Immunosuppressive polypeptides and nucleic acids
Abstract
An isolated or recombinant polypeptide comprising a polypeptide sequence that differs from SECID No.: 36 in no more than 6 amino acid residues and that includes residues at positions 24, 30, 32, 41, 50, 54.55, 56, 64, 65, 70, 85, 104 and 106 that are identical to amino acid residues in the corresponding positions in SEQ ID NO: 36, wherein the polypeptide binds to human CD80 or human CD86 or an extracellular domain of either of them and has an ability to inhibit an immune response that is greater than the capacity of a LEA29Y polypeptide comprising the polypeptide sequence shown in SEQ ID No. 168 to inhibit an immune response.

Term
2.1 yearsto projected expiry
Projected expiry 15 October 2028, counted from filing; an application has no term until it is granted.
- Priority
- Filed
- Published
- Today
- Projected expiry
18 claims: 2 independent, 16 dependent
- 1REIVINDICACIONES 1. Un polipéptido aislado o recombinante que comprende una secuencia de polipéptidos que se diferencia de SEC ID Nº:36 en no más de 6 residuos de aminoácidos y que incluye residuos en las posiciones 24, 30, 32, 41, 50, 54, 55, 56, 64, 65, 70, 85, 104 y 106 que son idénticos a los residuos de aminoácidos en las posiciones correspondientes en SEC ID Nº: 36, en el que el polipéptido se une a CD80 humano o CD86 humano o un dominio extracelular de cualquiera de ambos y tiene una capacidad para inhibir una respuesta inmunitaria que es mayor que la capacidad de un polipéptido LEA29Y que comprende la secuencia de polipéptidos mostrada en SEC ID Nº: 168 para inhibir una respuesta inmunitaria.
- 2El polipéptido de la reivindicación 1, en el que el polipéptido se diferencia de SEC ID Nº:36 en no más de 1, 2, 3, 4 ó 5 residuos de aminoácidos.
- 3El polipéptido de la reivindicación 1, en el que el polipéptido comprende la secuencia de polipéptidos mostrada en SEC ID Nº:36.
- 4Un dímero de polipéptidos aislado o recombinante que comprende dos polipéptidos de cualquiera de las reivindicaciones 1-3, en el que el dímero tiene una mayor capacidad para suprimir una respuesta inmunitaria que un dímero que comprende dos polipéptidos LEA29Y, en el que cada polipéptido LEA29Y comprende la secuencia de polipéptidos mostrada en SEC ID Nº:168.
- 5El polipéptido de la reivindicación 1 que es una proteína de fusión aislada o recombinante que comprende (a) un polipéptido que comprende una secuencia de polipéptidos que se diferencia de SEC ID Nº:36 en no más de 6 residuos de aminoácidos y que incluye residuos en las posiciones 24, 30, 32, 41, 50, 54, 55, 56, 64, 65, 70, 85, 104 y 106 que son idénticos a los residuos de aminoácidos en las posiciones correspondientes en SEC ID Nº: 36 y (b) un segundo polipéptido, en el que el segundo polipéptido es un polipéptido del Fc de Ig, en el que la proteína de fusión tiene una mayor capacidad para suprimir una respuesta inmunitaria que una proteína de fusión LEA29Y-Ig, en el que la proteína de fusión LEA29Y-Ig comprende la secuencia de polipéptidos de SEC ID Nº: 166.
- 6La proteína de fusión de la reivindicación 5, en el que la proteína de fusión comprende la secuencia de polipéptidos mostrada en SEC ID Nº:197 ó 211.
- 7El dímero de polipéptidos de la reivindicación 4, que es un dímero de proteínas de fusión aisladas o recombinantes que comprende dos proteínas de fusión monoméricas ligadas por al menos un enlace disulfuro formado entre dos residuos de cisteína presentes en cada proteína de fusión mutante monomérica, en el que cada proteína de fusión monomérica comprende (a) un polipéptido que comprende una secuencia de polipéptidos que se diferencia de SEC ID Nº:36 en no más de 6 residuos de aminoácidos y que incluye residuos en las posiciones 24, 30, 32, 41, 50, 54, 55, 56, 64, 65, 70, 85, 104 y 106 que son idénticos a los residuos de aminoácidos en las posiciones correspondientes en SEC ID Nº: 36 y (b) un polipéptido del Fc de Ig, y en el que el dímero de proteínas de fusión tiene una mayor capacidad para suprimir una respuesta inmunitaria que un dímero de proteínas de fusión LEA29Y-Ig, en el que el dímero de proteínas de fusión LEA29Y-Ig comprende dos proteínas de fusión LEA29Y-Ig monoméricas comprendiendo cada una la secuencia de polipéptidos de SEC ID Nº: 166.
- 8El dímero de proteínas de fusión de la reivindicación 7, en el que cada proteína de fusión monomérica comprende la secuencia de polipéptidos mostrada en SEC ID Nº:197 ó 211.
- 9Un ácido nucleico aislado o recombinante que comprende una secuencia de polinucleótidos que codifica un polipéptido de cualquiera de las reivindicaciones 1-3, un dímero de polipéptidos de la reivindicación 4, una proteína de fusión de la reivindicación 5 o la reivindicación 6, o un dímero de proteínas de fusión de la reivindicación 7 o la reivindicación 8, o una secuencia de polinucleótidos complementaria del mismo.
- 10Un vector que comprende un ácido nucleico de la reivindicación 9.
- 11Una célula huésped aislada o recombinante que comprende:(a) un polipéptido de cualquier de las reivindicaciones 1-3;(b) un dímero de polipéptidos de la reivindicación 4;(c) una proteína de fusión de la reivindicación 5 o la reivindicación 6;(d) un dímero de proteínas de fusión de la reivindicación 7 o la reivindicación 8;(e) un ácido nucleico de la reivindicación 9;y/o (f) un vector de la reivindicación 10.
- 12Una composición farmacéutica que comprende un excipiente farmacéuticamente aceptable o vehículo farmacéuticamente aceptable y uno o más de los siguientes:(a) un polipéptido de cualquier de las reivindicaciones 1-3;(b) un dímero de polipéptidos de la reivindicación 4;(c) una proteína de fusión de la reivindicación 5 o la reivindicación 6;(d) un dímero de proteínas de fusión de la reivindicación 7 o la reivindicación 8;(e) un ácido nucleico de la reivindicación 9;(f) un vector de la reivindicación 10;y/o (g) una célula huésped de la reivindicación 11.
- 13La composición farmacéutica de la reivindicación 12 que comprende un excipiente farmacéuticamente aceptable o vehículo farmacéuticamente aceptable y un dímero de proteínas de fusión de la reivindicación 8.
- 14Un polipéptido de cualquier de las reivindicaciones 1-3, un dímero de polipéptidos de la reivindicación 4, una proteína de fusión de la reivindicación 5 o la reivindicación 6, un dímero de proteínas de fusión de la reivindicación 7 o la reivindicación 8, un ácido nucleico de la reivindicación 9, un vector de la reivindicación 10 o una célula de la reivindicación 11 para su uso en:(i) un tratamiento profiláctico o terapéutico para inhibir o suprimir una respuesta inmunitaria en un mamífero;(ii) el tratamiento de una enfermedad o trastorno del sistema inmunitario;o (iii) el tratamiento de rechazo de trasplante de tejido u órgano en un mamífero.
- 15El dímero de proteínas de fusión para su uso de la reivindicación 14, en el que el dímero de proteínas de fusión es un dímero de proteínas de fusión de la reivindicación 8.
- 16Uso de un polipéptido según cualquiera de las reivindicaciones 1-3, un dímero de polipéptidos de la reivindicación 4, una proteína de fusión de la reivindicación 5 o la reivindicación 6, un dímero de proteínas de fusión de la reivindicación 7 o la reivindicación 8, un ácido nucleico de la reivindicación 9, un vector de la reivindicación 10 o una célula de la reivindicación 11 para la fabricación de un medicamento para:(i) un tratamiento profiláctico o terapéutico para inhibir o suprimir una respuesta inmunitaria en un mamífero;(ii) el tratamiento de una enfermedad o trastorno del sistema inmunitario;o (iii) el tratamiento de rechazo de trasplante de tejido u órgano en un mamífero.
- 17El uso de un dímero de proteínas de fusión de la reivindicación 16, en el que el dímero de proteínas de fusión es un dímero de proteínas de fusión de la reivindicación 8.
- 18Un procedimiento de producir un polipéptido que comprende cultivar una célula huésped de la reivindicación 11 en un medio de cultivo y recuperar el polipéptido expresado por la célula.
Independent claims18
2,527 paragraphs in 4 sections, as filed
Immunosuppressive polypeptides and nucleic acids
Field of the Invention
The present invention relates, in general, to novel polypeptides that bind to CD80 and / or CD86, to nucleic acid encoding such polypeptides and, to methods of preparation and, to use of such polypeptides and nucleic acids.
Background of the invention
T lymphocytes play an important role in the initiation and regulation of immune responses. For the complete activation of T lymphocytes to occur, at least two different signaling events are required. A first signal is produced by the interaction of T lymphocyte (TCR) receptors expressed on T lymphocytes with specific antigens (Ag) presented in the context of major histocompatibility complex (MHC) molecules expressed on antigen presenting cells (APC). A second signal (co-stimulation) results from the interaction between co-stimulatory ligands expressed on APC and their corresponding receptors expressed on T lymphocytes. A dominant co-stimulation pathway involves the interaction between CD80 (B7-1 or B7.1) and CD86 (B7-2 or B7.2) ligands expressed on APC with CD28 and CTLA-4 (also known as CD152) expressed mainly on T lymphocytes CTLA-4 (cytotoxic T lymphocyte antigen 4) and CD28 serve as receptors for CD80 and CD86 ligands.
Positive signaling is mediated by the CD28 receiver. The binding of the CD80 and / or CD86 ligand (s) to CD28 reduces the threshold of T lymphocyte activation by promoting the formation of immunological synapses (Viola A. et al., Science 283: 680-682 (1999)) . Additionally, co-stimulation of CD28 activates or enhances the production of fundamental factors for the proliferation and survival of T lymphocytes such as interleukin-2 (IL-2), NF-κB and Bcl-XL (Norton SD et al., J Immunol 149: 1556-1561 (1992); Vella AT et al., J. Immunol. 158: 4714-4720 (1997)). In vivo, CD28 deficient mice are severely immunocompromised and show poor antigen-specific T cell responses (Green, JM et al., Immunity 1: 501-508 (1994)). Allergy or tolerance to T lymphocytes can occur when T lymphocytes are activated in the absence of the co-stimulant signal.
Negative signaling is mediated by the CTLA-4 receptor. Each of the CD80 and CD86 ligands binds CTLA-4 with high avidity and compensates for immunoproliferative responses derived from CD28 signaling. Possible CTLA-4 signaling mechanisms include the competitive binding of CD80 / CD86 co-stimulatory molecules (Masteller, EM et al., J. Immunol. 164: 5319 (2000)), inhibition of TCR signaling by phosphatase induction for immunosinapsis (Lee KM et al., Science 282: 2263 (1998)) and interruption of immunological synapses (Pentcheva-Hoang T. et al., Immunity 21: 401 (2004); Chikuma S. et al., J. Exp. Med 197: 129 (2003); Schneider H. et al., Science 313: 1972 (2006)). In vivo, CTLA-4-deficient mice show deep autoimmune phenotypes characterized by massive tissue infiltration and organ destruction (Waterhouse P. et al., Science 270: 985 (1995)).
Therapeutic agents designed to antagonize the CD80 / CD86 co-stimulation pathway, such as soluble human CTLA-4-Ig, are promising for the treatment of autoimmune diseases and disorders. The present invention provides advantageous molecules that have improved capabilities to modulate or suppress signaling by the CD80 / CD86 co-stimulation pathway and methods of using such molecules for the selected and differential manipulation of T lymphocyte responses. Such molecules are of beneficial use in a variety of applications that are discussed in detail later.
Summary of the Invention
The invention provides an isolated or recombinant polypeptide comprising a polypeptide sequence that differs from SEQ ID NO: 36 in no more than 6 amino acid residues and that includes residues at positions 24, 30, 32, 41, 50, 54, 55, 56, 64, 65, 70, 85, 104 and 106 that are identical to amino acid residues at the corresponding positions in SEQ ID NO: 36, wherein the polypeptide binds to human CD80 or human CD86 or an extracellular domain of any of them and has an ability to inhibit an immune response that is greater than the capacity of a LEA29Y polypeptide comprising the polypeptide sequence shown in SEQ ID NO: 168 to inhibit an immune response.
The invention also provides an isolated or recombinant polypeptide dimer comprising two polypeptides of the invention, wherein the dimer has a greater ability to suppress an immune response than a dimer comprising two LEA29Y polypeptides, wherein each LEA29Y polypeptide comprises the polypeptide sequence shown in SEQ ID NO: 168.
The invention also provides a polypeptide of the invention, which is an isolated or recombinant fusion protein comprising (a) a polypeptide comprising a polypeptide sequence that differs from SEQ ID NO: 36 in no more than 6 amino acid residues and which includes residues at positions 24, 30, 32, 41, 50, 54, 55, 56, 64, 65, 70, 85, 104 and 106 that are identical to amino acid residues at positions
corresponding in SEQ ID NO: 36 and (b) a second polypeptide, wherein the second polypeptide is an Ig Fc polypeptide, in which the fusion protein has a greater ability to suppress an immune response than a fusion protein. LEA29Y-Ig, wherein the LEA29Y-Ig fusion protein comprises the polypeptide sequence of SEQ ID NO: 166.
The invention also provides a polypeptide dimer of the invention, which is an isolated or recombinant fusion protein dimer comprising two monomeric fusion proteins linked by at least one disulfide bond formed between two cysteine residues present in each mutant fusion protein. monomeric, wherein each monomeric fusion protein comprises (a) a polypeptide comprising a polypeptide sequence that differs from SEQ ID NO: 36 in no more than 6 amino acid residues and that includes residues in positions 24, 30, 32, 41, 50, 54, 55, 56, 64, 65, 70, 85, 104 and 106 that are identical to amino acid residues in the corresponding positions in SEQ ID NO: 36 and (b) an Ig Fc polypeptide, and in which the fusion protein dimer has a greater ability to suppress an immune response than a LEA29Y-Ig fusion protein dimer, in which the fusion protein dimer LEA29Y-Ig comprises two monomeric LEA29Y-Ig fusion proteins each comprising the polypeptide sequence of SEQ ID NO: 166.
The invention also provides an isolated or recombinant nucleic acid comprising a polynucleotide sequence encoding a polypeptide of the invention, a polypeptide dimer of the invention, a fusion protein of the invention, or a fusion protein dimer of the invention. , or a complementary polynucleotide sequence thereof.
The invention also provides a vector comprising a nucleic acid of the invention.
The invention also provides an isolated or recombinant host cell comprising:
<dl><dt>(to)</dt><dd> a polypeptide of the invention; </dd></dl>
<dl><dt>(b)</dt><dd> a polypeptide dimer of the invention; </dd></dl>
<dl><dt>(c)</dt><dd> a fusion protein of the invention; </dd></dl>
<dl><dt>(d) </dt><dd>a fusion protein dimer of the invention; </dd></dl>
<dl><dt>(and)</dt><dd> a nucleic acid of the invention; me</dd></dl>
<dl><dt>(F)</dt><dd> A vector of the invention. </dd></dl>
The invention also provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient or pharmaceutically acceptable carrier and one or more of the following:
<dl><dt>(to)</dt><dd> a polypeptide of the invention; </dd></dl>
<dl><dt>(b)</dt><dd> a polypeptide dimer of the invention; </dd></dl>
<dl><dt>(c)</dt><dd> a fusion protein of the invention; </dd></dl>
<dl><dt>(d) </dt><dd>a fusion protein dimer of the invention; </dd></dl>
<dl><dt>(and)</dt><dd> a nucleic acid of the invention; </dd></dl>
<dl><dt>(F)</dt><dd> a vector of the invention; me</dd></dl>
<dl><dt>(g)</dt><dd> a host cell of the invention. </dd></dl>
The invention also provides a polypeptide of the invention, a polypeptide dimer of the invention, a fusion protein of the invention, a fusion protein dimer of the invention, a nucleic acid of the invention, a vector of the invention or a cell of the invention for use in:
<dl><dt>(i) </dt><dd>a prophylactic or therapeutic treatment to inhibit or suppress an immune response in a mammal; </dd></dl>
<dl><dt>(ii)</dt><dd> the treatment of a disease or disorder of the immune system; or</dd></dl>
(iii) the treatment of tissue or organ transplant rejection in a mammal.
The invention also provides the use of a polypeptide of the invention, a polypeptide dimer of the invention, a fusion protein of the invention, a fusion protein dimer of the invention, a nucleic acid of the invention, a vector of the invention. invention or a cell of the invention for the manufacture of a medicament for:
<dl><dt>(i) </dt><dd>a prophylactic or therapeutic treatment to inhibit or suppress an immune response in a mammal; </dd></dl>
<dl><dt>(ii)</dt><dd> the treatment of a disease or disorder of the immune system; or</dd></dl>
(iii) the treatment of tissue or organ transplant rejection in a mammal.
The invention also provides a method of producing a polypeptide comprising culturing a host cell of the invention in a culture medium and recovering the polypeptide expressed by the cell.
Brief description of the figures
Figure 1 is a schematic diagram of the mutant CTLA-4-Ig plasmid expression vector of pcDNA comprising a nucleotide sequence encoding a mutant CTLA-4-Ig fusion protein. In Figure 1, each mutant CTLA-4-Ig fusion protein comprises a mutant CTLA-4 ECD polypeptide fused at its C-terminus with the N-terminus of a human IgG2 Fc polypeptide (hIgG2). Figures 2A-2D are schematic diagrams of hCD80-Ig, hCD86-Ig, LEA29Y-Ig and hCTLA-4-IgG2 fusion proteins by way of example, respectively. The signal peptide, extracellular domain (ECD), linker (if any) and Ig Fc domain of each fusion protein are shown schematically. Also shown
5 amino acid residues present at the junctions between the signal peptide, ECD, linker (if any) and Ig Fc. The signal peptide of each fusion protein is normally cleaved during processing and, therefore, the secreted (mature) fusion protein normally does not contain the signal peptide sequence. Figure 2D presents a schematic diagram of a human CTLA-4-IgG2 fusion protein ("hCTLA-4-IgG2") comprising an extracellular domain of human CTLA-4 ("hCTLA-4 ECD") covalently fused in its C-terminus with the N-terminus of a human IgG2 polypeptide. The predicted polypeptide sequence of this hCTLA-4-IgG2 fusion protein is shown in SEQ ID NO: 161 and comprises the following segments: hCTLA-4 signal peptide (amino acid residues 1-37), hCTLA-ECD polypeptide 4 (amino acid residues 38-161) and human IgG2 Fc polypeptide (amino acid residues 162-389). No linker (for example, any amino acid residue) is included between the C-terminus of the hCTLA-4 ECD polypeptide and the
fifteen N-terminus of human IgG2 Fc. The human IgG2 Fc polypeptide comprises a hinge, CH2 domain and CH3 domain of human IgG2. Figure 2D shows the amino acid residues at the junctions between these various segments. Specifically, the last four amino acid residues of the signal peptide, the first five and the last five amino acid residues of the hCTLA-4 ECD polypeptide, and the first five and last five amino acid residues of the human IgG2 Fc polypeptide are shown. . The signal peptide is normally cleaved during processing and, therefore, the secreted fusion protein (mature fusion protein) of hCTLA-4-IgG2 does not normally contain the signal peptide sequence. The polypeptide sequence of the mature or secreted form of this hCTLA-4-IgG2 fusion protein is shown in SEQ ID NO: 162. The hCTLA-4 ECD polypeptide sequence comprises amino acid residues 1-124 of SEQ ID NO: 162 and the human IgG2 Fc polypeptide sequence comprises the residues of
25 amino acids 125-352 of SEQ ID NO: 162. In another aspect, this mature hCTLA-4 Ig fusion protein does not include the lysine residue (K) of the C-terminus and, therefore, comprises amino acid residues 1-351 of SEQ ID NO: 162. The mature hCTLA-4-IgG2 fusion protein, which has a total of 352 amino acids, comprises amino acid residues 38-389 of the full length hCTLA-4 WT protein polypeptide sequence shown in SEQ ID NO: 160 and It begins with the amino acid sequence: methionine-histidine-valine-alanine. If desired, the amino acids of the mature form can be listed starting with the Met of the Met-His-Val-Ala sequence, which designates Met as the first residue (for example, the ECD comprises amino acid residues numbered 1-124 ), as in SEQ ID NO: 162. A mature hCTLA-4IgG2 dimer is the form of the fusion protein normally used in the tests of the examples described below, unless
35 set otherwise. A DNA sequence encoding the hCTLA-4-IgG2 fusion protein, which comprises hCTLA-4 ECD fused with the hIgG2 Fc polypeptide, is shown in SEQ ID NO: 163. Figure 3 depicts SDS / PAGE analysis of the following proteins: molecular weight markers of different mass (kilodaltons (kDa) (lane 1); an exemplary mutant CTLA-4-Ig fusion protein based on clone D3 (i.e., D3-IgG2) (lane 2); an exemplary mutant CTLA-4-Ig fusion protein based on clone D4 (i.e., D4-IgG2) (lane 3); and the fusion protein Orencia® (abatacept) (lane 4) (Bristol-Myers Squibb Co., Princeton, NJ). Figure 4 presents an elution profile of an exemplary mutant CTLA-4-Ig fusion protein (i.e., D3-IgG2) from SEC analysis, demonstrating that CTLA-4-Ig fusion proteins Mutants are homogeneous in size when purified from transiently transfected COS cells.
Four. Five Figure 5 shows a typical Biacore ™ analysis of the binding of the following fusion proteins to hCD86-Ig: Orencia® fusion protein, LEA29Y-Ig and D3-IgG2. The dissociation phase of the analysis begins at the moment marked by the arrow. The Orencia® fusion protein, which is composed of the natural human CTLA-4 ECD polypeptide fused with a mutant IgG1 io Fc domain polypeptide , effectively serves as a control of natural human CTLA-4-Ig. A mutant CTLA-4-Ig fusion protein, such as D3-IgG2, that has a greater avidity for binding to CD86-Ig than the Orencia® fusion protein has a slower rate of dissociation of CD86-Ig than the Orencia protein ®. Figure 6 is a graphic representation of the results of PBMC proliferation inhibition assays (with antibody stimulation directed against CD3) involving mutant CTLA-4-Ig fusion proteins by way of example (D3-04-IgG2 , D3-11-IgG2, D3-12-IgG2, D3-14-IgG2). These essays show that
55 The mutant CTLA-4-Ig fusion proteins are significantly more potent than Orencia® and LEA29Y-Ig in inhibiting proliferation of T lymphocytes in vitro. Figure 7 is a graphical representation of CD4 + T cell proliferation inhibition assays (with anti-CD3 stimulation and hB7.2 dependent co-stimulation) involving an exemplary set of CTLA-4 fusion proteins -Ig mutants. The Orencia® and LEA29Y-Ig fusion proteins were included as controls for comparison. Figure 8 is a graphical representation of PBMC proliferation inhibition assays (with stimulation with PPD antigen) involving an exemplary set of mutant CTLA-4-Ig fusion proteins. Orencia® and LEA29Y-Ig were included as controls for comparison. Figure 9 is a graphic representation of proliferation reaction inhibition assays of
65 Unilateral mixed lymphocytes (MLR) involving an example mutant CTLA-4-Ig fusion protein -D3-IgG2. The Orencia® and LEA29Y-Ig fusion proteins were included as controls for comparison.
Figure 10 is a schematic diagram showing the structure of an exemplary mutant CTLA-4-Ig fusion protein. Two schematically identical monomeric mutant CTLA-4-Ig fusion proteins are shown, each comprising a mature mutant CTLA-4 ECD fused at its C-terminus with the N-terminus of a human IgG2 Fc polypeptide. Each human IgG2 polypeptide includes a hinge, CH2 domain and CH3 domain of IgG2. Also shown are exemplary amino acid residues present at the junctions between ECD polypeptides and Ig Fc. The amino acid residues at the junctions between these components can be differentiated depending on the polypeptide sequence of the mutant CTLA-4 ECD and / or Ig polypeptide sequence. The dimeric fusion protein results from the formation of at least one disulfide bond between cysteine residues at similar positions in the two monomers. Cysteine residues (C) that possibly participate in the formation of disulfide bonds between the two monomers are marked with asterisks. The signal peptide of each monomeric fusion protein is normally cleaved during processing and, therefore, the secreted (mature) fusion protein normally does not include the signal peptide sequence. Figure 11 is a graphical representation of CD4 + T cell proliferation assays (with anti-CD3 stimulation and hB7.2-dependent co-stimulation) that involve hCTLA-4-IgG2, Orencia® and LEA29Y-Ig fusion proteins. Figures 12A-12F show an alignment of the polypeptide sequence of the extracellular domain of natural human CTLA-4 (designated in Figure "hCTLA4ECD"), the polypeptide sequence of the LEA29Y polypeptide (designated in Figure "LEA29YECD") and the exemplary mutant CTLA-4 ECD polypeptide polypeptide sequences. The names of the clones of these mutant CTLA-4 ECD polypeptides are indicated on the left. Amino acid residues that are identical to those in the natural human CTLA-4 ECD are indicated by a period (.). Figure 13 presents a BLOSUM62 matrix. Figures 14A-14D show alignments and alignment scores by way of example determined by manual calculation for two amino acid sequences. Figures 15A-15B show pharmacokinetic (PC) profiles for the Orencia® fusion protein, human CTLA-4-IgG2 and representative mutant CTLA-4-IgG2 fusion proteins administered at 1 mg / kg as (A) a single intravenous bolus (IV) or (B) subcutaneous injection (SC) in rats.
Detailed description
Definitions
It should also be understood that the terminology used herein is only for the purpose of describing particular embodiments and is not intended to be limiting. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which the invention relates.
The terms "nucleic acid" and "polynucleotide" are used interchangeably to refer to a polymer of nucleic acid residues (eg, deoxyribonucleotides or ribonucleotides) in both mono and double stranded form. Unless specifically limited, the terms encompass nucleic acids that contain known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (eg, degenerate codon substitutions) and complementary nucleotide sequences, in addition to the explicitly indicated sequence. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed base residues and / or deoxyinosine (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605 2608 (1985); and Cassol et al. (1992); Rossolini et al., Mol. Cell. Probes 8:91 98 (1994)) . The term nucleic acid or polynucleotide is used interchangeably with cDNA or mRNA encoded by a gene.
The term "gene" broadly refers to any segment of nucleic acid (eg, DNA) associated with a biological function. A gene may include a coding sequence and / or regulatory sequence required for its expression. A gene may also include non-expressed DNA nucleic acid segment (s) that, for example, form recognition sequences for another protein (s) (eg, promoter, enhancer or other regulatory region). A gene can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and can include one or more sequences designed to have desired parameters.
The terms "polypeptide", "peptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical mimetic of a naturally occurring corresponding amino acid, in addition to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. . As used herein, the terms encompass amino acid chains of any length, including full-length proteins (i.e., antigens), in which amino acid residues are linked by covalent peptide bonds.
The numbering of a given amino acid polymer or nucleic acid polymer "corresponds to" or is "with respect to" the numbering of an amino acid polymer or nucleic acid polymer selected when the position of any given polymer component (for example , amino acid, nucleotide, also generically referred to as "residue") is designated by reference thereto or an equivalent position in the selected amino acid polymer or nucleic acid, instead of the current numerical position of the component in the given polymer. Thus, for example, the numbering of a given amino acid position in a given polypeptide sequence corresponds to the same amino acid position or equivalent in a selected polypeptide sequence used as the reference sequence.
An "equivalent position" (for example, an "equivalent amino acid position" or "equivalent nucleic acid position" or "equivalent residue position") is defined herein as a position (such as an amino acid position or nucleic acid position or residue position) of a sequence of test polypeptides (or test polynucleotide) that aligns with a corresponding position of a sequence of reference polypeptides (or reference polynucleotides) when aligned (preferably it is optimally aligned) using an alignment algorithm as described herein. The equivalent amino acid position of the test polypeptide sequence does not need to have the same numerical position number as the corresponding position of the test polypeptide. Also, the equivalent nucleic acid position of the test polynucleotide sequence need not have the same numerical position as the corresponding position of the test polynucleotide.
A "mutant" polypeptide comprises a polypeptide sequence that differs into one or more amino acid residues of the polypeptide sequence of a parental or reference polypeptide (such as, for example, a natural polypeptide sequence (WT)). In one aspect, a mutant polypeptide comprises a polypeptide sequence that differs from the polypeptide sequence of a parental or reference polypeptide by about 1%, 2%, 3%, 4%, 5%, 6%, 7 %, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 30%, 40%, 50% or more of the total number of residues of the parental polypeptide sequence or reference. In another aspect, a mutant polypeptide comprises a polypeptide sequence having at least about 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the polypeptide sequence of a parental or reference polypeptide. In another aspect, a mutant polypeptide comprises a polypeptide sequence that differs from the polypeptide sequence of a parental or reference polypeptide in 1 to 100 or more amino acid residues (e.g., 1, 2, 3, 4, 5 , 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid residues). A mutant polypeptide may comprise a polypeptide sequence that differs from the polypeptide sequence of a parental or reference polypeptide by, for example, the deletion, addition or substitution of one or more amino acid residues (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid residues) of the parental or reference polypeptide, or any combination of such deletion (deletions), addition (additions) and / or substitution (substitutions). The reference or parental polypeptide may itself be a mutant polypeptide.
"That occurs naturally" as applied to an object means that the object is found in nature as opposed to being artificially produced by man. "That occurs not naturally" as applied to an object means that the object does not occur naturally (that is, that the object cannot be found in nature). For example, a naturally occurring polypeptide refers to a polypeptide that has been prepared by man such as, for example, being synthesized in vitro or artificially prepared.
A "sub sequence" or "fragment" of a sequence of interest is any portion of the entire sequence up to, but not including, the entire sequence of interest.
A nucleic acid, protein or other component is "isolated" when it is partially or completely separated from components with which it is normally associated (other proteins, nucleic acids, cells, synthetic reagents, etc.). On a molar base, an isolated species is more abundant than others in a composition. For example, an isolated species may comprise at least about 50%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , 99% or 100% (on a molar basis) of all macromolecular species present. Preferably, the species of interest is purified to essential homogeneity (i.e., the contaminating species cannot be detected in the composition by conventional detection procedures). The purity and homogeneity can be determined using several techniques well known in the art such as agarose or polyacrylamide gel electrophoresis of a protein or nucleic acid sample, followed by visualization after staining. If desired, a high resolution technique such as high performance liquid chromatography (HPLC) or a similar medium for purification of the material can be used.
The term "purified" as applied to nucleic acids or polypeptides generally denotes a nucleic acid or polypeptide that is essentially free of other components as determined by analytical techniques well known in the art (for example, a purified polypeptide or polynucleotide forms a discrete band in an electrophoretic gel, chromatographic eluate and / or a medium subjected to density gradient centrifugation). For example, a nucleic acid or polypeptide that essentially gives rise to a band in an electrophoretic gel is "purified." A purified nucleic acid or polypeptide has at least about 50% purity, usually at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98%,
99%, 99.5%, 99.6%, 99.7%, 99.8% or more purity (for example, weight percentage on a molar basis).
A nucleic acid or polypeptide is "recombinant" when it is artificial or manipulated, or is derived from an artificial or manipulated protein or nucleic acid.
The term "recombinant" when used with reference to a cell normally indicates that the cell replicates a heterologous nucleic acid or expresses a polypeptide encoded by a heterologous nucleic acid. Recombinant cells can comprise genes that are not found within the native (non-recombinant) form of the cell. Recombinant cells also include those that comprise genes that are in the native form of the cell, but are modified and re-introduced into the cell by artificial means. The term also encompasses cells comprising an endogenous nucleic acid to the cell that has been modified without eliminating the nucleic acid from the cell; Such modifications include those obtained by gene substitution, site-specific mutation and related techniques known to those skilled in the art. Recombinant DNA technology includes techniques for the production of recombinant DNA in vitro and transfer of recombinant DNA to cells in which it can be expressed or propagated, thereby producing a recombinant polypeptide.
A "recombinant expression cassette" or simply an "expression cassette" is a nucleic acid construct, recombinantly or synthetically generated, with nucleic acid elements that can effect the expression of a structural gene in hosts compatible with such sequences. Expression cassettes include at least promoters and optionally transcription termination signals. Typically, the recombinant expression cassette includes a nucleic acid to be transcribed (for example, a nucleic acid encoding a desired polypeptide) and a promoter. Additional factors necessary or useful in effecting expression can also be used as described herein. For example, an expression cassette can also include nucleotide sequences that encode a signal sequence that directs the secretion of an expressed protein from the host cell. Transcription termination signals, enhancers and other nucleic acid sequences that influence gene expression can also be included in an expression cassette.
An "exogenous" nucleic acid, "exogenous DNA segment", "heterologous sequence" or "heterologous nucleic acid" as used herein is one that originates from a source foreign to the particular host cell or, if It is from the same source, it is modified in its original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell, but has been modified. Modification of a heterologous sequence in the applications described herein normally occurs through the use of directed molecular evolution procedures. Thus, the terms refer to a segment of DNA that is foreign or heterologous to the cell, or homologous to the cell, but in a position within the nucleic acid of the host cell in which the element is not generally found. Exogenous nucleic acids or exogenous DNA are expressed to give exogenous polypeptides.
A "vector" can be any agent that can release or maintain a nucleic acid in a host cell and includes, for example, but is not limited to plasmids (eg, DNA plasmids), naked nucleic acids, viral vectors, viruses. , nucleic acids complexed with one or more polypeptides or other molecules, in addition to immobilized nucleic acids on solid phase particles. Vectors are described in detail below. A vector may be useful as an agent for administering or maintaining an exogenous gene and / or protein in a host cell. A vector can be able to transduce, transfect or transform a cell, thus causing the cell to replicate
or express nucleic acids and / or proteins other than those native to the cell or in a manner not native to the cell. A vector may include materials to help achieve the entry of a nucleic acid into the cell such as a viral particle, liposome, protein coating or the like. Any method of transferring a nucleic acid to the cell can be used; unless otherwise indicated, the term vector does not imply any particular method of administering a nucleic acid to a cell or implies that any particular cell type is the object of transduction. The present invention is not limited to any specific vector for the administration or maintenance of any nucleic acid of the invention, which includes, for example, a nucleic acid encoding a mutant CTLA-4 polypeptide of the invention or a fragment thereof (by eg, mutant CTLA-4 ECD) that binds to CD80 and / or CD86 or a fragment thereof (eg, CD80 ECD or CD86 ECD).
The term "expression vector" normally refers to a nucleic acid construct or sequence, recombinantly or synthetically generated, with a series of specific nucleic acid elements that allows transcription of a particular nucleic acid into a host cell. The expression vector normally includes a nucleic acid to be transcribed operably linked to a promoter. The term "expression" includes any stage that participates in the production of the polypeptide that includes, but is not limited to, transcription, post-transcriptional modification, translation, post-translational modification and / or secretion.
A "signal peptide" is a sequence of peptides (or amino acids) that normally precedes a polypeptide of interest and is translated in conjunction with the polypeptide and directs or facilitates the polypeptide to the secretory system. A signal peptide is normally covalently bound or fused with the amino terminus of the polypeptide of interest and facilitates the secretion of the polypeptide of interest from a host cell. The signal peptide is normally cleaved from the polypeptide of interest after translation.
The term "encoding" refers to the ability of a nucleotide sequence to encode one or more amino acids. The term does not require an initiation or termination codon. An amino acid sequence can be encoded in any one of six different reading frames provided by a polynucleotide sequence and its complement.
The term "control sequence" is defined herein to include all components that are necessary or advantageous for the expression of a polypeptide of the present invention. Each control sequence can be native or foreign to the nucleotide sequence encoding the polypeptide. Such control sequences include, but are not limited to, a conductor, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence and transcription terminator. At a minimum, a control sequence includes a promoter, and transcription termination and translation signals. Control sequences can be provided with linkers in order to introduce specific restriction sites that facilitate ligation of control sequences with the coding region of the nucleotide sequence encoding a polypeptide.
The term "coding sequence" refers to a nucleotide sequence that directly specifies the amino acid sequence of your protein product. The limits of the coding sequence are generally determined by an open reading frame (ORF), which can begin with the ATG initiation codon.
A nucleic acid is "operably linked" to another nucleic acid sequence when it is arranged in a functional relationship with the other nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it directs the transcription of the coding sequence. Operationally linked means that the DNA sequences that are linked are normally contiguous and, if necessary, join two protein-coding regions, contiguous and in reading frame. However, since the enhancers generally work when they are separated from the promoter by several kilobases and the intronic sequences may be of varying lengths, some polynucleotide elements may be operably linked, but are not contiguous.
A "host cell" is any cell that is susceptible to transformation with a nucleic acid.
An "antigen" refers to a substance that reacts with the product (s) of an immune response stimulated by a specific immunogen. See, for example, JULIUS CRUSE AND COL., ATLAS OF IMMUNOLOGY 60 (1999); RICHARD COICO Y COL., IMMUNOLOGY: A SHORT COURSE 27-30 (5th ed. 2003). An immune response may comprise a humoral response and / or a cell-mediated immune response (eg, cytotoxic T lymphocytes (CTL)). The products of an immune response may include antibodies and / or CTL. The antigens are normally macromolecules (for example, polypeptides, nucleic acids, complex carbohydrates, phospholipids, polysaccharides) that are foreign to the host; that portion of the antigen known as the antigenic determinant reacts with (for example, binds) the product (s) of the immune response, such as an antibody or a specific T-cell receptor on a T-cell. An antigen may, but not necessarily, induce an immune response, in addition to reacting with the product (s) of the immune response. "Antigenicity" refers to the state or property of being antigenic — that is, it has the properties of an antigen. The specificity of an antigen can be shown in the relationship of an antigen with its antibody or vice versa; an antigen normally reacts in a highly specific manner with its corresponding antibody and not with the same degree of specificity with other antibodies caused by the immunogen. An "antigenic amount" is an amount of an antigen that reacts detectably with the product (s) of an immune response stimulated by a specific immunogen.
An "immunogen" is a substance that can induce an immune response instead of immune tolerance. See, for example, JULIUS CRUSE AND COL., Above at 60-61; RICHARD COICO, up 27-30. Immunogens also react with (for example, bind with) the product (s) of the induced immune response that has or has been specifically induced against them. Therefore, all immunogens are antigens. "Immunogenicity" refers to the state or property of being immunogenic - that is, having the properties of an immunogen. An "immunogenic amount" is an amount of an immunogen that is effective in inducing a detectable immune response. An immunogen can cause a strong immune response in a subject, such as at least partial or complete protective immunity, to at least one pathogen.
An "immunomodulator" or "immunomodulatory" molecule, such as an immunomodulatory polypeptide or nucleic acid, modulates an immune response. By "modulating" or "modulating" an immune response it is envisioned that the immune response is altered. For example, "modulation" of or "modulating" an immune response in a subject generally means that an immune response is stimulated, induced, inhibited, decreased, suppressed, increased, potentiated or otherwise altered in the subject. Such modulation of an immune response can be evaluated by means known to those skilled in the art, including those described below. An "immunosuppressant" or "immunosuppressant" is a molecule, such as a polypeptide or nucleic acid, that suppresses an immune response.
An Fc region or domain of an immunoglobulin or antibody molecule (also called an Ig Fc polypeptide or Fc polypeptide) corresponds largely to the constant region of the immunoglobulin heavy chain, and is responsible for various functions that include the effector function (s) of the
antibody. For example, the Ig Fc region of the IgG molecule comprises the immunoglobulin CH2 and CH3 domains and the N-end hinge region leading to CH2. The hinge region is a part of the heavy chain between Fc and CH1 that contains the disulfide bonds between heavy chains and gives flexibility to the antibody molecule. The constant domains of the Fc region interact with cells of the immune system. Fc receptors are proteins that bind to the Fc region of antibodies. A significant family of Fc receptors for the IgG antibody class includes Fc gamma receptors (Fc! R). The binding of antibodies to Fc receptors on cells mediates several antibody functions. Different subclasses of IgG have different affinities for Fc gamma receptors. In general, IgG1 and IgG3 bind to receptors with a higher affinity than IgG2 and IgG4. Fc receptors are expressed on a variety of cells that include, for example, B lymphocytes, monocytes, dendritic cells, neutrophils and certain lymphocytes. The binding of an Ig Fc to its receptor takes these effector cells to sites of bound antigen, ultimately producing signaling and immune responses, which include activation of B lymphocytes, inflammatory responses, cytotoxic responses and phagocytic responses.
An Ig Fc fusion is a molecule that comprises one or more polypeptides (or one or more small molecules) operably linked to an Fc region of an immunoglobulin or antibody. See, for example, Chamow et al., 1996, Trends Biotechnol. 14: 52-60. Accordingly, an Ig Fc fusion protein is a molecule that comprises one or more polypeptides operably linked to an Ig Fc region. An Ig Fc fusion protein may comprise, for example, the Fc region of an antibody (which facilitates effector and pharmacokinetic functions) and the binding region or binding domain of a receptor protein or ligand protein or other protein or fragment of it. The binding region or medium binding domain in recognition of the target receptor or ligand (comparable to that of the antibody variable region of an antibody to an antigen). An Fc region of Ig can be linked indirectly or directly to one or more polypeptides or small molecules (fusion components). Various linkers known in the art and as described in greater detail below can be used to ligate an Ig Fc with a fusion component to generate an Ig Fc fusion. An Ig Fc fusion protein typically comprises an Ig Fc region covalently linked directly or indirectly to at least one polypeptide, a polypeptide that normally binds to a ligand or target receptor.
A "specific binding affinity" between two molecules, for example, a ligand and a receptor, means a preferential binding of one molecule with another. Molecule binding is normally considered specific if the equilibrium binding association constant (for example, KA) is about 1 x 102 M-1 to about 1 x 1013 M-1 or greater, which includes about 104 to 1013 M -1, approximately 106 to 1012 M-1, approximately 101 M-1 to 1011 M-1 or approximately 108 to 1010 M-1. KA values for the binding interaction between an antigen and
M-1 M-1
an antibody usually ranges from about 105 to about 1012, usually
M-1 M-1 M-1
about 107 to about 1011, and often about 108 to about 1010 M-1. KA (M-1) is determined by calculating ka / kd in which ka is the constant of the velocity of
M-1 -1 -1
association and kd is the constant of the dissociation rate. The units of ka and kd are s and s, respectively. The equilibrium dissociation constant, KD, is the inverse of KA. KD = kd / ka. For reaction A + B <=> AB (representing a single ligand that binds to a single protein of interest (eg, receptor)), KD is equal to ([A] · [B]) / [AB] . Non-limiting examples of well-known techniques for measuring affinities and / or avidity of molecule binding include, for example, Biacore ™ technology (GE Healthcare) as discussed elsewhere herein, isothermal titration microcalorimetry (MicroCal LLC, Northampton , MA, USA), ELISA and fluorescence activated flow cytometry procedures (FACS). For example, FACS or other cytometry procedures can be used to select populations of molecules (such as, for example, ligands presented on a cell surface) that specifically bind to the member of the associated binding pair (such as a receptor, for example, a soluble receptor). The ligand-receptor complexes can be detected and classified, for example, by fluorescence (for example, by reacting the complex with a fluorescent antibody that recognizes the complex). The molecules of interest that bind to a member of the associated binding pair (eg, receptor) gather and re-classify in the presence of lower receptor concentrations. Performing multiple rounds of classification in the presence of decreasing concentrations of receptor (an example concentration range being in the order of 10-6 M to 10-13 M, that is, 1 micromolar (μM) to 1 nanomolar (nM) , or less (for example, 10-11 M or 10-12 M), depending on the nature of the ligand receptor interaction) populations of the molecule of interest that have specific binding affinity for the receptor can be isolated.
The phrase "specifically binds (or selectively)" to an antibody or "specifically (or selectively) immunoreactive with", when referring to a protein, refers to a binding reaction that is determinant of the presence of the protein in a heterogeneous population of proteins and other biological products. Therefore, under designated immunoassay conditions, the specified antibodies bind to a particular protein at least twice the reference and do not bind substantially in a significant amount to other proteins present in the sample. Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. A variety of immunoassay formats can be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, for example, Harlow & Lane, Antibodies, A Laboratory Manual (1988)) for a description of immunoassay formats and conditions that can be used for
determine specific immunoreactivity). Normally, a specific or selective reaction will be at least twice the reference signal or noise and more normally more than 10 to 100 times the reference.
The term "cytokine" includes, for example, but is not limited to, interleukins, interferons (IFN), chemokines, hematopoietic growth factors, tumor necrosis factors (TNF) and transforming growth factors. In general, these are small molecular weight proteins that regulate the maturation, activation, proliferation and differentiation of immune system cells.
The term "screening" generally describes a method that identifies optimal molecules of the present invention such as, for example, that includes polypeptides of the invention, and related fusion proteins comprising the same, and nucleic acids encoding all those molecules Various properties of the respective molecules can be used in screening and screening, for example, an ability of a respective molecule to induce or alter a desired immune response in a test system or in an in vitro application, ex vivo or in vivo. "Selection" is a form of screening in which physical identification and separation are achieved simultaneously by expression of a selection marker that, in some genetic circumstances, allows cells to express the marker to survive, while other cells die (or vice versa). Screening markers include, for example, luciferase, beta-galactosidase and green fluorescent protein, reaction substrates and the like. Selection markers include drug and toxin resistance genes, and the like. Another mode of selection involves physical classification based on a detectable event such as binding of a ligand to a receptor, reaction of a substrate with an enzyme, or any other physical procedure that can generate a detectable signal both directly (for example, using a substrate or chromogenic ligand) as indirectly (for example, reacting with a chromogenic secondary antibody). Selection by physical classification can be performed by a variety of procedures that include, but are not limited to, for example, by FACS in whole cell or microdroplet formats.
Due to limitations in the study of primary immune responses in vitro, in vivo studies are particularly useful screening procedures. In some of such studies, a polynucleotide or polypeptide of the invention is first introduced into a test subject (for example, a mammal, such as an animal), and an induced immune response is subsequently studied by analyzing the type of immune response in the immunized animal (eg, production of antibody in the serum of immunized animals, proliferation of T lymphocytes), or by studying the quality or intensity of the immune response induced in the immunized animal (for example, induced antibody titer level).
The term "subject" as used herein includes, but is not limited to, an organism or animal, which includes mammals and non-mammals. A mammal includes, for example, but is not limited to, a human being, non-human primate (for example, baboon, orangutan, monkey, gorilla), mouse, dog, pig, cow, goat, cat, rabbit, rat, guinea pig , hamster, horse, sheep or other non-human mammal. A non-mammalian includes, for example, but is not limited to a non-mammalian invertebrate and non-mammalian vertebrate, such as a bird (eg, a chicken or duck) or a fish.
The term "pharmaceutical composition" refers to a composition suitable for pharmaceutical use in a subject, which includes an animal or human being. A pharmaceutical composition typically comprises an effective amount of an active agent and a vehicle, excipient or diluent. The carrier, excipient or diluent is normally a pharmaceutically acceptable carrier, excipient or diluent, respectively.
The term "effective amount" refers to a dosage (or dose) or amount of a substance sufficient to produce a desired result. The desired result may comprise an objective or subjective improvement in the recipient of the dosage or quantity. For example, the desired result may comprise a measurable, detectable or probable induction, promotion, enhancement or modulation of an immune response in a subject to which a dosage or amount of a particular antigen or immunogen (or composition thereof) has been administered. A dosage (or dose) or amount of an immunogen sufficient to produce such a result can be described as a dosage (or dose) or "immunogenic" amount.
A "prophylactic treatment" is a treatment administered to a subject that shows no signs or symptoms of, or only shows early signs or symptoms of, a disease, pathology or disorder, so that the treatment is administered in order to prevent or decrease the risk of developing the disease, pathology or disorder. A prophylactic treatment works as a preventive treatment against a disease, pathology or disorder, or as a treatment that further inhibits or reduces the development or enhancement of a disease, pathology or disorder. A "prophylactic activity" is an activity of an agent that, when administered to a subject that shows no signs or symptoms of, or only shows early signs or symptoms of, a pathology, disease or disorder prevents or decreases the subject's risk of Develop pathology, disease or disorder. A "prophylactically useful" agent (eg, nucleic acid or polypeptide) refers to an agent that is useful in preventing the development of a disease, pathology or disorder, or useful in inhibiting or reducing the further development or potentiation of a disease, pathology or disorder
A "therapeutic treatment" is a treatment administered to a subject that shows symptoms or signs of pathology, disease or disorder, in which the treatment is administered to the subject in order to decrease or eliminate those signs or symptoms. A "therapeutic activity" is an activity of an agent that eliminates or decreases signs or
symptoms of pathology, disease or disorder when administered to a subject suffering from such signs or symptoms. A "therapeutically useful" agent means that the agent is useful in reducing, treating or eliminating signs or symptoms of a disease, pathology or disorder.
Generally, the nomenclature used herein and many of the laboratory procedures in cell culture, molecular genetics, molecular biology, nucleic acid chemistry and protein chemistry described below are well known and commonly employed for those skilled in the art. Conventional techniques, such as described in Sambrook et al., Molecular Cloning -A Laboratory Manual (2nd ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989 (hereinafter “Sambrook”) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, FM Ausubel et al., Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (1994, supplemented by 1999) (hereinafter "Ausubel"), are used for recombinant nucleic acid procedures, nucleic acid synthesis, cell culture procedures and transgene incorporation, for example, electroporation, injection, gene gun, impression through the skin and lipofection. Generally, the steps of synthesis and purification of oligonucleotides are performed according to descriptive memories. The techniques and procedures are generally performed according to conventional procedures in the field and various general references that are provided throughout this document. It is believed that the procedures in this document are well known to those skilled in the art and are provided for the convenience of the reader.
Various additional terms are defined or otherwise characterized in this document.
Molecules and procedures
Molecules and procedures for treating diseases, disorders and conditions of the immune system are disclosed herein, including, for example, those in which immune system modulation is desired (eg, T-cell dependent immune responses). The molecules disclosed herein (e.g., polypeptides, conjugates, soluble fusion proteins, nucleic acids encoding such polypeptides or fusion proteins) are useful for the treatment of diseases, disorders and conditions of the immune system in which it is desired. immunosuppression that include, for example, but not limited to, the treatment of autoimmune diseases, disorders and conditions, immunoproliferative diseases, Graft-related disorders and treatment procedures involving transplantation of tissue, cell, organ or graft from a donor to a recipient in which the suppression of an immune response in the recipient against the donor's tissue, cell, organ or graft is desired .
Also disclosed herein are novel mutant CTLA-4 molecules that have improved properties compared to a CTLA-4 molecule, such as the natural human CTLA-4 polypeptide ("hCTLA4") or a fragment thereof that binds to CD80 and / or CD86, such as the extracellular domain of human CTLA-4 ("hCTLA-4 ECD"). As discussed in greater detail below, a variety of mutagenesis and screening strategies were used to prepare and identify novel mutant CTLA-4 molecules that bind to CD80 and / or CD86. In particular, such strategies were used to prepare and identify mutant CTLA-4 molecules that have binding avidities enhanced by CD80 (B7-1) and / or CD86 (B7-2) with respect to human CTLA-4 ("hCTLA- 4 "), and / or which have improved binding affinities for CD80 and / or CD86 with respect to hCTLA-4 ECD. Disclosure mutant CTLA-4 molecules that bind endogenous CD80 and / or CD86 ligands expressed on antigen presenting cells effectively inhibit or block the interaction of these ligands with the endogenous CD28 receptor, which is expressed on the lymphocyte surface T. As a result, the critical co-stimulatory signal for T lymphocyte activation provided by the interaction of the CD28 T lymphocyte surface receptor with the B7 molecules (i.e., CD80 and CD86) is inhibited or blocked. Such T lymphocytes are not optimally activated and have reduced proliferation capabilities.
In cases where signaling between a CD80 or CD86 ligand and a CD28 receptor is blocked, T lymphocytes are not optimally stimulated to be active and therefore are not optimally induced to proliferate. Similarly, in cases where signaling between a CD80 or CD86 ligand and a CD28 receptor is inhibited, T lymphocyte activation and proliferation is inhibited. Mutant CTLA-4 molecules that function as antagonists for CTLA-4 signaling are disclosed. Mutant CTLA-4 molecules that function as antagonists for CD28 signaling are also disclosed, thereby suppressing or blocking T-lymphocyte-dependent immune responses; Such molecules function as immunosuppressive agents. Mutant CTLA-4 molecules are also disclosed that bind both CD80 and CD86, but have a greater avidity for binding by CD86 than by CD80 and, therefore, inhibit CD86-dependent co-stimulation to a greater degree than CD80 dependent costimulation. All such mutant CTLA-4 molecules of the disclosure are expected to be useful for the treatment of diseases, disorders or conditions in which immunosuppression is desired or would be beneficial.
It has been shown that a human CTLA-4-Ig fusion protein and a specific mutant CTLA-4-Ig fusion protein - both developed by Bristol-Myers Squibb Co. (Princeton, NJ) - is effective in the treatment of certain diseases or immune-related conditions. Orencia® fusion protein (also known as abatacept (“ABA”)) (Bristol-Myers Squibb Co. (Princeton, NJ)) is a soluble recombinant dimeric fusion protein consisting of two linked identical monomeric immunoglobulin (Ig) fusion proteins
covalently together by a disulfide bond formed between a cysteine residue present in each monomeric fusion protein. ORENCIA is a registered trademark of Bristol-Myers Squibb Company. Each monomeric Ig fusion protein of the Orencia® dimer consists of the extracellular domain of human CTLA-4 (SEQ ID NO: 159) fused at its C-terminus with the N-terminus of a specific mutant IgG1 Fc polypeptide (SEQ ID NO. : 186). The complete polypeptide sequence of each monomeric fusion protein as shown in SEQ ID NO: 164. The Orencia® dimer is produced in a mammalian expression system and has an apparent molecular weight of 92 kDa. It is believed that the two monomeric Ig fusion proteins of the Orencia® dimer are covalently linked together by a single disulfide bond formed between the cysteine residue at position 120 of each mutant hCTLA-4-IgG1 monomer and that no bonds are formed disulfide between the two mutant IgG1 Fc polypeptides.
The Orencia® dimer is a selective co-stimulation modulator that inhibits the activation of T lymphocytes by binding to CD80 and CD86 and, therefore, blocking the interaction with CD28. The Orencia® dimer has been currently authorized for the treatment of human adults suffering from moderate to severe rheumatoid arthritis (RA). Additional information on the Orencia® dimer and its clinical indications and efficacy are provided on the universal website at orencia.com and bms.com.
As noted above, each fusion protein monomer of the Orencia® dimer contains an extracellular domain of human CTLA-4. Human CTLA-4 is a membrane protein that is transiently expressed on T lymphocytes. The full length protein sequence of WT full length hCTLA-4 is shown in SEQ ID NO: 160, and a nucleic acid sequence encoding Full length hCTLA-4 WT is shown in SEQ ID NO: 194. Human CTLA-4 includes a signal peptide (SP), extracellular domain (ECD), transmembrane domain (TD) and cytoplasmic domain (CD) covalently linked together in that order (for example, end C of SP is covalently linked to end N of the ECD, end C of the ECD is covalently linked to end N of the TD and end C of the TD is covalently linked to end N of the CD). The hCTLA-4 WT ECD polypeptide typically comprises residues 38-161 of the full-length hCTLA-4 protein sequence (SEQ ID NO: 160) and typically has 124 amino acid residues in length. This hCTLA-4 ECD polypeptide sequence is shown in SEQ ID NO: 159. The full-length hCTLA-4 protein signal peptide (SP), which typically comprises amino acid residues 1-35 or 1-37 of SEQ ID NO: 160, is cleaved during processing. See, for example, Harper et al., J. Immunol. 147 (3): 1037-1044 (1991). The human CTLA-4 signal peptide sequence comprising amino acid residues 1-35 or 137 of the hCTLA-4 protein is shown in SEQ ID NO: 182 or SEQ ID NO: 216, respectively. If the signal peptide sequence is that shown in SEQ ID NO: 182 or SEQ ID NO: 216, when the signal peptide is cleaved, the mature hCTLA-4 protein normally begins with the methionine residue at amino acid position 38 of the full length hCTLA-4 protein sequence shown in SEQ ID NO: 160. Therefore, although the signal peptide sequence of hCTLA-4 is that of SEQ ID NO: 182, which comprises amino acid residues 1-35 of the hCTLA-4 protein, the resulting mature secreted hCTLA-4 protein begins with methionine. which is at position 38 of the full length hCTLA-4 protein. Lysine (K) and alanine (A) residues at positions 36 and 37, respectively, of the full-length hCTLA-4 protein are not present in the mature hCTLA-4 protein and are believed to be cleaved from the hCTLA protein -4 matures during processing. Thus, amino acid residues of the mature hCTLA-4 protein sequence are normally numbered starting with the methionine residue present at position 38 of the full-length hCTLA-4 protein as the first amino acid (i.e., occupying position 1 ); therefore, the histidine residue occupies amino acid position 2 in the mature hCTLA-4 protein, etc. Each monomer of the Orencia® dimer includes the hCTLA-4 ECD polypeptide sequence shown in SEQ ID NO: 159. In the full length hCTLA-4 WT protein, the signal peptide comprises amino acid residues 1-37, the domain Extracellular (ECD) comprises amino acid residues 38-161, the transmembrane domain (TD) comprises amino acid residues 162-182 and the cytoplasmic domain (CD) comprises amino acid residues 183-223 of SEQ ID NO: 160. The mature domain (MD) of the hCTLA-4 protein typically comprises amino acid residues 36-223 or, in some cases, amino acid residues 37-223 or 38-223 of SEQ ID NO: 160.
The nucleic acid of SEQ ID NO: 194 comprises a nucleic acid sequence encoding the signal peptide sequence (nucleotide residues 1-111), a nucleic acid sequence encoding ECD of hCTLA-4 (nucleotide residues 112-483 ), a nucleic acid sequence encoding the transmembrane and cytoplasmic domains of hCTLA-4 (nucleotide residues 484-669); The last 3 nucleotides of the C-terminus are the TGA termination codon.
Belatacept (also known as "LEA29Y-Ig", "LEA-Ig" or "A29YL104E-Ig") (Bristol-Myers Squibb Co. (Princeton, NJ)) is a soluble recombinant dimeric protein composed of two Ig fusion proteins identical covalently linked together by a disulfide bond formed between a cysteine residue in each monomeric fusion protein. Each monomeric fusion protein is composed of a mutant CTLA-4 extracellular domain polypeptide fused at its C-terminus with the N-terminus of a specific mutant IgG1 polypeptide. The mutant CTLA-4 ECD polypeptide sequence differs from the WT human CTLA-4 ECD polypeptide sequence in two mutations, specifically a replacement of a tyrosine with the alanine at position 29 (abbreviated as the A29Y substitution) and a substitution of a glutamine with leucine at position 104 (abbreviated as the L104E substitution), wherein the amino acid residues in the human CTLA-4 ECD are numbered with the N-methionine representing the amino acid at position 1. Each belatacept monomer includes the mutant IgG1 Fc polypeptide sequence shown in SEC ID No.: 186; this polypeptide
of the mutant IgG1 Fc is identical to the mutant IgG1 Fc polypeptide included in the Orencia® fusion protein. Therefore, the monomeric fusion protein belatacept differs from each monomeric fusion protein Orencia® in two amino acids. The polypeptide sequence of each of such monomeric fusion protein in belatacept is shown in SEQ ID NO: 166. Thus, the name "LEA29Y-Ig" reflects the fact that each monomeric fusion protein of the belatacept dimer is composed of a mutant CTLA-4 ECD that differs from the human CTLA-4 ECD polypeptide sequence by two mutations L104E and A29Y. Belatacept has been shown to bind to CD86 approximately 4 times more avidly and binds to CD80 approximately 2 times more avidly than the Orencia® dimer (Larson et al., Amer. J. Transplant. 5: 443-453, 444 (2005 ). Belatacept has been shown to be up to approximately 10 times more potent than the Orencia® dimer in inhibiting the activation of T lymphocytes in vitro and has improved in vivo immunosuppressive potency compared to the Orencia® protein as shown by its high ability to inhibit responses. of antibodies dependent on T lymphocytes and their enhanced prolongation of renal allograft survival in clinical trials involving nonhuman primates. Idem. Additional information about belatacept and its clinical indications and efficacy is provided on the universal website at bms.com.
Mutant CTLA-4 molecules are disclosed herein, including novel soluble recombinant mutant CTLA-4-Ig fusion proteins described herein, which have a CD86 binding avidity that is greater than the binding avidity of the Orencia® dimer (dimeric hCTLA-4-Ig) by CD86. Mutant CTLA-4 molecules are also disclosed, including novel dimeric recombinant mutant CTLA-4-Ig fusion proteins, which have an avidity of binding by CD80 that is approximately equal to or greater than the binding avidity of the Orencia® dimer by CD80 . Also disclosed herein are mutant CTLA-4 molecules that include novel soluble recombinant mutant CTLA-4-Ig fusion proteins, which have a greater ability to suppress one or more immune responses (e.g., T-lymphocyte-dependent immune responses ) than Orencia® (abatacept). The disclosure mutant CTLA-4 molecules that have one or more improved properties compared to the Orencia® dimer are expected to be more potent and, therefore, more effective, useful and advantageous than the Orencia® dimer in the treatment of diseases, disorders or conditions in which immunosuppression is desired, including those diseases, disorders or conditions for which the Orencia® dimer is authorized and / or has been shown to provide clinical benefit, such as autoimmune diseases that include, for example, rheumatoid arthritis and psoriasis.
Mutant CTLA-4 molecules are also disclosed herein, including novel soluble recombinant mutant CTLA-4-Ig fusion proteins described herein, which have a CD86 binding avidity that is greater than the binding avidity. of belatacept (LEA29Y-Ig) by CD86. Mutant CTLA-4 molecules are also disclosed herein, including novel soluble recombinant mutant CTLA-4-Ig fusion proteins described herein, which have a CD86 binding avidity that is greater than the binding avidity. from belatacept on CD86. Also disclosed herein are mutant CTLA-4 molecules, which include novel soluble recombinant mutant CTLA-4-Ig fusion proteins described herein, which have a greater ability to suppress one or more immune responses (e.g., T-cell dependent immune responses) that belatacept. The disclosure mutant CTLA-4 molecules that have one or more improved properties compared to belatacept are expected to be more potent than belatacept and therefore more effective, useful and advantageous than belatacept in the treatment of diseases, disorders or conditions in which immunosuppression is desired, which includes those diseases, disorders or conditions for which belatacept fusion protein has been shown to provide clinical benefit, such as renal allograft survival in nonhuman primates.
The safety, tolerability, pharmacokinetics, immunogenicity and clinical efficacy of a molecule of the disclosure, such as a molecule of mutant CTLA-4 of the disclosure (eg, mutant CTLA-4 ECD polypeptide or CTLA-4- fusion protein Soluble mutant Ig as described in detail below) in a subject who has an immune disease or disorder (eg, rheumatoid arthritis, multiple sclerosis, psoriasis, etc.) to which a particular dose of the molecule is administered in a particular manner (eg, parenteral, intravenous or subcutaneous administration) can be determined using methodologies comparable to those employed in clinical trials for Orencia® involving similar subjects. See, for example, the universal web site addresses at bms.com and orencia.com. For example, the extent to which a molecule of mutant CTLA-4 of the disclosure (eg, soluble mutant CTLA-4-Ig) is effective in reducing the progression of joint injury in subjects who have rheumatoid arthritis (RA). Relieving the signs and symptoms of RA, which include pain reduction, can be evaluated using methodologies similar to those used in Orencia® clinical trials involving patients with RA.
The safety, tolerability, pharmacokinetics, immunogenicity and clinical efficacy of a molecule of the disclosure (eg, mutant CTLA-4 ECD polypeptide or soluble mutant CTLA-4-Ig fusion protein as described in detail below) in a subject in which immunosuppression is desired (for example, a subject undergoing tissue, cell transplantation, organ or graft of a donor) and to which a particular dose of the molecule is administered in a particular way (for example, parenteral, intravenous or subcutaneous administration) can be determined using methodologies comparable to those employed in clinical trials for belatacept involving similar subjects . See, for example, the universal website address bms.com. For example, the extent to which a molecule of mutant CTLA-4 of the disclosure (eg, soluble mutant CTLA-4-Ig) is effective in reducing kidney or renal transplant rejection in a recipient patient who undergoes a transplant of kidney or kidney
It can be evaluated using methodologies similar to those used in the clinical trial of belatacept that involves patients undergoing kidney or kidney transplantation.
The molecules and methods of the disclosure and other aspects of the disclosure are discussed in further detail below.
Polypeptides
Novel polypeptides are disclosed herein, collectively referred to as "disclosure polypeptides." The term "disclosure polypeptides" is intended to include variants and / or derivatives of the polypeptide sequences disclosed herein. The polypeptides of the disclosure include naturally occurring recombinant or mutant CTLA-4 polypeptides that bind to CD80 and / or CD86 and / or that inhibit or suppress immune responses. The polypeptides of the disclosure include recombinant fusion proteins comprising a mutant CTLA-4 polypeptide of the disclosure, and include monomeric and dimeric forms of such fusion proteins. The polypeptides of the disclosure include multimers comprising one
or more mutant CTLA-4 polypeptides of the disclosure. The disclosure also includes conjugates comprising one or more mutant CTLA-4 polypeptides of the disclosure. Some polypeptides of the disclosure are soluble polypeptides. For example, as described in more detail below, the disclosure includes soluble fusion proteins comprising a mutant CTLA-4 ECD polypeptide linked to a different polypeptide (such as, for example, an immunoglobulin polypeptide such as, for example, an Ig Fc polypeptide) that enhances solubility of the mutant CTLA-4 ECD polypeptide.
As discussed in greater detail below, in one aspect of the disclosure a variety of mutagenesis and screening strategies were used to prepare and identify novel polypeptides that bind to CD80 and / or CD86. In particular, such strategies were used to prepare and identify novel polypeptides that have improved abilities to bind to CD80 and / or CD86, which include novel mutant CTLA-4 polypeptides that have enhanced affinities or binding avidities for CD80 and / or CD86. Disclosure polypeptides that bind to CD80 and / or CD86 ligands expressed on antigen presenting cells interfere with or block the interaction of these ligands with CD28 receptors expressed on T lymphocytes. As a result, the T-cell costimulatory signal provided by The interaction of the CD28 T-cell surface receptor with the B7 molecules (i.e., CD80 and CD86) is inhibited or blocked. It is believed that such polypeptides are useful in the prophylactic and therapeutic treatment of diseases, disorders and conditions in which the modulation of the immune system is beneficial (for example, T lymphocyte responses).
CTLA-4 mutant polypeptides
Isolated or recombinant polypeptides are disclosed herein, each comprising a sequence of polypeptides having at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5 %, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1- 73 (for example, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID No.: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID No.: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, and SEQ ID NO: 73), wherein the polypeptide binds to CD80 and / or CD86 or a fragment of CD80 polypeptide and / or CD86 (or an ECD of either or both), and / or modulate or regulate an immune response. Some of such polypeptides, such as each of those set forth in SEQ ID NO: 1-73, are described as ECLA polypeptides of secreted or mature mutant CTLA-4. The mutant CTLA-4 ECD polypeptides exposed in each of SEQ ID NO: 1-73 do not include a signal peptide; It has been cleaved during processing, thus producing the mature or secreted polypeptide. A fragment of the CD80 polypeptide may comprise, for example, a polypeptide from the extracellular domain of a CD80 polypeptide such as, for example, human CD80 ECD polypeptide ("hCD80 ECD"). A fragment of the CD86 polypeptide may comprise, for example, a polypeptide from the extracellular domain of a CD86 polypeptide such as, for example, human CD86 ECD polypeptide ("hCD86 ECD"). Some of such polypeptides bind to mammalian CD80 and / or CD86 or polypeptide fragment thereof such as, for example, a CD80 or CD86 mammalian ECD. Some of such polypeptides bind to human CDT WT ("hCD80") and / or human CD86 WT ("hCD86") or a polypeptide fragment thereof such as, for example, ECD of hCD80 or ECD of hCD86. In some of such procedures at least one immune response is suppressed or inhibited.
Some of such polypeptides have an affinity or avidity for binding by hCD80 or a fragment thereof (eg, ECD of hCD80) that is at least about equal to or greater than the affinity or binding avidity of the
hCTLA-4 ECD polypeptide by hCD80 or a fragment thereof, respectively. The predicted full-length hCD80 polypeptide sequence, which includes a signal peptide, ECD, transmembrane domain and cytoplasmic domain covalently linked together in that order, is set forth in SEQ ID NO: 195. The signal peptide comprises amino acid residues 1-34, the ECD comprises amino acid residues 35-242, the transmembrane domain comprises amino acid residues 243-263 and the cytoplasmic domain comprises amino acid residues 264-288 of SEQ ID NO. : 195. The polypeptide sequence of the hCD80 ECD is shown in SEQ ID NO: 174. The nucleic acid sequence shown in SEQ ID NO: 173 encodes the signal peptide of human CD80 WT (at the N-terminus) and CD80 ECD human.
Some of such polypeptides have an affinity or avidity for hCD86 binding or a fragment thereof (eg, hCD86 ECD) that is at least about equal to or greater than the affinity or binding avidity of the hCTLA-4 ECD polypeptide for hCD86 or a fragment thereof (eg, ECD), respectively. The predicted full-length hCD86 polypeptide sequence, which includes a signal peptide, ECD, transmembrane domain and cytoplasmic domain covalently linked together in that order, is set forth in SEQ ID NO: 175, and an exemplary nucleic acid encoding The predicted full length hCD86 polypeptide sequence is shown in SEQ ID NO: 176. The hCD86 ECD polypeptide sequence is shown in SEQ ID NO:
180 Some of such polypeptides have an affinity or binding avidity for hCD86 that is at least about equal to or greater than the affinity or binding avidity of the LEA29Y ECD polypeptide having the sequence set forth in SEQ ID NO: 168 for hCD86. Exemplary polypeptides of the invention having binding affinities or binding avidities for hCD86 or ECD of hCD86 that are at least equal to or greater than those of ECD of hCTLA-4 and ECD OF LEA29Y (also called "A29YL104E" ECD) or "L104EA29Y") by hCD86 or hCD86 ECD, respectively, include, for example, but not limited to, those comprising a polypeptide sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the sequence of any of SEQ ID NO: 4, 10-12, 15, 17, 24, 26, 28, 35 and 61. See, for example, Table 5 in the Example 4. The data presented in Table 5 reflect a monomeric interaction between a representative CTLA-4-Ig and monomeric CD86 ECD. The term LEA29Y (or A29YL104E or L104EA29Y), if not indicated otherwise, refers to ECD of LEA29Y (or ECD of A29YL104E or L104EA29Y).
Some of such polypeptides comprise a polypeptide sequence having an amino acid length approximately equal to the amino acid length of the extracellular domain of human CTLA-4. Such polypeptides can be described as mutant CTLA-4 ECD polypeptides. Some of such mutant CTLA4 ECD polypeptides comprise a polypeptide sequence having about 110 amino acids to about 138 amino acid residues, about 112 to about 136 amino acid residues, about 114 to about 134 amino acid residues, about 116 to about 132 residues of amino acids, about 118 to about 130 amino acid residues, approximately 119 to approximately 129 amino acid residues, approximately 120 to approximately 128 amino acid residues, approximately 121 to approximately 127 amino acid residues, approximately 122 to approximately 126 amino acid residues, approximately 123 to approximately 125 amino acid residues in length. Some of such mutant CTLA-4 ECD polypeptides comprise a sequence that is 124 amino acid residues in length. Exemplary polypeptides include, for example, but are not limited to, a polypeptide comprising a polypeptide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, in which such polypeptide binds to CD80 and / or CD86 (or an ECD of either or both).
Some of such polypeptides described above, including, for example, those isolated or recombinant polypeptides each comprising a polypeptide sequence having at least 75%, 80%, 85%, 86%, 87%, 88%, 89 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence identity with at least one sequence of polypeptides selected from the group of SEQ ID NO: 1-73 and that bind to CD80 and / or CD86 and / or an ECD thereof, have a capacity to modulate or regulate an immune response. One or more of a variety of immune responses can be modulated or regulated by such polypeptides that include, but are not limited to, for example, activation or proliferation of T lymphocytes, synthesis or production of cytokines (eg, production of TNF-∀, IFN- !, IL-2, etc.), induction of various activation markers (for example, CD25, IL-2 receptor, etc.), synthesis or production of inflammatory molecules, inflammation, joint swelling, joint palpation pain, pain, stiffness, serum levels of C-reactive protein, production of anti-collagen antibodies and / or antibody response (s) dependent on T lymphocytes). In some cases, such a polypeptide has a greater ability to suppress or inhibit at least one immune response such as hCTLA-4 or ECD of hCTLA-4.
For example, some of such polypeptides may inhibit T lymphocyte activation or T lymphocyte proliferation in in vitro assays. Examples 4-9 set forth below, for example, demonstrate the ability of representative fusion proteins comprising a representative mutant CTLA-4 ECD polypeptide sequence such as those described herein, to inhibit T lymphocyte proliferation. in vitro Some of such polypeptides can inhibit or suppress an immune response in a subject in vivo, such as by administering a therapeutically or prophylactically effective amount of at least one such polypeptide to a subject in need of immunosuppressive therapy. Some such polypeptides are expected to be useful in a
variety of applications that include, for example, but are not limited to prophylactic and / or therapeutic procedures for treating diseases, disorders and conditions of the immune system in which immunomodulation is desired, as discussed in greater detail below. Such polypeptides are expected to be useful in prophylactic and / or therapeutic procedures to inhibit or suppress an immune response in a subject (for example, in the in vivo treatment of diseases or disorders of the mammalian immune system such as, for example, humans , in which immunoinhibition or immunosuppression is desired), procedures to inhibit rejection of a donor tissue or organ transplant by a recipient (e.g., by a mammal such as, for example, a human being), and other methods described elsewhere herein.
Additionally or alternatively, some such polypeptides have an ability to suppress or inhibit an immune response that is at least about equal to or greater than the ability of hCTLA-4 or ECD of hCTLA-4 to suppress or inhibit one or more types of immune responses . For example, some of such polypeptides have an ability to inhibit the activation or proliferation of T lymphocytes in assays and / or in vitro and / or in vivo applications, such as those described above and in greater detail below, which is at least about equal to or greater than the ability of hCTLA-4 or ECD of hCTLA-4 to inhibit the activation or proliferation of T lymphocytes in such applications. Additionally, some of such polypeptides have an ability to inhibit or suppress an immune response (eg, activation or proliferation of T lymphocytes, cytokine production, T lymphocyte dependent antibody response) that is greater than the capacity of a LEA29Y - polypeptide. a specific mutant CTLA-4 ECD comprising the polypeptide sequence shown in SEQ ID NO: 168 - to inhibit or suppress an immune response. Examples 4-9 set forth below, for example, compare the ability of representative fusion proteins of the invention that comprise a mutant CTLA-4 ECD polypeptide sequence of the invention to inhibit proliferation of T lymphocytes in vitro with respect to to the ability of a fusion protein comprising the hCTLA-4 or LEA29Y ECD polypeptide to inhibit proliferation of T lymphocytes in vitro. Such molecules are expected to be of beneficial use in a variety of therapeutic applications that include treatment of autoimmune diseases and disorders, and prophylactic and therapeutic procedures to inhibit rejection of organ, cell or tissue graft transplantation.
Some of such polypeptides can be differentiated from others by, for example, a deletion, addition and / or substitution of amino acids. An amino acid substitution may be a conservative or non-conservative substitution. See, for example, the section entitled "Sequence variation".
Isolated or recombinant polypeptides each comprising a polypeptide sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with at least one sequence are disclosed herein. of polypeptides selected from the group consisting of SEQ ID NO: 1-73, in which the polypeptide binds to monomeric hCD80 or monomeric hCD86 or an ECD of either or both. Some of such polypeptides have (1) a binding affinity for monomeric hCD86 that is approximately equal to or greater than the binding affinity of monomeric hCTLA-4 or a LEA29Y polypeptide for monomeric hCD86 or an ECD thereof, and (2) an affinity binding by monomeric hCD80 which is approximately equal to or greater than the binding affinity of monomeric hCTLA-4 by monomeric hCD80. The LEA29Y polypeptide comprises the polypeptide sequence of SEQ ID NO: 168. In addition, some such polypeptides have a greater ability to suppress a
or more immune responses described herein (eg, activation / proliferation of T lymphocytes, synthesis / production of cytokines, induction of activation markers, production of inflammatory molecules, inflammation, production of anti-collagen Ab, dependent Ab response of T lymphocytes) that monomeric hCTLA-4, monomeric hCTLA-4 ECD, or LEA29Y polypeptide.
Also disclosed herein are isolated or recombinant polypeptides each comprising a sequence of polypeptides having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, in which the polypeptide has a binding affinity for an hCD86 ECD or hCD80 ECD that is approximately equal to or greater than the binding affinity of an hCTLA-4 ECD for the hCD86 ECD or hCD80 ECD respectively. Some of such polypeptides have a binding affinity for the hCD86 ECD that is greater than the binding affinity of the hCTLA-4 ECD (SEQ ID NO: 159) or the LEA29Y polypeptide (SEQ ID NO: 168) for the ECD of hCD86. Some of such polypeptides have a binding affinity for the hCD80 ECD that is greater than the binding affinity of the hCTLA-4 ECD for the hCD80 ECD. Some of such polypeptides have an ability to suppress an immune response, in some cases, a greater ability to suppress one or more immune responses, which includes those described above and throughout this document, than the hCTLA-4 ECD or the polypeptide READ29Y.
Isolated or recombinant polypeptides (eg, mutant CTLA-ECD polypeptides) each comprising a polypeptide sequence (a) that differs from a polypeptide sequence selected from the group consisting of SEQ ID are disclosed herein. : 1-73 in no more than 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid residue (s), and (b) in which the residue of amino acid in the polypeptide sequence at the position of amino acid residue 41, 50, 54, 55, 56, 64, 65, 70 or 85 is identical to the amino acid residue at the corresponding position of said selected polypeptide sequence (for example , a polypeptide selected from SEQ ID NO: 1-73), in which the polypeptide binds to CD80 and / or CD86 and / or an extracellular domain of either or both, and / or inhibits an immune response (s). In some cases, the polypeptide differs from
selected polypeptide (eg, selected from SEQ ID NO: 1-73) in no more than 10, 9, 8, 7 or 6 amino acid residues (for example, no more than 1, 2, 3, 4, 5, 6 , 7, 8, 9 or 10 amino acid residues), but the amino acid that occupies one or more of the amino acid residue positions 41, 50, 54, 55, 56, 64, 65, 70 and 85 is identical to the residue of amino acid included in that position in the selected polypeptide sequence (for example, one selected from SEQ ID NO: 1-73) and is not deleted or substituted with another amino acid. Some of such polypeptides comprise a polypeptide sequence that differs from the selected polypeptide sequence in no more than 10, 9, 8, 7 or 6 amino acid residues (for example, no more than 1, 2, 3, 4, 5 , 6, 7, 8, 9 or 10 amino acid residues) and that includes amino acid residues in one or more of the amino acid residue positions 24, 30, 32, 41, 50, 54, 55, 56, 64, 65 , 70, 85, 104 and 106 that are identical to amino acid residues at the corresponding positions in the selected polypeptide sequence. Such polypeptides can be differentiated from the polypeptide sequence selected by amino acid deletion (deletions), addition (additions) and / or substitution (substitutions) at a position (positions) that is not specified as having (n) an amino acid identical to that of the selected sequence. Polypeptides such as having an affinity or avidity for hCD86 binding or a fragment thereof (eg, hCD86 ECD) are included which is at least about equal to or greater than the affinity or binding avidity of the hCTLA-4 ECD or polypeptide. READ29Y by hCD86 or a fragment thereof (eg, ECD), respectively. Some of such polypeptides have an affinity or avidity for hCD80 binding or a fragment thereof (eg, hCD80 ECD) that is at least about equal to or greater than the affinity or binding avidity of the hCTLA-4 ECD polypeptide for hCD80 or a fragment thereof, respectively. Some of such polypeptides comprise a polypeptide sequence that is approximately equal in length to the amino acid length of the ECT of hCTLA-4, for example, 118-130, 119-129, 120-128, 121-127, 122-126, 123-125 or 124 amino acid residues in length.
Some of such polypeptides may suppress one or more of a variety of immune responses that include, for example, activation of T lymphocytes, proliferation of T lymphocytes, synthesis or production of cytokines (eg, production of TNF-∀, IFN-! IL-2), induction of activation markers (eg, CD25, IL-2 receptor), inflammation, production of inflammatory molecules, production of anti-collagen Ab and / or Ab-dependent response (s) of T lymphocytes). Some of such polypeptides have a greater ability to inhibit one or more such immune responses than hCTLA-4, hCTLA-4 ECD polypeptide or LEA29Y polypeptide. For example, some of such polypeptides may inhibit T lymphocyte activation or T lymphocyte proliferation in in vitro assays. Examples 4-9, for example, compare the ability of representative fusion proteins of the invention comprising a mutant CTLA-4 ECD polypeptide sequence of the disclosure to inhibit proliferation of T lymphocytes in vitro with respect to the ability of a fusion protein comprising the HCTLA-4 ECD or LEA29Y polypeptide to do the same. Some of such polypeptides can inhibit or suppress an immune response in a subject in vivo, such as by administering a therapeutically or prophylactically effective amount of at least one such polypeptide to a subject in need of immunosuppressive therapy. Such polypeptides are expected to be useful in a variety of applications that include, for example, but are not limited to, prophylactic and / or therapeutic procedures for treating diseases, disorders and conditions of the immune system in which suppression of a response is desired. immune systems that include, for example, prophylactic and / or therapeutic procedures for treating autoimmune diseases and disorders, methods for inhibiting the rejection of a donor tissue or organ transplant by a recipient (for example, by a mammal such as, for example, a human being), and other procedures described elsewhere herein.
Also disclosed herein is an isolated or recombinant polypeptide comprising a polypeptide sequence comprising (i) at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73 and (ii) a phenylalanine residue at an amino acid position corresponding to position 70 of said polypeptide sequences selected from the group consisting of SEQ ID NO: 1-73, in which the polypeptide binds to hCD80 and / or hCD86 or an extracellular domain thereof and / or inhibits an immune response (for example, activation or proliferation of T lymphocytes, synthesis or production of cytokines, induction of activation markers, production of inflammatory molecules, inflammation, pain with joint palpation, pain, stiffness, serum levels of C-reactive protein, production of anti-collagen Ab and / or T-lymphocyte-dependent Ab response, etc.) in in vitro assays and / or in vivo procedures. Some of such polypeptides comprise one or more of the following with respect to the selected sequence: a glutamic acid residue at an amino acid position corresponding to position 24; an asparagine residue at an amino acid position corresponding to position 30; an isoleucine residue at an amino acid position corresponding to position 32; a methionine residue at an amino acid position corresponding to position 50; a lysine residue at an amino acid position corresponding to position 54; a glutamic acid residue at an amino acid position corresponding to position 55; an aspartic acid residue at an amino acid position corresponding to position 56; a proline residue at an amino acid position corresponding to position 64; a serine residue at an amino acid position corresponding to position 65; and a glutamic acid residue at an amino acid position corresponding to position 104. Such polypeptides are expected to be of beneficial use in a variety of applications, including procedures for treating autoimmune diseases and disorders, and procedures for inhibiting graft transplantation. organ, cell or tissue.
An isolated or recombinant polypeptide comprising a polypeptide sequence comprising (i) at least 95%, 96%, 97%, 98% or 99% sequence identity with a selected polypeptide sequence is disclosed herein. of the group consisting of SEQ ID NO: 36-46 and 55, and (ii) a glutamic acid residue at an amino acid position 55 of said selected polypeptide sequence, wherein the polypeptide binds to CD80 and / or CD86 or an extracellular domain of any of them or both and / or suppresses an immune response. Immune responses that can be suppressed include, for example, activation or proliferation of T lymphocytes, synthesis or production of cytokines (e.g., production of TNF-∀, IFN- !, IL-2), induction of activation markers (e.g. , CD25, IL-2 receptor), inflammation, production of inflammatory molecules, production of anti-collagen Ab and / or T lymphocyte-dependent Ab response). Such a polypeptide sequence may further comprise a phenylalanine residue at amino acid position 70. Such a polypeptide sequence may further comprise a proline residue at position 64 and / or an asparagine residue at position 30. Such a polypeptide sequence may further comprising a methionine residue at position 50 and / or a lysine residue at position 54.
An isolated or recombinant polypeptide comprising a polypeptide sequence comprising (i) at least 95%, 96%, 97%, 98% or 99% sequence identity with a selected polypeptide sequence is disclosed herein. of the group consisting of SEQ ID NO: 28, 30, 36-46, 55-57 and 65-73, and (ii) a glutamic acid residue at an amino acid position 55 of said selected polypeptide sequence, wherein the polypeptide binds to CD80 and / or CD86 or an extracellular domain of either or both and / or suppresses an immune response, such as activation or proliferation of T lymphocytes, synthesis or production of cytokines (eg, production of TNF-∀, IFN- !, IL-2 ), induction of activation markers (for example, CD25, IL-2 receptor), inflammation, production of inflammatory molecules, production of anti-collagen Ab and / or T cell-dependent Ab response. Such a polypeptide sequence may further comprise a phenylalanine residue at amino acid position 70. Such Polypeptide sequence may further comprise a proline residue at position 64 and / or an asparagine residue at position 30. Such a polypeptide sequence may further comprise a methionine residue at position 50 and / or a lysine residue at position 54.
Any polypeptide of the disclosure described above may additionally include a peptide that facilitates the secretion of said polypeptide. Thus, an isolated or recombinant polypeptide comprising (a) any polypeptide as described above (for example, a mutant CTLA-4 ECD described above) is disclosed herein, and (b) a peptide that facilitates the secretion of the polypeptide expressed from a host cell. The peptide is optionally a signal peptide. The C-terminus of the signal peptide is normally covalently linked to the N-terminus of the polypeptide. The signal peptide may comprise an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity of sequences with the amino acid sequence of SEQ ID NO: 182 or SEQ ID NO: 216. The signal peptide may comprise an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with an amino acid sequence comprising amino acid residues 1-35, 1-36 or 1-37 of SEQ ID NO: 160.
Any polypeptide of the disclosure described above may further comprise a transmembrane domain and / or cytoplasmic domain. Thus, it is disclosed herein to provide an isolated or recombinant polypeptide comprising (a) any polypeptide of the disclosure described above (eg, a mutant CTLA-4 ECD described above), and (b) a transmembrane domain. Such a protein may optionally further comprise a signal peptide as described above, wherein the C-terminus of the signal peptide is covalently linked to the N-terminus of the polypeptide of the disclosure. The C-terminus of the signal peptide is normally covalently linked to the N-terminus of the transmembrane domain. The C end of the transmembrane domain is normally covalently linked to the N end of the cytoplasmic domain. In some cases, the transmembrane domain comprises an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of identity with an amino acid sequence comprising amino acid residues 162-182 of SEQ ID NO: 160. In some cases, the cytoplasmic domain comprises an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of identity with an amino acid sequence comprising amino acid residues 183223 of SEQ ID NO: 160. Any of the polypeptides described above may comprise one or more of the amino acid residues that are glycosylated or pegylated.
Multimers of isolated or recombinant polypeptides comprising two or more polypeptides are also disclosed herein, wherein at least one of the multimer polypeptides is a mutant CTLA-4 polypeptide of the disclosure as described herein (by example, an ECD of mutant CTLA-4 or mutant CTLA-4-Ig). Such a multimer comprises at least one polypeptide of the disclosure and may further comprise at least one additional polypeptide that does not need to be a polypeptide of the disclosure. For example, the multimer may comprise at least one polypeptide of the disclosure and at least one other polypeptide that may be, for example, a natural polypeptide (for example, ECD of hCTLA-4 or hCTLA-4-Ig) and / or at least another mutant polypeptide (such as a mutant polypeptide that is not a polypeptide of the invention). Some or all of the polypeptides in the multimer (or multimeric polypeptide) may be identical to each other or, in some cases, all polypeptides in the multimer may be different from each other. In some cases, the polypeptide multimer is a dimer comprising two polypeptides of the disclosure, which may optionally be identical polypeptides (it is
ie, homodimer) or different polypeptides (ie, heterodimer). In some cases, the polypeptide multimer is a tetramer comprising four polypeptides of the disclosure. The tetramer may comprise four identical polypeptides (i.e., homotetramer) or any combination of four polypeptides of the disclosure such that at least one polypeptide is not identical to the other three polypeptides (i.e., heterotetramer). A tetramer comprising four identical CTLA-4 WT ECD polypeptides (for example, hCTLA-4 ECD) or four identical CTLA-4-Ig WT (for example, hCTLA-4-Ig) is also disclosed herein. . In some cases, the multimer can bind to CD80 and / or CD86 (or an ECD of either or both) and / or suppress or inhibit an immune response in in vitro and / or in vivo procedures (e.g., proliferation or activation of T lymphocytes, cytokine production, etc.). Some of such multimers are more capable of suppressing or inhibiting an immune response in vitro and / or in vivo than hCTLA-4 or hCTLA-4-Ig (for example, hCTLA-4-IgG2 or the Orencia® protein). The polypeptides of the multimers can be linked together, such as by covalent bonds, such as by disulfide bonds between one or more cysteine residues in the one or more polypeptides.
Some of such tetramers of the disclosure comprise a structure schematically similar to that of an antibody, but in which the variable domains of the antibody are each substituted with any mutant CTLA-4 ECD polypeptide of the disclosure described herein. The heavy chain of an antibody comprises a heavy chain variable domain (VH) fused with an immunoglobulin (Ig) CH1 domain (eg, CH1 of IgG2), which is fused with a hinge. The hinge is fused with a CH2 domain of Ig (for example, CH2 of IgG2), which is fused with a CH3 domain of Ig (for example, CH3 of IgG2). The light chain of an antibody comprises a variable domain of the light chain (VL) fused with a C kappa (Cκ) or C lambda (Cλ) Ig domain. Two heavy chains and two light chains are covalently linked together by one or more disulfide bonds formed by cysteine residues in the heavy and light chains. This document also discloses a mutant CTLA-4 tetramer in which each of the variable domains of the heavy and light chains is substituted with a mutant CTLA4 ECD polypeptide of the disclosure. Therefore, such a tetramer comprises two light chains and two heavy chains. Each light chain comprises a mutant CTLA-4 ECD polypeptide fused with a Cκ or Cλ domain of Ig. Each heavy chain comprises a mutant CTLA-4 ECD fused with a CH1 Ig domain (eg, CH1 IgG2), which is fused with a hinge. The hinge is fused with a CH2 domain of Ig (for example, CH2 of IgG2), which is fused with a CH3 domain of Ig (for example, CH3 of IgG2). The two heavy chains and the two light chains are covalently linked together by one or more disulfide bonds formed by cysteine residues in the heavy and light chains. Such tetramer can be described as a tetramer of CTLA4-Ig. The procedures for constructing such a tetramer of CTLA-4-Ig are known and would be understood by those skilled in the art. A tetrameric CD4-Ig construct, comprising a CD4 polypeptide and neutralizing isolates of primary HIV type 1 isolates, is described in Allaway, GP et al., AIDS Res. Hum. Retroviruses 11 (5): 533-9 (1995). The tetramer may comprise four identical mutant CTLA-4 ECD polypeptides or any combination of four mutant CTLA-4 ECD polypeptides of the disclosure such that at least one mutant CTLA-4 ECD is not identical to the other three polypeptides. of the mutant CTLA-4 ECD. Some of such tetramers may bind to CD80 and / CD86 with a greater avidity of binding than hCTLA-4 (or hCTLA4-Ig). Some of such tetramers may suppress or inhibit an immune response; In some cases, such a tetramer has a greater ability to suppress or inhibit an immune response in in vitro assays or in vivo applications (eg, proliferation or activation of T lymphocytes, cytokine production, etc.) than hCTLA4 or hCTLA-4 -Ig (for example, hCTLA-4-IgG2 or Orencia®). The multimers of the disclosure are expected to be of beneficial use in a variety of applications including procedures to treat autoimmune diseases and disorders, and procedures to inhibit organ, cell or tissue graft transplantation.
Also disclosed herein are isolated or recombinant conjugated multimers comprising two or more conjugates, in which at least one of the conjugates is a conjugate of the disclosure comprising a mutant CTLA-4 polypeptide of the disclosure (eg, a ECD of mutant CTLA-4 or mutant CTLA-4-Ig). Some or all of the conjugates in the multimer may be identical to each other, or all the conjugates in the multimer may be different from each other. In some cases, the conjugated multimer is a dimer comprising two conjugates or a tetramer comprising four conjugates of the disclosure. Some of such multimer conjugates may bind to CD80 and / CD86 (or an ECD of either or both) and / or suppress or inhibit an immune response in vitro and / or in vivo. Multimer conjugated molecules can be linked together, such as by covalent bonds, such as by disulfide bonds between one or more cysteine residues in the one or more conjugates.
Also disclosed herein is an isolated or recombinant polypeptide dimer comprising two any of the polypeptides of the disclosure described above (eg, mutant CTLA-4 ECD described above), wherein the dimer has a human avidity for CD86 binding or an extracellular domain thereof that is approximately equal to or greater than the binding avidity of a dimer comprising two extracellular domains of human CTLA-4 per human CD86 or an extracellular domain of it, respectively.
Dimer of isolated or recombinant polypeptides comprising two polypeptides of the disclosure described above (eg, mutant CTLA-4 ECD described above), wherein the dimer has an avidity for hCD80 binding or an ECD is disclosed herein. thereof that is approximately equal to or greater than the binding avidity of a dimer comprising two hCTLA-4 ECD polypeptides (SEQ ID NO: 159) by hCD80 or an ECD thereof, respectively.
In some cases, the dimer has an avidity for hCD80 binding or an ECD thereof that is approximately equal to or greater than the binding avidity for a dimer comprising two polypeptides of the hCTLA-4 ECD for 5 hCD80 or one ECD thereof. respectively. In some cases, the dimer has an avidity for binding by hCD86 or an ECD thereof that is greater than the binding avidity for a dimer comprising two LEA29Y polypeptides per hCD86 or one ECD thereof, respectively, in which each LEA29Y polypeptide It comprises the polypeptide sequence shown in SEQ ID NO: 168. In some cases, the dimer dissociates from binding to hCD86 or an ECD thereof at a rate that is less than the rate at which a dimer comprising two ECD polypeptides
10 of hCTLA-4 dissociates from the hCD86 junction or an ECD thereof, respectively. In some cases, the dimer dissociates from binding to hCD86 or an ECD thereof at a rate that is less than the rate at which a dimer comprising two LEA29Y polypeptides dissociates from binding to hCD86 or an ECD thereof, respectively, wherein each LEA29Y polypeptide comprises the polypeptide sequence shown in SEQ ID NO: 168.
In some cases, the dimer is associated with hCD86 or an ECD thereof at a rate that is greater than the
fifteen rate at which a dimer comprising two polypeptides of the hCTLA-4 ECD is associated with hCD86 or an ECD thereof, respectively. In some cases, the dimer is associated with hCD86 or an ECD thereof at a rate that is greater than the rate at which a dimer comprising two LEA29Y polypeptides is associated with hCD86 or an ECD thereof, respectively, in which each LEA29Y polypeptide comprises the polypeptide sequence shown in SEQ ID NO: 168.
twenty In some cases, such a dimer that comprises a mutant CTLA-4 ECD has a greater ability to suppress an immune response (eg, activation or proliferation of T lymphocytes, cytokine production, etc.) than a dimer comprising two extracellular domains of human CTLA-4 or two LEA29Y polypeptides.
Some of such dimers have a CD86 equilibrium dissociation constant (KD) that is less than the CD86 equilibrium dissociation constant (KD) of a dimer comprising two polypeptides of the ECD of
25 hCTLA-4 or two LEA29Y polypeptides. Some of such dimers have a CD86 equilibrium dissociation constant (KD) that is less than the CD86 equilibrium dissociation constant (KD) of a dimer comprising two LEA29Y polypeptides, each LEA29Y polypeptide comprising the polypeptide sequence set forth in SEQ ID NO: 168.
Some of such multimers comprising at least two polypeptides of the disclosure (eg, a dimer
30 which comprises two mutant CTLA-4 ECD polypeptides of the disclosure has an enhanced ability to suppress an immune response compared to a full length hCTLA-4 multimer of the same valence (i.e., a multimer comprising the same number of full length CTLA-4 polypeptides). Some of such multimers comprising at least two polypeptides of the disclosure have an enhanced ability to suppress an immune response compared to a multimer of the hCTLA-4 ECD of the
35 same valence (i.e., a multimer comprising the same number of hCTLA-4 ECD polypeptides).
Any polypeptide of the disclosure described above may further comprise an additional polypeptide sequence that enhances solubility, such as an immunoglobulin (Ig) polypeptide sequence, thus forming, for example, a soluble fusion protein, as discussed in greater detail. later. Each polypeptide of a multimer polypeptide may further comprise an additional polypeptide sequence that
40 enhances solubility, such as an Ig polypeptide sequence, thus forming, for example, a soluble fusion protein. Thus, for example, each polypeptide of a dimer comprising two or more polypeptides of the disclosure as described above may further comprise an additional polypeptide sequence that enhances solubility, such as an Ig polypeptide sequence, thus forming, for example, a soluble fusion protein.
Four. Five Such polypeptides and dimers of the disclosure are expected to be of beneficial use in a variety of applications, including procedures for treating autoimmune diseases and disorders, and procedures for inhibiting organ, cell or tissue graft transplantation.
As previously discussed, the mature hCTLA-4 protein sequence normally begins with the methionine residue at amino acid position 38 of the full-length hCTLA-4 protein sequence shown in
fifty SEQ ID NO: 160, and the amino acid residues of the mature hCTLA-4 protein sequence are normally numbered starting with this methionine residue as the first amino acid (i.e., occupying amino acid position 1).
Some disclosure mutant CTLA-4 polypeptides (including monomeric and dimeric fusion proteins and multimeric polypeptides) include at least one amino acid substitution at an amino acid position corresponding to an amino acid position in the mature hCTLA-4 protein sequence. which is outside the junction separation surface of classical hCTLA-4 / hB7-2 (see, for example, Schwartz et al., Nature 410: 604-608 (2001)), which includes, but is not limited to, for example, any of the amino acid positions 24, 41, 54, 55, 56, 64, 65, 70 and 85. In general, a person skilled in the art would not have anticipated that a substitution of
amino acids in any of the positions mentioned above (24, 41, 54, 55, 56, 64, 65, 70 and / or 85) or any combination of one or more substitutions selected from the group of positions 24, 41, 54, 55, 56, 64, 65, 70 and 85 had a capacity to enhance the affinity or avidity of hCTLA-4 binding by hB7-2, had an enhanced ability to inhibit the interaction of CD28 positive cells with B7-2 positive cells, or provide a greater ability to suppress or inhibit an immune response than, for example, ECD of hCTLA-4 or hCTLA-4-Ig (eg, activation or proliferation of T lymphocytes, synthesis or production of cytokines, induction of activation markers , synthesis or production of inflammatory molecules, production of anti-collagen antibodies, antibody response dependent on T lymphocytes and the like). In addition, one skilled in the art would not have anticipated that a particular amino acid substitution (substitutions) or combination of particular amino acid substitutions described herein in any of the aforementioned positions (24, 41, 54, 55, 56, 64, 65, 70 and / or 85) or any combination of such positions had the capacity to enhance the affinity or avidity of hCTLA-4 binding by hB7-2, had an enhanced ability to inhibit the interaction of CD28 positive cells with B7-2 positive ones, or provides a greater ability to suppress or inhibit an immune response than, for example, hCTLA-4 or hCTLA-4-Ig ECD.
CTLA-4 mutant fusion proteins
Also disclosed are novel and recombinant fusion proteins that comprise a first polypeptide that is at least one of the polypeptides of the disclosure described above and throughout this document (such as a mutant CTLA-4 polypeptide of the disclosure such as, by For example, a mutant CTLA-4 ECD polypeptide bound or fused with a second polypeptide, thus forming a fusion protein. The second polypeptide normally facilitates the secretion or expression of the first polypeptide. Exemplary polypeptides of the mutant CTLA-4 ECD include those comprising sequences identified as SEQ ID NO: 1-73. Fusion proteins comprising immunoglobulin (Ig) domains such as fc domains of Ig fused or linked with biological active moieties of the invention such as spreading mutant CTLA-4 polypeptides are also disclosed. It is believed that the fusion proteins of the disclosure are useful as prophylactic and / or therapeutic agents for the prophylactic and / or therapeutic treatment of a variety of diseases and disorders and conditions of the immune system in immunomodulation and / or immunosuppression is of benefit, in diagnostic tests and for the preparation of medications or agents that have immunomodulatory and / or immunosuppressive activities or properties as discussed in greater detail elsewhere herein.
The fusion proteins of the disclosure comprising a mutant CTLA-4 polypeptide and an Ig polypeptide (eg, Ig Fc) are typically called mutant CTLA-4-Ig fusion proteins. Any of the fusion proteins of the disclosure that include monomeric and dimeric fusion proteins of the disclosure described in greater detail below and in the examples may comprise an Ig polypeptide, such as, for example, an Ig Fc polypeptide, as described in this document and elsewhere before and later. The second polypeptide can be linked directly to the first polypeptide. For example, the N-terminus of the second polypeptide (for example, an Ig polypeptide such as an Ig Fc polypeptide) can be covalently fused directly with the C-terminus of the first polypeptide of the disclosure (eg, CTLA-ECD polypeptide). 4 mutant). Alternatively, the second polypeptide can be indirectly linked to the first polypeptide, such as when a linker amino acid sequence comprising 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more amino acid residues is included among the first and second polypeptides. In cases where a linker is included, the N-terminus of the amino acid linker sequence is normally covalently fused to the C-terminus of the first polypeptide (e.g., ECLA of mutant CTLA-4) and the N-terminus of the second polypeptide. (for example, an Ig polypeptide such as an Ig Fc) is normally covalently fused to the C-terminus of the amino acid linker sequence.
In some cases, the second polypeptide comprises at least a portion of an Ig polypeptide such as, for example, one or more domains of a constant region of the Ig heavy chain. The second polypeptide may comprise a hinge region, CH2 domain and CH3 domain of an Ig polypeptide. In some cases, the second polypeptide comprises an Fc domain of a WT Ig polypeptide (i.e., WT Ig Fc polypeptide) such as, for example, an Fc domain of a WT human Ig polypeptide (i.e., polypeptide of the Fc of human Ig WT). As discussed elsewhere, the Ig polypeptide can be of various species including, for example, mammal, for example, human, mouse, non-human primate (eg, monkey, gorilla), cat, dog, horse, etc., and may be of various kinds (eg, IgG, IgM, IgE, etc.) and subclasses (for example, for IgG include IgG1, IgG2, IgG4, etc.) and may comprise an Fc domain or portion of any of such Ig polypeptide. The amino acid and nucleic acid sequences of Ig polypeptides of such various species are known in the art.
Novel fusion or novel recombinant fusion proteins are disclosed herein that each comprise a mutant CTLA-4 polypeptide isolated or recombinant from the disclosed disclosed above (eg, mutant CTLA-4 ECD) covalently bound or fused, both directly and indirectly (by means of an amino acid linker sequence), at its C-terminus with the N-terminus of an Ig Fc polypeptide, that is, the Fc domain of an Ig polypeptide. Any of the disclosed fusion proteins that include monomeric and dimeric mutant CTLA-4-Ig fusion proteins of the disclosed disclosed in greater detail below and in the examples may comprise an Ig Fc polypeptide as described herein. document and elsewhere before and later. An Ig Fc polypeptide normally
it comprises the hinge region, CH2 domain and CH3 domain of the Ig polypeptide. The Ig Fc polypeptide can be derived from various species that include, for example, human, mouse, primate, etc., and can comprise a natural Ig Fc polypeptide (for example, IgG1, IgG2 or IgG4 WT). Exemplary human IgG Fc polypeptides include, for example, but are not limited to, human IgG1, human IgG2, human IgG4, etc. The exemplary human IgG1 Fc polypeptide sequence is set forth in SEQ ID NO: 185. The exemplary human IgG2 Fc polypeptide polypeptide sequences are set forth in SEQ ID NO: 184 and 218, respectively. Alternatively, the Ig Fc polypeptide may comprise a mutant Ig polypeptide. For example, a mutant IgG1 Fc in which one or more cysteine residues have been substituted with another amino acid (eg, a serine residue), thus eliminating one or more disulfide bonds formed between two Ig chains, or in the that one or more proline residues are substituted with another amino acid (e.g. proline) to reduce effector function (reduced Fc receptor binding), can be included in a mutant CTLA-4-Ig fusion protein. The polypeptide sequence of an exemplary mutant IgG1 Fc polypeptide is shown in SEQ ID NO: 186. The disclosure herein discloses an isolated or recombinant fusion protein such as a mutant CTLA-4-Ig dimer or mutant CTLA-4-Ig monomer comprising at least one recombinant mutant CTLA-4 polypeptide described above linked in its C-terminus to the N-terminus of a recombinant Ig Fc polypeptide comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99% or 100% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 184 (human IgG2 Fc polypeptide), 185 (human IgG1 Fc polypeptide), 186 (IgG1 Fc polypeptide mutant) and 218 (human IgG2 Fc polypeptide without lysine residue (K) from the C-terminus).
In one aspect, the predicted polypeptide sequence of a mutant CTLA-4-Ig fusion protein of the disclosure comprises the following segments: a signal peptide sequence that facilitates the secretion of the fusion protein (eg, hCTLA signal peptide -4 (SEQ ID NO: 182 or SEQ ID NO: 216)); a mutant CTLA-4 ECD polypeptide, mutant CTLA-4 ECD polypeptide that normally comprises, but not necessarily, about 118 to 130 amino acid residues, and usually approximately 124 amino acid residues in length; and an Ig Fc polypeptide. Exemplary mutant CTLA-4 ECD polypeptides include those described above and below. In some cases, amino acid linker sequence is not included between the C-terminus of the mutant CTLA-4 ECD polypeptide and the N-terminus of the human Ig Fc polypeptide; that is, the C-terminus of a mutant CTLA-4 ECD polypeptide is covalently fused directly with the N-terminus of the Ig Fc polypeptide in the mutant CTLA-4-Ig fusion protein. However, if desired, a mutant CTLA-4-Ig may include a linker (eg, one or more amino acid residues) between the C-terminus of the mutant CTLA-4 ECD polypeptide and the N-terminus of the Fc polypeptide. of human Ig. The signal peptide of a predicted monomeric mutant CTLA-4-Ig fusion protein of the disclosure is normally cleaved from the N-terminus of the mutant CTLA-4 Ig fusion protein during processing and, therefore, the mature or secreted form of a CTLA-4-Ig mutant protein disclosed in the disclosure does not normally include a signal peptide sequence. A fusion protein dimer comprising two such monomeric mutant CTLA-4-Ig fusion proteins is normally formed during cell processing by the creation of covalent disulfide bonds between (1) cysteine residues in the mutant CTLA-4 ECD and Fc of IgG2 of a monomeric fusion protein such and (2) cysteine residues in the ECD of mutant CTLA-4 and Fc of IgG2 of the second (usually, but not necessarily identical) monomeric fusion protein.
Dimeric fusion proteins (also called fusion protein dimer) are disclosed herein, each comprising two monomeric fusion proteins of the disclosure. The dimer may comprise two identical or different monomeric fusion proteins. The dimeric fusion protein is formed by a bond (s) between the two monomeric fusion proteins. A dimeric fusion protein comprising two such monomeric fusion proteins is normally formed during cell processing by the generation of covalent disulfide bonds between cysteine residues in a monomeric fusion protein and cysteine residues in the second monomeric fusion protein. Thus, in some cases, a mutant CTLA-4-Ig fusion protein of the disclosure is expressed as a dimer comprising two monomeric fusion proteins of the disclosure.
An isolated or recombinant dimeric mutant CTLA-4-Ig fusion protein comprising two monomeric fusion proteins is disclosed herein, each monomeric fusion protein comprising a mutant CTLA-4 ECD polypeptide of the disclosure, as described in detail above and additionally later, fused at its C-terminus with an Ig Fc polypeptide. The dimer is formed during cell processing by the generation of covalent disulfide bonds between cysteine residues in the mutant CTLA-4 ECD and Ig Fc of a monomeric fusion protein and cysteine residues in the mutant CTLA-4 ECD and Ig Fc of the second monomeric fusion protein. The two monomeric fusion proteins usually comprise, but not necessarily, identical sequences. The secreted or mature form of a mutant CTLA-4-Ig fusion protein does not include a signal peptide, since the signal peptide is normally cleaved from the N-terminus of the protein during processing. The predicted mutant CTLA-4-Ig fusion includes a signal peptide, whose C-terminus is normally covalently linked to the N-terminus of the mutant CTLA-4-Ig protein. The N-terminus of each monomer of a mature mutant CTLA-4-Ig fusion protein typically comprises a methionine (M).
Dimeric fusion proteins comprising two monomeric CTLA-4-Ig fusion proteins are disclosed herein, in which each monomeric mutant CTLA-4-Ig fusion protein comprises a mutant CTLA-4 ECD polypeptide bound in its C-terminus to the N-terminus of an Ig Fc polypeptide, wherein the mutant CTLA-4 ECD polypeptide comprises a polypeptide sequence selected from any of SEQ ID NO: 1-73. In some such dimeric fusion proteins, the two monomeric fusion proteins are covalently linked together by a covalent disulfide bond formed during cell processing between a cysteine residue at position 120 in each mutant CTLA-4 ECD polypeptide sequence. . Alternatively, or in addition, the two monomeric fusion proteins are covalently linked together by a covalent disulfide bond formed between one or more cysteine residues in the Ig Fc polypeptide of the first monomeric fusion protein and one or more cysteine residues in the Ig Fc polypeptide of the second monomeric fusion protein. Monomeric fusion proteins can be linked together by multiple disulfide bonds (for example, one, two, three, four or more disulfide bonds) formed during cell processing between cysteine residues present in their respective Ig Fc polypeptides. In some cases, each monomeric fusion protein comprises the same Ig Fc polypeptide (eg, human IgG2 Fc as shown in, for example, SEQ ID NO: 184 or 218), and covalent disulfide bond (s) ( s) can (n) be generated during cell processing between cysteine residues at equivalent positions in each Ig Fc polypeptide.
An exemplary mutant CTLA-4 ECD polypeptide is the D3-12 mutant CTLA-4 ECD polypeptide comprising the polypeptide sequence of SEQ ID NO: 11. An exemplary mutant CTLA-4-Ig fusion protein of the disclosure is the D3-12 mutant CTLA-4 ECD polypeptide covalently bound or fused directly (without linker) at its C-terminus with the N-terminus of the polypeptide of the Human IgG2 Fc shown in SEQ ID NO: 218, thus forming the D3-12-IgG2 fusion protein shown in SEQ ID NO: 205, or covalently bound or fused directly (without linker) at its C-terminus with the N-terminus of the human IgG2 Fc polypeptide shown in SEQ ID NO: 184, thus forming the D3-12-IgG2 fusion protein shown in SEQ ID No.: 74. The sequence of SEQ ID NO: 74 differs from that of SEQ ID NO: 205 by a residue - that is, an additional lysine residue is present at the C-terminus of SEQ ID NO: 74. The present inventors have experimentally found by mass spectrometry analysis with liquid chromatography (EM-CL), or the like, that a mature fusion protein CTLA-4-Ig prepared in CHO cells transfecting an expression vector comprising a nucleotide sequence encoding a mutant CTLA-4 ECD such as, for example, the D3-12 ECD polypeptide sequence shown in SEQ ID NO: 11, and the hIgG2 Fc polypeptide shown in SEQ ID NO: 184 It does not normally include the lysine residue (K) provided at the C-terminus, as would be expected based on the Fc sequence of hIgG2 shown in SEQ ID NO: 184.
For example, the nucleotide sequence of SEQ ID NO: 153 encodes the hCTLA-4 signal peptide and the D3-12-IgG2 fusion protein and includes the TAA termination codon at its C-terminus. The AAA codon, which encodes a Lysine residue, immediately precedes the TAA termination codon in the sequence of SEQ ID NO: 153. The predicted polypeptide sequence of a mature D3-12-IgG2 fusion protein produced by transfecting an expression vector comprising the nucleotide sequence of SEQ ID NO: 153 in CHO cells is shown in SEQ ID NO:
74. The signal peptide is absent in the mature form of the D3-12-IgG2 fusion protein, since it has been cleaved during processing to form the mature fusion protein. However, the present inventors have found, based on EM-CL analysis, that in such cases mature D3-12-IgG2 does not normally include the expected C-lysine residue, as would be expected based on the nucleotide sequence of SEQ ID NO: 153. Rather, the resulting mature D3-12-IgG2 polypeptide sequence produced by such a procedure is that shown in SEQ ID NO: 205. It is believed that the C-terminus lysine of the IgG2 Fc polypeptide is cleaved during processing or before of secretion
It is believed that the production of the D3-12-IgG2 protein using another mammalian cell line by transfection of such a vector comprising the nucleotide sequence of SEQ ID NO: 153 in such a mammalian cell (eg, COS cells and the like) it would produce a similar D3-12-IgG2 fusion protein that lacks the lysine residue of the C-terminus provided by analogous processing or secretion mechanism.
The dimeric D3-12-IgG2 fusion protein comprises two such D3-12-IgG2 monomers linked together by one or more disulfide bonds formed during cell processing by the generation of covalent disulfide bonds between cysteine residues. D3-12-IgG2 and other fusion proteins of the disclosure can be prepared, for example, using procedures set forth in Example 3. For example, a nucleic acid sequence encoding a D3-12 polypeptide (e.g., SEQ ID NO: 90) can be cloned into the IgG2 Fc fusion vector, mammalian cells can be transfected with the fusion vector and protein. The resulting can be expressed (usually in dimeric form), purified and evaluated as described in Example 3.
Another exemplary mutant CTLA-4 ECD polypeptide is the D354 mutant CTLA-4 ECD polypeptide comprising the polypeptide sequence of SEQ ID NO: 36, and a modem mutant CTLA-4-Ig fusion protein example, it comprises the mutant CT3-54 ECD polypeptide covalently bound or fused directly (without linker) at its C-terminus with the N-terminus of the hIgG2 Fc polypeptide shown in SEQ ID NO: 218 (without the lysine of the C-terminus), thus forming the D3-54-IgG2 fusion protein shown in SEQ ID NO: 211, or covalently bound or fused directly (without linker) at its C-terminus with the N-terminus of the Fc polypeptide of hIgG2 shown in SEQ ID NO: 184 (with the lysine of the C-terminus), thus forming the D3-54 fusion protein
IgG2 shown in SEQ ID NO: 197. As discussed above, experimental analysis indicates that mature D3-54-IgG2 fusion protein prepared in CHO cells does not normally include the expected C-terminal lysine residue. It is believed that the lysin of the C-terminus of hIgG2 Fc is cleaved during processing or prior to secretion, producing the D3-54-IgG2 fusion protein sequence shown in SEQ ID NO: 211. In addition, as noted above, D3-29-IgG2 can be prepared using methods of Example 3. The dimeric D3-54-IgG2 fusion protein comprises two D3-54-IgG2 monomers linked together by one or more disulfide bonds formed during the cellular processing by the generation of covalent disulfide bonds between cysteine residues. The nucleic acid sequence shown in SEQ ID NO: 201 encodes the fusion proteins shown in SEQ ID NO: 197 and 211.
Other fusion proteins of the disclosure may similarly comprise a mutant CTLA-4 ECD polypeptide bound or fused with hIgG2 (SEQ ID NO: 218 or 184). Mature mutant CTLA-4-IgG2 fusion proteins by way of example of the disclosure include, for example, the polypeptide sequences of each of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222. Each of the polypeptide sequences of SEQ ID NO: 74-79, 197-200, 220 and 222 includes a C-end lysine residue; This C-terminal lysine residue is normally cleaved during processing or prior to secretion, producing polypeptide sequences without the C-terminal lysine shown in SEQ ID NO: 205-210, 211-214, 219 and 221, respectively.
Figure 10 is a schematic diagram showing an exemplary configuration or structure of a mutant CTLA-4-IgG2 fusion protein by way of example of the disclosure. Two identical monomeric mutant CTLA-4-IgG2 fusion proteins are shown schematically, each comprising a mature mutant CTLA-4 ECD polypeptide covalently linked at its C-terminus with the N-terminus of a human IgG2 Fc polypeptide. Each human IgG2 polypeptide includes a hinge, CH2 domain and CH3 domain of human IgG2. Also shown are exemplary amino acid residues present at the junctions between the ECD and the Ig Fc polypeptides. The amino acid residues at the junctions between these components can be differentiated depending on the polypeptide sequence of the mutant CTLA-4 ECD and / or Ig polypeptide sequence. This dimeric mutant CTLA-4-IgG2 fusion protein results from the formation of at least one disulfide bond between cysteine residues at analogous positions in the two mutant CTLA-4-IgG2 fusion protein monomers. Cysteine residues (C) possibly involved in the formation of disulfide bonds between the two monomers are marked with asterisks. The signal peptide of each monomeric fusion protein is normally cleaved during processing and, therefore, the secreted (mature) fusion protein normally does not include the signal peptide sequence. The polypeptide sequence of the human IgG2 polypeptide, comprising the hinge, CH2 domain and CH3 domain of human IgG2, is shown in SEQ ID NO: 184. In an alternative aspect, the polypeptide sequence of the human IgG2 polypeptide, comprising the hinge, CH2 domain and CH3 domain of human IgG2, is shown in SEQ ID NO: 218; in this case, the IgG2 polypeptide does not include the lysine residue (K) of the C-terminus, with respect to the sequence of SEQ ID NO: 184.
The properties of the disclosure mutant CTLA-4-Ig fusion proteins, described in detail elsewhere, can be compared with the properties of one or more reference Ig fusion proteins such as, for example, hCTLA-4- IgG1, hCTLA-4-IgG2, Orencia® fusion protein and LEA29Y-Ig. Properties that can be compared include, for example, ability to bind to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or ability to inhibit or suppress an immune response (e.g., activation or proliferation of T lymphocytes, cytokine production, etc.). The mature hCTLA-4-IgG1 fusion protein normally exists in solution as a hCTLA-4-IgG1 fusion protein dimer comprising two identical monomeric hCTLA-4-IgG1 proteins, each monomeric hCTLA-4-IgG1 fusion protein comprising hCTLA-4 ECD polypeptide (SEQ ID NO: 159) linked to an IgG1 Fc polypeptide. The mature hCTLA-4-IgG2 fusion protein normally exists in solution as a hCTLA-4-IgG2 fusion protein dimer comprising two identical monomeric hCTLA-4-IgG2 proteins, each monomeric hCTLA-4-IgG2 fusion protein comprising ( SEQ ID NO: 162) an hCTLA-4 ECD polypeptide (SEQ ID NO: 159) linked to an IgG2 Fc polypeptide. The mature Orencia® fusion protein is a fusion protein dimer comprising two identical monomeric Orencia® fusion proteins, each monomeric fusion protein (SEQ ID NO: 164) comprising a hCTLA-4 ECD polypeptide (SEQ ID NO. : 159) linked to a specific mutant IgG1 polypeptide (SEQ ID NO: 186). The mature LEA29Y-Ig fusion protein normally exists in solution as a LEA29Y-Ig fusion protein dimer comprising two identical monomeric LEA29Y-Ig fusion proteins, each LEA29Y-Ig monomeric fusion protein comprising (SEQ ID NO: 166) a specific mutant CTLA-4 ECD polypeptide (SEQ ID NO: 168) linked to a specific mutant IgG1 polypeptide (SEQ ID NO: 186). It is believed that the two fusion protein monomers of the Orencia® dimer are covalently linked together by a single disulfide bond formed between the cysteine residue at position 120 of each mutant hCTLA-4-IgG1 monomer and that disulfide bonds are not formed between the two mutant IgG1 Fc polypeptides.
Some mutant CTLA-4 fusion proteins bind to CD80 (for example, hCD80) and / or CD86 (for example, hCD86). Some such mutant CTLA-4-Ig fusion proteins bind to a CD80-Ig fusion protein and / or a CD86-Ig fusion protein. Exemplary CD80-Ig fusion proteins include the hCD80mIg fusion protein (SEQ ID NO: 225) comprising a human CD80 ECD linked to a murine Ig Fc polypeptide; and the hCD80-hIgG1 fusion protein (SEQ ID NO: 171), which comprises the hCD80 ECD sequence linked to the human IgG1 Fc polypeptide. Exemplary CD86-Ig fusion proteins include the hCD86-mIg fusion protein (SEQ ID NO: 226), which comprises an ECD of hCD86 (SEQ ID NO: 180) linked to a Fc polypeptide of
Murine Ig; and the mature hCD86-hIgG1 fusion protein (SEQ ID NO: 178), which comprises the ECD sequence of hCD86 (SEQ ID NO: 180) linked to the human IgG1 Fc polypeptide (SEQ ID NO: 185). Exemplary nucleic acid sequences encoding hCD86-mIg and hCD80-mIg fusion proteins are shown in SEQ ID NO: 227 and 228, respectively.
An isolated or recombinant fusion protein comprising (a) a polypeptide comprising a polypeptide sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94 is disclosed herein. %, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, and (b) an Ig Fc polypeptide (eg, hIgG2 Fc), in which the fusion protein binds to CD80 and / or CD86, and / or CD80-Ig fusion protein and / or CD86-Ig, and / or has an ability to inhibit or suppress an immune response. The Ig Fc polypeptide may comprise a polypeptide sequence that has at least 95%, 96%, 97%, 98%, 99% or 100% identity with a polypeptide sequence selected from the group of SEQ ID NO: 184, 185, 186 and 218. In some cases, the C-terminus of the (a) polypeptide is covalently linked to the N-terminus of the Ig Fc polypeptide of (b). Some of such mutant CTLA-4-Ig fusion proteins bind to CD80 and / or CD86 (for example, hCD80 and / or hCD86), and / or a mammalian CD80-Ig and / or CD86-Ig fusion protein. A CD80-Ig may comprise, for example, a human CD80 ECD linked to an Ig Fc (for example, hCD80-Ig). In one embodiment, an hCD80-Ig is a human CD80 ECD linked to a human Ig Fc (hCD80-hIg); In another embodiment, an hCD80-Ig is a human CD80 ECD linked to a murine Ig Fc (hCD80-mIg). In one embodiment, an hCD86-Ig is a human CD86 ECD linked to a human Ig Fc (hCD86-hIg); In another embodiment, an hCD86-Ig is a human CD86 ECD linked to a murine Ig Fc (hCD86-mIg). Some of such fusion proteins have an ability to inhibit or suppress one or more of a variety of immune responses such as, for example, activation of T lymphocytes, proliferation of T lymphocytes, synthesis or production of cytokines (eg, production of TNF -∀, IFN- !, IL-2), induction of activation markers (eg, CD25, IL-2 receptor) or inflammatory molecules, inflammation, production of anti-collagen Ab and / or T lymphocyte-dependent Ab response (s) in assays and / or procedures in vitro and / or in vivo. Such fusion proteins are expected to be of beneficial use in a variety of applications that include procedures for treating diseases and immune system disorders (eg, autoimmune diseases), and procedures for inhibiting organ, cell or tissue graft transplantation, as discussed below.
An isolated or recombinant mutant CTLA-4-Ig fusion protein comprising two monomeric mutant CTLA-4-Ig fusion proteins linked by at least one disulfide bond formed between two cysteine residues present in each document is disclosed herein. CTLA-4-Ig monomeric mutant fusion protein. Each mutant CTLA-4-Ig fusion protein monomer comprises: (a) a mutant CTLA-4 ECD polypeptide comprising a polypeptide sequence having at least 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, and (b) an Ig Fc polypeptide (eg, hIgG2 Fc), in which the fusion protein dimer binds to CD80 and / or CD86, and / or CD80-Ig and / or CD86-Ig, and / or has an ability to inhibit or suppress an immune response. In some cases, the C-terminus of the (a) polypeptide is covalently bound or fused to the N-terminus of the Ig Fc polypeptide of (b). The Ig Fc polypeptide may comprise a polypeptide sequence that has at least 95%, 96%, 97%, 98%, 99% or 100% identity with a polypeptide sequence selected from the group consisting of SEQ ID Nº: 184-186 and 218. In some cases, the fusion protein dimer is formed by a covalent disulfide bond between a cysteine residue at amino acid position 120 of each polypeptide sequence of the mutant CTLA4 ECD, or at an amino acid position corresponding to position 120 in each polypeptide sequence of the mutant CTLA-4 ECD with respect to the hCTLA-4 ECD polypeptide sequence shown in SEQ ID NO: 159. Some of such fusion protein dimers have an ability to inhibit or suppress one or more of a variety of immune responses such as, for example, activation of T lymphocytes, proliferation of T lymphocytes, synthesis or production of cytokines (e.g., production of TNF-∀, IFN- !, IL-2), induction of activation markers (eg, CD25, IL-2 receptor) or inflammatory molecules, inflammation, production of anti-collagen Ab and / or T-lymphocyte-dependent Ab response (s) in assays and / or procedures in vitro and / or in vivo. Such fusion protein dimers are expected to be of beneficial use in a variety of applications that include procedures for treating diseases and immune system disorders (eg, autoimmune diseases) and procedures for inhibiting organ, cell or tissue graft transplantation, as discussed below.
Some of such mutant CTLA-4-Ig fusion protein monomers have binding affinities for hCD86 or ECD of hCD86 that are at least equal to or greater than those of ECD of hCTLA-4 and LEA29 for hCD86 or ECD of hCD86, respectively. See, for example, Table 5 in Example 4. The mutant CTLA-4 ECD polypeptide present in some such dimeric and monomeric fusion proteins comprises a polypeptide sequence having an amino acid length approximately equal to the amino acid length of the hCTLA-4 ECD. For example, some of such mutant CTLA-4 ECD polypeptides comprise a polypeptide sequence having approximately 110 to 138, 112 to 136, 114 to 134, 116 to 132, 118 to 130, 119 to 129, 120 to 128, 121 to 127, 122 to 126 or 123 to 125 amino acid residues in length. Some of such mutant CTLA-4 ECD polypeptides comprise a sequence of 124 amino acid residues. Exemplary mutant CTLA-4 ECD polypeptides include, for example, but are not limited to, those comprising a sequence of
polypeptides having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, in which such a mutant CTLA-4 ECD polypeptide binds to CD80 and / or CD86 (or an ECD of either or both), and / or has an ability to inhibit an immune response.
Some of such mutant CTLA-4-Ig fusion protein dimers have a hunger for hCD86 and / or hCD86-Ig that is at least about equal to or greater than the avidity of hCTLA-4 fusion protein dimer -Ig (for example, dimer hCTLA-4-IgG2 or hCTLA-4-IgG1), dimer Orencia® and / or dimer LEA29Y-Ig for hCD86 and / or hCD86-Ig, respectively. Some of such fusion protein dimers have a hunger for hCD86 and / or hCD86-mIg which is 2-10 times (2x-10x), 5-10 times (5x-10x), 10-20 times (10x- 20x), 20-40 times (20x-40x) or more than 40 times (> 40x) greater than the avidity of binding of the Orencia® dimer by hCD86 and / or hCD86-mlg. See, for example, dimeric fusion proteins as an example of the disclosure in Table 3 below. Alternatively or additionally, some such fusion protein dimers have a hunger for hCD80 and / or hCD80-Ig that is at least about equal to or greater than the hunger for binding of an hCTLA-4-Ig dimer (for example, hCTLA-4-IgG2 dimer or hCTLA-4-IgG1), Orencia® dimer and / or LEA29Y-Ig dimer by hCD80 and / or hCD80-Ig, respectively. Some of such fusion protein dimers have a hunger for hCD80 and / or hCD80-mIg which is 0.5-2 times (0.5x-2x), 2-4 times (2x-4x) or greater than 2 times (> 2x) greater than the avidity of binding of the Orencia® dimer by hCD86 and / or hCD86-mIg. See, for example, dimeric fusion proteins as an example of the disclosure in Table 4 below.
Some of such mutant CTLA-4-Ig fusion protein dimers dissociate from binding to hCD86 and / or hCD86-Ig at a rate that is less than the rate at which an hCTLA-4-Ig dimer (for example, hCTLA-4-IgG2 dimer or hCTLA-4-IgG1), Orencia® dimer and / or LEA29Y-Ig dimer dissociates from binding to hCD86 and / or hCD86-Ig, respectively. Some such fusion proteins are associated with or bind to hCD86 and / or hCD86-Ig at a rate that is at least equal to or greater than the rate at which an hCTLA-4-Ig dimer (for example, hCTLA- dimer) 4-IgG2 or hCTLA-4-IgG1), Orencia® dimer and / or LEA29Y-Ig dimer is associated with hCD86 and / or hCD86-Ig, respectively. For some of such fusion protein dimers, the equilibrium dissociation constant (KD) for the binding reaction between CD86 (or CD86-Ig) and the fusion protein dimer of the invention is less than the dissociation constant in equilibrium (KD) for the binding reaction between CD86 (or CD86-Ig) and an hCTLA-4-Ig dimer (for example, hCTLA-4-IgG2 dimer or hCTLA-4-IgG1), Orencia® dimer and / or dimer LEA29Y-Ig. See, for example, fusion protein dimers as an example of the disclosure in Table 3. For some of such fusion protein dimers, the equilibrium dissociation constant (KD) for the binding reaction between CD80 (or CD80-Ig) and the fusion protein dimer of the disclosure is approximately equal to or less than the constant equilibrium dissociation (KD) for the binding reaction between CD80 (or CD80-Ig) and an hCTLA-4-Ig dimer (for example, hCTLA-4-IgG2 or hCTLA-4-IgG1 dimer), Orencia® dimer or dimer LEA29Y-Ig. See, for example, fusion protein dimers as an example of the disclosure in Table 4.
Some of such mutant CTLA-4-Ig fusion protein dimers have an ability to inhibit or suppress an immune response (for example, inhibit activation or proliferation of T lymphocytes, inhibit cytokine production, etc.) which is at least approximately equal to or greater than the ability of an hCTLA-4-Ig dimer (eg, hCTLA-4-IgG2 or hCTLA-4-IgG1 dimer), Orencia® dimer and / or LEA29Y-Ig dimer to inhibit or suppress said immune response respectively. For example, some of such fusion protein dimers can inhibit T lymphocyte activation or T lymphocyte proliferation in in vitro assays. Examples 4-9 set forth below, for example, demonstrate the ability of fusion protein dimers representative of the disclosure comprising a representative mutant CTLA-4 ECD polypeptide sequence to inhibit proliferation of T lymphocytes in vitro. Some of such dimers can inhibit or suppress an immune response in a subject in vivo, such as by administering a therapeutically or prophylactically effective amount of at least one such dimer to a subject in need of immunosuppressive therapy. Some of such fusion protein dimers are expected to be useful in a variety of applications that include, for example, but are not limited to prophylactic and / or therapeutic procedures for inhibiting or suppressing an immune response in a subject suffering from a disease. or immune system disorder in which immunosuppression (eg, autoimmune diseases) is desired and procedures to inhibit rejection of a tissue transplant, cell or organ of a donor by a recipient.
Some of these dimers have varied capabilities to modulate or suppress signaling by CD28, since they have different comparative avidities for CD80 and CD86. Such dimers are useful in applications where differential manipulation of T-lymphocyte responses that include therapeutic and prophylactic procedures for treating diseases and immune system disorders such as, for example, diseases and immunodeficiency disorders (e.g., AR, MS, psoriasis, etc.). Example 4 shows exemplary dimeric fusion proteins comprising polypeptides of the disclosure having some of the differential avidities for CD80 / CD86 described above and immunoinhibitory properties.
Some of such mutants of mutant CTLA-4-Ig have an ability to suppress or inhibit an immune response that is at least about equal to or greater than the ability of the hCTLA-4 protein or an hCTLA-4-Ig dimer to suppress or inhibit one or more types of immune responses. For example, some such dimers have an ability to inhibit the activation or proliferation of T lymphocytes in assays and / or in vitro and / or in vivo applications, such as those described above and below, which is at least about
equal to or greater than the ability of the hCTLA-4 protein or an hCTLA-4-Ig dimer (eg, Orencia®, hCTLA-4-IgG2 dimer or hCTLA-4-IgG1 dimer) to inhibit T lymphocyte activation or proliferation In such applications. Additionally, some of such dimers have an ability to inhibit or suppress an immune response (eg, activation or proliferation of T lymphocytes, cytokine production, antibody response dependent on T lymphocytes) that is greater than the capacity of a LEA29Y- dimer. Ig to inhibit or suppress an immune response. Examples 4-9, for example, compare the ability of representative dimeric fusion proteins of the disclosure comprising a mutant CTLA-4 ECD polypeptide sequence of the disclosure to inhibit proliferation of T lymphocytes in vitro with respect to ability of dimeric hCTLA-4-IgG2, Orencia® and LEAY29-Ig to inhibit proliferation of T lymphocytes in vitro. See, for example, Tables 6-9 below. Some of such dimers have both an ability to bind hCD80 and / or hCD86 (or hCD80-Ig and / or hCD86-Ig) as well as an ability to inhibit or suppress an immune response in in vitro and / or in vitro assays and / or applications. in vivo, such as those described above and in greater detail below (for example, an in vivo method in which a therapeutically or prophylactically effective amount of at least one such dimer is administered). Some of such dimers have a hunger for hCD80 and / or hCD86 (or hCD80-Ig and / or hCD86-Ig) that is at least about equal to or greater than the hunger for binding of the hCTLA-4 protein, an hCTLA- Dimeric 4-Ig (for example, hCTLA-4-IgG2, Orencia®) or dimeric LEA29Y-Ig by hCD80 and / or hCD86 (or hCD80-Ig and / or hCD86-Ig), respectively, and an ability to inhibit a response immune that is at least equal to or greater than the capacity of the hCTLA-4 protein, a dimeric hCTLA-4-Ig (eg, hCTLA-4-IgG2, Orencia®) or dimeric LEA29Y-Ig to inhibit an immune response. Such mutant CTLA-4-Ig fusion protein dimers are expected to be useful in a variety of applications including, for example, prophylactic and / or therapeutic procedures for treating diseases, disorders and conditions of the immune system, as it is treated in greater detail later.
A dimer of isolated or recombinant fusion proteins (for example, mutant CTLA-4-Ig fusion protein dimer) comprising two identical monomeric fusion proteins (for example, two CTLA-4 fusion proteins) is disclosed herein. -Ig monomeric mutants), wherein each such monomeric fusion protein comprises a polypeptide sequence having at least 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93 %, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5% or 100% identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222, in which dimer binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig, such as hCD80-mIg and / or hCD86-mIg, respectively), and / or has a capacity to inhibit a immune response, including those described above and additionally below. Each of the polypeptide sequences set forth in SEQ ID NO: 74-79, 197-200, 205-214 and 219-222 is a mature mutant CTLA-4 ECD fused at its C-terminus with the N-terminus of a polypeptide of the IgG2 Fc, and each such sequence can be called a mutant CTLA-4-Ig fusion protein. The polypeptide sequence of each of SEQ ID NO: 74-79, 197-200, 220 and 222 is identical to SEQ ID NO: 205-214, 219 and 221, except that each of SEQ ID NO: 74-79 , 197-200, 220 and 222 includes a lysine at the C end.
An isolated or recombinant fusion protein monomer is disclosed herein comprising a polypeptide sequence having at least 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99% , 99.5% or 100% identity with a polypeptide sequence comprising amino acid residues 1-351 of any of SEQ ID NO: 7479, 197-200, 205-214 and 219-222, in which the fusion protein binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig, such as hCD80-mIg and / or hCD86-mIg, respectively), and / or has an ability to inhibit an immune response, including those described above and further below.
A dimer of isolated or recombinant fusion proteins comprising two identical monomeric fusion proteins is disclosed herein, in which each such monomeric fusion protein comprises a polypeptide sequence having at least 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a polypeptide sequence comprising amino acid residues 1-351 of any of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222, wherein said protein fusion protein dimer binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig, such as hCD80-mIg and / or hCD86-mIg, respectively), and / or has an ability to inhibit an immune response, including those described above and additionally below.
A mutant monomeric CTLA-4-Ig fusion protein comprising a polypeptide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 is disclosed herein. %, 98%, 99% or 100% identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222, wherein said monomeric fusion protein binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig, such as hCD80- mIg and / or hCD86-mIg, respectively), and / or has an ability to inhibit an immune response. Some of such monomers and dimers of fusion proteins have an ability to inhibit or suppress one or more immune responses that include, for example, activation or proliferation of T lymphocytes, synthesis or production of cytokines (eg, production of TNF-∀, IFN- !, IL-2), induction of activation markers (eg, CD25, IL-2 receptor), inflammation, production of anti-collagen Ab and / or T-lymphocyte-dependent Ab response (s) in assays and / or procedures in vitro and / or in vivo (for example, in vivo in a subject suffering from a disease, disorder or condition in which immunosuppressive therapy would be beneficial and to which
a therapeutically effective amount of such dimeric fusion protein is administered as discussed in greater detail below.) It is expected that such fusion protein monomers and dimers will be useful in a variety of applications that include therapeutic and / or prophylactic procedures for treating immune system diseases that include those discussed below.
A dimer of isolated or recombinant fusion proteins (for example, mutant CTLA-4-Ig fusion protein dimer) comprising two monomeric fusion proteins (for example, CTLA-4-Ig fusion protein) is disclosed herein. monomeric mutant), wherein each such monomeric fusion protein comprises: (1) a polypeptide (for example, mutant CTLA-4 extracellular domain polypeptide) comprising a polypeptide sequence that differs from a polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73 in no more than 6 amino acid residues (for example, no more than 1, 2, 3, 4, 5 or 6 amino acid residues), and in which the amino acid residue in the polypeptide sequence in the position 41, 50, 54, 55, 56, 64, 65, 70 or 85 is identical to the amino acid residue at the corresponding position of said selected polypeptide sequence (for example, a polypeptide selected from SEQ ID NO: 1-73), and (2) an Ig Fc polypeptide (eg, IgG2 Fc), in which the fusion protein dimer binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or inhibits an immune response (eg, activation or proliferation of T lymphocytes, cytokine production, induction of activation markers or inflammatory molecules, production of anti-collagen Ab, lymphocyte-dependent Ab responses T, etc.) in tests and / or in vitro and / or in vivo procedures as discussed in detail below. An isolated or recombinant monomeric fusion protein is disclosed herein as described above that binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig) and / or induces an immune response in In vitro or in vivo. In the fusion protein dimer, the two monomeric fusion proteins (eg, mutant CTLA-4-Ig monomer) are optionally covalently linked together by one or more disulfide bonds by cysteine residues in each monomer, and the two monomers They are normally identical to each other. In some cases, the mutant CTLA-4 ECD polypeptide in such a dimer or fusion protein monomer differs from the selected polypeptide (eg, selected from SEQ ID NO: 1-73) in no more than 6 amino acid residues, but the amino acid occupying position 41, 50, 54, 55, 56, 64, 65, 70 or 85 is identical to the amino acid residue included in that position in the selected polypeptide sequence; that is, an amino acid residue in such a position cannot be deleted or substituted. Some of such mutant CTLA-4 ECD polypeptides in such a fusion protein comprise a polypeptide sequence that differs from the selected polypeptide sequence in no more than 6 amino acid residues and that includes amino acid residues at positions 24, 30, 32, 41, 50, 54, 55, 56, 64, 65, 70, 85, 104 and 106 that are identical to amino acid residues at corresponding positions in the selected polypeptide sequence. Such mutant CTLA-4 ECD polypeptide can be differentiated from the polypeptide sequence selected by deletion (deletions) of amino acids, addition (additions) and / or substitution (substitutions) of amino acids. An amino acid substitution may be a conservative or non-conservative substitution. See, for example, the section "Sequence variation". Some such dimeric fusion proteins have a hunger for hCD86 or hCD86-Ig that is at least about equal to or greater than the hunger for binding of hCTLA-4, dimeric hCTLA-4-Ig, dimeric LEA29Y-Ig or Orencia protein ® by hCD86 or hCD86-Ig, respectively. Some such monomeric fusion proteins have an affinity or binding avidity for hCD86, hCD86-Ig or ECD of hCD86 that is at least about equal to or greater than the affinity or binding avidity of monomeric hCTLA-4, hCTLA-4-Ig monomeric or LEA29Y-Ig monomeric by hCD86, hCD86-Ig
or ECD of hCD86, respectively. Alternatively or additionally, some such dimeric fusion proteins have a hunger for hCD80 or hCD80-Ig that is at least about equal to or greater than the hunger for hCTLA-4 or hCTLA-4-Ig for hCD80, respectively. Alternatively or additionally, some such monomeric fusion proteins have an affinity or binding avidity for hCD80, hCD80-Ig or ECD of hCD80 that is at least about equal to or greater than the affinity or binding avidity of monomeric hCTLA-4 or hCTLA -4-Ig monomeric by hCD80, hCD80-Ig, or ECD of hCD80, respectively. In some cases, the mutant CTLA-4 ECD polypeptide in such a fusion protein dimer or monomer comprises a sequence of polypeptides having a length approximately equal to the amino acid length of the hCTLA-4 ECD, for example, approximately 118-130, 119-129, 120-128, 121-127, 122-126, 123-125 or 124 amino acid residues in length. The N-terminus of the Ig Fc polypeptide (e.g., Fc of IgG2, Fc of IgG1, Fc of IgG4, or a mutant IgG Fc that reduces effector function or receptor binding of Fc) can be ligated or covalently fused directly or indirectly (by means of a linker comprising, for example, 1-10 amino acid residues) with the C-terminus of the mutant CTLA-4 ECD polypeptide. The Ig Fc polypeptide may comprise a polypeptide sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 184-186 and 218, for example, any of SEQ ID NO: 184, 185, 186 and 218.
Some of such dimers and mutant CTLA-4-Ig fusion protein monomers can suppress one or more of a variety of immune responses that include, for example, activation of T lymphocytes, proliferation of T lymphocytes, synthesis or production of cytokines (by eg, production of TNF-∀, IFN- !, IL-2), induction of activation markers (eg, CD25, IL-2 receptor) or inflammatory molecules, inflammation, production of anti-collagen Ab and / or T lymphocyte-dependent Ab response (s). Some of such mutants of mutant CTLA-4-Ig have a greater ability to inhibit one or more such immune responses than hCTLA- 4, dimeric hCTLA4-Ig or dimeric LEA29Y-Ig. Examples 4-9, for example, provide data comparing the capacity of dimeric fusion proteins representative of the disclosure comprising an ECD polypeptide of
CTLA-4 mutant of the invention to inhibit the proliferation of T lymphocytes in vitro with respect to the ability of a dimeric hCTLA-4-Ig or dimeric LEA29Y-Ig to do so. Some of such mutant CTLA-4-Ig monomers have a greater ability to inhibit one or more such immune responses than monomeric hCTLA-4, monomeric hCTLA-4-Ig or monomeric LEA29Y-Ig. Some of such monomers and dimers can inhibit or suppress an immune response in a subject in vivo, such as by administering a therapeutically or prophylactically effective amount of at least one such polypeptide to a subject in need of immunosuppressive therapy. Such fusion proteins are expected to be of beneficial use in a variety of applications that include procedures for treating a disease, disorder or condition in which immunosuppressive therapy would be of benefit, such as prophylactic and / or therapeutic procedures for treating diseases and disorders. autoimmune, and procedures to inhibit organ, cell or tissue graft transplantation.
A dimer of isolated or recombinant proteins (for example, mutant CTLA-4-Ig fusion protein dimer) comprising two monomeric fusion proteins (for example, two mutant CTLA-4-Ig fusion proteins) is disclosed herein. monomeric), wherein each such monomeric fusion protein comprises: (1) a mutant CTLA-4 extracellular domain (ECD) polypeptide comprising a polypeptide sequence that (a) differs from a polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73 in no more than 6 amino acid residues (for example, no more than 1, 2, 3, 4, 5 or 6 amino acid residues), and (b) it comprises at least one amino acid substitution at an amino acid position corresponding to position 50, 54, 55, 56, 64, 65, 70 or 85 with respect to the polypeptide sequence of SEQ ID NO: 159; and (2) an Ig Fc polypeptide, in which the fusion protein dimer binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or inhibits an immune response (for example, activation or proliferation of T lymphocytes, cytokine production, induction of activation markers, inflammation, production of anti-collagen antibodies, antibody response dependent on T lymphocytes, etc.) in in vitro assays and / or procedures and / or in vivo as described in greater detail below. An isolated or recombinant monomeric fusion protein is also disclosed herein, as described above, which binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig) and / or induces a immune response in vitro or in vivo. In some cases, CD80 is hCD80 and CD86 is hCD86. In the fusion protein dimer, the two monomeric fusion proteins (eg, mutant CTLA-4-Ig monomer) are optionally covalently linked together by one or more disulfide bonds by cysteine residues in each monomer, and the two monomers They are normally identical to each other. The N-terminus of the Ig Fc polypeptide (e.g., Fc of IgG2, Fc of IgG1, Fc of IgG4 or a mutant IgG Fc that reduces effector function or receptor binding of Fc) can be covalently ligated or fused directly or indirectly. (by means of a linker comprising, for example, 1-10 amino acid residues) with the C-terminus of the mutant CTLA-4 ECD polypeptide. The Ig Fc polypeptide may comprise a polypeptide sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 184-186 and 218.
Some of such fusion protein dimers or monomers comprise a mutant CTLA-4 ECD polypeptide comprising a sequence of polypeptides having a length approximately equal to the amino acid length of the hCTLA-4 ECD, for example, 118-130 , 119-129, 120-128, 121-127, 122-126 or 123-125 amino acid residues in length. Some of such mutant CTLA-4 ECD polypeptides in such a dimer or fusion protein monomer comprise a polypeptide sequence that is 124 amino acid residues in length. Some of such mutant CTLA-4 ECD polypeptides comprise 2, 3, 4, 5 or 6 amino acid substitutions at positions relative to the sequence set forth in SEQ ID NO: 159 selected from the group consisting of position 50, 54 , 55, 56, 64, 65, 70 and 85. Some of such mutant CTLA-4 ECD polypeptides further comprise an amino acid substitution at a position corresponding to position 104 and / or 30 with respect to SEQ ID NO: 159. Some of such mutant CTLA-4 ECD polypeptides comprise at least one amino acid substitution with respect to SEQ ID NO: 159 at position 70 (optionally S70F), position 64 (optionally S64P), position 50 (optionally A50M), position 54 (optionally M54K / V, for example, M54K), position 65 (optionally I65S), position 56 (optionally N56D), position 55 (optionally G55E), position 85 (optionally M85A) and / or position 24 (optionally A24E / S , for example, A24E). Any such mutant CTLA-4 ECD polypeptide may further comprise an amino acid substitution with respect to SEQ ID NO: 159 at position 104 (optionally L104E / D, for example, L104E), position 30 (optionally T30N / D / A , for example, T30N, T30D or T30A) and / or position 32 (optionally V32I). Some of such mutant CTLA-4 ECD polypeptides comprise at least one substitution at an amino acid position with respect to SEQ ID NO: 159 selected from the group consisting of A50M, M54K, G55E, N56D, S64P, I65S and S70F. Some of such mutant CTLA-4 ECD polypeptides comprise 2, 3, 4, 5 or 6 substitutions at amino acid positions with respect to SEQ ID NO: 159 selected from the group consisting of A50M, M54K, G55E, N56D, S64P , I65S and S70F.
Some such dimers of mutant CTLA-4-Ig have a binding avidity for CD86 (for example, hCD86) or dimeric CD86-Ig (for example, hCD86-Ig) that is approximately equal to or greater than the binding avidity of the hCTLA-4 protein, dimeric hCTLA-4-Ig (for example, CTLA-4-IgG1 or CTLA-4-IgG2), Orencia® protein or LEA29Y-Ig dimeric by CD86 or dimeric CD86-Ig, respectively. Some of such dimers have a binding avidity for CD80 (for example, hCD80) or dimeric CD80-Ig (for example, hCD80-Ig) that is greater than the binding avidity for hCTLA-4, a dimeric hCTLA-4-Ig , Orencia® protein and / or LEAY29-Ig dimeric by CD80 or CD80-Ig dimeric, respectively.
Some of such mutant CTLA-4-Ig monomers exhibit a binding affinity or avidity for CD86 (eg, hCD86) or CD86-Ig (for example, hCD86-Ig) that is approximately equal to or greater than the affinity or avidity of binding of monomeric hCTLA-4, monomeric hCTLA-4-Ig or monomeric LEA29Y-Ig by CD86 or CD86-Ig, respectively. Some of such monomers have a binding affinity or avidity for CD80 (for example, hCD80) or CD80-Ig (for example, hCD80-Ig) that is greater than the binding affinity or avidity of monomeric hCTLA-4 or hCTLA-4 - Monomeric Ig (for example, CTLA-4-IgG1 or CTLA-4-IgG2 monomer) by CD80 or CD80-Ig dimer, respectively.
Some such dimers and monomers of mutant CTLA-4-Ig have an ability to suppress or inhibit one or more immune responses that include those described above and throughout this document (eg, activation or proliferation of T lymphocytes, cytokine production , induction of activation markers, inflammation, production of anti-collagen antibodies, antibody responses dependent on T lymphocytes), in trials and / or procedures in vitro and / or in vivo (for example, in vivo in a subject suffering from a disease, disorder or condition in which immunosuppressive therapy would be of benefit and to which a therapeutically effective amount of at least a mutant CTLA-4-Ig dimer such). Some such dimers of mutant CTLA-4-Ig inhibit one or more such immune responses to a greater degree than hCTLA-4, a dimeric hCTLA-4-Ig (for example, CTLA-4-IgG1 or CTLA-4-IgG2 dimeric), Orencia® protein and / or dimeric LEAY29-Ig. Some of such mutant CTLA-4-Ig monomers inhibit one or more such immune responses to a greater degree than monomeric hCTLA-4, monomeric hCTLA-4-Ig and / or monomeric LEAY29-Ig. Such dimers and mutant CTLA-4-Ig monomers are expected to be of beneficial use in a variety of applications including procedures for treating autoimmune diseases and disorders, and procedures for inhibiting organ, cell or tissue graft transplantation.
Any such dimer or monomeric mutant CTLA-4-Ig fusion protein dimer or monomer described above may additionally include a peptide that facilitates the secretion of the fusion protein from a host cell. The peptide is optionally a signal peptide. The C-terminus of the signal peptide is normally covalently linked to the N-terminus of a fusion protein. The signal peptide may comprise an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with The amino acid sequence of SEQ ID NO: 182 or SEQ ID NO: 216. The signal peptide may comprise an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98%, 99% or 100% identity with an amino acid sequence comprising amino acid residues 1-35, 1-36 or 1-37 of SEQ ID NO: 160. In addition, as discussed below, any such monomeric or dimeric mutant CTLA-4-Ig fusion protein described above may comprise one or more of the amino acid residues that are glycosylated or pegylated.
This document also discloses a mature / secreted mutant CTLA-4-IgG2 fusion protein that is 352 amino acids in length and comprises a mutant CTLA-4 ECD polypeptide comprising 124 amino acid residues and an IgG2 Fc polypeptide. human comprising 228 amino acid residues. Exemplary polypeptides of the mutant CTLA-4 ECD include those polypeptides comprising sequences identified by any of SEQ ID NO: 1-73. Exemplary mutant CTLA-4-IgG2 fusion proteins include those comprising a polypeptide sequence identified by any of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222. If desired, the amino acids of a mature mutant CTLA-4-IgG2 fusion protein may be listed starting with the first mutant CTLA-4-IgG2 amino acid residue (ie, the first mutant CTLA-4 ECD polypeptide residue ). In some aspects, the first residue of the mutant CTLA-4-IgG2 fusion protein (or mutant CTLA-4 ECD) is methionine and, therefore, the amino acid numbering of the mutant CTLA-4-IgG2 fusion protein ( or ECD of mutant CTLA-4) would start with methionine (designated amino acid residue 1).
Also disclosed herein are isolated or recombinant multimeric fusion proteins comprising two or more mutant CTLA-4-Ig fusion proteins described above. In some cases, the multimer is a fusion protein dimer comprising two mutant CTLA-4-Ig fusion proteins, which can be identical fusion proteins (i.e. homodimers) or different fusion proteins (i.e., heterodimers) . In some cases, the multimer is a tetrameric fusion protein comprising four mutant CTLA-4 ECD polypeptides of the disclosure. The tetramer may comprise four identical polypeptides of the mutant CTLA-4 ECD (ie, homotetramer) or any combination of four polypeptides of the mutant CTLA-4 ECD of the disclosure such that the four mutant CTLA-4 ECD polypeptides do not are identical (i.e. heterotetramer). Some of such multimers bind to CD80 and / CD86 (and / or hCD80-Ig and / or hCD86-Ig) and / or suppress or inhibit an immune response.
Soluble forms of any of the polypeptides, fusion proteins and multimers described above are disclosed herein. Soluble forms of the conjugate described below are also included. Soluble molecules of the disclosure - for example, soluble polypeptides, dimeric fusion proteins, monomeric fusion proteins, multimers and conjugates of the disclosure - are not bound or bound to a cell. Some of such soluble molecules may be in solution or may circulate, for example, in a liquid (for example, in a body of the subject). A signal peptide can normally be used to facilitate the secretion of such a molecule, but the signal peptide is cleaved during the secretion of the molecule from a host cell. Therefore, in most cases, a soluble molecule, such as a soluble polypeptide, dimeric fusion protein, fusion protein
monomeric or multimeric, does not include a signal peptide. As discussed above, a mutant CTLA-4 extracellular domain polypeptide of the disclosure can be linked to an Ig molecule that includes, for example, a part of an Ig polypeptide such as, for example, a Fc polypeptide of Ig that produces a soluble fusion protein. Thus, soluble mutant CTLA-4-Ig fusion proteins are disclosed herein comprising any mutant CTLA-4 ECD polypeptide as described herein fused to or linked to at least a portion of an Ig polypeptide. such as, for example, a natural Ig Fc (eg, human IgG2 Fc) or mutant Ig Fc polypeptide. Such soluble mutant CTLA-4-Ig fusion proteins may be monomeric or dimeric fusion proteins and include those mutant CTLA-4-Ig fusion protein monomers and dimers described in detail above and elsewhere, including the examples below. . As described in detail above and elsewhere herein, some such soluble monomeric and dimeric fusion proteins may have an ability to bind to CD80 and / or CD86 and / or an ability to suppress or inhibit an immune response ( for example, activation or proliferation of T lymphocytes) in in vitro and / or in vivo applications.
Such soluble molecules of the disclosure are expected to be of particular benefit in a variety of applications including, for example, therapeutic and prophylactic procedures for treating diseases and disorders of the immune system (eg, autoimmune diseases) and prophylactic and therapeutic procedures for inhibiting cell, organ or tissue graft transplant. Soluble disclosure molecules - for example, soluble recombinant mutant CTLA-4 ECD polypeptides, monomeric and dimeric mutant CTLA-4-Ig fusion proteins, mutant CTLA-4 ECD conjugates, mutant CTLA-4-Ig conjugates , multimers comprising mutant CTLA-4 or mutant CTLA-4-Ig ECD polypeptides, multimers comprising mutant CTLA-4 conjugates or mutant CTLA-4-Ig conjugates of the disclosure - which bind to CD80 and / or CD86, when administered to a subject in a therapeutically or prophylactically effective amount, they inhibit the interaction between endogenous CD80 and / or CD86 and endogenous CD28, thereby suppressing in the subject an immune system response or immune system attack on tissues, organs and / or healthy body cells of the subject. In cases where a subject is the recipient of tissues, organs and / or cells of a donor's healthy body (for example, such as when the recipient has received a tissue graft or transplant of a donor's cell or organ) , such soluble molecules inhibit the interaction between endogenous CD80 and / or CD86 and endogenous CD28, thus inhibiting a harmful response or attack by the subject's immune system in tissues, healthy body organs or cells donated to the subject by the donor. By suppressing an immune system response or attack on healthy body tissues, side effects (for example, pain, inflammation of joints, etc.) associated with such response or attack of the immune system on healthy tissues, organs or cells in the subject can be reduced. , and the injury resulting from such response or attack can be delayed or prevented.
Methods for measuring affinities and binding avidities of polypeptides of the invention described above including, for example, mutant CTLA-4 ECD polypeptides, dimeric and monomeric and multimeric mutant CTLA-4-Ig fusion proteins would be known for those skilled in the art and include, for example, but are not limited to, Biacore ™ technology (GE Healthcare), isothermal titration microcalorimetry (MicroCal LLC, Northampton, MA), ELISA, phage expression procedures for binding affinity and FACS procedures. Biacore procedures are described in detail in Example 4 below. FACS or other classification procedures are described in greater detail above and elsewhere in this document. Methods for measuring avidity of polypeptide binding of the disclosure by hCD80 and / or hCD86 by phage ELISA are described in Example 2 below.
Methods for detecting and measuring T-cell responses induced by molecules of the disclosure (including, for example, mutant CTLA-4 ECD polypeptides, dimeric and monomeric and multimeric mutant CTLA-4-Ig fusion proteins of the invention) are well known to those skilled in the art. T lymphocyte activation is commonly characterized by physiological events that include, for example, synthesis of cytokines associated with T lymphocytes (eg, production of IFN-!) And induction of activation markers (eg, CD25, IL-receptor two). CD4 + T lymphocytes recognize their immunogenic peptides in the context of MHC class II molecules, while CD8 + T lymphocytes recognize their immunogenic peptides in the context of MHC class I molecules. Exemplary procedures for evaluating and measuring the ability of molecules of the disclosure described above to inhibit or suppress T lymphocyte activation and / or T lymphocyte proliferation or to block signaling by CD86 and / or CD80 are described in the Examples. 5-8 and elsewhere in this document.
The polypeptides, monomeric and dimeric fusion proteins and multimers of the disclosure that include those discussed above optionally further comprise an additional amino acid such as a methionine, added to the N-terminus and / or a peptide tag for purification or identification. The polypeptides of the disclosure including those discussed above optionally further comprise a polypeptide purification sub-sequence such as, for example, a sub-sequence that is selected from an epitope tag, a FLAG tag, a polyhistidine sequence and a GST fusion.
In addition, as discussed in greater detail below, the disclosure includes isolated, recombinant or synthetic nucleic acids encoding all polypeptides, fusion proteins and multimers of the disclosure described above and in further detail below.
Sequence identity
As discussed above, an isolated or recombinant polypeptide comprising a polypeptide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92 is disclosed herein. %, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, wherein the polypeptide binds to CD80 or CD86 or an extracellular domain of any and / or has an ability to suppress or inhibit an immune response. An isolated or recombinant nucleic acid comprising a polynucleotide sequence encoding a polypeptide comprising a polypeptide sequence having at least 75%, 80%, 85%, 86%, 87%, 88 is also described below. %, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence identity with at least a polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, in which the polypeptide has an ability to bind to CD80 and / or CD86 and / or an ECD thereof, and / or has an ability to suppress an immune response, or a complementary polynucleotide sequence thereof.
The degree to which one sequence (polypeptide or nucleic acid) is similar to another provides an indication of similar structural and functional properties for the two sequences. Accordingly, in the context of the present disclosure, sequences that have a sequence similar to any given example sequence are a feature of the present disclosure. Sequences that have percent sequence identities as defined below are a feature of the disclosure. . A variety of procedures for determining sequence relationships including manual alignment and computer-assisted sequence alignment and analysis can be used. A variety of computer programs are available for sequence alignment, or they can be produced by an expert.
As noted above, the nucleic acid and polypeptide sequences employed in the subject invention need not be identical, but may be substantially identical to the corresponding sequence of a nucleic acid of the invention or polypeptide of the invention, respectively. For example, the polypeptides of the invention may undergo various changes such as one or more insertions, deletions and / or amino acid substitutions, both conservative and non-conservative, including in which, for example, such changes could provide certain advantages in their use as in its therapeutic or prophylactic use or administration or diagnostic application. The nucleic acids of the invention can also undergo various changes such as one or more substitutions of one or more nucleic acids in one or more codons so that a particular codon encodes the same amino acid or a different amino acid, producing both a silent variation ( for example, the mutation in a nucleotide sequence produces a silent mutation in the amino acid sequence, for example, when the encoded amino acid is not altered by the mutation of the nucleic acid) or non-silent variation, one or more deletions of one or more nucleic acids (or codons) in the sequence, one or more additions
<dl><dt /><dd>or insertions of one or more nucleic acids (or codons) in the sequence, cleavage of one or more truncations of one or more nucleic acids (or codons) in the sequence. Nucleic acids can also be modified to include one or more codons that provide optimal expression in an expression system (eg, bacterial or mammalian), while, if desired, said one or more codons still encode the same amino acid (s). Such nucleic acid changes could provide certain advantages in their therapeutic or prophylactic use or administration or diagnostic application. Nucleic acids and polypeptides can be modified in several ways, as long as they comprise a substantially identical sequence (as defined below) to a sequence in a respective nucleic acid or polypeptide of the invention.</dd></dl>
The term "identical" or "identity", in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences that are the same or have a specified percentage of amino acid residues.
<dl><dt /><dd>or nucleotides that are the same when compared and aligned for maximum similarity, as determined using the sequence comparison algorithm described below or by visual inspection. The "percent sequence identity" ("% identity") of an object sequence with a reference sequence (ie, query) means that the object sequence is identical (ie, it is an amino acid per amino acid base for a polypeptide sequence, or a nucleotide nucleotide base for a polynucleotide sequence) by a percentage specified with the query sequence with respect to a comparison length.</dd></dl>
The percentage of sequence identity ("% sequence identity" or "% identity") of an object sequence with respect to a query sequence can be calculated as follows. First, the optimal alignment of the two sequences is determined using a sequence comparison algorithm with specific alignment parameters. This determination of the optimal alignment can be done using a computer, or it can be calculated manually as described below. Then, the two optimally aligned sequences are compared with respect to the length of comparison, and the number of positions in the optimal alignment at which identical residues occur in both sequences is determined, providing the number of matching positions. The number of matching positions is then divided by the total number of positions of the comparison length (which, unless otherwise specified, is the length of the query sequence), and the result is then multiplied by 100, giving the percentage of sequence identity of the object sequence with respect to the query sequence.
With respect to polypeptide sequences, normally a sequence is considered a "query sequence" (for example, a polypeptide sequence of the invention) with which one or more other sequences are compared, ie, "sequence (s) object ”(for example, sequences present in a sequence database). The sequence comparison algorithm uses the alignment parameters designed to determine the optimal alignment between the query sequence and the object sequence (s). When a query sequence is compared with a sequence database such as, for example, the GENBANK® database (Genetic Sequence Data Bank; US Department of Health and Human Services) or the GENESEQ® database (Thomson Derwent; also available as the DGENE® database in STN), normally only the query sequence and alignment parameters are entered into the computer; Optimal alignments are returned between the query sequence and each object sequence up to a specified number of object sequences.
1. Determination of optimal alignment
Two polypeptide sequences are "optimally aligned" when aligned using defined parameters, that is, a defined amino acid substitution matrix, penalty for the existence of a hole (also called hole opening penalty) and hole extension penalty, so They reach the highest possible similarity score for the sequence pair. The BLOSUM62 matrix (Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89 (22): 10915-10919) is frequently used as a default score substitution matrix in polypeptide sequence alignment algorithms (such as BLASTP, described below). The penalty for the existence of a hole is imposed for the introduction of a single amino acid hole in one of the aligned sequences, and the penalty for extension of the hole is imposed for each position of residue in the hole. Unless stated otherwise, the alignment parameters used in this document are: BLOSUM62 score matrix, penalty for the existence of a gap = 11 and penalty for extension of hole = 1. The alignment score is defined by the amino acid positions of each sequence in which an alignment begins and ends (for example, an alignment window), and optionally by the insertion of a hole or multiple holes in one or both sequences, of so that they reach the highest possible similarity score.
Although the optimal alignment between two or more sequences can be determined manually (as described below), the procedure is facilitated by the use of a computer-implemented alignment algorithm such as BLAST® (National Library of Medicine), for example, BLASTP for polypeptide sequences and BLASTN for nucleic acid sequences, described in Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402, and made available to the public through various sources such as the website of the National Center for Biotechnology Information (NCBI). If a computerized BLAST interface is used, if there is an option to use a "low complexity filter", this option should be disabled (ie no filter).
The optimal alignment between two polypeptide sequences can also be determined by a manual calculation of the BLASTP algorithm (that is, without the help of a computer) using the same alignment parameters specified above (matrix = BLOSUM62, hole opening penalty = 11 and penalty per hole extension = 1). To begin, the two sequences are initially aligned by visual inspection. An initial alignment score is then calculated as follows: for each individual position of an alignment (that is, for each pair of aligned residues) a numerical value is assigned according to the BLOSUM62 matrix (Figure 13). The sum of the values assigned to each pair of residues in an alignment is the alignment score. If the two sequences that are aligned are highly similar, this initial alignment often provides the highest possible alignment score. An alignment with the highest possible alignment score is the optimal alignment based on the alignment parameters used.
Examples of manual calculation of alignment scores for two sequences are provided in Figures 14A-14D. Figure 14A shows the calculation of an alignment score for an arbitrary alignment (alignment 14A) of a "query" sequence, identified herein as residues 39-53 of the human CTLA-4 ECD sequence (SEC ID No.: 159), and an "object" sequence, identified herein as residues 40-54 of D3 (SEQ ID NO: 61). The numerical value assigned by the BLOSUM62 matrix for each aligned pair of amino acids is shown below each position in the alignment.
Figure 14B shows the alignment score for optimal alignment of the same two sequences. To aid in visualization, each identical pair of amino acids in an alignment is shown in bold. An alignment in Figure 14B (alignment 14B) below produces the highest possible alignment score (the sum of the values shown below each aligned position) of these two sequences; Any other alignment of these two sequences, with or without a gap, would produce a lower alignment score.
In some cases a higher alignment score could be obtained by introducing one or more gaps in an alignment. Whenever a hole is entered in an alignment, a penalty for opening a hole is assigned and a penalty for extension of hole for each residue position within that hole is also evaluated. Therefore, using the alignment parameters described above (including gap opening penalty = 11 and gap extension penalty = 1), a hole of a residue in an alignment would correspond to a value of - (11+ (1 x 1)) = -12 assigned to the hole; a gap of two residues would correspond to a value of - (11+ (2 x 1)) = -13 assigned to the hole, etc. This calculation is repeated for each new hole entered.
In an alignment.
The following is an example that demonstrates how the introduction of a hole in an alignment can produce a higher alignment score, despite the penalty for a hole. Figure 14C shows an alignment (alignment 14C) of a "query" sequence, identified herein as residues 39-53 of the human CTLA-4 ECD sequence (SEQ ID NO: 159), and a sequence "Subject", identified herein as residues 41-55 of D3 (SEQ ID NO: 61), but in these cases with amino acids 49-50 deleted. Alignment 14C, which is the best possible alignment without introducing any gaps, produces an alignment score of 34.
The alignment in Figure 14D (alignment 14D) shows the effect of introducing a gap of two residues in the lower sequence on an alignment score. Despite the penalty for total gaps of 13 (the penalty for opening a gap of 11, and 2 times the penalty for extension of a gap of 1), the overall alignment score of the two sequences increases to 43. The lower D alignment produces the highest possible alignment score and, therefore, is the optimal alignment of these two sequences; any other alignment of these two sequences (with or without gaps) would produce a lower alignment score.
It should be understood that the examples of sequence alignment calculations described above, which use relatively short sequences, are only provided for illustrative purposes. In practice, the alignment parameters used (BLOSUM62 matrix, hole opening penalty = 11 and hole extension penalty = 1) are generally provided for polypeptide sequences of 85 amino acids in length or more. The NCBI website provides the following alignment parameters for sequences of other lengths that are suitable for computer-assisted alignment calculation, in addition to manual, using the same procedure as described above. For sequences of 50-85 amino acids in length, optimal parameters are the BLOSUM80 matrix (Henikoff and Henikoff, above), gap opening penalty = 10 and gap extension penalty = 1. For sequences of 35-50 amino acids in length, optimal parameters are the PAM70 matrix (Dayhoff, MO, Schwartz, RM & Orcutt, BC (1978) "A model of evolutionary change in proteins" in Atlas of Protein Sequence and Structure, vol. 5, Suppl. 3, MO Dayhoff (ed.), P. 345-352, Natl. Biomed. Res. Found., Washington, DC.), Opening penalty = 10 and opening extension penalty = 1. For sequences of less than 35 amino acids in length, optimal parameters are the PAM30 matrix (Dayhoff, MO, above), opening penalty = 9 and gap extension penalty = 1.
two. Identity calculation in percentage
Once the sequences have been optimally aligned, the percentage identity of the object sequence with respect to the query sequence is calculated by counting the number of positions in the optimal alignment that contain pairs of identical residues, dividing by the number of residues in the comparison length (also called the comparison window) which, unless otherwise specified, is the number of residues in the query sequence, and multiplying the resulting number by 100. Referring back to the previous alignments, in each example the sequence designated as the (upper) query sequence is 15 amino acids in length. In alignment B, 12 pairs of aligned amino acid residues (shown in bold) are identical in the optimal alignment of the query sequence (upper) with the target sequence (lower). Therefore, this particular object sequence has (12/15) x 100 = 80% identity with the entire length of the query sequence of 15 residues; in other words, the sequence object in alignment B has at least 80% amino acid sequence identity with the query sequence. In alignment D, 11 pairs of amino acid residues (shown in bold) in the optimal alignment are identical; therefore, this particular object sequence has (11/15) x 100 = 73.3% identity with the entire length of the query sequence of 15 residues; in other words, the sequence object in alignment D has at least 73% amino acid sequence identity with the query sequence.
As applied to polypeptides, the term "substantial identity" (or "substantially identical") usually means that when two amino acid sequences (ie, a query sequence and an object sequence) are optimally aligned using the BLASTP algorithm (manually or by computer) using appropriate parameters described above, the object sequence has at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% amino acid sequence identity with the query sequence. In some cases, the substantial identity exists over a comparison length of at least 100 amino acid residues such as, for example, at least 110, 115, 118, 119, 120, 121, 122, 123, 124, 125, 130, 135, 140, 145, 150, 200, 250, 300, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 375, 400, 450 or 500 amino acid residues.
Similarly, as applied in the context of two nucleic acid sequences, the term substantial (or substantially identical) identity means that when two nucleic acid sequences (i.e., a query sequence and an object) are optimally aligned using the algorithm BLASTN (manually or by computer) using appropriate parameters described below, the subject sequence has at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, 99%, 99.5% or 100% nucleic acid sequence identity with the query sequence. Parameters used for nucleic acid sequence alignments are: reward for mating 1, penalty for missing -3,
penalty for the existence of hole 5, penalty for extension of hole 2 (replacement matrices are not used in the BLASTN algorithm). In some cases, the substantial identity exists over a comparison length of at least 300 nucleotide residues, for example, at least 330, 345, 354, 357, 360, 363, 366, 369, 362, 365, 375, 390, 405, 420, 435, 450, 600, 750, 900, 1035, 1038, 1041, 1044, 1047, 1050, 1053, 1056, 1059, 1062, 1065, 1068, 1071, 1074, 1077, 1080, 1200, 1350 or 1500 nucleotide residues
Other sequence alignment programs known in the art can be used. The ALIGN program produces an optimal (general) global alignment of the two protein sequences or nucleic acids chosen using a modification of the dynamic programming algorithm described by Myers and Miller CABIOS 4: 11-17 (1988). The ALIGN program normally, although not necessary, is used with weighted terminal gaps. If penalties for opening the gap and extension of the gap are available, they are frequently set between approximately -5 to -15 and 0 to -3, respectively, more preferably approximately -12 to -0.5 to -2, respectively, for the amino acid sequence alignment, and -10 to -20 and -3 to -5, respectively, more commonly about -16 and -4, respectively, for nucleic acid sequence alignments. The ALIGN program is further described in Pearson et al., Proc. Natl. Acad. Sci. USA 85: 2444-48 (1988), and Pearson et al., Meth. Enzymol 18: 63-98 (1990).
Alternatively, and particularly for the analysis of multiple sequences (i.e., comparison of more than three sequences), the CLUSTALW program (described in, for example, Thompson et al., Nucl. Acids Res. 22: 4673-4680 ( 1994)). The CLUSTALW program is a suitable algorithm for alignments of multiple DNA and amino acid sequences (Thompson et al., Nucl. Acids Res. 22: 4673-4680 (1994)). CLUSTALW performs multiple comparisons by pairing between groups of sequences and assembles them in a multiple homology-based alignment. In one aspect, the penalties for opening the gap and the extension of the gap are set at 10 and 0.05, respectively. Alternatively or additionally, the CLUSTALW program is executed using "dynamic" (versus "fast") parameters. Normally, nucleotide sequence analysis with CLUSTALW is performed using the BESTFIT matrix, while amino acid sequences are evaluated using a variable set of BLOSUM matrices depending on the level of identity between the sequences (for example, as used by the program CLUSTALW version 1.6 available from the San Diego Supercomputer Center (SDSC) or version W 1.8 available from the European Bioinformatics Institute, Cambridge, UK). Preferably, the CLUSTALW parameters are set to the default parameters of SDSC CLUSTALW (for example, with respect to special hydrophilic hole penalties in amino acid sequence analysis). The CLUSTALW program is further described in, for example, Higgins et al., CABIOS 8 (2): 189-91 (1992), Thompson et al., Nucleic Acids Res. 22: 4673-80 (1994), and Jeanmougin and col., Trends Biochem. Sci. 2: 403-07 (1998).
In an alternative format, the percent identity or identity between a particular pair of aligned amino acid sequences refers to the percent identity of amino acid sequences that is obtained by the CLUSTALW analysis (e.g., version W 1.8), counting the number of identical matches in an alignment and dividing such a number of identical matches by the greater of (i) the length of the aligned sequences, and (ii) 96, and using the following ClustalW parameters by default to achieve alignments by slow / precise pairing - gap opening correction: 10; penalty for extension of hole: 0.10; protein weight matrix: Gonnet series; DNA weight matrix: IUB; pairing alignments slow / fast switching = SLOW or FULL alignment.
Another useful algorithm for determining identity in percentage or percentage similarity is the FASTA algorithm, which is described in Pearson et al., Proc Natl. Acad. Sci. USA 85: 2444 (1988) and Pearson, Methods Enzymol. 266: 227-258 (1996). Typical parameters used in an FASTA alignment of DNA sequences to calculate percent identity are optimized, matrix BL50 15: -5, k-tuple = 2; union penalty = 40, optimization = 28; hole penalty = -12, hole length penalty = -2; and width = 16.
Other suitable algorithms include the BLAST and BLAST 2.0 algorithms, which facilitate the analysis of at least two amino acid or nucleotide sequences, aligning a selected sequence against multiple sequences in a database (eg, GenSeq) or, when modified by an additional algorithm such as BL2SEQ, between two selected sequences. The BLAST analysis software is publicly available from the National Center for Biotechnology Information (NCBI) (universal website address ncbi.nlm.nih.gov). The BLAST algorithm involves first identifying pairs of high score sequences (HSP) that identify short words of length W in the query sequence, which both coincide and satisfy some threshold T score with positive value when aligned with a word of the same length in a sequence of the database. T is called the neighboring word score threshold (Altschul et al., Above). These neighboring initial words act as seeds to initiate searches to find longer HSPs that contain them. The initial words extend in both directions along each sequence so that, as far as possible, the accumulated alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of mating residues; always> 0) and N (penalty score for mating residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. The extension of the initial words in each direction stops when: the cumulative alignment score falls by the amount X of its maximum value reached; the accumulated score tends to zero or below, due to the accumulation of one or more negative score residue alignments; or the end of any sequence is reached. The parameters
W, T and X of the BLAST algorithm determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) can be used with a word length (W) of 11, a hope (E) of 10, M = 5, N = 4 and a comparison of both chains. For amino acid sequences, the BLASTP program (for example, BLASTP 2.0.14; June 29, 2000) can be used with a word length of 3 and a hope (E) of 10. The BLOSUM62 scoring matrix (see Henikoff & Henikoff, (1989) Proc. Natl. Acad. Sci. USA 89: 10915) uses alignments (B) of 50, hope (E) of 10, M = 5, N = -4 and a comparison of both chains. Again, as with other suitable algorithms, the rigor of comparison can be increased until the program identifies only sequences that are more closely related to those in the sequence listing herein (for example, a polypeptide comprising a polypeptide sequence having at least 85, 90, 91, 92, 93, 49, 95, 96, 97, 98, 99% or 100% identity with a polypeptide sequence selected from SEQ ID NO: 1-79, 197-200, 205-214 and 219-222; or nucleic acid comprising a nucleotide sequence having at least 85, 90, 91, 92, 93, 49, 95, 96, 97, 98, 99% or 100% identity with a nucleotide sequence selected from any of SEQ ID NO: 80-158, 201-204, 223 and 224, or a complementary nucleotide sequence thereof.
The BLAST algorithm also performs a statistical analysis of the similarity or identity between two sequences (see, for example, Karlin & Altschul, (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787). A measure of the similarity or identity provided by the BLAST algorithm is the smallest sum probability (P (N)) that provides an indication of the probability at which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid with respect to the reference nucleic acid is less than about 0.2, such as less than about 0 , 01 or less than about 0.001.
The analysis of the BLAST program can also be modified or alternatively it can be modified by low complexity filtering programs such as the DUST or SEG programs, which are preferably integrated into the BLAST program operations (see, for example, Wootton et al., Comput. Chem. 17: 149-63 (1993), Altschul et al., Nat. Genet. 6: 119-29 (1991), Hancock et al., Comput. Appl. Biosci. 10: 67-70 (1991), and Wootton et al., Meth. Enzymol. 266: 554-71 (1996)). In such aspects, if a lambda relationship is used, useful parameters for the relationship are between 0.75 and 0.95, which include between 0.8 and 0.9. If costs for the existence of a gap (or punctuation per hole) are used in such aspects, the cost for the existence of a gap is usually set between approximately -5 and -15, more normally approximately -10, and the cost per gap per residue is normally fixed between about 0 and -5, such as between 0 and -3 (for example, -0.5). Similar gap parameters can be used with other programs as appropriate. The BLAST programs and the underlying principles are further described in, for example, Altschul et al., J. Mol. Biol. 215: 403-10 (1990), Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87: 2264-68 (199) (as modified by Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90: 5873-77 (1993)), and Altschul et al., Nucl. Acids Res. 25: 3389-3402 (1997).
Another example of a useful algorithm is incorporated into the PILEUP software. The PILEUP program creates an alignment of multiple sequences from a group of related sequences using progressive pairing alignments to show the ratio and percentage of sequence identity or percentage of sequence similarity. PILEUP uses a simplification of the progressive alignment procedure of Feng & Doolittle (1987)
J. Mol. Evol 35: 351-360, which is similar to the procedure described by Higgins & Sharp (1989) CABIOS 5: 151-153. The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids. The multiple alignment procedure begins with the matching alignment of the two most similar sequences that produce a grouping of two aligned sequences. Then, this grouping aligns with the next most related sequence or grouping of aligned sequences. Two clusters of sequences are aligned by a simple extension of the alignment by matching two individual sequences. The final alignment is achieved by a series of progressive matching alignments. The program is executed by designating specific sequences and their amino acid or nucleotide coordinates for sequence comparison regions and designating the program parameters. Using PILEUP, a reference sequence is compared to other test sequences to determine the ratio of percent sequence identity (or percent sequence similarity) using specified parameters. Exemplary parameters for the PILEUP program are: default gap weight (3.00), default gap length weight (0.10) and weighted terminal gaps. PILEUP is a component of the GCG sequence analysis software package, for example, version 7.0 (Devereaux et al. (1984) Nucl. Acids Res. 12: 387-395).
Other useful algorithms for performing identity analysis include the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48: 443, and the search for the similarity procedure of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85: 2444. Computerized implementations of these algorithms (for example, GAP, BESTFIT, FASTA and TFASTA) are provided in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, WI.
Sequence variation
As discussed above, an isolated or recombinant mutant CTLA-4 extracellular domain polypeptide comprising a polypeptide sequence that (a) differs from a polypeptide sequence selected from the group consisting of SEQ ID is disclosed herein. : 1-73 in no more than 6 amino acid residues (for example, no more than 1, 2, 3, 4, 5 or 6 amino acid residues), in which the mutant CTLA-4 ECD polypeptide binds to CD80 and / or CD86 and / or an extracellular domain of either or both, and / or inhibits a
5 immune response Such amino acid substitution (substitutions) includes (n) conservative amino acid substitution (substitutions).
As a non-limiting example, a polypeptide of the disclosure may have a polypeptide sequence that differs from SEQ ID NO: 1 in a total of up to 6 amino acids (which may be a combination of amino acid substitutions, deletions and / or insertions, which include those described above). In some cases,
10 None, any or all substitutions are substitutions according to a substitution group defined below.
The amino acid substitutions according to the invention may include, but are not limited to, one or more conservative amino acid substitutions. A substitution of conservative amino acid residues normally involves exchanging a member within a functional class of amino acid residues for a residue belonging to the same functional class (identical amino acid residues are considered functionally homologous or
fifteen preserved in the calculation of percentage of functional homology). Tables of conservative substitutions that provide functionally similar amino acids are well known in the art. An example is provided in Table 1, which sets out six exemplary groups containing amino acids that can be considered "conservative substitutions" with each other.
Table 1. Conservative substitution groups of amino acid residues
<dl><dt>1 </dt><dd>Alanina (A) Glycine (G) Serina (S) Threonine (T) </dd></dl>
<dl><dt>2 </dt><dd>Aspartic acid (D) Glutamic acid (E) </dd></dl>
<dl><dt>3 </dt><dd>Asparagine (N) Glutamine (Q) </dd></dl>
<dl><dt>4 </dt><dd>Arginine (R) Lysine (K) Histidine (H) </dd></dl>
<dl><dt>5 </dt><dd>Isoleucine (I) Leucine (L) Methionine (M) Valine (V) </dd></dl>
<dl><dt>6 </dt><dd>Phenylalanine (F) Tyrosine (Y) Tryptophan (W) </dd></dl>
twenty Other amino acid substitution groups may be provided. For example, amino acids can be grouped by function or similar chemical structure or composition (for example, acidic, basic, aliphatic, aromatic, sulfur-containing). For example, an aliphatic grouping may comprise: glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I). Other groups containing amino acids that are considered conservative substitutions with each other include: aromatic: phenylalanine (F), tyrosine (Y), tryptophan (W); containing sulfur: methionine (M), cysteine (C);
25 basic: arginine (R), lysine (K), histidine (H); acids: aspartic acid (D), glutamic acid (E); non-polar non-polar residues, cysteine (C), methionine (M) and proline (P); hydrophilic unloaded residues: serine (S), threonine (T), asparagine
(N) and glutamine (Q). See also Creighton (1984) Proteins, WH Freeman and Company, for additional amino acid clusters. The listing of a polypeptide sequence herein, together with the above substitution groups, provides an explicit listing of all polypeptide sequences.
30 conservatively substituted.
There are more conservative substitutions within the amino acid residue classes described above, which may also be suitable or alternatively may be suitable. Conservation groups for substitutions that are more conservative include: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine and asparagine-glutamine. Therefore, this document discloses, for example, in one aspect
35 in particular, an isolated or recombinant polypeptide comprising a polypeptide sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identity with SEQ ID NO: 1 (or any of SEQ ID NO: 1-79, 197200, 205-214 and 219-222) and which differs from the sequence of SEQ ID NO: 1 mostly (for example, at least 50%, 60%, 70% , 75%, 80%, 90%), if not all, for such more conservative amino acid substitutions.
Additional groups of amino acid substitutions that may also be suitable can be determined.
40 using the principles described in, for example, Creighton (1984) PROTEINS: STRUCTURE AND MOLECULAR PROPERTIES (2nd ed. 1993), WH Freeman and Company. In some aspects, at least 33%, 50%, 60%, 70%,
or more (for example, at least 75%, 80%, 90%, 95%, 96%, 97% or more) of the substitutions in an amino acid sequence variant comprises substitutions of one or more amino acid residues in a polypeptide sequence of the invention with residues that are within the same functional homology class (as is
Four. Five determined by any suitable classification system, such as those described above) that the amino acid residues of the polypeptide sequence they replace.
Conservatively substituted variations of a polypeptide sequence of the present invention include substitutions of a small percentage, usually less than 10%, 9%, 8%, 7% or 6% of the amino acids of the
polypeptide sequence, or more normally less than 5%, 4%, 3%, 2% or 1%, of the amino acids of the polypeptide sequence, with an amino acid conservatively selected from the same conservative substitution group.
Polypeptides comprising amino acid variations of a polypeptide sequence described herein are disclosed herein. As discussed above, in one aspect, the disclosure includes isolated or recombinant polypeptides (eg, mutant CTLA-4 polypeptides such as, for example, mutant CTLA-4 ECD polypeptides), each comprising a sequence of polypeptides that It has at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, 99%, 99.5% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, and bind to CD80 and / or CD86 or a CD80 polypeptide fragment and / or CD86 (or an ECD of either or both), and / or suppresses an immune response. Such polypeptides may vary by one or more deletions, additions or substitutions of amino acids, which include one or more conservative or non-conservative substitutions, provided, however, that the polypeptides possess the described functional properties. Variants of polypeptides comprising conservatively modified variations of any such polypeptide described herein are disclosed herein, such as, for example, one comprising a polypeptide sequence selected from the group of SEQ ID NO: 1-73.
As also discussed above, isolated or recombinant fusion proteins (eg, mutant CTLA-4-Ig fusion proteins) are disclosed herein each comprising a sequence of polypeptides having at least 75%, 80 %, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5 % or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222, in which the fusion protein binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or suppresses an immune response as disclosed herein. Such fusion proteins may vary by one or more amino acid deletions, additions or substitutions that include one or more conservative or non-conservative substitutions, provided, however, that the fusion proteins possess the described functional properties. Variants of polypeptides comprising conservatively modified variations of any fusion protein described herein are disclosed herein, such as, for example, one comprising a polypeptide sequence selected from the group of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222.
Polypeptide variants of any isolated or recombinant polypeptide of the disclosure described above or elsewhere herein are also disclosed, in which the amino acid sequence of the polypeptide variant differs from the respective polypeptide sequence of the reference polypeptide. by one or more substitutions of conservative amino acid residues, although non-conservative substitutions are sometimes permissible or even preferable (examples of such non-conservative substitutions are discussed further herein). For example, the sequence of the polypeptide variant may vary from a sequence of mutant CTLA-4 polypeptides by one or more amino acid residue substitutions in the mutant CTLA-4 ECD polypeptide sequence with one or more amino acid residues that they have similar weight (ie, a residue that has weight homology with the residue in the respective polypeptide sequence it replaces). The weight (and correspondingly the size) of the amino acid residues of a polypeptide can significantly affect the structure of the polypeptide. Conservation by weight or homology is based on whether a corresponding non-identical amino acid is associated with a positive score on one of the weight-based matrices described herein (eg, BLOSUM50 matrix; PAM250 matrix).
Similar to the functional amino acid classes described above, naturally occurring amino acid residues can be divided into weight-based conservation groups (which are divided between "strong" and "weak" conservation groups). The eight commonly used strong weight-based conservation groups are Ser Thr Ala, Asn Glu Gln Lys, Asn His Gln Lys, Asn Asp Glu Gln, Gln His Arg Lys, Met Ile Leu Val, Met Ile Leu Phe, His Tyr and Phe Tyr Trp. Weak conservation groups based on weight include Cys Ser Ala, Ala Thr Val, Ser Ala Gly, Ser Thr Asn Lys, Ser Thr Pro Ala, Ser Gly Asn Asp, Ser Asn Asp Glu Gln Lys, Asn Asp Glu Gln His Lys, Asn Glu Gln His Arg Lys, Phe Val Leu Ile Met and His Phe Tyr. Some versions of the CLUSTAL W sequence analysis program provide an analysis of strong and weak conservation groups based on weight at the output of an alignment, thus offering a convenient technique for determining weight-based conservation (for example, CLUSTAL W provided by SDSC, which is normally used with the default parameters of SDSC). In some aspects, at least 33%, 50%, 60%, 70%, 80% or 90% of substitutions in such a variant of polypeptides comprise substitutions in which a residue within a weight-based preservation replaces a residue amino acid of the polypeptide sequence that is in the same weight-based conservation group. In other words, such a percentage of substitutions is preserved in terms of weight characteristics of amino acid residues.
The sequence of a variant of polypeptides can be distinguished from a mutant CTLA-4 polypeptide of the invention by one or more amino acid substitutions with one or more amino acid residues having a similar hydropathy profile (i.e., having similar hydrophilicity) to the (original) substituted residues of the mutant CTLA-4 polypeptide. A hydropathy profile can be determined using the Kyte and Doolittle index, the scores for each amino acid occurring naturally in the index as follows: I (+4.5), V (+4.2), L (+ 3.8), F (+2.8), C (+2.5), M (+1.9); A (+1.8), G (-0.4), T (-0.7), S (-0.8), W (-0.9), Y (-1.3), P ( -1.6), H (-3.2); E (
3.5), Q (-3.5), D (-3.5), N (-3.5), K (-3.9) and R (-4.5). (See, for example, U.S. Patent No. 4,554,101 and Kyte & Doolittle, J. Molec. Biol. 157: 105-32 (1982) for further discussion). At least 75%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99% or 100% of the amino acid residues in the sequence of variant polypeptides that are not identical to the corresponding residues in the identical or functionally homologous mutant CTLA-4 polypeptide sequence disclosed herein ("most related homologue"), whose homologue may be selected from any of SEQ ID NO: 1-73, has less than +/- 2 change in hydrophilicity, which includes less than a +/- 1 change in hydrophilicity and less than a +/- 0.5 change in hydrophilicity with respect to the residue of non-identical amino acid in the corresponding position in the most related homolog. The variant polypeptide may have a total change in hydrophilicity with respect to its more related counterpart selected from the group of SEQ ID NO: 1-73 of less than about 150, less than about 100, and / or less than about 50 (per example, less than about 30, 20 or 10).
Examples of typical amino acid substitutions that retain similar or identical hydrophilicity include arginine-lysine substitutions, glutamate-aspartate substitutions, serine-threonine substitutions, glutamine-asparagine substitutions and valine-leucine-isoleucine substitutions. Algorithms and software, such as the GREASE program available from the SDSC, provide a convenient way to quickly assess the hydropathy profile of an amino acid sequence. Because a substantial proportion (for example, at least about 33%), if not most (at least 50%) or almost all (for example, about 65, 80, 90, 95, 96, 97, 98, 99%) of the amino acid substitutions in the sequence of a polypeptide variant, will frequently have a hydropathy score similar to that of the amino acid residue that they substitute in the polypeptide sequence (reference), The sequence of the polypeptide variant is expected to have a GREASE program output similar to that of the polypeptide sequence. For example, in a particular aspect it can be expected that a polypeptide variant of SEQ ID NO: 61 has an output of the GREASE program (or similar program) that is more similar to the output of GREASE obtained by entering the polypeptide sequence of SEQ ID NO. : 61 that obtained using a CTLA-4 WT polypeptide (for example, hCTLA-4), which can be determined by visual inspection
or computer aided comparison of the graphical output (eg, graphic lining / alignment) and / or numerical provided by subjecting the test variant sequence and SEQ ID NO: 1 to the program.
The conservation of amino acid residues in terms of functional homology, weight homology and hydropathy characteristics also apply to other variants of polypeptide sequences provided by the disclosure that include, but are not limited to, for example, variants of polypeptide sequences. of a polypeptide sequence selected from the group consisting of SEQ ID NO: 1-79197-200, 205-214 and 219-222.
At least one polypeptide variant is disclosed herein that comprises an amino acid sequence that differs from a recombinant polypeptide sequence selected from the group of SEQ ID NO: 1-79, 197-200, 205-214 and 219- 222, in which the amino acid sequence of the variant has at least one amino acid residue substitution such selected according to conservation or homology based on weight or similar hydropathy profile as discussed above. Such polypeptide variants described above normally have a capacity to bind to CD80 and / or CD86 and / or an ability to suppress at least one type of immune response as described above and in greater detail later in the examples.
Signal Peptide Sequences
The polypeptides of the invention may also further comprise any suitable number and type of additional amino acid sequences such as one or more peptide fragments. In one embodiment, such a polypeptide of the invention further comprises a signal peptide. Generally, the signal peptide directs the recombinant polypeptide to the endoplasmic reticulum when the recombinant polypeptide is expressed in an animal cell. A signal sequence that directs the traffic and / or secretion of organelles of at least a part of the polypeptide after expression in a cell can be included. Such sequences are normally present in the immature (ie, not fully processed) form of the polypeptide, and are subsequently removed / degraded by cellular proteases to reach the mature form of the protein. For example, a mutant CTLA-4 polypeptide or fusion protein of the invention may include any suitable signal sequence or combinations of signal sequences that direct the polypeptide to intracellular compartments such as a sequence that directs the polypeptide to be transported (eg, translocate) (for example, so that the protein is processed by and released from) to the endoplasmic reticulum or secretory pathway (e.g., ER, golgi, and other organelles and related cellular compartments secreted), the nucleus and / or which directs the polypeptide to be secreted from the cell, translocated into a cell membrane, or chooses a second cell different from the cell from which the protein is secreted. In this regard, the polypeptide may include an intracellular target sequence of choice (or "classification signal") that directs the polypeptide to an endosomal and / or lysosomal compartment (s) or other MHC-rich compartment II to promote the presentation and response of CD4 + and / or CD8 + T cells, such as a signal of choice of lysosomal / endosomal target derived from lysosome-associated membrane protein 1 (e.g., LAMP-1 - see, for example, Wu et al. Proc. Natl. Acad. Sci. USA 92: 1161-75 (1995) and Ravipraskash et al., Virology 290: 74-82 (2001)), a part or counterpart thereof (see, for example, U.S. Patent No. 5,633 .234), or another sequence of choice of lysosomal, endosomal and / or suitable ER target (see, for example, US Patent No. 6,248,565). In some aspects it may be desirable that the sequence of choice of intracellular target be located near or adjacent to a demonstrated (s) / identified epitope sequence (s) within the polypeptide, which can be identified by techniques known in the technique, thereby increasing the probability of T cell presentation of polypeptide fragments comprising such epitope (s). Such polypeptides may be expressed from an isolated, recombinant or synthetic DNA or RNA released to a cellular host by one or more of the nucleotide transfer vectors that include, for example, one or more of the gene transfer vectors further described. in the present document.
5 The polypeptide may comprise a signal sequence that directs the polypeptide to the endoplasmic reticulum (RE) (for example, facilitates translocalization by the RE of the polypeptide) when the polypeptide is expressed in a mammalian cell. The polypeptide can comprise any sequence you choose as a suitable RE target. Many sequences known as RE target are known in the art. Examples of such signal sequences are described in US Pat. No. 5,846,540. Commonly used RE / secretion signal sequences include the
10 yeast factor alpha signal sequence and mammalian viral signal sequences such as herpes gD virus signal sequence. Exemplary signal peptides for the production of E. coli include the STII or Ipp signal sequences of E. coli. Other examples of signal sequences are described in, for example, US Pat. No. 4,690,898, 5,284,768, 5,580,758, 5,652,139 and 5,932,445. Suitable signal sequences can be identified using skill known in the art. For example, the SignalP program can be used (described in, for example, Nielsen
fifteen et al. (1997) Protein Engineering 10: 1-6), which is publicly available from the Center for Biological Sequence Analysis at the designated universal web site address cbs.dtu.dk/services/SignalP, or similar sequence analysis software able to identify domains similar to signal sequence. Related techniques to identify suitable signal peptides are provided in Nielsen et al., Protein Eng. 10 (1): 1-6 (1997). The sequences can be analyzed manually for characteristics commonly associated with signal sequences such as
twenty European patent application No. 0 621 337, Zheng and Nicchitta (1999) J. Biol. Chem. 274 (51): 36623-30, and Ng et al. (1996) J. Cell Biol. 134 (2): 269-78.
Additional aspects
Any polypeptide of the invention (including any fusion protein of the invention) may be present as part of a larger polypeptide sequence as produced after the addition of one or more domains or sub-sequences for stabilization or detection or purification of the polypeptide. . Such domains or sub-sequences can be covalently fused with the polypeptide of the invention, as an expert would easily understand and be able to construct. A polypeptide purification sub-sequence may include, for example, an epitope tag, a FLAG tag, a polyhistidine sequence, a GST fusion or any other detection / purification sub-sequence or "tag" known in the art. These additional domains or sub-sequences have so little
30 as no effect on the activity of the polypeptide of the invention, or can be removed by processing steps after synthesis such as by treatment with a protease, inclusion of an intein or the like.
Any polypeptide of the invention (including any fusion protein of the invention) may also comprise one or more modified amino acids. The modified amino acid can be, for example, a glycosylated amino acid, a PEGylated amino acid, a farnesylated amino acid, an acetylated amino acid, a biotinylated amino acid, an amino acid conjugated to a lipid moiety and / or an amino acid conjugated to a derivatizing agent. The presence of modified amino acids may be advantageous in, for example, (a) increasing the half-life of the serum polypeptide and / or functional in vivo half-life, (b) reducing the antigenicity or immunogenicity of polypeptides, (c) increasing the stability during polypeptide storage, (d) increase the
40 bioavailability, (e) decrease the effector function, and / or (f) decrease or inhibit unwanted self-association (eg, formation of aggregates) between two or more molecules of the invention (such as between two or more protein dimers of fusion of the invention). The amino acid (s) are modified, for example, co-translationally or post-translationally during recombinant production (for example, N-linked glycosylation in NXS / T motifs during expression in mammalian cells) or modified by means synthetic
Four. Five The polypeptides of the invention (including fusion proteins of the invention) described herein can be further modified in a variety of ways by, for example, post-translational modification and / or synthetic modification or variation. For example, the fusion polypeptides or proteins of the invention can be properly glycosylated, usually by expression in a mammalian cell. For example, the disclosure includes glycosylated polypeptides that can bind to CD86 and / or CD80 and / or have a capacity to
fifty suppressing an immune response (eg, proliferation or activation of T lymphocytes) as described elsewhere herein, wherein each said glycosylated polypeptide comprises a sequence of polypeptides having at least 92%, 93%, 94 %, 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of SEQ ID NO: 1-79, 197-200, 205-214 and 219-222 .
The polypeptides of the invention can be subjected to any number of suitable additional forms of
55 post-translational and / or synthetic modification or variation. For example, the invention provides protein mimetics of the polypeptides of the invention. Peptide mimetics are described in, for example, US Pat. No. 5,668,110 and references cited therein.
In another aspect, a fusion polypeptide or protein of the invention can be modified by the addition of protecting groups to the side chains of one or more of the amino acids of the fusion polypeptide or protein. Such 60 protecting groups can facilitate transport of the fusion polypeptide or protein via membrane (s), if
you want, or by certain tissue (s), for example, reducing hydrophilicity and increasing lipophilicity of the polypeptide or fusion protein. Examples of suitable protecting groups include ester protecting groups, amine protecting groups, acyl protecting groups and carboxylic acid protecting groups, which are known in the art (see, for example, U.S. Patent No. 6,121,236 ). The synthetic fusion proteins of the invention
5 They can take any suitable form. For example, the fusion protein can be structurally modified from its naturally occurring configuration to form a cyclic peptide or other structurally modified peptide.
The polypeptides of the invention can also be linked to one or more non-proteinaceous polymers, usually to hydrophilic synthetic polymer, for example, polyethylene glycol (PEG), polypropylene glycol or polyoxyalkylene, using techniques
10 well known in the art, as described in, for example, US Pat. No. 4,179,337, 4,301,144, 4,496,689, 4,640,835, 4,670,417 and 4,791,192, or a similar polymer such as polyvinyl alcohol or polyvinylpyrrolidone (PVP).
The invention includes conjugates comprising at least one polypeptide of the invention (eg, mutant CTLA-4 ECD polypeptide, dimeric or monomeric mutant CTLA-4-Ig, multimeric mutant CTLA-4 ECD polypeptide, CTLA-4 -Ig multimeric mutant) and a non-polypeptide moiety. The term "conjugate" (or interchangeably "conjugated polypeptide") is intended to indicate a heterogeneous molecule (in the sense of composite or chimeric material) formed by the covalent attachment of one or more polypeptides to one or more non-polypeptide moieties. The term "covalent binding" means that the polypeptide and the non-polypeptide moiety are both directly covalently linked to each other and are indirectly covalently linked to each other by an intervening moiety or moieties such as a moiety or moiety, bridge, spacer or link using a binding group present in the polypeptide. Preferably, the conjugate is soluble at relevant concentrations and conditions, that is, soluble in physiological fluids such as blood. Examples of conjugated polypeptides of the invention include glycosylated and / or PEGylated polypeptides. The term "unconjugated polypeptide" can be used as part of the conjugate polypeptide. Such a conjugate normally binds to CD80 (for example, hCD80) and / or CD86 (for example, hCD86) and / or an extracellular domain of either or both (including hCD80-Ig and / or hCD86-Ig), and / or has an ability to inhibit an immune response. Such an immune response may comprise, but is not limited to, for example, activation or proliferation of T lymphocytes, synthesis / production of cytokines, induction of activation markers, production of inflammatory molecules, inflammation, production of anti-collagen Ab and / or exemplary Ab response of T lymphocytes. Exemplary polypeptides include those having the
30 minus 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group of SEQ ID NO: 1-79, 197-200, 205-214 and 219-222.
It is envisioned that the term "non-polypeptide moiety" indicates a molecule that can be conjugated to a binding group of a polypeptide of the invention. Preferred examples of such a molecule include polymer molecules, sugar moieties, lipophilic compounds or organic derivatizing agents. When used in the context of a conjugate
35 As described herein, it will be understood that the non-polypeptide moiety is linked to the polypeptide portion of the conjugate by a polypeptide binding group.
The term "polymer molecule" is defined as a molecule formed by covalent bonding of two or more monomers, in which none of the monomers is an amino acid residue, except when the polymer is human albumin or another abundant plasma protein. The term "polymer" can be used interchangeably with the
40 term "polymer molecule".
An N-glycosylation site has the sequence NXS / T / C, in which X is any amino acid residue, except proline, N is asparagine and S / T / C is both serine, threonine and cysteine, preferably serine or threonine, and most preferably threonine.
An "O-glycosylation site" comprises the OH group of a serine or threonine residue.
Four. Five It is envisioned that the term "binding group" indicates a group of amino acid residues of the polypeptide that can be coupled to the relevant non-polypeptide moiety, such as a polymer molecule or a sugar moiety. Non-limiting examples of useful binding groups and some corresponding non-polypeptide moieties are provided in Table 2 given below.
Table 2. Useful binding groups and examples of corresponding non-polypeptide moieties
<dl><dt>Union group </dt><dd>Amino acid Examples of non-polypeptide moieties Examples of conjugation procedure / activated PEG Reference </dd></dl>
<dl><dt>-NH2 </dt><dd>End N, Lys Polymer, for example, PEG mPEG-SPA mPEG2-NHS mPEG2-butyrAL D 2003 catalog of Nektar Inc .; see also Nektar Therapeutics, 2005-06 catalog</dd></dl>
(continuation)
<dl><dt>Group of </dt><dd>Amino acid Examples of Examples of Reference </dd></dl>
<dl><dt>Union </dt><dd>non-polypeptide moieties conjugation procedure / PEG activated </dd></dl>
<dl><dt>-COOH </dt><dd>End C, Asp, Glu Polymer, for example, PEG Sugar rest mPEG-Hz In vitro coupling 2003 catalog of Nektar Inc .; see also Nektar Therapeutics, 2005-06 catalog</dd></dl>
<dl><dt>-SH </dt><dd>Cys Polymer, for example, PEG Sugar rest mPEG-VS mPEG2-MAL (mPEGmaleimide) In vitro coupling 2003 catalog of Nektar Inc .; Nektar Therapeutics, 2005-06 catalog; Delgado et al., Critical Reviews in Therapeutic Drug Carrier Systems 9 (3,4): 249-304 (1992)</dd></dl>
<dl><dt>-OH </dt><dd>Be, Thr, OH- Sugar rest O-linked glycosylation in vivo </dd></dl>
<dl><dt>-CONH2 </dt><dd>Asn as part of a Nglucosylation site Sugar rest N-glycosylation in vivo </dd></dl>
<dl><dt>Aromatic residue </dt><dd>Phe, Tyr, Trp Sugar rest In vitro coupling </dd></dl>
<dl><dt>-CONH2 </dt><dd>Gln Sugar rest In vitro coupling Yan and Wold, Biochemistry, 1984, Jul 31; 23 (16): 3759-65</dd></dl>
<dl><dt>Aldehyde Ketone </dt><dd>Oxidized carbohydrate Polymer, for example, PEG, PEG-hydrazide PEGylation Andresz et al., 1978, Makromol. Chem. 179: 301; WO 92/16555, WO 00/23114</dd></dl>
<dl><dt>Guanidino </dt><dd>Arg Sugar rest In vitro coupling Lundblad and Noyes, Chemical Reagents for Protein Modification, CRC Press Inc. Boca Raton, FI </dd></dl>
<dl><dt>Imidazole ring </dt><dd>His Sugar rest In vitro coupling as for guanidine </dd></dl>
For N-glycosylation in vivo, the term "binding group" is used in an unconventional way to indicate amino acid residues that constitute an N-glycosylation site (with the NXS / T / C sequence in which X is any amino acid residue, except proline, N is asparagine and S / T / C is both serine, threonine and cysteine, preferably serine or threonine, and most preferably threonine). Although the asparagine residue of the N-glycosylation site is the one with which the rest of the sugar binds during glycosylation, such binding cannot be achieved unless the other amino acid residues of the N-glycosylation site are present. Therefore, when the non-polypeptide moiety is a sugar moiety and conjugation is to be achieved by N-glycosylation, the term "amino acid residue comprising a binding group for the non-polypeptide moiety" as used on purpose 10 of alterations of the amino acid sequence of the polypeptide of the invention should be understood as one, two or all amino acid residues that constitute an N-glycosylation site that is to be altered in such a way that both a functional N-glycosylation site is introduced into the amino acid sequence, removed from said sequences, as a site of Functional N-glycosylation is retained in the amino acid sequence (for example, by replacing a serine residue, which is already part of an N-glycosylation site, with a threonine residue
fifteen and vice versa).
The term "introduce" (ie, an "introduced" amino acid residue, "introduction" of an amino acid residue) is primarily intended to mean the replacement of an existing amino acid residue with another amino acid residue, but may also mean the insertion of an additional amino acid residue.
The term "remove" (ie, an amino acid residue "deleted", "removal" of an amino acid residue) 20 is primarily intended to mean the replacement of the amino acid residue to be removed by another amino acid residue, but it can also mean the deletion (without replacement) of the amino acid residue to be removed.
The term "amino acid residue comprising a binding group for the non-polypeptide moiety" is intended to indicate that the amino acid residue is one with which the non-polypeptide moiety binds (in the case of an introduced amino acid residue ) or would have joined (in the case of a deleted amino acid residue).
25 By eliminating and / or introducing amino acid residues comprising a binding group for the non-polypeptide moiety, it is possible to specifically adapt the polypeptide of the invention so as to make the molecule more
susceptible to conjugation with the rest of the non-polypeptide of choice, optimize the conjugation pattern (for example, to guarantee an optimal distribution of non-polypeptide residues on the surface of the polypeptide and thus, for example, effectively protect epitopes and other surface parts of the polypeptide without significantly altering its function). For example, by the introduction of binding groups, the polypeptide is altered in the content of specific amino acid residues with which the relevant non-polypeptide moiety binds, whereby a more efficient, specific and / or extensive conjugation is achieved. . By eliminating one or more binding groups it is possible to avoid conjugation with the non-polypeptide moiety in parts of the polypeptide in which such conjugation is disadvantageous, for example, with an amino acid residue located at or near a functional site of the polypeptide (since that conjugation at such a site may cause inactivation or binding to reduced CD80 or CD86 or reduced immunosuppressive activity of the resulting conjugate). In addition, it may be advantageous to eliminate a joint group located next to another joint group.
The amino acid residue comprising a binding group for a non-polypeptide moiety, whether it is an existing residue or a deleted or introduced residue, is selected based on the nature of the non-polypeptide moiety and, in some cases, based on the conjugation procedure to be used. For example, when the non-polypeptide moiety is a polymer molecule, such as a molecule derived from polyethylene glycol (PEG) or poly (alkylene oxide) (POA), the amino acid residues that can function as a binding group can be selected from the group consisting of cysteine, lysine (and / or the N-terminal amino group of the polypeptide), aspartic acid, glutamic acid, histidine and arginine. When the non-polypeptide moiety is a sugar moiety, the binding group is a Nu O-glycosylation site in vivo or in vitro, preferably an N-glycosylation site.
In some cases, in the part of the mutant CTLA-4 polypeptide of a conjugate of the invention, binding groups located at or near the receptor binding sites are removed, such as by substitution of the amino acid residue comprising such a group. In some cases, amino acid residues comprising a binding group with a non-polypeptide moiety, such as cysteine or lysine, are not frequently introduced at or near the receptor binding site of the mutant CTLA-4 polypeptide.
A mutant CTLA-4 polypeptide of the invention can be modified, so as to protect and thereby modify or destroy or otherwise inactivate an epitope present in the mutant CTLA-4 polypeptide, by conjugation with a non-polypeptide moiety. Epitopes of mutant CTLA-4 polypeptides can be identified by use of methods known in the art, also known as epitope mapping, see, for example, Romagnoli et al., J. Biol. Chem. 380 (5): 553-9 (1999), DeLisser HM, Methods Mol Biol, 1999, 96: 11-20, Van de Water et al., Clin. Immunol Immunopathol 85 (3): 229-35 (1997), Saint-Remy JM, Toxicology 119 (1): 77-81 (1997).
The exact number of binding groups available for conjugation and present in the mutant CTLA-4 polypeptide depends on the effect that is desired to be achieved by conjugation. The effect to be obtained depends, for example, on the nature and degree of conjugation (for example, the identity of the non-polypeptide moiety, the number of desirable or possible non-polypeptide moieties to conjugate with the polypeptide, when they should be conjugated or when conjugation should be avoided, etc.). For example, if reduced immunogenicity is desired, the number (and location) of binding groups should be sufficient to protect most or all epitopes. This is usually obtained when a greater proportion of the mutant CTLA-4 polypeptide is protected. Effective epitope protection is normally achieved when the total number of binding groups available for conjugation is in the range of 1-6 binding groups, for example, 1-5, such as in the range of 1-3, such as 1, 2 or 3 binding groups.
The functional in vivo half-life may depend on the molecular weight of the conjugate and, therefore, the number of binding groups necessary to provide the half-life increase depends on the molecular weight of the non-polypeptide moiety in question. Some of such conjugates comprise 1-6, for example, 1-5, such as 1-3, for example, 1, 2 or 3 non-polypeptide moieties, each having a molecular weight of approximately 100-2000 Daltons (Da) , such as approximately 200 Da, approximately 300 Da, approximately 400 Da, approximately 600 Da, approximately 900 Da, approximately 1000 Da, or approximately 2-40 kDa, such as approximately 2 kDa, approximately 5 kDa, approximately 12 kDa, approximately 15 kDa, approximately 20 kDa, approximately 30 kDa, approximately 40 kDa or approximately 60 kDa.
In the conjugate of the invention, some, most or substantially all conjugable binding groups are occupied by the relevant non-polypeptide moiety.
The conjugate of the invention may have one or more of the following improved properties: (a) increased serum half-life and / or functional in vivo half-life, (b) reduced antigenicity or reduced immunogenicity, (c) increased stability during storage, (d) increased bioavailability, (e) decreased effector function, or
<dl><dt>(F)</dt><dd> decrease or inhibition of self-association (for example, decrease in aggregate formation) between two </dd></dl>
<dl><dt /><dd>or more molecules of the invention. For example, the conjugate may have a reduced immunogenicity with respect to hCTLA-4 or with respect to the corresponding unconjugated polypeptide, for example, a reduction of at least 10%, such as a reduction of at least 25%, such as a reduction of at least 50%, for example, a reduction of at least 75% in comparison with the unconjugated polypeptide or in comparison with an hCTLA-4. The conjugate may have an increase in functional in vivo half-life and / or increase in serum half-life with respect to a reference molecule such as hCTLA-4 or with respect to the corresponding unconjugated polypeptide. Particular preferred conjugates are such conjugates in which the relationship between half-life in</dd></dl>
functional live (or serum half-life) of said conjugate and the functional in vivo (or serum half-life) of said reference molecule is at least 1.25, such as at least 1.50, such as at least 1.75 , such as at least 2, such as at least 3, such as at least 4, such as at least 5, such as at least 6, such as at least 7, such as at least 8. The half-life is conveniently determined in an experimental animal, such as rat or monkey, and can be based on intravenous or subcutaneous administration. In another aspect, the conjugate may exhibit an increase in bioavailability with respect to a reference molecule such as an hCTLA-4 or a corresponding unconjugated peptide.
The polymer molecule to be coupled with the polypeptide can be any suitable polymer molecule, such as a natural or synthetic homopolymer or heteropolymer, usually with a molecular weight in the range of 300-100,000 Da, such as 300-20,000 Da, more preferable in the range of 500-10,000 Da, even more preferably in the range of 500-5000 Da.
Examples of homopolymers include a polyol (i.e., poly-OH), a polyamine (i.e., poly-NH2) and a polycarboxylic acid (i.e., poly-COOH). A heteropolymer is a polymer comprising one or more different coupling groups such as, for example, a hydroxyl group and an amine group. Examples of suitable polymer molecules include polymer molecules selected from the group consisting of poly (alkylene oxide) (PAO), which includes polyalkylene glycol (PAG), such as polyethylene glycol (PEG) and polypropylene glycol (PPG), branched PEG, poly ( vinyl alcohol) (PVA), polycarboxylate, poly (vinyl pyrrolidone), polyethylene-co-anhydride of maleic acid, polystyrene-co-anhydride of malic acid, dextran which includes carboxymethyldextran, or any other suitable biopolymer to reduce immunogenicity and / or increase the functional in vivo half-life and / or serum half-life. Another example of a polymer molecule is human albumin or other abundant plasma protein. Generally, polymers derived from polyalkylene glycol are biocompatible, non-toxic, non-antigenic, non-immunogenic, have various water solubility properties and are easily removed from living organisms.
PEG is the preferred polymer molecule to be used since it only has few reactive groups that can be crosslinked compared to, for example, polysaccharides such as dextran and the like. In particular, monofunctional PEG, for example, monomethoxypolyethylene glycol (mPEG), is of interest since its coupling chemistry is relatively simple (only one reactive group is available to conjugate with binding groups in the polypeptide). Consequently, the risk of crosslinking is eliminated, the resulting polypeptide conjugates are more homogeneous and the reaction of the polymer molecules with the polypeptide is easier to control. When the molecule is PEGylated, it usually comprises 1, 2, 3, 4 or 5 polyethylene glycol (PEG) molecules. Each PEG molecule can have a molecular weight of about 5 kDa (kilodalton) at 100 kDa which includes, for example, about 10 kDa, about 12 kDa, about 20 kDa, about 40 kDa. Suitable PEG molecules are available from Shearwater Polymers, Inc. and Enzon, Inc. and can be selected from SS-PEG, NPC-PEG, aldehyde-PEG, mPEG-SPA, mPEG-SCM, mPEG-BTC, SC-PEG, three-sided mPEG (US 5,880,255), or oxycarbonyl-oxy-N-dicarboxyimide -PEG (US 5,122,614).
In one aspect, the invention provides an isolated or synthetic conjugate comprising: (a) a polypeptide of the invention (eg, mutant CTLA-4 ECD polypeptide, dimeric or monomeric mutant CTLA-4-Ig polypeptide, ECD polypeptide of CTLA-4 multimeric mutant, CTLA-4-Ig multimeric mutant); and (b) at least one non-polypeptide moiety such as, for example, 1-10, 1-9, 1-8, 1-7, 1-7, 1-6, 1-5, 1-4, 1 -3, 1, 2 or 3 non-polypeptide moieties bound to the polypeptide, wherein the conjugate binds to CD80 (for example, hCD80) and / or CD86 (for example, hCD86) and / or an extracellular domain of any of they or both (including hCD80-Ig and / or hCD86-Ig), and / or have an ability to induce an immune response (eg, T-cell dependent immune response). Exemplary polypeptides include those that have at least 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a polypeptide sequence selected from the group of SEQ ID NO: 1-79, 197-200, 205-214 and 219-222. In some cases, the conjugate comprises a non-polypeptide moiety. In some cases, the conjugate comprises two, three, four or more non-polypeptide moieties. In some cases, the amino acid sequence of the conjugate polypeptide further comprises one or more substitutions that each introduce a binding group for the non-polypeptide moiety (for example, by substituting an amino acid residue of the polypeptide sequence with a different residue comprising a binding group for the non-polypeptide moiety, or by insertion into the polypeptide sequence of an additional amino acid residue comprising a binding group for the non-polypeptide moiety).
A conjugate may comprise two or more polypeptides of the invention. In some cases, a non-polypeptide moiety is covalently bound to either or both of such polypeptides. If the conjugate comprises two or more identical polypeptides of the invention, the same type and number of non-polypeptide moieties are normally linked to each such polypeptide, usually in the same way to the corresponding binding group (s) ( s) in each polypeptide. As noted above, the non-polypeptide moiety may comprise, for example, a sugar molecule, which may optionally bind to an N-glycosylation site, or a polymer such as, for example, a polyethylene glycol moiety. The polyethylene glycol moiety can be covalently linked to a cysteine residue or lysine residue of the polypeptide of the invention. In some cases, the rest of polyethylene glycol is covalently bound to the amino group of the N-terminus of the polypeptide. A conjugate comprising a mutant CTLA-4-Ig of the invention can be described as a mutant CTLA-4-Ig conjugate of the invention. Conjugate multimers are also included. Multimeric conjugates include two or more
conjugates, in which at least one conjugate is a conjugate of the invention comprising at least one polypeptide of the invention. Conjugates in a multimeric conjugate can be, but do not need to be, identical to each other.
As discussed above, the polypeptides of the invention, which include fusion proteins of the invention, can commonly undergo glycosylation. The polypeptides and fusion proteins of the invention may be further subjected to (or modified so as to undergo) other forms of post-translational modification that include, for example, hydroxylation, lipid binding or lipid derivative, methylation, myristylation, pegylation, phosphorylation and sulphation. Other post-translational modifications that may be found in a fusion polypeptide or protein of the invention include acetylation, acylation, ADP-ribosylation, amidation, covalent binding of flavin, covalent binding of a heme moiety, covalent binding of a nucleotide or derivative of nucleotide, covalent phosphatidylinositol junction, crosslinking, cyclization, disulfide bond formation, demethylation, formylation, GPI anchor formation, iodination, oxidation, proteolytic processing, preylation, racemization, selenilation, arginylation and ubiquitination. Other common protein modifications are described in, for example, Creighton, above, Seifter et al., Meth. Enzymol 18: 626-646 (1990), and Rattan et al., Ann. NY Acad. Sci. 663: 48-62 (1992). Post-translational modifications for polypeptides or fusion proteins expressed from nucleic acids in host cells vary depending on what type of host or on what type of host cell the peptide is expressed. For example, glycosylation does not occur frequently in bacterial hosts such as E. coli and varies considerably in baculovirus systems with respect to mammalian cell systems. Therefore, when glycosylation is desired (which is normally the case for most of the polypeptides of the present invention), a polypeptide or fusion protein should be expressed (produced) in a glycosylating host, generally a eukaryotic cell (e.g., a mammalian cell or an insect cell). Modifications to the polypeptide or fusion protein in terms of post-translational modification can be verified by any suitable technique that includes, for example, X-ray diffraction, NMR imaging, mass spectrometry and / or chromatography (eg chromatography reverse phase, affinity chromatography,
or GLC).
The fusion polypeptide or protein may also comprise or alternatively comprise any suitable number of naturally occurring amino acids (e.g., β-amino acids) and / or alternative amino acids (e.g., selenocysteine) or amino acid analogs such as those listed. in MANUAL OF PATENT EXAMINING PROCEDURE § 2422 (7th revision -2000), which can be incorporated by protein synthesis, such as by solid phase protein synthesis (as described in, for example, Merrifield, Adv. Enzymol. 32: 221-296 (1969) and other references cited herein). A fusion polypeptide or protein of the invention can be further modified by the inclusion of at least one modified amino acid. The inclusion of one or more modified amino acids may be advantageous in, for example, (a) increasing the serum half-life of the fusion polypeptide or protein, (b) reducing the antigenicity of the fusion polypeptide or protein, or (c) increasing the stability during storage of the polypeptide or fusion protein. The amino acid (s) is modified, for example, co-translationally or post-translationally during recombinant production (eg, N-linked glycosylation site in NXS / T motifs during cell expression in mammal) or is modified (n) by synthetic means. Non-limiting examples of a modified amino acid include a glycosylated amino acid, a sulfated amino acid, a manned amino acid (e.g., farnesylated, geranylgeranylated), an acetylated amino acid, an acylated amino acid, a PEGylated amino acid, a biotinylated amino acid, a carboxylated amino acid, an amino acid phosphorylated and the like. The entire bibliography is full of appropriate references to guide an expert in amino acid modification. Sample protocols are found in Walker (1998) Protein Protocols on CD-ROM Humana Press, Towata, NJ. The modified amino acid may be selected from a glycosylated amino acid, a PEGylated amino acid, a farnesylated amino acid, an acetylated amino acid, a biotinylated amino acid, an amino acid conjugated to a lipid moiety and an amino acid conjugated to an organic derivatizing agent.
The invention further provides polypeptides (including fusion proteins) having the characteristics described above which further comprise additional amino acid sequences that affect the biological function (eg, immunogenicity, target choice and / or half-life) of the polypeptide (or fusion protein). ).
A polypeptide or fusion protein of the invention may additionally include a target sequence of choice other than, or in addition to, a signal sequence. For example, the polypeptide or fusion protein may comprise a sequence that selects as a target a receptor on a particular cell type (eg, a monocyte, dendritic cell or associated cell) to provide chosen administration as a target of the polypeptide to such cells and / or related tissues. Signal sequences are described above, and include location sequences in / membrane anchoring (eg, termination transfer sequences, GPI anchor sequences) and the like.
A particularly useful fusion component for a polypeptide of the invention (including a fusion protein of the invention) is a peptide sequence that facilitates the purification of the polypeptide, for example, a polypeptide purification sequence. A polynucleotide of the invention may comprise a frame-fused coding sequence with a marker amino acid sequence that, for example, facilitates purification of the encoded polypeptide. Such peptide domains that facilitate purification or purification sub-sequences of polypeptides include, but are not limited to, metal chelating peptides such as moduli of
histidine-tryptophan that allow purification on immobilized metals such as a hexa-histidine peptide or other polyhistidine sequence, a sequence encoding such a tag is incorporated into the pQE vector available from QIAGEN, Inc. (Chatsworth, California), a sequence that binds glutathione (eg, glutathione-S-transferase (GST)), a brand of hemagglutinin (HA) (corresponding to an epitope derived from the flu hemagglutinin protein; Wilson et al., Cell 37: 767 (1984)), maltose binding protein sequences, the FLAG epitope used in the FLAGS extension / affinity purification system (Immunex Corp, Seattle, WA) (commercially available FLAG epitopes also They are available from Kodak (New Haven, Connecticut)), an epitope brand E (E mark), thioredoxin (TRX), avidin and the like. Epitope tags that facilitate purification have been described in the art (see, for example, Whitehorn et al., Biotechnology 13: 1215-19 (1995)). A polypeptide may include an e-his tag that may comprise a polyhistidine sequence and an anti-epitope sequence (Pharmacia Biotech catalog); e-his brands can be prepared by conventional techniques. The inclusion of a protease cleavable polypeptide linker sequence between the purification domain and the polypeptide is useful to facilitate purification. Histidine residues facilitate purification on IMIAC (immobilized metal ion affinity chromatography (IMIAC), as described in Porath et al. Protein Expression and Purification 3: 263-281 (1992)), while the enterokinase cleavage site provides a method to separate the polypeptide from the fusion protein. PGEX vectors (Promega; Madison, WI) can also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can be easily purified from lysed cells by adsorption to ligand-agarose beads (eg, glutathione-agarose in the case of GST fusion) followed by elution in the presence of free ligand. Additional examples of sub-sequences that facilitate the purification of polypeptides and the use thereof for protein purification are described in, for example, International Patent Application Publication No. WO 00/15823. After expression of the polypeptide of interest and isolation thereof by such fusion constituents or otherwise as described above, the protein refolding steps can be used, as desired, in completing the mature polypeptide configuration.
A fusion protein of the invention may also include one or more additional peptide fragments or peptide portions that promote the detection of the fusion protein. For example, a fragment or portion of indicator peptide (e.g., fluorescent vede protein (GFP), β-galactosidase, or a detectable domain thereof) can be incorporated into the fusion protein. Additional marker molecules that can be conjugated with the polypeptide of the invention include radionuclides, enzymes, fluorophores, small molecule ligands and the like. Such fusion promoter detection components are particularly useful in fusion proteins used in diagnostic techniques discussed elsewhere herein.
In another aspect, a polypeptide of the invention may comprise a fusion component that promotes the stability of the polypeptide, secretion of the polypeptide (other than by choice of signal as a target), or both. For example, the polypeptide may comprise an immunoglobulin (Ig) domain such as an IgG polypeptide comprising a hinge region of Fc, a CH2 domain and a CH3 domain, which promotes stability and / or secretion of the polypeptide.
Peptide fragments or portions of fusion protein peptides may be associated in any suitable form. The various fragments or portions of fusion protein polypeptides can be covalently associated (for example, by means of a peptide bond or disulfide). The fragments or portions of polypeptides can be fused directly (for example, the C-terminus of an antigenic or immunogenic sequence of the invention can be fused to the N-terminus of a purification sequence or heterologous immunogenic sequence). The fusion protein may include any suitable number of modified bonds, for example, isosters, within or between the peptide portions. Alternatively or additionally, the fusion protein may include a linker peptide between one or more fragments or portions of polypeptides that includes one or more amino acid sequences that are not part of the biologically active peptide portions. Any suitable linker peptide can be used. Such a linker can have any suitable size. Typically, the linker has less than about 30 amino acid residues, less than about 20 amino acid residues and / or less than 10 amino acid residues. The linker may predominantly comprise or consist of neutral amino acid residues. Suitable linkers are generally described in, for example, US Pat. No. 5,990,275, 6,010,883, 6,197,946, and European patent application 0 035 384. If separation of peptide fragments or peptide portions is desired, a linker that facilitates separation can be used. An example of such a linker is described in US Pat. No. 4,719,326. "Flexible" linkers, which are normally composed of combinations of glycine and / or serine residues, may be advantageous. Examples of such linkers are described in, for example, McCafferty et al., Nature 348: 552-554 (1990), Huston et al., Proc. Natl. Acad. Sci. USA 85: 5879-5883 (1988), Glockshuber et al., Biochemistry 29: 1362-1367 (1990), and Cheadle et al., Molecular Immunol. 29: 21-30 (1992), Bird et al., Science 242: 423-26 (1988), and US Pat. No. 5,672,683, 6,165,476 and 6,132,992.
The use of a linker can also reduce the unwanted immune response to the fusion protein created by the fusion of the two peptide fragments or peptide portions, which can cause an unscheduled MHC I and / or MHC II epitope to be present in the fusion protein. In addition to the use of a linker, undesirable epitope sequences identified or adjacent sequences can be PEGylated (eg, by insertion of lysine residues to promote PEG binding) to protect identified epitopes from exposure. Other techniques for reducing the immunogenicity of the fusion protein of the invention that can be used in association with the administration of the fusion protein include the techniques provided in US Pat. No. 6,093,699.
Polypeptide Preparation
Recombinant methods for producing and isolating polypeptides of the invention (including fusion proteins
5 of the invention) are described below. In addition to recombinant production, polypeptides can be produced by direct peptide synthesis using solid phase techniques (see, for example, Stewart et al. (1969) Solid-Phase Peptide Synthesis, WH Freeman Co, San Francisco; Merrifield (1963) J. Am. Chem. Soc 85: 21492154). Peptide synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using the Applied Biosystems 431A peptide synthesizer (Perkin
10 Elmer, Foster City, Calif.) According to the instructions provided by the manufacturer. For example, the sub-sequences can be chemically synthesized separately and combined using chemical methods to provide mutant CTLA-4 polypeptides or functional fragments thereof. Alternatively, such sequences can be ordered from any number of companies specialized in the production of polypeptides. Most commonly, the polypeptides of the invention are produced by expressing nucleic acids encoding and recovering polypeptides,
fifteen for example, as described below.
The invention provides methods for producing polypeptides (including fusion proteins) of the invention. Such a method comprises introducing into a population of cells any nucleic acid described herein, which is operatively linked to an effective regulatory sequence to produce the encoded polypeptide, culturing the cells in a culture medium to produce the polypeptide and isolating the polypeptide. of cells 20 or of the culture medium. A sufficient amount of nucleic acid is used to facilitate cell uptake (transfection) and / or polypeptide expression. The culture medium may be any described herein and in the examples. Additional means are known to those skilled in the art. Nucleic acid is introduced into such cells by any administration procedure described herein that includes, for example, injection, needleless injection device, gene gun, electroporation 25 (e.g., DNA electroporation device, Biomedical Inovio Corp. (San Diego)), transdermal administration, passive collection, etc. The nucleic acid of the invention may be part of a vector, such as a recombinant expression vector, that includes a DNA plasmid vector, viral vector or any vector described herein. The nucleic acid or vector comprising a nucleic acid of the invention can be prepared and formulated as described herein; above, and in the examples below 30. Such a nucleic acid or expression vector can be introduced into a population of cells of a mammal in vivo, or cells selected from the mammal (eg, tumor cells) can be removed from the mammal and the nucleic acid expression vector introduced ex vivo into the population of such cells in a sufficient amount so that the uptake and expression of the encoded polypeptide results. Or, a nucleic acid or vector comprising a nucleic acid of the invention is produced using cells cultured in vitro. In one aspect, the method of producing a polypeptide of the invention comprises introducing into a population of cells a recombinant expression vector comprising any nucleic acid described herein in an amount and formula so as to result in the uptake of the vector and polypeptide expression; administering the expression vector to a mammal by any introduction / administration format described herein; and isolate the polypeptide from the mammal or a by-product of the mammal. Suitable host cells, vectors of
40 Expression, methods for transfecting host cells with an expression vector comprising a nucleic acid sequence encoding a polypeptide of the invention, cell cultures and methods for producing and recovering such polypeptide from a cell culture are described in detail later in the section. entitled "Nucleic acids of the invention". Additional production procedures are discussed in the examples, below.
Four. Five As noted above, the polypeptides of the invention (including fusion proteins of the invention) can undergo various changes, such as one or more insertions, deletions and substitutions of amino acids or nucleic acids, both conservative and non-conservative, which include in which, for example, such changes could provide certain advantages in their use, for example, in their therapeutic or prophylactic use or administration or diagnostic application. Procedures for preparing polypeptide variants using
fifty Substitutions, deletions, insertions and additions of amino acids are routine in the field. Polypeptides and variants thereof that have the desired ability to bind to CD80 and / or CD86, or a fragment thereof (eg, ECD), or an ability to suppress an immune response in vitro or in vivo as described in detail elsewhere in this document, are easily identified by tests known to those skilled in the art and by the tests described herein. See, for example, the essays
55 presented in the examples below.
The nucleic acids of the invention, discussed in greater detail below, can also undergo various changes such as one or more substitutions of one or more nucleic acids in one or more codons so that a particular codon encodes the same or a different amino acid. , producing both a conservative and non-conservative substitution, or one or more deletions of one or more nucleic acids in the sequence. Nucleic acids 60 may also be modified to include one or more codons that provide optimal expression in an expression system (eg, mammalian cell or mammalian expression system), while, if desired, said one or more codons still encode the same amino acid (s). Procedures for preparing variants
of nucleic acids using substitutions, deletions, insertions and additions of nucleic acids, and degenerate codons, are routine in the art, and variants of nucleic acids encoding polypeptides having the desired properties described herein (e.g., a capacity to bind to CD80 and / or CD86, and / or suppress an immune response in vitro or in vivo) are easily identified using the assays described herein. Such nucleic acid changes could provide certain advantages in their therapeutic or prophylactic use or administration or diagnostic application. In one aspect, nucleic acids and polypeptides can be modified in several ways as long as they comprise a nucleic acid or polypeptide sequence substantially identical to the nucleic acid sequence of a nucleic acid encoding the respective mutant CTLA-4 polypeptide or CTLA polypeptide. -4 mutant of the invention, respectively.
Nucleic acids
The disclosure provides isolated or recombinant nucleic acids (also referred to herein as polynucleotides), collectively referred to as "nucleic acids of the disclosure" (or "polynucleotides of the disclosure"), which encode polypeptides of the disclosure. The nucleic acids of the disclosure, which include all those described below, are useful in the recombinant production (eg, expression) of polypeptides of the disclosure, typically by expression of a plasmid expression vector comprising a sequence encoding the polypeptide or fragment thereof; as therapeutic agents; as prophylactics; as diagnostic tools; as diagnostic probes for the presence of complementary or partially complementary nucleic acids (including for the detection of a natural CTLA-4 nucleic acid). For example, the nucleic acids of the disclosure, which include all described below, are useful because they encode polypeptides that are useful in suppressing or inhibiting an immune response (eg, activation of T lymphocytes, proliferation of T lymphocytes, synthesis or cytokine production (e.g., production of TNF-∀, IFN- !, IL-2), induction of activation markers (e.g., CD25, IL-2 receptor), inflammation, production of anti-collagen antibodies and / or T lymphocyte-dependent antibody response) in in vitro and / or in vivo applications that include, for example, prophylactic and / or therapeutic procedures for treating diseases, disorders and conditions of the immune system in that suppression of an immune response is desired (for example, procedures to treat autoimmune diseases and disorders and procedures to inhibit rejection of a tissue transplant, cell or organ of a donor by a recipient). The nucleic acids of the disclosure can also be incorporated into useful expression vectors for gene therapy, DNA vaccination and immunosuppressive therapy. Additional uses of the nucleic acids and vectors of the disclosure comprising such nucleic acids are described elsewhere herein.
In one aspect, an isolated or recombinant nucleic acid is disclosed herein comprising a nucleotide sequence encoding any polypeptide (including any fusion protein, etc.) of the disclosure described above in the section entitled "Polypeptides of the disclosure" ”And elsewhere in this document. The disclosure also provides an isolated or recombinant nucleic acid comprising a nucleotide sequence that encodes a combination of two or more of any polypeptide (including any fusion protein) described above and elsewhere herein. Also included is a nucleic acid encoding any polypeptide of the disclosure such as, for example, a mutant CTLA-4 ECD polypeptide or mutant CTLA-4-Ig fusion protein comprising a codon sequence substantially optimized for expression in a mammalian host, such as a human being.
For example, an isolated or recombinant nucleic acid comprising a polynucleotide sequence encoding a polypeptide comprising a polypeptide sequence having at least 75%, 80%, 85%, 86%, 87% is disclosed herein. , 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, or a complementary polynucleotide sequence thereof, in which the polypeptide binds to CD80 and / or CD86 or a fragment of CD80 and / or CD86 polypeptide (eg, an extracellular domain of CD80 and / or CD86 ), and / or suppress an immune response in vitro and / or in vivo, or a complementary polynucleotide sequence thereof. Additional details regarding the properties and functional characteristics of such polypeptides are discussed above in "Disclosure Polypeptides". Some of such nucleic acids encode a polypeptide comprising a polypeptide sequence having an amino acid length approximately equal to the amino acid length of the hCTLA-4 ECD; such as 110-138, 112-132, 118-130,119-129, 120-128, 121-127, 122-126, 123-125 or 124 amino acid residues. Exemplary nucleic acids encoding mutant CTLA-4 ECD polypeptides comprise the sequences set forth in SEQ ID NO: 1-73, but are not limited to, for example, nucleic acids having the nucleotide sequences set forth in SEQ ID NO: 80-152, respectively. For example, an exemplary nucleic acid encoding the polypeptide shown in SEQ ID NO: 1 (clone D3-1) is the nucleic acid shown in SEQ ID: 80. Fragments of any such nucleic acids are also included, in which such fragment encodes a polypeptide that binds to CD80 and / or CD86 and / or an ECD of either or both, and / or has an ability to suppress a response. immune
An isolated or recombinant nucleic acid is disclosed herein that comprises a polynucleotide sequence encoding a polypeptide (eg, mutant CTLA-4 ECD polypeptide) comprising a sequence of polypeptides (a) that differs from a sequence of polypeptides selected from the group consisting of SEQ ID NO: 1-73 in no more than 6 amino acid residues (for example, no more than 1, 2, 3, 4, 5 or 6
amino acid residues), and (b) in which the amino acid residue in the polypeptide sequence at position 41, 50, 54, 55, 56, 64, 65, 70 or 85 is identical to the amino acid residue at position corresponding of said polypeptide sequences selected from the group consisting of SEQ ID NO: 1-73, in which the polypeptide binds to CD80 and / or CD86 and / or an extracellular domain of either or both, and / or inhibits an immune response in vitro and / or in vivo, or a polynucleotide sequence complementary of them. That is, the amino acid residue in such position 41, 50, 54, 55, 56, 64, 65, 70 or 85 in such a selected polypeptide sequence is not deleted or substituted. Some of such nucleic acids encode polypeptides that comprise a sequence that differs from the selected polypeptide sequence in no more than 6 amino acid residues and that includes amino acid residues in 2, 3, 4, 5, 6, 7, 8, 9 , 10, 11, 12, 13 and / or 14 positions selected from amino acid positions 24, 30, 32, 41, 50, 54, 55, 56, 64, 65, 70, 85, 104 and 106 that are identical to amino acid residues at the corresponding positions in the selected polypeptide sequence. Such polypeptides can be distinguished from the polypeptide sequence selected by deletion (deletions) of amino acids, addition (additions) and / or substitution (substitutions) of amino acids. An amino acid substitution may be a conservative or non-conservative substitution. Conservative substitutions by way of example are discussed in the section entitled "Sequence variation". Some of such polypeptides comprise a sequence that is approximately 118-130, 119-129, 120-128, 121-127, 122-126, 123-125 or 124 amino acid residues. Additional details of the properties and functional characteristics of such polypeptides are discussed above. Exemplary nucleic acids include, but are not limited to, for example, those comprising the nucleotide sequences set forth in SEQ ID NO: 80-152.
Also disclosed herein is an isolated or recombinant nucleic acid comprising a polynucleotide sequence encoding a polypeptide (eg, mutant CTLA-4 ECD) comprising a polypeptide sequence comprising (i) at least 95% , 96%, 97%, 98%, 99% or 100% identity with any polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73 and (ii) a phenylalanine residue at an amino acid position corresponding to position 70 of said polypeptide sequences selected from the group consisting of SEQ ID NO: 1-73, wherein the polypeptide binds to hCD80 and / or hCD86 or an ECD thereof and / or inhibits an immune response, or a complementary polynucleotide sequence thereof. Some of such nucleic acids encode polypeptides comprising one or more of the following with respect to the selected sequence: a glutamic acid residue at an amino acid position corresponding to position 24; an asparagine residue at an amino acid position corresponding to position 30; an isoleucine residue at an amino acid position corresponding to position 32; a methionine residue at an amino acid position corresponding to position 50; a lysine residue at an amino acid position corresponding to position 54; a glutamic acid residue at an amino acid position corresponding to position 55; an aspartic acid residue at an amino acid position corresponding to position 56; a proline residue at an amino acid position corresponding to position 64; a serine residue at an amino acid position corresponding to position 65; and a glutamic acid residue at an amino acid position corresponding to position 104. Some of such nucleic acids encode polypeptides that comprise a polypeptide sequence that is approximately 118-130, 119-129, 120128, 121-127, 122-126, 123-125 or 124 amino acid residues. Additional details of the properties and functional characteristics of such polypeptides are discussed above.
Also disclosed herein is an isolated or recombinant nucleic acid encoding any multimer of any polypeptide described above (eg, dimer, tetramer, etc.). As discussed in greater detail elsewhere, a dimer comprising two polypeptides of the disclosure (including two fusion proteins) is normally formed during cell processing by the generation of one or more covalent disulfide bonds between residue (s) of cysteine in a polypeptide and cysteine residue (s) in the second polypeptide. Similarly, other multimers can be formed. For example, an isolated or recombinant nucleic acid comprising a polynucleotide sequence encoding a recombinant polypeptide dimer comprising two polypeptides is disclosed herein, in which each such polypeptide comprises a polypeptide sequence having at least 95 %, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of SEQ ID NO: 1-73, wherein the dimer binds to hCD80 and / or hCD86 and / or inhibits an immune response, or a complementary polynucleotide sequence thereof.
Also disclosed herein is an isolated or recombinant nucleic acid encoding any fusion protein of the invention, which includes any multimeric fusion protein of the disclosure (eg, dimers, tetramers, etc.). Also disclosed herein is isolated or recombinant nucleic acid comprising a polynucleotide sequence encoding a fusion protein comprising
(a) a polypeptide comprising a polypeptide sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 %, 99.5% or 100% identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, and (b) an Ig polypeptide, in which the fusion protein binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or has a capacity to suppress an immune response, or a complementary polynucleotide sequence thereof. The Ig polypeptide may comprise an Ig Fc polypeptide that includes, for example, an Ig Fc polypeptide comprising a polypeptide sequence having at least 95%, 96%, 97%, 98%, 99% or 100% identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 184-186 and 218. A dimeric fusion protein comprising two such monomeric fusion proteins is normally formed during the
cellular processing by the generation of covalent disulfide bonds between cysteine residues in a monomeric fusion protein and cysteine residues in the second monomeric fusion protein. Similarly, other multimers can be formed. Additional details of the properties and functional characteristics of such fusion proteins are discussed above.
Also disclosed herein is an isolated or recombinant nucleic acid comprising a polynucleotide sequence encoding a protein dimer (eg, mutant CTLA-4-Ig dimer) comprising two monomeric fusion proteins (eg, CTLA -4-monomeric mutant Ig), each monomeric fusion protein comprising: (a) a polypeptide (eg, mutant CTLA-4 ECD) comprising a polypeptide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98%, 99%, 99.5% or 100% identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, and (b) an Ig polypeptide, in which the fusion protein dimer binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or has a ability to inhibit or suppress an immune response, or a complementary polynucleotide sequence thereof. The two monomeric fusion proteins, after expression, are linked together by at least one disulfide bond formed between the two cysteine residues present in each monomeric mutant CTLA-4-Ig fusion protein. The Ig polypeptide may comprise an Ig Fc polypeptide that includes, for example, an Ig Fc polypeptide comprising a sequence having at least 95%, 96%, 97%, 98%, 99% or 100 % identity with a sequence selected from the group consisting of SEQ ID NO: 184186 and 218. In some cases, the C-terminus of the (a) polypeptide is covalently bound or fused to the N-terminus of the Ig Fc polypeptide of ( b). Additional details of the properties and functional characteristics of such dimers are discussed above.
A termination codon (eg, tga) is normally included at the C-terminus of each nucleic acid sequence when the sequence is included in an expression vector for the expression of a protein of interest. For example, each of the nucleotide sequences of the invention encoding a mutant CTLA-4 polypeptide
or mutant CTLA-4 fusion protein may optionally additionally include a termination codon at the C-terminus such as TAA. A different termination codon may be substituted with TAA, such as a TGA termination codon. A nucleic acid sequence encoding a natural fusion protein (for example, hCTLA-4-Ig, hCD86-Ig, etc.) may also include a termination codon at its C-terminus. Each of the nucleotide sequences may optionally additionally include at the N-terminus a nucleotide sequence encoding a signal peptide to facilitate the secretion of a mutant CTLA-4 polypeptide or fusion protein.
Exemplary mutant CTLA-4-Ig fusion protein dimers include those comprising the polypeptide sequences shown in SEQ ID NO: 74-79, 197-200, 205-214 and 219-222. Exemplary nucleic acids encoding mutant CTLA-4 Ig fusion proteins of SEQ ID NO: 74-79, 197-200, 220 and 222 are set forth in SEQ ID NO: 153-158, 201-204 and 223- 224, respectively. The fusion protein sequences of SEQ ID NO: 205-210, 211-214, 219 and 221 are identical to the protein sequences of SEQ ID NO: 74-79, 197-200, 220 and 222, respectively, except that the protein sequences of SEQ ID NO: 205-210 do not include the lysine residue (K) of the C-terminus; As explained above, it is believed that the expected lysine residue of the C-terminus, which is encoded by the AAA codon immediately preceding the TAA termination codon of each such polynucleotide sequence, is cleaved from the resulting fusion protein during processing or secretion The nucleic acid sequences of SEQ ID NO: 153-158, 201-204 and 223-224 encode the fusion protein sequences of SEQ ID NO: 74-79, 197-200, 220 and 222, respectively, each of which produces after the cleavage / loss of residue K of the C-terminus the fusion protein sequences shown in SEQ ID NO: 205-210, 211-214, 219 and 221, respectively.
Each of the polynucleotide sequences SEQ ID NO: 153-158, 201-204 and 223-224 also includes at its N-terminus a nucleotide sequence encoding the signal peptide shown in SEQ ID NO: 181 or 215, signal peptide that It is ultimately cleaved to form the mature fusion protein. Nucleotide residues 1-111 of each of the polynucleotide sequences of SEQ ID NO: 153-158, 201-204 and 223-224, as counted from the N-terminus of each polynucleotide sequence such (nucleotide residues 1-111 are set forth in SEQ ID NO: 215), encode the hCTLA-4 WT signal peptide of 37 amino acid residues shown in SEQ ID NO: 216, signal peptide that is cleaved last after expression of the monomer or dimer of mature mutant CTLA-4 fusion proteins; therefore, for each of the nucleic acid sequences of SEQ ID NO: 153-158, 201-204 and 223-224, the first codon encoding the first amino acid residue (methionine) of the mature IgG2 fusion protein it is composed of nucleotide residues 112-114 of said nucleotide sequences. As noted above, in some cases, the signal peptide sequence may comprise only amino acid residues 1-35 as shown in SEQ ID NO: 182 and the nucleotide sequence encoding this signal peptide of 35 amino acid residues is shown. in SEQ ID NO: 181. However, the lysine (K) and alanine (A) residues encoded at positions 36 and 37, respectively (encoded by the two AAA-GCC codons), are not present in the mature mutant CTLA-4-Ig fusion protein resulting and it is believed that they are cleaved from the mature fusion protein CTLA-4-Ig mutant during processing. The sequence of mature mutant CTLA-4 proteins normally begins with the methionine residue present at the position of amino acid residue 38 of the encoded mutant CTLA-4-Ig fusion protein.
An isolated or recombinant nucleic acid is disclosed herein comprising a polynucleotide sequence encoding a fusion protein dimer (e.g., mutant CTLA-4-Ig dimer) comprising two identical monomeric fusion proteins (e.g. , CTLA-4-Ig monomeric mutant), wherein each such monomeric fusion protein comprises a polypeptide sequence having at least 95%, 96%, 97%, 98%, 99% or 100% identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222, in which the fusion protein dimer binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or has an ability to inhibit an immune response, or a complementary polynucleotide sequence thereof. An isolated or recombinant nucleic acid that encodes such a monomeric fusion protein that binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig) is also disclosed, and / or has an ability to inhibit a response immune Exemplary dimers of the mutant CTLA-4-Ig fusion protein include those comprising polypeptide sequences shown in SEQ ID NO: 74-79, 197-200, 220 and 222; Exemplary nucleic acids encoding such mutant CTLA-4 Ig fusion proteins, which are expressed as mutant CTLA-4-Ig fusion protein dimers, include those comprising polynucleotide sequences shown in SEQ ID NO: 153-158 , 201-204 and 223-224, respectively. Additional exemplary mutant CTLA-4-Ig fusion protein dimers comprise the polypeptide sequences of SEQ ID NO: 205-210, 211-214, 219 and 222, which are expressed as fusion protein dimers; These fusion proteins lack the lysine residue of the C-terminus because it is normally cleaved during processing or before secretion. Exemplary nucleic acids encoding these fusion protein sequences with the C-terminal lysine (the lysine is subsequently cleaved) include the polynucleotide sequences of SEQ ID NO: 153-158, 201-204 and 223-224, respectively .
An isolated or recombinant nucleic acid comprising a polynucleotide sequence encoding a fusion protein is disclosed herein, wherein said fusion protein comprises a polypeptide sequence having at least 95%, 96%, 97%. , 98%, 99% or 100% identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222, in which the fusion protein binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or has an ability to inhibit an immune response, or a complementary polynucleotide sequence thereof.
An isolated or recombinant nucleic acid comprising a nucleotide sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with a polynucleotide sequence is disclosed herein. selected from the group consisting of SEQ ID NO: 153-158, 201-204 and 223-224, in which such nucleic acid encodes a mutant CTLA-4-Ig protein dimer that binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86- Ig), and / or has an ability to inhibit an immune response, or a complementary polynucleotide sequence thereof.
An isolated or recombinant nucleic acid is disclosed herein comprising a polynucleotide sequence encoding a fusion protein dimer (e.g., mutant CTLA-4-Ig dimer) comprising two monomeric fusion proteins (e.g., CTLA-4-Ig monomeric mutant), in which each such monomeric fusion protein comprises: (1) a polypeptide (eg, mutant CTLA-4 ECD) comprising a polypeptide sequence that differs from a polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73 in no more than 6 amino acid residues, and in which the amino acid residue in the polypeptide sequence at position 41, 50, 54, 55, 56, 64, 65, 70 or 85 is identical to the residue of amino acid at the corresponding position of said selected polypeptide sequence (for example, a polypeptide selected from SEQ ID NO: 1-73), and (2) an Ig Fc polypeptide, in which the dimer binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or inhibits a response immune, or a complementary polynucleotide sequence thereof. Additional details of the properties and functional characteristics of such dimers are discussed above. A recombinant or isolated nucleic acid is also disclosed which comprises a nucleotide sequence encoding a monomeric fusion protein such that it binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig) and / or has an ability to inhibit an immune response.
An isolated or recombinant nucleic acid is disclosed herein comprising a polynucleotide sequence encoding a fusion protein dimer (e.g., mutant CTLA-4-Ig dimer) comprising two monomeric fusion proteins (e.g., two CTLA-4-Ig monomeric mutants), wherein each such monomeric fusion protein comprises: (1) a mutant CTLA-4 extracellular domain polypeptide comprising a polypeptide sequence that (a) differs from a polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73 in no more than 6 residues of amino acids, and (b) comprises at least one amino acid substitution at an amino acid position corresponding to position 50, 54, 55, 56, 64, 65, 70 or 85 with respect to the polypeptide sequence of SEQ ID NO: 159 ; and (2) an Ig polypeptide, in which the fusion protein dimer binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or inhibits an immune response, or a complementary polynucleotide sequence thereof. Additional details of the properties and functional characteristics of such dimers are discussed above. The Ig polypeptide may comprise an Ig Fc polypeptide that includes, for example, an Ig Fc polypeptide comprising a sequence having at least 90%, 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of SEQ ID NO: 184-186 and 218. Some of such polypeptides of (a) comprise at least one substitution at an amino acid position with respect to SEQ ID NO: 159 selected from the group consisting of A50M, M54K, G55E, N56D, S64P, I65S and S70F. Some of such polypeptides of (a) further comprise an amino acid substitution with respect to SEQ ID NO: 159 at position 104 (eg, L104E / D),
position 30 (for example, T30N / D / A) and / or position 32 (for example, V32I). A recombinant or isolated nucleic acid that encodes such a monomeric fusion protein that binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig) and / or has an ability to inhibit an immune response is also disclosed. .
An isolated or recombinant nucleic acid encoding a fusion protein dimer (for example, mutant CTLA-4-Ig dimer) comprising two monomeric fusion proteins (for example, mutant CTLA-4-Ig) is disclosed herein. monomeric), wherein each such monomeric fusion protein comprises: (1) a polypeptide (eg, mutant CTLA-4 ECD) comprising a sequence of polypeptides that (i) has at least 92%, 93%, 94%, 95%, 96%, 97%, 98% , 99% or 100% identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73 and (ii) includes a phenylalanine residue at an amino acid position corresponding to position 70 of said sequences of polypeptides selected from the group consisting of SEQ ID NO: 1-73; and (2) an Ig polypeptide, in which the fusion protein dimer binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig), and / or has an ability to inhibit a immune response, or a complementary polynucleotide sequence thereof. The encoded Ig polypeptide may comprise an Ig Fc polypeptide comprising a polypeptide sequence having at least 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100 % identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 184-186 and 218. Some of such encoded dimers comprise one or more of the following with respect to said polypeptide sequence selected from (1) (i): a Glu residue in a position corresponding to position 24; an Asn in a position corresponding to position 30; an Ile residue in a position corresponding to position 32; a residue of Met in a position corresponding to position 50; a residue of Lys in a position corresponding to position 54; a residue of Glu in a position corresponding to position 55; an Asp residue in a position corresponding to position 56; a Pro residue in a position corresponding to position 64; a residue of Ser at an amino acid position corresponding to position 65; and a Glu residue in a position corresponding to position 104. Additional details of the properties and functional characteristics of such dimers are discussed above. A recombinant or isolated nucleic acid is also disclosed which comprises a nucleotide sequence encoding a monomeric fusion protein such that it binds to CD80 and / or CD86 (and / or CD80-Ig and / or CD86-Ig) and / or has an ability to inhibit an immune response.
Fragments of any such nucleic acids of the disclosure described above are also disclosed, in which such fragments encode a polypeptide that binds to hCD80 and / or hCD86 and / or an ECD of either or both, and / or has a ability to suppress or inhibit an immune response. Many fragments of these nucleic acids will express polypeptides that bind to hCD80 and / or hCD86 or an ECD thereof, or suppress an immune response, properties that can be easily identified with reasonable experimentation. Nucleotide fragments typically comprise at least 250, 300, 400, 500, 600, 700, 800, 900, 950, 1000 or more nucleotide bases.
The disclosure includes an isolated or recombinant nucleic acid encoding a protein comprising a signal peptide and a polypeptide disclosed herein (which includes a dimeric or monomeric fusion protein), such as a mutant CTLA-4 ECD polypeptide or CTLA-4-Ig mutant fusion protein, which binds to CD80 and / or CD86 and / or suppresses an immune response in in vitro or in vivo assays and / or procedures as described in detail elsewhere herein. The encoded signal peptide sequence, which directs the secretion of the mature polypeptide by a prokaryotic or eukaryotic cell membrane, is normally covalently linked to the amino terminus of said polypeptide. A variety of signal peptides may be used that include, for example, the signal peptide sequence set forth in SEQ ID NO: 182, which is encoded by, for example, the nucleotide sequence shown in SEQ ID NO: 181, or the sequence of signal peptides set forth in SEQ ID NO: 216, which is encoded by, for example, the nucleotide sequence shown in SEQ ID NO: 215. The disclosure also includes an isolated or recombinant nucleic acid encoding a protein comprising a signal peptide, mutant CTLA-4 ECD polypeptide, transmembrane domain and / or cytoplasmic domain as discussed in detail above.
The signal peptide sequence of the full-length human CTLA-4 protein can be used to direct the expression or secretion of a recombinant mutant CTLA-4 ECD polypeptide or mutant CTLA-4-Ig fusion protein of the invention. In one aspect, the signal peptide (SP) of the hCTLA-4 protein comprises amino acid residues 1-37 of the hCTLA-4 protein; This signal peptide sequence is shown in SEQ ID NO: 216. In this case, the mature hCTLA-4 protein normally begins with the methionine residue at position 38, and the amino acid residues of the mature hCTLA-4 protein are therefore numbered starting with this methionine residue designated the first amino acid. (that is, it occupies position 1). Thus, a signal peptide comprising the peptide sequence shown in SEQ ID NO: 216 can be fused or ligated with the amino (N) end of a mutant CTLA-4 ECD polypeptide or mutant CTLA-4-Ig fusion protein of the invention, such as by a covalent bond, so as to facilitate expression or secretion of the mutant CTLA-4 ECD polypeptide or mutant CTLA-4-Ig fusion protein, respectively. An exemplary nucleic acid comprising a nucleotide sequence encoding the hCTLA-4 signal peptide sequence of SEQ ID NO: 216 is set forth in SEQ ID NO: 215.
When the signal peptide sequence of SEQ ID NO: 216 is fused to bind to the N-terminus of a mutant CTLA-4 ECD polypeptide or mutant CTLA-4-Ig fusion protein, after expression or secretion of said polypeptide or protein fusion, the signal peptide is cleaved; the resulting mature mutant CTLA-4 ECD polypeptide or the mature mutant CTLA-4-Ig fusion protein normally begins with the methionine residue at position 38, and the amino acid residues of the mature mutant CTLA-4 ECD polypeptide or mature mutant CTLA-4-Ig fusion protein are therefore numbered starting with this methionine residue which is designated the first
5 amino acid (that is, it occupies position 1).
The disclosure includes an isolated or recombinant polypeptide comprising a signal peptide (eg, SEQ ID NO: 216) and a mutant CTLA-4 ECD polypeptide (eg, a sequence selected from the group of SEQ ID NO: 1-73 ), in which the signal peptide is covalently linked to the N-terminus of the mutant CTLA-4 ECD polypeptide. Also disclosed is an isolated or recombinant polypeptide comprising a signal peptide (for example, SEQ ID NO: 216) and a mutant CTLA-4-Ig (for example, a sequence selected from the group of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222), in which the signal peptide is covalently linked to the N-terminus of the mutant CTLA-4-Ig. An isolated or recombinant nucleic acid comprising a nucleotide sequence (eg, SEQ ID NO: 215) encoding a signal peptide (eg, SEQ ID NO: 216) and a nucleotide sequence encoding a polypeptide of the polypeptide is also disclosed. CTD-4 mutant ECD (for example, a sequence
fifteen selected from the group of SEQ ID NO: 1-73) or a mutant CTLA-4-Ig fusion protein (eg, a sequence selected from the group of SEQ ID NO: 74-79, 197-200, 205-214 and 219 -222).
In an alternative aspect, the full-length hCTLA-4 protein signal peptide comprises residues 135 of the full-length hCTLA-4 protein; This signal peptide comprises the peptide sequence shown in SEQ ID NO: 182. However, in this case, the two amino acid residues lysine (K) and alanine (A) in the 20 positions 36 and 37, respectively, of the hCTLA-4 protein are normally absent from the mature secreted hCTLA-4 protein as has been determined by protein sequencing. Thus, the resulting mature hCTLA-4 protein begins similarly with the methionine residue at position 38, and the amino acid residues of the mature hCTLA-4 protein are therefore numbered starting with this methionine residue at position 38 of the hCTLA-4 protein that is designated the first amino acid of the mature hCTLA-4 protein. Because the
25 amino acid residues lysine (K) and alanine (A) at positions 36 and 37, respectively, of the full-length hCTLA-4 protein are not present in the resulting mature hCTLA-4 protein, it is believed that they have been cleaved from the hCTLA-4 protein matures during processing. An exemplary nucleic acid comprising a nucleotide sequence encoding the signal peptide sequence of hCTLA-4 (SEQ ID NO: 182) is shown in SEQ ID NO: 181.
30 A signal peptide comprising the peptide sequence shown in SEQ ID NO: 182 may be fused or ligated with the N-terminus of a mutant CTLA-4 ECD polypeptide or mutant CTLA-4-Ig fusion protein of the invention, such as by a covalent bond, so as to facilitate expression or secretion of the mutant CTLA-4 ECD polypeptide or mutant CTLA-4-Ig fusion protein, respectively. When the signal peptide sequence of SEQ ID NO: 182 is fused or ligated with the N-terminus of a CTLA-4 ECD polypeptide
35 mutant or fusion protein CTLA-4-Ig mutant, after expression or secretion of the fusion polypeptide or protein, the signal peptide is cleaved; however, the resulting mature mutant CTLA-4 ECD polypeptide or the mature mutant CTLA-4-Ig fusion protein normally begins with the methionine residue at position 38, and the amino acid residues of the CTLA- ECD polypeptide 4 mature mutant or the mature mutant CTLA-4-Ig fusion protein are therefore numbered starting with this methionine residue which is designated the first
40 amino acid (that is, it occupies position 1). Because the amino acid residues lysine (K) and alanine (A) at positions 36 and 37, respectively, of the full-length hCTLA-4 protein are not present in the resulting mature mutant CTLA-4 ECD polypeptide or The mature mutant CTLA-4-Ig fusion protein is believed to have been cleaved from said mutant CTLA-4 ECD polypeptide or mutant CTLA-4-Ig fusion protein during processing.
Four. Five The disclosure includes an isolated or recombinant polypeptide comprising a signal peptide (for example, SEQ ID NO: 182) and a mutant CTLA-4 ECD polypeptide (for example, a sequence selected from the group of SEQ ID NO: 1-73 ), in which the signal peptide is covalently linked to the N-terminus of the mutant CTLA-4 ECD polypeptide. Also disclosed is an isolated or recombinant polypeptide comprising a signal peptide (for example, SEQ ID NO: 182) and a mutant CTLA-4-Ig (for example, a sequence selected from the group of SEQ ID NO: 74-79,
fifty 197-200, 205-214 and 219-222), in which the signal peptide is covalently linked to the N-terminus of the mutant CTLA-4-Ig. An isolated or recombinant nucleic acid is also disclosed comprising a nucleotide sequence (eg, SEQ ID NO: 181) encoding a signal peptide (eg, SEQ ID NO: 182) and a nucleotide sequence encoding a polypeptide of the Mutant CTLA-4 ECD (for example, a sequence selected from the group of SEQ ID NO: 1-73) or a mutant CTLA-4-Ig fusion protein (for example, a
55 sequence selected from the group of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222).
A nucleic acid as disclosed herein may further comprise one or more suitable additional nucleotide sequences. For example, since a polypeptide of the disclosure (which includes a fusion protein of the invention) may comprise one or more additional polypeptide sequences such as, for example, a polypeptide purification sequence (such as, for example, a Subsequence is selected from an epitope brand, a FLAG brand, a polyhistidine sequence and a GST fusion), signal peptide sequence, etc., The disclosure includes nucleic acids encoding all such polypeptides comprising such additional sequences. Signal peptides by way of example, which after expression are
normally covalently linked to the N-terminus of a polypeptide of the invention, are discussed above. For example, a nucleic acid encoding a polypeptide sequence of any of SEQ ID NO: 1-79, 197-200, 205-214 and 219-222 may further comprise a nucleic acid encoding a signal peptide, such as the sequence of signal peptides of SEQ ID NO: 182 such as, for example, the nucleotide sequence set forth in SEQ ID NO: 181, or the signal peptide sequence set forth in SEQ ID NO: 216, which is encoded by, for example, the nucleotide sequence shown in SEQ ID NO: 215. Such nucleotide sequences can be fused directly together, in an appropriate reading frame, so that the resulting nucleic acid comprises a nucleotide sequence encoding a signal peptide and a nucleotide sequence encoding a polypeptide.
A nucleic acid of the invention can be isolated by any suitable technique, of which several are known in the art. An isolated nucleic acid of the invention (for example, a nucleic acid that is prepared in a host cell and subsequently substantially purified by any suitable nucleic acid purification technique) can be re-introduced into a host cell or re-introduced into a host cell. cellular or other biological environment or composition in which it is no longer the dominant nucleic acid species and is no longer separated from other nucleic acids.
Almost any isolated or recombinant nucleic acid of the invention can be inserted into or fused with a suitable larger nucleic acid molecule (including, for example, but not limited to, a chromosome, a plasmid, an expression vector or cassette, a genome viral, a gene sequence, a linear expression element, a bacterial genome, a plant genome or an artificial chromosome such as an artificial mammalian chromosome (MAC), or the yeast and bacterial homologs thereof (ie, a YAC or a BAC) to form a recombinant nucleic acid using conventional techniques. As another example, an isolated nucleic acid of the invention can be fused with smaller nucleotide sequences such as promoter sequences, immunostimulatory sequences and / or sequences encoding other amino acids, such as other antigen epitopes and / or linker sequences to form a recombinant nucleic acid.
In some cases, a recombinant or synthetic nucleic acid can be generated by chemical synthesis techniques applied outside the context of a host cell (for example, a nucleic acid produced by polymerase chain reaction (PCR) or chemical synthesis techniques, examples of which are described further herein).
Nucleic acids encoding polypeptides (including fusion proteins) of the invention may have any suitable chemical composition that allows the expression of a polypeptide of the invention or other desired biological activity (eg, hybridization with other nucleic acids). The polynucleotides of the invention may be in the form of RNA or in the form of DNA, and include mRNA, mRNA, RNA and recombinant or synthetic DNA, and cDNA. The nucleic acids of the invention are normally DNA molecules, and usually double-stranded DNA molecules. However, single stranded DNA, single stranded RNA, double stranded RNA and hybrid DNA / RNA nucleic acids or combinations thereof comprising any of the nucleotide sequences of the invention are also provided. A nucleic acid of the invention may include any suitable nucleotide base, base analog and / or skeleton (for example, a skeleton formed by, or including, a phosphothioate linkage, instead of phosphodiester, for example, DNA comprising a phosphotioate or phosphorothioate skeleton). A nucleic acid of the invention, if it is single stranded, can be the coding chain or the non-coding chain (ie, antisense or complementary). In addition to a nucleotide sequence encoding a polypeptide of the invention (eg, nucleotide sequence comprising the coding sequence of a mutant CTLA-4 or mutant CTLA-4-Ig ECD polypeptide), the polynucleotide of the invention may comprising one or more additional coding nucleotide sequences so as to encode, for example, a fusion protein, a sequence chosen by the target (other than a signal sequence), or the like (of which more particular examples are discussed further herein), and / or may comprise non-coding nucleotide sequences such as introns, terminator sequence or untranslated regions of 5 'and / or 3', regions that may be effective for the expression of the coding sequence in a suitable host and / or control elements such as a promoter (eg, naturally occurring or recombinant or redistributed promoter).
Modifications to a nucleic acid are particularly tolerable in the 3rd position of a sequence of mRNA codons encoding such a polypeptide. In particular aspects, at least a part of the nucleic acid comprises a phosphorothioate skeleton, incorporating at least one synthetic nucleotide analog instead of or in addition to the naturally occurring nucleotides in the nucleic acid sequence. Also or alternatively, the nucleic acid may comprise the addition of bases other than guanine, adenine, uracil, thymine and cytosine. Such modifications may be associated with prolonged half-life and, therefore, may be desirable in nucleic acid vectors of the invention. Thus, in one aspect, the invention provides recombinant nucleic acids and nucleic acid vectors (discussed further below), nucleic acids or vectors comprising at least one of the aforementioned modifications, or any suitable combination thereof, in the that the nucleic acid persists longer in a mammalian host than a substantially identical nucleic acid without such modification or modifications. Examples of modified nucleotides and / or non-cytosine, non-adenine, non-guanine, non-thymine that can be incorporated into a nucleotide sequence of the invention are provided in, for example, MANUAL OF PATENT EXAMINING PROCEDURE § 2422 (7th revision -2000).
It should be understood that a nucleic acid encoding at least one of the polypeptides of the invention (which includes a fusion protein of the invention), which includes those described above and elsewhere herein
document, is not limited to a sequence that directly encodes the expression or production of a polypeptide of the invention. For example, the nucleic acid may comprise a nucleotide sequence that produces a polypeptide of the invention by expression similar to intein (as described in, for example, Colson and Davis (1994) Mol. Microbiol. 12 (3): 959- 63, Duan et al. (1997) Cell 89 (4): 555-64, Perler (1998) Cell 92 (1): 1-4, Evans et al. 5 (1999) Biopolymers 51 (5): 333-42, and de Gray, Trends Biotechnol. 18 (9): 394-99 (2000)), or a nucleotide sequence comprising self-splicing introns (or other auto-splicing RNA transcripts), which form a coding sequence of intermediate recombinant polypeptides (as is described in, for example, U.S. Patent No. 6,010,884). The nucleic acid may also comprise or alternatively comprise sequences that produce other splicing modifications at the RNA level to produce an mRNA transcript encoding the polypeptide and / or at the DNA level by way of trans splicing mechanisms. before transcription (principles related to such mechanisms are described in, for example, Chabot, Trends Genet. (1996) 12 (11): 472-78, Cooper (1997) Am. J. Hum. Genet. 61 (2) : 259-66, and Hertel et al. (1997) Curr. Opin. Cell Biol. 9 (3): 350-57). Due to the inherent degeneracy of the genetic code, several nucleic acids can encode any particular polypeptide of the invention. Therefore, for example, any of the acids
fifteen Particular nuclei described herein may be modified by substituting one or more codons with an equivalent codon (with respect to the amino acid required by the codon) based on the degeneracy of the genetic code. Other nucleotide sequences encoding a polypeptide having the same or a functionally equivalent sequence as a polypeptide sequence of the invention can also be used to synthesize, clone and express such a polypeptide.
In general, any of the nucleic acids of the invention can be modified to increase expression in a particular host using the techniques exemplified herein with respect to the nucleic acids described above encoding a polypeptide of the invention (eg, nucleic acids encoding ECD of mutant CTLA-4 or mutant CTLA-4-Ig). Any of the nucleic acids of the invention as described herein can be optimized by codons for expression in a particular mammal (usually humans). A variety of codon optimization techniques are known in the art. Codons that are almost always used in a particular host are called optimal codons, and those not used very frequently are classified as rare or low-use codons (see, for example, Zhang, SP et al. (1991) Gene 105: 61-72). The codons may be substituted to reflect the host's preferred codon usage, a procedure called "codon optimization" or "codon bias control by species." The coding sequence comprising codons preferred by a particular prokaryotic or eukaryotic host can be used to increase the translation speed or to produce recombinant RNA transcripts having desirable properties such as a longer half-life compared to transcripts produced from an optimized sequence. . Techniques for producing codon optimized sequences are known (see, for example, E. et al. (1989) Nuc. Acids Res. 17: 477-508). The translation termination codons can also be modified to reflect host preference. For example, the preferred termination codons for S. cerevisiae and mammals are UAA and UGA, respectively. The preferred termination codon for monocot plants is UGA, while insects and E. coli prefer to use UAA as termination codon (see, for example, Dalphin, ME et al. (1996) Nuc. Acids Res. 24: 216- 218). The arrangement of codons in context with other codons can also influence the biological properties of nucleic acid sequences, and nucleic acid modifications to provide a context arrangement of common codons for a particular host is also contemplated by the inventors. Thus, a nucleic acid sequence of the invention can comprise a codon optimized nucleotide sequence, that is, optimized by codon frequency and / or optimized by codon matching (i.e., codon context) for a particular species ( for example, the polypeptide can be expressed from a polynucleotide sequence optimized for expression in beings
Four. Five human substitution of "rare" human codons based on codon frequency, or codon context, such as using techniques such as those described in Buckingham et al. (1994) Biochimie 76 (5): 35154 and US Pat. No. 5,082,767, 5,786,464 and 6,114,148).
The nucleic acids of the invention may be modified by truncation or one or more residues of the C-end portion of the sequence. Additionally, a variety of stop or termination codons can be included at the end of the nucleotide sequence as discussed further below.
One or more nucleic acids of the invention may be included in a vector, cell or host environment in which a nucleotide sequence encoding the invention is a heterologous gene.
The polynucleotides of the invention include polynucleotide sequences encoding any polypeptide of the invention (or polypeptide fragment thereof) that binds to CD80 and / or CD86 and / or suppresses a response
55 immune, polynucleotides that hybridize under at least stringent conditions with one or more such polynucleotide sequences described herein , polynucleotide sequences complementary to any such polynucleotide sequences and variants, analogs and homologues derived from all of the foregoing . A coding sequence refers to a nucleotide sequence that encodes a particular polypeptide or a domain, sub-sequence, region or fragment of said polypeptide. A coding sequence can encode a mutant CTLA-4 polypeptide or fragment thereof that has a functional property, such as the ability to bind CD80 and / or CD86 and / or inhibit or suppress an immune response. A nucleic acid of the invention may comprise a respective coding sequence of a mutant CTLA-4 polypeptide of the invention and variants, analogs and derivatives of homologs thereof.
The nucleic acids of the invention can also be found in combination with typical composition formulations of nucleic acids that include the presence of vehicles, buffers, adjuvants, excipients, diluents and the like, which are known to those skilled in the art.
Unless otherwise indicated, a particular nucleic acid sequence described herein also implicitly encompasses conservatively modified variants thereof (eg, degenerate codon substitutions) and complementary sequences and in addition the explicitly indicated sequence. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected codons (or all) is substituted with mixed base residues and / or deoxyinosine (Batzer et al. (1991) Nucl. Acid Res .19: 5081; Ohtsuka et al. (1985) J. Biol. Chem. 260: 2605-2608; Cassol et al. (1992); Rossolini et al. (1994) Mol. Cell. Probes 8: 91-98) .
Preparation and modification of nucleic acids
The nucleic acids of the invention can be obtained and / or generated by application of any suitable synthesis, manipulation and / or isolation technique, or combinations thereof. Exemplary procedures are described below. For example, polynucleotides of the invention are normally produced by conventional nucleic acid synthesis techniques such as solid phase synthesis techniques known in the art. In such techniques, fragments of up to about 100 bases are normally synthesized individually, then joined (for example, by enzymatic or chemical ligation procedures, or polymerase mediated recombination procedures) to form essentially any desired continuous nucleic acid sequence. The synthesis of the nucleic acids of the invention can also be facilitated (or performed alternatively) by chemical synthesis using, for example, the classical phosphoramidite process described in, for example, Beaucage et al. (1981) Tetrahedron Letters 22: 1859-69, or the procedure described by Matthes et al. (1984) EMBO J. 3: 801-05, for example, as is normally practiced in automated synthetic procedures. The nucleic acid of the invention can also be produced using an automatic DNA synthesizer. Other techniques for synthesizing nucleic acids and related principles are described in, for example, Itakura et al., Annu. Rev. Biochem. 53: 323 (1984), Itakura et al., Science 198: 1056 (1984), and Ike et al., Nucl. Acid Res. 11: 477 (1983).
Conveniently, custom-made nucleic acids can be handled from a variety of commercial sources such as The Midland Certified Reagent Company (mcrc@oligos.com), the Great American Gene Company (universal web site address genco.com), ExpressGen Inc. (website address universal expressgen.com), Operon Technologies Inc. (Alameda, CA). Similarly, custom peptides and antibodies can be tailored to any of a variety of sources, for example, PeptidoGenic (pkim@ccnet.com), HTI Bio-products, Inc. (universal website address htibio.com) and BMA Biomedicals Ltd. (RU), Bio.Synthesis, Inc.
Certain nucleotides of the invention can also be obtained by screening cDNA libraries using oligonucleotide probes that can hybridize with or amplify by PCR polynucleotides encoding the polypeptides of the invention. Procedures for screening and isolating cDNA clones and PCR amplification procedures are well known to those skilled in the art; Exemplary procedures are described below (see, for example, the procedures described in the examples below). Such techniques are described in, for example, Berger and Kimmel, "Guide to Molecular Cloning Techniques", in Methods in Enzymol. vol. 152, Acad. Press, Inc., San Diego, CA ("Berger"); Sambrook, above; and Ausubel, above. Some nucleic acids of the invention can be obtained by altering a naturally occurring skeleton, for example, by mutagenesis, in vitro recombination (eg shuffling) or oligonucleotide recombination. In other cases, such polynucleotides can be prepared by computer or by oligonucleotide recombination procedures as described in the references cited herein.
Recombinant DNA techniques useful in nucleic acid modification are well known in the art (for example, restriction endonuclease digestion, ligation, reverse transcription and cDNA production, and PCR). Useful recombinant DNA technology techniques and related principles are provided in, for example, Mulligan (1993) Science 260: 926-932, Friedman (1991) THERAPY FOR GENETIC DISEASES, Oxford University Press, Ibanez et al. (1991) EMBO J. 10: 2105-10, Ibanez et al. (1992) Cell 69: 329-41 (1992), and US Pat. No. 4,440,859, 4,530,901, 4,582,800, 4,677,063, 4,678,751, 4,704,362, 4,710,463, 4,757,006,
4,766,075 and 4,810,648, and are described more particularly in Sambrook et al. (1989) MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Harbor Press, and its third edition (2001), Ausubel et al. (19941999), Current Protocols in Molecular Biology, Wiley Interscience Publishers (with Greene Publishing Associates for some editions), Berger, above, and Watson, above.
Modified coding sequences
Where appropriate, the nucleic acids of the invention may be modified to increase or enhance expression in a particular host by modification of the sequence with respect to the use of codons and / or context of codons, given (s) the particular host (hosts) ( is) in which the expression of the nucleic acid is desired. Codons that are almost always used in a particular host are called optimal codons, and those not used
very often they are classified as rare or low-use codons (see, for example, Zhang, SP et al. (1991) Gene 105: 61-72). The codons may be substituted to reflect the host's preferred codon usage, a procedure called "codon optimization" or "codon bias control by species."
The optimized coding sequence comprising codons preferred by a particular prokaryotic or eukaryotic host can be used to increase the translation rate or to produce recombinant RNA transcripts that have desirable properties such as a longer half-life, as compared to transcripts produced from a sequence not optimized. Techniques for producing codon optimized sequences are known (see, for example, Murray, E. et al. (1989) Nucl. Acids Res. 17: 477-508). Translation termination codons can also be modified to reflect host preference. For example, preferred termination codons for S. cerevisiae and mammals are UAA and UGA, respectively. The preferred termination codon for monocot plants is UGA, while insects and E. coli prefer to use UAA as termination codon (see, for example, Dalphin, ME et al. (1996) Nucl. Acids Res. 24: 216-218 , for discussion). The arrangement of codons in context with other codons can also influence the biological properties of a nucleic acid sequence, and the inventors also contemplate nucleic acid modifications to provide an arrangement in the context of common codons for a particular host. Thus, a nucleic acid sequence of the invention may comprise a codon optimized nucleotide sequence, that is, optimized by codon frequency and / or optimized by codon matching (i.e., codon context) for a particular species ( for example, the polypeptide can be expressed from a polynucleotide sequence optimized for expression in humans by substitution of "rare" human codons based on the codon frequency, or codon context, such as using techniques such as those described in Buckingham et al. (1994) Biochimie 76 (5): 351-54 and US Pat. No. 5,082,767, 5,786,464 and 6,114,148). For example, the present invention discloses nucleic acid comprising a variant of the nucleotide sequence of SEQ ID NO: 80, wherein the variant of the nucleotide sequence differs from the nucleotide sequence of SEQ ID NO: 80 by the substitution of "rare" codons for a particular host with codons commonly expressed in the host, codons encoding the same amino acid residue as the "rare" codons substituted in SEQ ID NO: 80.
Vectors, vector components and expression systems
The present invention also includes recombinant constructs comprising one or more of the nucleic acids of the invention as described extensively above. Such constructs may comprise a vector such as a plasmid, a cosmid, a phage, a virus, a viral particle, a virus-like particle, an artificial bacterial chromosome (BAC), an artificial yeast chromosome (YAC) or the like, or a non-replicating vector such as a liposome, naked or conjugated DNA, DNA microparticle, in which at least one nucleic acid sequence of the invention has been inserted, in a direct or inverse orientation. In a particular aspect of this embodiment, the construction further comprises one or more regulatory sequences that include, for example, a promoter operably linked to a nucleic acid sequence of the invention (eg, nucleic acid encoding an isolated or recombinant polypeptide of the ECD of mutant CTLA-4 or dimeric or monomeric mutant CTLA-4-Ig). Large numbers of vectors and suitable promoters are known to those skilled in the art and are commercially available. In some cases, a vector, such as, for example, a virus or virus-like particle, may also include or alternatively include one or more polypeptides of the invention such as, for example, incorporated into the envelope of the virus or similar particle. to virus. Vectors may be useful as release agents for the release or administration to a subject of exogenous genes or proteins. The vectors of the present invention, which include those described herein, are useful as release agents for the release or administration of nucleic acids and / or polypeptides of the invention.
General texts describing molecular biological techniques useful herein, which include the use of vectors, promoters and many other relevant topics, include Berger, above, Sambrook (1989), above, and Ausubel, above. Examples of sufficient techniques to direct experts by in vitro amplification procedures, including polymerase chain reaction (PCR), ligase chain reaction (LCR), Q3-replicase amplification and other techniques mediated by RNA polymerase (for example, NASBA), for example, for the production of homologous nucleic acids of the invention, are found in Berger, Sambrook, and Ausubel, all above, in addition to Mullis et al. (1987), U.S. Pat. No. 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., Eds.) Academic Press Inc. San Diego, CA (1990) ("Innis"); Arnheim & Levinson (October 1, 1990) C&EN 36-47; The Journal of NIH Research (1991) 3: 81-94; (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173-1177; Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878; Lomeli et al. ( 1989) J. Clin. Chem. 35: 1826-1831; Landegren et al. (1988) Science 241: 1077-1080; Van Brunt (1990) Biotechnology 8: 291-294; Wu and Wallace (1989) Gene 4: 560-569; Barringer et al. (1990) Gene 89: 117-122, and Sooknanan and Malek (1995) Biotechnology 13: 563-564.
PCR generally refers to a process in which small amounts of a specific piece of nucleic acid (eg, RNA or DNA) are amplified by methods well known in the art (see, for example, U.S. Patent No. 4,683,195 and the other references cited above). Generally, sequence information from the ends of the region of interest or beyond is used to design oligonucleotide primers. Such primers will be identical or similar in sequence to the opposite chains of the template a
amplify. The nucleotides of the 5 'end of the opposite chains may coincide with the ends of the amplified material. PCR can be used to amplify specific RNA or specific DNA sequences, recombinant DNA or RNA sequences, total genomic DNA and RNA sequences and transcribed cDNA from total cellular, bacteriophage or plasmid RNA sequences, etc. PCR is an example, but not the only example, of a nucleic acid polymerase reaction method for amplifying a nucleic acid test sample that comprises the use of another nucleic acid (for example, known) as a primer. Improved in vitro cloning procedures for amplified nucleic acids are described in Wallace et al., US Pat. No. 5,426,039. Enhanced procedures for amplification of large nucleic acids by PCR are summarized in Cheng et al. (1994) Nature 369: 684 685 and references cited therein, in which PCR amplicons of up to 40 kilobases (kb) are generated. An expert will appreciate that essentially any RNA can be converted into a double stranded DNA suitable for restriction digestion, PCR expansion and sequencing using reverse transcriptase and a polymerase. See Ausubel, Sambrook, and Berger, all above.
The nucleic acids of the present invention can be incorporated into any one of a variety of vectors, for example, expression vectors, to express a polypeptide that includes, for example, a polypeptide of the invention. Expression vectors compatible with prokaryotic host cells can be used; Such prokaryotic expression vectors are known in the art and are commercially available. Such vectors include, but are not limited to, for example, BLUESCRIPT vector (Stratagene), T7 expression vector (Invitrogen), pET vector (Novagen) and similar prokaryotic vectors.
Alternatively, expression vectors compatible with eukaryotic host cells can be used; Such eukaryotic expression vectors are known in the art and are commercially available. Such vectors include, but are not limited to, for example, pCMV vectors (e.g. Invitrogen), pIRES vector (Clontech), pSG5 vector (Stratagene), pcDNA3.1 (Invitrogen Life Technologies), pcDNA3 (Invitrogen Life Technologies), Ubiquitous Cromatin Opening Element (UCOE ™) (Millipore) expression vector and similar eukaryotic expression vectors. The UCOE ™ vector is normally used for the production of proteins in mammalian cells (eg, CHO cells). According to Millipore, UCOE ™ expression technology frustrates transgene silencing and provides stable high level gene expression without respect for the chromosomal integration site. See the Millipore website at the universal web address millipore.com. An exemplary UCOE expression vector in which, for example, a nucleic acid of the invention can be incorporated is the UCOE expression vector called CET1019AS-pure-SceI, which is available for license from Millipore. Information on the UCOE CET1019AS-pure-SceI expression vector can be found in, for example, John Wynne, "UCOE ™ Technology Maximizes Protein Expression", BioProcess International 4 (7): 104-105 (July / August 2006) (RP1725EN00 ) (available at the universal web address millipore.com/bibliography/techl/rp1725en00); Additional information about this vector and the license of this Millipore vector can be found on the Millipore website which is included in, for example, the universal web address millipore.com/company/cp3/ucoe_licensing and millipore.com/techpublications / tech1 / ps1013en00. Thus, for example, a DNA sequence encoding a mutant CTLA-4 ECD (eg, SEQ ID NO: 36 or SEQ ID NO: 50) fused with a DNA sequence encoding an IgG2 Fc polypeptide ( for example, SEQ ID NO: 184), producing the DNA sequence of SEQ ID NO: 201, is inserted into a UCOE CET1019AS vector (Millipore) and the resulting DNA plasmid can be used for host cell transfections.
Expression vectors include chromosomal, non-chromosomal and synthetic DNA sequences, for example, derivatives of SV40, bacterial vectors (eg, S. typhimurium, S. typhi, S. flexneri, Listeria monocytogenes,
B. anthracis); plasmids; bacterial plasmids; Phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA; DNA or viral RNA vectors that include, for example, variolovaccine virus, adeno-associated virus (AAV), adenovirus, Semliki forest virus (eg, Notka et al., Biol. Chem. 380: 341-52 (1999), poxvirus (for example, MVA), alphavirus (for example, Venezuelan equine encephalitis virus (VEE), western equine encephalitis virus (WEE), eastern equine encephalitis virus (EEE) )), vesicular stomatitis virus (VSV), avian smallpox virus, pseudorabies, herpes simplex virus, retroviruses and many others. Any vector that transduces genetic material in a cell and, if replication is desired, that is replicable and viable in the relevant host can be used. The viral and bacterial vectors that serve as administration vehicles can be attenuated; the attenuation should be sufficient to reduce, if not eliminate, the induction of undesirable disease symptoms. Figure 1 is a schematic diagram of an exemplary plasmid expression vector of pcDNA mutant CTLA-4-Ig encoding a mutant CTLA-4-Ig of the invention. Additional details regarding suitable expression vectors are provided below, which include the examples.
A vector of the invention comprising a nucleic acid sequence of the invention as described herein, in addition to an appropriate promoter or control sequence, can be used to transform an appropriate host to allow the host to express the protein. Examples of appropriate expression hosts include: bacterial cells such as E. coli, Streptomyces and Salmonella typhimurium; fungal cells such as Saccharomyces cerevisiae, Pichia pastoris and Neurospora crassa; insect cells such as Drosophila and Spodoptera frugiperda; mammalian cells such as Chinese hamster ovary (CHO) cells (for example, CHO-K1), COS (for example, COS-1, COS-7), baby hamster kidney (BHK) and human embryonic kidney (HEK) (for example, HEK 293), Bowes melanoma, and plant cells. It is understood that not all cells or cell lines need to be able to produce fully functional polypeptides of the
invention or fragments thereof. The invention is not limited by the host cells employed. Additional details regarding suitable host cells are provided below.
In bacterial systems, several expression vectors can be selected depending on the intended use for the desired polypeptide or fragment thereof. For example, if large amounts of a particular polypeptide or fragments thereof are needed for antibody induction, vectors that direct high level expression of fusion proteins that are easily purified may be desirable. Such vectors include, but are not limited to, cloning in E. multifunctional coli and expression vectors such as BLUESCRIPT (Stratagene), in which the nucleotide coding sequence of interest (eg, nucleotide sequence encoding a recombinant mutant CTLA-4-Ig) can be ligated into the vector in frame with sequences for the Met of the amino terminus and the subsequent 7 residues of beta-galactosidase so that a hybrid protein is produced; pIN vectors (Van Heeke & Schuster (1989) J. Biol. Chem. 264: 5503-5509); pET vectors (Novagen, Madison WI); and the like
Similarly, in the yeast Saccharomyces cerevisiae, several vectors comprising constitutive or inducible promoters such as alpha factor, alcohol oxidase and PGH can be used for the production of the polypeptides of the invention. For reviews see Ausubel, above, Berger, above, and Grant et al. (1987) Meth. Enzymol 153: 516-544.
In mammalian host cells several expression systems such as virus-based systems can be used. In cases where an adenovirus is used as an expression vector, a coding sequence is optionally linked in an adenovirus transcription / translation complex consisting of the late promoter and the tripartite conductive sequence. Insertion into a non-essential E1 or E3 region in the viral genome produces a viable virus that can express a polypeptide of interest in infected host cells (Logan and Shenk (1984) Proc. Natl. Acad. Sci. USA 81: 3655-3659 ). In addition, transcription enhancers, such as the Rous sarcoma virus enhancer (RSV), are used to increase expression in mammalian host cells.
A vector, for example, expression vector, or polynucleotide of the invention may comprise one or more expression control sequences. An expression control sequence is normally associated to and / or operatively linked to a nucleic acid sequence of the invention, such as a nucleic acid encoding a recombinant mutant CTLA-4 ECD polypeptide or CTLA-4- fusion protein. Recombinant mutant Ig. An expression control sequence is normally a nucleotide sequence that promotes, enhances or controls the expression (usually transcription) of another nucleotide sequence. Suitable expression control sequences that can be employed include a promoter, which includes a constitutive promoter, inducible promoter and / or repressible promoter, an enhancer to amplify the expression, an initiation sequence, a termination translation sequence, a sequence of control of the splicing, and the like.
When a nucleic acid of the invention is included in a vector, the nucleic acid is normally operably linked to an appropriate transcription control sequence (promoter) to direct mRNA synthesis. Promoters exert a particularly important impact on the level of expression of recombinant polypeptides. Any suitable promoter can be used. Examples of suitable promoters include the cytomegalovirus (CMV) promoter with or without the first intron (intron A), the HIV long terminal repeat promoter, the phosphoglycerate kinase (PGK) promoter, Rous sarcoma virus promoters ( RSV) such as RSV long terminal repeat (LTR) promoters, SV40 promoters, mouse breast tumor virus (MMTV) promoters, HSV promoters such as the Lap2 promoter or the herpes thymidine kinase promoter (as described in, for example, Wagner et al. (1981) Proc. Natl. Acad. Sci. 78: 144-145), derived promoters of SV40 or Epstein Barr virus, adeno-associated viral promoters (AAV) such as the p5 promoter, metallothionein promoters (for example, the sheep metallothionein promoter or the mouse metallothionein promoter (see, for example, Palmiter et al. (1983) Science 222: 809-814), the human ubiquitin C promoter, E. coli promoters such as lac and trp promoters, phage lambda PL promoter and other promoters known to control gene expression in prokaryotic cells or eukaryotes (both directly in the cell and in viruses that infect the cell). Promoters that exhibit strong constitutive baseline expression in mammals, particularly humans, may be employed, such as CMV promoter such as the CMV immediate early promoter (described in, for example, U.S. Patent No. 5,168,062 , 5,385,839, 5,688,688 and 5,658,759), and promoters having substantial sequence identity with such CMV promoters. Recombinant promoters having enhanced properties such as in International Patent Publication No. WO 02/00897 may also be used.
A promoter that is operably linked to a nucleic acid of the invention for nucleic acid expression can have any suitable mechanism of action. Thus, the promoter can be, for example, an "inducible" promoter (for example, a growth hormone promoter, metallothionein promoter, heat shock protein promoter, E1B promoter, hypoxia induced promoter, promoter radiation inducible or adenoviral MLP promoter and tripartite conductor), an inducible-repressible promoter, a promoter related to the developmental stage (for example, a globin gene promoter) or a tissue specific promoter (for example, a smooth muscle cell ∀-actin promoter, myosin 1A light chain promoter or vascular endothelial cadherin promoter). Suitable inducible promoters include ecdysone and ecdysone-like inducible promoters. Ecdisone-inducible inducible promoters are commercially available, for example, through Stratagene (La Jolla, CA). If desired, a nucleic acid of the invention can be induced using
an inducible expression system in and out of the gel. Examples of such expression systems in and out of the gel include the Tet-On ™ gene expression system and the Tet-Off ™ gene expression system, respectively (Clontech, Palo Alto, CA; see, for example, catalog of Clontech 2000, page 110-111 for a detailed description of each of such a system). The inducible promoter can be any promoter that is regulated by increase and / or decrease in response to an appropriate signal. Additional inducible promoters include arabinose inducible promoters, an inducible steroid promoter (eg, glucocorticoid inducible promoters), in addition to pH, stress and heat inducible promoters.
The promoter can be, and often is, a native host promoter or a promoter derived from a virus that infects a particular host (for example, a human beta-actin promoter, human EF1 promot promoter or an AAV derived promoter human operably linked to the nucleic acid of interest), particularly when the strict avoidance of gene expression silencing due to host immunological reactions for sequences that are not regularly present in the host is of interest. A bi-directional promoter system (as described in, for example, US 5,017,478) linked to multiple nucleotide sequences of interest can also be used.
Other suitable promoters and principles related to the selection, use and constriction of suitable promoters are provided in, for example, Werner (1999) Mamm Genome 10 (2): 168-75, Walther et al. (1996) J. Mol. Med. 74 (7): 379-92, Novina (1996) Trends Genet. 12 (9): 351-55, Hart (1996) Semin. Oncol. 23 (1): 154-58, Gralla (1996) Curr. Opin. Genet Dev. 6 (5): 526-30, Fassler et al. (1996) Methods Enzymol 273: 3-29, Ayoubi et al. (1996), 10 (4) FASEB J 10 (4): 453-60, Goldstein et al. (1995) Biotechnol. Annu Rev. 1: 105-28, Azizkhan et al. (1993) Crit. Rev. Eucariot. Gene Expr. 3 (4): 229-54, Dynan (1989) Cell 58 (1): 1-4, Levine (1989) Cell 59 (3): 405-8, and Berk et al. (1986) Annu. Rev. Genet. 20: 45-79, in addition to US Pat. No. 6,194,191. Other suitable promoters can be identified by the use of the eukaryotic promoter database (publication 68) (available at the universal website address epd.isb-sib.ch/) and other similar databases such as the base of transcription regulatory region (TRRD) data (version 4.1) (available at the universal website address bionet.nsc.ru/trrd/) and the transcription factor database (TRANSFAC) (available at site address from the universal web transfac.gbf.de/TRANSFAC/index.html).
As an alternative to a promoter, particularly in vectors and RNA constructs, a vector or nucleic acid of the invention may comprise one or more internal ribosome entry sites (IRES), IRES coding sequences or RNA sequence enhancers ( analogs of the Kozak consensus sequence), such as the omega sensitization sequence of the tobacco mosaic virus.
A vector or polynucleotide of the invention may include a 5 'direction activator sequence (UAS) such as a Ga14 activator sequence (see, for example, U.S. Patent No. 6,133,028) or another regulatory sequence in the appropriate 5 'address (see, for example, US 6,204,060).
A vector or polynucleotide of the invention may include a Kozak consensus sequence that is functional in a mammalian cell. The Kozak sequence may be a naturally occurring or modified sequence, such as the modified Kozak consensus sequences described in US Pat. No. 6,107,477.
Specific initiation signals may aid in the efficient translation of a coding sequence of the invention, such as a nucleotide sequence encoding mutant CTLA-4 ECD polypeptides. Such signals can be included in a vector of the invention. These signals may include, for example, the ATG initiation codon and adjacent sequences. In cases where a coding sequence, its initiation codon and sequences in the 5 'direction are inserted into an appropriate expression vector, translation control signals may not be necessary. However, in cases where only one coding sequence is inserted (for example, a mature coding protein sequence), or a part thereof, exogenous nucleic acid transcription control signals including the codon must be provided. ATG initiation In addition, the initiation codon must be in the correct reading frame to ensure transcription of the entire insert. The exogenous transcriptional elements and initiation codons can be of various origins - both natural and synthetic. Expression efficiency can be enhanced by the inclusion of enhancers appropriate to the cell system in use (see, for example, Scharf et al., Results Probl. Cell. Differ. 20: 125-62 (1994); and Bittner et al. , Meth. Enzymol. 153: 516-544 (1987)). Suitable enhancers include the Rous sarcoma virus (RSV) enhancer and the RTE enhancers described in US Pat. No. 6,225,082.
The expert will recognize that the introduction of an initiation codon (ATG) at the 5 'end of a particular nucleotide sequence of interest normally results in the addition of an N-methionine to the encoded amino acid sequence when the sequence is expressed in a mammalian cell (other modifications may occur in bacterial and / or other eukaryotic cells such as introduction of a formyl methionine residue in an initiation codon). For the expression of a nucleic acid of the invention in eukaryotic cells, an initiation codon and a nucleotide sequence encoding a signal peptide are normally included at the 5 'end of a nucleic acid sequence (eg, SEQ ID NO: 80), and a termination codon is normally included at the C-terminus of the nucleic acid (eg, SEQ ID NO: 80). An exemplary signal peptide sequence is the signal peptide sequence of hCTLA-4 (SEQ ID NO: 182); the nucleic acid sequence encoding the plasminogen tissue activator signal peptide is shown in SEQ ID NO: 181. Another sequence of
Exemplary signal peptides is the signal peptide sequence of hCTLA-4 (SEQ ID NO: 216), which is encoded by the nucleic acid sequence shown in SEQ ID NO: 215.
Termination sequences are discussed in detail below.
Such elements can be included in the construction of choice vector. After expression, the polypeptide variants encoded by the nucleic acid (eg, SEQ ID NO: 80) will initially include an N-methionine residue and the signal peptide sequence. However, the N-end methionine and the signal peptide sequence will be cleaved after secretion, thereby generating the encoded polypeptide (eg, SEQ ID NO: 1).
The level of expression of a nucleic acid of the invention (or a corresponding polypeptide of the invention) can be evaluated by any suitable technique. Examples include Northern blot analysis (discussed in, for example, McMaster et al., Proc. Natl. Acad. Sci. USA 74 (11): 4835-38 (1977) and Sambrook, below), chain reaction of the reverse transcriptase polymerase (RT-PCR) (as described in, for example, US Pat.
5,601,820 and Zaheer et al., Neurochem. Res. 20: 1457-63 (1995)) and in situ hybridization techniques (as described in, for example, U.S. Patents 5,750,340 and 5,506,098). Protein quantification can also be carried out by the Lowry assay and other protein quantification assays (see, for example, Bradford, Anal. Biochem. 72: 248-254 (1976); Lowry et al., J. Biol Chem. 193: 265 (1951)). Western blot analysis of recombinant polypeptides of the invention obtained from the lysate of cells transfected with polynucleotides encoding such recombinant polypeptides is another suitable technique for evaluating expression levels of recombinant polypeptides.
A vector, for example, expression vector, or polynucleotide of the invention may comprise a ribosome binding site for translation initiation and a transcription termination region. A suitable transcription termination region is, for example, a polyadenylation sequence that facilitates the cleavage and polyadenylation of an RNA transcript produced from a DNA sequence. Any suitable polyadenylation sequence that includes a synthetic optimized sequence may be used, in addition to the BGH (bovine growth hormone) polyadenylation sequence, human growth hormone gene, polyoma virus, TK (thymidine kinase), EBV (virus of Epstein Barr), rabbit beta-globin and papillomavirus, which include human papillomavirus and BPV (bovine papillomavirus). Suitable polyadenylation (poly A) sequences also include the SV40 polyadenylation sequence (human sarcoma virus 40) and the BGH poly A sequence. Such polyA sequences are described in, for example, Goodwin et al. (1998) Nucleic Acids Res. 26 (12): 2891-8, Schek et al. (1992) Mol. Cell Biol. 12 (12): 5386-93, and van den Hoff et al. (1993) Nucleic Acids Res. 21 (21): 4987-8. Additional principles related to the selection of appropriate polyadenylation sequences are described in, for example, Levitt et al. (1989) Genes Dev. 1989 3 (7): 1019-1025, Jacob et al. (1990) Crit. Rev. Eucariot. Gene Expr. 1 (1): 49-59, Chen et al. (1995) Nucleic Acids Res. 23 (14): 2614-2620, Moreira et al. (1995) EMBO J. 14 (15): 3809-3819, Carswell et al. (1989) Mol. Cell Biol. 9 (10): 4248-4258.
A vector or polynucleotide of the invention may further comprise site-specific recombination sites that can be used to modulate the transcription of a nucleotide sequence of interest as described in, for example, US Pat. No. 4,959,317, 5,801,030 and 6,063,627, European Patent Application No. 0 987 326 and International Patent Application Publication No. WO 97/09439.
A vector or polynucleotide of the invention may also comprise a nucleic acid encoding a secretion / localization sequence to choose as a target the expression of polypeptides for a desired cell compartment, membrane or organelle, or to direct the secretion of polypeptides into the periplasmic space or in the cell culture medium. Such sequences are known in the art and include secretory conductive peptides or signal peptides, sequences that target organelles (e.g., nuclear localization sequences, RE retention signals, mitochondrial transit sequences, chloroplast transit sequences) , membrane localization / anchoring sequences (eg, arrest transfer sequences, GPI anchor sequences), and the like. The polynucleotides of the invention can be fused, for example, in frame with a nucleic acid such that it encodes a secretion and / or localization sequence. Polypeptides expressed by such polynucleotides of the invention may include the amino acid sequence corresponding to the secretion sequence (s) and / or location.
In addition, a vector or polynucleotide of the invention may comprise one or more nucleotide sequences of selection markers or genes to provide a phenotypic trait for the selection of transformed host cells such as dihydrofolate reductase resistance, neomycin resistance, G418 resistance, resistance to puromycin and / or resistance to blasticidine for eukaryotic cell culture, or such as resistance to tetracycline or ampicillin in E. coli.
A vector or polynucleotide of the invention may also comprise an origin of replication useful for propagation in a microorganism. The origin of bacterial replication (Ori) used is preferably one that does not adversely affect gene expression in mammalian cells. Examples of useful sequences of replication origin include phage of f1 ori, RK2 oriV, pUC ori and pSC101 ori. Sequences of the origin of replication include Co1EI ori and p 15 (available from plasmid pACYC177, New England Biolab, Inc.), alternatively another low copy ori sequence (similar to p15) may be desirable in some contexts. In this regard, the nucleic acid acts desirably as a shuttle vector, can be replicated and / or expressed in both eukaryotic and prokaryotic hosts (for example, a vector comprising sequences of an origin of replication recognized in both eukaryotes and prokaryotes).
The invention includes a naked DNA or RNA vector that includes, for example, a linear expression element (as described in, for example, Sykes and Johnston (1997) Nat Biotech 17: 355-59), a nucleic acid vector compacted (as described in, for example, US Pat. No. 6,077,835 and / or International Patent Publication No. WO 00/70087), a plasmid vector such as pcDNA3.1, pBR322, pUC 19/18 or pUC 118/119, a nucleic acid vector of minimum size " mosquito ”(as described in, for example, Schakowski et al. (2001) Mol. Ther. 3: 793-800) or as a precipitated nucleic acid vector construct such as a precipitated construct with CaPO4 (as described in, for example, international patent application WO 00/46147, Benvenisty and Reshef (1986) Proc. Natl. Acad. Sci. USA 83: 9551-55, Wigler et al. (1978), Cell 14: 725, and Coraro and Pearson (1981) Somatic Cell Genetics 7: 603), which comprises a nucleic acid of the invention. For example, the invention provides a naked DNA plasmid comprising SEQ ID NO: 80 operably linked to a CMV promoter or CMV promoter variant and a suitable polyadenylation sequence. Nucleotide vectors and the use thereof are known in the art (see, for example, U.S. Patent Nos. 5,589,466 and 5,973,972).
A vector of the invention is usually an expression vector that is suitable for expression in a bacterial system, eukaryotic system, mammalian system or other system (as opposed to a vector designed to replicate the nucleic acid sequence without expression, which can be called a cloning vector). For example, in one aspect, the invention provides a bacterial expression vector comprising a nucleic acid sequence of the invention (eg, nucleic acid sequence encoding a recombinant mutant CTLA-4-Ig). Suitable vectors include, for example, vectors that direct high level expression of fusion proteins that are easily purified (eg, cloning of E. multifunctional coli and expression vectors such as BLUESCRIPT (Stratagene), pIN vectors (Van Heeke & Schuster, J. Biol. Chem. 264: 55035509 (1989); pET vectors (Novagen, Madison WI); and the like). Although such bacterial expression vectors may be useful in expressing particular polypeptides of the invention, the glycoproteins of the invention are preferably expressed in eukaryotic cells and as such the invention also provides eukaryotic expression vectors.
The expression vector may be a suitable vector for the expression of the nucleic acid of the invention in a yeast cell. Any suitable vector for expression in a yeast system can be used. Vectors suitable for use in, for example, Saccharomyces cerevisiae include, for example, vectors comprising constitutive or inducible promoters such as alpha factor, alcohol oxidase and PGH (reviewed in Ausubel, above, Berger, above, and Grant et al., Meth. Enzymol. 153: 516-544 (1987)). Normally, the expression vector will be a suitable vector for the expression of a nucleic acid of the invention in an animal cell such as an insect cell (for example, an SF-9 cell) or a mammalian cell (for example, a CHO cell, cell 293, HeLa cell, human fibroblast cell or similar well characterized cell). Suitable mammalian expression vectors are known in the art (see, for example, Kaufman, Mol. Biotechnol. 16 (2): 151-160 (2000), Van Craenenbroeck, Eur. J. Biochem. 267 (18): 5665-5678 (2000), Makrides, Protein Expr. Purif. 17 (2): 183202 (1999), and Yarranton, Curr. Opin. Biotechnol 3 (5): 506-511 (1992)). Suitable insect plasmid expression vectors are also known (Braun, Biotechniques 26 (6): 1038-1040: 1042 (1999)).
An expression vector can normally be propagated in a host cell, which can be a eukaryotic cell (such as a mammalian cell, yeast cell or plant cell) or a prokaryotic cell, such as a bacterial cell. The introduction of a nucleic acid vector or expression vector into the host cell (eg, transfection) can be effected by transfection with calcium phosphate (see, for example, calcium phosphate coprecipitation procedure of Graham et al., Virology 52: 456-457 (1973)), DEAEdextran-mediated transfection, electroporation, gene or vaccine gun, injection, lipofection and biolistics or other common techniques (see, for example, Kriegler, GENE TRANSFER AND EXPRESSION: A LABORATORY MANUAL, Stockton Press (1990); see Davis, L., Dibner, M., and Battey, I., BASIC METHODS IN MOLECULAR BIOLOGY (1986) for a description of procedures in vivo, ex vivo and in vitro). Cells comprising these and other vectors of the invention form an important part of the invention.
An expression vector is disclosed herein comprising: (i) a first polynucleotide sequence encoding a first polypeptide comprising a polypeptide sequence having at least 95%, 96% 97%, 98%, 99% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, wherein said first polypeptide binds to human CD86 and / or human CD80 and / or an extracellular domain of either or both, and / or suppresses an immune response, and (ii) a second polynucleotide sequence encoding a second polypeptide comprising a hinge region, a CH2 domain and a CH3 domain of an immunoglobulin (Ig) polypeptide. The Ig polypeptide is optionally a human Ig Fc polypeptide (for example, IgG1, IgG2, IgG4, etc.) or a mutant Ig Fc polypeptide (for example, an Ig Fc polypeptide in which one or more cysteine residues have been substituted with another amino acid (for example, a serine residue), thus eliminating one or more disulfide bonds formed between two Ig chains, or in which one or more proline residues is substituted with another amino acid (by example, proline) to reduce effector function (reduced Fc receptor binding). An expression vector comprising a nucleotide sequence encoding a fusion protein having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity is disclosed herein. at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222.
Additional nucleic acids provided by the invention include cosmids. Any suitable cosmid vector can be used to replicate, transfer and express the nucleic acid sequence of the invention. Normally, a cosmid comprises a bacterial oriV, an antibiotic selection marker, a cloning site and any one or two cos sites derived from the bacteriophage lambda. The cosmid may be a shuttle cosmid or mammalian cosmid comprising an SV40 oriV and, desirably, suitable mammalian selection marker (s). Cosmid vectors are further described in, for example, Hohn et al. (1988) Biotechnology 10: 113-27.
The nucleic acids of the invention may be included in and / or administered to a host or host cell in the form of a suitable delivery vehicle (ie, a vector). The vector may be any suitable vector that includes chromosomal, non-chromosomal and synthetic nucleic acid vectors, or other vectors described above, and may include any combination of the expression elements described above and / or other sequence elements that facilitate transfection and / or promoters of expression. Examples of such vectors include viruses, bacterial plasmids, phages, cosmids, phagemids, derivatives of SV40, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, and viral nucleic acid vectors (RNA or DNA), polylysine and bacterial cells.
The administration of a recombinant DNA sequence of the invention can be carried out with a naked DNA plasmid or plasmid associated with one or more transfection enhancing agents as discussed further herein. The plasmid DNA vector can have any suitable combination of traits. Plasmid DNA vectors may comprise a strong promoter / enhancer region (eg, human CMV promoter, RSV, SV40, SL3-3, MMTV or HIV LTR), an effective poly (A) termination sequence, a origin of replication for plasmid product in E. coli, an antibiotic resistance gene as a selection marker and a convenient cloning site (eg, a polylinker). A particular plasmid vector for the administration of the nucleic acid of the invention is shown in this regard in Figure 1; The construction and features of this vector are described in the examples below.
In another aspect, the invention provides a non-nucleic acid vector comprising at least one nucleic acid.
or polypeptide of the invention. Such a non-nucleic acid vector includes, for example, but is not limited to a recombinant virus, a nucleic acid-viral protein conjugate (which, with recombinant viral particles, can sometimes be referred to as a viral vector) or such a cell. as recombinant (and normally attenuated) bacterial cells of Salmonella, Shigella, Listeria and Bacillus Calmette-Guérin (BCG). Thus, for example, the invention provides a viral vector, insect vector, bacterial vector or plant vector comprising a nucleic acid of the sequence of the invention. Any suitable viral, insect, plant or bacterial vector can be used in this regard and several are known in the art. A viral vector may comprise any number of viral polynucleotides, alone (a viral nucleic acid vector) or more commonly in combination with one or more (usually two, three, or more) viral proteins that facilitate administration, replication and / or expression. of the nucleic acid of the invention in a desired host cell.
In one aspect, intracellular bacteria (eg, Listeria monocytogenes) can be used to administer a nucleic acid of the invention. An exemplary bacterial vector for the administration of plasmid DNA of one or more nucleic acids of the invention is Listeria monocytogenes (Lieberman et al., Vaccine 20: 2007-2010 (2002)).
The invention includes recombinant or isolated viral vectors that have been modified to comprise one or more nucleic acids or polypeptides of the invention. A viral vector may include a polynucleotide comprising all or part of a viral genome, a viral protein / nucleic acid conjugate, a virus-like particle (VLP), a vector similar to those described in US Pat. No. 5,849,586 and International Patent Application Publication No. WO 97/04748, or an intact virus particle comprising one or more viral nucleic acids, and the viral vector is normally manipulated to include at least one nucleic acid and / or polypeptide of the invention. A viral vector (i.e., a recombinant virus) may comprise a natural viral particle or a modified viral particle, particular examples of which are discussed below. Numerous viruses are normally used as vectors for the administration of exogenous nucleic acids that include at least one nucleic acid of the invention, such as a nucleic acid encoding an ECD of mutant CTLA-4 or mutant CTLA-4-Ig described herein. document. Such vectors include recombinantly modified DNA and RNA enveloped viruses.
or not wrapped, normally selected from baculoviridiae, parvoviridiae, picomoviridiae, herpesveridiae, poxviridae, adenoviridiae or picornaviridiae. The viral vectors can be natural or can be modified by recombinant nucleic acid techniques to be replication deficient, replication competent or conditionally replicating.
The viral vector may be a vector that requires the presence of another vector or natural virus for replication and / or expression (i.e., a helper dependent virus) such as an adenoviral vector amplicon.
Typically, such viral vectors comprise a natural viral particle, or a modified viral particle in its protein and / or nucleic acid content to increase the ability of the transgene or assist in the transfection and / or expression of the nucleic acid (examples of such vectors include herpes / AAV virus amplicons). The viral genome can be modified to include inducible promoters that reach replication or expression only under certain conditions.
The viral vector may be derived from or comprise a hair that normally infects animals, preferably vertebrates, such as mammals, which include, for example, humans. Suitable viral vector particles include in this regard, for example, adenoviral vector particles (including any virus from or derived from an adenoviridae virus), adeno-associated viral vector particles (AAV vector particles) or other parvoviruses and particles of parvoviral vector, viral vector particles of papilloma, viral vector of the Semliki forest, flaviviric vectors, picornavirus vectors, alpha-viral vectors, viral herpes vectors, poxvirus vectors, retroviral vectors, which include lentiviral vectors. Examples of such viruses and viral vectors are provided in, for example, Fields Virology, above, Fields et al., Eds., VIROLOGY, Raven Press, Ltd., New York (3rd ed., 1996 and 4th ed., 2001) , ENCYCLOPEDIA OF VIROLOGY, RG Webster et al., Eds., Academic Press (2nd ed., 1999), FUNDAMENTAL VIROLOGY, Fields et al., Eds., Lippincott-Raven (3rd ed., 1995), Levine, "viruses ”, Scientific American Library No. 37 (1992), MEDICAL VIROLOGY, DO White et al., Eds., Academic Press (2nd ed. 1994), and INTRODUCTION TO MODERN VIROLOGY, Dimock, NJ et al., Eds., Blackwell Scientific Publications, Ltd. (1994) .
Viral vectors that can be employed with nucleic acids of the invention and the methods described herein include adeno-associated virus vectors that are reviewed in, for example, Carter (1992) Curr. Opinion Biotech. 3: 533-539 (1992) and Muzcyzka (1992) Curr. Top. Microbiol Immunol 158: 97-129 (1992). Additional types and aspects of AAV vectors are described in, for example, Buschacher et al., Blood 5 (8): 2499-504, Carter, Contrib. Microbiol 4: 85-86 (2000), Smith-Arica, Curr. Cardiol Rep. 3 (1): 41-49 (2001), Taj, J. Biomed. Sci. 7 (4): 279-91 (2000), Vigna et al., J. Gene Med. 2 (5): 308-16 (2000), Klimatcheva et al., Front. Biosci 4: D481-96 (1999), Lever et al., Biochem. Soc. Trans. 27 (6): 841-47 (1999), Snyder, J. Gene Med. 1 (3): 166-75 (1999), Gerich et al., Knee Surg. Sports Traumatol. Arthrosc 5 (2): 118-23 (1998), and During, Adv. Drug Deliv. Review 27 (1): 83-94 (1997), and US Pat. No. 4,797,368, 5,139,941, 5,173,414, 5,614,404, 5,658,785, 5,858,775 and 5,994,136, in addition to other references discussed elsewhere in this document). Adeno-associated viral vectors can be constructed and / or purified using the procedures set forth, for example, in US Pat. nº
4,797,368 and Laughlin et al., Gene 23: 65-73 (1983).
Alphavirus vectors can be gene administration vectors in other contexts. Alphavirus vectors are known in the art and are described in, for example, Carter (1992) Curr Opinion Biotech 3: 533-539, Schlesinger Expert Opin. Biol. Ther. (2001) 1 (2): 177-91, Polo et al., Dev. Biol. (Basel). 2000; 104: 181-5, Wahlfors et al., Gene Ther. (2000) 7 (6): 472-80, International Patent Application Publications No. WO 01/81609, WO 00/39318, WO 01/81553, WO 95/07994, WO 92/10578.
Another advantageous group of viral vectors are the viral vectors of herpes. Examples are described in, for example, Lachmann et al., Curr. Opin. Mol. Ther. (1999) 1 (5): 622-32, Fraefel et al., Adv. Virus Res. (2000) 55: 425-51, Huard et al., Neuromuscul. Disord (1997) 7 (5): 299-313, Frenkel et al., Gene Ther. (1994) Suppl 1: S40-6, U.S. Pat. No. 6,261,552 and 5,599,691.
Retroviral vectors, which include lentiviral vectors, can also be advantageous gene delivery vehicles in particular contexts. There are numerous retroviral vectors known in the art. Examples of retroviral vectors are described in, for example, Miller, Curr Top Microbiol. Immunol (1992) 158: 1-24, Weber et al., Curr. Opin. Mol. Ther. (2001) 3 (5): 439-53, Hu et al., Pharmacol. Rev. (2000) 52 (4): 493-511, Kim et al., Adv. Virus Res. (2000) 55: 545-63, Palu et al., Rev. Med. Virol. (2000) 10 (3): 185-202, Takeuchi et al., Adv. Exp. Med. Biol. (2000) 465: 23-35, US Pat. No. 6,326,195, 5,888,502, 5,580,766 and 5,672,510.
Baculovirus vectors are another advantageous group of viral vectors, particularly for the production of polypeptides of the invention. The production and use of baculovirus vectors is known (see, for example, Kost, Curr. Opin. Biotechnol. 10 (5): 428-433 (1999); Jones, Curr. Opin. Biotechnol. 7 (5): 512 -516 (1996)). If the vector is used for therapeutic uses, the vector will be selected so that it can adequately infect (or in the case of nucleic acid vectors, transfect or transform) target cells in which the desired therapeutic effect is desired.
Adenoviral vectors can also be viral vectors suitable for gene transfer. Adenoviral vectors are well known in the art and are described in, for example, Graham et al. (1995) Mol. Biotechnol 33 (3): 207-220, Stephenson (1998) Clin. Diag. Virol 10 (2-3): 187-94, Jacobs (1993) Clin Sci (Lond). 85 (2): 117-22, U.S. Pat. No. 5,922,576, 5,965,358 and 6,168,941 and international patent applications WO 98/22588, WO 98/56937, WO 99/15686, WO 99/54441 and WO 00/32754. Adenoviral vectors, viral herpes vectors and Sindbis viral vectors, useful in the practice of the invention and suitable for the in vivo transduction and expression of nucleic acid organisms of the invention, are generally described in, for example, Jolly (1994) Cancer Gene Therapy 1: 51-64, Latchman (1994) Molec. Biotechnol 2: 179-195, and Johanning et al. (1995) Nucl. Acids Res. 23: 1495-1501.
The virus vector may be deficient in replication in a host cell. Adeno-associated virus (AAV) vectors are included, which are naturally deficient in replication in the absence of complementary adenoviruses or at least adenovirus gene products (provided by, for example, a helper virus, plasmid or complement cell). By "replication deficient" it is indicated that the viral vector comprises a genome that lacks at least one gene function essential for replication. A deficiency in a gene, gene function or region of gene or genomics, as used herein, is defined as a deletion of sufficient genetic material from the viral genome to alter or destroy the function of the gene whose nucleic acid sequence was deleted. completely or in part. The functions of the gene essential for replication are those functions of the gene that are required for replication (i.e. propagation) of a viral vector deficient in replication. The essential gene functions of the viral vector particle vary with the type of viral vector particle in question. Examples of replication-deficient viral vector particles are described in, for example, Marconi et al., Proc. Natl Acad. Sci. USA 93 (21): 11319-20 (1996), Johnson and Friedmann, Methods Cell Biol. 43 (pt. A): 211-30 (1994), Timiryasova et al., J. Gene Med. 3 (5): 468-77 (2001), Burton et al., Stem Cells 19 (5): 358-77 (2001), Kim et al., Virology 282 (1): 154-67 (2001), Jones et al., Virology 278 (1): 137-50 (2000), Gill et al., J. Med. Virol. 62 (2): 127-39 (2000). Other replication-deficient vectors are based on simple MLV vectors (Miller et al. (1990) Mol. Cell Biol. 10: 4239; Kolberg (1992) J. NIH Res. 4:43, and Cometta et al. (1991) Hum. Gene. Ther. 2: 215). Canarian smallpox vectors are advantageous in the infection of human cells, but cannot naturally replicate inside (i.e., without genetic modification).
The basic construction of recombinant viral vectors is well understood in the art and involves using conventional molecular biology techniques such as those described in, for example, Sambrook et al., MOLECULAR CLONING: TO LABORATORY MANUAL (Cold Spring Harbor Press 1989) and its third edition (2001), Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Wiley Interscience Publishers 1995), and Watson, above, and several of the other references mentioned in This document. For example, adenoviral vectors can be constructed and / or purified using the procedures set forth, for example, in Graham et al., Mol. Biotechnol 33 (3): 207-220 (1995), U.S. Pat. No. 5,965,358, Donthine et al., Gene Ther. 7 (20): 1707-14 (2000), and other references described herein. Adeno-associated viral vectors can be constructed and / or purified using the procedures set forth, for example, in US Pat. nº
4,797,368 and Laughlin et al., Gene 23: 65-73 (1983). Similar techniques are known in the art with respect to other viral vectors, particularly with respect to viral herpes vectors (see for example, Lachman et al., Curr. Opin. Mol. Ther. 1 (5): 622-32 (1999 )), lentiviral vectors and other retroviral vectors. In general, the viral vector comprises an insertion of the nucleic acid (for example, a natural adenoviral vector may comprise an insertion of up to 3 KB without deletion) or, more normally, comprises one or more deletions of the virus genome to accommodate insertion of the virus. Nucleic acid and additional nucleic acids, as desired, and to prevent replication in host cells.
Non-viral vectors such as, for example, DNA plasmids, naked nucleic acids and nucleic acid complexed with a delivery vehicle such as a liposome can also be associated with molecules that target the vector for a particular region in the host (for example , a particular organ, tissue and / or cell type). For example, a nucleotide can be conjugated to a protein that chooses a target such as a viral protein that binds to a receptor or a protein that binds to a particular target's receptor (for example, by modification of the techniques in Wu et al., J. Biol. Chem. 263 (29): 14621-24 (1988)). Cationic compositions choosing target are known (see, for example, US 6,120,799). Other techniques for genetic constructs that choose target are provided in the international patent application publication WO 99/41402.
Guest of expression
The present invention also provides manipulated host cells transduced, transfected or transformed with a vector of the invention (eg, a cloning vector or neighbor expression neighbor) or a nucleic acid of the invention. Manipulated host cells can be cultured in conventional nutrient media modified as appropriate to activate promoters, select transformants or amplify the nucleic acid of interest. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to those skilled in the art and in the references cited herein that include, for example, Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, 3rd ed., Wiley-Louis, New York, and references cited therein. Polypeptides of the invention encoded by such vectors or nucleic acids of the invention are expressed in such host cells and can be isolated by conventional techniques. For example, polypeptides released in cell culture can be isolated from culture by ultracentrifugation or similar techniques.
Polypeptides of the invention can be produced in a variety of expression hosts that include, but are not limited to, animal cells such as mammalian cells (eg, CHO cells), which include human and non-human primate cells, and in non-animal cells such as plants, yeast, fungi, bacteria and the like. Examples of suitable expression hosts include bacterial cells such as E. coli, Streptomyces and Salmonella typhimurium; fungal cells such as Saccharomyces cerevisiae, Pichia pastoris and Neurospora crassa; insect cells such as Drosophila and Spodoptera frugiperda; mammalian cells such as CHO cells (for example, CHO-K1), COS (for example, COS-1, COS-7), BHK and HEK (for example, HEK 293), Bowes melanoma cells and plant cells. As noted above, the invention is not limited by the host cells employed. In addition to Sambrook, Berger and Ausubel, all above, details regarding cell culture are found in, for example, Payne et al. (1992) Plant Cell and Tissue Culture in Liquid Systems, John Wiley & Sons, Inc. New York, NY; Gamborg and Phillips (eds.) (1995) Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin Heidelberg NY); Atlas & Parks (eds.) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, FL. Such host cells can be adapted for growth in serum-free protein-free medium, medium without animal component such as, for example, a chemically defined medium (CD) (such as, for example, CD OptiCHO ™ (Invitrogen, No. 12681) using methods known in the art.
The invention provides a cell (s) comprising any one or more of the nucleic acids, vectors or other constructs of the invention (for example, a construct that expresses an ECD of mutant CTLA-4 or CTLA- 4-Ig mutant) described herein or any combination thereof. Also included is a cell comprising one or more of any of the polypeptides, antibodies or fusion proteins, or other constructs of the invention described herein, or any combination of one or more of these. A cell of the invention is normally an isolated or recombinant cell and may comprise a host cell. Such a cell, for example, a recombinant cell, can be modified by transformation, transfection and / or infection with at least one nucleic acid, vector or other construct of the invention. Such a cell can be a eukaryotic cell (e.g., mammalian, yeast or plant cell) or a prokaryotic cell (e.g., bacterial cell) and can be transformed with any such construction of the invention using a variety of known methods that include , for example, calcium phosphate transfection (see, for example, calcium phosphate co-precipitation procedure), DEAE-dextran-mediated transfection, electroporation (Irving et al., Cell 64: 891-901 (1991)), gene or vaccine gun, lipofection and biolistics or other common techniques as noted above. See also the electroporation procedures and technology of Inovio Biomedical Corp. at the universal website address inovio.com.
A strain of host cells is optionally chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired manner. Such modifications of the protein include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation and acylation. Different host cells such as E. cells coli, Bacillus sp., yeast or mammalian, such as CHO, HeLa, BHK, MDCK, HEK 293, WI38, etc., have specific cellular mechanism and characteristic mechanisms for such post-translational activities and can be chosen to ensure correct modification and processing of the introduced foreign protein.
A nucleic acid of the invention can be inserted into an appropriate host cell (in culture or in a host organism) to allow the host to express a protein of interest (eg, ECD of mutant CTLA-4 or mutant CTLA-4-Ig) . Any suitable host cell can be transformed / transduced by the nucleic acids of the invention. Examples of appropriate expression hosts include: bacterial cells such as
AND. coli, Streptomyces, Bacillus sp. and Salmonella typhimurium; fungal cells such as Saccharomyces cerevisiae, Pichia pastoris and Neurospora crassa; insect cells such as Drosophila and Spodoptera frugiperda; mammalian cells such as Vero cells, HeLa cells, CHO cells (eg, CHO-K1), COS cells, WI38 cells, NIH-3T3 cells (and other fibroblast cells such as MRC-5 cells), MDCK cells, cells KB, SW13 cells, MCF7 cells, BHK cells, HEK-293 cells, Bowes melanoma cells and plant cells, etc.
The present invention also provides host cells that are transduced, transformed or transfected with at least one nucleic acid or vector of the invention. As discussed above, a vector of the invention typically comprises a nucleic acid of the invention. Host cells are genetically manipulated (for example, transduced, transformed, infected or transfected) with the vectors of the invention, which can be, for example, a cloning vector or an expression vector. The vector may be in the form of a plasmid, a viral particle, a phage, attenuated bacteria or any other suitable type of vector. Suitable host cells for transduction and / or infection with viral vectors of the invention for the production of recombinant polypeptides of the invention and / or for replication of the viral vector of the invention include the cells described above. Examples of cells that have been shown to be suitable for encapsidation of viral vector particles are described in, for example, Polo et al., Proc. Natl Acad. Sci. 96 (8): 4598-603 (1999), Farson et al., J. Gene Med. 1 (3): 195-209 (1999), Sheridan et al., Mol. Ther. 2 (3): 262-75 (2000), Chen et al., Gene Ther. 8 (9): 697-703 (2001), and Pizzaro et al., Gene Ther. 8 (10): 737-745 (2001). For replication-deficient viral vectors such as AAV vectors, complementary cell lines, cell lines transformed with helper viruses, or cell lines transformed with plasmids encoding genes essential for viral vector replication are needed.
Manipulated host cells can be cultured in conventional nutrient media modified as appropriate to activate promoters, select transformants or amplify the gene of interest. Host cells can be grown in medium containing serum or medium without serum. Host cells can be cultured in a serum-free medium, without protein, without an animal component that includes, for example, a chemically defined medium (for example, CD OptiCHO ™ (Invitrogen, No. 12681)). The cell culture medium can be supplemented, if desired, with supplements known to those skilled in the art such as, for example, one or more amino acids such as L-glutamine (for example, 2% v / v of 200 mM L-glutamine (Invitrogen, No. 25031)). The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to those skilled in the art and in the references cited herein that include, for example, ANIMAL CELL TECHNOLOGY, Rhiel et al., Eds., (Kluwer Academic Publishers 1999), Chaubard et al., Genetic Eng. News 20 (18) (2000), Hu et al., ASM News 59: 65-68 (1993 ), Hu et al., Biotechnol. Prog. 1: 209-215 (1985), Martin et al., Biotechnol. (1987), Freshney, CULTURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUE, 4th ed., (Wiley, 2000), Mather, INTRODUCTION TO CELL AND TISSUE CULTURE: THEORY AND TECHNIQUE (Plenum Press, 1998), Freshney, CULTURE OF IMMORTALIZED CELLS, 3rd ed., (John Wiley & Sons, 1996), CELL CULTURE: ESSENTIAL TECHNIQUE, Doyle et al., Eds. (John Wiley & Sons 1998), and GENERAL TECHNIQUES OF CELL CULTURE, Harrison et al., Eds., (Cambridge Univ. Press 1997).
For stable long-term production of recombinant proteins, stable expression systems can be used. For example, cell lines stably expressing a polypeptide of the invention can be transduced with expression vectors comprising viral replication sources and / or endogenous expression elements and a selection marker gene. After the introduction of the vector, the cells in the cell line can be allowed to grow for 1-2 days in an enriched medium before they are changed to selective media. The purpose of the selection marker is to confer resistance to the selection, and its presence allows the growth and recovery of cells that satisfactorily express the introduced sequences. For example, resistant groups of stably transformed cells can proliferate using tissue culture techniques appropriate for the type of cell. Serum-free media is readily available (for example, JRH Biosciences, SAFC Biosciences, Sigma-Aldrich Corporation, universal website at sigmaaldrich.com). Media without serum or conditioned medium (for example, growth medium previously collected from untransfected or untreated cell cultures) may be preferred for the production of proteins or cell banks in some cases.
The invention includes immortalized cells or cell lines comprising one or more polypeptides (including, for example, dimeric or monomeric fusion proteins and multimeric polypeptides), conjugates, nucleic acids or vectors of the invention.
Host cells transformed with an expression vector and / or polynucleotide are optionally cultured under conditions suitable for the expression and recovery of the encoded cell culture protein. The polypeptide or fragment thereof produced by such a recombinant cell can be secreted, membrane bound or contained intracellularly, depending on the sequence and / or the vector used. Expression vectors comprising polynucleotides encoding mature polypeptides of the invention can be designed with signal sequences that direct the secretion of mature polypeptides by a prokaryotic or eukaryotic cell membrane. Such signal sequences are normally incorporated into the vector so that the signal sequence is expressed at the N-terminus of the polypeptide of the invention. The principles related to such signal sequences are discussed elsewhere herein.
Production and recovery of polypeptides
After transduction of a suitable host strain and growth of the host strain at an appropriate cell density, the selected promoter is induced by appropriate means (e.g. temperature shift or chemical induction) and the cells are cultured for an additional period. . The cells are normally collected by centrifugation, broken by physical or chemical means and the resulting crude extract is retained for subsequent purification. Microbial cells employed in protein expression can be broken by any convenient procedure, including freeze-thaw cycles, sonication, mechanical breakage or use of cell lysate agents, or other procedures that are well known to those skilled in the art. .
As noted, many references are available for the cultivation and production of many cells, including cells of bacterial, plant, animal (especially mammalian) and archaebacterial origin. See for example, Sambrook, Ausubel and Berger (all above), in addition to Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, third edition, Wiley-Liss, New York, and references cited therein; Doyle and Griffiths (1997) Mammalian Cell Culture: Essential Techniques, John Wiley and Sons, NY; Humason (1979) Animal Tissue Techniques, fourth edition WH Freeman and Company; and Ricciardelli, et al., (1989) In vitro Cell Dev. Biol. 25: 1016 1024. For culture and regeneration of plant cells, Payne et al. (1992) Plant Cell and Tissue Culture in Liquid Systems, John Wiley & Sons, Inc. New York, NY; Gamborg and Phillips (eds.) (1995) Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin Heidelberg New York) and Plant Molecular Biology (1993) RRD Croy, Ed. Bios Scientific Publishers, Oxford, UK ISBN 0 12 198370 6. Cell culture media in general are set forth in Atlas and Parks (eds.) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, Fla. Additional information for cell culture is available in commercial literature available such as the Life Science Research Cell Culture Catalog (1998) of Sigma-Aldrich, Inc. (St. Louis, Mo.) ("Sigma-LSRCCC") and, for example, the Plant Culture Catalog and supplement (1997), also of Sigma-Aldrich, Inc (St. Louis, Mo.) ("Sigma-PCCS").
The polypeptides of the invention can be recovered and purified from recombinant cell cultures by various methods well known in the art including precipitation with ammonium or ethanol sulfate, acid extraction, anionic or cationic exchange chromatography, phosphocellulose chromatography, chromatography of hydrophobic interaction, affinity chromatography (for example, using any of the marking systems noted herein), hydroxylapatite chromatography and lectin chromatography. The protein refolding steps can be used, as desired, in completing the mature protein configuration. Finally, high performance liquid chromatography (HPLC) can be used in the final purification steps. In addition to the references noted above, a variety of purification procedures are well known in the art, including, for example, those set forth in Sandana (1997) Bioseparation of Proteins, Academic Press, Inc .; and Bollag et al. (1996) Protein Methods, 2nd edition Wiley-Liss, NY; Walker (1996) The Protein Handbook Humana Press, NJ, Harris and Angal (1990) Protein Purification Applications: A Practical Approach IRL Press at Oxford, Oxford, England; Harris and Angal Protein Purification Principles: A Practical Approach IRL Press at Oxford, Oxford, England; Approach (1993) Protein Purification: Principles and Practice 3rd edition Springer Verlag, NY; Janson and Ryden (1998) Protein Purification: Principles, High Resolution Methods and Applications, Second Edition Wiley-VCH, NY; and Walker (1998) Protein Protocols on CD-ROM Humana Press, NJ.
An expert would understand that the fusion proteins of the invention (eg, mutant CTLA-4-Ig fusion protein) can be prepared by a variety of methods described herein that include, for example, those set forth in Example 1 for prepare LEA29Y-Ig. For example, instead of the nucleic acid encoding LEA29Y, a nucleic acid sequence encoding a mutant CTLA-4 ECD polypeptide of the invention (eg, D3-54 polypeptide) can be cloned into the Fc fusion vector of IgG2 to produce a vector encoding the mutant CTLA-4-Ig fusion protein (eg, D3-54-IgG2), Stable CHO-K1 cells expressing such mutant CTLA-4-Ig fusion protein can be prepared by transfecting such cells with the vector encoding the mutant CTLA-4-Ig fusion protein and the resulting mutant CTLA-4-Ig fusion protein ( for example, D3-54-IgG2) can be expressed (usually in dimeric form) and purified as described in Example 1.
In vitro expression systems
Cellless transcription / translation systems can also be employed to produce recombinant polypeptides of the invention or fragments thereof using DNA and / or RNA of the present invention or fragments thereof. Several such systems are commercially available. A general guide to in vitro transcription and translation protocols is found in Tymms (1995) IN VITRO TRANSCRIPTION AND TRANSLATION PROTOCOLS: METHODS IN MOLECULAR BIOLOGY, volume 37, Garland Publishing, New York.
Procedures
Polypeptides (including, for example, dimeric and monomeric fusion proteins and multimeric polypeptides), conjugates, compositions, nucleic acids, vectors and cells of the invention have a variety of properties and characteristics and are believed to be useful in a variety of applications. which include, but are not limited to, for example, in prophylactic or therapeutic procedures for treating a variety of diseases, disorders and conditions of the immune system in which the modulation or regulation of the immune system and responses of the immune system may be of benefit. For example, polypeptides, conjugates, compositions, nucleic acids, vectors and cells of the invention that have an ability to bind to CD80 and / or CD86 or an ECD of either or both and / or an ability to inhibit an immune response are believed to be useful in prophylactic and / or therapeutic procedures to inhibit or suppress an immune response in a subject, procedures to inhibit rejection of a tissue transplant, cell or organ of a donor by a recipient and other procedures described elsewhere in this document. Some of such polypeptides, conjugates, compositions, nucleic acids, vectors and cells of the invention are expected to be useful in methods for the process of modulating or inhibiting the interaction of T lymphocytes expressing CD28 and / or CTLA-4 with cells positive for B7
In one aspect, the therapeutic or prophylactic procedures disclosed herein involve administering to an individual an effective amount of at least one such polypeptide (including, for example, fusion protein, multimer, etc.), conjugate, composition, nucleic acid. , vector and / or cell to suppress or inhibit an immune response. In a therapeutic context, the subject is normally one suffering from a disease, disorder or condition of the immune system, and administration is performed to prevent the subsequent progression of the disease, disorder or condition. For example, the administration of a molecule of the invention to a subject suffering from a disease of the immune system (for example, autoimmune disease) may cause suppression or inhibition of such an attack of the immune system or biological responses associated therewith. By suppressing this attack of the immune system on healthy body tissues, the resulting physical symptoms (for example, pain, joint swelling, joint swelling or pain with palpation) resulting from or associated with such attack on healthy tissues can be lessened or relieved, and the biological and physical injury resulting from
or associated with the attack of the immune system can be decreased, delayed or stopped.
In a prophylactic context, the subject may be one afflicted with, susceptible to or believed to have a disease, disorder or condition of the immune system, and administration is usually performed to prevent the progression of the disease, disorder or condition, inhibit or relieve symptoms, signs or biological responses associated with it, prevent bodily injury potentially resulting from it, and / or maintain or improve the physical functioning of the subject.
A method of modulating the interaction of T lymphocytes expressing CD28 and / or CTLA-4 with B7 positive cells is disclosed herein, a method comprising contacting B7 positive cells with at least one of the following in a effective amount to modulate the interaction of B7 positive cells with CD28 positive T lymphocytes and / or CTLA-4 positive T lymphocytes: (1) a polypeptide of the invention (eg, mutant CTLA-4 ECD polypeptide or dimeric or monomeric mutant CTLA-4-Ig fusion protein); (2) a multimer comprising one or more polypeptides of the invention (for example, a dimer comprising any two of such polypeptides or a tetramer comprising four any such polypeptide); (3) a conjugate comprising at least one polypeptide of the invention; (4) a nucleic acid of the invention (for example, a nucleic acid encoding a polypeptide of the invention); (5) a vector comprising a nucleic acid of the invention or encoding a polypeptide of the invention; (6) a cell or population of cells comprising a polypeptide, nucleic acid, conjugate and / or vector of the invention; and / or (7) composition of the invention, wherein the interaction of B7 positive cells with CD28 positive T lymphocytes and / or CTLA-4 positive T lymphocytes is modulated. Normally, the modulating effect is an inhibitory effect such that the interaction of B7 positive cells with CD28 positive T lymphocytes and / or CTLA positive T lymphocytes is inhibited
Four. In some cases, B7 positive cells are antigen presenting cells (APC). In some such procedures, the interaction of B7-2 positive cells (eg, APC expressing B7-2 (CD86)) with CD28 positive T lymphocytes is inhibited. In some such procedures, the interaction of B7-1 positive cells (eg, APC expressing B7-1 (CD80)) with CD28 positive T lymphocytes is inhibited.
A method for inhibiting the interaction of T lymphocytes positive for CD28 and / or T lymphocytes positive for CTLA-4 with B7 positive cells is disclosed herein, a method comprising contacting B7 positive cells (e.g., B7-1 positive cells and / or B7-2 positive cells) with at least one of the following molecules or components of the invention in an amount effective to inhibit the interaction of CD28 positive T cells and / or T cells positive for CTLA-4 with B7 positive cells:
<dl><dt>(1)</dt><dd> a polypeptide of the invention (eg, mutant CTLA-4 ECD polypeptide or dimeric or monomeric mutant CTLA4-Ig fusion protein); (2) a multimer comprising one or more polypeptides of the invention (for example, a dimer comprising any two of such polypeptides or a tetramer comprising four any such polypeptide); (3) a conjugate comprising at least one polypeptide of the invention; (4) a nucleic acid of the invention (for example, a nucleic acid encoding a polypeptide of the invention); (5) a vector comprising a nucleic acid of the invention or encoding a polypeptide of the invention; (6) a cell</dd></dl>
<dl><dt /><dd>or population of cells comprising a polypeptide, nucleic acid, conjugate and / or vector of the invention; and / or (7) composition of the invention, in which the interaction of T lymphocytes positive for CD28 and / or T lymphocytes positive for CTLA-4 with B7 positive cells is inhibited. In some cases, B7 positive cells are APC. In some cases, the interaction of CD28 positive T lymphocytes with hB7-1 positive cells and / or hB7-2 positive cells is inhibited. In some of such procedures, inhibition of the interaction of CD28 positive T cells with hB7-1 positive cells and / or hB7-2 positive cells results in the suppression or inhibition of one or more of the following: activation or proliferation of T lymphocytes, synthesis or production of cytokines (for example, production of TNF-∀, IFN- !, IL-2), induction of various activation markers (for example, CD25, IL-2 receptor), inflammation, swelling of joints or pain with palpation, serum level of C-reactive protein, production of anti-collagen antibodies and / or antibody response (s) dependent on T lymphocytes. </dd></dl>
In some of such procedures, at least one of such a molecule or component of the invention is administered to a subject in an amount effective to inhibit the interaction of endogenous CD28 positive T lymphocytes with endogenous B7-1 positive cells and / or positive cells. for B7-2 in the subject. In some such procedures, the interaction of endogenous CD28 positive T lymphocytes with endogenous B7 positive cells expressing B7-2 (CD86) or B7-1 (CD80) is inhibited. In some cases, B7 positive cells are APCs that express B7-2
<dl><dt /><dd>or B7-1, and the interaction of B7-2 or B7-1 with CD28 positive T lymphocytes is inhibited. In some cases, the interaction of both B7-2 and B7-1 expressed on APC with CD28 positive T lymphocytes is inhibited.</dd></dl>
In this document a method of suppressing an immune response in vitro or in vivo is disclosed. The method comprises contacting B7 positive cells with at least one of the following molecules or components of the invention in an amount effective to suppress an immune response: (1) a polypeptide of the invention (eg, CTLA- ECD polypeptide) 4 mutant or fusion protein CTLA-4-Ig dimeric or monomeric mutant); (2) a multimer comprising one or more polypeptides of the invention (for example, a dimer comprising any two of such polypeptides or a tetramer comprising four any such polypeptide); (3) a conjugate comprising at least one polypeptide of the invention; (4) a nucleic acid of the invention (for example, a nucleic acid encoding a polypeptide of the invention); (5) a vector comprising a nucleic acid of the invention or encoding a polypeptide of the invention; (6) a cell
<dl><dt /><dd>or population of cells comprising a polypeptide, nucleic acid, conjugate and / or vector of the invention; and / or (7) composition of the invention, thus suppressing an immune response. One or more immune responses may be suppressed, including, for example, T lymphocyte response, proliferation or activation of T lymphocytes, synthesis or production of cytokines, inflammation, swelling of joints or pain with palpation, serum level of C-reactive protein , production of anti-collagen antibodies and / or antibody response (s) dependent on T lymphocytes. In such methods comprising contacting a B7 positive cell with a polypeptide of the invention, the polypeptide binds to B7-1 (eg, human B7-1) expressed on cells </dd></dl>
positive for B7, and / or binds to B7-2 (for example, human B7-2) expressed on B7 positive cells. In some cases, B7 positive cells are APC. In some cases, an immune response is suppressed in vitro, such as in, for example, an in vitro assay that includes those described in detail elsewhere herein (see, for example, the examples below). In some cases, an immune response is suppressed in vivo in a subject to which an amount effective to suppress an immune response is administered such as, for example, in therapeutic or prophylactic treatment procedures (eg, procedure for treating rheumatic disease such such as rheumatoid arthritis, or other autoimmune disease) treated in detail elsewhere in this document.
A method of suppressing an immune response in a subject (eg, mammal, such as a human being) is disclosed herein. The method comprises administering to a subject in need thereof at least one of the following molecules or components of the invention in a therapeutically or prophylactically effective amount (eg, therapeutically or prophylactically effective dose) that suppresses an immune response in the subject: ( 1) a polypeptide of the invention (eg, mutant CTLA-4 ECD polypeptide or dimeric or monomeric mutant CTLA-4-Ig fusion protein); (2) a multimer comprising one or more polypeptides of the invention (for example, a dimer comprising any two of such polypeptides or a tetramer comprising four any such polypeptide); (3) a conjugate comprising at least one polypeptide of the invention; (4) a nucleic acid of the invention (for example, a nucleic acid encoding a polypeptide of the invention); (5) a vector comprising a nucleic acid of the invention or encoding a polypeptide of the invention; (6) a cell or population of cells comprising a polypeptide, nucleic acid, conjugate and / or vector of the invention; and / or (7) composition of the invention, thus suppressing an immune response in the subject.
This document discloses a procedure for treating a subject who has a disease or immune system disorder modulated by the interaction of endogenous T lymphocytes with endogenous cells expressing CD80 and / or CD86. The method comprises administering to a subject in need of such treatment a therapeutically effective amount of: (1) a polypeptide of the invention (eg, mutant CTLA-4 ECD polypeptide
or dimeric or monomeric mutant CTLA-4-Ig fusion protein); (2) a multimer comprising one or more polypeptides of the invention (for example, a dimer comprising any two of such polypeptides or a tetramer comprising four any such polypeptide); (3) a conjugate comprising at least one polypeptide of the invention; (4) a nucleic acid of the invention (for example, a nucleic acid encoding a polypeptide of the invention); (5) a vector comprising a nucleic acid of the invention or encoding a polypeptide of the invention; (6) a cell or population of cells comprising a polypeptide, nucleic acid, conjugate and / or vector of the invention; and / or (7) composition of the invention, thus treating the disease or disorder of the immune system in the subject. If the subject is a human being, CD80 is human CD80, CD86 is human CD86 and CD28 is human CD28. In some of these procedures the interaction between endogenous T lymphocytes expressing CD28 and endogenous cells expressing CD86 and / or endogenous cells expressing CD80 is inhibited.
It is believed that a variety of diseases or disorders of the immune system, including rheumatic disease or disorder or of the autoimmune system, can be effectively treated using one or more of the molecules disclosed herein such as, for example, an ECD polypeptide of mutant CTLA-4 (for example, any of SEQ ID NO: 1-73 such as, for example, ECD of mutant CTLA-4 of D3-54 (SEQ ID NO: 36), D3-69 (SEQ ID NO: 50) or D3-27 (SEQ ID NO: 24)), or a fusion protein thereof (for example, D3-54-IgG2 (SEQ ID NO: 197 or 211), D3-69-IgG2 (SEQ ID NO: 199 or 213), D3-29-IgG2 (SEQ ID NO: 79 or 210)). The disease or disorder of the immune system may be or involve, for example, but not limited to, Addison's disease, allergy, alopecia areata, Alzheimer's disease, vasculitis associated with anti-neutrophil cytoplasmic antibodies (ANCA), ankylosing spondylitis, antiphospholipid syndrome (syndrome of Hughes), arthritis, asthma, atherosclerosis, atherosclerotic plaque, autoimmune disease (for example, lupus, RA, MS, Graves' disease, etc.), autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune disease of the inner ear, autoimmune lymphoproliferative syndrome, autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, azoospermia, Behcet's disease, Berger's disease, bullous pemphigoid, cardiomyopathy, cardiovascular disease, celiac disease / celiac disease, chronic fatigue syndrome immune dysfunction (SFCDI), chronic idiopathic polyneuritis, chronic inflammatory demyelinating polyradiculoneuropathy (PDIC), chronic recurrent polyneuropathy (Guillain-Barré syndrome), Churg-Strauss syndrome (SCS), scarring pemphigoid, cold agglutinin disease (EAF), COPD, CREST syndrome, Crohn's disease, dermatitis, herpetiformis, dermatomyositis, diabetes, lupus discoid, eczema, acquired bullous epidermolysis, essential mixed cryoglobulinemia, Evan syndrome, exophthalmia, fibromyalgia, Goodpasture syndrome, graft-related disease or disorder, Grave disease, EIFH, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, immunoproliferative disease or disorder (e.g., psoriasis), inflammatory bowel disease (IBD), insulin-dependent diabetes mellitus (DMDI), interstitial lung disease , juvenile diabetes, juvenile arthritis, juvenile idiopathic arthritis (JIA), Kawasaki disease, Lambert-Eaton myasthenic syndrome, lichen planus, lupus, lupus nephritis, Lymphocytic hypophysitis, Ménière's disease, Miller Fish syndrome / acute disseminated encephalomielorradiculopathy, mixed connective tissue disease, multiple sclerosis (MS), muscular rheumatism, myelgic encephalomyelitis (ME), myasthenia gravis, ocular inflammation, foliar pemphigus, vulgar pemphigus, anemia pernicious, polyarteritis nodosa, polychondritis, polyglandular syndromes (Whitaker syndrome), polymyalgia rheumatica, polymyositis, primary agammaglobulinemia, Primary biliary cirrhosis / autoimmune cholangiopathy, psoriasis, psoriatic arthritis, Raynaud's phenomenon, Reiter's syndrome / reactive arthritis, restenosis, rheumatic fever, rheumatic disease, rheumatoid arthritis, sarcoidosis, Schmidt syndrome, scleroderma, Sjörgen syndrome, transplant rejection solid organ (kidney, heart, liver, lung, etc.), Stiff-Man syndrome, systemic lupus erythematosus (SLE), systemic scleroderma, Takayasu arteritis, temporal arteritis / giant cell arteritis, thyroiditis, type 1 diabetes, type 2 diabetes, ulcerative colitis, uveitis, vasculitis, vitiligo, Wegener's granulomatosis, and prevent or suppress an immune response associated with rejection of a tissue transplant, cell , graft or donor organ by a recipient subject. Graft-related diseases or disorders include graft versus host disease (EIFH) such as bone marrow-associated transplantation, and immune disorders resulting from or associated with rejection of organ, tissue or cell graft transplantation (e.g., allografts or xenografts) of tissues or cells) that include, for example, grafts of skin, muscle, neurons, islets, organs, parenchymal cells of the liver, etc. With respect to a transplant of donor tissue, cell, graft or solid organ in a recipient subject, it is believed that such molecules of the invention disclosed herein (eg, mutant CTLA-4 ECD polypeptide or fusion protein CTLA-4-Ig mutant) may be effective in preventing acute rejection of such a transplant in the recipient and / or for long-term maintenance therapy to prevent rejection of such a transplant in the recipient (e.g., inhibit transplant rejection of insulin-producing islet cells from a donor in the recipient subject to diabetes).
The invention includes any mutant CTLA-4 ECD polypeptide or mutant CTLA-4-Ig fusion protein of the invention for use in suppressing an immune response associated with at least one of the above immune system diseases or disorders. The use of any mutant CTLA-4 ECD polypeptide or mutant CTLA-4-Ig fusion protein of the invention is also provided in the manufacture of a medicament for suppressing an immune response with at least one of the diseases or disorders of the previous immune system.
An effective amount of a molecule of the disclosure such as, for example, a mutant CTLA-4 ECD polypeptide (eg, D3-54, D3-69, D3-29, D3-56, D3-75) or a Ig fusion protein comprising a mutant CTLA-4 ECD polypeptide of the disclosure (eg, D3-54-IgG2, D3-69-IgG2, D3-29-IgG2, D3-56-IgG2, D3-75 -IgG2, respectively) to suppress an immune response in a subject or to treat a disease or disorder of the immune system modulated by interaction of endogenous T lymphocytes with endogenous cells expressing CD80 and / or CD86 in a subject in the procedures described herein may comprise approximately 0.0001 milligrams per kilogram (mg / kg) of the subject's weight to approximately 200 milligrams per kilogram (mg / kg) of the subject's body weight such as, for example, from about 0.001 milligrams per kilogram (mg / kg) of the subject's body weight to about 100 milligrams per kilogram (mg / kg) of the subject's weight or, for example, about 0.001 mg / kg of the subject's weight at least about 0.005, 0.01, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 25, 50 or 75 mg / kg of the subject's body weight. One or more immune responses can be suppressed in the subject, which includes, for example, T lymphocyte response, activation or proliferation of T lymphocytes, synthesis or production of cytokines (eg, production of TNF-∀, IFN- !, IL -2, etc.), induction of various activation markers (for example, CD25, IL-2 receptor, etc.), synthesis or production of inflammatory molecules, inflammation, swelling of joints, pain with palpation of joints, pain, stiffness, serum levels of C-reactive protein, production of anti-collagen antibodies and / or antibody response (s) dependent on T lymphocytes). An effective amount of a molecule or component of the invention to suppress an immune response may be an amount that suppresses an immune response or a symptom or sign thereof for a detectable or measurable amount. The immune response can be partially or completely suppressed. An amount effective to treat a disease or disorder of the immune system may be an amount that mitigates, reduces or alleviates at least one symptom or biological response, or effect associated with the disease or disorder, prevents the progression of the disease or disorder, or improves the physical functioning of the subject.
An effective amount of a molecule or component of the invention to modulate or inhibit the interaction of T lymphocytes expressing CD28 and / or CTLA-4 with B7 positive cells may be an amount that modulates or inhibits binding between B7 positive cells and T lymphocytes positive for CD28 and / or positive for CTLA-4, respectively. Such binding interaction (interactions) may be partially or completely modulated or inhibited.
In some of such methods, a mutant CTLA-4-Ig fusion protein dimer of the invention is administered to the subject in a therapeutically or prophylactically effective amount (or dose) sufficient to suppress an immune response, treat a disease or system disorder. immune modulated by the interaction of T lymphocytes with cells expressing B7, or modulating or inhibiting the interaction of T lymphocytes expressing CD28 and / or CTLA-4 with B7 positive cells. The fusion protein dimer administered is normally a soluble Ig fusion protein dimer. In some of such procedures, the effective amount or dose of the fusion protein dimer of the invention comprises from about 0.001 milligrams per kilogram (mg / kg) of the subject's body weight to about 200 milligrams per kilogram (mg / kg) of weight. of the subject's body (such as, for example, a human being) or from about 0.001 mg / kg to about 300 mg / kg of the subject's body weight. For example, the effective amount or dose of the fusion protein dimer may comprise from about 0.001 mg / kg body weight of the subject to at least about 0.005, 0.01, 0.05, 0.1, 0.2, 0 , 3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 10, 25, 30, 40, 50, 60, 75 , 80, 90, 100, 125, 150, 175, 200, 225, 250 or 300 mg / kg of the subject's body weight (such as, for example, human being, which includes an adult human). In some cases, the effective amount or dose is from about 0.001 milligrams (mg) to about 50 milligrams per kilogram (kg) of the subject's body weight that includes, but is not limited to, for example, about 0.01 mg / kg to about 100 mg / kg of the subject's body weight (eg, human), from about 0.01 mg / kg to about 50 mg / kg of the subject's body weight, or about 0.01 mg / kg to approximately 25 mg / kg of subject weight; for example, about 0.05 mg / kg, 0.075 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.25 mg / kg, 0, is administered to the subject. 3 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 1.5 mg / kg, 2 mg / kg, 2.5 mg / kg, 3 mg / kg, 5 mg / kg, approximately 10 mg / kg, 20 mg / kg, 25 mg / kg, 50 mg / kg, 75 mg / kg or 100 mg / kg of the subject's body weight (for example, adult human patient). In some cases, the effective amount or dose of the fusion protein dimer is about 2 to 10 mg / kg, about 3 to 10 mg / kg, about 3 to 5 mg / kg, about 5 to 10 mg / kg, 0 , 1 to 5 mg / kg, approximately 0.05 to 1.0 mg / kg, approximately 0.05 to 3 mg / kg, approximately 0.05 to 2.0 mg / kg, approximately 0.05 to 1.0 mg / kg, approximately 0.1 to 2.0 mg / kg, approximately 0.1 to 3.0 mg / kg, approximately 0.1 to 0.5 mg / kg, approximately 0.1 to 0.8 mg / kg kg, approximately 0.1 to 0.6 mg / kg, approximately 0.01 mg / kg to approximately 0.05 mg / kg, approximately 0.01 mg / kg to approximately 0.1 mg / kg, approximately 0.01 mg / kg at about 0.05 mg / kg, about 0.01 mg / kg at about 1 mg / kg, about 0.01 at about 5 mg / kg, about 0.01 mg / kg at about 3 mg / kg, about 0.05 mg / kg at about 2.5 mg / kg, about 0.1 mg / kg at about 1 mg / kg, approximately 0.1 mg / kg to approximately 5 mg / kg, approximately 0.2 to 1 mg / kg, approximately 0.2 to 0.6 mg / kg, approximately 0.2 to 0.5 mg / kg approximately 0, 3 to 1 mg / kg, approximately 0.3 to 0.6 mg / kg, approximately 0.3 to 0.5 mg / kg of a subject's weight. In some cases, the effective amount or dose is less than about 500 mg for a subject weighing less than 60 kg (for example, less than about 100 mg, 75 mg, 50 mg, 25 mg, 12.5 mg or 10 mg ), less than about 750 mg for a subject weighing between 60-100 kg (for example, less than about 150 mg, 100 mg, 75 mg, 37.5 mg or 20 mg), or less than about 1000 mg for a subject weighing more than 100 kg (for example, less than about 500 mg, 100 mg, 50 mg, 25 mg or 10 mg).
In another aspect, in some of such methods a mutant CTLA-4-Ig fusion protein of the invention is administered to the subject in a therapeutically or prophylactically effective amount or dose that is, for example, sufficient to suppress an immune response, treat a disease or disorder of the immune system modulated by interaction of T lymphocytes with cells expressing B7, or modulate or inhibit the interaction of T lymphocytes expressing CD28 and / or CTLA-4 with B7 positive cells. The effective amount or dose of the fusion protein, which is normally a soluble fusion protein, may comprise from about 0.001 mg / kg to about 300 mg / kg, about 0.001 mg / kg to about 200 mg / kg, or about 0.001 mg / kg to approximately 300 mg / kg of the subject's body weight (for example, being human). In one aspect, the effective amount or dose of the fusion protein comprises from about 0.001 mg / kg to at least about 0.005, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4 , 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 10, 25, 30, 40, 50, 60, 75, 80, 90, 100 , 125, 150, 175, 200, 225, 250 or 300 mg / kg of the subject's body weight. In another aspect, the effective amount or dose is from about 0.01 mg / kg to about 100 mg / kg, from about 0.01 mg / kg to about 50 mg / kg, or from about 0.01 mg / kg a approximately 25 mg / kg of subject weight. Exemplary doses or amounts include approximately 0.05 mg / kg, 0.075 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.25 mg / kg, 0 , 3 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 1.5 mg / kg, 2 mg / kg, 2.5 mg / kg, 3 mg / kg, 5 mg / kg, approximately 10 mg / kg, 20 mg / kg, 25 mg / kg, 50 mg / kg, 75 mg / kg and 100 mg / kg of the subject's body weight (for example, adult human being). In another aspect, the effective amount or dose of the fusion protein is about 2 to 10 mg / kg, about 3 to 10 mg / kg, about 3 to 5 mg / kg, about 5 to 10 mg / kg, 0, 1 to 5 mg / kg, approximately 0.05 to 1.0 mg / kg, approximately 0.05 to 3 mg / kg, approximately 0.05 to 2.0 mg / kg, approximately 0.05 to 1.0 mg / kg, approximately 0.1 to 2.0 mg / kg, approximately 0.1 to 3.0 mg / kg, approximately 0.1 to 0.5 mg / kg, approximately 0.1 to 0.8 mg / kg , approximately 0.1 to 0.6 mg / kg, approximately 0.01 mg / kg to approximately 0.05 mg / kg, approximately 0.01 mg / kg to approximately 0.1 mg / kg, approximately 0.01 mg / kg at about 0.05 mg / kg, about 0.01 mg / kg at about 1 mg / kg, about 0.01 at about 5 mg / kg, about 0.01 mg / kg at about 3 mg / kg, about 0.05 mg / kg at about 2.5 mg / kg, about 0.1 mg / kg at about 1 mg / kg, approximately 0.1 mg / kg to approximately 5 mg / kg, approximately 0.2 to 1 mg / kg, approximately 0.2 to 0.6 mg / kg, approximately 0.2 to 0.5 mg / kg approximately 0, 3 to 1 mg / kg, approximately 0.3 to 0.6 mg / kg, approximately 0.3 to 0.5 mg / kg of a subject's weight. In some aspects, the effective amount or dose is less than about 500 mg for a subject weighing less than 60 kg (for example, less than about 100 mg, 75 mg, 50 mg, 25 mg, 12.5 mg or 10 mg ), less than about 750 mg for a subject weighing between 60-100 kg (for example, less than about 150 mg, 100 mg, 75 mg, 37.5 mg or 20 mg), or less than about 1000 mg for a subject weighing more than 100 kg (for example, less than about 500 mg, 100 mg, 50 mg, 25 mg or 10 mg).
The effective amount or dose of a nucleic acid, vector, composition and / or cell of the invention sufficient to similarly suppress an immune or modular response, treat a disease or disorder of the immune system modulated by interaction of T lymphocytes with cells expressing cells can be determined. B7, or modulate or inhibit the interaction of T lymphocytes expressing CD28 and / or CTLA-4 with B7 positive cells. For example, if a vector encoding such a fusion protein dimer of the invention is to be administered to the subject, one skilled in the art can easily determine the amount of vector to be administered such that a therapeutic or prophylactically effective amount is also produced. desired of the fusion protein dimer in the subject.
The disclosure of fusion protein dimers by way of example herein includes any of those described in detail above and herein which includes, for example, a fusion protein dimer comprising two identical fusion protein monomers. , wherein each fusion protein monomer comprises a mutant CTLA-4 ECD polypeptide of the disclosure fused at its C-terminus with the N-terminus of an Ig Fc polypeptide (eg, Fc of IgG2, IgG1, IgG4 or mutant Ig F polypeptide that reduces effector function). An exemplary mutant CTLA-4 ECD polypeptide is one that comprises a polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73. An exemplary fusion protein dimer is one comprising two fusion protein monomers, wherein each fusion protein monomer comprises a polypeptide sequence selected from the group consisting of SEQ ID NO: 74-79, 197 -200, 205-214 and 219-222. Typically, the two monomeric fusion proteins in a dimeric fusion protein are covalently linked together by at least one disulfide bond formed between cysteine residue (s) present in each monomer.
In any of the methods described above, the molecule or component of the invention (for example, polypeptide (including, for example, dimeric or monomeric fusion protein or multimer of polypeptides), conjugate, nucleic acid, vector, composition and / or cell of the invention) can be administered to the subject as a composition. The composition typically comprises at least one of such a molecule or component and an excipient, vehicle or diluent. The composition may comprise a pharmaceutical composition comprising at least one of such a molecule or component and a pharmaceutically acceptable excipient, vehicle or diluent (eg, PBS). The pH of the compositions of the invention typically ranges from about pH 6.0 to about pH 9.0, which includes, for example, from about pH 6.5 to about pH 8.5, usually from about pH 7.0 to approximately pH 8.0. In one aspect, the pH of the compositions of the invention typically ranges from about pH 3 to about pH 10, from about pH 4 to about pH 10, from about pH 5 to about pH 9, from about pH 6 to about pH 9, from about pH 5.5 to about pH 8.5, from about pH 6.0 to about pH 6.7, from about pH 6.0 to about pH 6.5, from about pH 6.2 to about pH 8, 7, from about pH 6.5 to about pH 7.5, from about pH 6.2 to about pH 7.0, from about pH 6.3 to about pH 6.8, from about pH 6.4 to about pH 6, 8, and about pH 7.0 to about pH 7.4. In one aspect, a composition comprising at least one of such a molecule or component of the invention such as, for example, a mutant CTLA-4-Ig fusion protein, has a pH of pH 5.5, pH 6.0, pH 6.1, pH 6.2, pH 6.3, pH 6.4, pH 6.5, pH 6.6, pH 6.7, pH 6.8, pH 6.9, pH 7.0, pH 7.1, pH 7.2, pH 7.3, pH 7.4, pH 7.5, pH 7.6, pH 7.7, pH 7.8, pH 7.9, pH 8.0, pH 8.1, pH 8.2, pH 8.3, pH 8.4, pH 8.5, pH 8.6, pH 8.7, pH 8.8, pH 8.9, pH 9.0, pH 9.1, pH 9.2, pH 9.3, pH 9.4, pH 9.5, pH 9.6, pH 9.7, pH 9.8, pH, 9.9 or pH 10.0. Some compositions of the invention include one or more salts (for example, sodium chloride, sodium phosphate, calcium chloride and the like), one or more buffers (for example, HEPES, sodium citrate, sodium phosphate (for example, Na2HPO4 / Na3PO4), succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, tris (hydroxymethyl) aminomethane (Tris) and the like), one, two, three, four, five or more saccharides or sugars (e.g., sucrose, mannose maltose trehalose dextrose and the like) and / or one, two, three, four or more polyols or sugar alcohols (eg, mannitol, sorbitol, glycol, glycerol, arabitol, erythritol, xylitol, ribitol, lactitol and the like). One, two, three, four, five or more monosaccharides, disaccharides and / or polysaccharides may be included in the composition. The composition of the invention may comprise any concentration of such a molecule or component effective to suppress an immune response when administered to the subject. For example, in some of such procedures (including, for example, procedures in which immunosuppression is desired such as, but not limited to, for example, treatment of rheumatoid arthritis or similar immune disorders, or to inhibit rejection of a transplant of tissue, cell, graft or organ of a donor by a recipient subject), a pharmaceutical composition comprising a vehicle, pharmaceutically acceptable excipient or diluent and a fusion protein dimer of the invention is administered to the subject (eg, parentally, subcutaneously, intravenously, intramuscularly, etc.), wherein the pharmaceutical composition comprises a fusion protein dimer of the invention at a concentration of about 0.001 mg / ml to about 200 mg / ml, about 0.001 mg / ml to about 300 mg / ml, approximately 0.01 mg / ml to approximately 200 mg / ml, approximately 0.01 mg / ml to approximately 250 mg / ml, approximately 0.1 mg / ml to approximately 200 mg / ml, approximately 0.001 mg / ml to approximately 100 mg / ml, approximately 0.001 mg / ml to approximately 90 mg / ml, approximately 0.01 mg / ml to approximately 90 mg / ml, approximately 0.01 mg / ml to approximately 75 mg / ml, approximately 0.1 to approximately 80 mg / ml, approximately 0.1 to approximately 75 mg / ml, approximately 0.1 to approximately 60 mg / ml, approximately 0.1 to approximately 50 mg / ml, approximately 0.1 to approximately 40 mg / ml, approximately 0.1 to approximately 30 mg / ml, approximately 1 to approximately 90 mg / ml, approximately 1 to approximately 80 mg / ml, approximately 1 to approximately 75 mg / ml, approximately 1 to approximately 60 mg / ml, approximately 1 to approximately 50 mg / ml, approximately 1 to approximately 40 mg / ml, approximately 1 to approximately 30 mg / ml, approximately 1 to approximately 20 mg / ml, approximately 1 to approximately 10 mg / ml, approximately 1 to approximately 5 mg / ml, approximately 5 to approximately 90 mg / ml, approximately 5 to approximately 80 mg / ml, approximately 5 to approximately 75 mg / ml, approximately 5 to approximately 60 mg / ml, approximately 5 to approximately 50 mg / ml, approximately 5 to approximately 40 mg / ml, approximately 5 to approximately 30 mg / ml, approximately 5 to approximately 20 mg / ml, approximately 5 to approximately 10 mg / ml, approximately 1 to approximately 5 mg / ml, approximately 10 to approximately 75 mg / ml, approximately 25 mg / ml at about 75 mg / ml, about 30 mg / ml at about 60 mg / ml, about 25 to about 50 mg / ml, about 50 mg / ml at about 100 mg / ml, which includes, for example, about 1 mg / ml, 5 mg / ml, 10 mg / ml, approximately 15 mg / ml, approximately 25 mg / ml, approximately 30 mg / ml, approximately 40 mg / ml, approximately 50 mg / ml, approximately 60 mg / ml, approximately 70 mg / ml, approximately 80 mg / ml, approximately 90 mg / ml, or 100 mg / ml. Other concentrations are contemplated. In some procedures described herein, which include some therapeutic or prophylactic procedures, a volume of any such composition (eg, pharmaceutical composition) comprising a fusion protein of the invention in a range of about 0.01 milliliters ( ml) to approximately 10 ml, approximately 0.01 ml to approximately 5 ml, approximately 0.1 ml to approximately 5 ml, approximately 0.5 ml to approximately 2 ml, about 1 ml to about 2 ml, which includes, for example, a volume of 0.01 ml, 0.025 ml, 0.05 ml, 0.1 ml, 0.2 ml, 0.3 ml, 0.4 ml, 0.5 ml, 0.75 ml, 1 ml, 2 ml, 3ml, 4 ml, 5 ml, 10 ml, 20 ml, 25 ml, 50 ml, 75 ml, 100 ml, 200 ml, 250 ml, 300 ml , 500 ml, 1000 ml, etc., is administered to a subject by a single iv, sc, im or ip injection. More details of exemplary compositions of the invention are discussed elsewhere herein.
The effective amount or dose of a molecule of the invention that is administered to a particular subject can be varied depending on, for example, the disease, disorder or condition being treated, the potency of the particular mutant CTLA-4 molecule of the invention. (i.e. its effectiveness) (for example, a mutant CTLA-4-Ig fusion protein dimer of the invention) to be administered, the mode of administration of the molecule and the individual's ability to tolerate a specific amount of the particular molecule. For example, in a procedure to suppress an immune response in a subject having rheumatoid arthritis (RA) or a procedure to treat RA, the effective amount or dose of a mutant CTLA-4-Ig dimer of the disclosure (e.g., D3-29-IGg2, D3-54-IgG2, D3-56-IgG2, D3-69-IgG2, D3-75-IgG2, etc.) to be administered to the subject can be determined based on a variety of factors including the potency of the mutant CTLA-4-Ig dimer, the mode of administration of the dimer and / or the severity of the symptoms or signs of rheumatoid arthritis of the subject. In one aspect, an effective amount or dose of a particular mutant CTLA-4-Ig dimer of the invention can be determined by comparing the potency of such mutant CTLA-4-Ig dimer with that of the Orencia® dimer. Dosages of the effective Orencia® dimer to treat rheumatoid arthritis and related disorders are known in the art. For example, the Orencia® dimer is normally administered intravenously to a human being suffering from rheumatoid arthritis at a dose of approximately 10 mg of Orencia® per kilogram (kg) of human body weight. A mutant CTLA-4-Ig dimer of the invention that is approximately "X" times more potent than Orencia® can be administered (for example, intravenously, subcutaneously, or otherwise described herein) to a human being suffering from rheumatoid arthritis at a dose that is approximately "X" times lower than the dose of the Orencia® dimer to achieve a therapeutic effect (for example, suppress an immune response) that is approximately equivalent to that of the Orencia® dimer. If a greater therapeutic effect is desired, a proportionately high amount or dose of the mutant CTLA-4-Ig dimer can be readily determined and administered to humans.
In any of the methods described herein, the molecule or component of the invention (for example, a polypeptide (including, for example, dimeric or monomeric fusion protein or multimer of polypeptides), conjugate, nucleic acid, vector, composition and / or cell of the invention) can be administered parentally, subcutaneously or intravenously, or as described elsewhere herein. The molecule or component of the invention can be administered in a therapeutically effective amount once, twice, three or four times a month, twice a week, biweekly (every two weeks) or bi-monthly (every two months). Administration may last for a period of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months or more (for example, one, two, three, four or more years, which includes during the life of the subject).
Any of the methods described herein may further comprise administering to the subject an effective amount of at least one additional therapeutic or immunosuppressive agent or compound. Therefore, a method of suppressing an immune response is disclosed herein comprising administering to an individual in need thereof (1) an effective amount of at least one first immunosuppressive agent, in which each of said first agent Immunosuppressant is a polypeptide, nucleic acid, vector, composition and / or cell of the invention, and (2) an effective amount of at least a second immunosuppressive agent, suppressing an immune response in the subject.
A variety of additional therapeutic or immunosuppressive agents (which are not molecules of the invention) can be used or co-administered with a molecule of the invention (for example, polypeptide, nucleic acid, vector, composition and / or cell of the invention). Such agents include, for example, a disease-modifying anti-rheumatic drug (DMARD) (such as, for example, metrotrexate (MTX), cytokine antagonist (for example, IL-2 or IL-6 antagonist), steroidal compound ( for example, corticosteroid, glucocosteroid, for example, prednisone or methylprednisone), non-steroidal compound, sodium or magnesium salicylate, ibuprofen, acetylsalicylic acid, acetaminophen, antibody, Biological agent that blocks the synthesis of an anti-inflammatory cytokine production, Raptiva® efalizumab, anti-inflammatory agent or compound, and non-steroidal anti-inflammatory drug (NSAID). Such an additional therapeutic or immunosuppressive agent may be administered to the subject in a pharmaceutical composition comprising the additional agent and a pharmaceutically acceptable carrier or excipient. The effective amount or dose of the agent to be administered will depend on the specific agent. Some of such agents are currently used in immunosuppressive therapies and appropriate dosages can be determined based on the disease, disorder or condition being treated and the ability of the subject to tolerate specific amounts or doses, and the immunosuppressive efficacy of the agent. Exemplary doses are known for immunosuppressive agents described above that are not molecules of the invention. The additional immunosuppressive agent that is not a molecule of the invention can be administered simultaneously with or before
or after administration of the molecule of the invention (eg, mutant CTLA-4-Ig fusion protein).
A treatment regimen that includes, for example, dose, administration schedule, administration procedure (eg, intravenous injection, subcutaneous injection, etc.) and pharmaceutical composition comprising at least one of such a molecule or component of the invention may vary. depending on the disease, disorder or condition to be treated. One or more such molecules or components of the invention can be administered to a subject; each of such a molecule or component does not need to be administered in the same pharmaceutical formulation, by the same administration procedures, in the same amount or by the same dosage frequency schedule.
In some of such procedures, for example, about 1 ml of a pharmaceutical composition comprising a pharmaceutically acceptable excipient, vehicle or diluent and a concentration of a fusion protein dimer of the invention of approximately 50 mg / ml is administered subcutaneously to a subject (for example, adult human being) in need of immunosuppression (for example, a subject suffering from rheumatoid arthritis). Such an initial dose is 50 mg of fusion protein dimer. For a subject having a body weight of 100 kg, this initial dose corresponds to 0.5 mg of fusion protein dimer per kg of the subject's body weight. A second of the same amount is administered subcutaneously one or two weeks after the first dose. More doses are administered subcutaneously every week, biweekly, or once a month, or more or less frequently as needed. It is believed that such compositions and administration formats are useful, for example, to treat a human being suffering from rheumatoid arthritis or other immune disorder in which immunosuppression is desired or to inhibit rejection of a tissue, cell, graft or organ transplant. of a human donor for a human recipient.
Procedures to treat rheumatoid arthritis
Rheumatoid arthritis is one of the most common systemic inflammatory autoimmune diseases and is estimated to affect 1-2% of the adult population. See, for example, Dipiro, JT, Rheumatoid arthritis, in PHARMACOTHERAPY: A PATHOPHYSIOLOGIC APPROACH, 1671-1682 (Talbert, RT et al. Eds., McGraw-Hill, New York, 6th ed. 2005). The disease is characterized by synovial membrane hyperplasia and infiltration of inflammatory cells, which include activated T lymphocytes. Activated T lymphocytes play a crucial role in the progression of rheumatoid arthritis by stimulating a variety of cell types to produce pro-inflammatory cytokines such as IL-1, IL-6 and TNF-alpha, autoantibodies and matrix metalloproteinases (Hoffman, RW, Front Biosci. 6: 1369-1378 (2001); Choy, EK et al., N. Engl. J. Med 344: 907-916 (2001)). The strong contribution of T lymphocytes to the progression of rheumatoid arthritis makes the activation of T lymphocytes a logical target for therapeutic intervention. It is believed that such inflammatory molecules produce the inflammatory response, tissue injury (eg, joint injury) and pain associated with rheumatoid arthritis.
Co-stimulation of T lymphocytes mediated by interactions between the CD28 receptor and the CD80 and / or CD86 ligand (s) is essential for the activation of most T lymphocytes (Riley, JL et al., Blood 105 : 13-21 (2005)). It has been shown that therapeutic or prophylactic agents that antagonize the co-stimulation path of CD80 / CD86 -CD28, such as the Orencia® fusion protein (abatacept), which is a soluble dimeric hCTLA-4-Ig fusion protein, they are clinically effective in the treatment of rheumatoid arthritis (Kremer, JM et al., Ann. Intern. Med. 144: 865-876 (2006); Genovese, MC et al., N. Engl. J. Med. 353: 1114 -1123 (2005)). Abatacept is believed to exert an immunosuppressive function by binding to CD80 and / or CD86 ligands on antigen presenting cells when administered to a subject (e.g., adult human) in vivo in a therapeutically or prophylactically effective amount, thus preventing the interaction of either or both of these ligands with the CD28 receptor on T lymphocytes.
Abatacept has been currently authorized to treat adult human patients with moderate to severely active RA who had had an inadequate response to one or more DMARDs, such as metrotrexate or TNF antagonists. Abatacept is administered to an adult patient with RA at a dose of 10 mg / kg of the subject's body weight by intravenous infusion. After the first dose, the second and third doses of 10 mg / kg of the fusion protein are administered to the subject at two and four weeks, respectively, after the first dose. Subsequent doses are administered every four weeks (i.e. once a month). Intravenous infusion of abatacept is believed necessary to administer the high level of dose required to obtain desirable efficacy in rheumatoid arthritis therapy.
Other current therapies for rheumatoid arthritis include the administration of non-specific immunosuppressive agents such as metrotrexate and steroidal and non-steroidal anti-inflammatory drugs. Additionally, biological agents are chosen which target specific pro-inflammatory cytokines such as TNF por (for example, Remicade® infliximab, Enbrel® entaercept, Humira® adalimumab) and IL-1 (for example, Kineret® anakinra). However, many of these therapies have significant side effects - some of them are toxic - particularly when administered over a long period of time.
Despite the availability of various therapies, there is a significant unmet need for the treatment of RA. For example, 60% of human patients with RA who have failed in treatment with previous DMARD and 80% of human patients with RA who have failed in previous anti-TNF therapy did not reach an ACR50 score after treatment with Orencia for 6 months (Kremer JM et al., Ann. Intern. Med. 144: 865-876 (2006); Genovese, MC et al., N. Engl. J. Med. 353: 1114-11 (2005)). Dose response studies using abatacept and belatacept fusion protein (LEA29Y-Ig) in the treatment of RA in adults indicated that the efficacy was dose dependent and was not saturated at the highest dose levels tested (Kremer, JM et al., N. Engl. J. Med. 349: 1907-1915 (2003); Moreland, LW et al., Arthrit. Rheum. 46: 1470-1479 (2002)).
It is expected that a soluble dimeric mutant CTLA-4-Ig of the invention having a greater avidity for hCD80 and / or hCD86 binding than abatacept can exert more potent immunosuppressive effects than abatacept when administered to a subject with RA. Such a mutant CTLA-4-Ig binds to a similar number of CD80 and / or CD86 ligands at a lower concentration than abatacept.
A mutant CTLA-4-Ig with a greater avidity for binding by CD80 or CD86 and a slower dissociation constant of CD80 or CD86, respectively, has a longer residence time on such ligand. This longer residence time is expected to be associated more effectively in vivo. It is believed that such a mutant CTLA-4-Ig may be effective in therapeutically or prophylactically treating a subject with RA at a dose that is less than that of abatacept. That is to say, it is believed that such a mutant CTLA-4-Ig can reach a degree of efficacy equivalent to that of abatacept when administered to the subject with RA at a dose that is lower than abatacept doses of 10 mg / kg body weight. of the subject. The invention provides soluble dimeric mutant CTLA-4-Ig fusion proteins of binding avidities varied by hCD80 and / or hCD86. Soluble dimeric mutant CTLA-4-Ig fusion proteins that have substantially greater binding avidity for hCD86 than abatacept can be equivalent in efficacy to that of abatacept when administered to the subject with RA at a dose that is substantially lower than that of abatacept . The administration of a lower dose of a mutant CTLA-4-Ig may allow a more convenient administration procedure (eg subcutaneous injection) to be used than is currently used for the administration of abatacept (intravenous injection).
It is also believed that a soluble mutant CTLA-4-Ig fusion protein of the invention with greater immunosuppressive potency than the abatacept or belatacept fusion protein would allow a higher level of efficacy to be obtained in the treatment of patients with RA. It is expected that a more immunosuppressive mutant CTLA-4-Ig can alleviate symptoms associated with RA and progressively inhibit the harmful physical effects of RA more effectively than abatacept. Such a mutant CTLA-4-Ig can be formulated in a pharmaceutically acceptable diluent, excipient or carrier (eg, PBS) at a concentration ranging from 0.1-200 mg / ml. The treatment of a subject with RA can be carried out by administering to the subject a therapeutically or prophylactically effective amount (dose) of the mutant CTLA-4-Ig by subcutaneous injection or intravenous infusion at an appropriately determined dosage frequency (e.g., initial dose followed by a dose 2 to 4 times per month, one dose per month or one dose every two months). The dose would depend on the severity of the subject's disease or symptoms. For example, an amount or dose of a mutant CTLA-4-Ig of no more than about 10 mg / kg (including, for example, about 1 mg / kg, 0.5 mg / kg, 0.25 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg or 9 mg / kg) body weight of the subject. A more immunosuppressive mutant CTLA-4-Ig may allow a less frequent dosing schedule (for example, once every two months) than the dosing schedule normally used with abatacept. Alternatively, an amount or dose of a mutant CTLA-4-Ig greater than about 10 mg / kg of the subject's weight (for example, from about 10 mg / kg to about 100 mg / kg, from about 10 mg / kg to about 25 mg / kg, about 10 mg / kg at about 50 mg / kg, about 10 mg / kg at about 75 mg / kg, etc., which includes, for example, about 15 mg / kg, 20 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg, 60 g / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg) can be administered to a subject with RA if the condition of the subject's disease and / or symptoms guarantees such quantity or dose.
The amount or effective dose of a mutant CTLA-4-Ig dimer of the invention for treating RA in a human being suffering from it can be determined based on various factors such as the potency of the mutant CTLA-4-Ig dimer, the mode of administration of the dimer and / or the severity of the subject's symptoms or signs of rheumatoid arthritis. For example, an effective amount or dose of a mutant CTLA-4-Ig dimer of the invention can be determined by comparing the potency of such dimer with that of the Orencia® dimer and determining the amount or dose of the mutant CTLA-4-Ig dimer which would give the desired immunosuppressive effect compared to Orencia® (for example, an improved or approximately equivalent effect) based on the amount or dose of Orencia® that would normally be administered to a human subject that exhibits similar symptoms or signs of RA.
A method for treating rheumatoid arthritis in a subject in need of such treatment is disclosed herein, a method comprising administering to the subject an effective amount of a soluble dimeric mutant CTLA-4-Ig fusion protein of the invention by, for example , intravenous or subcutaneous injection. The effective amount or dose may comprise from about 0.001 milligrams (mg) to about 10 milligrams per kilogram (kg) of the subject's body weight that includes, but is not limited to, for example, from about 0.01 mg / kg to about 10 mg / kg subject weight, approximately 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.25 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg or 10 mg / kg body weight of the adult human patient is administered to the subject. In some cases, the effective amount or dose is about 2 to 10 mg / kg, about 3 to 10 mg / kg, about 3 to 5 mg / kg, about 5 to 10 mg / kg, 0.1 to 5 mg / kg weight, approximately 0.05 to 1.0 mg / kg, approximately 0.05 to 3 mg / kg weight, approximately 0.05 to 2.0 mg / kg, approximately 0.05 to 1.0 mg / kg, approximately 0.05 to 2.0 mg / kg, approximately 0.1 to 2.0 mg / kg, approximately 0.1 to 3.0 mg / kg, approximately 0.1 to 0.5 mg / kg, approximately 0 , 1 to 0.8 mg / kg, approximately 0.1 to 0.6 mg / kg, approximately 0.2 to 1 mg / kg, approximately 0.2 to 0.6 mg / kg, approximately 0.2 to 0.5 mg / kg approximately 0.3 to 1 mg / kg, approximately 0.3 to 0.6 mg / kg, approximately 0.3 to 0.5 mg / kg of a subject's weight. In some cases, the effective amount or dose is less than about 500 mg for a subject weighing less than 60 kg (for example, less than about 100 mg, 75 mg, 50 mg, 25 mg or 12.5 mg), less approximately 750 mg for a subject weighing between 60-100 kg (for example, less than approximately 150 mg, 100 mg, 75 mg, 37.5 mg or 20 mg) or less than approximately 1000 mg for a subject weighing more than 100 kg (for example, less than about 500 mg, 100 mg, 50 mg, 25 mg or 10 mg). After the first dose, subsequent equivalent doses are administered at intervals of 1, 2, 4, 8, 10, 12, 14 or 16 weeks. The subsequent dosing frequency can be determined as needed.
Such a mutant CTLA-4-Ig fusion can be formulated with a pharmaceutically acceptable excipient, vehicle or diluent to produce a pharmaceutical composition suitable for administration to a subject (eg, mammal, which includes a human being). The concentration of the fusion protein in the composition may range from about 0.01 mg / ml to about 300 mg / ml or from about 0.01 mg / ml to about 200 mg / ml, which includes, but is not limited to , for example, from about 0.1 mg / ml to about 300 mg / ml, from about 0.1 mg / ml to about 200 mg / ml, about 0.1 mg / ml to about 100 mg / ml, about 0 , 5 mg / ml to approximately 100 mg / ml, approximately 0.5 mg / ml to approximately 50 mg / ml, approximately 1 to approximately 100 mg / ml, approximately 1 to approximately 75 mg / ml, approximately 5 to approximately 75 mg / ml, approximately 10 to approximately 75 mg / ml, approximately 10 to approximately 60 mg / ml, approximately 25 to approximately 60 mg / ml, approximately 30 to approximately 60 mg / ml, approximately 25 to approximately 50 mg / ml, approximately 40 to approximately 50 mg / ml, approximately 25 mg / ml , or about 50 mg / ml. Other compositions are also contemplated, including those discussed above and below.
Such treatment is expected to reduce one or more signs and / or symptoms associated with rheumatoid arthritis such as, for example, inflammation, joint palpation pain, joint swelling, pain and stiffness, in the subject. Such treatment can reduce the further progression of the disease in the patient. For example, such treatment can reduce the progression of structural injury in the patient. Such treatment can improve the physical functioning of the subject.
Procedures to inhibit tissue, cell, graft or organ transplant rejection
This document discloses a procedure to inhibit the rejection of, or suppress an immune response associated with, a transplant of tissue, cell, skin graft or organ of a donor by a recipient subject, a procedure comprising administering to the recipient subject a therapeutically effective amount of one or more of the following: (1) a polypeptide of the invention (eg, mutant CTLA-4 ECD polypeptide or dimeric or monomeric mutant CTLA-4-Ig fusion protein); (2) a multimer comprising one or more polypeptides of the invention (for example, a dimer comprising any two of such polypeptides or a tetramer comprising four any such polypeptide); (3) a conjugate comprising at least one polypeptide of the invention; (4) a nucleic acid of the invention (for example, a nucleic acid encoding a polypeptide of the invention); (5) a vector comprising a nucleic acid of the invention or encoding a polypeptide of the invention; (6) a cell or population of cells comprising a polypeptide, nucleic acid, conjugate and / or vector of the invention; and / or (7) a composition of the invention, thereby inhibiting the rejection of tissue, cell, skin or organ transplantation by the recipient. The donor and recipient may be the same or different species. The donor or recipient may be a mammal, such as a human being, non-human primate (eg, monkey, gorilla), sheep, cat, dog, pig, cow, horse, etc. In some of such procedures, the polypeptide, conjugate, vector and / or cell of the invention is administered to the recipient subject before, simultaneously with or after transplantation of tissue, cell, skin graft or organ. The effective amount usually comprises from about 0.001 mg / kg of the subject's weight to about 200 mg / kg of the subject's body weight. In some such procedures, for example, the effective amount comprises from about 0.001 milligrams per kilogram (mg / kg) of the subject's weight to at least about 0.005, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250 or 300 milligrams per kilogram (mg / kg) of the subject's body weight. In some of such procedures, the effective amount comprises from about 0.001 milligrams per kilogram (mg / kg) of the subject's weight to at least about 0.005, 0.01, 0.05, 0.1, 0.2, 0.5 , 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 25, 50 or 75 milligrams per kilogram (mg / kg) of the subject's body weight. The polypeptide, conjugate, nucleic acid, vector and / or cell of the invention can be administered to the recipient subject during, before or immediately after transplantation. Alternatively or additionally, such a molecule of the invention can be administered one or more hours after the transplant, the day after the transplant and / or daily after, or at least once a week, at least once every two weeks or at least once per month after transplant, as needed, for up to 12, 24 or 36 or more months, or more as needed. Organ transplantation can involve any organ such as, for example, a kidney, liver, heart or lung.
The effective amount or dose of a mutant CTLA-4 molecule of the invention (eg, mutant CTLA-4-Ig fusion protein dimer) to be administered to a recipient of the organ, tissue or cell transplant recipient that transplant rejection is inhibited (or suppresses an immune response associated with such a transplant) is usually determined based on the potency of such a molecule, mode of administration, the type of transplant (eg, cell, tissue, organ), the subject's history and / or the severity of the symptoms of the transplant recipient or signs of a suggestive immune response (s) of transplant rejection. For example, an effective amount or dose of a mutant CTLA-4-Ig dimer of the disclosure (for example, dimer D3-29-IGg2, D3-54-IgG2, D3-56-IgG2, D3-69-IgG2, D3-75-IgG2, etc.) can be determined by comparing the potency of such a dimer with that of the belatacept dimer. Effective doses of belatacept useful to prevent or suppress an immune response associated with kidney / renal transplantation are known. For example, belatacept is administered by intravenous infusion to a human being after a kidney transplant in the human being of a kidney donor in an amount or dose of approximately 5 mg or 10 mg per kilogram of the human body weight per month. A mutant CTLA-4-Ig dimer of the invention that is approximately "X" times more potent than belatacept can be administered (for example, intravenously, subcutaneously, or otherwise described herein) to a human being who has had a kidney transplant in an amount or dose that is approximately "X" times less than the dose of belatacept to achieve a therapeutic effect (for example, suppress an immune response) approximately equivalent to that of belatacept. If a greater therapeutic effect is desired, a proportionally high amount or dose of the CTLA-4-Ig fusion protein dimer of the invention can be determined and administered.
This document discloses a procedure for treating tissue, cell or organ transplant rejection (for example, solid organ transplant rejection (for example, kidney, liver, lung, heart, etc.)) in a subject receiving such a donor tissue, cell or organ, a method comprising administering to the recipient a therapeutically effective amount of at least one polypeptide, conjugate, nucleic acid, vector and / or cell of the invention, thus inhibiting the rejection of the donor tissue, cell or organ transplant by the recipient. The polypeptide, conjugate, nucleic acid, vector and / or cell of the invention can be administered to the subject before, simultaneously with or after the transplantation of a cell, tissue or organ.
In one aspect, the invention provides a method for inhibiting islet cell transplant rejection of a donor in a recipient in need thereof, a method comprising administering to the subject an effective amount or dose of a mutant CTLA-4 molecule. of the invention (eg, mutant CTLA-4-Ig fusion protein) before, simultaneously with or after transplantation of islet cell (s) from the pancreas of a donor in the subject. The subject (for example, human being) normally suffers from diabetes (for example, DMDI) and such a procedure is useful in the treatment of a subject diagnosed with or suffering from diabetes. Islet transplantation procedures are known in the art. Normally, the islets are removed from the pancreas of a dead organ donor, purified and processed, and implanted in a recipient with diabetes. After the transplant, the beta cells in the islets begin to produce and release insulin, thus reducing the need for insulin from the recipient.
In such methods of inhibiting transplant rejection, the mutant CTLA-4 molecule of the invention (eg, mutant CTLA-4-Ig) can be formulated with a pharmaceutically acceptable excipient, carrier or diluent to produce a pharmaceutical composition suitable for administration. to a subject (eg, mammal, which includes a human being). Some of such methods comprise administration of a pharmaceutical composition comprising a pharmaceutically acceptable excipient, vehicle or diluent and a mutant CTLA-4-Ig dimer of the invention having a concentration of about 0.01 mg / ml to about 300 mg / ml or about 0.01 mg / ml to about 200 mg / ml, which includes, but is not limited to, for example, from about 0.1 mg / ml to about 300 mg / ml, from about 0.1 mg / ml to about 200 mg / ml, about 0.1 mg / ml to about 100 mg / ml, about 0.5 mg / ml to about 100 mg / ml, about 0.5 mg / ml at about 50 mg / ml, about 1 to about 100 mg / ml, about 1 to about 75 mg / ml, about 5 to about 75 mg / ml, about 10 to about 75 mg / ml, about 10 to about 60 mg / ml, approximately 25 to approximately 60 mg / ml, approximately 30 to approximately 60 mg / ml, approximately 25 to approximately 50 mg / ml, approximately 40 to approximately 50 mg / ml, approximately 25 mg / ml, or approximately 50 mg / ml. Other compositions are also contemplated, including those discussed above and below.
Procedures to inhibit an immune response
In another aspect, the invention includes the use of a polypeptide (including, for example, a dimeric or monomeric fusion protein or multimeric polypeptide), conjugate, nucleic acid, vector or cell of the invention for the manufacture of a medicament for inhibiting or suppress an immune response in a mammal (eg, human or non-human primate). Immune responses that can be suppressed include, for example, activation or proliferation of T lymphocytes, synthesis or production of cytokines, induction of activation markers, synthesis or production of inflammatory molecules, inflammation, production of anti-collagen Ab, dependent Ab response of T lymphocytes.
The invention also includes the use of a polypeptide (including, for example, a dimeric or monomeric fusion protein or multimeric polypeptide), conjugate, nucleic acid, vector or cell of the invention for the manufacture of a medicament for the treatment of a disease. or immune system disorder. The disease or immune system disorder may be one that is mediated by interaction of T lymphocytes with CD80 positive cells and / or CD86 positive cells in a mammal. The immune system disease or disorder can be an immune system disease or disease such as a rheumatic disease or disorder or an autoimmune disease or autoimmune disorder. Such disease or immune system disorder may be or involve, for example, but not limited to, Addison's disease, allergy, alopecia areata, Alzheimer's disease, vasculitis associated with anti-neutrophil cytoplasmic antibodies (ANCA), ankylosing spondylitis, antiphospholipid syndrome (syndrome of Hughes), arthritis, asthma, atherosclerosis, atherosclerotic plaque, autoimmune disease (for example, lupus, RA, MS, Graves' disease, etc.), autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, azoospermia, Behcet's disease, Behcet's syndrome, Berger's disease, bullous pemphigoid, cardiomyopathy, cardiovascular disease, celiac disease / celiac disease of chronic fatigue and immune dysfunction (SFCDI), chronic idiopathic polyneuritis, chronic inflammatory demyelinating polyradiculoneuropathy (PDIC), chronic recurrent polyneuropathy (Guillain-Barré syndrome), Churg-Strauss syndrome (SCS), scarring pemphigoid, cold agglutinin disease (EAF), COPD, CREST syndrome, Crohn's disease, dermatitis, herpetiformis, dermatomyositis, diabetes, lupus discoid, eczema, acquired bullous epidermolysis, essential mixed cryoglobulinemia, Evan syndrome, exophthalmia, fibromyalgia, Goodpasture syndrome, graft-related disease or disorder, Grave disease, EIFH, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, immunoproliferative disease or disorder (e.g., psoriasis), inflammatory bowel disease (IBD), insulin-dependent diabetes mellitus (DMDI), interstitial lung disease , juvenile diabetes, juvenile arthritis, juvenile idiopathic arthritis (JIA), Kawasaki disease, Lambert-Eaton myasthenic syndrome, lichen planus, lupus, lupus nephritis, Lymphocytic hypophysitis, Ménière's disease, Miller Fish syndrome / acute disseminated encephalomielorradiculopathy, mixed connective tissue disease, multiple sclerosis (MS), muscular rheumatism, myelgic encephalomyelitis (ME), myasthenia gravis, ocular inflammation, foliar pemphigus, vulgar pemphigus, anemia pernicious, polyarteritis nodosa, polychondritis, polyglandular syndromes (Whitaker syndrome), polymyalgia rheumatica, polymyositis, primary agammaglobulinemia, Primary biliary cirrhosis / autoimmune cholangiopathy, psoriasis, psoriatic arthritis, Raynaud's phenomenon, Reiter's syndrome / reactive arthritis, restenosis, rheumatic fever, rheumatic disease, rheumatoid arthritis, sarcoidosis, Schmidt syndrome, scleroderma, Sjörgen syndrome, transplant rejection solid organ (kidney, heart, liver, lung, etc.), Stiff-Man syndrome, systemic lupus erythematosus (SLE), systemic scleroderma, Takayasu arteritis, temporal arteritis / giant cell arteritis, thyroiditis, type 1 diabetes, type 2 diabetes, ulcerative colitis, uveitis, vasculitis, vitiligo, Wegener's granulomatosis, and prevent or suppress an immune response associated with rejection of a tissue transplant, cell , graft or donor organ by a recipient subject.
The use of a polypeptide, conjugate, nucleic acid, vector or cell of the invention for the manufacture of a medicament for inhibiting the interaction of CD80 positive cells and / or CD86 positive cells with CD28 positive T cells and / or cells is also disclosed. or positive for CTLA-4. In another aspect, the invention includes the use of a polypeptide, conjugate, nucleic acid, vector or cell of the invention for the manufacture of a medicament for the treatment of tissue or organ transplant rejection (eg, transplant rejection of solid organ (for example, kidney, lung, liver, heart, etc.)) in a mammal.
Evaluation of immune responses
Immune responses suppressed by a polypeptide, nucleic acid, vector, virus, pseudovirus, VLP or composition of the invention can be measured by any suitable technique. Examples of techniques useful in the evaluation of humoral immune responses include flow cytometry, immunoblotting assays, immunohistochemical assays, immunoprecipitation assays, radioimmunoassays (RIAs) and enzyme immunoassays. Enzyme immunoassays include enzyme-linked immunoflow assays (ELIFA) and adsorption enzyme immunoassay (ELISA), which includes competitive sandwich ELISA and ELISA assays. HPLC and capillary electrophoresis (EC) can also be used in immunoassays to detect complexes of antibodies and target substances. General guidance that performs such related techniques and principles are described in, for example, Harlow and Lane (1988) ANTIBODIES, A LABORATORY MANUAL, Cold Spring Harbor Publications, New York, Hampton R et al. (1990) SEROLOGICAL METHODS A LABORATORY MANUAL, APS Press, St. Paul Minn., Stevens (1995) CLINICAL IMMUNOLOGY AND SEROLOGY: A LABORATORY PERSPECTIVE, CRC press, Bjerrum (1988) HANDBOOK OF IMMUNOBLOTTING OF PROTEINS, vol. 2, Zoa (1995) DIAGNOSTIC IMMUNOPATHOLOGY: LABORATORY PRACTICE AND CLINICAL APPLICATION, Cambridge University Press, Folds (1998) CLINICAL DIAGNOSTIC IMMUNOLOGY: PROTOCOLS IN QUALITY ASSURANCE AND STANDARDIZATION, Blackwell Science Inc., Bryant (1992) LABORATORY SERIES WB Saunders Co. and Maddox DE et al. (1983) J. Exp. Med. 158: 1211. Guidance regarding ELISA techniques and related principles are described in, for example, Reen (1994) Methods Mol. Biol 32: 461-6, Goldberg et al. (1993) Curr. Opin. Immunol 5 (2): 278-81, Voller et al. (1982) Lab. Res. Methods Biol. Med. 5: 59-81, Yolken et al. (1983) Ann. NY Acad. Sci. 420: 381-90, Vaughn et al. (1999) Am. J. Trop. Med. Hyg. 60 (4): 693-8, and Kuno et al. (1991) J. Virol. Methods 33 (1-2): 101-13. Guidance regarding flow cytometry techniques is provided in, for example, Diamond (2000) IN LIVING COLOR: PROTOCOLS IN FLOW CYTOMETRY AND CELL SORTING, Springer Verlag, Jaroszeki (1998) FLOW CYTOMETRY PROTOCOLS, 1st ed., Shapiro (1995 ) PRACTICAL FLOW CYTOMETRY, 3rd edition, Rieseberg et al. (2001) Appl. Microbiol Biotechnol 56 (3-4): 350-60, Scheffold and Kern (2000) J. Clin. Immunol 20 (6): 400-7, and McSharry (1994) Clin. Microbiol Rev. (4): 576-604.
Cytotoxic responses and other immune responses of T lymphocytes can also be measured by any suitable technique. Examples of such techniques include ELISpot assay (particularly IFN-gamma ELISpot), intracellular cytokine staining (ICC) (particularly in combination with FACS analysis), CD8 + / FACS T lymphocyte tetramer staining, conventional T lymphocyte proliferation assays and modified, chromium release CTL assay, limiting dilution analysis (LDA) and CTL destruction assays. Guidance and principles related to T-cell proliferation assays are described in, for example, Plebanski and Burtles (1994) J. Immunol. Meth. 170: 15, Sprent et al. (2000) Philos. Trans. R. Soc. Lond. B Biol. Sci. 355 (1395): 317-22 and Messele et al. (2000) Clin. Diag. Lab. Immunol. 7 (4): 687-92. LDA is described in, for example, Sharrock et al. (1990) Immunol. Today 11: 281-286. ELISpot assays and related principles are described in, for example, Czerinsky et al. (1988) J. Immunol Meth. 110: 29-36, Olsson et al. (1990) J. Clin. Invest. 86: 981-985, Schmittel et al. (2001) J. Immunol. Meth. 247 (1-2): 17-24, Ogg and McMichael (1999) Immunol. Lett. 66 (1-3): 77-80, Schmittel et al. (2001) J. Immunol. Meth. 247 (1-2): 17-24, Kurane et al. (1989) J. Exp. Med. 170 (3): 763-75, Chain et al. (1987) J. Immunol. Meth. 99 (2): 221-8, Czerkinsky et al. (1988) J. Immunol. Meth. 110: 29-36, and U.S. Pat. No. 5,750,356 and
6,218,132. Tetramer assays are treated in, for example, Pielner et al. (2000) J. Immunol. 165 (2): 613-7. Other analytical techniques of T lymphocytes are described in Hartel et al. (1999) Scand. J. Immunol. 49 (6): 649-54 and Parish et al. (1983) J. Immunol. Meth. 58 (1-2): 225-37.
T lymphocyte activation can also be analyzed by measuring CTL activity or expression of activation antigens such as IL-2 receptor, CD69 or HLA-DR molecules. The proliferation of purified T lymphocytes can be measured in a mixed lymphocyte reaction (MLR) assay; Such assays are well known in the art.
ELISpot assays measure the number of T lymphocytes that secrete a specific cytokine such as IFN-! or TNF∀, which serves as a marker of T lymphocyte effectors. Cytokine-specific ELISA kits are commercially available (for example, an IFIS-specific ELISpot is available from R&D Systems, Minneapolis, MN).
Additional methods for evaluating and measuring the ability of molecules of the invention (for example, polypeptides of the invention, including, for example, soluble mutant CTLA-4-Ig fusion proteins of the invention) to suppress or inhibit lymphocyte activation T and / or proliferation of T lymphocytes are described in Examples 5-8 in the examples section below.
Administration Procedures
In any of the methods described herein, an injectable pharmaceutical composition comprising a suitable pharmaceutically acceptable excipient or vehicle (e.g., PBS) and an effective amount of a molecule of the invention, such as a polypeptide (e.g., ECD of mutant CTLA-4 or monomeric, dimeric or multimeric mutant CTLA-4-Ig) or conjugate of the invention, can be administered parenterally, intramuscularly, intraperitoneally, intravenously, subdermally, transdermally, subcutaneously or intradermally to a host. Alternatively, biolistic protein administration techniques (vaccine gun administration) can be used (examples of which are discussed elsewhere herein). Any other suitable technique can also be used. The administration of polypeptides can be facilitated by liposomes. Any such administration technique can be used to administer a polypeptide.
or conjugate of the invention in conjunction with any therapeutic or prophylactic procedure described herein.
While the following discussion relates mainly to nucleic acids, it will be understood that it also applies to nucleic acid vectors of the invention. A nucleic acid of the invention or composition thereof can be administered to a host by any suitable route of administration. In some aspects disclosed herein, the administration of the nucleic acid is parenteral (eg, subcutaneous (sc), intramuscular (im) or intradermal (id)), topical or transdermal. Nucleic acid can be introduced directly into a tissue, such as muscle, by injection using a needle or other similar device. See, for example, Nabel et al. (1990), above; Wolff et al. (1990) Science 247: 1465-1468), Robbins (1996) Gene Therapy Protocols, Humana Press, NJ, and Joyner (1993) Gene Targeting: A Practical Approach, IRL Press, Oxford, England, and US Pat. . No. 5,580,859 and 5,589,466. Other procedures such as "biolistics" or particle-mediated transformation (see, for example, US Patent Nos. 4,945,050 and 5,036,006, Sanford et al., J. Particulate Sci. Tech. 5: 27- 37 (1987), Yang et al., Proc. Natl. Acad. Sci. USA 87: 9568-72 (1990), and Williams et al., Proc. Natl. Acad. Sci. USA 88: 2726-30 (1991)). These procedures are useful not only for in vivo introduction of DNA into a subject, such as a mammal, but also for ex vivo modification of cells for reintroduction into a mammal (which is further discussed elsewhere herein). .
For conventional gene gun administration, the vector or nucleic acid of interest is precipitated on the surface of microscopic metal beads. Microprojectiles are accelerated with a shock wave or expanding helium gas, and penetrate tissues at a depth of several layers of cells. For example, the Accel ™ gene management device manufactured by Agacetus, Inc. Middleton WI is suitable for use in this embodiment. The nucleic acid or vector can be administered by such techniques, for example, intramuscularly, intradermally, subdermally, subcutaneously and / or intraperitoneally. Additional devices and techniques related to biolistic administration are International Patent Application Publications No. WO 99/2796, WO 99/08689, WO 99/04009 and WO 98/10750, and US Pat. No. 5,525,510, 5,630,796, 5,865,796 and 6,010,478.
The nucleic acid can be administered in association with an agent that facilitates transfection, the examples of which were discussed above. The nucleic acid can be administered topically and / or by administration of liquid particles (as opposed to the biolistic administration of solid particles). Examples of such nucleic acid delivery techniques, compositions and additional constructions that may be suitable as delivery vehicles for the nucleic acids of the invention are provided in, for example, US Pat. No. 5,591,601, 5,593,972, 5,679,647, 5,697,901, 5,698,436, 5,739,118, 5,770,580, 5,792,751, 5,804,566, 5,811,406, 5,817,637, 5,830,876, 5,830 .877, 5,846,949, 5,849,719, 5,880,103, 5,922,687, 5,981,505, 6,087,341, 6,107,095, 6,110,898, and international patent application publications No. WO 98/06863, WO 98 / 55495 and WO 99/57275.
Alternatively, the nucleic acid can be administered to the host by way of gene administration based on liposomes. Exemplary techniques and principles related to the administration of liposome-based genes are provided in, for example, Debs and Zhu (1993) WO 93/24640; Mannino and Gould-Fogerite (1988) BioTechniques 6 (7): 682-691; Rose, U.S. Pat. No. 5,279,833; Brigham (1991) document WO 91/06309; Brigham et al. (1989) Am. J. Med. Sci. 298: 278-281; Nabel et al. (1990) Science 249: 1285-1288; Hazinski et al. (1991) Am. J. Resp. Cell Molec. Biol. 4: 206-209; and Wang and Huang (1987) Proc. Natl. Acad. Sci. USA 84: 78517855) and Felgner et al. (1987) Proc. Natl Acad. Sci. USA 84: 7413-7414). Pharmaceutically acceptable compositions of suitable liposomes that can be used to administer the nucleic acid are further described elsewhere herein.
Any amount of nucleic acid of the invention can be used in the methods of the invention. For example, sufficient nucleic acid can be formulated in a pharmaceutically acceptable carrier or excipient and administered to a subject such that the encoded or conjugated polypeptide is produced in the subject in an amount believed to be effective for, for example, suppressing the response. immune in the subject, inhibit the interaction between endogenous B7 positive cells and CD28 positive cells in the subject, or inhibit rejection of a tissue, cell transplant, organ or graft. In one format, in which the nucleic acid is administered by injection, approximately 50 micrograms (μg) to 100 mg of nucleic acid are administered. In an exemplary application, to suppress an immune response, a pharmaceutical composition comprising PBS and an amount of a DNA vector encoding an effective amount of a mutant CTLA-4 polypeptide is administered by injection or electroporation or other method of proper administration (e.g., gene gun, skin printing and lipofection) to a subject in need of treatment (e.g., a subject suffering from a disease or disorder of the immune system in which immunosuppressive treatment is desired). An exemplary vector is shown in Figure 1.
The amount of plasmid DNA for use in the methods of the disclosure in which administration is by means of a gene gun, for example, is often about 100 to about 1000 times less than the amount used to direct the injection (for example , by conventional needle injection). Despite such sensitivity, at least about 1 μg of the nucleic acid can be used in such biolistic administration techniques.
RNA or DNA viral vector systems may be useful for the administration of nucleic acids encoding polypeptides of the invention. The viral vectors can be administered directly to a subject in vivo or can be used to treat cells in vitro and the modified cells are administered to the subject in an ex vivo format. Useful viral vectors include those previously treated, such as adeno-associated, adenoviral, retroviral, lentiviral and herpes simplex virus vectors. With such viral vectors, a nucleic acid of the invention can be easily transferred into target cells and tissues of the subject. Additionally, with the methods of transferring genes from retroviruses, lentiviruses and adeno-associated viruses, it may be possible to integrate a nucleic acid of the invention into the host genome, thus producing continuous expression of the inserted nucleic acid.
It is believed that the administration of a viral vector of the invention comprising at least one nucleic acid of the invention to a subject can suppress an immune response in the subject to which the vector is administered. Optionally, some prophylactic and / or therapeutic methods of the disclosure are practiced with a dosage of a suitable viral vector sufficient to inhibit a detectable immune response. Any suitable viral vector comprising a nucleic acid of the invention, at any suitable concentration, can be used to suppress the immune response. For example, a population of retroviral vectors may be administered to the host subject (examples of which are described in, for example, Buchscher et al. (1992) J. Virol. 66 (5) 2731-2739, Johann et al. (1992 ) J. Virol. 66 (5): 1635-1640 (1992), Sommerfelt et al. (1990) Virol. 176: 58-59, Wilson et al. (1989) J. Virol. 63: 2374-2378, Miller et al., J. Virol. 65: 2220-2224 (1991), Wong-Staal et al., PCT / US94 / 05700, Rosenburg and Fauci (1993) in FUNDAMENTAL IMMUNOLOGY, THIRD EDITION Paul (ed.) Raven Press, Ltd., New York and references inside), an AAV vector (as described in, for example, West et al. (1987) Virology 160: 38-47, Kotin (1994) Human Gene Therapy 5: 793-801, Muzyczka (1994) J Clin. Invest. 94: 1351, Tratschin et al. (1985) Mol. Cell. Biol. 5 (11): 3251-3260, US Pat. No. 4,797,368 and 5,173,414, and International Patent Application Publication No. WO 93/24641), or an adenoviral vector (as described in, for example, Berns et al. (1995) Ann. NY Acad. Sci 772: 95-104; Ali et al. (1994) Gene Ther. 1: 367-384; and Haddada et al. (1995) Curr. Top. Microbiol. Immunol. 199 (Pt 3): 297-306), so that immunosuppressive levels of nucleic acid expression included in the vector result, thus producing the desired immunosuppressive response. Other suitable types of viral vectors are described elsewhere herein (including alternative examples of suitable retroviral, AAV and adenoviral vectors).
Suitable infection conditions for these and other types of viral vector particles are described in, for example, Bachrach et al., J. Virol., 74 (18), 8480-6 (2000), Mackay et al., J. Virol., 19 (2), 620-36 (1976), and FIELDS VIROLOGY, above. Additional techniques useful in the production and application of viral vectors are provided in, for example, "Practical Molecular Virology: Viral Vectors for Gene Expression" in METHODS IN MOLECULAR BIOLOGY, vol. 8, Collins, M. Ed., (Humana Press 1991), VIRAL VECTORS: BASIC SCIENCE AND GENE THERAPY, 1st ed. (Cid-Arregui et al., Eds.) (Eaton Publishing 2000), "Viral Expression Vectors" in CURRENT TOPICS IN MICROBIOLOGY AND IMMUNOLOGY, Oldstone et al., Eds. (Springer-Verlag, NY, 1992), and "Viral Vectors" in CURRENT COMMUNICATIONS IN BIOTECHNOLOGY, Gluzman and Hughes, eds. (Cold Spring Harbor Laboratory Press, 1988).
The toxicity and therapeutic efficacy of vectors or viruses that include one or more molecules of the invention are determined using conventional pharmaceutical methods in cell cultures or experimental animals. The DML50 (the minimum lethal dose for 50% of the population) and / or the ED50 (the therapeutically effective dose in 50% of the population) can be determined using procedures presented herein and those otherwise known in the technique. See also S. Plotkin and W. Orenstein, VACCINES (WBSaunders Co. 1999 3d ed.) For suggested doses for known viral vaccines. Nucleic acids, polypeptides, proteins, fusion proteins, transduced cells and other formulations of the present invention can be administered in a certain amount, for example, by the DML50 of the formulation, and the side effects thereof at various concentrations, as Applies to the mass and general health of the patient. Therefore, a method of inducing an immune response is disclosed herein by administering a dose equal to or greater than the ED50 of a pharmaceutically acceptable composition comprising a population of virus or virus-like particles (eg, attenuated or virus-deficient viruses). the replication) comprising a polypeptide or nucleic acid of the invention. Administration can be carried out by single dose or divided doses (either by co-administration, serial administration or combinations thereof). Administration techniques and protocols are described in, for example, Plotkin (VACCINES), above, and other references cited herein. In a related sense, techniques for evaluating the dosage of nucleic acid, polypeptide, vector and cell compositions effective to induce immunity are described in, for example, European Patent Application No. 1 156 333 and references cited therein.
The viral vector can be chosen as a target for particular tissues, cells and / or organs of a subject, for example, mammal. Examples of such vectors are described above. For example, the viral vector or nucleic acid vector can be used to selectively release the nucleic acid sequence of the invention to monocytes, dendritic cells, cells associated with dendritic cells (eg, keratinocytes associated with Langerhans cells), T lymphocytes and / or B lymphocytes. The viral vector may be a viral vector deficient in replication. The viral vector particle can also be modified to reduce the host's immune response to the viral vector, thereby achieving persistent gene expression. Such "stealth" vectors are described in, for example, Martin, Exp. Mol. Pathol 66 (1): 3-7 (1999), Croyle et al., J. Virol. 75 (10): 4792-801 (2001), Rollins et al., Hum. Gene Ther. 7 (5): 619-26 (1996), Ikeda et al., J. Virol. 74 (10): 4765-75 (2000), Halbert et al., J. Virol. 74 (3): 1524-32 (2000) and International Patent Application Publication No. WO 98/40509. Alternatively or additionally, viral vector particles can be administered by a selected strategy to reduce the host's immune response to vector particles. Strategies to reduce the immune response to the viral vector particle after administration to a host are provided in, for example, Maione et al., Proc. Natl. Acad. Sci. USA 98 (11): 5986-91 (2001), Morral et al., Proc. Natl. Acad. Sci. USA 96 (22): 2816-21 (1999), Pastore et al., Hum. Gene Ther. 10 (11): 1773-81 (1999), Morsy et al., Proc. Natl. Acad. Sci. USA 95 (14): 7866-71 (1998), Joos et al., Hum. Gene Ther. 7 (13): 1555-66 (1996), Kass-Eisler et al., Gene Ther. 3 (2): 154-62 (1996), US Pat. No. 6,093,699, 6,211,160, 6,225,113, U.S. Patent Application Publication No. 2001-0066947A1.
Skin and muscle are generally preferred targets for administration of the polypeptides, conjugates, nucleic acids and vectors of the invention, by any suitable technique. Therefore, the administration of a polypeptide, conjugate, nucleic acid or vector of the invention in or through the skin of a subject (eg, mammal) is a feature of the invention. Such molecules of the invention can be administered in a pharmaceutically acceptable injectable solution in or through the skin, for example, intramuscularly or intraperitoneally. Administration can also be carried out by transdermal devices or, more normally, biolistic administration of the polypeptide, conjugate, nucleic acid and / or vector to, in or through the subject's skin or in the subject's exposed muscle. Transdermal devices, for example, can be applied to the skin of a host for a suitable period so that sufficient transfer of a polynucleotide and / or vector to the subject occurs, thereby suppressing an immune response in the subject or inhibiting the rejection of a graft, cell or tissue transplant. Muscle administration is more normally facilitated by injection of a liquid solution comprising a polypeptide, polynucleotide or vector of the invention. Particular cells that can be chosen as targets include dendritic cells, other APCs, B lymphocytes, monocytes, T lymphocytes (including helper T lymphocytes) and cells associated with such immune system cells (e.g., keratinocytes or other skin cells associated with cells from Langerhans). The choice of vectors and nucleic acids of the invention as a target is described elsewhere herein. Such administration chosen as a target can be carried out with nucleic acids or vectors comprising nucleic acids operatively linked to specific cell and / or tissue promoters, examples of which are known in the art.
The polynucleotide of the invention can be administered by any suitable delivery system, so that the expression of a recombinant polypeptide occurs in the host producing a suppression of an immune response, inhibition of the interaction between B7 positive and CD28 positive cells, or inhibition of tissue, cell, organ or graft transplant rejection. For example, an effective amount of a population of bacterial cells comprising a nucleic acid of the invention can be administered to a subject, producing the expression of a recombinant mutant CTLA-4 polypeptide of the invention, and suppressing an immune response in the subject. . Bacterial cells developed for the administration of mammalian genes are known in the art.
The administration of a polynucleotide or vector of the invention to a subject is facilitated by the application of electroporation to an effective number of cells or an effective tissue target, so that the nucleic acid and / or vector is collected by the cells, and it is expressed inside, producing the production of a recombinant polypeptide of the invention inside and the subsequent suppression of an immune response in the subject.
Production and purification procedures
The invention further provides methods of preparing and purifying polypeptides, nucleic acids, vectors and cells of the invention. In one aspect, the invention provides a method of preparing a recombinant polypeptide of the invention by introducing a nucleic acid of the invention into a population of cells in a culture medium, culturing the cells in the medium (for a time and under conditions suitable for the desired level of gene expression) to produce the polypeptide and isolate the polypeptide from the cells, culture medium or both. The nucleic acid is normally operably linked to an effective regulatory sequence to express the polypeptide encoded by the nucleic acid.
The polypeptide can be isolated from cell lysates, cell supernatants and / or cell culture medium by a variety of suitable techniques known in the art including, for example, various chromatography of cell lysates and / or cell supernatants. For example, the polypeptide can be isolated from cell lysates and / or cell culture medium by first concentrating the culture medium using centrifugal filters (Amicon), alternatively, precipitating the polypeptides with ammonium sulfate or polyethylene glycol and then resuspending the polypeptides in PBS or other suitable buffers. The polypeptide can then be purified using both Sephacryl S-400 column size exclusion chromatography (Amersham Biosciences) and described in, for example, Hjorth, R. and J. Moreno-Lopez, J. Virol. Methods 5: 151-158 (1982), as another affinity chromatography, or by centrifugation by gradients of 20-60% sucrose as described in, for example, Konish et al., Virology 188: 714-720 (1992) . Fractions containing the desired polypeptides can be identified by ELISA or SDS-PAGE followed by staining with protein silver and immunoblotting. The desired fractions are combined and additionally concentrated. Sucrose in gradient centrifuge fractions can be removed using PD-10 column gel filtration (Amersham Biosciences). Additional purification techniques include those described in the examples below and hydrophobic interaction chromatography (Diogo, M. M, et al., J. Gene Med. 3: 577-584 (2001)), and any other suitable technique known in The matter.
Any suitable purification technique that is known in the art can also be used. Polypeptide purification procedures known in the art include those set forth in, for example, Sandana (1997) BIOSEPARATION OF PROTEINS, Academic Press, Inc., Bollag et al. (1996) PROTEIN METHODS, 2nd edition, Wiley-Liss, NY, Walker (1996) THE PROTEIN PROTOCOLS HANDBOOK Humana Press, NJ, Harris and Angal (1990) PROTEIN PURIFICATION APPLICATIONS: A PRACTICAL APPROACH IRL Press at Oxford, Oxford, England, Scopes (1993) PROTEIN PURIFICATION: PRINCIPLES AND PRACTICE 3rd edition Springer Verlag, NY, Janson and Ryden (1998) PROTEIN PURIFICATION: PRINCIPLES, HIGH RESOLUTION METHODS AND APPLICATIONS, second edition Wiley-VCH, NY; and Walker (1998) PROTEIN PROTOCOLS ON CD-ROM Humana Press, NJ. Suitable cells for the production of polypeptides are known in the art and are treated elsewhere herein (for example, Vero cells, 293 cells, BHK cells, CHO (eg, CHO-K1) and COS may be suitable) . The cells can be lysed by any suitable technique that includes, for example, sonication, microfluidization, physical shearing, lysis in French press or detergent-based lysis.
A method of purifying a polypeptide of the invention comprising transforming a suitable host cell with a nucleic acid of the disclosure (for example, a recombinant nucleic acid encoding a recombinant polypeptide comprising the sequence of SEC polypeptides) is disclosed herein. ID Nº: 1) in the host cell (for example, a CHO cell or cell 293), lysate the cell by a suitable lysis technique (for example, sonication, lysis with detergent or other appropriate technique) and subject the lysate to affinity purification with a chromatography column comprising a resin that includes at least one novel antibody of the invention (usually a monoclonal antibody of the invention) or antigen binding fragment thereof, such that the lysate is enriched in the desired polypeptide (for example, a polypeptide comprising the polypeptide sequence of SEQ ID NO: 1).
A method of purifying such target polypeptides is disclosed herein, a process that differs from the procedure described above in that a nucleic acid comprising a nucleotide sequence encoding a fusion protein comprising a polypeptide of the disclosure (e.g., SEQ ID NO: 1) and a suitable mark (for example, an e-epitope / his mark), and purify the polypeptide by immunoaffinity, lentil-lectin affinity column chromatography, immobilized metal affinity chromatography (IMAC), or techniques of Enrichment by metal chelation affinity chromatography (MCAC). Additional purification procedures are disclosed elsewhere in this document.
In another aspect, the invention provides a method of producing a polypeptide of the invention, a method comprising introducing into a population of cells a recombinant expression vector comprising a nucleic acid of the invention, culturing the cells in a culture medium under conditions. appropriately sufficient for the expression of the nucleic acid from the vector and production of the polypeptide encoded by the nucleic acid, and isolate the polypeptide from the cells, culture medium, or both. The cells chosen are based on the desired processing of the polypeptide and are based on the appropriate vector (for example, E. coli cells are preferred for bacterial plasmids, while 293 cells are preferred for mammalian and / or adenovirus shuttle plasmids, particularly adenovirus deficient in E1).
In yet another aspect, the disclosure includes a method of producing a polypeptide, a method comprising: (a) introducing into a population of cells a recombinant expression vector comprising at least one nucleic acid encoding a polypeptide; (b) administer the expression vector in a mammal; and (c) isolate the polypeptide from the mammal or a by-product of the mammal.
A polypeptide of the invention can also be produced by culturing a cell or population of cells of the invention (which, for example, have been transformed with a nucleic acid of the invention encoding such polypeptide) under conditions sufficient for the expression of the polypeptide and recovering the polypeptide expressed in or by the cell using conventional techniques known in the art.
In another aspect, the invention provides a method of producing a polypeptide of the invention comprising (a) introducing into a population of cells a nucleic acid of the invention, in which the nucleic acid is operably linked to a regulatory sequence effective to produce the polypeptide encoded by the nucleic acid; (b) culturing the cells in a culture medium to produce the polypeptide; and (c) isolate the polypeptide from the cells or culture medium. Also included is a cultured cell in which a vector of the invention has been introduced (for example, an expression vector of the invention).
Also included is a method of producing a polypeptide of the invention which comprises introducing a nucleic acid encoding said polypeptide into a population of cells in a medium, cells that are permissive for the expression of the nucleic acid, keeping the cells in conditions in which The nucleic acid is expressed and then isolate the polypeptide from the medium.
In another aspect, a process for preparing a fusion protein is disclosed herein. The method comprises: (1) culturing a host cell transformed with a nucleic acid in a culture medium, wherein the nucleic acid comprises: (i) a first nucleotide sequence encoding a polypeptide having at least 95% of identity with a polypeptide sequence selected from the group consisting of SEQ ID NO: 1-73, polypeptide that binds to CD86 and / or CD80 and / or an extracellular domain of both CD86 and CD80, and
<dl><dt>(ii)</dt><dd> a second nucleotide sequence encoding an Ig Fc polypeptide comprising a hinge region, CH2 domain and CH3 domain, whereby the nucleic acid is expressed and a fusion protein is produced; and</dd></dl>
<dl><dt>(2) </dt><dd>Recover fusion protein. Any Ig Fc polypeptide can be any employee, which includes, for example, an IgG1 Fc, IgG2 Fc, IgG4 Fc, or mutant Ig Fc polypeptide. In some of such methods, the nucleic acid further comprises a third nucleotide sequence encoding a secretory peptide or signal operably linked to the fusion protein, and the fusion protein is secreted from the host cell as a dimer of bound fusion proteins. by disulfide comprising first and second identical fusion proteins, and the dimer of disulfide-linked fusion proteins is recovered from the culture medium. In some such procedures, the dimer of disulfide-linked fusion proteins is formed by a covalent disulfide bond between a cysteine residue of the first fusion protein and a cysteine residue of the second fusion protein. In some of such procedures, the fusion protein is recovered from the culture medium, host cell or periplasm of host cells.</dd></dl>
An isolated or recombinant nucleic acid molecule comprising a nucleotide sequence encoding (i) a first polypeptide comprising a polypeptide sequence having at least 95% sequence identity with at least one sequence is disclosed herein. of polypeptides selected from the group consisting of SEQ ID NO: 1-73, wherein the first polypeptide binds to CD80 and / or CD86 and / or an extracellular domain of either or both, and (ii) a second polypeptide comprising a hinge region, CH2 domain and CH3 domain of an IgG polypeptide. The second polypeptide may comprise any suitable Ig polypeptide discussed elsewhere herein, which includes, for example, which comprises the polypeptide sequence of SEQ ID NO: 184 or SEQ ID NO: 218.
In another aspect, the disclosure provides a method of preparing a soluble fusion protein dimer. The method comprises culturing a host cell transformed with an expression vector comprising a nucleotide sequence encoding a soluble fusion protein dimer of the invention. Exemplary fusion proteins include those comprising the polypeptide sequence of any of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222. The vector includes a nucleotide sequence that facilitates the expression of the fusion protein (for example, a nucleotide sequence encoding a signal peptide). The fusion protein is secreted from the host cell as a dimer of disulfide-linked fusion proteins comprising two identical fusion proteins, and the dimer of disulfide-linked fusion proteins is recovered from the culture medium. In some of such procedures, the dimer of disulfide-bound fusion proteins is formed by a covalent disulfide bond between a cysteine residue on each fusion protein. The fusion protein dimer is normally recovered from the culture medium, host cell or periplasm of host cells. Example 12 provides an exemplary method for creating a stably transfected cell line expressing a mutant CTLA4-Ig fusion protein of the invention, producing the mutant CTLA4-Ig fusion protein and purifying the mutant fusion protein from the culture.
In addition to recombinant production, the polypeptides of the invention can be produced by direct peptide synthesis using solid phase techniques (see, for example, Stewart et al. (1969) SOLID-PHASE PEPTIDE SYNTHESIS, WH Freeman Co, San Francisco and Merrifield J. (1963) J. Am. Chem. Soc. 85: 2149-2154). Peptide syntheses can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using the Applied Biosystems 431A peptide synthesizer (Perkin Elmer, Foster City, Calif.) According to the instructions provided by the manufacturer. For example, the sub-sequences can be chemically synthesized separately and combined using chemical methods to produce a polypeptide of the invention or fragments thereof. Alternatively, synthesized polypeptides can handle any number of companies that specialize in the production of polypeptides. Most commonly, the polypeptides of the invention are produced by expressing coding nucleic acids and recovering polypeptides, for example, as described above.
The invention includes a method of producing a polypeptide of the invention comprising introducing a nucleic acid of the invention, a vector of the invention or a combination thereof, into an animal, such as a mammal (including, for example, rat, non-human primate, bat, marmoset, pig or chicken), so that a polypeptide of the invention is expressed in the animal, and the polypeptide is isolated from the animal or a by-product of the animal. Isolation of the animal polypeptide or animal byproduct can be by any suitable technique, depending on the animal and desired recovery strategy. For example, the polypeptide can be recovered from sera from mice, monkeys or pigs that express the polypeptide of the invention. Transgenic animals (including the aforementioned mammals) comprising at least one nucleic acid of the invention are provided by the invention. The transgenic animal can have the nucleic acid integrated in its host genome (for example, by an AAV vector, lentiviral vector, biolistic techniques performed with promoter sequences of integration, etc.) or it can have the nucleic acid in epichromosomically maintained (by example, in a non-integrating plasmid vector or by insertion in a non-integrating viral vector). Epichromosomal vectors can be manipulated for more transient gene expression than integrating vectors. RNA-based vectors offer particular advantages in this regard.
Compositions
The invention further provides novel and useful compositions comprising at least one component of the invention such as, for example, at least one polypeptide (including, for example, fusion proteins and multimeric polypeptides), conjugate, nucleic acid, vector, virus, virus-like particle (VLP) and / or cell of the invention, or any combination thereof and a vehicle, excipient or diluent. The carrier, excipient or diluent may be a pharmaceutically acceptable carrier, excipient or diluent. Such a composition may comprise any suitable amount of any suitable number of polypeptides, conjugates, nucleic acids, vectors, viruses, VLPs and / or cells of the invention. Also provided are pharmaceutical compositions comprising at least one polypeptide, conjugate, nucleic acid, vector, virus, VLP and / or cell, or any combination thereof, and a pharmaceutically acceptable carrier, excipient or diluent. Such compositions are useful in the procedures described herein that include, for example, suppression procedures for immune responses.
For example, a composition is disclosed herein comprising an excipient, diluent or carrier and at least one such polypeptide of the disclosure (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptides), such as a mutant CTLA-4 ECD polypeptide (eg, any of SEQ ID NO: 1-73) or mutant CTLA-4-Ig fusion protein (eg, any of SEQ ID NO. : 74-79, 197-200, 205-214 and 219-222), wherein the at least one polypeptide is present in the composition in an amount effective to suppress an immune response that includes, for example, a response (s) Immune (s) involved in transplant rejection and / or autoimmunity, inhibit rejection of a tissue transplant, donated cell or organ or inhibit the interaction of endogenous B7 positive cells with CD28 positive T lymphocytes in a subject to which the composition is administered.
Also included is a pharmaceutical composition comprising a pharmaceutically acceptable excipient, diluent or carrier and an effective amount of one or more such components of the invention. The effective amount may be a therapeutic or prophylactically effective amount or dose for use in a therapeutic or prophylactic procedure described elsewhere herein, such as a procedure to treat an autoimmune disease or a procedure to inhibit rejection of a transplant. tissue, cell, graft or organ of a donor by a recipient subject.
The composition (or pharmaceutical composition) can be any non-toxic composition that does not interfere with the immunosuppressive properties of the polypeptide, conjugate, nucleic acid, vector, virus, VLP or cell of the invention included therein. The composition may comprise one or more excipients, diluents or carriers, and the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients, diluents or carriers. A wide variety of acceptable carriers, diluents and excipients are known in the art and can be included in the pharmaceutical compositions and compositions of the invention. For example, a variety of aqueous vehicles can be used, for example, distilled or purified water, sterile saline, buffered saline such as phosphate buffered saline (PBS) and the like, are advantageous in injectable polypeptide formulations, fusion proteins , conjugate, nucleic acid, vector, virus, VLP and / or cell of the invention. Numerous excipients, carriers and diluents suitable for administration of therapeutic proteins are known in the art. Such solutions are preferably sterile and generally free of undesirable matter. The compositions can be sterilized by conventional well-known sterilization techniques. The compositions of the invention may comprise pharmaceutically acceptable auxiliary substances, as required, to approximate physiological conditions. Such substances include, for example, pH adjusting agents, buffering agents and tonicity adjusting agents including, for example, sodium acetate, sodium ascorbate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like The compositions of the invention, which include pharmaceutical compositions, may also include one or more components such as diluents, fillers, salts, buffers, surfactants, emulsifiers, detergents (for example, a non-ionic detergent or emulsifier such as Tween®-20, Tween®-40, Tween®-60, Tween®-80, Pluronic F-68, and the like), stabilizers (e.g., sugars or amino acids without protein), preservatives, tissue fixatives, solubilizers and / or other materials suitable for inclusion in a pharmaceutical composition.
Examples of suitable components that can be used in the pharmaceutical composition are described in, for example, Berge et al., J. Pharm. Sci. 66 (1): 1-19 (1977), Wang and Hanson, J. Parenteral. Sci. Tech. 42: S4-S6 (1988), US Pat. No. 6,165,779 and 6,225,289, and elsewhere in this document. Pharmaceutical compositions may also include preservatives (such as benzyl alcohol, sodium azide, m-cresol, etc.), antioxidants, metal chelators (such as methionine, EDTA, etc.) and / or other additives known to those skilled in The matter. Examples of pharmaceutically acceptable carriers suitable for use in pharmaceutical compositions are described in, for example, Urquhart et al., Lancet 16: 367 (1980), Lieberman et al., PHARMACEUTICAL DOSAGE FORMS -DISPERSE SYSTEMS (2nd ed., Vol 3, 1998), Ansel et al., PHARMACEUTICAL DOSAGE FORMS & DRUG DELIVERY SYSTEMS (7th ed. 2000), Martindale, THE EXTRA PHARMACOPEIA (31st edition), Remington's PHARMACEUTICAL SCIENCES (16th-20th editions), THE PHARMACOLOGICAL BASIS OF THERAPEUTICS, Goodman and Gilman, Eds. (9th ed. -1996), WILSON AND GISVOLDS TEXTBOOK OF ORGANIC MEDICINAL AND PHARMACEUTICAL CHEMISTRY, Delgado and Remers, Eds. (10th ed. -1998), and US Pat. No. 5,708,025 and 5,994,106. The formulation principles of pharmaceutically acceptable compositions are described in, for example, Platt, Clin. Lab Med. 7: 289-99 (1987), Aulton, PHARMACEUTICS: THE SCIENCE OF DOSAGE FORM DESIGN, Churchill Livingstone (New York) (1988), EXTEMPORANEOUS ORAL LIQUID DOSAGE PREPARATIONS, CSHP (1998), and “Drug Dosage”, J. Kans . Med. Soc. 70 (1): 30-32 (1969). Additional pharmaceutically acceptable carriers particularly suitable for the administration of vectors are described in, for example, International Patent Application Publication No. WO 98/32859.
Compositions of the invention, which include pharmaceutical compositions, may include one or more vehicles.
or aqueous excipients (including, for example, pharmaceutically acceptable carriers or excipients) and one or more components such as one or more buffers, one or more salts, one or more detergents or emulsifiers and / or one or more sugars. The buffer system is normally one suitable for maintaining the pH of the composition within a range that is conducive to the stability of the molecule of the invention present in the composition (eg, mutant CTLA-4-Ig). Exemplary buffers for use in the composition include, but are not limited to, for example, N-2-hydroxyethylpiperazine-N'-2-aminoethanesulfonic acid buffer (HEPES), citrate buffer (e.g. citrate mixture trisodium disodium-citrate, sodium citrate-citric acid mixture, citric acid-trisodium citrate mixture, monosodium citrate-disodium citrate mixture, citric acid-monosodium citrate mixture), sodium phosphate buffer (per example, trisodium disodium phosphate mixture (Na2HPO4 / Na3PO4), sodium dibasic phosphate-sodium monobasic phosphate mixture), acetate buffer (for example, acetic acid-sodium acetate mixture, acetic acid-sodium hydroxide mixture) , histidine buffer, Tris buffer, Tris-maleate buffer, succinate buffer (e.g., succinic acid-sodium hydroxide mixture, succinic acid-monosodium succinate mixture, succinic acid-disodium succinate mixture, mixture of monosodium succinate-disodium succinate), maleate buffer, imidazole buffer, tartrate buffer, fumarate buffer, gluconate buffer, oxalate buffer, lactate buffer, acetate buffer and the like, or a combination thereof (e.g., mixture of citrate and acetate buffers, etc.). The concentration of buffer in the composition may be any that is appropriate for the molecule (s) of the invention (eg, a mutant CTLA-4-Ig) included in the composition solution such as, but they are not limited to, for example, in the range of about 1 mM to about 100 mM, about 1 mM to about 50 mM, about 5 mM to about 50 mM, or about 5 mM to about 25 mM, which include, for example , 1 mM, 5 mM, 10 mM, fifteen mM, 20 mM, 25 mM, 30 mM, 40 mM, 50 mM (such as, for example, 20 mM HEPES buffer, 20 mM triodium citrate disodium citrate buffer, 20 mM succinate buffer, etc.).
Exemplary salts for use in the composition include, but are not limited to, for example, water soluble salts that include an organic salt or inorganic salt (eg, water soluble inorganic salt) such as sodium chloride, chloride of magnesium, sodium bicarbonate, potassium chloride, calcium chloride and ammonium chloride, and the like, or any pharmaceutically acceptable or physiologically compatible salt. Exemplary salt concentrations in the composition solution include, but are not limited to, for example, in the range of about 1 mM to about 150 mM, about 10 mM to about 125 mM, or about 75 mM to about 125 mM, which include, for example, 10 mM, 50 mM, 75mM, 100 mM, 125 mM, 150 mM (such as, for example, 100 mM NaCl).
Exemplary sugars or carbohydrates for use in the composition include, but are not limited to, for example, sucrose, maltose, trehalose, dextrose, mannose, raffinose, lactose, maltodextrin, dextran, sucrose, etc., in a concentration range that includes, but is not limited to, for example, from about 0.1% to about 10% by weight of sugar, about 1% to about 5% by weight of sugar,
or about 1% to about 3% by weight sugar, including, for example, 0.1%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10% by weight of sugar (for example, 2% by weight of sucrose, 2% by weight of trehalose, or 2% by weight of mannose) based on the composition. Exemplary sugar alcohols for use in the composition include, but are not limited to, for example, mannitol, sorbitol, glycol, glycerol, arabitol, erythritol, xylitol, ribitol, lactitol and the like in a concentration range that includes , but is not limited to, for example, from about 0.1% to about 10% by weight of sugar alcohol, about 1-5%, about 1-3%, which includes, for example, 0.1% , 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10% by weight of sugar alcohol based on the composition.
The osmolality of the compositions of the invention, which include pharmaceutical compositions, is normally similar to blood serum osmolality, which ranges from about 250 to about 350 milliosmoles per kilogram (mOSm / kg) of water. The salt concentration in the composition is normally less than 125 mM. Salt and sugar concentrations can be adjusted or varied so that the osmolality of the composition is approximately 250-350 mOSm / kg of water.
Exemplary detergents or emulsifiers for use in the composition include, but are not limited to, for example, polysorbates such as Tween®-20, Tween®-40, Tween®-60, Tween®-80 or Pluronic F- 68 in a range that includes, but is not limited to, for example, from about 0.001% to about 0.2% by weight of a detergent or emulsifier based on the composition that includes, for example, 0.001%, 0.002% , 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.075% and 0.1% by weight of detergent or emulsifier (for example, Tween®-20, Tween®-40, Tween®-60, Tween®- 80 or Pluronic F-68) based on the composition.
The compositions of the invention, which include pharmaceutical compositions, may comprise a polymer, such as a PEG molecule, in a concentration sufficient to reduce or inhibit the unwanted association between two or more molecules of the invention such as, for example, two or more mutant CTLA-4-Ig fusion protein dimers of the invention. The composition may comprise two or more different polymers (eg, PEG). The polymer (eg, PEG molecule) normally has a molecular weight of about 200 Da to about 8000 Da (for example, about 200, 300, 400, 600, 900, 1000, 1450, 3350, 4500 or 8000 Da, available from Dow Chemical). It is believed that the addition of a polymer (eg, PEG molecule) to the composition reduces the formation of unwanted aggregates, particularly unwanted aggregates of two or more fusion protein dimers of the invention.
Compositions of the invention, which include pharmaceutical compositions, may include a cyclic oligosaccharide such as a cyclodextrin (eg, Captisol® (Cydex)). In one aspect, the composition comprises two or more different cyclic oligosaccharides. The addition of cyclic oligosaccharide (s) to the composition improves the solubility, stability, bioavailability and / or dosage of active pharmaceutical component (s) (eg, mutant CTLA-4 molecule).
The pH of a composition of the invention, which includes a pharmaceutical composition, can range from about pH 3 to about pH 10, from about pH 4 to about pH 10, from about pH 5 to about pH 9, from about pH 6 to about pH 9, from about pH 5.5 to about pH 8.5, from about pH 6.0 to about pH 6.7, from about pH 6.0 to about pH 6.5, from about pH 6.2 to about pH 8.7, from about pH 6.5 to about pH 8.5, from about pH 6.5 to about pH 7.5, from about pH 6.2 to about pH 7.0, from about pH 6.3 to about pH 6, 8, from about pH 6.4 to about pH 6.8, from about pH 7.0 to about pH 8.0, and about pH 7.0 to about pH 7.4. In one aspect, compositions comprising a molecule of the invention, such as, for example, a mutant CTLA-4-IgG2, have a pH of pH 5.0, pH 5.1, pH 5.2, pH 5, 3, pH 5.4, 5.5, pH 5.6, pH 5.7, pH 5.8, pH 5.9, pH 6.0, pH 6.1, pH 6.2, pH 6.3 , pH 6.4, pH 6.5, pH 6.6, pH 6.7, pH 6.8, pH 6.9, pH 7.0, pH 7.1, pH 7.2, pH 7.3 , pH 7.4, pH 7.5, pH 7.6, pH 7.7, pH 7.8, pH 7.9, pH 8.0, pH 8.1, pH 8.2, pH 8.3 , pH 8.4, pH 8.5, pH 8.6, pH 8.7, pH 8.8, pH 8.9, pH 9.0, pH 9.1, pH 9.2, pH 9.3 , pH 9.4, pH 9.5, pH 9.6, pH 9.7, pH 9.8, pH, 9.9 or pH 10.0.
In one aspect, the invention provides a composition of the invention comprising an excipient or vehicle (including, for example, a pharmaceutical composition comprising a pharmaceutically acceptable carrier or excipient) and an effective amount of any CTLA-4, multimer, dimer polypeptide. , conjugate, fusion protein or fusion protein dimer of the invention described everywhere and herein, and further comprising a buffer that can maintain the pH of the composition within the range of about pH 3 to about pH 10, water, optionally a non-ionic detergent, optionally a salt and optionally a sugar alcohol, monosaccharide, disaccharide or polysaccharide. Some of such compositions are at a physiological pH. Some of such compositions have a pH of about 4 to about 7.5, about 5.0 to about 7.5, or about 6.4 to about 6.6, including, for example, about pH 6.5, about pH 7.4 or pH 7.5. Some of such compositions comprise a buffer in a concentration of about 1 mM to about 100 mM, about 1 mM to about 50 mM, about 5 mM to about 35 mM, about 10 mM to about 25 mM, including, for example, about 20 mM, 25 mM, or 30 mM. Some of such compositions comprise a buffer selected from the group consisting of an HEPES buffer, citrate buffer, succinate buffer, acetate buffer, citrate buffer, maleate buffer, phosphate buffer and Tris buffer. Some of such compositions comprise a buffer that is selected from the group consisting of an HEPES buffer, sodium citrate buffer and sodium succinate buffer. For some of such compositions, the pH is from about 6.0 to about 6.7 and the buffer is sodium succinate or sodium citrate. For some of such compositions, the pH is about 7.0 to about 7.7 and the buffer is HEPES. Some of such compositions further comprise a sugar or saccharide alcohol, wherein the saccharide is a monosaccharide, disaccharide (eg, sucrose or trehalose) or polysaccharide. Some of such compositions comprise a salt present in a concentration of about 1 mM to about 50 mM, which includes, for example, about 20 mM, 25 mM or 30 mM. Some of such compositions comprise a non-ionic detergent such as, for example, a non-ionic detergent selected from the group consisting of the group consisting of Tween®-80, Tween®-60, Tween®-40, Tween®-20 or Pluronic F-68.
In some of such compositions (including pharmaceutical compositions) described in the preceding paragraph, the polypeptide, multimer, dimer, conjugate, fusion protein or fusion protein dimer is present at a concentration in the range of about 1 mg / ml (weight / volume op / v) at about 200 mg / ml (w / v), about 25 mg / ml (w / v) at about 100 mg / ml (w / v), about 50 mg / ml at about 300 mg / ml, optionally approximately in a range of about 50 mg / ml (w / v) to about 100 mg / ml (w / v). Some of such compositions comprise an effective amount of the polypeptide, multimer, dimer, conjugate, fusion protein or fusion protein dimer from about 0.1 mg / kg to about 15 mg / kg, and the composition is administered to a mammal ( for example, being human). Some of such compositions comprise an effective amount of the polypeptide, multimer, dimer, conjugate, fusion protein or fusion protein dimer from about 0.5 mg / kg to about 10 mg / kg, and the composition is administered parenterally. Some of such compositions comprise an effective amount of the polypeptide, multimer, dimer, conjugate, fusion protein or fusion protein dimer from about 0.1 mg / kg to about 5 mg / kg, and optionally about 0.5 mg / kg , and the composition is administered subcutaneously. Some of such compositions comprise an effective amount of the polypeptide, multimer, dimer, conjugate, fusion protein or fusion protein dimer from about 5 mg / kg to about 15 mg / kg (optionally about 10 mg / kg), and the composition It is administered intravenously. For some of such compositions, the polypeptide, multimer, dimer, conjugate, fusion protein or fusion protein dimer comprises an amino acid sequence having at least 95%, at least 96%, at least 97%, at minus 98% or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 36. For some of such compositions, the polypeptide, multimer, dimer, conjugate, fusion protein or fusion protein dimer comprises an amino acid sequence having at least 95%, at least 96%, at least 97%, at at least 98% or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 50. Some of such compositions are sterile and / or are isotonic with blood. Some of such compositions are liquid compositions. Some of such compositions are in a liquid or dried form, in which the dried form is selected from the group consisting of a lyophilized form, an air-dried form and a spray-dried form.
In an exemplary aspect, the invention provides a pharmaceutical composition comprising: (i) a CTLA-4-Ig fusion protein of the invention having a concentration of about 1 mg / ml to about 300 mg / ml (per example, about 1 mg / ml to about 100 mg / ml, about 50 mg / ml or about 100 mg / ml, etc.) (optionally a dimeric fusion protein);
(ii) a buffer having a buffering capacity of between about pH 5.0 and about pH 9.0 at a concentration of about 5 mM to about 50 mM; (iii) a pharmaceutically acceptable diluent to bring the composition to a designated volume; (iv) a sugar at a concentration of about 0.5% to about 10% by weight of sugar based on the composition; (v) a salt at a concentration of about 1 mM to about 200 mM; (vi) optionally a non-ionic detergent (for example, Tween®-20, Tween®-40, Tween®-60, Tween®-80 or Pluronic F-68) at a concentration of about 0.01 mg / ml to about 0.5 mg / ml, for example, about 0.01 mg / ml to about 0.1 mg / ml; and (vii) optionally a cyclic oligosaccharide (eg, cyclodextrin (Captisol®), wherein the pH of the composition is in a range of about pH 5.0 to about pH 8.0. Exemplary CTLA-4-Ig fusion proteins include those comprising a polypeptide sequence having at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 % or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 74-79, 197-200, 205214 and 219-222 (optionally, for example, selected from the group consisting of in SEQ ID NO: 197, 199, 211 and 213), in which the fusion protein binds to CD80 and / or CD86 and / or an extracellular domain thereof and / or suppresses an immune response. Such fusion proteins may be in monomeric or dimeric form.
In another aspect, the invention provides a pharmaceutical composition comprising: (i) a conjugate comprising a CTLA-4-Ig fusion protein of the invention (optionally a dimeric fusion protein) and a non-polypeptide moiety covalently bound to the fusion protein, said conjugate having a concentration of approximately 1 mg / ml to approximately 300 mg / ml (for example, approximately 1 mg / ml to approximately 100 mg / ml, approximately 50 mg / ml or approximately 100 mg / ml, etc.); (ii) a buffer having a buffering capacity of between about pH 5.0 and about pH 8.0 at a concentration of about 5 mM to about 50 mM; (iii) a pharmaceutically acceptable diluent to bring the composition to a designated volume; (iv) a sugar at a concentration of about 0.5% to about 10% by weight of sugar based on the composition; (v) a salt at a concentration of about 1 mM to about 200 mM; and (vi) optionally a non-ionic detergent (for example, Tween®-20, Tween®-40, Tween®-60, Tween®-80 or Pluronic F-68) at a concentration of approximately 0.01 mg / ml at about 0.5 mg / ml, for example, about 0.01 mg / ml to about 0.1 mg / ml, in which the pH of the composition is in a range of about pH 5.0 to about pH 8, 0. The conjugate may comprise one, two, three, four or more non-polypeptide moieties. Each non-polypeptide moiety can comprise a polymer (eg, PEG or PAO) or a sugar moiety. In some cases, the non-polypeptide moiety is a polymer molecule such as a PEG molecule. The polymer molecule can have any desired molecular weight depending on the desired functional effect (for example, increased half-life, decreased association between fusion protein molecules, etc.). In some cases, for example, the polymer is a PEG having a molecular weight of about 1 kDa to about 100 kDa Da (for example, 1, 2, 2.5, 3, 5, 8, 10, 12, 20, 25, 30, 40, 60 kDa, etc.). The non-polypeptide moiety (eg, sugar moiety or polymer molecule) is covalently linked to a binding group of an amino acid residue of the fusion protein using conventional procedures as described above. Exemplary CTLA-4-Ig fusion proteins include those comprising a polypeptide sequence having at least 91%, at least 92%, at least 93%, at least 94%, at least 95 %, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222 (optionally, for example, selected from the group consisting of SEQ ID NO: 197, 199, 211 and 213), in which the fusion protein binds to CD80 and / or CD86 and / or an extracellular domain thereof and / or suppresses an immune response. Such fusion proteins may be in monomeric or dimeric form.
In an exemplary aspect, the invention provides a pharmaceutical composition comprising from about 1 mg / ml to about 300 mg / ml of a CTLA-4-Ig fusion protein of the invention (for example, D3-54-IgG2 ) (for example, approximately 1 mg / ml to approximately 100 mg / ml, for example, approximately 50 mg / ml or approximately 100 mg / ml) which is normally expressed as a dimeric fusion protein, in 20 mM HEPES buffer in water , 100 mM NaCl, 2% by weight sucrose based on the composition, pH 7.4, which optionally includes a non-ionic detergent (e.g. Tween®-20, Tween®-40, Tween®-60, Tween®-80 or Pluronic F- 68) at a concentration of about 0.01 mg / ml to about 0.5 mg / ml, for example, about 0.01 mg / ml to about 0.1 mg / ml, and which optionally includes a polyethylene glycol (PEG) , such as a PEG molecule having a molecular weight of about 200 Dalton (Da) to about 8000 Da (for example, about 200, 300, 400, 600, 900, 1000, 1450, 3350, 4500 or 8000 Da, available from Dow Chemical). In another exemplary aspect, the disclosure includes a pharmaceutical composition comprising from about 1 mg / ml to about 300 mg / ml of a CTLA-4-Ig fusion protein (eg, D3-69-IgG2) that normally It is expressed as a dimeric fusion protein, in 20 mM sodium citrate buffer in water, 100 mM NaCl, 2% by weight of sucrose based on the composition, pH 6.5, which optionally includes a non-ionic detergent (e.g., Tween®-20, Tween®-40, Tween®-60, Tween®-80 or Pluronic F-68) at a concentration of about 0.01 mg / ml to about 0.5 mg / ml, for example, about 0.01 mg / ml to about 0.1 mg / ml, and which optionally includes a PEG molecule such as a PEG molecule having a molecular weight of about 200 Da to about 8000 Da (for example, about 200, 300, 400, 600, 900, 1000, 1450, 3350, 4500 or 8000 Da, available from Dow Chemical).
Receptacles are disclosed herein to contain a composition of the invention comprising a molecule of the invention (eg, mutant CTLA-4 molecule such as a mutant CTLA-4-Ig) and an excipient, diluent or carrier. The composition may be a pharmaceutical composition comprising a molecule of the invention and a pharmaceutically acceptable carrier, diluent or carrier. The receptacles include, but are not limited to, for example, vials (for example, glass vial such as a type I glass vial), autoinjectors, pen injectors (fixed dose or variable dose) and pre-filled syringes, or other containers adequate. If desired, a receptacle may contain one or more pre-determined doses of the molecule of the invention effective in suppressing an immune response or treating a disease or disorder of the immune system as described elsewhere herein. Some of such receptacles are useful for administration of the composition contained therein to a subject suffering from an immune disease or disorder (for example, auto-injectors, pen injectors, pre-filled syringes, etc.). Some of such receptacles allow the self-administration of the composition by the subject (for example, pen injectors, auto-injectors, pre-filled syringes, etc.).
Stable compositions or formulations of a molecule (eg, mutant CTLA-4 or mutant CTLA-4-Ig ECD) of the invention that include pharmaceutically acceptable compositions of a molecule of the invention with a pharmaceutically acceptable carrier are also provided. In another aspect, the invention includes freeze dried or lyophilized compositions or formulations. The term "freeze drying" or "lyophilized" generally refers to the state of a substance that has undergone a drying process such as freeze drying or freeze drying, in which at least 50% moisture has been removed. Pre-lyophilization and lyophilization procedures are well known in the art (see, for example, LYOPHILIZATION OF BIOPHARMACEUTICALS, vol. 2 of BIOTECHNOLOGY: PHARMACEUTICAL ASPECTS (Henry R. Costantino et al. eds., 2004), documents US 6,436,897, WO 06/104852), and would be easily understood by an expert. Any suitable lyophilization process can be used or modified as appropriate by one skilled in the art in the preparation of the lyophilized composition of the invention. A freeze-dried, air-dried, spray-dried or lyophilized composition is usually prepared from a liquid, such as a solution, suspension, emulsion, etc. The liquid to be freeze dried, air dried, spray dried or lyophilized normally includes all components (except liquid, for example, water) that will be in the final reconstituted liquid composition. Thus, the freeze-dried, air-dried, spray-dried or lyophilized composition will have the desired liquid composition (e.g., pharmaceutical composition) when reconstituted. Exemplary compositions of the invention, including pharmaceutical compositions, comprising a molecule of the invention (for example, mutant CTLA4-Ig fusion protein of the invention such as, for example, SEQ ID NO: 197, 199, 211 or 213), which are described throughout the present application, may be freeze dried, air dried, spray dried or lyophilized to produce a freeze dried, air dried, spray dried or freeze dried composition. , respectively, using conventional procedures known in the art. See, for example, the exemplary procedures described in LYOPHILIZATION OF BIOPHARMACEUTICALS, above.
For example, a container (eg, vial, such as a glass vial) containing a molecule of liquid composition of the disclosure (eg, mutant CTLA-4-Ig, fusion protein of the invention such as, for example , SEQ ID NO: 197, 199, 211 or 213) to be lyophilized can be lyophilized using conventional procedures known to those skilled in the art. See, for example, LYOPHILIZATION OF BIOPHARMACEUTICALS, above. The lyophilized molecule of the invention (for example, mutant CTLA-4-Ig of the invention) can subsequently be reconstituted with a liquid to generate a reconstituted liquid composition. Lyophilized formulations are normally reconstituted by the addition of an aqueous solution to dissolve the lyophilized formulation. Any suitable liquid or aqueous solution can be used to reconstitute a lyophilized formulation. A lyophilized formulation is frequently reconstituted using sterile or distilled water, but for reconstitution solutions comprising vehicles, excipients, diluent buffers and / or other components, including those described herein, may be used.
In one aspect, the invention provides a pharmaceutical composition in lyophilized form, wherein the composition comprises from about 1 mg / ml to about 300 mg / ml of a CTLA-4-Ig fusion protein of the invention, which is normally expressed. as a dimeric fusion protein, in appropriate buffer (e.g., HEPES, trisodium disodium citrate citrate, etc.) in water at a concentration to maintain the desired pH (e.g., about pH 6.0 to about pH 7.5), salt (for example, 50 mM NaCl), sugar (for example, 4-6% by weight of sucrose based on the composition), and optionally including a non-ionic detergent (Tween®-20, Tween®-40, Tween®-60, Tween®-80 or Pluronic F-68) at a concentration of about 0.01 mg / ml to about 0.5 mg / ml, for example, approximately 0.01 mg / ml to approximately 0.1 mg / ml (for example, Tween®-20, Tween®-60, Tween®-80 or Pluronic F-68). A lyophilized form of a pharmaceutical typically includes a lower concentration of salts and a higher concentration of sugar compared to a non-lyophilized liquid composition.
In a particular aspect, the invention provides a stable lyophilized composition for therapeutic administration after reconstitution with sterile water comprising a therapeutically effective amount of a molecule of the invention and optionally one or more of the following pharmaceutically acceptable components:
(a) a sugar or saccharide such as sucrose, mannose, dextrose or trehalose in an amount of about 1% by weight to about 10% by weight; (b) a detergent or emulsifier such as Tween®-20, Tween®-40 Tween®-60, Tween®-80 or Pluronic F-68; (c) an isotonic agent or salt, such as an inorganic salt (for example, sodium chloride) in a concentration of 0 mM to about 50 mM (including, for example, the concentrations set forth above; (d) a buffer suitable for maintaining the pH of the composition within a range that is conducive to the stability of the molecule; (e) dispersing agent (for example, in an amount sufficient for the long-term dispersion of the molecule of the invention such as, for example, 0.001% w / w approximately 1.0% w / v) (per example, polysorbate such as Tween®-20, Tween®-40, Tween®-60 or Tween®-80 or Pluronic F-68); and (f) a stabilizer (eg, saccharide, dextrans, low molecular weight PEG group (MW) such as PEG having MW from about 200 Da to about 8000 Da (for example, 200, 300, 400, 600, 900, 1000, 1450, 3350, 4500 or 8000 Da) or preservative. In some of such stable lyophilized compositions, the molecule is a recombinant or isolated fusion protein of the invention, such as a fusion protein comprising a polypeptide sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222 (optionally, for example, selected from the group consisting of SEQ ID NO: 197, 199, 211 and 213), in which the fusion protein binds to CD80 and / or CD86 and / or an extracellular domain thereof and / or suppresses an immune response. Such fusion proteins may be in monomeric or dimeric form.
Exemplary amounts of each such component in the lyophilized composition include those described above and herein. In one aspect, the buffer is selected so as to maintain the pH of the composition within a range of about pH 3 to about pH 8, from about pH 4 to about pH 7.5. A lyophilized composition of the invention comprising a recombinant mutant CTLA-4-Ig fusion protein of the invention is normally stable at -80 ° to + 40 ° C and / or substantially maintains its biological activity for at least one week, one or more months ( for example, six months), one year, two years, three years, four years or more when stored at room temperatures (for example, approximately 22 ° C to approximately 30 ° C). After reconstitution with a liquid (for example, sterile water for injection (API)), the lyophilized composition is suitable for administration (for example, iv, sc, parenteral, im, id, ip, etc.) to a subject (for example, human being).
A kit is disclosed herein comprising a freeze-dried or freeze-dried composition comprising a freeze-dried or freeze-dried molecule of the disclosure (eg, mutant CTLA-4-Ig fusion protein such as, for example, SEQ ID : 197, 199, 211 or 213) in a first container (for example, vial, such as a glass vial) and instructions for reconstituting the freeze dried or lyophilized composition using a liquid (eg, sterile water, API or buffer) . Optionally, the kit further comprises a second container (for example, vial, such as a glass vial) containing a sufficient amount of liquid (eg, sterile water, API or buffer) for reconstitution of the freeze dried or freeze dried composition. in a liquid composition. In this case, reconstitution is achieved using a syringe to remove a desired volume of water from the second container and to introduce the water into the first container. Then, the first vessel is then gently shaken with rocking to put the molecule of the invention (eg, fusion protein) into solution. The kit may include a device (s) for reconstituting the freeze dried or freeze dried composition and / or administering the reconstituted liquid composition. Exemplary devices include, but are not limited to, for example, a two-component mixed syringe, dual chamber syringe and dual chamber autoinjector. One component or chamber contains the lyophilized composition and the second component or chamber contains the liquid for reconstitution. With such devices, reconstitution is usually carried out just before administration, and the reconstituted composition is normally administered parenterally (eg, sc, iv, im, id injection).
The pharmaceutical composition or composition of the invention may comprise or be in the form of a liposome. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids and the like. The preparation of such liposomal formulations is described in, for example, US Pat. No. 4,837,028 and 4,737,323.
The form of the compositions or pharmaceutical composition can be dictated, at least in part, by the route of administration of the polypeptide, conjugate, nucleic acid, vector, virus, VLP or cell of interest. Because numerous routes of administration are possible, the form of the pharmaceutical composition and its components may vary. For example, in transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated may be included in the composition. Such penetrants are generally known in the art and include, for example, for transmucosal administration, detergents, bile salts and fusidic acid derivatives. In contrast, transmucosal administration can be facilitated by the use of nasal sprays or suppositories.
A common form of administration for compositions of the invention, which includes pharmaceutical compositions, is by injection. Pharmaceutically acceptable injectable compositions typically comprise one or more suitable liquid carriers such as water, petroleum, physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ), PBS or oils. Liquid pharmaceutical compositions may additionally include physiological saline, dextrose (or other saccharide solution), alcohols (eg, ethanol), polyols (polyols such as mannitol, sorbitol, etc.) or glycols such as ethylene glycol, propylene glycol, molecules of PEG, coating agents that promote proper fluidity such as lecithin, isotonic agents such as mannitol or sorbitol, organic esters such as ethyl oleate and absorption retarding agents such as aluminum monostearate and gelatins. The injectable composition may be in the form of a stable aqueous solution without pyrogens. An injectable aqueous solution may comprise an isotonic vehicle such as sodium chloride, solution for Ringer injection, dextrose, solution for injection of Ringer with lactate or an equivalent delivery vehicle (eg, solution for injection of sodium chloride / dextrose). Formulations suitable for intraarticular, intravenous, intramuscular, intradermal, subdermal, intraperitoneal and subcutaneous injection include sterile aqueous and non-aqueous isotonic injection solutions that may include solvents, co-solvents, antioxidants, reducing agents, chelating agents, buffers, bacteriostatics, antimicrobial preservatives and pathways that make the formulation isotonic with the intended recipient's blood (for example, PBS and / or saline solutions such as 0.1 M NaCl), and sterile aqueous and non-aqueous suspensions that may include suspending agents, solubilizers, thickeners, emulsifying agents, stabilizers and preservatives.
The administration of a polypeptide, conjugate, nucleic acid, vector, virus, pseudovirus, VLP or cell of the invention (or a composition comprising any such component) can be facilitated by an administration device formed of any suitable material. Examples of suitable matrix materials for producing non-biodegradable delivery devices include hydroxyapatite, bioglass, aluminates or other ceramics. In some applications a sequestering agent such as carboxymethylcellulose (CMC), methylcellulose or hydroxypropylmethylcellulose (HPMC) can be used to bind the particular component to the device for localized administration.
A nucleic acid or vector of the invention may be formulated with one or more poloxamers, polyoxyethylene / polyoxypropylene block copolymers or other surfactants or lipophilic soap-like substances for the administration of the nucleic acid or vector to a population of cells or tissue or skin of a subject. See, for example, US Pat. No. 6,149,922, 6,086,899 and 5,990,241.
The nucleic acids and vectors of the invention may be associated with one or more transfection enhancing agents. In some embodiments, a nucleic acid and / or nucleic acid vector of the invention are normally associated with one or more stability promoting salts, vehicles (e.g., PEG) and / or formulations that aid in transfection (e.g., sodium phosphate salts, dextran vehicles, iron oxide vehicles or biolistic administration vehicles ("gene gun") such as pearl vehicles or gold dust). See, for example, US Pat. No. 4,945,050. Additional transfection enhancing agents include viral particles with which the nucleic acid or nucleic acid vector can be conjugated, a calcium phosphate precipitating agent, a protease, a lipase, a bipuvicaine solution, a saponin, a lipid (for example , a loaded lipid), a liposome (for example, a cationic liposome), a peptide that facilitates the transfection or protein complex (for example, a poly (ethyleneimine), polylysine, or viral protein-nucleic acid complex), a virosome or a modified cell or cell-like structure (for example, a fusion cell).
Nucleic acids and vectors of the invention can also be administered by electroporation methods in vivo or ex vivo that include, for example, those described in US Pat. nº
6,110,161 and 6,261,281, and Widera et al., J. of Immunol. 164: 4635-4640 (2000).
Transdermal administration of a component of the invention (for example, polypeptide, conjugate, nucleic acid, vector, virus, VLP and / or cell of the invention) can be facilitated by a transdermal patch comprising such a component in any suitable composition in any form. adequate. Such transdermal patch devices are provided by the invention. For example, such a component may be contained in a liquid reservoir in a drug reservoir patch device or, alternatively, the component may be dispersed throughout a material suitable for incorporation into a simple monolithic transdermal patch device. Typically, the patch comprises an immunosuppressive amount of at least one such component - such as an amount effective to suppress an immune response in a subject contacted with the patch. Examples of such patch devices are known in the art. The patch device can be both a passive device and a device that can iontophoretically administer at least one such component to the skin or tissue of the subject.
A composition, particularly a pharmaceutical composition, may comprise any suitable dose of at least one such component of the invention (eg, polypeptide, conjugate, nucleic acid, vector, virus, VLP and / or cell) sufficient to achieve the desired immunosuppressive response. in a subject after administration. The appropriate dosage can be determined by any suitable technique and considerations for determining the appropriate one are known in the art. In a simple dosage test schedule, low doses of the composition are administered to a test subject or system (eg, an animal model, cell-free system or whole cell test system). The dosage is commonly determined by the effectiveness of the particular component to be administered, the condition of the subject, the body weight of the subject and / or target area of the subject to be treated. The dose size is also determined by the existence, nature and extent of any adverse side effects that accompany the administration of any particular component such in a particular subject. The principles related to the dosage of therapeutic and prophylactic agents are provided in, for example, Platt, Clin. Lab Med. 7: 289-99 (1987), "Drug Dosage", J. Kans. Med. Soc. 70 (1): 30-32 (1969), and other references described herein (eg, Remington's, above).
By way of example, a therapeutically effective amount of a polypeptide of the invention for an initial dosage to treat an autoimmune disease may comprise from about 0.001 mg / kg of body weight of the subject to about 100 mg / kg of body weight of the subject such as , for example, from about 0.001 milligrams per kilogram (mg / kg) of the subject's body weight to about 100 milligrams per kilogram (mg / kg) of the subject's weight or, for example, from about 0.001 mg / kg of the subject's weight to at least about 0.005, 0.01, 0.025, 0.05, 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 25, 30, 40, 50, 60, 70, 75, 80, 90 or 100 mg / kg body weight of the subject. Such dosage may be by any suitable protocol, for example, such as administered daily, weekly or biweekly, or any combination thereof (for example, in approximately 0, 1, 2, 4, 5, 6 and 7 days, weekly after , or in about 0, 1, 2, 4 and 6 weeks), followed by intervals of 1, 2, 3 months and by any suitable administration procedure such as, for example, by electroporation or a subcutaneous injection (sc), intramuscular (im), intravenous (iv) or intraperitoneal (ip), subdermal, transdermal, parenteral,
or intradermal (id). In some cases, a polypeptide of the invention is normally administered as a soluble polypeptide such as, for example, a fusion protein comprising a mutant CTLA-4 ECD polypeptide of the invention covalently linked to an Ig Fc polypeptide. For example, a pharmaceutical composition comprising a mutant CTLA-4-Ig fusion protein of the invention in a pharmaceutically acceptable carrier, diluent or excipient can be administered by any appropriate route (for example, intradermally, intravenously or subcutaneously) in an effective amount. which depends on autoimmune disease (for example, rheumatoid arthritis) or condition to be treated (for example, to inhibit rejection of a tissue transplant, cell, graft or solid organ of a donor by the recipient).
This document discloses a method of suppressing an immune response in a subject in need thereof comprising administering to the subject a pharmaceutical composition comprising, for example, from about 1 mg / ml to about 300 mg / ml, which includes from about 25 mg / ml to about 150 mg / ml (for example, 50 or 100 mg / ml) of D3-54-IgG2 fusion protein in 20 mM HEPES buffer in water, 100 mM NaCl, 2% sucrose by weight , pH 7.4, in which the subject suffers from an autoimmune disorder (for example, rheumatoid arthritis). A process for inhibiting rejection of a donor, cell, graft or solid organ transplant from a donor in a recipient subject comprising administering to the recipient subject a pharmaceutical composition comprising from about 25 mg / ml to about is disclosed herein. 100 mg / ml (for example, 50 or 100 mg / ml) of D3-69-IgG2 fusion protein in 20 mM sodium citrate buffer in water, 100 mM NaCl, 2% by weight sucrose, pH 6.5.
Also provided is a viral vector composition comprising a vehicle or excipient and a viral vector of the invention. Pharmaceutical compositions comprising a pharmaceutically acceptable carrier or excipient and a viral vector are also provided. The amount or dosage of viral vector particles or nucleic acid encoding viral vector particles depends on: (1) the type of virus vector particle with respect to the origin of the vector that includes, but is not limited to, for example, if the vector is an alpha virus vector, viral vector of the Semliki forest, adenoviral vector, adeno-associated viral vector ( AAV), flaviviric vector, papilloma viral vector and / or herpes simplex viral vector (HSV), (2) if the vector is a transgene expressing vector or expressing recombinant peptide, (3) the host, and (4) other considerations discussed above. Generally, with respect to gene transfer vectors, the pharmaceutically acceptable composition comprises at least about 1 x 102 viral vector particles in a volume of about 1 ml (for example, at least about 1 x 102 to 1 x 108 particles in about 1 ml) Higher dosages may also be suitable (for example, at least about 1 x 106, about 1 x 108, about 1 x 109, about 1 x 1010 particles / ml).
The invention also provides a composition (including a pharmaceutical composition) comprising an aggregate of two or more polypeptides or conjugates of the invention. In addition, the invention provides a composition (including a pharmaceutical composition) comprising a population of one or more multimeric polypeptides or multimeric conjugates of the invention. As noted above, pharmaceutical compositions include a pharmaceutically acceptable carrier, diluent or carrier.
Examples
The following examples further illustrate the invention, but should not be construed as limiting its scope in any way.
Example 1
This example provides a description of the procedures for creating a LEA29Y-Ig fusion protein, which was used as a control and for comparative purposes in Biacore ™ binding and cell-based activity assays.
Creation of DNA plasmid vector encoding the LEA29Y-Ig fusion protein.
This example describes the preparation of a DNA plasmid vector encoding the LEA29Y-Ig fusion protein. LEA29Y-Ig comprises a specific known mutant CTLA-4 ECD polypeptide called "LEA29Y" (or "LEA" or "L104EA29Y" or "A29YL104E") that is covalently linked at its C-terminus to the N-terminus of a Fc polypeptide of Specific mutant human IgG1. The LEA29Y polypeptide is a mutant CTLA-4 ECD polypeptide comprising a polypeptide sequence that differs from the polypeptide sequence of the human CTLA-4 extracellular domain by two mutations - an A29Y substitution and an L104E substitution - in which positions 29 and 104 are numbered by reference to the polypeptide sequence of the human CTLA-4 ECD polypeptide, the first amino acid residue of human CTLA-4 being designated the residue of amino acid position 1. See US 7,094,874. Plasmid vector pcDNA3.1-LEA, which includes a nucleotide sequence encoding LEA29Y-Ig, was created to produce this fusion protein.
DNA encoding LEA29Y-Ig is created by PCR assembly using overlapping oligonucleotides designated based on sequence homology with the nucleotide sequence encoding LEA29Y-Ig shown in SEQ ID NO: 167. The oligonucleotides are designed, prepared and assembled. using conventional procedures well known to those skilled in the art and may include termination and initiation codons and restriction sites as necessary. The PCR amplification procedures employed are also well known in the art. See, for example, Berger, Ausubel and Sambrook, all above.
The oligonucleotides are assembled in a 100 μl PCR reaction with 1 μM oligonucleotides, 1x Taq buffer (Qiagen; # 201225) and 200 μM dNTP for 30 cycles of amplification (94 ° C, 30 s; 60 ° C, 30 s; 72 ° C, 60 s ). The amplified DNA is purified by QiaQuick PCR centrifuge columns (Qiagen, cat. No. 28104) and digested with restriction enzymes NheI and SacII. The fragments were separated by agarose gel electrophoresis, purified using the Qiaquick gel extraction kit (Qiagen, no. 28704) according to the manufacturer's recommendation and ligated into similarly digested plasmid pcDNA 3.1 (+) (Invitrogen, cat. No. V790-20). The ligaments are transformed into E. coli TOP10 cells (Qiagen, cat. No. C4040-10) according to the manufacturer's recommendations. The resulting cells are incubated overnight at 37 ° C in LB medium containing 50 μg / ml carbenicillin with shaking at 250 rpm and then used to prepare a maxiprep broth (Qiagen; No. 12362) of plasmid DNA (referred to herein as successive plasmid vector pcDNA3.1-LEA).
The pcDNA3.1-LEA plasmid vector is identical to the mutant CTLA-4-IgG2 vector plasmid vector of pcDNA shown in Figure 1, except that the nucleic acid sequence encoding the mutant CTLA-4-IgG2 polypeptide has been replaced by a nucleic acid sequence encoding the LEA29Y-Ig fusion protein. A nucleic acid encoding the human CTLA-4 signal peptide was included as the nucleotide sequence encoding the signal peptide.
A nucleic acid sequence encoding the predicted LEA29Y-Ig fusion protein is shown in SEQ ID NO:
167. SEQ ID NO: 167 includes the nucleotide sequence encoding the signal peptide (eg amino acid residues 1-37 of SEQ ID NO: 165). The polypeptide sequences of the predicted LEA29Y-Ig and mature LEA29Y-Ig fusion protein (without the signal peptide) are shown in SEQ ID NO: 165 and 166, respectively. As indicated in Figure 2C, the predicted LEA29Y-Ig amino acid sequence includes the following segments: the expected signal peptide (amino acid residues 1-37), the ECD of the LEA29Y polypeptide (amino acid residues 38-161), linker (amino acid residue 162) and a mutant (modified) Fc domain of a human IgG1 polypeptide (amino acid residues 163-394). The amino acid residues at the junctions between these various segments are also shown in Figure 2C. Specifically, the last four amino acid residues of the signal peptide, the first five and the last five amino acid residues of the LEA29Y ECD, the only amino acid residue of the linker (Q) and the first five and the last five amino acid residues of the signal peptide are shown. mutant IgG1 Fc polypeptide.
The signal peptide is normally cleaved during processing and, therefore, the secreted fusion protein (ie, mature fusion protein) of LEA29Y-Ig does not normally contain the signal peptide sequence. The mature / secreted form of LEA29Y-Ig, which has a total of 357 amino acids, comprises amino acid residues 38-394 (the full length sequence without the signal peptide) of the predicted sequence shown in SEQ ID NO: 165, and It begins with the amino acid sequence : methionine-histidine-valine-alanine. SEQ ID NO: 165 includes the signal peptide (eg, residues 1-37) at its N-terminus; The signal peptide is normally cleaved to form the mature protein shown in SEQ ID NO: 166. If desired, the amino acids of the mature form can be listed starting with the Met of the Met-His-Val-Ala sequence, which designates Met as the first residue (for example, the ECD comprises amino acid residues numbered 1-124 ), as in the mature fusion protein LEA29Y-Ig having the sequence shown in SEQ ID NO: 166. In one aspect, the sequence of SEQ ID NO: 165 or 166 does not include the lysine residue of the C-terminus; This residue can be cleaved during processing or before secretion.
The protein sequence of the LEA29Y-Ig fusion protein is described in US 7,094,874. Specifically, SEQ ID NO: 4 of US 7,094,874 shows a protein sequence encoding the immature form of monomeric LEA29Y-Ig. In US 7,094,874, the LEA29Y-Ig fusion protein is called "L104EA29YIg." The mature fusion protein LEA29Y-Ig comprising the sequence shown in SEQ ID NO: 166 set forth herein differs from the fusion protein sequence shown in SEQ ID NO: 4 in US 7,094,874 because SEQ ID NO: 4 of US 7,094,874 includes a signal peptide (ie, residues 1-26 of SEQ ID NO: 4). This signal peptide is normally cleaved during processing and, therefore, the mature (secreted) form of the LEA29Y-Ig fusion protein does not normally include the signal peptide sequence. SEQ ID NO: 3 of US 7,094,874 presents a nucleic acid sequence encoding the LEA29Y-Ig fusion protein (ie, LEA29Y-Ig).
LEA29Y-Ig normally exists in solution as a dimeric fusion protein comprising two identical monomeric fusion proteins. In this case, each monomeric mature LEA29Y-Ig fusion protein comprises a LEA29Y ECD polypeptide (SEQ ID NO: 168) fused at its C-terminus with the N-terminus of a mutant IgG1 Fc (SEQ ID NO: 186). The two monomers of LEA29Y-Ig are covalently linked together by disulfide bonds formed between cysteine residues in each monomer, thus forming the fusion protein dimer LEA29Y-Ig. The LEA29Y-Ig dimer is the form of the fusion protein molecule used in the assays described in these examples, unless explicitly stated otherwise.
Creation of the stable CHO-K1 cell line that expresses the LEA29Y-Ig fusion protein.
A stable cell line was created to generate multiple milligram amounts of the LEA29Y-Ig fusion protein discussed above.
Transfection of CHO-K1 cells.
CHO-K1 cells were seeded at a density of 1 x 106 in T-175 flasks (BD Falcon, No. 353112) containing 40 ml of growth medium (DMEM / F12 medium (Invitrogen, No. 10565-018) supplemented with 10% of fetal bovine serum (SBF) (Hyclone, No. SV30014.03) and 1x PS (penicillin + streptomycin) (Invitrogen, No. 15140-122)). The cells were incubated for 24 hours (h) at 37 ° C and then transfected with 10 µg of Maxiprep plasmid DNA (eg, plasmid vector encoding LEA29Y-Ig as described above) mixed with 60 µl of Fugene 6 ( Roche, nº 11814443001) according to the conditions recommended by the manufacturer. The cells were incubated for 2 days (d) at 37 ° C in growth medium and then for 10 d in selection medium (growth medium containing 300 μg / ml of geneticin (Invitrogen, No. 10131-027), changing the media every 2 d. The medium was removed and the cells were dispersed by adding 3 ml of 0.05% trypsin (Invitrogen, cat. No. 25300-054) and incubation at 37 ° C for 3 min. The dispersed cells were diluted in 10 ml of growth medium and collected by centrifugation at 1000 rpm for 5 min at room temperature (RT) in a GH-3.8 rotor (Beckman Coulter, No. 360581). After discarding the supernatant, the cells were suspended in 1 ml of growth medium, filtered through 40 μm membranes (BD Falcon, No. 352340) and adjusted to a density of 1 x 10 6 cells / ml.
Separation of unique clones.
Using a cell sorter (Dako, MoFlo), living cells were individually dispersed in 96-well culture plates (Sigma-Aldrich, No. CLS-3596) containing 200 µl / well of growth medium containing 25% conditioned medium (growth medium previously collected from untransfected cell cultures (or without prior treatment)). After incubation at 37 ° C for 10-14 d, the cells were dispersed by hydrolysis with trypsin and transferred to new culture plates containing 200 µl / well of growth medium. The cells were grown at 37 ° C in growth medium until the cell density reached 70% confluence (approximately 14 d, with medium changed every 7 d).
Identification of desired clones.
Clones expressing high levels of recombinant LEA29Y-Ig fusion protein were identified by point transfer and Western analysis. For point transfer analysis, 100 μl of medium was collected from each well of the 96-well culture plates and transferred to nitrocellulose membranes (Whatman, No. 10439388) according to the manufacturer's recommendations. The membranes were washed twice with 200 ml of PBST (PBST is phosphate buffered saline (PBS) + 0.05% Tween®-20) for 10 min at room temperature (TA) and then incubated with PBST containing 5% skimmed milk powder (EMD, no.115363.0500) for 1 hour (h) at RT. The membranes were washed as described above and incubated for 1 h at RT in 20 ml of PBST containing goat antibody directed against human Ig conjugated with horseradish peroxidase (HRP) (Vector Labs, No. BA-3000) diluted to 1: 4000. The membranes were washed as described above and incubated for 1 h at RT with PBST containing streptavidin-HRP reagent (BD Biosciences, No. 554066) diluted 1: 2000. The membranes were washed as described above and signals were detected using Western ECL transfer detection reagent (Amersham, Cat. # RPN2132) according to the conditions recommended by the manufacturer. Positive clones identified by high signal intensity (ie, expressing high levels of fusion protein) were dispersed by trypsin hydrolysis and transferred to 6-well culture plates (BD Falcon, cat. No. 353046) containing 2 ml / well of growth medium. After incubation at 37 ° C for 3-4 d, the cells were dispersed by hydrolysis with trypsin and transferred to T-75 flasks (BD Falcon, cat. No. 353136) containing 20 ml of growth medium. After incubation at 37 ° C for 2 d, 100 µl of medium was collected and analyzed for protein expression levels by Western analysis. For Western analysis, equal amounts (15 μl) of medium from each cell culture were run by 4-12% of bis-Tris NuPAGE gels (Invitrogen, No. NP0322BOX) in MES electrophoresis buffer (MES is 2- (N-morpholino acid) ) ethanesulfonic acid, pH 7.3) (Invitrogen, No. NP0002) according to the conditions recommended by the manufacturer. The proteins were transferred from gels to nitrocellulose membranes (Invitrogen, cat. No. LC2001) by electrotransfer according to the conditions recommended by the manufacturer. The membranes were processed as described above for point transfer and positive clones (expressing the fusion protein of interest) were identified by signal intensity and apparent molecular weight. Positive clones were dispersed by trypsin hydrolysis as described above and propagated in T-175 flasks containing 40 ml of growth medium.
Production and purification of the LEA29Y-Ig fusion protein.
Propagation of crops in a rotating bottle.
A stable CHO-K1 cell line that had been transfected as described above with nucleic acid encoding the fusion protein of interest was grown confluently in T-175 flasks containing 40 ml of growth medium (DMEM / F- medium 12 (Invitrogen, No. 10565-018) supplemented with 10% SBF (Hyclone No. SV30014.03) and 1x PS (Invitrogen, No. 15140-122)). The cells were collected by incubation in 3 ml of 0.05% trypsin (Invitrogen, cat. No. 25300-054) for 3 min at 37 ° C, were diluted in 12 ml of growth medium and then transferred to rotary bottles (Corning, cat. No. 431191) containing 250 ml of growth medium. After incubation of cultures in a rotating bottle at 37 ° C in a humidified rotary incubation oven for 2 d, the medium was removed and replaced with 250 ml of fresh growth medium. The cultures were incubated for 2 d at 37 ° C and the medium was replaced with 250 ml of UltraCHO medium (UltraCHO medium (BioWhittaker, cat. No. 12-724) supplemented with 1/1000 of EX-CYTE (Serologicals Proteins, cat. No. 81129N) and 1x PS). After incubation for 2 d at 37 ° C, the medium was replaced with 250 ml of fresh UltraCHO medium. The cultures were incubated for 2 d at 37 ° C and the medium was replaced with 250 ml of production medium (DMEM / F-12 medium supplemented with 1 / 100x ITSA (Life Technologies No. 51300-044), 1 / 1000x EX-CYTE and 1x ). During production, the medium was collected and replaced with fresh production medium every two days.
Protein Purification
The rotary bottle culture production medium was clarified by centrifugation at 2500 xg for 30 min at RT followed by filtration through 0.2 μM membranes (VWR, Cat. No. 73520-986). The media was concentrated 10 times by tangential flow filtration using 10 kDa MWCO membranes (Millipore, cat. # P3C010C00) and then used for affinity chromatography with protein A using a BioCad vision HPLC system. The Ig fusion protein was bound to Protein A Poros 20 resin (Applied Biosystems, Cat. No. 1-5029-01) in PBS buffer, washed with the same buffer, eluted with 80 mM citric acid buffer ( pH 4.0) containing 160 mM sodium chloride and then neutralized by the addition of 2M Tris base. The protein solution was finally dialyzed against 6 liters (l) of PBS using 10 kDa MWCO membranes (Pierce, no. cat. PI66810).
Example 2
This example describes exemplary procedures used to create and screen CTLA-4 mutant libraries for human CD80 and / or human CD86 binding activities altered by phage expression.
Fusion protein of human CD80-Ig.
The human CD80-Ig ("hCD80-Ig") and human CD86-Ig ("hCD86-Ig") fusion proteins were used as ligands in phage immunopurification and phage ELISA experiments to identify mutant CTLA-4 molecules which bind human CD80 ("hCD80") and / or human CD86 ("hCD86") and / or an extracellular domain of any of them
or both. The human CD80-Ig fusion proteins (also called "hB7.1-Ig" or "hB7-1-Ig") and human CD86-Ig (also called "hB2.1-Ig" or "hB2-1-Ig" ) are available from R&D Systems (Minneapolis, MN).
A representative nucleic acid sequence encoding the predicted human CD80-IgG1 WT fusion protein, comprising the human CD80 signal peptide, human CD80 ECD and human IgG1 Fc, is shown in SEQ ID NO: 172. The sequences of Predicted and mature polypeptides of the hCD80-IgG1 fusion protein are shown in SEQ ID NO: 170 and SEQ ID NO: 171, respectively. The predicted fusion protein shown in SEQ ID NO: 170 comprises WT human CD80 ECD covalently fused at its C-terminus with the N-terminus of a human IgG1 Fc polypeptide and includes a signal peptide at its N-terminus. The signal peptide is normally cleaves to form the mature CD80-Ig fusion protein shown in SEQ ID NO: 171.
Human CD80-IgG1 is normally abbreviated herein hCD80-Ig. As shown in Figure 2A, the predicted amino acid sequence of the hCD80-Ig fusion protein (also designated "CD80-IgG1") includes the following segments: the expected signal peptide (amino acid residues 1-34), ECD of Human CD80 (amino acid residues 35-242), linker (amino acid residues 243-245) and human IgG1 Fc polypeptide (amino acid residues 246-476). The amino acid residues at the junctions between these various segments are shown in Figure 2A. Specifically, the last four amino acid residues of the signal peptide, the first five and the last five amino acid residues of the human CD80 ECD, the amino acid residues of the linker (GVT) and the first five and the last five amino acid residues of the signal peptide are shown. human IgG1 Fc polypeptide. In the CD80-Ig fusion protein, three GVT residues are present as a cloning artifact (or linker) between the C-terminus of CD80 ECD (which terminates with the FPDN amino acid residues) and the N-terminus of the Fc polypeptide of IgG1 (which begins with PKSC amino acid residues). This GVT or linker cloning artifact is shown in the predicted and mature CD80-Ig polypeptide sequences shown in SEQ ID NO: 170 and 171, respectively.
The signal peptide is normally cleaved during processing and, therefore, the secreted fusion protein (i.e., mature fusion protein) of hCD80-Ig does not normally contain the signal peptide. The mature / secreted form of hCD80-Ig, which has a total of 442 amino acids, comprises amino acid residues 35-476 (the full length sequence without the signal peptide) of SEQ ID NO: 170 and begins with the residue sequence of amino acid: valine-isoleucine-histidine-valine. If desired, the amino acids of the mature form can be listed starting with the valine (Val) of the Val-Ile-His-Val sequence, which designates Val as the first residue (for example, the ECD comprises numbered amino acid residues 1-208), as in the mature form of hCD80-Ig comprising the polypeptide sequence shown in SEQ ID NO: 171.
The hCD80-Ig fusion protein normally exists in solution as a dimeric fusion protein comprising two identical monomeric mature hCD80-Ig fusion proteins. In this case, each monomeric mature hCD80-Ig fusion protein (SEQ ID NO: 171) comprises a human CD80 ECD (SEQ ID NO: 174) fused at its C-terminus with the N-terminus of a human IgG1 Fc (SEC ID No.: 185). The two hCD80-Ig monomers are covalently linked together by disulfide bonds formed between cysteine residues in each monomer, thus forming the hCD80-Ig fusion protein dimer. The hCD80-Ig fusion protein dimer is the form of the fusion protein molecule used in the assays described in these examples, unless explicitly stated otherwise.
A representative nucleic acid encoding the intended full length human CD80 polypeptide is shown in SEQ ID NO: 196. The nucleic acid sequence shown in SEQ ID NO: 196 encodes the human CD80 signal peptide, ECD, transmembrane domain and domain. cytoplasmic, and includes the termination codon TAA at the C end.
Fusion protein of human CD86-Ig.
A representative nucleic acid sequence encoding the predicted amino acid sequence of the human CD86-human IgG1 fusion protein (normally abbreviated herein "hCD86-Ig") is shown in SEQ ID NO: 179. This nucleic acid sequence it includes a nucleotide sequence that encodes a signal peptide of the mature human CD86-human IgG1 fusion protein. The predicted amino acid sequence of the hCD86-Ig fusion protein is shown in SEQ ID NO: 177, and an exemplary nucleic acid encoding the predicted hCD86-Ig fusion protein is shown in SEQ ID NO: 179.
As shown in Figure 2B, the predicted amino acid sequence of the hCD86-Ig fusion protein includes the following segments: the predicted signal peptide (amino acid residues 1-23), extracellular domain of human CD86 (amino acid residues 24- 243), linker sequence (amino acid residues 244-246) and human IgG1 Fc polypeptide (amino acid residues 247-477). The amino acid residues at the junctions between these various segments are also shown in Figure 2B. Specifically, the last four amino acid residues of the signal peptide, the first five and the last seven amino acid residues of the human CD86 ECD, the amino acid residues of the linker (GVT) and the first five and the last five amino acid residues of the signal peptide are shown. human IgG1 Fc polypeptide.
The CD86 signal peptide is normally cleaved from the hCD86-Ig polypeptide envisaged during processing and, therefore, the secreted human CD86-Ig fusion protein (ie, mature fusion protein) does not normally include the signal peptide. The mature / secreted form of hCD86-Ig, which has a total of 454 amino acids, comprises amino acid residues 24-477 (the full length sequence without the signal peptide) of SEQ ID NO: 177 and begins with the following sequence of amino acid residues: alanine-proline-leucine. If desired, the amino acids of the mature fusion protein can be listed starting with the alanine residue (Ala) of the Ala-Pro-Leu sequence, which designates Ala as the first residue (for example, the ECD comprises the residues of amino acids numbered 1-218), as in the mature form of hCD86-Ig comprising the polypeptide sequence shown in SEQ ID NO: 178. The mature fusion protein (SEQ ID NO: 178) comprises a hCD86 WT ECD protein covalently fused at its C-terminus with the N-terminus of an hIgG1 Fc polypeptide.
The hCD86-Ig fusion protein normally exists in solution as a dimeric fusion protein comprising two identical monomeric mature hCD86-Ig fusion proteins. In this case, each monomeric mature CD86-Ig fusion protein (SEQ ID NO: 178) comprises a human CD86 ECD (SEQ ID NO: 180) fused at its C-terminus with the N-terminus of a human IgG1 Fc (SEC ID No.: 185). The two monomers of hCD86-Ig are covalently linked together by disulfide bonds formed between cysteine residues in each monomer, thus forming the dimer of hCD86-Ig fusion proteins. The hCD86-Ig fusion protein dimer is the form of the fusion protein molecule used in the assays described in these examples, unless explicitly stated otherwise.
In the CD86-Ig fusion protein (eg, predicted and mature forms), three GVT residues are present as a cloning artifact (or linker) between the C-terminus of the CD86 ECD and the N-terminus of the IgG1 Fc polypeptide. In another aspect, the human CD86 WT ECD protein comprises a polypeptide sequence comprising amino acid residues 1-218 of SEQ ID NO: 180 (ie, excluding the last two amino acid residues of the C-terminus in (PP) ).
Orencia® fusion protein.
As an additional control and for comparative purposes a commercially available fusion protein known as the Orencia® fusion protein (Bristol-Myers Squibb Co., Princeton, NJ) was purchased. The Orencia® fusion protein is composed of the extracellular domain of human WT CTLA-4 covalently fused at its C-terminus with the N-terminus of a specific mutant IgG1 Fc polypeptide. The Orencia® protein is a dimeric fusion protein comprising two identical monomeric fusion proteins covalently linked together by disulfide bonds formed between cysteine residues present in each monomeric fusion protein. The polypeptide sequence of each Orencia® mature fusion protein monomer is shown in SEQ ID NO: 164 and is composed of the following segments: an extracellular domain of human CTLA-4 WT (amino acid residues 1-124), sequence of linker (amino acid residue 125) and a mutant IgG1 Fc polypeptide (amino acid residues 126-357). Each Orencia® fusion protein monomer has a structure similar to that of the LEA29Y-Ig fusion protein monomer shown schematically in Figure 2C, except that the LEA29Y ECD is replaced by WT human CTLA-4 ECD, and is not present signal peptide in any Orencia® fusion protein monomer, because each monomer is a secreted or mature fusion protein. The polypeptide sequence of the immature form of an Orencia® monomer (which includes a signal peptide) and a nucleic acid sequence encoding the immature form of an Orencia® fusion protein monomer are shown in SEQ ID NO: 8 and SEQ ID NO: 7, respectively, of US 7,094,874. The procedures for preparing and using the Orencia® fusion protein are also disclosed in US document.
7.094.874.
Creation of DNA sequences encoding mutant CTLA-4 polypeptides.
Directional evolution procedures were used to generate naturally occurring recombinant polynucleotide libraries that encode recombinant mutant CTLA-4 extracellular domain polypeptides. Protein and nucleotide sequences of several naturally occurring mammalian CTLA-4 homologues are known. See, for example, National Center for Biotechnology Information (NCBI). The diversity of sequences identified in a variety of naturally occurring mammalian CTLA-4 extracellular domain homologs was used in directed evolution procedures to generate libraries of recombinant polynucleotides encoding mutant CTLA-4 ECD domain polypeptides. Directed evolution methods include, for example, in vitro recombination and mutagenesis procedures as substantially described in Stemmer, Proc. Natl. Acad. Sci. USA 91: 10747-10751 (1994); Chang et al., Nature Biotech 17: 793-797 (1999); International Patent Application Publication No. WO 98/27230; and U.S. patents nº
6,117,679 and 6,537,776.
Creation of DNA sequence libraries encoding mutant CTLA-4 polypeptides.
The mutant DNA sequences encoding recombinant mutant CTLA-4 ECD polypeptides were amplified from PCR assembly reactions using direct and reverse primers designed based on sequence homology. The primers were designed, made and assembled using conventional procedures well known to those skilled in the art and included termination and initiation codons and restriction sites as necessary. The PCR amplification procedures employed are also well known in the art. See, for example, Berger, Ausubel and Sambrook, all above. Exemplary direct and reverse primers include, but are not limited to, the following: direct primer (5'-CTATTGCTACGGCCGCTATGGCCMTKCACGTCGCTCAACCAGCCGTCGTACTC GCGTCC-3 ') (SEQ ID NO: 191) and reverse primer (5'-GTGATGGTGATGCGGTGATGCGGTGATGCGGTGATGCGGCGGCGGGGCG (SEQ ID NO: 192). 5 μl of assembly reaction was used as a template in 100 μl of PCR reaction with 1 μM direct and reverse primers, Taq buffer (Qiagen; # 201225) and 200 μM dNTP for 15 cycles of amplification (94ºC 30 s; 50ºC 30 s ; 72 ° C 40 s). The amplified DNA encoding the mutant CTLA-4 ECD polypeptides was digested with restriction enzymes (SfiI and NotI) and the fragments were separated by agarose gel electrophoresis, purified using the Qiaquick gel extraction kit (Qiagen, No. 28704) according to the manufacturer's recommendation and ligated into the similarly digested phage expression vector pSB0124 (procedure similar to that described in Chang et al., Nature Biotech 17: 793-797 (1999)). The resulting library ligation was transformed by electroporation into E. coli TOP10 cells (Invitrogen, Inc; # C4040-50) following the conditions recommended by the manufacturer. The transformed cells were incubated in LB (Luria broth medium) containing 50 μg / ml carbenicillin at 250 rpm overnight at 37 ° C and then used to prepare a maxiprep broth (Qiagen; No. 12362) from library DNA according to the conditions recommended by the manufacturer.
Screening of phage libraries expressing mutant CTLA-4 polypeptides that have enhanced avidity for human CD80 and / or human CD86
Generation of phage expression libraries of mutant CTLA-4 polypeptides.
Library DNA (for example, a DNA sequence library encoding CTLA-4 ECD mutants) was transformed by electroporation into E. coli TG-1 cells (Stratagene; No. 200123) according to the conditions recommended by the manufacturer. The culture was grown under phagemid selection conditions (LB medium containing carbenicillin at 50 μg / ml) for 1-2 generations, infected with phage M13K07 collaborator (at a multiplicity of infection level of 5-10) and incubated with stirring at 250 rpm overnight at 37 ° C under dual selection for phagemid (carbenicillin at 50 μg / ml) and collaborating phage (kanamycin at 70 μg / ml). Cultures were clarified by centrifugation (6000 rpm, 15 min, 4 ° C in a Sorvall 600TC rotor) and phage particles were precipitated by incubating 32 ml of culture supernatant with 8 ml of PEG / NaCl solution (20% PEG-8000 ; 2.5 M NaCl) on ice for 30 min followed by centrifugation (9500 rpm, 40 min, 4 ° C in a Sorvall 600TC rotor). The phage sediment was suspended in 1 ml of PBS containing 1% BSA (bovine serum albumin, Sigma; No. A7906), transferred to a microcentrifuge tube and clarified by centrifugation (max speed, 5 min, TA in an Eppendorf table centrifuge).
Immunopurification of CTLA-4 mutant phage libraries.
Phage libraries were immunopurified in up to five rounds against hCD80-Ig or hCD86-Ig fusion proteins using conventional conditions. See, for example, Lowman, et al., Biochemistry 12; 30 (45): 10832-10838 (1991); Smith, GP et al., Chem. Rev. 97: 391-410 (1997). Each round of immunopurification included: (a) binding of phage expression mutant CTLA-4 ECD polypeptides to hCD80-Ig or hCD86-Ig ligands; (b) unbound phage removal; (c) bound phage elution; and (d) eluted phage amplification for the next round of immunopurification. An aliquot of phage from each round was transduced into E. coli cells to obtain individual transducer colonies.
Identification of CTLA-4 mutants that have enhanced avidity for human CD80 and / or human CD86 for phage ELISA.
Individual colonies obtained from each round of immunopurification were inoculated in 96-well culture plates (NUNC; No. 243656) containing 150 μl / well of 2 x YT medium (yeast-triptone) containing 50 μg / ml carbenicillin and incubated at 250 rpm overnight at 37 ° C. The overnight cultures were used to inoculate blocks of deep wells (Scienceware; No. 378600001) containing 600 μl / well of the same medium. The cultures were incubated at 250 rpm for 2 h at 37 ° C, infected with collaborating phage M13K07 (multiplicity of infection (moi) 5-10) and then incubated at 250 rpm overnight at 37 ° C under dual selection for phagemid markers and collaborating phage (carbenicillin at 50 μg / ml and kanamycin at 70 μg / ml, respectively). The cultures were clarified by centrifugation at 4000 rpm for 20 min at 4 ° C in a Beckman GH 3.8 rotor. ELISA plates (NUNC; # 449824) were coated by adding 50 µl / well of PBS containing 10 µg / ml of hCD80-Ig or hCD86-Ig and incubated overnight at 4 ° C. The plates were washed three times with 200 µl / well of PBST and blocked by adding 200 µl / well of PBS containing 3% skimmed milk powder and incubation at RT for 1 hour (h). 25 µl / well of phage supernatants from the deep well block were transferred to ELISA plates containing 25 µl / well of 6% skimmed milk powder and the plates were incubated for 1 h at room temperature (RT). The plates were washed three times with 200 µl / well of PBST and incubated with 50 µl / well of anti-M13 monoclonal antibody conjugated with HRP (GE Healthcare, No. 27-9421-01) diluted at 1: 5000 in PBST containing 3% skimmed milk powder for 1 h at RT. The plates were washed three times with 200 µl / well of PBST and the signal was detected using a TMB substrate kit (Pierce; # 34021) according to conditions recommended by the manufacturer. Polypeptides of the mutant CTLA-4 ECD that showed increased binding avidity for human CD80 and / or human CD86 (as measured by an increased avidity for hCD80-Ig and / or hCD86-Ig), compared to the avidity of human CTLA-4 binding by human CD80 and / or human CD86 (as measured by the avidity of human CTLA-4 ECD binding by hCD80-Ig and / or hCD86-Ig), were selected for further analysis .
Example 3
Creation of an IgG2 Fc fusion protein vector.
A plasmid IgG2-Fc fusion protein expression vector was created to produce a fusion protein comprising a mutant CTLA-4 ECD polypeptide of the invention and human IgG2 Fc polypeptide. The DNA encoding the human IgG2 Fc polypeptide was generated by PCR amplification of human leukocyte cDNA (BD Biosciences, cat. No. HL4050AH) using direct primer (5'-AAGCTGTCACCGGTGGATCGATCCCGAACCCTGCCCTGATTCTGATGAGCGCAAATGTTGTGTCGAGTGCCCAC CGT-3 ') (SEQ ID NO: 189) and reverse primer (5'-CAGAATTCATTATTTACGGTCTTCTCGCGTG SEC3CG) Primers were designed, prepared and assembled using conventional techniques well known to those skilled in the art and included termination and initiation codons and restriction sites as necessary. The PCR amplification procedures employed are also well known in the art. See, for example, Berger, Ausubel and Sambrook, all above. 50-100 ng cDNA was used as a template in a 100 μl PCR reaction with 1 μM direct and reverse primers, Taq buffer (Stratagene; No. 200435) and 200 μM dNTP for 25 cycles of amplification (94 ° C, 30 s; 55 ° C , 30 s; 72 ° C, 60 s). The PCR product was purified by QiaQuick PCR centrifuge columns (Qiagen No. 28106) according to the conditions recommended by the manufacturer and digested with AgeI and EcoRI restriction enzymes. The PCR digestion fragment was separated by agarose gel electrophoresis and purified using the Qiaquick gel extraction kit (Qiagen, No. 28704) according to the conditions recommended by the manufacturer. A modified version of the pcDNA3.1-LEA vector (described above), which contained an AgeI restriction site in the signal sequence of CTLA-4 (introduced as a silent mutation), can be digested with AgeI and EcoRI and linked to the aforementioned fragment . The ligation is transformed into E. coli One-Shot TOP10 cells (Invitrogen Cat. No. C4040-03) according to the conditions recommended by the manufacturer. The transformed cells are incubated in LB (Luria broth medium) containing 50 μg / ml of carbenicillin at 250 rpm overnight at 37 ° C and then used to prepare a maxiprep broth (Qiagen; No. 12362) of plasmid DNA according to the conditions recommended by the manufacturer.
The resulting plasmid expression vector is designated the pcDNA IgG2 Fc fusion protein expression vector. This vector is identical to the mutant CTLA-4-IgG2 plasmid vector of pcDNA shown in Figure 1, except that the nucleic acid sequence encoding the mutant CTLA-4 ECD polypeptide is deleted. The nucleic acid sequence encoding the signal peptide in the pcDNA IgG2 Fc fusion vector (which in Figure 1 can be any nucleotide sequence encoding the appropriate signal peptide) is a nucleic acid encoding the signal peptide. Human CTLA-4 (SEQ ID NO: 181 or SEQ ID NO: 215). This IgG2 Fc fusion vector does not include any nucleic acid encoding a mutant CTLA-4 ECD polypeptide of the invention or any other CTLA-4 ECD polypeptide.
Cloning of nucleotide sequences encoding mutant CTLA-4 polypeptides in the IgG2 Fc fusion vector.
To produce mutant CTLA-4 polypeptides such as soluble Fc fusion proteins, DNA sequences encoding mutant CTLA-4 ECD polypeptides identified as having enhanced avidity for human CD80 and / or human CD86 (with respect to the avidity of ECD binding of human CTLA-4 by human CD80 and / or human CD86) from the phage library screening were each screened in the IgG2 Fc fusion protein vector described above using, for example, The following procedure.
DNA sequences encoding mutant CTLA-4 ECD polypeptides exhibiting greater avidity for hCD80-Ig and / or hCD86-Ig binding were first recovered from the phage expression vector by PCR amplification using direct and reverse primers designed based in sequence homology to several nucleotide residues (eg, 30-60 nucleotides) at the N and C ends of the mutant CTLA-4 ECD polypeptides and conventional procedures known in the art. See, for example, the procedures described in, for example, Berger, Ausubel and Sambrook, all above. For example, in an exemplary aspect, DNA sequences encoding mutant CTLA-4 ECD polypeptides were recovered from the phage expression vector by PCR amplification using direct primer (5'-GGAATACCGGTTTTTTGTAAAGCCATGCACGTCGCTCAACCAGCCGTCGTACTC-3 ') (SEC ID No.: 191) and reverse primer (5'-GGCACTCAGATCTACGTCATCGATCCCGAA-3 ') (SEQ ID NO: 192). 10 nanograms (ng) of plasmid DNA (phage expression vector containing a nucleotide sequence encoding mutant CTLA-4 ECD) was used as a template in a 100 μl PCR reaction with 1 μM direct and reverse primers described above, Taq buffer (Stratagene; No. 200435) and 200 µM dNTP for 25 cycles of amplification (94 ° C, 30 s; 55 ° C, 30 s; 72 ° C, 60 s). The PCR product was purified by QiaQuick PCR centrifuge columns (Qiagen No. 28106) according to the conditions recommended by the manufacturer and digested with AgeI and ClaI restriction enzymes. The fragments were separated by agarose gel electrophoresis, purified using the Qiaquick gel extraction kit (Qiagen, No. 28704) according to the conditions recommended by the manufacturer and ligated into similarly digested plasmid IgG2 Fc fusion vector. The ligation was transformed into E. coli One-shot TOP10 cells (Invitrogen Cat. No. C4040-03) according to the conditions recommended by the manufacturer. The transformed cells were incubated in LB (Luria broth medium) containing 50 μg / ml carbenicillin at 250 rpm overnight at 37 ° C and then used to prepare a maxiprep broth (Qiagen; No. 12362) of plasmid DNA according to the conditions recommended by the manufacturer.
The resulting plasmid expression vector, which comprises a nucleic acid encoding a mutant CTLA-4-IgG2 fusion protein, is designated the pcD mutant CTD-4 ECD IgG2 Fc plasmid expression vector. A schematic diagram of this vector is shown in Figure 1. This vector includes a Bla promoter; ampicillin resistance gene; pUC origin; SV40 polyadenylation signal sequence (poly A); origin f1; SV40 promoter; neomycin resistance gene; CMV promoter to facilitate the expression of a mutant CTLA-4-Ig fusion protein (comprising: for example, human CTLA-4 signal peptide, mutant CTLA-4 ECD polypeptide and human IgG2 Fc polypeptide); a nucleic acid sequence encoding a human CTLA-4 signal peptide (SEQ ID NO: 181 or SEQ ID NO: 215); a nucleic acid sequence encoding a mutant CTLA-4 ECD polypeptide (which includes, but is not limited to, for example, a nucleotide sequence encoding any one of SEQ ID NO: 80-152); an exemplary nucleic acid sequence encoding a human IgG2 Fc polypeptide is shown in SEQ ID NO: 183 or SEQ ID NO: 217; and a poly A termination signal sequence of bovine growth hormone (bGH). The nucleic acid sequence of SEQ ID NO: 183 encodes the hIgG2 Fc polypeptide with the lysine residue (K) of the C-terminus (SEQ ID NO: 184); the nucleic acid sequence of SEQ ID NO: 217 encodes the hIgG2 Fc polypeptide without the lysine residue of the C-terminus (SEQ ID NO: 218).
The plasmid IgG2 Fc fusion protein vector can also be used to produce a human CTLA-4-IgG2 ("hCTLA-4-Ig") fusion protein. In this case, a nucleic acid sequence encoding ECD of human CTLA-4 (eg, SEQ ID NO: 193) is cloned into the plasmid IgG2 Fc fusion protein vector using conventional cloning procedures similar to those described above instead of the nucleotide sequence encoding the mutant CTLA-4 ECD. The hCTLA-4-Ig fusion protein normally exists in solution as a dimeric fusion protein comprising two identical monomeric mature hCTLA-4-Ig fusion proteins. In this case, each monomeric mature hCTLA-4-Ig fusion protein comprises a human CTLA-4 ECD (SEQ ID NO: 159) fused at its C-terminus with the N-terminus of a human IgG2 Fc (SEQ ID NO: 218 or SEQ ID NO: 184). The two hCTLA-4-Ig monomers are covalently linked together by disulfide bonds formed between cysteine residues in each monomer, thus forming the hCTLA-4-Ig fusion protein dimer. The mature hCTLA-4-Ig fusion protein dimer is the form of the fusion protein used in the assays described in these examples, unless explicitly stated otherwise.
The present inventors have experimentally found that a human CTLA-4-Ig fusion protein or mutant CTLA-4-Ig fusion protein prepared in CHO cells by transfecting an expression vector comprising a nucleotide sequence encoding the hCTLA-fusion protein Mutant 4-Ig or CTLA-4-Ig and the hIgG2 Fc polypeptide shown in SEQ ID NO: 184 does not normally include the expected lysine (K) residue of the C-terminus, as determined by EM-CL analysis; therefore, the hcgG2 Fc sequence of polypeptides of a hCTLA-4-IgG2 or a mutant CTLA-4-IgG2 is that shown in SEQ ID NO: 218, in which the hIgG2 Fc polypeptide sequence does not normally include the lysine residue of the C-terminus with respect to the polypeptide sequence shown in SEQ ID NO: 184.
Transient transfection of COS cells.
80-90% confluence COS-7 cells were cultured in T-175 flasks containing 40 ml of growth medium (DMEM / F12 medium (Invitrogen, Cat. No. 10565-018) supplemented with 10% SBF (No. of cat. of Hyclone SV30014.03) and 1x PSG (penicillin, streptomycin and glutamine) (Invitrogen, cat. no. 10378-016)). Immediately before transfection of the cells with a plasmid expression vector, the medium was removed and replaced with 35 ml of expression medium (OptiMem medium (Gibco No. 51985) containing 1x PSG). Plasmid DNA (10 μg) (for example, an IgG2 Fc expression vector of the mutant CTLA-4 ECD of pcDNA encoding a mutant CTLA-4-IgG2 fusion protein) was mixed with FuGENE6 transfection reagent (Roche No. 11 815 075 001) in a 1: 3 volume ratio and added to 1 ml of growth medium. This mixture was then added slowly to the T-175 flask and gently rotated to mix. After incubation at 37 ° C for 3 days, the medium was collected, fresh expression medium was added and the cultures were incubated for an additional 3 d.
A similar procedure can be used to prepare COS-7 cells transfected with a similar plasmid vector encoding human CTLA-4-IgG2 or a pcDNA3.1-LEA plasmid vector encoding LEA29Y-Ig.
Protein Purification
Transfection culture supernatants (eg, comprising cells transfected with an IgG2 Fc vector of the mutant CTD-4 ECD of pcDNA encoding mutant CTLA-4-Ig fusion protein) were clarified by centrifugation at 1000xg for 10 min at RT and filtration through 0.2 μm membranes (Nalgene, VWR No. 73520-982). Proteins were purified by protein A affinity chromatography using an AKTA Explorer HPLC system (GE Healthcare). A mutant CTLA-4-Ig fusion protein bound to columns of FF Hitrap protein (GE Healthcare, No. 17-5079-01) in PBS buffer, washed with the same buffer, eluted with 100 mM citric acid buffer ( pH 4.0) and then neutralized by adding 1/10 volume of 2M Tris base. The buffer in the protein solution was finally exchanged to PBS by dialysis using 10 kDa MWCO membranes (Pierce, cat. no. PI66810).
A similar procedure can be used to purify human CTLA-4-IgG2 or LEA29Y-Ig fusion proteins.
Evaluation of protein equality.
SDS / PAGE analysis.
The apparent molecular weight (MW) of a purified mutant CTLA-4-Ig fusion protein was measured by SDS / PAGE analysis under non-reducing conditions. Under non-reducing conditions, a mutant CTLA-4-Ig fusion protein normally exists as a dimeric fusion protein comprising two monomeric mutant CTLA-4-Ig fusion proteins. In one aspect, the dimer is a homodimer comprising two identical mutant CTLA-4-Ig fusion protein monomers. In one aspect, each CTLA-4-Ig fusion protein monomer comprises a mature / secreted mutant CTLA-4 ECD fused at its C-terminus with the N-terminus of a human IgG2 Fc polypeptide. The two mutant CTLA-4-Ig monomers are covalently linked together by disulfide bonds formed between cysteine residues in each monomer. The homodimer is the form of the mutant fusion protein molecule normally described in these examples, unless explicitly stated otherwise. The data shown in these examples refer to mutant CTLA-4-Ig fusion protein homodimers, unless explicitly stated otherwise.
SDS / PAGE analyzes were performed as follows. 2 μg of purified protein was added to 20 μl of LDS sample buffer (Invitrogen No. NP0007) and executed by 4-12% of Bis-Tris NuPAGE gels (Invitrogen No. NP0321BOX) in 1x sodium MES-docecylsulfate electrophoresis buffer ( SDS) / PAGE (Invitrogen No. NP0002) following the conditions recommended by the manufacturer. The gels were stained by incubation in 50 ml of SimplyBlue SafeStain (Invitrogen No. LC6060) for 1 h with gentle stirring at RT. The gels were stained by two incubations with 200 ml of water for 1 h with gentle stirring at RT and processed in a drying buffer (Bio RAD 161-0752) according to the conditions recommended by the manufacturer.
An example SDS / PAGE gel representative of two homologous mutant CTLA-4-Ig fusion proteins (designated clones D3 and D4) and the Orencia® fusion protein, which serves as a comparative control, is presented in the Figure 3. The D3-Ig fusion protein dimer comprises two identical D3-Ig fusion protein monomers that are covalently linked by disulfide bonds formed between cysteine residues in each D3-Ig monomer. Each D3-Ig monomer comprises a mutant CTLA-4 ECD polypeptide (called "D3") comprising the polypeptide sequence shown in SEQ ID NO: 61 fused directly (ie, without amino acid residue (s) ) of the "linker") at its C-terminus to the N-terminus of the hIgG2 Fc polypeptide shown in SEQ ID NO: 218. The D4-Ig fusion protein dimer similarly comprises two identical D4-Ig monomers that are covalently linked by disulfide bonds formed between cysteine residues in each D3-Ig monomer. Each monomeric D4-IgG2 fusion protein comprises a mutant CTLA-4 ECD polypeptide (called "D4") comprising the polypeptide sequence shown in SEQ ID NO: 62 fused directly (ie, without amino acid residue (s) (s) of the "linker) at its C-terminus with the N-terminus of the hIgG2 polypeptide Fc sequence shown in SEQ ID NO: 218.
As explained above, the present inventors have experimentally found that a mutant CTLA-4-Ig fusion protein prepared in CHO cells using a vector comprising a nucleotide sequence encoding the predicted hIgG2 Fc polypeptide shown in SEQ ID NO. : 184 does not normally include the expected lysine (K) residue of the C-terminus, as determined by EM-CL analysis; therefore, the hcgG2 Fc sequence of polypeptides of a mutant CTLA-4-IgG2 described herein is that shown in SEQ ID NO: 218, whose hcg2 Fc polypeptide sequence does not normally include the lysine residue of the end C, with respect to the polypeptide sequence shown in SEQ ID NO: 184.
SDS / PAGE analyzes were performed on all protein preparations to verify protein quality in terms of apparent molecular weight, protein concentration and purity. The results of the SDS / PAGE analyzes were similar for all protein preparations. Of the exemplary gel results shown in Figure 3, the purified D3-IgG2 and D4-IgG2 fusion protein dimers have an apparent MW of approximately 80 kDa, which is in accordance with the expected MW of the structure of the exemplary homodimeric mutant CTLA-4-IgG2 fusion protein depicted in Figure 10 (expected MW = 7879 kDa). (Purified mutant CTLA-4-IgG2 protein monomers normally have apparent MW of 39-40 kDa). The protein bands in the gel shown in Figure 3 have been stained with equivalent intensities; This confirms the accuracy of measuring the protein concentration for different samples. As for the purity of the proteins, a lower MW band can be observed in Figure 3 at an apparent MW of approximately 44 kDa, which is in accordance with the expected MW of a monomeric IgG2 fusion protein. The relative intensity of this lower MW band is consistently low and is estimated to be less than 5% of the total protein.
Analog SDS / PAGE analyzes can be used to evaluate the purity of human CTLA-4-IgG2 or LEA29Y-Ig fusion proteins produced using procedures similar to those described above.
Endotoxin analysis.
Endotoxin levels of mutant CTLA-4 fusion proteins were measured using a Limulus QCL-1000 amebocyte lysate assay kit (Cambrex No. 50-648U) following the conditions recommended by the manufacturer. The maximum endotoxin level for proteins used in cell-based assays was set at 10 units of endotoxin (EU) / mg protein.
Analogous analyzes can be used to measure the endotoxin levels of human CTLA-4-IgG2 or LEA29Y-Ig protein preparations.
Size exclusion chromatography (CET) analysis.
Protein aggregation levels (including aggregation levels of mutant CTLA-4 polypeptides and control polypeptides) were measured by size exclusion chromatography using a Dionex BioLC system (Dionex). The protein (5 μg) was run by a Tosoh G3000Wx1 column (Tosoh Bioscience) in PBS electrophoresis buffer using 20 min isocratic execution and absorbance detection (A) at 214 nanometers (nm). The maximum level of aggregation for protein used in subsequent tests was set at 10%.
CET analysis was performed on all protein preparations to verify protein quality in terms of levels of protein aggregation. The results were similar for all protein preparations and an elution profile representative of a CET analysis of a mutant CTLA-4-Ig fusion protein dimer (D3-Ig) is shown in Figure 4. The axis and sample milliabsorbance units (UmA); The x axis shows elution time in minutes. The structure of the D3-Ig dimer is explained above in the "SDS / PAGE Analysis" section. This purified mutant CTLA-4-Ig dimer is broadly homogeneous in size and does not contain high levels of aggregate species. Other mutant CTLA-4-Ig fusion proteins were similarly analyzed and showed similar results (data not shown). Purified mutant CTLA-4-Ig fusion proteins were found to be homogeneous in size and did not contain high levels (> 10%) of aggregate proteins. It is important to verify the aggregation states of purified mutant CTLA-4-Ig fusion proteins because highly aggregated mutant CTLA-4-Ig fusion proteins can more avidly bind to human CD80 and / or human CD86 molecules and , therefore, they can present greater biological activity.
Example 4
Measurement of binding avidity of mutant CTLA-4-Ig fusion proteins by human CD80-murine Ig (hCD80-mIg) and human CD86-murine Ig (hCD86-mIg) fusion proteins using surface plasmon resonance (SPR) (analysis) Biacore ™).
This example describes a procedure for screening mutant CTLA-4-Ig fusion proteins for enhanced binding avidity for hCD80-mIg and / or hCD86-mIg ligands using a Biacore interaction analysis. In the nomenclature used to describe this type of analysis, the immobilized binding component is called the "ligand" and the binding component in the mobile phase is called the "analyte." Fusion proteins that contain an Ig domain typically form dimeric structures in solution by virtue of the strong association between two Ig domains. Unless otherwise indicated, such dimeric conformations are expected to exist for the fusion proteins described in this example (ie, mutant CTLA-4-Ig, Orencia® fusion protein, LEA29Y-Ig, hCD80-mlg and hCD86 -mIg). The term "avidity" normally refers to the binding strength between dimeric analytes (eg, mutant CTLA-4-Ig fusion proteins) and dimeric ligands (eg, hCD80-mIg or hCD86-mIg fusion proteins). The increases in binding avidity described for mutant CTLA-4-Ig fusion proteins result from increases in binding affinity between each CTLA-4 ECD domain and its corresponding ligand. The intensity of binding avidity is normally described in terms of the equilibrium dissociation constant (KD), which describes the analyte molar concentration at which 50% of the available ligand is bound in equilibrium.
In this screening procedure, Biacore sensor chips were derivatized with hCD80-mIg or hCD86-mIg ligands and buffer-mutant CTLA-4-Ig fusion proteins were allowed to flow over the ligand-coated sensor chips. The ability of a mutant CTLA-4-Ig fusion protein molecule to bind to a specific binding component (ie, hCD80-mIg or hCD86-mIg) was evaluated. Control fusion proteins (ie, human CTLA-4-IgG2 fusion protein, Orencia® fusion protein and mutant LEA29Y-Ig fusion protein) were also allowed to flow over ligand-coated sensor chips and capacities of these molecules to bind to hCD80-mIg or hCD86-mIg were similarly evaluated for comparison. Using the Biacore system, the association rate (kas) and dissociation (kdis) constant of a protein of interest that binds to hCD80-mIg or hCD86-mIg ligands can be evaluated and used to calculate the equilibrium dissociation constant, KD The human CTLA-4-IgG2 fusion protein, which comprises polypeptide of the human CTLA-4 WT ECD fused with the human IgG2 polypeptide, can serve as a "control" of natural human CTLA-4-Ig. In addition, or alternatively, because the Orencia® fusion protein is composed of the WT human CTLA-4 ECD polypeptide fused with a modified IgG1 Fc polypeptide, it also effectively serves control of natural human CTLA4-Ig for purposes. comparatives Mutant CTLA-4-Ig fusion proteins were identified that have increased binding avidity for hCD80-mIg and / or hCD86-mIg, compared to human CTLA-4-IgG2, Orencia® fusion protein and / or LEA29Y- Ig. As discussed in greater detail below, the increased avidity of binding of a mutant CTLA-4-Ig fusion protein by hCD80-mIg and / or hCD86-mIg, with respect to the binding avidity of the fusion protein Orencia® (ie hCTLA-4-IgG1) and / or LEA29Y-Ig by hCD80-mIg and / or hCD86-mIg, was not due to differences between IgG2 present in mutant CTLA-4-Ig molecules and IgG1 mutant present in the Orencia® or LEA29Y-Ig molecules.
All Biacore ™ analyzes were performed in a Biacore ™ 2000 system (GE Healthcare) at room temperature (TA, 25 ° C). HBS-EP buffer (10 mM HEPES (pH 7.4), 150 mM NaCl, 3 mM EDTA, 0.005% P20 surfactant) was used as a flow buffer for all experiments.
Conventional Kinetic Assay
The conventional kinetic assay measures the binding kinetics of the dimeric ligand (for example, hCD80-mIg fusion protein or hCD86-mIg fusion protein) coated on sensor chips and dimeric analytes (for example, CTLA-4-Ig fusion proteins mutants of the invention) in the mobile phase. Rabbit antibody directed against mouse IgG (GE Healthcare, No. BR-1005-14) was immobilized on CM5 sensor chips (GE Healthcare, No. BR-1000-14) according to the manufacturer's protocol. The antibody was diluted to 30 μg / ml in immobilization buffer (10 mM sodium acetate, pH 5.0 (BR-1003-51)). At a flow rate of 5 μl / minute, the CM5 sensor chip was activated with a 35 μl injection of a mixture of 1-ethyl-3- [3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) (prepared by mixing equal volumes of 11.5 mg / ml of EDC and 75 mg / ml of NHS) (GE Healthcare, No. BR-1000-50), followed by an injection of 35 μl of undiluted antibody. Unreacted sites were inactivated with 35 μl of 1 M ethanolamine-HCl, pH 8.5 (GE Healthcare, No. BR-1000-50). This procedure normally gave 15,000 response units (UR) of coupled antibody. Ligands of human CTLA-4 CD80-murine Ig (hCD80-mIg) (Ancell, No. 510-820) or human CD86-murine Ig (hCD86-mIg) (Ancell, No. 509-820) bound to coated sensor chips of antibody by injection of 10 μl or 16 μl, respectively, of ligand solution (2 μg / ml protein in HBS-EP buffer [10 mM HEPES at pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.005% ( v / v) of surfactant P-20, GE Healthcare, No. BR-1001-88]) at a flow rate of 10 μl / min. Ligand capture levels were normally 135-170 UR. The mutant CTLA-4-Ig proteins were diluted in HBS-EP buffer and flowed onto ligand coated sensor chips for 2 min at 30 µl / min, followed by 5 min incubation with HBS-EP buffer containing no protein at Same flow rate. For mutant CTLA-4-Ig fusion proteins that have very slow dissociation rates of hCD86-mIg, kinetic assays were also performed using longer dissociation times (eg, 20 min). Rmax signal levels for mutant CTLA-4-Ig proteins ranged from approximately 70-100 UR. The regeneration between cycles was carried out by incubation of 3 min with 10 mM glycine buffer (pH 1.7) at 50 μl / min. New chips were subjected to 4-5 capture / binding / regeneration cycles before use in real experiments. Data from a reference cell containing rabbit capture antibody directed against mouse IgG was only subtracted from data obtained from flow cells containing hCD80-mIg or hCD86-mIg captured. Normally 8 dilutions of mutant CTLA-4-Ig proteins ranging from 500 nM to 0.2 nM were analyzed against a blank reference (HBS-EP buffer alone).
The sensogram strokes of a typical Biacore analysis are shown in Figure 5. This figure shows the response (UR) with the time (in seconds (s)) generated by the union of the following three fusion proteins with the fusion protein hCD86-mIg: (1) Orencia® fusion protein (which serves as a control and for comparison) (Bristol-Myers Squibb Co .; see, for example, Larson CP et al., Am. J. Trans. 5: 443-453 (2005)); (2) LEA29Y-Ig fusion protein (for comparison); and (3) an exemplary mutant CTLA-4-Ig fusion protein designated "clone D3" (also called D3-IgG2). The D3-IgG2 fusion protein comprises two identical monomeric fusion proteins that are covalently linked together by one or more disulfide bonds formed between cysteine residues in each monomer. See the discussion in the “SDS / PAGE Analysis” section above. Each monomeric fusion protein comprises a mature mutant CTLA-4 ECD polypeptide shown in SEQ ID NO: 159 covalently fused at its C-terminus with the N-terminus of the human IgG2 polypeptide shown in SEQ ID NO: 184 or 218. Other dimeric fusion proteins may comprise structures similar to those of the dimeric D3-IgG2 fusion protein - except that the D3 mutant CTLA-4 ECD polypeptide of each monomeric fusion protein is replaced by a CTLA- ECD polypeptide. 4 different mutant.
The association phase reflects the union between the analyte of interest and the ligand of interest. In Figure 5, the association phase for each analyte is represented by the curve at times prior to the time marked by the arrow and is characterized by the binding of the analyte (D3-IgG2, Orencia® fusion protein or LEA29Y-Ig) to the ligand hCD86-mIg. The rate at which an analyte is associated with the hCD86-mIg ligand is reflected in the curve - see, for example, the sharp rate of increase in response units starting at approximately 510 seconds.
The dissociation phase of the analysis begins at the time marked by the arrow in Figure 5. During the dissociation phase, the analyte and ligand dissociate from their bound conformation. In Figure 5, the rate at which an analyte dissociates from the hCD86-mIg ligand is represented by the decrease in response units (rate of decrease in response units over time). Based on this data, the relative dissociation rate constant ("dis", kdis or kd speeds) and the association speed constants ("as", kas, or ka speeds) can be determined. The total avidity of the interaction can be described by KD, (kdis) / (kas). The increase in avidity of union often manifests itself in slower dissociation rates. If the slower dissociation rate is accompanied by an equal, greater or marginally slower association speed, so that the calculated equilibrium dissociation constant KD is lower, the avidity will be greater. In this case, a mutant CTLA-4-Ig fusion protein that has a binding avidity for the hCD86-mIg ligand that is greater than the binding avidity of the Orencia® fusion protein for the same ligand will also have a constant of slower dissociation of the ligand than the Orencia® protein. A mutant CTLA-4-Ig fusion protein that has a binding avidity for the hCD86-mIg ligand that is greater than the binding avidity of LEA29Y-Ig for the same ligand will also have a slower dissociation constant of the ligand than LEA29Y -Ig.
Figure 5 shows that the dissociation rate of LEA29Y-Ig of the hCD86-mIg ligand is significantly slower than the dissociation rate of the Orencia® protein from the same ligand. LEA29Y-Ig also has an association rate to bind to hCD86-mIg similar to that observed for the Orencia® fusion protein. Therefore, LEA29Y-Ig has a greater avidity for hCD86-mIg than the Orencia® protein. This finding is in agreement with previous studies describing LEA29Y-Ig as having a greater avidity for the hCD86-mIg ligand than the Orencia® fusion protein (Larson CP et al., Am. J. Trans. 5: 443 -453 (2005)). Figure 5 also shows that the mutant D3-IgG2 fusion protein has a slower dissociation rate of the hCD86mIg ligand than both the Orencia® and LEA29Y-Ig fusion protein. The D3-IgG2 fusion protein also has a similar (but somewhat faster) association rate to bind the hCD86-mIg ligand compared to the association rates of both the Orencia® and LEA29Y-Ig fusion proteins for the hCD86 ligand. -mIg. Therefore, the D3-IgG2 fusion protein has a greater avidity for binding by the hCD86-mIg ligand than both the Orencia® and LEA29Y-Ig fusion protein. Therefore, the D3-IgG2 fusion protein is expected to bind to native CD86 which includes, for example, CD86 as expressed in vivo on APC in mammals such as humans, with greater avidity for binding. This view is further supported by the functional cell-based assays discussed in the examples below.
Biacore analyzes were performed using other mutant CTLA-4-Ig fusion proteins. In addition, Biacore analyzes were performed using sensor chips coated with hCD80-mIg and mutant CTLA-4-Ig fusion proteins. The dissociation rates and binding avidities of these mutant molecules were determined and compared with the dissociation rates and binding avidities of the Orencia® and LEA29Y-Ig fusion proteins. Representative results are shown in Tables 3 and 4 and are discussed in more detail below.
Analysis of conventional Biacore data.
After deletion of the regeneration and capture portions of the sensograms, the curves were zeroed in an average of 5 s of all the curves approximately 10 s before the sample injection. A white curve was subtracted from each test curve. The data was analyzed by the BIAevaluation software (v4.1, available from GE Healthcare) using the “Kinetic adjustment, ka / kd simultaneous” function. The injection start time was defined as a moment before the association phase in which all the curves were close to zero. The selection of data for the association phase began approximately 10 s after the start time of the injection and ended approximately 10 s before the end time of the injection. The injection termination time was defined as a moment before the appearance of any signal tip associated with the dissociation phase. The dissociation phase was selected to begin 10 s after the injection termination time and included 280-295 s of the 5 min dissociation phase. The Langmuir 1: 1 model describes reaction A + B <=> AB. This model represents the binding of a single ligand to a single protein of interest (eg, receptor). The Langmuir 1: 1 model of the BIAevaluation software was used to determine the association rate constant (ka) and the dissociation rate constant (kd) and to calculate the equilibrium dissociation constant, KD. KD = kd / ka. KD = ([A] · [B]) / [AB]. The equilibrium dissociation constant, KD, is equal to the inverse of the equilibrium association constant, KA. KD = 1 / KA. The speed equations for the reaction (analyte A plus ligand B giving complex AB), in which A = injected analyte, B = free ligand and t = time, are: d [B] / dt = - (ka [A] [ B] -kd [AB]) and d [AB] / dt = ka [A] [B] -kd [AB]. Substituting R, the Biacore response units (UR) at a given time, for [AB], Rmax-R for [B], and C (analyte concentration) for [A], the expression of the net velocity in units of Biacore is dR / dt = kaC (Rmax-R) -kdR, where R a t0 = 0, B [0] = Rmax, and AB [0] = 0 UR, with the total response = [AB] + RI The mass shift (RI) was set to zero, and Rmax, ka and kd were adjusted globally for all curves.
Conventional kinetic assays and data analyzes described above were performed in protein preparations of the mutant CTLA-4-Ig fusion protein, in addition to the LEA29Y-Ig and Orencia® fusion proteins. Tables 3 and 4 summarize the binding data for representative mutant CTLA-4-Ig fusion proteins.
Table 3 shows avidity of binding of representative mutant CTLA-4-Ig fusion proteins by hCD86-mIg, as measured by the conventional Biacore assay described above. Specifically, Table 3 shows the name of each mutant CTLA-4Ig fusion protein; the sequence identification number (SEQ ID NO.) corresponding to the monomeric mutant CTLA-4 ECD fusion protein polypeptide sequence; the equilibrium dissociation constant (KD (molar (M)) determined based on the avidity of binding of the mutant protein by hCD86-mIg; and the binding avidity of each mutant CTLA-4-Ig by hCD86-mIg with respect to the binding avidity of the Orencia® fusion protein by hCD86-mIg. This relative binding avidity (shown in the far-light column) is shown as an improvement in times in the binding avidity of the mutant fusion protein by hCD86-mIg compared to the binding avidity of the Orencia® fusion protein by hCD86-mIg. Each mutant CTLA-4-Ig fusion protein in Table 3 normally exists in solution as a dimeric fusion protein comprising two identical monomeric fusion proteins, wherein each monomeric protein comprises a mutant CTLA-4 ECD polypeptide ( for example, called D1, D1T, D2, D3, D4, etc.) fused directly at its C-terminus with the N-terminus of an IgG2 Fc polypeptide comprising the sequence of SEQ ID NO: 184 or 218. Each of such dimeric mutant CTLA-4-Ig can be prepared using conventional techniques known in the art. Alternatively, each such dimeric mutant CTLA-4-Ig fusion protein dimer can be prepared using methods set forth in Example 3 above. Briefly, a nucleic acid sequence encoding a particular mutant CTLA-4 ECD identified in Table 3 (for example, a nucleic acid sequence encoding a mutant CTLA-4 ECD polypeptide sequence identified in Table 3) it can be cloned into the IgG2 Fc fusion vector, mammalian cells can be transfected with the vector and the resulting fusion protein can be expressed, purified and evaluated as described in Example 3. An exemplary nucleic acid sequence for each ECLA of mutant CTLA-4 is presented in the Sequence Listing included herein. The Orencia® fusion protein, which comprises two monomeric fusion proteins, each monomeric fusion protein comprising a natural human CTLA-4 ECD fused with a modified IgG1 Fc, serves as a reference, that is, with the hunger for hCD86 binding -mIg set to 1. The KD values for the LEA29Y-Ig fusion protein and the
fusion protein CTLA-4 human-Ig. In addition, the improvement in times in the avidity of hCD86-mIg of LEA29Y-Ig in comparison with the avidity of hCD86-mIg of the Orencia® protein is also shown. The avidity of binding of the CTLA-4-IgG2 and Orencia® fusion proteins by hCD86-mIg are approximately equal, confirming that the differences between the human IgG2 polypeptide present in human CTLA-4-IgG2 and the modified IgG1 present in the Orencia® protein contributes little, if anything, to the respective hCD86mIg binding affinities of these molecules. As discussed in greater detail in Example 5 below, the present inventors have confirmed that differences in immunosuppressive functional activities between mutant CTLA-4-Ig polypeptides and Orencia® protein (or LEA29Y-Ig) cannot be attributed to their respective Ig Fc regions comprising different IgG isotypes.
As shown in Table 3, representative mutant CTLA-4-Ig fusion proteins have hunger avidities for hCD86-mIg that are: (1) at least approximately equal to or greater than the human avidity of CTLA-4-IgG2 binding ("HCTLA-4-IgG2") (comprising two covalently linked monomeric fusion proteins, each of such monomeric proteins comprising the human CTLA-4 ECD polypeptide fused with an IgG2 Fc polypeptide); (2) at least approximately equal to or greater than the binding avidity of the Orencia® protein by the hCD86-mIg ligand; and / or (3) at least approximately equal to or greater than the avidity of LEA29Y-Ig binding by the hCD86-mIg ligand. The improvement in the binding avidity of the hCD86mIg ligand with respect to the binding avidity of the Orencia® protein by hCD86-mlg is indicated for each mutant of CTLA-4-Ig (4th column in Table 3).
It was found that most of the mutant CTLA-4-Ig fusion proteins had a dissociation rate of the hCD86-mIg fusion protein that was slower than the dissociation rate of the Orencia® fusion protein of hCD86-mIg ( data not revealed). It was found that several mutant CTLA-4-Ig fusion proteins had an association rate for hCD86-mIg greater than the association rate of the Orencia® fusion protein for the same ligand (data not shown).
All mutant CTLA-4-Ig fusion proteins shown in Table 3 had equilibrium dissociation constants (KD) of hCD86-mIg that were slower than the equilibrium dissociation constant of hCD86-mIg of the CTLA fusion protein -4 human-IgG2 or Orencia®. In addition, most of the mutant CTLA-4-Ig fusion proteins shown in Table 3 had equilibrium dissociation constants of hCD86-mIg that were slower than the equilibrium constant of hCD86-mIg of LEA29Y-Ig.
All mutant CTLA-4-Ig fusion proteins shown in Table 3 had avidity for hCD86mIg binding that were greater than the human avidity for human CTLA-4-IgG2 or Orencia® fusion protein for hCD86-mIg (the Improvement in times calculated in the avidity of hCD86-mIg binding with respect to the Orencia® fusion protein is shown in the 4th column of Table 3). In addition, many of the mutant CTLA-4-Ig fusion proteins shown in Table 3 had avidity for hCD86-mIg binding that were greater than the avidity for LEA29Y-Ig binding for hCD86-mIg (4th column of table 3) .
A mutant CTLA-4-Ig of the invention that has a greater avidity for binding by the hCD86-mIg ligand than the Orencia® or LEA29Y-Ig fusion protein will likely have a high immunosuppressive potency in vivo compared to the hCTLA fusion protein. -4-IgG2, Orencia® or LEA29Y-Ig, respectively, such as in, for example, therapeutic and / or prophylactic procedures to suppress an immune response in a subject (e.g., in the in vivo treatment of diseases or disorders of the mammalian immune system such as, for example, humans, in which immunoinhibition or immunosuppression is desired), procedures to inhibit the rejection of a donor tissue or organ transplant by a receptor (for example, by a mammal such as, for example, a human being) and other methods described elsewhere herein.
Table 3. (continued) (continued) 5
<dl><dt>Fusion protein (dimer) </dt><dd>SEQ ID NO * (eg, from mutant CTLA-4 ECD) HCD86mIg KD (M) Avidity of hCD86-mIg binding (with respect to the Orencia® fusion protein dimer) </dd></dl>
<dl><dt>Human CTLA-4-IgG2 </dt><dd>162 3.95 x 10-9 1.32x </dd></dl>
<dl><dt>Orencia® fusion protein dimer </dt><dd>164 5.23x10-9 1 </dd></dl>
<dl><dt>LEA29Y-Ig </dt><dd>166 1.05 x 10-9 -5.23 x 10-10 5x -10x </dd></dl>
<dl><dt>D1-IgG2 </dt><dd>58 2.65 x 10-9 -5.23 x 10-10 2x -10x </dd></dl>
<dl><dt>D1T-IgG2 </dt><dd>59 5.23 x 10-10 -2.62 x 10-10 10x -20x </dd></dl>
<dl><dt>Fusion protein (dimer) </dt><dd>SEQ ID NO * (eg, from mutant CTLA-4 ECD) HCD86mIg KD (M) Avidity of hCD86-mIg binding (with respect to the Orencia® fusion protein dimer) </dd></dl>
<dl><dt>D2-IgG2 </dt><dd>60 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-IgG2 </dt><dd>61 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D4-IgG2 </dt><dd>62 2.65 x 10-9 -5.23 x 10-10 2x -10x </dd></dl>
<dl><dt>D5-IgG2 </dt><dd>63 2.65 x 10-9 -5.23 x 10-10 2x -10x </dd></dl>
<dl><dt>D6-IgG2 </dt><dd>64 2.65 x 10-9 -5.23 x 10-10 2x -10x </dd></dl>
<dl><dt>D20-IgG2 </dt><dd>65 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D21-IgG2 </dt><dd>66 2.62 x 10-10-1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D23-IgG2 </dt><dd>67 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D24-IgG2 </dt><dd>68 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D26-IgG2 </dt><dd>69 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D27-IgG2 </dt><dd>70 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D28-IgG2 </dt><dd>71 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D29-IgG2 </dt><dd>72 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D31-IgG2 </dt><dd>73 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-1-IgG2 </dt><dd>1 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-2-IgG2 </dt><dd>two 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-3-IgG2 </dt><dd>3 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-4-IgG2 </dt><dd>4 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-5-IgG2 </dt><dd>5 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-6-IgG2 </dt><dd>6 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-7-IgG2 </dt><dd>7 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-8-IgG2 </dt><dd>8 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-9-IgG2 </dt><dd>9 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-11-IgG2 </dt><dd>10 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-12-IgG2 </dt><dd>eleven <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-14-IgG2 </dt><dd>12 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-15-IgG2 </dt><dd>13 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-16-IgG2 </dt><dd>14 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-17-IgG2 </dt><dd>fifteen <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-19-IgG2 </dt><dd>16 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-20-IgG2 </dt><dd>17 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>Fusion protein (dimer) </dt><dd>SEQ ID NO * (eg, from mutant CTLA-4 ECD) HCD86mIg KD (M) Avidity of hCD86-mIg binding (with respect to the Orencia® fusion protein dimer) </dd></dl>
<dl><dt>I D3-21-IgG2 </dt><dd>18 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-22-IgG2 </dt><dd>19 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-23-IgG2 </dt><dd>twenty 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-24-IgG2 </dt><dd>twenty-one 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-25-IgG2 </dt><dd>22 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-26-IgG2 </dt><dd>2. 3 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-27-IgG2 </dt><dd>24 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-28-IgG2 </dt><dd>25 5.23 x 10-10 -2.62 x 10-10 10x -20x </dd></dl>
<dl><dt>D3-29-IgG2 </dt><dd>26 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-30-IgG2 </dt><dd>27 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-31-IgG2 </dt><dd>28 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-32-IgG2 </dt><dd>29 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-33-IgG2 </dt><dd>30 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-34-IgG2 </dt><dd>31 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-39-IgG2 </dt><dd>32 5.23 x 10-10 -2.62 x 10-10 10x -20x </dd></dl>
<dl><dt>D3-50-IgG2 </dt><dd>33 2.62 x 10-10 -1.31 x 10-10 20x -40x </dd></dl>
<dl><dt>D3-52-IgG2 </dt><dd>3. 4 5.23 x 10-10 -2.62 x 10-10 10x -20x </dd></dl>
<dl><dt>D3-53-IgG2 </dt><dd>35 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-54-IgG2 </dt><dd>36 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-56-IgG2 </dt><dd>38 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-62-IgG2 </dt><dd>44 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-65-IgG2 </dt><dd>47 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-66-IgG2 </dt><dd>48 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-69-IgG2 </dt><dd>fifty <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-70-IgG2 </dt><dd>51 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-71-IgG2 </dt><dd>52 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-72-IgG2 </dt><dd>53 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-73-IgG2 </dt><dd>54 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-74-Ig G2</dt><dd>55 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-75-IgG2 </dt><dd>56 <1.31 x 10-10 > 40x </dd></dl>
<dl><dt>D3-76-IgG2 </dt><dd>57 <1.31 x 10-10 > 40x </dd></dl>
40 (continuation)
<dl><dt>Fusion protein (dimer) </dt><dd>SEQ ID NO * (eg, from mutant CTLA-4 ECD) HCD86mIg KD (M) Avidity of hCD86-mIg binding (with respect to the Orencia® fusion protein dimer) </dd></dl>
<dl><dt>* Note: The sequence identification numbers (SEQ ID NO.) Shown in Table 3 for the human CTLA-4-IgG2, Orencia® and LEA29Y-Ig fusion proteins are those of the polypeptide sequences of these fusion proteins of Ig, respectively. SEQ ID NO. Shown in Table 3 for each mutant CTLA-4-Ig fusion protein identifies the mutant CTLA-4-ECD polypeptide sequence of the identified mutant CTLA-4-Ig fusion protein. The data refers to a mutant CTLA-4-Ig comprising a mutant CTLA-4 ECD (eg, any of SEQ ID NO: 1-48 and 58-73) fused at its N-terminus with the C-terminus of the polypeptide of the IgG2 Fc shown in SEQ ID NO: 184 or 218. Methods for the preparation of such fusion proteins are known in the art and are described herein. However, as noted above, the present inventors have experimentally found that a mutant CTLA-4-Ig prepared in CHO cells using a vector comprising a nucleotide sequence encoding the predicted hIgG2 Fc polypeptide shown in SEQ ID NO: 184 does not normally include the lysine residue (K) provided at end C; therefore, the hgG2 Fc polypeptide sequence of a mutant CTLA-4-IgG2 is that shown in SEQ ID NO: 218, whose hIgG2 Fc polypeptide sequence does not include the C-terminal lysine residue with respect to sequence shown in SEQ ID NO: 184. Exemplary fusion protein sequences that do not include the lysine residue of the C-terminus are shown in SEQ ID NO: 205-214, 219 and 221. </dt><dd /></dl>
Table 4 shows avidity of binding of mutant CTLA-4-Ig fusion proteins by hCD80-mIg, as measured by the conventional Biacore assay. Specifically, Table 4 shows the name of the clone of a mutant CTLA-4-Ig fusion protein; the sequence identification number (SEQ ID NO.) corresponding to the monomeric mutant CTLA-4 ECD fusion protein polypeptide sequence; equilibrium dissociation constant (KD (molar (M)) for hCD80-mIg ligand binding avidity test; and the binding avidity of the mutant CTLA-4-Ig fusion protein by the hCD80-mIg ligand with respect to the binding avidity of the Orencia® fusion protein by the same ligand. For each mutant protein, the improvement in binding avidity for the hCD80-mIg ligand in comparison to the binding avidity of the Orencia® fusion protein for the hCD80-mIg ligand is shown (4th column in Table 4). The Orencia® fusion protein serves as a reference, that is, with the hunger for binding by hCD80-mIg set to 1. Mutant CTLA-4-Ig fusion proteins normally exist as dimeric fusion proteins in solution. As shown in Table 4, the dimeric mutant CTLA-4-Ig fusion proteins disclosed herein have avidity for binding by the hCD80-mIg ligand which are: (1) at least approximately equal to or greater than the avidity of binding of human CTLA-4-IgG2; (2) at least approximately equal to or greater than the binding avidity of the Orencia® fusion protein for the hCD80-mIg ligand; and / or (3) at least approximately equal to or greater than the avidity of LEA29Y-Ig binding by the hCD80-mIg ligand. As discussed above, each dimeric mutant CTLA-4-Ig dimer can be prepared using procedures set forth in Example 3 above.
Several mutant CTLA-4-Ig fusion proteins were found to have a dissociation rate of the hCD80-mIg fusion protein that was approximately equal to or greater than the dissociation rate of the Orencia® fusion protein of the same ligand (data not shown). It was found that some mutant CTLA-4-Ig fusion proteins had an association rate for hCD80-mIg approximately equal to or greater than the association rate of the Orencia® fusion protein for the same ligand (data not shown).
Many mutant CTLA-4-Ig fusion proteins shown in Table 4 had equilibrium dissociation constants for hCD80-mIg (KD) that were slower than the equilibrium dissociation constant for hCD80-mIg of the CTLA- fusion protein 4 human-IgG2 or Orencia®. In addition, several mutant CTLA-4-Ig fusion proteins shown in Table 4 had equilibrium dissociation constants for hCD80-mIg that were at least approximately equal to the equilibrium constant of hCD80-mIg of LEA29Y-Ig.
Many mutant CTLA-4-Ig fusion proteins shown in Table 4 had avidity for hCD80-mIg binding that were greater than the binding avidity of the human CTLA-4-IgG2 or Orencia® fusion protein for the same ligand ( the improvement in hunger binding times by hCD80-mIg with respect to the Orencia® fusion protein is shown in the 4th column). Additionally, several mutant CTLA-4-Ig fusion proteins shown in Table 4 had avidity for hCD80-mIg binding that were at least approximately equal to the avidity of LEA29Y-Ig binding for the same ligand.
A mutant CTLA-4-Ig as disclosed herein that has a greater avidity for hCD80-mIg binding than the hCTLA-4-IgG1, Orencia® or LEA29Y-Ig fusion protein will likely have an increased immunosuppressive potency. in vivo compared to the hCTLA-4-IgG2, Orencia® or LEA29Y-Ig fusion protein, respectively, such as in, for example, therapeutic and / or prophylactic procedures for suppressing an immune response in a subject (e.g., in the in vivo treatment of diseases or disorders of the mammalian immune system such as, for example, humans, in which immunoinhibition or immunosuppression is desired), procedures to inhibit the rejection of a donor tissue or organ transplant by a receptor (for example, by a mammal such as, for example, a human being) and other methods described elsewhere herein.
Table 4
<dl><dt>Fusion protein (dimer) </dt><dd>SEQ ID NO * (eg, from mutant CTLA-4 ECD) HCD80mIg KD (M) Avidity of hCD80-mIg binding (with respect to the Orencia® fusion protein dimer) </dd></dl>
<dl><dt>hCTLA-4-IgG2 </dt><dd>162 6.55 x 10-10 1.34x </dd></dl>
<dl><dt>Orencia® fusion protein dimer </dt><dd>164 8.77 x 10-10 1 </dd></dl>
<dl><dt>LEA29Y-Ig </dt><dd>166 4.39 x 10-10 -2.19 x 10-10 2x -4x </dd></dl>
<dl><dt>D1-IgG2 </dt><dd>58 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D1T-IgG2 </dt><dd>59 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D2-IgG2 </dt><dd>60 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-IgG2 </dt><dd>61 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D4-IgG2 </dt><dd>62 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D5-IgG2 </dt><dd>63 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D6-IgG2 </dt><dd>64 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D20-IgG2 </dt><dd>65 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D21-IgG2 </dt><dd>66 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D23-IgG2 </dt><dd>67 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D24-IgG2 </dt><dd>68 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D26-IgG2 </dt><dd>69 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D27-IgG2 </dt><dd>70 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D28-IgG2 </dt><dd>71 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D29-IgG2 </dt><dd>72 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D31-IgG2 </dt><dd>73 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-1-IgG2 </dt><dd>1 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-2-IgG2 </dt><dd>two 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-3-IgG2 </dt><dd>3 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-4-IgG2 </dt><dd>4 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-5-IgG2 </dt><dd>5 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-6-IgG2 </dt><dd>6 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-7-IgG2 </dt><dd>7 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
(continued) (continued)
<dl><dt>Fusion protein (dimer) </dt><dd>SEQ ID NO * (eg, from mutant CTLA-4 ECD) HCD80mIg KD (M) Avidity of hCD80-mIg binding (with respect to the Orencia® fusion protein dimer) </dd></dl>
<dl><dt>D3-8-IgG2 </dt><dd>8 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-9-IgG2 </dt><dd>9 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-11-IgG2 </dt><dd>10 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-12-IgG2 </dt><dd>eleven <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-14-IgG2 </dt><dd>12 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-15-IgG2 </dt><dd>13 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-16-IgG2 </dt><dd>14 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-17-IgG2 </dt><dd>fifteen 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-19-IgG2 </dt><dd>16 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-20-IgG2 </dt><dd>17 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-21-IgG2 </dt><dd>18 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-22-IgG2 </dt><dd>19 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-23-IgG2 </dt><dd>twenty 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-24-IgG2 </dt><dd>twenty-one 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-25-IgG2 </dt><dd>22 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-26-IgG2 </dt><dd>2. 3 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-27-IgG2 </dt><dd>24 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-28-IgG2 </dt><dd>25 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-29-IgG2 </dt><dd>26 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-30-IgG2 </dt><dd>27 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-31-IgG2 </dt><dd>28 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-32-IgG2 </dt><dd>29 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-33-IgG2 </dt><dd>30 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-34-IgG2 </dt><dd>31 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-39-IgG2 </dt><dd>32 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>Fusion protein (dimer) </dt><dd>SEQ ID NO * (eg, from mutant CTLA-4 ECD) HCD80mIg KD (M) Avidity of hCD80-mIg binding (with respect to the Orencia® fusion protein dimer) </dd></dl>
<dl><dt>D3-50-IgG2 </dt><dd>33 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-52-IgG2 </dt><dd>3. 4 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-53-IgG2 </dt><dd>35 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-54-IgG2 </dt><dd>36 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-56-IgG2 </dt><dd>38 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>D3-62-IgG2 </dt><dd>44 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-65-IgG2 </dt><dd>47 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-66-IgG2 </dt><dd>48 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-69-IgG2 </dt><dd>fifty <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-70-IgG2 </dt><dd>51 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-71-IgG2 </dt><dd>52 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-72-IgG2 </dt><dd>53 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-73-IgG2 </dt><dd>54 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-74-IsG2 </dt><dd>55 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-75-IgG2 </dt><dd>56 <4.39 x 10-10 > 2x </dd></dl>
<dl><dt>D3-76-IgG2 </dt><dd>57 1.75 x 10-9 -4.39 x 10-10 0.5x -2x </dd></dl>
<dl><dt>* Note: SEQ ID NO. Shown in Table 4 for the human CTLA-4-IgG2, Orencia® and LEA29Y-Ig fusion proteins are those of the polypeptide sequences of these fusion proteins, respectively. SEQ ID NO. Shown in Table 4 for each mutant CTLA-4-Ig fusion protein identifies the mutant CTLA-4-ECD polypeptide sequence of the identified mutant CTLA-4-Ig fusion protein. The data refers to a mutant CTLA4-Ig comprising a mutant CTLA-4 ECD (eg, any of SEQ ID NO: 1-48 and 58-73) fused at its N-terminus with the C-terminus of the Fc polypeptide of IgG2 shown in SEQ ID NO: 184 or 218. However, the present inventors have experimentally found by EM-CL analysis that a mutant CTLA-4-Ig prepared in CHO cells using a vector comprising a nucleotide sequence encoding the predicted hIgG2 Fc polypeptide shown in SEQ ID NO. : 184 does not normally include the lysine residue (K) provided at end C; therefore, the hcgG2 Fc sequence of polypeptides of a mutant CTLA-4-IgG2 is that shown in SEQ ID NO: 218, whose hcgG2 Fc polypeptide sequence does not normally include the C-terminal lysine residue with respect to The sequence shown in SEQ ID NO: 184. Exemplary fusion protein sequences that do not include the lysine residue of the C-terminus are shown in SEQ ID NO: 205-214, 219 and 221. </dt><dd /></dl>
Monomeric kinetic tests.
Additional confirmation of the binding properties of mutant CTLA-4-Ig fusion proteins was obtained by monovalent kinetic binding assays. These assays measure the kinetic binding of a bivalent test protein (for example, a mutant CTLA-4-Ig mutant dimeric fusion protein) coated on sensor chips and monovalent ligand (hCD86-mIg digested with papain) in the mobile phase. Goat antibody directed against human IgG (Jackson ImmunoResearch, No. 109-005-098) was coupled to CM5 sensor chips according to the manufacturer's protocols, normally giving 15,000 response units (UR). The ligand was captured by incubation of antibody-coated sensor chips with 10 µl of a 2 µg / ml solution of dimeric mutant CTLA-4-Ig fusion proteins in HBS-EP buffer at a flow rate of 10 µl / min . The ligand capture levels were 10 normally 25-80 UR. Monomeric hCD86-mIg ligands (created by papain digestion and adsorption on hCD86-mIg A-Sepharose protein as described in Hermanson, GT BIOCONJUGATE TECHNIQUES, Academic Press, 1996) were diluted in HBS-EP buffer and flowed through the test protein coated sensor chips for 2 min at 30 μl / min, followed by 2 min incubation with HBS-EP buffer that did not contain protein at the same flow rate. Regeneration between cycles was performed by incubation of 3
fifteen min with 10 mM glycine buffer (pH 1.7) at 30 μl / min. Normally, 8 dilutions of monomeric analyte proteins ranging from 3000 nM to 0.2 nM were analyzed against a blank reference (HBS-EP buffer alone) in duplicate. Rmax signal levels to bind to mutant CTLA-4-Ig proteins ranged from 10-60 UR.
For kinetic analysis, data from monomeric binding assays were selected as described above, except that the selection of association data began and ended 5 s from the start and end times of the injection, and the selection of data from dissociation began 5 s after the time of completion of the injection, and usually included 1-60 s of the dissociation period. Such data was also analyzed for 5 steady-state equilibrium affinities using BIAevaluation software. The steady-state binding levels for each concentration (Responseeq (“Req”) values) were averaged over the 5-20 s interval near the end of the sample injection using the “General Adjustment: Average” function of BIAevaluation. The steady state affinity was determined from the representation of Req versus concentration using the BIAevaluation software according to the formula Req = KA x C x Rmax / (KA x C x n + 1) in which C is the concentration of
10 analyte and n, the steric interference factor, is 1, and KD = 1 / KA. In some cases, substantial nonspecific binding was observed, represented by a residual R-plane value trace after dissociation. Such data was corrected by subtracting the residual R values from the Req values. KD was then calculated in GraphPad Prism software (GraphPad Software, Inc.) using the "site specific binding" model.
This monomeric binding assay was performed on a subset of representative mutant CTLA-4-Ig proteins and
fifteen The results are summarized in Table 5. In general, the degree of improvement in the binding of ECD of hCD86 to mutant CTLA-4-Ig fusion proteins with respect to LEA29Y-Ig observed in the monomeric binding assays was similar to that observed. for the binding of hCD86-mIg to mutant CTLA-4-Ig fusion proteins with respect to LEA29Y-Ig in conventional kinetic assays. Such results support the conclusion that the observed improvements in binding kinetics for mutant proteins are due to real improvements in the binding affinities of the
twenty Mutant proteins (for example, compared to the Orencia® and / or LEA29Y-Ig fusion proteins) and are not due to possible artifacts produced by the greater valence of aggregate protein preparations.
Table 5.
<dl><dt>Fusion protein (dimer) </dt><dd>SEQ ID NO * (eg, from mutant CTLA-4 ECD) Monomeric hCD86 ECD KD (M) ECD binding affinity of monomeric hCD86 (with respect to LEA29Y-Ig) </dd></dl>
<dl><dt>LEA29Y-Ig </dt><dd>166 1.68 x 10-6 1 </dd></dl>
<dl><dt>D3-IgG2 </dt><dd>61 <3.36 x 10-7 > 5x </dd></dl>
<dl><dt>D3-4-IgG2 </dt><dd>4 <3.36 x 10-7 > 5x </dd></dl>
<dl><dt>D3-11-IgG2 </dt><dd>10 <3.36 x 10-7 > 5x </dd></dl>
<dl><dt>D3-12-IgG2 </dt><dd>eleven <3.36 x 10-7 > 5x </dd></dl>
<dl><dt>D3-14-IgG2 </dt><dd>12 <3.36 x 10-7 > 5x </dd></dl>
<dl><dt>D3-17-IgG2 </dt><dd>fifteen <3.36 x 10-7 > 5x </dd></dl>
<dl><dt>D3-20-IgG2 </dt><dd>17 8.4 x 10-7 -3.36 x 10-7 2x-5x </dd></dl>
<dl><dt>D3-27-IgG2 </dt><dd>24 8.4 x 10-7 -3.36 x 10-7 2x-5x </dd></dl>
<dl><dt>D3-29-IgG2 </dt><dd>26 <3.36 x 10-7 > 5x </dd></dl>
<dl><dt>D3-31-IgG2 </dt><dd>28 <3.36 x 10-7 > 5x </dd></dl>
<dl><dt>D3-53-IgG2 </dt><dd>35 <3.36 x 10-7 > 5x </dd></dl>
<dl><dt>* Note: SEQ ID NO. Shown in Table 5 for LEA29Y-Ig is that of the LEA29Y-Ig fusion protein polypeptide sequence. SEQ ID NO. Shown in Table 5 for each mutant CTLA-4-Ig fusion protein identifies the mutant CTLA-4 ECD polypeptide sequence present in the identified mutant CTLA-4-Ig fusion protein. The data refers to a mutant CTLA-4-Ig comprising a mutant CTLA-4 ECD (for example, any of SEQ ID NO: 4, 10-12, 15, 17, 24, 26, 28, 35 and 61 ) fused at its N-terminus with the C-terminus of the IgG2 Fc polypeptide shown in SEQ ID NO: 184 or 218. However, the present inventors have experimentally found by EM-CL analysis that a mutant CTLA-4-Ig prepared in CHO cells using a vector comprising a nucleotide sequence encoding the predicted hIgG2 Fc polypeptide shown in SEQ ID NO. : 184 does not normally include the lysine residue (K) provided at end C; therefore, the hcgG2 Fc sequence of polypeptides of a mutant CTLA-4-IgG2 is that shown in SEQ ID NO: 208, whose hcgG2 Fc polypeptide sequence does not normally include the C-terminal lysine residue with respect to The sequence shown in SEQ ID NO: 184. Exemplary fusion protein sequences that do not include the lysine residue of the C-terminus are shown in SEQ ID NO: 205-214, 219 and 221. Exemplary fusion protein sequences that include the C-terminal lysine residue are shown in SEQ ID NO: 74-79, 197-200, 220 and 222. </dt><dd /></dl>
Example 5
Measurement of the biological activity of CTLA-4 mutants using human PBMC proliferation assays 25 (stimulation of antibodies directed against CD3).
CTLA-4-Ig and particular variants thereof have been shown to be potent inhibitors of T-cell proliferation in vitro (see, for example, Larson et al., Am. J. Transplant. 5, 443). To measure the enhanced activity of mutant CTLA-4-Ig proteins in such assays, a peripheral blood mononuclear cell proliferation (PBMC) assay was developed.
Human blood (recently collected from a donor program) was diluted with an equal volume of PBS and fractionated to isolate PBMC using a Histopaque gradient (Sigma, No. 10771) -Ficoll according to the conditions recommended by the manufacturer. PBMCs were diluted in growth medium (DMEM / F12 medium (Invitrogen, No. 10565-018) supplemented with 10% SBF (Hyclone No. SV30014.03) and 1x PSG (Invitrogen, No. 10378-016)) and added to 96-well culture plates (BD Biosciences, No. 353077) at a density of 1 x 105 cells / well. Test compounds were seriously diluted in growth medium and added to wells in triplicate. Cell proliferation was initiated by the addition of mouse antibody directed against human CD3 (BD Pharmingen: 555329) at a final concentration of 5 μg / ml. After incubation at 37 ° C for 2 days (d) 3H-thymidine (GE Healthcare, # TRK758 5MCl) was added at 1 µCi / well and the plates were incubated at 37 ° C for an additional 16 h. The cells were collected with a cell collector (FilterMate Omnifilter-96 collector) using the conditions recommended by the manufacturer and measured for the incorporation of 3H-thymidine using a scintillation counter (Wallac Trilux, No. 1450-421). The degree of 3H-thymidine incorporation (3H-thymidine uptake) is indicative of the degree of T lymphocyte proliferation. The incorporation of 3H-thymidine is measured by conventional techniques. T lymphocyte proliferation is expressed as the average counts per minute (cpm) of triplicate wells.
Cell proliferation data was analyzed with GraphPad Prism 5 software using a non-linear regression curve fitting model (sigmoid dose response, variable slope) and the least squares adjustment procedure. The IC50 parameters (also shown as IC50) and their associated 95% confidence intervals of the results are reported (Table 6). Figure 6 shows cell proliferation curves of a representative PBMC proliferation assay (using stimulation with antibodies directed against CD3) involving a set of exemplary mutant CTLA-4-Ig fusion proteins - that is, fusion proteins D3-04-IgG2, D3-11-IgG2, D3-12-IgG2 and D3-14-IgG2. The graph is a representation of the incorporation of 3Htimidine (counts per minute (cpm)) versus protein concentration (nanoMolar (nM)). The incorporation of 3H-thymidine (3H-thymidine uptake), which is indicative of the degree of cell proliferation, is measured by conventional techniques.
The Orencia® and LEA29Y-Ig fusion proteins were included as controls for comparison. These results demonstrate that the mutant CTLA-4-Ig Ig fusion proteins of the invention have significantly greater potency or greater capacity than the Orencia® and / or LEA29Y-Ig fusion protein (s) in inhibiting or suppressing the polyclonal activation of T lymphocytes or proliferation of T lymphocytes in vitro.
The PBMC proliferation assay was performed using other mutant CTLA-4-Ig fusion proteins. Table 6 provides a summary of the data for a representative set of mutant CTLA-4-Ig fusion proteins. Table 6 presents comparisons of mean IC50 values (nanomolar (nM)) for example mutant CTLA-4-Ig fusion proteins versus controls (Orencia®, hCTLA-4-IgG2 and LEA29Y-Ig fusion proteins) in the PBMC proliferation assay (with stimulation with antibodies directed against CD3). An IC50 value represents the concentration of a compound (eg, mutant CTLA-4-Ig, hCTLA-4-IgG2, Orencia® or LEA29Y-Ig fusion protein) that is required for 50% inhibition of proliferation inhibition. T lymphocytes in vitro. The IC50 values of individual experiments were averaged to provide average IC50 values, which were used for statistical analyzes. A unilateral ANOVA with Dunnett or Bonferroni a posteriori test was used to compare mutant CLTA-4-Ig and hCTLA-4-IgG2 fusion proteins with the Orencia® or LEA29Y-Ig fusion protein, respectively (CW Dunnett, New Tables for Multiple Comparisons with a Control, Biometrics 20 (3): 482-491 (Sept. 1964); Abdi, Herve, "The Bonferroni and Sidak corrections for multiple comparisons", in ENCYCLOPEDIA OF MEASUREMENT AND STATISTICS (NJ Salkind ed., Thousand Oaks, CA 2007); also available on the universal website at the web address utdallas.edu/~herve/Abdi-Bonferroni2007-pretty.pdf.). Statistical analysis of the Ig fusion protein composed of one of the following mutant CTLA-4 ECD polypeptides - clones D24, D3-07, D3-15 and D3-16 - was not performed as n = 1. The term “DE (log IC50 medium)” represents the standard deviation in log IC50 values average.
Table 6. Summary of PBMC proliferation assay data by way of example using stimulation with antibodies directed against CD3
<dl><dt>Fusion protein (dimer) </dt><dd>Mean IC50 (nM) Log IC50 medium (nM) DE (log IC50 medium) (nM) </dd></dl>
<dl><dt>Orencia® fusion protein dimer </dt><dd> 5,16 0,71 0,51 </dd></dl>
<dl><dt>hCTLA-4-IgG2 </dt><dd> 8,46 0,93 0,43 </dd></dl>
<dl><dt>LEA29Y-Ig </dt><dd> 0,481 -0,32 0,54 </dd></dl>
<dl><dt>D3-4-IgG2 </dt><dd> 0,051,2 -1,27 0,45 </dd></dl>
<dl><dt>D3-7-IgG2 </dt><dd>0.12 -0.93 ND </dd></dl>
(continuation)
<dl><dt>Fusion protein (dimer) </dt><dd>Mean IC50 (nM) Log IC50 medium (nM) DE (log IC50 medium) (nM) </dd></dl>
<dl><dt>D3-11-IgG2 </dt><dd> 0,081,2 -1,07 0,40 </dd></dl>
<dl><dt>D3-12-IgG2 </dt><dd> 0,061,2 -1,27 0,17 </dd></dl>
<dl><dt>D3-14-IgG2 </dt><dd> 0,071,2 -1,17 0,15 </dd></dl>
<dl><dt>D3-15-IgG2 </dt><dd>0.21 -0.69 ND </dd></dl>
<dl><dt>D3-17-IgG2 </dt><dd> 0,041,2 -1,36 0,37 </dd></dl>
<dl><dt>D3-20-IgG2 </dt><dd> 0,071,2 -1,19 0,37 </dd></dl>
<dl><dt>D3-26-IgG2 </dt><dd> 0,151 -0,83 0,49 </dd></dl>
<dl><dt>D3-27-IgG2 </dt><dd> 0,101,2 -1,00 0,41 </dd></dl>
<dl><dt>D3-29-IgG2 </dt><dd> 0,071,2 -1,13 0,53 </dd></dl>
<dl><dt>D3-30-IgG2 </dt><dd> 0,181 -0,74 0,35 </dd></dl>
<dl><dt>D3-31-IgG2 </dt><dd> 0,041,2 -1,42 0,25 </dd></dl>
<dl><dt>D3-32-IgG2 </dt><dd> 0,101 -1,00 0,47 </dd></dl>
<dl><dt>D3-33-IgG2 </dt><dd> 0,121 -0,94 0,69 </dd></dl>
<dl><dt>D3-34-IgG2 </dt><dd> 0,411 -0,39 0,18 </dd></dl>
<dl><dt>D3-39-IgG2 </dt><dd> 0,471 -0,33 0,21 </dd></dl>
<dl><dt>D3-50-IgG2 </dt><dd> 0,351 -0,46 0,23 </dd></dl>
<dl><dt>D3-52-IgG2 </dt><dd> 0,491 -0,31 0,20 </dd></dl>
<dl><dt>D3-53-IgG2 </dt><dd> 0,021,2 -1,69 0,24 </dd></dl>
<dl><dt>D3-54-IgG2 </dt><dd> 0,171 -0,77 0,22 </dd></dl>
<dl><dt>D3-56-IgG2 </dt><dd> 0,081 -1,08 0,20 </dd></dl>
<dl><dt>D3-62-IgG2 </dt><dd> 0,051,2 -1,29 0,23 </dd></dl>
<dl><dt>D3-69-IgG2 </dt><dd> 0,051,2 -1,34 0,19 </dd></dl>
<dl><dt>D3-70-IgG2 </dt><dd> 0,081 -1,10 0,10 </dd></dl>
<dl><dt>D3-71-IgG2 </dt><dd>0.05 -1.32 ND </dd></dl>
<dl><dt>D3-72-IgG2 </dt><dd> 0,031,2 -1,54 0,19 </dd></dl>
<dl><dt>D3-73-IgG2 </dt><dd> 0,23 1 -0,64 0,25 </dd></dl>
<dl><dt>D3-75-IgG2 </dt><dd> 0,081 -1,11 0,33 </dd></dl>
<dl><dt>D3-76-IgG2 </dt><dd> 0,131 -0,88 0,36 </dd></dl>
<dl><dt>D3-IgG2 </dt><dd> 0,141 -0,85 0,13 </dd></dl>
<dl><dt>D24-IgG2 </dt><dd>0.12 -0.93 ND </dd></dl>
The superscripts shown in Table 6 are as follows: 1 Statistically different from Orencia with p <0.05 as determined by unilateral ANOVA with Dunnett's posterior test. 2 Statistically different from LEA with p <0.05 as determined by unilateral ANOVA with Bonferroni a posteriori test.
5 Fusion proteins comprising the ECD of CTLA-4 mutants of D3-7, D3-15, D3-71 and D24 were tested once and therefore no statistical comparison could be made. Note: The term "ND" in Table 6 means "not available."
Statistical analysis revealed that all mutant CTLA-4-Ig fusion proteins that were tested in at least two separate assays and are designated with superscript (1) (see Table 6) were statistically superior in potential to 10 proteins. Orencia® and hCTLA-4-IgG2 fusion (p <0.05) (ie, they have a greater ability to suppress or inhibit T lymphocyte proliferation in in vitro PBMC assays than Orencia® and hCTLA-4 fusion proteins -IgG2). Those designated with superscript (2) (see Table 6) were also statistically superior in potency to the LEA29Y-Ig fusion protein (p <0.05) (i.e., have a greater ability to suppress or inhibit the proliferation of T lymphocytes in PBMC assays in vitro that the fusion protein LEA29Y-Ig), as determined by unilateral ANOVA with Dunnett and Bonferroni tests a posteriori treated above. There was no statistical difference between fusion proteins of human CTLA-4 comprising both Fc of modified IgG1 (as in Orencia®) and Fc of natural IgG2 (as in hCTLA4-IgG2). This finding implies that the differences in functional activities shown in Table 6 between the mutant CTLA-4-Ig fusion proteins disclosed herein (each comprising a human IgG2 Fc) and both
Orencia® as hCTLA4-IgG2 were a direct consequence of amino acid changes (i.e. amino acid substitutions) made in the ECD region of CTLA-4. The differences in functional activities between these mutant CTLA-4-Ig fusion proteins and, for example, Orencia® (comprising a modified IgG1 Fc) were not due to differences in their respective Ig Fc polypeptide sequences.
It is believed that given the increased capabilities of the mutant CTLA-4-Ig fusion proteins disclosed herein to suppress or inhibit T lymphocyte proliferation in in vitro assays with respect to the Orencia® fusion proteins, LEA29Y- Ig and / or hCTLA-4-IgG2, such mutant proteins should also have high immunosuppressive potencies in therapeutic and / or prophylactic procedures in vivo with respect to Orencia® fusion proteins, LEA29Y-Ig and / or hCTLA-4-IgG2. It is believed that each mutant CTLA-4-Ig fusion protein disclosed herein has a greater ability to suppress or inhibit T lymphocyte proliferation in procedures or applications in vivo with respect to Orencia® fusion proteins, LEA29Y- Ig and / or hCTLA-4-IgG2 such as in, for example, therapeutic and / or prophylactic procedures to suppress or inhibit an immune response in a subject (for example, in the in vivo treatment of diseases or disorders of the immune system in a mammal such as, for example, a human being), procedures for suppressing or inhibiting the rejection of a donor tissue or organ transplant by a recipient (for example, by a mammal such as, for example, a human being) and / or other diagnostic treatment or procedures described elsewhere herein.
Applying the same statistical analyzes, the present inventors found no statistical difference between the Orencia® fusion protein (which comprises mutant IgG1 from the human CTLA-4 ECD) and human CTLA-4-IgG2. Therefore, it is believed that differences in the Ig domains of these molecules (i.e., the mutant IgG1 of the Orencia® fusion protein and the human IgG2 of hCTLA-4-IgG2) did not affect the functionality of these molecules. See Figure 11. The proliferation inhibition observed with increasing doses of the Orencia® fusion protein was not significantly different from that observed with CTLA-4-IgG2, which indicates that their respective immunosuppressive activities are not biased according to their different IgG isotypes, but result of its hCTLA-4 ECD polypeptides. Therefore, the different immunosuppressive activities between mutant CTLA-4-Ig polypeptides disclosed herein and the Orencia® fusion protein (or LEA29Y-Ig, since it contains the same Ig as in the Orencia® protein) cannot be attributed to their respective Fc regions comprising different isotypes of IgG.
The disclosure includes monomeric mutant CTLA-4 ECD proteins that have a capacity and, in some cases, a greater ability to suppress or inhibit the activation or proliferation of T lymphocytes than a monomeric human CTLA-4 protein or an extracellular domain of the same. Fusion proteins of the monomeric mutant CTLA-4 ECD are also provided that have a capacity and, in some cases, a greater ability to suppress or inhibit the activation or proliferation of T lymphocytes than a monomeric hCTLA-4 Ig fusion protein or a extracellular domain of it. Also included are dimers of mutant CTLA-4 ECD proteins that have a capacity and, in some cases, a greater ability to suppress or inhibit the activation or proliferation of T lymphocytes than a dimer comprising two extracellular domains of human CTLA-4 . Some mutant CTLA-4 ECD fusion protein dimers disclosed herein (eg, mutant CTLA-4-ECD-Ig fusion protein dimers) have a capacity and, in some cases, a greater ability to suppress or inhibit the activation or proliferation of T lymphocytes such as an hCTLA-4-IgG2 fusion protein dimer, Orencia® fusion protein dimer and / or LEA29Y-Ig fusion protein dimer.
Example 6
Measurement of the biological activity of mutant CTLA-4-Ig molecules using human CD4 + T cell proliferation assays.
It has been shown that human CTLA-4-Ig and particular variants thereof inhibit T lymphocyte proliferation by blocking the signaling of CD80 and CD86 by CD28 (Linsley PS, Immunity 1: 793-801 (1994); Larson CP et al. , Am. J. Transplant. 5: 443-453 (2005)). Because the mutant CTLA-4-Ig proteins disclosed herein have enhanced binding avidity for the CD86-Ig ligand, a CD4 + T lymphocyte proliferation assay was developed to measure the activity of mutant CTLA-4-Ig proteins. in blocking the signaling by CD86.
DNA sequence creation that encodes a full length human CD86 protein.
Plasmid pcDNA3.1 hB7.2 FL was created to encode the full length human CD86 protein for expression on the surface of transfected cells. DNA encoding human CD86 was generated by PCR amplification of human leukocyte-derived cDNA (BD Biosciences, cat. No. HL4050AH) using direct and reverse oligonucleotide primers designed based on sequence homology with the nucleotide sequence encoding CD86 exposed in SEQ ID NO: 176. Primers were designed, prepared and assembled using conventional techniques well known to those skilled in the art and included termination and initiation codons and restriction sites as necessary. The PCR amplification procedures employed are also well known in the art. Such techniques are described in, for example, Berger, Ausubel and Sambrook, all above. 50 nanograms (ng) of cDNA were used as a template in a 100 μl PCR reaction with 1 μM direct and reverse primers, herculase polymerase buffer (Stratagene; # 600260) and 200 μM dNTP for 30 cycles of amplification (94 ° C, 30 s ; 50 ° C, 30 s; 72 ° C, 60 s). The PCR product was purified by QiaQuick PCR centrifuge columns (Qiagen No. 28106) and digested with restriction enzymes KpnI and NotI. The fragments were separated by agarose gel electrophoresis, purified using the Qiaquick gel extraction kit (Qiagen, no. 28704) according to the manufacturer's recommendation and ligated into the similarly digested pcDNA 3.1 (+) plasmid (Invitrogen, cat. No. V790-20). The ligaments were transformed into E. coli TOP10 cells (Qiagen, cat. No. C4040-10) according to the manufacturer's recommendations. The transformed cells were incubated in LB (Luria broth medium) containing 50 μg / ml carbenicillin at 250 rpm overnight at 37 ° C and then used to prepare a maxiprep broth (Qiagen; No. 12362) of plasmid DNA according to the conditions recommended by the manufacturer.
The predicted amino acid sequence of the full-length human CD86 protein is shown in SEQ ID NO: 175. In this sequence, amino acid residues 1-23 comprise the predicted signal sequence, amino acid residues 24-241 comprise the domain Extracellular from human CD86, amino acid residues 242-270 comprise the transmembrane domain and amino acid residues 271-329 comprise the cytoplasmic domain.
Creation of stable cell lines that express human CD86 on the cell surface.
80-90% confluence HEK293 cells were cultured in T-75 flasks containing 20 ml of growth medium (DMEM / F12 medium (Invitrogen, cat. No. 10565-018) supplemented with 10% SBF (cat. No. Hyclone SV30014.03) and 1x PSG (Invitrogen, Cat. No. 10378-016)). The cells were transfected with 10 μg of plasmid DNA (pcDNA3.1 hB7.2 FL) mixed with 60 μl of Fugene 6 (ROCHE, No. 11814443001) according to the conditions recommended by the manufacturer. The cells were incubated for 2 days (d) at 37 ° C in growth medium and additionally incubated for 10 d at 37 ° C in selection medium (growth medium containing 300 μg / ml of geneticin (Invitrogen, No. 10131-027), changing the media every 2 d. To allow classification by FACS, the transfected cells were stained with antibody directed against CD86 labeled with FITC (BD Biosciences, No. 555) according to the conditions recommended by the manufacturer. Using a cell sorter (Dako, MoFlo) selected for the FITC signal, CD86 positive cells were individually classified in 96-well culture plates (Sigma-Aldrich, No. CLS-3596) containing 200 μl / well of media growth containing 25% conditioned medium (growth medium previously collected from untransfected cell cultures (or without prior treatment)). After incubation at 37 ° C for 13-19 d, the cells were dispersed by trypsin hydrolysis and transferred to 24-well culture plates containing 0.5 ml / well of growth medium. After incubation at 37 ° C for 7 d, the cells were dispersed by hydrolysis with trypsin and transferred to T-75 flasks containing 20 ml of growth medium. Final cell lines were selected based on high levels of CD86 expression on the cell surface as measured by FACS analysis of cells stained with FITC-labeled CD86 antibody using FACSCalibur (BD Biosciences), according to the conditions recommended by the manufacturer.
Proliferation assays of CD4 + T lymphocytes.
CD4 + T lymphocytes were enriched at> 96% from human leukocyte layer preparations (Stanford University Blood Center, Stanford, CA) using the EasySep human CD4 positive selection kit (StemCell Technologies, No. 18052R) with a cell separator magnetic (RoboSep, StemCell Technologies, nº 20000) following the manufacturer's recommendations. Enriched CD4 + T lymphocytes were adjusted to a density of 1 x 106 cells / ml in Yssel medium (Gemini Bio-Products, No. 400-102) supplemented with 10% SBF (Hyclone SV30014.03) and added to culture plates of 96-well tissue at 50 μl / well. HEK293 cells expressing membrane bound human CD86 were irradiated at 6000 rads (Stanford Research Institute, Menlo Park, CA), adjusted to 1 x 10 6 cells / ml in the same medium and added to the culture plates at 50 μl / well. The test compounds were seriously diluted in the same medium and added to the wells in triplicate. Cell proliferation was initiated by the addition of mouse antibody directed against human CD3 (BD Pharmingen: 555329) at a final concentration of 5 μg / ml. After incubation at 37 ° C for 3 d, 3H-thymidine (GE Healthcare, # TRK758-5MCI) was added at 1 µCi / well and the plates were incubated at 37 ° C for an additional 18 h. Cells were collected using a cell collector (Perkin Elmer filter collector D961962) and 3H-thymidine was measured using a liquid scintillation counter (Wallac Trilux 1450) according to the conditions recommended by the manufacturer. Cell proliferation data was analyzed with GraphPad Prism 5 software using a variable slope equation (Y = Foot + (Top-Foot) / (1 + 10 ^ ((LogCI50-X) (Slope))) to generate an IC50 for each test compound. The term "(LogCI50-X) (Pending)" is an exponent in the equation.
Figure 7 shows cell proliferation curves of representative CD4 + T cell proliferation assays involving a set of example mutant CTLA-4-Ig fusion proteins - that is, D3-04-IgG2, D3-11-IgG2 , D3-12-IgG2 and D3-14-IgG2. The Orencia® and LEA29Y-Ig fusion proteins were included as controls for comparison. The graph is a representation of the incorporation of 3H-thymidine (cpm) versus protein concentration (nM). The incorporation of 3H-thymidine is indicative of the degree of cell proliferation and is measured by conventional techniques. These results demonstrate that mutant CTLA-4-Ig fusion proteins as disclosed herein have significantly greater or greater potency than Orencia® and / or LEA29Y-Ig fusion proteins in inhibiting or suppressing co-stimulation of CD86 in vitro.
This CD4 + T cell proliferation assay was performed on several other mutant CTLA-4-Ig fusion proteins. Table 7 provides a summary of the data for a set of example mutant CTLA-4-Ig fusion proteins. Table 7 presents comparisons of mean IC50 values (nanomolar (nM)) for example mutant CTLA-4-Ig fusion proteins versus reference controls (Orencia® fusion proteins,
5 LEA29Y-Ig and human CTLA-4-IgG2) using the CD4 + T cell proliferation assay. The IC50 of individual experiments were averaged to provide mean IC50 values that were used for statistical analysis. The term “DE (log IC50 medium)” represents the standard deviation in log IC50 average values.
Table 7. Summary of data from exemplary CD4 + T cell proliferation assays
<dl><dt>Fusion protein (dimer) </dt><dd>Mean IC50 (nM) Log IC50 medium (nM) DE (log IC50 medium) (nM) </dd></dl>
<dl><dt>Orencia® fusion protein dimer </dt><dd> 1,56 0,19 0,22 </dd></dl>
<dl><dt>hCTLA-4-IpG2 </dt><dd> 2,24 0,35 0,28 </dd></dl>
<dl><dt>LEA29Y-Ig </dt><dd> 0,21 -0,67 0,25 </dd></dl>
<dl><dt>D3-02-IgG2 </dt><dd>0.03 -1.56 NA </dd></dl>
<dl><dt>D3-03-IgG2 </dt><dd> 0,041,2 -1,40 0,11 </dd></dl>
<dl><dt>D3-04-IgG2 </dt><dd> 0,031,2 -1,47 0,02 </dd></dl>
<dl><dt>D3-06-IgG2 </dt><dd> 0,051 -1,32 0,03 </dd></dl>
<dl><dt>D3-11-IgG2 </dt><dd> 0,031,2 -1,52 0,07 </dd></dl>
<dl><dt>D3-12-IgG2 </dt><dd> 0,041,2 -1,45 0,09 </dd></dl>
<dl><dt>D3-14-IgG2 </dt><dd> 0,041,2 -1,37 0,11 </dd></dl>
<dl><dt>D3-15-IgG2 </dt><dd> 0,021,2 -1,62 0,08 </dd></dl>
<dl><dt>D3-17-IgG2 </dt><dd> 0,031,2 -1,47 0,11 </dd></dl>
<dl><dt>D3-20-IgG2 </dt><dd> 0,041,2 -1,40 0,11 </dd></dl>
<dl><dt>D3-27-IgG2 </dt><dd> 0,041,2 -1,37 0,10 </dd></dl>
<dl><dt>D3-29-IgG2 </dt><dd> 0,041,2 -1,36 0,13 </dd></dl>
<dl><dt>D3-31-IgG2 </dt><dd> 0,031,2 -1,58 0,21 </dd></dl>
<dl><dt>D3-34-IgG2 </dt><dd> 0,051,2 -1,28 0,13 </dd></dl>
<dl><dt>D3-39-IgG2 </dt><dd> 0,051,2 -1,35 0,10 </dd></dl>
<dl><dt>D3-50-IgG2 </dt><dd> 0,061,2 -1,23 0,24 </dd></dl>
<dl><dt>D3-52-IgG2 </dt><dd> 0,071,2 -1,14 0,24 </dd></dl>
<dl><dt>D3-53-IgG2 </dt><dd> 0,021,2 -1,70 0,25 </dd></dl>
<dl><dt>D3-54-IgG2 </dt><dd> 0,041,2 -1,40 0,12 </dd></dl>
<dl><dt>D3-56-IgG2 </dt><dd> 0,041,2 -1,41 0,07 </dd></dl>
<dl><dt>D3-62-IgG2 </dt><dd> 0,041,2 -1,44 0,09 </dd></dl>
<dl><dt>D3-65-IgG2 </dt><dd> 0,061,2 -1,26 0,14 </dd></dl>
<dl><dt>D3-69-IgG2 </dt><dd> 0,031,2 -1,59 0,14 </dd></dl>
<dl><dt>D3-70-IgG2 </dt><dd> 0,051,2 -1,30 0,06 </dd></dl>
<dl><dt>D3-71-IgG2 </dt><dd> 0,041,2 -1,43 0,09 </dd></dl>
<dl><dt>D3-72-IgG2 </dt><dd> 0,031,2 -1,48 0,05 </dd></dl>
<dl><dt>D3-73-IgG2 </dt><dd> 0,061,2 -1,26 0,18 </dd></dl>
<dl><dt>D3-75-IgG2 </dt><dd> 0,031,2 -1,51 0,12 </dd></dl>
<dl><dt>D2-IgG2 </dt><dd> 0,031,2 -1,52 0,18 </dd></dl>
<dl><dt>D3-IgG2 </dt><dd> 0,041,2 -1,45 0,17 </dd></dl>
The superscripts shown in Table 7 are as follows: 1 Statistically different from Orencia with p <0.05
10 as determined by unilateral ANOVA with Dunnett's test a posteriori. 2 Statistically different from LEA with p <0.05 as determined by unilateral ANOVA with Bonferroni post-test. The fusion protein comprising the D3-02 mutant CTLA-4 ECD was tested once and therefore no statistical comparison could be performed.
Statistical analysis revealed that all mutant CTLA-4-Ig fusion proteins that were tested in at least two separate trials and designated with superscript (1) (see Table 7) were statistically superior in potency to fusion proteins Orencia® and hCTLA-4-IgG2 (p <0.05) (that is, they have a greater ability to suppress or inhibit T lymphocyte proliferation in CD4 + T lymphocyte assays in vitro than Orencia® and hCTLA- fusion proteins 4-IgG2). Those designated with superscript (2) (see Table 7) were also statistically superior in potency to the LEA29Y-Ig fusion protein (p <0.05) (i.e., have a greater ability to suppress or inhibit the proliferation of T lymphocytes in CD4 + T lymphocyte assays in vitro that the fusion protein LEA29Y-Ig), as determined by unilateral ANOVA with Dunnett and Bonferroni a posteriori tests, discussed above. There was no statistical difference between fusion proteins of human CTLA-4 comprising both Fc of modified IgG1 (as in Orencia®) and Fc of natural IgG2 (as in hCTLA4-IgG2). This finding implies that the differences in functional activities shown in Table 7 between mutant CTLA-4-Ig fusion proteins (each comprising a human IgG2 Fc) and both Orencia® and hCTLA4-IgG2 were a direct consequence of amino acid changes (i.e. amino acid substitutions) made in the ECD region of CTLA-4. The differences in functional activities between these mutant CTLA-4-Ig fusion proteins and, for example, Orencia® (comprising a modified IgG1 Fc) were not due to differences in their respective Ig Fc polypeptide sequences.
It is believed that given the increased capabilities of mutant CTLA-4-Ig proteins disclosed herein to suppress or inhibit CD86-mediated co-stimulation of CD86-mediated cells (e.g., human T-lymphocytes) in in vitro assays with regarding Orencia®, LEA29Y-Ig and / or hCTLA-4-IgG2 fusion proteins, such mutant proteins should also have high immunosuppressive potencies in therapeutic and / or prophylactic procedures or applications in vivo with respect to fusion proteins Orencia®, LEA29Y-Ig and / or human CTLA4-Ig (for example, human CTLA-4-IgG2 ( "HCTLA-4-IgG2")), respectively. In one aspect it is believed that mutant CTLA-4-Ig fusion proteins as disclosed herein have a greater ability to suppress or inhibit co-stimulation of CD86-mediated T lymphocytes (eg, human T lymphocytes) in in vivo procedures or applications compared to Orencia®, LEA29Y-Ig and / or human CTLA-4-Ig fusion proteins (eg, hCTLA-4-IgG2), respectively, as in, for example, therapeutic and / or prophylactic procedures for suppressing or inhibiting an immune response in a subject (for example, in the in vivo treatment of diseases or disorders of the immune system in, for example, a mammal such as, for example, a human being), procedures for suppressing or inhibiting rejection of a donor tissue or organ transplant by a recipient (for example, by a mammal such as, for example, a human being) and / or other diagnostic treatment or procedures described elsewhere in this document.
Example 7
Measurement of the biological activity of mutant CTLA-4-Ig molecules using human PBMC proliferation assays (stimulation of memory antigens).
Activation of memory T lymphocytes is an important aspect of autoimmunity (Rogers NJ et al. Eur. J. Immunol 35: 2909-2919 (2005)). In this regard, to measure the immunosuppressive activity of mutant CTLA-4-Ig proteins, a peripheral blood mononuclear cell proliferation assay (PBMC) was developed using stimulation with PPD antigen.
Human blood (recently collected from a donor program) was diluted with an equal volume of PBS and fractionated to isolate PBMC using a Histopaque gradient (Sigma, No. 10771) -Ficoll according to the conditions recommended by the manufacturer. PBMCs were diluted in RPMI medium (Sigma, No. R8758) supplemented with 10% SBF (Hyclone No. SV30014.03) and 1x PSG (penicillin, streptomycin and glutamine) (Invitrogen, No. 10378-016) and added to plates. 96-well culture (BD Biosciences, No. 353077) at a density of 1 x 105 cells / well. The test compounds were seriously diluted in the same medium and added to wells in quadruplicate. Cell proliferation was initiated by the addition of PPD antigen (purified protein derived from Mycobacterium tuberculosis, Mycos, No. P-1000-001) at a final concentration of 5 μg / ml. After incubation at 37 ° C for 5 d, 3H-thymidine (GE Healthcare, # TRK758-5MCI) was added at 1 µCi / well and the plates were incubated at 37 ° C for an additional 18 h. The cells were collected with a cell collector (FilterMate Omnifilter-96, Perkin Elmer) using the conditions recommended by the manufacturer and measured for the incorporation of 3H-thymidine using a scintillation counter (Wallac Trilux, No. 1450-421) . Cell proliferation data was analyzed with GraphPad Prism 5 software using a non-linear regression curve fitting model (sigmoid dose response, variable slope) and the least squares adjustment procedure. The IC50 parameters (or "IC50") and their associated 95% confidence intervals are reported.
Figure 8 shows cell proliferation curves of representative PBMC proliferation assays involving a set of exemplary mutant CTLA-4-Ig fusion proteins - that is, D3-IgG2, D3-12-IgG2 fusion proteins, D3-17-IgG2 and D3-29-IgG2. The Orencia® and LEA29Y-Ig fusion proteins were included as controls for comparison. The graph is a representation of the incorporation of 3H-thymidine (cpm) versus protein concentration (nM). The incorporation of 3H-thymidine, which is indicative of the degree of cell proliferation, is measured by conventional techniques. These results demonstrate that, in one aspect, mutant CTLA-4-Ig fusion proteins as disclosed herein have significantly greater potency than Orencia® and / or LEA29Y-Ig proteins in inhibiting or suppressing T lymphocyte proliferation. in vitro memory (for
For example, mutant CTLA-4-Ig proteins have a greater ability than Orencia® and / or LEA29Y-Ig proteins to inhibit or suppress proliferation of in vitro memory T lymphocytes in human PBMC proliferation assays (stimulation of memory antigens )).
This PBMC proliferation assay with stimulation of PPD antigens was performed on several other mutant CTLA-4-Ig fusion proteins. Table 8 provides a summary of the data for a set of example mutant CTLA-4-Ig fusion proteins. Table 8 presents comparisons of mean IC50 values (nanomolar (nM)) for example mutant CTLA-4-Ig fusion proteins versus reference controls (Orencia® and LEA29Y-Ig fusion proteins) using the test PBMC proliferation with stimulation of memory antigens. The IC50 values of individual experiments were averaged to provide average IC50 values that were used for statistical analyzes. The term "DE (log IC50 medium)" represents the standard deviation in log IC50 average values.
Table 8. Summary of PBMC proliferation assay data by way of example using stimulation with PPD antigens
<dl><dt>Fusion protein (dimer) </dt><dd>Mean IC50 (nM) Log IC50 medium (nM) DE (log IC50 medium) (nM) </dd></dl>
<dl><dt>Orencia® fusion protein dimer </dt><dd> 5,92 0,67 0,37 </dd></dl>
<dl><dt>LEA29Y-Ig </dt><dd> 0,31 -0,71 0,53 </dd></dl>
<dl><dt>D3-IgG2 </dt><dd>0.03 -1.49 ND </dd></dl>
<dl><dt>D3-12-IgG2 </dt><dd> 0,06 -1,27 0,17 </dd></dl>
<dl><dt>D3-14-IgG2 </dt><dd> 0,07 -1,17 0,15 </dd></dl>
<dl><dt>D3-17-IgG2 </dt><dd> 0,07 -1,24 0,25 </dd></dl>
<dl><dt>D3-20-IgG2 </dt><dd> 0,13 -0,91 0,18 </dd></dl>
<dl><dt>D3-27-IgG2 </dt><dd> 0,17 -0,84 0,30 </dd></dl>
<dl><dt>D3-29-IgG2 </dt><dd> 0,07 -1,16 0,18 </dd></dl>
<dl><dt>D3-34-IgG2 </dt><dd>0.51 -0.29 ND </dd></dl>
<dl><dt>D3-50-IgG2 </dt><dd>0.28 -0.55 ND </dd></dl>
<dl><dt>D3-53-IgG2 </dt><dd>0.05 -1.29 ND </dd></dl>
<dl><dt>D3-54-IgG2 </dt><dd>0.01 -2.00 ND </dd></dl>
<dl><dt>D3-56-IgG2 </dt><dd>0.01 -1.92 ND </dd></dl>
<dl><dt>D3-69-IgG2 </dt><dd>0.01 -2.00 ND </dd></dl>
<dl><dt>D3-71-IgG2 </dt><dd>0.01 -1.87 ND </dd></dl>
<dl><dt>D3-75-IgG2 </dt><dd>0.01 -2.02 ND </dd></dl>
<dl><dt>D3-76-IgG2 </dt><dd>0.01 -1.89 ND </dd></dl>
<dl><dt>Note: The term "ND" in Table 8 means "not available." </dt><dd /></dl>
Statistical analysis revealed that all mutant CTLA-4-Ig fusion proteins tested were statistically superior in potency to both Orencia® and LEA29Y-Ig fusion proteins with p <0.05, as determined by unilateral ANOVA with evidence Dunnett and Bonferroni a posteriori, respectively, discussed above (for example, mutant CTLA-4-Ig fusion proteins have a greater capacity than Orencia® and / or LEA29Y-Ig fusion proteins to inhibit or suppress proliferation of in vitro memory T lymphocytes in human PBMC proliferation assays (stimulation of memory antigens)).
It is believed that given the increased capabilities of mutant CTLA-4-Ig fusion proteins as disclosed herein to suppress or inhibit proliferation of memory T lymphocytes (eg, human memory T lymphocytes) in assays. in vitro with respect to the Orencia® and / or LEA29Y-Ig fusion proteins, such mutant proteins should also have high immunosuppressive potencies in therapeutic and / or prophylactic procedures or applications in vivo with respect to fusion proteins Orencia®, LEA29Y-Ig and / or human CTLA4-Ig (for example, human CTLA-4-IgG2) . In one aspect it is believed that mutant CTLA-4-Ig fusion proteins as disclosed herein have a greater ability to suppress or inhibit proliferation of memory T lymphocytes (e.g., human memory T lymphocytes) in a procedure or application in vivo compared to fusion proteins Orencia®, LEA29Y-Ig and / or human CTLA-4-Ig (for example, human CTLA-4-IgG2) such as in, for example, therapeutic and / or prophylactic procedures for suppressing or inhibiting an immune response in a subject (for example, in the in vivo treatment of diseases or disorders of the immune system in, for example, a mammal such as, for example, a human being), procedures for suppressing or inhibiting rejection of a donor tissue or organ transplant by a recipient (for example, by a mammal such as, for example, a human being) and / or other diagnostic treatment or procedures described elsewhere in this document.
Example 8
Measurement of the biological activity of mutant CTLA-4-Ig molecules using human MLR (mixed lymphocyte reaction) assays.
CTLA-4-Ig and variants thereof are potent inhibitors of primary primary responses in vitro (Vaughan, AN et al., J. Immunol. 165: 3175-3181 (2000); Wallace PM, et al., Transplantation 58: 602 -610 (1994)). To measure the enhanced activity of mutant CTLA-4-Ig proteins in such assays, a cell proliferation assay by reaction of mixed human lymphocytes (MLR) was developed.
Human blood (recently collected from a human donor program) was diluted with an equal volume of PBS and fractionated to isolate PBMC using a Histopaque gradient (Sigma, No. 10771) -Ficoll according to the manufacturer's recommended conditions. The donor PBMCs were diluted in RPMI medium (Sigma, No. R8758) supplemented with 10% SBF (Hyclone No. SV30014.03) and 1x PSG (Invitrogen, No. 10378-016) and added to 96-well culture plates (BD Biosciences, No. 353077) at a density of 1 x 105 cells / well. PBMCs from a different donor were irradiated at 2500 rads, diluted in the same medium and added to the same plates at a density of 1 x 105 cells / well. The test compounds were seriously diluted in the same medium and added to the wells in quadruplicate. After incubation at 37 ° C for 5 d 3H-thymidine (GE Healthcare, # TRK758 5MCl) was added at 1 µCi / well and the plates were incubated at 37 ° C for an additional 18 h. The cells were collected with a cell collector (FilterMate Omnifilter-96, Perkin Elmer) using the conditions recommended by the manufacturer and measured for the incorporation of 3H-thymidine using a scintillation counter (Wallac Trilux, No. 1450-421) . Cell proliferation data was analyzed with GraphPad Prism 5 software using a non-linear regression curve fitting model (sigmoid dose response, variable slope) and the least squares adjustment procedure. The IC50 parameters and their associated 95% confidence intervals are reported.
Figure 9 shows cell proliferation curves of representative MLR proliferation assays involving an example mutant CTLA-4-Ig fusion protein: D3-IgG2. The Orencia® and LEA29Y-Ig fusion proteins were included as controls for comparison. The graph is a representation of the incorporation of 3H-thymidine (cpm) versus protein concentration (nM). The incorporation of 3H-thymidine, which is indicative of the degree of cell proliferation, is measured by conventional techniques. These results demonstrate that D3-IgG2 has significantly greater potency than Orencia® and / or LEA29Y-Ig fusion proteins in inhibiting or suppressing primary alloimulation of T lymphocytes in vitro (for example, D3-IgG2 has a greater ability to suppress or inhibit primary allo-stimulation of T lymphocyte proliferation in an in vitro MLR assay that Orencia® or LEA29Y-Ig fusion proteins).
This MLR assay was performed on several other mutant CTLA-4-Ig fusion proteins disclosed herein. Table 9 provides a summary of the data for an example mutant set of CTLA-4-Ig fusion proteins. Table 9 presents comparisons of mean IC50 values (nanomolar (nM)) for example mutant CTLA-4-Ig fusion proteins versus reference controls (Orencia® and LEA29Y-Ig fusion proteins) in the test of MLR The IC50 values of two separate experiments were averaged to provide average IC50 values. The term “DE (log IC50 medium)” represents the standard deviation in log IC50 average values. The mean IC50 values for the mutant CTLA-4-Ig fusion proteins shown in Table 9 were lower than the respective mean IC50 values of the Orencia® and LEA29Y-Ig fusion proteins.
Mutant CTLA-4-Ig fusion proteins that are believed to be superior in potency to the Orencia® and / or LEA29Y-Ig fusion proteins are disclosed (for example, it is believed that mutant CTLA-4-Ig fusion proteins have a greater ability to suppress or inhibit primary allo-stimulation of T lymphocyte proliferation in an in vitro MLR assay than Orencia® and / or LEA29Y-Ig fusion proteins).
It is believed that, based on the expected enhanced capacities of mutant CTLA-4-Ig fusion proteins as disclosed herein to suppress or inhibit primary alloestimulation of T lymphocytes (eg, human T lymphocytes) in in vitro assays with regarding Orencia® and / or LEA29Y-Ig fusion proteins, such mutant proteins should also have high immunosuppressive potencies in therapeutic and / or prophylactic procedures or applications in vivo with respect to the Orencia® and / or LEA29Y-Ig fusion proteins.
In one aspect, the mutant CTLA-4-Ig fusion proteins as disclosed herein have significantly greater potency than the Orencia®, LEA29Y-Ig and / or CTLA-4 human-Ig fusion proteins (for example, CTLA -4 human-IgG2) in inhibiting or suppressing primary alloimulation of T lymphocytes in vitro (e.g., mutant CTLA-4-Ig fusion proteins have a greater ability to suppress or inhibit primary allo-stimulation of T-cell proliferation in an in vitro MLR assay than Orencia®, LEA29Y-Ig and / or human CTLA-4 ). In one aspect it is believed that a mutant CTLA-4-Ig as disclosed herein has a greater ability to suppress or inhibit primary alloestimulation of T lymphocytes (eg, human T lymphocytes) in a procedure or application in vivo in comparison with Orencia® fusion proteins, LEA29Y
Ig and / or human CTLA-4-Ig as in, for example, a therapeutic and / or prophylactic method of suppressing or inhibiting an immune response in a subject (for example, in the in vivo treatment of diseases or disorders of the immune system in a mammal such as, for example, a human being), a method of suppressing or inhibiting rejection of a donor tissue or organ transplant by a recipient (for example, by a mammal such as, for example, a human being) and / or other diagnostic treatment or procedures described elsewhere in this document.
Table 9. Summary of sample MLR test data
<dl><dt>Fusion protein (dimer) </dt><dd>Mean IC50 (nM) Log IC50 medium (nM) DE (log IC50 medium) (nM) </dd></dl>
<dl><dt>Orencia® fusion protein dimer </dt><dd> 12,53 1,05 0,23 </dd></dl>
<dl><dt>LEA29Y-Ig </dt><dd> 0,92 -0,19 0,48 </dd></dl>
<dl><dt>D3-IgG2 </dt><dd>0.06 -1.26 ND </dd></dl>
<dl><dt>D3-12-IgG2 </dt><dd> 0,09 -1,11 0,34 </dd></dl>
<dl><dt>D3-14-IgG2 </dt><dd> 0,08 -1,20 0,43 </dd></dl>
<dl><dt>D3-17-IgG2 </dt><dd> 0,09 -1,15 0,43 </dd></dl>
<dl><dt>D3-20-IgG2 </dt><dd> 0,14 -1,11 0,64 </dd></dl>
<dl><dt>D3-27-IgG2 </dt><dd> 0,13 -1,29 0,86 </dd></dl>
<dl><dt>D3-29-IgG2 </dt><dd> 0,11 -1,14 0,54 </dd></dl>
<dl><dt>D3-34-IgG2 </dt><dd> 0,10 -1,09 0,39 </dd></dl>
<dl><dt>D3-53-IgG2 </dt><dd> 0,02 -1,64 0,11 </dd></dl>
<dl><dt>D3-54-IgG2 </dt><dd>0.07 -1.13 ND </dd></dl>
<dl><dt>D3-56-IgG2 </dt><dd>0.06 -1.23 ND </dd></dl>
<dl><dt>D3-69-IgG2 </dt><dd>0.04 -1.41 ND </dd></dl>
<dl><dt>D3-71-IgG2 </dt><dd>0.05 -1.32 ND </dd></dl>
<dl><dt>D3-75-IgG2 </dt><dd>0.08 -1.11 ND </dd></dl>
<dl><dt>D3-76-IgG2 </dt><dd>0.08 -1.11 ND </dd></dl>
<dl><dt>Note: The term "ND" in Table 9 means "not available." </dt><dd /></dl>
Example 9
An adult human patient suffering from rheumatoid arthritis can be treated with a soluble mutant CTLA-4-Ig fusion protein as follows. A pharmaceutical composition is prepared comprising a soluble mutant CTLA-4-Ig fusion protein and a pharmaceutically acceptable carrier or carrier (eg, P BS). An exemplary soluble mutant CTLA-4-Ig fusion protein comprises two identical monomeric mutant CTLA-4-Ig fusion proteins linked together by one or more disulfide bonds, each monomeric fusion protein comprising such a CTLA ECD polypeptide. -4 mutant comprising a polypeptide sequence selected from any of SEQ ID NO: 1-73 fused at its C-terminus with the N-terminus of a human IgG2 Fc polypeptide. Exemplary fusion proteins include those comprising polypeptide sequences set forth in any of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222. Such fusion proteins are normally expressed in dimeric form. The concentration of the fusion protein in the pharmaceutical composition may be in a range of from about 0.05 mg / ml to about 200 mg / ml, from about 1 mg / ml to about 150 mg / ml, from about 25 mg / ml at about 120 mg / ml, from about 1 mg / ml to about 100 mg / ml, from about 25 mg / ml to about 100 mg / ml, from about 50 mg / ml to about 100 mg / ml, from about 50 mg / ml at approximately 75 mg / ml, from about 100 mg / ml to about 150 mg / ml, and the like. For example, the concentration of fusion protein in the pharmaceutical composition may be approximately 1 mg / ml, 5 mg / ml, 10 mg / ml, 15 mg / ml, 25 mg / ml, 30 mg / ml, 40 mg / ml , 50 mg / ml, 60 mg / ml, 70 mg / ml, 80 mg / ml, 90 mg / ml, 100 mg / ml, 150 mg / ml or 200 mg / ml. The pH of such pharmaceutical composition is approximately pH 4 to approximately pH 10, which includes approximately pH 5 to approximately pH 9, approximately pH 6.5 to approximately pH 8.5, preferably approximately pH 6.0 to pH 8.0, approximately 6.5 at pH 7.5, or about pH 7.0 at about pH 8.0.
The rheumatoid arthritis treatment of the patient is carried out by administering a therapeutically effective amount of mutant CTLA-4-Ig to the patient (eg, effective dose) by intravenous or subcutaneous injection. The injection site may be, for example, the arm, torso or leg of the patient. The effective dose of the mutant CTLA-4-Ig fusion protein administered is normally, but not limited to, for example, from about 0.01 mg / kg to about 100 mg / kg of body weight of the adult human patient such as , for example, about 0.01-5.0 mg / kg, about 0.01-3.0 mg / kg, about 0.05-2.5 mg / kg, about 0.1-2.0 mg / kg, approximately 0.1-1.0 mg / kg, approximately 0.01-0.05 mg / kg, approximately 0.5-1.5 mg / kg, approximately 1.0-4.0 mg / kg, approximately 1.0-3.0 mg / kg, approximately 1.0-2.0 mg / kg, which includes, but is not limited to, approximately 0.01 mg / kg, 0.05 mg / kg, 0.075 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.25 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 1.25 mg / ml, 1.5 mg / kg, 2 mg / kg, 2.5 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 10 mg / kg, 20 mg / kg, 25 mg / kg, 50 mg / kg, 75 mg / kg or 100 mg / kg of the patient's body weight is administered to the patient. Alternatively, an effective amount or dose or dose range described in the "Methods of the Invention" section above may be used. The dose of the fusion protein to be administered is determined based on the potency of the fusion protein and / or the severity of the patient's symptoms or signs of rheumatoid arthritis. The total amount of mutant CTLA-4-Ig fusion protein administered to the patient may be, for example, from about 0.01 mg to about 100 mg, usually from about 1 mg to 100 mg, from about 10 mg to 100 mg, from about 10 mg to about 75 mg, or from about 10 to about 50 mg. The volume of the pharmaceutical composition administered to the patient is determined based on the concentration of fusion protein in the composition and the dose of fusion protein to be administered. For subcutaneous injection, usually one to two milliliters of the pharmaceutical composition comprising the injection fusion protein is administered. For intravenous injection an appropriate volume of the pharmaceutical composition comprising the fusion protein can be administered.
After injection of the initial dose, a second identical dose of the fusion protein can be administered to the patient subcutaneously (for example, sc injection) or intravenously (for example, iv injection), for example, 1, 2, 3 or 4 weeks later of the initial dose. The dosage schedule may be one dose every two weeks, one dose / month, one dose every two months, etc., depending, for example, on the patient's condition. Subsequent doses may be administered every four weeks or more frequently, as necessary. The dosage frequency may vary depending on the patient's condition and may depend on the severity of the patient's symptoms or signs of rheumatoid arthritis.
In an exemplary aspect, an amount of a pharmaceutical composition comprising a mutant CTLA-4-Ig fusion protein dimer as disclosed herein (such as D3-29-IgG2, D3-54-IgG2 , D3-56-IgG2, D3-69-IgG2, etc.) and a pharmaceutically acceptable excipient sufficient to provide a dose of the fusion protein dimer of approximately 0.5 mg / kg body weight is administered by subcutaneous injection to a human being suffering from rheumatoid arthritis once a week or once. per month, as needed, depending on the patient's condition and response to the drug.
In another exemplary aspect, an amount of a pharmaceutical composition comprising a CTLA-4-Ig fusion protein dimer as disclosed herein (such as D3-29-IgG2, D3-54-IgG2, D3 -56-IgG2, D3-69-IgG2, etc.) and a pharmaceutically acceptable excipient sufficient to provide a dose of the fusion protein dimer of approximately 10 mg / kg is administered intravenously to a human being suffering from rheumatoid arthritis once a week or once a month, as needed, depending on the patient's condition and the response to the drug. Conventional iv procedures can be used for such administration. For example, the pharmaceutical composition can be infused in the human being with another liquid such as a sterile saline solution, dextrose solution or other isotonic solution using a conventional continuous intravenous drip by a conventional intravenous access device.
Each treatment procedure described above by sc or iv injection is expected to reduce or alleviate one or more biological signs, symptoms or responses associated with rheumatoid arthritis such as, for example, inflammation, joint palpation pain, joint swelling, pain, tissue atrophy and stiffness in the patient. Such treatment can further reduce the progression of the disease in the patient, particularly in the connective, muscular and skeletal tissues. For example, such treatment can reduce the progression of injury to or deterioration of connective tissue, muscle tissue by atrophy, bone, joints, cartilage and / or spinal column, and the like in the patient. Additional clinical symptoms of the disease may also be reduced or relieved, including injury to the skin, central nervous system or organs. Such treatment can also improve the physical functioning of the patient.
Example 10
An adult human patient who undergoes maintenance therapy for the prevention of organ transplant rejection can be treated with a soluble mutant CTLA-4-Ig fusion protein as follows. A pharmaceutical composition is prepared comprising a soluble mutant CTLA-4-Ig fusion protein and a pharmaceutically acceptable carrier or carrier (eg, PBS or the like). An exemplary soluble mutant CTLA-4-Ig fusion protein comprises two identical monomeric mutant CTLA-4-Ig fusion proteins linked together by one or more disulfide bonds, each monomeric fusion protein comprising such a CTLA ECD polypeptide. -4 mutant comprising a polypeptide sequence selected from any of SEQ ID NO: 1-73 fused at its C-terminus with the N-terminus of a human IgG2 Fc polypeptide. Exemplary fusion proteins include those comprising polypeptide sequences set forth in any of SEQ ID NO: 74-79, 197-200, 205-214 and 219-222. The concentration of the fusion protein in the pharmaceutical composition may be in a range of from about 0.05 mg / ml to about 200 mg / ml, from about 1 mg / ml to about 150 mg / ml, from about 25 mg / ml at about 120 mg / ml, from about 1 mg / ml to about 100 mg / ml, from about 25 mg / ml to about 100 mg / ml, from about 50 mg / ml to about 100 mg / ml, from about 50 mg / ml at approximately 75 mg / ml, from about 100 mg / ml to about 150 mg / ml, and the like. For example, the concentration of fusion protein in the pharmaceutical composition may be approximately 1 mg / ml, 5 mg / ml, 10 mg / ml, 15 mg / ml, 25 mg / ml, 30 mg / ml, 40 mg / ml, 50 mg / ml, 60 mg / ml, 70 mg / ml, 80 mg / ml, 90 mg / ml, 100 mg / ml, 150 mg / ml or 200 mg / ml. The pH of such pharmaceutical composition is approximately pH 4 to approximately pH 10, which includes approximately pH 5 to approximately pH 9, approximately pH 6.5 to approximately pH 8.5, approximately pH 6.0 to pH 8.0, approximately 6 , 5 at pH 7.5, or about pH 7.0 at about pH 8.0.
Maintenance therapy for the prevention or suppression of organ transplant rejection is carried out by administering a therapeutically effective amount of mutant CTLA-4-Ig to the patient (eg, effective dose) that has received an organ transplant (eg. , kidney transplant) by intravenous or subcutaneous injection. The injection site may be, for example, the arm, torso or leg of the patient. The effective dose of the mutant CTLA-4-Ig fusion protein administered is normally, but not limited to, for example, from about 0.01 mg / kg to about 100 mg / kg of body weight of the adult human patient such as , for example, about 0.01-5.0 mg / kg, about 0.01-3.0 mg / kg, about 0.05-2.5 mg / kg, about 0.1-2.0 mg / kg, approximately 0.1-1.0 mg / kg, approximately 0.01-0.05 mg / kg, approximately 0.5-1.5 mg / kg, approximately 1.0-4.0 mg / kg, approximately 1.0-3.0 mg / kg, approximately 1.0-2.0 mg / kg, which includes, but is not limited to, approximately 0.01 mg / kg, 0.05 mg / kg, 0.075 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.25 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 1.25 mg / ml, 1.5 mg / kg, 2 mg / kg, 2.5 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 10 mg / kg, 20 mg / kg, 25 mg / kg, 50 mg / kg, 75 mg / kg or 100 mg / kg of the patient's body weight is administered to the patient. Alternatively, an effective amount or dose or dose range described in the "Procedures" section above may be used. The dose of the fusion protein to be administered is determined based on the potency of the fusion protein and / or the severity of the symptoms or signs of rejection of the patient's organ transplant. The total amount of mutant CTLA-4-Ig fusion protein administered to the patient may be, for example, from about 0.01 mg to about 100 mg, usually from about 1 mg to 100 mg, from about 10 mg to 100 mg, from about 10 mg to about 75 mg, or from about 10 to about 50 mg. The volume of the pharmaceutical composition administered to the patient is determined based on the concentration of fusion protein in the composition and the dose of fusion protein to be administered. The fusion protein can be administered any day after transplantation, for example, day 1, 4, 7, 14, 28, 56, 84, etc. after transplant For subcutaneous injection, usually one to two milliliters of the pharmaceutical composition is administered. For intravenous injection an appropriate volume of the pharmaceutical composition comprising the fusion protein can be administered.
After injection of the initial dose, a second identical dose of the fusion protein can be administered to the patient subcutaneously or intravenously 1, 2, 3 or 4 weeks after the initial dose. The dosage schedule may be one dose every two weeks, one dose / month, one dose every two months, etc., depending, for example, on the patient's condition. Subsequent doses may be administered every four weeks or more frequently, as necessary, and continue, if desired, monthly. The dosage frequency may vary depending on the patient's condition and may depend on the severity of the symptoms or signs of transplant rejection of the patient's organ.
Such treatment is expected to reduce or alleviate one or more biological signs, symptoms or responses associated with organ transplant rejection such as, for example, acute rejection of the transplanted organ, chronic rejection of the transplanted organ, decrease in the function of the transplanted organ, increased serum creatinine levels in the patient and / or increased infiltration of T lymphocytes in the transplanted organ. Such treatment can reduce the probability of rejection of the organ transplanted by the patient's immune system.
Example 11
Pharmacokinetic evaluation of mutant CTLA-4-IgG2 fusion proteins in rats.
The serum concentration of a therapeutic agent after external administration to a living organism greatly influences the therapeutic efficacy, and is determined by pharmacokinetic evaluation (PC). In the following procedure, PC profiles were evaluated in rats for representative mutant CTLA-4-IgG2 test items D3-29-IgG2, D3-54-IgG2, D3-56-IgG2, D3-69-IgG2 and D3 -75-IgG2 compared to both hCTLA-4-IgG2 and Orencia® fusion protein test articles. The study design and the generation and interpretation of data are immediately described.
In vivo study design.
Male Hans Wistar rats of the same weight were used after an acclimatization period of at least 5 days. Dosage volumes of test items were calculated for individual animals based on their weight so that everyone received 1 mg / kg of the test item. Therefore, a typical 150 gram (g) rat received 150 μl
of dosing volume since each test article was prepared at 1 mg / ml in PBS. A single administration of a test article of mutant CTLA-4-IgG2 described above, hCTLA4IgG2 or Orencia® fusion protein, was administered both as an intravenous bolus (iv or IV) and subcutaneously (abbreviated "sc" or " SC ”). The study size was sufficient for a minimum of four blood samples of 300 μl per moment of time, while the volume of blood drawn from any given rat was restricted to no more than 10% of the total blood volume. The blood sampling time was both before the dose, 5 minutes (min), 30 min, 2 hours (h), 4 h, 8 h, 1 day (d), 2 d, 3 d, 4 d , 6 d, 8 d, 10 d, 12 d and 14 d after the dose, or 5 min, 30 min, 2 h, 4 h, 8 h, 1 d, 2 d, 3 d, 4 d, 6 d, 8 d, 10 d, 11 d, 12 d, 13 d, 14 d and 15 d after the dose for iv and sc administrations, respectively. Serum was prepared from individual blood samples and tested by ELISA to quantify the presence of the administered test article.
PC ELISA procedure.
The mutant CTLA-4-IgG2, hCTLA-4IgG2 or Orencia® fusion protein present in the serum samples was bound to human CD80-murine IgG (described above) previously coated on microtiter plates. Detection was achieved by adding a goat antibody directed against human horseradish peroxidase conjugated (HRP) (Jackson ImmunoResearch No. 109-035-098). The quantification was by using a chromogenic HRP substrate, 3,3 ', 5,5'-tetramethylbenzidine (TMB), plus hydrogen peroxide (Kem-En-Tec No. 4390A), whereby the reaction was stopped by 0.2 N sulfuric acid addition (H2SO4) and optical absorbance was measured at 450 nm by a spectrophotometer. Serum samples were previously diluted 1/20 before adding to the ELISA plate so that the matrix was normalized to 5% rat sera and additionally diluted in 5% rat sera for a total of eight dilutions. . The concentration of each diluted serum sample was quantified against a standard curve prepared using titers of the same test article enriched in 5% rat sera. The standard curve ranged from 10 to 0.078 ng / ml, and it was determined that the accuracy range was twice the noise at 5 ng / ml in 5% of rat sera. The quality of the standard curve was evaluated by quality controls (QC) of the same test article prepared in 5% of rat sera at high, medium and low concentrations of the precision range of the standard curve. The acceptance criteria for QC was that the observed QC concentration be within 20% of the expected QC concentration. The concentration of an individual unknown serum sample was generated by averaging the concentrations assigned to dilutions with optical densities (OD) within the precision range of the standard curve. At least 4 individual serum samples were used to calculate the mean serum concentration at each nominal time.
PC parameters.
Figures 15A and 15B show PC profiles for the Orencia® fusion protein, hCTLA-4-IgG2 and the mutant CTLA-4-IgG2 fusion proteins administered at 1 mg / kg as a single (A) intravenous bolus (IV) or (B) subcutaneous injection (SC) in rats. Error bars represent the standard deviation of the mean (SD). The dashed line represents the lowest limit of quantification for ELISA (~ 3 ng / ml for the test article in 100% sera). The mean serum concentration at each nominal time after administration of the test article at time 0 h comprises the data points of the semi-logarithmic-time concentration profile in Figure 15.
The mean serum concentrations were used to generate PC parameters using WinNonLin model 201 (bolus iv input), or model 200 (extravascular input) for the iv (IV) or sc (SC) dosage pathways, respectively. Table 10 summarizes the key PC parameters for the sc and iv administration routes, respectively.
Table 10. Summary of PC parameters for Orencia® fusion protein, hCTLA-4-IgG2 and fusion proteins CTLA-4-IgG2 mutants administered at 1 mg / kg as a single IV bolus or SC to rats
<dl><dt>Compound </dt><dd>Via Cmax (ug / l) T1 / 2 (h) ABC (h * ng / l) Cl (ml / h / kg) Vz (ml / kg) </dd></dl>
<dl><dt>Orencia CTLA-4lgG2 D3-29 D3-54 D3-56 D3-69 D3-75 </dt><dd>SC SC SC SC SC SC SC 3.3 5.9 4.6 4.5 7.4 6.0 9.0 70.0 45.0 11.2 23.6 23.7 28.1 56.4 391 838 650 528 1049 967 1204 2.6 1.2 1.5 1.9 1.0 1.0 0.8 258.13 77.49 24.90 64.52 32.67 41.97 67.59 </dd></dl>
<dl><dt>Orencia CTLA-4IgG2 D3-29 D3-54 D3-56 D3-69 D3-75 </dt><dd>IV IV IV IV IV IV IV 22.3 66.2 43.0 20.6 34.2 81.9 30.1 42.3 49.8 33.0 39.4 15.3 83.0 65.4 728 2483 912 1034 1822 2133 2326 1.37 0.40 1.10 0.97 0.55 0.47 0.43 83.9 29.0 52.2 55.0 12.1 56.1 40.5 </dd></dl>
Cmax refers to the maximum serum concentration of the test article. The value of the terminal half-life (T1 / 2) is the time required in hours for the concentration of the test article in the serum to decrease by half during the termination phase of the concentration-time profile. The area under the curve (ABC) of the serum-time concentration is quantified from zero time to infinity using the trapezoidal rule. Elimination (Cl) was calculated using the dose / ABC equation, while the volume of distribution (Vz) of the terminal phase was calculated using the Cl / k equation.
The bioavailability factor (F) for each compound is presented in Table 11, and was determined by calculating the ABC by the subcutaneous route / ABC by the intravenous route.
Table 11. Comparison of the bioavailability of the Orencia® fusion protein, hCTLA-4-Ig2, D3-29-IgG2, D3-54-IgG2, D3-56-IgG2, D3-69-IgG2 and D3- fusion proteins. 75-IgG2
<dl><dt>Compound </dt><dd>Bioavailability </dd></dl>
<dl><dt>Orencia </dt><dd> 0,54 </dd></dl>
<dl><dt>CTLA-4IgG2 </dt><dd> 0,34 </dd></dl>
<dl><dt>D3-29 </dt><dd> 0,71 </dd></dl>
<dl><dt>D3-54 </dt><dd> 0,51 </dd></dl>
<dl><dt>D3-56 </dt><dd> 0,58 </dd></dl>
<dl><dt>D3-69 </dt><dd> 0,45 </dd></dl>
<dl><dt>D3-75 </dt><dd> 0,52 </dd></dl>
The human CTLA-4-IgG2 and Orencia® fusion protein had similar PC profiles despite their difference in structural regions of IgG, implying that the Fc portions of human IgG2 and mutated human IgG1 of these respective test items have PC activity comparable when the functional domain is constant. By inference, any change observed in the PC profile for mutant CTLA-4-IgG2 fusion proteins with respect to the Orencia® fusion protein must therefore be attributable to differences in the functional domain, and not to the Fc portion.
For each mutant CTLA-4-IgG2 fusion protein, elimination was slow as suggested by long half-life values and large areas under curves. Half-lives ranged from 11.2 to 56.4 h for SC dosing and 15.3 to 83.0 hours (h) for IV dosing compared to Orencia® fusion protein, which had a half-life of 70, 0 or 42.3 hours when administered by SC or IV routes, respectively. The ABC values for the mutant CTLA-4-IgG2 fusion proteins were on average higher than those of the Orencia® fusion protein. After SC dosing, the mean was 879.5 +/- 281.6 h * kg * ng / l / mg with respect to 391 h * kg * ng / l / mg for the Orencia® SC fusion protein, while that an IV administration gave an average ABC of 1645.5 +/- 641.1 h * kg * ng / l / mg with respect to 728 h * kg * ng / l / mg for the Orencia® IV fusion protein.
The volume of distribution was similar for both routes of administration in which the mutant CTLA-4-IgG2 fusion proteins were distributed outside the serum but within the extravascular fluid as suggested by the average value of 44.8 ml / kg, which is greater than the reference volume for plasma of 30 ml / kg, and within the reference limit of extracellular fluid of 300 ml / kg for a conventional rat (Davies, B. et al., Pharm. Res. 10 (7) : 1093-95 (1993)).
The bioavailability was also similar for most of the mutant CTLA-4-IgG2 fusion proteins, with an average of 0.6 +/- 0.1, which was favorably compared with the bioavailability of 0.53 of the fusion protein Orencia®.
Finally, Cmax was generally greater for the mutant CTLA-4-IgG2 fusion proteins with respect to the Orencia® fusion protein. Cmax values ranged from 4.5 to 9.3 ug / l for SC dosing and from 20.6 to 81.9 ug / l for IV dosing compared to the Orencia® fusion protein, which had a Cmax of 3.3 or 22.3 ug / l when administered by SC or IV routes, respectively.
In general, PC data showed that all the mutant CTLA-4-IgG2 fusion proteins evaluated normally had a PC profile not inferior to the Orencia® fusion protein when administered to rats at 1 mg / kg via SC or IV routes, and that the Fc portions of IgG1 or IgG2 were comparable when the functional domain was constant.
Example 12
This example describes a method for creating a stably transfected cell line to express mutant CTLA4-Ig fusion proteins of the invention using the cell line for routine laboratory scale production of the mutant CTLA4-Ig fusion protein, and purifying the proteins. fusion CTLA-4-Ig mutants of cell expression media. Although this example specifically describes a process for creating a CHO-K1 cell line stably transfected to express the D3-54-IgG2 fusion protein using such a cell for laboratory scale production and purifying the protein media, the procedures described in the This document can be used with any mutant CTLA-4-Ig fusion protein of the invention and / or any appropriate cell line disclosed above.
Creation of a stable transfected cell line.
Materials.
CHO-K1 cells without prior treatment (without transfecting): CHO-K1 cells adapted to serum-free suspension growth in chemically defined medium (cell ID: M4-PeM-0436-112-01) were stored in liquid nitrogen vapor phase (Dewar MVE1536P). A vial of M4-PeM-0436-112-01 was thawed and cultured with OptiCHO ™ CD medium (Invitrogen, No. 12681) in shaken flasks. The cultures provided cells for transfection and the medium was conditioned for growth and cloning. All cultures were grown at 37 ° C, 5% CO2.
Plasmid: DNA encoding the D3-54 mutant CTLA-4 ECD fused with an Fc region of human IgG2 was inserted into the CET1019AS UCOE (Millipore) vector and the resulting CET1019AS-D3-54-IgG2 plasmid was used for all transfections
Cell culture medium: Medium without chemically defined animal component CD Opti-CHO (Invitrogen No. 12681), supplemented with 2% v / v of 200 mM L-glutamine (Invitrogen No. 25031), was used for all cultures.
Conditioning medium: Conditioning medium was obtained by culturing the parental CHO-K1 cell line in CD Opti-CHO medium. At cell numbers ≥ 5 x 105 cells / ml, the cell culture was centrifuged and the supernatant of the conditioned medium was sterilized by filtration. The conditioned medium was prepared fresh every day for use or stored at 2-8 ° C for up to 7 days.
50% conditioned medium: The conditioned medium (above) is used in combination with an equal volume of fresh cell culture medium; Fresh prepared every day.
Analytical Procedures
The determination of the cell number and viability were performed with a Cedex or Cedex HiRes (Innovatis) cell counter.
Initial screening of clones expressing the mutant CTLA-4-Ig fusion protein (D3-54-IgG2) for production was performed by ELISA. ELISA plates were coated with murine hCD80-Ig fusion protein overnight. The next day, the samples to be analyzed were transferred to ELISA plates at dilutions 50 and 200 times in duplicate. After two hours of incubation, antibody directed against human IgG-HRP was added and incubated for 30 minutes. Plates were developed with TMB and read at 450 nm. The gross optical densities (OD) were reported.
Quantitative determination of the concentration of D3-54-IgG2 fusion protein was performed by an HPLC procedure with protein A using a Poros A / 20 column (ABI No. 1-5024-12). Two buffers were used: buffer A: 50 mM phosphoric acid, 150 mM potassium chloride, pH 7.6 ± 0.1 and buffer B: 50 mM phosphoric acid, 150 mM potassium chloride, pH 2.5 ± 0.1 . Both buffers additionally had 5% isopropanol added. The equilibrium and washing after injection of the sample was with 42% buffer A and 58% buffer B (pH 6.5). Elution was a linear gradient at 12% buffer A and 88% buffer B for 1 minute.
Process.
The non-pretreated adherent CHO-K1 cells used for the creation of stable cell lines used in the GMP production of the D3-54-IgG2 fusion protein were adapted to suspension growth in chemically defined OptiCHO ™ CD media. One vial of these CHO-K1 cells without prior treatment was thawed and cultured in 125 ml shake flasks containing OptiCHO ™ CD media at a density of 5 x 105 viable cells / ml. two x 106 viable cells were resuspended in 400 µl of 50% conditioned medium and combined with 20 µg plasmid DNA (D3-54-IgG2 in a CET1019AS UCEO vector) in a cuvette. Electroporation was performed with a Gene Xcell (BioRad) button at 320 volts (V) with a square wavelength pulse length of 15 milliseconds (ms). Duplicate transfections were performed and the cells then gathered. The pooled cells were transferred to a T-25 flask containing 5 ml of 50% conditioned medium and incubated for two days.
Transfected cells were both directly dispensed in 96-well plates for cloning and cultured with antibiotic selection until a stable set was obtained, and then dispensed in 96-well plates. Two days after electroporation, the culture was diluted to 1250 cells / ml in conditioned medium containing 8 μg / ml of puromycin for selection pressure. The cells were dispensed in 96-well plates at 200 μl per well (250 cells / well). The plates were incubated for approximately 10 days to destroy the transfected and transiently transfected cells. After 10-12 days, each well in each plate was visually inspected to identify wells with individual colonies. These wells were then re-inspected to verify that they contained individual healthy colonies suitable for expansion in 24-well plates.
Two days after electroporation, the culture was centrifuged and resuspended in 50% conditioned medium containing 7 μg / ml puromycin for the selection pressure. A control flask was also inoculated with untransfected cells in the same medium. Based on continuous optimization studies, the concentration of puromycin increased to 8 μg / ml after 3 days. The stable set was generated 10-12 days after selection, when all cells died in the control flask. The expression of the product in the stable set was verified by HPLC with protein A and the viability of the culture was verified that was> 95%. The cells were seriously diluted in conditioned medium without puromycin to a final density of 3.8 cells / ml. The cells were seeded on 96-well plates at 200 µl per well (75 cells / plate or 0.8 cells / well).
After one day each well in each plate was visually inspected to identify wells with individual cells or colonies. The next day the wells with individual colonies of 2-4 cells were selected. Any well with more than two colonies was removed. A second operator verified the selections. The wells were then rechecked to verify that they contained individual healthy colonies suitable for expansion in 24-well plates
The clones of the 96-well plates were expanded in 24-well plates containing 1 ml of conditioned medium per well with 8 μg / ml of puromycin. The entire contents of the wells selected from the 96-well plates with individual colonies were transferred to individual wells in the 24-well plates. 200 µl of each new well was taken in the 24-well plate to wash the corresponding well in the 96-well plate and transferred again. For support, 200 μl of conditioned medium containing 8 μg / ml of puromycin was added back to each well in the 96-well plates.
After 1-3 days, each well in the 24-well plates was sampled and tested for D3-54-IgG2 expression by ELISA. Clones were selected for further expansion based on the OD values for gross ELISA, in addition to the demonstration of adequate growth.
The upper 35-40 clones, based on ELISA and observable growth results, were expanded in T-25 flasks containing 5 ml of conditioned medium with 8 μg / ml of puromycin. The entire contents of each of the selected wells of the 24-well plates were transferred to individual T-25 flasks. Residual cells in the wells were washed with the same medium and added to the corresponding T-25 flask. For support, 1 ml of conditioned medium containing 8 μg / ml of puromycin was added back to each well in the 24-well plates.
The number of clones was further reduced by selecting clones with the highest productivity. The cells were resuspended in fresh medium at 1-2 x 105 viable cells / ml and seeded in T25 flasks (5 ml culture) or 125 ml shake flasks (12 ml culture). The cultures were incubated for 22-24 hours and then a determination of the cell density and final viability was made and a sample was taken for the determination of the product concentration by HPLC with protein A. Productivity was calculated by dividing the total amount of protein produced by the total number of viable cells in the flask and dividing by the duration of the culture. The units became picograms per cell per day or "pcd." Clones were classified according to their pcd values, but clones that did not show significant growth were omitted. The upper clones were expanded in flasks with 125 ml shaking for cryopreservation and subsequent evaluation of growth and productivity.
Clones to be evaluated further were seeded in flasks with shaking from 250 ml to 1 x 105 viable cells / ml in 50 ml of fresh medium. When the cell density reached 1 x 106 viable cells / ml, the culture was transferred to a new flask with stirring, again to 1 x 105 viable cells / ml in 50 ml of fresh medium. The pass was repeated once more. During this third pass, the culture was sampled daily for the determination of the number of cells, viability and concentration of product by HPLC with protein A.
The upper clones expressing the D3-54-IgG2 fusion protein based on growth and specific production rates were selected for subcloning. Subcloning was performed by limiting dilution as described in the previous section for stable sets, with the exception that puromycin was not used at any time. Expansion, screening and evaluation of subclones were also performed as described above.
The selected subclones were subjected to repeated passes in flasks with shaking for approximately 90 days to assess production stability. In each pass, the cells were seeded in flasks with agitation of 125 ml to 1 x 105 viable cells / ml in 25 ml of fresh medium. The cultures were subjected to passes every 3-4 days. Before each pass, cell density and viability were measured and a sample was taken to determine the product concentration by HPLC with protein A.
The selected clones and subclones were cryopreserved from the moment of classification by pcd values at various times in the stability assessment. The freezing medium was prepared again with 90% growth medium and 10% DMSO (Sigma). The cells of the flask cultures with agitation were centrifuged and resuspended in freezing medium at densities ranging from 2-10 x 106 cells / ml. The cell suspension was dispensed in 1 ml aliquots in cryogenic vials. The cryogenic vials were placed in a freezer vessel with isopropanol and stored at -80 overnight. The frozen vials were transferred to vapor phase storage of liquid nitrogen the next day.
Production of mutant CTLA4-IgG2 fusion proteins.
A cryovial containing 1 ml volume of CHO-K1 cells expressing the D3-54-IgG2 fusion protein is thawed and cultured in 125 ml shake flasks containing OptiCHO ™ CD media at 37 ° C and 5% CO2 at a density of 5 x 105 viable cells / ml. Several flasks are combined to inoculate a corrugated bag at 1-2 x 105 cells / ml in a volume of 5 or 10 l of OptiCHO ™ CD medium with 4 mM glutamine. The cultivation of the corrugated bag is maintained in an incubation oven at 37 ° C supplemented with 5% CO2 in a rolling platform environment of 18-22 rpm and an angle of 8 degrees for equipment purchased from Sartorius Stedim Biotech. The culture is sampled daily for cell numbers, viability, nutrient level, metabolite profile and expression level of mutant CTLA-4-IgG2 (i.e., D3-54-IgG2) using an HPLC assay with protein A. The culture is collected when the viability decreases to ~ 50%, usually 9-11 days after inoculation. The cell culture material is clarified by filtration using a combination of deep filtration and sterile filtration and is used both immediately for further processing and stored at 2-8 ° C.
Purification of mutant CTLA-4-IgG2 fusion proteins.
The mutant CTLA4-IgG2 fusion proteins (D3-54-IgG2) were purified by affinity chromatography with protein A using an AKTA Explorer HPLC system (GE Healthcare). A mutant CTLA-4-Ig fusion protein (D3-54-IgG2) bound to FF MabSelect protein A columns (GE Healthcare, No. 17-5079-01) in PBS buffer (Invitrogen), was loaded at ~ 10 mg / ml of chromatography medium, washed with the same buffer, eluted with 100 mM citric acid buffer (pH 4.0) and then neutralized by adding 1/10 volume of Tris 2 M base. The purified protein A sample is further processed by diafiltration using a tangential flow filtration system (TFF) with a buffer exchange in 20 mM Tris-Cl, pH 7.5.
The protein sample exchanged by buffer is further purified by anion exchange chromatography on a loaded Q-Sepharose column at ~ 10 mg / ml loading density. The bound protein is eluted using a linear NaCl gradient of 20 column volumes (VC) of 0-500 mM NaCl in 20 mM Tris-Cl, pH 7.5. The main peak fractions are collected and the concentration is determined by measuring the absorbance at 280 nm.
Protein purity is confirmed by SDS-PAGE analysis and the monomer content is determined using a size exclusion HPLC method. The samples are stored in aliquots at 2-8 ° C or -20 ° C for prolonged periods before use.
Although the foregoing invention has been described in some detail for the purpose of clarity and understanding, it will be apparent to one skilled in the art from a reading of the present disclosure that various changes in form and detail can be made without departing from the true scope of the invention. It is understood that the materials, examples and embodiments herein are only described for illustrative purposes and are not intended to be limiting and that various modifications or changes in light thereof will be suggested by those skilled in the art.
SEQUENCE LIST
<110> Maxygen, Inc. Karrer, Erik E. Paidhungat, Madan M. Bass, Steven H. Neighbors, Margaret Punnonen, Juha Chapin, Steven J. Viswanathan, Sridhar Larsen, Brent R.
<120> IMMUNOSUPPRESSING NUCLEIC POLYPEPTIDES AND ACIDS
<130> 0364.210WO
<150> US 60 / 984,631
<151>
<150> US 61 / 051,215
<151>
<160> 228
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 124 5 <212> PRT
<213> Artificial sequence
<220>
<223> CTLA-4 D3-1 10 ECD mutant
<400> 1
15 <210> 2
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-2 mutant of the CTLA-4 ECD
<400> 2
<210> 3
<211> 124
<dl><dt><212></dt><dd> PRT 30 <213> Artificial sequence </dd></dl>
<220>
<223> D3-3 mutant of the CTLA-4 ECD
<400> 3
<210> 4
<211> 124
<dl><dt><212></dt><dd> PRT 10 <213> Artificial sequence </dd></dl>
<220>
<223> D3-4 mutant of the CTLA-4 ECD
15 <400> 4
<210> 5 20 <211> 124
<212> PRT
<213> Artificial sequence
<220> 25 <223> D3-5 mutant of the CTLA-4 ECD
<400> 5 <210> 6
<213> Artificial sequence
<220>
<223> D3-6 CTLA-4 10 ECD mutant
<400> 6
15 <210> 7
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-7 CTLA-4 ECD mutant
<400> 7
<210> 8
<211> 124
<212> PRT 5 <213> Artificial sequence
<220>
<223> D3-8 CTLA-4 ECD mutant
10 <400> 8
<210> 9 15 <211> 124
<212> PRT
<213> Artificial sequence
<220> 20 <223> D3-9 CTLA-4 ECD mutant
<400> 9 <210> 10
<213> Artificial sequence
<220>
<223> D3-11 mutant of the CTLA-4 10 ECD
<400> 10
15 <210> 11
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-12 mutant of the CTLA-4 ECD
<400> 11
<210> 12
<213> Artificial sequence
<220>
<223> D3-14 mutant of the CTLA-4 10 ECD
<400> 12
15 <210> 13
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-15 mutant of the CTLA-4 ECD
<400> 13
<210> 14
<213> Artificial sequence
<220>
<223> D3-16 mutant of the CTLA-4 10 ECD
<400> 14
15 <210> 15
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-17 mutant of the CTLA-4 ECD
<400> 15
<210> 16
<213> Artificial sequence
<220>
<223> D3-19 mutant of the CTLA-4 10 ECD
<400> 16
15 <210> 17
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-20 mutant of the CTLA-4 ECD
<400> 17
<210> 18
<213> Artificial sequence
<220>
<223> D3-21 mutant of CTLA-4 10 ECD
<400> 18
15 <210> 19
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-22 mutant of the CTLA-4 ECD
<400> 19
<210> 20
<213> Artificial sequence
<220>
<223> D3-23 CTLA-4 10 ECD mutant
<400> 20
15 <210> 21
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-24 mutant of the CTLA-4 ECD
<400> 21
<210> 22
<213> Artificial sequence
<220>
<223> D3-25 CTLA-4 10 ECD mutant
<400> 22
15 <210> 23
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-26 mutant of the CTLA-4 ECD
<400> 23
<210> 24
<213> Artificial sequence
<220>
<223> D3-27 CTLA-4 10 ECD mutant
<400> 24
15 <210> 25
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-28 mutant of the CTLA-4 ECD
<400> 25
<210> 26
<213> Artificial sequence
<220>
<223> D3-29 mutant of CTLA-4 10 ECD
<400> 26
15 <210> 27
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-30 mutant of the CTLA-4 ECD
<400> 27
<210> 28
<213> Artificial sequence
<220>
<223> D3-31 CTLA-4 10 ECD mutant
<400> 28
15 <210> 29
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-32 CTLA-4 ECD mutant
<400> 29
<210> 30
<213> Artificial sequence
<220>
<223> D3-33 CTLA-4 10 ECD mutant
<400> 30
15 <210> 31
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-34 CTLA-4 ECD mutant
<400> 31
<210> 32
<213> Artificial sequence
<220>
<223> D3-39 CTLA-4 10 ECD mutant
<400> 32
15 <210> 33
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-50 CTLA-4 ECD mutant
<400> 33
<210> 34
<213> Artificial sequence
<220>
<223> D3-52 CTLA-4 10 ECD mutant
<400> 34
15 <210> 35
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-53 CTLA-4 ECD mutant
<400> 35
<210> 36
<213> Artificial sequence
<220>
<223> D3-54 CTLA-4 10 ECD mutant
<400> 36
15 <210> 37
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-55 CTLA-4 ECD mutant
<400> 37
<210> 38
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-56 CTLA-4 10 ECD mutant </dd></dl>
<400> 38
<210> 40
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-58 CTLA-4 10 ECD mutant </dd></dl>
<dl><dt>15 </dt><dd /></dl>
<dl><dt><210> 39 </dt><dd /></dl>
<dl><dt><211> 124 </dt><dd /></dl>
<dl><dt><212> PRT </dt><dd /></dl>
<dl><dt><213> Artificial sequence </dt><dd /></dl>
<dl><dt>20 </dt><dd /></dl>
<dl><dt><220> </dt><dd /></dl>
<dl><dt><223> D3-57 CTLA-4 ECD mutant </dt><dd /></dl>
<dl><dt><400> 39 </dt><dd /></dl>
<dl><dt>25 </dt><dd /></dl>
<400> 40
15 <210> 41
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-59 CTLA-4 ECD mutant
<400> 41
<210> 42
<213> Artificial sequence
<220>
<223> D3-60 CTLA-4 10 ECD mutant
<400> 42
15 <210> 43
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-61 CTLA-4 ECD mutant
<400> 43
<210> 44
<213> Artificial sequence
<220>
<223> D3-62 CTLA-4 10 ECD mutant
<400> 44
15 <210> 45
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-63 CTLA-4 ECD mutant
<400> 45
<210> 46
<213> Artificial sequence
<220>
<223> D3-64 CTLA-4 10 ECD mutant
<400> 46
15 <210> 47
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-65 CTLA-4 ECD mutant
<400> 47
<210> 48
<213> Artificial sequence
<220>
<223> D3-66 CTLA-4 10 ECD mutant
<400> 48
15 <210> 49
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-68 CTLA-4 ECD mutant
<400> 49
<210> 50
<213> Artificial sequence
<220>
<223> D3-69 CTLA-4 10 ECD mutant
<400> 50
15 <210> 51
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-70 CTLA-4 ECD mutant
<400> 51
<210> 52
<213> Artificial sequence
<220>
<223> D3-71 CTLA-4 10 ECD mutant
<400> 52
15 <210> 53
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-72 CTLA-4 ECD mutant
<400> 53
<210> 54
<213> Artificial sequence
<220>
<223> D3-73 CTLA-4 10 ECD mutant
<400> 54
15 <210> 55
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-74 CTLA-4 ECD mutant
<400> 55
<210> 56
<213> Artificial sequence
<220>
<223> D3-75 CTLA-4 10 ECD mutant
<400> 56 <210> 58
<dl><dt>15 </dt><dd /></dl>
<dl><dt><210> 57 </dt><dd /></dl>
<dl><dt><211> 124 </dt><dd /></dl>
<dl><dt><212> PRT </dt><dd /></dl>
<dl><dt><213> Artificial sequence </dt><dd /></dl>
<dl><dt>20 </dt><dd /></dl>
<dl><dt><220> </dt><dd /></dl>
<dl><dt><223> D3-76 CTLA-4 ECD mutant </dt><dd /></dl>
<dl><dt><400> 57 </dt><dd /></dl>
<dl><dt>25 </dt><dd /></dl>
<213> Artificial sequence
<220>
<400> 58
15 <210> 59
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D1T mutant of the CTLA-4 ECD
<400> 59
<210> 60
<213> Artificial sequence
<220>
<400> 60
15 <210> 61
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3 mutant of the CTLA-4 ECD
<400> 61
<210> 62
<213> Artificial sequence
<220>
<400> 62
15 <210> 63
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D5 mutant of the CTLA-4 ECD
<400> 63
<210> 64
<213> Artificial sequence
<220>
<400> 64
15 <210> 65
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D20 mutant of the CTLA-4 ECD
<400> 65
<210> 66
<213> Artificial sequence
<220>
<400> 66
15 <210> 67
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D23 mutant of the CTLA-4 ECD
<400> 67
<210> 68
<213> Artificial sequence
<220>
<400> 68
15 <210> 69
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D26 mutant of the CTLA-4 ECD
<400> 69
<210> 70
<213> Artificial sequence
<220>
<400> 70
15 <210> 71
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D28 mutant of the CTLA-4 ECD
<400> 71
<210> 72
<213> Artificial sequence
<220>
<400> 72
15 <210> 73
<211> 124
<212> PRT
<213> Artificial sequence
20 <220>
<223> D31 mutant of the CTLA-4 ECD
<400> 73
<210> 74
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-12-IgG2 fusion protein (with C-end lysine) 10 </dd></dl>
<400> 74
<210> 75
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-14-IgG2 fusion protein (with C-end lysine) 10 </dd></dl>
<400> 75
<210> 76
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-17-IgG2 fusion protein (with C-end lysine) 10 </dd></dl>
<400> 76
<210> 77
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-20-IgG2 fusion protein (with C-end lysine) 10 </dd></dl>
<400> 77
<210> 78
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-27-IgG2 fusion protein (with C-end lysine) 10 </dd></dl>
<400> 78
<210> 79
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-29-IgG2 fusion protein (with C-end lysine) 10 </dd></dl>
<400> 79
<210> 80
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> Coding sequence of mutant D3-1 of the CTLA-4 10 ECD </dd></dl>
<400> 80 <210> 81
<211> 372 5 <212> DNA
<213> Artificial sequence
<220>
<223> D3-2 coding sequence of CTLA-4 10 ECD mutant
<400> 81
15 <210> 82
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> D3-3 coding sequence of CTLA-4 ECD mutant
<400> 82
<210> 83
<211> 372
<212> DNA 30 <213> Artificial sequence
<220>
<223> Coding sequence of mutant D3-4 of the CTLA-4 ECD
35 <400> 83 <210> 84
<211> 372
<212> DNA
<213> Artificial sequence 5
<220>
<223> Coding sequence of D3-5 mutant of the CTLA-4 ECD
<400> 84 10
<210> 85
<211> 372 15 <212> DNA
<213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-6 20
<400> 85
25 <210> 86
<211> 372
<212> DNA
<213> Artificial sequence
30 <220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-7
<400> 86
<210> 87
<213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-8 45
<400> 87
5 <210> 88
<211> 372
<212> DNA
<213> Artificial sequence
10 <220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-9
<400> 88
<210> 89
<211> 372
<212> DNA 20 <213> Artificial sequence
<220>
<223> D3-11 mutant coding sequence of CTLA-4 ECD
25 <400> 89
<210> 90 30 <211> 372
<212> DNA
<213> Artificial sequence
<220> 35 <223> Sequence coding sequence of CT3-4 ECD mutant D3-12
<400> 90 <210> 91
<211> 372 5 <212> DNA
<213> Artificial sequence
<220>
<223> D3-14 mutant coding sequence of CTLA-4 10 ECD
<400> 91
15 <210> 92
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> CTLA-4 ECD mutant
<400> 92
<210> 93
<211> 372
<212> DNA 30 <213> Artificial sequence
<220>
<223> D3-16 coding sequence of CTLA-4 ECD mutant
35 <400> 93 <210> 94
<213> Artificial sequence
<220>
<223> D3-17 mutant coding sequence of CTLA-4 10 ECD
<400> 94
15 <210> 95
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> D3-19 mutant coding sequence of CTLA-4 ECD
<400> 95
<210> 96
<211> 372
<212> DNA 30 <213> Artificial sequence
<220>
<223> D3-20 mutant coding sequence of CTLA-4 ECD
35 <400> 96 <210> 97
<211> 372 5 <212> DNA
<213> Artificial sequence
<220>
<223> D3-21 coding sequence of CTLA-4 10 ECD mutant
<400> 97
15 <210> 98
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> D3-22 coding sequence of CTLA-4 ECD mutant
<400> 98
<210> 99
<211> 372
<212> DNA 30 <213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-23
35 <400> 99 <210> 100
<211> 372
<212> DNA
<213> Artificial sequence 5
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-24
<400> 100 10
<210> 101
<211> 372 15 <212> DNA
<213> Artificial sequence
<220>
<223> D3-25 coding sequence of CTLA-4 20 ECD mutant
<400> 101
25 <210> 102
<211> 372
<212> DNA
<213> Artificial sequence
30 <220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-26
<400> 102
<210> 103
<211> 372
<212> DNA 40 <213> Artificial sequence
<220>
<223> D3-27 coding sequence of CTLA-4 ECD mutant
Four. Five <400> 103 <212> DNA
<213> Artificial sequence
<220> 10 <223> Sequence coding sequence of D3-28 mutant of the CTLA-4 ECD
<400> 104
<210> 105
<211> 372
<212> DNA
<213> Artificial sequence 20
<220>
<223> D3-29 coding sequence of CTLA-4 ECD mutant
<400> 105 25
<210> 106
<211> 372 30 <212> DNA
<213> Artificial sequence
<220>
<dl><dt><223> </dt><dd>Coding sequence of CT3-4 ECD mutant D3-30 </dd></dl>
<400> 106
<210> 107
<213> Artificial sequence
<220>
<dl><dt><223> </dt><dd>Coding sequence of mutant D3-31 of the CTLA-4 10 ECD </dd></dl>
<400> 107
15 <210> 108
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-32
<400> 108
<210> 109
<211> 372
<212> DNA 30 <213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-33
35 <400> 109 <210> 110
<211> 372 5 <212> DNA
<213> Artificial sequence
<220>
<223> D3-34 coding sequence of CTLA-4 10 ECD mutant
<400> 110
15 <210> 111
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-39
<400> 111
<210> 112
<211> 372
<212> DNA 30 <213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-50
35 <400> 112 <210> 113
<211> 372 5 <212> DNA
<213> Artificial sequence
<220>
<223> D3-52 coding sequence of CTLA-4 10 ECD mutant
<400> 113
15 <210> 114
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-53
<400> 114
<210> 115
<211> 372
<212> DNA 30 <213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-54
35 <400> 115 <210> 116
<211> 372
<212> DNA
<213> Artificial sequence 5
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-55
<400> 116 10
<210> 117
<211> 372 15 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of mutant D3-56 of the CTLA-4 ECD 20
<400> 117
25 <210> 118
<211> 372
<212> DNA
<213> Artificial sequence
30 <220>
<223> D3-57 coding sequence of CTLA-4 ECD mutant
<400> 118
<210> 119 <211> 372 <212> DNA 40 <213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-58
<400> 119
<210> 120
<211> 372
<212> DNA 10 <213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-59
15 <400> 120
<210> 121 20 <211> 372
<212> DNA
<213> Artificial sequence
<220> 25 <223> Sequence coding sequence of CT3-4 ECD mutant D3-60
<400> 121
<210> 122
<211> 372
<212> DNA
<213> Artificial sequence 35
<220>
<223> Coding sequence of mutant D3-61 of the CTLA-4 ECD
<400> 122 40
<210> 123
<211> 372 5 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of D3-62 mutant of CTLA-4 10 ECD
<400> 123
15 <210> 124
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> Coding sequence of mutant D3-63 of the CTLA-4 ECD
<400> 124
<210> 125
<211> 372
<212> DNA 30 <213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-64
35 <400> 125 <210> 126
<211> 372
<212> DNA
<213> Artificial sequence 5
<220>
<223> Coding sequence of mutant D3-65 of the CTLA-4 ECD
<400> 126 10
<210> 127
<211> 372 15 <212> DNA
<213> Artificial sequence
<220>
<223> D3-66 coding sequence of CTLA-4 20 ECD mutant
<400> 127
25 <210> 128
<211> 372
<212> DNA
<213> Artificial sequence
30 <220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-68
<400> 128
<210> 129
<211> 372
<212> DNA 40 <213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-69
45 <400> 129 <210> 130
<213> Artificial sequence
<220>
<223> D3-70 coding sequence of CTLA-4 10 ECD mutant <400> 130
<210> 131 15 <211> 372
<212> DNA
<213> Artificial sequence
<220> 20 <223> Sequence coding sequence of CT3-4 ECD mutant D3-71
<400> 131
<210> 132
<211> 372
<212> DNA
<213> Artificial sequence 30
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-72
<400> 132 35
<210> 133
<211> 372
<212> DNA
<213> Artificial sequence 5
<220>
<223> Coding sequence of mutant D3-73 of the CTLA-4 ECD
<400> 133 10
<210> 134
<211> 372 15 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of mutant D3-74 of the CTLA-4 ECD 20
<400> 134
25 <210> 135
<211> 372
<212> DNA
<213> Artificial sequence
30 <220>
<223> D3-75 coding sequence of CTLA-4 ECD mutant
<400> 135
<210> 136
<211> 372
<212> DNA 40 <213> Artificial sequence
<220>
<223> Sequence coding sequence of CT3-4 ECD mutant D3-76
<400> 136
5 <210> 137
<211> 372
<212> DNA
<213> Artificial sequence
10 <220>
<223> Coding sequence of mutant D1 of the CTLA-4 ECD
<400> 137
<210> 138
<211> 372
<212> DNA 20 <213> Artificial sequence
<220>
<223> CT1-4 ECD mutant D1T coding sequence
25 <400> 138
<210> 139 30 <211> 372
<212> DNA
<213> Artificial sequence
<220> 35 <223> Sequence coding sequence of CT2-4 ECD mutant
<400> 139 <210> 140
<211> 372 5 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of mutant D3 of the CTLA-4 10 ECD
<400> 140
15 <210> 141
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> Sequence coding sequence of CT4-4 ECD mutant
<400> 141
<210> 142
<211> 372
<212> DNA 30 <213> Artificial sequence
<220>
<223> Coding sequence of mutant D5 of the CTLA-4 ECD
35 <400> 142 <210> 143
<211> 372
<212> DNA
<213> Artificial sequence 5
<220>
<223> CT6-4 ECD mutant D6 coding sequence
<400> 143 10
<210> 144
<213> Artificial sequence
<220>
<223> D20 mutant coding sequence of CTLA-4 20 ECD
<400> 144
25 <210> 145
<211> 372
<212> DNA
<213> Artificial sequence
30 <220>
<223> D21 mutant coding sequence of CTLA-4 ECD
<400> 145
<210> 146
<211> 372
<212> DNA 40 <213> Artificial sequence
<220>
<223> Coding sequence of mutant D23 of the CTLA-4 ECD
<400> 146
5 <210> 147
<211> 372
<212> DNA
<213> Artificial sequence
10 <220>
<223> Coding sequence of mutant D24 of the CTLA-4 ECD
<400> 147
<210> 148
<211> 372
<212> DNA 20 <213> Artificial sequence
<220>
<223> Coding sequence of mutant D26 of the CTLA-4 ECD
25 <400> 148
<210> 149 30 <211> 372
<212> DNA
<213> Artificial sequence
<220> 35 <223> Coding sequence of mutant D27 of the CTLA-4 ECD
<400> 149 <210> 150
<211> 372 5 <212> DNA
<213> Artificial sequence
<220>
<223> D28 mutant coding sequence of CTLA-4 10 ECD
<400> 150
15 <210> 151
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> Coding sequence of mutant D29 of CTLA-4 ECD
<400> 151
<210> 152
<211> 372
<212> DNA 30 <213> Artificial sequence
<220>
<223> Sequence coding sequence of CT31-4 ECD mutant
35 <400> 152 <210> 153
<211> 1170
<212> DNA
<213> Artificial sequence 5
<220>
<223> Coding sequence of the D3-12-IgG2 fusion protein
<400> 153 10
<210> 154
<211> 1170 15 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of the D3-14-IgG2 fusion protein 20
<400> 154
<210> 155
<211> 1170
<212> DNA
<213> Artificial sequence 5
<220>
<223> Coding sequence of the D3-17-IgG2 fusion protein
<400> 155 10
<210> 156
<211> 1170 15 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of the D3-20-IgG2 fusion protein 20
<400> 156
<210> 157
<211> 1170
<212> DNA
<213> Artificial sequence 5
<220>
<223> Coding sequence of the D3-27-IgG2 fusion protein
<400> 157 10
<210> 158
<211> 1170 15 <212> DNA
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> Coding sequence of D3-29-IgG2 fusion protein 20 </dd></dl>
<400> 158
<210> 160
<213> Homo Sapiens
<220>
<dl><dt><223></dt><dd> CTLA-4 full length natural human 20 </dd></dl>
<400> 160
<210> 161
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> Human CTLA4 fusion protein WT-IgG2T predicted 10 </dd></dl>
<400> 161
<210> 162
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> Mature CTLA4 fusion protein WT-IgG2 mature 10 </dd></dl>
<dl><dt><210> 159 </dt><dd /></dl>
<dl><dt><211> 124 </dt><dd /></dl>
<dl><dt><212> PRT </dt><dd /></dl>
<dl><dt><213> Homo sapiens </dt><dd /></dl>
<dl><dt>5 </dt><dd /></dl>
<dl><dt><220> </dt><dd /></dl>
<dl><dt><223> Natural human CTLA-4 ECD </dt><dd /></dl>
<dl><dt><400> 159 </dt><dd /></dl>
<dl><dt>10 </dt><dd /></dl>
<400> 162
5 <210> 163
<211> 1167
<212> DNA
<213> Artificial sequence
10 <220>
<223> Human WT-IgG2 human CTLA4 fusion protein coding sequence
<400> 163
<210> 164
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> Orencia (R) (Bristol-Myers Squibb Co.) 10 </dd></dl>
<400> 164
<210> 165
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> LEA29Y-Ig fusion protein predicted 10 </dd></dl>
<400> 165
<210> 166
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> Mature LEA29Y-Ig fusion protein 10 </dd></dl>
<400> 166 <210> 167
<211> 1182 5 <212> DNA
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> LEA29Y-Ig 10 fusion protein coding sequence </dd></dl>
<400> 167
<210> 168
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> ECD of LEA29Y 10 </dd></dl>
<400> 168
15 <210> 169
<211> 372
<212> DNA
<213> Artificial sequence
20 <220>
<223> LEA29Y ECD coding sequence
<400> 169
<210> 170
<213> Artificial sequence
<220>
<223> Human CD80-IgG1 fusion protein predicted 10
<400> 170
<210> 171
<211> 442
<212> PRT
<213> Artificial sequence 5
<220>
<223> Mature human WT-IgG1 human CD80 fusion protein
<400> 171 10
<210> 172
<211> 1428 5 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of the human CD80 fusion protein WT-IgG1 human 10
<400> 172
15 <210> 173
<211> 726
<212> DNA
<213> Artificial sequence
20 <220>
<223> Coding sequence of the signal peptide of human CD80 WT and ECD of human CD80 WT
<400> 173
<210> 174
<213> Homo Sapiens
<220>
<223> ECD of human CD80 WT 10
<400> 174
15 <210> 175
<211> 329
<212> PRT
<213> Homo Sapiens
20 <220>
<223> Full-length human W86 CD86 planned
<400> 175
5 <210> 176
<211> 987
<212> DNA
<213> Artificial sequence
10 <220>
<223> Full-length WT human CD86 coding sequence
<400> 176
<210> 177
<213> Artificial sequence
<220>
<223> Human WT-IgG1 human CD86 fusion protein predicted 10
<400> 177
<210> 178
<211> 454
<212> PRT
<213> Artificial sequence 5
<220>
<223> Mature human human W86-WT-IgG1 CD86 fusion protein
<400> 178 10
<210> 179 <211> 1431
<212> DNA
<213> Artificial sequence
<220>
<223> Human WT-IgG1 human CD86 fusion protein coding sequence
<400> 179
<210> 180
<211> 220
<212> PRT 15 <213> Homo Sapiens
<220>
<223> Human CD86 WT ECD
20 <400> 180 <210> 181
<213> Artificial sequence
<220>
<223> Coding sequence of the human CTLA-4 signal peptide WT 10
<400> 181
15 <210> 182
<211> 35
<212> PRT
<213> Homo Sapiens
20 <220>
<223> WT human CTLA-4 signal peptide
<400> 182
<210> 183
<211> 684
<212> DNA
<213> Artificial sequence
<220>
<223> Human IgG2 Fc polypeptide coding sequence (with C-terminus lysine)
<400> 183
<210> 184
<211> 228
<212> PRT
<213> Homo Sapiens 15
<220>
<223> Human IgG2 Fc polypeptide (with C-end lysine)
<400> 184 20
<210> 185
<213> Homo Sapiens
<220>
<dl><dt><223> </dt><dd>10 human IgG1 Fc polypeptide </dd></dl>
<400> 185
<210> 186
<213> Artificial sequence
<220>
<dl><dt><223> </dt><dd>10 mutant IgG1 Fc polypeptide </dd></dl>
<400> 186
<210> 187
<211> 59
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 187 ctattgctac ggccgctatg gccmtkcacg tcgctcaacc agccgtcgta ctcgcgtcc 59
<210> 188
<211> 30
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 188 gtgatggtga tggtgtgcgg ccgcatcaga 30
<210> 189
<211> 77
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 189
<dl><dt>5 </dt><dd><210> 190 <211> 42 <212> DNA <213> Artificial sequence </dd></dl>
<dl><dt>10 </dt><dd><220> <223> primer <400> 190 cagaattcat tatttacccg gagacaggga gaggctcttc tg 42 </dd></dl>
<dl><dt>15 </dt><dd><210> 191 <211> 54 <212> DNA <213> Artificial sequence </dd></dl>
<dl><dt>20 </dt><dd><220> <223> primer </dd></dl>
<dl><dt><400> 191 ggaataccgg ttttttgtaa agccatgcac gtcgctcaac cagccgtcgt actc </dt><dd> 54 </dd></dl>
<dl><dt>25 </dt><dd><210> 192 <211> 30 <212> DNA <213> Artificial sequence </dd></dl>
<dl><dt>30 </dt><dd><220> <223> primer </dd></dl>
<dl><dt>35 40 </dt><dd><400> 192 ggcactcaga tctacgtcat cgatcccgaa 30 <210> 193 <211> 372 <212> DNA <213> Artificial sequence <220> <223> Human CTLA-4 ECD coding sequence </dd></dl>
<dl><dt>45 </dt><dd> <400> 193 </dd></dl>
<210> 194
<211> 672
<212> DNA
<213> Artificial sequence
<220>
<223> Full length human CTLA-4 coding sequence
<400> 194
5 <210> 195
<211> 288
<212> PRT
<213> Homo Sapiens
10 <220>
<223> Full-length human CD80 planned
<400> 195
<210> 196
<211> 867
<212> DNA
<213> Artificial sequence 5
<220>
<223> Full length human CD80 coding sequence
<400> 196 10
<210> 197
<213> Artificial sequence
<220>
<223> D3-54-IgG2 fusion protein (with C-end lysine) 20
<400> 197 <212> PRT
<213> Artificial sequence
<220> 10 <223> D3-56-IgG2 fusion protein (with C-end lysine)
<400> 198 <210> 199
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-69-IgG2 fusion protein (with C-end lysine) 10 </dd></dl>
<400> 199
<210> 200
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-75-IgG2 fusion protein (with C-end lysine) 10 </dd></dl>
<400> 200 <210> 201
<211> 1170 5 <212> DNA
<213> Artificial sequence
<220>
<223> D3-54-IgG2 10 fusion protein coding sequence
<400> 201 <210> 202
<211> 1170 5 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of the D3-56-IgG2 fusion protein 10
<400> 202
15 <210> 203
<211> 1170
<212> DNA
<213> Artificial sequence
20 <220>
<223> Coding sequence of the D3-69-IgG2 fusion protein
<400> 203
<210> 204
<211> 1170 5 <212> DNA
<213> Artificial sequence
<220>
<223> D3-75-IgG2 fusion protein coding sequence 10
<400> 204
15 <210> 205
<211> 351
<212> PRT
<213> Artificial sequence
20 <220>
<223> D3-12-IgG2 fusion protein (without C-end lysine)
<400> 205
<210> 206
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-14-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 206
<210> 207
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-17-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 207
<210> 208
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-20-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 208
<210> 209
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-27-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 209
<210> 210
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-29-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 210
<210> 211
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-54-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 211
<210> 212
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-56-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 212
<210> 213
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-69-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 213
<210> 214
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-75-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 214
<210> 215
<213> Artificial sequence
<220>
<dl><dt><223> </dt><dd>Sequence coding sequence for the hCTLA-4 WT signal peptide comprising amino acid residues 10-37 of the full-length hCTLA-4 protein </dd></dl>
<400> 215
<210> 216
<211> 37
<212> PRT
<213> Homo sapiens
5 <220>
<223> hCTLA-4 WT signal peptide sequence comprising amino acid residues 1-37 of the full-length hCTLA-4 protein
<400> 216 10
<210> 217
<211> 684 15 <212> DNA
<213> Artificial sequence
<220>
<223> Human IgG2 Fc polypeptide coding sequence 20
<400> 217
25 <210> 218
<211> 227
<212> PRT
<213> Artificial sequence
30 <220>
<223> Human IgG2 Fc polypeptide (without C-end lysine)
<400> 218
<210> 219
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-71-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 219
<210> 220
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-71-IgG2 fusion protein (with C-end lysine) 10 </dd></dl>
<400> 220
<210> 221
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-76-IgG2 fusion protein (without C-end lysine) 10 </dd></dl>
<400> 221
<210> 222
<213> Artificial sequence
<220>
<dl><dt><223></dt><dd> D3-76-IgG2 fusion protein (with C-end lysine) 10 </dd></dl>
<400> 222 <210> 223
<211> 1170 5 <212> DNA
<213> Artificial sequence
<220>
<223> D3-71-IgG2 fusion protein coding sequence 10
<400> 223 <210> 224
<211> 1170 5 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of the D3-76-IgG2 fusion protein 10
<400> 224
<400> 225
<210> 226
<213> Artificial sequence
<220>
<223> Human CD80-murine Ig 10 fusion protein
<400> 226 <210> 227
<211> 1458 5 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of the human CD86-murine Ig 10 fusion protein
<400> 227 <210> 228
<211> 1455 5 <212> DNA
<213> Artificial sequence
<220>
<223> Coding sequence of the human CD80-murine Ig 10 fusion protein
<400> 228
Contents4
22 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22
61 members in 21 offices
Priority claims5
| Document | Office | Kind | Date |
|---|---|---|---|
| 984631P | United States of America | – | |
| 98463107 | United States of America | P | |
| 51215P | United States of America | – | |
| 5121508 | United States of America | P | |
| 2008079981 | United States of America | W |
Members61
| Document | Office | Kind | |
|---|---|---|---|
| AU2008319053A1 | Australia | A1 | |
| CA2703263A1 | Canada | A1 | |
| CA2805976A1 | Canada | A1 | |
| WO2009058564A2 | World Intellectual Property Organization (WIPO) | A2 | |
| TW200936607A | Taiwan Province of China | A | |
| US2009258031A1 | United States of America | A1 | |
| WO2009058564A3 | World Intellectual Property Organization (WIPO) | A3 | |
| EP2222697A2 | European Patent Office (EPO) | A2 | |
| US7794718B2 | United States of America | B2 | |
| KR20100105551A | Republic of Korea | A | |
| US2010260759A1 | United States of America | A1 | |
| MX2010004883A | Mexico | A | |
| JP2011502479A | Japan | A | |
| ZA201002872B | South Africa | B | |
| CN101998965A | China | A | |
| US2011129875A1 | United States of America | A1 | |
| US2011130546A1 | United States of America | A1 | |
| US2011159542A1 | United States of America | A1 | |
| US2011166324A1 | United States of America | A1 | |
| US2011177071A1 | United States of America | A1 | |
| US2011182898A1 | United States of America | A1 | |
| EP2385065A1 | European Patent Office (EPO) | A1 | |
| US8071095B2 | United States of America | B2 | |
| RU2010122053A | Russian Federation | A | |
| AU2008319053B2 | Australia | B2 | |
| AU2012202324A1 | Australia | A1 | |
| US8268587B2 | United States of America | B2 | |
| US8283447B2 | United States of America | B2 | |
| US8318176B2 | United States of America | B2 | |
| EP2222697B1 | European Patent Office (EPO) | B1 | |
| PT2222697E | Portugal | E | |
| DK2222697T3 | Denmark | T3 | |
| ES2399088T3This record | Spain | T3 | |
| SI2222697T1 | Slovenia | T1 | |
| HRP20130194T1 | Croatia | T1 | |
| US8445230B2 | United States of America | B2 | |
| PL2222697T3 | Poland | T3 | |
| CN103172750A | China | A | |
| EP2612867A1 | European Patent Office (EPO) | A1 | |
| EP2612868A1 | European Patent Office (EPO) | A1 | |
| US8491899B2 | United States of America | B2 | |
| US8496935B2 | United States of America | B2 | |
| JP5298134B2 | Japan | B2 | |
| RU2506275C2 | Russian Federation | C2 | |
| CN101998965B | China | B | |
| CA2703263C | Canada | C | |
| KR101383476B1 | Republic of Korea | B1 | |
| TWI448473B | Taiwan Province of China | B | |
| AU2012202324B2 | Australia | B2 | |
| AU2014250683A1 | Australia | A1 | |
| CN103172750B | China | B | |
| CA2805976C | Canada | C | |
| AU2014250683B2 | Australia | B2 | |
| PH12013501101A1 | Philippines | A1 | |
| PH12013501101B1 | Philippines | B1 | |
| IL205036A | Israel | A | |
| CY1113713T1 | Cyprus | T1 | |
| EP2612868B1 | European Patent Office (EPO) | B1 | |
| PT2612868T | Portugal | T | |
| ES2688721T3 | Spain | T3 | |
| PL2612868T3 | Poland | T3 |
Numbers
- Publication
- 2399088
- Application
- 8844441
Titles2
- Spanish
- Polipéptidos y ácidos nucleicos inmunosupresores
- English
- Immunosuppressive polypeptides and nucleic acids
Classification
- CPC, 4
- C07K14/70521
- C07K2319/30
- A61P37/00
- A61P37/06
- IPC, 7
- C07K14 705
- A61K35 12
- A61K35 64
- A61K35 76
- A61K35 761
- A61K35 763
- A61K36 06