Improved modulators of coagulation factors

<figref>image 1</figref>

<figref>image2</figref>

<figref>image3</figref>

<figref>image4</figref>

<figref>image5</figref>

E05740895

22-08-2014

nucleotides in length, including seven, six, five, four, three or two nucleotides in length. The length of loop 1 can also be varied and in one embodiment includes ten or nine nucleotides in the 5'-3 'direction and a nucleotide in the 3'-5' direction.

5 Aptamers for a factor IX gene product may comprise ribonucleotides or deoxyribonucleotides,

or a combination thereof. In general, improved aptamers are at least 25 nucleotides in length and typically are not more than 35-40 nucleotides in length. In one embodiment, the aptamers are at least 25, 30, 35 or 40 nucleotides in length. In specific embodiments, the stem 1 sequence includes 5 nucleotides in the 5'-3 'direction. In an embodiment submode, stem 1 includes three guanine residues (G) in

10 sense 5'-3 '.

Enhanced aptamers may include a "suicidal position." In one embodiment, this position becomes single-stranded and labile upon binding of the antidote to the improved aptamer and allows cleavage of the enhanced aptamer after binding of the antidote by circulating enzymes, such as blood endonucleases or

fifteen hepatic, so that the active aptamer is effectively removed from the circulation. The suicidal position may be in a stem 2 guanine that is hydroxylated. In one embodiment, this nucleotide is in a double stranded configuration until it binds with an antidote and becomes single stranded and becomes available for excision after antidote binding.

twenty It is described that aptamers include the gugg nucleotide sequence and the complementary ccac sequence. In one embodiment, the factor IX aptamer comprises the nucleotide sequence: gugga cuauacc gcg uaaugc ugc c uccac T (SEQ ID NO: 19).

Another embodiment of the invention includes an antidote oligonucleotide paired with the aptamer of the

25 invention. The antidote oligonucleotide may be complementary to at least a part of the aptamer. For example, the antidote may comprise the following sequences: (5'-3 ') sequence: cgcgguauaguccccau (Apt / AD; SEQ ID NO: 1); (5'-3 ') sequence: cgcgguauaguccc (Apt6 / AD; SEQ ID NO: 2); (5'-3 ') sequence: cgcgguauaguccac (Apt7 / AD; SEQ ID NO: 3); (5'-3 ') sequence: cgcgguauaguccauc (Apt8 / AD; SEQ ID NO: 4); (5'-3 ') sequence: cgcgguauagucag (Apt9 / AD; SEQ ID NO: 5); (5'-3 ') sequence: cgcgguauagucagg (Apt10 / AD; SEQ ID NO: 6); (5'-3 ') sequence:

30 cgcgguanagucagag (Apt11 / AD; SEQ ID NO: 7); (5'-3 ') sequence: cgcgguauaguccucac (Apt14 / AD; SEQ ID NO: 8) or any modification or derivative thereof. In certain embodiments, the antidote consists essentially of one of the above sequences or completely consists of one of the above sequences.

It is not necessary for the antidote sequence to be completely complementary to the improved anticoagulant aptamer 35 provided that the antidote binds or hybridizes sufficiently to the aptamer to neutralize its activity.

Aptamer pairs include the following sequences:

<dl><dt>Aptamer </dt><dd>Antidote </dd></dl>

<dl><dt>augggga cuauacc gcg uaaugc ugc c uccccau t (SEQ ID NO: 9) </dt><dd>cgcgguauaguccccau (SEQ ID NO: 1) </dd></dl>

<dl><dt>augggga cuauaccgcguaaugcugcc uccccau t (SEQ ID NO: 10) </dt><dd>cgcgguauaguccccau (SEQ ID NO: 1) </dd></dl>

<dl><dt>ggga cuauaccgcguaaugcugcc uccc t (SEQ ID NO: 11) </dt><dd>cgcgguauaguccc (SEQ ID NO: 2) </dd></dl>

<dl><dt>gugga cuauaccgcguaaugcugcc uccac t (SEQ ID NO: 12) </dt><dd>cgcgguauaguccac (SEQ ID NO: 3) </dd></dl>

<dl><dt>gaugga cuauaccgcguaaugcugcc uccauc t (SEQ ID NO: 13) </dt><dd>cgcgguauaguccauc (SEQ ID NO: 4) </dd></dl>

<dl><dt>cuga cuauaccgcguaaugcugcc ucag t (SEQ ID NO: 14) </dt><dd>cgcgguauagucag (SEQ ID NO: 5) </dd></dl>

<dl><dt>ccuga cuauaccgcguaaugcugcc ucagg t (SEQ ID NO: 15) </dt><dd>cgcgguauagucagg (SEQ ID NO: 6) </dd></dl>

<dl><dt>cucuga cuauaccgcguaaugcugcc ucagag t (SEQ ID NO: 16) </dt><dd>cgcgguauagucagag (SEQ ID NO: 7) </dd></dl>

<dl><dt>gugagga cuauaccgcguaaugcugcc uccucac t (SEQ ID NO: 17) </dt><dd>cgcgguauaguccucac (SEQ ID NO: 8) </dd></dl>

<dl><dt>gugagga cuauacc gcg uaaugc ugc c uccucac t (SEQ ID NO: 18) </dt><dd>cgcgguauaguccucac (SEQ ID NO: 8) </dd></dl>

<dl><dt>gugga cuauacc gcg uaaugc ugc c uccac t (SEQ ID NO: 19) </dt><dd>cgcgguauaguccac (SEQ ID NO: 3) </dd></dl>

40 Enhanced-antidote aptamer pairs are developed that are more stable and bioactive by the inclusion of secondary modifications in the aptamer or in the antidote or both. In one embodiment, the improved aptamer for factor IX includes one or more modified 2'-O-methyl nucleotides. In another embodiment, the

7

<figref>image6</figref>

<figref>image7</figref>

<figref>image8</figref>

<figref>image9</figref>

E05740895

22-08-2014

nucleotides in particular. For example, a consensus sequence could consist of a series of four positions in which the first position is A in all the members of the mix, the second position is A in 25%, T in 35% and C in 40 %, the third position is T in all oligonucleotides and the fourth position is G in 50% of oligonucleotides and C in 50% of oligonucleotides.

In specific embodiments, aptamers include the nucleotide sequences of the following SEQ ID NOS:

<dl><dt>SEC ID </dt><dd>Code Size Sequence </dd></dl>

<dl><dt>9 </dt><dd>AptA 35 number (5'-3 ') sequence: augggga cuauacc gcg uaaugc ugc c uccccau t </dd></dl>

<dl><dt>10 </dt><dd>Apt1 35 number (5'-3 ') sequence; augggga cuauaccgcguaaugcugcc uccccau t</dd></dl>

<dl><dt>9 </dt><dd>Apt2 35 number (5'-3 ') sequence: augggga cuauacc gcg uaaugc ugc c uccccau t </dd></dl>

<dl><dt>9 </dt><dd>Apt3 35 number (5'-3 ') sequence: augggga cuauacc gcg uaaugc ugc c uccccau t </dd></dl>

<dl><dt>9 </dt><dd>Apt4 35 number (5'-3 ') sequence: augggga cuauacc gcg uaaugc ugc c uccccau t </dd></dl>

<dl><dt>9 </dt><dd>Apt5 35 number (5'-3 ') sequence: augggga cuauacc gcg uaaugc ugc c uccccau t </dd></dl>

<dl><dt>11 </dt><dd>Apt6 29mer (5'-3 ') sequence: ggga cuauaccgcguaaugcugcc uccc t </dd></dl>

<dl><dt>12 </dt><dd>Apt7 31st (5'-3 ') sequence: gugga cuauaccgcguaaugcugcc uccac t </dd></dl>

<dl><dt>13 </dt><dd>Apt8 33rd (5'-3 ') sequence: gaugga cuauaccgcguaaugcugcc uccauc t </dd></dl>

<dl><dt>14 </dt><dd>Apt9 29 number (5'-3 ') sequence: cuga cuauaccgcguaaugcugcc ucag t </dd></dl>

<dl><dt>15 </dt><dd>Apt10 31st (5'-3 ') sequence: ccuga cuauaccgcguaaugcugcc ucaggt </dd></dl>

<dl><dt>16 </dt><dd>Apt11 33rd (5'-3 ') sequence: cucuga cuauaccgcguaaugcugcc ucagag t </dd></dl>

<dl><dt>10 </dt><dd>Apt12 35 number (5'-3 ') sequence: augggga cuauaccgcguaaugcugcc uccccau t </dd></dl>

<dl><dt>10 </dt><dd>Apt13 35 number (5'-3 ') sequence: augggga cuauaccgcguaaugcugcc uccccau t </dd></dl>

<dl><dt>17 </dt><dd>Apt14 35 number (5'-3 ') sequence: gugagga cuauaccgcguaaugcugcc uccucac t </dd></dl>

<dl><dt>17 </dt><dd>Apt15 35 number (5'-3 ') sequence: gugagga cuauaccgcguaaugcugcc uccucac t </dd></dl>

<dl><dt>17 </dt><dd>Apt16 35 number (5'-3 ') sequence: gugagga cuauaccgcguaaugcugcc uccucac t </dd></dl>

<dl><dt>17 </dt><dd>Apt17 35 number (5'-3 ') sequence: gugagga cuauaccgcguaaugcugcc uccucac t </dd></dl>

<dl><dt>11 </dt><dd>Apt18 29 number (5'-3 ') sequence: ggga cuauaccgcguaaugcugcc uccc t </dd></dl>

<dl><dt>12 </dt><dd>Apt19 31st (5'-3 ') sequence: gugga cuauaccgcguaaugcugcc uccac t </dd></dl>

<dl><dt>13 </dt><dd>Apt20 33rd (5'-3 ') sequence: gaugga cuauaccgcguaaugcugcc uccauc t </dd></dl>

<dl><dt>18 </dt><dd>Apt21 35 number (5'-3 ') sequence: gugagga cuauacc gcg uaaugc ugc c uccucac t </dd></dl>

<dl><dt>18 </dt><dd>Apt22 35 number (5'-3 ') sequence: gugagga cuauacc gcg uaaugc ugc c uccucac t </dd></dl>

<dl><dt>18 </dt><dd>Apt23 35 number (5'-3 ') sequence: gugagga cuauacc gcg uaaugc ugc c uccucac t </dd></dl>

<dl><dt>18 </dt><dd>Apt24 35 number (5'-3 ') sequence: gugagga cuauacc gcg uaaugc ugc c uccucac t </dd></dl>

<dl><dt>18 </dt><dd>Apt25 35 number (5'-3 ') sequence: gugagga cuauacc gcg uaaugc ugc c uccucac t </dd></dl>

<dl><dt>27 </dt><dd>Apt26 33rd (5'-3 ') sequence: gugagga cuauacc gca aucg ugc c uccucac t </dd></dl>

<dl><dt>28 </dt><dd>Apt27 33rd (5'-3 ') sequence: gugagga cuauacc gca aucg ugc c uccucac t </dd></dl>

<dl><dt>29 </dt><dd>Apt28 33rd (5'-3 ') sequence: gugagga cuauacc gca aucg ugc c uccucac t </dd></dl>

<dl><dt>30 </dt><dd>Apt29 33rd (5'-3 ') sequence: gugagga cuauacc gca aucg ugc c uccucac t </dd></dl>

<dl><dt>18 </dt><dd>Apt30 35 number (5'-3 ') sequence: gugagga cuauacc gcg uaaugc ugc c uccucac t </dd></dl>

<dl><dt>18 </dt><dd>Apt31 35 number (5'-3 ') sequence: gugagga cuauacc gcg uaaugc ugc c uccucac t </dd></dl>

<dl><dt>18 </dt><dd>Apt32 35 number (5'-3 ') sequence: gugagga cuauacc gcg uaaugc ugc c uccucac t </dd></dl>

<dl><dt>18 </dt><dd>Apt33 35 number (5'-3 ') sequence: gugagga cuauacc gcg uaaugc ugc c uccucac t </dd></dl>

<dl><dt>18 </dt><dd>Apt34 35 number (5'-3 ') sequence: gugagga cuauacc gcg uaaugc ugc c uccucac t </dd></dl>

<dl><dt>19 </dt><dd>Apt35 31st (5'-3 ') sequence: gugga cuauacc gcg uaaugc ugc c uccac t </dd></dl>

<dl><dt>19 </dt><dd>Apt36 31st (5'-3 ') sequence: gugga cuauacc gcg uaaugc ugc c uccac t </dd></dl>

<dl><dt>19 </dt><dd>Apt37 31st (5'-3 ') sequence: gugga cuauacc gcg uaaugc ugc c uccac t </dd></dl>

<dl><dt>19 </dt><dd>Apt38 31st (5'-3 ') sequence: gugga cuauacc gcg uaaugc ugc c uccac t </dd></dl>

<dl><dt>19 </dt><dd>Apt39 31st (5'-3 ') sequence: gugga cuauacc gcg uaaugc ugc c uccac t </dd></dl>

12

<figref>image10</figref>

<figref>image11</figref>

<figref>image12</figref>

<figref>image13</figref>

<figref>image14</figref>

<figref>image15</figref>

E05740895

22-08-2014

which improve the bioavailability of oligomers, enhance the resistance of oligomers to degradation and / or strengthen sequence-specific hybridization with RNA.

Aptamers include nucleotide sequences of any of the following sequences. ("A" is 2'OH A; "a" is 2'-O-methyl A; "G" is 2'-OH G; "g" is 2'-O-methyl G; "C" is 2 ' -fluoro C; "c" is 2-O-methyl C; "U" is 2'fluoro U; "u" is 2'O-methyl U; and "T" is inverted 2'HT.)

<dl><dt>SEQ ID NO: </dt><dd>Code Sequence </dd></dl>

<dl><dt>20 </dt><dd>AptA AUGGGGA CUAUACC GCG UAAUGC UGC C UCCCCAU T </dd></dl>

<dl><dt>21 </dt><dd>Apt1 aUgggga CUAUACCGCGUAAUGCUGCC UCCCCaU T </dd></dl>

<dl><dt>22 </dt><dd>Apt2 AUGGGGA CUaUaCC GCG UAAUGC UGC C UCCCCAU T </dd></dl>

<dl><dt>23 </dt><dd>Apt3 AUGGGGA CUAUACC gCg UAAUGC UgC C UCCCCAU T </dd></dl>

<dl><dt>24 </dt><dd>Apt4 AUGGGGA CUAUACC GCG UaaUgC UGC C UCCCCAU T </dd></dl>

<dl><dt>25 </dt><dd>Apt5 aUgggga CUaUaCC gCg UaaUgC UgC C UCCCCaU T </dd></dl>

<dl><dt>26 </dt><dd>Apt6 ggga CUaUaCCGCGUAAUGCUGCC uccc T </dd></dl>

<dl><dt>27 </dt><dd>Apt7 gugga CUaUaCCGCGUAAUGCUGCC uccac T </dd></dl>

<dl><dt>28 </dt><dd>Apt8 gaugga CUaUaCCGCGUAAUGCUGCC uccauc T </dd></dl>

<dl><dt>29 </dt><dd>Apt9 cuga CUaUaCCGCGUAAUGCUGCC ucag T </dd></dl>

<dl><dt>30 </dt><dd>Apt10 ccuga CUaUaCCGCGUAAUGCUGCC ucagg T </dd></dl>

<dl><dt>31 </dt><dd>Apt11 cucuga CUaUaCCGCGUAAUGCUGCC ucagag T </dd></dl>

<dl><dt>32 </dt><dd>Apt12 aUgggga CUaUaCCGCGUAAUGCUGCC UCCCCaU T </dd></dl>

<dl><dt>33 </dt><dd>Apt13 augggga CUaUaCCGCGUAAUGCUGCC uccocau T </dd></dl>

<dl><dt>34 </dt><dd>Apt14 gUga &amp; ga CUaUaCCGCGUAAUGCUGCC UCCUCaC T </dd></dl>

<dl><dt>35 </dt><dd>Apt15 gUgaggA CUaUaCCGCGUAAUGCUGCC UCCUCaC T </dd></dl>

<dl><dt>36 </dt><dd>Apt16 gugaggA CUaUaCCGCGUAAUGCUGCC Uccucac T </dd></dl>

<dl><dt>37 </dt><dd>Apt17 gugagga CUaUaCCGCGUAAUGCUGCC uccucac T </dd></dl>

<dl><dt>38 </dt><dd>Apt18 gggA CUaUaCCGCGUAAUGCUGCC Uccc T </dd></dl>

<dl><dt>39 </dt><dd>Apt19 guggA CUaUaCCGCGUAAUGCUGCC Uccac T </dd></dl>

<dl><dt>40 </dt><dd>Apt20 gauggA CUaUaCCGCGUAAUGCUGCC Uccauc T </dd></dl>

<dl><dt>41 </dt><dd>Apt21 gugagga CUaUaCC GCG UAAUGC UGC C Uccucac T </dd></dl>

<dl><dt>42 </dt><dd>Apt22 gugaggA CUaUaCC gCg UAAUGC UgC C Uccucac T </dd></dl>

<dl><dt>43 </dt><dd>Apt23 gugaggA CUaUaCC GCG UaaUgC UGC C Uccucac T </dd></dl>

<dl><dt>44 </dt><dd>Apt24 gugaggA CUaUaCC gCg UaaUgC UgC C Uccucac T </dd></dl>

<dl><dt>45 </dt><dd>Apt25 gugaggA CUaUaCC GCg UaaUgC UgC C Uccucac T </dd></dl>

<dl><dt>46 </dt><dd>Apt26 gugaggA CUaUaCC gCa AUCG UgC C Uccucac T </dd></dl>

<dl><dt>47 </dt><dd>Apt27 gugaggA CUaUaCC GCA aUCg UGC C Uccucac T </dd></dl>

<dl><dt>48 </dt><dd>Apt28 gugaggA CUaUaCC gCaaUCg UgC C Uccucac T </dd></dl>

<dl><dt>49 </dt><dd>Apt29 gugaggA CUaUaCC GCa aUCg UgC C Uccucac T </dd></dl>

<dl><dt>50 </dt><dd>Apt30 CUaUaCC gCG UaaUgC UGC C Uccucac T </dd></dl>

<dl><dt>51 </dt><dd>Apt31 gugagga CUaUaCC. gcg UaaUgC ugc C Uccucac T</dd></dl>

<dl><dt>52 </dt><dd>Apt32 gugagga CUaUaCC gcg UaaUgC UgC C Uccucac T </dd></dl>

<dl><dt>53 </dt><dd>Apt33 gugagga CUaUaCC gCg UaaUgC UGC C Uccucac T </dd></dl>

<dl><dt>54 </dt><dd>Apt34 gugagga CUaUaCC gCg UaaUgC uGc C Uccucac T </dd></dl>

<dl><dt>55 </dt><dd>Apt35 gugga CUaUaCC gCG UaaUgC UGC C Uccac T </dd></dl>

<dl><dt>56 </dt><dd>Apt36 gugga CUaUaCC gCG UaaUgC ugc C Uccac T </dd></dl>

<dl><dt>57 </dt><dd>Apt37 gugga CUaUaCC gCG UaaUgC UgC C Uccac T </dd></dl>

<dl><dt>58 </dt><dd>Apt38 gugga CUaUaCC gCg UaaUgC UGC C Uccac T </dd></dl>

<dl><dt>59 </dt><dd>Apt39 gugga CUaUaCC gCg UaaUgC uGc C Uccac T </dd></dl>

In a specific embodiment, the factor IX aptamer comprises, consists of, or consists essentially of, the nucleotide sequence: gugga CUaUaCC gCg UaaUgC uGc C Uccac T (Apt39; SEQ ID NO:

19

<figref>image16</figref>

<figref>image17</figref>

<figref>image18</figref>

<figref>image19</figref>

<figref>image20</figref>

<figref>image21</figref>

<figref>image22</figref>

<figref>image23</figref>

<figref>image24</figref>

<figref>image25</figref>

<figref>image26</figref>

<figref>image27</figref>

<figref>image28</figref>

<figref>image29</figref>