ES2328807T3

Immunostimulatory sequence oligonucleotides and methods of using the same

Abstract

An immunomodulatory polynucleotide comprising: a) 5- (TCG (Nq)) and (X1X2CGX2''X1 '' (CG) p) where N is nucleosides, y = 1, p = 0 or 1, q = 0 , 1 or 2, and z = 2-20, X1 and X1 '' are self-complementary nucleosides, X2 and X2 '' are self-complementary nucleosides, and in which the 5 '' T of the sequence (TCG (Nq )) and is at the 5 '' end of the polynucleotide; and b) a palindromic sequence of at least 8 bases in length in which the palindromic sequence comprises the first (X1X2CGX2''X1 '') of the sequences (X1X2CGX2''X1 '' (CG) p) z.

ES2328807T3, drawing sheet 1 — Sheet 1 of 2

Term

Term ended

Projected expiry passed 18 December 2023, 2.8 years ago.

18 claims: 18 independent, 0 dependent

1
Un polinucleótido inmunomodulador que comprende:a) 5-(TCG(N_{q}))_{y}(X_{1}X_{2}CGX_{2}'X_{1}'(CG)_{p})_{z} en la que N son nucleósidos, y = 1, p = 0 ó 1, q = 0, 1 ó 2, y z = 2-20, X_{1} y X_{1}' son nucleósidos auto-complementarios, X_{2} y X_{2}' son nucleósidos auto-complementarios, y en la que la T del 5' de la secuencia (TCG(N_{q}))_{y} está en el extremo 5' del polinucleótido;y b) una secuencia palindrómica de al menos 8 bases de longitud en la que la secuencia palindrómica comprende la primera (X_{1}X_{2}CGX_{2}'X_{1}') de las secuencias (X_{1}X_{2}CGX_{2}'X_{1}'(CG)_{p})_{z}.
2
Un polinucleótido inmunomodulador de acuerdo con la reivindicación 1, en el que la secuencia del polinucleótido tiene una composición de bases de más de 1/3 de A y T.
3
Un polinucleótido inmunomodulador de acuerdo con la reivindicación 1 ó 2 en el que, el IMP comprende una secuencia seleccionada entre el grupo que consiste en SEQ ID NO.:39, SEQ ID NO.:42, SEQ ID NO.:53, SEQ ID NO.:55 y SEQ ID NO.:113.
4
Un polinucleótido inmunomodulador de acuerdo con la reivindicación 3, en el que el IMP comprende la secuencia mostrada en SEQ ID NO.:39.
5
Un polinucleótido inmunomodulador de acuerdo con la reivindicación 3, en el que el IMP comprende la secuencia mostrada en SEQ ID NO.:42.
6
Un polinucleótido inmunomodulador de acuerdo con la reivindicación 3, en el que el IMP comprende la secuencia mostrada en SEQ ID NO.:113.
7
Un polinucleótido inmunomodulador de acuerdo con la reivindicación 1 ó 2 en el que z es 2 ó 3.
8
Un polinucleótido inmunomodulador de acuerdo con la reivindicación 1 ó 2 en el que p es 0.
9
Un polinucleótido inmunomodulador de acuerdo con la reivindicación 1 a 2 en el que p es 1.
10
Un polinucleótido inmunomodulador de acuerdo con cualquiera de las reivindicaciones 1 a 9, en el que los nucleósidos se unen a través de ésteres de fosforotioato.
11
Una composición inmunomoduladora que comprende un polinucleótido inmunomodulador de acuerdo con cualquiera de las reivindicaciones 1 a 9.
12
Un polinucleótido inmunomodulador de acuerdo con cualquiera de las reivindicaciones 1 a 9 para uso en la modulación de una respuesta inmune en un individuo.
13
Un polinucleótido inmunomodulador de acuerdo con cualquiera de las reivindicaciones 1 a 9 para uso en el aumento de interferón-\gamma (IFN-\gamma) en un individuo.
14
Un polinucleótido inmunomodulador de acuerdo con cualquiera de las reivindicaciones 1 a 9 para uso en el aumento de interferón-\alpha (IFN-\alpha) en un individuo.
15
Un polinucleótido inmunomodulador de acuerdo con cualquiera de las reivindicaciones 1 a 9 para uso en la mejora de un síntoma de una enfermedad infecciosa en un individuo.
16
Un polinucleótido inmunomodulador de acuerdo con cualquiera de las reivindicaciones 1 a 9 para uso en la mejora de un síntoma de un trastorno relacionado con IgE en un individuo.
17
El uso de un polinucleótido inmunomodulador de acuerdo con cualquiera de las reivindicaciones 1 a 9 para la fabricación de un medicamento para tratar el asma.
18
Un polinucleótido inmunomodulador de acuerdo con cualquiera de las reivindicaciones 1 a 9 para uso en el tratamiento del asma.

Independent claims18

496 paragraphs in 17 sections, as filed

Oligonucleotide sequence immunostimulators and methods to use them.

Technical field

The present invention relates to immunomodulatory polynucleotides. Also refers to the administration of polynucleotides that modulate a response immune.

Background of the invention

The type of immune response generated against an infection or other antigenic exposures can be distinguished usually by the subset of adjuvant T lymphocytes (Th) involved in the response. Subgroup Th1 is responsible for classic cell mediated functions such as the delayed type hypersensitivity and activation of T lymphocytes cytotoxic (CTL), while the subgroup Th2 works in a way more effective as an adjuvant for the activation of B cells. He type of immune response against an antigen is influenced usually by the cytokines produced by the cells that They respond to the antigen. It is thought that the differences between cytokines secreted by Th1 and Th2 cells reflect the different Biological functions of these two subgroups. See, for example, Romagnani (2000) Ann. Allergy Asthma Immunol. 85:9-18.

The subgroup Th1 can be particularly suitable to respond to viral infections, pathogens intracellular and tumor cells because it secretes IL-2 and IFN-?, Which activates the CTL. The subgroup Th2 may be more suitable to respond to natural bacteria and helminthic parasites and can mediate allergic reactions, since it is known that IL-4 and IL-5 induces the production of IgE and the activation of eosinophils, respectively. In general, Th1 and Th2 cells secrete different models of cytokines and thus a type of response You can moderate the activity of the other type of response. A Th1 / Th2 equilibrium shift may result an allergic response, for example, or, alternatively, a higher response of CTL.

For many of the infectious diseases, such as tuberculosis and malaria, type responses Th2 have a poor protective value against infection. The proposed vaccines using small peptides derived from target antigen and other antigenic agents currently used that avoid the use of potentially intact viral particles infective, they do not always generate the necessary immune response to achieve a therapeutic effect. Protein vaccines induce typically Th2 type immune responses, characterized by high titers of neutralizing antibodies but without significant cell mediated immunity.

In addition, some types of responses from antibodies are inappropriate in certain indications, more patently in allergies in which an antibody response IgE can cause anaphylactic shock. Generally, the allergic responses also involve immune responses of the type Th2. Allergic responses, including those of asthma allergic, are characterized by an early stage response, which occurs within a few seconds or minutes from the allergen exposure and it you characterize by cell degranulation, and a phase response late, that occur from 4 to 24 hours later and is characterized by infiltration of eosinophils at the exposure site allergen Specifically, during the late phase of the response allergic, the allergen is crosslinked with IgE antibodies in basophils and mast cells, which in turn trigger degranulation and subsequent release of histamine and other mediators of the inflammation by mast cells and basophils. During the response in late stage, eosinophils infiltrate the site of the allergen exposure (where it causes tissue damage and dysfunction).

Immunotherapy with antigens for allergic disorders involves subcutaneous injection of small, although gradually increasing, amounts of antigen. Such Immunization treatments present the risk of inducing IgE-mediated anaphylaxis and do not efficiently interfere with cytokine mediated events of the allergic response in late phase So far, this approach has provided only limited successes.

The administration of certain DNA sequences, generally known as immunostimulatory sequences, induces an immune response with a Th1 type bias as indicated by the secretion of cytokines associated with Th1. The administration of a immunostimulatory polynucleotide with an antigen results in an immune response of the Th1 type against the administered antigen. Roman et al. (1997) Nature Med. 3: 849-854. For example, mice at that is injected intradermally β-galactosidase (β-Gal) from Escherichia coli (E. coli) in saline solution or in the adjuvant alum responded with antibody production specific for IgG1 and IgE, and CD4 + cells that secreted IL-4 and IL-5, but not IFN-?, Demonstrating that the T cells were predominantly of the Th2 subgroup. However, mice at who were injected intradermally (or with an applicator for the scratching the lancet skin) with plasmid DNA (in solution saline) which encoded β-Gal and contained an immunostimulatory sequence responded by producing IgG2a antibodies and CD4 + cells that secreted IFN-?, But not IL-4 and IL-5, demonstrating that T cells belonged predominantly to subgroup Th1. In addition, the production of IgE specific for mice that had been injected with DNA from Plasmid was reduced by 66-75%. Razet al. (1996) Proc. Natl Acad. Sci. USA93: 5141-5145. In general, the answer in front to naked DNA immunization is characterized by production of IL-2, TNF-? and IFN-? By CD4 + T cells stimulated with antigens, which is indicative of a Th1 type response. This It is particularly important in the treatment of allergy and asthma as shown by the lower production of IgE. The capacity of immunostimulatory polynucleotides stimulate a response Th1 type immune has been demonstrated with bacterial antigens, viral and allergen antigens (see, for example, the document WO 98/55495).

References that describe the activity Polynucleotide immunostimulator include: Krug et al. (2001) Eur. J. Immunol. 31: 3026; Baueret al. (2001) J. Immunol. 166: 5000; Klinmanet al. (1999) Vaccine17: 19; Jahn-Schmidet al. (1999) J. Allergy Clin. Immunol. 104: 1015; Tigheet al. (2000) Eur. J. Immunol. 30: 1939; Shirotaet al. (2000) J. Immunol. 164: 5575; Klinmanet al. (1999) Infect Immun. 67: 5658; Southet al. (1999) J. Immunol. 162: 6284; Magoneet al. (2000) Eur. J. Immunol. 30: 1841; Kawaradaet al. (2001) J. Immunol. 167: 5247; Kranzeret al. (2000) Immunology99: 170; Kruget al. (2001) Eur. J. Immunol. 31: 2154; Hartmannet al. (2000) J. Immunol. 164: 944; Baueret al. (1999) Immunology97: 699; Fujiedaet al. (2000) Am. J. Respir. Crit. Care med. 162: 232; Krieg (2002)Annu Rev. Immunol. 20: 709; Verthelyiet al. (2002) J. Immunol. 168: 1659; Hornunget al. (2002) J. Immunol. 168: 4531; Yamamotoet al. (2000) Springer Semin Immunopathol. 22: 35; readet to the. (2000) J. Immunol. 165: 3631; Gurselet to the. (2002) J. Leukoc Biol. 71: 813; Gurselet to the. (2002) Eur. J. Immunol. 32: 2617; Broideet to the. (2001) J. Clin. Immunol. 21: 175; Zhuet to the. (2001) Immunology103: 226; Klinmanet to the. (2002) Infect microbes. 4: 897; Hartmannet to the. (2000) J. Immunol. 164: 1617; Krieg (1999)Biochim Biophys Minutes1489: 107; Dalpkeet al. (2002) Immunology106: 102; Yuet al. (2002) Biochem Biophys Res. Commun. 297: 83; Hafneret to the. (2001) Cancer Res.61: 5523; Zwavelinget to the. (2002) J. Immunol, 169: 350; Daviset to the. (2000) Vaccine18: 1920; Gierynskaet to the. (2002) J. Virol.76: 6568; Lipfordet to the. (2000) J. Immunol, 165: 1228; Freidaget to the. (2000) Infect Immun. 68: 2948; Dieudonneet al. (2001) J. Allergy Clin. Immunol. 107: S233.

Other references describing sequences Immunostimulators include: Krieg et al. (1989) J. Immunol. 143: 2448-2451; Tokunagaet al. (1992) Microbiol Immunol. 36: 55-66; Kataokaet al. (1992) Jpn J. Cancer Res.83: 244-247; Yamamoto et al. (1992) J. Immunol. 148: 4072-4076; Mojciket al. (1993) Clin. Immuno. and Immunopathol. 67: 130-136; Brandaet al. (1993) Biochem Pharmacol. 45: 2037-2043; Pisetsky et al. (1994) Life Sci. 54(2): 101-107; Yamamotoet al.(1994a) Antisense Research and Development. 4: 119-122; Yamamotoet al. (1994b)Jpn J. Cancer Res.85: 775-779; Razet al. (1994) Proc. Natl Acad. Sci. USA91: 9519-9523; Kimuraet al. (1994) J. Biochem. (Tokyo)116: 991-994; Krieg et al. (1995) Nature374: 546-549; Pisetskyet al. (1995) Ann. NY Acad. Sci. 772: 152-163; Pisetsky (1996a) J. Immunol. 156: 421-423; Pisetsky (1996b)Immunity5: 303-310; Zhaoet to the. (1996) Biochem Pharmacol51: 173-182; Yiet al. (1996) J. Immunol. 156: 558-564; Krieg (1996)Trends Microbiol. 4(2): 73-76; Krieget al. (1996) Antisense Nucleic Acid Drug Dev. 6: 133-139; Klinmanet al. (1996) Proc. Natl Acad. Sci. USA. 93: 2879-2883; Razet al. (nineteen ninety six); Satoet al. (1996) Science273: 352-354; Staceyet al. (1996) J. Immunol. 157: 2116-2122; Ballaset al. (1996) J. Immunol. 157: 1840-1845; Brandaet al. (1996) J. Lab. Clin. Med.128: 329-338; Sonehara et al. (1996) J. Interferon and Cytokine Res. 16: 799-803; Klinmanet al. (1997) J. Immunol. 158: 3635-3639; Sparwasseret al. (1997) Eur. J. Immunol. 27: 1671-1679; Romanet al. (1997); Carson et al. (1997) J. Exp. Med. 186: 1621-1622; Chaceet al. (1997) Clin. Immunol and Immunopathol. 84: 185-193; Chuet al. (1997) J. Exp. Med. 186: 1623-1631; Lipfordet to the. (1997a) Eur. J. Immunol. 27: 2340-2344; Lipfordet al. (1997b)Eur. J. Immunol. 27: 3420-3426; Weineret al. (1997) Proc. Natl Acad. Sci. USA94: 10833-10837; Macfarlaneet al. (1997) Immunology91: 586-593; Schwartz et al. (1997) J. Clin. Invest. 100: 68-73; Steinet al. (1997) Antisense Technology, Chapter 11 pp. 241-264, C. Lichtenstein and W. Nellen, Eds., IRL Press; Wooldridgeet al. (1997) Blood89: 2994-2998; Leclercet al. (1997) Cell Immunol. 179: 97-106; Klineet al. (1997) J. Invest. Med. 45(3): 282A; Yiet al. (1998a) J. Immunol. 160: 1240-1245; Yiet al. (1998b)J. Immunol. 160: 4755-4761; Yiet to the. (1998c) J. Immunol. 160: 5898-5906; Yiet al. (1998d)J. Immunol. 161: 4493-4497; Krieg (1998) Applied Antisense Oligonucleotide Technology Chapter 24, pp. 431-448, CA Stein and AM Krieg, Eds., Wiley Liss, Inc .; Krieget al. (1998a) Trends Microbiol6: 23-27; Krieget al.(1998b) J. Immunol. 161: 2428-2434; Krieg et al. (1998c) Proc. Natl Acad. Sci. USA95: 12631-12636; Spiegelberget al. (1998) Allergy53(45S): 93-97; Horneret al. (1998) Immunol cell. 190: 77-82; Jakobet al. (1998) J. Immunol. 161: 3042-3049; Redfordet to the. (1998) J. Immunol. 161: 3930-3935; Weeratnaet al. (1998) Antisense & Nucleic Acid Drug Development8: 351-356; McCluskieet al. (1998) J. Immunol. 161(9): 4463-4466; Gramzinski et al. (1998) Mol. Med. 4: 109-118; Liuet al. (1998) Blood92: 3730-3736; Moldoveanuet to the. (1998) Vaccine16: 1216-1224; Brazolot Milan et al. (1998) Proc. Natl Acad. Sci. USES95: 15553-15558; Briodeet al. (1998) J. Immunol. 161: 7054-7062; Briode et al. (1999) Int. Arch. Allergy Immunol. 118: 453-456; Kovariket al. (1999) J. Immunol. 162: 1611-1617; Spiegelberg et al. (1999) Pediatrician Pulmonol Suppl. 18: 118-121; Martin Orozcoet al. (1999) Int. Immunol. 11: 1111-1118; EP 468,520 documents; WO 96/02555; WO 97/28259; WO 98/16247; WO 98/18810; WO 98/37919; WO 98/40100; WO 98/52581; WO 98/55495; WO 98/55609 and WO 99/11275. See also Elkins et al. (1999) J. Immunol. 162: 2291-2298, WO 98/52962, WO 99/33488, WO 99/33868, WO 99/51259 and WO 99/62923. See also Zimmermann et al. (1998) J. Immunol. 160: 3627-3630; Krieg (1999)Trends Microbiol. 7: 64-65 and the patents of USA Nos. 5,663,153, 5,723,335 and 5,849,719. See also Liang et al. (1996) J. Clin. Invest. 98: 1119-1129; Bohleet al. (1999) Eur. J. Immunol. 29: 2344-2353 and the WO 99/56755. See also WO 99/61056; WO 00/06588; WO 00/16804; WO 00/21556; WO 00/54803; WO 00/61151; WO 00/67023; WO 00/67787 and US Pat. . 6,090,791. See also manzel et al. (1999) Antisense Nucl. Acid Drug Dev.9: 459-464; Verthelyiet al. (2001) J. Immunol. 166: 2372-2377; the WO 01/15726; WO 01/12223; WO 01/22972; WO 01/22990; WO 01/35991; WO 01/51500; WO 01/54720; U.S. patents Nos. 6,174,872, 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116. See also, WO 01/12804; WO 01/45750; WO 01/55341; WO 01/55370; WO 01/62207; WO 01/68077; WO 01/68078; WO 01/68103; WO 01/68116; WO 01/68117; WO 01/68143; WO 01/68144; WO 01/72123; WO 01/76642; WO 01/83503; WO 01/93902; WO 02/026757; WO 05/02/2002; WO 02/069369; WO 02/074922; U.S. patents Nos. 6,339,068, 6,406,705, 6,426,334, 6,426,336, 6,429,199, 6,476,000

<pre listing-type="other">\ newpage</pre>

Immunomodulatory polynucleotides They usually include a CG sequence. Nucleotides that flank the CG of an IMP also seems to play a role in the immunomodulatory activity of the polynucleotide. Is still pending a continuous identification of polynucleotides immunomodulators

Description of the invention

The invention relates to polynucleotides immunomodulators (IMP) and the modulation of immune responses in individuals using these polynucleotides, particularly beings humans.

In one aspect, the invention provides immunomodulatory polynucleotides. In certain embodiments, the invention includes immunomodulatory compositions comprising any of the immunomodulatory polynucleotides of the invention. The compositions may also include, for example, a pharmaceutically acceptable excipient or any of others various components, such as an antigen.

In particular, the invention provides a immunomodulatory polynucleotide comprising:

to) 5- (TCG (Nq)) y (X_ {X} {2} CGX_ {2} 'X_ {1} (CG) p) z

in which N are nucleosides, y = 1, p = 0 or 1, q = 0, 1 or 2, and z = 2-20, X_ {1} and X_ {1} 'are self-complementary nucleosides, X2 and X_ {2} 'are self-complementary nucleosides, and in which the 5 'T of the sequence (TCG (Nq)) y is at the 5 'end of the polynucleotide; and

b) a palindromic sequence of at least 8 bases of length in which the palindromic sequence comprises the first (X_ {X} {2} CGX_ {2} 'X_ {1}') of the sequences (X_ {X} {2} CGX_ {2} 'X_ {1}' (CG) p) z.

Also described in this document is a immunomodulatory polynucleotide comprising (a) a sequence palindromic comprising at least two CG dinucleotides, in which CG dinucleotides are separated by 0, 1, 2, 3, 4 or 5 bases and in which the palindromic sequence has at least 8 bases of length; and (b) a sequence (TCG) y, in which and is 1 or 2, in which the 5 'T of the sequence (TCG) y It is placed at 0, 1, 2 or 3 bases from the 5 'end of the polynucleotide and in which the sequence (TCG) y is separated from the 5 'end of the palindromic sequence by 0.1 or 2 bases. In some immunomodulatory polynucleotides of the invention, whether described in this paragraph or elsewhere of this application, the palindromic sequence has a composition of bases of less than two thirds of G and C. In some cases, the palindromic sequence has a base composition greater than one third of A and T.

Also described in this document is a immunomodulatory polynucleotide comprising (a) a sequence palindromic comprising at least two CG dinucleotides, in which CG dinucleotides are separated by 0, 1, 2, 3, 4 or 5 bases and in which the palindromic sequence has at least 8 bases of length; and (b) a sequence (TCG) y, in which y is 1 or 2, wherein the 5 'T of the sequence (TCG) y is placed at 0, 1, 2 or 3 bases from the 5 'end of the polynucleotide, and also in which the palindromic sequence of (a) includes all or part of the sequence (TCG) y and in which a CG of the sequence (TCG) y may be one of the CG dinucleotides of the palindromic sequence of (a).

Also described in this document is a immunomodulatory polynucleotide comprising (a) 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} X_ {2} CGX_ {2} 'X_ {1}' (CG) {p} ) z (SEQ ID NO: 156) in which N are nucleosides, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, X_ {1} and X_ {1} 'are self-complementary nucleosides, X_ {2} and X_ {2} 'are nucleosides self-complementary, and in which the T of 5 'of the sequence (TCG (Nq)) y is 0-3 bases from the 5 'end of the polynucleotide; and (b) a sequence palindromic at least 8 bases in length in which the sequence palindromic comprises the first (X_ {1} X_ {2} CGX_ {2} 'X_ {1}') of the sequences (X_ {X} {2} CGX_ {2} 'X_ {1}' (CG) p) z. In some cases, X_ {1} and X_ {2} are both A and T. In an IMP with w = -1, the 3 'base of the sequence (TCG (N_ {q})) y is the X_ {5} of the first sequence (X_ {X} {2} CGX_ {2} X_ {1 XCG) {p}). In a IMP with w = -2, the penultimate bases (that is, the second by the final) and the last one (i.e. the one in the final position) of 3 'of the sequence (TCG (Nq)) y are the X 1 and X 2 of 5 ', respectively, of the first sequence (X_ {X} {2} CGX_ {2} 'X_ {1}' (CG) P).

Also described in this document is a immunomodulatory polynucleotide comprising (a) 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} X_ {2} CGX_ {3} X_ {3} 'CGX_ {2}' X_ {1 } (CG) p) z (SEQ ID NO: 159) in which N are nucleosides, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, X_1 and X_ {1} 'are self-complementary nucleosides, X_ {2} and X_ {2} 'are nucleosides self-complementary, X_ {3} and X_ {3} 'are self-complementary nucleosides and in which the T 5 'of the sequence (TCG (Nq)) y is at 0-3 bases from the 5 'end of the polynucleotide; and (b) a palindromic sequence of at least 10 bases in length in which the palindromic sequence comprises the first (X_ {1} X_ {2} CGX_ {3} X_ {3} 'CGX_ {2}' X_ {1} ') (SEQ ID NO: 216) of the sequences (X_ {1} X_ {2} CGX_ {3} X_ {3} 'CGX_ {2}' X_ {1} '(CG) {p}) {z} (SEQ ID NO: 217). In some cases, when p = 1, X_ {1}, X_ {2} and X_ {3} are both A and T. In some cases, when p = 0, at minus two of X_ {1}, X_ {2} and X_ {3} are both A and T.

Also described in this document is a immunomodulatory polynucleotide comprising (a) 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} X_ {X} {3} X_ {4} X_ {5} CGX_ {5} ' X_ {4} 'X_ {3}' X_ {2} 'X_ {1}' (CG) p) z (SEQ ID NO: 160) in which N are nucleosides, x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, X_ {1} and X_ {1} 'are self-complementary nucleosides, X_ {2} and X_ {2} 'are nucleosides self-complementary, X_ {3} and X_ {3} 'are self-complementary nucleosides, X_ {4} and X_ {4} ' are self-complementary nucleosides, X5 and X_ {5} 'are self-complementary nucleosides, and in which the 5 'T of the sequence (TCG (Nq)) y is at 0-3 bases from the 5 'end of the polynucleotide; and (b) a palindromic sequence of at least 12 bases in length in which the palindromic sequence comprises the first (X_ {1} X_ {2} X_ {3} X_ {4} X_ {5} CGX_ {5} 'X_ {4}' X_ {3} 'X_ {2}' X_ {1} ') (SEQ ID NO: 218) of the sequences (X_ {1} X_ {2} X_ {3} X_ {4} X_ {5} CGX_ {5} 'X_ {4}' X_ {3} 'X_ {2}' X_ {1} '(CG) _ {p} z (SEQ ID NO: 219). In some cases, at least three of X_ {1}, X_ {2}, X_ {3}, X_ {4} and X_ {5} are both A and T.

Also described in this document is a immunomodulatory polynucleotide comprising (a) 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (CGX_ {1} X_ {1} 'CG (CG) {p}) {z} (SEQ ID NO: 161) in which N are nucleosides, x = 0-3, y = 1-4, w = -2, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} 'are self-complementary nucleosides and in which the 5 'T of the sequence (TCG (Nq)) y is at 0-3 bases from the 5 'end of the polynucleotide; and (b) a palindromic sequence of at least 8 bases in length in which the palindromic sequence comprises the first (CGX_ {1} X_ {1} 'CG) of the sequences (CGX_1 X_1 'CG (CG) p) z.

Also described in this document is a immunomodulatory polynucleotide comprising (a) 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} CGCGX_ {1} '(CG) {p}) {z} (SEQ ID NO: 162) in which N are nucleosides, x = 0-3, y = 1-4, w = -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, X_ {1} and X_ {1} ' they are self-complementary nucleosides and in which the 5 'T of the sequence (TCG (Nq)) y is at 0-3 bases from the 5 'end of the polynucleotide; and (b) a palindromic sequence of at least 8 bases in length in which the palindromic sequence comprises the first (X_ {1} CGCGX_ {1} ') of the sequences (X_ {CGCGX_ {1} ”(CG) p) z.

Also described in this document is a immunomodulatory polynucleotide comprising (a) 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} X_ {2} CGCGX_ {2} 'X_ {1}' (CG) p} ) z (SEQ ID NO: 163) in which N are nucleosides, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, X_1 and X_ {1} 'are self-complementary nucleosides, X_ {2} and X_ {2} 'are nucleosides self-complementary, and in which the T of 5 'of the sequence (TCG (Nq)) y is 0-3 bases from the 5 'end of the polynucleotide; and (b) a sequence palindromic at least 8 bases in length in which the sequence palindromic comprises the first (X_ {1} X_ {2} CGCGX_ {2} 'X_ {1}') of the sequences (X_ {X} {2} CGCGX_ {2} 'X_ {1}' (CG) p) z (SEQ ID NO: 220). In some cases, X_ {1} and X_ {2} are both A as T.

Also described in this document is a immunomodulatory polynucleotide comprising (a) 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {X} {2} X_ {3} CGCGX_ {3} 'X_ {2}' X_ {1 } '(CG) p) z (SEQ ID NO: 164) in which N are nucleosides, x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, X_ {1} and X_ {1} 'are self-complementary nucleosides, X_ {2} and X_ {2} 'are nucleosides self-complementary, X_ {3} and X_ {3} 'are self-complementary nucleosides, and in which the T 5 'of the sequence (TCG (Nq)) y is at 0-3 bases from the 5 'end of the polynucleotide; and (b) a palindromic sequence of at least 10 bases in length in which the palindromic sequence comprises the first (X_ {1} X_ {2} X_ {3} CGCGX_ {3} 'X_ {2}' X_ {1} ') (SEQ ID NO: 221) of the sequences (X_ {X} {2} X_ {3} CGCGX_ {3} 'X_ {2}' X_ {1} '(CG) {p}) {z} (SEQ ID NO: 222). In some cases, when p = 1, X_ {1}, X_ {2} and X_ {3} are both A and T. In some cases, when p = 0, at minus two of X_ {1}, X_ {2} and X_ {3} are both A and T.

Also described in this document is a immunomodulatory polynucleotide comprising a) 5'-N x (TCG (N q)) y N_ {w} (CGX_ {1} X_ {X} {2} 'X_ {1}' CG (CG) {p}} {z} (SEQ ID NO: 165) in which N are nucleosides, x = 0-3, y = 1-4, w = -2, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, X_ {1} and X_ {1} ' they are self-complementary nucleosides, X2 and X_ {2} 'are self-complementary nucleosides, and in which the 5 'T of the sequence (TCG (Nq)) y is at 0-3 bases from the 5 'end of the polynucleotide; and (b) a palindromic sequence of at least 8 bases in length in which the palindromic sequence comprises the first (CGX_ {1} X_ {2} X_ {2} 'X_ {1}' CG) of the sequences (CGX_ {1} X_ {2} X_ {1} 'CG (CG) p) z (SEQ ID NO: 223). In some cases, X_ {1} and X_ {2} are both A as T.

In another aspect, the invention provides a immunomodulatory polynucleotide of the invention for use in the modulation of an immune response in an individual. A Immunomodulatory polynucleotide of the invention is administered to a individual in an amount sufficient to modulate a response immune in said individual. Immunomodulation according to the invention can be put into practice on individuals, including those who suffer from a disorder associated with an immune response Th2 type (for example, allergies, allergy-induced asthma, or atopic dermatitis), individuals who receive vaccines such as therapeutic vaccines (for example, vaccines comprising a epitope of an allergy, a mycobacterial epitope, or an epitope associated with a tumor) or prophylactic vaccines, individuals with cancer and individuals suffering from an infectious disease.

In another aspect, the invention provides a immunomodulatory polynucleotide of the invention for use in the increase in interferon-gamma (IFN-?) In an individual. An effective amount of an immunomodulatory polynucleotide of the invention is administered to that individual. The administration of a polynucleotide immunomodulator according to the invention increases the IFN-? In the individual.

In another aspect, the invention provides a immunomodulatory polynucleotide of the invention for use in the increase in interferon-alpha (IFN-?) In an individual. An effective amount of an immunomodulatory polynucleotide of the invention is administered to that individual. The administration of a polynucleotide immunomodulator according to the invention increases the IFN-? In the individual.

In another aspect, the invention provides a immunomodulatory polynucleotide of the invention for use in the improvement of one or more symptoms of an infectious disease. A effective amount of an immunomodulatory polynucleotide of the invention is administered to an individual who has a disease infectious Administration of an immunomodulatory polynucleotide according to the invention improves one or more symptoms of the infectious disease

In another aspect, the invention provides a immunomodulatory polynucleotide of the invention for use in the improvement of one or more symptoms of an IgE related disorder. An effective amount of an immunomodulatory polynucleotide of the invention is administered to an individual who has a disorder IgE related. The administration of a polynucleotide immunomodulator according to the invention improves one or more symptoms of IgE related disorder. The invention also provides the use of an immunomodulatory polynucleotide of the invention for the manufacture of a medicament for treating asthma and an immunomodulatory polynucleotide of the invention for use in the asthma treatment

Kits are also described in this document, preferably to carry out the invention. The kits generally comprise an immunomodulatory polynucleotide of the invention (generally in a suitable container), and can also include instructions for the use of the polynucleotide immunomodulator in the immunomodulation of an individual.

Brief description of the drawings

Fig. 1 is a graph representing the amount of IFN-? produced (pg / ml) of PBMC humans in response to varying doses of four different IMPs: SEQ ID NOs: 1, 27, 113 and 172.

Fig. 2 consists of graphs that represent the lytic activity of NK cells stimulated with IMP.

Modes for carrying out the invention

The inventors have discovered polynucleotides immunomodulators and methods to modulate immune responses in individuals, particularly human beings, using these immunomodulatory polynucleotides. The compositions of the invention comprise an immunomodulatory polynucleotide of the invention. The immunomodulatory polynucleotides of the invention include:

to) 5- (TCG (Nq)) y (X_ {X} {2} CGX_ {2} 'X_ {1} (CG) p) z

b) a palindromic sequence of at least 8 bases of length in which the palindromic sequence comprises the first (X_ {X} {2} CGX_ {2} 'X_ {1}') of the sequences (X_ {X} {2} CGX_ {2} 'X_ {1}' (CG) p) z.

The inventors have found that Immunomodulatory polynucleotides of the invention modulate so efficient immune cells, including human cells, in ways diverse. The inventors have observed that polynucleotides immunomodulators of the invention can effectively stimulate cytokine production, including type I interferons, such as IFN-? and IFN- \ omega and IFN- \ gamma, a from human cells. The inventors have also observed that the immunomodulatory polynucleotides of the invention can effectively stimulate B cell proliferation. inventors have observed that some of the polynucleotides immunomodulators of the invention activate dendritic cells Plasmocytes that undergo maturation. The inventors have also observed that the presence of some of the polynucleotides immunomodulators of the invention may cause a delay of the Apoptosis of plasmocytoid dendritic cells in cultures.

The invention also provides a immunomodulatory polynucleotide of the invention for use in the modulation of an immune response in an individual. A Immunomodulatory polynucleotide of the invention is administered to the individual. Also described are kits comprising the IMP of the invention. The kits may also include instructions for administering an immunomodulatory polynucleotide of the invention to immunomodulation in a subject and polynucleotides immunomodulators

General techniques

The experimentation of the present invention employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which found within the knowledge of the technique. Such techniques are explain in detail in the bibliography, such as, "Molecular Cloning: A Laboratory Manual ", second edition (Sambrook et to the., 1989); "Oligonucleotide Synthesis" (MJ Gait, ed., 1984); "Animal Cell Culture" (RI Freshney, ed., 1987); "Handbook of Experimental Immunology" (DM Weir & CC Blackwell, eds.); "Gene Transfer Vectors for Mammalian Cells" (JM Miller & MP Calos, eds., 1987); "Current Protocols in Molecular Biology "(FM Ausubel et al., eds., 1987); "PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994); "Current Protocols in Immunology" (JE Coliganet al., eds., 1991); "The Immunoassay Handbook" (D. Wild, ed., Stockton Press NY, 1994); "Bioconjugate Techniques" (Greg T. Hermanson, ed., Academic Press, 1996); and "Methods of Immunological Analysis "(R. Masseyeff, WH Albert, and NA Staines, eds., Weinheim: VCH Verlags gesellschaft mbH, 1993).

Definitions

As used in this document, the form singular "a", "one" and "the" includes the plural references unless otherwise indicated. By example, "a" IMP includes one or more IMP.

As used in this document in a manner interchangeably, the terms "polynucleotide" and "oligonucleotide" include single stranded DNA (ssDNA), DNA double stranded (dsDNA), single stranded RNA (ssRNA) and double stranded RNA (dsRNA), modified oligonucleotides and oligonucleosides or their combinations The oligonucleotide can be configured linearly or circularly, or the oligonucleotide can contain both segments linear as circular. Oligonucleotides are polymers of nucleosides bound, generally, through phosphodiester bonds, although alternate joints, such as esters of phosphorothioate in oligonucleotides. A nucleoside consists of a purine base (adenine (A) or guanine (G) or its derivative) or pyrimidine (thymine (T), cytosine (C) or uracil (U), or its derivative) attached to a sugar. The four nucleoside units (or bases) in the DNA is called deoxyadenosine, deoxyguanosine, deoxythymidine and deoxycytidine A nucleotide is a phosphate ester of a nucleoside

The expression "polynucleotide immunomodulator "or" IMP "as used herein is refers to a polynucleotide that generates and / or participates in a measurable immune response as measured in vitro, in alive me ex vivo. Examples of immune responses Measurable include, but are not limited to, antibody production antigen specific, cytokine secretion, activation or expansion of lymphocyte populations such as NK cells, CD4 + T lymphocytes, CD8 + T lymphocytes, B lymphocytes, and Similar. Preferably, the IMP sequences activate preferably a response of type Th1.

The expression "immunomodulator" or "modulation of an immune response" as used in this document includes immunostimulatory effects as well as immunosuppressive Immunomodulation is primarily a qualitative alteration in a global immune response, although quantitative changes may also occur along with the immunomodulation An immune response that is immunomodulated from according to the present invention is that which moves towards an immune response "of type Th1", as opposed to a immune response "type Th2". Th1 type responses responses of the cellular immune system are normally considered (for example, cytotoxic lymphocytes), while the responses of type Th2 are generally "humoral", or with a response from antibodies Immune responses of type Th1 are characterized normally by reactions to an antigen "of delayed type hypersensitivity ", and can be detected at biochemical level by increasing levels of associated cytokines to Th1 such as IFN-?, IFN-?, IL-2, IL-12, and TNF-? As well as IL-6, although IL-6 can also be associated with responses of type Th2 as well. The answers Th1 type immune agents are generally associated with production of cytotoxic lymphocytes (CTL) and low levels or a production transient antibody. Immune responses of type Th2 are generally associated with higher production levels of antibodies, including IgE production, absence or minimum production of CTL, as well as cytokine expression associated with Th2 such as IL-4. In accordance with this, the immunomodulation according to the invention can be recognized, for example, by an increase in IFN-? And / or IFN-? And / or a decrease in IgE production in an individual treated for according to the invention as compared to the absence of treatment.

The term "3 '" generally refers to a 3 'region or position of the polynucleotide or oligonucleotide (downstream) from another region or position in it polynucleotide or oligonucleotide. The expression "3 'end" refers to the 3 'end of the polynucleotide.

The term "5 '" generally refers to a 5 'region or position of the polynucleotide or oligonucleotide (upstream) from another region or position in it polynucleotide or oligonucleotide. The expression "5 'end" refers to the 5 'end of the polynucleotide.

A region, portion, or sequence that is find "adjacent" to another sequence directly limits with such region, portion or sequence. For example, another sequence of polynucleotide (for example, a TCG trinucleotide) found adjacent to a particular portion of a polynucleotide Immunomodulator directly borders such region.

The expression "palindromic sequence" or "palindrome" refers to a sequence of nucleic acids that it is an inverted repetition, for example, ABCDD'C'B'A ', where bases, for example, A, and A ', B and B', C and C ', D and D', are capable of form the base pairs of Watson-Crick. Such sequences can be single stranded or they can form structures double-stranded or may form low fork loop structures certain conditions. For example, as used in this document, "an 8 base palindrome" refers to an acid sequence nuclei in which the palindromic sequence has 8 bases of length, such as ABCDD'C'B'A '. A palindromic sequence can be part of a polynucleotide that also contains sequences not palindromic A polynucleotide may contain one or more portions. of palindromic sequences and one or more portions of sequences not palindromic Alternatively, a sequence of Polynucleotides can be entirely palindromic. In a polynucleotide with more than some sequence portions palindromic, portions of palindromic sequence can overlap each other or portions of palindromic sequence They may not overlap each other.

The term "conjugate" refers to a complex in which an IMP and an antigen bind. Such links from Conjugate include covalent and / or non-covalent junctions.

The term "antigen" means a substance that is recognized and specifically bound by a antibody or by a T cell antigen receptor. antigens may include peptides, proteins, glycoproteins, polysaccharides, complex carbohydrates, sugars, gangliosides, lipids and phospholipids; Your portions and combinations. The antigens can be those found in nature or They can be synthetic. The appropriate antigens for the administration with IMP include any molecule capable of generating a specific T cell or B cell antigen response. Preferably, the antigens generate a response with Antigen specific antibodies. Haptens are included within the scope of the term "antigen". A hapten is a low molecular weight compound that is not immunogenic by itself but that becomes immunogenic when conjugated with a molecule immunogenic that contains antigenic determinants. Molecules small may require becoming haptenized to become antigenic Preferably, the antigens of the present invention include peptides, lipids (eg, sterols, acids fatty and phospholipids), polysaccharides such as those used in vaccines of Hemophilusinfluenza, gangliosides and glycoproteins

"Adjuvant" refers to a substance that, when added to an immunogenic agent such as an antigen, non-specific or potentiates an immune response against the agent in the receiving host under exposure to the mixture.

The term "peptide" are polypeptides that they have sufficient length and composition to produce a biological response, for example, the production of antibodies or Cytokine activity whether or not the peptide is a hapten. Normally, the peptides have at least six residues of amino acid in length. The term "peptide" also includes modified amino acids (both natural and synthetic), including such modifications, although without restriction, phosphorylation, glycosylation, pegylation, lipidization and methylation

"Antigenic Peptides" may include purified natural peptides, synthetic peptides, proteins recombinants, unpurified protein extracts, viruses attenuated or inactivated cells, microorganisms, or fragments of such peptides. An "antigenic peptide" or "polypeptide antigenic "according to this means all or a portion of a polypeptide that exhibits one or more antigenic properties. A) Yes, for example, an "Amb to 1 antigenic polypeptide" or "antigen of Amb a 1 "polypeptide is an amino acid sequence of Amb a 1, as an entire sequence, portion of the sequence, and / or sequence modification, which exhibits an antigenic property (i.e. specifically binds to an antibody or a receptor of T cells).

A "release molecule" or "vehicle of liberation "is a chemical residue that facilitates, allows and / or potentiates the release of an immunomodulatory polynucleotide in a particular site and / or with respect to a particular program. A release vehicle may or may not further stimulate a immune response.

An "allergic response to the antigen" means an immune response generally characterized by generation of eosinophils and / or specific IgE antigens and their resulting effects. As is well known in the art, IgE is binds to IgE receptors in mast cells and basophils. Under the exposure to the antigen recognized by IgE later, the antigen is lattice with IgE in mast cells and basophils causing degranulation of these cells, including, but not limited to, Histamine release It is understood and it is intended that the "allergic response to antigen" expressions, "allergy" and "allergic condition" are equally appropriate for the application of the invention. Also I know it is understood and intended that the uses of the invention include those that are equally appropriate for the prevention of a allergic response as well as the treatment of an allergic condition preexisting.

As used herein, the term "allergen" means an antigen or antigenic portion of a molecule, usually a protein, that generates a response allergic under exposure to a subject. Typically the subject is allergic to the allergen as indicated, for example, by the papule test and erythematous reaction or any method known in the art. It is said that a molecule is an allergen even if only a small subset of subjects exhibit a allergic immune response (eg, IgE) under exposure to molecule. Various allergens isolated in the art are known. These include, but are not limited to, those provided in the Table 1 in this document.

The term "desensitization" refers to to the process of administering increasing doses of an allergen to It has been shown that the subject shows sensitivity. The Examples of allergen doses used for desensitization are know in the art, see, for example, Fornadley (1998)OtolaryngolClin. North am. 31 :111-127.

"Antigen specific immunotherapy" refers to any form of immunotherapy that involves antigen and generate a specific antigen modulation of the immune response. In the context of allergy, immunotherapy Specific antigen includes, but is not limited to, therapy desensitization

The term "microcarrier" refers to a particle composition that is insoluble in water and that has a size less than about 150, 120 or 100 µm, preferably less than about 50-60 µm, preferably less than about 10 µm, preferably less than about 5, 2.5, 2 or 1.5 µm. Microcarriers include "nanocarriers," which are microcarriers that are less than about 1 in size µm, preferably less than about 500 nm. The microcarriers include solid phase particles such as particles formed from biocompatible natural polymers, synthetic polymers or synthetic copolymers, although microcarriers formed from agarose or crosslinked with agarose may be included or excluded from the definition of microcarriers of this document as well as other materials biodegradable known in the art. The microcarriers for use in the present invention they may or may not be biodegradable. The Non-biodegradable solid phase microcarriers are formed from of polymers or other materials that are not erodible and / or degradable under physiological conditions in mammals, such as polystyrene, polypropylene, silica, ceramic materials, polyacrylamide, gold, latex, hydroxyapatite, dextran and materials ferromagnetic and paramagnetic. The solid phase microcarriers biodegradable can be formed from polymers that are degradable (for example, poly (lactic acid), poly (glycolic acid) and its copolymers) or erodible (for example, poly (ortho esters such as 3,9-diethyliden-2,4,8,10-tetraoxaspiro [5.5] undecano (DETOSU) or poly (anhydrides), such as poly (anhydrides) of sebacic acid) under conditions Physiological of mammals. The microcarriers can also be in the liquid phase (for example, in an oily or lipid base), such as liposomes, iscomas (complexes immuno-stimulators, which are stable complexes of cholesterol, phospholipids and adjuvant-saponin active) without antigen, or drops or micelles found in emulsions of oil-in-water or water-in-oil. Microcarriers in the biodegradable liquid phase they usually incorporate an oil biodegradable, several of which are known in the art, including squalene and vegetable oils. Microcarriers they usually have a spherical shape, although the microcarriers that are presented in almost spherical shape are also acceptable (for example, ellipsoidal, cylindrical, etc.). Because of his insoluble nature (with respect to water), the microcarriers are filterable in water and aqueous solutions (solutions aqueous).

The term "non-biodegradable," as used in this document, it refers to a microcarrier that does not degrade or erodes under normal physiological conditions in mammals. Generally, a microcarrier is considered not biodegradable if it does not degrade (that is, it loses less than 5% of its mass or its average polymer length) after a 72 hour incubation at 37 ° C in normal human serum.

A microcarrier is considered to be "biodegradable" if it is degradable or erodible under normal physiological conditions of mammals. Usually, a microcarrier is considered biodegradable if it degrades (that is, it loses at least 5% of its mass or its length polymeric average) after a 72-hour incubation at 37 ° C in normal human serum.

The "size" of a microcarrier is usually the "design size" or the intended size of the particles established by the manufacturer. Size can be a directly measurable dimension, such as the average diameter or maximum, or it can be determined by an indirect test such as a screening test by filtration. Direct size measurement of the microcarrier is normally carried out by microscopy, usually optical microscopy or scanning microscopy electronic (SEM), comparing with particles of known size or by reference to a micrometer. How minor variations arise in the size during the manufacturing process, it is considered that microcarriers are of an established size if the measurements show that microcarriers have approximately + - 5-10% of the established measure. The characteristics in size can also be determined by techniques of dynamic light scattering or opacity. Alternatively, The size of the microcarrier can be determined by tests of filter selection. A microcarrier is smaller than established if at least 97% of the particles pass through a "grid type" filter of the established size (it is that is, a filter in which the retained particles remain on the filter surface, such as polycarbonate filters or polyethersulfone, in contrast to a "depth filter" in which retained particles are deposited inside the filter). A microcarrier is larger than an established size if at least approximately 97% of the particles of the microcarrier remain retained by a grid type filter of the established size. Thus, at least about 97% of microcarriers of about 10 µm to about 10 nm in size become through a 10 µm pore grid filter and are retained by a 10 nm grid filter.

As indicated above, the references to a size or size range for a microcarrier implicitly include approximate variations and approximations of the established size and / or the range of sizes. This is reflects by the use of the term "approximately" when it is done reference to a size and / or size range, and with the reference to a size or size range without reference to "approximately" does not mean that the size and / or range of Sizes be accurate.

The expression "polynucleotide complex immunomodulator / microcarrier "or" IMP / MC complex "se refers to a complex of an immunomodulatory polynucleotide and a microcarrier The components of the complex can be joined covalently or not covalently. Non-covalent junctions can be mediated by any non-covalent bond strength, including by hydrophobic interaction, ionic bond (electrostatic), hydrogen bonds and / or van der forces Waals. In the case of hydrophobic joints, the union is made usually via a hydrophobic moiety (for example, cholesterol) covalently linked to the IMP.

An "individual" is a vertebrate, such as avian, and is preferably a mammal, more preferably a being human. Mammals include, but are not limited to, beings humans, primates, farm animals, sports animals, rodents and pets.

An "effective amount" or an "amount enough "of a substance is that amount sufficient to produce beneficial or desired results, including results clinical, and as such, an "effective amount" depends on the context in which it is applied. In the context of administration of a composition that modulates an immune response against a co-administered antigen, an effective amount of a immunomodulator polynucleotide and antigen is an amount enough to achieve such modulation as compared to the immune response obtained when the antigen is administered alone. An effective amount can be administered in one or several administrations

The term "joint administration" according used in this document refers to the administration of at least two different substances close enough in time to Modulate an immune response. Preferably, the administration joint refers to the simultaneous administration of at least two different substances

The "stimulation" of a response or parameter includes generating and / or enhancing such response or parameter. For example, the "stimulation" of an immune response, such as the Th1 response, it means an increase in the response, which may increase from the generation and / or the enhancement of an answer. Similarly, the "stimulation" of a cytokine or cell of this type (such as CTL) means an increase in the amount or level of cytokine or cells of this type. The "stimulation" of B cells includes, for example, the Enhanced B cell proliferation, B cell activation induced and / or increased cytokine production, such as IL-6 and / or TNF-?, From stimulated B cells.

An "IgE-associated disorder" is a physiological condition that is characterized, in part, by levels elevated IgE, which may or may not be IgE associated disorders persistent and that include, but without restriction, allergy and allergic reactions, food allergies, related disorders with allergies (described below), asthma, rhinitis, dermatitis atopic, conjunctivitis, urticaria, shock, allergies to poisons of Hymenoptera and allergies to drugs and parasitic infections. The expression also includes manifestations related to these disorders. Generally, IgE, in such disorders, is specific to antigen.

An "allergy related disorder" means a disorder caused by the effects of a response Immune specific IgE immune system. Such effects may include, although without restriction, hypotension and shock. Anaphylaxis is a example of an allergy related disorder during which histamine released in the circulation causes vasodilation as well as a greater permeability of the capillaries with a marked resulting loss of plasma from the circulation. Anaphylaxis can occur systemically, with the associated effects suffered by all the body, and can occur locally, with a limited reaction in a specific target tissue or organ.

The expression "viral disease" as used in this document, refers to a disease that has a virus as its etiologic agent. The examples of diseases Viral include hepatitis B, hepatitis C, influenza, syndrome Acquired immunodeficiency (AIDS), and herpes zoster.

As used in this document, and as understood in the art, "treatment" is an approach to obtain desired beneficial or clinical results, including clinical results For purposes of this invention, desired beneficial or clinical results include, but without restriction, relief or improvement of one or more symptoms, decreased degree of disease, stabilized disease status (i.e. no worsening), prevention of disease spread, delay or delay of disease progression, improvement or palliation of disease status, and remission (both partial and total), being detectable or undetectable. "Treatment" it can also mean prolong survival as compared with the expected survival if the treatment is not received.

"Alleviate" a disease or disorder means that the degree and / or undesirable clinical manifestations of a disorder or disease state are reduced and / or the period of progression time is reduced or shortened, as compared to Do not treat the disorder. Especially in the context of allergy, as understood by those skilled in the art, palliation may occur under the modulation of the immune response against an allergen (s). In addition, palliation does not occur necessarily by the administration of a dose, although often occurs under the administration of a series of doses. So, one enough to alleviate a response or disorder can be administered in one or more administrations.

An "antibody titer" or "amount of antibody ", which is" generated "by a polynucleotide immunomodulator and antigen refers to the amount of a given antibody measured at the time after the administration of the immunomodulatory polynucleotide and the antigen.

An "antibody associated with Th1" is a antibody whose production and / or increase is associated with a response Th1 immune. For example, IgG2a is an antibody associated with Th1 in mice For the purposes of this invention, the measurement of a Th1 associated antibody can be measured from one or more of such antibodies. For example, in humans, the measure of a Th1 associated antibody could cover the measure of IgG1 and / or IgG3.

An "antibody associated with Th2" is a antibody whose production and / or increase is associated with a response Th2 immune. For example, IgG1 is an antibody associated with Th2 in mice. For the purposes of this invention, the measurement of a Th2-associated antibody can be measured from one or more of such antibodies. For example, in humans, the measure of a Th2-associated antibody could encompass the measure of IgG2 and / or IgG4.

"Delete" or "inhibit" a function or activity, such as cytokine production, production of antibodies or histamine release, is to reduce the function or activity when compared to other similar conditions except for a condition or parameter of interest, or alternatively, as compared to another condition. For example, a composition comprising an immunomodulatory polynucleotide and antigen that suppresses the release of histamine reduces the release of histamine as compared, for example, with the release of histamine induced by an antigen alone. As another example, a composition comprising an immunomodulatory polynucleotide and antigen that suppresses antibody production reduces the degree and / or antibody levels as compared, for example, with the degree and / or antibody levels produced by the antigen single.

A "whey protein" is a protein that It is normally found in the serum of healthy mammals, particularly healthy cattle. The most prevalent whey protein It is serum albumin.

As used herein, the term "who understands" and his cognates are used in their inclusive sense; that is, equivalent to the term "that includes" and its cognates corresponding.

Compositions of the invention

The invention provides polynucleotides immunomodulators (IMP) to modulate immune responses in individuals The compositions of the invention comprise a immunomodulatory polynucleotide of the invention alone (or a combination of two or more immunomodulatory polynucleotides of the invention) or together with another immunomodulatory agent, such as a peptide, an antigen (described below) and / or an adjuvant additional. The compositions of the invention may comprise a immunomodulatory polynucleotide of the invention and an excipient pharmaceutically acceptable. The excipients pharmaceutically Acceptable, including buffers, are well known in the art. Remington: "The Science and Practice of Pharmacy", 20th edition, Mack Publishing (2000).

Under his administration, the compositions that they comprise an antigen, an immunomodulatory polynucleotide of the invention, and optionally an adjuvant can lead to a potentiation of an immune response against the antigen and so, they can cause an enhanced immune response compared to that results from a composition comprising the IMP and the antigen alone. Adjuvants are known in the art and include, but are not restriction, emulsions of oil-in-water emulsions of water-in-oil, alum (salts of aluminum), liposomes and microparticles, including, but not restriction, polystyrene, starch, polyphosphazene and polylactide / polyglycosides. Other suitable adjuvants also include, but are not limited to, MF59, DETOX® (Ribi), mixtures of squalene (SAF-1), muramyl peptide, derivatives of saponin, mycobacterial cell wall preparations, monophosphoryl lipid A, derivatives of mycolic acid, non-ionic block copolymer surfactants, Quil A, subunit of cholera toxin B, polyphosphazene and derivatives, and complexes immunostimulators (ISCOM) such as those described by Takahashiet al. (1990) Nature344: 873-875, as well as, basic adjuvants lipid and others described in this document. For veterinary use and for the production of antibodies in animals, they can be used Freund's adjuvant mitogenic components (both complete and incomplete).

The IMPs of the invention can be combined with other therapies for particular indications. For example, in addition of an IMP, the compositions of the invention can also understand anti-malaria drugs such as Chloroquine for patients with malaria, such leishmanicidal drugs such as pentamidine and / or allopurinol for patients with leishmaniasis, anti-mycobacterial drugs such as isoniazid, rifampin and / or ethambutol for patients with tuberculosis or reagents of allergen desensitization for atopic patients (allergy).

As described in this document, the Compositions of the invention may include IMPs and may further comprise one or more additional immunotherapeutic agents (i.e., an agent that acts via the immune system and / or is derived from the immune system) including, but not limited to, cytokine, adjuvants and antibodies. Examples of antibodies Therapeutics include those used in the context of cancer (for example, anti-tumor antibodies), such as those described below.

Immunomodulatory polynucleotides

In the following paragraphs, the specific immunomodulatory polynucleotides found within the scope of the invention with an asterisk (*). It is described in this document an immunomodulatory polynucleotide containing the minus a palindromic sequence (i.e., a palindrome) of at at least 8 bases in length containing at least one CG dinucleotide. The IMP also contains at least one trinucleotide sequence TCG in the 5 'end of the polynucleotide or near (i.e. 5'-TCG). In some cases, the palindromic sequence and 5'-TCG are separated by 0, 1 or 2 bases in the IMP. In some cases the palindromic sequence includes all or part of the 5'-TCG.

Various IMPs have been described in the art and their activity can be easily identified using standard tests which indicate various aspects of the immune response, such as the cytokine secretion, antibody production, activation NK cell, B cell proliferation, proliferation of T cells. See, for example, WO 97/28259; WO 98/16247; WO 99/11275; Krieget al. (1995) Nature374: 546-549; Yamamotoet al. (1992a); Ballas et al. (nineteen ninety six); Klinmanet al. (1997); Satoet al. (nineteen ninety six); Pisetsky (1996a); Shimadaet al. (1986) Jpn J. Cancer Res.77: 808-816; Cowderyet al. (1996) J. Immunol. 156: 4570-4575; Romanet to the. (1997); Lipfordet al. (1997a); WO documents 98/55495 and WO 00/61151. According to this, these and other methods can be used to identify, analyze and / or confirm IMPs immunomodulators

The IMP can be any length greater than 10 bases or base pairs, preferably greater than 15 bases or base pairs, more preferably greater than 20 bases or pairs of length bases.

As clearly agreed in this document, It is understood that, with respect to the formulas described in this document, any and all parameters are selected independently. For example, if x = 0-2, y can be independently selected independently among the values of x (or any other selectable parameter in a formula).

In some cases, an IMP comprises a) a palindromic sequence of at least 8 bases in length containing at least two CG dinucleotides, where the CG dinucleotides are separated from each other by 0, 1, 2, 3, 4 or 5 bases, and b) a sequence (TCG) y located at 0, 1, 2 or 3 bases from the end 5 'of the polynucleotide, where y is 1 or 2, and where the 3' end of the sequence (TCG) y is separated from the 5 'end of the palindromic sequence by 0, 1 or 2 bases. In some cases, a CG dinucleotide of the sequence (TCG) y of (b) can count for one of the at least two CG dinucleotides in the sequence palindromic of (a). In some cases, the CG dinucleotides of the Palindromic sequence are separated from each other by 1, 3 or 4 bases. In some IMP of the invention, both those described in this paragraph as in other parts of the application, the palindromic sequence It has a base composition of less than two thirds of G and C. In some embodiments, the palindromic sequence has a base composition greater than one third of A and T.

An IMP is described in this document that comprises a) a palindromic sequence of at least 8 bases of length containing at least two CG dinucleotides, where the CG dinucleotides are separated from each other by 0.1, 2, 3, 4 or 5 bases, and b) a sequence (TCG) y located at 0, 1, 2 or 3 bases from the 5 'end of the polynucleotide, where y is 1 or 2, where the palindromic sequence includes all or part of the sequence (TCG) y, and where a CG dinucleotide of the sequence (TCG) y of (b) can count for one of the dinucleotides CG of the palindromic sequence of (a). Preferably, the CG dinucleotides of the palindromic sequence are separated between yes for 1, 3 or 4 bases.

According to this, an IMP may comprise a sequence with the formula: 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} CGX_ {1} ' (CG) p) z (SEQ ID NO: 155) in which N are nucleosides with x = 0-3, y = 1-4, w = -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} 'are self-complementary and in which the T of 5 'of the sequence (TCG (Nq)) y is 0-3 bases from the 5 'end of the polynucleotide. The IMP includes also a palindromic sequence of 8 bases in length or greater in which the palindromic sequence comprises at least one of the sequences (X 1 CGX 1 '(CG) p). In an IMP with w = -1, the 3 'base of the sequence (TCG (N_ {q})) y is the X_ {1} of 5 'of the first sequence (X_ {CGX_ {1} '(CG) p). In some cases, the sequence (TCG (Nq)) y is separated from the sequence palindromic by 0, 1 or 2 bases. In other cases, the sequence palindromic includes all or part of the sequence (TCG (Nq)) y. In some cases, when p = 0, X_ {1} It is both A and T.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

The following sequences (sequences palindromic underlined), except those marked with a asterisk (*), are shown for illustrative purposes only:

An IMP may comprise a sequence of the formula: 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} X_ {2} {3} CGX_ {3} 'X_ {2}' X_ {1 } '(CG) p) z (SEQ ID NO: 157) in which N are nucleosides with x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} ', X_ {2} and X_ {2}', and X_ {3} and X_ {3} 'are self-complementary and in which the T of 5 'of the sequence (TCG (Nq)) y is 0-3 bases from the 5 'end of the polynucleotide. The IMP includes also a palindromic sequence of 8 bases in length or greater in which the palindromic sequence comprises the first (X_ {1} X_ {2} X_ {3} CGX_ {3} 'X_ {2}' X_ {1} ') of at least one sequence (X_ {1} X_ {2} X_ {3} CGX_ {3} 'X_ {2}' X_ {1} '(CG) {p}) (SEQ ID NO: 224). In an IMP with w = -1, the 3 'base of the sequence (TCG (N_ {q})) y is the X_ {5} of the first sequence (X_ {1} X_ {2} X_ {3} CGX_ {3} 'X_ {2}' X_ {1} '(CG) {p}) (SEQ ID NO: 224). In an IMP with w = -2, the penultimate bases (is say, the second by the end) and the last (that is, that of the final position) of 3 'of the sequence (TCG (Nq)) y they are the X_ {1} and X_ {5}, respectively, of the first sequence (X_ {1} X_ {2} X_ {3} CGX_ {3} 'X_ {2}' X_ {1} ' (CG) p) (SEQ ID NO: 224). In an IMP with w = -3, the bases antepenultimate (that is, the third by the end), the penultimate (is say, the second by the end) and the last (that is, that of the final position) of 3 'of the sequence (TCG (Nq)) y are the X_ {1}, X_ {2} and X_ {5} of 5 ', respectively, of the first sequence (X_ {1} X_ {2} X_ {3} CGX_ {3} 'X_ {2}' X_ {1} '(CG) {p}) (SEQ ID NO: 224). In some cases, the sequence (TCG (N_ {q})) y is separated from the sequence palindromic by 0, 1 or 2 bases. In other cases, the sequence palindromic includes all or part of the sequence (TCG (Nq)) y. In some cases, when p = 1, X_ {1}, X_ {2} and X_ {3} are both A and T. In some cases, when p = 0, at least two of X_ {1}, X_ {2} and X_ {3} are both A as T.

The following sequences (sequences underlined palindromic) are shown for purposes only illustrative:

An IMP may comprise a sequence of the formula: 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} X_ {X} {3} X_ {4} CGX_ {4} 'X_ {3} 'X_ {2}' X_ {1} ' (CG) p) z (SEQ ID NO: 158) in which N are nucleosides with x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} ', X_ {2} and X_ {2} ', X_ {3} and X_ {3}', and X_ {4} and X_ {4} 'are self-complementary and in which the T of 5 'of the sequence (TCG (Nq)) y is 0-3 bases from the 5 'end of the polynucleotide. The IMP includes also a palindromic sequence of 10 bases in length or greater in which the palindromic sequence comprises the first (X_ {1} X_ {2} X_ {3} X_ {4} CGX_ {4} 'X_ {3}' X_ {2} 'X_ {1}') (SEQ ID NO: 225) of at least one sequence (X_ {1} X_ {2} X_ {3} X_ {4} CGX_ {4} 'X_ {3}' X_ {2} 'X_ {1}' (CG) {p}) (SEQ ID NO: 226). In an IMP with w = -1, the 3 'base of the sequence (TCG (Nq)) y is the X1 of 5 'of the first sequence (X_ {1} X_ {2} X_ {3} X_ {4} CGX_ {4} 'X_ {3}' X_ {2} 'X_ {1}' (CG) {p}) (SEQ ID NO: 226). In an IMP with w = -2, the penultimate bases (is say, the second by the end) and the last (that is, that of the final position) of 3 'of the sequence (TCG (Nq)) y they are the X_ {1} and X_ {5}, respectively, of the first sequence (X_ {1} X_ {2} X_ {3} X_ {4} CGX_ {4} 'X_ {3}' X_ {2} 'X_ {1}' (CG) p) (SEQ ID NO: 226). In an IMP with w = -3, the bases antepenultimate (that is, the third by the end), the penultimate (is say, the second by the end) and the last (that is, that of the final position) of 3 'of the sequence (TCG (Nq)) y are the X_ {1}, X_ {2} and X_ {5} of 5 ', respectively, of the first sequence (X_ {1} X_ {2} X_ {3} X_ {4} CGX_ {4} 'X_ {3}' X_ {2} 'X_ {1}' (CG) {p}) (SEQ ID NO: 226). In some cases, the sequence (TCG (N_ {q})) y is separated from the sequence palindromic by 0, 1 or 2 bases. In other cases, the sequence palindromic includes all or part of the sequence (TCG (Nq)) y. In some cases, when p = 1, at minus three of X_ {1}, X_ {2}, X_ {3} and X_ {4} are both A and T. In some cases, when p = 0, at least two of X_ {1}, X_ {2}, X_ {3} and X_ {4} are both A and T.

The following sequences (sequences palindromic underlined), except those marked with an asterisk (*), are for illustrative purposes only:

An IMP may comprise a sequence of the formula: 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} CGCGX_ {1} '(CG) {p}) {z} (SEQ ID NO: 162) in which N are nucleosides with x = 0-3, y = 1-4, w = -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} 'are self-complementary and in which the T 5 'of the sequence (TCG (Nq)) y is at 0-3 bases from the 5 'end of the polynucleotide. He IMP also comprises an 8-base palindromic sequence of length or greater in which the palindromic sequence comprises the first (X_ {1} CGCGX_ {1} ') of at least one sequence (X_ {CGCGX_ {1} '(CG) p). In an IMP with w = -1, the 3 'base of the sequence (TCG (N_ {)) y is X_ {1} 5 'of the first sequence (X_ {1} CGCGX_ {1}' (CG) p). In some cases, the sequence (TCG (N_ {q})) y is separated from the sequence palindromic by 0, 1 or 2 bases. In other cases, the sequence palindromic includes all or part of the sequence (TCG (Nq)) y. The following sequences (sequences underlined palindromic) are shown for purposes only illustrative:

An IMP may comprise a sequence of the formula: 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (CGX_ {1} X_ {1} 'CG (CG) {p}) {z} (SEQ ID NO: 161) in which N are nucleosides with x = 0-3, y = 1-4, w = -2, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} 'are self-complementary and in which the T 5 'of the sequence (TCG (Nq)) y is at 0-3 bases from the 5 'end of the polynucleotide. He IMP also comprises an 8-base palindromic sequence of length or greater in which the palindromic sequence comprises the first (CGX_ {1} X_ {1} 'CG) of at least one sequence (CGX_1 X_ {1} 'CG (CG) p). In an IMP with w = -2, the penultimate bases (that is, the second by the end) and the last (i.e. the end position) of 3 'of the sequence (TCG (N_ {q})) y are CG and are the 5 'CG of the first sequence (CGX_1 X_ {1} 'CG (CG) p). In some cases, the sequence (TCG (Nq)) y is separated from the palindromic sequence by 0, 1 or 2 bases. In other cases, the palindromic sequence includes all or part of the sequence (TCG (Nq)) y. The following sequences (sequences underlined palindromic) are shown for purposes only illustrative:

An IMP may comprise a sequence of the formula: 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} X_ {2} CGX_ {3} X_ {3} 'CGX_ {2}' X_ {1 } (CG) p) z (SEQ ID NO: 159) in which N are nucleosides with x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} ', X_ {2} and X_ {2}', and X_ {3} and X_ {3} 'are self-complementary and in which the T of 5 'of the sequence (TCG (Nq)) y is 0-3 bases from the 5 'end of the polynucleotide. The IMP includes also a palindromic sequence of 10 bases in length or greater in which the palindromic sequence comprises the first (X_ {1} X_ {2} CGX_ {3} X_ {3} 'CGX_ {2}' X_ {1} ') (SEQ ID NO: 216) of at least one sequence (X_ {1} X_ {2} CGX_ {3} X_ {3} 'CGX_ {2}' X_ {1} '(CG) {p}) (SEQ ID NO: 217). In an IMP with w = -1, the 3 'base of the sequence (TCG (Nq)) y is the X1 of 5 'of the first sequence (X_ {1} X_ {2} CGX_ {3} X_ {3} 'CGX_ {2}' X_ {1} '(CG) {p}) (SEQ ID NO: 217). In an IMP with w = -2, the penultimate bases (is say, the second by the end) and the last (that is, that of the final position) of 3 'of the sequence (TCG (Nq)) y they are the X_ {1} and X_ {5}, respectively, of the first sequence (X_ {1} X_ {2} CGX_ {3} X_ {3} 'CGX_ {2}' X_ {1} '(CG) {p}) (SEQ ID NO: 217). In some cases, the sequence (TCG (N_ {q})) y is separated from the sequence palindromic by 0, 1 or 2 bases. In other cases, the sequence palindromic includes all or part of the sequence (TCG (Nq)) y. In some cases, when p = 1, X_ {1}, X_ {2} and X_ {3} are both A and T. In some embodiments, when p = 0, at least two of X_ {1}, X_ {2} and X 3 are both A and T. The following sequences (sequences underlined palindromic) are shown for purposes only illustrative:

An IMP of the invention may comprise a formula sequence: 5 '- (TCG (Nq)) y (X_ {X} {2} CGX_ {2} X_ {1}' (CG) p) z in which N are nucleosides with y = 1, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} ', X_ {2} and X_ {2} 'are self-complementary, and in which the T 5 'of the sequence (TCG (Nq)) y is in the 5 'end of the polynucleotide. The IMP also comprises a sequence palindromic 8 bases in length or greater in which the sequence palindromic comprises the first (X_ {X} {2} CGX_ {2} 'X_ {1}') of at least one sequence (X_ {X} {2} CGX_ {2} 'X_ {1}' (CG) p) z. In some embodiments, the sequence (TCG (Nq)) y It is separated from the palindromic sequence by 0, 1 or 2 bases. In other embodiments, the palindromic sequence includes all or part of the sequence (TCG (Nq)) y. In some embodiments, X_ {1} and X_ {2} are both A and T.

In some embodiments, the IMP comprises the following sequences (underlined palindromic sequences), marked with an asterisk (*). The rest only has ends illustrative:

<pre listing-type="other">\ newpage</pre>

In some embodiments, in an IMP of the invention, X1 X2 is not AA. In some embodiments, in a IMP of the invention, X_ {1} is not A. According to this, in some embodiments, the IMP comprises the following sequences (palindromic sequences underlined). The rest only has ends illustrative:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

An IMP may comprise a sequence of the formula: 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} X_ {X} {3} X_ {4} X_ {5} CGX_ {5} ' X_ {4} 'X_ {3}' X_ {2} 'X_ {1}' (CG) p) z (SEQ ID NO: 160) in which N are nucleosides with x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} ', X_ {2} and X_ {2} ', X_ {3} and X_ {3}', X_ {4} and X_ {4} ', and X_ {5} and X_ {5} 'are self-complementary, and in which the T 5 'of the sequence (TCG (Nq)) y is at 0-3 bases from the 5 'end of the polynucleotide. He IMP also comprises a 12-base palindromic sequence of length or greater in which the palindromic sequence comprises the first (X_ {1} X_ {2} X_ {3} X_ {4} X_ {5} CGX_ {5} 'X_ {4}' X_ {3} 'X_ {2}' X_ {1} ') (SEQ ID NO: 218) of at least one sequence ((X_ {1} X_ {2} X_ {3} X_ {4} X_ {5} CGX_ {5} 'X_ {4}' X_ {3} 'X_ {2}' X_ {1} '(CG) p) (SEQ ID NO: 219). In an IMP with w = - 1, the 3 'base of the sequence (TCG (Nq)) y is the X1 of 5 'of the first sequence (X_ {1} X_ {2} X_ {3} X_ {4} X_ {5} CGX_ {5} 'X_ {4}' X_ {3} 'X_ {2}' X_ {1} '(CG) _ {p}) (SEQ ID NO: 219). In an IMP with w = -2, the penultimate bases (is say, the second by the end) and the last (that is, that of the final position) of 3 'of the sequence (TCG (Nq)) y they are the X_ {1} and X_ {5}, respectively, of the first sequence (X_ {1} X_ {2} X_ {3} X_ {4} X_ {5} CGX_ {5} 'X_ {4}' X_ {3} 'X_ {2}' X_ {1} '(CG) _ {p}) (SEQ ID NO: 219). In an IMP with w = -3, the antepenultimate basis (is say, the third by the end), the penultimate (that is, the second at the end) and the last one (i.e. the end position) of 3 ' of the sequence (TCG (Nq)) y are the X1, X_ {2} and X_ {5}, respectively, of the first sequence (X_ {1} X_ {2} X_ {3} X_ {4} X_ {5} CGX_ {5} 'X_ {4}' X_ {3} 'X_ {2}' X_ {1} '(CG) _ {p}) (SEQ ID NO: 219). In some cases, the sequence (TCG (N_ {q})) y is separated from the sequence palindromic by 0, 1 or 2 bases. In other cases, the sequence palindromic includes all or part of the sequence (TCG (Nq)) y. In some cases, at least three of X_ {1}, X_ {2}, X_ {3}, X_ {4} and X_ {5} are both A and T. following sequences (underlined palindromic sequences) are show for illustrative purposes only:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

An IMP may comprise a sequence of the formula: 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {1} X_ {2} CGCGX_ {2} 'X_ {1}' (CG) p} ) z (SEQ ID NO: 163) in which N are nucleosides with x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} ', and X_ {2} and X_ {2}' are self-complementary, and in which the T of 5 'of the sequence (TCG (Nq)) y is 0-3 bases from the 5 'end of the polynucleotide. The IMP includes also a palindromic sequence of 8 bases in length or greater in which the palindromic sequence comprises the first (X_ {1} X_ {2} CGCGX_ {2} 'X_ {1}') of at least one sequence (X_ {X} {2} CGCGX_ {2} 'X_ {1}' (CG) p) (SEQ ID NO: 220). In an IMP with w = -1, the 3 'base of the sequence (TCG (N_ {q})) y is the X_ {5} of the first sequence (X_ {X} {2} CGCGX_ {2} 'X_ {1} (CG) p) (SEQ ID NO: 220). In an IMP with w = -2, the penultimate bases (that is, the second by the end) and the last (that is, the position final) of 3 'of the sequence (TCG (Nq)) y are X_ {1} and X_ {5}, respectively, of the first sequence (X_ {X} {2} CGCGX_ {2} 'X_ {1}' (CG) p) (SEQ ID NO: 220). In some cases, the sequence (TCG (Nq)) y It is separated from the palindromic sequence by 0, 1 or 2 bases. In other cases, the palindromic sequence includes all or part of the sequence (TCG (Nq)) y. In some cases, X_ {1} and X 2 are both A and T. The following sequence (sequence palindromic underlined) is shown for illustrative purposes only Tives:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

An IMP may comprise a sequence of the formula: 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (X_ {X} {2} X_ {3} CGCGX_ {3} 'X_ {2}' X_ {1 } '(CG) p) z (SEQ ID NO: 164) in which N are nucleosides with x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} ', X_ {2} and X_ {2}' and X_ {3} and X_ {3} 'are self-complementary, and in which the T of 5 'of the sequence (TCG (Nq)) y is 0-3 bases from the 5 'end of the polynucleotide. The IMP includes also a palindromic sequence of 10 bases in length or greater in which the palindromic sequence comprises the first (X_ {1} X_ {2} X_ {3} CGCGX_ {3} 'X_ {2}' X_ {1} ') (SEQ ID NO: 221) of at least one sequence (X_ {X} {2} X_ {3} CGCGX_ {3} 'X_ {2}' X_ {1} '(CG) {p}) (SEQ ID NO: 222). In an IMP with w = -1, the 3 'base of the sequence (TCG (Nq)) y is the X1 of 5 'of the first sequence (X_ {X} {2} X_ {3} CGCGX_ {3} 'X_ {2}' X_ {1} '(CG) {p}) (SEQ ID NO: 222). In an IMP with w = -2, the penultimate bases (is say, the second by the end) and the last (that is, that of the final position) of 3 'of the sequence (TCG (Nq)) y they are the X_ {1} and X_ {5}, respectively, of the first sequence (X_ {X} {2} X_ {3} CGCGX_ {3} 'X_ {2}' X_ {1} '(CG) {p}) (SEQ ID NO: 222). In an IMP with w = -3, the antepenultimate basis (is say, the third by the end), the penultimate (that is, the second at the end) and the last one (i.e. the end position) of 3 ' of the sequence (TCG (Nq)) y are the X1, X_ {2} and X_ {5}, respectively, of the first sequence (X_ {X} {2} X_ {3} CGCGX_ {3} 'X_ {2}' X_ {1} '(CG) {p}) (SEQ ID NO: 222). In some cases, the sequence (TCG (N_ {q})) y is separated from the sequence palindromic by 0, 1 or 2 bases. In other cases, the sequence palindromic includes all or part of the sequence (TCG (Nq)) y. In some cases, when p = 1, X_ {1}, X_ {2} and X_ {3} are both A and T. In some cases, when p = 0, at least two of X_ {1}, X_ {2} and X_ {3} are both A as T. The following sequence (underlined palindromic sequence) It is for illustrative purposes only:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

An IMP may comprise a sequence of the formula: 5'-N_ {x} (TCG (N_ {q})) y {N} {w} (CGX_ {1} X_ {2} X_ {2} 'X_ {1}' CG (CG) _ {p } z (SEQ ID NO: 165) in which N are nucleosides with x = 0-3, y = 1-4, w = -2, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1-20, in which X_ {1} and X_ {1} ', and X_ {2} and X_ {2}' are self-complementary, and in which the T of 5 'of the sequence (TCG (Nq)) y is 0-3 bases from the 5 'end of the polynucleotide. The IMP includes also a palindromic sequence of 8 bases in length or greater in which the palindromic sequence comprises the first (CGX_ {1} X_ {2} X_ {2} 'X_ {1}' CG) of at least one sequence (CGX_ {1} X_ {2} X_ {2} 'X_ {1}' CG (CG) p) (SEQ ID NO: 223). In an IMP with w = -2, the penultimate bases (that is, the second by the end) and the last (that is, the position final) of 3 'of the sequence (TCG (Nq)) y are CG and they are the 5 'CG of the first sequence (CGX_ {1} X_ {2} X_ {2} 'X_ {1}' CG (CG) p) (SEQ ID NO: 223). In some cases, the sequence (TCG (Nq)) y It is separated from the palindromic sequence by 0, 1 or 2 bases. In other cases, the palindromic sequence includes all or part of the sequence (TCG (Nq)) y. In some cases, X_ {1} and X 2 are both A and T. The following sequence (sequence palindromic underlined) is shown for illustrative purposes only:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

For IMPs that comprise any of the Reasons described in this document (ie SEQ ID NOs: 155 - 165) where y = 2 or more, the (N_ {q}) in each of the repetitions de y del (TCG (N_ {q})) is independently selected. For example, in an IMP with y = 2, the first TCG (N_ {q}) it can have N = A and q = 1 and the second TCG (N_ {q}) can have q = 0 in which case this portion of the IMP would be ... TCGATCG .... In some embodiments of the IMPs comprising any of the reasons described in this document (ie SEQ ID NOs: 155 - 165) x is preferably 0 or 1. In some cases of the IMP that include any of the reasons described in this document (ie, SEQ ID NOs: 155-165), and is preferably 1 or 2. In some cases of the IMP that include any of the reasons described in this document (i.e., SEQ ID NOs: 155-165), w is preferably 0. In some cases of the IMP that comprise any of the reasons described in this document (i.e. SEQ ID NOs: 155-165), z is preferably 1, 2, 3, 4, 5, 6, 7 or 8. In the IMP of the invention, z is preferably 2, 3, 4, 5, 6, 7 or 8.

As indicated above, IMPs contain the less a palindromic sequence of at least 8 bases in length. In some embodiments, an IMP contains at least one sequence. palindromic of at least the following lengths (in bases): 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30. In some embodiments, the Palindromic sequence is repeated at least once in an IMP. In some embodiments, the palindromic sequence also includes the 5 'bases of the sequence (TCG (Nq)) y, if exist.

An immunomodulatory polynucleotide may contain modifications. IMP modifications include any known in the art, although without restriction, the modifications of the OH group of 3 'or OH of 5', modifications of the base of the nucleotide, modifications of the sugar component and modifications of the phosphate group. Some such modifications are described further. down. Modified bases can be included in the sequence palindromic of an IMP provided that the base (s) modified (s) maintain the same specificity for your natural complement through base pairing of Watson-Crick (for example, that portion palindromic IMP is still complementary).

An IMP can be linear, it can be circular or include circular portions and / or may include a loop of fork. In some embodiments, the IMP comprises the following cyclic sequence (underlined palindromic sequences):

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

An IMP can be single stranded DNA or double stranded as well as single stranded or double stranded RNA or others modified polynucleotides. The following double stranded sequences They are for illustrative purposes only:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

An IMP may contain natural bases or modified, artificial, and may contain sugar, phosphate and / or modified ends. For example, in addition to the unions phosphodiester, phosphate modifications include, but are not restriction, methyl phosphonate, phosphorothioate, phosphoramidate (in bridge or without bridge), phosphotriester and phosphorodithioate and can be used in any combination. Other joints can also be used not based on phosphate. In some embodiments, the polynucleotides of the present invention comprise only structures of phosphorothioate. In some embodiments, the polynucleotides of The present invention comprises only phosphodiester structures. In some embodiments, an IMP may comprise a combination of phosphate bonds in the phosphate structure such as a combination of phosphodiester and phosphorothioate junctions. For example, In some embodiments, the IMP comprises the following sequences ("s" indicates phosphorothioate junctions) marked with a asterisk (*). The rest is for illustrative purposes only:

The sugar modifications known in the field, such as analogues of 2'-alkoxy-RNA analogs of 2'-amino-RNA, 2'-fluoro-DNA and chimeras 2'-alkoxy- or amino-RNA / DNA and others described in this document, can also be made and combined with any phosphate modification. The examples of base modifications (discussed below) include, but without restriction, the addition of an electron acceptor moiety to C-5 and / or C-6 of an IMP cytosine (for example, 5-bromocytosine, 5-chlorocytosine, 5-fluorocytosine, 5-iodocytosine) and C-5 and / or C-6 of an IMP uracil (for example, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, 5-iodouracil). See, for example, international patent application No. WO 99/62923. As indicated above, the use of a modification of based on a palidromic sequence of an IMP should not interfere with the self-complementary capacity of the bases involved for the pairing of the bases of Watson-Crick However, out of a sequence palindromic, modified bases can be used without this restriction. The following sequences are only for illustrative:

IMP can be synthesized using techniques and nucleic acid synthesis equipment that are well known in the technique including, but not limited to, enzymatic methods, chemical methods, and the degradation of larger sequences of oligonucleotides See, for example, Ausubelet al. (1987); and Sambrook et al. (1989). When assembled enzymatically, individual units can be ligated, by example, with a ligase such as T4 DNA or RNA ligase. Patent USA . 5,124,246. Oligonucleotide degradation can achieved through exposure of an oligonucleotide to a nuclease, as shown in US Pat. . 4,650,675.

IMP can also be isolated using conventional polynucleotide isolation procedures. Such procedures include, but are not limited to, the hybridization of genomic library or cDNA probes for detect shared nucleotide sequences, selection of Expression library antibodies to detect characteristics shared structural and natural sequence synthesis particular by the polymerase chain reaction.

The immunomodulatory polynucleotide can be isolated circulate, synthesize through recombinant methods, or chemically synthesized When the circular IMP is obtained at through isolation or through recombinant methods, the IMP It will preferably be a plasmid. The chemical synthesis of Smaller circular oligonucleotides can be performed using any method described in the bibliography. See, for example, Gao et al. (1995) Nucleic Acids Res. 23: 2025-2029; and Wanget al. (1994) Nucleic Acids Res. 22:2326-2333.

The double helix shapes (i.e. double-stranded) and fork most of the IMP are in dynamic balance, the fork shape being favored generally at low concentration of the polynucleotide and higher temperatures Covalent crosslinks inter-chain or intra-chain increase double helix or fork stability, respectively, towards thermal, ionic, pH and induced induced conformational changes of concentration Chemical crosslinks can be used to close the polynucleotide both in the form of double helix and of fork for physicochemical and biological characterization. IMP reticulates that are conformationally homogeneous and that are "closed" in its most active form (both in its double form propeller like fork) could be potentially more active than their counterparts not crosslinked. According to this, some IMP of the invention contain covalent crosslinks inter-chain and / or intra-chain.

Various modes of knowledge are known in the art. Chemically crosslink the double helix DNA. Any method of crosslinking can be used as long as the polynucleotide product cross-linked possesses the desired immunomodulatory activity.

A method, for example, creates a bridge disulfide between two opposite thymidines at the end of the double propeller or fork. For this cross-linking method, the oligonucleotide (s) of interest are synthesize (n) with a 5'-DMT-N3- (tBu-SS-ethyl) thymidine-3'-phosphoramidite ("T *"). To form the disulfide bridge, the disulfide bonds mixed are reduced, the oligonucleotide is purified, the chains are hybridize and the compound is oxidized in air to form the crosslink intra-chain in the case of a fork form or cross-linked interchain in the case of a double helix shape. So Alternatively, oligonucleotides can hybridize first and then be reduced, purified and oxidized in air. Such methods and others are describe, for example, in Glick et al. (1991) J. Org. Chem. 56: 6746-6747, Glick et al. (1992) J. Am. Chem. Soc. 114: 5447-5448, Goodwin et al. (1994) Tetrahedron Letters35: 1647-1650, Wanget al. (1995) J. Am. Chem. Soc. 117: 2981-2991, Osborne et al. (1996) Bioorganic & Medicinal Chemistry Letters6: 2339-2342 and Osborne et al. (1996) J. Am. Chem. Soc. 118:11993-12003.

Examples of polynucleotide sequences in which one 5'-DMT-N3- (tBu-SS-ethyl) thymidine-3'-phosphoramidite ("T *") can be incorporated for the purpose of crosslinking Include the following. The incorporation of T * at the 3 'end of an analogue of SEQ ID NO: 27 (5'-TCGTCGAACGTTCGAGATGAT * -3 ', SEQ ID NO: 185) and in the 5 'end of an analogue of SEQ ID NO: 29 (5'-T * TCATCTCGAACGTTCGACGA-3 ', SEQ ID NO: 186) would allow crosslinking in a double helix of the two chains at the 3 'end of the analog of SEQ ID NO: 27. The incorporation of the T * in two positions in an analogue of SEQ ID NO: 113 * would allow two crosslinks to form a crosslink Double helix or simple to maintain a fork shape. By example, sequence folding 5'-TCGT * AACGTTCGAACGTTCGAACGTTT * -3 (SEQ ID NO: 227 *) in a fork structure and the formation of a crosslink in the substituted T residues it would produce a polynucleotide crosslinked with the following secondary structure.

Such fork structure or structure of double helix of the same sequence would have a 5'-TCG free although constrained in two positions (the 3 'end and 4 bases inside from the 5 'end).

Another cross-linking method forms a bridge disulfide between residues displaced in the double structure propeller or fork. For this cross-linking method, the oligonucleotide (s) of interest are synthesize (n) with convertible nucleosides (commercially available, for example, in Glen Research). This method uses, for example, an AA disulfide or a bridge AC disulfide and are also possible unions to through other bases. To form the modified polynucleotide of disulfide, the polynucleotide that contains the convertible nucleoside is reacted with cystamine (or other amine containing disulfide). To form the disulfide bridge, the disulfide bonds mixed are reduced, the oligonucleotide is purified, the chains are hybridize and the compound oxidizes in air to form the intra-chain crosslinking in the case of a fork shape or the interchain crosslinking in the case of a double helix shape. Alternatively, oligonucleotides can hybridize. first and then be reduced, purified and oxidized in the air. Such methods are described, for example, in Ferentz et al. (1991) J. Am. Chem. Soc. 113: 4000-4002 and Ferentz et al. (1993) J. Am. Chem. Soc. 115:9006-9014.

Examples of polynucleotide sequences in which the waste of N6-cystamine-2'-dA (A *) displaced are used to crosslink a double helix include the following. The incorporation of the A * at the 3 'end of the sequence 5'-TCGTCGAACGTTCGAGA * TGAT-3 ', SEQ ID NO: 191 and at the 5 'end of its 5'-ATCA * TCTCGAACGTTCG ACGA-3 ', SEQ ID NO: 192 complementary would allow a double helix crosslinking of the two chains in the 3 'end of SEQ ID NO: 191. Such modifications can also used to crosslink the fork structures.

The techniques for preparing polynucleotides and Modified polynucleotides are known in the art. DNA or RNA natural, which contains phosphodiester bonds, is synthesized generally sequentially coupling phosphoramidite from nucleoside appropriate to the 5'-hydroxy group of increasing oligonucleotide attached to a solid support at the end 3 ', followed by the oxidation of the phosphite triester intermediate in a phosphate triester. Once the sequence has been synthesized desired polynucleotides, the polynucleotide is removed from the support, the triaster phosphate groups are deprotected in diesters of phosphate and nucleoside bases are deprotected using ammonia aqueous or other bases. See, for example, Beaucage (1993) "Oligodeoxyribonucleotide Synthesis" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties(Agrawal, ed.) Humana Press, Totowa, NJ; Warneret al. (1984) DNA3: 401 and US Pat. . 4,458,066.

IMP may also contain polynucleotides phosphate modified, some of which are known to stabilize the polynucleotide. According to this, some embodiments include immunomodulatory polynucleotides stabilized The synthesis of polynucleotides containing bonds Modified phosphate or non-phosphate-based junctions are also Knows in the art. For a review, see Matteucci (1997) "Oligonucleotide Analogs: an Overview" in Oligonucleotides as Therapeutic Agents, (DJ Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY. The phosphorous derivative (or group modified phosphate) that can bind sugar or the rest of the analog of sugar in the polynucleotides of the present invention may be a monophosphate, diphosphate, triphosphate, alkyl phosphonate, phosphorothioate, phosphorodithioate, phosphoramidate or the like. The preparation of the aforementioned phosphate analogs, and their incorporation into nucleotides, modified nucleotides and oligonucleotides, per se, is also known and does not require described in this document in detail. Peyrotteset to the. (1996) Nucleic Acids Res. 24: 1841-1848; Chaturvediet al. (1996) Nucleic Acids Res. 24: 2318-2323; and Schultz et al. (1996) Nucleic Acids Res. 24: 2966-2973. For example, the synthesis of phosphorothioate oligonucleotides is similar to that described above for natural oligonucleotides except the oxidation stage it is replaced by a sulfurization stage (Zon (1993) "Oligonucleoside Phosphorothioates" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190). Similarly, the synthesis of other phosphate analogs, such as phosphotriester (Miller et al. (1971) JACS93: 6657-6665), non-bridged phosphoramidates (Jager et al. (1988) Biochem. 27: 7247-7246), phosphoramidiates from N3 'to P5' (Nelson et al. (1997) JOC62: 7278-7287) and phosphorodithioates (patent for USA . 5,453,496) has also been described. Can also be used other modified non-phosphorous oligonucleotides (Stirchak et to the. (1989) Nucleic Acids Res. 17: 6129-6141). Polynucleotides with phosphorothioate structures may be more immunogenic than those which have phosphodiester structures and appear to be more resistant to degradation after injection into the host. Braunet to the. (1988) J. Immunol. 141: 2084-2089; and Latimeret al. (1995) Mol. Immunol. 32:1057-1064.

The IMPs used in the invention may comprise one or more ribonucleotides (containing ribose as the only one or main component of sugar), deoxyribonucleotides (which contain deoxyribose as the main component of sugar), or, as is known in the art, modified sugars or analogs of Sugar can be incorporated into the IMP. So, in addition to ribose and deoxyribose, the rest of the sugar can be pentose, deoxy-dense, hexose, deoxyhexose, glucose, arabinose, xylose, lyxose and a group "analog" cyclopentyl sugar. The sugar can be in pyranosyl or furanosyl form. In the IMP, the rest of the sugar is preferably ribose, deoxyribose, arabinose or furanoside 2'-0-alkylribose, and sugar can be attached to the respective heterocyclic bases both in anomeric configuration α as β. The modifications of Sugar include, but are not limited to, analogs of 2'-alkoxy-RNA analogs of 2'-amino-RNA, 2'-fluoro-DNA and chimeras of 2'-alkoxy- or amino-RNA / DNA. By For example, a modification of sugar in the IMP includes, but without restriction, 2'-O-methyl-uridine and 2'-O-methyl-cytidine. The preparation of these sugars or sugar analogs and the respective "nucleosides" in which such sugars or analogs bind to a heterocyclic base (nucleic acid base) per se, and does not need to be described in this document, except that the degree of such preparation may belong to Any specific example. The sugar modifications too can be made and combined with any phosphate modification in the preparation of an IMP.

Heterocyclic bases, or acid bases Nuclei, which are incorporated into the IMP can be the basis of main natural purine and pyrimidine, (i.e. uracil, thymine, cytosine, adenine and guanine, as mentioned before), as well as natural and synthetic modifications of said bases main. Thus, an IMP can include 2'-deoxyuridine and / or 2-amino-2'-deoxyadenosine.

Those skilled in the art will recognize that a large number of "synthetic" unnatural nucleosides that they comprise diverse heterocyclic bases and several sugar residues (and sugar analogs) are available in the art, and that provided that the other criteria of the present invention are satisfy, the IMP may include one or more heterocyclic bases other than the main components of five acid bases natural nuclei Preferably, however, the base heterocyclic in the IMP includes, but is not limited to, the groups uracil-5-yl, cytosin-5-yl, adenin-7-yl, adenin-8-yl, guanin-7-ilo, guanin-8-ilo, 4-aminopyrrolo [2.3-d] pyrimidin-5-yl, 2-amino-4-oxopyrolo [2,3-d] pyrimidin-5-yl, 2-amino-4-oxopyrrolo [2.3-d] pyrimidin-3-yl, where purines join the rest of the IMP sugar via position 9, the pyrimidines via position 1, the pyrrolopyrimidines via the position 7 and the pyrazolopyrimidines via position 1.

The IMP can comprise at least one base modified As used herein, the expression "base modified "is synonymous with" base analog ", for example, "modified cytosine" is synonymous with "analogue of cytosine ". Similarly, nucleosides or nucleotides "modified" are defined in this document as a synonym for "analogs" of nucleoside or nucleotide. The examples of basic modifications include, but are not limited to, the addition of an electron acceptor moiety to C-5 and / or C-6 of an IMP cytosine. Preferably, the electron acceptor moiety is a halogen. Such cytosines Modified may include, but is not limited to, azacytosine, 5-Bromocytosine, bromouracil, 5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil, 5,6-dihydrocytosine, 5-iodocytosine, hydroxyurea, iodouracil, 5-nitrocytosine, uracil and any other modified pyrimidine or pyrimidine analog. Other examples of base modifications include, but are not restriction, the addition of an electron acceptor moiety to C-5 and / or C-6 of a uracil of immunomodulatory polynucleotide. Preferably, the acceptor moiety of Electrons is a halogen. Such modified uracils can include, but not limited to, 5-bromouracil, 5-chlorouracil, 5-fluorouracil and 5-iodouracil.

Other examples of basic modifications include the addition of one or more thiol groups at the base including, but not limited to, 2-amino-adenine, 6-uncle guanine, 2-uncle-thymine, 4-uncle-thymine, 5-propynyl-uracil and 4-uncle-uracil. Other examples of Base modifications include, but are not limited to, N4-ethylcytosine, 7-desazaguanine, 7-desaza-8-azaguanine and 5-hydroxycytosine. See, for example, Kandimallaet al. (2001) Bioorg Med. Chem. 9: 807-813. In some cases, the IMP includes the following sequences with modified bases (sequence palindromic underlined) and marked with an asterisk (*). The rest It is for illustrative purposes only.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

As illustrated in Example 1, the IMPs that maintain a double helix shape at low concentration tend to be able to stimulate the production of IFN-? From human PBMC. The stabilization of double helix polynucleotide forms at through crosslinking has been previously described. When are in the form of a double helix with its complementary sequence, certain modified bases can also increase the stability of The double helix For example, 2-amino-dA (commercially available, for example, in Glen Research) forms 3 bridges of hydrogen with T instead of 2 hydrogen bridges, as formed between dA and T. SEQ ID NO: 188, an analogue of SEQ ID NO: 27, contains five 2-amino-dA bases in place of the five dA bases of SEQ ID NO: 27 and form a double Propeller stronger with itself than SEQ ID NO: 27 (data from size exclusion chromatography). The incorporation of these modified bases increases the Tm by approximately 3 ° C by modification. As demonstrated in this document in Example 1, SEQ ID NO: 188 also induced the production of more IFN-? SEQ ID NO: 27 when treated Human PBMC with 0.8 µg / ml IMP. SEQ ID NO: 884 double-stranded induced approximately three times the production of IFN-? SEQ ID NO: 188 single chain.

The modified nucleoside preparation of base, and the synthesis of modified oligonucleotides using said modified base nucleosides as precursors, has been described, for example, in US Pat. 4,910,300, 4,948,882 and 5,093,232. These modified base nucleosides have been designed to so that they can be incorporated by chemical synthesis in positions terminals or internal of an oligonucleotide. Such nucleosides modified base, present in the terminal positions or internal to an oligonucleotide, can serve as sites for binding of a peptide or other antigen. Have also been described modified nucleosides in its remaining sugar (including, although without restriction, for example, US Pat. 4,849,513, 5,015,733, 5,118,800, 5,118,802) and can be used Similary.

In some cases, a polynucleotide immunomodulator is less than about any of the following lengths (in bases or base pairs): 10,000; 5,000; 2500; 2000; 1500; 1250; 1000; 750; 500; 300; 250; 200; 175; 150; 125; 100; 75; 60; fifty; 40; 30; 25; twenty; fifteen; 14; 13; 12; eleven; 10. In some embodiments, an immunomodulatory polynucleotide is greater that approximately any of the following lengths (in bases or base pairs): 10; eleven; 12; 13; 14; fifteen; twenty; 25; 30; 40; fifty; 60; 75; 100; 125; 150; 175; 200; 250; 300; 350; 400; 500; 750; 1000; 2000; 5000; 7500; 10000; 20,000; 50,000 Alternatively, the immunomodulatory polynucleotide can have any of one variety of sizes with an upper limit of 10,000; 5,000; 2500; 2000; 1500; 1250; 1000; 750; 500; 300; 250; 200; 175; 150; 125; 100; 75; 60; fifty; 40; 30; 25; twenty; fifteen; 14; 13; 12; eleven; 10 and a limit bottom independently selected from 10; eleven; 12; 13; 14; fifteen; twenty; 25; 30; 40; fifty; 60; 75; 100; 125; 150; 175; 200; 250; 300; 350; 400; 500; 750; 1000; 2000; 5000; 7500, in which the limit lower is less than the upper limit. In some embodiments, an IMP is preferably approximately 200 bases in length or less.

Methods are also described in this document. to prepare the immunomodulatory polynucleotides described in this document. The methods can be any of those described in this document. For example, the method could be to synthesize the IMP (for example, using solid state synthesis) and can also understand which one (s) you want purification stage (s). The purification methods are known in the art. Other preparation methods include combine an immunomodulatory polynucleotide and an antigen.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Antigen

Any antigen can be administered in conjunction with an immunomodulatory polynucleotide and / or used in compositions comprising an immunomodulatory polynucleotide and the antigen (and the preparation of these compositions).

In some embodiments, the antigen is a allergen Examples of recombinant allergens are provided. in Table 1. The preparation of many allergens is well known in the art, including, but not limited to, the preparation of the ambrosia pollen allergen Antigen E (Amb to I) (Rafnaret al. (1991) J. Biol. Chem. 266: 1229-1236), Lol p1 lawn allergen (Tamborini et al. (1997) Eur. J. Biochem. 249: 886-894), dust mite allergens Main Der pI and Der PII (Chua et al. (1988) J. Exp. Med. 167: 175-182; Chuaet al. (1990) Int. Arch. Allergy Appl. Immunol. 91: 124-129), Fel cat domestic allergen d I (Rogers et al. (1993) Mol. Immunol. 30: 559-568), birch pollen from the canyons Bet vl (Breiteneder et al. (1989) EMBO J. 8: 1935-1938), allergens of Japanese cedar Cry j 1 and Cry j 2 (Kingetsu et al. (2000) Immunology99: 625-629), and other protein antigens tree pollens (Elsayed et al. (1991) Scand. J. Clin. Lab. Invest. Suppl. 204: 17-31). How I know indicates, tree allergens are known, including Japanese birch, juniper and cedar allergens. The preparation of protein antigens from grass pollen for the administration in vivo.

In some embodiments, the allergen is a food allergen, including, but not limited to, allergen of the peanut, for example Ara h I (Stanley et al. (1996) Adv. Exp. Med. Biol. 409: 213-216); nut allergen, for example, Jug r I (Tueber et al. (1998) J. Allergy Clin. Immunol. 101: 807-814); walnut allergen Brazil, for example, albumin (Pastorello et al. (1998) J. Allergy Clin. Immunol. 102: 1021-1027; shrimp allergen, for example, Pen a I (Reese et al. (1997) Int. Arch. Allergy Immunol. 113: 240-242); egg allergen, for example, ovomucoid (Crooke et al. (1997) J. Immunol. 159: 2026-2032); milk allergen, for example, bovine β-lactoglobin (Selot et to the. (1999) Clin. Exp. Allergy29: 1055-1063); fish allergen, for example, parvalbúminas (Van Do et al. (1999) Scand. J. Immunol. 50: 619-625; Gallandet to the. (1998) J. Chromatogr. B. Biomed. Sci. Appl. 706: 63-71). In some embodiments, the allergen is a latex allergen, including, but not restriction, Hev b 7 (Sowka et al. (1998) Eur. J. Biochem. 255: 213-219). Table 1 shows an illustrative list of allergens that can be used.

TABLE 1

Recombinant allergens

In some embodiments, the antigen originates. from an infectious agent, including protozoa, bacteria, fungi (including unicellular and multicellular) and viral agents infectious Examples of suitable viral antigens are described herein and are known in the art. Bacteria include Hemophilus influenza, Mycobacterium tuberculosis and Bordetella pertussis. The agents Infectious protozoa include malaria by Plasmodium, Leishmania spp., Trypanosoma spp. andSchistosoma spp. Fungi includeCandida albicans.

In some embodiments, the antigen is a viral antigen Viral polypeptide antigens include, although unrestricted, HIV proteins such as gag proteins of HIV (including, but not limited to, protein anchoring membrane (MA), core capsid protein (CA) and protein nucleocapsid (NC)), HIV polymerase, matrix protein influenza virus (M) and nucleocapsid protein virus influenza (NP), hepatitis B surface antigen (HBsAg), Hepatitis B core protein (HBcAg), protein of hepatitis e (HBeAg), hepatitis B DNA polymerase, antigens of Hepatitis C and the like. References studying the Flu vaccination include Scherle and Gerhard (1988) Proc. Natl Acad. Sci. USA85: 4446-4450; Scherle and Gerhard (1986) J. Exp. Med.164: 1114-1128; Granoffet al. (1993) Vaccine11: 546-51; Kodihalliet to the. (1997) J. Virol.71: 3391-3396; Ahmeida et al. (1993) Vaccine11: 1302-1309; Chenet al. (1999) Vaccine17: 653-659; Govorkova and Smirnov (1997) Virol Act. (1997) 41: 251-257; Koideet al. (1995) Vaccine13: 3-5; Mbawuikeet al. (1994) Vaccine12: 1340-1348; Tamuraet al. (1994) Vaccine12: 310-316; Tamuraet al. (1992) Eur. J. Immunol. 22: 477-481; Hirabayashi et al. (1990) Vaccine8: 595-599. Other examples of polypeptides antigens are group specific antigens or subgroup, which are known for various agents infectious, including, but not limited to, adenovirus, virus of herpes simplex, papillomavirus, respiratory syncytial virus and poxvirus.

Many peptides and proteins are known antigenic, and are available in the art; others may Identify using conventional techniques. For immunization against tumor formation or tumor treatment existing, immunomodulatory peptides can include cells tumor (live or irradiated), tumor cell extracts or protein subunits of tumor antigens such as Her-2 / neu, Mart1, carcinoembryonic antigen (CEA), gangliosides, human milk fat globule (HMFG), mucin (MUC1), MAGE antigens, BAGE antigens, GAGE antigens, gp100, prostate specific antigen (PSA) and tyrosinase. Immune contraception vaccines may be formed including sperm proteins administered with IMP. Leaet al. (1996) Biochim Biophys Minutes1307:263.

Attenuated and inactivated viruses are suitable for use herein as antigens. The preparation of these virus is well known in the art and many are commercially available (see, for example, "Physicians' Desk Reference" (1998) 52nd edition, Medical Economics Company, Inc.). For example, Poliovirus is available as IPOL® (Pasteur Merieux Connaught) and ORIMUNE® (Lederle Laboratories), the virus of the hepatitis A as VAQTA® (Merck), measles virus as ATTENUVAX® (Merck), the mumps virus like MUMPSVAX® (Merck) and the rubella virus like MERUVAX®II (Merck). In addition, viruses attenuated and inactivated such as HIV-1, HIV-2, herpes simplex virus, hepatitis B, rotavirus, human and non-human papillomavirus and slow brain viruses can provide antigens peptides

In some embodiments, the antigen comprises a viral vector, such as vaccine, adenovirus and smallpox from Canary.

Antigens can be isolated from their source using purification techniques known in the art or, more conveniently, they can be produced using methods recombinant

Antigenic peptides may include peptides. purified natural, synthetic peptides, recombinant proteins, unpurified protein extracts, attenuated and inactivated viruses, cells, microorganisms or fragments of such peptides. The immunomodulatory peptides may be natural or may synthesized chemically or enzymatically. Any method of Chemical synthesis known in the art is suitable. Can be used Dissolution phase peptide synthesis to construct peptides of moderate size or, for the chemical construction of peptides, solid phase synthesis can be used. Athertonet al. (1981) Hoppe Seylers Z. Physiol. Chem. 362: 833-839. Can also be used proteolytic enzymes to couple amino acids to produce peptides Kullmann (1987)Enzymatic Peptide Synthesis, CRC Press, Inc. Alternatively, the peptide can be obtained using the biochemical machinery of a cell, or by isolation from from a biological source. DNA techniques can be used recombinant for peptide production. Hameset al. (1987) Transcription and Translation: A Practical Approach, IRL Press Peptides can also be isolated using standard techniques such as affinity chromatography.

Preferably, the antigens are peptides, lipids (e.g. sterols excluding cholesterol, acids fatty and phospholipids), polysaccharides such as those used in vaccines of H. influenza, gangliosides and glycoproteins. These can be obtained through various methods known in the technique, including isolation and synthesis using methods Chemical and enzymatic. In certain cases, such as for many sterols, fatty acids and phospholipids, antigenic portions of the molecules are commercially available.

Examples of viral antigens useful in compositions and object methods using the compositions include, although unrestricted, HIV antigens. Such antigens include, although without restriction, those antigens derived from HIV envelope glycoproteins including, but not restriction, gp160, gp120 and gp41. Numerous sequences are known for HIV genes and antigens. For example, the database of HIV sequences from Los Alamos National Laboratory collects, Accurate and describe nucleotide and amino acid sequences of HIV. This database is accessible via the Internet and in a publication annual, see Human

Retroviruses and AIDS Compendium (by example, the 2000 edition).

Antigens derived from agents can be obtained infectious using methods known in the art, for example, to from natural viral or bacterial extracts, from cells infected with the infectious agent, from purified polypeptides, from polypeptides produced recombinantly and / or synthetic peptides.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

IMP-Antigen

When used with an antigen, IMP can administered with the antigen in various ways. In some embodiments, an IMP and an antigen can be administered with spatial proximity to each other, or as a mixture (that is, in dissolution). As described above, spatial proximity it can be achieved in various ways, including conjugation (union), encapsidation, via fixation to a platform or adsorption on a surface. Generally, and most preferably, an IMP and a antigen are associated with proximity at an effective distance to enhance the immune response generated compared to the IMP and antigen administration as a mixture.

In some embodiments, the IMP is conjugated with the antigen The IMP portion can be coupled with the portion of antigen of a conjugate in various ways, including covalent and / or non-covalent interactions.

The union between the portions can be done in the 3 'or 5' end of the IMP, or on a properly modified basis in an internal position in the IMP. If the antigen is a peptide and contains a suitable reactive group (for example, an ester of N-hydroxysuccinimide) can be reacted directly with the amino group N 4 of cytosine residues. Depending on the number and location of cytosine residues in the IMP, a specific coupling can be achieved in one or more waste.

Alternatively, they can be incorporated modified oligonucleosides, as are known in the art, in each end, or in internal positions in the IMP. These can contain locked functional groups that, when unlocked, they are reactive with various functional groups that may be present, or attached, to the antigen of interest.

When the antigen is a peptide or a polypeptide, this portion of the conjugate can bind to the 3 'end of IMP through chemistry with solid supports. For example, the portion of IMP can be added to a portion of the polypeptide that is has pre-synthesized on a support. Haralambidiset al. (1990a) Nucleic Acids Res. 18: 493-499; and Haralambidiset al.(1990b) Nucleic Acids Res. 18: 501-505. Alternatively, the IMP can be synthesized so that it connects to a solid support through a cleavable binder that is extend from the 3 'end. Under the chemical cleavage of the IMP since the support, a thiol terminal group is left at the 3 'end of the oligonucleotide (Zuckermann et al. (1987) Nucleic Acids Beef. 15: 5305-5321; and Coreyet al. (1987) Science238: 1401-1403) or a amino terminal group is left at the 3 'end of the oligonucleotide (Nelson et al. (1989) Nucleic Acids Res. 17: 1781-1794). IMP conjugation amino modified to amino groups of the peptide can be performed as described in Benoit et al. (1987) Neuromethods6: 43-72. The conjugation of the modified IMP with thiol to carboxyl groups of the peptide can be performed as describe in Sinah et al. (1991) Oligonucleotide Analogues: A Practical Approach, IRL Press. The coupling of a oligonucleotide bearing a maleimide associated with the side chain thiol of a cysteine residue of a peptide has also been described Tunget al. (1991) Bioconjug Chem. 2:464-465.

The peptide or polypeptide portion of the conjugate can be attached to the 5 'end of the IMP through a group amine, thiol or carboxyl that has been incorporated into the oligonucleotide during its synthesis. Preferably, while the oligonucleotide is attached to the solid support, a linking group comprising a amine, thiol or carboxyl protected at one end, and a phosphoramidite in the other, covalently binds to the 5 'hydroxyl. Agrawal et al. (1986) Nucleic Acids Res. 14: 6227-6245; Connolly (1985)Nucleic Acids Res. 13: 4485-4502; Kremskyet to the. (1987) Nucleic Acids Res. 15: 2891-2909; Connolly (1987)Nucleic Acids Res. 15: 3131-3139; Bischoffet to the. (1987) Anal. Biochem. 164: 336-344; Blankset al. (1988) Nucleic Acids Res. 16: 10283-10299; and U.S. patents Nos. 4,849,513, 5,015,733, 5,118,800 and 5,118,802. After deprotection, the functionalities of amine, thiol and carboxyl can be used to covalently bind the oligonucleotide to a peptide. Benoitet al. (1987); and sinahet al. (1991).

An IMP-antigen conjugate It can also be formed through non-covalent interactions, such as ionic bonds, hydrophobic interactions, bridges of hydrogen and / or van der Waals bonds.

Non-covalently bound conjugates can include a non-covalent interaction such as a complex of biotin-streptavidin. A biotinyl group can join, for example, to a modified base of an IMP. Roget et to the. (1989) Nucleic Acids Res. 17: 7643-7651. The incorporation of a remainder of Streptavidin in the peptide portion allows the formation of a non-covalently bound complex of the conjugated peptide with Streptavidin and the biotinylated oligonucleotide.

There can also be non-covalent associations through ionic interactions involving an IMP and residues within the antigen, such as charged amino acids, or through the use of a binding portion comprising charged waste that they can interact with both the oligonucleotide and the antigen. For example, non-covalent conjugation can occur between an IMP generally negatively charged and amino acid residues positively charged with a peptide, for example, residues of polylysine, polyarginine and polyhistidine.

The non-covalent conjugation between IMP and antigens can be given through DNA binding motifs of molecules that interact with DNA as their natural ligands. For example, such DNA binding motifs can be found in transcription factors and antibodies anti-DNA

IMP binding to a lipid can form using standard methods. These methods include, but without restriction, conjugate synthesis oligonucleotide phospholipid (Yanagawa et al. (1988) Nucleic Acids Symp. Be. 19: 189-192), oligonucleotide-acid conjugates fatty (Grabarek et al. (1990) Anal. Biochem. 185: 131-135; and Staroset al. (1986) Anal. Biochem. 156: 220-222), and oligonucleotide-sterol conjugates. Boujradet to the. (1993) Proc. Natl Acad. Sci. USA90:5728-5731.

The oligonucleotide binding to an oligosaccharide It can be formed using known standard methods. These methods include, but not limited to, the synthesis of conjugates oligonucleotide-oligosaccharide, in which the oligosaccharide is a residue of an immunoglobulin. O'Shannessyet to the. (1985) J. Applied Biochem. 7:347-355.

The binding of a circular IMP to a peptide or Antigen can be formed in various ways. When the IMP circulates it is synthesized using recombinant or chemical methods, a nucleoside Modified is suitable. Ruth (1991) in Oligonucleotides and Analogues: A Practical Approach, IRL Press. The technology standard linker can then be used to connect the circular IMP to the antigen or another peptide. Goodchild (1990)Bioconjug Chem. 1: 165. When the circular IMP is isolated, or synthesized using recombinant or chemical methods, the binding can formed by chemically activating, or photoactivating, a reactive group (e.g., carbeno, radical) that has been incorporated into the antigen u other peptide

Other methods for peptide and other binding molecules to oligonucleotides can be found in the patent of USA . 5,391,723; Kessler (1992) "Nonradioactive labeling methods for nucleic acids "in Kricka (ed.)" Nonisotopic ADN Probe Techniques ", Academic Press; and Geoghegan et al. (1992) Bioconjug Chem. 3:138-146.

An IMP can be associated with proximity to an antigen (s) in different ways. In some embodiments, an IMP and the antigen are associated with proximity by encapsulation In other cases, an IMP and the antigen are associated with proximity by binding to a platform molecule. A "molecule platform "(also called" platform ") is a molecule that contains sites that allow the binding of IMP and the antigen (s). In other embodiments, an IMP and the antigen are associated with adsorption proximity on a surface, preferably a vehicle particle.

In some embodiments, the invention employs a encapsulating agent that can maintain the close association of IMP and the first antigen until the complex is available for the target (or compositions comprising such agents encapsulants). Preferably, the composition comprising IMP, antigen and encapsulating agent is in the form of emulsions of oil-in-water adjuvants, microparticles and / or liposomes. More preferably, emulsions of oil-in-water adjuvants, microparticles and / or liposomes that encapsulate a molecule IMP immunomodulators are in the form of particles of about 0.04 µm to about 100 µm in size, preferably any of the following intervals: from about 0.1 µm to about 20 µm; since about 0.15 µm to about 10 µm; since about 0.05 µm to about 1.00 µm; since about 0.05 µm to about 0.5 µm.

Colloidal dispersion systems, such as microspheres, beads, macromolecular complexes, nanocapsules and lipid systems, such as emulsions of oil-in-water, micelles, mixtures of micelles and liposomes can provide effective encapsulation of compositions containing IMP.

The encapsulation composition further comprises various components These include, but are not limited to, alum, lipids, phospholipids, lipid membrane structures (LMS), polyethylene glycol (PEG) and other polymers, such as polypeptides, glycopeptides and polysaccharides.

The polypeptides suitable for the components encapsulation include any known in the art and include, but are not limited to, fatty acid binding proteins. Modified polypeptides contain any of several modifications, including, but not limited to, glycosylation, phosphorylation, myristylation, sulphation and hydroxylation. Is according used herein, a suitable polypeptide is one that will protect a composition that contains IMP to preserve its activity immunomodulatory Examples of binding proteins include, although unrestricted, albumin such as bovine serum albumin (BSA) and pea albumin.

Other suitable polymers may be any known in the art of pharmaceutical agents and include, but are not limited to, natural polymers such as dextrans, hydroxyethyl starch and polysaccharides and polymers synthetic Examples of natural polymers include proteins, glycopeptides, polysaccharides, dextran and lipids. Other polymer It can be a synthetic polymer. Polymer Examples synthetics that are suitable for use in the present invention include, but are not limited to, polyalkyl glycols (PAG) such such as PEG, polyoxyethylated polyols (POP), such as glycerol polyoxyethylated (POG), polytrimethylene glycol (PTG) polypropylene glycol (PPG), polyhydroxyethyl methacrylate, poly (alcohol of vinyl) (PVA), poly (acrylic acid), polyethyloxazoline, polyacrylamide, polyvinylpyrrolidone (PVP), polyamino acids, polyurethane and polyphosphazene. Synthetic polymers too they can be linear or branched, substituted or unsubstituted, homopolymers, co-polymers, or block co-polymers of two or more monomers different synthetics

PEGs for use in compositions of encapsulation of the present invention or are purchased at chemical suppliers or are synthesized using techniques known to Those skilled in the art.

The term "LMS", as used in this document, means laminar lipid particles in which the polar head groups of a polar lipid are disposed toward a aqueous phase of an interface to form membrane structures. Examples of LMS include liposomes, micelles, cochleates (en ie, usually cylindrical liposomes), microemulsions, unilamellar vesicles, multilamellar vesicles and the like.

A preferred colloidal dispersion system of This invention is a liposome. In mice immunized with a antigen encapsulated in a liposome, the liposomes seemed enhance a Th1 type immune response against the antigen. Aramaki et al. (1995) Vaccine13: 1809-1814. As used in this document, a "liposome" or "lipid vesicle" is a small vesicle attached by at least one, and possibly more than one, membrane of lipid bilayer. Liposomes are artificially prepared at starting from phospholipids, glycolipids, lipids, steroids such such as cholesterol, related molecules, or their combinations by any technique known in the art, including, but not restriction, sonication, extrusion or removal of detergent lipid-detergent complexes. A liposome too may optionally comprise other components, such as a tissue recognition component. It is understood that a "lipid membrane" or "lipid bilayer" does not have to consist exclusively of lipids, but may also contain any other suitable components, including, but not restriction, cholesterol and other steroids, chemicals fat soluble, proteins of any length and other molecules amphipathic, provided that the overall membrane structure be a sheet of two hydrophilic surfaces that hug a core hydrophobe. For a general discussion of membrane structures, see "The Encyclopedia of Molecular Biology" by J. Kendrew (1994). For suitable lipids see e.g., Lasic (1993) "Liposomes: from Physics to Applications" Elsevier, Amsterdam

The processes to prepare liposomes that contain compositions containing IMP are known in the technique. Lipid vesicles can be prepared by any suitable technique known in the art. The methods include, although without restriction, microencapsulation, microfluidification, LLC method, ethanol injection, freon injection, the method of the "bubbles", dialysis with detergent, hydration, sonication and evaporation in reverse phase. Watwe Reviewet to the. (1995) Curr. Sci. 68: 715-724. The techniques can be combined to provide vesicles with the most desirable features.

The invention encompasses the use of LMS containing tissue or cell recognition components. Such recognition components are components of an LMS that enhance their accumulation in certain tissue or cell sites preferably compared to other tissue or cell sites when they are administered to an intact animal, organ or cell culture. A recognition component can usually be accessed from outside the liposome, and therefore preferably or joins the outer surface or is inserted into the lipid bilayer Exterior. A recognition component can beinter alia a peptide, a region of a major peptide, an antibody specific for a cell surface molecule or marker, or its antigen binding fragment, a nucleic acid, a carbohydrate, a region of a complex carbohydrate, a lipid special or a small molecule such as a drug, hormone or hapten, attached to any of the molecules above mentioned. Antibodies with specificity are known in the art towards specific cell surface markers of the type cell and are easily prepared by the methods known in the technique.

LMS can recognize any type of cell to which a therapeutic treatment has to go, for example, a type of cell that can modulate and / or participate in an immune response Such recognition cells and organs include, but are not limited to, APC, such as macrophages, dendritic cells and lymphocytes, lymphatic structures, such as lymph nodes and spleen, and non-lymphatic structures, particularly those in which the cells are found dendritic

The LMS compositions herein The invention may further comprise surfactants. Surfactants they can be cationic, anionic, amphiphilic or non-ionic. A Preferred class of surfactants are non-ionic surfactants; particularly preferred are those that are soluble in Water.

In the embodiments in which an IMP and the antigen are associated with proximity by binding to a molecule platform, the platform can be proteinaceous or non-proteinaceous (ie organic). Examples of proteinaceous platforms include, but are not limited to, albumin, gammaglobulin, immunoglobulin (IgG) and ovalbumin. Borealiset al. (1990) Immunol Methods126: 159-168; Dumaset al. (1995) Arch. Dematol. Beef. 287: 123-128; Borealiset al. (1995) Int. Arch. Allergy Immunol.107: 264-267; Borealiset al. (1996) Ann. NY Acad. Sci. 778: 80-87. A platform is multi-valent (that is, it contains more of a binding site, or binding) to accommodate the binding to both an IMP like the antigen. According to this, a platform can contain 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more binding or binding sites. Other examples Polymeric platforms are dextran, polyacrylamide, ficoll, carboxymethyl cellulose, polyvinyl alcohol, and poly (acid D-glutamic) / D-lysine.

The principles of the use of platform molecules They are well known in the art. Generally a platform contains, or is derivatized to contain appropriate binding sites for IMP and the antigen. In addition, or alternatively, the IMP and / or the antigen is derivatized to provide binding groups appropriate. For example, a simple platform is a linker bi-functional (that is, it has two binding sites), such as a peptide. Other examples are discussed below.

Platform molecules can stabilize biologically, that is, exhibit a half-life of excretion in alive of, often, hours to days to months to confer the therapeutic efficacy, and are preferably composed of a Simple synthetic chain of defined composition. Have generally a molecular weight in the range of approximately 200 to about 1,000,000, preferably any of the following intervals: from about 200 to about 500,000; from about 200 to about 200,000; since about 200 to about 50,000 (or less, such as 30,000). Examples of valencia platform molecules are polymers (or are comprised of polymers) such as polyethylene glycol (PEG; preferably having a molecular weight from about 200 to about 8000), poly-D-lysine, poly (alcohol vinyl), polyvinylpyrrolidone, D-glutamic acid and D-lysine (in a ratio of 3: 2). Other molecules that can be used are albumin and IgG.

Other platform molecules suitable for use Within the present invention are the platform molecules of chemically defined non-polymeric valence described in the U.S. Patent . 5,552,391. Other platform molecules of homogeneously defined chemically defined valence suitable for use within of the present invention are derived from 2,2'-ethylenedioxydiethylamine (EDDA) and of triethylene glycol (TEG).

Other suitable Valencia platform molecules include, but are not limited to, tetraaminobenzene, heptaaminobetacyclodextrin, tetraaminopentaerythritol, 1,4,8,11-tetraazacyclotetradecane (Cyclam) and 1,4,7,10-tetraazacyclododecane (Cyclen).

In general, these platforms are prepared by standard chemical synthesis techniques. The PEG must be derivatized and become multivalent, which is achieved using standard techniques. Some substances suitable for conjugate synthesis, such such as PEG, albumin and IgG are commercially available.

The conjugation of an IMP and the antigen to a Platform molecule can be performed in various ways, which normally involve one or more crosslinking agents and groups functional on the antigen and the IMP platform and the molecule platform. Platforms and IMP and antigen must have appropriate binding groups. The appropriate binding groups are they add to platforms using standard synthetic chemistry techniques. Binding groups can be added to polypeptide antigens and IMP using both standard solid phase synthetic techniques and recombinant techniques Recombinant approaches may require a post-translational modification to join a binder, and such methods are known in the art.

As an example, polypeptides contain amino acid side chain residues containing groups functional such as amino, carboxyl or sulfhydryl groups that they serve as sites for coupling the polypeptide to the platform. Waste having such functional groups can be added to the polypeptide if the polypeptide does not yet contain these groups Such residues can be incorporated by synthesis techniques in solid phase or recombinant techniques, both of which are very known in peptide synthesis techniques. When he polypeptide has a side chain (s) of carbohydrates (or if the antigen is a carbohydrate), they can incorporating functional amino groups, sulfhydryl and / or aldehyde in this by conventional chemistry. For example, they can incorporate primary amino groups by oxidized sugar reaction with ethylenediamine in the presence of sodium cyanoborohydride, they can sulfhydryls are introduced by dihydrochloride reaction of cysteamine followed by reduction with a reducing agent standard disulfide, while aldehyde groups can be generated after oxidation with periodate. In a similar way, the platform molecule can also be derivatized to contain functional groups if you do not already have functional groups appropriate.

Hydrophilic linkers of lengths variables are useful for connecting IMP and the antigen to molecules platform. Suitable binders include linear oligomers or ethylene glycol polymers. Such binders include binders with the formula R 1 S (CH 2 CH 2 O) n CH 2 CH 2 O (CH 2) m CO 2 R 2 in which n = 0-200, m = 1 or 2, R1 = H or a protective group such as trityl, R2 = H or alkyl or aryl, for example, 4-nitrophenyl ester. These binders are useful in connecting a molecule that contains a reactive thiol group such as haloaceyl, maleamide, etc., via a thioether in a second molecule that contains an amino group via a Amide bond These binders are flexible with respect to the order of union, that is, the thioether may be formed first or latest.

In the embodiments in which an IMP and the antigen are associated with adsorption proximity on a surface, the surface may be in the form of a particle vehicle (for example, a nanoparticle) made with a core inorganic or organic. Examples of such nanoparticles include, but are not limited to, nanocrystalline particles, nanoparticles made by the polymerization of alkylcyanoacrylates and nanoparticles made by the polymerization of malonate from methylidene Other surfaces to which an IMP can be adsorbed and the antigen include, but not limited to, carbon particles active and protein-ceramic nanoplates. Others Examples of vehicle particles are provided in this document.

Adsorption of polynucleotides and polypeptides to a surface in order to release the adsorbed molecules in Cells is well known in the art. See, for example, Douglas et al. (1987) Crit. Rev. Ther. Drug Carrier Syst. 3: 233-261; Hagiwaraet al. (1987) Live1: 241-252; Bousquetet al. (1999) Pharm Beef. 16: 141-147; and Kossovskyet al., the U.S. Patent 5,460,831. Preferably, the material that The adsorbent surface comprises is biodegradable. Adsorption of an IMP and / or the antigen to a surface can be given through non-covalent interactions, ionic interactions and / or interactions hydrophobic

In general, the characteristics of vehicles such as nanoparticles, such as surface charge, the particle size and molecular weight, depends on the polymerization conditions, monomer concentration and presence of stabilizers during the polymerization process (Douglas et al., 1987). The surface of the particles vehicle can be modified, for example, with a coating of surface, to allow or enhance the adsorption of the IMP and / or antigen. Vehicle particles with IMP and / or adsorbed antigen They can also be coated with other substances. The addition of said other substances may, for example, prolong the half-life of particles once the subject is administered and / or can recognize particles in a specific cell type or tissue, as described in this document.

Nanocrystalline surfaces have been described a which can be adsorbed an IMP and the antigen (see, for example, U.S. Patent 5,460,831). Core particles nanocrystalline (with diameters of 1 µm or less) are coated with a modifying layer of surface energy that promotes adsorption of polypeptides, polynucleotides and / or other agents Pharmacists As described in US Pat. 5,460,831, for example, a particle with a core is coated with a surface that promotes the adsorption of an oligonucleotide and is coated subsequently with a preparation of the antigen, for example, in the form of a lipid-antigen mixture. Such nanoparticles are self-assembling complexes of particles of nanometric size, usually of the order of 0.1 \ mum, which carry an internal layer of IMP and an external layer of antigen.

Another adsorbent surface are nanoparticles made by the polymerization of alkylcyanoacrylates. The alkylcyanoacrylates can be polymerized in aqueous media acidified by an anionic polymerization process. Depending of polymerization conditions, small particles they tend to have sizes in the range of 20 to 3000 nm, and it is possible to prepare specific surface characteristics of nanoparticles and with specific surface charges (Douglaset al., 1987). For example, they can be adsorbed oligonucleotides in nanoparticles of poly-isobutyl and poly-isohexylcyanoacrylate in the presence of cations hydrophobes such as tetraphenylphosphonium chloride or salts of quaternary ammonium, such as bromide cetyltrimethyl ammonium. Adsorption of oligonucleotides on these nanoparticles seems to be mediated by the formation of ionic pairs between phosphate groups negatively loaded with the nucleic acid chain and cations hydrophobic See, for example, Lambert et al. (1998) Biochimie80: 969-976, Chavany et to the. (1994) Pharm Beef. 11: 1370-1378; Chavanyet al. (1992) Pharm Beef. 9: 441-449. They can also adsorb polypeptides into nanoparticles of polyalkylcyanoacrylate. See, for example, Douglaset al., 1987; Schroederet al. (1998) Peptides19:777-780.

Another adsorbent surface are nanoparticles made by the polymerization of methylidene malonate. By example, as described in Bousquet et al., 1999, the polypeptides adsorbed to polyparticles nanoparticles methylidene 2.1.2) seem to do so initially through electrostatic forces followed by stabilization through hydrophobic forces

IMP / MC complexes

IMPs can be administered in the form of immunomodulator / microcarrier polynucleotide complexes (IMP / MC). Accordingly, the invention provides compositions. which comprise IMP / MC complexes.

The microcarriers useful in the invention are smaller in size of approximately 150, 120 or 100 µm, more commonly smaller in size of approximately 50-60 µm, preferably smaller in size than about 10 µm, and are insoluble in pure water. The microcarriers used in the invention are preferably biodegradable, although microcarriers are not acceptable biodegradable Microcarriers are commonly in solid phase, such as "pearls" or other particles, but also contemplate liquid phase microcarriers such as emulsions of oil-in-water comprising biodegradable polymers or oils. A wide variety of materials biodegradable and non-biodegradable acceptable for use as Microcarriers are known in the art.

The microcarriers for use in the compositions or methods of the invention have a size of generally less than approximately 10 µm (for example, they have an average diameter of less than about 10 µm, or at least about 97% of the particles pass through a selection filter of 10 µm), and include nano vehicles (i.e. vehicles of less about 1 µm in size). Preferably, the microcarriers are selected with dent ro sizes of a limit greater than about 9, 7, 5, 2 or 1 or 900, 800, 700, 600, 500, 400, 300, 250, 200 or 100 nm and a lower limit independently selected from about 4, 2 or 1 um or about 800, 600, 500, 400, 300, 250, 200, 150, 100, 50, 25 or 10 nm, where the lower limit is less than the upper limit. In some embodiments, the microcarriers have a size of about 1.0-1.5 µm, about 1.0-2.0 µm or about 0.9-1.6 µm. In certain embodiments preferred, the microcarriers have a size of approximately 10 nm at about 5 µm or about 25 nm at about 4.5 µm, about 1 µm, about 1.2 µm, about 1.4 µm, about 1.5 µm, about 1.6 µm, about 1.8 µm, about 2.0 µm, about 2.5 µm or about 4.5 µm. When the microcarriers are nanocarriers, the preferred embodiments include nano vehicles from about 25 to about 300 nm, from 50 to about 200 nm, about 50 nm or approximately 200 nm.

Biodegradable solid phase microcarriers they can be manufactured from biodegradable polymers including, although without restriction: biodegradable polyesters, such as poly (lactic acid), poly (glycolic acid) and their copolymers (including block copolymers), as well as block copolymers of poly (lactic acid) and poly (ethylene glycol); polyorthoesters such as polymers based on 3,9-diethyliden-2,4,8,10-tetraoxaspiro [5.5] undecano (DETOSU); polyanhydrides such as polymers of poly (anhydride) based on relatively hydrophilic monomers such as sebacic acid; polyanhydride imides, such as polyanhydride polymers based on acid-derived monomers sebaceous incorporating amino acids (i.e. acid bound sebaceous by imide bonds through the end nitrogen amino terminal) such as glycine or alanine; esters of polyanhydride; polyphosphazenes, especially poly (phosphazenes) containing ester groups sensitive to hydrolysis that can catalyze structure degradation polymeric through the generation of carboxylic acid groups (Schacht et al., (1996) Biotechnol Bioeng. 1996:102); and polyamides such as poly (acid lactic-co-lysine).

A wide variety of materials not Biodegradable suitable for manufacturing microcarriers are also known, including, but not limited to polystyrene, polypropylene, polyethylene, silica, ceramic materials, polyacrylamide, dextran, hydroxyapatite, latex, gold and materials ferromagnetic or paramagnetic. Certain embodiments exclude Gold, latex and / or magnetic pearls. In certain embodiments, microcarriers can be made of a first material (by example, a magnetic material) encapsulated with a second material (for example, polystyrene).

The solid phase microspheres are prepared using techniques known in the art. For example, they can prepare by emulsion-extraction techniques with solvent / evaporation. Generally, in this technique, polymers biodegradable such as polyanhydrates, poly (alkyl-α-cyanoacrylates) and poly (α-hydroxy esters), by example, poly (lactic acid), poly (glycolic acid), poly (co-acid D, L-lactic-glycolic) and poly (caprolactone), dissolve in an organic solvent suitable, such as methylene chloride, to constitute the phase dispersed (DP) of the emulsion. DP is emulsified by high speed homogenization in excess phase volume aqueous continuous (CP) containing a dissolved surfactant, by example, polyvinyl alcohol (PVA) or polyvinylpyrrolidone (PVP). The surfactant in CP is to ensure the formation of drops discrete emulsion and the right size. Organic solvent then it is extracted in the CP and subsequently evaporated increasing the system temperature The solid microparticles are then separated by centrifugation or filtration, and dried, for example, by lyophilization or vacuum application, before storing 4 ° C.

Characteristics can be determined physicochemical such as average size, size distribution and surface load of dry microspheres The size characteristics are determined, by example, by the dynamic light scattering technique and the loading of The surface is determined by measuring the zeta potential.

Liquid phase microcarriers include liposomes, micelles, drops of oil and other lipid particles or Oils that incorporate biodegradable polymers or oils. In certain embodiments, the biodegradable polymer is a surfactant In other embodiments, the microcarriers in phase Liquid are biodegradable due to the inclusion of an oil biodegradable such as squalene or a vegetable oil. A Preferred liquid phase microcarrier oil drops inside an emulsion of oil-in-water. Preferably, the used oil-in-water emulsions as microcarriers comprise biodegradable substituents such Like squalene.

The IMP / MC complexes comprise an IMP linked to the surface of a microcarrier (that is, the IMP is not encapsulated in the MC), and preferably comprises molecules multiple IMP attached to each microcarrier. In certain embodiments, a mixture of different IMPs can be complexed with a microcarrier, such that the microcarrier binds to more than one species of IMP. The link between the IMP and MC may be covalent or not. covalent As understood by any expert in the technique, the IMP can be modified or derivatized and the Microcarrier composition can be selected and / or modified to accommodate the type of joint desired for the formation of the IMP / MC complex.

IMP / MC covalently bound complexes can be joined using any covalent crosslinking technology known in the art. Normally, the IMP portion will be modified, both to incorporate another remainder (for example, a group amine, carboxyl or free sulfhydryl) to incorporate bases of modified nucleotides (eg phosphorothioate) to provide a site where the IMP portion can join the microcarrier The union between the IMP and MC portions of the complex can be done at the 3 'or 5' end of the IMP, or on a base properly modified in an internal position in the IMP. He microcarrier is also generally modified to incorporate remains through which a covalent bond can be formed, although functional groups can also be used normally present on the microcarrier. The IMP / MC is formed by incubating the IMP with a microcarrier under conditions that allow formation of a covalent complex (for example, in the presence of an agent of crosslinking or by the use of an activated microcarrier comprising an activated moiety that will form a covalent bond with the IMP).

A wide variety of technologies are known crosslinking in the art, and include crosslinking agents reagents with amino, carboxyl and sulfhydryl groups. As will be evident to any expert in the art, the selection of a crosslinking agent and a crosslinking protocol will depend of the configuration of the IMP and the microcarrier as well as the desired final configuration of the IMP / MC complex. The agent Crosslinker can be both homobifunctional and heterobifunctional. When a homobifunctional crosslinking agent is used, the agent crosslinker exploits the same remainder on the IMP and MC (for example, an aldehyde crosslinking agent can be used to bind covalently an IMP and MC where both the IMP and the MC comprise one or more free amines). Crosslinking agents heterobifunctional use different residues on the IMP and the MC, (for example, an ester of maleimido-N-hydroxysuccinimide can used to covalently bond a free sulfhydryl on the IMP and a free amine on the MC), and are preferred to minimize the formation of inter-microcarrier links. In the In most cases, it is preferable to cross-link through a first rest of crosslinking on the microcarrier and a second remainder of cross-linking over the IMP, where the second remaining cross-linking does not It is present on the microcarrier. A preferred method for producing the IMP / MC complex is "activating" the microcarrier by incubation with a crosslinking agent heterobifunctional, then forming the IMP / MC complex by the incubation of the IMP and activated MC under appropriate conditions for the reaction The crosslinking agent can incorporate an arm "spacer" between the reactive moieties, or the two moieties reagents in the crosslinking agent can be attached directly.

In a preferred embodiment, the IMP portion comprises at least one free sulfhydryl (for example, provided by a base modified with 5'-thiol or linker) for crosslinking to the microcarrier, while the microcarrier It comprises free amino groups. A crosslinking reagent heterobifunctional with these two groups (for example, an agent crosslinker comprising a maleimide group and an NHS-ester), such as 4- (N-maleimidomethyl) cyclohexane-1-carboxylate of succinimidyl is used to activate the MC, then cross-link Covalently the IMP to form the IMP / MC complex.

Non-covalent IMP / MC complexes can bind for any link or non-covalent interaction, including links ionic (electrostatic), hydrophobic interactions, bridges hydrogen, van der Waals bonds, or a combination of two or more different interactions, as is usually the case when a couple Binding joins IMP and MC.

Preferred non-covalent IMP / MC complexes are normally complex by hydrophobic interactions or electrostatic (ionic), or combinations thereof, (for example, to through base couplet between an IMP and a bound polynucleotide to a MC a union pair is used). Due to the hydrophilic nature of the structure of the polynucleotides, the IMP / MC complexes, which based on hydrophobic interactions to form the complex, they generally require modification of the IMP portion of the complex to incorporate a highly hydrophobic residue. Preferably, the hydrophobic moiety is biocompatible, not immunogenic and is natural in the individual for whom the Composition is intended (for example, found in mammals, particularly human beings). Examples of hydrophobic moieties Preferred include lipids, steroids, sterols such as cholesterol and terpenes. The method to join the hydrophobic moiety to IMP will, of course, depend on the IMP configuration and the hydrophobic rest identity. The hydrophobic moiety can be added in any convenient site in the IMP, preferably in the 5 'or 3' end; in the case of the addition of a cholesterol residue at an IMP, the rest of the cholesterol is preferably added to the 5 'end of the IMP, using conventional chemical reactions (see, for example, Godard et al. (1995) Eur. J. Biochem. 232: 404-410). Preferably, microcarriers for use in IMP / MC complexes linked by links hydrophobes are made from hydrophobic materials, such as drops of oil or hydrophobic polymers, although they can be used also modified hydrophilic materials to incorporate residues hydrophobic When the microcarrier is a liposome or another liquid phase microcarrier comprising a cavity, the IMP / MC complex is formed by mixing the IMP and the MC after the preparation of the CM, to avoid encapsulation of the IMP during MC preparation process.

Non-covalent IMP / MC complexes linked by electrostatic junction normally exploit the high negative charge of The structure of the polynucleotide. According to this, the microcarriers for use in IMP / MC complexes not covalently bound together are generally positively charged (cationic) at pH physiological (for example, approximately pH 6.8-7.4). The microcarrier can own intrinsically a positive charge, but the microcarriers made of compounds that do not normally have a positive charge can be derivatized or otherwise modified to become charged positively (cationic). For example, the polymer used to Prepare the microcarrier can be derivatized to add groups positively charged, such as primary amines. So alternatively, positively charged compounds can incorporated into the microcarrier formulation during manufacturing (for example, positive surfactants can be used charged during the manufacture of poly (acid copolymers) lactic acid) / poly (glycolic acid) to confer a positive charge on the resulting particles of the microcarrier).

As described in this document, for prepare cationic microspheres, cationic lipids are added or polymers, for example, 1,2-dioleoyl-1,2,3-trimethylammoniumpropane (DOTAP), cetyltrimethylammonium bromide (CTAB) or polylysine, both to DP as to CP, as per its solubility in these phases.

As described in this document, the IMP / MC complexes can be performed by adsorption on microspheres cationic by incubation of the polynucleotide and particles, preferably in an aqueous mixture. Such incubation can take carried out under any desired conditions, including room temperature (for example, approximately 20 ° C) or low refrigeration (for example, 4 ° C). Because the microspheres cationic and polynucleotides associate relatively quickly, incubation can be done for any period of time convenient, such as 5, 10, 15 minutes or more, including overnight incubations and longer. For example, the IMP they can be adsorbed on cationic microspheres by overnight incubation of the polynucleotide and particles at 4 ° C. However, since cationic microspheres and polynucleotides spontaneously associate, the IMP / MC complex can be formed by simple co-administration of polynucleotide and MC. The microspheres can be characterized by surface sizes and load before and after association of polynucleotide. The selected batches can then be evaluated according to its activity against appropriate controls, for example, in human peripheral blood mononuclear cells (PBMC) established, as described in this document, and trials of mouse splenocytes. The formulations can also be evaluated in suitable animal models.

The non-covalent IMP / MC complexes bound by the pairing nucleotide bases can be produced using conventional methodologies Generally, complexes occur Paired IMP / MC with bases using a microcarrier comprising a bond, preferably a covalent bond bound polynucleotide (the "capture polynucleotide") which is at least partially complementary to the IMP. The complementarity segment between the IMP and the capture nucleotide preferably has at least 6, 8, 10 or 15 adjacent base pairs, more preferably at least 20 adjacent base pairs. The capture nucleotide can bind to MC by any method known in the art, and binds preferably covalently to the IMP at the 5 'or 3' end.

In other embodiments, a pair of union to join the IMP and the MC in an IMP / MC complex. The pair of binding can be a receptor and a ligand, an antibody and a antigen (or epitope), or any other binding pair that binds with high affinity (for example, Kd less than about 10-8). A preferred type of binding pair is biotin and streptavidin or biotin and avidin, which form very strong complexes. When is it used a binding pair to mediate the binding of the IMP / MC complex, the IMP is derivatize, usually by a covalent bond, with an element of the union pair, and the MC is derivatized with the other element of the pair of Union. The mixture of the two derivatized compounds gives as IMP / MC complex formation resulted.

Many embodiments of the IMP / MC complex do not include an antigen, and certain embodiments exclude (a the) antigen (s) associated with the disease or the disorder that is the subject of the IMP / MC complex therapy. In other embodiments, the IMP also binds to one or more molecules of antigen. The antigen can be coupled with the IMP portion of a IMP / MC complex in various ways, including interactions covalent and / or non-covalent, as described, for example, in the WO 98/16247. Alternatively, the antigen can join the microcarrier The union between the antigen and the IMP in IMP / MC complexes comprising an antigen bound to IMP can be done by the techniques described in this document and which are known in the art, including, but not limited to, the direct covalent union, covalent conjugation via a residue crosslinker (which may include a spacer arm), conjugation non-covalent via a specific binding pair (for example, biotin and avidin), and non-covalent conjugation via an electrostatic bond or hydrophobic

IMP complexes with cationic condensing agent and agent stabilizer

IMPs can be administered as a composition comprising a cationic condensing agent, a IMP, and a stabilizing agent (i.e., the CIS composition) for Modulate an immune response in the receptor. See, the request for U.S. Patent . 60 / 402,968. In some embodiments, the CIS composition may also comprise an antigen and / or an acid fatty.

The CIS compositions of the invention are normally in the form of particles. As will be evident to skilled in the art, the CIS particle compositions of the invention will consist of a population of particles of different sizes. Because of this naturally occurring variability, the "size" of the particles in the compositions of the invention can be described in intervals or as a maximum diameter or minimum The particles are considered to have a size particularly if at least 95% of the particles (by mass) satisfy the specified dimension (for example, if at least 97% of the particles are less than 20 µm in diameter, then the composition is considered to consist of particles of less than 20 um diameter). The particle size can be measured by any convenient method known in the art, including filtration (for example, the use of a "depth" filter to capture particles larger than a cut size), dispersion dynamic light, electron microscopy, including TEM (particularly in combination with processes of frozen-fracture) and SEM, and the like.

Preferably, the CIS compositions of the invention comprise particles that are less than about 50 µm in diameter, more preferably less than about 20 µm in diameter, although in some embodiments the particles will have less than about 3, 2 or 1 µm of diameter. Preferred particle size ranges include from about 0.01 µm to 50 µm, from 0.02 to 20 um, from 0.05 to 5 µm and from 0.05 to 3 µm in diameter.

The components of the CIS compositions can be present in various relationships / quantities in compositions, although it is contemplated that the amounts of (of the stabilizing agent (s) and components optional such as fatty acids and the antigen will remain relatively invariant, the stabilizing agents being generally in the range of about 0.1% to 0.5% (v / v), fatty acids in the range of about 0 to 0.5%, and the antigen concentrations in the range of about 0.1 to about 100 µg / mL, preferably about 1 at about 100 µg / mL, more preferably of approximately 10 to 50 µg / mL. The quantities and relationships of IMP and the cationic condensing agent are subjected to an interval greater variation in the compositions of the invention. The amount of IMP will vary to some extent as a function of molecular weight of the IMP, and is generally in the range of approximately 50 ? / mL at about 2 mg / mL, preferably of approximately 100 µg / mL at 1 mg / mL. Condensing agent cationic is generally present in excess (in terms of mass) with respect to IMP, generally in ratios of approximately 1: 2 (IMP: cationic condensing agent) at about 1: 6, plus preferably from about 2: 5 to 1: 5.

The particle size in CIS compositions It is a function of various variables. The size distribution of particles in the compositions can be modulated by altering the ratio of cationic condensation agent and IMP. For example, altering the ratio of cationic condensing agent and IMP in the compositions of + ISS / 0.4% Tween 85 / oleate / polymyxin B al Illustrative 0.4% can alter the average particle size about 1.5 µm in condensing agent cationic: BMI = 1 of approximately 45 µm in agent cationic condensation: IMP = 10.

In certain embodiments, the CIS compositions they comprise a cationic condensing agent, an IMP and an agent stabilizer that is a non-ionic detergent. In others embodiments, the compositions comprise a lipopeptide cationic membrane rupture (preferably a polymyxin, more preferably polymyxin B), an IMP and an agent stabilizer In some embodiments the stabilizing agent does not it is a whey protein (particularly it is not a protein of bovine serum). An illustrative composition of this kind of embodiments use such a polyoxyethylene ether detergent as Tween 80 or Tween 85 as the stabilizing agent, with oleate as another optional stabilizing agent.

In some embodiments, the CIS compositions they comprise immunomodulatory particles, in which the particles they are made by the procedure of combining a condensing agent cationic, an IMP and a stabilizing agent that is not a detergent ionic. In other embodiments, the compositions of the invention they comprise immunomodulatory particles, in which the particles they are made by the procedure of combining a cationic lipopeptide of membrane rupture (preferably a polymyxin, more preferably polymyxin B), an IMP and a stabilizing agent. In some embodiments the stabilizing agent is not a protein of whey (particularly not a bovine whey protein).

In some embodiments, the CIS compositions they comprise immunomodulatory particles, in which the particles they are formed by the procedure of combining an IMP and an agent stabilizer that is not an ionic detergent, thus forming a IMP / stabilizing agent mixture, and combining an agent cationic condensation with the IMP / stabilizing agent mixture. In other embodiments, the compositions of the invention comprise immunomodulatory particles, in which particles are formed by the procedure of combining an IMP and a stabilizing agent, thus forming an IMP / stabilizing agent mixture, and combining a cationic membrane rupture lipopeptide (preferably a polymyxin, more preferably polymyxin B) with the mixture of IMP / stabilizing agent. In some embodiments the agent stabilizer is not a whey protein (particularly it is not a bovine serum protein).

In some embodiments, the CIS compositions they comprise immunomodulatory particles, in which the particles they comprise a cationic condensing agent, an IMP and an agent stabilizer that is not an ionic detergent. In others embodiments, the compositions of the invention comprise immunomodulatory particles, in which the particles comprise a cationic membrane rupture lipopeptide (preferably a polymyxin, more preferably polymyxin B), an IMP and an agent stabilizer In some embodiments the stabilizing agent does not it is a whey protein (particularly it is not a protein of bovine serum).

The cationic condensing agents useful in CIS compositions and methods for using CIS compositions they are molecules that are positively charged at physiological pH (it is ie, pH from about 7.0 to about 7.5). Preferably, the cationic condensing agents used in the The present invention are not zwitterionic and are polycationic, it is that is, they have more than one positive charge per molecule. The cationic condensing agents useful in the present invention include hydrophilic or amphipathic polycations.

Cationic condensing agents Preferred include: (a) cationic lipopeptide rupture of membrane including, but not limited to polymyxins including polymyxin A, polymyxin B (including polymyxin B1 and polymyxin B2), polymyxin C, polymyxin D, polymyxin E (also known as colistin), polymyxin K, polymyxin M, polymyxin P, polymyxin S and polymyxin T, circulins including circulin A, circulin B, Circulin C, Circulin D, Circulin E and Circulin F, Octapeptin, amphotericins including amphotericin B, and acylated peptides including octanoil-KFFKFFKFF and acil KALA (octanoil-WEAKLAKALAKALAKHLAKALAKALEACEA (SEQ ID NO: 183); (b) cationic membrane rupture peptides including, although unrestricted polymyxin B nonapeptide, cecropins including cecropin A, cecropin B and cecropin P1, KFFKFFKFF (SEQ ID NO: 182) and KALA (WEAKLAKALAKALAKHLAKALAKALKACEA (SEQ ID NO: 184)); (c) single chain cationic surfactants including, although unrestricted cetyltrimethylammonium bromide (CTAB), benzyl dimethyl ammonium bromide (BDAB), CpyrB (cetyl pyridinium bromide), CimB (cetyl imidazolium bromide) and polymers polycationic, including, but not limited to, poly-L-lysine (PLL) and polyethyleneimine (PEI). In certain embodiments, the agent of cationic condensation is a cationic lipopeptide rupture of membrane, preferably a polymyxin, more preferably polymyxin B. In some embodiments, the condensing agent cationic can exclude fatty acid esters (i.e. lipids) and cationic double chain surfactants.

Stabilizing agents useful in CIS compositions and methods of using CIS compositions include those that can be suspended in water and reduce tension superficial in water, although agents are preferred stabilizers that are water soluble and / or completely miscible in water Several classes of stabilizing agents are useful in compositions and methods of the invention, including proteins (preferably hydrophilic proteins), non-ionic detergents, polymeric surfactants (eg, poly (alcohol of vinyl) and poly (vinyl pyrrolidone)), cationic detergents, anionic detergents and fatty acids, although in certain embodiments, can be excluded from the definition of agents whey protein stabilizers (particularly proteins from bovine serum), fatty acids and / or ionic detergents.

Any protein can be used as an agent. stabilizer according to the invention. In some embodiments, the stabilizing agent is a protein that is not intended as antigen (see previous discussion); in these embodiments, it prefers that the protein is derived from the same species as the intended recipient of the composition (for example, if the composition is intended for use in humans, then it prefers that the protein used as a stabilizing agent be a human protein). Whey albumin is an illustrative protein useful as a stabilizing agent in such embodiments. In others embodiments, an antigen is used as a stabilizing agent, in in which case the antigen is not required to be, and in general preferably it is not, coupled to the species with the receptor alleged. The antigens useful in the compositions and methods of The invention is described above.

Non-ionic detergents useful in CIS compositions and methods of using CIS compositions include glucamides such as decyl dimethylphosphine oxide (APO-10) and dimethyldodecylphosphine oxide (APO-12), octanoyl-N-methylglucamide (MEGA-8), nonanoyl-N-methylglucamide (MEGA-9) and decanoyl-N-methyl glucamide (MEGA-10), polyoxyethylene ether detergents including poly (oxyethylene dodecyl ester) (10) (Genapol C100), poly (oxyethylene lauryl ether) (4) (BRIJ® 30), poly (ether of oxyethylene lauryl) (9) (LUBROL® PX) poly (lauryl ether of oxyethylene) (23) (BRIJ® 35), poly (oxyethylene cetyl ether) (2) (BRIJ® 52), poly (oxyethylene cetyl ether) (10) (BRIJ® 56), poly (oxyethylene cetyl ether) (20) (BRIJ® 58), poly (ether of oxyethylene stearyl) (2) (BRIJ® 72), poly (stearyl ether of oxyethylene) (10) (BRIJ® 76), poly (stearyl ether of oxyethylene) (20) (BRIJ® 78), poly (stearyl ether of oxyethylene) (100) (BRIJ® 700), poly (oxyethylene oleyl ether) (2) (BRIJ® 92), poly (oxyethylene oleyl ether) (10) (BRIJ®97), polyethylene oxyethylene ether (20) (BRIJ® 98), isotridecilpoli (ethylene glycol) 8 (Genapol 80), PLURONIC® F-68, PLURONIC® F-127, dodecilpoli (ethylene glycol) 9 (Thesit) ether of polyoxyethylene isooctylphenyl (10) (TRITON® X-100), poly (isooctylphenyl ether of oxyethylene) (8) (TRITON® X-114), poly (ethylene glycol sorbitan monolaurate) (TWEEN® 20), poly (oxyethylene sorbitan monopalmitate) (TWEEN® 40), poly (ethylene glycol sorbitan monostearate) (TWEEN® 60), poly (oxyethylenesorbitan triestearate) (TWEEN® 65), poly (ethylene glycol sorbitan monooleate) (TWEEN® 80), poly (oxyethylene sorbitan trioleate) (20) (TWEEN® 85), poloxamer 188, and ether of polyethylene glycol-p-isooctylphenyl (Nonidet NP40), alkyl maltóside detergents including cyclohexyl-n-ethyl-? -D-maltósido, cyclohexyl-n-hexyl-? -D-maltósido, and cyclohexyl-n-methyl-? -D-maltósido, n-decanoylsacarose, glucopyranosides including 6-O- (N-heptylcarbamoyl) -aD-glucopyranoside methyl (HECAMEG) and alkyl glucopyranosides such asn-decyl-? -D-glucopyranoside,n-heptyl-? -D-glucopyranoside,n-dodecyl-? -D-glucopyranoside,n-nonyl-? -D-glucopyranoside,n-octyl-? -D-glucopyranoside andn-octyl-? -D-glucopyranoside, alkyl thioglucopyranosides includingn-heptyl-? -D-thioglucopyranoside, alkyl maltopyranosides includingn-decyl-? -D-maltopyranoside andn-octyl-? -D-maltopyranoside,n-decyl-? -D-thiomaltoside, digitonin, n-dodecanoyl sucrose,n-dodecyl-? -D-maltósido, 1,2,3-triol heptane,n-octanoyl-? -D-glucosylamine (NOGA), n-octanoyl sucrose, poloxamers (copolymers of polyoxyethylene / polyoxypropylene block) such as poloxamer 188 and poloxamer 407, and sulfobetains including SB-10, SB-12, and SB-14 andn-undecyl-? -D-maltósido. Preferred stabilizing agents include detergents of poly (oxyethylene ether), particularly poly (monooleate ethylene glycol sorbitan) and poly (sorbitan trioleate from oxyethylene) (20).

Anionic detergents useful in CIS compositions and methods of using CIS compositions include caprylic acid and its salts, chenodeoxycholic acid and its salts, colic acid and its salts, decanosulfonic acid and its salts, deoxycholic acid and its salts, glycodeoxycholic acid and its salts, lauroylsarcosine and its salts, sulfate n-dodecilo and his salts (including sodium and lithium salts), acid tauroquenodeoxycholic and its salts, taurocolic acid and its salts, taurodehydrocolic acid and its salts, taurodeoxycholic acid and its salts, taurolitocolic acid and its salts, and acid Tauroursodeoxycholic and its salts.

Cationic detergents include cetylpyridinium and its salts, cetyltrimethylammonium and its salts including cetyltrimethylammonium bromide (CTAB), dodecyltrimethylammonium and its salts including bromide of dedecyltrimethylammonium, alkylammonium imidazolines, imidazolines quaternaries, and tetradecyltrimethylammonium and its salts including tetradecyltrimethylammonium bromide.

Detergents selected for use as stabilizing agents are preferably those that consider oil / water emulsifying detergents. The oil / water emulsifying detergents are known in the art, and are generally characterized by an equilibrium value hydrophobic / lipophilic (HLB) from about 8 to about 18. Preferably, the detergents incorporated in the compositions in particles have HLB values of approximately 10 to about 16, more preferably about 11 to about 15 (for example, poly (monooleate of ethylene glycol sorbitan), HLB = 15.4; poly (isooctylphenyl ether of oxyethylene) (10), HLB = 13.5; poly (sorbitan trioleate oxyethylene) (20) HLB = 11).

In certain embodiments, the CIS compositions they can also include one or more fatty acids, or one of their salts, As an additional component. In those embodiments that employ a fatty acid as a component of stabilizing agent and an acid fatty as an additional component of the composition, fatty acid used as a stabilizing agent will be different than the acid fatty used as an 'additional' component. Useful fatty acids in the CIS compositions of the invention they can have a size in the range of four to 30 carbon atoms, and can be unsaturated (for example, stearic acid), monounsaturated (for example, oleic acid) or polyunsaturated (for example, linoleic acid), although monounsaturated fatty acids and polyunsaturated are generally the preferred.

In some embodiments, the CIS compositions incorporate a fatty acid with a carbon chain length of at least about 4, 5, 6, 8, 10, 15, 18 or 20 atoms of carbon and less than about 30, 25, 20, 19, 15 or 10 atoms carbon According to this, in some embodiments the acids fatty acids used in the invention may have carbon chains with a length in the range of approximately 4 to 30, from 5 to 25, from 10 to 20, or from 15 to 20 carbon atoms.

Fatty acids useful in CIS compositions include, but are not limited to, arachidonic acid, acid decanoic acid, docosanoic acid, docosahexanoic acid, acid eicosanoic acid, heneicosanoic acid, heptadecanoic acid, acid heptanoic acid, hexanoic acid, lauric acid, linoleic acid, acid linolenic, myristic acid, nonadecanoic acid, nonanoic acid, octanoic acid, oleic acid, palmitic acid, acid pentadecanoic acid, stearic acid, tetracosanoic acid, acid tricosanoic acid, tridecanoic acid and undecanoic acid. Acids Preferred fatty acids for use in CIS compositions include acid oleic, palmitoleic acid and linoleic acid.

In certain embodiments of the invention, incorporates an antigen in the CIS composition or is administered in combination with a CIS composition. Those CIS compositions that incorporate an antigen can incorporate the antigen into the own particle composition, or they can be dissolved or suspended in the solution in which the particulate composition is suspended. May any antigen incorporated or co-administered with a CIS composition of the invention.

Methods of the invention

As described in this document, the IMPs of the invention can particularly stimulate the production of IL-6, TNF-?, IFN-? And interferons of type I, including IFN-? And IFN-?, stimulate B cell proliferation and / or activate that cells Plasmocytoid dendrites differ. The IMP of the invention they can also stimulate the production of other cytokines, chemokines and proteins associated with activation including, although unrestricted, IP-10 (protein induced by 10kDa interferon), MCP-1 (protein 1 monocyte chemoattractant), MCP-2, MCP-3, MIG, MIP-3b, CD80, CD86, CD40, CD54 and MHC class II. The IMPs of the invention can also stimulate the expression of inducible genes of IFN-? Including, but not restricted 2,5-oligoadenylate synthase (2,5-OAS), gene stimulant of interferon-54K (ISG-54K) and protein of guanilato union 1 (GBP-1). The immunomodulatory polynucleotides of the invention can also provide a signal that retards cell apoptosis Plasmocytoid dendritic. Immunomodulatory polynucleotides of the invention can also stimulate the lytic activity of natural cytotoxic lymphocytes (NK). According to this, the IMP of the invention are particularly effective in modulating a immune response in an individual.

The invention relates to the modulation of a immune response in an individual, preferably a mammal, more preferably a human being, administering to the individual an IMP of the invention. Immunomodulation may include stimulating a immune response of type Th1 and / or inhibit or reduce a response Immune type Th2. The IMP is administered in an amount Enough to modulate an immune response. As described in this document, the modulation of an immune response can be humoral and / or cellular, and measured using standard techniques in the technique and as described in this document.

For example, modulating a response immune of an animal or population of cells, for example, mammals, optionally humans, blood cells (for example, PBMC, lymphocytes, dendritic cells), alveolar lavage cells bronchial, or other cells or populations of cells that contain ISS sensitive cells, is achieved by contacting the cells with an IMP or composition containing IMP described in this document (for example, a composition that contains an IMP, IMP and a antigen, an IMP-antigen conjugate, a complex IMP / microcarrier, etc.). Modulation can be achieved by any contact form, including without limitation, co-incubation of cells and IMP in vitro, application of IMP to the skin of a mammal (for example, of a experimental animal), and parenteral administration.

An immune response in animals or populations of cells can be detected in various ways, including the largest expression of one or more of IFN-?, IFN-?, IL-2, IL-12, TNF-?, IL-6, IL-4, IL-5, IP-10, ISG-54K, MCP-1, or a change in profile characteristics of genetic expression of immune stimulation as well as responses such as B cell proliferation and cell maturation dendritic The ability to stimulate an immune response in a cell population has various uses, for example, in a system Test for immunosuppressive agents.

A certain number of individuals are suitable for receive the polynucleotide (s) immunomodulator (s) described in this document. Preferably, but not necessarily, the individual is a being human.

In certain embodiments, the individual suffers a disorder associated with an immune response of type Th2, such such as allergies or allergy-induced asthma. The administration of a IMP causes immunomodulation, increasing the levels of one or more Th1 type responses associated with cytokines, which can cause a reduction in response characteristics of type Th2 associated with the individual's response to the allergen. The immunomodulation of individuals with response-associated disorders of type Th2 causes a reduction or improvement of one or more of the symptoms of the disorder When the disorder is allergy or asthma Allergy-induced, the improvement of one or more of the symptoms includes a reduction of one or more of the following: rhinitis, allergic conjunctivitis, circulating levels of IgE, levels circulating histamine and / or the requirement for therapy of "rescue" inhaler (for example, inhaled albuterol administered by a metered dose inhaler or nebulizer).

In other embodiments, the individual subjected to The immunomodulatory therapy of the invention is an individual who Get a vaccine. The vaccine can be a prophylactic vaccine or a therapeutic vaccine A prophylactic vaccine comprises one or more epitopes associated with a disorder for which the individual can being at risk (for example, antigens from M. tuberculosisas a vaccine for the prevention of tuberculosis). Vaccines Therapeutics comprise one or more epitopes associated with a particular disorder affecting the individual, such as antigens of surface of M. tuberculosis or M. bovis in TB patients, antigens against which the individual you are allergic (i.e. allergy desensitization therapy) in individuals undergoing allergies, tumor cells of an individual with cancer (for example, as described in US Pat. . 5,484,596), or tumor associated antigens in patients with Cancer.

The IMP can be administered together with the vaccine (for example, in the same injection or a simultaneous injection, although separate) or the IMP can be administered separately (by example, at least 12 hours before or after administration of the vaccine). In certain embodiments, the Vaccine antigen (s) is (are) part of the IMP, both by covalent union as non-covalent to IMP. In others embodiments, the IMP can be administered only as a vaccine prophylactic to increase resistance against infection by a wide variety of bacterial or viral pathogens, including natural or genetically modified organisms used as agents of biological wars or terrorism. The administration of immunomodulatory polynucleotide therapy to an individual receiving a vaccine causes an immune response against to the vaccine that moves towards a Th1 type response according to It is compared to individuals who receive a vaccine without IMP. He shift towards a response of type Th1 can be recognized for a delayed type hypersensitivity response (DTH) against the antigen (s) in the vaccine, higher responses of IFN-? and others of the type Th1 associated with cytokines, the production of specific CTL for the vaccine antigen (s), low levels or reduced IgE specific for the antigen (s) of the vaccine, a reduction in specific antibodies associated with Th2 for the vaccine antigen (s), and / or a increase in specific antibodies associated with Th1 for the vaccine antigen (s). In the case of therapeutic vaccines, the administration of IMP and the vaccine causes improvement of one or more symptoms of the disorder to which the vaccine is intended try. As will be apparent to any person skilled in the art, the exact symptom (s) and the manner of their Improvement will depend on the defendant disorder being treated. For example, when the therapeutic vaccine is for tuberculosis, the treatment IMP with vaccine causes less cough, less pleural pain or anginal, fever and / or other symptoms known in the art. When the vaccine is an allergen used in desensitization therapy of allergy, treatment causes reduction in the symptoms of allergy (for example, reduction of rhinitis, allergic conjunctivitis, circulating levels of IgE and / or circulating levels of histamine)

Other embodiments of the invention relate to immunomodulatory therapy of individuals who have a pre-existing disease or disorder, such as Cancer or an infectious disease. Cancer is a target attractive for immunomodulation because most of the cancers express antigens associated with tumors and / or specific for tumors that are not found in other cells in the body. The stimulation of a Th1 type response against tumor cells causes the destruction of the direct and / or nonspecific activity of tumor cells by the immune system, leading to a reduction of cancer cells and / or a reduction of the symptom (s). The administration of an IMP to a individual who has cancer causes stimulation of a response Immune Th1 type against tumor cells. Such answer Immune can eliminate tumor cells, both by direct action of cells of the cellular immune system (for example, CTL, NK cells) as by components of the humoral immune system, or by effects of nonspecific activation on cells near target cells by the immune system See, for example, Choet al. (2000) Nat. Biotechnol. 18: 509-514. At cancer context, the administration of IMP may include in addition the administration of one or more therapeutic agents additional such as, for example, antibodies anti-tumor, chemotherapeutic and / or regimes radiation treatments Antibodies anti-tumor, which include, but without restriction, antibody fragments anti-tumor and / or its derivatives, and antibodies monoclonal anti-tumors, their fragments and / or derivatives, are known in the art since such are administered antibody reagents in cancer therapy (for example, Rituxan® (rituximab); Herceptin® (trastuzumab)). The administration of one or more additional therapeutic agents may occur before, after and / or concurrently to the administration of the IMP.

Immunomodulatory therapy according to the invention is also useful for individuals with diseases infectious, particularly infectious diseases that are resistant to humoral immune responses (for example, diseases caused by mycobacterial and pathogenic infections intracellular). Immunomodulatory therapy can be used for treatment of infectious diseases caused by pathogens cellular (for example, bacteria or protozoa) or by pathogens subcellular (for example, virus). IMP therapy can given to individuals suffering from mycobacterial diseases such as tuberculosis (for example, infections due to M. tuberculosis me M. bovis), leprosy (i.e. infections by M. leprae), or infections due to M. marinum or M. ulcerans. IMP therapy is also useful for treatment. of viral infections, including virus infections influenza, respiratory syncytial virus (RSV), hepatitis B virus, hepatitis C virus, herpes virus, particularly Herpes simplex and papillomavirus. The diseases caused by intracellular parasites such as malaria (for example, infection by Plasmodium vivax, P. ovale, P. falciparumme P. malariae), leishmaniosis (for example, infection byLeishmania Donovani, L. tropica, L. Mexican, L. braziliensis, L. peruviana, L. infantum, L. chagasi me L. aethiopica), and toxoplasmosis (it is say infection by Toxoplasmosis gondii) I also know benefit from therapy with IMP. IMP therapy is also useful for the treatment of parasitic diseases such as schistosomiasis (i.e. blood dystroma infection of the gender Schistosoma such as S. haematobium, S. mansoni, S. japonicum and S. mekongi) and clonorchiasis (i.e. infection by Clonorchis sinensis). The administration of an IMP to an individual suffering from a disease Infectious causes an improvement in disease symptoms infectious In some embodiments, the infectious disease does not It is a viral disease.

The invention further relates to the increase or the stimulation of at least one cytokine associated with Th1 in a individual, including IL-2, IL-12, TNF- ?-, IFN-? And IFN-? In certain embodiments, the invention refers to the increase or stimulation of IFN-? In an individual, particularly in a individual who needs higher levels of IFN-?, Administering an effective amount of an IMP to the individual such that it increases IFN-?. Individuals who need to increase the IFN-? Are those that have disorders that generally respond to the administration of IFN- γ. Such disorders include various inflammatory disorders including, but not limited to, colitis ulcerative Such disorders also include various disorders. fibrotic, including, but not limited to, pulmonary fibrosis idiopathic (IPF), scleroderma, cutaneous fibrosis induced by radiation, liver fibrosis including induced liver fibrosis by schistosomiasis, renal fibrosis as well as other conditions that can be improved by administering IFN- γ. IMP administration agree with the invention causes an increase in the levels of IFN-?, And causes the improvement of one or more symptoms, stabilization of one or more symptoms, and / or prevention or the delay of the progression (for example, reduction or elimination of other injuries or symptoms) of the disorder that responds to IFN- γ.

The invention can be practiced in combination with other therapies that constitute the standard of care for the disorder, such as agent administration anti-inflammatories such as therapy with Systemic corticosteroids (eg cortisone) in IPF.

In certain embodiments, the invention will be refers to the increase in type I interferon, including IFN-?, IFN-? And IFN- \ omega, in an individual, particularly in a individual who needs to increase interferon levels in the type I, administering an effective amount of an IMP to the individual such that interferon levels of type I are increased. In certain embodiments, the invention relates to the increase of IFN-? In an individual, particularly in a individual who needs IFN-? levels increased, administering an effective amount of an IMP at individual such that the levels of IFN-? The individuals who need a Increased IFN-? Are those that have disorders that generally respond to the administration of IFN-?, Including Recombinant IFN-?, Including, but not restriction, viral infections and cancer. In some embodiments in which an increased production of more levels is desired high IFN-?, the IMP contains at least one palindromic sequence of at least the following lengths (in bases): 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 or 30, and, in some embodiments, the IMP contains at least one palindromic sequence with a length greater than 30 bases.

The administration of IMP according to the invention causes an increase in the levels of IFN-?, And causes an improvement of one or more symptoms, stabilization of one or more symptoms, and / or prevention or the delay of the progression (for example, the reduction or elimination of additional injuries or symptoms) of the disorder that Respond to IFN-? The methods of the invention they can be implemented in combination with other therapies that consist of the standard of care for the disorder, such as the administration of anti-viral agents for viral infections

The invention also relates to levels reducers, particularly serum levels, of IgE in an individual who has an IgE related disorder by administering a effective amount of an IMP to the individual. In such embodiments, the immunomodulatory polynucleotide can be administered alone (by example, without antigen) or can be administered with the antigen, such Like an allergen The reduction in IgE causes an improvement of one or more symptoms of IgE related disorder. Such symptoms include allergy symptoms such as rhinitis, conjunctivitis, in decreasing sensitivity to allergens, a reduction in allergy symptoms in an individual with allergies, or a reduction of the severity of an allergic response. According to this, the invention also refers to the treatment of a condition Allergic in an individual. In some embodiments, the treatment of an allergic condition includes administering the polynucleotide immunomodulator with a particular amount or dose of antigen. With any administration of the additional antigen, the amount or administered antigen dose may remain unchanged, may decrease or may increase (as in conventional therapy of desensitization) in the course of treatment.

In some embodiments, the invention will be refers to the stimulation of CTL production in an individual, particularly in an individual who needs larger numbers and / or CTL activity, which comprises administering an effective amount of an IMP to the individual such that increases the production of CTL. The individuals who need a greater production of CTL are those who have disorders that generally respond to the activity of CTL Such disorders include, but are not limited to, cancer and intracellular infections IMP administration according to the invention causes an increase in CTL levels, and causes the improvement of one or more symptoms, stabilization of one or more symptoms, and / or the prevention or retardation of progression (by example, reduction or elimination of injuries or symptoms additional) of the disorder that responds to CTL activity.

The invention includes any of the embodiments described in this document, such as administering IMPs in the form of the polynucleotide complex immunomodulator / microcarrier (with or without antigen, or with or without antigen in a course of administrations), or in close association With an antigen

As will be apparent to any expert in the technique, the invention can be practiced in combination with other therapies for the particular indication for which Manage the IMP. For example, IMP therapy can administered together with anti-malaria drugs such as chloroquine for patients with malaria, along with drugs leishmanicides such as pentamidine and / or allopurinol for patients with leishmaniasis, along with drugs anti-mycobacterials such as isoniazid, rifampin and / or ethambutol in patients with tuberculosis, or together with therapy of desensitization of allergens for atopic patients (allergy).

As described in this document, the IMP administration may further comprise the administration of one or more additional immunotherapeutic agents (ie, a agent that acts via the immune system and / or is derived from the system immune) including, but not limited to, cytokine, adjuvants and antibodies (including, but not limited to, fragments of antibodies and / or derivatives and monoclonal antibodies, fragments and / or Their derivatives). Examples of therapeutic antibodies include those used in the context of cancer (for example, antibodies anti-tumor). The administration of such agents Additional immunotherapeutic applies to all methods described in this document.

An IMP can also be administered along with a adjuvant Administration of an antigen with an IMP and a adjuvant leads to potentiation of an immune response against to the antigen and thus, can cause an enhanced immune response compared to that resulting from a composition comprising the IMP and the antigen alone. Adjuvants are known in the art and include, although without restriction, emulsions of oil-in-water emulsions of water-in-oil, alum (salts of aluminum), liposomes and microparticles, including but not restriction, polystyrene, starch, polyphosphazene and polylactide / polyglycosides. Other suitable adjuvants also include, but are not limited to, MF59, DETOX® (Ribi), mixtures of squalene (SAF-1), muramyl peptide, derivatives of saponin, mycobacterial cell wall preparations, lipid Monophosphoryl A, mycolic acid derivatives, surfactants non-ionic block copolymer, Quil A, toxin B subunit of cholera, polyphosphazene and derivatives, and immunostimulatory complexes (ISCOM) such as those described by Takahashi et al. (1990) Nature344: 873-875, as well as, lipid adjuvants and others described herein. For use veterinarian and for the production of antibodies in animals, can used mitogenic components of Freund's adjuvant (both complete as incomplete).

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Administration and evaluation of the immune response

The IMP can be administered in combination with other pharmaceutical and / or immunogenic agents and / or immunostimulators, as described in this document, and may combine with your physiologically acceptable vehicle (and as such the invention includes these compositions). The IMP can be any of those described in this document.

According to this, the IMP can be administered together with other immunotherapeutic agents including, but not restriction, cytokine, adjuvants and antibodies.

As with all immunogenic compositions, immunologically effective amounts and the method of administration of the particular IMP formulation may vary according to the individual, what condition is treated and other factors evident to any person skilled in the art. The factors that are consider include antigenicity of the antigen if administered, whether or not IMP will be administered or covalently linked to a adjuvant, release molecule and / or antigen, route of administration and the number of immunizing doses administered. Such factors are known in the art and are within of the skill of those skilled in the art to prepare such determinations without undue experimentation. An interval of adequate dosage is one that provides modulation desired immune response (for example, stimulation of IFN-? And / or IFN-?). When an immune response to an antigen is desired, a proper dosage range is one that provides the Desired modulation of the immune response against the antigen. Generally, the dosage is determined by the amount of IMP administered to the patient, rather than by the overall amount of the composition containing the administered IMP. The intervals of useful dosages of IMP, given in amounts of IMP released, they can be, for example, about any of the next: 1 to 500 µg / kg, 100 to 400 µg / kg, 200 to 300 µg / kg, 1 to 100 µg / kg, 100 to 200 µg / kg, 300 at 400 µg / kg, from 400 to 500 µg / kg. The absolute amount given to Each patient depends on pharmacological properties such as bioavailability, clearance rate and route of administration.

The effective amount and method of administration of the particular IMP formulation may vary by patient individual, the desired outcome and / or the type of disorder, the state of the disease and other obvious factors for any expert in the technique The route (s) of administration useful (s) in a particular application are evident to Any expert in the art. Administration routes include, but are not limited to, topical, dermal, transdermal, transmucosal, epidermal, parenteral, gastrointestinal and naso-pharyngeal and pulmonary, including transbronchial and transalveolar. A suitable dosage range is one that provides sufficient composition containing IMP to achieve a tissue concentration of approximately 1-10 µM measured by blood levels. The absolute amount given to each patient depends on properties pharmacological such as bioavailability, speed of clearance and route of administration.

As described in this document, the APCs and tissues with high concentration of APC are preferred targets for IMP. Thus, the administration of IMP to skin and / or mucosa of mammals, where APCs are present at concentrations relatively high

The present invention provides formulations of IMP suitable for topical application including, but not restriction, physiologically acceptable implants, ointments, creams, clarifying solutions and gels. Topical administration it is, for example, by a cloth or benda that has dispersed in this one a system of liberation, by direct administration of a release system in incisions or open wounds, or by a transdermal delivery device directed to a site of interest. Creams, rinsing solutions, gels or ointments that they have dispersed in these an IMP are suitable for use as topical ointments or wound-filling agents.

The preferred routes of administration Dermal are those that are less invasive. The preferred media Among these are transdermal transmission, epidermal administration and subcutaneous injection. Of these means, the administration Epidermal is preferred for larger concentrations of APC expected to be in intradermal tissue.

Transdermal administration is achieved by the application of a cream, lightening solution, gel, etc. able to allow the IMP to penetrate the skin and enter the current blood Compositions suitable for administration Transdermal include, but are not limited to, suspensions, pharmaceutically acceptable oils, creams and ointments applied directly to the skin or incorporated into such a protective vehicle as a transdermal device (called a "patch"). The examples of creams, ointments, etc. suitable can be found, for example, in the Physician's Desk Reference.

For transdermal transmission, the Iontophoresis is a suitable method. Iontophoretic transmission can be achieved using commercially available patches that release your product continuously through healthy skin for periods of several days or more. The use of this method allows the controlled transmission of pharmaceutical compositions to relatively large concentrations, allows the infusion of combination drugs and allows the simultaneous use of a promoter of absorption.

An exemplary patch product for use in this method is the product with the trademark LECTRO PATCH of General Medical Company of Los Angeles, CA. This product maintains electronically reserve electrodes at neutral pH and can adapt to provide different dosages concentrations, to dose continuously and / or periodically. The preparation and use of the patch should be done in accordance with the manufacturer's printed instructions that accompany the product PATCH READER; whose instructions are incorporated in this document as reference. Other occlusive patch systems are also adequate.

For transdermal transmission, release Ultrasonic at low frequency is also a suitable method. Mitragotri et al. (1995) Science269: 850-853. The application of frequencies Low frequency ultrasonic (approximately 1 MHz) allows the general controlled release of therapeutic compositions, including those of high molecular weight.

Epidermal administration implies essentially mechanically or chemically irritate the layer more external epidermis to sufficiently elicit a response immune against the irritant. Specifically, the irritation must be enough to attract the APC to the site of irritation.

An illustrative mechanical irritant means employs a multiplicity of short fork teeth of very diameter narrow that can be used to irritate the skin and attract APCs to site of irritation, for the taking of the IMP transferred from the end of these teeth. For example, the tuberculin assay MONO-VACC manufactured by Pasteur Merieux de Lyon, France, contains a device suitable for introduction of compositions containing IMP.

The device (which is distributed in States United by Connaught Laboratories, Inc. of Swiftwater, PA) consists in a plastic container that has a syringe plunger in a end and a disc with teeth on the other. The disk with teeth supports a multiplicity of narrow diameter teeth of one length that will scratch just the outermost layer of cells epidermal Each of the teeth in the kit MONO-VACC is coated with old tuberculin; in the present invention, each needle is coated with a composition Pharmaceutical formulation of IMP. The use of the device is preferably according to the written instructions of the Manufacturer included with the product device. Dispositives similar ones that can also be used in this embodiment are those currently used to perform the tests of the allergy.

Another approach suitable for management IMP epidermal is by using a chemical that irritate the outermost cells of the epidermis, thus causing a sufficient immune response to attract APCs to the area. A example is a keratinolytic agent, such as salicylic acid used in commercially available topical depilatory cream sold by Noxema Corporation under the trademark NAIR. East approach can also be used to achieve epithelial administration In the mucosa. The chemical irritant can also be applied together with the mechanical irritant (as, for example, would occur if the MONO-VACC teeth were also coated with the chemical irritant). The IMP can be suspended in a vehicle that also contain the chemical irritant or co-administered with this.

Parenteral administration routes include, although without restriction, the electric injection (iontophoresis) or direct such as direct injection in a line injection central venous, intravenous, intramuscular, intraperitoneal, intradermal or subcutaneous. IMP formulations suitable for parenteral administration are generally formulated in USP water or water for injection and may also comprise pH buffers, salts of loading agents, preservatives, and other excipients pharmaceutically acceptable. The immunomodulator polynucleotide for parenteral injection can be formulated in solutions pharmaceutically acceptable sterile isotonics such as saline solution and phosphate buffered saline solution for injection.

The gastrointestinal routes of administration include, but are not limited to, ingestion and rectal. The invention includes appropriate IMP formulations for administration gastrointestinal including, but not limited to, powders Pharmaceutically acceptable pills or liquids for ingestion and suppositories for rectal administration. As will be evident for any expert in the art, pills or suppositories they will further comprise pharmaceutically acceptable solids, such as starch, to provide the volume for the composition.

The naso-pharyngeal administration and pulmonary is achieved by inhalation, and includes release routes such as intranasal, transbronchial and transalveolar routes. The invention includes IMP formulations suitable for the administration by inhalation including, but not limited to, liquid suspensions for aerosol formation as well as powder forms for powder inhalation release systems dry The right devices for administration by Inhalation of IMP formulations include, but are not limited to, atomizers, vaporizers, nebulizers, and devices release of inhalation of dry powders.

As is well known in the art, the solutions or suspensions used for administration routes described in this document may include any one or more of the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; agents antibacterials such as benzyl alcohol or methyl parabens; antioxidants such as acid ascorbic or sodium bisulfite; chelating agents such as acid ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for tonicity adjustment such as chloride of sodium or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The preparation Parenteral may be included in ampoules, disposable syringes or multi-dose vials made of glass or plastic.

As is well known in the art, the pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (being soluble in water) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For the intravenous administration, suitable vehicles include physiological saline solution, bacteriostatic water, Cremophor EL® (BASF, Parsippany, NJ) or phosphate buffered saline (PBS) In all cases, the composition must be sterile and must be fluid to a degree that is easily applicable with syringe. It must be stable under the manufacturing conditions and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by use. of a coating such as lecithin, by maintaining of the particle size required in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be achieved by various agents antibacterials and antifungals, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. May it is preferable to include isotonic agents, for example, sugars, polyols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the compositions injectables can be performed including approximately in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

As is well known in the art, they can Prepare sterile injectable solutions by incorporating the active compound (s) in the amount required in an appropriate solvent with one or a combination of the ingredients listed above, as required, followed by the filtered sterilization. Generally, dispersions are prepared incorporating the active compound in a sterile vehicle containing a basic dispersion medium and the other ingredients required to from those listed above. In the case of sterile powders For the preparation of sterile injectable solutions, the methods Preferred preparation are vacuum drying and lyophilization. which provides an active ingredient powder plus any additional desired ingredient from its sterile solution previously filtered.

The choice of release routes can be used to modulate the immune response generated. For example, the titles of IgG and CTL activities were identical when administered a flu virus vector via routes intramuscular or epidermal (gene gun); However, the muscle inoculation first provided IgG2a, while The epidermal route provided mostly IgG1. Pertmeret to the. (1996) J. Virol.70: 6119-6125. Thus, any expert in the technique can benefit from slight differences in the immunogenicity generated by different routes of administration of the immunomodulatory polynucleotides of the present invention.

Compositions and methods of administration mentioned above are intended to describe, but not limit, to the methods of administration of the formulations of IMP of the invention. The methods to produce the various compositions and devices are within the capacity of any skilled in the art and are not described in detail in this document.

The analyzes (both qualitative and quantitative) of the immune response against IMP may be by any method known in the art, including, but not restriction, the measurement of the specific antigen of the production of antibody (including measurement of antibody subclasses specific), the activation of specific lymphocyte populations such as CD4 + T cells, B cells, NK or CTL cells, the dendritic cell maturation (including dendritic cells plasmocytoids), the production of cytokines and chemokines such like IFN-?, IFN-?, IFN-?, TNF-?, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IP-10, MCP-1, MCP-2, MCP-3, MIG or MIP-3? And / or histamine release. The methods to measure specific antibody responses include the enzyme-linked immunosorbent assay (ELISA) and are well known in the art. The measures of the numbers of types of specific lymphocytes such as CD4 + T cells can be achieved, for example, with classification of activated cells with fluorescence (FACS). The measurement of the activation of populations of particular cells can be achieved by determining the expression of markers, for example, cell surface markers, specific for the activation of the particular cell type. May measure the expression of the cell marker, for example, by measuring the RNA expression or measuring cell surface expression of the particular marker, for example, by FACS analysis. The essays of cytotoxicity and CTL can be performed, for example, as describe in Raz et al. (1994) Proc. Natl Acad. Sci. USES91: 9519-9523 and Cho et al.(2000). Cytokine concentrations can be measured by example, by ELISA. The measure for cell maturation dendritic can be performed, for example, as described in Hartmann et al. (1999) Proc. Natl Acad. Sci. USA96: 9305-9310. These and other essays for assess the immune response against an immunogen are very known in the art. See, for example,Selected Methods in Cellular Immunology (1980) Mishell and Shiigi, eds., WH Freeman and Co.

The analyzes (both qualitative and quantitative) of the immune response against IMP can also measure the level of cytokines, chemokines and / or other molecules that they are induced by cytokines , such as IFN-? And / or IFN-?, Whose Production is stimulated by IMP. According to this, the IMP of the invention can also stimulate cytokine expression inducible by IFN-? and / or IFN-?, Chemokines and proteins inflammatory including, but not limited to, IP-10 (10 kDa interferon-induced protein), IFN-γ induced monokine, and protein monocyte chemotactic 1 (MCP-1). The answer immune against IMP can also be analyzed by measuring the level of cytokines, chemokines and / or other molecules known to have antiviral activities, including 2,5-oligoadenylate synthetase (2,5-OAS), 54K interferon stimulating gene (ISG-54K), MxA, MxB and guanylate binding protein 1 (GBP-1). So, the antiviral molecules and IFN-? and / or induced molecules IFN-? Can be used as markers of the IMP activity. The extent of such production of the molecule Interferon-induced and / or gene expression can be by any method known in the art, including, but not restriction, by ELISA and quantitative PCR to measure production of RNA.

Preferably, it is stimulated, that is, it generates and / or enhances a response of type Th1. With reference to the invention, the stimulation of an immune response of the Th1 type can be determined in vitro or ex vivo measuring the cytokine production from IMP treated cells according to it is compared with those treated without IMP. The methods to determine the cytokine production in cells include those methods described herein and any known in the art. The type of cytokines produced in response to the treatment of IMP indicates an immune response of type Th1 or type Th2 biased by the cells. As used herein, the expression cytokine production "of the biased Th1 type" refers to the increased measurable production of cytokines associated with a immune response of type Th1 in the presence of a stimulator according to it is compared with the production of such cytokines in the absence of stimulation Examples of such cytokines of type Th1 Biased include, but are not limited to, IL-2, IL-12, IFN-? And IFN-? In contrast, "cytokines of the type Biased Th2 "refers to those associated with a response immune system of type Th2, and include, but not limited to, IL-4, IL-5, and IL-13. Cells useful for the determination of IMP activity include immune system cells, mainly isolated cells of a host and / or cell lines, preferably APC and lymphocytes, even more preferably macrophages and cells T.

Stimulation of an immune response of the type Th1 can also be measured in a host treated with an IMP and can be determined by any method known in the art including, but not limited to: (1) a reduction in IL-4 or IL-5 levels measured before and after exposure to the antigen; or level detection lower (or even absent) of IL-4 or IL-5 in a host treated with IMP, optionally as compared to an antigen-priming, or control primed and exposed, treated without IMP; (2) an increase in levels of IL-12, IL-18 and / or IFN (α, β or γ) before and after exposure to the antigen; or the detection of higher levels of IL-12, IL-18 and / or IFN (?,? Or?) In a host treated with IMP as compared to a antigen-priming or, priming and exposed control, treated without IMP; (3) antibody production "of type Th1 biased "in a guest treated with IMP as compared to a control treated without IMP; and / or (4) a reduction in the levels of IgE specific antigen as measured before and after the antigen exposure; or the detection of lower levels (or even absent) of specific IgE antigen in a host treated with IMP as compared to a antigen-priming, or priming and exposed control, treated without IMP. Various of these determinations can be made measuring cytokines made by APC and / or lymphocytes, preferably macrophages and / or T cells, in vitro or former alive using the methods described in this document or any known in the art. Some of these determinations can be made by measuring the class and / or subclass of antigen specific antibodies using the methods described in This document or any known in the art.

The class and / or subclass of specific antibodies of antigen produced in response to the treatment of IMP indicates an immune response of type Th1 or type Th2 biased by cells. As used herein, the expression production of "biased Th1 type" antibody refers to production measurable increased antibody associated with a response immune system of type Th1 (ie, antibodies associated with Th1). They can measure one or more antibodies associated with Th1. Examples of such biased Th1 type antibodies include, but are not limited to, IgG1 and / or human IgG3 (see, for example, Widhe et al. (1998) Scand. J. Immunol. 47: 575-581 and of Martino et al. (1999) Ann. Allergy Asthma Immunol. 83: 160-164) and murine IgG2a. By contrast, "biased Th2 type antibodies" refers to those associated with an immune response of type Th2, and include, although unrestricted, IgG2, IgG4 and / or human IgE (see, for example, Widhe et al. (1998) and Martino et al. (1999)) e IgG1 and / or murine IgE.

Induction of cytokine of the biased Th1 type which occurs as a result of the administration of IMP produces enhanced cellular immune responses, such as those performed by NK cells, cytotoxic lymphocytes, Th1 adjuvants and memory. These responses are particularly beneficial for use. in protective or therapeutic vaccination against viruses, fungi, protozoan parasites, bacteria, allergic diseases and asthma, as well as tumors.

In some embodiments, the Th2 response is suppresses (reduces) Deleting a Th2 response can be determined, for example, by the reduction in the levels of cytokines associated with Th2, such as IL-4 and IL-5, reduction in antibody levels associated with Th2, as well as the reduction of IgE and the reduction in histamine release in response to the allergen.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Kits

Kits are also described in this document. In certain cases, the kits generally comprise one or more containers comprising any IMP as described in this document. The kits may further comprise a group of appropriate instructions, usually written instructions, which refer to the use of IMP for any of the methods described in this document (for example, immunomodulation, improvement of one or more symptoms of an infectious disease, increased levels of IFN-?, Increased levels of IFN-? Or improvement of a related disorder with IgE).

The kits can comprise IMP packed in Any convenient and appropriate container. For example, if the IMP is a dry formulation (for example, lyophilized or a dry powder), is normally use a vial with a resilient cap, so that the IMP can be easily resuspended by injecting fluid through the resilient plug. Blisters with non-resyntive closures, removable (for example, sealed glass) or resilient plugs they are the most conveniently used for liquid formulations of IMP. Containers for use in combination with a specific device, such as an inhaler, device nasal administration (for example, an atomizer) or a device of infusion such as a minipump.

The instructions that refer to the use of IMP They usually include information about the dosage, schedule administration and administration path for the method of use alleged. IMP containers can be unit doses, bulky containers (for example, containers multi-dose) or sub-unit doses. The instructions supplied in the kits are normally written instructions on a label or leaflet (for example, a sheet of paper included in the kit), even if they are also Acceptable mechanical reading instructions (for example, instructions supported by a magnetic storage disk or optical).

In some embodiments, the kits comprise also an antigen (or one or more antigens), which may or may not be wrapped in the same container (formulation) as the IMP (s). The antigen has been described in this document.

In certain embodiments, the kits comprise a IMP in the form of a polynucleotide complex immunomodulator / microcarrier (IMP / MC) and may also comprise a group of instructions, usually written instructions, that refer to the use of the IMP / MC complex for any of the methods described in this document (for example, immunomodulation, improvement of one or more symptoms of an infectious disease, increase of IFN-? levels, increased levels of IFN-?, or improvement of a related disorder with IgE).

In some embodiments, the kits comprise materials for the production of IMP / MC complex that include generally separate containers of IMP and MC, although in certain realizations materials are supplied for the production of the MC instead of those made with MC. The IMP and the MC are supplied preferably in a way that allows complex formation IMP / MC under the mixture of IMP and MC supplied. This configuration is preferred when the IMP / MC complex is joined by binding not covalent. This setting is also preferred when the IMP and MC have to be crosslinked via a heterobifunctional crosslinker; both IMP and MC are supplied in an "activated" form (by example, attached to the heterobifunctional crosslinker such that it is available a reactive residue with the IMP).

The kits for IMP / MC complexes comprising a Liquid phase MC preferably comprise one or more containers which include materials for the production of liquid phase MC. For example, an IMP / MC kit for the emulsion of MC oil-in-water can comprise one or more containers containing an oily phase and an aqueous phase The contents of the container are emulsified to produce the MC, which is then mixed with the IMP, preferably a IMP that has been modified to incorporate a hydrophobic moiety. Such Materials include oil and water, for the production of emulsions of oil-in-water, or containers of lyophilized liposome components (for example, a mixture of phospholipids, cholesterol and a surfactant) plus one or more containers of an aqueous phase (for example, an aqueous buffer pharmaceutically acceptable). In certain cases, the kits comprise an IMP in the form of a condensing agent composition cationic - IMP - stabilizing agent (CIS) in one or more containers comprising any particulate composition of Immunomodulatory CIS as described in this document. So Alternatively, the kits may comprise one or more containers of the components of the CIS compositions of the invention. The configurations include kits with a mixing vessel IMP / stabilizing agent and a condensing agent container cationic and kits with an IMP container, an agent container stabilizer, and a cationic condensing agent container. The kits may further comprise a suitable group of instructions, usually written instructions, which refer to the use of the CIS particulate composition for any of the methods described in this document (for example, immunomodulation, improvement of one or more symptoms of an infectious disease, increase of IFN-? levels, increase in IFN-? levels, or improvement of a disorder related to IgE). The kit embodiments that comprise containers of the components of the CIS compositions generally will include instructions for the production of CIS compositions in accordance with the methods described in this document. In addition to the CIS composition and / or the components of the CIS composition of the invention, kit embodiments may also include instructions for the production of the CIS compositions of in accordance with the methods described in this document and instructions for use of immunomodulatory CIS compositions for anyone of the methods described in this document.

The following examples are provided for illustrate, but not limit, the invention. Polynucleotides Immunomodulators of the invention are labeled with an asterisk (*). He Other sequences are for illustrative purposes only.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Examples

Example 1

Immunomodulation of human cells by polynucleotides immunomodulators

Polynucleotide samples immunomodulators (IMP) or control, including polynucleotides without an immunomodulatory sequence (5'-TGACTGTGAACCTTAGAGATGA-3 '(SEQ ID NO: 2)), SAC and a half alone, were analyzed to detect their immunomodulatory activity in blood mononuclear cells human peripheral (PBMC). The polynucleotide was also analyzed 5'-TGACTGTGAACGTTCGAGATGA standard immunomodulator (SEQ ID NO: 1). Unless stated otherwise, polynucleotides analyzed was phosphorothioate oligodeoxynucleotides completely modified.

Peripheral blood was collected from volunteers by venipuncture using heparinized syringes. Blood spread on a pad of FICOLL® (Amersham Pharmacia Biotech) and centrifugal. The PBMC, located at the FICOLL® interface, is recovered, then washed twice with saline cold phosphate buffer (PBS). The cells were resuspended and were cultured in 48 or 96 well plates at 2 x 10 6 cells / mL in RPMI 1640 with 10% human AB serum inactivated by heat plus 50 units / mL penicillin, 50 µg / mL streptomycin, 300 µg / mL glutamine, 1 mM sodium pyruvate, and 1 x non-amino acids Essential MEM (NEAA).

The cells were cultured in the presence of test samples (IMP or controls) at doses in the range of 0.2 at 20 µg / ml for 24 hours, then the medium was recovered without cells of each well and analyzed to determine the IFN-γ concentration and / or IFN-? Were analyzed IFN-? And IFN-? Using ELISA CYTOSCREEN® kits from BioSource International, Inc., of According to the manufacturer's instructions. Generally, the test samples were analyzed with PBMC from 4 human donors.

IMPs stimulated the secretion of IFN-? And / or IFN-? By Human PBMC. In the human PBMC assay, the background levels of IFN-? May vary, even significantly, with the donor. Other cytokines such as IFN-?, However, show a model of generally stable activation and routinely exhibit low background levels under unstimulated conditions. The examples of Results of such tests with PBMC are summarized in the Tables 2-7.

In a dose titration trial, the PBMCs of 4 donors were stimulated with 0.2 to 20 µg / ml SEQ ID NO: 27 as described before. The amount of IFN-? and IFN-? produced was evaluated as described before and the results of the 4 donors were averaged and the Average results are presented in Table 2.

TABLE 2

IMP titration - IFN (pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

As can be seen from the results presented in Table 2, the ability to induce the production of IFN-? Increased when the dose of IMP and became optimal at approximately 3-8 / mug / ml, after which the activity decreased with the dose. Other trials confirmed this result.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

PBMCs from four donors were stimulated with 20 µg / ml IMP or controls and production stimulation of IFN-? and IFN-? are evaluated as described before. Among the polynucleotides analyzed They were:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

The results of the cytokine production of the PBMC of each donor was averaged and the results averaged They are presented in Table 3.

TABLE 3

PBMC assays in humans - IFN (pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

As shown in Table 3, the IMPs that stimulated the production of more IFN-? than a Standard IMP, SEQ ID NO: 1, includes at least one TCG sequence in the 5 'end or near the polynucleotide (a sequence 5'-TCG) and a palindromic sequence of at least 8 bases of both adjacent and within 3 bases of the 5'-TCG sequence. In general, the stimulation of IFN-γ production replicated stimulation of IFN-? production, although the interval of variation in the stimulation of IFN-? was lower than for IFN-?. In the polynucleotides in which the palindromic sequence and the 5'-TCG were separated, it was usually preferable for the production of IFN-? than the separation was or overlaps with a second TCG trinucleotide (see, for example, SEQ ID NO: 14). IMPs that contain a 5'-TCG but no palindromic sequence as described before induced very low levels of IFN-? And did not induce the production of IFN-? (See, for example, SEQ ID NOs: 18 and eleven). IMPs containing 6-8 base palindromes but not the trinucleotide 5'-TCG induced IFN-? Although only under levels of IFN-? (See, for example, SEQ ID NO: 1 and 4). Interestingly, IMPs containing TCG of up to three bases removed from the 5 'end of the polynucleotide and that contain a palindromic sequence of at least 10 bases of length induced a particularly high level of IFN-? Compared to a standard IMP without a 5'-TCG, SEQ ID NO: 1 (see, for example, SEQ ID NO: 24 and 8).

An assay was conducted to analyze the dose dependence of IMP in production stimulation of IFN-? The IMP analyzed in this trial varied in the position of the palindromic sequence in the polynucleotide and / or the positions of at least one TCG sequence in the 5 'end. Among the polynucleotides analyzed were some with CG dinucleotides and 5'-TCG sequences but without 8 bases of palindromic sequences or greater in length (by example, SEQ ID NO: 11; SEQ ID NO: 18; 5'-TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 3)). As well polynucleotides were analyzed with CG dinucleotides and 8 bases of palindromic sequence or longer in length but not trinucleotides 5'-TCG (for example, SEQ ID NO: 1; SEQ ID NO: 4; 5'-ATCATCTCGAACGTTCGACGA (SEQ ID NO: 29); 5'-AACGTTCGAACGTTCGAACGTTT (SEQ ID NO: 67); 5'-TCAACGTTCGAACGTTCGAACGTT (SEQ ID NO: 68); 5'-GACGATCGTCGACGATCGTC (SEQ ID NO: 85)). PBMC of four donors were stimulated with 0.8, 4.0 or 20 µg / ml of the IMP or controls. The stimulation of the production of IFN-? Was evaluated as described above and the averaged results from the 4 donors are shown in Table 4

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

TABLE 4

PBMC assay in humans -IFN-? (Pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

The results presented in Table 4 support the importance of a palindromic sequence of at least 8 bases of length and at least one TCG sequence at the 5 'end or near of the polynucleotide for stimulation of IFN-? From PBMC of humans.

Another trial was performed to analyze the dose dependence of IMP on stimulation of IFN-? production. The IMPs analyzed in this assay varied in the presence of CG dinucleotides and sequences 5'-TCG in the polynucleotide. Between the analyzed polynucleotides there were some with palindromic sequence but without CG dinucleotides (for example, SEQ ID NO: 2; 5'-TGCTTGCAAGCTTGCAAGCA (SEQ ID NO: 90), 5'-TCAGTCAGTCAGCT GACTGACTGA (SEQ ID NO: 96) and / or without a 5'-TCG sequence (for example, SEQ ID NOs: 1, 90, 96; 5'-ACC GATAACGTTGCCGGTGACGGCACCACG (SEQ ID NO: 92), 5'-AACAACAACGTTGTTGTT (SEQ ID NO: 95), 5'-ACCGATAACGTTGCCGGTGACGGCACCACG (SEQ ID NO: 25), 5'-AACAACAACGTTGTTGTT (SEQ ID NO: 94)). I also know analyzed in this test the polynucleotide 5'-TCGTTGCAAGCTTGCAACGA (SEQ ID NO: 91). Some of IMPs varied in the composition of the phosphate structure. The PBMC from three donors were stimulated with 0.8, 4.0 or 20 µg / ml of the IMP or controls. The stimulation of the production of IFN-? Was evaluated using the PBMC of 3 donors as described before and the results averaged for The 3 donors are shown in Table 5.

TABLE 5

PBMC assay in humans -IFN-? (Pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

As can be seen from the results presented in Table 5, the inversion of CG dinucleotides in the sequence SEQ ID NO: 42 highly active in GC abole dinucleotides the ability of SEQ ID NO: 90 to induce IFN-? Similarly SEQ ID NO: 96, a palindromic polynucleotide without CG dinucleotides is also inactive.

As can be seen in Table 5, two Representative phosphodiester polynucleotides, SEQ ID NO: 25 and SEQ ID NO: 94, and its phosphorothioate versions completely modified, SEQ ID NO: 92 and SEQ ID NO: 95, respectively, no were active in the induction of IFN-? of PBMC of humans. Although SEQ ID NOs: 25 and 92 contain various CG dinucleotides, including the AACGTT motif, do not include TCG or a palindromic sequence of at least 8 bases. SEQ ID NOs: 94 and 95 are 18 base palindromes and contain a CG dinucleotide, but not the TCG trinucleotide. Thus, these polynucleotides do not conform to reasons described in this document.

SEQ ID NOs: 26, 30, 32 and 33, which contain all phosphorothioate junctions (SEQ ID NOs: 30 and 32) or junctions of chimeric phosphorothioate / phosphodiester (SEQ ID NOs: 26 and 33), induced high amounts of PBMC IFN-? human. Both SEQ ID NOs: 34 (containing unions of chimeric phosphorothioate / phosphodiester) and 93 (all junctions of phosphorothioate) induced PBNC IFN-? human.

In an essay to analyze the effect of length of a palindromic sequence on stimulation of IFN-?, The PBMCs of four donors are stimulated with 2 µg / ml or 20 µg / ml of the IMP or controls, stimulation of IFN-? production is evaluated as described before and the averaged results are shown in Table 6. Among the polynucleotides analyzed were 5'-TTCGAACGTTCGTTAACGTTCG (SEQ ID NO: 20) and 5'-TCGTC GAACGTTCGAACGTTCG (SEQ ID NO: 19).

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

TABLE 6

PBMC assays in humans -IFN-? (Pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

The results presented in Table 6 support the importance of a palindromic sequence of at least 8 bases of length and at least one TCG sequence at the 5 'end or near of the polynucleotide for stimulation of IFN-? Of human PBMC.

In an essay to analyze the activity IMP-IFN-α stimulator with a variety of 12 base palindromes, the PBMC of four donors are stimulated with 0.8, 4 or 20 µg / ml of the IMP or controls, the stimulation of IFN-α production is evaluated as described before and the averaged results are shown in Table 7.

TABLE 7

PBMC assays in humans -IFN-? (Pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

The results presented in Table 7 indicate that any of the IMP analyzed with 12 base palindromes were active in the stimulation of IFN-? of Human PBMC. These IMPs contain a 12 base palindrome with the TCG sequence X_ {X} {2} CGX_ {2} 'X_ {1}' CGA (SEQ ID NO: 198) in which there are no nucleotide limitations for X_ {1} and X_ {2}, to Despite the formation of CGCG, CCGG and GCGC cycles, which have been previously described as immunoinhibitory sequences or immune neutralizing sequences (Krieg et al. (1998) Proc. Natl Acad. Sci. USA95: 12631-12636). For example, SEQ ID NOs: 49 and 50 are active in the stimulation of IFN-? And They contain the CGCG sequence. SEQ ID NO: 49 exemplifies a immunomodulatory polynucleotide containing SEQ ID NO: 161 described before. SEQ ID NO: 50 exemplifies a polynucleotide immunomodulator containing SEQ ID NO: 162 described above.

IMPs with longer palindromes induced higher levels of IFN-? of human PBMC, particularly at lower doses of IMP. As can be seen in the test results shown in Fig. 1, the amount of IFN-? Produced from cells in response to SEQ ID NO: 172 was significantly higher than that of SEQ ID NO: 113, SEQ ID NO: 27 and SEQ ID NO: 1 at the dose of 0.4 µg / ml IMP. In addition, the amount of IFN-? Produced in response to SEQ ID NO: 172 was significantly greater than SEQ ID NO: 27 and SEQ ID NO: 1 at the dose of 0.8 µg / ml IMP (p < 0.001). Palindrome length in IMP is: 28 bases in SEQ ID NO: 172, 22 bases in SEQ ID NO: 113, 12 bases in SEQ ID NO: 27, and 8 bases in SEQ ID NO: 1

In another trial, the overall IMP length and the palindrome length of IMP were compared in induction of the IFN-α production of human PBMC. Between The polynucleotides analyzed were: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 12, SEQ ID NO: 27, 5'-TCGTCGAACGTTCGAGATG (SEQ ID NO: 166); 5'-TCGTC GAACGTTCGAGAT (SEQ ID NO: 99); 5'-TCGTCGAACGTTCGAG (SEQ ID NO: 100); 5'-TCGTCGAACGTTC GA (SEQ ID NO: 101); 5'-TCGAACGTTCGAG (SEQ ID NO: 102); 5'-TCGAACGTTCGA (SEQ ID NO: 103); 5'-TCGAACGTTCG (SEQ ID NO: 104); 5'-TCGACGTCGA (SEQ ID NO: 105); 5'-TCGTCGAACGTTCG (SEQ ID NO: 167); 5'-TCGTCGAACGTT (SEQ ID NO: 199); 5'-TCGTTCGAACGTTCGAA (SEQ ID NO: 54 *); 5'-TTC GAACGTTCGAA (SEQ ID NO: 98). PBMC of four donors were stimulated with 0.8, 4.0 or 20 µg / ml of the IMP or controls and the resulting production of IFN-? Was evaluated as described above. The averaged results for the 4 donors at each concentration of IMP are shown in Table 8.

TABLE 8

PBMC assays in humans -IFN-? (Pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

The results presented in Table 8 indicate that, for the polynucleotides analyzed, the minimum total length of the polynucleotide to stimulate the production of IFN-? In human PBMC is approximately 12 bases with a palindrome of approximately 10 bases in length. According to this, in some embodiments in which the production of higher levels of IFN-? is desired, the IMP contains at least one palindromic sequence of at minus the following lengths (in bases): 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 or 30, and, in some embodiments, the IMP contains at least one palindromic sequence with a length greater than 30 bases.

In another trial, the PBMC of three donors were stimulated with 0.8, -4.0 or 20 µg / ml of the IMP or controls. The stimulation of IFN-? production, IFN-? And IFN-? Was evaluated as described before. IFN- \ omega was analyzed using an ELISA kit from PBL Biomedical Laboratories and the limit lower and upper detection of IFN-? it was 48 pg / ml and 6000 pg / ml, respectively. IFN-? Was analyzed using an ELISA kit of BioSource and the lower and upper limit of detection was 12 IU / ml and 3046 IU / ml, respectively. The averaged results for the 3 donors at each IMP concentration are shown in the Table 9

TABLE 9

PBMC assays in humans - IFN-? And IFN-? (pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

As can be seen in Table 9, the IMP of the present invention stimulate the production of IFN- \ omega of human PBMC as well as production of IFN-? In the essay described above, IFN-? Was not detected.

In another essay, double helix shapes of polynucleotides were compared with non-double helix forms in the induction of the IFN-? production of PBMC human. Among the polynucleotides analyzed were: SEQ ID NO: 1, SEQ ID NO: 90, SEQ ID NO: 27, and 5'-TCGTCGAACGTTCGAGATGAT / 5'-ATCATCTCGAACGTTCGACGA (SEQ ID NO: 182 - double helix of SEQ ID NO: 27 and SEQ ID NO: 29). The PBMC from three donors were stimulated with 0.4, 0.8, 4.0 or 20 µg / ml of the IMP or controls and the resulting production of IFN-? Was evaluated as described above. The double helices were compared with simple sequences using the same total dose of polynucleotide (for example, 4 µg / ml of SEQ ID NO: 27 as compared to 4 µg / ml double chain SEQ ID NO: 182 containing 2 µg / ml (SEQ ID NO: 27 and 2 µg / ml SEQ ID NO: 29). The results averaged for the 3 donors to each IMP concentration are shown in Table 10.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

TABLE 10

PBMC assays in humans -IFN-? (Pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

As can be seen in Table 10, SEQ ID NO: 182, the double helix form of SEQ ID NO: 27 is more active than SEQ ID NO: 27 in stimulating the production of IFN-? At lower IMP doses. At doses upper (4 and 20 \ mug / ml), SEQ ID NO: 27 was something else stimulant

In another assay, a polynucleotide containing modified bases and polynucleotides without modified bases are compared in the induction of the production of IFN-? Of human PBMC. Between the analyzed polynucleotides were: SEQ ID NO: 1, SEQ ID NO: 2, 5'-TCGTCGAACGTTCGAGATGAT (SEQ ID NO: 27), and 5'-TCXTCXAACXTTC XAGATGAT (X = 7-deaza-dG, SEQ ID NO: 193). SEQ ID NO: 27 and SEQ ID NO: 193 have the same nucleotide sequence except for deaza-dG substitutions for four dG in SEQ ID NO: 27. PBMCs from four donors were stimulated with 0.8, 4.0 or 20 µg / ml of IMP or controls and production resulting from IFN-? was evaluated as describe before. The results averaged for the 4 donors a Each concentration of IMP is shown in Table 11.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

TABLE 11

PBMC assays in humans -IFN-? (Pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

As can be seen in Table 11, SEQ ID NO: 193 has stimulatory IFN-? Activity comparable to SEQ ID NO: 27 except at the dose of 0.8 µg / ml.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

The single and double chain shapes of polynucleotides containing modified bases were analyzed for detect the activity in the induction of the production of IFN-? Of human PBMC. Between the analyzed polynucleotides were: SEQ ID NO: 1 single chain and double, SEQ ID NO: 2 single chain, SEQ ID NO: 29 chain single, SEQ ID NO: 27 single chain and double chain, SEQ ID NO: 187 single and double chain, SEQ ID NO: 188 single chain and double, SEQ ID NO: 189 single and double chain, SEQ ID NO: 190 single and double chain, SEQ ID NO: 194 single chain, and SEQ ID NO: 197 single chain. SEQ ID NOs: 187, 188, 189, 190, 194 and 197 have the same nucleotide sequence as SEQ ID NO: 27 except for the indicated substitutions:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

PBMC from eight donors were stimulated variously with 0.2, 0.4, 0.8, 1.6, 4.0 or 8 µg / ml of the IMP or controls and the resulting production of IFN-? It was evaluated as described above. The double propellers were compared to simple sequences using the same total dose polynucleotide (for example, 4 µg / ml SEQ ID NO: 27 according to compares with 4 µg / ml SEQ ID NO: 182 double chain which contained 2 µg / ml SEQ ID NO: 27 and 2 µg / ml SEQ ID NO: 29). The averaged results for the 8 donors at each IMP concentration are shown in Table 12.

TABLE 12

PBMC assays in humans -IFN-? (Pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

As can be seen in Table 12, the use of certain modified bases in the IMP can cause polynucleotides that have IFN-α stimulating activity. With the exception of 183, these results also show that the formation of a double helix polynucleotide with the sequence complementary leads to a highly active IMP for the stimulation of IFN-? production, particularly at lower doses. The polynucleotides that could not form double propellers themselves, for example, SEQ ID NO: 189 and SEQ ID NO: 190, induced little IFN-? While than the longest sequences (for example, SEQ ID NO: 172, a 30-grouper with a palindrome of 28 bases) and SEQ ID NO: 182 double helix induced more IFN-? A low doses (e.g. 0.4 and 0.8 µg / ml) than SEQ ID NO: 27 and other IMP with palindromos less than 28 bases in length (as shown in Table 12 and Fig. 1). As discussed in this document, certain modified bases can increase stability of the double propellers formed.

<pre listing-type="other">\ newpage</pre>

Example two

Activation of human B cells by polynucleotides immunomodulators

The ability of IMPs to activate cells Human B was determined by measuring the proliferation of B cells and the IL-6 production in response to incubation with the IMP. Human PBMCs were incubated with CD19 MACS beads (Miltenyi Biotec) and passed through a magnet, separating the CD19 + B cells through positive selection (> 98% CD19 + as determined by FACS). For the essay of proliferation, B cells were grown at 1 x 10 5 / well (5 x 10 5 / ml) in 96-well round bottom plates. The cells incubated in triplicate with IMP at 2 µg / ml or control during 72 hours At the end of the cultivation period, the plates were pressed with 3 H-thymidine (1 µCi / well, Amersham) and they were incubated for another 8 hours. The plates were then collected and radioactive incorporation was determined using techniques of standard liquid scintillation, and the data was presented in accounts per minute (cpm). For the secretion of IL-6, it cultured B cells at 0.5-1 x 10 6 / well in 48-well plates with 5 µg / ml IMP or control for 48 hours, then the culture supernatants were collected and analyzed for IL-6 using ELISA with pairs of CytoSet antibody according to the manufacturer's instructions (BioSource). The maximum / minimum detection limits were 4000/2 pg / ml.

The proliferation test results of B cells presented in Table 13 are the average of the values in cpm of triplicate cell proliferation for cells each donor and the average of the values in cpm for both donors. The results of the B-cell IL-6 assay presented in Table 13 are the amount of IL-6 produced from each donor's cells and the average value of Both donors.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

TABLE 13

Human B cell assays

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

From the results presented in the Table 13, compounds containing CG dinucleotides induced B cell proliferation and production of IL-6 As can be seen from the results presented in Table 9, although the good activity B cell stimulator in immunostimulatory polynucleotides depends on the presence of a CG dinucleotide, does not seem to require the most specialized reasons described in this document for the IFN-? high induction.

In another trial, double forms were compared polynucleotide helix with non-double helix shapes in the B cell activation. Among the polynucleotides analyzed were: SEQ ID NO: 1, SEQ ID NO: 90, SEQ ID NO: 27, and SEQ ID NO: 182 - double helix of SEQ ID NO: 27 and SEQ ID NO: 29. B cells of three donors were stimulated with 1.0 or 5.0 µg / ml IMP or control and the resulting cell proliferation and the production of IL-6 was evaluated as described before. The averaged results for the 3 donors at each concentration of IMP are shown in Table 14.

TABLE 14

Human B cell assays

From the results presented in the Table 14, SEQ ID NO: 182, the double helix shape of SEQ ID NO: 27 is approximately equivalent to SEQ ID NO: 27 in B cells activators as measured by the stimulation of the production of IL-6 and cell proliferation.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Example 3

Immunomodulation of murine cells by polynucleotides immunomodulators

The immunomodulatory polynucleotides or control polynucleotides were analyzed for activity immunomodulatory in mouse splenocytes. Polynucleotides analyzed were phosphorothioate oligodeoxynucleotides completely modified. Among the polynucleotides analyzed were SEQ ID NO: 1 (positive control) and SEQ ID NO: 2 (control negative).

BALB / c mouse spleen fragments were digested with collagenase / dispase (0.1 U / mL / 0.8U / mL) dissolved in solution phosphate buffered saline (PBS) for 45 minutes at 37 ° C, then they dispersed mechanically forcing the passage of the fragments digested through metal meshes. Splenocytes dispersed pellets were made by centrifugation, then resuspended in freshly prepared medium (RPMI 1640 with fetal calf serum at 10%, plus 50 units / mL of penicillin, 50 µg / mL of Streptomycin, 2 mM glutamine and 0.05 mM β-mercaptoethanol).

Mouse splenocytes were dispensed in wells of 96-well plates (7 x 10 7 cells / ml) and incubated for one hour at 37 ° C. 100 µL of sample was added 2x concentration or control assay and the cells were incubated 24 more hours Each test or control sample was analyzed by duplicate. The medium was collected from each well and frozen to -80 ° C before analysis. The collected medium was frozen and analyzed to determine cytokine concentrations by ELISA. Polynucleotides at various concentrations were analyzed including 5.0, 1.0 and 0.1 µg / ml. Among the polynucleotides analyzed were 5'-TGACTGTGAACGTTCGAAATGA (SEQ ID NO: 36) and 5'-TGACTGTGAACGTTCGAAGTGA (SEQ ID NO: 37). The control samples included medium alone and PANSORBIN® removed by heat, and Staphylococcus aureus (SAC) fixed in formalin (CalBiochem).

IL-6 were analyzed, IL-12 and IFN-? Using an ELISA sandwich format Splenocyte assay medium was incubated mouse on microtiter plates coated with anti-IL-6, p40 / p70 anti-IL-12 or monoclonal antibody anti-IFN-? (Nunc). The bound cytokine (IL-6, IL-12 or IFN-?) Was detected using an antibody of biotinylated anti-cytokine (anti-IL-6, anti-IL-12 p40 / p70 or anti IFN- γ) and conjugated secondary antibody of Streptavidin-horseradish peroxidase, se developed with the chromogenic peroxidase substrate 3,3 ', 5,5'-tetramethylbenzidine (TMB) in the presence of peroxidase, and was quantified by measuring absorbance at 450 nm using an Emax precision microplate reader (Molecular Devices). TO IL-6 values less than 45 pg / ml are given assigned a value of 45 pg / ml (i.e. 45 = <45). To the values of IL-12 p40 / p70 under 36 pg / ml were assigned a value of 36 pg / ml (i.e. 36 = <36). To the values of IFN-? Less than 54 pg / ml were assigned a value of 54 pg / ml (ie 54 = <54).

Tables 15 and 16 summarize the results of test for the production of cytokines in response to IMP. The immunomodulatory polynucleotides containing a CG dinucleotide generally stimulated the secretion of IL-6, IL-12 and IFN-? By murine splenocytes regardless of the presence of more specialized reasons described in this document for discharge IFN-? induction.

TABLE 15

Mouse Splenocyte Assay - IL-6 (pg / ml)

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

TABLE 16

Mouse Splenocyte Assay - IL-12 and IFN-?

From the results presented in the Tables 15 and 16, all compounds containing CpG motifs induced the production of splenocyte IL-12 murine and most of compounds, although not all, that contained CpG motives induced the production of IL-6 and IFN-? Splenocytes murine. As can be seen from the results presented in Tables 15 and 16, although stimulating activity of IL-6, IL-12 and IFN-? Of immunostimulatory polynucleotides in murine splenocytes it usually depends on the presence of a CG dinucleotide, the more specialized reasons do not seem to be required described in this document for the high induction of IFN-?

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Example 4

Stimulation of interferon inducible gene expression by immunomodulatory polynucleotides

As demonstrated in this document, the immunomodulatory polynucleotides can induce the production of IFN-? And / or IFN-? Of PBMC IMPs were analyzed to detect activity on PBMC human to induce mRNA expression of other genes of cytokine, chemokine genes and other genes using a technique Quantitative PCR, the TaqMan technique. The polynucleotides analyzed were phosphorothioate oligodeoxynucleotides completely modified. Among the polynucleotides analyzed were SEQ ID NO: 1 (positive control) and SEQ ID NO: 2 (negative control).

Human PMBCs were prepared as described in Example 1. Cells were cultured in the presence of samples of assay (IMP or controls) at 5 µg / ml for 24 hours. RNA Total was extracted using the Qiagen Mini RNeasy Protocol (Qiagen) and became cDNA using oligo dT (Promega), hexamers random (Promega), and SuperScript RT II (InVitrogen). It was diluted cDNA 1:10 and PCR was performed using both master PCR mix SYBR green by QuantiTect (Qiagen) and bare primers (synthesized by Operon) or master PCR mix of QuantiTect probe (Qiagen) and PDAR primers with labeled probe (Applied BioSystems). The reactions were performed using the 5700 sequence detector of GeneAmp (PE BioSystems).

Examples of the sequence for primers synthesized are the following (exposed from 5 'to 3'):

<pre listing-type="other">\ hskip0.5cm</pre> Ubiquitin

IFN-? Were measured, IL-1α, IL-6, IP-10, MCP-3, and MIP-3? Using PDARs supplied by PE BioSystems The threshold cycle (CT) values for each gene are normalized to ubiquitin using the formula 1.8 (UBQ-GEN)} (100,000), where UBQ is C_ {T} average of ubiquitin cycles in triplicate, GEN is the CT average cycles per duplicate of the gene of interest, and 100,000 arbitrarily choose as a factor to carry all values above 0. To the negative control for each experiment, Stimulation with medium alone, is assigned a value of 1 and all the data are expressed as induction times with respect to the control negative.

Table 17 summarizes the test results for cytokine, chemokine and inflammatory protein gene expression of PBMC in response to SEQ ID NO: 27 of IMP. We also analyzed the 5'-GGTGCATCGATG CAGGGGGG polynucleotide (SEQ ID NO: 154). Data are presented as the average times of induction with respect to the control of the medium (given the value of 1.0) with SEM

TABLE 17

Gene expression profile modulated by IMP

As shown in Table 17, SEQ ID NO: 27 strongly increased chemokine expression IP-10, MCP-2, MCP-3, MIG, and MIP-3β. The IL-1α expression decreased in the presence of SEQ ID NO: 27. In addition, SEQ ID NO: 27 markedly increased the 2,5-oligoadenylate synthetase expression (2,5-OAS) of inducible genes from IFN-?, Gene-54K stimulant of interferon (ISG-54K), and binding protein of guanylate 1 (GBP-1).

In these trials, SEQ ID NO: 27 of IMP did not have a significant effect on the expressed mRNA levels of the G-CSF cytokines, IL-1β, IL-6, IL-12 p40, IL-23, TNF-?, Or chemokines BCA-1, IL-8, LPTN, MCP-1, MDC, MIP-1a, MIP-1b, MIP-3a, RANTES, and TARC.

Example 5

Stimulation of the lytic activity of NK cells by immunomodulatory polynucleotides

The IMPs of the present invention stimulate the cytolytic activity of natural cytotoxic lymphocytes (NK) according It is compared to a standard IMP. The cytolytic activity of NK is analyzed through the lysis of K562 target cells. Briefly, the PBMC were stimulated with 10 mg / ml of IMP (optimal dose previously obtained) or negative control polynucleotide for 48 hours in culture. The treated PBMCs were then grown together with K562 tumor target cells loaded with 51 Cr at an interval of effector relationship: target for 4 hours. 51 Cr was measured released under cell lysis by a counter TopCount NXT (Packard) scintillation and was obtained as accounts by minute (cpm).

The results of NK cell stimulation from two different PBMC donors are shown in Fig. 2. The IMP used in the trials were SEQ ID NO: 1, SEQ ID NO: 90, SEQ ID NO: 27, SEQ ID NO: 172 * and SEQ ID NO: 113 *. Palindrome Length in the IMP it is: 28 bases in SEQ ID NO: 172 *, 22 bases in SEQ ID NO: 113 *, 12 bases in SEQ ID NO: 27, and 8 bases in SEQ ID NO: 1. SEQ ID NO: 90, a non-IMP control, has a palindrome length of 20 bases but does not contain a sequence of G-3 ', 5'-C. In this experiment, the IMP with palindromes 12 bases in length or greater stimulated an increasing amount of cytolytic activity of NK as compare with SEQ ID NO: 1 of the standard IMP with a length of 8 base palindrome.

Although the above invention has been described with detail by way of illustration and examples for the purpose of clarity and explanation will be evident to experts in the technique that certain changes can be implemented and modifications. Therefore, descriptions and examples should not understood as limiting the scope of the invention.

56 members in 18 offices

This recordMember, by publication datePriority claim8 more offices are in the list below

Priority claims6

Priority claims
Document	Office	Kind	Date
20020436122P	United States of America	–	2002-12-23
43612202	United States of America	P	2002-12-23
20030447885P	United States of America	–	2003-02-13
44788503	United States of America	P	2003-02-13
20030467546P	United States of America	–	2003-05-01
46754603	United States of America	P	2003-05-01

Members56

Family members, oldest first
Document	Office	Kind
CA2511475A1	Canada	A1	2004-07-15
WO2004058179A2	World Intellectual Property Organization (WIPO)	A2	2004-07-15
AU2003297483A1	Australia	A1	2004-07-22
WO2004058179A3	World Intellectual Property Organization (WIPO)	A3	2004-11-11
KR20050089983A	Republic of Korea	A	2005-09-09
EP1575977A2	European Patent Office (EPO)	A2	2005-09-21
CN1745089A	China	A	2006-03-08
US2006058254A1	United States of America	A1	2006-03-16
JP2006512096A	Japan	A	2006-04-13
EP1575977A4	European Patent Office (EPO)	A4	2006-04-26
NZ541027A	New Zealand	A	2008-04-30
EP1992635A1	European Patent Office (EPO)	A1	2008-11-19
HK1125943A	Hong Kong, China	A	2009-08-21
HK1125943A1	Hong Kong, China	A1	2009-08-21
EP1575977B1	European Patent Office (EPO)	B1	2009-09-09
AT442376T	Austria	T	2009-09-15
ATE442376T1	Austria	T1	2009-09-15
CN100546998C	China	C	2009-10-07
DE60329223D1	Germany	D1	2009-10-22
DK1575977T3	Denmark	T3	2009-11-09
ES2328807T3This record	Spain	T3	2009-11-18
PT1575977E	Portugal	E	2009-12-15
SI1575977T1	Slovenia	T1	2010-01-29
CN101693890A	China	A	2010-04-14
US7745606B2	United States of America	B2	2010-06-29
US2010184834A1	United States of America	A1	2010-07-22
AU2003297483B2	Australia	B2	2010-11-18
SG173219A1	Singapore	A1	2011-08-29
EP1992635B1	European Patent Office (EPO)	B1	2012-02-08
AT544772T	Austria	T	2012-02-15
ATE544772T1	Austria	T1	2012-02-15
DK1992635T3	Denmark	T3	2012-03-05
PT1992635E	Portugal	E	2012-03-20
JP2012070757A	Japan	A	2012-04-12
US8158768B2	United States of America	B2	2012-04-17
KR20120046326A	Republic of Korea	A	2012-05-09
ES2381309T3	Spain	T3	2012-05-25
SI1992635T1	Slovenia	T1	2012-05-31
CN101693890B	China	B	2012-09-05
KR101178816B1	Republic of Korea	B1	2012-09-07
KR20120128729A	Republic of Korea	A	2012-11-27
JP5102959B2	Japan	B2	2012-12-19
US2013142814A1	United States of America	A1	2013-06-06
KR101309501B1	Republic of Korea	B1	2013-09-24
CA2511475C	Canada	C	2013-11-19
CY1109642T1	Cyprus	T1	2014-08-13
US8871732B2	United States of America	B2	2014-10-28
US2015132293A1	United States of America	A1	2015-05-14
CY1112704T1	Cyprus	T1	2016-02-10
US9422564B2	United States of America	B2	2016-08-23
SG2011035342A	Singapore	A	2016-12-29
US2017067055A1	United States of America	A1	2017-03-09
US10196643B2	United States of America	B2	2019-02-05
US2019276829A1	United States of America	A1	2019-09-12
US11312965B2	United States of America	B2	2022-04-26
US2022267772A1	United States of America	A1	2022-08-25

Immunostimulatory sequence oligonucleotides and methods of using the same

Abstract

Term

TABLE 1

TABLE 2

TABLE 3

TABLE 4

TABLE 5

TABLE 6

TABLE 7

TABLE 8

TABLE 9

TABLE 10

TABLE 11

TABLE 12

TABLE 13

TABLE 14

TABLE 15

TABLE 16

TABLE 17

Priority claims6

Members56

Numbers

Titles2

Classification