Anti-tnf antibodies, compositions, methods and uses
Abstract
An antibody specific for tumor necrosis factor alpha (TNFα) that has three CDRs of the heavy chain and three CDRs of the light chain or a fragment that binds to them, where the three CDRs of the heavy chain have the sequence of amino acids of: CDRH1: SYAMH; CDRH2: FMSYDGSNKKYADSVKG; CDRH3: DRGIAAGGNYYYYGMDV; and the three light chain CDRs have the amino acid sequence of: CDRL1: RASQSVYSYLA; CDRL2: DASNRAT; CDRL3: QQRSNWPPFT; for use in the treatment of ulcerative colitis.

Term
Term ended
Projected expiry passed 7 August 2021, 5.1 years ago.
- Priority
- Filed
- Published
- Projected expiry
- Today
5 claims: 3 independent, 2 dependent
- 1ES 2 607 679 T3 ES 2 607 679 T3 Claims Reivindicaciones 1. A specific antibody for tumor necrosis factor alpha (TNFa) that has three heavy chain CDRs and three light chain CDRs or a fragment that binds to them, wherein the three heavy chain CDRs have the sequence of amino acids from:1. Un anticuerpo específico para el factor de necrosis tumoral alfa (TNFa) que tiene tres CDRs de la cadena pesada y tres CDRs de la cadena ligera o un fragmento que enlaza con los mismos, en donde las tres CDRs de la cadena pesada tienen la secuencia de aminoácidos de: CDRH1: SYAMH;CDRH1:SYAMH;CDRH2: FMSYDGSNKKYADSVKG;CDRH2: FMSYDGSNKKYADSVKG;CDRH3: DRGIAAGGNYYYYGMDV;and the three CDRs of the light chain have the amino acid sequence of: CDRH3: DRGIAAGGNYYYYGMDV;y las tres CDRs de la cadena ligera tienen la secuencia de aminoácidos de: CDRL1: RASQSVYSYLA;CDRL1: RASQSVYSYLA;CDRL2: DASNRAT;CDRL2: DASNRAT;CDRL3: QQRSNWPPFT;CDRL3: QQRSNWPPFT;for use in the treatment of ulcerative colitis. para su uso en el tratamiento de colitis ulcerosa.
- 4Una composición que comprende el anticuerpo de las reivindicaciones 1-3 y un vehículo o diligente farmacéuticamente aceptable, para su uso en el tratamiento de colitis ulcerosa. Four. A composition comprising the antibody of claims 1-3 and a pharmaceutically acceptable carrier or diligent for use in the treatment of ulcerative colitis.
- 5A composition comprising an antibody of claims 1-3 for use in the treatment of ulcerative colitis, further comprising at least one selected from a TNF antagonist, an antirheumatic, a muscle relaxant, a narcotic, a non-steroidal anti-inflammatory ( NSAID), an analgesic, an anesthetic, a sedative, a local anesthetic, a neuromuscular blocker, an antimicrobial, an antipsoriatic, a corticosteroid, an anabolic steroid, a diabetes-related agent, a mineral, a nutrient, a thyroid agent, a vitamin, a calcium-related hormone, an antidiarrheal, an antitussive, an antiemetic, an antiulcer, a laxative, an anticoagulant, an erythropeitin, an ilgrastim , a sargramostim, an immunization, an immunoglobulin, an immunosuppressant, a growth hormone, a hormone replacement drug, an estrogen receptor modulator, a mydriatic, a cycloplegic, an alkylating agent, an antimetabolite, a mitotic inhibitor, a radiopharmaceutical, an antidepressant, an antimanic, an antipsychotic, an anxiolytic, a hypnotic, a sympathomimetic, a stimulant, donepezil, tacrine, an asthma medication, a beta agonist, a inhaled steroid, a leukotriene inhibitor, a methylxanthine, a cromolyn, an epinephrine or analog, dornase alfa, a cytokine, and a cytokine antagonist. 5. Una composición que comprende un anticuerpo de las reivindicaciones 1-3 para su uso en el tratamiento de colitis ulcerosa, que comprende adicionalmente al menos uno seleccionado de un antagonista del TNF, un antirreumático, un relajante muscular, un narcótico, un antiinflamatorio no esteroideo (NSAID), un analgésico, un anestésico, un sedante, un anestésico local, un bloqueante neuromuscular, un antimicrobiano, un antipsoriático, un corticosteroide, un esteroide anabólico, un agente relacionado con la diabetes, un mineral, un nutritivo, un agente tiroideo, una vitamina, una hormona relacionada con el calcio, un antidiarreico, un antitusivo, un antiemético, un antiulceroso, un laxante, un anticoagulante, una eritropieitina, un ilgrastim, un sargramostim, una inmunización, una inmunoglobulina, un inmunosupresor, una hormona del crecimiento, un fármaco de sustitución hormonal, un modulador del receptor de estrógenos, un midriático, un cicloplégico, un agente alquilante, un antimetabolito, un inhibidor mitótico, un radiofármaco, un antidepresivo , un antimaniaco, un antipsicótico, un ansiolítico, un hipnótico, un simpaticomimético, un estimulante, donepezil, tacrina, un medicamento para el asma, un beta agonista, un esteroide inhalado, un inhibidor de leucotrieno, una metilxantina, un cromolino, una epinefrina o análogo, dornasa alfa, una citoquina y un antagonista de citoquinas.
Independent claims3
588 paragraphs in 44 sections, as filed
ES 2 607 679 T3
Anti-TNF antibodies, compositions, methods and uses
Description
The present invention relates to antibodies specific for tumor necrosis factor alpha (TNF) protein.
RELATED TECHNIQUE
TNF alpha is a soluble 17 kD protein subunit homotrimer (Smith et al., J. Biol. Chem. 262: 6951-6954 (1987)). There is also a membrane-bound 26 kD precursor form of TNF (Kriegler et al., Cell 53: 45-53 (1988)). For reviews on TNF, see Beutler et al., Nature 320: 584 (1986); Old, Science 230: 630 (1986) and Le et al., Lab. Invest. 56: 234 (1987).
Cells other than monocytes or macrophages also produce TNF alpha. For example, human non-monocytic tumor cell lines produce TNF alpha (Rubin et al., J. Exp. Med. 164: 1350 (1986); Spriggs et al., Proc. Natl. Acad. Sci. United States 84: 6563 (1987)). Peripheral blood CD4 + and CD8 + T lymphocytes and some cultured T and B cell lines (Cuturi et al., J. Exp. Med. 165: 1581 (1987); Sung et al., J. Exp. Med. 168: 1539 (1988), Turner et al., Eur. J. Immunol. 17: 1807-1814 (1987)) also produce TNF alpha.
TNF alpha elicits pro-inflammatory actions that result in tissue damage, such as cartilage and bone degradation (Saklatvala, Nature 322: 547-549 (1986); Bertolini, Nature 319: 516-518 (1986)), induction of molecules adhesion, induction of pro-coagulant activity in vascular endothelial cells (Pober et al., J. Immunol. 136: 1680 (1986)), increased neutrophil and lymphocyte adherence (Pober et al., J. Immunol. 138: 3319 (1987)) and stimulation of platelet activating factor release from macrophages, neutrophils, and vascular endothelial cells (Camussi et al., J. Exp. Med. 166: 1390 (1987)).
Recent evidence associates TNF alpha with infections (Cerami et al., Immunol. Today 9:28 (1988)), immune disorders, neoplastic pathologies (Oliff et al., Cell 50: 555 (1987)), autoimmune pathologies and pathologies graft versus host (Piguet et al., J. Exp. Med. 166: 1280 (1987)). The association of TNF alpha with cancer and infectious diseases is often related to the catabolic state of the host. Cancer patients suffer from weight loss, usually associated with anorexia.
The considerable wasting that is associated with cancer and other diseases is known as "cachexia" (Kern et al. J. Parent. Enter. Nutr. 12: 286-298 (1988)). Cachexia includes progressive weight loss, anorexia, and persistent erosion of lean body mass in response to malignant growth. The cachectic state causes much of the morbidity and mortality in cancer. There is evidence that TNF alpha is involved in cachexia in cancer, infectious pathology, and other catabolic states (eg, see Beutler and Cerami, Ann. Rev. Immunol. 7: 625-655 (1989)).
TNF alpha is believed to play a central role in gram negative sepsis and endotoxic shock (Michie et al., Br. J. Surg. 76: 670-671 (1989); Debets et al., Second Vienna Shock Forum, pp. 463-466 (1989), Simpson et al., Crit. Care Clin. 5: 27-47 (1989)), including fever, malaise, anorexia, and cachexia. Endotoxin markedly activates monocyte / macrophage production and secretion of TNF alpha and other cytokines (Kornbluth et al., J. Immunol. 137: 2585-2591 (1986)). TNF alpha and other monocyte derived cytokines mediate metabolic and neurohormonal responses to endotoxin (Michie et al., New Engl. J. Med. 318: 1481-1486 (1988)). Administration of endotoxin to human volunteers produces acute illness with flu-like symptoms including fever, tachycardia, increased metabolic rate, and stress hormone release (Revhaug et al., Arch. Surg. 123: 162-170 (1988)). Circulating TNF alpha is increased in patients suffering from gram negative sepsis (Waage et al., Lancet 1: 355-357 (1987); Hammerle et al., Second Vienna Shock Forum, pp. 715-718 (1989); Debets et al., Crit. Care. Med 17: 489-497 (1989); Calandra et al., J. Infect. Dis. 161: 982-987 (1990)).
Thus, TNF alpha has been implicated in inflammatory diseases, autoimmune diseases, viral, bacterial and parasitic infections, malignancies and / or neurodegenerative diseases and is a useful target for specific biological therapy in diseases, such as rheumatoid arthritis and Crohn's disease. Beneficial effects in discovered-tag experiments with a chimeric monoclonal antibody to TNF alpha (cA2) have been reported with suppression of inflammation and with successful retreatment after relapse in rheumatoid arthritis (Elliott et al., Arthritis Rheum. 36: 1681-1690 (1993) and Elliott et al., Lancet 344: 1125-1127 (1994)) and in Crohn's disease (Van Dullemen et al., Gastroenterology 109: 129-135 (1995)). Beneficial results have also been reported in a randomized, double-blind, placebo-controlled experiment with cA2 in inflammation-suppressed rheumatoid arthritis (Elliott et al., Lancet 344: 1105-1110 (1994)). Antibodies to a "modulator" material that was characterized as cachectin (which was subsequently found to be identical to TNF) have been described by Cerami et al., (EPO Patent Publication 0212489, March 4, 1987). Such antibodies have been said to be useful in diagnostic immunoassays and in shock therapy in bacterial infections. Rubin et al., (EPO Patent Publication 0218868, April 22, 1987) described
ES 2 607 679 T3 monoclonal antibodies to human TNF, hybridomas secreting such antibodies, methods for producing such antibodies and the use of such antibodies in immunoassay for TNF. Yone et al. (EPO Patent Publication 0288088, October 26, 1988) described anti-TNF antibodies, including mAbs and their utility in immunoassay diagnosis of pathologies, in particular Kawasaki pathology and bacterial infection. Body fluids from patients with Kawasaki disease (infantile acute febrile mucocutaneous lymph node syndrome; Kawasaki, T., Allergy 16: 178 (1967), Kawasaki, T., Shonica (Pediatrics) 26: 935 (1985)) have been said they contain elevated levels of TNF that were related to the progression of the pathology (Yone et al., mentioned above).
Other investigators have described mAbs specific for recombinant human TNF that had neutralizing activity in vitro (Liang, CM et al., (Biochem. Biophys. Res. Comm. 137: 847-854 (1986); Meager, A. et al., Hybridoma 6: 305-311 (1987); Fendly et al., Hybridoma 6: 359-369 (1987); Bringman, TS et al., Hybridoma 6: 489507 (1987); Hirai, M. et al., J. Immunol Meth 96: 57-62 (1987); Moller, A. et al. (Cytokine 2: 162-169 (1990)). Some of these mAbs were used to map human TNF epitopes and develop enzyme immunoassays (Fendly et al., Mentioned above; Hirai et al., Mentioned above; Moller et al., Mentioned above) and to aid in the purification of recombinant TNF (Bringman et al., Mentioned above). However, these studies do not provide a basis for producing TNF neutralizing antibodies that can be used for in vivo diagnostic or therapeutic uses in humans, due to immunogenicity, lack of specificity and / or pharmaceutical suitability.
Neutralizing antisera or mAbs for TNF have been shown in mammals other than man to abrogate adverse physiological changes and prevent death after fatal exposure in experimental endotoxemia and bacteraemia. This effect has been demonstrated, for example, in rodent mortality assays and in primate pathology model systems (Mathison, JC et al., J. Clin. Invest. 81: 1925-1937 (1988); Beutler, B . et al., Science 229: 869-871 (1985); Tracey, KJ, et al., Nature 330: 662-664 (1987); Shimamoto, Y. et al., Immunol. Lett. 17: 311-318 (1988) Silva, AT, et al., J. Infect. Dis. 162: 421-427 (1990), Opal, SM, et al., J. Infect: Dis. 161: 1148-1152 (1990); Hinshaw, LB, et al., Circ. Shock 30: 279-292 (1990)).
The putative hTNF receptor binding loci have been described by Eck and Sprang (J. Biol. Chem. 264 (29), 17595-17605 (1989)), who identified the TNF-α receptor binding loci consisting of at amino acids 1113, 37-42, 49-57 and 155-157. PCT Application WO91 / 02078 (priority date August 7, 1989) describes TNF ligands that can bind to monoclonal antibodies that have the following epitopes: at least one of 1-20, 56-77, and 108-127; at least two of 1-20, 56-77, 108-127 and 138-149; all from 1-18, 58-65; 115-125 and 138149; all from 1-18 and 108-128; all from 56-79, 110-127 and 135 or 136-155; all from 1-30,117-128 and 141-153; all from 1-26, 117-128 and 141-153; all of 22-40, 49-96 or 97, 110-127 and 136-153; all from 12-22, 36-45, 96-105 and 132-157; all from both 1-20 and 76-90; all from 22-40, 69-97, 105-128 and 135-155; all from 22-31 and 146-157; all from 2240 and 49-98; at least one from 22-40, 49-98 and 69-97, both from 22-40 and 70-87. WO 97/291131 describes human antibodies that bind to human TNFa. The antibodies are believed to have a high affinity for human TNFa (Kd of 10<sup>-8</sup> M or less); a slow dissociation rate for dissociation of human TNFa (Kf of 10<sup>-3 </sup>s<sup>-1</sup> or less) and which are capable of neutralizing human TNFa activity in vitro and in vivo.
Non-human mammalian, chimeric, polyclonal (eg, antisera) and / or monoclonal (mAb) antibodies and fragments (eg, proteolytic digestion or protein fusion products thereof) are potential therapeutic agents under investigation. in some cases to try to treat certain diseases. However, such antibodies or fragments can elicit an immune response when administered to humans. Such an immune response can result in immune complex-mediated clearance of the antibodies or fragments from the circulation and render repeated administration unsuitable for therapy, thereby reducing the therapeutic benefit to the patient and limiting re-administration of the drug. antibody or fragment. For example, repeated administration of antibodies or fragments comprising non-human parts can lead to serum sickness and / or anaphylaxis. To avoid these and other problems, various approaches have been taken to reduce the immunogenicity of such antibodies and parts thereof, including chimerization and humanization, as is well known in the art. However, these and other approaches can still result in antibodies or fragments that have some immunogenicity, low affinity, low avidity or problems in cell culture, low scaling, production and / or yields. Thus, such antibodies or fragments may be less than ideally suited for preparation or use as therapeutic proteins.
Accordingly, there is a need to provide anti-TNF antibodies or fragments that overcome one more of these problems, as well as improvements over known antibodies or fragments thereof.
SUMMARY OF THE INVENTION
The present invention provides isolated human anti-TNF antibodies, anti-TNF antibody compositions, encoding nucleic acids, vectors, host cells, compositions, and uses thereof, as described and enabled herein, in combination with the foregoing. known in the art.
ES 2 607 679 T3
The invention provides an antibody or antigen-binding fragment thereof having three heavy chain CDRs and three light chain CDRs, wherein the three heavy chain CDRs have the amino acid sequence of:
CDRH1: SYAMH;
CDRH2: FMSYDGSNKKYADSVKG;
CDRH3: DRGIAAGGNYYYYGMDV; and the three CDRs of the light chain have the amino acid sequence of:
CDRL1: RASQSVYSYLA;
CDRL2: DASNRAT;
CDRL3: QQRSNWPPFT;
for use in the treatment of ulcerative colitis.
The invention also provides a composition comprising the antibody of claim 1 and a pharmaceutically acceptable carrier or diligent, wherein the composition is for the treatment of ulcerative colitis.
The present specification describes isolated nucleic acid molecules that comprise, are complementary to, or hybridize to a polynucleotide encoding specific anti-TNF antibodies that comprise at least one specified sequence, domain, part, or variant thereof. The present specification further describes recombinant vectors comprising said anti-TNF antibody nucleic acid molecules, host cells containing such recombinant nucleic acids and / or vectors, as well as methods for preparing and / or using such antibody nucleic acids, vectors and / or or host cells.
At least one antibody of the invention binds to at least one specified epitope specific for at least one TNF protein, subunit, fragment, part, or any combination thereof. The at least one epitope may comprise at least one antibody binding region comprising at least a part of said protein, which epitope is preferably comprised of at least 1-5 amino acids of at least a part thereof, such as but not limited to , at least one functional, extracellular, soluble, hydrophilic, external or cytoplasmic domain of said protein or any part thereof.
The present invention also provides at least one anti-TNF antibody isolated as described herein, wherein the antibody has at least one activity, such as, but not limited to, inhibition of TNF-induced cell adhesion molecules, inhibition of binding of TNF to receptor, Arthritic Index enhancement in mouse model, (see, eg, Examples 3-7). Thus, an anti-TNF antibody can be selected for a corresponding activity according to known methods, such as, but not limited to, at least one biological activity towards a TNF protein.
The present specification also describes at least one method of expressing at least one anti-TNF antibody, in a host cell, which comprises culturing a host cell as described herein under conditions in which at least one anti-TNF antibody It is expressed in detectable and / or recoverable amounts.
The present specification also describes at least one composition comprising (a) an isolated nucleic acid encoding an anti-TNF antibody and / or antibody as described herein and (b) a suitable carrier or diluent. The carrier or diluent may optionally be pharmaceutically acceptable, in accordance with known carriers or diluents. Optionally, the composition may further comprise at least one additional compound, protein, or composition.
The present specification further describes at least one anti-TNF antibody composition or method, for administering a therapeutically effective amount to modulate or treat at least one TNF-related condition in a cell, tissue, organ, animal or patient and / or, prior to , subsequent to or during a related condition, as known in the art and / or described herein.
The present specification also describes at least one composition, device and / or method of administration of a therapeutically or prophylactically effective amount of at least one anti-TNF antibody, according to the present invention.
The present specification further describes at least one anti-TNF antibody composition or method, for diagnosing at least one TNF-related condition in a cell, tissue, organ, animal, or patient and / or, before, after, or during a related condition, as known in the art and / or described herein.
ES 2 607 679 T3
The present specification also describes at least one composition, device and / or administration method for the diagnosis of at least one anti-TNF antibody, according to the present invention.
DESCRIPTION OF THE FIGURES
Figure 1 shows a graphical representation showing an assay for ability of TNV mAbs in hybridoma cell supernatants to inhibit binding of TNFα to recombinant TNF receptor. Varying amounts of hybridoma cell supernatants containing known amounts of TNV mAbs were preincubated with a fixed concentration (5 ng / ml) of labeled TNFa.<sup>125</sup>I. The mixture was transferred to 96-well Optiplates that had previously been coated with p55-sf2, a recombinant TNF / IgG receptor fusion protein. The amount of TNFa that bound to the p55 receptor in the presence of the mAbs was determined after washing off unbound material and counting using a gamma counter. Although eight TNV mAb samples were tested in these experiments, for simplicity three of the mAbs that were shown by DNA sequence analysis to be identical to one of the other TNV mAbs are not shown here for simplicity (see section 5.2 .two). Each sample was tested in duplicate. The results shown are representative of two independent experiments.
Figure 2 shows DNA sequences of the TNV mAb heavy chain variable regions. The germline gene shown is the DP-46 gene. "TNV" indicates that the sequence shown is the sequence of TNV14, TNV15, TNV148 and TNV196. The first three nucleotides in the TNV sequence define the translation initiation Met codon. The dots in the TNV mAb gene sequences indicate that the nucleotide is the same as in the germline sequence. The first 19 nucleotides (underlined) of the TNV sequences correspond to the oligonucleotide used to PCR amplify the variable region. An amino acid translation (single letter abbreviations) beginning with the mature mAb is shown only for the germline gene. The three CDR domains in germline amino acid translation are bold and underlined. Lines marked TNV148 (B) indicate that the sequence shown refers to both TNV148 and TNV148B. Gaps in the germline DNA sequence (CDR3) are because the sequence is unknown or does not exist in the germline gene. TNV mAb heavy chains use the J6 junction region.
Figure 3 shows DNA sequences of the TNV mAb light chain variable regions. The germline gene shown is a representative member of the Vg / 38K family of human kappa germline variable region genes. The dots in the TNV mAb gene sequences indicate that the nucleotide is the same as in the germline sequence. The first 16 nucleotides (underlined) of the TNV sequences correspond to the oligonucleotide used to PCR amplify the variable region. An amino acid translation of the mature mAb (single letter abbreviations) is shown for the germline gene only. The three CDR domains in germline amino acid translation are bold and underlined. Lines marked TNV148 (B) indicate that the sequence shown refers to both TNV148 and TNV148B. Gaps in the germline DNA sequence (CDR3) are because the sequence is not known or does not exist in the germline gene. TNV mAb light chains use the J3 junction sequence.
Figure 4 shows deduced amino acid sequences of TNV mAb heavy chain variable regions. The amino acid sequences shown (single letter abbreviations) were deduced from the determined DNA sequence from both uncloned PCR products and cloned PCR products. The amino acid sequences are shown divided into secretory signal (signal), flanking (FW) and complementarity determining region (CDR) domains. The amino acid sequence for the germline DP-46 gene is shown on the top line of each domain. The dots indicate that the amino acid in the TNV mAb is identical to the germline gene. TNV148 (B) indicates that the sequence shown refers to both TNV148 and TNV148B. TNVs indicate that the sequence shown refers to all TNV mAbs unless a different sequence is shown. Hyphens in the germline sequence (CDR3) indicate that the sequences are not known or do not exist in the germline gene.
Figure 5 shows deduced amino acid sequences of TNV mAb light chain variable regions. The amino acid sequences shown (single letter abbreviations) were deduced from DNA sequence determined from both uncloned PCR products and cloned PCR products. The amino acid sequences are shown divided into secretory signal (signal), flanking (FW) and complementarity determining region (CDR) domains. The amino acid sequence for the Vg / 38K type light chain germline gene is shown on the top line of each domain. The dots indicate that the amino acid in the TNV mAb is identical to the germline gene. TNV148 (B) indicates that the sequence shown refers to both TNV and TNV148B. "All" indicates that the sequence shown refers to TNV14, TNV15, TNV148, TNV148B, and TNV186.
Figure 6 shows schematic illustrations of the heavy and light chain expression plasmids
ES 2 607 679 T3 used to prepare C466 cells expressing rTNV148B. p1783 is the heavy chain plasmid and p1776 is the light chain plasmid. The variable and constant region coding domains of rTNV148B are shown as black boxes. Immunoglobulin enhancers in JC introns are shown as gray boxes. Relevant restriction sites are shown. The plasmids are shown oriented so that the transcription of the Ab genes progresses in a clockwise direction. Plasmid p1783 is 19.53 kb in length and plasmid p1776 is 15.06 kb in length. The complete nucleotide sequences of both plasmids are known. The variable region coding sequence in p1783 can easily be replaced with another heavy chain variable region sequence by replacing the BsiWI / BstBI restriction fragment. The variable region coding sequence in p1776 can be replaced with another variable region sequence by replacing the SaII / AflII restriction fragment.
Figure 7 shows the graphical representation of growth curve analysis of five rTNV148B producing cell lines. The cultures were started on day 0 by seeding the cells in T75 flasks in I5Q + MHX medium to have a viable cell density of 1.0 X 10<sup>5</sup> cells / ml in a volume of 30 ml. The cell cultures used for these studies had been in continuous culture since transfections and subclones were performed. In the following days, the cells in the T flasks were thoroughly resuspended and a 0.3 ml aliquot was removed from the culture. Growth curve studies were terminated when cell counts fell below 1.5 X 10<sup>5</sup> cells / ml. The number of live cells in the aliquot was determined by trypan blue exclusion and the remainder of the aliquot was stored for subsequent mAb concentration determination. An ELISA for human IgG was performed on all sample aliquots at the same time.
Figure 8 shows a graphical representation of comparison of cell growth rates in the presence of varying concentrations of selection of MHX. Cell subclones C466A and C466B were thawed in medium without MHX (IMDM, 5% FBS, and 2 mM glutamine) and cultured for an additional two days. Then both cell cultures were divided into three cultures containing no MHX, 0.2X MHX or 1X MHX. One day later, the new T75 flasks were seeded with the cultures at a starting density of 1 X 10<sup>5</sup> cells / ml and cells were counted at 24 hour intervals for one week. The doubling times for the first 5 days were calculated using the formula in SOP PD32.025 and are shown above the bars.
Figure 9 shows graphical representations of the stability of mAb production over time from two rTNV148B producing cell lines. Cell subclones that had been in continuous culture since transfections and subclones were performed were used to begin long-term serial cultures in 24-well culture plates. Cells were grown in I5Q medium with and without MHX selection. Cells were continuously passaged by separating cultures every 4 to 6 days to maintain viable new cultures while previous cultures were allowed to deplete. Aliquots of the depleted cell supernatant were collected shortly after the cultures were depleted and stored until mAb concentrations were determined. An ELISA for human IgG was performed on all sample aliquots at the same time.
Figure 10 shows weight changes in Tg 197 mice in a mouse model of arthritis in response to anti-TNF antibodies of the present invention compared to controls in Example 4. At approximately 4 weeks of age the Tg197 study mice were assigned, based on gender and body weight, to one of 9 treatment groups and treated with a single intraperitoneal bolus dose of Dulbecco's PBS (D-PBS) or a anti-TNF antibody of the present invention (TNV14, TNV148 or TNV 196) at 1 mg / kg or 10 mg / kg. When weights were analyzed as a change from pre-dose, animals treated with 10 mg / kg cA2 showed consistently greater weight gain than D-PBS treated animals throughout the study. This weight gain was significant in weeks 3-7. Animals treated with 10 mg / kg TNV148 also achieved significant weight gain at week 7 of the study.
Figures 11A-C depict the progression of disease severity based on the arthritic index as presented in Example 4. The arthritic index of the group treated with 10 mg / kg of cA2 was lower than the control group of D- PBS starting at week 3 and continuing through the remainder of the study (week 7). Animals treated with 1 mg / kg of TNV14 and animals treated with 1 mg / kg of cA2 did not show significant reduction in AI after week 3 when compared to the Group treated with D-PBS. There were no significant differences between the 10 mg / kg treatment groups when each was compared with the others of similar doses (10 mg / kg of cA2 compared with 10 mg / kg of TNV14, 148 and 196). When the 1 mg / kg treatment groups were compared, the 1 mg / kg TNV148 showed AI significantly less than 1 mg / kg cA2 at weeks 3, 4, and 7. The 1 mg / kg TNV148 was also significantly less than the group treated with 1 mg / kg TNV14 at 3 and 4 weeks. Although TNV196 showed significant reduction in Al up to week 6 of the study (when compared to the D-PBS treated Group), TNV148 was the only 1 mg / kg treatment that remained significant at
ES 2 607 679 T3 completion of the study.
Figure 12 shows weight changes of Tg 197 mice from a mouse model of arthritis in response to anti-TNF antibodies of the present invention compared to controls in Example 5. At approximately 4 weeks of age the Tg197 study mice were assigned, based on body weight, to one of 8 treatment groups and treated with an intraperitoneal bolus dose of control article (D-PBS) or antibody (TNV14, TNV148) at 3 mg / kg (week 0). Injections were repeated in all animals at weeks 1, 2, 3 and 4. Groups 1-6 were evaluated to test the efficacy of the article. Serum samples, obtained from animals in Groups 7 and 8, were evaluated for immune response induction and pharmacokinetic clearance of TNV14 or TNV148 at weeks 2, 3, and 4.
Figures 13A-C are graphs depicting disease severity progression in Example 5 based on arthritic index. The arthritic index of the group treated with 10 mg / kg cA2 was significantly lower than that of the D-PBS control group starting at week 2 and continuing through the remainder of the study (week 5). Animals treated with 1 mg / kg or 3 mg / kg of cA2 and animals treated with 3 mg / kg of TNV14 did not achieve any significant reduction in Al at any time throughout the study when compared to the group of D-PBS control. Animals treated with 3 mg / kg TNV148 showed a significant reduction when compared to the D-PBS treated group starting at week 3 and continuing through week 5. Animals treated with 10 mg / kg of cA2 showed a significant reduction in Al when compared to both lower doses (1 mg / kg and 3 mg / kg) of cA2 in weeks 4 and 5 of the study as well as significantly less than animals treated with TNV14 at weeks 3-5. Although there appear to be no significant differences between any of the 3 mg / kg treatment groups, Al for animals treated with 3 mg / kg TNV14 was significantly higher at some time points than those at 10 mg / kg, whereas animals treated with TNV148 were not significantly different from animals treated with 10 mg / kg cA2.
Figure 14 shows weight changes in Tg 197 mice from a mouse model of arthritis in response to anti-TNF antibodies of the present invention compared to controls in Example 6. At approximately 4 weeks of age the Tg197 study mice were assigned, based on gender and body weight, to one of 6 treatment groups and treated with a single intraperitoneal bolus dose of antibody (cA2 or TNV148) at 3 mg / kg or 5 mg / kg. This study used the D-PBS and 10 mg / kg cA2 Control Groups.
Figure 15 depicts disease severity progression based on arthritic index as presented in Example 6. All treatment groups showed some protection at early time points, showing the 5 mg / kg cA2 and the of 5 mg / kg TNV148 significant reductions in Al at weeks 1-3 and all treatment groups showing a significant reduction at week 2. Later in the study, the animals treated with 5 mg / kg of cA2 showed some protection, with significant reductions in weeks 4, 6 and 7. The low dose (3 mg / kg) of both cA2 and TNV148 showed significant reductions in 6 and all treatment groups showed significant reductions at week 7. Neither treatment group was able to maintain a significant reduction at study completion (week 8). There were no significant differences between any of the treatment groups (excluding the saline control group) at any point in time.
Figure 16 shows weight changes of Tg 197 mice from a mouse model of arthritis in response to anti-TNF antibodies of the present invention compared to controls in Example 7. To compare the efficacy of a single intraperitoneal dose of TNV148 (obtained from hybridoma cells) and rTNV148B (obtained from transfected cells). At approximately 4 weeks of age Tg197 study mice were assigned, based on gender and body weight, to one of 9 treatment groups and treated with a single intraperitoneal bolus dose of Dulbecco's PBS (D-PBS) or antibody ( TNV148, rTNV148B) at 1 mg / kg.
Figure 17 depicts the progression of disease severity based on the arthritic index as presented in Example 7. The arthritic index of the group treated with 10 mg / kg cA2 was lower than that of the D-PBS control group. beginning at week 4 and continuing throughout the remainder of the study (week 8). Both the Groups treated with TNV148 and the Group treated with 1 mg / kg cA2 showed a significant reduction in Al at week 4. Although a previous study (document P-099-017) showed that TNV148 was slightly more effective in reducing the Arthritic Index following a single 1 mg / kg intraperitoneal bolus, this study showed that the Al of both versions of the treated groups with TNV antibody it was slightly higher. Although (with the exception of week 6) the Group treated with 1 mg / kg of cA2 was not significantly increased compared to the group of 10 mg / kg of cA2 and the Groups treated with TNV148 were significantly greater in weeks 7 and 8 , there were no significant differences in Al between 1 mg / kg of cA2, 1 mg / kg of TNV148 and 1 mg / kg of TNV148B in any
ES 2 607 679 T3 point in the study.
DESCRIPTION OF THE INVENTION
The present invention provides isolated, recombinant and / or synthetic anti-human TNF antibodies, as well as compositions encoding nucleic acid molecules comprising at least one polynucleotide encoding at least one anti-TNF antibody of the invention. The present invention further includes, but is not limited to, uses of such antibodies, for example in diagnostic and therapeutic compositions, methods and devices.
As used herein, an "anti-tumor necrosis factor alpha antibody", "anti-TNF antibody", "anti-TNF antibody part" or "anti-TNF antibody fragment" and / or "antibody variant "anti-TNF" and the like include any protein or peptide that contains a molecule comprising at least a part of an immunoglobulin molecule, such as but not limited to, at least one complementarity determining region (CDR) of a heavy or light chain or a ligand-binding portion thereof, a heavy chain or light chain variable region, a heavy chain or light chain constant region, a flanking region or any part thereof, or at least a part of a TNF receptor or binding protein, which can be incorporated into an antibody of the present invention. Such antibody optionally further influences a specific ligand, such as but not limited to, where such antibody modulates, decreases, increases, antagonizes, agonizes, mitigates, alleviates, blocks, inhibits, abrogates and / or interferes with at least one activity or binding of TNF, or with a TNF receptor activity or binding, in vitro, in situ and / or in vivo. As a non-limiting example, a suitable anti-TNF antibody, specified part or variant can bind to at least one TNF or specified parts, variants or domains thereof. A suitable anti-TNF antibody, specified part or variant may also optionally influence at least one TNF activity or function, such as but not limited to, RNA, DNA or protein synthesis, TNF release, TNF receptor signaling, membrane TNF cleavage, TNF activity, TNF production and / or synthesis. The term "antibody" is further intended to encompass specified antibodies, digest fragments, parts and variants thereof, including antibody mimetics or comprising parts of antibodies that mimic the structure and / or function of an antibody or specified fragment or part thereof. , including single chain antibodies and fragments thereof. Functional fragments include antigen-binding fragments that bind to a mammalian TNF. For example, antibody fragments capable of binding TNF or parts thereof, including but not limited to Fab (eg, by papain digestion), Fab '(eg, by partial pepsin digestion and reduction), and F ( ab ') 2 (eg by pepsin digestion), facb (eg by plasmin digestion), pFc' (eg by pepsin or plasmin digestion), Fd (eg by digestion, partial reduction and reaggregation with pepsin), Fv or scFv fragments (eg, by molecular biology techniques), are encompassed by the invention (see, eg, Colligan, Immunology, mentioned above).
Such fragments can be produced by enzymatic cleavage, synthetic or recombinant techniques, as is known in the art and / or as described herein. Antibodies can also be produced in a variety of truncated forms using antibody genes in which one or more stop codons have been introduced upstream of the natural stop site. For example, a combination gene encoding a heavy chain portion of F (ab ') 2 can be designed to include DNA sequences encoding the CH, domain, and / or hinge region of the heavy chain. The various antibody parts can be linked chemically by conventional techniques or can be prepared as a contiguous protein using genetic engineering techniques.
As used herein, the term "human antibody" refers to an antibody in which substantially every part of the protein (eg, CDR, flanking, Cl, Ch domains (eg, Ch1, Ch2, CH3) hinges , (VL, VH)) are substantially non-immunogenic in humans, with only minor sequence changes or variations. Similarly, so-called primate (monkey, baboon, chimpanzee, etc.), rodent (mouse, rat, rabbit, guinea pig, hamster, and the like) and other mammalian antibodies designate such species, subgenus, genus, subfamily specific antibodies. and family. Furthermore, chimeric antibodies include any combination of the above. Such changes or variations optionally and preferably retain or reduce immunogenicity in humans or other species relative to unmodified antibodies. Thus, a human antibody is different from a chimeric or humanized antibody. It is noted that a human antibody can be produced by a non-human animal or prokaryotic or eukaryotic cell, which is capable of expressing functionally rearranged human immunoglobulin genes (eg, heavy chain and / or light chain). Furthermore, when a human antibody is a single chain antibody, it may comprise a linker peptide that is not found in native human antibodies. For example, an Fv can comprise a linker peptide, such as at about eight or different glycine amino acid residues, that connects the heavy chain variable region and the light chain variable region. Such linker peptides are considered to be of human origin.
Bispecific, heterospecific, heteroconjugate or the like can also be used which are monoclonal antibodies, preferably human or humanized, having binding specificities for
ES 2 607 679 T3 at least two different antigens. In the present case, one of the binding specificities is for at least one TNF protein and the other is for any other antigen. Methods for preparing bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two pairs of immunoglobulin heavy chain-light chain, where the two heavy chains have different specificities (Milstein and Cuello, Nature 305: 537 (1983)). Due to the random mixing of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome and the product yields are low. Similar procedures are described, for example, in WO 93/08829, US Patent Nos. 6210668, 6193967, 6132992, 6106833, 6060285, 6037453, 6010902, 5989530, 5959084, 5959083, 5932448, 5833985, 5821333, 5807706 , 5643759, 5601819, 5582996, 5496549, 4676980, WO 91/00360, WO 92/0373, EP 03089, Traunecker et al, EMBO J. 10: 3655 (1991), Suresh et al., Methods in Enzymology 121: 210 (1986).
The anti-TNF antibodies (also called TNF antibodies) of the present invention can optionally be characterized by high affinity binding to TNF and optionally and preferably have low toxicity. In particular, an antibody of the invention, in which individual components, such as the variable region, constant and flanking region, individually and / or collectively, optionally and preferably possess low immunogenicity, is useful in the present invention. Antibodies that can be used in the invention are optionally characterized by their ability to treat patients for prolonged periods with measurable relief of symptoms and low and / or acceptable toxicity. Low or acceptable immunogenicity and / or high affinity, as well as other suitable properties, can contribute to the therapeutic results achieved. "Low immunogenicity" is defined herein as elevating significant HAHA, HACA, or HAMA responses in less than about 75% or preferably less than about 50% of treated patients and / or elevating low titers in the patient. treated (less than about 300, preferably less than about 100 measured with a double antigen enzyme immunoassay) (Elliott et al., Lancet 344: 1125-1127 (1994).
Utility
The isolated nucleic acids of the present invention can be used for the production of at least one anti-TNF antibody or specified variant thereof, which can be used to measure or achieve in a cell, tissue, organ or animal (including mammals and human beings). humans), to diagnose, control, modulate, treat, alleviate, help prevent the incidence of, or reduce the symptoms of at least one TNF condition, selected from, but not limited to, at least one of an immune disorder or disease, a cardiovascular disease or disorder, an infectious, malignant and / or neurological disorder or disease.
Such a method may comprise administering an effective amount of a composition or a pharmaceutical composition comprising at least one anti-TNF antibody to a cell, tissue, organ, animal or patient in need of such modulation, treatment, alleviation, prevention or reduction. symptoms, effects or mechanisms. The effective amount may comprise an amount of from about 0.001 to 500 mg / kg per single (eg bolus), multiple or continuous administration, or to achieve a serum concentration of 0.015000 mg / ml serum concentration per single administration. , multiple or continuous, or any range or rms value therein, as performed and determined using known methods, as described herein or as known in the relevant arts.
Quotes
All publications or patents cited in this document show the state of the art at the time of the present invention and / or provide description and enablement of the present invention. Publications refer to any scientific or patent publication or any other information available in any media format, including all recorded, electronic or printed formats. The following references are specifically mentioned: Ausubel, et al., Ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, NY (1987-2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2<sup>to</sup> Editing, Cold Spring Harbor, NY (1989); Harlow and Lane, Antibodies, a Laboratory Manual, Cold Spring Harbor, NY (1989); Colligan, et al., Eds., Current Protocols in Immunology, John Wiley & Sons, Inc., NY (1994-2001); Colligan et al., Current Protocols in Protein Science, John Wiley & Sons, NY, NY, (1997-2001).
Antibodies of the Present Invention
At least one anti-TNF antibody of the present invention can optionally be produced by a cell line, a mixed cell line, an immortalized cell, or a clonal population of immortalized cells, as is known in the art. See, for example, Ausubel, et al., Ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, NY (1987-2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, NY (1989); Harlow and Lane, antibodies, a Laboratory Manual, Cold Spring Harbor, NY (1989); Colligan, et al.,
ES 2 607 679 T3 eds., Current Protocols in Immunology, John Wiley & Sons, Inc., NY (1994-2001); Colligan et al., Current Protocols in Protein Science, John Wiley & Sons, NY, NY, (1997-2001).
Human antibodies that are specific for human TNF proteins or fragments thereof can be raised against an appropriate immunogenic antigen, such as isolated protein and / or TNF or a part thereof (including synthetic molecules, such as synthetic peptides ). Other specific or general mammalian antibodies can be similarly generated. Immunogenic antigen preparation and monoclonal antibody production can be performed using any suitable technique.
In one approach, a hybridoma is produced by fusing a suitable immortal cell line (e.g., a myeloma cell line such as, but not limited to, Sp2 / 0, Sp2 / 0-AG14, NSO, NS1, NS2, Ae-1, L.5,> 243, P3X63Ag8.653, Sp2 SA3, Sp2 SS1, Sp2 SA5, U937, MLA 144, ACT IV, MOLT4, DA-1, JURKAT, WEHI, K-562, COS, RAJI, NIH 3T3, HL -60, MLA 144, NaMAIWA, NEURO 2A or similar or heteromyelomas, fusion products thereof or any cell or cell fusion obtained therefrom or any suitable cell line as known in the art. See, for example, www.atcc.org, www.lifetech.com and the like, with antibody-producing cells, such as, but not limited to, spleen, peripheral blood, lymph node, tonsil, or other immune cells or containing isolated or cloned B cells or any of other cells expressing constant or variable or flanking heavy or light chain sequences or CDRs, such as endogenous or heterologous nucleic acid, such as genomic DNA, cDNA, rDNA, Recombinant or endogenous mitochondrial DNA or RNA, viral, bacterial, algae, prokaryotic, amphibian, insect, reptile, fish, mammalian, rodent, equine, ovine, goat, sheep, primate, eukaryotic, chloroplast DNA or RNA, hnRNA, mRNA, tRNA, single, double or triple stranded, hybridized and the like or any combination thereof. See, for example, Ausubel, mentioned above and Colligan, Immunology, mentioned above, chapter 2.
Antibody-producing cells can also be obtained from the peripheral blood or, preferably the spleen or lymph nodes, of humans or other suitable animals that have been immunized with the antigen of interest. Any other suitable host cell can also be used to express heterologous or endogenous nucleic acid encoding an antibody, specified fragment, or variant thereof, of the present invention. Fused cells (hybridomas) or recombinant cells can be isolated using selective culture conditions or other suitable known methods and cloned by limiting dilution or cell separation or other known methods. Cells producing antibodies with the desired specificity can be selected by a suitable assay (eg ELISA).
Other suitable methods can be used to produce or isolate antibodies of the necessary specificity, including, but not limited to, methods that select recombinant antibody from a library of peptides or proteins (for example, but not limited to, a bacteriophage display library. , ribosome, oligonucleotide, RNA, cDNA or the like, eg, as available from Cambridge antibody Technologies, Cambridgeshire, UK; MorphoSys, Martinsreid / Planegg, Germany; Biovation, Aberdeen, Scotland, UK; Biolnvent, Lund, Sweden; Dyax Corp., Enzon, Affymax / Biosite; Xoma, Berkeley, CA; Ixsys. See, for example, EP 368684, PCT / GB91 / 01134; PCT / GB92 / 01755; PCT / GB92 / 002240; PCT / GB92 / 00883; PCT / GB93 / 00605; US 08/350260 (5/12/94); PCT / GB94 / 01422; PCT / GB94 / 02662; PCT / GB97 / 01835; (CAT / MRC); WO90 / 14443; WO90 / 14424; WO90 / 14430; PGT / US94 / 1234; WO92 / 18619; WO96 / 07754; (Scripps), EP 614 989 (MorphoSys); WO95 / 16027 (Biolnvent); WO88 / 06630; WO90 / 3809 (Dyax); US 4,704,692 (Enzon); PCT / US91 / 02989 (Affymax); WO89 / 06283; PE 371 998, EP 550 400, (Xoma); EP 229 046; PCT / US91 / 07149 (Ixsys); or stochastically generated peptides or proteins, documents US5723323, 5763192, 5814476, 5817483, 5824514, 5976862, WO 86/05803, EP 590 689 (Ixsys, now Applied Molecular Evolution (AME)) or that depend on the immunization of animals transgenic (eg, SCID mice, Nguyen et al., Microbiol. Immunol. 41: 901907 (1997); Sandhu et al., Crit. Rev. Biotechnol. 16: 95-118 (1996); Eren et al., Immunol. 93: 154-161 (1998), as well as related patents and applications) that are capable of producing a repertoire of human antibodies, as known in the art and / or as described herein. Such techniques include, but are not limited to, ribosome display (Hanes et al., Proc. Natl. Acad. United States. 94: 4937-4942 (May 1997); Hanes et al., Proc. Natl. Acad. United States. 95: 14130-14135 (Nov. 1998)); single cell antibody production technologies (eg, selected lymphocyte antibody method ("SLAM") (US Patent No. 5,627,052, Wen et al., J. Immunol. 17: 887-892 (1987 ); Babcook et al., Proc. Natl. Acad. USA 93: 78437848 (1996)); gel droplets and flow cytometry (Powell et al., Biotechnol. 8: 333-337 (1990), One Cell Systems, Cambridge, MA, Gray et al., J. Imm. Meth. 182: 155-163 (1995), Kenny et al., Bio / Technol. 13: 787-790 (1995)); B cell selection (Steenbakkers et al., Molec. Biol. Reports 19: 125-134 (1994); Jonak et al., Progress Biotech, Vol. 5, In Vitro Immunization in Hybridoma Technology, Borrebaeck, ed., Elsevier Science Publishers BV, Amsterdam, The Netherlands (1988).
Methods for engineering or humanizing non-human or human antibodies can also be used and are well known in the art. In general, a humanized or engineered antibody has one or more amino acid residues from a source that is non-human, for example, but not limited to, mouse, rat, rabbit, non-human primate, or other mammal. These human amino acid residues are often referred to as "imported" residues, which are typically taken from one variable, constant, or other.
ES 2 607 679 T3 domain "imported" from a known human sequence. Known human Ig sequences are described, for example, at www.ncbi.nlm.nih.gov/entrez/query.fcgi;www.atcc.org/phage/hdb.html;www.sciquest.com/; www.abcam.com/;www.antibodyresource.com/online-comp.html; www.public.iastate.edul-pedro / research tools.html; www.mgen.uniheidelberg.de/SD/IT/IT.html;www.wh-freeman.com/immunology/CH05/kuby05.htm; www.library.thinkquest.org/12429/lnunune/Antibody.html;www.hhmi.org/grants/lectures/1996/vlab/; www.path.cam.acuk ~ mrc7 / mikeimages.html; www.aatibodyresource.com/; mcb.
harvard.edu/BioLinks/lmmunology.html; www.immunologylink.com/;pathbox.wustl.edu/~hcenter/index.html; www.biotech.ufl.edu/-hcl/; www.pebio.com/pa/340913/340913.html;www.nal.usda.gov/awic/pubs/antibody/;
www.m.ehimeu.ac.jp/~yasuhitolElisa.html;www.biodesign.com/table.asp;www.icnet.uk/facs/davies/links.html; www.biotech./ufl.edu/~fccl/protocol.html;www.isac-net.org/sites_geo.html;aximt1.imt.unimarburg.de/~rek/AEPStart.html; baserv.uci.kun.nl/~jraatsl/inks1.html; www.recab.uni-hd.de/immuno.bme.nwu.edu/; www.mrc-cpe.cam.ac.uklimt-doc / public / INTRO.html; www.ibt.unam.mx/vir/V_mice.html; imgt.cnusc.fr:8104/; www.biochem.ucl.ac.uk/~martin/abs/index.html;antibody.bath.ac.uk/; abgen.cvm.tamu.edu/lab/wwwabgen.html; www.unizh.ch/~honegger/AHOseminar/Slide01.html;www.cryst7bbk.ac.uk/-ubcg07s; www.nimr.mrc.ac.uk/CCccaewg/ccaewg.htm;www.path.cam.ac.uk/~mrc7/humanisation/TAHHP.html; www.ibt.unam.mx/vir/structure/stat_aim.html;www.biosci.missouri.edu/smithgp/ index.html;
www./cryst.bioc.cam.ac.uk/~fmolina/Web-pages/Pept/spottech.html;
www.jerini.de/fr_products.htm;www.patents.ibm.com/ibm.html. Kabat et al., Sequences of Proteins of Immunological Interest, US Dept. Health (1983).
Such imported sequences can be used to reduce immunogenicity or to reduce, enhance, or modify binding, affinity, association, dissociation, avidity, specificity, half-life, or any other suitable characteristic, as is known in the art. Generally, part or all of the non-human or human CDR sequences are retained while the non-human sequences of the variable and constant regions are replaced with human or other amino acids. Optionally, the antibodies can also be humanized with retention of high affinity for the antigen and other favorable biological properties. To achieve this goal, humanized antibodies can optionally be prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and familiar to those of skill in the art. Computer programs are available that illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays allows analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, that is, the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the consensus and import sequences so as to achieve the desired antibody characteristic, such as increased affinity for the target antigen (s). In general, CDR residues are directly and more substantially involved in influencing antigen binding. Humanization or engineering of antibodies of the present invention can be performed using any known method, such as, but not limited to, those described in, Winter (Jones et al., Nature 321: 522 (1986); Riechmann et al. , Nature 332: 323 (1988); Verhoeyen et al., Science 239: 1534 (1988)), Sims et al., J. Immunol. 151: 2296 (1993); Chothia and Lesk, J. Mol. Biol. 196: 901 (1987), Carter et al., Proc. Natl. Acad. Sci. USA 89: 4285 (1992); Presta et al., J. Immunol. 151: 2623 (1993), United States Patent Nos. 5723323, 5976862, 5824514, 5817483, 5814476, 5763192, 5723323, 5.766886, 5714352, 6204023, 6180370, 5693762, 5530101, 5585089, 5225539, 4816T567, the documents /: US98 / 16280, US96 / 18978, US91 / 09630, US91 / 05939, US94 / 01234, GB89 / 01334, GB91 / 01134, GB92 / 01755; WO90 / 14443, WO90 / 14424, WO90 / 14430, EP 229246, including references cited therein.
The anti-TNF antibody can also optionally be generated by immunizing a transgenic animal (eg, mouse, rat, hamster, non-human primate, and the like) capable of producing a repertoire of human antibodies, as described herein and / or as is known in the art. Cells that produce an anti-human TNF antibody can be isolated from such animals and immortalized using suitable methods, such as the methods described herein.
Transgenic mice that can produce a repertoire of antibodies that bind to human antigens can be produced by known methods (eg, but not limited to, US Patent Nos. 5,770,428, 5,569,825, 5,545,806, 5,625. 126, 5,625,825, 5,633,425, 5,661,016 and 5,789,650 issued to Lonberg et al .; Jakobovits et al., WO 98/50433, Jakobovits et al., WO 98/24893, Lonberg et al., WO 98/24884, Lonberg et al., WO 97/13852, Lonberg et al. al., WO 94/25585, Kucherlapate et al., WO 96/34096, Kucherlapate et al., EP 0463 151 B1, Kucherlapate et al., EP 0710 719 Al, Surani et al. , US Patent No. 5,545,807, Bruggemann et al., WO 90/04036, Bruggemann et al., EP 0438 474 B1, Lonberg et al., EP 0814 259 A2, Lonberg et al., GB 2 272 440 A, Lonberg et al., Nature 368: 856-859 (1994), Taylor et al. ., Int. Immunol. 6 (4) 579-591 (1994), Green et al., Nature Genetics 7: 13-21 (1994), Mendez et al., Nature Genetics 15: 146-156 (1997), Taylor et al., Nucleic Acids Research 20 (23): 6287-6295 (1992), Tuaillon et al., Proc Natl Acad Sci United States. 90 (8) 3720-3724 (1993), Lonberg et al., Int Rev Immunol 13 (1): 65-93 (1995) and Fishwald et al., Nat
ES 2 607 679 T3
Biotechnol 14 (7): 845-851 (1996). In general, these mice comprise at least one transgene comprising DNA from at least one human immunoglobulin locus that is functionally transposed or that can undergo functional transposition. Endogenous immunoglobulin loci in such mice can be altered or deleted to eliminate the ability of the animal to produce antibodies encoded by endogenous genes.
Selection of antibodies for specific binding to proteins or similar fragments can be practically accomplished using peptide display libraries. This method involves screening large collections of peptides for individual members that have the desired function or structure. The selection of antibodies from peptide display libraries is well known in the art. The presented peptide sequences can be 3 to 5000 or more amino acids in length, frequently 5-100 amino acids in length, and often about 8 to 25 amino acids in length. In addition to direct chemical synthesis methods for generating peptide libraries, several recombinant DNA methods have been described. One type involves the presentation of a peptide sequence on the surface of a bacteriophage or cell. Each bacteriophage or cell contains the nucleotide sequence that encodes the particular displayed peptide sequence. Such methods are described in PCT Patent Publication Nos. 91/17271, 91/18980, 91/19818 and 93/08278. Other systems for generating peptide libraries have aspects of both in vitro chemical synthesis and recombinant methods. See, PCT Patent Publications Nos. 92/05258, 92/14843 and 96/19256. See also, US Patent Nos. 5,658,754 and 5,643,768. Peptide display libraries, vectors, and screening kits are commercially available from vendors such as Invitrogen (Carlsbad, CA) and Cambridge Antibody Technologies (Cambridgeshire, UK). See, for example, US Patent Nos. 4704692, 4939666, 4946778, 5260203, 5455030, 5518889, 5534621, 5656730, 5763733, 5767260, 5856456, assigned to Enzon; 5223409, 5403484, 5571698, 5837500, assigned to Dyax, 5427908, 5580717, assigned to Affymax, 5885793, assigned to Cambridge Antibody Technologies; 5750373, assigned to Genentech, 5618920, 5595898, 5576195, 5698435, 5693493, 5698417, assigned to Xoma, Colligan, mentioned above; Ausubel, mentioned above or Sambrook, mentioned above.
The antibodies of the present invention can also be prepared using at least one nucleic acid encoding anti-TNF antibody to provide transgenic animals or mammals, such as goats, cows, horses, sheep and the like, that produce such antibodies in their milk. Such animals can be provided using known methods. See, for example, but not limited to, US Patent Nos. 5,827,690, 5,849,992, 4,873,316, 5,849,992, 5,994,616, 5,565,362, 5,304,489, and the like.
The antibodies of the present invention can be further prepared using at least one nucleic acid encoding an anti-TNF antibody to provide transgenic plants and cultured plant cells (eg, but not limited to tobacco and corn) that produce such antibodies, specified parts or variants in the plant parts or cells grown therefrom. As a non-limiting example, transgenic tobacco leaves expressing recombinant proteins have been used successfully to provide large amounts of recombinant proteins, for example, using an inducible promoter. See, for example, Cramer et al., Curr. Top. Microbol. Immunol. 240: 95-118 (1999) and references cited therein. Also, transgenic corn has been used to express mammalian proteins at commercial production levels, with biological activities equivalent to those produced in other recombinant systems or purified from natural sources. See, for example, Hood et al., Adv. Exp. Med. Biol. 464: 127-147 (1999) and references cited therein. Antibodies have also been produced in large quantities from transgenic plant seeds including antibody fragments, such as single chain antibodies (scFv), including tobacco seeds and potato tubers. See, for example, Conrad et al., Plant Mol. Biol. 38: 101-109 (1998) and reference cited therein. Therefore, the antibodies of the present invention can also be produced using transgenic plants, according to known methods. See also, for example, Fischer et al., Biotechnol. Appl. Biochem. 30: 99-108 (Oct, 1999), Ma et al., Trends Biotechnol. 13: 522-7 (1995); Ma et al., Plant Physiol. 109: 341-6 (1995); Whitelam et al., Biochem. Soc. Trans. 22: 940-944 (1994) and references cited therein.
The antibodies of the invention can bind to human TNF with a wide range of affinities (Kd). In a preferred embodiment, at least one human mAb of the present invention can optionally bind human TNF with high affinity. For example, a human mAb can bind to human TNF with a Kd equal to or less than about 10<sup>-7</sup> M, such as, but not limited to 0.1-9.9 (or any range or value within it) X 10<sup>-7</sup>, 10<sup>-8</sup>, 10<sup>-9</sup>, 10<sup>-10</sup>, 10<sup>-11</sup>, 10<sup>-12</sup>, 10<sup>-13</sup> or any range or value within them.
The affinity or avidity of an antibody for an antigen can be determined experimentally using any suitable method. (See, for example, Berzofsky, et al., "Antibody-Antigen Interactions," In Fundamental Immunology, Paul, WE, Ed., Raven Press: New York, NY (1984); Kuby, Janis Immunology, WH Freeman and Company : New York, NY (1992); and methods described therein). The measured affinity of a particular antibody-antigen interaction can vary if measured under different conditions (eg, salt concentration and pH). Therefore, measurements of affinity and other antigen-binding parameters (eg, K0 Ka, Kd) are preferably performed with standard antibody and antigen solutions and a standard buffer, such as the buffer described herein.
ES 2 607 679 T3
Nucleic Acid Molecules
Using information provided herein, a nucleic acid molecule of the present invention that encodes at least one anti-TNF antibody can be obtained using methods described herein or as known in the art.
The nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, hnRNA, tRNA or any other form or in the form of DNA, including but not limited to cDNA and genomic DNA obtained by cloning or produced synthetically or any combination thereof. The DNA can be tri-stranded, double-stranded, or single-stranded or any combination thereof. Any part of at least one DNA or RNA strand can be the coding strand, also known as the sense strand or it can be the non-coding strand, also called the antisense strand.
Isolated nucleic acid molecules described herein include nucleic acid molecules comprising an open reading frame (ORF), optionally with one or more introns, for example, but not limited to, at least a specified part of at least one CDR. , such as CDR1, CDR2 and / or CDR3 of at least one heavy chain (eg SEQ ID NO: 1-3) or light chain (eg SEQ ID NO: 4-6); nucleic acid molecules that comprise the coding sequence of an anti-TNF antibody or variable region (eg, SEQ ID NOS: 7 and 8) and nucleic acid molecules that comprise a nucleotide sequence substantially different from those that have been described above but which, due to the degeneracy of the genetic code, still encodes at least one anti-TNF antibody as described herein and / or as known in the art. Of course, the genetic code is well known in the art. Therefore, it will be routine for one of ordinary skill in the art to generate such degenerate nucleic acid variants encoding specific anti-TNF antibodies of the present invention. See, for example, Ausubel, et al., Mentioned above. Non-limiting examples of isolated nucleic acid molecules include SEQ ID NOs: 10, 11, 12, 13, 14 and 15, corresponding to non-limiting examples of a nucleic acid encoding, respectively, CDR1 HC, CDR2 HC, CDR3 HC, CDR1 LC, CDR2 LC and CDR3 LC.
As indicated herein, the nucleic acid molecules of the present invention that comprise a nucleic acid that encodes an anti-TNF antibody may include, but is not limited to, those that encode the amino acid sequence of an antibody fragment, for example itself; the coding sequence for the entire antibody or a part thereof; the coding sequence for an antibody, fragment or part, as well as additional sequences, such as the coding sequence for at least one leader or fusion signal peptide, with or without the aforementioned additional coding sequences, such as at least one intron, together with additional non-coding sequences, including but not limited to 5 'and 3' non-coding sequences, such as non-translated transcribed sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals (eg, ribosome binding and mRNA stability); an additional coding sequence encodes additional amino acids, such as those that provide additional functionalities. Thus, the sequence encoding an antibody can be fused to a marker sequence, such as a sequence encoding a peptide that facilitates purification of the fused antibody comprising an antibody fragment or part.
Nucleic Acid Construction
The isolated nucleic acids of the present invention can be prepared using (a) recombinant methods, (b) synthetic techniques, (c) purification techniques, or combinations thereof, as is well known in the art.
Nucleic acids can practically comprise sequences in addition to a polynucleotide of the present invention. For example, a multi-cloning site comprising one or more restriction endonuclease sites can be inserted into the nucleic acid to aid in the isolation of the polynucleotide. Also, translatable sequences can be inserted to aid in the isolation of the translated polynucleotide of the present invention. For example, a hexa-histidine marker sequence provides a convenient means of purifying the proteins of the present invention. The nucleic acid of the present invention, excluding the coding sequence, is optionally a vector, an adapter or linker for cloning and / or expression of a polynucleotide of the present invention.
Additional sequences can be added to such cloning and / or expression sequences to optimize their role in cloning and / or expression, to aid in the isolation of the polynucleotide, or to enhance introduction of the polynucleotide into a cell. The use of cloning vectors, expression vectors, adapters, and linkers is well known in the art. (See, for example, Ausubel, mentioned above, or Sambrook, mentioned above).
Recombinant Methods for the Construction of Nucleic Acids.
ES 2 607 679 T3
The isolated nucleic acid compositions of this invention, such as RNA, cDNA, genomic DNA, or any combination thereof, can be obtained from biological sources using any number of cloning methodologies known to those of skill in the art. In some embodiments, oligonucleotide probes that selectively hybridize, under stringent conditions, to the polynucleotides of the present invention are used to identify the desired sequence in a genomic DNA or cDNA library. Isolation of RNA and construction of cDNA and genomic libraries are known to those of skill in the art. (See, for example, Ausubel, mentioned above, or Sambrook, mentioned above).
Selection and / or Isolation Methods of Nucleic Acid.
A cDNA or genomic library can be screened using a probe based on the sequence of a polynucleotide of the present invention, such as those described herein. Probes can be used to hybridize to genomic DNA or cDNA sequences to isolate homologous genes in the same or different organisms. Those skilled in the art will appreciate that varying degrees of hybridization stringency can be employed in the assay; and hybridization or wash medium can be stringent. As hybridization conditions become more stringent, there has to be a greater degree of complementarity between probe and target for duplex formation to occur. The degree of stringency can be controlled by one or more of temperature, ionic strength, pH, and the presence of a partially denaturing solvent such as formamide. For example, the stringency of hybridization is practically varied by changing the polarity of the reactant solution through, for example, manipulation of the formamide concentration within the range of 0% to 50%. The degree of complementarity (sequence identity) required for detectable binding will vary according to the stringency of the hybridization medium and / or the wash medium. The degree of complementarity will optimally be 100% or 70-100% or any range or value within them. However, it should be appreciated that minor sequence variations in probes and primers can be compensated for by reducing the stringency of the hybridization and / or wash medium.
RNA or DNA amplification methods are well known in the art and can be used in accordance with the present invention without undue experimentation, based on the contents and guidance presented herein.
Known methods of DNA or RNA amplification include, but are not limited to, polymerase chain reaction (PCR) and related amplification processes (see, for example, US Patent Nos. 4,683,195, 4,683,202, 4,800,159, 4,965,188, to Mullis, et al .; 4,795,699 and 4,921,794 to Tabor, et al; 5,142,033 to Innis, 5,122,464 to Wilson, et al .; 5,091,310 to Innis, 5,066,584 to Gyllensten, et al; 4,889,818 to Gelfand, et al; 4,994,370 to Silver, et al; 4,766,067 to Biswas; 4,656,134 to Ringold) and RNA-mediated amplification using antisense RNA to target the sequence as a template for double-stranded DNA synthesis (US Patent No. 5,130,238 to Malek, et al, tradename NASBA). (See, for example, Ausubel, mentioned above or Sambrook, mentioned above.).
For example, polymerase chain reaction (PCR) technology can be used to amplify the polynucleotide sequences of the present invention and related genes directly from genomic DNA or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences encoding proteins to be expressed, to prepare nucleic acids for use as probes to detect the presence of the desired mRNA in samples, to nucleic acid sequencing or for other purposes. Examples of techniques sufficient to direct specialists through in vitro amplification methods are found in Berger, mentioned above, Sambrook, mentioned above, and Ausubel, mentioned above, as well as Mullis, et al., US Patent No. 4,683 202 (1987) and Innis, et al., PCR Protocols A Guide to Methods and Applications, Eds., Academic Press, Inc., San Diego, CA (1990). Commercially available kits for genomic PCR amplification are known in the art. See, for example, Advantage-GC Genomic PCR Kit (Clontech). Additionally, for example, the T4 gene 32 protein (Boehringer Mannheim) can be used to improve the throughput of long PCR products.
Synthetic Methods for the Construction of Nucleic Acids
The isolated nucleic acids of the present invention can also be prepared by direct chemical synthesis by known methods (see, for example, Ausubel, et al., Mentioned above). Chemical synthesis generally produces a single-stranded oligonucleotide, which can be converted to double-stranded DNA by hybridization to a complementary sequence or by polymerization with a DNA polymerase using the single strand as a template. One of ordinary skill in the art will recognize that while chemical DNA synthesis can be limited to sequences of about 100 or more bases, longer sequences can be obtained by ligation of shorter sequences.
Recombinant Expression Cassettes
The present invention further provides cassettes for recombinant expression comprising a
ES 2 607 679 T3 nucleic acid of the present invention. A nucleic acid sequence of the present invention, for example a cDNA or genomic sequence encoding an antibody of the present invention, can be used to construct a cassette for recombinant expression that can be introduced into at least one desired host cell. A cassette for recombinant expression will typically comprise a polynucleotide of the present invention operably linked to transcription initiation regulatory sequences that will direct transcription of the polynucleotide in the intended host cell. Both heterologous and non-heterologous (ie, endogenous) promoters can be used to drive the expression of nucleic acids of the present invention.
In some embodiments, isolated nucleic acids that serve as promoters, enhancers, or other elements can be introduced at the appropriate position (upstream, downstream, or intron) in a non-heterologous manner to a polynucleotide of the present invention in a regular manner. positively or negatively expressing a polynucleotide of the present invention. For example, endogenous promoters can be altered in vivo or in vitro by mutation, deletion, and / or substitution.
Vectors and Host Cells
The present invention also relates to vectors that include isolated nucleic acid molecules of the present invention, host cells that are engineered with the recombinant vectors, and the production of at least one anti-TNF antibody by recombinant techniques, as known. good on technique. See, for example, Sambrook, et al., Mentioned above and Ausubel, et al., Mentioned above.
The polynucleotides can optionally be linked to a vector containing a selectable marker for propagation in a host. In general, a plasmid vector is introduced into a precipitate, such as a calcium phosphate precipitate, or into a complex with a charged lipid. If the vector is a virus, it can be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
The DNA insert must be operably linked to an appropriate promoter. Expression constructs will additionally contain transcription initiation and termination sites and, in the transcribed region, a ribosome binding site for translation. The coding part of the mature transcripts expressed by the constructs will preferably include a translation start at the beginning and a stop codon (e.g. UAA, UGA or UAG) appropriately placed at the end of the mRNA to be translated, UAA being preferred. and UAG for expression in mammalian or eukaryotic cells.
Expression vectors will preferably but optionally include at least one selectable marker. Such markers include, for example, but are not limited to, resistance to methotrexate (MTX), dihydrofolate reductase (DHFR, US Patent Nos. 4,399,216, 4,634,665, 4,656,134, 4,956,288, 5,149,636, 5,179 .017, ampicillin, neomycin (G418), mycophenolic acid or glutamine synthetase (GS, US Patent No. 5,122,464, 5,770,359, 5,827,739) for eukaryotic cell culture and tetracycline or ampicillin resistance genes for culture in E. coli and other bacteria or prokaryotes. Appropriate culture media and conditions for the host cells described above are known in the art. Suitable vectors will be readily apparent to those of skill in the art. Introduction of a vector construct into a host cell can be accomplished by calcium phosphate transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other known methods. Such methods are described in the art, such as in Sambrook, previously mentioned, chapters 1-4 and 16-18; Ausubel, mentioned above, chapters 1, 9, 13, 15 and 16.
At least one antibody of the present invention can be expressed in a modified form, such as a fusion protein, and can include not only secretion signals, but also additional heterologous functional regions. For example, a region of additional amino acids, particularly charged amino acids, can be added to the N-terminus of an antibody to improve stability and persistence in the host cell, during purification or during subsequent handling and storage. Also, peptide moieties can be added to an antibody of the present invention to facilitate purification. Such regions can be removed prior to a final preparation of an antibody or at least a fragment thereof. Such methods are described in many conventional laboratory manuals, such as Sambrook, mentioned above, chapters 17.29-17.42 and 18.1-18.74; Ausubel, mentioned above, chapters 16, 17 and 18.
Those skilled in the art are aware of numerous expression systems available for expression of a nucleic acid encoding a protein of the present invention.
Alternatively, the nucleic acids of the present invention can be expressed in a host cell by activation (by manipulation) in a host cell containing endogenous DNA encoding an antibody of the present invention. Such methods are well known in the art, for example, as described in US Patent Nos. 5,580,734, 5,641,670, 5,733,746, and 5,733,761.
ES 2 607 679 T3
Mammalian cells are illustrative of cell cultures useful for the production of the antibodies, specified parts, or variants thereof. Mammalian cell systems will often be in the form of cell monolayers, although mammalian cell suspensions or bioreactors can also be used. Several suitable host cell lines capable of expressing intact glycosylated proteins have been developed in the art and include COS-1 (eg ATCC CRL 1650), COS-7 (eg ATCC CRL-1651), HEK293, BHK21 (for example, ATCC CRL-10), CHO (for example, ATCC CRL 1610) and BSC-1 (for example, ATCC CRL-26) CoS-7 cells, CHO cells, hep G2 cells, P3X63Ag8.653, SP2 / 0- Ag14, 293 cells, HeLa cells and the like, which are readily available in, for example, the American Type Culture Collection, Manassas, VA (www.atcc.org). Preferred host cells include cells of lymphoid origin, such as myeloma and lymphoma cells. Particularly preferred host cells are P3X63Ag8.653 cells (ATCC Accession Number CRL-1580) and SP2 / 0-Ag14 cells (ATCC Accession Number CRL1851). In a particularly preferred embodiment, the recombinant cell is a P3X63Ag8.653 cell or an SP2 / 0-Ag14 cell.
Expression vectors for these cells can include one or more of the following expression control sequences, such as, but not limited to, an origin of replication; a promoter (e.g., SV40 late or early promoters, the CMV promoter (US Patent Nos. 5,168,062 and 5,385,839), an HSV tk promoter, a pgk (phosphoglycerate kinase) promoter, an EF promoter -1 alpha (US Patent No. 5,266,491), at least one human immunoglobulin promoter, enhancer, and / or processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites (for example, a SV40 large Ag T poly A addition site) and transcription termination sequences. See, for example, Ausubel et al., Mentioned above and Sambrook, et al., Mentioned above. Other cells useful for the production of nucleic acids or proteins of the present invention are known and / or available, for example, in the Catalog of Cell Lines and Hybridomas of the American Collection of Type Cultures (www.atcc.org) or others. commercial or known sources.
When eukaryotic host cells are employed, polyadenylation or transcription termination sequences are typically incorporated into the vector. An example of a termination sequence is the polyadenylation sequence of the bovine growth hormone gene. Sequences for precise splicing of the transcript can also be included. An example of a splice sequence is the SV40 intron VP1 (Sprague, et al., J. Virol. 45: 773-781 (1983)). Additionally, gene sequences can be incorporated into the vector to control replication in the host cell, as is known in the art.
Purification of an Antibody
An anti-TNF antibody can be recovered and purified from recombinant cell cultures by well known methods, including but not limited to, protein A purification, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, Phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and lectin chromatography. High performance liquid chromatography ("HPLC") can also be used for purification. See, for example, Colligan, Current Protocols in Immunology or Current Protocols in Protein Science, John Wiley & Sons, Ny, NY, (1997-2001), for example, Chapters 1, 4, 6, 8, 9 and 10.
The antibodies of the present invention include naturally purified products, products of chemical synthesis procedures, and products produced by recombinant techniques from a eukaryotic host, including, for example, yeast, higher insect and mammalian plant cells. Depending on the host employed in a recombinant production method, the antibody of the present invention may be glycosylated or it may be non-glycosylated, with glycosylated being preferred. Such methods are described in many conventional laboratory manuals, such as Sambrook, mentioned above, Sections 17.37-17.42; Ausubel, mentioned above, chapters 10, 12, 13, 16, 18 and 20, Colligan, Protein Science, mentioned above, chapters 12-14.
Anti-TNF antibodies
The isolated antibodies of the present invention comprise the specific antibody amino acid sequence mentioned in the appended claims encoded by any suitable polynucleotide or any isolated or prepared antibody. Preferably, the human antibody binds human TNF and thereby partially or substantially neutralizes at least one biological activity of the protein. An antibody that substantially, partially, or preferably neutralizes at least one biological activity of at least one TNF protein or fragment can bind to the protein or fragment and thereby inhibit activities mediated through the binding of TNF to the TNF receptor. TNF or through other TNF-dependent or mediated mechanisms. As used herein, the term "neutralizing antibody" refers to an antibody that can inhibit a TNF-dependent activity by about 20-120%, preferably by at least about 10, 20, 30, 40, 50, 55. , 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% or more depending on the
ES 2 607 679 T3 test. The ability of an anti-TNF antibody to inhibit a TNF-dependent activity is preferably assessed by at least one suitable TNF receptor or protein assay, as described herein and / or as known in the art. A human antibody of the invention can be of any class (IgG, IgA, IgM, IgE, IgD, etc.) or isotype and can comprise a kappa or lambda light chain. In one embodiment, the human antibody comprises an IgG heavy chain or defined fragment, eg, at least one of the isotypes, IgG1, IgG2, IgG3, or IgG4. Antibodies of this type can be prepared using a transgenic mouse or other transgenic non-human mammal comprising at least one human light chain transgene (eg, IgG, IgA, and IgM (eg, γ1, γ2, γ3, and γ4) as It has been described herein and / or as known in the art. In another embodiment, the human anti-human TNF antibody comprises an IgG1 heavy chain and an IgG1 light chain.
At least one antibody of the invention binds at least one specified epitope, specific for at least one protein, subunit, fragment, part of TNF, or any combination thereof. The at least one epitope may comprise at least one antibody-binding region comprising at least a part of said protein, which epitope is preferably comprised of at least one extracellular, soluble, hydrophilic, external or cytoplasmic part of said protein. The at least one specified epitope may comprise any combination of at least one amino acid sequence of at least 1-3 amino acids for the entire specified portion of contiguous amino acids of SEQ ID NO: 9.
The antigen-binding antibody or fragment of the present invention is a human monoclonal antibody or antigen-binding fragment thereof having three heavy chain CDRs and three light chain CDRs, wherein the three CDRs of the heavy chain have the amino acid sequence of the corresponding TNV148 mAb CDRs as described in Figure 4; all three light chain CDRSs have the amino acid sequence of corresponding TNV148 mAb CDRs as described in Figure 5; and the antibody or fragment binds human TNF with a Kd equal to or less than 0.1-9.9 x 10<sup>-11</sup> M. Such antibodies can be prepared by chemically linking the various parts (eg, CDR, flank) of the antibody using standard techniques, preparing and expressing one (ie, one or more) nucleic acid molecule encoding the antibody using standard techniques of recombinant DNA technology or using any other suitable method.
The anti-TNF antibody can comprise the heavy and light chain variable regions of a TNV148 mAb and TNV148B mAb as described in Figures 4 and 5. Antibodies that bind to human TNF and comprise a variable region of Heavy or light chain can be prepared using suitable methods, such as phage display (Katsube, Y., et al., Int J Mol. Med, 1 (5): 863-868 (1998)) or methods employing transgenic animals, as known in the art and / or described herein. For example, a transgenic mouse, comprising a functionally rearranged human immunoglobulin heavy chain transgene and a transgene comprising DNA from a human immunoglobulin light chain locus that can undergo functional rearrangement, can be immunized with human TNF or a fragment of the same to provoke the production of antibodies. If desired, antibody-producing cells can be isolated and hybridomas or other immortalized antibody-producing cells prepared as described herein and / or as known in the art. Alternatively, the antibody, specified part or variant can be expressed using the coding nucleic acid or part thereof in a suitable host cell.
A conservative amino acid substitution refers to the replacement of a first amino acid with a second amino acid that has chemical and / or physical properties (eg, charge, structure, polarity, hydrophobicity / hydrophilicity) that are similar to those of the first amino acid. Conservative substitutions include replacement of one amino acid for another within the following groups: lysine (K), arginine (R), and histidine (H); aspartate (D) and glutamate (E); asparagine (N), glutamine (Q), serine (S), threonine (T), tyrosine (Y), K, R, H, D and E; alanine (A), valine (V), leucine (L), isoleucine (I), proline (P), phenylalanine (F), tryptophan (W), methionine (M), cysteine (C) and glycine (G); F, W and Y; C, S and T.
Amino Acid Codes
The amino acids that make up the anti-TNF antibodies of the present invention are often abbreviated. Amino acid designations can be indicated by designating the amino acid by its single letter code, its three letter code, name, or the three nucleotide codon (s) as appreciated in the art (see Alberts, B., et al., Molecular Biology of The Cell, Third Ed., Garland Publishing, Inc., New York, 1994):
ES 2 607 679 T3
<td>SINGLE LETTER CODE</td><td>THREE LETTER CODE</td><td>NAME</td><td>THREE NUCLEOTIDE CODON OR CODONS</td>
<td>TO</td><td>To</td><td>To the girl</td><td>GCA, GCC, GCG, GCU</td>
<td>C</td><td>Cys</td><td>Cysteine</td><td>UGC, UGU</td>
<td>D</td><td>Asp</td><td>Aspartic acid</td><td>GAC, GAU</td>
<td>AND</td><td>Glu</td><td>Glutamic acid</td><td>GAA, GAG</td>
<td>F</td><td>Phe</td><td>Phenylalanine</td><td>UUC, UUU</td>
<td>G</td><td>Gly</td><td>Wisteria</td><td>GGA, GGC, GGG, GGU</td>
<td>H</td><td>His</td><td>Histidine</td><td>CAC, CAU</td>
<td>I</td><td>Ile</td><td>Isoleucine</td><td>AUA, AUC, AUU</td>
<td>K</td><td>Lys</td><td>Lysine</td><td>AAA, AAG</td>
<td>L</td><td>Leu</td><td>Leucine</td><td>UUA, UUG, CUA, CUC, CUG, CUU</td>
<td>M</td><td>Met</td><td>Methionine</td><td>AUG</td>
<td>N</td><td>Asn</td><td>Asparagine</td><td>AAC, AAU</td>
<td>P</td><td>Pro</td><td>Proline</td><td>CCA, CCC, CCG, CCU</td>
<td>Q</td><td>Gln</td><td>Glutamine</td><td>CAA, CAG</td>
<td>R</td><td>Arg</td><td>Arginine</td><td>AGA, AGG, CGA, CGC, CGG, CGU</td>
<td>S</td><td>To be</td><td>Serine</td><td>AGC, AGU, UCA, UCC, UCG, UCU</td>
<td>T</td><td>Thr</td><td>Threonine</td><td>ACA, ACC, ACG, ACU</td>
<td>V</td><td>Val</td><td>Valine</td><td>GUA, GUC, GUG, GUU</td>
<td>W</td><td>Trp</td><td>Tryptophan</td><td>UGG</td>
<td>Y</td><td>Tyr</td><td>Tyrosine</td><td>UAC, UAU</td>
An anti-TNF antibody of the present invention can include one or more amino acid substitutions, deletions, or additions, from natural or human-engineered mutations, as specified herein.
Of course, the number of amino acid substitutions a skilled person would make depends on many factors, including those described above. In general, the number of amino acid substitutions, insertions or deletions for any given anti-TNF fragment or variant antibody will not be more than 40, 30, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, such as 1-30 or any range or value within it, as specified herein.
The amino acids in an anti-TNF antibody of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine mutagenesis (eg, Ausubel, mentioned above, chapters 8, 15; Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces a unique alanine mutation at each residue in the molecule. The resulting mutant molecules are then tested for biological activity, such as, but not limited to, at least one neutralizing activity of TNF. Sites that are critical for antibody binding can also be identified by structural analysis such as crystallization, nuclear magnetic resonance, or photoaffinity labeling (Smith, et al., J. Mol. Biol. 224: 899-904 (1992) and de Vos, et al., Science 255: 306-312 (1992)).
As will be appreciated by those skilled in the art, the present invention includes at least one biologically active antibody of the present invention. Biologically active antibodies have a specific activity of at least 20%, 30% or 40% and preferably at least 50%, 60% or 70% and more preferably at least 80%, 90% or 95% -1000% of that of the native known endogenous or related antibody (non-synthetic). The methods for assaying and quantifying measurements of enzyme activity and substrate specificity are well
ES 2 607 679 T3 known to those skilled in the art.
In another aspect, the invention relates to human antibodies and antigen-binding fragments, as described herein, that are modified by the covalent attachment of an organic moiety. Such modification can produce an antibody or antigen-binding fragment with improved pharmacokinetic properties (eg, increased in vivo serum half-life). The organic moiety can be a linear or branched hydrophilic polymeric group, a fatty acid group, or a fatty acid ester group. In particular embodiments, the hydrophilic polymeric group can have a molecular weight of from about 800 to about 120,000 Daltons and can be a polyalkane glycol (eg, polyethylene glycol (PEG), propylene glycol (PPG)), carbohydrate polymer, amino acid polymer, or polyvinyl. pyrrolidone and the fatty acid or fatty acid ester group can comprise from about eight to about forty carbon atoms.
The modified antibodies and antigen-binding fragments of the invention may comprise one or more organic moieties that are covalently linked, directly or indirectly, to the antibody. Each organic moiety that is linked to an antibody of the invention can independently be a hydrophilic polymeric group, a fatty acid group, or a fatty acid ester group. As used herein, the term "fatty acid" encompasses mono carboxylic acids and dicarboxylic acids. A "hydrophilic polymeric group", as the term is used herein, refers to an organic polymer that is more soluble in water than octane. For example, polylysine is more soluble in water than in octane. Thus, an antibody modified by covalently linking polylysine is encompassed by the invention. Hydrophilic polymers suitable for modifying antibodies of the invention can be linear or branched and include, for example, polyalkane glycols (for example, PEG, monomethoxy-polyethylene glycol (mPEG), PPG and the like), carbohydrates (for example, dextran, cellulose, oligosaccharides, polysaccharides, and the like), hydrophilic amino acid polymers (eg, polylysine, polyarginine, polyaspartate, and the like), polyalkane oxides (eg, polyethylene oxide, propylene oxide and the like) and polyvinyl pyrrolidone. Preferably, the hydrophilic polymer that modifies the antibody of the invention has a molecular weight of from about 800 to about 150,000 Daltons as a separate molecular entity. For example, PEG5000 and PEG20,000 can be used, where the subscript is the Dalton average molecular weight of the polymer. The hydrophilic polymeric group can be substituted with one to about six alkyl, fatty acid, or fatty acid ester groups. Hydrophilic polymers that are substituted with a fatty acid or fatty acid ester group can be prepared using suitable methods. For example, a polymer comprising an amine group can be coupled to a carboxylate of the fatty acid or fatty acid ester and an activated carboxylate (eg, activated with N, N-carbonyl diimidazole) on a fatty acid or acid ester. Fatty can be coupled to a hydroxyl group in a polymer.
The fatty acids and fatty acid esters suitable for modifying antibodies of the invention may be saturated or may contain one or more units of unsaturation. Fatty acids that are suitable for modifying antibodies of the invention include, for example, n-dodecanoate (C12, laurate), N-tetradecanoate (C14, myristate), N-octadecanoate (C18, stearate), N-eicosanoate (C20, arachidate), N-docosanoate (C22, behenate), Ntriacontanoate (C30 N- ), N-tetracontanoate (C40), cis-A9-octadecanoate (C18, oleate), all cis-D5, 8, 11, 14-eicosatetraenoate (C20 arachidonate), octanedioic acid, tetradecanedioic acid, octadecanedioic acid, docosanodioic acid and the like. Suitable fatty acid esters include dicarboxylic acid mono-esters comprising a linear or branched lower alkyl group. The lower alkyl group can comprise from one to about twelve, preferably one to about six, carbon atoms.
Modified human antibodies can be prepared using suitable methods, such as by reacting one or more modifying agents. A "modifying agent" as the term is used herein, refers to a suitable organic group (eg, hydrophilic polymer, a fatty acid, or a fatty acid ester) that comprises an activating group. An "activating group" is a chemical moiety or functional group that can, under appropriate conditions, react with a second chemical group thereby forming a covalent bond between the modifying agent and the chemical group. For example, amine-reactive activating groups include electrophilic groups such as tosylate, mesylate, halo (chlorine, bromine, fluorine, iodine), N-hydroxysucinimidyl esters (NHS), and the like. Activating groups that can react with thiols include, for example, maleimide, iodoacetyl, acrylolyl, pyridyl disulfides, 5-thiol-2-nitrobenzoic acid thiol (TNB-thiol), and the like. An aldehyde functional group can be coupled to amide or hydrazide containing molecules and an azide group can react with a trivalent phosphorous group to form phosphoramidate or phosphorimide linkages. Suitable methods for introducing activating groups into molecules are known in the art (see, for example, Hermanson, GT, Bioconjugate Techniques Academic Press: San Diego, CA (1996)). An activating group can be attached directly to the organic group (eg, hydrophilic polymer, fatty acid, or fatty acid ester) or through a linking moiety, eg, a divalent C1-C12 group in which one or more carbon atoms they can be replaced by a hetero atom such as oxygen, nitrogen, or sulfur. Suitable linker moieties include, for example, tetraethylene glycol, - (CH2) 3 -, - NH- (CH2) 6-NH-, - (CH2) 2-NH-, and -CH2O-CH2-CH2-O-CH-CH2 -O-CH-NH-. Modifying agents comprising a linker moiety can be produced, for example, by reacting a mono-Boc-alkyldiamine (eg, mono-Boc-ethylenediamine, mono-Boc-diaminohexane) with a fatty acid in the presence of 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC) to form an amide bond between the free amine and the fatty acid carboxylate. The Boc protecting group can be removed from the product by acid treatment
ES 2 607 679 T3 trifluoroacetic acid (TFA) to expose a primary amine that can be coupled to another carboxylate as described or reacted with maleic anhydride and the resulting product cyclized to produce an activated maleimido derivative of the fatty acid. (See, for example, Thompson, et al., WO 92/16221).
The modified antibodies of the invention can be produced by reacting a human antibody with a modifying agent. For example, organic moieties can be attached to the antibody in a non-site specific manner using an amine-reactive modifying agent, eg, a PEG NHS ester. Modified human antibodies can also be prepared by reducing the disulfide bonds (eg, intrachain disulfide bonds) of an antibody or antigen-binding fragment. The reduced antibody can then be reacted with a thiol-reactive modifying agent to produce the modified antibody of the invention. Modified human antibodies comprising an organic moiety that is linked to specific sites of an antibody of the present invention can be prepared using suitable methods, such as reverse proteolysis (Fisch et al., Bioconjugate Chem., 3: 147-153 (1992 ); Werlen et al., Bioconjugate Chem., 5: 411417 (1994); Kumaran et al., Protein Sci. 6 (10): 2233-2241 (1997); Itoh et al., Bioorg. Chem., 24 ( 1): 59-68 (1996); Capellas et al., Biotechnol. Bioeng., 56 (4): 456-463 (1997)), and the methods described in Hermanson, GT, Bioconjugate Techniques, Academic Press: San Diego, CA (1996).
ANTI-TNF ANTIBODY COMPOSITIONS
The present invention also provides at least one anti-TNF antibody composition comprising at least one, at least two, at least three, at least four, at least five, at least six or more anti-TNF antibodies thereof, as It has been described herein and / or as known in the art to be provided in a non-naturally occurring composition, mixture or form. The anti-TNF antibody compositions of the present invention may further comprise at least one of any suitable and effective amount of a pharmaceutical composition or composition comprising at least one anti-TNF antibody to a cell, tissue, organ, animal or patient that necessitates such modulation, treatment or therapy, optionally further comprising at least one selected from at least one TNF antagonist (e.g., but without limitation a TNF antibody or fragment, a TNF receptor or soluble fragment, fusion proteins thereof, or a small molecule TNF antagonist), an antirheumatic (eg, methotrexate, auranofin, aurothioglucose, azathioprine, etanercept, thiomalate gold sodium, hydroxychloroquine sulfate, leflunomide, sulfasalzine), a muscle relaxant, a narcotic, a non-steroidal anti-inflammatory drug (NSAID), an analgesic, an anesthetic, a sedative, a local anesthetic, a neuromuscular blocker, an antimicrobial (for example, aminoglycoside, an antifungal, an antiparasitic, an antiviral, a carbapenem, a cephalosporin, a fluoroquinolone, a macrolide, a penicillin, a sulfonamide, a tetracycline, or another antimicrobial), a corticosteroid , an anabolic steroid, a diabetes-related agent, a mineral, a nutritional agent, a thyroid agent, a vitamin, a calcium-related hormone, an antidiarrheal, a cough suppressant, an antiemetic, an antiulcer, a laxative, an anticoagulant, an erythropoietin (for example, epoetin alfa), a filgrastim (for example, G-CSF, Neupogen) a sargramostim (GM-CSF, Leucine), an immunization, an immunoglobulin, an immunosuppressant (e.g. basiliximab, cyclosporine, daclizumab), a growth hormone, a hormone replacement drug, an estrogen receptor modulator, a mydriatic, a cycloplegic, an alkylating agent, an antimetabolite, a mitotic inhibitor, a radiopharmaceutical, an antidepressant, an anti-manic agent, an antipsychotic, an anxiolytic, a hypnotic, a sympathomimetic, a stimulant, donepezil, tacrine, an asthma medication, a beta antagonist, an inhaled steroid, a leukotriene inhibitor, a methylxanthine, a cromolyn, an epinephrine or analog, dornase alfa (Pulmozyme), a cytokine, or a cytokine antagonist. Non-limiting examples of such cytokines include, but are not limited to, any of IL-1 to IL-23. Suitable dosages are well known in the art. See, for example, Wells et al., Eds., Pharmacotherapy Handbook, 2<sup>to</sup> Editing, Appleton and Lange, Stamford, CT (2000); PDR Pharmacopeia, Taras-con Pharmacopeia 2000, Deluxe Edition, Tarascon Publishing, Loma Linda, CA (2000). Such anti-cancer or anti-infectives can also include toxin molecules that are associated, bound, co-formulated, or co-administered with at least one antibody of the present invention. The toxin can optionally act to selectively destroy the pathological cell or tissue. The pathological cell can be a cancer cell or another cell. Such toxins may be, but are not limited to, a purified or recombinant toxin or toxin fragment comprising at least one functional cytotoxic domain of toxin, for example, selected from at least one of ricin or diphtheria toxin, a poison toxin, or a toxin. bacterial. The term toxin also includes both endotoxins and exotoxins produced by any naturally occurring, mutant, or recombinant bacteria or virus that can cause any disease process in humans and other mammals, including toxin shock, which can result in death. Such toxins can include, but are not limited to, heat labile enterotoxin from E. coli enterotoxigenic (LT), heat stable enterotoxin (ST), Shigella cytotoxin, Aeromonas enterotoxins, Toxic shock syndrome toxin 1 (TSST-1), Staphylococcal enterotoxin A (SEA), B (SEB) or C (SEC), enterotoxins streptococcal and the like. Such bacteria include, but are not limited to, strains of an enterotoxigenic E. coli (ETEC) species, E. enterohaemorrhagic coli (for example, strains of serotype 0157: H7), Staphylococcus species (eg Staphylococcus aureus, Staphylococcus pyogenes), Shigella species (eg Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei), Salmonella species (eg Salmonella typhi-, Salmonella suis, Salmonella enteritidis), Clostridium species (for example, Clostridium perfringens, Clostridium difficult, Clostridium botulinum), Camphlobacter species (for example, Camphlobacter jejuni, Camphlobacter fetus), Helicobacter species, (for
ES 2 607 679 T3 example, Helicobacter pylori), Aeromonas species (for example Aeromonas sobria, Aeromonas hydrophila, Aeromonas caviae), Plesiomonas shigelloides, Yersinia enterocolitica, Vibrios species (for example Vibrios cholerae, Vibrios parahemolyticus), species of Klebsiella, Pseudomonas aeruginosa, and Streptococci. See, for example, Stein, ed., INTERNATIONAL MEDICINE, 3<sup>to</sup> edition, pp. 1-13, Little, Brown and Co., Boston, (1990); Evans et al, eds., Bacterial Infections of Humans: Epidemiology and Control, 2a. Ed., Pp. 239-254, Plenum Medical Book Co., New York (1991); Mandelletal, Principles and Practice of Infectious Diseases, 3rd Ed., Churchill Livingstone, New York (1990); Berkow et al, eds., The Merck Manual, 16th Edition, Merck and Co., Rahway, NJ, 1992; Wood et al, FEMS Microbiology Immunology, 76: 121-134 (1991); Marrack et al, Science, 248: 705-711 (1990).
The anti-TNF antibody compounds, compositions or combinations of the present invention may further comprise at least one of any suitable auxiliaries, such as, but not limited to, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservatives, adjuvants or Similar. Pharmaceutically acceptable auxiliaries are preferred. Non-limiting examples of and methods of preparing such sterile solutions are well known in the art, such as, but not limited to, Gennaro, Ed., Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Co. (Easton, PA) 1990 . Pharmaceutically acceptable carriers that are suitable for the mode of administration, solubility and / or stability of the anti-TNF antibody composition can be routinely selected as is well known in the art or as described herein.
Pharmaceutical excipients and additives useful in the present composition include, but are not limited to, proteins, peptides, amino acids, lipids, and carbohydrates (eg, sugars, including monosaccharides, di, tri, tetra, and oligosaccharides; derivatized sugars such as alditols, aldonic acids , esterified sugars and the like; and polysaccharides or sugar polymers), which can be presented individually or in combination, comprising alone or in combination 1-99.99% by weight or volume. Illustrative protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid / antibody components, which may also function in a buffering capacity, include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame and the like. A preferred amino acid is glycine.
Suitable carbohydrate excipients for use in the invention include, for example, monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol), myoinositol, and the like. Preferred carbohydrate excipients for use in the present invention are mannitol, trehalose, and raffinose.
Anti-TNF antibody compositions can also include a buffer or pH adjusting agent; typically, the buffer is a salt prepared from an organic acid or base. Representative buffers include organic acid salts such as salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid or phthalic acid; Tris, tromethamine hydrochloride or phosphate buffers. Preferred buffers for use in the present compositions are salts of organic acids such as citrate.
Additionally, the anti-TNF antibody compositions of the invention may include polymeric excipients / additives such as polyvinyl pyrrolidones, phycools (a polymeric sugar), dextrates (eg, cyclodextrins, such as 2-hydroxypropyl-b-cyclodextrin), polyethylene glycols, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, surfactants (eg, polysorbates such as "TWEEN 20" and "TWEEN 80"), lipids (eg, phospholipids and fatty acids), steroids (eg cholesterol) and chelating agents (eg EDTA).
These and other suitable pharmaceutical excipients and / or additives known for use in anti-TNF antibody compositions according to the invention are known in the art, for example, as listed in "Remington: The Science & Practice of Pharmacy" , 19th Ed., Williams & Williams, (1995), and in "Physician's Desk Reference", 52nd ed., Medical Economics, Montvale, NJ (1998). Preferred carrier or excipient materials are carbohydrates (eg, saccharides and alditols) and buffers (eg, citrate) or polymeric agents.
Formulations
As indicated above, the invention provides stable formulations, which are preferably a phosphate buffer with saline or a chosen salt, as well as preserved solutions and formulations containing a preservative as well as multi-use preserved formulations suitable for pharmaceutical or veterinary use, which they comprise at least one anti-TNF antibody in a pharmaceutically acceptable formulation. Preserved formulations contain at least one known preservative or are optionally selected from the group consisting of at least one phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, nitrite
ES 2 607 679 T3 phenylmercuric, phenoxyethanol, formaldehyde, chlorobutanol, magnesium chloride (for example, hexahydrate), alkyl paraben (methyl, ethyl, propyl, butyl and the like), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal or mixtures thereof in an aqueous diluent. Any suitable concentration or mixture can be used as is known in the art, such as 0.001-5% or any range or value within it, such as, but not limited to, 0.001, 0.003, 0.005, 0.009, 0.01, 0.02, 0.03, 0.05, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0, 9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3, 4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.3, 4.5, 4.6, 4.7, 4.8, 4.9 or any range or value within them. Non-limiting examples include, without preservative, 0.1-2% m-cresol (eg 0.2, 0.3, 0.4, 0.5, 0.9, or 1.0%), alcohol 0.1-3% benzyl (e.g. 0.5, 0.9, 1.1, 1.5, 1.9, 2.0, 2.5%), 0.001-0.5% thimerosal (eg 0.005, 0.01), 0.001-2.0% phenol (eg 0.05, 0.25, 0.28, 0.5, 0.9, 1.0%), alkyl parabens 0.00051.0% (for example, 0.00075, 0.0009, 0.001, 0.002, 0.005, 0.0075, 0.009, 0.01, 0.02, 0.05, 0.075, 0.09, 0 , 1, 0.2, 0.3, 0.5, 0.75, 0.9, 1.0%) and the like.
As indicated above, the invention provides an article of manufacture, comprising packaging material and at least one vial comprising a solution of at least one anti-TNF antibody, with the prescribed buffers and / or preservatives, optionally in a diluent aqueous, wherein said packaging material comprises a label indicating that such solution can be kept for a period of 1, 2, 3, 4, 5, 6, 9, 12, 18, 20, 24, 30, 36, 40, 48, 54, 60, 66, 72 hours or greater. The invention further comprises an article of manufacture, comprising packaging material, a first vial comprising at least one lyophilized anti-TNF antibody and a second vial comprising an aqueous diluent of buffer or prescribed preservative, wherein said packaging material comprises a label that instructs a patient to reconstitute the at least one anti-TNF antibody in the aqueous diluent to form a solution that can be kept for a period of twenty-four hours or longer.
The at least one anti-TNF antibody used in accordance with the present invention can be produced by recombinant means, including from mammalian or transgenic cell preparations or can be purified from other biological sources, as described herein. document or as known in the art.
The range of at least one anti-TNF antibody in the product of the present invention includes amounts that produce upon reconstitution, if in a wet / dry system, concentrations from about 1.0 mg / ml to about 1000 mg / ml, Although lower and higher concentrations are functional and depend on the desired delivery vehicle, for example, solution formulations will differ from transdermal, pulmonary, patch methods. transmucosal or osmotic pump or micro pump.
Preferably, the aqueous diluent optionally further comprises a pharmaceutically acceptable preservative. Preferred preservatives include those selected from the group consisting of phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, alkyl paraben (methyl, ethyl, propyl, butyl, and the like), benzalkonium chloride, chloride benzethonium, sodium dehydroacetate and thimerosal or mixtures thereof. The preservative concentrations used in the formulation are a sufficient concentration to produce an antimicrobial effect. Such concentrations depend on the preservative selected and are easily determined by the specialist.
Optionally and preferably, other excipients, for example isotonicity agents, buffers, antioxidants, preservatives and enhancers, can be added to the diluent. An isotonicity agent, such as glycerin, is commonly used in known concentrations. A physiologically tolerated buffer is preferably added to provide improved pH control. The formulations can encompass a wide range of pH, such as from about pH 4 to about pH 10 and the preferred ranges from about pH 5 to about pH 9 and a more preferred range from about 6.0 to about 8.0. Preferably, the formulations of the present invention have a pH between about 6.8 and about 7.8. Preferred buffers include phosphate buffers, more preferably sodium phosphate, particularly phosphate buffered saline (PBS).
Other additives can be added to the formulations or compositions, such as pharmaceutically acceptable solubilizers such as Tween 20 (polyoxyethylene (20) sorbitan monolaurate), Tween 40 (polyoxyethylene (20) sorbitan monopalmitate), Tween 80 (polyoxyethylene (20) monooleate) sorbitan), Pluronic F68 (polyoxyethylene polyoxypropylene block copolymers) and PEG (polyethylene glycol) or non-ionic surfactants such as polysorbate 20 or 80 or poloxamer 184 or 188, Pluronic® polyols, other block copolymers and chelators such as EDTA and EGTA, to reduce aggregation. These additives are particularly useful if a pump or plastic container is used to deliver the formulation. The presence of pharmaceutically acceptable surfactant mitigates the propensity of the protein to form aggregates.
The formulations of the present invention can be prepared by a process that comprises mixing at least one anti-TNF antibody and a preservative selected from the group consisting of phenol, mcresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, alkyl paraben (methyl, ethyl, propyl, butyl and the like),
ES 2 607 679 T3 benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal or mixtures thereof in an aqueous diluent. Mixing of at least one anti-TNF antibody and preservative in an aqueous diluent is accomplished using standard dissolution and mixing procedures. For example, to prepare a suitable formulation, a measured amount of at least one anti-TNF antibody in buffered solution is combined with the desired preservative in a buffered solution in amounts sufficient to provide the protein and preservative in the desired concentrations. One skilled in the art will recognize variations in this process. For example, the order in which the components are added, if additional additives are used, the temperature and pH at which the formulation is prepared, are all factors that can be optimized for the concentration and means of administration used.
The claimed formulations can be provided to patients as transparent solutions or as double vials comprising a vial of at least one lyophilized anti-TNF antibody that is reconstituted with a second vial containing water, a preservative and / or excipients, preferably a phosphate buffer. and / or saline solution and a chosen salt, in an aqueous diluent. Both a single solution vial and a double vial that requires reconstitution can be reused multiple times and may be sufficient for a single cycle or multiple cycles of patient treatment and therefore may provide a more convenient treatment regimen than those that are currently available. currently available.
The present claimed articles of manufacture are useful for administration over a period of immediately to twenty-four hours or longer. Accordingly, the present articles of manufacture indicated offer significant advantages to the patient. The formulations of the invention can optionally be safely stored at temperatures of from about 2 to about 40 ° C and retain the biological activity of the protein for extended periods of time, thereby allowing a container label to indicate that the solution is You can keep and / or use for a period of 6, 12, 18, 24, 36, 48, 72 or 96 hours or longer. If preserved diluent is used, such a label may include use up to 1-12 months, a half, one and a half, and two years.
Solutions of at least one anti-TNF antibody of the invention can be prepared by a process that comprises mixing at least one antibody in an aqueous diluent. Mixing is done using standard dissolution and mixing procedures. To prepare a suitable diluent, for example, a measured amount of at least one antibody is combined in water or buffer in amounts sufficient to provide the protein and optionally a preservative or buffer in the desired concentrations. One skilled in the art will recognize variations in this process. For example, the order in which the components are added, if additional additives are used, the temperature and pH at which the formulation is prepared, are all factors that can be optimized for the concentration and means of administration used.
The claimed products can be provided to patients as clear solutions or as double vials comprising a vial of at least one lyophilized anti-TNF antibody that is reconstituted with a second vial containing the aqueous diluent. Both a single solution vial and a double vial requiring reconstitution can be reused multiple times and may be sufficient for a single cycle or multiple cycles of patient treatment, thereby providing a more convenient treatment regimen than those that are currently available. currently available.
The claimed products can be provided indirectly to patients by providing to pharmacies, clinics or other institutions and facilities of this type, clear solutions or double vials comprising a vial of at least one lyophilized anti-TNF antibody that is reconstituted with a second vial containing the aqueous diluent. In this case, the clear solution can be up to a liter or even larger, providing a large container from which small parts of the at least one antibody solution can be recovered one or multiple times for transfer to smaller vials and provided by the pharmacy or clinic to its clients and / or patients.
Recognized devices comprising these single vial systems include pen injector devices for administration of a solution such as BD Pens, BD Autojector®, Humaject®, NovoPen®, BD®Pen, AutoPen® and OptiPen®, GenotropinPen®, Genotronorm Pen®, Humatro Pen®, Reco-Pen®, Roferon Pen®, Biojector®, ijec®, J-tip Needle-Free Injector®, Intraject®, Medi-Ject®, for example, as prepared or developed by Becton Dickensen (Franklin Lakes, NJ, www.bectondickenson.com), Disetronic (Burgdorf, Switzerland, www.disetronic.com); Bioject, Portland, Oregon (www.bioject.com); National Medical Products, Weston Medical (Peterborough, UK, www.weston-medical.com) and Medi-Ject Corp (Minneapolis, MN, www.mediject.com). Recognized devices comprising a dual vial system include pen injector systems for reconstituting a lyophilized drug into a cartridge for administration of the reconstituted solution such as the HumatroPen®.
The products claimed in this document include packaging material. The packaging material provides, in addition to the information required by regulatory agencies, the conditions under which the product can be used. The packaging material of the present invention provides instructions to the patient for
ES 2 607 679 T3 reconstitute the at least one anti-TNF antibody in the aqueous diluent to form a solution and to use the solution over a period of 2-24 hours or longer for the product from two wet / dry vials. For the single vial solution product, the label indicates that such a solution can be used over a period of 2-24 hours or longer. The products listed herein are useful for human pharmaceutical use.
The formulations of the present invention can be prepared by a process that comprises mixing at least one anti-TNF antibody and a selected buffer, preferably a phosphate buffer containing saline or a chosen salt. Mixing of the at least one antibody and buffer in an aqueous diluent is accomplished using standard dissolution and mixing procedures. For example, to prepare a suitable formulation, a measured amount of at least one antibody in water or buffer is combined with the desired buffering agent in water in amounts sufficient to provide the protein and buffer in the desired concentrations. One skilled in the art will recognize variations in this process. For example, the order in which the components are added, if additional additives are used, the temperature and pH at which the formulation is prepared, are all factors that can be optimized for the concentration and means of administration used.
The claimed stable or preserved formulations can be provided to patients as clear solutions or as double vials comprising a vial of at least one lyophilized anti-TNF antibody that is reconstituted with a second vial containing a preservative or a buffer and excipients in a diluent. aqueous. Both a single solution vial and a double vial requiring reconstitution can be reused multiple times and may be sufficient for a single cycle or multiple cycles of patient treatment and thus provide a more convenient treatment regimen than those that are currently available. currently available.
At least one anti-TNF antibody in the stable or preserved formulations or solutions described herein can be administered to a patient in accordance with the present invention through a variety of administration methods including SC or IM injection; by the transdermal, pulmonary, transmucosal route, implant, osmotic pump, cartridge, micro pump or other means appreciated by those skilled in the art, as is well known in the art.
Therapeutic Applications
The antibody or composition of the invention can be to modulate or treat at least one TNF-related disease, in a cell, tissue, organ, animal or patient, as is known in the art or as described herein.
In particular, they can be to modulate or treat at least one TNF-related disease in a cell, tissue, organ, animal, or patient including, but not limited to, at least one obesity, an immune-related disease, a cardiovascular disease, an infectious disease, a malignancy or a neurological disease.
More specifically, they can be to modulate or treat at least one disease related to the immune system, in a cell, tissue, organ, animal or patient including, but not limited to, at least one of rheumatoid arthritis, juvenile rheumatoid arthritis, arthritis systemic onset juvenile rheumatoid disease, psoriatic arthritis, ankylosing spondylitis, gastric ulcer, seronegative arthropathies, osteoarthritis, inflammatory bowel disease, ulcerative colitis, Systemic lupus erythematosus, antiphospholipid syndrome, iridocyclitis / uveitis / optic neuritis, idiopathic pulmonary fibrosis, systemic vasculitis / Wegener's granulomatosis, sarcoidosis, orchitis / vasectomy inversion procedures, allergic / atopic diseases, asthma, contact rhinitis, eczema allergic, allergic conjunctivitis, hypersensitivity pneumonitis, transplants, organ transplant rejection, graft-versus-host disease, systemic inflammatory response syndrome, sepsis syndrome, gram positive sepsis, gram negative sepsis, culture negative sepsis, fungal sepsis, neutropenic fever, urosepsis, meningococcemia, trauma / hemorrhage, burns, ionizing radiation exposure, acute pancreatitis, syndrome from adult respiratory stress, rheumatoid arthritis, alcohol-induced hepatitis, chronic inflammatory pathologies, sarcoidosis, Crohn's disease, sickle cell anemia, diabetes, nephrosis, atopic diseases, hypersensitivity reactions, allergic rhinitis, hay fever, perennial rhinitis, conjunctivitis, endometriosis, asthma, urticaria, systemic anaphylaxis, dermatitis, pernicious anemia, hemolytic disease, thrombocytopenia, graft rejection of any organ or tissue, rejection kidney transplant, heart transplant rejection, liver transplant rejection, pancreas transplant rejection, lung transplant rejection, bone marrow transplant rejection (BMT), skin allograft rejection, cartilage transplant rejection, bone graft rejection, small intestine transplant rejection, fetal thymus implant rejection, parathyroid transplant rejection, xenograft of any organ or tissue, allograft rejection, anti-receptor hypersensitivity reactions, Graves' disease, Raynoud's disease, type B insulin-resistant diabetes, asthma, myasthenia gravis, Antibody-mediated cytotoxicity, type III hypersensitivity reactions, systemic lupus erythematosus, POEMS syndrome (polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy and skin change syndrome), polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy, skin change syndrome , antiphospholipid syndrome, pemphigus, scleroderma, mixed connective tissue disease, Addison's disease
ES 2 607 679 Idiopathic T3, diabetes mellitus, chronic active hepatitis, primary biliary cirrhosis, vitiligo, vasculitis, post-MI cardiotomy syndrome, type IV hypersensitivity, contact dermatitis, hypersensitivity pneumonitis, allograft rejection, granulomas due to organisms intracellular, drug sensitivity, metabolic / idiopathic, Wilson's disease, hemochromatosis, alpha 1 antitrypsin deficiency, diabetic retinopathy, Hashimoto's thyroiditis, osteoporosis, evaluation of the hypothalamic-pituitary-adrenal axis, primary biliary cirrhosis, thyroiditis, encephalomyelitis, cachexia, cystic fibrosis, neonatal chronic pulmonary disease, chronic obstructive pulmonary disease (COPD), familial hematophagocytic lymphohistiocytosis, dermatological conditions, psoriasis, alopecia, nephrotic syndrome, nephritis , glomerular nephritis, acute renal failure, hemodialysis, uremia, toxicity, preeclampsia, okt3 therapy, anti-cd3 therapy, cytokine therapy, chemotherapy, radiation therapy (eg, including but not limited to asthenia, anemia, cachexia, and the like), chronic salicylate poisoning, and the like. See, for example, Merck Manual, 12<sup>to</sup>-17<sup>to</sup> Editions, Merck & Company, Rahway, NJ (1972, 1977, 1982, 1987, 1992, 1999), Pharmacotherapy Handbook, Wells et al., Eds., Second Edition, Appleton and Lange, Stamford, Conn. (1998, 2000).
The antibody or composition of the invention can be to modulate or treat at least one cardiovascular disease in a cell, tissue, organ, animal or patient including, but not limited to, at least one of cardiac daze syndrome, myocardial infarction, heart failure congestive, stroke, ischemic stroke, hemorrhage, arteriosclerosis, atherosclerosis, restenosis, diabetic arteriosclerotic disease, hypertension, arterial hypertension, renovascular hypertension, syncope, shock, syphilis of the cardiovascular system, heart failure, cor pulmonale, primary pulmonary hypertension, cardiac arrhythmias, atrial ectopic beat, atrial flutter, atrial fibrillation (sustained or paroxysmal), post-perfusion syndrome, inflammatory response to cardiopulmonary bypass, atrial tachycardia chaotic or multifocal, regular tachycardia with narrow QRS, specific arrhythmias, ventricular fibrillation, His bundle arrhythmias, atrioventricular block, bundle branch block, myocardial ischemic disorders, coronary artery disease, angina pectoris, myocardial infarction, cardiomyopathy, dilated congestive cardiomyopathy, restrictive cardiomyopathy, valvular heart disease, endocarditis, pericardial disease, cardiac tumors, aortic and peripheral aneurysms , aortic dissection, inflammation of the aorta, occlusion of the abdominal aorta and its branches, peripheral vascular disorders, arterial occlusive disorders, peripheral atherosclerotic disease, obliterative thromboangitis, functional peripheral arterial disorders, Raynaud's phenomenon and disease, acrocyanosis, erythromelalgia, venous diseases, venous thrombosis, varicose veins, arteriovenous fistula, lymphedema, lipedema, unstable angina, reperfusion injury, syndrome post-pump, ischemia-reperfusion injury, and the like.
The antibody or composition of the invention can be to modulate or treat at least one infectious disease in a cell, tissue, organ, animal or patient, including but not limited to, at least one of: acute or chronic bacterial infection, parasitic or infectious processes acute and chronic, including bacterial, viral and fungal infections, HIV infection / HIV neuropathy, meningitis, hepatitis (A, B or C or similar), septic arthritis, peritonitis, pneumonia, epiglottitis, E. coli 0157: h7, hemolytic uraemic syndrome / thrombolytic thrombocytopenic purpura, malaria, dengue hemorrhagic fever, leishmaniasis, leprosy, toxic shock syndrome, streptococcal myositis, gas gangrene, mycobacterium tuberculosis, intracellular mycobacterium avium, pneumocystis cariniélica disease, pneumocystis cariniélica disease orchitis / epididymitis, legionella, lyme disease, influenza A, epstein-barr virus, vital associated hemaphagocytic syndrome, vital encephalitis / aseptic meningitis and the like.
The antibody or composition of the invention can be to modulate or treat at least one malignant disease in a cell, tissue, organ, animal or patient, including but not limited to, at least one of: leukemia, acute leukemia, acute lymphoblastic leukemia (ALL), B-cell ALL, T-cell or FAB, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodysplastic syndrome (MDS), a lymphoma, Hodgkin's disease, a malignant lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, multiple myeloma, Kaposi's sarcoma, colorectal carcinoma, pancreatic carcinoma, nasopharyngeal carcinoma, malignant histiocytosis, Malignancy paraneoplastic / hypercalcemia syndrome, solid tumors, adenocarcinomas, sarcomas, malignant melanoma, hemangioma, metastatic disease, cancer-related bone resorption, cancer-related bone pain, and the like.
The antibody or composition of the invention can be to modulate or treat at least one neurological disease in a cell, tissue, organ, animal or patient, including but not limited to, at least one of: neurodegenerative diseases, multiple sclerosis, migraine headache, AIDS dementia complex, demyelinating diseases, such as multiple sclerosis and acute transverse myelitis, extrapyramidal and cerebellar disorders such as lesions of the corticospinal system; basal ganglia disorders or cerebellar disorders; hyperkinetic movement disorders such as Huntington's chorea and senile chorea; drug-induced movement disorders, such as those induced by drugs that block CNS dopamine receptors; hypokinetic movement disorders, such as Parkinson's disease; Progressive supranuclear palsy; structural lesions of the cerebellum; spinocerebellar degenerations, such as spinal ataxia, Friedreich's ataxia, cerebellar cortical degenerations, multiple system degenerations (Mencel, Dejerine-Thomas, Shi-Drager and Machado-Joseph); systemic disorders (Refsum's disease, abetalipoproteinemia, ataxia, telangiectasia, and multiple mitochondrial system disorder); core disorders
ES 2 607 679 T3 demyelinating, such as multiple sclerosis, acute transverse myelitis; and motor unit disorders such as neurogenic muscle atrophy (anterior horn cell degeneration, such as amyotrophic lateral sclerosis, infantile spinal muscular atrophy, and juvenile spinal muscular atrophy); Alzheimer's disease, Down syndrome in middle age; Diffuse Lewy Body Disease, Lewy Body Type Senile Dementia; Wernicke-Korsakoff syndrome, chronic alcoholism, Creutzfeldt-Jakob disease; Subacute sclerosing panencephalitis, Hallerrorden-Spatz disease and Dementia pugilística and the like. See, for example, the Merck Manual, 16<sup>to</sup> edition, Merck & Company, Rahway, NJ (1992).
The composition of the invention can be used in a method comprising administering an effective amount to a cell, tissue, organ, animal or patient in need thereof. Such a method may optionally further comprise co-administration or combination therapy to treat such immune diseases, wherein the administration of said composition further comprises administering, before, simultaneously and / or afterwards at least one selected from at least one TNF antagonist (for example, but not limited to, a TNF antibody or fragment, a soluble TNF receptor or fragment, fusion proteins thereof or a small molecule TNF antagonist), an antirheumatic (for example, methotrexate, auranofin, aurothioglucose, azathioprine, etanercept, gold sodium thiomalate, hydroxychloroquine sulfate, leflunomide, and sulfasalzine), a muscle relaxant, a narcotic, non-steroidal anti-inflammatory drug (NSAID), pain reliever, anesthetic, sedative, local anesthetic, neuromuscular blocker, antimicrobial (e.g. aminoglycoside, antifungal, an antiparasitic, an antiviral, a carbapenem, a cephalosporin, a fluoroquinolone, a macrolide, a penicillin, a sulfonamide, a tetracycline or other antimicrobials), an antipsoriatic, a corticosteroid, an anabolic steroid, a diabetes-related agent, a mineral, a nutritional agent, a thyroid agent, a vitamin, a calcium-related hormone, an antidiarrheal, an antitussive, an antiemetic, an antiulcer, a laxative, an anticoagulant, an erythropoietin (eg, epoetin alfa), a filgrastim (eg, G-CSF, Neupogen), a sargramostim (GM-CSF, Leucine), an immunization, an immunoglobulin, an immunosuppressant (eg, basiliximab, cyclosporin, and daclizumab ), a growth hormone, a hormone replacement drug, an estrogen receptor modulator, a mydriatic agent, a cycloplegic and an alkylator, an antimetabolite, a mitotic inhibitor, a radiopharmaceutical, an antidepressant, an antimanic, an antipsychotic, an anxiolytic, a hypnotic, a sympathomimetic, a stimulant, donepezil, tacrine, an asthma medication, a beta agonist, an inhaled steroid, a leukotriene inhibitor, a methylxanthine, a chromoline, an epinephrine or analog, dornase alpha (Pulmozyme), a cytokine, or a cytokine antagonist. Suitable dosages are well known in the art. See, for example, Wells et al., Eds., Pharmacotherapy Handbook, 2nd Edition, Appleton and Lange, Stamford, CT (2000); PDR Pharmacopoeia, Tarascon Pocket Pharmacopoeia 2000, Deluxe Edition, Tarascon Publishing, Loma Linda, CA (2000).
Suitable TNF antagonists for compositions, combination therapy, co-administration, devices and / or methods of the present invention (further comprising at least one antibody, specified part and variant thereof, of the present invention), include, but are not limited to limiting, anti-TNF antibodies, antigen-binding fragments thereof, and receptor molecules that specifically bind to TNF; Compounds that prevent and / or inhibit TNF synthesis, TNF release, or its action on target cells, such as thalidomide, tenidap, phosphodiesterase inhibitors (eg, pentoxifylline and rolipram), adenosine A2b receptor agonists, and enhancers of adenosine A2b receptor; compounds that prevent and / or inhibit TNF receptor signaling, such as mitogen-activated protein kinase (MAP) inhibitors; compounds that block or inhibit membrane TNF cleavage, such as metalloproteinase inhibitors; compounds that block or inhibit TNF activity, such as angiotensin converting enzyme (ACE) inhibitors (for example, captopril) and compounds that block and / or inhibit TNF production and / or synthesis, such as inhibitors of MAP kinase.
As used herein, a "tumor necrosis factor antibody", "TNF antibody", "TNFa antibody" or fragment and the like decreases, blocks, inhibits, abrogates or interferes with the activity of TNFa in vitro, in situ and / or preferably in vivo. For example, a suitable human TNF antibody of the present invention can bind to TNFa and includes anti-TNF antibodies, antigen-binding fragments thereof, and specified mutants or domains thereof that specifically bind TNFa. A suitable TNF antibody or fragment can also decrease, block, abrogate, interfere with, prevent and / or inhibit TNF RNA, DNA or protein synthesis, TNF release, TNF receptor signaling, TNF cleavage in membrane, TNF activity and TNF production and / or synthesis.
The chimeric antibody cA2 consists of the antigen-binding variable region of the high affinity neutralizing mouse anti-human TNFa IgG1 antibody, designated A2, and the constant regions of a human IgG1 kappa immunoglobulin. The Fc region of human IgG1 enhances the effector function of allogeneic antibody, increases the half-life in circulating serum, and decreases the immunogenicity of the antibody. The avidity and epitope specificity of the cA2 chimeric antibody is derived from the variable region of the murine A2 antibody. In a particular embodiment, a preferred source of nucleic acids encoding the variable region of murine antibody A2 is the hybridoma cell line A2.
Chimeric A2 (cA2) neutralizes the cytotoxic effect of both natural and recombinant human TNFa from
ES 2 607 679 T3 in a dose-dependent manner. From chimeric antibody cA2 and recombinant human TNFa binding assays, the affinity constant of chimeric antibody cA2 was calculated to be 1.04 x 10<sup>10</sup> M<sup>-1</sup>. Preferred methods for determining monoclonal antibody specificity and affinity by competitive inhibition can be seen in Harlow, et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1988; Colligan et al., Eds., Current Protocols in Immunology, Greene Publishing Assoc, and Wiley Interscience, New York, (1992-2000); Kozbor et al., Immunol. Today, 4: 72-79 (1983); Ausubel et al., Eds. Current Protocols in Molecular Biology, Wiley Interscience, New York (1987-2000); and Muller, Meth. Enzymol., 92: 589-601 (1983).
In a preferred embodiment, murine monoclonal antibody A2 is produced by a cell line designated c134A. The chimeric antibody cA2 is produced by a cell line called c168A.
Additional examples of monoclonal anti-TNF antibodies that can be used in the present invention are described in the art (see, for example, US Patent No. 5,231,024; Moller, A. et al., Cytokine 2 ( 3): 162-169 (1990); US Application No. 07 / 943,852 (filed September 11, 1992); Rathjen et al., International Publication No. WO 91/02078 (published February 21, 1991 ); Rubin et al .. EPO Patent Publication No. 0 218 868 (published April 22, 1987); Yone et al., EPO Patent Publication No. 0288 088 (October 26, 1988); Liang, et al., Biochem. Biophys. Res. Comm. 137: 847-854 (1986); Meager, et al., Hybridoma 6: 305-311 (1987); Fendly et al., Hybridoma 6: 359-369 (1987); Bringman, et al., Hybridoma 6: 489-507 (1987); and Hirai, et al., J. Immunol. Meth. 96: 57-62 (1987).
TNF receptor molecules
Preferred TNF receptor molecules useful in the present invention are those that bind TNFa with high affinity (see, eg, Feldmann et al., International Publication No. WO 92/07076 (published April 30, 1992); Schall et al., Cell 61: 361-370 (1990), and Loetscher et al., Cell 61: 351-359 (1990), the references of which are incorporated herein in their entirety by reference) and optionally possess low immunogenicity. In particular, 55 kDa (p55 TNF-R) and 75 kDa (p75 TNF-R) cell surface receptors are useful in the present invention. The truncated forms of these receptors, comprising the extracellular domains (ECDs) of the receptors or functional parts thereof (see, for example, Corcoran et al., Eur. J. Biochem. 223: 831-840 (1994)) are also useful in the present invention. Truncated forms of TNF receptors, comprising ECDs, have also been detected in urine and serum as 30 kDa and 40 kDa TNFa inhibitory binding proteins (Engelmann, H. et al., J. Biol. Chem. 265: 1531-1536 (1990). Multimeric TNF receptor molecules and TNF immunoreceptor fusion molecules and derivatives and fragments or parts thereof are additional examples of TNF receptor molecules that are useful in the methods and compositions of the present invention. The TNF receptor molecules that can be used in the invention are characterized by their ability to treat patients for prolonged periods with good to excellent relief of symptoms and low toxicity. Low immunogenicity and / or high affinity, as well as other undefined properties, can contribute to the therapeutic results achieved.
Multimeric TNF receptor molecules useful in the present invention comprise all or a functional part of the ECDs of two or more TNF receptors linked through one or more polypeptide linkers or other non-peptide linkers, such as polyethylene glycol (PEG). The multimeric molecules may further comprise a signal peptide from a secreted protein to direct the expression of a multimeric molecule.
The TNF immunoreceptor fusion molecules useful in the methods and compositions of the present invention comprise at least a part of one or more immunoglobulin molecules and all or a functional part of one or more TNF receptors. These immunoreceptor fusion molecules can be assembled as monomers or hetero or homo-multimers. Immunoreceptor fusion molecules can also be monovalent or multivalent. An example of such a TNF immunoreceptor fusion molecule is the TNF / IgG receptor fusion protein. TNF immunoreceptor fusion molecules and methods for their production have been described in the art (Lesslauer et al., Eur. J. Immunol. 21: 2883-2886 (1991); Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88: 10535-10539 (1991); Peppel et al., J. Exp. Med. 174: 1483-1489 (1991); Kolls et al., Proc. Natl. Acad. Sci. USA 91: 215-219 (1994); Butler et al., Cytokine 6 (6): 616-623 (1994); Baker et al., Eur. J. Immunol. 24: 2040-2048 (1994); Beutler et al., US Patent No. 5,447,851; and United States Application No. 08 / 442,133 (filed May 16, 1995). Methods for producing immunoreceptor fusion molecules can also be found in Capon et al., US Patent No. 5,116,964; Capon et al., US Patent No. 5,225,538; and Capon et al., Nature 337: 525-531 (1989).
A functional equivalent, derivative, fragment or region of TNF receptor molecule refers to the part of the TNF receptor molecule or the part of the sequence of the TNF receptor molecule that encodes the TNF receptor molecule, which has a size and sequences sufficient to functionally resemble TNF receptor molecules that can be used in the present invention (eg, they bind TNF with high affinity and possess low immunogenicity). A functional equivalent of the TNF receptor molecule as well
ES 2 607 679 T3 includes modified TNF receptor molecules that functionally resemble TNF receptor molecules that can be used in the present invention (eg, they bind TNF with high affinity and possess low immunogenicity). For example, a functional equivalent of a TNF receptor molecule may contain a "SILENTE" codon or one or more amino acid substitutions, deletions, or additions (eg, substitution of an acidic amino acid with another acidic amino acid; or substitution of a codon that encodes the same amino acid or a different hydrophobic amino acid by another codon encoding a hydrophobic amino acid). See Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Assoc, and Wiley-Interscience, New York (1987-2000).
Cytokines include any known cytokine. See, for example, CopewithCytokines.com. Cytokine antagonists include, but are not limited to, any antibody, fragment or mimetic, any soluble receptor, fragment or mimetic, any small molecule antagonist, or any combination thereof.
Therapeutic Treatments. The composition of the invention can be used in a method of treating a TNF-mediated disorder, which comprises administering an effective amount to a cell, tissue, organ, animal or patient in need thereof. Such a method may further optionally comprise co-administration or combination therapy to treat such immune diseases, wherein the administration of said composition further comprises administering, before, simultaneously and / or after, at least one selected from among minus one TNF antagonist (for example, but not limited to, a TNF antibody or fragment, a TNF receptor or soluble fragment, fusion proteins thereof or a small molecule TNF antagonist), an antirheumatic (for example, methotrexate, auranofin, aurothioglucose, azathioprine, etanercept, gold sodium thiomalate, hydroxychloroquine sulfate, leflunomide, sulfasalzine), a muscle relaxant, a narcotic, a non-steroidal anti-inflammatory drug (NSAID), an analgesic, an anesthetic, a sedative, a local anesthetic, a neuromuscular blocker, an antimicrobial (for example, aminoglycoside, an antifungal, an antiparasitic, an antiviral, a carbapenem, a cephalosporin, a fluoroquinolone, a macrolide, a penicillin, a sulfonamide, a tetracycline or other antimicrobial), an antipsoriatic, a corticosteroid, an anabolic steroid, an agent related to diabetes, a mineral, a nutritional agent, a thyroid agent, a vitamin, a calcium-related hormone, an antidiarrheal, an antitussive, an antiemetic, an antiulcer, a laxative, an anticoagulant, an erythropoietin (eg, epoetin alfa), a filgrastim (eg, G-CSF, Neupogen), a sargramostim (GM-CSF, Leucine), an immunization, an immunoglobulin, an immunosuppressant (eg, basiliximab, cyclosporin, daclizumab ), a growth hormone, a hormone replacement drug, an estrogen receptor modulator, a mydriatic, a cycloplegic, an alkylating agent, an antimetabolite, a mitotic inhibitor, a radiopharmaceutical, an antidepressant, an antimanic, an antipsychotic, an anxiolytic, a hypnotic, a sympathomimetic, a stimulant, donepezil, tacrine, an asthma medication, a beta agonist, an inhaled steroid, a leukotriene inhibitor, a methylxanthine, a chromoline, an epinephrine or analog, dornase alpha (Pulmozyme), a cytokine, or a cytokine antagonist.
Typically, the treatment of disease processes is accomplished by administering an effective amount or dosage of at least one anti-TNF antibody composition totaling, on average, a range of at least about 0.01 to 500 milligrams of at least one anti-TNF antibody. TNF per kilogram of patient per dose and preferably at least about 0.1 to 100 milligrams of antibody / kilogram of patient by single or multiple administration, depending on the specific activity contained in the composition. Alternatively, the effective serum concentration may comprise 0.1-5000 mg / ml serum concentration per single or multiple administration. Appropriate dosages are known to medical practitioners and will, of course, depend on the particular pathology, the specific activity of the composition being administered, and the particular patient undergoing treatment. In some cases, to achieve the desired therapeutic amount, it may be necessary to provide repeat administration, ie, repeated individual administrations of a particular metered or controlled dose, where individual administrations are repeated until the desired daily dose or effect is achieved.
Optionally preferred doses may include 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and / or
100-500 mg / kg / administration, or any range, value or fraction thereof or to achieve a serum concentration of 0.1, 0.5, 0.9, 1.0, 1.1.1.2 , 1.5, 1.9, 2.0, 2.5, 2.9, 3.0, 3.5, 3.9, 4.0, 4.5, 4.9, 5.0, 5 , 5, 5.9, 6.0, 6.5, 6.9, 7.0, 7.5, 7.9, 8.0, 8.5, 8.9, 9.0, 9.5 , 9.9, 10, 10.5, 10.9, 11, 11.5, 11.9,20, 12.5, 12.9, 13.0, 13.5, 13.9, 14.0 , 14.5, 4.9, 5.0, 5.5 ,, 5.9, 6.0, 6.5.6.9, 7.0, 7.5, 7.9, 8.0, 8.5, 8.9, 9.0, 9.5, 9.9, 10, 10.5, 10.9, 11, 11.5, 11.9, 12,
12.5, 12,9, 13,0, 13,5, 13,9, 14, 14,5, 15 , 15,5, 15,9, 16, 16,5, 16,9, 17, 17,5, 17,9, 18, 18,5, 18,9, 19, 19,5, 19,9, 20,
20.5, 20,9, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 96, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500 and / or 5000 mg / ml serum concentration by single administration or multiple, or any interval, value or fraction thereof.
Alternatively, the administered dose may vary depending on known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; age, health and weight of
ES 2 607 679 T3 receptor; nature and extent of symptoms, type of concurrent treatment, frequency of treatment and desired effect. Typically, a dose of active ingredient can be from about 0.1 to 100 milligrams per kilogram of body weight. Typically 0.1 to 50 and preferably 0.1 to 10 milligrams per kilogram per administration or in sustained release form are effective to obtain the desired results.
As a non-limiting example, the treatment of humans or animals can be provided as a one-time or periodic dose of at least one antibody of the present invention at 0.1 to 100 mg / kg, such as 0.5, 0.9, 1.0, 1.1, 1.5.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,27,
28, 29, 30, 40, 45, 50, 60, 70, 80, 90 or 100 mg / kg, per day, on at least one of the days 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 or, alternatively or additionally, at least one of weeks 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
48, 49, 50, 51 or 52 or, alternatively or additionally, at least one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19 or 20 years or any combination thereof, using single, infusion or repeated doses.
Dosage forms (composition) suitable for internal administration generally contain from about 0.1 milligram to about 500 milligrams of active ingredient per unit or container. In these pharmaceutical compositions the active ingredient will normally be present in an amount of about 0.5-99.999% by weight based on the total weight of the composition.
For parenteral administration, the antibody can be formulated as a solution, suspension, emulsion, or lyophilized powder in association or provided separately, with a pharmaceutically acceptable parenteral vehicle. Examples of such vehicles are water, saline, Ringer's solution, dextrose solution, and 1-10% human serum albumin. Liposomes and non-aqueous vehicles such as non-volatile oils can also be used. The lyophilized vehicle or powder may contain additives that maintain isotonicity (eg, sodium chloride and mannitol) and chemical stability (eg, buffers and preservatives). The formulation is sterilized by known or suitable techniques.
Suitable pharmaceutical carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, A. Osol, a standard reference text in this field.
Alternative Administration
Many modes known and developed in accordance with the present invention can be used to administer pharmaceutically effective amounts of at least one anti-TNF antibody in accordance with the present invention. Although pulmonary administration is used in the following description, other modes of administration can be used in accordance with the present invention with suitable results.
The TNF antibodies of the present invention can be administered in a vehicle, as a solution, emulsion, colloid, or suspension, or as a dry powder, using any of a variety of devices and methods suitable for administration by inhalation or other modes described in this document or known in the art.
Parenteral Formulations and Administration
Formulations for parenteral administration may contain as common excipients sterile water or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes, and the like. Aqueous or oily injection suspensions can be prepared using an appropriate emulsifier or humectant and a suspending agent, according to known methods. The agents for injection may be a non-toxic, non-orally administrable diluent such as aqueous solution or a sterile injectable solution or suspension in a solvent. As the vehicle or solvent that can be used, water, Ringer's solution, isotonic saline, etc .; As an ordinary solvent or suspending solvent, sterile non-volatile oil can be used. For these purposes, any type of oil and non- volatile fatty acid can be used , including natural or synthetic or semi-synthetic fatty oils or fatty acids; natural or synthetic or semi-synthetic mono or di or triglycerides. Parenteral administration is known in the art and includes, but is not limited to, conventional means of injections, a pressurized gas needleless injection device as described in US Patent No. 5,851,198, and a laser piercing device as described. described in US Patent No. 5,839,446, incorporated herein by reference in its entirety.
Alternative Administration
The invention further relates to the administration of at least one anti-TNF antibody by parenteral, subcutaneous, intramuscular, intravenous, intra-articular, intrabronchial, intra-abdominal, intracapsular, intracartilaginous, intracavitary, intracelial, intracerebellar, intracerebroventricular, intracolic, intra-cervical means. intrahepatic, intramyocardial, intraosseous, intrapelvic,
ES 2 607 679 T3 intrapericardiac, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, bolus, vaginal, rectal, buccal, sublingual, intranasal or transnasal. At least one anti-TNF antibody composition can be prepared for use for parenteral (subcutaneous, intramuscular or intravenous) or any other type of administration, particularly in the form of liquid solutions or suspensions; for use in vaginal or rectal administration, particularly in semisolid forms, such as, but not limited to, creams and suppositories; for buccal or sublingual administration such as, but not limited to, in the form of tablets or capsules; or intranasally, such as, but not limited to, in the form of powders, nasal drops or aerosols or certain agents; or transdermally, such as, but not limited to, a gel, ointment, lotion, suspension, or patch delivery system with chemical enhancers such as dimethylsulfoxide to modify the structure of the skin or to increase the concentration of drug in the transdermal patch (Junginger, et al., In "Drug Permeation Enhancement"; Hsieh, DS, Eds., Pp. 59-90 (Marcel Dekker, Inc. New York 1994, which is incorporated in its entirety herein by reference), or with oxidizing agents that allow the application of formulations containing proteins and peptides on the skin (WO 98/53847) or applications of electric fields to create transient transport routes such as electroporation or to increase the mobility of drugs charged through of the skin such as iontophoresis or application of ultrasound such as sonophoresis (US Patent Nos. 4,309,989 and 4,767,402).
Pulmonary / Nasal Administration
For pulmonary administration, preferably at least one anti-TNF antibody composition is administered in a particle size effective to reach the lower airways of the lungs or sinuses. In accordance with the invention, at least one anti-TNF antibody can be administered by any of a variety of inhalation or nasal devices known in the art for administration of a therapeutic agent by inhalation. These devices capable of depositing aerosolized formulations in the sinus cavity or alveoli of a patient include metered dose inhalers, nebulizers, dry powder generators, sprays, and the like. Other suitable devices for directing the pulmonary or nasal administration of antibodies are also known in the art. All of these devices can use formulations suitable for administration for the delivery of antibody in an aerosol. Such aerosols can be comprised of solutions (both aqueous and non-aqueous) or solid particles. Metered dose inhalers such as the Ventolin® metered dose inhaler typically use a propellant gas and require actuation during inspiration (See, for example, WO 94/16970 and WO 98/35888). Dry powder inhalers such as Turbuhaler ™ (Astra), Rotahaler® (Glaxo), Diskus® (Glaxo), Spiros ™ inhaler (Dura), devices marketed by Inhale Therapeutics and the Spinhaler® powder inhaler (Fisons), use the trigger by breathing a mixed powder (US 4668218 Astra, EP 237507 Astra, WO 97/25086 Glaxo, Wo 94/08552 Dura, US 5458135 Inhala, WO 94/06498 Fisons, which are incorporated herein by reference in their entirety ). Nebulizers such as AERx ™ Aradigm, UltraVent® nebulizer (Mallinckrodt) and Acorn II® nebulizer (Marquest Medical Products) (US 5404871 Aradigm and WO 97/22376), the above references being incorporated herein in their entirety as reference, produce aerosols from solutions, whereas metered dose inhalers, dry powder inhalers, etc. generate small particle aerosols. These specific examples of commercially available inhalation devices are intended to be a representation of specific devices suitable for the practice of this invention and are not intended to limit the scope of the invention. Preferably, a composition comprising at least one anti-TNF antibody is administered by inhaler or a dry powder spray. There are several desirable features of an inhalation device for delivering at least one antibody of the present invention. For example, administration by the inhalation device is advantageously reliable, reproducible, and accurate. The inhalation device can optionally deliver small dry particles, eg, less than about 10mm, preferably about 1-5mm, for good breathability.
Administration of TNF Antibody Compositions as a Spray
A spray including TNF antibody composition protein can be produced by forcing a suspension or solution of at least one anti-TNF antibody through a nozzle under pressure. Nozzle size and configuration, applied pressure, and liquid feed rate can be chosen to achieve desired particle size and throughput. Electrospray can be produced, for example, by an electric field in connection with a capillary or nozzle feed. Advantageously, particles of at least one anti-TNF antibody composition protein delivered by spray have a particle size of less than about 10mm, preferably in the range of about 1mm to about 5mm, and more preferably about 2mm. to about 3 mm.
Formulations of at least one anti-TNF antibody composition protein suitable for use with a spray typically include antibody composition protein to an aqueous solution at a concentration of from about 0.1 mg to about 100 mg of at least one protein. Of composition
ES 2 607 679 T3 of anti-TNF antibody per ml of solution or mg / g or any range or value therein, for example but not limited to 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 45, 50, 60, 70, 80, 90 or 100 mg / ml or mg / g. The formulation can include such agents as an excipient, a buffer, an isotonicity agent, a preservative, a surfactant, and preferably zinc. The formulation may also include an excipient or agent for stabilizing the antibody composition protein, such as a buffer, a reducing agent, a bulking protein, or a carbohydrate. Bulking proteins useful in formulating antibody composition proteins include albumin, protamine, or the like. Typical carbohydrates useful in formulating antibody composition proteins include sucrose, mannitol, lactose, trehalose, glucose, or the like. The antibody composition protein formulation may also include a surfactant, which may reduce or prevent surface-induced aggregation of the antibody composition protein caused by atomization of the solution in the formation of an aerosol. Various conventional surfactants can be employed, such as polyoxyethylene fatty acid esters and alcohols and polyoxyethylene sorbitol fatty acid esters. Amounts will generally vary between 0.001 and 14% by weight of the formulation. Especially preferred surfactants for the purposes of this invention are polyoxyethylene sorbitan monooleate, polysorbate 80, polysorbate 20, or the like. Additional agents known in the art for formulation of a protein such as TNF antibodies or specified parts or variants can also be included in the formulation.
Administration of TNF Antibody Compositions Using a Nebulizer
Protein of antibody composition can be delivered by a nebulizer, such as a compression nebulizer or an ultrasonic nebulizer. Typically, in a compression nebulizer, a source of compressed air is used to create a high velocity jet of air through an orifice. As the gas expands past the nozzle, a low pressure region is created, which draws a protein solution of antibody composition through a capillary tube connected to a reservoir of liquid. The jet of liquid from the capillary tube breaks into unstable filaments and droplets as it exits the tube, creating the aerosol. A variety of baffle configurations, flow rates, and types can be employed to achieve the desired performance characteristics from a given compression fogger. In an ultrasonic nebulizer, high frequency electrical energy is used to create vibrational mechanical energy, typically employing a piezoelectric transducer. This energy is delivered to the antibody composition protein formulation directly or through a coupling liquid, creating an aerosol that includes the antibody composition protein. Advantageously, the antibody composition protein particles delivered by a nebulizer have a particle size of less than about 10 pm, preferably in the range of about 1 pm to about 5 pm, and more preferably from about 2 pm to about 3 pm.
Formulations of at least one anti-TNF antibody suitable for use with a nebulizer, either compression or ultrasonic, typically include a concentration of from about 0.1 mg to about 100 mg of at least one anti-TNF antibody protein per ml. from solution. The formulation can include such agents as an excipient, a buffer, an isotonicity agent, a preservative, a surfactant, and preferably zinc. The formulation may also include an excipient or agent for stabilizing the at least one anti-TNF antibody composition protein, such as a buffer, a reducing agent, a bulking protein, or a carbohydrate. Bulking proteins useful for formulating at least one anti-TNF antibody composition protein include albumin, protamine, and the like. Typical carbohydrates useful for formulating at least one anti-TNF antibody include sucrose, mannitol, lactose, trehalose, glucose, or the like. The at least one anti-TNF antibody formulation may also include a surfactant, which can reduce or prevent surface-induced aggregation of the at least one anti-TNF antibody caused by spraying the solution into an aerosol. Various conventional surfactants can be employed, such as polyoxyethylene fatty acid esters and polyoxyethylene sorbitan fatty acid esters and alcohols. Amounts will generally vary between 0.001 and 4% by weight of the formulation. Especially preferred surfactants for the purposes of this invention are polyoxyethylene sorbitan monooleate, polysorbate 80, polysorbate 20, or the like. Additional agents known in the art for formulating a protein such as an antibody protein can also be included in the formulation.
Administration of TNF Antibody Compositions by a Metered Dose Inhaler.
In a metered dose inhaler (MDI), a propellant, at least one anti-TNF antibody and any excipients or other additives are contained in a cartridge as a mixture that includes a liquefied compressed gas. Actuation of the metering valve releases the mixture as an aerosol, preferably containing particles in the size range of less than about 10 pm, preferably about 1 pm to about 5 pm, and more preferably about 2 pm to about 3 pm. The desired aerosol particle size can be obtained by employing an antibody composition protein formulation produced by various methods known to those of skill in the art, including jet milling, spray drying, critical point condensation or the like. Preferred metered dose inhalers include those manufactured by 3M or Glaxo and employing a hydrofluorocarbon propellant.
ES 2 607 679 T3
Formulations of at least one anti-TNF antibody for use with a metered dose inhaler device will generally include a finely divided powder containing at least one anti-TNF antibody as a suspension in a non-aqueous medium, for example, suspended in a propellant. with the help of a surfactant. The propellant can be any conventional material employed for this purpose, such as chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, HFA-134a-134a (hydrofluoroethane), HFA-134a-134a (hydrofluoroethane). , HFA227 (hydrofluoroalkane-227) or the like. Preferably the propellant is a hydrofluorocarbon. The surfactant can be chosen to stabilize the at least one anti-TNF antibody as a suspension in the propellant, to protect the active agent against chemical degradation, and the like. Suitable surfactants include sorbitan trioleate, soy lecithin, oleic acid, or the like. In some cases, solution sprays using solvents such as ethanol are preferred. Additional agents known in the art for formulating a protein such as protein may also be included in the formulation.
One skilled in the art will recognize that the methods of the present invention can be accomplished by pulmonary administration of at least one anti-TNF antibody composition via devices not described herein.
Oral Formulations and Administration
Formulations for oral administration depend on the co-administration of adjuvants (for example, resorcinols and nonionic surfactants such as polyoxyethylene oleyl ether and n-hexadecylpolyethylene ether) to artificially increase the permeability of the intestinal walls, as well as the co-administration of enzyme inhibitors (for eg, pancreatic trypsin inhibitors, diisopropylfluorophosphate (DFF), and trasylol) to inhibit enzymatic degradation. The active constituent compound of the solid type pharmaceutical form for oral administration can be mixed with at least one additive, including sucrose, lactose, cellulose, mannitol, trehalose, raffinose, maltitol, dextran, starches, agar, arginates, chitins, chitosans, pectins , gum tragacanth, acacia, gelatin, collagen, casein, albumin, synthetic or semi-synthetic polymer and glyceride. These dosage forms may also contain other types of additives, for example, inactive diluting agent, lubricant such as magnesium stearate, paraben, preservative agent such as sorbic acid, ascorbic acid, alpha-tocopherol, antioxidant such as cysteine, disintegrant, binder, thickener, buffering agent, sweetening agent, flavoring agent, perfuming agent, etc.
Tablets and pills can be further processed into enteric-coated preparations. Liquid preparations for oral administration include emulsion, syrup, elixir, suspension and solution preparations that can be used for medical use. These preparations may contain inactive diluting agents normally used in said field, for example, water. Liposomes have also been described as drug delivery systems for insulin and heparin (US Patent No. 4,239,754). More recently, mixed amino acid (proteinoid) artificial polymer microspheres have been used to deliver pharmaceutical agents (US Patent No. 4,925,673). In addition, the carrier compounds described in US Patent Nos. 5,879,681 and 5,871,753 are known in the art to be used to administer biologically active agents orally.
Formulations and Mucosa Administration
For absorption through mucosal surfaces, compositions and methods of administration of at least one anti-TNF antibody include an emulsion comprising a plurality of submicron particles, a mucoadhesive macromolecule, a bioactive peptide, and an aqueous continuous phase, which promotes absorption through mucosal surfaces achieving mucoadhesion of emulsion particles (US Patent No. 5,514,670). Suitable mucosal surfaces for application of the emulsions of the present invention may include corneal, conjunctival, buccal, sublingual, nasal, vaginal, pulmonary, stomach, intestinal, and rectal routes of administration. Formulations for vaginal or rectal administration, for example suppositories, may contain as excipients, for example, polyalkylene glycols, petroleum jelly, cocoa butter and the like. Formulations for intranasal administration can be solid and contain as excipients, for example, lactose, or they can be aqueous or oily solutions of nasal drops. For buccal administration excipients include sugars, calcium stearate, magnesium stearate, pregelatinized starch, and the like (US Patent No. 5,849,695).
Formulations and Transdermal Administration
For transdermal administration, the at least one anti-TNF antibody is encapsulated in a delivery device such as a liposome or polymeric nanoparticles, microparticles, microcapsules or microspheres (collectively referred to as microparticles unless otherwise indicated). Various suitable devices are known, including microparticles made from synthetic polymers such as polyhydroxy acids such as polylactic acid, polyglycolic acid and copolymers thereof, polyorthoesters, polyanhydrides and
ES 2 607 679 T3 polyphosphazenes and natural polymers such as collagen, polyamino acids, albumin and other proteins, alginate and other polysaccharides and combinations thereof (US Patent No. 5,814,599).
Prolonged Administration and Formulations
Sometimes it may be desirable to administer the compounds of the present invention to the subject for extended periods of time, for example, for periods of one week to one year from a single administration. Various slow, prolonged or implant release dosage forms can be used. For example, a dosage form may contain a non-toxic pharmaceutically acceptable salt of the compounds that has a low degree of solubility in body fluids, for example, (a) an acid addition salt with a polybasic acid such as phosphoric acid, sulfuric acid, citric acid, tartaric acid, tannic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalene mono- or disulfonic acids, polygalacturonic acid and the like; (b) a salt with a polyvalent metal cation such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium and the like or with an organic cation formed from, for example, N, N ' -dibenzylethylenediamine or ethylenediamine; (c) combinations of (a) and (b), for example, a zinc tannate salt. Additionally, the compounds of the present invention or, preferably, a relatively insoluble salt such as those just described, can be formulated in a gel, for example an aluminum monostearate gel, for example sesame oil, suitable for injection. Particularly preferred salts are the zinc salts, zinc tannate salts, pamoate salts, and the like. Another type of sustained-release formulation for injection could contain the dispersed compound or salt to be encapsulated in a non-toxic, non-antigenic, slow-degrading polymer such as a polylactic acid / polyglycolic acid polymer, for example, as described in United States Patent No. 3,773,919. Compounds or, preferably, relatively insoluble salts such as those described above can also be formulated into cholesterol matrix silastic granules, particularly for use in animals. Additional slow, prolonged or implant release formulations are known in the literature, for example gas or liquid liposomes (US Patent No. 5,770,222 and "Sustained and Controlled Release Drug Delivery Systems", JR Robinson ed., Marcel Dekker, Inc., NY 19778).
Having generally described the invention, it will be more readily appreciated by reference to the following examples, which are provided by way of illustration and are not intended to be limiting.
Example 1: Cloning and Expression of TNF Antibody in Mammalian Cells
A typical mammalian expression vector contains at least one promoter element, which mediates the initiation of mRNA transcription, the antibody coding sequence, and signals necessary for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences, and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved with the SV40 early and late promoters, the long terminal repeats (LTRS) of retroviruses, eg, RSV, HTLVI, HIVI, and the early promoter of cytomegalovirus (CMV). However, cellular elements (eg, the human actin promoter) can also be used. Suitable expression vectors for use in the practice of the present invention include, for example, vectors such as pIRES1neo, pRetro-Off, pRetro-On, PLXSN, or pLNCX (Clonetech Labs, Palo Alto, CA), pcDNA3.1 (+/-), pcDNA / Zeo (+/-) or pcDNA3.1 / Hygro (+/-) (Invitrogen), PSVL and PmSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109). Mammalian host cells that could be used include Hela 293, h9, and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7, and CV 1 cells, QC1-3 quail cells, mouse L cells, and ovary cells. Chinese hamster (CHO).
Alternatively, the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome. Cotransfection with a selection marker such as dhfr, gpt, neomycin or hygromycin allows the identification and isolation of the transfected cells.
The transfected gene can also be amplified to express large amounts of the encoded antibody. The DHFR (dihydrofolate reductase) marker is useful for developing cell lines that carry several hundred or even several thousand copies of the gene of interest. Another useful selection marker is the enzyme glutamine synthetase (GS) (Murphy, et al., Biochem. J. 227: 277-279) (1991); Bebbington, et al., Bio / Technology 10: 169-175 (1992)). Using these markers, mammalian cells are grown in selective medium and cells with the highest resistance are selected. These cell lines contain the amplified gene or genes integrated into a chromosome. Chinese Hamster Ovary (CHO) and NSO cells are frequently used for the production of antibodies.
The expression vectors pC1 and pC4 contain the strong promoter (LTR) of the Rous sarcoma virus (Cullen, et al., Molec. Cell. Biol. 5: 438-447 (1985)) plus a fragment of the CMV enhancer ( Boshart, et al., Cell 41: 521-530 (1985)). Multiple cloning sites, for example, with the restriction enzyme cleavage sites BamHI, Xbal, and Asp718, facilitate cloning of the gene of interest. The vectors also contain the 3 'intron, the polyadenylation and termination signal of the rat preproinsulin gene.
ES 2 607 679 T3
Cloning and Expression in CHO Cells
The pC4 vector is used for TNF antibody expression. Plasmid pC4 is a derivative of plasmid pSV2-dhfr (ATCC Accession No. 37146). The plasmid contains the mouse DHFR gene under the control of the SV40 early promoter. Chinese hamster ovary cells or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (eg, alpha-MEM, Life Technologies, Gaithersburg, MD) supplemented with the chemotherapeutic agent methotrexate. Amplification of DHFR genes in methotrexate (MTX) resistant cells has been well documented (see, eg, FW Alt, et al., J. Biol. Chem. 253: 1357-1370 (1978); JL Hamlin L and C. Ma, Biochem. et Biophys. Acta 1097: 107-143 (1990) and MJ Page and MA Sydenham, Biotechnology 9: 64-68 (1991)). Cells grown in increasing concentrations of MTX develop resistance to the drug through overproduction of the target enzyme, DHFR, as a result of amplification of the DHFR gene. If a second gene is linked to the DHFR gene, it is usually co-amplified and overexpressed. It is known in the art that this approach can be used to develop cell lines that carry more than 1,000 copies of the amplified gene (s). Subsequently, when the methotrexate is removed, cell lines are obtained that contain the amplified gene integrated into one or more chromosomes of the host cell.
The plasmid pC4 contains for the expression of the gene of interest the strong promoter of the long terminal repeat (LTR) of the Rous Sarcoma Virus (Cullen, et al., Molec. Cell. Biol 5: 438-447 (1985)) plus an isolated fragment of the human cytomegalovirus (CMV) immediate early gene enhancer (Boshart, et al., Cell 41: 521530 (1985)). Downstream of the promoter are the restriction enzyme cleavage sites BamHI, Xbal and Asp718 that allow the integration of genes. Behind these cloning sites the plasmid contains the 3 'intron and the polyadenylation site of the rat preproinsulin gene. Other high-efficiency promoters can also be used for expression, eg, the human β-actin promoter, SV40 early or late promoters, or the long terminal repeats of other retroviruses, eg, HIV and HTLVI. The Clontech Tet-Off and Tet-On gene expression systems and similar systems can be used to express TNF in a regulated manner in mammalian cells (M. Gossen and H. Bujard, Proc. Natl., Acad. Sci. USA 89: 5547-5551 (1992) Other signals can also be used for polyadenylation of mRNA, for example from human growth hormone or globin genes. Stable cell lines that carry a gene of interest integrated into the chromosomes after cotransfection with a selection marker such as gpt, G418 or hygromycin can also be selected. It is advantageous to use more than one selection marker at the beginning, eg, G418 plus methotrexate.
Plasmid pC4 is digested with restriction enzymes and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The vector is then isolated from a 1% agarose gel.
The isolated variable and constant region encoding DNA and the dephosphorylated vector are then ligated with T4 DNA ligase. Then, E. coli HB101 or XL-1 Blue cells are transformed and bacteria containing the inserted fragment in plasmid pC4 are identified using, for example, restriction enzyme analysis.
Chinese hamster ovary (CHO) cells lacking an active DHFR gene are used for transfection. 5 g of the expression plasmid pC4 is cotransfected with 0.5 g of the plasmid pSV2-neo using lipofectin. The plasmid pSV2neo contains a dominant selection marker, the Tn5 neo gene that encodes an enzyme that confers resistance to a group of antibiotics including G418. Cells are seeded in alpha-MEM supplemented with 1 µg / ml G418. After 2 days, cells are trypsinized and plated on hybridoma cloning plates (Greiner, Germany) in alpha-MEM supplemented with 10, 25 or 50 ng / ml of methotrexate plus 1 µg / ml of G418. After approximately 10-14 days, single clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM). . Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (1mM, 2mM, 5mM, 10mM, 20mM). The same procedure is repeated until clones growing at a concentration of 100-200 mM are obtained. Expression of the desired gene product is analyzed, for example, by SDSPAGE and Western blotting or by reverse phase HPLC analysis.
Example 2: Generation of High Affinity Human IgG Monoclonal Antibodies Reactive with Human TNF Using Transgenic Mice
Summary
Transgenic mice containing human heavy and light chain immunoglobulin genes have been used to generate fully human high affinity monoclonal antibodies that can be used therapeutically to inhibit the action of TNF for the treatment of one or more TNF-mediated diseases. Hybrid (CBA / J x C57BL6 / J) F2 mice containing human variable and constant region antibody transgenes for both heavy and light chains are immunized with recombinant human TNF (Taylor et al., Intl.
ES 2 607 679 T3
Immunol. 6: 579-591 (1993); Lonberg, et al., Nature 368: 856-859 (1994); Neuberger, M., Nature Biotech. 14: 826); Fishwild, et al., Nature Biotechnology 14: 845-851 (1996)). Several fusions produced one or more panels of fully human TNF-reactive IgG monoclonal antibodies. Fully human anti-TNF antibodies were further characterized. They are all lgG1. Such antibodies are observed to have affinity constants between 1 x 10<sup>9</sup> and 9 x 10<sup>12</sup>. The unexpectedly high affinities of these fully human monoclonal antibodies make them suitable candidates for therapeutic applications in TNF-related diseases, pathologies, or disorders.
Abbreviations
BSA - bovine serum albumin CO2 - carbon dioxide DMSO - dimethylsulfoxide EIA - enzyme immunoassay FBS - fetal bovine serum H2O2 - hydrogen peroxide HRP - horseradish peroxidase ID - intradermal Ig - immunoglobulin
TNF - tissue necrosis factor alpha
IP - intraperitoneal IV - intravenous
Mab - monoclonal antibody DO - optical density
OPD - o-phenylenediamine dihydrochloride
PEG - polyethylene glycol PSA - penicillin, streptomycin, amphotericin RT - room temperature
SC - subcutaneous v / v - volume by volume w / v - weight by volume
Materials and methods
Animals
Transgenic mice that can express human antibodies are known in the art (and are commercially available (e.g., from GenPharm International, San Jose, CA; Abgenix, Freemont, CA, et al.) That express human immunoglobulins but not IgM or Ig of mouse. For example, such transgenic mice contain human sequence transgenes that undergo V (D) J binding, heavy chain class change, and somatic mutation to generate a repertoire of human sequence immunoglobulins (Lonberg, et al., Nature 368: 856- 859 (1994)). The light chain transgene can be obtained, for example, in part from a yeast artificial chromosome clone that includes almost half of the human germline V region. Furthermore, the heavy chain transgene can encode both human µ and 1 (Fishwild, et al., Nature Biotechnology 14: 845-851 (1996)) and / or human 3 constant regions. Mice derived from appropriate genotypic lineages can be used in immunization and fusion processes to generate fully human monoclonal antibodies against TNF.
Immunization
One or more immunization schedules can be used to generate the anti-human TNF hybridomas. The first several fusions can be performed after the following illustrative immunization protocol, but other similar known protocols can be used. Several 14-20 week old surgically castrated transgenic male and / or female mice are immunized IP and / or ID with 1-1000 pg of recombinant human TNF emulsified with an equal volume of TITERMAX or complete Freund's adjuvant in a final volume of 100-400 pl (for example, 200). Each mouse can also optionally receive 1-10 pg in 100 µl of physiological saline at each of 2 SC sites. Mice can then be immunized 1-7, 5-12, 10-18, 17-25 and / or 21-34 days later IP (1-400 pg) and SC (1-400 pg x 2) with TNF emulsified with an equal volume of TITERMAX or Freund's Incomplete Adjuvant. Blood samples can be taken from mice 12-25 and 25-40 days later by retroorbital puncture without anticoagulant. The blood is then allowed to clot at room temperature for one hour and the serum is collected and titrated using a TNF EIA assay according to known methods. Fusions are performed when repeated injections do not cause increased titers. At that time, the mice are given a final IV booster injection of 1-400 pg of TNF diluted in 100 µl of physiological saline. Three days later, mice can be euthanized by cervical dislocation and spleens removed aseptically and immersed in 10 μl of cold phosphate-buffered saline (PBS) that
ES 2 607 679 T3 contains 100 U / ml of penicillin, 100 mg / ml of streptomycin and 0.25 mg / ml of amphotericin B (PSA). Splenocytes are harvested by perfusing the spleen sterile with PSA-PBS. Cells are washed once in cold PSA-PBS, counted using Trypan blue dye exclusion, and resuspended in RPMI 1640 medium containing 25 mM Hepes.
Cell Fusion
Fusion can be performed in a 1: 1 to 1:10 ratio of murine myeloma cells to viable spleen cells according to known methods, eg, as is known in the art. As a non-limiting example, spleen cells and myeloma cells can be pelleted together. The pellet can then be slowly resuspended, for 30 seconds, in 1 ml of 50% (w / v) PEG / PBS solution (PEG 1,450 molecular weight, Sigma) at 37 ° C. The fusion can then be stopped by slowly adding 10.5 ml of RPMI 1640 medium containing 25 mM Hepes (37 ° C) over 1 minute. The fused cells are centrifuged for 5 minutes at 500-1500 rpm. The cells are then resuspended in HAT medium (RPMI 1640 medium containing 25 mM Hepes, 10% Fetal Clone I serum (Hyclone), 1 mM sodium pyruvate, 4 mM L-glutamine, 10 mg / ml gentamicin, complement 2.5% Origin culture (Fisher), RPMI 1640 / Hepes medium conditioned with 10% 653, 50 mM 2-mercaptoethanol, 100 mM hypoxanthine, 0.4 mM aminopterin and 16 mM thymidine) and then plated at 200 ml / well in fifteen 96-well flat-bottom tissue culture plates. The plates are then placed in a humidified 37 ° C incubator containing 5% CO2 and 95% air for 7-10 days.
Detection of Human IgG Anti-TNF Antibodies in Mouse Serum
Solid phase ElA can be used to screen mouse sera for human IgG antibodies specific for human TNF. Briefly, plates can be coated with TNF at 2 mg / ml in PBS overnight. After washing in 0.15 M saline containing 0.02% (v / v) Tween 20, the wells can be blocked with 1% (w / v) BSA in PBS, 200 ml / well for 1 hour at room temperature. The plates are used immediately or frozen at -20 ° C for future use. Mouse serum dilutions are incubated on the TNF-coated plates at 50 ml / well at room temperature for 1 hour. Plates are washed and then probed with 50 ml / well HRP-labeled goat anti-human IgG, specific Fc diluted 1: 30,000 in 1% BSAPBS for 1 hour at room temperature. Again, the plates can be washed and 100 ml / well of the citrate-phosphate substrate solution (0.1 M citric acid and 0.2 M sodium phosphate, 0.01% H2O2 and 1 mg / ml OPD) for 15 minutes at room temperature. Stopping solution (4N sulfuric acid) is then added at 25 ml / well and ODs are read at 490 nm by an automated plate spectrophotometer.
Detection of Fully Human Immunoglobulins in Hybridoma Supernatants.
Culture-positive hybridomas secreting fully human immunoglobulins can be detected using a suitable EIA. Briefly, 96-well Pop-out plates (VWR, 610744) can be coated with 10 mg / ml of goat anti-human IgG Fc in sodium carbonate buffer overnight at 4 ° C. Plates are washed and blocked with 1% BSA-PBS for one hour at 37 ° C and used immediately or frozen at -20 ° C. Undiluted hybridoma supernatants are incubated on the plates for one hour at 37 ° C. Plates are washed and probed with HRP-labeled goat anti-human kappa diluted 1: 10,000 in 1% BSA-PBS for one hour at 37 ° C. The plates are then incubated with substrate solution as described above.
Determination of Reactivity of Fully Human Anti-TNF
As above, hybridomas can be simultaneously tested for reactivity against TNF using a suitable RIA or other assay. For example, supernatants are incubated in goat anti-human IgG Fc as above, washed, and then probed with radiolabelled TNF with appropriate counts per well for 1 hour at room temperature. The wells are washed twice with PBS and bound radiolabelled TNF is quantitated using a suitable counter.
Hybridomas secreting anti-TNF human IgG1 can be expanded in cell culture and serially subcloned by limiting dilution. The resulting clonal populations can be expanded and cryopreserved in freezing medium (95% FBS and 5% DMSO) and stored in liquid nitrogen.
Isotyped.
Isotyping of antibodies can be accomplished using an EIA in a format similar to that used to screen mouse immune sera for specific titers. 96-well plates can be coated with TNF as described above and purified antibody at 2 mg / ml can be incubated on the plate for one hour at room temperature. The plate is washed and probed with HRP-labeled goat anti-human IgG1 or HRP-labeled goat anti-human IgG3 diluted 1: 4000 in 1% BSA-PBS for one hour at room temperature. Again, the plate is washed and incubated with substrate solution as described above.
ES 2 607 679 T3
Kinetics of Binding of Human Anti-Human TNF Antibodies with Human TNF
The binding characteristics of antibodies can be suitably assessed using TNF capture EIA and Biacore technology, for example. Sorted concentrations of purified human TNF antibodies can be evaluated for binding to EIA plates coated with 2 mg / ml TNF in assays as described above. The ODs can then be presented as semi-logarithmic representations showing relative binding efficiencies.
Quantitative binding constants can be obtained, for example, as follows or by any other suitable known method. A Biacore CM-5 (carboxymethyl) microplate is placed in a Biacore 2000 unit. HBS buffer (0.01 M HEPES, 0.15 M NaCl, 3 mM EDTA, 0.005% v / v surfactant P20, pH 7) is flushed. , 4) on a microplate flow cell at 5 ml / minute until a stable baseline measurement is obtained. A solution (100 ml) of 15 mg of EDC (N-ethyl-N '- (3-dimethylaminopropyl) -carbodiimide hydrochloride) in 200 μ! of water is added to 100 ml of a solution of 2.3 mg of NHS (N-hydroxysuccinimide) in 200 ml of water. Forty (40) ml of the resulting solution is injected into the microplate. Six ml of a human TNF solution (15 mg / ml in 10 mM sodium acetate, pH 4.8) is injected into the microplate, resulting in an increase of approximately 500 RU. The buffer is changed to TBS / Ca / Mg / BSA processing buffer (20 mM Tris, 0.15 M sodium chloride, 2 mM calcium chloride, 2 mM magnesium acetate, 0.5% Triton X-100, 25 mg / ml BSA, pH 7.4) and flowed over the microplate overnight to equilibrate and to hydrolyze or protect any unreacted succinimide esters.
The antibodies are dissolved in the processing buffer at 33.33, 16.67, 8.33 and 4.17 nM. The flow rate is set at 30 ml / min and the instrument temperature at 25 ° C. Two flow cells are used for kinetic processing, one in which TNF had been immobilized (sample) and a second non-derivatized flow cell (blank). 120 ml of each antibody concentration is injected onto the flow cells at 30 ml / min (association phase), followed by 360 seconds of continuous buffer flow (dissociation phase). The surface of the microplate is regenerated (tissue necrosis factor alpha / antibody complex is dissociated) by two sequential injections of 30 ml each of 2M guanidine thiocyanate.
Data analysis is performed using BIA Evaluation 3.0 or CLAMP 2.0, as is known in the art. For each antibody concentration the blank sensorgram is subtracted from the sample sensorgram. A global adjustment is made for both the dissociation constant (Kd, s<sup>-1</sup>) as for the association (Ka, mol<sup>-1</sup> s<sup>-1</sup>) and the dissociation constant (Kd, mol) (kd / ka) is calculated. When the affinity of the antibody is high enough that the RUs of captured antibody are> 100, further dilutions of the antibody are processed.
Results and Discussion
Generation of Human Anti-TNF Monoclonal Antibodies
Several fusions are performed and each fusion is plated on 15 plates (1440 wells / fusion) that produce several dozen antibodies specific for human TNF. Of these, some are seen to consist of a combination of human and mouse Ig chains. The remaining hybridomas secrete anti-TNF antibodies consisting solely of human heavy and light chains. All of the human hybridomas are expected to be IgG1.
Human Anti-TNF Human Antibody Binding Kinetics
ELISA analysis confirms that antibodies purified from most or all of these hybridomas bind TNF in a concentration-dependent manner. Figures 1-2 show the results of the relative binding efficiency of these antibodies. In this case, the avidity of the antibody for its cognate antigen (epitope) is measured. It should be noted that binding of TNF directly to the EIA plate can cause denaturation of proteins and apparent binding affinities may not reflect binding to denatured protein. Fifty percent binding is observed over a range of concentrations.
Quantitative binding constants are obtained using Biacore analysis of human antibodies and reveal that several of the human monoclonal antibodies have very high affinity for Kd in the 1 x 10 'range.<sup>9</sup> to 7 x 10 '<sup>12</sup>.
Conclusions
Various fusions are performed using splenocytes from hybrid mice containing human constant variable region antibody transgenes that are immunized with human TNF. A pool of several fully human TNF-reactive IgG monoclonal antibodies of the IgG1 isotype is generated. Fully human anti-TNF antibodies are further characterized. Several of the generated antibodies have affinity constants between 1 x 10<sup>9</sup> and 9 x 10<sup>12</sup>. The unexpectedly high affinities of these antibodies
Fully human monoclonal ES 2 607 679 T3 make them suitable for therapeutic applications in TNF-dependent diseases, pathologies or related conditions.
Example 2: Generation of Human IgG Monoclonal Antibodies Reactive to Human TNFa
Summary
Hybrid mice (CBA / J x C57BL / 6J) F2 (1-4) containing human constant and variable region antibody transgenes for both heavy and light chains were immunized with recombinant human TNFa. One fusion, called GenTNV, produced eight fully human IgG1k monoclonal antibodies that bind to immobilized recombinant human TNFa. Shortly after identification, all eight cell lines were transferred to Molecular Biology for further characterization. Since these mAbs are fully human in sequence, they are expected to be less immunogenic than cA2 (Remicade) in humans.
Abbreviations
BSA - bovine serum albumin
CO2 - carbon dioxide
DMSO - dimethylsulfoxide
EIA - enzyme immunoassay
FBS - fetal bovine serum
H2O2 - hydrogen peroxide HRP - horseradish peroxidase ID - intradermal
Ig - immunoglobulin
TNF - tissue necrosis factor alpha
IP - intraperitoneal
IV - intravenous
Mab - monoclonal antibody
DO - optical density
OPD - o-phenylenediamine dihydrochloride
PEG - polyethylene glycol
PSA - penicillin, streptomycin, amphotericin
RT - room temperature
SC - subcutaneous v / v - volume by volume w / v - weight by volume
Introduction
Transgenic mice containing human heavy and light chain immunoglobulin genes were used to generate fully human monoclonal antibodies that are specific for recombinant human TNFa. It is hoped that these unique antibodies can be used, in the same way that cA2 (Remicade) is used to therapeutically inhibit inflammatory processes involved in TNFa-mediated diseases with the benefit of increased serum half-life and decreased side effects in relation to immunogenicity. .
Materials and methods
Animals
Transgenic mice expressing human immunoglobulins, but not mouse IgM or IgK, have been developed by GenPharm International. These mice contain functional human antibody transgenes that undergo V (D) J binding, heavy chain class change, and somatic mutation to generate a repertoire of antigen-specific human immunoglobulins (1). Light chain transgenes are obtained in part from a yeast artificial chromosome clone that includes almost half of the V locus.<sub>K</sub> germ line human. In addition to several VH genes, the heavy chain (HC) transgene encodes both human μ and human γ1 (2) and / or human γ3 constant regions. A mouse obtained from the HCo12 / KCo5 genotypic lineage was used in the immunization and fusion process to generate the monoclonal antibodies described in this document.
Purification of Human TNFa
Human TNFa was purified from C237A cell tissue culture supernatant by affinity chromatography using a column packed with TNFa-Fc receptor fusion protein (p55-sf2) (5) coupled to Sepharose 4B (Pharmacia). The cell supernatant was mixed with one-ninth its volume of 10x Dulbecco's PBS (D-PBS) and passed through the column at 4 ° C at 4 ml / min. The column was then washed with
ES 2 607 679 T3
PBS and TNFa was eluted with 0.1M sodium citrate, pH 3.5 and neutralized with 2M Tris-HCl pH 8.5. The purified TNFa was buffered in 10 mM Tris, 0.12 M sodium chloride, pH 7.5 and filtered through a 0.2 mm syringe filter.
Immunizations
A female GenPharm mouse, approximately 16 weeks old, was immunized IP (200 ml) and ID (100 ml at the base of the tail), with a total of 100 mg of TNFa (lot JG102298 or JG102098) emulsified with a volume equal Titermax adjuvant on days 0, 12 and 28. Blood samples were taken from the mouse on days 21 and 35 by retroorbital puncture without anticoagulant. The blood was allowed to clot at room temperature for one hour and the serum was collected and titrated using a TNFa solid phase EIA assay. The fusion, designated GenTNV, was performed after resting the mouse for seven weeks after the day 28 injection. The mouse, with a specific human IgG titer of 1: 160 against TNFa, was then given an injection of Final IV boost of 50 mg of TNFa diluted in 100 ml of physiological saline. Three days later, the mouse was euthanized by cervical dislocation and the spleen was aseptically removed and immersed in 10 ml of cold phosphate buffered saline (PBS) containing 100 U / ml penicillin, 100 mg / ml streptomycin and 0 , 25 mg / ml of amphotericin B (PSA). Splenocytes were harvested by sterile prefusing the spleen with PSA-PBS. Cells were washed once in cold PSA-PBS, counted using a Coulter counter, and resuspended in RPMI 1640 medium containing 25 mM Hepes.
Cell lines
The non-secretory mouse myeloma fusion partner, 653 was received into the Cell Biology Services (CBS) group on 5-14-97 from the Centocor's Product Development group. The cell line was expanded in RPMI medium (JRH Biosciences) supplemented with 10% (v / v) FBS (Celll Culture Labs), 1 mM sodium pyruvate, 0.1 mM NEAA, 2 mM L-glutamine (all from JRH Biosciences) and cryopreserved in 95% FBS and 5% DMSO (Sigma), then stored in a vapor phase liquid nitrogen freezer at CBS. The cell bank was sterile (Quality Control Centocor, Malvern) and mycoplasma-free (Bionique Laboratories). Cells were kept in log phase culture until fusion. They were washed in PBS, counted and viability (> 95%) determined by exclusion of trypan blue dye before melting.
A recombinant cell line, designated C237A, generated in Molecular Biology at Centocor produced human TNFa. The cell line was expanded in IMDM medium (JRH Biosciences) supplemented with 5% (v / v) FBS (Cell Culture Labs), 2 mM L-glutamine (all from JRH Biosciences) and 0.5 mg / ml mycophenolic acid and cryopreserved in 95% FBS and 5% DMSO (Sigma), then stored in a liquid nitrogen vapor phase freezer in CBS (13). The cell bank was sterile (Quality Control Centocor, Malvern) and mycoplasma-free (Bionique Laboratories).
Cell Fusion
Cell fusion was performed using a 1: 1 ratio of 653 murine myeloma cells and viable murine spleen cells. In summary, spleen cells and myeloma cells pelleted together. The pellet was slowly resuspended over a 30 second period in 1 ml of 50% (w / v) PEG / PBS solution (PEG molecular weight 1,450 g / mol, Sigma) at 37 ° C. Melting was stopped by slowly adding 10.5 ml of RPMI medium (no additives) (JRH) (37 ° C) over 1 minute. The fused cells were centrifuged for 5 minutes at 750 rpm. The cells were then resuspended in HAT medium (RPMI / HEPES medium containing 10% fetal calf serum (JRH), 1 mM sodium pyruvate, 2 mM L-glutamine, 10 mg / ml gentamicin, Origin culture supplement al 2.5% (Fisher), 50 mM 2-mercaptoethanol, RPMI medium conditioned with 1% 653, 100 mM hypoxanthine, 0.4 mM aminopterin and 16 mM thymidine) and then seeded at 200 ml / well in five plates of 96-well flat bottom tissue culture. The plates were then placed in a humidified 37 ° C incubator containing 5% CO2 and 95% air for 7-10 days.
Detection of Human IgG Anti-TNFa Antibodies in Mouse Serum
Solid phase ALS were used to screen mouse sera for human IgG antibodies specific to human TNFa. Briefly, plates were coated with TNFa at 1mg / ml in PBS overnight. After washing in 0.15 M saline containing 0.02% (v / v) Tween 20, the wells were blocked with 1% (w / v) BSA in PBS, 200 ml / well for 1 hour at room temperature. The plates were used immediately or frozen at -20 ° C for future use. Mouse sera were incubated in two-fold serial dilutions on human TNFa coated plates at 50 ml / well at room temperature for 1 hour. The plates were washed and then probed with 50 ml / well of HRP-labeled goat anti-human IgG, specific Fc (Accurate) diluted 1: 30,000 in 1% BSA-PBS for 1 hour at room temperature. Again, the plates were washed and 50 ml / well of the citrate-phosphate substrate solution (0.1 M citric acid and 0.2 M sodium phosphate, 0.01% H2O2 and 1 mg / ml) were added. OPD) for 15 minutes at room temperature. Later
ES 2 607 679 T3 added stop solution (4 N sulfuric acid) at 25 µl / well and ODs were read at 490 nm using an automated plate spectrophotometer.
Detection of Fully Human Immunoglobulins in Hybridoma Supernatants
Because the GenPharm mouse is capable of generating both mouse and human immunoglobulin chains, two separate EIA assays were used to test culture-positive hybridoma clones for the presence of both human light chains and human heavy chains. The plates were coated as described above and the undiluted hybridoma supernatants were incubated on the plates for one hour at 37 ° C. Plates were washed and probed with HRP-conjugated goat anti-human kappa antibody (Southern Biotech) diluted 1: 10,000 in 1% BSA-HBSS or HRP-conjugated goat anti-human IgG Fc specific antibody diluted to 1 : 30,000 in 1% BSA-HBSS for one hour at 37 ° C. The plates were then incubated with substrate solution as described above. Hybridoma clones that did not give a positive signal in both the anti-kappa and anti-human IgG Fc EIA formats were discarded.
Isotyped
Isotyping of the antibodies was accomplished using an EIA in a format similar to that used to screen mouse immune sera for specific titers. The EIA plates were coated with goat anti-human IgG (H + L) in sodium carbonate buffer overnight at 4 ° C and blocked as described above. Pure 24-well culture supernatants were incubated on the plate for one hour at room temperature. The plate was washed and probed with HRP-labeled goat ant-human IgG1, IgG2, IgG3 or IgG4 (Binding Site) diluted 1: 4000 in 1% BSA-PBS for one hour at room temperature. Again, the plate was washed and incubated with substrate solution as described above.
Results and Discussion.
Generation of Fully Human Anti-TNFa Monoclonal Antibodies
One fusion, called GenTNV, was made from a GenPharm mouse immunized with recombinant human TNF-a protein. From this fusion, 196 positive culture hybrids were selected. Eight hybridoma cell lines were identified that secreted fully human IgG antibodies reactive with human TNFa. These eight cell lines each secreted immunoglobulins of the human IgG1k isotype and all were subcloned twice by limiting dilution to obtain stable cell lines (> 90% homogeneous). The cell line names and respective C code designations are listed in Table 1. Each of the cell lines was frozen in 12 vial research cell banks stored in liquid nitrogen.
Parental cells harvested from the wells of a 24-well culture plate for each of the eight cell lines were passed to the Molecular Biology group on 02-18-99 for further transfection and characterization.
Table 1: GenTNV Cell Line Designations
<td>Name</td><td>Code Designation C</td>
<td>GenTNV14.17.12</td><td>C414A</td>
<td>GenTNV15.28.11</td><td>C415A</td>
<td>GenTNV32.2.16</td><td>C416A</td>
<td>GenTNV86.14.34</td><td>C417A</td>
<td>GenTNV118: 3.36</td><td>C418A</td>
<td>GenTNV122.23.2</td><td>C419A</td>
<td>GenTNV148.26.12</td><td>C420A</td>
<td>GenTNV196.9.1</td><td>C421A</td>
Conclution
GenTNV fusion was performed using hybrid mouse splenocytes containing human constant and variable region antibody transgenes that were immunized with recombinant human TNFa prepared in Centocor. Eight fully human TNFa reactive IgG monoclonal antibodies of the IgG1k isotype were generated. Parental cell lines were transferred to the Molecular Biology pool for characterization and further development. One of these new human antibodies may be useful as an anti-inflammatory with the potential benefit of decreased immunogenicity and allergic-type complications compared to Remicade.
Bibliography
ES 2 607 679 T3
1. Taylor, et al., International Immunology 6: 579,591 (1993).
two. Lonberg, et al., Nature 368: 856-859 (1994).
3. Neuberger, M. Nature Biotechnology 14: 826 (1996).
Four. Fishwild, et al., Nature Biotechnology 14: 845-851 (1996).
5. Scallon, et al., Cytokine 7: 759-770 (1995).
Example 3: Cloning and Preparation of Cell Lines Expressing Anti-Human TNFa Antibodies
Summary
A panel of eight human monoclonal antibodies (mAbs) with a TNV designation were found to bind immobilized human TNFa with apparently high avidity. Seven of the eight mAbs were shown to be effective in blocking the binding of huTNFa to a recombinant TNF receptor. Sequence analysis of the DNA encoding the seven mAbs confirmed that all mAbs had human V regions. The DNA sequences also showed that three pairs of the mAbs were identical to each other, such that the original panel of eight mAbs contained only four different mAbs, represented by TNV14, TNV15, TNV148 and TNV196. Based on the analyzes of the deduced amino acid sequences of the mAbs and the results of the in vitro TNFa neutralization data, the mAbs TNV148 and TNV14 were selected for further study.
Because the proline residue at position 75 (flanking region 3) in the TNV148 heavy chain was not found at that position in other human antibodies of the same subgroup during a database search, DNA-directed mutagenesis was performed. to encode a serine residue at that position to match known germline flanking region sequences. The serine modified mAbs were designated TNV148B. The PCR amplified DNA encoding the heavy and light chain variable regions of TNV148B and TNV14 was cloned into freshly prepared expression vectors that were based on the recently cloned heavy and light chain genes of another human mAb (12B75), described in United States patent application filed October 7, 2000, entitled IL-12 Antibodies, Compositions, Methods and Uses.
P3X63Ag8.653 (653) cells or Sp2 / 0-Ag14 (SP2 / 0) mouse myeloma cells were transfected with the respective heavy and light chain expression plasmids and selected through two rounds of subcloning for cell lines that produce high levels of recombinant TNV148B and TNV14 mAbs (rTNV148B and rTNV14) mAbs. Growth curve evaluations and the stability of mAb production over time indicated that the 653 C466D and C466C transfectant clones stably produced approximately 125 mg / ml rTNV148B mAb in depleted cultures while the SP2 transfectant / 0 1.7312-122 (C467A) stably produced approximately 25 mg / ml mAb rTNV148B in depleted cultures. Similar analyzes indicated that the Sp2 / 0 transfectant clone C476A produced 18 mg / ml rTNV14 in depleted cultures.
Introduction
A panel of eight mAbs obtained from GenPhanm / Medarex mice immunized with human TNFa (genotype HCo12 / KCo5) were previously shown to bind human TNFa and to have a fully human IgG1 kappa isotype. A single binding assay was used to determine whether illustrative mAbs of the invention were likely to have TNFa neutralizing activity by evaluating their ability to block the binding of TNFa to the recombinant TNF receptor. Based on those results, DNA sequence results, and in vitro characterizations of several of the mAbs, TNV148 was selected as the mAb to be further characterized.
DNA sequences encoding mAb TNV148 were cloned, modified to fit into gene expression vectors encoding suitable constant regions, introduced into well-characterized 653 and SP2 / 0 mouse myeloma cells, and the resulting transfected cell lines. they were screened until subclones were identified that produced 40 times more mAbs than the original hybridoma cell line.
Materials and methods
Reagents and cells
TRIZOL reagent was purchased from Gibco BRL. Proteinase K was obtained from Sigma Chemical Company. Reverse transcriptase was obtained from Life Sciences, Inc. Taq DNA Polymerase was obtained from Perkin Elmer Cetus or Gibco BRL. Restriction enzymes were purchased from New England Biolabs. The QIAquick PCR Purification Kit was from Qiagen. A QuikChange site-directed mutagenesis kit was purchased from Stratagene. The Wizard plasmid miniprep and RNasin kits were from Promega. Optiplates were obtained from Packard. The <sup>125</sup>Iodine was purchased from Amersham. Custom oligonucleotides were purchased from Keystome / Biosource International. The names, identification numbers and sequences of the oligonucleotides used in this work are shown in Table 1.
ES 2 607 679 T3
Table 1. Oligonucleotides used to clone, engineer or sequence the TNV mAb genes. The amino acids encoded by oligonucleotides 5'14s and HuH-J6 are shown above the sequence. The amino acid residue "M" represents the translation start codon. The underlined sequences in oligonucleotides 5'14s and HuH-J6 mark the BsiWI and BstBI restriction sites, respectively. The bar in HuH-J6 corresponds to the exon / intron boundary. Note that the oligonucleotides whose sequence corresponds to the negative strand are written in a 3'-5 'orientation.
<td>Momore</td><td>ID</td>
<td>HGl-4b</td><td> 119</td>
<td>HGl-5b</td><td> 354</td>
<td>HGlhg</td><td> 360</td>
<td>HG1-6</td><td> 35</td>
<td>HCK1-3E</td><td> 117</td>
<td>HuK-3'Hd</td><td> 208</td>
<td>HVKRNAseq</td><td> 34</td>
<td>5'14s</td><td> 366</td>
<td>5'46s</td><td> 367</td>
<td>5'47s</td><td> 368</td>
<td>5'63s</td><td> 369</td>
<td>5'73s</td><td> 370</td>
<td>HuH-J6</td><td> 388</td>
<td>LK7s</td><td> 362</td>
<td>LVgs</td><td> 363</td>
<td>HuL-J3</td><td> 380</td>
<td>V148-QC1</td><td> 399</td>
<td>V148-QC2</td><td> 400</td>
Sequence
3'-TTGGTCCAGTCGGACTGG-5 '
3'-CACCrGCACTCGGTGdT-5 '
3'-CACTGmTGAGTGTGTACGGGCTTAAGTT-5 '
3'-G € CGCACGTGTGGAAGGG-5 '
3'-AGTCAAGGTCGGACTGGCTTAAGTT-5 '
3'-GTTGTCCCCTCTCACAATCTTCGAATTT-5 '
3'-GGCGGTAGACTACTCGTC-5 '
BsiWI
MDWTWSI
5-TTTCGTACGCCACCATGGACTGGACCTGGAGCATC-3 '
5 '-' nTCGTACGCCACCATGGGGTITGGGCTGAGCTG-3 '
S'-TTTCGTACGCCACCATGGAGTITGGGCTGAGCATG-r
S'-TTTCGTACGCCACCAIXjAAACACCTGTGGTrCITC-y
5'-TTTCGTACGCCACCATGGGGTCAACCGCCATCCTC-3 '
TV TVSS
BstBI
3'-GTGCCAGTGGCAGAGGAGTC / CATTCAAGCTTAAGTT-5 '
I left MDMRV
S'-TITGTCGACACCATGGACATGAGGGTCCíTCIC-y
5'-TTTGTCGACACCATGGAAGCCCCAGCTC-3 '
AfÉ
3'CTGGTTTCACCTATAGTTTG / CATTCAGAATrCGGCGCCTrT
5'-CATCTCCAGAGACAATtCCAAGAACACGCTGTATC-3 *
3'-GTAGAGGTCTCTGTTAaGGTTCTTGTGCGACATAG-5 '
A single frozen vial of 653 mouse myeloma cells was obtained. The vial was thawed that day and expanded in T-flasks in IMDM, 5% FBS, 2 mM glutamine (media). These cells were kept in continuous culture until they were transfected 2 to 3 weeks later with the anti-TNF DNA described herein. Some of the cultures were harvested 5 days after the thaw date, pelleted by centrifugation and resuspended in 95% FBS, 5% DMSO, aliquoted into 30 vials,
ES 2 607 679 T3 were frozen and stored for future use. Similarly, a single frozen vial of SP2 / 0 mouse myeloma cells was obtained. The vial was thawed, a new freeze was prepared as described above and the frozen vials were stored in the CBC AA and AB freezer boxes. These cells were thawed and used for all SP2 / 0 transfections described herein.
Assay for Inhibition of TNF Receptor Binding
Hybridoma cell supernatants containing the TNV mAbs were used to test the ability of the mAbs to block the binding of labeled TNFa. <sup>125</sup>I to the recombinant TNF receptor fusion protein, p55-sf2 (Scallon et al. (1995) Cytokine 7: 759-770). 50 ml of p55-sf2 at 0.5 mg / ml in PBS was added to Optiplates to coat the wells during a one hour incubation at 37 ° C. Serial dilutions of the eight TNV cell supernatants were prepared in 96-well round bottom plates using PBS / 0.1% BSA as a diluent. The cell supernatant containing anti-IL18 mAb was included as a negative control and the same anti-IL18 supernatant with additions of cA2 (chimeric anti-TNF antibody, Remicade, US Patent No. 5,770,198) was included as a control. positive. TNFa labeled with<sup>125</sup>I (58 mCi / mg, D. Shealy) at 100 μ! of cell supernatants to have a final TNFa concentration of 5 ng / ml. The mixture was pre-incubated for one hour at RT. The coated Optiplates were washed to remove unbound p55-sf1 and 50 ml of the TNFa mix.<sup>125</sup>I / cell supernatant was transferred to the Optiplates. After 2 h at RT, the Optiplates were washed three times with PBS-Tween. 100 ml of Microscint-20 was added and the bound cpm was determined using the TopCount gamma counter.
V Gene Amplification and DNA Sequence Analysis
The hybridoma cells were washed once in PBS before the addition of TRIZOL reagent for RNA preparation. Between 7 x 10<sup>6</sup> and 1.7 x 10<sup>7</sup> cells were resuspended in 1 ml of TRIZOL. The tubes were vigorously shaken after the addition of 200 ml of chloroform. The samples were centrifuged at 4 ° C for 10 minutes. The aqueous phase was transferred to a new microcentrifuge tube and an equal volume of isopropanol was added. The tubes were vigorously shaken and allowed to incubate at room temperature for 10 minutes. The samples were then centrifuged at 4 ° C for 10 minutes. The pellets were washed once with 1 ml of 70% ethanol and dried briefly in a vacuum drier. The RNA pellets were resuspended with 40 ml of DEPC-treated water. The quality of the RNA preparations was determined by fractionating 0.5 ml on a 1% agarose gel. RNA was stored in a -80 ° C freezer until use.
To prepare heavy and light chain cDNA, mixtures were prepared including 3 ml of RNA and 1 mg of oligonucleotide 119 (heavy chain) or oligonucleotide 117 (light chain) (see Table 1) in a volume of 11.5 ml. The mixture was incubated at 70 ° C for 10 minutes in a water bath and then cooled on ice for 10 minutes. A separate mixture was prepared consisting of 2.5 ml of 10X reverse transcriptase buffer, 10 ml of 2.5 mM dNTP, 1 ml of reverse transcriptase (20 units) and 0.4 ml of RNasin ribonuclease inhibitor (1 unit ). 13.5 ml of this mixture was added to the 11.5 ml of the chilled RNA / oligonucleotide mixture and the reaction was incubated for 40 minutes at 42 ° C. The cDNA synthesis reaction was then stored in a -20 ° C freezer until use.
The unpurified heavy and light chain cDNAs were used as templates to PCR amplify the variable region coding sequences. Five pairs of oligonucleotides (366/354, 367/354, 368/354, 369/354 and 370/354, Table 1) were tested simultaneously for their ability to amplify the heavy chain DNA primer. Two pairs of oligonucleotides (362/208 and 363/208) were tested simultaneously for their ability to amplify by light chain DNA primer. PCR reactions were performed using 2 units of PLATMUM ™ high fidelity Taq DNA polymerase (HIFI) in a total volume of 50 ml. Each reaction included 2 ml of a cDNA reaction, 10 pmol of each oligonucleotide, 0.2 mM dNTP, 5 ml of 10X HIFl buffer, and 2 mM magnesium sulfate. The thermal cycler program was 95 ° C for 5 minutes followed by 30 cycles of (94 ° C for 30 seconds, 62 ° C for 30 seconds, 68 ° C for 1.5 minutes). This was followed by a final incubation at 68 ° C for 10 minutes.
To prepare the PCR products for direct DNA sequencing, they were purified using the QIAquick ™ PCR Purification Kit according to the manufacturer's protocol. DNA was eluted from the spin column using 50 ml of sterile water and then dried to a volume of 10 ml using a vacuum drier. DNA sequencing reactions were then adjusted with 1 ml of purified PCR product, 10 mM oligonucleotide primer, 4 ml of prepared BigDye Terminator ™ reaction mix, and 14 ml of sterile water for a total volume of 20 ml. Heavy chain PCR products prepared with oligonucleotide pair 367/354 were sequenced with oligonucleotide primers 159 and 360. Light chain PCR products prepared with oligonucleotide pair 363/208 were sequenced with oligonucleotides 34 and 163. The thermocycler program for sequencing was 25 cycles of (96 ° C for 30 seconds, 50 ° C for 15 seconds, 60 ° C for 4 minutes) followed by 4 ° C overnight. The reaction products were fractionated through a polyacrylamide gel and detected using an ABI 377 DNA sequencer.
ES 2 607 679 T3
Directed Mutagenesis to Change an Amino Acid
A single nucleotide in the TNV148 heavy chain variable region DNA sequence was changed to replace Pro<sup>75</sup> with a Serine residue on the TNV148 mAb. Complementary oligonucleotides, 399 and 400 (Table 1) were designed and ordered to make this change using the unique BsiWI cloning site just upstream of the translation start site, following the manufacturer's protocol. The resulting plasmid was named p1747. To introduce a BstBI site at the 3 'end of the variable region, a 5' oligonucleotide primer was designed with SaII and BstBI sites. This primer was used with the reverse primer pUC to amplify a 2.75 kb fragment of p1747. This fragment was then cloned back into the naturally occurring Sall site in the 12B75 variable region and a HindIII site, thereby introducing the unique BstBI site. The resulting intermediate vector, designated p1750, could accept variable region fragments with BsiWI and BstBI ends. To prepare a version of the heavy chain vector in which the constant region was also derived from the 12B75 gene, the BamHI-Hindlll insert in p1750 was transferred to pBR322 to have an EcoRI site downstream of the HindIII site. The resulting plasmid, p1768, was then digested with HindIII and EcoRI and ligated into a 5.7 kb HindIII-EcoRI fragment from p1744, a subclone obtained by cloning the large BamHI-BamHI fragment from p1560 into pBC. The resulting plasmid, p1784, was then used as a vector for TNV Ab cDNA fragments with BsiWI and BstBI ends. Additional work was done to prepare expression vectors, p1788 and p1798, which include the IgG1 constant region of the 12B75 gene and differ from each other in how much of the 12B75 heavy chain JC intron they contain.
To modify the 12B75 light chain gene in plasmid p1558, a 5.7 kb Sall / Aflll fragment containing the promoter and variable region of 12B75 was transferred from p1558 to the Xhol / AfIII sites of plasmid L28. This new plasmid, p1745, provided a smaller template for the mutagenesis step. Oligonucleotides (C340sall and C340sal2) were used to introduce a unique SaII restriction site at the 5 'end of the variable region by QuikChange ™ mutagenesis. The resulting intermediate vector, p1746, had unique SaII and Aflll restriction sites into which variable region fragments could be cloned. Any variable region fragment cloned into p1746 would preferably bind to the 3 'half of the light chain gene. To prepare a restriction fragment from the 3 'half of the 12B75 light chain gene that could be used for this purpose, oligonucleotides BAHN1 and BAHN-2 hybridized to each other to form a double-stranded linker containing the restriction sites BsiW1, Aflll , Hindll and Notl and that it contained ends that could be ligated at Kpnl and Sacl sites. This linker was cloned between the Kpnl and Sacl sites of pBC to produce plasmid p1757. A 7.1 kb fragment containing the 12B75 light chain constant region generated by digesting p1558 with Aflll, and then partially digesting with HindIII, was cloned between the Aflll and Hindll sites of p1757 to produce p1762. This new plasmid contained unique sites for BsiWI and Aflll where the BsiWI / Aflll fragment containing the promoter and variable regions could be transferred by joining the two halves of the gene.
Cloning and Assembly of cDNA from Expression Plasmids
All RT-PCR reactions (see above) were treated with Klenow enzyme to further fill in the DNA ends. The heavy chain PCR fragments were digested with restriction enzymes BsiWI and BstBI and then cloned between the BsiWI and BstBI sites of plasmid L28 (L28 was used because the intermediate vector based on 12B75 p1750 had not yet been prepared). DNA sequence analysis of the cloned inserts showed that the resulting constructs were correct and that no errors had been introduced during the PCR amplifications. The assigned identification numbers for these L28 plasmid constructs (for TNV14, TNV15, TNV148, TNV148B and TNV196) are shown in Table 2.
The BsiWI / BstBI inserts for the TNV14, TNV148 and TNV148B heavy chains were transferred from the L28 vector to the freshly prepared intermediate vector, p1750. The identification numbers assigned for these intermediate plasmids are shown in Table 2. This cloning step and subsequent steps were not performed for TNV 15 and TNV 196. The variable regions were then transferred into two different human IgG1 expression vectors. . The restriction enzymes EcoRI and HindIII were used to transfer the variable regions into Centocor's previously used IgG1 vector, p104. The resulting expression plasmids, encoding an IgG1 of the Gm (f +) allotype, were named p1781 (TNV14), p1782 (TNFV148) and p1783 (TNV148B) (see Table 2). Variable regions were also cloned upstream of the IgG1 constant region obtained from the 12B75 gene (GenPharm). Those expression plasmids, which encode an IgG1 of the Glm (z) allotype, are also listed in Table 2.
ES 2 607 679 T3
Table 2. Plasmid identification numbers for various heavy and light chain plasmids. The L28 vector or pBC vector represents the initial Ab cDNA clone. The inserts in those plasmids were transferred into an incomplete 12B75-based vector to prepare the intermediate plasmids. An additional transfer step resulted in the final expression plasmids, which were either introduced into cells after linearization or used to purify the mAb gene inserts prior to cell transfection. (NR) = not done.
<td rowspan="2">mAb</td><td colspan="4">Plasmid ID Plasmid ID Plasmid ID Plasmid ID</td>
<td>vector L28</td><td>Intermediate</td><td>Gm expression (f +)</td><td>expression Glm (z)</td>
<td colspan="2">Heavy Chains</td><td></td><td></td><td></td>
<td>TNFV14</td><td>p1751</td><td>p1777</td><td>p1781</td><td>P1786</td>
<td>TNV15</td><td>p1752</td><td>(ND)</td><td>(ND)</td><td>(ND)</td>
<td>TNV148</td><td>p1753</td><td>p1778</td><td>p1782</td><td>p1787</td>
<td>TNV148B</td><td>p1760</td><td>p1779</td><td>p1783</td><td>p1788</td>
<td>TNV196</td><td>p1754</td><td>(ND)</td><td>(ND)</td><td>(ND)</td>
<td></td><td></td><td>Plasmid ID</td><td>Plasmid ID</td><td>Plasmid ID of</td>
<td></td><td></td><td>pBC vector</td><td>Intermediate</td><td>expression</td>
<td colspan="2">Light Chains</td><td></td><td></td><td></td>
<td>TNV14</td><td></td><td>p1748</td><td>p1755</td><td>p1775</td>
<td>TNV15</td><td></td><td>p1748</td><td>p1755</td><td>p1775</td>
<td>TNV148</td><td></td><td>p1749</td><td>p1756</td><td>p1776</td>
<td>TNV196</td><td></td><td>p1749</td><td>p1756</td><td>p1776</td>
The light chain PCR products were digested with restriction enzymes Sall and Sacll and then cloned between the SaII and Sacll sites of plasmid pBC. The two different versions of the light chain, which differed by one amino acid, were named p1748 and p1749 (Table 2). DNA sequence analysis confirmed that these constructs had the correct sequences. The Sall / Aflll fragments in p1748 and p1749 were then cloned between the SalI and Aflll sites of the intermediate vector p1746 to prepare p1755 and p1756, respectively. These 5 'halves of the light chain genes were then joined to the 3' halves of the gene by transferring the BsiWI / Aflll fragments from p1755 and p1756 to the fresh construct p1762 to prepare the final expression plasmids p1775 and p1776, respectively (Table two).
Cell Transfections, Screening and Subcloning
A total of 15 mouse myeloma cell transfections were performed with the various TNV expression plasmids (see Table 3 in the Results and Discussion section). These transfections were distinguished in that (1) the host cells were SP2 / 0 or 653; (2) the heavy chain constant region was encoded by Centocor's previous IgG1 vector or the 12B75 heavy chain constant region; (3) the mAb was TNV148B, TNV 148, TNV14, or a new HC / LC combination; (4) whether the DNA was a linearized plasmid or purified AB gene insert and (5) the presence or absence of the full JC intron sequence in the heavy chain gene. Furthermore, several of the transfections were repeated to increase the probability that a large number of clones could be screened.
Each of the SP2 / 0 cells and 653 cells were transfected with a mixture of heavy and light chain DNA (8-12 mg each) by electroporation using standard conditions as previously described (Knight, DM et al. (1993 ) Molecular Immunology 30: 1443-1453). For transfection numbers 1, 2, 3, and 16, the appropriate expression plasmids were linearized by restriction enzyme digestion prior to transfection. For example, restriction enzymes SalI and NotI were used to linearize the TNV148B heavy chain plasmid p1783 and the light chain plasmid p1776, respectively. For the remaining transfections, DNA inserts containing only the mAb gene were removed from the plasmid vector by digesting the heavy chain plasmids with BamHI and light chain plasmids, with BsiWI and NotI. The mAb gene inserts were then purified by agarose gel electrophoresis and Qiex purification resins. Cells transfected with purified gene inserts were co-transfected with 3-5 mg of PstI-linearized plasmid pSV2gpt (p13) as a source of selection marker. After electroporation, cells were seeded in 96-well tissue culture plates in IMDM, 15% FBS, 2 mM glutamine and incubated at 37 ° C in a 5% CO 2 incubator. Two days later, an equal volume of IMDM, 5% FBS, 2 mM glutamine, 2X MHX selection (1X MHX = 0.5 mg / ml mycophenolic acid, 2.5 mg / ml hypoxanthine, 50 mg / ml xanthine) and the plates were incubated for an additional 2-3 weeks while colonies were forming.
Cell supernatants collected from wells with colonies were assayed for human IgG by ELISA as described. Briefly, various dilutions of cell supernatants were incubated in 96-well EIA plates with polyclonal goat anti-human IgG Fc fragment and bound human IgG was then detected using conjugated goat anti-human IgG (H + L). Alkaline Phosphatase and appropriate color substrates. Standard curves, which used as a standard the same purified mAb that was being measured in the cell supernatants, were included in each EIA plate to enable quantification of human IgG in the supernatants. Cells in those colonies that appeared to produce the majority of human IgG were passaged
ES 2 607 679 T3 24-well plates for additional production determinations in depleted cultures and the highest producing parental clones were subsequently identified.
Higher producing parental clones were subcloned to identify higher producing subclones and to prepare a more homogeneous cell line. 96-well tissue culture plates were seeded with one cell per well or four cells per well in IMDM, 5% FBS, 2 mM glutamine, 1 X MHX and incubated at 37 ° C in a 5% CO2 incubator. for 12 to 20 days until colonies were evident. Cell supernatants were collected from wells containing one colony per well and analyzed by ELISA as described above. The selected colonies were plated in 24-well plates and the cultures were allowed to drain before the highest producing subclones were identified by quantifying the levels of human IgG in their supernatants. This process was repeated when selected first round subclones underwent a second round of subcloning. The best second cycle clones were selected as the cell lines for development.
Characterization of Cell Subclones
The best second cycle subclones were chosen and growth curves were made to evaluate the production of mAb levels and cell growth characteristics. T75 flasks were seeded with 1 x 10<sup>5</sup> cells / ml in 30 ml of IMDM, 5% FbS, 2 mM glutamine and 1X MHX (or medium without serum). 300 ml aliquots were taken at 24 h intervals and live cell density determined. The analyzes continued until the number of living cells was less than 1 x 10<sup>5</sup> cells / ml. Aliquots collected from cell supernatants were tested to determine the concentration of antibody present. ELISA assays were performed using a rTNV148B or rTNV14 JG92399 standard. Samples were incubated for 1 hour in ELISA plates coated with polyclonal Fc goat anti-human IgG and bound mAb detected with goat anti-human IgG (H + L) antibody conjugated to alkaline phosphatase at a 1: 1000 dilution. .
A different growth curve analysis was also performed for two cell lines for the purpose of comparing growth rates in the presence of varying amounts of selection with MHX. Cell lines C466A and C466B were thawed in MHX-free media (IMDM, 5% FBS, and 2 mM glutamine) and cultured for an additional two days. The two cell cultures were then divided into three cultures that did not contain MHX or contained 0.2X MHX or 1X MHX (1X MHX = 0.5 mg / ml mycophenolic acid, 2.5 mg / ml hypoxanthine and 50 mg / ml xanthine). One day later, new T75 flasks were seeded with the cultures at an initial density of 1 x 10<sup>5</sup> cells / ml and cells were counted at 24 hour intervals for one week. Aliquots for mAb production were not collected. Doubling times were calculated for these samples using the formula provided in SOP PD32.025.
Additional studies were conducted to assess the stability of mAb production over time. Cultures were grown in 24-well plates in IMDM, 5% FBS, 2 mM glutamine, with or without MHX selection. The cultures were separated into new cultures the moment they became confluent and then the older culture was allowed to deplete. At this time, an aliquot of supernatant was taken and stored at 4 ° C. Aliquots were taken over a 55-78 day period. At the end of this period the supernatants were assayed for the amount of antibody present by the anti-human IgG Fc ELISA as described above.
Results and Analysis
Inhibition of TNF Binding to Recombinant Receptor
A simple binding assay was performed to determine whether the eight TNV mAbs that were contained in the hybridoma cell supernatant were capable of blocking TNFα receptor binding. The concentrations of the TNV mAbs in their respective cell supernatants were first determined by standard ELISA analysis for human IgG. Then, a recombinant p55 IgG / TNF receptor fusion protein, p55-Sf2, was coated onto EIA plates and TNFα-labeled <sup>125</sup>I bound to the p55 receptor in the presence of varying amounts of TNV mAbs. As shown in Figure 1, all but one (TNV122) of the eight TNV mAbs effectively blocked the binding of TNFα to the p55 receptor. In fact, TNV mAbs appeared to be more effective in inhibiting TNFa binding than the cA2 positive control mAb that had been added in known amounts to the negative control hybridoma supernatant. These were interpreted to indicate that TNV mAbs were highly likely to block TNFα bioactivity in cell-based and in vivo assays, and therefore further analyzes were warranted.
DNA Sequence Analysis
Confirmation that RNAs Encode Human mAbs
As a first step in the characterization of the seven TNV mAbs (TNV14, TNV15, TNV32, TNV86,
ES 2 607 679 T3
TNV118, TNV148 and TNV196) that showed TNFa blocking activity in the receptor binding assay, total RNA was isolated from the seven hybridoma cell lines that produce these mAbs. Each RNA sample was then used to prepare human antibody heavy or light chain cDNA that included the complete signal sequence, the complete variable region sequence, and part of the constant region sequence for each mAb. These cDNA products were then amplified in PCR reactions and the PCR amplified DNA was directly sequenced without first cloning the fragments. The sequenced heavy chain cDNAs were more than 90% identical to one of the five human germline genes present in the mice, DP-46 (Figure 2). Similarly, the sequenced light chain cDNAs had 100% or 98% identity to one of the human germline genes present in mice (Figure 3). These sequence results confirmed that the RNA molecules that were transcribed into cDNA and sequenced encoded human antibody heavy chains and human antibody light chains. It should be noted that, because the variable regions were amplified by PCR using oligonucleotides that are located at the 5 'end of the coding sequence of the signal sequence, the first amino acids of the signal sequence may not be the actual sequence of the signals. original TNV translation products, but represent the actual sequences of recombinant TNV mAbs.
Unique Neutralizing mAbs
Analysis of the cDNA sequences for the complete variable regions of both the heavy and light chains for each mAb revealed that TNV32 is identical to TNV15, TNV118 is identical to TNV14, and TNV86 is identical to TNV148. The receptor binding assay results were consistent with DNA sequence analyzes, ie, both TNV86 and TNV148 were approximately 4 times better than both TNV118 and TNV14 at blocking TNF binding. Therefore, subsequent work has focused not only on the four unique TNV mAbs, TNV14, TNV15, TNV148, and TNV196.
Ratio of the Four mAbs
The DNA sequence results revealed that all the genes encoding the heavy chains of the four TNV mAbs were highly homologous to each other and appeared to have been derived from the same germline gene, DP-46 (Figure 2). Furthermore, because all the heavy chain CDR3 sequences are so similar and of the same length, and because they all use exon J6, they apparently originated from a single single VDJ gene transposition event that later it was followed by somatic changes that made each mAb unique. DNA sequence analysis revealed that there were only two different light chain genes among the four mAbs (Figure 3). The light chain variable region coding sequences in TNV14 and TNV15 are identical to each other and to a representative germline sequence of the Vg / 38K family of human kappa chains. The TNV148 and TNV196 light chain coding sequences are identical to each other but differ from the germline sequence at two nucleotide positions (Figure 3).
The deduced amino acid sequences of the four mAbs revealed the relationship of the actual mAbs. The four mAbs contain four different heavy chains (Figure 4), but only two different light chains (Figure 5). The differences between the TNV mAb sequences and the germline sequences were mostly confined to the CDR domains, but three of the mAb heavy chains also differed from the germline sequence in the flanking regions (Figure 4 ). Compared to the DP-46 germline encoded Ab flanking regions, TNV14 was identical, TNV15 differed by one amino acid, TNV148 differed by two amino acids, and TNV196 differed by three amino acids.
CDNA Cloning, Targeted Mutagenesis and Assembly of End Expression Plasmids
CDNA cloning
Based on the DNA sequence of the variable regions amplified by PCR, new oligonucleotides were ordered to perform another cycle of PCR amplification in order to adapt the coding sequence to be cloned into expression vectors. In the case of heavy chains, the products of this second round of PCR were digested with restriction enzymes BsiWI and BstBI and cloned into the plasmid vector L28 (plasmid identification numbers are shown in Table 2). In the case of light chains, the second cycle PCR products were digested with Sali and Aflll and cloned into the plasmid vector pBC. The individual clones were then sequenced to confirm that their sequences were identical to the previous sequence obtained from direct sequencing of PCR products, revealing the most abundant nucleotide at each position in a potentially heterogeneous population of molecules.
Directed Mutagenesis to Change TNV148
TNV148 and TNV196 mAbs were consistently observed to be four times more potent than the closest best mAb (TNV14) in neutralizing TNFa bioactivity. However, as described above, the heavy chain flanking sequences of TNV148 and TNV196 differed from the sequences
ES 2 607 679 T3 germline flankings. A comparison of the TNV148 heavy chain sequence with other human antibodies indicated that many other human mAbs contained the Ile residue at position 28 in flank 1 (counting only the mature sequence), while the Pro residue at position 75 in flank 3 was an unusual amino acid at that position.
A similar comparison of the TNV196 heavy chain suggested that the three amino acids in which it differs from the germline sequence on flank 3 may be rare in human mAbs. There was a possibility that these differences could render TNV148 and TNV196 immunogenic if administered to humans. Because TNV148 had only one amino acid residue of interest and this residue was believed to be unimportant for TNF binding, a site-directed mutagenesis technique was used to change a single nucleotide in the TNV148 heavy chain coding sequence (in the plasmid p1753) to encode a germline Ser residue in place of the Pro residue at position 75. The resulting plasmid was named p1760 (see Table 2). The resulting mAb and gene were named TNV148B to distinguish them from the original TNV148 gene and mAbs (see Figure 5).
Final Expression Plasmid Assembly
New antibody expression vectors were prepared which were based on the 12B75 heavy chain and light chain genes previously cloned as genomic fragments. Although different TNV expression plasmids were prepared (see Table 2), in each case the 5 'flanking sequences, the promoter and the intron enhancer were derived from the respective 12B75 genes. For light chain expression plasmids, the entire JC intron, constant region coding sequence, and 3 'flanking sequence were also derived from the 12B75 light chain gene. For the heavy chain expression plasmids that resulted in the final production cell lines (p1781 and p1783, see below), the human IgG1 constant region coding sequences were obtained from the previously used expression vector from Centocor ( P104). Importantly, the final production cell lines presented herein express a different allotype (Gm (f +)) from the original hybridoma derived TNV mAbs (G1m (z)). This is because the 12B75 heavy chain gene obtained from GenPharm mice encodes an Arg residue at the C-terminus of the CH1 domain while the Centocor P104 IgG1 expression vector encodes a Lys residue at that position. Other heavy chain expression plasmids (e.g., p1786 and p1788) were prepared in which the JC intron, the entire constant region coding sequence, and the 3 'flanking sequence were derived from the 12B75 heavy chain gene, but cell lines transfected with those genes were not selected as production cell lines. The vectors were carefully designed to allow one-step cloning of future PCR-amplified V regions that could result in final expression plasmids.
The PCR amplified variable region cDNAs were transferred from the L28 or PBC vectors to 12,875 base middle phase vectors which provided the promoter region and part of the JC intron (see Table 2 for plasmid identification numbers). The restriction fragments containing the 5 'half of the antibody genes were then transferred from these intermediate phase vectors to the final expression vectors that provided the 3' half of the respective genes to form the final expression plasmids (see Table 2 the plasmid identification numbers).
Cell Transfections and Subcloning
Expression plasmids were linearized by restriction digestion or the antibody gene inserts in each plasmid were purified by separating the plasmid structures. The mouse myeloma cells SP2 / 0 and 653 were transfected with the heavy and light chain DNA by electroporation. Fifteen different transfections were performed, most of which were unique as defined by the Ab, the specific characteristics of the Ab genes, whether the genes were on linearized whole plasmids or purified gene inserts, and the host cell line (summarized in Table 3). Cell supernatants from mycophenolic acid resistant clones were assayed for the presence of human IgG by ELISA and quantitated using purified rTNV148B as a reference standard curve.
Highest Production rTNV148B Cell Lines
Ten of the rTNV148B transfection 2 transfection 2 653 parental lines were subcloned (produced 5-10 mg / ml in 24-well depleted cultures) to select for the best producer cell lines and to prepare a more homogeneous cell population. Two of these subclones from parental line 2,320, 2,320-17 and 2,320-20 produced approximately 50 mg / ml in depleted 24-well cultures, which was a 5-fold increase over their parental line. A second cycle of subcloning of subcloned lines 2,320-17 and 2,320-20 led to
ES 2 607 679 T3
Table 3. Summary of Cell Transfections. The identification numbers of the heavy and light chain plasmids encoding each mAb are shown. In the case of transfections made with purified mAb gene inserts, plasmid p13 (pSV2gpt) was included as a source of the gpt selection marker. The heavy chain constant regions were encoded by the same human IgG1 expression vector used to encode Remicade ("old") or by the constant regions contained within the 12B75 heavy chain gene (GenPharm / Medarex) ("new") . H1 / L2 refers to a "new" mAb made up of the TNV14 heavy chain and the TNV148 light chain. Plasmids p1783 and p1801 differ only in how much of the JC intron their heavy chain genes contain. The transfection numbers, which define the first number of the generic names for the cell clones, are shown on the right. The rTNV148B producing cell lines C466 (A, B, C, D) and C467A described in this document were obtained from transfection number 2 and 1, respectively. The rTNV14 C476A producing cell line was obtained from transfection number 3.
<td rowspan="2">mAb</td><td rowspan="2">HC / LC / gpt plasmids</td><td rowspan="2">HC vector</td><td rowspan="2">DNA format</td><td colspan="2">Transfection No.</td>
<td>by Sp2 / 0</td><td> 652</td>
<td>rTNV148B</td><td> 1783/1776</td><td>Old</td><td>Linear</td><td> 1</td><td> 2</td>
<td>rTNV14</td><td> 1781/1775</td><td>Old</td><td>Linear</td><td> 3</td><td> -</td>
<td>rTNV14</td><td> 3.27-1</td><td>C476A</td><td>Sp2 / 0</td><td></td><td>19 mg / ml</td>
Characterization of Subcloned Cell Lines
To more carefully characterize cell line growth characteristics and determine mAb production levels on a larger scale, growth curve analyzes were performed using T75 cultures. The results demonstrated that each of the four C466 series of cell lines reached a peak cell density between 1.0 X 10<sup>6</sup> and 1.25 x 10<sup>6</sup> cells / ml and maximum mAb accumulation levels between 110 and 140 mg / ml (Figure 7). In contrast, the best-producing SP2 / 0 subclone, C467A, reached a maximum cell density of 2.0 x 10<sup>6</sup> cells / ml and maximum mAb accumulation levels of 25 mg / ml (Figure 7). A growth curve analysis was not performed on the rTNV14 producing cell line, C476A.
Additional growth curve analysis was performed to compare growth rates at different MHX selection concentrations. This comparison was driven by recent observations that C466 cells grown in the absence of MHX appeared to grow faster than the same cells grown in the normal amount of MHX (1X). Because cytotoxic concentrations of compounds such as mycophenolic acid tend to
To be measured over orders of magnitude, it was considered possible that using a lower concentration of MHX could result in significantly faster cell doubling times without sacrificing the stability of mAb production. Cell lines C466A and C466B were grown in: no mHx, 0.2X MHX or 1X MHX. Live cell counts were taken at 24 hour intervals for 7 days. The results revealed a cell growth rate dependent on the MHX concentration (Figure 8). The C466A cell line showed a doubling time of 25.0 hours in 1X MHX but only 20.7 hours without MHX. Similarly, the C466B cell line showed a doubling time of 32.4 hours in 1X MHX but only 22.9 hours without MHX. More importantly, the doubling times for both cell lines in 0.2X MHX were more similar to what has been observed without MHX than in 1X MHX (Figure 8). This observation raises the possibility that enhanced cell yield in bioreactors, for which doubling times are an important parameter, could be achieved using less MHX. However, while stability test results (see below) suggest that the C466D cell line is capable of stably producing rTNV148B for at least 60 days even without MHX present, the stability test also showed production levels. Higher mAbs when cells were grown in the presence of MHX compared to the absence of MHX.
To evaluate the mAb production of the various cell lines over a period of approximately 60 days, stability assays were performed on cultures containing or not containing, MHX selection. Not all cell lines maintained high mAb production. After just two weeks of culture, clone C466A was producing approximately 45% less than at the beginning of the study. The production of clone C466B also appeared to be significantly reduced. However, clones C466C and C466D maintained a fairly stable production, with C466D showing the highest absolute production levels (Figure 9).
Conclution
From an initial panel of eight human mAbs against TNFa, TNV148B was selected as preferred based on several criteria including protein sequence and neutralizing potency of TNF, as well as TNV14. Cell lines were prepared that produced more than 100 mg / ml rTNV148B and 19 mg / ml rTNV14.
ES 2 607 679 T3
Example 4: Study of Arthritic Mice Using Anti-TNF Antibodies and Controls Using a Single Bolt Injection.
At approximately 4 weeks of age, Tg197 study mice were assigned, based on gender and body weight, to one of nine treatment groups and were treated with a single intraperitoneal bolus dose of Dulbecco's PBS (D-PBS) or a anti-TNF antibody of the present invention (TNV14, TNV148 or TNV196) at 1 mg / kg or 10 mg / kg.
RESULTS: When weights were analyzed as a change from before dosing, animals treated with 10 mg / kg cA2 showed consistently greater weight gain than D-PBS treated animals throughout the study. This weight gain was significant in weeks 3-7. Animals treated with 10 mg / kg TNV148 also achieved significant weight gain at week 7 of the study (See Figure 10).
Figures 11A-C depict disease severity progression based on arthritic index. The arthritic index of the group treated with 10 mg / kg cA2 was lower than that of the D-PBS control group starting at week 3 and continuing throughout the remainder of the study (week 7). Animals treated with 1 mg / kg of TNV14 and animals treated with 1 mg / kg of cA2 did not show significant reduction in AI after week 3 when compared to the group treated with D-PBS. There were no significant differences between the 10 mg / kg treatment groups when each was compared with the others of similar doses (10 mg / kg of cA2 compared with 10 mg / kg of TNV14, 148 and 196). When the 1 mg / kg treatment groups were compared, 1 mg / kg TNV148 showed significantly less Al than 1 mg / kg cA2 at 3, 4 and 7 weeks. The 1 mg / kg of TNV148 was also significantly lower than the 1 mg / kg of the group treated with TNV14 at 3 and 4 weeks. Although TNV196 showed a significant reduction in Al through study week 6 (when compared to the D-PBS group), TNV148 was the only 1 mg / kg treatment that remained significant at study completion.
Example 5: Study of Arthritic Mice Using Anti-TNF Antibodies and Controls as Multiple Bolt Dose
At approximately 4 weeks of age the Tg197 study mice were assigned, based on body weight, to one of 8 treatment groups and treated with an intraperitoneal bolus dose of control article (D-PBS) or antibodies (TNV14 , TNV148) at 3 mg / kg (week 0). Injections were repeated in all animals at weeks 1, 2, 3 and 4. Groups 1-6 were evaluated to test the efficacy of the article. Serum samples, obtained from animals in groups 7 and 8, were evaluated for induction of immune response and pharmacokinetic clearance of TNV14 or TNV148 at weeks 2, 3, and 4.
RESULTS: No significant differences were observed when weights were analyzed as a change from before dosing. Animals treated with 10 mg / kg cA2 showed consistently greater weight gain than animals treated with D-PBS throughout the study. (See Figure 12).
Figures 13A-C depict disease severity progression based on arthritic index. The arthritic index of the group treated with 10 mg / kg cA2 was significantly lower than the D-PBS control group starting at week 2 and continuing throughout the remainder of the study (week 5). Animals treated with 1 mg / kg or 3 mg / kg of Ca2 and animals treated with 3 mg / kg of TNV14 did not achieve any significant reduction in Al at any time throughout the study when compared to the group of d-PBS control. Animals treated with 3 mg / kg TNV148 showed a significant reduction when compared to the d-PBS treated group starting at week 3 and continuing through week 5. Animals treated with 10 mg / kg of cA2 showed a significant reduction in Al when compared to the two lower doses (1 mg / kg and 3 mg / kg) of cA2 in weeks 4 and 5 of the study and it was also significantly lower. than in animals treated with TNV14 at weeks 3-5. Although there were apparently no significant differences between any of the 3 mg / kg treatment groups, the Al for animals treated with 3 mg / kg TNV14 was significantly higher at some time points than that of 10 mg / kg, whereas animals treated with TNV148 were not significantly different from animals treated with 10 mg / kg cA2.
Example 6: Study of Arthritic Mice Using Anti-TNF Antibodies and Controls as a Single Intraperitoneal Bolus Dose.
At approximately 4 weeks of age the Tg197 study mice were assigned, based on gender and body weight, to one of 6 treatment groups and treated with a single intraperitoneal bolus dose of antibody (Ca2 or TNV148) to 3 mg / kg or 5 mg / kg. This study used D-PBS and 10 mg / kg cA2 control groups.
ES 2 607 679 T3
When weights were analyzed as a change from before dosing, all treatments achieved similar weight gains. Animals treated with 3 or 5 mg / kg of TNV148 or 5 mg / kg of cA2 gained a significant amount of weight earlier in the study (at weeks 2 and 3). Only animals treated with TNV148 maintained significant weight gain at subsequent time points. Animals treated with both 3 and 5 mg / kg TNV148 showed a significant result at 7 weeks and animals with 3 mg / kg TNV148 showed a significantly elevated result even at 8 weeks after injection. (See Figure 14).
Figure 15 depicts disease severity progression based on arthritic index. All treatment groups showed some protection at the earliest time points, with the 5 mg / kg Ca2 and 5 mg / kg TNV148 showing significant reductions in Al at weeks 1-3 and all groups showing significant reductions in Al. treatment a significant reduction at week 2. Later in the study the animals treated with 5 mg / kg of cA2 showed some protection, with significant reductions in weeks 4, 6 and 7. The low dose (3 mg / kg) of both cA2 and TNV148 showed significant reductions in the Week 6 and all treatment groups showed significant reductions at 7. Neither treatment group was able to maintain a significant reduction at study completion (week 8). There were no significant differences between any of the treatment groups (excluding the saline control group) at any point in time.
Example 7: Study of Arthritic Mice Using Anti-TNF Antibodies and Controls as a Single Intraperitoneal Bolus Dose between Anti-TNF Antibody and Modified Anti-TNF Antibody.
To compare the efficacy of a single intraperitoneal dose of TNV148 (obtained from hybridoma cells) and rTNV148B (obtained from transfected cells). At approximately 4 weeks of age, Tg197 study mice were assigned, based on gender and body weight, to one of 9 treatment groups and treated with a single intraperitoneal bolus dose of Dulbecco's PBS (D- PBS) or antibody (TNV148, RT1 VV148B) at 1 mg / kg.
When weights were analyzed as a change from before dosing, animals treated with 10 mg / kg cA2 showed consistently greater weight gain than DPBS-treated animals throughout the study. This weight gain was significant at weeks 1 and weeks 3-8. Animals treated with 1 mg / kg TNV148 also achieved significant weight gain at weeks 5, 6, and 8 of the study. (See Figure 16).
Figure 17 depicts disease severity progression based on arthritic index. The arthritic index of the group treated with 10 mg / kg cA2 was lower than that of the D-PBS control group starting at week 4 and continuing throughout the remainder of the study (week 8). Both the group treated with TNV148 and the group treated with 1 mg / kg of cA2 showed a significant reduction in Al at week 4. Although a previous study (P-099-017) showed that TNV148 was slightly more effective in reducing the Arthritic Index after a single bolus intraperitoneal injection of 1 mg / kg, this study showed that the Al of the two versions of the groups treated with TNV antibody was slightly higher. Although (with the exception of week 6) the group treated with 1 mg / kg of cA2 was not significantly increased when compared to the group of 10 mg / kg of cA2 and the groups treated with TNV148 were significantly greater at week 7 and 8, there were no significant differences in Al between 1 mg / kg cA2, 1 mg / kg TNV148, and 1 mg / kg TNV148B at any point in the study.
<110> Centocor Ortho Biotech Inc.
<120> ANTI-TNF ANTIBODIES, COMPOSITIONS, METHODS AND USES <130> P055221EP <150> US 60 / 223,360 <151> 2000-08-07 <150> US 60 / 236,826 <151> 2000-09-29 <150 > US 09 / 920,137 <151> 2001-08-01 <160> 15 <170> PatentIn Ver 2.0 <210> 1 <211> 5 <212> PRT <213> Homo sapiens <400> 1
ES 2 607 679 T3
Arg Tyr Thr Met His
5 <210> 2 <211> 16 <212> PRT <213> Homo sapiens <400> 2
Val lie Ser Phe Asp Gly Ser Asn Lys Tyr Tyr Val Asp Ser Val Lys
5 '10 15 <210> 3 <211> 10 <212> PRT <213> Homo sapiens <400> 3
Glu Ala Arg Gly Ser Tyr Ala Phe Asp lie
5 10 <210> 4 <211> 11 <212> PRT <213> Homo sapiens <400> 4
Arg Ala Ser Gln Gly lie Ser Ser Trp Leu Ala 15 10 <210> 5 <211> 7 <212> PRT <213> Homo sapiens <400> 5
Ala Ala Ser Ser leu Gln Ser
5 <210> 6 <211> 10 <212> PRT <213> Homo sapiens <400> 6
Gln Gln Arg Ser Asn Trp Pro Pro Phe Thr
10 <210> 7 <211> 115 <212> PRT <213> Homo sapiens <400> 7
ES 2 607 679 T3
<td colspan="10">Gln Val Gln Leu Val Glu Ser Gly Gly Gly</td><td rowspan="2">Val</td><td rowspan="2">Val</td><td rowspan="2">Gln</td><td rowspan="2">Pro</td><td rowspan="2">Gly fifteen</td><td rowspan="2">Arg</td>
<td> 1</td><td colspan="4"> 5</td><td colspan="5"> 10</td>
<td>to be</td><td>Leu</td><td>Arg</td><td>Leu</td><td>To be</td><td>Cys</td><td>To</td><td>To</td><td>To be</td><td>Gly</td><td>Phe</td><td>Thr</td><td>Phe</td><td>To be</td><td>To be</td><td>Tyr</td>
<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>
<td>To</td><td>Met</td><td>His</td><td>Trp</td><td>Val</td><td>Arg</td><td>Gln</td><td>To</td><td>Pro</td><td>Gly</td><td>Lys</td><td>Gly</td><td>Leu</td><td>Glu</td><td>Trp</td><td>Val</td>
<td></td><td></td><td> 35</td><td></td><td></td><td> 1,</td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>
<td>To</td><td>Val</td><td>lie</td><td>To be</td><td>Tyr</td><td>Asp</td><td>Gly</td><td>To be</td><td>Asn</td><td>Lys</td><td>Tyr</td><td>Tyr</td><td>To·</td><td>Asp</td><td>To be</td><td>Val</td>
<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>
<td>Lys</td><td>Gly</td><td>Arg</td><td>Phe</td><td>Thr</td><td>lie</td><td>To be</td><td>Arg</td><td>Asp</td><td>Asn</td><td>To be</td><td>Lys</td><td>Asn</td><td>Thr</td><td>Leu</td><td>Tyr</td>
<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>
<td>Leu</td><td>Gln</td><td>Met</td><td>Asn</td><td>To be</td><td>Leu</td><td>Arg</td><td>To</td><td>Glu</td><td>Asp</td><td>Thr</td><td>To</td><td>Val</td><td>Tyr</td><td>Tyr</td><td>Cys</td>
<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>
<td>To</td><td>Arg</td><td>Asp</td><td>Arg</td><td>Gly</td><td>lie</td><td>To be</td><td>To</td><td>Gly</td><td>Gly</td><td>Asn</td><td>Tyr</td><td>Tyr</td><td>Tyr</td><td>Tyr</td><td>Gly</td>
100 105 110
Met Asp Val
115 <210> 8 <211> 108 <212> PRT <213> Homo sapiens <400> 8
<td>Glu 1</td><td>lie</td><td>Val</td><td>Leu</td><td colspan="2">Thr Gln 5</td><td>To be</td><td colspan="2">Pro Wing</td><td>Thr 10</td><td>Leu</td><td>To be</td><td>Leu</td><td>To be</td><td>Pro fifteen</td><td>Gly</td>
<td>Glu</td><td>Arg</td><td>To</td><td>Thr</td><td>Leu</td><td>To be</td><td>Cys</td><td>Arg</td><td>To</td><td>To be</td><td>Gln</td><td>To be</td><td>Val</td><td>To be</td><td>To be</td><td>Tyr</td>
<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>
<td>Leu</td><td>To</td><td>Trp</td><td>Tyr</td><td>Gln</td><td>Gln</td><td>Lys</td><td>Pro</td><td>Gly</td><td>Gln</td><td>To</td><td>Pro</td><td>Arg</td><td>Leu</td><td>Leu</td><td>lie</td>
<td></td><td colspan="2"> 35</td><td></td><td></td><td></td><td colspan="2"> '40</td><td></td><td></td><td></td><td colspan="2"> 45</td><td></td><td></td><td></td>
<td>Tyr</td><td>Asp</td><td>To</td><td>To be</td><td>Asn</td><td>Arg</td><td>To</td><td>Thr</td><td>Gly</td><td>lie</td><td>Pro</td><td colspan="2">To. Arg</td><td>Phe</td><td>To be</td><td>Gly</td>
<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>
<td>To be</td><td>Gly</td><td>To be</td><td>Gly</td><td>Thr</td><td>Asp</td><td>Phe</td><td>Thr</td><td>Leu</td><td>Thr</td><td>lie</td><td>To be</td><td>To be</td><td>Leu</td><td>Glu</td><td>Pro</td>
<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>
<td>Glu</td><td>Asp</td><td>Phe</td><td>To</td><td>Val</td><td>Tyr</td><td>Tyr</td><td>Cys</td><td>Gln</td><td>Gln</td><td>Arg</td><td>To be</td><td>Asn</td><td>Trp</td><td>Pro</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>
<td>Phe</td><td>Thr</td><td>Phe</td><td>Gly</td><td>Pro</td><td>Gly</td><td>Thr</td><td>Lys</td><td>Val</td><td>Asp</td><td>lie</td><td>Lys</td><td></td><td></td><td></td><td></td>
100 105 <210> 9 <211> 157 <212> PRT <213> Homo sapiens <400> 9
ES 2 607 679 T3
<td>Val 1</td><td colspan="2">Arg Ser</td><td>To be</td><td colspan="2">Be Arg 5</td><td>Thr</td><td>Pro</td><td>To be</td><td colspan="2">Asp Lys 10</td><td>Pro</td><td>Val</td><td>To</td><td>His fifteen</td><td>Val</td>
<td>Val</td><td>To</td><td>Asn</td><td>Pro</td><td>Gln</td><td>To</td><td>'Glu</td><td>Gly</td><td>Gln</td><td>Leu</td><td>Gln</td><td>Trp</td><td>Leu</td><td>Asn</td><td>Arg</td><td>Arg</td>
<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>
<td>To</td><td>Asn</td><td>To</td><td>Leu</td><td>Leu</td><td>To</td><td>Asn</td><td>Gly</td><td>Val</td><td>Glu</td><td>Leu</td><td colspan="2">Arg Asp</td><td>Asn</td><td>Gln</td><td>Leu</td>
<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>
<td>Val</td><td>Val</td><td>Pro</td><td>To be</td><td>Glu</td><td>Gly</td><td>Leu</td><td>Tyr</td><td>Leu</td><td>lie</td><td>Tyr</td><td>To be</td><td>Gln</td><td>Val</td><td>Leu</td><td>Phe</td>
<td colspan="2"> 50</td><td></td><td></td><td></td><td colspan="2"> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>
<td>Lys</td><td>Gly</td><td>Gln</td><td>Gly</td><td>Cys</td><td>Pro</td><td>To be</td><td>Thr</td><td>His</td><td>Val</td><td>Leu</td><td>Leu</td><td>Thr</td><td>His</td><td>Thr</td><td>lie</td>
<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>
<td>To be</td><td>Arg</td><td>lie</td><td>To</td><td>Val</td><td>To be</td><td>Tyr</td><td>Gln</td><td>Thr</td><td>Lys</td><td>Val</td><td>Asn</td><td>Leu</td><td>Leu</td><td>To be</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>
<td>lie</td><td>Lys</td><td>To be</td><td>Pro</td><td>Cys</td><td>Gln</td><td>Arg</td><td>Glu</td><td>Thr</td><td>Pro</td><td>Glu</td><td>Gly</td><td>To</td><td>Glu</td><td>To</td><td>Lys</td>
<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>
<td>Pro</td><td>Trp</td><td>Tyr</td><td>Glu</td><td>Pro</td><td>lie</td><td>Tyr</td><td>Leu</td><td>Gly</td><td>Gly</td><td>Val</td><td>Phe</td><td>Gln</td><td>Leu</td><td>Glu</td><td>Lys</td>
<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>
<td>Gly</td><td>Asp</td><td>Arg</td><td>Leu</td><td>To be</td><td>To</td><td>Glu</td><td>lie</td><td>Asn</td><td>Arg</td><td>Pro</td><td>Asp</td><td>Tyr</td><td>Leu</td><td>Asp</td><td>Phe</td>
<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>
<td>To</td><td>Glu</td><td>To be</td><td>Gly</td><td>Gln</td><td>Val</td><td>Tyr</td><td>Phe</td><td>Gly</td><td>lie</td><td>lie</td><td>To</td><td>Leu</td><td></td><td></td><td></td>
<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td></td>
<210> 10 <211> 15 <212> DNA <213> Homo sapiens <400> 10 agatatacta tgcac 15 <210> 11 <211> 51 <212> DNA <213> Homo sapiens <400> 11 gttatatcat ttgatggaag caataaatac tacgtagact ccgtgaaggg c 51 <210> 12 <211> 30 <212> DNA <213> Homo sapiens <400> 12 gaggcccggg gatcgtatgc ttttgatatc 30 <210> 13 <211> 42 <212> DNA <213> Homo sapiens <400> 13 ctctcctgca gggccagtca gagtgttagc agctacttag ce 42 <210> 14 <211> 18 <212> DNA <213> Homo sapiens <400> 14 gatgcatcca acagggcc <210> 15 <211> 21 <212> DNA <213> Homo sapiens <400> 15 cagcagcgta gcaactggcc 121
Contents44
24 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24
294 members in 40 offices
Priority claims6
| Document | Office | Kind | Date |
|---|---|---|---|
| 223360P | United States of America | – | |
| 22336000 | United States of America | P | |
| 236826P | United States of America | – | |
| 23682600 | United States of America | P | |
| 920137 | United States of America | – | |
| 92013701 | United States of America | A |
Members294
| Document | Office | Kind | |
|---|---|---|---|
| CA2106299A1 | Canada | A1 | |
| CA2324853A1 | Canada | A1 | |
| CA2736076A1 | Canada | A1 | |
| WO9216553A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU1764992A | Australia | A | |
| JPH06506120A | Japan | A | |
| EP0610201A1 | European Patent Office (EPO) | A1 | |
| EP0610201A4 | European Patent Office (EPO) | A4 | |
| AU668864B2 | Australia | B2 | |
| US5656272A | United States of America | A | |
| US5698195A | United States of America | A | |
| US5919452A | United States of America | A | |
| CA2106299C | Canada | C | |
| EP1097945A2 | European Patent Office (EPO) | A2 | |
| EP0610201B1 | European Patent Office (EPO) | B1 | |
| AT201234T | Austria | T | |
| ATE201234T1 | Austria | T1 | |
| DK0610201T3 | Denmark | T3 | |
| DE69231828D1 | Germany | D1 | |
| ES2156859T3 | Spain | T3 | |
| US6277969B1 | United States of America | B1 | |
| US6284471B1 | United States of America | B1 | |
| US2001027249A1 | United States of America | A1 | |
| EP1097945A3 | European Patent Office (EPO) | A3 | |
| GR3036375T3 | Greece | T3 | |
| NL300069I1 | Netherlands (Kingdom of the) | I1 | |
| LU90854I2 | Luxembourg | I2 | |
| CA2419205A1 | Canada | A1 | |
| WO0212502A2 | World Intellectual Property Organization (WIPO) | A2 | |
| AU7922701A | Australia | A | |
| DE10199067I1 | Germany | I1 | |
| US2002022720A1 | United States of America | A1 | |
| HK1037923A1 | Hong Kong, China | A1 | |
| US2002106372A1 | United States of America | A1 | |
| US2002114805A1 | United States of America | A1 | |
| US2002132307A1 | United States of America | A1 | |
| NL300069I2 | Netherlands (Kingdom of the) | I2 | |
| US2002141996A1 | United States of America | A1 | |
| US2002146419A1 | United States of America | A1 | |
| WO0212502A3 | World Intellectual Property Organization (WIPO) | A3 | |
| US2003017584A1 | United States of America | A1 | |
| NO20030620D0 | Norway | D0 | |
| US2003049725A1 | United States of America | A1 | |
| KR20030022367A | Republic of Korea | A | |
| US2003054004A1 | United States of America | A1 | |
| NO20030620L | Norway | L | |
| EP1309691A2 | European Patent Office (EPO) | A2 | |
| US2003133935A1 | United States of America | A1 | |
| US2003144484A1 | United States of America | A1 | |
| US2003147891A1 | United States of America | A1 | |
| AR030133A1 | Argentina | A1 | |
| EA200300243A1 | Eurasian Patent Organization (EAPO) | A1 | |
| BR0113110A | Brazil | A | |
| IL154327D0 | Israel | D0 | |
| US2003175275A1 | United States of America | A1 | |
| US2003175837A1 | United States of America | A1 | |
| US2003176676A1 | United States of America | A1 | |
| US2003180299A1 | United States of America | A1 | |
| US2003181695A1 | United States of America | A1 | |
| US2003187231A1 | United States of America | A1 | |
| HK1052948A1 | Hong Kong, China | A1 | |
| MXPA03001231A | Mexico | A | |
| US2003194402A1 | United States of America | A1 | |
| US2003198634A1 | United States of America | A1 | |
| US2003198641A1 | United States of America | A1 | |
| HU0302376A2 | Hungary | A2 | |
| HUP0302376A2 | Hungary | A2 | |
| US2003204066A1 | United States of America | A1 | |
| CN1468308A | China | A | |
| WO0212502A9 | World Intellectual Property Organization (WIPO) | A9 | |
| US2004115200A1 | United States of America | A1 | |
| ZA200301856B | South Africa | B | |
| US2004120952A1 | United States of America | A1 | |
| JP2004180686A | Japan | A | |
| US2004138427A1 | United States of America | A1 | |
| JP2004523209A | Japan | A | |
| PL360438A1 | Poland | A1 | |
| US6790444B2 | United States of America | B2 | |
| US6835823B2 | United States of America | B2 | |
| US2005037008A1 | United States of America | A1 | |
| NZ524147A | New Zealand | A | |
| HRP20030089A2 | Croatia | A2 | |
| US2005074454A1 | United States of America | A1 | |
| US2005123541A1 | United States of America | A1 | |
| US2005249735A1 | United States of America | A1 | |
| US2005255104A1 | United States of America | A1 | |
| US2005260201A1 | United States of America | A1 | |
| US2006013816A1 | United States of America | A1 | |
| US2006018905A1 | United States of America | A1 | |
| US2006018906A1 | United States of America | A1 | |
| US2006018907A1 | United States of America | A1 | |
| US6991791B2 | United States of America | B2 | |
| US2006024310A1 | United States of America | A1 | |
| DE10199067I2 | Germany | I2 | |
| YU9103A | Yugoslavia, later Serbia and Montenegro (until 2006) | A | |
| US2006121037A1 | United States of America | A1 | |
| WO2006065975A2 | World Intellectual Property Organization (WIPO) | A2 | |
| US2006140946A1 | United States of America | A1 | |
| US2006140949A1 | United States of America | A1 | |
| EA007005B1 | Eurasian Patent Organization (EAPO) | B1 |
Numbers
- Publication
- 2607679
- Application
- 10184630
Titles2
- Spanish
- Anticuerpos anti-TNF, composiciones, métodos y usos
- English
- Anti-TNF antibodies, compositions, methods and uses
Classification
- CPC, 24
- C07K16/241
- C07K16/24
- A61K2039/505
- C07K2317/21
- C07K2317/56
- C07K2317/565
- C07K2317/76
- A61P1/04
- A61P19/02
- A61P25/00
- A61P29/00
- A61P31/00
- A61P31/04
- A61P31/12
- A61P33/00
- A61P35/00
- A61P35/02
- A61P37/00
- A61P37/02
- A61P37/06
- A61P43/00
- A61P9/00
- Y02A50/30
- Y02A90/10
- IPC, 22
- A61K39 00
- C07K16 24
- C12N15 13
- C12N5 10
- A61K39 395
- A61P37 00
- C12N15 09
- A61K
- A61K31 7088
- A61K35 76
- A61K38 00
- A61K38 16
- A61K45 00
- A61K48 00
- A61P
- A61P35 00
- A61P43 00
- C07K
- C07K16 42
- C12N
- C12P21 08
- G01N