Glycopyranosyloxypyrazole derivatives and medicinal use thereof

ES 2 319 263 T3

DESCRIPTION

Glucopyranosyloxypyrazole derivatives and their use as drugs.

Technical field

The present invention relates to glucopyranosyloxypyrazole derivatives, their pharmaceutically acceptable salts or their prodrugs that are useful as medicaments, their production intermediates and their pharmaceutical uses.

More specifically, the present invention relates to glucopyranosyloxypyrazole derivatives having an inhibitory activity against human SGLT2, represented by the general formula:

<img file="ES2319263T3_D0001.tif" />

where one of Q and T represents a group represented by the general formula:

<img file="ES2319263T3_D0002.tif" />

while the other represents a lower alkyl group or a halo lower alkyl group; R¹ represents a hydrogen atom, a lower alkyl group, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkyl substituted lower alkyl group or a group represented by the general formula: HO-A¹- where to¹represents a lower alkylene group; R² represents a hydrogen atom, a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a lower haloalkyl group, a halogen atom, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkoxy group, a (lower) alkylidene methyl, a phenyl group that may have 1-3 the same or different groups selected from a halogen atom and a hydroxy group, a 5- or 6-membered aromatic heterocyclic group containing 1-4 the same or different atoms selected from an oxygen atom, a sulfur atom and a nitrogen atom in the ring, or a group represented by the general formula: HO-A²- where to² represents a lower alkylene group; and with the condition that R² does not represent a hydrogen atom, a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a lower haloalkyl group or a halogen atom when R¹ represents a hydrogen atom or a lower alkyl group, or their pharmaceutically acceptable salts and their prodrugs that are useful as agents for the prevention or treatment of a disease such as diabetes, diabetic complications or obesity.

Previous technique

Diabetes is one of the lifestyle-related diseases with a history of eating habits and lack of exercise. Therefore, diet and exercise therapies are performed in patients with diabetes. Furthermore, when its sufficient control and continuous performance are difficult, drug treatment is performed simultaneously. Now, biguanides, sulfonylureas, and insulin sensitivity enhancers have been used as antidiabetic agents. However, biguanides and sulfonylureas occasionally show adverse effects such as lactic acidosis and hypoglycemia, respectively. In case of using insulin sensitivity enhancers, adverse effects such as edema are occasionally observed, and this also has to do with the progression of obesity. Therefore, in order to solve these problems, it has been desired to develop antidiabetic agents having a new mechanism.

In recent years, the development of new type antidiabetic agents has progressed, which promote urinary glucose excretion and a lower blood glucose level by preventing the reabsorption of excess glucose in the kidney (J. Clin. Invest., Vol. 79, pp. 1510-1515 (1987)). Furthermore, it is reported that SGLT2 (Na cotransporter 2⁺ / glucose) is present in the S1 segment of the proximal tubule of the kidney and participates mainly in the reabsorption of filtered glucose through the glomerulus (J. Clin. Invest., Vol. 93, pp. 397-404 (1994)) . Consequently, inhibition of human SGLT2 activity prevents reabsorption of excess glucose in the kidney, subsequently promotes excretion of excess glucose through the urine, and normalizes the level of glucose in the blood. Therefore, the rapid development of antidiabetic agents, having potent activity, has been desired.

ES 2 319 263 T3 inhibitory on human SGLT2 and that they have a new mechanism. Furthermore, since such agents promote the excretion of excess glucose through the urine and the consequent decrease in the accumulation of excess glucose in the body, they are also expected to have an obesity prevention or alleviation effect and a diuretic. Furthermore, the agents are considered to be useful for different related diseases that occur accompanying the progress of diabetes or obesity due to hyperglycemia.

Regarding the compounds having a pyrazole radical, WAY-123783 is reported to increase the amount of glucose excreted in normal mice. However, its effects in humans are not described at all (J. Med. Chem., Vol. 39, pp. 3920-3928 (1996)).

Description of the invention

The present inventors have studied extensively to find compounds that have human SGLT2 inhibitory activity. As a result, they found that the compounds represented by the above general formula (I) show an inhibitory activity of human SGLT2, thus forming the basis of the present invention.

The present invention provides the following glucopyranosyloxypyrazole derivatives, their pharmaceutically acceptable salts and their prodrugs which exert an inhibitory activity of human SGLT2 and show an excellent hypoglycemic effect by excreting excess glucose in the urine through the prevention of glucose reabsorption in the kidney, and its production intermediates, and provides its pharmaceutical uses.

That is, the present invention relates to a glucopyranosyloxypyrazole derivative represented by the general formula:

<img file="ES2319263T3_D0003.tif" />

where one of Q and T represents a group represented by the general formula:

<img file="ES2319263T3_D0004.tif" />

while the other represents a lower alkyl group or a halo lower alkyl group; R¹ represents a hydrogen atom, a lower alkyl group, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkyl substituted lower alkyl group or a group represented by the general formula: HO-A¹ -where to¹ represents a lower alkylene group; R² represents a hydrogen atom, a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a lower haloalkyl group, a halogen atom, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkoxy group, a (lower) alkylidene methyl, a phenyl group that may have 1-3 the same or different groups selected from a halogen atom and a hydroxy group, a 5- or 6-membered aromatic heterocyclic group containing 1-4 the same or different atoms selected from an oxygen atom, a sulfur atom and a nitrogen atom in the ring, or a group represented by the general formula: HO-A²- where to² represents a lower alkylene group; and with the condition that R² does not represent a hydrogen atom, a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a lower haloalkyl group or a halogen atom when R¹ represents a hydrogen atom or a lower alkyl group, their pharmaceutically acceptable salts or their prodrugs where the term "lower alkyl group" means a straight chain or branched alkyl group having 1 to 6 carbon atoms; the term "lower alkoxy group" means a straight or branched chain alkoxy group having 1 to 6 carbon atoms; the term "lower alkylthio group" means a straight or branched chain alkylthio group having 1 to 6 carbon atoms; the term "lower alkylene group" means a straight or branched chain alkylene group having 1 to 6 carbon atoms; the term "lower alkenyl group" means a straight chain or branched alkenyl group having 2 to 6 carbon atoms; the term "cyclic lower alkyl group" means a 3- to 7-membered cyclic alkyl group; the term "cyclic lower alkoxy group" means a 3- to 7-membered cyclic alkoxy group; the term "cyclic lower alkylidene methyl group" means a cyclic 3 to 6 membered alkylidene methyl group; the term "halogen atom" means a fluorine atom, a chlorine atom, a bromine atom or an iodine atom; the term "haloalkyl group

ES 2 319 263 T3 lower "means a straight or branched chain alkyl group having 1 to 6 carbon atoms substituted by 1 to 3 identical or different halogen atoms; and the term "prodrug" means a compound that is converted into a glucopyranyloxypyrazole derivative represented by the general formula (I) as an active form thereof in vivo.

Likewise, the present invention refers to a pharmaceutical composition, a human SGLT2 inhibitor and an agent for the prevention or treatment of a disease associated with hyperglycemia, which comprises as an active ingredient a glucopyraniloxypyrazole derivative represented by the general formula (I) above, a pharmaceutically acceptable salt thereof or a prodrug thereof.

The present invention relates to a use of a glucopyranyloxypyrazole derivative represented by the general formula (I) above, a pharmaceutically acceptable salt thereof or a prodrug thereof for the manufacture of a pharmaceutical composition for the prevention or treatment of a disease associated with hyperglycemia.

The present invention relates to a pharmaceutical combination comprising (A) a glucopyranyloxypyrazole derivative represented by the general formula (I) above, a pharmaceutically acceptable salt thereof or a prodrug thereof, and (B) at least one member selected from the group consisting of an insulin sensitivity enhancer, a glucose uptake inhibitor, a biguanide, an insulin secretion enhancer, an insulin preparation, a glucagon receptor antagonist, an insulin receptor kinase stimulator, a tripeptidyl peptidase II inhibitor, a dipeptidyl peptidase IV inhibitor, a protein tyrosine phosphatase 1B inhibitor, a glycogen phosphorylase inhibitor, an inhibitor glucose-6-phosphatase, a fructose-bisphosphatase inhibitor, a pyruvate dehydrogenase inhibitor, an inhibitor of hepatic gluconeogenesis, Dchyroinositol, a glucogensyntase kinase 3 inhibitor, a glucagon-like peptide 1, a glucagon-like peptide 1 analog, a glucagon-like peptide 1 agonist, amylin, an amylin analog, an amylin agonist, an aldose inhibitor reductase, an inhibitor of advanced glycosylation end-product formation, a protein kinase C inhibitor, a γ-aminobutyric acid receptor antagonist, a sodium channel antagonist, a transcription factor NF-kB inhibitor, a lipid peroxidase inhibitor, an alpha N-acetylated acid dipeptidase inhibitor, insulin-like growth factor I, platelet-derived growth factor, a growth factor analog platelet derivative, epidermal growth factor, nerve growth factor, a carnitine derivative, uridine, 5-hydroxy-1-methylhydantoin, EGB-761, bimoclomol, sulodexide, Y-128, a hydroxymethyl-glutaryl coenzyme A reductase inhibitor, a fibric acid derivative, a β-adrenoceptor agonist₃, an acyl-coenzyme A cholesterol acyltransferase inhibitor, probcol, a thyroid hormone receptor agonist, a cholesterol absorption inhibitor, a lipase inhibitor, a microsomal triglyceride transfer protein inhibitor, a lipoxygenase inhibitor , a carnitine palmitoyl transferase inhibitor, a squalene synthase inhibitor, a low-density lipoprotein receptor enhancer, a nicotinic acid derivative, a bile acid sequestrant, a sodium / bile acid cotransporter inhibitor, a cholesterol ester transfer protein inhibitor, an appetite suppressant, an angiotensin converting enzyme inhibitor, a neutral endopeptidase inhibitor, a angiotensin II receptor antagonist, an endothelin converting enzyme inhibitor, an endothelin receptor antagonist, a diuretic agent, a calcium antagonist, a vasodilator antihypertensive agent, a sympathetic blocking agent, a centrally acting antihypertensive agent, an α-adrenoceptor agonist₂, an antiplatelet agent, a uric acid synthesis inhibitor, a uricosuric agent, and a urinary alkalinizer.

The present invention relates to a use of (A) a glucopyranyloxypyrazole derivative represented by the general formula (I) above, a pharmaceutically acceptable salt thereof or a prodrug thereof, and (B) at least one member selected from the group that consists of an insulin sensitivity enhancer, a glucose uptake inhibitor, a biguanide, an insulin secretion enhancer, an insulin preparation, a glucagon receptor antagonist, an insulin receptor kinase stimulator, a tripeptidyl peptidase II inhibitor, a dipeptidyl peptidase IV inhibitor, a protein tyrosine phosphatase 1B inhibitor, a glycogen phosphorylase inhibitor, a glucose-6-phosphatase inhibitor , a fructose bisphosphatase inhibitor, a pyruvate dehydrogenase inhibitor, an inhibitor of hepatic gluconeogenesis, D-chiroinositol, a glycogeninase kinase 3 inhibitor, a glucagon-like peptide 1, a glucagon-like peptide 1 analog, a glucagon-like peptide 1 agonist, amylin, an amylin analog, an amylin agonist, an aldose reductase inhibitor, an inhibitor of advanced glycosylation end-product formation, a protein kinase C inhibitor, a γ-aminobutyric acid receptor antagonist, a sodium channel antagonist, a transcription factor NF-KB inhibitor, a lipid peroxidase inhibitor, an inhibitor of α N-acetylated-linked acid dipeptidase, insulin-like growth factor type I, platelet-derived growth factor, a platelet-derived growth factor analog, epidermal growth factor, nerve growth factor, a derivative of carnitine, uridine, 5-hydroxy-1-methylhydantoin, EGB-761, bimoclomol, sulodexide, Y-128, a hydroxymethyl-glutaryl coenzyme A reductase inhibitor, a fibric acid derivative, a β adrenoceptor agonist₃, an acyl-coenzyme A cholesterol acyltransferase inhibitor, probcol, a thyroid hormone receptor agonist, a cholesterol absorption inhibitor, a lipase inhibitor, a microsomal triglyceride transfer protein inhibitor, a lipoxygenase inhibitor , a carnitine palmitoyl transferase inhibitor, a squalene synthase inhibitor, a low-density lipoprotein receptor enhancer, a nicotinic acid derivative, a bile acid sequestrant, a sodium / bile acid cotransporter inhibitor, a cholesterol ester transfer protein inhibitor, an appetite suppressant, an angiotensin converting enzyme inhibitor, a neutral endopeptidase inhibitor, a angiotensin II receptor antagonist, an inhibitor of the

ES 2 319 263 T3 endothelin, an endothelin receptor antagonist, a diuretic agent, a calcium antagonist, a vasodilator antihypertensive agent, a sympathetic blocking agent, a centrally acting antihypertensive agent, an α-adrenoceptor agonist₂, an antiplatelet agent, an inhibitor of uric acid synthesis, a uricosuric agent and a urinary alkalinizer, for the manufacture of a pharmaceutical composition for the prevention or treatment of a disease associated with hyperglycemia.

Furthermore, the present invention relates to a glucopyranyloxypyrazole derivative represented by the general formula:

<img file="ES2319263T3_D0005.tif" />

where one of Q² and T² represents a 2,3,4,6-tetra-O-acetyl-BD-glucopyranosyloxy group and the other represents a lower alkyl group or a lower haloalkyl group; R represents a hydrogen atom, a lower alkyl group, a lower alkenyl group, a cyclic lower alkyl group, an acyclic lower alkyl substituted lower alkyl group, or a group represented by the general formula: P^I0'-OA^I- where P¹⁰ represents a hydrogen atom or a hydroxy protecting group; already¹ represents a lower alkylene group; R⁰ represents a hydrogen atom, a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a lower haloalkyl group, a halogen atom, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkoxy group, a (lower) alkylidene methyl, a phenyl group that may have 1-3 the same or different groups selected from a halogen atom and a hydroxy group, a 5- or 6-membered aromatic heterocyclic group containing 1-4 the same or different atoms selected from an oxygen atom, a sulfur atom and a nitrogen atom in the ring, or a group represented by the general formula: P²⁰-OA²- represents a hydrogen atom or a hydroxy protecting group; already² represents a lower alkylene group; and with the condition that R⁰ does not represent a hydrogen atom, a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a lower haloalkyl group or a halogen atom when R represents a hydrogen atom or a lower alkyl group, or a pharmaceutically acceptable salt of the same, where the term "lower alkyl group" means a straight or branched chain alkyl group having 1 to 6 carbon atoms; the term "lower alkoxy group" means a straight or branched chain alkoxy group having 1 to 6 carbon atoms; the term "lower alkylthio group" means a straight or branched chain alkylthio group having 1 to 6 carbon atoms; the term "lower alkylene group" means a straight or branched chain alkylene group having 1 to 6 carbon atoms; the term "lower alkenyl group" means a straight chain or branched alkenyl group having 2 to 6 carbon atoms; the term "cyclic lower alkyl group" means a 3- to 7-membered cyclic alkyl group; the term "cyclic lower alkoxy group" means a 3- to 7-membered cyclic alkoxy group; the term "cyclic lower alkylidene methyl group" means cyclic 3- to 6-membered alkylidene methyl group; the term "halogen atom" means a fluorine atom, a chlorine atom, a bromine atom or an iodine atom; and the term "lower haloalkyl group" means a straight or branched chain alkyl group having 1 to 6 carbon atoms substituted with 1 to 3 the same or different halogen atoms.

The present invention relates to a benzylpyrazole derivative represented by the general formula:

<img file="ES2319263T3_D0006.tif" />

where R⁰⁰ represents a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkoxy group, a methyl (lower) alkylidene group, a phenyl group which may have 1-3 equal or different groups selected from a halogen atom and a hydroxy group, a 5- or 6-membered aromatic heterocyclic group containing 14 equal or different atoms selected from an oxygen atom, a sulfur atom and a nitrogen atom in the ring, or a group represented by the general formula: p²⁰-OA²- where P²⁰ represents a hydrogen atom or a hydroxy protecting group; already² represents a lower alkylene group; R³ represents a lower alkyl group or a halo lower alkyl group, or a pharmaceutically acceptable salt thereof where the term "lower alkyl group" means a straight or branched chain alkyl group having 1 to 6 carbon atoms; the term "lower alkoxy group" means a straight or branched chain alkoxy group having 1 to 6 carbon atoms; the term "lower alkylthio group" means a straight or branched chain alkylthio group having 1 to 6 carbon atoms; the term "lower alkylene group" means a straight chain or branched alkylene group

ES 2 319 263 T3 having 1 to 6 carbon atoms; the term "lower alkenyl group" means a straight chain or branched alkenyl group having 2 to 6 carbon atoms; the term "cyclic lower alkyl group" means a 3- to 7-membered cyclic alkyl group; the term "cyclic lower alkoxy group" means a 3- to 7-membered cyclic alkoxy group; the term "cyclic methyl (lower) alkylidene group" means 3-6 membered cyclic alkylidenemethyl group; the term "halogen atom" means a fluorine atom, a chlorine atom, a bromine atom or an iodine atom; and the term "lower haloalkyl group" means a straight or branched chain alkyl group having 1 to 6 carbon atoms substituted with 1 to 3 the same or different halogen atoms.

As prodrugs of the above-mentioned glucopyranosyloxypyrazole derivatives, a compound represented by the general formula is illustrated:

<img file="ES2319263T3_D0007.tif" />

where one of Q¹ and T¹ represents a group represented by the general formula:

<img file="ES2319263T3_D0008.tif" />

where P represents a hydrogen atom or a group that forms a prodrug; and the other represents a lower alkyl group or a halo lower alkyl group; R¹¹ represents a hydrogen atom, a lower alkyl group, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkyl substituted lower alkyl group, a group forming a prodrug, or a group represented by the general formula: P¹ -OA¹- where P¹ represents a hydrogen atom or a group that forms a prodrug; already¹ represents a lower alkylene group; R¹² represents a hydrogen atom, a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a lower haloalkyl group, a halogen atom, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkoxy group, a (lower) alkylidene methyl, a phenyl group that may have 1-3 the same or different groups selected from a halogen atom and a hydroxy group, a 5- or 6-membered aromatic heterocyclic group containing 1-4 the same or different atoms selected from an oxygen atom, a sulfur atom and a nitrogen atom in the ring, or a group represented by the general formula: P²-OA² where P²represents a hydrogen atom or a group that forms a prodrug; already² represents a lower alkylene group; and with the condition that R¹² does not represent a hydrogen atom, a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a lower haloalkyl group or a halogen atom when at least one of P, R¹¹ and R¹² represents a group that forms a prodrug and R¹¹ represents a hydrogen atom or a lower alkyl group where the term "lower alkyl group" means a straight chain or branched alkyl group having 1 to 6 carbon atoms; the term "lower alkoxy group" means a straight or branched chain alkoxy group having 1 to 6 carbon atoms; the term "lower alkylthio group" means a straight or branched chain alkylthio group having 1 to 6 carbon atoms; the term "lower alkylene group" means a straight or branched chain alkylene group having 1 to 6 carbon atoms; the term "lower alkenyl group" means a straight chain or branched alkenyl group having 2 to 6 carbon atoms; the term "cyclic lower alkyl group" means a 3- to 7-membered cyclic alkyl group; the term "cyclic lower alkoxy group" means a 3- to 7-membered cyclic alkoxy group; the term "cyclic lower alkylidene methyl group" means a cyclic 3 to 6 membered alkylidene methyl group; the term "halogen atom" means a fluorine atom, a chlorine atom, a bromine atom or an iodine atom; the term "lower haloalkyl group" means a straight chain or branched alkyl group having 1 to 6 carbon atoms substituted by 1 to 3 the same or different halogen atoms; and the term "prodrug" means a compound that is converted into a glucopyranyloxypyrazole derivative represented by the general formula (I) as an active form thereof in vivo.

In the present invention, the term "prodrug" means a compound that is converted into a glucopyranyloxypyrazole derivative represented by the general formula (I) above as an active form thereof in vivo. As examples of the prodrug forming groups, in cases where such groups are located on a hydroxy group, a hydroxy protecting group generally used as a prodrug such as a lower acyl group, a lower alkoxy substituted lower acyl group is illustrated. , a lower alkoxycarbonyl substituted lower acyl group, a lower alkoxycarbonyl group and a lower alkoxy substituted lower alkoxycarbonyl group, and in cases where

ES 2 319 263 T3 that such groups are located on a nitrogen atom, an amino protecting group generally used as a prodrug is illustrated such as a lower acyl group, a lower alkoxycarbonyl group, an acyl (lower) oxy group -methyl and a lower alkoxycarbonyloxymethyl group.

In the present invention, the term "lower alkyl group" means a straight chain or branched alkyl group having 1 to 6 carbon atoms such as a methyl group, an ethyl group, a propyl group, an isopropyl group, a group butyl, an isobutyl group, a sec-butyl group, a tert-butyl group, a pentyl group, an isopentyl group, a neopentyl group, a tert-pentyl group, a hexyl group or the like; the term "lower alkoxy group" means a straight or branched chain alkoxy group having 1 to 6 carbon atoms such as a methoxy group, an ethoxy group, a propoxy group, an isopropoxy group, a butoxy group, an isobutoxy group , a secbutoxy group, an eerc-butoxy group, a pentyloxy group, an isopentyloxy group, a neopentyloxy group, an eerc-pentyloxy group, a hexyloxy group or the like; and the term "lower alkylthio group" means a straight chain or branched alkylthio group having 1 to 6 carbon atoms such as a methylthio, an ethylthio group, a propylthio group, an isopropylthio group, a butylthio group, an isobutylthio group, a sec-butylthio group, an eerc-butylthio group, a pentylthio group, an isopentylthio group, a neopentylthio group, an eerc-pentylthio group, a hexylthio group or the like. The term "lower alkylene group" means a straight or branched chain alkylene group having 1 to 6 carbon atoms such as a methylene, an ethylene group, a trimethylene group, a propylene group or the like; the term "lower alkenyl group" means a straight chain or branched alkenyl group having 2 to 6 carbon atoms such as a vinyl group, an allyl group, a 1-propenyl group, an isopropenyl group, a 1-butenyl group , a 2-butenyl group, a 2-methylallyl group, a 2-methyl-1-propenyl group or the like; the term "cyclic lower alkyl group" means a 3 to 7 membered cyclic alkyl group such as a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a cycloheptyl group or the like; the term "cyclic lower alkoxy group" means a 3 to 7 membered cyclic alkoxy group such as a cyclopropyloxy group, a cyclobutyloxy group, a cyclopentyloxy group, a cyclohexyloxy group, a cycloheptyloxy group or the like; and the term "cyclic (lower) alkylidene methyl group" means a cyclic 3-6 membered alkylideneomethyl group such as a cyclopropylidenemethyl group, a cyclobutylidene-methyl group, a cyclopentylidenemethyl group, a cyclohexylidenemethyl group or the like. The term "halogen atom" means a fluorine atom, a chlorine atom, a bromine atom or an iodine atom; and the term "halo lower alkyl group" means the above lower alkyl group substituted with 1 to 3 same or different halogen atoms defined above. The term "lower acyl group" means a straight chain, branched or cyclic acyl group having 2 to 7 carbon atoms such as an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a pivaloyl group, a hexanoyl group, a cyclohexylcarbonyl group or the like; and the term "lower alkoxy substituted lower acyl group" means the above lower acyl group substituted with above lower alkoxy group. The term "lower alkoxycarbonyl group" means a straight chain, branched or cyclic alkoxycarbonyl group having 2 to 7 carbon atoms such as a methoxycarbonyl group, an ethoxycarbonyl group, a propyloxycarbonyl group, an isopropyloxycarbonyl group, a group butyloxycarbonyl, an isobutyloxycarbonyl group, a sec-butyloxycarbonyl group, a tert-butyloxycarbonyl group, a pentyloxycarbonyl group, an isopentyloxycarbonyl group, a neo-pentyloxycarbonyl group, an eerc-pentyloxycarbonyl group, a hexyloxycarbonyl group, and a cyclohexyloxycarbonyl group; the term "lower alkoxycarbonyl substituted lower acyl group" means the above lower acyl group substituted with the above lower alkoxycarbonyl group such as a 3- (ethoxycarbonyl) propionyl group; and the term "lower alkoxycarbonyl group" substituted by lower alkoxy means the above lower alkoxycarbonyl group substituted with the above alkoxy group such as a 2-methoxyethoxycarbonyl group. The term "methyl (lower) acyloxy group" means a hydroxymethyl group O-substituted with the above lower acyl group; and the term "lower alkoxycarbonyloxymethyl group" means a hydroxymethyl group O-substituted with the above lower alkoxycarbonyl group. The term "5- or 6-membered aromatic heterocyclic group containing 1-4 identical or different atoms selected from an oxygen atom, a sulfur atom and a nitrogen atom in the ring" means a univalent group derived from such an aromatic heterocycle such as furan, thiophene, pyrrole, oxazole, isoxazole, thiazole, isothiazole, pyrazole, imidazole, furazan, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, triazine or the like. The term "hydroxy protecting group" means a hydroxy protecting group used in general organic synthesis such as a benzyl group, a methoxymethyl group, an acetyl group or the like.

ES 2 319 263 T3

The glucopyranosyloxypyrazole derivatives represented by the above general formula (I) of the present invention and their prodrugs can be prepared according to the following procedure:

Procedure 1

<img file="ES2319263T3_D0009.tif" />

(V)

R³Car₂COOR (VI)

<img file="ES2319263T3_D0010.tif" />

Procedure 3

<img file="ES2319263T3_D0011.tif" />

<img file="ES2319263T3_D0012.tif" />

I) (optionally) R^s-x (X)

2) (Optionally) Check Out

Procedure 4-2

Procedure 5-1

Aceiobromo-a D-Clucose

<img file="ES2319263T3_D0013.tif" />

Procedure 4-1

1) Hydrolysis

2) (Optionally) Check Out

<img file="ES2319263T3_D0014.tif" />

|) Hydrolysis

2) (Optionally) Check Out

<img file="ES2319263T3_D0015.tif" />

<img file="ES2319263T3_D0016.tif" />

Vulnerability

Procedure 6

Transformation into drug π

Prodrug of the glucopyranosyloxypyrazole derivative represented by the above general formula (I) where X and Y represent a removable group such as a halogen atom, a mesyloxy group or a tosyloxy group; R³ represents a lower alkyl group or a lower haloalkyl group; R⁴ represents a methyl group or an ethyl group; R⁵ represents a lower alkyl group, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkyl substituted lower alkyl group or a group represented by the general formula: P¹⁰-OA¹ - where P¹⁰ already¹ they have the same meanings that have been defined before; and R, R⁰, R¹, R², Q, Q², T and T² they have the same meanings that have been defined before.

Procedure 1

A compound represented by the above general formula (VII) can be prepared by condensing a benzyl derivative represented by the above general formula (V) with a ketoacetate represented by the above general formula (VI) in the presence of a base such as sodium hydride or Potassium eerc-butoxide in an inert solvent. As for the inert solvent used in the reaction, 1,2-dimethoxyethane, tetrahydrofuran, N, N-dimethylformamide, a mixed solvent thereof and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, its variation being based on the starting material, the solvent and the reaction temperature used.

ES 2 319 263 T3

Procedure 2

A benzylpyrazole derivative represented by the above general formula (IV) of the present invention can be prepared by condensing a compound represented by the above general formula (VII) with hydrazine or hydrazine monohydrate in an inert solvent. As for the inert solvent used in the reaction, toluene, tetrahydrofuran, chloroform, a mixed solvent thereof, and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, its variation being based on the starting material, the solvent and the reaction temperature used. The obtained pyrazolone derivative represented by the above general formula (IV) can also be used in process 3 after converting it into a salt thereof in the usual way.

Procedure 3

1) In the case of benzylpyrazole derivatives represented by the above general formula (IV) where R³ is a lower alkyl group, a group corresponding to the compound represented by the above general formula (VIII) can be prepared by subjecting a corresponding benzylpyrazole derivative represented by the above general formula (IV) to glycosylation using acetobromo-aD-glucose in the presence of a base such as silver carbonate in an inert solvent. As for the solvent used in the glycosylation reaction, tetrahydrofuran and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, its variation being based on the starting material, the solvent and the reaction temperature used.

2) In the case of benzylpyrazole derivatives represented by the above general formula (IV) where R³ is a lower haloalkyl group, a group corresponding to the compound represented by the above general formula (VIII) can be prepared by subjecting a corresponding benzylpyrazole derivative represented by the above general formula (IV) to glycosylation using acetobromo-αD-glucose in the presence of a base such as potassium carbonate in an inert solvent. As for the solvent used in the glycosylation reaction, acetonitrile, tetrahydrofuran and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, its variation being based on the starting material, the solvent and the reaction temperature used.

In the compounds represented by the above general formula (IV) of the present invention as starting substances, the following three tautomers may exist, their variation being based on the change of the reaction conditions. The compounds represented by the above general formula (IV) of the present invention include all the compounds described as follows:

<img file="ES2319263T3_D0017.tif" />

where R⁰ and R³ they have the same meanings that have been defined before.

Procedure 4-1

A glucopyranosyloxypyrazole derivative represented by the above general formula (IX) can be prepared by subjecting a compound represented by the above general formula (VIII) to alkaline hydrolysis and optionally removal of a hydroxy protecting group in the usual manner. Regarding the solvent used in hydrolysis

ES 2 319 263 T3 alkaline, methanol, ethanol, tetrahydrofuran, water, a solvent mixture thereof and the like can be illustrated, and as for the base used, sodium hydroxide, sodium methoxide, sodium ethoxide and Similar. The reaction temperature is usually from 0 ° C to room temperature, and the reaction time is usually from 30 minutes to 6 hours, its variation being based on the starting material, the solvent and the reaction temperature used.

Procedure 4-2

A glucopyranosyloxypyrazole derivative represented by the above general formula (I) of the present invention can be prepared by subjecting a compound represented by the above general formula (III) to alkaline hydrolysis and optionally removal of a hydroxy protecting group in the usual way. As for the solvent used in the hydrolysis reaction, methanol, ethanol, tetrahydrofuran, water, a solvent mixture thereof and the like can be illustrated, and as for the base, sodium hydroxide, sodium methoxide, ethoxide can be illustrated. sodium and the like. The reaction temperature is usually 0 ° C to room temperature, and the reaction time is usually 30 minutes to 6 hours, its variation being based on the starting material, the solvent and the reaction temperature used.

Procedure 5-1

A compound represented by the above general formula (III) of the present invention can be prepared by subjecting a glucopyranyloxypyrazole derivative represented by the above general formula (VIII) to N-alkylation optionally using an N-alkylating agent represented by the above general formula ( X) in the presence of a base such as potassium carbonate or cesium carbonate in an inert solvent, and optionally deprotected in the usual way. As for the inert solvent used in N-alkylation, acetonitrile, N, N-dimethylformamide, tetrahydrofuran, a mixed solvent thereof, and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 30 minutes to 1 day, its variation being based on the starting material, the solvent and the reaction temperature used. The obtained compound represented by the above general formula (III) can also be used in the procedure 4-2 after converting it into a salt thereof in the usual way.

Procedure 5-2

A compound represented by the above general formula (I) of the present invention can be prepared by subjecting a glucopyranyloxypyrazole derivative represented by the above general formula (IX) to N-alkylation optionally using an N-alkylating agent represented by the above general formula ( X) in the presence of a base such as potassium carbonate or cesium carbonate, and occasionally a catalytic amount of sodium iodide in an inert solvent, and optionally deprotection in the usual manner. As for the inert solvent used in the N-alkylation, N, N-dimethylformamide, 1,2-dimethoxyethane, dimethylsulfoxide, tetrahydrofuran, ethanol, a mixed solvent thereof and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 10 minutes to 1 day, its variation being based on the starting material, the solvent and the reaction temperature used.

Procedure 6

A prodrug of a glucopyranyloxypyrazole derivative represented by the general formula (I) above (including a prodrug represented by the above general formula (II)) can be prepared by introducing hydroxy and / or amino protecting groups generally capable of being used in a prodrug on a hydroxy group and / or a nitrogen atom of a glucopyranyloxypyrazole derivative represented by the above general formula (II) in the usual way.

ES 2 319 263 T3

For example, the transformation reaction into a prodrug in procedure 6 above can be performed according to the following procedure or analogous procedures:

Procedure 7 (In case R¹ be a hydrogen atom)

<img file="ES2319263T3_D0018.tif" />

a protecting group) Deprotection

<img file="ES2319263T3_D0019.tif" />

(XIV) a hydrogen atom)

FACT

Procedure 15 (In case Ρ ^ θ is / are a benzyloxycarbonyl group or groups Deprotection where P⁰ represents a hydroxy protecting group such as a lower acyl group, a lower alkoxy substituted lower acyl group, a lower alkoxy (lower) alkoxy carbonyl substituted acyl group, a lower alkoxy carbonyl group, a lower alkoxycarbonyl group substituted with lower alkoxy or a benzyloxycarbonyl group; P⁶ represents a lower acyl group; P⁷ represents a lower alkoxycarbonyl group; P⁸ represents a lower acyl group or a lower alkoxycarbonyl group; R⁶ represents a lower acyl group or a lower alkoxycarbonyl group; R⁷represents a lower acyl oxymethyl group or a lower alkoxycarbonyloxymethyl group; R⁸ represents a lower alkyl group, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkyl substituted lower alkyl group, a lower acyl group, a lower alkoxy substituted lower acyl group, a lower alkoxy substituted lower acyl group (lower ) -carbonyl, a lower alkoxycarbonyl group, a lower alkoxy substituted lower alkoxycarbonyl group, a benzyloxycarbonyl group, or a group represented by the general formula: P²¹ -OA¹ - where P²¹ represents a hydrogen atom or a hydroxy protecting group such as a lower acyl group, a lower alkoxy substituted lower acyl group, a lower alkoxy (lower) carbonyl substituted acyl group, a lower alkoxy carbonyl group, an alkoxy group (lower) -carbonyl substituted with lower alkoxy or a benzyloxycarbonyl group; already¹ represents a lower alkylene group; X¹ and X² they represent a removable group such as a bromine atom or a chlorine atom; one of Q³ and T³ represents a group represented by the general formula:

ES 2 319 263 T3

<img file="ES2319263T3_D0020.tif" />

where P²⁰ represents a hydrogen atom, a lower acyl group or a (lower) alkoxycarbonyl group; and the other represents a lower alkyl group or a lower haloacyl group; R³² represents a hydrogen atom, a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a lower haloalkyl group, a halogen atom, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkoxy group, a (lower) alkylidene methyl, or a phenyl group that may have 1-3 the same or different groups selected from a halogen atom and a hydroxy group, a 5- or 6-membered aromatic heterocyclic group containing 1-4 the same or different atoms selected from an oxygen atom, a sulfur atom and a nitrogen atom in the ring, or a group represented by the general formula: P²²-OA²- where P²² represents a hydrogen atom, a lower acyl group or a (lower) alkoxycarbonyl group; already² represents a lower alkylene group; and with the condition that at least one of P²⁰ And p²² represents a lower acyl group or a (lower) alkoxycarbonyl group and one of Q⁴ and T⁴represents a group represented by the general formula:

<img file="ES2319263T3_D0021.tif" />

where P³⁰ represents a hydrogen atom or a hydroxy protecting group such as a lower acyl group, a lower alkoxy substituted lower acyl group, a lower alkoxycarbonyl substituted lower acyl group, a lower alkoxycarbonyl group, a lower alkoxycarbonyl substituted with lower alkoxy or a benzyloxycarbonyl group; and the other represents a lower alkyl group or a halo lower alkyl group; R⁴² represents a hydrogen atom, a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a lower haloalkyl group, a halogen atom, a lower alkenyl group, a cyclic lower alkyl group, a cyclic lower alkoxy group, a (lower) alkylidene methyl, or a phenyl group that may have 1-3 the same or different groups selected from a halogen atom and a hydroxy group, a 5- or 6-membered aromatic heterocyclic group containing 14 equal or different atoms selected from an oxygen atom, a sulfur atom and a nitrogen atom in the ring, or a group represented by the general formula: P³²-OA²- where P³² represents a hydrogen atom or a hydroxy protecting group such as a lower acyl group, a lower alkoxy substituted lower acyl group, a lower alkoxycarbonyl substituted lower acyl group, a lower alkoxycarbonyl group, an alkoxy group (lower) -carbonyl substituted with lower alkoxy or a benzyloxycarbonyl group; already² represents a lower alkylene group; and with the condition that at least one of P²¹, P³⁰ And p³² represents a hydroxy protecting group such as a lower acyl group, a lower alkoxy substituted lower acyl group, a lower alkoxy (lower) alkoxy carbonyl substituted acyl group, a lower alkoxy carbonyl group, a lower alkoxycarbonyl group substituted with lower alkoxy or a benzyloxycarbonyl group; and R¹, R², Q and T have the same meanings as defined above.

Procedure 7

A prodrug represented by the above general formula (IIa) can be prepared by protecting a nitrogen atom of a glucopyranyloxypyrazole derivative represented by the above general formula (I) with an aliphatic acid anhydride represented by the above general formula (XI) in a aliphatic acid such as acetic acid usually at 0 ° C to reflux temperature usually for 30 minutes to 1 day, or alternatively, with a succinimide derivative represented by the above general formula (XII) in an inert solvent such as tetrahydrofuran usually at room temperature to reflux temperature for 1 hour to 1 day. The reaction time can be appropriately varied based on the starting material, the solvent and the reaction temperature used.

Procedure 8

A compound represented by the above general formula (XIII) can be prepared by introducing a hydroxymethyl group to a nitrogen atom of a glucopyranyloxypyrazole derivative represented by the above general formula (I) using formaldehyde in various solvents. As for the solvent used in the reaction, water, methanol, ethanol, tetrahydrofuran, dichloromethane, ethyl acetate, N, N-dimethylformamide, acetonitrile, a solvent mixture thereof and the like can be illustrated. The reaction temperature is usually from 0 ° C to the reflux temperature, and the reaction time is usually from 30 minutes to 1 day, its variation being based on the starting material, the solvent and the reaction temperature used.

ES 2 319 263 T3

Procedure 9

A prodrug represented by the above general formula (IIb) can be prepared by protecting the hydroxymethyl group of a compound represented by the above general formula (XIII) with a protective reagent represented by the above general formula (XIV) in the presence of such a base such as pyridine, triethylamine, N, N-diisopropylethylamine, picoline, lutidine, collidine, quinuclidine, 1,2,2,6,6-pentamethylpiperidine or 1,4-diazabicyclo [2,2,2] octane in an inert solvent or without solvent. As for the inert solvent used in the reaction, dichloromethane, acetonitrile, ethyl acetate, diisopropyl ether, chloroform, tetrahydrofuran, 1,2-dimethoxyethane, 1,4-dioxane, acetone, tert-butanol, a solvent mixture of the same and similar. The reaction temperature is usually -40 ° C to the reflux temperature, and the reaction time is usually 30 minutes to 2 days, its variation being based on the starting material, the solvent and the reaction temperature used.

Procedure 10

A prodrug represented by the above general formula (IIc) or an analogue thereof can be prepared by protecting a nitrogen atom and / or a hydroxy group of a glucopyranyloxypyrazole derivative represented by the above general formula (I) with a protecting reagent represented by the above general formula (XV) in the presence of a base such as pyridine, triethylamine, N, N-diisopropylethylamine, picoline, lutidine, collidine, quinuclidine, 1,2,2,6,6-pentamethylpiperidine or 1,4-diazabicyclo [2,2,2] -octane in an inert solvent or without solvent. As for the inert solvent used in the reaction, dichloromethane, acetonitrile, ethyl acetate, diisopropyl ether, chloroform, tetrahydrofuran, 1,2-dimethoxyethane, 1,4-dioxane, acetone, tert-butanol, a solvent mixture of the same and similar. The reaction temperature is usually -40 ° C to the reflux temperature, and the reaction time is usually 30 minutes to 2 days, its variation being based on the starting material, the solvent and the reaction temperature used.

Procedure 11

A prodrug represented by the above general formula (IId) or an analogue thereof can be prepared by subjecting a compound represented by the above general formula (IIc) to deacylation in the presence of a weak base such as sodium hydrogen carbonate, sodium carbonate or potassium carbonate in an alcoholic solvent such as methanol or ethanol. The reaction temperature is usually 0 ° C to the reflux temperature, and the reaction time is usually 15 minutes to 1 day, its variation being based on the starting material, the solvent and the reaction temperature used.

Procedure 12

A prodrug represented by the above general formula (IIe) or an analogue thereof can be prepared by protecting a nitrogen atom of a compound represented by the above general formula (IId) with an aliphatic acid anhydride represented by the above general formula ( XI) in an aliphatic acid such as acetic acid usually at 0 ° C to reflux temperature usually for 30 minutes to 1 day, or alternatively, with a succinimide derivative represented by the above general formula (XII) in an inert solvent such as tetrahydrofuran usually from room temperature to reflux temperature for 1 hour to 1 day, and additionally alternatively, with a protection reagent represented by above general formula (XIV) in the presence of a base such as pyridine, triethylamine, N, N-diisopropylethylamine, picoline, lutidine, collidine, quinuclidine, 1,2,2,6,6-pentamethylpiperidine or 1,4-diazabicyclo [2,2,2] octane in an inert solvent such as dichloromethane, acetonitrile, ethyl acetate, diisopropyl ether, chloroform, tetrahydrofuran, 1,2- dimethoxyethane, 1,4-dioxane, acetone, tert-butanol or a solvent mixture thereof, or without solvent usually at -40 ° C to reflux temperature for 30 minutes to 2 days. The reaction time can be appropriately varied based on the starting material, the solvent and the reaction temperature used.

Procedure 13

A compound represented by the above general formula (XVI) can be prepared by introducing a hydroxymethyl group to a nitrogen atom of a compound represented by the above general formula (IId) using formaldehyde in various solvents. As for the solvent used in the reaction, water, methanol, ethanol, tetrahydrofuran, dichloromethane, ethyl acetate, N, N-dimethylformamide, acetonitrile, a solvent mixture thereof and the like can be illustrated. The reaction temperature is usually 0 ° C to the reflux temperature, and the reaction time is usually 30 minutes to 1 day, its variation being based on the starting material, the solvent and the reaction temperature used.

ES 2 319 263 T3

Procedure 14

A prodrug represented by the above general formula (IIf) or an analogue thereof can be prepared by protecting a hydroxymethyl group of a compound represented by the above general formula (XVI) with a protection reagent represented by the above general formula (XIV) in the presence of a base such as pyridine, triethylamine, N, N-diisopropylethylamine, picoline, lutidine, collidine, quinuclidine, 1,2,2,6,6-pentamethylpiperidine or 1,4-diazabicyclo [2,2,2] octane in an inert solvent or without solvent. As for the inert solvent used in the reaction, dichloromethane, acetonitrile, ethyl acetate, diisopropyl ether, chloroform, tetrahydrofuran, 1,2-dimethoxyethane, 1,4-dioxane, acetone, tert-butanol, a mixed solvent of the same and similar. The reaction temperature is usually -40 ° C to the reflux temperature, and the reaction time is usually 30 minutes to 2 days, its variation being based on the starting material, the solvent and the reaction temperature used.

Procedure 15

A prodrug represented by the above general formula (II g) can be prepared by subjecting a compound represented by the above general formula (IIf) to deprotection in the presence of a palladium catalyst such as palladium-carbon powder in an inert solvent. As for the inert solvent used in the reaction, methanol, ethanol, tetrahydrofuran, ethyl acetate, a mixed solvent thereof, and the like can be illustrated. The reaction temperature is usually from 0 ° C to the reflux temperature, and the reaction time is usually from 30 minutes to 1 day, its variation being based on the starting material, the solvent and the reaction temperature employed.

Of the compounds represented by the above general formula (III), the following compounds where R⁰ is a phenyl group that can have 1-3 equal or different groups selected from a halogen atom and a hydroxy group, or a 5- or 6-membered aromatic heterocyclic group that contains 1-4 equal or different atoms selected from an oxygen atom , a sulfur atom and a nitrogen atom in the ring can also be prepared according to the following procedure:

<img file="ES2319263T3_D0022.tif" />

where R¹⁰ represents a phenyl group that can have 1-3 equal or different groups selected from a halogen atom and a hydroxy group, or a 5- or 6-membered aromatic heterocyclic group that contains 1-4 equal or different atoms selected from an oxygen atom , a sulfur atom and a nitrogen atom in the ring; Y¹represents a removable group such as a chlorine atom, a bromine atom or an iodine atom; and R, Q² and T²they have the same meanings that have been defined before.

Procedure 16

A compound represented by the above general formula (IIIa) can be prepared by subjecting a glucopyranyloxypyrazole derivative represented by the above general formula (XVII) which can be prepared using the corresponding starting material in a similar manner to procedures 1 to 3 above and 5-1 to a Suzuki coupling reaction using a borate compound represented by the above general formula (XVIII) in the presence of a base such as cesium fluoride, sodium carbonate, potassium carbonate, and potassium tert-butoxide, and a metal catalyst such as tetrakis (triphenylphosphine) palladium (0), bis (dibenzylideneacetone) palladium (0), bis (triphenylphosphine) palladium (II) dichloride in various solvents. As for the solvent used in the reaction, 1,2-dimethoxyethane, toluene, ethanol, water, a mixed solvent thereof, and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, its variation being based on the starting material, the solvent and the reaction temperature used.

The glucopyranosyloxypyrazole derivatives represented by the above general formula (I) and the prodrugs of the present invention obtained by the above production procedures can be isolated and purified by conventional separation methods such as fractional recrystallization, purification using chromatography, solvent extraction and solid phase extraction. Procedures for isolation or purification

ES 2 319 263 T3 can occasionally be carried out in any production process of the glucopyranosyloxypyrazole derivatives represented by the above general formula (I) and their prodrugs.

The glucopyranosyloxypyrazole derivatives represented by the above general formula (I) of the present invention and their prodrugs can be converted into their pharmaceutically acceptable salts in the usual way. Examples of such salts include acid addition salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid and the like, acid addition salts with organic acids such as formic acid, acid acetic, adipic acid, citric acid, fumaric acid, maleic acid, oleic acid, lactic acid, stearic acid, succinic acid, tartaric acid, propionic acid, butyric acid, oxalic acid, malonic acid, malic acid, carbonic acid, glutamic acid, aspartic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid and the like, acid salts with organic amines such as 2-aminoethanol, piperidine, morpholine, pyrrolidine and the like, and salts with inorganic bases such as a sodium salt, a potassium salt, a calcium salt, a magnesium salt, and the like.

The glucopyranosyloxypyrazole derivatives represented by the above general formula (I) of the present invention and their prodrugs include their solvates with pharmaceutically acceptable solvents such as ethanol and water.

Among the glucopyranosyloxypyrazole derivatives represented by the above general formula (I) of the present invention and their prodrugs, there are two geometric isomers in each compound having an unsaturated bond. In the present invention, any of the cis (Z) isomer or transiE) isomer can be employed.

Among the glucopyranosyloxypyrazole derivatives represented by the above general formula (I) of the present invention and its prodrugs, there are two optical isomers, the R isomer and the S isomer, in each compound having an asymmetric carbon atom excluding the glucopyranosyloxy radical. In the present invention, either the R isomer or the S isomer can be used, and a mixture of both isomers can also be used.

The glucopyranosyloxypyrazole derivatives represented by the above general formula (I) of the present invention and their prodrugs show excellent human SGLT2 inhibitory activity. On the other hand, since WAY-123783 has extremely weak human SGLT2 inhibitory activity, it cannot be expected to exert a sufficient effect as a human SGLT2 inhibitor. Therefore, the represented glucopyranosyloxypyrazole derivatives of the present invention and their prodrugs are extremely useful as drugs for the prevention or treatment of a disease associated with hyperglycemia such as diabetes, diabetic complications (e.g. g., retinopathy, neuropathy, nephropathy, ulcer, macroangiopathy), obesity, hyperinsulinemia, glucose metabolism disorder, hyperlipidaemia, hypercholesterolemia, hypertriglyceridaemia, lipid metabolism disorder, atherosclerosis, hypertension, congestive heart failure, edema, hyperuricaemia, gout or similar.

Furthermore, the compounds of the present invention can be suitably used in combination with at least one member selected from drugs other than SGLT2 inhibitors. Examples of drugs that can be used in combination with the compounds of the present invention include an insulin sensitivity enhancer, a glucose uptake inhibitor, a biguanide, an insulin secretion enhancer, an insulin preparation. , a glucagon receptor antagonist, an insulin receptor kinase stimulator, a tripeptidyl peptidase II inhibitor, a dipeptidyl peptidase IV inhibitor, a protein tyrosine phosphatase 1B inhibitor, a glycogen phosphorylase inhibitor, a glucose-6-phosphatase inhibitor, a fructose-bisphosphatase inhibitor, a pyruvate dehydrogenase inhibitor, an inhibitor of hepatic gluconeogenesis, Dchyroinositol, a glucogensyntase kinase 3 inhibitor, a glucagon-like peptide 1, a glucagon-like peptide 1 analog, a glucagon-like peptide 1 agonist, amylin, an amylin analog, an amylin agonist, an aldose reductase inhibitor, an inhibitor of advanced glycosylation end-product formation, a protein kinase C inhibitor, a γ-aminobutyric acid receptor antagonist, a sodium channel antagonist, a factor inhibitor NF-κΒ transcription, a lipid peroxidase inhibitor, an α N-acetylated acid dipeptidase inhibitor, insulin-like growth factor type I, platelet-derived growth factor (PDGF), a platelet-derived growth factor (PDGF) analog (e.g. e.g. PDGF-AA, PDGFBB, PDGF-AB), epidermal growth factor (EGF), nerve growth factor, a carnitine derivative, uridine, 5-hydroxy-1-methylhydantoin, EGB-761, bimoclomol, sulodexide, Y-128, a hydroxymethylglutaryl coenzyme A reductase inhibitor, a fibric acid derivative, a / -b adrenoceptor antagonist, an acyl-coenzyme A cholesterol acyltransferase inhibitor, probcol, a thyroid hormone receptor agonist, a cholesterol absorption inhibitor, a lipase inhibitor, a microsomal triglyceride transfer protein inhibitor, a lipoxygenase inhibitor, a carnitine palmitoyltransferase inhibitor, a squalene synthase inhibitor, a lipoprotein receptor enhancer low density, a nicotinic acid derivative, a bile acid sequestrant, a sodium / bile acid cotransporter inhibitor, a cholesterol ester transfer protein inhibitor, an appetite suppressant, an angiotensin converting enzyme inhibitor, a neutral endopeptidase inhibitor, an angiotensin II receptor antagonist, an endothelin converting enzyme inhibitor, an endothelin receptor antagonist, a diuretic agent, a calcium antagonist, a vasodilator antihypertensive agent, a sympathetic blocking agent, a centrally acting antihypertensive agent, an α2-adrenoceptor agonist, an antiplatelet agent, an inhibitor of uric acid synthesis, a uricosuric agent, and a urinary alkalinizer.

In the case of the uses of the compound of the present invention in combination with one or more of the above drugs, the present invention includes either the dosage forms of simultaneous administration in the form of a single

ES 2 319 263 T3 preparation or separate preparations by the same or different route of administration, and administration at different dosage ranges as separate preparations by the same or different route of administration. A pharmaceutical combination comprising the compound of the present invention and one or more of the above drugs includes both the dosage forms as a single preparation and separate preparations for combining as mentioned above.

The compounds of the present invention can obtain more advantageous effects than additive effects in the prevention or treatment of the above diseases when properly used in combination with the above drugs. Likewise, the dose of administration can be decreased compared to the administration of any drug alone, or the adverse effects of the simultaneous administration of drugs other than SGLT2 inhibitors can be avoided or lowered.

The particular compounds as regards the above drugs used to combine them and the preferable diseases to be treated are exemplified below. However, the present invention is not limited thereto, and for example, concrete compounds include their free compounds, and their pharmaceutically acceptable or other salts.

As enhancers of insulin sensitivity, peroxisome proliferator-activated receptor γ agonists such as troglitazone, pioglitazone hydrochloride, rosiglitazone maleate, darglitazone sodium, GI-262570, isaglitazone, LG-100641, NC-2100 can be illustrated. , T-174, DRF-2189, CLX-0921, CS-011, GW-1929, ciglitazone, englitazone sodium and NIP-221, peroxisome proliferator activated receptor α agonists such as GW-9578 and BM-170744, peroxisome proliferator activated receptor α / γ agonists such as GW409544, KRP-297, NN-622, CLX-0940, LR-90, SB-219994, DRF-4158 and DRF-MDX8, retinoid X receptor agonists such such as ALRT-268, AGN-4204, MX-6054, AGN-194204, LG-100754 and bexarotene, and other insulin sensitivity enhancers such as reglixane, OnO-5816, MBX-102, CRE-1625, FK- 614, CLX-0901, CRE1633, NN-2344, BM-13125, BM-501050, HQL-975, CLX-0900, MBX-668, MBX-675, S-15261, GW-544, AZ-242, LY-510929, AR-H049020 and GW-501516. Insulin sensitivity enhancers are preferably used for diabetes, diabetic complications, obesity, hyperinsulinemia, glucose metabolism disorders , hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, lipid metabolism disorders or atherosclerosis , and more preferably for diabetes, hyperinsulinemia or glucose metabolism disorders due to enhanced impaired insulin signal transduction in peripheral tissues and increased tissue glucose uptake from the blood, leading to decreased level blood glucose.

As glucose uptake inhibitors, α-glucosidase inhibitors such as acarbose, voglibose, miglitol, CKD-711, emiglitate, MDL-25,637, camiglibose and MDL-73,945, and α-amylase inhibitors such as AZM are illustrated. -127. Inhibitors of glucose uptake are preferably used for diabetes, diabetic complications, obesity, hyperinsulinemia or disorders of glucose metabolism, and more preferably for diabetes or disorders of glucose metabolism due to inhibition of the gastrointestinal enzymatic digestion of carbohydrates contained in food, and the inhibition or delay of glucose absorption in the body.

As biguanides, phenformin, buformin hydrochloride, metformin hydrochloride and the like are illustrated. Biguanides are preferably used for diabetes, diabetic complications, hyperinsulinemia or glucose metabolism disorders, and more preferably for diabetes, hyperinsulinemia or glucose metabolism disorders due to decreased blood glucose level. due to the inhibitory effects of hepatic gluconeogenesis, the accelerating effects of anaerobic glycolysis in tissues or the enhancing effects of insulin resistance in peripheral tissues.

As insulin secretion enhancers, tolbutamide, chlorpropamide, tolazamide, acetohexamide, glylopyramide, glyburide (glibenclamide), gliclazide, 1-butyl-3-methanilyl-urea, carbutamide, glyburinuride, glipidizona, glyburidene, glipidizide, glyburide, glipidizona, are illustrated , glyhexamide, glimidine sodium, glipinamide, fenbutamide, tolcyclamide, glimepiride, nateglinide, mitiglinide calcium hydrate, repaglinide, and the like. Insulin secretion enhancers are preferably used for diabetes, diabetic complications or disorders of glucose metabolism, and more preferably for diabetes or disorders of glucose metabolism due to lowering of the blood glucose level. by acting on pancreatic β cells and increasing insulin secretion.

As insulin preparations, human insulin, human insulin analogs, insulin from undernourished animals and the like are illustrated. Insulin preparations are preferably used for diabetes, diabetic complications or glucose metabolism disorders, and more preferably for diabetes or glucose metabolism disorders.

As glucagon receptor antagonists, BAY-27-9955, NNC-92-1687 and the like are illustrated; as insulin receptor kinase stimulators, TER-17411, L-783281, KRX-613 and the like are illustrated; as tripeptidyl peptidase II inhibitors, UCL-1397 and the like are illustrated; as inhibitors of dipeptidyl peptidase IV, NVP-DPP728A, TSL-225, P-32/98 and the like are illustrated; as protein tyrosine phosphatase 1B inhibitors, PTP-112, OC-86839, PNU-177496 and the like are illustrated; as glycogen phosphorylase inhibitors, NN-4201 is illustrated,

ES 2 319 263 T3

CP-368296 and the like; as fructose bisphosphatase inhibitors, R-132917 and the like are illustrated; as pyruvate dehydrogenase inhibitors, AZD-7545 and the like are illustrated; as inhibitors of hepatic gluconeogenesis, FR-225659 and the like are illustrated; as glucagon-like peptide 1 analogs, exendin-4, CJC-1131 and the like are illustrated; as glucagon-like peptide 1 agonists; AZM-134, LY-315902 and the like are illustrated; and as amylin, amylin analogs or amylin agonists, pramlintide acetate and the like are illustrated. These drugs, glucose-6-phosphatase inhibitors, D-chiroinositol, glycogen synthase kinase-3 inhibitors, a glucagon-type peptide 1 is used preferably for diabetes, diabetic complications, hyperinsulinemia or glucose metabolism disorders , and more preferably for diabetes or glucose metabolism disorders.

As aldose reductase inhibitors, ascorbyl gamolenate, tolrestat, epalrestat, ADN-138, BAL-ARI8, ZD-5522, ADN-311, GP-1447, IDD-598, fidarestat, sorbinil, ponalrestat, risarestat, zenarestat are illustrated , minalrestat, metosorbinil, AL-1567, imirestat, M-16209, TAT, AD-5467, zopolrestat, AS-3201, NZ-314, SG-210, JTT-811, lindolrestat, and the like. Aldose reductase inhibitors are preferably used for diabetic complications due to inhibition of aldose reductase and decrease in excessive intracellular accumulation of sorbitol in the accelerated pathway of polyols that are in continuous hyperglycemic conditions in tissues in diabetic complications .

As inhibitors of the formation of advanced glycosylation end products, pyridoxamine, OPB-9195, ALT-946, ALT-711, pimagedin hydrochloride and the like are illustrated. Inhibitors of the formation of advanced glycosylation end products are preferably used for diabetic complications due to the inhibition of the formation of advanced glycosylation end products which is accelerated under continuous hyperglycemic conditions in diabetes and decreases cell damage.

As protein kinase C inhibitors, LY-333531, midostaurin, and the like are illustrated. Protein kinase C inhibitors are preferably used for diabetic complications due to inhibition of protein kinase C activity which is accelerated under continuous hyperglycemic conditions in diabetes.

As the γ-aminobutyric acid receptor antagonist, topiramate and the like are illustrated; as sodium channel antagonists, mexiletine hydrochloride, oxcarbazepine and the like are illustrated; as inhibitors of the transcription factor NF-kB, dexlipotam and the like are illustrated; as lipid peroxidase inhibitors, tirilazad mesylate and the like are illustrated; as inhibitors of αN-acetylated-linked acid dipeptidase, GPI-5693 and the like are illustrated; and as carnitine derivatives, carnitine, levacecarnine hydrochloride, levocarnitine chloride, levocarnitine, ST-261 and the like are illustrated. These drugs, insulin-like growth factor type I, platelet-derived growth factor, platelet-derived growth factor analogs, epidermal growth factor, nerve growth factor, uridine, 5-hydroxy-1-methyl -hydantoin, EGB-761, bimoclomol, sulodexide and Y128 are preferably used for diabetic complications.

As hydroxymethyl glutaryl coenzyme A reductase inhibitors, cerivastatin sodium, pravastatin sodium, lovastatin, simvastatin, fluvastatin sodium, atorvastatin calcium hydrate, SC-45355, SQ-33600, CP83101, BB-476, L-669269 are illustrated 2468, DMP-565, U-20685, BAY-x-2678, BAY-10-2987, pitavastatin calcium, rosuvastatin calcium, cholestolone, dalvastatin, acetamate, mevastatin, crilvastatin, BMS-180431, BMY-21950, glenvastatin, carvastatin, carvastatin BMY-22089, bervostatin and the like. Hydroxymethyl glutaryl coenzyme A reductase inhibitors are preferably used for hyperlipidemia, hypercholesterolemia, hypertriglyceridaemia, lipid metabolism disorders or atherosclerosis, and more preferably for hyperlipidemia, hypercholesterolemia or atherosclerosis due to decreased level cholesterol in the blood by inhibiting hydroxymethyl glutaryl coenzyme A reductase.

As fibric acid derivatives, bezafibrate, beclobrate, binifibrate, ciprofibrate, clinofibrate, clofibrate, aluminum clofibrate, clofibric acid, etofibrate, fenofibrate, gemfibrozil, nicofibrate, pirifibrate, ronifibrate, symphibrate, 157, teofibrate, and the like are illustrated. Fibric acid derivatives are preferably used for hyperinsulinemia, hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, lipid metabolism disorders or atherosclerosis, and more preferably for hyperlipidemia, hypertriglyceridaemia or atherosclerosis due to activation of hepatic lipoprotein lipase and increased fatty acid oxidation, leading to a decrease in the level of triglycerides in the blood.

As β-adrenoceptor agonists₃, BRL-28410, SR-58611A, ICI-198157, ZD-2079, BMS-194449, BRL-37344, CP-331679, CP-114271, L-750355, BMS-187413, SR-59062A, BMS-210285 are illustrated , LY-377604, SWR-0342SA, AZ-40140, SB-226552, D-7114, BRL-35135, FR-149175, BRL-26830A, CL-316243, AJ-9677, GW427353, N-5984, GW-2696 and the like. Β-adrenoceptor agonists₃ are preferably used for obesity, hyperinsulinemia, hyperlipidemia, hypercholesterolemia, hypertriglyceridaemia or lipid metabolism disorders, and more preferably for obesity or hyperinsulinemia due to β-adrenoceptor stimulation₃in adipose tissue and increased fatty acid oxidation, leading to the induction of energy expenditure.

As inhibitors of acyl-coenzyme A cholesterol acyltransferase, NTE-122, MCC-147, PD-1323012, DUP-129, U-73482, U-76807, RP-70676, P-06139, CP-113818, RP are illustrated. -73163, FR-129169, FY-038, EAB-309, KY455, LS-3115, FR-145237, T-2591, J-104127, R-755, FCE-28654, YIC-C8-434, avasimibe, CI -976, RP-64477, F1394, eldacimibe, CS-505, CL-283546, YM-17E, lecimibide, 447C88, YM-750, E-5324, KW-3033, HL-004, eflucimibe and the like. Inhibitors of acyl-coenzyme A cholesterol acyltransferase are preferably used to

ES 2 319 263 T3 hyperlipidaemia, hypercholesterolaemia, hypertriglyceridaemia or disorders of lipid metabolism, and more preferably for hyperlipidaemia or hypercholesterolemia due to the reduction of the level of cholesterol in the blood by inhibiting acyl-coenzyme A cholesterol acyltransferase.

As thyroid hormone receptor agonists, liothyronine sodium, levothyroxine sodium, KB-2611 and the like are illustrated; as cholesterol absorption inhibitors, ezetimibe, SCH-48461 and the like are illustrated; as lipase inhibitors, orlistat, ATL-962, AZM-131, RED-103004 and the like are illustrated; as carnitine palmitoyltransferase inhibitors, etomoxir and the like are illustrated; as squalene synthase inhibitors, SDZ268-198, BMS-188494, A-87049, RPR-101821, ZD-9720, RPR-107393, ER-27856 and the like are illustrated; as nicotinic acid derivatives, nicotinic acid, nicotinamide, nicomol, niceritrol, acipimox, nicorandil and the like are illustrated; as bile acid sequestrants, cholestyramine, cholestilan, colesevelam hydrochloride, GT-102-279 and the like are illustrated; as sodium / bile acid cotransporter inhibitors, 264W94, S-8921, SD-5613 and the like are illustrated; and as cholesterol ester transfer protein inhibitors, PNU-107368E, SC-795, JTT-705, CP-529414 and the like are illustrated. These drugs, probcol, microsomal triglyceride transfer protein inhibitors, lipoxygenase inhibitors, and low-density lipoprotein receptor enhancers are preferably used for hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, or lipid metabolism disorders.

As appetite suppressants, monoamine absorption inhibitors, serotonin absorption inhibitors, serotonin release stimulators, serotonin agonists (especially 5HT agonists) are illustrated._{2 C}), norepinephrine reuptake inhibitors, norepinephrine release stimulators, «j-adrenoceptor agonists, β-adrenoceptor agonists₂, dopamine agonists, cannabinoid receptor antagonists, γ-aminobutyric acid receptor antagonists, histamine H antagonists₃, L-histidine, leptin, leptin analogs, leptin receptor agonists, melanocortin receptor agonists (especially MC3-R agonists, MC4-R agonists), melanocyte-stimulating hormone a, cocaine-regulated transcript and amphetamine , mahogany protein, enterostatin agonists, calcitonin, calcitonin gene-related peptide, bombesin, cholecystokinin agonists (especially CCK-A agonists), corticotropin-releasing hormone, corticotropin-releasing hormone analogs, corticotropin-releasing hormone agonists, urocortin, somatostatin, somatostatin analogs, somatostatin receptor agonists, pituitary adenylate cyclase activating peptide, brain-derived neurotrophic factor, ciliary neurotrophic factor thyrotropin releasing hormone, neurotensin, sauvagine, neuropeptide Y antagonists, opioid peptide antagonists, galanin antagonists, melanin-concentrating hormone antagonists, agouti-related protein inhibitors, and orexin receptor antagonists. Specifically, as monoamine absorption inhibitors, mazindol and the like are illustrated; as serotonin uptake inhibitors, dexfenfluramine hydrochloride, fenfluramine, sibutramine hydrochloride, fluvoxamine maleate, sertraline hydrochloride and the like are illustrated; as serotonin agonists, inotriptan, (+) - norfenfluramine and the like are illustrated; as norepinephrine reuptake inhibitors, bupropion, GW-320659 and the like are illustrated; as stimulators of norepinephrine release, rolipram, YM-992 and the like are illustrated; as β adrenoceptor agonists₂, amphetamine, dextroamphetamine, phentermine, benzphetamine, methamphetamine, phendimetrazine, phenmetrazine, diethylpropion, phenylpropanolamine, clobenzorex and the like are illustrated; as dopamine agonists, ER-230, doprexin, bromocriptine mesylate, and the like are illustrated; as cannabinoid receptor antagonists, rimonabant and the like are illustrated; as γ-aminobutyric acid receptor antagonists, topiramate and the like are illustrated; as histamine H antagonists₃, GT-2394 and the like are illustrated; as leptin, leptin analogs or leptin receptor agonists, LY-355101 and the like are illustrated; As cholecystokinin agonists (especially CCK-A agonists), SR-146131, SSR-125180, BP-3,200, A-71623, FPL15849, GI-248573, GW-7178, GI-181771, GW-7854, A are illustrated. -71378 and the like; and as antagonists of neuropeptide Y, SR-120819-A, PD-160170, NGD-95-1, BIBP-3226, 1229-U-91, CGP-71683, BIBO-3304, CP-67190601, J-115814 are illustrated. and the like. Appetite suppressants are preferably used for diabetes, diabetic complications, obesity, glucose metabolism disorders, hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, lipid metabolism disorders, atherosclerosis, hypertension, congestive heart failure , edema, hyperuricemia or gout, and more preferably for obesity due to stimulation or inhibition of the activities of intracerebral monoamines or bioactive peptides in the central appetite regulatory system and appetite suppression, leading to reduced energy input.

Illustrated as angiotensin converting enzyme inhibitors are captopril, enalapril maleate, alacepril, delapril hydrochloride, ramipril, lisinopril, imidapril hydrochloride, benazepril hydrochloride, ceronapril monohydrate, cilazapril, erbumindopril, moovinyl sodium , quinapril hydrochloride, spirapril hydrochloride, temocapril hydrochloride, trandolapril, zofenopril calcium, moexipril hydrochloride, rentiapril and the like. Angiotensin converting enzyme inhibitors are preferably used for diabetic complications or hypertension.

As neutral endopeptidase inhibitors, omapatrilat, MDL-100240, fasidotril, sampatrilat, GW660511X, mixanpril, SA-7060, E-4030, SLV-306, ecadotril and the like are illustrated. Neutral endopeptidase inhibitors are preferably used for diabetic complications or hypertension.

Illustrated as angiotensin II receptor antagonists are candesartan, cilexetil, candesartan cilexetil / hydrochlorothiazide, losartan potassium, eprosartan mesylate, valsartan, telmisartan, irbesartan, EXP-3174, L-158809, EXP3312, tasmesartan 3-14 671, GA-0113, RU-64276, EMD-90423, BR-9701 and the like. Angiotensin II receptor antagonists are preferably used for diabetic complications or hypertension.

ES 2 319 263 T3

As endothelin converting enzyme inhibitors, CGS-31447, CGS-35066, SM-19712 and the like are illustrated; as endothelin receptor antagonists, L-749805, TBC-3214, BMS-182874, BQ-610, TA0201, SB-215355, PD-180988, sitaxsentan sodium, BMS-193884, darusentan, TBC-3711, bosentan, tezosentan sodium, J-104132, YM-598, S-0139, SB-234551, RPR-118031A, ATZ-1993, RO-61-1790, ABT-546, lasentan, BMS207940 and the like. These drugs are preferably used for diabetic complications or hypertension, and more preferably for hypertension.

As diuretic agents, chlorthalidone, metolazone, cyclopentiazide, trichloromethiazide, hydrochlorothiazide, hydroflumethiazide, benzyl-hydrochlorothiazide, penflutizide, methichlotiazide, inrasedapamide, triparanemide, mefruside, azosetanosemide, pothanumethiazide, methanosemide, pothanumethiazide, methanosemide, totanumethic acid spironolactone, triamterene, aminophylline, cyclotanin hydrochloride, LLU-α, PNU-80873A, isosorbide, D-mannitol, D-sorbitol, fructose, glycerin, acetazolamide, methazolamide, FR-179544, OPC-31260, lixivaptan, conivaptan hydrochloride, and the like. Diuretic drugs are preferably used for diabetic complications, hypertension, congestive heart failure or edema, and more preferably for hypertension, congestive heart failure or edema due to lowering of blood pressure or improvement of edema by increased urinary excretion.

As calcium antagonists, aranidipine, efonidipine hydrochloride, nicardipine hydrochloride, barnidipine hydrochloride, benidipine hydrochloride, manidipine hydrochloride, cylnidipine, nisoldipine, nitrendipine, nifedipine, nilvodipine hydrochloride, pylvadipine hydrochloride, lecanipranine, nilvodipine hydrochloride are illustrated. , isradipine, elgodipine, azelnidipine, lacidipine, vatanidipine hydrochloride, lemyldipine, diltiazem hydrochloride, clentiazem maleate, verapamil hydrochloride, S-verapamil, fasudil hydrochloride, bepridil hydrochloride, galopamil hydrochloride and the like; as vasodilatory antihypertensive agents, indapamide, todralazine hydrochloride, hydralazine hydrochloride, cadralazine, budralazine and the like are illustrated; as sympathetic blocking agents, amosulalol hydrochloride, terazosin hydrochloride, bunazosin hydrochloride, prazosin hydrochloride, doxazosin mesylate, propranolol hydrochloride, atenolol, metoprolol tartrate, carvedilol, nipradilivol hydrochloride, celloxychlorol hydrochloride, betaxol hydrochloride are illustrated , pindolol, tercatolol hydrochloride, bevantolol hydrochloride, timolol maleate, carteolol hydrochloride, bisoprolol hemifumarate, bopindolol malonate, nipradilol, penbutolol sulfate, acebutolol hydrochloride, tilisolol hydrochloride, nadolol, urapidil, indoramine, and the like; as centrally acting antihypertensive agents, reserpine and the like are illustrated; and as α-adrenoceptor agonists₂, clonidine hydrochloride, methyldopa, CHF-1035, guanabenz acetate, guanfacine hydrochloride, moxonidine, lofexidine, talipexole hydrochloride and the like are illustrated. These drugs are preferably used for hypertension.

As antiplatelet agents, ticlopidine hydrochloride, dipyridamole, cilostazol, ethyl icosapentate, sarpogrelate hydrochloride, dilazep dihydrochloride, trapidil, beraprost sodium, aspirin and the like are illustrated. Antiplatelet agents are preferably used for atherosclerosis or congestive heart failure.

As inhibitors of uric acid synthesis, allopurinol, oxipurinol and the like are illustrated; as uricosuric agents, benzbromarone, probenecid, and the like are illustrated; and as urinary alkalinizers, sodium hydrogen carbonate, potassium citrate, sodium citrate and the like are illustrated. These drugs are preferably used for hyperuricemia or gout.

In the case of the combined use with drugs other than SGLT2 inhibitors, for example, in the use for diabetes, the combination with at least one member of the group consisting of an insulin sensitivity enhancer, a glucose uptake inhibitor, a biguanide, an insulin secretion enhancer, an insulin preparation, a glucagon receptor antagonist, an insulin receptor kinase stimulator, a tripeptidyl peptidase II inhibitor, a dipeptidyl peptidase IV inhibitor, a protein tyrosine phosphatase 1B inhibitor, a glycogen phosphorylase inhibitor, a glucose-6-phosphatase inhibitor, a fructose-bisphosphatase inhibitor, a pyruvate dehydrogenase inhibitor, an inhibitor of hepatic gluconeogenesis, D-chiroinositol, a glycogensynthase kinase 3 inhibitor, a glucagon-like peptide 1, a glucagon-like peptide 1 analog, a glucagon-like peptide 1 agonist, amylin, an amylin analog, an amylin agonist, and an appetite suppressant; more preferable is the combination with at least one member of the group consisting of an insulin sensitivity enhancer, a glucose uptake inhibitor, a biguanide, an insulin secretion enhancer, an insulin preparation, an antagonist glucagon receptor, an insulin receptor kinase stimulator, a tripeptidyl peptidase II inhibitor, a dipeptidyl peptidase IV inhibitor, a protein tyrosine phosphatase 1B inhibitor, a glycogen phosphorylase inhibitor, a glucose-6-phosphatase inhibitor, a fructose-bisphosphatase inhibitor, a pyruvate dehydrogenase inhibitor, a liver gluconeogenesis inhibitor, D-chiroinositol, a glycogeninase kinase 3 inhibitor , a glucagon-like peptide 1, a glucagon-like peptide 1 analog, a glucagon-like peptide 1 agonist, amylin, an amylin analog and an amylin agonist; and most preferable is the combination with at least one member of the group consisting of an insulin sensitivity enhancer, a glucose uptake inhibitor, a biguanide, an insulin secretion enhancer and an insulin preparation. Similarly, in use for diabetic complications, the combination with at least one member of the group consisting of an insulin sensitivity enhancer, a glucose uptake inhibitor, a biguanide, a glucose enhancer is preferable. insulin secretion, an insulin preparation, a glucagon receptor antagonist, an insulin receptor kinase stimulator, a tripeptidyl peptidase II inhibitor, a dipeptidyl peptidase IV inhibitor, a protein tyrosine phosphatase 1B inhibitor, a glycogen phosphorylase inhibitor, a

ES 2 319 263 T3 glucose-6-phosphatase inhibitor, a fructose-bisphosphatase inhibitor, a pyruvate dehydrogenase inhibitor, a hepatic gluconeogenesis inhibitor, D-chiroinositol, glycogen synthase kinase-3 inhibitors, a glucagon-like peptide 1, a glucagon-like peptide 1 analog, a glucagon-like peptide 1 agonist, amylin, an amylin analog, an amylin agonist, an aldose reductase inhibitor, an inhibitor of advanced glycosylation end-product formation, a protein kinase C inhibitor, a γ-aminobutyric acid antagonist, a sodium channel antagonist, an inhibitor of the transcription factor NF-kB, a lipid peroxidase inhibitor , an inhibitor of α N-acetylated acid dipeptidase, insulin-like growth factor type I, platelet-derived growth factor, an analog of platelet-derived growth factor, epidermal growth factor, nerve growth factor, a carnitine derivative, uridine, 5-hydroxy-1-methylhydantoin, EGB-761, bimoclomol, sulodexide, Y-128, an angiotensin converting enzyme inhibitor, an inhibitor of neutral endopeptidase, an angiotensin II receptor antagonist, an endothelin converting enzyme inhibitor, an endothelin receptor antagonist, and a diuretic agent; and the combination with at least one member of the group consisting of an aldose reductase inhibitor, an angiotensin converting enzyme inhibitor, a neutral endopeptidase inhibitor and an angiotensin II receptor antagonist is more preferable. Furthermore, in the use for obesity, the combination with at least one member of the group consisting of an insulin sensitivity enhancer, a glucose absorption inhibitor, a biguanide, an insulin secretion enhancer is preferable. , an insulin preparation, a glucagon receptor antagonist, an insulin receptor kinase stimulator, a tripeptidyl peptidase II inhibitor, a dipeptidyl peptidase IV inhibitor, a protein tyrosine phosphatase 1B inhibitor, a glycogen phosphorylase inhibitor, a glucose-6-phosphatase inhibitor, a fructose-bisphosphatase inhibitor, a pyruvate dehydrogenase inhibitor, an inhibitor of hepatic gluconeogenesis, D- chiroinositol, a glucogensynthase kinase 3 inhibitor, a glucagon-like peptide 1, a glucagon-like peptide 1 analog, a glucagon-like peptide 1 agonist, amylin, an amylin analog, an amylin agonist, a β adrenoceptor agonist₃ and an appetite suppressant; and the combination with at least one member of the group consisting of a β-adrenoceptor agonist is more preferable.₃ and an appetite suppressant is more preferable.

When the pharmaceutical compositions of the present invention are used in practical treatment, different dosage forms are used depending on their uses. As examples of the dosage forms, powders, granules, fine granules, dry syrups, tablets, capsules, injections, solutions, ointments, suppositories, poultices and the like, which are administered are illustrated. orally or parenterally.

These pharmaceutical compositions can be prepared by mixing or diluting and dissolving with appropriate pharmaceutical additives such as excipients, disintegrants, binders, lubricants, diluents, buffers, isotonic agents, antiseptics, wetting agents, emulsifiers, dispersing agents, stabilizing agents, dissolution aids. and the like, and formulate the mixture according to conventional pharmaceutical methods depending on its dosage forms. In the case of the use of the compound of the present invention in combination with drugs other than SGLT2 inhibitors, they can be prepared by formulating each active ingredient together or individually.

When the pharmaceutical compositions of the present invention are employed in practical treatment, the dosage of a compound represented by the general formula (I) above, a pharmaceutically acceptable salt thereof, or a prodrug thereof as an active ingredient is appropriately decided depending on the age, sex, body weight and degree of symptoms and treatment of each patient, which is approximately in the range of 0.1 to 1,000 mg per day per adult human in the case of oral administration and approximately in the range of 0.01 to 300 mg per day per adult human in the case of parenteral administration, and the daily dose can be divided into one to several doses per day and appropriately administered. Also, in the case of using the compound of the present invention in combination with drugs other than SGLT2 inhibitors, the dosage of the compound of the present invention can be reduced depending on the dosage of drugs other than SGLT2 inhibitors.

The present invention is further illustrated in more detail by means of the following Reference Examples, Examples and Test Examples. However, the present invention is not limited thereto.

Reference Example 1

Methyl 4- (Cyclopropylidenemethyl) benzoate

To a suspension of sodium hydride (60%, 0.27 g) in tetrahydrofuran (40 mL) was added cyclopropyl triphenylphosphonium bromide (2.6 g), and the mixture was stirred at 70 ° C for 2 hours. Methyl terephthalaldehydate (1.0 g) was added to the reaction mixture, and the mixture was stirred at 70 ° C for 7 days. Water was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was washed with water and brine, and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / dichloromethane = 1/1) to yield methyl 4- (cyclopropylidenemethyl) benzoate (0.80 g).

H NMR¹ (CDCl₃) δ ppm:

ES 2 319 263 T3

1.15-1.30 (2H, m), 1.40-1.50 (2H, m), 3.91 (3H, s), 6.75-6.85 (1H, m), 7, 55-7.60 (2H, m), 7.95-8.05 (2H, m)

Reference Example 2

4- (cyclopropylidenemethyl) benzyl alcohol

To a suspension of lithium aluminum hydride (0.16 g) in tetrahydrofuran (30 mL) was added methyl 4- (cyclopropylidenemethyl) benzoate (0.80 g), and the mixture was stirred at room temperature for 5 hours. . Water (0.4 mL) was added to the reaction mixture, and the mixture was stirred for 3 days. Insoluble matter was removed by filtration, and the solvent in the filtrate was removed under reduced pressure to yield 4- (cyclopropylidenemethyl) benzyl alcohol (0.69 g).

H NMR¹ (CDCls) δ ppm:

1.15-1.25 (2H, m), 1.35-1.50 (2H, m), 1.61 (1H, t, J = 6.0 Hz), 4.68 (2H, d, J = 6.0 Hz), 6.70-6.80 (1H, m), 7.307.35 (2H, m), 7.50-7.55 (2H, m)

Example 1

5-Methyl-4 - {[4- (cyclopropylidenemethyl) phenyl] methyl} -1,2-dihydro-3H-pyrazol-3-one.

To a solution of 4- (cyclopropylidenemethyl) benzyl alcohol (0.21 g) and triethylamine (0.18 mL) in tetrahydrofuran was added methanesulfonyl chloride (0.10 mL), and the mixture was stirred at room temperature for 30 minutes. Insoluble matter was filtered off. A solution of the obtained 4 (cyclopropylidenemethyl) benzyl methanesulfonate in tetrahydrofuran was added to a suspension of sodium hydride (60%, 0.052 g) and methyl acetoacetate (0.14 mL) in 1,2-dimethoxyethane, and the mixture was stirred at 70 ° C for 5 hours. A saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. Anhydrous hydrazine (0.12 mL) was added to a solution of the residue in toluene, and the mixture was stirred at 95 ° C for 10 minutes. The solvent in the reaction mixture was removed under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 10/1) to yield 5-methyl4 - {[4- (cyclopropylidenemethyl) phenyl] methyl} -1,2-dihydro-3H-pyrazol-3-one (0.032 g).

H NMR¹ (DMSO-de) δ ppm:

1.10-1.20 (2H, m), 1.30-1.45 (2H, m), 2.00 (3H, s), 3.52 (2H, s), 6.65-6, 75 (1H, m), 7.05-7.15 (2H, m), 7.35-7.45 (2H, m)

Example 2

5-Methyl-4 - {[4- (cyclopropylidene.omethyl) phenyl] methyl} -3- (2, 3,4,6-tetra-O-acetyl-eD-glucopyranOsiloxy) -1H-pyrazole

To a suspension of 5-methyl-4 - {[4- (cyclopropylidenemethyl) phenyl] methyl} -1,2-dihydro-3H-pyrazol-3-one (0.026 g) and acetobromo-aD-glucose (0.049 g) in Tetrahydrofuran was added to silver carbonate (0.036 g), and the mixture was stirred at 60 ° C overnight protecting from light. The reaction mixture was purified by column chromatography on aminopropyl silica gel (eluent: tetrahydrofuran) and successively by column chromatography on silica gel (eluent: hexane / ethyl acetate = 1/3) to yield 5-methyl-4 - {[4- (cyclopropylidenemethyl) -phenyl] methyl} -

3- (2,3,4,6-tetra-O-acetyl-j6-D-glucopyranosyloxy) -1H-pyrazole (0.010 g).

H NMR¹ (CDCls) δ ppm:

1.10-1.20 (2H, m), 1.30-1.45 (2H, m), 1.86 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s), 2.11 (3H, s), 3.50-3.70 (2H, m), 3.80-3.90 (1H, m), 4.13 (1H, dd, J = 2.3, 12.4 Hz), 4.31 (1H, dd, J = 4.1, 12.4 Hz), 5.15-5.35 (3H, m), 5.505.65 (1H, m), 6.65-6.75 (1H, m), 7.05-7.15 (2H, m), 7.35-7.45 (2H, m)

Reference Example 3

4-cyclopropylbenzaldehyde

Diethylzinc (1 mol / L, 30 mL) was added to a solution of 4-bromostyrene (1.83 g) in dichloromethane (5 mL) under argon atmosphere at 0 ° C, and the mixture was stirred at the same temperature. for 10 minutes. Chloroiodomethane (4.3 mL) was added to the mixture, and the mixture was warmed to room temperature and stirred for 9 days. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure to produce

ES 2 319 263 T3

4-cyclopropylbromobenzene. The 4-cyclopropylbromobenzene obtained was dissolved in tetrahydrofuran (25 mL) and cooled to -78 ° C. To the solution, tert-butyl lithium (1.45 mol / L pentane solution, 9.4 mL) was added dropwise under argon, and the mixture was stirred at -78 ° C for 30 minutes. A solution of N, N-dimethylformamide (1.2 mL) in tetrahydrofuran (16 mL) was added to the reaction mixture, and the mixture was warmed to 0 ° C and stirred for 1 hour. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 12/1) to yield 4-cyclopropylbenzaldehyde (0.72 g).

H NMR¹ (CDCl₃) δ ppm:

0.60-0.75 (2H, m), 1.05-1.15 (2H, m), 1.80-1.95 (1H, m), 7.15-7.25 (2H, m ), 7.70-7.80 (2H, m), 9.94 (1H, s)

Reference Example 4

4-cyclopropylbenzyl alcohol

To a solution of 4-cyclopropylbenzaldehyde (0.71 g) in methanol (10 mL) was added lithium borohydride (2 mol / L tetrahydrofuran solution, 3.7 mL), and the mixture was warmed to room temperature and stirred for 30 minutes. Water was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was washed with a 1 mol / L hydrochloric acid solution and brine, and dried over anhydrous sodium sulfate. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 5/1) to yield 4-cyclopropylbenzyl alcohol (0.69 g).

H NMR¹ (CDCl₃) δ ppm:

0.60-0.75 (2H, m), 0.90-1.00 (2H, m), 1.80-1.95 (1H, m), 4.62 (2H, s), 7, 00-7.10 (2H, m), 7.20-7.30 (2H, m)

Example 3

5-Methyl-4 - [(4-cyclopropylpheml) methyl] -1,2-dihydro-3H-pyrazol-3-one

Triethylamine (1.2 mL) and methanesulfonyl chloride (0.66 mL) were added to a solution of 4-cyclopropylbenzyl alcohol (1.1 g) in tetrahydrofuran (23 mL), and the mixture was stirred at room temperature for 2 hours. Insoluble matter was filtered off. A solution of the obtained 4-cyclopropylbenzyl methanesulfonate in tetrahydrofuran was added to a suspension of sodium hydride (60%, 0.34 g) and methyl acetoacetate (0.91 mL) in 1,2-dimethoxyethane (26 mL), and the mixture was stirred at 80 ° C for 13 hours. A saturated aqueous sodium hydrogen carbonate solution was poured into the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was dissolved in toluene (23 mL), hydrazine monohydrate (1.1 mL) was added to the solution, and the mixture was stirred at 100 ° C for 10 hours. After cooling to room temperature, the resulting insoluble matter was collected by filtration, washed with water and then hexane, and dried under reduced pressure to yield 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1,2-dihydro- 3H-pyrazol-3-one (1.22 g).

H NMR¹ (CD₃DO) δ ppm:

0.50-0.65 (2H, m), 0.80-0.95 (2H, m), 1.75-1.90 (1H, m), 2.01 (3H, s), 3, 58 (2H, s), 6.85-7.10 (4H, m)

Example 4

5-Methyl-4 - [(4-cyclopropylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrawl

To a suspension of 5-methyl-4 - [(4-cyclopropylphenyl) -methyl] -1,2-dihydro-3H-pyrazol-3-one (0.23 g) and acetobromoa-D-glucose (0.45 g ) in tetrahydrofuran (5 mL) was added silver carbonate (0.33 g), and the mixture was stirred at 40 ° C for 36 hours protecting it from light. The reaction mixture was purified by column chromatography on aminopropyl silica gel (eluent: tetrahydrofuran) and successively by column chromatography on silica gel (eluent: hexane / ethyl acetate = 1/2) to yield 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -3- (2,3,4,6-tetraO-acetyl-eD-glucopyranosyloxy) -1H-pyrazole (0.30 g).

H NMR¹ (CDCl₃) δ ppm:

0.55-0.70 (2H, m), 0.85-1.00 (2H, m), 1.75-1.90 (1H, m), 1.86 (3H, s), 2, 01 (3H, s), 2.03 (3H, s), 2.06 (3H, s), 2.10 (3H, s), 3.54 (1H, d, J = 15.8 Hz), 3.61 (1H, d, J = 15.8 Hz), 3.80-3.90 (1H, m), 4.12 (1H, dd, J = 2.3, 12.4 Hz), 4 , 30 (1H, dd, J = 4.1, 12.4 Hz), 5.15-5.35 (3H, m), 5.50-5.65 (1H, m), 6.85-7 .05 (4H, m)

ES 2 319 263 T3

Reference Example 5 (E) -4- (But-1-en-1-yl) methyl benzoate

To a suspension of sodium hydride (60%, 0.97 g) in tetrahydrofuran (80 mL) was added methyl 4- (diethylphosphorylmethyl) benzoate (5.8 g) at 0 ° C, and the mixture was stirred for 30 minutes. A solution of propionaldehyde (1.6 mL) in tetrahydrofuran (10 mL) was added to the reaction mixture, and the mixture was stirred at room temperature for 30 minutes. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was washed with water and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 5/1) to yield methyl (E) -4- (but-1-en-1-yl) benzoate (2, 5 g).

H NMR¹ (CDCl₃) δ ppm:

1.11 (3H, t, J = 7.5 Hz), 2.20-2.35 (2H, m), 3.90 (3H, s), 6.35-6.45 (2H, m) , 7.35-7.45 (2H, m), 7.90-8.00 (2H, m)

Reference Example 6

Benzyl alcohol (E) -4- (but-1-en-1-yl)

To a suspension of lithium aluminum hydride (1.2 g) in diethyl ether (100 mL) was added a solution of methyl 4- (but-1-en-1-yl) benzoate (2.5 g) in diethyl ether (20 mL) at 0 ° C, and the mixture was refluxed for 30 minutes. After cooling the reaction mixture to 0 ° C, water (1.2 mL), an aqueous sodium hydroxide solution (15%, 1.2 mL) and water (3.6 mL) were added to the mixture. , and the mixture was stirred at room temperature for 5 minutes. Insoluble matter was filtered off, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 2/1) to yield (E) -4- (but-1-en-1-yl) benzyl alcohol (1.9 g).

H NMR¹ (CDCl₃) δ ppm:

1.09 (3H, t, J = 7.5Hz), 1.60 (1H, t, J = 6.0Hz), 2.15-2.30 (2H, m), 4.66 (2H , d, J = 6.0 Hz), 6.27 (1H, dt, J = 15.9, 6.3 Hz), 6.37 (1H, d, J = 15.9 Hz), 7.25 -7.40 (4H, m)

Example 5 (E) -4 - {[4- (But-1-en-1-yl) phenyl] methyl} -5-methyl-1,2-dihydro-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 3 using 4- (but-1en-1-yl) benzyl alcohol in place of 4-cyclopropylbenzyl alcohol.

H NMR¹ (DMSO-Ó6) δ ppm:

1.03 (3H, t, J = 7.5Hz), 1.99 (3H, s), 2.10-2.25 (2H, m), 3.51 (2H, s), 6.23 (1H, dt, J = 16.0, 6.2 Hz), 6.32 (1H, d, J = 16.0 Hz), 7.05-7.10 (2H, m), 7.20- 7.30 (2H, m)

Example 6 (E) -4 - {[4- (But-1-en-1-yl) phenyl] methyl} -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD -glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 4 using (E) -4 - {[4 (but-1-en-1-yl) phenyl] methyl} -5-methyl-1,2 -dihydro-3H-pyrazol-3-one instead of 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1,2-dihydro-3H-pyrazol-3-one.

H NMR¹ (CDCl₃) δ ppm:

1.07 (3H, t, J = 7.3Hz), 1.86 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s ), 2.10 (3H, s), 2.10-2.25 (2H, m), 3.57 (1H, d, J = 15.6 Hz), 3.63 (1H, d, J = 15.6 Hz), 3.80-3.90 (1H, m), 4.05-4.20 (1H, m), 4.31 (1H, dd, J = 4.0, 12.3 Hz ),

5.15-5.35 (3H, m), 5.50-5.65 (1H, m), 6.10-6.25 (1H, m), 6.25-6.35 (1H, m ), 6.95-7.10 (2H, m), 7.15-7.25 (2H, m)

Reference Example 7

1-Bromo-4 - [(methoxymethyloxy) methyl] benzene

To a solution of 4-bromobenzyl alcohol (2.8 g) and diisopropylethylamine (2.5 g) in dichloromethane (30 mL) was added chloromethyl methyl ether (1.3 g) at 0 ° C, and the mixture was stirred at room temperature for 14 hours. Water was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was washed with

ES 2 319 263 T3 was water and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 5/1) to yield 1-bromo-4 - [(methoxymethyloxy) methyl] benzene (3.0 g).

H NMR¹ (CDCl3) δ ppm:

3.40 (3H, s), 4.54 (2H, s), 4.70 (2H, s), 7.20-7.30 (2H, m), 7.45-7.55 (2H, m)

Reference Example 8

4- (thiazol-2-yl) benzyl alcohol

To a solution of 1-bromo-4 - [(methoxymethyloxy) -methyl] benzene (3.0 g) in tetrahydrofuran (52 mL) was added n-butyl lithium (1.6 mol / L hexane solution, 9 , 3 mL) at -78 ° C, and the mixture was stirred for 30 minutes. Triisopropyl borate (2.6 g) was added to the reaction mixture, and the mixture was stirred at room temperature for 1 hour. A 1 mol / L hydrochloric acid solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure to yield 4 - [(methoxymethyloxy) methyl] phenylboric acid (2.5 g). A mixture of the obtained 4 - [(methoxymethyloxy) methyl] -phenylboric acid (2.5 g), 2-bromothiazole (1.2 g), cesium fluoride (2.2 g) and tetrakis (triphenylphosphine) palladium (0) (0.16 g) in 1,2-dimethoxyethane (40 mL), ethanol (10 mL) and water (10 mL) was stirred at 85 ° C for 24 hours. The reaction mixture was concentrated under reduced pressure, and the residue was added, and the mixture was extracted with diethyl ether. The organic layer was washed with water and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 5/1) to yield 2- {4 - [(methoxymethyloxy) methyl] phenyl} thiazole (0.80 g). To a solution of 2- {4 - [(methoxymethyloxy) -methyl] phenyl} thiazole (0.80 g) in ethanol (10 mL) was added a solution of 2 mol / L of hydrochloric acid (5 mL), and the mixture was stirred at 50 ° C for 5 hours. Concentrated hydrochloric acid (0.10 mL) was added to the mixture, and the mixture was stirred for 1 hour. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 2/1 - 1/1) to yield 4- (thiazol-2-yl) benzyl alcohol (0.33 g).

H NMR¹ (CDCl3) δ ppm:

4.76 (2H, d, J = 4.6 Hz), 7.33 (1H, d, J = 3.7 Hz), 7.40-7.50 (2H, m), 7.87 (1H , d, J = 3.7 Hz), 7.90-8.05 (2H, m)

Example 7

5-Methyl-4 - {[4- (thiazol-2-yl) phenyl] methyl} -1,2-dihydro-3H-pyrazol-3-one

The title compound was prepared in a manner similar to that described in Example 3 using alcohol 4- (thiazole-

2-yl) benzyl instead of 4-cyclopropylbenzyl alcohol.

H NMR¹ (DMSO-dU δ ppm:

2.03 (3H, s), 3.60 (2H, s), 7.25-7.30 (2H, m), 7.74 (1H, d, J = 3.1Hz), 7.80 -7.85 (2H, m), 7.88 (1H, d, J = 3.1 Hz) Example 8

5-Methyl-3- (2,3,4,6-tetra-O_-acetyl-eD-glucopyranOsiloxy) -4 - {[4- (thiazol-2-yl) phenyl] methyl '} -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 4 using 5-methyl-4 {[4- (thiazol-2-yl) phenyl] methyl} -1,2-dihydro-3H-pyrazole-3 -one instead of 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1,2-dihydro-3H-pyrazol-3-one.

H NMR¹ (CDCl3) δ ppm:

1.88 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s), 2.13 (3H, s), 3.64 (1H , d, J = 16.0 Hz), 3.71 (1H, d, J = 16.0 Hz), 3.80-3.90 (1H, m), 4.14 (1H, dd, J = 2.7, 12.2 Hz), 4.32 (1H, dd, J = 3.8, 12.2 Hz), 5.15-5.35 (3H, m), 5.55-5.65 (1H, m), 7.15-7.25 (2H, m), 7.29 (1H, d, J = 3.2 Hz), 7.80-7.90 (3H, m)

Reference Example 9

4- [3- (Benzyloxy) propyl] benzyl alcohol

To a solution of ethyl diethylphosphonoacetate (4.4 mL) in tetrahydrofuran (40 mL) was added sodium hydride (60%, 0.88 g) at 0 ° C, and the mixture was stirred for 10 minutes. A solution was added to the reaction mixture

ES 2 319 263 T3 of terephthalaldehyde mono- (diethyl acetal) (4.2 g) in tetrahydrofuran (10 mL), and the mixture was stirred at room temperature for 1.5 hours. A saturated aqueous ammonium chloride solution and water were added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was washed with water and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 3/1) to yield ethyl 4- (diethoxymethyl) cinnamate (5.8 g). To a solution of the obtained ethyl 4- (diethoxymethyl) cinnamate (5.8 g) in tetrahydrofuran (50 mL) was added platinum on 5% carbon powder (0.58 g), and the mixture was stirred at temperature environment in hydrogen atmosphere for 10 hours. Insoluble matter was filtered off, and the filtrate was concentrated under reduced pressure. A solution of the residue in tetrahydrofuran (20 mL) was added to a suspension of lithium aluminum hydride (1.1 g) in tetrahydrofuran (100 mL) at 0 ° C. The reaction mixture was heated to 70 ° C and stirred for 40 minutes. After cooling the reaction mixture to 0 ° C, water (1.1 mL), a 15% aqueous sodium hydroxide solution (1.1 mL) and water (3.3 mL) were added, and the mixture stirred at room temperature for 10 minutes. Insoluble matter was removed by filtration, and the solvent in the filtrate was removed under reduced pressure to yield 4- (3-hydroxypropyl) benzaldehyde diethyl acetal (4.7 g). To a solution of the obtained 4- (3-hydroxypropyl) benzaldehyde diethyl acetal (4.7 g) in dimethylformamide (100 mL) was added sodium hydride (60%, 1.2 g) at 0 ° C, and the mixture stirred for 5 minutes. Benzyl bromide (2.5 mL) was added to the reaction mixture, and the mixture was stirred at room temperature for 72 hours. Water was added to the reaction mixture, and the mixture was extracted with hexane. The organic layer was washed with water and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure to yield 4- [3- (benzyloxy) propyl] benzaldehyde diethyl acetal (6.4 g). To a solution of the obtained 4- [3- (benzyloxy) propyl] -benzaldehyde diethyl acetal (6.4 g) in tetrahydrofuran (60 mL) was added a solution of 2 mol / L of hydrochloric acid (10 mL) at 0 ° C, and the mixture was stirred for 1 hour. Water was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was washed with a saturated aqueous sodium hydrogen carbonate solution and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was dissolved in ethanol (50 mL), and sodium borohydride (1.1 g) was added to the solution at 0 ° C. The mixture was stirred for 14 hours while gradually returning to room temperature. Methanol was added to the reaction mixture, and the mixture was concentrated under reduced pressure. Ethyl acetate was added to the residue, and the mixture was washed with water and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 3/1 - 2/1) to yield 4- [3- (benzyloxy) propyl alcohol ] benzyl (3.7 g).

H NMR¹ (CDCl3) δ ppm:

1.85-2.00 (2H, m) ;, 2.65-2.80 (2H, m), 3.49 (2H, t, J = 6.4 Hz), 4.51 (2H, s), 4.66 (2H, d, J = 5.7Hz), 7.15-7.40 (9H, m)

Example 9

4 - ({4- [3- (Ben.cyloxy) propyl] phenyl} methyl) -5-trifluoromethyl-1,2-dihydro-3H-pyrazol-3-one.

To a solution of 4- [3- (benzyloxy) propyl] benzyl alcohol (2.0 g) in tetrahydrofuran (26 mL) were added triethylamine (1.1 mL) and methanesulfonyl chloride (0.60 mL) at 0 ° C, and the mixture was stirred at room temperature for 2 hours. Insoluble matter was filtered off. A solution of the obtained 4- [3- (benzyloxy) propyl] benzyl methanesulfonate in tetrahydrofuran was added to a suspension of sodium hydride (60%, 0.31 g) and ethyl 4,4,4-trifluoroacetoacetate (1, 1 mL) in 1,2-dimethoxyethane (26 mL), and the mixture was stirred at 80 ° C for 16 hours. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the mixture was extracted with diethyl ether. The extract was washed with water and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure, and the residue was dissolved in toluene (20 mL). Anhydrous hydrazine (0.74 mL) was added to the solution, and the mixture was stirred at 80 ° C for 18 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography on silica gel (eluent: dichloromethane / methanol = 10/1) and successively by column chromatography on silica gel (eluent: dichloromethane / methanol = 20/1) to yield 4 - ({4- [3- (benzyloxy) propyl] phenyl} methyl) -5-trifluoromethyl-1,2-dihydro-3H-pyrazol-3-one (0.84 g).

H NMR¹ (CDCl3) δ ppm:

1.85-1.95 (2H, m); 2.60-2.70 (2H, m), 3.48 (2H, t, J = 6.5Hz), 3.79 (2H, s), 4.49 (2H, s), 7.05-7.20 (4H, m), 7.257.40 (5H, m)

Example 10

4 - ({4- [3- (Benzyloxy) propyl] feml '} methyl) -5-trifluoromethyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

To a solution of 4 - ({4- [3- (benzyloxy) propyl] phenyl} methyl) -5-trifluoromethyl-1,2-dihydro-3H-pyrazol-3-one (0.83 g) and acetobromo-aD -glucose (1.5 g) in acetonitrile (12 mL) was added potassium carbonate (0.55 g), and the mixture was stirred at 60 ° C for 20 hours. Insoluble matter was removed by filtration, and the solvent in the filtrate was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 1 / 1-1 / 2) to yield 4 - ({4- [3- (benzyloxy) propyl] phenyl} methyl) - 5-trifluoromethyl-3- (2,3,4,6 tetra-O-acetyl-j6-D-glucopyranosyloxy) -1 H-pyrazole (0.64 g).

ES 2 319 263 T3

H NMR¹ (CDCl₃) δ ppm:

1.80-1.95 (5H, m), 2.02 (3H, s), 2.04 (3H, s), 2.07 (3H, s), 2.60-2.70 (2H, m), 3.47 (2H, t, J = 6.2 Hz), 3.74 (2H, s), 3.75-3.85 (1H, m), 4.18 (1H, dd, 2 , 2.12.7Hz), 4.26 (1H, dd, 4.5, 12.7Hz), 4.50 (2H, s), 5.15-5.35 (3H, m), 5.355 , 45 (1H, m), 7.00-7.15 (4H, m), 7.20-7.40 (5H, m)

Example 11

4 - {[4- (3-Hydroxypropyl) phenyl] methyl} -5-trifluoromethyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

To a solution of 4 - {[4- (3-benzyloxy) propyl] phenyl} methyl) -5-trifluoromethyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H- Pyrazole (0.64 g) in methanol (10 mL) was added 10% palladium-carbon powder (0.13 g), and the mixture was stirred at room temperature under hydrogen atmosphere for 11 hours. Insoluble matter was filtered off, the solvent in the filtrate was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 1/2) to yield 4 - {[4- (3-hydroxypropyl) phenyl] methyl} -5-trifluoromethyl-3- ( 2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole (0.45 g).

H NMR¹ (CDCl₃) δ ppm:

1.80-1.90 (2H, m), 1.92 (3H, s), 2.03 (3H, s), 2.04 (3H, s), 2.09 (3H, s), 2 , 60-2.70 (2H, m), 3.65 (2H, t, J = 6.3Hz), 3.75 (2H, s), 3.75-3.85 (1H, m), 4.15-4.30 (2H, m), 5.10-5.40 (4H, m), 7.05-7.15 (4H, m)

Reference Example 10

4- (2-methylprop-1-en-1-yl) benzyl alcohol

To a suspension of isopropyl triphenylphosphonium iodide (9.5 g) in tetrahydrofuran (90 mL) was added n-butyllithium (1.5 mol / L hexane solution, 15 mL) at 0 ° C, and the mixture was stirred for 15 minutes. A solution of methyl terephthalaldehyde (3.3 g) in tetrahydrofuran (10 mL) was added to the reaction mixture, and the mixture was stirred at room temperature for 3 hours. The reaction mixture was poured into a saturated aqueous ammonium chloride solution, and the mixture was extracted with diethyl ether. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography on aminopropyl silica gel (eluent: hexane / ethyl acetate = 3/1) and then by column chromatography on silica gel (eluent: dichloromethane / ethyl acetate = 10/1) to yield methyl 4- (2-methylprop-1-en-1-yl) -benzoate (3.4 g). To a suspension of lithium aluminum hydride (0.68 g) in diethyl ether (120 mL) was added a solution of methyl 4- (2-methylprop-1-en-1-yl) benzoate (3.4 g) in diethyl ether (30 mL) at 0 ° C, and the mixture was heated under reflux for 50 minutes. After cooling the reaction mixture to 0 ° C, water (0.69 mL), a 15% aqueous sodium hydroxide solution (0.69 mL) and water (2 mL) were added, and the mixture was stirred at room temperature for 30 minutes. Insoluble matter was removed by filtration, and the solvent in the filtrate was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 4/1 - 2/1) to yield 4- (2-methylprop-1-en-1-yl) benzyl alcohol (2 , 8 g).

H NMR¹ (CDCl₃) δ ppm:

1.60 (1H, t, J = 5.6 Hz), 1.86 (3H, s), 1.90 (3H, s), 4.67 (2H, d, J = 5.6 Hz), 6.26 (1H, s), 7.15-7.25 (2H, m), 7.257.35 (2H, m)

Example 12

5-Methyl-4 - {[4- (2-methylprop-1-en-1-yl) phenyl] methyl} -1,2-dihydro-3H-pyrazol-3-one

To a solution of 4- (2-methylprop-1-en-1-yl) benzyl alcohol (0.60 g) and carbon tetrabromide (1.2 g) in dichloromethane (12 mL) was added triphenylphosphine (0, 97 g) at 0 ° C, and the mixture was stirred at room temperature for 3.5 hours. Water was added to the reaction mixture, and the mixture was extracted with hexane. The organic layer was washed with water and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: hexane) to yield benzyl 4- (2-methylprop-1-en-1-yl) bromide. To a solution of methyl acetoacetate (0.44 mL) in tetrahydrofuran (17 mL) was added sodium hydride (60%, 0.18 g) at 0 ° C, and the mixture was stirred for 10 minutes. A solution of benzyl 4- (2-methylprop-1-en-1-yl) bromide in tetrahydrofuran (3 mL) was added to the reaction mixture, and the mixture was heated under reflux for 3.5 hours. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was washed with water and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure, and the residue was dissolved in toluene (8 mL). Hydrazine monohydrate (0.54 mL) was added to the solution, and the mixture was stirred at 80 ° C for 30 minutes. The reaction mixture was cooled to 0 ° C, and the resulting precipitates were collected by filtration, washed with water and hexane, and dried under reduced pressure to yield 5-methyl-4 - {[4- (2-methylprop- 1-en-1-yl) phenyl] methyl} -1,2-dihydro-3H-pyrazol-3-one (0.31 g).

ES 2 319 263 T3

H NMR¹ (DMSO-de) δ ppm:

1.79 (3H, d, J = 0.8Hz), 1.85 (3H, d, J = 1.3Hz), 2.01 (3H, s), 3.52 (2H, s), 6.15-6.25 (1H, m), 7.05-7.15 (4H, m)

Example 13

5-Methyl-4 - {[4- (2-methylprop-1-en-1-yl) phenyl] methyl} -3- (2,3,4,6-tetra-O_-acetyl-eD-glucopyranosyloxy) - 1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 4 using 5-methyl-4 - {[4- (2-methyl-prop-1-en-1-yl) phenyl] methyl} -1,2- dihydro-3H-pyrazol-3-one instead of 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1,2-dihydro-3H-pyrazol-3-one.

H NMR¹ (CDCl₃) δ ppm:

1.83 (3H, s), 1.86 (3H, s), 1.87 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H , s), 2.12 (3H, s), 3.57 (1H, d, J = 15.6 Hz), 3.65 (1H, d, J = 15.6 Hz), 3.80-3 , 90 (1H, m), 4.13 (1H, dd, J = 2.1, 12.6 Hz), 4.31 (1H, dd, J = 3.9, 12.6 Hz),

5.15-5.35 (3H, m), 5.50-5.65 (1H, m), 6.15-6.25 (1H, m), 7.00-7.15 (4H, m )

Reference Example 11

4 - [(4-Bromofeml) methyl] -5-methyl-1,2-dihydro-3H-pyrazol-3-one

To a solution of methyl acetoacetate (3.2 mL) in tetrahydrofuran (100 mL) was added sodium hydride (60%, 1.3 g) at 0 ° C, and the mixture was stirred for 5 minutes. 4-Bromobenzyl bromide (7.5 g) was added to the reaction mixture, and the mixture was heated under reflux for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was washed with water and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure, and the residue was dissolved in toluene (50 mL). Hydrazine monohydrate (4.4 mL) was added to the solution, and the mixture was stirred at 80 ° C for 30 minutes. The reaction mixture was cooled to room temperature, and the resulting precipitates were collected by filtration, washed with water and hexane, and dried under reduced pressure to yield 4 - [(4-bromophenyl) methyl] -5-methyl-1 , 2-dihydro-3H-pyrazol-3-one (4.0 g).

H NMR¹ (DMSO-du δ ppm:

2.00 (3H, s), 3.52 (2H / s), 7.05-7.15 (2H, m), 7.35-7.45 (2H, m)

Reference Example 12

4 - [(4-Bromophenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 4 using 4 - [(4-bromophenyl) methyl] -5-methyl-1,2-dihydro-3H-pyrazol-3-one instead of 5 -methyl-4 - [(4-cyclopropylphenyl) methyl] -1,2-dihydro-3H-pyrazole-

3-one.

H NMR¹ (CDCl₃) δ ppm:

1.89 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.07 (3H, s), 2.12 (3H, s), 3.54 (1H , d, J = 16.0 Hz), 3.60 (1H, d, J = 16.0 Hz), 3.80-3.90 (1H, m), 4.05-4.20 (1H, m), 4.31 (1H, dd, J = 3.3, 12.3 Hz), 5.10-5.35 (3H, m), 5.55-5.65 (1H, m),

6.95-7.10 (2H, m), 7.30-7.40 (2H, m)

Example 14

4 - {[4- (4-Fluorophenyl) phenyl] methyl '} - 5-methyl-3- (2,3,4,6-tetra-O_-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

A mixture of 4 - [(4-bromophenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-j6-D-glucopyranosyloxy) -1H-pyrazole (0.099 g), 4- acid fluorophenylboronic (0.046 g), cesium fluoride (0.050 g) and tetrakis- (triphenylphosphine) palladium (0) (0.0038 g) in 1,2-dimethoxyethane (1.3 mL), ethanol (0.3 mL) and Water (0.3 mL) was stirred at 85 ° C for 18 hours. The reaction mixture was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 1/1 - 1/2 - 1/5) to yield 4 - {[4- (4-fluorophenyl) phenyl] methyl} -5-methyl-3- (2,3,4,6-tetra-O-acetyl-j6-D-glucopyranosyloxy) 1H-pyrazole (0.061 g).

H NMR¹ (CDCl₃) δ ppm:

1.86 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.16 (3H, s), 3.64 (1H , d, J = 15.9 Hz), 3.70 (1H, d, J = 15.9 Hz), 3.80-3.90 (1H, m), 4.14 (1H, dd, J = 2.0, 12.5 Hz), 4.31 (1H, dd, J = 4.1, 12.5 Hz), 5.15-5.30 (3H, m), 5.55-5.65 (1H, m), 7.05-7.15 (2H, m), 7.15-7.25 (2H, m), 7.35-7.55 (4H, m)

ES 2 319 263 T3

Reference Example 13

4-cyclobutyloxybenzyl alcohol

To a suspension of 4-hydroxybenzaldehyde (0.12 g) and cesium carbonate (0.49 g) in N, N-dimethylformamide (2 mL) was added cyclobutyl bromide (0.15 g), and the mixture was stirred at 65 ° C overnight. A 1 mol / L aqueous sodium hydroxide solution was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was washed with a 0.5 mol / L aqueous sodium hydroxide solution, water, and brine, and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure to yield 4-cyclobutyloxybenzaldehyde (0.13 g). To a solution of the obtained 4-cyclobutyloxybenzaldehyde (0.13 g) in methanol (10 mL) was added sodium borohydride (0.056 g), and the mixture was stirred at room temperature overnight. A 1 mol / L hydrochloric acid solution was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure to yield 4-cyclobutyloxybenzyl alcohol (0.12 g).

H NMR¹ (CDCl₃) δ ppm:

1.50 (1H, t, J = 5.8 Hz), 1.60-1.75 (1H, m), 1.80-1.95 (1H, m), 2.10-2.25 ( 2H, m), 2.40-2.50 (2H, m), 4.61 (2H, d, J = 5.8 Hz), 4.60-4.70 (1H, m), 6.75 -6.85 (2H, m), 7.20-7.30 (2H, m)

Example 15

4 - {[4- (Cyclobutyloxy) phenyl] methyl} -5-methyl-1,2-dihydro-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 3 using 4-cyclobutyloxybenzyl alcohol in place of 4-cyclopropylbenzyl alcohol.

H NMR¹ (DMSO-de) δ ppm:

1.55-1.70 (1H, m), 1.70-1.85 (1H, m), 1.90-2.05 (5H, m), 2.30-2.45 (2H, m ), 3.50 (2H, s), 4.55-4.65 (1H, m), 6.656.75 (2H, m), 6.95-7.10 (2H, m)

Example 16

4 - {[4- (cidobutyloxy) phenyl] methyl} -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a manner similar to that described in Example 4 using 4 - {[4- (cyclobutyloxy) phenyl] -methyl} -5-methyl-1,2-dihydro-3H-pyrazol-3-one instead of 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1,2-dihydro3H-pyrazol-3-one.

H NMR¹ (CDCl₃) δ ppm:

1.55-1.95 (2H, m), 1.88 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2 , 10 (3H, s), 2.00-2.25 (2H, m), 2.35-2.50 (2H, m), 3.52 (1H, d, J = 15.6 Hz), 3.58 (1H, d, J = 15.6 Hz), 3.80-3.90 (1H, m), 4.12 (1H, dd, J = 2.4, 12.3 Hz), 4 , 30 (1H, dd, J = 3.7, 12.3 Hz), 4.50-4.65 (1H, m), 5.15-5.35 (3H, m), 5.50-5 , 60 (1H, m), 6.65-6.75 (2H, m), 6.95-7.05 (2H, m)

Reference Example 14

4 - ({4- [4- (Benzyloxy) phenyl] phenyl} methyl) -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 14 using 4 (benzyloxy) phenylboronic acid in place of 4-fluorophenylboronic acid.

H NMR¹ (CDCl₃) δ ppm:

1.85 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s), 2.15 (3H, s), 3.62 (1H , d, J = 16.0 Hz), 3.69 (1H, d, J = 16.0 Hz), 3.80-3.90 (1H, m), 4.10-4.20 (1H, m), 4.25-4.40 (1H, m), 5.10 (2H, s), 5.15-5.35 (3H, m), 5.55-5.65 (1H, m) ,

6.95-7.55 (13H, m)

Example 17

4 - {[4- (4-Hydroxyphenyl) phenyl] methyl} -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

To a solution of 4 - ({4- [4- (benzyloxy) phenyl] phenyl} methyl) -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H -pyrazole (0.14 g) in methanol (3 mL) 10% palladium-carbon powder (0.030 g) was added, and the mixture was stirred

ES 2 319 263 T3 at room temperature under hydrogen atmosphere for 11 hours. Insoluble matter was removed by filtration, and the solvent in the filtrate was removed under reduced pressure. The residue was purified by column chromatography on aminopropyl silica gel (eluent: hexane / ethyl acetate = 1/1 - 1/5 - dichloromethane / methanol = 10/1) to yield 4 - {[4- (4-hydroxyphenyl ) phenyl] methyl} -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole (0.071 g).

H NMR¹ (CDCl3) δ ppm:

1.85 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.15 (3H, s), 3.62 (1H , d, J = 15.7 Hz), 3.69 (1H, d, J = 15.7 Hz), 3.80-3.90 (1H, m), 4.10-4.20 (1H, m), 4.31 (1H, dd, J = 3.9, 12.6 Hz), 5.12 (1H, bs), 5.15-5.35 (3H, m),

5.55-5.65 (1H, m), 6.80-6.90 (2H, m), 7.10-7.25 (2H, m), 7.35-7.50 (4H, m )

Example 18

4 - {[4- (3-Fluorophenyl) phenyl] methyl} -5-methyl-3- (2,3,4,6-tetra-O_-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 14 using 3-fluorophenylboronic acid in place of 4-fluorophenylboronic acid.

H NMR¹ (CDCl₃) δ ppm:

1.86 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s), 2.16 (3H, s), 3.63 (1H , d, J = 16.1 Hz), 3.71 (1H, d, J = 16.1 Hz), 3.80-3.90 (1H, m), 4.05-4.20 (1H, m), 4.32 (1H, dd, J = 4.0, 12.4 Hz), 5.15-5.35 (3H, m), 5.55-5.65 (1H, m),

6.95-7.05 (1H, m), 7.15-7.50 (7H, m)

Reference Example 15

4- (pyridin-2-yl) benzyl chloride

To a solution of 2- (p-tolyl) pyridine (1.7 g) and N-chlorosuccinimide (1.5 g) in carbon tetrachloride (30 mL) was added α, α-azobisisobutyronitrile (0.033 g), and the mixture was refluxed for 5 hours. Insoluble matter was filtered off, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 5/1-3 / 1) to yield 4- (pyridin-2-yl) benzyl chloride (1.1 g).

H NMR¹ (CDCb) δ ppm:

4.65 (2H, s), 7.20-7.30 (1H, m), 7.45-7.55 (2H, m), 7.65-7.80 (2H, m), 7, 95-8.05 (2H, m), 8.65-8.75 (1H, m)

Example 19

5-Methyl-4 - {[4- (pyridin-2-yl) phenyl] methyl} -1,2-dihydro-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Reference Example 11 using 4- (pyridin-2-yl) benzyl chloride instead of 4-bromobenzyl bromide.

H NMR¹ (DMSO-de) δ ppm:

2.03 (3H, s), 3.60 (2H, s), 7.20-7.30 (2H, m), 7.31 (1H, ddd, J = 1.2, 4.7, 7 , 3 Hz), 7.80-8.00 (4H, m), 8.63 (1H, ddd, J = 0.9, 1.6, 4.7 Hz)

Example 20

3- (eD-Glucopyranosyloxy) -5-methyl-4 - {[4- (cyclopropylidenemethyl) phenyl] methyl} -1H-pyrazole

To a solution of 5-methyl-4 - {[4- (cyclopropylidenemethyl) phenyl] methyl} -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole (0.010 g ) in methanol (2 mL) was added sodium methoxide (28% methanol solution, 0.0020 mL), and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was concentrated under reduced pressure, and the residue was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol) to yield 3- (eD-glucopyranosyloxy) -5-methyl-4- {[4- (cyclopropylidenemethyl) phenyl] methyl} -1H-pyrazole (0.0070 g).

H NMR¹ (CD₃DO) δ ppm:

1.05-1.20 (2H, m), 1.30-1.45 (2H, m), 2.06 (3H, s), 3.25-3.45 (4H, m), 3, 60-3.90 (4H, m), 5.00-5.10 (1H, m), 6.606.70 (1H, m), 7.00-7.20 (2H, m), 7.30- 7.45 (2H, m)

ES 2 319 263 T3

Example 21

3- (eD-Glucopyranosyloxy) -5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1H-pyrazole

To a solution of 5-methyl-4 - [(4-cyclopropylphenyl) -methyl] -3- (2,3,4,6-tetra-O-acetyl-j6-D-glucopyranosyloxy) -1 H-pyrazole (0.14 g) In ethanol (8.4 mL), a 2 mol / L aqueous solution of sodium hydroxide (0.63 mL) was added, and the mixture was stirred at room temperature for 30 minutes. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 6/1) to yield

3- (eD-glucopyranosyloxy) -5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1H-pyrazole (0.087 g).

H NMR¹ (CD₃DO) δ ppm:

0.55-0.70 (2H, m), 0.85-0.95 (2H, m), 1.75-1.90 (1H, m), 2.04 (3H, s), 3, 25-3.45 (4H, m), 3.60-3.90 (4H, m), 5.00-

5.10 (1H, m), 6.85-7.15 (4H, m)

Example 22 (E) -4 - {[4- (But-1-en.-1-yl) phenyl] methyl} -3- (eD-glucopyranOsiloxy) -5-methyl-1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 21 using (E) -4 - {[4- (but1-en-1-yl) -phenyl] methyl} -5-methyl-3- ( 2,3,4,6-tetra-O-acetyl-j6-D-glucopyranosyloxy) -1H-pyrazole instead of 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -3- (2,3,4,6 -tetra-O-acetyl-j6-D-glucopyranosyloxy) -1H-pyrazole.

H NMR¹ (CD₃DO) δ ppm:

1.07 (3H, t, J = 7.4Hz), 2.05 (3H, s), 2.15-2.25 (2H, m), 3.30-3.45 (4H, m) , 3.60-3.80 (3H, m), 3.80-3.90 (1H, m), 5.00-5.10 (1H, m), 6.22 (1H, dt, J = 16.0, 6.5 Hz), 6.33 (1H, d, J = 16.0 Hz), 7.05-7.15 (2H, m), 7.20-7.25 (2H, m )

Example 23

3- (eD-Glucopyranosyloxy) -5-methyl-4 - {[4- (thiazol-2-yl) -phenyl] methyl} -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 21 using 5-methyl-3 (2,3,4,6-tetra-O-acetyl-j6-D-glucopyranosyloxy) -4 - {[4 - (thiazol-2-yl) -phenyl] methyl} -1H-pyrazole instead of 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -3- (2,3,4,6-tetra-O- acetyl-j6-D-glucopyranosyloxy) -1H-pyrazole.

H NMR¹ (CD3OD) 6 ppm:

2.10 (3H, s), 3.25-3.50 (4H, m), 3.60-3.90 (4H, m), 5.05-5.15 (1H, m), 7, 30-7.40 (2H, m), 7.55 (1H, d, J = 3.1 Hz),

7.80-7.90 (3H, m)

Example 24

3- (eD-Glucopyranosyloxy) -4 - {[4- (3-hydroxypropyl) phenyl] -methyl} -5-trifluoromethyl-1H-pyrazole

To a solution of 4 - {[4- (3-hydroxypropyl) phenyl] methyl} -5-trifluoromethyl-3- (2,3,4,6-tetra-O-acetyl-j6-D-glucopyranosyloxy) -1H- Pyrazole (0.45 g) in methanol (7 mL) was added sodium methoxide (28% methanol solution, 0.068 mL), and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography on silica gel (eluent: dichloromethane / methanol = 6/1) to yield 3- (eD-glucopyranosyloxy) -4 - {[4- (3-hydroxypropyl) phenyl] methyl} -5-trifluoromethyl 1H-pyrazole (0.17 g).

H NMR¹ (CD3OD) δ ppm:

1.75-1.85 (2H, m), 2.62 (2H, t, J = 7.6Hz), 3.30-3.45 (4H, m), 3.54 (2H, t, J = 6.2 Hz), 3.68 (1H, dd, J = 5.2, 12.2 Hz), 3.75-3.95 (3H, m), 4.95-5.05 (1H , m), 7.05-7.15 (4H, m)

Example 25

3- (eD-Glucopyranosyloxy) -5-methyl-4 - {[4- (2-methylprop-1-en-1-yl) phenyl] methyl} -1H-pyrazole

The title compound was prepared in a manner similar to that described in Example 21 using 5-methyl-4 - {[4 (2-methylprop-1-en-1-yl) phenyl] methyl} -3- (2, 3,4,6-tetra-O-acetyl-j6-D-glucopyranosyloxy) -1H-pyrazole instead of 5-methyl-

4- [(4-cyclopropylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-j6-D-glucopyranosyloxy) -1 H-pyrazole.

H NMR¹ (CDCl3) δ ppm:

ES 2 319 263 T3

1.81 (3H, d, J = 1.0Hz), 1.86 (3H, s), 2.06 (3H, s), 3.25-3.45 (4H, m), 3.60 -3.80 (3H, m), 3.80-3.90 (1H, m); 5.00-

5.10 (1H, m), 6.15-6.25 (1H, m), 7.00-7.20 (4H, m)

Example 26

4 - {[4- (4-Fluorophenyl) phenyl] methyl} -3- (eD-glucopyranosyloxy) -5-methyl-1H-pyrazole

The title compound was prepared in a manner similar to that described in Example 21 using 4 - {[4- (4-fluorophenyl) -phenyl] methyl} -5-methyl-3- (2,3,4,6- tetra-O-acetyl-j6-D-glucopyranosyloxy) -1H-pyrazole instead of 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl -eD-glucopyranosyloxy) -1H-pyrazole.

H NMR¹ (CD3OD) δ ppm:

2.10 (3H, s), 3.30-3.45 (4H, m), 3.60-3.90 (4H, m), 5.05-5.15 (1H, m), 7, 05-7.20 (2H, m), 7.25-7.35 (2H, m), 7.407.50 (2H, m), 7.50-7.65 (2H, m)

Example 27

4 - {[4- (cyclobutyloxy) phenyl] methyl} -3- (eD-glucopyranosyloxy) -5-methyl-1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 21 using 4 - {[4- (cyclobutyloxy) -phenyl] methyl} -5-methyl-3- (2,3,4,6-tetra- O-acetyl-j6-D-glucopyranosyloxy) -1H-pyrazole instead of 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-j6 -D-glucopyranosyloxy) -1H-pyrazole.

H NMR¹ (CD3OD) δ ppm:

1.60-1.90 (2H, m), 2.00-2.15 (5H, m), 2.35-2.50 (2H, m), 3.30-3.45 (4H, m ), 3.60-3.75 (3H, m), 3.75-3.90 (1H, m), 4.50-4.70 (1H, m), 5.00-5.10 (1H , m), 6.65-6.75 (2H, m), 7.00-7.15 (2H, m)

Example 28

3- (eD-Glucopyranosyloxy) -5-methyl-1-isopropyl-4 - [(4-cyclopropylphenyl) methyl] -1H-pyrazole

To a suspension of 3- (BD-glucopyranosyloxy) -5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1H-pyrazole (56 mg) and cesium carbonate (23 mg) in N, N-dimethylformamide (1 , 5 mL) 2-iodopropane (0.043 mL) was added at 80 ° C, and the mixture was stirred for 35 minutes. Water was added to the reaction mixture, and the mixture was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol). The obtained crude product was purified by preparative thin-layer silica gel chromatography (developing solvent: dichloromethane / methanol = 7/1) to yield 3- (eD-glucopyranosyloxy) -5-methyl-1-isopropyl-4- [ (4-cyclopropylphenyl) methyl] -1H-pyrazole (45 mg).

H NMR¹ (CD3OD) δ ppm:

0.50-0.65 (2H, m), 0.80-0.95 (2H, m), 1.36 (3H, d, J = 6.6 Hz), 1.37 (3H, d, J = 6.6 Hz), 1.75-1.90 (1H, m), 2.07 (3H, s), 3.15-3.50 (4H, m), 3.60-3.85 (4H, m), 4.30-4.50 (1H, m), 4.95-5.10 (1H, m), 6.85-7.10 (4H, m)

Example 29

3- (eD-Glucopyranosyloxy) -4 - {[4- (4-hydroxyphenyl) phenyl] -methyl} -5-methyl-1H-pyrazole

The title compound was prepared in a manner similar to that described in Example 21 using 4 - {[4- (4-hydroxyphenyl) -phenyl] methyl} -5-methyl-3- (2,3,4,6-tetra- O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole instead of 5-methyl-4 [(4-cyclopropylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-j6-D- glucopyranosyloxy) -1H-pyrazole.

H NMR¹ (CD3OD) δ ppm:

2.09 (3H, s), 3.25-3.45 (4H, m), 3.60-3.90 (4H, m), 5.00-5.10 (1H, m), 6, 75-6.85 (2H, m), 7.15-7.25 (2H, m), 7.30-

7.45 (4H, m)

Example 30

4 - {[4- (3-Fluorophenyl) phenyl] methyl} -3- (eD-Glucopyranosyloxy) -5-methyl-1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 21 using 4 - {[4- (3-fluorophenyl) -phenyl] methyl} -5-methyl-3- (2,3,4,6 -tetra-O-acetyl-j6-D-glucopyranosyloxy) -1H-pyrazole instead of 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -3- (2,3,4,6-tetra-O- acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

ES 2 319 263 T3

H NMR¹ (CD3OD) δ ppm:

2.10 (3H, s), 3.25-3.55 (4H, m), 3.60-3.90 (4H, m), 5.00-5.15 (1H, m), 6, 95-7.10 (1H, m), 7.25-7.35 (3H, m), 7.35-

7.45 (2H, m), 7.45-7.55 (2H, m)

Example 31

3- (eD-Glucopyranosyloxy) -5-methyl-4 - {[4- (pyridin-2-yl) -phenyl] methyl} -1H-pyrazole

5-Methyl-4 - {[4- (pyridin-2-yl) phenyl] methyl} -3- (2,3,4,6-tetraacetyl-eD-glucopyranosyloxy) -1H-pyrazole was prepared in a similar manner to that described in Example 4 using 5-methyl-4 - {[4- (pyridin-2-yl) phenyl] methyl} -1,2-dihydro-3H-pyrazol-3-one instead of 5-methyl-4- [(4-cyclopropylphenyl) -methyl] -1,2-dihydro-3H-pyrazol-3-one. The title compound was then prepared in a similar manner to that described in Example 21 using 5-methyl-4 - {[4- (pyridin-2-yl) phenyl] -methyl} -3- (2,3,4 , 6-tetraacetyl-eD-glucopyranosyloxy) -1H-pyrazole instead of 5-methyl-4 - [(4-cyclopropylphenyl) methyl] 3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy ) -1H-pyrazole.

H NMR¹ (CD3OD) δ ppm:

2.10 (3H, s), 3.30-3.45 (4H, m), 3.60-3.90 (4H, m), 5.00-5.15 (1H, m), 7, 25-7.40 (3H, m), 7.75-7.95 (4H, m), 8.508.60 (1H, m)

Example 32

3- (eD-Glucopyranosyloxy) -5-methyl-1- (cyclopropylmethyl) -4 - [(4-cyclopropylphenyl) methyl] -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 28 using (bromomethyl) cyclopropane in place of 2-iodopropane.

H NMR¹ (CD3OD) δ ppm:

0.25-0.40 (2H, m), 0.45-0.65 (4H, m), 0.80-0.95 (2H, m), 1.05-1.25 (1H, m ), 1.75-1.90 (1H, m), 2.08 (3H, s), 3.25-

3.45 (4H, m), 3.55-3.90 (6H, m), 5.00-5.10 (1H, m), 6.85-7.10 (4H, m)

Example 33

3- (eD-Glucopyranosyloxy) -1- (2-hydroxyethyl) -5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1H-pyrazole

To a suspension of 3- (eD-glucopyranosyloxy) -5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1 H-pyrazole (33 mg) and cesium carbonate (138 mg) in N, N-dimethylformamide ( 1 mL) was added ethyl 2-bromoacetate (0.035 mL) at 40 ° C, and the mixture was stirred for 2 hours. Water was added to the reaction mixture, and the mixture was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol). The obtained crude product was dissolved in methanol (1 mL), and a 2 mol / L aqueous solution of sodium hydroxide (0.04 mL) was added to the solution, and the mixture was stirred at room temperature for 30 minutes. The solvent was removed under reduced pressure, and the residue was purified by column chromatography on ODS (elution solvent: methanol / water = 3/2) to yield 3- (eD-glucopyranosyloxy) -1- (2-hydroxyethyl) - 5-methyl-4 - [(4-cyclopropylphenyl) methyl] -1H-pyrazole (8 mg).

H NMR¹ (CD3OD) δ ppm:

0.45-0.55 (2H, m), 0.70-0.85 (2H, m), 1.65-1.80 (1H, m), 2.01 (3H, s), 3, 15-3.35 (4H, m), 3.50-3.65 (3H, m), 3.653.75 (3H, m), 3.90 (2H, t, J = 5.5 Hz), 4 , 95-5.05 (1H, m), 6.80-6.90 (2H, m), 6.90-7.00 (2H, m)

Example 34

3- (eD-Glucopyranosyloxy) -5-methyl-1-cyclopentyl-4 - [(4-cyclopropylphenyl) methyl] -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 28 using bromocyclopentane in place of 2-iodopropane.

H NMR¹ (CD3OD) δ ppm:

0.55-0.65 (2H, m), 0.80-1.00 (2H, m), 1.50-1.75 (2H, m), 1.75-2.10 (7H, m ), 2.07 (3H, s), 3.15-3.45 (4H, m), 3.55-

3.85 (4H, m), 4.45-4.65 (1H, m), 5.00-5.10 (1H, m), 6.85-7.10 (4H, m)

ES 2 319 263 T3

Reference Example 16

4 - [(4-Ethylphenyl) methyl] -5-methyl-1,2-dihydro-3H-pyrazol-3-one

To a solution of 4-ethylbenzyl alcohol (2.5 g) and triethylamine (2.5 mL) in tetrahydrofuran (35 mL) was added methanesulfonyl chloride (1.4 mL), and the mixture was stirred at room temperature for 1 hour. Insoluble matter was filtered off. A solution of the obtained 4-ethylbenzyl methanesulfonate in tetrahydrofuran was added to a suspension of sodium hydride (60%, 0.72 g) and methyl acetoacetate (1.9 mL) in 1,2-dimethoxyethane (40 mL), and the mixture was stirred at 70 ° C for 2 hours. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. Hydrazine monohydrate (2.7 mL) was added to a solution of the residue in toluene (50 mL), and the mixture was stirred at 80 ° C for 2 hours. After cooling the reaction mixture to room temperature, hexane was added to the mixture. The precipitates were collected by filtration, washed with water and hexane, and dried under reduced pressure to yield 4 - [(4-ethylphenyl) methyl] -5-methyl-1,2-dihydro3H-pyrazol-3-one (1 ,2 g).

H NMR¹ (DMSO-de) δ ppm:

1.13 (3H, t, J = 7.6Hz), 2.00 (3H, s), 2.45-2.60 (2H, m), 3.49 (2H, s), 7.00 -7.15 (4H, m)

Reference Example 17

4 - [(4-Ethylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O_-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

To a suspension of 4 - [(4-ethylphenyl) methyl] -5-methyl-1,2-dihydro-3H-pyrazol-3-one (0.65 g) and acetobromo-aD-glucose (1.2 g) Silver carbonate (0.83 g) was added in tetrahydrofuran (15 mL), and the mixture was stirred at 60 ° C overnight protected from light. The reaction mixture was purified by column chromatography on aminopropyl silica gel (eluent: tetrahydrofuran), and successively by column chromatography on silica gel (eluent: hexane / ethyl acetate = 1/3) to yield 4 - [( 4-ethylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-j6D-glucopyranosyloxy) -1H-pyrazole (0.61 g).

H NMR¹ (CDCl₃) δ ppm:

1.19 (3H, t, J = 7.6Hz). 1.86 (3H, s), 2.02 (3H, s), 2.03 (3H, s), 2.07 (3H, s), 2.12 (3H, s), 2.58 (2H , c, J = 7.6 Hz), 3.56 (1H. d, J = 15.7 Hz), 3.63 (1H, d, J = 15.7 Hz), 3.80-3.90 (1H, m), 4.13 (1H, dd, J = 2.4, 12.5 Hz), 4.31 (1H, dd, J = 4.1, 12.5 Hz), 5.10- 5.35 (3H, m), 5.50-5.65 (1H, m), 7.00-7.15 (4H, m), 8.91 (1H, bs)

Reference Example 18

1- (2-Benzyloxyethyl) -4 - [(4-ethylphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-methyl-1H-pyrazole

To a suspension of 4 - [(4-ethylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-j6-D-glucopyranosyloxy) -1 H-pyrazole (0.030 g ) and cesium carbonate (0.091 g) in acetonitrile (0.4 mL), benzyl (2-bromoethyl) ether (0.035 mL) was added, and the mixture was stirred at 80 ° C for 30 minutes. After cooling to room temperature, the reaction mixture was further stirred overnight. Methanol (0.4 mL) and a 2 mol / L aqueous solution of sodium hydroxide (0.55 mL) were added to the reaction mixture, and the mixture was stirred at room temperature for 1 hour. Water was added to the reaction mixture, and the mixture was purified by solid phase extraction in CBA (washing solvent: distilled water, eluent: methanol), and successively by column chromatography on silica gel (eluent: dichloromethane / methanol = 10/1 - 5/1) to yield to yield 1- (2-benzyloxyethyl) -4 - [(4-ethylphenyl) -methyl] 3- (eD-glucopyranosyloxy) -5-methyl-1H-pyrazole (0.012 g ).

H NMR¹ (CD3OD) δ ppm:

1.17 (3H, t, J = 7.6Hz), 2.08 (3H, s), 2.56 (2H, c, J = 7.6Hz), 3.25-3.45 (4H , m), 3.60-3.90 (6H, m), 4.05-4.20 (2H, m), 4.30-4.45 (2H, m), 5.00-5.10 (1H, m), 7.00-7.30 (9H, m)

Reference Example 19

5-Methyl-4 - [(4-methylthiophenyl) methyl] -1,2-dihydro-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Reference Example 16 using 4-methylthiobenzyl alcohol in place of 4-ethylbenzyl alcohol.

H NMR¹ (DMSO-de) δ ppm:

ES 2 319 263 T3

1.99 (3H, s), 2.42 (3H, s), 3.50 (2H, s), 7.05-7.20 (4H, m)

Reference Example 20

5-Methyl-4 - [(methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to that described in Reference Example 17 using

5-methyl-4 - [(4-methylthiophenyl) methyl] -1,2-dihydro-3H-pyrazol-3-one instead of 4 - [(4-ethylphenyl) methyl] -5-methyl-1,2- dihydro3H-pyrazol-3-one.

H NMR¹ (CDCl₃) δ ppm:

1.88 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.07 (3H, s), 2.12 (3H, s), 2.44 (3H , s), 3.50-3.65 (2H, m), 3.80-3.90 (1H, m), 4.13 (1H, dd, J = 2.4, 12.4 Hz), 4.31 (1H, dd, J = 4.1, 12.4 Hz), 5.15-5.30 (3H, m), 5.55-5.65 (1H, m), 7.00- 7.10 (2H, m), 7.10-7.20 (2H, m), 8.65-8.85 (1H, bs)

Reference Example 21

3- (eD-Glucopyranosyloxy) -5-methyl-4 - [(4-methylthiophenyl) -methyl] -1H-pyrazole

To a solution of 5-methyl-4 - [(methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1 H-pyrazole (0.42 g) in Ethanol (5 mL) was added sodium methoxide (28% methanol solution, 0.042 mL), and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography on silica gel (eluent: dichloromethane / methanol = 5/1) to yield 3- (BD-glucopyranosyloxy) -5-methyl-4- [(4-methylthiophenyl) methyl] -1H-pyrazole (0.23 g).

H NMR¹ (CD₃DO) δ ppm:

2.06 (3H, s), 2.42 (3H, s), 3.20-3.45 (4H, m), 3.55-3.75 (3H, m), 3.80-3, 90 (1H, m), 5.00-5.10 (1H, m), 7.05-7.20 (4H, m)

Reference Example 22

4- [(4-Isopropoxyphenyl) methyl] -5-methyl-1,2-dihydro-3H-pyrazol-3-one

Triethylamine (0.28 mL) and methanesulfonyl chloride (0.16 mL) were added to a solution of 4-isopropoxybenzyl alcohol (0.34 g) in tetrahydrofuran (6 mL), and the mixture was stirred at room temperature for 30 minutes. Insoluble matter was filtered off. a solution of the 4-isopropoxybenzyl methanesulfonate obtained in tetrahydrofuran was added to a suspension of sodium hydride (60%, 81 mg) and methyl acetoacetate (0.20 mL) in 1,2-dimethoxyethane (10 mL), and the mixture was stirred at 80 ° C overnight. The reaction mixture was poured into a saturated aqueous sodium hydrogen carbonate solution, and the mixture was extracted with diethyl ether. The organic layer was washed with brine and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure, and the residue was dissolved in toluene (5 mL). Anhydrous hydrazine (0.19 mL) was added to the mixture, and the mixture was stirred at 80 ° C overnight. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 10/1) to yield 4 - [(4-isopropoxyphenyl) methyl] -

5-methyl-1,2-dihydro-3H-pyrazol-3-one (95 mg).

H NMR¹ (DMSO-d) δ ppm:

1.22 (6H, d, J = 6.0Hz), 1.99 (3H, s), 3.45 (2H, s), 4.40-4.60 (1H, m), 6.65 -6.80 (2H, m), 6.95-7.10 (2H, m)

Reference Example 23

4 - [(4-Isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

To a suspension of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1,2-dihydro-3H-pyrazol-3-one (46 mg), acetobromo-aD-glucose (99 mg) and 4A molecular sieves Silver carbonate (66 mg) was added in tetrahydrofuran (3 mL), and the mixture was stirred at 65 ° C overnight protected from light. The reaction mixture was purified by column chromatography on aminopropyl silica gel (eluent: tetrahydrofuran), and successively by preparative thin-layer silica gel chromatography (developing solvent: ethyl acetate / hexane = 2/1) to yield 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1 H-pyrazole (42 mg).

H NMR¹ (CDCl₃) δ ppm:

ES 2 319 263 T3

1.25-1.35 (6H, m), 1.88 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2 , 10 (3H, s), 3.45-3.65 (2H, m), 3.80-3.90 (1H, m), 4.13 (1H, dd, J = 2.3, 12, 4Hz), 4.31 (1H, dd, J = 4.0, 12.4Hz), 4.40-4.55 (1H, m), 5.15-5.35 (3H, m), 5.505.60 (1H, m), 6.70-6.80 (2H, m), 6.95-7.05 (2H, m)

Reference Example 24

3- (eD-Glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole

To a solution of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1 H-pyrazole (61 mg) in ethanol ( 3 mL), a 1 mol / L aqueous solution of sodium hydroxide (0.53 mL) was added, and the mixture was stirred at room temperature for 2 hours. The solvent was removed under reduced pressure, and the residue was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol) to yield 3- (eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1 H-pyrazole (39 mg).

H NMR¹ (CD3OD) δ ppm:

1.26 (6H, d, J = 5.9Hz), 2.05 (3H, 5), 3.25-3.45 (4H, m), 3.55-3.75 (3H, m) , 3.75-3.90 (1H, m), 4.45-4.60 (1H, m), 5.00-5.10 (1H, m), 6.70-6.80 (2H, m), 7.00-7.15 (2H, m)

Example 35

4 - [(4-Ethylphenyl) methyl] -3- (BD-glucopyranosyloxy) -1- (2-hydroxyethyl) -5-methyl-1H-pyrazole

A solution of 1- (2-benzyloxyethyl) -4 - [(4-ethylphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-methyl-1H-pyrazole (0.012 g) in ethanol (2 mL) was A catalytic amount of 10% palladium-carbon powder was added thereto, and the mixture was stirred at room temperature under hydrogen atmosphere for 30 minutes. Insoluble matter was removed by filtration, and the solvent was removed under reduced pressure to yield 4 - [(4-ethylphenyl) -methyl] -3- (eD-glucopyranosyloxy) 1- (2-hydroxyethyl) -5-methyl-1H -pyrazole (0.011 g).

H NMR¹ (CD3OD) δ ppm:

1.18 (3H, t, J = 7.6Hz), 2.11 (3H, s), 2.56 (2H, c, J = 7.6Hz), 3.25-3.50 (4H , m), 3.55-3.95 (6H, m), 3.95-4.05 (2H, m), 5.05-5.15 (1H, m), 7.00-7.15 (4H, m)

Example 36

3- (eD-Glucopyranosyloxy) -1- (3-hydroxypropyl) -5-methyl-4 - [(4-methylthiophenyl) methyl] -1H-pyrazole

To a suspension of 3- (eD-glucopyranosyloxy) -5-methyl-4 - [(4-methylthiophenyl) methyl] -1 H-pyrazole (0.020 g) and cesium carbonate (0.11 g) in N, N- Dimethylformamide (0.5 mL) was added 3-bromopropanol (0.022 mL), and the mixture was stirred at 40 ° C overnight. Water was added to the reaction mixture, and the mixture was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol), and successively by column chromatography on silica gel (eluent: dichloromethane / methanol = 5/1) to yield 3- (BD-glucopyranosyloxy) -1- (3-hydroxypropyl) -5-methyl-4 - [(4-methylthiophenyl) methyl] -1H-pyrazole (0.011 g).

H NMR¹ (CD3OD) δ ppm:

1.85-1.95 (2H, m), 2.10 (3H, s), 2.42 (3H, s), 3.25-3.45 (4H, m), 3.45-3, 55 (2H, m), 3.60-3.75 (3H, m), 3.82 (1H, dd, J = 1.8, 12.2 Hz), 3.95-4.10 (2H, m), 5.00-5.15 (1H, m); 7.05-7.20 (4H, m)

Example 37

1-Allyl-4 - [(4-ethylphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-methyl-1H-pyrazole

To a suspension of 4 - [(4-ethylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-je-D-glucopyranosyloxy) -1 H-pyrazole (0.030 g ) and cesium carbonate (0.036 g) in acetonitrile (0.4 mL) was added allyl iodide (0.010 mL), and the mixture was stirred at room temperature for 1 hour. Methanol (0.4 mL) and a 1 mol / L aqueous solution of sodium hydroxide (0.5 mL) were added to the reaction mixture, and the mixture was stirred at room temperature for 1 hour. Water was added to the reaction mixture, and the mixture was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol), and successively by column chromatography on silica gel (eluent: dichloromethane / methanol = 10/1) to yield 1-allyl-4 - [(4-ethylphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-methyl-1H-pyrazole (0.018 g).

H NMR¹ (CD3OD) δ ppm:

ES 2 319 263 T3

1.18 (3H, t, J = 7.5Hz), 2.04 (3H, s), 2.57 (2H, c, J = 7.5Hz), 3.25-3.45 (4H , m), 3.55-3.95 (4H, m), 4.50-4.65 (2H, m), 4.80-4.95 (1H, m), 5.00-5.20 (2H, m), 5.85-6.00 (1H, m), 7.00-7.15 (4H, m)

Example 38

1- (cyclopropylmethyl) -3- (eD-glucopyranosyloxy) -5-methyl-4 - [(4-methylthiophenyl) methyl] -1H-pyrazole

To a solution of 3- (BD-glucopyranosyloxy) -5-methyl-4 - [(4-methylthiophenyl) methyl] -1H-pyrazole (0.081 g) in N, N-dimethylformamide (1 mL) was added cesium carbonate (0 , 40 g), bromomethylcyclopropane (0.099 mL) and a catalytic amount of sodium iodide, and the mixture was stirred at room temperature for 7 days. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water, and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 10/1 - 8/1) to yield 1- (cyclopropylmethyl) -3- (eD-glucopyranosyloxy) -5-methyl-4- [ (4-methylthiophenyl) methyl] -1H-pyrazole (0.041 g).

H NMR¹ (CD₃DO) δ ppm:

0.25-0.40 (2H, m), 0.40-0.60 (2H, m), 1.05-1.25 (1H, m), 2.10 (3H, s), 2, 42 (3H, s), 3.25-3.45 (4H, m), 3.55-3.90 (6H, m), 5.00-5.10 (1H, m), 7.00- 7.25 (4H, m)

Example 39

4 - [(4-Ethylphenyl) methyl] -3- (eD-glucopyranosyloxy) -1- (3-hydroxypropyl) -5-methyl-1H-pyrazole

To a suspension of 4 - [(4-ethylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-je-D-glucopyranosyloxy) -1 H-pyrazole (0.030 g ) and cesium carbonate (0.091 g) in acetonitrile (0.4 mL), benzyl (3-bromopropyl) ether (0.039 mL) was added, and the mixture was stirred at 80 ° C for 30 minutes. Methanol (0.4 mL) and a 2 mol / L aqueous solution of sodium hydroxide (0.55 mL) were added to the reaction mixture, and the mixture was stirred at room temperature overnight. Water was added to the reaction mixture, and the mixture was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol). A catalytic amount of 10% palladium-carbon powder was added to the resulting eluent, and the mixture was stirred at room temperature under hydrogen atmosphere for 3 days. Insoluble matter was removed by filtration, and the solvent in the filtrate was removed under reduced pressure. The residue was purified by liquid chromatography on ODS (eluent: methanol / water = 40/60) to yield 4 - [(4-ethylphenyl) methyl] -3- (eD-glucopyranosyloxy) -1- (3-hydroxypropyl) -5 -methyl-1H-pyrazole (0.0080 g).

H NMR¹ (CD₃DO) δ ppm:

1.18 (3H, t, J = 7.5 Hz), 1.85-2.00 (2H, m), 2.10 (3H, s), 2.57 (2H, c, J = 7, 5Hz), 3.25-3.45 (4H, m), 3.45-3.55 (2H, m), 3.55-3.90 (4H, m), 3.95-4.10 (2H, m), 5.00-5.10 (1H, m), 7.00-7.15 (4H, m)

Example 40

1- (cyclopropylmethyl) -3- (eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole

To a suspension of 3- (BD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole (0.050 g), cesium carbonate (0.20 g) and a catalytic amount of iodide sodium in N, N-dimethylformamide (1 mL), bromomethylcyclopropane (0.050 g) was added at 50 ° C, and the mixture was stirred for 3 days. Water was added to the reaction mixture, and the mixture was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol), and successively by column chromatography on silica gel (eluent: dichloromethane / methanol = 8/1) to yield 1- (cyclopropylmethyl) -3- (BD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole (0.034 g).

H NMR¹ (CD₃DO) δ ppm:

0.25-0.35 (2H, m), 0.45-0.55 (2H, m), 1.10-1.25 (1H, m), 1.26 (6H, d, J = 6 , 1 Hz), 2.09 (3H, s), 3.25-3.45 (4H, m), 3.55-3.75 (3H, m), 3.75-3.90 (3H, m), 4.45-4.55 (1H, m), 5.00-5.10 (1H, m), 6.70-6.85 (2H, m), 7.00-7.15 ( 2H, m)

Example 41

1-cyclopentyl-3- (eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole

To a suspension of 3- (BD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole (0.050 g) and cesium carbonate (0.20 g) in N, N-dimethylformamide (1 mL) Cyclopentyl bromide (0.055 g) was added at 80 ° C, and the mixture was stirred for 30 minutes. After cooling to room temperature, water was added to the reaction mixture.

ES 2 319 263 T3 tion, and the mixture was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol), and successively by column chromatography on silica gel (eluent: dichloromethane / methanol = 8 / 1) to yield 1-cyclopentyl-3- (BD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole (0.034 g).

H NMR¹ (CD3OD) δ ppm:

1.26 (6H, d, J = 6.1Hz), 1.55-1.75 (2H, m), 1.80-2.05 (6H, m), 2.03 (3H, s) , 3.15-3.30 (1H, m), 3.30-3.45 (3H, m), 3.60-3.75 (3H, m), 3.77 (1H, dd, J = 2.6, 12.0 Hz), 4.40-4.65 (2H, m), 5.00-5.10 (1H, m), 6.70-6.85 (2H, m), 7.007 , 15 (2H, m)

Example 42

1- (cyclopropylmethyl) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (6-O-propionyl-eD-glucopyranosyloxy) -1H-pyrazole

To a solution of 1- (cyclopropylmethyl) -3- (eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole (0.40 g) in 2,4,6- Trimethylpyridine (1.5 mL) was added propionyl chloride (0.0088 g) at 0 ° C, and the mixture was stirred for 3 hours. Citric acid monohydrate (3.3 g) and water were added to the reaction mixture, and the mixture was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol), and successively by chromatography in column on silica gel (eluent: dichloromethane / methanol = 10/1) to yield 1- (cyclopropylmethyl) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (6-O-propionyl-j6- D-glucopyranosyloxy) -1Hpyrazole (0.20 g).

H NMR¹ (CD3OD) δ ppm:

0.25-0.35 (2H, m), 0.45-0.55 (2H, m), 1.05 (3H, t, J = 7.6 Hz), 1.15-1.25 ( 1H, m), 1.26 (6H, d, J = 6.3 Hz), 2.07 (3H, s), 2.29 (2H, c, J = 7.6 Hz), 3.30- 3.55 (4H, m), 3.55-3.70 (2H, m), 3.82 (2H, d, J = 6.7Hz), 4:22 (1H, dd, J = 5, 4, 12.0 Hz), 4.32 (1H, dd, J = 2.3, 12.0 Hz), 4.45-4.55 (1H, m), 5.05-5.15 (1H , m) 6.70-6.80 (2H, m), 7.00-7.15 (2H, m)

Example 43

1- (cyclopropylmethyl) -3- (6-O-ethoxycarbonyl-eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole

To a solution of 1- (cyclopropylmethyl) -3- (BD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole (0.050 g) in 2,4,6-trimethylpyridine (1 mL) was added ethyl chloroformate (0.035 g), and the mixture was stirred at room temperature overnight. Citric acid monohydrate (3.3 g) and water were added to the reaction mixture, and the mixture was purified by solid phase extraction in ODS (washing solvent: distilled water, eluent: methanol), and successively by chromatography in column on silica gel (eluent: dichloromethane / methanol = 10/1) to yield 1- (cyclopropylmethyl) -3- (6-O-ethoxycarbonyl-j6-D-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -

5-methyl-1H-pyrazole (0.043 g).

H NMR¹ (CD3OD) δ ppm:

0.25-0.35 (2H, m), 0.45-0.55 (2H, m), 1.05-1.25 (1H, m), 1.23 (3H, t, J = 7 , 1Hz), 1.26 (6H, d, J = 6.1Hz), 2.08 (3H, s), 3.30-3.50 (4H, m), 3.62 (1H, d , J = 16.2 Hz), 3.67 (1H, d, J = 16.2 Hz), 3.82 (2H, d, J = 6.6 Hz), 4.13 (2H, c, J = 7.1 Hz), 4.23 (1H, dd, J = 5.2, 11.7 Hz), 4.37 (1H, dd, J = 2.1, 11.7 Hz), 4.45 -4.55 (1H. M), 5.05-5.15 (1H, m), 6.70-6.80 (2H, m), 7.00-7.15 (2H, m)

Test Example 1

Analysis of the inhibitory effect on the activity of human SGLT2

1) Construction of the plasmid vector expressing human SGLT2

The preparation of the cDNA library for PCR amplification was carried out by reverse transcription of total RNA obtained from the human kidney (Ori gene) with oligo dT as a primer, using the SUPERSCRIPT Preamplification System (Gibco-BRL: LIFE TECHNOLOGIES). The DNA fragment encoding human SGLT2 was amplified by the PCR reaction, in which the human kidney cDNA library described above was used as a template and the following oligonucleotides 0702F and 0712R, presented as Sequence Numbers 1 and 2 respectively, were used as primers. The amplified DNA fragment was ligated into pCR-Blunt (Invitrogen), a vector for cloning, according to the standard kit method. Escherichia coli HB101 was transformed according to the usual method and then selection of transformants was performed on LB agar medium containing 50 pg / ml. kanamycin. After extracting and purifying the plasmid DNA of one of the transformants, the DNA fragment encoding human SGLT2 was amplified by means of the PCR reaction, in which the following oligonucleotides 0714F and 0715R, presented as Sequence Numbers 3 and 4 respectively, they were used as primers. The amplified DNA fragment was digested with restriction enzymes, XhoI and Hind III, and

ES 2 319 263 T3 was then purified with Wizard Purification System (Promega). This purified DNA fragment was inserted into the corresponding restriction sites of pcDNA3.1 (-) Myc / His-B (Invitrogen), a vector for expression of the fusion protein. Escherichia coli HB101 was transformed according to a standard method and then selection of the transformant was performed on LB agar medium containing 100 pg / mL ampicillin. After extracting and purifying the plasmid DNA from this transformant, the base sequence of the DNA fragment inserted into the multiple cloning sites of the pcDNA3.1 (-) Myc / His-B vector was analyzed. This clone had a single substitution of bases (ATC encoding isoleucine-433 was replaced by GTC) compared to human SGLT2 reported by Wells et al (Am. J. Phisiol., Vol. 263, pp. 459-465 (1992)). Successively, a clone was obtained in which valine is replaced by isoleucine 433. This plasmid vector expressing human SGLT2 in which the peptide presented as Sequence Number 5 is fused to the carboxy terminal alanine residue was named KL29.

<td>Sequence Number 1</td><td>ATGGAGGAGCACACAGAGAGGC</td>

<td>Sequence Number 2</td><td>GGCATAGAAGCCCCAGAGGA</td>

<td>Sequence Number 3</td><td>AACCTCGAGATGGAGGAGCACACAGAGGC</td>

<td>Sequence Number 4</td><td>AACAAGCTTGGCATAGAAGCCCCAGAGGA</td>

<td>Sequence Number 5</td><td>KLGPEQKLISEEDLNSAVDHHHHHH</td>

2) Preparation of cells expressing human SGLT2 transiently

KL29, the plasmid encoding human SGLT2, was transfected into COS-7 cells (RIKEN CELL BANK RCB0539) by electroporation. Electroporation was performed with GENE PULSER II (Bio-Rad Laboratories) under conditions: 0.290 kV, 975 pF, 2 x 10⁶ COS-7 cells and 20 pg of KL29 in 500 pL of OPTI-MEM I medium (Gibco-BRL: LIFE TECHNOLOGIES) in the 0.4 cm type cuvette. After gene transfer, cells were harvested by centrifugation and resuspended in OPTI-MEM I medium (1 mL / cuvette). 125 pL of this cell suspension was added to each well of a 96-well plate. After culturing overnight at 37 ° C in CO₂ at 5%, 125 pL of DMEM medium containing 10% fetal bovine serum (Sanko Jyunyaku), 100 units / mL of penicillin G sodium (Gibco-BRL: LIFE TECHNOLOGIES), and 100 pg / mL of streptomycin sulfate (Gibco-BRL: LIFE TECHNOLOGIES). These cells were cultured overnight and then used for the measurement of methyl-aD-glucopyranoside uptake inhibitory activity.

3) Measurement of the absorption inhibitory activity of methyl-aD-glucopyranoside

After dissolving a test compound in dimethylsulfoxide and diluting with the absorption buffer (a pH 7.4 buffer containing 140 mM sodium chloride, 2 mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride, methyl-aD 5 mM -glucopyranoside, 2- [4- (2-hydroxyethyl) -1-piperazinyl] ethanesulfonic acid 10 mM and tris (hydroxymethyl) aminomethane) 5 mM, each diluent was used as a test sample for the measurement of inhibitory activity. After removal of the medium from the COS-7 cells that express human SGLT2 transiently, 200 pL of the pretreatment buffer (a pH 7.4 buffer containing 140 mM choline chloride, 2 mM potassium chloride) was added to each well. , 1 mM calcium chloride, 1 mM magnesium chloride, 10 mM 2- [4- (2-hydroxyethyl) -1piperazinyl] ethanesulfonic acid and 5 mM tris (hydroxymethyl) -aminomethane), and the cells were incubated at 37 ° C for 10 minutes. After removing the pretreatment buffer, 200 pL of the same buffer was added again, and the cells were incubated at 37 ° C for 10 minutes. The buffer for measurement was prepared by adding and mixing 7 pL of methyl-aD- (U-14C) glucopyranoside (Amersham Pharmacia Biotech) to 525 pL of the prepared test sample. For the control, the measurement buffer was prepared without any test compound. For the estimation of basal absorption in the absence of a test compound and sodium, the buffer for the measurement of basal absorption, containing 140 mM choline chloride instead of sodium chloride, was prepared in a similar manner. After removing the pretreatment buffer, 75 pL of each buffer was added to each well for measurement, and the cells were incubated at 37 ° C for 2 hours. After removing the buffer for measurement, 200 pL of the wash buffer (a pH 7.4 buffer containing 140 mM choline chloride, 2 mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride) was added to each well. mM, 10 mM methyl-aD-glucopyranoside, 10 mM 2- [4- (2-hydroxyethyl) 1-piperazinyl] ethanesulfonic acid and 5 mM tris (hydroxymethyl) aminomethane) and immediately removed. After two additional washes, the cells were solubilized by adding 75 pL of a 0.2 mol / L aqueous solution of sodium hydroxide to each well. After transferring the cell lysates to the PicoPlate (Packard) and adding 150 pL of MicroScint-40 (Packard) to each well, radioactivity was measured with a TopCount microplate scintillation counter (Packard). The difference in absorption was obtained as the 100% value by subtracting the radioactivity of the basal absorption from that of the control and then the concentrations at which 50% of the absorption was inhibited (CI₅₀) from the concentration-inhibition curve using the least squares method. The results are shown in the following Table 1.

ES 2 319 263 T3

TABLE 1

<td>Test compound</td><td>CI value₅₀ (nM)</td>

<td>Example 20</td><td> 15</td>

<td>Example 21</td><td> 18</td>

<td>Example 22</td><td> 41</td>

<td>Example 23</td><td> 46</td>

<td>Example 24</td><td> 57</td>

<td>Example 25</td><td> 65</td>

<td>Example 26</td><td> 150</td>

<td>Example 27</td><td> 210</td>

<td>Example 32</td><td> 26</td>

<td>Example 38</td><td> 45</td>

<td>Example 39</td><td> 47</td>

<td>WAY-123783</td><td> &gt;100000</td>

Industrial applicability

The glucopyranosyloxypyrazole derivatives represented by the above general formula (I) of the present invention, their pharmaceutically acceptable salts and their prodrugs show an excellent hypoglycemic effect by excreting excess glucose in the urine through the prevention of reabsorption of glucose in the kidney because they show excellent human SGLT2 inhibitory activity. The present invention can provide drugs for the prevention or treatment of a disease associated with hyperglycemia such as diabetes, diabetic complications, obesity or the like. Furthermore, since the compounds represented by the above general formula (III) or (IV) or their salts are important as intermediates in the production of the compounds represented by the above general formula (I), their pharmaceutically acceptable salts and their prodrugs, the compounds represented by the general formula (I) above, their pharmaceutically acceptable salts and their prodrugs of the present invention can be easily prepared through such compounds.

Sequence list free text

<td>Sequence Number 1:</td><td>Synthetic DNA primer</td>

<td>Sequence Number 2:</td><td>Synthetic DNA primer</td>

<td>Sequence Number 3:</td><td>Synthetic DNA primer</td>

<td>Sequence Number 4:</td><td>Synthetic DNA primer</td>

<td>Sequence Number 5:</td><td>Peptide fused to the carboxyl terminal alanine residue of human SGLT2</td>