Immunoglobulin chimeric monomer-dimer hybrids

Description

FIELD OF THE INVENTION [0001] The present disclosure relates generally to therapeutic chimeric proteins, comprised oftwo polypeptide chains, wherein the first chain Is comprised of a therapeutic biologically active molecule and the second chain is nőt comprised of the therapeutic biologically active molecule of the first chain. More specifically, the present disclosure relates to chimeric proteins, comprised oftwo polypeptide chains, wherein both chains are comprised of at least a portion ofan immunoglobulin constant region wherein the first chain is modified to further comprise a biologically active molecule, and the second chain Is nőt so modified. The present disclosure, thus relates to a chimeric protein that is a monomerdimer hybrid, i.e., a chimeric protein having a dimeric aspect and a monomeric aspect, wherein the dimeric aspect relates to the fact that it is comprised of two polypeptide chains each comprised of a portion of an Immunoglobulin constant region, and wherein the monomeric aspect relates to the fact that only one ofthe two chains is comprised ofa therapeutic biologically active molecule. Figure 1 illustrates one example ofa monomer-dimer hybrid wherein the biologically active molecule is erythropoietin (EPO) and the portion ofan immunoglobulin constant region is an IgG Fc region.

BACKGROUND OF THE INVENTION [0002] Immunoglobulins are comprised of four polypeptide chains, two heavy chains and two light chains, which associate via disulfide bonds to form tetramers. Each chain is further comprised of one variable region and one constant region. The variable regions mediate antigén recognition and binding, while the constant regions, particularly the heavy chain constant regions, mediate a variety of effector functions, e.g., complement binding and Fc receptor binding (see, e.g., U.S. Patent Nos.: 6,086,875; 5,624,821; 5,116,964).

[0003] The constant region is further comprised of domains denoted CH (constant heavy) domains (CH1, CH2, etc.). Depending on the isotype, (i.e. IgG, IgM, IgA IgD, IgE) the constant region can be comprised of three orfour CH domains. Somé isotypes (e.g. IgG) constant regions alsó contain a hinge region Janeway et al. 2001, Immunobiology, Garland Publishing, N.Y., N.Y.

[0004] The creation of chimeric proteins comprised of immunoglobulin constant regions linked to a protein of interest, orfragment thereof, has been described (see, e.g., U.S. Patent Nos. 5,480,981 and 5,808,029; Gascoigne et al. 1987, Proc. Natl. Acad. Sci. USA84:2936; Capon etal. 1989, Natúré 337:525; Trauneckeretal. 1989, Mature 339:68; Zettmeissi et al. 1990, DNA Cell Bioi. USA 9:347; Bym et al. 1990, Natúré 344:667; Watson et al. 1990, J. Cell. Bioi. 110:2221; Watson et al. 1991, Natúré 349:164; Aruffo et al. 1990, Cell 61:1303: Linsley etal. 1991, J. Exp. Med. 173:721; Linsley et al. 1991, J. Exp. Med. 174:561; Stamenkovic et al., 1991, Cell 66:1133; Ashkenazi et al. 1991, Proc. Natl. Acad. Sci. USA 88:10535; Lesslauer et al. 1991, Eur. J. Immunoi. 27:2883; Peppel et al. 1991, J. Exp. Med. 174:1483; Bennett et al. 1991, J. Bioi. Chem. 266:23060; Kurschner et al. 1992, J. Bioi. Chem. 267:9354; Chalupny et al. 1992, Proc. Natl. Acad. Sci. USA 89:10360; Ridgway and Gorman, 1991, J. Cell. Bioi. 115, Abstract No. 1448; Zheng et al. 1995, J. Immun. 154:5590). These molecules usually possess both the biological activity associated with the linked molecule of interest as well as the effector function, orsome other desired characteristic associated with the immunoglobulin constant region (e.g. biological stability, cellular secretion).

[0005] The Fc portion ofan immunoglobulin constant region, depending on the immunoglobulin isotype can include the CH2, CH3, and CH4 domains, as well as the hinge region. Chimeric proteins comprising an Fc portion of an immunoglobulin bestow several desirable properties on a chimeric protein including increased stability, increased serum half life (see Capon et al. 1989, Natúré 337:525) as well as binding to Fc receptors such as the neonatal Fc receptor (FcRn) (U.S. Patent Nos. 6,086,875, 6,485,726, 6,030,613; WO 03/077834; US2003-0235536A1).

[0006] FcRn is active in aduit epithelial tissue and expressed in the lumen ofthe intestines, pulmonary airways, nasal surfaces, vagina! surfaces, colon and rectaí surfaces (U.S. Patent No. 6,485,726). Chimeric proteins comprised of FcRn binding partners (e.g. IgG, Fc fragments) can be effectively shuttled across epithelial barriers by FcRn, thus providing a non-invasive means to systemically administer a desired therapeutic molecule. Additionally, chimeric proteins comprising an FcRn binding partner are endocytosed by cells expressing the FcRn. Bút instead of being marked for degradation, these chimeric proteins are recycled out intő circulation again, thus increasing the in vivő half life of these proteins. [0007] Portions of immunoglobulin constant regions, e.g., FcRn binding partners typically associate, via disulfide bonds and other non-specific interactions, with one another to form dimers and higher order multimers. The present disclosure, Including the instant invention, is based in part upon the surprising discovery that transcytosis of chimeric proteins comprised of FcRn binding partners appears to be limited by the molecular weight of the chimeric protein, with higher molecular weight species being transported less efficiently.

[0008] Chimeric proteins comprised of biologically active molecules, once administered, typically will interact with a target molecule or cell. The present disclosure, Including the instant invention, is further based in part upon the surprising discovery that monomer-dimer hybrids, with one biologically active molecule, bút two portions of an immunoglobulin

EP 2 361 932 Β1 constant region, e.g., two FcRn binding partners, function and can be transported more effectively than homodimers, alsó referred to herein simply as dimmers or higher order multimers with two or more copies ofthe biologically active molecule. This is due in part to the fact that chimeric proteins, comprised of two or more biologically active molecules, which exist as dimers and higher order multimers, can be sterically hindered from interacting with their target molecule or cell, due to the presence ofthe two or more biologically active molecules In close proximity to one another and that the biologically active molecule can have a high affinity for itself.

[0009] Accordingly, one aspect of the present disclosure provides chimeric proteins comprised of a biologically active molecule that is transported across the epithelium barrier. An additional aspect ofthe present disclosure provides chimeric proteins comprised of at least one biologically active molecule that is able to interact with its target molecule or cell with little or no steric hindrance or self aggregation.

[0010] The aspects of the present disclosure provide for chimeric proteins aomprising a first and second polypeptide chain, the first chain comprising at least a portion of immunoglobulin constant region wherein the portion of an immunoglobulin constant region has been modified to include a biologically active molecule, and the second chain comprising at least a portion of immunoglobulin constant region, wherein the portion ofan immunoglobuilin constant region has nőt been so modified to include the biologically active molecule ofthe first chain.

SUMMARY OF THE PRESENT DISCLOSURE [0011] The present disclosure relates to a chimeric protein comprising one biologically active molecule and two molecules of at least a portion of an immunoglobulin constant region. The chimeric protein is capable of interacting with a target molecule or cell with less steric hindrance compared to a chimeric protein comprised of at least two biologically active molecules and at least a portion of two Immunoglobulin constant regions. The present dsclosure alsó relates to a chimeric. protein comprising at least one biologiccally active molecule and Two molecules of at least a portion of an immunoglobulin constant region that is transported across an epithelium barrier more efficiently than a corresponding homodimer, i.e., wherein both chains are linked to the same biologically active molecule. The present disclosure thus relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region, bút no immunoglobulin variable region and without any biologically active molecule attached.

[0012] The present disclosure relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion ofan immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region without an immunoglobulin variable region or any biologically active molecule and wherein said second chain is nőt covalently bonded to any molecule having a molecular weight greater than 1 kD, 2 kD, 5 kD, 10 kD, or20 kD. In one instance, the second chain is nőt covalently bonded to any molecule having a molecular weight greater than 0-2 kD. In one instance, the second chain is nőt covalently bonded to any molecule having a molecular weight greater than 5-10 kD. In one instance, the second chain is nőt covalently bonded to any molecule having a molecular weight greater than 15-20 kD. [0013] The present disclosure relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion ofan immunoglobulin constant region, and said second chain comprises at least a portion ofan immunoglobulin constant region nőt covalently linked to any other molecule except the portion of an immunoglobulin of said first polypeptide chain.

[0014] The present disclosure relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion ofan immunoglobulin constant region, and said second chain consists of at least a portion ofan immunoglobulin constant region and optionally an affinity tag.

[0015] The present disclosure relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion ofan immunoglobulin constant region, and said second chain consists essentially of at least a portion of an immunoglobulin constant region and optionally an affinity tag.

[0016] The present disclosure relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion ofan immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region without an immunoglobulin variable region or any biologically active molecule and optionally a molecule with a molecular weight less than 10 kD, 5 kD, 2 kD or 1 kD. In one instance, the second chain comprises a molecule less than 15-20 kD. In one instance, the second chain comprises a molecule less than 5-10 kD. In one instance, the second chain comprises a molecule less than 1-2 kD.

[0017] The present disclosure relates to a chimeric protein comprising a first and second polypeptide chain, wherein said first chain comprises a biologically active molecule, at least a portion of an immunoglobulin constant region, and at

ΕΡ 2 361 932 Β1 least a first domain, said first domain having at least one specific binding partner, and wherein said second chain comprises at least a portion of an immunoglobulin constant region, and at least a second domain, wherein said second domain is a specific binding partner of said first domain, without any immunoglobulin variable region or a biologically active molecule.

[0018] The present disclosure relates to a method of makíng a chimeric protein comprising a first and second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain are nőt the same, said method comprising transfecting a cell with a first DNA construct comprising a DNA molecule encoding a first polypeptide chain comprising a biologically active molecule and at least a portion of an immunoglobulin constant region and optionalíy a linker, and a second DNA construct comprising a DNA molecule encoding a second polypeptide chain comprising at least a pottion of an immunoglobulin constant region without any biologically active molecule or an immunoglobulin variable region, and optionalíy a linker, culturing the calls under conditions such that the polypeptide chain encoded by the first DNA construct is expressed and the polypeptide chain encoded by the second DNA construct is expressed and isolating monomer-dimer hybrids comprised of the polypeptide chain encoded by the first DNA construct and the polypeptide chain encoded by the second DNA construct.

[0019] The present disclosure relates to a method of makíng a chimeric protein comprising a first and second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain are nőt the same, and wherein said first polypeptide chain comprises a biologically active molecule, at least a portion ofan immunoglobulin constant region, and at least afirst domain, said first domain having at least one specific binding partner, and wherein said second polypeptide chain comprises at least a portion ofan immunoglobulin constant region and a second domain, wherein said second domain is a specific binding partner of said first domain, without any biologically active molecule or an immunoglobulin variable region, said method comprising transfecting a cell with afirst DNA construct comprising a DNA molecule encoding said first polypeptide chain and a second DNA construct comprising a DNA molecule encoding said second polypeptide chain, culturing the cells under conditions such that the polypeptide chain encoded bythe first DNA construct is expressed and the polypeptide chain encoded by the second DNA construct is expressed and isolating monomer-dimer hybrids comprised ofthe polypeptide chain encoded by the first DNA construct and polypeptide chain encoded by the second DNA construct [0020] The present disclosure relates to a method of makíng a chimeric protein ofthe present disclosure, said method comprising transfecting a cell with a first DNA construct comprising a DNA molecule encoding a first polypeptide chain comprising a biologically active molecule and at least a portion ofan Immunoglobulin constant region and optionalíy a linker, culturing the cell under conditions such that the polypeptide chain encoded bythe first DNA construct is expressed, isolating the polypeptide chain encoded by the first DNA construct and transfecting a cell with a second DNA construct comprising a DNA molecule encoding a second polypeptide chain comprising at least a portion of an immunoglobulin constant region without any biologically active molecule or Immunoglobulin variable region, culturing the cell under conditions such that the polypeptide chain encoded bythe second DNA construct Is expressed, isolating the polypeptide chain encoded by the second DNA construct, combining the polypeptide chain encoded by the first DNA construct and the polypeptide chain encoded by the second DNA construct under conditions such that monomer-dimer hybrids comprising the polypeptide chain encoded by the first DNA construct and the polypeptide chain encoded by the second DNA construct form, and isolating said monomer-dimer hybrids.

[0021] The present disclosure relates to a method of makíng a chimeric protein comprising a first and second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain are nőt the same, said method comprising transfecting a cell with a DNA construct comprising a DNA molecule encoding a polypeptide chain comprising at least a portion of an immunoglobulin constant region, culturing the cells under conditions such that the polypeptide chain encoded by the DNA construct is expressed with an N terminál cysteine such that dimers ofthe polypeptide chain form and isolating dimers comprised of two copies of the polypeptide chain encoded by the DNA construct and chemically reacting the isolated dimers with a biologically active molecule, wherein said biologically active molecule has a C terminus thioester, under conditions such that the biologically active molecule reacts predominantly with oniy one polypeptide chain of the dimer thereby forming a monomer-dimer hybrid.

[0022] The present disclosure relates to a method of makíng a chimeric protein comprising a first and second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain are nőt the same, said method comprising transfecting a cell width a DNA construct comprising a DNA molecule encoding a polypeptide chain comprising at least a portion of an immunoglobulin constant region, culturing the cells under conditions such that the polypeptide chain encoded by the DNA construct is expressed with an N terminál cysteine such that dimers ofthe polypeptide chains form, and isolating dimers comprised of two copies ofthe polypeptide chain encoded by the DNA construct, and chemically reacting the isolated dimers with a biologically active molecule, wherein said biologically active molecule has a C terminus thioester, such that the biologically achieve molecule is linked to each chain ofthe dimer, denaturing the dimer comprised ofthe portion ofthe immunoglobulin linked to the biologically active molecule such that monomeric chains form, combining the monomeric chains with a polypeptide chain comprising at least a portion of an immunoglobulin constant region without a biologically active molecule linked to it, such that monomer-dimer hybrids form, and isolating the monomer5

ΕΡ 2 361 932 Β1 dimer hybrids.

[0023] The presentdisclosure relates to a method of making a chimeric protein comprising a first and second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain are nőt the same, said method comprising transfecting a cell with a DNA construct comprising a DNA molecule encoding a polypeptide chain comprising at least a portion of an immunoglobulin constant region, culturing the cells under conditions such that the polypeptide chain encoded by the DNA construct is expressed as a mixture of two polypeptide chains, wherein the mixture comprises a polypeptide with an N terminál cysteine, and a polypeptide with a cysteine In close proximity to the N terminus, isolating dimers comprised ofthe mixture of polypeptide chains encoded by the DNA construct and chemically reacting the isolated dimers with a biologically active molecule, wherein said biologically active molecule has an active thioester, such that at least somé monomer-dimer hybrid forms and isolating the monomer-dimer hybrid from said mixture.

[0024] The presentdisclosure relates to a method of treating a disease or condition comprising administering a chimeric protein of the present disclosure thereby treating the disease or condition.

[0025] Additional objects and advantages of the present disclosure will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the present disclosure. The objects and advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims.

SUMMARY OF THE INVENTION [0026] Thus, based on the disclosure contained herein, the present invention provides [0027] A chimeric protein, for use in a method of treatment, with one biologically active molecule and two immunoglobulin constant regions or portions thereof, wherein the chimeric protein comprises a first polypeptide chain and a second polypeptide chain, wherein the first polypeptide chain comprises the biologically active molecule and an immunoglobulin constant region, or a portion thereof, that is an Fc neonatal receptor (FcRn) binding partner and wherein the biologically active molecule is a protein selected from the group consisting of a cytokine, a hormoné, and a clotting factor; and wherein the second polypeptide chain consists of an immunoglobulin constant region, or a portion thereof, that is an FcRn binding partner and optionally a molecule with a molecular weight no greater than 2 kD.

[0028] The present invention further provides a pharmaceutical composition comprising said chimeric protein and a pharmaceutically acceptable excipient.

[0029] The present invention still further provides a first polynucleotide encoding the first polypeptide chain of said chimeric protein and a second polynucleotide encoding the second polypeptide chain ofsaid chimeric protein.

[0030] Further aspects and embodiments of the present invention are set forth in the appended claims.

[0031] it is to be understood that both the foregoing generál description and the hollowing detailed description are exemplary and explanatory only and are nőt restrictive ofthe invention, as claimed.

BRIEF DESCRIPTION OF THE DRAWINGS [0032]

Figure 1 is a schematic diagram comparing the structure of an EPO-Fc homodimer, or dimer, and the structure of an Epo-FC monomer-dimer hybrid.

Figure 2a is the amino acid sequence ofthe chimeric protein Factor VII-Fc. Included in the sequence is the signal peptide (underlined), which is cleaved by the cell and the propeptide (bőid), which is recognized by the vitamin Kdependentycarboxylase which modifies the Factor VII to achieve full activity. The sequence is subsequently cleaved by PACE to yield Factor VII-Fc.

Figure 2b is the amino acid sequence ofthe chimeric protein Factor IX-Fc. Included in the sequence is the signal peptide (underlined) which is cleaved by the cell and the propeptide (bőid) which is recognized by the vitamin Kdependenty carboxylase which modifies the Factor IX to achieve full activity. The sequence is subsequently cleaved by PACE to yield Factor IX-Fc.

Figure 2c is the amino acid sequence ofthe chimeric protein IFNa-Fc.. Included in the sequence is the signal peptide (underlined), which is cleaved by the cell resulting in the mature IFNa-Fc.

Figure 2d is the amino acid sequence ofthe chimeric protein IFNa-Fc Δ linker. Included in the sequence is the signal peptide (underlined) which is cleaved by the cell resulting in the mature IFNa- Fc Δ linker.

Figure 2e is the amino acid sequence ofthe chimeric protein Flag-Fc. Included in the sequence is the signal peptide (underlined), which is cleaved by the cell resulting in the mature Flag-Fc.

Figure 2f is the amino acid sequence ofthe chimeric protein Epo-CCA-Fc. Included in the sequence is the signal peptide (underlined), which is cleaved by the cell resulting in the mature Epo-CCA-Fc. Alsó shown in bőid is the

ΕΡ 2 361 932 Β1 acidic coiled coil domain.

Figure 2g is the amino acid sequence ofthe chimeric protein CCB-Fc. Included in the sequence is the signal peptide (underlined), which is cleaved by the cell resulting in the mature CCB-Fc. Alsó shown in bőid is the basic coiled coil domain.

Figure 2h is the amino acid sequence ofthe chimeric protein Cys-Fc. Included in the sequence is the signal peptide (underlined), which is cleaved by the cell resulting in the mature Cys-Fc. When this sequence is produced in CHO cells a percentage ofthe molecules are incorrectly cleaved by the signal peptidase such that two extra amino acids are left on the N terminus, thus preventing the linkage of a biologically active molecule with a C terminál thioester (e.g., via native ligation). When these improperly cleaved species dimerize with the properly cleaved Cys-Fc and are subsequently reacted with biologically active molecules with C terminál thioesters, monomer-dimer hybrids form. Figure 2i is the amino acid sequence ofthe chimeric protein IFNa-GS15-Fc. Included in the sequence is the signal peptide (underlined) which is cleaved by the cell resulting in the mature IFNa- GS15-Fc.

Figure 2j is the amino acid sequence ofthe chimeric protein Epo-Fc. Included in the sequence is the signal peptide (underlined), which is cleaved bythe cell resulting in the mature Epo-Fc. Alsó shown in bőid is the 8 amino acid linker. Figure 3a is the nucleic acid sequence ofthe chimeric protein Factor Vll-Fc. Included in the sequence is the signal peptide (underlined) and the propeptide (bőid) which is recognized by the vitamin K-dependent γ carboxylase which modifies the Factor VII to achieve full activity. The transiated sequence is subsequently cleaved by PACE to yield mature Factor Vll-Fc.

Figure 3b is the nucleic acid sequence ofthe chimeric protein Factor IX-Fc. Included in the sequence is the signal peptide (underlined) and the propeptide (bőid) which is recognized by the vitamin K-dependent γ carboxylase which modifies the Factor IX to achieve full activity. The transiated sequence is subsequently cleaved by PACE to yield mature Factor IX-Fc.

Figure 3c is the nucleic acid sequence ofthe chimeric protein IFNa-F_G Included in the sequence is the signal peptide (underlined), which is cleaved by the cell after translation resulting in the mature IFNa-Fc.

Figure 3d is the nucleic acid sequence ofthe chimeric protein IFNa-, FcA linker. Included in the sequence is the signal peptide (underlined) which is cleaved by the cell after translation resulting in the mature IFNa- FcA linker. Figure 3e Is the nucleic acid sequence ofthe chimeric protein Flag-Fc, Include In the sequence is the signal peptide (underlined), which is cleaved by the cell after translation resulting In the mature Flag-Fc.

Figure 3f is the nucleic acid sequence of the chimeric protein Epo-CCA-Fc. included in the sequence is the signal peptide (underlined), which Is cleaved by the cell after translation resulting in the mature Epo-CCA-Fc. Alsó shown in bőid is the acidic coiled coil domain.

Figure 3g is the nucleic acid sequence ofthe chimeric protein CCB-Fc. Included in the sequence is the signal peptide (underlined), which Is cleaved by the cell after translation resulting in the mature CCB-Fc. Alsó shown In bőid is the basic coiled coil domain.

Figure 3h is the nucleic acid sequence ofthe chimeric protein Cys-Fc. Included in the sequence is the signal peptide (underlined), which is cleaved by the cell after translation resulting in the mature Cys-Fc.

Figure 3i is the nucleic acid sequence ofthe chimeric protein IFNa-GS15-Fc. Included in the sequence is the signal peptide (underlined) which is cleaved by the cell after translation resulting in the mature IFNa-GS15-Fc.

Figure 3j is the nucleic acid sequence ofthe chimeric protein Epo-Fc. Included in the sequence is the signal peptide (underlined), which is cleaved by the cell after translation resulting in the mature Epo-Fc. Alsó shown in bőid is a nucleic acid sequence encoding the 8 amino acid linker.

Figure 4 demonstrates ways to form monomer-dimer hybrids through native ligation.

Figure 5a shows the amino acid sequence of Fc MESNA (SEQ ID NO:4).

Figure 5b shows the DNA sequence of Fc MESNA (SEQ ID NO:5).

Figure 6 compares antiviral activity of IFNa homo-dimer(/'.e. comprised of2 IFNa molecules) with an IFNa monomerdimer hybrid (i.e. comprised of 1 IFNa molecule).

Figure 7 is a comparison of clotting activity of a chimeric monomer-dimer hybrid Factor Vlla-Fc (one Factor VII molecule) and a chimeric homodimer Factor Vlla-Fc (two Factor VII molecules).

Figure 8 compares órai dosing in néonatal rats ofa chimeric monomer-dimer hybrid Factor Vlla-Fc (one Factor VII molecule) and a chimeric homodimer Factor Vlla-Fc (two Factor VII molecules).

Figure 9 compares órai dosing in néonatal rats of a chimeric monomer-dimer hybrid Factor IX-Fc (one Factor IX molecule) with a chimeric homodimer.

Figure 10 is a time eourse study comparing a chimeric monomer-dimer hybrid Factor IX-Fc (one Factor IX molecule) administered orally to néonatal rats with an orally administered chimeric homodimer.

Figure 11 demonstrates pharmokinetics of Epo-Fc dimer compared to Epo-Fc monomer-dimer hybrid in cynomolgus monkeys after a single pulmonary dose.

Figure 12 compares serum concentration in monkeys of subcutaneously administered Epo-Fc monomer-dimer hybrid with subcutaneously administered Aranesp® (darbepoetin alfa).

ΕΡ 2 361 932 Β1

Figure 13 compares serum concentration in monkeys of intravenously administered Epo-Fc monomer-dimer hybrid with intravenously administered Aranesp® (darbepoetin alfa) and Epogen® (epoetin alfa).

Figure 14 shows a trace from a Mimetic Red 2™ column (ProMetic LifeSciences, Inc., Wayne, NJ) and an SDSPAGE of fractions from the column containing EpoFc monomer-dimer hybrid, EpoFc dimer, and Fc. EpoFc monomerdimer hybrid is found in fractions 11, 12, 13, and 14. EpoFc dimer is found in fraction 18. Fc is found in fractions 1/2. Figure 15 shows the pharmacokinetics of IFNpFc with an 8 amino acid linker in cynomolgus monkeys after a single pulmonary dose.

Figure 16 shows neopterin stimulation in response to the IFNp-Fc homodimer and the IFNp-Fc N297A monomerdimer hybrid in cynomolgus monkeys.

Figure 17a shows the nucleotide sequence of interferon β-Fc; Figure 17b shows the am ino acid sequence of Interferon β-Fc.

Figure 18 shows the amino acid sequence of T20(a); T21 (b) and T1249(c).

DESCRIPTION OF THE EMBODIMENTS,

A. Definitions [0033] Affinity tag, as used herein, means a molecule attached to a second molecule of interest, capable of interacting with a specific binding partner for the purpose of Isolating or identifying said second molecule of interest.

[0034] Analogs of chimeric proteins of the present disclosure, e.g. of chimeric proteins of the present invention, or proteins or peptides substantially identical to the chimeric proteins ofthe present disclosure, e.g. to the chimeric proteins ofthe present Invention, as used herein, means that a relevant amino acid sequence of a protein or a peptide is at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to a given sequence. By way of example, such sequences may be variants derived from various species, orthey may ba derided from the given sequence by truncation, deletion, amino acid substitution or addition. Percent identity between two amino acid sequences is determined by standard alignment algorithms such as, for example, Basic Local Alignment Tool (BLAST) described in Altschul et al.1990, J. Mól. Bioi., 215:403-410, the algorithm of Needleman at al. 1970, J. Mól. Bioi., 48:444-453; the algorithm of Meyers et al. 1988, Comput. Appl. Biosci., 4:11-17; or Tatusova et al. 1999, FEMS Microbiol. Lett., 174:247-250, etc, Such algorithms are Incorporated intő the BLASTN, BLASTP and BLAST 2 Sequences programs (see www.ncbl.nlm.nih.gov]BLAST). When utilizing such programs, the default parameters can be used. For example, for nucleotide sequences the following settings can be used for BLAST 2 Sequences: program BLASTN, reward for match 2, penalty for mismatch -2, open gap and extension gap penalties 5 and 2 respectively, gap x_dropoff 50, expect 10, word size 11, filter ON. For amino acid sequences the following settings can be used for BLAST 2 Sequences: program BLASTP, mátrix BLOSUM62, open gap and extension gap penalties 11 and 1 respectively, gap x_dropoff 50, expect 10, word size 3, filter ON.

[0035] Bioavailability, as used herein, means the extent and rate at which a substance is absorbed intő a living system or is made available at the site of physiological activity.

[0036] Biologically active molecule, as used herein, means a non-immunoglobulin molecule or fragment thereof, capable of treating a disease or condition or localizing or targeting a molecule to a site of a disease or condition in the body by performing a function or an action, or stimulating or responding to a function, an action or a reaetion, in a biological context (e.g. in an organism, a cell, or an in vitro model thereof). Biologically active molecules may comprise at least one of polypeptides, nucleic acids, small molecules such as small organic or inorganic molecules.

[0037] A chimeric protein, as used herein, refers to any protein comprised of a first amino acid sequence derived from a first source, bonded, covalently or non-covalently, to a second amino acid sequence derived from a second source, wherein the first and second source are nőt the same. A first source and a second source that are nőt the same can include two different biological entities, or two different proteins from the same biological entity, or a biological entity and a non-biological entity. A chimeric protein can include for example, a protein derived from at least 2 different biological sources. A biological source can include any non-synthetically produced nucleic acid or amino acid sequence (e.g. a genomic or cDNA sequence, a plasmid or viral vector, a native virion óra mutant or analóg, as further described herein, of any ofthe above). A synthetic source can include a protein or nucleic acid sequence produced chemically and nőt by a biological system (e.g. solid phase synthesis of amino acid sequences). A chimeric protein can alsó include a protein derived from at least 2 different synthetic sources or a protein derived from at least one biological source and at least one synthetic source. A chimeric protein may alsó comprise a first amino acid sequence derived from a first source, covalently or non-covalently linked to a nucleic acid, derived from any source or a small organic or inorganic molecule derived from any source. The chimeric protein may comprise a linker molecule between the first and second amino acid sequence or between the first amino acid sequence and the nucleic acid, or between the first amino acid sequence and the small organic or inorganic molecule.

[0038] Clotting factor, as used herein, means any molecule, or analóg thereof, naturally occurring or recombinantly

ΕΡ 2 361 932 Β1 produced which prevents or decreases the duration of a bleeding episode in a subject with a hemostatic disorder. In other words, it means any molecule having clotting activity.

[0039] Clotting activity, as used herein, means the ability to participate in a Cascade of biochemical reactions that culminates in the formation of a fibrin clot and/or reduces the severity, duration or frequency of hemorrhage or bleeding episode.

[0040] Dimer as used herein refers to a chimeric protein comprising a first and second polypeptide chain, wherein the first and second chains both comprise a biologically active molecule, and at least a portion ofan immunoglobulin constant region. A homodimer refers to a dimer where both biologically active molecules are the same.

[0041] Dimerically linked monomer-dimer hybrid refers to a chimeric protein comprised of at least a portion of an immunloglobulin constant region, e.g. an Fc fragment of an immunoglobulin, a biologically active molecule and a linker which links the two together such that one biologically active molecule is bound to 2 polypeptide chains, each comprising a portion ofan immunoglobulin constant region. Figure 4 shows an exampleof a dimerically linked monomer-dimer hybrid. [0042] DNA construct, as used herein, means a DNA molecule, óra clone ofsuch a molecule, either single- ordoublestranded that has been modified through humán intervention to contain segments of DNA combined in a manner that as a whole would nőt otherwise exist in natúré. DNA constructs contain the information necessary to direct the expression of polypeptides of interest. DNA constructs can include promoters, enhancers and transcription terminators. DNA constructs containing the information necessary to direct the secretion ofa polypeptide will alsó contain at leastone secretory signal sequence.

[0043] Domain, as used herein, means a region of a polypeptide (including proteins as that term is defined) having somé distinctive physical feature or role including for example an independently földed structure composed of one section of a polypeptide chain. A domain may contain the sequence of the distinctive physical feature of the polypeptide or it may contain a fragment of the physical feature which retains its binding characteristics (i.e., it can bind to a second domain). Adomain may be associated with another domain. In other words, afirst domain may naturally bind to a second domain.

[0044] A fragment, as used herein, refers to a peptide or polypeptide comprising an amino acid sequence of at least 2 contiguous amino acid residues, of at least 5 contiguous amino acid residues, of at least 10 contiguous amino acid residues, of at least 15 contiguous amino acid residues, of at least 20 contiguous amino acid residues, of at least 25 contiguous amino acid residues, of at least 40 contiguous amino acid residues, of at least 50 contiguous amino acid residues, of at least 100 contiguous amino acid residues, or of at least 200 contiguous amino acid residues or any deletion or truncation ofa protein, peptide, or polypeptide.

[0045] Hemostasis, as used herein, means the stoppage of bleeding or hemorrhage; or the stoppage of blood flow through a blood véssél or body part.

[0046] Hemostatic disorder, as used herein, means a genetically inherited or acquired condition characterized by a tendency to hemorrhage, either spontaneously or as a result of trauma, due to an impaired ability or inability to form a fibrin clot.

[0047] Linked, as used herein, refers to a first nucleic acid sequence covalently joined to a second nucleic acid sequence. The first nucleic acid sequence can be directly joined or juxtaposed to the second nucleic acid sequence or alternatively an intervening sequence can covalently jóin the first sequence to the second sequence. Linked as used herein can alsó refer to a first amino acid sequence covalently, or non-covalently, joined to a second amino acid sequence. The first amino acid sequence can be directly joined or juxtaposed to the second amino acid sequence or alternatively an intervening sequence can covalently jóin the first amino acid sequence to the second amino acid sequence.

[0048] Operatively linked, as used herein, means a first nucleic acid sequence linked to a second nucleic acid sequence such that both sequences are capable of being expressed as a biologically active protein or peptide.

[0049] Polypeptide, as used herein, refers to a polymer of amino acids and does nőt refer to a specific length of the product; thus, peptides, oligopeptides, and proteins are included within the définition of polypeptide. This term does nőt exclude post-expression modifications of the polypeptide, for example, glycosylation, acetylation, phosphorylation, pegylation, addition of a lipid moiety, or the addition of any organic or inorganic molecule. Included within the définition, are forexample, polypeptides containing one or more analogs ofan amino acid (including, for example, unnatural amino acids) and polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.

[0050] High stringency, as used herein, includes conditions readily determined by the skilled artisan based on, for example, the length ofthe DNA. Generally, such conditions are defined in Sambrook etal. Molecular Cloning: A Laboratory Manual, 2 ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory Press (1989), and include use ofa prewashing solution for the nitrocellulose filters 5X SSC, 0.5% SDS, 1.0 mM EDTA (PH 8.0), hybridization conditions of 50% formamide, 6X SSC at 42°C (or other similar hybridization solution, such as Stark’s solution, in 50% formamide at 42°C, and with washing at approximately 68°C, 0.2X SSC, 0.1% SDS. The skilled artisan will recognize that the temperature and wash solution salt concentration can be adjusted as necessary according to factors such as the length ofthe probe. [0051] Moderate stringency, as used herein, include conditions that can be readily determined by those having ordinary

ΕΡ 2 361 932 Β1 skill in the art based on, for example, the length of the DNA. The basic conditions are set forth by Sambrook et al. Molecular Cloning; A Laboratory Manual 2d ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory Press (1989), and include use ofa prewashing solution forthe nitrocellulose filters 5X SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of 50% formamide, 6X SSC at 42°C (or other similar hybridization solution, such as Stark’s solution, in 50% formamide at 42°C), and washing conditions of 60°C, 0.5X SSC, 0.1 % SDS.

[0052] A small inorganic molecule, as used herein means a molecule containing no carbon atoms and being no larger than 50 kD.

[0053] A small organic molecule, as used herein means a molecule containing at least one carbon atom and being no larger than 50 kD.

[0054] Treat, treatment, treating, as used herein means, any ofthe Following: the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration of one or more symptoms associated with a disease or condition; the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition, the prophylaxis ofone or more symptoms associated with a disease or condition.

B. Improvements Offered by Certain Embodiments ofthe Invention [0055] The present disclosure provides for chimeric proteins (monomer-dimer hybrids) comprising a first and a second polypeptide chain, wherein said first chain comprises a biologically active molecule and at least a portion ofan immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region without any biologically active molecule or variable region of an immunoglobulin. Figure 1 contrasts traditional fusion protein dimers with one example ofthe monomer-dimer hybrid ofthe present disclosure (which example is, moreover, an embodiment of the present invention). In this example, the biologically active molecule is EPO and the portion of an immunoglobulin is IgG Fc region.

[0056] Like other chimeric proteins comprised of at least a portion of an immunoglobulin constant region, the present disclosure, including the present invention, provides for chimeric proteins which afford enhanced stability and increased bioavailability ofthe chimeric protein compared to the biologically active molecule alone. Additionally, however, because only one ofthe two chains comprises the biologically active molecule, the chimeric protein has a lower molecular weight than a chimeric protein wherein all chains comprise a biologically active molecule and while nőt wishing to be bound by any theory, this may result in the chimeric protein being more readily transcytosed across the epithelium barrier, e.g., by binding to the FcRn receptor thereby increasing the half-life of the chimeric protein. In one instance, the present disclosure thus provides for an improved non-invasive method (e.g. via any mucosal surface, such as, orally, buccally, sublingually, nasally, rectally, vaginally, orvia pulmonary oroccular route) of administering a therapeutic chimeric protein of the present disclosure, e.g. a therapeutic chimeric protein of the present invention. The present disclosure thus provides methods of attaining therapeutic levels of the chimeric proteins of the present disclosure, e.g. of the chimeric proteins ofthe present invention, using less frequent and lower doses compared to previously described chimeric proteins (e.g. chimeric proteins comprised of at least a portion of an immunoglobulin constant region and a biologically active molecule, wherein all chains ofthe chimeric protein comprise a biologically active molecule).

[0057] In another instance, the present disclosure provides an invasive method, e.g. subcutaneously, intravenously, of administering a therapeutic chimeric protein ofthe presentdisclosure, e.g. a therapeutic chimeric protein ofthe present invention. Invasive administration ofthe therapeutic chimeric protein ofthe present disclosure, e.g. ofthe therapeutic chimeric protein ofthe present invention, provides for an increased half life ofthe therapeutic chimeric protein which resuits in using less frequent and lower doses compared to previously described chimeric proteins (e.g. chimeric proteins comprised of at least a portion of an immunoglobulin constant region and a biologically active molecule, wherein all chains ofthe chimeric protein comprise a biologically active molecule).

[0058] Yet another advantage of a chimeric protein wherein only one of the chains comprises a biologically active molecule is the enhanced accessibility of the biologically active molecule for its target cell or molecule resulting from decreased steric hindrance, decreased hydrophobic interactions, decreased ionic interactions, or decreased molecular weight compared to a chimeric protein wherein all chains are comprised ofa biologically active molecule.

C. Chimeric Proteins [0059] The presentdisclosure relates to chimeric proteins comprising one biologically active molecule, at least a portion of an immunoglobulin constant region, and optionally at least one linker. The portion of an immunoglobulin will have both an N, or an amino terminus, and a C, or carboxy terminus. The chimeric protein may have the biologically active molecule linked to the N terminus ofthe portion ofan immunoglobulin. Alternatively, the biologically active molecule may be linked to the C terminus of the portion of an immunoglobulin. In one instance, the linkage is a covalent bond. In another embodiment, the linkage is a non-covalent bond.

[0060] The chimeric protein can optionally comprise at least one linker; thus, the biologically active molecule does nőt

ΕΡ 2 361 932 Β1 have to be directly linked to the portion of an immunoglobulin constant region. The linker can intervene in between the biologically active molecule and the portion of an immunoglobulin constant region. The linker can be linked to the N terminus of the portion of an immunoglobulin constant region, or the C terminus of the portion of an immunoglobulin constant region. Ifthe biologically active molecule is comprised ofat least one amino acid the biologically active molecule will have an N terminus and a C terminus and the linker can be linked to the N terminus ofthe biologically active molecule, or the C terminus the biologically active molecule.

[0061] The present disclosure relates to a chimeric protein of the formula X-L_a-F:F or F:F-L_a-X , wherein X is a biologically active molecule, L is an optional linker, F is at least a portion of an immunoglobulin constant region and, a is any integer or zero. The present disclosure alsó relates to a chimeric protein ofthe formula T_a-X-L_a-F:F or T_a-F:F-L_a-X, wherein X is a biologically active molecule, L is an optional linker, F is at least a portion of an immunoglobulin constant region, a is any integer or zero, T is a second linker or alternatively a tag that can be used to facilitate purification ofthe chimeric protein, e.g., a FLAG tag, a histidine tag, a GST tag, a maltose binding protein tag and (:) represents a Chemical association, e.g. at least one non-peptide bond. In certain instances, the Chemical association, i.e., (:) is a covalent bond. In other instances, the Chemical association, i.e., (:) is a non-covalent interaction, e.g., an ionic interaction, a hydrophobic interaction, a hydrophilic interaction, a Van derWaals interaction, a hydrogen bond. Itwill be understood by the skilled artisan that when a equals zero X will be directly linked to F. Thus, fór example, a may be 0, 1,2, 3, 4, 5, or more than 5. [0062] In one instance, the chimeric protein of the present disclosure comprises the amino acid sequence of figure 2a (SEQ ID NO: 6). In one instance, the chimeric protein ofthe present disclosure comprises the amino acid sequence of figure 2b (SEQ ID NO:8). In one instance, the chimeric protein of the present disclosure comprises the amino acid sequence of figure 2c (SEQ ID NO:10). In one instance, the chimeric protein ofthe present disclosure comprises the amino acid sequence of figure 2d (SEQ ID NO:12). In one instance, the chimeric protein ofthe present disclosure comprises the amino acid sequence of figure 2e (SEQ ID NO:14). In one instance, the chimeric protein ofthe present disclosure comprises the amino acid sequence of figure 2f (SEQ ID NO:16). In one instance, the chimeric protein ofthe present disclosure comprises the amino acid sequence of figure 2g (SEQ ID NO:18). In one instance, the chimeric protein ofthe present disclosure comprises the amino acid sequence of figure 2h (SEQ ID NO:20). In one instance, the chimeric protein of the present disclosure comprises the amino acid sequence of figure 2i (SEQ ID NO:22). In one instance, the chimeric protein ofthe present disclosure comprises the amino acid sequence of figure 2j (SEQ ID NO:24). In one instance, the chimeric protein of the present disclosure comprises the amino acid sequence of figure 17b (SEQ ID NO:27).

[0063] Based on the disclosure that is provided above, and on the disclosure contained elsewhere herein, the present invention provides fór chimeric proteins within the scope ofthe appended claim 1.

1. Chimeric Protein Variants [0064] Derivatives ofthe chimeric proteins ofthe present disclosure, including ofthe chimeric proteins ofthe present invention, antibodies against such chimeric proteins, and antibodies against binding partners ofsuch chimeric proteins, are all contemplated, and can be made by altering their amino acids sequences by substitutions, additions, and/or deletions/truncations or by Introducing Chemical modification that result in functionally equivalent molecules. It will be understood by one of ordinary skill in the art that certain amino acids in a sequence of any protein may be substituted fór other amino acids without adversely affecting the activity of the protein.

[0065] Various changes may be made in the amino acid sequences ofthe chimeric proteins ofthe present disclosure, e.g. of the chimeric proteins of the present invention, or in DNA sequences encoding therefor without appreciable loss of their biological activity, function, or utility. Derivatives, analogs, or mutants resulting from such changes and the use of such derivatives is within the scope of the present disclosure. In a specific instance, the derivative is functionally active, i.e., capable of exhibiting one or more activities associated with the chimeric proteins of the present disclosure, e.g. of the chimeric proteins of the invention, e.g., FcRn binding, viral inhibition, hemostasis, production of red blood cells. Many assays capable of testing the activity of a chimeric protein comprising a biologically active molecule are known in the art Where the biologically active molecule is an HÍV Inhibitor, activity can be tested by measuring reverse transcriptase activity using known methods (see, e.g., Barre-Sinoussi et al. 1983, Science 220:868; Gallo et al. 1984, Science 224:500). Alternatively, activity can be measured by measuring fusogenic activity. (see, e.g., Nussbaum et al. 1994, J. Virol. 68(9):5411). Where the biological activity is hemostasis, a StaCLot FVIIa-rTF assay can be performed to assess activity of Factor Vlla derivatives (Johannessen et al. 2000, Blood Coagulation and Fibrinolysis 11 :S159). [0066] Substitutes fór an amino acid within the sequence may be selected from other members of the eláss to which the amino acid belongs (see Table 1). Furthermore, various amino acids are commonly substituted with neutral amino acids, e.g., alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine (see, e.g., MacLennan et al. 1998, Acta Physiol. Scand. Suppl. 643:55-67; Sasaki et al. 1998, Adv. Biophys. 35:1-24).

ΕΡ 2 361 932 Β1

TABLE 1

<td> Original Residues</td><td> Exemplary Substitutions</td><td> Typical Substitutions</td>

<td> Alá (A)</td><td> Val, Leu, Ile</td><td> Val</td>

<td> Arg (R)</td><td> Lys, Gin, Asn</td><td> Lys</td>

<td> Asn (N)</td><td> Gin</td><td> Gin</td>

<td> Asp (D)</td><td> Glu</td><td> Glu</td>

<td> Cys (C)</td><td> Ser, Alá</td><td> Ser</td>

<td> Gin (Q)</td><td> Asn</td><td> Asn</td>

<td> Gly (G)</td><td> Pro, Alá</td><td> Alá</td>

<td> His (H)</td><td> Asn, Gin, Lys, Arg</td><td> Arg</td>

<td> lle(l)</td><td> Leu, Val, Met, Alá, Phe, Norleucine</td><td> Leu</td>

<td> Leu (L)</td><td> Norleucine, Ile, Val, Met, Alá, Phe</td><td> Ile</td>

<td> Lys (K)</td><td> Arg, 1,4-Diamino-butyric Acid, Gin, Asn</td><td> Arg</td>

<td> Met (M)</td><td> Leu, Phe, Ile</td><td> Leu</td>

<td> Phe (F)</td><td> Leu, Val, Ile, Alá, Tyr</td><td> Leu</td>

<td> Pro (P)</td><td> Alá</td><td> Gly</td>

<td> Ser (S)</td><td> Thr, Alá, Cys</td><td> Thr</td>

<td> Thr (T)</td><td> Ser</td><td> Ser</td>

<td> Trp (W)</td><td> Tyr, Phe</td><td> Tyr</td>

<td> Tyr (Y)</td><td> Trp, Phe, Thr, Ser</td><td> Phe</td>

<td> Val (V)</td><td> Ile, Met, Leu, Phe, Alá, Norleucine</td><td> Leu</td>

2. Biologically Active Molecules [0067] In the embodiments of the present invention, the biologically active molecule is a protein selected from the group consisting of a cytokine, a hormoné, and a clotting factor (examples ofwhich are provided in the following disclosure). However, the present disclosure more generally contemplates the use of any biologically active molecule as the therapeutic molecule ofthe present disclosure. The biologically active molecule can be a polypeptide. The biologically active molecule can be a single amino acid. The biologically active molecule can Include a modified polypeptide. [0068] The biologically active molecule can include a lipid molecule (e.g. a steroid or cholesterol, a fatty acid, a triacylglycerol, glycerophospholipid, or sphingolipid). The biologically active molecule can include a sugár molecule (e.g. glucose, sucrose, mannose). The biologically active molecule can Include a nucleic acid molecule (e.g. DNA, RNA). The biologically active molecule can include a small organic molecule or a small inorganic molecule.

a. Cytokines and Growth Factors [0069] In one instance, the biologically active molecule is a growth factor, hormoné or cytokine or analóg or fragment thereof. The biological active molecule can be any agent capable of inducing cell growth and proliferation. In a specific instance, the biologically active molecule is any agent which can induce erythrocytes to proliferate. Thus, one example of a biologically active molecule contemplated by the present disclosure is EPO. The biologically active molecule can alsó include, bút is nőt limited to, RANTES, MIP1 α, ΜΙΡ1β, IL-2, IL-3, GM-CSF, growth hormoné, tumor necrosis factor (e.g. TNFa or β).

[0070] The biologically active molecule can Include interferon a, whether synthetically or recombinantly produced, including bút nőt limited to, any one ofthe about twenty-five structurally related subtypes, as for example interferon-a2a, now commercially available for clinical use (ROFERON®, Roche) and interferon-a2b alsó approved for clinical use (INTRON®, Schering) as well as genetically engineered versions of various subtypes, including, bút nőt limited to, commercially available consensus interferon a (INFERGEN®, Intermune, developed by Amgen) and consensus humán

EP 2 361 932 Β1 leukocyte interferon see, e.g., U.S. Patent Nos.: 4,695,623; 4,897,471, interferon β, epidermal growth factor, gonadotropin releasing hormoné (GnRH), leuprolide, follicle stimulating hormoné, progesterone, estrogen, or testosterone.

[0071] A list of cytokines and growth factors which may be used in the chimeric protein of the present disclosure has been previously described (see, e.g., U.S. Patent Nos. 6,086,875, 6,485,726, 6,030,613; WO 03/077834; US2003-0235536A1).

b. Antiviral Agents [0072] In one instance, the biologically active molecule is an antiviral agent, including fragments and analogs hereof. An antiviral agent can include any molecule that Inhibits or prevents viral replication, or inhibits or prevents viral entry intő a cell, or inhibits or prevents viral egress from a cell. In one instance, the antiviral agent is a fusion inhibitor. In one instance, the antiviral agent is a cytokine which inhibits viral replication. In another instance, the antiviral agent is interferon

а.

[0073] The viral fusion inhibitor for use In the chimeric protein can be any molecule which decreases or prevents viral penetration of a cellular membráné of a target cell. The viral fusion inhibitor can be any molecule that decreases or prevents the formation of syncytia between at least two susceptible cells. The viral fusion inhibitor can be any molecule that decreases or prevents the joining ofa lipid bilayer membráné of a eukaryotic cell and a lipid bilayerof an enveloped vírus. Examples of enveloped vírus include, bút are nőt limited to HIV-1, HIV-2, SIV, influenza, parainfluenza, EpsteinBarr vírus, CMV, herpes simplex 1, herpes simplex 2 and respiratory syncytia vírus.

[0074] The viral fusion inhibitor can be any molecule that decreases or prevents viral fusion including, bút nőt limited to, a polypeptide, a small organic molecule or a small inorganic molecule. in one instance, the fusion inhibitor is a polypeptide. In one instance, the viral fusion inhibitor is a polypeptide of 3-36 amino acids. In another instance, the viral fusion inhibitor is a polypeptide of 3-50 amino acids, 10-65 amino acids, 10-75 amino acids. The polypeptide can be comprised ofa naturally occurring amino acid sequence (e.g. a fragment of gp41) including analogs and mutants thereof orthe polypeptide can be comprised of an amino acid sequence nőt found in natúré, so long as the polypeptide exhibits viral fusion inhibitory activity.

[0075] In one instance, the viral fusion inhibitor is a polypeptide, identified as being a viral fusion inhibitor using at leastone computer algorithm, e.g., ALLMOTI5,107x178x4 and PLZIP (see, e.g., U.S. Patent Nos.; 6,013,263; 6,015,881;

б, 017,536; 6,020,459; 6,060,065; 6,068,973; 6,093,799; and 6,228,983).

[0076] In one instance, the viral fusion inhibitor is an HÍV fusion inhibitor. In one instance, HÍV is HIV-1. In another instance, HÍV is HIV-2. In one instance, the HÍV fusion inhibitor is a polypeptide comprised of a fragment of the gap41 envelope protein of HIV-1, The HÍV fusion inhibitor can comprise, e.g., T20 (SEQ ID NO:1) or an analóg thereof, T21 (SEQ ID NO:2) or an analóg thereof, T1249 (SEQ ID NO:3) or an analóg thereof, N_CCGgp41 (Louis et al. 2001, J, Bioi. Chem. 276:(31)29485) or an analóg thereof, or 5 helix (Root et al. 2001, Science 291:884) or an analóg thereof.

[0077] Assays known in the art can be used to test for viral fusion Inhibiting activity of a polypeptide, a small organic molecule, or a small inorganic molecule. These assays include a reverse transcriptase assay, a p24 assay, or syncytia formation assay (see, e.g., U.S. Patent No. 5,464,933).

[0078] A list of antiviral agents which may be used in the chimeric protein ofthe present disclosure has been previously described (see, e.g., U.S. Patent Nos. 6,086,875, 6,485,726, 6,030,613; WO 03/077834; US2003-0235536A1).

c. Hemostatic Agents [0079] In one Instance, the biologically active molecule is a clotting factor or other agent that promotes hemostasis, including fragments and analogs thereof. The clotting factor can include any molecule that has clotting activity or activates a molecule with clotting activity. The clotting factor can be comprised of a polypeptide. The clotting factor can be, as an example, bút nőt limited to Factor Vili, Factor IX, Factor XI, Factor XII, fibrinogen, prothrombin, Factor V, Factor VII, FactorX, FactorXIII orvon Willebrand Factor. In one instance, the clotting factor Is FactorVII or Factor VI la. The clotting factor can be a factor that participates in the extrinsic pathway. The clotting factor can be a factor that participates in the Intrinsic pathway. Alternatively, the clotting factor can be a factor that participates In both the extrinsic and intrinsic pathway.

[0080] The clotting factor can be a humán clotting factor or a non-human clotting factor, e.g., derived from a nonhuman primate, a pig or any mammal. The clotting factor can be chimeric clotting factor, e.g., the clotting factor can comprise a portion of a humán clotting factor and a portion of a porcine clotting factor or a portion of a first non-human clotting factor and a portion of a second non-human clotting factor.

[0081] The clotting factor can be an activated clotting factor. Alternatively, the clotting factor can be an inactive form of a clotting factor, e.g., a zymogen. The inactive clotting factor can undergo activation subsequent to being linked to at least a portion of an immunoglobulin constant region. The inactive clotting factor can be activated subsequent to administration to a subject. Alternatively, the inactive clotting factor can be activated prior to administration.

ΕΡ 2 361 932 Β1 [0082] In certain Instances, an endopeptidase, e.g. paired basic amino acid cleaving enzyme (PACE), or any PACE family member, such as PCSK1-9, including truncated versions thereof, or its yeast equivalent Kex2 from S. cerevisiae and truncated versions of Kex2 (Kex2 1-675) (see, e.g., U.S. Patent Nos. 5,077,204; 5,162,220; 5,234,830; 5,885,821; 6,329,176) may be used to cleave a propetide to form the mature chimeric protein of the present disclosure (e.g. factor VII, factor IX).

d. Other Proteinaceous Biologically Active Molecules [0083] In one Instance ofthe present disclosure, the biologically active molecule is a receptor or a fragment or analóg thereof. The receptor can be expressed on a cell surface, or alternatively the receptor can be expressed on the Ínteríor ofthe cell. The receptor can be a viral receptor, e.g., CD4, CCR5, CXCR4, CD21, CD46. The biologically active molecule can be a bacterial receptor. The biologically active molecule can be an extra-cellular mátrix protein orfragment or analóg thereof, important in bacterial colonization and infection (see, e.g., U.S. Patent Nos.: 5,648,240; 5,189,015; 5,175,096) or a bacterial surface protein Important in adhesion and infection (see, e.g., U.S. Patent No. 5,648,240). The biologically active molecule can be a growth factor, hormoné or cytokine receptor, or a fragment or analóg thereof, e.g., TNFa receptor, the erythropoietin receptor, CD25, CD 122, or CD132.

[0084] A list of other proteinaceous molecules which may be used in the chimeric protein ofthe present disclosure has been previously described (see, e.g., U.S. Patent Nos. 6,086,875; 6,485,726; 6,030,613; WO 03/077834; US2003-0235536A1).

e. Nucleic Acids [0085] In one instance, the biologically active molecule Is a nucleic acid, e.g., DNA, RNA. In one specific instance, the biologically active molecule is a nucleic acid that can be used in RNA interference (RNAI). The nucleic acid molecule can be as an example, bút nőt as a limitation, an anti-sense molecule or a ribozyme or an aptamer.

[0086] Antisense RNA and DNA molecules act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation. Antisense approaches involve the design of oligonucleotides that are complementary to a target gene mRNA. The antisense oligonucleotides will bind to the complementary target gene mRNA transcripts and prevent translation. Absolute complementarily, Is nőt required.

[0087] A sequence complementary to a portion ofan RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand ofthe duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point ofthe hybridized complex.

[0088] Antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects, the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.

[0089] The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified atthe base moiety, sugár moiety, or phosphate backbone, for example, to improve stability ofthe molecule, hybridization, etc. The oligonucleotide may include other appended groups such as polypeptides (e.g. for targeting hőst cell receptors in vivő), or agents facilitating transport across the cell membráné (see, e.g., Letsinger et al. 1989, Proc. Natl. Acad. Sci. USA 86:6553; Lemaitre et al. 1987, Proc. Natl. Acad. Sci. USA 84:648; WO 88/09810,) orthe blood-brain barrier (see, e.g., WO 89/10134), hybridizationtriggered cleavage agents (see, e.g., Krol et al. 1988, BioTechniques 6:958) or intercalating agents (see, e.g., Zon 1988, Pharm. Rés. 5:539). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a polypeptide, hybridization triggered crosslinking agent, transport agent, or hybridization-triggered cleavage agent.

[0090] Ribozyme molecules designed to catalytically cleave target gene mRNA transcripts can alsó be used to prevent translation of target gene mRNA and, therefore, expression of target gene product. (See, e.g., WO 90/11364; Sarver et al. 1990, Science 247,1222-1225).

[0091] Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. (See Rossi 1994, Current Biology 4:469). The mechanism of ribozyme action involves sequence specific hybridization ofthe ribozyme molecule to complementary target RNA, followed by an andonucleolytic cleavage event. The composition of ribozyme molecules must include one or more sequences complementary to the target gene mRNA, and must include the well known catalytic sequence responsible for mRNA cleavage. For this sequence, see, e.g., U.S. Pat. No. 5,093,246. [0092] In one instance, ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy target gene mRNAs. In another instance, the use of hammerhead ribozymes is contemplated. Hammerhead ribozymes

ΕΡ 2 361 932 Β1 cleave mRNAs at locations dictated by flanking regions thatform complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5’-UG-3’. The construction and production of hammerhead ribozymes Is well known In the art and is described more fully in Myers 1995, Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VGH Publishers, New York, and in Haseloff and Gerlach 1988, Natúré, 334:585.

f. Small Molecules [0093] The present disclosure alsó contemplates the use of any therapeutic small molecule or drug as the biologically active molecule In the chimeric protein ofthe present disclosure. A list of small molecules and drugs which may be used in the chimeric protein ofthe present disclosure has been previously described (see, e.g., U.S. Patent Nos. 6,086,875; 6,485,726; 6,030,613; WO 03/077834; US2003-0235536A1).

2. Immunoglobulins [0094] The chimeric proteins of the present disclosure comprise at least a portion of an immunoglobulin constant region. Immunoglobulins are comprised of four protein chains that associate covalently-two heavy chains and two light chains. Each chain is further comprised of one variable region and one constant region. Depending upon the immunoglobulin isotype, the heavy chain constant region is comprised of 3 or 4 constant region domains (e.g. CH1, CH2, CH3, CH4). Somé isotypes are further comprised of a hinge region.

[0095] The portion of an immunoglobulin constant region can be obtained from any mammal. The portion of an immunoglobulin constant region can include a portion of a humán immunoglobulin constant region, a non-human primate immunoglobulin constant region, a bovine immunoglobulin constant region, a porcine immunoglobulin constant region, a murine immunoglobulin constant region, an ovine immunoglobulin constant region or a rat immunoglobulin constant region.

[0096] The portion ofan immunoglobulin constant region can be produced recombinantly or synthetíeally. The immunoglobulin can be Isolated from a cDNA library. The portion ofan immunoglobulin constant region can be isolated from a phage library (See, e.g., McCafferty et al. 1990, Natúré 348:552, Kang et al. 1991, Proc. Natl. Acad. Sci. USA 88:4363; EP 0 589 877 B1). The portion of an immunoglobulin constant region can be obtained by gene shuffling of known sequences (Mark et al. 1992, Bio/Technol. 10:779). The portion of an immunoglobulin constant region can be isolated by in vivő recombination (Waterhouse et al. 1993, Nucl. Acid Rés. 21:2265). The immunoglobulin can be a humanized immunoglobulin (U.S. Patent No. 5,585,089, Jones et al. 1986. Natúré 332:323).

[0097] The portion of an immunoglobulin constant region can include a portion of an IgG, an IgA, an IgM, an IgD, or an IgE. In one Instance, the immunoglobulin is an IgG. In another instance, the immunoglobulin is lgG1. In another instance, the immunoglobulin is lgG2.

[0098] The portion of an immunoglobulin constant region can include the entire heavy chain constant region, or a fragment or analóg thereof. In one instance, a heavy chain constant region can comprise a CH1 domain, a CH2 domain, a CH3 domain, and/or a hinge region. In another instance, a heavy chain constant region can comprise a CH1 domain, a CH2 domain, a CH3 domain, and/or a CH4 domain.

[0099] The portion ofan immunoglobulin constant region can include an Fc fragment. An Fc fragment can be comprised ofthe CH2 and CH3 domains ofan immunoglobulin and the hinge region ofthe immunoglobulin. The Fc fragment can be the Fc fragment of an IgG 1, an lgG2, an lgG3 or an lgG4. In once specific instance, the portion ofan immunoglobulin constant region is an Fc fragment of an IgG 1. In another instance, the portion of an immunoglobulin constant region is an Fc fragment of an lgG2.

[0100] As discussed elsewhere herein, the chimeric proteins ofthe present invention comprise at least a portion of an immunoglobulin constant region which is an Fc neonatal receptor (FcRn) binding partner. This reflects another instance ofthe present disclosure, wherein the portion ofan immunoglobulin constant region Is an FcRn binding partner. An FcRn binding partner is any molecule that can be specifically bound by the FcRn receptor with consequent active transport by the FcRn receptor ofthe FcRn binding partner. Specifically bound refers to two molecules forming a complex that Is relatively stable under physiologic conditions. Specific binding Is characterized by a high affinity and a low to moderate capacity as distinguished from nonspecific binding which usually has a low affinity with a moderate to high capacity. Typically, binding is considered specific when the affinity constant K_A is higher than 10⁶M^_1, or more preferably higher than 10⁸M^_1. If necessary, non-specific binding can be reduced without substantially affecting specific binding by varying the binding conditions. The appropriate binding conditions such as concentration ofthe molecules, lőnie strength ofthe solution, temperature, time allowed fór binding, concentration ofa blocking agent (e.g. serum albumin, milk casein), etc., may be optimized by a skilled artisan using routine techniques.

[0101] The FcRn receptor has been isolated from several mammalian species including humans. The sequences of the humán FcRn, monkey FcRn rat FcRn, and mouse FcRn are known (Story et al. 1994, J. Exp. Med. 180:2377). The

ΕΡ 2 361 932 Β1

FcRn receptor binds IgG (bút nőt other Immunoglobulin classes such as IgA, IgM, IgD, and IgE) at relatively low pH, actively transports the IgG transcellularly in a luminal to serosal direction, and then releases the IgG at relatively higher pH found in the interstitial fluids. lt is expressed in aduit epithelial tissue (U.S. Patent Nos. 6,485,726, 6,030,613, 6,086,875; WO 03/077834; US2003-0235536A1) including lung and intestinal epithelium (Israel et al. 1997, Immunology 92:69) renal proximal tubular epithelium (Kobayashi et al. 2002, Am. J. Physiol. Renal Physiol. 282:F358) as well as nasal epithelium, vagina! surfaces, and biliary tree surfaces.

[0102] FcRn binding partners for use in accordance with the present disclosure, including the present invention, encompass any molecule that can be specifically bound by the FcRn receptor including whole IgG, the Fc fragment of IgG, and other fragments that include the complete binding region ofthe FcRn receptor. The region ofthe Fc portion of IgG that binds to the FcRn receptor has been described based on X-ray crystallography (Burmeister et al. 1994, Natúré 372:379). The major contact area of the Fc with the FcRn is near the junction of the CH2 and CH3 domains. Fc-FcRn contacts are all within a single lg heavy chain. The FcRn binding partners include whole IgG, the Fc fragment of IgG, and other fragments of IgG that include the complete binding region of FcRn. The major contact sites include amino acid residues 248, 250-257, 272, 285, 288, 290-291, 308-311, and 314 ofthe CH2 domain and amino acid residues 385-387, 428, and 433-436 of the CH3 domain. References made to amino acid numbering of immunoglobulins or immunoglobulin fragments, or regions, are all based on Kábát et al. 1991, Sequences of Proteins of Immunological Interest, U.S. Department of Public Health, Bethesda, MD.

[0103] The Fc region of IgG can be modified according to well recognized procedures such as site directed mutagenesis and the like to yield modified IgG or Fc fragments or portions thereof that will be bound by FcRn. Such modifications include modifications remote from the FcRn contact sites as well as modifications within the contact sites that preserve or even enhance binding to the FcRn. For example, the following single amino acid residues in humán lgG1 Fc (Fcy1) can be substituted without significant loss of Fc binding affinity for FcRn: P238A, S239A, K246A, K248A, D249A, M252A, T256A, E258A, T260A, D265A, S267A, H268A, E269A, D270A, E272A, L274A, N276A, Y278A, D280A, V282A, E283A, H285A, N286A, T289A, K290A, R292A, E293A, E294A, Q295A, Y296F, N297A, S298A, Y300F, R301 A, V303A, V305A, T307A, L309A, Q311A, D312A, N315A, K317A, E318A, K320A, K322A, S324A, K326A, A327Q, P329A, A330Q, P331A, E333A, K334A, T335A, S337A, K338A, K340A, Q342A, R344A, E345A, Q347A, R355A, E356A, M368A, T359A, K360A, N361 A, Q302A, Y373A, S375A, D376A, A378Q, E380A, E382A, S383A ,N384A, Q386A, E388A, N389A, N390A, Y391F, K392A, L398A, S400A, D401A, D413A, K414A, R416A, Q498A, Q419A, N421A, V422A, S424A, E430A, N434A, T437A, Q438A, K439A, S440A, S444A, and K447A, where for example P238A represents Wildtype proline substituted by alanine at position number 238. As an example, one specific instance of the present disclosure, e.g. one specific embodiment ofthe present invention, Incorporates the N297A mutation, removing a highly conserved N-glycosylation site. In addition to alanine other amino acids may be substituted for the wildtype amino acids at the positions specified above. Mutations may be Introduced singly intő Fc giving rise to more than one hundred FcRn binding partners distinct from native Fc. Additionally, combinations of two, three, or more of these individual mutations may be introduced together, giving rise to hundreds more FcRn binding partners. Moreover, one of the FcRn binding partners of the monomer-dimer hybrid may be mutated and the other FcRn binding partner nőt mutated at all, or they both may be mutated bút with different mutations. Any ofthe mutations described herein, including N297A, may be used to modify Fc, regardless ofthe biologically active molecule (e.g., EPO, IFN, Factor IX, T20).

[0104] Certain ofthe above mutations may confer new functionality upon the FcRn binding partner. For example, one embodiment Incorporates N297A, removing a highly conserved N-glycosylation site. The effect of this mutation is to reduce immunogenicity, thereby enhancing circulating half life of the FcRn binding partner, and to render the FcRn binding partner incapable of binding to FcyRI, FcyRIlA, FcyRIIB, and FcyRIIIA, without compromising affinity for FcRn (Routledge et al. 1995, Transplantation 60:847; Friend et al. 1999, Transplantation 68:1632; Shields et al. 1995, J. Bioi. Chem. 276:6591). As a further example of new functionality arising from mutations described above affinity for FcRn may be Increased beyond that of wild type in somé instances. This increased affinity may reflect an increased on rate, a decreased off rate or both an increased on rate and a decreased off rate. Mutations believed to impact an increased affinity for FcRn include T256A, T307A, E380A, and N434A (Shields etal. 2001, J. Bioi. Chem. 276:6591).

[0105] Additionally, at least three humán Fc gamma receptors appear to recognize a binding site on IgG within the lower hinge region, generally amino acids 234-237. Therefore, another example of new functionality and potential decreased immunogenicity may arise from mutations of this region, as for example by replacing amino acids 233-236 of humán IgG 1 ELLG to the corresponding sequence from lgG2 PVA (with one amino acid deletion). lt has been shown that FcyRI, FcyRII, and FcyRIII, which mediate various effector functions will nőt bind to IgG 1 when such mutations have been introduced. Ward and Ghefie 1995, Therapeutic Immunology2:77and Armouretal. 1999, Eur. J. Immunoi. 29:2613. [0106] In one Instance, e.g. in one embodiment, the FcRn binding partner Is a polypeptide including the sequence PKNSSMISNTP (SEQ ID NO:26) and optionally further including a sequence selected from HQSLGTQ (SEQ ID NO:27), HQNLSDGK (SEQ ID NO:28), HQNISDGK (SEQ ID NO:29), orVISSHLGQ (SEQ ID NO:30) (U.S. Patent No. 5,739,277). [0107] Two FcRn receptors can bind a single Fc molecule. Crystallographic data suggest that each FcRn molecule binds a single polypeptide of the Fc homodimer. In one instance of the present disclosure, e.g. In one embodiment of

ΕΡ 2 361 932 Β1 the present invention, linking the FcRn binding partner, e.g., an Fc fragment ofan IgG, to a biologically active molecule (which in the case of the invention is a cytokine, a hormoné, or a clotting factor) provides a means of delivering the biologically active molecule orally, buccally, sublingually, rectally, vaginally, as an aerosol administered nasally or via a pulmonary route, or via an ocular route. In another instance, e.g. in another embodiment, the chimeric protein can be administered invasively, e.g., subcutaneously, intravenously.

[0108] The skilled artisan will understand that portions of an immunoglobulin constant region for use in the chimeric protein ofthe invention can include mutants or analogs thereof, or can include chemically modified immunoglobulin constant régions (e.g. pegylated), orfragments thereof (see, e.g., Aslam and Dent 1998, Bioconjugation: Protein Coupling Techniques Forthe Biomedical Sciences Macmilan Reference, London). In one instance, a mutant can provide for enhanced binding of an FcRn binding partner for the FcRn. Alsó contemplated for use in the chimeric protein of the present disclosure are peptide mimetics of at least a portion of an immunoglobulin constant region, e.g., a peptide mimetic of an Fc fragment or a peptide mimetic of an FcRn binding partner. In one instance, the peptide mimetic is identified using phage display or via Chemical library screening (see, e.g., McCafferty et al. 1990, Natúré 348:552, Kang etal. 1991, Proc. Natl. Acad. Sci. USA 88:4363; EP 0 589 877 B1).

3. Optional Linkers [0109] The chimeric protein ofthe present disclosure, e.g. the chimeric protein ofthe present invention, can optionally comprise at least one linker molecule. The linker can be comprised of any organic molecule. In one instance of the present disclosure, e.g. in one embodiment ofthe present invention, the linker is polyethylene glycol (PEG). In another instance, e.g. in another embodiment, the linker is comprised of amino acids. The linker can comprise 1-5 amino acids, 1-10 amino acids, 1-20 amino acids, 10-50 amino acids, 50-100 amino acids, 100-200 amino acids. In one instance, e.g. In one embodiment, the linker is the eight amino acid linker EFAGAAAV (SEQ ID NO:31). Any ofthe linkers described herein may be used in the chimeric protein ofthe present disclosure, e.g. in the chimeric proteins ofthe present invention, e.g. a monomer-dimer hybrid, including EFAGAAAV, regardless ofthe biologically active molecule (e.g. EPO, IFN, Factor IX).

[0110] The linker can comprise the sequence G_n. The linker can comprise the sequence (GA)_n (SEQ ID NO:32). The linker can comprise the sequence (GGS)_n (SEQ ID NO:33). The linker can comprise the sequence (GGS)_n(GGGGS)_n(SEQ ID NO:34). I n these instances, n may be an integer from 1-10, i.e., 1,2, 3, 4, 5, 6, 7, 8, 9, 10. Examples of linkers include, bút are nőt limited to, GGG (SEQ ID NO:35), SGGSGGS (SEQ ID NO:36), GGSGGSGGSGGSGGG (SEQ ID NO:37), GGSGGSGGGGSGGGGS (SEQ ID NO:38), GGSGGSGGSGGSGGSGGS (SEQ ID NO:39). The linker does nőt eliminate or diminish the biological activity of the chimeric protein. Optionally, the linker enhances the biological activity of the chimeric protein, e.g., by further diminishing the effects of steric hindrance and making the biologically active molecule more accessible to its target binding site.

[0111] In one specific instance ofthe present disclosure, e.g. in one specific embodiment ofthe present Invention, the linker for interferon a is 15-25 amino acids long. In another specific instance / in another specific embodiment, the linker for interferon a Is 15-20 amino acids long. In another specific instance / in another specific embodiment, the linker for interferon a is 10-25 amino acids long. In another specific instance / in another specific embodiment, the linker for interferon a is 15 amino acids long. In one instance / in one embodiment, the linker for interferon a is (GGGGS)_n (SEQ ID NO:40) where G represents glycine, S represents serine and n is an integer from 1-10. In a specific instance / in a specific embodiment, n is 3.

[0112] The linker may alsó incorporate a moiety capable of being cleaved either chemically (e.g. hydrolysis ofan ester bond), enzymatically (i.e. incorporation ofa protease cleavage sequence) or photolytically (e.g.,a chromophore such as 3-amino-3-(2-nitrophenyl) proprionic acid (ANP)) in orderto release the biologically active molecule from the Fc protein.

4. Chimeric Protein Dimerization Using Specific Binding Partners [0113] In one instance, the chimeric protein ofthe present disclosure comprises a first polypeptide chain comprising at least a first domain, said first domain having at least one specific binding partner, and a second polypeptide chain comprising at least a second domain, wherein said second domain, is a specific binding partner of said first domain. The chimeric protein thus comprises a polypeptide capable of dimerizing with another polypeptide due to the interaction ofthe first domain and the second domain. Methods of dimerizing antibodies using heterologous domains are known in the art (U.S. Patent Nos.: 6,807,706 and 5,910,573; Kostelny et al. 1992, J. Immunoi. 148(5):1547).

[0114] Dimerization can occur by formation ofa covalent bond, or alternatively a non-covalent bond, e.g., hydrophobic interaction, Van dér Waal’s forces, interdigitation ofamphiphilic peptides such as, bút nőt limited to, alpha helices, chargecharge interactions of amino acids bearing opposite charges, such as, bút nőt limited to, lysine and aspartic acid, arginine and glutamic acid. In one instance, the domain is a helix bundle comprising a helix, a turn and another helix. In another instance, the domain is a leucine zipper comprising a peptide having several repeating amino acids in which every

ΕΡ 2 361 932 Β1 seventh amino acid is a leucine residue. In one instance, the specific binding partners are fos/jun. (see Branden et al. 1991, Introduction To Protein Structure, Garland Publishing, New York).

[0115] In another instance, binding is mediated by a Chemical linkage (see, e.g., Brennan et al. 1985, Science 229:81). In this instance, intact immunoglobulins, or chimeric proteins comprised of at least a portion of an immunoglobulin constant region are cleaved to generate heavy chain fragments. These fragments are reduced in the presence ofthe dithlol complexing agent sodiurn arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The fragments generated are then converted to thionitrobenzoate (TNB) derivatives. One of the TNB derivatives is then reconverted to the heavy chain fragment thiol by reduction with mercaptoethylamine and is then mixed with an equimolar amount of the other TNB derivative to form a chimeric dimer.

D. Nucleic Acids [0116] The present disclosure relates to a first nucleic acid construct and a second nucleic acid construct each comprising a nucleic acid sequence encoding at least a portion of the chimeric protein of the present disclosure. In one instance, the first nucleic acid construct comprises a nucleic acid sequence encoding a portion of an immunoglobulin constant region operatively linked to a second DNA sequence encoding a biologically active molecule, and said second DNA construct comprises a DNA sequence encoding an immunoglobulin constant region without the second DNA sequence encoding a biologically active molecule.

[0117] The biologically active molecule can include, forexample, bút nőt as a limitation, a viral fusion inhibitor, a clotting factor, a growth factor or hormoné, or a receptor, or analóg, or fragment of any of the preceding. The nucleic acid sequences can alsó include additionai sequences or elements known in the art (e.g., promoters, enhancers, poly A sequences, affinity tags). In one instance, the nucleic acid sequence ofthe first construct can optionally include a nucleic acid sequence encoding a linker placed between the nucleic acid sequence encoding the biologically active molecule and the portion ofthe immunoglobulin constant region. The nucleic acid sequence ofthe first DNA construct can optionally include a linker sequence placed before or after the nucleic acid sequence encoding the biologically active molecule and/or the portion of the immunoglobulin constant region.

[0118] In one instance, the nucleic acid construct is comprised of DNA. In another instance, the nucleic acid construct is comprised of RNA. The nucleic acid construct can be a vector, e.g., a viral vector or a plasmid. Examples of viral vectors include, bút are nőt limited to adeno vírus vector, an adeno associated vírus vector or a murine leukémia vírus vector. Examples of plasmids include bút are nőt limited to pUC, pGEM and pGEX.

[0119] In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 3a (SEQ ID NO:7). In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 3b (SEQ ID NO:9). In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 3c (SEQ ID NO:11). In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 3d (SEQ ID NO:13). In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 3e (SEQ ID NO:15). In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 3f (SEQ ID NO:17). In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 3g (SEQ ID NO:19). In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 3h (SEQ ID NO:21). In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 3i (SEQ ID NO:23). In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 3j (SEQ ID NO:25). In one instance, the nucleic acid construct comprises the nucleic acid sequence of figure 17a (SEQ ID NO:27).

[0120] Due to the known degeneracy ofthe genetic code, wherein more than one codon can encode the same amino acid, a DNA sequence can vary from that shown in SEQ ID NOS:7, 9,11,13, 15, 17, 19, 21,23, 25 or 27 and still encode a polypeptide having the corresponding amino acid sequence of SEQ ID NOS:6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or26 respectively. Such variant DNA sequences can result from silent mutations (e.g. occurring during PCR amplification), or can be the product of deliberate mutagenesis of a native sequence. The present disclosure thus provides isolated DNA sequences encoding polypeptides of the present disclosure, chosen from: (a) DNA comprising the nucleotide sequence ofSEQ ID NOS:7, 9,11,13, 15,17,19, 21,23, 25or27; (b) DNA encoding the polypeptides ofSEQ ID NOS:6, 8,10,12,14,16,18,20, 22, 24 or 26; (c) DNA capable of hybridization to a DNAof (a) or (b) under conditions of moderate stringency and which encodes polypeptides of the present disclosure; (d) DNA capable of hybridization to a DNA of (a) or (b) under conditions of high stringency and which encodes polypeptides ofthe present disclosure, and (e) DNA which Is degenerate as a result of the genetic code to a DNA defined in (a), (b), (c), or (d) and which encode polypeptides of the present disclosure. Of course, polypeptides encoded by such DNA sequences are encompassed by the present disclosure.

[0121] In another instance, the nucleic acid molecules comprising a sequence encoding the chimeric protein of the present disclosure can alsó comprise nucleotide sequences that are at least 80% identical to a native sequence. Alsó contemplated are instances in which a nucleic acid molecules comprising a sequence encoding the chimeric protein of the present disclosure comprises a sequence that Is at least 90% identical, at least 95% identical, at least 98% identical,

ΕΡ 2 361 932 Β1 at least 99% identical, orat least 99.9% identical to a native sequence. A native sequence can include any DNA sequence nőt altered bythe humán hand. The percent identity may be determined by visual inspection and mathematical calculation. Alternatively, the percent identity oftwo nucleic acid sequences can be determined by comparing sequence information using the GAP computer program, version 6.0 described by Devereux et al. 1984, Nucl. Acids Rés. 12:387, and available from the University of Wisconsin Genetics Computer Group (UWGCG). The preferred default parameters fór the GAP program include: (1) a unary comparison mátrix (containing a value of 1 fór identities and 0 fór non identities) fór nucleotides, and the weighted comparison mátrix of Gribskov and Burgess 1986, Nucl. Acids Rés. 14:6745, as described by Schwartzand Dayhoff, eds. 1979, Atlasof Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358; (2) a penalty of 3.0 fór each gap and an additional 0.10 penalty fór each Symbol in each gap; and (3) no penalty fór end gaps. Other programs used by one skilled in the art of sequence comparison may alsó be used. Based on the above disclosure, and on the disclosure contained elsewhere herein, the present invention provides first and second polynucleotides as setforth in the appended claims.

E. Synthesis of Chimeric Proteins [0122] Chimeric proteins comprising at least a portion of an immunoglobulin constant region and a biologically active molecule can be synthesized using techniques well known in the art. Fór example, the chimeric proteins of the present disclosure, including the chimeric proteins ofthe present invention, can be synthesised recombinantly in cells (see, e.g., Sambrook et al. 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. and Ausubel et al. 1989, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley interscience, N.Y.). Alternatively, the chimeric proteins ofthe present disclosure, including the chimeric proteins ofthe present invention, can be synthesized using known synthetic methods such as solid phase synthesis. Synthetic techniques are well known in the art (see, e.g., Merrifield, 1973, Chemical Polypeptides, (Katsoyannis and Panayotis eds.) pp. 335-61; Merrifield 1963, J. Am. Chem. Soc. 85:2149; Davis et al. 1985, Biochem Inti. 10:394; Finn et al. 1976, The Proteins (3d ed.) 2:105; Erikson et al. 1976, The Proteins (3d ed.) 2:257; U.S. Patent No. 3,941,763). Alternatively, the chimeric proteins of the present disclosure, including the chimeric proteins of the present invention, can be synthesized using a combination of recombinant and synthetic methods. In certain applications, it may be beneficial to use either a recombinant method or a combination of recombinant and synthetic methods.

[0123] Nucleic acids encoding a biologically active molecule can be readily synthesized using recombinant techniques well known in the art. Alternatively, the peptides themselves can be chemically synthesized. Nucleic acids ofthe present disclosure, including nucleic acids ofthe present invention, may be synthesized by standard methods known in the art, e.g., by use ofan automated DNA synthesizer (such as are commercially availablefrom Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. 1988, Nucl. Acids Rés. 16:3209, methylphosphonate oligonucleotides can be prepared by use of controlled poré glass polymer supports as described in Sárin et al. 1988, Proc. Natl. Acad. Sci. USA 85:7448. Additional methods of nucleic acid synthesis are known In the art. (see, e.g., U.S. Patent Nos. 6,015,881; 6,281,331; 6,469,136).

[0124] DNA sequences encoding immunoglobulin constant regions, or fragments thereof, may be cloned from a variety of genomic or cDNA libraries known in the art. The techniques fór isolating such DNA sequences using probe-based methods are conventional techniques and are well known to those skilled in the art. Probes fór isolating such DNA sequences may be based on published DNA sequences (see, fór example, Hieter et al.1980, Cell 22:197-207). The polymerase chain reaetion (PCR) method disclosed by Mullis et al. (U.S. Patent No. 4,683,195) and Mullis (U.S. Patent No. 4,683,202) may be used. The choice of library and selection of probes fór the isolation of such DNA sequences is within the level of ordinary skill in the art. Alternatively, DNA sequences encoding immunoglobulins or fragments thereof can be obtained from vectors known in the art to contain immunoglobulins or fragments thereof.

[0125] Fór recombinant production, a first polynucleotide sequence encoding a portion ofthe chimeric protein ofthe present disclosure, e.g. ofthe chimeric protein ofthe present invention (e.g. a portion ofan immunoglobulin constant region) and a second polynucleotide sequence encoding a portion of the chimeric protein of the present disclosure, e.g. ofthe chimeric protein ofthe present invention (e.g. a portion of an immunoglobulin constant region and a biologically active molecule, which in the case ofthe present invention is a cytokine, a hormoné, or a clotting factor) are Ínserted intő appropriate expression vehicles, i.e. vectors which contains the necessary elements fór the transcription and translation of the Ínserted coding sequence, or in the case of an RNA viral vector, the necessary elements fór replication and translation. The nucleic acids encoding the chimeric protein are Ínserted intő the vector in proper reading frame.

[0126] The expression vehicles are then transfected or co-transfected intő a suitable target cell, which will express the polypeptides. Transfection techniques known in the art include, bút are nőt limited to, calcium phosphate precipitation (Wigler et al. 1978, Cell 14:725) and electroporation (Neumann et al. 1982, EMBO, J. 1:841), and liposome based reagents. A variety of host-expression vector systems may be utilized to express the chimeric proteins described herein including both prokaryotic or eukaryotic cells. These include, bút are nőt limited to, microorganisms such as bacteria (e.g. E. coli) transformed with recombinant bacteriophage DNA or plasmid DNA expression vectors containing an ap19

ΕΡ 2 361 932 Β1 propriate coding sequence; yeast or filamentous fungi transformed with recombinant yeast or fungi expression vectors containing an appropriate coding sequence; insect cell systems infected with recombinant vírus expression vectors (e.g. baculovirus) containing an appropriate coding sequence; plánt cell systems infected with recombinant vírus expression vectors (e.g. cauliflower mosaic vírus or tobacco mosaic vírus) or transformed with recombinant plasmid expression vectors (e.g. Ti plasmid) containing an appropriate coding sequence; or animal cell systems, including mammalian cells (e.g. CHO, Cos, HeLa cells).

[0127] When the chimeric protein of the present disclosure, e.g. the chimeric protein of the present invention, is recombinantly synthesized in a prokaryotic cell it may be desirable to refold the chimeric protein. The chimeric protein produced by this method can be refolded to a biologically active conformation using conditions known in the art, e.g., denaturing under reducing conditions and then dialyzed slowly intő PBS.

[0128] Depending on the expression system used, the expressed chimeric protein is then isolated by procedures wellestablished in the art (e.g. affinity chromatography, size exclusion chromatography, ion exchange chromatography). [0129] The expression vectors can encode for tags that permit for easy purification of the recombinantly produced chimeric protein. Examples include, bút are nőt limited to vector pUR278 (Ruther et al. 1983, EMBO J. 2:1791) in which the chimeric protein described herein coding sequences may be ligated intő the vector In frame with the lac z coding region so that a hybrid protein is produced; pGEX vectors may be used to express chimeric proteins of the present disclosure, e.g. chimeric proteins ofthe present invention, with a glutathione S-transferase (GST) tag. These proteins are usually soluble and can easily be purified from cells by adsorption to glutathione-agarose beads followed by elution in the presence offree glutathione. The vectors include cleavage sites (thrombin or Factor Xa protease or PreScission Protease™ (Pharmacia, Peapack, N.J.)) for easy removal ofthe tag after purification.

[0130] To increase efficiency of production, the polynucleotides can be designed to encode multiple units ofthe chimeric protein ofthe present disclosure, e.g. ofthe chimeric protein ofthe present invention, separated by enzymatic cleavage sites. The resulting polypeptide can be cleaved (e.g. by treatment with the appropriate enzyme) in orderto recoverthe polypeptide units. This can increase the yield of polypeptides driven by a single promoter. When used in appropriate viral expression systems, the translation of each polypeptide encoded by the mRNA is directed internally in the transcript; e.g., by an internál ribosome entry site, IRES. Thus, the polycistronic construct directs the transcription ofa single, large polycistronic mRNA which, in turn, directs the translation of multiple, individual polypeptides. This approach eliminates the production and enzymatic processing of polyproteins and may significantly increase yield of polypeptide driven by a single promoter.

[0131] Vectors used in transformation will usually contain a selectable marker used to identify transformants. In bacterial systems, this can include an antibiotic resistance gene such as ampicillin or kanamycin. Selectable markers for use in cultured mammalian cells include genes that confer resistance to drugs, such as neomycin, hygromycin, and methotrexate. The selectable marker may be an amplifiable selectable marker. One amplifiable selectable marker is the DHFR gene. Another amplifiable marker is the DHFR cDNA(Simonsen and Levinson 1983, Proc. Natl. Acad. Sci. USA 80:2495). Selectable markers are reviewed by Thilly (Mammalian Cell Technology, Butterworth Publishers, Stoneham, MA) and the choice of selectable markers is well within the level of ordinary skill in the art.

[0132] Selectable markers may be introduced intő the cell on a separate plasmid at the same time as the gene of interest, or they may be introduced on the same plasmid. If on the same plasmid, the selectable marker and the gene of interest may be under the control ofdifferent promoters or the same promoter, the latter arrangement producing a dicistronic message. Constructs ofthis type are known in the art (for example, U.S. Pat. No. 4,713,339).

[0133] The expression elements ofthe expression systems vary in their strength and specificities. Depending on the host/vector system utilized, any ofa number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used in the expression vector. For example, when cloning in bacterial systems, inducible promoters such as pL of bacteriophage λ, piac, ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used; when cloning in insect cell systems, promoters such as the baculovirus polyhedron promoter may be used; when cloning in plánt cell systems, promoters derived from the genome of plánt cells (e.g. heat shock promoters; the promoter for the small subunit of RUBISCO; the promoter for the chlorophyll a/b binding protein) orfrom plánt viruses (e.g. the 35S RNA promoter of CaMV; the coat protein promoter ofTMV) may be used; when cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (e.g. metallothionein promoter) or from mammalian viruses (e.g. the adenovirus laté promoter; the vaccinia vírus 7.5 K promoter) may be used; when generating cell lines that contain multiple copies of expression product, SV40-, BPV-and EBV-based vectors may be used with an appropriate selectable marker. [0134] In cases where plánt expression vectors are used, the expression of sequences encoding linearor non-cyclized forms of the chimeric proteins of the present disclosure, including the chimeric proteins of the present invention, may be driven by any of a number of promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV (Brisson et al. 1984, Natúré 310:511-514), orthe coat protein promoter ofTMV (Takamatsu et al. 1987, EMBO

J. 6:307-311) may be used; alternatively, plánt promoters such as the small subunit of RUBISCO (Coruzzi et al. 1984, EMBO J. 3:1671-1680; Broglie et al. 1984, Science 224:838-843) or heat shock promoters, e.g., soybean hsp17.5-E or hsp17.3-B (Gurley et al. 1986, Mól. Cell. Bioi. 6:559-565) may be used. These constructs can be introduced intő plánt

ΕΡ 2 361 932 Β1 cells using Ti plasmids, Rl plasmids, plánt vírus vectors, direct DNA transformation, microinjection, eleetroporation, etc. Forreviews ofsuch techniques see, e.g., Weissbach &amp; Weissbach 1988, Methods for Plánt Molecular Biology, Academic Press, NY, Section Vili, pp. 421-4.63; and Grierson &amp; Corey 1988, Plánt Molecular Biology, 2d Ed., Blackie, London, Ch. 7-9.

[0135] In one insect expression system that may be used to produce the chimeric proteins ofthe present disclosure, including the chimeric proteins ofthe present invention, Autographa californica nuclear polyhidrosis vírus (AcNPV) is used as a vector to express the foreign genes. The vírus grows in Spodoptera frugiperda cells. A coding sequence may be cloned intő non-essential regions (for example, the polyhedron gene) of the vírus and placed under control of an AcNPV promoter (for example, the polyhedron promoter). Successful insertion of a coding sequence will result in Inactivation ofthe polyhedron gene and production of non-occluded recombinant vírus (i.e. vírus lacking the proteinaceous coat coded for by the polyhedron gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed. (see, e.g., Smith et al. 1983, J. Virol. 46:584; U.S. Patent No. 4,215,051). Further examples ofthis expression system may be found in Ausubel et al., eds. 1989, Current Protocols in Molecular Biology, Vol. 2, Greene Publish. Assoc. &amp; Wiley Interscience.

[0136] Another system which can be used to express the chimeric proteins of the present disclosure, including the chimeric proteins ofthe present invention, is the glutamine sythetase gene expression system, alsó referred to as the GS expression system (Lonza Biologics PLC, Berkshire UK). This expression system is deseribed in detail in U.S. Patent No. 5,981,216.

[0137] In mammalian hőst cells, a number of viral based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, a coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the laté promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivő recombination. Insertion in a non-essential region ofthe viral genome (e.g. region E1 or E3) will result In a recombinant vírus that is viable and capable of expressing peptide in infected hosts (see, e.g., Logan &amp; Shenk 1984, Proc. Natl. Acad. Sci. USA 81:3655). Alternatively, the vaccinia 7.5 K promoter may be used (see, e.g., Mackett et al. 1982, Proc. Natl. Acad. Sci. USA 79:7415; Mackett et al. 1984, J. Virol. 49:857; Panicali et al. 1982, Proc. Natl. Acad. Sci. USA 79:4927).

[0138] In cases where an adenovirus is used as an expression vector, a coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the laté promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivő recombination. Insertion in a non-essential region ofthe viral genome (e.g. region E1 or E3) will result in a recombinant vírus that is viable and capable of expressing peptide in infected hosts (see, e.g., Logan &amp; Shenk 1984, Proc. Natl. Acad. Sci. USA 81:3655). Alternatively, the vaccinia 7.5 K promoter may be used (see, e.g., Mackett et al. 1982, Proc. Natl. Acad. Sci. USA 79:7415; Mackett et al. 1984, J. Virol. 49:857; Panicali et al. 1982, Proc. Natl. Acad. Sci. USA 79:4927).

[0139] Hőst cells containing DNA constructs of the chimeric protein are grown in an appropriate growth médium. As used herein, the term appropriate growth médium means a médium containing nutrients required for the growth of cells. Nutrients required for cell growth may include a carbon source, a nitrogén source, essential amino acids, vitamins, minerals and growth factors. Optionally the média can contain bovine calf serum orfetal calf serum. In one instance, e.g. in one embodiment, the média contains substantially no IgG. The growth médium will generally select for cells containing the DNA construct by, for example, drug selection or deficiency in an essential nutrient which is complemented by the selectable marker on the DNA construct or co-transfected with the DNA construct. Cultured mammalian cells are generally grown In commercially available serum-containing or serum-free média (e.g. MÉM, DMEM). Selection of a médium appropriate for the particular cell line used is within the level of ordinary skill in the art.

[0140] The recombinantly produced chimeric protein ofthe present disclosure, e.g. the recombinantly produced chimeric protein ofthe present invention, can be isolated from the culture média. The culture médium from appropriately grown transformed or transfected hőst cells is separated from the cell matériái, and the presence of chimeric proteins is demonstrated. One method of detecting the chimeric proteins, for example, is by the binding of the chimeric proteins or portions of the chimeric proteins to a specific antibody recognizing the chimeric protein of the present disclosure, e.g. the chimeric protein of the present invention. An anti-chimeric protein antibody may be a monoclonal or polyclonal antibody raised against the chimeric protein in question. For example, the chimeric protein contains at least a portion of an immunoglobulin constant region. Antibodies recognizing the constant region of many immunoglobulins are known in the art and are commercially available. An antibody can be used to perform an ELISA or a western biot to detect the present of the chimeric protein of the present disclosure, e.g. the chimeric protein of the present invention.

[0141] The chimeric protein of the present disclosure, e.g. the chimeric protein of the present invention, can be synthesized in a transgenic animal, such as a rodent, cow, pig, sheep, orgoat. The term transgenic animals refers to nonhuman animals that have incorporated a foreign gene intő their genome. Because this gene is present in germline tissues, it is passed from parent to offspring. Exogenous genes are introduced intő single-celled embryos (Brinster et al. 1985, Proc. Natl. Acad. Sci. USA 82:4438). Methods of producing transgenic animals are known in the art, including transgenics that produce immunoglobulin molecules (Wagner at al. 1981, Proc. Natl. Acad. Sci. USA 78:6376; McKnight

ΕΡ 2 361 932 Β1 et al. 1983, Cell 34:335; Brinster et al. 1983, Natúré 306:332; Ritchie et al. 1984, Natúré 312:517; Baldassarre et al. 2003, Theriogenology 59:831; Robi et al. 2003, Theriogenology 59:107; Malassagne et al. 2003, Xenotransplantation 10(3):267).

[0142] The chimeric protein ofthe present disclosure, e.g. the chimeric protein ofthe present invention, can alsó be produced by a combination of synthetic chemistry and recombinant techniques. For example, the portion of an immunoglobulin constant region can be expressed recombinantly as described above. The biologically active molecule, which in the case ofthe present invention is a cytokine, a hormoné, óra clotting factor, can be produced using known chemica synthesis techniques (e.g. solid phase synthesis).

[0143] The portion of an immunoglobulin constant region can be ligated to the biologically active molecule using appropriate ligation chemistry and then combined with a portion of an immunoglobulin constant region that has nőt been ligated to a biologically active molecule to form the chimeric protein ofthe present disclosure, e.g. the chimeric protein ofthe present invention. In one instance of this disclosure, the portion ofan immunoglobulin constant region is an Fc fragment. The Fc fragment can be recombinantly produced to form Cys-Fc and reacted with biologically active molecule expressing a thioesterto make a monomer-dimer hybrid. In another instance, an Fc-thioester is made and reacted with a biologically active molecule expressing an N terminus Cysteine (Figure 4).

[0144] In one instance, the portion of an immunoglobulin constant region ligated to the biologically active molecule will form homodimers. The homodimers can be disrupted by exposing the homodimers to denaturing and reducing conditions (e.g. beta-mercaptoethanol and 8M urea) and then subsequently combined with a portion ofan immunoglobulin constant region nőt linked to a biologically active molecule to form monomer-dimer hybrids. The monomer-dimer hybrids are then renatured and refolded by dialyzing intő PBS and Isolated, e.g., by size exclusion or affinity chromatography. [0145] In another instance, the portion ofan immunoglobulin constant region will form homodimers before being linked to the biologically active molecule. In this instance, reaction conditions for linking the biologically active molecule to the homodimer can be adjusted such that linkage of the biologically active molecule to only one chain of the homodimer is favored (e.g. by adjusting the molar equivalents of each reactant).

[0146] The biologically active molecule can be chemically synthesized with an N terminál cysteine. The sequence encoding a portion of an immunoglobulin constant region can be sub-cloned intő a vector encoding intein linked to a chitin binding domain (New England Biolabs, Beverly, MA). The intein can be linked to the C terminus ofthe portion of an immunoglobulin constant region. In one instance, the portion ofthe immunoglobulin with the intein linked to its C terminus can be expressed in a prokaryotic cell. In another instance, the portion ofthe immunoglobulin with the intein linked to its C terminus can be expressed in a eukaryotic cell. The portion of immunoglobulin constant region linked to intein can be reacted with MESNA. In one instance, the portion of an immunoglobulin constant region linked to intein is bound to a column, e.g., a chitin column and then eluted with MESNA. The biologically active molecule and portion of an immunoglobulin can be reacted together such that nucleophilic rearrangement occurs and the biologically active molecule is covalently linked to the portion of an immunoglobulin via an amidé bond. (Dawsen et al. 2000, Annu. Rév. Biochem. 69:923). The chimeric protein synthesized this way can optionally Include a linker peptide between the portion ofan immunoglobulin and the biologically active molecule. The linker can for example be synthesized on the N terminus ofthe biologically active molecule. Linkers can include peptides and/or organic molecules (e.g. polyethylene glycol and/or short amino acid sequences). This combined recombinant and Chemical synthesis allows for the rapid screening of biologically active molecules and linkers to optimize desired properties ofthe chimeric protein ofthe present disclosure, e.g. ofthe chimeric protein ofthe present invention, e.g., viral inhibition, hemostasis, production of red blood cells, biological half-life, stability, binding to serum proteins or somé other property ofthe chimeric protein. The method alsó allows for the incorporation of non-natural amino acids intő the chimeric protein of the present disclosure, e.g. intő the chimeric protein of the present Invention, which may be useful for optimizing a desired property ofthe chimeric protein ofthe present disclosure, e.g. ofthe chimeric protein ofthe present invention. If desired, the chimeric protein produced by this method can be refolded to a biologically active conformation using conditions known in the art, e.g., reducing conditions ahd then dialyzed slowly intő PBS.

[0147] Alternatively, the N-terminal cysteine can be on the portion ofan Immunoglobulin constant region, e.g., an Fc fragment. An Fc fragment can be generated with an N- terminál cysteine by taking advantage ofthe fact that a native Fc has a cysteine at position 226 (see Kábát et al. 1991, Sequences of Proteins of Immunological Interest, U.S. Department of Public Health, Bethesda, MD).

[0148] Toexpose a terminál cysteine, an Fcfragment can be recombinantly expressed. In one instance, the Fcfragment is expressed in a prokaryotic cell, e.g., E.coli. The sequence encoding the Fc portion beginning with Cys 226 (EU numbering) can be placed immediately following a sequence endcoding a signal peptide, e.g., OmpA, PhoA, STII. The prokaryotic cell can beosmotically shocked to release the recombinant Fcfragment. In another instance, the Fcfragment is produced in a eukaryotic cell, e.g., a CHO cell, a BHK cell. The sequence encoding the Fc portion fragment can be placed directly following a sequence encoding a signal peptide, e.g., mouse IgK light chain or MHC eláss I Kb signal sequence, such that when the recombinant chimeric protein is synthesized by a eukaryotic cell, the signal sequence will be cleaved, leaving an N terminál cysteine which can than be isolated and chemically reacted with a molecules bearing

ΕΡ 2 361 932 Β1 a thioester (e.g. a C terminál thioester if the molecule is comprised of amino acids).

[0149] The N terminál cysteine on an Fcfragment can alsó be generated using an enzyme that cleaves its substrate at its N terminus, e.g., Factor X^a, enterokinase, and the product isolated and reacted with a molecule with a thioester. [0150] The recombinantly expressed Fcfragment can be used to make homodimers or monomer-dimer hybrids. [0151] In a specific instance, an Fc fragment is expressed with the humán α interferon signal peptide adjacent to the Cys at position 226. When a construct encoding this polypeptide Is expressed in CHO cells, the CHO cells cleave the signal peptide at two distinct positions (at Cys 226 and at Val within the signal peptide 2 amino acids upstream in the N terminus direction). This generates a mixture of two species of Fc fragments (one with an N-terminal Val and one with an N-terminal Cys). This in turn results in a mixture of dimeric species (homodimers with terminál Val, homodimers with terminál Cys and heterodimers where one chain has a terminál Cys and the other chain has a terminál Val). The Fc fragments can be reacted with a biologically active molecule having a C terminál thioester and the resulting monomerdimer hybrid can be isolated from the mixture (e.g. by size exclusion chromatography). It is contemplated that when other signal peptide sequences are used for expression of Fc fragments in CHO cells a mixture of species of Fc fragments with at least two different N termini will be generated.

[0152] In another instance, a recombinantly produced Cys-Fc can form a homodimer. The homodimer can be reacted with peptide that has a branehed linker on the C terminus, wherein the branehed linker has two C terminál thioesters that can be reacted with the Cys-Fc. In another instance, the biologically active molecule has a single non-terminal thioester that can be reacted with Cys-Fc. Alternatively, the branehed linker can have two C terminál cysteines that can be reacted with an Fc thioester. In another instance, the branehed linker has two functional groups that can be reacted with the Fc thioester, e.g., 2-mercaptoamine. The biologically active molecule may be comprised of amino acids. The biologically active molecule may include a small organic molecule or a small inorganic molecule.

F. Methods of Using Chimeric Proteins [0153] The chimeric proteins ofthe present disclosure have many uses as will be recognized by one skilled in the art, including, bút nőt limited to methods of treating a subject with a disease or condition. The disease or condition can include, bút is nőt limited to, a viral infection, a hemostatic disorder, anémia, cancer, leukémia, an inflammatory condition or an autoimmune disease (e.g. arthritis, psoriasis, lupus erythematosus, multiple sclerosis), or a bacterial infection (see, e.g., U.S. Patent Nos. 6,086,875, 6,030,613, 6,485,726; WO 03/077834; US2003-0235536A1).

1. Methods of Treating a Subject with a Red Blood Cell Deficiency [0154] The present disclosure relates to a method of treating a subject having a deficiency of red blood cells, e.g., anémia, comprising administering a therapeutically effective amount ofat leastone chimeric protein, wherein the chimeric protein comprises a first and a second polypeptide chain, wherein the first chain comprises at least a portion of an immunoglobulin constant region and at least one agent capable of inducing proliferation of red blood cells, e.g., EPO, and the second polypeptide chain comprises at least a portion ofan immunoglobulin without the agent capable of inducing red blood cell proliferation ofthe first chain.

2. Methods of Treating a Subject with a Viral Infection [0155] The present disclosure relates to a method of treating a subject having a viral infection or exposed to a vírus comprising administering a therapeutically effective amount ofat leastone chimeric protein, wherein the chimeric protein comprises a first and a second polypeptide chain, wherein the first chain comprises at least a portion ofan immunoglobulin constant region and at least one antiviral agent, e.g., a fusion inhibitor or interferon α and the second polypeptide chain comprises at least a portion ofan immunoglobulin without the antiviral agent ofthe first chain. In one instance, the subject is infected with a vírus which can be treated with IFNa, e.g., hepatitis C vírus. In one instance, the subject is infected with HÍV, such as HIV-1 or HIV-2.

[0156] In one instance, the chimeric protein of the present disclosure inhibits viral replication. In one instance, the chimeric protein ofthe present disclosure prevents or inhibits viral entry Intő target cells, thereby stopping, preventing, or limiting the spread of a viral infection in a subject and decreasing the viral burden in an infected subject. By linking a portion ofan immunoglobulin to a viral fusion inhibitor the present disclosure provides a chimeric protein with viral fusion inhibitory activity with greater stability and greater bioavailability compared to viral fusion Inhibitors alone, e.g., T20, T21, T1249. Thus, in one instance, the viral fusion inhibitor decreases or prevents HÍV infection of a target cell, e.g., HIV-1.

a. Conditions That May Be Treated [0157] The chimeric protein ofthe present disclosure can be used to inhibit or prevent the infection of a target cell by

ΕΡ 2 361 932 Β1 a hepatitis vírus, e.g., hepatitis vírus C. The chimeric protein may comprise an anti-viral agent which inhibits viral replication.

[0158] In one instance, the chimeric protein ofthe present disclosure comprises a fusion inhibitor. The chimeric protein of the present disclosure can be used to inhibit or prevent the infection of any target cell by any vírus (see, e.g., U.S. Patent Nos. 6,086,875, 6,030,613, 6,485,726; WO 03/077834; US2003-0235536A1). In one instance, the vírus is an enveloped vírus such as, bút nőt limited to HÍV, SIV, measles, influenza, Epstein-Barr vírus, respiratory syncytia vírus, or parainfluenza vírus. In another instance, the vírus is a non-enveloped vírus such as rhino vírus or polio vírus.

[0159] The chimeric protein ofthe present disclosure can be used to treat a subject already Infected with a vírus. The subject can be acutely infected with a vírus. Alternatively, the subject can be chronically infected with a vírus. The chimeric protein ofthe present disclosure can alsó be used to prophylactically treat a subject at risk fór contracting a viral infection, e.g., a subject known or believed to in close contact with a vírus or subject believed to be infected or carrying a vírus. The chimeric protein of the present disclosure can be used to treat a subject who may have been exposed to a vírus, bút who has nőt yet been positively diagnosed.

[0160] In one instance, the present disclosure relates to a method of treating a subject infected with HCV comprising administering to the subject a therapeutically effective amount ofa chimeric protein, wherein the chimeric protein comprises an Fc fragment of an IgG and a cytokine, e.g., IFNa.

[0161] In one instance, the present disclosure relates to a method of treating a subject infected with HÍV comprising administering tothe subject a therapeutically effective amountofa chimeric protein wherein the chimeric protein comprises an Fc fragment of an IgG and the viral fusion inhibitor comprises T20.

3. Methods of Treating a Subject Having a Hemostatic Disorder [0162] The present disclosure relates to a method of treating a subject having a hemostatic disorder comprising administering a therapeutically effective amount ofat least one chimeric protein, wherein the chimeric protein comprises a first and a second chain, wherein the first chain comprises at least one clotting factor and at least a portion of an immunoglobulin constant region, and the second chain comprises at least a portion ofan immunoglobulin constant reg ion. [0163] The chimeric protein of the present disclosure treats or prevents a hemostatic disorder by promoting the formation ofa fibrin clot. The chimeric protein ofthe present disclosure can activate any member ofa coagulation Cascade. The clotting factor can be a partiéi pánt In the extrinsic pathway, the intrinsic pathway or both. In one instance, the clotting factor is Factor VII or Factor Vlla. Factor Vlla can activate Factor X which interacts with Factor Va to cleave prothrombin to thrombin, which in turn cleaves fibrinogen to fibrin. In another instance, the clotting factor is Factor IX or Factor IXa. In yet another instance, the clotting factor is Factor Vili or Factor Villa. In yet another instance, the clotting factor Is von Willebrand Factor, Factor XI, Factor XII, Factor V, Factor Xor Factor XIII.

a. Conditions That May Be Treated [0164] The chimeric protein ofthe present disclosure can be used to treat any hemostatic disorder. The hemostatic disorders that may be treated by administration of the chimeric protein of the present disclosure include, bút are nőt limited to, hemophilia A, hemophilia B, von Willebrand’s disease, Factor XI deficiency (PTA deficiency), Factor XII deficiency, as well as deficiencies or structural abnormalities in fibrinogen, prothrombin, FactorV, FactorVII, FactorX, or Factor XIII.

[0165] In one instance, the hemostatic disorder is an Inherited disorder. In one instance, the subject has hemophilia A, and the chimeric protein comprises Factor Vili or Factor Villa. In another instance, the subject has hemophilia A and the chimeric protein comprises FactorVII or Factor Vlla. In another instance, the subject has hemophilia B and the chimeric protein comprises Factor IX or Factor IXa. In another instance, the subject has hemophilia B and the chimeric protein comprises FactorVII or Factor Vlla. In another instance, the subject has Inhibitory antibodies to Factor Vili or Factor Villa and the chimeric protein comprises FactorVII or Factor Vlla. In yet another instance, the subject has inhibitory antibodies against Factor IX or Factor IXa and the chimeric protein comprises FactorVII or Factor Vlla.

[0166] The chimeric protein ofthe present disclosure can be used to prophylactically treat a subject with a hemostatic disorder. The chimeric protein ofthe present disclosure can be used to treat an acute bleeding episode in a subject with a hemostatic disorder [0167] In one instance, the hemostatic disorder is the result of a deficiency in a clotting factor, e.g., Factor IX, Factor Vili. In another instance, the hemostatic disorder can be the result of a defective clotting factor, e.g., von Willebrand’s Factor.

[0168] In another instance the hemostatic disorder can be an acquired disorder. The acquired disorder can result from an underlying secondary disease or condition. The unrelated condition can be, as an example, bút nőt as a limitation, cancer, an autoimmune disease, or pregnancy. The acquired disorder can result from old age or from medication to treat an underlying secondary disorder (e.g. cancer chemotherapy).

EP 2 361 932 Β1

4. Methods of Treating a Subject In Need of a General Hemostatic Agent [0169] The present disclosure alsó relates to methods of treating a subject that does nőt have a hemostatic disorder or a seeondary disease or condition resulting in acquisition of a hemostatic disorder. The present disclosure thus relates to a method of treating a subject in need of a generál hemostatic agent comprising administering a therapeutically effective amount ofat leastone chimeric protein, wherein the chimeric protein comprises afirst and a second polypeptide chain wherein the first polypeptide chain comprises at least a portion of an immunoglobulin constant region and at least one clotting factor and the second chain comprises at least a portion of an immunoglobulin constant region without the clotting factor of the first polypeptide chain.

a. Conditions That May Be Treated [0170] In one instance, the subject in need of a generál hemostatic agent Is undergoing, or Is about to undergo, surgery. The chimeric protein of the present disclosure can be administered prior to or after surgery as a prophylactic. The chimeric protein of the present disclosure can be administered during or after surgery to control an acute bleeding episode. The surgery can include, bút Is nőt limited to, liver transplantation, liver resection, or stem cell transplantation. [0171] The chimeric protein ofthe present disclosure can be used to treat a subject having an acute bleeding episode who does nőt have a hemostatic disorder. The acute bleeding episode can result from severe trauma, e.g., surgery, an automobilé accident, wound, laceration gun shot, or any other traumatic event resulting in uncontrolled bleeding.

5. Treatment Modalities [0172] The chimeric protein of the present disclosure, e.g. a chimeric protein of the present invention, can be administered Intravenously, subcutaneously, intra-muscularly, or via any mucosal surface, e.g., orally, sublingually, buccally, sublingually, nasally, rectally, vaginally or via pulmonary route. The chimeric protein can be Implanted within or linked to a biopolymer solid support that allows for the slow release of the chimeric protein to the desired site.

[0173] The dose ofthe chimeric protein ofthe present disclosure, e.g. ofthe chimeric protein ofthe present invention, will vary depending on the subject and upon the particular route of administration used. Dosages can rangé from 0.1 to 100,000 μg/kg body weight. In one instance, the dosing rangé is 0.1-1,000 μg/kg. The protein can be administered continuously or at specific timed intervals. In vitro assays may be employed to determine optimál dose ranges and/or schedules for administration. Many in vitro assays that measure viral infectivity are known in the art. For example, a reverse transcriptase assay, or an rt PCR assay or branched DNA assay can be used to measure HÍV concentrations. A StaCIot assay can be used to measure clotting activity. Additionally, effective doses maybe extrapolated from doseresponse curves obtained from animal models.

[0174] The present disclosure alsó relates to a pharmaceutical composition comprising a viral fusion inhibitor, at least a portion of an immunoglobulin and a pharmaceutically acceptable carrier or excipient. Examples of suitable pharmaceutical carriers are described In Remington’s Pharmaceutical Sciences by E.W. Martin. Examples of excipients can include starch, glucose, lactose, sucrose, gelatin, mait, rice, flour, chalk, silica gél, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glyeol, water, ethanol, and the like. The composition can alsó contain pH buffering reagents, and wetting or emulsifying agents.

[0175] For órai administration, the pharmaceutical composition can take the form of tablets or capsules prepared by conventional means. The composition can alsó be prepared as a liquid for example a syrup or a suspension. The liquid can include suspending agents (e.g. sorbitol syrup, celiuíose derivatives or hydrogenated edible fats), emulsifying agents (lecithin or acacia), non-aqueous vehicles (e.g. almond oil, oily esters, ethyi alcohol, orfractionated vegetable oils), and preservatives (e.g. methyl or propyl -p-hydroxybenzoates or sorbic acid). The preparations can alsó include flavoring, coloring and sweetening agents. Alternatively, the composition can be presented as a dry produet for constitution with water or another suitable vehicle.

[0176] For buccal and sublingual administration the composition may take the form of tablets, lozenges or fást dissolving films according to conventional protocols.

[0177] For administration by inhalation, the compounds for use according to the present disclosure are conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer (e.g. in PBS), with a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoromethane, carbon dioxide or other suitable gas. In the case ofa pressurized aerosol the dosage unit can be determined by providing a vaive to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0178] The pharmaceutical composition can be formulated for parenteral administration (i.e. intravenous or intramuscular) by bolus injection. Formulations for injection can be presented in unit dosage form, e.g., In ampoules or In multidose containers with an added preservative. The composítions can take such forms as suspensions, Solutions, or emulsions

ΕΡ 2 361 932 Β1 in oily or aqueous vehicles, and contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Aiternatively, the active ingredient can be in powderform fór constitution with a suitable vehicle, e.g., pyrogen free water. [0179] The pharmaceutical composition can alsó be formulated fór rectal administration as a suppository or retention enema, e.g., containing conventional suppository bases such as cocoa butteror other glycerides.

6. Combination Therapy [0180] The chimeric protein ofthe present disclosure, e.g. the chimeric protein ofthe present invention, can be used to treat a subject with a disease or condition In combination with at least one other known agent to treat said disease or condition.

[0181] In one instance, the present disclosure relates to a method of treating a subject Infected with HÍV comprising administering a therapeutically effective amount of at least one chimeric protein comprising a first and a second chain, wherein the first chain comprises an HÍV fusion inhibitor and at least a portion of an Immunoglobulin constant region and the second chain comprises at least a portion ofan immunoglobulin without an HÍV fusion inhibitor ofthe first chain, in combination with at least one other anti-H IV agent. Said other anti-H IV agent can be any therapeutic with demonstrated anti-HIV activity. Said other anti-HIV agent can include, as an example, bút nőt as a limitation, a protease inhibitor (e.g. Amprenavir®, Crixivan®, Ritonivir®), a reverse transeriptase nucleoside analóg (e.g. AZT, DDI, D4T, 3TC, Ziagen®), a nonnucleoside analóg reverse transeriptase inhibitor (e.g. Sustiva®), another HÍV fusion inhibitor, a neutralizing antibody specific to HÍV, an antibody specific to CD4, a CD4 mimic, e.g., CD4-lgG2 fusion protein (U.S. Patent Application 09/912,824) or an antibody specific to CCR5, or CXCR4, or a specific binding partner of CCR5, or CXCR4.

[0182] In another instance, the present disclosure relates to a method of treating a subject with a hemostatic disorder comprising administering a therapeutically effective amount of at least one chimeric protein comprising a first and a second chain, wherein the first chain comprises at least one clotting factor and at least a portion of an immunoglobulin constant region and the second chain comprises at least a portion of an immunoglobulin constant region without the clotting factor ofthe first chain, in combination with at least one other clotting factor or agent that promotes hemostasis. Said other clotting factor or agent that promotes hemostasis can be any therapeutic with demonstrated clotting activity. As an example, bút nőt as a limitation, the clotting factor or hemostatic agent can include Factor V, Factor VII, Factor Vili, Factor IX, Factor X, Factor XI, Factor XII, Factor XIII, prothrombin, or fibrinogen or activated forms of any ofthe preceding. The clotting factor of hemostatic agent can alsó include anti-fibrinolytic drugs, e.g., epsilon-amino-caproic acid, tranexamic acid.

7. Methods of Inhibiting Viral Fusion With a Target Cell [0183] The present disclosure alsó relates toan in vitro method of inhibiting HlVfusion with a mammalian cell comprising combining the mammalian cell with at least one chimeric protein, wherein the chimeric protein comprises a first and a second chain, wherein the first chain comprises at least a portion of an immunoglobulin constant region and an HÍV inhibitor and the second chain comprises at least a portion ofan immunoglobulin constant region without the HÍV inhibitor of the first chain. The mammalian cell can include any cell or cell line susceptible to infection by HÍV including bút nőt limited to primary humán CD4⁺ T cells or macrophages, MOLT-4 cells, CEM cells, AA5 cells or HeLa cells which express CD4 on the cell surface.

G. Methods of Isolating Chimeric Proteins [0184] Typically, when chimeric proteins ofthe present disclosure, including chimeric proteins ofthe present invention, are produced, they are contained in a mixture ofother molecules such as other proteins or protein fragments. The present disclosure thus provides fór methods of isolating any ofthe chimeric proteins described supra from a mixture containing the chimeric proteins. It has been determined that the chimeric proteins ofthe present disclosure, including the chimeric proteins ofthe present invention, bind to dye ligands under suitable conditions and that altering those conditions subsequent to binding can disrupt the bond between the dye ligand and the chimeric protein, thereby providing a method of isolating the chimeric protein. In somé instances, the mixture may comprise a monomer-dimer hybrid, a dimer and at least a portion ofan immunoglobulin constant region, e.g., an Fc. Thus, in one instance, the present disclosure provides a method of isolating a monomer-dimer hybrid. In another instance, the present disclosure provides a method of isolating a dimer.

[0185] Accordingly, in one instance, the present disclosure provides a method of Isolating a monomer-dimer hybrid from a mixture, where the mixture comprises

a) the monomer-dimer hybrid comprising a first and second polypeptide chain, wherein the first chain comprises a biologically active molecule, and at least a portion of an immunoglobulin constant region and wherein the second

ΕΡ 2 361 932 Β1 chain comprises at least a portion of an immunoglobulin constant region without a biologically active molecule or immunoglobulin variable region;

b) a dimer comprising a first and second polypeptide chain, wherein the first and second chains both comprise a biologically active molecule, and at least a portion of an immunoglobulin constant region; and

c) a portion ofan immunoglobulin constant region; said method comprising

1) contacting the mixture with a dye ligand linked to a solid support under suitable conditions such that both the monomer-dimer hybrid and the dimer bind to the dye ligand;

2) removing the unbound portion ofan immunoglobulin constant region;

3) altering the suitable conditions of 1) such that the binding between the monomer-dimer hybrid and the dye ligand linked to the solid support is disrupted;

4) isolating the monomer-dimer hybrid.

In somé instances, priorto contacting the mixture with a dye ligand, the mixture may be contacted with a chromatographic substance such as protein A sepharose or the like. The mixture is eluted from the chromatographic substance using an appropriate elution buffer (e.g. a low pH buffer) and the eluate containing the mixture is then contacted with the dye ligand. [0186] Suitable conditions for contacting the mixture with the dye ligand may include a buffer to maintain the mixture at an appropriate pH. An appropriate pH may include a pH of from, 3-10, 4-9, 5-8. In one instance, the appropriate pH is 8.0. Any buffering agent known in the art may be used so long as it maintains the pH In the appropriate rangé, e.g., tris, HEPES, PIPES, MOPS. Suitable conditions may alsó include a wash buffer to elute unbound species from the dye ligand. Th e wash buffer may be any buffer which does nőt disrupt binding of a bound species. For example, the wash buffer can be the same buffer used in the contacting step.

[0187] Once the chimeric protein is bound to the dye ligand, the chimeric protein is isolated by altering the suitable conditions. Altering the suitable conditions may include the addition of a salt to the buffer. Any salt may be used, e.g., NaCI, KCI. The salt should be added at a concentration that is high enough to disrupt the binding between the dye ligand and the desired species, e.g., a monomer-dimer hybrid.

[0188] In somé Instances where the mixture is comprised ofan Fc, a monomer-dimer hybrid, and a dimer, it has been found that the Fc does nőt bind to the dye ligand and thus elutes with the flow through. The dimer binds more tightly to the dye ligand than the monomer-dimer hybrid. Thus a higher concentration of salt is required to disrupt the bond (e.g. elute) between the dimer and the dye ligand compared to the salt concentration required to disrupt the bond between the dye ligand and the monomer-dimer hybrid.

[0189] In somé instances NaCI may be used to isolate the monomer-dimer hybrid from the mixture. In somé instances the appropriate concentration of salt which disrupts the bond between the dye ligand and the monomer-dimer hybrid is from 200-700 mM, 300-600 mM, 400-500 mM. In one instance, the concentration of NaCI required to disrupt the binding between the dye ligand the monomer-dimer hybrid is 400 mM.

[0190] NaCI may alsó be used to isolate the dimer from the mixture. Typically, the monomer-dimer hybrid Is isolated from the mixture before the dimer. The dimer is isolated by adding an appropriate concentration of salt to the buffer, thereby disrupting the binding between the dye ligand and the dimer. In somé instances the appropriate concentration of salt which disrupts the bond between the dye ligand and the dimer is from 800 mM to 2 M, 900 mM to 1.5 M, 950 mM to 1.2 M. In one specific Instance, 1 M NaCI is used to disrupt the binding between the dye ligand and the dimer. [0191] The dye ligand may be a bio-mimetic. Abio-mimetic is a human-made substance, device, or system that imitates natúré. Thus in somé instances the dye ligand imitates a molecule’s naturally occurring ligand. The dye ligand maybe chosen from MimeticRed 1™, Mimetic Red 2™, Mimetic Orange 1™, Mimetic Orange 2™, Mimetic Orange 3™, Mimetic Yellow 1™, Mimetic Yellow 2™, Mimetic Green 1™, Mimetic Blue 1™, and Mimetic Blue 2™ (Prometic Biosciences (USA) Inc., Wayne, NJ). In one specific instance, the dye ligand is Mimetic Red 2™ (Prometic Biosciences (USA) Inc., Wayne, NJ). In certain instances the dye ligand is linked to a solid support, e.g., from Mimetic Red 1A6XL™, Mimetic Red 2 A6XL™, Mimetic Orange 1 A6XL™, Mimetic Orange 2 A6XL™, Mimetic Orange 3 A6XL™, Mimetic Yellow 1 A6XL™, Mimetic Yellow 2 A6XL™, Mimetic Green 1 A6XL™, Mimetic Blue 1 A6XL™, and Mimetic Blue 2 A6XL™ (Prometic Biosciences (USA) Inc., Wayne, NJ).

[0192] The dye ligand may be linked to a solid support. The solid support may be any solid support known in the art (see, e.g., www.seperationsNOW.com). Examples of solid supports may include a bead, a gél, a membráné, a nanoparticle, óra microsphere. The solid support may comprise any matéria! which can be linked to a dye ligand (e.g. agarose, polystyrene, sepharose, sephadex). Solid supports may comprise any synthetic organic polymer such as polyacrylic, vinyl polymers, acrylate, polyméthacrylate, and polyacrylamide. Solid supports may alsó comprise a carbohydrate polymer, e.g., agarose, cellulose, ordextran. Solid supports may comprise inorganic oxides, such as silica, zirconia, titania, ceria, alumina, magnesia (i.e., magnesium oxide), or calcium oxide. Solid supports may alsó comprise combinations of somé ofthe above-mentioned supports including, bút nőt limited to, dextran-acrylamide.

ΕΡ 2 361 932 Β1

Examples

Example 1: Molecular Weight Affects FcRn Mediated Trancytosis [0193] Chimeric proteins comprised of various proteins of interest and IgG Fc were recombinantly produced (Sambrook et al. Molecular Cloning: A Laboratory Manual, 2 ed., Cold Spring Harbor Laboratory Press, (1989)) or in the case of contactin-Fc, ΜΑΒ-β-gal, (a complex ofa monoclonal antibody bound to β-gal) (Biodesign International, Saco, ME) and MAB-GH (a complex of monoclonal antibody and growth hormone)(Research Diagnostics, Inc. Flanders, NJ) were purchased commercially. Briefly, the genes encoding the protein of interest were cloned by PCR, and then sub-cloned intő an Fc fusion expression plasmid. The plasmids were transfected intő DG44 CHO cells and stable transfectants were selected and amplified with methotrexate. The chimeric protein homodimers were purified over a protein A column. The proteins tested included interferon a, growth hormoné, erythropoietin, follicle stimulating hormoné, Factor IX, betagalactosidase, contactin, and Factor Vili. Linking the proteins to immunoglobulin portions, including the FcRn receptor binding partner, or using commercially available whole antibody (including the FcRn binding region)-antigen complexes permitted the investigation oftranscytosis as a function of molecular weight (see U.S. Patent No. 6,030,613). The chimeric proteins were administered to rats orally and serum levels were measured 2-4 hours post administration using an ELISA for recombinantly produced chimeric proteins and both a western biot and ELISA for commercially obtained antibody complexes and chimeric proteins. Additionally, all ofthe commercially obtained proteins or complexes as well as Factor Vlll-Fc, Factor IX-Fc and Epo-Fc Controls were iodinated using IODO beads (Pierce, Pittsburgh, PA). The results indicated serum levels of Fc and monoclonal antibody chimeric proteins orally administered to rats are directly related to the size ofthe protein. The apparent cutoff point for orally administered Fc chimeric proteins is between 200-285 kD. (Table 2).

TABLE 2

<td> Protein</td><td> Size(kD)</td><td> Transcytosis</td>

<td> IFNa-Fc</td><td> 92</td><td> ++++</td>

<td> GH-Fc</td><td> 96</td><td> +++</td>

<td> Epo-Fc</td><td> 120</td><td> +++</td>

<td> FSH-Fc</td><td> 170</td><td> +++</td>

<td> MAB:GH</td><td> 172-194</td><td> +++</td>

<td> FIX-Fc</td><td> 200</td><td> +</td>

<td> MAB^Gal</td><td> 285-420</td><td> -</td>

<td> Contactin-Fc</td><td> 300</td><td> -</td>

<td> FVIIIA-Fc</td><td> 380</td><td> -</td>

Example 2: Cloning of pcDNA 3.1 -Flag-Fc [0194] The sequence forthe FLAG peptide (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys), a common affinity tag used to identify or purify proteins, was cloned intő the pcDNA 3.1-Fc plasmid, which contains the mouse IgK signal sequence followed by the Fc fragment of humán lgG1 (amino acids 221-447, EU numbering). The construct was created by overlapping PCR using the following primers:

FlagFc-F1: 5’- GCTGGCTAGCCACCATGGA -3’(SEQ ID NO:41)

FlagFc-R1: 5’- CTTGTCATCGTCGTCCTTGTAGTCGTCA CCAGTGGAACCTGGAAC -3’ (SEQ ID NO:42) FlagFc-F2: 5’- GACTACAAGG ACGACGATGA CAAGGACAAA ACTCACACAT GCCCACCGTG CCCAGCTCCG GAACTCC -3’ (SEQ ID NO:43)

FlagFc-R2: 5’- TAGTGGATCCTCATTTACCCG -3’ (SEQ ID NO:44) [0195] The pcDNA 3.1-Fc template was then added to two separate PCR reactions containing 50 pmol each ofthe primer pairs FlagFc-F1/R1 or FlagFc-F2/R2 in a 50 μΙ reaetion using Pfu Ultra DNA polymerase (Stratagene, CA) according to manufacturer’s standard protocol in a MJ Thermocycler using the following cycles: 95°C 2 minutes; 30 cycles of (95°C 30 seconds, 52°C 30 seconds, 72°C 45 seconds), followed by 72°C for 10 minutes. The products of these two reactions were then mixed in another PCR reaetion (2 μΙ each) with 50 pmol of FlagFc-F1 and FlagFc-R2 primers in a 50 μΙ reaetion using Pfu Ultra DNA polymerase (Stratagene, CA) according to manufacturer’s standard

ΕΡ 2 361 932 Β1 protocol in a MJ Thermocyder using the following cycles: 95°C 2 minutes; 30 cycles of (95°C 30 seconds, 52°C 30 seconds, 72°C 45 seconds), followed by 72°C fór 10 minutes. The resulting fragment was gél purified, digested and Ínserted intő the pcDNA 3.1-Fc plasmid Nhel-Bam Hl. The resulting plasmid contains contains the mouse lgi&lt; signal sequence producing the FlagFc protein.

Example 3: Cloning of-Factor Vll-Fc construct [0196] The coding sequence fór Factor VII, was obtained by RT-PCR from humán fetal liver RNA (Clontech, Palo Alto, CA). The cloned region is comprised of the cDNA sequence from bp 36 to bp 1430 terminating just before the stop codon. A Sbfl site was introduced on the N-terminus. A BspEI site was introduced on the C-terminus. The construct was cloned by PCR using the primers:

Downstream: 5’ GCTACCTGCAGGCCACCATGGTCTCCCAGGCCCTCAGG 3’(SEQ ID NO:45)

Upstream: 5’ CAGTTCCGGAGCTGGGCACGGCGGGCACGTGTGAGTTT TGTCGGGAAAT GG 3’ (SEQ ID NO:46) and the following conditions: 95°C fór 5 minutes followed by 30 cycles of 95°C fór 30 seconds, 55°C fór 30 seconds, 72°C fór 1 minute and 45 seconds, and a final extension cycle of 72°C fór 10 minutes.

[0197] The fragment was digested Sbfl - BspE I and Ínserted intő pED.dC-Fc a plasmid encoding fór the Fc fragment of an IgG 1.

Example 4: Cloning of Factor IX-Fc construct [0198] The humán Factor IX coding sequence, including the prepropeptide sequence, was obtained by RT-PCR amplification from aduit humán liver RNA using the following primers:

natFIX-F: 5’-TTACTGCAGAAGGTTATGCAGCGCGTGAACATG- 3’(SEQ ID NO:47)

F9-R: 5’-TTTTTCGAATTCAGTGAGCTTTGTTTTTTCCTTAATCC-3’(SEQ ID NO:48) [0199] 20 ng of aduit humán liver RNA (Clontech, Palo Alto, CA) and 25 pmol each primer were added to a RT-PCR reaetion using the SuperScript.™ One-Step RT-PCR with PLATINUM® Taq system (Invitrogen, Carlsbad, CA) according to manufacturers protocol. Reaetion was carried out in a MJ Thermocyder using the following cycles: 50°C 30 minutes; 94°C 2 minutes; 35 cycles of (94°C 30 seconds, 58°C 30 seconds, 72°C 1 minute), and a final 72°C 10 minutes. The fragment was gél purified using Qiagen Gél Extraction Kit (Qiagen, Valencia, CA), and digested with Pstl-EcoRI, gél purified, and cloned intő the corresponding digest of the pED.dC.XFc plasmid.

Example 5: Cloning of PACE construct [0200] The coding sequence fór humán PACE (paired basic amino acid cleaving enzyme), an endoprotease, was obtained by RT-PCR. The following primers were used:

PACE-F1: 5’- GGTAAGCTTGCCATGGAGCTGAGGCCCTGGTTGC -3’(SEQ ID NO:49)

PACE-R1: 5’- GTTTTCAATCTCTAGGACCCACTCGCC -3’(SEQ ID NO:50)

PACE-F2: 5’- GCCAGGCCACATGACTACTCCGC -3’(SEQ ID NO:51)

PACE-R2: 5’- GGTGAATTCTCACTCAGGCAGGTGTGAGGGCAGC -3’(SEQ ID NO:52) [0201] The PACE-F1 primer adds a Hindlll site to the 5’ end ofthe PACE sequence beginning with 3 nucleotides before the start codon, while the PACE-R2 primer adds a stop codon after amino acid 715, which occurs at the end of the extracellular domain of PACE, as well as adding an EcoRI site to the 3’ end of the stop codon. The PACE-R1 and -F2 primers anneal on the 3’ and 5’ sides of an internál BamHI site, respectively. Two RT-PCR reactions were then set up using 25 pmol each ofthe primer pairs of PACE-F1/R1 or PÁC E-F2/R2 with 20 ng of aduit humán liver RNA (Clontech; Palo Alto, CA) in a 50 μΙ RT-PCR reaetion using the Superscript.™ One-Step RT-PCR with PLATINUM® Taq system (Invitrogen, Carlsbad, CA) according to manufacturers protocol. The reaetion was carried out in a MJ Thermocyder using the following cycles: 50°C 30 minutes; 94°C 2 minutes; 30 cycles of (94°C 30 seconds, 58°C 30 seconds, 72°C 2 minutes), followed by 72°C 10 minutes. These fragments were each ligated intő the vector pGEM Τ-Easy (Promega, Madison, Wl) and sequenced fully. The F2-R2 fragment was then subcloned intő pcDNA6 V5/His (Invitrogen, Carlsbad, CA) using the BamHI/EcoRI sites, and then the F1-R1 fragment was cloned intő this construct using the Hind11l/BamH I sites. The final plasmid, pcDNA6-PACE, produces a soluble form of PACE (amino acids 1-715), as the transmembrane

ΕΡ 2 361 932 Β1 region has been deleted. The sequence of PACE in pcDNA6-PACE is essentially as described in Harrison et al. 1998, Seminars in Hematology 35:4.

Example 6: Cloning of IFNa-Fc eight amino acid linker construct [0202] The humán interferon a 2b (hIFNa) coding sequence, including the signal sequence, was obtained by PCR from humán genomic DNA using the following primers:

IFNa-Sig-F: 5’-GCTACTGCAGCCACCATGGCCTTGACCTTTGCTTTAC-3’(SEQ ID NO:53)

IFNa-EcoR-R: 5’-CGTTGAATTCTTCCTTACTTCTTAAACTTTCTTGC-3’(SEQ ID NO:54) [0203] Genomic DNA was prepared from 373MG humán astrocytoma cell line, according to standard methods (Sambrook et al. 1989, Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press). Briefly, approximately 2 x 10⁵ cells were pelleted by centrifugation, resuspended in 100 μΙ phosphate buffered saline pH 7.4, then mixed with an equal volume of lysis buffer (100 mM Tris pH 8.0/ 200 mM NaCI/2% SDS / 5 mM EDTA). Proteinase K was added to a final concentration of 100 μg/ml, and the sample was digested at 37°C for 4 hours with occasional gentle mixing. The sample was then extracted twice with phenoLchloroform, the DNA precipitated by adding sodium aeetate pH 7.0 to 100 mM and an equal volume of isopropanol, and pelleted by centrifugation for 10 min at room temperature. The supernatant was removed and the pellet was washed once with cold 70% ethanol and allowed to air dry before resuspending in TE (10 mM Tris pH 8.0 /1 mM EDTA).

[0204] 100 ng of this genomic DNA was then used in a 25 μΙ PCR reaetion with 25 pmol of each primer using Expand

High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer’s standard protocol in a MJ Thermocycler using the following cycles: 94°C 2 minutes; 30 cycles of (94°C 30 seconds, 50°C 30 seconds, 72°C 45 seconds), and finally 72°C 10 minutes. The expected sízed bánd (-550 bp) was gél purified with a Gél Extraction kit (Qiagen, Valencia, CA), digested with Pstl/EcoRI, gél purified again, and cloned intő the Pstl/EcoRI site of pED.dC.XFc, which contains an 8 amino acid linker (EFAGAAAV) followed by the Fc region of humán IgG 1.

Example_7: Cloning of IFNaFc Alinker construct [0205] 1 μg of purified pED.dC.native humán IFNaFc DNA, from Example 6, was then used as a template in a 25 μΙ

PCR reaetion with 25 pmol of each primer IFNa-Sig-F and the following primer:

hIFNaNoLinkFc-R: 5’CAGTTCCGGAGCTGGGCACGGCGGG

CACGTGTGAGTTTTGTCTTCCTTACTTCTTAAACTTTTTGCAAGTTTG- 3’(SEQ ID NO:55) [0206] The PCR reaetion was carried out using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer’s standard protocol in a RapidCycier thermocycler (Idaho Technology, Salt Laké City, UT), denaturing at 94°C for 2 minutes followed by 18 cycles of 95°C for 15 seconds, 55°C for 0 seconds, and 72°C for 1 minute with a slope of 6, followed by 72°C extension for 10 minutes. A PCR product ofthe correct size (-525 bp) was gél purified using a Gél Extraction kit (Qiagen; Valencia, CA), digested with the Pstl and BspEI restriction enzymes, gél purified, and subcloned intő the corresponding sites of a modified pED.dC.XFc, where amino acids 231-233 of the Fc region were altered using the degeneracy ofthe genetic code to incorporate a BspEI site while maintaining the wild type amino acid sequence.

Example 8: Cloning of IFNaFc GS15 linker construct [0207] A new backbone vector was ereated using the Fc found in the Alinker construct (containing BspEI and Rsrll sites in the 5’ end using the degeneracy of the genetic code to maintain the amino acid sequence), using this DNA as a template for a PCR reaetion with the following primers:

5’ B2xGGGGS: 5’ gtcaggatccggcggtggagggagcgacaaaactcacacgtgccc 3’(SEQ ID NO:56)

3’ GGGGS: 5’ tgacgcggccgctcatttacccggagacaggg 3’(SEQ ID NO:57) [0208] A PCR reaetion was carried out with 25 pmol of each primer using Pfu Turbo enzyme (Stratagene, La Jolla, CA) according to manufacturer’s standard protocol in a MJ Thermocycler using the following method: 95°C 2 minutes; 30 cycles of (95°C 30 seconds, 54°C 30 seconds, 72°C 2 minutes), 72°C 10 minutes. The expected sízed bánd (-730 bp) was gél purified with a Gél Extraction kit (Qiagen, Valencia CA), digested BamHI/Notl; gél purified again, and cloned intő the BamHI/Notl digested vector of pcDNA6 ID, a version of pcDNA6 with the IRES sequence and dhfr gene inserted

ΕΡ 2 361 932 Β1 intő Notl/Xbal site.

[0209] 500 ng of purified pED.dC.native humán IFNaFc DNA was then used as a template in a 25 μΙ PCR reaction with the following primers:

5’ IFNa for GGGGS: 5’ ccgctagcctgcaggccaccatggccttgacc 3’(SEQ ID NO:58)

3’ IFNa for GGGGS: 5’ ccggatccgccgccaccttccttactacgtaaac 3’(SEQ ID NO:59) [0210] A PCR reaction was carried out with 25 pmol of each primer using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer’s standard protocol in a MJ Thermocycler using the following cycles:

95°C 2 minutes; 14 cycles of (94°C 30 seconds, 48°C 30 seconds, 72°C 1 minute), 72°C 10 minutes. The expected sízed bánd (-600 bp) was gei purified with a Gei Extraction kit (Qiagen, Valencia CA), digested Nhel/BamHI, gei purified again, and cloned intő the Nhel/BamHI site ofthe pcDNA6 ID/Fc vector, above, to create an IFNa Fcfusion with a 10 amino acid Gly/Ser linker (2xGGGGS), pcDNA6 ID/IFNa-GS10-Fc.

[0211] A PCR reaction was then performed using 500 ng ofthis pcDNA6 ID/IFNa-GS10-Fc with the following primers

5’B3XGGGGS:5’(SEQ ID NO:60) gtcaggatccggtggaggcgggtccggcggtggagggagcgacaaaactcacacgtgccc 3’(SEQ ID NO:61) fcciv-R: 5’ atagaagcctttgaccaggc 3’(SEQ ID NO:62) [0212] A PCR reaction was carried out with 25 pmol of each primer using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer’s standard protocol in a MJ Thermocycler using the following cycles: 95°C 2 minutes; 14 cycles of (94°C 30 seconds, 48°C 30 seconds, 72°C 1 minute), 72°C 10 minutes. The expected sízed bánd (504 bp) was gei purified with a Gei Extraction kit (Qiagen, Valencia CA), digested BamHI/BspEI, the 68 bp bánd was gei purified, and cloned intő the BamHIBspEI site ofthe pcDNA6 ID/IFNa-GS10-Fc vector, above, to create an IFNa Fc fusion with a 15 amino acid Gly/Ser linker (3xGGGGS), pcDNA6 ID/IFNa-GS15-Fc.

Example 9: Cloning of a Basic Peptide Construct [0213] The hinge region ofthe humán IgG 1 Fc fragment from amino acid 221-229 (EU numbering) was replaced with a basic peptide (CCB).

[0214] Four overlapping oligos were used (IDT, Coralville, IA):

1. CCB-Fc Sense 1:

5’ GCC GGC GAA TTC GGT GGT GAG TAC CAG GCC CTG AAG AAG AAG GTG GCC CAG CTG AAG GCC AAG AAC CAG GCC CTG AAG AAG AAG 3’(SEQ ID NO:63)

2. CCB-Fc Sense 2:

5’ GTG GCC CAG CTG AAG CAC AAG GGC GGC GGC CCC GCC CCA GAG CTC CTG GGC GGA CCG A 3’(SEQ ID NO:64)

3. CCB-Fc Anti-Sense 1:

5’ CGG TCC GCC CAG GAG CTC TGG GGC GGG GCC GCC GCC CTT GTG CTT CAG CTG GGC CAC CTT CTT CTT CAG GGC CTG GTT CTT G 3’(SEQ ID NO:65)

4. CCB-Fc Anti-Sense 2:

ΕΡ 2 361 932 Β1

5’ GCC TTC AGC TGG GCC ACC TTC TTC TTC AGG GCC TGG TAC TCA CCA CCG AAT TCG CCG GCA 3’(SEQ ID NO:66) [0215] The oligos were reconstituted to a concentration of 50 μΜ with dH₂0. 5 μΙ of each oligo were annealed to each other by combining in a thin walled PCR tűbe with 2.2 μΙ of restriction buffer #2 (i.e. final concentration of 10 mM Tris HCI pH 7.9, 10 mM MgCI₂, 50 mM Na Cl, 1 mM dithiothreitol) (New England Biolabs, Beverly, MA) and heated to 95°C for 30 seconds and then allowed to anneal by cooling slowly for 2 hours to 25°C. 5 pmol of the now annealed oligos were ligated intő a pGEM T-Easy vector as directed in the kit manual. (Promega, Madison Wl). The ligation mixture was added to 50 μΙ of DH5a competent E. coli cells (Invitrogen, Carlsbad, CA) on ice for 2 minutes, incubated at 37°C for 5 minutes, incubated on ice for 2 minutes, and then plated on LB+100 μg/L ampicillin agar plates and placed at 37°C for 14 hours. Individual bacterial colonies were picked and placed in 5 ml of LB+100 μg/L ampicillin and allowed to grow for 14 hours. The tubes were spun down at 2000xg, 4°C for 15 minutes and the vector DNA was isolated using Qiagen miniprep kit (Qiagen, Valencia, CA) as indicated in the kit manual. 2 μg of DNA was digested with NgoM IV-Rsr-lI. The fragment was gél purified by the Qiaquick method as instructed in the kit manual (Qiagen, Valencia, CA) and ligated to pED.dcEpoFc with NgoM IV/Rsr II. The ligation was transformed intő DH5a competent E. co//'cells and the DNA prepared as described for the pGEM T-Easy vector.

Example 10: Cloning of the erythropoietin-acidic peptide Fc construct [0216] The hinge region of the humán IgG 1 Fc fragment in EPO-Fc from amino acid 221-229 (EU numbering) was replaced with an acidic peptide (CCA). Four overlapping oligos were used (IDT, Coralville, IA):

1. Epo-CCA-Fc Sense 1:

5’ CCG GTG ACA GGG AAT TCG GTG GTG AGT ACC AGG CCC TGG AGA AGG AGG TGG CCC AGC TGG AG 3’(SEQ ID NO:67)

2. Epo-CCA-Fc Sense 2:

5’ GCC GAG AAC CAG GCC CTG GAG AAG GAG GTG GCC CAG CTG GAG CAC GAG GGT GGT GGT CCC GCT CCA GAG CTG CTG GGC GGA CA 3’(SEQ ID NO:68)

3. Epo-CCA-Fc Anti-Sense 1:

5’ GTC CGC CCA GCA GCT CTG GAG CGG GAC CAC CAC CCT CGT GCT CCA GCT GGG CCA C 3’(SEQ ID NO:69)

4. Epo-CCA-Fc Anti-Sense 2:

5’ CTC CTT CTC CAG GGC CTG GTT CTC GGC CTC CAG CTG GGC CAC CTC CTT CTC CAG GGC CTG GTA CTC ACC ACC GAA TTC CCT GTC ACC GGA 3’(SEQ ID NO:70) [0217] The oligos were reconstituted to a concentration of 50 μΜ with dH₂O. 5 μΙ of each oligo were annealed to each other by combining in a thin walled PCR tűbe with 2.2 μΙ of restriction buffer No. 2 (New England Biolabs, Beverly, MA) and heated to 95°C for 30 seconds and then allowed to cool slowly for 2 hours to 25°C. 5 pmol of the now annealed oligos were ligated intő a pGEM T-Easy vector as directed in the kit manual. (Promega, Madison, Wl). The ligation mixture was added to 50 μΙ of DH5a competent E. coli cells (Invitrogen, Carlsbad, CA) on ice for 2 minutes, Incubated at 37°C 5 minutes, incubated on ice for 2 minutes, and then plated on LB+100 μg/L ampicillin agar plates and placed at 37°C for 14 hours. Individual bacterial colonies were picked and placed in 5 ml of LB+100 μg/L ampicillin and allowed to grow for 14 hours. The tubes were spun down at 2000xg, 4°C for 15 minutes and the vector DNA was prepared using Qiagen miniprep kit (Qiagen, Valencia, CA) as indicated in the kit manual. 2 μg of DNA was digested with Age l-Rsr-lI.

ΕΡ 2 361 932 Β1

The fragment was gél purified by the Qiaquick method as instructed in the kit manual (Qiagen, Valencia, CA) and ligated intő pED.Epo Fc.1 Age l-Rsr II. The ligation was transformed intő DH5a competent E. coli cells and DNA prepped as described above.

Example 11: Cloning of Cys-Fc construct [0218] Using PCR and standard molecular biology techniques (Sambrook et al. 1989, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press), a mammalian expression construct was generated such that the coding sequence forthe humán IFNa signal peptide was directly abutted against the coding sequence of Fc beginning at the first cysteine residue (Cys 226, EU Numbering). Upon signal peptidase cleavage and secretion from mammalian cells, an Fc protein with an N-terminal cysteine residue was thus generated. Briefly, the primers

IFNa-Sig-F (IFNa-Sig-F: 5’-GCTACTGCAGCCACCATGGCCTTGACCTTTGCTTTAC-3’)(SEQ ID NO:71) and CysFc-R (5’-CAGTTCCGGAGCTGGGCACGGCGGA GAGCCCACAGAGCAGCTTG-3’) (SEQ ID NO:72) were used in a PCR reaction to create a fragment linking the IFNa signal sequence with the N terminus of Fc, beginning with Cys 226. 500 ng of pED.dC.native hIFNa Alinker was added to 25 pmol of each primer in a PCR reaction with Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer’s standard protocol. The reaction was carried out in a MJ Thermocycler using the following cycles: 94°C 2 minutes; 30 cycles of (94°C 30 seconds, 50°C 30 seconds, 72°C 45 seconds), and finally 72°C 10 minutes. The expected sízed bánd (-112 bp) was gél purified with a Gél Extraction kit (Qiagen, Valencia CA), digested with the Pstl and BspEI restriction enzymes, gél purified, and subcloned intő the corresponding sites pED.dC.native hIFNa Alinker to generate pED.dC.Cys-Fc (Figure 5).

Example 12: Protein Expression and Preparation of Fc-MESNA [0219] The coding sequence for Fc (the constant region of humán IgG 1) was obtained by PCR amplification from an Fc-containing plasmid using standard conditions and reagents, following the manufacturer’s recommended procedure to subclone the Fc coding sequence Nde\ISap\. Briefly, the primers 5’- GTGGTCATA TGGGCATTGAAGGCAGAGGCGCCGCTGCGGTCG - 3’(SEQ ID NO:73) and 5’-GGTGGTTGC TCTTCCGCAAAAACCCGGAGACAGGGAGAGACTCTTCTGCG - 3’ (SEQ ID NO:74)were used to amplify the Fc sequence from 500 ng ofthe plasmid pED.dC.EpoFc using Expand High Fidelity System (Boehringer Mannheim, Basel Switzerland) in a RapidCylcler thermocycler (Idaho Technology Salt Laké City, Utah), denaturing at 95°C for 2 minutes followed by 18 cycles of 95°C for 0 sec, 55°C for 0 sec, and 72°Cfor 1 minute with a slope of 4, followed by 72°C extension for 10 minutes. The PCR product was subcloned intő an intermediate cloning vectorand sequenced fully, and then subcloned using the Nde\ and Sápi sites in the pTWINl vector following standard procedures. Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989, Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. This plasmid was then transformed intő BL21(DE3) pLysS cells using standard methods. Id. A 1 liter culture of cells was grown to an absorbance reading of 0.8 AU at 37°C, induced with 1 mM isopropyl beta-D-1-thiogalactopyranoside, and grown overnight at 25°C. Cells were pelleted by centrifugation, lysed in 20 mM Tris 8.8/1% NP40/0.1 mM phenylmethanesulfonyl fluoride/1 μg/ml Benzonase (Novagen Madison, Wl), and bound to chitin beads (New England Biolabs; Beverly, MA) overnight at 4°C. Beads were then washed with several column volumes of20 mM Tris 8.5/500 mM NaCI/1 mM EDTA, and then stored at-80°C. Purified Fc-MESNA was generated by eluting the protein from the beads in 20 mM Tris 8.5/ 500 mM NaCI/1 mM EDTA / 500 mM 2-mercapto ethane sulfoníc acid (MESNA), and the eluate was used directly in the coupling reaction, below.

Example 13: Factor Vll-Fc monomer-dimer hybrid expression and purification [0220] CHO DG-44 cells expressing Factor Vll-Fc were established. CHO DG-44 cells were grown at37°C, 5% CO₂, in MÉM Alpha plus nucleoside and ribonucleosides and supplemented with 5% heat-inactivated fetal bovine serum until transfection.

[0221] DG44 cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50%- 60%. A totál of 10 μg of DNA was used to transfect one 100 mm dish: 7.5 μg of pED.dC.FVII-Fc + 1.5 μg pcDNA3/Flag-Fc + 1 μg of pcDNA6-PACE. The cells were transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). The média was removed from transfection after 48 hours and replaced with MÉM Alpha without nucleosides plus 5% dialyzed fetal bovine serum and 10 μg/ml of Blasticidin (Invitrogen, Carisbad, CA) and 0.2 mg/ml geneticin (Invitrogen, Carisbad, CA). After 10 days, the cells were released from the plate with 0.25% trypsin and transferred intő T25 tissue culture flasks, and the selection was continued for 10-14 days until the cells began to grow well as stable cell lines were established. Protein expression was subsequently amplified by the addition 25 nM methotrexate.

ΕΡ 2 361 932 Β1 [0222] Approximately 2 χ 10⁷ cells were used to inoculate 300 ml of growth médium in a 1700 cm² roller bottle (Coming, Coming, NY) supplemented with 5 μg/ml of vitamin K₃ (menadione sodium bisulfite) (Sigma, St Louis, MO). The roller bottles were incubated in a 5% CO₂ at 37°C for 72 hours. Then the growth médium was exchanged with 300 ml serumfree production médium (DMEM/F12 with 5 μg/ml bovine insulin and 10 μg/ml Gentamicin) supplemented with 5 μg/L of vitamin K₃. The production médium (conditioned médium) was collected every day for 10 days and stored at 4°C. Fresh production médium was added to the roller bottles after each collection and the bottles were returned to the incubator. Pooled média was first clarified using a Sartoclean glass fiber filter (3.0 μπι + 0.2 μηι) (Sartorious Corp. Gottingen, Germany) followed by an Acropack 500 filter (0.8 μπι + 0.2 μπι) (Pali Corp., East Hills, NY). The clarified média was then concentrated approximately 20-fold using Pellicon Biomax tangential flow filtration cassettes (10 kDa MWCO) (Millipore Corp., Billerica, MA).

[0223] Fc chimeras were then captured from the concentrated média by passage over a Protein A Sepharose 4 Fást Flow Column (AP Biotech, Piscataway, NJ). A 5 x 5 cm (100 ml) column was loaded with &lt;5 mg Fc protein per ml column volume at a linear flow rate of 100 cm/hour to achieve a residence time of &gt; 3 minutes. The column was then washed with &gt;5 column volumes of 1X DPBS to remove non-specifically bound proteins. The bound proteins were eluted with 100 mM Glycine pH 3.0. Elution fractions containing the protein peak were then neutralized by adding 1 part 1 M TrisHCL, pH 8 to 10 parts elute fraction.

[0224] To remove FLAG-Fc homodimers (that is, chimeric Fc dimers with FLAG peptide expressed as fusions with both Fc molecules) from the preparation, the Protein A Sepharose 4 Fást Flow pool was passed over a Unosphere S cation-exchange column (BioRad Corp., Richmond, CA). Underthe operating conditions for the column, the FLAG-Fc monorner-dimer hybrid is uncharged (FLAG-Fc theoretical pl=6.19) and flows through the column while the hFVII-Fc constructs are positiveiy charged, and thus bind to the column and elute at higher ionic strength. The Protein A Sepharose 4 Fást Flow pool was first dialyzed intő 20 mM MES, 20 mM NaCI, pH 6.1. The dialyzed matéria! was then loaded onto a 1.1 x 11 cm (9.9 ml) column at 150 cm/hour. During the wash and elution, the flow rate was increased to 500 cm/hour. The column was washed sequentially with 8 column volumes of 20 mM MES, 20 mM NaCI, pH 6.1 and 8 column volumes of 20 mM MES, 40 mM NaCI, pH 6.1. The bound protein was eluted with 20 mM MES, 750 mM NaCI, pH 6.1. Elution fractions containing the protein peak were pooled and sterilé filtered through a 0.2 μπι filter disc prior to storage at-80°C. [0225] An anti-FLAG MAB affinity column was used to separate chimeric Fc dimers with hFVII fused to both Fc molecules from those with one FLAG peptide and one hFVII fusion. The Unosphere S Eluate pool was diluted 1:1 with 20 mM Tris, 50 mM NaCI, 5 mM CaCI₂, pH 8 and loaded onto a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp., St. Louis, MO) at a linear flow rate of 60 cm/hour. Loading was targeted to &lt; 2.5 mg monomer-dimer hybrid /ml column volume. After loading the column was washed with 5 column volumes 20 mM Tris, 50 mM NaCI, 5 mM CaCI₂, pH 8.0, monomer dimer hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution fractions containing the protein peak were then neutralized by adding 1 part 1 M Tris-HCI, pH 8 to 10 parts eluate fraction. Pools were stored at -80°C.

Example 14: Factor IX-Fc homodimer and monomer-dimer hybrid expression and purification [0226] CHO DG-44 cells expressing Factor IX-Fc were establíshed. DG44 cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50%- 60%. A totál of 10 μg of DNA was used to transfect one 100 mm dish: for the homodimer transfection, 8 μg of pED.dC.Factor IX-Fc + 2 μg of pcDNA6-PACE was used; for the monomerdimer hybrid transfection, 8 μg of pED.dC.Factor IX-Fc +1 μg of pcDNA3-FlagFc +1 μg pcDNA6-PACE was used. The cells were transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). The média was removed from transfection after 48 hours and replaced with MÉM Alpha without nucleosides plus 5% dialyzed fetal bovine serum and 10 μg/ml of Blasticidin (Invitrogen, Carlsbad, CA) for both transfections, while the monomer-dimer hybrid transfection was alsó supplemented with 0.2 mg/ml geneticin (Invitrogen, Carlsbad, CA). After 3 days, the cells were released from the plate with 0.25% trypsin and transferred intő T25 tissue culture flasks, and the selection was continued for 10-14 days until the cells began to grow well as stable cell lines were establíshed. Protein expression was subsequently amplified by the addition 10 nM or 100 nM methotrexate for the homodimer or monomer-dimer hybrid, respectively.

[0227] For both cell lines, approximately 2 χ 10⁷ cells were used to inoculate 300 ml of growth médium in a 1700 cm²roller bottle (Coming, Coming, NY), supplemented with 5 μg/L of vitamin K₃ (menadione sodium bisulfite) (Sigma, St. Louis, MO). The roller bottles were incubated in a 5% CO₂ at 37°C for approximately 72 hours. The growth médium was exchanged with 300 ml serum-free production médium (DMEM/F12 with 5 μg/ml bovine insulin and 10 μg/ml Gentamicin), supplemented with 5 μg/L of vitamin K₃. The production médium (conditioned médium) was collected everyday for 10 days and stored at 4°C. Fresh production médium was added to the roller bottles after each collection and the bottles were returned to the incubator. Prior to chromatography, the médium was clarified using a SuporCap-100 (0.8/0.2 μηι) filter (Pali Gelman Sciences, Ann Arbor, Ml). All ofthe following steps were performed at 4°C. The clarified médium was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI), eluted with 0.1 M glycine, pH 2.7 , and then neutralized with 1/10 volume of 1 M Tris-HCI, pH 9.0.

ΕΡ 2 361 932 Β1

The protein was then dialyzed intő PBS.

[0228] The monomer-dimer hybrid transfection protein sample was subject to further purification, as it contained a mixture of FIX-Fc:FIX-Fc homodimer, FIX-Fc:Flag-Fc monomer-dimer hybrid, and Flag-Fc:Flag-Fc homodimer. Matéria! was concentrated and applied to a 2.6 cm x 60 cm (318 ml) Superdex 200 Prep Grade column at aflow rate of 4 ml/minute (36 cm/hour) and then eluted with 3 column volumes of 1X PBS. Fractions corresponding to two peakson the UV detector were collected and analyzed by SDS-PAGE. Fractions from the first peak contained either FIX-Fc:FIX-Fc homodimer or FIX-Fc:FlagFc monomer-dimer hybrid, while the second peak contained FlagFc:FlagFc homodimer. All fractions containing the monomer-dimer hybrid bút no FlagFc homodimer were pooled and applied directly to a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp., St. Louis, MO) at a linear flow rate of 60 cm/hour. After loading, the column was washed with 5 column volumes PBS. Monomer-dimer hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution fractions containing the protein peak were then neutralized by adding 1/10 volume of 1 M Tris-HCI, and analyzed by reducing and nonreducing SDS-PAGE. Fractions were dialyzed intő PBS, concentrated to 1-5 mg/ml, and stored at-80°C.

Example 15: IFNa homodimer and monomer-dimer hybrid expression and purification [0229] CHO DG-44 cells expressing hIFNa were established. DG44 cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50%-60%. A totál of 10 μg of DNA was used to transfect one 100 mm dish: for the homodimer transfection, 10 μg of the hIFNaFc constructs; for the monomer-dimer hybrid transfection, 8 μg of the hIFNaFc constructs + 2 μg of pcDNA3-FlagFc. The cells were transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). The média was removed from transfection after 48 hours and replaced with MÉM Alpha without nucleosides plus 5% dialyzed fetal bovine serum, while the monomer-dimer hybrid transfection was alsó supplemented with 0.2 mg/ml geneticin (Invitrogen, Carlsbad, CA). After 3 days, the cells were released from the plate with 0.25% trypsin and transferred intő T25 tissue culture flasks, and the selection was continued for 10-14 days until the cells began to grow well and stable cell lines were established. Protein expression was subsequently amplified by the addition methotrexate: ranging from 10 to 50 nM.

[0230] For all cell lines, approximately 2 x 10⁷ cells were used to inoculate 300 ml of growth médium in a 1700 cm²roller bottle (Corning, Corning, NY). The roller bottles were incubated in a 5% CO₂ at 37°C for approximately 72 hours. Then the growth médium was exchanged with 300 ml serum-free production médium (DMEM/F12 with 5 μg/ml bovine insulin and 10 μg/ml Gentamicin). The production médium (conditioned médium) was collected every day for 10 days and stored at 4°C. Fresh production médium was added to the roller bottles after each collection and the bottles were returned to the incubator. Priorto chromatography, the médium was clarified using a SuporCap-100 (0.8/0.2 |im) filter from Pali Gelman Sciences (Ann Arbor, Ml). All ofthe following steps were performed at 4°C. The clarified médium was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI), eluted with 0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M Tris-HCI, pH 9.0. The protein was then dialyzed intő PBS.

[0231] The monomer-dimer hybrid transfection protein samples were then subjectto further purification, as it contained a mixture of IFNaFcJFNaFc homodimer, IFNaFc:FlagFc monomer-dimer hybrid, and FlagFc:FlagFc homodimer (or Alinker or GS15 linker). Matéria! was concentrated and applied to a 2.6 cm x 60 cm (318 ml) Superdex 200 Prep Grade column at a flow rate of 4 ml/min (36 cm/hr) and then eluted with 3 column volumes of 1X PBS. Fractions corresponding to two peaks on the UV detector were collected and analyzed by SDS-PAGE. Fractions from the first peak contained either IFNaFcJFNaFc homodimer or IFNaFc:FlagFc monomer-dimer hybrid, while the second peak contained FlagFc:FlagFc homodimer. All fractions containing the monomer-dimer hybrid, bút no FlagFc homodimer, were pooled and applied directly to a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp., St Louis, MO) at a linear flow rate of 60 cm/hour. After loading the column was washed with 5 column volumes PBS monomer-dimer hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution fractions containing the protein peak were then neutralized by adding 1/10 volume of 1 M Tris-HCI, and analyzed by reducing and nonreducing SDS-PAGE. Fractions were dialyzed intő PBS, concentrated to 1-5 mg/ml, and stored at -80°C.

Example 16: Coiled coil protein expression and purification [0232] The plasmids, pED.dC Epo-CCA-Fc and pED.dC CCB-Fc will be transfected either alone or together at a 1:1 ratio intő CHO DG44 cells. The cells will be transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). The média will be removed after 48 hours and replaced with MÉM Alpha w/o nucleosides plus 5% dialyzed fetal bovine serum. Purification will be done by affinity chromatography over a protein A column according to methods known in the art. Alternatively, purification can be achieved using size exclusion chromatography.

ΕΡ 2 361 932 Β1

Example 17: Cys-Fc expression and purification [0233] CHO DG-44 cells expressing Cys-Fc were established. The pED.dC.Cys-Fc expression plasmid, which contains the mouse dihydrofolate reductase (dhfr) gene, was transfected intő CHO DG44 (dhfr deficient) cells using Superfect reagent (Qiagen; Valencia, CA) according to manufacturer’s protocol, followed by selection fór stable transfectants in aMEM (without nucleosides) tissue culture média supplemented with 5% dialyzed FBS and penicillin/streptomycin antibiotics (Invitrogen; Carlsbad, CA) fór 10 days. The resulting pool of stably transfected cells were then amplified with 50 nM methotrexate to increase expression. Approximately 2 χ 10⁷ cells were used to inoculate 300 ml of growth médium in a 1700 cm² roller bottle (Coming, Corning, NY). The roller bottles were incubated in a 5% CO₂ at37°C fór approximately 72 hours. The growth médium was exchanged with 300 ml serum-free production médium (DMEM/F12 with 5 μg/ml bovine insulin and 10 μg/ml Gentamicin). The production médium (conditioned médium) was collected every day fór 10 days and stored at 4°C. Fresh production médium was added to the roller bottles after each collection and the bottles were returned to the incubator. Prior to chromatography, the médium was clarified using a SuporCap-100 (0.8/0.2 |im) filter from Pali Gelman Sciences (Ann Arbor, Ml). All ofthe following steps were performed at 4°C. The clarified médium was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI), eluted with 0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M Tris-HCI, pH 9.0. Protein was dialyzed intő PBS and used directly in conjugation reactions.

Example 18: Coupling of T20-thioesters to Cys-Fc [0234] Cys-Fc (4 mg, 3.2 mg/ml final concentration) and eitherT20-thioesterorT20-PEG-thioester (2 mg, approximately 5 molar equivalents) were incubated fór 16 hours at room temperature in 0.1 M Tris 8/10 mM MESNA. Analysis by SDSPAGE (Tris-Gly gél) using reducing sample buffer indicated the presence of a new bánd approximately 5 kDa larger than the Fc control (&gt;40-50% conversion to the conjugate). Previous N-terminal sequencing of Cys-Fc and unreacted Cys-Fc indicated that the signal peptide is incorrectly processed in a fraction of the molecules, leaving a mixture of (Cys)-Fc, which will react through native ligation with peptide-thioesters, and (Val)-(Gly)-(Cys)-Fc, which will nőt. As the reaetion conditions are insufficient to disrupt the dimerization ofthe Cys-Fc molecules, this reaetion generated a mixture of T20-Cys-Fc:T20-Cys-Fc homodimers, T20-Cys-Fc: Fc monomer-dimer hybrids, and Cys-Fc:Cys-Fc Fc-dimers. This protein was purified using size exclusion chromatography as indicated above to separate the three species. The result was confirmed by SDS-PAGE analysis under nonreducing conditions.

Example 19: Antiviral assay fór IFNa activity [0235] Antiviral activity (lU/ml) of IFNa fusion proteins was determined using a CPE (cytopathic effect) assay. A549 cells were plated in a 96 well tissue culture plate in growth média (RPMI 1640 supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine) fór 2 hours at 37°C, 5% CO₂. IFNa standards and IFNa fusion proteins were diluted in growth média and added to cells in triplicate fór 20 hours at 37°C, 5% CO₂. Following incubation, all média was removed from wells, encephalomyocarditis vírus (EMC) vírus was diluted in growth média and added (3000 pfu/well) to each well with the exception of control wells. Plates were incubated at 37°C, 5% CO₂ fór 28 hours. Living cells were fixed with 10% cold trichloroacetic acid (TCA) and then stained with Sulforhodamine B (SRB) according to published protocols (Rubinstein et al. 1990, J. Natl. Cancer Inst. 82, 1113). The SRB dye was solubilized with 10 mM Tris pH 10.5 and read on a speetrophotometer at 490 nm. Samples were analyzed by comparing activities to a known standard curve World Health Organization IFNa 2b International Standard ranging from 5 to 0.011 lU/ml. The results are presented below in Table 3 and Figure 6 and demonstrate increased antiviral activity of monomer-dimer hybrids.

TABLE 3: INTERFERON ANTIVIRAL ASSAY HOMODIMER V. MONOMER-DIMER HYBRID

<td> Protein</td><td> Antiviral Activity (lU/nmol)</td><td> Std dev</td>

<td> IFNaFc 8aa linker homodimer</td><td> 0.45 X 10</td><td> 0.29 X 10⁵</td>

<td> IFNaFc 8aa linker:FlagFc monomer-dimer hybrid</td><td> 4.5 X 10⁵</td><td> 1.2 X 10⁵</td>

<td> IFNaFc Δ linker homodimer</td><td> 0.22 X 10⁵</td><td> 0.07 X 10⁵</td>

<td> IFNaFcA delta linker: FlagFc monomer-dimer hybrid</td><td> 2.4 X 10⁵</td><td> 0.0005 X 10⁵</td>

<td> IFNaFc GS15 linker homodimer</td><td> 2.3X10⁵</td><td> 1.0X10⁵</td>

<td> IFNaFc GS15 linker monomer-dimer hybrid</td><td> 5.3X10⁵</td><td> 0.15X10⁵</td>

ΕΡ 2 361 932 Β1

Example 20: FVIIa Clotting Activity Analysis [0236] The StaCIot FVIIa-rTF assay kit was purchased from Diagnostica Stago (Parsippany, NJ) and modified as described in Johannessen et al. 2000, Blood Coagulation and Fibrinolysis 11:S159. A standard curve was preformed with the FVIIa World Health Organization standard 89/688. The assay was used to compare clotting activity of monomerdimer hybrids compared to homodimers. The results showed the monomer-dimer hybrid had four times the clotting activity compared to the homodimer (Figure 7).

Example 21: FVIIa-Fc Órai dosing in day 10 rats [0237] 25 gram day 9 newborn Sprague Dawley rats were purchased from Charles River(Wilmington, MA) and allowed to acclimate for 24 hours. The rats were dosed orally with FVIIaFc homodimer, monomer-dimer hybrid or a 50:50 mix ofthe two. A volume of 200 μΙ of a FVIIaFc solution for a dose of 1 mg/kg was administered. The solution was composed of a Tris-HCI buffer pH 7.4 with 5 mg/ml soybean trypsin inhibitor. The rats were euthanized with CO₂ at several time points, and 200 μΙ of blood was drawn by cardiac puncture. Plasma was obtained by the addition of a 3.8% sodium citrate solution and centrifugation at room temperature at a speed of 1268xg. The plasma samples were either assayed fresh or frozen at 20°C. Orally dosed monomer-dimer hybrid resulted in significantly higher maximum (C_max) serum concentrations compared to homodimeric Factor VII (Figure 8).

Example 22: Factor IX-Fc Órai dosing of neonatal rats [0238] Ten-day old neonatal Sprague-Dawley rats were dosed p.o. with 200 μΙ of FIX-Fc homodimeror FIX-Fc: FlagFc monomer-dimer hybrid at approximately equimolar doses of 10 nmol/kg in 0.1 M sodium phosphate buffer, pH 6.5 containing 5 mg/ml soybean trypsin inhibitor and 0.9% NaCI. At 1,2, 4, 8, 24, 48, and 72 hours post injection, animals were euthanized with CO₂, blood was drawn via cardiac puncture and plasma was obtained by the addition of a 3.8% sodium citrate solution and centrifugation at room temperature at a speed of 1268xg. Samples were then sedimented by centrifugation, serum collected and frozen at -20°C until analysis ofthe fusion proteins by ELISA.

Example 23: Factor IX-Fc ELISA [0239] A 96-well Immulon 4HBX ELISA plate (Thermo LabSystems, Vantaa, Finland) was coated with 100 μΙ/well of goat anti-Factor IX IgG (Affinity Biologicals, Ancaster, Canada) diluted 1:100 in 50 mM carbonate buffer, pH 9.6. The plates were incubated at ambient temperature for 2 hours or overnight at 4°C sealed with piastic film. The wells were washed 4 times with PBST, 300 μΙ/well using the TECAN plate washer. The wells were blocked with PBST + 6% BSA, 200 μΙ/well, and incubated 90 minutes at ambient temperature. The wells were washed 4 times with PBST, 300 μΙ/well using the TECAN plate washer. Standards and blood samples from rats described in Example 18 were added to the wells, (100 μΙ/well), and incubated 90 minutes at ambient temperature. Samples and standards were diluted in HBET buffer (HBET: 5.95 g HEPES, 1.46 g NaCI, 0.93 g Na₂EDTA, 2.5 g Bovine Serum Albumin, 0.25 ml Tween-20, bring up to 250 ml with dH₂0, adjust pH to 7.2). Standard curve rangé was from 200 ng/ml to 0.78 ng/ml with 2 fold dilutions in between. Wells were washed 4 times with PBST, 300 μΙ/well using the TECAN plate washer. 100 μΙ/well of conjugated goat anti-human IgG-Fc-HARP antibody (Pierce, Rockford, IL) diluted in HBET 1:25,000 was added to each well. The plates were incubated 90 minutes at ambient temperature. The wells were washed 4 times with PBST, 300 μΙ/well using the TECAN plate washer. The plates were developed with 100 μΙ/well of tetramethylbenzidine peroxidase substrate (TMB) (Pierce, Rockford, IL) was added according to the manufacturer’s instructions. The plates were incubated 5 minutes at ambient temperature in the dark or until color developed. The reaction was stopped with 100 μΙ/well of 2 M sulfuric acid. Absorbance was read at 450 nm on SpectraMax plusplate reader (Molecular Devices, Sunnyvale, CA). Analysis of blood drawn at 4 hours indicated more than a 10 fold difference in serum concentration between Factor IXFc monomer-dimer hybrids compared to Factor IX Fc homodimers (Figure 9). The results indicated Factor IX-Fc monomer-dimer hybrid levels were consistently higherthan Factor IX-Fc homodimers (Figure 10).

Example 24: Cloning of Epo-Fc [0240] The mature Epo coding region was obtained by PCR amplification from a plasmid encoding the mature erythropoietin coding sequence, originally obtained by RT-PCR from Hep G2 mRNA, and primers hepoxba-F and hepoecoR, indicated below. Primer hepoxba-F contains an Xbal site, while primer hepoeco-R contains an EcoRI site. PCR was carried out in the Idaho Technology RapidCycIer using Vént polymerase, denaturing at 95°C for 15 seconds, followed by 28 cycles with a slope of 6.0 of 95°C for 0 seconds, 55°C for 0 seconds, and 72°C for 1 minute 20 seconds, followed by 3 minute extension at 72°C. An approximately 514 bp product was gél purified, digested with Xbal and EcoRI, gél

ΕΡ 2 361 932 Β1 purified again and directionally subcloned intő an Xbal/EcoRI-digested, gél purified pED.dC.XFc vector, mentioned above. This construct was named pED.dC.EpoFc.

[0241] The Epo sequence, containing both the endogenous signal peptide and the mature sequence, was obtained by PCR amplification using an aduit kidney QUICK-cione cDNA preparation as the template and primers Epo+Pep-SbfF and Epo+Pep-Sbf-R, described below. The primer Epo+Pep-Sbf-F contains an Sbfí site upstream ofthe start codon, while the primer Epo+Pep-Sbf-R anneals downstream of the endogenous Sbfl site in the Epo sequence. The PCR reaction was carried out in the PTC-200 MJ Thermocycler using Expand polymerase, denaturing at 94°C for 2 minutes, followed by 32 cycles of 94°C for 30 seconds, 57°C for 30 seconds, and 72°C for 45 seconds, followed by a 10 minute extension at 72°C. An approximately 603 bp product was gél isolated and subcloned intő the pGEM-T Easy vector. The correct coding sequence was excised by Sbfí digestion, gél purified, and cloned intő the Psti-digested, shrimp alkaline phosphatase (SAP)-treated, gél purified pED.dC.EpoFc plasmid. The plasmid with the insert in the correct orientation was initially determined by Kprfí digestion. A Xmrfí and Pvull digestion ofthis construct was compared with pED.dC. EpoFc and confirmed to be in the correct orientation. The sequence was determined and the construct was named pED.dC.natEpoFc. PCR Primers:

hepoxba-F (EPO-F): 5’-AATCTAGAGCCCCACCACGCCTCATCTGTGAC-3’(SEQ ID NO:75) hepoeco-R (EPO-R) 5’-TTGAATTCTCTGTCCCCTGTCCTGCAGGCC-3’(SEQ ID NO:76)

Epo+Pep-Sbf-F: 5’-GTACCTGCAGGCGGAGATGGGGGTGCA-3’(SEQ ID NO:77)

Epo+Pep-Sbf-R: 5’-CCTGGTCATCTGTCCCCTGTCC-3’(SEQ ID NO:78)

Example 25: Cloning of Epo-Fc [0242] An alternative method of cloning EPO-Fc is described herein. Primers were first designed to amplify the full length Epo coding sequence, including the native signal sequence, as follows:

Epo-F: 5’-GTCCAACCTG CAGGAAGCTTG CCGCCACCAT GGGAGTGCAC GAATGTCCTG CCTGG- 3’(SEQ ID NO:79)

Epo-R: 5’-GCCGAATTCA GTTTTGTCGA CCGCAGCGG CGCCGGCGAA CTCTCTGTCC CCTGTTCTGC AGGCCTCC- 3’(SEQ ID NO:80) [0243] The forward primer incorporates an Sbfl and Hindlll site upstream of a Kozák sequence, while the reverse primer removes the internál Sbfl site, and adds an 8 amino acid linker to the 3’ end ofthe coding sequence (EFAGAAAV) (SEQ ID NO:81) as well as Sáli and EcoRI restriction sites. The Epo coding sequence was then amplified from a kidney cDNA library (BD Biosciences Clontech, Palo Alto, CA) using 25 pmol of these primers in a 25 μΙ PCR reaction using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer’s standard protocol in a MJ Thermocycler using the following cycles: 94°C 2 minutes; 30 cycles of (94°C 30 seconds, 58°C 30 seconds, 72°C 45 seconds), followed by 72°C for 10 minutes. The expected sízed bánd (641 bp) was gél purified with a Gél Extraction kit (Qiagen, Valencia, CA) and ligated intő the intermediate cloning vector pGEM T-Easy (Promega, Madison, Wl). DNA was transformed intő DH5a cells (Invitrogen, Carlsbad, CA) and miniprep cultures grown and purified with a Plasmid Miniprep Kit (Qiagen, Valencia, CA) both according to manufacturer’s standard protocols. Once the sequence was confirmed, this insert was digested out with Sbfl/EcoRI restriction enzymes, gél purified, and cloned intő the Pstl/EcoRI sites ofthe mammalian expression vector pED.dC in a similar manner.

[0244] Primers were designed to amplify the coding sequence for the constant region of humán IgG 1 (the Fc region, EU numbering 221-447) as follows:

Fc-F: 5’-GCTGCGGTCG ACAAAACTCA CACATGCCCA CCGTGCCCAG CTCCGGAACT CCTGGGCGGA CCGTCAGTC- 3’(SEQ ID NO:82)

Fc-R 5’-ATTGGAATTC TCATTTACCC GGAGACAGGG AGAGGC- 3’(SEQ ID NO:83)

The forward primer incorporates a Sáli site at the linker-Fc junction, as well as introducing BspEI and Rsrll sites intő the Fc region without affecting the coding sequence, while the reverse primer adds an EcoRI site after the stop codon. The Fc coding sequence was then amplified from a leukocyte cDNA library (BD Biosciences Clontech, Palo Alto, CA) using 25 pmol of these primers in a 25 μΙ PCR reaction using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturers standard protocol in a MJ Thermocycler using the following cycles: 94°C 2 minutes; 30 cycles of (94°C 30 seconds, 58°C 30 seconds, 72°C 45 seconds), followed by 72°C for 10 minutes. The expected sízed bánd (696 bp) was gél purified with a Gél Extraction kit (Qiagen, Valencia, CA) and ligated intő the intermediate cloning vector pGEM T-Easy (Promega, Madison, Wl). DNA was transformed intő DH5a cells (Invitrogen, Carlsbad, CA) and miniprep culturesgrown and purified with a Plasmid Miniprep Kit (Qiagen, Valencia, CA), both according to manufacturer’s

ΕΡ 2 361 932 Β1 standard protocols. Once the sequence was confirmed, this insert was digested out with Sal/EcoRI restriction enzymes, gél purified, and cloned intő the Sall/EcoRI sites ofthe plasmid pED.dC.Epo (above) in a similar manner, to generate the mammalian expression plasmid pED.dC.EpoFc. In another experiment this plasmid was alsó digested with Rsrl l/Xmal, and the corresponding fragment from pSYN-Fc-002, which contains the Asn 297 Ala mutation (EU numbering) was cloned in to create pED.dC.EPO-Fc N297A (pSYN-EPO-004). Expression in mammalian cells was as described in Example 26. The amino acid sequence of EpoFc with an eight amino acid linker is provided in figure 2j. During the process of this alternative cloning method, although the exact EpoFc amino acid sequence was preserved (figure 2J), a number of non-coding changes were made at the nucleotide level (figure 3J). These are G6A (G at nucleotide 6 changed to A) (eliminate possible seeondary structure in primer), G567A (removes endogenous Sbfl site from Epo), A582G (removes EcoRI site from linker), A636T and T639G (adds unique BspEI site to Fc), and G651C (adds unique Rsrll site to Fc). The nucleotide sequence in figure 3J is from the construct made in Example 25, which incorporates these differences from the sequence of the construct from Example 24.

Example 26: EPO-Fc Homodimer And Monomer-dimer Hybrid Expression And Purification [0245] DG44 cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50%-60%. A totál of 10 μg of DNA was used to transfect one 100 mm dish: fór the homodimer transfection, 10 μg of pED.dC.EPO-Fc; fór the monomer-dimer hybrid transfection, 8 μg of pED.dC.EPO-Fc + 2 μg of pcDNA3-FlagFc. The constructs used were cloned as described in Example 24. The cloning method described in Example 25 could alsó be used to obtain constructs fór use in this example. The cells were transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). Aiternatively, pED.dC.EPO-Fc was cotransfected with pSYN-Fc-016 to make an untagged monomer. The média was removed from transfection after 48 hours and replaced with MÉM Alpha without nucleosides plus 5% dialyzed fetal bovine serum fór both transfections, while the monomer-dimer hybrid transfection was alsó supplemented with 0.2 mg/ml geneticin (Invitrogen, Carlsbad, CA). After 3 days, the cells were released from the plate with 0.25% trypsin and transferred intő T25 tissue culture flasks, and the selection was continued fór 10-14 days until the cells began to grow well as stable cell lines were established. Protein expression was subsequently amplified by the addition methotrexate.

[0246] Fór both cell lines, approximately 2 χ 10⁷ cells were used to inoculate 300 ml of growth médium in a 1700 cm²roller bottle (Corning, Corning, NY). The roller bottles were incubated in a 5% CO₂ at 37°C fór approximately 72 hours. The growth médium was exchanged with 300 ml serum-free production médium (DMEM/F12 with 5 μg/ml bovine insulin and 10 μg/ml Gentamicin). The production médium (conditioned médium) was collected every day fór 10 days and stored at4°C. Fresh production médium was added to the roller bottles after each collection and the bottles were returned to the incubator. Priorto chromatography, the médium was clarified using a SuporCap-100 (0.8/0.2 μηι) filter from Pali Gelman Sciences (Ann Arbor, Ml). All ofthe following steps were performed at 4°C. The clarified médium was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI), eluted with 0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M Tris-HCI, pH 9.0. Protein was then dialyzed intő PBS.

[0247] The monomer-dimer hybrid transfection protein sample was subject to further purification, as it contained a mixture of EPO-Fc:EPO-Fc homodimer, EPO-Fc:Flag-Fc monomer-dimer hybrid, and Flag-Fc:Flag-Fc homodimer. Matéria! was concentrated and applied to a 2.6 cm x 60 cm (318 ml) Superdex 200 Prep Grade column at a flow rate of 4 ml/min (36 cm/hour) and then eluted with 3 column volumes of 1X PBS. Fractions corresponding to two peaks on the UV detector were collected and analyzed by SDS-PAGE. Fractions from the first peak contained either EPO-Fc:EPOFc homodimer or EPO-Fc:FlagFc monomer-dimer hybrid, while the second peak contained FlagFc:FlagFc homodimer. All fractions containing the monomer-dimer hybrid bút no FlagFc homodimer were pooled and applied directly to a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp.) at a linear flow rate of 60 cm/hour. After loading the column was washed with 5 column volumes PBS. Monomer-dimer hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution fractions containing the protein peak were then neutralized by adding 1/10 volume of 1 M Tris-HCI, and analyzed by reducing and nonreducing SDS-PAGE. Fractions were dialyzed intő PBS, concentrated to 1-5 mg/ml, and stored at-80°C. [0248] Aiternatively, fractions from first peak of the Superdex 200 were analyzed by SDS-PAGE, and oniy fractions containing a majority of EpoFc monomer-dimer hybrid, with a minority of EpoFc homodimer, were pooled. This pool, enriched fór the monomer-dimer hybrid, was then reapplied to a Superdex 200 column, and fractions containing oniy EpoFc monomer-dimer hybrid were then pooled, dialyzed and stored as purified protein. Note that this alternate purification method could be used to purify non-tagged monomer-dimer hybrids as well.

Example 27: Administration of EpoFc Dimer and Monomer-Dimer Hybrid With an Eight Amino Acid Linker to

Cynomolgus Monkeys [0249] Fór pulmonary administration, aerosols of either EpoFc dimer or EpoFc monomer-dimer hybrid proteins (both

EP 2 361 932 Β1 with the 8 amino acid linker) in PBS, pH 7.4 were created with the Aeroneb Pro™ (AeroGen, Mountain View, CA) nebulizer, in-line with a Bírd Mark 7A respirator, and administered to anesthetized na'ive cynomolgus monkeys through endotracheal tubes (approximating normál tidal breathing). Both proteins were alsó administered to na'ive cynomolgus monkeys by intravenous injection. Samples were taken at various time points, and the amount of Epo-containing protein in the resulting plasma was quantitated using the Quantikine ÍVD Humán Epo Immunoassay (R&amp;D Systems, Minneapolis, MN). Pharmacokinetic parameters were calculated using the software WinNonLin. Table 4 presents the bioavailability results of cynomolgus monkeys treated with EpoFc monomer-dimer hybrid or EpoFc dimer.

TABLE 4: ADMINISTRATION OF EPOFC MONOMER-DIMER HYBRID AND EPOFC DIMER TO MONKEYS

<td> Protein</td><td> Monkey #</td><td> Route</td><td> Approx. Deposited Dose¹^g/kg)</td><td> p '“'max (ng/ml)</td><td> p '“'max (fmol/ml)</td><td>^l1/2 (hr)</td><td>^l1/2 avg (hr)</td>

<td rowspan="7"> EpoFc monomer-dimer hybrid</td><td> CO6181</td><td> púim</td><td> 20</td><td> 72.3</td><td> 1014</td><td> 23.6</td><td rowspan="4"> 25.2</td>

<td> CO6214</td><td> púim</td><td> 20</td><td> 50.1</td><td> 703</td><td> 23.5</td>

<td> C07300</td><td> púim</td><td> 20</td><td> 120</td><td> 1684</td><td> 36.2</td>

<td> CO7332</td><td> púim</td><td> 20</td><td> 100</td><td> 1403</td><td> 17.5</td>

<td> CO7285</td><td> IV</td><td> 25</td><td> 749</td><td> 10508</td><td> 21.3</td><td rowspan="3"> 22.6</td>

<td> CO7288</td><td> IV</td><td> 25</td><td> 566</td><td> 7941</td><td> 23</td>

<td> CO7343</td><td> IV</td><td> 25</td><td> 551</td><td> 1014</td><td> 23.5</td>

<td rowspan="11"> EpoFc dimer</td><td> DD026</td><td> púim</td><td> 15</td><td> 10.7</td><td> 120</td><td> 11.5</td><td rowspan="5"> 22.1</td>

<td> DD062</td><td> púim</td><td> 15</td><td> 21.8</td><td> 244</td><td> 27.3</td>

<td> DD046</td><td> púim</td><td> 15</td><td> 6.4</td><td> 72</td><td> 21.8</td>

<td> DD015</td><td> púim</td><td> 15</td><td> 12.8</td><td> 143</td><td> 20.9</td>

<td> DD038</td><td> púim</td><td> 35</td><td> 27</td><td> 302</td><td> 29</td>

<td> F4921</td><td> IV</td><td> 150</td><td> 3701</td><td> 41454</td><td> 15.1</td><td rowspan="6"> 14.6</td>

<td> 96Z002</td><td> IV</td><td> 150</td><td> 3680</td><td> 41219</td><td> 15.3</td>

<td> 1261CQ</td><td> IV</td><td> 150</td><td> 2726</td><td> 30533</td><td> 23.6</td>

<td> 127-107</td><td> IV</td><td> 150</td><td> 4230</td><td> 47379</td><td> 15.0</td>

<td> 118-22</td><td> IV</td><td> 150</td><td> 4500</td><td> 50403</td><td> 8.7</td>

<td> 126-60</td><td> IV</td><td> 150</td><td> 3531</td><td> 39550</td><td> 9.8</td>

¹ Based on 15% deposition fraction of nebulized dose as determined by gamma scintigraphy [0250] The percent bioavailability (F) was calculated for the pulmonary doses using the following equation:

F= (AUC pulmonary / Dose pulmonary) / (AUC IV / Dose IV) * 100

TABLE 5: CALCULATION OF PERCENT BIOAVAILABILITY FOR EPOFC MONOMER-DIMER HYBRID V. DIMER AFTER PULMONARY ADMINISTRATION TO NÁIVE CYNOMOLGUS MONKEYS

<td> Protein</td><td> Monkey #</td><td> Approx. Dose¹(deposited)</td><td> AUC ng’hr/mL</td><td> Bioavailability² (F)</td><td> Average Bioavailabiity</td>

<td rowspan="4"> EpoFc monomerdimer hybrid</td><td> CO6181</td><td> 20 μg/kg</td><td> 3810</td><td> 25.2%</td><td rowspan="4"> 34.9%</td>

<td> CO6214</td><td> 20 μg/kg</td><td> 3072</td><td> 20.3%</td>

<td> C07300</td><td> 20 μg/kg</td><td> 9525</td><td> 63.0%</td>

<td> CO7332</td><td> 20 μg/kg</td><td> 4708</td><td> 31.1%</td>

ΕΡ 2 361 932 Β1 (continued)

<td> Protein</td><td> Monkey #</td><td> Approx. Dose¹(deposited)</td><td> AUC ng’hr/mL</td><td> Bioavailability² (F)</td><td> Average Bioavailabiity</td>

<td rowspan="5"> EpoFc dimer</td><td> DD026</td><td> 15 μg/kg</td><td> 361</td><td> 5.1%</td><td rowspan="5"> 10.0 %</td>

<td> DD062</td><td> 15 μg/kg</td><td> 1392</td><td> 19.6%</td>

<td> DD046</td><td> 15 μg/kg</td><td> 267</td><td> 3.8%</td>

<td> DD015</td><td> 15 μg/kg</td><td> 647</td><td> 9.1%</td>

<td> DD038</td><td> 35 μg/kg</td><td> 2062</td><td> 12.4%</td>

<td colspan="6">¹ Based on 15% deposition fraction of nebulized dose as determined by gamma scintigraphy ²Mean AUC for IV EpoFc monomer-dimer hybrid = 18,913 ng-hr/mL (n=3 monkeys), dosed at 25 μg/kg. Mean AUC for IV EpoFc dimer = 70, 967 ng-hr/mL(n=6 monkeys), dosed at 150 μg/kg</td>

[0251] The pharmacokinetics of EpoFcwith an 8 amino acid linker administered to cynomolgus monkeys is presented in figure 11. The figure compares the EpoFc dimer with the EpoFc monomer-dimer hybrid in monkeys after administration of a single pulmonary dose. Based on a molar comparison significantly higher serum levels were obtained in monkeys treated with the monomer-dimer hybrid compared to the dimer.

Example 28: Subeutaneous Administration of EPOFc Monomer-dimer Hybrid [0252] To compare serum concentrations of known erythropoietin agents with EPOFc monomer-dimer hybrids, both EPOFc monomer-dimer hybrid and Aranesp®(darbepoetin alfa), which is nóta chimeric fusion protein, were administered subcutaneously to different monkeys and the serum concentration of both was measured over time.

[0253] Cynomolgus monkeys (n = 3 per group) were injected subcutaneously with 0.025 mg/kg EpoFc monomerdimer hybrid. Blood samples were collected predose and at times up to 144 hours post dose. Serum was prepared from the blood and stored frozen until analysis by ELISA (Humán Epo Ouantikine Immunoassay) (R&amp;D Systems, Minneapolis, MN). Pharmacokinetic parameters were determined using WinNonLiná® software (Pharsight, Mountainview, CA). [0254] The results indicated the serum concentrations of both EPOFc monomer-dimer hybrid and Aranesp® (darbepoetin alfa) were equivalent over time, even though the administered molar dose of Aranesp® (darbepoetin alfa) was slightly larger (Table 6) (figure 12).

TABLE 6

<td></td><td> Route</td><td> Dose (pg/kg)</td><td> Dose (nmol/kg)</td><td> Cmax (ng/mL)</td><td> AUC (ng’hr’mL¹)</td><td>^T1/2 (hr)</td><td> % Bioavailability (F)</td>

<td> EpoFc Monomerdimer hybrid</td><td> Subeutaneous</td><td> 25</td><td> 0.3</td><td> 133 ± 34</td><td> 10,745 ± 3,144</td><td> 26 ± 5</td><td> 57 ±17</td>

<td> Aranesp®</td><td> Subeutaneous</td><td> 20</td><td> 0.54</td><td> 83 ± 11</td><td> 5390 ± 747</td><td> 22 ±2</td><td> 53 ± 8</td>

Example 29: Intravenous Administration of EPOFc Monomer-dimer Hybrid [0255] To compare serum concentrations of known erythropoietin agents with EPOFc monomer-dimer hybrids, EPOFc monomer-dimer hybrid, Aranesp® (darbepoetin alfa), and Epogen® (epoetin alfa), neither ofwhich is a chimeric fusion protein, were administered intravenously to different monkeys and the serum concentration of both was measured over time.

[0256] Cynomolgus monkeys (n = 3 per group) were injected intravenously with 0.025 mg/kg EpoFc monomer-dimer hybrid. Blood samples were collected predose and at times up to 144 hours post dose. Serum was prepared from the blood and stored frozen until analysis by ELISA (Humán Epo Ouantikine Immunoassay) (R&amp;D Systems, Minneapolis, MN). Pharmacokinetic parameters were determined using WinNonLiná software (Pharsight, Mountainview, CA). [0257] The results indicated the serum concentration versus time (AUC) of EPOFc monomer-dimer hybrid was greater than the concentrations of either Epogen® (epoetin alfa) or Aranesp® (darbepoetin alfa), even though the monkeys received larger molar doses of both Epogen® (epoetin alfa) and Aranesp® (darbepoetin alfa) (Table 7) (Figure 13).

ΕΡ 2 361 932 Β1

TABLE 7

<td></td><td> Route</td><td> Dose (μ-g/kg)</td><td> Dose (nmol/kg)</td><td> Cmax (ng/mL)</td><td> AUC (ng’hr’mL^-1)</td><td> T_1/2 (hr)</td>

<td> EpoFc Monomer-dimer hybrid</td><td> Intravenous</td><td> 25</td><td> 0.3</td><td> 622 ± 110</td><td> 18,913 ±3,022</td><td> 23 ± 1</td>

<td> Aranesp®</td><td> Intravenous</td><td> 20</td><td> 0.54</td><td> 521 ± 8</td><td> 10,219 ± 298</td><td> 20 ± 1</td>

<td> Epogen</td><td> Intravenous</td><td> 20</td><td> 0.66</td><td> 514 ± 172</td><td> 3936 ± 636</td><td> 6.3 ± 0.6</td>

Example 30: Alternative Purification of EpoFc Monomer-dimer Hybrid [0258] Yet another alternative for purifying EPO-Fc is described herein. A mixture containing Fc, EpoFc monomerdimer hybrid, and EpoFc dimer was applied to a Protein A Sepharose column (Amersham, Uppsala, Sweden). The mixture was eluted according to the manufacturer’s instructions. The Protein A Sepharose eluate, containing the mixture was buffer exchanged intő 50 mM Tris-CI (pH 8.0). The protein mixture was loaded onto an 8 mL Mimetic Red 2 XL column (ProMetic Life Sciences, Inc., Wayne, NJ) that had been equilibrated in 50 mM Tris-CI (pH 8.0). The column was then washed with 50 mM Tris-CI (pH 8.0); 50 mM NaCI. This step removed the majority ofthe Fc. EpoFc monomerdimer hybrid was specifically eluted from the column with 50 mM Tris-CI (pH 8.0); 400 mM NaCI. EpoFc dimer can be eluted and the column regenerated with 5 column volumes of 1 M NaOH. Eluted fractionsfrom the column were analyzed bySDS-PAGE (Figure 14).

Example 31: Cloning of Igk signal sequence - Fc construct for making untagged Fc alone.

[0259] The coding sequence for the constant region of lgG1 (EU # 221-447; the Fc region) was obtained by PCR amplification from a leukocyte cDNA library (Clontech, CA) using the following primers:

rcFc-F 5’- GCTGCGGTCGACAAAACTCACACATGCCCACCGTGCCCAGCTCC GGAACTCCTGGGCGGACCGTCAGTC -3’ (SEQ ID NO: 84) rcFc-R 5’-ATTGGAATTCTCATTTACCCGGAGACAGGGAGAGGC -3’ (SEQ ID NO: 85) [0260] The forward primer adds three amino acids (AAV) and a Sáli cloning site before the beginning ofthe Fc region, and alsó incorporates a BspEI restriction site at amino acids 231-233 and an Rsrll restriction site at amino acids 236-238 using the degeneracy ofthe genetic code to preserve the correct amino acid sequence (EU numbering). The reverse primer adds an EcoRI cloning site after the stop codon of the Fc. A 25 μΙ PCR reaetion was carried out with 25 pmol of each primer using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer’s standard protocol in a MJ Thermocycler using the following cycles: 94°C 2 minutes; 30 cycles of (94°C 30 seconds, 58°C 30 seconds, 72°C 45 seconds), 72°C 10 minutes. The expected sízed bánd (-696 bp) was gél purified with a Gél Extraction kit (Qiagen, Valencia CA), and cloned intő pGEM Τ-Easy (Promega, Madison, Wl) to produce an intermediate plasmid pSYN-Fc-001 (pGEM T-Easy/Fc).

[0261] The mouse Igk signal sequence was added to the Fc CDS using the following primers:

rc-lgk sig seq-F: 5’-TTTAAGCTTGCCGCCACCATGGAGACAGACACACTCC TGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACAAAACT CACACATGCCCACCG -3’ (SEQ ID NO: 86)

Fc-noXma-GS-R: 5’- GGTCAGCTCATCGCGGGATGGG -3’ (SEQ ID NO: 87)

Fc-noXma-GS-F: 5’- CCCATCCCGCGATGAGCTGACC -3’ (SEQ ID NO: 88) [0262] The rc-lgK signal sequence-F primer adds a Hindlll restriction site to the 5’end ofthe molecule, followed by a Kozák sequence (GCCGCCACC) (SEQ ID NO: 89) followed by the signal sequence from the mouse Igk light chain, directly abutted to the beginning ofthe Fc sequence (EU#221). The Fc-noXma-GS-F and - R primers remove the internál Xmal site from the Fc coding sequence, using the degeneracy ofthe genetic code to preserve the correct amino acid sequence. Two 25 μΙ PCR reactions were carried out with 25 pmol of either rc-lgk signal sequence-F and Fc-noXma42

ΕΡ 2 361 932 Β1

GS-R or Fc-noXma-GS-F and rcFc-R using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer’s standard protocol in a MJ Thermocycler. The first reaction was carried out with 500 ng of leukocyte cDNA library (BD Biosciences Clontech, Palo Alto, CA) as a template using the following cycles: 94°C 2 minutes; 30 cycles of (94°C 30 seconds, 55°C 30 seconds, 72°C 45 seconds), 72°C 10 minutes. The second reaction was carried out with 500 ng of pSYN-Fc-001 as a template (above) using the following cycles: 94°C 2 minutes; 16 cycles of (94°C 30 seconds, 58°C 30 seconds, 72°C 45 seconds), 72°C 10 minutes. The expected sízed bands (-495 and 299 bp, respectively) were gei purified with a Gei Extraction kit (Qiagen, Valencia CA), then combined in a PCR reaction with 25 pmol of rc-lgk signal sequence-F and rcFc-R primers and run as before, annealing at 58°C and continuing for 16 cycles. The expected sízed bánd (-772 bp) was gei purified with a Gei Extraction kit (Qiagen, Valencia CA) and cloned intő pGEM Τ-Easy (Promega, Madison, Wl) to produce an intermediate plasmid pSYN-Fc-007 (pGEM T-Easy/lgk sig seq-Fc). The entire Igk signal sequence-Fc cassette was then subcloned using the Hind111 and EcoRI sites intő either the pEE6.4 (Lonza, Slough, UK) or pcDNA3.1 (Invitrogen, Carlsbad, CA) mammalian expression vector, depending on the system to be used, to generate pSYN-Fc-009 (pEE6.4/lgk sig seq-Fc) and pSYN-Fc-015 (pcDNA3/lgk sig seq-Fc).

Example 32: Cloning of Igk signal sequence - Fc N297A construct for making untagged Fc N297A alone.

[0263] In order to mutate Asn 297 (EU numbering) of the Fc to an Alá residue, the following primers were used:

N297A-F 5’- GAGCAGTACGCTAGCACGTACCG -3’ (SEQ ID NO: 90)

N297A-R 5’- GGTACGTGCTAGCGTACTGCTCC -3’ (SEQ ID NO: 91) [0264] Two PCR reactions were carried out with 25 pmol of either rc-lgk signal sequence-F and N297A-R or N297AF and rcFc-R using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according tothe manufacturer’s standard protocol in a MJ Thermocycler. Both reactions were carried out using 500 ng of pSYN-Fc-007 as a template using the following cycles: 94°C 2 minutes; 16 cycles of (94°C 30 seconds, 48°C 30 seconds, 72°C 45 seconds), 72°C 10 minutes. The expected sízed bands (-319 and 475 bp, respectively) were gei purified with a Gei Extraction kit (Qiagen, Valencia CA), then combined in a PCR reaction with 25 pmol of rc-lgK signal sequence-F and rcFc-R primers and run as before, annealing at 58°C and continuing for 16 cycles. The expected sízed bánd (-772 bp) was gei purified with a Gei Extraction kit (Qiagen, Valencia CA) and cloned intő pGEM Τ-Easy (Promega, Madison, Wl) to produce an intermediate plasmid pSYN-Fc-008 (pGEM T-Easy/lgK sig seq-Fc N297A). The entire Igk signal sequence-Fc alone cassette was then subcloned using the H ind 111 and EcoRI sites intő either the pEE6.4 (Lonza, Slough, UK)or pcDNA3.1 (Invitrogen, Carlsbad, CA) mammalian expression vector, depending on the system to be used, to generate pSYN-Fc-010 (pEE6.4/lgk sig seq-Fc N297A) and pSYN-Fc-016 (pcDNA3/lgk sig seq-Fc N297A).

[0265] These same N297A primers were alsó used with rcFc-F and rcFc-R primers and pSYN-Fc-001 as a template in a PCR reaction followed by subcloning as indicated above to generate pSYN-Fc-002 (pGEM T Easy/Fc N297A).

Example 33:Cloning of EpoFc and Fc intő single plasmid for double gene vectors for making EpoFc wildtype or

N297A monomer-dimer hybrids, and expression.

[0266] An alternative to transfecting the EpoFc and Fc constructs on separate plasmids is to clone them intő a single plasmid, alsó called a double gene vector, such as used in the Lonza Biologics (Slough, UK) system. The Rsril/EcoRI fragment from pSYN-Fc-002 was subcloned intő the corresponding sites in pEE12.4 (Lonza Biologics, Slough, UK) according to standard procedures to generate pSYN-Fc-006 (pEE12.4/FcN297Afragment). The pSYN-EPO-004 plasmid was used as a template for a PCR reaction using Epo-F primer from Example 25 and the following primer:

EpoRsr-R: 5’-CTGACGGTCCGCCCAGGAGTTCCG GAGCTGGGCACGGTGGGCATG TGTGAGTTTTGTCGACCGCAGCGG -3’ (SEQ ID NO: 91) [0267] A PCR reaction was carried out using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturers standard protocol in a MJ Thermocycler as indicated above, for 16 cycles with 55°C annealing temperature. The expected sízed bánd (-689 bp) was gei purified with a Gei Extraction kit (Qiagen, Valencia CA) and cloned intő pSYN-Fc-006 using the Hind11l/RsrlI restriction sites, to generate pSYN-EPO-005 (pEE12.4/EpoFc N297A). The double gene vector for the EpoFc N297A monomer-dimer hybrid was then constructed by cloning the NotIBamHI fragment from pSYN-Fc-010 intő the corresponding sites in pSYN-EPO-005 to generate pSYN-EPO-008 (pEE12.4-6.4/EpoFc N297A/Fc N297A).

[0268] The wild type construct was alsó made by subcloning the wild type Fc sequence from pSYN-Fc-001 intő pSYNEPO-005 using the Rsrll and EcoRI sites, to generate pSYN-EPO-006 (pEE12.4/EpoFc). The double gene vector for

ΕΡ 2 361 932 Β1 the EpoFc monomer-dimer hybrid was then constructed by cloning the Notl/BamHI fragment from pSYN-Fc-009 intő the corresponding sites in pSYN-EPO-006 to generate pSYN-EPO-007 (pEE1,2.4-6.4/EpoFc /Fc).

[0269] Each plasmid was transfected intő CHOK1SV cells and positive clones identified and adpated to serum-free suspension, as indicated in the Lonza Biologics Manual for Standard Operating procedures (Lonza Biologics, Slough, UK), and purified as indicated for the other monomer-dimer constructs.

Example 34: Cloning of humán IFNpFc, IFN[l-Fc N297A with eight amino acid linkers and lgk-Fc-6His constructs [0270] 10 ng of a humán genomic DNA library from Clontech (BD Biosciences Clontech, Palo Alto, CA) was used as a template to isolate humán IFNp with its native signal sequence using the following primers:

IFNP-F H3/Sbfl:

5’- CTAGCCTGCAGGAAGCTTGCCGCCACCATGACCA ACAAGTGTCTCCTC -3’ (SEQ ID NO: 92)

IFNp-R (EFAG) Sál:

5’TTTGTCGACCGCAGCGGCGCCGGCGAACTCGTTTCGG AGGTAACCTGTAAG -3' (SEQ ID NO: 93) [0271] The reverse primer was alsó used to create an eight amino acid linker sequence (EFAGAAAV) (SEQ ID NO: 94) on the 3’ end ofthe humán IFNp sequence. The PCR reaction was carried out using the Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer’s standard protocol in a Rapid Cycler thermocycler (Idaho Technology, Salt Laké City, UT). A PCR product ofthe correct size (-607 bp) was gél purified using a Gél Extraction kit (Qiagen; Valencia, CA), cloned intő TA cloning vector (Promega, Madison, Wl) and sequenced. This construct was named pSYN-IFNp-002. pSYN-IFNp-002 was digested with Sbfl and Sáli and cloned intő pSP72 (Promega) at Pstl and Sáli sites to give pSYN-IFNp-005.

[0272] Purified pSYN-Fc-001 (0.6 μg) was digested with Sáli and EcoRI and cloned intő the corresponding sites of pSYN-IFNp-005 to create the plasmid pSYN-IFNp-006 which contains humán IFNp linked to humán Fc through an eight amino acid linker sequence. pSYN-IFNp-006 was then digested with Sbfl and EcoRI and the full-length IFNp-Fc sequence cloned intő the Pstl and EcoRI sites of pEDdC.sig to create plasmid pSYN-IFNp-008.

[0273] pSYN-Fc-002 containing the humán Fc DNA with a single amino acid change from asparagine to alanine at position 297 (N297A; EU numbering) was digested with BspEI and Xmal to isolate a DNA fragment of-365 bp containing the N297A mutation. This DNA fragment was cloned intő the corresponding sites in pSYN-IFNp-008 to create plasmid pSYN-IFNp-009 that contains the IFNp-Fc sequence with an eight amino acid linker and an N297A mutation in Fc in the expression vector, pED.dC.

[0274] Cloning of Igk signal sequence-Fc N297A - 6His. The following primers were used to add a 6xHis tag to the C terminus of the Fc N297A coding sequence:

Fc GS-F: 5’- GGCAAGCTTGCCGCCACCATGGAGACAGACACACTCC -3’ (SEQ ID NO: 95)

Fc.6His-R: 5’- TCAGTGGTGATGGTGATGATGTTTACCCGGAGACAGGGAG -3’ (SEQ ID NO: 96)

Fc.6His-F: 5’- GGTAAACATCATCACCATCACCACTGAGAATTCC AATATCACTAGTGAATTCG -3’ (SEQ ID NO: 97)

Sp6+T-R: 5’- GCTATTTAGGTGACACTATAGAATACTCAAGC -3’ (SEQ ID NO: 98) [0275] Two PCR reactions were carried out with 50 pmol of either Fc GS-F and Fc.6His-R or Fc.6His-F and Sp6+TR using the Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer’s standard protocol in a MJ Thermocycler. Both reactions were carried out using 500 ng of pSYN-Fc-008 as a template in a 50 μΙ reaction, using standard cycling conditions. The expected sízed bands (-780 and 138 bp, respectively) were gél purified with a Gél Extraction kit (Qiagen, Valencia CA), then combined in a 50 μΙ PCR reaction with 50 pmol of Fc GS-F and Sp6+T-R primers and run as before, using standard cycling conditions. The expected sízed bánd (-891 bp) was gél purified with a Gél Extraction kit (Qiagen, Valencia CA) and cloned intő pcDNA6 V5-His B using the Hind111 and EcoRI sites to generate pSYN-Fc-014 (pcDNA6/lgk sig seq-Fc N297A-6 His).

ΕΡ 2 361 932 Β1

Example 35: Expression and purification of IFNpFc, IFNp-Fc N297A homodimer and IFNp-Fc N297A monomerdimer hybrid [0276] CHO DG44 cells were plated in 100 mm tissue culture dishes and grown to a confluency of 50%-60%. A totál of 10 μg of DNA was used to transfect a single 100 mm dish. For the homodimer transfection, 10 μg ofthe pSYN-FNp008 or pSYN-IFNp-009 construct was used; forthe monomer-dimer hybrid transfection, 8 μg ofthe pSYN-IFNp-009 + 2 μg of pSYN-Fc-014 construct was used. The cells were transfected using Superfect transfection reagents (Qiagen, Valencia, CA) according to the manufacturer’s instructions. 48 to 72 hours post-transfection, growth médium was removed and cells were released from the plates with 0.25% trypsin and transferred to T75 tissue culture flasks in selection médium (MÉM Alpha without nucleosides plus 5% dialyzed fetal bovine serum). The selection médium forthe monomerdimer hybrid transfection was supplemented with 5 μg/ml Blasticidin (Invitrogen, Carlsbad, CA). Selection was continued for 10-14 days until the cells began to grow well and stable cell lines were established. Protein expression was subsequently amplified by the addition methotrexate: ranging from 10 to 50 nM.

[0277] For all cell lines, approximately 2 x 10⁷ cells were used to inoculate 300 ml of growth médium in a 1700 cm²roller bottle (Corning, Coming, NY). The roller bottles were incubated in a 5% CO₂ incubator at 37°C for approximately 72 hours. The growth médium was then exchanged with 300 ml serum-free production médium (DMEM/F12 with 5 μg/ml humán insulin). The production médium (conditioned médium) was collected every day for 10 days and stored at 4°C. Fresh production médium was added to the roller bottles after each collection and the bottles were returned to the incubator. Priorto chromatography, the médium was clarified using a SuporCap-100 (0.8/0.2 μηι) filterfrom Pali Gelman Sciences (Ann Arbor, Ml). All ofthe following steps were performed at 4°C. The clarified médium was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCi), eluted with 0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M Tris-HCI pH 8.0, 5 M NaCi. The homodimer proteins were further purified over a Superdex 200 Prep Grade sizing column run and eluted in 50 mM sodium phosphate pH 7.5, 500 mM NaCi, 10% glycerol.

[0278] The monomer-dimer hybrid protein was subject to further purification since it contained a mixture of IFNpFc. N297A:IFNpFc N297A homodimer, IFNpFc N297A: Fc N297A His monomer-dimer hybrid, and Fc N297A His: Fc N297A His homodimer. Matéria! was applied to a Nickel chelating column in 50 mM sodium phosphate pH 7.5, 500 mM NaCi. After loading, the column was washed with 50 mM imidazole in 50 mM sodium phosphate pH 7.5, 500 mM NaCi and protein was eluted with a gradientof 50 - 500 mM imidazole in 50 mM sodium phosphate pH 7.5, 500 mM NaCi. Fractions corresponding to elution peaks on a UV detector were collected and analyzed by SDS-PAGE. Fractions from the first peak contained IFNpFc N297A: Fc N297A His monomer-dimer hybrid, while the second peak contained Fc N297A His: Fc N297A His homodimer. All fractions containing the monomer-dimer hybrid, bút no Fc homodimer, were pooled and applied directly to a Superdex 200 Prep Grade sizing column, run and eluted in 50 mM sodium phosphate pH 7.5, 500 mM NaCi, 10% glycerol. Fractions containing IFNp-Fc N297A:Fc N297A His monomer-dimer hybrids were pooled and stored at -80°C.

Example 36: Antiviral assay for IFNP activity [0279] Antiviral activity (lU/ml) of IFNp fusion proteins was determined using a CPE (cytopathic effect) assay. A549 cells were plated in a 96 well tissue culture plate in growth média (RPMI 1640 supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine) for 2 hours at 37°C, 5% CO₂. IFNp standards and IFNp fusion proteins were diluted in growth média and added to cells in triplicate for 20 hours at 37°C, 5% CO₂. Following incubation, all média was removed from wells, encephalomyocarditis vírus (EMCV) was diluted in growth média and added (3000 pfu/well) to each well with the exception of control wells. Plates were incubated at 37°C, 5% CO₂ for 28 hours. Líving cells were fixed with 10% cold trichloroacetic acid (TCA) and then stained with Sulforhodamine B (SRB) according to published protocols (Rubinstein et al. 1990, J. Natl. Cancer Inst. 82, 1113). The SRB dye was solubilized with 10 mM Tris pH 10.5 and read on a spectrophotometer at 490 nm. Samples were analyzed by comparing activities to a known standard curve ranging from 10 to 0.199 lU/ml. The results are presented below in Table 8 and demonstrate increased antiviral activity of monomer-dimer hybrids.

TABLE 8: INTERFERON BÉTA ANTIVIRAL ASSAY HOMODIMER V. MONOMER-DIMER HYBRID

<td> Protein</td><td> Antiviral Activity (lU/nmol)</td><td> Std dev</td>

<td> IFNp-Fc 8aa linker homodimer</td><td> 4.5 X 10⁵</td><td> 0.72 X 10⁵</td>

<td> IFNpFc N297A 8aa linker homodimer</td><td> 3.21 X 10⁵</td><td> 0.48 X 10⁵</td>

<td> IFNpFc N297A8aa linker: Fc His monomer-dimer hybrid</td><td> 12.2 X 10⁵</td><td> 2 X 10⁶</td>

ΕΡ 2 361 932 Β1

Example 37: Administration of IFNpFc Homodimer and Monomer-Dimer Hybrid With an Eight Amino Acid Linker to Cynomolgus Monkeys [0280] Fór pulmonary administration, aerosols of either IFNpFc homodimer or IFNpFc N297A monomer-dimer hybrid proteins (both with the 8 amino acid linker) in PBS, pH 7.4, 0.25% HSA were created with the Aeroneb Pro™ (AeroGen, Mountain View, CA) nebulizer, in-line with a Bírd Mark 7A respirator, and administered to anesthetized na'ive cynomolgus monkeys through endotracheal tubes (approximating normál tidal breathing). Blood samples were taken at various time points, and the amount of IFNp-containing protein in the resulting serum was quantitated using a humán IFNp Immunoassay (Biosource International, Camarillo, CA). Pharmacokinetic parameters were calculated using the software WinNonLin. Table 9 presents the results of cynomolgus monkeys treated with IFNpFc N297A monomer-dimer hybrid or IFNpFc homodimer.

TABLE 9: ADMINISTRATION OF IFNPFC N297A MONOMER-DIMER HYBRID AND IFNPFC HOMODIMER TO MONKEYS

<td> Protein</td><td> Monkey #</td><td> Route</td><td> Approx. Deposited Dose¹ ^g/kg)</td><td> p '“'max (ng/ml)</td><td> AUC (hr*ng/ml)</td><td>^l1/2 (hr)</td><td>^l1/2 avg (hr)</td>

<td rowspan="3"> IFNpFc N297A monomer-dimer hybrid</td><td> CO7308</td><td> púim</td><td> 20</td><td> 23.3</td><td> 987.9</td><td> 27.6</td><td rowspan="3"> 27.1</td>

<td> CO7336</td><td> púim</td><td> 20</td><td> 22.4</td><td> 970.6</td><td> 25.6</td>

<td> CO7312</td><td> púim</td><td> 20</td><td> 21.2</td><td> 1002.7</td><td> 28.0</td>

<td rowspan="2"> IFNpFc homodimer</td><td> CO7326</td><td> púim</td><td> 20</td><td> 2.6</td><td> 94.6</td><td> 11.1</td><td rowspan="2"> 11.4</td>

<td> CO7338</td><td> púim</td><td> 20</td><td> 5.0</td><td> 150.6</td><td> 11.7</td>

<td colspan="8">¹ Based on 15% deposition fraction of nebulized dose as determined by gamma scintigraphy</td>

[0281] The pharmacokinetics of IFNpFc with an 8 amino acid linker administered to cynomolgus monkeys is presented in figure 15. The figure compares the IFNpFc homodimer with the IFNpFc N297A monomer-dimer hybrid in monkeys after administration of a single pulmonary dose. Significantly higher serum levels were obtained in monkeys treated with the monomer-dimer hybrid compared to the homodimer.

[0282] Serum samples were alsó analyzed fór neopterin levels (a biomarker of IFNp activity) using a neopterin immunoassay (MP Biomedicals, Orangeburg, NY). The results fór this analysis are shown in figure 16. The figure compares neopterin stimulation in response to the IFNp-Fc homodimer and the IFNp-Fc N297A monomer-dimer hybrid. It can be seen that significantly higher neopterin levels were detected in monkeys treated with IFNp-Fc N297A monomer-dimer hybrid as compared to the IFNp-Fc homodimer.

[0283] All numbers expressing quantities of ingredients, reaetion conditions, and so forth used in the specification and claims are to be understood as being modified In all instances by the term about. Accordingly, unless indicated to the contrary, the numerical parameters setforth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and nőt as an attempt to limit the application of the doctrine of equivalents to the scope ofthe claims, each numerical paraméter should be construed in light of the number of significant digits and ordinary rounding approaches.

[0284] The specific embodiments described herein are offered by way of example only and are nőt meant to be limiting in any way.

[0285] Preferred instances of the present disclosure are described below and are referred to as instances E1-E194.

E1. A chimeric protein comprising a first and second polypeptide chain, wherein said first chain comprises a biologically active molecule, and at least a portion of an immunoglobulin constant region and wherein said second chain comprises at least a portion ofan immunoglobulin constant region without a biologically active molecule or immunoglobulin variable region.

E2. The chimeric protein of E1, wherein said second chain further comprises an affinity tag.

E3. The chimeric protein of E2, wherein the affinity tag is a FLAG tag.

E4. The chimeric protein of E1, wherein the portion of an immunoglobulin is an Fc fragment.

ΕΡ 2 361 932 Β1

Ε5. The chimeric protein of E4, wherein the portion of an immunoglobulin Is an FcRn binding partner.

E6. The chimeric protein of E5, wherein the FcRn binding partner is a peptide mimetic of an Fc fragment of an immunoglobulin.

E7. The chimeric protein of E1 or 5, wherein the immunoglobulin is IgG.

E8. The chimeric protein of E1 or 5, wherein the biologically active molecule is a polypeptide.

E9. The chimeric protein of E7, wherein the IgG is an IgG 1 or an lgG2.

E10. The chimeric protein of E1 or 5, wherein the biologically active molecule is a viral fusion inhibitor.

E11. The chimeric protein of E10, wherein the viral fusion inhibitor is an HÍV fusion inhibitor.

E12. The chimeric protein of E11, wherein the HÍV fusion inhibitor is T20 (SEQ ID NO:1), T21 (SEQ ID NO:2), or T1249 (SEQ ID NO:3).

E13. The chimeric protein of E1 or 5, wherein the biologically active molecule is a clotting factor.

E14. The chimeric protein of E13, wherein the clotting factor Is Factor VII or Vlla.

E15. The chimeric protein of E13, wherein the clotting factor is Factor IX.

E16. The chimeric protein of E1 or 5, wherein the biologically active molecule is a small molecule.

E17. The chimeric protein of E16, wherein the biologically active molecule is leuprolide.

E18. The chimeric protein of E1 or 5, wherein the biologically active molecule is interferon.

E19. The chimeric protein of E18, wherein the interferon is interferon a and has a linker of 15-25 amino acids.

E20. The chimeric protein of E19, wherein the interferon a has a linker of 15-20 amino acids.

E21. The chimeric protein of E1 or 5, wherein the biologically active molecule Is a nucleic acid.

E22. The chimeric protein of E21, wherein the nucleic acid is DNA or RNA.

E23. The chimeric protein of E21, wherein the nucleic acid is an antisense molecule.

E24. The chimeric protein of E21, wherein the nucleic acid Is a ribozyme.

E25. The chimeric protein of E1 or 5, wherein the biologically active molecule is a growth factor.

E26. The chimeric protein of E25, wherein the growth factor is erythropoietin.

E27. The chimeric protein of E16, wherein the small molecule is a VLA4 antagonist.

E28. A chimeric protein comprising a first and second polypeptide chain, wherein said first chain comprises a biologically active molecule, and at least a portion of an immunoglobulin constant region and wherein said second chain consists of at least a portion of an immunoglobulin constant region and optionally an affinity tag.

E29. The chimeric protein of E28, wherein the affinity tag is a FLAG tag.

E30. A chimeric protein comprising a first and second polypeptide chain, wherein said first chain comprises a biologically active molecule, and at least a portion of an immunoglobulin constant region and wherein said second chain consists essentially of at least a portion of an immunoglobulin constant region and

ΕΡ 2 361 932 Β1 optionally an affinity tag.

E31. The chimeric protein of E30, wherein the affinity tag is a FLAG tag.

E32. A chimeric protein comprising a first and second polypeptide chain

a) wherein said first chain comprises a biologically active molecule, at least a portion of an immunoglobulin constant region, and a first domain having at least one specific binding partner, and

b) wherein said second chain comprises at least a portion of an immunoglobulin without a biologically active molecule or immunoglobulin variable region and further comprising a second domain said second domain being a specific binding partner of said first domain.

E33. The chimeric protein of E32, wherein said second chain further comprises an affinity tag.

E34. The chimeric protein of E33, wherein the affinity tag is a FLAG tag.

E35. The chimeric protein of E32, wherein the portion of an immunoglobulin is an Fc fragment.

E36. The chimeric protein of E32 or 35, wherein the immunoglobulin is IgG.

E37. The chimeric protein of E35, wherein the portion of an immunoglobulin is an FcRn binding partner.

E38. The chimeric protein of E37, wherein the FcRn binding partner Is a peptide mimetic of an Fc fragment of an immunoglobulin.

E39. The chimeric protein of E32 or 37, wherein the first domain binds with the second domain non-covalently.

E40. The chimeric protein of E32 or 37, wherein the first domain is one half of a leucine zipper coiled coil and said second domain is the complementary binding partner of said leucine zipper coiled coil.

E41. The chimeric protein of E32 or 37, wherein the biologically active molecule is a peptide.

E42. The chimeric protein of E32 or 37, wherein the biologically active molecule is interferon.

E43. The chimeric protein of E42, wherein the interferon is interferon α and has a linker of 15-25 amino acids.

E44. The chimeric protein of E43, wherein the interferon α has a linker of 15-20 amino acids.

E45. The chimeric protein of E41, wherein the biologically active molecule is leuprolide.

E46. The chimeric protein of E32 or 37, wherein the biologically active molecule is a viral fusion inhibitor.

E47. The chimeric protein of E46, wherein the viral fusion inhibitor is an HÍV fusion inhibitor.

E48. The chimeric protein of E47, wherein the HÍV fusion inhibitor is T20 (SEQ ID NO:1), or T21 (SEQ ID NO:2), orT1249 (SEQ ID NO:3).

E49. The chimeric protein of E32 or 37, wherein the biologically active molecule is a clotting factor.

E50. The chimeric protein of E49, wherein the clotting factor is Factor VII or Factor Vlla.

E51. The chimeric protein of E49, wherein the clotting factor is Factor IX.

E52. The chimeric protein of E32 or 37, wherein the biologically active molecule is a small molecule.

E53. The chimeric protein of E52, wherein the small molecule is a VLA4 antagonist.

E54. The chimeric protein of E32 or 37, wherein the biologically active molecule comprises a nucleic acid.

ΕΡ 2 361 932 Β1

Ε55. The chimeric protein of E54, wherein the nucleic acid is DNA or RNA.

E56. The chimeric protein of E54, wherein the nucleic acid is an antisense nucleic acid.

E57. The chimeric protein of E54, wherein the nucleic acid is a ribozyme.

E58. The chimeric protein of E32 or 37, wherein the biologically active molecule is a growth factor or hormoné.

E59. The chimeric protein of E58, wherein the growth factor is erythropoietin.

E60. A pharmaceutical composition comprising the chimeric protein of E1, 5, 32, or 37 and a pharmaceutically acceptable excipient.

E61. A chimeric protein comprising a first and second polypeptide chain

a) wherein said first chain comprises a biologically active molecule, at least a portion of an immunoglobulin constant region, and a first domain having at least one specific binding partner; and

b) wherein said second chain consists of at least a portion of an immunoglobulin, a second domain said second domain being a specific binding partner ofsaid first domain and optionally an affinity tag.

E62. The chimeric protein of E61, wherein the affinity tag is a FLAG tag.

E63. A chimeric protein comprising a first and second polypeptide chain

a) wherein said first chain comprises a biologically active molecule, at least a portion of an immunoglobulin constant region, and a first domain having at least one specific binding partner; and

b) wherein said second chain consists essentially of at least a portion of an immunoglobulin, and a second domain said second domain being a specific binding partner of said first domain and optionally an affinity tag.

E64. The chimeric protein of E63, wherein the affinity tag is a FLAG tag.

E65. A method of making a biologically active chimeric protein comprising:

a) transfecting a first cell with a first DNA construct comprising a DNA molecule encoding a polypeptide comprising a biologically active molecule operatively linked to a second DNA molecule encoding at least a portion ofan immunoglobulin constant region;

b) transfecting a second cell with a second DNA construct comprising a DNA molecule encoding a polypeptide comprising at least a portion of an immunoglobulin constant region without a biologically active molecule or variable region ofan immunoglobulin);

c) culturing the cell of a) and b) under conditions such that the polypeptide encoded by said first DNA construct and said second DNA construct is expressed; and

d) isolating dimers of a) and b) from said transfected cell.

E66. The method of E65, wherein said portion of an immunoglobulin constant region is an FcRn binding partner.

E67. The method of E65 or 66, wherein the biologically active molecule is a polypeptide.

E68. The method of E65 or 66, wherein the biologically active molecule Is interferon.

E69. The method of E68, wherein the interferon is interferon α and has a linker of 15-25 amino acids.

E70. The method of E69, wherein the interferon α has a linker of 15-20 amino acids.

E71. The method of E65 or 66, wherein the biologically active molecule is a peptide.

E72. The method of E65 or 66, wherein the biologically active molecule is a viral fusion inhibitor.

E73. The method of E72, wherein the viral fusion inhibitor is an HÍV viral fusion inhibitor.

ΕΡ 2 361 932 Β1

Ε74. The method of E73, wherein the HÍV viral fusion inhibitor is T20 (SEQ ID NO:1), T21 (SEQ ID NO:2), T1249 (SEQ ID NO:3).

E75. The method of E65 or 66, wherein the biologically active molecule comprises a clotting factor.

E76. The method of E75, wherein the clotting factor is Factor VII or Factor Vlla.

E77. The method of E75, wherein the clotting factor is a Factor IX.

E78. The method of E65 or 66 wherein the biologically active molecule is a small molecule.

E79. The method of E65 or 66, wherein the biologically active molecule comprises a nucleic acid.

E80. The method of E79, wherein the nucleic acid is DNA or RNA.

E81. The method of E79, wherein the nucleic acid is an antisense molecule.

E82. The method of E79, wherein the nucleic acid is a ribozyme.

E83. The method of E65 or 66, wherein the biologically active molecule comprises a growth factor or hormoné.

E84. The method of E83, wherein the growth factor is erythropoietin.

E85. The method of E65 or 66, wherein the dimers are isolated by chromatography.

E86. The method of E65 or 66, wherein the cell is a eukaryotic cell.

E87. The method of E86, wherein the eukaryotic cell is a CHO cell.

E88. The method of E65 or 66, wherein the cell is a prokaryotic cell.

E89. The method of E88, wherein the prokaryotic cell is E. coli.

E90. A method of treating a subject with a disease or condition comprising administering a chimeric protein to the subject, such that said disease or condition is treated, wherein said chimeric protein comprises a first and second polypeptide chain,

a) said first chain comprising an FcRn binding partner, and a biologically active molecule and

b) said second chain comprising an FcRn binding partner without a biologically active molecule or a variable region of an immunoglobulin.

E91. The method of E90, wherein said chimeric protein is administered intravenously, subcutaneously, orally, buccally, sublingually, nasally, parenterally, rectally, vaginally or via a pulmonary route.

E92. The method of E90, wherein said disease or condition is a viral infection.

E93. The method of E90, wherein the biologically active molecule is Interferon.

E94. The method of E93, wherein the interferon is interferon α and has a linker of 15-25 amino acids.

E95. The method of E94, wherein the interferon α has a linker of 15-20 amino acids.

E96. The method of E90, wherein said disease or condition is HÍV.

E97. The method of E90, wherein said biologically active molecule is a viral fusion inhibitor.

E98. The method of E97, wherein said viral fusion inhibitor is T20, T21, or T1249.

ΕΡ 2 361 932 Β1

Ε99. The method of E90, wherein said disease or condition is a hemostatic disorder.

E100. The method of E90, wherein said disease or condition is hemophilia A.

E101. The method of E90, wherein said disease or condition is hemophilia B.

E102. The method of E90, wherein said biologically active molecule is Factor VII or Factor Vlla.

E103. The method of E90, wherein said biologically active molecule is Factor IX.

E104. The method of E90, wherein said disease or condition is anémia.

E105. The method of E90, wherein said biologically active molecule is erythropoietin.

E106. A chimeric protein of the formula

X-L_a-F:F or

F:F-L_a-X wherein X is a biologically active molecule, L is a linker, F is at least a portion of an immunoglobulin constant region and, a is any integer or zero.

E107. The chimeric protein of E106, wherein F is an FcRn binding partner.

E108. The chimeric protein of E106, wherein the FcRn is a peptide mimeticof an Fcfragment ofan immunoglobulin.

E109. The chimeric protein of E106 or 107, wherein each F is chemically associated with the other F.

E110. The method of E109, wherein the Chemical association is a noncovalent interaction.

E111. The method of E109, wherein the Chemical bond is a covalent bond.

E112. The method of E109, wherein the Chemical bond is a disulfide bond.

E113. The chimeric protein of E106, or 107, wherein F is linked to F by a bond that is nőt a disulfide bond.

E114. The chimeric protein of E106, wherein F is an IgG immunoglobulin constant region.

E115. The chimeric protein of E106, wherein F is an lgG1.

E116. The chimeric protein of E106, wherein F is an Fc fragment.

E117. The chimeric protein of E106, wherein X Is a polypeptide.

E118. The chimeric protein of E106, wherein X is leuprolide.

E119. The chimeric protein of E106, wherein X is a small molecule.

E120. The chimeric protein of E119, wherein the small molecule is a VLA4 antagonist.

E121. The chimeric protein of E106, wherein X is a viral fusion inhibitor.

E122. The chimeric protein of E121, wherein the viral fusion inhibitor is an HÍV fusion inhibitor.

E123. The chimeric protein of E122, wherein the HÍV fusion inhibitor is T20 (SEQ ID NO:1), orT21 (SEQ ID NO:2),

ΕΡ 2 361 932 Β1 orT1249 (SEQ ID ΝΟ:3).

Ε124. The chimeric protein of E106 or 107, wherein X is a clotting Factor.

E125. The chimeric protein of E124, wherein the clotting factor is Factor VII or VIla.

E126. The chimeric protein of E124, wherein the clotting factor is Factor IX.

E127. The chimeric protein of E106 or 107, wherein X is a nucleic acid.

E128. The chimeric protein of E127, wherein the nucleic acid is a DNA or an RNA molecule.

E129. The chimeric protein of E106 or 107, wherein X is a growth factor.

E130. The chimeric protein of E129, wherein the growth factor is erythropoietin.

E131. A method of treating a disease or condition In a subject comprising administering the chimeric protein of E1, 5, 32, 37, 106, or 107 to said subject.

E132. The method of E131, wherein the disease or condition is a viral infection.

E133. The method of E131, wherein the biologically active molecule is interferon.

E134. The method of E133, wherein the interferon is interferon α and has a linker of 15-25 amino acids.

E135. The method of E134, wherein the interferon α has a linker of 15-20 amino acids.

E136. The method of E132, wherein the viral infection is HÍV.

E137. The method of E131, wherein the disease or condition is a bleeding disorder.

E138. The method of E137, wherein the bleeding disorder is hemophilia A.

E139. The method of E137, wherein the bleeding disorder is hemophilia B.

E140. The method of E131, wherein the disease or condition is anémia.

E141. The method of E131, wherein the chimeric protein is administered intravenously, intramuscularly, subcutaneously, orally, buccally, sublingually, nasally, rectally, vaginally, via an aerosol, or via a pulmonary route.

E142. The method of E141, wherein the chimeric protein is administered via a pulmonary route.

E143. The method of E141, wherein the chimeric protein is administered orally.

E144. The method of E131, wherein the immunoglobulin is IgG.

E145. The method of E131, wherein the portion of an immunoglobulin is an Fc fragment.

E146. A chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region without the biologically active molecule ofthe first chain and wherein said second chain is nőt covalently bonded to any molecule having a molecular weight greater than 2 kD.

E147. The chimeric protein of E146, wherein the portion of an immunoglobulin constant region is an FcRn binding partner.

E148. A chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain

ΕΡ 2 361 932 Β1 comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region nőt covalently linked to any other molecule except the portion of an immunoglobulin of said first polypeptide chain.

E149. The chimeric protein of E148, wherein the portion of an immunoglobulin constant region Is an FcRn binding partner.

E150. A chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain consists of at least a portion of an immunoglobulin constant region.

E151. The chimeric protein of E150, wherein the portion of an immunoglobulin constant region is an FcRn binding partner.

E152. A chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region without the biologically active molecule of the first chain and a molecule with a molecular weight less than 2 kD covalently attached.

E153. The chimeric protein of E152, wherein the portion of an immunoglobulin constant region is an FcRn binding partner.

E154. A method of making a chimeric protein comprising an Fcfragment of an immunoglobulin linked to a biologically active molecule, said method comprising

a) transfecting a cell with a DNA construct comprising a DNA sequence encoding an Fc fragment of an immunoglobulin and a second DNA sequence encoding intein;

b) culturing said cell under conditions such that the Fc fragment and intein is expressed;

c) isolating said Fc fragment and intein from said cell;

d) chemically synthesizing a biologically active molecule having an N terminál Cys;

e) reacting the isolated intein Fc of c) with MESNA to generate a C terminál thio-ester;

f) reacting the biologically active molecule of d) with the Fc of e) to make a chimeric protein comprising an Fc linked to a biologically active molecule.

E155. A method of making a chimeric protein comprising an Fcfragment ofan immunoglobulin linked to a biologically active molecule, said method comprising

a) transfecting a cell with a DNA construct comprising a DNA sequence encoding an Fc fragment of an immunoglobulin and a second DNA sequence encoding a signal peptide wherein said signal peptide is adjacent to an Fc fragment cysteine;

b) culturing said cell under conditions such that the Fc fragment and signal peptide is expressed and the Fc fragment is secreted from the cell without the signal peptide and with a N terminál cysteine;

c) Isolating dimers of said Fc fragment with an N terminál cysteine from said cell;

d) chemically synthesizing a biologically active molecule having a thioester;

e) reacting the biologically active molecule of d) with the Fc of c) under conditions such that the biologically active molecule can link to one chain of the dimer of c) to make a chimeric protein comprising an Fc linked to a biologically active molecule.

E156. The method of E155, wherein the thioester is a C terminál thioester.

E157. A method of making a chimeric protein comprising an Fcfragment ofan immunoglobulin linked to a biologically active molecule, said method comprising

a) transfecting a cell with a DNA construct comprising a DNA sequence encoding an Fc fragment of an immunoglobulin and a second DNA sequence encoding a signal peptide wherein said signal peptide is adjacent to an Fc fragment cysteine;

b) culturing said cell under conditions such thatthe Fcfragment and signal peptide are expressed linked together and said signal peptide is cleaved from the Fc fragment by the cell at a first position adjacent to a cysteine or

ΕΡ 2 361 932 Β1 a second position adjacent to a valine;

c) Isolating dimers ofsaid Fc fragments with two N terminál cysteines or two N terminál valines or an N terminál cysteine and an N terminál valine from said cell;

d) chemically synthesizing a biologically active molecule having a thioester;

e) reacting the biologically active molecule of d) with the dimers of c) to make a chimeric protein comprising a first chain comprising an Fc linked to a biologically active molecule and a second chain comprising an Fc nőt linked to any biologically active molecule or a variable region of an immunoglobulin.

E158. The method of E157, wherein the thioester is a C terminál thioester.

E159. The chimeric protein of E20, wherein the linker is (GGGGS)₃.

E160. A method of isolating a monomer-dimer hybrid from a mixture, where the mixture comprises,

a) the monomer-dimer hybrid comprising a first and second polypeptide chain, wherein the first chain comprises a biologically active molecule, and at least a portion of an immunoglobulin constant region and wherein the second chain comprises at least a portion ofan immunoglobulin constant region without a biologically active molecule or immunoglobulin variable region;

b) a dimer comprising a first and second polypeptide chain, wherein the first and second chains both comprise a biologically active molecule, and at least a portion of an immunoglobulin constant region;

c) a portion ofan immunoglobulin constant region; said method comprising

1) contacting the mixture with a dye ligand linked to a solid support under suitable conditions such that both the monomer-dimer hybrid and the dimer bind to the dye ligand;

2) removing the unbound portion ofan immunoglobulin constant region;

3) altering the suitable conditions of 1) such that the binding between the monomer-dimer hybrid and the dye ligand linked to the solid support is disrupted;

4) isolating the monomer-dimer hybrid.

E161. The method of E160, wherein the portion of an immunoglobulin is an Fc fragment

E162. The method of E160, wherein the dye ligand is a bio-mimetic molecule.

E163. The method of E160, wherein the dye ligand is chosen from Mimetic Red 1™, Mimetic Red 2™, Mimetic Orange 1™, Mimetic Orange 2™, Mimetic Orange 3™, Mimetic Yellow 1™, Mimetic Yellow 2™, Mimetic Green 1 ™, Mimetic Blue 1 ™, and Mimetic Blue 2™.

E164. The method of E160, wherein the chimeric protein comprises Epo. E165. The method of E163 or 164, wherein the dye ligand is Mimetic Red 2™.

E166. The method of E160, wherein the chimeric protein comprises Factor VII orVlla.

E167. The method of E160, wherein the chimeric protein comprises Factor IX.

E168. The method of E160, wherein the chimeric protein comprises interferon.

E169. The method of E160, wherein the chimeric protein comprises an HÍV fusion inhibitor.

E170. The method of E163 or 167, wherein the dye ligand is Mimetic Green 1 ™.

E171. The method of E160, wherein the suitable conditions comprises a buffer having a pH in the rangé of 4-9 inclusive.

E172. The method of E171, wherein altering the suitable conditions comprises adding at least one salt to the buffer at a concentration sufficient to disrupt the binding ofthe monomer-dimer hybrid to the dye ligand thereby isolating the monomer-dimer hybrid.

E173. The method of E172, wherein the at least one salt is NaCI.

EP 2 361 932 Β1

E174. The method of E171, wherein the buffer has a pH of 8.

E175. The method of E174, wherein the salt concentration is 400 mM and the chimeric protein comprises Epo.

E176. The method of E172, further comprising adding a higher concentration of salt compared to the concentration of salt which disrupts the binding of the monomer-dimer hybrid to the dye ligand such that the higher concentration of salt disrupts the binding of the dimer to the dye ligand thereby isolating the dimer.

E177. The chimeric protein of E18, wherein the biologically active molecule is interferon a.

E178. The chimeric protein of E18, wherein the biologically active molecule is interferon β.

E179. The chimeric protein of E42, wherein the biologically active molecule is interferon a.

E180. The chimeric protein of E42, wherein the biologically active molecule is interferon β.

E181. The method of E68, wherein the biologically active molecule is interferon a.

E182. The method of E68, wherein the biologically active molecule is interferon β.

E183. The method of E93, wherein the biologically active molecule is interferon a.

E184. The method of E93, wherein the biologically active molecule is interferon β.

E185. The method of E133, wherein the biologically active molecule is interferon a.

E186. The method of E133, wherein the biologically active molecule is interferon β.

E187. The method of E168, wherein the chimeric protein comprises interferon a.

E188. The method of E168, wherein the chimeric protein comprises interferon β.

E189. A chimeric protein comprising a first and second polypeptide chain, wherein said first chain comprises EPO, an eight amino acid linker having the amino acid sequence EFAGAAAV, and an Fc fragment of an immunoglobulin constant region comprising a mutation of aspargine to alanine at position 297; and wherein said second chain comprises an Fc fragment of an immunoglobulin constant region comprising a mutation of aspargine to alanine at position 297.

E190. The chimeric protein of E189, further comprising an affinity tag.

E191. A chimeric protein comprising a first and second polypeptide chain, wherein said first chain comprises ΙΡΝβ, an eight amino acid linker having the amino acid sequence EFAGAAAV, and an Fc fragment of an immunoglobulin constant region comprising a mutation of aspargine to alanine at position 297; and wherein said second chain comprises an Fc fragment of an immunoglobulin constant region comprising a mutation of aspargine to alanine at position 297.

E192. The chimeric protein of E191, further comprising an affinity tag.

E193. A chimeric protein comprising a first and second polypeptide chain, wherein said first chain comprises factor IX, an eight amino acid linker having the amino acid sequence EFAGAAAV, and an Fc fragment of an immunoglobulin constant region comprising a mutation of aspargine to alanine at position 297; and wherein said second chain comprises an Fc fragment of an immunoglobulin constant region comprising a mutation of aspargine to alanine at position 297.

E194. The chimeric protein of E193, further comprising an affinity tag.

ΕΡ 2 361 932 Β1

SEQUENCE LISTING [0286] &lt;110&gt; SYNTONIX PHARMACEUTICALS, INC.

&lt;120&gt; IMMUNOGLOBULIN CHIMERIC MONOMER-DIMER HYBRIDS &lt;130&gt; 08945.0007-00304 &lt;140&gt; PCT/US04/14064 &lt;141 &gt; 2004-05-06 &lt;150&gt; 60/539,207 &lt;151&gt; 2004-01-26 &lt;150&gt; 60/487,964 &lt;151&gt; 2003-07-17 &lt;150&gt; 60/469,600 &lt;151&gt; 2003-05-06 &lt;160&gt; 107 &lt;170&gt; Patentln Ver. 3.3 &lt;210&gt; 1 &lt;211&gt; 36 &lt;212&gt; PRT &lt;213&gt; Humán immunodeficiency vírus &lt;400&gt; 1

<td> Tyr 1</td><td> Thr</td><td> Ser</td><td> Leu</td><td> Ile 5</td><td> His</td><td> Ser</td><td> Leu</td><td> Ile</td><td> Glu 10</td><td> Glu</td><td> Ser</td><td> Gin</td><td> Asn</td><td> Gin 15</td><td> Gin</td>

<td> Glu</td><td> Lys</td><td> Asn</td><td> Glu 20</td><td> Gin</td><td> Glu</td><td> Leu</td><td> Leu</td><td> Glu 25</td><td> Leu</td><td> Asp</td><td> Lys</td><td> Trp</td><td> Ala 30</td><td> Ser</td><td> Leu</td>

<td> Trp</td><td> Asn</td><td> Trp</td><td> Phe</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

&lt;210&gt; 2 &lt;211&gt; 37 &lt;212&gt; PRT &lt;213&gt; Humán immunodeficiency vírus &lt;400&gt; 2

<td> Asn 1</td><td> Asn</td><td> Leu</td><td> Arg</td><td> Ala 5</td><td> Ile</td><td> Glu</td><td> Ala</td><td> Gin</td><td> Gin 10</td><td> His</td><td> Leu</td><td> Leu</td><td> Gin</td><td> Leu 15</td><td> Thr</td>

<td> Val</td><td> Trp</td><td> Gly</td><td> Ile 20</td><td> Lys</td><td> Gin</td><td> Leu</td><td> Gin</td><td> Ala 25</td><td> Arg</td><td> Ile</td><td> Leu</td><td> Ala</td><td> Val 30</td><td> Glu</td><td> Arg</td>

<td> Tyr</td><td> Leu</td><td> Lys</td><td> Asp</td><td> Gin</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

ΕΡ 2 361 932 Β1 &lt;210&gt; 3 &lt;211&gt; 39 &lt;212&gt; PRT &lt;213&gt; Humán immunodeficiency vírus &lt;400&gt;3

<td> Trp 1</td><td> Gin</td><td> Glu</td><td> Trp</td><td> Glu Gin Lys 5</td><td> Ile</td><td> Thr Alá 10</td><td> Leu</td><td> Leu</td><td> Glu</td><td> Gin</td><td> Alá 15</td><td> Gin</td>

<td> Ile</td><td> Gin</td><td> Gin</td><td> Glu</td><td> Lys Asn Glu</td><td> Tyr</td><td> Glu Leu</td><td> Gin</td><td> Lys</td><td> Leu</td><td> Asp</td><td> Lys</td><td> Trp</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td> Alá</td><td> Ser</td><td> Leu</td><td> Trp</td><td> Glu Trp Phe</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

&lt;210&gt; 4 &lt;211&gt; 238 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt;4

ΕΡ 2 361 932 Β1

<td rowspan="2"> Met 1</td><td rowspan="2"> Gly</td><td colspan="10"> Ile Glu Gly Arg Gly Alá Alá Alá Val Asp</td><td rowspan="2"> Thr</td><td rowspan="2"> Ser</td><td rowspan="2"> His 15</td><td rowspan="2"> Thr</td>

<td colspan="4"> 5</td><td colspan="6"> 10</td>

<td> Cys</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Alá</td><td> Pro</td><td> Glu</td><td> Leu</td><td> Leu</td><td> Gly</td><td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys</td><td> Pro</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu</td><td> Met</td><td> Ile</td><td> Ser</td><td> Arg</td><td> Thr</td><td> Pro</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td> Glu</td><td> Val</td><td> Thr</td><td> Cys</td><td> Val</td><td> Val</td><td> Val</td><td> Asp</td><td> Val</td><td> Ser</td><td> His</td><td> Glu</td><td> Asp</td><td> Pro</td><td> Glu</td><td> Val</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td> Lys</td><td> Phe</td><td> Asn</td><td> Trp</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td><td> Val</td><td> Glu</td><td> Val</td><td> His</td><td> Asn</td><td> Alá</td><td> Lys</td><td> Thr</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td> Lys</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin</td><td> Tyr</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr</td><td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td> Leu</td><td> Thr</td><td> Val</td><td> Leu</td><td> His</td><td> Gin</td><td> Asp</td><td> Trp</td><td> Leu</td><td> Asn</td><td> Gly</td><td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> Cys</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Lys</td><td> Alá</td><td> Leu</td><td> Pro</td><td> Alá</td><td> Pro</td><td> Ile</td><td> Glu</td><td> Lys</td><td> Thr</td><td> Ile</td><td> Ser</td>

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

<td> Lys</td><td> Alá</td><td> Lys</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> Gin</td><td> Val</td><td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro</td><td> Pro</td>

<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>

<td> Ser</td><td> Arg</td><td> Asp</td><td> Glu</td><td> Leu</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td>

<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td>

<td> Lys</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td><td> Ile</td><td> Alá</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td><td> Gly</td>

<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td>

<td> Gin</td><td> Pro</td><td> Glu</td><td> Asn</td><td> Asn</td><td> Tyr</td><td> Lys</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Pro</td><td> Val</td><td> Leu</td><td> Asp</td><td> Ser</td><td> Asp</td>

<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td>

<td> Gly</td><td> Ser</td><td> Phe</td><td> Phe</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Lys</td><td> Leu</td><td> Thr</td><td> Val</td><td> Asp</td><td> Lys</td><td> Ser</td><td> Arg</td><td> Trp</td>

<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

<td> Gin</td><td> Gin</td><td> Gly</td><td> Asn</td><td> Val</td><td> Phe</td><td> Ser</td><td> Cys</td><td> Ser</td><td> Val</td><td> Met</td><td> His</td><td> Glu</td><td> Alá</td><td> Leu</td><td> His</td>

<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>

<td> Asn</td><td> His</td><td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Phe</td><td></td><td></td>

225 230 235 &lt;210&gt; 5 &lt;211&gt; 714 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 5

ΕΡ 2 361 932 Β1 atgggcattg ccagcacctg accctcatga gaccctgagg aagccgcggg caccaggact gcccccatcg accctgcccc aaaggettet aactacaaga ctcaccgtgg gaggetetge aaggcagagg aactcctggg tctcccggac tcaagttcaa aggagcagta ggctgaatgg agaaaaccat catcccggga atcccagcga ccacgcctcc acaagagcag acaaccacta cgccgctgcg gggaccgtca ccctgaggtc ctggtacgtg caacagcacg caaggagtac ctccaaagcc tgagctgacc catcgccgtg cgtgttggac gtggcagcag cacgcagaag gtegataeta gtcttcctct acatgcgtgg gacggcgtgg taccgtgtgg aagtgcaagg aaagggcagc aagaaccagg gagtgggaga tccgacggct gggaacgtct agtctctccc gtcacacatg tccccccaaa tggtggacgt aggtgcataa tcagcgtcct tctccaacaa cccgagaacc tcagcctgac gcaatgggca ccttcttcct tctcatgctc tgtctccggg cccaccgtgc acccaaggac gagccacgaa tgccaagaca caccgtcctg agccctccca acaggtgtac ctgcctggtc gccggagaac ctacagcaag cgtgatgcat tttt &lt;210&gt;6 &lt;211&gt; 671 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt;6

<td> Met 1</td><td> Val</td><td> Ser</td><td> Gin</td><td> Alá 5</td><td> Leu</td><td> Arg</td>

<td> Gly</td><td> Cys</td><td> Leu</td><td> Alá 20</td><td> Alá</td><td> Val</td><td> Phe</td>

<td> Leu</td><td> His</td><td> Arg 35</td><td> Arg</td><td> Arg</td><td> Arg</td><td> Alá</td>

<td> Gly</td><td> Ser 50</td><td> Leu</td><td> Glu</td><td> Arg</td><td> Glu</td><td> Cys 55</td>

<td> Alá 65</td><td> Arg</td><td> Glu</td><td> Ile</td><td> Phe</td><td> Lys 70</td><td> Asp</td>

Leu Leu Cys Leu Leu Leu Gly Leu Gin 10 15

Val Thr Gin Glu Glu Alá His Gly Val 25 30

Asn Alá Phe Leu Glu Glu Leu Arg Pro 40 45

Lys Glu Glu Gin Cys Ser Phe Glu Glu 60

Alá Glu Arg Thr Lys Leu Phe Trp Ile 75 80

ΕΡ 2 361 932 Β1

<td rowspan="2"> Ser</td><td rowspan="2"> Tyr</td><td rowspan="2"> Ser Asp Gly 85</td><td rowspan="2"> Asp</td><td rowspan="2"> Gin Cys</td><td rowspan="2"> Alá</td><td colspan="2"> Ser Ser Pro Cys Gin Asn G</td>

<td> 90</td><td> 95</td>

<td> Gly</td><td> Ser</td><td> Cys Lys Asp 100</td><td> Gin</td><td> Leu Gin</td><td> Ser 105</td><td> Tyr</td><td> Ile Cys Phe Cys Leu Pro 110</td>

<td> Alá</td><td> Phe</td><td> Glu Gly Arg 115</td><td> Asn</td><td> Cys Glu 120</td><td> Thr</td><td> His</td><td> Lys Asp Asp Gin Leu Ile 125</td>

<td> Cys</td><td> Val 130</td><td> Asn Glu Asn</td><td> Gly</td><td> Gly Cys 135</td><td> Glu</td><td> Gin</td><td> Tyr Cys Ser Asp His Thr 140</td>

<td> Gly 145</td><td> Thr</td><td> Lys Arg Ser</td><td> Cys 150</td><td> Arg Cys</td><td> His</td><td> Glu</td><td> Gly Tyr Ser Leu Leu Alá 155 160</td>

<td> Asp</td><td> Gly</td><td> Val Ser Cys 165</td><td> Thr</td><td> Pro Thr</td><td> Val</td><td> Glu 170</td><td> Tyr Pro Cys Gly Lys Ile 175</td>

<td> Pro</td><td> Ile</td><td> Leu Glu Lys 180</td><td> Arg</td><td> Asn Alá</td><td> Ser 185</td><td> Lys</td><td> Pro Gin Gly Arg Ile Val 190</td>

<td> Gly</td><td> Gly</td><td> Lys Val Cys 195</td><td> Pro</td><td> Lys Gly 200</td><td> Glu</td><td> Cys</td><td> Pro Trp Gin Val Leu Leu 205</td>

<td> Leu</td><td> Val 210</td><td> Asn Gly Alá</td><td> Gin</td><td> Leu Cys 215</td><td> Gly</td><td> Gly</td><td> Thr Leu Ile Asn Thr Ile 220</td>

<td> Trp 225</td><td> Val</td><td> Val Ser Alá</td><td> Alá 230</td><td> His Cys</td><td> Phe</td><td> Asp</td><td> Lys Ile Lys Asn Trp Arg 235 240</td>

<td> Asn</td><td> Leu</td><td> Ile Alá Val 245</td><td> Leu</td><td> Gly Glu</td><td> His</td><td> Asp 250</td><td> Leu Ser Glu His Asp Gly 255</td>

<td> Asp</td><td> Glu</td><td> Gin Ser Arg 260</td><td> Arg</td><td> Val Alá</td><td> Gin 265</td><td> Val</td><td> Ile Ile Pro Ser Thr Tyr 270</td>

<td> Val</td><td> Pro</td><td> Gly Thr Thr 275</td><td> Asn</td><td> His Asp 280</td><td> Ile</td><td> Alá</td><td> Leu Leu Arg Leu His Gin 285</td>

<td> Pro</td><td> Val 290</td><td> Val Leu Thr</td><td> Asp</td><td> His Val 295</td><td> Val</td><td> Pro</td><td> Leu Cys Leu Pro Glu Arg 300</td>

<td> Thr 305</td><td> Phe</td><td> Ser Glu Arg</td><td> Thr 310</td><td> Leu Alá</td><td> Phe</td><td> Val</td><td> Arg Phe Ser Leu Val Ser 315 320</td>

<td> Gly</td><td> Trp</td><td> Gly Gin Leu 325</td><td> Leu</td><td> Asp Arg</td><td> Gly</td><td> Alá 330</td><td> Thr Alá Leu Glu Leu Met 335</td>

<td> Val</td><td> Leu</td><td> Asn Val Pro 340</td><td> Arg</td><td> Leu Met</td><td> Thr 345</td><td> Gin</td><td> Asp Cys Leu Gin Gin Ser 350</td>

<td> Arg</td><td> Lys</td><td> Val Gly Asp 355</td><td> Ser</td><td> Pro Asn 360</td><td> Ile</td><td> Thr</td><td> Glu Tyr Met Phe Cys Alá 365</td>

<td> Gly</td><td> Tyr 370</td><td> Ser Asp Gly</td><td> Ser</td><td> Lys Asp 375</td><td> Ser</td><td> Cys</td><td> Lys Gly Asp Ser Gly Gly 380</td>

<td> Pro 385</td><td> His</td><td> Alá Thr His</td><td> Tyr 390</td><td> Arg Gly</td><td> Thr</td><td> Trp</td><td> Tyr Leu Thr Gly Ile Val 395 400</td>

ΕΡ 2 361 932 Β1

<td rowspan="2"> Ser</td><td rowspan="2"> Trp Gly Gin</td><td rowspan="2"> Gly 405</td><td rowspan="2"> Cys Ala</td><td rowspan="2"> Thr Val</td><td colspan="2"> Gly His Phe Gly Val Tyr T</td>

<td> 410</td><td> 415</td>

<td> Arg</td><td> Val Ser Gin 420</td><td> Tyr</td><td> Ile Glu</td><td> Trp Leu 425</td><td> Gin Lys Leu</td><td> Met Arg Ser Glu 430</td>

<td> Pro</td><td> Arg Pro Gly 435</td><td> Val</td><td> Leu Leu</td><td> Arg Ala 440</td><td> Pro Phe Pro</td><td> Asp Lys Thr His 445</td>

<td> Thr</td><td> Cys Pro Pro 450</td><td> Cys</td><td> Pro Ala 455</td><td> Pro Glu</td><td> Leu Leu Gly 460</td><td> Gly Pro Ser Val</td>

<td> Phe 465</td><td> Leu Phe Pro</td><td> Pro</td><td> Lys Pro 470</td><td> Lys Asp</td><td> Thr Leu Met 475</td><td> Ile Ser Arg Thr 480</td>

<td> Pro</td><td> Glu Val Thr</td><td> Cys 485</td><td> Val Val</td><td> Val Asp</td><td> Val Ser His 490</td><td> Glu Asp Pro Glu 495</td>

<td> Val</td><td> Lys Phe Asn 500</td><td> Trp</td><td> Tyr Val</td><td> Asp Gly 505</td><td> Val Glu Val</td><td> His Asn Ala Lys 510</td>

<td> Thr</td><td> Lys Pro Arg 515</td><td> Glu</td><td> Glu Gin</td><td> Tyr Asn 520</td><td> Ser Thr Tyr</td><td> Arg Val Val Ser 525</td>

<td> Val</td><td> Leu Thr Val 530</td><td> Leu</td><td> His Gin 535</td><td> Asp Trp</td><td> Leu Asn Gly 540</td><td> Lys Glu Tyr Lys</td>

<td> Cys 545</td><td> Lys Val Ser</td><td> Asn</td><td> Lys Ala 550</td><td> Leu Pro</td><td> Ala Pro Ile 555</td><td> Glu Lys Thr Ile 560</td>

<td> Ser</td><td> Lys Ala Lys</td><td> Gly 565</td><td> Gin Pro</td><td> Arg Glu</td><td> Pro Gin Val 570</td><td> Tyr Thr Leu Pro 575</td>

<td> Pro</td><td> Ser Arg Asp 580</td><td> Glu</td><td> Leu Thr</td><td> Lys Asn 585</td><td> Gin Val Ser</td><td> Leu Thr Cys Leu 590</td>

<td> Val</td><td> Lys Gly Phe 595</td><td> Tyr</td><td> Pro Ser</td><td> Asp Ile 600</td><td> Ala Val Glu</td><td> Trp Glu Ser Asn 605</td>

<td> Gly</td><td> Gin Pro Glu 610</td><td> Asn</td><td> Asn Tyr 615</td><td> Lys Thr</td><td> Thr Pro Pro 620</td><td> Val Leu Asp Ser</td>

<td> Asp 625</td><td> Gly Ser Phe</td><td> Phe</td><td> Leu Tyr 630</td><td> Ser Lys</td><td> Leu Thr Val 635</td><td> Asp Lys Ser Arg 640</td>

<td> Trp</td><td> Gin Gin Gly</td><td> Asn 645</td><td> Val Phe</td><td> Ser Cys</td><td> Ser Val Met 650</td><td> His Glu Ala Leu 655</td>

<td> His</td><td> Asn His Tyr 660</td><td> Thr</td><td> Gin Lys</td><td> Ser Leu 665</td><td> Ser Leu Ser</td><td> Pro Gly Lys 670</td>

&lt;210&gt;7 &lt;211&gt; 2016 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 7

ΕΡ 2 361 932 Β1 atggtctccc aggccctcag gctcctctgc cttctgcttg ggcttcaggg ctgcctggct 60 gcagtcttcg taacccagga ggaagcccac ggcgtcctgc accggcgccg gcgcgccaac 120 gcgttcctgg aggagctgcg gccgggctcc ctggagaggg agtgcaagga ggagcagtgc 180 tccttcgagg aggcccggga gatcttcaag gacgcggaga ggacgaagct gttctggatt 240 tcttacagtg atggggacca gtgtgcctca agtccatgcc agaatggggg ctcctgcaag 300 gaccagctcc agtcctatat ctgcttctgc ctccctgcct tcgagggccg gaactgtgag 360 acgcacaagg atgaccagct gatctgtgtg aacgagaacg gcggctgtga gcagtactgc 420 agtgaccaca cgggcaccaa gcgctcctgt cggtgccacg aggggtactc tctgctggca 480 gacggggtgt cctgcacacc cacagttgaa tatccatgtg gaaaaatacc tattctagaa 540 aaaagaaatg ccagcaaacc ccaaggccga attgtggggg gcaaggtgtg ccccaaaggg 600 gagtgtccat ggcaggtcct gttgttggtg aatggagctc agttgtgtgg ggggaccctg 660 atcaacacca tctgggtggt ctccgcggcc cactgtttcg acaaaatcaa gaactggagg 720 aacctgatcg cggtgctggg cgagcacgac ctcagcgagc acgacgggga tgagcagagc 780 cggcgggtgg cgcaggtcat catccccagc acgtacgtcc cgggcaccac caaccacgac 840 atcgcgctgc tccgcctgca ccagcccgtg gtcctcactg accatgtggt gcccctctgc 900 ctgcccgaac ggacgttctc tgagaggacg ctggccttcg tgcgcttctc attggtcagc 960 ggctggggcc agctgctgga ccgtggcgcc acggccctgg agctcatggt cctcaacgtg 1020 ccccggctga tgacccagga ctgcctgcag cagtcacgga aggtgggaga ctccccaaat 1080 atcacggagt acatgttctg tgccggctac tcggatggca gcaaggactc ctgcaagggg 1140 gacagtggag gcccacatgc cacccactac cggggcacgt ggtacctgac gggcatcgtc 1200 agctggggcc agggctgcgc aaccgtgggc cactttgggg tgtacaccag ggtctcccag 1260 tacatcgagt ggctgcaaaa gctcatgcgc tcagagccac gcccaggagt cctcctgcga 1320 gccccatttc ccgacaaaac tcacacgtgc ccgccgtgcc cagctccgga actgctgggc 1380 ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 1440 cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 1500 tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga ggagcagtac 1560 aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc 1620 aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc 1680 tccaaagcca aagggcagcc ccgagaacca caggtgtaca ccctgccccc atcccgggat 1740 gagctgacca agaaccaggt cagcctgacc tgcctggtca aaggcttcta tcccagcgac 1800 atcgccgtgg agtgggagag caatgggcag ccggagaaca actacaagac cacgcctccc 1860 gtgttggact ccgacggctc cttcttcctc tacagcaagc tcaccgtgga caagagcagg 1920 tggcagcagg ggaacgtctt ctcatgctcc gtgatgcatg aggctctgca caaccactac 1980 acgcagaaga gcctctccct gtctccgggt aaatga 2016 &lt;210&gt; 8 &lt;211&gt; 696 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt;8

<td> Met 1</td><td> Gin</td><td> Arg</td><td> Val</td><td> Asn 5</td><td> Met</td><td> Ile</td><td> Met</td><td> Alá</td><td> Glu 10</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Leu</td><td> Ile 15</td><td> Thr</td>

<td> Ile</td><td> Cys</td><td> Leu</td><td> Leu 20</td><td> Gly</td><td> Tyr</td><td> Leu</td><td> Leu</td><td> Ser 25</td><td> Alá</td><td> Glu</td><td> Cys</td><td> Thr</td><td> Val 30</td><td> Phe</td><td> Leu</td>

<td> Asp</td><td> His</td><td> Glu 35</td><td> Asn</td><td> Alá</td><td> Asn</td><td> Lys</td><td> Ile 40</td><td> Leu</td><td> Asn</td><td> Arg</td><td> Pro</td><td> Lys 45</td><td> Arg</td><td> Tyr</td><td> Asn</td>

<td> Ser</td><td> Gly 50</td><td> Lys</td><td> Leu</td><td> Glu</td><td> Glu</td><td> Phe 55</td><td> Val</td><td> Gin</td><td> Gly</td><td> Asn</td><td> Leu 60</td><td> Glu</td><td> Arg</td><td> Glu</td><td> Cys</td>

ΕΡ 2 361 932 Β1

Glu Alá Arg Glu Val Phe Glu Asn

<td> Met 65</td><td> Glu</td><td> Glu</td><td> Lys</td><td> Cys</td><td> Ser 70</td><td> Phe</td><td> Glu</td>

<td> Thr</td><td> Glu</td><td> Arg</td><td> Thr</td><td> Thr 85</td><td> Glu</td><td> Phe</td><td> Trp</td>

<td> Cys</td><td> Glu</td><td> Ser</td><td> Asn 100</td><td> Pro</td><td> Cys</td><td> Leu</td><td> Asn</td>

<td> Asn</td><td> Ser</td><td> Tyr 115</td><td> Glu</td><td> Cys</td><td> Trp</td><td> Cys</td><td> Pro 120</td>

<td> Glu</td><td> Leu 130</td><td> Asp</td><td> Val</td><td> Thr</td><td> Cys</td><td> Asn 135</td><td> Ile</td>

<td> Cys 145</td><td> Lys</td><td> Asn</td><td> Ser</td><td> Alá</td><td> Asp 150</td><td> Asn</td><td> Lys</td>

<td> Tyr</td><td> Arg</td><td> Leu</td><td> Alá</td><td> Glu 165</td><td> Asn</td><td> Gin</td><td> Lys</td>

<td> Pro</td><td> Cys</td><td> Gly</td><td> Arg 180</td><td> Val</td><td> Ser</td><td> Val</td><td> Ser</td>

<td> Glu</td><td> Thr</td><td> Val 195</td><td> Phe</td><td> Pro</td><td> Asp</td><td> Val</td><td> Asp 200</td>

<td> Thr</td><td> Ile 210</td><td> Leu</td><td> Asp</td><td> Asn</td><td> Ile</td><td> Thr 215</td><td> Gin</td>

<td> Thr 225</td><td> Arg</td><td> Val</td><td> Val</td><td> Gly</td><td> Gly 230</td><td> Glu</td><td> Asp</td>

<td> Gin</td><td> Val</td><td> Val</td><td> Leu</td><td> Asn 245</td><td> Gly</td><td> Lys</td><td> Val</td>

<td> Val</td><td> Asn</td><td> Glu</td><td> Lys 260</td><td> Trp</td><td> Ile</td><td> Val</td><td> Thr</td>

<td> Val</td><td> Lys</td><td> Ile 275</td><td> Thr</td><td> Val</td><td> Val</td><td> Alá</td><td> Gly 280</td>

<td> His</td><td> Thr 290</td><td> Glu</td><td> Gin</td><td> Lys</td><td> Arg</td><td> Asn 295</td><td> Val</td>

<td> Tyr 305</td><td> Asn</td><td> Alá</td><td> Alá</td><td> Ile</td><td> Asn 310</td><td> Lys</td><td> Tyr</td>

<td> Leu</td><td> Asp</td><td> Glu</td><td> Pro</td><td> Leu 325</td><td> Val</td><td> Leu</td><td> Asn</td>

<td> Alá</td><td> Asp</td><td> Lys</td><td> Glu 340</td><td> Tyr</td><td> Thr</td><td> Asn</td><td> Ile</td>

<td> Val</td><td> Ser</td><td> Gly 355</td><td> Trp</td><td> Gly</td><td> Arg</td><td> Val</td><td> Phe 360</td>

<td> Leu</td><td> Gin 370</td><td> Tyr</td><td> Leu</td><td> Arg</td><td> Val</td><td> Pro 375</td><td> Leu</td>

<td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td> Lys</td><td> Gin 90</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td><td> Asp 95</td><td> Gin</td>

<td> Gly 105</td><td> Gly</td><td> Ser</td><td> Cys</td><td> Lys</td><td> Asp 110</td><td> Asp</td><td> Ile</td>

<td> Phe</td><td> Gly</td><td> Phe</td><td> Glu</td><td> Gly 125</td><td> Lys</td><td> Asn</td><td> Cys</td>

<td> Lys</td><td> Asn</td><td> Gly</td><td> Arg 140</td><td> Cys</td><td> Glu</td><td> Gin</td><td> Phe</td>

<td> Val</td><td> Val</td><td> Cys 155</td><td> Ser</td><td> Cys</td><td> Thr</td><td> Glu</td><td> Gly 160</td>

<td> Ser</td><td> Cys 170</td><td> Glu</td><td> Pro</td><td> Alá</td><td> Val</td><td> Pro 175</td><td> Phe</td>

<td> Gin 185</td><td> Thr</td><td> Ser</td><td> Lys</td><td> Leu</td><td> Thr 190</td><td> Arg</td><td> Alá</td>

<td> Tyr</td><td> Val</td><td> Asn</td><td> Ser</td><td> Thr 205</td><td> Glu</td><td> Alá</td><td> Glu</td>

<td> Ser</td><td> Thr</td><td> Gin</td><td> Ser 220</td><td> Phe</td><td> Asn</td><td> Asp</td><td> Phe</td>

<td> Alá</td><td> Lys</td><td> Pro 235</td><td> Gly</td><td> Gin</td><td> Phe</td><td> Pro</td><td> Trp 240</td>

<td> Asp</td><td> Alá 250</td><td> Phe</td><td> Cys</td><td> Gly</td><td> Gly</td><td> Ser 255</td><td> Ile</td>

<td> Alá 265</td><td> Alá</td><td> His</td><td> Cys</td><td> Val</td><td> Glu 270</td><td> Thr</td><td> Gly</td>

<td> Glu</td><td> His</td><td> Asn</td><td> Ile</td><td> Glu 285</td><td> Glu</td><td> Thr</td><td> Glu</td>

<td> Ile</td><td> Arg</td><td> Ile</td><td> Ile 300</td><td> Pro</td><td> His</td><td> His</td><td> Asn</td>

<td> Asn</td><td> His</td><td> Asp 315</td><td> Ile</td><td> Alá</td><td> Leu</td><td> Leu</td><td> Glu 320</td>

<td> Ser</td><td> Tyr 330</td><td> Val</td><td> Thr</td><td> Pro</td><td> Ile</td><td> Cys 335</td><td> Ile</td>

<td> Phe 345</td><td> Leu</td><td> Lys</td><td> Phe</td><td> Gly</td><td> Ser 350</td><td> Gly</td><td> Tyr</td>

<td> His</td><td> Lys</td><td> Gly</td><td> Arg</td><td> Ser 365</td><td> Alá</td><td> Leu</td><td> Val</td>

<td> Val</td><td> Asp</td><td> Arg</td><td> Alá</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Arg</td>

380

ΕΡ 2 361 932 Β1

Asn Met Phe Cys Alá Gly Phe His

395 400

<td> Ser 385</td><td> Thr</td><td> Lys</td><td> Phe</td><td> Thr</td><td> Ile 390</td><td> Tyr</td><td> Asn</td>

<td> Glu</td><td> Gly</td><td> Gly</td><td> Arg</td><td> Asp 405</td><td> Ser</td><td> Cys</td><td> Gin</td>

<td> Thr</td><td> Glu</td><td> Val</td><td> Glu 420</td><td> Gly</td><td> Thr</td><td> Ser</td><td> Phe</td>

<td> Glu</td><td> Glu</td><td> Cys 435</td><td> Alá</td><td> Met</td><td> Lys</td><td> Gly</td><td> Lys 440</td>

<td> Arg</td><td> Tyr 450</td><td> Val</td><td> Asn</td><td> Trp</td><td> Ile</td><td> Lys 455</td><td> Glu</td>

<td> Gly 4 65</td><td> Alá</td><td> Alá</td><td> Alá</td><td> Val</td><td> Asp 470</td><td> Lys</td><td> Thr</td>

<td> Pro</td><td> Glu</td><td> Leu</td><td> Leu</td><td> Gly 485</td><td> Gly</td><td> Pro</td><td> Ser</td>

<td> Lys</td><td> Asp</td><td> Thr</td><td> Leu 500</td><td> Met</td><td> Ile</td><td> Ser</td><td> Arg</td>

<td> Val</td><td> Asp</td><td> Val 515</td><td> Ser</td><td> His</td><td> Glu</td><td> Asp</td><td> Pro 520</td>

<td> Asp</td><td> Gly 530</td><td> Val</td><td> Glu</td><td> Val</td><td> His</td><td> Asn 535</td><td> Alá</td>

<td> Tyr 545</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr</td><td> Arg 550</td><td> Val</td><td> Val</td>

<td> Asp</td><td> Trp</td><td> Leu</td><td> Asn</td><td> Gly 565</td><td> Lys</td><td> Glu</td><td> Tyr</td>

<td> Leu</td><td> Pro</td><td> Alá</td><td> Pro 580</td><td> Ile</td><td> Glu</td><td> Lys</td><td> Thr</td>

<td> Arg</td><td> Glu</td><td> Pro 595</td><td> Gin</td><td> Val</td><td> Tyr</td><td> Thr</td><td> Leu 600</td>

<td> Lys</td><td> Asn 610</td><td> Gin</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr 615</td><td> Cys</td>

<td> Asp 625</td><td> Ile</td><td> Alá</td><td> Val</td><td> Glu</td><td> Trp 630</td><td> Glu</td><td> Ser</td>

<td> Lys</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Pro 645</td><td> Val</td><td> Leu</td><td> Asp</td>

<td> Ser</td><td> Lys</td><td> Leu</td><td> Thr 660</td><td> Val</td><td> Asp</td><td> Lys</td><td> Ser</td>

<td> Ser</td><td> Cys</td><td> Ser 675</td><td> Val</td><td> Met</td><td> His</td><td> Glu</td><td> Alá 680</td>

<td> Ser</td><td> Leu 690</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Pro</td><td> Gly 695</td><td> Lys</td>

<td> Gly</td><td> Asp 410</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Pro</td><td> His 415</td><td> Val</td>

<td> Leu 425</td><td> Thr</td><td> Gly</td><td> Ile</td><td> Ile</td><td> Ser 430</td><td> Trp</td><td> Gly</td>

<td> Tyr</td><td> Gly</td><td> Ile</td><td> Tyr</td><td> Thr 445</td><td> Lys</td><td> Val</td><td> Ser</td>

<td> Lys</td><td> Thr</td><td> Lys</td><td> Leu 4 60</td><td> Thr</td><td> Glu</td><td> Phe</td><td> Alá</td>

<td> His</td><td> Thr</td><td> Cys 475</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Alá 480</td>

<td> Val</td><td> Phe 4 90</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys 4 95</td><td> Pro</td>

<td> Thr 505</td><td> Pro</td><td> Glu</td><td> Val</td><td> Thr</td><td> Cys 510</td><td> Val</td><td> Val</td>

<td> Glu</td><td> Val</td><td> Lys</td><td> Phe</td><td> Asn 525</td><td> Trp</td><td> Tyr</td><td> Val</td>

<td> Lys</td><td> Thr</td><td> Lys</td><td> Pro 540</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin</td>

<td> Ser</td><td> Val</td><td> Leu 555</td><td> Thr</td><td> Val</td><td> Leu</td><td> His</td><td> Gin 560</td>

<td> Lys</td><td> Cys 570</td><td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Lys 575</td><td> Alá</td>

<td> Ile 585</td><td> Ser</td><td> Lys</td><td> Alá</td><td> Lys</td><td> Gly 590</td><td> Gin</td><td> Pro</td>

<td> Pro</td><td> Pro</td><td> Ser</td><td> Arg</td><td> Asp 605</td><td> Glu</td><td> Leu</td><td> Thr</td>

<td> Leu</td><td> Val</td><td> Lys</td><td> Gly 620</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td>

<td> Asn</td><td> Gly</td><td> Gin 635</td><td> Pro</td><td> Glu</td><td> Asn</td><td> Asn</td><td> Tyr 640</td>

<td> Ser</td><td> Asp 650</td><td> Gly</td><td> Ser</td><td> Phe</td><td> Phe</td><td> Leu 655</td><td> Tyr</td>

<td> Arg 665</td><td> Trp</td><td> Gin</td><td> Gin</td><td> Gly</td><td> Asn 670</td><td> Val</td><td> Phe</td>

<td> Leu</td><td> His</td><td> Asn</td><td> His</td><td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td>

685

ΕΡ 2 361 932 Β1 &lt;210&gt;9 &lt;211&gt; 2091 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 9 atgcagcgcg tgaacatgat catggcagaa tcaccaggcc tcatcaccat ctgcctttta 60 ggatatctac tcagtgctga atgtacagtt tttcttgatc atgaaaacgc caacaaaatt 120 ctgaatcggc caaagaggta taattcaggt aaattggaag agtttgttca agggaacctt 180 gagagagaat gtatggaaga aaagtgtagt tttgaagaag cacgagaagt ttttgaaaac 240 actgaaagaa caactgaatt ttggaagcag tatgttgatg gagatcagtg tgagtccaat 300 ccatgtttaa atggcggcag ttgcaaggat gacattaatt cctatgaatg ttggtgtccc 360 tttggatttg aaggaaagaa ctgtgaatta gatgtaacat gtaacattaa gaatggcaga 420 tgcgagcagt tttgtaaaaa tagtgctgat aacaaggtgg tttgctcctg tactgaggga 480 tatcgacttg cagaaaacca gaagtcctgt gaaccagcag tgccatttcc atgtggaaga 540 gtttctgttt cacaaacttc taagctcacc cgtgctgaga ctgtttttcc tgatgtggac 600 tatgtaaatt ctactgaagc tgaaaccatt ttggataaca tcactcaaag cacccaatca 660 tttaatgact tcactcgggt tgttggtgga gaagatgcca aaccaggtca attcccttgg 720 caggttgttt tgaatggtaa agttgatgca ttctgtggag gctctatcgt taatgaaaaa 780 tggattgtaa ctgctgccca ctgtgttgaa actggtgtta aaattacagt tgtcgcaggt 840 gaacataata ttgaggagac agaacataca gagcaaaagc gaaatgtgat tcgaattatt 900 cctcaccaca actacaatgc agctattaat aagtacaacc atgacattgc ccttctggaa 960 ctggacgaac ccttagtgct aaacagctac gttacaccta tttgcattgc tgacaaggaa 1020 tacacgaaca tcttcctcaa atttggatct ggctatgtaa gtggctgggg aagagtcttc 1080 cacaaaggga gatcagcttt agttcttcag taccttagag ttccacttgt tgaccgagcc 1140 acatgtcttc gatctacaaa gttcaccatc tataacaaca tgttctgtgc tggcttccat 1200 gaaggaggta gagattcatg tcaaggagat agtgggggac cccatgttac tgaagtggaa 1260 gggaccagtt tcttaactgg aattattagc tggggtgaag agtgtgcaat gaaaggcaaa 1320 tatggaatat ataccaaggt atcccggtat gtcaactgga ttaaggaaaa aacaaagctc 1380 actgaattcg ccggcgccgc tgcggtcgac aaaactcaca catgcccacc gtgcccagca 1440 cctgaactcc tggggggacc gtcagtcttc ctcttccccc caaaacccaa ggacaccctc 1500 atgatctccc ggacccctga ggtcacatgc gtggtggtgg acgtgagcca cgaagaccct 1560 gaggtcaagt tcaactggta cgtggacggc gtggaggtgc ataatgccaa gacaaagccg 1620 cgggaggagc agtacaacag cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag 1680 gactggctga atggcaagga gtacaagtgc aaggtctcca acaaagccct cccagccccc 1740 atcgagaaaa ccatctccaa agccaaaggg cagccccgag aaccacaggt gtacaccctg 1800 cccccatccc gggatgagct gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc 1860 ttctatccca gcgacatcgc cgtggagtgg gagagcaatg ggcagccgga gaacaactac 1920 aagaccacgc ctcccgtgtt ggactccgac ggctccttct tcctctacag caagctcacc 1980 gtggacaaga gcaggtggca gcaggggaac gtcttctcat gctccgtgat gcatgaggct 2040 ctgcacaacc actacacgca gaagagcctc tccctgtctc cgggtaaatg a 2091 &lt;210&gt; 10 &lt;211&gt; 423 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 10

Met Alá Leu Thr Phe Alá Leu Leu Val Alá Leu Leu Val Leu Ser Cys 15 10 15

ΕΡ 2 361 932 Β1

Asp Leu Pro Gin

Leu Ala Gin Met

Lys Ser Ser Cys Ser Val Gly 20

Gly Ser Arg Arg Thr Leu Met 35

Leu Phe Ser Cys Leu Lys Asp 50 55

Glu Phe Gly Asn Gin Phe Gin 65 70

Glu Met Ile Gin Gin Ile Phe 85

Ala Ala Trp Asp Glu Thr Leu 100

Gin Gin Leu Asn Asp Leu Glu 115

Thr Glu Thr Pro Leu Met Lys 130 135

Tyr Phe Gin Arg Ile Thr Leu 145 150

Cys Ala Trp Glu Val Val Arg 165

Ser Thr Asn Leu Gin Glu Ser 180

Ala Ala Ala Val Asp Lys Thr 195

Glu Leu Leu Gly Gly Pro Ser 210 215

Asp Thr Leu Met Ile Ser Arg 225 230

Asp Val Ser His Glu Asp Pro 245

Gly Val Glu Val His Asn Ala 260

Asn Ser Thr Tyr Arg Val Val 275

Trp Leu Asn Gly Lys Glu Tyr 290 295

Pro Ala Pro Ile Glu Lys Thr 305 310

Glu Pro Gin Val Tyr Thr Leu 325

Cys

Leu

Arg

Lys

Asn

Leu

Ala

120

Glu

Tyr

Ala

Leu

His

200

Val

Thr

Glu

Lys

Ser

280

Lys

Ile

Pro

His Asp Phe Gly 60

Ala Glu Thr Ile 75

Leu Phe Ser Thr 90

Asp Lys Phe Tyr 105

Cys Val Ile Gin

Asp Ser Ile Leu 140

Leu Lys Glu Lys 155

Glu Ile Met Arg 170

Arg Ser Lys Glu 185

Thr Cys Pro Pro

Phe Leu Phe Pro 220

Pro Glu Val Thr 235

Val Lys Phe Asn 250

Thr Lys Pro Arg 265

Val Leu Thr Val

Cys Lys Val Ser 300

Ser Lys Ala Lys 315

Pro Ser Arg Asp 330

Thr His Ser Leu 30

Arg Arg Ile Ser 45

Phe Pro Gin Glu

Pro Val Leu His 80

Lys Asp Ser Ser 95

Thr Glu Leu Tyr 110

Gly Val Gly Val 125

Ala Val Arg Lys

Lys Tyr Ser Pro 160

Ser Phe Ser Leu 175

Glu Phe Ala Gly 190

Cys Pro Ala Pro 205

Pro Lys Pro Lys

Cys Val Val Val 240

Trp Tyr Val Asp 255

Glu Glu Gin Tyr 270

Leu His Gin Asp 285

Asn Lys Ala Leu

Gly Gin Pro Arg 320

Glu Leu Thr Lys 335

ΕΡ 2 361 932 Β1

<td> Asn</td><td> Gin</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td>

<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>

<td> He</td><td> Alá</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Glu</td><td> Asn</td><td> Asn</td><td> Tyr</td><td> Lys</td>

<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>

<td> Thr</td><td> Thr</td><td> Pro</td><td> Pro</td><td> Val</td><td> Leu</td><td> Asp</td><td> Ser</td><td> Asp</td><td> Gly</td><td> Ser</td><td> Phe</td><td> Phe</td><td> Leu</td><td> Tyr</td><td> Ser</td>

<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td><td></td>

<td> Lys</td><td> Leu</td><td> Thr</td><td> Val</td><td> Asp</td><td> Lys</td><td> Ser</td><td> Arg</td><td> Trp</td><td> Gin</td><td> Gin</td><td> Gly</td><td> Asn</td><td> Val</td><td> Phe</td><td> Ser</td>

<td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td><td></td><td></td><td></td><td> 395</td><td></td><td></td><td></td><td></td><td> 400</td>

<td> Cys</td><td> Ser</td><td> Val</td><td> Met</td><td> His</td><td> Glu</td><td> Alá</td><td> Leu</td><td> His</td><td> Asn</td><td> His</td><td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td><td> Ser</td>

<td></td><td></td><td></td><td></td><td> 405</td><td></td><td></td><td></td><td></td><td> 410</td><td></td><td></td><td></td><td></td><td> 415</td><td></td>

<td> Leu</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Lys</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

420 &lt;210&gt; 11 &lt;211&gt; 1272 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 11 atggccttga cctttgcttt actggtggcc ctcctggtgc tcagctgcaa gtcaagctgc 60 tctgtgggct gtgatctgcc tcaaacccac agcctgggta gcaggaggac cttgatgctc 120 ctggcacaga tgaggagaat ctctcttttc tcctgcttga aggacagaca tgactttgga 180 tttccccagg aggagtttgg caaccagttc caaaaggctg aaaccatccc tgtcctccat 240 gagatgatcc agcagatctt caatctcttc agcacaaagg actcatctgc tgcttgggat 300 gagaccctcc tagacaaatt ctacactgaa ctctaccagc agctgaatga cctggaagcc 360 tgtgtgatac agggggtggg ggtgacagag actcccctga tgaaggagga ctccattctg 420 gctgtgagga aatacttcca aagaatcact ctctatctga aagagaagaa atacagccct 480 tgtgcctggg aggttgtcag agcagaaatc atgagatctt tttctttgtc aacaaacttg 540 caagaaagtt taagaagtaa ggaagaattc gccggcgccg ctgcggtcga caaaactcac 600 acatgcccac cgtgcccagc acctgaactc ctggggggac cgtcagtctt cctcttcccc 660 ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggtg 720 gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg 780 cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 840 gtcctcaccg tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc 900 aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga 960 gaaccacagg tgtacaccct gcccccatcc cgggatgagc tgaccaagaa ccaggtcagc 1020 ctgacctgcc tggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat 1080 gggcagccgg agaacaacta caagaccacg cctcccgtgt tggactccga cggctccttc 1140 ttcctctaca gcaagctcac cgtggacaag agcaggtggc agcaggggaa cgtcttctca 1200 tgctccgtga tgcatgaggc tctgcacaac cactacacgc agaagagcct ctccctgtct 1260 ccgggtaaat ga 1272 &lt;210&gt; 12 &lt;211&gt; 415 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct

ΕΡ 2 361 932 Β1 &lt;400&gt; 12

Met Ala Leu Thr 1

Lys Ser Ser Cys 20

Gly Ser Arg Arg 35

Leu Phe Ser Cys 50

Glu Phe Gly Asn 65

Glu Met Ile Gin

Ala Ala Trp Asp 100

Gin Gin Leu Asn 115

Thr Glu Thr Pro 130

Tyr Phe Gin Arg 145

Cys Ala Trp Glu

Ser Thr Asn Leu 180

Thr Cys Pro Pro 195

Phe Leu Phe Pro 210

Pro Glu Val Thr 225

Val Lys Phe Asn

Thr Lys Pro Arg 260

Val Leu Thr Val 275

Cys Lys Val Ser 290

Phe Ala Leu Leu Val Ala

10

Ser Val Gly Cys Asp Leu 25

Thr Leu Met Leu Leu Ala 40

Leu Lys Asp Arg His Asp 55

Gin Phe Gin Lys Ala Glu 70

Gin Ile Phe Asn Leu Phe 85 90

Glu Thr Leu Leu Asp Lys 105

Asp Leu Glu Ala Cys Val 120

Leu Met Lys Glu Asp Ser 135

Ile Thr Leu Tyr Leu Lys 150

Val Val Arg Ala Glu Ile 165 170

Gin Glu Ser Leu Arg Ser 185

Cys Pro Ala Pro Glu Leu 200

Pro Lys Pro Lys Asp Thr 215

Cys Val Val Val Asp Val 230

Trp Tyr Val Asp Gly Val 245 250

Glu Glu Gin Tyr Asn Ser 265

Leu His Gin Asp Trp Leu 280

Asn Lys Ala Leu Pro Ala 295

Leu Leu Val Leu Ser Cys

Pro Gin Thr His Ser Leu 30

Gin Met Arg Arg Ile Ser 45

Phe Gly Phe Pro Gin Glu 60

Thr Ile Pro Val Leu His 75 80

Ser Thr Lys Asp Ser Ser 95

Phe Tyr Thr Glu Leu Tyr 110

Ile Gin Gly Val Gly Val 125

Ile Leu Ala Val Arg Lys 140

Glu Lys Lys Tyr Ser Pro 155 160

Met Arg Ser Phe Ser Leu 175

Lys Glu Asp Lys Thr His 190

Leu Gly Gly Pro Ser Val 205

Leu Met Ile Ser Arg Thr 220

Ser His Glu Asp Pro Glu 235 240

Glu Val His Asn Ala Lys 255

Thr Tyr Arg Val Val Ser 270

Asn Gly Lys Glu Tyr Lys 285

Pro Ile Glu Lys Thr Ile 300

EP 2 361 932 Β1

<td colspan="3"> Ser Lys Alá 305</td><td colspan="3"> Lys Gly Gin 310</td><td> Pro</td><td> Arg</td><td colspan="4"> Glu Pro Gin Val 315</td><td> Tyr</td><td colspan="2"> Thr Leu</td><td> Pro 320</td>

<td> Pro</td><td> Ser</td><td> Arg</td><td> Asp</td><td> Glu</td><td> Leu</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td>

<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td>

<td> Val</td><td> Lys</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td><td> Ile</td><td> Alá</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td>

<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>

<td> Gly</td><td> Gin</td><td> Pro</td><td> Glu</td><td> Asn</td><td> Asn</td><td> Tyr</td><td> Lys</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Pro</td><td> Val</td><td> Leu</td><td> Asp</td><td> Ser</td>

<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>

<td> Asp</td><td> Gly</td><td> Ser</td><td> Phe</td><td> Phe</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Lys</td><td> Leu</td><td> Thr</td><td> Val</td><td> Asp</td><td> Lys</td><td> Ser</td><td> Arg</td>

<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td><td></td>

<td> Trp</td><td> Gin</td><td> Gin</td><td> Gly</td><td> Asn</td><td> Val</td><td> Phe</td><td> Ser</td><td> Cys</td><td> Ser</td><td> Val</td><td> Met</td><td> His</td><td> Glu</td><td> Alá</td><td> Leu</td>

<td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td><td></td><td></td><td></td><td> 395</td><td></td><td></td><td></td><td></td><td> 400</td>

<td> His</td><td> Asn</td><td> His</td><td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Lys</td><td></td>

<td></td><td></td><td></td><td></td><td> 405</td><td></td><td></td><td></td><td></td><td> 410</td><td></td><td></td><td></td><td></td><td> 415</td><td></td>

&lt;210&gt; 13 &lt;211&gt; 1248 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 13 atggccttga cctttgcttt actggtggcc ctcctggtgc tcagctgcaa gtcaagctgc 60 tctgtgggct gtgatctgcc tcaaacccac agcctgggta gcaggaggac cttgatgctc 120 ctggcacaga tgaggagaat ctctcttttc tcctgcttga aggacagaca tgactttgga 180 tttccccagg aggagtttgg caaccagttc caaaaggctg aaaccatccc tgtcctccat 240 gagatgatcc agcagatctt caatctcttc agcacaaagg actcatctgc tgcttgggat 300 gagaccctcc tagacaaatt ctacactgaa ctctaccagc agctgaatga cctggaagcc 360 tgtgtgatac agggggtggg ggtgacagag actcccctga tgaaggagga ctccattctg 420 gctgtgagga aatacttcca aagaatcact ctctatctga aagagaagaa atacagccct 480 tgtgcctggg aggttgtcag agcagaaatc atgagatctt tttctttgtc aacaaacttg 540 caagaaagtt taagaagtaa ggaagacaaa actcacacgt gcccgccgtg cccagctccg 600 gaactgctgg gcggaccgtc agtcttcctc ttccccccaa aacccaagga caccctcatg 660 atctcccgga cccctgaggt cacatgcgtg gtggtggacg tgagccacga agaccctgag 720 gtcaagttca actggtacgt ggacggcgtg gaggtgcata atgccaagac aaagccgcgg 780 gaggagcagt acaacagcac gtaccgtgtg gtcagcgtcc tcaccgtcct gcaccaggac 840 tggctgaatg gcaaggagta caagtgcaag gtctccaaca aagccctccc agcccccatc 900 gagaaaacca tctccaaagc caaagggcag ccccgagaac cacaggtgta caccctgccc 960 ccatcccggg atgagctgac caagaaccag gtcagcctga cctgcctggt caaaggcttc 1020 tatcccagcg acatcgccgt ggagtgggag agcaatgggc agccggagaa caactacaag 1080 accacgcctc ccgtgttgga ctccgacggc tccttcttcc tctacagcaa gctcaccgtg 1140 gacaagagca ggtggcagca ggggaacgtc ttctcatgct ccgtgatgca tgaggctctg 1200 cacaaccact acacgcagaa gagcctctcc ctgtctccgg gtaaatga 1248 &lt;210&gt; 14 &lt;211&gt; 256 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence

ΕΡ 2 361 932 Β1 &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 14 5

<td></td><td> Met 1</td><td> Glu Thr Asp Thr 5</td><td> Leu Leu</td><td> Leu</td><td> Trp Val 10</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Trp</td><td> Val 15</td><td> Pro</td>

<td></td><td> Gly</td><td> Ser Thr Gly Asp</td><td> Asp Tyr</td><td> Lys</td><td> Asp Asp</td><td> Asp</td><td> Asp</td><td> Lys</td><td> Asp</td><td> Lys</td><td> Thr</td>

<td> 10</td><td></td><td> 20</td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td></td><td> His</td><td> Thr Cys Pro Pro</td><td> Cys Pro</td><td> Alá</td><td> Pro Glu</td><td> Leu</td><td> Leu</td><td> Gly</td><td> Gly</td><td> Pro</td><td> Ser</td>

<td></td><td></td><td> 35</td><td></td><td> 40</td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td> 15</td><td> Val</td><td> Phe Leu Phe Pro</td><td> Pro Lys</td><td> Pro</td><td> Lys Asp</td><td> Thr</td><td> Leu</td><td> Met</td><td> Ile</td><td> Ser</td><td> Arg</td>

<td></td><td></td><td> 50</td><td> 55</td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td></td><td> Thr</td><td> Pro Glu Val Thr</td><td> Cys Val</td><td> Val</td><td> Val Asp</td><td> Val</td><td> Ser</td><td> His</td><td> Glu</td><td> Asp</td><td> Pro</td>

<td></td><td> 65</td><td></td><td> 70</td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td> 20</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> Glu</td><td> Val Lys Phe Asn</td><td> Trp Tyr</td><td> Val</td><td> Asp Gly</td><td> Val</td><td> Glu</td><td> Val</td><td> His</td><td> Asn</td><td> Alá</td>

<td></td><td></td><td> 85</td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td></td><td> Lys</td><td> Thr Lys Pro Arg</td><td> Glu Glu</td><td> Gin</td><td> Tyr Asn</td><td> Ser</td><td> Thr</td><td> Tyr</td><td> Arg</td><td> Val</td><td> Val</td>

<td> 25</td><td></td><td> 100</td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td></td><td> Ser</td><td> Val Leu Thr Val</td><td> Leu His</td><td> Gin</td><td> Asp Trp</td><td> Leu</td><td> Asn</td><td> Gly</td><td> Lys</td><td> Glu</td><td> Tyr</td>

<td></td><td></td><td> 115</td><td></td><td> 120</td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

<td></td><td> Lys</td><td> Cys Lys Val Ser</td><td> Asn Lys</td><td> Alá</td><td> Leu Pro</td><td> Alá</td><td> Pro</td><td> Ile</td><td> Glu</td><td> Lys</td><td> Thr</td>

<td> 30</td><td></td><td> 130</td><td> 135</td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>

<td></td><td> Ile</td><td> Ser Lys Alá Lys</td><td> Gly Gin</td><td> Pro</td><td> Arg Glu</td><td> Pro</td><td> Gin</td><td> Val</td><td> Tyr</td><td> Thr</td><td> Leu</td>

<td></td><td> 145</td><td></td><td> 150</td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td>

<td> 35</td><td> Pro</td><td> Pro Ser Arg Asp</td><td> Glu Leu</td><td> Thr</td><td> Lys Asn</td><td> Gin</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td>

<td></td><td></td><td> 165</td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td>

<td></td><td> Leu</td><td> Val Lys Gly Phe</td><td> Tyr Pro</td><td> Ser</td><td> Asp Ile</td><td> Alá</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu</td><td> Ser</td>

<td></td><td></td><td> 180</td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td> 190</td><td></td><td></td>

<td> 40</td><td> Asn</td><td> Gly Gin Pro Glu</td><td> Asn Asn</td><td> Tyr</td><td> Lys Thr</td><td> Thr</td><td> Pro</td><td> Pro</td><td> Val</td><td> Leu</td><td> Asp</td>

<td></td><td></td><td> 195</td><td></td><td> 200</td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

<td></td><td> Ser</td><td> Asp Gly Ser Phe</td><td> Phe Leu</td><td> Tyr</td><td> Ser Lys</td><td> Leu</td><td> Thr</td><td> Val</td><td> Asp</td><td> Lys</td><td> Ser</td>

<td> 45</td><td></td><td> 210</td><td> 215</td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>

<td></td><td> Arg</td><td> Trp Gin Gin Gly</td><td> Asn Val</td><td> Phe</td><td> Ser Cys</td><td> Ser</td><td> Val</td><td> Met</td><td> His</td><td> Glu</td><td> Alá</td>

<td></td><td> 225</td><td></td><td> 230</td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>

<td></td><td> Leu</td><td> His Asn His Tyr</td><td> Thr Gin</td><td> Lys</td><td> Ser Leu</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Lys</td>

<td> 50</td><td></td><td> 245</td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td>

&lt;210&gt; 15 &lt;211&gt; 771 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct

ΕΡ 2 361 932 Β1 &lt;400&gt; 15 atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60 gacgactaca aggacgacga tgacaaggac aaaactcaca catgcccacc gtgcccagct 120 ccggaactcc tggggggacc gtcagtcttc ctcttccccc caaaacccaa ggacaccctc 180 atgatctccc ggacccctga ggtcacatgc gtggtggtgg acgtgagcca cgaagaccct 240 gaggtcaagt tcaactggta cgtggacggc gtggaggtgc ataatgccaa gacaaagccg 300 cgggaggagc agtacaacag cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag 360 gactggctga atggcaagga gtacaagtgc aaggtctcca acaaagccct cccagccccc 420 atcgagaaaa ccatctccaa agccaaaggg cagccccgag aaccacaggt gtacaccctg 480 cccccatccc gggatgagct gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc 540 ttctatccca gcgacatcgc cgtggagtgg gagagcaatg ggcagccgga gaacaactac 600 aagaccacgc ctcccgtgtt ggactccgac ggctccttct tcctctacag caagctcacc 660 gtggacaaga gcaggtggca gcaggggaac gtcttctcat gctccgtgat gcatgaggct 720 ctgcacaacc actacacgca gaagagcctc tccctgtctc cgggtaaatg a 771 &lt;210&gt; 16 &lt;211&gt; 444 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 16

<td> Met 1</td><td> Val</td><td> Pro</td><td> Cys</td><td> Thr 5</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Leu 10</td><td> Alá</td><td> Alá</td><td> Alá</td><td> Leu</td><td> Alá 15</td><td> Pro</td>

<td> Thr</td><td> Gin</td><td> Thr</td><td> Arg 20</td><td> Alá</td><td> Gly</td><td> Ser</td><td> Arg</td><td> Alá 25</td><td> Pro</td><td> Pro</td><td> Arg</td><td> Leu</td><td> Ile 30</td><td> Cys</td><td> Asp</td>

<td> Ser</td><td> Arg</td><td> Val 35</td><td> Leu</td><td> Gin</td><td> Arg</td><td> Tyr</td><td> Leu 40</td><td> Leu</td><td> Glu</td><td> Alá</td><td> Lys</td><td> Glu 45</td><td> Alá</td><td> Glu</td><td> Asn</td>

<td> Ile</td><td> Thr 50</td><td> Thr</td><td> Gly</td><td> Cys</td><td> Alá</td><td> Glu 55</td><td> His</td><td> Cys</td><td> Ser</td><td> Leu</td><td> Asn 60</td><td> Glu</td><td> Asn</td><td> Ile</td><td> Thr</td>

<td> Val 65</td><td> Pro</td><td> Asp</td><td> Thr</td><td> Lys</td><td> Val 70</td><td> Asn</td><td> Phe</td><td> Tyr</td><td> Alá</td><td> Trp 75</td><td> Lys</td><td> Arg</td><td> Met</td><td> Glu</td><td> Val 80</td>

<td> Gly</td><td> Gin</td><td> Gin</td><td> Alá</td><td> Val 85</td><td> Glu</td><td> Val</td><td> Trp</td><td> Gin</td><td> Gly 90</td><td> Leu</td><td> Alá</td><td> Leu</td><td> Leu</td><td> Ser 95</td><td> Glu</td>

<td> Alá</td><td> Val</td><td> Leu</td><td> Arg 100</td><td> Gly</td><td> Gin</td><td> Alá</td><td> Leu</td><td> Leu 105</td><td> Val</td><td> Asn</td><td> Ser</td><td> Ser</td><td> Gin 110</td><td> Pro</td><td> Trp</td>

<td> Glu</td><td> Pro</td><td> Leu 115</td><td> Gin</td><td> Leu</td><td> His</td><td> Val</td><td> Asp 120</td><td> Lys</td><td> Alá</td><td> Val</td><td> Ser</td><td> Gly 125</td><td> Leu</td><td> Arg</td><td> Ser</td>

<td> Leu</td><td> Thr 130</td><td> Thr</td><td> Leu</td><td> Leu</td><td> Arg</td><td> Alá 135</td><td> Leu</td><td> Gly</td><td> Alá</td><td> Gin</td><td> Lys 140</td><td> Glu</td><td> Alá</td><td> Ile</td><td> Ser</td>

<td> Pro 145</td><td> Pro</td><td> Asp</td><td> Alá</td><td> Alá</td><td> Ser 150</td><td> Alá</td><td> Alá</td><td> Pro</td><td> Leu</td><td> Arg 155</td><td> Thr</td><td> Ile</td><td> Thr</td><td> Alá</td><td> Asp 160</td>

ΕΡ 2 361 932 Β1

Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu Arg Gly Lys 165 170 175

<td colspan="2" rowspan="2"> Leu Lys</td><td colspan="2" rowspan="2"> Leu Tyr 180</td><td rowspan="2"> Thr</td><td rowspan="2"> Gly</td><td rowspan="2"> Glu</td><td rowspan="2"> Alá</td><td colspan="7"> Cys Arg Thr Gly Asp Arg Glu</td><td rowspan="2"> Phe</td>

<td colspan="4"> 185</td><td colspan="3"> 190</td>

<td> Gly</td><td> Gly</td><td> Glu</td><td> Tyr</td><td> Gin</td><td> Alá</td><td> Leu</td><td> Glu</td><td> Lys</td><td> Glu</td><td> Val</td><td> Alá</td><td> Gin</td><td> Leu</td><td> Glu</td><td> Alá</td>

<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

<td> Glu</td><td> Asn</td><td> Gin</td><td> Alá</td><td> Leu</td><td> Glu</td><td> Lys</td><td> Glu</td><td> Val</td><td> Alá</td><td> Gin</td><td> Leu</td><td> Glu</td><td> His</td><td> Glu</td><td> Gly</td>

<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>

<td> Gly</td><td> Gly</td><td> Pro</td><td> Alá</td><td> Pro</td><td> Glu</td><td> Leu</td><td> Leu</td><td> Gly</td><td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Leu</td><td> Phe</td>

<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>

<td> Pro</td><td> Pro</td><td> Lys</td><td> Pro</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu</td><td> Met</td><td> Ile</td><td> Ser</td><td> Arg</td><td> Thr</td><td> Pro</td><td> Glu</td><td> Val</td>

<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td>

<td> Thr</td><td> Cys</td><td> Val</td><td> Val</td><td> Val</td><td> Asp</td><td> Val</td><td> Ser</td><td> His</td><td> Glu</td><td> Asp</td><td> Pro</td><td> Glu</td><td> Val</td><td> Lys</td><td> Phe</td>

<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td>

<td> Asn</td><td> Trp</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td><td> Val</td><td> Glu</td><td> Val</td><td> His</td><td> Asn</td><td> Alá</td><td> Lys</td><td> Thr</td><td> Lys</td><td> Pro</td>

<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td><td></td><td></td><td></td>

<td> Arg</td><td> Glu</td><td> Glu</td><td> Gin</td><td> Tyr</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr</td><td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val</td><td> Leu</td><td> Thr</td>

<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td>

<td> Val</td><td> Leu</td><td> His</td><td> Gin</td><td> Asp</td><td> Trp</td><td> Leu</td><td> Asn</td><td> Gly</td><td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> Cys</td><td> Lys</td><td> Val</td>

<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td>

<td> Ser</td><td> Asn</td><td> Lys</td><td> Alá</td><td> Leu</td><td> Pro</td><td> Alá</td><td> Pro</td><td> Ile</td><td> Glu</td><td> Lys</td><td> Thr</td><td> Ile</td><td> Ser</td><td> Lys</td><td> Alá</td>

<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td>

<td> Lys</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> Gin</td><td> Val</td><td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro</td><td> Pro</td><td> Ser</td><td> Arg</td>

<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>

<td> Asp</td><td> Glu</td><td> Leu</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Gly</td>

<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>

<td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td><td> Ile</td><td> Alá</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td><td> Gly</td><td> Gin</td><td> Pro</td>

<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td><td></td>

<td> Glu</td><td> Asn</td><td> Asn</td><td> Tyr</td><td> Lys</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Pro</td><td> Val</td><td> Leu</td><td> Asp</td><td> Ser</td><td> Asp</td><td> Gly</td><td> Ser</td>

<td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td><td></td><td></td><td></td><td> 395</td><td></td><td></td><td></td><td></td><td> 400</td>

<td> Phe</td><td> Phe</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Lys</td><td> Leu</td><td> Thr</td><td> Val</td><td> Asp</td><td> Lys</td><td> Ser</td><td> Arg</td><td> Trp</td><td> Gin</td><td> Gin</td>

<td></td><td></td><td></td><td></td><td> 405</td><td></td><td></td><td></td><td></td><td> 410</td><td></td><td></td><td></td><td></td><td> 415</td><td></td>

<td rowspan="2"> Gly</td><td> Asn</td><td> Val</td><td> Phe</td><td> Ser</td><td> Cys</td><td> Ser</td><td> Val</td><td> Met</td><td> His</td><td> Glu</td><td> Alá</td><td> Leu</td><td> His</td><td> Asn</td><td> His</td>

<td></td><td></td><td> 420</td><td></td><td></td><td></td><td></td><td> 425</td><td></td><td></td><td></td><td></td><td> 430</td><td></td><td></td>

<td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Lys</td><td></td><td></td><td></td><td></td>

435 440 &lt;210&gt; 17 &lt;211&gt; 1335 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

ΕΡ 2 361 932 Β1 &lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 17 atggtaccgt gcacgctgct cctgctgttg gcggccgccc tggctccgac tcagacccgc 60 gccggctcta gagccccacc acgcctcatc tgtgacagcc gagtcctgca gaggtacctc 120 ttggaggcca aggaggccga gaatatcacg acgggctgtg ctgaacactg cagcttgaat 180 gagaatatca ctgtcccaga caccaaagtt aatttctatg cctggaagag gatggaggtc 240 gggcagcagg ccgtagaagt ctggcagggc ctggccctgc tgtcggaagc tgtcctgcgg 300 ggccaggccc tgttggtcaa ctcttcccag ccgtgggagc ccctgcagct gcatgtggat 360 aaagccgtca gtggccttcg cagcctcacc actctgcttc gggctctggg agcccagaag 420 gaagccatct cccctccaga tgcggcctca gctgctccac tccgaacaat cactgctgac 480 actttccgca aactcttccg agtctactcc aatttcctcc ggggaaagct gaagctgtac 540 acaggggagg cctgcaggac cggtgacagg gaattcggtg gtgagtacca ggccctggag 600 aaggaggtgg cccagctgga ggccgagaac caggccctgg agaaggaggt ggcccagctg 660 gagcacgagg gtggtggtcc cgcacccgag ctgctgggcg gaccgtcagt cttcctcttc 720 cccccaaaac ccaaggacac cctcatgatc tcccggaccc ctgaggtcac atgcgtggtg 780 gtggacgtga gccacgaaga ccctgaggtc aagttcaact ggtacgtgga cggcgtggag 840 gtgcataatg ccaagacaaa gccgcgggag gagcagtaca acagcacgta ccgtgtggtc 900 agcgtcctca ccgtcctgca ccaggactgg ctgaatggca aggagtacaa gtgcaaggtc 960 tccaacaaag ccctcccagc ccccatcgag aaaaccatct ccaaagccaa agggcagccc 1020 cgagaaccac aggtgtacac cctgccccca tcccgggatg agctgaccaa gaaccaggtc 1080 agcctgacct gcctggtcaa aggcttctat cccagcgaca tcgccgtgga gtgggagagc 1140 aatgggcagc cggagaacaa ctacaagacc acgcctcccg tgttggactc cgacggctcc 1200 ttcttcctct acagcaagct caccgtggac aagagcaggt ggcagcaggg gaacgtcttc 1260 tcatgctccg tgatgcatga ggctctgcac aaccactaca cgcagaagag cctctccctg 1320 tctccgggta aatga 1335 &lt;210&gt; 18 &lt;211&gt; 276 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 18

<td> Met 1</td><td> Val</td><td> Pro</td><td> Cys</td><td> Thr 5</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Leu 10</td><td> Alá</td><td> Alá</td><td> Alá</td><td> Leu</td><td> Alá 15</td><td> Pro</td>

<td> Thr</td><td> Gin</td><td> Thr</td><td> Arg 20</td><td> Alá</td><td> Gly</td><td> Glu</td><td> Phe</td><td> Gly 25</td><td> Gly</td><td> Glu</td><td> Tyr</td><td> Gin</td><td> Alá 30</td><td> Leu</td><td> Lys</td>

<td> Lys</td><td> Lys</td><td> Val 35</td><td> Alá</td><td> Gin</td><td> Leu</td><td> Lys</td><td> Alá 40</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Alá</td><td> Leu 45</td><td> Lys</td><td> Lys</td><td> Lys</td>

<td> Val</td><td> Alá 50</td><td> Gin</td><td> Leu</td><td> Lys</td><td> His</td><td> Lys 55</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Pro</td><td> Alá 60</td><td> Pro</td><td> Glu</td><td> Leu</td><td> Leu</td>

<td> Gly 65</td><td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe 70</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys 75</td><td> Pro</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu 80</td>

<td> Met</td><td> Ile</td><td> Ser</td><td> Arg</td><td> Thr 85</td><td> Pro</td><td> Glu</td><td> Val</td><td> Thr</td><td> Cys 90</td><td> Val</td><td> Val</td><td> Val</td><td> Asp</td><td> Val 95</td><td> Ser</td>

<td> His</td><td> Glu</td><td> Asp</td><td> Pro 100</td><td> Glu</td><td> Val</td><td> Lys</td><td> Phe</td><td> Asn 105</td><td> Trp</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly 110</td><td> Val</td><td> Glu</td>

ΕΡ 2 361 932 Β1

<td rowspan="2"> Val</td><td colspan="2" rowspan="2"> His Asn 115</td><td rowspan="2"> Ala</td><td rowspan="2"> Lys</td><td rowspan="2"> Thr</td><td rowspan="2"> Lys</td><td colspan="9"> Pro Arg Glu Glu Gin Tyr Asn Ser Thr</td>

<td> 120</td><td colspan="8"> 125</td>

<td> Tyr</td><td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val</td><td> Leu</td><td> Thr</td><td> Val</td><td> Leu</td><td> His</td><td> Gin</td><td> Asp</td><td> Trp</td><td> Leu</td><td> Asn</td>

<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>

<td> Gly</td><td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> Cys</td><td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Lys</td><td> Ala</td><td> Leu</td><td> Pro</td><td> Ala</td><td> Pro</td>

<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td>

<td> Ile</td><td> Glu</td><td> Lys</td><td> Thr</td><td> Ile</td><td> Ser</td><td> Lys</td><td> Ala</td><td> Lys</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> Gin</td>

<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td>

<td> Val</td><td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro</td><td> Pro</td><td> Ser</td><td> Arg</td><td> Asp</td><td> Glu</td><td> Leu</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Val</td>

<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td>

<td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td><td> Ile</td><td> Ala</td><td> Val</td>

<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

<td> Glu</td><td> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Glu</td><td> Asn</td><td> Asn</td><td> Tyr</td><td> Lys</td><td> Thr</td><td> Thr</td><td> Pro</td>

<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>

<td> Pro</td><td> Val</td><td> Leu</td><td> Asp</td><td> Ser</td><td> Asp</td><td> Gly</td><td> Ser</td><td> Phe</td><td> Phe</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Lys</td><td> Leu</td><td> Thr</td>

<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>

<td> Val</td><td> Asp</td><td> Lys</td><td> Ser</td><td> Arg</td><td> Trp</td><td> Gin</td><td> Gin</td><td> Gly</td><td> Asn</td><td> Val</td><td> Phe</td><td> Ser</td><td> Cys</td><td> Ser</td><td> Val</td>

<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td>

<td> Met</td><td> His</td><td> Glu</td><td> Ala</td><td> Leu</td><td> His</td><td> Asn</td><td> His</td><td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Leu</td>

<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td>

<td> Ser</td><td> Pro</td><td> Gly</td><td> Lys</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

275 &lt;210&gt; 19 &lt;211&gt; 831 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 19 atggtaccgt gcacgctgct cctgctgttg gcggccgccc tggctccgac tcagacccgc 60 gccggcgaat tcggtggtga gtaccaggcc ctgaagaaga aggtggccca gctgaaggcc 120 aagaaccagg ccctgaagaa gaaggtggcc cagctgaagc acaagggcgg cggccccgcc 180 ccagagctcc tgggcggacc gtcagtcttc ctcttccccc caaaacccaa ggacaccctc 240 atgatctccc ggacccctga ggtcacatgc gtggtggtgg acgtgagcca cgaagaccct 300 gaggtcaagt tcaactggta cgtggacggc gtggaggtgc ataatgccaa gacaaagccg 360 cgggaggagc agtacaacag cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag 420 gactggctga atggcaagga gtacaagtgc aaggtctcca acaaagccct cccagccccc 480 atcgagaaaa ccatctccaa agccaaaggg cagccccgag aaccacaggt gtacaccctg 540 cccccatccc gggatgagct gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc 600 ttctatccca gcgacatcgc cgtggagtgg gagagcaatg ggcagccgga gaacaactac 660 aagaccacgc ctcccgtgtt ggactccgac ggctccttct tcctctacag caagctcacc 720 gtggacaaga gcaggtggca gcaggggaac gtcttctcat gctccgtgat gcatgaggct 780 ctgcacaacc actacacgca gaagagcctc tccctgtctc cgggtaaatg a 831

ΕΡ 2 361 932 Β1 &lt;210&gt; 20 &lt;211&gt; 245 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 20

Met Alá Leu Thr Phe Alá Leu 1 5

Lys Ser Ser Cys Ser Val Gly 20

Leu Gly Gly Pro Ser Val Phe 35

Leu Met Ile Ser Arg Thr Pro 50 55

Ser His Glu Asp Pro Glu Val 65 70

Glu Val His Asn Alá Lys Thr 85

Thr Tyr Arg Val Val Ser Val 100

Asn Gly Lys Glu Tyr Lys Cys 115

Pro Ile Glu Lys Thr Ile Ser 130 135

Gin Val Tyr Thr Leu Pro Pro 145 150

Val Ser Leu Thr Cys Leu Val 165

Val Glu Trp Glu Ser Asn Gly 180

Pro Pro Val Leu Asp Ser Asp 195

Thr Val Asp Lys Ser Arg Trp 210 215

Val Met His Glu Alá Leu His 225 230

Leu Ser Pro Gly Lys 245

Leu Val Alá Leu Leu Val Leu Ser Cys 10 15

Cys Pro Pro Cys Pro Alá Pro Glu Leu 25 30

Leu Phe Pro Pro Lys Pro Lys Asp Thr 40 45

Glu Val Thr Cys Val Val Val Asp Val 60

Lys Phe Asn Trp Tyr Val Asp Gly Val 75 80

Lys Pro Arg Glu Glu Gin Tyr Asn Ser 90 95

Leu Thr Val Leu His Gin Asp Trp Leu 105 110

Lys Val Ser Asn Lys Alá Leu Pro Alá 120 125

Lys Alá Lys Gly Gin Pro Arg Glu Pro 140

Ser Arg Asp Glu Leu Thr Lys Asn Gin 155 160

Lys Gly Phe Tyr Pro Ser Asp Ile Alá 170 175

Gin Pro Glu Asn Asn Tyr Lys Thr Thr 185 190

Gly Ser Phe Phe Leu Tyr Ser Lys Leu 200 205

Gin Gin Gly Asn Val Phe Ser Cys Ser 220

Asn His Tyr Thr Gin Lys Ser Leu Ser 235 240

ΕΡ 2 361 932 Β1 &lt;210&gt; 21 &lt;211&gt; 738 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 21 atggccttga cctttgcttt actggtggcc ctcctggtgc tcagctgcaa gtcaagctgc 60 tctgtgggct gcccgccgtg cccagctccg gaactgctgg gcggaccgtc agtcttcctc 120 ttccccccaa aacccaagga caccctcatg atctcccgga cccctgaggt cacatgcgtg 180 gtggtggacg tgagccacga agaccctgag gtcaagttca actggtacgt ggacggcgtg 240 gaggtgcata atgccaagac aaagccgcgg gaggagcagt acaacagcac gtaccgtgtg 300 gtcagcgtcc tcaccgtcct gcaccaggac tggctgaatg gcaaggagta caagtgcaag 360 gtctccaaca aagccctccc agcccccatc gagaaaacca tctccaaagc caaagggcag 420 ccccgagaac cacaggtgta caccctgccc ccatcccggg atgagctgac caagaaccag 480 gtcagcctga cctgcctggt caaaggcttc tatcccagcg acatcgccgt ggagtgggag 540 agcaatgggc agccggagaa caactacaag accacgcctc ccgtgttgga ctccgacggc 600 tccttcttcc tctacagcaa gctcaccgtg gacaagagca ggtggcagca ggggaacgtc 660 ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacgcagaa gagcctctcc 720 ctgtctccgg gtaaatga 738 &lt;210&gt; 22 &lt;211&gt; 430 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 22

<td> Met 1</td><td> Alá</td><td> Leu</td><td> Thr</td><td> Phe 5</td><td> Alá</td><td> Leu</td><td> Leu</td><td> Val</td><td> Alá 10</td><td> Leu</td><td> Leu</td><td> Val</td><td> Leu</td><td> Ser 15</td><td> Cys</td>

<td> Lys</td><td> Ser</td><td> Ser</td><td> Cys 20</td><td> Ser</td><td> Val</td><td> Gly</td><td> Cys</td><td> Asp 25</td><td> Leu</td><td> Pro</td><td> Gin</td><td> Thr</td><td> His 30</td><td> Ser</td><td> Leu</td>

<td> Gly</td><td> Ser</td><td> Arg 35</td><td> Arg</td><td> Thr</td><td> Leu</td><td> Met</td><td> Leu 40</td><td> Leu</td><td> Alá</td><td> Gin</td><td> Met</td><td> Arg 45</td><td> Arg</td><td> Ile</td><td> Ser</td>

<td> Leu</td><td> Phe 50</td><td> Ser</td><td> Cys</td><td> Leu</td><td> Lys</td><td> Asp 55</td><td> Arg</td><td> His</td><td> Asp</td><td> Phe</td><td> Gly 60</td><td> Phe</td><td> Pro</td><td> Gin</td><td> Glu</td>

<td> Glu 65</td><td> Phe</td><td> Gly</td><td> Asn</td><td> Gin</td><td> Phe 70</td><td> Gin</td><td> Lys</td><td> Alá</td><td> Glu</td><td> Thr 75</td><td> Ile</td><td> Pro</td><td> Val</td><td> Leu</td><td> His 80</td>

<td> Glu</td><td> Met</td><td> Ile</td><td> Gin</td><td> Gin 85</td><td> Ile</td><td> Phe</td><td> Asn</td><td> Leu</td><td> Phe 90</td><td> Ser</td><td> Thr</td><td> Lys</td><td> Asp</td><td> Ser 95</td><td> Ser</td>

<td> Alá</td><td> Alá</td><td> Trp</td><td> Asp 100</td><td> Glu</td><td> Thr</td><td> Leu</td><td> Leu</td><td> Asp 105</td><td> Lys</td><td> Phe</td><td> Tyr</td><td> Thr</td><td> Glu 110</td><td> Leu</td><td> Tyr</td>

<td> Gin</td><td> Gin</td><td> Leu 115</td><td> Asn</td><td> Asp</td><td> Leu</td><td> Glu</td><td> Alá 120</td><td> Cys</td><td> Val</td><td> Ile</td><td> Gin</td><td> Gly 125</td><td> Val</td><td> Gly</td><td> Val</td>

<td> Thr</td><td> Glu</td><td> Thr</td><td> Pro</td><td> Leu</td><td> Met</td><td> Lys</td><td> Glu</td><td> Asp</td><td> Ser</td><td> Ile</td><td> Leu</td><td> Alá</td><td> Val</td><td> Arg</td><td> Lys</td>

ΕΡ 2 361 932 Β1

<td colspan="5"> 130</td><td colspan="2"> 135</td><td colspan="9"> 140</td>

<td> Tyr</td><td> Phe</td><td> Gin</td><td> Arg</td><td> Ile</td><td> Thr</td><td> Leu</td><td> Tyr</td><td> Leu</td><td> Lys</td><td> Glu</td><td> Lys</td><td> Lys</td><td> Tyr</td><td> Ser</td><td> Pro</td>

<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td>

<td> Cys</td><td> Ala</td><td> Trp</td><td> Glu</td><td> Val</td><td> Val</td><td> Arg</td><td> Ala</td><td> Glu</td><td> Ile</td><td> Met</td><td> Arg</td><td> Ser</td><td> Phe</td><td> Ser</td><td> Leu</td>

<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td>

<td> Ser</td><td> Thr</td><td> Asn</td><td> Leu</td><td> Gin</td><td> Glu</td><td> Ser</td><td> Leu</td><td> Arg</td><td> Ser</td><td> Lys</td><td> Glu</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td>

<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td>

<td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Asp</td><td> Lys</td><td> Thr</td><td> His</td><td> Thr</td>

<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

<td> Cys</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Ala</td><td> Pro</td><td> Glu</td><td> Leu</td><td> Leu</td><td> Gly</td><td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td>

<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys</td><td> Pro</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu</td><td> Met</td><td> Ile</td><td> Ser</td><td> Arg</td><td> Thr</td><td> Pro</td>

<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>

<td> Glu</td><td> Val</td><td> Thr</td><td> Cys</td><td> Val</td><td> Val</td><td> Val</td><td> Asp</td><td> Val</td><td> Ser</td><td> His</td><td> Glu</td><td> Asp</td><td> Pro</td><td> Glu</td><td> Val</td>

<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td>

<td> Lys</td><td> Phe</td><td> Asn</td><td> Trp</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td><td> Val</td><td> Glu</td><td> Val</td><td> His</td><td> Asn</td><td> Ala</td><td> Lys</td><td> Thr</td>

<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td>

<td> Lys</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin</td><td> Tyr</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr</td><td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val</td>

<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td><td></td><td></td><td></td>

<td> Leu</td><td> Thr</td><td> Val</td><td> Leu</td><td> His</td><td> Gin</td><td> Asp</td><td> Trp</td><td> Leu</td><td> Asn</td><td> Gly</td><td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> Cys</td>

<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td>

<td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Lys</td><td> Ala</td><td> Leu</td><td> Pro</td><td> Ala</td><td> Pro</td><td> Ile</td><td> Glu</td><td> Lys</td><td> Thr</td><td> Ile</td><td> Ser</td>

<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td>

<td> Lys</td><td> Ala</td><td> Lys</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> Gin</td><td> Val</td><td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro</td><td> Pro</td>

<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td>

<td> Ser</td><td> Arg</td><td> Asp</td><td> Glu</td><td> Leu</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td>

<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>

<td> Lys</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td><td> Ile</td><td> Ala</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td><td> Gly</td>

<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>

<td> Gin</td><td> Pro</td><td> Glu</td><td> Asn</td><td> Asn</td><td> Tyr</td><td> Lys</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Pro</td><td> Val</td><td> Leu</td><td> Asp</td><td> Ser</td><td> Asp</td>

<td></td><td> 37 0</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td><td></td>

<td> Gly</td><td> Ser</td><td> Phe</td><td> Phe</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Lys</td><td> Leu</td><td> Thr</td><td> Val</td><td> Asp</td><td> Lys</td><td> Ser</td><td> Arg</td><td> Trp</td>

<td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td><td></td><td></td><td></td><td> 395</td><td></td><td></td><td></td><td></td><td> 400</td>

<td> Gin</td><td> Gin</td><td> Gly</td><td> Asn</td><td> Val</td><td> Phe</td><td> Ser</td><td> Cys</td><td> Ser</td><td> Val</td><td> Met</td><td> His</td><td> Glu</td><td> Ala</td><td> Leu</td><td> His</td>

<td></td><td></td><td></td><td></td><td> 405</td><td></td><td></td><td></td><td></td><td> 410</td><td></td><td></td><td></td><td></td><td> 415</td><td></td>

<td> Asn</td><td> His</td><td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Lys</td><td></td><td></td>

<td></td><td></td><td></td><td> 420</td><td></td><td></td><td></td><td></td><td> 425</td><td></td><td></td><td></td><td></td><td> 430</td><td></td><td></td>

&lt;210&gt; 23 &lt;211&gt; 1291 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

ΕΡ 2 361 932 Β1 &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 23 atggccttga cctttgcttt actggtggcc ctcctggtgc tcagctgcaa gtcaagctgc 60 tctgtgggct gtgatctgcc tcaaacccac agcctgggta gcaggaggac cttgatgctc 120 ctggcacaga tgaggagaat ctctcttttc tcctgcttga aggacagaca tgactttgga 180 tttccccagg aggagtttgg caaccagttc caaaaggctg aaaccatccc tgtcctccat 240 gagatgatcc agcagatctt caatctcttc agcacaaagg actcatctgc tgcttgggat 300 gagaccctcc tagacaaatt ctacactgaa ctctaccagc agctgaatga cctggaggcc 360 tgtgtgatac agggggtggg ggtgacagag actcccctga tgaaggagga ctccattctg 420 gctgtgagga aatacttcca aagaatcact ctctatctga aagagaagaa atacagccct 480 tgtgcctggg aggttgtcag agcagaaatc atgagatctt tttctttgtc aacaaacttg 540 caagaaagtt tacgtagtaa ggaaggtggc ggcggatccg gtggaggcgg gtccggcggt 600 ggagggagcg acaaaactca cacgtgcccg ccgtgcccag ctccggaact gctgggcgga 660 ccgtcagttt cctcttcccc ccaaaaccca aggacaccct catgatctcc cggacccctg 720 aggtcacatg cgtggtggtg gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt 780 acgtggacgg cgtggaggtg cataatgcca agacaaagcc gcgggaggag cagtacaaca 840 gcacgtaccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg aatggcaagg 900 agtacaagtg caaggtctcc aacaaagccc tcccagcccc catcgagaaa accatctcca 960 aagcaaaggg cagccccgag aaccacaggt gtacaccctg cccccatccc gggatgagct 1020 gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc ttctatccca gcgacatcgc 1080 cgtggagtgg gagagcaatg ggcagccgga gaacaactac aagaccacgc ctcccgtgtt 1140 ggactccgac ggctccttct tcctctacag caagctcacc gtggacaaga gcaggtggca 1200 gcaggggaac gtcttctcat gctccgtgat gcatgaggct ctgcacaacc actacacgca 1260 gaagagcctc tccctgtctc cgggtaaatg a 1291 &lt;210&gt; 24 &lt;211&gt; 428 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 24

<td> Met 1</td><td> Gly</td><td> Val</td><td> His</td><td> Glu 5</td><td> Cys</td><td> Pro</td><td> Ala</td><td> Trp</td><td> Leu 10</td><td> Trp</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Ser 15</td><td> Leu</td>

<td> Leu</td><td> Ser</td><td> Leu</td><td> Pro 20</td><td> Leu</td><td> Gly</td><td> Leu</td><td> Pro</td><td> Val 25</td><td> Leu</td><td> Gly</td><td> Ala</td><td> Pro</td><td> Pro 30</td><td> Arg</td><td> Leu</td>

<td> Ile</td><td> Cys</td><td> Asp 35</td><td> Ser</td><td> Arg</td><td> Val</td><td> Leu</td><td> Glu 40</td><td> Arg</td><td> Tyr</td><td> Leu</td><td> Leu</td><td> Glu 45</td><td> Ala</td><td> Lys</td><td> Glu</td>

<td> Ala</td><td> Glu 50</td><td> Asn</td><td> Ile</td><td> Thr</td><td> Thr</td><td> Gly 55</td><td> Cys</td><td> Ala</td><td> Glu</td><td> His</td><td> Cys 60</td><td> Ser</td><td> Leu</td><td> Asn</td><td> Glu</td>

<td> Asn 65</td><td> Ile</td><td> Thr</td><td> Val</td><td> Pro</td><td> Asp 70</td><td> Thr</td><td> Lys</td><td> Val</td><td> Asn</td><td> Phe 75</td><td> Tyr</td><td> Ala</td><td> Trp</td><td> Lys</td><td> Arg 80</td>

<td> Met</td><td> Glu</td><td> Val</td><td> Gly</td><td> Gin</td><td> Gin</td><td> Ala</td><td> Val</td><td> Glu</td><td> Val</td><td> Trp</td><td> Gin</td><td> Gly</td><td> Leu</td><td> Ala</td><td> Leu</td>

90 95

ΕΡ 2 361 932 Β1

<td colspan="2"> Leu Ser Glu Alá Val·</td><td rowspan="2"> Leu</td><td rowspan="2"> Arg</td><td rowspan="2"> Gly Gin 105</td><td rowspan="2"> Alá Leu Leu Val Asn Ser ! 110</td>

<td></td><td> 100</td>

<td> Gin</td><td> Pro Trp Glu Pro 115</td><td> Leu</td><td> Gin</td><td> Leu His 120</td><td> Val Asp Lys Alá Val Ser Gly 125</td>

<td> Leu</td><td> Arg Ser Leu Thr 130</td><td> Thr</td><td> Leu 135</td><td> Leu Arg</td><td> Alá Leu Gly Alá Gin Lys Glu 140</td>

<td> Alá 145</td><td> Ile Ser Pro Pro</td><td> Asp 150</td><td> Alá</td><td> Alá Ser</td><td> Alá Alá Pro Leu Arg Thr Ile 155 160</td>

<td> Thr</td><td> Alá Asp Thr Phe 165</td><td> Arg</td><td> Lys</td><td> Leu Phe</td><td> Arg Val Tyr Ser Asn Phe Leu 170 175</td>

<td> Arg</td><td> Gly Lys Leu Lys 180</td><td> Leu</td><td> Tyr</td><td> Thr Gly 185</td><td> Glu Alá Cys Arg Thr Gly Asp 190</td>

<td> Arg</td><td> Glu Phe Alá Gly 195</td><td> Alá</td><td> Alá</td><td> Alá Val 200</td><td> Asp Lys Thr His Thr Cys Pro 205</td>

<td> Pro</td><td> Cys Pro Alá Pro 210</td><td> Glu</td><td> Leu 215</td><td> Leu Gly</td><td> Gly Pro Ser Val Phe Leu Phe 220</td>

<td> Pro 225</td><td> Pro Lys Pro Lys</td><td> Asp 230</td><td> Thr</td><td> Leu Met</td><td> Ile Ser Arg Thr Pro Glu Val 235 240</td>

<td> Thr</td><td> Cys Val Val Val 245</td><td> Asp</td><td> Val</td><td> Ser His</td><td> Glu Asp Pro Glu Val Lys Phe 250 255</td>

<td> Asn</td><td> Trp Tyr Val Asp 260</td><td> Gly</td><td> Val</td><td> Glu Val 265</td><td> His Asn Alá Lys Thr Lys Pro 270</td>

<td> Arg</td><td> Glu Glu Gin Tyr 275</td><td> Asn</td><td> Ser</td><td> Thr Tyr 280</td><td> Arg Val Val Ser Val Leu Thr 285</td>

<td> Val</td><td> Leu His Gin Asp 290</td><td> Trp</td><td> Leu 295</td><td> Asn Gly</td><td> Lys Glu Tyr Lys Cys Lys Val 300</td>

<td> Ser 305</td><td> Asn Lys Alá Leu</td><td> Pro 310</td><td> Alá</td><td> Pro Ile</td><td> Glu Lys Thr Ile Ser Lys Alá 315 320</td>

<td> Lys</td><td> Gly Gin Pro Arg 325</td><td> Glu</td><td> Pro</td><td> Gin Val</td><td> Tyr Thr Leu Pro Pro Ser Arg 330 335</td>

<td> Asp</td><td> Glu Leu Thr Lys 340</td><td> Asn</td><td> Gin</td><td> Val Ser 345</td><td> Leu Thr Cys Leu Val Lys Gly 350</td>

<td> Phe</td><td> Tyr Pro Ser Asp 355</td><td> Ile</td><td> Alá</td><td> Val Glu 360</td><td> Trp Glu Ser Asn Gly Gin Pro 365</td>

<td> Glu</td><td> Asn Asn Tyr Lys 370</td><td> Thr</td><td> Thr 375</td><td> Pro Pro</td><td> Val Leu Asp Ser Asp Gly Ser 380</td>

<td> Phe 385</td><td> Phe Leu Tyr Ser</td><td> Lys 390</td><td> Leu</td><td> Thr Val</td><td> Asp Lys Ser Arg Trp Gin Gin 395 400</td>

<td> Gly</td><td> Asn Val Phe Ser</td><td> Cys</td><td> Ser</td><td> Val Met</td><td> His Glu Alá Leu His Asn His</td>

405 410 415

ΕΡ 2 361 932 Β1

Tyr Thr Gin Lys Ser Leu Ser Leu Ser Pro Gly Lys 420 425 &lt;210&gt; 25 &lt;211&gt; 1287 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic construct &lt;400&gt; 25 atgggagtgc ctgggcctcc aggtacctct agcttgaatg atggaggtcg gtcctgcggg catgtggata gcccagaagg actgctgaca aagctgtaca gtcgacaaaa gtcttcctct acatgcgtgg gacggcgtgg taccgtgtgg aagtgcaagg aaagggcagc aagaaccagg gagtgggaga tccgacggct gggaacgtct agcctctccc acgaatgtcc cagtcctggg tggaggccaa agaatatcac ggcagcaggc gccaggccct aagccgtcag aagccatctc ctttccgcaa caggggaggc ctcacacatg tccccccaaa tggtggacgt aggtgcataa tcagcgtcct tctccaacaa cccgagaacc tcagcctgac gcaatgggca ccttcttcct tctcatgctc tgtctccggg tgcctggctg cgccccacca ggaggccgag tgtcccagac cgtagaagtc gttggtcaac tggccttcgc ccctccagat actcttccga ctgcagaaca cccaccgtgc acccaaggac gagccacgaa tgccaagaca caccgtcctg agccctccca acaggtgtac ctgcctggtc gccggagaac ctacagcaag cgtgatgcat taaatga tggcttctcc cgcctcatct aatatcacga accaaagtta tggcagggcc tcttcccagc agcctcacca gcggcctcag gtctactcca ggggacagag ccagctccgg accctcatga gaccctgagg aagccgcggg caccaggact gcccccatcg accctgcccc aaaggcttct aactacaaga ctcaccgtgg gaggctctgc tgtccctgct gtgacagccg cgggctgtgc atttctatgc tggccctgct cgtgggagcc ctctgcttcg ctgctccact atttcctccg agttcgccgg aactcctggg tctcccggac tcaagttcaa aggagcagta ggctgaatgg agaaaaccat catcccggga atcccagcga ccacgcctcc acaagagcag acaaccacta gtcgctccct agtcctggag tgaacactgc ctggaagagg gtcggaagct cctgcagctg ggctctggga ccgaacaatc gggaaagctg cgccgctgcg cggaccgtca ccctgaggtc ctggtacgtg caacagcacg caaggagtac ctccaaagcc tgagctgacc catcgccgtg cgtgttggac gtggcagcag cacgcagaag &lt;210&gt; 26 &lt;211&gt; 11 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic peptide &lt;400&gt; 26

Pro Lys Asn Ser Ser Met Ile Ser Asn Thr Pro 15 10 &lt;210&gt; 27 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic peptide

ΕΡ 2 361 932 Β1 &lt;400&gt; 27

His Gin Ser Leu Gly Thr Gin 1 5 &lt;210&gt; 28 &lt;211&gt;8 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic peptide &lt;400&gt; 28

His Gin Asn Leu Ser Asp G±y Lys 1 5 &lt;210&gt; 29 &lt;211&gt;8 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic peptide &lt;400&gt; 29

His Gin Asn Ile Ser Asp Gly Lys 1 5 &lt;210&gt; 30 &lt;211&gt;8 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic peptide &lt;400&gt; 30

Val Ile Ser Ser His Leu Gly Gin 1 5 &lt;210&gt; 31 &lt;211&gt;8 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;400&gt; 31

ΕΡ 2 361 932 Β1

Glu Phe Alá Gly Alá Alá Alá Val 1 5 &lt;210&gt; 32 &lt;211&gt; 20 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;220&gt;

&lt;223&gt; This sequence may encompass 1-10 Gly-Ala repeats &lt;400&gt; 32

Gly Alá Gly Alá Gly Alá Gly Alá Gly Alá Gly Alá Gly Alá Gly Alá 15 10 15

Gly Alá Gly Alá 20 &lt;210&gt; 33 &lt;211&gt; 30 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;220&gt;

&lt;223&gt; This sequence may encompass 1-10 Gly-Gly-Ser repeats &lt;400&gt; 33

Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly 1 5 10 15

Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser 20 25 30 &lt;210&gt; 34 &lt;211&gt; 80 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;220&gt;

&lt;221 &gt; misc_feature &lt;222&gt; (1)..(30) &lt;223&gt; This region may encompass 1-10 Gly-Gly-Ser repeats &lt;220&gt;

&lt;221 &gt; misc_feature &lt;222&gt; (31)..(80)

ΕΡ 2 361 932 Β1 &lt;223&gt; This region may encompass 1-10 Gly-Gly-Gly-Gly-Ser repeats &lt;400&gt; 34

<td> Gly 1</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly 5</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly 10</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Ser 15</td><td> Gly</td>

<td> Gly</td><td> Ser</td><td> Gly</td><td> Gly 20</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly 25</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Ser 30</td><td> Gly</td><td> Gly</td>

<td> Gly</td><td> Gly</td><td> Ser 35</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser 40</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser 45</td><td> Gly</td><td> Gly</td><td> Gly</td>

<td> Gly</td><td> Ser 50</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser 55</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser 60</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td>

<td> Ser 65</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser 70</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser 75</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser 80</td>

&lt;210&gt; 35 &lt;211&gt;3 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;400&gt; 35

Gly Gly Gly 1 &lt;210&gt; 36 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;400&gt; 36

Ser Gly Gly Ser Gly Gly Ser 1 5 &lt;210&gt; 37 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;400&gt; 37

Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Gly 15 10 15

ΕΡ 2 361 932 Β1 &lt;210&gt; 38 &lt;211&gt; 16 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;400&gt; 38

Gly Gly Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 15 10 15 &lt;210&gt; 39 &lt;211&gt; 18 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;400&gt; 39

Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly 15 10 15

Gly Ser &lt;210&gt; 40 &lt;211&gt; 50 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;220&gt;

&lt;223&gt; This sequence may encompass 1-10 Gly-Gly-Gly-Gly-Ser repeats &lt;400&gt; 40

<td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly</td>

<td> 1</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td><td></td>

<td> Gly</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td> Gly</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

Gly Ser 50 &lt;210&gt; 41 &lt;211&gt; 19 &lt;212&gt; DNA

EP 2 361 932 Β1 &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 41 gctggctagc caccatgga 19 &lt;210&gt; 42 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 42 cttgtcatcg tcgtccttgt agtcgtcacc agtggaacct ggaac 45 &lt;210&gt; 43 &lt;211&gt; 67 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 43 gactacaagg acgacgatga caaggacaaa actcacacat gcccaccgtg cccagctccg 60 gaactcc 67 &lt;210&gt; 44 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 44 tagtggatcc tcatttaccc g 21 &lt;210&gt; 45 &lt;211&gt; 38 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 45 gctacctgca ggccaccatg gtctcccagg ccctcagg 38 &lt;210&gt; 46 &lt;211&gt; 51 &lt;212&gt; DNA

ΕΡ 2 361 932 Β1 &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 46 cagttccgga gctgggcacg gcgggcacgt gtgagttttg tcgggaaatg g &lt;210&gt; 47 &lt;211&gt; 33 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 47 ttactgcaga aggttatgca gcgcgtgaac atg 33 &lt;210&gt; 48 &lt;211&gt; 38 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 48 tttttcgaat tcagtgagct ttgttttttc cttaatcc 38 &lt;210&gt; 49 &lt;211&gt; 34 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 49 ggtaagcttg ccatggagct gaggccctgg ttgc 34 &lt;210&gt; 50 &lt;211&gt; 27 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 50 gttttcaatc tctaggaccc actcgcc 27 &lt;210&gt; 51 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

ΕΡ 2 361 932 Β1 &lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 51 gccaggccac atgactactc ege 23 &lt;210&gt; 52 &lt;211&gt; 34 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 52 ggtgaattct cactcaggca ggtgtgaggg cagc 34 &lt;210&gt; 53 &lt;211&gt; 37 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 53 gctactgcag ccaccatggc cttgaccttt getttae 37 &lt;210&gt; 54 &lt;211&gt; 35 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 54 egttgaatte tteettaett cttaaacttt ettge 35 &lt;210&gt; 55 &lt;211&gt; 73 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 55 cagttccgga gctgggcacg gcgggcacgt gtgagttttg tcttccttac ttcttaaact ttttgcaagt ttg 73 &lt;210&gt; 56 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer

ΕΡ 2 361 932 Β1 &lt;400&gt; 56 gtcaggatcc ggcggtggag ggagcgacaa aactcacacg tgccc 45 &lt;210&gt; 57 &lt;211&gt; 32 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 57 tgacgcggcc gctcatttac ccggagacag gg 32 &lt;210&gt; 58 &lt;211&gt; 32 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 58 ccgctagcct gcaggccacc atggccttga cc 32 &lt;210&gt; 59 &lt;211&gt; 34 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 59 ccggatccgc cgccaccttc cttactacgt aaac 34 &lt;210&gt; 60 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;400&gt; 60

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 15 10 15 &lt;210&gt; 61 &lt;211&gt; 60 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer

ΕΡ 2 361 932 Β1 &lt;400&gt; 61 gtcaggatcc ggtggaggcg ggtccggcgg tggagggagc gacaaaactc acacgtgccc 60 &lt;210&gt; 62 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 62 atagaagcct ttgaccaggc 20 &lt;210&gt; 63 &lt;211&gt; 84 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic oligonucleotide &lt;400&gt; 63 gccggcgaat tcggtggtga gtaccaggcc ctgaagaaga aggtggccca gctgaaggcc 60 aagaaccagg ccctgaagaa gaag 84 &lt;210&gt; 64 &lt;211&gt; 58 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic oligonucleotide &lt;400&gt; 64 gtggcccagc tgaagcacaa gggcggcggc cccgccccag agctcctggg cggaccga 58 &lt;210&gt; 65 &lt;211&gt; 82 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic oligonucleotide &lt;400&gt; 65 cggtccgccc aggagctctg gggcggggcc gccgcccttg tgcttcagct gggccacctt 60 cttcttcagg gcctggttct tg 82 &lt;210&gt; 66 &lt;211&gt; 60 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

ΕΡ 2 361 932 Β1 &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic oligonucleotide &lt;400&gt; 66 gccttcagct gggccacctt cttcttcagg gcctggtact caccaccgaa ttcgccggca 60 &lt;210&gt; 67 &lt;211&gt; 62 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic oligonucleotide í5 &lt;400&gt; 67 ccggtgacag ggaattcggt ggtgagtacc aggccctgga gaaggaggtg gcccagctgg 60 ag 62 &lt;210&gt; 68 &lt;211&gt; 83 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic oligonucleotide &lt;400&gt; 68 gccgagaacc aggccctgga gaaggaggtg gcccagctgg agcacgaggg tggtggtccc 60 gctccagagc tgctgggcgg aca 83 &lt;210&gt; 69 &lt;211&gt; 55 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic oligonucleotide &lt;400&gt; 69 gtccgcccag cagctctgga gcgggaccac caccctcgtg ctccagctgg gccac 55 &lt;210&gt; 70 &lt;211&gt; 90 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic oligonucleotide &lt;400&gt; 70 ctccttctcc agggcctggt tctcggcctc cagctgggcc acctccttct ccagggcctg 60 gtactcacca ccgaattccc tgtcaccgga 90

ΕΡ 2 361 932 Β1 &lt;210&gt; 71 &lt;211&gt; 37 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 71 gctactgcag ccaccatggc cttgaccttt gctttac 37 &lt;210&gt; 72 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 72 cagttccgga gctgggcacg gcggagagcc cacagagcag cttg 44 &lt;210&gt; 73 &lt;211&gt; 42 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 73 gtggtcatat gggcattgaa ggcagaggcg ccgctgcggt cg 42 &lt;210&gt; 74 &lt;211&gt; 50 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 74 ggtggttgct cttccgcaaa aacccggaga cagggagaga ctcttctgcg &lt;210&gt; 75 &lt;211&gt; 32 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 75 aatctagagc cccaccacgc ctcatctgtg ac 32 &lt;210&gt; 76 &lt;211&gt; 30 &lt;212&gt; DNA

ΕΡ 2 361 932 Β1 &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 76 ttgaattctc tgtcccctgt cctgcaggcc 30 &lt;210&gt; 77 &lt;211&gt; 27 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 77 gtacctgcag gcggagatgg gggtgca 27 &lt;210&gt; 78 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 78 cctggtcatc tgtcccctgt cc 22 &lt;210&gt; 79 &lt;211&gt; 56 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 79 gtccaacctg caggaagctt gccgccacca tgggagtgca cgaatgtcct gcctgg 56 &lt;210&gt; 80 &lt;211&gt; 67 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 80 gccgaattca gttttgtcga ccgcagcggc gccggcgaac tctctgtccc ctgttctgca 60 ggcctcc 67 &lt;210&gt; 81 &lt;211&gt;5 &lt;212&gt; PRT

ΕΡ 2 361 932 Β1 &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;400&gt; 81

Gly Gly Gly Gly Ser 1 5 &lt;210&gt; 82 &lt;211&gt; 69 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 82 gctgcggtcg acaaaactca cacatgccca ccgtgcccag ctccggaact cctgggcgga 60 ccgtcagtc 69 &lt;210&gt; 83 &lt;211&gt; 36 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 83 attggaattc tcatttaccc ggagacaggg agaggc 36 &lt;210&gt; 84 &lt;211&gt;4 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 84

Glu Leu Leu Gly 1 &lt;210&gt; 85 &lt;211&gt; 10 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;220&gt;

&lt;223&gt; This sequence may encompass 1-10 Gly repeats &lt;400&gt; 85

ΕΡ 2 361 932 Β1

Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 15 10 &lt;210&gt; 86 &lt;211&gt; 10 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic linker peptide &lt;400&gt; 86

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 15 10 &lt;210&gt; 87 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic peptide fragment &lt;400&gt; 87

Ser Val Gly Cys Pro Pro Cys 1 5 &lt;210&gt; 88 &lt;211&gt;6 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic peptide fragment &lt;400&gt; 88

Val Gly Cys Pro Pro Cys 1 5 &lt;210&gt; 89 &lt;211&gt;7 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic peptide fragment &lt;400&gt; 89

Ser Thr Gly Cys Pro Pro Cys 1 5

ΕΡ 2 361 932 Β1 &lt;210&gt; 90 &lt;211&gt;4 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic peptide fragment &lt;400&gt; 90

Cys Pro Pro Cys 1 &lt;210&gt; 91 &lt;211&gt;8 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic FLAG peptide &lt;400&gt; 91

Asp Tyr Lys Asp Asp Asp Asp Lys 1 5 &lt;210&gt; 92 &lt;211&gt; 48 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 92 ctagcctgca ggaagcttgc cgccaccatg accaacaagt gtctcctc 48 &lt;210&gt; 93 &lt;211&gt; 51 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 93 tttgtcgacc gcagcggcgc cggcgaactc gtttcggagg taacctgtaa g 51 &lt;210&gt; 94 &lt;211&gt; 37 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer

EP 2 361 932 Β1 &lt;400&gt; 94 ggcaagcttg ccgccaccat ggagacagac acactcc 37 &lt;210&gt; 95 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 95 tcagtggtga tggtgatgat gtttacccgg agacagggag 40 &lt;210&gt; 96 &lt;211&gt; 53 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 96 ggtaaacatc atcaccatca ccactgagaa ttccaatatc actagtgaat tcg &lt;210&gt; 97 &lt;211&gt; 32 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 97 gctatttagg tgacactata gaatactcaa gc 32 &lt;210&gt; 98 &lt;211&gt; 1269 &lt;212&gt; DNA &lt;213&gt; Homo sapiens &lt;400&gt; 98

ΕΡ 2 361 932 Β1 atgaccaaca agtgtctcct ccaaattgct ctcctgttgt gcttctccac tacagctctt 60 tccatgagct acaacttgct tggattccta caaagaagca gcaattttca gtgtcagaag 120 ctcctgtggc aattgaatgg gaggcttgaa tattgcctca aggacaggat gaactttgac 180 atccctgagg agattaagca gctgcagcag ttccagaagg aggacgccgc attgaccatc 240 tatgagatgc tccagaacat ctttgctatt ttcagacaag attcatctag cactggctgg 300 aatgagacta ttgttgagaa cctcctggct aatgtctatc atcagataaa ccatctgaag 360 acagtcctgg aagaaaaact ggagaaagaa gatttcacca ggggaaaact catgagcagt 420 ctgcacctga aaagatatta tgggaggatt ctgcattacc tgaaggccaa ggagtacagt 480 cactgtgcct ggaccatagt cagagtggaa atcctaagga acttttactt cattaacaga 540 cttacaggtt acctccgaaa cgagttcgcc ggcgccgctg cggtcgacaa aactcacaca 600 tgcccaccgt gcccagctcc ggaactcctg ggcggaccgt cagtcttcct cttcccccca 660 aaacccaagg acaccctcat gatctcccgg acccctgagg tcacatgcgt ggtggtggac 720 gtgagccacg aagaccctga ggtcaagttc aactggtacg tggacggcgt ggaggtgcat 780 aatgccaaga caaagccgcg ggaggagcag tacaacagca cgtaccgtgt ggtcagcgtc 840 ctcaccgtcc tgcaccagga ctggctgaat ggcaaggagt acaagtgcaa ggtctccaac 900 aaagccctcc cagcccccat cgagaaaacc atctccaaag ccaaagggca gccccgagaa 960 ccacaggtgt acaccctgcc cccatcccgg gatgagctga ccaagaacca ggtcagcctg 1020 acctgcctgg tcaaaggctt ctatcccagc gacatcgccg tggagtggga gagcaatggg 1080 cagccggaga acaactacaa gaccacgcct cccgtgttgg actccgacgg ctccttcttc 1140 ctctacagca agctcaccgt ggacaagagc aggtggcagc aggggaacgt cttctcatgc 1200 tccgtgatgc atgaggctct gcacaaccac tacacgcaga agagcctctc cctgtctccg 1260 ggtaaatga 1269 &lt;210&gt; 99 &lt;211&gt; 422 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 99

ΕΡ 2 361 932 Β1

Met Thr Asn Lys Cys Leu Leu Gin 1 5

Thr Thr Alá Leu Ser Met Ser Tyr 20

Ser Ser Asn Phe Gin Cys Gin Lys 35 40

Leu Glu Tyr Cys Leu Lys Asp Arg 50 55

Ile Lys Gin Leu Gin Gin Phe Gin 65 70

Tyr Glu Met Leu Gin Asn Ile Phe 85

Ser Thr Gly Trp Asn Glu Thr Ile 100

Tyr His Gin Ile Asn His Leu Lys 115 120

Lys Glu Asp Phe Thr Arg Gly Lys 130 135

Arg Tyr Tyr Gly Arg Ile Leu His 145 150

His Cys Alá Trp Thr Ile Val Arg 165

Phe Ile Asn Arg Leu Thr Gly Tyr 180

Alá Alá Val Asp Lys Thr His Thr 195 200

Leu Leu Gly Gly Pro Ser Val Phe 210 215

Thr Leu Met Ile Ser Arg Thr Pro 225 230

Ile Alá Leu Leu Leu Cys Phe Ser 10 ' 15

Asn Leu Leu Gly Phe Leu Gin Arg 25 30

Leu Leu Trp Gin Leu Asn Gly Arg 45

Met Asn Phe Asp Ile Pro Glu Glu 60

Lys Glu Asp Alá Alá Leu Thr Ile 75 80

Alá Ile Phe Arg Gin Asp Ser Ser 90 95

Val Glu Asn Leu Leu Alá Asn Val 105 110

Thr Val Leu Glu Glu Lys Leu Glu 125

Leu Met Ser Ser Leu His Leu Lys 140

Tyr Leu Lys Alá Lys Glu Tyr Ser 155 160

Val Glu Ile Leu Arg Asn Phe Tyr 170 175

Leu Arg Asn Glu Phe Alá Gly Alá 185 190

Cys Pro Pro Cys Pro Alá Pro Glu 205

Leu Phe Pro Pro Lys Pro Lys Asp 220

Glu Val Thr Cys Val Val Val Asp 235 240

ΕΡ 2 361 932 Β1

<td> Val</td><td> Ser</td><td> His</td><td> Glu</td><td> Asp 245</td><td> Pro</td><td> Glu</td><td> Val</td><td> Lys</td><td> Phe Asn Trp Tyr Val Asp Gly 250 255</td>

<td> Val</td><td> Glu</td><td> Val</td><td> His</td><td> Asn</td><td> Ala</td><td> Lys</td><td> Thr</td><td> Lys</td><td> Pro Arg Glu Glu Gin Tyr Asn</td>

<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td> 270</td>

<td> Ser</td><td> Thr</td><td> Tyr</td><td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val</td><td> Leu</td><td> Thr Val Leu His Gin Asp Trp</td>

<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td> 285</td>

<td> Leu</td><td> Asn</td><td> Gly</td><td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> Cys</td><td> Lys</td><td> Val Ser Asn Lys Ala Leu Pro</td>

<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td> 300</td>

<td> Ala</td><td> Pro</td><td> Ile</td><td> Glu</td><td> Lys</td><td> Thr</td><td> Ile</td><td> Ser</td><td> Lys</td><td> Ala Lys Gly Gin Pro Arg Glu</td>

<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td> 315 320</td>

<td> Pro</td><td> Gin</td><td> Val</td><td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro</td><td> Pro</td><td> Ser</td><td> Arg Asp Glu Leu Thr Lys Asn</td>

<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330 335</td>

<td> Gin</td><td> Val</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Gly Phe Tyr Pro Ser Asp Ile</td>

<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td> 350</td>

<td> Ala</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td><td> Gly</td><td> Gin</td><td> Pro Glu Asn Asn Tyr Lys Thr</td>

<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td> 365</td>

<td> Thr</td><td> Pro</td><td> Pro</td><td> Val</td><td> Leu</td><td> Asp</td><td> Ser</td><td> Asp</td><td> Gly</td><td> Ser Phe Phe Leu Tyr Ser Lys</td>

<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td> 380</td>

<td> Leu</td><td> Thr</td><td> Val</td><td> Asp</td><td> Lys</td><td> Ser</td><td> Arg</td><td> Trp</td><td> Gin</td><td> Gin Gly Asn Val Phe Ser Cys</td>

<td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td><td></td><td></td><td> 395 400</td>

<td> Ser</td><td> Val</td><td> Met</td><td> His</td><td> Glu</td><td> Ala</td><td> Leu</td><td> His</td><td> Asn</td><td> His Tyr Thr Gin Lys Ser Leu</td>

<td></td><td></td><td></td><td></td><td> 405</td><td></td><td></td><td></td><td></td><td> 410 415</td>

<td> Ser</td><td> Leu</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Lys</td><td></td><td></td><td></td><td></td>

420 &lt;210&gt; 100 &lt;211&gt; 102 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 100 tttaagcttg ccgccaccat ggagacagac acactcctgc tatgggtact gctgctctgg 60 gttccaggtt ccactggtga caaaactcac acatgcccac cg 102 &lt;210&gt; 101 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 101

ΕΡ 2 361 932 Β1 ggtcagctca tcgcgggatg gg 22 &lt;210&gt; 102 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 102 cccatcccgc gatgagctga cc 22 &lt;210&gt; 103 &lt;211&gt;9 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic Kozák sequence &lt;400&gt; 103 gccgccacc 9 &lt;210&gt; 104 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 104 gagcagtacg ctagcacgta ccg 23 &lt;210&gt; 105 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 105 ggtacgtgct agcgtactgc tcc 23 &lt;210&gt; 106 &lt;211&gt; 69 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic primer &lt;400&gt; 106

100

ΕΡ 2 361 932 Β1 ctgacggtcc gcccaggagt tccggagctg ggcacggtgg gcatgtgtga gttttgtcga 60 ccgcagcgg 69 &lt;210&gt; 107 &lt;211&gt;6 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Description of Artificial Sequence: Synthetic 6xHis tag