Novel anti-IL 13 antibodies and uses thereof

ES 2 390 344 T3

DESCRIPTION

Cancer treatment with novel anti-IL13 monoclonal antibodies

Background

IL13 is a pleiotropic Th2 cytokine produced predominantly by CD4 + type 2 helper T cells, as well as NKT cells, basophils, and mast cells (Hershey, GKK, J Allergy Clin Immunol. (2003) 111: 677-90). In addition to its etiologic roles in asthma, fibrosis, chronic obstructive pulmonary disease, and ulcerative colitis Wynn, TA, Annu Rev Immunol. (2003) 21: 425-56; Wynn TA., Nat Rev Immunol. (2004) 4: 583-94; Heller F et al., Immunity (2002) 17: 629-38), IL13 is also known to play important roles in tumor growth (Kapp U et al., J Exp Med. (1999) 189: 1939-4; Trieu Y et al., Cancer Res. 2004; 64: 3271-5) and in the modulation of tumor immunity (Terabe M et al., Cancer Immunol Immunother. 2004; 53: 79-85; Terabe M et al., Nat Immunol. 2000; 1: 515-20). Therefore, IL13 and its receptors are potential therapeutic targets for cancer.

Hodgkin lymphoma (HL) is a malignant lymph node disorder characterized by abnormal production of multiple cytokines from the malignant HL cell population, Reed-Stemberg (RS) cells (see Kapp et al. And Trieu et al., cited above). IL13 was shown to promote HL proliferation by an autocrine mechanism. Neutralizing anti-IL13 monoclonal antibodies (mAbs) were shown to inhibit HL cell proliferation in vitro (Trieu et al. Cited above; Skinnider et al., Leukemia and Lymphoma (2002) 43: 1203-1210)).

Accumulating evidence indicates that IL13 receptors are highly expressed in a variety of human malignant tumor cell lines (e.g., glioblastoma, head and neck tumors, squamous cell carcinoma, renal cell carcinoma, AIDS-associated Kaposi carcinoma, prostate carcinoma, pancreatic carcinoma and epithelial carcinomas such as adenocarcinoma of the stomach, colon and skin) (see for example, Debinski W et al. J Biol Chem. (1995) 270: 16775-80; Purl RK et al. Blood (1998) 87: 4333-9; Maini A et al. J Urol. (1997) 158: 948-53; Debinski W et al. Clin Cancer Res. (1995) 1: 1253-8; Kommann M et al. Anticancer Res. (1999) 19: 125-31: Husain SR et al. Blood (2000) 95: 3506-13; Kawakami K et al. Cancer Res. (2001) 61: 61946200). A recombinant fusion protein comprising IL13 coupled to a mutated form of Pseudomonas exotoxin was shown to specifically kill these tumor cells in vitro. Thus, these data suggest that the IL13 receptor is an attractive target for directing selective tumor killing.

It is now known that the main mediators of anti-tumor immunity are CD4 + Th1 cells and CD8 + cytotoxic T lymphocytes (CTL). Since immune drift toward Th2 suppresses Th1 development, it has been suggested that induction of a Th2 response in cancer patients is one of the main mechanisms that suppresses tumor immunosurveillance. Terabe et al. showed that an IL13 inhibitor (sIL13Ra2-Fc) inhibited tumor recurrence in a mouse model. Similar observations were also found with mice deficient in STAT6 or IL4R, but not with mice deficient in IL4. Together, these results indicate that IL13 plays an important role in suppressing anti-tumor immunity in vivo. Therefore, inhibition of IL13 could promote anti-tumor immunity in cancer patients.

Antibody-based therapy has been shown to be very effective in treating various cancers. For example, HERCEPTIN® and RITUXAN® have been used successfully to treat breast cancer and non-Hodgkin lymphoma, respectively. The present invention provides alternative methods of cancer treatment that overcome the limitations of conventional therapeutic methods as well as offer additional advantages that will become apparent from the detailed description below.

Summary of the invention

The present application relates to the treatment of IL13-expressing cancers and / or tumors with novel antagonist anti-IL13 monoclonal antibodies. In a first aspect, there is provided a pharmaceutical composition for use in treating cancer, comprising an antagonistic anti-human IL-13 antibody or antigen-binding fragment thereof that specifically binds human IL-13, wherein said antibody competes with an antibody produced by the 228B / C-1 hybridoma (PTA-5657) to bind IL-13. In addition, a composition is provided for use in the diagnosis of a cancer or tumor in a biological sample, wherein the cancer and / or tumor overexpresses IL-13, comprising an antagonist antibody or antigen-binding fragment thereof that specifically binds human IL-13, wherein said antibody competes with an antibody produced by the 228B / C-1 hybridoma (PTA-5657) to bind IL-13. Antibodies useful in the present invention comprise novel antagonist anti-IL13 antibodies that specifically and with high affinity bind to both glycosylated and non-glycosylated human IL-13; wherein said antibody competes with an antibody produced by the 228B / C-1 hybridoma (PTA-5657) to bind IL-13; they do not bind mouse IL13, and neutralize human IL13 activity at an approximate 1: 2 molar ratio (mAb: IL13). Also included in the present invention are antibodies comprising antigen-binding regions derived from the heavy and / or light chain variable regions of such antibodies. The antibodies of the invention can be monoclonal, and a monoclonal antibody can be a human antibody, a chimeric antibody, or a

ES 2 390 344 T3 humanized antibody.

Examples of these antibodies are 228B / C-1, 228A-4, 227-26, and 227-43. The hybridomas that produce these antibodies were deposited on November 20, 2003, with the American Type Culture Collection, 10801 University Blvd., Manassas, VA 20110-2209, under accession numbers PTA5657, PTA- 5656, PTA-5654 and PTA-5655, respectively. These antibodies can target a tumor cell that expresses iL-13 in vivo. These antibodies are described in a co-pending patent application (WO 2005/062967, filed December 23, 2004).

Antibodies useful in the present invention also include antibodies having a VL sequence at least 95% homologous to that set forth in SEQ ID NO: 3, and a VH sequence at least 95% homologous to that set forth in SEQ ID NO. : 4; antibodies having a VL sequence at least 95% homologous to that set forth in SEQ ID NO: 5, and a VH sequence at least 95% homologous to that set forth in SEQ ID NO: 6; and antibodies having a VL sequence at least 95% homologous to that set forth in SEQ ID NO: 7, and a VH sequence at least 95% homologous to that set forth in SEQ ID NO: 8. The present invention also includes a recombinant antibody molecule, or an IL-13 binding fragment thereof, comprising at least one antibody heavy chain, or an IL-13 binding fragment thereof, which comprises non-human CDRs. at positions 31-35 (CDR1), 50-65 (CDR2) and 95-102 (CDR3) (Kabat numbering) from a mouse anti-IL13 antibody, in which positions 27-30 have the amino acids Gly 26, Phe 27, Ser 28, Leu 29, Asn 30, (SEQ ID NO: 18); and at least one antibody light chain, or an IL-13 binding fragment thereof, comprising non-human CDRs at positions 24-34 (CDR1), 50-56 (CDR2), and 89-97 (CDR3) from from a mouse anti-IL13 antibody, and framework regions from a human monoclonal antibody.

Antibodies useful in the present invention also include human antigen-binding antibody fragments of the antibodies of the present invention including, but not limited to, Fab, Fab 'and F (ab') 2, Fd, Fv single chain ( scFv), single chain antibodies, disulfide-linked Fv (sdFv). The invention also includes single domain antibodies comprising either a VL or a VH domain. An example is a scFv having the sequence as set forth in SEQ ID NO 152.

Antibodies also useful in the present invention include humanized sequences of monoclonal antibody 228B / C-1. These humanized recombinant antibody molecules comprise a light chain variable region comprising an amino acid sequence having the formula: FRL1-CDRL1-FRL2-CDRL2FRL3-CDRL3-FRL4, wherein FRL1 consists of any one of SEQ ID NOS: 20 -25; CDRL1 consists of any one of SEQ ID NOS: 99-103; FRL2 consists of SEQ ID NO: 29; CDRL2 consists of any one of SEQ ID nOs: 104-114; FRL3 consists of any one of SEQ ID NOS: 30-56; CDRL3 consists of any of SEQ ID NOS: 115-116; and FRL4 consists of SEQ ID NO: 57-59; and comprises a heavy chain variable region comprising an amino acid sequence having the formula: FRH1-CDRH1-FRH2-CDRH2-FRH3-CDRH3-FRH4, wherein FRH1 consists of any one of SEQ ID NOS: 60-66; CDRH1 consists of any one of SEQ ID NOS: 117-122; FRH2 consists of any one of SEQ ID NOS: 67-75; CDRH2 consists of any one of SEQ ID NOS: 123-134; FRH3 consists of any one of SEQ ID NOS: 76-90; CDRH3 consists of any of SEQ ID NOS: 135-141; and FRH4 consists of SeQ ID NO: 91-92. The heavy chain variable region may further comprise at least the CH1 domain of a constant region or the CH1, CH2 and CH3 domains of a constant region. The heavy chain constant region may comprise an IgG antibody, wherein the IgG antibody is an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, or an IgG4 antibody.

Additionally, the included antibodies comprise recombinant antibody molecules in which the variable light chain is selected from any one of SEQ ID NOS: 3, 5, 7, 93, 95, 97, 142, 144 and 150, and a variable heavy chain which is selected from any one of SEQ ID NOS: 4, 6, 8, 94, 96, 98, 143, 145, 146, 147, 148 and 149. A particular antibody comprises the variable light chain having the sequence set forth in SEQ ID NO: 142, and a variable heavy chain having the sequence set forth in SEQ ID NO: 143.

The binding epitope of mAb 228B / C-1 was mapped to a unique site in IL13 responsible for the interaction with IL4Ra, which constitutes part of the multimeric IL13R complex. This binding site on IL13 is distant from the site responsible for the IL13R interaction, and therefore 228B / C-1 can bind to bound IL13 in tumor cells that overexpress IL13R. Also provided are antibodies that compete to bind to the same epitope recognized by any of the monoclonal antibodies mentioned above. The present invention also includes antibodies that bind to the same epitope as 228B / C-1. Epitope peptides include a peptide comprising or consisting essentially of ESUNVSG (SEQ ID NO: 18) or YCAALESLINVS (SEQ ID NO: 19).

In another embodiment, an isolated monoclonal anti-IL13 antibody is provided that inhibits the growth of cancer cells expressing IL-13 in vivo, or is cytotoxic in vivo, to such cells and tumors containing such cells. The invention provides anti-IL13 antibodies that are conjugated to a cytotoxic agent or to a growth inhibitory agent. The cytotoxic agent can be a toxin, cytotoxic small molecule drug, high energy radioactive isotope, photoactivatable drug, pro-apoptotic drug or protein, cytolytic or nucleolytic enzyme.

Antibodies useful in the present invention may comprise a constant region of human IgG1, which

ES 2 390 344 T3 can mediate tumor cell killing by complement-mediated cytolysis (CMC) and antibody-dependent cell-mediated cytotoxicity (ADCC). Such an antibody can also suppress tumor growth that is dependent on IL13.

The anti-IL13 antibodies of the above embodiments include intact antibodies (full length) as well as 5 antibody fragments. In one embodiment, the anti-IL13 antibody of any of the above embodiments is a chimeric, humanized, or human antibody, human antigen-binding antibody fragments of the antibodies of the present invention including, but not limited to, Fab, Fab ' and F (ab ')₂, Fd, single chain Fv (scFv), single chain antibodies, disulfide linked Fv (sdFv). The invention also includes single domain antibodies comprising either a VL or a VH domain. An example is a scFv having the sequence of SEQ ID NO 152.

The invention also encompasses the use of a composition comprising any one of the anti-IL13 antibodies of the foregoing embodiments, and a carrier, in the methods of the present invention. The carrier is a pharmaceutically acceptable carrier. These compositions can be provided in an article of manufacture or a kit for the treatment of cancer.

Yet a separate aspect of the invention is a method of killing an IL13-expressing cancer cell, which comprises contacting the cancer cell with an anti-IL13 antibody of any of the above embodiments, thereby killing the cancer cell. Another aspect is a method of alleviating or treating an IL13-expressing cancer in a mammal, which comprises administering a therapeutically effective amount of the anti-IL13 antibodies of the invention to the mammal. In embodiments of the above methods, the cancer is renal cell carcinoma, glioma, brain tumors, Hodgkins lymphoma, or other tumors or cancers that express the IL13 receptor on their surface. In a preferred embodiment of these methods, the anti-IL13 antibody is a human or a humanized antibody. In another preferred embodiment, the antibody is conjugated to a cytotoxic agent such as a toxin or a radioactive isotope and a cytostatic agent such as inhibitors for cyclin-dependent kinases.

The IL13-expressing cancer relief method provides for the administration of the anti-IL13 antibody in combination with other forms of cancer treatment, such as radiotherapy and chemotherapy. Lastly, the mammal also receives at least one chemotherapeutic agent. In a specific embodiment, the chemotherapeutic agent is one in which the chemotherapy is selected from the group of drugs such as, but not limited to, doxorubicin, 5-fluorouracil, cytokine arabinoside, cyclophosphamide, thiotepa, busulfan, cytoxin, taxol, methotrexate, cisplatin , melphalan, vinblastine, bleomycin, and carboplatin. In another specific embodiment, the anti-IL13 antibody can be used in conjunction with other anti-tumor antibodies such as, but not limited to, anti-VEGF mAb, anti-Her2 mAb, anti-EGFR mAb, anti-EpCam mAb, anti-EpCam mAb. angioside, anti-tissue factor mAb and anti-integrin mAb.

In a further aspect, an article of manufacture comprising a container and a composition contained therein is described, wherein the composition comprises an anti-IL13 antibody of the above embodiments, and further comprising a package insert indicating that the composition can be used to alleviate or treat IL13-expressing cancer.

Another aspect of the invention comprises diagnosing an IL13 overexpressing cancer or tumor comprising the use of the anti-IL13 antibodies of the present invention to detect IL13 overexpression in the biological sample taken from a patient suspected of having said cancer. or tumor.

Brief description of the figures

Figure 1 depicts the binding of anti-IL13 monoclonal antibodies to human IL13.

Figure 2 depicts the binding of anti-IL13 monoclonal antibodies to mutant IL13-Fc.

Figure 3 illustrates that there is no inhibition of binding of mAb 228B / C-1 to human IL13 by mAb JES10-5A2 (Pharmingen).

Figure 4 illustrates the effect of anti-IL13 monoclonal antibodies on the proliferation of Hodgkin lymphoma L-1236 cells.

Figure 5 illustrates the effect of anti-IL13 monoclonal antibodies on IL13-induced suppression of CD14 expression in human monocytes.

Figure 6 illustrates the effect of anti-IL13 monoclonal antibodies on the IL13-induced up-regulation of CD23 expression in human monocytes.

Figure 7 illustrates the effect of anti-IL13 monoclonal antibodies on IL13-induced STAT6 phosphorylation in THP-1 cells.

Figure 8 depicts the amino acid sequences of the VH and VL regions of monoclonal antibody 228B / C-1.

ES 2 390 344 T3

Figure 9 depicts the amino acid sequences of the VH and VL regions of various humanized antibodies derived from monoclonal antibody 228 B / C-1.

Detailed description

This invention is not limited to the particular methodology, protocols, cell lines, vectors, or reagents described herein because they may vary. Furthermore, the terminology used herein is for the purpose of describing only particular embodiments and is not intended to limit the scope of the present invention. As used herein and in the appended claims, the singular forms "a", "an" and "the" include the plural reference unless the context clearly dictates otherwise, eg, the reference a "a host cell" includes a plurality of such host cells.

Unless defined otherwise, all technical and scientific terms and any acronyms used herein have the same meanings commonly understood by one of ordinary skill in the field of the invention. Although any of the methods and materials similar or equivalent to those described herein may be used in the practice of the present invention, the methods, devices, and materials are described herein.

The term "antibody," as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, that is, molecules that contain an antigen-binding site that immunospecifically binds to a antigen. The immunoglobulin molecules of the invention can be of any type (for example, IgG, IgE, IgM, IgD, IgA and IgY), class (for example, IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of molecule immunoglobulin. Furthermore, the term "antibody" (Ab) or "monoclonal antibody" (mAb) is intended to include intact molecules, as well as antibody fragments (such as, for example, Fab and F fragments (ab '> 2) that can specifically bind to proteins. Fab and F (ab ') 2 fragments lack the Fc fragment of the intact antibody, are cleared more rapidly from the circulation of the animal or plant, and may have less non-specific tissue binding than an intact antibody (Wahl et al., J. Nucl. Med. 24: 316-325 (1983)).

As used herein, "human" antibodies include antibodies that have the amino acid sequence of a human immunoglobulin and include antibodies isolated from human or animal immunoglobulin libraries that are transgenic to one or more human immunoglobulins and do not express immunoglobulins. endogenous, as described below and, for example, in US Patent No. 5,939,598 by Kucherlapati et al.

Antibody "effector functions" refer to those biological activities that are attributed to the Fc region (a native sequence Fc region or variant Fc region in amino acid sequence) of an antibody, and vary with the isotype of the antibody. Examples of effector functions of the antibody include: complement dependent cytotoxicity and C1q binding; binding to the Fc receptor; Antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (eg B cell receptor); and activation of B cells.

"Antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig binds to Fc gamma receptors (FcDRs) present on certain cytotoxic cells (eg, natural killer (NK) lymphocytes) , neutrophils and macrophages) allow these cytotoxic effector cells to specifically bind to an antigen-bearing target cell and subsequently destroy the target cell with cellular enzymes or oxidative free radicals. Antibodies "arm" cytotoxic cells and are required for such destruction. The main cells for mediating ADCC, NK cells, express only FcyRIII, whereas monocytes express FcyRI, FcyRII, and FcyRIII. To assess the ADCC activity of a molecule of interest, an in vitro ADCC assay, such as that described below, can be performed. Useful effector cells for such assays include peripheral blood mononuclear cells (PBMC) and natural killer (NK) cells. Alternatively or additionally, the ADCC activity of the molecule of interest can be evaluated in vivo, for example, in an animal model such as that disclosed in Clynes et al. PNAS (USA) 95: 652-656 (1998). Immunogen

Recombinant IL13 was used to immunize mice to generate the hybridomas that produce the monoclonal antibodies of the present invention. Recombinant IL13 is commercially available from various sources (see, for example, R&D Systems, Minneapolis, MN, PeproTech, Inc., NJ, and Sanofi Bio-Industries, Inc., Tervose, PA.). Alternatively, a gene or cDNA encoding IL13 can be cloned into a plasmid or other expression vector and expressed in any of a number of expression systems according to methods well known to those of skill in the art. Methods of cloning and expression of IL13 and the nucleic acid sequence for IL13 are well known (see, for example, US Patent No. 5,652,123). Due to the degeneracy of the genetic code, a multitude of nucleotide sequences can be produced that code for IL13 polypeptides. The nucleotide sequence can be varied by selecting combinations based on possible codon choices. These combinations are made according to the conventional triplet genetic code as applied to the nucleotide sequence encoding the naturally occurring IL13 polypeptide and all of the following are to be considered.

ES 2 390 344 T3 variations of this type. Any one of these polypeptides can be used in the immunization of an animal to generate antibodies that bind to IL13.

The immunogenic IL13 polypeptide can be expressed, when beneficial, as a fusion protein having the IL13 polypeptide bound to a fusion segment. The fusion segment often aids in protein purification, for example, by allowing the fusion protein to be isolated and purified by affinity chromatography. Fusion proteins can be produced by culturing a recombinant cell transformed with a fusion nucleic acid sequence encoding a protein that includes the fusion segment attached to either the carboxyl terminal end and / or the amino terminal end of the protein. Fusion segments can include, but are not limited to, immunoglobulin Fc regions, glutathione-S-transferase, β-galactosidase, a polyhistidine segment that can bind to a divalent metal ion, and maltose-binding protein.

A fusion protein comprising a mutant form of human IL13 was used to generate the antibodies of the present invention. This mutant form of IL13 contained a single mutation that resulted in an inactive form of the protein (Thompson et al., J. Biol. Chem. 274: 2994 (1999)). In order to generate neutralizing antibodies with high affinity, the fusion protein comprised the mutant IL13 protein fused to an immunoglobulin Fc region, specifically IgG1, and was expressed in a mammalian cell line such that the recombinant protein was glycosylated in a manner natural. The Fc part of the fusion protein may have provided a conformational structure that exposed a key epitope. Glycosylation may have increased the immunogenicity of the epitope, allowing the generation of antibodies against this particular epitope.

IL13 polypeptides expressed in E. coli lack glycosylation and commercially available antibodies tested were generated using this protein. These antibodies were tested, eg, R&D Systems and Pharmingen, and found not to cross-react with the epitope bound by the antibodies of the present invention.

Generation of antibodies

The antibodies of the present invention can be generated by any suitable method known in the art. The antibodies of the present invention can comprise polyclonal antibodies. The person skilled in the art knows the methods of preparing polyclonal antibodies (Harlow, et al., Antibodies: a Laboratory Manual, (Cold spring Harbor Laboratory Press, 2^to ed. (1988).

For example, an immunogen as described above can be administered to various host animals including, but not limited to, rabbits, mice, rats, etc., to induce the production of sera containing polyclonal antibodies specific for the antigen. Administration of the immunogen may involve one or more injections of an immunizing agent and, if desired, an adjuvant. Various adjuvants can be used to enhance the immune response, depending on the host species, and include but are not limited to, Freund's adjuvant (complete and incomplete), mineral gels such as aluminum hydroxide, surface-active substances such as lysolecithin, pluronic polyols, polyanions. , peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (Bacillus Calmette-Guerin) and Corynebacterium parvum. Additional examples of adjuvants that may be employed include the adjuvant MPL-TDM (monophosphoryl lipid A, synthetic trehalose dicorinomycolate). Immunization protocols are well known in the art and can be performed by any method that elicits an immune response in the chosen animal host. Adjuvants are also well known in the art.

Typically, the immunogen (with or without adjuvant) is injected into the mammal by multiple subcutaneous or intraperitoneal injections, or intramuscularly or via the iv route. The immunogen can include an IL13 polypeptide, a fusion protein, or variants thereof. Depending on the nature of the polypeptides (i.e. percent hydrophobicity, percent hydrophilicity, stability, net charge, isoelectric point, etc.), it may be useful to conjugate the immunogen with a known protein to make it immunogenic in the mammal being tested. is immunizing. Such conjugation includes either chemical conjugation by derivatizing active chemical functional groups on both the immunogen and the immunogenic protein to be conjugated so that a covalent bond is formed, either through fusion protein-based methodology, or other known methods. by the person skilled in the art. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, ovalbumin, serum albumin, bovine thyroglobulin, soybean trypsin inhibitor, and various ligand-binding T-helper peptides. Various adjuvants can be used to enhance the immune response as described above.

The antibodies of the present invention comprise monoclonal antibodies. Monoclonal antibodies can be prepared using hybridoma technology, such as that described by Kohler and Milstein, Nature, 256: 495 (1975) and US Patent No. 4,376,110, by Harlow, et al., Antibodies: A Laboratory Manual , (Cold spring Harbor Laboratory Press, 2.sup.nd ed. (1988), by Hammerling, et al., Monoclonal Antibodies and T-Cell Hybridomas (Elsevier, NY, (1981)), or other methods known to the skilled person. Other examples of methods that can be employed to produce monoclonal antibodies include, but are not limited to, the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc. Natl Acad Sd. USA 80: 20262030), and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies And Cancer Therapy, Alan R. Liss,

ES 2 390 344 T3

Inc., pp. 77-96). Such antibodies can be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD, and any subclass thereof. The hybridoma that produces the mAb of this invention can be cultured in vitro or in vivo.

Using typical hybridoma techniques, a host such as a mouse, a humanized mouse, a mouse with a human immune system, hamster, rabbit, camel, or any other appropriate animal host, is normally immunized with an immunogen to produce lymphocytes that produce or can produce antibodies that will specifically bind IL13. Alternatively, lymphocytes can be immunized in vitro with the antigen.

Generally, when making antibody-producing hybridomas, either peripheral blood lymphocytes ("PBLs") are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-mammalian sources are desired. human. The lymphocytes are then fused with an immortalized cell line using a suitable fusion agent, such as polyethylene glycol, to form a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986), pp. 59-103) . Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine or human origin. Typically, a rat or mouse myeloma cell line is used. The hybridoma cells can be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused immortalized cells. For example, if the parent cells lack the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the culture medium for hybridomas will typically include hypoxanthine, aminopterin, and thymidine ("HAT medium"), substances that prevent the growth of cells deficient in HGPRT.

Preferred immortalized cell lines are those that fuse efficiently, support stable high-level expression of antibodies by selected antibody-producing cells, and are sensitive to a medium such as HAT medium. The most preferred immortalized cell lines are murine myeloma lines, available, for example, from the Salk Institute Cell Distribution Center, San Diego, Calif. and from the American Type Culture Collection, Manassas, Va. Human myeloma and mouse-human heteromyeloma cell lines can also be used for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63).

The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against IL13. The binding specificity of monoclonal antibodies produced by hybridoma cells is determined by, for example, immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA). Such techniques are known in the art and are within the skill of the skilled person. The binding affinity of the monoclonal antibody to IL13 can be determined, for example, by Scatchard analysis (Munson et al., Anal. Biochem., 107: 220 (1980)).

Once the desired hybridoma cells have been identified, the clones can be subcloned by limiting dilution procedures and growth by standard methods (Goding, cited above). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640. The monoclonal antibodies secreted by the subclones can be isolated or purified from the culture medium by standard immunoglobulin purification procedures such as, for example, Protein A-Sepharose, hydroxyapatite chromatography, gel exclusion chromatography, gel electrophoresis, dialysis or chromatography. affinity.

A variety of methods exist in the art for the production of monoclonal antibodies and therefore the invention is not limited to their exclusive production in hybridomas. For example, monoclonal antibodies can be made by recombinant DNA methods, such as those described in US Patent No. 4,816,567. In this context, the term "monoclonal antibody" refers to an antibody derived from a single eukaryotic, phage, or prokaryotic clone. DNA encoding the monoclonal antibodies of the invention can be isolated and rapidly sequenced using standard procedures (for example, using oligonucleotide probes that can specifically bind to genes encoding the heavy and light chains of murine antibodies, or such source chains. human, humanized, or other). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, DNA can be placed into expression vectors, which are then transformed into host cells such as NSO cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin protein. otherwise, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. DNA can also be modified, for example, by substituting the coding sequence for the constant domains of human heavy and light chains in place of the homologous murine sequences (US Patent No. 4,816,567; Morrison et al., Cited above) or by covalently binding to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or it can be substituted for the variable domains of an antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.

ES 2 390 344 T3

The antibodies can be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is generally truncated at any point in the Fc region so that the heavy chain is prevented from crosslinking. Alternatively, the relevant cysteine ​​residues are replaced with another amino acid residue or removed so that cross-linking is prevented.

Antibody fragments that recognize specific epitopes can be generated by known techniques. For example, the Fab and F (ab ') 2 fragments of the invention can be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F (ab') fragments 2). F (ab ') 2 fragments contain the variable region, the light chain constant region, and the CH1 domain of the heavy chain.

For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use chimeric, humanized or human antibodies. A chimeric antibody is a molecule in which different parts of the antibody are derived from different animal species, such as antibodies that have a variable region that is derived from a murine monoclonal antibody and a constant region from human immunoglobulin. Methods for producing chimeric antibodies are known in the art. See, for example, Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4: 214 (1986); Gillies et al., (1989) J. Immunol. Methods 125: 191-202; US patents n^you. 5,807,715; 4,816,567 and 4,816397.

Humanized antibodies are antibody molecules generated in a non-human species that bind to the desired antigen that has one or more complementarity determining regions (CDRs) from the non-human species and framework regions (FRs) from a human immunoglobulin molecule. Often, framework residues in human framework regions will be substituted for the corresponding residue from the CDR donor antibody to alter, preferably enhance, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by modeling the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues. in particular positions. (See, for example, Queen et al., US Patent No. 5,585,089; Riechmann et al., Nature 332: 323 (1988)). Antibodies can be humanized using a variety of techniques known in the art including, for example, cDr grafting (EP 239,400; PCT publication WO 91/09967; US Patent Nos.^you. 5,225,539; 5,530,101; and 5,585,089), coating or surfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28 (4/5): 489-498 (1991); studnicka et al., Protein Engineering 7 (6): 805-814 (1994); Roguska et al., PNAS 91: 969-973 (1994)), and chain exchange (US Patent No. 5,565,332).

Generally, a humanized antibody has one or more amino acid residues introduced into it from a non-human source. These non-human amino acid residues are often referred to as "import" residues, typically derived from an "import" variable domain. Humanization can be performed essentially by following the methods of Winter et al. (Jones et al., Nature, 321: 522-525 (1986); Reichmann et al., Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988), substituting rodent CDR or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (US Patent No. 4,816,667), in which substantially less than one intact human variable domain has been replaced by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted for analogous sites in rodent antibodies.

Fully human antibodies are particularly desired for the therapeutic treatment of human patients. Human antibodies can be obtained by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also, US patents n^you. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735 and Wo 91/10741. The techniques of Cole et al., And Boerder et al., Are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Riss, (1985); and Boemer et al. , J. Immunol., 147 (1): 86-95, (1991)).

Human antibodies can also be produced using transgenic mice that cannot express functional endogenous immunoglobulins, but that can express human immunoglobulin genes. For example, complexes of human heavy and light chain immunoglobulin genes can be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, the human variable region, constant region, and diversity region can be introduced into mouse embryonic stem cells in addition to human heavy and light chain genes. Mouse heavy and light chain immunoglobulin genes can be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, the homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring that express human antibodies. The rats

ES 2 390 344 T3 transgenic animals are immunized in the normal way with a selected antigen, for example, in whole or in part of a polypeptide of the invention. Monoclonal antibodies directed against the antigen can be obtained from immunized, transgenic mice using standard hybridoma technology. Human immunoglobulin transgenes harbored by transgenic mice rearrange during B cell differentiation, and subsequently undergo class change and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar, Int. Rev. Immunol. 13: 65-93 (1995). For a detailed explanation of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, for example, PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; US patents n^you. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; and 5,939,598. Additionally, companies such as Abgenix, Inc. (Freemont, Calif.), Genpharm (San Jose, Calif.), And Medarex, Inc. (Princeton, NJ) may be tasked with providing human antibodies directed against a selected antigen using technology similar to that of described above.

Human mAbs could also be obtained by immunizing transplanted mice with human peripheral blood leukocytes, splenocytes, or bone marrow (eg, XTL Trioma techniques). Fully human antibodies that recognize a selected epitope can be generated using a technique called "guided selection." In this approach, a selected non-human monoclonal antibody, eg, a mouse antibody, is used to guide the selection of a fully human antibody that recognizes the same epitope. (Jespers et al., Bio / technology 12: 899-903 (1988)).

Furthermore, antibodies to the polypeptides of the invention can, in turn, be used to generate anti-idiotype antibodies that "mimic" the polypeptides of the invention using techniques well known to those of skill in the art. (See, for example, Greenspan & Bona, FASEB J. 7 (5): 437-444; (1989) and Nissinoff, J. Immunol. 147 (8): 2429-2438 (1991)). For example, antibodies that bind to and competitively inhibit the multimerization of polypeptides and / or the binding of a polypeptide of the invention to a ligand can be used to generate anti-idiotypes that "mimic" the multimerization of polypeptides and / or the domain. binding and, as a consequence, binding to and neutralizing the polypeptide and / or its ligand. Such neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize the polypeptide ligand. For example, such anti-idiotypic antibodies can be used to bind to a polypeptide of the invention and / or to bind to its ligands / receptors, and thereby block its biological activity.

The antibodies of the present invention can be bispecific antibodies. Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present invention, one of the binding specificities can be directed towards IL13, the other can be for any other antigen, and preferably for a cell surface protein, receptor, receptor subunit, tissue specific antigen, protein derived in a manner viral, virally encoded envelope protein, bacterially derived protein, or bacterial surface protein, etc.

Methods for obtaining bispecific antibodies are well known. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two pairs of immunoglobulin heavy chain / light chain, in which the two heavy chains have different specificities (Milstein and Cuello, Nature, 305: 537-539 (1983) . Due to the random distribution of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in WO 93/08829, published May 13, 1993, and in Traunecker et al., EmBO J., 10: 3655-3659 (1991).

The variable domains of the antibody with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion is preferably with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2 and CH3 regions. It may have the first heavy chain constant region (CH1) containing the necessary site for light chain attachment present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and co-transformed into a suitable host organism. For additional details of bispecific antibody generation see, eg, Suresh et al., Meth. In Enzym., 121: 210 (1986).

Heteroconjugate antibodies are also contemplated by the present invention. Heteroconjugate antibodies are made up of two covalently linked antibodies. Such antibodies, for example, have been proposed to target cells of the immune system toward unwanted cells (US Patent No. 4,676,980). It is contemplated that the antibodies can be prepared in vitro using known methods in synthetic protein chemistry, including the cross-linking agents involved. For example, immunotoxins can be constructed using a disulfide exchange reaction or by forming a thioester bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in the patent

ES 2 390 344 T3 US No. 4,676,980.

In addition, single domain antibodies can be generated against IL-13. Examples of this technology have been described in WO9425591 for antibodies derived from Camelidae heavy chain Ig, as well as in US20030130496 which describes the isolation of single domain fully human antibodies from phage libraries.

Identification of anti-IL13 antibodies

The present invention provides antagonistic monoclonal antibodies that inhibit and neutralize the action of IL13. In particular, the antibodies of the present invention bind to IL13 and inhibit the activation of the IL13-receptor complex. Also described are antibodies designated 228A-4, 227-26 and 227-43. The antibodies of the present invention include the antibodies designated 228B / C-1 and humanized clones of 228B / C-1 are disclosed. The present invention also includes antibodies that bind to the same epitope such as monoclonal antibody 228B / C-1.

Candidate anti-IL13 antibodies were tested by enzyme-linked immunosorbent assay (ELISA), Western blot, or other immunochemical techniques. Assays performed to characterize individual antibodies included: (1) Inhibition of autocrine IL-13 proliferation of HDLM-2 and L-1236 Hodgkin lymphoma cell lines; (2) Inhibition of IL13-induced STAT6 phosphorylation in THP-1 cells; and (3) Inhibition of IL13-induced suppression of CD14 expression in primary human monocytes; and (4) Inhibition of IL13-induced up-regulation of CD23 expression in primary human monocytes. The experimental details are described in the examples.

Antibodies of the invention include, but are not limited to, polyclonal, monoclonal, monovalent, bispecific, heteroconjugate, multispecific, human, humanized or chimeric antibodies, single chain antibodies, single domain antibodies, Fab fragments, F (ab ') fragments , fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies (including, for example, anti-Id antibodies to antibodies of the invention), and epitope-binding fragments of any of the foregoing.

Antibodies may be human antigen-binding antibody fragments of the present invention and include, but are not limited to, Fab, Fab 'and F (ab') 2 fragments, Fd, single chain Fv (scFv), chain antibodies single, disulfide-linked Fv (sdFv), and single domain antibodies comprising either a VL or a VH domain. Antigen-binding antibody fragments, including single chain antibodies, may comprise the variable region (s) alone or in combination with all or part of the following: hinge region, CH1 domains , CH2 and CH3. Also included in the invention are antigen-binding fragments comprising any combination of variable region / regions (s) with a hinge region, CH1, CH2, and CH3 domains. The antibodies of the invention can be of any animal origin including birds and mammals. Preferably, the antibodies are human, non-human primates, rodents (eg, mouse and rat), donkey, sheep, rabbit, goat, guinea pig, camel, horse, or chicken.

The antibodies of the present invention can be monospecific, bispecific, trispecific, or of greater multispecificity. Multispecific antibodies can be specific for epitopes other than IL13 or they can be specific for both IL13 as well as a heterologous epitope, such as a heterologous polypeptide or solid support material. See, for example, PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147: 60-69 (1991); US patents n^you. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148: 1547-1553 (1992).

The antibodies of the present invention can be described or specified with respect to the epitope (s) or part (s) of IL13 that they specifically recognize or bind to. The epitope (s) or polypeptide part (s) may be specified as described herein, for example, by the positions of the N-terminal and C-terminal ends, by size in residues of contiguous amino acids, or listed in the tables and figures.

The antibodies of the present invention can also be described or specified in terms of their cross-reactivity. Also included in the present invention are antibodies that bind to IL13 polypeptides, which have at least 95% identity, at least 90%, at least 85%, at least 80%, at least 75%, to the less 70%, at least 65%, at least 60%, at least 55%, and at least 50% (as calculated using methods known in the art and described herein) for IL- 13.

In specific embodiments, the antibodies of the present invention cross-react with monkey homologs of human IL13 and the corresponding epitopes thereof. In a specific embodiment, the cross-reactivity described above is with respect to any single specific antigenic or immunogenic polypeptide, or combination / combinations of the specific antigenic and / or immunogenic polypeptides disclosed herein.

Also included in the present invention are antibodies that bind to polypeptides encoded by polynucleotides that hybridize to a polynucleotide encoding IL13 under stringent hybridization conditions. Antibodies

ES 2 390 344 T3 of the present invention may also be described or specified with respect to their binding affinity to a polypeptide of the invention. Preferred binding affinities include those with an equilibrium dissociation constant or Kd of from 10⁸ up to 10-¹⁵ M. The invention also provides antibodies that competitively inhibit the binding of an antibody to an epitope of the invention as determined by any method known in the art to determine competitive binding, for example, the immunoassays described herein. . In preferred embodiments, the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%. , at least 60%, or at least 50%.

Also included in the present invention are antibodies that bind to the same epitope as the antiIL13 antibodies of the present invention. To determine whether an antibody can compete to bind to the same epitope as the epitope bound by the anti-IL13 antibodies of the present invention including the antibodies produced by ATCC-deposited hybridomas, a cross-blocking assay can be performed, for example, a competitive ELISA assay. In an exemplary competitive ELISA assay, coated IL13 is preincubated in the wells of a microtiter plate with or without candidate competing antibody and then the biotin-labeled anti-IL13 antibody of the invention is added. The amount of labeled anti-IL13 antibody bound to the IL13 antigen in the wells is measured using avidin-peroxidase conjugate and appropriate substrate. The antibody can be labeled with a radioactive or fluorescent marker or some other detectable and measurable marker. The amount of labeled anti-IL13 antibody that binds to the antigen will have an indirect correlation with the ability of the candidate competing antibody (test antibody) to compete for binding to the same epitope, i.e. the greater the affinity of the test antibody. for the same epitope, the less bound the labeled antibody will be to the antigen-coated wells. A candidate competing antibody is considered an antibody that binds substantially the same epitope or competes to bind to the same epitope as an anti-IL13 antibody of the invention if the candidate antibody can block IL13 antibody binding by at least 20% , preferably by at least 20-50%, even more preferably, by at least 50% compared to the control performed in parallel in the absence of the candidate competing antibody. It will be understood that variations of this test can be made to arrive at the same quantitative value.

Vectors and host cells

In another aspect, the present disclosure provides vector constructs comprising a nucleotide sequence encoding the antibodies of the present invention and a host cell comprising such a vector. Standard techniques for cloning and transformation can be used in the preparation of cell lines expressing the antibodies of the present invention.

Recombinant expression vectors containing a nucleotide sequence encoding the antibodies of the present invention can be prepared using well known techniques. Expression vectors include a nucleotide sequence operably linked to transcriptional or translational regulatory nucleotide sequences such as those derived from mammalian, microbial, viral, or insect genes. Examples of regulatory sequences include transcriptional promoters, operators, enhancers, mRNA ribosome binding sites, and / or other appropriate sequences that control the initiation and termination of transcription and translation. Nucleotide sequences are "operably linked" when the regulatory sequence functionally refers to the nucleotide sequence for the appropriate polypeptide. Thus, a promoter nucleotide sequence is operably linked to, for example, the heavy chain sequence of the antibody if the promoter nucleotide sequence controls the transcription of the appropriate nucleotide sequence.

In addition, sequences encoding appropriate signal peptides that do not naturally associate with antibody heavy and / or light chain sequences can be incorporated into expression vectors. For example, a nucleotide sequence for a signal peptide (secretory leader) can be fused in frame to the polypeptide sequence so that the antibody is secreted into the periplasmic space or into the medium. A signal peptide that is functional in the intended host cells enhances the extracellular secretion of the appropriate antibody. The signal peptide can be cleaved from the polypeptide upon secretion of the antibody from the cell. Examples of such secretory signals are well known and include, for example, those described in US5698435, US5698417 and US6204023.

Host cells include, but are not limited to, microorganisms such as bacteria (eg, E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, cosmid DNA expression vectors and plasmid DNA containing antibody coding sequences; yeast (eg, Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus (eg, Baculovirus) expression vectors containing antibody-coding sequences; plant cell systems infected with recombinant virus expression vectors (eg, cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (eg, Ti plasmid) containing antibody coding sequences; or mammalian cell systems (eg, COS, CHO, BHK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (eg, metallothionein promoter) or mammalian virus (eg, adenovirus late promoter, vaccinia virus 7.5K promoter).

ES 2 390 344 T3

The vector may be a plasmid vector, a single or double-stranded phage vector, or a single or double-stranded RNA or DNA viral vector. Such vectors can be introduced into cells as polynucleotides by well known techniques for introducing DNA and RNA into cells. Vectors, in the case of phage and viral vectors, can also be introduced into cells as packaged or encapsulated viruses by well known techniques for infection and transduction. Viral vectors can be replication competent or replication defective. In the latter case, viral spread will generally occur only in complementing host cells. Cell-free translation systems can also be employed to produce the protein using RNA derived from the present DNA constructs. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, for example, PCT publication WO 86/05607; PCT publication WO 89/01036; and US Patent No. 5,122,464 ) and the variable domain of the antibody can be cloned into such a vector for expression of the entire heavy or light chain.

Prokaryotes useful as host cells include Gram negative or Gram positive microorganisms such as E. coli, and B. subtilis. Expression vectors for use in prokaryotic host cells generally comprise one or more phenotypic selection marker genes. A phenotypic selection marker gene is, for example, a gene that encodes a protein that confers resistance to antibiotics or that provides an autotrophic requirement. Examples of useful expression vectors for prokaryotic host cells include those derived from commercially available plasmids such as pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), pGEM1 (Promega Biotec, Madison, Wis., USA), and pET (Novagen , Madison, Wisconsin, USA) and pRSET (Invitrogen Corporation, Cartsbad, California, USA) vector series (Studier, FW, J. Mol. Biol. 219: 37 (1991); Schoepfer, R. Gen 124: 83 (1993) )). Promoter sequences commonly used for recombinant prokaryotic host cell expression vectors include T7, (Rosenberg, et al. Gene 56, 125-135 (1987)), β-lactamase (penicillinase), lactose promoter system (Chang et al. , Nature 275: 615, (1978); and Goeddel et al., Nature 281: 544, (1979)), tryptophan (trp) promoter system (Goeddel et al., Nucl. Acids Res. 8: 4057, (1980)), and tac promoter (Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY).

Yeasts include those of the genus Saccharomyces, Pichia, Actinomycetes, and Kluyveromyces. Yeast vectors will often contain an origin of replication sequence from a 2 μ yeast plasmid, an autonomously replicating sequence (ARS), a promoter region, sequences for polyadenylation, sequences for transcription termination, and a selection marker gene. Suitable promoter sequences for yeast vectors include, but are not limited to, promoters for metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem. 255: 2073, (1980)) or other glycolytic enzymes (Holland et al. , Biochem. 17: 4900, (1978)) such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosaphosphate isomerase, and glucokinase phogluase, and glucokinase phosphate. Other suitable vectors and promoters for use in yeast expression are further described in Fleer et al., Gene, 107: 285-195 (1991). Other suitable promoters and vectors for yeast and yeast transformation protocols are well known in the art. Yeast transformation protocols are well known. Such a protocol is described by Hinnen et al., Proc. Natl. Acad. Sci., 75: 1929 (1978). The Hinnen protocol selects for Trp + transformants on selective medium.

Mammalian or insect host cell culture systems can also be employed to express recombinant antibodies, eg, Baculovirus systems for the production of heterologous proteins. In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) can be used as a vector to express foreign genes. The virus grows in cells of Spodoptera frugiperda. The sequence encoding the antibody can be individually cloned into non-essential regions (eg the polyhedrin gene) of the virus and placed under the control of an AcNPV promoter (eg the polyhedrin promoter).

NSO or Chinese Hamster Ovary (CHO) cells can be used for mammalian expression of the antibodies of the present invention. Transcriptional and translational control sequences for expression vectors in mammalian host cells can be excised from viral genomes. The commonly used promoter sequences and enhancer sequences are derived from Polyoma virus, Adenovirus 2, Simian Virus 40 (SV40), and human cytomegalovirus (CMV). DNA sequences derived from the SV40 viral genome can be used to provide other genetic elements for expression of a structural gene sequence in a mammalian host cell, eg, origin, early and late promoter, enhancer, splicing, and sites. polyadenylation of SV40. Viral early and late promoters are particularly useful because both are readily obtained from a viral genome as a fragment that may also contain a viral origin of replication. Exemplary expression vectors are commercially available for use in mammalian host cells.

Polynucleotides encoding antibodies

The description further provides polynucleotides comprising a nucleotide sequence encoding an antibody of the invention and fragments thereof. The disclosure also encompasses polynucleotides as defined in the claims that hybridize under stringent or low stringency hybridization conditions with polynucleotides encoding an antibody of the present invention.

ES 2 390 344 T3

The polynucleotides can be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art. For example, if the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody can be formed from chemically synthesized oligonucleotides (eg, as described in Kutmeier et al., BioTechniques 17242 (1994)), which, briefly, it involves the synthesis of overlapping oligonucleotides containing parts of the sequence encoding the antibody, the hybridization and ligation of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.

Alternatively, a polynucleotide encoding an antibody can be generated from a nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin can be chemically synthesized or obtained from a suitable source ( for example, an antibody cDNA library, or a cDNA library generated from either nucleic acid, preferably poly A + RNA, isolated from any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention) by PCR amplification using synthetic primers that can hybridize to the 3 'and 5' ends of the sequence, or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, for example, a cDNA clone from a cDNA library encoding the antibody. The amplified nucleic acids generated by PCR can then be cloned into cloning vectors which can be replicated using any method well known in the art.

Once the nucleotide sequence and corresponding amino acid sequence of the antibody are determined, the nucleotide sequence of the antibody can be manipulated using methods well known in the art for manipulating nucleotide sequences, eg, recombinant DNA techniques, site-directed mutagenesis. , PCR, etc. (See, for example, techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2^to Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al., Eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY), to generate antibodies having a different amino acid sequence, for example to create amino acid substitutions, deletions and / or insertions.

The amino acid sequence of the heavy and / or light chain variable domains can be inspected to identify the CDR sequences by well-known methods, for example, by comparison with known amino acid sequences of other heavy and light chain variable regions to determine the regions of sequence hypervariability. Using routine recombinant DNA techniques, one or more of the CDRs can be inserted into framework regions, for example, into human framework regions to humanize a non-human antibody, as described and cited above. The framework regions can be consensus or naturally occurring framework regions, and preferably human framework regions (see, for example, Chothia et al., J. Mol. Biol. 278: 457-479 (1998) for an enumeration of human framework regions). Preferably, the polynucleotide generated by the combination of the framework and CDR regions encodes an antibody that specifically binds to a polypeptide of the disclosure. Preferably, as discussed and cited above, one or more amino acid substitutions can be made within the framework regions, and preferably the amino acid substitutions enhance the binding of the antibody to its antigen. Additionally, such methods can be used to make amino acid substitutions or deletions of one or more variable region cysteine ​​residues that participate in an in-chain disulfide bond to generate antibody molecules lacking one or more in-chain disulfide bonds. . Other alterations to the polynucleotide are encompassed by the present disclosure and within the skill of the art.

In addition, techniques developed for the production of "chimeric antibodies" can be used (Morrison et al., Proc. Natl. Acad. Sci. 81: 851-855 (1984); Neuberger et al., Nature 312: 604-608 (1984) ); Takeda et al., Nature 314: 452-454 (1985)) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity. As described above, a chimeric antibody is a molecule in which different parts are derived from different animal species, such as those that have a variable region derived from a murine mAb and a constant region from human immunoglobulin, for example, the antibodies humanized.

Alternatively, techniques described for the production of single chain antibodies can be adapted (US Patent No. 4,946,778; Bird, Science 242: 423-42 (1988); Huston et al., Prog Natl. Acad. Sci. USA 85 : 5879-5883 (1988); and Ward et al., Nature 334: 544-54 (1989)) to produce single chain antibodies. Single chain antibodies are formed by joining the heavy and light chain fragments of the Fv region through an amino acid bridge, resulting in a single chain polypeptide. Techniques for the constitution of functional Fv fragments in E. coli can also be used (Skerra et al., Science 242: 1038-1041 (1988)).

Methods of production of anti-IL13 antibodies

The antibodies of the invention can be produced by any method known in the art for the synthesis of antibodies, in particular by chemical synthesis or preferably by recombinant expression techniques.

ES 2 390 344 T3

Recombinant expression of an antibody of the invention, or fragment, derivative or analog thereof, (for example, a heavy or light chain of an antibody of the invention or a single chain antibody of the invention), requires the construction of an expression vector containing a polynucleotide encoding the antibody or a fragment of the antibody. Once a polynucleotide encoding an antibody molecule has been obtained, the vector for antibody production can be produced by recombinant DNA technology. An expression vector is constructed that contains sequences encoding antibodies and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination.

The expression vector is transferred into a host cell by standard techniques and then the transfected cells are cultured by standard techniques to produce an antibody of the invention. Vectors encoding both heavy and light chains can be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.

A variety of host expression vector systems can be used to express the antibody molecules of the invention as described above. Such host expression systems represent vehicles by which the coding sequences of interest can be produced and subsequently purified, but also represent cells that can express, when transformed or transfected with the appropriate nucleotide coding sequences, an antibody molecule of the invention in situ. Bacterial cells such as E. coli, and eukaryotic cells are commonly used for the expression of a recombinant antibody molecule, especially for the expression of the entire recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary (CHO) cells, in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus are an efficient expression system for antibodies (Foecking et al., Gen 45: 101 (1986); Cockett et al., Bio / Technology 8: 2 (1990)).

In addition, a host cell variety can be chosen that modulates the expression of the inserted sequences, or that modifies and processes the gene product in the specific manner desired. Such modifications (eg, glycosylation) and processing (eg, cleavage) of protein products can be important to protein function. Different host cells have characteristic and specific mechanisms for processing through translation and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure correct modification and processing of the expressed foreign protein. For this purpose, eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product can be used. Such mammalian host cells include, but are not limited to, CHO, COS, 293, 3T3 cells, or myeloma cells.

For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express the antibody molecule can be engineered. Rather than using expression vectors containing viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (eg, promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.) , and a selection marker. Following the introduction of the foreign DNA, the engineered cells can be allowed to grow for 1-2 days in enriched media, and then switched to selective media. The selection marker on the recombinant plasmid confers resistance to selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method can be used advantageously to genetically engineer cell lines that express the antibody molecule. Such engineered cell lines can be particularly useful in the selection and evaluation of compounds that interact directly or indirectly with the antibody molecule.

Various selection systems can be used, including but not limited to the use of herpes simplex virus thymidine kinase genes (Wigler et al., Cell 11: 223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl Acad. Sci. USA 48: 202. (1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22: 817 (1980)) in tk-, hgprt- or aprt- cells, respectively. Antimetabolite resistance can also be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Proc. Natl. Acad. Sci. USA 77: 357 (1980); O'Hare et al. al., Proc. Natl. Acad. Sci. USA 78: 1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78: 2072 (1981)); neo, which confers resistance to the aminoglycoside G-418 (Wu and Wu, Biotherapy 3: 87-95 (1991)); and hygro, which confers resistance to hygromycin (Santerre et al., Gene 30: 147 (1984)). Methods commonly known in the art of recombinant DNA technology can be routinely applied to select the desired recombinant clone, and such methods are described, for example, in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler. Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. BioL 150: 1 (1981).

Expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, "The use of vectors based on gene amplification for the expression of

ES 2 390 344 T3 cloned genes in mammalian cells ”(DNA Cloning, Vol.3. Academic Press, New York, 1987)). When a marker in the vector system expressing the antibody is amplifiable, increasing the level of inhibitor present in host cell culture will increase the number of copies of the marker gene. Since the amplified region associates with the antibody gene, antibody production will also increase (Crouse et al., Mol. Cell. Biol. 3257 (1983)).

The host cell can be co-transfected with two expression vectors of the disclosure, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors can contain identical selection markers that allow for equal expression of heavy and light chain polypeptides. Alternatively, a single vector that encodes and can express both heavy and light chain polypeptides can be used. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature 322: 52 (1986); Kohler, Proc. Natl. Acad. Sci. USA 77: 2197 (1980) )). The coding sequences for the heavy and light chains can comprise cDNA or genomic DNA.

Once an antibody molecule of the invention has been produced by an animal, chemically synthesized, or recombinantly expressed, it can be purified by any method known in the art for the purification of an immunoglobulin molecule, for example , by chromatography (for example, ion exchange, affinity, particularly by affinity for the specific antigen for Protein A, and size exclusion chromatography), centrifugation, differential solubility, or by any other conventional technique for protein purification. Furthermore, the antibodies of the present invention or fragments thereof can be fused to heterologous polypeptide sequences described herein or otherwise known in the art, to facilitate purification.

The present invention encompasses recombinantly fused or chemically conjugated antibodies (including conjugations both covalently and non-covalently) with a polypeptide. The fused or conjugated antibodies of the present invention can be used to facilitate purification. See, for example, Harbor et al., Cited above, and PCT publication WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett. 39: 91-99 (1994); US Patent No. 5,474,981; Gillies et al., Proc. Natl. Acad. Sci. 89: 14281432 (1992); Fell et al., J. Immunol. 146: 2446-2452 (1991).

Furthermore, the antibodies or fragments thereof of the present invention can be fused to marker sequences, such as a peptide to facilitate purification. In preferred embodiments, the amino acid sequence of the marker is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311), among many others of all of which are commercially available. As described in Gentz ​​et al., Proc. Natl. Acad. Sci. USA 86: 821-824 (1989), for example, hexa-histidine provides convenient purification of the fusion protein. Other useful peptide tags for purification include, but are not limited to, the "HA" tag, which corresponds to an epitope derived from the influenza virus hemagglutinin protein (Wilson et al., Cell 37: 767 (1984)) and the tag "flag".

Diagnostic uses for anti-IL13 antibodies

The antibodies of the invention include derivatives that are modified, that is, by covalently binding any type of molecule to the antibody, so that covalent binding does not interfere with binding to IL13. For example, but not by way of limitation, antibody derivatives include antibodies that have been modified, for example, by biotinylation, HRP, or any other detectable moiety.

The antibodies of the present invention can be used, for example, but not limited to, to detect the IL13 level of a cancer patient, including both in vitro and in vivo diagnostic methods. For example, antibodies can be used in immunoassays for qualitatively and quantitatively measuring levels of IL13 in biological samples. See, for example, Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988).

As discussed in more detail below, the antibodies of the present invention can be used either alone or in combination with other compositions. Antibodies can further be recombinantly fused to a heterologous polypeptide at the Non-C terminus or chemically conjugated (including covalent and non-covalent conjugations) with polypeptides or other compositions. For example, the antibodies of the present invention can be recombinantly fused or conjugated to molecules useful as labels in detection assays.

The present invention further encompasses antibodies or fragments thereof conjugated to a diagnostic agent. The antibodies can be used diagnostically to, for example, monitor the development or progression of cancer as part of a clinical testing procedure to, for example, determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, metals that emit positrons using various positron emission tomography, and non-radioactive paramagnetic metal ions. The substance

Detectable ES 2 390 344 T3 can be coupled or conjugated either directly to the antibody (or fragment thereof) or Indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. The technique. See, for example, US Patent No. 4,741,900 for metal ions that can be conjugated to antibodies for use as diagnostic agents in accordance with the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; Examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; An example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, ^{J 1 JJ 1} 125 131 iii 99 ^J Luciferin, and Aequorin; and examples of suitable radioactive material include I, I, In, or Tc.

Antibodies can also be bound to solid supports, which are particularly useful for immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride, or polypropylene.

Labeled antibodies, and derivatives and analogs thereof, that specifically bind IL13 for diagnostic purposes can be used to detect, diagnose, or monitor diseases, disorders, and / or conditions associated with aberrant expression and / or activity of IL13. . The invention provides the detection of aberrant expression of IL13, comprising (a) assaying the expression of IL13 in cells or body fluid of an individual using one or more antibodies of the present invention specific for IL13 and (b) comparing the level of gene expression with a conventional gene expression level, whereby an increase or decrease in the expression level of IL13 tested compared to the conventional expression level is indicative of aberrant expression.

The invention provides a diagnostic test for diagnosing a disorder, comprising (a) testing the expression of IL13 in the cells or body fluid of an individual using one or more antibodies of the present invention and (b) comparing the level gene expression with a conventional gene expression level, whereby an increase or decrease in the level of gene expression tested compared to the level of conventional expression is indicative of a particular disorder.

The antibodies of the invention can be used to test protein levels in a biological sample using classical immunohistological methods known to those of skill in the art (eg, see Jalkanen, et al., J. Cell. Biol. 101: 978-985 (1985); Jalkanen, et al., J. Cell. Biol. 105: 3087-3096 (1987)). Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay markers are known in the art and include enzymatic markers, such as, glucose oxidase; radioisotopes, such as iodine (²⁵I, ¹²¹I), carbon (¹⁴-C), sulfur (³⁵S), tritium (³H), Indian (¹¹²In), and technetium (⁹⁹Tc); luminescent markers, such as luminol; and fluorescent markers, such as fluorescein and rhodamine and biotin.

One aspect of the invention is the detection and diagnosis of a disease or disorder associated with aberrant expression of IL13 in an animal, preferably a mammal, and most preferably a human. In one embodiment, the diagnosis comprises: a) administering (eg, parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled molecule that specifically binds IL13; b) waiting for a time interval after administration that allows the labeled molecule to preferentially concentrate at sites in the subject where the polypeptide is expressed (and for the unbound labeled molecule, to be removed to a baseline level) ; c) determine the reference level; and d) detecting the labeled molecule in the subject, such that detection of the labeled molecule above the baseline level indicates that the subject has a particular disease or disorder associated with aberrant expression of IL13. The reference level can be determined by various methods including, comparing the amount of labeled molecule detected with a previously determined standard value for a particular system.

It will be understood in the art that the size of the subject and the imaging system used will determine the amount of remainder imaging necessary to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the amount of radioactivity injected will normally range from about 5 to 20 millicuries of⁹⁹Tc. The labeled antibody or antibody fragment will then preferentially accumulate at the location of cells that contain the specific protein. In vivo imaging is described in SW Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, SW Burchiel and BA Rhodes, eds., Masson Publishing Inc. (1982).

Depending on several variables, including the type of marker used and the mode of administration, the time interval after administration to allow the labeled molecule to preferentially concentrate at sites in the subject and for an unbound labeled molecule to be eliminated up to a baseline level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment, the time interval after administration is 5 to 20 days or 5 to 10 days.

In one embodiment, monitoring for the disease or disorder is carried out by repeating the method for

ES 2 390 344 T3 diagnose the disease or illness, for example, one month after the initial diagnosis, six months after the initial diagnosis, one year after the initial diagnosis, etc.

The presence of the labeled molecule can be detected in the patient using methods known in the art for in vivo screening. These methods depend on the type of marker used. Those skilled in the art will be able to determine the appropriate method to detect a particular marker. Methods and devices that can be used in the diagnostic methods of the invention include, but are not limited to, computed tomography (CT), whole-body scanning such as positron emission tomography (PET), magnetic resonance imaging ( MRI), and sonography.

In a specific embodiment, the molecule is labeled with a radioisotope and detected in the patient using a radiation-responsive surgical instrument (Thurston et al., US Patent No. 5,441,050). In another embodiment, the molecule is labeled with a fluorescent compound and detected in the patient using a fluorescence-responsive scanning instrument. In another embodiment, the molecule is labeled with a positron emission metal and detected in the patent using positron emission tomography. In yet another embodiment, the molecule is labeled with a paramagnetic marker and detected in a patient using magnetic resonance imaging (MRI).

In another aspect, a method is described for diagnosing a patient's predisposition to develop diseases caused by unregulated expression of cytokines. Increased amounts of IL13 in certain cells, tissues, or body fluids of the patient may indicate that the patient is predisposed to certain diseases. The method comprises collecting a sample of cells, tissue, or body fluid from a subject known to have low or normal levels of IL13, analyzing the tissue or body fluid for the presence of IL13 in the tissue, and predicting the predisposition of the patient to certain immune diseases based on the level of IL13 expression in the body tissue or fluid. The method comprises collecting a sample of cells, tissue, or body fluid known to contain a defined level of IL13 from a patient, analyzing the tissue or body fluid to determine the amount of IL13, and predicting the patient's predisposition to certain diseases. based on the change in the amount of IL13 compared to a defined or tested level established for normal cells, tissue, or body fluid. The defined level of IL13 can be a known amount based on literature values ​​or it can be determined in advance by measuring the amount in normal cells, tissue or body fluid. Specifically, the determination of IL13 levels in certain tissues or body fluids allows specifically and early, preferably before disease occurs, the detection of immune diseases in the patient. Immune diseases that can be diagnosed using the present method include, but are not limited to, the immune diseases described herein. The tissue or body fluid can be peripheral blood, peripheral blood leukocytes, biopsy tissues such as lung or skin biopsies, and tissue.

Therapeutic uses of anti-IL13 antibodies

An antibody, with or without a therapeutic moiety conjugated thereto, administered alone or in combination with cytotoxic factor (s) or cytostatic factor (s) can be used as a therapeutic element. The present invention relates to antibody-based therapies that involve administering antibodies of the invention to an animal, a mammal, or a human, to treat an IL13-mediated disease, disorder, or condition. Antibodies directed against IL13 are useful for the inhibition of tumors or the proliferation of cancer cells in animals, including but not limited to cows, pigs, horses, chickens, cats, dogs, non-human primates etc., as well as humans. For example, by administering a therapeutically acceptable dose of an antibody, or antibodies, of the present invention, or a cocktail of the present antibodies, or in combination with other antibodies from various sources, cancers or tumors can be reduced or eliminated in the treated mammal.

Therapeutic compounds of the invention include, but are not limited to, antibodies of the invention (including fragments, analogs, and derivatives thereof as described herein) and nucleic acids encoding antibodies of the invention as described. below (including fragments, analogs and derivatives thereof and anti-idiotypic antibodies as described herein). Antibodies of the invention can be used to treat, inhibit, or prevent diseases, disorders, or conditions associated with aberrant IL13 expression and / or activity, including, but not limited to, any one or more of the described diseases, disorders, or conditions. in the present document. Treatment and / or prevention of diseases, disorders, or conditions associated with aberrant IL13 expression and / or activity includes, but is not limited to, alleviating symptoms associated with those diseases, disorders, or conditions. The antibodies of the invention may be provided in pharmaceutically acceptable compositions as is known in the art or as described herein.

The anti-IL13 antibodies of the present invention can be used therapeutically in a variety of diseases. The present invention provides a method of preventing or treating IL13-mediated diseases in a mammal. The method comprises administering a disease-preventing or disease-treating amount of anti-IL13 antibody to the mammal. The anti-IL13 antibody binds IL13 and regulates cellular cytokine receptor expression resulting in cytokine levels characteristic of non-states. disease.

ES 2 390 344 T3

The amount of the antibody that will be effective in treating, inhibiting, and preventing a disease or disorder associated with aberrant IL13 expression and / or activity can be determined by standard clinical techniques. The antibody can be administered in disease-compatible treatment regimens, for example, a single or some doses over one to several days to improve a disease state or periodic doses over a long time to prevent allergy or asthma. In addition, in vitro assays can optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the severity of the disease or disorder, and should be decided at the discretion of the physician and the circumstances of each patient. Dose-effective dose-response curves derived from in vitro or animal model test systems can be extrapolated.

For antibodies, the dosage administered to a patient is typically 0.1 mg / kg to 100 mg / kg of the patient's body weight. Preferably, the dosage administered to a patient is between 0.1 mg / kg and 20 mg / kg of the patient's body weight, more preferably 1 mg / kg to 10 mg / kg of the patient's body weight. Generally, human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to foreign polypeptides. Thus, lower human antibody dosages and less frequent administration are often possible. Furthermore, the dosage and frequency of administration of the antibodies of the invention can be reduced by enhancing the uptake and penetration into tissue (eg, the brain) of the antibodies by modifications such as, for example, lipidation.

The antibodies of this invention can be used advantageously in combination with other monoclonal and chimeric antibodies, or with lymphokines or hematopoietic growth factors (such as, for example, IL2, IL-3, IL-7, IFN, GCSF, GMCSF, Flt3, IL21) and unmethylated CpG containing oligonucleotides, for example, which serves to increase the number or activity of effector cells that interact with antibodies.

The antibodies of the invention can be administered alone or in combination with other types of treatments, such as chemotherapy and radiotherapy.

In a preferred aspect, the antibody is substantially purified (eg, substantially free of substances that limit its effect or produce unwanted side effects).

The anti-IL13 antibody can be administered to the mammal in any acceptable manner. Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, inhalation, and oral routes. The antibodies or compositions can be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g. oral, rectal and intestinal mucosa, etc.) and can be administered in conjunction with other biologically active agents. Administration can be systemic or local. Furthermore, it may be desirable to introduce the antibodies or therapeutic compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection can be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.

Pulmonary administration may also be employed, for example, by use of an inhaler or nebulizer, and formulation with an aerosolizing agent. The antibody can also be administered to the lungs of a patient in the form of a dry powder composition (see, for example, US Patent No. 6,514,496).

In a specific embodiment, it may be desirable to administer the antibodies or therapeutic compositions of the invention locally to the area in need of treatment; This can be achieved by, for example, and not by way of limitation, local infusion, topical application, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous material , non-porous, or gelatinous, including membranes, such as sialastic membranes, or fibers. Preferably, when administering an antibody of the invention, great care should be taken to use materials to which the protein is not absorbed.

In another embodiment, the antibody can be delivered in a vesicle, in particular a liposome (see Langer, Science 249: 1527-1533 (1990); Treat et al., In Liposomes in the Therapy of Infectious Disease and Cancer, LopezBerestein and Fidler ( eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).

In yet another embodiment, the antibody can be delivered in a controlled release system. In one embodiment, a pump can be used (see Langer, cited above; Sefton, CRC Crit. Ref. Biomed. Eng. 14: 201 (1987); Buchwald et al., Surgery 88: 507 (1980); Saudek et al. , N. Engl. J. Med. 321: 574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228: 190 (1985); During et al., Ann. Neurol. 25: 351 (1989); Howard et al., J. Neurosurg. 71: 105 (1989)). In yet another embodiment, a controlled release system may be placed in proximity to the therapeutic target.

ES 2 390 344 T3

The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of the antibody, and a physiologically acceptable carrier. In a specific embodiment, the term "physiologically acceptable" means approved by a regulatory agency of the federal or state government or listed in the United States Pharmacopeia or other generally recognized pharmacopoeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic agent is administered. Such physiological carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous solutions of dextrose and glycerol can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, limestone, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene, glycol, water, ethanol, and the like. The composition, if desired, may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations, and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. The oral formulation can include conventional carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, etc. Examples of suitable carriers are described in "Remington's Pharmaceutical Sciences" by EW Martin. Such compositions will contain an effective amount of the antibody, preferably in a purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation must be adapted to the mode of administration.

In one embodiment, the composition is formulated according to routine procedures as a pharmaceutical composition adapted for intravenous administration to humans. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. When necessary, the composition can also include a solubilizing agent and a local anesthetic such as lidocaine to relieve pain at the injection site. Generally, the components are supplied either separately or mixed together in a unit dosage form, for example, as a water-free concentrate or dry lyophilized powder in a hermetically sealed container such as an ampoule or a sachet indicating the amount of active principle. When the composition is to be administered by infusion, it can be dispensed from an infusion bottle containing sterile pharmaceutical grade water or saline. When the composition is administered by injection, an ampoule of sterile water for injection or saline may be provided so that the components are mixed prior to administration.

A pharmaceutical package or kit is described that comprises one or more containers filled with one or more of the components of the pharmaceutical compositions of the invention. Optionally associated with such container (s) may be a note in the form prescribed by a government agency that regulates the manufacture, use, or sale of pharmaceutical or biological products, a note that reflects approval by the manufacturing, use, or agency agency. sale for human administration.

Furthermore, the antibodies of the present invention can be conjugated to various effector molecules such as heterologous polypeptides, drugs, radionucleotides, or toxins. See, for example, PCT publications WO 92/08495; WO 91/14438; WO 89/12624; US Patent No. 5,314,995; and EP 396,387. An antibody or fragment thereof can be conjugated to a therapeutic moiety such as a cytotoxin, for example a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, for example alpha emitters such as, for example, 213Bi. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoside, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy-anthrazine-dione, mitoxantrone-actinomycin, mitycin-dione glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologues thereof. Therapeutic agents include, but are not limited to, antimetabolites (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (eg, mechlorethamine, thioepa, chlorambucil, melphalan, carmustine ( BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (for example, daunorubicin (formerly known as daunomycin) and doxorubicin), antibiotics (for example, dactinomycin (formerly known as actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (for example, vincristine and vinblastine).

Techniques for conjugating such therapeutic moieties with antibodies are well known, see, for example, Amon et al., "Monoclonal Antibodies For Immunotargeting of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers of Citotoxic Agents in Cancer Therapy: A Review," in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-508 (1985); "Analysis, Results, And Future Prospective Of Therapeutic Use Of Radiolabeled Antibody in Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., “The Preparation And Citotoxic

ES 2 390 344 T3

Properties Of Antibody-Toxin Conjugates ”, Immunol. Rev. 62: 119-58 (1982). Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate. (See, for example, Segal in US Patent No. 4,676,980.)

The conjugates of the invention can be used to modify a given biological response, the therapeutic agent or drug moiety should not be considered as limited to classical chemical therapeutic agents. For example, the drug moiety can be a protein or polypeptide that possesses a desired biological activity. Such proteins can include, for example, a toxin such as abrin, ricin A, Pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, interferon a, interferon β, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, eg TNF-a, TNF-β, AIM I (See, International Publication No. WO 97/33899), AIM II (See, International Publication No. WO 97/34911), Fas Ligand (Takahashi et al., Int. Immunol., 6: 1567-1574 (1994)), VeGI (see, International Publication No. WO 99/23105), a thrombotic agent or an anti-angiogenic agent, eg angiostatin or endostatin; or, biological response modifiers such as, for example, lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), stimulatory factor of granulocyte macrophage colony ("GMCSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors.

Examples

Example 1:

IL13 Immunogen Preparation: A Mutated, Inactive Human IL13 / Fc (MT-IL13 / Fc)

A. Cloning and construction of an expression plasmid for MT-IL13 / Fc

Human IL13 with a mutation (glutamic acid to lysine) at amino acid residue # 13 was reported to bind IL13Ra1 with equal or high affinity but had lost the ability to activate IL13Ra1 bearing cells (Thompson et al. , J. Biol. Chem., 274: 29944 (1999)). This inactive, mutated IL13, designated MT-IL13, was expressed in human embryonic kidney 293-T cells. The purified recombinant protein was used as an immunogen in the present invention to generate anti-IL13 monoclonal antibodies. Two oligonucleotide primers were synthesized: 5 'AAGCTTTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGAAGCTCAT3' (SEQ ID NO 9) 5 'CTCGAGGTTGAACCGTCCCTCGCGAAAAAG 3' (SEQ ID NO. 13 of the gene chain IL-13 nucleotides correspond to the sequence of gene MTN nucleotides used and sequence reactions used in IL-13 nucleotides and gene sequence SEQ ID NO 13) that correspond to the sequence of IL-13 nucleotides and gene chain reactions used and gene sequence SEQ ID NO. polymerase (PCR) to clone the IL13 gene from a human testes cDNA library (BD Biosciences Clontech, Palo Alto, CA). The PCR fragment (342 base pairs) lacking the predicted signal peptide sequence of IL13 was ligated into the vector pSecTag / FRT (Invitrogen, Carlsbad, CA) containing a secretory signal peptide sequence at the 5 'end and a human Fcy1 sequence (constant regions and hinge CH2 and CH3) at the 3 'end. The composition of the construct was confirmed by sequencing.

B. Production of MT-IL13 / Fc from transfected 293T cells

For transient expression of MT-IL13 / Fc, purified plasmid DNA was transfected into 293T cells by Lipofectamine 2000 (Invitrogen), according to the manufacturer's protocol. At 72 hours after transfection, the transfected cell culture supernatants were collected for purification. For stable expression of MTIL13 / Fc, cell lines were established using a 293T Flp-In cell line (Invitrogen). To confirm expression, culture supernatants were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The separated proteins were transferred to a nitrocellulose membrane and detected by reaction with mouse monoclonal antibody anti-human IgG (Fc) conjugated to horseradish peroxidase (HRP) (Sigma, St. Louis, MO) or polyclonal goat anti-IL13 antibodies (R&D Systems, Minneapolis, MN), which were then detected with donkey anti-goat HRP-IgG (Jackson ImmunoResearch Laboratories, West Grove, PA). Film immunoreactive proteins were identified using enhanced chemiluminescence detection (Supersignal West Pico Chemiluminescent Substrate, Pierce, Rockford, IL).

C. Purification of MT-IL13 / Fc

MT-IL13 / Fc was purified with a protein A hyper-D affinity column (Invitrogen) equilibrated with phosphate buffered saline (PBS). After applying the cell culture supernatant to the column, the resin was washed with more than 20 column volumes of PBS. Then, the resin was washed with SCC buffer (0.05M sodium citrate, 0.5M sodium chloride, pH 6.0) to remove unbound proteins. The IL13 fusion proteins (0.05 M sodium citrate, 0.15 M sodium chloride, pH 3.0) were then eluted and dialyzed in PBS.

The affinity column fractions containing MT-IL13 / Fc were analyzed by SDS-PAGE. Protein purity was analyzed by Coomassie blue staining and protein identity by Western blot using goat anti-human IgG (Fc) antibody (Sigma) and goat anti-human IL13 antibody (R&D Systems). as described above.

Example 2:

ES 2 390 344 T3

Generation of monoclonal anti-IL13 antibodies

Male A / J mice (Harlan, Indianapolis, IN), 8-12 weeks old, were injected subcutaneously with 20 pg of MT-IL13 / Fc in complete Freund's adjuvant (Difco Laboratories, Detroit, MI) in 200 µl of PBS pH 7.4. At two week intervals, the mice were injected twice subcutaneously with 20 pg of MT-IL13 / Fc in incomplete Freund's adjuvant. Then, two weeks later and three days before sacrifice, the mice were again injected intraperitoneally with 20 pg of the same immunogen in PBS. Spleen cells isolated from one or more antigen-immunized mice were used for fusion. Similar immunization and fusion procedures were also used with human IL13 expressed in E. coli (R&D Systems) as the immunogen.

In the fusion leading to the generation of anti-IL13 mAb 228B / C-1, 26.4x10⁶ spleen cells and 58.8x10⁶ spleen cells from two immunized mice. For each fusion, individual cell suspensions were prepared from the spleen of immunized mice and used for fusion with Sp2 / 0 myeloma cells. Sp2 / 0 and spleen cells were fused at a 1: 1 ratio in medium containing 50% polyethylene glycol (MW 1450) (Kodak, Rochester, NY) and 5% dimethyl sulfoxide (Sigma). The cells were then adjusted to a concentration of 1.5 x 10⁵ spleen cells per 250 μl of suspension in DMEM medium (Invitrogen, CA), supplemented with 10% fetal bovine serum, 100 units / ml penicillin, 100 pg / ml streptomycin, 0.1 mM hypoxanthine, 0 aminopterin, 4 pM, and thymidine 16 pM. Two hundred and fifty microliters of the cell suspension were added to each well of approximately fifty 96-well microculture plates. After approximately ten days the culture supernatants were removed to select for reactivity with MT-IL13 / Fc in ELISA.

Wells of Immulon 2 microtest plates (Dynatech Laboratories, Chantilly, VA) were coated by adding purified MTIL13 / Fc (0.1 pg / ml) overnight at room temperature. After removing the coating solution by shaking from the plate, 200 µl of a blocking buffer / diluent (PBS containing 2% bovine serum albumin and 0.05% TWEEN® 20) was added to each well over a period of 1 hour. time to block non-specific sites. One hour later, the wells were then washed with PBST buffer (PBS containing 0.05% TWEEN® 20). Fifty microliters of culture supernatant were collected from each fusion well, mixed with 50 µl of the blocking / diluent buffer, and then added to individual wells of the microtest plates. After one hour of incubation, the wells were washed with PBST. Bound murine antibodies were then detected by reaction with HRP-conjugated goat anti-mouse IgG (Fc specific) (Jackson ImmunoResearch Lab, West Grove, PA) and diluted 1: 2,000 with the blocking buffer / diluent. Peroxidase substrate solution containing 0.1% 3,3,5,5-tetramethylbenzidine (Sigma, St. Louis, MO) and 0.003% hydrogen peroxide (Sigma) was added to the development wells. color for 30 minutes. The reaction was terminated by adding 50 µl of 2M H2SO4 per well. The OD450 of the reaction mixture was measured with a BioTek ELISA reader (BioTek Instruments, Winooski, VM).

The culture supernatants from the MT-IL13 / Fc selection positive wells were then tested for negative binding to an irrelevant Fy1 fusion protein. Final positive wells were then selected for single cell cloning by limiting dilution. The monoclonal antibody culture supernatants were retested for reactivity by ELISA. Selected hybridomas were grown in shake flasks and spent culture supernatant was collected for antibody purification by protein A affinity chromatography.

The purified antibodies were tested by four assays: i) cross-reactivity with MT-IL13 / Fc expressed in 293T cells and mouse IL13 expressed in E. coli; ii) inhibition of autocrine proliferation of IL-13 of HDLM-2 and L-1236 cells; iii) inhibition of IL13-induced STAT6 phosphorylation in THP-1 cells; and iv) inhibition of IL13-regulated CD14 and CD23 expression in human monocytes.

Seventy-three anti-IL13 mAbs were obtained from fusions made in mice immunized with MT-IL13 / Fc and IL13. Thirty-nine of these mAbs were purified for characterization by ELISA and cell-based assays. Thirteen of these 39 mAbs inhibited autocrine IL-13-induced proliferation of HDLM-2 and L-1236 cells (see assay description and results in Example 5). Four of the mAbs were found to be very strongly reactive with human IL13 in ELISA and were neutralizing against human IL13 in functional cell-based assays. These mAbs were named 228B / C-1, 228A-4, 227-26 and 227-43. All of these antibodies were generated using glycosylated MT-IL13 / Fc as the immunogen.

Example 3:

Reactivity of monoclonal anti-IL13 antibodies with human and mouse IL13 in ELISA

Various anti-IL13 monoclonal antibodies were tested for reactivity by ELISA. Different wells of 96-well microtest plates were coated with either non-glycosylated human IL13 expressed in E. coli (R&D Systems), MT-IL13 / Fc glycosylated expressed in 293T cells, or mouse IL13 expressed in E. coli ( R&D Systems) by adding 100 µl of IL13 protein at 0.1 µg / ml in PBS. Following overnight incubation at room temperature, wells were treated with PBSTB (PBST containing 2% BSA) to saturate the remaining binding sites. The wells were then washed with PBST.

ES 2 390 344 T3

One hundred microliters of anti-IL13 mAb diluted twice in series (0.5 pg / ml (3.33 nM) to 0.05 ng / ml (0.00033 nM)) were added to the wells for 1 hour at room temperature. ambient. An anti-IL13 JES-5A2 mAb (BD Biosciences-Pharmingen, San Diego, CA) was also tested as a positive control. This antibody was generated using human IL13 expressed in E. coli as the immunogen. Isotype matched HIV 1 anti-gp120 mouse mAb was used as an irrelevant negative control. The wells were then washed with PBST. Bound antibody was detected by incubation with HRP-goat anti-mouse IgG (Fc) antibody (Jackson ImmunoResearch) for 1 hour at room temperature. Peroxidase substrate solution was then added for color development as described above. OD450 was measured using an ELISA reader.

Figure 1 shows the dose-dependent binding of anti-IL13 mAb 228B / C-1, 228A-4, 227-26, 227-43, and the negative control in ELISA. Among these mAbs, 228B / C-1 showed the strongest reactivity. Figure 2 shows the dose-dependent binding of anti-IL13 mAbs to MT-IL13 / Fc in ELISA. 228B / C-1 and 228A-4 showed the strongest reactivity with MT-IL13 / Fc, while 227-26 and 227-43 showed moderate reactivity.

Figures 1 and 2 show that 228B / C-1 has the highest affinity for both glycosylated and non-glycosylated human IL3 among all anti-IL13 mAbs tested. None of these anti-IL13 mAbs cross-reacted with mouse IL13 in ELISA (data not shown).

Example 4

Lack of competition of the binding of 228B / C-1-HRP to human IL13 by JES10-5A2

To examine whether JES10-5A2 and 228B / C-1 bind to the same epitope in human IL13, a competition ELISA was used to examine the effect of JES10-5A2 on the binding of 228B / C-1-HRP to expressed human IL13. in E. coli. Each well of 96-well microtest plates was incubated with 100 µl of IL13 protein at 0.1 pg / ml in PBS. Following overnight incubation at room temperature, wells were treated with PBSTB (PBST containing 2% BSA) to saturate the remaining binding sites. The wells were then washed with PBST. Fifty microliters of 228B / C-1 and JES10-5A2 diluted twice in series (from a final concentration of 20 pg / ml to 9.76 ng / ml) were mixed with 50 µl of 228B / C-1-HRP previously titrated (at a 1: 6,400 dilution). The mixtures were then added to the wells and incubated for 1 hour at room temperature. Then peroxidase substrate solution was added for color development as described above. OD450 was measured using an ELISA reader.

Figure 3 demonstrates that JES10-5A2 does not compete with the binding of 228B / C-1-HRP to human IL13, indicating that 228B / C-1 and JES10-5A2 bind to different sites on human IL13.

Example 5

Selection of neutralizing monoclonal anti-IL13 antibodies by an autocrine IL-13-dependent proliferation assay using L-1236 and HDLM-2 cells

L-1236 and HDLM-2 are Hodgkin lymphoma cell lines obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). These cell lines produce IL13 which in turn activates their cell proliferation in an autocrine manner (Kapp U et.al., J. Exp. Med. 189: 1939 (1999)). Cells (25,000 cells / well) were cultured in the presence or absence of different anti-IL13 mAbs (0.2, 0.02 and 0.002 pg / ml) in 5% CO2 at 37 ° C for 3-5 days. Cell proliferation was then measured either by an assay using the tetrazolium compound MTS (Promega, Madison, WI) (readings at OD490) or by incorporation of ³H-thymidine (Amersham Biosciences, Piscataway, NJ).

The addition of a neutralizing anti-IL13 mAb to the culture of these cell lines was expected to inhibit their proliferation by binding to, and inactivating, IL13 produced by these cells. The results illustrated in Figure 4 show the effect of the anti-IL13 mAb of the present invention on the proliferation of L-1235 cells. The mAb 228B / C-1 shows the highest potency of inhibiting L-1236 cell proliferation in a dose-dependent manner among the neutralizing antibodies tested. TA1-37 (an anti-IL13 mAb generated using human IL13 expressed in E. coli as an immunogen) did not have any inhibitory activity even at a dose of up to 0.2 pg / ml. Similar results were obtained with HDLM-2 cells.

Example 6

Assay to determine IL13-regulated expression of CD14 and CD23 in primary human monocytes

IL13 induces the suppression of CD14 expression and up-regulation of CD23 expression in human monocytes (de Waal Malefyt et al., J. Immunol., 151: 6370 (1993), Chomarat et al., Int. Rev. Immunol., 17: 1 (1998)). Peripheral blood leukocytes (PBL) were isolated from freshly collected heparinized whole blood from healthy human donors by Histopaque-1077 density gradient centrifugation (Sigma). PBL (1.5x10⁶) suspended in RPMI-1640 medium (Invitrogen) with 5% fetal calf serum to each well of a 96-well tissue culture plate containing recombinant IL13 (final 10 ng / ml = 0.813 nM) and an anti-monoclonal antibody. IL13 or an irrelevant antibody (three-fold serial dilutions, from 12 pg / ml

ES 2 390 344 T3 final = 80 nM). The expression of CD14 or the expression of CD23 in monocytes, respectively, was suppressed or upregulated by the addition of 0.813 nM human IL13 to the incubation medium. The medium control contained RPMI-1640 / FBS medium without recombinant IL13.

Cells were incubated in 5% CO2 at 37 ° C for 2 days. Cells were harvested for staining with anti-CD14-FITC or anti-CD23-PE antibody (BD Biosciences-Pharmingen). The expression levels of CD14 and CD23 in the monocyte population were measured by flow cytometry and represented by mean fluorescence intensity (MFI).

The effects of anti-IL13 mAbs on IL13-suppressed CD14 expression in human monocytes are depicted in Figure 5. Among all anti-IL13 mAbs tested, 228B / C-1 had the highest potency in inhibiting the effect of IL13 on CD14 expression. Complete inhibition of the effect of IL13 was achieved at 0.33 nM. The inhibitory activities of mAb 227-26 and 228A-4 were moderate, while that of JES10-5A2 was weak. The effect of IL13 could not be completely inhibited by JES10-5A2 even at 80 nM.

The effects of anti-IL13 mAb on IL13-induced upregulation of CD23 in human monocytes are depicted in Figure 6. Similar to the results in CD14 expression (Figure 5), 228B / C-1 was the most potent in inhibiting the effect of IL13 on CD23 expression among the anti-IL13 mAbs tested. Complete inhibition was achieved by 228B / C-1 at 0.33 nM. The inhibitory potency of JES10-5A2 was weak.

Based on the results presented in Figures 5 and 6, complete inhibition of IL13 by 228B / C-1 can be achieved at a molar stoichiometric ratio of 1: 2 (mAb: IL13), and therefore 228B / C-1 it is a very high affinity neutralizing mAb against human IL13.

Example 7

IL13-induced STAT6 phosphorylation assay in THP-1 cells

IL13 can activate the myeloid cell line THP-1 (ATCC, Manassas, VA) to induce phosphorylation of STAT6 which is a critical step in the IL13 signal transduction pathway (Murata T et al., Int. Immunol. 10: 1103-1110 (1998) Anti-IL13 mAbs were tested for IL13 inhibition in this assay.

THP-1 cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM) (Invitrogen) supplemented with 5% fetal calf serum. On the day of experiments, cells were washed and incubated in serum-free DMEM at 37 ° C in 5% CO2 for 2 hours. Then 0.3x10⁶ cells in 80 µl of serum-free medium to each well of a 96-well round bottom plate. One hundred and twenty microliters of medium containing human IL13 (final concentration of 10 ng / ml = 0.813 nM) and anti-IL13 mAb (5-fold serial dilutions, from a final concentration of 0.5 pg / ml = 3.333 nM). Negative control wells containing either no IL13 or IL13 and an isotype-matched irrelevant mouse mAb.

The mixtures were incubated at 37 ° C in 5% CO2 for 10 min. The plates were then centrifuged at 300 xg for 3 minutes at 4 ° C. After removing the supernatant, the cell pellets were resuspended in 100 µl of Laemmli non-reducing sample buffer (SDS-PAGE loading buffer, BioRad, CA) and then transferred to microcentrifuge tubes. The tubes were heated at 95 ° C for 5 minutes and then centrifuged at 10,000 xg for 10 minutes at room temperature. Supernatants were collected and analyzed by 4-20% gradient SDS-PAGE. The separated proteins were transferred to a PVDF membrane which was then incubated with diluted mouse anti-human Stat6 mAb (Y641, phosphospecific) (BD Bioscienses Pharmingen).

Bound antibody was detected by HRP-conjugated goat anti-mouse IgG (Fc) antibodies (Jackson ImmunoResearch Laboratories). Film immunoreactive proteins were identified using enhanced chemiluminescence detection (Supersignal West Pico Chemiluminescent Substrate, Pierce). Figure 7 depicts the results of the effect of anti-IL13 mAb on IL13-induced phosphorylation of Stat6 in THP-1 cells. Stat6 is phosphorylated in THP-1 cells treated with 0.813 nM human IL13. Dose-dependent inhibition of Stat6 phosphorylation was found when cells were treated with mAb 228B / C-1, 228A-4, 227-26, 227-43, and JES10-5A2. The mAb 228B / C-1 is the most potent neutralizing antibody among the anti-IL13 mAbs tested. Complete inhibition was achieved by 228B / C-1 at a concentration between 0.667 nM and 0.133 nM. The approximate stoichiometric molar ratio between 228B / C-1 and IL13 for complete inhibition was 1: 2. This agrees with the data shown in Figures 5 and 6.

Example 8

Molecular cloning of heavy and light chain genes encoding anti-IL13 monoclonal antibodies

Total RNA was isolated from hybridoma cells using a QIAGEN kit (Valencia, CA). A reverse transcription reaction (first strand cDNA) was carried out as follows: 1-1.5 mg of total RNA was mixed with 1 ml of 10 mM dNTP, 50 ng of random hexamers, and RNase-free water in a final volume of 12 ml

ES 2 390 344 T3

The reaction mixture was incubated at 65 ° C for 5 minutes and immediately placed on ice for 1 minute. After a brief centrifugation, the following reagents were added: 4 ml of 5X first strand buffer (250 mM TrisHCl, pH 8.3, 375 mM KCl, 15 mM MgCl2), 2 ml of 0.1 mM DTT, and 1 ml RNaseOUT RNase inhibitor (40 U / ml). After mixing, the reaction was incubated at room temperature for 2 minutes. Then one milliliter of Superscript II RT (50 U / ml) was added to the mixture for incubation at 25 ° C for 10 minutes followed by 50 minutes at 42 ° C. After a short centrifugation, the reaction was incubated for 15 minutes at 70 ° C to inactivate the reverse transcriptase. Then one microliter of RNase H (2 U / ml) was added and the reaction was incubated for 20 minutes at 37 ° C to destroy the RNA.

To amplify the variable regions of the heavy and light chains, a method described by O'Brien and Jones (O'Brien S. and Jones T., "Humanizing antibodies by CDR grafting", Antibody Engineering, Springer Lab manual, Eds. Kontermann and Duble, S (2001)). Briefly, 5 'primers were selected from the signal peptide region (11 sets for the light chain and 12 sets of degenerate primers for the heavy chain) and 3' primers were selected from the constant region of the chain or either light or heavy. The 5 'and 3' primers (1.5 ml of 10 mM) were mixed with 5 ml of 10X PCR buffer (250 mM Tris-HCl, pH 8.8, 20 mM MgSO4, 100 mM KCI, (NH4) 2SO4100 mM, 1% Triton X-100, 1 mg / ml nuclease-free BSA), 1 ml cDNA as prepared above, 1 ml Turbo pfu (Stratagene) and water to adjust the total volume of the reaction to 50 ml. PCR was performed as follows: 1 cycle at 94 ° C for 4 minutes; 25 cycles at 94 ° C for 30 seconds, at 53 ° C for 30 seconds, and at 72 ° C for 45 seconds; and 1 cycle at 72 ° C for 7 minutes. The reaction mixtures were resolved by electrophoresis on a 1% agarose gel.

The amplified DNA fragment was purified and cloned into a pcDNA3.1 vector. Cloning was carried out using the TOPO cloning kit from Invitrogen following the protocol suggested by the manufacturer (Invitrogen). Fifteen to twenty transformed E.coli colonies were used for plasmid purification. Plasmids were sequenced using a T7 primer. The predominant sequences for the heavy and light chains were cloned into an M13 Fab expression vector by hybridization mutagenesis (Glaser S. et al. Antibody Engineering (Oxford University Press, New York (1995)), Near RI, BioTechniques 12: 88 (1992)). The binding properties of the expressed Fab were confirmed by ELISA. Figure 8 depicts the VH and VL chain amino acid sequences for 228B / C.

Example 9

Epitope mapping

Anti-IL13 mAb 228B / C-1 binds to a conformational epitope and binds to cynomologus monkey IL13 with the same high affinity as it does to human IL13. However, 228B / C does not bind to murine IL13. Therefore, the strategy designed to map epitopes was to exchange small parts of monkey IL13 with the corresponding mouse IL13 sequence. Overlapping oligonucleotides were synthesized. Two rounds of PCR were performed to assemble the hybrid IL13 constructs so that part of the monkey IL13 was replaced by the corresponding sequence from mouse IL13. Final PCR amplified IL13 coding regions were cloned into pcDNA3.1 vector in frame with a V5 tag using the TOPO cloning kit (Invitrogen). It was confirmed by sequencing that the entire PCR amplified region contained only the desired domain swap mutations and no additional unwanted mutations in the expression vectors.

The anti-IL13 mAb binding epitope was identified as an 8 mer peptide from amino acid # 49 to 56, ESLINVSG (SeQ ID NO 18). This epitope is located in the B helix and the BC loop in human IL13. When the cynomologus iL13-derived epitope peptide was used to exchange the corresponding sequence in murine IL13, the resulting hybrid IL13 molecule can bind to 228B / C with an affinity similar to that of the original cynomologus IL13, further validating that the MAb 228B / C binds to cynomologus or human IL13 at this peptide between residues # 49-56. Sequence comparison between human, cynomologus and murine IL13 reveals that only three residues Ile52, Val54, Gly56 in human IL13 are not conserved, suggesting that the critical residues for the interaction of IL13 and anti-IL13 mAb through this 8-mer peptide are determined by one or a combination of some of these three residues.

This epitope was further confirmed by peptide spot analysis. The entire human IL13 peptide was screened with a series of overlapping 12 mer peptides synthesized by SPOT on cellulose membrane. The only peptide reactive with anti-IL13 mAb was identified as a 12-mer peptide of amino acids # 44-56, YCAALESLINVS (SEQ ID NO 19), which overlaps the identified region through domain exchange experiments.

Example 10

ADCC Assays to Determine Anti-IL-13 mAbs

PBMC are isolated from fresh heparinized blood samples by conventional centrifugation techniques using Ficoll-paque (50 ml buffy coat provides ~ 300 x10⁶ PBMC). PBMC are stimulated (20 x10⁶ PBMC) with IL-2 (10 U / ml) in RPMI1640 / 10% FCS for 24 h at 37 ° C, 5% CO2.