Enzymatic treatment of oils

p00001Enzymatic oil treatment.

Field of the Invention

p00002The present invention relates to a new procedure for the elimination and / or enzymatic reduction of diglyceride (preferably 1,2-diacylglyceride) from an edible oil.

Technical background

p00003The oils and fats are constituted by complex mixtures of triacylglycerols (TAG), diacylglycerols (DAG), free fatty acids and other components in smaller proportion. The crystallization of these mixtures depends on the characteristics of the TAG (structure, chain length, saturation compared with unsaturation and the like) and the interaction of these GADs with each of the others. Regarding the presence of DAGs, previous studies have shown that they have an effect significant about the physical properties of oils and fat These vary from crystallization rate, changes Polymorphism, melting point, crystal size and crystallography (Siew, 2001).

p00004In most of the oils that are extracted from oily seeds, the effect of DAGs is less pronounced, since DAGs are only present in small quantities. Mainly in palm oil and olive oil, which are oils that contain large natural amounts of DAG, without However, the quality of these oils worsens if DAGs are present in them.

p00005Palm oil obtained from palm of oil (<i>Elaeis guineensis</i>) is an edible oil commercially important. Palm oil has been a fat important and an oil resource for the food industry due to several advantageous properties, such as high productivity, low price, high thermal and oxidative stability and low temperature plasticity. In addition, compared to others Vegetable oils, palm oil is a rich source of antioxidant vitamin E

p00006A typical chemical composition of the oil of Refined palm is about 93% triglycerides, 6% of diglycerides and 1% monoglycerides (MAG) (Okiy, 1977).

p00007When palm oil crystallizes, it forms a complex three-dimensional network of the present components. In theory describes that the greater the diversity of the blocks construction (TAG, DAG and MAG) in the network, the more complicated the network and slower crystallization will take place (Jacobsberg &amp; Ho, 1976). This theory was confirmed by Drozdowski (1994). Further, their studies showed that the greater the variation of the fatty acid composition in the triacylglycerol molecule, more difficult was the transition between the different phases crystalline

p00008As mentioned earlier, a high Diglyceride content in palm oil affects your crystallization properties (Okiy <i>et al</i>., 1978, Okiy, 1978).

p00009The presence of diglycerides in these oils It presents inconveniences. In particular, the diglycerides in edible oils (particularly in palm oil) can lead to a low quality oil.

p00010The problems that refer to the content of diglyceride in palm oil and other oils and fats edibles have represented the subject of many studies and may find in the bibliography different solutions to try overcome the problem of excess diglycerides.

p00011The Japanese enzyme producer Amano in his home page (Amano Enzyme Inc., 2004), recommended a Enzymatic procedure to eliminate fat diglycerides and oils This procedure is based on the use of a LIPASA G "AMANO" 50 enzyme that can degrade diglycerides to free fatty acids and glycerol. This enzyme is a hydrolyzate of diglycerides (DAG) and / or (MAG). The free fatty acids produced are removed by vacuum distillation or crystallization fractional

p00012EP 0 558 112 describes a procedure for enzymatic hydrolysis of diglycerides residuals in triglyceride preparations in emulsions. He procedure is based on the hydrolysis of diglyceride with Lipasa G from Amano, Japan (<i>supra</i>). The procedure was enhanced by performing the enzymatic reaction in an emulsion to the degradation of diglyceride to fatty acids and glycerol. The phase aqueous is separated after the reaction and the enzyme is reused partially.

p00013JP 62061590 discloses a hydrogenated butter containing low amounts of diglyceride, which is prepared by treating oils or fats with a partially specific diglyceride enzyme (for example, a lipase) in the presence of a catalytic amount of water and by a lipase that is a 1,3-specific enzyme in presence of fatty acids, esters of fatty acids or other oils or glyceride fats. The product is hydrogenated butter especially suitable for use as a substitute for cocoa butter Therefore, lipase G and lipase of<i>Rhizopus deremer</i> (1,3-specific enzyme) is mixed with diatomaceous earth and granulated. The granules are mixed with medium palm melting point fraction (5.7% of diglycerides, acid index 0.25) and water (10% with respect to specific partial glyceride enzyme). The mixture was stirred at room temperature for 1 h., and enzymes and water are removed to provide a hydrogenated butter containing 1.2% diglyceride (acid value 10.5).

p00014The prior art thus discloses ways of reduce or eliminate the diglyceride content in the oil of palm and other edible oils by enzymatic reactions. These procedures are based on the hydrolysis of diglyceride with a specific diglyceride hydrolyzing lipase during formation of free fatty acids and glycerol. Fatty acids free can then be removed by different procedures such as vacuum distillation or division.

p00015The inconvenience of using an enzyme Specific diglyceride hydrolyzate is the disadvantageous formation of free fatty acids. These free fatty acids must Remove from palm oil. Therefore, the formation of acids Free fatty is often considered as loss of product.

p00016To overcome the problems of eliminating Free fatty acid and the loss of product produced by the free fatty acid formation applicants have discovered a new procedure to overcome high content problems in diglycerides in palm oil and other vegetable oils.

p00017Enzymatic elimination of diglycerides of palm oil has been released through the use of lipases, which are typically hydrolyzing enzymes of 1,3-specific triacylglycerol (EC 3.1.1.3) (for example see documents JP 6206590 or EP 0 652 289). He WO 00/05396 discloses among others the treatment of a food material that glycerol can comprise with a lipase to effect glycerolysis in a medium with little water.

p00018However, both hydrolyzing enzymes (tripacylglycerol 1,3 specific lipases) and enzymes DAG / MAG hydrolysers produce a significant increase in free fatty acids in the oil, and also produce hydrolysis of the monoglycerides.

p00019However, in some vegetable oils for some applications, for example, may be desirable to increase the monoglyceride content of the oil since this provides emulsifying functionality. Therefore, in one aspect it turns out preferred to reduce the diglyceride content without decreasing the monoglyceride content. In other aspects it can be reduced preferably both the diglyceride content and monoglycerides

p00020Lipase enzymes can also produce a harmful increase in DAG due to hydrolysis of triacylglycerol (TAG), most of the lipid present in food oils

p00021In WO 2000/36114, US 2003/0028923 and US 2003/0074695 the transformation of a plant is announced with a nucleic acid that has a sequence that encodes a diacylglycerol acyltransferase enzyme (DGAT) or a sequence complementary to this one. The DGAT enzyme disclosed in these documents catalyzes the final stage in the "series of reactions of Kennedy "in which a diacylglycerol (DAG) is combined with acyl groups of acyl CoA to form a triglyceride (GAD). For the Therefore, these documents show the production of plants transgenic with compositions and / or contents of TAG. Enzymes DGAT disclosed in these documents are not acyl lipid transferases and / or diglyceride: glycerol acyltransferases according to present invention

p00022In particular, DGATs require the presence of acyl CoA or CoA fatty acid to function. Acyl CoA does not commercial use is appropriate for the treatment of edible oils since its cost is prohibitive. Nevertheless, These enzymes do not work without the presence of acyl CoA. In addition the acid-based enzyme reactions fatty-CoA are very difficult to control industrially.

p00023In addition, all these documents announce that it is often desirable to reduce the expression of DGAT enzymes in a vegetable, to reduce the amount of DAG in the plant. This contrasts sharply with the present invention which ultimately instance requires the conservation and / or production of TAG at the same time which reduces diglycerides (DAG) in an edible oil.

p00024WO 03/100044 discloses a phospholipids: diacylglycerol acyltransferase (PDAT) that catalyzes the triglyceride formation (GAD) by acyltransfer of phospholipids (lecithin) among others to diacylglycerols (DAG). The PDATs require phospholipids as acyl donors. This contrasts notably with the present invention in which the donor of acyl are the DAG. This document does not disclose the removal of DAG of edible oil using a lipid acyltransferase according to the present invention.

Summary of the invention

p00025It has been discovered that the use of lipid CoA fatty acid independent acyltransferases as defined herein, diglyceride: glycerol acyltransferases independent of CoA fatty acid, produce selective reduction and / or elimination of diglycerides (preferably 1,2-diglycerides) of edible oils.

<pre listing-type="other">\ newpage</pre>

p00026The term "selective" as used herein means that in an oil medium edible the enzyme uses diglycerides (DAG), preferably 1,2-diglycerides, as a substrate preferably for triacylglycerides (DAG) or monoglycerides (MAG). Therefore, the diglycerides can be removed and / or reduced from edible oil while leaving the amount of triglyceride unchanged in the oil (or considerably unchanged). The amount of monoglycerides in the oil remains unchanged (or considerably unchanged) or may increase. In some applications, the amount of monoglyceride in the oil can reduce.

p00027In one aspect of the present invention, provides a procedure to reduce and / or eliminate the diglyceride of an edible oil, which comprises a) mixing a edible oil with an acyl receptor substrate and a diglyceride: fatty acid independent glycerol acyltransferase CoA, in which the diglyceride: glycerol acyltransferase Independent fatty acid CoA is characterized as an enzyme that in an edible oil you can transfer an acyl group from a diglyceride to glycerol, in which the diglyceride: glycerol acyltransferase independently of CoA according to the present invention is an acyltransferase comprising the motive of the GDSX amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M o S.

p00028Properly, the procedure according to the present invention may further comprise adding the edible oil treated or a fraction thereof to one or more constituents foods to formulate a food product, such as by example margarine or a spreadable product.

p00029In another aspect, the present invention even further provides the use of a diglyceride: fatty acid independent glycerol acyltransferase CoA characterized as an enzyme that in an edible oil can transfer an acyl group from a diglyceride to glycerol, in the preparation of a food product, to improve crystallization properties of the food product, in which the diglyceride: CoA independent glycerol acyltransferase according to present invention is an acyltransferase comprising the motif of the GDSX amino acid sequence, in which X is one or more of the amino acid residues following L, A, V, I, F, Y, H, Q, T, N, M or S.

p00030In another aspect the present invention provides the use of a diglyceride: glycerol CoA fatty acid independent acyltransferase characterized as an enzyme that in a edible oil can transfer a group acyl from a diglyceride to glycerol, in the preparation of a edible oil, to reduce and / or eliminate (preferably reduce and / or selectively eliminate) diglyceride of said oil edible, in which the diglyceride: glycerol acyltransferase CoA independent according to the present invention is a acyltransferase comprising the reason for the sequence of GDSX amino acids, in which X is one or more of the following residues of amino acid L, A, V, I, F, Y, H, Q, T, N, M or S.

p00031In this report the use of a diglyceride: glycerol acyltransferase independent of CoA fatty acid characterized as enzyme that in an edible oil can transfer an acyl group from a diglyceride to glycerol, in the preparation of a product nutritional, reducing and / or eliminating (preferably reducing and / or selectively removing) diglyceride from said product food

p00032In this report it is also disclosed the use of a diglyceride: glycerol acyltransferase independent of an enzyme that in an edible oil can transfer an acyl group from a diglyceride to glycerol, in the preparation of an edible oil, to improve the properties of crystallization of an edible oil.

Detailed statement of the invention

p00033The expressions "lipid acyltransferase independent of fatty acid CoA "and" diglyceride: glycerol fatty acid independent acyltransferase CoA "as used herein mean an enzyme that presents acyltransferase activity (generally classified as EC 2.3.1.x according to the Enzyme Nomenclature Recommendations (1992) of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology), through which the enzyme can transfer an acyl group from a diglyceride to one or more substrates receivers).

p00034Thus, the "lipid acyltransferase independent of fatty acid CoA "or" diglyceride: glycerol fatty acid independent acyltransferase CoA "is an enzyme presenting acyltransferase activity (generally classified as EC 2.3.1.x), but that is not a diacylglycerol acyltransferase (DGAT) or a phospholipid: diacylglycerol acyltransferase (PDAT). DGATs are typically classified as EC 2.3.1.20. PDATs are typically classified as EC 2.3.1.158. Lipid Acyltransferase independent of CoA fatty acid or the diglyceride: fatty acid independent glycerol acyltransferase CoA is an enzyme that has acyltransferase activity, but which is not an enzyme classified as EC 2.3.1.20 or EC 2.3.1.158.

p00035The independent lipid acyltransferase enzyme of CoA fatty acid or diglyceride enzyme: glycerol acyltransferase Independent fatty acid CoA is the one that is capable in an oil edible of transforming an acyl group from DAG to glycerol. Therefore, the enzyme catalyzed reaction according to the present invention is as follows:

Diglyceride (DAG) + glycerol? 2 monoglycerides (MAG)

<pre listing-type="other">\ newpage</pre>

p00036This contrasts sharply with enzymes. known as diacylglycerol acyltransferases (or diacylglycerol <i>OR</i>-acyltransferase) (DGAT) (these enzymes are classified as EC 2.3.1.20) that catalyze the final stage in the procedure from Kennedy, that is:

1,2-DAG + acyl CoA ? CoA + triacylglycerol (TAG)

p00037For the avoidance of doubt, DGATs are not lipid Acyltransferases independent of fatty acid CoA or diglyceride: fatty acid independent glycerol acyltransferase CoA according to the present invention.

p00038The enzyme catalyzed reaction according to the The present invention contrasts sharply with the catalyst by enzymes known as phospholipids: diacylglycerol acyltransferase (PDAT), that is:

Phospholipids (such as lecithin) + 1,2-DAG → triacylglycerol (GAD) + lysophospholipid

p00039For the avoidance of doubt, PDATs are not lipid Acyltransferases independent of fatty acid CoA or diglyceride: fatty acid independent glycerol acyltransferase CoA according to the present invention.

p00040Preferably, the lipid acyltransferase independent of CoA fatty acid or diglyceride: glycerol fatty acid independent acyltransferase CoA is an enzyme classified as EC 2.3.1.73.

p00041Properly, the diglyceride: glycerol fatty acid independent acyltransferase CoA can be membrane independent, that is, it can be a protein that is not, in its natural environment, associated with a membrane by the presence of a membrane anchoring or expansion domain of the membrane

p00042To avoid doubts, lipid acyltransferase Independent fatty acid CoA is not an enzyme disclosed in None of documents WO 03/100044, WO 2000/36114, US 2003/0028923 or US 2003/0074695.

p00043In addition to having acyltransferase activity the enzyme may have lipase activity, for example activity of phospholipase (generally classified as EC 3.1.1.x).

p00044Acid independent lipid acyltransferase CoA fatty is a diglyceride: independent glycerol acyltransferase of CoA fatty acid. These expressions can be used interchangeably herein.

p00045Diglyceride: glycerol acyltransferase Independent fatty acid CoA is an acyltransferase that comprises the reason for the GDSX amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

p00046The expression "diglyceride: glycerol acyltransferase "as used herein is Synonym of the expression "diglyceride: glycerol acyltransferase independent of fatty acid CoA ".

p00047For the avoidance of doubt, the expression "fatty acid CoA "is the same as the expressions "acyl-CoA", "fatty acid enzyme CoA" and "acyl-Co enzyme A". These expressions can used interchangeably herein.

p00048The edible oil used in a method or use according to the present invention may be in the form of crude oil or it can be a refined oil.

p00049In one embodiment, preferably the amount of diglyceride is reduced instead of being eliminated completely.

p00050The term "reduced" as used herein means that the amount of diglyceride in an edible oil treated with the enzyme according to the present invention is less than the amount of diglyceride in the oil edible before enzymatic treatment.

p00051Preferably, the diglycerides are not removed. completely from edible oil.

p00052In some applications, such as utilization of the oil treated in margarines and / or solid fat, the amount of diglycerides, particularly 1,2-diglycerides, should be reduced to a point where the speed of crystallization of the fat mixture produce small beta crystals The amount of 1,2-diglyceride with respect to the amount of Total diglyceride in palm oil depends on conditions of time and oil storage. For commercial oils the proportion of 1,3-diglyceride: 1,2-diglyceride is 1.8: 3.3. The elimination of 1,2-diglycerides will have the maximum impact on the properties of the crystallization.

p00053As will be apparent to the expert in matter the reduction of the amount of diglyceride can be controlled by the reaction time and the reaction temperature. In a flow reactor with an immobilized enzyme the reaction can Be controlled by the flow.

<pre listing-type="other">\ newpage</pre>

p00054Lipid acyltransferase for use in The methods and / or uses of the present invention may transfer an acyl group from a diglyceride to a receptor of acyl, in which the acyl receptor is any compound that comprise a hydroxy group (-OH).

p00055Properly, the term "diglyceride" such as used herein means one or more of 1,2-diglyceride or 1,3-diglyceride. Preferably, the diglyceride is a 1,2-diglyceride.

p00056The terms "diglyceride" and "diacylglycerol" are used interchangeably herein memory.

p00057The term "diglyceride" does not include digalactosyldiglyceride (DGDG) or / or lecithin, for example phosphatidylcholine.

p00058The acyl receptor is the one that is soluble in a Edible oil.

p00059The acyl receptor is glycerol.

p00060Therefore, in one embodiment the The present invention provides a reduction process and / or removal of diglycerides from an edible oil, which comprises a) mix an edible oil with both glycerol and diglyceride: fatty acid independent glycerol acyltransferase CoA, in which the diglyceride: glycerol acyltransferase Independent fatty acid CoA is characterized as an enzyme that has acyltransferase activity and that includes the reason for the GDSX amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

p00061Preferably, the lipid acyltransferase Independent fatty acid CoA can cleave the acyl bond between a fatty acid residue (s) and a central axis of glycerol from a lipid substrate, in which preferably the lipid substrate is a diglyceride, preferably 1,2-diglyceride.

p00062Preferably, the lipid acyltransferase Independent fatty acid CoA does not act on triglycerides and / or monoglycerides. In other words, preferably the lipid fatty acid independent acyltransferase CoA is selective for diglycerides, preferably selective for 1,2-diglycerides. The lipid substrate can be referred to herein as "lipid donor acil. "

p00063Therefore according to the present invention, they can get one or more of the following advantageous properties: reduction in the diglyceride content of an edible oil; a reduction in the diglyceride content of an oil edible without reduction in the triglyceride content of the oil edible; a reduction in the diglyceride content of the edible oil without increasing the monoglyceride content; a reduction in the diglyceride content of edible oil without increase the monoglyceride content; a reduction of diglycerides and a reduction in the monoglyceride content of a Edible oil; a reduction in the diglyceride content of the edible oil without a significant increase in the content of fatty acids in edible oil.

p00064Preferably, the lipid acyltransferase Independent fatty acid CoA carries out a reaction of alcoholysis (glycerolysis) by transferring an acyl group of the acid fat from the diglyceride (preferably the 1,2-DAG) to an alcohol (glycerol) producing from this mode two monoglyceride molecules, that is, one of diglyceride and the other glycerol together with the accepted acyl group.

p00065Preferably, X of the GDSX motif is L. So therefore, preferably the enzyme comprises the GSDL motif of the amino acid sequence

p00066The GDSX motif is composed of four conserved amino acids Preferably, the serine within the motive is a catalytic serine lipid enzyme acyltransferase Properly, the serine of the GDSX motif may be in a position corresponding to Ser-16 in the lipolytic enzyme of <i>Hydrophilic Aeromonas</i> released in Brumlik &amp; Buckey (<i>Journal of Bacteriology</i> Apr. 1996, vol. 178, No. 7, p. 2060-2064).

p00067To determine if a protein has the motive GDSX, the sequence is preferably compared with the profiles of the Hidden Markov model (HMM profiles) of the database pfam

p00068Pfam is a database of the families of the protein domain Pfam contains sequence alignments multiple cured for each family as well as Markov models of hidden profile (HMM profiles) to identify these domains in New sequences An introduction to Pfam can be found at Bateman A. <i>et al</i>. (2002) <i>Nucleic Acids Res</i>. <b>30</b>; 276-280. Hidden Markov models are used in numerous databases that help classify proteins, for a study see Bateman A. and Haft DH (2002) Brief Bioinform 3; 236-245.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00069http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=PubMed&amp;list_uids=12230032&amp;dopt=Abstract

p00070http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=PubMed&amp;list_uids=11752314&amp;dopt=Abstract

<pre listing-type="other">\ newpage</pre>

p00071For a detailed explanation of the models hidden from Markov and how they are applied in the Pfam database see Durbin R., Eddy S. and Krogh A. (1998) Biological sequence analysis; probabilistic models of proteins and nucleic acids. Cambridge University Press, ISBN 0-521-62041-4. He Hammer computer package can be purchased in the Washington University, St. Louis, USA.

p00072Alternatively, the GDSX motif may Identify yourself using the Hammer software package, instructions are provided in Durbin R., Eddy S. and Krogh A. (1998) Biological sequence analysis; probabilistic models of proteins and nucleic acids. Cambridge University Press, ISBN 0-521-62041-4 and the references in it, and the HMMER2 profile provided in this memory.

p00073The PFAM database can be accessed, by example, through several servers that are currently located on the following pages of the network.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00074http://www.sanger.ac.uk/Software/Pfam/index.shtml

p00075http://pfam.wustl.edu/

p00076http://pfam.jouy.inra.fr/

p00077http://pfam.cgb.ki.se/

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00078The database offers a tool for search in which one can enter a protein sequence. Using the default parameters of the database, then analyze the presence of Pfam domains in the protein sequence The GDSX domain is a domain demonstrated in the database and as such its presence in any sequence Wanted will be recognized. The database will return the alignment of The consensus sequence Pfam00657 to the sequence sought:

p00079A multiple alignment, which includes<i>Aeromonas salmonicida</i> or <i>Aeromonas hydrophila</i> may Obtained by:

p00080a) manual

<dl><dt>quad</dt><dd>get an alignment of the protein of interest with the consensus sequence Pfam00657 and get an alignment of P10480 with the consensus sequence Pfam00657 following the procedure described above; or</dd></dl>

p00081b) through the database

<dl><dt>quad</dt><dd>After identifying the sequence of Pfam00657 consensus the database offers the option that consists in showing an alignment of the sequence sought with the alignment of the origin and is indicated by GCAT_AERHY. Both the sequence Searched as P10480 will be presented in the same window.</dd></dl>

p00082Reference Sequence of <i>Aeromonas hydrophila</i>:

p00083The remains of GDSX lipase from <i>Aeromonas hydrophila</i> are numbered in NCBI file P10480, the figures in This text refers to the figures provided in this row that are used in the present invention to determine the remains of specific amino acids that, in a preferred embodiment are present in the lipid acyltransferase enzymes of the invention.

p00084<i>Pfam alignment was performed (Figure 33 and 3. 4)</i>:

p00085The following preserved remains may recognized and in a preferred embodiment may be present in enzymes for use in the compositions and methods of the invention;

<figref>500</figref>

p00086In which "hid" means a remainder hydrophobic selected from Met, Ile, Leu, Val, Ala, Gly, Cys, His, Lys, Trp, Tyr, Phe.

p00087Preferably the lipid acyltransferase enzyme for use in the compositions / procedures of the invention can be aligned using the consensus sequence Pfam00657.

p00088Preferably, a positive compatibility with the profile of the hidden Markov model (HMM profile) of the family of domain pfam00657 indicates the presence of the GDSL or GDSX domain according to The present invention.

p00089Preferably when aligned with the consensus sequence Pfam00657 lipid acyltransferase for its use in the compositions / methods of the invention it has at least one, preferably more than one, preferably more than two, of the following, a GDSx block, a GANDY block, an HPT block. Properly, the lipid acyltransferase pu ede have a GDSx block and a GANDY block. Alternatively, the Enzyme can have a GDSx block and an HPT block. Preferably The enzyme comprises at least one GDSx block.

p00090Preferably, when aligned with the consensus sequence Pfam00657 the enzyme for use in the compositions / methods of the invention have at least one, preferably more than two, preferably more than three, preferably more than four, preferably more than five, preferably more than six, preferably more than seven, preferably more than eight, preferably more than nine, preferably more than ten, preferably more than eleven, preferably more than twelve, preferably more than thirteen, preferably more than fourteen of the following remains of amino acid when compared to the polypeptide sequence of reference of <i>A. hydrophilia</i>, namely the SEC. ID. nº: 32: 28hid, 29hid, 30hid, 31hid, 32gly, 33Asp, 34Ser, 35hid, 130hid, 131Gly, 132Hid, 133Asn, 134Asp, 135hid, 309His.

p00091The GDSX domain of pfam00657 is an identifier unique that distinguishes proteins that possess this domain from others enzymes

p00092The pfam00657 consensus sequence is represented in Figure 1 as SEC. ID. nº: 1. This one comes from the pfam family ID 00657, database version 6, which may also be referred to as pfam00657.6 herein memory.

p00093The consensus sequence can be updated also using the editions of the pfam database.

p00094For example, Figures 33 and 34 present the pfam alignment of family 00657, from database version 11, which may also be referred to herein as pfam00657.11 memory.

p00095The presence of the GDSx, GANDY and HPT blocks is found in pfam family 00657 of both editions of the base of data.

p00096Future editions of the database of pfam can be used to identify family 00657 of pfam

p00097Preferably, the lipid enzyme fatty acid independent acyltransferase CoA can be characterized using the following criteria:

<dl><dt>(i)</dt><dd>the enzyme possesses acyltransferase activity that can be defined as activity for ester transfer whereby the acyl part of an original ester linkage of a acyl lipid donor is transferred to the acyl receptor to form a new ester;</dd></dl>

<dl><dt>(ii)</dt><dd>the enzyme comprises the reason for the sequence of GDSX amino acids, in which X is one or more of the following residues of amino acids L, A, V, I, F, Y, H, Q, T, N, M or S;</dd></dl>

<dl><dt>(iii)</dt><dd>the enzyme comprises His-309 or comprises a histidine residue in a position corresponding to His-309 in the lipolytic enzyme of <i>Aeromonas hydrophila</i> represented in Figure 2 (SEQ ID NO: 2 or SEC. ID. nº: 32).</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00098Preferably, the amino acid residue of the GDSX reason is L.

p00099In SEC. ID. nº: 2 or SEC. ID. nº: 32 the First 18 amino acid residues form a signal sequence. His-309 of the complete sequence, which is the protein which includes the signal sequence, is equal to His-291 of the mature part of the protein, that is, the sequence without the signal sequence

p00100Preferably, the lipid enzyme fatty acid independent acyltransferase CoA comprises the following catalytic triad: Ser-34, Asp-134 and His-309 or comprises a serine residue, an aspartic acid residue and a remainder of histidine, respectively, in the positions corresponding to Ser-34, Asp-134 e His-309 in the lipolytic enzyme of <i>Aeromona hydrophila</i> represented in Figure 2 (SEQ ID NO: 2) or in the Figure 28 (SEQ ID NO: 32). As indicated above, in the SEC. ID. nº: 2 or SEC. ID. nº: 32 the first 18 remains of amino acid form a signal sequence. Be-34, Asp-134 and His-309 of the sequence complete, which is the protein that includes the signal sequence, is equal to Ser-16, Asp-116 e His-291 of the mature part of the protein, is say, the sequence without the signal sequence. In the sequence of pfam00657 consensus, as provided in Figure 1 (SEQ. ID. nº: 1), the remains with active point correspond to Ser-7, Asp-157 e His-348.

p00101Preferably, the lipid enzyme fatty acid independent acyltransferase CoA can be characterized using the following criteria:

<dl><dt>(i)</dt><dd>the enzyme possesses acyltransferase activity that can be defined as activity for ester transfer whereby the acyl part of an original ester linkage of a acyl lipid donor is transferred to the acyl receptor to form a new ester;</dd></dl>

<dl><dt>(ii)</dt><dd>the enzyme comprises at least Gly-32, Asp-33, Ser-34, Asp-134 e His-309 or comprises glycine, acid residues aspartic, serine, aspartic acid and histidine in positions corresponding to Gly-32, Asp-33, Ser-34, Asp-134 e His-309, respectively in the lipolytic enzyme of<i>Aeromonas hydrophila</i> represented in Figure 2 (SEQ. ID. No. 2) or in Figure 28 (SEQ ID NO: 32).</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00102Properly, the lipid acyltransferase enzyme independent of fatty acid CoA can be obtained, preferably Obtained from organisms of one or more of the following genera:<i>Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Campylobacter, Vibrionaceae, Xylella, Sulfolobus, Aspergillus, Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas</i> and <i>Candida</i>.

p00103Properly, the lipid acyltransferase enzyme independent of fatty acid CoA can be obtained, preferably Obtained from one or more of the following organisms: <i>Aeromonas hydrophila, Aeromonas salmonicida, Streptomyces coelicolor, Streptomyces rimosus, Mycobacterium, Streptococcus pyogenes, Lactococcus lactis, Streptococcus pyogenes, Streptococcus thermophilus, Lactobacillus helveticus, Desulfitobacterium dehalogenans, Bacillus sp, Campylobacter jejuni, Vibrionaceae, Xylella fastidiosa, Sulfolobus solfataricus, Saccharomyces cerevisiae, Aspergillus terreus, Schizosaccharomyces pombe, Listeria innocua, Listeria monocytogenes, Neisseria meningitidis, Mesorhizobium loti, Ralstonia solanacearum, Xanthomonas campestris, Xanthomonas axonopodis</i> and <i>Candida parapsilosis</i>.

p00104In another aspect, the lipid enzyme fatty acid independent acyltransferase CoA can preferably obtained, preferably obtained, from one or over between <i>Aeromonas hydrophila</i> or <i>Aeromonas salmonicide</i>.

p00105Properly, the lipid acyltransferase enzyme Independent fatty acid CoA comprises one or more of the following amino acid sequences:

<dl><dt>(i)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 2 (see Figure 2)</dd></dl>

<dl><dt>(ii)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 3 (see Figure 3)</dd></dl>

<dl><dt>(iii)</dt><dd>the amino acid sequence represented as SEC. ID. nº: 4 (see Figure 4)</dd></dl>

<dl><dt>(iv)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 5 (see Figure 5)</dd></dl>

<dl><dt>(v)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 6 (see Figure 6)</dd></dl>

<dl><dt>(saw)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 12 (see Figure 14)</dd></dl>

<dl><dt>(vii)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 20 (see Figure 16)</dd></dl>

<dl><dt>(viii)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 22 (see Figure 18)</dd></dl>

<dl><dt>(Ix)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 24 (see Figure 20)</dd></dl>

<dl><dt>(x)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 26 (see Figure 22)</dd></dl>

<dl><dt>(xi)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 28 (see Figure 24)</dd></dl>

<dl><dt>(xii)</dt><dd>the amino acid sequence represented as SEC. ID. No. 30 (see Figure 26)</dd></dl>

<dl><dt>(xiii)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 32 (see Figure 28)</dd></dl>

<dl><dt>(xiv)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 34 (see Figure 30)</dd></dl>

<dl><dt>(xv)</dt><dd>the amino acid sequence represented as SEC. ID. No .: 55 (see Figure 52)</dd></dl>

<dl><dt>(xvi)</dt><dd>the amino acid sequence represented as SEC. ID. nº: 58</dd></dl>

<dl><dt>(xvii)</dt><dd>the amino acid sequence represented as SEC. ID. nº: 60</dd></dl>

<dl><dt>(xviii)</dt><dd>the amino acid sequence represented as SEC. ID. nº: 61</dd></dl>

<dl><dt>(xix)</dt><dd>the amino acid sequence represented as SEC. ID. nº: 63</dd></dl>

<dl><dt>(xx)</dt><dd>the amino acid sequence represented as SEC. ID. nº: 65</dd></dl>

<dl><dt>(xxi)</dt><dd>the amino acid sequence represented as SEC. ID. nº: 67</dd></dl>

<dl><dt>(xxii)</dt><dd>the amino acid sequence represented as SEC. ID. nº: 70 or</dd></dl>

<dl><dt>(xxiii)</dt><dd>an amino acid sequence that has 75% or more of identity with any of the sequences represented as SEC. ID. nº: 2, SEC. ID. nº: 3, SEC. ID. nº: 4, SEC. ID. nº: 5, SEC. ID. nº: 6, SEC. ID. nº: 12, SEC. ID. No. 20, SEC. ID. nº: 22, SEC. ID. nº: 24, SEC. ID. nº: 26, SEC. ID. nº: 28, SEC. ID. nº: 30, SEC. ID. No. 32, SEC. ID. No. 34, SEC. ID. No. 55, SEC. ID. No. 58, SEC. ID. nº: 60, SEC. ID. No. 61, SEC. ID. No. 63, SEC. ID. No. 65, SEC. ID. nº: 67 or SEC. ID. nº: 70.</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00106Properly, the lipid acyltransferase enzyme Independent fatty acid CoA comprises the sequence of amino acids represented as SEC. ID. nº: 2 or as SEC. ID. nº: 3 or SEC. ID. nº: 32 or SEC. ID. nº: 34 or comprises a sequence of amino acid that has 75% or more, preferably 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more, of identity with the sequence of amino acids presented as SEC. ID. nº: 2 or the sequence of amino acids presented as SEC. ID. nº: 3 or the sequence of amino acids presented as SEC. ID. nº: 32 or the sequence of amino acids presented as SEC. ID. nº: 34.

p00107For the purposes of the present invention, the degree of identity is based on the number of elements of the sequence that are the same. The degree of identity can be determined properly through computer programs known in the subject matter, such as GAP provided by the GCG program package (Program Manual for Wisconsin Package, version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, US53711) (Needleman &amp; Wunsch (1970), <i>J. of Molecular Biology</i> 48, 443-45) using the settings Following for comparison of the polypeptide sequence: penalty for creation of 3.0 GAP and extension penalty of 0.1 GAP.

p00108Properly, the lipid acyltransferase enzyme Independent fatty acid CoA comprises a sequence of amino acids that have 80% or more, preferably 85% or more, more preferably 90% or more and even more preferably the 95% or more identity with any of the sequences represented as SEC. ID. nº: 2, SEC. ID. nº: 3, SEC. ID. nº: 4, SEC. ID. nº: 5, SEC. ID. nº: 6, SEC. ID. nº: 12, SEC. ID. nº: 20, SEC. ID. nº: 22, SEC. ID. nº: 24, SEC. ID. nº: 26, SEC. ID. nº: 28, SEC. ID. nº: 30, SEC. ID. No. 32, SEC. ID. No. 34, SEC. ID. nº: 55, SEC. ID. No. 58, SEC. ID. nº: 60, SEC. ID. No. 61, SEC. ID. No .: 63, SEC. ID. No. 65, SEC. ID. nº: 67 or SEC. ID. nº: 70.

p00109Properly, the lipid acyltransferase enzyme Independent fatty acid CoA comprises one or more of the following amino acid sequences:

<dl><dt>(to)</dt><dd>an amino acid sequence presented as the 1 to 100 amino acid residues of the SEC. ID. nº: 2 or SEC. ID. nº: 32;</dd></dl>

<dl><dt>(b)</dt><dd>an amino acid sequence presented as the 101 to 200 amino acid residues of the SEC. ID. nº: 2 or SEC. ID. nº: 32;</dd></dl>

<dl><dt>(c)</dt><dd>an amino acid sequence presented as the 201 to 300 amino acid residues of the SEC. ID. nº: 2 or SEC. ID. nº: 32; or</dd></dl>

<dl><dt>(d)</dt><dd>an amino acid sequence that has 75% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more identity with any of the amino acid sequences defined in (a) to (c) previously.</dd></dl>

p00110Properly, the lipid acyltransferase enzyme Independent fatty acid CoA comprises one or more of the following amino acid sequences:

<dl><dt>(to)</dt><dd>an amino acid sequence presented as the amino acid residues 28-39 of the SEC. ID. nº: 2 or of the SEC. ID. nº: 32;</dd></dl>

<dl><dt>(b)</dt><dd>an amino acid sequence presented as the 77-88 amino acid residues of the SEC. ID. nº: 2 or of the SEC. ID. nº: 32;</dd></dl>

<pre listing-type="other">\ global \ parskip0.900000 \ baselineskip</pre>

<dl><dt>(c)</dt><dd>an amino acid sequence presented as the amino acid residues 126-136 of the SEC. ID. nº: 2 or of the SEC. ID. nº: 32;</dd></dl>

<dl><dt>(d)</dt><dd>an amino acid sequence presented as the amino acid residues 163-175 of the SEC. ID. nº: 2 or of the SEC. ID. nº: 32;</dd></dl>

<dl><dt>(and)</dt><dd>an amino acid sequence presented as the amino acid residues 304-311 of the SEC. ID. nº: 2 or of the SEC. ID. nº: 32; or</dd></dl>

<dl><dt>(F)</dt><dd>an amino acid sequence that has 75% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more identity with any of the amino acid sequences defined in (a) to (e) previously.</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00111Properly, the lipid acyltransferase enzyme Independent fatty acid CoA may comprise a sequence of amino acids produced by the expression or one or more of the following nucleotide sequences:

<dl><dt>(to)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No. 7 (see Figure 9);</dd></dl>

<dl><dt>(b)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No .: 8 (see Figure 10);</dd></dl>

<dl><dt>(c)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No .: 9 (see Figure 11);</dd></dl>

<dl><dt>(d)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No. 10 (see Figure 12);</dd></dl>

<dl><dt>(and)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No. 11 (see Figure 13);</dd></dl>

<dl><dt>(F)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No: 13 (see Figure 15);</dd></dl>

<dl><dt>(g)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No: 21 (see Figure 17);</dd></dl>

<dl><dt>(h)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No .: 23 (see Figure 19);</dd></dl>

<dl><dt>(i)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No.: 25 (see Figure 21);</dd></dl>

<dl><dt>(j)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No. 27 (see Figure 23);</dd></dl>

<dl><dt>(k)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No. 29 (see Figure 25);</dd></dl>

<dl><dt>(l)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No.: 31 (see Figure 27);</dd></dl>

<dl><dt>(m)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No. 33 (see Figure 29);</dd></dl>

<dl><dt>(n)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No. 35 (see Figure 31);</dd></dl>

<dl><dt>(or)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No. 54 (see Figure 51);</dd></dl>

<dl><dt>(p)</dt><dd>the nucleotide sequence depicted in the SEC. ID. nº: 59;</dd></dl>

<dl><dt>(q)</dt><dd>the nucleotide sequence depicted in the SEC. ID. no .: 62;</dd></dl>

<dl><dt>(r)</dt><dd>the nucleotide sequence depicted in the SEC. ID. no .: 64;</dd></dl>

<dl><dt>(s)</dt><dd>the nucleotide sequence depicted in the SEC. ID. No.: 66;</dd></dl>

<dl><dt>(t)</dt><dd>the nucleotide sequence depicted in the SEC. ID. no .: 68;</dd></dl>

<dl><dt>(or)</dt><dd>the nucleotide sequence depicted in the SEC. ID. nº: 69 or</dd></dl>

<dl><dt>(v)</dt><dd>a nucleotide sequence that has 75% or more of identity with any of the sequences represented as SEC. ID. nº: 7, SEC. ID. nº: 8, SEC. ID. nº: 9, SEC. ID. nº: 10, SEC. ID. nº: 11, SEC. ID. nº: 13, SEC. ID. nº: 21, SEC. ID. nº: 23, SEC. ID. No. 25, SEC. ID. No. 27, SEC. ID. nº: 29, SEC. ID. nº: 31, SEC. ID. nº: 33, SEC. ID. No. 35, SEC. ID. No. 54, SEC. ID. No. 59, SEC. ID. No. 62, SEC. ID. No. 64, SEC. ID. No. 66, SEC. ID. nº: 68 or SEC. ID. nº: 69.</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00112The nucleotide sequence itself can present 80% or more, preferably 85% or more, more preferably 90% or more, and still more preferably 95% or more identity with any of the sequences represented as SEC. ID. nº: 7, SEC. ID. nº: 8, SEC. ID. nº: 9, SEC. ID. nº: 10, SEC. ID. nº: 11, SEC. ID. nº: 13, SEC. ID. nº: 21, SEC. ID. nº: 23, SEC. ID. No. 25, SEC. ID. No. 27, SEC. ID. nº: 29, SEC. ID. nº: 31, SEC. ID. nº: 33, SEC. ID. No. 35, SEC. ID. No. 54, SEC. ID. nº: 59, SEC. ID. No. 62, SEC. ID. No. 64, SEC. ID. No. 66, SEC. ID. nº: 68 or SEC. ID. nº: 69.

<pre listing-type="other">\ global \ parskip1.000000 \ baselineskip</pre>

p00113In one aspect, the lipid acyltransferase Independent fatty acid CoA can be a lecithin: cholesterol acyltransferase (LCAT) or a variant thereof (for example a variant prepared by molecular evolution).

p00114Suitable LCATs are known in the art and can be obtained from one or more of the organisms following, for example: mammals, rat, mice, chickens,<i>Drosophila melanogaster</i>, plants, including<i>Arabidopsis</i> and <i>Oryza sativa</i>, nematodes, fungi and yeasts

p00115In one embodiment the lipid enzyme fatty acid independent acyltransferase CoA may be the lipid acyltransferase that can be obtained, preferably obtained, from the TOP 10 strains of <i>E. coli</i> what host ppET12? Ahydro and ppET12? ASalmo deposited by Danisco A / S of Langebrogade 1, DK-1001 Copenhagen K, Denmark under the Budapest Treaty in the International Recognition of the Deposit of Microorganisms for the Patent Procedure in the National Collection of Industrial, Marine and Food Bacteria (NCIMB) 23 St. Machar Street, Aberdeen Scotland, GB on December 22, 2003 with registration numbers NICMB 41204 and NCIMB 41205, respectively.

p00116Preferably, when performing a procedure according to the present invention the product is produced without increasing or considerably increase the free fatty acids in the product food

p00117The term "transferase" as it is used herein is interchangeable with the expression "lipid acyltransferase".

p00118Properly, the lipid acyltransferase CoA fatty acid independent as defined herein Memory catalyzes one or more of the following reactions: interesterification, transesterification, alcohololysis and hydrolysis.

p00119The term "intersterification" refers to to the catalytic enzymatic transfer of acyl groups between the lipid donor and lipid receptor, in which the lipid donor does not It is a free acyl group.

p00120The term "transesterification" such as used herein means transfer catalytic enzyme of an acyl group from a donor lipid (other than a free fatty acid) to an acyl receptor (other than water).

p00121As used herein, the term "alcohololysis" refers to the enzymatic cleavage of a covalent bond of an acid derivative by reaction with alcohol ROH so that one of the products is combined with the H of the alcohol and the other product is combined with the OR group of alcohol.

p00122As used herein, the "alcohol" refers to an alkyl compound that It contains a hydroxyl group.

p00123As used herein, the term "hydrolysis" refers to enzymatic transfer catalyzed from an acyl group from a lipid to the OH group of A molecule of water. The acyl transfer that comes from the Hydrolysis requires separation of the water molecule.

p00124The expression "without increasing or without increasing considerably free fatty acids "as used herein means that preferably the lipid acyltransferase according to the present invention has 100% of transferase activity (i.e. transfers 100% of the groups acyl from an acyl donor to the acyl receptor, without activity hydrolytic) in an edible oil medium; However, the enzyme can transfer less than 100% of acyl groups present in the donor lipid acyl to the acyl receptor. In whose case, preferably acyltransferase activity totals at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at minus 70%, more preferably at least 80%, more preferably at least 90% and more preferably at minus 98% of the total enzymatic activity. % Activity of transferase (i.e., the activity of transferase as percentage of total enzyme activity) can be determined by the following protocol:

Protocol for the determination of the% activity of acyltransferase

p00125An edible oil to which a lipid fatty acid independent acyltransferase CoA can Extract following the enzymatic reaction with CHCl 3: CH 3 OH 2: 1 and the organic phase containing the lipid material is isolated and analyzed by GLC according to the procedure detailed below in This memory. From the GLC analyzes the amount of Free fatty acids and diglycerides are determined. An oil edible reference to which no enzyme has been added according to the present invention it is analyzed in the same way.

Calculation

p00126From the results of the analyzes by GLC can be calculated the increase in free fatty acids and the decrease in diglycerides:

p00127Δ% fatty acid =% fatty acid (enzyme) - % fatty acid (reference);

p00128Mv Fa = average molecular weight of acids fatty

p00129Δ% diglyceride =% diglyceride (reference) -% diglyceride (enzyme);

p00130Mv Di = mean molecular weight of diglyceride;

p00131Transferase activity is calculated as percentage of total enzyme activity:

<figref>501</figref>

p00132If the free fatty acids increase in the edible oil preferably do not increase considerably, it is say, to a significant degree. This means that the increase in fatty acid does not adversely affect oil quality edible.

p00133In some aspects of the present invention, the expression "without significantly increasing fatty acids free "as used herein, means that the amount of free fatty acid in a treated edible oil with a lipid acyltransferase is less than the amount of acid Fat free produced in an edible oil or composition in the that an enzyme other than a lipid acyltransferase has been used, such as for example compared to the amount of free fatty acid produced when a conventional lipase by example the lipase of <i>Pseudomonas cepacia</i> (Lipase PS, Amano Japan) or a lipase from <i>Rhizopus oryzae</i> (Lipase F, Amano Japan).

p00134Properly, any glycerol can be removed remaining in the edible oil after the reaction has had place, for example, by centrifugation or vacuum distillation.

p00135Optionally, the enzyme can be removed from the edible oil once the reaction has taken place enzymatic Alternatively, the enzyme can simply deactivate and remain in the edible oil. Properly, the Enzyme can be deactivated by heating, for example.

p00136In one embodiment the lipid CoA fatty acid independent acyltransferase for use in the processes of the present invention it can be immobilized. When it is the case that the enzyme is immobilized, a mixture that it comprises an acyl receptor and the edible oil can be passed to through a column comprising for example the enzyme immobilized By immobilizing the enzyme it is possible to reuse it easily.

p00137The immobilized enzyme itself can be used in a flow reactor or a discontinuous reactor that it contains a reaction mixture comprising an acyl receptor and a edible oil as a two phase system. Reaction mixture It can optionally be shaken or treated by ultrasound. Once the reaction has reached equilibrium, for example, the mixture of reaction and immobilized enzyme can be separated. Properly, the Acyl receptor in excess (such as in excess of glycerol) can removed after the reaction, for example by centrifugation or vacuum distillation.

p00138The immobilized lipid acyltransferase can be prepared using immobilization techniques known in the technique. There are numerous enzyme preparation procedures fixed assets, which will be evident to an expert in subject matter (for example the techniques cited in EP 0 746 608; or in Balcao VM, Paiva AL, Malcasa FX,<i>Enzyme Microb. Technol</i>. May 1, 1996; 18 (6): 392-416; o Retz MT, Jaeger KE<i>Chem. Phys. Lipids</i>. June 1998; 93 (1-2): 3-14; Bornscheuer U. T., Bessler C., Srinivas R., Krishna SH <i>Trains Biotechnol</i>. October 2002; 20 (10): 433-7; Plou<i>et al</i>., <i>J. Biotechnology</i> 92 (2002) 55-66; Warmuth<i>et to the</i>., 1992. Bio Forum 9, 282-283; Ferrer<i>et to the</i>., 2000. <i>J. Chem. Technol. Biotechnol</i>. 75, 1-8; or Christensen<i>et al</i>., 1998. Nachwachsende Rohstoff 10, 98-105; Petersen and Christensen, 2000, Applied Biocatalysis. Harwood academic Publishers, Amsterdam. The techniques that can be used in the This report includes covalent coupling to Eupergit C, the polypropylene adsorption and silica granulation, by example.

p00139Preferably, the edible oil is any edible oil that contains a diglyceride, preferably a significant amount of diglyceride.

p00140Preferably, the edible oil is one or more of the following oils: oils extracted or from palm oil, palm olein, palm stearin, medium fraction of palm or any fraction of palm oil or oil olive.

p00141More preferably, the edible oil is palm oil and / or palm olein and / or palm stearin.

p00142With respect to the edible oil mixture, acyl and lipid acyltransferase receptor substrate, the expert in matter will readily appreciate that it can be done in any combination and / or order. By way of example only, the substrate Acyl acceptor can be mixed with edible oil followed by the addition of lipid acyltransferase. Alternatively, the edible oil can be mixed with lipid acyltransferase followed by the addition of the acyl acceptor substrate. Alternatively, the lipid acyltransferase and the receptor substrate of acyl can be mixed followed by mixing of the mixture enzyme / substrate with edible oil. Alternatively, from then, the three substances (namely edible oil, the acyl receptor substrate and lipid acyltransferase) can mix simultaneously.

p00143Preferably the procedure is performed at a temperature higher than the melting point of the oil edible.

p00144The procedure itself can be performed at a temperature between 30 and 50 ° C, preferably between 35 and 45 ° C, preferably between 40 and 45 ° C.

p00145Preferably, the enzyme is added to the oil raw or refined edible. Preferably present invention does not comprise the enzymatic treatment of an oil edible when mixed with water containing constituents. Thus, the present invention provides for the treatment of a edible oil by itself, that is, in a medium with little Water.

p00146Although water can be added to the oil before or during the process of the present invention, in the form of more preferred embodiment no water is added. If water is present in edible oil, there is preferably less than 10% of water present, more preferably less than 7.5%, less than 5%, less than 1%, less than 0.5%, less than 0.4%, less than 0.3%, less 0.2% or less of 0.1% water present. Properly, between the 0.1 and 1% water may be present in the oil edible.

p00147In one embodiment the edible oil used in a process according to the present invention can be enriched with one or more acyl donors and / or can be enriched with one or more acyl receptors and / or can be enriched with both one or more acyl receptors as with one or more acyl donors. "Enriched with" means that the acyl donor and / or the acyl receptor is not naturally present in the oil edible and added at the same time, immediately after and / or immediately before putting the edible oil in contact with the lipid acyltransferase according to the present invention.

p00148Properly, the supplementary acyl donor It may be different from a DAG. The acyl donor itself supplementary can be for example a phospholipid (for example lecithin).

p00149Properly, the supplementary acyl receptor It can be glycerol. Properly, however it can be a acyl receptor other than glycerol, for example a sterol vegetable and / or a vegetable stanol, for example. Properly, the supplementary acyl receptor may be a combination of glycerol and one or more additional acyl receptors.

p00150The use of an oil enriched with a phospholipid allows an emulsifier to be produced in the oil additional (smooth-phospholipid). The use of a oil enriched with a vegetable sterol and / or a vegetable stanol allows both an ester of edible oil to be produced in edible oil vegetable sterol as / or an ester of vegetable stanol. Both the plant sterol esters such as plant stanol esters have published that have cholesterol lowering effects in the blood serum when incorporated into the diet.

p00151The enzymatic interesterification that it uses immobilized lipases, such as Lipozyme® TL IM, lipase 1,3-specific (Novozymes, Denmark) is used to reduce the amount of trans fatty acids in oils for dietary use and / or to modify the characteristics of fusion of edible oils and fats.

p00152During intersterification, one or two of the polyunsaturated fatty acids in oil triglycerides food can be substituted with a fatty acid from another oil Low in trans fatty acids, such as palm oil. This Palm oil fatty acid transfer allows the modification of the melting point of food oil without introduction of trans fatty acids. The immobilization of Lipases are described in US Patents No. 5,776,741, US No. 4,798,793 and US 5,156,963. US Patent No. 6,284,501 describes the interesterification of phospholipids.

p00153An immobilized transferase can be produced using the same technology used for lipases.

p00154In one embodiment, the lipid fatty acid independent acyltransferase CoA described in the This report can be used in combination with a lipase of intersterification The intersterification of lipase and acyltransferase steps are preferably performed by separated.

p00155In another aspect, lipid acyltransferase CoA fatty acid independent described herein can be used in combination with crystallization inhibitors conventional.

p00156In another aspect, the present invention provides a procedure to improve the properties of crystallization in a food product comprising an oil edible, which comprises mixing an edible oil with a acyl receptor substrate and a diglyceride: glycerol CoA fatty acid independent acyltransferase as described herein and optionally an inhibitor of additional crystallization

p00157In one embodiment, the present invention provides diglyceride: glycerol acyltransferase independent of CoA fatty acid for the preparation of a product food comprising an edible oil to improve crystallization properties of the food product, in which the diglyceride: CoA independent glycerol acyltransferase is a acyltransferase comprising the reason for the sequence of GDSX amino acids, in which X is one or more of the remains of following amino acids L, A, V, I, F, Y, H, Q, T, N, M or S.

p00158You can optionally add one or more additional crystallization inhibitors.

p00159The present invention further provides even the use of a diglyceride: glycerol acyltransferase CoA fatty acid independent as described herein memory for the preparation of a food product that comprises an edible oil to improve the properties of crystallization of said food product.

p00160In another aspect, the present invention provides the use of a diglyceride: glycerol CoA fatty acid independent acyltransferase as described herein in combination with an inhibitor of crystallization for the preparation of a food product that comprises an edible oil to improve the properties of crystallization of said food product.

p00161The additional crystallization inhibitor can be any conventional crystallization inhibitor such as one or more of sorbitan triestearates, lecithins, PGE or polysorbates, for example.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Advantage

p00162In the present invention by use of the procedure disclosed herein, and in particular by selecting the enzymes disclosed in this report for use in the procedure claimed, to remove or reduce the diglyceride of an oil edible or in it, a selective reduction can be made in the diglyceride over mono- and di-glyceride, without a decrease in triglycerides and / or a significant increase in free fatty acids (FFA).

p00163The fact that this procedure can be performed without significantly increasing the acid content Fat free edible oil solves the problem of loss of product.

p00164If a crude palm oil is treated with a Conventional lipase is necessary to remove free fatty oil during oil refining, but if a refined palm oil it is treated with the lipid acyltransferase according to the present invention (thus denying the need to treat palm oil in raw with a conventional lipase) it is not necessary to remove fatty acids because the fatty acid content does not increase considerably.

p00165In addition or alternatively, the present invention produces the elimination and / or reduction of the diglycerides of or in a edible oil, without significant decrease in monoglyceride concentrations.

p00166In addition or alternatively, the present invention produces the elimination and / or reduction of the diglycerides of or in a edible oil, while increasing concentrations of monoglyceride in edible oil. This contrasts with the prior art enzymes that use monoglyceride as substrate and therefore reduce the amount of monoglyceride in Edible oil

p00167The present invention has advantages since does not require the addition of CoA fatty acid. This contrasts notably with acyl CoA dependent DGATs. Rather the enzyme according to the present invention is based on the presence (and addition if necessary) of glycerol, which is an article economic.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Commercial relevance of eliminating / reducing diglycerides in the Palm oil

p00168Diglycerides delay crystallization in margarines and solid fats based on palm oil.

p00169For many years, the authors have appreciated a steady increase in the growth of oil consumption of palm, partially due to localized availability, partially due to domestic economy and mainly due to performance The presence of palm oil in products of margarine / solid fat type is observed to increase the quality in β 'of an oil mixture. However, the use of palm oil was previously restricted to the use of palm stearin, and palm olein, with some use of palm kernels and their fractions. Currently, this is more varied, due to the confectionery and food treaters who need very specific fusion properties.

p00170With customers trying to increase the use of palm oil in formulations, industry You are seeing more crystallization results than ever before. When necessary add "procristal" triggers to initiate crystallization in low formulations in trans or without trans thus preventing or delaying training after glass before the point of use. It has also been observed increased interest in anti-crystallizers, such as sorbitan triestearates, lecithins, PGE, polysorbates, which will allow the retardation of crystal growth. This is a symptom of the presence of much diglyceride.

p00171The commercial advantages of this invention may be one or more of the following:

p00172a) reduces the need to add monoglyceride additional to edible oil during treatment and / or later during use. The monoglyceride is a emulsifier widely used in systems feeding.

p00173b) decreases diglycerides from about 6 to 8% to about 4 to 5%, and even more.

p00174c) increases the flexibility of the capacity of the plant (factory), therefore reduction in costs Production Operatives

p00175d) allows greater decreases in post-crystallization results.

p00176e) in some formulations, it would be possible remove some triglycerides from fully saturated oil, because the authors reduce the need to favor the crystal. TO in this respect manufacturers add in a conventional way fully saturated triglycerides to formulations in order to "favor" crystal formation and resolve formation delayed undesirable crystal in the aftermarket product. Bliss crystal formation is a symptom of presenting a quantity significant palm oil or its components in a formulation, which would contain diglyceride concentrations enough to retard crystal growth at the type of desired crystal (i.e. preferably beta-premium in the case of margarines and fats solid) during preparation. However, through the use of treated palm oil according to the present invention, the diglyceride content is sufficiently reduced by one mixture or formulation given so that the need for the action of fully saturated triglyceride to help the development of Crystal becomes less important.

p00177f) allows greater diversification towards mixtures based on palm oil, with liquid oil costs increased and without the changes of the main procedure.

p00178g) allows the replacement of anti-crystallizers and / or partial replacement of anti-crystallizers.

B Trans fatty acid

p00179Currently, the authors contemplate the legislation and public opinion against the use of acids trans in food products (Fødevareministeriet, Denmark 2003). Thus, this has led to performance problems. The Manufacturers whenever possible may wish to exchange with the palm oil based solutions due to the large concentrations of C: 16: 0 and C: 18: 0 isomers discovered in this type of oil. The result is that the authors are starting to appreciate an increase in palm oil consumption in the economy domestic that previously did not use palm oil.

C Inhibition of diglyceride crystallization in confectionery products

p00180Cocoa butter equivalents are formulated (CBE) from specialty fats such as oil fractionated palm, in particular medium fractions of palm (PMF), fractionated shea fat as well as many others exotic fats For economic reasons it is favorable to include as many PMFs as possible in the CBE. In fact many CBE can contain only palm fractions. The most delicate aspect of Chocolate making is the crystallization of fat. The diglycerides will have a negative impact on crystallization, for example, demoulding can be a serious problem (Siew, 2001).

D Crystal quality

p00181Triglyceride quality greatly affects measure the operation, and this is evident, in the examples of a typical oil formula that contains trans acid for margarine table with 82% conventional fat, compared to the exempt version of trans containing a fraction of palm stearin typical intersterified and palm kernels as a hard supply, having both similar CFS profiles. The reduced speed and crystallization quality can produce a known symptom as "oiled." This in turn demands the need to crystal activators, such as hard MAGs. In addition, the delayed formation of the stabilized crystal leads to the symptom known as "gritty" with which the transformation of desired type of glass optionally reverts to the Beta form plus stable, and thus provides a sandy texture. This symptom is a specific problem of industrial type.

Some uses

Fat Modification

p00182During the chemical production of fats for your use in food products rich in solid fat such as margarines, spreads, confectionery / chocolates, trans fatty acids are introduced into the food oil during a hydrogenation process (hardening). This allows the modification of the temperature of melting of food oil to ensure consistency adequate final food product, for example, a margarine tabletop, which is solid but extensible at room temperature, or a chocolate that is solid during storage, but melts in mouth.

p00183However, chemical production uses large amounts of solvents such as hexane that considered dangerous for the environment and health and require complete removal of the solvent before using the oil / fat modified as food ingredient.

p00184In many countries the use of partial hydrogenation for food production is being limited by legislation and regulatory controls, and many major food producers are currently switching to alternatives with little trans.

p00185The oil prepared by the procedure of the invention can be used as an ingredient for margarine and / or The spreads.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Cocoa butter substitutes / equivalents

p00186Cocoa butter contains a composition unique that provides a solid confectionery product that melts in the mouth. In order to replace cocoa butter using cheaper alternatives, vegetable oils have hydrogenated to produce trans fatty acids, increasing from this mode the melting point of food oil to provide a similar solid confectionery product that melts at temperature of the body. Such modified vegetable oils are known as cocoa butter equivalents (CBE) or, in the case where modified fats improve the product characteristics of Chocolate, cocoa butter substitutes (CBR). A main problem with CBE and CBR is that the hydrogenation of Vegetable oils produce trans fats that are considered to be harmful to health and temperature. This has led to the use of vegetable oils with little trans, or fractions thereof, which have a higher melting temperature. He palm oil and palm oil fractions are considered advantageous in this regard as a low principal component in the CBR / CBE trans.

p00187Cocoa butter replacement fats (CBR) are used to provide preferred features to Chocolate products such as not tempered, hardening reduced, stability, resistant to flowering. Is particularly desirable to use lauric / non-trans fats such Like palm oil The crystallization properties of Fats used in CBRs play a key role in ensure an adequate balance between the fusion of the product in the mouth while retaining the preferred characteristics previous. The use of fats with little trans, such as palm oil, in CBR mixtures is particularly desirable For health reasons. The use of palm oil in CBR It is described in EP 0293194.

p00188The oil prepared according to the procedure of the The present invention can be used as an ingredient for chocolate, for example in a mixture of fat such as substitute and / or Cocoa butter equivalent.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Sequences of some diglyceride enzymes: glycerol acyltransferase for use according to the present invention

p00189Diglyceride enzymes: glycerol acyltransferase suitable for use according to the present invention and / or in The methods of the present invention may comprise any of the following amino acid sequences and / or be encoded by the following nucleotide sequences:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Thermobifida

\

fusca

GDSx 548 aa

p00190SEC. ID. nº: 58

<figref>1</figref>

<pre listing-type="other">\ newpage</pre>

p00191SEC. ID. nº: 59

<figref>2</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Thermobifida

\

fusca

\ - GDSx

p00192SEC. ID. nº: 60

<figref>3</figref>

Corynebacterium efficiens

\ GDSx 300 aa

p00193SEC. ID. nº: 61

<figref>4</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00194SEC. ID. nº: 62

<figref>5</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<figref>6</figref>

<pre listing-type="other">\ newpage</pre>

Novosphingobium

\

aromaticivorans

\ GDSx 284 aa

p00195SEC. ID. nº: 63

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<figref>7</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00196SEC. ID. nº: 64

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<figref>8</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

S. coelicolor

\ GDSx 268 aa

p00197SEC. ID. nº: 65

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<figref>9</figref>

<pre listing-type="other">\ newpage</pre>

p00198SEC. ID. nº: 66

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<figref>10</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

S. avermitilis

\ GDSx 269 aa

p00199SEC. ID. nº: 67

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<figref>11</figref>

<pre listing-type="other">\ newpage</pre>

p00200SEC. ID. nº: 6

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<figref>12</figref>

<pre listing-type="other">\ newpage</pre>

Diglyceride: glycerol acetyltransferase from

Streptomyces

p00201SEC. ID. nº: 69

<figref>13</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Diglyceride: glycerol acetyltransferase from

Streptomyces

p00202SEC. ID. nº: 70

<figref>14</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Identification of a diglyceride: glycerol acyltransferase according to the present invention

Test for the enzymatic reduction of diglyceride in oil palm

p00203Weigh in a glass with lid 1 gram of oil of palm containing 7% diglyceride.

p0020450 mg of glycerol and 10 µl of enzyme solution The reaction mixture is stirred with a stirrer. magnetic in a heating chamber at 40 ° C for 20 hours. The Enzyme reaction is interrupted by heating at 100 ° C for 10 minutes A reference sample to which 10 \ mul is added of water instead of enzymatic solution it is the same way. The samples are analyzed by GLC according to the procedures usual (see below here) and calculate the amounts of fatty acids, monoglyceride and diglyceride

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Calculation

p00205From the results of the analyzes by GLC can be calculated the increase in free fatty acids and the decrease in diglycerides:

p00206Δ% fatty acid =% fatty acid (enzyme) - % fatty acid (reference);

p00207Mv Fa = average molecular weight of acids fatty

p00208Δ% diglyceride =% diglyceride (reference) -% diglyceride (enzyme);

p00209Mv Di = mean molecular weight of diglyceride;

p00210Transferase activity is calculated as percentage of total enzyme activity:

<figref>502</figref>

GLC analysis

p00211Autosystem 9000 capillary gas chromatograph Perkin Elmer equipped with 12.5 m cast silica WCOT column 0.25 mm ID x 0.1 µm 5% film thickness phenyl methyl silicone (CP Sil 8 CB from Chrompack).

p00212Carrier gas: helium

p00213Injector. PSSI cold cutting injection (temp. initial 50 ° C heated to 385 ° C), volume 1.0 µl

<figref>503</figref>

p00214Sample preparation: 30 mg dissolved of the sample in 9 ml of heptane: pyridine, 2: 1 containing internal standard heptadecane, 0.5 mg / ml. 300 µl of the solution the sample was transferred to a translucent vial, 300 were added \ mul of MSTFA (N-methyl-N-trimethylsilyl-trifluoroacetamid) and reacted for 20 minutes at 60 ° C.

Isolated

p00215In one aspect, preferably the polypeptide or protein for use in the present invention is in form isolated. The term "isolated" means that the sequence is at least considerably exempt from at least one other component with which the sequence is naturally associated in the nature and is found in nature.

Purified

p00216In one aspect, preferably the polypeptide protein for use in the present invention is in form purified. The term "purified" means that the sequence is in a relatively pure state, for example at least about 51% purity or at least about 75% or at least about 80% or at least about 90% of purity or at least about 98% purity.

Cloning of a nucleotide sequence encoding a polypeptide according to the present invention

p00217A nucleotide sequence that encodes a polypeptide that has the specific properties defined in the present specification or a polypeptide that is suitable for the modification can be isolated from any cell or organism that produces said polypeptide. Several procedures are well known. in the art for the isolation of nucleotide sequences.

p00218For example, a DNA bank can be constructed genomic and / or cDNA using chromosomal DNA or messenger RNA from the organism that produces the polypeptide. If the sequence amino acid polypeptide is known, can be synthesized and used labeled oligonucleotide probes and used to identify the clones encoding the polypeptide from the library prepared from the organism. Alternatively, a labeled oligonucleotide probe containing the sequences homologous to those of another known polypeptide gene could used to identify clones encoding the polypeptide. In the latter case, the hybridization conditions and washing of lesser severity.

p00219Alternatively, the clones encoding the polypeptide could be identified by inserting DNA fragments genomic in an expression vector, such as a plasmid, bacteria negative to the transforming enzyme with the genomic DNA bank resulting and then plating the bacteria transformed into agar-agar containing an enzyme inhibited by the polypeptide, thereby allowing the clones express the polypeptide to be identified.

p00220Even in another alternative, the sequence nucleotide encoding the polypeptide can be prepared synthetically by the usual established procedures, by example the phosphoramidite method described by Beucage SL<i>et al</i>. (1981) <i>Tetrahedron Letters</i> 22, p. 1859-1869, or the method described by Matthes <i>et to the</i>. (1984) <i>EMBO J</i>. 3, p. 801-805. At phosphoramidite method, oligonucleotides are synthesized, by example in an automatic DNA synthesizer, they are purified, they hybridize, bind and clone into appropriate vectors.

p00221The nucleotide sequence can be of origin mixed genomic and synthetic, mixed synthetic and of cDNA origin, or mixed genomic and cDNA origin, prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate) according to techniques usual. Each linked fragment corresponds to several parts of the complete nucleotide sequence. DNA sequence can also be prepared by polymerase chain reaction (PCR) using specific primers, for example as described in the US 4,683,202 or Saiki RK <i>et al. (Science</i>(1988) 239, p. 487-491).

Nucleotide sequences

p00222The present invention also comprises the use of nucleotide sequences encoding polypeptides that present the specific properties defined herein memory. The expression "nucleotide sequence" used in the herein refers to an oligonucleotide sequence or a polynucleotide sequence, and variants, homologues, fragments and derivatives thereof (such as parts of the same). The nucleotide sequence can be of genomic origin, synthetic or recombinant, which can be double stranded or single stranded as it represents the transcribed or complementary chain.

p00223The expression "nucleotide sequence" It includes genomic DNA, cDNA, synthetic DNA and RNA. Preferably means DNA, more preferably cDNA for the sequence of coding.

p00224In a preferred embodiment, the own nucleotide sequence encoding a polypeptide that has the specific properties defined herein do not comprises the natural nucleotide sequence in its natural environment when attached to its sequence (s) naturally associated (s) that is also in its natural environment (s). For ease of mention, this preferred embodiment is will call "unnatural nucleotide sequence". To this respect, the expression "natural nucleotide sequence" means a complete nucleotide sequence that is in its middle natural and when operatively binds to a complete activator with which is associated naturally, activator that is also in its natural environment Therefore, the polypeptide for use in the present invention can be expressed by a sequence nucleotide in your natural organism but in which the sequence nucleotide is not under the control of the activator with which it is naturally associated in this organism.

p00225Preferably the polypeptide is not a natural polypeptide In this regard, the expression "polypeptide natural "means a complete polypeptide that is in your environment natural and when it has been expressed by its nucleotide sequence natural.

p00226Typically, the nucleotide sequence that encodes polypeptides that have specific properties defined herein is prepared using techniques of Recombinant DNA (ie, recombinant DNA). However, in a alternative embodiment of the invention, the sequence nucleotide could be synthesized, in whole or in part, using chemical procedures well known in the art (see Caruthers MH. <i>et al</i>. (1980) <i>Nuc. Acids Res. Symp. Be</i>. 215-23 and Horn T.<i>et al</i>. (1980) <i>Nuc. Acids Res. Symp. Be</i>. 225-232).

Molecular evolution

p00227Once the nucleotide sequence has been isolated encoding the enzyme, or a possible sequence has been identified nucleotide encoding the enzyme, it may be desirable to modify the selected nucleotide sequence, for example it may be desirable mutate the sequence in order to prepare an enzyme according to the present invention

p00228Mutations can be introduced using synthetic nucleotides These oligonucleotides contain sequences nucleotides that flank the desired mutation points.

p00229An appropriate procedure is disclosed in Morinaga <i>et al. (Biotechnology</i> (1984) 2, p. 646-649). Another procedure to introduce mutations in nucleotide sequences encoding the enzyme are describe in Nelson and Long (<i>Analytical Biochemistry</i> (1989), 180, p. 147-151).

p00230Instead of site-directed mutagenesis such as described above, mutations can be introduced to the random for example using a commercial kit such as the kit for Stratagene GeneMorph PCR mutagenesis, or the kit for Clontech Diversify PCR random mutagenesis. EP 0 patent 583 265 refers to methods of optimization of mutagenesis based on PCR, which can also be combined with the use of mutagenic DNA analogs such as those described in EP patent 0 866 796. Error prone PCR technologies are adequate for the production of lipid acyl transferase variants with preferred features. WO 0206457 refers to the molecular evolution of lipases.

<pre listing-type="other">\ newpage</pre>

p00231A third procedure to obtain new sequences consists of fragmenting nucleotide sequences not identical, either using any number of enzymes from restriction or an enzyme such as Dnasa I, and reassembling the complete nucleotide sequences encoding proteins functional. Alternatively you can use one or multiple non-identical nucleotide sequences and introduce mutations during reassembly of the complete nucleotide sequence. The DNA mixing and family mixing technologies are suitable for the production of lipid acyltransferase variants With preferred features. The proper procedures for perform the "mixing" can be found in EP 0 patents 752 008, EP 1 138 763 and EP 1 103 606. Mixing can also combine with other forms of DNA mutagenesis as described in US 6,180,406 and WO 01/34835.

p00232In this way, it is possible to produce numerous site-directed or random mutations in a sequence nucleotide either <i>in vivo</i> or <i>in vitro</i>and screen subsequently for enhanced polypeptide functionality encoded by various means. Using in the procedures of silica-mediated exo recombination (see WO documents 00/58517, US 6,344,328 and US 6,361,974), for example, may perform the molecular evolution in which the variant produced it retains very little homology with known enzymes or proteins. Such variants obtained in this way may present analogy. significant structural with known transferase enzymes, but they have very little amino acid sequence homology.

p00233As a non-limiting example, in addition, the natural mutations or variants of a polynucleotide sequence they can recombine with the natural type or other mutations or natural variants to produce new variants. In said new variants can also identify functionality Enhanced encoded polypeptide.

p00234The application of evolution methods molecular mentioned above and the like allows the identification and selection of enzyme variants for use in the present invention that have characteristics preferred without any prior knowledge of the structure or function protein, and allows the production of mutations or variants not predictable but beneficial. There are numerous examples of the application of molecular evolution in the technique for optimization or alteration of enzymatic activity, such examples include, but are not limited to one or more of the following: optimized expression and / or activity in the host cell or<i>in vitro</i>, increased enzyme activity, altered substrate and / or product specificity, increase or decrease stability enzymatic or structural, altered enzymatic activity, specificity in the preferred environmental conditions, by example temperature, pH and substrate.

p00235As is evident to an expert in matter, using molecular evolution tools can alter an enzyme to improve the functionality of the enzyme.

p00236Properly, lipid acyltransferease used in the invention can be a variant, that is to say it can contain at least one substitution, deletion or addition of amino acid, when compared to a progenitor enzyme. The Variant enzymes retain at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99% enzyme homology parent. Suitable progenitor enzymes may include any enzyme with esterase or lipase activity. Preferably, the parent enzyme aligns with the sequence of pfam00657 consensus.

p00237In a preferred embodiment an enzyme lipid acyltransferase variant retains or incorporates at least one or more of the amino acid residues with the consensus sequence pfm00657 discovered in the GDSx, GANDY and HPT blocks.

p00238Enzymes, such as lipases without any or low lipid acyltransferase activity in an aqueous medium can be mutated using molecular evolution tools to introduce or increase transferase activity, producing this way a lipid acyltransferase enzyme with significant Transferase activity suitable for use in Compositions and methods of the present invention.

p00239Properly, the lipid acyltransferase for its use in the invention can be a variant with activity Enlarged enzyme in polar lipids, preferably phospholipids and / or glycolipids when compared to the enzyme parent. Preferably, said variants also have little or no activity on lysopolar lipids. The increased activity on polar lipids, phospholipids and / or glycolipids may be the result of hydrolysis and / or of the Transferase activity or a combination of both.

p00240Variants of lipid acyltransferases for use in the invention may present activity decreased on triglycerides and / or monoglycerides and / or diglycerides compared to the progenitor enzyme.

p00241Properly the variant enzyme may not present activity on triglycerides and / or monoglycerides and / or diglycerides

p00242Alternatively, the variant enzyme for its use in the invention may show increased activity on triglycerides and / or may also present increased activity on one or more of the following, polar lipids, phospholipids, lecithin, phosphatidylcholine, glycolipids, digalactosyl monoglyceride and monogalactosyl monoglyceride.

p00243Variants of lipid acyltransferases are known, and one or more of said variants may be suitable for use in procedures and uses according to the present invention and / or in the enzymatic compositions. Only by way of example, variants of lipid acyltransferases are described in the following references can be used according to the Present invention: Hilton &amp; Buckley <i>J. Biol. Chem</i>. fifteen January 1991: 266 (2): 997-1000; Robertson<i>et to the. J. Biol. Chem</i>. January 21, 1994; 269 ​​(3): 2146-50; Brumlik<i>et al. J. Bacteriol</i> April 1996; 178 (7): 2060-4; Peelman <i>et al. Sci Protein</i>. March 1998; 7 (3): 587-99.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Amino acid sequences

p00244As used herein, the expression "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein." In some cases, the expression "amino acid sequence" is synonymous with term "peptide".

p00245The amino acid sequence can be prepared or be isolated from a suitable source, or it can be prepared by synthesis or can be prepared by using DNA techniques recombinant

p00246Properly, the amino acid sequences can be obtained from the isolated polypeptides given to know herein by conventional techniques.

p00247An appropriate procedure to determine amino acid sequences from isolated polypeptides is the following:

p00248The purified polypeptide can be lyophilized and 100 µg of lyophilized material can be dissolved in 50 µl of a mixture of 8 M urea and 0.4 M ammonium bicarbonate, pH 8.4. The dissolved protein can be denatured and reduced for 15 minutes at 50 ° C after covering with nitrogen and adding 5 µl of 45 mM dithiothreitol. After cooling to temperature ambient, 5 µl of 100 mM iodoacetamide may be added to modify the cysteine ​​residues for 15 minutes at temperature Dark environment under nitrogen.

p00249135 µl of water and 5 µg of Lys-C endoproteinase in 5 µl of water to the mixture of previous reaction and digestion can be carried out at 37 ° C under nitrogen for 24 hours.

p00250The resulting peptides can be separated by HPLC in reverse phase on a VYDAC C18 column (0.46 x 15 cm; 10 µm; The Separation Group, California, USA) using the solvent A: 0.1% TFA in water and solvent B: 0.1% TFA in acetonitrile Selected peptides can return to Chromatograph on a Develosil C18 column using the same solvent system, before sequencing of the N terminal. He sequencing can be performed using a 476A sequencer of Applied Biosystems that uses rapid pulsed liquid cycles according to the manufacturer's instructions (Applied Biosystems, California, USA).

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Sequential identity or sequential homology

p00251The present invention also comprises the use of sequences that have a degree of identity sequential or sequential homology with the (s) amino acid sequence (s) of a polypeptide presenting the specific properties defined herein or of any nucleotide sequence encoding said polypeptide (in hereinafter referred to as "homologous sequence (s)"). Here, the term "homologue" means a entity that presents a certain homology with the sequences of subject amino acids and the nucleotide sequences of the subject. In herein, the term "homology" may be equal to "identity".

p00252The homologous amino acid sequence and / or the nucleotide sequence should provide and / or encode a polypeptide that preserves functional activity and / or increases the enzyme activity.

p00253In the present context, a homologous sequence It is considered to include an amino acid sequence that can be at least 75, 85 or 95% identical preferably, at least 95 or 98% identical to the sequence in question. Typically, the counterparts will comprise the same active points etc. as the amino acid sequence in question. Although homology can also be considered from the point of view of similarity (i.e. amino acid residues that have chemical properties / functions similar) in the context of the present invention it is preferred express homology from the point of view of identity sequential.

p00254In the present context, a homologous sequence It is considered to include a nucleotide sequence that can be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical to the nucleotide sequence encoding a polypeptide of the present invention (the sequence in question). Typically, homologues will comprise the same active points etc. as the amino acid sequence in question. Although the homology can also be considered from the point of view of similarity (i.e. amino acid residues that present similar chemical properties / functions) in the context of the present invention it is preferred to express homology from the point Sequential identity view.

p00255Homology comparisons can be made with the naked eye, or more frequently, with the help of programs comparison of very available sequences. These programs available on the market can calculate the% of homology between two or more sequences.

p00256The% homology can be calculated in sequences contiguous, that is to say a sequence is aligned with another sequence and each amino acid in a sequence is compared directly with the corresponding amino acid in the other sequence, one residue at a time. This is called "non-separate" alignment. Typically said non-separated alignments are made only over a number relatively short of remains.

p00257Although this is a very simple procedure and consistent, you cannot consider that, for example, in a couple of otherwise identical sequences, an insertion or deletion results to the following amino acid residues be placed outside the alignment, resulting in a great reduction in power in% homology when a global alignment is performed. By consequently, most of the comparison procedures of sequences are designated to produce optimal alignments that have account for possible insertions or deletions without penalty unduly the overall homology score. This is achieved inserting "gaps" in the sequence alignment to Try to maximize local homology.

p00258However, these more complex procedures assign "penalties per hole" to each hole that occurs in alignment so that, for the same number of amino acids identical, an alignment of the sequence with as few gaps as possible (which reflects greater relevance between the two sequences compared), you will get a higher score than many gaps "Related hollow costs" are typically used that bear a relatively high cost of the existence of a gap and a smaller penalty for each subsequent remainder in the hole. This is the hollow scoring system used most frequently. High penalties of the hole will certainly produce Optimized alignments with fewer gaps. Most of the alignment programs allow penalties to be modified by hole. However, it is preferred to use the values ​​by defect when using said software for sequence comparisons For example when using the GCG package of Wisconsin Bestfit the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

p00259The calculation of the maximum homology% requires therefore first of all the production of an alignment optimal, taking into account the penalties per hole. A program suitable computer to perform such alignment is the package GCG Wisconsin Bestfit (Devereux <i>et al</i>. 1984 <i>Nucleic Acids Research</i> 12 p. 387). Examples of other computer programs that can perform sequence comparisons include, but not are limited to the BLAST package (see Ausubel <i>et al</i>. 1999 <i>Short Protocols in Molecular Biology</i>, 4th ed. - Chapter 18), FASTA (Altschul <i>et al</i>. 1990 <i>J. Mol. Biol</i>. 403-410) and the GENEWORKS toolkit of comparison. Both BLAST and FASTA are available for offline and online search (see Ausubel <i>et al</i>. 1999, pages 7 to 58 to 7 to 60). However, for some applications, it is preferable to use the GCG Bestfit program. A new tool, called BLAST 2 Sequences is also available to compare protein and nucleotide sequences (see <i>FEMS Microbiol. Lett</i>. 1999 174(2): 247-50; <i>FEMS Microbiol. Lett</i>. 1999 177 (1): 187-8 and tatiana@ncbi.nlm.nih.gov).

p00260Although the final homology% can be measured from the point of view of identity, the process of alignment is not typically based on a pair comparison all or nothing. Instead, a matrix of scale similarity score that assigns scores to each pairwise comparison based on chemical similarity or evolution distance. An example of said matrix used normally it is the BLOSUM62 matrix, the default matrix for the BLAST series of programs. GCG Wisconsin programs use usually public defaults or a table of usual symbol comparison is supplied (see the manual of the user for more detail). For some applications, it is preferable use the default public values ​​for the CGC package, or in case of another computer program, the default matrix, such as BLOSUM62.

p00261Alternatively, the percentage can be calculated of homologies using the multiple alignment feature in DNASIS? (Hitachi software), based on a algorithm, analogous to CLUSTAL (Higgins DG &amp; Sharp PM (1988),<i>Gene</i> 73(1), 237-244).

p00262Once the computer program has produced a optimal alignment, it is possible to calculate the% homology, preferably% sequence identity. The program IT typically performs it as part of the comparison of sequences and generates a numerical result.

p00263The sequences can also present deletions, insertions or substitutions of amino acid residues that produce an imperceptible change and result in a substance functionally equivalent. The deliberate substitutions of amino acids can be made based on similarity in the polarity, charge, solubility, hydrophobia, hydrophilicity, and / or the amphipathic nature of the remains in order that the activity Secondary binding of the substance is preserved. For example, the negatively charged amino acids include aspartic acid and the glutamic acid; positively charged amino acids include the lysine and arginine; and amino acids with head groups non-polar polar with similar hydrophilic values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine and tyrosine

p00264Conservative substitutions can be made, for example according to the following table. Amino acids in it block in the second column and preferably on the same line in The third column can be substituted for each other:

<figref>15</figref>

p00265The process of the present invention it also includes homologous substitution (substitution and replacement both are used herein to mean the exchange of an existing amino acid residue, with an alternative remainder) that may occur, that is, replacement similar for similar such as basic for basic, acid for acid, polar by polar, etc. Non-homologous substitution may occur. that is also, from one class of rest to another or alternatively that involves the inclusion of non-amino acids natural such as ornithine (hereinafter referred to as Z), acidic diaminobutyric ornithine (hereinafter referred to as B), norleucine Ornithine (hereinafter referred to as O), pyrilalanine, thienylalanine, naphthylalanine and phenylglycine.

p00266Replacements can also be made by unnatural amino acids

p00267The amino acid sequence variants may include suitable spacer groups that can be inserted between any of two amino acid residues of the sequence that include alkyl groups such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine residues or β-alanine. Another form of variation, which implies the presence of one or more amino acid residues in the form Peptoid will be evident to those skilled in the art. For avoid doubts, "the peptoid form" is used to refer to variant amino acid residues in which the substituent group α-carbon is in the nitrogen atom of rest instead of in the α-carbon. The procedures for prepare peptides in peptoid form are known in the technique, for example Simon RJ <i>et al</i>., <i>PNAS</i> (1992) 89 (20), 9367-9371 and Horwell DC, <i>Trains Biotechnol</i>. (1995) 13(4), 132-134.

p00268Nucleotide sequences for use in the present invention or encoding a polypeptide that presents the specific properties defined herein invention may include synthetic nucleotides or modified. Numerous different types of modification to oligonucleotides are known in the art. These include axes Methyl phosphonate and phosphorothioate plants and / or the addition of acridine or polylysine chains at terminals 3 'and / or 5' of the molecule For the purposes of the present invention, you must interpreted that the nucleotide sequences described in the This report can be modified by any available method in the technique Such modifications may be made in order to improve activity <i>in vivo</i> or the life span of the nucleotide sequences

p00269The present invention also comprises the use of nucleotide sequences that are complementary to the sequences set forth herein, or any derivative, fragment or derivative thereof. If the sequence is complementary to a fragment of it then the sequence can be used as a probe to identify sequences of similar coding in other organisms, etc.

p00270Polynucleotides that are not 100% homologous with the sequences of the present invention but which are not within the scope of the process of the invention They can be obtained in numerous ways. Other variants of sequences described herein can be obtained by example probing DNA banks prepared from a record of individuals, for example individuals from different populations. In addition, other viral / bacterial or cellular homologs particularly cell homologs are found in the cells of mammal (for example, rat, mouse, bovine and primate cells) can be obtained and said homologs and fragments thereof in general may selectively hybridize to sequences represented in the sequence listing herein. These sequences can be obtained by probing cDNA banks prepared from genomic DNA banks of other species animals, and probing said libraries with probes comprising all or part of any of the sequences in the listings of Attached sequences in medium to high severity conditions. Similar considerations apply to obtain homologous species and allele variants of the polypeptide or nucleotide sequences of the invention.

p00271Variants and homologs can also be obtained of strains / species using degenerate PCR that will use primers designed for target sequences in variants and homologs that encode amino acid sequences conserved within sequences of the present invention. The conserved sequences can be predicted, for example, by aligning the sequences of amino acids of several variants / homologues. Alignments sequential can be done using computer programs known in the field. For example the GCG Wisconsin program PileUp is widely used.

p00272Primers used in degenerate PCR they will contain one or more degenerate positions and will be used in severity conditions lower than those used to clone the sequences with sequence primers isolated against sequences known.

p00273Alternatively, said polynucleotides can Obtained by site-directed mutagenesis of sequences characterized. This can be useful when, for example, they are required. imperceptible codon sequence changes to optimize codon preferences for a specific host cell in the that polynucleotide sequences are being expressed. They can other sequence changes are desired in order to introduce points of recognition of the restriction polypeptide, or to alter the property or function of the polypeptides encoded by the polynucleotides

p00274The polynucleotides (nucleotide sequences) for use in the invention can be used to produce a primer, for example a PCR primer, a primer for a alternative expansion reaction, a probe labeled for example with a discovery marker by conventional means using radioactive or non-radioactive markers or Polynucleotides can be cloned into vectors. These primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 25, 30 or 40 nucleotides in length and are also included in the term polynucleotides of the invention used herein memory.

p00275Polynucleotides such as DNA polynucleotides and probes can be produced in a manner recombinant, by synthesis or by any means available by subject matter experts. They can also be cloned by techniques conventional.

p00276In general, primers will be produced by synthetic means, which implies a preparation in stages of the desired nucleic acid sequence one nucleotide at a time. The techniques for its realization that use automatic techniques are easily available in the art.

p00277Longer polynucleotides are usually will produce using recombinant means, for example using PCR cloning techniques (polymerase chain reaction). This will involve the preparation of a pair of primers (for example approximately 15 to 30 nucleotides) that flank an area of ​​the target sequence of the lipid to be cloned, putting the primers in contact with mRNA or cDNA obtained from a cell animal or human, performing a polymerase chain reaction in conditions that cause the extension of the desired area, isolating the expanded fragment (for example purifying the reaction mixture in an agarose gel) and recovering the expanded DNA. The primers can be designed to contain recognition points of the suitable restriction enzyme so that the expanded DNA can clone into a suitable cloning vector.

Hybridization

p00278The present use also includes sequences that are complementary to the sequences herein invention or sequences that can hybridize to the sequences for their use in the present invention or to sequences that are complementary of these.

p00279The term "hybridization" as used herein will include "the procedure by which a nucleic acid chain binds to a chain complementary by base pairing "as well as the extension procedure performed in reaction technologies in polymerase chain (PCR).

p00280The present invention also comprises the use of nucleotide sequences that can hybridize with the sequences that are complementary to the sequences in question set forth herein, or any derivative, fragment or derived from them.

p00281The present invention also comprises the use of sequences that are complementary to the sequences which can hybridize with the nucleotide sequences exposed in This memory.

p00282Hybridization conditions are based on the melting temperature (Tm) of the nucleotide binding complex, such as disclosed in Berger and Kimmel (1987, <i>Guide to Molecular Cloning Techniques, Methods in Enzymology</i>, vol. 152, Academic Press, San Diego, CA), and confer a definite "severity" as explained below.

p00283Maximum severity typically occurs at approximately Tm-5ºC (5ºC below the Tm of the probe); the high severity between approximately 5ºC and 10ºC below Tm; the intermediate severity between approximately 10 ° C and 20 ° C below Tm; and low severity between approximately 20 ° C and 25 ° C below Tm. How will you appreciate the experts in the field, a hybridization of maximum severity to identify or detect sequences identical nucleotides while a severe hybridization intermediate (or low) can be used to identify or detect similar or related polynucleotide sequences.

p00284The present invention comprises the use of sequences that are complementary to sequences that can hybridize under conditions of high severity or conditions of intermediate severity with nucleotide sequences encoding polypeptides that have the specific properties defined in This memory.

p00285More preferably, the present invention comprises sequences that are complementary to the sequences that they can hybridize under conditions of high severity (for example 65 ° C and 0.1 x SSC {1 x SSC = 0.15 M NaCl, 0.015 M citrate-Na, pH 7.0}) with the sequences nucleotides encoding polypeptides that have properties specific defined herein.

p00286The present invention also relates to the use of nucleotide sequences that can hybridize with the nucleotide sequences set forth herein (including complementary sequences of those exposed in the present memory).

p00287They are also included within the scope of the present invention the polynucleotide sequences that they can hybridize with the nucleotide sequences exposed in the present memory in conditions of intermediate severity to maximum

p00288In a preferred aspect, the present invention includes the use of nucleotide sequences that can hybridize with the nucleotide sequences set forth herein memory, or the complement thereof, under severe conditions (for example 50 ° C and 0.2XSC).

p00289In a more preferred aspect, the present invention comprises the use of nucleotide sequences that they can hybridize with the nucleotide sequences exposed in the present memory, or with the complement thereof, in conditions of high severity (for example 65 ° C and 0.1 x SSC).

Polypeptide expression

p00290A nucleotide sequence for use in the present invention or to encode a polypeptide that presents the specific properties defined herein Memory can be incorporated into a replicable recombinant vector. He vector can be used to replicate and express the sequence nucleotide, in the form of a polypeptide, in and / or of a cell compatible host. The expression can be controlled using control sequences that include activators / enhancers and other expression regulation signals. Can be used prokaryotic activators and functional activators in eukaryotic cells Specific activators can be used for tissue or specific for stimuli. Can be used also hybrid activators comprising elements of the sequence of two or more different activators described previously.

p00291The polypeptide produced by a cell recombinant host by sequence expression nucleotide can be segregated or it can be contained within the cell depending on the sequence and / or the vector used. The coding sequences can be designed with signal sequences whose direct secretion of the substance encoding the sequences to through a prokaryotic or eukaryotic cell membrane determined.

Expression vector

p00292The expression "expression vector" means a mount capable of expression <i>in vivo</i> or <i>in vitro</i>.

p00293Preferably, the expression vector is Incorporates into the genome of the organism. The term "incorporates" preferably comprises stable incorporation into the genome.

p00294The nucleotide sequence for use in the present invention or the coding for a polypeptide that presents the specific properties defined herein memory may be present in a vector, in which the sequence nucleotide is operatively linked to regulatory sequences so that regulatory sequences can provide the nucleotide sequence expression by an organism suitable host, that is, the vector is a vector of expression.

p00295Vectors for use herein invention can be transformed into a suitable host cell as described below to provide the expression of a polypeptide that has the specific properties defined In the present memory.

p00296The selection of the vector, for example, plasmid, cosmid, virus or phage vector, will often depend on the cell host in which it must be introduced.

p00297Vectors may contain one or more genes. selectable markers, such as a gene that communicates antibiotic resistance for example resistance to ampicillin, kanamycin, chloramphenicol or tetracycline. Alternatively, the selection can be made by cotransformation (as described in WO 91/17243).

p00298Vectors can be used <i>in vitro</i>, for example for the production of RNA or used to transfer or Transform a host cell.

p00299In addition a procedure of preparation of nucleotide sequences for use in the present invention or nucleotide sequences encoding polypeptides that have the specific properties defined in the present specification by introducing a nucleotide sequence into a replicable vector, introducing the vector into a cell compatible host and culturing the host cell in conditions that produce vector replication.

p00300The vector may further comprise a sequence. nucleotide that allows the vector to replicate in a cell host in question. Examples of such sequence are the origins of plasmid replication pUC19, pACYC177, pUB110, pE194, pAMB1 and pIJ702.

Regulatory sequences

p00301In some applications, a sequence nucleotide for use in the present invention or a nucleotide sequence encoding a polypeptide that has the specific properties defined herein may be operatively linked to a regulatory sequence that can provide expression of the nucleotide sequence, such as through the selected host cell. As an example, the The present invention comprises the use of a vector that comprises the nucleotide sequences of the present invention operatively linked to said regulatory sequence, ie the Vector is an expression vector.

p00302The expression "operationally linked" is refers to a juxtaposition in which the components described present a relationship that allows them to function in the way desired. A regulatory sequence "operatively linked" to a coding sequence is linked in such a way that the expression of the coding sequence is achieved under conditions compatible with control sequences.

p00303The expression "regulatory sequences" includes activators and enhancers and other signals from expression regulation.

p00304The term "activator" is used in the normal sense of technique, for example a junction point of the RNA polymerase.

p00305Increase in sequence expression nucleotide that encodes the enzyme that has the properties specific defined herein may also achieved by selecting heterologous regulatory zones, for example zones of activator, main secretion and of terminator

p00306Preferably, the nucleotide sequence for its use in the present invention may be operatively attached to at least one activator.

p00307Examples of activators suitable for directing transcription of the nucleotide sequence in a host Bacterial, fungal or yeast are well known in the matter.

Mounts

p00308The term "assembly", which is synonymous with terms like "conjugate", "cassette" and "hybrid", includes a nucleotide sequence encoding a polypeptide that presents the specific properties defined herein memory for use according to the present direct invention or indirectly attached to an activator. An example of a union indirect is the contribution of a suitable spacer group such as a intronic sequence, such as intron Sh1 or intron ADH, activator intermediate and nucleotide sequence of the present invention. The same is true for the term "merged" in relationship with the present invention that includes direct bonding or hint. In some cases, the terms do not include the natural combination of the nucleotide sequence encoding the protein normally associated with the natural gene activator and when They are both in their natural environment.

p00309The assembly can even contain or express a marker that allows selection of genetic assembly.

p00310For some applications, assembly includes preferably at least one nucleotide sequence of the present invention or a nucleotide sequence encoding a polypeptide that has the specific properties defined in the present memory operatively linked to an activator.

Host cells

p00311The expression "host cell", in relationship with the present invention comprises any cell that comprise a nucleotide sequence encoding a polypeptide which presents the specific properties defined herein memory or an expression vector described above and which used in the recombinant production of a polypeptide that presents the specific properties defined herein.

p00312Thus, an additional embodiment of the present invention provides host cells transformed or transfected with a nucleotide sequence of the present invention or a nucleotide sequence expressing a polypeptide that has the specific properties defined in the present memory The cells will be selected to be compatible with said vector and can be for example prokaryotic (for example, bacterial), fungal, yeast or vegetables. Preferably, the host cells are not cells human.

p00313Examples of bacterial host organisms Suitable are gram negative or gram positive bacteria.

p00314Depending on the nature of the sequence nucleotide that encodes a polypeptide that has the specific properties defined herein, and / or the convenience of trying more provided expressly, may preferred eukaryotic cells such as yeasts or others mushrooms. In general, yeast cells are preferred over Fungal cells because they are easier to manipulate. Nevertheless, some proteins secrete little in the yeast cell, or in some cases are not treated appropriately (for example the hyperglycosylation in yeasts). In these cases, it would be selected a fungal host organism.

p00315The use of host cells suitable, such as yeast, fungal and host cells Vegetables, can provide modifications after the translation (for example myristoylation, glycosylation, truncation, stoning and phosphorylation of tyrosine, serine or threonine) or it may be necessary to provide biological activity optimal in the recombinant expression products of the present invention.

p00316The host cell can be a strain insufficient in protease or devoid of protease.

Organisms

p00317The term "organism" in relation to the present invention comprises any organism that can comprising a nucleotide sequence according to the present invention or a nucleotide sequence encoding a polypeptide that has the specific properties defined herein and / or the products obtained from it.

p00318Suitable organisms may include a Prokaryotic, fungus, yeast or a plant.

p00319The expression "transgenic organism" in relationship with the present invention includes any organism that comprises a nucleotide sequence encoding a polypeptide that presents the specific properties defined herein memory and / or products obtained from it, and / or in which a activator can allow the expression of the one sequence nucleotide that encodes a polypeptide that has the specific properties defined herein in the organism. Preferably the nucleotide sequence is incorporated into the organism genome

p00320The expression "transgenic organism" does not comprises the natural nucleotide coding sequences in their natural environment when they are under the control of their activator natural that is also in its natural environment.

p00321Therefore, the transgenic organism of the The present invention includes an organism comprising any of between a nucleotide sequence encoding a polypeptide that presents the specific properties defined herein memory, the mounts defined herein, the vectors defined herein, the plasmids defined in the present memory, the cells defined herein, or combinations thereof or the products thereof. By example the transgenic organism may also comprise a nucleotide sequence encoding a polypeptide that has the specific properties defined herein under the control of a heterologous activator.

Transformation of host cells / organism

p00322As indicated at the beginning, the organism Host can be a prokaryotic or eukaryotic organism. Examples of suitable prokaryotic host cells include a<i>E. coli</i> and <i>Bacillus subtilis</i>.

p00323The information on the transformation of Prokaryotic hosts is well documented in the art, by example see Sambrook <i>et al. (Molecular Cloning: A Laboratory Manual</i>, 2nd edition, 1989. If a host is used prokaryotic then the nucleotide sequence may need be modified appropriately before transformation, such as by removing introns.

p00324In another embodiment the organism Transgenic can be a yeast.

p00325Filamentous fungal cells can transform using several known procedures in the technique, such as a procedure that involves the formation of protoplast and transformation of protoplasts followed by the cell wall regeneration in a known way. The utilization from <i>Aspergillus</i> as a host microorganism is described in EP 0 238 023.

p00326Another host organism can be a vegetable. A study of the general techniques used to transform plants can be found in articles by Potrykus (<i>Annu Rev. Plant. Physiol Plant Mol. Biol</i>. [1991] 42: 205-225) and Christou (Agro-Food-Industry Hi-Tech March 17-27 / April 1994). More teachings on plant transformation can be found in document EP-A-0449375.

p00327The general teachings on transformation of fungi, yeasts and vegetables are presented in the sections following.

Fungus transformed

p00328A host organism can be a fungus, such Like a filamentous fungus Examples of such hosts suitable include any member that belongs to the genders<i>Thermomyces, Acremonium, Aspergillus, Penicillium, Mucor, Neurospora, Trichoderma</i> and the like

p00329The teachings on mushroom transformation filamentous are studied in the document US-A-5741665 which states that the conventional techniques for the transformation of fungi filamentous and fungal cultivation are well known in the matter. An extensive study of the techniques applied to<i>N. crassa</i> is found, for example in Davis and de Serres,<i>Methods Enzymol</i>. (1971) 17A: 79-143.

p00330More lessons on mushroom transformation filamentous are studied in the document US-A-5674707.

p00331In one aspect the host organism can be of the genre <i>Aspergillus</i> such as <i>Aspergillus niger</i>.

p00332A <i>Aspergillus</i> transgenic according to The present invention can also be prepared by following, for example, Turner G. 1994 instructions (Vectors for genetic manipulation In: Martinelli SD, Kingborn JR (editors)<i>Aspergillus</i>: 50 years on. Progress in industrial microbiology vol. 29. Elsevier Amsterdam 1994. pp. 641-666).

p00333Gene expression in filamentous fungi has been studied in Punt <i>et al</i>. (2002) <i>Trends Biotechnol</i>. May 2002; 20 (5): 200-6, Archer &amp; Peberdy <i>Crit. Rev. Biotechnol</i>. (1997) 17(4):273-306.

Yeast transformed

p00334In another embodiment, the organism Transgenic can be a yeast.

p00335A study of the principles of expression Heterologous gene in yeast are provided in, for example,<i>Methods Mol. Biol</i>. (1995), 49: 341-54, and<i>Curr. Opin. Biotechnol</i>. (1997) Oct; 8 (5): 554-60.

p00336In this regard, yeast may be used, such as the species <i>Saccharomyces cerevisi</i> or <i>Pichia pastoris</i> (see <i>FEMS Microbiol. Rev</i>. (2000 24 (1): 45-66), can be used as a vehicle for heterologous gene expression.

p00337A study of the principles of expression heterologous gene in <i>Saccharomyces cerevisiae</i> and of the Gene products secretion is provided by E. Hinchcliffe E. Kenny (1993, "Yeast as a vehicle for the expression of heterologous genes ", <i>Yeasts</i>, vol. 5, Anthony H. Rose and J. Stuart Harrison, eds. 2nd edition, Academic Press Ltd.).

p00338For the transformation of yeast they have developed several transformation protocols. For example, a<i>Saccharomyces</i> transgenic according to the present invention can prepare following the teachings of Hinnen <i>et al</i>., (1978, <i>Proceedings of the National Academy of Sciences of the USA</i><b>75</b>, 1929); Beggs, JD (1978,<i>Nature</i>, London, 275, 104); and Ito, H.<i>et al</i>. (1983, <i>J. Bacteriology</i> 153, 163-168).

p00339Transformed cells can be selected using several selective markers, such as markers with resistance to dominant antibiotics of auxotrophic markers.

p00340A suitable yeast host organism can be selected from yeast species biotechnologically relevant as but not limited to, species of yeasts selected from <i>Pichia</i> spp.,<i>Hansenula</i> spp., <i>Kluyveromyces, Yarrowinia</i> spp.,<i>Saccharomyces</i> spp., including <i>S. cerevisiae</i>or<i>Schizosaccharomyce</i> spp. including<i>Schizosaccharomyce pombe</i>.

p00341A strain of the methylotropic yeast species<i>Pichia pastoris</i> can be used as an organism host.

p00342In one embodiment, the organism host can be a species <i>Hansenula</i>, such as <i>H. polymorpha</i> (described in WO 01/39544).

Plants / transformed plant cells

p00343A suitable host organism for The present invention can be a plant. A study of the techniques generals can be found in Potrykus articles (<i>Annu Rev. Plant. Physiol Plant Mol. Biol</i>. [1991] <b>42</b>: 205-225) and Christou (Agro-Food-Industry Hi-Tech March 17-27 / April 1994), or in WO 01/16308. The transgenic plant can produce increased levels of phytosterol esters and phytostanol esters, for example.

p00344Accordingly, the present invention is also refers to a procedure for the production of a plant transgenic with increased levels of phytosterol esters and phytostanol esters, which comprises the stages of transforming a plant cell with a lipid acyltransferase as defined in the present memory (in particular with an expression vector or assembly comprising a lipid acyltransferase as defined in this memory) and grow a plant from the cell transformed vegetable

Secretion

p00345Frequently, it is desirable that the polypeptide is segregated from the expression host in the culture medium to from which the enzyme can be more easily recovered. According the present invention, the main secretion sequence can selected based on the desired expression host. The hybrid signal sequences can also be used in context of the present invention.

p00346Typical examples of main sequences of Heterologous secretion are those that originate from the gene (<i>gla</i>A, both 18 and 24 amino acid versions for example of<i>Aspergillus</i>) of the fungal amyloglucosidase (AG) gene of factor a (yeasts for example <i>Saccharomyces, Kluyveromyces</i> and <i>Hansenula</i>) or the gene of the α-amylase (<i>Bacillus</i>).

Detection

p00347A variety of protocols to detect and measure amino acid sequence expression is known in the matter. Examples include the enzyme immunosorbent assay linked (ELISA), radioimmunoassay (RIA) and classification of fluorescent activated cell sorting (FACS).

p00348A wide variety of markers and techniques conjugation are known to those skilled in the art and can used in several amino acid and nucleic acid assays.

p00349Numerous companies such as Pharmacia Biotech (Piscataway, NJ), Promega (Madison, WI), and US Biochemical Corp (Cleveland, OH) supply commercial kits and protocols for these procedures

p00350Suitable indicator molecules or markers include radionuclides, enzymes, fluorescent agents, chemiluminescent or chromogens as well as substrates, cofactors, inhibitors, magnetic particles and the like. The patents that disclose the use of such markers include the US-A-3,817,837; US-A-3,850,752; US-A-3,939,350; US-A-3,996,345; US-A-4,277,437; US-A-4,275,149 and US-A-4,366,241.

p00351Also, immunoglobulins can be produced. recombinants as shown in the document US-A-4,816,567.

Fusion proteins

p00352A polypeptide that has the properties specific ones defined herein may occur as fusion protein, for example to aid extraction and purification of it. Examples of protein companions fusion include the glutathione-S-transferase (GST), 6XHis, GAL4 (domains of DNA binding and / or activation of transcription) and β-galactosidase. Likewise it may be convenient to include a cleavage sequence proteolytic between the companion of the fusion protein and the protein sequence of interest that allows the elimination of fusion protein sequences. Preferably the protein of fusion will not impede protein sequence activity.

p00353Gene fusion expression systems in<i>E. coli</i> have been studied in <i>Curr. Opin. Biotechnol</i>. (1995) 6(5):501-6.

p00354In another embodiment of the invention, the amino acid sequence of a polypeptide presenting the specific properties defined herein may bind to a heterologous sequence to encode a protein from fusion. For example, for screening peptide banks intended for agents capable of affecting the activity of the substance, may be useful for encoding a hybrid substance that expresses a heterologous epitope that is recognized by an antibody available in the market.

p00355The invention will be described below, by way of example only, referring to the Figures and Following examples.

p00356Figure 1 presents a consensus sequence pfam00657 of the database version 6 (SEQ ID NO: 1);

p00357Figure 2 presents a sequence of amino acids (SEQ ID NO: 2) obtained from the body (<i>Aeromonas hydrophila</i> (P10480; GI: 121051);

p00358Figure 3 presents a sequence of amino acids (SEQ ID NO: 3) obtained from the body (<i>Aeromonas salmonicida</i> (AAG098404; GI: 9964017);

p00359Figure 4 presents a sequence of amino acids (SEQ ID NO: 4) obtained from the body<i>Streptomyces coelicolor</i> A3 (2) (registration number in Genbank NP_631558);

p00360Figure 5 presents a sequence of amino acids (SEQ ID NO: 5) obtained from the body<i>Streptomyces coelicolor</i> A3 (2) (registration number in Genbank CAC42140);

p00361Figure 6 presents a sequence of amino acids (SEQ ID NO: 6) obtained from the body<i>Saccharomyces cerevisiae</i> (registration number in Genbank P41734);

p00362Figure 7 shows an alignment of the selected sequences for the consensus sequence pfam00657;

p00363Figure 8 shows a pairwise alignment of the SEC. ID. nº: 3 with the SEC. ID. nº: 2 that presents 93% of amino acid sequence identity. The signal sequence is underlined. + indicates differences. The GDSX reason that contains the serine active point 16 and aspartic acid active points 116 e Histidine 291 are highlighted (see shaded areas). The numbers after the amino acid is less the signal sequence;

p00364Figure 9 presents a nucleotide sequence (SEQ ID NO: 7) encoding a lipid acyltransferase obtained at leave the organism <i>Aeromonas hydrophila</i>;

p00365Figure 10 presents a nucleotide sequence (SEQ ID NO: 8) encoding a lipid acyltransferase obtained at leave the organism <i>Aeromonas salmonicida</i>;

p00366Figure 11 presents a nucleotide sequence (SEQ ID NO: 9) encoding a lipid acyltransferase obtained at leave the organism <i>Streptomyces coelicolor</i> A3 (2) (Genbank registration number NC_003888.1: 8327480 .. 8328367);

p00367Figure 12 shows a nucleotide sequence (SEQ ID NO: 10) encoding a lipid acyltransferase obtained at leave the organism <i>Streptomyces coelicolor</i> A3 (2) (Genbank registration number AL939131.1: 265480..236667);

p00368Figure 13 presents a nucleotide sequence (SEQ ID NO: 11) encoding a lipid acyltransferase obtained at leave the organism <i>Saccharomyces cerevisiae</i> (number of Genbank registration Z75034);

p00369Figure 14 presents a sequence of amino acids (SEQ ID NO: 12) obtained from the body<i>Ralstonia</i> (Genbank registration number AL646052);

p00370Figure 15 presents a nucleotide sequence (SEQ ID NO: 13) encoding a lipid acyltransferase obtained at leave the organism <i>Ralstonia</i>;

p00371Figure 16 presents the SEC. ID. nº: 20. Scoe1 NCBI protein code CAB39707.1 GI: 4539178 hypothetical protein preserved [<i>Streptomyces coelicolor</i> A3 (2)];

p00372Figure 17 presents a nucleotide sequence represented as SEC. ID. No .: 21 encoding the NCBI protein registration code CAB39707.1 preserved hypothetical protein GI: 4539178 [<i>Streptomyces coelicolor</i> A3 (2)];

p00373Figure 18 shows a sequence of amino acids SEC. ID. nº: 22 represented as a protein that encodes to the NCBI Scoe2 protein registration code CAC01477.1 protein hypothetical conserved GI: 9716139 [<i>Streptomyces coelicolor</i>A3 (2)];

p00374Figure 19 presents a nucleotide sequence represented as SEC. ID. nº: 23 encoding the Scoe2 protein NCBI registration code CAC01477.1 preserved hypothetical protein GI: 9716139 [<i>Streptomyces coelicolor</i> A3 (2)];

p00375Figure 20 presents a sequence of amino acids (SEQ ID NO: 24) encoding the Scoe3 NCBI protein registration code CAB88833.1 possible segregated protein GI: 7635996 [<i>Streptomyces coelicolor</i> A3 (2)];

p00376Figure 21 presents a sequence of amino acids represented as SEC. ID. nº: 25 coding the Scoe3 protein NCBI registration code CAB88833.1 possible protein segregated GI: 7635996 [<i>Streptomyces coelicolor</i>A3 (2)];

p00377Figure 22 shows a sequence of amino acids (SEQ ID NO: 26) encoding the Scoe4 NCBI protein Registration code CAB89450.1 GI segregated possible protein: 7672261 [<i>Streptomyces coelicolor</i> A3 (2)];

p00378Figure 23 shows a sequence of amino acids represented as SEC. ID. nº: 27 coding the Scobi protein NCBI registration code CAB89450.1 possible protein segregated GI: 7672261 [<i>Streptomyces coelicolor</i>A3 (2)];

p00379Figure 24 presents a sequence of amino acids (SEQ ID NO: 28) encoding the Scoe5 NCBI protein registration code CAB62724.1 possible segregated protein GI: 6562793 [<i>Streptomyces coelicolor</i> A3 (2)];

p00380Figure 25 presents a sequence of amino acids represented as SEC. ID. nº: 29 coding the Scobi5 NCBI protein registration code CAB62724.1 lipoprotein possible GI: 6562793 [<i>Streptomyces coelicolor</i>A3 (2)];

p00381Figure 26 presents a sequence of amino acids (SEQ ID NO: 30) protein registration code Srim1 NCBI AAK84028.1 GI: 5082088 GDSL-lipase [<i>Streptomyces rimosus</i>];

p00382Figure 27 presents a nucleotide sequence represented as SEC. ID. nº: 31 encoding the Srim1 protein NCBI registration code AAK84028.1 GI: 5082088 GDSL-lipase [<i>Streptomyces rimosus</i>];

p00383Figure 28 presents a sequence of amino acids (SEQ ID NO: 32) of a lipid acyltransferase of<i>Aeromonas hydrophila</i> (ATCC No. 7965);

p00384Figure 29 presents a sequence of amino acids (SEQ ID NO: 33) encoding a lipid acyltransferase from <i>Aeromonas hydrophila</i> (ATCC No. 7965);

p00385Figure 30 presents a sequence of amino acids (SEQ ID NO: 34) of a lipid acyltransferase of<i>Aeromonas salmonicida</i> subsp. <i>Salmonicide</i> (ATCC No. 14174);

<pre listing-type="other">\ newpage</pre>

p00386Figure 31 shows a nucleotide sequence (SEQ ID NO: 35) encoding a lipid acyltransferase of<i>Aeromonas salmonicida</i> subsp. <i>Salmonicide</i> (ATCC No. 14174);

p00387Figure 32 demonstrates that the counterparts of the genes of <i>Aeromonas</i> can be identified using the tool service for searching the basic local alignment in the National Center for Biotechnology Information, NIH, MD, USA and Full genome databases. The GDSX motif was used in the search in the database and numerous were identified sequences / genes that potentially encode enzymes with activity lipolytic Genus genes were identified<i>Streptomyces, Xanthomonas</i> and <i>Ralstonia</i>. As an example below, aligned <i>Ralstonia solanacearum</i> to the gene (satA) of <i>Aeromona salmonicide</i>. The peer alignment showed 23% of identity. The active point serine is present in the terminal amino and histidine and aspartic acid catalytic moieties can identify;

p00388Figure 33 presents the consensus sequence Pfam00657.11 [family 00657, database version 11] (called hereinafter Pfam consensus) and the alignment of several sequences with the consensus sequence Pfam. The arrows indicate the remains with active point, the underlined boxes indicate three of the boxes with homology indicated by [Upton C. and Buckley JT (1995)<i>Trends Biochem. Sci</i>. <b>20</b>; 179-179]. The Capital letters in the Pfam consensus indicate remains preserved in Many family members. The symbol - indicates a position in which the hidden Markov model of the Pfam consensus is expected to find a remainder but can't find it, so that a hole. The symbol . indicates a remainder without a corresponding remainder in the Pfam consensus. The sequences are the amino acid sequences included in Figures 16, 18, 20, 22, 24, 26, 28 and 30.

p00389Figure 34 presents the consensus sequence Pfam00657.11 [family 00657, database version 11] (called hereinafter Pfam consensus) and the alignment of several sequences with the consensus sequence Pfam. The arrows indicate the remains with active point, the underlined boxes indicate three of the boxes with homology indicated by [Upton C. and Buckley JT (1995)<i>Trends Biochem. Sci</i>. <b>20</b>; 179-179]. The Capital letters in the Pfam consensus indicate remains preserved in Many family members. The symbol - indicates a position in which the hidden Markov model of the Pfam consensus is expected to find a remainder but can't find it, so that a hole. The symbol . indicates a remainder without a corresponding remainder in the Pfam consensus. The sequences are the amino acid sequences listed in Figures 2, 16, 18, 20, 26, 28 and 30. All these proteins were found to be active against substrates of lipids

p00390Figure 35 presents an expression vector pet12-AsalGCAT = pSM containing the lipid gene acyltransferase from <i>Aeromonas salmonicida</i> tagged in His from terminal C;

p00391Figure 36 presents the results of the test of cell extracts in an NEFA analysis kit, which represents the activity of a lipid acyltransferase of <i>TO. salmonicide</i> recombinant, towards lecithin. The wells of left to right indicate: a positive reference, a reference negative (i.e. empty plasmid extracts) and samples collected after 0, 1, 2 and 3 hours of cultivation after IPTG induction;

p00392Figure 37 presents the optimization of BL21 (DE3) pLysS growth housing the vector of pet12-AsalGCAT expression = pSM showing the culture at 30 ° C resulting in the production of enzyme with great activity for Lecithin Phospholipase activity was determined in the cell extracts using the NEFA analysis kit. Pocillos de left to right: positive reference; negative reference; 20 ° C; 30 ° C;

p00393Figure 38 shows cell extracts in BL21 (DE3) pLysS gross expressing lipid active acyltransferase incubated with the lecithin substrate and the mixture reaction was analyzed using thin layer chromatography which It presents the presence of degradation products. Stripes: 1. Without enzyme; 2. + A. salt-10 µL 37 ° C; 3. + A. salt -20 3737 ° C; 4. + A. salt -10 µL 24 ° C; 5. + A. salt -20 µ 24 ° C;

p00394Figure 39 shows the partial purification of acyltransferase from <i>Aeromonas salmonicida</i> that presents the phospholipase activity associated with purified protein with His tag. SE = extracts treated with ultrasound, His = purified with Qiagen's Ni-NTA spin kit;

p00395Figure 40 shows the expression vector pet12-Ah GCAT = pSMa containing the gene glycerolipid acyltransferase (GCAT) from <i>Aeromonas hydrophila</i>His tagging in terminal C was used to transform the strain BL21 (DE3) pLysS of <i>E. coli</i>;

p00396Figure 41 shows the activity of the crude extracts (5 and 10 µl) containing the enzyme recombinant GCAT of <i>Aeromonas hydrophila</i> was determined to with lecithin using the non-esterified fatty acid kit (NEFA) (Roche, Switzerland), which presents the presence of active enzyme stops with phospholipid, lecithin;

p00397Figure 42 presents the optimization of BL21 (DE3) pLysS growth housing the vector of pet12-AsalGCAT expression = pSM showing the culture at 30 ° C resulting in the production of enzyme with great activity for Lecithin Phospholipase activity was determined in the cell extracts using the NEFA analysis kit.

p00398Figure 43 shows the partial purification of acyl transferases from <i>Aeromonas hydrophila</i> and <i>TO. salmonicide</i> that presents the phospholipase activity associated with the purified protein with His tag. SE = extracts treated with ultrasound, His = purified with Ni-NTA spin kit from Qiagen;

p00399Figure 44 shows the expression of the genes from <i>Aeromonas</i> in <i>Bacillus subtilis</i> 163 that presents the secreted enzyme production with activity for both lecithin as for DGDG. The pUB-AH = assembly that contains the gene of <i>A. hydrophila</i> and pUB-AS, assembly with the gene of <i>A. salmonicide</i>, the culture filtrate was incubated with the substrates for 60 minutes.

p00400Figure 45 presents a sequence (SEQ. ID. nº: 36) amino acids of the fusion assembly used for lipid acyltransferase gene mutagenesis of <i>Aeromonas hydrophila</i> in Example 17. The underlined amino acids are a xylanase signal peptide;

p00401Figure 46 shows a nucleotide sequence (SEQ ID NO: 45) encoding an enzyme of <i>Aeromonas hydrophila</i> which includes a xylanase signal peptide;

p00402Figure 47 presents the results of the analysis by HPTLC in Experiment I;

p00403Figure 48 presents the results of the analysis by HPTLC in Experiment II;

p00404Figure 49 presents a calibration curve for monoglyceride standard solutions;

p00405Figure 50 presents a calibration curve for standard solutions of diglyceride;

p00406Figure 51 shows a nucleotide sequence encoding a lipid acyltransferase enzyme according to the present invention of <i>Streptomyces</i> (SEQ ID NO: 54);

p00407Figure 52 presents a sequence polypeptide encoding a lipid acyltransferase enzyme according to the present invention of <i>Streptomyces</i> (SEQ ID NO: 55).

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Examples

p00408For the avoidance of doubt, the following abbreviations herein:

p00409MONKEY = monoglyceride

p00410MAG = monoacrylic glycerol = monoglyceride

p00411MAG and MONO are interchangeable here. memory.

p00412DAG = diacylglycerol

p00413FFA = free fatty acid

Example 1

Cloning, sequencing and heterologous expression of a transferase from

Aeromonas salmonicida

subsp.

Salmonicide

Strains used

p00414The <i>Aeromonas salmonicida</i> subsp.<i>Salmonicide</i> (ATCC 14174) was purchased at ATCC and cultivated overnight at 30 ° C in Luria-Bertani medium (LB). The cells were centrifuged and the genomic DNA was isolated using the procedures for genomic DNA isolation from the Qiagen Ltd. genomic DNA buffer series (cat. 19060), Protease K (cat. 19131) and RNase A (cat. 19101) were all acquired in Qiagen Ltd. (Boundary court Gatwick Court, West Sussex, RH10 2AX).

p00415Strain BL21 (DE3) pLysS was used (Novagen) bacterial host for enzyme production recombinants of <i>Aeromonas</i>. Cells were used competent BL21 (DE3) pLysS as hosts for transformation with the expression vector pet12-AsalGCAT = pSM.

p00416Transformants containing the plasmid appropriate were grown at 37 ° C in medium with LB agar-agar containing 100 µg of ampicillin / ml

Construction of the expression vector pet12-AsalGCAT-pSM

p00417For all gene DNA extensions of transferase from <i>Aeromonas</i>, genomic DNA was used (0.2 a 1 \ mul) as a template and <i>pfu</i> DNA polymerase (2.5 units) it was used with 10 µl of 10x pfu buffer, 1 µl of each primer (50 pmoles / µl), 200 µMdNTP in a reaction volume total of 100 µl. PCR reactions were carried out in a Programmable thermal cycler using the following conditions: 95 ° C for 30 seconds, 30 cycles of 95 ° C for 30 seconds, 60 ° C for 1 minute and 68 ° C for 2 minutes. One was applied additional extension of 5 minutes at 72 ° C.

p00418PCR amplification of the transferase gene from<i>A. salmonicide</i> was carried out in 2 PCR reactions per separated. PCR reaction 1 was carried out using pairs primers, such as 1USNEW (5 'AGCATATGAAAA AATGGTTTGT TTGTTTATTG GGG 3 '[SEC. ID. nº: 56] and asls950new (5 'GTG ATG GTG GGC GAG GAA CTC GTA CTG 3 '[SEC. ID. nº: 37]). A second reaction was carried out. PCR to incorporate a histidine tag C-terminal using the PCR product of the First reaction and primers: as1USNEW (5 'AGCATATGAAAA AATGGTTTGT TTGTTTATTG GGG 3 '[SEC. ID. nº: 38]) and AHLS1001 (5 ' TTGGATCC GAATTCAT CAATG GTG ATG GTG ATG GTG GGC 3 '[SEC. ID. : 39]). The PCR product of the second reaction was purified and digested with restriction enzymes Nde1 and BamHI. two DNA mug pET vector 12a were also digested with restriction enzymes Nde1 and BamHI and treated with phosphatase. Restriction enzyme treated with pET12α and the PCR product of reaction 2 is purified and ligated using the rapid ligation kit (Roche, Switzerland). The ligation mixture was used to transform TOP10 cells of <i>E. coli</i>. The transformants were placed in plates in LB medium with agar-agar containing 100 µg / ml ampicillin.

p00419T7 activating primer (5 'TAATACGACTCACTATAG 3 '[SEC. ID. nº: 40]) and the T7 terminator primer (5 ' CTAGTTATTGCTCAGCGG 3 '[SEC. ID. nº: 41]) were used to verify the sequences and orientation of the genes of transferase cloned into the pET12α vector. The DNA sequencing using the ABI Prism® sequencing kit BigDye? Terminators Cycle with 500 ng of plasmid DNA as template and 3.2 pmoles of T7 primer primers and terminators

p00420The assembly presented in Figure 35 was used to transform strain BL21 (DE3) pLysS (Novagen) competent bacterial host and resistant transformants a ampicillin were selected and used for analysis of expression.

Expression of recombinant lipid acyltransferase from

Aeromonas salmonicida

p00421The quantification of the activity was determined enzyme for lecithin in cell extracts using the kit of non-esterified fatty acid (NEFA) (Roche, Switzerland).

p00422In Figure 36, BL21 (DE3) pLysS which houses the expression vector pet12-AsalGCAT = pSM was grown in LB + 100 µg / ml ampicillin medium and was incubated with shaking at 37 ° C until an OD 600 is reached = 0.6 to 1.0. Cultures were then induced using IPTG (0.4 mM) and incubation was continued for 3 hours following. Samples were taken at 0 hours, 1, 2 and 3 hours after induction with IPTG. Enzymatic activity was determined using the NEFA and lecithin kit as a substrate.

Crop optimization for the production of more enzymes active

p00423The BL21 (DE3) pLysS that houses the expression vector pet12-AsalGCAT = pSM was cultured in LB + 100 µg / ml ampicillin medium and incubated with shaking at different culture temperatures (37 ° C, 30 ° C and 20 ° C). The state optimal for the production of the active enzyme lipid acyltransferase it was when the cultures were grown at 30 ° C as shown in the Figure 37

Partial purification of recombinant transferase from

Aeromonas salmonicide

p00424The strain BL21 (DE3) pLysS that harbors the expression vector pet12-AsalGCAT = pSM is cultured at 37 ° C and crude cell extracts were prepared by Ultrasound treatment The recombinant enzyme was purified more in raw cell extracts treated with ultrasound using the Qiagen Ni-NTA spin kit. He determined phospholipase activity using the NEFA kit and Lecithin as a substrate. The crude cell extracts of BL21 (DE3) pLysS expressing active transferase is incubated with the substrate lecithin and the reaction mixture was analyzed using thin layer chromatography demonstrating the presence of degradation products (see Figure 38).

Partial purification of recombinant transferase from

Aeromonas salmonicidae

p00425The strain BL21 (DE3) pLysS that harbors the expression vector pet12-AsalGCAT = pSM is cultured at 37 ° C and crude cell extracts were prepared by Ultrasound treatment The recombinant enzyme was purified more in raw cell extracts treated with ultrasound using the Qiagen Ni-NTA spin kit. He determined phospholipase activity using the NEFA kit and Lecithin as a substrate. (see Figure 39).

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Example 2

Cloning and expression of the transferase of

Aeromonas hydrophila

in

E. coli

p00426The <i>Aeromonas hydrophila</i> (ATCC 7965) is acquired at ATCC and grown overnight at 30 ° C in medium Luria-Bertani (LB). The cells were centrifuged and genomic DNA was isolated using the procedures to genomic DNA isolation from the genomic DNA buffer series from Qiagen Ltd. (cat. 19060), protease K (cat. 19131) and RNase A (cat. 19101) were all acquired at Qiagen Ltd. (Boundary court Gatwick Court, West Sussex, RH10 2AX).

p00427Strain BL21 (DE3) pLysS was used (Novagen) bacterial host for enzyme production recombinants of <i>Aeromonas</i>. Cells were used competent BL21 (DE3) pLysS as hosts for transformation with the expression vector pET12α-AhGCAT = pSMa. The transformants that contain the appropriate plasmid were grown at 37 ° C in medium with LB agar-agar containing 100 µg of ampicillin / ml

Construction of the expression vector pET12α-AhGCAT-pSMa

p00428For all gene DNA extensions of transferase from <i>Aeromonas</i>, genomic DNA was used (0.2 a 1 \ mul) as a template and <i>pfu</i> DNA polymerase (2.5 units) it was used with 10 µl of 10x pfu buffer, 1 µl of each primer (50 pmoles / µl), 200 µMdNTP in a reaction volume total of 100 µl. PCR reactions were carried out in a Programmable thermal cycler using the following conditions: 95 ° C for 30 seconds, 30 cycles of 95 ° C for 30 seconds, 60 ° C for 1 minute and 68 ° C for 2 minutes. One was applied additional extension of 5 minutes at 72 ° C.

p00429PCR amplification of the transferase gene from<i>A. hydrophila</i> (ATCC # 7965) was carried out in 2 PCR reactions separately.

p00430PCR reaction 1 was carried out using primer pairs, such as AHUS1 (5 ' GTCATATGAAAAAATGGTT TGTGTGTGTTTATTGGGATTGGTC3 ', SEC. ID. : 42 and aHls950 (5 ' ATGGTGATGGTGGGCGAGGAACTCG TACTG 3 'SEC. ID. nº: 43).

p00431A second PCR reaction was carried out to incorporate a C-terminal histidine tag using the PCR product of the first reaction and the primers:

p00432AUS1 (5 ' GTCATATATGAAAAAATGGTTTGTGTGTTTATTGGGATTGGTC 3 'SEC. ID. nº: 44) and AHLS1001 (5 ' TTGGATCCGAATTCATCAATGGTGATGGTGATGGTGGGC 3 'SEC. ID. nº: 57).

p00433The PCR product of the second reaction is purified and digested with restriction enzymes Nde1 and BamHI. two pET 12a vector DNA was also digested with enzymes of restriction Nde1 and BamHI. 2 Mg of DNA vector pET12? it was also digested with restriction enzymes Nde1 and BamHI and was He treated with phosphatase. The enzyme-treated pET12α restriction and the PCR product of reaction 2 were purified and were ligated using the rapid ligation kit (Roche, Switzerland). The ligation mixture was used to transform TOP10 cells from<i>E. coli</i>. The transformants were plated in the middle LB with agar agar containing 100 µg / ml of ampicillin

p00434T7 activating primer (5 'TAATACGACTCACTATAG 3 ') and T7 terminator primer (5' CTAGTTATTGCT CAGCGG 3 ') were used to verify the sequences and orientation of the transferase genes cloned in the pET12α vector. He performed the DNA sequencing using the ABI sequencing kit Prism® BigDye? Terminators Cycle with 500 ng plasmid DNA as template and 3.2 pmoles of primers primers T7 and terminators

p00435The assembly presented in Figure 40 was used to transform strain BL21 (DE3) pLysS (Novagen) competent bacterial host and resistant transformants a ampicillin were selected and used for analysis of expression.

Transferase expression of

Aeromonas hydrophila

in BL21 (DE3) pLysS

p00436BL21 strain (DE3) pLysS of <i>AND. coli</i> which houses the expression vector pET12? -AhGCAT = pSMa was grown in LB + 100 µg / ml ampicillin medium and was incubated with shaking at 37 ° C until an OD 600 is reached = 0.6 to 1.0. Cultures were then induced using IPTG (0.4 mM) and incubation was continued for 3 hours following. Samples were taken at 0 hours, 1, 2 and 3 hours after induction with IPTG. Enzymatic activity was determined using the NEFA and lecithin kit as a substrate (Figure 41).

Crop optimization for the production of more enzymes active

p00437The BL21 (DE3) pLysS that houses the expression vector pET12? -AhGCAT = pSMa was grown in LB + 100 µg / ml ampicillin medium and incubated with shaking to different culture temperatures (37ºC, 30ºC and 20ºC). The state optimal for the production of the active enzyme GCAT was when the cultures were grown at 30 ° C as shown in Figure 42.

Partial purification of recombinant transferase from

TO. hydrophila

(GCAT)

p00438The strain BL21 (DE3) pLysS that harbors the expression vector pET12? -AhGCAT = pSMa was cultured at 37 ° C and crude cell extracts were prepared by treatment with ultrasound The recombinant enzyme was further purified in the raw cell extracts treated with ultrasound using the Qiagen Ni-NTA spin kit. The phospholipase activity using the NEFA and lecithin kit as substrate (Figure 43).

Example 3

Transferase Expression of

Aeromonas

in

Bacillus subtilis

163

Plasmid Construction

p00439Two expression vectors were used different from <i>Bacillus subtilis</i> (pUB 110 and pBE5) for the heterologous expression of the genes of <i>Aeromonas</i> in<i>Bacillus subtilis</i>. The vector pUB110 contains the activator alpha amylase while the vector pBE has the activator P32 as regulatory zone for the expression of the fused genes of<i>Aeromonas</i>. In pUB110, the first amino acid of genes mature GCAT's <i>Aer omonas</i> merged into the frame with the last amino acids of the xylanase signal peptide sequence of<i>Bacillus subtilis</i> by the restriction sequence Nhe1, which creates 2 additional amino acids in front of proteins mature PBE5 contains the fusion of the cgtase signal sequence in the Nco1 point for the secretion of recombinant proteins in the culture filtering.

p00440PCR reactions were carried out to get the fuse genes from <i>Aeromonas</i> in the framework for signal sequences of vectors pUB 110 and pBE5. They took place PCR using the following primer pairs for the gene from<i>A. hydrophila</i>:

<dl><dt>Reaction 1 of PCR:</dt><dd>usAHnco1 (5 ' ATGCCATGGCCGACAGCCGTCCCGCC3 ', SEC. ID. nº: 46) and 1sAH (5'TTGGATCCGAATTCATCAATGGTGATG3 ', SEQ ID NO: 47)</dd></dl>

<dl><dt>Reaction 2 of PCR:</dt><dd>US-AhnheI (5'TTGCTAGCGCCGACAGCCGTCCCGCC3 ', SEC. ID. No.: 48) and 1sAH (5'TTGGATCCGAATTCATCAATGGTGATG3, SEQ ID NO: 49)</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00441The PCR were purified using the following primer pairs for the gene of <i>A. salmonicide</i>:

<dl><dt>Reaction 3 of PCR:</dt><dd>US-Asnco1 (5'TTGCCATGGCCGACACTCGCCCCGCC3 ', SEQ ID NO: 50) and 1sAH (5'TTGGATCCGAATTCATCAATGGTGATG3 ', SEQ ID NO: 51)</dd></dl>

<dl><dt>Reaction 4 of PCR:</dt><dd>US-ASnhe1 (5'TTGCTAGCGCCGACACTCGCCCCGCC3 ', SEC. ID. No.: 52) and 1sAH (5'TTGGATCCGAATTCATCAATGGTGATG3 ', SEQ ID NO: 53).</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00442All PCR products were cloned in the truncation II by PCR (TOPO vector) and sequenced with primers of complementary sequencing and transcription.

p00443The clones of PCR reactions 1 and 3 are they cut with Nco1 and Bam HI and were used as inserts for the ligation to the vector pBE5 cut with Nco1 / BamH1 / phosphatase. Clones of reactions 2 and 4 by PCR were cut with Nhe1 and Bam H1 and were used as inserts for ligation to the pUB vector that cut with Nhe1 / BamH1 / phosphatase.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Expression of transferase genes from

Aeromonas

in

Bacillus subtilis

and characterization of the activity enzymatic

p00444Acyltransferases of the two species of<i>Aeromonas</i> have been successfully expressed in <i>E. coli</i>(Previous results). Gene fusion assemblies were used pUB110 and pBE5 of <i>Bacillus</i> to transform <i>Bacillus subtilis</i> and the transformants were selected by placing them in Kanamycin plates. Transformants resistant to Kanamycin isolated and grown in 2XYT can expression heterologous of the genes of <i>Aeromonas</i> in <i>Bacillus</i>. The culture filtrates show activity of digalactosildiacylglycerol (DGDG) galactolipase, in addition to present activities of both acyltransferase and phospholipase. The activity for digalactosyldiacylglycerol (DGDG) was measured after 60 minutes incubation of the culture supernatant with the substrate, wheat flour DGDG (form that can be acquire at Sigma) as well as the activity for with lecithin as shown in Figure 44. The <i>Bacillus</i> produced the enzyme overnight (20 to 24 hours) to 48 hours of culture in the medium of culture as a segregated protein. In some cases, the expression of the genes of <i>Aeromonas</i> It has been shown to interfere with cell viability and culture in <i>Bacillus</i> and <i>AND. coli</i>, it is therefore necessary to select carefully expression strains and optimize culture conditions for Secure the expression. For example, several host strains of<i>Bacillus</i> (Bs 163, DB104 and OS 21) were transformed with the expression vectors for crop comparison. B.s163 is transformable with the 2 genes of <i>Aeromonas</i> and can express the active protein DB104 can be transformed with all mounts but it can only express the transferase of <i>TO. salmonicide</i>.

Example 4

Fermentation and purification of lipid acyltransferases from

Aeromonas

produced in

E. coli

Fermentations of

E. coli

Microorganisms

p00445In this study two strains of<i>Escherichia coli</i>, one that contained a lipid acyltransferase from <i>Aeromonas hydrophila</i> (Example 2) and two containing lipid acyltransferases from <i>Aeromonas salmonicida</i>, (Example 1).

p00446The strain of <i>E. coli</i> which contained the gene of<i>A. hydrophila</i> it was named DIDK0124 and the strain of <i>AND. coli</i> that contained the gene of <i>A. salmonicide</i> it was called DIDK0125. The fermentation with DIDK0124 was called HYDRO0303 and the Fermentation with DIDK0125 was called SAL0302. The protein purified from HYDRO025 it was called REF138. The protein purified from HYDRO0303 was called REF No. 135.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Culture medium and culture conditions

LB-agar-agar

p00447Plates with LB agar-agar used to keep the strains contained: 10 g / l of tryptone, 5 g / l of yeast extract, 5 g / l of NaCl, 15 g / l of agar-agar, 100 mg / l ampicillin and 35 mg / l chloramphenicol The agar agar plates were incubated at 30 ° C.

Stirring flask with LB

p00448The LB medium (50 ml per stirred flask) used for the production of inoculum material for crops of Bioreactor contained: 10 g / l of tryptone, 5 g / l of extract yeast, 5 g / l NaCl, 100 mg / l ampicillin and 35 mg / l chloramphenicol Stirring flasks were inoculated on plates of LB agar-agar and incubated at 30 ° C and 200 rpm.

Bioreactor culture

p00449Cultures were carried out in the bioreactor in 6 l bioreactors of own construction filled with 4 l of medium containing: 10 g / l tryptone, 5 g / l extract yeast, 5 g / l of NaCl, 8 g / l of KH2PO4, 0.9 g / l of MgSO 4 • 7H 2 O, 40 g / l glucose monohydrate, 0.4 ml of ADD APT® Foamstop Sin 260 (ADD APT Chemicals AG, Helmond, Netherlands), 10 mg / l of (NH 4) 2 Fe (SO 4) 2 • 6H 2 O, 0.7 mg / l of CuSO4 · 5H2O, 3 mg / l of ZnSO_4 \ cdot7H2O, 3 mg / l of MnSO_4 \ H2O, 10 mg / l EDTA, 0.1 mg / l NiSO4 · 6H2O, 0.1 mg / l CoCl 2, 0.1 mg / l of H 3 BO 4, 0.1 mg / l of KI, 0.1 mg / l of Na 2 MoO 4 • 2H 2 O, 1 g / l ampicillin and 35 mg / l Chloramphenicol

p00450The bioreactors were operated with a amount of LB culture that ensures the end of the crop after approximately 20 hours of cultivation (calculated from the rate of maximum specific growth of 0.6 h -1, the OD 600 of the shaker flask LB and the final DO_ {600} in the bioreactor of approximately 20).

p00451SAL0302 was inoculated with 10 ml of LB culture and inoculated HYDRO0303 with 4 ml of LB culture.

p00452The bioreactors were operated under the conditions following: temperature 30ºC, stirring 800 to 1,000 rpm (depending of the experiment), aeration 5 l / min., pH 6.9, reference pH 8.75% (w / v) NH 3 -water and H 2 SO 4 2 M. La induction was achieved by the addition of isopropyl β-D-thiogalactoside up to one final concentration of 0.6 mM, when 0.4 moles were produced (HYDRO0303) and 0.7 moles of CO2 respectively.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Harvest

p00453The following procedure was used for biomass collection and homogenization:

<dl><dt>1)</dt><dd>The fermentation broth from The fermentations were centrifuged at 5,000 x g and 4 ° C for 10 minutes, and the supernatant was discharged. The biomass was stored at -20ºC until use. The biomass was thawed and returned to Suspend in 500 ml of 20 mM NaH2PO4, pH 7.4, 500 mM NaCl, 10 mM imidazole and complete protease inhibitor (exempt from EDTA) (Roche, Germany).</dd></dl>

<dl><dt>2)</dt><dd>The suspended biomass was homogenized at 2 kbar and 4 ° C in a cellular crusher from Constant Systems Ltd. (Warwick, UK).</dd></dl>

<dl><dt>3)</dt><dd>Cellular debris was removed by centrifugation at 10,000 x g and 4 ° C for 30 minutes followed of supernatant collection.</dd></dl>

<dl><dt>4)</dt><dd>The supernatant was further clarified by centrifugation at 13,700 x g and 4 ° C for 60 minutes, followed by collection of the supernatant.</dd></dl>

<dl><dt>5)</dt><dd>The supernatant was filtered through Vacu filters 0.2 µm cap (Pall Life Sciences, UK) and the filtrate was collected for immediate chromatographic purification.</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Chromatographic purification of transferases

p00454A column (2.5 x 10 cm) was filled with 50 ml of Chelating Sepharose ff. and it was loaded with sulfate nickel (according to the method described by the manufacturer, Amersham Biosciences). The column was equilibrated with 200 ml of 20 mM NaH 2 PO 4, pH 7.4, 500 mM NaCl, 10 mM imidazole. He applied 400 ml of the crude product to the column at a flow rate of 5 ml / min The column was then washed with NaH2PO4 mM, pH 7.4, 500 mM NaCl, 10 mM imidazole until UV 280 reached the reference line. The GCAT was eluted then conn 40 ml of 20 mM NaH 2 PO 4, pH 7.4, 500 mM NaCl and 500 imidazole mM.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Example 5

Fermentation and purification of lipid acyltransferases from

Aeromonas

produced in

Bacillus subtilis

Fermentations

p00455BAC0318-19, BAC0323-24.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Microorganisms

p00456The microorganisms used in this study originate from the transformation of a host strain from <i>Bacillus subtilis</i>, No. 163 with a plasmid containing the gene that encodes the transferase of <i>Aeromonas salmonicida</i>inserted into the vector pUB110OIS. Gene expression is controlled by an alpha-amylase activator, and the Transferase secretion is mediated by the signal sequence of silanasa of <i>B. subtilis</i> (Example 3). The strains are called DIDK0138 (fermentation BAC0318-19) and DIDK0153 (fermentation BAC0323-24).

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Culture medium and culture conditions

Preculture medium

p00457They were added to a flask with stirring (500 ml of total volume, with partitions) 100 ml of a medium containing:

<dl><dt>NaCl</dt><dd>5 g / l</dd></dl>

<dl><dt>K 2 HPO 4</dt><dd>10 g / l</dd></dl>

<dl><dt>Soybean meal</dt><dd>twenty g / l</dd></dl>

<dl><dt>Yeast extract, BioSpringer 106 </dt><dd>twenty g / l</dd></dl>

<dl><dt>Antifoam, SIN260</dt><dd>5 ml / l</dd></dl>

p00458The pH was adjusted to 7.0 before sterilization. in autoclave

p00459After autoclaving it is They added 6 ml of 50% Nutriose (w / w) per flask. Was added Kanamycin at a concentration of 50 mg / l after autoclave sterilization.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Inoculation

p00460A flask was inoculated in preculture shaking with frozen culture directly from a stock solution in 25% glycerol (w / v). The shake flask was incubated at 33 ° C and 175 rpm for approximately 16 hours, thus using 50 ml to inoculate the fermenter.

Fermentations

p00461The fermentations were carried out in 6 l in Fermenters of own construction.

p00462The medium of the lot (3 l) contained:

<dl><dt>Saturated Solution with corn (50% deadweight)</dt><dd>40 g / l</dd></dl>

<dl><dt>Yeast extract BioSpringer 153 (50% deadweight)</dt><dd>10 g / l</dd></dl>

<dl><dt>NaCl</dt><dd>5 g / l</dd></dl>

<dl><dt>CaCl2, 2H 2 O</dt><dd>0.25 g / l</dd></dl>

<dl><dt>Mn (NO 3) 2, H2O</dt><dd>0.2 g / l</dd></dl>

<dl><dt>Defoamer SIN260</dt><dd>1 m / l</dd></dl>

<dl><dt>Kanamycin (sterilized in filter for the fermenter after sterilization in autoclave)</dt><dd>\\ [2.1mm] {} \ hskip0.9cm 50 mg / l</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00463The food contained:

<dl><dt>Glucose monohydrate</dt><dd>540 g / kg</dd></dl>

<dl><dt>MgSO 4 • 7H 2 O</dt><dd>4.8 g / kg</dd></dl>

<dl><dt>Defoamer SIN260</dt><dd>4 ml / kg</dd></dl>

<dl><dt>Yeast Estraco, Bio Springer 153 (50% deadweight) (autoclaved by separated)</dt><dd>\\ [2.1mm] {} \ hskip0.9cm 150 g / kg</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00464The fermentation feed BAC0318 and BAC0323 was started based on the accumulated CO2, according to the following equations:

p00465Feed rate [g / h] = 0, AcCO_ {2} &lt;0.15

p00466Feed rate [g / h] = 2.85 + t \ 1.54, AcCO_2 \ 0.15 and t &lt;12

p00467Feed rate [g / h] = 21.3, t> 12

t: time (hours) from the moment in which the accumulated CO2 (AcCO2) reached 0.15 moles

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00468The fermentation feed BAC0319 and BAC0324 was started based on the accumulated CO2, according to the following equations:

p00469Feed rate [g / h] = 0, AcCO_ {2} &lt;0.15

p00470Feed rate [g / h] = 2.0 + t? 1.08, AcCO_2? 0.15 and t &lt;12

p00471Feed rate [g / h] = 1.5, t> 12

t: time (hours) from the moment in which the accumulated CO2 (AcCO2) reached 0.15 moles

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00472The pH was controlled at 7.0 by adding 12.5% ​​(w / v) of NH3-water or 2M phosphoric acid

p00473The aeration was 3 l / min corresponding to 1 vvm

p00474The temperature was 33 ° C.

p00475The fermenter was equipped with two stirrers of 8 cm Ø Rushton propeller arranged at a distance of 10 cm.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Harvest

p00476The biomass was removed by centrifugation at 16,000 x g for 10 minutes at room temperature. He supernatant was filter sterilized and the filtrate was used to Purification and application tests.

Example 6

Enzymatic removal of DAGs in catalyzed palm oil by a lipid acyltransferase of

Aeromonas salmonicidae

Summary

p00477Glycerolysis experiments were initiated enzymatic by adding the solution of glycerol / transferase to the reactor containing palm oil and glycerol / water in varying concentrations. All reactions are performed at 43 ° C, using magnetic stirring for 24 hours. After the reaction, HPTLC samples were analyzed and in Some experiments confirmed the result by GC analysis. The tests performed showed that there was a good correlation between the concentration in water and the concentrations of the DAG and MAG respectively: lower water concentrations determined gave the highest concentration of MAG and the concentration lower DAG.

p00478Based on the evidence, it can be concluded that it was possible to reduce the amount of DAG in palm oil by a transferase catalyzed reaction in which the enzyme used DAG as donor molecules and glycerol as a molecule receptor, in a glycerolysis reaction in which they were synthesized monoglycerides This contrasted with the glycerolysis reaction. with lipases that hydrolyze conventional triglyceride in which the amount of DAG increases.

p00479In addition, it can be concluded that the concentration in water produces a significant impact on performance synthesized monoglycerides and the amount of DAG. The Next correlation: low water concentration (&lt;1%) and 5% of Glycerol gives increased MAG yield and concentration decreased DAG. The results obtained also demonstrate that mainly the 1,2 isomer of the diglyceride tends to be reduced.

p00480It is known that diglycerides, especially 1,2 isomers retard the crystallization of fats. East effect produces the subsequent crystallization of fatty products such as margarine and solid fats, which favors the formation of large crystals (sandy). In certain fat mixtures noted that diglycerides improve the stability of β crystals. A reduction but not a complete elimination of the diglycerides in palm oil would result from consequently preferred. In this way it can be concluded that a diglyceride reduction will produce better oil quality and more uniform; fact that should not be underestimated.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Introduction

p00481Problems concerning diglycerides depend to some extent on the type of product, for example if it is in the form of margarine and solid fat. Therefore, depending on the product the presence of diglycerides will have effects both Negative as positive. For the production of margarine, you can Only use the fatty product of crystalline structure required in order to obtain consistency and plasticity appropriate. The crystalline form? Is the most required, presenting small crystals and a large capacity for Keep the liquid fraction. The most stable crystalline form (form β) is undesirable, since having large crystals It produces the grain structure of margarine. According to Hernquist and Anjou (1993) and Wahnelt <i>et al</i>. (1991) the presence of diglycerides in fat retards the transition of crystal? to β. But since diglycerides slow the transition of β 'to β, also slow the transition of the form α to the form β '(Walnet <i>et al</i>., 1991). For this reason can be defined that the presence of diglycerides retards The total crystallization process. Slow crystallization produces A crucial impact on the application of margarine. The effect of retard crystallization in margarine mixtures that contain a high part of palm oil is that after conventional treatment the product may be something soft, which causes difficulties in packaging and crystallization back can lead to a firmer texture than desired (Berger, 1990). Despite the advantages and disadvantages, it can be important to find a correct balance between elimination reduced and total diglycerides.

p00482It has been surprisingly discovered that it is possible to reduce the amount of diglyceride in palm oil by enzymatic glycerolysis of palm oil using a lipid acyltransferase, for example GDSx lipid acyltransferase from <i>Aeromonas salmonicida</i>. Without pretending to stick to the theory, In this process the enzyme is added to palm oil along with a small amount of glycerol and the enzyme catalyzes the reaction following:

<figref>16</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00483After the reaction the excess glycerol can separate, if deemed necessary, easily from the mixture of Reaction by centrifugation or other procedures.

p00484The advantage of this process is that the amount of diglyceride (preferably 1,2 diglyceride) is reduced by a glycerolysis reaction catalyzed by an enzyme that is specific for diglyceride without using triglyceride as donor for the transferase reaction.

p00485The monoglycerides reaction products do not have to be removed from the reaction mixture, but can be used advantageously as an effective emulsifier for production of food products such as margarine and solid fats. The procedure thus solves two problems. First of all the amount of diglyceride and 1.2 is preferably removed diglyceride, which produces a negative impact on the properties Crystallization of triglycerides. Second the monoglyceride reaction product can be used as a effective emulsifier in the production of food products such as Margarine and solid fats.

p00486In one embodiment, it is preferred eliminate the monoglycerides produced (if they exist) by reaction with transferase.

p00487Properly, if the transferase reaction is has carried out in the crude palm oil, the monoglyceride and / or glycerol and / or water debris (if any) can be removed through a deodorization process during the refining process of edible oil.

p00488Another very interesting advantage of using of the liquid acyltransferase is that this enzyme is less dependent on the water content in the reaction mixture and due because this enzyme is a transferase, low activity occurs hydrolytic or none, which means that the amount of acids Free fat does not increase significantly.

p00489The well known that the water content in the glycerolysis reactions is very important when enzymes Lipolytics such as lipases are used in this process (Kristensen, 2004). Even small amounts of water, which are necessary for most lipolytic reactions will produce the formation of a significant amount of free fatty acids. This problem can be solved using lipid acyltransferase. in the glycerolysis reaction.

p00490Another aspect is that the lipases known in the technique to catalyze the glycerolysis reaction, use mainly triglyceride as a donor during the formation of diglyceride instead of reducing the amount of diglyceride

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

materials

<dl><dt>Oil of palm:</dt><dd>Palmotex, Aarhus United, Denmark</dd></dl>

<dl><dt>Glycerol:</dt><dd>JT Baker, (7044)</dd></dl>

<dl><dt>DIMODAN® P:</dt><dd>Danisco A / S, Denmark</dd></dl>

<dl><dt>Enzyme:</dt><dd>GCAT lipid acyltransferase from <i>Aeromonas salmonicide</i></dd></dl>

p00491expressed in <i>B. subtilis</i> and fermented to laboratory scale (Transferase No. 196).

Procedures

Lyophilization of the enzyme

p00492Enzymes were desalted (desalting columns PD-10, Amersham Biosciences) before the lyophilization Desalted enzymes were mixed with glycerol (enzyme ratio: glycerol 3.5: 1). The sample was lyophilized and added 10% water. The sample contained approximately 20 U (phospholipase units) per gram.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Determination of phospholipase activity (test of phospholipase activity):

Substratum

p0049395% of L-? Were dissolved 0.6% plant phosphatidylcholine (Avanti No. 441601), 0.4% of Triton-X 100 (Sigma X-100) and 5 mM CaCl 2 in 0.05 M HEPES buffer pH 7.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Analytical procedure

p00494400 µl of substrate was added to a tube 1.5 ml Eppendorf and placed in an Eppendorf thermomixer a 37 ° C for 5 minutes. At time t = 0 min, 50 µl was added of enzymatic solution. A blank with water was also analyzed in enzyme place. The sample was mixed at 10 * 100 rpm in a Eppendorf thermomixer at 37 ° C for 10 minutes. In the time t = 10 min the Eppendorf tube was placed in another thermomixer at 99 ° C for 10 minutes to interrupt the reaction.

p00495Free fatty acid in the samples was analyzed using the NEFA C kit from WAKO GmbH.

p00496Enzymatic activity was calculated PLU-7 at pH 7 as a fatty acid in micromoles produced per minute under test conditions

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Enzymatic reaction

p00497Palm oil was reacted with the glycerol-enzyme solution according to the following recipe in Tables 1 and 2

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

TABLE 1

Experiment I

<figref>17</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

TABLE 2

Experiment II

<figref>18</figref>

<pre listing-type="other">\ newpage</pre>

p00498Palm oil was weighed in a Wheaton glass 20 ml and glycerol / enzyme and optional water were added. The mixture is placed in the heating block (heating block Multitherm HP 15 Stheating heated with differential stirring (15 wells) controlled by a Thermomodul 40 ST thermostat VARIOMAG) and was reacted under the following conditions:

<dl><dt>Temperature of reaction:</dt><dd>43 ° C</dd></dl>

<dl><dt>Agitation magnetic:</dt><dd>650 rpm</dd></dl>

<dl><dt>Time of reaction:</dt><dd>twenty hours</dd></dl>

p00499The enzyme was inactivated in the reaction mixture at 97.5 ° C in 10 min. After the reaction the sample was homogenized (Ultra Turrax) for 20 s. and a homogeneous sample was taken to additional analyzes

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

HPTLC

<dl><dt /><dd>Applicator: LINOMAT 5 applicator, CAMAG</dd></dl>

<dl><dt /><dd>HPTLC plate: 10 x 10 cm (Merck No. 1.05633)</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00500The plate was activated before using drying in an oven at 180 ° C for 20 to 30 minutes.

<dl><dt /><dd>Application: 2.0 µl of a 2.0% solution of reacted palm oil dissolved in chloroform: methanol (2: 1) was applied to the HPTLC plate using the LINOMAT 5 applicator.</dd></dl>

<dl><dt /><dd>Series buffer: P-ether: MTBE: acetic acid (50: 50: 1)</dd></dl>

<dl><dt /><dd>Time of Application / elution: 8 minutes.</dd></dl>

<dl><dt /><dd>Fluid Revealed: 6% Cupriacetate in 16% H 3 PO 4</dd></dl>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00501After elution the plate was dried in a oven at 180 ° C for 10 minutes, cooled and immersed in the developing fluid and then dried more in 20 minutes at 180 ° C The plate was evaluated visually and scanned (ScanWizard 5) directly.

p00502In Experiment II the components are quantified by Adobe photoshop 6.0 and the amount of MAG and DAG is calculated from the solution calibration curves DAG and MAG pattern (see Figures 49 and 50).

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Gas chromatography

p00503Perkin Elmer 8420 capillary gas chromatograph provided with a 12.5 m \ WCOT fused silica column 0.25 mm ID x 0.1 \ mum 5% phenyl methyl silicone (CP Sil 8 Crompack CB).

<dl><dt /><dd>Carrier: helium.</dd></dl>

<dl><dt /><dd>Injection: 1.5 \ mul with unfolding.</dd></dl>

<dl><dt /><dd>Detector: FID, 385 ° C.</dd></dl>

p00504<pre listing-type="other">\ hskip0.7cm</pre><figref>504</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00505Sample preparation: 50 mg dissolved of lipid in 12 ml of heptane: pyridine (2: 1) containing 2 mg / ml of the internal heptadecane pattern. 500 µl of the shows a translucent vial. 100 µL of MSTFA was added (N-methyl-N-trimethylsilyl-trifluoroacetamide) and the reaction was incubated for 15 minutes at 60 ° C.

p00506Calculation: The factors of answer to mono-di-triglycerides, fatty acids free from the reference mixtures of these components. Based on these response factors, lipids were calculated In the samples.

Results

Experiment I

p00507The objective of this experiment was to examine the impact of a diglyceride: glycerol acyltransferase from<i>Aeromonas salmonicida</i> in the DAG in palm oil by glycerolysis reaction. It is known that a GCAT can transfer fatty acid from lecithin to cholesterol during cholesterol and lysolecitin ester formation. In this study the authors investigated the possibility of the enzyme of use DAG as a donor and glycerol as a recipient in order to reduce the amount of DAG in palm oil and produce monoglyceride

p00508It is well known in the literature to use Enzymes such as lipases to catalyze glycerolysis reactions. In these reactions triglycerides are the main substrate and mono and diglycerides are the products of the reaction. In these procedures the amount of diglycerides increases significantly and the amount of diglycerides produced is in the level or height of the amount of monoglyceride produced (Kristensen, 2004).

p00509Four compositions of the different samples and were compared with an oil reference of palm mixed with 5% glycerol but without enzyme and treated with the Same way as the samples. Figure 47 presents the result of the HPTLC analysis of the sample in table 1.

p00510The results obtained from the HPTLC analysis show that the amount of DAG varies according to reaction conditions (referring to the relationship between GL: H2O). The same for all reactions was that the isomers 1.3 diglyceride were in greater proportion than isomers 1,2- (2,3-) diglyceride. This observation can be confirmed by the theory, which says that the ratio of 1,3 isomer to 1,2- isomer (2,3-) in crude palm oil is 7: 3 (Siew and Ng, 1999; Timms, 2004). In addition, analyzing the result, the HPTLC plate demonstrates that transferase successfully reduces the amount of DAG. The reduction can be correlated to some extent with the amount of MONKEY synthesized

p00511If the 1,2 isomer is compared with the 1,3 isomer the DAGs in figure 1 it seems that the 1.2 DAGs are reduced mainly by the enzyme catalyzed reaction. This is from according to the fact that the transferase has a specified preferred by fatty acids in the sn2 position.

p00512In the experiments performed they were used different concentrations of water in the range between 0.5 and 5.5% From the result it seems that the water concentration it has a significant impact on the synthesized amount of MONKEY combined with the reduced amount of DAG. In this case the transferase No. 196 demonstrates that if the system contains low water concentration an increased MONO concentration is formed and the corresponding decreased amount of DAG is observed. He experiment also investigates whether the amount of glycerol presents an effect on the balance in the system (Band 5: 10% of GL: 1% of H2O). Transferase No. 196 demonstrates that a concentration higher glycerol (which also means double dose of activity enzymatic) the dose does not produce a higher concentration of MONO.

p00513Preferably the present invention is realized in a medium with little water, that is less than about 1%.

p00514One of the advantages of working with transferases instead of lipases, the synthesis of the MONO dose is not correlates with excessive increase in FFA concentration. This fact is confirmed in the present experiment. Figure 1 shows that none of the reactions have a clear band of FFA (The FFA band was expected to be visible between 1.3 DAG and TAG)

p00515From this experiment it can be summarized that the optimal concentration of glycerol and water for transferase no. 196 is as follows:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00516Transferase No. 196: 5% GL: 0.5% of H2O.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00517The sample procedure in the analysis HPTLC did not include the determination of specific weight, due to this was not possible to calculate the concentration of the different components in reaction mixtures. Because of this the Observation is based solely on visual evaluation.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

GC results

p00518Based on the results of HPTLC, Selected sample # 2 for GC analysis. To find out if The visual evaluation of the HPTLC plates could be confirmed by quantitative analysis of DAG. Before the analysis the glycerol in the sample by centrifugation and only the lipid phase to GC analysis. GC results are presented in Table 3 below.

TABLE 3

GC result in the reaction selected in the Experiment I

<figref>19</figref>

p00519Analyzing the result of the GC study, found that the selected sample differs from the reference in a higher MONO content and lower DAG performance. This Observation supports the results obtained in the HPTLC analysis.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Conclusion: Experiment I

p00520Referring to the content of monoglycerides and diglycerides in the product of glycerolysis, the HPTLC analysis results indicated that there is a correlation between the concentration of water and the amounts of MONO and DAG, respectively: the lowest concentration of water, less than DAG and greater than MONKEY.

p00521GC analysis confirmed the degree of DAG reduction. In this experiment the reduced amount of DAG counts for 7.1% of the total amount of diglycerides of palm oil (Table 4).

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

TABLE 4

Degree of DAG reduction

<figref>20</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Experiment II

p00522The objective of this part was to continue the optimization of DAG reduction in palm oil and analyze Transferase catalyzed glycerolysis using transferase no. 196. The purpose is mainly to achieve a reaction well balanced in which the amount of DAG has been reduced in the time with increase of MONO concentration.

p00523In this part of the experimental work, analyzed six different sample compositions and compared with a reference of palm oil mixed with 5% glycerol (Table 2). The reference was exposed to the same heating profile that enzymatic reactions, which makes it possible to observe and Determine the degree of thermal degradation during reduction. The Figure 48 presents the result of the HPTLC analysis.

p00524From the results in Figure 48 It seems that especially the amount of MAG is variable. The analysis HPTLC demonstrates that in samples containing 5% glycerol (bands: 1 to 3) there is a continuous relationship between the concentration water and MAG performance: the decrease in the amount of water in the reaction mixture is followed by the increase in yield of MAG. The same trend is observed in the reactions that they contain 10% glycerol (band: 5 to 7).

p00525Depending on the amount of diglycerides, it was not possible to differentiate samples based solely on evaluation visual of the HPTLC board. Therefore, to be able to distinguish between samples, components were quantified analyzing the standard materials with a known composition of MAG and DAG. The HPTLC plates were scanned and manipulated by Adobe Photoshop 6.0 and more were calculated using the help of a Built-in macro calculation (Microsoft Excel 2000). The analysis Quantitative components analyzed by HTPLC are presented in Table 5 below.

TABLE 5

<figref>21</figref>

p00526The research supports visual evaluation and provides a fine image of the variable level of diglycerides. In The results show that the greatest degree of reduction in amount of DAG was achieved in sample # 1 (5% of GL: 1.5% of H2O). It is also noted that this sample also contains the greater amount of MAG.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Conclusion: Experiment II

p00527Experiment II confirmed the observations of that a GCAT lipid acyltransferase of <i>Aeromonas salmonicida</i>could reduce the amount of diglycerides in palm oil. For the experiments with 5% glycerol, a correlation was found between the concentration of water in the reaction mixture and the amounts of MAG and DAG, respectively: the lower concentration of water, the lower of DAG and greater of MAG.

p00528HPTLC quantified the degree of reduction (see Table 5). From the results it seems that the reduced amount of DAG counts for 13.29% of the total amount of diglycerides in palm oil and the amount of synthesized MONO increased from 0.01% (ref.) to 0.38% (sample # 1).

p00529From this experiment it can be summarized that the optimal concentration of glycerol and water for transferase no. 196 is as follows:

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00530Transferase No. 196: 5% GL: 1.5% of H2O.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00531Comparing these observations with the result obtained in Experiment I, it is confirmed that a adequate continuity in the results. The optimal concentration of water is supposedly between 0 and 1% of H2O depending on the enzymatic activity and the content of glycerol.

p00532Based on the two experiments performed, it can draw the conclusion that it is possible to reduce the amount of DAGs in palm oil by a catalyzed reaction by transferase, in which the enzyme uses DAG as molecules donors and glycerol as a receptor molecule, in a reaction of glycerolysis in which monoglycerides are synthesized. This is in marked contrast with the glycerolysis reaction with lipases that they hydrolyze conventional triglycerides in which the amount of DAG increases due to lipase partial hydrolysis activity It hydrolyzes triglycerides.

p00533Based on the fact that the structure of diglycerides is a mixture of 1,2 and 1,3 isomers and that the Transferase is specific for sn2 position, even a small reduction in the amount of diglyceride will have a physical impact huge on palm oil based products.

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

Example 7

Immobilization of diacylglycerol: glycerol transferase (lipid acyltransferase) from

Aeromonas salmonicida

p00534Diacylglycerol: glycerol transferase se immobilizes on Celite by precipitation in acetone. 10 ml of Enzymatic solution in 20 mM TEA buffer pH 7 is slowly stirred with 0.1 gram of Celite 535 (from Fluka) for 2 hours at temperature ambient.

p0053550 ml of cold acetone are added during continuous agitation

p00536The precipitate is isolated by centrifugation at 5,000 g for 1 minute.

p00537The precipitate is washed twice with 20 ml of cold acetone

p00538Celite is tested at room temperature for about 1 hour.

p00539The immobilized transferase is analyzed in oil palm (see table below):

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

TABLE

<figref>22</figref>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

p00540Palm oil and glycerol are heated to 42 ° C Immobilized transferase was added.

p00541The transferase reaction continued at 42 ° C during gentle stirring with a magnetic stirrer. They were taken samples for analysis after ½, 1, 3, 6 and 24 hours and are analyzed by HPTLC. The reaction was interrupted after 24 hours of reaction time and the immobilized enzyme was filtered.

p00542HPTLC analysis clearly presents the effect of diacylglycerol: immobilized glycerol from <i>A. salmonicide</i>by forming monoglyceride and reducing diglyceride in palm oil

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

References

p00543Amano Enzyme Inc. (<u>2004</u>). http://www.amano-enzyme.co.jp/english/productuse/oil_fat.html. Data: 06.01.04

p00544<b>Fødevareministeriet</b> (<u>2003</u>). Bekendtgørelse om indhold af transfedtsyrer i olier og fedtstoffer. Bekendtgørelse nº 160 af 11/03/2003

p00545Directive 2000/36 / EC. http://europa.eu.int/scadplus/leg/en/lvb/121122b.htm. Fact: 16.06.04

p00546<b>Karlshamns</b>, (<u>2004</u>). Press information. http://www.karlshamns.com/investor/press information-show.asp? ID = 319. Fact: 16.06.04

p00547<b>Berger</b>, KG (<u>1990</u>). Recent developments in palm oil. In Oleagineux 45: 437-443

p00548<b>Drozdowski</b>, B. (<u>1994</u>). general characteristics of eatable fats. WNT, Warszawa, Poland, p. 240-243 (in polish)

p00549<b>Hernquist</b>, L. &amp; <b>Anjou</b>K. (<u>1983</u>). Diglycerides as a stabilizer of the \ beta'crystal Form in Margarines and Fats. In Fette Seifen Anstrichmittel. 2: 64-66

p00550<b>Hernquist</b>, L. <b>Herslof</b>B.<b>Larsson</b>, K. &amp; <b>Podlaha</b>, OR (<u>1981</u>). Polymorphism of rapeseed oil with low content of erucic acid and possibilities to stabilize the \ beta'crystal form in fats. In Journal of Science and Food Agriculture. 32: 1197-1202

p00551<b>Jacobsberg</b>, B. &amp; <b>Oh</b>, CH (<u>1976</u>). Studies in Palm Oil Crystallisation. In Journal of the American Oil Chemist Society. 53: 609-616

p00552<b>Kristensen</b>, ACJ (<u>2004</u>). Preparation of margarine and spreads by enzyme-generated emulsifiers. Master thesis, The Royal Veterinary and Agricultural University, Frederiksberg, Copenhagen

p00553<b>Mcneill</b>, GP &amp; <b>Berger</b>, RG (<u>1993</u>). Enzymatic glycerolysis of palm oil fractions and palm oil based model mixture: Relationship between fatty acid composition and monoglyceride yield. In Food Biotechnology 7: 75-87

p00554<b>Okiy</b>, GIVES (<u>1977</u>). Partial glycerides and palm oil Crystallisation. In Journal of Science and Food Agriculture 28: 955

p00555<b>Okiy</b>, GIVES (<u>1978</u>). Interaction of triglycerides and diglycerides of palm oil. In Oleagineux. 33: 625-628

p00556<b>Okiy</b>, GIVES, <b>Wright</b>, WB,<b>Berger</b>, KG &amp; <b>Morton</b>, ID (<u>1978</u>). The physical properties of modified palm oil. In Journal of Science of Food and Agriculture 29: 625-628

p00557<b>Walnett</b>, SV, <b>Meusel</b>, D. &amp;<b>Tülsner</b>, M. (<u>1991</u>). Zur Kenntnis Des Diglyceride influsses auf das kristallisationsverhalten von Fetten. In fat Science Technology 4: 117-121

p00558<b>Siew</b>, NL (<u>2001</u>). Understanding the Interactions of Diacylglycerols with oil for better Product performance Article presented at the International Congress of Palm oil PIPOC 2001 - Conference on Technology and Technology. August 20-23, 2001, Kuala Lumpur, Malaysia

p00559<b>Siew</b>, NL &amp; Ng, WL (<u>2000</u>). Differential scanning thermograms of palm oil triglycerides in the presence of diglycerides. In Journal of Oil Palm Research 12: 1-7

p00560<b>Siew</b>, NL &amp; <b>Ng</b>, WL (<u>1999</u>). Influence of diglycerides on crystalisation of palm oil In Journal of Science of Food and Agriculture. 79: 722-726

p00561<b>Sonntag</b>, NOV (<u>1982a</u>). Fat splitting, esterification and interesterification. Bailey's Industrial Oils and Fat products, Vol. 2, 4th edn. John Wiley and Sons, New York pp. 97-173

p00562<b>Sonntag</b>, NOV (<u>1982b</u>). Glycerolysis of Fats and methyl esters - status, review and criticize. In Journal of American Oil Chemist Society. 59: 795A-802A

p00563<b>Timms</b>, R. (<u>2004</u>). Oral presentation (Lecture: Trends &amp; delvlopment) at Danisco A / S, Brabrand, Denmark

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

<pre listing-type="other">\ vskip1.000000 \ baselineskip</pre>

(Form goes to page following)

<figref>23</figref>

<figref>24</figref>

<figref>25</figref>

<figref>26</figref>

<figref>27</figref>

<figref>28</figref>

<pre listing-type="other">\ global \ parskip0.000000 \ baselineskip</pre>

&lt;110&gt; Danisco A/S

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;120&gt; Procedimiento

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;130&gt; P021904WO

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;140&gt; PCT/IB2004/004374

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;141&gt; 2004-12-23

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;150&gt; GB0330016.7

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;151&gt; 2003-12-24

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;150&gt; PCT/IB04/00655

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;151&gt; 2004-01-15

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;150&gt; GB0416023.0

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;151&gt; 2004-07-16

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;150&gt; US10/898775

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;151&gt; 2004-07-26

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;160&gt; 70

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;170&gt; PatentIn version 3.3

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 1

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 361

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; pfam00567 secuencia de consenso

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 1

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>29</figref>

<figref>30</figref>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 2

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 335

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Aeromonas hydrophila</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 2

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>31</figref>

<figref>32</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 3

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 336

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Aeromonas salmonicida</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 3

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>33</figref>

<figref>34</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 4

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 295

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces coelicolor</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 4

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>35</figref>

<figref>36</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 5

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 295

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces coelicolor</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 5

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>37</figref>

<figref>38</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 6

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 238

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Saccharomyces cerevisiae</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 6

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>39</figref>

<figref>40</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 7

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 1005

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Aeromonas hydrophila</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 7

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>41</figref>

<figref>42</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 8

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 1011

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Aeromonas salmonicida</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 8

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>43</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 9

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 888

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces coelicolor</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 9

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>44</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 10

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 888

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces coelicolor</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 10

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>46</figref>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 11

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 717

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Saccharomyces cerevisiae</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 11

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>48</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 12

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 347

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Ralstonia</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 12

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>49</figref>

<figref>50</figref>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 13

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 1044

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Ralstonia</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 13

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>52</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 14

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 0

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Desconocido

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Sin secuencia

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 14

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 15

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 0

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Desconocido

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Sin secuencia

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 15

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 16

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 0

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Desconocido

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Sin secuencia

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 16

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 17

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 0

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Desconocido

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Sin secuencia

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 17

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 18

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 0

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Desconocido

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Sin secuencia

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 18

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 19

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 0

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Desconocido

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Sin secuencia

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 19

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 20

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 261

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; proteína hipotética conservada de <i>Streptomyces coelicolor</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 20

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>53</figref>

<figref>54</figref>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 21

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 786

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; <i>Streptomyces coelicolor</i> hipotética conservada

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 21

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>55</figref>

<figref>56</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 22

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 260

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; <i>Streptomyces coelicolor</i> hipotética conservada

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 22

<figref>57</figref>

<figref>58</figref>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 23

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 783

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; <i>Streptomyces coelicolor</i> hipotética conservada

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 23

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>59</figref>

<figref>60</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 24

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 454

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Proteína segregada posible de <i>Streptomyces coelicolor</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 24

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>61</figref>

<figref>62</figref>

<figref>63</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 25

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 1365

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Proteína segregada posible de <i>Streptomyces coelicolor</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 25

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>64</figref>

<figref>65</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 26

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 340

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Proteína segregada posible de <i>Streptomyces coelicolor</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 26

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>66</figref>

<figref>67</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 27

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 1023

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; <i>Streptomyces coelicolor</i> posible

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 27

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>68</figref>

<figref>69</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 28

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 305

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Lipoproteína posible de <i>Streptomyces coelicolor</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 28

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>70</figref>

<figref>71</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 29

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 918

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Lipoproteína posible de <i>Streptomyces coelicolor</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 29

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>72</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 30

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 268

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces rimosus</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 30

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>73</figref>

<figref>74</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 31

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 1068

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces rimosus</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 31

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>75</figref>

<figref>76</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 32

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 335

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Aeromonas hydrophila</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 32

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>77</figref>

<figref>78</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 33

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 2016

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Aeromonas hydrophila</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 33

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>80</figref>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 34

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 336

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Aeromonas salmonicida</i> subsp. <i>Salmonicida</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 34

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>82</figref>

<figref>83</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 35

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 2022

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Aeromonas salmonicida</i> sibsp. <i>Salmonicida</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 35

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>84</figref>

<figref>85</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 36

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 347

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; Constructo de fusión

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 36

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>86</figref>

<figref>87</figref>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 37

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 27

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador asls950new

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 37

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>gtgatggtgg gcgaggaact cgtactg <pre listing-type="other">\hfill</pre> 27

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 38

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 35

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador 1 USNEW

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 38

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>agcatatgaa aaaatggttt gtttgtttat tgggg <pre listing-type="other">\hfill</pre> 35

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 39

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 39

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador AHLS1001

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 39

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>ttggatccga attcatcaat ggtgatggtg atggtgggc <pre listing-type="other">\hfill</pre> 39

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 40

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 18

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; promotor T7

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 40

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>taatacgact cactatag <pre listing-type="other">\hfill</pre> 18

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 41

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 18

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; T7 cebador terminador

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 41

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>ctagttattg ctcagcgg <pre listing-type="other">\hfill</pre> 18

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 42

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 41

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador AHUS1

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 42

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>gtcatatgaa aaaatggttt gtgtgtttat tgggattggt c <pre listing-type="other">\hfill</pre> 41

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 43

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 30

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador ahls950

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 43

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>atggtgatgg tgggcgagga actcgtactg <pre listing-type="other">\hfill</pre> 30

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 44

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 41

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador AHUS1

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 44

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>gtcatatgaa aaaatggttt gtgtgtttat tgggattggt c <pre listing-type="other">\hfill</pre> 41

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 45

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 2094

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Aeromonas hydrophila</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 45

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>89</figref>

<figref>90</figref>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 46

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 26

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador usAHncol

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 46

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>atgccatggc cgacagccgt cccgcc <pre listing-type="other">\hfill</pre> 26

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 47

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 27

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador lsAH

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 47

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>ttggatccga attcatcaat ggtgatg <pre listing-type="other">\hfill</pre> 27

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 48

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 26

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador US-AhnheI

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 48

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>ttgctagcgc cgacagccgt cccgcc <pre listing-type="other">\hfill</pre> 26

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 49

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 27

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador lsAH

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 49

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>ttggatccga attcatcaat ggtgatg <pre listing-type="other">\hfill</pre> 27

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 50

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 26

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador US-Asncol

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 50

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>ttgccatggc cgacactcgc cccgcc <pre listing-type="other">\hfill</pre> 26

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 51

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 27

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; lsAH

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 51

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>ttggatccga attcatcaat ggtgatg <pre listing-type="other">\hfill</pre> 27

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 52

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 26

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador US-ASnhe1

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 52

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>ttgctagcgc cgacactcgc cccgcc <pre listing-type="other">\hfill</pre> 26

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 53

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 27

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador lsAH

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 53

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>ttggatccga attcatcaat ggtgatg <pre listing-type="other">\hfill</pre> 27

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 54

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 1371

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 54

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>91</figref>

<figref>92</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 55

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 267

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 55

<figref>93</figref>

<figref>94</figref>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 56

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 35

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; Artificial

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;220&gt;

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;223&gt; cebador 1USNEW

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 56

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>agcatatgaa aaaatggttt gtttgtttat tgggg <pre listing-type="other">\hfill</pre> 35

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 57

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 39

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; AHLS1001

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 57

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

<pre listing-type="other">\hskip-.1em\dddseqskip</pre>ttggatccga attcatcaat ggtgatggtg atggtgggc <pre listing-type="other">\hfill</pre> 39

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 58

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 548

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Thermobifida fusca</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 58

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>95</figref>

<figref>96</figref>

<figref>97</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 59

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 3000

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Thermobifida fusca</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 59

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>98</figref>

<figref>99</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 60

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 372

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Thermobifida fusca</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 60

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>100</figref>

<figref>101</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 61

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 300

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Corynebacterium efficiens</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 61

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>102</figref>

<figref>103</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 62

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 3000

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Corynebacterium efficiens</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 62

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>104</figref>

<figref>106</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 63

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 284

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Novosphingobium aromaticivorans</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 63

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>107</figref>

<figref>108</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 64

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 1500

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Novosphingobium aromaticivorans</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 64

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>109</figref>

<figref>110</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 65

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 268

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces coelicolor</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 65

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>111</figref>

<figref>112</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 66

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 2000

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces coelicolor</i>

<pre listing-type="other">\newpage</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 66

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>113</figref>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 67

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 269

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces avermitilis</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 67

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>115</figref>

<figref>116</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 68

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 1980

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces avermitilis</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 68

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>117</figref>

<figref>118</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 69

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 1371

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; ADN

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 69

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>119</figref>

<figref>120</figref>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;210&gt; 70

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;211&gt; 267

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;212&gt; PRT

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;213&gt; <i>Streptomyces</i>

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<pre listing-type="other">\vskip0.400000\baselineskip</pre>

&lt;400&gt; 70

<pre listing-type="other">\vskip1.000000\baselineskip</pre>

<figref>121</figref>

<figref>122</figref>