Compositions and methods for genetic modification of plants

ES 2 245 487 T3

DESCRIPTION

Compositions and methods for the genetic modification of plants.

Field of the invention

The invention relates to the genetic modification of plants. In particular, control of gene integration and expression in plants is provided.

Background of the invention

Genetic modification techniques allow the insertion of exogenous nucleotide sequences into the genome of an organism. A number of methods for the genetic modification of plants have been described. All of these methods are based on introducing foreign DNA into the plant cell, the isolation of those cells that contain the foreign DNA integrated into the genome, followed by subsequent regeneration of an entire plant. Unfortunately, such methods produce transformed cells that contain the introduced foreign DNA inserted randomly throughout the genome and often in multiple copies.

Random insertion of introduced DNA into the host cell genome can be lethal if the foreign DNA inserts into, and thus mutates, a critically important natural gene. Furthermore, even when a case of random insertion does not impair the functioning of a host cell gene, the expression of an inserted foreign gene can be influenced by "position effects" caused by the surrounding genomic DNA. In some cases, the gene is inserted at sites where the positional effects are strong enough to prevent synthesis of an effective amount of product from the introduced gene. In other cases, overproduction of the gene product has detrimental effects on the cell.

Transgene expression is typically governed by the sequences, including promoters and enhancers, that are physically connected to the transgene. Currently, it is not possible to precisely modify the structure of transgenes once they have been introduced into plant cells. In many applications of transgenic technology, it would be desirable to introduce the transgene in one way and then to be able to modify the transgene in a defined way. By these means, transgenes could be activated or inactivated when the sequences that control transgene expression could be altered by removing sequences present in the original transgene or by inserting additional sequences into the transgene.

For higher eukaryotes, homologous recombination is an essential event that participates in processes such as DNA repair and chromatid exchange during mitosis and meiosis. Recombination depends on two highly homologous extended sequences and several helper proteins. Strand separation can occur anywhere between regions of homology, although particular sequences can influence efficiency. These processes can be exploited for a targeted integration of transgenes into the genome of certain cell types.

Even with advances in the genetic modification of higher plants, the main problems associated with conventional gene transformation techniques have remained essentially unresolved in terms of the previously discussed problems relating to variable expression levels due to effects of chromosomal position and variation of the gene. number of copies of genes transferred. For these reasons, efficient methods are needed for the orientation and control of the insertion of nucleotide sequences to be integrated into a plant genome. Summary of the invention

Compositions and methods are provided for the targeted integration of nucleotide sequences in a transformed plant. The methods employ transfer cassettes that are flanked by non-identical recombination sites.

The methods find use in guiding the integration of nucleotide sequences of interest at a specific chromosomal site, finding optimal integration sites in a plant genome, comparing promoter activity in transformed plants, managing chromosomal rearrangements, and other genetic manipulation of plants.

Transgenic plants and plant cells containing corresponding non-identical recombination sites are also provided.

Accordingly, the invention provides a method for targeting the insertion of a nucleotide sequence of interest at a specific chromosomal site within a genome of a plant cell, comprising (a) introducing into said plant cell whose genome comprises a target site flanked by non-identical recombination sites a transfer cassette comprising the nucleotide sequence of interest flanked by corresponding non-identical recombination sites; and (b) providing a recombinase that recognizes and recombines non-identical recombination sites.

The invention also provides a method for locating preferred integration sites within a genome of a plant cell, which comprises introducing into said plant cell a target site comprising a sequence.

ES 2 245 487 T3 nucleotide cia flanked by non-identical recombination sites; (a) determining the level of expression of said nucleotide sequence; and (b) selecting a plant cell that expresses said nucleotide sequence.

The invention also provides a method for determining promoter activity in a plant cell, comprising (a) introducing into said plant cell whose genome comprises a target site flanked by non-identical recombination sites a transfer cassette comprising a linked promoter operably to a nucleotide sequence encoding a marker gene; said transfer cassette being flanked by corresponding non-identical recombination sites; and (b) providing a recombinase that recognizes and establishes recombination at non-identical recombination sites.

The invention also provides a method of minimizing or eliminating expression resulting from the random integration of DNA sequences into the genome of a plant cell, comprising (a) introducing into the genome of the plant cell a nucleotide sequence comprising a target site comprising two non-identical recombination sites, wherein the target site is located downstream of a promoter fused to an ATG translational initiation sequence; (b) introducing a transfer cassette comprising a nucleotide sequence of interest flanked by corresponding non-identical recombination sites, wherein the ATG translational initiation sequence of said nucleotide sequence of interest is replaced by one of the corresponding non-identical recombination sites from the target site, and in such a way that after successful orientation the nucleotide sequence of interest is placed in the correct reading frame to form a translational fusion between the ATG translational initiation sequence and the nucleotide sequence of interest; and (c) providing a recombinase that recognizes and establishes recombination at non-identical recombination sites.

The invention also provides a method for directly selecting transformed plant cells, comprising (a) introducing a transfer cassette into plant cell genomes, said plant cell genomes comprising a target site comprising a promoter operably linked to a nucleotide sequence comprising a first non-identical recombination site, a nucleotide sequence of interest and a second non-identical recombination site, and said transfer cassette comprising a nucleotide sequence encoding a selectable marker gene not operably linked to a promoter, wherein said transfer cassette is flanked by said first and second non-identical recombination sites; and (b) providing a recombinase that recognizes and performs recombination at non-identical recombination sites, and growing said plant cells on an appropriate selective agent to recover cells expressing the selectable marker.

The invention also provides a method of reducing the complexity of transgene integration into a plant cell genome, comprising (a) introducing into the plant cell a transfer cassette flanked by non-identical recombination sites, said cassette comprising transferring a nucleotide sequence of interest, said plant cell genome comprising a target site comprising corresponding non-identical recombination sites; (b) providing a recombinase that recognizes and performs recombination at non-identical recombination sites; and (c) selecting plant cells with simple integration patterns in their genome.

The invention also provides a method for combining multiple transfer cassettes at one location in a plant genome, comprising (a) introducing into the plant cell genome a first transfer cassette comprising at least three non-recombination sites. identical, wherein at least two of said non-identical recombination sites, which are referred to herein as the first and second reorientation sites, are in close proximity to each other; (b) introducing into the genome of the plant cell a second transfer cassette flanked by two non-identical recombination sites corresponding to the first reorientation sites of said first transfer cassette; and (c) providing a recombinase that recognizes and performs recombination at the first redirection site.

The invention also provides a method of combining multiple transfer cassettes at one location in a genome of a plant cell, said method comprising (a) introducing into the plant cell a target site comprising at least a first and a second site of non-identical recombination; (b) introducing into the plant cell a first transfer cassette comprising in the following order at least the first, a third and the second non-identical recombination site, wherein the first and third non-identical recombination sites of the first cassette transfer flanks a first nucleotide sequence of interest; (c) providing a first recombinase that recognizes and performs recombination at the first and second non-identical recombination sites; (d) introducing into the plant cell a second transfer cassette comprising at least the second and third non-identical recombination sites, wherein the second and third non-identical recombination sites from the second transfer cassette flank a second nucleotide sequence of interest; and (e) providing a second recombinase that recognizes and performs recombination at the second and third non-identical recombination sites.

The invention also provides a method of removing a nucleotide sequence of interest introduced into the genome of a plant cell, comprising (a) providing said plant cell, wherein said nucleotide sequence of interest is flanked by non-identical recombination sites. ; (b) introducing into the plant cell a chimeric RNA-DNA oligonucleotide molecule capable of recognizing and establishing nucleotide conversion at one of the non-identical recombination sites of the transfer cassette in order to create two identical recombination sites; and (c) providing a recombinase that recognizes and cleaves the sequences between the two identical recombination sites.

ES 2 245 487 T3

The invention also provides a dicot or monocot plant cell having stably incorporated into its genome: (a) a transfer cassette comprising a nucleotide sequence of interest flanked by or comprising at least two non-identical FRT recombination sites; or (b) at least a first and a second transfer cassette, wherein: (i) said first transfer cassette comprises a first nucleotide sequence of interest flanked by a first and a second recombination site, wherein said recombination sites first and second are not identical; (ii) said second transfer cassette comprises a second nucleotide sequence of interest flanked by the second recombination site and a third recombination site, wherein said third recombination site is not identical to said first and second recombination site; and (iii) said second recombination site is shared between the first and second transfer cassettes, so that the genome of the plant cell comprises in the following order the first recombination site, the first nucleotide sequence of interest, the second recombination site, the second nucleotide sequence of interest, and the third recombination site.

The invention also provides a monocotyledonous plant cell that has stably incorporated into its genome a transfer cassette comprising a nucleotide sequence of interest flanked by or comprising at least two non-identical FRT recombination sites or two non-identical LOX recombination sites, wherein said plant cell is from a monocot.

The invention also provides a transformed plant comprising a plant cell of the invention.

The invention also provides a transformed seed of such a plant.

Brief description of the figures

Figure 1 provides a scheme for gene stacking through site-specific integration using the FLP system.

Figure 2 provides a representative plasmid PHP10616 construct.

Detailed description of the invention

Compositions and methods are provided for the directional oriented integration of exogenous nucleotides in a transformed plant. The methods use new recombination sites in a gene targeting system that facilitates the directional targeting of desired genes and nucleotide sequences at corresponding recombination sites previously introduced into the genome of the target plant.

In the methods of the invention, a nucleotide sequence flanked by two non-identical recombination sites is introduced into the genome of the target organism establishing a target site for the insertion of nucleotide sequences of interest. Once a stable plant or cultured tissue is established, a second construct, or nucleotide sequence of interest, flanked by recombination sites corresponding to those flanking the target site, is introduced into the stably transformed plant or tissues in the presence of a recombinant protein. This procedure results in the exchange of the nucleotide sequences between the non-identical recombination sites of the target site and the transfer cassette.

It is known that the transformed plant can comprise multiple target sites; that is, groups of non-identical recombination sites. In this way, multiple manipulations of the target site are available in the transformed plant. By target site in the transformed plant is meant a DNA sequence that has been inserted into the genome of the transformed plant and comprises non-identical recombination sites.

Examples of recombination sites for use in the invention are known in the art and include FRT sites (See, for example, Schlake and Bode (1994) Biochemistry 33: 12746-12751; Huang et al. (1991) Nucleic Acids Research 19: 443 -448; PaulD. Sadowski (1995) in Progress in Nucleic Acid Research and Molecular Biology vol. 51, pp. 53-91; Michael M. Cox (1989) in Mobile DNA, Berg and Howe (eds) American Society of Microbiology, Washington D.

C., pp. 116-670; Dixon et al. (1995) 18: 449-458; Umlauf and Cox (1988) The EMBO Journal 7: 1845-1852; Buchholz et al. (1996) Nucleic Acids Research 24: 3118-3119; Kilby et al. (1993) Trends Genet. 9: 413-421: Rossant and Geagy (1995) Nat. Med. 1: 592-594; Albert et al. (1995) The Plant J. 7: 649-659; Bayley et al. (1992) Plant Mol. Biol. 18: 353-361; Odell et al. (1990) Mol. Gen. Genet. 223: 369-378 and Dale and Ow (1991) Proc. Natl. Acad. Sci. USA 88: 10558-105620; all of which are incorporated herein by reference); Lox (Albert et al. (1995) Plant J. 7: 649659; Qui et al. (1994) Proc. Natl. Acad. Sci. USa 91: 1706-1710; Stuurman et al. (1996) Plant Mol. Biol. 32: 901913 ; Odell et al. (1990) Mol. Gen. Gevet. 223: 369-378; Dale et al. (1990) Gene 91: 79-85 and Bayley et al. (1992) Plant Mol. Biol. 18: 353-361.) .

The two-micron plasmid found in most naturally occurring strains of Saccharomyces cerevisiae encodes a site-specific recombinase that promotes a DNA inversion between two inverted repeats. This inversion plays a major role in plasmid copy number amplification. The protein, called the FLP protein, catalyzes site-specific recombination events. The minimal recombination site (FRT, SEQ ID NO 1) has been defined and contains two inverted 13 base pair (bp) repeats

ES 2 245 487 T3 surrounding an 8 bp asymmetric spacer. The FLP protein cleaves the site at the junctions of the repeats and the spacer and is covalently connected to DNA through a 3 'phosphate.

Site-specific recombinases such as FLP cleavage and re-link DNA into specific target sequences, resulting in precisely defined recombination between two identical sites. To function, the system needs the recombination sites and the recombinase. No auxiliary factors are needed. Thus, the entire system can be inserted into and function in plant cells.

The yeast FLP / FRT site specific recombination system has been shown to work in plants. To date, the system has been used for the cleavage of unwanted dNa. See Lyznik et al. (1993) Nucleic Acid Res. 21: 969-975. In contrast, the present invention uses non-identical FRTs for exchange, orientation, arrangement, insertion, and control of the expression of nucleotide sequences in the plant genome.

To practice the methods of the invention, a transformed plant is needed that contains a target site integrated into its genome. The target site is characterized by being flanked by non-identical recombination sites. Additionally required is a targeting cassette containing a nucleotide sequence flanked by non-identical recombination sites corresponding to the sites contained in the target site of the transformed organism. A recombinase is required that recognizes non-identical recombination sites that catalyzes site-specific recombination.

It is known that recombinase can be provided by any means known in the art. That is, it can be provided in the organism or the plant cell by transforming the organism with an expression cassette capable of expressing the recombinase in the organism, by transient expression; or by providing messenger RNA (mRNA) for the recombinase or the recombinase protein.

By "non-identical recombination sites" is meant that the flanking recombination sites are not identical in sequence and will not recombine or recombination between the sites will be minimal. That is, a flanking recombination site can be a FRT site in which the second recombination site can be a mutated FRT site. The non-identical recombination sites used in the methods of the invention greatly prevent or suppress the recombination between the two flanking recombination sites and the cleavage of the nucleotide sequence contained therein. Accordingly, it is known that any suitable non-identical recombination sites can be used in the invention, including mutant FRT and FRT sites, FRT and lox sites, mutant lox and lox sites, as well as other recombination sites known in the art.

Suitable non-identical recombination site implies that, in the presence of active recombinase, sequence cleavage between two non-identical recombination sites occurs, if it occurs, with considerably lower efficiency than the targeting arrangement of the recombinantly mediated exchange of nucleotide sequences in the plant genome. Thus, non-identical sites suitable for use in the invention include sites where the recombination efficiency between the sites is low; for example, where the efficacy is less than about 30 to about 50%, preferably less than about 10 to about 30%, more preferably less than about 5 to about 10%.

As noted above, the recombination sites in the targeting cassette correspond to those in the target site of the transformed plant. That is, if the target site of the transformed plant contains non-identical FRT flanking recombination sites and a mutant FRT, the targeting cassette will contain the same non-identical FRT and mutant FRT recombination sites.

It is further known that the recombinase, which is used in the invention, will depend on the recombination sites in the target site of the transformed plant and the targeting cassette. That is, if FRT sites are used, the FLP recombinase will be required. In the same way, when lox sites are used, the Cre recombinase is required. If the non-identical recombination sites comprise both a FRT and a lox site, both FLP and Cre recombinase will be required in the plant cell.

FLP recombinase is a protein that catalyzes a site-specific reaction that is involved in amplifying copy number of the S. cerevisiae two-micron plasmid during DNA replication. The FLP protein has been cloned and expressed. See, for example, Cox (1993) Proc. Natl. Acad. Sci. USA 80: 4223-4227. The FLP recombinase for use in the invention can be derived from the genus Saccharomyces. It may be preferable to synthesize the recombinase using plant preferred codons for optimal expression in a plant of interest. See, for example, US Application Serial No. 08 / 972,258, filed November 18, 1997, entitled "Novel Nucleic Acid Sequence Encoding FLP Recombinase."

Bacteriophage Cre recombinase catalyzes site-specific recombination between two lox sites. Cre recombinase is known in the art. See, for example, Guo et al. (1997) Nature 389: 40-46; Abremski et al. (1984) J. Biol. Chem. 259: 1509-1514; Chen et al. (1996) Somat. Cell Mol. Genet. 22: 477-488 and Shaikh et al. (1977) J. Biol. Chem. 272: 5695-5702. Such a Cre sequence can also be synthesized using plant-preferred codons.

Where appropriate, the nucleotide sequences to be inserted into the plant genome can be optimized

ES 2 245 487 T3 for increased expression in the transformed plant. When mammalian, yeast, or bacterial genes are used in the invention, they can be synthesized using plant-preferred codons for improved expression. It is known that for monocot expression, dicot genes can also be synthesized using monocot preferred codons. Methods for synthesizing preferred plant genes are available in the art. See, for example, US Patent Nos. 5,380,831, 5,436,391 and Murray et al. (1989) Nucleic Acids Res. 17: 477-498.

Plant preferred codons can be determined from the most frequently used codons in the proteins expressed in the plant of interest. It is known that preferred monocot or dicot sequences can be constructed as well as preferred plant sequences for particular plant species. See, for example, EPA 0359472; EPA 0385962; WO 91/16432; Perlak et al. (1991) Proc. Natl. Acad. Sci. USA, 88: 3324-3328 and Murray et al. (1989) Nucleic Acids Research, 17: 477-498. US Patent No. 5,380,831; US Patent No. 5,436,391, and the like. It is further known that all or any part of the gene sequence can be optimized or synthesized. That is, fully optimized or partially optimized sequences can also be used.

Additional sequence modifications are known to enhance gene expression in a cellular host and can be used in the invention. These include deletion of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well-characterized sequences, which can be detrimental to gene expression. The GC content of the sequence can be adjusted to average levels for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin-like secondary mRNA structures.

The present invention also encompasses novel FLP recombination target sites (FRT). The FRT (SEQ ID NO: 1) has been identified as a minimal sequence comprising two repeats of 13 base pairs, separated by an 8 base spacer, as follows:

5'GAAGTTCCTATTC [TCTAGAAA] GTATAGGAACTTC3 'where the nucleotides in square brackets indicate the spacer region. The nucleotides in the spacer region can be replaced by a combination of nucleotides, as long as the two 13-base repeats are 8 nucleotides apart. It appears that the actual nucleotide sequence of the spacer is not critical. However, for the practice of the invention, some nucleotide substitutions in the spacer region may work better than others.

The 8 base pair spacer is involved in DNA-DNA pairing during strand exchange. The asymmetry of the region determines the direction of site alignment in the recombination event, which will subsequently lead to inversion or cleavage. As previously noted, most of the spacer can be mutated without loss of function. See, for example, Schlake and Bode (1994) Biochemistry 33: 12746-12751.

New mutant FRT sites are provided for use in practicing the methods of the present invention. Such mutant sites can be constructed by PCR-based mutagenesis. Although mutant FRT sites (SEQ ID NOs 2, 3, 4 and 5) are provided herein, it is known that other mutant FRT sites can be used in the practice of the invention. The present invention is not the use of a particular FRT site or recombination, but instead non-identical recombination sites or FRT sites can be used for the insertion and targeted expression of nucleotide sequences in a plant genome. Thus, other mutant FRT sites can be constructed and used based on the present disclosure.

As discussed previously, putting genomic DNA containing a target site with non-identical recombination sites together with a vector containing a transfer cassette with corresponding non-identical recombination sites, in the presence of the recombinase, results in recombination. The nucleotide sequence of the transfer cassette located between the flanking recombination sites is exchanged with the nucleotide sequence of the target site located between the flanking recombination sites. In this way, nucleotide sequences of interest can be precisely incorporated into the host genome.

It is known that many variations of the invention can be practiced. For example, target sites that have multiple non-identical recombination sites can be constructed. Thus, multiple genes or nucleotide sequences can be stacked or arranged at precise positions in the plant genome. Also, once a target site has been established within the genome, additional recombination sites can be introduced by incorporating such sites into the nucleotide sequence of the transfer cassette and transferring the sites to the target sequence. Thus, once a target site has been established, it is possible to subsequently add sites or alter the sites through recombination.

Another variation includes providing a promoter or transcription initiation region operably linked to the target site in an organism. Preferably, the promoter will be 5 'to the first recombination site. By transforming the organism with a transfer cassette comprising a coding region, expression of the coding region will occur during integration of the transfer cassette at the target site. This embodiment provides a method for selecting transformed cells, particularly plant cells, by providing a selectable marker sequence as the coding sequence.

ES 2 245 487 T3

Other advantages of the present system include the ability to reduce the complexity of integration of transgenes or transferred DNA into an organism using transfer cassettes as discussed above and selecting organisms with simple integration patterns. In the same way, preferred sites within the genome can be identified by comparing various transformation events. A preferred site within the genome includes one that does not disrupt the expression of essential sequences and provides for adequate expression of the transgene sequence.

The methods of the invention also provide means of combining multiple cassettes at one location within the genome. See, for example, Figure 1. Recombination sites can be added or deleted at target sites within the genome.

Any means known in the art to contact the three components of the system can be used in the invention. For example, a plant can be stably transformed to host the target site in its genome. The recombinase can be expressed or provided transiently. Alternatively, a nucleotide sequence capable of expressing the recombinase can be stably integrated into the plant genome. In the presence of the corresponding target site and recombinase, the transfer cassette, flanked by corresponding non-identical recombination sites, is inserted into the genome of the transformed plant.

Alternatively, the components of the system can be contacted by sexually crossing transformed plants. In this embodiment, a transformed plant, parent one, containing a target site integrated into its genome can be sexually crossed with a second plant, parent two, that has been genetically transformed with a transfer cassette containing flanking non-identical recombination sites. , which correspond to those of floor one. Plant one or plant two contains within its genome a nucleotide sequence that expresses recombinase. The recombinase can be under the control of a constitutive or inducible promoter.

Inducible promoters include thermally inducible promoters, estradiol sensitive promoters, chemically inducible promoters, and the like. Pathogen-inducible promoters include those of pathogenesis-related proteins (PR proteins), which are induced after infection by a pathogen; for example, PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathol. 89: 245-254; Uknes et al. (1992) The Plant Cell 4: 645-656 and Van Loon (1985) Plant Mol. Virol. 4: 111-116. In this way, recombinase expression and subsequent activity at recombination sites can be controlled.

Constitutive promoters for use in gene expression in plants are known in the art. Such promoters include, but are not limited to, the cauliflower mosaic virus 35S promoter (Depicker et al. (1982) Mol. Appl. Genet. 1: 561-573; Odell et al. (1985) Nature 313: 810- 812), ubitiquine promoter (Christensen et al. (1992) Plant Mol. Biol. 18: 675-689), promoters from genes such as ribulose bisphosphate carboxylase (De Almeida et al. (1989) Mol. Gen. Genet. 218: 78-98), actin (McElroy et al. (1990) Plant J. 2: 163-171), histone, DnaJ (Baszczynski et al. (1997) Maydica 42: 189-201), and the like.

The compositions and methods of the invention find use in targeting the integration of transferred nucleotide sequences to a specific chromosomal site. The nucleotide sequence can encode any nucleotide sequence of interest. Particular genes of interest include those that provide an easily analyzable functional trait to the host cell and / or organism, such as marker genes, as well as other genes that alter the phenotype of recipient cells, and the like. Thus, genes that affect plant growth, height, susceptibility to disease, insects, nutritional value, and the like can be used in the invention. The nucleotide sequence can also encode an "antisense" sequence to disrupt or modify gene expression.

It is known that nucleotide sequences will be used in a functional expression unit or cassette. By functional expression unit or cassette is meant the nucleotide sequence of interest with a functional promoter and in most cases a termination region. There are various ways to achieve unity of functional expression within the practice of the invention. In one embodiment of the invention, the nucleic acid of interest is transferred or inserted into the genome as a functional expression unit. Alternatively, the nucleotide sequence can be inserted at a site within the genome that is 3 'to a promoter region. In the latter case, the insertion of the coding region 3 'with respect to the promoter region is such that a functional expression unit is achieved during integration. For convenience, for expression in plants, nucleic acid encoding target sites and transfer cassettes, including nucleotide sequences of interest, may be contained within expression cassettes. The expression cassette will comprise a transcriptional initiation region, or promoter, operably linked to the nucleic acid encoding the peptide of interest. Such an expression cassette is provided with a plurality of restriction sites for the insertion of the gene or genes of interest to be under the transcriptional regulation of the regulatory regions.

The transcriptional initiation region, the promoter, can be natural or homologous or foreign or heterologous to the host, or it could be the natural sequence or a synthetic sequence. By "foreign" is meant that the transcriptional initiation region is not found in the wild host into which the transcriptional initiation region is introduced. A natural or heterologous promoter can be used with respect to the coding sequence of interest.

The transcriptional cassette will include in the 5'-3 'direction of transcription a transcriptional and translational initiation region, a DNA sequence of interest, and a functional transcriptional and translational termination region in

ES 2 245 487 T3 plants. The termination region may be natural to the transcriptional initiation region, it may be natural to the DNA sequence of interest, or it may be derived from another source. Convenient termination regions are available from the potato proteinase inhibitor gene (PinII) or from the A. tumefaciens Ti plasmid, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (1991) Mol. Gen. Genet. 262: 141144; Proudfoot (1991) Cell 64: 671-674; Sanfacon et al. (1991) Genes Dev. 5: 141-149; Mogen et al. (1990) Plant Cell 2: 1261-1272; Munroe et al. (1990) Gene 91: 151-158; Bailas et al. 1989) Nucleic Acids Res.17: 7891-7903; Joshi et al. (1987) Nucleic Acid Res. 15: 9627-9639.

Expression cassettes may additionally contain 5 'leader sequences in the expression cassette construct. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, eg, EMCV leader (Encephalomyocarditis 5 'noncoding region) (Elroy-Stein, O., Fuerst, TR and Moss, B. (1989) PNAS USA, 86: 6126-6130); potyvirus leaders, eg, TEV (tobacco etch virus) leader (Allison et al. (1986)); MDMV (corn dwarf mosaic virus) leader; Virology, 154: 9-20) and human immunoglobulin heavy chain binding protein (BiP), (Macejak, DG and P. Sarnow (1991) Nature, 353: 90-94; untranslated leader of protein mRNA from alfalfa mosaic virus envelope (AMV 4 RNA) (Jobling, SA and Gehrke, L., (1987) Nature, 325: 622-625; tobacco mosaic virus (TMV) leader, (Gallie et al. (1989) Molecular Biology ofRNA, pages 237-256, Gallie et al. (1987) Nucl. Acids Res. 15: 3257-3273 and chlorotic speckle virus leader Maize (MCMV) (Lommel, SA et al. (1991) Virology, 81: 382-385) See, further, Della-Cioppa et al. (1987) Plant Physiology, 84: 965-968. Other known methods to enhance translation can also be used, eg, introns and the like.

Expression cassettes can contain one or more than one gene or nucleic acid sequence to be transferred and expressed in the transformed plant. Thus, each nucleic acid sequence will be operably linked to 5 'and 3' regulatory sequences. Alternatively, multiple expression cassettes can be provided.

Generally, the expression cassette will comprise a selectable marker gene for selection of transformed cells. Selectable marker genes are used for the selection of transformed cells or tissues.

See generally GT Yarranton (1992) Curr. Opin. Biotech., 3: 506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA, 89: 6314-6318; Yao et al. (1992) Cell, 71: 63-72; WS Reznikoff (1992) Mol. Microbiol, 6: 2419-2422; Barkley and others (1980) The Operon, pp. 177-220; Hu et al. (1987) Cell, 48: 555-566; Brown et al. (1987) Cell, 49: 603-612; Figge et al. (1988) Cell, 52: 713-722; Deuschle et al. (1989) Proc. Natl. Acad. Aci. USA, 86: 5400-5404; Fuerst and others (1989) Proc. Natl. Acad. Sci. USA, 86: 2549-2553; Deuschle et al. (1990) Science, 248: 480-483; M. Gossen (1993) PhD Thesis, University of Heidelberg; Reines and others (1993) Proc. Natl. Acad. Sci. USA, 90: 1917-1921; Labow et al. (1990) Mol. Cell Bio., 10: 3343-3356; Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA, 89: 3952-3956; Baim et al. (1991) Proc. Natl. Acad. Sci. USA, 88: 5072-5076; Wyborski et al. (1991) Nuc. Acids Res., 19: 4647-4653; A. Hillenand-Wissman (1989) Topics in Mol. and Struc. Biol., 10: 143-162; Degenkolb et al. (1991) Antimicrob. Agents Chemother., 35: 1591-1595; Kleinschnidt et al. (1988) Biochemistry, 27: 1094-1104; Gatz et al. (1992) Plant J., 2: 397-404; AL Bonin (1993) PhD Thesis, University of Heidelberg; Gossen et al. (1992) Proc. Natl. Acad. Sci. USA, 89: 5547-5551; Oliva and others (1992) Antimicrob. Agents Chemother., 36: 913-919; Hlavka et al. (1985) Handbook of Exp. Pharmacology, 78; Gill et al. (1988) Nature 334: 721-724.

The methods of the invention can also be used to find optimal integration sites within a plant genome. In this way, a plant is transformed with an expression cassette comprising a selectable marker gene. The expression cassette is a target site since the marker gene is flanked by non-identical recombination sites. A transformed protoplast, tissues or whole plants can be tested to determine the activity levels of the inserted gene. By comparison of cellular activities of the gene at different insertion sites, preferred integration sites can be found where the gene is expressed at high or acceptable levels. These plants can then be used with subsequent reorientation techniques to replace the marker gene with other genes or nucleotide sequences of interest. In the same way, multiple genes can be inserted at the optimal site for expression. See, for example, Figure 2, which indicates a scheme for gene stacking using site-specific integration using the FRT / FLP system.

A variety of genetic manipulations are available using the compositions of the present invention, including, for example, comparing promoter activity in a transformed plant. Prior to the present invention, promoter activity could not be precisely determined and compared because the chimeric genes were inserted at different positions within the plant genome. Such chromosomal positions affected activity. Using the methods of the present invention, a direct comparison of promoter activity is possible in a defined chromosomal context. Thus, using the methods, enhanced gene activity can be achieved by selecting optimal chromosomal sites as well as optimal promoters for expression in the plant cell.

The present invention can be used for the transformation of any plant species, including, but not limited to, corn (Zea mays), canola (Brassica napus, Brassica rapa species), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annuus), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea) , cotton (Gossypium hirsutum), sweet potato (Ipomoea battus), guacamote (Manihot esculenta), coffee (Cofea species), coconut (Cocos nucífera), pineapple (Ananas comosus), citrus (Citrus species), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa species), avocado (Persea americana), fig (Ficus casica), guava (Psidium

ES 2 245 487 T3 guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almonds (Prunus amygdalus), sugar beets (Beta vulgaris) , oats, barley, vegetables, ornamental plants and conifers.

Vegetables include tomatoes (Lycopersicon esculentum), lettuce (for example, Lactuca sativa), green beans (Phaseolus vulgaris), Lima beans (Phaseolus limensis), peas (Lathyrus species), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis) and melon (C. melo). Ornamental plants include azalea (Rhododendron species), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa species), tulips (Tulipa species), daffodils (Narcissus species), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima) and chrysanthemum. Conifers that may be used to practice the present invention include, for example, pine trees such as frankincense pine (Pinus taeda), elliotii pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), contorted pine (Pinus contorta), and pine Monterrey (Pinus radiata); Oregon pine (Pseudotsuga menziesii); Pacific tsuga (Tsuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as common fir (Abies amabilis) and balsamina (Abies balsamea) and cedars such as giant thuja (Thuja plicata) and Nootka cypress (Chamaecyparis nootkatensis). Preferably, the plants of the present invention are crop plants (eg corn, alfalfa, sunflower, canola, soybean, cotton, peanut, sorghum, wheat, tobacco, etc.), more preferably corn and soybean plants, still more preferably corn plants. It is known that the methods of the invention can be applied in any plant system. Methods for transforming plants are known in the art. In this way, genetically modified plants, plant cells, plant tissue, seeds and the like can be obtained. Transformation procedures may vary depending on the type of plant or plant cell, ie, monocot or dicot, chosen as a target for transformation. Suitable methods for transforming plant cells include microinjection (Crossway et al. (1986) Biotechniques 4: 320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA, 83: 5602-5606, mediated transformation by Agrobacterium (Hinchee et al. (1988) Biotechnology, 6: 915-921), direct gene transfer (Paszkowski et al. (1984) EMBO J., 3-.2ΊΥ7-2Ί22) and ballistic acceleration of particles (see, for example, Sanford et al., US Pat. 4,945,050; WO91 / 10725 and McCabe et al. (1988) Biotechnology, 6: 923-926). See also Weissinger et al. (1988) Annual Rev. Genet., 22: 421-477; Sanford et al. (1987) Partculate Science and Technology, 5: 27-37 (onion); Christou et al. (1988) Plant Physiol. 87: 671674 (soybean); McCabe et al. (1988) Bio / Technology, 6: 923-926 (soy); Datta et al. (1990) Biotechnology, 8: 736740 (rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA, 85: 4305-4309 (corn); Klein et al. (1988) Biotechnology, 6: 559-563 (corn); WO91 / 10725 (corn); Klein et al. (1988) Plant Physiol., 91: 440-444 (corn); Fromm et al. (1990) Biotechnology, 8: 833-839 and Gordon-Kamm et al. (1990) Plant Cell, 2: 603-618 (corn); Hooydaas-Van Slogteren & Hooykaas (1984) Nature (London), 311: 763-764; Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA, 84: 5345-5349 (Liliaceae); De Wet et al. (1985) In The Experimental Manipulation of Ovule Tissues, ed. GP Chapman and others, pp. 197-209. Longman, NY (pollen); Kaeppler et al. (1990) Plant Cell Reports, 9: 415-418 and Kaeppler et al. (1992) Theor. Appl. Genet., 84: 560-566 (transformation mediated by filamentary crystallites) D'Halluin et al. (1992) Plant Cell, 4: 1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports, 12: 250-255 and Christou and Ford (1995) Annals of Botany, 75: 407-413 (rice) and Osjoda et al. (1996) Nature Biotechnology, 14: 745-750 (corn through Agrobacterium tumefaciens).

Cells that have been transformed can be grown as plants according to conventional systems. See, for example, McCormick et al. (1986) Plant Cell Reports, 5: 81-84. These regenerated plants can then be pollinated with the same transformed strain or different strains, and the resulting hybrid have the desired phenotypic characteristic identified. Two or more generations can be grown to ensure that the phenotypic trait of interest is maintained and stably inherited and then the seeds are harvested to ensure that the phenotype or other desired property has been achieved.

It is known that any transformation medium can be used for the present invention. However, to insert the target site into the transformed plant, Agrobacterium-mediated transformation may be preferred. Agrobacterium-mediated transformation generally tends to insert a lower copy number of transferred DNA than particle bombardment or other transformation means.

The following examples are offered by way of illustration and not by way of limitation.

Experimental part

The present general invention provides a method of using existing and new FRT sites in a new gene targeting system that facilitates the directional reorientation of desired genes at previously introduced FRT sites in the genome of the target organism. The new FRT sites differ from previously described FRT sites in the sequence of the 8 bp spacer regions of the FRT sites. Previous publications have also shown that in the presence of FLP protein, sequence recombination between two FRT sites occurs efficiently only with two identical FRT sites. See, for example, Umlauf and Cox (1988) Embo J. 7: 1845-1852; Schlake and Bode (1994) Biochem. 33: 1 2746-12751. To use the invention, a DNA or gene sequence is flanked by two non-identical FRT sites and introduced into a genome of a target organism. The enclosed gene can be a selectable marker, thereby allowing selection for successfully introduced sequences. Molecular characterization confirms the integration of desired sequences including complete FRT sites. Genetic examples of vector constructs useful for practicing the invention are listed below:

ES 2 245 487 T3

A. FRTa-P1-G1-T1-FRTb

B. FRTa-P1-G1-T1-FRTa

C. FRTb-P1-G1-T1-FRTb

D. P1-FRTa-G1-T1-FRTb

E. P1-FRTa-G1-T1-FRTa

F. P1-FRTb-G1-T1-FRTb

G. P1-ATG :: FRTa :: G1 (noATG) -TI-P2-G2-T2-FRTb

H. P1-ATG :: FRTa :: G1 (noATG) -TI-P2-G2-T2-FRTb-P3-G3-T3

I. P1-ATG :: FRTa :: G1 (noATG) -TI-FRTa :: G2 (noATG) -T2-FRTb

J. P1-ATG :: FRTa :: G1 (noATG) -TI-FRTa :: G2 (noATG) -T2-FRTb-P3-G3-T3

K. P1-FRTa-G1-T1-P2-G2-T2-FRTb

L. P1-FRTa-G1-T1-P2-G2-T2-FRTb-P3-G3-T3

M. P1-FRTa-G1-T1-FRTa-G2-T2-FRTb

N. P1-FRTa-G1-T1-FRTa-G2-T2-FRTb-P3-G3-T3

Variations thereof can be constructed with other promoters, genes, terminators, or FRT sites.

FRTa and FRTb are two examples of non-identical FRT sites. P1, P2 and P3 are different promoters, G1, G2 and G3 are different genes, T1, T2 and T3 are different terminators. ATG is the start of the translation codon for the subsequent gene. The designation noATG indicates that the particular gene lacks the ATG translation initiation codon. The symbol :: implies a fusion between adjacent elements, and when used between ATG, FRT and a gene it implies that the sequences are brought together to generate an in-frame translational fusion resulting in an appropriately expressed and functional gene product.

A through F are preferred configurations for testing new FRT sites for the ability to recombine sequences with each other; the desired situation being that when two of the same site are used, recombination is efficient and that when two different sites are used, no recombination takes place between them in the presence of FLP protein. G through J are preferred settings for general use when developing lines for reorientation. It is understood that any number of genes or other combinations of sequences can be assembled for use as part of this invention. K to N are possible configurations that could also be used.

Once a stable cultured plant or tissue is established with one of the above constructs, a second construct flanked by the same FRT sites flanking the sequences of the above first construct is introduced into the stably transformed tissues along with the expression of FLP protein. The new constructs can be, but are not limited to, the following:

O. FRTa :: G1 (noATG) -TI-FRTb

P. FRTa :: G1 (noATG) -TI-P2-G2-T2-FRTb

Q. FRTa-G1-T1-FRTb

R. FRTa-G1-T1-P2-G2-T2-FRTb

The FLP protein can be delivered a) by co-transforming with a plasmid carrying a gene encoding FLP; b) co-introducing FLP mRNA or protein directly; c) using an initial transformation line that expresses FLP constitutively or after induction; or d) growing the plants bearing the initial targeted vectors, crossing with plants expressing active FLP protein and selecting cases in the progeny.

As a working example, the sequence O above is introduced into a line containing a copy of the G sequence stably integrated into the genome, in the presence of functional FLP protein. Recombination occurs between identical FRT sites such that the sequence between the FRT sites in O replaces the sequence between the corresponding FRT sites of the G sequence, thereby giving a new directionally oriented reintegrated sequence.

ES 2 245 487 T3

The new gene in O is now removed from the P1 promoter in G. The purpose of designing some of the constructs without an ATG start codon in the gene is such that if random integration occurs, there is an extremely low probability of gene expression. introduced, since for this to occur the fragment would need to integrate behind an endogenous promoter region in the correct reading frame. This would occur extremely rarely and the data to date have not given examples of this event using a sequence such as O where the contained gene is the easily evaluable GUS gene. A requirement for each gene to be constructed in this way (i.e. without ATG in the gene but with the ATG upstream of the FRT site) is the demonstration that the gene can tolerate a fusion of the FRT sequence between the ATG codon. and the second codon of the protein. To date, this has worked for a large number but not all genes. In the latter cases, the other form of the construct that retains the ATG (for example Q.) could be used. All of the sequences listed above are expected to work in this scheme, some with different frequencies or efficiencies than others.

A problem that this strategy addresses is the limitations with current transformation systems, particularly in plants, where the delivery of DNA to cells or nuclei and the subsequent integration into the genome occurs more or less randomly and unpredictably. This is particularly true with particle bombardment methods; Arguments have been made that Agrobacterium-based methods tend to deliver T-DNA border-flanked sequences to more actively transcribed regions of the genome, but other than that the procedure is still largely random. Therefore, for commercial product development, large numbers (estimates of> 200) of cases need to be generated to identify a case: a) that is expressed at the desired level; b) in which the product is functional and effective; c) has a simple integration complexity to facilitate recovery; d) that it does not contain foreign sequences that pose potential regulatory problems; e) that the expression is stablely maintained over generations; f) most importantly, that it does not have a negative impact on agronomic behavior characteristics when it goes through a breeding program that involves introgression of the trait into different genetic backgrounds. The use of resources is very large and thus schemes that can significantly produce the demand for resources would be very beneficial for the production of larger numbers of desired end products.

Example 1

Creation of new non-identical FRT sites

DNA fragments containing new FRT sequences were constructed by synthesizing, reassociating and ligating complementary oligonucleotides or creating primers for PCR amplification (Mullis and Faloona, 1987) of a DNA product containing the new FRT sequence near the 5 'end of the product of PCR. The newly constructed FRT product includes flanking restriction sites useful for cloning into plant expression units. In general, the 5 'end is flanked by a NheI site and a terminal NcoI site. The NcoI site includes ATG bases, which are advantageously used in recently developed vector constructs as the recognition sequences to initiate an open reading frame. In constructs based on the sequence called noATG / FRT, the NheI site is used for cloning thereby removing the ATG upstream in the process. At the 3 'end of the FRT sequence, a restriction site is included that allows the unique identification of individual spacer sequences. As specific examples, the wild-type FRT site (referred to here as FRT1) is cloned with a flanking BglII site, the FRT5 site (TTCAAAAG spacer) has a ScaI site, the FRT6 site (TTCAAAAA spacer) has an AatII site, and the FRT7 site ( TTCAATAA spacer) has a SpeI site. The outermost flanking restriction site is an XhoI site and is used to clone a gene of interest in the open reading frame.

The structures and sequences of the FRT sites that are indicated and / or used in the present example of the invention are represented below with indicated restriction site positions, repeats and spacer regions.

FRT1 (SEQ ID NO 2)

<td>Ncol</td><td>Nhel Repeat 1</td><td>Repeat 2</td><td>Spacer</td><td>Inverted Rep.</td><td>BglII</td><td>Xhol</td>

<td> 3'</td><td colspan="6">CCATGGCTAOC GAAGTTCCTATTCC GAAGTTCCTATTC TCTAGAAA GTATAGGAACTTC AGATCTCGAG</td>

<td>FRT5</td><td>(SEQ ID No. 3)</td><td></td><td></td><td></td><td></td><td></td>

<td>Ncol</td><td>Nhel Repetition</td><td>Repeat 2</td><td>Spacer</td><td>Inverted Rep.</td><td>Seal</td><td>Xhol</td>

3 'CCATGGCTAGC GAAGTTCCTATTCC GAAGTTCCTATTC TTCAAAAG GTATAGGAACTTC AGTACTCGAG

FRT6 (SEQ ID NO 4)

<td>Ncol</td><td>Nhel Repetition</td><td>Repeat 2</td><td>Spacer</td><td>Inverted Rep.</td><td>AatlI</td><td>Xhol</td>

<td> 5'</td><td colspan="6">CCATGGCTAGC GAAGTTCCTATTCC GAAGTTCCTATTC TTCAAAAA GTATAGGAACTTC AGACGTCCTCGAG</td>

<td>FRT7</td><td>(SEQ ID No. 5)</td><td></td><td></td><td></td><td></td><td></td>

<td>Ncol</td><td>Nhel Repetition</td><td>Repeat 2</td><td>Spacer</td><td>Inverted Rep.</td><td>Spel</td><td>Xhol</td>

5 'CCATCGCTAGC GAAGTTCCTATTCC GAAGTTCCTATTCTTCAATAA GTATAGGAACTTCACTACTTCTCGAG

ES 2 245 487 T3

Example 2

Creation of plant transformation vectors containing new non-identical FRT sites

Based on the FRT site design described above, standard PCR or mutagenesis procedures were used to create an XhoI site that overlaps at the start of a gene sequence to be used for cloning upstream of the FRT site, converting from that mode the ATG start codon into GTG. Ligation of an FRT to the mutated gene sequence in XhoI creates a new open reading frame that starts 5 'to the FRT. A second FRT sequence can be cloned downstream of the terminator using a variety of methods including PCR or ligation. The FRT / gene / terminator / FRT unit can then be used to make target or substrate constructs.

Targets are created by inserting a promoter into the NcoI site upstream of the first FRT. This maintains a complete open reading frame of the FRT / gene fusion. These target constructs are for use in transformation experiments to create desirable "target lines." Substrate vectors are constructed by cloning with the NheI site to truncate the start codon of the FRT / gene unit, thereby eliminating the appropriate open reading frame. These substrate vectors are used in experiments designed to reorient a new gene flanked by FRT sites into corresponding FRT sites previously introduced into the target lines. In either case, to create multiple gene cassettes, additional promoter / gene / terminator units are inserted between the terminator and the second FRT on any target or substrate molecules.

Example 3

Demonstration of the functionality of new FRT sites and the requirement of two identical sites for efficient recombination of DNA sequences located between two FRT sites

Plasmids containing two identical or two different FRT sequences were tested for the efficiency of sequence recombination between FRT sites by transformation into 294-FLP, a version of E. coli strain MM294 with FLP recombinase integrated at the lacZ locus. (Buchholz and others, 1996). The strains were grown overnight at 37 ° C with shaking, allowing constitutive expression of FLP recombinase in the cultures. Plasmid DNA was isolated using standard procedures and digested with restriction enzymes that create new restriction fragments after FLP-mediated recombination. The extent of recombination between FRT sites was estimated by examining banding patterns on an agarose gel. Table 1 summarizes data from the gel analysis.

TABLE 1

<td>Combination of Diana Sites</td><td>Recombination Extension</td>

<td>FRT1 andFRT1</td><td>Complete</td>

<td>FRT5 and FRT5</td><td>Extensive, but partially incomplete</td>

<td>FRT6 and FRT6</td><td>Complete</td>

<td>FRT7 and FRT7</td><td>Complete</td>

<td>FRT1 and FRT5</td><td>No recombination</td>

<td>FRT1 and FRT6</td><td>No recombination</td>

<td>FRT1 and FRT7</td><td>No recombination</td>

<td>FRT5 and FRT6</td><td>No recombination</td>

<td>FRT5 and FRT7</td><td>No recombination</td>

<td>FRT6 and FRT7</td><td>Very small amount of recombination</td>

The results of these studies indicate that sequence cleavage between identical FRT sites occurs with high overall efficiency (FT5, SEQ ID No. 3, appears to be less efficient overall than FRT1 sites, SEQ ID No. 2, or the newer FRT6, SEQ ID No. 4, and FRT7, SEQ ID No. 5). Equally important, recombination with two different FRT sites was absent, or at least undetectable under the conditions of this assay for all combinations except FRT6, SEQ ID No. 4, and FRT7, SEQ ID No. 5, where a small degree of recombination was seen. These data provided strong support for the potential utility of non-identical FRT sites in developing a system of

ES 2 245 487 T3 directional gene integration. One point to note is that because sequence recombination between two identical FRT sites can occur with different efficiencies depending on the specific FRT site used (e.g., FRT5, SEQ ID No. 3, in the present experiment), the design of Constructs for directional oriented integration may require judicious selection of FRT site pairs to optimize for desired recombination efficiency or to avoid any unwanted recombination.

Example 4

Introduction of DNA sequences including new non-identical FRT sites in plant cells, generation and recovery of stable transgenic cases ("target lines"), conservation of "target lines" and plant regeneration

A number of stable transgenic cases were produced that carried FRT target sites. These target lines were generated by introducing one of a number of constructs including, for example, PHP9643, PHP10616, PHP11407, PHP11410, PHP11457, PHP11599, PHP11893, or PHP14220 (See Table 2) into corn cells, by particle bombardment, as described. described in Register et al. (1994) Plant Mol. Biol. 25: 951-961 or through co-culture with Agrobacterium as described by Heath et al. (1997) Mol. Plant-Microbe Interact. 10: 22-227; Hiei et al. (1994) Plant J. 6: 271-282 and Ishida et al. (1996) Nat. Biotech. 14: 745-750 and in Provisional Application Serial No. 60 / 045,121 for "Agrobacterium Mediated Sorghum Transformation", filed April 30, 1997. All vectors were constructed using standard molecular biology techniques as described, for example , in Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual (2^to ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY). Table 2 below describes the components within each of the vectors used to create a group of target lines. The assembly strategy was as follows. The first expression unit in each case contains the 2.0 kb PstI fragment of the maize Ubi-1 ubiquitin promoter (Christensen et al. (1992) Plant Mol. Biol. 18: 675-689). Downstream of the ubiquitin promoter, variable FRT sequences were inserted using Ncol or other sites that retained the ATG start codon. PHP10616 has the coding sequence mo-PAT (US Provisional Patent Application Serial No. 60 / 035,560 for "Methods for Improving Transformation Efficiency", filed January 14, 1997) merged into the frame at the site XhoI flanking FRT1 (see above, SEQ ID NO: 2). PHP11407 and PHP11893 have GFPm-C3 (PCT / US97 / 07688, filed May 1, 1997 from Provisional Application 0 / 016,345, filed May 1, 1996) containing the second intron of potato ST-LS1 (Vancanneyt et al. (1990) Mol. Gen. Genet. 220: 245-250) fused in frame at the XhoI site of FRT1 and FRT6, respectively. The potato proteinase inhibitor II (PinII) terminator (bases 2 to 310 of An et al. (1989) Plant Cell 1: 115-122) was ligated downstream of the coding sequences. PHP10616 has a FRT5 sequence (SEQ ID NO: 3) cloned downstream of the PinII terminator.

(Table goes to next page)

ES 2 245 487 T3

<td>Downstream-3</td><td>pinll, FRT5</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>Coding-3</td><td>NoATG / FRTl / GFPm</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>Downstream-2</td><td>term 35S</td><td></td><td>pinll, FRT5</td><td>term 35S, FRT1</td><td>term 35S, FRT1</td><td>term 35S, FRT1</td><td>pinll, FRT1</td><td>pinll, FRT5</td><td>pinll, FRT5</td>

<td>Coding-2</td><td>moPAT</td><td></td><td>HM1</td><td>PUB</td><td>PUB</td><td>PUB</td><td>HM1</td><td>GFPm</td><td>GFPm</td>

<td>Upstream-2</td><td>E35S / 35S / O '/ intron ADH</td><td></td><td>Ubiquitin</td><td>E35S / 35S / O '/ intron ADH</td><td>E35S / 35S / O '/ intron ADH</td><td>35S / O '/ ADH intron</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td>

<td>Downstream-1</td><td></td><td>pinll, FRT5</td><td>pinll</td><td></td><td></td><td></td><td>pinll</td><td>pinll</td><td>pinll</td>

<td>Coding-1</td><td>ATG / FRT1</td><td>ATG / FRTl / moPAT</td><td>ATG / FRTl / GFPm- C3-intron</td><td>ATG / FRT5</td><td>ATG / FRT6</td><td>ATG / FRT6</td><td>ATG / FRT6 / GFPm- C3-intron</td><td>FLPm</td><td>FLPm</td>

<td>Upstream-1</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>---1 Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin / FRTl in UTR 5 '</td><td>Ubiquitin / in FRT1 intron</td>

<td>PHP</td><td> 9643</td><td> 10616</td><td> 11407</td><td> 11410</td><td> 11457</td><td> 11599</td><td> 11893</td><td> 14220</td><td></td>

ES 2 245 487 T3

The second expression units have the corn ubiquitin promoter or alternatively the enhanced or standard versions of the cauliflower mosaic virus 35S promoter. The standard 35S promoter includes bases -421 to +2 (from Gardner et al. (1981) Nucl. Acids Res. 9: 2871-2888), and the enhanced version has a -421 to -90 base duplication upstream of it. standard 35S forwarder. The 79 bp O 'tobacco mosaic virus leader (Gallie et al. (1987) Nucl. Acids Res. 15: 3257-3273) is inserted downstream of the 35S promoter followed by the first intron of the maize alcohol dehydrogenase gene ADH1-S (Dennis et al. (1984) Nucl. Acids Res. 12: 3983-3990). The coding sequences in these second expression units include the genes mo-PAT, bar (Thompson et al. (1987) EMBO J. 6: 2519-2523) or HM1 (Johal and Briggs, Science 258: 985-987) followed by the PinII terminator or the 35S terminator (nucleotides 7487-7639 in Gardner et al. (1981) Nucl. Acids Res. 9: 2871-2888). Variable FRT sites are ligated downstream of the terminators as shown in the table. A third expression unit is present in PHP9643 and has a FRT1 / GFPm fusion cloned using the FRT1 flanking NheI site (SEQ ID NO.

2) to remove the ATG start codon from GFPm, thereby rendering it non-functional in the existing construct, but where correct cleavage of the sequences between FRT1 sites (SEQ ID NO 2) can put the mGFP in frame with the ubiquitin and ATG promoter of the first expression unit, thereby rendering it functional. Downstream of mGFP is the PinII terminator followed by a FRT5 sequence (SEQ ID NO: 3).

PHP9643 was cloned into a plasmid backbone derived from pUC. All other vectors were cloned into a pSB11-like plasmid (See, for example, EPA0672753A1, EPA0604662A1, EPA0687730A1 and US Patent No. 5,591,616) with the expression units contained between the TDNA border sequences. All are oriented with the unit of expression one adjacent to the right limit. Plasmids based on pSB11 were integrated into the superbinary plasmid pSB1 (See, for example, EPA0672752A1, EPA0604662A1, EPA0687730A1 and US Patent No. 5,591,616) by homologous recombination between the two plasmids. The HB101 strain of E. coli containing the derivatives of pSB11 was crossed with the Agrobacterium strain LBA4404 harboring pSB1 to create the cointegrated plasmids PHP10616, PHP11407, PHP11410, PHP11457, PHP11599, PHP11893, and PHP14220 in Agrobacterium (using the method of Ditta et al. (1980) Proc Natl. Acad. Sci. USA 77: 7347-7351). The cointegrates were verified by the resistance of Agrobacterium to spectinomycin and restriction digestions with SalI.

Table 2 also includes an example of a vector for creating a target line where FRT sites are inserted into the maize ubiquitin intron (last entry) as an alternative location for placement of FRT or other target sites.

After selection of stably transformed cases, samples of these target lines were cryopreserved as a supply for future experiments using the system described by Peterson (see application 08 / 859,313). For several but not all cases, another callus sample from several of the stable transgenic cases was grown, transferred to regeneration medium to induce seedling formation, and the plants subsequently recovered and grown to maturity ( Register et al. (1994) Plant. Mol. Biol. 25: 951-961). Example 5

Demonstration of the functionality of new FRT sites in plants (A) Excision of DNA sequences between two identical FRT sites, but not when flanked by two non-identical FRT sequences

The extent of intraplasmid recombination was examined in plants using the FRT cleavage constructs described in Table 3 below. Vectors PHP10968, PHP10998, PHP10969, PHP11272, PHP11243, PHP11244, PHP12140, PHP12141, PHP12156, and PHP12157 were constructed by ligating the corn ubiquitin promoter upstream of FRT sequences using NcoI or other sites that maintained the ATG start codon. The FRT sequence was fused in frame at the flanking XhoI site to a GFPm sequence containing a mutation from serine to threonine at amino acid residue 65 in the wild-type sequence (new sequence designated GFPmS65T). The pinII terminator was cloned downstream of mGFP. The second expression unit consists of a promoterless FRT, cloned with the 5 'flanking NheI site to remove the ATG start codon, fused in-frame with the GUS coding sequence (Jefferson et al. (1986) Proc. Natl Acad. Sci USA 83: 8447-8451) and followed by the pinII terminator. The vector backbone is a plasmid derived from pUC in all cases. Experiments were carried out by bombarding the indicated plasmids into maize cells together with the construct pHP5096, which supports a functional expression cassette for the FLP protein. PHP5096, the FLPm expression vector that was used in experiments with the cleavage and substrate vectors, consists of the maize ubiquitin promoter cloned upstream of the FLPm coding sequence (US Pat. Serial No. 08 / 972,258 for "Novel Nucleic Acid Sequence Encoding FLP Recombinase") and the pinII terminator on a plasmid backbone derived from pUC. In each case, successful cleavage would remove intermediate sequences between the indicated FRT sites thereby putting an inactive uidA (GUS) gene in frame with and in proximity to the ubiquitin promoter resulting in GUS activity. If cleavage does not occur, no GUS expression is expected. The results for GUS expression from these experiments are listed in Table 4 below. In these studies, efficient cleavage occurred only when the constructs contained two identical FRT sites. In the case of the combination of FRT6 (SEQ ID No. 4) and FRT7 (SEQ ID No. 5), a small amount of recombination was observed, again emphasizing the need to test combinations of target sites and judiciously select appropriate combinations for the application.

ES 2 245 487 T3

<td>Downstream-2</td><td>pinll 1-</td><td>pinll</td><td>pinll i</td><td>pinll</td><td>pinll</td><td>pinll</td><td>pinll</td><td>pinll</td><td>| pinll -</td><td>pinll</td><td>pinll</td><td>pinll</td><td>pinll</td><td>pinll</td>

<td>Coding-2</td><td>noATG / FRTl / GUS</td><td>noATG / FRT5 / GUS</td><td>noATG / FRT6 / GUS</td><td>noATG / FRT7 / GUS</td><td>noATG / FRT5 / GUS</td><td>noATG / FRT6 / GUS</td><td>noATG / FRT7 / GUS</td><td>noATG / FRT6 / GUS</td><td>noATG / FRT7 / GUS</td><td>noATG / FRT7 / GUS</td><td>GUS</td><td>GUS i_</td><td>GUS</td><td>GUS</td>

<td>Upstream-2</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>FRT1 in 5 'UTR / intron of Ubi</td><td>FRT1 in Ubi intron</td><td>FRT5 in Ubi intron</td><td>FRT6 in Ubi intron -</td>

<td>Downstream-1</td><td>Pinll</td><td>Pinll</td><td>Pinll L.</td><td>Pinll</td><td>Pinll</td><td>Pinll</td><td>Pinll</td><td>Pinll</td><td>Pinll</td><td>Pinll</td><td>Pinll</td><td>Pinll</td><td>Pinll</td><td>Pinll</td>

<td>i Coding-1</td><td>ATG / FRTl / GFPm-S65T</td><td>| ATG / FRT5 / GFPm-S65T</td><td>ATG / FRT6 / GFPm-S65T</td><td>ATG / FRT7 / GFPm-S65T</td><td>ATG / FRTl / GFPm-S65T</td><td>ATG / FRTl / GFPm-S65T</td><td>ATG / FRTl / GFPm-S65T</td><td>ATG / FRT5 / GFPm-S65T</td><td>ATG / FRT5 / GFPm-S65T</td><td>ATG / FRT6 / GFPm-S65T</td><td>GFPm-S65T</td><td>AHAS</td><td></td><td>AHAS</td>

<td>Upstream-1</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin</td><td>Ubiquitin / FRT in UTR 5 '</td><td>Ubiquitin / FRT1 in intron</td><td>Ubiquitin / FRT 1 in intron</td><td>Ubiquitin / FRT1 in intron</td>

<td>PHP</td><td> 89601</td><td> 86601</td><td> 11242</td><td> 12157</td><td> 10969</td><td> 11243</td><td> 12140</td><td> 11244</td><td> 12141</td><td> 12156</td><td> 12933</td><td> 14076</td><td> 14053</td><td> 14086</td>

ES 2 245 487 T3

TABLE 4

<td>Plasmid</td><td>Proven recombination between</td><td>GUS expression</td>

<td>PHP10968</td><td>FRT1 and FRT1</td><td> +++</td>

<td>PHP10998</td><td>FRT5 and FRT5</td><td> ++</td>

<td>PHP11272</td><td>FRT6 and FRT6</td><td> +++</td>

<td>PHP12157</td><td>FRT7 and FRT7</td><td> +++</td>

<td>PHP9643</td><td>FRT1 and FRT5</td><td> -</td>

<td>PHP11243</td><td>FRT1 and FRT6</td><td> -</td>

<td>PHP 12140</td><td>FRT 1 and FRT7</td><td> -</td>

<td>PHP11244</td><td>FRT5 and FRT6</td><td> -</td>

<td>PHP 12141</td><td>FRT5 and FRT7</td><td> -</td>

<td>PHP 12156</td><td>FRT6 and FRT7</td><td> +</td>

B) Transient integration of a second DNA sequence flanked by two non-identical FRT sites in plant cells

Data from experiments are summarized in Table 5 below in which target lines created using the plasmids described in Table 2 were bombarded with a substrate plasmid containing a GUS reporter gene flanked by the corresponding FRT sites used in the target constructs. This experiment measured the ability to detect transient GUS expression shortly after introduction of the substrate plasmid. Since there is no promoter to the first coding sequence in the substrate plasmids, random integration, unless in-frame behind an appropriate regulatory sequence anywhere in the genome, would not result in GUS expression. . This assay system then assesses the ability to target FRT-flanked genes to FRT sites in the genome. In general, FRT substrate vectors (Table 6) are constructed as cloned promoterless gene / FRT fusions using the FRT 5 'flanking NheI site to remove the ATG initiation codon. Genes fused in frame to the FRT with the flanking XhoI site include one of several evaluable or selectable marker genes such as aadA (Svab et al. (1990) Plant Mol. Biol. 14: 197-205), uidA, GFPm, GFPm- C3 / intron or bar and are followed by a pinII terminator. In some cases (PHP10259, PHP10603, PHP11561 and PHP11633), the plasmids contain a single expression unit and the second heterologous FRT site is cloned downstream of the pinII terminator. The substrate plasmids PHP10859, PHP10997, PHP11204, PHP11699 and PHP12190 have in addition to the first expression unit described above a second unit consisting of a corn ubiquitin promoter, the enhanced 35S promoter or a chimeric promoter consisting of the enhancer region of 35S cloned upstream of a synthetic core promoter named Rsyn7 (US patent application Ser. Serial No. 08 / 661,601, filed June 11, 1996) cloned upstream of the HM1, aadA, GUS or bar coding sequences and the pinII terminator. A heterologous FRT is inserted downstream of the second terminator. Finally, PHP11003 and PHP11809 contain three expression units. The first unit is a noATG / FRT / promoterless gene fusion as described above. The second unit contains the chimeric 35S enhancer / Rsyn7 promoter described above or the ZmdJ1 promoter (Baszczynski et al. (1997) Maydica 42: 189-201) cloned upstream of the GUS coding sequence and the pinII terminator. The third expression unit consists of the maize ubiquitin promoter cloned upstream of the HM1 coding sequence, the pinII terminator, and a heterologous FRT sequence. All FRT substrate vectors are cloned into a plasmid backbone derived from pUC. Details of the components of these vectors are described in Table 6. Two vectors with alternate location of the FRT sites in the 5 'UTR or the ubiquitin intron are also listed in Table 6.

ES 2 245 487 T3

TABLE 5

<td>No. of GUS spots</td><td>PHP9643 (n = 74)</td><td>PHP1147 (n = 127)</td><td>PHP11410 (n = 32)</td><td>PHP11407 (n = 38)</td><td>PHP11457 (n = 113)</td>

<td>without stains</td><td> 17,57%</td><td> 3,15%</td><td> 6,25%</td><td> 2,63%</td><td> 7,96%</td>

<td> 1-25</td><td> 22,97%</td><td> 48,03%</td><td> 62,50%</td><td> 10,53%</td><td> 27,43%</td>

<td> 26-100</td><td> 31,08%</td><td> 37,80%</td><td> 18,75%</td><td> 18,42%</td><td> 32,74%</td>

<td> 101-200</td><td> 14,86%</td><td> 8,66%</td><td> 12,50%</td><td> 57,89%</td><td> 27,43%</td>

<td>too many to count</td><td> 13,51%</td><td> 2,36%</td><td> 0,00%</td><td> 10,53%</td><td> 4,42%</td>

(Table goes to next page)

ES 2 245 487 T3

<td>Downstream-3</td><td></td><td></td><td></td><td></td><td>pinll, FRT5</td><td></td><td></td><td></td><td></td><td>pinll, FRT1</td><td></td><td>pinll, FRT5</td><td>pinll, FRT5</td>

<td>Encodes- tion-3</td><td></td><td></td><td></td><td></td><td>HM1</td><td></td><td></td><td></td><td></td><td>HM1</td><td></td><td>PUB</td><td>PUB</td>

<td>Upstream-3</td><td></td><td></td><td></td><td></td><td>Ubiquitin</td><td></td><td></td><td></td><td></td><td>Ubiquitin</td><td></td><td>^rE35S / 35S / O7 entered n of ADH</td><td>rE35S / 35S / O7 entered n of ADH</td>

<td>Downstream- two</td><td></td><td></td><td>pinll, FRT5</td><td>pinll, FRT5</td><td>pinll</td><td>pinll, FRT5</td><td></td><td></td><td>pinll, FRT1</td><td>pinll</td><td>pinll, FRT5</td><td>pinll</td><td>pinll</td>

<td>Coding- two</td><td></td><td></td><td>HM1</td><td>added</td><td>GUS</td><td>GUS</td><td></td><td></td><td>HM1</td><td>GUS</td><td>PUB</td><td>HM1</td><td>HM1</td>

<td>Upstream-2</td><td></td><td></td><td>Ubiquitin</td><td>Ubiquitin</td><td>E3 5 S / Rsyn7 / O '/ intron ofADH</td><td>E3 5 S / Rsyn7 / O '/ intron ofADH</td><td></td><td></td><td>Ubiquitin</td><td>F3.7</td><td>E35S / 35S / O7 Intron ADH</td><td>Ubiquitin / FRTl in UTR5 '</td><td>Ubiquitin / FRTl in UTR5 '</td>

<td>Downstream-1</td><td>pinll, FRT5</td><td>pinll, FRT5</td><td>PinII</td><td>PinII</td><td>PinII</td><td>PinII</td><td>pinll, FRT1</td><td>pinll, FRT1</td><td>PinII</td><td>PinII</td><td>PinII</td><td></td><td></td>

<td>Coding-1</td><td>NoATG / FRTl / aadA</td><td>NoATG / FRTl / GUS</td><td>NoATG / FRTl / GFPm</td><td>NoATG / FRT5 / GUS</td><td>NoATG / FRTl / GFPm</td><td>NoATG / FRTl / BAR</td><td>N0ATG / FRT6 / GUS</td><td>NoATG / FRT5 / GUS</td><td>NoATG / FRT6 / GFPm- C3-intron</td><td>NoATG / FRT6 / GFPm- C3-intron</td><td>NoATG / FRTl / GUS</td><td></td><td></td>

<td>PHP</td><td> 10259</td><td> 10603</td><td> 10859</td><td> 10997</td><td> 11003</td><td> 11204</td><td> 11561</td><td> 11633</td><td> 1699</td><td> 11809</td><td> 12190</td><td></td><td></td>

ES 2 245 487 T3

The results in Table 5 indicate that the frequency and level of GUS expression vary between different cases, as could be predicted for genes inserted at different positions in the genome. The prediction is that once a high-frequency, high-expression line is identified, the expression of genes subsequently introduced at those same sites will also be higher than in other cases of lower expression.

C) Stable integration of a second DNA sequence flanked by two non-identical FRT sequences in plant cells

A subset of the stable transgenic "target lines" described in Example 4 above was used in experiments aimed at stably reorienting to these primary target lines a new gene flanked by the same FRT sites used in the target lines and cloned into a second plasmid " substrate ”of construct. Table 7 lists the constructs contained in the primary target lines (from Table 2), the FRT sites contained in these lines, and the substrate plasmids (from Table 6) that were subsequently reoriented to the target lines.

Table 8 presents data from stable transgenic cases demonstrating satisfactory and reproducible targeting of introduced sequences to previously created genomic target sites. The data shown is for 18 independent target lines, each retargeted with a promoterless GUS construct. Since the bar gene was simultaneously introduced into the same plasmid, the proportion of GUS-expressing cases out of the total cases recovered with bialophos selection provides a measure of the reorientation frequency relative to random integration.

TABLE 7

<td>Target construct</td><td>FRT sites</td><td>Substrates being evaluated</td>

<td>PHP9643</td><td> 1/1/5</td><td> 10603, 10259, 10859, 10997, 11003</td>

<td>PHP11147</td><td> 1/5</td><td> 10603, 10859, 11003</td>

<td>PHP11407</td><td> 1/5</td><td> 10603, 11204, 12190</td>

<td>PHP 11410</td><td> 5/1</td><td> 11633</td>

<td>PHP11457</td><td> 6/1</td><td> 11561, 11699, 11809</td>

<td>PHP11893</td><td> 6/1</td><td>Ongoing experiments</td>

TABLE 8

<td>Diana lines</td><td>N ° of Random Cases</td><td>N ° of Cases Oriented</td><td>Orientation Frequency (%)</td>

<td>TO</td><td> 13</td><td> 1</td><td> 7,1</td>

<td>B</td><td> 14</td><td> 1</td><td> 6,7</td>

<td>C</td><td> 108</td><td> 14</td><td> 11,5</td>

<td>D</td><td> 18</td><td> 1</td><td> 5,3</td>

<td>AND</td><td> 14</td><td> 2</td><td> 12,5</td>

<td>F</td><td> 9</td><td> 1</td><td> 10,0</td>

<td>G</td><td> 65</td><td> 1</td><td> 1,5</td>

<td>H</td><td> 63</td><td> 9</td><td> 12,5</td>

<td>I</td><td> 71</td><td> 6</td><td> 7,8</td>

<td>J</td><td> 15</td><td> 1</td><td> 6,3</td>

ES 2 245 487 T3

TABLE 8 (continued)

<td>Diana lines</td><td>N ° of Random Cases</td><td>N ° of Cases Oriented</td><td>Orientation Frequency (%)</td>

<td>K</td><td> 33</td><td> 9</td><td> 21,4</td>

<td>L</td><td> 19</td><td> 2</td><td> 9,5</td>

<td>M</td><td> 8</td><td> 1</td><td> 11,1</td>

<td>N</td><td> 12</td><td> 1</td><td> 7,7</td>

<td>OR</td><td> 29</td><td> 4</td><td> 12,1</td>

<td>P</td><td> 43</td><td> 4</td><td> 8,5</td>

<td>Q</td><td> 16</td><td> 3</td><td> 15,8</td>

<td>R</td><td> 4</td><td> 1</td><td> 20,0</td>

<td>S</td><td> 12</td><td> 1</td><td> 7,7</td>

<td>T</td><td> 10</td><td> 1</td><td> 9,1</td>

<td>OR</td><td> 1</td><td> 2</td><td> 66,7</td>

Example 6

Evaluation of the impact of introduced FRT sequences on plant development, gene expression and agronomic behavior

Initial evaluation of the impact of the introduced sequences on plant growth and gene expression is done in the greenhouse by making regular observations through pollination and seed formation. Plants are both selfed and crossed with other genotypes to obtain T1 seeds for subsequent greenhouse and field evaluation. For the evaluation of gene expression, both qualitative and quantitative data are collected and analyzed. T1 seeds from transgenic cases that give acceptable or desirable levels of expression that do not show significant negative impact on plant development (for example, they have normal developmental morphology, are andro- and geno-fertile, etc.) are made are then grown in engineered field plots together with non-transgenic control plants, and standard agronomic performance data is collected and evaluated.

Example 7

Conversion of an Introduced Functional FRT Sequence to a Non-Identical Second Functional FRT Sequence

The system adopted here to develop a method for converting between different FRT sites for use in various applications is based on the previously described "chimeraplasty" strategy to make specific targeted nucleotide modifications to a specified strachomosomal or genomic target sequence in animal cells (Yoon and others (1996) Proc. Natl. Acad. Sci. 93: 2071-2076; Cole-Strauss et al. (1996) Science 273: 1386-1389). This ability in plants, as recently demonstrated in these laboratories, is beneficial in extending the potential use of the present invention to broader application. The proposed use of this "chimeraplasty" technology in the present invention would be to orient and modify nucleotides at a FRT site of a pair of non-identical FRT sites that flank a DNA sequence of interest in a way that then makes the two sites identical. FRT. Subsequent or simultaneous expression of FLP recombinase in cells with these FRT site modifications would lead to cleavage of the sequences between these now identical FRT sites, thereby specifically removing the undesirable DNA sequences from the previously created stable transgenic case containing those sequences. One application of such a system would be, for example, in the case of a selectable marker that is required during initial stages of a breeding or backcrossing program to maintain and select individual preferred plants, but which is not desired in the final product.

A) Design and construction of vectors to test chimeraplasty-based FRT site conversion

The target vectors for evaluating this FRT site modification strategy are specifically shown below, where P1 and P2 represent two different promoters, G1 and G2 represent two genes, and T1 and T2 represent two terminator regions; these regions are shown as white boxes. Different FRT sites are indicated and shown as dark boxes. One version of the construct incorporates a unique third FRT site downstream of the second gene

ES 2 245 487 T3 and is used to evaluate whether the targeted conversion, in this case, of FRT5 to FRT6 (SEQ ID No. 4), also results in conversion of the FRT1 site (SEQ ID No. 2) downstream into a FRT6 site (SEQ ID NO: 4). In the first case, the dispersion of the downstream gene (G1) must be detected, whereas if the conversion is not specific for FRT5 (SEQ ID No. 3) and the FRT1 site (SEQ ID No. 2) is also converted, then both gene activities will be lost. For the specific examples used herein, P1 is the corn ubiquitin promoter, P2 is the 35S CaMV-enhanced promoter, G1 is the uidA (GUS) gene, G2 is the bar gene, and T1 and T2 are pinII terminators. It is understood that based on the various previous vector construct descriptions in this application, a variety of different promoters, genes, terminators or DNA sequences or FRT sites could be used to implement this component approach. The DNA cassettes shown below could be assembled into a pUC-based plasmid for direct DNA delivery methods (such as particle bombardment) or into a binary vector for Agrobacterium-based transformation as previously described.

<img file="ES2245487T3_D0001.tif" />

B) Design of chimeric oligonucleotide molecules for chimeraplasty-based oriented conversion of an FRT site

Specific examples of chimeric molecules that would be used to modify a single nucleotide to convert the FRT5 site (SEQ ID NO: 3) to a FRT6 site (SEQ ID NO: 4) in constructs as described above are shown below. Both the linear sequence of these chimeric molecules and the predicted active form of the molecule are shown (based on earlier publications by Yoon et al. And Cole-Strauss et al.). DNA residues are represented in uppercase, RNA residues in lowercase and the site to be modified (a single nucleotide difference between FRT5, SEQ ID No. 3, and FRT6, SEQ ID No. 4) is underlined and in bold font. Two examples of chimeras that differ in the number of residues downstream of the FRT5 site (SEQ ID NO: 4) that could be included in the design of chimeric molecules and thus determine the specificity for the target sequence are represented below.

1. Chimeric oligonucleotide linear sequence (the sequence includes six residues specific for the target downstream of the FRT site that is modified in the target construct and must convert only this specific FRT5 site, SEQ ID No. 3, specific to a FRT6 site, SEQ ID No. 4)

5 'CCTATTCTTCAAAAAGTATAGGAACTTCAGTACTTTTTaguacugaaguu CCTATACTTTuugaagaauaggGCGCGTTTTCGCGC-3'

Active oligonucleotide conformation

TGCGCG - ggauaagaaguuTTTCATATCCuugaagucaugaT TT

TT

TCGCGC CCTATTCTTCAAAAAGTATAGGAACTTCAGTACTT 3 '5'

two. Chimeric oligonucleotide linear sequence (the sequence contains specific residues only for sequences at the FRT site and thus should convert any FRT5 site, SEQ ID No. 3, into a target molecule at a FRT6 site, SEQ ID No. 4)

5 'TATTCTTCAAAAAGTATAGGAACTTCTTTTgaaguuccuaTACTTTuuga agaauaGCGCGTTTTCGCGC-3'

ES 2 245 487 T3

Active oligonucleotide conformation

TGCGCG - auaagaaguuTTTCATauccuugaagT

TCGCGC TATTCTTCAAAAAGTATAGGAACTTCT 3 '5'

Vector constructs and chimeric oligonucleotide molecules as described above were generated and used in the experiments.

C) Demonstration of the conversion of one FRT site to another

Stable transgenic corn lines are generated with the above-described or related constructs by transforming into the constructs and selecting on bialophos as described above. Tissues to be used for the delivery of chimeras are transferred onto medium that does not contain bialophos and the chimeric oligonucleotides are delivered to cells of these stable cases by particle bombardment, together with the co-delivery of PHP5096 that supports an expression cassette of FLP functional recombinase. In control experiments, only chimeric molecules are contributed or only PHP5096. After sufficient time for cells to recover without bialophos selection, samples from the bombarded cases are evaluated for GUS expression. For those bombarded cases containing the downstream FRT1 site (SEQ ID NO 2) construct that does not show GUS expression, an equivalent cell sample is plated and grown on medium with or without bialophos selection for determine the sensitivity to the chemical. If the chimeric molecules are specific to modify only the FRT5 site (SEQ ID NO 3), then no differences in cell number and growth should be observed between treatments with or without selection. Otherwise, reduced growth and recovery should be noted.

D) Molecular verification of stable conversion of FRT sites

DNA from samples exhibiting GUS expression is isolated, amplified by PCR if necessary, and sequenced by standard methods through the region corresponding to the predicted nucleotide conversion. A sufficient stretch of DNA is sequenced to cover the entire originally introduced region of DNA to confirm correct and specific conversion. Using standard methods for PCR, Southern analysis and / or sequencing of samples that express and do not express GUS establishes the presence or absence of specific DNA fragments before and after the delivery of chimeric molecules and FLP recombinase, and thus substantiates the visual observations and Chemicals performed previously.

E) Utility of chimeraplasty-based conversion of FRT sites in a transgenic stacking strategy for plants

Outlined in Figure 1 is a potential strategy to combine or stack multiple desired transgenes at one genomic location using the non-identical FRT-based system of the present invention. Although gene stacking can be achieved without the use of the oriented FRT conversion method described in this example 7, this latter method extends the capabilities of the system by allowing in vivo conversion of FRT sites to create new sites, rather than reintroducing new sites. FRT by transformation. In the diagram of Figure 1, an FRT site with an asterisk next to it indicates that it was initially created to be non-functional with respect to recombination between it and the equivalent FRT site without an asterisk, but that during conversion with the based system in chimeraplasty described here it is made capable of recombination with its counterpart without an asterisk equivalent. In the specific example presented in the figure, this would facilitate, for example, the removal of a selectable marker so that it is never present or to allow the selectable marker to be reused in future transformations. Thus, this method also provides a mechanism for recycling selectable markers, which is only possible when using the FRT system of the present invention.

Analysis

To date, in plants, the main application of the FLP / FRT system has been for DNA cleavage (Lyznik et al. (1993) Nucleic Acid Res. 21: 969-975). For example, a gene such as a selectable marker flanked by FRT sites is first introduced into plant cells by one of several transformation systems and stable transgenic plants or cases are recovered through appropriate selection. Next, to remove the selectable marker gene, the FLP protein is expressed in cells transiently by introducing a plasmid carrying an FLP expression cassette, stably following the integration of an introduced FLP expression cassette, or by crossing plants carrying the FLP expression cassette. selectable marker gene flanked by FRT with plants bearing sequences for and expressing active FLP protein (US Pat. Serial No. 08 / 972,258 for "Novel Nucleic Acid Sequence Encoding FLP Recombinase").

ES 2 245 487 T3

A major problem associated with the development of the FLP / FRT system for integrating genes in animals or plants stems from the fact that the yeast FLP recombinase catalyzed recombination reaction is a reversible process (Sadowski (1995) in Progress in Nucleic Acid Research and Molecular Biology, 51: 53-91). For example, after the introduction of a DNA sequence flanked by similarly oriented FRT sites into plant cells in the presence of actively expressed FLP recombinase, the recombination should lead to the insertion of the new DNA sequences at the site. Endogenous FRT. However, with continued expression of the FLP enzyme, the reverse reaction would lead to re-excision of the introduced sequences due to recombination between the identical FRT sites. Since the reaction is reversible, integration and cleavage can continue repeatedly toward equilibrium. As cells divide and the concentration of DNA substrate per cell decreases, the likelihood of integration decreases, so in general, as long as active FLP protein is expressed, the reaction will move toward the unintegrated state. . To promote integration, a situation must be established that avoids re-excision once integration occurs. A number of strategies have been suggested, including limiting the duration of FLP recombinase activity through inducible expression or by directly introducing FLP protein or RNA into Sadowski cells (1995) in Progress on Nucleic Acid Research and Molecular Biology, 51 : 53-91), but to date a non-random integration system for plants has not been established.

The present invention describes the development of a new gene targeting system useful for plants that utilizes yeast FLP recombinase or a modified FLP recombinase designed to function more efficiently in certain plant species and new non-identical FRT sites that can be used for integration. directional non-reversible DNA. Additionally, a new use of ancillary technologies such as "chimeraplasty" that allow in vivo or in vitro modification of DNA sequences, such as FRT sites, is described herein to further extend the utility of the system. The data provided demonstrates successful stable integration of DNA sequences between two previously introduced non-identical FRT sites in maize. It is further shown that the DNA sequences between the FRT sites can subsequently be replaced by a second DNA sequence flanked by the same FRT sites as the first. Together, these results demonstrate that it is possible to introduce and retrieve non-identical FRT site pairs at certain genomic positions, that desirable or preferred genomic positions can be selected to express DNA sequences of interest, and that these selected positions can be used to reorient other DNA sequences. of interest. Aside from the obvious benefits of being able to integrate genes into the plant genome, The present invention provides means to facilitate the introduction of new genes or DNA sequences at genomic positions previously determined to be particularly beneficial for gene integration from the perspective of providing adequate levels of stable expression of the introduced gene (s) and not exhibit detrimental impacts on agronomic characteristics including yield. Furthermore, the invention provides a system whereby the integration of two or more genes can be directed to the same genomic location, providing a mechanism for "gene stacking". These stacked genes can then be kept and manipulated as a closely connected pair of traits in breeding programs. Thus, this invention also provides an improved method of introducing, maintaining, and reproducing multiple genetic traits of interest, including agronomic traits, commercially important genes, or other heterologous gene products.

The invention further provides to use the non-recombination characteristic of non-identical FRT sites to allow the creation of a group of "parental" lines, which are initially well characterized for all the desired behavioral and expression parameters described above. These lines then serve as the basis for the introduction of new traits at the same predefined sites in the genome where the initial genes were introduced. Far fewer cases need to be generated, as integration would preferentially occur at sites that are shown to be well expressed and have minimal negative impact on behavior.

Although the foregoing invention has been described in some detail by way of illustration and example for the purposes of clarity of understanding, it will be obvious that certain changes and modifications may be implemented within the scope of the appended claims.