Antibodies for inhibiting blood coagulation and methods of use thereof

IS 2 380 452 T3

DESCRIPTION

Antibodies to inhibit blood clotting and methods of using them.

BACKGROUND OF THE INVENTION

1. Field of the invention

[0001] The present invention relates to new antibodies and methods of using the antibodies to inhibit blood clotting. In particular, the present invention relates to new antibodies that specifically bind native human tissue factor with high affinity. The antibodies of the invention are useful for a number of applications, particularly to reduce blood clotting in vivo.

2. Background

[0002] Blood clotting aids homeostasis by minimizing blood loss. In general, blood clotting requires vessel damage, platelet aggregation, clotting factors, and inhibition of fibrinolysis. Clotting factors act through a cascade that relates vessel damage to the formation of a blood clot (see generally L. Stryer, Biochemistry, 3rd Ed, WH Freeman Co., New York; and AG Gilman et al., The Pharmacological Basis of Therapeutics, 8th Edition, McGraw Hill Inc., New York, p. 1311-1331).

[0003] There is general agreement that the activation of factor X in factor Xa (FXa) is a critical step in the blood clotting process. In general, FX is converted to FXa by the binding of a catalytically active complex that includes "tissue factor" (TF). TF is a controlled expressed cell membrane protein that binds factor VII / VIIa to produce the catalytically active complex (TF: VIIa). The blood clot follows the FXa-mediated activation of prothrombin. Blood clotting can be minimized by inactivation of TF in non-native forms that cannot optimally produce the TF: VIIa complex. Excessive FXa formation is believed to contribute to various thromboses, including restenosis.

[0004] Thrombosis can be associated with invasive medical procedures, such as cardiac surgery (eg, angioplasty), abdominal thoracic surgery, arterial surgery, device deployment (eg, a stent or catheter), or endarterectomy. Furthermore, thrombosis can be accompanied by various thromboembolic disorders and coagulopathies, such as pulmonary embolism (eg, atrial fibrillation with embolization) and disseminated intravascular coagulation, respectively. Handling of body fluids can also lead to unwanted thrombi, particularly in blood transfusions or fluid sampling, as well as procedures involving cardiopulmonary bypass (eg, cardiopulmonary bypass surgery) and dialysis.

[0005] Anticoagulants are often used to alleviate or prevent blood clots associated with thrombosis. Blood clotting can often be minimized or eliminated by administering a suitable anticoagulant or a mixture thereof, including one or more of a coumarin derivative (eg, warfarin and dicoumarol) or a loaded polymer (eg, heparin, hirudin or bivalirudin). See, for example, Gilman et al., Supra, RJ Beigering et al., Ann. Hemathol., 72: 177 (1996); JD Willerson, Circulation, 94: 866 (1996).

[0006] However, the use of anticoagulants is often associated with side effects, such as bleeding, reocclusion, "white clot" syndrome, irritation, birth defects, thrombocytopenia, and liver dysfunction. Long-term administration of anticoagulants can particularly increase the risk of fatal diseases (see, for example, Gilman et al., Supra).

[0007] Certain antibodies with antiplatelet activity have also been used to alleviate various thromboses. For example, Abciximab is a therapeutic antibody that is routinely administered to alleviate various thromboembolic disorders, such as those arising from angioplasty, myocardial infarction, unstable angina, and coronary artery stenosis. Additionally, Abciximab can be used as a prophylactic agent to reduce the risk of myocardial infarction and angina (JT Willerson, Circulation, 94: 866 (1996); ML Simmons et al., Circulation, 89: 596 (1994)).

[0008] Certain anticoagulant antibodies are also known. In particular, certain TF-binding antibodies have been reported to inhibit blood clotting, presumably by interfering with the assembly of a catalytically active TF: VIIa complex (see for example, Jeske et al., SEM in THROM. And HEMO, 22 : 213 (1996); Ragni et al., Circulation, 93: 1913 (1996); European Patent No. 0 420 937 B1; W. Rufet al., Throm. Haemosp., 66: 529 (1991); MM Fiorie et al., Blood, 8: 3127 (1992)).

[0009] However, current TF-binding antibodies show significant disadvantages that can minimize their suitability as anticoagulants. For example, current TF-binding antibodies do not show sufficient binding affinity for optimal anticoagulant activity. Accordingly, for many thrombotic pathologies, to compensate for such ineffective binding affinities, unacceptably high levels of antibody must be administered to minimize blood clotting. Furthermore, current TF-binding antibodies do not efficiently discriminate between native TF and

ES 2 380 452 T3 non-native forms of TF, ie current antibodies do not show sufficient binding specificity. Furthermore, current TF-binding antibodies do not prevent FX from binding to TF and / or the TF: VIIa complex.

[0010] Thus, it would be desirable to have an anticoagulant antibody that binds native human TF with high affinity and selectivity to thereby inhibit unwanted blood clotting and blood clot formation. It would also be desirable to have such an anticoagulant antibody that prevents Factor X from binding to the TF / VIIa complex.

[0011] Fiore MM et al, Blood, vol. 80, no. 12 (December 15), 1992; pages 3127-3134 describe two anti-TF monoclonal antibodies (TF8-11D12 and TF9-9C3). WO 94/05328 refers to molecules that bind to tissue factor and alter the TF: VIIa complex. WO 96/40921 provides CDR-grafted antibodies against human tissue factor that maintain the high binding affinity of rodent monoclonal antibodies against tissue factor, but have reduced immunogenicity. WO 89/12463 relates to a method and therapeutic composition for the treatment of myocardial infarction comprising the administration of a tissue factor protein antagonist and a thrombolytic agent. US 5 437 864 provides a method of inhibiting extracorporeal circulation coagulation in a subject, comprising the administration of a therapeutically effective amount of a monoclonal antibody that inhibits the ability of tissue factor to bind factor VII / VIIa.

SUMMARY DESCRIPTION OF THE INVENTION

[0012] Antibodies have been discovered that provide superior anticoagulant activity by binding a native human TF with high affinity and specificity. Thus, in one aspect, the present invention provides claim 1. The antibodies of the invention can effectively inhibit blood clotting in vivo. The antibodies of the invention can bind to native human TF, either alone or present in a TF: VIIa complex, effectively preventing the binding of factor X to TF or that complex, and thus reducing blood clotting.

[0013] Preferred antibodies of the invention are monoclonal and specifically bind and bind a predominant conformational epitope to native human TF, which epitope provides an unexpectedly strong antibody binding site. In fact, the preferred antibodies of the invention bind native human TF at least about 5 times more, more usually at least about ten times more than the binding affinity shown by prior anticoagulant antibodies. Additionally, the preferred antibodies of the invention are selective for native human TF and do not substantially bind to non-native or denatured TF. H36.D2.B7 (secreted by the ATCC HB-12255 hybridoma) is an especially preferred antibody of the invention.

[0014] Preferred antibodies of the invention bind TF, such that FX does not bind effectively to the TF / factor VIIa complex, thus FX is not effectively converted to its activated form (FXa). Preferred antibodies of the invention can inhibit TF function by effectively blocking the binding or access of FX to TF molecules. See, for example, the results of Example 3 below.

[0015] Preferred antibodies of the invention either significantly inhibit the interaction or binding between TF and factor VIIa, or inhibit the activity of the TF: factor VIIa complex with respect to materials other than FX. See, for example, the results of Example 4 below.

[0016] The invention also provides nucleic acids encoding antibodies of the invention. The nucleic acid and amino acid sequences (SEQ ID: NOS 1-4) of variable regions of H36.D2.B7 are set out in Figures 1A and 1B of the drawings.

[0017] In preferred aspects, the antibodies of the invention are for use in inhibiting blood clotting and blood clot formation and in reducing human TF levels.

In general, the antibodies of the invention will be useful to modulate virtually any biological response mediated by the binding of FX to TF or the TF: VIIa complex, including blood clotting noted above, inflammation, or other disorders.

[0019] The antibodies of the invention are particularly useful for alleviating various thromboses, particularly to prevent or inhibit restenosis, or other thromboses after an invasive medical procedure, such as arterial or cardiac surgery (eg, angioplasty). The antibodies of the invention can also be used to effectively reduce or even eliminate blood clotting that arises from the use of medical devices (eg, a catheter, stent, or other medical devices). The preferred antibodies of the invention will be compatible with many anticoagulant, antiplatelet and thrombolytic compositions, thus allowing administration in a cocktail format to enhance or prolong inhibition of blood clotting.

[0020] The antibodies of the invention can also be used as an anticoagulant in the extracorporeal circulation of a mammal, particularly a human subject. In such methods, one or more antibodies are administered to the mammal in an amount sufficient to inhibit blood clotting before or during cardiopulmonary bypass, such as may occur with cardiopulmonary bypass surgery, organ transplant surgery, or other surgeries. prolonged.

IS 2 380 452 T3

[0021] The antibodies of the present invention can also be used as carriers for drugs, particularly pharmaceuticals targeted for interaction with a blood clot, such as streptokinase, tissue plasminogen activator (t-PA) or urokinase. Similarly, the antibodies of the invention can be used as a cytotoxic agent by conjugating a suitable toxin to the antibody. Conjugates of the antibodies of the invention can also be used to reduce tissue factor levels in a mammal, particularly a human, by administering to the mammal an effective amount of an antibody of the invention that is covalently linked to a cellular toxin. or an effector molecule to provide antibody-dependent cell-mediated cytotoxicity and complement binding ability, whereby the antibody conjugate is contacted with cells expressing tissue factor to thereby reduce tissue factor levels in the mammal.

[0022] The antibodies of the invention can also be used in in vivo diagnostic methods including in vivo diagnostic imaging of native human TF.

[0023] The antibodies of the invention can also be used in in vitro assays to detect native TF in a biological sample that includes a biological fluid (eg, plasma or serum) or tissue (eg, a biopsy sample). More particularly, various heterogeneous and homogeneous immunoassays in a competitive or non-competitive format can be used to detect the presence and preferably an amount of native TF in the biological sample.

Such assays of the invention are very useful for determining the presence or probability of a patient of having a blood clot or a blood clot. That is, blood clotting is normally accompanied by TF expression on cell surfaces, such as cells lining the vasculature. In the absence of blood clotting, TF is not normally expressed. Thus, detection of TF in a body fluid sample by an assay of the invention will be indicative of blood clotting.

The antibodies of the invention can also be used to prepare substantially pure native TF, particularly native human TF, from a biological sample. The antibodies of the invention can also be used to detect and purify cells that express native TF.

[0026] The antibodies of the invention can also be used as a component of a diagnostic kit, for example, to detect and preferably quantify native TF in a biological sample. Other aspects of the invention are described below and are also set forth in the appended claims.

BRIEF DESCRIPTION OF THE DRAWINGS

[0027]

Figures 1A and 1B show the nucleic acid (SEQ ID NOS: 1 and 3) and amino acid (SEQ ID NOS: 2 and 4) sequences of H36.D2.B7 light chain and heavy chain variable regions with hypervariable regions ( CDRs or Complementarity Determining Regions) underlined (single underline for nucleic acid sequences and double underline for amino acid sequences).

Figure 2 shows the association (Ka) and dissociation (Kd) constants of anti-tissue factor antibodies as determined by ELISA or BIACore analysis.

Figure 3 shows the inhibition of TF: VIIa complex mediated FX activation by preincubation with anti-tissue factor factors.

Figure 4 shows the inhibition of TF / VIIa activity towards the FIBA-specific substrate S-2288 by anti-tissue factor antibodies.

Figure 5 shows the ability of the H36 antibody to increase prothrombin time (PT) in a TF-initiated clotting assay.

Figures 6A and 6B graphically show the relationship between FXa formation and the molar ratio of antibody H36.D2 and rhTF. Figure 6A: H36.D2 was preincubated with the FT: VIIa complex before adding FX. Figure 6B: H36.D2, TF: VIIa and FX were added simultaneously.

Figure 7 shows the inhibition of TF: VIIa activity by the H36.D2 antibody in a J-82 cell activation assay. Figures 8A and 8B are dot blot representations showing that the H36.D2 antibody binds to a conformational epitope on rhTF. Lane 1 - native rhTF, Lane 2 - native rhTF treated with 8M urea, Lane 3 - native rhTF treated with 8 M urea and 5 mM DTT. In Figure 8A, the blot was exposed for approximately 40 seconds, while in Figure 8B, the blot was exposed for 120 seconds.

DETAILED DESCRIPTION OF THE INVENTION

[0028] As described above, the preferred antibodies of the invention show substantial affinity for

Native human TF. In particular, the preferred antibodies of the invention show an association constant (Ka, M^-1) to

IS 2 380 452 T3

Native human TF of at least about 1 x 10⁸ as determined by surface plasmon analysis (particularly, BIACore analysis according to the procedures of Example 1 below), more preferably at least about 5 x 10⁸ as determined by surface plasmon analysis, even more preferably a Ka (Ka, M^-1) for native human TF of at least about 1 x 10¹⁰ as determined by surface plasmon analysis. Such substantial binding affinity of antibodies of the invention is in sharp contrast to the much lower affinities of antibodies previously described.

In this regard, a fairly low effective concentration of an antibody of the present invention, eg, a relatively low concentration of antibody, can be used to inhibit TF function as desired (eg, at least about 95 , 98 or 99 percent inhibition) in an in vitro assay, such as that described in Example 3 below.

[0030] Preferred antibodies are highly specific for native human TF, and preferably do not substantially bind non-native TF. Preferred antibodies do not substantially bind to non-native TF or other immunologically unrelated molecules as determined, for example, by a standard dot blot assay (eg, no binding or essentially no binding to non-native TF visually detected by assay transfer points). References of the present invention to "non-native TF" mean a natural or recombinant human TF that has been treated with a chaotropic agent, such that TF is denatured. Chaotropic agents include a detergent (eg, SDS), urea, combined with dithiothreotol or β-mercaptoethanol; guanidine hydrochloride and the like. The H36, H36.D2 or H36.D2.B7 antibody does not substantially bind to such non-native TF. See, for example, the results of Example 8 below and is a dot transfer test.

[0031] As described above, the preferred antibodies of the invention will also bind with TF, such that FX does not bind effectively to the TF / factor VIIa complex, whereby FX is not effectively converted to an activated form (FXa). Particularly preferred antibodies of the invention will strongly inhibit the activity of FX to a TF / factor VIIa complex, for example, an inhibition of at least about 50%, more preferably at least about 80%, and even more preferably by at least about 90% or 95%, even at low TF concentrations, such as less than about 1.0 nM TF, or even less than about 0.20 nM or 0.10 nM TF, as determined by a standard in vitro binding assay such as that in Example 3 below and includes contacting FX with a TF: factor VIIa complex both in the presence (i.e., experimental sample) and in the absence (i.e., sample control) of an antibody of the invention and determine the difference in percentage of the conversion of FX to FXa between the experimental and control samples.

[0032] The antibodies of the invention are preferably substantially pure when used in the methods and assays described. References to an antibody that is "substantially pure" means an antibody or protein that has been separated from components that naturally accompany it. For example, using standard immunoaffinity or protein A affinity purification techniques, an antibody of the invention can be purified from a hybridoma culture using native TF as a protein A antigen or resin. Similarly, native TF can be obtained in substantially pure form using an antibody of the invention with standard immunoaffinity purification techniques. In particular, an antibody or protein is substantially pure when at least 50% of the total protein (% by weight of the total protein in a given sample) is an antibody or protein of the invention. Preferably, the antibody or protein is at least 60% by weight of the total protein, more preferably at least 75% by weight, even more preferably at least 90% by weight, and most preferably at least 98% by weight of the total material. Purity can be easily analyzed by known methods, such as SDS gel electrophoresis (PAGE), column chromatography (eg, affinity chromatography) in HPLC analysis.

[0033] The nucleic acid (SEQ ID NOS: 1 and 3) and amino acid (SEQ ID NOS: 2 and 4) sequences of a preferred antibody of the invention (H36.D2.B7) are shown in Figures 1A and 1B of the drawings. SEQ ID NOS. 1 and 2 are the nucleic acid and amino acid sequences respectively of the light chain variable region, and SEQ ID NOS. 3 and 4 are the nucleic acid and amino acid sequences respectively of the heavy chain variable region, with the hypervariable regions (CDRs or Complementarity Determining Regions) underlined in all these sequences.

[0034] Additional preferred antibodies of the invention will have substantial sequence identity to one or both of the heavy or light chain sequences shown in Figures 1A and 1B. More particularly, preferred antibodies include those that have at least about 70 percent homology (sequence identity) to SEQ ID NOS. 2 and / or 4, more preferably about 80 percent or more homology to SEQ ID NOS. 2 and / or 4, even more preferably about 85, 90 or 95 percent or more homology to SEQ ID NOS. 2 and / or 4.

[0035] Preferred antibodies of the invention will have high sequence identity with hypervariable regions (shown with double underlining in Figures 1A and 1B) of SEQ ID NOS. 2 and 4). Especially preferred antibodies of the invention will have three hypervariable regions of the H36.D2.B7 light chain variable region (those hypervariable regions shown with the underlining in Figure 1A and are as follows: 1) LASQTID (SEQ ID NO: 5 ); 2) AATNLAD (SEQ ID NO: 6); and 3) QQVYSSPFT (SEQ ID NO: 7)).

[0036] Especially preferred antibodies of the invention will also have three hypervariable regions of the H36.D2.B7 heavy chain variable region (those hypervariable regions shown underlined in Figure 1B and are as follows: 1) TDYNVY (SEQ ID NO. NO: 8); 2) YIDPYNGITIYDQNFKG (SEQ ID NO: 9); and 3) DVTTALDF (SEQ ID NO: 10).

IS 2 380 452 T3

[0037] The nucleic acids in the specification are preferably of sufficient length (preferably at least about 100, 200 or 250 base pairs) to bind to the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 3 under the following moderately stringent conditions (referred to herein as normal stringency conditions): use of a hybridization buffer comprising 20% ​​formamide in 0.8M saline / 0.08M sodium citrate (SSC) buffer at a temperature of 37 ° C and which remains bound when washed once with that SSC buffer at 37 ° C.

More preferably, the memory nucleic acids (preferably at least about 100, 200 or 250 base pairs) will bind to the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 3 under the following conditions stringent high (referred to here as “high ridiculous” conditions): use of a hybridization buffer comprising 20% ​​formamide in 0.9M saline / 0.09M sodium citrate (SSC) buffer at a temperature of 42 ° C and which remains bound when washed twice with that SSC buffer at 42 ° C.

[0039] The nucleic acids of the specification preferably comprise at least 20 base pairs, more preferably at least about 50 base pairs, and even more preferably a nucleic acid of the invention comprises at least about 100, 200, 250 or 300 base pairs.

[0040] The generally preferred nucleic acids of the invention will express an antibody of the invention that exhibits the preferred binding affinities and other properties described herein.

[0041] Preferred nucleic acids of the invention will also have substantial sequence identity to one or both of the heavy or light chain sequences shown in Figures 1A and 1B. More particularly, preferred nucleic acids will comprise a sequence that has at least about 70 percent homology (sequence identity) to SEQ ID NOS. 1 and / or 3, more preferably about 80 percent or more homology to SEQ ID NOS. 1 and / or 3, even more preferably about 85, 90 or 95 percent or more homology to SEQ ID NOS. 1 and / or 3.

[0042] Particularly preferred nucleic acid sequences of the invention will have high sequence identity with the hypervariable regions (shown with underlined in Figures 1A and 1B) of SEQ ID NOS. 1 and 3). Especially preferred nucleic acids include those that encode an antibody light chain variable region and that have three sequences that encode hypervariable regions of H36.D2.B7 (those hypervariable regions shown underlined in Figure 1A and are as follows: 1 ) CTGGCAAGTCAGACCATTGAT (SEQ ID NO: 11); 2) GCTGCCACCAACTTGGCAGAT (SEQ ID NO: 12); and 3) CAACAAGTTTACAGTTCTCCATTCACGT (SEQ ID NO: 13)).

[0043] Especially preferred nucleic acids also encode an antibody heavy chain variable region and have three sequences encoding H36.D2.B7 hypervariable regions (those hypervariable regions shown with underlined in Figure 1B and are as follows: 1) ACTGACTACAACGTGTAC (SEQ ID NO: 14); 2) TATATTGATCCTTACAATGGTATTACTATCTACGACCA GAACTTCAAGGGC (SEQ ID NO: 15); and 3) GATGTGACTACGGCCCTTGAC TTC (SEQ ID NO: 16)).

The nucleic acids of the invention are isolated, which means that a given nucleic acid usually constitutes at least about 0.5%, preferably at least about 2%, and more preferably at least about 5%. % by weight of the total nucleic acid present in a given fraction. A partially pure nucleic acid constitutes at least about 10%, preferably at least about 30%, and more preferably at least about 60% by weight of total nucleic acid present in a given fraction. A pure nucleic acid constitutes at least about 80%, preferably at least about 90%, and more preferably at least about 95% by weight of the total nucleic acid present in a given fraction.

The antibodies of the invention can be prepared by techniques generally known in the art, and usually generated for a purified sample of native TF, usually native human TF, preferably recombinant human tissue factor (rhTF). Truncated recombinant human tissue factor or rhTF (composed of 243 amino acids and lacking the cytoplasmic domain) is particularly preferred for generating antibodies of the invention. Antibodies can also be generated from an immunogenic peptide comprising one or more native TF epitopes that are not displayed by a non-native TF. References herein to "native TF" include such TF samples, including such rhTF. As described above, monoclonal antibodies are generally preferred, although polyclonal antibodies can also be used.

More particularly, antibodies can be prepared by immunizing a mammal with a purified sample of native human TF, or an immunogenic peptide described above, alone or complexed with a carrier. Suitable mammals include typical laboratory animals, such as sheep, goats, rabbits, guinea pigs, rats, and mice. Rats and mice, especially mice, are preferred for obtaining monoclonal antibodies. The antigen can be administered to the mammal by a number of suitable routes, such as subcutaneous, intraperitoneal, intravenous, intramuscular, or intracutaneous injection. The optimal immunization interval, immunization dose, etc., can vary in relatively wide ranges and can be determined empirically based on this specification. The usual procedures involve injecting the antigen several times over a few months. Antibodies are collected from the serum of the immunized animal by techniques

ES 2 380 452 T3 standard and screened for native human TF specific antibodies. Monoclonal antibodies can be produced in antibody-producing cells and these cells are used to generate monoclonal antibodies by standard fusion techniques to form hybridoma cells. See G. Kohler, et al., Nature, 256: 456 (1975). Typically, this involves fusing an antibody-producing cell with an immortal cell line, such as a myeloma cell, to produce the hybrid cell. Alternatively, monoclonal antibodies can be produced from cells by the method of Huse, et al., Science, 256: 1275 (1989).

[0047] A suitable protocol provides for intraperitoneal immunization of a mouse with a composition comprising purified rhTF complex performed over a period of about two to seven months. The spleen cells can then be removed from the immunized mouse. Serum from the immunized mouse is tested for rhTF-specific antibody titers prior to excision of spleen cells. The excised mouse spleen cells are then fused to a suitable homogeneous or heterogenic (preferably homogeneous) lymphoid cell line having a marker, such as hypoxanthine-guanine phosphoribosyltransferase deficiency (HGPRT) or thymidine kinase deficiency (TK-). Preferably, a myeloma cell is used as the lymphoid cell line. Myeloma cells and spleen cells are mixed together, for example, at a ratio of about 1 to 4 myeloma cells to spleen cells. Cells can be fused by the polyethylene glycol (PEG) method. See G. Kohler, et al., Nature, supra. The hybridoma cloned in this way is grown in a culture medium, for example RPMI-1640. See GE More, et al., Journal of American Medical Association, 199: 549 (1967). Hybridomas, developed after the fusion procedure, are screened by, for example, radioimmunoassay or enzyme immunoassay for the secretion of antibodies that specifically bind to purified rhTF, for example, antibodies that bind to purified rhTF are selected, but not to non-native TF. Preferably, an ELISA is used for screening. Hybridomas showing positive results after such screening can be expanded and cloned by the limiting dilution method. Preferably, additional screens are performed to select for antibodies that can bind to rhTF in solution, as well as in a human fluid sample. Isolated antibodies can be further purified by any suitable immunological technique, including affinity chromatography. The hybridoma culture producing the particular preferred antibody H36.D2.B7 has been deposited according to the Budapest Treaty with the American Type Culture Collection (ATCC) at 12301 Parklawn Drive, Rockville, MD, 10852. The hybridoma culture was deposited with the ATCC on January 8, 1997 and was assigned the ATCC Accession Number HB-12255.

[0048] For human therapeutic applications, it may be desirable to produce derivatives of chimeric antibodies, eg, antibody molecules that combine a non-human animal variable region and a human constant region, thereby rendering the antibodies less immunogenic in a human subject. than the corresponding non-chimeric antibody. A variety of types of such chimeric antibodies can be prepared, including, for example, producing chimeras of human variable regions, in which parts of the variable regions, especially the conserved regions of the antigen-binding domain, are of human origin and only those Hypervariable regions are of non-human origin. See also the descriptions of chimeric antibodies and methods of their production in SL Morrison, Science, 229: 1202-1207 (1985); Oi et al., BioTechniques, 4: 214 (1986); Teng et al., Proc. Natl. Acad. Sci. USA, 80: 7308-7312 (1983); Kozbor et al., Immunology Today, 4: 7279 (1983); Olsson et al., Meth. Enzymol., 9: 3-16 (1982). Additionally, transgenic mice can be used. For example, transgenic mice have been created that carry human antibody repertoires that can be immunized with native human TF. Splenocytes from immunized transgenic mice can then be used to create hybridomas that secrete human monoclonal antibodies that specifically react with native human TF as described above. See N. Lonberg et al., Nature, 368: 856-859 (1994); LL Green et al., Nature Genet., 7: 13-21 (1994); SL Morrison, Proc. Natl. Acad. Sci. USA, 81: 6851-6855 (1994).

[0049] Antibody nucleic acids of the invention can also be prepared by the polymerase chain reaction (see primers described in Example 1 below). See generally Sambrook et al., Molecular Cloning (2d ed. 1989). Such nucleic acids can also be synthesized by known methods, for example the triester transfer method (see Oligonucleotide Synthesis, IRL Press (MJ Gait, ed., 1984)), or using a commercially available automated oligonucleotide synthesizer. Said prepared nucleic acid of the invention can be used to express an antibody of the invention by known techniques. For example, a nucleic acid encoding an antibody of the invention can be incorporated into a suitable vector by known methods by, for example, using restriction enzymes to cut the vector for insertion of the construct followed by ligation. . The vector containing the inserted nucleic acid sequence, suitably operably linked to a promoter sequence, is then introduced into host cells for expression. See, generally, Sambrook et al., Supra. Selection of suitable vectors can be done empirically based on factors that depend on the cloning protocol. For example, the vector must be compatible with and have the appropriate replicon for the host cell being used. Furthermore, the vector must be capable of accommodating the inserted nucleic acid sequence. Suitable host cells will include a wide variety of eukaryotic or prokaryotic cells, such as E. Coli and the like.

[0050] The molecular weight of the antibodies of the invention will vary depending on various factors, such as the intended use and whether the antibody includes a recombinantly fused or conjugated toxin, a detectable marker or pharmaceutical product, or the like. In general, an antibody of the invention will have a molecular weight of between about 20 to 150 kDa. Such molecular weights can be easily determined by molecular size methods, such as SDS-PAGE gel electrophoresis followed by protein staining or Western blot analysis.

[0051] Antibody of the invention "or another similar term refers to whole immunoglobulin, as well as immunologically active fragments that bind native TF. Immunoglobulins and immunologically active fragments of the

ES 2 380 452 T3 themselves include an antibody binding site (ie, an epitope capable of specifically binding native human TF). Exemplary antibody fragments include, for example, Fab, F (v), Fab ', F (ab') fragments₂, half molecules obtained by reducing the disulfide bonds of immunoglobulins, single chain immunoglobulins, or other suitable antigen-binding fragments (see, for example, Bird et al., Science, pp. 242-424 (1988); Huston et al., PNAS, (USA), 85: 5879 (1988); Webber et al., Mol. Immunol., 32: 249 (1995)). The antibody or immunologically active fragment thereof can be animal (eg, a rodent, such as a mouse or rat), or a chimeric form (see Morrison et al., PNAS, 81: 6851 (1984); Jones et al. al., Nature, pp. 321, 522 (1986)). Single chain antibodies of the invention may be preferred.

Similarly, a "nucleic acid of the invention" refers to a sequence that can be expressed to provide an antibody of the invention as specified by said term immediately above.

As described above, the antibodies of the invention can be administered to a mammal, preferably a primate, such as a human, to prevent or reduce thrombosis, such as restenosis, usually in a composition that includes one or more non-toxic pharmaceutically acceptable carriers, such as sterile water or saline, oils of vegetable origin, and the like. In particular, they can be lactide polymer copolymers, lactide glycolide or polyoxyethylene, polyoxypropylene copolymers as excipients to control the release of the antibody-containing compositions described herein. Other potentially useful delivery systems include ethylene vinyl acetate particles, osmotic pumps and implantable perfusion systems and liposomes. In general, an anticoagulant composition of the invention will be in the form of a solution or suspension and will preferably include about 0.01% to 10% (w / v) of the antibody of the present invention, preferably about 0.01%. to 5% (w / w) of the antibody. The antibody can be administered as a single active ingredient in the composition, or as a cocktail that includes one or more other anticoagulants (eg, Heparin, Hirudin, or Bivalirudin), antiplatelets (eg, Abciximab, or thrombolytic agents (eg. , tissue plasminogen activator, streptokinase and urokinase). Additionally, the antibodies of the invention can be administered before, or after, the administration of one or more anticoagulant, antiplatelet or thrombolytic agents to enhance or prolong the desired anticoagulant activity.

[0054] As also described above, the antibodies of the invention can be used to reduce the potential for blood clotting arising from the use of medical devices, for example an internally acting device, such as a catheter, a stent , etc. In a preferred method, the device can be treated with an antibody of the invention (eg, as a 1 mg / ml saline solution) prior to contact with a body fluid. Alternatively, or additionally, an antibody of the invention can be combined with body fluid in an amount sufficient to minimize blood clotting.

The therapeutic anticoagulant compositions according to the present invention are suitable for use in parenteral or intravenous administration, particularly in the form of liquid solutions. Said compositions can be conveniently administered in unit doses and can be prepared according to methods known in the pharmaceutical sector. See Remington's Pharmaceutical Sciences, (Mack Publishing Co., Easton PA, (1980)). By the term "unit dose" is meant a therapeutic composition of the present invention used in a physically discrete unit suitable as a unit dose for a primate, such as a human, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent or carrier. The unit dose will depend on a variety of factors including the type and severity of the thrombosis to be treated, the ability of the subject's blood clotting system to utilize the antibody, the degree of inhibition or neutralization of the desired FX activation. The precise amounts of antibody to be administered will typically be guided by the judgment of the physician, although the unit dose will generally depend on the route of administration and will range from 10 ng / kg of body weight to 50 mg / kg of body weight per day, more usually in the range of 100 ng / kg of body weight to about 10 mg / kg of body weight per day. Appropriate schedules for initial administration in booster administrations are also variable, but are typified by an initial administration followed by repeated doses at intervals of one or more hours by a subsequent injection or other administration. Alternatively, continuous or intermittent intravenous infusions can be performed sufficiently to maintain concentrations of at least from about 10 nanomolar to 10 micromolar of the antibody in the blood.

[0056] In some cases, it may be desirable to modify the antibody of the present invention to convey a desirable biological, chemical, or physical property thereto. More particularly, it may be useful to conjugate (ie covalently link) the antibody to a pharmaceutical agent, for example, a fibrinolytic drug, such as t-Pa, streptokinase, or urokinase to provide fibrinolytic activity. Such binding can be accomplished by various methods, including the use of a binding molecule, such as a heterobifunctional protein crosslinking agent, eg, SPDP, carbodimide, or the like, or by recombinant methods.

[0057] In addition to pharmaceuticals, such as a fibrinolytic agent, an antibody of the invention can be conjugated to a toxin of, for example, plant or bacterial origin, such as diphtheria toxin (ie DT), toxin shiga, abrin, cholera toxin, ricin, saporin, pseudomonas exotoxins (PE), ombu antiviral protein, or gelonin. Biologically active fragments of such toxins are well known in the art and include, for example, DT A chain and ricin A chain. The toxin can also be an active agent on cell surfaces, such as phospholipases (eg, phospholipase C). As another example, the toxin can be a chemotherapeutic drug, such as, for example, vendesine, vincristine, vinblastine, methotrexate, adriamycin, bleomycin, or cisplatin, or, the toxin can be a radionuclide, such as, for example, iodine. 131, yttrium-90, rhenium-188, or bismuth-212 (see generally Moskaug et al., J. Biol. Chem., 264: 15709 (1989); 1.

IS 2 380 452 T3

Pastan et al., Cell, 47: 641 (1986); Pastan et al., Recombinant Toxins as Novel Therapeutic Agents, Ann. Rev. Biochem., 61: 331 (1992); Chimeric Toxins Olsnes and Phil, Pharmac. Ther., 25: 355 (1982); Published PcT Application No. WO 94/29350; Published PCT Application No. WO 94/04689; and US Patent No. 5,620,939). Furthermore, as described above, in addition to a toxin, an antibody of the invention can be conjugated to an effector molecule (eg, IgG1 or IgG3) to provide antibody-dependent cell-mediated cytotoxicity and complement binding ability. after administration to a mammal.

[0058] Said antibody / cytotoxin conjugate or effector molecule can be administered in a therapeutically effective amount to a mammal, preferably a primate, such as a human, where the mammal is known to have or suspected to have tumor cells, cells of the immune system, or endothelial cells capable of expressing TF. Examples of such tumor cells, immune system cells, and endothelial cells include malignant tumors of the breast and lung, monocytes, and vascular endothelium.

The antibodies of the invention can also be conjugated to a variety of other pharmaceutical agents in addition to those described above, such as, for example, enzymes, hormones, chelating agents capable of binding to a radionuclide, as well as other proteins and polypeptides. useful for the diagnosis or treatment of the disease. For diagnostic purposes, the antibody of the present invention can be used in a detectably or unlabeled labeled form. For example, a wide variety of labels can be suitably used to detectably label the antibody, such as radionuclides, fluorescent agents, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, ligands, such as, for example, haptens and Similar.

[0060] Diagnostic methods including in vivo diagnostic imaging are also described [see, eg, AK Abbas, Cellular and Molecular Immunology, p. 328 (WB Saunders Co. 1991)]. For most in vivo imaging applications, an antibody of the invention can be detectably labeled with, for example,¹²⁵I, ³²P, ⁹⁹Tc, or other detectable tag, and subsequently administered to a mammal, particularly a human, for a predetermined amount of time sufficient to allow the antibody to come into contact with a desired target. The subject is then screened by known procedures, such as scintigraphic camera analysis to detect antibody binding. The test could aid in the diagnosis and treatment of a cluster of thromboses, such as those specifically described here. The method is particularly useful when used in conjunction with cardiac surgery, particularly angioplasty, or other surgical procedure where unwanted blood clot formation may take place, to visualize the development or movement of a blood clot.

The antibodies of the invention can also be used to prepare substantially pure native TF (eg, at least about 90% pure, preferably at least about 96 or 97% pure), particularly native human TF from a biological sample. For example, native TF can be obtained as previously described (see, for example, LVM Rao et al., Thrombosis Res., 56: 109 (1989)) and purified by mixing the solution with a solid support comprising the antibody to form a coupling reaction mixture. Exemplary solid supports include a wall of a plate, such as a microtiter plate, as well as supports that include or consist of polystyrene, polyvinyl chloride, a cross-linked dextran, such as Sephadex ™ (Pharmacia Fine Chemicals), agarose, polystyrene particles (Abbott Laboratories), polyvinyl chloride, polystyrene, polyacrylamide in crosslinked form, nitrocellulose or nylon and the like. TF can then be isolated from the solid support in substantially pure form according to standard immunological techniques. See generally Harlow and Lane in Antibodies: A Laboratory Manual, CSH Publications, New York (1988) and Ausubel et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989).

As described above, the antibodies of the invention can be used to detect native human TF in a biological sample, particularly native TF associated with a blood clot. Exemplary biological samples include blood plasma, serum, saliva, urine, feces, vaginal secretions, bile, lymph, ocular fluids, cerebrospinal fluid, cell culture medium, and tissue, particularly vascular tissues, such as heart tissue. Samples may be suitably obtained from a mammal suffering from or suspected of suffering from thrombosis, preferably restenosis, associated with, for example, an invasive medical procedure, such as cardiopulmonary bypass surgery; a heart disease, such as myocardial infarction, cardiomyopathy, heart valve disease, unstable angina, or embolism associated artery fibrillation; a coagulopathy, including disseminated intravascular coagulation, deployment of a device, such as a stent or catheter; shock (eg, septic shock syndrome), vascular trauma, liver disease, cardiac stroke, malignant tumors (eg, pancreatic, ovarian, or small cell lung carcinoma), lupus, eclampsia, perivascular occlusive disease, and kidney disease.

[0063] For such assays, an antibody of the invention can be detectably labeled with a suitable atom or molecule, for example, radioactive iodine, tritium, biotin, or reagent capable of generating a detectable product, such as an anti-idiotypic antibody, bound to an enzyme, such as an enzyme, such β-galactosidase or horseradish peroxidase, or a fluorescent tag (eg, fluorescein or rhodamine) according to known methods. After contacting the biological sample with the detectably labeled antibody, any unreacted antibody can be separated from the biological sample, the marker (or product) is detected by conventional immunological methods including antibody capture assay, antibody sandwich assay , RIA, ELISA, immunoprecipitation, immunosorption, and the like (see Harlow and Lane, supra; Ausubel et al. Supra). Any marker (or product) in excess of that detected in a suitable control sample is indicative of the presence of native TF, more particularly a blood clot, in the biological sample. For example, the antibodies of the invention can be detectably labeled to detect, and preferably quantify, TF

Native ES 2 380 452 T3 according to standard immunological techniques, such as antibody capture assay, ELISA, antibody sandwich assay, RIA, immunoprecipitation, immunosorption, and the like. In some cases, particularly when using tissue, the immunological technique may include fixation of tissue with a reagent known to substantially maintain protein conformation (eg, dilute formaldehyde). See, generally, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, (1989); Harlow and Lane in Antibodies: A Laboratory Manual, CSH Publications, NY (1988).

[0064] The antibodies of the invention can also be used to detect and purify cells that express native TF, including fibroblasts, brain cells, immune cells (eg, monocytes), epithelium, as well as certain malignant cells. Preferred methods of cell detection and purification include conventional immunological methods (eg, flow cytometric methods, such as FACS and "immunospanning"). Substantially pure populations of native TF expressing cells are useful in clinical and research settings, for example, to establish such cells as cultured cells to screen for TF-binding antibodies.

The specification also describes diagnostic and test kits for the detection of native TF, particularly native human TF, in a test sample, especially a body fluid, such as blood, plasma, etc., or tissue as described. previously described. A preferred kit includes an antibody of the invention labeled for detection. The diagnostic kit can be used in any immunologically acceptable format, such as an ELISA format to detect the presence or amount of native TF in the biological sample.

The following non-limiting examples are illustrative of the invention. In the following examples and elsewhere reference is made to antibodies H36 and H36.D2. Those antibodies are the same antibody as H36.D2.B7, but H36 is derived from the parent clone, and H36.D2 is derived from the primary clone, while H36.D2.B7 is derived from the secondary clone. No differences have been observed between these three clones with respect to the ability to inhibit TF or other physical properties.

EXAMPLE 1 - Preparation and cloning of anti-rhTF monoclonal antibodies. Monoclonal antibodies against rhTF were prepared as follows:

A. Immunization and boosters

[0067] Five female BALB / c mice were immunized with 10 pg of lipidated and purified rhTF in each. Mice were initially sensitized intraperitoneally using Hunter's Titermax adjuvant. Three final boosters were given in 0.85% NaCl. Boosts were 2, 5.5, and 6.5 months after initial sensitization. All boosters were administered intraperitoneally, except the first one, which was subcutaneous. The final boost was administered 3 days prior to fusion and 20 pg.

B. Fusion of mouse spleen lymphocytes with mouse myeloma cells

[0068] Lymphocytes from the spleen of a rhTF immunized BALB / c mouse were fused with X63-Ag8.653 mouse myeloma cells using PEG 1500. After exposure to PEG, cells were incubated for one hour in fetal calf serum. heat inactivated at 37 ° C. The fused cells were then resuspended in RPMI 1640 and incubated overnight at 37 ° C with 10% CO2. The next day cells were plated using RPMI 1640 and supplemented with macrophage culture supernatant.

C. ELISA development

[0069] Plates for the ELISA assay were coated with 100 microliters of recombinant tissue factor (0.25 pg / ml) in a carbonate-based buffer. All steps were carried out at room temperature. Plates were blocked with BSA, washed, and then test samples and controls were added. Antigen / antibody binding was detected by incubating the plate with goat anti-mouse HRP conjugate (Jackson ImmunoResearch Laboratories) and then using an ABTS peroxidase substrate system (Kirkegaad and Perry Laboratories). The absorbance was read on an automated plate reader at a wavelength of 405 nm.

D. Stabilization of rhTF hybridoma cell lines

[0070] Two weeks after fusion, hybridoma colony screening was started by specific rhTF ELISA. Screening for new colonies continued for three weeks. Is positive clones each two weeks analyzed by antibody production until fifteen stable continuous clones were frozen.

E. Primary and secondary cloning

[0071] Limiting dilution cloning was performed on each of the positive stable hybridomas to obtain primary clones. Cells were thawed, grown in culture for a short period of time, and then diluted from 10 cells / well to 0.1 cells / well. Primary clones were analyzed by anti-rhTF ELISA and five to six positive clones were expanded and frozen.

IS 2 380 452 T3

[0072] The secondary anti-rhTF clone, H36.D2.B7, was obtained from the primary clone, H36.D2, prepared and stored in liquid nitrogen as described above. Four different dilutions, 5 cells / well, 2 cells / well, 1 cell / well, 0.5 cells / well of the primary clone were prepared in 96-well microtiter plates to begin secondary cloning. Cells were diluted in IMDM tissue culture media containing the following additives: 20% fetal bovine serum (FBS), 2 mM L-glutamine, 100 units / ml penicillin, 100 pg / ml streptomycin, MSG-S al 1%, 0.075% NaHCO3. To determine clones secreting anti-rhTF antibody, supernatants from five individual wells were removed from the 0.2 cell / well microtiter plate after two weeks of growth and analyzed for the presence of anti-rhTF antibody by ELISA assays. as described above. All five clones showed positive results in the ELISA test, with H36.D2.B7 being the best producer of antibodies. All five clones were adapted and expanded in RPMI medium containing the following additives: 10% FBS, 2 mM L-glutamine, 100 units / ml penicillin, 100 pg / ml streptomycin, 1% GMS-S, 0.075% NaHCO3, and 0.013 mg / ml of oxaloacetic acid. H36.D2.B7 was purified by Protein A affinity chromatography from cell culture supernatant and tested for its ability to inhibit TF: VIIa in an FX activation assay. The results indicated that H36.D2.B7 had the same inhibition as the H36.D2 antibody. All cells were stored in liquid nitrogen.

F. Isolation of total RNA from H36.D2.B7

[0073] 269 pg of 2.7 x 10 total RNA were isolated⁵ H36.D2.B7 hybridoma cells. Total RNA isolation was performed as described in the Qiagen RNeasy Midi Kits protocol. The RNA sample was stored in -20 ° C water until needed.

G. cDNA synthesis and cloning of variable regions of the H36.D2.B7 gene

[0074] To obtain the first strand cDNA, a reaction mixture containing 5 pg of total RNA isolated as above, reverse primers JS300 (all primers are identified below) was prepared for the heavy chain (HC) and OKA 57 for light chain (LC), RNase inhibitor, dNTP, DTT, and superscript II reverse transcriptase, and incubated at 42 ° C for 1 hour. The reaction tube is then incubated at 65 ° C for 15 minutes to stop transcription. After cooling, five units of RNase H were added and the reaction was allowed to incubate at 37 ° C for 20 minutes. The cDNA sample was stored at -70 ° C until needed.

[0075] A PCR (polymerase chain reaction) was performed separately to clone both the HC and LC variable regions of anti-rhTF, H36.D2.B7 from the cDNA produced as above (in Figures 1A and 1B describes the nucleic acid and amino acid sequences of these variable regions of HC and LC). Three rounds of PCR were performed. Round 1: PCR was run for 35 cycles at 96 ° C, 53 ° C and 72 ° C using the JS002 forward primer and JS300 reverse primer for HC. For LC the forward primer JS009 and reverse primer OKA 57 were used and the PCR was processed for 35 cycles at 96 ° C, 63 ° C and 72 ° C. Round 2: Both HC and LC PCR were run the same as Round 1 except that pMC-18 was used for HC forward primer and pMC-15 was used for LC forward primer. Round 3: PCR was run for 30 cycles at 96 ° C, 60-65 ° C and 72 ° C using primers H36HCF and H36HCR for HC. For LC, PCR was run for 30 cycles at 96 ° C, 58 ° C and 72 ° C using primers H36LCF and H36LCR.

[0076] The following primers were used for variable region cloning of H36.D2.B7 from HC and LC.

OKA 57: 5'-GCACCTCCAGATGTTAACTGCTC-3 '(SEQ ID NO: 17)

[0077] JS300:

5'-GAARTAVCCCTTGACCAGGC-3 '(SEQ ID NO: 18)

[0078] JS009:

5'-GGAGGCGGCGGTTCTGACATTGTGMTGWCMCARTC-3 '(SEQ ID NO: 19)

JS002: 5'-ATTTCAGGCCCAGCCGGCCATGGCCGARGTYCARCTKCARCARYC-3 '(SEQ ID NO: 20) pMC-15:

5'-CCCGGGCCACCATGKCCCCWRCTCAGYTYCTKG-3 '(SEQ ID NO: 21) pMC-18:

5'-CCCGGGCCACCATGGRATGSAGCTGKGTMATSCTC-3 '(SEQ ID NO: 22)

H36HCF:

5'-ATATACTCGCGACAGCTACAGGTGTCCACTCCGAGATCCAGCTGCAGCAGTC-3 '(SEQ ID NO: 23)

H36HCR:

IS 2 380 452 T3

5'-GACCTGAATTCTAAGGAGACTGTGAGAGTGG-3 '(SEQ ID NO: 24)

H36LCF:

5'-TTAATTGATATCCAGATGACCCAGTCTCC-3 '(SEQ ID NO: 25)

H36LCR:

TAATCGTTCGAAAAGTGTACTTACGTTTCAGCTCCAGCTTGGTCC (SEQ ID NO: 26) wherein from SEQ ID NO: 17 to 26 above: K is G or T; MesAoC; R is A or G; S is C or G; V is A, C, or G; W is A or T; Y is C or T.

EXAMPLE 2 - Mabs binding activity of the invention

[0079] The Mabs of the invention were used as prepared in Example 1 above. The rhTF molecule was expressed in E.coli and purified by immunoaffinity chromatography according to standard procedures (see Harlow and Lane, supra, Ausubel et al. Supra). The association constants (K_to) and dissociation (K_d) of Mab by ELISA and surface plasmon resonance assays (i.e. BIACore) (see for example, Harlow and Lañe, supra 'Ausubel et al. supra' Altschuh et al., Biochem., 31: 6298 (1992) ; and the BIAcore procedure described by Pharmacia Biosensor). For BIACore assays, rhTF was immobilized on a biosensor chip according to the manufacturer's instructions. The constants for each Mab were determined at four antibody concentrations (0.125 nM, 0.25 nM, 0.5 nM, and 1 nM).

[0080] Protein concentrations were determined by standard assay (MM Bradford, Anal. Biochem., 72: 248 (1976)) using Bovine Serum Albumin as a standard and a commercially available staining reagent (Bio-Rad).

[0081] Figure 2 shows the association and dissociation constants for each anti-rhTF Mab. Mab H36 showed the highest association speed (K_to= 3.1 X 10¹° M '¹) and the lowest dissociation rate (K_d= 3.2 X 10 '¹¹ M) of any of the anti-rhTF Mabs tested.

EXAMPLE 3 - FXa Specific Substrate Assay

[0082] In general, the experiments described in the present invention were performed using lipidated rhTF with phosphatidylcholine (0.07 mg / ml) and phosphatidylserine (0.03 mg / ml) in a 70/30 w / w ratio in Tris- 50 mM HCl, pH 7.5, 0.1% bovine serum albumin (BSA) for 30 minutes at 37 ° C. A preformed TF: Vlla complex stock solution was produced by incubating 5 nM lipidated rhTF and 5 nM FVIIa for 30 minutes at 37 ° C. The TF: Vlla complex was aliquoted and stored at -70 ° C until needed. Purified human factors Vil, Vlla, and FX were obtained from Enyzme Research Laboratories, Inc. The following buffer was used for all FXa and FVIIa assays: 25 mM Hepes-NaOH, CaCl₂ 5 mM, 150 mM NaCl, 0.1% BSA, pH 7.5.

[0083] Mabs were screened for the ability to block TF: Vlla mediated activation of FX to Fxa. Activation of FX was determined in two discontinuous steps. In the first step (activation of FX), the conversion of FX to FXa was tested in the presence of Ca⁺². In the second step (Fxa activity assay), the activation of FX was stopped by EDTA and the formation of FXa was determined using an FXa-specific chromogenic substrate (S-2222). Chromogens S-2222 and S-2288 (see below) were obtained from Chromogenix (distributed by Pharmacia Hepar Inc.). Activation of FX was performed in 1.5 ml microcentrifuge tubes by incubating the reaction mixture with 0.08 nM TF: Vlla, either preincubated with an anti-rhTF antibody or a control buffer. The reaction mixture was subsequently incubated for 30 minutes at 37 ° C, then 30 nM FX was added followed by a further incubation for 10 minutes at 37 ° C. FXa activity was determined in 96-well titer plates. Twenty microliters of sample from step one were removed and mixed with an equal volume of EDTA (500 nM) in each well, followed by the addition of 0.144 ml of buffer and 0.016 ml of 5mM S-2222 substrate. The reaction mixture was allowed to incubate for an additional 15-30 minutes at 37 ° C. The reaction mixtures were then quenched with 0.05 ml of 50% acetic acid, after which, the absorbance at 405 nm of each reaction mixture was recorded. The inhibition of TF: Vlla activity was calculated from the OD values₄05nm in the experimental (plus antibody) and control (no antibody) samples. In some experiments, an anti-hTF, TF / Vlla, and FX antibody were added simultaneously to detect binding competition. Figure 3 shows that MAb H36.D2 (in bold) inhibited TF: / Vlla activity towards FX to a significantly greater degree (95%) than other anti-rHTF Mabs tested.

EXAMPLE 4 - FVIIa Specific Substrate Assay

[0084] Mabs were further screened by a FVIIa specific assay. In this assay, 5 nM lipidated rhTF was first incubated with buffer (control) or 50 nM antibody (experimental) in a 96-well microtiter plate for 30 minutes at 37 ° C, then mixed with purified human FVIIa 5 nM (VT = 0.192 ml), followed by a 30 minute incubation at 37 ° C. Then, eight microliters of a 20 mM stock solution of the FVIIa specific substrate S-2288 (final concentration, 0.8 mM) were added to each well. Subsequently, the reaction mixture was incubated for one hour at 37 ° C. Next, the absorbance at 405 nm was measured after stopping with 0.06 ml of 50% acetic acid. The percentage of inhibition of TF / VIIa activity was calculated from the values ​​of OD ios_llm of the experimental and control samples.

IS 2 380 452 T3

[0085] Figure 4 shows that the H36 antibody did not significantly block TF / VIIa activity towards the S2288 substrate when the antibody was preincubated with TF (before the addition of VIIa) or added to TF preincubated with VIIa (before add the antibody). This indicates that H36 does not interfere with the interaction (binding) between TF and FVIIa, and that H36 also does not inhibit the activity of TF: VIIa towards a peptide substrate.

EXAMPLE 5 - Prothrombin time (PT) test

[0086] The calcified blood plasma will coagulate within seconds after the addition of thromplastin (TF); a phenomenon called the "prothrombin time" (PT). A prolonged PT is usually a useful indicator of anticoagulation activity (see, eg, Gilman et al. Supra).

[0087] The H36.D2 antibody was investigated for the ability to affect PT according to standard methods using commercially available human plasma (Ci-Trol Control, Level I obtained from Baxter Diagnostics Inc.). The coagulation reactions were initiated by the addition of lipidated rhTF in the presence of Ca⁺⁺. Clotting time was monitored by an automated clotting time controller (MLA Electra 800). The PT assays were initiated by injecting 0.2 ml of lipidated rhTF (in a 50 mM Tris-HCl buffer, pH 7.5, containing 0.1% BSA, CaCl₂ 14.6 mM, 0.07 mg / ml phosphatidylcholine, and 0.03 mg / ml phosphatidylserine) in plastic double-well cuvettes. The cuvettes each contained 0.1 ml of the plasma preincubated with 0.01 ml of buffer (control sample) or antibody (experimental sample) for 1-2 minutes. The inhibition of TF-mediated clotting by the H36.D2 antibody was calculated using a TF standard curve in which the log [TF] was plotted against the log of clotting time.

[0088] Figure 5 shows that the H36.D2 antibody substantially inhibits TF-initiated coagulation in human plasma. Antibody H36.D2 increased PT times significantly, showing that the antibody is an effective inhibitor of TF-initiated coagulation (up to approximately 99% inhibition).

EXAMPLE 6 - FX and the H36.D2 antibody compete for binding to the TF: VIIa complex

[0089] Competition experiments were performed between TF / VIIa, FX and the H36.D2 antibody. Figure 6A illustrates the results of an experiment in which a preformed TF / VIIa complex (0.08 nM) was pre-incubated at 37 ° C for 30 minutes in buffer including 0.02 nM, 0.04 nM, 0.08 nM and 0.16 nM of the monoclonal antibody H36.D2, respectively. Then, FX (30 nM) was added to the mixture of TF / VIIa and H36.D2 antibody and the mixture was allowed to incubate for an additional 10 minutes at 37 ° C. Activation of FX was stopped with EDTA as previously described. Thus, the Fxa produced was determined by the FXa specific assay described in Example 3 above.

[0090] Figure 6B shows the results of an experiment performed on the same line described above, except that the H36.D2 antibody, preformed TF: VIIA, and FX were added simultaneously to initiate the FX activation assay.

[0091] The data set forth in Figures 6A and 6B show that antibody H36.D2 and FX compete for binding to the preformed TF / VIIa complex.

EXAMPLE 7 - Inhibition of TF activity in cell culture

[0092] J-82 is a human bladder carcinoma cell line (available from ATCC) that abundantly expresses native human TF as a cell surface protein. To see if the H36.D2 antibody could prevent FX from binding to native TF expressed on the cell surface, a J-82 FX activation assay was performed on microtiter plates in the presence of FVII (see DS Fair et al. , J. Biol. Chem., 262: 11692 (1987)). To each well, 2 x 10⁵ cells and incubated with 50 ng of FVII, buffer (control sample) or the anti-TF antibody (experimental sample) for 2 hours at 37 ° C. Each well was then gently washed with buffer and 0.3 ml of FX (0.05 mg / ml) was added to each well over 30 minutes at room temperature. In some cases, the antibody was added at the same time as FX to detect binding competition by native TF. Following this, 0.05 ml aliquots were removed and added to new wells in a 96-well titer plate containing 0.025 ml of 100 mM EDTA. FXa activity was determined by a specific FXa assay as described in Example 3 above. Inhibition of TF activity on the surface of J-82 cells was calculated from OD405 nm in the absence (control sample) and presence of the antibody (experimental sample).

[0093] Figure 7 shows that the H36.D2 antibody bound to native TF expressed on J-82 cell membranes and inhibited TF-mediated activation of FX. These results indicate that the antibody competes with FX for binding to native TF expressed on the cell surface. Taken with the data from Example 8 below, the results also show that the H36.D2 antibody can bind to a conformational epitope in native TF on a cell membrane.

EXAMPLE 8 - Specific binding of the H36.D2 antibody to native rhTF

[0094] Evaluation of the binding of H36.D2 to native and non-native rhTF was performed by a simplified dot blot assay (dot). Specifically, rhTF was diluted to 30 pg / ml in each of the following three buffers: 10 mM Tris-HCl mM, pH 8.0; 10 mM Tris-HCl, pH 8.0 and 8 M urea; and 10 mM Tris-HCl, pH 8.0, 8 M urea, and 5 mM dithiothreitol. Incubation in the Tris buffer maintains the rhTF in native form, while treatment with 8 M urea and 5 nM dithiothreitol produces non-native (denatured) rhTF. Each sample was incubated for 24 hours at room temperature. After incubation,