"> Ser His Leu Leu</td>

<td> 50</td><td> 55 60</td><td></td>

<td> Arg</td><td> Tyr Glu</td><td> Glu</td>

<td> 65</td><td> 70 75 80</td><td></td>

<td> Glu</td><td> Arg Val</td><td> Leu</td>

90 95

<td> Val</td><td> Gly</td><td> Pro</td><td> Leu</td>

<td> 100</td><td> 105</td><td> 110</td><td></td>

<td> Lys</td><td> Asp</td><td> Gly</td><td> Glu</td>

<td> 115</td><td> 120</td><td> 125</td><td></td>

<td> Asp</td><td> Pro</td><td> Thr</td><td> Gly</td>

<td> 130</td><td> 135</td><td> 140</td><td></td>

<td> Ser</td><td> Gin</td><td> Leu</td><td> Thr</td>

<td> 145</td><td> 150</td><td> 155</td><td> 160</td>

<td> Arg</td><td> Asp</td><td> Ser</td><td> Leu</td>

<td> 165</td><td> 170</td><td> 175</td><td></td>

<td> Thr</td><td> Thr</td><td> Ser</td><td> Thr</td>

<td> 180</td><td> 185</td><td> 190</td><td></td>

<td> Thr</td><td> Ile</td><td> Asn</td><td> Asn</td>

<td> 195</td><td> 200</td><td> 205</td><td></td>

<td> Leu</td><td> Lys</td><td> Phe</td><td> Asn</td>

<td> 210</td><td> 215</td><td> 220</td><td></td>

<td> Leu</td><td> Phe</td><td> Gin</td><td> Arg</td>

<td> 225</td><td> 230</td><td> 235</td><td> 240</td>

<td> Ile</td><td> Alá</td><td> Leu</td><td> Arg</td>

<td> 245</td><td> 250</td><td> 255</td><td></td>

<td> Leu</td><td> Cys</td><td> Thr</td><td> Tyr</td>

<td> 260</td><td> 265</td><td> 270</td><td></td>

<td> Gin</td><td> Val</td><td> Phe</td><td> His</td>

<td> 275</td><td> 280</td><td> 285</td><td></td>

<td> Gly</td><td> Pro</td><td> Tyr</td><td> Ser</td>

<td> 290</td><td> 295</td><td> 300</td><td></td>

<td> Glu</td><td> Pro</td><td> Gly</td><td> Pro</td>

<td> 305</td><td> 310</td><td> 315</td><td> 320</td>

<td> Phe</td><td> Leu</td><td> Pro</td><td> Pro</td>

<td> 325</td><td> 330</td><td> 335</td><td></td>

<td> Lys</td><td> Thr</td><td> Leu</td><td> Thr</td>

<td> 340</td><td> 345</td><td> 350</td><td></td>

<td> Asp</td><td> Met</td><td> Gly</td><td> Lys</td>

<td> 355</td><td> 360</td><td> 365</td><td></td>

<td> Gin</td><td> His</td><td> Leu</td><td> Leu</td>

<td> 370</td><td> 375</td><td> 380</td><td></td>

<td> Tyr</td><td> Leu</td><td> Gly</td><td> Cys</td>

<td> 385</td><td> 390</td><td> 395</td><td> 400</td>

<td> Alá</td><td> Thr</td><td> Gly</td><td> Val</td>

<td> 405</td><td> 410</td><td> 415</td><td></td>

<td> Pro</td><td> Gly</td><td> Leu</td><td> Asp</td>

<td> 420</td><td> 425</td><td> 430</td><td></td>

<td> His</td><td> Gly</td><td> Val</td><td> Thr</td>

<td> 435</td><td> 440</td><td> 445</td><td></td>

<td> Phe</td><td> Ile</td><td> Asn</td><td> Gly</td>

<td> 450</td><td> 455</td><td> 460</td><td></td>

<td> Gin</td><td> Ile</td><td> Asn</td><td> Phe</td>

<td> 465</td><td> 470</td><td> 475</td><td> 480</td>

<td> Thr</td><td> Ser</td><td> Ser</td><td> Glu</td>

<td> 485</td><td> 490</td><td> 495</td><td></td>

<td> Thr</td><td> Thr</td><td> Leu</td><td> Tyr</td>

<td colspan="4"> Alá Arg Arg Alá</td>

<td> Ser</td><td> Thr</td><td> Thr</td><td> Ser</td>

<td> Lys</td><td> Thr</td><td> Pro</td><td> Alá</td>

<td> Ile</td><td> Leu</td><td> Phe</td><td> Thr</td>

<td> Asn</td><td> Met</td><td> Trp</td><td> Pro</td>

<td> Gin</td><td> Gly</td><td> Leu</td><td> Leu</td>

<td> Tyr</td><td> Ser</td><td> Gly</td><td> Cys</td>

<td> Alá</td><td> Thr</td><td> Gly</td><td> Val</td>

<td> Pro</td><td> Gly</td><td> Leu</td><td> Asp</td>

<td> His</td><td> Ser</td><td> Ile</td><td> Thr</td>

<td> Tyr</td><td> Val</td><td> Asn</td><td> Gly</td>

<td> Gly</td><td> Val</td><td> Val</td><td> Ser</td>

<td> Leu</td><td> Arg</td><td> Tyr</td><td> Met</td>

<td> Ile</td><td> Thr</td><td> Asp</td><td> Asn</td>

<td> Ser</td><td> Ser</td><td> Leu</td><td> Gly</td>

<td> Ser</td><td> Val</td><td> Lys</td><td> Asn</td>

<td> Leu</td><td> Gin</td><td> Pro</td><td> Leu</td>

<td> Glu</td><td> Leu</td><td> Ser</td><td> Gin</td>

<td> Leu</td><td> Asp</td><td> Lys</td><td> Asp</td>

<td> Asp</td><td> Glu</td><td> Pro</td><td> Pro</td>

<td> Leu</td><td> Ser</td><td> Glu</td><td> Alá</td>

<td> Leu</td><td> Asn</td><td> Phe</td><td> Thr</td>

<td> Gly</td><td> Ser</td><td> Alá</td><td> Thr</td>

<td> Arg</td><td> Pro</td><td> Leu</td><td> Phe</td>

<td> Gin</td><td> Leu</td><td> Ile</td><td> Ser</td>

<td> Asp</td><td> Thr</td><td> Thr</td><td> Cys</td>

<td> Ile</td><td> Gin</td><td> Gin</td><td> Leu</td>

<td> Gin</td><td> Leu</td><td> Gly</td><td> Phe</td>

<td> Tyr</td><td> Alá</td><td> Pro</td><td> Gin</td>

<td> His</td><td> Ile</td><td> Val</td><td> Asn</td>

<td> Tyr</td><td> Ile</td><td> Thr</td><td> Leu</td>

<td> Lys</td><td> Gly</td><td> Ser</td><td> Gin</td>

<td> Arg</td><td> Arg</td><td> Thr</td><td> Lys</td>

<td> Thr</td><td> Pro</td><td> Gly</td><td> Thr</td>

<td> Ser</td><td> Ile</td><td> Phe</td><td> Gly</td>

<td> Leu</td><td> Asn</td><td> Phe</td><td> Thr</td>

<td> Gly</td><td> Ser</td><td> Arg</td><td> Lys</td>

<td> Arg</td><td> Pro</td><td> Leu</td><td> Phe</td>

<td> Arg</td><td> Leu</td><td> Thr</td><td> Leu</td>

<td> Asp</td><td> Alá</td><td> Ile</td><td> Cys</td>

<td> Arg</td><td> Glu</td><td> Gin</td><td> Leu</td>

<td> Glu</td><td> Leu</td><td> Gly</td><td> Pro</td>

<td> Phe</td><td> Thr</td><td> His</td><td> Arg</td>

<td> Glu</td><td> Glu</td><td> Pro</td><td> Phe</td>

<td> Alá</td><td> Asp</td><td> Met</td><td> Gly</td>

<td> Val</td><td> Met</td><td> Lys</td><td> His</td>

<td> Alá</td><td> Arg</td><td> Tyr</td><td> Thr</td>

<td> Gly</td><td> Alá</td><td> Glu</td><td> Thr</td>

<td> Ser</td><td> Gly</td><td> Pro</td><td> Gly</td>

<td> Gin</td><td> Thr</td><td> His</td><td> Gly</td>

<td> Ser</td><td> Leu</td><td> Tyr</td><td> Leu</td>

<td> Thr</td><td> Thr</td><td> Pro</td><td> Lys</td>

<td> Thr</td><td> Thr</td><td> Alá</td><td> Met</td>

<td> Ile</td><td> Ser</td><td> Asn</td><td> Leu</td>

<td> Phe</td><td> Asn</td><td> Ser</td><td> Thr</td>

<td> Gin</td><td> Lys</td><td> Ser</td><td> Ser</td>

<td> Leu</td><td> Arg</td><td> Pro</td><td> Glu</td>

<td> Thr</td><td> Tyr</td><td> His</td><td> Pro</td>

<td> Tyr</td><td> Trp</td><td> Glu</td><td> Leu</td>

<td> Tyr</td><td> Val</td><td> Leu</td><td> Asp</td>

<td> Asn</td><td> Leu</td><td> Ser</td><td> Ile</td>

<td> Trp</td><td> Asn</td><td> Leu</td><td> Ser</td>

<td> Leu</td><td> Arg</td><td> Asp</td><td> Ile</td>

<td> Leu</td><td> His</td><td> Asp</td><td> Thr</td>

<td> Leu</td><td> Phe</td><td> Thr</td><td> His</td>

<td> Pro</td><td> Thr</td><td> Val</td><td> Tyr</td>

<td> Pro</td><td> Ser</td><td> Alá</td><td> Alá</td>

<td> Ile</td><td> Thr</td><td> Asn</td><td> Leu</td>

<td> Phe</td><td> Asn</td><td> Thr</td><td> Thr</td>

<td> Lys</td><td> Asn</td><td> Thr</td><td> Ser</td>

<td> Leu</td><td> Arg</td><td> Pro</td><td> Glu</td>

<td> Thr</td><td> His</td><td> Arg</td><td> Pro</td>

<td> Tyr</td><td> Leu</td><td> Glu</td><td> Leu</td>

<td> Tyr</td><td> Thr</td><td> Leu</td><td> Asp</td>

<td> Ser</td><td> Ser</td><td> Val</td><td> Pro</td>

<td> Thr</td><td> Leu</td><td> Asn</td><td> Phe</td>

<td> Gin</td><td> Pro</td><td> Gly</td><td> Ser</td>

<td> Leu</td><td> Leu</td><td> Ser</td><td> Pro</td>

<td> Gly</td><td> Cys</td><td> Arg</td><td> Val</td>

<td> Arg</td><td> Val</td><td> Asp</td><td> Leu</td>

<td> Leu</td><td> Pro</td><td> Ile</td><td> Lys</td>

<td> Ile</td><td> Thr</td><td> Arg</td><td> Leu</td>

<td> Asn</td><td> Gly</td><td> Tyr</td><td> Asn</td>

<td> Pro</td><td> Alá</td><td> Thr</td><td> Thr</td>

<td> Gly</td><td> Tyr</td><td> His</td><td> Leu</td>

<td> Gin</td><td> Tyr</td><td> Ser</td><td> Pro</td>

<td> Glu</td><td> Gly</td><td> Val</td><td> Leu</td>

<td> Met</td><td> Gly</td><td> Pro</td><td> Phe</td>

<td> Lys</td><td> Asp</td><td> Gly</td><td> Alá</td>

<td> Asp</td><td> Pro</td><td> Val</td><td> Gly</td>

<td> Ser</td><td> Gin</td><td> Leu</td><td> Thr</td>

<td> Arg</td><td> Asp</td><td> Ser</td><td> Leu</td>

<td> Arg</td><td> Gly</td><td> Glu</td><td> Tyr</td>

<td> Asn</td><td> Pro</td><td> Asp</td><td> Pro</td>

<td> Gin</td><td> Asp</td><td> Lys</td><td> Val</td>

<td> Phe</td><td> Arg</td><td> Phe</td><td> Cys</td>

ΕΡ 2 891 666 Β1

<td> 500</td><td> 505</td><td colspan="14"> 510</td>

<td> Leu</td><td> Val</td><td> Thr</td><td> Asn</td><td> Leu</td><td> Thr</td><td> Met</td><td> Asp</td><td> Ser</td><td> Val</td><td> Leu</td><td> Val</td><td> Thr</td><td> Val</td><td> Lys</td><td> Alá</td>

<td> 515</td><td> 520</td><td> 525</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Phe</td><td> Ser</td><td> Ser</td><td> Asn</td><td> Leu</td><td> Asp</td><td> Pro</td><td> Ser</td><td> Leu</td><td> Val</td><td> Glu</td><td> Gin</td><td> Val</td><td> Phe</td><td> Leu</td>

<td> 530</td><td> 535</td><td> 540</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asp</td><td> Lys</td><td> Thr</td><td> Leu</td><td> Asn</td><td> Alá</td><td> Ser</td><td> Phe</td><td> His</td><td> Trp</td><td> Leu</td><td> Gly</td><td> Ser</td><td> Thr</td><td> Tyr</td><td> Gin</td>

<td> 545</td><td> 550</td><td> 555</td><td> 560</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Val</td><td> Asp</td><td> He</td><td> His</td><td> Val</td><td> Thr</td><td> Glu</td><td> Met</td><td> Glu</td><td> Ser</td><td> Ser</td><td> Val</td><td> Tyr</td><td> Gin</td><td> Pro</td>

<td> 565</td><td> 570</td><td> 575</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Thr</td><td> Gin</td><td> His</td><td> Phe</td><td> Tyr</td><td> Leu</td><td> Asn</td><td> Phe</td><td> Thr</td><td> He</td><td> Thr</td>

<td> 580</td><td> 585</td><td> 590</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asn</td><td> Leu</td><td> Pro</td><td> Tyr</td><td> Ser</td><td> Gin</td><td> Asp</td><td> Lys</td><td> Alá</td><td> Gin</td><td> Pro</td><td> Gly</td><td> Thr</td><td> Thr</td><td> Asn</td><td> Tyr</td>

<td> 595</td><td> 600</td><td> 605</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> Arg</td><td> Asn</td><td> Lys</td><td> Arg</td><td> Asn</td><td> He</td><td> Glu</td><td> Asp</td><td> Alá</td><td> Leu</td><td> Asn</td><td> Gin</td><td> Leu</td><td> Phe</td><td> Arg</td>

<td> 610</td><td> 615</td><td> 620</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asn</td><td> Ser</td><td> Ser</td><td> He</td><td> Lys</td><td> Ser</td><td> Tyr</td><td> Phe</td><td> Ser</td><td> Asp</td><td> Cys</td><td> Gin</td><td> Val</td><td> Ser</td><td> Thr</td><td> Phe</td>

<td> 625</td><td> 630</td><td> 635</td><td> 640</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Arg</td><td> Ser</td><td> Val</td><td> Pro</td><td> Asn</td><td> Arg</td><td> His</td><td> His</td><td> Thr</td><td> Gly</td><td> Val</td><td> Asp</td><td> Ser</td><td> Leu</td><td> Cys</td><td> Asn</td>

<td> 645</td><td> 650</td><td> 655</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Phe</td><td> Ser</td><td> Pro</td><td> Leu</td><td> Alá</td><td> Arg</td><td> Arg</td><td> Val</td><td> Asp</td><td> Arg</td><td> Val</td><td> Alá</td><td> He</td><td> Tyr</td><td> Glu</td><td> Glu</td>

<td> 660</td><td> 665</td><td> 670</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Phe</td><td> Leu</td><td> Arg</td><td> Met</td><td> Thr</td><td> Arg</td><td> Asn</td><td> Gly</td><td> Thr</td><td> Gin</td><td> Leu</td><td> Gin</td><td> Asn</td><td> Phe</td><td> Thr</td><td> Leu</td>

<td> 675</td><td> 680</td><td> 685</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asp</td><td> Arg</td><td> Ser</td><td> Ser</td><td> Val</td><td> Leu</td><td> Val</td><td> Asp</td><td> Gly</td><td> Tyr</td><td> Ser</td><td> Pro</td><td> Asn</td><td> Arg</td><td> Asn</td><td> Glu</td>

<td> 690</td><td> 695</td><td> 700</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Leu</td><td> Thr</td><td> Gly</td><td> Asn</td><td> Ser</td><td> Asp</td><td> Leu</td><td> Pro</td><td> Phe</td><td> Trp</td><td> Alá</td><td> Val</td><td> He</td><td> Leu</td><td> He</td>

<td> 705</td><td> 710</td><td> 715</td><td> 720</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gly</td><td> Leu</td><td> Alá</td><td> Gly</td><td> Leu</td><td> Leu</td><td> Gly</td><td> Leu</td><td> He</td><td> Thr</td><td> Cys</td><td> Leu</td><td> He</td><td> Cys</td><td> Gly</td><td> Val</td>

<td> 725</td><td> 730</td><td> 735</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Val</td><td> Thr</td><td> Thr</td><td> Arg</td><td> Arg</td><td> Arg</td><td> Lys</td><td> Lys</td><td> Glu</td><td> Gly</td><td> Glu</td><td> Tyr</td><td> Asn</td><td> Val</td><td> Gin</td>

<td> 740</td><td> 745</td><td> 750</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> Gin</td><td> Cys</td><td> Pro</td><td> Gly</td><td> Tyr</td><td> Tyr</td><td> Gin</td><td> Ser</td><td> His</td><td> Leu</td><td> Asp</td><td> Leu</td><td> Glu</td><td> Asp</td><td> Leu</td>

<td> 755</td><td> 760</td><td> 765</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> Asn</td><td> Ser</td><td> Alá</td><td> Asp</td><td> He</td><td> Gin</td><td> His</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Arg</td><td> Ser</td><td> Ser</td><td> Leu</td><td> Glu</td>

<td> 770</td><td> 775</td><td> 780</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gly</td><td> Pro</td><td> Arg</td><td> Phe</td><td> Glu</td><td> Gin</td><td> Lys</td><td> Leu</td><td> He</td><td> Ser</td><td> Glu</td><td> Glu</td><td> Asp</td><td> Leu</td><td> Asn</td><td> Met</td>

<td> 785</td><td> 790</td><td> 795</td><td> 800</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> His</td><td> Thr</td><td> Gly</td><td> His</td><td> His</td><td> His</td><td> His</td><td> His</td><td> His</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> 805</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

&lt;210&gt;3 &lt;211&gt; 12 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 117.1 VH1 CDR &lt;400&gt;3

Gly Phe Ser Leu Ser Thr Pro Gly Met Gly Val Gly 1 5 10 &lt;210&gt;4 &lt;211&gt; 16 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 117.1 VH2 CDR &lt;400&gt;4

ΕΡ 2 891 666 Β1

His Ile Trp Trp Asp Asp Phe Lys Arg Asp Asn Pro Alá Leu Lys Ser 1 5 10 15 &lt;210&gt;5 &lt;211&gt; 12 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 117.1 VH3 CDR &lt;400&gt;5

Val Asp Gly Asn Phe Leu Ser Trp Tyr Phe Asp Val 1 5 10 &lt;210&gt;6 &lt;211&gt; 16 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 117.1 VL1 CDR &lt;400&gt;6

Arg Ser Ser Gin Ser Leu Val His Ser Asn Gly Asn Thr Tyr Leu His 1 5 10 15 &lt;210&gt;7 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 117.1 VL2 CDR &lt;400&gt;7

Lys Val Ser Asn Arg Phe Ser 1 5 &lt;210&gt;8 &lt;211&gt;9 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 117.1 VL3 CDR &lt;400&gt;8

Ser Gin Ser Arg Tyr Val Pro Glu Thr 1 5 &lt;210&gt;9 &lt;211&gt; 10 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 368.1 VH1 CDR &lt;400&gt; 9

Gly Tyr Ser Phe Thr Gly Phe Tyr Met His 1 5 10

ΕΡ 2 891 666 Β1 &lt;210&gt; 10 &lt;211&gt; 17 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 368.1 VH2 CDR &lt;400&gt; 10

Tyr Val Ser Cys Tyr Thr Gly Alá Thr Thr Tyr Thr Gin Lys Phe Lys

5 10 15

Gly &lt;210&gt; 11 &lt;211&gt;9 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 368.1 VH3 CDR &lt;400&gt; 11

Glu Gly Asp Tyr Tyr Ser Met Asp Phe 1 5 &lt;210&gt; 12 &lt;211&gt; 16 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 368.1 VL1 CDR &lt;400&gt; 12

Arg Ser Ser Gin Ser Leu Glu Arg Thr Asn Gly Asn Thr Tyr Leu His 1 5 10 15 &lt;210&gt; 13 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 368.1 VL2 CDR &lt;400&gt; 13

Lys Val Ser Ser Arg Phe Ser 1 5 &lt;210&gt; 14 &lt;211&gt;9 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 368.1 VL3 CDR &lt;400&gt; 14

Ser Gin Thr Thr His Gly Pro Pro Thr 1 5 &lt;210&gt; 15

ΕΡ 2 891 666 Β1 &lt;211&gt; 10 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 501.1 VH1 CDR &lt;400&gt; 15

Gly Tyr Ile Phe Thr Asp Tyr Gly Met Asn 1 5 10 &lt;210&gt; 16 &lt;211&gt; 17 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 501.1 VH2 CDR &lt;400&gt; 16

Cys Ile Asn Thr Tyr Thr Gly Glu Thr Ile Tyr Ser Asp Asp Phe Arg

5 10 15

Gly &lt;210&gt; 17 &lt;211&gt;9 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 501.1 VH3 CDR &lt;400&gt; 17

Gly Asn Tyr Arg Asp Alá Ile Asp Tyr 1 5 &lt;210&gt; 18 &lt;211&gt; 11 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 501.1 VL1 CDR &lt;400&gt; 18

Lys Alá Ser Gin Asp Ile Lys Ser Tyr Leu Ser 1 5 10 &lt;210&gt; 19 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 501.1 VL2 CDR &lt;400&gt; 19

Tyr Alá Thr Thr Leu Alá Asp 1 5 &lt;210&gt; 20 &lt;211&gt;9

ΕΡ 2 891 666 Β1 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 501.1 VL3 CDR &lt;400&gt; 20

Leu His His Asp Glu Ser Pro Phe Thr 1 5 &lt;210&gt; 21 &lt;211&gt; 10 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 776.1 VH1 CDR &lt;400&gt; 21

Gly Tyr Thr Phe Thr Asp Tyr Asn Ile His 1 5 10 &lt;210&gt; 22 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 776.1 VH2 CDR &lt;400&gt; 22

Tyr Ile Tyr Pro Tyr Asn Gly Val Ser Asp Tyr Asn Gin Asn Phe 1 5 10 15 &lt;210&gt; 23 &lt;211&gt; 12 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 776.1 VH3 CDR &lt;400&gt; 23

Arg Trp Asp Phe Gly Ser Gly Tyr Tyr Phe Asp Tyr 1 5 10 &lt;210&gt; 24 &lt;211&gt; 10 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 776.1 VL1 CDR &lt;400&gt; 24

Arg Alá Ser Ser Ser Val Ile Tyr Met Cys 1 5 10 &lt;210&gt; 25 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

EP 2 891 666 Β1 &lt;223&gt; 776.1 VL2 CDR &lt;400&gt; 25

Gly Thr Ser Thr Leu Alá Ser 1 5 &lt;210&gt; 26 &lt;211&gt;9 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 776.1 VL3 CDR &lt;400&gt; 26

Gin Gin Trp Ser Ser Asn Pro Phe Thr 1 5 &lt;210&gt; 27 &lt;211&gt; 131 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 117.1 light chain polypeptide variable region (117.1L) &lt;400&gt; 27

<td> Met Lys Leu 1 5 10 15</td><td> Pro</td><td> Val</td><td> Arg</td><td> Leu</td><td> Leu</td><td> Val</td><td> Leu</td><td> Met</td><td> Phe</td><td> Trp</td><td> Ile</td><td> Pro</td><td> Gly</td>

<td> Ser Ser Ser 20 25 30</td><td> Asp</td><td> Alá</td><td> Val</td><td> Met</td><td> Thr</td><td> Gin</td><td> Thr</td><td> Pro</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Pro</td><td> Val</td>

<td> Ser Leu Gly 35 40 45</td><td> Asp</td><td> Gin</td><td> Alá</td><td> Ser</td><td> Ile</td><td> Ser</td><td> Cys</td><td> Arg</td><td> Ser</td><td> Ser</td><td> Gin</td><td> Ser</td><td> Leu</td>

<td> Val His Ser 50 55 60</td><td> Asn</td><td> Gly</td><td> Asn</td><td> Thr</td><td> Tyr</td><td> Leu</td><td> His</td><td> Trp</td><td> Tyr</td><td> Leu</td><td> Gin</td><td> Lys</td><td> Pro</td>

<td> Gly Gin Ser 65 70 75 80</td><td> Pro</td><td> Lys</td><td> Leu</td><td> Leu</td><td> Ile</td><td> Tyr</td><td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Arg</td><td> Phe</td><td> Ser</td>

<td> Gly Val Pro 85 90 95</td><td> Asp</td><td> Arg</td><td> Phe</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Thr</td><td> Asp</td><td> Phe</td><td> Thr</td>

<td> Leu Arg Ile 100 105 110</td><td> Ser</td><td> Arg</td><td> Val</td><td> Glu</td><td> Alá</td><td> Glu</td><td> Asp</td><td> Leu</td><td> Gly</td><td> Val</td><td> Tyr</td><td> Phe</td><td> Cys</td>

<td> Ser Gin Ser 115 120 125 Glu Ile Lys 130</td><td> Arg</td><td> Tyr</td><td> Val</td><td> Pro</td><td> Trp</td><td> Thr</td><td> Phe</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Leu</td>

&lt;210&gt; 28 &lt;211&gt; 141 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 117.1 heavy chain polypeptide variable region (117.1 H) &lt;400&gt; 28

ΕΡ 2 891 666 Β1

<td> Met</td><td> Gly Arg</td><td> Leu</td><td> Thr</td><td> Ser</td><td> Ser</td><td> Phe</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Ile</td><td> Val</td><td> Pro</td><td> Alá</td><td> Tyr</td>

<td> 1 5</td><td> 10 15</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Val</td><td> Leu Ser</td><td> Gin</td><td> Val</td><td> Thr</td><td> Leu</td><td> Lys</td><td> Glu</td><td> Ser</td><td> Gly</td><td> Pro</td><td> Gly</td><td> Ile</td><td> Leu</td><td> Gin</td>

<td> 20</td><td> 25 30</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Ser Gin</td><td> Thr</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Ser</td><td> Phe</td><td> Ser</td><td> Gly</td><td> Phe</td><td> Ser</td><td> Leu</td>

<td> 35</td><td> 40 45</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Thr Pro</td><td> Gly</td><td> Met</td><td> Gly</td><td> Val</td><td> Gly</td><td> Trp</td><td> Ile</td><td> Arg</td><td> Gin</td><td> Pro</td><td> Ser</td><td> Gly</td><td> Lys</td>

<td> 50</td><td> 55 60</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gly</td><td> Leu Glu</td><td> Trp</td><td> Leu</td><td> Alá</td><td> His</td><td> Ile</td><td> Trp</td><td> Trp</td><td> Asp</td><td> Asp</td><td> Phe</td><td> Lys</td><td> Arg</td><td> Asp</td>

<td> 65</td><td> 70 75 80</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asn</td><td> Pro Alá</td><td> Leu</td><td> Lys</td><td> Ser</td><td> Arg</td><td> Leu</td><td> Thr</td><td> Ile</td><td> Ser</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Ser</td><td> Ser</td>

<td> 85</td><td> 90 95</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Gin Val</td><td> Phe</td><td> Leu</td><td> Lys</td><td> Ile</td><td> Alá</td><td> Ser</td><td> Val</td><td> Asp</td><td> Thr</td><td> Alá</td><td> Asp</td><td> Thr</td><td> Alá</td>

<td> 100</td><td> 105 110</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Tyr Tyr</td><td> Cys</td><td> Val</td><td> Arg</td><td> Val</td><td> Asp</td><td> Gly</td><td> Asn</td><td> Phe</td><td> Leu</td><td> Ser</td><td> Trp</td><td> Tyr</td><td> Phe</td>

<td> 115</td><td> 120 125</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asp</td><td> Val Trp</td><td> Gly</td><td> Alá</td><td> Gly</td><td> Thr</td><td> Thr</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser</td><td></td><td></td><td></td>

130 135 140 &lt;210&gt; 29 &lt;211&gt; 131 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 368.1 light chain polypeptide variable region (368.1 L) &lt;400&gt; 29

Met Lys Leu Pro Val Arg Leu Leu Val Leu Met Phe Trp Ile Pro Alá

5 10 15

<td> Ser Ser Ser 20 25 30</td><td> Asp</td><td> Val</td><td> Val</td><td> Met</td><td> Thr</td><td> Gin</td><td> Thr</td><td> Pro</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Pro</td><td> Val</td>

<td> Ser Leu Gly 35 40 45</td><td> Asp</td><td> Gin</td><td> Alá</td><td> Ser</td><td> Ile</td><td> Ser</td><td> Cys</td><td> Arg</td><td> Ser</td><td> Ser</td><td> Gin</td><td> Ser</td><td> Leu</td>

<td> Glu Arg Thr 50 55 60</td><td> Asn</td><td> Gly</td><td> Asn</td><td> Thr</td><td> Tyr</td><td> Leu</td><td> His</td><td> Trp</td><td> Tyr</td><td> Leu</td><td> Gin</td><td> Lys</td><td> Pro</td>

<td> Gly Gin Ser 65 70 75 80</td><td> Pro</td><td> Lys</td><td> Leu</td><td> Leu</td><td> Ile</td><td> Tyr</td><td> Lys</td><td> Val</td><td> Ser</td><td> Ser</td><td> Arg</td><td> Phe</td><td> Ser</td>

<td> Gly Val Pro 85 90 95</td><td> Asp</td><td> Arg</td><td> Phe</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Thr</td><td> Asp</td><td> Phe</td><td> Thr</td>

<td> Leu Lys Ile 100 105 110</td><td> Ser</td><td> Arg</td><td> Val</td><td> Glu</td><td> Alá</td><td> Glu</td><td> Asp</td><td> Leu</td><td> Gly</td><td> Ile</td><td> Tyr</td><td> Phe</td><td> Cys</td>

<td> Ser Gin Thr</td><td> Thr</td><td> His</td><td> Gly</td><td> Pro</td><td> Pro</td><td> Thr</td><td> Cys</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Leu</td>

115 120 125 Glu Ile Lys 130 &lt;210&gt; 30 &lt;211&gt; 137 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 368.1 heavy chain polypeptide variable region (368.1 H) &lt;400&gt; 30

ΕΡ 2 891 666 Β1

<td> Met</td><td> Gly Trp</td><td> Ile</td><td> Trp</td><td> Ile</td><td> Phe</td><td> Leu</td><td> Phe</td><td> Leu</td><td> Leu</td><td> Ser</td><td> Gly</td><td> Thr</td><td> Alá</td><td> Gly</td>

<td> 1 5</td><td> 10 15</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Val</td><td> His Ser</td><td> Glu</td><td> Val</td><td> Gin</td><td> Leu</td><td> Gin</td><td> Gin</td><td> Ser</td><td> Gly</td><td> Pro</td><td> Glu</td><td> Leu</td><td> Val</td><td> Arg</td>

<td> 20</td><td> 25 30</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Gly Alá</td><td> Ser</td><td> Val</td><td> Lys</td><td> Ile</td><td> Ser</td><td> Cys</td><td> Lys</td><td> Alá</td><td> Ser</td><td> Gly</td><td> Tyr</td><td> Ser</td><td> Phe</td>

<td> 35</td><td> 40 45</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Gly Phe</td><td> Tyr</td><td> Met</td><td> His</td><td> Trp</td><td> Val</td><td> Lys</td><td> Gin</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Lys</td><td> Ser</td><td> Leu</td>

<td> 50</td><td> 55 60</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Glu</td><td> Trp Ile</td><td> Gly</td><td> Tyr</td><td> Val</td><td> Ser</td><td> Cys</td><td> Tyr</td><td> Thr</td><td> Gly</td><td> Alá</td><td> Thr</td><td> Thr</td><td> Tyr</td><td> Thr</td>

<td> 65</td><td> 70 75 80</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> Lys Phe</td><td> Lys</td><td> Gly</td><td> Lys</td><td> Alá</td><td> Thr</td><td> Phe</td><td> Thr</td><td> Val</td><td> Asp</td><td> Thr</td><td> Ser</td><td> Ser</td><td> Ser</td>

<td> 85</td><td> 90 95</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Alá Tyr</td><td> Met</td><td> Gin</td><td> Leu</td><td> Asn</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Ser</td><td> Glu</td><td> Asp</td><td> Ser</td><td> Alá</td><td> Val</td>

<td> 100</td><td> 105 110</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Tyr</td><td> Tyr Cys</td><td> Alá</td><td> Arg</td><td> Glu</td><td> Gly</td><td> Asp</td><td> Tyr</td><td> Tyr</td><td> Ser</td><td> Met</td><td> Asp</td><td> Phe</td><td> Trp</td><td> Gly</td>

<td> 115</td><td> 120 125</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> Gly Thr</td><td> Ser</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

130 135 &lt;210&gt; 31 &lt;211&gt; 128 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 501.1 light chain polypeptide variable region (501.1L) &lt;400&gt; 31

<td> Met Asp Met 1 5 10 15</td><td> Arg</td><td> Alá</td><td> Pro</td><td> Alá</td><td> Gin</td><td> Phe</td><td> Phe</td><td> Gly</td><td> Ile</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Trp</td>

<td> Phe Pro Gly 20 25 30</td><td> Ile</td><td> Arg</td><td> Cys</td><td> Asp</td><td> Ile</td><td> Lys</td><td> Met</td><td> Thr</td><td> Gin</td><td> Ser</td><td> Pro</td><td> Ser</td><td> Ser</td>

<td> Ile Tyr Alá 35 40 45</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Glu</td><td> Arg</td><td> Val</td><td> Thr</td><td> Ile</td><td> Thr</td><td> Cys</td><td> Lys</td><td> Alá</td><td> Ser</td>

<td> Gin Asp Ile 50 55 60</td><td> Lys</td><td> Ser</td><td> Tyr</td><td> Leu</td><td> Ser</td><td> Trp</td><td> Tyr</td><td> Gin</td><td> Gin</td><td> Lys</td><td> Pro</td><td> Trp</td><td> Lys</td>

<td> Ser Pro Lys 65 70 75 80</td><td> Thr</td><td> Leu</td><td> Ile</td><td> Tyr</td><td> Tyr</td><td> Alá</td><td> Thr</td><td> Thr</td><td> Leu</td><td> Alá</td><td> Asp</td><td> Gly</td><td> Val</td>

<td> Pro Ser Arg 85 90 95</td><td> Phe</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gin</td><td> Asp</td><td> Tyr</td><td> Ser</td><td> Leu</td><td> Ile</td>

<td> Ile Asn Ser 100 105 110</td><td> Leu</td><td> Glu</td><td> Ser</td><td> Asp</td><td> Asp</td><td> Ile</td><td> Alá</td><td> Thr</td><td> Tyr</td><td> Phe</td><td> Cys</td><td> Leu</td><td> His</td>

<td> His Asp Glu 115 120 125</td><td> Ser</td><td> Pro</td><td> Phe</td><td> Thr</td><td> Phe</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Leu</td><td> Glu</td><td> Ile</td>

&lt;210&gt; 32 &lt;211&gt; 137 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 501.1 heavy chain polypeptide variable region (501.1H) &lt;400&gt; 32

ΕΡ 2 891 666 Β1

<td> Met</td><td> Alá Trp</td><td> Val</td><td> Trp</td><td> Thr</td><td> Leu</td><td> Leu</td><td> Phe</td><td> Leu</td><td> Met</td><td> Alá</td><td> Alá</td><td> Alá</td><td> Gin</td><td> Ser</td>

<td> 1 5</td><td> 10 15</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Alá</td><td> Gin Alá</td><td> Gin</td><td> Ile</td><td> Gin</td><td> Leu</td><td> Val</td><td> Gin</td><td> Ser</td><td> Gly</td><td> Pro</td><td> Glu</td><td> Leu</td><td> Lys</td><td> Lys</td>

<td> 20 :</td><td> 25 30</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Gly Glu</td><td> Thr</td><td> Val</td><td> Gin</td><td> Ile</td><td> Ser</td><td> Cys</td><td> Lys</td><td> Alá</td><td> Ser</td><td> Gly</td><td> Tyr</td><td> Ile</td><td> Phe</td>

<td> 35</td><td> 40 45</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Asp Tyr</td><td> Gly</td><td> Met</td><td> Asn</td><td> Trp</td><td> Val</td><td> Lys</td><td> Gin</td><td> Alá</td><td> Pro</td><td> Gly</td><td> Lys</td><td> Gly</td><td> Leu</td>

<td> 50</td><td> 55 60</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Lys</td><td> Trp Met</td><td> Gly</td><td> Cys</td><td> Ile</td><td> Asn</td><td> Thr</td><td> Tyr</td><td> Thr</td><td> Gly</td><td> Glu</td><td> Thr</td><td> Ile</td><td> Tyr</td><td> Ser</td>

<td> 65</td><td> 70 75 80</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asp</td><td> Asp Phe</td><td> Arg</td><td> Gly</td><td> Arg</td><td> Phe</td><td> Alá</td><td> Ile</td><td> Ser</td><td> Leu</td><td> Glu</td><td> Thr</td><td> Ser</td><td> Alá</td><td> Ser</td>

<td> 85</td><td> 90 95</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Alá Phe</td><td> Ile</td><td> Gin</td><td> Ile</td><td> Asn</td><td> Asn</td><td> Leu</td><td> Lys</td><td> Asn</td><td> Glu</td><td> Asp</td><td> Alá</td><td> Alá</td><td> Thr</td>

<td> 100</td><td> 105 110</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Tyr</td><td> Phe Cys</td><td> Alá</td><td> Arg</td><td> Gly</td><td> Asn</td><td> Tyr</td><td> Arg</td><td> Asp</td><td> Alá</td><td> Ile</td><td> Asp</td><td> Tyr</td><td> Trp</td><td> Gly</td>

<td> 115</td><td> 120 125</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> Gly Thr</td><td> Ser</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

130 135 &lt;210&gt; 33 &lt;211 &gt;127 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 776.1 light chain polypeptide variable region (776.1 L) 25 &lt;400&gt; 33

<td> Met</td><td> Asp Phe</td><td> Gin</td><td> Val</td><td> Gin</td><td> Ile</td><td> Phe</td><td> Ser</td><td> Phe</td><td> Leu</td><td> Leu</td><td> Ile</td><td> Ser</td><td> Alá</td><td> Ser</td>

<td> 1 5</td><td> 10 15</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Val</td><td> Ile Met</td><td> Ser</td><td> Arg</td><td> Gly</td><td> Gin</td><td> Ile</td><td> Val</td><td> Leu</td><td> Ser</td><td> Gin</td><td> Ser</td><td> Pro</td><td> Alá</td><td> Ile</td>

<td> 20</td><td> 25 30</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Phe Alá</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Glu</td><td> Thr</td><td> Val</td><td> Thr</td><td> Met</td><td> Thr</td><td> Cys</td><td> Arg</td><td> Alá</td><td> Ser</td>

<td> 35</td><td> 40 45</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Ser Val</td><td> Ile</td><td> Tyr</td><td> Met</td><td> Cys</td><td> Trp</td><td> Asn</td><td> Gin</td><td> Gin</td><td> Lys</td><td> Pro</td><td> Gly</td><td> Ser</td><td> Ser</td>

<td> 50</td><td> 55 60</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Lys Pro</td><td> Trp</td><td> Ile</td><td> Tyr</td><td> Gly</td><td> Thr</td><td> Ser</td><td> Thr</td><td> Leu</td><td> Alá</td><td> Ser</td><td> Gly</td><td> Val</td><td> Pro</td>

<td> 65</td><td> 70 75 80</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Arg Phe</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Thr</td><td> Ser</td><td> Tyr</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Ile</td>

<td> 85</td><td> 90 95</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Arg Val</td><td> Glu</td><td> Alá</td><td> Glu</td><td> Asp</td><td> Alá</td><td> Alá</td><td> Thr</td><td> Tyr</td><td> Tyr</td><td> Cys</td><td> Gin</td><td> Gin</td><td> Trp</td>

<td> 100</td><td> 105 110</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Ser Asn</td><td> Pro</td><td> Phe</td><td> Thr</td><td> Phe</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Leu</td><td> Glu</td><td> Ile</td><td></td>

<td> 115</td><td> 120 125</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

&lt;210&gt; 34 &lt;211&gt; 139 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 776.1 heavy chain polypeptide variable region (776.1 H) &lt;400&gt; 34

<td> Met</td><td> Gly Trp</td><td> Ser</td><td> Trp</td><td> Ile</td><td> Phe</td><td> Leu</td><td> Phe</td><td> Leu</td><td> Leu</td><td> Ser</td><td> Gly</td><td> Thr</td><td> Alá</td><td> Gly</td>

<td> 1 5</td><td> 10 15</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Val</td><td> His Ser</td><td> Glu</td><td> Val</td><td> Gin</td><td> Leu</td><td> Gin</td><td> Gin</td><td> Ser</td><td> Gly</td><td> Pro</td><td> Glu</td><td> Leu</td><td> Val</td><td> Lys</td>

<td> 20</td><td> 25 30</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Gly Alá</td><td> Ser</td><td> Val</td><td> Lys</td><td> Ile</td><td> Ser</td><td> Cys</td><td> Lys</td><td> Alá</td><td> Ser</td><td> Gly</td><td> Tyr</td><td> Thr</td><td> Phe</td>

<td> 35</td><td> 40 45</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

ΕΡ 2 891 666 Β1

<td> Thr</td><td> Asp</td><td> Tyr</td><td> Asn</td><td> He</td><td> His</td><td> Trp</td><td> Val</td><td> Lys</td><td> Gin</td><td> Ser</td><td> His</td><td> Gly</td><td> Lys</td><td> He</td><td> Leu</td>

<td> 50</td><td> 55 60</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Glu</td><td> Trp</td><td> He</td><td> Gly</td><td> Tyr</td><td> He</td><td> Tyr</td><td> Pro</td><td> Tyr</td><td> Asn</td><td> Gly</td><td> Val</td><td> Ser</td><td> Asp</td><td> Tyr</td><td> Asn</td>

<td> 65</td><td> 70 75</td><td> 80</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> Asn</td><td> Phe</td><td> Lys</td><td> Ser</td><td> Lys</td><td> Alá</td><td> Thr</td><td> Leu</td><td> He</td><td> Val</td><td> Asp</td><td> Asn</td><td> Ser</td><td> Ser</td><td> Asn</td>

<td> 85</td><td colspan="2"> 90 95</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Alá</td><td> Tyr</td><td> Met</td><td> Glu</td><td> Leu</td><td> Arg</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Ser</td><td> Glu</td><td> Asp</td><td> Ser</td><td> Alá</td><td> Val</td>

<td> 100</td><td> 105</td><td> 110</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Tyr</td><td> Tyr</td><td> Cys</td><td> Alá</td><td> Arg</td><td> Trp</td><td> Asp</td><td> Phe</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Tyr</td><td> Tyr</td><td> Phe</td><td> Asp</td><td> Tyr</td>

<td> 115</td><td> 120</td><td> 125</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Trp</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Thr</td><td> Thr</td><td> Leu</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser</td><td></td><td></td><td></td><td></td><td></td>

130 135 &lt;210&gt; 35 &lt;211&gt; 393 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 117.1 light chain polypeptide variable region (117.1L) &lt;400&gt; 35 atgaagttgc ctgttaggct gttggtgctg atgttctgga ttcctggttc cagcagtgat 60 gctgtgatga cccaaactcc actctccctg cctgtcagtc ttggagatca ggcctccatc 120 tcttgcagat ctagtcagag ccttgtacac agtaatggaa acacctattt acattggtac 180 ctgcagaagc caggccagtc tccaaaactc ctgatctaca aagtttccaa ccgattttct 240 ggggtcccag acaggttcag tggcagtgga tcagggacag atttcacact caggatcagc 300 agagtggagg ctgaggatct gggagtttat ttctgctctc aaagtagata tgttccgtgg 360 acgttcggtg gaggcaccaa gctggaaatc aaa 393 &lt;210&gt; 36 &lt;211&gt; 423 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 117.1 heavy chain polypeptide variable region (117.1 H) &lt;400&gt; 36 atgggcaggc ttacttcttc attcctgcta ctgattgtcc ctgcatatgt cctgtcccag 60 gttactctga aagagtctgg ccctgggata ttgcagccct cccagaccct cagtctgact 120 tgttctttct ctgggttttc actgagcact cctggtatgg gtgtaggctg gattcgtcag 180 ccatcaggga agggtctgga gtggctggca cacatttggt gggatgattt caagcgcgat 240 aatccagccc ttaagagccg actgactatc tctaaggata cctccagcag ccaggttttc 300 ctcaaaatcg ccagtgtgga cactgcagat actgccacat attactgtgt tcgagtggat 360 ggtaacttcc tctcctggta tttcgatgtc tggggcgctg ggaccacggt caccgtctcc 420 tea 423 &lt;210&gt; 37 &lt;211&gt; 393 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 368.1 light chain polypeptide variable region (368.1 L) &lt;400&gt; 37

ΕΡ 2 891 666 Β1 atgaagttgc ctgttaggct gttggtgctg atgttctgga ttcctgcttc cagcagtgat gttgtgatga cccaaactcc actctccctg cctgtcagtc ttggagatca agcctccatc tcttgcagat ctagtcagag ccttgaacgc actaatggaa acacctattt acattggtac ctgcagaagc caggccagtc tccaaaactc ctgatctaca aagtttccag ccgattttct ggggtcccag ataggttcag tggcagtgga tcagggacag atttcacact caagatcagt agagtggagg ctgaggatct gggaatttat ttctgttctc aaactacaca tggtcctccg acgtgcggtg gaggcaccaa gctggaaatc aaa 393 &lt;210&gt; 38 &lt;211&gt; 411 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 368.1 heavy chain polypeptide variable region (368.1 H) &lt;400&gt; 38 atgggatgga tctggatctt tctcttcctc ctgtcaggaa ctgcaggtgt ccactctgag 60 gtccagctgc agcagtctgg acctgagtta gtgaggactg gggcttcagt gaagatatcc tgcaaggctt ctggttactc attcactggt ttctacatgc actgggtcaa gcagagcctt ggaaagagcc ttgagtggat tggatatgtt agttgttaca ctggtgctac tacctacacc cagaagttca agggcaaggc cacatttact gttgacacat cctccagcac agcctacatg caactcaaca gcctgacatc tgaagactct gcggtctatt actgtgcaag agaaggggat tactattcta tggacttctg gggtcaagga acctcagtca ccgtctcctc a 411 &lt;210&gt; 39 &lt;211&gt; 386 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 501.1 light chain polypeptide variable region (501.1L) &lt;400&gt; 39 atggacatga gggcccctgc tcagtttttt gggatcttgt tgctctggtt tccaggtatc agatgtgaca tcaagatgac ccagtctcca tcgtccattt atgcatcgct gggagagagg gtcactataa cttgcaaggc gagtcaggac attaaaagct atttaagctg gtaccaacag aaaccctgga aatctcctaa gaccctgatc tattatgcaa caaccttggc agatggggtc ccatcaagat tcagtggcag tggatctggg caagattatt ctctaatcat caacagcctg gagtctgacg atatagctac ttatttctgt ctacaccatg atgagagccc attcacgttc ggctcgggga caaaattgga aataaa 386 &lt;210&gt; 40 &lt;211&gt; 411 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 501.1 heavy chain polypeptide variable region (501.1H) &lt;400&gt; 40

ΕΡ 2 891 666 Β1 atggcttggg tgtggacctt gctgttcctg atggcagctg cccaaagtgc ccaagcacag 60 atccagttgg tgcagtctgg acctgagctg aagaagcctg gagagacagt ccagatctcc 120 tgcaaggctt ctggctatat cttcacagac tatggaatga actgggtgaa acaggctcca 180 ggaaagggtt taaaatggat gggctgtata aacacctaca ctggagagac aatatatagt 240 gatgacttca ggggacggtt tgccatctct ttggaaacct ctgccagcac tgcctttatt 300 cagatcaaca acctcaaaaa tgaggacgcg gcaacatatt tctgtgcaag gggaaattac 360 agggatgcta ttgactattg gggtcaagga acctcagtca ccgtctcctc a 411 &lt;210&gt; 41 &lt;211&gt; 383 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 776.1 light chain polypeptide variable region (776.1 L) &lt;400&gt; 41 atggattttc aagtgcagat tttcagcttc ctgctaatca gtgcttcagt cataatgtcc 60 agaggacaaa ttgttctctc ccagtctcca gcaatcctgt ttgcatctcc aggggagacg 120 gtcacaatga cttgcagggc cagttcaagt gtaatttaca tgtgttggaa tcagcagaag 180 ccaggatcct cccccaaacc ctggatttat ggcacatcca ccctggcttc tggagtccct 240 actcgcttca gtggcagtgg gtctgggacc tcttactctc tcacaatcag cagagtagag 300 gctgaagatg ctgccactta ttactgccag cagtggagta gtaacccatt cacgttcggc 360 tcggggacaa agttggaaat aaa 383 &lt;210&gt; 42 &lt;211&gt; 417 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 776.1 heavy chain polypeptide variable region (776.1 H) &lt;400&gt; 42 atgggatgga gctggatctt tctcttcctc ctgtcaggaa ctgcaggcgt ccactctgag 60 gtccagcttc agcagtcagg acctgagctg gtgaaacctg gggcctcagt gaagatatcc 120 tgcaaggctt ctggatacac attcactgac tacaacattc actgggtgaa acagagccat 180 ggaaagatcc ttgagtggat tggatatatt tatccttata atggtgtttc tgactacaac 240 cagaatttca agagcaaggc cacattgatt gtagacaatt cctccaacac agcctacatg 300 gaactccgca gcctgacatc tgaggactct gcagtctatt attgtgcaag atgggacttc 360 ggtagtggct actactttga ctactggggc caaggcacca ctctcacagt ctcctca 417 &lt;210&gt; 43 &lt;211&gt; 45 &lt;212&gt; RNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; primer (see section 6.6) &lt;400&gt; 43 rcgacuggag cacgaggaca cugacaugga cugaaggagu agaaa 45 &lt;210&gt; 44 &lt;211&gt; 54 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; primer (see section 6.6) &lt;400&gt; 44 gctgtcaacg atacgctacg taacggcatg acagtgtttt tttttttttt tttt 54 &lt;210&gt; 45 &lt;211&gt; 30

ΕΡ 2 891 666 Β1 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; primer (see section 6.6) &lt;400&gt; 45 ayctccacac acaggrrcca gtggatagac &lt;210&gt; 46 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; primer (see section 6.6) &lt;400&gt; 46 ggatacagtt ggtgcagcat c 21 &lt;210&gt; 47 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; primer (see section 6.6) &lt;400&gt; 47 cgactggagc acgaggacac tga 23 &lt;210&gt; 48 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; primer (see section 6.6) &lt;400&gt; 48 attaaccctc actaaaggga 20 &lt;210&gt; 49 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; primer (see section 6.6) &lt;400&gt; 49 taatacgact cactataggg 20 &lt;210&gt; 50 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; primer (see section 6.6) &lt;400&gt; 50 attaaccctc actaaaggga 20 &lt;210&gt; 51 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; primer (see section 6.6) &lt;400&gt; 51 taatacgact cactataggg 20 &lt;210&gt; 52 &lt;211&gt; 383 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

ΕΡ 2 891 666 Β1 &lt;220&gt;

&lt;223&gt; 725.1 light chain polypeptide variable region (725.1 L) &lt;400&gt; 52 atggattttc aagtgcagat tttcagcttc ctgctaatca gtgcttcagt cataatgtcc 60 agaggacaaa ttattctctc ccagtctcca gcaatcctgt ctgcatctcc aggggagaag 120 gtcacaatga cttgcagggc cagttcaagt gtaagttcca ttcactggta ccagcagaag 180 ccagaatcct cccccaaacc ctggatttac gccacatcca acctggcttc tggagtccct 240 gttcgcttca gtggcagtgg gtctgggacc tcttatactc tcacaatcag cagaatggag 300 gctgcagatg ctgccactta ttactgccag cagtggagta ttgatccagc cacgttcgga 360 ggggggacca agctggaaat aaa 383 &lt;210&gt; 53 &lt;211&gt; 135 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 725.1 heavy chain polypeptide variable region (725.1 H) &lt;400&gt; 53

<td> Met</td><td> Alá Trp</td><td> Val</td><td> Trp</td><td> Thr</td><td> Leu</td><td> Leu</td><td> Phe</td><td> Leu</td><td> Met</td><td> Alá</td><td> Alá</td><td> Alá</td><td> Gin</td><td> Ser</td>

<td> 1 5</td><td> 10 15</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Alá</td><td> Gin Alá</td><td> Gin</td><td> Ile</td><td> Gin</td><td> Leu</td><td> Val</td><td> Gin</td><td> Ser</td><td> Gly</td><td> Pro</td><td> Glu</td><td> Leu</td><td> Lys</td><td> Lys</td>

<td> 20</td><td> 25 30</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Gly Glu</td><td> Thr</td><td> Val</td><td> Lys</td><td> Ile</td><td> Ser</td><td> Cys</td><td> Lys</td><td> Alá</td><td> Ser</td><td> Gly</td><td> Tyr</td><td> Ser</td><td> Phe</td>

<td> 35</td><td> 40 45</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Asn Tyr</td><td> Gly</td><td> Met</td><td> Asn</td><td> Trp</td><td> Val</td><td> Lys</td><td> Gin</td><td> Alá</td><td> Pro</td><td> Gly</td><td> Lys</td><td> Gly</td><td> Leu</td>

<td> 50</td><td> 55 60</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Lys</td><td> Trp Met</td><td> Gly</td><td> Trp</td><td> Ile</td><td> Asn</td><td> Alá</td><td> Tyr</td><td> Ile</td><td> Gly</td><td> Glu</td><td> Pro</td><td> Thr</td><td> Tyr</td><td> Alá</td>

<td> 65</td><td> 70 75 80</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Asp</td><td> Asp Phe</td><td> Lys</td><td> Gly</td><td> Arg</td><td> Phe</td><td> Alá</td><td> Phe</td><td> Ser</td><td> Leu</td><td> Glu</td><td> Alá</td><td> Ser</td><td> Thr</td><td> His</td>

<td> 85</td><td> 90 95</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Alá Tyr</td><td> Leu</td><td> Gin</td><td> Ile</td><td> Asn</td><td> Ser</td><td> Leu</td><td> Lys</td><td> Ser</td><td> Glu</td><td> Asp</td><td> Thr</td><td> Alá</td><td> Thr</td>

<td> 100</td><td> 105 110</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Tyr</td><td> Phe Cys</td><td> Alá</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Asn</td><td> Ser</td><td> Leu</td><td> Asp</td><td> Phe</td><td> Trp</td><td> Gly</td><td> Gin</td><td> Gly</td>

115 120 125

Thr Thr Leu Thr Val Ser Ser 130 135 &lt;210&gt; 54 &lt;211&gt; 127 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 725.1 light chain polypeptide variable region (725.1 L) &lt;400&gt; 54

<td> Met</td><td> Asp Phe</td><td> Gin</td><td> Val</td><td> Gin</td><td> Ile</td><td> Phe</td><td> Ser</td><td> Phe</td><td> Leu</td><td> Leu</td><td> Ile</td><td> Ser</td><td> Alá</td><td> Ser</td>

<td> 1 5</td><td> 10 15</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Val</td><td> Ile Met</td><td> Ser</td><td> Arg</td><td> Gly</td><td> Gin</td><td> Ile</td><td> Ile</td><td> Leu</td><td> Ser</td><td> Gin</td><td> Ser</td><td> Pro</td><td> Alá</td><td> Ile</td>

<td> 20</td><td> 25 30</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Ser Alá</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Glu</td><td> Lys</td><td> Val</td><td> Thr</td><td> Met</td><td> Thr</td><td> Cys</td><td> Arg</td><td> Alá</td><td> Ser</td>

<td> 35</td><td> 40 45</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Ser Val</td><td> Ser</td><td> Ser</td><td> Ile</td><td> His</td><td> Trp</td><td> Tyr</td><td> Gin</td><td> Gin</td><td> Lys</td><td> Pro</td><td> Glu</td><td> Ser</td><td> Ser</td>

<td> 50</td><td> 55 60</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Lys Pro</td><td> Trp</td><td> Ile</td><td> Tyr</td><td> Alá</td><td> Thr</td><td> Ser</td><td> Asn</td><td> Leu</td><td> Alá</td><td> Ser</td><td> Gly</td><td> Val</td><td> Pro</td>

ΕΡ 2 891 666 Β1

70 75 80

<td> Val</td><td> Arg Phe</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Thr</td><td> Ser</td><td> Tyr</td><td> Thr</td><td> Leu</td><td> Thr</td><td> Ile</td>

<td> 85</td><td> 90 95</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Arg Met</td><td> Glu</td><td> Alá</td><td> Alá</td><td> Asp</td><td> Alá</td><td> Alá</td><td> Thr</td><td> Tyr</td><td> Tyr</td><td> Cys</td><td> Gin</td><td> Gin</td><td> Trp</td>

<td> 100</td><td> 105 110</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Ile Asp</td><td> Pro</td><td> Alá</td><td> Thr</td><td> Phe</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Leu</td><td> Glu</td><td> Ile</td><td></td>

115 120 125 &lt;210&gt; 55 &lt;211&gt; 141 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 16Η9 heavy chain polypeptide variable region (16H9H) &lt;400&gt; 55

<td> Met</td><td> Lys Cys</td><td> Ser</td><td> Trp</td><td> Val</td><td> Ile</td><td> Phe</td><td> Phe</td><td> Leu</td><td> Met</td><td> Alá</td><td> Val</td><td> Val</td><td> Thr</td><td> Gly</td>

<td> 1 5</td><td> 10 15</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Val</td><td> Asn Ser</td><td> Glu</td><td> Val</td><td> Gin</td><td> Leu</td><td> Gin</td><td> Gin</td><td> Ser</td><td> Gly</td><td> Alá</td><td> Glu</td><td> Leu</td><td> Val</td><td> Lys</td>

<td> 20</td><td> 25 30</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Gly Alá</td><td> Ser</td><td> Val</td><td> Lys</td><td> Leu</td><td> Ser</td><td> Cys</td><td> Thr</td><td> Alá</td><td> Ser</td><td> Gly</td><td> Phe</td><td> Asn</td><td> Ile</td>

<td> 35</td><td> 40 45</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Lys</td><td> Asp Thr</td><td> Tyr</td><td> Met</td><td> His</td><td> Trp</td><td> Val</td><td> Lys</td><td> Gin</td><td> Arg</td><td> Pro</td><td> Glu</td><td> Gin</td><td> Gly</td><td> Leu</td>

<td> 50</td><td> 55 60</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Glu</td><td> Trp Ile</td><td> Gly</td><td> Arg</td><td> Ile</td><td> Asp</td><td> Pro</td><td> Alá</td><td> Asn</td><td> Gly</td><td> Asn</td><td> Thr</td><td> Lys</td><td> Tyr</td><td> Asp</td>

<td> 65</td><td> 70 75 80</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Lys Phe</td><td> Gin</td><td> Gly</td><td> Lys</td><td> Alá</td><td> Thr</td><td> Ile</td><td> Thr</td><td> Alá</td><td> Asp</td><td> Thr</td><td> Ser</td><td> Ser</td><td> Asn</td>

<td> 85</td><td> 90 95</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Alá Tyr</td><td> Val</td><td> Gin</td><td> Leu</td><td> Ser</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Ser</td><td> Glu</td><td> Asp</td><td> Thr</td><td> Alá</td><td> Val</td>

<td> 100</td><td> 105 110</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Tyr</td><td> Tyr Cys</td><td> Alá</td><td> Ser</td><td> Ser</td><td> Asp</td><td> Ile</td><td> Tyr</td><td> Tyr</td><td> Gly</td><td> Asn</td><td> Pro</td><td> Gly</td><td> Gly</td><td> Phe</td>

<td> 115</td><td> 120 125</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Alá</td><td> Tyr Trp</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Thr</td><td> Leu</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Alá</td><td></td><td></td><td></td>

130 135 140 &lt;210&gt; 56 &lt;211&gt; 129 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 16H9 light chain polypeptide variable region (16H9L) &lt;400&gt; 56

<td> Met</td><td> Asp Phe</td><td> Gin</td><td> Val</td><td> Gin</td><td> Ile</td><td> Phe</td><td> Ser</td><td> Phe</td><td> Leu</td><td> Leu</td><td> Ile</td><td> Ser</td><td> Alá</td><td> Ser</td>

<td> 1 5</td><td> 10 15</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Val</td><td> Ile Met</td><td> Ser</td><td> Arg</td><td> Gly</td><td> Gin</td><td> Ile</td><td> Val</td><td> Leu</td><td> Thr</td><td> Gin</td><td> Ser</td><td> Pro</td><td> Alá</td><td> Ile</td>

<td> 20</td><td> 25 30</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Met</td><td> Ser Alá</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Glu</td><td> Arg</td><td> Val</td><td> Thr</td><td> Met</td><td> Thr</td><td> Cys</td><td> Thr</td><td> Alá</td><td> Ser</td>

<td> 35</td><td> 40 45</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Ser Val</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Tyr</td><td> Leu</td><td> His</td><td> Trp</td><td> Tyr</td><td> Gin</td><td> Gin</td><td> Lys</td><td> Pro</td><td> Gly</td>

<td> 50</td><td> 55 60</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Ser Pro</td><td> Lys</td><td> Leu</td><td> Trp</td><td> Ile</td><td> Tyr</td><td> Ser</td><td> Thr</td><td> Ser</td><td> Asn</td><td> Leu</td><td> Alá</td><td> Ser</td><td> Gly</td>

<td> 65</td><td> 70 75 80</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Val</td><td> Pro Alá</td><td> Arg</td><td> Phe</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Thr</td><td> Ser</td><td> Tyr</td><td> Ser</td><td> Leu</td>

<td> 85</td><td> 90 95</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Thr</td><td> Ile Ser</td><td> Ser</td><td> Met</td><td> Glu</td><td> Alá</td><td> Glu</td><td> Asp</td><td> Alá</td><td> Alá</td><td> Thr</td><td> Tyr</td><td> Tyr</td><td> Cys</td><td> His</td>

<td> 100</td><td> 105 110</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Gin</td><td> Tyr His</td><td> Arg</td><td> Ser</td><td> Pro</td><td> Phe</td><td> Thr</td><td> Phe</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Leu</td><td> Glu</td>

115 120 125 Ile

ΕΡ 2 891 666 Β1 &lt;210&gt; 57 &lt;211&gt; 406 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 725.1 heavy chain polypeptide variable region (725.1 H) &lt;400&gt; 57 atggcttggg tgtggacctt gctattcctg atggcagctg cccaaagtgc ccaagcacag atccagttgg tgcagtctgg acctgaactg aagaagcctg gagagacagt caagatctcc tgcaaggctt ctggatattc cttcacaaac tatggaatga actgggtgaa gcaggctcca gggaagggtt taaagtggat gggctggata aacgcctaca ttggagagcc aacatatgct gatgacttca agggacgatt tgccttctct ctggaagcct ctacccacac tgcctatttg cagatcaaca gcctcaaaag tgaggacacg gctacatatt tctgtgcaag tgggggtaac tcccttgact tttggggcca aggcaccact ctcacagtct cctcag 406 &lt;210&gt; 58 &lt;211&gt; 423 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 16H9 heavy chain polypeptide variable region (16H9H) &lt;400&gt; 58 atgaaatgca gctgggttat cttcttcctg atggcagtgg ttacaggggt caattcagag gttcagctgc agcagtctgg ggcagagctt gtgaagccag gggcctcagt caagttgtcc tgcacagctt ctggcttcaa cattaaagac acctatatgc actgggtgaa gcagaggcct gaacagggcc tggagtggat tggaaggatt gatcctgcga atggtaatac taaatatgac ccgaagttcc agggcaaggc cactataaca gcagacacat cctccaacac agcctacgtg cagctcagca gcctgacatc tgaggacact gccgtctatt actgtgctag tagtgacatc tactatggta accccggggg gtttgcttac tggggccaag ggactctggt cactgtctct gca 423 &lt;210&gt; 59 &lt;211&gt; 389 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 16H9 light chain polypeptide variable region (16H9L) &lt;400&gt; 59 atggattttc aggtgcagat tttcagcttc ctgctaatca gtgcctcagt cataatgtcc agaggacaaa ttgttctcac ccagtctcca gcaatcatgt ctgcatctct aggggaacgg gtcaccatga cctgcactgc cagctcaagt gtaagttcca gttacttgca ctggtaccag cagaagccag gatcctcccc caaactctgg atttatagca catccaacct ggcttctgga gtcccagctc gcttcagtgg cagtgggtct gggacctctt actctctcac aatcagcagc atggaggctg aagatgctgc cacttattac tgccaccagt atcatcgttc cccattcacg ttcggctcgg ggacaaagtt ggaaataaa 389 &lt;210&gt; 60 &lt;211&gt; 10 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 725.1 VH1 CDR &lt;400&gt; 60

ΕΡ 2 891 666 Β1

Gly Tyr Ser Phe Thr Asn Tyr Gly Met Asn 1 5 10 &lt;210&gt; 61 &lt;211&gt; 17 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 725.1 VH2 CDR &lt;400&gt; 61

Trp Ile Asn Alá Tyr Ile Gly Glu Pro Thr Tyr Alá Asp Asp Phe Lys

5 10 15

Gly &lt;210&gt; 62 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 725.1 VH3 CDR &lt;400&gt; 62

Gly Gly Asn Ser Leu Asp Phe

5 &lt;210&gt; 63 &lt;211&gt; 10 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 725.1 VL1 CDR &lt;400&gt; 63

Arg Alá Ser Ser Ser Val Ser Ser Ile His 1 5 10 &lt;210&gt; 64 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 725.1 VL2 CDR &lt;400&gt; 64

Alá Thr Ser Asn Leu Alá Ser 1 5 &lt;210&gt; 65 &lt;211&gt;9 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 725.1 VL3 CDR

ΕΡ 2 891 666 Β1 &lt;400&gt; 65

Gin Gin Trp Ser Ile Asp Pro Alá Thr 1 5 &lt;210&gt; 66 &lt;211&gt; 10 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 16H9 VH1 CDR &lt;400&gt; 66

Gly Phe Asn Ile Lys Asp Thr Tyr Met His 1 5 10 &lt;210&gt; 67 &lt;211&gt; 17 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 16H9 VH2 CDR &lt;400&gt; 67

Arg Ile Asp Pro Alá Asn Gly Asn Thr Lys Tyr Asp Pro Lys Phe Gin

5 10 15

Gly &lt;210&gt; 68 &lt;211&gt; 13 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 16H9 VH3 CDR &lt;400&gt; 68

Ser Asp Ile Tyr Tyr Gly Asn Pro Gly Gly Phe Alá Tyr 1 5 10 &lt;210&gt; 69 &lt;211&gt; 12 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 16H9 VL1 CDR &lt;400&gt; 69

Thr Alá Ser Ser Ser Val Ser Ser Ser Tyr Leu His 1 5 10 &lt;210&gt; 70 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 16H9 VL2 CDR &lt;400&gt; 70

ΕΡ 2 891 666 Β1

Ser Thr Ser Asn Leu Alá Ser 1 5 &lt;210&gt; 71 &lt;211&gt;9 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 16H9 VL3 CDR &lt;400&gt; 71

His Gin Tyr His Arg Ser Pro Phe Thr 1 5