Diagnostics and therapeutics for diseases associated with an il-1 inflammatory haplotype

ES 2 356 167 T3

DESCRIPTION

Diagnostic method and therapy for diseases associated with an IL-1 inflammatory haplotype.

1. Foundation of the invention

Genetics of the IL-1 gene cluster

The IL-1 gene cluster is on the long arm of chromosome 2 (2q13) and contains at least the genes IL1α (IL-1A), IL-ίβ (IL-1B), and the IL-1 receptor antagonist ( IL-1RN), within a 430 Kb region (Nicklin, et al., (1994) Genomics, 19: 382-4). The agonist molecules, IL-1a and IL-1/1, have potent pro-inflammatory activity and are at the beginning of many inflammatory cascades. Its actions, often via the induction of other cytokines, such as IL-6 and IL-8, lead to the activation and recruitment of leukocytes in damaged tissue, local production of vasoactive agents, fever response in the brain, and brain response. of the acute liver phase. All three IL-1 molecules bind to type I and type II IL-1 receptors, but only the type I receptor transduces a signal into the cell. In contrast, the type II receptor is released from the cell membrane and acts as a decoy receptor. The receptor antagonist and the type II receptor, therefore, are both anti-inflammatory in their actions.

Inappropriate IL-1 production plays a central role in the pathology of many autoimmune and inflammatory diseases, including rheumatoid arthritis; inflammatory bowel disorder, psoriasis and the like. Furthermore, there are stable inter-individual differences in IL-1 production rates, and some of this variation may be explained by genetic differences at IL-1 gene loci. Therefore, IL-1 genes are reasonable candidates to determine part of the genetic sensitivity to inflammatory diseases, most of which have a multifactorial etiology with a polygenic component.

Certain alleles of the IL-1 gene cluster are known to be associated with particular disease states. For example, IL-1RN allele 2 with variable number tandem repeats (VNTR for Variable Number of Tandem Repeats) has been shown to be associated with osteoporosis (US Patent No. 5,698. 399), nephropathy in diabetes mellitus (Blakemore, et al., (1996) Hum. Genet. 97 (3): 369-74), alopecia areata (Cork, et al., (1995) J. Invest. Dermatol. 104 (5 Supp.): 15S-16S; Cork et al., (1996) Dermatol. Clin. 14: 671-8), Graves disease (Blakemore, et al., (1995) J. Clin. Endocrinol. 80 (1): 111-5), systemic lupus erythematosus (Blakemore, et al., (1994) Arthritis Rheum. 37: 1380-85), lichen sclerosis (Clay, et al., (1994) Hum. Genet. 94: 407-10), and ulcerative colitis (Mansfield, et al., (1994) Gastroenterol. 106 ( 3): 637-42).

Furthermore, IL-1A allele 2 of marker -889 and IL-1B allele 2 (TagI) of marker +3954 have been found to be associated with periodontopathy (US Patent No. 5,686,246 ; Kornman and diGiovine (1998) Ann. Periodont. 3: 327-38; Hart and Kornman (1997) Periodontol. 2000 14: 202-15; Newman (1997) Compend. Contin. Educ. Dent. 18: 881-4; Kornman et al., (1997) J. Clin. Periodontol. 24: 72-77). IL1A allele 2 of marker -889 has also been found to be associated with juvenile chronic arthritis, particularly chronic iridocyclitis (McDowell, et al., (1995) Arthritis Rheum. 38: 221-28). IL-1B allele 2 (TagI) of IL-1B marker + 3954 has also been found to be associated with psoriasis and insulin-dependent diabetes in patients with DR3 / 4 (diGiovine, et al., (1995) Cytokine 7: 606; Pociot, et al., (1992) Eur. J. Clin. Invest. 22: 396-402). Additionally, allele 1 of IL-1RN (VNTR) has been found to be associated with diabetic retinopathy (see USSN applications 09/037472, and PCT / GB97 / 02790). Furthermore, IL-1RN allele 2 (VNTR) has been found to be associated with ulcerative colitis in the Caucasian population of North America and Europe (Mansfield, J. et al., (1994) Gastroenterology 106: 637-42) . It is very interesting to know that this association is particularly strong with ethnically related Ashkenazi Jewish populations (PCT application WO97 / 25445).

Genotype screening

Traditional methods for screening for inheritable diseases have relied on the identification of abnormal gene products (eg, sickle cell anemia) or an abnormal phenotype (eg, mental retardation). These methods are of limited utility for heritable diseases that start late and for which there are no easily identifiable phenotypes, such as, for example, vascular diseases. With the development of the methodology of simple and cheap genetic screening, it is now possible to identify polymorphisms that indicate a propensity to develop the disease, even when the disease is of polygenic origin. The number of diseases that can be screened for by molecular biology methods continues to grow with the increasing understanding of the genetic bases of multifactorial disorders.

Genetic screening (also called genotyping or molecular screening), can be broadly defined as an analysis to determine whether a patient has mutations (alleles or polymorphisms) that cause a disease state or are "linked" to the mutation that causes the disease state. Linkage refers to the phenomenon that DNA sequences that are close to each other in the genome tend to be inherited together. Two sequences may be linked due to some selective advantage of joint inheritance. More typically, however, two polymorphic sequences are jointly inherited because of the relative infrequency with which meiotic recombination events occur within the region between the two polymorphisms. Inherited Polymorphic Alleles

ES 2 356 167 T3 together are said to be in linkage disequilibrium with one another because, in a given human population, they both tend to be present together or otherwise not at all in any particular member of the population. Indeed, when multiple polymorphisms are found in a given chromosomal region they are in linkage disequilibrium with each other, defining a quasi-stable genetic "haplotype." In contrast, recombination events that occur between two polymorphic loci cause them to become separated on different homologous chromosomes. If meiotic recombination between two physically linked polymorphisms occurs frequently enough, the two polymorphisms will appear independently segregated and are said to be in linkage equilibrium.

Although the frequency of meiotic recombination between two markers is generally proportional to the physical distance between them on the chromosome, the presence of "hot spots" as well as regions of repressed chromosomal recombination can result in discrepancies between the physical distance and that of recombination between the two markers. Thus, in certain chromosomal regions, multiple polymorphic loci that span a broad chromosomal domain may be in linkage disequilibrium with respect to each other and thereby define a broad-ranging genetic haplotype. Furthermore, when a disease-causing mutation is found within or in conjunction with this haplotype, one or more polymorphic alleles of the haplotype can be used as a diagnostic or prognostic indicator of the likelihood of developing the disease. This association between otherwise benign polymorphisms and a disease-causing polymorphism occurs if the disease-causing mutation arose in the recent past, so that not enough time has elapsed to achieve equilibrium through recombination events. Therefore, the identification of a human haplotype that encompasses or is within a disease-causing mutational change serves as a predictive measure of an individual's probability of inheriting a disease-causing mutation. Importantly, such prognostic or diagnostic methods can be used without the need for identification and isolation of the disease-causing lesion. This is significant because the precise determination of the molecular defect involved in a disease process can be difficult and time consuming, especially in the case of multifactorial diseases such as inflammatory disorders.

Actually, the statistical correlation between an inflammatory disorder and an IL-1 polymorphism does not necessarily indicate that the polymorphism directly causes the disorder. Instead the correlated polymorphism may be a benign allelic variant that is linked to (i.e., in linkage disequilibrium with) a disorder-causing mutation that has occurred in the recent human evolutionary past, such that not enough time has elapsed to equilibrium is achieved through recombination events in the intercalated chromosomal segment. Therefore, for the purposes of analysis for diagnosis and prognosis of a particular disease, the detection of a polymorphic allele associated with the disease can be used without consideration of whether the polymorphism is directly involved in the etiology of the disease. On the other hand, when a benign polymorphic locus is in linkage disequilibrium with a polymorphic locus apparently causing the disease, other polymorphic loci that are in linkage disequilibrium are still likely to be in linkage disequilibrium with the polymorphic locus causing the disease. disease. Therefore, these other polymorphic loci will also be a prognosis or diagnosis of the probability of having inherited the polymorphic locus causing the disease. Indeed, a broad human haplotype (describing the typical pattern of allele co-inheritance from a set of linked polymorphic markers) can serve as a target for diagnostic purposes once an association between a particular disease or condition has been established. and a corresponding human haplotype. Therefore, the determination of the probability of an individual to develop a particular disease or condition can be carried out by characterizing one or more polymorphic alleles associated with the disease (or even one or more haplotype associated with the disease) without necessarily determining or characterizing the variation. causative genetics.

2.- Summary of the invention

The present invention provides a method for predicting susceptibility to periodontal disease in a human subject, comprising the step of identifying in a genomic DNA sample from a subject an allelic model comprising one of the following sets of IL-1B alleles:

(1) (-511) allele 1, (-1468) allele 1, and (-3737) allele2;

(2) (-511) allele 2, (-1468) allele 2, and (-3737) allele1;

(3) (-511) allele 1, (-1468) allele 1, and (-3737) allele1; or (4) (-511) allele 2, (-1468) allele 1 and (-3737) allele1, where the presence of any one of models 1, 3 or 4 indicates that said subject has increased sensitivity to periodontal disease , and where the presence of allelic pattern 2 indicates that the subject has a decreased sensitivity to periodontal disease.

The subject is homozygous for each of the alleles. Altered IL-1B transcription results in altered IL-1B production. Subject is of Asian ethnicity, such as Japanese, Chinese, Taiwanese, or Vietnamese.

ES 2 356 167 T3

An allele comprising an IL-1 inflammatory haplotype can be detected by any of a variety of techniques including: 1) performing a hybridization reaction between a nucleic acid sample and a probe that is capable of hybridizing to the allele; 2) sequencing at least a portion of the allele; or 3) determining the electrophoretic mobility of the allele or its fragments (eg, fragments generated by endonuclease digestion). The allele can optionally be subjected to an amplification step prior to performing the detection step. Amplification methods include for example polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (hereinafter SDA for Strand Displacement Amplification), cloning and variations of the above (eg RT-PCR and allele-specific amplification). The oligonucleotides necessary for amplification are selected, for example, within the loci of the IL-1 gene, either those that flank the marker of interest (as required for PCR amplification) or directly those that overlap with the marker (as in allele-specific oligonucleotide hybridization, hereinafter abbreviated ASO, by the expression Aliel Specific Oligonucleotide). For example, the sample is hybridized to a set of primers, which hybridize 5 'and 3' to a sense or antisense sequence for the IL-1 inflammatory haplotype associated allele and subjected to PCR amplification.

An allele containing an IL-1 inflammatory haplotype is also detected indirectly, for example by analyzing the protein product encoded by the DNA. For example, when the marker in question results in the translation of a mutant protein, the protein is detected by any of a variety of protein detection methods. Such methods include immunodetection and biochemical assays, such as size fractionation, where the protein undergoes a change in apparent molecular weight, through truncation, elongation, altered folding, or altered post-translational modifications.

Kits are described to perform the analyzes described above. The kit may include means for collecting nucleic acid samples and means for determining whether a subject carries at least one allele that comprises an IL-1 inflammatory haplotype. Optionally, the kit contains a positive or negative control sample or a standard and / or an algorithmic device to evaluate the results and additional reagents and components including, for example, DNA amplification reagents, DNA polymerase, acid amplification reagents. nucleic acid, restriction enzymes, buffers, a nucleic acid sampling device, DNA purification device, deoxynucleotides, oligonucleotides (eg probes and primers) etc.

The control can be a positive or negative control. In addition, the control sample may contain the positive (or negative) products of the allele detection technique used. For example, when the allele detection technique is PCR amplification followed by size fractionation, the control sample may comprise DNA fragments of the appropriate size. Similarly, when the allele detection technique involves the detection of a mutant protein, the control sample may comprise a sample of the mutated protein. However, it is preferred that the control sample contains the material to be tested. For example, controls can be a sample of genomic DNA or a cloned portion of the IL-1 gene cluster. Preferably, the control sample is a highly purified sample of genomic DNA where the sample to be analyzed is genomic DNA.

The oligonucleotides present in said kit are used for amplification of the region of interest or for direct hybridization of allele-specific oligonucleotides (ASO) to the markers in question. Thus, the oligonucleotides flank the marker of interest (as required for PCR amplification) or are directly overlapped with the marker (as in ASO hybridization).

Also provided are isolated nucleic acids less than 250, 200, 150, 100, 50, 25 or less nucleotides in length that contain the nucleic acid sequence of SEQ ID NO; 36-39. Optionally, the nucleic acid is attached to a solid or semi-solid support or is present as an oligonucleotide matrix (chip).

Information obtained using the assays and kits described herein (alone or in conjunction with information about another genetic defect or environmental factor, contributing to the disease or condition that is associated with the inflammatory haplotype of IL-1) is useful in determining whether a non-symptomatic subject has or is likely to develop the particular disease or condition. In addition, the information can allow a more personalized proposal to prevent the onset or progress of the disease or condition. For example, this information can make it easier for the clinician to more effectively prescribe a therapy that will address the molecular basis of the disease or condition.

Methods are described for treating or preventing the development of a disease or condition that is associated with an inflammatory haplotype of IL-1 in a subject by administering to the subject a suitable therapeutic agent of the invention. In yet another aspect, the invention provides in vitro or in vivo assays for screening test compounds to identify therapeutic agents to treat or prevent the development of a disease or condition that is associated with an inflammatory haplotype of IL-1. The assay comprises contacting a cell transfected with a causative mutation, which is operably linked with an appropriate promoter, with a test compound and determining the level of expression of a protein in the cell in the presence and in the absence of the test compound. The causative mutation results in decreased production of the IL-1 receptor antagonist, and increased production of the 1L-1 receptor antagonist in the presence of the test compound indicates that the compound is an agonist of IL-1 receptor antagonist activity. IL-1. Alternatively, the causative mutation results in an increased production of IL-1a or IL-β, and a decreased production of IL-1α or IL-β in the presence of the test compound indicates that the compound is an antagonist of the activity of IL-1a or II.-1 / L

ES 2 356 167 T3

Unless otherwise defined, all scientific and technical terms used herein have the same meanings that are usually understood by those of ordinary skill in the art to which the present invention pertains. Although materials and methods similar or equivalent to those described herein may be used in the practice or analysis of the present invention, suitable materials and methods are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the event of conflict, this report, which includes the definitions, will prevail. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be limiting.

Other embodiments and advantages are set forth in the following description and claims.

3.- Brief description of the figures in the drawings

Fig. 1 is a schematic representation of the IL-1 gene cluster that includes a few polymorphic markers.

Fig. 2 is a graph depicting the correlation between linkage disequilibrium values ​​and physical distance as described herein.

Fig. 3 shows that of the nucleic acid sequence for IL-1A (GEN X03833; SEQ ID NO. 1).

Fig. 4 shows the nucleic acid sequence for IL-1B (GEN X04500; SEQ ID NO. 2).

Fig. 5 shows the nucleic acid sequence for secreted IL-1RN (GEN X64532; SEQ ID NO. 3).

Fig. 6 shows single nucleotide polymorphism (hereinafter SNP for Single Nucleotide Polymorphism) constructs within the IL-1B promoter region. The parental construct where all SNPs are allele 1 are indicated by pGL3 (IL1) BS for SNP 1-15, pGL (3-IL1) BS (3) K (M) for SNP 2-15, and pGL3 - (IL1) BL (3) KM for SNPs 2-17 (the parentheses indicate parts of the identifiers of the constructs that do not appear in the graph of Fig. 7). Below each parental series are the constructs where individual SNPs have been converted to allele 2 by site-directed mutagenesis.

Fig. 7 AB show the location of the SNPs and promoter constructs. In Fig. 7A, the positions of the SNPs are indicated within the promoter region of the IL-1B gene on the top line. The lines at the bottom represent the lengths of the promoter region used in the different constructions of the reporter (luciferase), the results of which transcriptional activity are shown in Fig. 7B. The KpnI and BamHI sites are indicated. In the IL-1BS series, SNPs are indicated by vertical lines.

Fig. 8 shows plasmid constructions of SNPs within the IL-1B promoter region in which SNPs 14 and 15 have remained mostly constant at allele 2. The parental construction, where all SNPs except the 14 and 15 are allele 1 is identified as pGL-BS.2. Below are the constructs where the individual SNP has been converted to allele 2 by site-directed mutagenesis. The SNPs of allele 2 SNPs are highlighted.

Fig. 9A-B shows the location of the SNPs and promoter constructs. In Fig. 9A, the positions of the SNPs are indicated within the promoter region of the IL-1B gene on the top line. The lower lines represent the lengths of the promoter region used in the different constructions of the reporter (luciferase) whose results of the relative transcriptional activity are shown in Fig. 9B. The KpnI and BamHI sites are indicated. In the IL-1BS series, SNPs are indicated by vertical lines.

Fig. 10 is a diagram showing the transfection analysis of SNP 4 in different allelic models of SNPs 14 and 15. The promoter activity of the constructed alleles designated AD as measured by firefly luciferase activity is shown at different doses of LPS (lipopolysaccharide) (0, 1, 10 and 100 ng / ml) and 20 ng / ml of myristate-phorbol acetate (abbreviated PMA by the English expression Phorbol 12-myristate 13-acetate). Firefly luciferase activity was normalized to Renilla activity to monitor transfection efficiency. Each construct was transfected in triplicate and the transfection for each construct was repeated at least three times.

Fig. 11 is a diagram showing the transfection analysis of SNP 10. The promoter activities of constructs A (diamond) and B (circle) as measured by firefly luciferase activity are shown at different doses of LPS. (0, 1, 10 and 100 ng / ml) and 20 ng / ml of PMA. Firefly luciferase activity was normalized to Renilla activity to monitor transfection efficiency. Each construct was transfected in triplicate and the transfection for each construct was repeated at least three times.

Fig. 12 is a diagram demonstrating the transfection analysis of SNPs 14 and 15. The promoter activity of the constructs with the allele models represented as AD as measured by the firefly luciferase activity is shown at different doses. of LPS (0.1,10 and 100 ng / ml) and 20 ng / ml of PMA. Firefly luciferase activity was normalized to Renilla activity to monitor transfection efficiency. Each construct was transfected in triplicate and the transfection for each construct was repeated at least three times.

ES 2 356 167 T3

Fig. 13 is a diagram showing haplotype transfection analysis of the promoter comprising SNPs 10, 14 and 15. Allelic combinations are shown for plasmids AC. The promoter activities of constructs A (rhombus), B (square) and C (triangle) as measured by firefly luciferase activity are shown at different doses of LPS (0, 1, 10 and 100 ng / ml) and 20 ng / ml PMA. Firefly luciferase activity was normalized to Renilla activity to monitor transfection efficiency. Each construct was transfected in triplicate and the transfection for each construct was repeated at least three times.

Fig. 14 is a photographic image of the results of a SNP 4 electrophoretic mobility shift assay. The sequences of both alleles 1 and 2 labeled double-stranded oligomers of SNP 4 used for mobility shift analysis are shown. hereinafter EMSA by the English term Electrophoretic Mobility ShiftAssay). Nuclear proteins isolated from THP-1 cells treated at 0, 2,4,6 and 24 hours with LPS (100 ng / ml) and PMA (20 ng / ml) were used. The locations of the free probe and the delayed complexes are indicated by arrows.

Fig. 15 is a photographic image of the results of a SNP 4 electrophoretic mobility shift assay, using unlabeled probes to compete for specific binding. The sequences of both alleles 1 and 2 labeled double-stranded oligomers of SNP 4 used for the EMSA assay are shown. To determine binding specificity, unlabeled double-stranded oligomers for alleles 1 and 2 were used in the EMSA assay to compete with the labeled probes.

Fig. 16 is a photographic image of the results of the super-shift analysis of the NF-kB antibodies to SNP 4. The NF-kB antibodies to both p50 and p65 subunits were used in the EMSA assay to determine that the DNA complexes -Proteins formed were due to the NF-kB proteins.

Fig. 17 a photographic image of the results of an electrophoretic mobility change test of the SNP

10. The sequences of both alleles 1 and 2 tagged double-stranded oligomers of SNP 10 used for the EMSA assay are shown. Nuclear proteins isolated from THP-1 cells treated at 0, 2, 4, 6 and 24 hours with LPS (100 ng / ml) and PMA (20 ng / ml) were used. The locations of the free probe and the delayed complexes are indicated by arrows.

Fig. 18 is a photographic image of the results of a SNP 10 electrophoretic mobility shift assay showing the specificity of complex formation for SNP 10. The sequences of alleles 1 and 2 of the oligomers are shown. Labeled double strands used for EMSA testing To determine binding specificity alleles 1 and 2 of the unlabeled double-stranded oligomers were used in the EMSA assay to compete for the binding of the labeled probes.

Fig. 19 is a photographic image of the results of a SNP 14 electrophoretic mobility shift assay. The sequences of alleles 1 and 2 of the labeled double-stranded oligomers of SNP 14 used for the EMSA assay are shown. Nuclear proteins isolated from THP-1 cells treated at 0, 2, 4, 6 and 24 hours with LPS (100 ng / ml) and PMA (20 ng / ml) were used. The locations of the free probe and the delayed complexes are indicated by arrows.

FIG. 20 is a photographic image of the results of an analysis of the change in electrophoretic mobility results of SNP 15. The sequences of both alleles 1 and 2 of the labeled double-stranded oligomers of SNP 15 used for the EMSA assay are shown. Nuclear proteins isolated from THP-1 cells treated at 0, 2, 4, 6 and 24 hours with LPS (100 ng / ml) and PMA (20 ng / ml) were used. The locations of the free probe and the delayed complexes are indicated by arrows.

Fig. 21 is a photographic image of the results of a SNP 15 electrophoretic mobility shift assay showing the specificity of complex formation for SNP 15. The sequences of alleles 1 and 2 of the oligomers are shown. Tagged double-stranded SNP 15 used for EMSA assay. To determine binding specificity alleles 1 and 2 of the unlabeled double-stranded oligomers were used in the EMSA assay to compete for the binding of the labeled probes.

Fig. 22 is a diagram showing the severity of periodontitis in subjects by measuring the depth of cavities in the gums of the subjects.

Fig. 23 is a diagram showing the frequency of IL-1B haplotypes in Japanese and Caucasian subjects.

Fig. 24 is a diagram showing the relative amounts of IL-1 / I in gingival fluids from Caucasian individuals having IL-1B haplotypes that have specific IL-1B haplotypes.

Fig. 25 is a diagram demonstrating the reduced risk of periodontitis in Japanese subjects having a specific IL-1B genotype.

Fig. 26 is a diagram demonstrating the association of IL-1B haplotypes and the severity of periodontitis in Japanese subjects.

ES 2 356 167 T3

Four. Detailed description of the invention

4.1.- Definitions

For convenience, the meanings of certain terms and phrases used in this descriptive part of the specification, examples, and appended claims are given below.

The term "allele" refers to the different sequence variants found in different polymorphic regions. For example, IL-1RN (VNTR) has at least five different alleles. Sequence variants can be single or multiple base changes, including without limitation insertions, deletions or substitutions, or can be a variable number of sequence repeats.

The term "allelic pattern" refers to the identity of an allele or alleles in one or more polymorphic regions. For example, an allelic pattern may consist of a single allele at a polymorphic site, such as allele 1 for IL1RN (VNTR), which is an allelic pattern that has at least one copy of allele 1 of IL-1RN in the VNTRs of the IL-1RN gene loci. Alternatively, an allelic pattern can consist of a homozygous or heterozygous state at a single polymorphic site. For example, the IL1-RN allele 2,2 (VNTR) is an allelic model in which there are two copies of the second allele in the IL-1RN VNTR marker that corresponds to the IL-RN allele 2 status ( VNTR) homozygous. Alternatively, an allelic pattern can consist of the identity of alleles at more than one polymorphic site.

The term "antibody" as used herein refers to a binding agent that includes a whole antibody or one of its binding fragments that is specifically reactive with an IL-1 polypeptide. Antibodies can be fragmented using standard techniques and fragments can be screened for utility as described above for whole antibodies. For example, F (ab) 2 fragments can be generated by treating an antibody with pepsin. The resulting F (ab) 2 fragment can be treated to reduce disulfide bridges to produce Fab fragments. The antibodies of the present invention further include chimeric and humanized, single-chain and bi-specific molecules that have affinity for an IL-1B polypeptide conferred by at least one complementarity determining region (hereinafter abbreviated CDR by the English expression Complementarity Determining Region ) of the antibody.

"Biological activity" or "bioactivity" or "activity" or "biological function", which are used interchangeably for the purposes herein means an effector or antigenic function that is carried out directly or indirectly by an IL-1 polypeptide (both in its natural conformation as denatured), or by any of its sub-sequences. Biological activities include binding to a target peptide, eg, an IL-1 receptor. Biological activities also include the transcription of an IL-1 gene, such as IL-1B. An IL-1 bioactivity can be modulated by directly affecting an IL-1 polypeptide. Alternatively, a bioactivity of IL-1 can be modulated, by modulating the level of an IL-1 polypeptide, such as by modulating the expression of an IL-1 gene.

As used herein the term "bioactive fragment of an IL-1 polypeptide" refers to a full-length fragment of the IL-1 polypeptide, wherein the fragment specifically mimics or antagonizes the activity of the IL-1 type polypeptide. natural. The bioactive fragment is preferably a fragment capable of interacting with an interleukin receptor.

The term "aberrant activity", as applied to an activity of a polypeptide such as IL-1, refers to an activity that differs from the activity of the wild type or wild type polypeptide in a healthy subject. An activity of a polypeptide can be aberrant because it is stronger than the activity of its natural counterpart. Alternatively, an activity may be aberrant in that it is weaker or absent relative to the activity of its natural counterpart. An aberrant activity can also be a change in activity. For example an aberrant polypeptide can interact with a different target peptide. A cell may have aberrant IL-1 activity due to overexpression or under-expression of a gene from the IL-1 locus that encodes a polypeptide from the IL-1 locus.

"Cells", "host cells" or "recombinant cells" are terms used interchangeably herein to refer not only to the particular subject cell, but to the progeny or potential progeny of said cell. Due to certain modifications it may occur, in subsequent generations due to mutational or environmental influences, that said progeny may not in fact be identical to the parent cell, but is still included within the scope of the term as used herein.

A "chimera," "mosaic," "chimeric mammal," and the like, refers to a non-human transgenic mammal with a knock-out or an activated (knock-in) construct in at least some of its cells containing the genome.

The term "animal" as used herein never refers to a human.

The terms "control" or "control sample" refer to any sample appropriate to the appropriate detection technique employed. The control sample may contain the products of the allele detection technique used or the matter to be tested. Additionally, controls can be positive or negative. As an example, when

The allele detection technique is PCR amplification, followed by size fractionation, the control sample may comprise DNA fragments of an appropriate size. Similarly, when the allele detection technique involves the detection of a mutated protein, the control sample may comprise a sample of a mutant protein. However, it is preferred that the control sample comprises the material to be analyzed. For example, controls can be a genomic DNA sample or a cloned portion of the IL-1 gene cluster. However, when the sample to be analyzed is genomic DNA, the control sample is preferably a highly purified control sample of genomic DNA.

The phrase "diseases and conditions associated with IL-1 polymorphisms" refers to a variety of diseases or conditions, the sensitivity of which may be indicated in a subject based on the identification of one or more alleles within the IL-complex. 1. Examples include: inflammatory or degenerative disease, including: systemic inflammatory response (SIRS for Systemic Inflammatory Response Syndrome); Alzheimer's disease (and associated conditions and symptoms including: chronic neuroinflammation, glial activation; enlargement of microglia; neuritic plaque formation; and response to therapy); Amylotropic Lateral Sclerosis (Amylotropic Lateral Sclerosis), arthritis (and associated conditions and symptoms including: acute arthritis, antigen-induced arthritis, arthritis associated with chronic lymphocytic thyroiditis, collagen-induced arthritis, juvenile chronic arthritis; rheumatoid arthritis juvenile, osteoarthritis, prognosis and streptococcal-induced arthritis), asthma (and associated conditions and symptoms, including: bronchial asthma; chronic obstructive airway disease; chronic obstructive pulmonary disease (COPD), juvenile asthma and occupational asthma); cardiovascular diseases (and associated conditions and symptoms, including: atherosclerosis, autoimmune myocarditis, chronic cardiac hypoxia, congestive heart failure, coronary artery disease, cardiomyopathy, and cardiac cell dysfunction, including: activation of aortic smooth muscle cells, apoptosis of cardiac cells; and immunomodulation of cardiac cell function; diabetes and associated conditions and symptoms, including autoimmune diabetes, insulin-dependent diabetes (Type 1), diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy); gastrointestinal inflammations (and related conditions and symptoms, including celiac disease, associated osteopenia, chronic colitis, Crohn's disease, inflammatory bowel disease, and ulcerative colitis); gastric ulcers; liver inflammations, cholesterol gallstones and liver fibrosis, HIV infection (and related conditions and symptoms, including degenerative responses, neurodegenerative responses, and HIV-associated Hodgkin's disease), Kawasaki syndrome (and associated conditions and symptoms, including syndrome mucocutaneous lymph node, cervical lymphadenopathy, coronary artery lesions, edema, fever, increased white blood cells, mild anemia, peeling of the skin, skin rash, conjunctival redness, thrombocytosis; multiple sclerosis, kidney disease (and associated conditions and symptoms, including diabetic nephropathy, end-stage renal disease, glomerulonephritis, Goodpasture syndrome, hemodialysis survival injuries and renal ischemic reperfusion), neurodegenerative diseases (and associated conditions and symptoms, including acute neurodegeneration, induction of IL-1 in aging and neurodegenerative disease, IL-1-induced plasticity of hypothalamic neurons and chronic stress hyperresponsiveness), ophthalmopathies (and associated conditions and symptoms, including diabetic retinopathy, Graves' ophthalmopathy, and uveitis, osteoporosis (and associated conditions and symptoms, including decreased bone mass) o frequency of alveolar, femoral, radial, vertebral or wrist fracture, decrease in postmenopausal bone mass, tumors, frequency of fractures or rate of decrease in bone mass), otitis media (in adults or children), pancreatic pancreatitis or acinitis, periodontitis or periodontopathy (and associated conditions and symptoms, including in adults, early-onset and diabetic); lung diseases, including chronic lung disease, chronic sinusitis, hyaline membrane disease, hypoxia, and lung disease in sudden latent death syndrome (SIDS for short, Sudden Infant Death Syndrome); restenosis; rheumatism including rheumatoid arthritis, rheumatic Aschoff's nodes, rheumatic diseases and rheumatic myocarditis; thyroiditis including chronic lymphocytic thyroiditis; urinary tract infections including chronic prostatitis, chronic pelvic pain syndrome, and urolithiasis. Immune disorders, including autoimmune diseases, such as alopecia aerata, autoimmune myocarditis, Graves 'disease, Graves' ophthalmopathies, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and lymphomatous struma Hashimoto's thyroiditis, lymphadenoid goiter), sleep disorders, and chronic fatigue syndrome and obesity (non-diabetic or associated with diabetes). Resistance to infectious diseases, such as leishmaniasis, leprosy, Lyme disease, Lyme carditis, malaria, cerebral malaria, meningititis, tubulointerstitial nephritis associated with malaria), which are caused by bacteria, viruses (e.g. cytomegalovirus, encephalitis, EpsteinBarr virus, human immunodeficiency virus, influenza virus) or protozoa (eg, Plasmodium falciparum, trypanosomes). trauma, including brain trauma (including stroke and ischemia, encephalitis, encephalopathies, epilepsy, perinatal brain injury, febrile seizures, SIDS and subarachnoid hemorrhages), low birth weight (for example cerebral palsy), lung injuries (acute hemorrhagic lung injuries, syndrome Goodpasture, acute ischemic reperfusion), myocardial dysfunction, caused by occupational and environmental pollutants (eg sensitivity to toxic oil syndrome and silicosis), radiation trauma, and effectiveness of wound healing responses (eg burn or thermal wounds, chronic wounds, surgical wounds, and wound injuries). spinal cord). Sensitivity to neoplasms, including osteolytic metastases associated with breast cancer, cachexia, colorectal cancer, hyper-proliferative diseases, Hodgkin's disease, leukemias, lymphomas, metabolic diseases and tumors, metastases, myelomas and various cancers (including breast, prostate , ovary, colon, lung, etc), anorexia and cachexia. Hormonal regulation including fertility / fecundity, probability of pregnancy, incidence of preterm birth, prenatal and neonatal complications including low preterm birth weight, cerebral palsy, septicemia, hypothyroxinemia, oxygen dependence, head deformity, early menopause. A subject's response to transplants (rejection or acceptance), acute phase response (eg, febrile response), general inflammatory response, response to acute respiratory distress, acute systemic inflammatory response, wound healing, adherence, immune-inflammatory response , neuroendocrine response, development and re8

ES 2 356 167 T3 resistance to fever, acute phase response, stress response, disease sensitivity, repetitive motion stress, epicondylitis, and pain management and response.

The phrases "gene disruption" and "targeted disruption" or any similar phrase refer to the site-specific disruption of a DNA sequence so as to prevent expression of that gene in the cell as compared to the type copy. natural gene. The disruption can be caused by deletions, insertions or modifications in the gene or any of their combinations.

The term "haplotype" as used herein is intended to refer to a set of alleles that are inherited together as a group (are in linkage disequilibrium) at statistically significant levels (p_corr<0.05). As used herein, the phrase "an IL-1 haplotype" refers to a haplotype at IL-1 loci. An inflammatory or pro-inflammatory IL-1 haplotype refers to a haplotype that is indicative of increased agonist and / or decreased antagonist activities. An inflammatory or pro-inflammatory haplotype of IL-1 also refers to a haplotype that is indicative of altered expression of IL-1 genes, such as increased expression of IL-1B.

The terms "IL-1 gene cluster" and "IL-1 loci" as used herein include all of the nucleic acid at or near the 2q13 region of chromosome 2, including at least the IL-1A genes. , IL1B and IL-1RN and any other linked sequences. (Nicklin et al., Genomics 19: 382-84, 1994). The terms "IL1A", "IL-1B", and "IL-1RN" as used herein refer to genes encoding IL-1A, IL-1B, and IL-1 receptor antagonists. , respectively. The gene access numbers (in the GenBank database) for IL-1A, IL-1B, and IL-1RN are X03833, X04500, and X64532, respectively.

"IL-1 functional mutation" refers to a mutation within the IL-1 gene cluster that results in an altered phenotype (ie, affects the function of an IL-1 gene or protein). Examples include : IL-1A allele 2 (+4845), IL-1B allele 2 (+3954), IL-1B allele 2 (+6912), IL-IB allele 1 (+3737), allele 1 of IL-1B (-1468); and allele 2 of IL-1RN (+2018).

"IL-1X (Z) Y allele" refers to a particular allele form, designated Y, that is present at a polymorphic site of the IL-1 locus in the X gene, where X is IL-1A, B, or RN and located at or near nucleotide Z, wherein nucleotide Z is numbered with respect to the major transcriptional start site, which is nucleotide +1, of the particular IL-1 X gene. As further used herein, the term "IL-1X allele (Z)" refers to all alleles of a polymorphic site in IL-1 in the X gene positioned at or near the Z nucleotide. For example, the term "IL-1RN (+2018) allele" refers to alternative forms of the IL-1RN gene at marker +2018. "Allele 1 of L-1RN (+2018)" refers to a form of the IL-1RN gene that contains a cytosine (C) at position +2018 of the sense strand. Clay et al., Hum. Genet. 97: 723-26, 1996. "Allele 2 of IL-1RN (+2018)" refers to a form of the IL-1RN gene that contains a thymine at position (T) +2018 of the positive strand (+). When a subject has two identical IL-1RN alleles, the subject is said to be homozygous, or to have a homozygous state. When a subject has two different IL-1RN alleles, the subject is said to be heterozygous, or to have the heterozygous state. The term "IL-1RN (+2018) allele 2,2" refers to state 2 of homozygous IL-1 RN (+2018) allele 2. Conversely, the term "IL-1RN (+2018) allele 1,1" refers to the homozygous IL-1RN (+2018) allele 1 status. The term "1,2 allele of IL-1RN (+2018)" refers to states 1 and 2 of the heterozygous allele.

"Related to IL-1" as used herein is used to include all genes related to the genes of the human IL-1 locus on human chromosome 2 (2q 12-14). These include the IL-1 genes of the human IL-1 gene cluster located on chromosome 2 (2q 13-14) which includes: the IL-1A gene encoding interleukin-1a, the IL-1B gene encoding interleukin -1 ^, and the IL-1RN (or IL-1ra) gene that encodes the interleukin-1 receptor antagonist. In addition, these related IL-1 genes include the type I and type II IL-1 receptor genes located on chromosome 2 (2q 12) and their mouse counterparts located on mouse chromosome 1 at position 19, 5 cM. Interleukin-1a, interleukin-1 ^ and interleukin-1RN are related all the more since they all bind to IL-1 type l receptors, however only interleukin-1a and interleukin-1 ^ are ligands. agonists that activate IL-1 type I receptors, whereas interleukin1RN is a naturally occurring antagonist ligand. When the term "IL-1" is used to refer to a gene product or polypeptide, it is intended to mean that it refers to all gene products encoded by the interleukin-1 locus on human chromosome 2 (2q 12-14) and their corresponding homologs from other species or their functional variants. The term IL-1 therefore includes secreted polypeptides that promote an inflammatory response, such as IL-1a and IL-1/1, as well as a secreted polypeptide that antagonizes inflammatory responses, such as the IL-1 receptor antagonist. and the IL-1 type II receptor (decoy).

An "IL-1 receptor" or "IL-1R" refers to protein receptors attached to the membrane of various cells capable of binding to, and / or transducing, a signal from a ligand encoded by the IL-1 locus. The term applies to any of the proteins that are capable of binding to interleukin-1 (IL-1) molecules and, in their natural configuration as membrane proteins in mammalian plasma, presumably play a role in transducing the signal provided. by IL-1 to a cell. As used herein, the term includes analogs of natural proteins with IL-1 binding or signal transducing activity. Examples include the human and murine IL-1 receptors described in US Patent No. 4,968,607. The term "IL-1 nucleic acid" refers to a nucleic acid that encodes an IL-1 protein.

ES 2 356 167 T3

An "IL-1 polypeptide" and "IL-1 protein" is used to encompass polypeptides comprising the amino acid sequence encoded by the IL-1 genomic DNA sequences shown in Figures 1, 2, and 3, or their fragments. , and their homologues and include agonist and antagonist polypeptides.

"Increased risk" refers to a statistically higher frequency of the disease or condition occurring in an individual carrying a particular polymorphic allele compared to the frequency of the disease or condition occurring in a member of a population that does not carry the particular polymorphic allele.

The term "interact" as used herein is used to mean detectable relationships or associations (eg, biochemical interactions) between natural molecules, such as protein-protein, protein-nucleic acid, nucleic acid-nucleic acid interactions. and protein-small molecule or nucleic acid-small molecule.

The term "isolated" as linked herein with respect to nucleic acids, such as DNA or RNA, refers to molecules separate from other DNA or RNA, respectively, that are present in the natural source of the macromolecule. For example, an isolated nucleic acid encoding one of the subject IL-1 polypeptides includes no more than 10 kilobases (kb) of the nucleic acid sequence that naturally and immediately flanks the IL-1 gene in genomic DNA, more preferably not more than 5 kb of said naturally occurring flanking sequences, and more preferably less than 1.5 kb of said naturally occurring flanking sequences. The term "isolated" as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals. when chemically synthesized. Furthermore, an "isolated nucleic acid" is used to include fragments of a nucleic acid that do not occur naturally as fragments and would not be found in the natural state. The term "isolated" is also used herein to refer to polypeptides that are isolated from other cellular proteins and is used to encompass both purified and recombinant polypeptides.

An activated transgenic animal ("knock-in") refers to a non-human animal that has had a modified gene introduced into its genome and the modified gene can be of exogenous or endogenous origin.

A "knock-out" transgenic animal refers to a non-human animal in which there is a partial or complete suppression of the expression of an endogenous gene (eg, based on the deletion of at least a portion of the gene, replacement of at least a portion of the gene with a second sequence, introduction of stop codons, mutation of bases encoding critical amino acids, or removal of an intron splice, etc.).

A "knock-out construct" refers to a nucleic acid sequence that can be used to decrease or suppress the expression of a protein encoded by endogenous DNA sequences in a cell. In a simple example, the inactivated construct consists of a gene, such as the IL-1RN gene, with a deletion in a critical portion thereof, so that the active protein cannot be expressed from it. Alternatively, a number of stop codons can be added to a wild-type gene to cause early termination of the protein or intron splicing can be disabled. In a typical inactivated construct, some portion of the gene is replaced with a selectable marker (such as the neo gene) so that the gene can be represented as follows: IL-1RN 5 '/ neo / IL-1RN 3', where IL-1RN5 'and IL-1RN 3', refer to genomic or cDNA sequences that are, respectively, in a position located towards the 5 end and respectively in a position located towards the 3 'end, respectively with respect to a portion of the 1L-1RN gene and where neo refers to a neomycin resistance gene. In another inactivated construct, a second selectable marker is added at a flanking position so that the gene can be represented as: IL-1RN / neo / IL-1RN / TK, where TK is a thymidine kinase gene that can be added to the IL-1RN5 'or 1L-1RN3' sequence of the preceding construction and which can further be selected against (ie, is a negative selectable marker) in appropriate media. This two-marker construction allows the selection of homologous recombination events, which removes the flanking TK marker, from non-homologous recombination events that typically retain TK sequences. The deletion and / or replacement of genes can be of exons, introns, especially intron splices, and / or regulatory regions such as promoters.

"Linkage disequilibrium" refers to the joint inheritance of two alleles at frequencies greater than what might be expected from the separate frequencies exhibited by each allele in a given control population. The expected frequency of presentation of two alleles that are inherited together is the frequency of the first allele multiplied by the frequency of the second allele. Alleles that co-present at the expected frequencies are said to be in "linkage disequilibrium." The cause of linkage disequilibrium is often unclear. It may be due to selection for certain allele combinations or recent mixing of genetically heterogeneous populations. Furthermore, in the case of markers that are very strongly linked to a disease gene, an association of an allele (or group of linked alleles) with the disease gene is expected if the disease mutation occurred in the recent past, so that not enough time has elapsed for equilibrium to be achieved through recombination events in the specific chromosomal region. When referring to allelic models that are made up of more than one allele, a first allele model is in linkage disequilibrium with a second allelic model if all alleles that comprise the first allelic model are in linkage disequilibrium with at least one of the alleles of the second allelic model. An example of linkage disequilibrium is that which occurs between alleles at the IL-1RN (+2018) and IL-1RN (VNTR) polymorphic sites. Both

ES 2 356 167 T3 alleles in IL-1RN (+2018) are 100% in linkage disequilibrium with the two most frequent alleles of IL-1RN (VNTR), which are allele 1 and allele 2.

The term "marker" refers to a genome sequence that is known to vary between individuals. For example, the IL-1RN gene has a marker consisting of a variable number of tandem repeats (VNTR).

A "mutated gene" or "mutation" or "functional mutation" refers to an allelic form of a gene, which is capable of altering the phenotype of a subject who has the mutated gene relative to a subject who does not have the mutated gene. The altered phenotype caused by a mutation can be corrected or compensated for for certain agents. If a subject must be homozygous for this mutation having an altered phenotype, the mutation is said to be recessive. If one copy of the mutated gene is sufficient to alter the phenotype of the subject, the mutation is said to be dominant. If a subject has one copy of the mutated gene and has a phenotype that is intermediate between that of a homozygous subject and that of a heterozygous subject (for that gene), the mutation is said to be co-dominant.

A "non-human animal" of the invention includes mammals such as rodents, non-human primates, sheep, dogs, cows, goats, etc., amphibians, such as members of the genus Xenopus, and transgenic birds (eg, chickens, birds , etc.). The term "chimeric animal" is used herein to refer to non-human animals in which the recombinant gene is found, or in which the recombinant gene is expressed in some but not all cells of the animal. The term "tissue-specific chimeric animal" indicates that one of the IL-1 genes is present and / or expressed or disrupted in some tissues but not others. The term "mammal" refers to any member of the mammalian class, except humans.

As used herein, the term "nucleic acid" refers to polynucleotides or oligonucleotides, such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents RNA or DNA analogs made from nucleotide analogs (eg, peptide nucleic acids) and as applicable to the embodiment describing polynucleotides, single-stranded (sense or antisense) and double-stranded.

The terms "periodontitis" and "periodontopathy" refer to a dental disorder that is the result of the progression of gingivitis, involving inflammation and infection of the tissue, including ligaments and bones, that support the teeth. Periodontitis is frequently diagnosed by examination that shows the swollen and tender purple-red gingiva. Plaque and tartar deposits may be visible at the base of the teeth, with elongated cavities in the gums. The gums are usually painless or mildly tender, unless a tooth abscess is present. Teeth can be lost and gums reabsorbed. The severity of periodontitis is quantified by measuring the cavity depth (PC, also called "probing depth") in a subject's gum cavities.

The term "polymorphism" refers to the coexistence of more than one form of a gene or one of its portions (eg, allelic variant). A portion of a gene of which there are at least two different forms, that is, two different nucleotide sequences, is called a "polymorphic region of a gene." A specific genetic sequence in a polymorphic region of a gene is an allele. A polymorphic region can be of a single nucleotide, the identity of which differs in different alleles. A polymorphic region can also be several nucleotides in length.

The term "disease propensity," also "predisposition" or "sensitivity" to disease or any similar phrase, means that certain alleles discovered by the present invention are associated with, or predictive of, a subject's incidence of developing a particular disease. (for example, a vascular disease). Alleles are therefore over-expressed in frequency in individuals with disease compared to healthy individuals. Therefore, these alleles can be used to predict disease even in pre-symptomatic individuals or in a pre-disease state.

"Small molecule" as used herein, is intended to refer to a composition, which has a molecular weight of less than about 5 kD and more preferably about 4 kD. Small molecules can be nucleic acids, peptides, peptide-mimetics, carbohydrates, lipids, or other organic or inorganic molecules.

As used herein, the term "specifically hybridizes" or "specifically detects" refers to the ability of a nucleic acid molecule to hybridize to at least about 6 consecutive nucleotides of a nucleic acid from a sample.

"Transcriptional regulatory sequence" is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, that induce or control the transcription of protein coding sequences with which they are operably linked.

As used herein, the term "transgene" means a nucleic acid sequence (encoding, for example, one of the IL-1 polypeptides or an antisense transcript therefor) that has been introduced into a cell. A transgene could be partially or entirely heterologous, that is, foreign, to the transgenic animal or cell into which it is introduced, or, it is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the genome of the animal in such a way that

ES 2 356 167 T3 alters the genome of the cell into which it is inserted (for example, it is inserted in a location that differs from the wild-type gene or its insertion results in an inactivation or knockout). A transgene can also be present in a cell in the form of an episome. A transgene can include one or more transcriptional regulatory sequences and any other nucleic acids, such as introns, that may be necessary for optimal expression of a selected nucleic acid.

A "transgenic animal" refers to a preferably non-human mammal, a bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced through human intervention, such as transgenic methods well known to the skilled in the art. Nucleic acid is introduced into the cell, directly or indirectly by introduction into a cell precursor, by deliberate genetic manipulation, such as by micro-injection or by infection with a recombinant virus. The term genetic manipulation does not include classical cross breeding, or in vitro fertilization, but rather is directed towards the introduction of a recombinant DNA molecule. This molecule can be integrated with a chromosome, or it can be extrachromosomally replicating DNA. In the typical transgenic animals described herein, the transgene causes cells to express a recombinant form of one of the IL-1 polypeptides, eg, agonistic or antagonistic forms. However, transgenic animals in which the recombinant gene is silent are also considered, such as the FLP or CRE recombinase-dependent construct described below. Furthermore, "transgenic animal" also includes non-human recombinant animals in which the gene disruption of one or more genes is caused by human intervention, including both recombination and antisense techniques. The term is intended to include all generations of progeny. Therefore, the founder animal and all F1, F2, F3, and so on, of its progeny are included.

The term "treatment" as used herein is intended to encompass curing as well as amelioration of at least one symptom of a condition or disease.

The term "vector" refers to a nucleic acid molecule, which is capable of transporting another nucleic acid to which it has been linked. One type of preferred vector is an episome, that is, a nucleic acid capable of extrachromosomal replication. Preferred vectors are those capable of autonomous replication and / or expression of nucleic acids to which they are attached. Vectors capable of directing the expression of genes to which they are operably linked are referred to herein as "expression vectors." In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which generally refer to loops of circular double-stranded DNA which, in their vector form, are not found on the chromosome. Herein, "plasmid" and "vector" are used interchangeably since plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve as functional equivalents and which have subsequently become known in the art.

The term "wild-type allele" refers to an allele of a gene that, when present in two copies in a subject, results in a wild-type phenotype. There may be different wild-type alleles of a specific gene, since certain nucleotide changes in a gene cannot affect the phenotype of a subject who has two copies of the gene with the nucleotide changes.

4.2 Predictive medicine

4.2.1. Inflammatory IL-1 haplotypes and their association with certain diseases or conditions

The present invention is based, at least in part, on the identification of certain models of inflammatory haplotypes and the association (to a statistically significant extent) of these models with the development of certain diseases or conditions. Thus, detection of alleles comprising a haplotype, alone or in conjunction with other means in a subject may indicate that the subject has or is predisposed to the development of a disease or condition. However, because these alleles are in linkage disequilibrium with other alleles, the detection of such other linked alleles may also indicate that the subject has or is predisposed to the development of a particular disease or condition. For example, the 44112332 haplotype comprises the following phenotype:

<img file="ES2356167T3_D0001.tif" />

ES 2 356 167 T3

Three other polymorphisms in an alternate exon of IL-1RN (exon lic, which produces an intracellular form of the gene product) are also in linkage disequilibrium with allele 2 of IL-1RN (VNTR) (Clay et al., (1996) Hum. Genet. 97: 723-26). These include: the exon lic (1812) of IL-1RN (GenBank: X77090 at 1812); the IL-1RN exon lic (1868) polymorphism (GenBank: X77090 at 1868); and the IL-1RN exon lic (1887) polymorphism (GenBank: X77090 in 1887). Furthermore, yet another polymorphism in the promoter for the alternately spliced ​​intracellular form of the gene, the Pic (1731) polymorphism (GenBank: X77090 at 1731), is also in linkage disequilibrium with allele 2 of the IL- polymorphic locus (VNTR). 1RN. For each of these loci, the sequence variant of allele 2 in linkage disequilibrium with allele 2 of the IL-1RN locus (VNTR) has been determined (Clay et al., (1996) Hum. Genet. 97: 723 -26).

Haplotype 33221461 haplotype comprises the following genotype:

<img file="ES2356167T3_D0002.tif" />

Individuals with the 44112332 haplotype are typically over-producers of both IL-1a and IL1β proteins, upon stimulation. In contrast, individuals with the 33221461 haplotype are typically IL1ra sub-producers. Each haplotype results in a net pro-inflammatory response. Each allele within a haplotype can have an effect, as well as a compound genotype effect. Furthermore, particular diseases may be associated with both haplotype models.

Table 1 below sets forth a number of genotype markers and various diseases and conditions with which these markers have been found to be associated to a statistically significant extent.

TABLE 1

Association of IL-1 haplotype gene markers with certain diseases

<td>GENOTYPE</td><td>IL-1A (-889)</td><td>IL-1A (+4845)</td><td>IL-1B (-511)</td><td>IL-1B (+3954)</td><td>IL-1RN (+2018)</td>

<td>DISEASE</td><td></td><td></td><td></td><td></td><td></td>

<td>Periodontal disease</td><td> (*₂₎</td><td> *2</td><td></td><td> *2</td><td></td>

<td>Coronary artery stenosis</td><td></td><td></td><td> *2</td><td></td><td> *2</td>

<td>Osteoporosis</td><td></td><td></td><td></td><td></td><td> *2</td>

<td>Insulin dependent diabetes</td><td></td><td></td><td></td><td> *2</td><td></td>

<td>Diabetic retinopathy</td><td></td><td></td><td></td><td></td><td> *1</td>

<td>Kidney disease in the end stage</td><td></td><td></td><td></td><td></td><td> (+)</td>

<td>Diabetic nephropathy</td><td></td><td></td><td></td><td></td><td> *2</td>

<td>Liver fibrosis (Japanese alcoholics)</td><td></td><td></td><td></td><td></td><td> (+)</td>

<td>Alopecia areata</td><td></td><td></td><td></td><td></td><td> *2</td>

<td>Graves disease</td><td></td><td></td><td></td><td></td><td> *2</td>

<td>Graves ophthalmopathy</td><td></td><td></td><td></td><td></td><td> (-)</td>

<td>Extrathyroidal disease</td><td></td><td></td><td></td><td></td><td> (+)</td>

<td>Systemic lupus erythematosus</td><td></td><td></td><td></td><td></td><td> *2</td>

<td>Lichen sclerosis</td><td></td><td></td><td></td><td></td><td> *2</td>

<td>Arthritis</td><td></td><td></td><td></td><td></td><td> (+)</td>

<td>Juvenile chronic arthritis</td><td> *2</td><td></td><td></td><td></td><td></td>

<td>Rheumatoid arthritis</td><td></td><td></td><td></td><td></td><td> (+)</td>

<td>Insulin dependent diabetes</td><td></td><td></td><td></td><td> *2</td><td>* 2 VNTR</td>

<td>Ulcerative colitis</td><td></td><td></td><td></td><td></td><td> *2</td>

<td>Asthma</td><td></td><td></td><td> *2</td><td> *2</td><td></td>

<td>Multiple sclerosis</td><td></td><td></td><td></td><td> (*2)</td><td>* 2VNTR</td>

<td>Early-onset menopause</td><td></td><td></td><td></td><td></td><td> *2</td>

ES 2 356 167 T3

Additional IL-1B alleles and haplotypes that modulate IL-1/1 expression and inflammatory states are also described herein. The SNPs at positions -3737 of IL1B and -1468 of IL-1B are described herein. Individuals with a haplotype that includes IL-1B allele 1 (-511), IL-1B allele 1 (-1468), and IL-1B allele 2 (-3737) are typically overproducers of both proteins. IL-1 / I by stimulation. Individuals with a haplotype that includes IL-1B allele 1 (-511), IL-1B allele 1 (-1468), and IL-1B allele 1 (-3737) are also typically overproducers of both. IL.-1/1 proteins. In contrast, individuals with a haplotype that includes IL-1B allele 2 (-511), IL-1B allele 2 (-1468), and IL-1B allele 1 (-3737) are typically sub-producers. of IL-1. Each allele within a haplotype can have an effect, as well as a compound genotype effect. Furthermore, particular diseases may be associated with both haplotype models. It should be noted that the SNP at position -1468 of IL-1B has also been labeled IL-1B (-1464) and IL-1B (-1473). (See, Lee, et al, J. Gastroenterol. 2004, 39: 429-433).

In addition to the allelic models described above, as described herein, one of skill in the art can easily identify other alleles (including polymorphisms and mutations) that are in linkage disequilibrium with an allele associated with a disease or disorder. For example, a nucleic acid sample can be collected from a first group of subjects without a particular disorder, as well as DNA from a second group of subjects with the disorder. Nucleic acid samples can be compared to identify alleles that are over-represented in the second group compared to the first group, where those alleles are presumably associated with a disorder, which is caused by, or contributes to, a regulation. inappropriate interleukin 1. Alternatively, alleles that are in linkage disequilibrium with an allele that is associated with the disorder can be identified, for example, by genotyping a large population and performing statistical analysis to determine which alleles appear more often together than expected. Preferably the group is chosen to consist of related individuals. Genetically related individuals include individuals of the same race, the same ethnic group, or even the same family. As the degree of genetic relationship between a control group and a test group increases, the predictive value of polymorphic alleles that are even more distantly linked to a disease-causing allele increases. This is because less evolutionary time has elapsed to allow polymorphisms that are linked along a chromosome in a founder population to redistribute through genetic crossing events. Thus genotyping analyzes can be developed for race-specific, ethnic-specific and even family-specific diagnosis for the detection of disease alleles that arose in even more recent times in human evolution, for example, after the divergence of the main human races, after the separation of human populations into different ethnic groups, and even within the recent history of a particular family line.

Linkage disequilibrium between two polymorphic markers or between a polymorphic marker and a disease-causing mutation is a metastable state. In the absence of selective pressure or sporadic repeated linked presentation of the underlying mutational events, polymorphisms will eventually become dissociated by chromosomal recombination events and thus reach linkage equilibrium throughout the course of human evolution. Therefore, the probability of finding a polymorphic allele in linkage disequilibrium with a disease or condition may increase with changes in at least two factors: decrease in the physical distance between the polymorphic marker and the disease-causing mutation, and decrease in the number. of meiotic generations available for linked pair dissociation. Consideration of the latter factor suggests that the more closely related two individuals are, the more likely they will share a common parental chromosome or chromosomal region containing the linked polymorphisms and the less likely that this linked pair will have become unlinked through meiotic crossing events that they occur in every generation. As a result, the more closely related two individuals are, the more likely it is that widely spaced polymorphisms are jointly inherited. Therefore, for individuals related by common race, ethnicity, or family, the reliability of even the most distantly spaced polymorphic loci may be reliable as an indicator of the co-inheritance of a linked disease-causing mutation.

Appropriate probes can be designed to hybridize to a specific gene at the IL-1 locus, such as IL-1A, IL-1B, or IL-1RN or a related gene. These genomic DNA sequences are shown in Figures 3, 4 and 5, respectively, and further correspond to SEQ ID NOS. 1, 2 and 3, respectively. Alternatively, these probes can incorporate other relevant genomic locus regions, including intergenic sequences. Actually the 1L1 region of human chromosome 2 spans about 400,000 base pairs and, assuming an average of a single nucleotide polymorphism per 1,000 base pairs, includes about 400 SNP loci alone. Even other polymorphisms available for use with the present invention are obtainable from various public sources. For example, the human genome database gathers intragenic SNPs, is searchable by sequence, and usually contains approximately 2,700 entries (http://hgbase.interactiva.de). A human polymorphism database maintained by the Massachusetts Institute of Technology (MIT SNP database (http://www.genome.wi.mit.edu/SNP/ human / index.html)) is also available. From these sources, SNPs can be found, as well as other human polymorphisms.

For example, examination of the IL-1 region of the human genome in any one of these databases reveals that the IL-1 locus genes are flanked by a polymorphic marker close to the centromere called the AFM220ze3 microsatellite marker at 127.4 cM. (centiMorgans) (see GenBank Accession No. Z17008) and a distal polymorphic marker named AFM087xa1 microsatellite docking marker at 127.9 cM (see GenBank Accession No. Z16545). These human polymorphic loci are both microsatellite repeat polymorphisms of the CA dinucleotide, and as such show a high degree of heterozygosity in human populations. For example, an allele of AFM220ze3 generates a 211 bp PCR amplification product with a primer 5 'of the

ES 2 356 167 T3 sequence TGTACCTAAGCCCACCCTTTAGAGC (SEQ ID No. 4) and a 3 'primer of the sequence TGGCCTC

CAGAAACCTCCAA (SEQ ID No. 5). In addition, an allele of AFM087xa1 generates an amplification product by

177 bp PCR with a 5 'primer of the sequence GCTGATATTCTGGTGGGAAA (SEQ ID No. 6) and a 3' primer of the sequence GGCAAGAGCAAAACTCTGTC (SEQ ID No. 7).

The human IL-1B promoter is of interest in identifying polymorphisms associated with altered IL-1j6 production. Two sets of primers are used to amplify the IL-1B promoter containing different 3 'ends. The primers IL-1BF1 5'cccACGCGTGAGTGAAAGGAATCCCGTTAGAAGT (SEQ ID NO: 33) and IL-1BR2 5'cccACGCGTGCCTGTTGTGCCTTGTGCCTCGAAG (SEQ ID NO: 34) are used to generate the fragment, (of the IL32 promoter 1 - 1B 5326) (S = short; without the first exon). IL-1BR1 5'cccACGCGTGGCTGCTTCAGA CACCTGTGTA (SEQ ID NO: 35) is used to generate the IL-1BL promoter fragment (+471 to -5326) (L = long; containing the first exon and SNP 17 (+45) ).

Equivalent primers that correspond to unique sequences displaying 5 'and 3' for these CA dinucleotide repeat polymorphisms on human chromosome 2 will be apparent to those of skill in the art. Reasonable equivalent primers include those that hybridize within about 1 kb of the designed primer, and that are also anywhere from about 17 bp to about 27 bp in length. A general guideline for designing primers for the amplification of unique human chromosomal genomic sequences is that they possess a melting temperature of at least about 50 ° C, where an approximate melting temperature can be estimated using the formula T_fusion = [2xnumber of A or T) + 4x (number of G or C)].

Numerous polymorphic loci are present between these two CA dinucleotide repeat polymorphisms and provide additional targets for determination of a prognostic allele in a family or other group of genetically related individuals. For example, the website of the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/genemap/) contains a list of a number of polymorphism markers in the IL-1 locus region and provides guidance for designing appropriate primers for amplification and analysis of those markers.

Accordingly, the nucleotide segments of the invention can be used for their ability to selectively form duplex molecules with complementary stretches of human chromosome 2, q12-13 or cDNA from that region or provide primers for the amplification of DNA or cDNA from this region. The design of appropriate probes for this purpose requires consideration of a number of factors. For example, fragments that are between 10, 15, or 18 nucleotides in length up to about 20, or about 30 nucleotides, will find particular utility. Longer sequences, eg, 40, 50, 80,90,100, even up to full length, are even more preferred for certain embodiments. Oligonucleotide lengths of at least about 18 to 20 nucleotides are well accepted by those skilled in the art as sufficient to allow sufficiently specific hybridization to be useful as a molecular probe. Also depending on the intended application, varying hybridization conditions may be employed to achieve varying degrees of probe selectivity for the target sequence. For applications requiring high selectivity, it will typically be desired to employ relatively stringent conditions to form the hybrids. For example, relatively low salt conditions and / or high temperature, such as provided by 0.02M - 0.15M NaCl at temperatures from about 50 ° C to about 70 ° C. Such selective conditions can tolerate little, if any, mismatch between probe and template or target strand.

In a subject, other alleles or other indications of a disorder may be detected or monitored in conjunction with the detection of the alleles described above, for example, identifying thicknesses of blood vessel walls (for example, as measured by ultrasound), or if the subject is a smoker, drinker, overweight or under stress or exercise.

4.2.2 Allele detection

Many methods are available to detect specific alleles at human polymorphic loci. The preferred method of detecting a specific polymorphic allele will depend, in part, on the molecular nature of the polymorphism. For example, the various allelic forms of the polymorphic locus may differ by only one DNA base pair. These single nucleotide polymorphisms (or SNPs) are the main contributors to genetic variation, comprising 80% of all known polymorphisms, and their density in the human genome is estimated to be on average 1 per 1,000 pairs. bases. SNPs are very frequently biallelic that occur in only two different forms (although up to four different forms of a SNP are theoretically possible, corresponding to the four different nucleotide bases that exist in DNA). However, SNPs are mutationally more stable than other polymorphisms, making them suitable for association studies in which linkage disequilibrium between markers and an unknown variant is used to map disease-causing mutations. Furthermore, because SNPs typically have only two alleles, they can be genotyped by a simple plus / minus assay rather than a lengthy measure, making them more susceptible to automation.

A variety of methods are available to detect the presence of a particular single nucleotide polymorphism in an individual. Advances in this field have provided precision, ease, and inexpensive and large-scale genotyping of SNPs. Very recently, for example, new techniques including hybridization have been described

ES 2 356 167 T3 allele-specific dynamics (abbreviated DASH for the English expression Dynamic Allele-Specific Hybridization), diagonal gel electrophoresis in microplate arrays, abbreviated MADGE for the English expression Microplate Array Diagonal Gel Electrophoresis), pyro-sequencing, ligation specific oligonucleotide, the TaqMan system, as well as various DNA "chip" technologies, such as the Affymetrix SNP chips. These methods require amplification of the target genetic region, typically by PCR. Even other recently developed methods, based on the generation of small signal molecules by invasive cleavage followed by mass spectrometry or immobilized padlock probes and rolling circle amplification, could eventually eliminate the need for PCR. Several of the methods known in the art for detecting specific single nucleotide polymorphisms are summarized below. The method of the present invention is understood to include all available methods.

Various methods have been developed to facilitate such analysis of single nucleotide polymorphisms. In one embodiment, the single base polymorphism can be detected using a specialized exonuclease resistant nucleotide, as described, for example, in Mundy, CR (US Patent No. 4,656,127). According to the method, a primer complementary to the allelic sequence immediately 3 'to the polymorphic site is allowed to hybridize to a target molecule obtained from a particular animal or human. If the polymorphic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease resistant nucleotide derivative present, then the derivative will be incorporated onto the end of the hybridized primer. Such incorporation renders the primer resistant to the exonuclease, and therefore allows its detection. Since the identity of the exonuclease resistant derivative in the sample is known, a finding that the primer has become resistant to exonucleases reveals that the nucleotide present at the polymorphic site of the target molecule was complementary to that of the nucleotide derivative. used in the reaction. This method has the advantage that it does not require the determination of large amounts of sequence data.

A solution-based method for determining nucleotide identity of a polymorphic site is described. Cohen, D. et al. (French patent 2,650,840; PCT patent application No. WO91 / 02087). As in the Mundy method of US Patent No. 4,656,127, a primer is employed that is complementary to the allelic sequences immediately 3 'to a polymorphic site. The method determines the identity of the nucleotide of that site using derivatives of labeled dideoxynucleotides, which, if complementary to the nucleotide of the polymorphic site, will be incorporated at the (end) of the primer.

An alternative method is described, known as Genetic Bit Analysis or GBA^TM Goelet, P. et al., (PCT patent application No. 92/15712). The method of Goelet, P. et al., Uses mixtures of labeled terminators and a primer that is complementary to the 3 'sequence for a polymorphic site. The tagged terminator that is incorporated is therefore determined by, and is complementary to, the nucleotide present at the polymorphic site of the target molecule being evaluated. In contrast to the method of Cohen et al., (French Patent 2,650,840; PCT application No. WO91 / 02087) the method of Goelet, P. et al., Is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized on a solid phase.

Recently, several primer-guided nucleotide incorporation methods have been described for analyzing polymorphic sites in DNA (Komher, JS et al., Nucl. Acids. Res. 17: 7779-7784 (1989); Sokolov, BP, Nucl. Acids Res. 18: 3671 (1990); Syvanen, A. -C., Et al., Genomics 8: 684-692 (1990); Kuppuswamy, MN et al., Proc. Natl. Acad. Sci. (USA) 88 : 1143-1147 (1991); Prezant, TR et al., Hum. Mutat. 1: 159-164 (1992); Ugozzoli, L. et al., GATA 9: 107-112 (1992); Nyren, P. et al., Anal. Biochem. 208: 171-175 (1993)). These methods differ from GBA^TMin that they all rely on the incorporation of labeled deoxynucleotides to discriminate between bases in a polymorphic site. In this format, since the signal is proportional to the number of deoxynucleotides incorporated, the polymorphisms that may be present in experiments of the same nucleotide can result in signals that are proportional to the length of the experiment (Syvanen, A. -C., Et al., Amer. J. Hum. Genet. 52: 46-59 (1993)).

For mutations that cause premature termination of protein translation, the Protein Truncation Test (PTT for Protein Truncation Test) offers an efficient approach to diagnosis (Roest, et al., (1993) Hum. Mol. Genet. 2: 1719-21; van der Luijt, et al., (1994) Genomics 20: 1-4). By PTT, RNA is initially isolated from available tissue and reverse transcribed, and the segment of interest is amplified by PCR. The reverse transcription and PCR products are then used as a template for nested PCR amplification with a primer containing an RNA polymerase promoter and a sequence to initiate translation in eukaryotes. After amplification of the region of interest, the unique residues incorporated into the primer allow sequential in vitro transcription and translation of the PCR products. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis of translation products, the appearance of truncated polypeptides indicates the presence of a mutation that causes premature termination of translation. In a variation of this technique, DNA (as opposed to RNA) is used as a template for PCR when the target region of interest is derived from a single exon.

Any type of cell or tissue can be used to obtain nucleic acid samples for use in the diagnostics described herein. In a preferred embodiment, the DNA sample is obtained from a body fluid, eg, blood, obtained by known techniques (eg, venipuncture) or saliva. Alternatively, the nucleic acid assay can be performed on dry samples (eg, hair or skin). When using RNA or protein, the cells or tissues that can be used must express an IL-1 gene.

ES 2 356 167 T3

Diagnostic methods can also be performed directly in situ on tissue sections (fixed and / or frozen) of patient tissue obtained from biopsies or resections, such that nucleic acid purification is not necessary. Nucleic acid reagents can be used as probes and / or primers for such in situ methods (see, eg, Nuovo, GJ, 1992, PCR in situ hybridization: protocols and applications, Rayen Press, NY).

In addition to methods that primarily emphasize the detection of a nucleic acid sequence, profiles can also be determined in such detection schemes. Fingerprint profiles can be generated, for example, using a differential display method, Northern analysis and / or RT-PCR.

A preferred detection method is allele-specific hybridization using probes that overlap a region of at least one allele of a pro-inflammatory IL-1 haplotype and that have approximately 5, 10, 20, 25, or 30 nucleotides around the mutation or polymorphic region. In a preferred embodiment of the invention, a number of probes capable of specifically hybridizing to other allelic variants involved in restenosis are attached to a solid phase support, for example, a "chip" (which may contain up to about 250,000 oligonucleotides). The oligonucleotides can be attached to a solid support by a variety of processes, including lithography. Mutation detection analysis using these chips comprising oligonucleotides, also called "DNA probe arrays" is described for example by Cronin et al., (1996) Human Mutation 7: 244. In one embodiment, a chip comprises all allelic variants of at least one polymorphic region. The solid phase support is then contacted with a test nucleic acid and hybridization to specific probes is detected. Accordingly, the identity of numerous allelic variants of one or more genes can be identified in a simple hybridization experiment.

These techniques may also comprise the step of amplifying the nucleic acid prior to analysis. Amplification methods are known to those of skill in the art and include, but are not limited to, cloning, polymerase chain reaction (PCR), allele-specific polymerase chain reaction (ASA), ligase chain reaction (LCR), nested polymerase chain reaction, self-sustained sequence replications (Guatelli, JC et a ., 1990, Proc. Natl. Acad. Sci. USA, 87: 1874-1878), transcriptional amplification system (Kwoh, DY et al., 1989, Proc. Natl. Acad. Sci. USA 86: 1173-1177), and Q-Beta Replicase (Lizardi, PM et al., 1988, Bio / Technology 6: 1197).

Amplification products can be analyzed in a variety of ways, including size analysis, restriction digestion followed by size analysis, detection of oligonucleotide primers with a specific tag in the reaction products, allele-specific oligonucleotide hybridization (ASO), allele-specific 5 'exonuclease detection, sequencing, hybridization, and the like.

PCR-based detection means that it can include multiplex amplification of a variety of markers simultaneously. For example, it is well known in the art to select PCR primers to generate PCR products that do not overlap in size and can be analyzed simultaneously. Alternatively, it is possible to amplify different markers with primers that are labeled differently and therefore each can be differentially detected. Of course, hybridization-based detection means allowing the differential detection of multiple PCR products in a sample. Other methods are known in the art to allow multiple analyzes of a plurality of markers.

In a merely illustrative embodiment, the method includes the steps of: (i) collecting a sample of cells from a patient, (ii) isolating nucleic acid (e.g., genomic, mRNA, or both) from the cells in the sample, (iii) contacting the nucleic acid sample with one or plus primers that specifically hybridize 5 'and 3' to at least one allele of a pro-inflammatory IL-1 haplotype under conditions such that hybridization and amplification of the allele occurs, and (iv) detect the amplification product. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.

In a preferred embodiment of the relevant analysis, the allele of a pro-inflammatory IL-1 haplotype is identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA are isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis.

In yet another embodiment, any of the sequencing reactions known in the art can be used to directly sequence the allele. Illustrative sequencing reactions include those based on techniques developed by Maxam and Gilbert ((1977) Proc. Natl Acad Sci USA, 74: 560) or by Sanger (Sanger et al., (1977) Proc. Nat. Acad. Sci USA 74: 5463). It is also contemplated that any of a variety of automated sequencing methods may be used when performing the relevant analyzes (see, for example, Biotechniques (1995) 19: 448), including mass spectrometric sequencing (see for example the publication of pCt patent application WO 94/16101; Cohen et al., (1996) Adv. Chromatogr., 36: 127-162; and Griffin et al., (1993) Appl. Biochem. Biotechnol, 38: 147-159) . It will be apparent to those skilled in the art that, for certain embodiments, the presence of only one, two, or three of the nucleic acid bases needs to be determined in the sequencing reaction. For example, a fingerprint of A (adenine) or the like can be carried out, for example, when only one nucleic acid is detected.

ES 2 356 167 T3

In a further embodiment, the protection of cleavage agents (such as an osmium nuclease, hydroxylamine or tetroxide and / with piperidine) can be used to detect mismatched bases in RNA / DNA or RNA / DNA or DNA / DNA heteroduplexes (Myers , et al., (1985) Science, 230: 1242). In general, the "mismatch cleavage" technique begins by providing the heteroduplexes formed by hybridizing RNA or DNA (labeled) containing the wild-type allele with the sample. The double-stranded duplexes are treated with an agent that cleaves the single-stranded regions of the duplexes, such as those that will exist due to base mismatches between the control and sample strands. For example, RNA / DNA duplexes can be treated with RNase and DNA / DNA hybrids treated with S1 nuclease to enzymatically digest the mismatched regions. In other embodiments, the DNA / DNA or RNA / DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine to digest the mismatched regions. After digestion of the mismatched regions, the resulting material is then size separated on denaturing polyacrylamide gels to determine the site of the mutation. See, for example, Cotton et al., (1988) Proc. Natl. Acad. Sci. USA, 85: 4397; and Saleeba et al., (1992) Enzymol Methods. 217: 286-295. In a preferred embodiment, the control DNA or RNA can be tagged for detection.

In yet another embodiment, the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNAs (so-called "DNA mismatch repair enzymes"). For example, the mutY enzyme from E. coli cleaves A mismatches in G / A and HeLa cell thymidine DNA glycosylase cleaves T mismatches in G / T (Hsu et al., (1994) Carcinogenesis, 15: 1657 -1662). In accordance with an illustrative embodiment, a probe based on the IL-1 locus haplotype allele hybridizes to a cDNA or other DNA product from a test cell (s). The duplex is treated with the DNA mismatch repair enzyme, and the cleaved products, if any, can be detected by electrophoresis protocols or the like. See, for example, US Patent No. 5,459,039.

In other embodiments, alterations in electrophoretic mobility will be used to identify an allele of the IL-1 locus. For example, single-stranded conformational polymorphism (hereinafter SSCP for Single Strand Conformation Polymorphism) can be used to detect differences in electrophoretic mobility between wild-type and mutant-type nucleic acids (Orita et al., ( 1989) Proc. Natl. Acad. Sci. USA 86: 2766, see also Cotton (1993) Mutat. Res. 285: 125-144; and Hayashi (1992) Genet. Anal. Tech. Appl., 9: 73-79). The single-stranded DNA fragments of the IL-1 alleles from the sample and the control are denatured and allowed to re-naturalize. The secondary structure of single-stranded nucleic acids varies according to sequence, and the resulting alteration in electrophoretic mobility allows detection of even a single base change. DNA fragments can be labeled or detected with labeled probes. The sensitivity of the analysis can be improved by using RNA (instead of DNA), in which the secondary structure is more sensitive to a change in sequence. In a preferred embodiment, the relevant method uses heteroduplex analysis to separate double-stranded heteroduplex molecules based on changes in electrophoretic mobility (Keen et al., (1991) Trends Genet., 7: 5).

In yet another embodiment, allele movement in polyacrylamide gels containing a denaturant gradient is analyzed using gradient gene electrophoresis (hereinafter abbreviated DGGE for Denaturing Gradient Gel Electrophoresis) (Myers et al., (1985 ) Nature, 313: 495). When DGGE is used as the method of analysis, the DNA will be modified to ensure that it is not completely denatured, for example by adding a GC clamp of approximately 40 bp of high melting point GC-rich DNA by PCR. In a further embodiment, a temperature gradient is used instead of a denaturing agent gradient to identify differences in the mobility of the sample and control DNA (Rosenbaum and Reissner (1987) Biophys. Chem. 265: 12753).

Examples of other techniques for detecting alleles include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, "oligonucleotide" primers can be prepared in which the known mutation or nucleotide difference (eg, in allelic variants) is centrally placed and then hybridized to a target DNA under conditions that allow hybridization only if a match is found. perfect (Saiki et al., (1986) Nature, 324: 163); Saiki et al., (1989) Proc. Natl. Acad. Sci USA 86: 6230). Such allele-specific oligonucleotide hybridization techniques can be used to analyze a mutation or polymorphic region by reaction when the oligonucleotides hybridize to a PCR-amplified target DNA or a number of different mutations or polymorphic regions when the oligonucleotides bind to the membrane. hybridizing and hybridizing to the tagged target DNA.

Alternatively, allele-specific amplification technology that relies on selective PCR amplification can be used in conjunction with the present invention. The oligonucleotides used as primers for specific amplification can carry the mutation or polymorphic region of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al., (1989) Nucleic Acids Res. , 17: 2437-2448) or at the 3 'end of a primer where, under appropriate conditions, it can prevent or reduce extension by polymerase (Prossner (1993) Tibtech., 11: 238. Furthermore, it may be desirable to introduce a new restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al., (1992) Mol. Cell Probes, 6: 1). It is anticipated that in certain embodiments amplification can also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA, 88: 189). In such cases, ligation will occur only if there is a perfect match at the 3 'end of the 5' sequence that makes it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.

ES 2 356 167 T3

In another embodiment the identification of the allelic variant is carried out using an oligonucleotide ligation assay (hereinafter abbreviated OLA for Oligonuclotide Ligation Assay), as described, for example, in US Pat. No. 4,998,617 and in Landegren, U. et al., ((1988) Science, 241: 10771080). The OLA protocol uses two oligonucleotides that are designed to be capable of hybridizing to contiguous single-stranded sequences of a target. One of the oligonucleotides binds to a cleavage marker, eg, biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their ends are contiguous and create a ligation substrate. Ligation then allows the labeled oligonucleotide to be recovered using avidin or another biotin ligand. Nickerson, DA et al., have described a nucleic acid detection assay that combines the attributes of PCR and OLA (Nickerson, DA et al., (1990) Proc. Natl. Acad. Sci. USA, 87: 8923-27) . In this method, PCR is used to achieve exponential amplification of the target DNA, which is then detected using the OLA.

Several techniques based on this OLA method have been developed and can be used to detect alleles of a haplotype of the IL-1 locus. For example, US Patent No. 5,593,826 describes an OLA that uses an oligonucleotide having a 3'-amino group and a 5'-phosphorylated oligonucleotide to form a conjugate having a phosphoramidate bond. In another variation of the OLA described in Tobe et al., ((1996) Nucleic Acid Res., 24: 3728), the OLA combined with the PCR allows to determine the type of two alleles in a single microtiter well. By labeling each of the allele-specific primers with a unique hapten, i.e., digoxigenin and fluorescein, each OLA reaction can be detected using hapten-specific antibodies that are labeled with different enzyme reporters, alkaline phosphatase, or horseradish peroxidase. This system allows the detection of the two alleles using a high throughput format that leads to the production of two different colors.

Another embodiment of the invention is directed to kits for detecting a predisposition to develop restenosis. This kit may contain one or more oligonucleotides, including 5 'and 3' oligonucleotides that hybridize 5 'and 3' to at least one allele of a haplotype of the IL-1 locus. The oligonucleotides from the PCR amplification should hybridize between 25 and 2500 base pairs apart, preferably between about 100 and about 500 bases apart, to produce a PCR product of convenient size for subsequent analysis.

Primers particularly preferred for use in the diagnostic method of the invention include SEQ ID NO: 8-23 and 36-39.

The design of additional oligonucleotides for the amplification and detection of polymorphic alleles of IL-1 by the method of the invention is facilitated by the availability of both updated information on human chromosome 2q13 sequences - which contain the human IL-1 locus-, as well as of updated information on human polymorphisms available for this locus. For example, the DNA sequence for IL-1A, IL-1B, and IL-1RN is shown in Figures 1 (GenBank Accession No. X03833), 2 (GenBank Accession No. X04500) and 3 (GenBank Accession No. X04500). access in GenBank X64532) respectively. Suitable primers for the detection of a human polymorphism in these genes can be readily designed using sequence information and standard methods known in the art for primer sequence design and optimization. Optimal design of such primer sequences can be achieved, for example, by using commercially available primer selection programs, such as Primer

2.1, Primer 3 or GeneFisher (see also, Nicklin MHJ, Weith A. Duff GW, “A Physical Map of the Region Encompassing the Human Interleukin-1 a, interleukin-1e, and Interleukin-1 Receptor Antagonist Genes” Genomics, 19: 382 (1995); Nothwang HG, et al., "Molecular Cloning of the Interleukin-1 gene Cluster: Construction of an Integrated YAC / PAC Contig and a partial transcriptional Map in the Region of Chromosome 2q13" Genomics, 41: 370 (1997) Clark, et al., (1986) Nucl. Acids. Res., 14: 7897-7914 [the list of published errata appears in Nucl. Acids Res., 15: 868 (1987) and the Genome Database (GDB) project at URL http://www.gdb.org).

For use in a kit, the oligonucleotides can be of any variety of natural and / or synthetic compositions, such as synthetic oligonucleotides, restriction fragments, cDNAs, synthetic peptide nucleic acids (PNAs for Peptide Nucleic Acids). ), and the like. The assay kit and method may also employ labeled oligonucleotides to allow easy identification in assays. Examples of tags that can be employed include radio tags, enzymes, fluorescent compounds, streptavidin, avidin, biotin, magnetic moieties, metal-binding moieties, antigen or antibody moieties, and the like.

The kit can optionally also include DNA sampling means. DNA sampling media are well known to those of skill in the art and may include, but are not limited to, substrates, such as filter papers, the AmpliCard ™ (University of Sheffield, Sheffield, England S10 2JF; Tarlow, JW, et al. al., J. of Invest. Dermatol., 103: 387-389 (1994)) and the like; DNA purification reagents, such as Nucleon ™ kits, lysis buffers, proteinase solutions, and the like; PCR reagents, such as 10-fold reaction buffers, thermostable polymerase, dNTP, and the like; and allele detection means, such as Hinfl restriction enzyme, allele-specific oligonucleotides, degenerate oligonucleotide primers for nested dried blood PCR.

4.2.3. Pharmacogenomics

Knowledge of the particular alleles associated with a sensitivity to developing a particular disease or condition, alone or in association with information about other genetic defects that contribute to the particular disease or condition allows for the personalization of prevention or treatment according to the profile genetic of

ES 2 356 167 T3 individual, and this is what constitutes the object of "pharmacogenomics". Thus, comparison of an individual IL1 profile with the population profile for a vascular disorder allows the selection or design of drugs or other therapeutic regimens that are expected to be safe and effective for a particular patient or patient population ( that is, a group of patients who have the same genetic alteration).

In addition, the ability to target populations that are expected to show the highest clinical benefit, based on genetic profiling, can facilitate: 1) repositioning of already marketed drugs; 2) the rescue of drug candidates whose clinical development has been interrupted as a result of safety or efficacy limitations, which are specific to a sub-group of patients; and 3) less expensive and accelerated development for candidate therapeutic agents and more optimal drug labeling (eg, since measuring the effect of various doses of an agent on the causative mutation is useful to optimize the effective dose).

Treatment of an individual with a particular therapeutic agent can be monitored by determining the protein (eg, IL-1a, IL-1j6, or IL-1Ra), mRNA, and / or level of transcription. Depending on the level detected, the therapeutic regimen can be maintained or adjusted later (increasing or decreasing the dose). In a preferred embodiment the efficacy of treating a subject with an agent comprises the steps of: (i) obtaining a sample for pre-administration to a subject prior to administration of the agent; (ii) detect the level or amount of a protein, mRNA or genomic DNA in the sample for pre-administration; (iii) obtaining one or more samples from the subject for post-administration; (iv) detect the level of expression or activity of the protein, mRNA or genomic DNA in the administration sample; (v) comparing the level of expression or activity of the protein, mRNA or genomic DNA in the pre-administration sample with the corresponding protein, mRNA or genomic DNA in the post-administration sample, respectively; and (vi) consequently altering the administration of the agent to the subject.

Cells from a subject can also be obtained before and after administration of a therapeutic agent to detect the level of expression of genes other than the IL-1 gene to verify that the therapeutic agent does not increase or decrease the expression of genes that could be harmful. This can be done, for example, using the method of transcriptional profiling. Therefore, mRNA from cells exposed in vivo to a therapeutic agent and mRNA from the same type of cells that were not exposed to the therapeutic agent could be reversed, transcribed, and hybridized to a chip containing DNA from numerous genes for comparison. thereby the expression of genes in cells treated and not treated with the therapeutic agent.

4.3.- Therapeutic agents for diseases and conditions associated with IL-1 polymorphisms

Therapeutic agents for diseases or conditions associated with an IL-1 polymorphism or haplotype refer to any agent on a therapeutic regimen (including pharmaceuticals, nutritional products, and surgical means) that prevents or postpones the development of symptoms or their relief from the particular disease or condition in the subject. The therapeutic agent can be a polypeptide, peptidomimetic, nucleic acid, or other organic or inorganic molecule, preferably a "small molecule" that includes vitamins, minerals, and other nutrients. Preferably the therapeutic agent can modulate at least one activity of an IL-1 polypeptide, eg, interacting with a receptor, mimicking or potentiating (agonizing) or inhibiting (antagonizing) the effects of a naturally occurring polypeptide. An agonist can be a wild-type protein or a derivative thereof that has at least one wild-type bioactivity, eg, receptor-binding activity. An agonist can also be a compound that up-regulates the expression of a gene or increases at least one bioactivity of a protein. An agonist can also be a compound that increases the interaction of a polypeptide with another molecule, for example, a receptor. An antagonist can be a compound that inhibits or decreases the interaction between a protein and another molecule, for example, a receptor or an agent that blocks signal transduction or post-translational processing (for example, the 1L-1 (ICE) Accordingly, a preferred antagonist is a compound that inhibits or decreases binding to a receptor and thereby blocks subsequent activation of the receptor. An antagonist can also be a compound that down-regulates the expression of a gene or that reduces the amount of a protein present. The antagonist can be a dominant negative form of a polypeptide, eg, a form of a polypeptide that is capable of interacting with a target peptide, eg, a receptor, but does not promote activation of the receptor. The antagonist can also be a nucleic acid encoding a dominant negative form of a polypeptide, an antisense nucleic acid, or a ribozyme capable of specifically interacting with an RNA. Even other antagonists are molecules that bind to a polypeptide and inhibit its action. Such molecules include peptides, for example, forms of target peptides that have no biological activity, and that inhibit binding to receptors. Thus, such peptides will bind to the active site of a protein and prevent interaction with the target peptides. Still other antagonists include antibodies that specifically interact with an epitope on a molecule, such that binding interferes with the biological function of the polypeptide. In another preferred embodiment, the antagonist is a small molecule, such as a molecule capable of inhibiting the interaction between a polypeptide and a target receptor. Alternatively, the small molecule can function as an antagonist by interacting with sites other than the receptor binding site.

Modulators of IL-1 (eg, 1L-1a, IL-1/1, or IL-1 receptor antagonist) or a protein encoded by a gene that is in linkage disequilibrium with an IL-1 gene may comprise any type of compound, including a protein, peptide, peptidomimetic, small molecule, or nucleic acid. Preferred agonists include nucleic acids (eg, those that encode an IL-1 protein or a gene that is up- or downregulated by an IL-1 protein), proteins (eg, IL-1 proteins or a protein that is over-regulated). or under-regulated) or

ES 2 356 167 T3 a small molecule (for example, that regulates the expression or binding of an IL-1 protein). Preferred antagonists that can be identified, for example, using the assays described herein, include nucleic acids (eg, single-stranded DNA (antisense) or double-stranded DNA or PNA (triplex) and ribozymes), protein (eg antibodies) and small molecules that act to suppress or inhibit IL-1 transcription and / or protein activity.

4.3.1. Effective dose

The toxicity and therapeutic efficacy of said compounds can be determined by standard pharmaceutical methods in cell cultures or experimental animals, for example, to determine the LD.₅₀ (the lethal dose for 50% of the population) and the ED₅₀ (the therapeutically effective dose in 50% of the population). The dose relationship between toxic and therapeutic effects is the therapeutic index and can be expressed as LD₅₀/OF₅₀. Compounds that exhibit large therapeutic indices are preferred. Although compounds that exhibit toxic side effects can be used, care must be taken to design a delivery system that targets such compounds to the site of affected tissues in order to minimize potential damage to uninfected cells and thereby reduce the effects. secondary.

Data obtained from cell culture assays and animal studies can be used in formulating a range of dosages for use in humans. The dosage of such compounds is preferably within circulating concentrations that include ED.₅₀ with little or no toxicity. The dosage may vary within this range depending on the dosage form used and the route of administration used. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. In animal models, a dose can be formulated to achieve a range of circulating plasma concentration that includes the IC.₅₀ (ie, the concentration of the test compound that achieves semi-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more precisely determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

4.3.2. Formulation and use

Compositions for use in accordance with the present disclosure may be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. Thus, the compounds and their physiologically acceptable salts and solvates can be formulated for administration, for example, injection, inhalation or insufflation (through the mouth or nose) or oral, buccal, parenteral or rectal administration.

For such therapy the compounds of the invention can be formulated for a variety of administration loads, including systemic and topical or localized administration. Techniques and formulations can generally be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA. For systemic administration injection is preferred, including intramuscular, intravenous, intraperitoneal and subcutaneous. For injection, the compounds of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers, such as Hank's solution or Ringer's solution. In addition, the compounds can be formulated in solid form and re-dissolved or suspended immediately before use. Also included are lyophilized forms.

For oral administration the compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients, such as binding agents (for example, pregelatinized cornstarch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (eg, lactose, microcrystalline cellulose, or calcium hydrogen phosphate); lubricants (eg, magnesium stearate, talc, or silica); disintegrants (eg potato starch or sodium starch glycolate); or wetting agents (eg sodium lauryl sulfate). The tablets can be coated by methods well known in the art. Liquid preparations for oral administration can take the form of, for example, solutions, syrups or suspensions or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives, such as suspending agents (eg, sorbitol syrup, cellulose derivatives, or edible hydrogenated fats). Emulsifying agents (eg, lecithin or gum acacia); non-aqueous vehicles, (eg, almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils); and preservatives (eg, methyl or propyl p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.

Preparations for oral administration can be suitably formulated to give a controlled release of the active compound. For buccal administration the compositions may be in the form of tablets or pills formulated in the usual way. For administration by inhalation, the compounds for use in accordance with the present invention are conveniently delivered in aerosol spray presentation form, from pressurized containers or a nebulizer, with the use of a suitable propellant gas, eg, dichlorodifluoromethane, trichlorofluoromethane , dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. In the case of a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered quantity. The

ES 2 356 167 T3 capsules and cartridges of, for example, gelatin for use in an inhaler or insufflator can be formulated containing a mixture of powders and a suitable powder base, such as lactose or starch.

The compounds can be formulated for parenteral administration by injection, eg, bolus injection or continuous infusion. Formulations for injection may be presented in unit dose form, for example, in ampoules or in multidose containers, with an added preservative. The compositions may take the form of suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain suspension formulation agents, such as suspending, stabilizing and / or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, eg, sterile pyrogen-free water, before use.

The compounds can also be formulated into rectal compositions, such as suppositories or retention enemas, for example, containing customary suppository bases, such as coconut butter or other glycerides.

In addition to the formulations previously described, the compounds can also be formulated as a sustained release preparation. Such long-acting formulations can be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds can be formulated with polymeric or hydrophobic materials (eg, as an emulsion in an acceptable oil) or ion exchange resins or as sparingly soluble derivatives, eg, as a sparingly soluble salt. Other suitable delivery systems include microspheres that offer the possibility of local non-invasive drug delivery over an extended period of time. This technology uses pre-capillary size microspheres that can be injected through a coronary catheter into any selected part, for example the heart or other organs, without causing inflammation or ischemia. The administered therapeutic agent is slowly released from these microspheres and is taken up by surrounding tissue cells (eg, endothelial cells).

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrating agents appropriate to the barrier to be permeated are used in the formulation. Such penetrating agents are generally known in the art, and include, for example, bile salts and fusidic acid derivatives for transmucosal administration. In addition, detergents can be used to facilitate permeation. Transmucosal administration can be through nasal sprays or using suppositories. For topical administration the oligomers of the invention are formulated into ointments, balms, gels or creams as is generally known in the art. A scrub solution can be used locally to treat injury or inflammation to speed healing.

The compositions can be presented, if desired, in a container or dispensing device that can contain one or more unit dosage forms containing the active ingredient. The container or dispensing device may be accompanied by instructions for administration.

4.4 Analysis to identify therapeutic agents

Based on the identification of mutations that cause or contribute to the development of a disease or disorder that is associated with an IL-1 polymorphism or haplotype, the invention is further characterized by cell-based or cell-free assays to identify therapeutic agents. In one embodiment, a cell that expresses an IL-1 receptor, or a receptor for a protein that is encoded by a gene that is in linkage disequilibrium with an IL-1 gene, On the outer surface of its cell membrane, it is incubated in the presence of a test compound alone or in the presence of a test compound and another protein and the interaction between test compound and the receptor or between the protein (preferably a designated protein) is detected. as a target) and the receptor, for example, using a microphysiometer (McConnell et al., (1992) Science, 257: 1906).

An interaction between the receptor and the test compound or the protein is detected by the microphysiometer as a change in the acidity of the medium. This assay system thus provides a means of identifying molecular antagonists that, for example, work by interference with protein-receptor interaction, as well as molecular agonists that, for example, work by activating a receptor.

Cellular or cell-free assays can also be used to identify compounds that modulate the expression of an IL-1 gene or a gene in linkage disequilibrium with it, modulate the translation of an mRNA, or that modulate the stability of an mRNA or protein. Accordingly, in one embodiment, a cell that is capable of producing an IL-1 or other protein is incubated with a test compound and the amount of protein produced in the cell medium is measured and compared to that produced by a cell. that it has not been in contact with the test compound. The specificity of the compound against the protein can be confirmed by various control tests, for example, by measuring the expression of one or more control genes. In particular, this assay can be used to determine the efficacy of antisense compounds, ribozymes, and triplexes.

Cell-free assays can also be used to identify compounds that are capable of interacting with a protein, thereby modifying the activity of the protein. Such a compound can modify, for example, the structure of a protein by affecting its ability to bind to a receptor. In a preferred embodiment, the analyzes

ES 2 356 167 T3 cell-free to identify such compounds consist essentially of a reaction mixture containing a protein and a test compound or a library of test compounds in the presence or absence of a binding partner. A test compound can be, for example, a derivative of a binding partner, for example, a biologically inactive target peptide or a small molecule.

Accordingly, an illustrative screening analysis of the present disclosure includes the steps of contacting a protein or one of its functional fragments with a test compound or library of test compounds and detecting complex formation. For screening purposes, the molecule can be tagged with one specific marker and the test compound or library of test compounds tagged with a different marker. The interaction of a test compound with a protein or one of its fragments can then be detected by determining the level of the two labels after an incubation step and a washing step. The presence of the two markers after the washing step is indicative of an interaction.

An interaction between molecules can also be identified using a biomolecular interaction analysis (hereinafter BIA for the English term Biomolecular Interaction Analysis), from Pharmacia Biosensor AB, in real time that detects surface plasmon resonance (SPR = Surface Plasmon Resonance) an optical phenomenon. Detection depends on changes in the mass concentration of macromolecules at the biospecific interface, and does not require any labeling of the interacting entities. In one embodiment, a library of test compounds can be immobilized on a sensing surface, eg, which forms a wall that forms a micro-flow cell. A solution containing the protein or one of its functional fragments is then continuously flowed over the sensing surface. A change in the resonance angle as shown in the signal log indicates that an interaction has occurred. This technique is described, for example, in the BlAtechnology Handbook by Pharmacia.

Another illustrative screening assay of the present disclosure includes the steps of: (a) forming a reaction mixture that includes: (i) an IL-1 or other protein, (ii) an appropriate receptor, and (iii) a test compound; and (b) detecting an interaction of the protein and the receptor. A statistically significant change (enhancement or inhibition) in the interaction of the protein and the receptor in the presence of the test compound, relative to the interaction in the absence of the test compound, indicates a potential antagonism (inhibitor). The compounds of this analysis can be contacted simultaneously. Alternatively, a protein can first be contacted with a test compound for an appropriate amount of time, after which the receptor is added to the reaction mixture. The efficacy of the compound can be determined by generating dose-response curves from the data obtained using various concentrations of the test compound. In addition, a control analysis can be performed to provide a baseline for comparison.

The formation of a complex between a protein and a receptor can be detected by a variety of techniques. Modulation of complex formation can be quantified using, for example, detectably tagged proteins, such as radiolabeled, fluorescently or enzymatically tagged proteins or receptors, by immunoassay or by chromatographic detection.

Typically, it will be desirable to immobilize the protein or receptor to facilitate the separation of uncomplexed complex forms of one or both of the proteins, as well as to accommodate automation of the assay. The binding of the protein and the receptor can be achieved in any suitable container to contain the reactants. Examples include microtiter plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided that adds a domain that allows the protein to be bound to a matrix. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione Sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtiter plates, which are then combined with the receptor, for example , a receptor labeled with³⁵S, and the test compound, and the mixture is incubated under conditions conducive to complex formation, for example under physiological conditions for salt and pH, although it may be desirable, under slightly more stringent conditions. Following incubation, the beads are washed to remove unbound tag, and the immobilized and radiolabeled matrix is ​​determined directly (for example, by placing the beads in a flashing device), or in the supernatant after the complexes are subsequently dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the protein or receptor level found in the bead fraction quantified from the gel using standard electrophoretic techniques, such as those described in the accompanying examples. Other techniques for immobilizing proteins on arrays are also available for use in relevant analysis. For example, the protein or receptor can be immobilized using conjugation of biotin and streptavidin. Transgenic animals can also be obtained to identify agonists and antagonists or to confirm the safety and efficacy of a candidate therapeutic agent. Transgenic animals of the invention can include non-human animals that contain a restenosis-causing mutation under the control of an appropriate endogenous promoter or under the control of a heterologous promoter.

Transgenic animals can also be animals that contain a transgene, such as a reporter gene, under the control of an appropriate promoter or one of its fragments. These animals are useful, for example, to identify drugs that modulate the production of an IL-1 protein, that is, by modulating the expression of the gene. Methods for obtaining non-human transgenic animals are well known in the art. In preferred embodiments, the expression of the restenosis-causing mutation is restricted to specific subsets of cells, tissues, or stages of development using, for example, cis-acting sequences that control expression in the model.

ES 2 356 167 T3 desired. In the present invention, such mosaic expression of a protein may be essential for many forms of lineage analysis and may additionally provide a means to determine the effects of, for example, the level of expression that could grossly alter development in small patches of tissue within an otherwise normal embryo. For this purpose, tissue-specific regulatory sequences and conditional regulatory sequences can be used to control the expression of the mutation in certain spatial patterns. In addition, temporal patterns of expression can be provided, for example, conditional recombination systems or prokaryotic transcriptional regulatory sequences. Genetic techniques, which allow the expression of a mutation to be regulated by site-specific genetic manipulation in vivo, are known to those of skill in the art.

The transgenic animals described all include within a plurality of their cells a transgene of the causative mutation, which alters the phenotype of the "host cell". In an illustrative embodiment, the bacteriophage P1 cre / IoxP recombinase system can be used (Lakso et al., (1992) PNAS, 89: 6232-6236; Orban et al., (1992) PNAS, 89: 6861-6865) or the Saccharomyces cerevisiae FLP recombinase system (O'Gorman et al., (1991) Science, 251: 1351-1355; PCT publication WO 92/15694) to generate site-specific genetic recombination systems in vivo. Cre recombinase catalyzes the site-specific recombination of an intercalated target sequence located between loxP sequences. The loxP sequences are 34 base pair nucleotide repeat sequences to which Cre recombinase binds and are required for Cre recombinase-mediated genetic recombination. The orientation of the loxP sequences determines whether the intercalated target sequence is cleaved or inverted when Cre recombinase is present (Abremski et al., (1984) J. Biol. Chem. 259: 1509-1514); catalyzing the cleavage of the target sequence when loxP sequences are oriented as direct repeats and catalyzes reversal of the target sequence when loxP sequences are oriented as reverse repeats.

Consequently, the genetic recombination of the target sequence is dependent on the expression of the Cre recombinase. The expression of the recombinase can be regulated by promoter elements that are subject to regulatory control, for example, specific to the stage of tissue development, inducible or repressible by externally added agents. This regulated control will result in genetic recombination of the target sequence only in cells where the expression of the recombinase is mediated by the promoter element. Thus, the activation of the expression of the causative mutation transgene can be regulated by controlling the expression of the recombinase.

The use of the cre / loxP recombinase system to regulate the expression of a causative transgene requires the construction of a transgenic animal that contains the transgenes encoding both the Cre recombinase and the relevant protein. Animals containing both the Cre recombinase and the restenosis-causing mutation transgene can be obtained through the construction of "double" transgenic animals. A convenient method of obtaining such animals is to mate two transgenic animals each containing one transgene.

Similar conditional transgenes can be provided using prokaryotic promoter sequences that require prokaryotic proteins to be simultaneously expressed to facilitate expression of the transgene. Illustrative promoters and corresponding transactivating prokaryotic proteins are given in US Patent No. 4,833,080.

Furthermore, the expression of conditional transgenes can be induced by methods similar to gene therapy wherein a gene encoding the transactivating protein, for example a recombinase or a prokaryotic protein, is delivered to the tissue and caused to be expressed, such as as in a cell type specific mode. By this method, the transgene could remain silent in an adult until it is "turned on" by introducing the transactivator.

In an illustrative embodiment, the "transgenic non-human animals" of the invention are obtained by introducing transgenes into the germ line of the non-human animal. Embryonic target cells at various stages of development can be used to introduce transgenes. Different methods are used depending on the developmental stage of the embryonic target cell. The specific line (s) of any non-human animal used to carry out this invention are selected to achieve good general health, good embryo yield, good pronuclear visibility in the embryo, and good fitness. reproductive. Furthermore, the haplotype is a significant factor. For example, when transgenic mice are to be obtained, strains such as the C57BL / 6 or FVB lines (Jackson Laboratory, Bar Harbor, ME) are frequently used. Preferred breeds are those with H-2b, H-2d, or H-2q haplotypes, such as C57BL / 6 or DBA / 1. The line (s) used to carry out this invention may be itself (s) transgenic (s) and / or may be deactivated (that is, obtained animals that have one or more genes partially or completely suppressed).

In one embodiment, the transgenic construct is introduced into a single stage embryo. The zygote is the best target for micro-injection. In the mouse, the male pronucleus reaches the size of approximately 20 microns in diameter which allows the reproducible injection of 1-2 µl of DNA solution. The use of zygotes as a target for gene transfer has the main advantage that in most cases the injected DNA will be incorporated into the host gene before the first cleavage (Brinster et al., (1985) PNAS, 82: 4438 -4442). Consequently, all cells of the transgenic animal will carry the incorporated transgene. This will also generally be reflected in the efficient transmission of the transgene to the offspring of the founder animal, since 50% of the germ cells will harbor the transgene.

ES 2 356 167 T3

Normally, fertilized embryos are incubated in suitable media until pronuclei appear. At about that time, the nucleotide sequence comprising the transgene is introduced into the female or male pronucleus as described below. In some species such as mice, the male pronucleus is preferred. It is best preferred that the exogenous genetic material is added to the complement of male DNA of the zygote before it is processed by the nucleus of the ovule or the female pronucleus of the zygote. The ovule nucleus or female pronucleus is known to release molecules that affect the complement of male DNA, perhaps substituting histones for the protamines of the male DNA, thereby facilitating the combination of the female and male DNA complements to form the diploid zygote. Thus, it is preferred that the exogenous genetic material is added to the male DNA complement or any other DNA complement before it is affected by the female pronucleus. For example, exogenous genetic material is added to the male pronucleus early, as soon as possible after the formation of the male pronucleus, which is when the male and female pronuclei are well separated and both are located close to the cell membrane. Alternatively, exogenous genetic material could be added to the sperm nucleus after it has been induced to undergo decondensation. The sperm containing the exogenous genetic material can then be added to the egg or the decondensed sperm could be added to the egg with the transgenic constructs added as soon as possible.

Introduction of the transgenic nucleotide sequence into the embryo can be accomplished by any means known in the art, such as, for example, micro-injection, electroporation, or lipofection. After the introduction of the transgenic nucleotide sequence into the embryo, said embryo can be incubated in vitro for various periods of time or reimplanted in the surrogate host or both techniques. In vitro incubation to maturity is within the scope of this invention. A common method is to incubate the embryos in vitro for about 1-7 days, depending on the species, and then reimplant them into the surrogate host.

For the purposes of this invention, a zygote is essentially the formation of a diploid cell that is capable of becoming a complete organism. Generally, the zygote will comprise an egg that contains a nucleus formed, naturally or artificially, by the fusion of two haploid nuclei derived from a gamete or gametes. Therefore, the nuclei of the gametes must be naturally compatible, that is, they must result in a viable zygote capable of undergoing differentiation and becoming a functional organism. In general, an euploid zygote is preferred. If an aneuploid zygote is obtained, then the number of chromosomes should not vary by more than one from the euploid number of the organism from which each gamete originated.

In addition to similar biological considerations, physical ones also govern the amount (eg, volume) of exogenous genetic material that can be added to the nucleus of the zygote or to the genetic material that forms a part of the nucleus of the zygote. If genetic material is not removed, then the amount of exogenous genetic material that can be added is limited by the amount that will be absorbed without being physically harmful. In general, the volume of exogenous genetic material inserted will not exceed about 10 picoliters. The physical effects of addition should not be so great that they physically destroy the viability of the zygote. The biological limit to the number and variety of DNA sequences will vary depending on the particular zygote and the functions of the exogenous genetic material and will be readily apparent to those skilled in the art, because the genetic material, including the exogenous genetic material, of the zygote The resultant must be biologically capable of initiating and maintaining zygote differentiation and development in a functional organism.

The number of copies of the transgenic constructs added to the zygote is dependent on the total amount of exogenous genetic material added and will be the amount that allows genetic transformation to take place. Theoretically, only one copy is required; however, generally, numerous copies, eg 1,000-20,000 copies of the transgenic construct are used in order to ensure that the copy is functional. As regards the present invention, it will often be an advantage to have more than one functional copy of each of the inserted exogenous DNA sequences to enhance the phenotypic expression of the exogenous DNA sequences.

Any technique that allows the addition of exogenous genetic material to the nucleic genetic material can be used as long as it is not destructive to the cell, the nuclear membrane or other existing cellular or genetic structures. The exogenous genetic material is preferably inserted into the nucleic genetic material by micro-injection. Micro-injection of cells and cell structures is known and used in the art.

Reimplantation is accomplished using standard methods. Generally, the surrogate host is anesthetized and the embryos are inserted into the oviduct. The number of embryos implanted in a particular host will vary by species, but will generally be comparable to the number of offspring that species naturally produce.

The transgenic offspring of the surrogate host can be screened for the presence and / or expression of the transgene by any suitable method. Selection is often done by Southern blot or Northern blot analysis, using a probe complementary to at least a portion of the transgene. Western blot analysis using an antibody against the protein encoded by the transgene can be employed as an alternative or additional method to screen for the presence of the transgenic product. Typically, DNA is prepared from the tail tissue and analyzed by Southern analysis or by PCR to determine the transgene. Alternatively, tissues or cells believed to express the transgene at higher levels are analyzed for the presence and expression of the transgene using Southern analysis or PCR, although any tissues or cell types can be used for this analysis.

ES 2 356 167 T3

Alternative or additional methods for evaluating the presence of the transgene include, without limitation, suitable biochemical assays, such as enzyme and / or immunological assays, histological strains to detect a particular marker or enzyme activities, flow cytometric analysis, and the like. Blood analysis can also be useful in detecting the presence of the transgenic product in the blood, as well as in evaluating the effect of the transgene on the levels of various types of blood cells and other constituents of the blood.

Progeny of transgenic animals can be obtained by mating the transgenic animal with a suitable mate, or by in vitro fertilization of eggs and / or sperm obtained from the transgenic animal. When mating with a partner, said partner may or may not be transgenic and / or inactivated; if it is transgenic, it may contain the same or different transgenes or both. Alternatively, the couple can be a parental line. If in vitro fertilization is used, the fertilized embryo can be implanted into a surrogate host or incubated in vitro, or both. Using any method, the progeny can be evaluated for the presence of the transgene by applying the methods described above or other appropriate methods.

Transgenic animals produced in accordance with the present invention will include exogenous genetic material. Furthermore, in such embodiments the sequence will be linked to a transcriptional control element, eg, a promoter, which preferably allows expression of the transgenic product in a specific type of cell.

Retroviral infection can also be used to introduce the transgene into a non-human animal. The developing non-human embryo can be cultured in vitro to the blastocyst stage. During this time, blastomeres can be targets for retroviral infection (Jaenich, R. (1976) PNAS 73: 1260-1264). Effective blastomere infection is obtained by enzymatic treatment to remove the zona pellucida (Manipulating the Mouse Embryo, Hogan eds. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1986). The viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al., (1985) PNAS, 82: 6927-6931; Van der Putten et al., (1985) pNaS, 82 : 6148-6152). Transfection is easily and efficiently obtained by growing the blastomers on a virus-producing cell monolayer (Van der Putten, supra; Stewart et al., (1987) EMBO J., 6: 383-388). Alternatively, the infection can be carried out at a later stage. The virus or virus-producing cells can be injected into the blastocele (Jahner et al., (1982) Nature, 298: 623-628). Most of the founders will be mosaics for the transgene since incorporation only occurs in a subset of cells that made up the non-human transgenic animal. Furthermore, the founder may contain various retroviral insertions of the transgene at different positions in the genome that will generally segregate in the offspring. On the other hand, it is also possible to introduce the transgenes into the germ line by intrauterine retroviral infection of the embryo in mid-gestation (Jahner et al., (1982) supra).

A third type of target cell for the introduction of transgenes is the embryonic stem cell. Embryonic stem cells are obtained from preimplantation embryos grown in vitro and fused with embryos (Evans et al., (1981) Nature, 292: 154-156; Bradley et al., (1984) Nature, 309: 255- 258; Gossler et al., (1986) PNAS, 83: 9065-9069; and Robertson et al., (1986) Nature, 322: 445-448). Transgenes can be efficiently introduced into stem cells by DNA transfection or retrovirus-mediated translation. Said transformed embryonic stem cells can then be combined with blastocysts from a non-human animal. The stem cells then colonize the embryo and contribute to the germ line of the resulting chimeric animal. See a review by Jaenisch, R. (1988) in Science, 240: 1468-1474.

The present invention is further illustrated by the following examples which are not to be construed as limiting in any way. The contents of all cited references (including bibliographic references, granted patents, and published patent applications cited throughout this application) are expressly incorporated by reference. The practice of the present invention will employ, unless otherwise indicated, conventional methods that are included in the art. These methods are fully explained in the literature. See, for example, Molecular Cloning A Laboratory Manual, (2nd ed., Sambrook, Fritsch and Maniatis, eds., Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (DN Glover ed., 1985); Oligonucleotide Synthesis (MJ Gait ed., 1984); US Pat. No. 4,683,195; US Patent No. 4,683,202; and Nucleic Acid Hybridization (BD Hames &amp; SJ Higgins eds., 1984).

5. Examples

Example 1

Genotyping

All human subjects were healthy, white, unrelated blood donors from Sheffield (n = 112). Subjects were typed at the loci indicated in Table 1.

ES 2 356 167 T3

TABLE 2

Markers used in the study of the haplotype

<td>Marker</td><td>Gen</td><td>Reference</td>

<td> 222/223</td><td>IL1A</td><td>Todd &amp; Naylor, Nucleic Acids Res. 19: 3756 (1991)</td>

<td>gz5 / gz6</td><td>IL1A</td><td>Zuliani, et al., Am. J. Hum. Genet. 46: 963-69 (1990)</td>

<td> -889</td><td>IL1A</td><td>McDowell, et al., Arth. &amp; Rheum. 38: 221-8 (1995)</td>

<td> +3954</td><td>IL1B</td><td>di Giovine, et al., Cytokine 7 (6): 606 (1995)</td>

<td> -511</td><td>IL1B</td><td>di Giovine, Hum. Molec. Genet. 1 (6): 450 (1992)</td>

<td>gaat.p33330</td><td>between IL1B and IL1RN</td><td>Murray, et al., Coop. Hum. Link. Center, unpublished</td>

<td>Y31</td><td>between IL1B and IL1RN</td><td>Spurr, et al., Cytogenet. &amp; Cell Genet. 73: 255-73 (1996)</td>

<td>VNTR</td><td>IL1RN</td><td>Tarlow, et al., Hum. Genet. 91: 403-4 (1993)</td>

The sequences of the primers and fluorescent tags used in the PCR amplification of the markers are shown in Table 3.

TABLE 3

Primer sequence and fluorescent tag for genotyping

<td>Marker</td><td>Label</td><td>Primer sequence</td>

<td> 222/223</td><td>HEX</td><td>ATGTATAGAATTCCATTCCTG (SEQ ID NO. 8)</td>

<td></td><td></td><td>TAAAATCAAGTGTTGATGTAG (SEQ ID NO. 9)</td>

<td>gz5 / gz6</td><td>FAM</td><td>GGGA7TACAGGCGTGAGCCACCGCG (SEQ ID NO. 10)</td>

<td></td><td></td><td>TTAGTATTGCTGGTAGTATTCATAT (SEQ ID NO. 11)</td>

<td> -889</td><td>NONE</td><td>TGTTCTACCACCTGAACTAGG (SEQ ID NO. 12)</td>

<td></td><td></td><td>TTACATATGAGCCTTCCATG (SEQ ID NO. 13)</td>

<td> +3954</td><td>NONE</td><td>CTCAGGTGTCCTCGAAGAAATCAAA (SEQ ID NO. 14)</td>

<td></td><td></td><td>GCTTTMGCTGTGAGTCCCG (SEQ ID NO. 15)</td>

<td> -511</td><td>NONE</td><td>TGGCATTGATCTGGTTCATC (SEQ ID NO. 16)</td>

<td></td><td></td><td>GTTTAGGAATCTTCCCACTT (SEO ID NO. 17)</td>

<td>gaat.p33330</td><td>FAM</td><td>GAGGCGTGAGAATCTCAAGA (SEQ ID NO. 18)</td>

<td></td><td></td><td>GTGTCCTCAAGTGGATCTGG (SEQ 10 NO. 19)</td>

<td>Y31</td><td>HEX</td><td>GGGCAACAGAGCAATGTTTCT (SEQ ID NO. 20)</td>

<td></td><td></td><td>CAGTGTGTCAGTGTACTGTT (SEQ ID NO. 21)</td>

<td>VNTR</td><td>NONE</td><td>CTCAGCAACACTCCTAT (SEQ ID NO. 22)</td>

<td></td><td></td><td>TCCTGGTCTGCAGGTAA (SEQ ID NO. 23)</td>

<td> -1468</td><td>NONE</td><td>CCT ATT TCC CTC GTG TCT CAA ATA CT (SEQ ID NO: 36)</td>

<td></td><td></td><td>TCA AAT TAG TAT GTG CCA GGT ATC GT</td>

<td> -3737</td><td>NONE</td><td>CTA AGC CCT CCT TGT TCT AGA CCA</td>

<td></td><td></td><td>CTC TTG GAT CCA GGT TCT CAG ATT</td>

ES 2 356 167 T3

The reaction conditions were those included in Table 4.

TABLE 4

Reaction conditions

<td>Marker</td><td>Terms</td>

<td> 222/223</td><td>50 mM KCl, 10 mM Tris-HCl pH 9.0, MgCl₂1.5 mM, 200 mM dNTP, 25 ng of primers, 50 ng of template, 0.004% W-1 (Gibco-BRL) 0.2 u Taq, PCR was performed in 30 cycles of 94 ° C for 1.55 ° C for 1.72 ° C for 1</td>

<td>gz5 / gz6</td><td>as for marker 222/223, except that 1 u of Perfect Match (StrataGene) was added</td>

<td> -889</td><td>as for marker 222/223, except that the PCR was performed with 1 cycle at 96 ° C for 1.40 cycles of 94 ° C for 1.46 ° C for 1.72 ° C for 1 and 1 cycle of 72 ° C for 4, the products were cleaved with Ncol for analysis</td>

<td> +3954</td><td>as for marker 222/223, except that the PCR was performed in 35 cycles with annealing at 67.5 ° C, the products were cleaved with Taq 1 for analysis</td>

<td> -511</td><td>as for marker 222/223, except that PCR was performed in 1 cycle at 95 ° C for 2.35 cycles of 95 ° C for 1.53 ° C for 1.74 ° C for 1 and 1 cycle of 74 ° C for 4, the products were cleaved with Aval and Bsu361 for analysis</td>

<td>gaat.p33330</td><td>as for marker 222/223</td>

<td>Y31</td><td>as for marker 222/223</td>

<td>VNTR</td><td>as for marker 222/223, except with MgCI₂1.7 mM, 1 cycle at 96 ° C for 1; 30 cycles of 94 ° C for 1.60 ° C for 1.70 ° C for 1 and 1 cycle at 70 ° C for 2</td>

The PCR products 222/223, gz5 / gz6, gaat.p33330 and Y31 were examined by agarose gel electrophoresis and the rest of the PCR products were mixed according to the intensity of ethidium bromide staining. 2 g / L of the mixture was analyzed on an ABI 373A automated sequencer and allele sizes were determined using the Genescan and Genotyper computer program. Alleles were grouped globally using a simple computer program and numbered in order of size.

The -889 PCR products were digested with NcoI and the resulting fragments were size ordered by 8% PAGE. Allele 1 produces 83 and 16 bp fragments. Allele 2 produces a 99 bp fragment.

The +3954 PCR products were digested with the restriction enzyme Taq I. Allele 1 produces 97, 85 and 12 bp fragments and allele 2 produces 182 and 12 bp fragments.

The -511 PCR products were digested with Aval and Bsu36I and the fragments were size ordered by 8% PAGE. Allele 1 produces 190 and 114 bp fragments when digested with Aval and a 304 bp fragment when digested with Bsu36I. Allele 2 produces a 304 bp fragment when digested with Aval and 190 and 114 bp fragments when digested with Bsu36I.

The VNTR PCR products were sized by 2% agarose gel electrophoresis at 90V for 45 minutes. Allele 1 has 4 repeats and the PCR product has 412 bp, allele 2 has 2 repeats and the PCR product has 240 bp, allele 3 has 3 repeats and the PCR product has 326 bp, allele 4 has 4 repeats and the PCR product is 498 bp, allele 5 has 6 repeats, and the PCR product is 584 bp.

Intergenic distances were determined by estimation based on the insert sizes of the corresponding PAC clones from a set of contiguous clones spanning the IL-1 gene cluster (Nicklin, et al., Genomics 19: 382-4 (1994)). Intragenic distances were determined from the corresponding nucleotide sequence obtained from the GENBANK database.

ES 2 356 167 T3

Example 2

Method for estimating linkage disequilibrium

Since four of the markers studied in the present invention are multi-allelic, a preliminary analysis was performed to determine which allelic combinations between pairs of loci contributed to the greatest imbalance, so that the imbalance was not masked when alleles were grouped in biallelic systems. The EH program was used de Xie and Ott (Handbook of Human Genetic Linkage, 1994, John Hopkins University Press, 188-98), incorporated here by reference, to estimate the frequencies of haplotypes under H₀ (no linkage) and H, (allelic linkage allowed). The allele grouping strategy developed was found to have some advantages over commonly used methods, in that imbalance was detected between almost all marker combinations in pairs tested and there was good correlation between imbalance and physical distance.

More specifically, the EH program of Xie and Ott was used to determine the estimates of maximum probability of imbalance (Dj) between each combination of alleles in pairs, where D¡j = hij-p ^ qj are the frequencies for allele i in locus 1 and for allele j at locus 2 respectively, and h, is the frequency of haplotype ij. The program calculated the maximum probability values ​​for the frequencies of the haplotypes (and therefore frequencies of the alleles) under H₀ (no association) and the frequencies of the haplotypes under H, (allelic association allowed). For markers with more than two alleles, the EH estimate for allele frequencies is poorly related to the allele frequencies estimated directly in the sample population and therefore did not give any confidence to the estimates of Dij given. Therefore it was not necessary to group alleles of the multi-allelic markers in a biallelic system. Marker analysis in a biallelic format has the additional advantages that the annotation ^TOD_Y, p, and q, can be simplified into ^TOD, p and q respectively, where p and q are defined as the frequencies of the rarest alleles in both loci (in such a way that without loss of generality p α q α 0.5) and ad is the estimated imbalance between these alleles.

In a biallelic system, power is also much easier to determine using equations such as those detailed by Hill (Hill, Heredity, 33: 229-39 (1974)). Furthermore, the sign of ad becomes more informative, such that ad&gt; 0 when the rarest alleles are associated at each of the two loci and ad &lt;0 when the rare allele at a locus is associated with the common allele at the other locus.

Because the allele grouping method clearly affected the power to detect disequilibrium (Zouros, et al., Gent. 85: 543-50 (1977); Weir, et al., Gent. 88: 633-42 ( 1976)), a preliminary analysis was performed to ensure that the clustering did not mask the imbalance between subsets of alleles. In this analysis, or_ij = (O'ij-Ejj) // E_ij for each haplotype, where E_ij is the expected number of haplotypes ij assuming equilibrium (E_ij = 2n p_iqj, where n = number of individuals in the study) and O '_ij is a basic estimate for the observed haplotype count, determined as follows. All genotypes that could be unambiguously resolved were a counted haplotype. Each double heterozygote (i, i₂/ j, j₂) could be resolved into two possible sets of haplotypes, [iiJi, i₂j₂] or [iiJ₂, i₂jd. Using the haplotype frequencies estimated from the unambiguous haplotype count, the probability of each set was calculated and used as a "partial" count. Thus the ambiguous genotypes were also counted haplotypes and the total counts (ambiguous plus unambiguous) constituted the O '_ij used in δ, Once stabilized, the magnitude and sign of the o were used_ij to determine which allelic combination showed the greatest deviation from the null hypothesis of no association. This information was used to group alleles at multi-allelic loci in biallelic systems in order to use the EH program effectively.

In order to compare the degree of imbalance between different combinations of loci in pairs, an independent measure of the frequency of the imbalance ~ D, (the maximum possible imbalance ratio in the given direction) was calculated, where ~ D = AD / | D_max| (Thompson, et al., Am. J. Hum. Gent. 42: 113-24 (1988)). The relationship between p and q is such that p α q α 0.5, therefore it can be written that -pq α D α p (1-q), such that when ad &lt;0, D_max = -pq and when ad&gt; 0, D_max = p (1-q). The output of the EH program included logarithmic probabilities for the maximum values ​​of the low probability parameter H₀ and H_i, and since -2ln (L₀/ L₁) ~ X²₁, where L₀ and L_i are the probabilities under H₀ and H |, then the p-values ​​for each trial could be determined.

The asymptotic variances for ad, under H₀: D = 0 and H ,, were calculated using the formula defined by Hill (Heredity, 33: 229-39 (1974)) for genotypic data. Using them, the power could be calculated for each pairwise comparison.

Common haplotypes containing all 8 loci were identified from preliminary analysis of o_ij previously described and supported by the magnitude and sign of the imbalances once the alleles at the multi-allelic loci were clustered. For these loci, the allele in the group that contributed the most to the imbalance was identified in the haplotype. To estimate the frequencies of haplotypes in the population, the transport rates of at least one copy of the relevant alleles in the population were determined. These do not represent true haplotypes since the phase is unknown. Monte Carlo simulation techniques were used to analyze the significant deviation from a simulated null distribution for these transports combined assuming no association.

ES 2 356 167 T3

Example 3

Estimation of linkage disequilibrium in the IL-1 gene cluster

Various biallelic and multiallelic markers have been identified in and around IL-1 genes. However, the degree of linkage disequilibrium between markers and the prevalence of multi-marker haplotypes in the general population have not been identified so far.

Figure 1 shows the relative positions of the 8 marker loci used in this study. DNA samples from 212 unrelated healthy volunteers were genotyped for each of these markers, and the resulting allele frequency estimates are shown in Table 5.

TABLE 5

Estimated Frequencies of Marker Alleles

<td> 222/223</td><td>freq.</td><td>gz5 / gz6</td><td>freq.</td><td> -889</td><td>freq.</td><td> +3953</td><td>freq.</td>

<td>1 (126 bp)</td><td> 0,005</td><td>1 (79 bp)</td><td> 0,003</td><td>1 (Ncol)</td><td> 0,714</td><td>1 (2 TagI)</td><td> 0,812</td>

<td>2 (128 bp)</td><td> 0,018</td><td>2 (82 bp)</td><td> 0,005</td><td> 2</td><td> 0,286</td><td> 2</td><td> 0,188</td>

<td>3 (130 bp)</td><td> 0,378</td><td>3 (88 bp)</td><td> 0,676</td><td></td><td></td><td></td><td></td>

<td>4 (132 bp)</td><td> 0,299</td><td>4 (91 bp)</td><td> 0,316</td><td></td><td></td><td></td><td></td>

<td>5 (134 bp)</td><td> 0,016</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>6 (136 bp)</td><td> 0,208</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>7 (138 bp)</td><td> 0,055</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>8 (140 bp)</td><td> 0,003</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>9 (142 bp)</td><td> 0,010</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>10 (144 bp)</td><td> 0,008</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>*total</td><td> 384</td><td></td><td> 392</td><td></td><td> 398</td><td></td><td> 398</td>

<td> -511</td><td>freq.</td><td>gaat.p33330</td><td>freq.</td><td>Y31</td><td>freq.</td><td>VNTR</td><td>freq.</td>

<td> 1</td><td> 0,618</td><td>1 (189 bp)</td><td> 0,658</td><td>1 (148 bp)</td><td> 0,092</td><td> 1</td><td> 0,744</td>

<td>2 (Bsu361)</td><td> 0,382</td><td>2 (193 bp)</td><td> 0,002</td><td>2 (158 bp)</td><td> 0,008</td><td> 2</td><td> 0,256</td>

<td></td><td></td><td>3 (197 bp)</td><td> 0,255</td><td>3 (160 bp)</td><td> 0,454</td><td></td><td></td>

<td></td><td></td><td>4 (201 bp)</td><td> 0,084</td><td>4 (162 bp)</td><td> 0,062</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>5 (164 bp)</td><td> 0,003</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>6 (166 bp)</td><td> 0,122</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>7 (168 bp)</td><td> 0,035</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>8 (170 bp)</td><td> 0,030</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>9 (172 bp)</td><td> 0,095</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>10 (174 bp)</td><td> 0,087</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>11 (176 bp)</td><td> 0,003</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>12 (178 bp)</td><td> 0,011</td><td></td><td></td>

<td></td><td> 398</td><td></td><td> 404</td><td></td><td> 370</td><td></td><td> 398</td>

* number of chromosomes analyzed

Note - allele names (and sizes) are in bold.

To determine the linkage disequilibrium between combinations of loci in pairs, the computer program of Xie and Ott was used. This program was found to be the most efficient when used with biallelic systems, therefore alleles were grouped at the multiallelic loci in the most appropriate way for each pairwise comparison, so that the imbalance between subsets of alleles was not masked.

In Table 6, the imbalances between pairs of loci are expressed as ~ D, the relationship between ^TOD and its maximum value D_max, and are shown along with the approximate physical distance between the loci in kilo base pairs.

ES 2 356 167 T3

TABLE 6

Unbalance (~ D = ^/'D / \ D_max\) and physical distance between markers

<td></td><td> 222/223</td><td>gz5 / gz6</td><td> -889</td><td> +3953</td>

<td> 222/223</td><td> -</td><td> +0,872</td><td> +0,829</td><td> +0,710</td>

<td>gz5 / gz6</td><td> 2,5</td><td> -</td><td> -0,889</td><td> -0,695</td>

<td> -889</td><td> 7</td><td> 4,5</td><td> -</td><td> +0,804</td>

<td> +3953</td><td> 55</td><td> 55</td><td> 50</td><td> -</td>

<td> -511</td><td> 60</td><td> 60</td><td> 55</td><td> 4,5</td>

<td>gaat.p33330</td><td> 260</td><td> 260</td><td> 255</td><td> 205</td>

<td>Y31</td><td> 310</td><td> 310</td><td> 305</td><td> 255</td>

<td>VNTR</td><td> 380</td><td> 380</td><td> 375</td><td> 325</td>

<td></td><td> -511</td><td>gaat.p33330</td><td>Y31</td><td>VNTR</td>

<td> 222/223</td><td> +0,535</td><td> +0,433</td><td> +0,364</td><td> -0,499</td>

<td>gz5 / gz6</td><td> +0,540</td><td> +0,517</td><td> -0,503</td><td> +0,286</td>

<td> -889</td><td> -0,264</td><td> +0,337</td><td> +0,318</td><td> -0,207</td>

<td> +3954</td><td> -0,617</td><td> +0,409</td><td> -0,475</td><td> 0,439</td>

<td> -511</td><td> -</td><td> +0,691</td><td> -0,456</td><td> +0,448</td>

<td>gaat.p33330</td><td> 200</td><td> -</td><td> +0,639</td><td> +0,442</td>

<td>Y31</td><td> 250</td><td> 50</td><td> -</td><td> -0,765</td>

<td>VNTR</td><td> 320</td><td> 120</td><td> 70</td><td> -</td>

Note - unbalance values ​​are shown in the upper right, physical distances in Kb are shown in the lower left. Intergenic distances are given with an error of 5 Kb.

Table 7 shows the power to detect 50% of D_max for each combination of loci and the p-values ​​for each corresponding D.

TABLE 7

Power to detect 50% of D_max and p values ​​of -2Ln (LaL-β

<td></td><td> 222/223</td><td>gz5 / gz6</td><td> -889</td><td> +3953</td>

<td> 222/223</td><td> -</td><td> -100(+)</td><td> -100(+)</td><td> 98(+)</td>

<td>gz5 / gz6</td><td>&lt;1x10 '^ID</td><td> -</td><td> 87(-)</td><td> 60(-)</td>

<td> -889</td><td>&lt;1x10 '^iu</td><td>&lt;3x10^-8</td><td> -</td><td> -100(+)</td>

<td> +3954</td><td>-1x10 · '</td><td>* -9x10 · * '</td><td>&lt;1x10 '¹⁹</td><td> -</td>

<td> -511</td><td>-9x10 '^w</td><td>-4x10^lü</td><td>* -9.4x10 '⁴</td><td>* -2.6x10 '²</td>

<td>gaat.p3330</td><td>-9x10 *</td><td>-2x10 '⁹</td><td>* -1.7x10 '²</td><td>-5Χ10⁴</td>

<td>Y31</td><td>-1x10^-4</td><td>-4x10⁴</td><td>-6x10⁴</td><td>-1x10 '</td>

<td>VNTR</td><td>-1x10 '³</td><td>-1x10 '³</td><td>'-3Χ10¹</td><td>h ^ xiF</td>

<td></td><td> -511</td><td>gaat.p33330</td><td>Y31</td><td>VNTR</td>

<td> 222/223</td><td> -100(+)</td><td> -100(+)</td><td> -100(+)</td><td> 93(-)</td>

<td>gz5 / gz6</td><td> -100(+)</td><td> -100(+)</td><td> 98(-)</td><td> -100(+)</td>

<td> -889</td><td> 96(-)</td><td> 89(+)</td><td> -100(+)</td><td> 78(-)</td>

<td> +3954</td><td> 79(-)</td><td> 97(+)</td><td> -100(+)</td><td> 52(-)</td>

<td> -511</td><td> -</td><td> -100(+)</td><td> -100(-)</td><td> -100(+)</td>

<td>gaat.p33330</td><td>&lt;1x10 '^1u</td><td> -</td><td> 49(+)</td><td> -100(+)</td>

<td>Y31</td><td>-2x10⁴</td><td>* ~ 7x10 '³</td><td> -</td><td> 89(-)</td>

<td>VNTR</td><td>-8x1 θ '*</td><td>-1x10 '⁹</td><td>2x10 ''</td><td> -</td>

Note - Power is shown in the upper right with the unbalance sign in parentheses; point p-values ​​are shown (uncorrected) in the bottom left. For an overall significance level of p = 0.05, the point significance level is 0.0018 for 28 comparisons.

• Not significant at a threshold of p = 0.0018

Significant linkage disequilibrium was detected (p_corr &lt;0.05) among most combinations of loci, with only a few exceptions. These include comparisons between the VNTR marker and the more distant biallelic markers, +3954 and -889, in which the imbalance occurs in the negative direction and consequently the potency is reduced (Table 7). The correlation between ~ D imbalance and physical distance was r = -0.752 (p &lt;0.0001, one-sided) (Figure 2).

ES 2 356 167 T3

In order to compare different clustering methods for multi-allelic markers, ~ D was calculated for all comparisons involving 222/223 using two additional clustering strategies. The first consisted of a “common allele versus the rest” proposal and the second in a grouping based on allele size, using the bimodal distribution of allele frequency versus size that was observed for all multi-allelic markers examined. The results of this analysis are shown in Table 8, where the values ​​of ~ D for the three clustering methods are compared.

TABLE 8

~ D values ​​for the three allele clustering methods at multi-allelic marker loci

<td></td><td>TO</td><td>common compared to the rest</td><td>allele size</td>

<td>gz5 / gz6</td><td> 0,87</td><td> 0,79</td><td> 0,77</td>

<td> -899</td><td> 0,83</td><td> 0,81</td><td> 0,98</td>

<td> +3954</td><td> 0.71</td><td> *0,74</td><td> 0,77</td>

<td> -511</td><td> 0,54</td><td> *0,15</td><td> 0,61</td>

<td>gaat.p33330</td><td> 0,43</td><td> *0,03</td><td> 0,53</td>

<td>Y31</td><td> 0,36</td><td> *0,12</td><td> 0,16</td>

<td>VNTR</td><td> 0,5</td><td> 0,48</td><td> *0,04</td>

Note - Values ​​given for the imbalance between 222/223 and the other indicated markers.

* indicates not significant at the p = 0.05 level, even before correction for multiple trials.

It can be seen that the imbalance is not detected in several cases using these other grouping strategies, mainly 222/223 with -511 and gaat.p33330 in the common proposal versus the rest, 222/223 with Y31 both in the common proposal versus the rest as in the allele size and 222/223 with VNTR in the allele size proposal.

The examination of which alleles of the multi-allelic loci contributed the most to the disequilibrium, based on the determination of or_ij revealed the existence of 2 haplotypes that contained alleles of the 8 loci. These were confirmed by examination of the haplotype frequencies and disequilibrium values ​​obtained after clustering. The first haplotype: alleles 44112332 (expressed in chromosomal order, see Fig. 1) is the most common (34/198 transport) and is present 7 times more frequently than expected (expected = 4.5 / 198) (p &lt;0.000001). The second haplotype: alleles 33221461 (transport of 2/206) was present 4 times more frequently than expected (expected 0.5 / 206), but this was not statistically significant (p ~ 0.106). However, examining a larger sample size could help increase the statistical significance of this finding.

The data presented indicate a significant degree of linkage disequilibrium in a stretch of approximately 400 Kb of chromosome 2q13. The imbalance was large both for the three markers in the IL-1a gene, which might be expected, but also between some of the more widely separated markers (-899 / + 3954; ~ D = +0.804, physical distance = 50 Kb) (Table 6). However, ~ D decreased considerably between the furthest extremes of the cluster. Within the IL-1 / T gene, a moderate value of ~ D (+ 3954 / -511; ~ D = -0.617) was obtained, although this value was not significant when corrected for multiple comparisons, probably reflecting the reduction in potency when disequilibrium occurs in the negative direction (Thompson, et al., Am. J. Hum. Gent. 42: 113-24 (1988)).

In general, there is a good correlation between physical distance and linkage disequilibrium (Figure 2); r = -0.752. The reliability of r itself depends partially on the reliability of the estimates of both the physical distance and ~ D. At short distances, physical distances are exact since they are determined from known DNA sequences, while long-distance estimates are less precise. Power can be tentatively considered as an indicator of the reliability of ~ D, since if the power is low this indicates that the sample size was too small and with small sample sizes the estimates of ~ D may not be reliable.

The success of the elaborate clustering strategy is indicated in Table 8, which presents several cases in which the imbalance between particular loci is apparently low or undetected when other commonly used clustering methods are employed. The disadvantages of the clustering strategy used in the present invention are that the clustering strategy is quite time consuming since the information used for clustering was based on a rough estimate of the "observed" haplotype frequencies (see Example 2). For the more polymorphic markers, the greater heterozygosity means that the estimation of or_ij was less precise since there was a higher proportion of ambiguous haplotypes. Despite this drawback, efforts were made to take into account both the sign and the magnitude of or_ij and the frequencies of the related alleles.

ES 2 356 167 T3

The method could be simplified, in a sufficiently large study, only considering unambiguous haplotypes when clustering is determined. The determination of ¿¡j uses all the previous knowledge for the grouping of the multi-allelic markers and this may be the reason why the imbalance was detected between almost all the combinations of markers in pairs.

The two haplotypes containing the 8 markers, as well as other shorter haplotypes, are of particular interest since it is likely that particular combinations of alleles of the IL-1 genes may work together to determine a global inflammatory phenotype. Understanding which markers are in strong linkage disequilibrium not only allows a more rational design of genetic studies but can also provide clues to understanding the mechanism of the disease. Therefore, in addition to the alleles identified herein, the IL-1 haplotype (44112332) may contain the following alleles:

allele 2 of marker 1731 of the IL1RN gene (A at position 1731);

allele 2 of marker 1812 of the IL1RN gene (A at position 1812);

allele 2 of marker 1868 of the IL1RN gene (G at position 1868);

allele 2 of marker 1887 of the IL1RN gene (C at position 1887);

allele 2 of marker 8006 of the IL1RN gene (contains an Hpall or Mspl site) allele 2 of marker 8061 of the IL1RN gene (lacks a Mwol site) allele 2 of marker 9589 of the IL1RN gene (contains an Sspl site)

In addition, the following PCR primers can be used to amplify these alleles: TTACGCAGATAAGAACCAGTTTGG (SEQ ID NO. 24)

TTTCCTGGACGCTTGCTCACCA (SEQ ID NO. 25) (used for 1731, 1812, 1868 and 1887)

TTCTATCTGAGGAACAACCAACTAGTAGC (SEQ ID NO. 26) CACCAGACTTGACACAGGACAGGCACATC (SEQ ID NO. 27) (used for 8006)

CGACCCTCTGGGAGAAAATCCAGCAAG (SEQ ID NO. 28) (used with SEQ ID NO. 20 for 8006)

ACACAGGAAGGTGCCAAGCA (SEQ ID NO. 29)

TGCAGACAGACGGGCAAAGT (SEQ ID NO. 30) (used for 8006 and 9589)

TTGTGGGGACCAGGGGAGAT (SEQ ID NO. 31) and

AGCCTGGCACTCTGCTGAAT (SEQ ID NO. 32) (used for 9589).

Example 4

IL-1 haplotype (441123-32) is associated with diabetic nephropathy

The presence of the two haplotypes described herein was investigated in healthy and diseased populations to determine whether the haplotypes were associated with inflammatory disease. In Example 3, 81 non-insulin dependent diabetes mellitus (NIDDM) patients with nephropathy were compared with 198 ethnically similar healthy subjects and 147 NIDDM patients without nephropathy. Genotyping was performed as in the example

1.

The IL-1 haplotype (44112332) was carried by 24 of 79 of the patients with NIDDM and nephropathy and 25 of 141 of the patients with NIDDM without nephropathy. However, the second haplotype (3322146 1) was not found in patients with nephropathy (0/8 1). The IL-1 haplotype (44112332) was significantly overrepresented in the patient group compared to the healthy control group (24/79 vs 34/198; p = 0.015) and in the NIDDM group without nephropathy ( 24/79 vs 25/141; p = 0.03).

Example 5

An IL-1 haplotype is associated with an inflammatory disease

It is a prophetic or predictive example. Other diseases were examined as in Example 4. The IL-1 haplotype (44112332) was found to be associated with coronary artery disease, osteoporosis, nephropathy in diabetes mellitus, alopecia areata, Graves disease, disseminated lupus erythematosus, lichen sclerosis. and ulcerative colitis.

ES 2 356 167 T3

Similarly, the IL-1 haplotype (33221461) is associated with periodontal disease, juvenile chronic arthritis, psoriasis, insulin-dependent diabetes, and diabetic retinopathy.

Example 6

New markers are linked to an IL-1 haplotype

It is a predictive example. More markers were identified by sequence analysis and restriction enzymes of the 2q13-14 region. These new markers were identified as belonging to an IL-1 haplotype in the manner described in Examples 2 and 3.

Example 7

IL-1 haplotype (44112332) is used to predict disease sensitivity

It is a predictive example. A patient with a family history of ulcerative colitis was genotyped for the presence of the IL-1 haplotype (44112332). Genotyping was performed as in Example 1 and the patient was found to carry one or more alleles of the haplotype. The patient was therefore treated with IL-1 antagonists to avoid disease.

A second patient with a family history of coronary artery disease was genotyped to detect the IL-1 gene cluster. The patient was found to carry one or more alleles of the IL-1 haplotype (44112332) and to be homozygous for allele 2 of VNTR. Thus, the patient was 5.4 times more likely to develop coronary artery disease than the general population and was extensively treated to prevent the disease.

Example 8

Additional haplotypes are statistically significant

In a predictive example, 1,400 more chromosomes were typed, as in Example, and linkage disequilibrium was assessed as in Example 2. The IL-1 haplotype (33221461) was found to be present approximately 4 times more frequently than previously reported. expected (p-0.05).

Similarly, the following markers were determined to be present in the IL-1 haplotype (44112332) (p &lt;&lt; 0.05).

Allele 2 of marker 1731 of the IL1RN gene allele 2 of marker 1812 of the IL1RN gene allele 2 of marker 1868 of the IL1RN gene allele 2 of marker 1887 of the IL1RN gene allele 2 of marker 8006 of the IL1 RN gene allele 2 of marker 8061 of the IL1 RN gene allele 2 of marker 9589 of the IL1 RN gene

Example 9

Identification and characterization of single nucleotide polymorphisms in the human IL-1B gene associated with altered IL-1fl expression and inflammatory states

The IL-1B gene and other members of the IL-1 gene cluster were studied. In particular, IL-1B was investigated because various diseases are associated with SNPs in its region in the 5 'direction. Several new SNPs were identified, as shown in Tables 9^to-AND. Reporter gene assays were used to analyze allelic combinations of SNPs in the IL-1B promoter region, some of which represent common haplotypes in the population. A control construct has the wild type (designated allele 1) in all alleles containing SNPs. Differential transcriptional activity of individual alleles in reporter titers was further studied by analyzing the binding of nuclear proteins to allelic DNA in electromobility shift assays.

ES 2 356 167 T3

High-density SNP mapping

Twenty-five healthy volunteers of different ethnic origin, self-described, were selected. Each subject provided informed written consent and the protocol was approved by the Ethics Committee of the University of Sheffield (UK). Genomic DNA was prepared from blood samples. The DNA was submitted to Genome Therapeutics Corporation (Waltham, MA, USA) for sequencing and mapping of the high-density SNPs. The publicly available genomic sequence in the IL-1 region was used to establish the reference sequence of this region for identification of SNPs. In addition, a commercially available bacterial artificial chromosome (BAC hereinafter abbreviated for Bacterial Artificial Chromosomes) library was screened to identify BAC clones spanning the IL-1 region. Positive BACs were used to generate a small library of plasmid inserts with inserts of 3 to 3.5 kb. Four genes (IL-1A, IL-1B, IL-RN and IL-1F5) were studied and SNPs were identified for each gene in the exon and 5 kb regions of the 5 'end of the gene. SNP detection was performed automatically using the PolyPhred program on an ABI 3700 instrument, followed by visual inspection of the SNPs listed in Tables 9A-E.

TABLE 9A

Discovery of Π.-1α SNPs

<td>N ° SNP</td><td>Relative to +1</td><td>Location</td><td>Guy</td><td>SNP sequence</td>

<td> 1</td><td> -3885</td><td>Promoter</td><td>C / T</td><td>GCATGAGCCA \ CGGCACCCAGCCACT (SEQ ID NO:)</td>

<td> 2</td><td> -3764</td><td>Promoter</td><td>C / T</td><td>TGAACTAGAA \ CTCAAGAAATTGA (SEQ ID NO:)</td>

<td> 3</td><td> -3726</td><td>Promoter</td><td>T / C</td><td>CACACTCTCA \ TATGAATTCTCCAT (SEQ ID NO:)</td>

<td> 4</td><td> -3608</td><td>Promoter</td><td>G / A</td><td>CATATTCTGG / AACCTTCAATAAA (SEQ ID NO:)</td>

<td> 5</td><td> -3115</td><td>Promoter</td><td>C / T</td><td>AAAAGTTATG \ TTTTTCTCTTCATTCA (SEQ ID NO :)</td>

<td> 6</td><td> -2756</td><td>Promoter</td><td>C / T</td><td>TCTTTATAAG \ CCATCACTTGGTG (SEQ ID NO:)</td>

<td> 9</td><td> -2269</td><td>Promoter</td><td>G / A</td><td>CGAGAGGTGG \ GTGCCTGAAGCCACC (SEQ ID NO :)</td>

<td> 10</td><td> -2118</td><td>Promoter</td><td>C / T</td><td>TGTTCACAGT / CCCAGAAAAGCGGGC (SEQ ID NO:)</td>

<td> 11</td><td> -1506</td><td>Promoter</td><td>C / T</td><td>TAAAGAGGAA / CCAAGGTAAGCAGAA (SEQ ID NO:)</td>

<td> 12</td><td> -1202</td><td>Promoter</td><td>C / T</td><td>ACACAAGCTG \ CTTTCCTCCCAGATC (SEQ ID NO:)</td>

<td> 13</td><td> -889</td><td>Promoter</td><td>C / T</td><td>CCAGGCAACA \ CCATTGAAGGCTC (SEQ ID NO:)</td>

<td> 14</td><td> + 145</td><td>Promoter</td><td>C / T</td><td>AAAGCTACAG / CCTCTCCTTTCTTT (SEQ ID NO:)</td>

<td> 15</td><td> +251</td><td>Promoter</td><td>T / A</td><td>CTGATTCGTT \ TTACTGAGGGACG (SEQ ID NO:)</td>

<td> 16</td><td> +263</td><td>Promoter</td><td>G / A</td><td>ACTGAGGGAC \ GGCAGAACTAGTTTC (SEQ ID NO:)</td>

<td> 17</td><td> + 1864</td><td>Promoter</td><td>A / C</td><td>CTTGAATCTTXAAATACTTTTGTT (SEQ ID NO:)</td>

<td> 18</td><td> + 1892</td><td>Promoter</td><td>G / A</td><td>CTCACTAGAG \ GTCCAGAGACCT (SEQ ID NO:)</td>

<td> 19</td><td> +2822</td><td>Promoter</td><td>G / A</td><td>AAGAAGAGAC \ GGTTGAGTTT (SEQ ID NO:)</td>

<td> 24</td><td> +4718</td><td>Promoter</td><td>A / C</td><td>TCTGGATTGGXAATATTCCTA (SEQ ID NO:)</td>

<td> 25</td><td> +4728</td><td>Promoter</td><td>T / C</td><td>ATTCCTAATA / TCCCCTCCAG (SEQ ID NO:)</td>

<td> 26</td><td> +4845</td><td>Intron 1</td><td>G / T</td><td>GCCTAGGTCA \ GCACCTTTTAG (SEQ ID NO:)</td>

<td> 30</td><td> +6627</td><td>Intron 1</td><td>G / A</td><td>GCCCCCACCT \ GCCCACCCCA (SEQ ID NO:)</td>

<td> 31</td><td> +8811</td><td>Intron 1</td><td>A / C</td><td>CCTTTTTCTA / ACATCTTGTTCTCTA (SEQ ID NO:)</td>

<td> 32</td><td> +9460</td><td>Intron 3</td><td>G / A</td><td>TTTGCCTTCT \ GCTTTTAAGTT (SEQ ID NO:)</td>

<td> 33</td><td> +9613</td><td>Intron 3</td><td>C / T</td><td>AAATACTTCT / CGAAGCCGAGC (SEQ ID NO:)</td>

<td> 34</td><td> +9749</td><td>Exon 4</td><td>C / G</td><td>CTGAGTGTGA \ CCAGGCATCCTC (SEQ ID NO:)</td>

ES 2 356 167 T3

TABLE 9B

Discovery of IL-Ιβ SNPs

<td>N ° SNP</td><td>Relative to +1</td><td>Location</td><td>Guy</td><td>SNP sequence</td>

<td> 1</td><td> -5164</td><td>Promoter</td><td>T / C</td><td>GCCTGGGTCC / CAGACTTGACAAA (SEQ ID NO:)</td>

<td> 2</td><td> -3959</td><td>Promoter</td><td>T / C</td><td>AGAAAAGACA / TAGAGTAGGA (SEQ ID NO:)</td>

<td> 3</td><td> -3893</td><td>Promoter</td><td>G / A</td><td>TCCAAAGGAA / GGACAAGGTC (SEQ ID NO:)</td>

<td> 4</td><td> -3737</td><td>Promoter</td><td>C / T</td><td>GGGAGGAGAATGGAATGT / CCCTTGGACTCT (SEQ ID NO :)</td>

<td> 5</td><td> -3686</td><td>Promoter</td><td>A / G</td><td>GAAGAAGCCC / ATTGGAGATGATG (SEQ ID NO:)</td>

<td> 6</td><td> -3254</td><td>Promoter</td><td>T / C</td><td>GATAACTGGC / TGCGAAGCCCATGAT (SEQ ID NO:)</td>

<td> 7</td><td> -2905</td><td>Promoter</td><td>A / G</td><td>GGAAGACAGG / ATCTGATACATAC (SEQ ID NO:)</td>

<td> 8</td><td> -2394</td><td>Promoter</td><td>G / A</td><td>CCTGTCACTG / GCTTTGATCCTCCTT (SEQ ID NO:)</td>

<td> 9</td><td> -2378</td><td>Promoter</td><td>G / A</td><td>ATCCTCCTTC / GTTCAGCTTGTAATC (SEQ ID NO:)</td>

<td> 10</td><td> -1468</td><td>Promoter</td><td>G / C</td><td>CACTCCCTTG / GATAATGCAGAGCGAG (SEQ ID NO:)</td>

<td> 14</td><td> -511</td><td>Promoter</td><td>C / T</td><td>AGAGAGCTCC / TGAGGCAGAGAAC (SEQ ID NO:)</td>

<td> 15</td><td> -31</td><td>Promoter</td><td>T / C</td><td>TTTTGAAAGC / CATAAAAACAGCGAGGGAG (SEQ ID NO:)</td>

<td> 17</td><td> +45</td><td>Exon 1 5 'UTR</td><td>T / C</td><td>GCTCTGGGAT / TCTCTTCAGCCAATCTTCAT (SEQ ID NO:)</td>

<td> 19</td><td> +746</td><td>Intron 2</td><td>C / T</td><td>ACTACTTTCC / CATTACAAGTCCCTCCAG (SEQ ID NO:)</td>

<td> 24</td><td> +3876</td><td>Intron 4</td><td>G / A</td><td>AAATTTTGCC / GCCTCGCCTCACGAG (SEQ ID NO:)</td>

<td> 25</td><td> +3954</td><td>Exon 5</td><td>C / T</td><td>CTATCTTCTT / CGACACATGGGATAACG (SEQ ID NO:)</td>

<td> 30</td><td> +5548</td><td>Intron 6</td><td>G / A</td><td>CCTTCTCCCC / GCCCCCATCCCTAGG (SEQ ID NO:)</td>

<td> 35</td><td> +6506</td><td>Exon 7 3 'UTR</td><td>AC</td><td>ATAGCCTGGA / CTTTCCTGTTGTCT (SEQ ID NO:)</td>

<td> 37</td><td> +6911</td><td>Exon 7 3 'UTR</td><td>G / C</td><td>CTTTAATTAA / GACTGAAAATATATAAGC (SEQ ID NO:)</td>

<td> 38</td><td> +7214</td><td>Unknown</td><td>C / T</td><td>CAGTGCACAT / TTGGAACAGGATC (SEQ ID NO:)</td>

ES 2 356 167 T3

TABLE 9C

Discovery of IL-Rnic SNPs

<td>N ° SNP</td><td>Relative to +1</td><td>Location</td><td>Guy</td><td>SNP sequence</td>

<td> 14</td><td> -4864</td><td></td><td>G / A</td><td>GTTGGGTCAC / GTACCCGACGTGCTA (SEQ ID NO:)</td>

<td> 15</td><td> -4744</td><td></td><td>T / G</td><td>ACTGTTCACA / GAGCCAAGATATGGA (SEQ ID NO:)</td>

<td> 18</td><td> -3662</td><td></td><td>T / G</td><td>TGTTTGCTTG / TTCTTCTCTCTCAGC (SEQ ID NO :)</td>

<td> 19</td><td> -3417</td><td></td><td>A / G</td><td>AGCTGGGTCT / ATGAGTTGTGGTGGC (SEQ ID NO:)</td>

<td> 21</td><td> -3230</td><td></td><td>C / T</td><td>GTGTGTGTGT / CTGTGTTTGTGTGTG (SEQ ID NO:)</td>

<td> 22</td><td> -3188</td><td></td><td>G / A</td><td>GAGAGAATGA / GAATATGAGTGGTGG (SEQ ID NO:)</td>

<td> 25</td><td> -2448</td><td></td><td>T / C</td><td>TATCTTGCTC / TTCCATTCCTGATGC (SEQ ID NO:)</td>

<td> 26</td><td> -2343</td><td></td><td>T / C</td><td>GTCACCATCA / TTGGGGTTGTGGATC (SEQ ID NO:)</td>

<td> 29</td><td></td><td>Promoter</td><td>C / T</td><td>TGAGCCAAGG / CGGAAGAGAACAGGA (SEQ ID NO:)</td>

<td> 30</td><td> -1002</td><td>Promoter</td><td>T / C</td><td>GCAGATAGCA / TCAGGTCCATTTTGC (SEQ ID NO:)</td>

<td> 31</td><td> -501</td><td>Promoter</td><td>G / C</td><td>CTCTCAGAGA / GGGCTTCCCTGGCCA (SEQ ID NO:)</td>

<td> 32</td><td> -500</td><td>Promoter</td><td>G / A</td><td>TCTCAGAGAG / GGCTTCCCTGGCCAC (SEQ ID NO:)</td>

<td> 33</td><td> -388</td><td>Promoter</td><td>C / T</td><td>TATTTTATTTG / CTAACTTGTTTCTTG (SEQ ID NO:)</td>

<td> 34</td><td> -252</td><td>Promoter</td><td>A / C</td><td>GCACACATGC / ATGAGCTGGCGGCAG (SEQ ID NO:)</td>

<td> 35</td><td> -41</td><td>Promoter</td><td>G / A</td><td>GGGAGGGGAG / GCTGGGCTCCTCCTT (SEQ ID NO:)</td>

<td> 36</td><td> +40</td><td>Exon 1 5 'UTR</td><td>G / A</td><td>CCCAGGTACT / GCCCGGGTGCTACTT (SEQ ID NO:)</td>

<td> 37</td><td> +96</td><td>Exon 1 5 'UTR</td><td>G / A</td><td>GGAAGACCTC / AGAAGACCTCCTGTC (SEQ ID NO:)</td>

<td> 38</td><td> + 115</td><td>Exon 1 5 'UTR</td><td>G / C</td><td>CCTGTCCTAT / GAGGCCCTCCCCATG (SEQ ID NO:)</td>

<td> 39</td><td> + 162</td><td>Intron 1</td><td>T / C</td><td>TCTCATTTTT / TCACCTGAGAAATGA (SEQ ID NO :)</td>

<td> 40</td><td> +304</td><td>Intron 1</td><td>A / G</td><td>GGAGGCATCC / ATGGGAGACCATGCA (SEQ ID NO:)</td>

<td> 42</td><td> +2027</td><td>Intron 1</td><td>G / T</td><td>GTGCATACTC / TGACTGGAAACTGGA (SEQ ID NO:)</td>

<td> 43</td><td> +2060</td><td>Intron 1</td><td>G / C</td><td>AAAGGATAGA / GATGGAACCATGTGC (SEQ ID NO:)</td>

<td> 44</td><td> +2245</td><td>Intron 1</td><td>A / C</td><td>AGGGTAAATT / ATTTTTAGGATCCAA (SEQ ID NO:)</td>

<td> 61</td><td> +11732</td><td>Exon 3</td><td>T / C</td><td>AACTAGTTGC / TGGATACTTGCAAGG (SEQ ID NO:)</td>

<td> 62</td><td> +11787</td><td>Intron 3</td><td>T / C</td><td>GCCAGGAAAG / CCAATGTATGTGGGC (SEQ ID NO:)</td>

<td> 63</td><td> +11797</td><td>Intron 3</td><td>G / A</td><td>CAATGTATGT / GGGCATCACGTCACT (SEQ ID NO:)</td>

<td> 64</td><td> +11819</td><td>Intron 3</td><td>G / C</td><td>CACTTTGCCC / GTCTGTCTGCAGCAG (SEQ ID NO:)</td>

<td> 65</td><td> +11860</td><td>Intron 3</td><td>T / G</td><td>TGCACAAACCCTAGG / TCAATGTCCTAATC (SEQ ID NO:)</td>

<td> 66</td><td> +11855</td><td>Intron 3</td><td>A / C</td><td>AAACCCTAGG / TGCAATGTCCTAATC (SEQ ID NO:)</td>

<td> 67</td><td> +11890</td><td>Intron 3</td><td>T / C</td><td>TGTATTCAAG / TTTGAAGCTGGGAGG (SEQ ID NO:)</td>

<td> 68</td><td> +11892</td><td>Intron 3</td><td>G / A</td><td>ATTCAAGTTT / GAAGCTGGGAGGGCC (SEQ ID NO:)</td>

<td> 76</td><td> +13070</td><td>Intron 3</td><td>G / A</td><td>AAAAATACCC / GGGGTCTCTTCATTA (SEQ ID NO:)</td>

<td> 77</td><td> +13092</td><td>Intron 3</td><td>T / C</td><td>TTATTGCTGC / TTCCTCTTCTATTAA (SEQ ID NO:)</td>

<td> 78</td><td> +13307</td><td>Intron 3</td><td>A / T</td><td>AAACAACCAA / AATTTTTTCTTATGA (SEQ ID NO:)</td>

<td> 79</td><td> +13414</td><td>Intron 4</td><td>T / A</td><td>GCAGAGTGCC / TGGCTTGCGCTGGGC (SEQ ID NO:)</td>

<td> 80</td><td> +13520</td><td>Intron 4</td><td>T / G</td><td>GCATGGCGGC / TGACTTCCAAAAGGG (SEQ ID NO:)</td>

<td> 81</td><td> +13575</td><td>Intron 4</td><td>G / A</td><td>CGCTTATTAT / GACTTCTGCTTGCAT (SEQ ID NO:)</td>

<td> 82</td><td> +13614</td><td>Intron 4</td><td>C / T</td><td>AAGCCAGTCA / CGTGGCTAAGTCTAG (SEQ ID NO:)</td>

<td> 89</td><td> +14818</td><td>Exon 4</td><td>T / C</td><td>GCTCAGACAG / CGGCCCCACCACCAG (SEQ ID NO:)</td>

ES 2 356 167 T3

TABLE 9D

Discovery of IL-Rnsec SNPs

<td>N ° SNP</td><td>Relative to +1</td><td>Location</td><td>Guy</td><td>SNP sequence</td>

<td> 61</td><td> +2014</td><td>Exon 2</td><td>T / C</td><td>AACTAGTTGC / TGGATACTTGCAAGG (SEQ ID NO:)</td>

<td> 62</td><td> +2069</td><td>Intron 2</td><td>T / C</td><td>GCCAGGAAAG / CCAATGTATGTGGGC (SEQ ID NO:)</td>

<td> 63</td><td> +2080</td><td>Intron 2</td><td>G / A</td><td>CAATGTATGT / GGGCATCACGTCACT (SEQ ID NO:)</td>

<td> 64</td><td> +2101</td><td>Intron 2</td><td>G / C</td><td>CACTTTGCCC / GTCTGTCTGCAGCAG (SEQ ID NO:)</td>

<td> 66</td><td> +2142</td><td>Intron 2</td><td>A / C</td><td>AAACCCTAGG / TGCAATGTCCTAATC (SEQ ID NO:)</td>

<td> 67</td><td> +2180</td><td>Intron 2</td><td>T / C</td><td>TGTATTCAAG / TTTGAAGCTGGGAGG (SEQ ID NO:)</td>

<td> 68</td><td> +2183</td><td>Intron 2</td><td>G / A</td><td>ATTCAAGTTT / GAAGCTGGGAGGGCC (SEQ ID NO:)</td>

<td> 76</td><td> +3192</td><td>Intron 2</td><td>G / A</td><td>AAAAATACCC / GGGGTCTCTTCATTA (SEQ ID NO:)</td>

<td> 77</td><td> +3214</td><td>Intron 2</td><td>T / C</td><td>TTATTGCTGC / TTCCTCTTCTATTAA (SEQ ID NO:)</td>

<td> 78</td><td> +3428</td><td>Intron 2</td><td>A / T</td><td>AAACAACCAA / AATTTTTTCTTATGA (SEQ ID NO:)</td>

<td> 79</td><td> +3535</td><td>Intron 3</td><td>T / A</td><td>GCAGAGTGCC / TGGCTTGCGCTGGGC (SEQ ID NO:)</td>

<td> 80</td><td> +3641</td><td>Intron 3</td><td>T / G</td><td>GCATGGCGGC / TGACTTCCAAAAGGG (SEQ ID NO:)</td>

<td> 81</td><td> +3696</td><td>Intron 3</td><td>G / A</td><td>CGCTTATTAT / GACTTCTGCTTGCAT (SEQ ID NO:)</td>

<td> 82</td><td> +3735</td><td>Intron 3</td><td>C / T</td><td>AAGCCAGTCA / CGTGGCTAAGTCTAG (SEQ ID NO:)</td>

<td> 89</td><td> +4939</td><td>Exon 4</td><td>T / C</td><td>GCTCAGACAG / CGGCCCCACCACCAG (SEQ ID NO:)</td>

<td> 90</td><td> +5221</td><td>Exon 4 3 'UTR</td><td>G / C</td><td>GGCGTCACAA / CAACCTGGTCACAGG (SEQ ID NO:)</td>

<td> 91</td><td> +6047</td><td>Exon 4 3 'UTR</td><td>G / A</td><td>CTCCCCCACC / AGGCTGGGAGCTCTG (SEQ ID NO:)</td>

<td> 93</td><td> +6410</td><td></td><td>T / C</td><td>GCAAAAAAGA / TATGGGGCAGCACTG (SEQ ID NO:)</td>

<td> 94</td><td> +6440</td><td></td><td>A / G</td><td>AACAGCCTCT / ACTGGAAACAACCCA (SEQ ID NO:)</td>

<td> 95</td><td> +6179</td><td></td><td>A / G</td><td>AAAGTTCCCT / ACTTCCTGTGACTTC (SEQ ID NO:)</td>

ES 2 356 167 T3

TABLE 9E

Discovery of IL-1F5 SNPs

<td>N ° SNP</td><td>Relative to +1</td><td>Location</td><td>Guy</td><td>SNP sequence</td>

<td> 15</td><td> -2346</td><td>Promoter</td><td>T / C</td><td>ATTCAGGGAA / TGGAGGCTTAT (SEQ ID NO:)</td>

<td> 16</td><td></td><td>Promoter</td><td>T / C</td><td>AGAGAACTTA / TGTTGGTGAGG (SEQ ID NO:)</td>

<td> 17</td><td> -2063</td><td>Promoter</td><td>A / G</td><td>TTGACAGTAT / ACACAGTCATA (SEQ ID NO:)</td>

<td> 18</td><td> -1953</td><td>Promoter</td><td>C / T</td><td>CTCACTGCAA / CCTCCACCTCC (SEQ ID NO:)</td>

<td> 19</td><td></td><td></td><td>A / T</td><td>TGCAACCTCC / ACCTCCCAGGT (SEQ ID NO :)</td>

<td> 20</td><td> -1834</td><td>Promoter</td><td>C / T</td><td>GGTTTTGCCA / CGTTGGCCAGG (SEQ ID NO:)</td>

<td> 21</td><td> -1019</td><td>Promoter</td><td>C / T</td><td>GCTATTTTGC / CACATGAAAAA (SEQ ID NO:)</td>

<td> 22</td><td> -926</td><td>Promoter</td><td>T / A</td><td>GTGGAGGAAA / TAGTGTTGTCAT (SEQ ID NO:)</td>

<td> 23</td><td></td><td></td><td>G / C</td><td>GGAGGAAATA / GTGTTGTCATTG (SEQ ID NO:)</td>

<td> 24</td><td></td><td></td><td>G / A</td><td>GAAATGGGAA / GGGAAAGAAG (SEQ ID NO:)</td>

<td> 25</td><td></td><td>UTR</td><td>T / C</td><td>AAAGT \ CGCGCTTCCCTGAGC (SEQ ID NO:)</td>

<td> 26</td><td></td><td></td><td>C / T</td><td>GCCAGGATCC / CTGCTCAGAGCTCCG (SEQ ID NO:)</td>

<td> 27</td><td></td><td>Intron</td><td>T / C</td><td>CTGAGGGGGA / TAAGTGAACCTCCCA (SEQ ID NO:)</td>

<td> 28</td><td></td><td>Intron</td><td>T / C</td><td>CAGCACCTCA / CTGCTCTTAGAGTTT (SEQ ID NO:)</td>

<td> 29</td><td></td><td>Intron</td><td>G / A</td><td>CTGTGCCCCT / ACCTCCCTGCTACTC (SEQ ID NO:)</td>

<td> 30</td><td></td><td>Intron</td><td>T / C</td><td>TTACCATCAG / TAGTCTGTCCA (SEQ ID NO:)</td>

<td> 31</td><td></td><td>Intron</td><td>A / T</td><td>TTCTGGGCTT / ACAACAGAGGA (SEQ ID NO:)</td>

<td> 32</td><td></td><td>Intron</td><td>T / C</td><td>GCACTTCCCA / TATGTGTTCTA (SEQ ID NO:)</td>

<td> 33</td><td></td><td>Intron</td><td>G / T</td><td>ATTGGAGGCA / GGATGGGGCAA (SEQ ID NO:)</td>

<td> 34</td><td></td><td>Intron</td><td>G / A</td><td>TTCTCTTCCA / GAGGAGATGGG (SEQ ID NO:)</td>

<td> 35</td><td></td><td>Intron</td><td>G / A</td><td>CCCAGGCATT / GGGGCAGCACAAACC (SEQ ID NO:)</td>

<td> 36</td><td></td><td>Intron</td><td>G / C</td><td>TGAAGACACA / GGCTCTGGGGCCACC (SEQ ID NO:)</td>

<td> 37</td><td></td><td>Intron</td><td>G / A</td><td>TGAAGCTTCT / ATGCAGAAGTGGGAA (SEQ ID NO:)</td>

<td> 38</td><td></td><td>Intron</td><td>G / A</td><td>TGCAGAAGTG / GGAATGTTTTCCAAG (SEQ ID NO:)</td>

<td> 39</td><td></td><td>Intron</td><td>G / C</td><td>CACTGCAACA / GTCCCTCTCTA (SEQ ID NO:)</td>

<td> 40</td><td></td><td>Intron</td><td>T / C</td><td>CAGGCCGTCT / TACAGCAGTCCTGTG (SEQ ID NO:)</td>

<td> 41</td><td></td><td></td><td>A / G</td><td>GTGGTCCCCA / ATCGGTGGCTGGATG (SEQ ID NO:)</td>

<td> 42</td><td></td><td>UTR</td><td>G / A</td><td>ATTTCTGTGG / GGTGGGGTGGG (SEQ ID NO:)</td>

<td> 43</td><td></td><td>UTR</td><td>C / G</td><td>TGAGGAGGTG / GTGATGTCAGAAGAA (SEQ ID NO:)</td>

<td> 44</td><td></td><td></td><td>G / A</td><td>GGTGGTGGCA / GTATAGGTGATTTTT (SEQ ID NO:)</td>

<td> 45</td><td></td><td>UTR</td><td>T / C</td><td>TGTTAATTTA / TCTGTATTTCCTAAT (SEQ ID NO:)</td>

<td> 46</td><td></td><td>UTR</td><td>G / C</td><td>TTAATCTTGA / GGTAAGCAGAGTAGA (SEQ ID NO:)</td>

<td> 47</td><td></td><td>UTR</td><td>T / C</td><td>GTAAGCAGAG / TAGACATCATCTCTGA (SEQ ID NO:)</td>

<td> 48</td><td></td><td>UTR</td><td>A / C</td><td>GGAGGCTGTG / ATGAGTTTGTGTGGC (SEQ ID NO:)</td>

<td> 49</td><td></td><td>UTR</td><td>T / C</td><td>ACAGAGGAGA / CGCGGGGAAGACTAT (SEQ ID NO:)</td>

<td> 50</td><td></td><td>UTR</td><td>C / T</td><td>TAATTGGTTA / TGGCAGCTCTAGGAA (SEQ ID NO:)</td>

<td> 51</td><td></td><td>UTR</td><td>A / G</td><td>AATTGGTTAC / GGCAGCTCTAGGAAA (SEQ ID NO:)</td>

<td> 52</td><td></td><td></td><td>T / A</td><td>TTACAGCAGC / TCTAGGAAACTAATA (SEQ ID NO:)</td>

<td> 53</td><td></td><td></td><td>AC</td><td>TACAGCAGCT / CTAGGAAACTAATAC (SEQ ID NO:)</td>

<td> 54</td><td></td><td>UTR</td><td>G / T</td><td>GAAGCTAGCT / TCCATGCTATGAGCA (SEQ ID NO:)</td>

<td> 55</td><td></td><td>UTR</td><td>C / T</td><td>AAGAGACTTA / TGTGGTAAAAAATGAA (SEQ ID NO:)</td>

<td> 56</td><td></td><td>UTR</td><td>G / A</td><td>TGAGATAATC / AATGTTTGTTGTTTT (SEQ ID NO:)</td>

<td> 57</td><td></td><td>UTR</td><td>T / C</td><td>TTTGTTGAGT / CATCTGGTTCTGCAA (SEQ ID NO:)</td>

In the IL-1A gene, mapping revealed a total of 25 SNPs. Two SNPs were in the exon regions and resulted in non-synonymous changes. One of them in Exon 5 was known and was in position +4845, the other in Exon 4 had a low frequency (2%) and subsequent attempts to confirm them in another population showed no variation. Of the 11 SNPs in the promoter region, 3 were only found in one subject (2%) and the other 8 were also in the public database of the National Center for Biotechnology Information (NCBI dbSNP). The remaining 12 SNPs were either intronic (n = 9) or were in the untranslated region (hereinafter abbreviated UTR by the English expression UnTranslated Region) 3 '(n = 3) of Exon 7. Ten of these were also in the public database and the remaining 2 had a very low frequency (2-4%) in our population.

To identify the variants in the IL-1B gene (IL-1F2) that were most likely functional, the seven exons and adjacent intronic regions, 5 kb downstream of the gene and 2 kb in the 3 'region, comprised 12 kb, were sequenced in a panel of 25 ethnically diverse healthy individuals. Twenty SNPs were identified (Table 9B). It is

ES 2 356 167 T3 significant that in seven sequenced exons only one SNP was identified in a coding region, the well-described synonymous SNP at +3954. There were three intronic SNPs, three SNPs in the 3 'UTR of exon 7 and one SNP in the 5' UTR of exon 1 identified. The remaining 12 SNPs were in the promoter / enhancer region. Two of the 12 promoter SNPs were not found in the public databases and six of the 12 had minor allele frequencies &lt;4%. The presence of 5 previously indicated SNPs at positions -511 (SNP 14), -31 (SNP15), -1468 (SNP10), +3954 (SNp 25) and +3877 (SNP 24) in the IL-gene was confirmed. 1 B. These SNPs have been associated with clinical conditions. The existence of five other SNPs was also identified: -3893 (SNP3); -3737 (SNP4), +5548 (SNP30), +6911 (SNP37) and +7214 (SNP 38).

Screening for functional SNPs

Non-synonymous SNPs were not identified in the exons of IL-1B. SNPs were identified that altered transcriptional activity and / or transcription factor binding. By fitting all SNPs to allele 1 except the individual SNP of the focus, the promoter activity was screened after transfection of the SNP constructs into THP-1 cells. Transfection analysis with parental constructs of variable length showed that deletion of the distal fragment between SNP 1 and SNP 10 enhanced promoter activity, indicating strong repressors in this region. Greater promoter activity of plasmids containing this region between SNP 17 and the beginning of the exon also revealed the existence of enhancers in the 5 'UTR. In order to avoid interference from repressors and enhancers during the identification of individual functional SNPs in the promoter region, SNPs 2 to 17 were analyzed in plasmid backgrounds with or without the 5 'UTR region in the 3' direction SNP 15 (possible enhancer). SNPs 10 to 17 were also analyzed in plasmid backgrounds with and without strong potential interference from the promoter regions in the 5 'direction. Because the initial BAC clone was found to contain allele 2 in both SNP 14 and 15, individual SNPs were also screened for transcriptional activity on this background. The results reported here used the longest promoter plasmid containing 5 'sequences including SNP 2.

SNPs were annotated and grouped schematically in relation to their position in the gene, cDNA, and protein as the basis for developing a clear strategy to probe for allele-specific differences in gene function.

Five functional SNPs were identified; B4, B7, B10, B14 and B15, demonstrating allelic differences in transcription. SNPs, B4, B10, B14 and B15 occur with high frequency (&gt; 25%) in the population used for the discovery of SNPs; while B7 was found only in 2% of the sequenced subjects.

Generation of IL-1B gene promoter constructs

The human IL-1B promoter was PCR amplified from BAC clone RP11-67L14 (IL-1B, BAC PAC Resources, Children's Hospital Oakland Research Institute) using turbo Pfu turbo DNA polymerase (Stratagene, CA). Two sets of primers were used to amplify the IL-1B promoter containing different 3 'ends. The primers IL-1BF1 5'cccACGCGTGAGTGAAAGGAATCCCGTTAGAAGT (SEQ ID NO: 33) and IL-1BR2 5'cccACGCGTGCCTGTTGTGCCTTGTGCCTCGAAG (SEQ ID NO: 34) were used to generate the IL-1B32 promoter fragment 5326) (S = short; without the first exon). IL-1BR1 5'cccACGCGTGGCTGCTTCAGACACCTGTGTA (SEQ ID NO: 35) was used to generate the IL-1BL promoter fragment (+471 to -5326) (L = long; containing the first exon and SNP 17 (+45)). The amplified IL-1B promoter fragments were cloned into the vector pCRBlunt II-TOPO using the Zero Blunt TOPO PCR cloning kit (Invitrogen, CA) and then subcloned into the vector pGL3-Basic (Promega, WI) in the direction of 5 'of the luciferase reporter gene to generate parental constructs with different promoter region lengths. Sequencing of the BAC DNA clones revealed that the SNPs at positions 14 and 15 were the secondary alleles. These SNPs were sequentially converted into the sequences of the major alleles by site-directed mutagenesis so that the parental serial constructs for both the longest plasmid (containing SNPs 2-15 using the KpnI site just upstream of the SNP 2) as for a short plasmid (containing the promoter region outside the BamHI site between SNPs 9 and 10) they were uniformly allele 1 in all 13 SNPs (12 in the 5 'flanking region and 1 in the first exon). Site-directed mutagenesis of individual SNPs to allele 2 sequences was performed with the QuikChange XL site-directed mutagenesis kit (Stratagene, CA). Successful mutagenesis of the IL-1B promoter was confirmed by sequencing analysis and re-cloned into the original pGL3-Basic vector to avoid possible mutations introduced by PCR into the vector. The DNA used in cell transfection was prepared by the EndoFree Plasmid Maxi kit (Qiagen, CA) to guarantee minimal contamination with endotoxins. The genotypes of the IL-1B SNP constructs are listed in Table 6.

Cell culture and Reagents

The human monocytic cell line, THP-1, was obtained from the American Type Culture Collection (ATCC, VA). THP-1 cells were grown in RPMI 1640 medium (ATCC, VA) supplemented with 10% fetal calf serum (Hyclone, UT). The cells were subcultured every other day and kept at a cell density between 2 x10⁵ to 7 x 10⁵ cells / ml. Lipopolysaccharide (LPS; from Escherichia coli 055: B5) and phorbol 12-myristate-13-acetate (PMA) were obtained from Sigma (MO). Anti-NF-KB p50 (11-119) and anti-NF-KB p65 (c-20) were purchased from Santa Cruz Biotechnology, Inc. (CA).

ES 2 356 167 T3

Cell transfection and assessment of reporter activity

Prior to transfection, THP-1 cells were counted, washed, and resuspended in natural RPMI medium at 1.5-2x10.⁷ cells / ml. For transfection, 200 ng of pGLIL1 promoter constructs and 6.25 ng of phRL-TK (Promega, WI) were mixed with 750 µl of RPMI, 50 µl of 1 M TRIS at pH 7.4, 100 µl. DEAEdextran (2mg / ml) in phosphate buffered saline and 100 μl of THP-1 cells. The mixtures were incubated at 37 ° C for 30 minutes. The cells were centrifuged, washed, resuspended in 0.5 ml of culture medium, and transferred to a 24-well culture plate. Eighteen to twenty-four hours after transfection, cells were stimulated with phorbol 12-myristate-13-acetate (PMA, 20 ng / ml) and lipopolysaccharide (LPS) for 6 hours. The cells were then lysed in 100 µl of passive lysis buffer (Promega, WI). Cell lysate (20μ ^) was analyzed to determine the activities of both firefly and Renilla luciferase using the dual-luciferase indicator titration system (Promega, WI). Luciferase activity was measured with a 1450 MicroBeta luminometer (Perkin Elmer, MA). Promoter activity was normalized to Renilla activity from co-transfected phRL-TK. Each construct was transfected and scored for promoter activity in triplicate and transfection was performed for each construct at least three times.

Electromobility shift assessment (EMSA abbreviated for the English expression Electromobility Shift Assay)

THP-1 cells were cultured as described above and harvested without treatment or treated with 100 ng / ml LPS and 20 ng / ml PMA for various periods of time. Nuclear extracts were prepared according to Andrews NC and Faller DV³¹. Briefly, cells were resuspended in cold buffer A (10 mM HepesKOH, pH 7.9 - 1.5 mM MgCl2 - 10 mM KCl - 0.5 mM DTT - 2 mM AEBSF) and incubated on ice. for 10 minutes. The nuclear pellets were resuspended in cold C buffer (20 mM Hepes-KOH, pH 7.9 - 25% glycerol - 420 mM NaCl - 1.5 mM MgCl2-0.2 mM EDTA -DTT 0.5 mM - 2 mM AEBSF) for 30 minutes on ice. After centrifugation for 2 minutes at 4 ° C, the nuclear extracts were stored at -80 ° C. The oligonucleotides of each SNP (MWG Biotech, High Point, NC) were synthesized and purified on a 10% polyacrylamide gel. Complementary single-stranded oligonucleotides were re-associated and labeled with α³²P-dGTP by filling with Klenow (exo-). For protein-DNA binding, 7 μg of nuclear extracts were incubated with 5.0 X 10⁴ cpm of probes marked with³²-P for 20 minutes at room temperature in a volume of 20 μl of binding buffer (Hepes-KOH 12 mN, pH 7.9 - MgCl2 1.5 mM - KCl 60 mM - EDTA 0.2 mM - DTT 0, 5 mM - 0.4 mM AEBSF - 10% glycerol) and 2 µg of Poly (dI-dC) (Sigma, St. Louis, MO). The protein-DNA complexes were resolved on a 4% polyacrylamide gel and visualized by exposure to X-ray films. For cold oligonucleotide competition titers, nuclear extracts were incubated with a cold probe for 10 minutes at room temperature prior to the addition of the labeled probe. In antibody supershift titrations, 1-2 µg of antibody was added after binding of nuclear extracts to the labeled probe and incubated for 15 minutes at room temperature prior to gel loading. The oligonucleotide sequences are as follows:

Oligonucleotide name

B4C

B4C-r

B4T

B4T-r

B10G

B10G-r

B10C

B10C-r

B14C

B14C-r

B14T

B14T-r

B15T

B15T-r

B15C

B15C-r

5'-3 'cggagaatggaatgtcccttggactctgcatga (SEQ ID NO:) cgcgtcatgcagagtccaagggacattccattctccgagct (SEQ ID NO:) cggagaatggaatgttccttggactctgcatga (SEQ ID NO:) cgcgtcatgcagagtccaaggaacattccattctccgagct (SEQ ID NO:) ctcactcccttggataatgcagagcgagca (SEQ ID NO:) cgcgtgctcgctctgcattatccaagggagtgagagct (SEQ ID NO:) ctcactcccttgcataatgcagagcgagca (SEQ ID NO:) cgcgtgctcgctctgcattatgcaagggagtgagagct (SEQ ID NO:) ccaattgacagagagctcccgaggcagagaacagca (SEQ ID NO: ) Cgcgtgctgttctctgcctcgggagctctctgtcaattggagct (SEQ ID NO:) ccaattgacagagagctcctgaggcagagaacagca (SEQ ID NO:) cgcgtgctgttctctgcctcaggagctctctgtcaattggagct (SEQ ID NO:) ccttctgcttttgaaagctataaaaacagcgagggaga (SEQ ID NO:) cgcgtctccctcgctgtttttatagctttcaaaagcagaaggagct (SEQ ID NO:) ccttctgcttttgaaagccataaaaacagcgagggaga (SEQ ID NO:) cgcgtctccctcgctgtttttatggctttcaaaagcagaaggagct (SEQ ID NO:)

SNP B4 (-3737)

SNP B4 did not show differences in transcription per allele, on the backgrounds of the others

ES 2 356 167 T3

SNPs included in allele 1 (Figure 10).

EMSA analysis shows significant differences in protein binding between probes containing allele 1 and allele 2 of SNP B4. (Figures 15-17) Both alleles 1 and 2 show constant binding of a rapidly migrating band (complex 3) at 0, 4, 6 and 24 hours of LPS stimulation of the cells. Allele 1 shows strong binding of two high mobility complexes after LPS stimulation. Complex 1 consists of two bands close to each other and is present at the beginning of 4 o'clock. At 24 hours, the lower band of complex 1 disappears and complex 2 becomes evident (Figure 15) and competition with the unlabeled probe demonstrated the specificity of the binding (Figure 16). Allele 2 also bound to complex 2 at 24 hours but there was no evidence for complex 1 at either time. Due to the presence of a regulatory element NF-kB close to SNP B4, antibodies to both the p50 and p65 subunits of NF-kB were used in the EMSA incubation of allele-1 and allele-2 probes. As shown in Figure 17, lanes 7 and 8, the p50 antibody is capable of super-shifting both bands of complex 1 and the p65 antibody is capable of super-shifting only the upper band of complex 1. This result indicates that LPS / PMA stimulated NF-kB preferentially binds allele 1 of SNP B4.

SNP B10 (-1468)

In the background construction with the other SNPs located in allele 1, A) the presence of allele 2 in SNP 1310 produced a slightly lower transcriptional activity. (See Figure 11).

EMSA analysis with probes containing allele-1 and allele-2 of SNP10 demonstrated clear differences in protein binding profiles (Figure 18-19) with allele 2 of SNP B 10 binding to a group of high mobility proteins (HMG) (complex 1) more strongly than allele 2. Competition with an unlabeled probe showed that this strong binding preference was allele specific (Figure 19).

SNPB14 (-511)

The results of the transcriptional analysis for individual effects of various alleles at SNP 14 only are included in Figure 12. In the background constructs where the other SNPs are allele 1 (Fig. 20), SNP B14 became the allele. 2 (Fig. 20) and showed a higher promoter activity.

EMSA with probes containing allelic variants of SNP 14 showed 2 different complexes formed with this probe but without allelic differences in the mobility of protein complexes. (Figure 20). However, the promoter activity enhanced by allele 2 of SNP 14 indicates that there may be subtle differences in protein compositions between the two complexes bound to regulatory elements surrounding allele 1 and 2 of SNP 14 leading to functional impact. in transcriptional activity.

SNP 15 (-31)

The effect of allelic variation only in SNP B15 on transcriptional activity is also included in Figures 21-22. With the conversion of SNP B15 to allele 2 (Figure 21), there was a significant reduction in promoter activity compared to the base construct (Figure 21).

The EMSA protein profile of SNP B15 is markedly different for allele-1 (T) probes than for allele-2 (C) (Figure 22). As shown in Figure 22, two strong bands formed with allele 1 probe while 3 distinct bands formed with allele 2. A cold competition assay was performed to determine the specificity of protein binding to these allelic probes (Figure 22) and it was indicated that the protein binding of complex 1 is highly specific for allele 2, whereas complexes II and III have higher affinity for allele 1.

Example 10

Determination of the severity of periodontitis in subjects who had IL-1B genotypes

An indication of the severity of periodontitis in a subject is the depth of the cavities (PD for short, pocket depth). Severe periodontitis is classified in a subject who has a PD&gt; 2 in one or more cavities in the gums. PD was measured in subjects who had various IL-1B genotypes as shown in Table 10A (for example, a subject with the BP1 genotype has two alleles of IL-1B allele 1 (-511), two alleles of allele IL-1B 1 (-1468) and two alleles of IL-1B allele 2 (-3737). Table 10B shows the percentage distribution of IL-1B haplotypes in subjects with varying degrees of periodontitis, measured by the number of cavities in the gums per subject (less than 2 cavities, between 2 and 4 cavities, between 4 and 10 cavities, more than 10 cavities).

ES 2 356 167 T3

TABLE 10A

<td>Genotypes</td><td colspan="3">IL-1 B SNP alleles</td>

<td></td><td> -511</td><td> -1468</td><td> -3737</td>

<td>BP1</td><td> 1,1</td><td> 1,1</td><td> 2,2</td>

<td>BP2</td><td> 2,2</td><td> 2,2</td><td> 1,1</td>

<td>BP3</td><td> 1,1</td><td> 1,1</td><td> 1,1</td>

<td>BP4</td><td> 2,2</td><td> 1,1</td><td> 1,1</td>

TABLE 10B

<td>Genotypes</td><td colspan="4">% of distribution</td>

<td></td><td>0-2 cavities in gums</td><td>2 to 4 cavities in gums</td><td>4 to 10 cavities in gums</td><td>&gt; 10 cavities in gums</td>

<td>BP1</td><td> 0,429</td><td> 0,089</td><td> 0,304</td><td> 0,179</td>

<td>BP2</td><td> 0,833</td><td> 0,000</td><td> 0,167</td><td> 0,000</td>

<td>BP3</td><td> 0,375</td><td> 0,094</td><td> 0,188</td><td> 0,344</td>

<td>BP4</td><td> 0,364</td><td> 0,091</td><td> 0,000</td><td> 0,545</td>

As shown in Table 10B and Figure 23, subjects who have genotypes BP1, BP3, or BP4 are more likely to develop severe periodontitis, while subjects who have genotype BP2 are less likely to develop severe periodontitis.

Example 11

Determination of the severity of periodontitis in ethnic populations

Previously, in white men, specific variations in IL-1 genes (IL-1A (+4845), IL-1A (-889) and IL-1B (+3954)) were associated with increased of the severity of periodontitis. These IL-1 SNPs are of low prevalence in the Asian populations that have been studied, which include Japanese, Koreans, and Chinese. Since the prevalence of a polymorphism and its penetration in relation to the expression of the disease affects the size of the sample necessary to identify the association between the allele of interest and the expression of the disease, most of the previous studies in Asian populations have been too small to accurately assess whether IL-1A (+4845) and IL-1B (+3954) are associated with periodontal disease. This example details the specific variations of IL-1 genes that predict the most severe periodontitis in Japanese adults. This was done by analyzing haplotypes in IL-1 gene clusters to determine genetic variations associated with clinical variance in periodontitis, using high-density SNP mapping of all exons and regulatory regions of the genes for Π. -1α (IL-1A), IL-1j6 (IL-1B) and the gene for the IL-1 receptor antagonist (IL-1RN), which encompasses the cluster of nine IL-1 genes on chromosome 2q13-14.

There are several predominant haplotypes of IL-1 that are defined by six SNPs. Of the 64 possible haplotypes, 23 haplotypes constitute more than 98% of the haplotypes in the white and African American race. The same haplotypes constitute more than 97% of the haplotypes observed in Japanese patients. (See Table 11A). Haplotypes containing allele 2 in IL-1rN (+2018) only represent 3.7% of haplotypes, which would produce an expected rate of homozygous individuals at that locus of approximately 1/1000 subjects. Allele 2 in IL-1A (+4845) and IL-1B (+3954) was also so rare that only about 1/100 individuals would be expected to be homozygous at that locus. Haplotypes were estimated using the haplo.score version 1.0 program (Schaid et al, 2002). This computer program applies a version of the EM algorithm (Excoffier and Slatkin, 1995) to correctly assess phase ambiguity.

ES 2 356 167 T3

<td colspan="10">Table 11 A. Frequency of IL-1 haplotypes in subjects of various ethnicities.</td>

<td>Gen:</td><td colspan="2">IL-1A</td><td colspan="2">IL-1B</td><td colspan="2">IL-1RN</td><td></td><td></td><td></td>

<td></td><td> 4845</td><td> 3954</td><td> -511</td><td> -1468</td><td> -3737</td><td> 2018</td><td>Freq. in japanese</td><td>Freq. in white race</td><td>Freq. in black race</td>

<td>Haplotype</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>IL1C1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 2</td><td> 1</td><td> 0,458</td><td> 0,339</td><td> 0,241</td>

<td>IL1C2</td><td> 2</td><td> 2</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 0,039</td><td> 0,145</td><td> 0,029</td>

<td>IL1C3</td><td> 1</td><td> 1</td><td> 2</td><td> 2</td><td> 1</td><td> 2</td><td> 0,03</td><td> 0,137</td><td> 0,05</td>

<td>IL1C4</td><td> 1</td><td> 1</td><td> 2</td><td> 2</td><td> 1</td><td> 1</td><td> 0,279</td><td> 0,097</td><td> 0,056</td>

<td>IL1C5</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 2</td><td> 2</td><td> 0,007</td><td> 0,071</td><td>ND</td>

<td>IL1C6</td><td> 1</td><td> 1</td><td> 2</td><td> 1</td><td> 1</td><td> 1</td><td> 0,048</td><td> 0,038</td><td> 0,331</td>

<td>IL1C7</td><td> 2</td><td> 1</td><td> 1</td><td> 1</td><td> 2</td><td> 1</td><td> 0,015</td><td> 0,031</td><td> 0,013</td>

<td>IL1C8</td><td> 1</td><td> 2</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td>ND</td><td> 0,021</td><td>ND</td>

<td>IL1C9</td><td> 2</td><td> 1</td><td> 2</td><td> 2</td><td> 1</td><td> 2</td><td>ND</td><td> 0,02</td><td>ND</td>

<td>IL1C10</td><td> 2</td><td> 2</td><td> 1</td><td> 1</td><td> 1</td><td> 2</td><td>ND</td><td> 0,019</td><td>ND</td>

<td>IL1C11</td><td> 2</td><td> 1</td><td> 2</td><td> 1</td><td> 1</td><td> 1</td><td> 0,025</td><td> 0,016</td><td> 0,039</td>

<td>IL1C12</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 0,027</td><td> 0,015</td><td> 0,061</td>

<td>IL1C13</td><td> 2</td><td> 2</td><td> 2</td><td> 2</td><td> 1</td><td> 1</td><td>ND</td><td> 0,01</td><td>ND</td>

<td>IL1C14</td><td> 2</td><td> 2</td><td> 1</td><td> 1</td><td> 2</td><td> 1</td><td>ND</td><td> 0,007</td><td> 0,019</td>

<td>IL1C15</td><td> 2</td><td> 2</td><td> 2</td><td> 2</td><td> 1</td><td> 2</td><td>ND</td><td> 0,007</td><td>ND</td>

<td>IL1C16</td><td> 1</td><td> 1</td><td> 2</td><td> 1</td><td> 1</td><td> 2</td><td>ND</td><td> 0,006</td><td> 0,009</td>

<td>IL1C17</td><td> 2</td><td> 1</td><td> 2</td><td> 2</td><td> 1</td><td> 1</td><td> 0,008</td><td> 0,006</td><td>ND</td>

<td>IL1C18</td><td> 1</td><td> 1</td><td> 1</td><td> 2</td><td> 1</td><td> 1</td><td> 0,021</td><td>ND</td><td>ND</td>

<td>IL1C19</td><td> 1</td><td> 1</td><td> 2</td><td> 1</td><td> 2</td><td> 1</td><td> 0,01</td><td>ND</td><td>ND</td>

<td>IL1C20</td><td> 2</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 0,005</td><td>ND</td><td> 0,049</td>

<td>IL1C21</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 2</td><td>Q</td><td> ?</td><td> 0,008</td>

<td>IL1C22</td><td> 1</td><td> 2</td><td> 2</td><td> 1</td><td> 1</td><td> 1</td><td> ?</td><td> ?</td><td> 0,035</td>

<td>IL1C23</td><td> 2</td><td> 2</td><td> 2</td><td> 1</td><td> 1</td><td> 1</td><td> ?</td><td> ?</td><td> 0,047</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td>Totals</td><td> 0,972</td><td> 0,985</td><td> 0,987</td>

Three SNPs have been identified in the IL-1B promoter that are functional and highly prevalent in Japanese subjects. These SNPs include IL-1B (-511), IL-1B (-1468), and IL-1B (-3737). Figure 24 shows the distribution of the relative frequencies in the haplotypes of the alleles listed in Table 11A in Caucasian and Japanese subjects. The authors of the present invention have determined that the predominant haplotypes, based on these 3 SNPs, show significant differences in the levels of IL-1 ^ in the gingival fluid (GCF). Figure 25 demonstrates that Caucasian subjects having the H1 or H3 genotype have increased inflammation, measured compared to the other haplotypes using a scoring statistic. A scoring statistic is a statistic used to evaluate the statistical significance of parametric estimates calculated by maximum probability methods. It is also sometimes called an efficient scoring statistic. The test is based on the behavior of the logarithmic probability function at the point where the respective parametric estimate is equal to 0.0 (zero); specifically, the derivative (slope) of the logarithmic probability function evaluated at the null hypothesis value of the parameter (parameter = 0.0) is used.

In subjects of Japanese ethnicity, the predisposition to periodontal disease and the severity of the disease have been determined to be affected by the IL-1 haplotype.

One method to measure periodontal disease uses the generalized Bleeding on Probing (BOP) test. As shown in Figure 26, Japanese subjects who have a genotype that is homozygous at allele 2 of IL-1B (-511), homozygous in IL-1B allele 2 (-1468), and homozygous in IL-1B allele 1 (-373) have a lower risk of periodontitis as measured by the generalized BOP assay. This decrease in risk is seen in two different percentage increases in plate-covered surfaces.

Another method of measuring periodontopathy to obtain the association between specific IL-1 haplotypes and the severity of periodontitis involves measuring the depth of probing and the level of probe coupling of a subject. These measurements are performed on individuals, whose haplotypes are identified, and the mean percentage of the measured sites having a probing depth greater than 4 mm or the probe coupling level greater than or equal to 4 mm are determined. As shown in Figure 27, Japanese subjects who have an IL-1 H1, H3, or H4 haplotype have a greater severity of periodontitis compared to subjects who have an H2 haplotype, as measured by these methods.