Non-aggregating, non-quenching oligomers comprising nucleotide analogues; methods of synthesis and use thereof

ES 2 344 337 T3

DESCRIPTION

Non-aggregating, non-fluorescence blocking oligomers comprising nucleotide analogs; synthesis methods and their use.

Technical field

The description relates to the use of nucleotide analogs to provide improved properties to hybridization probes, including DNA and RNA probes and modified nucleic acid probes, such as nucleic acid peptides (PNAs), and chimeric probes containing two or more more types of nucleic acids and / or modified nucleic acids.

Background

Hybridization analysis is central to a number of techniques in molecular biology and diagnostics, including gene cloning, gene identification, forensic analysis, pharmacogenomics, and identification of genetic polymorphisms. Hybridization can be used as the goal of an assay, in which the presence of hybridized probes constitutes the readout for the assay; or hybridization can be used as the initial step in an assay, in which a post-hybridization event (such as, for example, extension of a hybridized primer or hydrolysis of a hybridized probe) is used as the readout.

Traditionally, the hybridization probes and primers have been DNA molecules; however, there are certain disadvantages to using DNA as a probe or primer. For example, the base composition of a DNA molecule can affect its effectiveness as a probe or primer in several ways. A DNA molecule with a high concentration of G residues is often difficult to handle (eg, problems with aggregation and poor solubility) and can provide high background noise in hybridization reactions. It is also known that G-rich DNA molecules are prone to the production of artifacts in analysis of DNA sequences by gel electrophoresis, presumably due to the adoption of secondary structures by these molecules, despite the denaturing conditions under those that carry out such analyzes.

Various modified forms of DNA and DNA analogs have been used in an attempt to overcome some of the disadvantages of using DNA molecules as probes and primers. Among these are nucleic acid peptides (PNAs, also known as nucleic acid polyamides). Nielsen et al. (1991) Science 254: 14971500. PNAs contain heterocyclic base units, as found in DNA and RNA, that are linked by a polyamide backbone, rather than the characteristic sugar-phosphate backbone of DNA and RNA. PNAs are capable of hybridizing to complementary DNA and RNA target sequences and, in fact, hybridize more strongly than the corresponding nucleic acid probe. Furthermore, PNAs are resistant to many types of nucleases that attack the sugar-phosphate backbones of DNA and RNA. Other advantages of ANPs include the ability of specifically modified ANPs to cross the blood-brain barrier and the observation that ANPs injected intrathecally can mediate antisense effects in vivo. During et al. (1999) Nature Biotechnol. 17: 753-754.

The synthesis of PNA oligomers and reactive monomers used in the synthesis of PNA oligomers has been described in US Patents No. 5,539,082; 5,714,331; 5,773,571; 5,736,336 and 5,766,855. Alternative approaches to PNA synthesis and monomers for PNA synthesis are summarized in Uhlmann et al. (1998) Angew. Chem. Int. Ed 37: 2796-2823.

However, as they have become widely used, the disadvantages of NAPs have also been seen. For example, long PNA oligomers, depending on their sequence, are prone to aggregation, difficult to purify, and difficult to characterize. Furthermore, PNA oligomers rich in purines tend to aggregate and are poorly soluble in aqueous medium. Gangamani et al. (1997) Biochem. Biophys. Res. Comm. 240: 778-782; Egholm, Cambridge Healthtech Institute's Seventh Annual nucleic acid-Based Technologies, June 21-23, 1999, Washington, DC; Uhlmann, Cambridge Healthtech Institute's Seventh Annual nucleic acid -Based Technologies, June 21-23, 1999, Washington, DC As a consequence, the effective use of PNAs in hybridization is limited to sequences in which there are no more than 4-5 consecutive purines, no more than 6 purines in any 10-base portion of the sequence, and / or no more of 3 consecutive G residues. See, for example, http://www.resgen.com/perseptivedesign.html. Furthermore, since PNA-PNA interactions are even stronger than PNA-DNA interactions, PNA-containing probes and primers containing self-complementary sequences cannot generally be used for hybridization to a target sequence. Another consequence of the strong interaction between PNA and complementary DNA and / or RNA molecules is that it is difficult to obtain single nucleotide mismatch discrimination using PNA probes. Demidov et al. (1995) Proc. Natl. Acad. Sci. USA 92: 2637-2641.

Uhlmann et al., Supra review approaches to increase the solubility of PNAs, which include the synthesis of PNA / DNA chimeras and the addition of terminal lysine residues to a PNA oligomer. They do not describe the use of nucleotide analogs to increase the solubility and improve the hybridization properties of PNA oligomers.

Similar design constraints are required in the synthesis of oligonucleotide probes and primers that do not contain PNAs. See, for example, the publication entitled "Quantitative Test Design and Optimization of

ES 2 344 337 T3

Sequence Detection Systems ”, PE Biosystems, reservation number. 117MI02-01. In these cases, the G / C content of an oligomer should be kept within the range of 20-80% and the use of an identical nucleotide, particularly guanine (G), should be avoided. In particular, the aforementioned publication cautions about stretches of four or more G residues and against the presence of a G residue at the 5 'terminal end of a 5' fluorescently labeled probe. In the case of primers, the five nucleotides at the 3 'end cannot comprise more than two G and / or C residues.

The synthesis of pyrazolo [3,4-d] pyrimidine and 7-deazapurine nucleosides, as well as their phosphoramidite monomers, have been described for use in oligomer synthesis. Seela et al. (1985) Nucl. Acids Res. 13: 911-926; Seela et al. (1986a) Helv Chim. Acta 69: 1191-1198; Seela et al. (1986b) Helv. Chim. Acta 69: 1813-1823; and Seela et al. (1987) Biochem. 26: 2232-2238. Pyrazolo [3,4-d] pyrimidine and 7-deazapurine nucleosides for use in DNA sequencing and as antiviral agents are described in EP 286 028. PCT co-publication WO 99/51775 describes the use of oligonucleotides that they contain pyrazolo [3,4-d] pyrimidine for hybridization and mismatch discrimination. Incorporation of 2'-deoxy-7-deazaguanosine into DNA has been reported to eliminate band compression in GC-rich stretches during DNA sequence analysis by gel electrophoresis (US Patent No. 5,844,106) , reduces the formation of tetraplexes by sequences rich in G (Murchie et al. (1994) EMBO J. 13: 993-1001) and reduces the formation of characteristic aggregates of DNA molecules containing 2'-deoxyguanosine (United States Patent No. 5,480,980). However, the substitution of oligonucleotides with 7-deazaadenosine (instead of A) or 7-deazaguanosine (instead of G) decreases the Tm of the hybrids formed by these substituted oligonucleotides, with more than one degree of reduction in the Tm per substituted base. Seela et al. (1987) supra; and Seela et al. (1986) Nucl. Acids Res. 14: 2319-2332.

On the other hand, the stabilization of duplexes by analogues of the pyrazolopyrimidine base has been described. Seela et al. (1988) Helv. Chim. Acta. 71: 1191-1198; Seela et al. (1988) Helv. Chim Acta. 71: 1813-1823; and Seela et al. (1989) nucleic acid Res. 17: 901-910. Oligonucleotides in which one or more purine residues have been replaced by pyrazolo [3,4-d] pyrimidines show improved duplex and triplex forming ability, as described, for example, in Belousov et al. (1998) nucleic acid Res. 26: 1324-1328; US Patent No. 5,594,121 and shared PCT publication WO 98/49180. Pyrazolo [3,4-d] pyrimidine residues in oligonucleotides are also useful as sites of attachment of various pendant groups to oligonucleotides. See PCT joint publication WO 90/14353, November 29, 1990 and US Patent No. 5,824,796. None of these references describe the use of pyrazolopyrimidines or any other type of base analog to reduce aggregation and / or increase the solubility of an oligomer, or to decrease the blocking of fluorescence of a fluorophore conjugated to an oligomer.

Conjugates comprising a minor groove binding ligand (MGB), an oligonucleotide in which one or more purine residues are replaced by a pyrazolo [3,4-d] pyrimidine (PZP) residue, a fluorophore, and a blocker of fluorescence are described in shared PCT publications WO 99/51621 and WO 99/51775. Such conjugates are used, inter alia, as hybridization probes, primers and hydrolyzable probes in 5'-nuclease based amplification assays. The inclusion of an MGB in these conjugates increases the stability of the hybrids formed by the oligonucleotide portion of the conjugate, allowing the design of shorter probes. Furthermore, both MGB and PZP contribute to the ability of such conjugates to exhibit improved mismatch discrimination. None of the publications mentioned above describe the use of PZP or any other type of base analog to reduce aggregation and / or increase the solubility of an oligomer, or to decrease the blocking of fluorescence of a fluorophore conjugated to an oligomer.

In a first aspect of the present invention a conjugate is provided comprising:

(a) a polymer comprising a series of monomer units; and (b) a fluorophore covalently attached thereto, wherein one or more of the monomer units comprises a base analog, wherein the base analog is selected from the group consisting of pyrazolopyrimidines, such as the analog of bases retain the base pairing specificity of the bases for which they are substituted, and leads to a reduction in blocking of fluorophore fluorescence and / or reduced polymer self-association.

Oligomers are provided in which at least one of the subunits comprises a pyrazolopyrimidine base analog. The oligomers can comprise DNA, RNA, PNA, or any combination or chimera thereof. Any number of purine residues in the oligomer can be substituted by a base analog. Any of these aforementioned oligomers may comprise additional moieties such as fluorophores, fluorescence blockers and / or minor groove binding ligands.

Oligomers in which at least one of the subunits comprises a pyrazolopyrimidine base analog, when used for hybridization, have less tendency to aggregation and self-association, are more soluble, have increased mismatch discrimination ability, and do not block emission of conjugated fluorescent labels.

ES 2 344 337 T3

Also provided are oligomers comprising one or more PNA residues wherein at least one of the PNA residues comprises a pyrazolopyrimidine base analog. The oligomers can exclusively comprise PNA residues, or the oligomers can comprise both PNA nucleotide residues and / or DNA and / or RNA to constitute a PNA / DNA, PNA / RNA or PNA / DNA / RNA chimera. Any number of purine residues in the oligomer can be substituted by a base analog. Any of the aforementioned oligomers may comprise additional moieties such as fluorophores, fluorescence blockers and / or minor groove binding ligands.

Compositions comprising a polymer and a fluorophore are provided, wherein one or more purine-containing residues of the polymer are substituted with a residue comprising a pyrazolopyrimidine base analog. The polymers can comprise PNA, DNA, RNA, or any combination or chimera thereof; and the base analog may be present in any portion of the chimeric polymer PNA, DNA, or RNA. Any number of purine residues in the polymer can be substituted by a base analog, in any of the PNA, DNA and / or RNA portions. The aforementioned compositions may optionally comprise a fluorescence blocker and / or minor groove binding ligands.

In the polymer-fluorophore compositions just described, blocking of the fluorophore by purine residues in the polymer is reduced when one or more purines is substituted with a base analog. Such compositions additionally comprising a fluorescence blocker are useful, for example, as probes in hydrolyzable probe assays, in which blockage of the fluorophore by the fluorescence blocker is reduced by hybridization-dependent hydrolysis of the probe. The reduction in blocking provided by substituting a base analog for a purine leads to higher fluorescence emission after hydrolysis and therefore higher sensitivity in such assays.

New intermediates for the synthesis of PNA-containing oligomers comprising base analogs are also described. In one embodiment, acetic acid derivatives of pyrazolopyrimidine and pyrrolopyrimidine base analogs are provided, wherein the N1 of pyrazolopyrimidine or pyrrolopyrimidine is attached to the C2 of an acetic acid moiety and the functional groups are blocked. These derivatives are useful for the preparation of monomers for the automated synthesis of substituted PNAs and PNA / DNA chimeras. Preferable embodiments of these intermediates include 2- {6 - [(1E) -1-aza-2- (dimethylamino) vinyl] -4-hydroxypyrazolo [5,4-d] pyrimidinyl} acetic acid; 2- (6-amino-4-hydroxypyrazolo [5,4-d] pyrimidinyl) acetic acid; and 2 - (- 4-aminopyrazolo [5,4d] pyrimidinyl) acetic acid.

Also described are aminoethylglycyl derivatives of the aforementioned acetic acid derivatives of pyrazolopyrimidine and pyrrolopyrimidine base analogs, in which the α-amino group of a blocked glycyl portion is derived to C1 of acetic acid of acetate and to C2 of a portion of ethylamine. These derivatives are also known as "PNA monomers". Such compounds are useful for the automated synthesis of the aforementioned oligomers and polymers. Preferable embodiments of PNA monomers containing PPG (also known as PPPG) include 5- [4-hydroxy-6- (2-methylpropanoz7amino) pyrazolo [5,4-d] pyrimidinyl] -3- (2 - {[acid (4-methoxyphenyl) diphenylmethyl] amino} ethyl) -4-oxopentanoic and 1- {6 - [(1E) -aza-2- (dimethylamino) vinyl] -4-hydroxypyrzolo [5,4-d] pyrimidinyl} -N- ( 2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) -N- (2-oxypropyl) acetamide. A preferred embodiment of a PPA-containing PNA monomer is 2- [N- (2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) -2- {4 - [(4-methoxyphenyl) carbonylamino] pyrazolo acid [5,4-d] pyrimidinyl} acetylamino] acetic.

Also described are methods for the synthesis of oligomers comprising PNA, DNA, RNA and / or chimeras thereof, in which the aforementioned PNA monomers are used in one or more steps in the synthesis. Oligomers synthesized by these methods are also provided.

In another embodiment, methods are provided for detecting a target sequence in a polynucleotide by hybridization to a probe comprising a DNA, PNA, or PNA / DNA oligomer, wherein one or more residues in the probe comprises a base analog. pyrazolopyrimidine. In the practice of these methods, the probe may additionally comprise one or more of a ribonucleoside, a fluorophore, a fluorescence blocker and / or a minor groove binding ligand.

In another embodiment, methods are provided for the detection of a target sequence in a polynucleotide using compositions comprising a polymeric portion (comprising a polymer) and a fluorogenic portion (comprising one or more fluorophores), wherein one or more most of the polymer's purine-containing residues are replaced by a residue comprising a pyrazolopyrimidine base analog. Polymers for use in the method can comprise PNA, DNA, RNA, or chimeras thereof; and the base analog may be present in any of the PNA, DNA, or RNA portions of a chimeric polymer. Any number of purine residues in the polymer can be substituted by a base analog. In a preferred embodiment, the method is practiced using a composition in which a purine residue in the polymeric portion that is directly adjacent to the fluorogenic portion is replaced with a pyrazolopyrimidine. In another preferred embodiment, oligomers containing three or more consecutive G residues have their consecutive G residues substituted for PPG. Compositions for use in this method may optionally comprise a fluorescence blocker and / or a minor groove binding ligand.

ES 2 344 337 T3

In additional embodiments, methods are provided for detecting a target sequence in an amplification reaction, using the compositions of the invention. In a preferred embodiment, the amplification reaction comprises a hydrolyzable probe assay.

Oligomer microchips are also provided in which at least one of the oligomers described herein is present on the chip.

Also provided are methods for detecting a target sequence in a polynucleotide, wherein the polynucleotide is present in a sample, by hybridization to a composition as described herein. In a preferred embodiment, the target sequence exhibits a single nucleotide mismatch to the related sequence that is also present in the sample, and the composition forms a hybrid with the target sequence but not with the related sequence.

Brief description of the figures

Figure 1 shows the real-time fluorescence analysis of a series of hydrolyzable probe assays using probes containing G between 2 and 9 nucleotides (Seq ID No. 1-8) as fluorescent probes and compared to probes in which G residues are substituted for PPG (Seq ID No. 9-16).

Detailed description

The practice of the invention will employ, unless otherwise indicated, conventional techniques in organic chemistry, biochemistry, oligonucleotide synthesis and modification, bioconjugate chemistry, nucleic acid hybridization, molecular biology, microbiology, genetics, recombinant DNA, and fields related to experts in the field. These techniques are fully explained in the literature. See, for example, Maniatis, Fritsch & Sambrook, MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Harbor Laboratory Press (1982); Sambrook, Fritsch & Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition, Cold Spring Harbor Laboratory Press (1989); Ausubel, et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons (1987 and annual updates); Gait (ed.), OLIGONUCLEOTIDE SYNTHESES: A PRACTICAL APPROACH, IRL Press (1984); Eckstein (ed.), OLIGONUCLEOTIDES AND ANALOGUES: A PRACTICAL APPROACH, IRL Press (1991).

The descriptions of all publications and patents cited herein are incorporated in their entirety by reference.

Definitions

The terms deazapurine and pyrrolopyrimidine are used interchangeably to indicate a heterocyclic nucleus comprising fused pyrimidine and pyrrole rings, according to the following general formula:

<img file="ES2344337T3_D0001.tif" />

The term pyrazolopyrimidine refers to a heterocyclic nucleus comprising fused pyrimidine and pyrazole rings, according to the following general formula:

<img file="ES2344337T3_D0002.tif" />

A "monomer" refers to a composition comprising a base or base analog covalently attached to a reactive portion, such that the monomer can be incorporated, via the reactive portion, as part of an oligomer or polymer. In certain cases, the functional groups on the base / base analog portion and / or on

ES 2 344 337 T3 the reactive portion is blocked from being reactive during polymerization. In preferred embodiments, the reactive portion is an aminoethylglycine portion, in which case the monomer can be described as "PNA monomer."

An "oligomer" is a polymer comprising linked monomer units. The oligomers can be synthesized by sequential linking of the monomers, via their reactive moieties, as is known in the art. An oligomer can comprise a DNA oligomer, an RNA oligomer, a PNA oligomer, or any chimeric oligomer composed of DNA, RNA, and / or PNA monomers.

A "blocking group" or "protecting group" is any chemical moiety capable of preventing the reactivity of an N, S, or O atom to which it is attached, under conditions in which said N, S, or O atoms may otherwise be reactive. Examples of protecting groups include, but are not limited to, tert-butyloxycarbonyl (tBoc), 4-methoxyphenyldiphenylmethyl (MMTr), isobutyryl (iBu), 9-fluoronylmethyloxycarbonyl (Fmoc), -C groups₆H₅ (benzyl), diphenylcarbamoyl (DPC), 2-N-dimethylvinyl (Dmv), benzyloxycarbonyl (Cbz), benzoyl (bz), isobutanoyl, acetyl, and anisoyl (An). These and other protecting groups useful in the synthesis of nucleic acids and oligomers of PNA are known in the art. Uhlmann et al. (1998) Angew. Chem. Int. Ed 37: 2796-2823; Green, et al. in Protective Groups in Organic Synthesis, 2^to Edition, John Wiley and Sons, Inc, NY., Pp. 441-452. 1991.

Oligomers

The invention provides oligomers in which one or more purine bases are substituted with a base analog of the same base pairing specificity as the purine it replaces. Analogs can be pyrazolopyrimidines or pyrrolopyrimidines. The oligomers can comprise DNA oligonucleotides, RNA oligonucleotides, PNA oligomers, or chimeras thereof. A chimera refers to an oligomer that comprises more than one type of subunit, for example, an RNA / DNA chimera, a PNA / DNA chimera, an RNA / PNA chimera, or a PNA / DNA / RNA chimera. For chimeric oligomers, a base analog may be present in any portion of the chimera (ie, a portion of the DNA, a portion of the RNA, and / or a portion of the PNA).

Methods for the synthesis of DNA, RNA and PNA oligomers are known in the art. See, for example, US Patent No. 5,419,966; Gait, supra; Eckstein (ed.) "Oligonucleotides and Analogues: A Practical Approach", 1991, IRL Press, Oxford; Ogilve et al. (1988) Proc. Natl. Acad Sci. USA 85: 5746-5748; Nielsen et al. (1991) supra; Uhlmann et al. (1998) supra; US Patents No. 5,539,082; 5,714,331; 5,773,571; 5,736,336 and 5,766,855. Other modified DNA and / or RNA oligomers can also be used. For example, methods for the synthesis of 2'-O-methyl oligoribonucleotides have been described. Sproat et al. (1989) Nucleic acid Res. 17: 3373-3386.

In general, the methods for the synthesis of oligomers comprise sequential cycles d of monomer addition to a growing oligomer chain that is optionally attached to a solid support, wherein the growing oligomer chain optionally contains protected functional groups and a growing end. locked. Typically, in each monomer addition cycle, the growing chain attached to the support is first subjected to conditions that unblock the growing end, then condensed with a monomer, which is optionally activated by condensation. Unblocking reagents and conditions, as well as activating conditions and reagents, are known in the art. The monomer addition step is repeated as often as necessary, with the identity of the monomer added at each step corresponding to the desired sequence of the oligomer. When the desired sequence has been obtained, the nascent oligomer is subjected to conditions that deprotect the functional groups and / or cleave the entire oligomer from the support, then purify, if necessary.

PNA oligomers are often used as surrogates for DNA oligonucleotides in hybridization and other techniques. However, PNA oligomers tend to aggregate and often exhibit reduced solubility in aqueous solvents, especially PNAs rich in G. In a preferred embodiment, a PNA oligomer comprises one or more residues in which a purine base is substituted by a pyrazolopyrimidine or pyrrolopyrimidine base analog; for example, G is substituted for PPG or 7-deazaguanine, A is substituted for PPA or 7-deazaadenine, and G or A is substituted for PPI or 7-deazahypoxanthine. In this way the base analog retains the base pairing specificity of the base for which it is substituted. In a more preferred embodiment, a PNA oligomer is provided with one or more G residues substituted for PPG. Such PPG-substituted PNAs exhibit reduced intermolecular and intramolecular self-association when compared to oligomers containing G. This facilitates purification and handling of oligomers and provides improved hybridization properties (eg, increased sensitivity), especially for probe sequences that contain three or more consecutive G residues.

Since a base analog retains the base-pairing specificity of the base it replaces, the oligomers of the invention are capable of sequence-specific binding to complementary sequences and may exhibit increased duplex and triplex formation to single and double stranded targets, respectively.

Without wishing to be bound by theory, applicants note that, when compared to naturally occurring purine bases, pyrazolopyrimidine and pyrrolopyrimidine base analogs are less likely to form non-canonical base pairs (such as GT and GG pairings). , still retaining the ability to form the characteristic canonical pairings of the purines they substitute (that is, PPG-C, 7PG-C, PPA-T and 7PA-T pairings).

ES 2 344 337 T3

Base analogs and their synthesis

Base analogs are provided in oligomers and in intermediates for oligomer synthesis. The base analog has a structure as indicated in Formula 1, wherein R1 and R2 are independently -H, -OH, -SH, or -NH2; R3 is -H, -CN, halogen (F, Cl, Br or I), or -R12-Y, where R11 is C1-C12 alkyl, alkenyl or alkynyl and Y is -H, -OH, -NH2 or -SH; X is = CH- or = N-; and L is the linkage to an oligomer backbone, such as DNA, RNA, PNA, or any chimera thereof.

<img file="ES2344337T3_D0003.tif" />

When X is = N-, the base analog is pyrazolopyrimidine and when X is = CH-, the base analog is pyrrolopyrimidine (also known as 7-deazapurine). For example, when X is = N-, R1 is -OH, R2 is -NH2, and R3 is -H, the base analog is pyrazolopyrimidinylguanine (PPG). When X is = N-, R1 is -NH2, and R2 and R3 are -H, the base analog is pyrazolopyrimidinyladenine (PPA). When X is = N-, R1 is -OH, and R2 and R3 are -H, the base analog is pyrazolopyrimidinylhypoxanthine (PPI).

When X is = C-, R1 is -OH, R2 is -NH2, and R3 is -H, the base analog is 7-deazaguanine (7PG). When X is = C-, R1 is -NH2, and R2 and R3 are -H, the base analog is 7-deazaadenine (7PA). When X is = C-, R1 is -OH, and R2 and R3 are -H, the base analog is 7-deazahypoxanthine (7PI).

PPG and 7-deazaguanine possess the same base-pairing properties as guanine (that is, it pairs with C), while PPA and 7-deazaadenine possess the same base-pairing properties as adenine (that is, it pairs with T and U). PPI and 7-deazahypoxanthin possess equivalent base-pairing properties to both G and A and therefore pair with C, T, and U.

The base analogs comprising the oligonucleotides are synthesized by automated methods that are well known in the art, using precursors ("PNA monomers") according to Formula 3. The monomers are produced using intermediates possessing the structure depicted in Formula 2.

<img file="ES2344337T3_D0004.tif" />

The functional groups allowed in Formulas 1 and 2 are as follows. R1 and R2 are independently -H, -OH, -OR6, -SH, -NH2 or -NHR7; R3 is -H, -CN, halogen (F, Cl, Br or I), or -R12-Y, where R12 is C1-C12 alkyl, alkenyl or alkynyl and Y is -H, -OH, -NH2 or -SH, R4 is -H or a protecting group selected from the group consisting of tert-butyloxycarbonyl (tBoc), 4-methoxyphenyldiphenylmethyl (MMTr), isobutyryl (iBu) and 9-fluoronylmethyloxycarbonyl (Fmoc); R5 is -H or -C6F4H (TFP); R6 is -H, -C6H5 (benzyl) or a diphenylcarbamoyl group (DPC); R7 is a protecting group selected from the group consisting of 2-N-dimethylvinyl (Dmv), benzyloxycarbonyl (Cbz), monomethoxytrityl (MMtr), benzoyl (bz), isobutyryl (iBu), isobutanoyl, acetyl, and anisoyl groups (An) ; and X is = CHo = N-.

ES 2 344 337 T3

These formulas include all isomers and tautomers of the molecules they symbolize. The preferable embodiments of the precursors for the synthesis of pNa and the intermediates used in the synthesis of these precursors are as follows. When R1 is -OH, R2 is -NH2, R3 is -H and X is = N- in Formula 2, the resulting structure is 2- (6-amino-4-hydroxypyrazolo [5,4-d] pyrimidinyl) acid acetic (PPGA). When R1 is -NH2, R2 is -H, R3 is -H and X is = N- in Formula 2, the resulting structure is 2- (4-aminopyrazolo [5,4-d] pyrimidinyl) acetic acid (PPAA) . The corresponding derivatives of Formula 3, where R4 and R5 are -H, are abbreviated MPPGA and MPPAA, respectively. The blocking derivatives of these compounds are also provided, as described below.

The designation "pyrazolo [5,4-d] pyrimidine" as used herein refers to the same structures as those referred to as pyrazolo [3,4-d] pyrimidines in earlier shared publications, patents, and patent applications. See, for example, US Patent No. 5,824,796; PCT WO 99/51621 and PCT WO 99/51775. The reason for this nomenclature change is so that the names by which the structures are identified comply with those assigned to the structures using the NamExpert and Nomenclator naming programs, provided by ChemInnovation Software, San Diego, CA.

The synthesis of pyrazolopyrimidine and pyrrolopyrimidine bases is accomplished by methods known in the art. Seela et al. (1985) supra; Seela et al. (1986a), supra; Seela et al. (1986b), supra; and Seela et al. (1987) supra. Using the reactions described by Uhlmann et al. (1998) supra for the synthesis of 2-substituted purine acetic acid derivatives, appropriately protected 4-aminopyrazolo [5,4-d] pyrimidine (PPA) and 6-amino-4-hydroxypyrazolo [5,4-d] pyrimidine ( PPG) can react with alkyl 2-bromoacetate to provide products of Formula 2. Since alkylation can occur at both nitrogen atoms 1 and 2 of pyrazolopyrimidines, isomer separation and purification of the 1-substituted isomer is necessary. In the case of 7-deazapurines and related pyrrolopyrimidines, reaction with alkyl 2-bromoacetate provides only the N1-substituted product.

Accordingly, PPGA (3) can be synthesized from 4-methoxypyrazolo [5,4-d] pyrimidine-6-ylamine (4) (Seela et al. (1985) Heterocycles 23: 2521-2524) by alkylation with ethyl 2-chloroacetate in the presence of sodium hydride, followed by separation of the isomers (Reaction Scheme 1).

<img file="ES2344337T3_D0005.tif" />

Another approach to PPGA synthesis is shown in Reaction Scheme 2. In this case, 2-amino-4-6-dichloropyrimidine-5-carboxyaldehyde (1) reacts with ethyl acetate 2- (hydrazinol) acetic acid to provide 2- ( Ethyl 6-amino-4- {2 - [(ethoxycarbonyl) methyl] hydrazino} pyrazolo [5,4-d] pyrimidinyl) acetate (2). Treatment of (2) with sodium hydroxide followed by hydrogen peroxide provides the desired PPGA product (3). An advantage of this synthetic procedure is that it provides only the N1-substituted isomer. See Example 1, infra.

ES 2 344 337 T3

<img file="ES2344337T3_D0006.tif" />

For use in automated chemical synthesis of oligomers, reactive groups on base analogs, such as amino groups, must be protected. In one embodiment, blocked PPGA derivatives are synthesized as described in Reaction Scheme 3. PPGA (3) reacts with isobutanoyl chloride in dimethylformamide and triethylamine to generate an isobutyryl-blocked amino group PPGA derivative (14 ). See Example 2, infra.

<img file="ES2344337T3_D0007.tif" />

Reaction scheme 3

The methods for the synthesis of aminoethylglycyl derivatives of PPGA, PPAA, 2- (2-amino-4-hydroxypyrrolo [2,3-d] pyrimidin-7-yl) acetic acid (7PGA) and 2- (4-aminopyrrolo [ 2,3-d] pyrimidin-7-yl) acetic acid (7PAA), for use as monomers in automated oligomer synthesis, are known in the art. Uhlmann et al., Supra. These methods involve the condensation of appropriately protected aminoethylglycine, for example, methyl 2 - [(2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) amino] acetate (MMTrAeg, Will et al. (1995) Tetrahedron 51: 12069-12082) with either PPGA, PPAA, 7PGA or 7PAA (also protected, if necessary) in the presence of a condensation reagent such as (O-7-azabenzotriazol-1-yl) hexafluorophosphate - 1,1,3,3-tetramethyluronium (HATU), (benzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), or O - [(cyano (tetoxycarbonyl) methylene) amino tetrafluoroborate ] -1,1,3,3-tetramethyluronium (TOTU), as shown in Reaction Scheme 4. The R₅ protecting group is chosen so that it can be selectively removed, (i.e. without removing other blocking groups) to provide compound 7 wherein R₅ is -H and, for example, Ri is -NHCbz, R₂, and R₃ are -H and R₄ is -MMTr. This protected derivative of MPPAA is used in the synthesis of a PNA oligomer or a PNA / DNA chimera.

ES 2 344 337 T3

<img file="ES2344337T3_D0008.tif" />

Synthesis examples of a blocked PPG monomer for PNA synthesis is accomplished according to Reaction Scheme 5. PPG (15) reacts with isobutanoyl chloride to generate amino blocked PPG (16), which is treated with sodium hydride and then reacts with alkyl bromoacetate to generate, for example, a derivative of methyl acetate (17). Alkaline hydrolysis of methyl ester 17 provides the acetic acid derivative 18. Another reaction of 18 with methyl 2 - [(2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) amino] acetate (MMTrAeg) generates an alkyl ester (in this example, the methyl ester) of a derivative MMTr-blocked aminoethylglycyl with an MMTr-protected amino group (19), which, upon alkaline hydrolysis of the ester, provides the MMTr-protected aminoethylglycine derivative 20. See Example 3, infra.

<img file="ES2344337T3_D0009.tif" />

An example method for the synthesis of a PNA monomer comprising the PPA base analog is shown in Reaction Scheme 6. 4-aminopyrazolo [5,4-d] pyrimidine (PPA, Compound 8) reacts with 4-methoxybenzoyl chloride in pyridine to provide the amino-protected PPA derivative (9). This reacts with sodium hydride followed by the methyl 2-bromoacetate ester, and the N1-substituted methylacetate derivative (10) is isolated. Treatment of 10 with sodium hydroxide converts the methyl ester to the N-Bz protected acetate derivative of PPAA (Compound 11). See Example 4 for details.

ES 2 344 337 T3

<img file="ES2344337T3_D0010.tif" />

Continuing with Reaction Scheme 6, the conversion of N-Bz PPAA (11) to a reactive monomer for PNA synthesis proceeds by condensation of 11 with monomethoxytritylaminoethylaminoacetate (MMTrAeg = monomethoxytritylaminoethylglycine) to form 12, followed by treatment of 12 with alkali to generate the MMTr 13 protected aminoethylglycine derivative. See Example 5 for details.

A preferable PPG monomer is the 2-N-dimethylvinyl protected MMTr-aminoethylglycine derivative (24), the synthesis of which is shown in Reaction Scheme 7. 4-methoxypyrazolo [5,4] pyrimidine-6-ylamine (21) Reacted first with KOH in dry methanol, followed by reaction with methyl bromoacetate to provide the methyl acetate derivative (22). Alkaline hydrolysis to provide acetic acid derivative 23 was preceded by reaction with (dimethoxymethyl) dimethylamine to provide (24). Reaction of (24) with MMTrAeg provided the protected PPG monomer 25.

ES 2 344 337 T3

<img file="ES2344337T3_D0011.tif" />

A preferable PPA monomer is the 2-N-dimethylvinyl protected MMTr-aminoethylglycine derivative (29), the synthesis of which is shown in Reaction Scheme 8. Pyrazolo [5,4] pyrimidin-4-ylamine (8) reacted first with KOH in dry methanol followed by reaction with methyl bromoacetate to provide the methyl acetate derivative (26). This reacted with (dimethoxymethyl) dimethylamine to provide (27), which was treated with NaOH to provide (28). Reaction of (28) with MMTrAeg provided the PPA monomer (29).

ES 2 344 337 T3

<img file="ES2344337T3_D0012.tif" />

4CHjOhCHN (CH »),

OMF

<img file="ES2344337T3_D0013.tif" />

H

<img file="ES2344337T3_D0014.tif" />

Reaction scheme 8

The synthesis of reactive derivatives of PPI follows similar procedures. Pyrazolo [5,4-d] pyrimidin-4-ol (PPI, Tominaga et al. (1990) J. Heterocycl. Chem. 27: 775-783) can be directly alkylated with methyl bromoacetate, followed by alkaline hydrolysis, to provide 2- (4-hydroxypyrazolo [5,4-d] pyrimidinyl) acetic acid, which can be converted as described (Uhlmann et al. (1998) supra) for the MMTr-blocked aminoethylglycine derivative. Alternatively, the hydroxyl group of PPI can be blocked with a diphenylcarbamoyl group prior to reaction with methyl bromoacetic acetate.

The same synthetic approaches used to synthesize reactive derivatives of pyrazolo [5,4-d] pyrimidines can be used to synthesize reactive derivatives of 7-deazapurines for use in the synthesis of PNA-containing oligomers. The basic difference between the synthesis of these two types of compounds is that in the latter case only one isomer is generated after alkylation with methyl bromoacetate.

Synthesis of oligomers containing PNA

In addition to the monomers and precursors described above, the invention includes PNA oligomers, DNA oligonucleotides and / or pNA / DNA chimeras comprising at least one monomeric unit of Formula 4, optionally covalently linked to one or more ligands, portions of tails or hanging groups. A PNA oligomer comprises two or more PNA monomers that are covalently linked by peptide bonds, as illustrated in Formula 4, where B is a base (i.e., a heterocyclic base A, G, C, T, or U as normally found in nucleic acids or a modified derivative thereof) or base analog; k is between 0 and 50, preferably between 0 and 40, more preferably between 0 and 30, and even more preferably between 0 and 20; and R₂i are independently -H, -OH, -NH₂, -NHR₂₂, -N (R₂₂)₂, a protecting group, a reactive group or an oligomer, in which R₂₂ is -H or C_1-6 alkyl, alkenyl or alkynyl.

ES 2 344 337 T3

<img file="ES2344337T3_D0015.tif" />

The synthesis of PNA oligomers from monomeric precursors is known in the art. See, for example, Uhlmann et al., Supra. The synthesis begins with a CPG resin or other solid support, which contains a conjugated amino group. An appropriately blocked monomer (corresponding to the terminal monomer of the desired oligomer) is covalently coupled to the amino group with the aid of a coupling reagent. After deprotection of the blocked growing end of the first monomer, a second monomer is coupled. The process is repeated until an oligomer of the desired length and sequence is obtained, at which point the oligomer is cleaved from the solid support and any base protecting group is removed.

In one embodiment, a PNA oligomer contains a -NH group₂ at the end that has been cleaved from the solid support, and a -COOH or -OH group at the opposite end. Functional end groups provide sites for attachment of additional molecules and pendant groups for PNA-containing oligomers.

Strategies for the synthesis of chimeric PNA / DNA oligomers are well known in the art. See, for example, Uhlmann et al., Supra. The two main strategies for the synthesis of PNA / DNA chimeras are condensation of pre-synthesized DNA and PNA oligomer blocks in solution and sequential solid-phase synthesis with suitably protected monomeric PNA and DNA precursors. Those skilled in the art will appreciate that, depending on the synthesis method, different connecting groups are possible between the PNA and DNA portions. Examples of linkages include, but are not limited to, the N- (2-hydroxyethyl) glycine and 5'-amino-2 ', 5'dideoxynucleoside phosphoramidite linkages. Uhlmann et al., Supra.

Coupling reagents (or activating agents) for use in the condensation of PNA monomers to form a PNA oligomer include, but are not limited to, benzotriazolyl-1-oxy-trispyrodinphosphonium hexafluorophosphate (PyBOP), O- hexafluorophosphate (7-'azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium (HATU), O- (7-benzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU) , dicyclohexylcarbodiimide (DCC) / 1-hydroxybenzotriazole (HOBt), N, N'-diisopropylcarbodiimide (DIC), Bromine tris (pyrrolidino) phosphonium hexafluorophosphate (ByBrop), and O - [(cyano (ethoxycarbonyl) methylene) amino} 1,1,3,3-tetramethyluronium tetrafluoro (TOTU). These and other activating and condensing agents are known to those of skill in the art. See, for example, Uhlmann et al., Supra.

Other molecules that can be covalently coupled to an oligomer include, but are not limited to, intercalators, lipophilic groups, minor groove binding ligands, major groove binding ligands, marker groups (including fluorescent, chemiluminescent and radioactive markers), proteins, enzymes, antibodies, chelating agents and / or crosslinking agents. These molecules can be linked internally and / or to one or both ends of the oligomer. The nature and binding of such molecules to oligonucleotides are well known in the current art, and are described, for example, in US Patent Nos. 5,512,667 and 5,419,966 and in PCT publication WO 96/32496, which is incorporated herein by reference.

The oligomers of the invention may also have a relatively low molecular weight tail portion attached to one or both ends. By way of example, a tail molecule can be a phosphate, a phosphate ester, an alkyl group, an aminoalkyl group, a hydrophilic group, or a lipophilic group. The tail portion may also bind an intercalator, lipophilic group, minor groove binding ligand, marker group, chelating agent, and / or crosslinking functionality to the oligomers of the invention. The nature of the tail portions and the methods for obtaining oligonucleotides with various tail portions are also described in the aforementioned US Patent Nos. 5,512,667 and 5,419,966.

The molecules can be attached to an oligomer of the invention to modify its solubility in aqueous solvents. Such molecules include, but are not limited to, saccharides and charged molecules such as amino acids, charged minor groove binding ligands, and the like.

In a preferred embodiment, the oligomers of the invention containing guanine-substituted PPG and / or adenine-substituted PPA also comprise a conjugated minor groove binding ligand (MGB). Optimal single nucleotide mismatch discrimination is obtained using MGB-conjugated oligonucleotides containing PPG instead of guanine, as described in PCT co-publication WO 99/51775. Polar MGBs are preferable; Most preferable MGB moieties include 3-carbamoyl-1,2-dihydro- (3H) -pyrrolo [3,2-e] indole-7-carboxylate (CDPI3) trimer and N-methylpyrrole-4-carbox pentamer -2-amide (MFC). Other portions MGB

ES 2 344 337 T3 that we can use in the practice of the present invention are described in US Patent No. 5,801,155 and PCT co-publication WO 99/51621, the disclosures of which are incorporated herein by reference.

The oligomers may comprise base analogs in addition to the purine analogs described herein such as, for example, modified pyrimidines and pyrimidine analogs.

Furthermore, the oligomers of the invention can comprise backbones different from peptide backbones, or they can comprise heterogeneous backbones made of mixed peptides and non-peptide bonds. For example, backbone oligomers based on methyl glycine esters, ornithine, proline, diaminocyclohexane and the phosphoramidite of 2-aminopropanediol can be used. Uhlmann et al., Supra. Furthermore, PNAs in which the peptide bond is replaced by a phosphonic acid bridge, such as N- (2-aminoethyl) phosphonoglycine and N- (2-hydroxyethyl) phosphonoglycine, can be used. Peyman et al. (1997) Angew. Chem. Intl. Ed Engl. 36: 2809-2812; Efimov et al. (1998) Nucl. Acids. Res. 26: 566-577. Other oligomer linkages will be apparent to those of skill in the art.

Triplex-forming oligomers

PNA-containing oligomers are useful for the detection of both single-stranded and double-stranded nucleic acid targets. For the detection of double-stranded nucleic acids, an oligomer binds to the major groove of a double-stranded target via Hoogsteen-type base pairing, reverse Hoogsteen type, or equivalent base pairing, as is known in the art. See, for example, Fresco, US Patent No. 5,422,251; Hogan, US Patent No. 5,176,996; and Lampe (1997) Nucleic acid Res. 25: 4123-4131. Substitution of purines by base analogs in a PNA-containing oligomer, as described herein, facilitates triplex formation. The triplex-forming oligonucleotides optionally contain conjugated groups, such as fluorophores, fluorescence blockers, and any of the additional molecules described above. In a preferred embodiment, an oligomer containing triplex-forming PNA with one or more purines substituted by a base analog comprises a conjugated minor groove binding ligand. See above for description of minor groove binding ligands useful in the oligomers of the invention.

Fluorophores and fluorescence blockers

In one embodiment, a bound label group is a fluorescent label or a fluorophore / fluorescence blocker pair. In a preferred embodiment, substitution of one or more purine residues for pyrazolopyrimidine and / or pyrrolopyrimidine base analogs, in a probe containing a fluorescent label, results in reduced label blockage. Accordingly, fluorescence-labeled probes comprising one or more purine analogs, optionally comprising a fluorescence blocker, are provided.

Fluorescent labels include, but are not limited to, dyes such as fluoresceins, rhodamines, naphthylamines, coumarins, xanthenes, acridines, benzoxadiazoles, stilbenes, pyrenes, cyanines, phycoerythrins, green fluorescent proteins, and the like. Other fluorescent labels, and methods for their conjugation to nucleic acids and PNA probes, are known to those of skill in the art. See, for example, Haugland (1996) Handbook of Fluorescent probes and Research Chemicals, Sixth Edition, Molecular Probes, Inc., Eugene, or PCT publication WO 99/40226. In general, the methods for binding a fluorescent label and / or a fluorescence blocker to a PNA oligomer or a PNA portion of a chimeric oligomer are similar to those used for the conjugation of a fluorophore and / or blocker of fluorescence to a DNA oligonucleotide. The fluorophore or fluorescence blocker is also attached to a tail portion comprising a reactive group such as -OH or -NH.₂; or is attached to a base, for example, at the 5-position of a pyrimidine, the 7-position of a purine, or the 3-position of a pyrazolopyrimidine or pyrrolopyrimidine.

In certain embodiments of the present invention, oligomers comprising both a fluorescent label (fluorophore) and a fluorescence blocker are used. A fluorescence blocker is also referred to as a fluorescence blocker portion of a probe or polymer. Fluorescence blockers include those molecules whose absorption spectrum overlaps with the fluorescent emission spectrum of a particular fluorophore, such that they are capable of absorbing the energy emitted by a fluorophore to reduce the amount of fluorescence emitted (i.e., blocking the emission of the fluorescent label). Different fluorophores are blocked by different blocking agents. In general, the spectral properties of a particular fluorophore / fluorescence blocker pair are those in which one or more of the absorption wavelengths of the fluorescence blocker overlaps one or more of the emission wavelengths. of the fluorophore.

Suitable fluorophore / fluorescence blocker pairs, whose emission from the fluorophore is absorbed by the quencher, are known in the art. See, for example, Haugland, supra. Examples of fluorescence blocker / fluorophore pairs that can be used in the practice of the invention are as follows. A preferable fluorophore / fluorescence blocker pair is fluorescein and tetramethylrhodamine. Nitrothiazole blue blocks the fluorescence emission of six different types of dyes, which are 6-FAM, dR110, dR6G, dTMR, dROX, and JAZ. Lee et al. (1999) Biotechniques 27: 342-349. 6-carboxytetramethylrhodamine (TAMRA) blocks the emission of 6-carboxyfluorescein (FAM) and 6-carboxy-4,7,2 ', 7'-fluorescein (TET). Lee et al. (1993) Nucl. Acid Res. 21: 36713766. 6- (N- [7-nitrobenz-2-oxa-1,3-diazol-4-yl] amino) hexanoic acid blocks the fluorescence of 7-dimethylaminocoumarin-4-acetate. Bicket et al. (1994) Ann. NY. Acad. Sci. (Sep. 6) 732: 3 51-355. 6-carboxy-X-rhodamine (ROX) and erythromycin B block the release of FAM. Li et al. (1999) Bioconj. Chem. 10: 241-245. The 2,4-dinitropheni group

ES 2 344 337 T3 is blocked by (R, S) -2-amino-3- (7-methoxy-4-coumaryl) propanoic acid. Hawthorne et al. (1997) Anal. Chem. 253: 1317. Dabcyl is used as a fluorescence blocker for dansyl sulfonamide in chemosensors and in fluorogenic peptides as a fluorescence blocker for the EDANS fluorophore. Rothman et al. (1999) Bioorg. Med Chem. Left. 22: 509-512 and Matayoshi et al. (1990) Science 247: 954-958. QSY-7 is a tetramethylrhodamine fluorescence blocker. Haugland supra. Additional fluorophore / fluorescence blocker pairs can be selected by those skilled in the art by comparing the emission and absorption wavelengths in accordance with the properties set forth above.

Although any fluorescent label is useful in the practice of the invention, the preferred fluorophores have an emission maximum between 400 and 800 nm. Similarly, although any fluorescence blocker is useful, the preferred fluorescence blockers have an absorption maximum between 400 and 800 nm.

In another embodiment, an oligomer comprises a pair of fluorophores capable of fluorescent resonance energy transfer (FRET). In this case, two fluorophores are used in a FRET series. The first fluorophore (fluorescence donor) has an emission spectrum that overlaps with the excitation spectrum of the second fluorophore (fluorescence acceptor). Accordingly, irradiation at the fluorescence donor excitation wavelengths results in fluorescence at the acceptor emission wavelength. It is clear that any number of fluorophores, possessing a suitable overlap of their emission and excitation wavelengths, can form a FRET series of three, four or more fluorophores.

In one embodiment, a fluorophore is a latent fluorophore, as described in shared US Patent Application No. 09 / _, _, entitled "Hybridation triggered fluorescent detection of nucleic acids" (Proclaimer docket No. 34469-20006.00) , deposited on October 26, 1999.

Examples of benefits

When an oligomer is used as a probe or primer, substitution of the base analogs for purines reduces aggregation of the substituted oligomer, with itself and with other oligomer molecules. Reduction of aggregation is demonstrated by G-rich probes as described in Example 6, infra. As a consequence, improved methods for the detection of target sequences by hybridization are obtained by using oligomers as probes, using the oligomers described herein. The target sequences can comprise DNA, RNA, or any oligonucleotide or polynucleotide.

Substitution of purines by base analogs in fluorescently labeled probes reduces the blockage of labeling that occurs in unsubstituted probes. See Examples 7 and 8, infra. In particular, the inventors have determined that the detection of the amplification product using probes containing more than three consecutive G residues adjacent to a fluorescent label is inefficient and, for probes containing 5 or more consecutive G residues adjacent to a fluorescent label, no product detection is observed. The inventors have also determined that, when PPG is substituted for G, fluorescent probes containing up to 9 consecutive PPG residues adjacent to a fluorescent label provide highly efficient detection of amplification products. Accordingly, improved methods for detecting a target sequence are obtained using probes comprising a polymeric portion (usually an oligomer, preferably a PNA oligomer or a PNA / DNA chimera, more preferably a DNA oligomer) and a fluorescent portion. using the compositions described here.

Thus, DNA, RNA, PNA, and chimeric oligomers, comprising pyrazolopyrimidine and pyrrolopyrimidine base analogs as described herein, are useful in techniques including, but not limited to, hybridization, primer extension, assays for hydrolyzable probe, amplification methods (e.g. PCR, SSSR, NASBA), discrimination of single nucleotide mismatch, allele-specific oligonucleotide hybridization, nucleotide sequence analysis, hybridization to oligonucleotide chips, in situ hybridization, and related techniques. The oligomers described herein can be used as immobilized oligomers on oligomer chips such as those described in, for example, US Patent Nos. 5,492,806; 5,525,464; 5,556,752 and PCT publications WO 92/10588 and WO 96/17957. The improved specificity and sensitivity likely result from increased solubility, decreased tendency for aggregation, reduced blockage of fluorescence by conjugated fluorogenic labels, and / or some combination of these and other factors.

The improved performance of PPG substituted probes in a real-time hydrolyzable probe assay is demonstrated in Example 9, infra.

In another embodiment of the invention, a PNA-containing oligomer with one or more purine residues substituted by a base analog is used as a drug, for example as an anti-gene or antisense reagent, as a component of a ribozyme, or to gene therapy. Therapeutic uses include D-loop formation in vivo or ex vivo.

The following examples are provided to illustrate, but not to limit the invention.

ES 2 344 337 T3

Examples

Example 1

Synthesis of 2- (6-amino-4-hydroxypyrazolo [5,4-d] pyrimidinyl) acetic acid (PPGA, Compound 3)

Ethyl-2- (6-amino-4- {2- [ethoxycarbonyl) methyl] hydrazino} pyrazolo [5,4-d] pyrimidinyl) acetate (Compound 2)

The 2-amino-4-6-dichloropyrimidine-5-carboxyaldehyde (Compound 1) (10 g; 52 mmol) was treated with a solution of 10.1 g (64.8 mmol) of ethyl acetate hydrochloride 2- ( hydrazinol) acetic acid in 100 ml of water. Triethylamine (15 ml; 107 mmol) was added and the mixture was heated at 60 ° C for 10 min., Then stirred at room temperature for 3 days. Although ethyl acetate 2- (hydrazinol) acetic hydrochloride did not completely dissolve, TLC on SiO₂(CH₂Cl₂: CH₃OH 10: 1) showed the formation of a new product. The mixture was evaporated to dryness, taken up in toluene (100 ml) and evaporated to dryness. The solid was suspended in about 300 ml of CH₃CN and filtered through a column of SiO2 (49x6 cm), washed with 0.71 of CH₃CN and about 300 ml of CHCl₃. The filtrate was evaporated to dryness, dissolved in 120 ml of CH₃OH hot and crystallized overnight at 4 ° C. The product, a colorless solid (3.2 g) was collected and dried. TLC and reverse phase HPLC indicated a pure compound and NMR analysis certified the structure.

2. 2- (6-amino-4-hydroxypyrazolo [5,4-d] pyrimidinyl) acetic acid (Compound 2)

Compound 2 (3.16 g; 9.4 mmol) was dissolved in 100 ml of hot methanol, then 100 ml of a 2N NaOH solution was added, and the mixture was refluxed for 6 hours, after which time, TLC analysis indicated hydrolysis of the ester. Product 3 (PPGA) was formed by the addition of 2 ml of H₂OR₂ 30% (in 0.5 ml portions) to the reaction mixture, followed by heating to 80 ° C, until the generation of O2 was completed by the degradation of excess H₂OR₂. The methanol was removed by heating to 100-120 ° C, followed by cooling to room temperature and the addition of 17 ml of concentrated HCl to provide a pH of around 4. Precipitation of the product started at this time, and was facilitated by adding ice. The product was filtered, washed with cold water and dried over NaOH and P₂OR₅ (yield 3.9 g). NMR confirmed the structure and indicated the presence of about 4-8 H2O molecules per product molecule.

Example 2

Synthesis of 2- [4-hydroxy-6- (2-methyl-propanoylamino) pyrazolo [5,4-d] pyrimidinyl] acetic acid (14)

PPGA (Compound 3, 5.58 g, 20 mmol) was suspended in anhydrous DMF (40 ml) and triethylamine (4.29 ml, 30.8 mmol). Isobutanoyl chloride (2.12 g, 19.9 mmol) was added dropwise with a syringe. The mixture was stirred at 100 ° C for 3 hours, then treated with methanol and evaporated to dryness. The residue was treated with 20 ml of 1N HCl and then with methanol and evaporated to dryness. The residue was treated with hot isopropanol and the precipitated product was filtered off and dried under vacuum. The product (14) was analyzed by TLC and HPLC and, if necessary, purified by chromatography.

Example 3

5- [4-Hydroxy-6- (2-methylpropanoyl-amino) pyrazolo [5,4-d] pyrimidinyl] -3- (2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) -4 acid -oxopentanoic (20)

N- (4-ishydroxypyrazolo [5,4-d] pyrimidin-6-yl) -2-methylpropanamide (16)

Compound 15 (PPG, 3.02 g; 20 mmol) was resuspended in anhydrous DMF (40 ml) and triethylamine (1.45 ml, 10.4 mmol), and isobutanoyl chloride (2.12 g, 19 , 9 mmol) dropwise using a syringe. The mixture was stirred at 100 ° C for 3 hours. The reaction mixture was then treated with methanol and evaporated to dryness. The residue was treated with methanol and evaporated to dryness. The residue was then treated with hot isopropanol and the precipitated product (16) was filtered off and dried under vacuum. The product was analyzed by TLC and HPLC and, if necessary, further purified by chromatography.

Methyl 2- [4-hydroxy-6- (2-methylpropanoylamino) pyrazolo [5,4-d] pyrimidinyl] acetate (17)

Compound 16 (4.42 g; 20 mmol) was resuspended in dry DMF (40 ml), sodium hydride (0.5 g; 20.8 mmol) was added portionwise, and the mixture was stirred at room temperature for 60 min. Then methyl bromoacetate (1.9 ml, 20.6 mmol) was added at room temperature, via syringe, and stirring was continued at room temperature. After completion of the reaction (monitored by TLC), the reaction mixture was treated with a small amount of carbon dioxide in methanol. Then the solvent was evaporated and the residue was dissolved in CH2Cl2, washed once with water and then evaporated to dryness. The product was purified by chromatography to provide the desired isomer (17).

ES 2 344 337 T3

2- [4-Hydroxy-6- (2-methylpropanoylamino) pyrazolo [5,4-d] pyrimidinyl] acetic acid (18)

Compound 17 (4.41 g; 15 mmol) was resuspended in 25 ml of water, and a 2N aqueous solution of sodium hydroxide was added dropwise at 0 ° C, while maintaining the pH at 11, until the ester methyl is completely hydrolyzed. Then the reaction solution was filtered, and the filtrate was brought to pH 3 using a KHSO solution.₄ 2M, then extracted with ethyl acetate. The aqueous phase was evaporated and the product (18) was purified by chromatography.

Methyl 5- [4-hydroxy-6- (2-methylpropanoylamino) pyrazolo [5,4-d] pyrimidinyl] -3- (2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) -4-oxopentanoate 19)

The methyl 2 - [(2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) amino] acetate (MMTrAeg, 1.26 g, 3.1 mmol) was dissolved in DMF (8 mL). To this solution were added N-ethylmorpholine (1.07 g, 6.28 mmol), 3-hydroxy-4-oxo-3,4-dihydro1,2,3-benzotrazine (HOObt) (0.505 g, 3.1 mmol ), compound 18 (0.91 g, 3.1 mmol) and diisopropylcarbodiimide (DIPC) (0.59 g, 3.72 mmol). The reaction mixture was stirred for 48 hours at 4 ° C, at which time the solvent was evaporated and the residue was dissolved in ethyl acetate. The ethyl acetate solution was washed with water and washed once more with a saturated KCl solution. Then the organic phase was dried over Na₂SW₄, filtered and evaporated. The residue was dissolved in a small volume of ethyl acetate and cooled on ice to induce crystallization of diisopropylurea, leaving product 19 in the aqueous phase. Alternatively, diisopropylurea was separated from compound 19 by silica gel chromatography.

5- [4-Hydroxy-6- (2-methylpropanoylamino) pyrazolo [5,4-d] pyrimidinyl] -3- (2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) -4-oxopentanoic acid (20 )

Compound 19 (1.33 g, 2 mmol) was dissolved in 10 ml of dioxane. This solution was cooled to 0 ° C and 1M aqueous NaOH (8.66 ml) was added dropwise in 5 aliquots over 2.5 hours. After an additional 2 hours at room temperature the solution was adjusted to pH 5 by dropwise addition of 2M KHSO4. The precipitated salts were removed by filtration and washed with dioxane, and the combined filtrates were evaporated. The residue was co-evaporated with ethanol and methanol / CH2Cl2, then purified by silica gel chromatography to provide (20).

Example 4

Synthesis of 2- {4- [4-methoxyphenyl) carbonylamino] pyrazolo [5,4-d] pyrimidinyl} acetic acid (Compound 11, Reaction scheme 6)

4- (Methoxyphenyl) -N-pyrazolo [4,5-d] pyrimidin-4-ylcarboxamide (9)

Pyrazolo [5,4-d] pyrimidin-4-ylamine (8) (13.5 g, 0.10 mol) was resuspended in dry pyridine (250 ml), and 4-methoxybenzolyl chloride (17.1 g; 0.1 mol) dropwise using a syringe. The mixture was heated to 100 ° C until TLC showed the reaction to be complete (between 1 and 3 hours). The cooled reaction was then treated with methanol and the solvent was evaporated. The residue was co-evaporated twice with toluene and then stirred with hot isopropanol. This mixture was slowly cooled and the precipitated product (9) was filtered off and its purity was evaluated by TLC and HPLC. If necessary, the product was further purified by chromatography.

Methyl 2- {4 - [(4-methoxyphenyl) carbonylamino] pyrazolo [5,4-d] pyrimidinyl} acetate (10)

Compound (9) (6.7 g, 25 mmol) was resuspended in 75 ml of dry DMF. Sodium hydride (0.65 g, 27 mmol) was added portionwise, and the mixture was stirred at room temperature for 30 min. Methyl bromoacetate (2.44 ml, 26.5 mmol) was added at room temperature using a syringe. Stirring was maintained at room temperature until TLC analysis indicated completion of the reaction, at which time the reaction mixture was treated with a small amount of carbon dioxide in methanol. The solvent was evaporated and the residue was dissolved in CH2Cl2, washed once with water and then evaporated to dryness. The product was purified by chromatography to provide the desired isomer (10).

2- {4- [4-Methoxyphenyl) carbonylamino] pyrazolo [5,4-d] pyrimidinyl} acetic acid (11)

Compound (10) (5.13 g; 15 mmol) was resuspended in 120 ml of water, and a 2N aqueous sodium hydroxide solution was added dropwise at 0 ° C to maintain the pH at 11, until the ester of methyl was completely hydrolyzed. The reaction solution was filtered and the pH of the filtrate was brought to 3, using a 2M KHSO4 solution, which led to the precipitation of the product (11). The precipitate was washed with a small amount of water, dried in vacuo, and analyzed for purity. If necessary, the product (11) was further purified by chromatography.

ES 2 344 337 T3

Example 5

Synthesis of 2- [N- (2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) -2- {4 - [(4-methoxyphenyl) carbonylamino] pyrazolo [5,4d] pyrimidinyl} acetylamino] acetic acid ( Compound 13, Reaction Scheme 6)

2- [N- (2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) -2- {4 - [(4-methoxyphenyl) carbonylamino] pyrazolo [5,4-d] pyrimidinyl} acetylamino] acetylamino] acetate methyl (12)

Methyl 2- (2 - {[(4-methoxyphenyl) diphenylmethyl] -amino} ethyl) amino] acetate (MMTrAeg, 1.26 g, 3.1 mmol) was dissolved in DMF (8 mL). To this solution were added N-ethylmorpholine (1.07 g, 6.28 mmol), 3-hydroxy-4-oxo-3,4-dihydro-1,2,3-benzotrazine (HOObt) (0.505 g, 3.1 mmol ), compound 11 (1.01 g, 3.1 mmol) and diisopropylcarbodiimide (DIPC) (0.59 g, 3.72 mmol). The reaction mixture was stirred for 48 hours at 4 ° C, then the solvent was removed in vacuo and the residue was dissolved in ethyl acetate. This solution was washed with water and washed once more with a saturated KCl solution. The organic phase was dried over Na₂SW₄, filtered and evaporated. The residue was dissolved in a small volume of ethyl acetate and cooled on ice to induce crystallization of the diisopropylurea, leaving the product (12) in solution. Alternatively, the diisopropylurea was separated from (12) by silica gel chromatography.

2- [N- (2 - {[(4-methoxyphenyl) diphenylmethyl] amino} ethyl) -2- {4 - [(4-methoxyphenyl) carbonylamino] pyrazolo [5,4-d] pyrimidinyl} acetylamino] acetic acid ( 13)

Compound (12) (1.43 g, 2 mmol) was dissolved in dioxane (10 ml). The solution was cooled to 0 ° C, and 1M aqueous NaOH (8.66 ml) was added dropwise in 5 aliquots over 2.5 hours. After an additional 2 hours at room temperature, the pH was adjusted to 5 by dropwise addition of 2M HKSO4. The precipitated salts were removed by filtration, washed with dioxane, then the combined filtrates were dried in vacuo. The residue (13) was co-evaporated with ethanol and methanol / CH2Cl2, then purified by silica gel chromatography.

Example 6

Reduction in self-association of PPG-containing oligonucleotides

In this example, conjugated 13-mer and 14-mer oligonucleotides, containing between two and nine G residues, were analyzed by non-denaturing gel electrophoresis and compared to oligonucleotides of identical sequence, except that all residues of G were replaced by PPG. The lengths and sequences of the oligonucleotides are provided in Table 1. Electrophoresis was performed on 8% polyacrylamide gels that were run in 1X TBE buffer for 45 min. at 40 ° C. The gels were stained with Daiichi 2D Silver Stain II® and the R values_F of the stained oligonucleotide bands were determined using two control oligonucleotides as standards. The control oligonucleotide A has the sequence 5'-ACCTGTATTCCTTGCC-3 '(Seq. ID No. 22) and the control oligonucleotide B has the sequence 5'-ZTACAZCAAATZZAA-3' (Seq. ID No. 23), where Z represents PPG.

TABLE 1

Oligonucleotide sequences

<td>Sequence*</td><td>Length</td><td>Id. No.</td><td>of Sec. (with G)</td><td>Sec ID No. (with PPG)</td>

<td>5'-CAAATGGGGGGGGG-3 '</td><td> 14</td><td colspan="2"> 1</td><td> 9</td>

<td>5'-ACAAATGGGGGGGG-3 '</td><td> 14</td><td colspan="2"> 2</td><td> 10</td>

<td>5'-AACAAATGGGGGGG-3 '</td><td> 14</td><td colspan="2"> 3</td><td> 11</td>

ES 2 344 337 T3

<td>5 '- CAACAAATGGGGGG-3'</td><td> 14</td><td> 4</td><td> 12</td>

<td>5 '-ACAACAAATGGGGG-3'</td><td> 14</td><td> 5</td><td> 13</td>

<td>5'-CACAACAAATGGGG-3 '</td><td> 14</td><td> 6</td><td> 14</td>

<td>5'-CACAACAAATGGG-3 '</td><td> 13</td><td> 7</td><td> 15</td>

<td>5 '-AGCACAACAAATGG-3'</td><td> 14</td><td> 8</td><td> 16</td>

<td colspan="4">* All oligonucleotides contained, at their 5 'ends, a conjugated fluorescein portion and, at their conjugated 3' ends, a minor groove binding ligand (CDPI₃) and a fluorescence blocker (tetramethylrhodamine). The synthesis of this type of conjugate is described in shared PCT publication WO 99/51775, the disclosure of which is incorporated by reference.</td>

The results of the analysis are shown in Table 2. The R values_F they were measured separately for the oligonucleotides containing G and PPG relative to the control oligonucleotides A and B, respectively. However, the distance that control oligonucleotides A and B migrated was essentially identical. Oligonucleotides that contain three or more G residues (oligonucleotides 1-6) show a reduction by one Rf compared to oligonucleotides of similar size that contain two or fewer G residues (for example, oligonucleotides 7 and 8 and the control oligonucleotide A), which indicates the aggregation of the oligonucleotides rich in G. In contrast, oligonucleotides containing between two and nine PPG residues possess Rf's that are similar to each other and to a control oligonucleotide containing two PPG residues. It was also observed that the G-containing oligonucleotides showed diffuse bands after electrophoresis (the Rf values ​​of these oligonucleotides were determined by measuring from the center of the band). Furthermore, comparison of an oligonucleotide containing G with an oligonucleotide of the same size and sequence, but with G substituted for PPG, shows that the reduction in Rf characteristic of oligonucleotides containing three or more G residues is not observed with oligonucleotides containing PPG, suggesting low or no aggregation of oligonucleotides containing up to nine consecutive PPG residues.

ES 2 344 337 T3

TABLE 2

R values_F of oligonucleotides containing G and PPG

<td>Sec. ID No.</td><td># G</td>

<td> 22</td><td> 2</td>

<td> 1</td><td> 9</td>

<td> 2</td><td> 8</td>

<td> 3</td><td> 7</td>

<td> 4</td><td> 6</td>

<td> 5</td><td> 5</td>

<td> 6</td><td> 4</td>

<td> 7</td><td> 3</td>

<td> 8</td><td> 2</td>

<td> 23</td><td></td>

<td> 9</td><td></td>

<td> 10</td><td></td>

<td> 11</td><td></td>

<td> 12</td><td></td>

<td> 13</td><td></td>

<td> 14</td><td></td>

<td> 15</td><td></td>

<td> 16</td><td></td>

Example 7

<td># PPG</td><td>Rf</td>

<td></td><td> 1,00</td>

<td></td><td> 0,58</td>

<td></td><td> 0,42</td>

<td></td><td> 0,37</td>

<td></td><td> 0,35</td>

<td></td><td> 0,32</td>

<td></td><td> 0,29</td>

<td></td><td> 0,96</td>

<td></td><td> 0,96</td>

<td> 4</td><td> 1,00</td>

<td> 9</td><td> 0,96</td>

<td> 8</td><td> 0,97</td>

<td> 7</td><td> 0,95</td>

<td> 6</td><td> 0,95</td>

<td> 5</td><td> 0,98</td>

<td> 4</td><td> 1,03</td>

<td> 3</td><td> 0,98</td>

<td> 2</td><td> 0,96</td>

Reduced fluorescence blockage in fluorescently labeled nucleotides when G is replaced with PPG

Fluorescein was coupled to GMP and PPGMP (ie, the monophosphate derivatives of G and PPG) and the fluorescence of 200 nM solutions of these conjugates was determined. Excitation was performed at 494 nm and fluorescence emission was measured at 522 nm. The fluorescence emission of the GMP conjugate was 15,447 units; while the fluorescence emission of the PPGMP conjugate was 32,767 units. Thus, the blocking of the fluorophore by guanine is reduced when guanine is replaced by PPG, which leads to an increase in the fluorescence yield of the PPGMP conjugate to almost double compared to the G conjugate.

ES 2 344 337 T3

Example 8

Reduced fluorescence blocking in fluorescence-labeled oligonucleotide probes when G is substituted with PPG

The effect on fluorescein-oligonucleotide conjugates was analyzed, in fluorescence yield, of replacing G with PPG. The oligonucleotide portion of the conjugates contained a G or a 5'-terminal PPG residue, to which a fluorescein molecule was coupled. Conjugates optionally contained an CDPI molecule₃ covalently coupled to its 3 'end. The sequences are provided in Table 3. The fluorescence of a 200 nM solution of the conjugates was measured, in 20 mM Tris-HCl, pH 7, 40 mM NaCl, MgCl₂ 5 mM, at room temperature, with an excitation at 494 nm and the emission was detected at 522 nm. The results are provided in Table 3.

TABLE 3

Effect of PPG substitution on the fluorescence performance of conjugated oligonucleotides

<td>Id. &lt; Sec N °</td><td>you</td><td>Sequence*</td><td>Ft</td><td>AF *</td><td>% au- ment</td>

<td colspan="2"> 18</td><td>5'-Fl-GTCCTGATTTTAC-MGB- 3'</td><td> 8.650</td><td></td><td></td>

<td colspan="2"> 19</td><td>5'-Fl- (PPG) TCCTGATTTTAC- MGB-3 '</td><td> 10.739</td><td> 2.089</td><td> 24</td>

<td colspan="2"> 20</td><td>5'-Fl-GTCCTGATTTTAC-3 '</td><td> 14.883</td><td></td><td></td>

<td colspan="2"> 21</td><td>5'-Fl- (PPG) TCCTGATTTTAC- 3'</td><td> 23.835</td><td> 8.952</td><td> 38</td>

<td colspan="6">* - Fl indicates fluorescein; MGB indicates a conjugated minor groove binding ligand (CDPI3) t - indicates fluorescence performance, in arbitrary units t indicates the increase in fluorescence of an oligonucleotide containing PPG, compared to an oligonucleotide containing G</td>

The results indicated that substitution of G with PPG increases fluorescence (ie, reduces blocking) by 24% and 38% in MGB conjugated and non-MGB conjugated oligonucleotides, respectively.

ES 2 344 337 T3

Example 9

Improved performance of probes containing multiple consecutive G residues in a hydrolyzable probe assay when G is substituted for PPG

The conjugated oligonucleotides whose sequences are shown in Table 1 were used as fluorescent probes in a hydrolyzable probe assay. US Patent No. 5,210,015; Livak et al. (1995) PCR Meth. App. 4: 357-362; Wittwer et al. (1997a) Biotechniques 22: 130-138; and Wittwer et al. (1997b) Biotechniques 22: 176-181. The performance of the G-containing probes was compared to that of the PPG-containing probes. The probes contained a conjugated fluorophore at their 5 'end, together with a fluorescence blocker and a minor groove binding ligand conjugated to the 3' end of the probe, as described in shared PCT publication WO 99/51775. The target sequence was 5'-CACCTCAGCCTCCCAAGTAACTTTTAACCCCCCCCCATTTGTTGTGCTG TTTTCATACCTGTAATCCTGGCACTTT-3 '(Seq ID No. 17). The underlined portions of the target sequence correspond to the primer sequences.

Amplification was performed on an Idaho Technologies LC-24 LightCycler® with real-time fluorescence monitoring. Amplification reactions contained 10⁵ copies / μl of target 76-mer (as above), 100 nM of each primer, 10 nM fluorescent probe (as above), 20 mM Tris-HCl, pH 7, 40 mM NaCl, MgCl₂ 5 mM, 0.05% bovine serum albumin, 0.5 mM of each dNTP, 0.038 Units / µl of Taq polymerase and 0.01 Units / µl of uracil-N-glycosylase. The thermocycling program was one cycle at 50 ° C for 3 min, then 95 ° C for 2 min, followed by 50 cycles at 95 ° C for 2 s, then 60 ° C for 30 s.

The results are shown in Figure 1. In this method, the production of amplification product is indicated by an increase in fluorescence with time, caused by hydrolysis of the probe hybridized with the amplification product. The results obtained here show that the detection of the amplification products using probes containing more than three consecutive G residues was inefficient and, indeed, for probes containing 5 or more consecutive G residues, no product detection was observed. In contrast, when PPG was substituted for G in the fluorescent probe, probes containing up to 9 consecutive PPG residues provided highly efficient real-time detection of the amplification product. The preceding descriptions and examples are not intended to be limiting of the scope of the invention.