Method of nucleic acid sequencing

ES 2 563 643 T3

DESCRIPTION

Nucleic acid sequencing method

[0001] The present invention relates, among other things, to nucleic acid amplification.

[0002] The development of molecular biology and pharmacology now makes extensive use of nucleic acid analysis (Friedrich, GA Moving beyond the genome projects, Nature Biotechnology 14, 1234 (1996)). The most challenging areas are the sequencing of the entire genome, the detection of mononucleotide polymorphisms, and the exploration and monitoring of gene expression. Currently, in DNA sequencing projects alone, up to hundreds of thousands of samples have been handled (Venter, JC, HO Smith, L. Hood, A new strategy for genome sequencing, Nature 381, 364 (1996)). This capacity is limited by available technology. Projects such as the "human genome project" (genetic mapping and DNA sequencing) and identification of all polymorphisms in expressed genes involved in common diseases, involve the sequencing of millions of DNA samples.

[0003] With most current DNA sequencing technologies, it is simply not possible to indefinitely decrease the time it takes to process a single sample. One way to increase performance is to run many processes in parallel. The introduction of slides and the provision of robotic samples, of 96 well and 384 well plates, of high density grating apparatus (Maier, E., S. Meierewer, AR Ahmadi, J. Curtis, H. Lehrach, Application of robotic technology to automated sequence fingerprint analysis by oligonucleotide hybridization, Journal Of Biotechnology 35,191 (1994)) and recently the development of high-density oligonucleotide matrices (Chee, M., R.Yang, E. Hubbell, A. Berno , XC Huang, D. Stern, J. Winkler, DJ Lockhart, MS Morris, and SPA Fodor, Accessing genetic information with high-density DNA arrays, Science 274 (5287): 610-614, (1996)) are beginning to respond to demands with increasing performance. Such technologies allow up to 50,000-100,000 samples to be processed at a time, over the course of days or even hours (Maier, E., Robotic technology in library screening, Laboratory Robotics and Automation 7, 123 (1995)).

[0004] In most known methods for performing nucleic acid analysis, it is necessary to first extract the nucleic acids of interest (eg, genomic or mitochondrial DNA or messenger RNA (mRNA)) from an organism. Then it is necessary to isolate the nucleic acids of interest from the mixture of all nucleic acids and usually, to amplify these nucleic acids to obtain suitable quantities for their characterization and / or detection. The isolation of nucleic acid fragments has been considered necessary even when one is interested in a representative, albeit random, set of all the different nucleic acids, for example, a representative set of all the mRNAs present in a cell or of all the fragments obtained after having randomly cut genomic DNA into small pieces.

[0005] Various methods that are well known to those of skill in the art can be used to amplify DNA with biological means. Generally, DNA fragments are first inserted into vectors using restriction enzymes and DNA ligases. A vector containing a fragment of interest can then be introduced into a biological host and amplified using well-established protocols. Hosts are usually randomly scattered on culture medium (eg agar plates). They can then be copied to provide colonies originating from individual host cells.

[0006] In such hosts, up to millions of simultaneous amplifications of cloned DNA fragments can be performed simultaneously. The density of colonies is of the order of 1 colony / mm². To obtain DNA from these colonies, one option is to transfer the colonies to a membrane, and then immobilize the DNA from within the biological hosts directly to the membrane (Grunstein, M. and DS Hogness, Colony Hybridization: A method for the isolation of cloned DNAs that contain a specific gene, Proceedings of the National Academy of Science, USA, 72: 3961 (1975)). However, with these options, the amount of DNA transferred is limited and often insufficient for non-radioactive detection.

[0007] Another option is to transfer, by sterilization techniques, each colony individually to a container (for example, to 96-well plates) where in addition the host cells can replicate, in such a way that more DNA can be obtained from the colonies. The amplified nucleic acids can then be recovered from the host cells with an appropriate purification process. However such a procedure is generally laborious and time consuming, and difficult to automate.

[0008] The revolutionary technique of DNA amplification using the polymerase chain reaction (PCR) was proposed in 1985 by Mullis et al. (Saiki, R., S. Scharf, F. Faloona, K. Mullis, G. Horn, H. Erlich and N. Arnheim, Science 230, 1350-1354 (1985) and is now well known to those of skill in the art . In this amplification process, a DNA fragment of interest can be amplified using two short oligonucleotides (generally about 20 bases in length) flanking a region to be amplified, and which are commonly referred to as "primers". Amplification occurs during PCR cycling times, which includes a stage during which double-stranded DNA molecules are denatured (usually

ES 2 563 643 T3 heating a reaction mixture, for example, to 95 ° C to separate double-stranded DNA molecules into two single-stranded fragments), a pairing step (in which the reaction mixture is brought to a temperature of, for example, Four. Five ° C to allow the primers to pair with the single-stranded templates) and an elongation step (DNA complementary to the single-stranded fragment is synthesized by incorporation of sequential nucleotides at the ends of the primers with the enzyme DNA polymerase).

[0009] The above procedure is normally carried out in solution, whereby neither the primers nor the template bind to any solid matrix.

[0010] More recently, however, the use of a surface grafted primer together with free primers in solution has been proposed to simultaneously amplify and graft a PCR product onto the surface (Oroskar, AA, SE Rasmussen, HN Rasmussen , SR Rasmussen, BM Sullivan, and A. Johansson, Detection of immobilized amplicons by ELISA-like techniques, Clinical Chemistry 42: 1547 (1996)). (The term "graft" is used herein to indicate that a residue begins to bond to a surface and remains there, unless it is removed or desired to be removed). Amplification is generally performed in containers (eg, 96-well format plates) such that each container contains the PCR product (or products) of a reaction. With such methods, some of the PCR products begin to graft onto a container surface that has primers inside that have been contacted with the reactant during PCR cycling. Grafting on the surface simplifies subsequent testing and enables efficient automation.

[0011] Arrangement of DNA samples is more conventionally done on membranes (eg, nylon or nitrocellulose membranes). With the use of suitable robotics (eg Q-bot ™, Genetix Ltd, Dorset BH23 3TG UK) it is possible to achieve a density of up to 10 samples / mm². In this case, the DNA is covalently bound to a membrane by physiochemical means (eg UV radiation). These technologies allow the arrangement of large DNA molecules (eg, molecules over 100 nucleotides in length) as well as smaller DNA molecules. Thus, both molds and probes can be provided.

[0012] New strategies based on previously arranged glass slides (arrangements of reactive areas obtained by injection technology (Blanchard, AP and L. Hood, Oligonucleotide array synthesis using ink jets, Microbial and Comparative Genomics, 1: 225 (1996)) or reactive polyacrylamide gel matrices (Yershov, G. et al., DNA analysis and diagnostics on oligonucleotide micromicroplates, Proceedings of the National Academy of Science, USA, 93: 4913-4918 (1996)) allow the arrangement of up to 100 samples / mm². With these technologies, only the grafting of probes (oligonucleotides) has been described. The indicated number of samples / mm² it is still very low (25 to 64).

[0013] Higher sample densities can be achieved using DNA microplates, which can be oligonucleotide arrays that are covalently attached to a surface and which can be obtained using microlithography techniques (Fodor, SPA et al., Light directed, spatially addressable parallel chemical synthesis, Science 251: 767 (1991)). Currently, in molecular biology applications, microplates with 625 probes / mm are used² (Lockhart, DJ et al., Expression monitoring by hybridization to high-density oligonucleotide arrays, Nature Biotechnology 14: 1675 (1996)). Probe densities of up to 250,000 samples / cm are claimed to be achievable² (Chee, M. et al., Accessing genetic information with high-density DNA arrays, Science 274: 610 (1996)). Currently, in a single microplate of approximately 2.5 cm² up to 132,000 different oligonucleotides can be arranged. Currently, these microplates are manufactured by solid phase oligonucleotide synthesis with the 3'OH end of the oligonucleotide attached to the surface. Thus these chips have been used to provide oligonucleotide probes that cannot act as primers in a DNA polymerase mediated elongation step.

[0014] When PCR products are ligated in the vessel in which PCR amplification is performed, this can be viewed as a straightforward array arrangement process. The density of the resulting PCR products in the matrix is ​​therefore limited to the container that is arranged. Currently available containers are only in a 96-well microtiter plate format. These allow to obtain only about 0.02 samples of PCR products / mm² Of surface.

Using the commercially available Nucleolink ™ system, available from Nunc A / S (Roskilde, Denmark), it is possible to achieve simultaneous amplification and arrangement of samples in containers on the surface onto which the primers have been grafted. oligonucleotides. However, in this case, the density of the sample matrix₂It is fixed by the size of the container. Currently, a density of 0.02 samples / mm can be achieved for the 96-well plate format. Increasing this density is difficult. This is appreciable since, for example, the availability of 384-well plates (0.08 samples / mm²), suitable for PCR, has been delayed due to technical problems (for example, heat transfer and capillary effects during filling). Therefore, in the foreseeable future, this strategy is unlikely to achieve orders of magnitude improvements in the density of samples arranged in a matrix.

[0016] The present invention aims to overcome, or at least alleviate, some of the disadvantages of

ES 2 563 643 T3 prior art nucleic acid sequencing methods. The present invention is concerned with a method of sequencing a nucleic acid molecule as defined in the claims.

[0017] In accordance with the present description a nucleic acid amplification method is disclosed comprising the steps of:

A. providing a plurality of primers that are immobilized but have one end exposed to allow extension of the primer;

B. allowing a single-stranded target nucleic acid molecule to be paired with one of said plurality of primers over part of the length of said single-stranded nucleic acid molecule and then extending that primer using the paired single-stranded nucleic acid molecule as a template, to provide an extended immobilized nucleic acid strand;

C. separating the target nucleic acid molecule from the extended immobilized nucleic acid chain;

D. allowing the extended immobilized nucleic acid strand to be paired with one of said plurality of primers indicated in step A) and then extending that primer using, as a template, the extended immobilized nucleic acid strand, to provide another acid strand nucleic immobilized extended; and optionally,

E. Separate paired extended immobilized nucleic acid strands from each other.

[0018] Preferably the method also comprises the step of:

F. use at least one extended immobilized nucleic acid strand to repeat steps D) and E), to provide additional extended immobilized nucleic acid strands, and optionally,

G. repeat step F) one or more times.

[0019] If possible the single stranded target nucleic acid sequence is provided by a method in which said single stranded target nucleic acid is produced by providing a certain nucleic acid sequence to be amplified (whose sequence may or may not be known) and added to the itself a first nucleic acid sequence and a second nucleic acid sequence; wherein said first nucleic acid sequence hybridizes to one of said plurality of primers and said second nucleic acid sequence is complementary to a sequence that hybridizes to one of said plurality of primers.

The second nucleic acid sequence can be a sequence that is the same as the sequence of one of the plurality of primers. Thus, the single-stranded target nucleic acid sequence can be provided by a method in which said single-stranded target nucleic acid is produced by providing a certain nucleic acid sequence to be amplified (the sequence of which may or may not be known) and adding thereto a first sequence. nucleic acid and a second nucleic acid sequence; wherein said first nucleic acid sequence hybridizes to one of said plurality of primers and said second nucleic acid sequence is the same as the sequence of one of said plurality of primers.

The first and second nucleic acid sequences can be provided at the first and second ends of said single stranded target nucleic acid, although this is not essential.

[0022] If desired, a marker can be provided to allow the amplification products of a given nucleic acid sequence to be identified.

Colonies

The method of the present disclosure allows one or more distinct areas to be provided, each distinct area comprising a plurality of immobilized nucleic acid strands (hereinafter referred to as "colonies"). These areas can contain large amounts of amplified nucleic acid molecules. These molecules can be DNA and / or RNA molecules and can be provided in single or double stranded form. Both a given chain and its complementary chain can be provided in amplified form in a single colony.

[0024] Colonies of any particular size can be provided.

However, throughout its dimension, the size of the preferred colonies is 10 nm to 100 pm, more preferably 100 nm to 10 pm. If possible, a large part of the colonies present on a surface (ie, at least 50% of it) have sizes within the ranges indicated above.

[0026] Colonies can be arranged in a predetermined or random manner. Two- or three-dimensional colony configurations are possible. The configurations can be regular (for example, have a polygonal or generally circular design) or they can be irregular.

ES 2 563 643 T3

[0027] Colonies can be provided at high densities. Densities of more than one colony / mm can be achieved² Of surface. In fact, using the present invention, densities of more than 10², more than 10³ or even more than 10⁴ colonies / mm². In preferred embodiments, the present invention provides colony densities of 10^4-5 colonies / mm², more preferably densities of 10^6-7 colonies / mm², thus offering a 3-4 orders of magnitude improvement over densities that can be achieved using many of the prior art methods. This property of the invention is what allows a great advantage over the prior art, since the high density of DNA colonies makes it possible to randomize and amplify a large number of DNA templates (up to 10^6-7 colonies / mm²).

Primers

[0028] The immobilized primers for use in the present invention can be provided by any suitable means, as long as their free 3'-OH end is available for primer extension. When many different nucleic acid molecules are to be amplified, many different primers can be provided. Alternatively, "universal" primers can be used, whereby only one or two different types of primers (depending on the embodiment of the invention) can be used to amplify the different nucleic acid molecules. Universal primers can be used when the molecules to be amplified comprise first and second sequences, as described above. The acquisition of universal primers is advantageous over methods such as those disclosed in WO96 / 04404 (Mosaic Technologies, Inc.) in which specific primers must be prepared for each particular sequence to be amplified.

[0029] Synthetic oligodeoxynucleotide primers are commercially available from many suppliers (eg Microsynth, Switzerland, Eurogentech, Belgium).

[0030] The grafting of primers on glass or silanized quartz and on silicon wafers or gold surfaces has been described (Maskos, U. and EM Southern, Oligonucleotide hybridizations on glass supports: a novel linker for oligonucleotide synthesis and hybridization properties of oligonucleotides synthesized in situ, Nucleic Acids Research 20 (7): 1679-84, 1992; Lamture, JB, et al. Direct-detection of nucleic-acid hybridization on the surface of a charge coupled-device, Nucleic Acids Research 22 (11): 2121-2125, 1994; Chrisey, LA, GU Lee, and CE Oferrall, Covalent attachment of synthetic DNA to self-assembled monolayer films, Nucleic Acids Research 24 (15): 3031-3039, 1996).

[0031] Grafting of biotin-labeled primers onto streptavidin-coated supports is another alternative. This grafting method is normally used for bio macromolecules in general.

In the present invention, the non-covalent grafting of primers at the interface between an aqueous phase and a hydrophobic phase through a hydrophobic anchor is also possible. Said anchor is normally used for bio macromolecules in general (S. Terrettaz et al .: Protein binding to supported lipid membranes, Langmuir 9,1361 (1993)). Preferred forms of such interfaces would be liposomes, lipid vesicles, emulsions, patterned biolayers, Langmuir or Langmuir-Blodgett films. Designs can be obtained by designing directly in molds, for example, on designed silicon microplates through microlithographic methods (Goves, JT et al., Micropatterning Fluid Bilayers on Solid Supports, in Science 275,651 (1997)). Designs can also be obtained due to the self-assembling properties of "colloids", for example latex emulsions or particles (Larsen, AE and DG Grier, Like charge attractions in metastable colloidal crystallites, Nature 385,230 (1997)).

[0033] In the above methods, two or more different primers can be grafted onto one surface. The primers can be grafted homogeneously and simultaneously onto the surface.

[0034] Using microlithographic methods it is possible to provide immobilized primers in a controlled manner. If direct synthesis of oligonucleotides on a solid support with a free 3'-OH end is desired, then microlithographic methods can be used to simultaneously synthesize many different oligonucleotide primers (Pirrung, MC and Bradley, JC Comparison of methods for photochemical phosphoramidite -based DNA- synthesis. Journal of Organic Chemistry 60 (20): 6270-6276, 1995). These can be provided in different areas whose configuration can correspond to that of the colonies to be formed (for example, it can be across several nanometers or micrometers). Within each area, it is necessary to provide only a single type of oligonucleotide primer. Alternatively, a mixture comprising a plurality of different primers can be provided. In any case, within each area, the primers must be homogeneously distributed. These can be provided in the form of a regular matrix.

[0035] When the areas initially comprise a single immobilized primer type, these can be modified, if desired, to carry two or more different primer types. One way to achieve this is to use molecules as templates for primer extension that have 3 'ends that hybridize to a single type of primer initially present and that have 5' ends that extend beyond the 3 'ends of those primers. . By providing a mixture of templates with different sequences from each other, primer extension of one type of primer using the mixture of said templates followed by strand separation will result in

ES 2 563 643 T3 different modified primers. (Modified primers are referred to herein as "extended" primers to differentiate them from "primary" primers initially present on a surface).

[0036] In this way, one, two or more different types of primers can be provided extended in any area where primary primers are initially located. If desired, substantially equal parts of different templates can be used to give substantially equal proportions of different types of extended primers immobilized over a given area. Therefore then, if different ratios of different immobilized extended primers are desired, this can be achieved by adjusting the ratios of the different template molecules initially used.

[0037] Within the primer there may be a restriction endonuclease cleavage site. A primer can also be provided with a restriction endonuclease recognition site that directs cleavage of DNA several bases apart (Type II restriction endonucleases). (For the avoidance of doubt, such sites are considered to be present even if both the primer and its complement are required to be present on a double-stranded molecule for recognition and / or cleavage to occur). Alternatively, when a primer is extended, a cleavage and / or recognition site can be produced. In any case, restriction endonucleases can be useful by allowing a nucleic acid molecule, immobilized in a colony, to be cleaved to release at least a part of it. As an alternative to the use of other restriction endonucleases, ribozymes can be used to release at least parts of the nucleic acid molecules from a surface (when said molecules are RNA molecules). Other methods are possible. For example, if a covalent bond is used to attach a primer to a surface, this bond can be degraded (eg, by chemical, physical, or enzymatic means).

[0038] Primers for use in the present invention are preferably at least five bases in length. Typically, they will be less than 100 or less than 50 bases in length. However this is not essential. In the primers there may be bases of natural and / or non-natural origin.

Target nucleic acid molecules

Turning now to target nucleic acid molecules (also referred to herein as "templates") for use in the method of the present invention, these can be provided by any appropriate means. A target molecule (when in single-stranded form) comprises a first part having a sequence that can be paired with a first primer and a second part that has a sequence complementary to a sequence that can be paired with a second primer. In a preferred embodiment the second part has the same sequence as the second primer.

[0040] The second primer can have a sequence that is the same as, or different from, the sequence of the first primer.

[0041] The first and second parts of the target nucleic acid molecules are preferably located at their 3 'and 5' ends respectively. However this is not essential. The target molecule will also normally comprise a third part located between the first and second parts. This part of the molecule comprises a particular sequence to be copied. This can be, if desired, from any source and can have a known or unknown sequence (sometimes referred to as "anonymous"). This can proceed, for example, from random fractionation by mechanical means or by digestion with limited restriction enzymes of a nucleic acid sample.

[0042] Other parts of the target molecules can be provided if desired. For example, designed parts can be provided that act as labels. A "tag" is defined by its function of identifying a particular nucleic acid molecule (or its complement).

[0043] Regardless of which parts are present, the target nucleic acid molecules can be provided by techniques known to those skilled in the art for manipulating nucleic acids. For example, two or more parts can be linked together by ligation. If necessary, appropriate modifications can be made prior to ligation to provide molecules in ligation-ready form. For example, if blunt-ended ligation is desired then a specific single-stranded exonuclease, such as nuclease S1, can be used to remove single-stranded parts of the molecules prior to ligation. Linkers and / or adapters can also be used in nucleic acid manipulation. (Useful nucleic acid manipulation techniques are disclosed, for example, in Sambrook et al, Molecular Cloning, 2^to edition, Cold Spring Harbor Laboratory Press (1989)).

[0044] Once a template molecule has been synthesized, it can be cloned into a vector and amplified in a suitable host before being used in the present invention. Alternatively, it can be amplified by PCR. As a further alternative, batches of template molecules can be chemically synthesized using automated DNA synthesizers (eg, from Perkin-Elmer / Applied Biosystems, Foster City, CA).

ES 2 563 643 T3

However, it is important to note that the present invention enables large quantities of nucleic acid molecules of identical sequence to be provided in a colony originating from a single template molecule. Additionally, the template can be reused to generate other colonies. Therefore, for use in colony formation, it is not essential to provide large amounts of template molecules.

[0046] The mold can have any desired length, as long as it can participate in the method of the present invention. Preferably it is at least 10, more preferably at least 20 bases in length. More preferably it is at least 100 or at least 1000 bases in length. As is the case with primers for use in the present invention, the templates may comprise bases of natural and / or non-natural origin.

Reaction conditions

[0047] Turning now to the reaction conditions suitable for the method of the present invention, it will be appreciated that the present invention utilizes repetitive steps of primer pairing with templates, primer extension and separation of extended primers from templates. These steps can generally be performed using reagents and conditions known to those skilled in the pCr (or reverse transcriptase plus PCR) arts. PCR techniques are disclosed, for example, in "PCR: Clinical Diagnostics and Research", published in 1992 by Springer-Verlag.

[0048] Thus a nucleic acid polymerase can be used together with a supply of nucleoside triphosphate molecules (or other molecules that act as precursors of nucleotides present in DNA / RNA, such as modified nucleoside triphosphates) to extend primers in the presence of a suitable mold.

Desirably, an excess of deoxyrubonucleoside triphosphates is provided. Preferred deoxyribonucleoside triphosphates are abbreviated as follows: dTTP (deoxythymidine nucleoside triphosphate), dATP (deoxyadenosine nucleoside triphosphate), dCTP (deoxycytosine nucleoside triphosphate) and dGTP (deoxyguanosine nucleosphoside) triphosphate. The preferred ribonucleotide triphosphates are UTP, ATP, CTP, and GTP. However, alternatives are possible. They can be of natural or non-natural origin. A buffer of the type generally used in PCR reactions can also be provided.

[0050] To incorporate nucleotides during primer extension a nucleic acid polymerase is used which is preferably stable under the relevant reaction conditions so that it can be used several times. (This is particularly useful in automated amplification procedures.) Therefore, when heating is used to separate a newly synthesized nucleic acid strand from its template, it is preferable that the nucleic acid polymerase is thermostable at the temperature used. Such thermoset polymerases are known to those skilled in the art. These polymerases can be obtained from thermophilic microorganisms and include the DNA-dependent DNA polymerase known as Taq polymerase and also its thermostable derivatives. (However, the nucleic acid polymerase need not be DNA dependent and may be RNA dependent. Thus it may be a reverse transcriptase, ie, an RNA dependent DNA polymerase).

[0051] Generally, the pairing of a primer with its template takes place at a temperature of 25 to 90 ° C. This temperature range will normally be maintained during primer extension. After sufficient time has elapsed to allow for pairing and also to allow a desired degree of primer extension, the temperature can be increased, if desired, to allow strand separation. In this phase the temperature will generally be increased to a temperature of 60 to 100 ° C. (Elevated temperatures can also be used to reduce non-specific priming problems before mating.) These can be used to control the colony start time, for example to synchronize the start of the colony for various samples. Alternatively, the chains can be separated by treatment with a low salinity, high pH solution (> 12) or by using a chaotropic salt (eg guanidium hydrochloride) or by an organic solvent (eg formamide).

[0052] After the separation of the chain (for example, by heating), a washing step will preferably be carried out. The washing step can be omitted between initial rounds of mating, primer extension and strand detachment, and if desired, to keep the same templates close to the immobilized primers. This allows the molds to be used multiple times to initiate colony formation. (It is preferable to provide a high concentration of template molecules initially so that many colonies are started in one phase).

[0053] The size of the colonies can be controlled, for example, by controlling the number of mating cycles, primer extension and strand separation that occur. Other factors that affect colony size can also be controlled. These include the number and arrangement on a surface of immobilized primers, the conformation of a support on which the primers are immobilized, the length and stiffness of the template and / or of the primer molecules, the temperature and the ionic strength and the viscosity. of a fluid in which the cycles mentioned above can be performed.

ES 2 563 643 T3

Uses of the colonies

[0054] Once the colonies have formed they can be used for any desired purpose.

[0055] For example, they can be used in nucleic acid sequencing (either partial or complete), in diagnostics, in screening, as supports for other components, and / or for research purposes (preferred uses will be described in more detail). go ahead). If desired, the colonies can be modified to provide different colonies (referred to herein as "secondary colonies" to differentiate them from the initially formed "primary colonies").

Surfaces comprising immobilized nucleic acid strands

[0056] A surface comprising immobilized nucleic acid strands as colonies of single stranded nucleic acid molecules is also within the scope of the present invention.

[0057] Normally each immobilized nucleic acid chain within a colony will be located on the surface in such a way that an immobilized nucleic acid chain complementary to it is located on the surface at a distance of the length of said acid chain immobilized nucleic acid (i.e., the length of the molecule). This makes it possible to provide nucleic acid chains and their complements at very high density in immobilized form. Preferably they will be proportions substantially equal to those of a given nucleic acid chain and its complementary within a colony. Preferably, within the colony, a nucleic acid strand and its complement will be distributed substantially homogeneously.

[0058] It is also possible to provide a surface comprising single-stranded nucleic acid strands in the form of colonies, in which, in each colony, the coding and non-coding single strands are provided in such a way that the two strands are no longer in absolutely complementary, or are simply partly complementary. Such surfaces are also within the scope of the present invention. Typically such surfaces are obtained after treating primary colonies, for example, by partial digestion with restriction enzymes or by partial digestion after strand separation (for example, after heating) by an enzyme that digests single-stranded DNA, or by chemical or physical means (eg, by irradiating with light colonies that have been stained with an intercalating dye, eg, ethidium bromide).

[0059] Once single-stranded colonies are provided, they can be used to provide double-stranded molecules. This can be done, for example, by providing a suitable primer (preferably in solution) that hybridizes to the 3 'ends of immobilized single-stranded molecules and then extending that primer using a nucleic acid polymerase and a supply of nucleoside triphosphates (or other precursors. nucleotide).

[0060] Thus, surfaces comprising colonies of non-bridged single-stranded nucleic acid molecules are also within the scope of the present invention. (The term "non-bridged" is used herein to indicate that the molecules are not in the form of bridging structures such as those shown, for example, in Figure 1h).

[0061] Using the present invention, small colonies can be provided that contain large amounts of nucleic acid molecules (either single or double stranded). Therefore, many colonies can be located on a surface that has a small area. Therefore, the colony densities that can be obtained can be very high, as indicated above.

[0062] Generally, different colonies will comprise different amplified nucleic acid strands and amplified complementary strands thereof. Thus, the present invention allows many different populations of amplified nucleic acid molecules and their complements to be placed on a single surface having a relatively small surface area. The surface will normally be flat, although this is not essential.

Apparatus

[0063] The present invention also provides an apparatus for providing a surface comprising colonies of the immobilized nucleic acid molecules noted above.

Said apparatus may include one or more of the following:

a) means for immobilizing primers on a surface (although this is not necessary if immobilized primers have already been provided);

b) a supply of a nucleic acid polymerase;

ES 2 563 643 T3

c) a supply of nucleotide precursors to be incorporated into a nucleic acid (for example, a supply of nucleoside triphosphates);

d) means for separating paired nucleic acids (eg heating means);

Y

e) control means to coordinate the different steps required for the method of the present invention.

Other apparatus are within the scope of the present disclosure. These allow the immobilized nucleic acids produced by the method of the present invention to be analyzed. This may include a source of reactants and detection means to detect a signal that can be generated once one or more reactants have been applied to the immobilized nucleic acid molecules. This can also be provided with a surface comprising immobilized nucleic acid molecules in the form of colonies, as described above.

[0066] If possible the means for detecting a signal has sufficient resolution to allow it to differentiate between signals generated from different colonies.

[0067] The apparatus of the present disclosure (of whatever nature) are preferably provided in automated form such that once they have been activated, individual process steps can be repeated automatically.

The present invention will now be described without limitation thereof in the following sections A to I with reference to the accompanying drawings.

[0069] It should be appreciated that the procedures using the DNA molecules referred to in these sections are applicable, with due changes, to RNA molecules, unless the context indicates otherwise.

[0070] It should also be appreciated that when sequences are provided in the following description, they are written in the 5 'to 3' direction (left to right), unless the context indicates otherwise.

[0071] The figures provided are summarized below:

FIGURE 1 illustrates a method of simultaneous amplification and immobilization of nucleic acid molecules using a single type of primer.

FIGURE 2 illustrates how colony growth can occur using a method of the present invention.

FIGURE 3 illustrates the principle of the method used to produce DNA colonies using the present invention. It also illustrates the mating, elongation, and denaturation steps that are used to provide such colonies.

FIGURE 4 is an example of DNA colonies formed by amplification of a specific template with single primers grafted onto a surface.

FIGURE 5 illustrates a method of simultaneous amplification and immobilization of nucleic acid molecules using two types of primers.

FIGURE 6 shows actual DNA colonies produced by the present invention.

FIGURE 7 illustrates a method of simultaneous amplification and immobilization of nucleic acid molecules when using, as a template, a target molecule having internal sequences that are paired with primers.

FIGURE 8 illustrates a method for synthesizing additional copies of the original nucleic acid strands using nucleic acid strands present in colonies. The newly synthesized chains are shown in solution but can be provided in immobilized form if desired.

FIGURE 9 shows PCR amplification of DNA from DNA found in previously formed DNA colonies.

FIGURE 10 illustrates how secondary primers can be generated from DNA colonies.

FIGURE 11 illustrates how secondary DNA colonies can be generated from secondary primers.

ES 2 563 643 T3

FIGURE 12 illustrates how primers with different sequences can be generated from a surface functionalized with existing primers.

FIGURE 13 represents methods of preparing DNA fragments suitable for the generation of DNA colonies.

FIGURE 14 illustrates a method for synthesizing cRNA using the DNA colony as a substrate for RNA polymerase.

FIGURE 15 illustrates a preferable method for determining the DNA sequence of DNA present in individual colonies.

FIGURE 16 illustrates a method of determining the sequence of a DNA colony, de novo.

FIGURE 17 illustrates the utility of secondary DNA colonies in assaying mRNA expression levels.

FIGURES 18 and 19 illustrate the use of secondary DNA colonies in the isolation and identification of new and rare expressed genes.

A) Scheme showing simultaneous amplification and immobilization of nucleic acid molecules using a single type of primer

Referring now to Figure 1a), a surface is provided having a plurality of primers attached thereto (for simplicity only one primer is shown). Each primer (1) is attached to the surface by a linkage indicated by a dark colored block. This bond can be covalent or non-covalent but must be strong enough to hold a primer in place on the surface. Primers having a short nucleotide sequence (5'-ATT) are shown. However, in practice longer sequences could generally be provided.

[0073] Figure 1b) shows a target molecule (II) that has been paired with a primer. The target molecule comprises at its 3 'end a sequence (5'-ATT) that is complementary to the primer sequence (5'-ATT). At its 5 'end the target molecule comprises a sequence (5'-ATT) that is the same as the primer sequence (although exact identity is not required).

[0074] Between the two ends any sequence to be amplified can be provided (or the complementary one to any sequence to be amplified). As an example, part of the sequence to be amplified is shown as 5'-CCG.

[0075] A primer extension is shown in Figure 1c). In this case, a DNA polymerase is used together with dATP, dTTP, dGTP and dCTP to extend the primer (5'-ATT) from its 3 'end, using the target molecule as a template.

[0076] When primer extension is complete, as shown in Figure 1d), it can be seen that an immobilized extended strand (III) is provided which is complementary to the target molecule. The target molecule can then be separated from the extended immobilized chain (eg, by heating, as shown in Figure 1e)). This separation step releases the immobilized, extended strand so that it can then be used to initiate a subsequent round of primer extension, as shown in Figures 1f) and 1g). In this case, the immobilized extended strand is bent in such a way that one end of this strand (which has the terminal sequence 5'-AAT) pairs with another primer (2, 5'-ATT), as shown in Figure 1f). This primer provides a 3 'end from which primer extension can occur, this time using the extended, immobilized strand as a template. In Figure 1g) it is shown that primer extension is taking place and in Figure 1h) that it is ending.

[0077] Figure 1i) shows the two extended immobilized chains shown in Figure 1h) after their separation (eg by heating). Each of these strands can then itself be used as templates in subsequent rounds of primer extension initiated from new primers (3 and 4), as shown in Figures 1j) and 1k). After two rounds of amplification four single stranded immobilized strands can be provided followed by a strand separation step (eg by heating), as shown in Figure 11). Two of these have sequences corresponding to the sequence of the target molecule originally used as a template. The other two have sequences complementary to the sequence of the target molecule originally used as a template. (In practice a given immobilized chain and its immobilized complementary can pair together).

[0078] It will therefore be appreciated that a given sequence and its complement can be provided in the same amounts in immobilized form and that they can be substantially homogeneously distributed within

ES 2 563 643 T3 of a colony.

[0079] Of course, subsequent rounds of amplification can be performed in addition to those shown in Figure 1, such that colonies comprising large amounts of a given single-stranded nucleic acid molecule and a strand complementary thereto can be provided. Only one template needs to be used to start each colony, although one template can be reused to start multiple colonies if desired.

[0080] It will be appreciated that the present invention enables the provision of very high densities of immobilized, extended nucleic acid molecules. Within a colony each extended, immobilized molecule will locate on a surface within a molecule length of another extended, immobilized molecule. Thus, position 3 shown in Figure 11) is within a molecule length of position 1; position 1 is within a molecule length of position 2; and position 2 is within a molecule length of position 4.

[0081] Figure 2 is provided to illustrate how colony growth can occur (using the method described with reference to Figure 1 and Figure 6 or any method of the present invention to provide immobilized nucleic acid molecules).

A schematic plan view of a flat plate is shown having primers immobilized thereon in a square grid pattern (primers are indicated by small dots). A regular grid is used purely for the sake of simplicity: in many real-world cases, the primer positions should in fact be less ordered or random.

[0083] At the position indicated by an arrow X a template molecule has been paired with a primer and an initial piece of primer extension has been produced to provide an immobilized, extended nucleic acid strand. After strand separation, one end of this strand is left free to pair with additional primers such that other, extended, immobilized nucleic acid strands can be produced. This is shown to have occurred sequentially at the positions indicated by the letter Y. For simplicity, the primer selected for mating is located close to the primer that carries the nucleic acid strand: in actual cases, the acid strand nucleic would pair with a primer that is not the closest neighbor. However, it is obvious that this primer will be at a distance equal to the length of the nucleic acid strand.

[0084] It will be appreciated that, for colony cell growth to occur, only mating is required at one of these positions (rather than all).

[0085] After other immobilized, extended, single-stranded nucleic acid molecules have been provided at the positions indicated by the letter Y, the resulting molecules can themselves pair with other primers and the process can continue to provide a colony comprising a large number of nucleic acid molecules immobilized in a relatively small area.

[0086] Figure 3 shows a simplified version of the cycle of mating, elongation and denaturation. It also represents the typical observations that can be made, as can be seen in the examples shown in Figures 4 and 6. The simultaneous amplification and immobilization of nucleic acids using solid phase primers has been successfully performed using the procedure described in the Examples. 1, 2 and 3 below:

EXAMPLE 1

[0087] Oligonucleotides, 5 'end phosphorylated (Microsynth GmbH, Switzerland), were grafted into Nucleolink plastic microtiter wells (Nunc, Roskilde, Denmark). The sequence of oligonucleotide p57 corresponds to the sequence 5'-TTTTTTCACCAACCCAAACCAACCCAAACC and that of p58 corresponds to the sequence 5'-TTTTTTAGAAGGAGAAGGAAAGGGAAAGGG. Microtiter wells with p57 or p58 were prepared as follows. To each Nucleolink well, 30 µl of a solution of the 160nM oligonucleotide in 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals, St. Louis, MO) was added. To each well, 10 µl of 40 mM 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole was added to the oligonucleotide solution. The wells were then closed and incubated at 50 ° C overnight. After incubation; wells were washed twice with 200 µl RS (0.4 N NaOH, 0.25% Tween 20 (Fluka Chemicals, Switzerland)), incubated for 15 minutes with RS 200 µl RS, washed twice with RS 200 µl and twice with TNT (100 mM TrisHCl, pH 7.5, 150 mM NaCl, 0.1% Tween 20) 200 µl. The tubes were dried at 50 ° C and stored in a closed plastic bag at a temperature of 4 ° C.

The generation of the colonies was started in each well with 15 µl of priming mix; 1 nanogram of template DNA (in which the template DNA begins with the sequence 5'-AGAAGGAGAAGGAAAGGGAAAGGG and ends

ES 2 563 643 T3 at the 3 'end with the sequence CCCTTTCCCTTTCCTTCTCCTTCT-3'), all four dNTPs (0.2 mM), 0.1% BSA (bovine serum albumin, Boehringer-Mannheim, Germany), Tween 20 0.1%, 8% DMSO (dimethylsulfoxide, Fluka Chemicals, Switzerland), 1X Amplitaq PCR buffer, and 0.025 units ^ l AmpliTaq DNA polymerase (Perkin Elmer, Foster City, CA). The priming reaction was a single round of PCR under the following conditions: 94 ° C for 4 minutes, 60 ° C for 30 seconds, and 72 ° C for 45 seconds in a thermal cycler (PTC 200, MJ Research, Watertown, MA). 100 µl TE buffer (10 mM trisHCl, pH 7.5, 1 mM EDTA) was then used in three successive one minute washes at 94 ° C. The DNA colonies were then formed by adding to each well, 20 µl of polymerization mix, which was identical to the priming mix but lacking template DNA. The wells were then placed in the PTC 200 thermal cycler and the growth of the colonies was performed by incubating the closed wells for 4 minutes at 94 ° C and cycling for 50 repetitions under the following conditions: 94 ° C for 45 seconds, 65 ° C for 2 minutes, 72 ° C for 45 seconds. After completion of this program, the wells were kept at 8 ° C until further use.

[0089] A 640 base pair fragment corresponding to the core sequence of the template (but not including the sequence 5'-AGAAGGAGAAGGAAAGGGAAAGGG) was amplified by PCR. PCR. The isolated fragment was labeled with biotin-N⁴-dCTP (NEN Life Sciences, Boston, MA) and a trace of [a-³²P] dCTP (Amersham, UK) using the Primet-it II labeling kit (Stratagene, San Diego, CA) to generate a biotin-labeled probe.

[0090] The biotin-labeled probe was diluted to a concentration of 2.5 nM in EasyHyb (Boehringer-Mannheim, Germany) and 15 µl was hybridized in each sample with the following temperature scheme (PTC 200 thermocycler): 94 ° C for 5 minutes, followed by 500 steps of 0.1 ° C decrease in temperature every 12 seconds (in other words, the temperature dropped to 45 ° C in 100 minutes). Afterwards, the samples were washed as follows; 1 time with 2X SSC / 0.1% SDS (2X SSC; 0.3 M Na-Cl / 0.03 M sodium citrate pH 7.0 / 0.001 mg / ml sodium dodecyl sulfate) at room temperature, once with 2X SSC / 0.1% SDS at 37 ° C and once with 0.2X SSC / 0.1% SDS at 50 ° C. The wells were then incubated for 30 minutes with 50 μl of red fluorescent, covered with Neutravidin, FluoSpheres^(R) 40 nm (excitation at 580 nm and emission at 605 nm, Molecular Probes Inc., Eugene, OR) in 0.1% TNT / BSA. (The microsphere solution was prepared from a 2 μl dilution of the microsphere stock solution in 1 ml of 0.1% TNT / BSA, which was then sonicated for 5 minutes in an ultrasound water bath. at 50 W (Elgasonic, Switzerland), followed by filtration through a 0.22 μιτι filter (Millex GV4). The wells were then counted (Cherenkov) in a Microbeta plate scintillation counter (WALLAC, Turku, Finland).

[0091] The FluoSpheres^(R) leftovers were removed by washing for 30 min in TNT / 0.1% BSA at room temperature. Images of the stained samples were viewed using a 20X objective on an inverted microscope (Axiovert S100TV, Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax512x768 CCD camera (Princeton instruments, Trenton, NJ) through a set of XF43 filters. (PB546 / FT580 / LP590, Omega Optical, Brattleboro, VT) with a 5 second exposure.

[0092] Figure 4 shows the hybridization results of colony generation in tubes functionalized with either: (a) oligonucleotide p57 or (b) oligonucleotide p58. The control reaction shows very little fluorescent spots, since the sequence of the flanking regions in the template does not correspond to the primer sequences grafted onto the well. Instead, Figure 4b shows the number of fluorescent spots detected when the primers grafted into the wells correspond to the flanking sequences in the DNA primer template. Calculating the number of fluorescent spots detected and taking into account the magnification, it can be estimated that there are between 3 and 5 x 10⁷ colonies / cm². The photographs were generated with the Winview 1.6.2 program (Princeton Instruments, Trenton, NJ) with backgrounds and intensities normalized to the same values.

B) Scheme showing simultaneous amplification and immobilization of nucleic acid molecules using two different types of primers

Referring now to Figure 5, another embodiment of the present invention is illustrated. In this embodiment, two different immobilized primers were used to provide primer extension.

[0094] In this embodiment the target molecule shown is provided with a nucleotide sequence at its 3 'end (AAT-3') that is complementary to the sequence of a first primer, (5'-ATT, I), which is grafts onto the surface so that mating with that primer can occur. The sequence (5'-GgT) at the 5 'end of the target molecule, III, corresponds to the sequence (5'-GGT) of a second primer, II, which is also grafted onto the surface, such that the sequence that is complementary to the sequence at the 5 'end can be paired with this said second primer. Generally said complementary sequence (5'-ACC) is selected in such a way that it does not pair with the first primer (5'-ATT). Despite the situation described in section A, once the 3 'end of a newly synthesized strand is paired with a primer on the surface, you will have to find a primer whose sequence is different from the sequence it carries in its 5 'end (see the difference between Figures 1f and 5f).

ES 2 563 643 T3

The embodiment shown in figure 5 has an advantage over the embodiment illustrated in figure 1 in that the possibility of one end of a single-stranded target molecule mating with another end of the same molecule in solution can be avoided and thus both amplification can go ahead. The possibility of pairing between both ends of an immobilized complement to a target molecule can also be avoided.

EXAMPLE 2

[0096] A mixture of two oligonucleotides that were phosphorylated at the 5 'end ((Microsynth GmbH, Balgach, Switzerland) was grafted onto 96-well Nucleolink plates (Nunc, Denmark) according to the manufacturer's recommendations. The resulting plates were stored dry at 4 ° C. The sequence of the primer, P1, was 5'-GCGCGTAATACGACTCACTA, the sequence of the other primer, P2, was 5'-CGCAATTAACCCTCACTAAA. These plates were specially formulated from Nunc, and allow covalent grafting of phosphorylated DNA fragments at the 5 'end via a standard procedure.

[0097] A template was cloned into a vector (pBlueScript Skminus, Stratagene Inc, San Diego, CA) with the appropriate DNA sequence at the cloning site (ie, corresponding to P1 and P2 at position 621 and 794 respectively) and a linear double-stranded DNA template of 174 bp in length was obtained by PCR amplification, using P1 and P2. The template PCR product was purified on Qiagen Qia-quick columns (Qiagen GmbH, Hilden, Germany) to remove nucleotides and primers used during PCR amplification.

[0098] The purified template (in a 50 µl solution containing 1X PCR buffer (Perkin Elmer, Foster City, CA) with the four deoxyrubonucleoside triphosphates (dNTP) at 0.2 mM (Pharmacia, Uppsala, Sweden) and 2, 5 units of AmpliTaq Gold DNA polymerase (Perkin Elmer, Foster City, CA)) was dispersed on the support, i.e. on the P1 and P2 grafted Nucleolink plates (plates had been washed with a solution containing TRIS-HCl 100 mM (pH 7.5), 150 mM NaCl and 0.1% Tween 20 (Fluka, Switzerland) at room temperature for 15 min). This solution was incubated at 93 ° C for 9 minutes to activate DNA polymerase and then 60 cycles (94 ° C / 30 sec; 48 ° C / 30 sec; 72 ° C / 30 sec) were performed in a PTC 200 thermal cycler. Several different concentrations of PCR template were analyzed (approximately 1, 0.5, 0.25, 0.125, 0.0625 ng / μl) and for each sample a control reaction carried out without Taq polymerase was carried out (the same conditions as above but without DNA polymerase).

Each sample was stained with YO-PRO (Molecular Probes, Portland OR), a highly sensitive dye for double-stranded DNA. The resulting products were observed with a confocal microscope using a 40X objective (LSM 410, Carl Zeiss AG, Oberkochen, Germany) with appropriate excitation (an argon 488 laser) and detection filters (a 510 low-pass filter) (note : the bottom of each well is flat and allows observation with an inverted fluorescence microscope).

[0100] In Figure 6A, the control well (no added DNA template, panel a) shows only foreign objects that can be seen on a white surface (these objects were useful at this stage to indicate that the focus was correct ). These objects were irregular in shape, 20 to 100 microns in size, and were much larger than the depth of the field of observation. In a well where there was DNA polymerase (Figure 6A, panel ii), in addition to the irregularly shaped objects observed in the control well, a large number of fluorescent spots were observed. These were circular in shape, 1 to 5 microns in size, and did not occupy the visual field. The number of spots depended on the concentration of the template used to initiate colony formation. From the observed size of the colonies, it can be estimated that more than 10,000 distinct colonies can be arranged within 1 mm² of support.

EXAMPLE 3

[0101] Oligonucleotides (Microsynth GmbH, Switzerland) were grafted into Nucleolink wells (Nunc, Denmark). Oligonucleotide P1 corresponds to the sequence 5'-TTTTTTCTCACTATAGGGCGAATTGG and oligonucleotide P2 corresponds to 5'-TTTTTTCTCACTAAAGGGAACAAAAGCTGG. To each Nucleolink well, a 45 µl solution of 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals, St. Louis, MO) containing 360 fmol of P1 and 360 fmol of P2 was added. To each well, to the oligonucleotide solution, 15 µl of 40 nM 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (pH 7.0) (Sigma Chemicals) in 1-methyl-imidazole was added. The wells were then closed and incubated at 50 ° C for 16 hours.

[0102] After incubation, wells were rinsed twice with RS 200 µl (0.4 N NaOH, 0.25% Tween 20), incubated for 15 minutes with RS 200 µl, washed twice with RS 200 µl, and twice with 200 µl TNT (100 mM Tris / HCl, pH 7.5, 150 mM NaCl, 0.1% Tween 20), before drying at 50 ° C in an oven. The dry tubes were stored in a closed plastic bag at a temperature of 4 ° C.

[0103] Colony growth was initiated in each well with 15 µl of starter mix (1X PCR buffer, 0.2 mM dNTPs and 0.75 units of AmpliTaq Gold DNA polymerase, 20 nanograms of template DNA, in the that he

ES 2 563 643 T3 DNA template was S1 DNA or S2 DNA or a mixture of different proportions of S1 DNA and S2 DNA, as indicated in the comment of Figure 6B. S1 and S2 are fragments of 704 and 659 base pairs, respectively, that have been cloned in the plasmids pBlue-Script Skminus and subsequently amplified through PCR using P1 and P2 as primers. Fragments were purified on Qiagen Qia-quick columns (QIAGEN GmbH, Germany) to remove nucleotides and primers.

[0104] Each well was closed with Cycleseal ™ (Robbins Scientific Corp., Sunnyvale, CA), and incubated at 93 ° C for 9 minutes, at 65 ° C for 5 minutes and at 72 ° C for 2 minutes and again at 93 ° C. Then, a 200 µl TNT solution was used in three successive one minute washes at 93 ° C. The starter mix was then replaced by 15 µl growth mix (the same as the starter mix, but without template DNA), and growth was performed by incubating the sealed wells for 9 minutes at 93 ° C and repeating the following 40 times. conditions: 93 ° C for 45 seconds, 65 ° C for 3 minutes, 72 ° C for 2 minutes. After completing this program, the wells were stored at 6 ° C until use. Temperature control was performed in a PTC 200 thermal cycler, using a silicon pad provided in the Nucleolink kit and the plate was heated (104 ° C) in the PTC 200 thermal cycler.

[0105] A 640 base pair fragment corresponding to the core sequence of the S1 fragment, but which did not include the P1 or P2 sequence, was amplified by PCR, as described above. The probe was labeled with biotin-16-dUTP (Boehringer-Mannheim, Germany) using the Prime-it II Random Primer Labeling Kit (Stratagene, San Diego, CA) according to the manufacturer's instructions.

[0106] The biotin-labeled probes were hybridized with the samples in EasyHyb buffer (Boehringer-Mannheim, Germany), using the following temperature scheme (in the PTC 20 thermocycler): 94 ° C for 5 minutes, followed by 68 steps of decreasing 0.5 ° C temperature every 30 seconds (in other words, the temperature decreased to 60 ° C in 34 minutes), using closed wells. The samples were then washed 3 times with 200 µl of TNT at room temperature. The wells were then incubated for 30 minutes with 50 µl TNT containing 0.1 mg / ml BSA. The wells were then incubated for 5 minutes with 15 µl of red fluorescent solution, covered with Neutravidin, FluoSpheres^(R) 40 nm (excitation at 580nm and emission at 605 nm, Molecular Probes, Portland, OR). The microsphere solution was prepared from a 2 µl dilution of the microsphere stock solution, which had been sonicated for 5 minutes in a 50 W ultrasound water bath (Elgasonic, Switzerland), diluted in 1 ml. of TNT solution containing 0.1 mg / ml BSA and filtered with a Millex GV4 0.22 pm pore size filter (Millipore, Bedford, MA).

[0107] The stained samples were observed using an inverted Axiovert 10 microscope using a 20X objective (Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera (Princeton Instruments, Trenton, NJ), using an XF43 filter set. (PB546 / FT580 / LP590, Omega Optical, Brattleboro, VT), and 10 seconds of light collection. The files were converted to TIFF format and processed in the appropriate software (PhotoPaint, Corel Corp., Ottawa, Canada). The processing consisted of linear contrast and inversion enhancement, to provide an image suitable for black and white printing on a laser printer.

[0108] Figure 6B shows the results of 3 different ratios of the S1 / S2 templates used in the initiation reaction: i) the ratio of S1 / S2 is 1/0, many spots can be observed, ii) the ratio of S1 / S2 is 1/10, and the number of spots is approximately 1/10 of the number of spots that can be seen in the image i), as expected and iii) the S1 / S2 ratio is 0/1 , and only a few infrequent spots can be seen.

Scheme showing simultaneous amplification and immobilization of nucleic acid molecules when the target molecule contains internal sequences complementary to the immobilized primers

[0109] Figure 7 is provided to show that the sequences shown at the 5 'and 3' ends of the target molecule illustrated in Figures 1 and 5 need not be located at the ends of a target molecule.

[0110] A target nucleic acid molecule (II) may have a sequence at each (or either) end that is not involved in primer matching or acting as a template to provide a complementary sequence that matches a primer ( 5'-AAA sequence and 5'-CCC sequence). One of the internal sequences (5'-AAT) is used as a template to synthesize a complementary sequence, III, to the same (5'-TTT) as can be seen from Figures 7 (a) to 7 (e).

[0111] However, the 5'-TTT sequence itself is not used to provide a sequence complementary to it, as is apparent from Figures 7 (f) to 7 (k). In Figure 7 (I) it can be seen that only one of the four immobilized strands is shown after two rounds of primer extension and that a strand separation step comprises the additional sequence 5'-TTT and that there is no strand that understands a

ES 2 563 643 T3 complementary sequence (5'-AAA) to this sequence (ie there is only one chain that is significantly longer than the others). After several rounds of amplification the strand comprising the 5'-TTT sequence will represent a negligible proportion of the total number of immobilized, extended nucleic acid molecules present.

D) The use of nucleic acid chains present in colonies to synthesize additional copies of nucleic acid chains

[0112] The amplified, single-stranded nucleic acid molecules present in colonies provided by the present invention can themselves be used as templates to synthesize additional nucleic acid strands.

[0113] Figure 8 illustrates a method for synthesizing additional nucleic acids using immobilized nucleic acids as a starting point.

[0114] Colonies will normally comprise both a given nucleic acid strand and its complementary in immobilized form (Figure 8a). Therefore these can be used to provide additional copies not only in a given nucleic acid chain but also of its complementary one.

[0115] One way to do this is to provide one or more primers (TTA and TGG primers) in solution that pair with immobilized, amplified nucleic acid strands present in colonies (Figure 8c) provided by the present invention. (These primers can be the same as the primers initially used to provide the immobilized colonies, being provided separately, in free form, rather than in immobilized form). The original DNA colony is denatured by heating in its single-stranded form (Figure 8b), which allows primers TTA and TGG to pair at the available 3 'end of each DNA strand. Then, primer extension, using AmpliTaq DNA polymerase and the four deoxyribonucleoside triphosphates (labeled or not) can be used to synthesize complementary strands with immobilized nucleic acid strands or at least parts thereof (step (iii)).

[0116] Once the newly formed strands have been synthesized (Figure 8d) by the process described above, they can be separated from the immobilized strands to which they are hybridized (eg, heating). The process can be repeated if desired using the PCR reaction, to provide a large number of such chains in solution (Figure 8e).

[0117] If desired, strands synthesized in this way, after separation of the immobilized strands, can be paired with each other (ie a given strand and its complement can hybridize) to provide double-stranded nucleic acid molecules in solution. Alternatively, they can be separated from each other to provide homogeneous populations of single-stranded nucleic acid molecules in solution.

[0118] It is also to be noted that, once the single-stranded molecules are provided in solution, they can be used as templates for PCR (or reverse PCR). Therefore it is not essential to continue using immobilized nucleic acid strands to obtain further amplification of particular strands or strands complementary thereto.

[0119] It should be noted that, when a plurality of colonies are provided and the nucleic acid strands in different colonies have different sequences, it is possible to select only certain colonies for use as templates in the synthesis of additional nucleic acid molecules. This can be done using primers for the extension of primers that are specific for molecules present in selected colonies.

[0120] Alternatively, primers can be provided to allow several or all colonies to be used as templates. Such primers can be a mixture of many different primers (eg, a mixture of all primers originally used to provide all colonies, but the primers being provided in solution rather than in immobilized form).

EXAMPLE 4

[0121] Microsynth GmbH (Balgach, Switzerland) oligonucleotides were grafted into Nucleolink wells (Nunc, Denmark). Oligonucleotide P1 corresponds to the sequence 5'-TTTTTTTTTTCACCAACCCAAACCAACCCAAACC and oligonucleotide P2 corresponds to 5'-TTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG. To each Nucleolink well, a 45 µl solution of 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals) containing 360 fmol of P1 and 360 fmol of P2 was added. To each well, 15 µl of 40 mM 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole was added to the oligonucleotide solution. The wells were then closed and incubated at 50 ° C for 16 hours. After incubation, the wells were rinsed twice with 200 µl of RS (0.4 N NaOH, 0.25% Tween 20), incubated for 15 minutes with 200 µl RS, washed two times.

ES 2 563 643 T3 times with RS 200 μΙ, and twice with TNT (100 mM Tris / HCl, pH 7.5, 150 mM NaCl, 0.1% Tween 20) 200 μΙ, before drying in a oven at 50 ° C. The dry tubes were stored in a closed plastic bag at a temperature of 4 ° C.

[0122] Colony growth was started in each well with 15 µl of starter mix (1X PCR buffer, 0.2 mM dNTPs and 0.75 units of AmpliTaq DNA polymerase, 20 nanograms of template DNA, where the DNA The template was DNA S1 or AdN S2 or a 1/1 mixture of DNA S1 and AdN S2, as indicated in the comment of Example 3. S1 and S2 are fragments of 658 and 704 base pairs, respectively, which have been prepared as described in Example 3.

[0123] Each well was sealed with Cycleseal ™ (Robbins Scientific Corp., Sunnyvale, CA), and incubated at 93 ° C for 9 minutes, at 65 ° C for 5 minutes and at 72 ° C for 2 minutes and again at 93 ° C. Then, a 200 µl TNT solution was used in three successive one minute washes at 93 ° C. The starter mix was then replaced with 15 μl of growth mix (the same as the starter mix, but without template DNA), and growth was accomplished by incubating the sealed wells for 9 minutes at 93 ° C and repeating 40 times the following conditions: 93 ° C for 45 seconds, 65 ° C for 3 minutes, 72 ° C for 2 minutes. After completing this program, the wells were stored at 6 ° C until later use. Temperature control was carried out in a PTC 200 thermal cycler.

[0124] Different treatments were applied to 6 sets (A, B, C, D, E and F) of 3 wells (1,2,3), one prepared with template S1, one with template S1 and template S2 and one prepared only with S2 mold (which produces A1, A2, A3, ..., F1, F2, F3). Pool A was untreated, Pool B was incubated for 10 minutes with BAL-31 exonuclease (New England Biolabs, Beverly, MA) at 37 ° C in BAL-31 buffer (BAL-31 essentially digests double-stranded DNA having both ends free), pool C was incubated for 10 minutes with nuclease S1 (Pharmacia Uppsala, Sweden) at 37 ° C in buffer S1 (nuclease S1 essentially digests single-stranded DNA), pool D, E and F were incubated with both BAL- 31 as with nuclease S1. Reactions were stopped by washing wells with TNT buffer.

[0125] PCR (25 cycles, 30 s at 94 ° C, 45 s at 60 ° C, 45 s at 72 ° C) was performed in the Nucleolink wells with primers 0.25 μM P70 (5'-CACCAACCCAAACCAACCCAAACCACGACTCACTATAGGGCGAA) and P71 ( 5'AGAAGGAGAAGGAAAGGGAAAGGGTAAAGGGAACAAAAGCTGGA) in solution in pools A, B, C and D. P70 and P71 were suitable for amplification of S1 and S2, since primer P70 contains the sequence of primer P1 and P71 contains that of P2. In set E wells, PCR was performed with a direct (P150, 5'-GGTGCTGGTCCTCAGTCTGT) and reverse (P151, 5'-CCCGCTTACCAGTTTCCATT) primer set that are within S1 and not within S2 to produce a PCR product. of 321 bp, and in the wells of set F, PCR was performed with a set of direct primers (P152, 5'-CTgGcCTTATcCcTAACAGC) and reverse (P153, 5'CGATCTTGGCTCATCACAAT) that are within S2 and not within S1 to produce a 390 bp PCR product. For each of the 18 PCR reactions, 3 µl of 1% agarose gel electrophoresis solution was used in the presence of 0.1 µg / ml ethidium bromide. Gel drawings are shown in Figure 9 showing that DNA in colonies is protected from digestion by exonucleases (sets B, C and D compared to set A) and that both S1 and S2 can be recovered. simultaneously using P1 and P2 (sets A, B, C and D) or specifically (set E and F). In set E and F, where the shorter PCR products were amplified more efficiently than the longer PCR products in sets A, B, C, D, a cross contamination between the S1 templates could be detected and S2 (see lanes E2 and F1).

E) Supply of secondary colonies

[0126] It is also possible to modify initially formed colonies to provide different colonies (ie to provide colonies comprising immobilized nucleic acid molecules with different sequences from those molecules present in the initially formed colonies). In this case, the colonies initially formed are called "primary colonies" and the last colonies formed are called "secondary colonies." To convert the primary colonies into "secondary primers" a preliminary procedure is necessary which will be suitable for the generation of secondary colonies.

[0127] Figure 10 shows how 'secondary primers' are generated using existing primary colonies. As a starting point, the primary colony (Figure 10a) is left in double-stranded form, fully hybridized. A specific single stranded DNA exonuclease could be used to remove all primers that have not been elongated. One could also choose to protect all the 3'-OH ends of the primers with dideoxyribunucleotide triphosphates using a terminal DNA transferase (step (i), figure 10b).

[0128] Second and independently, the DNA molecules that form the colonies can be cleaved using endonucleases. For example, a restriction enzyme that recognizes a specific site within the colony (represented by the arrow 'RE' in Figure 10c) and cleaves the DNA colony (step (ii), Figure 10). If desired, the enzyme-cleaved colony (Figure 10d) can then be partially digested with a specific double-stranded exonuclease II in the 3 'to 5' direction (e.g., E. coli III exonuclease, represented by 'N', step (iii ),

ES 2 563 643 T3 figure below). In either case, the secondary primers are available after denaturation (eg, by heat) and washing (Figure 10e).

[0129] Alternatively, the double-stranded DNA that forms the colonies (Figure 10f) can be digested with the specific double-stranded 3'-5 'exonuclease, which only digests one strand of the double-stranded DNA. An important case is when the exonuclease digests only a few bases of the DNA molecule before being released into solution and when the digestion can take place when another enzyme binds to the DNA molecule (Figure 10g). In this case, the exonuclease digestion will continue until only single-stranded molecules remain that are, on average, half the length of the starting material, and have no complementary parts (which could form partial duplexes) left in the chain molecules. simple in a colony (figure 10h).

[0130] In all cases, these treatments give rise to single-stranded fragments grafted onto a support that corresponds to the sequence of the original template and that can be used for the growth of new DNA colonies if an appropriate new template is provided for initiation. of the colony (Figures 10e and 10h).

[0131] The result of such treatment, therefore a secondary primer attachment support, will be called "secondary colony growth support". Templates useful for the growth of secondary colonies can include molecules that have known sequences (or complementary to such sequences). Alternatively the templates can be derived from unsequenced molecules (eg random fragments). In no case should templates be provided with one or more regions for mating with nucleic acid strands present in the primary colonies.

[0132] Figure 11ae shows how a secondary colony can be generated when a template (TP, Figure 11a) suitable for a second round of DNA colony generation is provided on a support for secondary colony growth, holding secondary primers . In this example, treatment of the primary colony, as described above, has generated the secondary primers, SP1 and SP2 (Figure 11a). The TP template will hybridize with its complementary secondary primer, SP1, and after an extension reaction using a DNA polymerase, as described, it will extend as shown (Figure 12b). After denaturation (stage ii), re-spawning (stage iii) and a DNA polymerase cycle (stage iv), a copy of the original primary colony will form (Figure 11e).

[0133] The maximum size of a secondary colony provided by this embodiment of the present invention is limited by the size of the primary colony on which it grows. Various secondary growth processes can be used sequentially to create colonies for specific applications (ie, a first colony can be replaced by a second colony, the second colony can be replaced by a third colony, etc.).

F) Supply of extended primers

[0134] Figure 12 shows how extended primers can be generated on an oligonucleotide array. The same procedure can be applied to a support covered with colonies or secondary primers as described in section E.

[0135] In Figure 12a) a support is provided having a plurality of immobilized primers shown thereon. Different immobilized primers present in different regions of the support are shown (represented by squares). Primers having the sequence 5'-AAA are shown in one square and primers having the sequence 5'-GGG are shown in another square.

[0136] Figures 12b) to 12d) show how the present initial primers (initial primers) are modified to give different primers (extended primers). In this example, the initial primers having the sequence 5'-AAA are modified to produce two different types of extended primers, which have the sequences 5'-AAAGCC and 5'-AAATAC respectively. This is achieved through hybridization of 5'-GTATTT and 5'-GGCTTT oligonucleotide templates with the primary primers immobilized on the surface (Figure 12b), followed by DNA polymerase reaction. Initial primers having the sequence 5'-GGG are modified to produce two different types of extended primers, having the sequences 5'-GGGTAT and 5'GGGTAA (Figure 12d) in a similar manner.

[0137] The technique of producing extended primers is useful for transforming immobilized oligonucleotides provided on a DNA chip or other surface into immobilized primers useful in amplifying a particular target nucleic acid sequence and / or amplifying a strand complementary thereto. .

G) Preparation of nucleic acid fragments

[0138] The apparatus of the present invention can be used for various procedures, some of which will be described later. Nucleic acid fragments for use in the generation of

ES 2 563 643 T3 colonies can be prepared differently for different procedures (referred to herein as "prepared nucleic acids"). Various preparation procedures are described below:

(i) Preparation of random DNA fragments

[0139] A method is described here for preparing DNA originating from a biological sample (or a plurality of samples) by amplification in the case where it is not necessary to trace the origin of the DNA when it is incorporated into a colony.

[0140] The DNA of interest is first extracted from the biological sample and randomly cut into "small" pieces (eg, 50 to 10,000 bases in length, but preferably 500 to 1,000 base pairs in length, represented by bar "I", figure 13a). (This can be done, for example, by phenol chloroform extraction followed by ultrasound treatment, mechanical shearing, partial digestion with frequent cutter restriction endonucleases, and other methods known to those of skill in the art). To normalize the experimental conditions, the extracted and excised DNA fragments can be fractionated according to their size, for example, by agarose gel electrophoresis, sucrose gradient centrifugation or gel chromatography. Fragments obtained within a single fraction can be used to provide templates to reduce mold size variability.

[0141] Second, the extracted, cut and (optionally) classified template DNA fragments can be ligated with oligonucleotide linkers (IIa and IIb, Figure 13a) containing the sequence of one or more primers that have previously been grafted onto a support. This can be done, for example, using "blunt end" ligation. Alternatively, the template DNA fragments can be inserted into a biological vector at a site that is flanked by the sequence of the primers that are grafted onto the support. This cloned DNA can be amplified within a biological host and extracted. Obviously, if you are working with a single primer grafted on the solid support for the formation of DNA colonies, the purification of the fragments containing both primers P1 and P2 does not pose any problem.

[0142] In the following, the DNA fragments obtained after said suitable process are named with the expression: "prepared genomic DNA" (III, figure 13a).

(ii) Preparation of random DNA fragments originating from a plurality of samples

[0143] It is described here how to prepare DNA originating from a plurality of biological samples in the case where it is necessary to trace the origin of DNA when it is incorporated into a colony.

[0144] The procedure is the same as that described in the previous section, except that in this case, the oligonucleotide linkers that are used to glue the randomly cut genomic DNA fragments are now made up of two parts; the sequence of the primers grafted onto the surface (P1 and P2, figure 13b) and a "tag" sequence that is different for each sample and that will be used to identify the origin of the DNA colony. Note that, for each sample, the label may not be unique, but a plurality of labels can be used. Hereinafter, the DNA fragments obtained after said suitable process will be referred to as "tagged genomic DNA" (III, Figure 13b).

[0145] This labeling procedure can be used to provide colonies that carry an identification medium that is independent of the sequence carried by the template itself. This can also be useful when some colonies are to be specifically recovered (using the procedure given in section D). This could also be useful in the case where the recovered colonies are also processed, for example creating new primary colonies and if a cross reference between the original colonies and the new colonies is desired.

(iii) Preparation of DNA fragments corresponding to a plurality of DNA sequences originating from a sample

[0146] The DNA of interest can first be extracted from a biological sample by any means known to those of skill in the art (as mentioned above). The specific sequences of interest can then be amplified with PCR (step (i), figure 13c) using PCR primers (IIa and IIb) consisting of two parts; 1) at the 5 'end, the sequences correspond to the sequences of one or more primer oligonucleotides that have been grafted onto a surface (P1 and P2) and 2) at the 3' end, to specific primer sequences for the sequence of interest (S1 and S2). Hereinafter, the DNA fragments obtained after said suitable process will be named with the expression: "prepared DNA" (III, figure 13c).

(iv) Preparation of a plurality of DNA fragments originating from a plurality of samples

[0147] The procedure is the same as that indicated in the previous apparatus except that in this case the DNA primers (IIa and IIb) used to carry out the PCR amplification (step (i), figure 13d) are

ES 2 563 643 T3 now made up of three parts; 1) the sequence of the primers grafted onto the surface (P1 and P2), 2) a “tag” sequence that is different for each sample and that will be used for the identification of the origin of the DNA colony and 3) primer sequences that surround the specific sequence of interest (S1 and S2). Note that for each sample, a plurality of labels could be used, as in (ii), above.

[0148] Hereinafter, the DNA fragments obtained after said suitable process will be named with the expression: "tagged DNA" (III, figure 13d). The possible uses of the labels are the same as those indicated in point (ii) above.

(v) Preparation of mRNA

[0149] The procedure is similar to the procedures described for preparing DNA fragments in the previous sections, except that the starting point is to extract mRNA by any means known to those skilled in the art (for example, by using kits of commercially available mRNA preparation). The mRNA can be copied into double-stranded cDNA by any means known to those of skill in the art (eg, using a reverse transcriptase and a DNA polymerase). Certainly, the tags and primers described above can be used in conjunction with the double-stranded cDNA synthesis processes to allow their incorporation into templates. Hereinafter, the mRNA fragments obtained after said suitable processes will be named with the expressions: "Total mRNA prepared" (cf. "Genomic DNA prepared", as described in section (I) above), "Total mRNA labeled ", (Cf." Tagged genomic DNA ", as described in section (ii) above)," Prepared mRNA "(cf." Prepared DNA ", as described in section (iii) above) and" Tagged mRNA ”(Cf. "DNA labeled" as described in section (iv) above).

H) Preferred screening assays

[0150] Markers can be used to provide detectable signals in the assay procedures of the present invention. Examples include:

a) a fluorescent group or an energy transfer based fluorescence system.

b) a biotin-based system. In this case the colonies can be incubated with streptavidin labeled with a fluorescent group or an enzyme (eg streptavidin coated fluorescent latex beads; streptavidin labeled with fluorescent groups; enzymes for use with the corresponding fluorescence assay).

c) a system based on the detection of an antigen or its fragment, for example, a hapten (including biotin and fluorescent groups). In this case, the colonies can be incubated with antibodies (eg specific for a hapten). Antibodies can be labeled with a fluorescent group or with an enzyme (e.g. fluorescent latex beads coated with the antibody; antibodies labeled with fluorescent groups; antibodies linked to an enzyme for use with a corresponding fluorescence or luminescence assay, etc.) .

d) a radiolabel (eg, incorporated using a 5'-polynucleotide kinase and [and-³²P] adenosine triphosphate or a DNA polymerase and [a-³²P or a-³³P] deoxyribonucleoside triphosphates to add one or more radioactive phosphate groups to a nucleic acid). In this case the colonies can be incubated with a scintillation liquid.

e) a colorant or other staining agent.

[0151] Markers for use in the present invention are preferably attached to

a) nucleic acids

b) proteins that specifically bind to double-stranded DNA (e.g. histones, repressors, enhancers) and / or

c) proteins that specifically bind single-stranded DNA (eg, single-stranded nucleic acid binding protein).

[0152] Labeled colonies are preferably detected by:

a) fluorescence measurement

b) luminescence measurement.

ES 2 563 643 T3

c) measurement of radioactivity.

d) measurement of flux or fluorescent anisotropy induced by electric field and / or

e) measurement of the thickness of the polymeric layer.

[0153] Staining agents can be used in the present invention. Thus DNA colonies can be incubated with a suitable DNA specific staining agent, such as intercalating dyes, ethidium bromide, YO-YO, YO-PRO (Molecular Probes, Eugene, OR).

[0154] With certain staining examples the result can be observed with a suitable fluorescent imaging apparatus.

[0155] Examples of particular tests / procedures will now be described in more detail.

I) Preferred Test Embodiments of the Present Invention

i) Nucleic acid probe hybridization assay

[0156] DNA colonies are first prepared for hybridization. They are then hybridized with a probe (labeled or not). If required, the hybridized probe is tested, and the result is observed. This can be done with an apparatus of the present invention (eg, as described above).

Preparation for hybridization

[0157] In a preferred embodiment of the present disclosure, the colonies are treated with a DNA restriction endonuclease that is specific for a sequence provided by a single-stranded form of one of the primers originally grafted onto the surface where the colonies are formed or of another sequence present in a template DNA molecule (see, for example, Figure 16c).

[0158] After restriction enzyme digestion, colonies can be heated to a temperature high enough to separate double-stranded DNA molecules. After this heat denaturation step, the colonies are washed to remove the detached, unhybridized single stranded DNA strands, leaving a remaining single stranded DNA attached.

[0159] In another embodiment the colonies can be partially digested with a 3 'to 5' double-stranded DNA exonuclease (see section E, Figure 10f) that removes one strand of the DNA duplexes starting from the 3 'end, thus leaving a part of a DNA molecule in a single-stranded form.

[0160] Alternatively, DNA in colonies can first be heat denatured and then partially digested with a specific 3 'to 5' single stranded DNA exonuclease that digests single stranded DNA starting from the 3 'end.

[0161] A further alternative is to simply heat denature the DNA in the colonies.

Probe hybridization

[0162] Single-stranded nucleic acid probes (labeled or not) can hybridize to single-stranded DNA in colonies under appropriate temperature and buffer conditions (which depends on the sequence of each probe, and which can be determined using protocols known to those of skill in technique).

Unlabeled Hybrid Probe Assay

[0163] A hybridized probe initially provided in an unlabeled form can be used with a primer for incorporation of the different (or a subset of the different) labeled deoxyribonucleoside triphosphates (or a mixture of labeled and unlabeled) with a DNA polymerase. . The incorporated labeled nucleotides can then be detected as described above.

Cyclical testing of labeled or unlabeled probes

[0164] First, DNA colonies can be prepared for hybridization by the methods described above. They can then hybridize with a probe (labeled or initially unlabeled). If desired, hybridized labeled probes are assayed and results are viewed with an apparatus as described above. The probe can then be removed by heat denaturation and a probe specific for a DNA sequence can be hybridized and detected. These steps can be repeated with new probes

ES 2 563 643 T3 as many times as desired.

[0165] Second, the probes can be assayed as described above for unlabeled probes, except that only a subset (preferably 1 only) of the different nucleotides (labeled or not) is used in each cycle. The colonies can then be assayed to monitor nucleotide incorporation. This second process can be repeated until a sequence of a desired length is determined.

(ii) In situ RNA synthesis assay

[0166] In this embodiment, DNA colonies can be used as templates for in situ RNA synthesis as depicted in Figure 14. DNA colonies can be generated from templates and primers, such that a promoter of RNA polymerase is placed at one end of the double-stranded DNA in the colony. The DNA colonies can then be incubated with RNA polymerase and the newly synthesized RNA (cRNA) can be assayed as desired. Detection can be performed non-specifically (eg, staining) or in a sequence-dependent manner (eg, hybridization).

[0167] The DNA template (I, figure 14a) to be amplified in a colony is generated by PCR reaction using primers (IIa and IIb) having the following four parts; 1) a sequence identical to the sequences of the surface-grafted primers ('P1' and 'P2'), 2) a "tag" sequence that is different for each sample, 3) a sequence corresponding to an RNA polymerase promoter ie, the RNA T3, T7 and SP6 promoters ('RPP', Figure 14a) and 4) primer sequences surrounding the specific sequence of interest ('S1' and 'S2'). Hereinafter, the DNA fragments obtained after said suitable process will be named with the expression: "tagged DNA and RNA synthesis" (III, figure 14b).

[0168] After amplification of the DNA template from the original DNA sample, these templates are used to generate DNA colonies. The DNA colonies (IV, Figure 14c) are then incubated with RNA polymerase specific for the RNA polymerase promoter ('RPP', Figure 14c). This will generate a specific RNA copy for the DNA colony template (template cRNA, V, Figure 14d).

[0169] The cRNA thus synthesized can be isolated and used as hybridization probes, as templates for messenger RNA (mRNA) for in vitro protein synthesis or as templates for in situ RNA sequence analysis.

(iii) Sequencing methods

[0170] In another embodiment of the present invention, the colonies can be analyzed to determine sequences of nucleic acid molecules that make up the colonies. Since very large amounts of the same nucleic acid molecules can be provided in each colony, the reliability of the obtained sequencing data is likely to be very high.

[0171] The determined sequences can be partial or complete. The sequences of the nucleic acids present in one or more colonies can be determined. At the same time, a plurality of sequences can be determined.

[0172] In some embodiments, the sequence of a strand complementary to a nucleic acid strand to be sequenced (or a portion thereof) may initially be obtained. However this sequence can be converted using base pairing rules to provide the desired sequence (or apart from it). This conversion can be done by a computer or a person. It can be done after each primer extension step or it can be done at a later stage.

[0173] Sequencing can be performed by various methods. For example, methods based on sequential restriction endonuclease digestion and linker ligation can be used. Such a method is disclosed, for example, in WO95 / 27080. This method comprises the steps of: ligating a probe to one end of a polynucleotide, the probe having a nuclease recognition site; identifying one or more nucleotides at the end of the polynucleotide; and cleaving the polynucleotide with a nuclease that recognizes the nuclease recognition site of the probe, such that the polynucleotide is shortened by one or more nucleotides.

[0174] However in a preferred method of the present invention, the amplified nucleic acid molecules (preferably in the form of colonies, as disclosed herein) are sequenced allowing the primers to hybridize to the nucleic acid molecules, extending the primers and detecting the nucleotides used in the extension of the primer. Preferably, after a primer extension by a single nucleotide, the nucleotide is detected before an additional nucleotide is used in a primer extension (step sequencing).

ES 2 563 643 T3

[0175] One or more of the nucleotides that are used in primer extension can be labeled. The use of labeled nucleotides during primer extension facilitates detection. (The term "marker" is used in a general sense to indicate any residue that can be identified using an appropriate detection system. Preferably the marker is not present in naturally occurring nucleotides). At best, the markers are non-radioactive, such as fluorophores. However, radioactive markers can be used.

[0176] When nucleotides are provided in labeled form, the labels can be the same for different nucleotides. If the same marker is used, each nucleotide incorporation can be used to provide a cumulative augmentation of the same signal (eg, of a signal detected at a particular wavelength). Alternatively, different markers can be used for each type of nucleotide (which can be detected at different wavelengths).

[0177] Thus, four different markers can be provided for dATP, dTTP, dCTP and dGTP, or the same marker can be provided for all of them. Similarly, four different markers can be provided for ATP, UTP, CTP, and GTP, or the same marker can be provided for all of them). In some embodiments of the present invention, a mixture of labeled or unlabeled nucleotides may be provided, as will be described in more detail below.

[0178] In a preferred embodiment of the present invention, the sequencing of the nucleic acid molecules present in at least 2 different colonies is carried out simultaneously. More preferably, the sequencing of the nucleic acid molecules present in more than 10, more than 100, more than 1000 or even more than 1,000,000 different colonies is carried out simultaneously. Therefore if colonies having different nucleic acid molecules are provided, many different sequences (complete or partial) can be determined simultaneously, that is, more than 10, more than 100, more than 1000 or even more can be determined. of 1,000,000 different sequences simultaneously.

[0179] If desired, controls can be provided, whereby a plurality of colonies comprising the same nucleic acid molecules are provided. By determining whether or not the same sequences are obtained for the nucleic acid molecules in these colonies, it can be confirmed whether or not the sequencing procedure is reliable.

[0180] A sequencing method of the present invention is illustrated in Figure 17, which is titled "in situ sequencing". In prepared DNA colonies, hybridized with an appropriate sequencing primer, cyclic addition of the individual deoxyribonucleotide triphosphates and DNA polymerase would allow determination of the DNA sequence immediately 3 'to the sequencing primer. In the example indicated in Figure 17, the addition of dGTP allows the determination of 1 colony containing 'G'. In the second cycle of addition of dATP it is detected in both colonies, determining that the two colonies have 'A' in the next position. After several repetitions of the addition of single deoxyribonucleoside triphosphates, it will be possible to determine any sequence. For example, sequences of at least 10, at least 20, at least 50, or at least 100 bases can be determined.

[0181] If colonies are initially provided in a form comprising double-stranded molecules, the colonies can be processed to provide single-stranded molecules for use in sequencing, as described above. (However, it should be noted that double-stranded molecules can be used for sequencing without such processing. For example, a double-stranded DNA molecule can be provided with a promoter sequence and stepwise sequencing can then be performed using a labeled RNA polymerase and ribonucleotides (cf Figure 16d). (Another alternative is to introduce a notch into a double-stranded DNA molecule in such a way that translation of the notch can be performed using labeled deoxyribonucleotides and a DNA polymerase with 5 'to 3' exonuclease activity).

[0182] One way of processing double-stranded molecules present in colonies to provide single-stranded colonies is described below with reference to Figure 19. In this case, immobilized double-stranded molecules present in a colony (which may be in the form of bridge-like structures) they are cleaved and after this a denaturation step is carried out. (Alternatively, a denaturation step could be used initially and then a cleavage step could be performed). Preferably, the cleavage is carried out enzymatically. However, other means of cleavage are also possible, such as chemical cleavage. (An appropriate cleavage site can be provided on such a molecule). Denaturation can be done by any suitable means. For example, it can be done by heating and / or changing the ionic strength of a medium in the vicinity of nucleic acid molecules.

[0183] Once the single-stranded molecules to be sequenced have been provided, suitable primers can be hybridized with them for the extension of the primers. Preferred primers are oligonucleotides which are nucleic acid molecules typically 6 to 60 in length, eg, 15 to 25 nucleotides. These can comprise nucleotides of natural and / or non-natural origin. (However, alternatively, if desired, other molecules can be used, for example longer nucleic acid chains, such as

ES 2 563 643 T3 primers). Preferably, the primers for use in sequencing hybridize to the same sequences present in the amplified nucleic acid molecules as do the primers that were used to provide said amplified nucleic acids. (Primers having the same / similar sequences can be used for both amplification and sequencing purposes).

[0184] When the primers are provided in solution and are paired (hybridized) with the nucleic acid molecules present in the colonies to be sequenced, those primers that remain in solution or cannot specifically pair have to be removed after pairing. Preferred annealing conditions (temperature and buffer composition) prevent non-specific hybridization. These conditions can be harsh. Such conditions will typically be annealing temperatures close to the Tf (melting temperature) of the primer at a given salt concentration (for example, 50 nM primer in 200 mM NaCl buffer at 55 ° C for an oligonucleotide of 20 monomer units (mers) with 50% GC content). (One skilled in the art can determine the stringent conditions for a given system. These will depend on the base composition, the GC content, the length of the primer used and the salt concentration. For an average 20 base oligonucleotide calculated from 50% GC, the annealing temperature is 55 to 60 ° C, but in practice it can vary between 35 to 70 ° C).

[0185] The primers used for primer extension need not have to be provided in solution, as they can be provided in immobilized form. In this embodiment the primers must be provided close to the immobilized molecules with which they are to be paired. (In fact, such primers may already be present as excessively immobilized primers that were not used in the amplification of nucleic acid molecules during colony formation).

[0186] The nucleic acid molecules present in the colonies to be sequenced will include a sequence that hybridizes with the primers to be used in the sequencing (preferably under "stringent" conditions). This part can be added to a given molecule before amplification (which molecule can have a totally / partially unknown sequence) using techniques known to those of skill in the art. For example, it can be artificially synthesized and added to a given molecule using a ligase.

[0187] Once a nucleic acid molecule is provided paired with a primer, the extension primer can be made. RNA or DNA polymerases can be used. However, DNA polymerases are the enzymes of choice for preferred embodiments. Some of these are commercially available. Polymerases that do not have 3 'to 5' exonuclease activity can be used, such as T7 DNA polymerase or the small fragment (Klenow) of DNA polymerase I can be used [for example the modified T7 DNA polymerase Sequenase ™ 2.0 (Amersham) or the Klenow fragment (exo 3 'to 5', New England Biolabs)]. However, the use of such polymerases is not essential. In fact, when polymerases are desired to have error-correcting activity, polymerases that do not have 3 'to 5' exonuclease activity should not be used. Certain applications may require the use of thermoset polymerases, such as ThermoSequenase ”(Amersham) or Taquenase ™ (ScienTech, St Louis, MO). Any nucleotide (naturally occurring or non-naturally occurring) can be used for primer extension reactions. The preferred nucleotides are the deoxyribonucleotides: dATP, dTTP, dGTP and dCTP (although in some applications dUPT, the analog of DTTP is preferred) or the ribonucleotides ATP, UTP, GTP and CTP; at least some of which are provided markedly.

[0188] Preferably, after each primer extension step a washing step is incorporated to remove unincorporated nucleotides that may interfere with subsequent steps. The preferred wash solution should be compatible with polymerase activity and have a salt concentration that does not interfere with the pairing of the primer molecules with the nucleic acid molecules to be sequenced. (In less preferred embodiments, the wash solution may interfere with polymerase activity. In this case the wash solution does not require removal prior to extension of the additional primer).

[0189] Considering that many copies of molecules to be sequenced can be provided in a given colony, a combination of labeled and unlabeled nucleotides can be used. In this case, even if a small proportion of the nucleotides are labeled (eg, fluorescently labeled), the amount of labels incorporated into each colony during primer extension may be sufficient to detect with a detection device. For example, the ratio of labeled to unlabeled nucleotides can be selected such that, on average, the labeled nucleotides used in primer extension is less than 50%, less than 20%, less than 10% or even less than 1% of the time (i.e., on average, in a given primer extension step, a nucleotide is incorporated in marked form less than 50%, less than 20%, less than 10% or less than 1% of the extended primers).

[0190] Therefore, in a further embodiment of the present description, a method of sequencing nucleic acid molecules present in a colony of the present invention is provided, the method comprising the steps of:

ES 2 563 643 T3

a) providing at least one colony comprising a plurality of single-stranded nucleic acid molecules that have the same sequences as each other and that hybridize to primers in a manner that allows primer extension in the presence of nucleotides and an acid polymerase nucleic;

b) providing said at least one colony with a nucleic acid polymerase and a determined nucleotide in labeled or unlabeled form under conditions that allow the extension of the primers if a complementary base or if a plurality of said bases is present in the appropriate position in the single-stranded nucleic acid molecules present in said at least one colony;

c) detecting whether or not said labeled nucleotide has been used for primer extension by determining whether or not the label present in said nucleotide has been incorporated into the extended primers.

[0191] Steps b) and c) can be repeated one or more times. Preferably, a plurality of different colonies are provided and several different sequences are determined simultaneously.

[0192] This further embodiment of the present disclosure can be used to reduce costs, since relatively few labeled nucleotides are needed. It can also be used to reduce deactivation effects.

[0193] However, it is also possible to use only labeled nucleotides for primer extension or to use a higher proportion of them (for example, more than 50%, more than 70% or more than 90% of the nucleotides used can be labeled ). This can be done, for example, by selecting markers to prevent or reduce deactivation effects. Alternatively, markers can be removed or neutralized at various stages which are rendered problematic by deactivation effects (for example laser bleaching of fluorophores can be performed). However, this may increase the number of steps required and therefore it is preferred not to remove the markers (or at least not to remove them after each nucleotide has been incorporated but only remove them periodically). In other less preferred embodiments, the primer itself and its extension product can be removed and replaced with another primer. If required, several sequential steps of unlabeled nucleotide additions can be performed prior to beginning the actual sequencing in the presence of labeled nucleotides. A further alternative is to use a different type of marker than the one initially used (eg switching from fluorescein to rhodamine) which becomes problematic due to deactivation effects.

[0194] In preferred embodiments of the present disclosure a plurality of labeled bases are incorporated into a primer extended during sequencing. This is advantageous as it can speed up the sequencing procedure over methods where, once a labeled base is incorporated into an extended primer, the label must be removed before additional labeled base can be incorporated. (The plurality of marked bases may be in the form of one or more contiguous spans, although this is not essential).

[0195] Therefore, the present invention relates to a method for sequencing nucleic acid molecules, comprising the steps of:

a) using a first colony to provide a plurality of single-stranded nucleic acid molecules that have the same sequences as each other and that hybridize to primers in a way that allows primer extension in the presence of nucleotides and a nucleic acid polymerase ;

b) using a second colony to provide a plurality of single-stranded nucleic acid molecules that have the same sequences as each other, and that also hybridize to primers in a way that allows primer extension in the presence of nucleotides and a polymerase of nucleic acid;

c) providing each colony with a nucleic acid polymerase and a determined labeled nucleotide under conditions that allow primer extension if a complementary base or a plurality of said bases are present in the appropriate position in the single-stranded nucleic acid molecules;

d) detecting whether or not said labeled nucleotide has been used for primer extension in each colony, determining whether or not the label present in said nucleotide has been incorporated into the extended primers;

e) repeating steps c) and d) one or more times so as to provide extended primers comprising a plurality of markers.

[0196] Preferably the sequences of the nucleic acid molecules present at said first location and at said locations are different from each other, that is, a plurality of colonies comprising different nucleic acid molecules are sequenced.

[0197] In light of the above description, it will be appreciated that a large number of methods of

ES 2 563 643 T3 different sequencing using colonies of the present invention. In these methods, various detection systems can be used to detect markers used in sequencing (although in certain embodiments detection may simply be possible by eye, so that a detection system is not needed). A preferred detection system for fluorescent markers is a charge-coupled device (CCD) camera that can optionally be coupled to a magnifying device. Any other device that allows detection and preferably also quantification of fluorescence on a surface can be used. Devices such as fluorescent imaging devices or confocal microscopes can be selected.

[0198] In less preferred embodiments, the labels may be radioactive and therefore a radioactivity detection device might be necessary. At best, such devices would be real-time radioactive imaging systems. Also less preferred are other devices based on phosphor screens (Moleculal Dynamics) or autoradiography film for detection.

[0199] Depending on the number of colonies to be monitored, a scanning system may be preferred to collect data. (Although an alternative is to provide a plurality of detectors to allow all colonies to be recovered). Such a system allows a detector to move relative to a plurality of colonies to be analyzed. This is useful when all signaling colonies are not within the visual field of a detector. The detector can be held in a fixed position and the colonies to be analyzed can be moved into the detector's field of view (eg by means of a movable platform). Alternatively the colonies can be held in a fixed position and the detection device can be moved to bring them into your field of view.

[0200] The detection system is preferably used in combination with an analysis system to determine the amount of bases (and preferably also the nature) incorporated by the primer extension in each colony after each step. This analysis can be performed immediately after each stage or later, using recorded data. The sequence of nucleic acid molecules present within a given colony can then be deduced from the number and type of nucleotides added after each step.

[0201] Preferably the detection system is part of an apparatus comprising other components. The present invention includes an apparatus comprising a plurality of labeled nucleotides, a nucleic acid polymerase, and detection means for detecting labeled nucleotides when incorporated into a nucleic acid molecule by primer extension, the detection means being adapted to differentiate between signals. provided by the labeled nucleotides incorporated in the different colonies.

[0202] The apparatus may also include temperature control, solvent supply and wash means. It can also be automatic.

[0203] Methods and apparatus within the scope of the present invention can be used in the sequencing of:

• unidentified nucleic acid molecules (ie de novo sequencing);

• and nucleic acid molecules to be sequenced to verify if one or more differences relative to a known sequence are present (eg, identification of polymorphisms). This is sometimes called "resequencing."

[0204] Both de novo sequencing and resequencing are discussed in more detail below (see the following sections (v) and (vi)).

[0205] For de novo sequencing applications, the order of nucleotides applied to a particular location can be selected as desired. For example, the sequential addition of the nucleotides dATP, dTTP, dGTP, dCTP; dATP, dTTP, dGTP, dCTP; and so on. (Generally a single order of four nucleotides will be repeated, although this is not essential). For resequencing applications, the order of nucleotides to be added in each step is preferably selected according to a known sequence.

[0206] Resequencing may be of particular interest for the analysis of a large number of similar template molecules to detect and identify sequence differences (for example for the analysis of recombinant plasmids in candidate clones after site-directed mutagenesis or, what is more important, for the exploration of polymorphisms in a population). Differences in a given sequence can be detected by the absence of incorporation of one or more nucleotides present in the given sequence at particular stages of primer extension. Unlike the most commonly used techniques, the method of the present invention allows the detection of any type of mutation, such as point mutations, insertions, or deletions. Furthermore, not only known existing mutations, but also previously unidentified mutations can be characterized with the provision of sequence information.

ES 2 563 643 T3

[0207] In some embodiments of the present invention, long nucleic acid molecules may have been sequenced by various sequencing reactions, each allowing the determination of part of the entire sequence. These reactions can be performed in different colonies (where each of the different colonies is provided with the same nucleic acid molecules to be sequenced but with different primers), or in successive cycles applied to the same colony (where between each of the cycles , primers and extension products are washed out and replaced with different primers).

(iv) DNA fingerprint

[0208] This embodiment of the present invention aims to solve the problem of screening a large population for the identification of certain characteristics of certain genes, such as the detection of mononucleotide polymorphisms.

[0209] In a preferred embodiment, this is to generate tagged genomic DNA (see section G (ii) above). (Therefore each sample originating from a given individual sample has been marked with a single label). This tagged DNA can be used to generate primary colonies on an appropriate surface comprising immobilized primers. Several successive probe hybridization assays can then be performed on the colonies. Between each test the preceding probe can be removed, for example, by heat denaturation and washing.

[0210] The advantages of this embodiment of the present invention over strategies to solve this problem are illustrated in the following example of a possible practical application.

[0211] The aim is to detect which part of a gene (of a size, for example, 2000 bases), if any, is related to a disease phenotype in a population of typically 1,000 to 10,000 individuals. For each individual, PCR amplification can be performed to specifically amplify the gene of interest and ligate a tag and primer that generates a colony (referring to G (iv), preparation of "tagged DNA").

[0212] To obtain a representative matrix of samples, you might want to arrange 500,000 colonies at random (ie 10-fold redundancy, to have only a small probability of missing detection of a sample. With a colony density of 10,000 colonies per mm2, a -7mm x 7mm area can be used. This is a much smaller surface area compared to any other technology available so far (eg the HySeq strategy uses 220mm x 220mm for the same number of samples (50,000) with no redundancy). The quantity of reactants (a large part of the cost) will be proportional to the surface occupied by the sample matrix. Thus, the present invention can offer an 800-fold improvement over currently available technology.

[0213] The use of an apparatus to monitor the result of sequencing or probe hybridization assays 'in situ' entails a time of the order of 1 to 10 seconds to image a fluorescent signal of the colonies tested using efflorescence present on a surface of -1 mm2. Therefore, the bottleneck of the method is assumed to be the time required for imaging resulting from the assay, which takes on the order of 10 minutes for imaging resulting from an assay of 50,000 samples (500,000 colonies). . To provide 200 assays that include imaging (on one or more 7mm x 8mm surfaces), using the present invention may take less than 36 hours. This represents a 20-fold improvement over the best known method so far (HySeq boasts 30 days to achieve a comparable task).

[0214] The improvements (10 times higher colony densities and 1 second imaging) would allow much higher throughput and finally the finally expected throughput could be about 2000 times faster than the best technology, although not fully proven, available so far.

[0215] Another advantage of using the present invention is based on the fact that it overcomes the problem that arises with individuals who have heterozygous mutations for a given gene. Although this problem can be addressed by existing sequencing methods to determine allelic polymorphisms, current high-throughput mutation detection methods based on oligonucleotide probe hybridization can lead to difficulties in interpreting results due to uneven probe hybridization in cases of allelic polymorphisms and therefore errors can occur. In this embodiment of the present invention, each colony arises from a single copy of an amplified gene of interest. If an average of 10 colonies are generated for each individual locus, there will be an average of 5 colonies corresponding to one version of a gene and 5 colonies corresponding to the other version of the gene. Thus, heterozygous mutations can be scored by the number of times a single allele is detected per individual genomic sample.

(v) DNA resequencing

ES 2 563 643 T3

[0216] This embodiment of the present invention provides a solution to the problem of identifying and characterizing new allelic polymorphisms within known genes in a large population of biological samples.

[0217] In its preferred embodiment this is to obtain tagged DNA (each sample originating from a given individual has been tagged with a unique tag - see section G (iv)). This encoded DNA can then be used to generate primary colonies on an appropriate surface comprising immobilized primers. Various successive probe hybridization assays can then be performed with the colonies in which between each cyclic assay the preceding probe can be removed by heat denaturation and washing. Preferably, the 3 'DNA sequence, relative to a specific probe, can be determined directly by' in situ 'sequencing (section I (iii), Sequencing methods).

[0218] The advantages of the present invention over other strategies to solve this problem are illustrated in the following example of a possible practical application.

[0219] It is desired to identify the variability of the sequence of a gene (of a size, for example, 2000 bases), if any, in a population of typically 4,000 individuals. It is assumed that a reference sequence of the gene is known. For each individual, PCR amplification can be performed to specifically amplify the gene of interest and ligate a colony-generating tag and primer. To obtain a representative matrix of samples, you might want to arrange 40,000 colonies at random (ie 10-fold redundancy, to have only a small probability of missing detection of a sample). With a colony density of 10,000 colonies per mm2, an area of ​​~ 2mm x 2mm can be used.

[0220] Using an apparatus with a CCD camera (having a 2000 x 2000 pixel plate) to monitor the assay result could take on the order of 10 seconds to image a fluorescent signal of colonies on a surface. 4 mm2. Assuming that it is possible to read at least 20 bases during one round of the assay, this requires 61 imaging steps (3n + 1 imaging steps are needed to read n numbers of bases). Assuming that the method bottleneck is the time to image the assay result, this takes on the order of 15 minutes to image the result of a 4,000-sample assay (40,000 colonies). To perform 100 assays (on one or more 2x2 mm2 surfaces) to cover the entire gene of interest, the present invention can allow the entire screening experiment to be performed in about one day, with one apparatus. This can be compared to the most powerful operating systems available today.

[0221] In this embodiment of the present invention, with conservative assumptions (colony density, imaging time, CCD chip size), a throughput of 3.2x106 bases per hour, that is, an improvement of 400 times when compared to the most commonly used system today (current DNA sequencers have a typical throughput on the order of 8,000 read bases / hour).

(vi) De novo DNA sequencing

[0222] This embodiment of the present invention refers to solving the problem of sequencing new genomes (or parts of them) with low cost and in a short period of time, in which the DNA sequence is unknown. Genotyped DNA can be prepared, either directly from total DNA from an organism of interest or from a vector into which DNA has been inserted. Prepared genomic DNA (from any source) can be used to generate DNA colonies. The DNA colonies can then be digested with a rare cutter restriction enzyme, the site of which is included in the linker, denatured, and sequenced.

[0223] Figure 16 depicts an example of de novo DNA sequencing. In this example, the genomic DNA is fragmented into pieces of 100-2000 base pairs (see Preparation of random DNA fragments, section G (i)). These fragments will be ligated to oligonucleotide linkers (IIa and IIIb, Figure 16a) that include specific sequences for the surface-grafted primers ('P1' and 'P2'), a sequence that is recognized by a rare cleavage restriction nuclease ( 'RE') and a sequence corresponding to a sequencing primer ('SP'), producing templates (III, Figure 16b). Using this prepared DNA as a template for DNA colony formation, primary colonies are obtained (IV, Figure 16c). Those colonies are then digested with the corresponding restriction endonuclease and denatured to remove the unbound DNA strand (V, Figure 16d). The sequencing primer (SP) is then paired with the attached single-stranded template (Figure 16e). The incorporation and detection of labeled nucleotides can then be performed as described above (see section I (iii), Sequencing Methods).

[0224] In this embodiment, the achievable performance may be at least 400 times higher than that achievable with currently available methods.

(vii) Monitoring of mRNA gene expression

ES 2 563 643 T3

[0225] This embodiment of the invention relates to solving the problem of monitoring the expression of a large number of genes simultaneously.

[0226] Its preferred embodiment is represented in figure 17.

[0227] First, primary colonies were prepared, as depicted in Figure 3. In this preferred form, the DNA used for this preparation is 'prepared genomic DNA' or 'tagged genomic DNA', as described in the sections G (i) and G (iii), respectively, and in which the DNA is from the complete genome of one (or more) organism (s) or a subset thereof (for example, from a library of previously isolated genes ). In figure 17, the capital letters “A”, “B” and “D” represent colonies that have arisen from genes that present high, medium and low expression levels respectively, and “E” represents colonies that arise from non-expressed genes. (In real cases, all these situations may not necessarily be present simultaneously).

[0228] Secondly, the colonies were treated to change them into supports (ie secondary primers) for the growth of secondary colonies (step i in figure 17a), as described in section E. In this phase (figure 17b ), the treated colonies are represented by underlined characters (A, B, D or E).

[0229] Third, (step ii in Figure 17b) this secondary colony growth support is used to regenerate colonies of mRNA (or cDNA) templates extracted from a biological sample, as described in section C. If the template is mRNA, the colony regeneration priming step will be performed with a reverse transcriptase. After a determined number of colony amplification cycles, preferably from 1 to 50, the situation will be as represented in figure 17c: the colonies corresponding to highly expressed genes (represented by the letter "A") are fully regenerated, already that its regeneration has been initiated by many copies of the mRNA; the colonies corresponding to genes with medium expression levels (represented by the letters "b" and "B"), have only partially regenerated; only some of the colonies corresponding to rare genes (represented by the letter "d") have partially regenerated; the colonies corresponding to the unexpressed sequences (represented by the letter "E"), have not regenerated at all.

[0230] Finally, (step iii in figure 17c), additional colony growth cycles were performed (preferably 2 to 50), and colonies that had not fully regenerated during the previous steps were finally fully regenerated, " b "becomes" B "," d "becomes" D "(figure 17d): colonies corresponding to genes with high and medium expression levels were fully regenerated" A "and" B "or" B " ; colonies corresponding to genes with low expression levels did not fully regenerate "D" and "D"; colonies corresponding to unexpressed sequences are not fully regenerated "E".

[0231] The relative expression levels of genes can be obtained by the following preferred methods:

- Firstly, the expression levels can be monitored by following the regeneration rate of the colonies (i.e. measuring the amount of DNA within a colony after different numbers of colony growth cycles during step (iii)) as well as the rate at which a colony regenerates will be related to the number of mRNA (or cDNA) molecules that initiated the regeneration of that colony (first approximation, the number of DNA molecules after n cycles, indicated as M (n), in a colony undergoing regeneration must be given by M (n) = M0r⁽ⁿ'¹⁾, in which M0 is the number of molecules that initiate colony regeneration, r is the growth rate and n is the number of cycles);

- Second, expression levels can be monitored by counting, for each gene, the number of colonies that have regenerated and comparing this number with the total number of corresponding colonies for that gene. These measurements will generally give access to the relative expression levels of the genes represented by the colonies. Identification of the colonies is preferably carried out by identification fingerprint, in a manner essentially similar to that of the embodiment, section I (iv). Note that coding of DNA samples is not required, but can be considered as an alternative to direct identification of DNA in colonies. This may be of practical interest because with coding the same codes (hence the same oligonucleotides involved in the code assay) can be used for any of the gene sets, whereas without coding, a different set of oligonucleotides must be used. specific for each of the gene sets.

[0232] This embodiment of our invention has many advantages compared to the current state of the art including: very high performance; no prior amplification of mRNA is required (although prior amplification is compatible with our invention); Small amounts of samples and reactants are required due to the high density of samples with our invention; the presence of highly expressed genes has no impact on the ability to monitor genes with low expression levels; the ability to simultaneously monitor low and high expression levels within the set of genes of interest.

ES 2 563 643 T3

[0233] When the initial DNA in the generation of the primary DNA colony is made from the DNA of a complete genome, this embodiment also provides the following characteristics: there is no interference between genes that are expressed at a high level and at a low level even when a specific amplification of the genes of interest has not been carried out. This is an exclusive feature of the use of the present invention: specific amplification is not possible because the initial assumption of this embodiment is to monitor expression genes that may not even have been isolated, therefore they are unknown, and therefore for which specific (unique) sequences are not known and whose specific sequences should have been necessary for the amplification of specific genes. The ability of our invention to perform this type of monitoring of mRNA expression is due to the fact that when the primary colonies are prepared, statistically, each part of the initial genome will be represented by the same number of colonies. Therefore, frequent and infrequent DNA will initiate the same number of colonies (eg, one colony per added genome molecule). Quantitative information could be obtained from frequent and infrequent mRNAs by monitoring the growth rate of the colonies.

(viii) Isolation and characterization of newly expressed genes

[0234] This embodiment of our invention relates to solving the problem of isolating genes that are specifically induced under certain conditions, for example, in specific tissues, different strains of a certain species or under specific activation. A practical example is the identification of genes that are positively and negatively regulated after drug administration.

[0235] The preferred embodiment for the isolation of genes from a specific or activated biological sample (hereinafter referred to as a target sample) that is up-regulated compared to a reference biological sample (hereinafter referred to as the target sample). referred to herein as a reference sample) is depicted in Figure 18.

[0236] First, primary colonies are prepared (Figure 18a). In this preferred form, the DNA used for this preparation is prepared genomic DNA or tagged genomic DNA, as described in sections G (i) and G (ii), respectively, where the DNA is from the entire genome of one (or several) organisms or a subset thereof (for example, from a library of previously isolated genes), and wherein the two primers used for colony generation (hereinafter referred to as P1 and P2) contain an endonuclease restriction site. In Figure 18a, "A" represents colonies that have arisen from genes expressed in both the reference and target sample, "B" represents colonies that arise from genes expressed only in the reference sample, "C" represents colonies that have arisen of genes expressed only in the target sample, and "D" represents colonies that arise from non-expressed genes (in real cases, all these situations may not necessarily be present simultaneously).

[0237] Second, the primary colonies are then added to generate secondary primers as the support for secondary colony growth (step i in Figure 18a). In this phase (b) the colonies are represented as underlined characters (A, B, C, D).

[0238] Third, (step ii in figure 21b) the secondary primers are used to regenerate colonies using mRNA or cDNA (represented by "mA + mB") extracted from the biological reference sample as a template, as described in G (v). If the template is mRNA, the first elongation step of colony regeneration will be performed with a reverse transcriptase. After sufficient colony growth cycles, preferably 5 to 100, only colonies corresponding to genes expressed in the reference sample ("A" and "B") will regenerate, as depicted in (Figure 18c).

[0239] In step (iii) the colonies are digested with a restriction enzyme (represented by RE) that recognizes a site in the flanking primer sequences, P1 and P2, which are grafted onto the support and which are the basis of the generation of primary colonies. It should be noted that only colonies that have regenerated during step (ii) will undergo digestion. This is because the support for the growth of secondary colonies is made in single-stranded DNA molecules, which cannot be digested by the restriction enzyme. Only regenerated colonies are present in a double-stranded form, and undergo digestion. After digestion, the situation is as depicted in Figure 18d. The colonies corresponding to the genes expressed in the reference sample have totally disappeared, that is, they are no longer present as a support for the growth of secondary colonies, and the colonies corresponding to the genes that are expressed only in the target sample "C "And the colonies corresponding to non-expressed genes" D "are still present as a support for the generation of secondary colonies.

[0240] In step (iv), the mRNA (or cDNA) (represented by "mA + mC") extracted from the target sample is used to generate secondary colonies. Since the colonies corresponding to mA and mB no longer exist, only the colonies corresponding to mC can be regenerated (ie only the mRNA is specifically expressed in the target sample). After sufficient colony growth cycles (preferably 5 to 100) the situation is such that only the colonies corresponding to the genes specifically expressed in the target sample ("C", Figure 18e) are regenerated.

ES 2 563 643 T3

[0241] In step (v), the regenerated colonies "C" are used to generate copies of the DNA they contain by performing various colony growth cycles (preferably 1 to 20) in the presence of primers P1 and P2 , as described in section D of the present invention. Then a PCR amplification is carried out using P1 and P2 in solution (described in section D) and the amplified DNA is characterized by classical methods.

[0242] The preferred embodiment for isolating genes from a specific or activated biological sample that are expressed less than in a reference biological sample is depicted in Figure 19. The different steps involved in this procedure are very similar to those involved in isolation of genes that are more regulated than in the reference sample, and the notation is the same as in Figure 18. The only difference is to reverse the order used to regenerate the colonies: in step (ii), the mRNA used is that extracted from the target biological sample ("mA + mC") instead of the mRNA extracted from the biological sample of reference ("mA + mB"), and in step (iv), the mRNA used is that extracted from the reference biological sample ("mA + mB") instead of that extracted from the target sample ("mA + mC "). As a result, only DNA is recovered and amplified from colonies corresponding to genes that are expressed in the reference sample, but not in the target sample ("B", Figure 19f).

[0243] Preferred embodiments are indicated in the following paragraphs:

Accomplishments

[0244]

1. An immobilized, amplified nucleic acid molecule sequencing method comprising:

(a) allowing the primers to hybridize to the amplified nucleic acid molecules;

(b) extending the primers by adding a nucleotide; and (c) detecting the nucleotide used in the primer extension.

two. A method according to paragraph I in which the nucleotide added in step (b) is labeled and step (c) comprises detecting whether or not the labeled nucleotide has been used for primer extension by determining whether the label is present in said nucleotide has or has not been incorporated into the extended primers.

3. A method according to paragraph 1 or paragraph 2 wherein step (b) comprises providing the amplified nucleic acid molecules with a nucleic acid polymerase and a determined nucleotide in labeled and unlabeled form or in labeled form alone under conditions that allow the extension of the primers if a complementary base or if a plurality of said bases is present in the appropriate position in the amplified nucleic acid molecules.

Four. A method according to any preceding paragraph wherein the amplified nucleic acid molecules are provided in the form of at least one nucleic acid colony, the colony comprising a plurality of single-stranded nucleic acid molecules having the same sequence as each other and which they hybridize to primers in a manner that allows primer extension in the presence of the nucleotides.

5. A method according to paragraph 4 in which the amplified nucleic acid molecules are provided as a plurality of colonies each comprising a plurality of single-stranded nucleic acid molecules having the same sequence as each other and hybridizing with primers in a way that allows primer extension in the presence of nucleotides.

6. A method according to paragraph 4 or paragraph 5 wherein step (b) comprises providing at least one colony with a nucleic acid polymerase and a determined nucleotide in labeled and unlabeled form or in labeled form only under conditions that allow the extension of the primers if a complementary base or if a plurality of said bases is present in an appropriate position in the single-stranded nucleic acid molecules present in said at least one colony and step (c) comprises detecting whether or not the labeled nucleotide has been used for primer extension by determining whether or not the label present in said nucleotide has been incorporated into the extended primers.

7. A method for sequencing nucleic acid molecules present in a colony comprising a plurality of immobilized nucleic acid strands, the method comprising caps of:

(a) providing at least one colony comprising a plurality of single-stranded nucleic acid molecules that have the same sequence as each other and that hybridize to primers in a manner that allows primer extension in the presence of nucleotides and an acid polymerase nucleic;

(b) providing said at least one colony with a nucleic acid polymerase and a determined nucleotide in labeled and unlabeled form under conditions that allow the extension of the primers if a complementary base or if a plurality of said bases is present at position appropriate in single stranded nucleic acid molecules present in said at least one colony;

(c) detecting whether or not said labeled nucleotide has been used for primer extension by determining whether or not the label present in said nucleotide has been incorporated into the extended primers.

ES 2 563 643 T3

8. A method according to paragraph 7 wherein in step (a) a plurality of colonies are provided, each comprising a plurality of single-stranded nucleic acid molecules having the same sequence to each other and hybridizing with primers in a way that allows primer extension in the presence of nucleotides.

9. A method according to paragraph 7 or paragraph 8 wherein the single stranded nucleic acid molecules are present in amplified form in at least one colony.

10. A method according to any preceding paragraph in which steps (b) and (c) are repeated one or more times.

eleven. A method according to any preceding paragraph in which the label attached to any nucleotide added by primer extension in part (b) and detected in step (c) is removed after step (c).

12. A method according to paragraph 11 in which steps (b) and (c) are repeated one or more times and the marker attached to any nucleotide added by primer extension in part (b) and detected in step ( c) is removed after each step (c).

13. A method according to any of paragraphs 4-8 wherein said single stranded nucleic acid molecules and said primers are immobilized.

14. A method according to paragraph 5 or paragraph 8 that is used to sequence, completely or partially, simultaneously, the amplified nucleic acid molecules present in at least 2 different colonies having different nucleic acid molecules.

fifteen. A method according to paragraph 14 that is used to sequence, completely or partially, simultaneously, the nucleic acid molecules present in 10 or more different colonies having different nucleic acid molecules.

16. A method according to paragraph 14 that is used to sequence, completely or partially, simultaneously, the nucleic acid molecules present in 100 or more different colonies having different nucleic acid molecules.

17. A method according to paragraph 14 that is used to sequence, completely or partially, simultaneously, the nucleic acid molecules present in 1000 or more different colonies having different nucleic acid molecules.

18. A method according to paragraph 14 that is used to sequence, completely or partially, simultaneously, the nucleic acid molecules present in 1,000,000 or more different colonies having different nucleic acid molecules.

19. A method according to any preceding paragraph, wherein after step (b) the excess nucleotides that have not been used in primer extension is removed.

twenty. A method according to any preceding paragraph, in which step (c) uses a charging coupled device chamber, which is coupled to a magnifying device.

twenty-one. A method according to any preceding paragraph, wherein each of the four different nucleotides is used in primer extension.

22. A method according to paragraph 21, wherein said four different nucleotides are used in a predetermined order in repeated cycles.

2. 3. A method according to paragraph 21 or paragraph 22, wherein the nucleotides are dATP, dTTP, dGTP and dCTP in labeled form.

24. A method according to paragraph 21 or paragraph 22, wherein the nucleotides are ATP, UTP, GTP and CTP in labeled form.

25. A method as described in any preceding paragraph with the exception that double-stranded nucleic acid molecules that have notches within them are provided in step (a) instead of nucleic acid molecules that hybridize to primers.

26. The method according to any preceding paragraph wherein the amplified nucleic acid molecules or the single-stranded nucleic acid molecules are DNA or RNA.

27. A method according to any preceding paragraph in which the amplified nucleic acid molecules or the single-stranded nucleic acid molecules and / or the primers comprise bases of natural and / or non-natural origin.

28. A method according to any one of paragraphs 1 to 27 wherein the amplified nucleic acid molecules or the single-stranded nucleic acid molecules are sequenced to determine whether there are one or more sequence differences with respect to the single-stranded nucleic acid molecules. to a known reference sequence.

29. A method according to paragraph 28 for use in identifying polymorphisms or mutations in amplified nucleic acid molecules or single stranded nucleic acid molecules.