Deoxyribonucleic acids, recombinant deoxyribonucleic acids, hosts containing them, polypeptides and process for their production
Abstract
The invention relates to recombinant DNA molecules and using this transformed hosts which produce polypeptides having the activity of human lymphoblastoid interferon. The invention further relates to methods for preparing these recombinant DNA molecules, these hosts and lymphoblastoid interferon-like polypeptides. The inventive polypeptides are useful as immunomodulators, especially as anti-viral, anti-tumor and anti-cancer agents.

Term
No projected expiry on record.
- Priority
- Filed
- Granted
- Today
4 claims: 4 independent, 0 dependent
- 1Claims. ’Αξιώσεις. 1) A method of DNA preparation comprising a DNA sequence derived from human lymphoblastoid cells or a portion, a variant or a mutant of said sequence, and which is probed for a polypeptide such as the DNA or any DNA thereof;or any method that involves. 1) Μέθοδος παρασκευπης DNA περιέχοντος μία σειρά DNA προερχομένη άπό ανθρώπινα λεμφοβλαστοειδή κύτταρα ή ένός τμήματος ,μιας παραλλαγής ή ένός μεταλλάκτου τής άναο^ερθείσης σειράς,κω.δικοποι ουντος διά ένα πολυπεπτίδιο σάν τό ίντερφερόν ή ένός ΌΝΑ τό όποιον ύβριδοποιεΐται πρός τό άναφερθέν DNA, ή όποία μέθοδος περιλαμβάνει. (i) preparation from EULYILN-RNA of a single-stranded complementary DMA and, if one double-stranded cDNA is required, or (2) partial separation of the chromosomal DNA of human lymphoblastoid cells and selection of fragments containing genomes of LYIFN chromosomes, and if each DNA fragment is sequenced, digestion of said DNA with a suitable extracellular DNA or, if a DMA ligand is required, insertion of said DNA into a suitable LNA vector. (ί) παρασκευή άπό EULYILN-τη RNA ένός συμπληρωματικού DMA μονής έλικος καί, έάν απαιτείται άπό έκεΐ ένός CDNA διπλής έλικος ,ή (2) μερικό διαχωρισμό τού χρωμοσωμικού DNA τών ανθρωπίνων λεμφοβλαστοειδών κυττάρων καί έκλογή τμημάτων τά οποία περιέχουν γένη χρωμοσωμικού LYIFN καί έάν άπαιτεΐται ένα τμήμα τής άναφερθείσης σειράς ,περιορισμόν τού άναφερθέντος DNA μέ μία κατάλληλο ένδονουκλεάση ή μερική χώνευσι τού άναφερθέντος DNA μέ μία κατάλληλο έξωτουκλεάση ή έάν απαιτείται άνασυνδετικύ DMA ,εισαγωγή τού άναφερθέντος DNA είς ενα κατάλληλο ενδιάμεσο ξενιστή LNA.
- 22) Μέθοδος παρασκευής άνασυνδετικού DNA συμφώνως πρός τήν άξίωσιν I περιλαμβάνουσα τό στάδιο εισαγωγής έντός ένός ενδιαμέσου ξενιστού ΒΝΑ ένός DNA προερχομένου άπό άνθρώπινα λεμφοβλαστοειδή κύτταρα ή ένός τμήματος ,μιάς παραλλαγής ή ένός μεταλλάκτου τής άνιφερθείσης σειράς ,κωδικοποιούσης διά ένα πολυπεπτίδιο σάν τήν ίντερφερόνη. A method for the preparation of a ligand DNA according to claim I comprising the step of inserting into a DNA vector a human DNA derived from human lymphoblastoid cells or a fragment, a variant or a mutant of a single transcript.
- 33) Μέθοδος παρασκευής άνασυνδετικού DNA συμφώνως πρός τήν άξίωσιν 2 χαρακτηριζόμενη άπό τό δτι τό DNA προέρχεται άπό κύτταρα NAMALWA A method for the preparation of a DNA ligand according to claim 2, characterized in that the DNA is derived from NAMALWA cells.
- 44) recombinant DNA preparation method comprising the spanked ACATCCCAATGGCCCTGTCCTTTTCTTTACCGATGGCCGTGCTGGTGCTCAC-CCACAAATCCATO TGTTCTCTGGGCTGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTCCTGGCACAAATGGGAAGAATCCCCCCTTTCTCCTGCCTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGGCTCAAGCCATCTCTGTCCTCCATGAGATGATO cagcagaccttcaatctcttcagcacaaBgactcatctgAtaottc-ggaacagagcctccta ^ 4) Μέθοδος παρασκευής άνασυνδετικού DNA περιέχοντος τήν δειρά ACATCCCAATGGCCCTGTCCTTTTCTTTACCGATGGCCGTGCTGGTGCTCAC-CCACAAATCCATO TGTTCTCTGGGCTGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTCCTGGCACAAATGGGAAGAATCCCCCCTTTCTCCTGCCTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGGCTCAAGCCATCTCTGTCCTCCATGAGATGATO cagcagaccttcaatctcttcagcacaaBgactcatctgAtaottc-ggaacagagcctccta^ AAAAATTTTCCACTGA ;, N Earth AAAAATTTTCCACTGA ;,N Γή Process for the preparation of the sequence containing the DNA ligand. Μέθοδος παρασκευής Ανασυνδετικοϋ DNA περιέχοντος τήν σειρά. ATCTGAACCAGCTCAGCAGCATCCACAACATCTACAATGGCCTTGACTTTTTATTTACTC ATCTGAACCAGCTCAGCAGCATCCACAACATCTACAATGGCCTTGACTTTTTATTTACTC GTGGCCCTAGTGG'i'GCTCAGCTACAAGTCATTCAGCTCTCTGGGGTGTGATCTGGCTCAG GTGGCCCTAGTGG'i'GCTCAGCTACAAGTCATTCAGCTCTCTGGGGTGTGATCTGGCTCAG ACTCACAGCCTGGGTAACAGGAGGGCCTTGATACTCCTGGCACAAATGCGAAGAATCTCT ACTCACAGCCTGGGTAACAGGAGGGCCTTGATACTCCTGGCACAAATGCGAAGAATCTCT CCTTTCTCCTGCCTGAAGGACAGACATGACTTTGAATTCCCCCAGGAGGAGTTTGATGAT CCTTTCTCCTGCCTGAAGGACAGACATGACTTTGAATTCCCCCAGGAGGAGTTTGATGAT AAACAGTTCCAGAAGGCTCAAGCCATCT • ill · AAACAGTTCCAGAAGGCTCAAGCCATCT •ill· -V -V CTCTCC'fCCA'rGACATGA'fCCAGCAGACCTi'CAACC'L'C'ri.'CAGCACAAAGCACTCATCTGCTGGn .; CTCTCC’fCCA'rGACATGA’fCCAGCAGACCTi'CAACC'L’C'ri.’CAGCACAAAGCACTCATCTGCTGGn.; CGATGACACCCTTCTAGATGAATri:i'ACATGC <\ AC'nGACCAGCAGCTGAATGACCTGGAG .TCC'rCrCTCATGCACCAACTCCCGGTGATACAGTC'rCCCCTGATC'rACGAGGACTCCATCCTACACACACAC'ACGACCACCAC'AC CGATGACACCCTTCTAGATGAATri:i’ACATGC<\AC'nGACCAGCAGCTGAATGACCTGGAG .TCC'rCrCTCATGCACCAACTCCCGGTGATACAGTC'rCCCCTGATC'rACGAGGACTCCATCCTGGOfC 'rGACCAAA'rACTTCCAAACAA'rCAC'rCTATATCTCACAGACAAGAAATACAGCTCT'rGTCCCTGCCA GGTTCTCACACCAGAAATCATGAGATCC'rrCTCTTTATCAATCAACTTCCAAAAAAGA'n'GAACACT GGTTCTCACACCAGAAATCATGAGATCC'rrCTCTTTATCAATCAACTTCCAAAAAAGA'n'GAACACT. AACGAA'fCAGACCTCCTACAACACCCAAA'rGATTCTt'ATACACTAATACACCAGCTCACACTTCCAC AACGAA'fCAGACCTCCTACAACACCCAAA'rGATTCTt'ATACACTAATACACCAGCTCACACTTCCAC AAGTTGTGC'l'CT'nCAAAGACCG'rTGTTI'C'rGCCAAjXAGCATGCTATGTTTTGAATCA ^ VrCTCTGA AGTGT'm'CAGGAG'l'CTTxUGCAATC fAACTATCTATAGCCC'I'TAAAT TAGTTTTGTTCATAT'L'A'L'ATTATCTG / kACTTTTACATTGTCAATTGTGTAACzAAAAACATGTTGTTT ATATTTATTAiTrTGGCTTGTTTATTAAtTimeNotTime AAGTTGTGC'l'CT'nCAAAGACCG'rTGTTI'C'rGCCAAjXAGCATGCTATGTTTTGAATCA^VrCTCTGA AGTGT'm’CAGGAG'l’CTTxUGCAACA'rCCTCT'rCAGCTGTATGGCCACTACTCCCTTACAGATGACC ATGCTCATGGA'rCTA'r'i.'CATCTATT'IVTTTAAA'rCT'ri'ATT'f ACT'fAACTATCTATAGCCC'I’TAAAT TAGTTTTGTTCATAT'L'A'L’ATTATCTG/kACTTTTACATTGTCAATTGTGTAACzAAAAACATGTTGTTT ATATTTATTAiTrTGGCTTGTTTATTAAAT'rTi'TACTATAG, Συμφώνως χρός τήν άξίωσιν I. A method for the preparation of sequence-containing unbound DNA. Μέθοδος παρασκευής άνασυνδετικού DNA περιέχοντος τήν σειρά. L.5’ Λ5’ CCCAACG'f'fCACAC'l'CACCCATCTCAGCAACCCCACAAGCATCTCCAATATCTATGATGGCCTCCCC CCCAACG'f'fCACAC’l'CACCCATCTCAGCAACCCCACAAGCATCTCCAATATCTATGATGGCCTCCCC Cl'TTGGl'TTACTGATGGCCCTGCl'GGTCC'rCAGCTGCAAGTCAAGCTGCTCTCTCGCCTGTCATCTC Cl'TTGGl'TTACTGATGGCCCTGCl'GGTCC'rCAGCTGCAAGTCAAGCTGCTCTCTCGCCTGTCATCTC CCTGAGACCCACAGCCTCGATAACAGGACCACCTTGATGCTCCTGGCACAAATGAGCAGAATCTCTC CCTGAGACCCACAGCCTCGATAACAGGACCACCTTGATGCTCCTGGCACAAATGAGCAGAATCTCTC CTTCC'fCCTCTCTCATCCACACACATGACTTTCCA'fTTCCCCAGGAGGAGTTTGATGGCAACCAGTT CTTCC'fCCTCTCTCATCCACACACATGACTTTCCA'fTTCCCCAGGAGGAGTTTGATGGCAACCAGTT CCAGAAGGCTGCAGCCATCTC'rCTCCTCCATGAGCTCATCCAGCAGATCTTCAACCTCTTTACCACA CCAGAAGGCTGCAGCCATCTC'rCTCCTCCATGAGCTCATCCAGCAGATCTTCAACCTCTTTACCACA AAACATTCA'fCTCCTCCTTGCCATGAGCACCTCCTAGACAAATTCTGCACCGAACTCTACCAGCACC AAACATTCA'fCTCCTCCTTGCCATGAGCACCTCCTAGACAAATTCTGCACCGAACTCTACCAGCACC CTCCATCl'TGGCTGTGAAGAAATACTTCCGAAGAATCACTCTCTATCTGACACAGAAGAAATACACC CCTTCTGCCTCCGAGGTTGTCAGAGCAGAAATCATGACATCCCTCTCTTTATCAACAAACTTGCAAC AAACATTAACGACCAAGCAATAACACCTGCTCCAACATGAAACAATTCTTATTGACTCATATACCAG CTCACGCT'rTCATGAxVT'fC'rGCCATTTCAAAGACTCTCACTTCTGCTATAACTATGACCATGCTGAT ?uMCTGATTl\\TCTATTTAAATArn’ATTTACCTATTCATAAGATTTAAATTATTTTTCTTCATATA ACATCATGTCCATCTTTACACTCTCCTTAGTCTAATAAAACATGTTCCTTATATTTACTCAAA'n'CA 1.1ΛΠΤΓΛ, Συμφώνως πρδς τήν άξίωσιν I, ΜίίΟδος κσραοχεν^ ίναοονδετ.ΗΟϋ »Α περ.ίχο-ο, CTCCATCl'TGGCTGTGAAGAAATACTTCCGAAGAATCACTCTCTATCTGACACAGAAGAAATACACC CCTTCTGCCTCCGAGGTTGTCAGAGCAGAAATCATGACATCCCTCTCTTTATCAACAAACTTGCAAC AAACATTAACGACCAAGCAATAACACCTGCTCCAACATGAAACAATTCTTATTGACTCATATACCAG CTCACGCT'rTCATGAxVT'fC'rGCCATTTCAAAGACTCTCACTTCTGCTATAACTATGACCATGCTGAT? UMCTGATTl \\ TCTATTTAAATArn'ATTTACCTATTCATAAGATTTAAATTATTTTTCTTCATATA ACATCATGTCCATCTTTACACTCTCCTTAGTCTAATAAAACATGTTCCTTATATTTACTCAAA'n'CA 1.1LPTGL according prds claimed in Claim I, MiOdh crachohydrofoil. AGCACCAATTTTCA (riU'nL \ GAACCTCCTCTCCCA / ^ TGAATCGGAGCCTTCAATACTCCCTCAACC AGCACCAATTTTCA(riU'nL\GAACCTCCTCTCCCA/^TGAATCGGAGCCTTCAATACTCCCTCAACC ACAG <;A'rcAAC'ni;cACATCcc'rcAGC <\ G? ITTAAccA * ccTCCAGCACTTCCAGAACCAGGACCCccc ACAG<;A'rcAAC'ni;cACATCcc’rcAGC<\G?iTTAAccA*ccTCCAGCACTTCCAGAACCAGGACCCccc A'r'rCACCATCTA'rCJAGA'rCCLCCAGAACATCT'f'rGCTATT'rTCAGACAAGATTCATC'rAGCAC'rCGC 'L'GGAATGAGAGTATTGCCGACAACCTCCTGGC'rAA'rGTCTATCATCAGATGAACAT A'r’rCACCATCTA'rCJAGA’rCCLCCAGAACATCT'f'rGCTATT'rTCAGACAAGATTCATC’rAGCAC'rCGC 'L'GGAATGAGAGTATTGCCGACAACCTCCTGGC'rAA'rGTCTATCATCAGATAAACCATCTGAAGACAG TCCTGGMCAAAAAC'L'GGAGAAACAAGA'm'CACCAGCGGAAAACTCATGACCAGTCTG'I.'ACCTGAA TCCTGGMCAAAAAC’L'GGAGAAACAAGA'm'CACCAGCGGAAAACTCATGACCAGTCTG'I.’ACCTGAA AACATArrATCCCACCA'rrCTGCATTACCTGAACGCCAAGCACTACAGTCACTGTGCC'rCCACCATAG AACATArrATCCCACCA'rrCTGCATTACCTGAACGCCAAGCACTACAGTCACTGTGCC’rCCACCATAG TCACAGTGGAAATGCTAAGCzUCTmACTTCATTAACAGACTTACAGGTTACCTCCGMACTGAAG TCACAGTGGAAATGCTAAGCzUCTmACTTCATTAACAGACTTACAGGTTACCTCCGMACTGAAG ATCTCCI'ACCCI'CTCCCTCTOCGACTCCACAATTGCTTCAAGCATTCTTCAACCAGCAGATCCTCTT ATCTCCI’ACCCI'CTCCCTCTOCGACTCCACAATTGCTTCAAGCATTCTTCAACCAGCAGATCCTCTT TAAGTGACTGATCGGTAATC'fACTGCAI'ATCMAGGACACTAGAACATTTTCAAATTTTTATlAAAT TAAGTGACTGATCGGTAATC'fACTGCAI’ATCMAGGACACTAGAACATTTTCAAATTTTTATlAAAT TA'I'GAG'n'Arn'TrArn'AT'n'AAA'm'TATTTTGGAAAA'rAAATTAl'l'TTTGGTGCAAAAGTC, TA'I'GAG'n'Arn'TrArn'AT'n'AAA'm'TATTTTGGAAAA'rAAATTAl'l'TTTGGTGCAAAAGTC, According to Claim I, Συμφώνως πρδς τήν άξίωσιν I, 9 · Method of Preparation * DNA Binders According to Association I, characterized in that the said or the said DNA sequence is operably linked to an expression control sequence in said said DNA vector. 9· Μέθοδος παρασκευής *νασυνδετικοί DNA συμφώνως πρδς τήν άζίωσιν I χαρακτηριζομένη άπδ τδ δτι ή άναφερθεΤσα σειρά DNA συνδέεται λειτουργικές πρδς μία σειρά έλέγχου έκφράσεωςπαροΏσα είς τδν άναφερθέντα ένδι άμεσο ξενιστή DNA. A method for the preparation of the sequence-containing DNA ligand. Μέθοδος παρασκευής άνασυνδετικοΟ DNA περιέχοντος τήν σειρά. GACACAATAACCCTCATAAATGG'fTCAATAATATTGAAAAAGGAACACTAATGTGTCA'fCTGCCTCA CACCCACACCCTGCGTAATACCACCCCCrrGATACTCCTGGCACAAATGGGAAGAATCCCCCC'rrTC TCCTGCCTCAAGGACAGACATGACTT'l'CGATTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCACA AGCCTCAA GCCATCTCTGTCG'i'CCATCAGA'fGATCCAGCAGACCTTCAATCTCTTCACCACAAAGG AC'fCATCTGCTACT'fCGGAACACAGCGTCCTACAAAAATTTTCCACTGAACTTAACCACCAGCTCAA TGACCTCCAAGCCTCCG'rGATACAGCAGGTTGCCGTGGAAGAGACTCCCCTGATGAATC'rGCACTCC ATCCTGGCTCTGAAGAAATACTTCCAAAGAATCACTCTTTATCTGACAGAGAAGAAATACAGCCCTT GTGCC'rCGGAGCTTGTCAGAGCACAAATCATGAGATCCTTCTCTTTATCAAAAATTTTTCAAGAAAG ATTAAGCACCAACGAATGAAACC'rCTTTCAACA'rGGAAATCATCTGTATTGACTAATACACCACTCC ACACTTCCATGACTTCCGCCATTTCAAAGACTCATTTCTCCTATAACCACCGCATCACTTCAATCAA / VATT'rrCAGATCTTTTCAGCACTCTAACGAAACATCATGTTTACCTGTGTACGCACTACTCCTTTAC GACACAATAACCCTCATAAATGG'fTCAATAATATTGAAAAAGGAACACTAATGTGTCA'fCTGCCTCA CACCCACACCCTGCGTAATACCACCCCCrrGATACTCCTGGCACAAATGGGAAGAATCCCCCC'rrTC TCCTGCCTCAAGGACAGACATGACTT'l'CGATTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCACA AGCCTCAA GCCATCTCTGTCG'i’CCATCAGA'fGATCCAGCAGACCTTCAATCTCTTCACCACAAAGG AC'fCATCTGCTACT'fCGGAACACAGCGTCCTACAAAAATTTTCCACTGAACTTAACCACCAGCTCAA TGACCTCCAAGCCTCCG'rGATACAGCAGGTTGCCGTGGAAGAGACTCCCCTGATGAATC'rGCACTCC ATCCTGGCTCTGAAGAAATACTTCCAAAGAATCACTCTTTATCTGACAGAGAAGAAATACAGCCCTT GTGCC'rCGGAGCTTGTCAGAGCACAAATCATGAGATCCTTCTCTTTATCAAAAATTTTTCAAGAAAG ATTAAGCACCAACGAATGAAACC'rCTTTCAACA'rGGAAATCATCTGTATTGACTAATACACCACTCC ACACTTCCATGACTTCCGCCATTTCAAAGACTCATTTCTCCTATAACCACCGCATCACTTCAATCAA /VATT'rrCAGATCTTTTCAGCACTCTAACGAAACATCATGTTTACCTGTGTACGCACTACTCCTTTAC ACA'L'GAGCATGG'l'GA'l'ACA'rC'l'AA'n'ACCTA'L'C'rAGCCxUATATTTATTTATTTATTACA'rT'L'AAA'r 'i'A'f'rrnOTCCATG'lWA'rA' L'TATGTGTAG'rrr'CACATTGTGTTATATCAAAATATG'CTAlTl'A'fA'rT ACA'L'GAGCATGG’l’GA'l'ACA'rC'l'AA'n’ACCTA'L’C'rAGCCxUATATTTATTTATTTATTACA'rT'L’AAA'r ‘i'A'f'rrnOTCCATG'lWA'rA'L'TATGTGTAG'rrr'CACATTGTGTTATATCAAAATATG'CTAlTl'A'fA’rT 0 · Ί · · Γ Γ Γ - - - - - - - - - - - -. - · Γ Γ Γ Γ 0 Γ ΐ ΐ ΐ;;;;;;;;;;;;;;;;;;;;;;;;;ΤΑ0ΤαΛΛΤΛ1·ΑϊΊ·ΛΪ·ΓΓΤ€'Π·ΐΐ·ΓΛτϊΛΛ'Γ·Π··ι·-·.Λ0·ΓΛΤ·ΓΑΑΛΛσΓΤ€τΤΛΪΛΤϊΛΤΤΐ(;Τ·ΓΪΛΤΐα, According to Claim I and 9. Συμφώνως πρδς τήν άξίωσιν I καί 9. ‘, ·< -. . ‘, ·< -. . K-,' Κ-,' Method for preparing a single-stranded DNA binding sequence. Μέθοδος παρασκευής άνασυνδετικοϋ ΕΝΑ ηεριέχοντος τήν σειρά. GACACAATAACCCTCAT.UArGCTTCAATAATATTC / XAAAACCAiAGAGTAATCTC'rCA'rCTCCC'rC GACACAATAACCCTCAT.UArGCTTCAATAATATTC/XAAAACCAiAGAGTAATCTC'rCA'rCTCCC'rC AGACCCACAGCCTGGAT / lACAGGAGGACCTTGATGC'fCCTGGCACAAATGAGCAGAATCl'GTCGTT AGACCCACAGCCTGGAT/lACAGGAGGACCTTGATGC'fCCTGGCACAAATGAGCAGAATCl'GTCGTT CCTCCTGTCTCATGGACAGACATCACTTTGGATTTCCCCAGGACGAGTTTGATCGCAACCACTTCC CCTCCTGTCTCATGGACAGACATCACTTTGGATTTCCCCAGGACGAGTTTGATCGCAACCACTTCC AGAACGCTCCAGCCATCTCTGTCCTCCATCAGCTGATCCACCAGATCTTCAACCTCTTTACCACAA AGAACGCTCCAGCCATCTCTGTCCTCCATCAGCTGATCCACCAGATCTTCAACCTCTTTACCACAA AAGATTCAl'CTCCTGCTTGGGATGAGGACCTCCl'AGACAAATTCTGCACCGAACTCTACCAGCAGC AAGATTCAl'CTCCTGCTTGGGATGAGGACCTCCl'AGACAAATTCTGCACCGAACTCTACCAGCAGC TCAATCACTTCGAAGCCTCTCTGATCCAGGAGCAGAGGGTCGGAGAAACTCCCCTGATGAATGCGG TCAATCACTTCGAAGCCTCTCTGATCCAGGAGCAGAGGGTCGGAGAAACTCCCCTGATGAATGCGG ACTCCA'rCTTGCCTCTCAACAAATACTTCCGAACAA'rCACTCl'.CTATCTGACAGACAAGAAATACA ACTCCA'rCTTGCCTCTCAACAAATACTTCCGAACAA'rCACTCl'.CTATCTGACAGACAAGAAATACA GCCCTTCTGCC'rCCGAGCTTGTCAGAGCAGAAATCATGAGA'rCCCTCTCTTTATCAACAAACTTCCzVA GCCCTTCTGCC'rCCGAGCTTGTCAGAGCAGAAATCATGAGA'rCCCTCTCTTTATCAACAAACTTCCzVA CAAAGATTAAGGACGAACGAATAACACCTCCTCCAACATCAAACAATTCTTA'rTGAGl'CATATACCAG CAAAGATTAAGGACGAACGAATAACACCTCCTCCAACATCAAACAATTCTTA'rTGAGl'CATATACCAG GTCACGCT'ETCATGAATTCTGCCATTTCAAAGACTCTCACT'i'CTGCTATAACTATGACCA'rCCTGATA GTCACGCT'ETCATGAATTCTGCCATTTCAAAGACTCTCACT'i’CTGCTATAACTATGACCA'rCCTGATA AACTGATT'fATCTATTTAAATATTTAT'n'AGCTAT'fCATAAGATrTAAATTAT'fTTTCTTCATATAAC AACTGATT’fATCTATTTAAATATTTAT'n’AGCTAT'fCATAAGATrTAAATTAT'fTTTCTTCATATAAC ATCA'i'GTGCATCTT'fACACTCl'GCTrAGTGTAATAAAAGATGTTGGTTATATTTAGTCAAAT'i'CATTA im, In accordance with claim I and 9. ATCA'i'GTGCATCTT'fACACTCl'GCTrAGTGTAATAAAAGATGTTGGTTATATTTAGTCAAAT'i'CATTA im, Συμφώνως πρός τήν άξίωσιν I καί 9. Method for the preparation of a single-stranded ENA linker Μέθοδος παρασκευής άνασυνδετικοϋ ΕΝΑ τεριέχοντος τήν σειρά GAGACAATAACGCTCA 'pAAATCCTTCAATAATAT'rCAAAAAGGAACAGTAATGTGTGATCTGCC'rC AGAGTCACAGCCTGGGTAACACGACGGCCTTGATACTCCTGGCACAAATGCGAAGAATCTCTCCrr TCTCCTGCCTGAAGCACAGACATCACTTTGAATTCCCCCACGAGCAG'fTTCATGATAAACAGTTCC ACAACGCTCAAGCCATCTCTGTCCTCCATCACATCATCCAGCAGACCTTCAACCTCTTCACCACAA ACCACTCATCTGCTGC'm'CGATCAGACeCT'fCTAGA'fCAATTCTACATCCAACTTGACCACCACC I'GAATGAGCTGGAGTCCTCTC'fGATGCAGGAAGTGGGGGTGATAGAGTCTCCCCTGATGTAGGAGC ACTCCATCeTGCCTGTCACCAAATACTTCCAAAGAATCACTCI'ATATCTGACAGACAACAAATACA CCTC'rTGTGCCTGCGACCT'rCTCAGAGCAGAAATCATGACATCCTTCTCTTTATCAATCAACTTGC AAAAAACATTCAACAGTAAGCAATGAGACCVCGTACAACACCGAAATCATTCTTATACACTAATAC AGCAGCTCACACTTCCACAAGT'rC'fCCl'CTn'CAAACACCCT'rCTTTCTCCCAAAACCATCCTATe Tri.'TGAATGAAATCTGTCAAG'l.'GTTTTCAGCAC'rGTTAAGCAACATCCTGTrCAGC'rCTATCGCCA CTAGTCCCTTAGAGATGACCATGCTGATGGATCTATTCATCTATTTATTTAAATCTTTATTTAG '!. ? MCTATCTATAGGGCT'rAAATTAGTTT'rGTTCATAXrATATTATGTCAACTTTTACATTCTGr.A. ' GICr / VVCAAA.XACA'rGTTCTTTATAT'TTATTATTT ^ CCTTGTTTArrAAArm-rAC VATAG. GAGACAATAACGCTCA'pAAATCCTTCAATAATAT'rCAAAAAGGAACAGTAATGTGTGATCTGCC'rC AGAGTCACAGCCTGGGTAACACGACGGCCTTGATACTCCTGGCACAAATGCGAAGAATCTCTCCrr TCTCCTGCCTGAAGCACAGACATCACTTTGAATTCCCCCACGAGCAG'fTTCATGATAAACAGTTCC ACAACGCTCAAGCCATCTCTGTCCTCCATCACATCATCCAGCAGACCTTCAACCTCTTCACCACAA ACCACTCATCTGCTGC'm'CGATCAGACeCT'fCTAGA'fCAATTCTACATCCAACTTGACCACCACC I'GAATGAGCTGGAGTCCTCTC'fGATGCAGGAAGTGGGGGTGATAGAGTCTCCCCTGATGTAGGAGC ACTCCATCeTGCCTGTCACCAAATACTTCCAAAGAATCACTCI’ATATCTGACAGACAACAAATACA CCTC'rTGTGCCTGCGACCT'rCTCAGAGCAGAAATCATGACATCCTTCTCTTTATCAATCAACTTGC AAAAAACATTCAACAGTAAGCAATGAGACCVCGTACAACACCGAAATCATTCTTATACACTAATAC AGCAGCTCACACTTCCACAAGT'rC'fCCl'CTn'CAAACACCCT'rCTTTCTCCCAAAACCATCCTATe Tri.'TGAATGAAATCTGTCAAG'l.'GTTTTCAGCAC'rGTTAAGCAACATCCTGTrCAGC'rCTATCGCCA CTAGTCCCTTAGAGATGACCATGCTGATGGATCTATTCATCTATTTATTTAAATCTTTATTTAG'!. ? MCTATCTATAGGGCT'rAAATTAGTTT'rGTTCATAXrATATTATGTCAACTTTTACATTCTGr.A.’ GICr/VVCAAA.XACA'rGTTCTTTATAT’TTATTATTT^CCTTGTTTArrAAArm-rAC VATAG . Tipsyonik? to claim I and 9 Τυκψωνικ;πρός τήν άξίωσιν I καί 9 12) A method of producing a polypeptide having the "immunological and biological activity of human lymphoblastoid interferon or a fragment or derivative thereof, characterized in that a host is transformed with at least one DNA fragment;or a fragment, variant or mutant of said DNA insert encoding a polypeptide such as interferon, or a DNA hybridizing to said human DNA is cultured, and said polypeptide is recovered from the culture broth. 12) Μέθοδος παραγωγ ής πολυπεπτιδίσυ παρουσιάζοντος τήν «νοσολογική καί βιολογική δραστηριότητα τής άνθρωπίνη^ λεμφοβλαστοειδούς ίντερφερόνης ή ένός τμήματος ή παραγώγου αύτής, χαρακτηριζομένη άπό τό δτι ένας ξενιστής μετασχηματίσθείς μέ τουλάχιστο, ένα άνασυνδετικό DNA περιέχον ενα DNA ένθεμα προερχόμενον άπό άν·· θρώπινα λεμφοβλαστοειδή κύτταρα ή ένα τμήμα ,μία παραλλαγή ή ένα μεταλλάκτη του άναφερθέντος ένθέματος DNA κωφικοποιούντος διά ένα πολυπεπτίδιο σάν τήν ίντερφερόνη, ή ένα DNA τό όπο~ιον ύβριδοποιεΐ διά τδ άναφερθέν DNA ένθρρ,α , καλλιεργείται καί τό άναφερθέν πολυπεπτίδιο άνακκταται άπό τήν ζωμό καλλιεργείας. 13) Method of producing a polypropylene presenting the anatologic and biological activity of NAMALWA interferon according to claim 12. 13) Μέθοδος παραγωγής πολυπρρδίου παρουσιάζοντος τ ήν άνοδολογική καί βιολογική δραστηριότητα τής NAMALWA ίντερφερόνης βάσει τής άξιώσεως 12. 14) Μέθοδος παραγωγής ένός πολυπεπτιδίσυ βάσει δποιαδήποτε των αξιώσεων 13 καί 14 χαρακτηριζομένη άπό τό δτι δ μετασχηματίσθείς ξενιστής έκλέγεται άπό ένα βάκηλλο ,μία μαγιά ,ένα μύκητα ,άλλο ζωικό ή φυτικό ξενιστή ,ή κύτταρο άνθρωπίνου ιστού. The method of producing a polypeptide according to any one of claims 13 and 14 characterized in that the transformed host is selected from a bacillus, a yeast, a fungus, another animal or plant host, or human tissue cell. 15) Μέθοδος παραγωγής πολυπεπτιδίσυ βάσει τής άξιώσεως 14, χαρακτηριζομένη άπό τό δτι ό άναφερθείς ξενιστής μετασχηματίζεται είς γενός τής E.COLI. A method of producing a polypeptide according to claim 14, characterized in that said host is transformed into a genera of E. coli. 16) Μέθοδος παραγωγής πολυπεπτιδίσυ βάσει τής άξιώσεως 15 χαρακτηρίζομένη άπδ τό δτι & μετασχηματίσθείς ξενιστής είναι τό γένος E.C0LI ΗΒ ΙΟΙ CG-PBR 322/KLYCIFN-5-,- (NRRL Β-Ι253Ι). A method of producing a polypeptide according to claim 15 characterized by the transformed host is the genus E. coli HB ICI CG-PBR 322 / KLYCIFN-5 -, - (NRRL B-I253I). 17) Μέθοδος παραγωγής πολυπεπτιδίσυ βάσει τής άξιώσεως 15 χαρακτηρισμένη άπό τό δτι δ μετασχηματίσθείς ξενιστής είναι τό γένος & E.COLI ΗΒ ΙΟΙ CG-PBR 322/HLYCIFN-8£(HRRL Β-Ι2532). The method of production of a polypeptide according to claim 15 characterized by the transformed host is the genus E. coli HB LCI CG-PBR 322 / HLYCIFN-8 (HRRL B-I2532). 18) A method for producing a polypeptide according to claim 15;originating from the transformed host is E.OOLI 18) Μέθοδος παραγωγής πολυπεπτιδίσυ βάσει τής άξιώσεως 15 χαρακττγ· ριζομένη άπδ τό δτι δ μετασχηματίσθείς ξενιστής είναι E.OOLI UK CG-PBR (AP) / LYIFN-a-Ig ΗΒ ΙΟΙ CG-PBR(ΑΡ )/LYIFN—a—Ig 2 A method of producing a polypeptide according to claim 16 characterized in that the transformed host is the genusXCOLIX HB LCI GG-pBR (AP) / LYIFN-a-3. 2 Ο. Μέθοδος παραγωγής πολυπεπτιδίου συμφώνως πρός τήν αξίωσιν 16 χαρακτηριζομένη Από τό ότι ό μετασχηματιστείς ξενιστής είναι τό γένος £XCOLIX ΗΒ ΙΟΙ GG-pBR(AP)/LYIFN-a-3. 21. The method of producing a polypeptide according to claim 16 characterized in that the transformed host is the genus E. coli HB LCI OG-pBR (AP) / LYIFN-a-2. 21. Μέθοδος παραγωγής πολυπεπτιοίου ουμφώνως πρός τήν αξίωσιν 16 χαρακτηριζομένη από τό οτι δ μετασχηματισθείς ξενιστής είναι τό γένος E.COLI ΗΒ ΙΟΙ OG-pBR(AP)/LYIFN-a-2. . Polypeptide production methods having the sequence i . Μέθοδρς παραγωγής πολυπεπτιδίου έχοντος τήν σειρά ί LYS GLU 'In accordance with JJS Deserved, LYS GLU ’ Συμφώνως πρός τήν Αξίω σιν JJS, A method of producing a polypeptide having the sequence Μέθοδος παραγωγής πολυπεπτιδίου έχοντος τήν σειρά -the- -ή- lys glu, haphazardly to claim 13. lys glu, χυμφώυως πρός τήν άξίωσιν 13. A method for producing polypeptide sequences containing the sequence Μέθοδος παρα||ωγής πολυπεπτιδίου Ζχοντος τήν σειρά In my opinion, I will go to sleep 15. Γυμφώνως πρός τήν ίξίω σιυ 15. Method of producing polypeptide Zydon series Μέθοδος παραγωγής πολνπεχτιδίου Ζχοντος τήν σειρά Immediately to claim 13 Γυμψύνως πρός τήν άξίωσιν 13 2x polypeptide production methodnt ° £ t^n p5no^ Μέθοδος παραγωγής πολυπεπτιδίου 2χθντ°£ τ^ν σ5νρ^ In accordance with the law Συμφώνως πρός τήν ίζίω σιν Ι5> 26) Μέθοδος παραγωγής βάσει τής αξιώσεως 12, χαρακτηριζόμενη άπό τό δτι δ μετασχηματισθεΐς ξενιστής καλλιεργείται είς θρεπτικό μέσο τό δποϊον περιέχει Αφολοιώσιμες πηγές ανθρακος καί αζώτου καί Ανόργανων Αλάτων. A method of production according to claim 12, characterized in that the transformed host is cultured in a nutrient medium containing contaminated sources of carbon, nitrogen and inorganic salts. 27) Μέθοδος παραγωγής πολυπεπτιδίου βάσει τής Αξιώσεως 13, χαρακ κτηριξομένη Από τό δτι τό Αναφερθέν πολυπεπτίδιο Ανακτάται Από τόν ζωμό καλλιέργειας περιλαμβάνοντας τά στάδια τής έλευθερώσεως τοϋ Αναφερθέντος πολυπεπτιδίου Από τά κύτταρα τοϋ μετασχηματισθέντος ξενιστοϋ καί τοϋ καθαρρσμοϋ αύτοϋ. A method of producing a polypeptide according to Claim 13, characterized by said Polypeptide. It is recovered from the culture broth comprising the steps of releasing said polypeptide from the transformed cells. 29) Μέθοδος παραγωγής πολυπεπτιδίου βάσει τής Αξιώσεως 13 χαρακτηριζομένη Από τό δτι δ Αναφερθείς ξενιστής παρασκευάζεται περιλαμβάνοντας τά στάδια (ί) Απομόνωσις Ανθρωπίνου λεμφοβλαστοειδούς πολυ(Α)Ρΰ·ίΑ Από προκληθέντα Ανθρώπινα λεμφοβλαστοειδή κύτταρα καί εμποτισμού αύτοϋ διά HULYIFN rpRNA. A method of producing a polypeptide according to Claim 13, characterized in that said host is prepared comprising the steps (i) Isolation of Human Lymphoblastoid Poly (A) Pol;(2) From this TEMPLATE one complementary single-stranded and one-stranded double-stranded cDNA. (2) παρασκεϋης Από αύτό τό TEMPLATE ένός συμπληρωματικού ΕΝΑ απλής ελικος καί έκειθεν ένός CDNA διπλής έλικος. (3) insertion of 4S CENA into a suitable linear vector ANA (4) conversion of a suitable microorganism host with the obtained ligation ENA (5) of the culture hosts of the host organisms, Of DNAS Ligands From Transformed Host If Required Modifying ENAS Ligands To Improve Level Of Polypeptides With IFN activity. and performing steps (4) and (5) again 29) A method of producing a host transformed with at least one ligand containing an ENA insert utilized. interferon, comprising the step of converting a host micro-organism with an LNA ligand obtained according to any one of claims 2-12. (3) εισαγωγής τοϋ 4S CENA έντός καταλλήλου γραμμικού ένδιαμέσου ξενιστοϋ ΕΝΑ (4) μετατροπής ένός καταλλήλου ξενιστοϋ μικροοργανισμού μέ τό ληφθέν Ανασυνδετικό ΕΝΑ (5) καλλιεργείας τών ξενιστών μικροοργανισμών καί έκλογής τών κλώνων μετασχηματισθέντων μέ Ανθρώπινο λεμφοβλαστοειδές IFN CENA ή τμήματα ΌΝΑ,καί προαιρετικως Απομονώσεως τών Ανασυνδετικών DNAS Από τόν μετασχηματισθέντα ξενιστή ,έάν Απαιτείται τροποποιώντας τά Ανασυνδετικά ENAS γιά νά βελτιωθή τδ έπίπεδο τών πολυπεπτιδίων μέ IFN δραστικότητα. καί έκτέλεσιν τών σταδίων (4) καί (5) πάλι 29) Μέθοδος παραγωγής ξενιστοϋ μετασχηματισθέντος μέ τουλάχιστον ενα Ανασυνδετικό ΕΝΑ περιέχον ένα ΕΝΑ ένθεμα ποοεργόμενον.. Από Ανθρώπινα λεμφοβάστοειδή κύφταρκ/ηέΛπάς τμήματος ,παρο ταλλάκτου τοϋ Αναφερθέντος DNA ονθέμαιος ,κωδικοποιο^Μ πολυπεπτίδιο σάν τήν ίντερφερόνη, περιλαμβάνουσα τό στάδιο τής μετατροπής ένός ξενιστού μικροοργανισμού μέ άνασυνδετικό LNA λαμβανομένου βάσει όποιασδήποτε τών άξιώσεων 2-12. 30) "A polypeptide having the immunological and biological activity of a human lymphoblastoid interferon, or an O-moiety or derivative thereof, whenever prepared by a method according to any one of claims 12-28. 30) “Ενα πολυπεπτίδιο τό όποιο παρουσιάζει άνοσολογική καί βιολογική δραστηριότητα μιας άνθρωπινου λεμφοβλαστοειδούς ίντερφερόνης ,ή ένΟ- τμήμα ή παράγωγο αυτού, όποτεδήποτε παρασκευαζομένου διά μεθόδου βάσει όποιασδήποτε τών άξιώσεων 12-28. 31) Method of producing a polypeptide mainly in pure form of bass of any one of claims 12-28. * Translated by: Attorney Attorney George St. Vagian 31) Μέθοδος παραγωγής πολυπεπτιδίου κυρίως είς καθαρή μορφή βάσρι όποιασδήποτε τών άξιώσεων 12-28.*0 μεταφράσας πληρεξούσιος Δικηγόρος Γεώργιος Στ. Βαγιανός
Independent claims4
682 paragraphs in 13 sections, as filed
DNAS, DNAS Binders, Hosts Containing This, Poly<sub>:</sub>peptides <sup>K</sup>method_produce £ _ these _.______________________
Field of the Invention!
The invention relates to DNAS-derived human lymphoblastoid cells encoding both polypeptides that are interfering with DNAS-associated transcriptionally active DNAs containing their respective transposable DNA sequences. interfering.
* The invention also provides METHYL preparing said DBAS, said DNAS, said xenthston and said polypeptides they so Inti ^ wearer, while applying the technology of the recombinant VNA.To polypeptides of the invention are useful as anodotropopoiitai, especially as antiviral against tumors and anti-cancer agents. Therefore, pharmaceutical compositions containing said polypeptides and methods for the treatment of viral tumor and cancer infections are also provided.
* Hydration. of the invention
Interferon (IFN) is a group of predominantly glycosylated polypeptides having a molecular weight of 10,000-40,000. The vertebrate cells are produced by exposure<sub>L.</sub>a susceptible virus, such as a virus, a double-stranded RNA, a viral RNA, or microbial products, or a variety of chemical agents are usually found in normal cellulose.
<img file="GR76992B_D0001.tif" />
V.
<img file="GR76992B_D0002.tif" />
<img file="GR76992B_D0003.tif" />
<img file="GR76992B_D0004.tif" />
<img file="GR76992B_D0005.tif" />
<img file="GR76992B_D0006.tif" />
<img file="GR76992B_D0007.tif" />
<img file="GR76992B_D0008.tif" />
<img file="GR76992B_D0009.tif" />
<img file="GR76992B_D0010.tif" />
the spinal cord cells in the amine of the filamentous infections and other infections. IFNs have been found to have / have immunoregulatory activities. The interferon polypeptide nomenclature has not yet been clearly established. According to recent recommendations (2), or classification, it will be based on the animal of origin (e.g. "HU for Human Origin)" Antigenic specificity (types a, b, c, etc.). based on their 03V Antigen-Antibody Reactions with α, β, or γ-IFN Antibodies, respectively), structural and physiological differences (subtypes are indicated by Arabic numerals, <sup>K</sup>^<sup>Pi</sup>·) <sup>K</sup>"I <sup>tt</sup>cell type of origin (LE is produced by leukocytes, LY is derived from lymphoblastoid cells, F is produced by fibroblasts, etc.). Thus, e.g., HUIFK-a- LY) or HDBYIPN-α- ^ indicates an atypical type I , Anyone derived from Human Lymphoblastoid Cells. 'Except for such names it may be necessary to determine whether the interferon is obtained directly from its progenitor cell or by synthesizing a microorganism and a specific species. a mixture of two or more interferon subtypes.
Nomenclature or Other Regarding the DNA sequences encoding for IFN polypeptides, DNA Ligand molecules and hosts, these have not yet been established. The nomenclature used for these DNA sequences reflects, interfering with, those encoded in an abbreviated form. For example, ESCHERICHIA COLI UK IB (Z-pBR-322 (PST) / HCIF-2) indicates the bacterial genus (COL). HB10) containing the DBA Binding Plasmid Z-pBR322 (PST) HCIF-2 ^, i.e., plasmid pBR 322 which contains a PST I site (DNA entry site) of a HCLF-a | insert, but only in ZURICH (g). The letter "The Epiphany" of Man ^
JS / * f L ** '- »' I T, C„ footnoteΐ a complementary DNA and <sub>T.</sub> oT & i & st!
/1 *
sin
<img file="GR76992B_D0011.tif" />
<img file="GR76992B_D0012.tif" />
<img file="GR76992B_D0013.tif" />
<img file="GR76992B_D0014.tif" />
<img file="GR76992B_D0015.tif" />
k>
The
<img file="GR76992B_D0016.tif" />
<img file="GR76992B_D0017.tif" />
The template (OF. WEISSMANN (3)) .The given sample of denomenclature, or the source of the IFN genera (leukocytes) is not indicated. In the present application, a similar nomenclature is adopted, however, in the present case. cells) indicated.
Three classes of HUIFNS have so far been identified as HUIFN-j HUIFN-β and HUIFN-γ. HUDIPN-α (formerly called IGF-IFN, leukocyte interferon or LYIFN lymphoblastoid interferon) is produced by human leukocytes (freshly derived human blood donor cells) and lymphoblastic cells e.g. and partners (4) and AD SAGAR and partners (5)). It is a stable PH2 (IFNS © constant between previously designated type I) and consists of a mixture of atomic transfer polypeptides, which differ substantially in the degree of glycosylation (e.g., M. rubinstrin and partners). (see below). * Of the two isolated components and purified to date, one with a molecular weight of 15,000-18,000 is not glycosylated while the other with a molecular weight of 21000-22000 is glycosylated. '0W.E. STEV / ART, II and colleagues (7) reported that non-glycosylated interferon retained most or all of HUIFN-α activity. Parts of the amino acid sequence of HUIFN-a from lymphoblastoid cells have been reported similarly (KC ZOON et al., (8j).) Various forms of HUIFN-a are structurally and physiologically different, known to other human species.
HUIFN.
HUIFN-β (formerly FIFN or FIIFN), type I) is produced by human fibroblasts (e.g. neonatal sperm cells) upon induction with a </ S> RNA and, "HUIFN-inducible, & quot; human lymphoblastic cells by:
<sup>;</sup> 7.7 '' / 4 ^ 7 with a virus. HUIFN is also a PH 2 station
<img file="GR76992B_D0018.tif" />
<img file="GR76992B_D0019.tif" />
<img file="GR76992B_D0020.tif" />
<img file="GR76992B_D0021.tif" />
<img file="GR76992B_D0022.tif" />
<img file="GR76992B_D0023.tif" />
<img file="GR76992B_D0024.tif" />
belongs to type I). At least two types of HUIFN-β have been described so far (33.48). The molecular weights are about 20,000 and 22,000. The amino acid sequence is known in parts.
The HDLII-antigen is termed IIFN (immunofluorescent or type II Interferon) is produced by T lymphocytes in response to antigen or mitogen. They are unstable EH<sub>2</sub> and routinely distinguishable from HUIFN-α and HUIFN-β.
HUIFNS are useful anti-cancer, anti-tumor and anti-cancer agents.
Anti-viral agents may be used for the treatment of • for example respiratory infections, herpes simplex herpes, acute hemorrhagic inflammation of the membrane;
As anti-dengue or anti-cancer agents of HUIFN, they may be used for the treatment of, for example, osteosarcoma, acute myeloid leukemia, multiple myeloma, Hodgkin's disease, melanoma, melanoma the papillae and others.
HUIFNS may be used in the form of oral or parenteral medicinal preparations, e.g., topical, intravenous, intramuscular, anandrinsic, intradermal or intradermal medications, e.g. such as mouth, throats, injectable or infusion solutions or suspensions, eye drops, ointments, sprays and the like.
The preparations are usually administered, e.g., intramuscularly, one to three times a day in doses of about 10-10 units, or treatment depends on the patient's condition, condition or application and the condition of the patient. * HIV infections' i'vS * treatment daily or up to three times daily Hours up to a few weeks, including tumors and cancer, on Sundays
<img file="GR76992B_D0025.tif" />
<img file="GR76992B_D0026.tif" />
treatment over a few months or years once to several times a day, or twice or more times a week.
Until now, HUIFlJ-α has only been produced in sufficient quantities by stimulated human cells, e.g., human lymphoblastoid cells (e.g. from BURKITT IVA KALWA lymphoma, IV) or human leukocyte leukocytes. HUIFN-β is mainly obtained from human fibroblasts. It is reported that only 2.6X10 ^ IU of crude HUIFN-α are obtained from 80 ° L of cultured NAMALWA cells, and that only about 10 IV crude HUIFN-α can be obtained annually at very large blood centers, eg CENTER you F FT. ST NET. The specific activity of HUIFN-α is in the range of about 4X10 to ICr VI / MB. The amount of HUIFN-a for its commercial and commercial application would have been very small compared to other pharmaceutical compounds.
One hundred grams of pure HUIFN-a will provide between 10 and 30 million doses. * However, such quantities can be produced industrially at reasonable cost and expense using human tissue culture and human leukocyte technology. "Another disadvantage of these large-scale production methods is that only mixtures of interferons are obtained and it is difficult and expensive to separate them into individual subpopulations. Therefore, it is unsatisfactory or differentiating the therapeutic applications of pure, interferon species to date.
The industrial application of these methods is further restricted to HUIFNs produced by human cells that can be cultured (ifc as human germ cells and defined as fibroblast cells) or as human cells or cells. * However, all of these (methods are 7 inaccurate and complex. \ - //
It has been recognized that the solution to the problem of industrial synthesis of large quantities of atomic species of interferons could have arisen from the promotion of molecular biology, through which a specific non-bacterial cellular bacterial strain was likely to be expressed.
COHEN and HW BOYER (9) described a general method of biological functional DNA sequences. * This method involves the steps of separating a circular plasmid DNA to yield a first portion of linear DNA, insertion into this first portion of a second linear DNA fragment having a genus for a phenotypic trace to yield a molecule of unbound DNA (a modified cyclic plasmid); conversion of a non-cellular microorganism with that of an anisotropic molecule non-converters, micro-organisms in appropriate nutrients, and isolates of the transducers * of the parent non-cellular microorganisms. The transducers can then produce the desired protein.
The problem of producing a linear sequence of DNA coding for the interferon and that of a non-synthetic DMA was not solved by COHEN and BOYER.
DNA sequences derived from human leukocytes and fibroblasts encoded by HUIFN-α and HUIFN-bp polypeptides, unrelated DNA molecules containing unrestricted DNA, transcriptional hosts, or hosts. and methods of its production ..,. X SENDAI virus-induced duplicate probes with polypeptides similar to
HUIFN-α DBA activity sequences, DNA-binding molecules, and scramblers for their preparation are described in C.WEISSMAN (3 'see also S. NAGATA et al. (10), N.Manthei et al., II). STREULI AND PARTNERS (12).
Also derived from human leukocytes, especially human myeloblastoid cell line KG-I
SENDAI, partially purified as a HUIFN-α polypeptide with a molecular weight of 21,000 the corresponding DNAS as well as the structure of the distinct human IF IFN CDBAS are described under DV
G0EDDEL et al. (13, 14); liCa method of polypeptide preparation similar to that of HUIFN
<img file="GR76992B_D0027.tif" />
Newcastle disease virus is revealed
<img file="GR76992B_D0028.tif" />
(I) Z poly (C), DNAS, HUIFN-β-encoded DNA molecules, and the microorganisms containing them, have also been described in European patent application 28033 (16); see also TANIGUCHI 17 and co. DERYNK AND PARTNERS (18). rpRNAS, LNAS, DNA-binding molecules, and bacterial genes capable of producing HUIFN-β and HUIFN-3<sub>2</sub> are obtained by genetic engineering methods starting from human fibroblasts, especially FS II or SV80 progenitor cells, induced by poly (ii) poly (i) double strand, in accordance with UKP 2063 882 (20). DNAS, LlS .E.COLI Recombinant Molecules About and Polypeptides Having Activity -
<img file="GR76992B_D0029.tif" />
rpRNA-derived human FS-4-induced human dspram; methods of preparing them are also disclosed in B.E. Diploma No. 887 397 (21).
Generally, without giving any specific data or details, or a method of producing a polypeptide with similarly intense HUIFN activity Starting from Human Pinoblasts (Nodule Progeny) Caused by Poly (ΐ) πολυ Poly (i), European Disclosure 30 (22).
Human lymphoblastoid interferon HUIFN (LY), can be produced in a variety of amounts from NA MALWA cells upon stimulation with a variety of motifs (MD J0NST0N et al. (24)). EUIFN (LY) produced by NAI.iALWA cells induced by SENDAI showed that it contains HUIFN-a (LY) (70-904) and HUIFN-p (LY) (IC-3O71). It consists of at least seven ingredients (KC Zoo and Partners (8) and G. ALLEN and Partners (25); see also X HAVELL and Partners (4) and AD SAGAR et al. (5) * Although the overall structure of the lymphoblastoid polypeptides of Atfern remains unknown at this time, it became apparent that KUIFN-a (LY) is different from HUIFN-a (LG). glycosylation of the various components of the lymphoblastoid interferon. The various components have not yet been separated and purified.
Object of the invention.
Since clinical trials are performed with mixtures of HUIFNS lymphoblasts, it is desirable to analyze the various components and to produce them individually to be able to determine their therapeutic potential. None of the aforementioned methods of Binding DNA are directed to the lymphoblastoid human Interferon binding. It is an object of the present invention or a coating of this technology of DNA binding. text of the invention to clarify (a) the various subpopulations of HU1YIFNS,
<img file="GR76992B_D0030.tif" />
ot which allow interferons to be manufactured in sufficient quantities to ensure the supply of large numbers of potential patients.
Summary of the Invention.
The present invention solves the problem of also producing large quantities of atomic polypeptides with biological activity similar to HUIFNS lymphoblasts. The simple polypeptides are either identical or different from the known components of HUIFM-α (Lg) and HUIFM-β.
Polypeptide-containing pharmaceutical preparations having the immunological and biological activity of HUDYIFN-a or HULYIFN-β. and methods of use are similarly provided.
"User tips and shortcuts [See description.
Clone. Population of cells that are asexually derived from a simple cell. This population is assumed to be genetically identical.
OPERON. A genetic group consisting of adjacent genera expressing coordinated control of an operator or repressor.
Expression Control Series * A nucleotide sequence that controls and regulates the expression of structural genera when functionally combined with those genes. It includes, but is not limited to, the promoter and the ribosomal binding site.
Promoters A segment of DNA that binds to RNA polymerase and initiates or replicates.
Ribosomal binding site. Series that allow RMA to bind to ribosomes, a translational prerequisite. ----- "Expression Method Recommended for Anti-Script Writing.
A method comprising a base pair coupling. Partial information contained in the DMA used herein, N-Ay; extension an additional set of base mixes.
<img file="GR76992B_D0031.tif" />
IO
Transl., * The method where or the existing genetic information in an rpRNA molecule directs the sequence of specific amino acids in protein synthesis.
Nucleotide, The nucleic acid block comprising a purine or pyrimidine, a ribose or a 2-deoxyribose moiety, and a phosphoric acid moiety. T.
* Intermediate {; mid_clock ^ £ (or clone vector); A DNA sequence, e.g., a plasmid or a phage DNA, or which can be automatically replicated in a host cell, which contains a label suitable for use in identifying transformants, e.g., tetracycline or tetracycline resistance; Where another LNA segment can be attached experimentally to cause the adjoining segment to duplicate.
Plasmid. An extra chromosomal, circular, double stranded DNA that can be replicated in a host cell. * DNA (hybrid) DNA, “A DNA molecule consisting of segments of RNA from different genes that are attached to outside living cells and can invade some host cells and maintain them.
Nucleases. “Enzymes that cross the phosphodiester bonds of the nucleic acid chains.
Proc<sup>uc</sup>You're laughing. (KEASA). Enzymes that separate the phosphodiester bonds of RNA.
D-anchoribnucleases; PNAase ^ 2 * Enzymes that can separate the phosphodiester bonds of DNA. 2, Endonucleases_of the enzymes in any of the nucleotides that have specific sequences of phages within their 5s. The separation products give RNAcu fragments / - blunt, // (flattened) edge or "laminated" /
II
Enzymes that digest ONE from the ends of the helices.
Lysozyme. Enzymes that degrade polysaccharides found in the cell walls of affected bacteria.
Reverse Enzyme RNA-encoded enzymes that can generate single-stranded helix chains from TEMPLATES RNA and then convert these chains into double strands.
* Enzymes that catalyze formation of 5 ', 5' phosphodiester bonds.
REA ligaseZ "Enzyme Catalyzes the structure of the cleavage of a single-stranded single-stranded phosphoviester linker of the endonuclease type.
Polynucleotide kinase. The enzyme catalyzes the phosphorylation of the & quot; 5 '-hydroxyl groups of ENA.
Mutation. The insertion of an exogenous ENA, e.g., a plasmid or an ENA hybrid, into a cell sequencer by the settlement of the irreversible ENA into the cell. Abbreviations.
A licenosine or deoxyadenosine monophosphate substrate
U uridine monophosphate residue
The deoxythymidine monophosphate residue
C cytidine or deoxycytidine monophosphate residue
G Gonanosine or deoxygonosine monophosphate substrate
I viral monophosphate moiety ^ ATP deoxyadenosine triphosphate d TTP deoxythymidine triphosphate dcTP triphosphate deoxycytidine dGTP triphosphate dexyphenylmethoxyphosphine * ctcft
<img file="GR76992B_D0032.tif" />
the MIA messenger ribonuclear chain
Transfer ribonucleic acid mRNA
ZRNA Ribosomal Nucleic Acid dsRNA Ribonucleic Acid Double-stranded DNA Deoxyribonucleic Acid
CDNA complementary deoxyribonucleic acid (virally synthesized from a single rnRNA sequence) clsCLKA double-stranded deoxyribonucleic acid
A series of β-lactomase gene expression control pt
IFN interferon
HULY (from) human lymphoblastoid cells
A detailed description of the _ _2 is £<sub>±</sub>The invention relates to a DNA, especially an untranslated LNA, comprising a DNA sequence derived from human lymphoblastoid cells or a fragment, variant or mutant of said sequence, encoded for a polypeptide expressed as an interfering DNA; said DNA, a vector transduced with at least one of said DNAS ligands, a polypeptide wherein it exhibits the immunological and biological activity of a human lymphoblastoid interferon, or a derivative thereof, a non-pharmaceutical composition comprising said polypeptide and a method of treating viral infections, cancers or cancers an ineffective amount <sub>:</sub> said polypeptide in the form of said pharmaceutical composition.
The invention also has a method of producing a polypeptide, but having the immunological and biological activity of: []
c. '· u · -<sup>Q:</sup> ? ' • Interferon-labeled human lymphoblastoid I; A conversion host with at least one transcript of said unbound DNA is cultivated and the desired polypeptide harvested, and a method of producing a transformed host vector includes a method of producing a vector.
1) Isolation of human lymphoblastoid poly (A), RNA from induced human lymphoblastoid cells and enriching it with HUlYIFN-RNA.
2) Manufacture of this TEMPLATE single stranded complementary DNA and double stranded single stranded cDNA
3) Insert oisCDNA into a suitable DI'1'A vector
4) conversion of a suitable host microorganism with the obtained unbound DNA
5) culture of microorganism hosts and selection of clones transformed with human lymphoblastoid IFN C DNA or DNA fragments and optionally isolate the DNAS-binding sites of transcriptional hosts if necessary. (4) and (5) again. * The invention further relates to individual stages and to a combination of two or more individual stages.
I. 'Inhibition of human lymphoblastoid cells and in vitro transcription of human lymphoblastoid poly (A) RNAs embedded in HULYIFN transcription RNA. The method used in the present invention comprises the following steps.
I) Motivation of Human Lymphoblastoid LYIFN Synthesis.
b) Disruption of the induced cells
(c) Isolation of lymphoblastoid poly (A) RNA by oligmatism;
<img file="GR76992B_D0033.tif" />
ili ·; - / -.
I proteins, lipoproteins, DNAS and RNAS of different kinds. d) LYIFN-specific tjjRNA enrichment of LYIFN-stimulated Human Lymphoblastoid Cells.
As a result of exposure to an IFN promoter, Human Xyloblastoid cells produce LYIFN mRNA, and subsequently, Human LYIFN.
Suitable cellular IFNs are, for example, various chemical agents of a double-stranded RNA, e.g. poly (ΐ) Z poly (i) or in particular certain viruses mainly members of paramyxoviruses, pseudomycs, and reoviruses, such as its virus. NEWCASTLE disease (eg genus 110, B, SOTA or TEXAS), SENDAI virus, blue tongue virus, rubella virus, mumps virus, influenza virus type I, 11, or III, or SEIviLIKI FOREST virus .
Human Lymphoblastoid Cells Are Advantageously Produced From Patients With BURKITT Lymphoma. Such a cell line, NAMALWA, has been shown to produce high levels of IFNs upon viral stimulation (26). In addition to NAMADWA cells, further lymphoblastoid cells may be used, such as LAUDI cells, AKWBA cells, NC-37 cells, KN-2 cells and others known in the art.
Prior to hypokinesis, lymphoblastoid cells may be pretreated with a lower straight chain Alkanic acid, e.g., butyric acid or a salt thereof known to promote IFN production by lymphoblastoid cells (27, 28). Further, if necessary or desirable, the lymphoblast cell type may be prepared by treating them with a small amount. IFN. The lymphoblastoma cell motility is performed in a manner known by analogous methods. Lymphoblastoid cells, e.g. x NA cells - / -; MABWA, Are you growing a standard nutrient supplement (ex. PMI 1640 medium)? 10% fetal calf serum '': . l
Adequate cell density (eg 10 -10 'cells / ML). The cells were recovered by centrifugation and resuspended in the medium, stimulated by the addition of a suitable virus, e.g. at a concentration of about 200 hemoglutinating units per 10 cells for a sufficient period of time, e.g., for 5-16 hours. Once the primed cells produce sufficient titers of IFN, the cells are harvested and further processed as described below.
IFN activity can be determined, for example, by the ARMSTRONG method of obtaining color undeveloped (29). <sup>: </sup>(b) The following are the cell_cells.
The first step in the isolation of a nucleic acid is its detachment from other cellular constituents, including cell disruption and removal of infectious proteins, including methods which are used eg homogenized with a motor o-. mobile teflon mortar with a glass homogenizer, osmotic shock burst, ultrasonic vibration burst and the use of lithic chemical agents such as anionic non-contaminated, e.g. dodecyl sulfide sodium, or sodium tri-isopropylnaphthalene sulfonate.
In some cases, the application of anionic detergents may also result in partial release of the nucleic acids from protein complexes and partial inhibition of the activity of the enzyme.
A nucleation of nucleic acids, especially RNA, by gradient.
Advantageously, the induced cells are lysed by
<img file="GR76992B_D0034.tif" />
An appropriate anionic detergent, e.g., sodium dodecyl sulfate, in a typical buffer, e.g., TNF. After a short period of A-positioning, the suspension is treated with an apoprotein agent as described in paragraph (c).
(c) Separation of lymphoblastoid poly (A) RNA from infectious proteins, lipoproteins, PNA1 and BHAS δ £ 222 £ epitope<sub>L.</sub> The deproteinization of the nucleic acid mixture obtained can be achieved by the action of chemical agents, for example chloroform containing 1-4% L-pentandyl or in particular phenol. Proteins can also be isolated by digestion with a protease, e.g., proinase or protease P, or which digests almost any protein with amino acids. To ensure complete removal of the proteins a combination consisting of 2 chemical deprotein agents, e.g., phenol and chloroform; or treatment with a protease and then with a chemical deprotein agent, e.g. Deproteinization of the nucleic acid mixture is performed by suppressing with a protease, e.g., proanase, and repeated extraction of the resulting mixture with phenol and then with chloroform. Using the phenol system almost all of the altered and digested proteins are transferred to the phenol and the intermediate phase.
This and subsequent steps of recovering poly (A) RNA may be controlled by degrading rpRNA by adding small amounts of a radiolabeled labeled dna, e.g.
125 I-labeled globulin rpRNA.
Purified deoxyribonuclease (free from RNAase can be used to digest infectious ENA.
Alternatively, the RNA may be capable of receiving LNA by equilibrium centrifugation.
<img file="GR76992B_D0035.tif" />
<img file="GR76992B_D0036.tif" />
CSC1.'In addition RNA may be separated from the Biol'SO V 'topographic methods, for example by column chromatography (cross-linking).
The RNA molecules present in the purified solution differ from other types of RNA, e.g., t-RNA or 2RNA, in a long duplicated sequence of adenosine nucleotides (ΐ00-200 $ residues long) at their 3'-end. These poly (A) chains may be used to select the RNA in a manner known per se, for example by repeated batch adsorption on small ('I) cellulose or poly (H) sepharose. RNA is then eluted by partial washing with a solution with low ionic strength (e.g., water.
A preferred embodiment of the poly (A) RNA isolation comprises, for example, treatment of the nucleic acid mixture, solved by dissociation of the primed cells (step Ia), with a protease, immediately followed by phenol. , subjecting the resulting solution to olive (T) cell chromatography and washing the bound poly (A) RNA with water.
* If desired or unnecessary, absorption of small (<T) cellulose can sometimes be removed.
At this stage, the poly (A) RNA may be tested for its ability to direct the synthesis of polypeptides that exhibit HUIFN activity in an IN VITRO translation system (e.g., lysine-specific lysine transducers, XEN cells, XEN cells). to be identified using a radioimmunoassay, or specific to a cytopathic bioassay. For this purpose, a sample of recovered poly (A) RNA is dissolved in a suitable solvent, for example, water, a diluent (e.g., I / IV EDTA solution or a standard buffer mixture, and the sample is poured into an oocyte. <sup>:</sup>: X \ Frog Canine (XENORUS IjAEUS) Agree with COLMAg- * I \ '* \ Partners (30). IFN produced in oocyte xylose / x X was determined by a cytopathic biopsy; XX / use of the color-binding method accordingly. Pi<sup>7</sup>flush
ARMSTRONG (29) or the reduction of a Cytopathic Effect to STEWART and co-workers (31) by applying a suitable challenge, e.g., Cellular Stomatitis Virus (USV) to Human CC, e.g. 23 cells or HEB-2 cells. * If any step of the method described herein is desirable, or HUIFN mRNA acts * for the purity of an RNA, Isolated at any step purified or derived from a DNA Converter, e.g., a double stranded cDNA, can be determined<sub>p</sub>any of the said tests.
d) * LYIFK-specific rp RNA enrichment.
Upon Removal of Other Infectious RHA Species, e.g. -fcRNA, ZRNA or DNA (cf. paragraph 1C), the solution of poly (A) RNA in 0.5 mM n-M M EDTA may be further purified by phenol extraction and passage through a CHELEX column to remove divalent cations. RNA HUIFN RNA fragment RNA can be obtained by a variety of methods known from the literature. It is mainly based on the different molecular sizes of the Simple hBNA species incorporated.
* Size fractionation of poly (A) RNA can be complemented, for example, by gel filtration on cesarstran derivatives, or very acrylamide, where smaller RNA molecules penetrate into the large gel particles, They are not easily retained and pass through. 'In addition, a blend of poly (A) RNA species can be fractionated by belt electrophoresis via polyacrylamide, such as Amyl or Agarose. Multi (A) RNASs may also be separated according to Pax at its sedimentation rate5 | by zone of sucrose density centrifugation using solutions of approximately 5-23% as slurry. 1 ZZz
BC or fractionation of poly (A) RNA mixture may be carried out as follows. The poly (A) RNA solution released from other types of infectious DNA and RNA is fractionated according to size by centrifugation through sucrose (e.g.
5-230) in standard buffer containing a small amount of SDTA. The fractions are collected and can be assayed for IFN mRNA activity as described above (paragraph l).
The fractions presenting the highest IFN RNA activity were pooled and applied to a column of small (τ1) cellulose or poly (D) sephardic acid. ethanol.
In this step, && S or HULYIFN mRNA activity can be determined once acetate using the above-mentioned method (see par. 1c). Generally, sucrose gradient centrifugation results in a 10-20 fold enrichment with HULYIFN or RITA.
2) Preparation of HULYIFN c / sDNA double stranded lymphoblastoid cDNA.
The highly (A) RNA enriched with HULYIFN mRNA as described above (paragraph id) can be used as TEIFPLATE to prepare a double stranded cDNA. digestion of the final HAIRDIB structure previously created.
(a)? Preparation_Of_05Na_ Simple £ _ <sup>u</sup>This single-stranded cDNA demonstrates the affinity for the poly (A) RNA described above (paragraph Id) can be prepared by reverse-transcription: replication of said RNA. ) avian myeloblastosis.). * H'AMV antiretroviral replicase does not begin its synthesis<sub>7 </sub>DNA on a single-stranded RNA. It is similar to a N-terminal? / Polymerase, in that it requires an archetype with a free 3-hydroxy group to be essentially coupled to the RNA-TEMPLATE helix of the same strain. adhering to the 3 *-terminus of TflRNAS, it is advantageous to use, e.g., doligodeoxythymidyl ester (double (<Lt) or poly (D) as an archetype. When sequence information is available it is also likely to initiate or synthesize the cDNA). the gender he is interested in. BC or single-stranded cDNA synthesis is complemented as follows. Poly (A) RNA isolated and purified as described above was reacted with a local buffer with an archetype e.g. (double (<Lt) magnesium salt, e.g. CL<sub>2</sub>, a mercaptan, e.g. dithiothreitol (DTT), JaTP, c / gTP, cZ, TTP and AMV reverse transcriptases,
Preferably high concentrations of deoxynucleotide triphosphates are selected to encourage full-length replication or synthesis.
The following steps of purification of a single-stranded cDNA are facilitated if one of the deoxy nucleosidotriphosphate esters used is labeled, e.g., by 52p. * The reaction may be determined by the addition of a mixture of suspension containing, e.g., EBTA and SDS. After reaction, the product is disprotected, for example, by extraction of the solution with phenol and chloroform, and then chromatographed on a SEPHADEX column to remove the salts and the transducers. Creatures containing synthesized cDNA (given that one of the deoxynucleosidotrophosphates is labeled with<sup>J</sup> Identification of used fractions can be readily obtained by measuring CERENKOV radiation and pooled nucleic acids (RNA and cDNA) can be isolated. .TEMPLATE RNA is removed. <sup>;</sup>µg, pg (cleavage kinase, e.g., nAnase or hNasease T, or, preferably, d-d -samosRK; <sup>1</sup> of alkali, eg sodium hydroxide
<img file="GR76992B_D0037.tif" />
polyacrylamide relative DNAS markers of known length (e.g. 32).
b) Device_of_DNA_double £ _el_kil £<sub>L.</sub>
The single-stranded cDNA prepared as described above possesses a 3 'terminal HAIRPIN structure. This or HAIRPIN structure consists of a short double stranded region, or cDNA, that is substituted for the sequenced synthesis of a second strand of DNA. “There is no need for an additional archetype.
In double stranded cDNA can be synthesized from a DNA-dependent DNA polymerase, e.g. AKV reverse transcriptase, similar to the one described above in the single-stranded cDNA composition except that poly (A) RNA is replaced by single-stranded cDNA and archetypal parallaxes; its decidiribonate cladidate precursors may similarly be used, e.g., TUDNA polymerase E. coli DNA polymerase (KLENOV / plasma) or, preferably E. coli DNA polymerase I. The second strand composition can be made using a buffer mixture containing the single stranded cDNA, a magnesium salt, e.g. I / ijCLg. one mercaptan, e.g. dithiothrexed, in the four deoxynucleoside triphosphates, one of which is rabio-selective;
<img file="GR76992B_D0038.tif" />
DNA polymerase I. After the reaction was stopped and the mixture depleted (see paragraph 2a), the DNA was precipitated with ethanol. . __
The CWSDNA obtained contains a HAIRPIN loop, linking them
<img file="GR76992B_D0039.tif" />
of solution by treatment of the product of the second-strand synthesis with SI nuclease in the presence of zinc salt zinc sulfate, * Digestion may be stopped by addition of SOS and EDTA. After deproteinization with phenol, the solution is chromatographed on a SEPHADEX column, fractions containing
J'S cDNA (which can be determined for example by measuring CERENCOV Radiation in each fraction) was pooled and dsCDNA precipitated with ethanol.
Advantageously, the synthesized HsCDNA which is a large member of different species is further enriched at this stage by full size cDNAs. Methods suitable for this purpose include gelatin filtration or electrophoresis gel electrophoresis or filtration. sucrose.
Co-centrifugation and centrifugation of molecules of known Dl'TA molecules, in parallel, prevents the placement of these cDNA molecules possessing the expected molecular size by IFN dsCDNAS 14 (700-1200 pairs). 16,18,33)
For example, cis cDNA dissolved within a typical buffer is subject to band centrifugation via sucrose gradients (e.g.
5-235 &). DKAs that precipitate faster From a suitable DNA marker running parallel gradients (e.g. a 700-800 base-pair marker) Isolated.
3) * 0 HULYIFN-enriched cDNA clone formation, its _CDNA _._______________________________________________________
(a) £ a<sub>L.</sub> Formation of the cDNA clones obtained as described hereinafter (paragraph 2b) may complement complementary methods.
The method includes
<img file="GR76992B_D0040.tif" />
linking ds OLKA to l<sub>w</sub> a suitable clue <sub>5mins m</sub> and
-transfer the resultant DMA ligand without a suitable host cell (switch) that can degrade.
“A DNA host is a DMA molecule that contains a genetic function that ensures its replication when transferred to a host cell. In addition, it is desirable that the DMA host contains a genus through which host cells carry plasmid transducers) can be selected from a large population of cells, most of which do not contain the plasmid. Examples of DMAS vectors commonly used in genetic engineering are the circular plasmid DMA and the DMA of certain bacteriophages such that CDMA can be covalently attached, e.g. PRSB 9, PSF 2124, PBR 317 and, in particular, PBR 322. The aforementioned plasmids contain genes for resistance to ampicillin and, partially, resistance for tetracycline. 'Therefore, host cells containing such plasmid will contain a phenotype which can be altered.
For example, to obtain a non-binding DMA molecule, a suitable plasmid, e.g. PBR 322, is separated, the dS CDMA enters the linear plasmid, and the ring is closed again to form a flattened unbound molecule.<sub>;</sub>: a plasmid comprising the inserted <Ls cDNA fragment.
Advantageously, the DMA plasmid is separated at predetermined sites. For this purpose, a large number of restriction endonucleases are available which recognize DMA Legendary sequences. Some of them have double stranded and two-stranded DNA helices at the same point producing 'blunt ends'. edged edges ,,).
DNA fragments are usually ligated through single-stranded cohesive ends and typically closed by a DMA ligase e.g.
T4 DNA ligase. Complementary edges can be formed in two distinct ways, either by separation with restriction enzymes creating alternating cleavages and cohesive edges, or by the addition of identified single stranded sequences (e.g. homopolymeric tails). Alternatively completely unbound DNA; may be bound by T4 ligase, e.g. plasmid e.g. P3R 322, cleaved by a suitable restriction endonuclease, e.g.<sup>-</sup>^, I, the linear plasmid and cDNA to be extracted each elucidating the presence of a suitable enzyme, e.g., terminal deoxynucleotidyl transferase, with single stranded homopolymeric urine. For example, many (dc) sera may be added at one or the other (alternatively, urine may be similarly selected). Both types of DMAS may be linked through their complementary ends.
Useful hosts include, for example, yeast and especially bacteria that are susceptible to transformation and do not have restriction enzymes or modifying enzymes, e.g., the genus of E. coli, E. coli X 1776, or E. coli_HB_IOI, or the genus BACILLUS SUBTILIS, BACILLUS STEAROTHEPMOPHILUS, PSEUDOMONAS, HAEMOPHILUS STREPTOCOCCUS and other bacteria, and their mutants.
The DNA ligand prepared previously described can be transferred to an appropriate host cell by means of common conversion processes including, for example, pretreatment<sup>h</sup> of host cells / T cells containing an unbound plasmid DNA that gives phenotypic property, e.g., tetracycline resistance, to the host cell<sup>: </sup>Saying by label you are a selective, e.g., tetra25 cyclin containing nutrient or agar tablets.
In the present invention, the preferred DMA vector is the plasmid PER 322 which, after cleavage with a restriction endonuclease, especially PS 4: 1 ', binds to CDMA via complementary duplex polymerases. The resulting unbound DNA is transferred to E. coli
HB LC. * Instead of the IFN generations prepared via the cLs cDNA ligand according to the previous chapters of the corresponding chromosomes, DNA may similarly be used for the preparation of clones capable of producing polypeptides with IFM activity.
Chromosomal DNA can be obtained from human lymphoblastoid cells, such as NAKALWA cells by methods well known in the art, for example by partial cleavage of all chromosomal DMAs with AL'Hy I and binding to their hosts. 4A arms, or by cleavage of the chromosomal DNA with a priming enzyme, e.g. Crp I HIND III and binding the obtained fragments to a DMA vector, such as to DBR 322 plasmid or DNA cosmid. A DMA lysing host may be transformed into a host, such as E or COLI. Colonies containing the chromosomal IFNs a and b are generally identified by hybridization of the colony (cf. Chapter 4a) either by the use of radioactively labeled synthetic aligodeoxynucleotide or a radioactive labeled α and β specific IFN cDNA as a probe. The portions may be obtained by restricting such fragments to one or more appropriate sites.
Therefore, the invention relates to a method of preparing a DMA containing a DMA sequence capable of being derived (lymphoblastoid cells or a fragment, a variant of the said sequence, encoded by multiplexing).
<img file="GR76992B_D0041.tif" />
interferon or any DNA hybridizing to said DNA, which method comprises.
1) Preparation of HUIYIFN-RNA single-stranded RNA complement helix DNA, Jan is. preferably having a double stranded cDNA, or
2) partial separation of chromosomal DNA from human lymphoblastoid cells and selection of fragments containing chromosomal LYIFN genes, and, if a portion of said sequence is required, restriction of said inserted DNA, referred DNA to a suitable vector host DNA.
b) Preparation of the linear, deoxynuclear <i> d) -substituted PBR 522; The preferred vector of the present invention, plasmid PBR 322 is a small plasmid consisting of 4361 base pairs. Contains two genera (AnnP<sup>t</sup> They each provide resistance to tetracycline and ampicillin, respectively, on bacterial recipient cells and which can be used to select and identify transformed cells. There are some restriction sites within the PBR 322 A simple PS-J ^ I site is found in the genus AtF<sup>t</sup> whereas the only BamH, HIND III and SALI sites are found within the genus TET<sup>t</sup> A simple ECOR I site is everywhere (34). When applying one of the so-called restrictive endocytes to the genus<sup>t</sup> either gender or both sexes remain intact. Therefore, any of the said enzymes is suitable for the separation and alignment of PBR 322.
After the plasmid PBR 322 has become linear deoxynucleotidolysis both of the 3-terminal ends may be added in the presence of terminal dexynucleedidyl transferase ^, Preferably .- * -? about 20-50 deoxynucleotide residues are amplified to secure a stable linker for c / S cDNA epithelial / fungal chains of complementary dexynucleotides.
<img file="GR76992B_D0042.tif" />
For example, plasmid PBR 322 is treated with a well-regulated aqueous medium containing MgCl2, a mercaptan, e.g., 2 mercaptoethanol and a carrier protein source, e.g. bovine serum albumin or gelatin additionally restricted · After pausing the digestion, the solution is deprotected with, for example, phenol. The final addition of deoxynucleotidyl residues is carried out in a typical buffer system which contains CLg, a sodium cacodylate carrier, first , e.g., bovine albumin, with a sufficient amount of deoxy nucleoside triphosphates, e.g., ISTP, and final deoxynucleotidyl transferase.
Y) _defixed2 deoxynucleotide-ep]<sub>:</sub>^ Ί] cuff |<sub>:</sub>henna_ 4 / 3_0 ONE<sub>l </sub>The curvature of {CENA obtained as described above (paragraph 2b) may be complemented in the same manner as the composition of the linear, deoxynucleotide-eluted plasmid U PBR322 (see paragraph 3b) e.g. CTPg for LL and TP) and preferably using CoCLg for MGCII.
SCDBA is encapsulated in a buffer containing sodium cacodylate, CoCl2, a protein, e.g., bovine serum albumin, the corresponding deoxynucleotide trifosphate, e.g., dcTP and terminal deoxidine.
d) Incineration by incubation of linear, PBB_322 elongated chains.<sub>L.</sub>_________ _______
The linear, long-chain elongated plasmid BBB 322 and the otsCENA chains can be hardened and recycled in a standard manner, i.e. by basic coupling. additional deoxynucleotide chains. .
To promote cycle formation and sequence alignment (which may bind different plasmids) or reaction, both C ^ SCDNA chains and 32 PBR lines should be performed.
<img file="GR76992B_D0043.tif" />
. »I.
I.
-L
<img file="GR76992B_D0044.tif" />
BC mixture of deoxynucleotide (e.g. fltcMR-epileptic) cDNA and linear dexynucleotide-epileptic (e.g. dGMP-epileptic) PBR 322 is incubated for 4 consecutive one hour stages at different temperatures ° C, 46 ° C, 37 ° C and 2 ° C). T <5 cDNA can be used directly for conversion to a compatible bacterium, e.g., E. coli HB ICI.
It should be pointed out at this point that the product of the curing method contains non-binding DNA molecules, of which only a very few are related to HULYIFN, since most of the ligands include a cDNA insert originating from L other RNA TpRNA.
C) Conversion of E. coli UK viruses with hardened hydride plasmids
The hardened hybrid plasmids obtained may serve to convert E. coli HBCI. The plasmids replicate within the cell and the plasmid replicates are distributed to the daughter cells when the cell divides.
Conversion of E. coli HBCIs with hardened hybrid plasmids can be supplemented by methods known from <sub>2</sub>+ method. * The method comprises Cd-pretreatment of cells to allow or take up DNA (e.g. (35)) or by hybrid plasmid. The cells can then be transferred by selective growth medium which allows the separation of the transformed cells from the parent cells. * As long as the hybrid plasmid still contains one H<sup>t</sup> Generally, an agar medium containing tetracycline as an inhibitory substance of growth is advantageously selected. ·.
Hybrid hybrid | Chlamydia and E. coli HB IgI cells cultured with CoA<sup>2</sup> are buffered with buffer buffered saline, e.g., CaCL, and a "Ha-salt", (III; sufficient incubation time (e.g. 10-40 min); <sub>:</sub> .<sub>n</sub> Aeromagnetic turbulence (35-42 ° C) is generally a short time-point / z ·. '/ 7'; ' (1-5 minutes), the cells are cooled and coated with sufficient H.
amount of tetracycline. Cells depleted in this medium contain the recycled plasmid or the hybrid plasmid DNA. Therefore, undeveloped colonies are used for careful observation of appropriate clones.
4) Identification of lymphoblastoid-containing clones_IEP_ORNA_ a) Methods Suitable for identification of clones containing L ¥ IFN cDNA.
* Colonies containing specific genes may be identified by a variety of methods, e.g., RNA hybridization selection, differential hybridization, or hybridization with synthetic endogenous cats or cloning agents; specific gene products may be used .
Whereas, the immunological and biological approaches are based on the production of the immunologically and biologically detectable genus, the first set of methods is largely dependent on the availability of a suitable catheter which is purely specific. &&& mGMA complementary to the desired genus or corresponding GDNA.
Some approaches are known for the careful observation of characteristic clones containing human leukocytes and fibroblast IFN. BC GOEDDEL and co-workers (13) and SUGAGO and co-workers (16) identified IFN genera by visualization of the two hybrid kits. The first set was hybridized with radioactive cDNA which was synthesized by reverse transcription of the n-RNA mixture obtained from induced cells, using<sup>J</sup> P-labeled CTP as a marker and oligo (dT) (SUGANO) or a synthetic deoxy, undecanucleafide (GOEDDEL) as an archetype. The second jet was hybridized to a similarly produced radioactive cDNA | received / not received
<img file="GR76992B_D0045.tif" />
j
induced cells. * This method is characterized by a lack of specificity and reproducibility, as is evident from the data shown. Another approach described under WEIS "
SMAN (3), employs the hybridization method of RNA selection, or which involves a tedious and multi-step search for the desired strand.
The aforementioned methods are not applicable for the purpose of providing an invention to isolate both LYIFNs and β genera, since IFN-β concentration is only about 10% of the human IFN concentration. This or a small amount is below the traceability of these methods.
As a consequence of the unsatisfactory approaches prior to the present invention, a new method of careful observation has failed, comprising the synthesis of a 5'-terminal labeled oligodeoxynucleotide complementary to both IFN-α and IFN-β mRNAS, with or without duplicate replication of most (A) RBA-enriched IN LYIFN transcript using RNA. colonies of plasmid-bound DNAS with the labeled CD cDNA probe. This approach allows for specific, rapid and direct detection of IFN-α and IFN-β-containing genes base sequence of the synthesized oligodeoxynucleotide archetype and no further difficult hybridization-translation assays as described in the prior art. IN SITU colonization hybridization is based on the general method described by GRUNSTEIN and K0GNESS (36) or on variants thereof.
«
In this method, colonies are grown on or transported by nitrocellulose filters, completely alkali-treated, and solidified with filters in a radioactively labeled nucleic acid or catheter. <sup>r</sup> The genus is then hybridized to the human DNA-bound DNA.
As the hybridization catheter can be detected autoradiographically, the corresponding colonies containing a hybridizing DNA can be isolated from a set of nitrocellulose filters.
A comparison of the 'coding regions' of the cloned human IEN-α and IFN-β has revealed an area of 13 nucleotides in common with both CDNASs (and apparently also the corresponding trRNAS plus one (23)). 15mg oligodeoxynucleotide having the above mentioned<sup>T.</sup>This related base sequence can be used to initiate cDNA synthesis of human lymphoblastoid IFN-α and -b mRNA.
zz L.
(b) Preparation of <sup>9</sup> x-labeled human IFN-α and IFN-β-specific cDNA catheters .__________________________________ There are some unsubstantiated approaches for the synthesis of oligodeoxynucleotide of a given structure (37), e.g. e.g., the diester or triester method The basic step of the siester method is the binding of two suitable protected deoxynucleotides to form one. diodeoxynucleotide which contains a phosphodiester bond. The triester method differs from the diester method in the presence of an additional protecting organic group on the phosphate groups making the deoxynucleotides and the few deoxynucleotides soluble in organic solvents or ethyl acetate. controlled condition, usually adds a single deoxynucleus7 \ / Ύ * / 'EX'<sup>J</sup> A short all igodeoxynucleapid. * The antidote '.<sup>:</sup> \ / vXt·.'··*.* be carried out in solution or by techniques that are 'in situ'<sup>1 :</sup>’<sup>L.</sup><sup>L.</sup> K vxKWJ- /; which have been perfected to a high degree recently L0 / L.
For example, the IL-3 or oligodeoxynucleotide composition of the 5'-CCTTCTGGAACTG-3 'type complementary to human IFN-α and -β mRNA can be supplemented by the method of triester (described herein). 39) using protected mono-, di- and trideoxynucleotides as starting materials. <sub>b</sub> Process step illustrated in the following figure showing the synthesis of a dinucleotide in
RiPs:
Ho
II o
O_P ~ O '
I.
OR,
Height?
I o =? - oR
CRa
R, 0
K> N - '/ lf Jz o = p.0- | / ° sj in Ι
OR.
O = P- oRn I
OR, where Rj, R2 and R2 are protecting groups, DN and BN are purine or pyrimidine bases and cis. is a condensing agent.
The starting articles used in the present composition (protecting or partially protected mono-, di- or trideoxynucleotides) are known from the literature.
The protecting groups are elongated so that they can be sequentially removed under the same conditions, e.g., separation of the nucleotide-3 * -5'-ligands. :
i, ** I W .. - Rj groups are, for example, monomethoxytrityl or dimethyl Xyj xpjXl & A & Zy
R<sub>2</sub> is, for example, 2-chlorophenyl, and is, for example, 2-cyanoethyl.
* Extracyclic amino functions in adenine residues, guanine;
and cytosine are especially protected by alkyl groups, e.g., benzoyl or isobutyryl. * As a condensing agent, for example 2,4,6-trisopropylbenzene sulfonic acid may be used.
Specific isolation of simple protecting groups (eg R ^, Rj and R<sub>2</sub>) intermediates and complete blocking of the fully ligated proto-3-part dimigodeoxynucleotide can be performed by treatment with an alkali, a monomethoxy triethyl group R is eliminated by treatment with 80% diclof<sub>2</sub> Other methods known in the art may be used in the same way. and / or by high performance liquid chromatography. (HPLC). The 'Z' is 5 * -P-labeled to allow the hybridized catheter to be detected by the following hybridization method. The labeling is complemented by reacting the synthetic archetypal with a signal; -AIR, ·. with T4 polynucleotide kinase in a standard buffer.
The resultant & solution containing the P-labeled archetype is purified by deproteinization, e.g., with phenol, and by chromatographic means, e.g., by SEPHADEX chromatography or polyacrylamide migel electrophoresis. * If desired or nucleotide sequence, this step can be determined by two-dimensional chromatography. Poly (A) RNA LYIFN-embedded RNA (see step Id) is used. TEMPLATE b; n, '; «<sup>1</sup> i for the synthesis of one IFN-α and one-half IFN-α. 'then *' CDHA synthesis takes place at <»t '0 · · · · · · · ·:: * (x? 7·) 7 ... ···'. ···· described above (step 2a); except for the 5'-labeled synthetic oligodeoxynucleotide it is used as an archetype instead of oligode (Atr). The product of the labeled cDNA is deproteinized with, for example, phenol and collected with ethanol. Further purification may be effected, for example, by the polyacrylamide gel electrophoresis of the CDN product. The product can be observed autoradiographically. "A simple ENA bond that is specific for two (A) RNA from pre-loaded cells. Yes, there is no product obtained by using poly (A) DNA from uninfected cells extracted. Its size can be determined, for example, by its relative mobility relative to a labeled DNAS format • 7 Q of known length. The product represents a <sup>9 lbs</sup>P-labeled human ULTT-α and -β specific cDNA probe.
(c) careful observation of two clones containing lymphoblastoids
IFN_CDNA _._____________________________________________________ Colonies which grow and grow on a tetracycline-supplemented agar medium (see section 3e) are carefully observed for two clones containing lymphoblastoid IFN cDNA. For this purpose, the colony hybridization method IN SITU is selected as described above (paragraph 4a). Converting colonies are transferred to nitrocellulose filters and a set of upstream of these colonies is subsequently obtained from each other. The colonies on the filters are dissolved, their DNA denatured and fixed on the IN SITU filters (36).
Prior to the hybridization process, the denatured DNA on the filters is advantageously pre-hybridized with a mixture containing, inter alia, DNA of lower origin to obtain lower levels.<sup>1</sup>-'-^ <sup>;</sup> · Infrastructures and low infrastructure and saturation, non-hybridism, Next, the radio-labeled
CDNA catheter prepared as described above (paragraph 4b) i <sup>7</sup> s' - / _.
is hybridized to the filter-linked two-stranded DNA<sup>1</sup>After the release of the leaves from the oil and other contaminants, the result of the hybridization method can be recorded by autoradiographic analysis on an X-ray film. Colonies presenting a positive response to the X-ray membrane may be collected from the set upstream and used for further research.
Preferably, only a portion of the transformed colonies are transferred to the microcellulose filters. The remaining colonies will be used for further careful observation methods, detailed in detail below (paragraph 4d), e.g., the DMA cells are fixed. which contains inter alia a denatured DMA, e.g. denatured calf thymus DMA, bovine leucomycin, FIGGED and polyvinylpyrrolidone and thereby hybridize to the radio-labeled CDMA catheter (see section 4b) under paraffin oil using fixed paraffin oil. 36) After the hybridization has ceased, the filters are washed successively with chloroform and with a buffer mixture containing SDS and low salt to remove paraffin oil and non-hybridized CDMA filters respectively. they are positively corrosive and can be collected from the set indifferently.
The identified colonies contain DNAS ligands with inserts complementary to those of the cDNA catheter, i.e., DMA fragments corresponding to human lymphoblastoid genes or parts thereof, if any, of their primary metastatic clones. dos. Unbound, of the DMA molecules, the & quot; DMID plasmid, & quot;<sub>X. </sub>from the positively hybridized clones ^> for use / ^ 9 cm.<sup>: </sup>to transform E-CODI UK viruses (paragraph 3e)
<img file="GR76992B_D0046.tif" />
The hybrid plasmid DNASs can be isolated, for example, by the following method. First, each colony identified is cultured in a suitable nutrient medium, e.g. The surviving cells are harvested, are dissolved in a standard buffer and gently pierced to allow the chromosomes to remain within the cell covers.
This method involves, for example, the sequential addition of lysozyme, EDTA, and a non-ionic detergent, e.g., TRITON. The cell is then destroyed and the chromosomal DNA is removed by centrifugation. The supernatant solution is deproteinized, e.g., with phenol, and the RNA is degraded with one HNase to HNase A.
The hybrid plasmid DNA can be separated from RNA fragments by precipitation with polyethylene glycol and purified with ethanol.
At this stage, the separation status of each Isolated hybrid DNA can be determined by separation with a suitable endonuclease restriction specifically or used for alignment of plasmid PBR 322, or position thereof (c). The size of the restriction fragments can be determined, for example, by their electrophoretic mobility within an agarose gel relative to a known DNAS marker of known length.
Each of the Isolated Hydatidic DNAS is transformed into E. coli HB LCI and developed on a suitable tyracycline-containing medium (see paragraph 3e). * From each transformation, some clones are harvested and a single-stranded hybrid plasmid Is isolated as described above hybrid plasmids.
DNAS Submitted to Restrictive Analysis Once a Complete or Partial Nucleotide Sequence Analysis
<img file="GR76992B_D0047.tif" />
This is performed to select hybrid CENASs that are suitable for further treatment. Further, partial sequence analysis may clarify whether the IFN CBNA inserted segments correspond to Human lymphoblastic IFNs or IFNs. Hereinafter, some rapid methods are available for sequencing the ENA molecules. Primary Analysis Methods Specifically developed by SANGER (40) utilize the ability of single polymer composites to precisely complement one copy of a single other single TEMPLATE using radio-labeled DNA fragments generated directly or indirectly. Sequence One method developed by MAHAM and GILBERT (UL) can be selected. In this method, the ENA that is finally sequenced is partially separated into each of the four bases by four different Reactions, and the products are fractionated in size, e.g., by gel electrophoresis.
Sequence ONE can be read From the trace of radioactive bands. To determine or complete a single-stranded nucleotide sequence of ENA, a restriction endonuclease is required or which cleaves one of this region. By the method of MAHAM and GILBERT or series up to 100-150 bases, both directions From the burning can be analyzed an Experiment.
For example, the isolated hybrid ENASs may be cleaved with suitable restriction endonucleases, e.g., PS- I, EC0R I, B-II II or U-I, at sites located within the insert. The resulting ENA fragments are finally labeled with 32 µg (γ- P) -ATP in the presence of a * polynucleotide.<sub><</sub>^ ΐ4<sub>h</sub>voltage, and ^ - ..
<img file="GR76992B_D0048.tif" />
are separated by a second restriction kinase such as d
J- /
S ONE to remain finally marked.
DNA fragments are isolated by, e.g., polyacrylamide gel electrophoresis. Subsequently, the DNA fragments are subjected to specific base separation reactions described by MAHAM and GILBERT (41). The products are fractionated by electrophoresis, e.g. In 7 M urine and DNA fragments can be observed autoradiographically.
d) Identification of additional clones containing lymphoblastoid IFN cDNA.
* As described above (paragraph 4c) a part now? transfected colonies are transferred to nitrocellulose filters and their stabilized DNA is subjected to IN SITU colony hybridization using a radiolabeled cDNA as a catheter, e.g. test additional clones containing DNA ligands having the same or related DNA insert (e.g. IFN related sequences).
For this purpose, the plasmid DNAS of each of the identified colonies (corresponding to different IFN genera or gene fragments) obtained by the first observation method (paragraph 4c) are isolated as described above and separated by restricted fragments the IFN cDNA insert or portion thereof is obtained After these plasmid fragments have a 5'-end, and appropriate DNA fragments (e.g. containing a radioactive labeled IFN insert or part thereof) isolated, e.g. by polyacrylamide gel electrophoresis, may be used either alone or alternatively as a mixture. For hybridization, transgenic colonies (see above) were counted as> 50 kV / g).
their LNA denatured, preloaded? - -g i -. '. 'N -'X - is with IFN individually
X IN filters and hybridized labeled DNA fragments according to GRUNSTEIN and HOGNESS (36). * Hybridization of the colonies can be observed sporadically and collected at a single point.
Identified colonies contain one or more cDNA ligands having the same or similar cDNA insert as the catheters used. In this test method, additional clones may be identified which contain either or each of the fragments. those. The LNA plasmid of each identified colony can be isolated and characterized by restriction analysis and (partial) sequencing analysis as described above (paragraph 4f |).
5) Synthesis of polypeptides with HULYIFN-like activity in E. coli Eu was restricted to DUHIPN species of H0_binders_DNA3
The HULYIFN cDNA inserts of the present invention have been inserted by hybridization into the Pst I site of PER 322 (see e.g. supra) If either the PS or I site of the PBR 322 lies within the genus blastamase, a molten protein will occur when the cDNA insert is attached to that site in an appropriate orientation relative to the orientation. * If the cDNA inserted has its own initiation signal and / or a phase-ending signal with the β-lactamase sequence, there may be a hypotension and / or a hypotension at the second point. But unlike clones, they are toxic ones that do not exhibit any IFN activity if there is a HULYIFN. In this case, the cDNA insert may be isolated and attached to the expression control region appropriately — see (see paragraph 7) to obtain high levels of expression.<sub>G.</sub>a desired polypeptide. '
Cells containing unbound DNA with a HUDYIFN cDNA insert; '/
<img file="GR76992B_D0049.tif" />
V.
- · Can be tested for IFN activity by standard media. For example, cultures with sufficient cell density may grow. Cells are harvested, resuspended, and lysed (see section lb). Free cell extracts may be tested for IFN activity using, e.g., a cytokine assay. x 29)
Clones which synthesize polypeptides with HULYIFN activity are well suited for large scale production. The clones are cultured and the polypeptides can be recovered as described in Chapters 7 and I.
6) Manufacture of the bound plasmids capable of expressing high levels of polypeptides with HULYIFN activity .____________
To be sufficiently expressed, the genus should be suitably pruned relative to the control region comprising the transcriptional promoter (promoter and translation (ribosomal coupling sites).
As described above (paragraph 3d), plasmid PER 322 has been separated with a suitable restriction endonuclease and bound to HULY cDNA. The resulting unbound plasmid DNA has been used to transform E. coli HB ICI. * If PS I is used as a restriction endonuclease, or insertion of the HULY cDNA will occur within the β-lactamase gene PBR 322. 'In addition, if the linker has achieved an appropriate orientation and an appropriate orientation, A protein composed of part of the β-lactamase chain followed by the HULYIIN amino acid sequence. In the event that the DNA does not have the appropriate reading and / or orientation framework, or the resulting protein will not provide any IFN activator In the case of inappropriate orientation, may be rearranged by cDNA excision of a suitable restriction endonuclease (if present;? / f / z; invention; both exhibits may be transduced). I) and Disassociation of the cDNA and the linear plasmid. The resulting hybrid plasmid may be transformed with E.OLI HB ICI or that in turn can be tested for IFN activity as usual.
In order to produce or ineffect the expression of the KULYIFN cDNA insert, it is necessary to place the HULYIFN cDNA near the Reference Expression Control sequence above so that no additional nucleotides (e.g., nucleotides) are inserted. activity). In addition, in the case of HULYIPNB, the primary translational products are pre-interferons consisting of flat spots attached to the N-terminus of mature interferons. The peptide signaling sequences are transduced or transduced. * However, E.COLI will not be able to Disassemble the strings in the first place. Therefore, the strands are advantageously removed from the OPNAbase by appropriate methods (cf. above) so that the Initial Translation Product will be a mature IFN polypeptide. For this purpose, the coding for mature HULYIFN is pre-assembled in vitro and inserted into a plasmid adjacent to a functional linker. Expression of the β-lactamase gene, * Other expression control sequences. including, inter alia, the promoter and the ribosomal conjugation site, may be similarly used, e.g., lactose OBERON, tryptophan OBERON, OBERON arabinose and the like sequences of the phage J N-genus and the phage co-genus prebiotic other sequences known; Technique. The expression control sequence may include an insert already containing the cDNA insert, or the C) DNA may be inserted into a plasmid that contains the expression control sequence or even the two DNA fragments may be inserted into the plasmid.
For example, the mature HUDYIFN cDNA may be subjected to control of the β-lactamase expression control sequence, provided that the mature cDNA insert encodes a mature polypeptide such as HUDYIFN that does not start with an ATG code translation initiation ATG-triple must be synthetically inserted.XX, knowing the nucleotide base sequence and consequently the traces of restriction endonuclease and the PB 322 and the HUDYIFN cDNA, may or may not be achieved in advance. Plasmid PBR 322 is cleaved with PS1 I within the β-lactamase genome and digested with an exonuclease, e.g., BAL 31 'to shorten or encode the β-lactamase sequence.' Alternatively, a combination of β-lactam (5 '). -exonuclease) or 3'-exonuclease from S.COLI and SI nuclease may similarly be useful, the restricted locus, / itself bound to a ds DNA ligand which can be synthesized e.g.
described above (paragraph 4b). &&& The ligand comprises the sequence of recognition of a suitable restriction endonuclease, e.g., BCI, I (Savu.3A). The foregoing plasmid fragment is separated by the restriction endonuclease characteristic of the endonuclease (e.g. BCI, 1) and, subsequently, with ECoR I, (there is an ECoR I site within DBR 322 or located close to the β-lactamase expression control line). The foregoing DNA fragment, e.g. ECol-I-BCI I DNA fragment, consists predominantly of the β-lactamase (ASP) expression control sequence and the incandescent-cured ligand, and can be isolated by electrophoresis. pearl acrylate.
On the other hand, the HUDYIFN cDNA insert is subjected to a DNA binding fragment thereof (paragraph 4d) by a "virus"<sub>L.</sub>WS43 (L); e.g., with the restriction endonuclease PSL I, the TS-isolated HULYIFN cDNA insert is further separated by another restriction endonuclease (or, if necessary, by two other restriction endonucleases and partially reconnected). The DNA or other encodes for a peptide signal. The pre-mature HULYIFN cDNA has a sticky end complementary to that of the ApPt DNA fragment referred to above (e.g., Sa, 3A, 3A adhesive end). 3d) The expression of the hybrid DNA must contain the ATG code preceding the first coding of the mature cDNA to establish an appropriate reading frame. The resulting hybrid DNA contains the control region. of the β-lactamase expression, jfcva ATG, and * own translational sequence encoding complete HULYIFN and two endonuclease restriction ends (e.g. ECoR I and Psli I ends). They are suitable for the entry of the DMA hybrid into the plasmid PER 322 thus separated. The foregoing hybrid plasmid can be used to convert E. Coli viruses and to direct the synthesis of high levels of a polypeptide with HULYIFN activity.
7) Cultivation of clones containing HULYIFN-specific DNAS junction ._________________________________________
Transformed hosts according to the present invention can be used for the production of polypeptides with HULYIFN. The method of targeting said polypeptide is characterized by a transformed host in particular a transformed E. coli genus in culture.
<img file="GR76992B_D0050.tif" />
nutrient medium containing decomposable sources of carbon, nitrogen and organic salts.
Various sources of carbon can be used
<img file="GR76992B_D0051.tif" />
Preferred carbon sources are disposable water<sub>K</sub>thiol<sup>the</sup>^
A.
Such as glucose, maltose, mannitol lactose, or an acetate salt, which can be used either alone or in suitable mixtures. Suitable sources of nitrogen include, for example, amino acids, such as cesamic acids, peptides and proteins, and their degradation products, such as tryptone, peptone or meat extracts, additional yeast extracts, maize extract, maize extract, whey extract, , such as ammonium chloride or nitrate, which may be used alone or in appropriate mixtures. Inorganic salts which may be used include, for example, sulphates
sodium, potassium, magnesium and calcium chlorides, phosphates and carbonates;
In addition, the nutrient medium may also contain growth promoting substances and / or substances that exert a selective pressure to prevent or lose the HULYIFN-specific crosslinker. Substances that promote growth include, for example, trace elements, such as iron, zinc, manganese and the like, or aromatic amino acids. Except for the gene encoding for a HU1YIFN polypeptide with the activity, the DitfAS ligands according to the invention preferably contain a single antibody that gives antibiotic resistance, e.g. In the culture medium, cells containing the unbound DNA will kill and grow into cells that have lost said unbound DNA or foreign microorganisms. Antibiotic-sensitive infectious media will not grow.
The culture is carried out using standard techniques, -The cultivation conditions, such as the pH temperature at which the fermentation time is chosen, in such a way as to produce a% C% yield. | List of polypeptide levels as IFIT. "A selected EiCOI-I develops preferably under aerobic swabs, cultured with immobilization or stirring at a temperature of about 2 ° C-4 ° C, at about 2 ° C-4 ° C. 30 ° 0, at a BH value of 4-9 h, preferably at pH 7 and about a bh of 4-20 h, preferably
8-12 hours. * As a result of culture culture, polypeptides similar to IFNs aggregate intracellularly.
8) Isolation and purification of polypeptides by IFN-activity.
Human lymphoblastoid interferons according to the present invention can be recovered from the culture broth by comprising the steps of releasing said polypeptides from the transformed host cells and purified.
After development of the transformed X-COLI cells at a satisfactory cell density, the first step for the expression of the expressed polypeptide consists of releasing it by cellular or extracellular targeting. . Alternatively, mechanical forces, such as separation forces (eg pressure -X) or pressurized glass beads or alumina, may be used to break down the TS cells resulting from a polypeptide , such as precipitation with ammonium sulfate or trichloroacetic acid, gel electrophoresis, dissolution, chromatography e.g. ion exchange chromatography, Size exclusion chromatography or reverse-phase HPLC and the like. Final purification of the pre-purified product can be achieved, for example, by antibody affinity chromatography. Basically, the purification steps can be completed in accordance with the procedures described above. ) undeveloped by human leukocyte interferon;
BC or degradation and purification of human LVlFN can be (έ max. · = Resolved using the following steps;
<img file="GR76992B_D0052.tif" />
(1) lysis of E. coli cells (2) removal of part of the non-protein material by treatment with polyethyleneimine (3) precipitation of the polypeptides by saturation of the solution with ammonium sulfate.
(4) dissolution in a suitable buffer (5) column chromatography on DEAE-cellulose.
(6) monoclonal antibody affinity chromatography and - (7) molecular size sorting on a suitable SEPEADEX column To obtain a sufficiently pure product, additional purification steps may be performed, without any delay, e.g. phase reversal, etc. * On the other hand, one or more stages may be omitted if possible, or the sequence of stages may be varied.
The present invention also comprises portions and derivatives of the polypeptides of the present invention, e.g., proteolytically purified polypeptides, fully or partially protected, e.g. acylated silicates and especially glycosylated polypeptides, e.g.
The invention pertaining in particular to the DNAS and polypeptides of the present invention are in predominantly pure form and in particular the DNAS, transforming host polypeptides and their method of preparation as described herein by e.g. used in analogy to known interferons for the treatment of viral infections, tumors and cancers of the human body, optionally in combination<sup>7</sup> with antivirals. antigens and anti-cancer products. (e.g., those containing '), in the form of pharmaceutical preparations, an ineffective amount of the active ingredient together with or
in combination with inorganic or organic, solid or liquid, pharmaceutically acceptable carriers which are preferably suitable for pharmacological use.
The pharmacologically active substances of the present invention are preferably used in the form of preparations or infusions for parenteral, e.g., intramuscular or intravenous administration. Such solutions are preferably isotonic aqueous solutions or suspensions which may be prepared prior to ♦
for use, e.g., from lyophilized preparations containing the active ingredient alone or together with a pharmaceutically acceptable carrier. Pharmaceutical preparations may be sterilized and / or contain additives, e.g. preservatives, stabilizers, fibrillating agents or agents. , Solvents for the regulation of osmotic pressure and / or buffering solutions. The present pharmaceutical preparations, which may, if desired, contain pharmacologically valuable substances, in a manner known in the art, e.g. or dissolved and containing from about 0.1% to 100%, especially from about I% to about 50%, and in the case of lyophilisates up to 100% of the active ingredient.
The invention also relates to a method of producing a pharmaceutical composition characterized by the pharmacologically active substance of the present invention is mixed with a pharmaceutically acceptable carrier.
Depending on the nature of the disease and the condition of the patient, the preparations are usually administered, for example, intramuscularly 7 muscles one to three times daily at doses of about 10-10 units.
The following examples exemplify the present invention can no longer be construed as limitations thereof.
The following links are used in the examples!
ethyl bromide
BSA Bovine skin albumin
BTT 1,4-dithiothreitol (I, 4-dimercapto-2,3-butanediol
EDTA ethylenediamine tetraacetic acid
SCS sodium dodecyl sulfate
TNX solution containing 100 mM NaCL, 50 mM Tris.HOB (pH 7.5) and 5 mM EDTA.
Tris (trizma.) Tris - (hydroxymethyl) aminomethane
Tris .HCL tris monohydrochloride
I) * Isolation of poly (A) RNA enriched with EUIFN TflRNA (Figure I)
a) Motivation of the cell_JTAMALWA.,
NAMALWA cells were cultured in RPIil 1640 medium containing 10% fetal calf serum at 37 ° C or cell density 3.10 cells / ml was achieved, the suspension was centrifuged at 800 ° C for 10 minutes at room temperature. within 200 ML of culture medium containing glutamine (0.027% by volume), penicillin (200 units / ml) and streptomycin (50 mg / L). The cells are incubated for 90 minutes.
37 ° 0 only in Newcastle disease (NDV 110) ratio
190 HAV / I0 cells (HAV! Hemoglutinating units). Adding fresh culture medium or cell density is adjusted to 1.3.10 cells / ml and the cell suspension is shaken at 34 ° C at 100 RPM.<sup>M.</sup>after 12 hr. of IC50 cells are harvested and resuspended in 50 ML phosphate buffer (<sup>n</sup>PBS „I fl<sup>t</sup>PBS contains 80 g. NaCL, 2 g. KCL, 14.4 g. To<sub>2</sub>Hep. And Jj? gr.
'W X *' **
KHgPO ^). Before harvesting, do you remove the cells?
However, the activity of interferon was also determined to be "disagree", "or" interferon to the ARMSTRONG (2a) method used in humans;
V. \ z · - .33 .: /
CCL-23 cells and vesicular spasmitis (VSV) as a challenge. There are 4300 IFN units / ML.
<img file="GR76992B_D0053.tif" />
At room temperature at 800 ML lysis buffer 0.05 M tris.HCl (pH 7.5) 0.1 M NaCL, 5 mM EDTA and 2% SDS (crystallographic research grade, SERVA). The lysis product is digested with 0 , 2 MG / ML preincubated (2 h at 37 ° C) protease (Protease P, type VI, SIGMP) at room temperature by extraction with 500 mL of TNF saturated phenol and 5 times with 500 mL of 500 MG nucleic acid chloroform were obtained. as measured by Absorption in 2S NM.
c) Removal of infectious PEA __ * ai_RNA ..
The slightly viscous aqueous solution obtained as described above (Step Ib) was adjusted to 0.3 M NaCl and 1 g. oligo (3T) cellulose (type 7 PL-biochemical) is added. After stirring for 30 minutes at room temperature, the suspension is centrifuged in a 1 liter SORVALL flask in a SORVALL RC-3 centrifuge at 4000 RDM for 10 minutes at room temperature and the slurry is reduced to two cells. 40 ML 2XTNE containing 0.5 SDS.T0 bound poly (A) RNA is then eluted through five successive washes with 2.5 ML of water. * Yield is 720 µg. poly (A) RNA was determined by measuring supernatant density. TS supernatant RNA solution From the first adsorbent Absorbed a second time I g. oligo (c (T) cellulose and eluted as described above, yielding 320 g.
poly (A) RNA. The washes are harvested, TLC-regulated, and poly (A) RNA precipitated with 67% ethanol at -20% for 10 h.
<img file="GR76992B_D0054.tif" />
RNA was collected by centrifugation in SORWALL R0-5B for 10 minutes at 0 ° C. soluble in I ML I nM EDTA.
i
RNA is tested for HUIFN RNA activity by infusion into XENOPUS LAEVIS oocytes as follows:
ML of RNA solution injected into each of the 20 oocytes.
i »
The oocytes are incubated in BARTH medium (2 mg, 88 mg)
NaCL, L at 0 KCL, 0.33 nM 0α (NO<sub>5</sub>)<sub>2</sub>.THE<sub>2</sub>0 , 0.41 mMacaz ^ 2H<sub>2</sub>0 0.82 M MaSO ^ .7H<sub>2</sub>The 2.4 mM NaClO, OG MG / ML penicillin, OG MG / ML streptomycin, the solution is adjusted to pH 7 with hydrogen chloride; according to GURDON (42), BARTH (43) and COLMAN and co-workers ( 30) Spilled oocytes are suppressed for 42-48 hours and the suppressor is removed; It is centrifuged for 5 minutes within an EPPEN DORP centrifuge and the supernatant stored at -20 ° or -80 ° C until used for testing. on HEP-2-cells (PLOW laboratories) the cell extract has a specific activity of 600 IV interferon per gram. injected RNA. d) Enrichment of poly (A) RNA_ with HUIFN, mRNA;
Max (A) RNA is passed through a 0.5 ML CHELEX-I00 column (200-400 MESH, BIO-RAD). The column is washed with I ML I M EDTA. The wash (I MG long (A) RNA within 2 ML EDTA) was heated for 2 minutes at IOO ° C and subjected to centrifugation through sucrose density gradient (G 14 ML sucrose solutions increasing sucrose concentration from 50 to 230 (d / v) and containing 50. HCl (pH 7.5) (0.2 M NaCL and 1 mM EDTA). The centrifugation is carried out in a TST 41 engine (KONTRON AG) at 35,000 RPM over 16 hours at 5 ° C. Fractions of 0.3 ML are collected with an ISC0.2 gradient collector, volumes of ethanol are added to each fraction and the solution is allowed to dilute.
at 10 ° C at -20 ° C. The precipitated TpRNA was harvested by centrifugation (SOVVALL, HB-4 motors at 0 ° C, iVyCOtA RNM at | NO minutes);
The precipitate of the 20th fraction is resolved "within 25 microliters-3 · /,";<sup>;</sup>
Human EDTA and each fraction were assayed for human luteinis RNA as described above (step L), except that only 100 oocytes were injected Per Sample H1A instead of 2O. Results are given. I.
TABLE I
HUIEN tdRNA activity From sucrose-density gradient fractions.
<td>Fracture No.</td><td>IFN activity (moles ^ lu)</td>
<td>I-1.8</td><td> -</td>
<td> 19</td><td> 162</td>
<td> 20</td><td> 162</td>
<td> 21</td><td> 162</td>
<td> 22</td><td> 162</td>
<td> 23</td><td>NOT TESTED</td>
<td> 24</td><td> 729</td>
<td> 25</td><td>NOT TESTED</td>
<td> 26</td><td> 405</td>
<td> 27</td><td>NOT TESTED</td>
<td> 28</td><td> 486</td>
<td> 29</td><td><sub>(</sub> NOT TESTED</td>
<td> 30</td><td> 162</td>
<td> 31</td><td>NOT TESTED</td>
<td> 32</td><td> 162</td>
<td> 33</td><td>NOT TESTED</td>
<td> 34</td><td> 54</td>
<td> 35-40</td><td>NOT TESTED</td>
Fractions 23-29 pool and the poly (A) RNA is further purified as follows.
The poly (A) RNA solution is adjusted to 2xTNE within 0.5 SDS and applied to a 20 µl. double (c / T) cellulose column (A)
The RNA is washed five times with 0.5 g HCl. The wash is adjusted with TNF and the solution is extracted twice with an equal volume of phenol (saturated TNF) and twice with an equal volume of chloroform.
Poly (A) RNA was precipitated with ethanol columns; 20 ° C at 10 j. hours and harvested by centrifugation in HR-4 Mp / L / L, described previously. Poly (A) RNA is dissolved in 100 µL of 0.5 ml M EDTA. The yield is 40 µg. One month top poly (A) RNA is assayed for human IFN activity as described above using 20 oocyte assay. The poly (A) RNA preparation has 81 specificity. interferon single mg RNA.
2) Preparation of the double stranded cDNA (Figure I)
Many (A) RNA enriched for HUIFN RNA (see Step Id) is used as TEMPLATE to prepare double-stranded cDNA mainly as described by EFSTRADIADIS and its partners (44) Maniat and its partners (45) and HERSE and 46)
a) Composition ___Screen_Volume] g_electric £
250 microliters of the reaction mixture containing 40 mM HCl (pH 7.5, 30 rp M NaCL, 5 mM MjCL<sub>2</sub>, 0.5 mM DTT (CALBIOCHEM) I, MJ © TP, dlTP (PL-BIOCHEMICALS) and I M <sup>52</sup>P-JatP (AMERSHAM & specific activity 50,000 CPM / N molar), 20 µg / mL I2-iq (PL-BIOCKEM)<sup>1</sup>CALS), 40 µg / ml poly (A) RNA and 100 units of myeloblastoma virus (AMV) reverse transcriptase (LIFE SCIEWCES, INC, ST, PETERSBURG, FLORIDA) are printed for 80 minutes at 37 ° C. Finish by adjusting the solution to 10 M EDTA and 0.1% SOS. The mixture is extracted once with 1g of phenol. The aqueous phase is extracted with 1g of phenol. * The aqueous phase is extracted with I-chloroform buffer and applied to a 3 ML SEPHADEX G-5O column (PHARMACIA thin). I ML extracts are collected. The fraction of radioactivity is measured by measuring CK. Radioactive fractions were collected and the nucleic acids precipitated with 2 volumes of ethanol at -20 ° C for 10 hours. The sample was centrifuged in HB-4 mobile xx for 20 minutes (0.000 RFM at 0 ° C in the solvent). within 95 microliters H.<sub>2</sub>©. 5 microliters of Ion NaOH is protected and the mixture is quenched at 25 ° C overnight.<sup>:</sup> 40 min. After neutralization with 5 M acetic acid, g / microliter of H2 O and 2 drops of ethanol are added and the sample is stored at -20 ° C for 10 hours. The precipitate is collected by centrifugation as described previously and 200 microliter diluted. 0.1 M EDTA. * The yield of single stranded cDNA is 3.7 micrograms. The size of the cDNA is 7CG-100C nucleotides in length, as determined by the breeding mobility within a 60 polyacrylamide gel in tris-boric SDTA (108 g per tris, 9 g / 3 s SD). g of boric acid over one liter of solution with pH 8.3) containing 7 M urea relative to a known length DNAS marker (32).
b) Synthesis of the second reel and Sj endonuclease digestion
The obtained cDNA solution was heated to IOO ° C for 90 seconds. cooled and incubated in 400 microliters of reaction mixture containing 0.1 M potassium phosphate buffer (pH 6.9), 10 mM MftCL<sub>2</sub>, I0mM DTT (CALBI0CHEM), In Mel ATP, I mfelJcTT, InM C (STP (PL EI0CHBK ± CAL $$ I Earth M) <sup>5</sup>H-dGTP (AMERSHAM, specific activity, 94,000 cpm / NMOLS) and 164 units / ML E. coli DNA polymerase I (BIOLABS, New England) for 8 h at 15 ° C. The reaction ends with addition of EDTA and SDS with The final concentrations were 10 ml of Mn and 0,1 0, respectively. The mixture was extracted with phenol and chloroform, chromatographed on SEPHADEX (PHARMACIA, lithium, 2 L bed volume) and saturated with ethanol 2 .
Prokiptox DNA was treated in a 50 µL incubation mixture containing 0.25 M NaCl, 50 mM sodium acetate (pH 4.5) and 1 rP M ZnO3, with 6 Sj endonuclease units (PL JilOCHEMICALSj at 37 ° C for 30 min. The reaction is stopped with 0.10 SDS and 10 mM EDTA. The reaction mixture is deprotected with 1% phenol (saturated in 50 mM sodium hydroxide, pH 4.5) and /, chloroform. The aqueous phase is chromatographed on a 2 mL column of SEPHADEX 50 mL GAC; ) within TBE. Fractions of HD0 'microliters were not labeled, and the CERENC0V of each strand was determined. The eluted fractions were collected, and the DNA was precipitated with 2 volumes of ethanol at -20 ° C for 10 hours. The pellet is centrifuged in a HB-4 engine (see above) and the pellet is dissolved in a 100 µl solution containing 10 mM Tris, HCL (pH 7.5) and 0.5 mM SAT, 4 micrograms are obtained. DNA is fractionated by a sucrose density gradient (5-23%) within 50 µM HCl (pH 7.5) and 1 nM, EDTA one TST-60 engine (KONTRON AG). Centrifugation is performed 55,000 tPa over 5 hours at I5 ° C. The one who settles faster From an 800 base pair DNA marker who runs in a parallel gradient, adjusted to TGE and precipitated with 67% ethanol at -20 ° C for 10 hours, 0.4 micrograms of double-stranded cDNA are obtained.
3) Preparation of the PBR 522-bound cDNA (Fig. I)
(a) 5th inning_4mph_mph in height_OBNA<sub><</sub>.
The 3'-ends of 0.1 µg. the obtained cIsCLNA yielded poly (<? i) tails within 10 µl. of reaction containing 100 mM sodium cacodylate (pH 7.2) 2.5 M M COCL<sub>2</sub>, 50 µg. BSA (CALBIOCHEM) A Per ML, I n | M c | cTP and 10 units of terminal deoxynucleotidyl transferase (P-1 BIOCHEMICALS) per µg. After cessation (20 min at 27 ° C), EDTA was added at 10 mM and the sample was stored at -20 ° C until used.
(b) Preparation of PS ^ I separated, JgMP eluted PBR 322.
mgr PBR 322 plasmid DNA is digested with 10 units of Pstl Edonuclease (BI0LABS) in a 100 µl solution containing 50 mM NaCL 6 nM, tris -HCL (pH 7.5) 6 nM M ^ CL<sub>O</sub>6mM 2Mercaptoethanol and 100 µg. / ML gelatin at I hour at 37 ° C
The solution is extracted with I<sup>s</sup>, volume of phenol? xi chloroform? g.<sub>;</sub>. The solution is adjusted to TNF and LNA linearly, with 2 volumes of ethanol at -20 ° C for 5 hours .WifepfSlo linear
DNA is eluted with GMP within 200 µl. of a reaction volume containing 100 mM sodium cacodylate (pH 7.2), 5 mM Mg Clg, M NaHCl2, 50 µg; BSA over ML, 1 mM BtTP 100 units of final deoxynucleotidyl transferase (PL BIOCHEMICAL). After centrifugation at 37 ° C for 2 min, EDTA was added at 10 mM and the reaction mixture was cooled to -20 ° C until use. (c) Incandescent staining of dGMP-eluted PBR 322 to _OMP_<sub>L.</sub>______________________________________
DcMP blend of elongated double-stranded cDNA (0.1 µg) and urine
GRIP linear PBR 322 (0.5 µg) within 500 µL of TNF buffer is incubated at 65 ° C for one hour, at 46 ° C at one hour at 37 ° C at one hour and at 20 ° C at one hour. The solution containing PBR 322 bound DNA is placed on ice and used immediately for transformation.
4) Transformation of the E. coli UK viruses with the unfertilized hybrid l-asmid C -.._______________________________________________________
E. coli HB LCI treated with calcium is prepared for transformation by the method of MANDEL and co-workers (35). 10 microliters of top reaction mixture containing the unbound PBR 322 hybrid DNAS plasmid prepared as described above (step 3c) was added to a mixture containing 150 microliters of calcium treated E. coli IBM HCl IgM IgG Cl 1 HCl HCl IBM Cl;<sub>2</sub> and 10 nM tris .HCL (pH 7.5) in a total volume of 200 µl.
The mixture was cooled on ice for 20 minutes, heated to 42 ° C for 1 minute and incubated at 20 ° C for 10 minutes. I ML tryptone medium (tryptone medium contains 10 g BACTO-TRYPTON (DIEC0), 1 g yeast extract (DIFCO), 1 g glucose, 8 g NaCL and 294 MG
OAOE<sub>2</sub>.2H<sub>2</sub>of 1 liter of distilled water was added, and, the mixture was quenched for 20 minutes at 37 ° C by stirring at RPM.
The mixture is topped with two discs (MC CONKEY e ^ f ^ pgDlFCO, <*
<img file="GR76992B_D0055.tif" />
0.6 ML tray) supplemented with 10 µg / ml tetracycline (SIGMA). Lids Incubated at 37 ° C for 12-17 hours. About 5600 tetracycline resistant colonies are transformed from transformed E. coli HB ICIs.
5) Tantopus] in the clones_of the transducers_HIDIGN) <sub>A</sub>
a) Deletion of a 13-mer oligodeoxynucleotide Archetype (Figure 2) "An oligodeoxynucleide complementary to an area of 13 nucleotides that share both HUIFN-Oj and
HUIFN-β synthase is chemically synthesized by the phosphotriestate method TAKURA (see Partners (38), DE ROGI and Partners (39)) The individual steps of the composition are signed in Figure 2. The starting materials indicated 2 * (Mono- and d-ideoxynucleotides bearing protecting groups) are known from the wild type. The protecting groups are separated by methods described by ITAKURA and colleagues. Depolarization of 5'-monomethoxitrile (M) or dimethoxitrile (E) substituted hydroxyl groups is performed at 80% acidity (80% acidity). 0.1 N sodium hydroxide in dioxane water (4 ° C) at room temperature. Concentration of the building blocks is accomplished using trisopropylbenzenesulfonyl chloride as Activating agent to give oligodeoxynucleotides up to the fully conserved I3-moiety of the Representative represented in line 7 of Fig. 2. The final step (complete removal of all protecting groups) is achieved.
A solution containing 64,6 MG crew protected I3-mer oligodeoxynucleotide within 13 ML dioxane and I ml of acetonitrile is treated with 200 MG q & Yv-P-nitrovenxaldoximis AND 124 MG N ^, N ^, N ^, N ^ -tetramethylgouanithinis and Afip & "4j to remain * /. ' ··> ''. · Hours.10 MI Ammonia (25%) and dialyzed / stored -
<img file="GR76992B_D0056.tif" />
set for 24 hours at 50 ° C. After evaporation of the solvent in vacuo, the residue is dissolved in water, adjusted to pH 4 with only aqueous acid and the solution is extracted 20 times with chloroform. The aqueous solution is evaporated in vacuo. within I ML of acid solution (80%) The solution is allowed to stand for 1 hour, diluted, with β ML of water, extracted 3 times with chloroform and lyophilized. The third part of the crude product obtained was purified by chromatography on DEAE-SEPEAD3C A25 (column size LCO 1.3.3 cm2, 2 mL of 200 mL, 200 mL gradient). Triethylammonium carbonate. Washing of the main fraction occurs at a concentration of 0.87 M. The main fraction consisting of a pure product as indicated by HPLC test, was evaporated three times with water, filtered through 10 mL D0WEX 50 (NaCl-salt) and lyophilized .HPLC (REKMARAPHEALH 90 ° C, AX. ° 0, 2M / min, slope
A = 0.005 M KH<sub>2</sub>P0<sub>4</sub>, B = 0.5 M 0.5 M KCL pH 4.5, 20% A ---->
100% B within 30 minutes 11.8 minutes.
b) Preparation of the human-labeled IFN-α and IFN-β-specific cDNA probe (Figure 3) _________________________
EM0L of the Synthetic I3-portion of the Archetypal oligodeoxynucleotide (see step 5a and 40 PM0L of g (<sup>52</sup>P) -ATP (5,700 CC -MMO<sup>-I</sup>yAMER SHAM) inoculated in 100 microliters 50 nM HCl (pH 9.5) mM CL<sub>2</sub> and 5 ml of DTT, 50 units of T polynucleotide kinase (PL BIOCHEMICALS) are added thereafter. After 30 minutes at 37 ° C, another 20 units of enzyme are added, or continued at a reduced temperature - (4-7) 20,000 CEP.ENKON - gPrn-to-P-sesirifruit Human Human TGFR-α ^ HepN-β specific cDNA Aux-ether is obtained.
) Observation - for colonies 7tepV0 ^ itgg HUIFN OPNA (Fig. 3) ^ 650 From the transformed colonies were transcribed by Amit-EpiB (S4B) SB-transfected SB-transfected X-SB strains. 8 CM), The cells were incubated for 15 minutes at 37 ° C. TS aqueous solution containing TS<sup>2</sup>P-labeled archetype is complemented by SEPHADEX G-50 column chromatography of 4 1 L (PHARMACIA, fine (except I m tris -HCL (pH 8p)) O, I ML fractions are collected. * Periodic radionuclide CERENKON irradiation A specific activator is obtained of 4.10 CERENK0N OPT per mole of oligonucleotide. TS-P-labeled archetype (40 PM0L) is lyophilized, resuspended in 91 ml.<sub>2</sub>0 containing 14 µg. poly (A) ENA (from NAMALWA-induced cells prepared as described in step I) and heated for 60 s. at I00 ° C, 9 microliterate of 4 M KOI is added and the mixture is bubbled at 25 ° C for 60 minutes. 450 microliters of the reverse transcript mixture is added so that the reaction volume comprises 40 mM tris-HCl (pH 8) 4 mM MgCl.<sub>2></sub> I mM DTT (CALBIOCHEM, INC) 74 II) KCL, I each of cJaTP, c | gTTP (P-L BI0CHEMCALS) and 90 units of avian myeloblastoma (AMV) transcription by continuous transcription. at 37 ° C. The solution was extracted with 1 g of phenol (saturated TNF) and the nucleic acids were precipitated with 2 drops of ethanol at -20 ° C for 10 hours. The precipitate was collected by centrifugation (HB-4 engine, 20 minutes, 20 minutes). ) and dissolve in 20 µl. of a mixture containing 90% (V / V) formamide (MERCK, pre-analysis), I rp M EDTA, 0.05% blue bromophendyl and 0.05% blue xylene cyanide. The sample is heated at 90 ° C for 2 minutes, and applied over a 5 % polyacrylamide gel plus EDTA (see PEACOCK and co-workers (32). A single strand is visible on the autoradiogram or migrating between the 267 wk and 435 wk segments). <sup>J</sup> P-labeled DNA obtained from Hep III III incubation of the plasmid PBR 322.<sup>2</sup>The p-sessional cDNA fragment was extracted from the gel and purified in the manner described in MUELLER et al. (47). Received 20,000 CERE-
<img file="GR76992B_D0057.tif" />
CDNA cleaner.
(c) Observation for colonies containing HUIEN cDNA (Figure 5)
1650 From the transformed colonies prepared as described above (step 4) cells were transferred to EA 85 nitrogen cellulose filters (SCHLEICHER and SCHUELL 8 cm diameter) cells.
<img file="GR76992B_D0058.tif" />
5«|
What they do and their DNA are denatured and fixed in the filters!
IN SITU, in accordance with GRUNSTEIN and HOGNESS (56). The colonies-bearing filters are preloaded with 4XSET (
lysate containing 0.15 M NaCL, 50 mM Tris.HCl (PH 8.0) I nM EDTA), 0.1% (W / V) FICO 400 (PHARMACIA), 0.I% (S / V) polyvinyl- pyrrolidine (PVP-360, SIGMA), 0.1% (V / V) BSA, 0.5% SDS, 50 µg / ml of rescued calf thymus DNA (prepared as follows: 5 HG DNA; calf thymus (type I , SIGMA) are boiled for 10 minutes in 0.5 M NaOH to separate the DNA, neutralized with 5 M oxic acid and precipitated with 2 drops of ethanol at -20 ° C. The precipitate was collected by centrifugation in a BH-4 engine for 10 minutes at 0 ° C and resuspended in 500 µl of 0.5 mMKGa). At 65 ° C for 4 hours using mixtures of the 20 ML uptake filter and hybridized with 103 CERANK0N Ophthalmic P-labeled nitrocellulose filter catheter within 5XSET, 0.02% (W / V) FICOLL, O.O. V) BSA, 0.2% SDS and 50 µg / ml denatured calf thymus DNA. The hybridization is performed at 65 ° C for 36 hours. The filters are washed once with chloroform, twice in SET, 0.5% SDS without room temperature and twice in SET, 0.5% SDS in I hour at 60 ° C and once. with 3 I) TRIZMA base & room temperature in I hour.
The filters are dried with a 3 mm MM InC paper (WHATMAN) and an X-ray film (FUJI) is exposed to the filters using a screen (ILFORD intensifying screen) at -80 ° C for 72 hours.
* Positive colonies are identified on a autoradiogram and used for further research.
* Since the primary clones of the transformed cells occasionally contain more than one of the transcript DNA loads, the double-stranded LNAp plasmids are isolated from the positive hybridizing strains and used as E. coli. previously described.
<img file="GR76992B_D0059.tif" />
The hybrid plasmid LNA is isolated as follows! a colony was used to inoculate IO ML tryptophan medium supplemented with 10 µg / ml tetracycline to above 25 ml ERLENMEYER vessels. * The culture was incubated for 15-18 hours at 37 ° C at 30 ° KPM. The cells were harvested. S0R ”IALL, HS-4 engine, 10 minutes at 4000 REM, 4 ° C). of cells are obtained and resuspended in I ML 50 mM Tris .HCL (pH 8.0) .0.25L of lysozyme solution (IO MG) ML in 50 mM TrisOH (pH 8.0), or lysozyme is purchased. from SIGMA) are added and after incubation at 0 ° C for 10 minutes, 0.15 ML of 0.5 M EDTA (pH 7.5) are added. After another 10 minutes at 60 ° C 60 µl of 2% TRITON X-10C. (MERCK) are added. After 30 minutes at 0 ° C, The sample was centrifuged for 30 minutes at 15,000 RPM and 4 ° C in a SORVALL SA-600 engine. RPM at 4 ° C. * The upper phase is extracted twice with 1 g of chloroform. Pancreatic RNA A (SIGMA, 10 MG / ML in TNF, preheated 10 min at 85 ° C) is added at a final concentration of 25 µg / ml and the mixture is incubated for 40 minutes. 37 ° C. The solution is then adjusted with I ML NaCL and 10% polyethylene glycol 6000 (FLUKA, incubated for 20 minutes at I20 ° C) and incubated at -IO ° C for 2 hours. The precipitate is collected in a SORVALL HB-4 engine (20 min). at 10,000 RPM, 0 ° C, and resuspended in 100 µL of smaller TNF. One solution is extracted with 1 volume of phenol and one is precipitated with 2 drops of ethanol at -80 ° C for 10 minutes. The precipitate is collected by centrifugation. reflux within 20 microliters
X. i
10 mM tris .HCL (pH 7.5) and 0.5 mM EDTA. From 10M culture, 8-10 µg are recovered. of hybrid plasmid \ ^^^ / *
E. coli HB LCI is transformed with each of the xenobase isolated hybrid DNAS and transformed cells onto tetracycline-containing agar plates, as described previously (step 4). DNAS hybrids are isolated from the cultures as described previously.
"All DMAS samples before and after the transformation are analyzed by separation with PS1 I endonuclease and electrophoresis through a 1% agarose gel in 50 nM trisacetic (pH 7.8) and I EDTA." All samples show traces of cleansing before and after the transformation.
One of the D1IA redundant ligand molecules yields 2 bands, one with the mobility of the PS-I-separated PBR 322, the other with motility corresponding to approximately 1000 P. * CG-PBR 322 / HLYCIFN-Iβ subunits.
Another ligand ENA yields 3 strips, one with the mobility of the PS't-I separated PBR 322, one with mobility of about 600 P and one with mobility of about 150 P. The molecule of the ligand ENA has this clone and CG-PBR is indicated. 322 / HLYCIFN-pj.
(d) Characterization of CG-PBR 322 / HYLCIFN-JE'β and CG-PBR 522 / HLYCIEN clone clones<sub>=</sub>g<sub>I.</sub>______________
The DNAS-binding plasmids of clones CG-PBR 322 / HLYC-IFN-Iβ and CG-PBR 322 / HBYUEN-β<sub>I.</sub> Isolated from melting cultures as described above (step 5 c) and characterized by the consolidation of the nucleotide sequence of the cDNA insert using the method described by I / JAMAM and Gibber et al. (41) used.
The unbound isolated plasmid DNA is digested with a variety of restrictive endococcases. The enzymes are mainly used as described in Supply (BIOAABS NEW ENGLAND), a phenol (saturated BSA) buffer. The enzyme wastewater. The solution _ contained * the solution
<img file="GR76992B_D0060.tif" />
treated with ethanol, resuspended in 50 mM tris-HCL (pH 8.0) at 50 µg / ml DNA concentration and quenched with 0.1 units of calcium enteral halide phosphatase (BOEHRIRGER) with PMOLE DNA at 30 ° C for 30 minutes at 37 ° C. The enzyme is inactivated by heating the solution for 60 minutes at 65 ° C. DKA is purified by LEAE-cellulose chromatography as described by Mueller and colleagues (47) and precipitated with ethanol. DNA is then labeled with 5'-end with (γ - ^^) - ATP (^ 5000 Ct / MMOLE, AMERSHAM). and Polynucleotide Kinase (PL BIOCHEMICALS) sir as described by MAHAM% GILBERT (41) except that DBA is not denatured prior to kinase reaction. In general, the specific activities coincide with a 1-3.10-fold / PrflJe, 5 '- edge.
Segments of labeled LNA are separated by a second restriction endonuclease and the products are separated by electrophoresis through a 6%, 8%, or 10% polyacrylamide gel in a non-borate EDTA buffer. The D1TA fragments are extracted from the gel and purified as described by Mueller and co-workers (47) To determine the nucleotide sequences of the DNA fragments are chemically degraded and the products separated by multilamellar gel electrophoresis.
In particular, the isolated DMAS plasmids of clone CG RBR 322 / HLTCIFN-I * β are treated as follows. * On one occasion, 5 µg of plasmid DNA is digested with Bl I, II, 5 * finally labeled,
P are separated by FVU II. The PVU HH -BL II (* "indicates the labeled position) and BHII-PVU II # DNA fragments were isolated on a 6% polyacrylamide gel. On the other 5 µg. of the plasmid are digested with ALU I, 5'X - finally labeled, and separated with PS'tl.T0 PSLl-A1 * m, 1H Di & an isolated fragment on an '8xHpol' U-n, n. The individual segments are degraded and sequenced based on MAHAM and GILBERT. * The x or x nucleotide sequence obtained is described in approximately 25-35 degrees centigrade. - „end of the cDNA insert. The nucleotide sequence shown is very similar to that of IFN-α (type F) cDNA described by GOEDDEL and co-workers (14). but also WEISSMAN (3), but had several distinct aberrations (point mutations) some of which affect the resulting amino acids (see Figure 4).
Isolated plasmid DNA of clone CG-PBR 322 / HUGIPN-β2 is similarly treated with 5 µg. The plasmid is digested with PVU II and labeled 5'-end. Half of the mixture is separated with pst I and the remainder with B j I II. The Ps II I-PVU II * and B II I IIPVU II fragments are isolated by electrophoresis on a 6 % very- . acrylamide gel and degraded as mentioned above. * The nucleotide sequence (N-terminal sequence) is described in Fig. 5 and discloses that the cDNA insert begins at nucleotide number 102 of IFN-β ^ CDNAS as described by TANIGUCHI and co-workers (ΐ7). The insert has the ability to encode for human IFN-β which does not have II amino acids at the N-terminus. The cDNA insert is bordered at its 5 'end by a stretch of about 20-25 deoxygenic residues and shows a point of mutation at position 153, converting a G to an enantiomeric residue without affecting the resulting amino acid.
(e) Identification of clones containing crosslinked DNA molecules hybridized to the inserts of CG-PBR 322 / HLY2III-IK_k_k_5c<sub>=</sub>PBK_322 / HEV0IPN<sub>=</sub>b<sub>IL</sub>______________________________
The PNAS-binding plasmids of the CG-PBR 322 / HLYC IFNIII clones and CG-PBR 322 / HY0IPN-ββ clones were isolated from the callus / 7 as described above (step 5). 3 CG-PBR. / HLYCIFN * jt '* 0 ·. Plasma · X \<sup>L.</sup>. DNA (5 µg) is digested with Bq I II, 5 µg
, Mr. Shem. <£ © © I
V%. * ___
<img file="GR76992B_D0061.tif" />
and diazosized with PVU II. On the other hand, Isolated CG-PBR
322 / HLYCIPN-P<sub>I.</sub> plasmid DNA (5 µg) is digested with PVU II, 5'-labeled and separated with Bg I, II Bg I II
11 (351 P) DNA fragment (catheter A) and PVU II * - B <| II (368 bp) DNA fragment (catheter B) is isolated from an 80 polyacrylamide gel or description above (step 5) and used for
IN SITU colonization hybridization (see below). The restriction of plasmid DNAS, or the labeling and purification of DNA fragments are all sequenced in the same known manner described above (step 5d)
J000 from the transformed colonies prepared as described above step 4) by transferring nitrocellulose BA 85 filters (SCHLEICHER and SCHUEli, 8 CJfc diameter). The cells are lysed and their DNA denatured and fixed in the IN SITU filters based on GRUNSTEIN and H0GBEPS (36). Hybridization to probes A and (B) (mixed with both probes) is performed as described above (5). 6 Positive colonies are identified by autoradiography, 3 of which are designated as E. coli UK viruses. CG-PBR 322 / HDYCIFNE.COLI UK HOL. CG-PBR 322 / HLYCIFN-Sj and E.COLI UK viruses CG-PBR 322 / HLYCIFN-8 £
They are used for further research. These DNAS plasmids of these clones are isolated, re-transformed, and isolated again as described above (step 5c, 5d)
To establish the nature of the insert of the DNAS ligands, the nucleotide sequences of the insert DNA (partial or complete) are established using the general approach. described above (step 5d). Specifically, 5 µg. DNAS CG-PBR 3ft / HDYCIFN-4-r and CG-PBR-322 / HLYCIFN-8<sup>1</sup> W / -> 7 i are each digested with PVU II, 5 'completely separated and separated'
<img file="GR76992B_D0062.tif" />
V with PS-. I. DNA fragments are fractionated on an 8% polyacrylamide gel and PSL I-PVU II (approx. X20 g) of 8 g DNA and Pst I-PVU II *; (82 g) of 4j DNA are sequentially isolated. §. Isolated CG-PBR 322 / HLYCIFN-5j DNA plasmid is treated as follows. of plasmid DNA is digested with Hae. III, 5-end-labeled and separated by PS1; Psfc; II * (57 bp) portion of JBNA is isolated on an 10c polyacrylamide gel. On the other hand, 5 µg. of the plasmid are digested with ECOR I, 5-end-labeled and separated with PS-I, Pst-IECOR 1 (235 bp) and ECOR I -PS-I (approximately 700 bp) DNA fragments isolated on a Qfi polyacrylamide Gel DB fragments were subjected to sequence analysis according to LIAXAIVI and GILBERT (41).
The nucleotide sequences of the cDNA inserts are described in figures 6-8. In Fig. 6, the nucleotide sequence of the CG-PBR 322 / HLYCIFN-4j cDNA insert is shown; The insert borders at the 5 'end with an extensive 23 deoxygenated subspace and includes part of IFN-ag (ig). described in STREULI et al. (12). In the 3 '-extrasitron region, there are some minimal overexpression (point mutations) and an extension of 3IS nucleotide adducts. The nucleotide sequence of the CG-PBR 322 / HLYCIFN-3 insert cDNA insert is described in detail 7. The insert is bordered at the 5 'end with an extensor of 20-23 dexyglanthoidal residues and is similar to other non-identical cDNAs (type D) cDNA described by G0EDDEL and its partners ((14) * β-j- and cassettes (ΐΐ). * In terms of differences without the cDNA regions preceding and following the IFN coding sequence, the IFN genus contains at positions 28- one GCC triple and 409 / sites. 4GCG triple coding for lane or GTG'Hai *. The GTG correspondingly encodes a valve. Finally, or the votJ clade sequence of the C <-PBR 322 / HLYC LFN-5 cDNA insert<sub>T.</sub> # --- 1 '(see fig. 8) Reveals an area of 17 deoxygenase residues at the 5' end. * The nucleotide sequence is associated with that of IFN-α - (type B) cDNA described by GOEDDEL and co-workers (ΐ4). * However, additional nucleotides exist. The 5th end of the HLYCIFN-5j cDNA insert, point mutations and insertions in the extracellular domain and IFN coding sequence, especially at positions 22 and 361-372, are similarly apparent.
6) Synthesis of E. coli-containing Human Interferons with a molecule containing IFN-specific Human_Disconnector_DNA<sub>L.</sub>____________________ clones which have been shown to contain human IFN-specific Ligand DNA molecules, that is.
.COLI HB ICI CG-PBR 322 / HLYC IFN-1b
EQCI <sup>UK 101</sup> CG-PBR 322 / HLYC IFN-4 ·] -,
E. coli HB ICI CG-PBR 322 / HLYC IFN-5 -,.
E.COLI <sup>nb 101</sup> CG- PBR 322 / HLYC IFN-8 £ and
E coli HBVCs CG-PBR 322 / HLYC IFN-β2 are tested for IFN activity, or whichever is the case, supplemented in the following manner.
Cultures of the corresponding E. coli clone (30 ml suspension) Grow in tryptone medium at optical density (OD q) of approximately I. Cells of 30 ml M NaCL and 50 nM tris.HOE (pH 8.0) * Siloxane (SIGMA) were added in I MG / ML. After 30 minutes at 0 ° C, the suspensions were frozen (liquid nitrogen) and thawed ( 378 C) 5 times, and centrifuged for 20 minutes at 20,000 BPM in SS 34 SORYALL engine at 4 ° C. The supernatants are tested for IFN activity using the ARMSTROG cytopathic assay (29) as described in step 3
<img file="GR76992B_D0063.tif" />
<img file="GR76992B_D0064.tif" />
Source of extract extract
E. coli UK viruses containing DNA Ligation
Extract IFN (IU / ML)
CG-PBR 322 / HLYCIFN-I * β O ', O
CD-PBR 322 / HLYCIFN-4-J- OJO
CG-PBR 322 / HLYCIFN-5J 10, COCELO, COC
CG-FBR 322 / HLYCIFN-8 £ IOOJIOO
CG-PBR 322 / HL ¥ CIFN-p<sub>I.</sub> 0JO
Probably clones lacking measurable IFN activities contain a DNAS Binding wherein the HULYIFN-cDNA insert is in an inappropriate orientation relative to the direction of the Copy. any containing a full length cDNA insert is redirected as follows!
The plasmid DNA of the E. coli HB ICI clone CG-PBR 322 / KL & FF HLYCIFN-I? Clone is Isolated as described above (step 5c) and separated with Pst, I.
O, 5 mg. of the separated DNA within 20 microliters of a buffer mixture containing 20 mM Tris.HOB (pH 7.5) 10 mM Mg, 0E<sub>2</sub>10 µM DTT, 25 M NaCL and 50 µg / ml gelatin, was treated with 0.2 units of DNA ligase (BIOLABS) and 0.5 µM M ATP over 2 hours at 15 ° C.
The E. coli HIV virus is transformed with a cDNA mixture as described above (step 4). Transformed colonies are selected on MC CKNKEY agar plates supplemented with tetracycline and then co-cultured as follows. PVU II-BII II * fragment (351 bp) of CG-PBR 322 / HLYCIFN-Ib DNA Binding (see step 5C) are specified E. coli HB ICI CG-PBR 322 /
HLYCIFN-I 'β-j-.
Extracts of IFN activity assays.
clones are prepared and tested for
<img file="GR76992B_D0065.tif" />
<img file="GR76992B_D0066.tif" />
IFN Activity (IY / ML)
O ', O o', o; o
30; 30
Source of extract of _____
S.C0LI_HB ICIs Containing LNA OG-PBR 322 / HLYCIFN-I * B Ligand<sub>S. </sub>CG-PBR 322 / HLYCIFN-I'β<sub>2 </sub>CG-PBR 322 / HLYCIFN-I'β<sub>3 </sub>CG-PBR 322 / HLYCIFN-I'β<sub>4</sub> Thus, plasmid CG-PBR 322 / HLYCIFK-5S2 Iβ ^ contains a cDNA insert capable of directing the synthesis of a polypeptide with IFN activity. ; ·
7) Manufacture of the unbound plasmid capable of producing high levels of polypeptide with IFN activity and transformation of these plasmids ..__________________________;
A. Construction of the CG-PBR (AP) / LYIFN-gI Binding Plasmid
To improve or improve the IEN specific protein of clone E<sub>±</sub>COLI HBCI CG-PBR 322 / HLYCIFN-Iβ, 6% is then constructed as schematically shown in Table 9. a) Preparation <sub>j</sub> insert. . ..
The E. coli HB ICL CG-PBR 322 / HLYCILN-L? -Bonding DNA plasmid (150 µg) was separated with PSt I (BIOLABS). following stable procedures (see step 5d). After phenol extraction and ethanol precipitation, the estimated insert was removed. · Are centrifuged by gradient centrifugation (5-23%) / within 50 nM Tris-EOE (pH -8.0) and ItttjM EDTA. AG) at 15 ° C for 16 h. Fractions of 0.3 ml are collected with an ISCO gradient collector in I ML / min. Fractions containing the small portion ΐ (e.g., the insert) are collected. The DNA is ethanol precipitated as usual, and the precipitate is collected by centrifugation. '
HB-4 engine (SORVALL) with no RCM, 0 ° C RPM at 0 ° C,. , S.M.
The precipitate was redissolved in 60 µl of 10mM (pH 7.5) and 0.05 M M EDTA. 30 µL of DNA was recovered by measuring the optical density.
<img file="GR76992B_D0067.tif" />
The DNA insert (10 µg) was digested with KaII III (BIOLABS) and the fragments were fractionated on a 2 g agarose gel solution containing 10 mM Tris, 50 mM boric acid, 1 mM EDTA and 0.5 µg / ml bromine. The largest DNA fragments, Ha<sub>:</sub> ·-'
III-Ps1, (S69βP) and Haase III-Ka111 (82βP, cf. Fig. 9, sections 3 and 4 respectively) are each exhaled from the gel, injected through a fine needle with a syringe within 0.5 ML 0µ5 M; NaCL, 50 mM Tris.HOE (pH 8.0) I mM EDTA and elute overnight with stop. The wash is passed through a 100 µL DE-52 (WHATMAN) Paste-Column Mixer to access DMA.'E the column is washed with 2 ml of the same buffer and the DNA is washed with 400 µl of solution containing
1.5 M NaCL 50 M Tris (BH 8.0) and I EDTA.T0 DNA were precipitated with 2 volumes of ethanol - 20 ° C overnight. The precipitate was collected by centrifugation in an EDRENDORE centrifuge *
HAS Ill-Hag, III DNA fragment (82 bp) is redissolved and digested with SACL 3A (BIOLABS). The enzyme is heat inactivated at 65 ° C for 30 minutes. Haft III-Psk I DNA fragment (869 bp), the solution is adjusted to 10 mg CLg, 10<sup>1</sup> · M DTT and 0.5 mM ATP, and Triglase (BIOLABS) was added at 30 units / microliter. The solution was quenched at 0 ° C for 10 min at 0.5 ° C. After extraction with phenol and chloroform. The mixture was fractionated on a 2 L agarose gel in EDTA trisporate in the presence of ethidium bromide. SAM 3A-PS- | ·. ' but (see Fig. 9, section 5) is extracted as described previously, precipitated with ethanol, and redissolved in 10 µl of a solution containing 10 g of HCl, (pH 7.5) and 0, EDTA,
(b) Preparation of the DNA fragment containing the transcript<sup>? </sup>of β-lactamase (A> P<sub>t</sub>) of BBR 322.
<img file="GR76992B_D0068.tif" />
<img file="GR76992B_D0069.tif" />
Plasmid PER 322 is separated with PS't I (see step 3b) and treated with 4 units / ML of BaL 31 exonuclease (BETHESDA RESEARCHLAB) at 30 ° C for 4-10 minutes to remove the hPC codons of the β- lactamase,
A chemical DNA ligand of the type -ATGTGTGATCACACAT-3 is synthesized using the method described above (step 5a) The ligand is added to BaL 31 treated PBR 322 DNA by standard binding. The foregoing hybrid molecule is separated by the restriction endonuclease BCL I (BI0LABS) and ECOR I. Digestion products are fractionated on an 8% polyacrylamide gel in trisporate EDTA as described previously (step 2 DNA).<sub>t</sub> DNA fragments) are migrated between 184 bP and 234 bP DMAS markers, isolated as described above (step 7a), and precipitated with ethanol as usual. The precipitate was redissolved in a solution containing IC mg M Tris, HCL (PH 7.5) and 0.05 M EDTA.
c) Binding of the ApPt DNA segment to the C0NA insert and par<sup>p</sup>2) euphydrophobin-0 & -PBK_ (A1 / HYPN-α<sub>S.</sub>I _.__________________
The solutions containing the ApPt DNA fragments and the cDNA insert? stagnate. The mixture was adjusted to 10 mM Cl j<sub>2</sub>, IOTn M DTT and 0.5 mM ATP, and quenched with 30 units / well TL DNA ligase (BIOLABS) at I5 ° C for 12 hours, after extraction with phenol and chloroform, the mixture was partitioned into 1 % low agarose gel melting (BI0RAD). The obtained APP fragment is ligated to the large portion of PBR 322 separated by PStl (BIOLABS) and ECOR i (BIOLABS) in the following manner. The gel portion (containing the PCR fragment) about 2 is blended with the PS't I-ECTOR section of PpR 322 corporation
<img file="GR76992B_D0070.tif" />
65 ° C for 2 minutes at 37 ° C, cool [30 mmol / mL] and quenched with 30 units / L / L ligase (BIOLABS) for 112 hours at 15 ° C to give a solution containing the CG-PBR (AP) / LYIFNα-I crosslinking plasmid.
d) Transformation of E. coli UK viruses with the plasmid CG-PBR (AP) /LYIFN-aI.________________________________________________________
One tenth of the volume of solution containing 100 mM Tris ECL (pH 7.5) 100 mM CaClg was added to a solution containing the plasmid CG-PBR (AP) /LYIFN- aI. The combined solutions were heated at 10 ° C for 65 minutes. to inactivate or ligase and cool to 37 ° C. The solution is then taken to convert to <sup>; </sup>The treated E-OQLI HB LCs as described above (step 4) were coated onto MC C0NKEY agar plates supplemented with 10 µg / ml tetracycline. Transformed colonies are observed for IFN activity (see Fig. 2). step 6). * The clone synthesizing the highest level of IFN activity is collected and designated E, COLI E3 CG-PBR (AP) /LYIFN-aI. An activity of 40,000 (lU / ML) is present or which represents a total of 1300 cells. compared to the original E. coli UK clone CGPBR 322 / HLYIFN-Iβ clone.
The CG-PBR (AP) / LYIFN-aI clone-bound DNA plasmid was isolated from the culture as described above (step 3c) and characterized by the establishment of the nucleotide sequence of the cDNA insert (genomic IFN). the result is summed up in twenty.
V.
B) Construction of the CG-PBR (AP) / LYIFN-a-3 ligand binding plasmid. The yields of the IFN specific protein of the E.gQLI UK clone CG-PBR 322 / HLYCIFN-S is improved as follows (see Figure II) a. ) Preparation of the DNA fragment containing the regulatory region of CG-PBR<sub>g</sub>(AP) / LYIFN-aI.
OG-PBR (AP) / LYIFN-α DNA (100 µg) was double-digested with HIND III (Bg-X; L'-7?);
L \. '? LAB3) and BQ I II (BIOLABS). After extraction with phenol; ethanol depletion; the excised DNA fragment; of sucrose density gradient centrifugation (5-23%) in 50 mM Tris-HCL (pH 8.0) and 1 mM EDTA. Centrifugation is performed at 58,000 RPM in a TST 60 engine (KONTRON AG) at 15 ° C for 4 hours. . Fractions of 92 ML are collected as described above. Fractions containing the small portion (HIND III-II) II are collected and the DNA precipitated with ethanol as usual. The precipitate is resuspended in 80 µl of 10 mM Trisol (pH 7.5). ) and 0.05 mM EDTA. Recovers 16 µg. DNA was determined by measuring haptic density. i.
The DN segment (HIND III-B <i> II) (4 µg) was separated with SAU 3A (BI0LABS) and the digestion products were fractionated on a 6% polyacrylamide gel in tris-borate-EDTA as described previously. DNA was stained with EtOBt (0.5 µg / ml), the HIND III-SAU 3ADNA fragment (239 bp) extracted and isolated as before. DNA was precipitated with ethanol as usual. The precipitate was resuspended in 20 µl of 1H Tris. (PH 7.5) and 0.05 mM EDTA.
b) Preparation of cDNA-Inserted cDNA<sub>X.</sub>
The cDNA insert is extracted from the CG-PBR 322 HLYCIPN-8 * Ligation Plasmid with PSL I as described above (section 7a)
The cDNA insert (2 µg) is digested with 2.5 units of SAM 3A (BIOLABS) M at 10 µg / ml Eqb and incubated at 37 ° C for 60 minutes. The 5-stranded extracts are phenol extracted and the DNA precipitated. 'ethanol' as above. The DNA fragments were fractionated on a 1.2% agarose gel in a solution containing 50 nM Tris 50 nM Tris 50 mM boric acid, 1 mM EDTA and 0.5 µg / ml bromide ethidium.
The second largest DNA (SAM 3A-P st 1X639 bP) was extracted and purified as described in section 7a). The LNA went-
<img file="GR76992B_D0071.tif" />
c) Binding of HIND III-SAU 3A DNA fragment to CSAU_3A cDNA insert 'ePst_I __________________________________________________ equal quantities of both DNA fragments (approximately 50 NG-) Incubate solution containing 10 mM CL<sub>2</sub> , 10 M DTT,
0.5 mM ATP and 30 units / microliter T-DNA ligase (BI0LABS) at 15 ° C for 3 hours. The mixture is incubated for 15 minutes. At 80 ° C and adjusted to 50 mM NaOB.TS DNA mixture is digested with 0.5 PStl (BIOLABS) and I HIND IIl (BIOLABS) unit for 20 minutes at 37 ° C. The DNA was extracted with phenol, precipitated with ethanol and resuspended in 20 microliters of 10 mM HCl (pH 7.5) and 0.05 mM EDTA.
Half of the resulting mixture is bound to the large HIND Ill-Pst I DNA fragment of plasmid PER 322 (approximately 100 NG-) at 10 M M <CL.<sub>2</sub> 10 M DTT, 0.5 mM ATP containing 30 units / microliter of T-DNA ligase (BI0LABS) for 2 hours at 15 ° C to give a solution containing the CG-PBR (AP) / LYIFN-bound plasmid. -3.
d) E. coli HB LCI transformer with plasmid CG-PBR (AP) / LYIFN-a -3. ________
One tenth of the above solution is used to transform E. coli HB LCIs as described in step 4) Transformed colonies are used to test for IFN activity as described above (see step 6).
* The clone synthesizing the highest IFN activity level Selected and designated E. coli HBVCI CG-PBR (AP) / LYIFNα-3.
* IFN activity is determined as described above (step 6). An activity of 70,000 (IU / ML) is present or which represents a total of 700 complete transcripts compared to the original clone E<sub>±</sub>COLI HBCI CG-PBR 322 / HLYCIFN-8Ί
The DNA-binding plasmid of the cloning strand (APYYYNN) was isolated from culture as described above (step
<img file="GR76992B_D0072.tif" />
\ .-*.4'·:
and is characterized by the nucleotide sequence of the insert cDNA (IFN genus) and the β-lactamase regulatory region. The result is summarized in Fig. 12.
The construction protocol for the plasmid (G-PBR (AP) / LYIFN-a-3) can be used for both a-IFN cDNA genes or suitably truncated a-IFN chromosomes in general.
BC Starting from plasmid CG-PBR 322 / HLYCIFN-5, plasmid CG-PBR (AP) / LYIFN-α-2 is obtained in the same manner as described for plasmid CG-PBR (AP) / LYIFN-a- 3. This new plasmid contains the DNA insert of CG-PBR 322 / HLYCIFN-5j and the CG-PBR (aP) / LYIFN-α-I β-lactamase regulatory domain. "A clone designated E. coli HB viruses CG-PBR (AP) / LYIFN-a -2 is selected as described above. A 50,000 IFN activity (III / KL) is present or which represents a 5-fold stimulation compared to the original E. coli. ICG CG-PBR 322 / ELYIFN-5-; * The cDNA insert nucleotide sequence and the plasmid CG-PBR (AP) / LYIFN-a -2 plasmid regulatory region is amplified as described above and described in Fig. 13.
8) Cultivation of E. coli HB viruses CG-PBR (AP) / L] fIFN-a-3 / kg / lb [Photo] ..____________________________________________
The genus E. coli HBCI CG-TBR (AP) / LYIFN-a-3 is grown in mono No X which contains the following components per liter of solution.
To<sub>2</sub>HPO<sub>4</sub>· 7H<sub>2</sub>Eh<sub>2</sub>yes<sub>4</sub>
NaCL
NH '<sub>4</sub>CI
CkCL<sub>2</sub>.2H<sub>2</sub>O
M ^ S0<sub>4</sub>.7E<sub>2</sub>0 citrate (III) citrate acid yeast extract serelose tetracycline
13.25 g
3.0
0.5
1.0
0.015
0.25
<img file="GR76992B_D0073.tif" />
Separate from the tumor volume, either serelose and or tetracycline, are sterilized by sterile hot and sterile filtration, respectively. Three 2-liter starting containers; 500 ML of No X medium are each inoculated with the cells from a well-developed agar. The stopper vessels are provided with four flanges and sealed on a rotary stopper; at 120 RFM at 30 ° C in II hours, 1.5 liters of this pre-culture is transferred to a 500 liter fermenter containing 300 liters of medium No X and cultured under the following conditions: I start at 350-500 RPM. blade level, ventilation rate 0.3- -1.0 liters / min, kneading head pressure 0.3 BAR, temperature 30 ° C. The dissolved oxygen level is protected from falling below 50 ° by increasing the rate of ventilation and, if necessary, also the rate of initiation at maximum values. The pH is maintained above 6.8 by controlled addition of NaOH. After culture for about 10 hours or the culture has reached the maximum interferon titre (determined by ARMSTRONG (29)) and harvested.
8) * Isolation and purification of HLYIFN-a-5. (a) Preparation of the polypeptide solution for the monoclonal antibody column.
280 liters of pH 7.2 culture broth were cooled to 0 ° C and the cells were separated with an ALFA-lAVAL BRPX-2O7 freezer.
The pure supernatant does not contain IFN activity. Prior to harvesting or cell mass aggregated into the solid ice-cold methyl extractor, the supernatant is placed with 20 liters of Solution Buffer (50 mM Tris.H0E, 50mM EDC, 0.2 mM EDTA, 0.2 mM). PIl'ISF (phenyl methylsulfonyl chloride) in LM-cysteine, adjusted with HCl to pH 8.2) and containing methylation buffer (7 kDa) were extracted with complete freeze-thaw (0 ° C). :
Rinse three times with 2 liters of buffer A Lyceum. Cellulose was adjusted to cell mass with buffer A at 20 liters and had a pH of 6.9. After cooling to 5 -0 ° C, the suspension was passed through a DYNO-mill (type K0L-BIL0T, I.4L). ) discs fitted with a polyurethane disc; and 1170 ML of dull beads 0.5-0.75 in diameter at a starting speed of 3350 RFM and a feed rate of 5 liters / min, while the cells break down.
800 ML of lysis buffer A (additionally containing 100 g.
polyethylamine buffered pH 8.2 non HCl) was added to the obtained suspension of the disrupted cells at 2 ° C with mild stirring. The non-pH suspension was cooled to about 7.6 for three hours at -2 ° C and centrifuged (centrifuged). 77.2 liters) add 30.28 g. The slightly cloudy mixture was centrifuged for an hour at 6 ° C. The supernatant was treated with 4324 g of the ammonium sulfate. of ammonium sulfate and after standing overnight, centrifuge at 3000 RPM. The liquid centrifuge (about 1224 g) is dissolved in buffer E (25 mL without HCL).
10 µM PMSF, adjusted to pH 8.5 with KCL) to give 2800 ML of solution containing the desired polypeptide.
A 700 ML portion of this polypeptide solution is diafiltered at room temperature through a HOLIO HOLLOW filter cartridge through an AMICON DC-2 HOLLOW FIBER system using 7 liters of buffer system B. The filter cartridge is filtered. The washes were combined (1440 ML) and passed at a flow rate of 200 ML / ml on a PEAE bed (trisacryl, M DEAE, LKB 2205-300) with a bed of 450 ML, or having a pre-balanced buffer. The fraction of the first polypeptide with UV-absorbance at 280 UT.5 wavelength is decanted, * The column is further washed with buffer B, until at least 5 lambs have been washed.
/. the base absorption line at 250 BM. Highly adsorbed - X / X; ';', -. · JV..XX-.
peptides are then eluted with 2.8 liters of buffer C (Q, 2M NaCL'XU '/
<img file="GR76992B_D0074.tif" />
M. Tris-HCL, pH 8.5). Column chromatography is performed at 4 ° C. The ARMSTRONG (29) assay washing assay shows IFN activity of 1.4-10 IU / MG. The wash is adjusted with 2H '/ ΐ HCl to pH 7.4 and fractions of its 100 mL are cooled to -20 ° C until used on the monoclonal antibody column.
b) Purification of human LYIFN-a-3 on a monoclonal column _______________________________________________ The monoclonal antibody column I K<sub>2</sub>~ 2O (bed volume 0.8 ML see below) is equilibrated with PBS (phosphate buffer slim) 0.137 M NaCL, 0.0027 M ECL, 0.0077M Na<sub>2</sub>HP0<sub>4</sub>.2H<sub>2</sub>0, 0.0015 M KH<sub>2</sub>B ©<sub>4 </sub>PH 7.4) and portions of the IO NILs of the above polypeptide solution are applied to the column at room temperature at a flow rate of IO Molar. 3 ML of PBS containing 0.5 M NaCL Additive and 0.2% TRITON X 100. The column is eluted with 3M PBS while the specifically adsorbed polypeptides are eluted with 3M of buffer D (0.1M). citrate (0.3M NaCL, pH 2) This fraction and 4 mL of one subsequent PBS wash were combined, adjusted to pH 6.3 with 2N NaOH, and centrifuged at 4 ° C with the help of a submerged CX<sup>Ttl</sup> The concentrate is applied on a SEPHADEX G-25 thin column (2.6 X 34 CM, 200 ML bed volume) equilibrated with 0.025 M HCl pH 6.3.
At 4 ° C and at a flow rate of 42HL / h or column elute with the same histidine. HOE PH 6.3 while 20 fractions of 10.5 ML each are collected. Fractions containing a polypeptide were precipitated by its π280 NMR adsorption. Fractions 7 and 8 contain the polypeptide with IFN activity as L<sup>;</sup>Where? under the test of ARMSTRONG (29). EuVIN - (/ * αα-3) active fractions are stored at -20 ° C or in an ice bath with dilution, * IFN activity of the fractions is 1.8.10<sup>8</sup> IU / MD polypeptide (29)
By lyophilizing the above fractions from I ML solution, 20-40 MG polypeptide is obtained.
SDS polyacrylamide gel electrophoresis (see (49)) reveals molecular weight for approximately 18 KDALTON S obtained LYIFN-a-3
<img file="GR76992B_D0075.tif" />
acrylamide (DCM1) carried out in accordance with BJ RAD0LA (50)
<img file="GR76992B_D0076.tif" />
human LYIFN -α-3 at the isoelectric point of 8.5-5.4 pH, units.
Y) Preparation of the monoclonal antibody column IK2-20
A) Immunodeficiency<sub>L.</sub>
BABB / C mice (8 weeks old obtained from TIERFARM SISSELIf, Switzerland) is injected with 3X105 units of human leukocyte IgG-1 (1% purified) within a full FREUND'S additive (DIFC0) distributed within 4 feet on day 50, or the same amount of IFH is not complete FREUND'S same. injection is given on day 85 when 4X1010 human leukocyte IFM units are given intraperitoneally in brine. · Four days later / spleens are obtained for melting.
B) Preparation of hybrids.
"All melting experiments are used X65-A ^ 8-655 myeloma line (52) mainly performed according to the method of KOHLER and MILSTEIN (53) by mixing 10 ° cells spleen with 10 'cells, myeloma using 50%, 50% myeloma," After washing, the cells were resuspended in 48 mL of fixed DULBECC0 minimal essential oil, 15% fetal bovine serum and 5X10 5 normal cells. <sup>;</sup>
<img file="GR76992B_D0077.tif" />
vd with fixed selective medium (53) over 3-6 weeks. When the hybrids develop, they are frozen and the supernatants tested for anti-Lt activity as described below. * The formation of hybridoma cell clones is performed by dilution.
C) Antibody assays.
For test or anti-IFN activity of the 50 µl supernatant of an IFN-α (final 10-20 units of IFN / ml) is printed with 50 µl, The culture supernatant at room temperature, and 30-60 min. Later or the rest of the IFN activity is tested by a fixed IFN assay. The subsequent combined immobilization bioassay is therefore developed for this purpose. Fifty microliters of Crude IFN-α- (1 MU / L) were mixed (in 38 well microsphere, EPPSNDORP) with an equal amount of supernatant, and the mixture was incubated at 37 ° C for 2-4 hr. -Rabbit Rabbit (NORDIC) is added and the mixture is first incubated at 37 ° C for 1 hour and then at + 4 ° C for 16 hours to form immune complexes. The tubes are then centrifuged at 12,000 RPM for 5 min. The supernatant is laminated and the precipitate is washed once with 1 ML brine pH 7.2 buffers. After washing, the precipitate is dissolved in 200 microliters of pH 2.2 brine. * H. IFN activity is assayed according to ARMSTRONG (29). .
D) Purification of the Anti-IFN Antibody Isolated From Ascotic Fluid ._________________ 3_________________________________
BA1B / C mice were prepared with 0.4 ml PRISTAN (CARL ROTH.) Ty \ peritoneally. One week later mice were injected ritually with 2-5.XIII hybridoma cells.
<img file="GR76992B_D0078.tif" />
<img file="GR76992B_D0079.tif" />
centrifuge at 16,000 RPM for 30 minutes.
<img file="GR76992B_D0080.tif" />
The fluid was precipitated at 180 ° C at room temperature. * This fragment is then passed through SEPHACRYL G 200 (PHARMACIA) according to the instructions of the manufacturer using 0.1 M Hydrochloride. PH 8.2 buffer. Active fractions are collected and concentrated under 50 filters (AMIC0). Determination of the protein was performed by OLggQ measurement by doubling that the I MG of the protein conferred an anti-PPAR resistance of 1.2 to 280 Nm in a cell of CM I.
E) * Immuno-Absorbent Column IK-SO "An ML of the suppressed AFFI-GEL IO (BI0-RAD) is conjugated to 15 MG of the monoclonal anti-IFN monoclonal antibody according to the manufacturer's instructions; AFFI-GEL 10 is washed over a glass-fired funnel first with cold distilled water and then with a 0.1 M solution of NaHCO ^ pH 8.0 (coupling buffer) 500 g of buffer coupling is transferred into a plastic tube, mixed with equal amounts of purified antibiotic solution and rotated for 4 hours at room temperature. After coupling or gel was washed with coupling buffer and to block untreated sites, treated with 0.1 mL of 1H (0.8 mL HH). ML gel for 1-2 hours at room temperature / 'The gel is washed with brine buffer
<img file="GR76992B_D0081.tif" />
0.8 ML of the resultant g% using a monoclonal antibody preparation or column (used for the preparation of
LYIFN (see above)
<img file="GR76992B_D0082.tif" />
IC) Pharmaceutical preparations ί 52 £££££ £ £ 5_X2 £ uΑ32A5ΐ
IviG lymphoblastoid interferons, e.g., LYIFN-a-3 Isolated from the E. coli HB ICL clone CG-PBR (AP) / LYIFN-a-3 (bp. 9) having specific activity of 1.8.10 ^ I units. 1G, dissolve in 30 ML of 5N Human Serum Albumin. The resulting solution is passed through a bacterial filter and the filtrate is filtered under aseptic conditions within 100 vials containing 3.6 x 10 ^ units of pure lymphoblastoid interferon. Vials suitable for parenteral administration are preferably stored in the cold, for example at -20 ° C. Likewise, vials containing 7.2 x 10 ° or 1.08 x 10 'units may be prepared using 5 or 6 I.IG., respectively, of the above lymphoblastoid interferon.
Listing them_for £ 2 made_ £ £ £ £ beans<sub>X.</sub>
Micro-organisms and DNA-binding molecules prepared by the methods described herein are exemplified by cultures deposited within the collection!
of the AGRICULTURAL RESEARCH CULTURE COLLECTION (NRRI) farm on September 14, 1981 and assigned under the following tariffs.
E. coli HB LCI CG-PBR
E.COLI UK CG-PBR E / C0LI UK CG-RBR E_.COLI UK CG-BBR E..C0LI UK CG-PBR
322 / HLYCIFN — b<sub>T.</sub>I NRRL B-I2528 322 / HLYCIPN-4J: NRRL B-I2529 322 / HLYCIFN-I<sup>z</sup>k NRRL B-I253O 322 / HLYCIFN-5jΐ NRRL B-I253I 322 / HLYCIFN-8 £: NRRL B-I2532
<img file="GR76992B_D0083.tif" />
<img file="GR76992B_D0084.tif" />
Anastasia L.
1) WE STEWART, II, Spring Interoperability System SPRINGER VERLAG, VIENNA (1979)
2) Interferon Nomenclature, Nature 286, IIO (1989)
3) C.WEISSMAN DNA sequences, DNA-binding molecules and methods of producing human interferon polypeptides,
European diploma, application no. 32I34 (BIOGEN NV).
4) E. HAVELL ET AL, CHARACTERISTICS OF HUMAN Lymphoblastoid (NAJSADWA) Interferon, J. GEN. VIROL.33,51-59 (1977)).
5) AD SAGAR et al., Heterogeneity of the interferon mRNA species of human lymphoblastoid cells (NAMALWA) induced by SENDAI and murine lymphoblastic cells (UC) CA cells. RES .9,149-16θ (ΐ98ΐ)
6) M. RUBENSTEIN et al. Human leukocyte interferon I production, purification to homogeneity and initial designation „BROC. NATL.ACAD.SCI. USA 76.640-644 (1979)
7) WE STEWARD, II et al. Effect of glycerol inhibitors
<img file="GR76992B_D0085.tif" />
cellulose interferon, Virophysiology 97, 473-476 (1979)
8) KC ZOOON et al. Amino terminal sequence of the main human lymphoblastoid interferon systemic complex, SCIENCE 207 527-528 (1980).
9) SN COHEN AND HW BOYER Method of production of biologically functional molecular CHIMSRANS ,, USP No. 4,237,224 (LELAND STAMFORD JR. UNIVERSITY).
10) S. NAGATA et al. Synthesis within E. coli of a polypeptide with human leukocyte interferon activity,
11) N. Mante and co. The '.Nucleotide sequence of a cDNA.
<img file="GR76992B_D0086.tif" />
J,
S3
12) M. STREULI et al. At least 3 human interferons such as Structure a<sub>2</sub>SCIENCE 209 1343-1547 (1980)
13) DV GOEDDEL et al. 'Human' leucomethylcellulose interferon produced by E. coli is biologically active.<sub>()</sub>
NATURE 287 IV<sub>=</sub>4ΐ6 (1980)
14) DV GOEDDEL et al. The structure of eight distinct GDNAS cloned human leukocyte interferons, NATURE 290 20-26 (1981)
15) J.GRONEBERS And partners. Microbiological preparations of single-stranded amino acids polypeptides of human DNA interferons and plasmid. , which encode this series. Micro-organisms which contain this genetic information and method of preparation thereof, European Patent Application no. 34307 (HOECHST AKTIENGESELLSCHAET).
16) H. SUGANO AND PARTNERS New LNA Cloned DNA, DNA-bound Plasmid. Micro-organisms Containing DNA, and Their Production Methods, European Patent Application no. 28033 (Japanese Research Institute No.7). TANIGUCHI and partners. * The nucleotide sequence of the human fibroblast interferon cDNA, GENE 10.11-15 (1980)
18) R. DERYNCK et al. * Isolation and structure of a human fibroblast interferon genus »MATURE 285 542-547 (1980)
19) DV GOEDDEL and partners. Arrangement of human fibroblast interferon by E. coli, NUCL.ACIDS RES.8, 40574075 (1980).
20) M. REVEL et al Production of interferon by genetic engineering UKPNo. 2,063,882 (YEDA Research and Development Company) .2I) Gene for expression of a similar protein
<img file="GR76992B_D0087.tif" />
See also; · N. &
to human interferon, produced t
for modified bacterial cells, ^) '887,397 (SEARLE AND CO)
<img file="GR76992B_D0088.tif" />
BE \ diploma No
22) J. GRONEBERG et al. Microbiological polypeptide preparations with amino acid sequences of human interferon LNAs and plasmids, which encode these sequences, Micro-organisms, which contain this EuK-like gene30 and its genetic information30. ).
23) T. TANIGUCHI AND PARTNERS. ” Human Leukocyte and Fibroblast Interferon is Structurally Schematic ', NATURE 285,547-549 (1980)
24) ML JOHNSTON AND PARTNERS. ” Factors affecting the production of interferon by human ADV lymphoblastoid cells. EXP. MED.BIOL. 110.61-74 (1978)
25) G.ALLEN AND PARTNERS. ” A family of human lymphoblastoid (leukocyte type) interferon constructs, NATURE
287, 408-411(1980)
26) H.STRANLER AND PARTNERS. ” Production of Human Interferon Lymphoblastoid ,, J.CLIN. MICROBIOL. JD, II6-II7 (1975).
27) MD JOHNSTON, Improvements or methods of production of Interferon European Patent Application No. 520 (VffiLLCOIvIE Foundation).
28) P. SWETLY and partners. VERBESSERTES VERFAHREN ZUR HERSTELLUHG VON HYKANINTERFERON AUS LYMPHOBBASTffilDEB ZELLEN ,,, GERMAN OFFENLEGUNGSSCHRIFT No. 2,946,275 (THOMAE).
29) JAARMSTRONG, * Semi-micro, chromo-conjugate assay for rabbit interferon, APPI. MICROBIOL.21, 723-725 (1971).
30) A. COLMAN AND PARTNERS. ” Extraction of proteins from oocytes of XENOPUSLAEVIS „CELL 17. 517-526 (1979).
31) WE STEWART, II and partners. ” Example of interferon in HAMSTERS experimentally infected with rabies, PROC> SOg .. EXP. BIOL
MEL.123,650-653 (1966) I
32) AC PEACOCK and partners. Nucleic Acids Analysis by Electrophoresis BIOCHEMISTRY 6, IS8-I827 (1957)
<img file="GR76992B_D0089.tif" />
many weapons
L? .
<img file="GR76992B_D0090.tif" />
t
33). PB SEHC-AL and partners. * Heterogeneity of poly (ΐ)-poly (i) -induced human fibroblast interferon species in AifA species, NATURE 288, 95-97 (1980).
34.JG SUTCLIFFE, PBR 322 restriction map derived from the DNAI sequence of precise DNA size markers up to 4,361 pairs of NUCL long nucleotides. ACIDS RES 5, 2721-2728 (1978)
35) ii. MANDEL and partners. Salmonella Bacterium Phage Isolation by Calcium-Dependent DBA Bacteriophage, J.MOL.BIOL. 53 159-162 (1970).
36) iii. & RUNSTEIN & DS HOGNESS, 'Colony Hybridization and Isolation Method of Cloned DBAS Pathways Containing a Specific Genus of PROC.NATL ACAD. SCI 72, 3961-3965 (1979).
37) Mr ITAKURA and associates. Chemical DBA Composition and Studies on DNA Scavenger DNA SCIENCE 209,1401-1405 (I98 @).
58) Mr ITAKURA and associates. Improved triester approach for the synthesis of pentadecdimidyl acetate ',' J. AM. CHEM.
SOC.97, 7327- 7332. (1975).
39) JFM DE ROOIJ and partners. Synthesis of complementary DNA fragments via phosphotriester intermediates, IECL. TRAV.CHIM. PAY β-BAS 98 537-548 (1979).
4S / F.SANGER and partners. DNA sequence with chain termination inhibitors, PROC. NATL.ACAD. SCI. USA 74, 5463-5467v (l977)
41). AM MAXAM AND W. GILBERT, New Method of DNA Sequence PROC.NATL.ACAD.USA 74,560-564 (1977), cf. also enzyme, 65,
499-559 (1980)
42) JB GURDON, J. BHBRYOL, EXP. MORPH. 20 401-414 (I96S).
43) BARTH, J. EMBRYOL, EXP. MORPH. 7, 210-222 (1959)
44) A. EFSTRATIADIS AND PARTNERS. Full length and discreet
Partial Reverse Copies of the RNAS of Globulin and Chorion, CELL 4, 367-378 (1975). \
45) T. KANIATIS and partners. Explanation and characterization of an in vitro synthesized β-globin genus, C3 (LL 8, 163-182 (1976)
46) JHJ HOEIJMAKERS AND PARTNERS. Isolation of Plasmids Containing DNA Complementary to Angeleural RNA for Various Surface Glycoproteins of TRYPOSOMA BRUCEI ,, Gen. 8,391-417 (1980).
47) W.MUELLER AND PARTNERS. Site-directed mutagenesis of DITA1 Creation of point mutations in cloned β-globin complementary RNAs at amino acid residues 121-123 °, J. MOL BIOL. 124, 343-358 (1978).
48) 2. WEISSENBACH AND PARTNERS. Two RNASs of interferon in human fibroblasts Z IBR VITRO translation and studies on cloning of E. coli PROG. NATL.ACAD. SU USA 77, 7152-7156 (1980).
49) UK LAEMMLI, MATURE 227,680-685 (1970).
50) BJ RADOLA, Electrophoresis ,,. P 79-94, WALTER DE GRUYTER BERLIN-NEW YORK 1980.
51) T.STAEHELIN et al., J.BIOL.CHEM. 256. 9750-9754 (1981)
52) JF KEARNEY et al., J. IMMUNOLOG. 123,1548 (1979).
53) G. KOHLER and C. MILSTEIN, NATURE 256,459 (1975).
54) G.GALFRE AND PARTNERS. NATURE 266,550- (1977).
Contents13
104 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32 Sheet 33 Sheet 34 Sheet 35 Sheet 36 Sheet 37 Sheet 38 Sheet 39 Sheet 40 Sheet 41 Sheet 42 Sheet 43 Sheet 44 Sheet 45 Sheet 46 Sheet 47 Sheet 48 Sheet 49 Sheet 50 Sheet 51 Sheet 52 Sheet 53 Sheet 54 Sheet 55 Sheet 56 Sheet 57 Sheet 58 Sheet 59 Sheet 60 Sheet 61 Sheet 62 Sheet 63 Sheet 64 Sheet 65 Sheet 66 Sheet 67 Sheet 68 Sheet 69 Sheet 70 Sheet 71 Sheet 72 Sheet 73 Sheet 74 Sheet 75 Sheet 76 Sheet 77 Sheet 78 Sheet 79 Sheet 80 Sheet 81 Sheet 82 Sheet 83 Sheet 84 Sheet 85 Sheet 86 Sheet 87 Sheet 88 Sheet 89 Sheet 90 Sheet 91 Sheet 92 Sheet 93 Sheet 94 Sheet 95 Sheet 96 Sheet 97 Sheet 98 Sheet 99 Sheet 100 Sheet 101 Sheet 102 Sheet 103 Sheet 104
43 members in 21 offices
Priority claims12
| Document | Office | Kind | Date |
|---|---|---|---|
| 8129937 | United Kingdom | A | |
| 8129937 | United Kingdom | A | |
| 8208988 | United Kingdom | A | |
| 8208988 | United Kingdom | A | |
| 8224871 | United Kingdom | A | |
| 8224871 | United Kingdom | A | |
| 8129937 | – | – | – |
| 8208988 | – | – | – |
| 8224871 | – | – | – |
| GB19810029937 | – | – | – |
| GB19820008988 | – | – | – |
| GB19820024871 | – | – | – |
Members43
| Document | Office | Kind | |
|---|---|---|---|
| FI823356A0 | Finland | A0 | |
| PT75643A | Portugal | A | |
| IL66920A0 | Israel | A0 | |
| IL66920D0 | Israel | D0 | |
| DK437382A | Denmark | A | |
| FI823356L | Finland | L | |
| NO823314L | Norway | L | |
| EP0076489A2 | European Patent Office (EPO) | A2 | |
| AU8895882A | Australia | A | |
| IE822385L | Ireland | L | |
| GB2108510A | United Kingdom | A | |
| JPS5890596A | Japan | A | |
| ZA827216B | South Africa | B | |
| DD204266A5 | German Democratic Republic (until 1990) | A5 | |
| EP0076489A3 | European Patent Office (EPO) | A3 | |
| KR840002031A | Republic of Korea | A | |
| GR76992BThis record | Greece | B | |
| GB2108510B | United Kingdom | B | |
| ES516154A0 | Spain | A0 | |
| ES8504936A1 | Spain | A1 | |
| ES528141A0 | Spain | A0 | |
| ES8601237A1 | Spain | A1 | |
| NZ202058A | New Zealand | A | |
| PT75643B | Portugal | B | |
| AU561104B2 | Australia | B2 | |
| PH21524A | Philippines | A | |
| HU197047B | Hungary | B | |
| PH23119A | Philippines | A | |
| IE54051B1 | Ireland | B1 | |
| FI80719B | Finland | B | |
| EP0076489B1 | European Patent Office (EPO) | B1 | |
| AT52797T | Austria | T | |
| ATE52797T1 | Austria | T1 | |
| DE3280174D1 | Germany | D1 | |
| FI80719C | Finland | C | |
| NO166494B | Norway | B | |
| NO166494C | Norway | C | |
| US5089400A | United States of America | A | |
| KR920007665B1 | Republic of Korea | B1 | |
| JPH06104066B2 | Japan | B2 | |
| JPH07173195A | Japan | A | |
| DK170714B1 | Denmark | B1 | |
| JP2612149B2 | Japan | B2 |
Numbers
- Publication, DOCDB
- 76992
- Publication, EPODOC
- GR76992
- Application
- 69416
- Application, DOCDB
- 820169416
- Application, EPODOC
- GR19820169416
Titles
- English
- DEOXYRIBONUCLEIC ACIDS, RECOMBINANT DEOXYRIBONUCLEIC ACIDS, HOSTS CONTAINING THEM, POLYPEPTIDES AND PROCESS FOR THEIR PRODUCTION
Classification
- CPC, 6
- C07K14/555
- C12N15/11
- A61P31/12
- C12N15/70
- A61P35/00
- A61P35/02
- IPC, 19
- C12N15 09
- A61K38 00
- A61K38 21
- A61P31 12
- A61P35 00
- A61P35 02
- C07K1 22
- C07K14 00
- C07K14 52
- C07K14 555
- C07K14 56
- C07K14 565
- C07K16 00
- C12N1 00
- C12N1 21
- C12N5 10
- C12N15 70
- C12P21 02
- C12R1 19