Infectious and attenuated bovine viral diarrhea virus clones; methods for their production and use

Bovine infectious viral diarrhea virus vaccine

Field of the Invention

The invention belongs to the field of animal health and, in particular, to Bovine Viral Diarrhea Virus (BVDV). The invention provides infectious clones of BVDV and methods for producing said clones of BVDV. The invention further relates to methods for attenuating said clones, to attenuated BVDV clones and to vaccines comprising said attenuated clones.

Background of the invention

Bovine Viral Diarrhea Virus (BVDV) is the causative agent of BVD and mucosal disease in cattle (Baker, 1987; Moennig and Plagemann, 1992; Thiel et al., 1996). Fetal infection during pregnancy can result in resorption of the fetus, abortions, as well as the birth of immuno-tolerant calves that are persistently infected with BVDV. These calves lack or have very low titers of neutralizing antibodies and continuously expel large amounts of the virus. Together with cattle with acute infection, these calves are the main source of virus diffusion and are therefore of great importance in the epidemiology of this disease. The strong economic impact of BVD is a consequence of the high rates of abortion, births of dead animals, fetal resorption, mummification, congenital malformations and births of weak and normal-sized calves. For a detailed review of the pathogenesis, reference is made here to the article by Moennig and Liess of 1995.

Two main BVDV antigenic groups (types 1 and 2) have been described (Becher et al., 1999), which show limited cross-reactions of neutralizing antibodies (Ridpath et al., 1994). Current vaccines for the prevention and treatment of BVDV infections continue to have disadvantages (Oirschot et al., 1999). Vaccines against classical BVDV type 1 offer only partial protection against type 2 infection and vaccinated cows can give birth to calves that are persistently infected with virulent type 2 BVDV (Bolin et al., 1991, Ridpath et al. , 1994). This problem probably has its origin in the great antigenic diversity between type 1 and type 2 strains, which is more pronounced in glycoprotein E2, the main antigen (Tijssen et al., 1996): most of the monoclonal antibodies against Type 1 strains fail to bind to type 2 viruses (Ridpath et al., 1994).

Vaccines of dead viruses (inactivated complete virus) or sub-unit vaccines (conventionally purified or heterologously expressed viral proteins) are very often inferior to live virus vaccines in terms of their efficacy to produce a complete protective immune response, even in the presence of adjuvants.

Live BVDV vaccines, although attenuated, are often associated with safety problems. As mentioned above, they cross the placenta of pregnant cows and give rise to clinical manifestations in the fetus and / or the induction of persistently infected calves. Therefore, they cannot be applied to livestock that contain pregnant cows. Pregnant cows should be kept separate from vaccinated cattle to protect fetuses and should not be vaccinated. Additionally, the reversal elements of live attenuated BVDVs represent a serious threat to livestock. For conventionally derived attenuated viruses, in which attenuation is achieved by multiple conventional passages, the molecular origin and genetic stability of attenuation remain unknown and reversion to the virulent wild type is unpredictable.

Live vaccines with defined mutations, as a basis for attenuation, would overcome the drawbacks of the present generation of attenuated vaccines. Another advantage of such attenuating mutations lies in their defined molecular uniqueness, which can be used as a distinctive mark for attenuated pestiviruses, in order to distinguish them from field pestiviruses.

WO 01/39801 describes that the deletion of the codon for histidine at position 349 of the ERNS gene of strain CP7 of BVDV type 1 results in a recombinant BVDV strain that is suitable as a vaccine against BVDV-1 infection.

In the art, BVDVs of defined genetic identity that resemble wild-type viruses, especially for type 2 BVDVs, are poorly known. In the art, there is a prolonged need for methods that generate such BVDVs. Therefore, a technical problem underlying this invention was to provide a BVDV, in particular a type 1 BVDV in conjunction with a type 2 BVDV, of defined genetic identity.

Description of the invention

Definitions of the terms used in the description:

Against the embodiments of the present invention, it should be noted that, as used herein and in the appended claims, the singular forms "one, one, the and the" also include plural references, unless the context clearly indicates what contrary. Thus, for example, the reference to "a BVDV virus" includes a plurality of such BVDV viruses, the reference to the "cell" is a reference to one or more cells and equivalents thereof known to those skilled in the art, etc. . Unless defined otherwise, all the technical and scientific terms used here have the same meanings as those usual for a person skilled in the art to which this invention belongs. Although any method and material similar or equivalent to those described herein may be used in the practice or testing of the present invention, the preferred methods, devices and materials are those described below. All publications mentioned herein are incorporated by reference in order to describe and disclose cell lines, vectors and methodologies reported in the publications that may be used in connection with the invention. Nothing described herein can be understood as an admission that the invention is not authorized to anticipate said description by virtue of previous inventions.

The term "BVDV", as used herein, refers to all viruses belonging to the species BVDV1 and BVDV2 in the genus pestivirus, within the family Flaviviridae (Becher et al., 1999). The more classic BVDV type 1 strains, and the more recently discovered BVDV type 2 strains, show some limited, but distinctive, differences in nucleotide and amino acid sequences.

A "clone" is a DNA vector or a host cell strain into which that vector has been introduced. Preferably, the DNA vector is a plasmid.

An "infectious clone" is a DNA vector with the ability to serve as a model for transcription in an RNA that induces virus generation when introduced into susceptible cells. Preferably, the RNA is produced by in vitro transcription and the cells are introduced by transfection technologies known to those skilled in the art.

"BVDV particles" or "viral particles", as used herein, refer to BVD viruses generated by "infectious clones" through RNA, which will induce the production of such BVDV particles when introduced into susceptible cells. "Attenuated BVDV particles" or "attenuated viral particles", as used herein, refer to attenuated BVDV particles by a method according to the invention (see below).

"Infectivity" is the ability of a virus or viral particle to induce a certain number of plaques in a plaque assay or a certain TCID50 score in an endpoint assay.

A full-length RNA is an RNA that comprises at least 98% of the sequence of an RNA that manifests in a wild-type isolate. A complementary full length DNA is a DNA comprising a sequence complementary to at least 98% of an RNA that manifests in a wild-type isolate.

As used herein, "calf" refers to a bovine animal six months of age or less.

Virulence: "Authentic virulence", as used herein, means that there are no statistically significant differences between the virulence of BVDV infectious particles, according to the invention, and wild-type BVDV isolates from which said DNA molecules containing a nucleotide sequence complementary to BVDV RNA, preferably a type 2 RNA, for at least one predominant clinical parameter. Examples of such dominant clinical parameters are diarrhea, fever and / or lethality.

Attenuation: "An attenuated BVDV particle", as used herein, means that there is a statistically significant difference between the virulence of attenuated BVDV particles, according to the invention, said BVDV particles being attenuated by a method according to the invention, and isolated from BVDV. wild-type, from which said attenuated BVDV particles have been derived, for the predominant clinical parameters diarrhea, fever and lethality in animals infected with the same dose, preferably 6x106TCID50. Thus, said attenuated BVDV particles do not cause diarrhea, fever or lethality and can therefore be used in a vaccine.

"RACE" as used herein means rapid amplification of cDNA ends and is known as such in the art (Frohman et al., Proc. Natl. Acad. Sci USA 1988, 85: 8998-9002)

"Susceptible cell" as used herein is a cell that can be infected with the BVDV virus or transfected with BVDV RNA, where said virus or RNA, when introduced into said susceptible cells, induces the generation of infectious BVDV.

A "fragment", according to the invention, is any sub-unit of an infectious BVDV DNA molecule or clone, that is, any sub-set, which is distinguished because it is encoded by a nucleic acid molecule shorter than that described. and that can still be transcribed into RNA.

A "functional variant" of the BVDV infectious DNA or clone molecule, according to the invention, is a BVDV infectious DNA or clone molecule that possesses a biological activity (functional or structural) that is substantially similar to the DNA molecule or Infectious clone of BVDV according to the invention. The term "functional variant" also includes a "fragment", "a functional variant", "a variant based on the degenerative nucleic acid code"

or "chemical derivative." A "functional variant" of this type may, for example, be a carrier of one or more exchanges, deletions or insertions of nucleic acids. Such exchanges, deletions or insertions may represent 10% of the complete sequence. Said functional variant retains at least its biological activity, for example the function as an infectious clone or vaccine strain or even shows an improved biological activity. A "variant based on the degenerative nature of the genetic code" is a variant resulting from the fact that some amino acid may be encoded by several triplets of different nucleotides. Said variant at least partially preserves its biological activity or even shows an improved biological activity.

A "fusion molecule" may be the BVDV infectious DNA or clone molecule according to the invention, linked to, for example, an informant such as a radioactive label, a chemical molecule such as a fluorescent label or any other molecule known in the technique.

As used herein, a "chemical derivative" according to the invention is a DNA molecule or an infectious clone of BVDV according to the invention, chemically modified or containing additional chemical fractions that are not normally part of the molecule. These fractions can improve solubility, absorption, biological half-life, etc. of the molecule.

A molecule is "substantially similar" to another molecule if both molecules have substantially similar nucleotide sequences or biological activity. Thus, whenever two molecules possess a similar activity, they are considered variants, since said term is used here if the nucleotide sequence is not identical, and two molecules having a similar nucleotide sequence are considered variants, since It is the term used here, even if its biological activity is not identical.

The term "vaccine" as used herein refers to a pharmaceutical composition comprising at least one immunologically active component that induces an immune response in an animal and possible, but not necessarily, one or more additional components that enhance the immunological activity of said active component. A vaccine may additionally comprise other typical components of pharmaceutical compositions. The immunologically active component of a vaccine may comprise complete virus particles both in their original form or as attenuated particles in a so-called live modified vaccine (MLV) or particles inactivated by appropriate methods in a so-called dead vaccine (KV). In another form, the immunologically active component of a vaccine may comprise appropriate elements of said organisms (sub-unit vaccines), wherein these elements are generated by the destruction of the entire particle, or growth cultures containing such particles and, optionally, subsequent purification steps that result in the desired structure (s), or by synthetic processes that include adequate handling through the use of an appropriate system based, for example, bacteria, insects, mammals or other species, plus the subsequent optional isolation and purification procedures, or by induction of said synthetic processes in the animal that needs a vaccine by direct incorporation of genetic material, using suitable pharmaceutical compositions (polynucleotide vaccination). A vaccine may comprise one or simultaneously more than one of the elements described above.

The term "vaccine", as understood herein, is a vaccine for veterinary use that comprises antigenic substances and is administered in order to induce a specific and active immunity against a disease caused by BVDV. The BVDV clone according to the invention confers active immunity that can be passively transferred through maternal antibodies against the immunogens it contains and, sometimes, also against related organisms in an antigenic manner.

Additional components to enhance the immune response are constituents normally designated as adjuvants such as, for example, aluminum hydroxide, mineral or other oils, or auxiliary molecules added to the vaccine or generated by the body after the corresponding induction by such additional components. , such as interferons, interleukins or growth factors, without being limited to them.

A "pharmaceutical composition" basically consists of one or more ingredients capable of modifying physiological functions, for example, immunological functions, of the organism to which it is administered, or of organisms that live in or on the organism. The term includes, but is not limited to, antibiotics or antiparasitic agents, as well as other constituents normally used to achieve some other objectives such as, but not limited to, processing features, sterility, stability, viability to administer the composition via enteric routes parenteral such as oral, intranasal, intravenous, intramuscular, subcutaneous, intradermal or other suitable route, tolerance after administration and controlled release properties.

Description of the invention

The solution to the above technical problem is achieved by the description and the embodiments characterized in the claims.

The prolonged need for a live BVDV (bovine viral diarrhea virus) of defined sequence and specificity correlated with virulence, which can be used to generate specific attenuated BVDV for use, for example, in a vaccine, has been overcome. The inventors have offered for the first time a method to generate infectious clones and infectious BVDV particles derived therefrom, of defined genetic identity that, at the same time, has a pathogenesis closely similar to those of the wild-type virus. In addition, the inventors have described for the first time an infectious clone of type 2 and infectious particles of BVDV of type 2 derived therefrom. Thirdly, having provided live and infectious BVDV particles of defined sequence, the inventors also describe a method for generating attenuated BVDV particles with genetic identity, which can be attenuated by a modification in a single site of defined genetic brand. The description allows generating a causal link between genome modification and attenuation, which is essential to understand the functional mechanism of attenuation and useful, therefore, to assess the quality of its use as a vaccine.

In connection with the invention, a DNA molecule containing a nucleotide sequence complementary to BVDV RNA is described, wherein said RNA, when introduced into susceptible host cells, induces the generation of infectious BVDV particles.

a) with the ability to induce viremia and leukopenia in calves for a period of at least one day and at least one of the following clinical symptoms of the group comprising diarrhea and / or fever of at least one day duration when the infection is performed with a dose of 6x106TCID50.

b) with true virulence, as defined above, compared to a wild-type BVDV isolate from which such a DNA molecule has been derived; me

c) that they are lethal, when calves that have not previously been in contact with BVDV are infected, at a dose of 6x106TCID50 of such particles, for at least 30% of such calves in a period of 21 days; me

d) with a virulence not less than 90% of BVDV particles comprising an RNA with a sequence complementary to SEQ ID No. 1; and / or e) comprising a sequence complementary to SEQ ID No. 1.

Said dose of 6x106TCID50 from step a) is preferably administered as 2x106 im (gluteus muscle), 2x106 intranasally and 2x106 subcutaneously (over the scapula) to obtain a total dose of 6x106. Said clinical symptoms of stage a) should preferably be observed in at least two thirds of all infected animals. Said stage a) leukopenia will preferably be a reduction of at least 35% below the initial level on at least two consecutive days, where "initial value" refers to the average values ​​of all animals, 10 days before the infection. Diarrhea is a typical symptom of BVDV infection.

Preferably, in a DNA molecule according to the invention, as described above, the fever of step a) is at least 40 ° C.

A second aspect refers to an infectious clone of BVDV, capable of serving as a template for transcription in an RNA, where said RNA, when introduced into susceptible host cells, induces the generation of infectious particles of BVDV

f) with the ability to induce viremia and leukopenia in calves for a period of at least one day and at least one of the following clinical symptoms of the group comprising diarrhea and / or fever of at least one day duration when infected with a dose of 6x106TCID50; me

g) with authentic virulence compared to a wild-type BVDV isolate, from which such a DNA molecule has been derived; me

h) that they are lethal, when calves from 3 to 6 months of age who have not previously been in contact with the BVDV are infected, at a dose of 6x106TCID50 with such particles, for at least 30% of such calves in a period of time 21 days after infection; me

i) with a virulence of not less than 90% of the BVDV particles comprising an RNA with a sequence complementary to SEQ ID No. 1; and / or j) comprising a sequence complementary to SEQ ID No. 1.

Said dose of 6x106TCID50 from step f) is preferably administered as 2x106 im (gluteus muscle), 2x106 intranasally and 2x106 subcutaneously (over the scapula) to obtain a total dose of 6x106. Said clinical symptoms of stage f) should preferably be observed in at least two thirds of all infected animals. Said stage f) leukopenia will preferably be a reduction of at least 35% below the initial level for at least two consecutive days, wherein "initial value" refers to the average values ​​of all animals 10 days before infection. .

Said BVDV infectious clone is preferably a type 1 or type 2 clone.

Since it is important that said infectious BVDV clone be of true virulence, the virus that serves as the origin for the construction of that clone is preferably obtained directly from a field isolate or retransferred to animals and then re- isolated from the animal with the most intense clinical symptoms, then subjecting it to no more than two passages in cell culture, preferably one or none at all. The example (Example 1) illustrates this procedure. The example demonstrates the cDNA cloning of the NY93 / C virus which, after several passages through cell cultures, is retransfected to a bovine animal, is re-isolated and used for RNA preparation and cDNA cloning after no more than two passages by re-isolated virus cell cultures.

Another important aspect is a BVDV particle generated by transcription, using the DNA molecule or BVDV clone according to the invention, the transfection of suitable cells or cell lines with said RNA and the collection of the resulting BVDV particles produced by said cells. . Yet another aspect refers to a BVDV particle generated by the cloning of the DNA molecule or the BVDV clone, in the genome of a suitable DNA-virus, said DNA-viruses being known to the technician, followed by infection of suitable cells, resulting in the generation of BVDV particles produced by said cells. Preferably also, the infectious DNA or clone can be transfected into suitable cells that produce, then, the RNA as described for classical swine fever virus (CSFV) van Gennip et al. (1999) for cells that stably express T7 polymerase. Also preferably, the infectious DNA or clone according to the invention can be expressed under the control of a eukaryotic promoter in eukaryotic cells that lead to the generation of infectious BVDV particles capable of being secreted from the cell (as exemplified by

V. Racaniello and D. Baltimore for the poliovirus (1981)).

A highly important aspect of this description is an infectious clone of BVDV type 2. Preferably, said infectious clone of BVDV type 2, capable of serving as a model for transcription in an RNA, wherein said RNA, when introduced into susceptible host cells , induces the generation of infectious particles of BVDV

k) with the ability to induce viremia and leukopenia in calves for a period of at least 1 day and at least one of the following clinical symptoms of the group comprising diarrhea and / or fever of at least one day duration, when infected with a dose of 6x106TCID50; me

l) with true virulence compared to a wild-type BVDV isolate, from which that DNA molecule has been derived; me

m) that they are lethal, when calves from 3 to 6 months of age who have not previously been in contact with BVDV are infected, at a dose of 6x106TCID50, with such particles, for at least 30% of such calves in a period of 21 days after infection; me

n) with a virulence of not less than 90% of the BVDV particles comprising an RNA with a sequence complementary to SEQ ID No. 1; and / or) comprising a sequence complementary to SEQ ID No. 1.

A preferred type 2 BVDV clone can be obtained by a method that is distinguished by the following steps: aaa) a type 2 strain of wild type BVDV is isolated; bbb) said wild type BVDV type 2 strain is passed through a cell culture; ccc) said BVDV type 2 strain subjected to cell culture passage is used to infect bovine animals

and a BVDV strain of the most severely infected animal is re-isolated; ddd) said re-isolated type of BVDV strain 2 is passed no more than twice, preferably once, through a cell culture;

eee) said re-isolated BVDV type 2 strain is reverse transcribed and cloned, resulting in a full length cDNA clone, the 5 'and 3' ends being preferably cloned using RACE technology.

Said infectious DNA clone can then be transcribed into RNA under appropriate conditions, said RNA is introduced into suitable cells or cell lines and the resulting type 2 BVDV particle is collected.

Such a clone is exemplified in Example 1 and characterized by the cDNA sequence SEQ ID No. 1. Thus, an infectious clone of BVDV type 2 is characterized by the DNA sequence of SEQ ID No. 1, or a fragment, Functional variant, variant based on the degenerative nucleic acid code, fusion molecule or a chemical derivative thereof. An example is given in Example 1. In connection with the invention, a type 2 BVDV particle is generated by in vitro transcription of the BVDV clone into RNA, the transfection of suitable cells or cell lines with said RNA and the collection of the resulting BVDV particles produced by said cells. Also preferably, the infectious DNA or clone can be transfected into suitable cells that then produce the RNA as described for classical swine fever virus (CSFV) van Gennip et al. (1999) for cells that stably express T7 polymerase. Also preferably, the infectious DNA or clone can be expressed under the control of a eukaryotic promoter in

eukaryotic cells that lead to the generation of infectious BVDV particles capable of being secreted from the cell (as exemplified by V. Racaniello and D. Baltimore for the poliovirus (1981)). Another very important aspect is a DNA molecule that contains a complementary nucleotide sequence to BVDV RNA type 2 full length. Preferably, said DNA molecule is distinguished by the sequence SEQ ID No. 1. Accordingly, a further aspect in relation to the invention relates to a DNA molecule, as characterized by SEQ ID No. 1, or a fragment, functional variant, variant based on the code of degenerative nucleic acid, fusion molecule or a chemical derivative thereof. In Example 1 a example.

Most preferably, a DNA molecule, consisting of a sequence as described, is described. characterized by SEQ ID No. 1.

In addition, an RNA molecule complementary to the DNA molecule is described, as described. above, or to the BVDV clone, as described above. An RNA molecule that can be obtained by transcription of the DNA molecule, as described above, is also described. described above, or of the BVDV clone, as described above.

Another important aspect is a method for the production of an infectious clone of BVDV from an isolate of Wild-type BVDV, said infectious clone of BVDV being complementary to an RNA that has authentic virulence compared to said wild type isolate, which comprises the stages of

p) isolate viral particles from an infected animal; making them pass preferably no more than twice

in suitable cell culture cells; q) prepare RNA from viral particles; r) generate a full length complementary DNA after reverse transcription of the RNA; where the

Reverse transcription includes a stage at elevated temperatures sufficient to degrade or reduce secondary RNA structures, and the use of a thermostable enzyme for this stage, said enzyme being active at these elevated temperatures;

s) incorporate complementary DNA (cDNA) into a plasmid vector or into a DNA-virus capable of directing the

BVDV cDNA transcription in RNA after infection of suitable cells. Said viral particles are preferably isolated during viremia (step k)). Complementary DNA (cDNA) of full length of step m) can preferably be generated by assembling overlapping partial cDNA (see also Example 1).

Another preferred aspect relates to a method for the production of an infectious BVDV clone from a wild-type BVDV isolate, said BVDV infectious clone being complementary to an RNA having authentic virulence, as compared to said type isolate wild, which comprises the stages of

ppp) isolate RNA from cells of an infected animal during viremia or, optionally, from its organs after sacrificing said animal; qqq) generate complementary full length BVDV DNA which, preferably, is assembled from DNA fragments, after the reverse transcription of the RNA; wherein the reverse transcription includes a stage at elevated temperatures, sufficient to degrade or reduce secondary RNA structures, and the use of a thermostable enzyme for this stage, said enzyme being active at these elevated temperatures; rrr) incorporate the complementary DNA (cDNA) into a plasmid vector or into a DNA-virus capable of directing the transcription of BVDV cDNA into RNA after infection of suitable cells.

Suitable cells for cell culture are Madin-Darby bovine renal cells (MDBK), RD (bovine testicular) cells or Turbinat bovine cells (BT). The person skilled in the art knows other suitable cells.

The infectious clone produced by the method described herein is a type 1 clone or, preferably, a type 2 clone.

Another important aspect is a method for the production of an infectious BVDV clone from a wild-type BVDV isolate, said BVDV infectious clone being complementary to an RNA having a virulence not less than 90% of said type isolate wild, which comprises the stages of

t) isolate viral particles from an infected animal; u) pass them no more than twice in appropriate cell culture cells; preferably only one

time or none at all; v) prepare RNA from viral particles; w) generate full length complementary DNA after reverse RNA transcription; where the

Reverse transcription includes a stage at elevated temperatures, sufficient to degrade or reduce secondary RNA structures, and the use of a thermostable enzyme for this stage, said enzyme being active at these elevated temperatures;

x) incorporating the complementary DNA (cDNA) is a plasmid or n-DNA vector virus capable of directing the transcription of BVDV cDNA into RNA after infection of suitable cells.

Said viral particles are preferably isolated during viremia (step t)). Complementary DNA (cDNA) of full length of step x) can preferably be generated by assembling overlapping partial fragments of cDNA (see also Example 1).

There was a particular technical difficulty in cloning the 5 'and 3' regions of an infectious BVDV. The inventors developed a method to obtain authentic 5 'and 3' regions. Surprisingly, this was possible by applying RACE technology. However, only the modification made in this technique by the present inventors led to the surprising and unexpected generation of BVDV clones of true virulence. In a preferred method, the 5 'end of the RNA is generated using RACE. Surprisingly, only through the application of RACE technology together with a polymerase was it possible to effectively dissolve the secondary structure of the genome. The person skilled in the art knows the conventional methods of molecular biology that can also be found, for example, in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York and Bertram, S. and Gasse, HG, Gentechnische Methoden, G. Fischer Publishing House, Stuttgart, New York, 1991.

In a preferred method, RACE is carried out with a thermostable polymerase, which allows reaction temperatures of at least 48 ° C, preferably 50-55 ° C, preferably also 56-60 ° C.

Having provided for live and infectious BVDV particles of defined sequence, the inventors also provided a method for generating attenuated BVDV particles with a defined genetic identity that, preferably, are attenuated at only a single genetic label site. This surprisingly allows simple determination of reverters or effective attenuation, since the presence of the genetic label site should only be determined by molecular biology methods known to the technician. XIKE-B and XIKE-C of Example 1 are examples of such attenuated BVDV particles of defined sequence.

Another important aspect is a method of attenuating the BVD virus by introducing one or more mutations into the DNA molecule according to the invention, as described above, or the infectious BVDV clone as described above, wherein said mutation or mutations lead to or increase an attenuated phenotype of the recovered BVD virus. Yet another important aspect is a method of attenuating a strain of BVDV, which comprises the steps of

and) introducing one or more mutations in the DNA molecule, as described above, or in the clone

BVDV infectious, as described above;

z) introducing the mutated DNA into susceptible host cells, in which said DNA is transcribed into RNA, or

introducing an RNA transcribed from said DNA into said cells; and

aa) collect the viral particles produced by these cells;

in which said mutation or mutations results in attenuation.

A preferred aspect is an attenuation method, as described above, in which the mutation or mutations consist of a substitution, deletion, insertion, addition of a nucleotide, or combinations thereof.

According to the invention, "mutation" means replacing one nucleotide with another (for example, C with T), the so-called "substitution", or any other mutation such as "deletion" or "insertion". "Deletion" means the elimination of one or more nucleotides or amino acids.

Since these BVDV infectious clones are viruses of true virulence, similar to wild-type viruses and, at the same time, have a defined genotype, said virus should be used as a positive control in animal experiments . Such infectious clones are excellent instruments for generating specifically attenuated BVDV clones that are used, for example, for vaccination. The invention comprises clones of BVDV in which the activity of the RNase resident in the glycoprotein RNS is inactivated. Preferably, said RNase activity is inactivated by a deletion and / or other mutation, such as a substitution. Preferably, said deletions and / or other mutations are located in amino acids at position 295 to 307 and / or position 338 to 357.

Thus, according to the invention, an attenuation method is provided, in which the mutation (s) are found in the Erns glycoprotein and cause the alteration or loss of function of the mutated protein. A more preferred aspect is an attenuation method, in which the mutation consists of

bb) deletion of all or part of the Erns glycoprotein; me

cc) deletion or replacement of histidine at position 300 of SEQ ID No. 1; me

dd) deletion or replacement of histidine at position 349 of SEQ ID No. 1.

ee) Most preferably, another important aspect is a method for the attenuation of BVDV comprising the mutation of a clone of BVDV at histidine positions 300 and / or 349, in which the coding triplet is eliminated or replaced.

Yet another important aspect is a method for attenuation of BVDV, in which the codon for histidine 300 It is replaced by a codon for leucine.

Yet another important aspect is a method for the attenuation of BVDV, in which the codon is removed for histidine 349.

Another important aspect is an attenuated clone of BVDV or strain of BVDV that can be obtained by a method described in this report.

Another important embodiment of the invention is a vaccine comprising a clone or strain of attenuated BVDV according to the invention, optionally in combination with a pharmaceutically compatible carrier or excipient.

The invention also relates to the use of a clone or strain of attenuated BVDV according to the invention in the manufacture of a vaccine for the prevention and treatment of BVDV infections.

Preferably, a vaccine of the invention refers to a vaccine as defined above, in which An immunologically active component is a live BVDV in which the activity of RNase in its ERNS protein It is inactive. The term "live vaccine" refers to a vaccine that comprises a particle capable of replication, in particular a viral component of active replication.

A vaccine according to claim 1 comprises an attenuated type 1 BVD virus, combined with a BVD virus type 2 attenuated, or any other antigenic group and a pharmaceutically compatible carrier or excipient. Said vaccine can be administered as a combined vaccine. Very preferably, said type 1 BVD virus attenuated according to the invention can be administered first, followed by administration of a BVD virus Type 2 attenuated according to the invention, three to four weeks later.

A vaccine according to the invention comprises an attenuated type 1 BVD virus according to the invention, in which the RNase activity in its ERNS protein is inactivated, combined with an attenuated type 2 BVD virus, in the that the activity of RNase in its ERNS protein is inactivated, and a pharmaceutically carrier or excipient compatible. Said vaccine can be administered as a combined vaccine. Very preferably, said virus of attenuated type 1 BVD according to the invention, as described above, can be administered first site, followed by administration of an attenuated type 2 BVD virus according to the invention, as described previously, three to four weeks later.

The invention preferably relates to a method for treating a BVDV infected bovine animal with a BVDV. attenuated according to the invention, as described above, wherein said attenuated BVDV or the composition of vaccine, as described above, is given to the bovine animal that needs it at an appropriate dose, according to the knowledge of those skilled in the art, monitoring the reduction of BVDV symptoms such such as viremia and leukopenia and / or fever and / or diarrhea. Preferably, this treatment can be repeated. The following examples serve to further illustrate the present invention.

Example 1

MATERIALS AND METHODS

Cells and viruses MDBK cells from the American Type Culture Collection (Rockville, Md) were obtained. The cells were cultured in Dulbecco-modified Eagle medium supplemented with 10% fetal calf serum (FCS; analyzed to verify the absence of pestivirus and antibodies against pestivirus) and non-essential amino acids. The strain of bovine viral diarrhea New York '93 (isolated from field VLS No. 399) was kindly provided by

EJ Dubovi (New York State School of Veterinary Medicine, Cornell University, Ithaca). The virus underwent a passage per animal and was subsequently designated as "New York '93 / C".

Cell infection, immunofluorescence assay and viral peroxidase assay. Since pestiviruses are largely associated with their host cells, infected cell lysates were used for re-infection of the culture cells. Lysates were prepared by freezing and thawing cells 3 to 5 days after infection and stored at –70 ° C. Unless otherwise indicated in the text, a multiplicity of infection (moi) of 0.1 was used for the infection of the culture cells. For immunofluorescence and peroxidase assays, the infected cells were fixed with acetone: methanol (1: 1) ice cream for 15 min at –20 ° C, air dried and rehydrated with phosphate buffer saline (PBS). The cells were then incubated with a mixture of monospecific anti-BVDV antibodies directed against E2 (Weiland et al., 1989). After three washes with PBS, a rabbit anti-mouse antibody conjugated to fluorescein isothiocyanate (FITC) (Dianova, Hamburg, Germany) was used to detect the antibodies fixed in immunofluorescence assays. For peroxidase assays, a goat anti-mouse (Dianova) antibody conjugated to peroxidase was used as the second antibody. after incubation for one hour at temperature

ambient, the cells were washed three times with PBS. The fixed antibodies were detected with a solution composed of 50 mM sodium acetate buffer at pH 5.0, 1 µM aminoethylcarbazole and 0.1% H2O2.

Northern hybridization (RNA). RNA was prepared 48 hours after infection by cesium density gradient centrifugation, as described above (Rümenapf et al., 1989). Gel electrophoresis, radioactive labeling of the probe, hybridization and post-hybridization washes were performed in the manner described above (Rümenapf et al., 1989). A radioactively labeled PCR product (nucleotides 4301 to 5302) of the strain New York 93 / C was used as the probe.

PCR and RT-PCR. PCR was performed with Tfl-Polymerase (Promega, Mannheim, Germany) or with Taq-Polymerase (Appligene, Heidelberg, Germany), following the manufacturer's recommendations and using approx. 50-100 ng of DNA model and 25 pmol of each primer. The sequences of the primers used for the amplification of the 5 'end of the genome were, upstream, T25V primer (Display Systems Biotech, Copenhagen, Denmark); and downstream, CM79: CTCCATGTGCCATGTACAGCAGAG for the first cycle and CM86: CTCGTCCACATGGCATCTCGAGAC for nested PCR. The primers used for amplification of the 3 'end of the genome were, upstream, CM46: GCACTGGTGTCACTCTTTG for the first cycle and CM80: GAGAAGGCTGAGGGTGATGCTGATG for nested PCR, and downstream, nls-: GACTTTCCGCTTCTTTTTAGG. Reverse transcription PCR (RT-PCR) was carried out with the One Tube Titan® RT-PCR system (Boehringer Mannheim, Germany), using 2 µg of total RNA as a model and following the manufacturer's instructions. The primers for amplification of the Erns coding region were upstream: CM28: GGAGAGAATATCACCCAGTG; and downstream, CM21: CTCCACTCCGCAGTATGGACTTGC. The amplified RT-PCR products were purified by electrophoresis on preparative agarose gel and elution with the Nucleotrap kit (Macherey-Nagel, Düren, Germany), according to the manufacturer's recommendations.

Phosphorylation and binding of DNA-oligonucleotides to the 3 'ends of RNA. For the binding of a DNA primer to the 3 'end of the virus genome, the primer was phosphorylated. 10 µg of the nls + oligonucleotide: CCTAAAAAGAAGCGGAAAGTG was incubated with 5 units of T4 oligonucleotide kinase (New England Biolabs, Schwalbach, Germany) in 30 µl of a mixture of kinases (2 mM ATP, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM dithiothreitol, 25 µg / ml bovine serum albumin) for 40 min at 37 ° C. The primer was passed through a Sephadex G-15 rotation column (Sambrook et al., 1989) and was further purified by phenol / chloroform extraction and ethanol precipitation. Binding was carried out using 5 µg of total RNA prepared from infected culture cells and 150 pmol of the phosphorylated oligonucleotide with 20 units of T4-RNA-Ligase (New England Biolabs, Schwalbach, Germany) in 50 µl of ligase mixture (50 mM Tris-HCl pH 7.8, 10 mM MgCl 2, 10 mM dithiothreitol, 1 mM ATP, 40% polyethylene glycol and 50 RNA guard units (Amersham, Freiburg, Germany) for 16 hours at 17 ° C. The product was purified by phenol / chloroform extraction and ethanol precipitation.

Synthesis and addition of single stranded DNA tails. Single stranded DNA (-) was generated from the 5 'end of the viral genome with DisplayThermo-RT reverse transcriptase (Display Systems Biotech, Copenhagen, Denmark) using 2 µg of total RNA from infected cells and 100 pmol of CM79 primer (See “PCR and RT-PCR”) and following the manufacturer's instructions (reaction: 65ºC for 10 min, 42ºC for 40 min, 65ºC for 15 min). The DNA was purified by two sequential phenol / chloroform extractions and ethanol precipitations with 1/4 vol of 10 M ammonium acetate (Schaefer, 1995). A poly-dA tail was added to the first cDNA chain with Terminal deoxynucleotidyl transferase (TdT) (Roche Molecular Biochemicals, Mannheim, Germany) using 50% of the "first chain" product, 50 units of terminal transferase, dATP 6, 25 µM and 1.5 mM CoCl2 in 50 µl of TdT buffer, as recommended by the manufacturer. After incubation at 37 ° C for 30 min, the product was purified by phenol / chloroform extraction and ethanol precipitation.

Construction of a cDNA library and nucleotide sequencing. The cDNA synthesis, cloning and analysis of the library were generally carried out in the manner described above (Meyers et al., 1991). The synthesis of cDNA was primed with BVD13, BVD14 and BVD15 (Meyers et al., 1991), as well as with B22.1R (GTTGACATGGCATTTTTCGTG), B12.1R (CCTCTTATACGTTCTCACAACG), BVD33 (GCATCCATCATXCC-NGG-3-RTGATGCC-RTGAT-CCG-NGG-3) 7 (CAAATCTCTGATCAGTTGTTCCAC), B23-RII (TTGCACACGGCAGGTCC) and B-3 '(GTCCCCCGGGGGCTGTTAAGGGT-TTTCCTAGTCCA). The probe used for library analysis was the Xhol / Aatll insert of a cDNA clone of the BVDV strain cp7 (GenBank accession number U63479, Meyers et al., 1996b); hybridization was carried out at 52 ° C. Exonuclease III and S1 nuclease were used to establish deletion libraries of cDNA clones (Henikoff, 1987). Nucleotide sequencing of double stranded DNA was carried out with a BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany). As a rule, the two chains of the cDNA clones were sequenced; overlaps between independent cDNA clones were sequenced in at least two clones. In total, about 47,000 nucleotides were analyzed, which is equivalent to an overall coverage of ~ 3.8 for the entire genome. Sequence alignment analyzes were performed with the Genetics Computer Group software (Devereux et al., 1984).

Construction of the full length cDNA clone. Restriction, cloning and other conventional procedures were generally carried out in the manner described in the literature (Sambrook et al., 1989). Restriction and modification enzymes were purchased from New England Biolabs (Schwalbach, Germany), Pharmacia (Freiburg, Germany), GibcoBRL (Eggenstein, Germany) and Boehringer Mannheim (Germany). Five cDNA clones from the library were used for the construction of the full-length cDNA clone: ​​plasmid C3 / 8 (nucleotides 35 to 2411), plasmid C5 / 11 (nucleotides 22 to 2400), plasmid 8/11 (nucleotides 3400 to 7814), plasmid 13/27 (nucleotides 4783 to 9910) and plasmid C4 / 24 (nucleotides 8658 to 12322). A RT-E2 fragment was obtained by RT-PCR that ranged from nucleotide position 2144 to position 4447 with primers CM29 (GATGTAGACACATGCGACAAGAACC) and CM51 (GCTTCCACTCTTATGCCTTG), using RNA from MDBK cells infected with field isolate VLS No. 399 as model. In the following description, plasmid restriction sites that flank viral cDNA inserts are underlined.

First, clone 3/8 was cut with AatII and HindIII and the cDNA insert was transferred to pACYC177 cut with the same enzymes. The resulting plasmid was designated pKANE5. The RT-PCR product "RT-E2" was inserted into the Ndel / HindIII sites of this plasmid after restriction with the same enzymes; The resulting plasmid was pKANE8. Next, the AatII fragment of clone 5/11 was transferred to the AatII site of pKANE8, giving rise to plasmid pKANE14.

The 5 'end of the recombinant cDNA clone was generated by PCR with CM87 primers (GCTCTAGACGGCCGTAATAC-GACTCACTATAGGTATACGAGATTAGCTAAAGAACTCGTATATGGATTGGACGTCAAC) that introduces a T7 promoter sequence upstream of the first nucleotide and CM-PCR79; plasmid C5 / 11 was used as a PCR model. The PCR product was linked to the Xbal and BsrGI sites of the C5 / 9 cDNA clone, resulting in plasmid pKANE22. Subsequently, it was observed that the CM87 oligo contained a false nucleotide and pKANE22 was repaired by PCR with the CM88 (GACGGCCGTAATACGACTCACTATAGTATACG) and CM79. The PCR product was treated with E. coli DNA polymerase I (Klenow fragment) to produce blunt ends and then restricted with BsrGI. It was cloned into the SpeIromo / BsrGI sites of pKANE22, resulting in plasmid pKANE22A. The cDNA 8/11 clone insert was cut with Xhol and BamHI and cloned into pACYC177 cut with the same enzymes; The resulting plasmid was named pKANE6. The AvrII / BamHI fragment of cDNA clone 13/27 was transferred to pKANE6, giving plasmid pKANE15. Next, the EcoRV / MfeI fragment of pKANE14 was inserted into pKANE15, digested with the same enzymes. The resulting plasmid was pKANE21. pKANE21 was digested with SacII and EcoRV and a corresponding fragment of pKANE14 was cloned into these sites, leading to plasmid pKANE24. Then, the SacII / SacII fragment of pKANE22A was cloned into pKANE24, cut with the same enzyme. The resulting plasmid was pKANE28AII. The 3 'end of the genome was generated by PCR with primers B2-11500 (CCTAACCATGATATATGCCTTCTG) and CM81 (CGGA-ATTCGCCCGGGCTGTTAGAGGTCTTCCCTAGT) that adds a SrfI site to the 3' end of the genome. The PCR product was cut with BamHI and EcoRI and cloned into pACYC177, resulting in plasmid pKANE17. Next, the SacI / Kpn21 fragment of the cDNA clone C4 / 24 was transferred to pKANE17; the plasmid was named pKANE20. The StuI / EcoRI fragment of pKANE20 was cleaved and cloned into plasmid pKANE21, which was digested with EcoRI and partially digested with StuI. The resulting plasmid was pKANE23. Finally, the XbaI / PshAI fragment of pKANE28AII was inserted into plasmid pKANE23 cut with the same enzymes, giving rise to the full length cDNA clone pKANE40.

Site-directed mutagenesis. All mutants were generated by PCR using the QuikChange site directed mutagenesis kit (Stratagene, Amsterdam, Netherlands) following the manufacturer's instructions. The plasmid used to introduce mutations in the region encoding Erns was C5 / 9, a clone obtained from the initial cDNA library (nucleotides 50 to 2411). The oligonucleotides to generate H "346". were CM126 (GAGTGGAATAAAGGTTGGTGTAAC) and CM127 (GTTACACCAACCTTTATTCCACTC), the oligo for mutant H "297" L were CM128 (AACAGGAGTCTATTAGGAATTTGGCCA) and CM129 (TGGCCAAATTCCTATAGACT.) The presence of the desired mutations and the absence of second site mutations were verified by nucleotide sequencing.

In vitro transcription and RNA transfection

RNA transcription and MDBK cell transfection were basically performed in the manner described above (Meyers et al., 1996a). In a nutshell, 2 µg of the corresponding cDNA construct with SrfI was linearized and purified by phenol extraction and ethanol precipitation. Transcription with T7 RNA polymerase (NEB, Schwalbach, Germany) was carried out in a total volume of 50 µl transcription mixture (40 mM Tris-HCl, pH 7.5; 6 mM MgCl2; 2 mM spermidine; 10 mM NaCl; 0.5 mM ATP, GTP, CTP and UTP for each; 10 mM dithiothreitol; 10 µg / ml bovine serum albumin) with 50 units of T7 RNA polymerase in the presence of 15 RNA guard units (Pharmacia, Freiburg, Germany). After incubation at 37 ° C for 1 h, the reaction mixture was passed through a rotation column of Sephadex G-50 and further purified by phenol extraction and ethanol precipitation.

If the opposite is not specified, the transfection was carried out with a suspension of approx. 3x106 MDBK cells and about 0.5 µg of RNA transcribed in vitro bound to DEAE-dextran (Pharmacia, Freiburg, Germany). The RNA / DEAE-dextran complex was established by mixing dissolved RNA in 100 µl of HBSS (5 g of Hepes, 8 g of NaCl, 0.37 g of KCl, 0.125 g of Na2HPO4 · 2H2O and 1 g of dextrose per liter; pH 7.05) with 100 µl of DEAE-dextran (1 mg / ml in HBSS) and incubation for 30 minutes on ice. The granulated cells were washed once with DMEM without FCS, centrifuged and resuspended in the RNA / DEAE-dextran mixture. After 30 minutes of incubation at 37 ° C, 20 µl of dimethylsulfoxide was added and the mixture was incubated for 2 minutes at room temperature. After the addition of 2 ml of HBSS, the cells were agglomerated and washed once with HBSS and once with medium without FCS. The cells were re-suspended in DMEM with FCS and seeded on a 10.0 cm diameter plate. 48 72 hours after transfection, the cells were separated and seeded appropriately for further analysis. Electroporation was used to determine the specific infectivity of RNA. 3x106 MDBK cells in 0.5 ml of phosphate buffered saline (PBS) without magnesium or calcium were mixed with adequate amounts of RNA and transferred to a 2 mm electroporation cuvette. Electroporation was performed with a pulse of 960 µF, 180 volts on a Progenetor II Hoefer PG 200. The cells were then seeded on 3.5 cm plates and analyzed by immunofluorescence approximately 20 h later.

Determination of RNAse activity. MDBK cells were infected with the recombinant viruses and cultured for 48 hours. Cells infected with a wild-type virus served as positive controls and uninfected cells were used as negative controls. Cell preparation and RNAse activity measurement were carried out in the manner described above (Meyers et al., 1999), with the exception that the incubation of the probes at 37 ° C was 30 min instead of 1 hour, because a longer incubation resulted in considerable background activity in MDBK cells.

Animal experiments Two animal experiments were carried out to test the recombinant viruses. In the first experiment, 3 animals of spotted cattle (8 to 10 months of age) were inoculated intranasally with 105TCID50 per animal. In the second experiment, 6 crossed Holstein and Holstein male calves (7 to 10 weeks old) were infected intranasally with 5x105TCID50. In the stimulation experiment, the animals were inoculated with 5x106TCID50. Before infection, it was found that all animals were free of antigens and antibodies specific for BVDV. The different groups were housed in separate isolation units. Clinical parameters were recorded daily, as indicated in the results section. Blood was extracted from the external jugular vein at the times indicated in the results section and stabilized with heparin (approx. 35 IU / ml), unless used for serum production.

In order to determine the presence of virus in blood, leukocyte layers ("buffy coats") were prepared from all blood samples. 5 ml of frozen lysis buffer was added to an aliquot of blood stabilized with heparin (containing approx. 107 leukocytes) and incubated on ice for 10 min, followed by centrifugation. The granulate was washed once with lysis buffer and twice with PBS without Ca2 + or Mg2 + before re-suspending it in 2 ml of PBS. MDBK cells seeded in 24-well plates were inoculated with 200 µl of leukocyte layer preparations and incubated for 5 days. The viral antigen was detected by immunofluorescence microscopy with the BVDV E2 mAb mixture (see above).

The presence of virus neutralizing antibodies was tested in serum samples that had been inactivated by incubation at 56 ° C for 30 min. The sera were diluted in 1: 2 steps in 96-well microtiter plates and inoculated with a suspension of the '93 / C New York strain (100 TCID50 per well) for 1 hour at 37 ° C. S added 101.75 MDBK cells to each well and incubated for 5 days. The infection was analyzed by immunofluorescence, calculated by the Kaerber method (Mayr et al., 1974) and expressed as the final 50% dilution that neutralized approx. 100 TCID50.

To detect viruses in nasal secretions, samples of said secretions were collected at the times indicated in the results section, diluted in 2 ml of transport buffer (PBS supplemented with 5% FCS, 100 IU / ml of penicillin G, 0.1 ml of streptomycin and 2.5 µg / ml of amphotericin B) and passed through a 0.2 µm filter. MDBK cells were inoculated in 24-well plates with 100 µl of these preparations and analyzed by indirect immunofluorescence microscopy after 5 days.

RESULTS

Genome Analysis The NY'93 / C strain is the second genome of BVDV type 2 that has been completely sequenced. Northern blot analysis showed that, unlike strain 890 (Ridpath and Bolin, 1995), the NY'93 / C genome does not contain large insertions or deletions (data not shown). Nucleotide sequence analysis revealed that the genome is 12332 nucleotides in length and contains an open reading frame that encodes a 3913 amino acid polyprotein.

The 5 'untranslated region (position 1 to 385) was determined by RACE technology and proved to be identical to the '93 New York sequence published by Topliff and Kelling (1998), except position 21. Unlike other genomes of type 2 known (Ridpath, 1995; Topliff and Kelling, 1998), the strain NY'93 / C has in this position adenine instead of thymine.

Construction and analysis of an infectious cDNA clone for NY'93 / C. Although a series of infectious cDNA clones for CSFV and BVDV type 1 have been established (Méndez et al., 1998; Meyers et al., 1996a and 1996b; Moormann et al., 1996; Vassilev et al., 1997; Kümmerer and Meyers, 2000), this is the first report of an infectious clone of a type 2 BVDV strain. The clone was designed for second-round transcription with T7 RNA polymerase, which results in a genome-like RNA without any heterologous addition. The full length clone was constituted from four cDNA plasmids selected from the initial phage library and an RT-PCR product that included the region between positions 2265 and 4301. At the 5 'end, the T7 promoter sequence was added for in vitro transcription and a SrfI site was added to the 3' end for linearization of the plasmid (Fig. 1). The full length clone was named pKANE40A.

MDBK cells were transfected with RNA generated from the linearized model pKANE40A by in vitro transcription. A second-round transcript of plasmid pKANE28AII that terminates 19 codons upstream of the NS5B coding region served as a negative control. Three days after transfection, specific BVDV signals were detected after immunofluorescent staining in cells transfected with pKANE40A RNA, but not in controls. The virus generated from the infectious clone pKANE40A was named XIKE-A. The transfected cells were subjected to two passages and the stock of the second passage was used for all subsequent experiments. The virus was analyzed by RT-PCR sequencing, considering the exchange of nucleotides from C to T at position 1630 as proof of the identity of XIKE-A.

The specific infectivity of pKANE40A-derived RNA was determined in comparison to RNA prepared from cells infected with the wild type NY'93 / C virus. For this purpose, the concentration of viral RNA was measured in samples used for transfection of MDBK cells, compared to defined amounts of RNA transcribed in vitro after Northern blotting and hybridization, using a phosphorescent imaging device. MDBK cells with similar amounts of both RNAs were transfected and plates were counted three days after transfection. On average, the infectivity of RNA derived from pKANE40A was 4.32 x 102 pfu /! G and wild-type RNA gave 4 x 102 pfu /! G.

Growth characteristics of the recombinant virus were analyzed through a growth curve, using the original field isolate VLS No. 399 as a control in the same experiment (Fig. 2). MDBK cells were infected with a moi of 0.1 and samples were taken at seven intervals from 2 hours to 96 hours after infection. The growth curve of the recombinant XIKE-A is somewhat flatter than that of VLS No. 399, but both viruses reach a titer of 106.39 after 96 hours. It was therefore considered that XIKE-A is suitable for subsequent experiments.

Construction and analysis of Erns mutants. Previous experiments with CSFV (Meyers et al., 1999) had shown that Erns glycoprotein RNAse activity is destroyed by the replacement of histidine 297 or 346 (the figures represent the positions of the residue in the strain of CSFV Alfort / Tübingen) by leucine or lysine, or by deletion of the codon "H346". Mutant viruses are viable, but clinically attenuated. In the BVDV NY'93 / C strain, the two histidine residues are located at positions 300 and 349, respectively. To test whether the effects of mutations in these positions could be similar to CSFV in the genome of BVDV type 2, two infectious clones were engineered with a deletion of the "H349" codon or a replacement of the "H300" codon with leucine. The resulting viral mutants were named XIKE-B (H349.) And XIKE-C (H300L). Both mutants were stable in MDBK cells for at least five passages, as determined by nucleotide sequencing of RT-PCR products comprising the Erns coding region. The growth characteristics of the two mutant viruses were compared with the virus derived from the infectious clone of wild type XIKE-A (Fig. 3).

The RNAse activity of XIKE-A, XIKE-B and XIKE-C in crude cell extracts of infected cells with the same moi of any of the virus two days after infection was determined. The ability to degrade poly (U) of aliquots of the preparations was analyzed; cells infected with the wild type NY'93 / C strain served as a positive control and uninfected cells were used as negative controls. After 30 min incubation, high molecular weight, residual RNA precipitated, and OD260 measurement of supernatants revealed the presence of small degraded RNA fragments (Meyers et al., 1999). High RNAse activity was found in the NY'93 / C and XIKE-A samples, while the two mutants, XIKE-B and XIKE-C, were found at the same level as the negative control (Fig. 4) .

Animal experiments with XIKE-A and NY'93 / C. The purpose of the first animal experiment was to compare the virulence and pathogenesis of the recombinant XIKE-A virus derived from the infectious cDNA clone with the wild type NY'93 / C strain. Two groups of three animals (8 to 9 months old) were infected with 105TCID50 of XIKE-A (animals No. 615, No. 377, No. 091) or NY'93 / C (animals No. 275, No. 612, No. 1610). Each group was housed in a separate isolation unit. Body temperature and clinical signs were recorded daily; Blood samples were taken on days 0, 2 to 16 21 after infection for leukocyte count and viremia detection. Serums were collected from all calves for the detection of neutralizing antibodies against NY'93 / C

on days 0, 7, 14, 21, 19 and 35 after infection. Nasal smears were performed for virus isolation on days 0, 2 to 16 and 21 after infection.

<dl><dt>Virus isolation from leukocyte layer preparations Day pi No. 275 No. 612 No. 1610 No. 615 No. 377 No. 091 -26 0 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 21 Total ø --- ++ - + ++ ++ ++ ++ - ++ ------ 7 ---- ++ ++ ++ - + ---------- 4 5 ---- + + + - ++ ++ ---------- 4 ---- + ++ ++ ++ ++ ++ --------- 6 --- ++ ++ ++ ++ ++ ++ ++ -------- 7 6,7 --- ++ - + ++ ++ ++ ++ ---- ++ * * * * 7 </dt><dd>Virus isolation from nasal smears No. 275 No. 612 No. 1610 No. 615 No. 377 No. 091 --------- ++ bac bac ------ 1 --------- + --------- 1 0.7 ------------------ 0 --------- ++ + ------ --2 --------- ++ bac ------- 1 1.7 --------- ++ + ---- * * * * 2 </dd></dl>

Table 1: virus isolation from leukocyte layer and nasal smear preparations of animals infected with New York '93 / C or XIKE-A. + Virus detected; - absence of virus detection; bac = bacteria; * The animal underwent euthanasia on day 13 after infection.

All animals in both groups developed fever (Fig. 5) and a broad spectrum of clinical signs, including respiratory symptoms and gastrointestinal disorders. Animal No. 091 was sacrificed on day 13 after infection for humanitarian reasons. All calves in both groups showed leukopenia that started on day 3 after infection and persisted until day 15 after infection (Fig. 6). The virus was detected in leukocyte layer preparations of animals infected with NY'93 / C for 5 days and with XIKE-A for 7 days. Nasal discharge was observed for 1 or 2 days (Table 1).

The identity of the viruses was verified by nucleotide sequencing of RNA RT-PCR products prepared from leukocyte layer preparations of all animals. The entire Erns coding region (positions 1140 to 1780) was sequenced and demonstrated to be identical to the known sequences of NY'93 / C or XIKE-A, respectively. Neutralizing anti-bodies were found in the serum of all calves from day 14 after infection (Table 2).

Days pi 615 377 091 275 612 1610

-26 &lt;2 &lt;2 &lt;2 &lt;2 &lt;2 &lt;2 0 &lt;2&lt;2&lt;2&lt;2&lt;2&lt;2 7 &lt;2&lt;2&lt;2&lt;2&lt;2&lt;2 13/14 645 323 406 256 128 40 21 1024 1290 * 1290 512 51 29 2580 4096 * 813 2580 2580 35 3251 3251 * 8192 2580 5161

* The animal underwent euthanasia on day 13

Table 2. Titles of neutralizing antibodies determined in serum samples from all calves after experimental infection with New York '93 / C or XIKE-A. The results are expressed as the reciprocal of the neutralizing antibody titres specific for serum BVDV against New York '93 / C (102.07TCID50).

The results of this study demonstrated that the XIKE-A recombinant virus is very similar to the New York '93 / C wild-type virus with respect to both the pathogenesis and the induction of an immune response in the natural host. It is therefore possible to assume that any deviation from this clinical picture that could be observed in a viral mutant generated on the basis of the infectious clone pKANE40A would be caused by the desired mutation.

Animal experiment with XIKE-B and XIKE-A. In the second experiment with animals, the clinical and immunological characteristics of the RNAsa-negative mutant XIKE-B were analyzed, compared to XIKE-A. The H349 mutant. received precedence over the H300L mutant to minimize the risk of genomic reversion to type

5 wild.

In two groups of three calves each (from 7 to 10 weeks of age) a dose of 5x105TCID50 of XIKE-A (animals No. 387, No. 388, No. 418) or XIKE-B virus (animals No. 415, No. 417) was inoculated , no. 419). The groups were housed in separate isolation units. Daily rectal temperature and clinical symptoms were controlled; he

10 they took nasal smears and blood samples on days –8, 0, 2 to 14, 17 and 21. Serum samples were collected on days 0, 8, 12/14, 21, 28 and 38/40.

Nine to ten days after infection, calves infected with XIKE-A developed fever for a period of up to 3 days; In addition, animal No. 387 had a fever on day 3 after infection (Fig. 7), which was accompanied by diarrhea and respiratory symptoms. Calf No. 388 suffered seizures. The group underwent euthanasia for humanitarian reasons on day 12 after infection, in a state of marked depression and anorexia. None of the calves infected with XIKE-B showed an increase in body temperature (Fig. 7). Only mild respiratory symptoms were observed until day 6. Leukopenia was observed in all animals; however, the decrease in the number of leukocytes was more pronounced in calves infected with wild-type XIKE-A than in the group

twenty XIKE-B (Fig. 8).

The virus was detected in leukocyte layer preparations of all animals from day 4 after infection; however, the viremia was shorter for the Erns mutant (Ø 4 days) than for the virus with the wild type sequence (Ø 8 days). Nasal secretion of the virus could be observed for a period of up to 8 days (Ø 4.7) in the

25 XIKE-A animals, but only for a maximum of 1 day (Ø 0.7) in XIKE-B animals (Table 3).

Virus isolation from layer preparations Virus isolation from leukocyte nasal smears Days No. 415 No. 417 No. 419 No. 387 No. 388 No. 418 No. 415 No. 417 No. 419 No. 387 No. 388 No. 418

pi

<dl><dt>-8 </dt><dd> - - - - - - - - - - - - </dd></dl>

<dl><dt>or </dt><dd> - - - - - - - - - - - - </dd></dl>

<dl><dt>2 </dt><dd> - - - - - - - - - - - - </dd></dl>

<dl><dt>3 </dt><dd> - - - - - - - - - - - - </dd></dl>

<dl><dt>4 </dt><dd> +- +- - ++ ++ ++ - - - - - - </dd></dl>

<dl><dt>5 </dt><dd> ++ +- +- ++ ++ ++ - - - - - +- </dd></dl>

<dl><dt>6 </dt><dd> ++ +- ++ ++ ++ ++ - +- - - - +- </dd></dl>

<dl><dt>7 </dt><dd> ++ ++ ++ ++ ++ ++ - - +- +- - +- </dd></dl>

<dl><dt>8 </dt><dd> - +- - ++ ++ ++ - - - - - +- </dd></dl>

<dl><dt>9 </dt><dd> - - - ++ +- ++ - - - ++ ++ +- </dd></dl>

<dl><dt>10 </dt><dd> - - - ++ +- +- - - - +- +- ++ </dd></dl>

<dl><dt>11 </dt><dd> - - - ++ +- ++ - - - +- - +- </dd></dl>

<dl><dt>12 </dt><dd> - - - - - - - - - - - ++ </dd></dl>

<dl><dt>13 </dt><dd> - - - * * * - - - * * * </dd></dl>

<dl><dt>14 </dt><dd> - - - * * * - - - * * * </dd></dl>

<dl><dt>17 </dt><dd> - - - * * * - - - * * * </dd></dl>

<dl><dt>21 </dt><dd> - - - * * * - - - * * * </dd></dl>

<dl><dt>total </dt><dd> 4 5 3 8 8 8 0 1 4 2 8 </dd></dl>

<dl><dt>OR </dt><dd> 4 8 0,7 1 4,7 </dd></dl>

Table 3. Virus isolation from leukocyte layer and nasal smear preparations of animals infected with the recombinant virus XIKE-A (animals No. 38, No. 388 and No. 418) or the Erns XIKE-B mutant (animals No. 415, No. 30 417 and No. 419). + Virus detected, - absence of virus detection, * animals undergoing euthanasia on day 12 after infection.

Again, nucleotide sequencing of RT-PCR products comprising the entire Erns coding region was used for virus identification in leukocyte layer preparations. As expected, the isolates of animals No. 387, No. 388 and No. 418 were of the wild type. A deletion of the codon "H349" was confirmed for animals No. 415, No. 417 and No. 419. It is interesting to note that an additional point mutation was found in the RT-PCR products of two of these animals (No. 415 and No. 419): nucleotide position 1246 changed from guanine to thymine, resulting in the replacement of amino acid Q287H. Neutralizing antibodies were first detected on day 12 after infection in the serum of calves infected with

40 XIKE-A and on day 14 after infection in the serum of calves infected with the Erns mutant (Table 4).

Days pi 0 8 12/14 21 28 38/40

<dl><dt>387</dt><dd> 388 418 415 417 419 </dd></dl>

<dl><dt>&lt;2 </dt><dd /><dt>&lt;2 </dt><dd /><dt>&lt;2 </dt><dd /><dt>&lt;2 </dt><dd /><dt>&lt;2 </dt><dd /><dt>&lt;2 </dt><dd /></dl>

<dl><dt>&lt;2 </dt><dd /><dt>&lt;2 </dt><dd /><dt>&lt;2 </dt><dd /><dt>&lt;2 </dt><dd /><dt>&lt;2 </dt><dd /><dt>&lt;2 </dt><dd /></dl>

<dl><dt>20 </dt><dd> 8 128 51 203 64 </dd></dl>

<dl><dt>* </dt><dd /><dt>* </dt><dd /><dt>* </dt><dd> 512 1024 406 </dd></dl>

<dl><dt>* </dt><dd /><dt>* </dt><dd /><dt>* </dt><dd> 2048 1024 4096 </dd></dl>

<dl><dt>* </dt><dd /><dt>* </dt><dd /><dt>* </dt><dd> 8182 4096 4096 </dd></dl>

* the animals underwent euthanasia on day 12.

5 Table 4: Titles of neutralizing antibodies determined in serum samples from all calves after experimental infection with XIKE-A (wild type sequence) or XIKE-B (H346?). The results are expressed as the reciprocal of the neutralizing antibody titres specific for serum BVDV against New York '93 / C (101.7TCID50).

10 Example 2 Experimental Design

ç 12 pregnant heifers were selected from a negative herd for BVDV. The following group of 5/7 heifers was included in the trial: 15 Virus Inoculation No.

Group 1: 5 One administration, 3 ml in each nostril XIKE-A Group 2: 5 One administration, 3 ml in each nostril NY-93

The heifers were moved to the experimental facilities 8 days before the inoculations. Pregnancy was confirmed after transport to the experimental facility. The heifers were on day 60 to 90 of gestation on the day of inoculation. Inoculation was carried out in all animals at the same time with 2.5 x 104

twenty TCID50 / ml of the corresponding virus, applied in 6 ml of tissue culture supernatant. In the heifers, the presence of clinical signs of BVDV infection, including abortion, was monitored during the observation period. The experiment ended 9 weeks after infection. Cows that did not abort were sacrificed and their uterus examined and collected. Samples of the fetal organs were taken during routine necropsy and examined for BVDV infection.

25 The presence of fetal infection was the main evaluation parameter, composed of the cow mortality rate related to BVDV, the number of abortions related to BVDV and the number of BVDV term fetuses. Results:

30 Group 1

Animal nº Conclusion

35 526 Abortion by BVD 598 Abortion by BVD 615 Abortion by BVD 618 Abortion by BVD

40 626 Dead heifer by BVD

Group 2

Animal nº Conclusion 45 __________________________________

184 Heifer killed by BVD 203 Abortion by BVD 232 Heifer killed by BVD

fifty 233 BVD-positive (viral) fetus 252 Abortion by BVD 267 Dead heifer by BVD 306 Abortion by BVD

Bibliography

Baker, JC 1987. Bovine viral diarrhea virus: a review. J. AM. Vet. Med. Assoc. 190: 1449-1458

Becher, P., Orlich, M., Kosmidou, A., König, M., Baroth, M., Thiel, HJ, 1999. genetic Diversity of Pestivirus: Identification of Novel Groups and Implications for Classification. Virology 262: 64-71.

Bolin, SR, Littledike, ET and Ridpath, JF (1991): Serologic detection and practical consequences of antigenic diversity among bovine viral diarrhea viruses in a vaccinated herd. Am. J. Vet. Res. 52: 1033-1037.

Devereux, J., Haeberli, P. and Smithies, O. (1984): A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12: 387-195.

Flores, EF, Gil., LH, Botton, SA, Weiblen, R., Ridpath, JF, Kreutz, LC, Pilati, C., Driemeyer, D., Moojen, V. and Wendelstein, AC (2000): Clinical, pathological and antigenic aspects of bovine viral diarrhea virus (BVDV) type 2 isolates identified in Brazil. Vet. Microbiol 77: 175-83.

Henikoff, S. (1987): Unidirectional digestion with exonuclease III in DNA sequence analysis. Methods Enzymol. 155: 156-165.

Hulst, MM, Panoto, FE, Hoekman, A., van Gennip, HG and Moormann, RJ (1998): Inactivation of the RNase activity of glycoprotein E (rns) of classical swine fever virus results in a cytopathogenic virus. J. Virol. 72: 151-7.

Kümmerer, BM, Tautz, N., Becher, P., Thiel, H. and Meyers, G. (2000): The genetic basis for cytopathogenicity of pestiviruses. Vet. Microbiol 77: 117-28.

Mayr, A., Bachmann, PA, Bibrack, B. and Wittmann, G. (1974): Virologische Arbeitsmethoden Band I. Gustav Fischer Verlag, Stuttgart.

Méndez, E., Ruggli, N., Collett, MS and Rice, CM (1998): Infectious bovine viral diarrhea virus (strain NADL) RNA from stable cDNA clones: a cellular insert determines NS3 production and viral cytopathogenicity. J. Virol. 72: 4737

45.

Meyers, G., Tautz, N., Dubovi, EJ and H.-J-Thiel (1991): Viral cytopathogenicity correlated with integration of ubiquitin-coding sequences. Virology 180: 602-616.

Meyers, G., Thiel, HJ and Rumenapf, T. (1996a): Classical swine fever virus: recovery of infectious viruses fron cDNA constructs and generation of recombinant cytopathogenic defective interfering particles. J. Virol. 70: 1588-95.

Meyers, G., Tautz, N., Becher, P., Thiel, H.-J., Kümmerer, BM (1996b): Recovery of cytopathogenic and noncytopathogenic bovine viral diarrhea viruses from cDNA constructs. J. Virol. 70: 8606-13 (Erratum J. Virol. 1997, 71: 173)

Meyers, G., Saalmüller, A. and Büttner, M. (1999): Mutations abrogating the RNAse activity in glycoprotein Erns of the pestivirus classical swine fever virus leads to virus attenuation. J. Virol. 73: 10224-10235.

Moennig, V. and Liess, B. 1995. Pathogenesis of Intrauterine Infections with Bovine Viral Diarrhea Virus. 11: (3), 477

487.

Moennig, V. and Plagemann, J. 1992. The pestiviruses. Adv. Virus Res. 41: 53-91.

Moormann, RJ, van Gennip, HG, Miedema, GK, Hulst, MM and van Rijn, PA (1996): Infectious RNA transcribed from an engineered full-length cDNA template of the genome of a pestivirus. J. Virol. 70: 763-70.

Oirschot van, JT, Bruschke, CJM, Rijn van, PA, 1999. Vaccination of cattle against bovine viral diarrhea. Veterinary Microbiology, 64: 169-183.

Racaniello, VR and Baltimore, D., 1981. Cloned poliovirus complementary DNA is infectious in mammalian cells. Science 214: 916-919.

Ridpath, JF, Bolin, SR and Dubovi, EJ (1994): Segregation of bovine viral diarrhea virus into genotypes. Virology 205: 66-74.

Ridpath, JF and Bolin, SR (1995): The genomic sequence of a virulent bovine viral diarrhea virus (BVDV) from the type 2 genotype: detection of a large genomic insertion in a noncytopathic BVDV. Virology 212: 39-46.

Ridpath, JF, Neill, JD (2000): Detection and characterization of genetic recombination in cytopathic type 2 bovine viral diarrhea viruses. J. Virol. 74: 8771-4.

Ridpath, JF, Neill, JD, Frey, M., Landgraf, JG (2000): Phylogenetic, antigenic and clinical characterization of type 2 BVDV from North America. Vet. Microbiol 77: 145-55.

Rümenapf, T., Meyers, G., Stark, R. and Thiel H.-J. (1989): Hog cholera virus characterization of specific antiserum and identification of cDNA clones. Virology 171: 18-27.

Sambrook, SE, Fritsch, F. and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Schaefer, BC (1995): Revolutions in Rapid Amplification of cDNA Ends: New Strategies for Polymerase Chain Reaction Cloning of Full-Length cDNA Ends. Anal. Biochem 227: 255-273.

Thiel, H.-J., Stark, R., Weiland, E., Rümenapf, T. and Meyers, G. (1991): Hog cholera virus: molecular composition of virions from a pestivirus. J. Virol. 65: 4705-4712.

Thiel, H.-J., Plagemann, GW and Moennig, V. 1996. The pestiviruses. In Fields Virology, eds. Fields, BN, Knipe, DM, and Howley, PM (Lippincott-Raven, Philadelphia), pp. 1059-1073.

Tijssen, P. Pellerin, C., Lecomte, J. (1996): Immunodominant E2 (gp53) sequences of highly virulent bovine viral diarrhea group II viruses indicate a close resemblance to a subgroup of border disease viruses. Virology 217: 356

361.

Topliff, CL and Kelling, CL (1998): Virulence markers in the 5 'untranslated region of genotype 2 bovine viral diarrhea virus isolates. Virology 250: 164-72.

Van Gennip, HG, van Rijn, PA, Widjojoatmodjo, MN, Moormann, RJ (1999): Recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones by a swine kidney cell line expressing bacteriophage T7 RNA polymerase. J. Virol. Methods 78: 117-128.

Vassilev, VB, Collett, MS and Donis, RO (1997): Authentic and chimeric full-length genomic cDNA clones of bovine viral diarrhea virus that yield infectious transcripts. J. Virol. 71: 471-8.

Weiland, E., Thiel, H.-J., Hess, G. and Weiland, F. (1989): Development of monoclonal neutralizing antibodies against bovine viral diarrhea virus after pre-treatment of mice with normal bovine cells and cyclophosphamide. J. Virol. Methods 24: 237-244.

SEQUENCE LIST

&lt;110&gt; Boehringer Ingelheim Vetmedica GmbH 5 &lt;120&gt; Infectious virus of bovine viral diarrhea

&lt;130&gt; 1-1249

&lt;140&gt; not assigned 10 &lt;141&gt; 2001-09-06

&lt;160&gt; 25

&lt;170&gt; PatentIn Ver. 2.1 15

&lt;210&gt; 1

&lt;211&gt; 12332

&lt;212&gt; DNA

&lt;213&gt; Bovine viral diarrhea virus (BVDV) 20

<dl><dt>&lt;210&gt; 2 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: PCR primer </dt><dd /></dl>

<dl><dt>&lt;400&gt; 2 ctccatgtgc catdtacagc agag </dt><dd> 24 </dd></dl>

<dl><dt>&lt;210&gt; 3 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: PCR primer </dt><dd /></dl>

<dl><dt>&lt;400&gt; 3 ctcgtccaca tggcatctcg agac</dt><dd> 24 </dd></dl>

<dl><dt>&lt;210&gt; 4 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: PCR primer </dt><dd /></dl>

<dl><dt>&lt;400&gt; 4 gcactggtgt cactctgttg </dt><dd> 20 </dd></dl>

<dl><dt>&lt;210&gt; 5 &lt;211&gt; 25 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: PCR primer </dt><dd /></dl>

<dl><dt>&lt;400&gt; 5 gagaaggctg agggtgatgc tgatg </dt><dd> 25 </dd></dl>

<dl><dt>&lt;210&gt; 6 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: PCR primer </dt><dd /></dl>

<dl><dt>&lt;400&gt; 6 gactttccgc ttctttttag g </dt><dd> 21 </dd></dl>

<dl><dt>&lt;210&gt; 7 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: PCR primer </dt><dd /></dl>

<dl><dt>&lt;400&gt; 7 ggagagaata tcacccagtg</dt><dd> 20 </dd></dl>

<dl><dt>&lt;210&gt; 8 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Artificial sequence description: PCR primer &lt;400&gt; 8 ctccactccg cagtatggac ttgc </dt><dd> 24 </dd></dl>

<dl><dt>&lt;210&gt; 9 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: oligonucleotide </dt><dd /></dl>

<dl><dt>&lt;400&gt; 9 cctaaaaaga agcggaaagt c </dt><dd> 21 </dd></dl>

<dl><dt>&lt;210&gt; 10 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; </dt><dd /></dl>

&lt;223&gt; Description of artificial sequence: oligonucleotide

&lt;400&gt; 10 gttgacatgg catttttcgt g

&lt;210&gt; 11

&lt;211&gt; 22

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: oligonucleotide

&lt;400&gt; 11 cctcttatac gttctcacaa cg

&lt;210&gt; 12

&lt;211&gt; 21

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: oligonucleotide

&lt;400&gt; 12 gtatccatca tccrtgatga t

&lt;210&gt; 13

&lt;211&gt; 24

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: oligonucleotide

&lt;400&gt; 13 caaatctctg atcagttgtt ccac

&lt;210&gt; 14

&lt;211&gt; 17

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: oligonucleotide

&lt;400&gt; 14 ttgcacacgg caggtcc

&lt;210&gt; 15

&lt;211&gt; 35

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: oligonucleotide

&lt;400&gt; 15 gtcccccggg ggctgttaag ggttttccta gtca

&lt;210&gt; 16

&lt;211&gt; 25

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: PCR primer &lt;400&gt; 16 gatgtagaca catgcgacaa gaacc 25

<dl><dt>21 </dt><dd /></dl>

<dl><dt>22 </dt><dd /></dl>

<dl><dt>21 </dt><dd /></dl>

<dl><dt>24 </dt><dd /></dl>

<dl><dt>17 </dt><dd /></dl>

<dl><dt>35 </dt><dd /></dl>

&lt;210&gt; 17

&lt;211&gt; 20

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: PCR primer

&lt;400&gt; 17 gcttccactc ttatgccttg 20

&lt;210&gt; 18

&lt;211&gt; 78

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: PCR primer

&lt;400&gt; 18

gctctagacg gccgtaatac gactcactat aggtatacga gattagctaa 60 agaactcgta tatggattgg acgtcaac 78

&lt;210&gt; 19

&lt;211&gt; 32

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: PCR primer

&lt;400&gt; 19 gacggccgta atacgactca ctatagtata cg 32

&lt;210&gt; 20

&lt;211&gt; 24

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: PCR primer

&lt;400&gt; 20 cctaaccatg atatatgcct tctg 24

&lt;210&gt; 21

&lt;211&gt; 36

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

&lt;220&gt;

&lt;223&gt; Description of artificial sequence: PCR primer

&lt;400&gt; 21 cggaattcgc ccgggctgtt agaggtcttc cctagt 36

&lt;210&gt; 22

&lt;211&gt; 24

&lt;212&gt; DNA

&lt;213&gt; Artificial sequence

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: oligonucleotide </dt><dd /></dl>

<dl><dt>&lt;400&gt; 22 gagtggaata aaggttggtg taca </dt><dd> 24 </dd></dl>

<dl><dt>&lt;210&gt; 23 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: oligonucleotide </dt><dd /></dl>

<dl><dt>&lt;400&gt; 23 gttacaccaa cctttattcc actc</dt><dd> 24 </dd></dl>

<dl><dt>&lt;210&gt; 24 &lt;211&gt; 27 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: oligonucleotide </dt><dd /></dl>

<dl><dt>&lt;400&gt; 24 aacaggagtc tattaggaat ttggcca </dt><dd> 27 </dd></dl>

<dl><dt>&lt;210&gt; 25 &lt;211&gt; 27 &lt;212&gt; DNA &lt;213&gt; Artificial sequence </dt><dd /></dl>

<dl><dt>&lt;220&gt; &lt;223&gt; Description of artificial sequence: oligonucleotide </dt><dd /></dl>

<dl><dt>&lt;400&gt; 25 tggccaaatt cctaatagac tcctgtt</dt><dd> 27 </dd></dl>