Dna encoding kappa-casein, process for obtaining the protein and use thereof.

IS 2 188 592 T3

DESCRIPTION

DNA that codes for Kappa-Casein, a process for obtaining the protein and using it.

This invention relates to the DNA sequence that codes for a polypeptide comprising the amino acid sequence SEQ ID NO: 2 or an analogue or variant thereof, with a sequence identity with said polypeptide of at least 95% and an activity biology of human kappa-casein. In a specific embodiment, the DNA sequence codes for a polypeptide having the amino acid sequence 21-152 of SEQ ID NO: 2 cited below. The DNA sequence is advantageously used in the production of recombinant human kappa-casein or an analog or variant thereof, as described below, or through a prokaryotic or eukaryotic production system, or advantageously produced by means of mammals. transgenic non-humans, for example bovine species such as cows. A primary use of recombinant human kappa-casein is as a constituent of an infant formula used to feed infants as a substitute for human milk. When used as a constituent of an infant formula, recombinant human kappa-casein is expected to provide a substantial improvement in the nutritional and biological value of the formula, in the sense that a milk more closely resembles human milk is obtained. Human proteins were also envisioned to be used in a number of other embodiments due to the advantageous properties of human kappa-casein and can be used, for example, as drugs.

Background of the invention

It is known that breastfeeding in humans is considered superior to feeding babies with formulations. Human milk not only provides a balanced source of nutrients, it is also easily digestible by the baby. Thus, several biologically active components with known physiological functions in the baby are either constituents of human milk, or are produced during its digestion, including components involved in the defense against infections and components that facilitate the assimilation of milk nutrients. human.

Despite the great efforts made to prepare formulations for babies, it has not been possible to produce a formulation that in a substantial way has all the advantageous properties of human milk. Thus, baby formulations, often prepared from cow's milk, are generally incompletely digested by the drinker and lack substances known to have an effect on the baby's physiological functions. In order to obtain a formulation for babies with a nutritional value similar to that of human milk, a series of additives are included in the formulation, including proteins, protein fragments, vitamins, minerals, etc., which are normally formed or they assimilate during the digestion of human milk by the baby, with the consequent risk of forcing important organs such as the liver or kidneys, and possibly causing long-term damage to these organs. Another disadvantage associated with the use of formulations based on cow's milk is the increased risk of allergy induction against bovine proteins in the baby.

As an alternative to formulations for babies based on cow's milk, human milk that can be obtained from so-called milk banks has been used. However, feeding newborns with human milk from milk banks has been increasingly avoided in recent years, for fear of the presence of infectious agents such as HIV and VMC in human milk. To destroy infectious agents in human milk, it has become necessary to pasteurize the milk before use. However, pasteurization decreases or eliminates the nutritional value and biological effects of dairy components. Therefore, human milk is used even less.

Currently, commercially available human milk replacement formulations are based primarily on the protein constituents of cow's milk. These infant formula compositions have led to difficulties in terms of nutrient balance, bioavailability of nutrients, and sensitivity of human infants to non-human / animal proteins. Specifically, the allergic reactions to non-human animal proteins used in these formulations for babies have caused the protein component of commercial formulations to be changed and formulations based on soy protein to be prepared, although many babies are allergic to cow's milk as well. they are allergic to soy-based milks (Am. Acad. of Pediatrics Comm. on Nutrition, Pediatrics 72, 359-362 (1983)).

Furthermore, many of the problems in the use of cow's milk proteins are associated with digestibility difficulties due to the content and structure of bovine casein (L.Hambraeus, E.Forsum and B.Lonnerdal, in: “Food and Immunology "[" Food and Immunology "], pages 116-124 (Eds. L. Hambraeus, LA Hanson and H. McFarlane) Almquist and Wiksell (1977)).

IS 2 188 592 T3

This has led to the production of formulations for babies that contain a higher proportion of serum protein, being easily digested by human babies (MJ Newport and MJ Henschel, Pediatric Res. 18, 658-662 (1984)), or with little or no bovine casein. However, the main protein in cow's milk whey is beta-lactoglobulin. This protein is essentially absent from human milk and has been found to be a major cause of childhood allergy to cow's milk (I. Axelsson, I. Jakobsson, T. Lindberg and B. Benediktsson, Acta Pediatrica Scand. 75, 702-707 (1986)). The severity of allergy problems to cow's milk-based formulations can be seen from the fact that soy-based formulations form a significant part of the market for human baby formulations in the United States.

The formulations based on soy proteins, although different in their sources of carbohydrates and proteins, are similar in composition to the protein formulations of cow's milk according to recommendations, of the American Academy of Pediatrics, Committee on Nutrition [“American Academy of Pediatrics, Nutrition Committee ”], for nutrient levels in baby formulas. Existing differences include a slightly higher protein level and a slightly lower carbohydrate content. The protein source is generally soy protein; lipids are a mixture of vegetable oils; and the carbohydrate source is usually sucrose, corn syrup solids, or a mixture of both. However, the use of soy-based formulations tends to raise serum alkaline phosphatase and blood urea levels in babies, in addition to causing allergic and digestibility problems with the use of protein formulations for babies of bovine origin.

Human milk presents marked differences with that of other mammalian species, including that of the cow, since it has a lower total protein content and a lower casein / serum ratio, as well as a different protein composition. For example, subclasses of casein from human milk include only beta-casein and kappa-casein (Miller et al., 1990). The amino acid compositions of human milk proteins also differ from those of other mammalian milk proteins.

Kappa-casein is a glycosylated protein that is present in the milk of several species, including man. Human kappa-casein has been shown to contain several (up to 10) glycid prosthetic groups, distributed throughout the peptide chain instead of 0-5 as in the case of cow and sheep kappa-casein.

A number of different biological activities have been proposed for kappa-casein and kappa-casein peptides. For a review of the literature, see for example Miller et al., 1990, and Fiat and Jollies, 1989. Kappa-casein has been shown to exhibit a calcium binding site (Fitzgerald and Swaisgood, 1989). Examples of other functions of kappa-casein, or fragments of it released during digestion, are the inhibition of gastrin secretion and, therefore, of acid secretion in the stomach (Stan et al., 1982), a regulatory effect on gastrointestinal hormones and, therefore, on the release of enzymes from the exocrine pancreas (Yvon et al., 1987), growth-promoting effects on Lactobacillus bifidus pennsylvanicus (Bezkorovainy et al., 1979) and Bifidus infantis (Azuma et al., 1984), antagonistic activity on opioids (Chiba et al., 1989), inhibition of the angiotensin 1-converting enzyme (ACE) (Marayama et al., 1987), inhibition platelet aggregation (Jollíes et al., 1986), immunostimulating properties (Jollíes et al., 1982), and various antimicrobial effects (Miller et al., 1990). A digestion product (kappa-caseinoglycopeptide) of human kappa-casein has been found to inhibit the adhesion of certain bacteria, Streptococcus pneumoniae and Haemophilus influenza, to the epithelial cells of the human respiratory tract (Aniansson et al., 1990).

It would be desirable to be able to prepare a formulation for babies with a composition similar to that of human milk and thus avoid the aforementioned drawbacks, associated with formulations for babies based on bovine milk, for example, a formulation comprising proteins of human milk. However, this would require that human milk proteins could be obtained in large quantities. Although human milk proteins can be purified directly from human milk, it is neither a realistic nor sufficiently economical method to obtain the large amounts required for the production of large-scale formulations, and other methods have to be developed before a formula for drinking containing human milk proteins can be prepared.

Chobert et al. Isolated in 1976 the so-called caseinomacropieptides, the glycosylated C-terminal part of human kappa-casein, and determined part of its amino acid sequence. The complete sequence of the C-terminal part of human kappa-casein was determined by Fiat et al., 1980. The sequence3

ES 2 188 592 T3 cia of para-kappa-caselna, the N-terminal part of kappa-casein, was subsequently determined by Brignon et al., 1985. The complete sequence of native human kappa-casein has been reported to contain 158 amino acids. This sequence differs in total by 10 positions from the human kappa-casein polypeptide, as identified from SEQ ID NO: 2. In addition to these ten differences, the Brignon sequence does not have 4 amino acids in the N-terminal region and only comprises 158 residues, compared to the 162 residues at 21-182 of SEQ ID NO: 2. An analysis using the GCG GAP software program, calculated an identity of 93.7% with the default parameters, and an identity of 94.3% with the final weight parameter, which also takes into account the spaces at the ends. .

Several milk protein genes, mainly from rodents and dairy animals, have been cloned and sequenced, but little is yet known about the genes that code for human milk proteins. Hall et al., 1987, published the sequence of the human alpha-lactalbumin gene. Menon and Ham, 1989, disclosed the isolation and sequencing of a partial cDNA clone encoding human beta / casein, the complete cDNA sequence was subsequently determined by Lonnerdal et al., 1990. Formulations are described in WO91 / 08675. for human babies containing recombinant human alpha-lactalbumin and beta-casein. The human lactoferrin cDNA sequence was published by Powell and Ogden, 1990. The cloning of the salt-stimulable human milk bile lipase cDNA was published by Nilsson et al., 1990. Menon et al., 1991, reported an mRNA from which a part of the amino acid sequence can be deduced (3 'end ) of human kappa-casein.

Brief description of the invention

It is an object of the present invention to provide a means of producing high yield recombinant human kappa-casein.

Accordingly, in one aspect, the present invention relates to an expression system comprising a 5 'flanking sequence of a mammalian milk protein gene and a DNA sequence encoding a polypeptide comprising the sequence of amino acids 21-182 of SEQ ID NO: 2 or an analog or variant thereof, which has at least a 95% sequence identity with said polypeptide and a biological activity of human kappa-casein, the 5 'flanking sequence being capable of mediating the expression of said DNA sequence.

A transgenic cell or animal contains one or more transgenes within its genome. A transgene is a DNA sequence integrated into one location in a genome, where the transgenic DNA sequence would not otherwise normally be found at that locus in that genome. Transgenes can be composed of heterologous DNA sequences (sequences normally found in the genome of other species) or homologous DNA sequences (sequences derived from the genome of the same species). The existence of transgenic animals has been made known. For example, US Patent No. 4,736,866 discloses a transgenic mouse containing a c-myc oncogene. Other reports on transgenic animals include PCT Publication No. WO 82/04443 (rabbit beta-globin gene, DNA fragment injected into the pronucleus of a mouse zygote); EPO N Publication^° 0 246 166 (Hepatitis B surface antigen and tissue plasminogen activation genes under control of serum aecid protein promoter for specific expression in breast tissue); EPO N Publication^° 0 247 494 (transgenic mice containing heterologous DNA encoding various forms of insulin); PCT Publication N^° WO 88/00239 (tissue-specific expression of DNA encoding factor IX under control of a serum protein promoter); PTC N published^° WO88 / 01648 (transgenic mammal with mammary secretory cells incorporating a recombinant expression system comprising a lactogen-inducible mammary regulatory region and a structural region encoding a heterologous protein); EPO N published^° 0 279 582 (tissue-specific expression of chloramphenicol acetyltransferase under control of rat beta-casein promoter in transgenic mice); WO91 / 03551 (production of a growth hormone in transgenic animal milk) and WO 91/08216 (production of recombinant polypeptides by bovine species and transgenic methods).

As used herein, a "recombinant polypeptide" (or the recombinant DNA sequence encoding it) is a "heterogeneous polypeptide." Heteréologous polypeptides are polypeptides that are not normally produced by the transgenic animal. An example of a hetereologous polypeptide consists of human milk proteins, such as kappa-casein.

Each of the hetereologous or homoeologous polypeptides is characterized by specific amino acid and nucleotide sequences. It should be understood, however, that such sequences include naturally occurring allelic variations thereof and variants produced by recombinant methods in

ES 2 188 592 T3 that such nucleic acid and polypeptide sequences have been modified by the substitution, insertion and / or deletion of one or more nucleotides in such nucleic acids to cause the substitution, insertion or deletion of one or more nucleic acids to cause the substitution, insertion or deletion of one or more amino acid residues in the recombinant polypeptide. When the term DNA is used in the text below, it should be understood that for a number of purposes where DNA can be substituted for RNA, the term DNA should be read as including RNA embodiments, which will be apparent to the person skilled in the art. The matter.

A DNA sequence encoding a polypeptide comprising the amino acid sequence, SEQ ID NO: 2 or an analog of said DNA sequence, which

1) hybridizes with the DNA sequence shown in SEQ ID NO: 1 or a specific part thereof under stringent hybridization conditions, or

2) encodes a polypeptide, the amino acid sequence of which is at least 85% homologous with the amino acid sequence SEQ ID NO: 2, or

3) constitutes an effective subsequence of said DNA sequence, it can encode a polypeptide with a biologic activity of human kappa-casein.

A DNA sequence of the invention will be determined on the basis of a cDNA clone isolated from a human mammary gland DNA library. The procedure used for the isolation of the human kappa-casein cDNA sequence is outlined in broad strokes in Example 3.

The stringent hybridization conditions referred to above are to be understood in their conventional meaning, that is, hybridization is carried out at 67 C in 2xSSC with a final wash at 67 C in IxSSC using the method specified in "Definition" part of the Examples described below.

The term "homolog" is used herein to illustrate the degree of identity between the amino acid sequence of a given polypeptide and the amino acid sequence shown in SEQ ID NO: 2. The amino acid sequence to be compared with the amino acid sequence shown in SEQ ID NO: 2 can be deduced from a DNA sequence, for example obtained by hybridization as defined above, or it can be obtained by conventional sequencing methods. of amino acids. The degree of homology is preferably determined from the amino acid sequence of a mature polypeptide, that is, without taking into account any leader sequence. It is preferred that the degree of homology is at least 95% or even 98% with the amino acid sequence shown in SEQ ID NO: 2.

The term "effective subsequence", as used previously herein, refers to a subsequence that encodes a peptide that is at least partially functional with respect to the activities of human kappa-casein as defined. below. The subsequence can be the result of truncation at either end of a DNA sequence or the deletion of one or more nucleotides or nucleotide sequences within the DNA sequence. Preferably, when encoding a peptide with a biological activity of human kappa-casein, the effective subsequence comprises at least 15 nucleaotides, such as at least 20 nucleaotides.

The subsequences with biological activity of human kappa-casein can also be larger and comprise for example at least 50 nucleaotides such as at least 75, 100 or 125 nucleotides, for example 150 nucleotides.

The term "biological activity" of human kappa-casean is to be understood to include, but is not limited to, one or more combinations of two or more of the disclosed activities of human kappa-casein, such as "activity antimicrobial "," opioid activity "," immunostimulatory activity "," calcium binding activity "and" micelle-forming activity "of human kappa-casein and / or human kappa-casein derived peptides.

The term "antimicrobial activity" indicates the ability of kappa-casein to inhibit the adhesion, colonization, or growth of pathogens such as bacteria, viruses, or parasites. The "antimicrobial activity" can be determined as disclosed in Anianson et al., 1990.

IS 2 188 592 T3

The term "opioid activity" indicates the ability of kappa-caselna-derived peptides to bind to opiate receptors (affinity for opiate receptors). "Opioid activity" can be determined as disclosed in Chiba et al., 1989.

The term "immunostimulatory activity" indicates the ability of human kappa-casein to stimulate immunological reactions such as phagocytosis by macroephages and the differentiation of B and cells.

T.

The term "calcium binding activity" indicates the ability of human kappa-casein to bind, transport and deliver calcium ions, while the term "micelle-forming activity" indicates the ability of human kappa-casein to form micelles. by itself or together with other milk proteins. These micelles can play important roles in the transport and delivery of ions, vitamins, lipids, peptides, polypeptides, minerals, trace elements, and growth factors.

In this regard, it should be noted that the terms "opioid activity", "antimicrobial activity", "immunostimulating activity", "calcium binding activity", "micelle formation activity" and related terms should be understood as qualitative and / or quantitative, that is, they relate primarily to the nature of the activity, such as the nature of the biological activity, and / or the level of activity of the polypeptide, determined with reference to human kappa-casein. Regarding the digestive fragments of human kappa-casein, their biological activity is also of the same quantitative / qualitative nature as that attributed in the literature to digestive fragments of human kappa-casein with, for example, antimicrobial activity. or opioid, respectively.

In this sense, the term "digestive fragment" refers to the peptide fragment (s), which are generated naturally during the digestion of human kappa-casein by the baby that is fed with human milk. Such fragments can be prepared, for example, by cleavage of recombinant human kappa casein, by expressing DNA sequences encoding such fragments, or by use of conventional peptide synthesis.

In another aspect, the present invention refers to a polypeptide produced by a DNA sequence of the invention, preferably a recombinant polypeptide comprising the 21-182 amino acid sequence of SEQ ID NO: 2 or a variant or analogue of said sequence of amino acids having at least a 95% sequence identity with said polypeptide and a biological activity of human kappa-casein as defined above. In a specific embodiment, the invention also relates to a recombinant polypeptide having the amino acid sequence 21-182 of SEQ ID NO: 2. The variant and subsequence have been defined in detail above and are defined later in this document in greater detail.

In yet another aspect, the present invention relates to a method for the production of a transgenic non-human mammal capable of expressing a recombinant polypeptide of the invention, comprising the injection of a mammalian expression system as defined above, in a fertilized egg or cell of a non-human mammalian embryo in order to incorporate the expression system in the germ line of the non-human mammal and develop the fertilized and injected egg or embryo in an adult female non-human mammal.

In other aspects, the present invention relates to a DNA sequence encoding a polypeptide as defined herein, a replicable expression vector that carries and is capable of expressing such a DNA sequence, a cell containing said vector, a method for the production of the polypeptide, a method for producing a non-human transgenic animal capable of expressing the polypeptide, such a transgenic animal per se, milk from such a transgenic animal, an infant formulation comprising a polypeptide as defined herein, a method for the isolation of a polypeptide as defined herein, and the polypeptide itself.

Detailed description of the present invention

The expression system according to the invention can be an expression system comprising a 5 'flanking sequence of a mammalian milk protein gene and a DNA sequence encoding a polypeptide comprising the 21-182 amino acid sequence of SEQ ID NO: 2 or an analog or variant thereof having at least 95% sequence identity with said polypeptide and human kappa-cayenne biological activity, the 5 'flanking sequence being capable of mediating the expression of said DNA sequence.

IS 2 188 592 T3

As discussed in detail below, the expression system according to the invention is, for many purposes, preferably an expression system in which the DNA sequence contains at least one intron sequence, and preferably contains at least one intron sequence. a permissive signal for RNA splicing. In particular, the present invention relates to an expression system, in which the introon sequence or sequences are selected from the intron sequences presented in SEQ ID NO: 3 and / or SEQ ID NO: 4, such as a system of expression encoding a polypeptide comprising or being the amino acid sequence of SEQ ID NO: 2.

In a preferred embodiment, the mammalian expression system according to the invention is one in which the DNA sequence is combined with a regulatory element of a gene encoding a mammalian milk proteon to form a hybrid gene that it is expressible in the mammary gland of an adult female of a non-human mammal that contains said hybrid gene such that the polypeptide encoded by the DNA sequence is produced when the hybrid gene is expressed. For example, the gene encoding laoctea proteon may be one selected from caseone genes or serum acid proteon (WAP) genes. The present invention also encompasses the hybrid gene itself.

As mentioned above, the expression system is preferably one in which the encoded polypeptide analog or variant is at least 85% homoologous to the amino acid sequence SEQ ID NO: 2. Another way of expressing the close structural relationship with the DNA sequence, SEQ ID NO: 2, is by referring to hybridization: The expression system is preferably a system such that the DNA sequence coding for the polypeptide hybridizes with the sequence of DNA, SEQ ID NO: 1, or a part thereof, under stringent hybridization conditions.

The amino acid sequence deduced from the nucleotodic sequence shown in SEQ ID NO: 1 is different in eight positions compared to the published sequence that has been determined by amino acid sequencing (Brignon et al., 1985). Based on the proposed signal-site of peptidase cleavage, it is suggested that the peptide chain contains four more amino acid residues than previously published (Brignon et al., 1985). If so, the amino acid sequence at the N-terminal end is identical to the rat, and very similar to those reported for other species, with the following amino acid sequence Glu-Val-Gln-Asn. Menon et al., 1991, have disclosed an mRNA sequence from which a part of the amino acid sequence (3 'end) of human kappa-caseone can be deduced.

An interesting DNA sequence translatable into a human kappa-caseone polypeptide is a sequence comprising a human kappa-caseone gene or a part thereof capable of expressing human kappa-caseone. Accordingly, in yet another aspect, the present invention relates to a DNA sequence comprising a DNA sequence shown in SEQ ID NO: 3 and a DNA sequence shown in SEQ ID NO: 4 and which optionally also comprises a DNA sequence that links SEQ ID NO: 3 to SEQ ID NO: 4. This can be done, for example, as described in Example 7.

An interesting embodiment comprises a modified DNA sequence which differs from the previous DNA sequence in that at least one nucleotide has been deleted, substituted or modified, or at least one additional nucleootide has been inserted so that a DNA sequence results that encodes for a polypeptide having human kappa-caseone biological activity.

A DNA sequence comprising a human kappa-caseone gene or an effective subsequence thereof that contains elements capable of expressing a polypeptide with human kappa-caseone activity or a digestive fragment thereof, or an anaologue of said sequence DNA, and can

1) hybridize with the DNA sequence shown in SEQ ID NO: 1 or a specific part thereof under stringent hybridization conditions, or

2) encode a polypeptide, the amino acid sequence of which is at least 85% homologous to the amino acid sequence shown in SEQ ID NO: 2, or

3) constitutes an effective subsequence of said DNA sequence, which encodes a polypeptide that exhibits a biological activity of human kappa-caseone.

One aspect of the invention relates, inter alia, to a DNA sequence encoding a polypeptide comprising the 21-182 amino acid sequence of SEQ ID NO: 2 or an analog or variant

ES 2 188 592 T3 thereof having at least 95% sequence identity with said human kappa-casein and polypeptide biologic activity. In one embodiment, the DNA sequence comprises at least one intron sequence; In another embodiment, the DNA sequence contains at least one permissive RNA splicing signal.

In a preferred embodiment, the DNA sequence substantially comprises the DNA sequence shown in SEQ ID NO: 1. Alternatively, the DNA sequence may be a modified DNA sequence that differs from a DNA sequence, as defined above, in that a nucleotide has been deleted, substituted or modified or at least one additional nucleotide has been inserted such that results in a DNA sequence encoding a polypeptide, which has a sequence identity of at least 95% with the amino acid sequence 21-182 of SEQ ID NO: 2, and exhibiting a biological activity that is similar, increased, or reduced compared to a biological activity of human kappa-caseone.

In the present context, the term "gene" is used to indicate a DNA sequence involved in the production of a polypeptide chain and that includes the regions that precede and are after the coding region (sequences 5'-upstream and 3 ' -descending sense) as well as the intermediate sequences, the so-called introns, which are located between the individual coding segments (the so-called exons) or in the 5'-ascending or 3'-descending region. The 5'-upstream region comprises a regulatory sequence which controls the expression of the gene, topically a promoter. The 3'-downstream region comprises sequences which are involved in the termination of the transcription of a gene and, optionally, sequences responsible for the polyadenylation of the transcript and the 3 'untranslated region.

The aforementioned regulatory or expression regulatory sequences, in addition to controlling transcription, also contribute to the stability and processing of RNA, at least to the extent that they are also transcribed.

Such expression regulation sequences are selected to produce tissue-specific or specific expression of certain cell types of the recombinant DNA. Once a tissue or cell type is selected for expression, the 5 'and optionally 3' expression regulatory sequences are selected. In general, such expression regulation sequences are derived from genes that are expressed primarily in the selected tissue or cell type. Preferably, the genes from which said expression regulation sequences are obtained are expressed substantially only in the selected tissue or cell type, although secondary expression in another tissue and / or cell type is acceptable if the expression of the recombinant DNA in the transgene in said tissue or cell type is not detrimental to the transgenic animal. Especially preferred expression regulatory sequences are those that are endogenous to the species of animal to be manipulated. However, expression regulatory sequences from other species, such as those from human genes, can also be used. In some cases, the expression regulatory sequences and the structural DNA sequences (either genoomic or cDNA) are from the same species, eg, each from bovine species or of human origin. In such cases, the expression regulatory sequences and the DNA sequence are homologous to each other. Alternatively, the expression regulatory sequences and DNA sequences (be they cDNA or genomic DNA) are obtained from different species, for example, a bovine expression regulatory sequence, and a DNA sequence of human origin. In such cases, expression regulation and DNA sequence are heterologous to each other. The expression regulatory sequences from endogenous genes are defined below. Such definitions are also applicable to the expression regulatory sequences of heteroologous, non-endogenous genes.

In general, the 5 'expression regulatory sequence includes the transcribed portion of the endogenous gene upstream of the translation initiation sequence (the 5' untranslated region or 5 'RNT) and those flanking sequences upstream from there, which they comprise a functional promoter. As used herein, a "functional promoter" includes those necessary, non-transcribed DNA sequences that direct the binding of RNA polymerase to the endogenous gene to promote transcription. Such sequences topically comprise a TATA sequence or a box generally located about 25 to 30 nucleotides from the transcription start site. The TATA box is also sometimes called the proximal signal. In many cases, the promoter further comprises one or more distal signals located upstream of the proximal signal (TATA box) which are necessary to initiate transcription. Such promoter sequences are generally contained within the first 100 to 200 nucleootides upstream of the transcription start site, but can extend up to 500 to 600 nucleotides or more from the transcription start site. Such sequences are easily locatable for those skilled in the art or easily identifiable by standard methods. This document refers to such sequences

ES 2 188 592 T3 promoters, alone or in combination with the 5 'untranslated region, as "proximal 5' expression regulatory sequences".

In addition to such proximal 5 'expression regulatory sequences, the inclusion of additional 5' flanking sequences (referred to herein as "distal 5 'expression regulatory sequences") in the transgene is preferred. Such 5 'proximal expression regulatory sequences are believed to contain one or more enhancer sequences and / or other sequences that facilitate the expression of the endogenous gene and, as a consequence, facilitate the expression of the structural DNA sequence operably linked to the regulatory sequences. of the distal and 5 'proximal expression. These 5 'expression regulatory sequences regulate the spatial and temporal distribution of genic expression. The amount of distal 5 'expression regulation sequences depends on the endogenous gene from which the expression regulatory sequences are derived. In general, however, such sequences comprise 5 'flanking regions of about 1 kb, more preferably 16 kb and more preferably about 30 kb of 5' flanking sequence. The determination of the optimal amount of 5 'distal expression regulatory sequences used for any specific endogenous gene is easily obtained by varying the amount of distal 5' expression regulatory sequence until the maximum expression is obtained. In general, the regulatory sequence of distal 5 'expression will not be so long as to extend into an adjacent gene and will not include DNA sequences that adversely affect the expression level of the transgene.

Furthermore, the inclusion of 3 'expression regulatory sequences is preferred to supplement tissue-specific or specific expression of certain cell types. Such 3 'expression regulatory sequences include 3' proximal and 3 'distal expression regulatory sequences of an appropriate endogenous gene. Proximal 3 'expression regulation sequences include transcribed but untranslated DNA located downstream of the transcription stop signal in the recombinant DNA sequence (also referred to as the 3' untranslated region or 3 'RNT). Such sequences generally end in a polyadenylation sequence (from the endogenous gene or from another source, such as SV40) and sequences that can affect RNA stability. In general, 3 'RNTs comprise about 100 to 1000 nucleootides or more downstream of the translation stop signal in the gene from which the 3' regulatory sequence is derived. The distal 3 'expression regulatory sequences include DNA flanking sequences downstream of the proximal 3' expression regulatory sequence. Some of these distal sequences are transcribed, but are not part of the mRNA, while other sequences in this distal 3 'expression regulatory sequence are not transcribed at all. Such 3 'distal expression regulatory sequences are believed to contain enhancer sequences and / or other sequences that enhance expression. Such sequences are believed to be necessary for efficient polyadenylation and to contain transcription termination sequences. Preferably such sequences comprise about 2 kb, more preferably 8 kb and more preferably about 15 kb of 3 'flanking sequence.

Although the use of both 3 'and 5' expression regulatory sequences is preferred, in some embodiments of the invention, endogenous 3 'regulatory sequences are not used. In such cases, the 3 'proximal expression regulatory sequences normally associated with the genoomic DNA encoded by the recombinant DNA sequence are used to direct polyadenylation. Furthermore, the 3 'distal regulatory sequences of the genoomic DNA that encode for the recombinant polypeptide can also preferably be used in the same amounts as those indicated for the 3' endogenous expression regulatory sequences. In such cases, it is to be understood that the transgene-encoded recombinant polypeptide may comprise both genomic DNA and a double-stranded DNA derived from the cDNA. As with 5 'expression regulatory sequences, the optimal amount of 3' expression regulatory sequence can be easily determined by varying the amount of flanking 3 'sequence to obtain maximum expression of the recombinant polypeptide. In general, the distal 3 'regulatory sequence, derived from an endogenous gene or a heteroologous gene, did not extend into the adjacent gene from which it was derived and excluded any sequence that adversely affects the expression level of the transgene.

In addition to the 5 'and 3' expression regulatory sequences, and the recombinant DNA (be it genoomic or derived from cDNA), the transgenes of the invention preferably also comprise an introon sequence that disrupts the transcribed region of the transgene. Intermediate recombinant sequences, however, also comprise a "hybrid intervening sequence". Such hybrid intervening sequences comprise a 5 'RNA splicing signal and a 3' RNA splicing signal from intervening sequences of heterologous or homologous origin.

Such intermediate hybrid sequences containing permissive RNA editing signals are preferably used when the recombinant DNA corresponds to a cDNA sequence.

IS 2 188 592 T3

Based on the above, it appears that preferred transgenes include large amounts of expression regulatory 5 'and 3' sequences. Furthermore, the recombinant DNA is preferably derived from genomic clones that can be tens to hundreds of kilobases in length. Using current technology for DNA cloning and manipulation, the construction and microinjection of transgenes is practically limited to linearized DNA, with a length not exceeding about 50 kb. However, the transgenes of the invention, especially those with a length greater than about 50 kb, can be easily generated by introducing two or more overlapping fragments of the desired transgene into an embryonic target cell. When introduced this way, the overlapping fragments undergo homologous recombination resulting in the integration of the fully reconstituted transgene into the target cell genome. In general, it is preferred that such overlapping transgenic fragments have 100% homology in those regions where they overlap. However, lower sequence homology can be tolerated as long as efficient homologous recombination is given. If there is non-homology between fragments of homologous sequences, it is preferred that the non-homology is not spread throughout the homologous sequence portion, but is localized in discrete areas. Although only 14 base pairs of 100% homology are sufficient for homologous recombination in mammary cells (Rubnitz, J. and Subramani, S. (1984) Mol. Cell. Biol. 4, 2253-2258), more portions are preferred lengths of homologous sequence, for example 500 bp, and more preferably than 1000 bp, follows in order of preference 2000 bp and more preferably more than 2000 bp for each portion of homologous sequence.

When the transgene of the invention encodes a recombinant polypeptide encoded by recombinant DNA derived from or corresponding to genoamic DNA (or which is substantially comprised of such genetic sequences, for example, more than about 50%, more preferably greater than about 75%, and more preferably greater than 90% of the codons that code for the recombinant polypeptide are of genetic sequences), molar concentrations and protein levels in transganic bovine milk are the same as for cDNA or higher. In general, the molar concentration of the recombinant polypeptide in such transganic milk is preferably greater than about 50 µΜ, more preferably greater than about 150 µ, and most preferably greater than about 500 µ. From the point of view of the protein level in the transganic milk, the levels are preferably greater than about 1 mg / ml, more preferably greater than about 2.5 mg / ml, and more preferably greater than 5 mg / ml.

The above molar concentrations and protein levels in transganic bovine milk will vary depending on the molecular weight of the particular recombinant polypeptide. A particular advantage of recombinant polypeptide production in transganic bovine milk is that relatively high molecular weight polypeptides can also be produced, which would otherwise be difficult to produce in large quantities in other systems such as prokaryotic expression systems.

The mouse, however, normally produces between 55 and 80 milligrams of protein per ml of milk. A cow, on the other hand, normally produces between 30 and 34 milligrams of protein per ml. Since exceptionally high levels of recombinant polypeptide production can adversely affect endogenous milk protein production and / or have adverse effects on the secretory mammary gland, it is preferred that the recombinant polypeptide concentration is between approximately 1 and 50% of the protein concentration. from normal bovine milk (i.e. approximately 0.3 to 17 milligrams of recombinant polypeptide per ml of transgaenic milk), more preferably between 10 and 20% (that is, between 3 and about 7 milligrams per ml) and more preferably between 10 and 15% (that is, between about 3 and 5 milligrams per ml) of the normal amount of protein produced in bovine milk. Such preferred ranges also provide a preferred upper limit at the aforementioned levels of protein produced in transganic bovine milk.

The term "effective subsequence" of the gene should be understood in the same way as defined above with reference to DNA sequence.

Hybridization can be carried out as described in the "Definition" part of the Examples, below, preferably on the basis of a probe containing the coding part of the DNA sequence shown in SEQ ID NO: 1 more go ahead. The terms "homologous" and "effective subsequences" are used in a manner similar to that defined above.

Preferably, the polypeptide encoded by the DNA sequence analog is at least 95% or even 98% homologous to the amino acid sequence shown in SEQ ID NO: 2.

Examples of specific analogs of the DNA sequence of the invention are the DNA sequences

ES 2 188 592 T3 that comprise an essential part, or the complete DNA sequence shown in SEQ ID NO: 1 specially adapted for its expression in a bacterium such as E.coli, yeast, mammalian cell system or in a transgenic animal. This DNA sequence is such that, when inserted into the expression system together with suitable regulatory sequences, it results in the expression of a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an analog or variant of yourself, as described above.

As mentioned above, the DNA sequence shown in SEQ ID NO: 1 encodes a polypeptide comprising the functional domain (s) of human kappa-casein, as well as the signal peptide naturally associated with the same. While the presence of the signal peptide in most cases is a prerequisite that allows the polypeptide expressed from the DNA sequence to be transported outside the cell in which it is produced, the nature and origin of the specific signal peptide The use can vary and does not necessarily have to be the signal peptide naturally associated with human kappa-caselna.

According to the foregoing, a particularly interesting DNA sequence of the invention is a DNA sequence that codes for a polypeptide comprising amino acids 21-182 in SEQ ID NO: 2, that is, the amino acids that correspond to kappa -mature human case.

Human kappa-casein is highly glycosylated at the serine and threonine residues at the C-terminus, and this glycosylated part of kappa-casein is believed to provide the molecule with its antimicrobial effect.

The glycosylation of a recombinant polypeptide is dependent on the expression system selected. It is well known that eukaryotic cells of different species and / or of different tissue origin show variation in the glycosylation machinery. Therefore, to achieve the glycosylation modifications of interest, it is critical to select a host organism for the production of the recombinant molecule, which has the ability to carry out the appropriate post-translational glycosylation modifications.

However, there are methods available that allow modification of the glycosylation machinery of a host organism. This can be done by altering the genome of the host organism, for example a host cell or a transgenic animal, by introducing recombinant genetic elements. These genetic elements can encode additional or modified glycosyltransferases or other involved enzymes, and mediate their expression, or inhibit the function of endogenous glycosyltransferases or other involved enzymes. Inhibition can be achieved by deleting gene functions of endogenous glycosyltransferase genes or by introducing vectors that display RNA sequences that are complementary to endogenous glycosyltransferase mRNA species, and thus function as antisense RNA.

The polypeptide encoded by the modified DNA sequence typically has a different amino acid sequence from the amino acid sequence of human kappa-casein. It should be understood that a modified DNA sequence of the invention will be important in the preparation of new polypeptides with modified activity compared to human kappa-casein or digestive fragments thereof or other similarly important activities.

When a "substitution" is made, one or more nucleotides in the entire nucleotide sequence are substituted with one or more different nucleotides; when an "addition" is carried out, oneomeas nucleotides are added at either end of the complete nucleotide sequence; when an "insertion" is carried out, one or more nucleotides are inserted into the complete nucleotide sequence; and when a "deletion" is made, one or more nucleotides from the entire nucleotide sequence are removed, either at either end of the sequence or at any appropriate site within it.

A modified DNA sequence can be obtained by well known methods, for example, using site-focused mutagenesis.

An example of an important modified DNA sequence of the invention is a DNA sequence in which additional codons coding for serine or threonine residues have been inserted resulting in a modified DNA sequence coding for a polypeptide with an increased number of residues. to be glycosylated and / or phosphoryl . Additional residues can be inserted by addition at either end or within a DNA sequence of the invention, or by substituting one or more non-serine or non-threonine codons present in a DNA sequence of the invention. A polypeptide

ES 2 188 592 T3 encoded by such a modified DNA sequence is expected to have a higher degree of glycosylation and / or phosphorylation. The polypeptide produced from such a modified DNA sequence can be used as a nutritional supplement and / or as a drug, for example, in combination with a pharmacologically acceptable carrier or vehicle by methods well known in the art.

Another example of an interesting modified DNA sequence is a DNA sequence that codes for an amino acid sequence of a variant of a natural human kappa-casein with a different amino acid sequence than that shown in SEQ ID NO: 2. For this purpose, site-focused mutagenesis would be carried out using specific oligonucleotide probes that provide exchange / removal of the relevant amino acid residues.

Another important use of a DNA sequence of the invention as defined above is the preparation of a fusion protein comprising, on the one hand, a polypeptide comprising the amino acid sequence 21-182 of ID SEQ NO: 2 or a analogue or subsequence thereof as defined above and, on the other hand, a polypeptide of another origin, for example, a polypeptide or peptide part of another milk protein, for example, a human dairy protein such as alpha-lactalbumin, or a dairy protein such as a bovine or ovine dairy protein such as bovine kappa-casein. The fusion protein can be prepared by fusing a DNA sequence of the invention with a DNA sequence that codes for the other part of the fusion protein and the appropriate regulatory sequences in such a way as to allow expression of the protein to take place. of fusioín.

The DNA sequences of the invention explained herein may comprise both natural and synthetic DNA sequences, the natural sequence typically deriving directly from cDNA or genomic DNA, usually mammalian, for example as described below. A synthetic sequence can be prepared by conventional methods for the synthetic preparation of DNA molecules. Obviously, the DNA sequence can also be of mixed cDNA and genomic DNA, mixed cDNA and synthetic, and mixed genomic and synthetic origin. RNA sequences can also be used as described above.

The terms "sequence", "subsequence", "analog" and "polypeptide" as used herein with respect to sequences, subsequences, analogs and polypeptides according to the invention are evidently to be understood as not understanding these phenomena in their environment. natural, but mine well, for example, in isolated, purified, in vitro or recombinant forms. When referring to a DNA sequence of the invention, it should be understood to include "analogs", "subsequences" and "modified sequences" as defined above. Analogously, when referring to "a polypeptide of the invention" is to be understood to include any of the polypeptides defined below.

In another important aspect, the present invention relates to a polypeptide encoded by a DNA sequence as defined above. An especially interesting polypeptide of the invention is a recombinant human kappa-casein polypeptide comprising the amino acid sequence shown in ID SEQ NO: 2 or a subsequence thereof having a biological activity of human kappa-casein. An example of a polypeptide comprising a significant subsequence of said amino acid sequence is a polypeptide comprising amino acid residues 21-182 of the amino acid sequence shown in ID SEQ NO: 2 corresponding to a mature recombinant human kappa-casein without a Peptid signal.

As will become apparent from what was previously revealed, Another interesting polypeptide of the present invention is one that differs from a polypeptide comprising amino acid sequence 21-182 of SEQ ID NO: 2 in that at least one amino acid residue has been replaced by a different amino acid residue and / or in that at least one amino acid residue has been removed or added so as to result in a polypeptide comprising an amino acid sequence that is different from amino acid sequence 21-182 of SEQ ID NO: 2 but has at least 95% sequence identity with said polypeptide and having a similar or increased biological activity compared to the activity of human kappacasein. Examples of a strategy for the design and preparation of modified polypeptides of the invention will be apparent from the above disclosed.

Another interesting polypeptide of the present invention is one in which at least one amino acid residue has been modified by post-translational modification, such as by glycosylation, phosphorylation, acetylation or methylation. Obviously, the polypeptide can undergo a type of post-translational modification. In a certain presently preferred embodiment, the polypeptides of the invention are preferably in glycosylated form. Normally, glycosylation is achieved when the

ES 2 188 592 T3 polypeptide is expressed by a cell of a higher organism such as yeast or preferably a mammal as described above.

The glycosylation is normally found on amino acid residues Asn, Ser, Thr, or hydroxylysine.

In a further aspect, the present invention relates to a replicable expression vector that carries and is capable of mediating the expression of a DNA sequence encoding human kappa-casein.

In the present context, the term "replicable" means that the vector is capable of replicating itself in a given type of host cell into which it has been introduced. Immediately upstream of the human kappa-casein DNA sequence, a sequence encoding a signal peptide can be provided, the presence of which ensures secretion of the human kappa-casein, expressed by the host cells containing the vector. The signal sequence may be that naturally associated with the DNA sequence of human kappa-casein or of other origin.

The vector can be any vector that is conveniently subjected to recombinant DNA procedures, and the choice of vector often depends on the host cell into which it is to be introduced. Therefore, the vector could be an autonomous replication vector, that is, a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication; examples of such a vector are a plasmid, phage, coismid, mini-chromosome, or virus. Alternatively, the vector could be one which, when introduced into a host cell, integrates into the host cell genome and replicates together with the chromosome (s) into which it has integrated. Examples of suitable vectors are bacterial expression vectors, for example, as illustrated in Example 5, and expression vectors designed for expression in mammalian cell systems, for example as illustrated in Example 6. The vector of the invention could carry any of the DNA sequences of the invention as defined above and be used for the expression of any of the polypeptides of the invention defined above.

The present invention, thus, also refers to a replicable expression vector selected from the group consisting of the expression vectors called pS 330, 339, 415 and 425 and which have been deposited on January 20, 1993, in the collection of Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM) under the accession numbers DSM 7410, DSM 7411, DSM 7412 and DSM 7413, in accordance with the provisions of the Budapest Treaty, and expression vectors that express DNA sequences that differ from the DNA sequences of said deposited expression vectors, but that encode the same polypeptide or an analog or variant thereof that has a sequence identity of at least 95%. with said polypeptide and a biological activity of human kappa-casein as well as a replicable expression as defined above, wherein the expressed DNA sequence differs from the deposited vector DNA sequence in that at least one nucleoitide has been deleted, substituted or modified or at least one additional nucleotide has been inserted so as to result in a DNA sequence encoding a polypeptide having at least 95% sequence identity to said polypeptide and exhibiting kappa-casein biological activity.

Furthermore, the present invention relates to a plaismide selected from the group consisting of a plaismid named pS 270, which has been deposited on January 20, 1992 in the collection of Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM) under the number access code DSM 6878 in accordance with the provisions of the Budapest Treaty, the plaísmids called pS 459 and 460, which have been deposited on January 20, 1993, in the collection of Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM) under accession numbers DSM 7414 and DMS 7415, in accordance with the provisions of the Budapest Treaty, and plaismids that have a DNA sequence that differs from the sequence DNA shown in SEQ ID NO: 1, but encoding the polypeptide shown in SEQ ID NO: 2 or an analog or variant thereof that has a sequence identity of at least 95% with said polypeptide and a biological activity of human kappa-casein.

The present invention further relates to a cell containing a replicable expression vector as defined above. In principle, this cell can be of any cell type, that is, a prokaryoitic cell such as a bacterium, for example E.coli, a unicellular eukaryotic organism, a fungus or yeast, for example Saccharomyces cerevisiae, or a cell derived from a multicellular organism, for example a mammal. Mammalian cells are especially suitable and are discussed in more detail below.

In another important aspect, the invention relates to a method for the production of recombinant human kappa-casein, in which a DNA sequence encoding human kappa-casein is

ES 2 188 592 T3 inserted into a vector that is capable of replicating in a specific host cell, the resulting recombinant vector is introduced into a host cell that is grown in or on an appropriate culture medium under conditions appropriate for the expression of kappa -human caseona, and human kappa-caseona is recovered. The medium used to culture the cells may be a suitable conventional medium for this purpose. A suitable vector could be any of the vectors described above, and an appropriate host cell could be any of the cell types listed above. The methods used to construct the vector and affecting its introduction into the host cell could be any of the known methods for such purposes within the field of recombinant DNA, examples of which are given in Examples 5 and 6. The recombinant human kappa-caseone expressed by the cells can be secreted, that is, exported across the cell membrane, depending on the type of cell and the composition of the vector. The method described above is equally useful for the production of any of the polypeptides of the invention as defined above, that is, on the basis of a DNA sequence of the invention.

If human kappa-caseone is produced intracellularly by the recombinant host, that is, it is not secreted by the cell, it can be recovered by standard procedures that include cell disruption by mechanical means, for example sonication or homogenization, or by enzymatic means or chemicals followed by purification.

To be secreted, the DNA sequence encoding human kappa-caseone must be preceded by a sequence encoding a signal peptide, the presence of which ensures the secretion of human kappacaseone from cells such that at least a significant proportion of the Expressed human kappa-caseone is secreted into the culture medium and recovered.

In a further aspect, the present invention relates to a method for the production of a polypeptide of the invention that comprises the insertion of a DNA sequence, as defined above, into a vector that is capable of replicating in a specific host cell. , for the introduction of the recombinant vector that results in a host cell, and culturing the resulting cell in or on an appropriate culture medium under the appropriate conditions for the expression of the polypeptide and for its recovery.

A method of isolating a recombinant polypeptide having the amino acid sequence SEQ ID NO: 2 or an anaolog or variant thereof, which has a biological activity of human kappa-caseone from mammalian, bacterial or yeast cells, in the which is produced intracellularly in substantial amounts, may comprise the separation of cells containing the recombinant polypeptide from the culture medium, disruption of the separated cells to further release their recombinant polypeptide content, optionally removal of cell debris from the mixture of disrupted cells, and isolation of the polypeptide. A method in which human kappa-caseone is isolated from a culture of bacterial, mammalian, or yeast cells and in which human kappa-caseone is produced extracellularly in substantial quantities, can be performed essentially as described in general lines. above, replacing the separation and breakdown steps with a step in which bacterial, mammalian or yeast cells are removed from the culture medium.

The present invention also refers to a polypeptide that comprises the amino acid sequence 21-182 of SEQ ID NO: 2 or an analog or variant thereof that has at least a 95% sequence identity with said polypeptide and a biological activity. of human kappa-caseóna. Furthermore, the present invention relates to a polypeptide according to the invention in which at least one amino acid residue has been replaced with a different amino acid residue and / or in which at least one amino acid residue has been removed or added so that a polypeptide is obtained that comprises an amino acid sequence different from the amino acid sequence 21-182 of SEQ ID NO: 2, but having at least 95% sequence identity with said polypeptide and human kappacaseone biological activity.

In particular, the present invention refers to a recombinant polypeptide according to the invention in which at least one amino acid residue has been modified by post-translational modification such as glycosylation.

Although recombinant production of human kappa-caseone as disclosed above and described in Examples 5 and 6 using lower organisms such as bacteria or yeast or mammalian cell lines as production organisms, is satisfactory for some purposes, for example when moderate yields of human kappa-caseone are sufficient, when short-term production is desirable or when substantially high purity human kappa-caseone is desirable

ES 2 188 592 T3 free of other substances derived from mammals such as proteones, specifically milk proteones, the currently preferred method for the production of recombinant human kappa-caseone of the invention is through the use of non-human transgenic mammals capable of excreting kappa-caseon human in her milk. The use of non-human transgenic mammals has the advantage that high yields of recombinant human kappa-caseone can be obtained at reasonable cost and especially when the non-human mammal is a cow, goat, sheep, lama, camel, mouse, rat , rabbit, or pig, that recombinant human kappa-caseone is produced in milk, which is the normal constituent of, for example, infant formulations, thus, its extensive purification is not required when recombinant human kappa-caseone is used as a nutritional supplement in milk-based products. Furthermore, the production in a higher organism, such as for example a non-human mammal, normally leads to the correct processing of the mammalian proteon, for example, with respect to the post-translational processing as discussed above and to its correct folding. Furthermore, large amounts of substantially pure human kappa-caseone can be obtained.

In accordance with the foregoing, in another important aspect, the present invention relates to a mammalian expression system comprising a DNA sequence encoding human kappa-caseone inserted into a gene encoding a mammalian milk proteon. so that it forms a hybrid gene that is expressible in the mammary gland of an adult female of a non-human mammal that contains said hybrid gene.

The DNA sequence encoding human kappa-caseone is preferably a DNA sequence as defined above, encoding a polypeptide comprising the amino acid sequence 21-182 of SEQ ID NO: 2 or an anaolog or variant of the same, as discussed above.

The mammary gland as expression tissue and the genes that encode for lacteal proteons are generally considered especially suitable for use in the production of heterologous proteones in non-human transgenic mammals, since lacteal proteons are produced naturally at high levels of expression. in the mammary gland. Furthermore, the milk is easily collected and was available in large quantities. In this sense, the use of milk proteon genes in the production of recombinant human kappa-caseone has the additional advantage that it is produced under conditions similar to those of its natural production in terms of regulation of expression and localization of production ( the mammary gland). In the present context, the term "hybrid gene" indicates a DNA sequence comprising, on the one hand, a DNA sequence encoding human kappa-caseone as defined above and, on the other hand, a DNA sequence of the a lacteal proteon gene that is capable of mediating the expression of the hybrid gene product. The term "gene encoding a milky proteon" or "milky proteon gene" indicates an entire gene, as well as an effective subsequence of it, which is capable of mediating and directing the expression of a hybrid gene towards the tissue of interest. that is to say, towards the mammary glandula. The laoctea proteon gene may be the gene for beta-lactoglobulin, for alpha-lactalbumin or for a caseone, but the gene for serum acid proteon is especially preferred. Typically, the effective subsequence is such that it contains at least one or more promoter regions, a transcriptional start site, 3 'and 5' noncoding regions, and framework sequences. The DNA sequence encoding human kappa caseone was preferably free of prokaryotic sequences, such as vector sequences, which may be associated with the DNA sequence after, for example, cloning thereof. The hybrid gene is preferably formed by in vitro insertion of the DNA sequence encoding human kappa-caseone into a laocteal proteone gene by techniques known in the art. Alternatively, the DNA sequence encoding human kappa caseone can be inserted in vivo by homologous recombination.

Typically, the DNA sequence encoding human kappa-caseone was inserted into one of the first exons of the chosen laoctea proteon gene or into an effective subsequence thereof comprising the first exons and preferably a substantial part of the 5 'flanking sequence. , which is believed to be important in regulation.

The hybrid gene preferably comprises a sequence encoding a signal peoptide that allows the hybrid gene product to be secreted correctly in the mammary gland. The signal peptide would be topically the one normally found in the milk proteon gene in question or one associated with the DNA sequence encoding human kappa-caseone. However, other signal sequences capable of mediating the secretion of the hybrid gene product to the mammary gland are also relevant. Obviously, the various elements of the hybrid gene should be fused in such a way as to allow the correct expression and processing of the gene product. Thus, normally the DNA sequence that codes for the chosen signal peptide must be precisely fused to the N-terminal part of the signal.

ES 2 188 592 T3 DNA sequence encoding human kappa-casein. In the hybrid gene, the DNA sequence encoding human kappa-casein will normally comprise its stop codon, but not its own polyadenylation and message cleavage site. Downstream of the DNA sequence encoding human kappa casein, the processing mRNA sequences of the milk protein gene will normally remain.

A series of factors are considered as those responsible for the current level of expression of a specific hybrid gene. The capacity of the promoter, as well as of other regulatory sequences as mentioned above, the integration site of the expression system in the mammalian genome, the integration site of the DNA sequence that codes for human kappa-casein in the The gene that codes for milk protein, the elements that provide post-transcriptional regulation and other similar factors can be of vital importance in the level of expression obtained. On the basis of the knowledge of the various factors that influence the expression level of the hybrid gene, the person skilled in the art would know how to design an expression system useful for the present purpose.

The mammary gland secretes a variety of different milk proteins. There are two main groups of milk protein, the casein and the serum protein. The composition of the milk of different species varies qualitatively as well as quantitatively with respect to these proteins. Most non-human mammals produce 3 different types of casein, alpha-casein, beta-casein, and kappa-casein. The most common bovine serum proteins are alpha-lactalbumin and beta-lactaglobulin. The composition of milk of various origins is further disclosed in Clark et al., 1987.

The milk protein gene to be used can be derived from the same species into which the expression system will be inserted, or it can be derived from another species. In this sense, the regulatory elements that direct gene expression to the mammary gland have been shown to be functional across species boundaries (which may be due to a possible common ancestor) (Hennighausen et al., 1990).

Examples of suitable genes that code for a milk protein or effective subsequence of the same to be used in the construction of an expression system of the invention are found, among the serum proteins of mammals of diverse origins, for example a serum protein gene. aecid (WAP), preferably of murine origin, and a beta-lactoglobulin gene, preferably of ovine origin. Casein genes of various origins can also be found, which are suitable for the transgenic production of human kappa-casein, for example bovine aS1-casein and rabbit beta-casein. The currently preferred gene is the murine WAP gene, since it has been found to be capable of providing a high level of expression of a series of foreign proteins, of human origin, in milk from different transgenic animals (Hennighausen et al., 1990).

Another sequence preferably associated with the expression system of the invention is a sequence called expression stabilizer, capable of mediating high-level expression. There are clear indications that such stabilizing sequences are found near and upstream of the milk protein genes.

The DNA sequence encoding a human kappa-casein to be inserted into the expression system of the invention can be of cDNA, of genetic or synthetic origin, or any combination thereof. While some expression systems have been found to perform better when using the cDNA encoding the desired protein, others have found that the presence of introns and other regulatory regions is required to obtain satisfactory expression (Henninghausen et al., 1990 ). In some cases it may be favorable to introduce genoemic structures into constructed vectors, compared to cDNA elements (Brinster et al., 1988). The structure of introen and exeon can result in higher mRNA levels in dynamic equilibrium than those obtained when using cDNA-based vectors.

In the specification, the term "introen" includes the whole of a natural intréon or a part of it.

A hybrid gene comprising a DNA sequence encoding human kappa casein can be inserted into a gene encoding a mammalian milk protein, the DNA sequence being inserted into a dairy protein gene in such a way that it can be expressed in the mammary gland of an adult female of a non-human mammal that contains the hybrid gene. The hybrid gene and its constituents have been discussed in detail previously. The hybrid gene constitutes an important intermediary in the construction of an expression system of the invention, as has been disclosed

ES 2 188 592 T3 earlier in this document.

In another aspect, the present invention relates to a non-human mammalian cell containing an expression system as defined above. The mammalian cell is preferably an embryonic cell or a pro-nucleus. The expression system is suitably inserted into a mammalian cell using a method such as the one explained below.

In another important aspect, the present invention relates to a method for the production of a non-human transgenic mammal capable of expressing human kappa-casein, which comprises the injection of an expression system of the invention, as defined above, in a fertilized egg or in a cell of a non-human mammalian embryo in order to incorporate the expression system in the germ line of the non-human mammal and develop the resulting fertilized and injected egg or embryo into a non-human mammal adult female.

In another important aspect, the present invention relates to a method for the production of a non-human transgenic mammal capable of expressing a polypeptide comprising the amino acid sequence 21-182 of SEQ ID NO: 2 or an analog or variant thereof. having at least 95% sequence identity with said polypeptide and human kappa-casein biological activity, said method comprising the chromoemic incorporation of a DNA sequence encoding the polypeptide into the genome of a non-human mammal.

A further embodiment of the method described above comprises the chromoemic incorporation of another DNA sequence encoding beta-casein or an analog, variant or subsequence thereof in the genome of a non-human mammal. This embodiment should not be limited to a DNA sequence encoding beta-casein or an analog, variant, or subsequence thereof but could comprise essentially any appropriate DNA sequence encoding a desired recombinant polypeptide.

One method comprises the injection of an expression system that encodes kappa-casein or an analog, variant or subsequence of it and another DNA that encodes beta-casein or an analog, variant or subsequence thereof, in a fertilized egg or cell of a non-human mammalian embryo in order to incorporate the expression system in a germ line of the non-human mammal and develop the fertilized and injected egg or embryo that results in a female adult non-human mammal.

In another important embodiment, the present invention relates to a method comprising 1) destroying the expression capacity of the endogenous kappa-casein of the non-human mammal so that substantial amounts of the endogenous kappa-casein are not expressed and the insertion of an expression system of the invention in the germ line of the non-human mammal in such a way that the polypeptide comprising the amino acid sequence 21-182 of SEQ ID NO: 2, or an analogue or variant thereof that has at least 95% sequence identity with said polypeptide and a human kappa-casein biological activity, is expressed in the non-human mammal, or 2) the substitution of the gene encoding the endogenous kappa-casein, or part thereof, with an expression system of the invention thereby rendering the non-human mammal substantially incapable of expressing the corresponding endogenous polypeptide. A method can be imagined by which the ability to express more of an endogenous polypeptide is destroyed. Endogenous polypeptides may be caseenic aoma such as alpha, beta or kappa-casein, but are not limited to these polypeptides.

Obviously, the method of destroying the expression capacity of the endogenous polypeptide can be combined with the method of expressing more than one recombinant polypeptide.

The "non-human mammals" of the invention comprise all non-human mammals capable of producing a "transgenic non-human mammal" having a "desirable phenotype". Such mammals include non-human primates, murine species, bovine species, canine species, etc. Preferred non-human animals are bovine, porcine and ovine species, most preferably bovine species.

Desirable phenotypes for transgenic non-human mammals include, but are not limited to, the production of recombinant polypeptides in the milk of transgenic non-human female mammals.

The transgenic non-human mammals of the invention are produced by introducing a "transgene" into the embryonic target cell of the animal of choice. In one aspect of the invention, a "transgene" is a DNA sequence that is capable of producing a desirable phenotype when contained in

ES 2 188 592 T3 the cell genome of a non-human transgenic mammal. In specific embodiments, the transgene comprises a "recombinant DNA sequence" that encodes a "recombinant polypeptide." In such cases, the transgene is capable of being expressed to produce the recombinant polypeptide.

Incorporation of an expression system into the germ line of the non-human mammal can be accomplished using any suitable technique, eg, as described in Hogan, B., Constantini, F. and Lacy, E. "Manipulating the Mouse Embryo. A Laboratory Manual ”[“ Handling the mouse embryo. A laboratory manual ”]. Cold Spring Harbor Laboratory Press, 1986 heard in W091 / 08216.

Methods of introduction of overlapping transgenes or transgene fragments into embryonic target cells include microinjection of the transgene into the pronuclei of fertilized oocytes or the nuclei of ES cells of the non-human animal. Such methods are well known to murine species to those of skill in the art. Alternatively, the transgene can be introduced into an animal by zygote infection with a retrovirus containing the transgene (Jaenisch, R. (1976), Proc. Natl. Acad. Sci. USA, 73, 1260-1264). The preferred method is microinjection of the fertilized oocyte. In this preferred embodiment, the fertilized oocytes are first microinjected by standard techniques. Afterwards, they are cultured in vitro until obtaining a “pre-implantation embryo”. Such pre-implantation embryos preferably contain about 16 to 150 cells. The embryonic stage of 16 to 32 cells is commonly known as myorula. Those pre-implantation embryos that contain more than 32 cells are commonly known as blasts. They are generally characterized by the development of a blastocellular cavity, typically at the 64-cell stage. Methods for culturing fertilized oocytes to the pre-implantation stage include those described by Gordon et al. (1984), Methods in Enzymology, 101, 414; Hogan et al. (1986) in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (for mouse embryo); and Hammer et al. (1985), Nature, 315, 680 (for rabbit and porcine embryos); Gandolfi and others (1987); J. Reprod. Fert. 81, 23-28; Rexroad and others (1988) J. Anim. Sci. 66, 947-953 (for sheep embryos); and Eyestone, WH et al. (1989) J. Reprod. Fert. 85, 715-720, Camous and others (1984)

J. Reprod. Fert. 72, 779-785; and Heyman, Y. et al. (1987) Theriogenology 27, 5968 (for bovine embryos). Such pre-implantation embryos are then transferred to an appropriate female by standard methods to allow the birth of a transgenic or chimeric animal depending on the stage of development into which the transgene is introduced. As is well known, mosaic animals can reproduce to form genuinely transgenic animals in the germ line.

As the frequency of transgene incorporation is often low, detection of transgene integration in the pre-implantation embryo is highly desirable. In one aspect of the invention, methods are provided for the identification of embryos in which transgenesis has occurred and which allow the implantation of transgenic embryos to form transgenic animals. In this method, one or more cells are removed from the pre-implantation embryos. When equitable division is used, the embryo is preferably not cultured beyond the myorula stage (32 cells). Division of the pre-implantation embryo (literature review in Williams et al. (1984) Theriogenology 22, 521-531) results in two "hemi-embryos" (hemi-myorula or hemi-blastocyst), one of which is capable of further development after implantation in a female suitable for developing in the uterus at term. Although even division of the pre-implantation embryo is preferred, it should be understood that such an embryo may intentionally or unintentionally divide unevenly into two hemi-embryos that do not necessarily have the same number of cells. Essentially, all that is required is that one of the embryos that is not tested, as described later in this document, has a sufficient number of cells to develop to term in utero. In a specific embodiment, the hemi-embryo that is not analyzed as described herein, if it is shown to be transgenic, is used to generate a clonesal population of non-human transgenic animals.

One of each of the hemi-embryos formed by division of the pre-implantation embryos is analyzed to determine if the transgene has integrated into the genome of the organism. Each of the other hemi-embryos is preserved for later implantation in a recipient female of the species.

The identification of pre-implantation embryos that contain the integrated transgene is achieved by DNA analysis of one of each of the hemi-embryos. Such DNA is typically obtained by lysing the hemi-embryo and analyzing the DNA thus released as described in Example 8. A polymerase chain reaction ("PCR,") is carried out to amplify all or part of the transgene. . When the entire transgene has been amplified, two primers are used for amplification.

ES 2 188 592 T3 extension, each complementary to opposite strands at opposite ends of the transgene. In general, the amplified DNA from the hemi-embryo is subjected to electrophoresis followed by hybridization with a labeled probe complementary to the transgene region between the two extension primers. This facilitates the determination of the size of the amplified DNA sequences, if any, and provides an indication of whether the transgene has integrated into the pre-implantation embryo from which the hemi-embryo was obtained (hereinafter called “hemi-embryo -GMO embryo ”). If integrated, the remaining untreated transgenic hemi-embryo is transplanted into a recipient parent. After development in the uterus, the transgenic non-human animal with the desired phenotype, conferred by the integrated transgene, is identified by an appropriate method in utero or after birth.

The previously described methods for the detection of transgenesis in preimplantation embryos provide inexpensive and rapid methods for generating non-human transgeonic animals, since they significantly reduce the number of pregnancies required to produce a transgenic animal and substantially increase the probability that an implanted embryon will produce a non-human transgenic animal. Such methods are especially important for those animals for which very low or non-existent frequencies of transgeonesis have been obtained, for example bovine species.

In an alternative embodiment, the previously described method for the detection of transgenesis in pre-implantation embryos is combined with embryonic cloning steps to generate a population of transgenic embryo clones that later can be implanted in recipient females to produce a population of clones of non-human transgenic animals that also have the same genotype. In this sense, it is to be understood that transgogenic embryos and / or non-human transgenic animals with the same "genotype" means that the genoomic DNA is substantially identical between the individuals of the embryo and / or the transgogenic animal population. It should be understood, however, that various somatic mutations can occur during mitosis that can produce variations in the genotype of one or more cells and / or animals. Thus, a population with the same genotype may present individual or subpopulation variations. After the identification of a hemi-embryo as a transgenic hemi-embryo, it is cloned. Such embryo cloning can be carried out in different ways. In a cloning method, the transgenic hemi-embryo is grown in the same or similar medium as that used to grow individual oocytes to the pre-implantation stage. The newly formed "transgenic embryo" (preferably a transgenic moorula) is then divided into "transgenic hemi-embryos" which can then be implanted into a recipient female to form clone populations of two non-human transgenic animals. Alternatively, the two transgeonic hemi-embryos obtained can be cultured again until the pre-implantation phase, divided, and recultured until the transgenic embryo phase. This procedure is repeated until the desired number is obtained from transgenic embryos of clones with the same genotype. Such transgenic embryos can then be implanted into recipient females to produce a population of non-human transgenic animal clones.

In a preferred method of cloning, the transgenic embryo is cloned by nuclear transfer according to the techniques of Prather et al. (1987) Biol. Reprod. 37, 859-866; Roble and others (1987) J. Anim. Sci. 64, 642-664. According to this method, nuclei of the transgenic embryo are transplanted into enucleated oocytes, each of which is subsequently cultured until reaching the blastocyst phase. At this point, the transgenic embryos can be subjected again to a new round of cloning by nuclear transplantation or they can be transferred to a recipient parent for the production of transgenic progeny having the same genotype.

In addition to the above methods for detecting early transgenesis, other methods can be used to detect transgenesis. Such methods include the analysis of tissues in the uterus or the postpartum analysis. The analysis in the uterus is carried out using several techniques. In one, transvaginal perforation of the amniotic cavity is performed with the aid of transvaginal ultrasound (Bongso et al. (1975) Vet. Res. 96, 124-126; Rumsey et al. (1974) J. Anim. Sci. 39, 386-391). This method involves the recovery of approximately 15 to 20 milliliters of amniotic fluid around day 35 and day 100 of gestation. This volume of amniotic fluid contains approximately 1,000 to 12,000 cells per ml from the urogenital tract, skin, and possibly lungs of the developing embryo. Most of these cells are dead. Such cells, however, contain genomic DNA that undergoes PCR analysis for the transgene as an indicator of successful transgenesis. Alternatively, fetal cells can be recovered by perforation of the chorion. This method can also be performed transvaginally and guided by ultrasound. In this method, a needle is used to pierce the recipient animal's placenta, in particular the placental structures, which are fixed against the vaginal wall. Such sampling should be carried out around day 60 of gestation in bovine species. The cells of

ES 2 188 592 T3 chorion, if necessary, are separated from the maternal tissue and subjected to PCR analysis for the transgene as an indicator of successful transgenesis.

Transgenesis can also be detected after birth. In such cases, integration of the transgene can be detected by performing an appropriate tissue biopsy, such as from the ear or tail of the putative transgenic animal. About one or two centimeters of the tail or about five to ten square millimeters of ear are obtained followed by southern blotting with a probe for the transgene according to the method of Hogan et al. (1986) "Manipulating the Mouse Embryo" [" Manipulation of the mouse embryo ”], Cold Spring Harbor Laboratory.

Normally not all injected eggs would develop into transgenic mammals capable of expressing human kappa-casein. Founder transgenic animals can be identified, for example as described in Example 8. About half of the mammals would be statistically male. Based on the identified transgenic individuals - male or female - the progeny can be determined and stable lines of transgenic animals established.

Once integrated into the germ line, the DNA sequence encoding human kappa-casein can be expressed at high levels to produce a properly processed and functional human kappa-casein. Transgenic females from which the recombinant polypeptide can be harvested can thus be reared in subsequent generations.

Gene targeting refers to the direct modification of a selected chromosomal locus of an endogenous chromosome of a cell by recombination homogenous with an exiogenous DNA sequence homologous with the selected endogenous sequence. Gene targeting has been used to enhance, modify, and disrupt the expression of endogenous genes (see Bollag et al. (1989) Ann. Rev. Genet. 23, 199-225 and WO92 / 03917 (homoyologous recombination in mammalian cells).

In another aspect, the present invention relates to a non-human transgenic mammal prepared by a method as described above.

The DNA used to produce transgenic cells and animals comprises genoymic DNA, rather than cDNA. This is because the expression of transgenes is preferentially limited to tissue-specific expression as well as time-specific expression. When the transgene is derived from genomic DNA, cis regulatory sequences, such as enhancers and other regulatory elements, located in introns or distant regions of the structural gene, can be included. Such regulatory sequences are lost during RNA transcription and processing and, correspondingly, are generally not available with cDNA-derived transgenes.

In another aspect, the present invention relates to a non-human transgenic mammal prepared by a method as described above.

While the transgenic non-human mammal of the invention in its broadest aspect is not restricted to any particular type of mammal, the mammal will normally be selected from the group consisting of mice, rats, rabbits, sheep, pigs, goats and cows. Larger animals such as sheep, goats, pigs and especially cattle are normally preferred for large-scale production of human kappa-casein, due to their high milk production. However, also mice, rabbits and rats can be interesting because the handling of these animals is simpler and results in transgenic animals much faster than when dealing with, for example, cows.

It is also within the scope of the present invention, the progeny of a non-human transgenic mammal as defined above, capable of producing human kappa-casein.

From the above explanation it would be clear that the present invention makes possible for the first time the production of milk from a non-human mammal comprising human kappa-casein, the importance and usefulness of which will become apparent from this context. Thus, in another aspect of the present invention milk from a non-human mammal comprising recombinant human kappa-casein is included. Of special interest is the milk of a non-human mammal that comprises a polypeptide of the invention as defined above, comprising the amino acid sequence 21-182 of SEQ ID NO: 2 or a polypeptide encoded by a DNA sequence or a analogue or subsequence thereof as defined above. Typically, the milk of the invention could be obtained from a transgenic non-human mammal of the invention as defined above.

IS 2 188 592 T3

From the foregoing explanation it will be clear that an important use of the polypeptide of the invention is as a nutritional supplement, in particular as a substituent for an infant formula. In particular, the present invention thus relates to an infant formulation comprising a polypeptide of the invention.

In an important embodiment, the present invention thus relates to a method for the production of a human infant formulation comprising a polypeptide comprising the amino acid sequence 21-182 of SEQ ID NO: 2 or an analog or variant of same that has at least a sequence identity of 95% with said polypeptide and a biological activity of human kappa-casein, together with at least one other constituent of infant formula selected from other milk proteans, gravestones, carbohydrates, vitamins, minerals and other essential nutrients to meet the nutritional requirements of a human baby, comprising the introduction of an expression system of the invention into the genome of a non-human mammary such that the DNA encoding the polypeptide comprising the amino acid sequence 21-182 of SEQ ID NO: 2 or an analog or variant of which it has at least a 95% sequence identity with said polypeptide and a human kappa-casean biologic activity, is capable of being expressed in a mammary gland of a non-human mammary, obtaining polypeptide expression from said non-human transgaenic mammary, producing and optionally purifying the polypeptide expressed by said non-human transgaenic mammary, and formulating the human infant formulation with said polypeptide.

In still another aspect, the present invention relates to an infant formulation comprising recombinant human kappa-casein, in particular a polypeptide of the invention as described above. In a specific embodiment, the human infant formulation comprises recombinant human beta-casein as well as recombinant human kappa-casein. The infant formulation can be prepared by adding recombinant human kappa-casein or polypeptide in purified or partially purified form to the normal constituents of the infant formulation. However, it is normally preferred that the infant formulation is prepared from milk of the invention as defined above, especially when said of bovine origin. The infant formula can be prepared using conventional procedures and contain any necessary additives such as minerals, vitamins, etc.

In another aspect, the present invention relates to a method for obtaining human kappa-casean which comprises collecting the milk of a non-human transganic mammary of the invention as defined above and the recovery of human kappa-casein from milk. The milk can be collected in any appropriate manner normally used during the collection of milk from the mother in question.

Preparation of infant formulation

The formulation of an infant formula based on bovine alpha-lactalbumin and casein has been defined (VS Packard, "Human Milk and Infant Formula", pages 147-154. Academic Press (1982)). It is suggested that serum and casean proteins are in a ratio of 60:40 or 0.9 weight percent alpha-lactalbumin to 0.6 weight percent casein for a total of 1.5 g protein / 100 ml of milk.

Calcium will preferably be in a chemical form that is biologically compatible and commercially available, for example from SIGMA Chemical Co., and should preferably be present at a minimum of 50 mg / 100 kcal. The minimum level of phosphorus is 25 mg / 100 kcal. The minimum and maximum amounts of sodium, potassium, and chlorine must be controlled as well. These levels are reached in the ranges 6-17, 14-34, and 11-29 milliequivalents (mEq), respectively, in a formulation that provides 670 kcal / liter. One milliequivalent is equal to the atoamic weight (in milligrams) of the element divided by the valence. The osmolarity - in moles of solute / liter - should not exceed 400 mOsm.

A caloric density of infant formulations of 670 kcal / liter appears to be almost optimal for normal full-term infants. The formulation should provide a preferred calcium-phosphorus ratio of not less than 1.1: 1.0 and not more than 2: 1. More preferably, the ratio is close to 1.5: 1, at least for most of the first year of life. By one year of age, the appropriate ratio will be closer to 1: 1.

Infant formulations can vary in composition, but within fairly narrow and precise limits. In general, as a complete substitute for human milk, the formulation preferably comprises 21

ES 2 188 592 T3 is actually proteone at 7-16% calories, lipids at 30-54% calories, linoleic acid at 2-3% calories, and the remaining calories from carbohydrate origin. The lipid component of the formulation preferably comprises various plant lipids. Because many food contaminants are lipid soluble, especially refined vegetable fats and oils provide better control of the content of formulations. To avoid the conversion of fatty acids from the cis form to the trans form, and the resulting loss of essential fatty acids, treatment at low (or ultra-high) temperature is preferred throughout the process.

A representative list of ingredients follows:

Water

Lactose (corn syrup or sucrose can be used)

Human alpha-lactalbumin

Human beta-caseone

Coconut oil Soybean oil

Modified corn starch Mono- and diglycoerides Soy lecithin Carrageenan

Sources of vitamins

Vitamin A Palmitate Vitamin D3

Alpha-Tocopheryl Acetate (Vitamin E)

Phytonadione (vitamin K)

TO^orascoorbic acid (vitamin C)

Thiamine chloride hydrochloride (vitamin B1)

Riboflavin

Cyanocobalamin (vitamin B12)

Niacinamide

Caolic pantothenate

Pyridoxine chloride (vitamin B6)

Biotin

TO^or foolic acid

Choline chloride

Mineral sources

IS 2 188 592 T3

Tribaesic, calcium phosphate Copper sulfate Ferrous sulfate Magnesium chloride Potassium chloride Potassium citrate Potassium iodide Zinc sulfate

The amounts of each of the listed ingredients are adjusted to keep each nutritional component within the FDA maximum and minimum recommendations (VS Packard, “Human Milk and Infant Formula”], pages 147 -154 Academic Press (1982)) and by the American Academy of Pediatrics (Am. Acad. Of Pediatrics Comm. On Nutrition. Pediatrics 72, 359-363 (1983)), as disclosed later (modified from the American Academy of Pediatrics, Committee on Nutrition: Commentary on Breast-Feeding and Infant Formulas. : Commentary on Breastfeeding and Infant Formulations "], including proposed standards for formulations. Pediatrics 57, 278 (1976)).

Carbohydrate sources include lactose (or dairy and serum products that contain lactose), sucrose, corn syrup solids (a source of glucose), and starch.

Appropriate thickening agents, emulsifiers, antioxidants, and compounds can be used to adjust the pH. In the United States, the conditions of use of additives in infant formulations are regulated under the Code of Federal Regulations (CFR), Title 21, Section 172.620 and Section 180. Vitamin additives for use in infant formulations are approved by the Food and Agricultural Organization (FAO). Processing, availability, and / or stability requirements in the specific nutritional system will dictate which starch will serve best.

FAO must also approve mineral sources for infant formulations. The suitability of any mineral additive will depend on the composition and moisture level of the food product. In addition, each food imposes its own requirements for flavor and / or textural stability. Oxidative rancidity is an ever-present problem in iron and / or copper fortified foods that contain unsaturated fats. Jelly is a potential problem in concentrated liquid infant formulations. Reduced iron or electrolyte iron, which works well for dry foods, will precipitate as a sediment in liquid formulation. FAO also recognizes the need for acids and bases to make pH adjustments; however, these adjustments must be taken into account when determining the total content of any given mineral.

Certain mineral compounds, for example calcium and phosphorus, are required in fairly high amounts in infant formulations. Other mineral elements are necessary only in trace amounts. Therefore, trace amounts of minerals in the ingredients of infant formula should be considered, along with those that may be added to waters used to reconstitute various dry ingredients. Water sources may or may not be treated for use for this purpose, depending on their overall quality. The quality of the water must be controlled, however, as well as the trace mineral content of the finished formulation.

When trace minerals are added to formulations, sulfated salts are normally used. However, acceptable levels of sulfate ions have not been specified (Anderson et al., 1982). Due to the potential to cause methemoglobinemia, nitrate salts are not commonly added to formulations. Trace amounts can be found in formulations made from plant products. Nitrates also exist and are occasionally found at elevated levels in some water sources. Copper is another potentially toxic component of water. However, any biologically acceptable salt composition is envisioned for use in the present invention.

IS 2 188 592 T3

Minerals commonly added to formulations include calcium, phosphorus, magnesium, iron, copper, iodine, zinc, potassium, sodium, manganese, and chlorine (as chloride). Conventional compositions of infant formulations require the addition of bovine or soy protein sources, which can present significant amounts of minerals, entrained together with the protein component. The presence of these minerals decreases the precision with which the mineral components present after the manufacture of an infant formula can be determined. Conventional methodologies, including electrodialysis, ion exchange, and ultrafiltration, are commonly used to separate proteones from minerals and other contaminants associated with them. The use of the recombinant DNA-derived human proteones of the present invention in human infant formulations reduces the amount of proteon purification required, thus providing a more accurate determination of mineral content and lower costs in proteon processing.

Formulations for premature babies

For preterm or low weight babies (less than 2500 g), the formulations are usually modified, with the evaluation of protein and mineral levels. The lactose level can preferably be lowered by one-third to one-half of the normal amounts, compensating for the difference with more easily absorbed carbohydrate sources, such as corn syrup solids. Fats, calcium, and phosphorus must be available in readily usable forms.

The caloric density is preferably 800-1000 kcal / liter; with approximately 11% calories from proteones and 50% from fat. In general, corn and soybean oils appear to be reasonably absorbed by premature babies. The polypeptides of the present invention are especially suitable for infant formulations for premature babies, since caseone proteones are more easily digested than serum proteones and thus constitute a very suitable source of proteone for premature babies, as well as for other purposes. wherein the aforementioned advantageous properties of human caseones are useful.

In addition to infant formulations, other food formulations can also be supplemented with recombinant polypeptides from transgenic bovine milk. For example, such recombinant polypeptides can be used to supplement common diet formulations.

Thus, the production of human kappa-caseone in the milk of transgenic bovine species provides a source of human kappa-caseone. Such human kappa-caseone can be purified from transgenic milk for the preparation of formulations. Alternatively, all GM milk can be used, preferably after pasteurization, in liquid or dry form.

Legends of the figures

Figure 1 shows the plasmid pS 270 containing the full-length cDNA fragment encoding human kappa-caseone, obtained as described in Example 3.

Figure 2 shows a circular map of plasmid pS459 containing genomic sequences of human kappa-caseone derived from purified phage 8, isolation solution # 42, cloned into SalI-digested pUC19, as described in Example 4. They are shown EcoRI restriction sites to target the kappa-caseone gene fragment. The arrow indicates the transcriptional direction of the kappa-caseone gene. The exons are indicated as solid segments and the nuomers indicate their position in the human kappa-caseone gene.

Figure 3 shows a circular map of plasmid pS460 containing genoomic sequences derived from the PCR-amplified region of the human kappa-caseone gene, cloned in XmaI and HindIII-digested pUC19, as described in Example 4. The restriction sites to target the kappa-caseone gene fragment. The arrow indicates the transcriptional direction of the kappacaseone gene. The exons are indicated as solid segments and the nuomers indicate their position within the human kappa-caseone gene.

Figure 4 shows a fossil map of the human kappa-caseone gene locus. The organization and position of the restriction enzyme sites of the exons and introns are shown. Exons are indicated as solid boxes numbered 1-5. The indicated restriction enzymes are E = EcoRI, A = AccI, X = XbaI, S = SacI, P = PstI, H = HindIII, K = KpnI. The plasmid origin of the two genoomic fragments is also indicated.

IS 2 188 592 T3

Figure 5 shows the restriction map of pS459 and the positions of the 18 different subclones, pS461-478, which were used for sequence analysis (Example 4). pS461-467 represent different HindIII fragments; pS468-470 represent different XbaI fragments; pS471-474 represent different EcoRI fragments, and pS475 and pS476 represent different PstI fragments; pS477 represents an AccI / EcoRI fragment; and pS478 represents an AccI fragment. All fragments were subcloned into pUC19. Key: H = HindIII, E = EcoRI, S = SacI, X = XbaI, P = PstI, A = AccI, K = KpnI.

Figure 6 shows the restriction map of pS460 and the positions of the 6 different subclones, pS479-484, which were used for sequence analysis (Example 4). pS479 and pS480 represent two different EcoRI fragments; pS481 represents a HindIII / AccI fragment; pS482 represents an AccI / SacI fragment; pS483 represents a HindIII / SbaI fragment; and pS484 represents an XbaI / SacI fragment. All fragments were subcloned into pUC19.

Key: E = EcoRI, A = AccI, X = XbaI, H = HindIII.

Figure 7 shows a circular map of the expression vector pS415, constructed as described in Example 5. This expression vector mediates the intracellular expression of recombinant human kappa casein in E.coli.

Figure 8 shows a circular map of the expression vector pS425, constructed as described in Example 5. This expression vector mediates the extracelllar expression of recombinant human kappa-casein in E.coli.

Figure 9 shows the result of an SDS-PAGE and a Western blot analysis of recombinant human kappacasein expressed in E.coli BL 21 (DE3) pLysS containing the expression vectors pS14, pS415 and pS425, respectively. Bacterial cells were boiled in sample buffer and proteins were separated. pS14 is identical to pS415 except that it lacks kappa-casein sequences and that it functions as a negative control. Recombinant human kappa-casein was visualized using labeled rabbit polyclonal alkaline antibodies, grown against high purity human kappa-casein (Example 2). The culture conditions and induction methods were as described in Example 5.

<td>Track 1.</td><td>Intended molecular weight markers 106, 80, 49.5, 32.5, 27.5 and 18.5 kDa (BioRad)</td>

<td>Track 2.</td><td>pS14 not induced</td>

<td>Track 3.</td><td>induced pS14</td>

<td>Track 4.</td><td>pS415 not induced</td>

<td>Track 5.</td><td>induced pS415</td>

<td>Track 6.</td><td>pS425 not induced</td>

<td>Track 7.</td><td>induced pS425</td>

<td>Track 8.</td><td>Purified human kappa-casein (5.00 ng)</td>

Figure 10 shows a circular map of the expression vector pS330, constructed as described in Example 6. This expression vector mediates the expression of recombinant human kappa-casein in mammalian cells.

Figure 11 shows the expression analysis of the recombinant human kappa-casein gene in mammalian cells. Total RNA from C127 cells was prepared and separated on a 1% formaldehyde agarose gel, transferred to a nitrocellulose membrane, and hybridized with a pS270-derived, kappa-casein-labeled probe.³²P. The experimental procedures were those described in Ausubel et al., 1991. Three different cell lines containing the expression vector pS330 (Example 6) were isolated and analyzed. A C217 cell line containing the vector pS306 was used as a control. pS306 is similar to pS330 except for the absence of kappa-casein coding sequences.

Lane 1 5 μg total RNA from pS306 / C127 cells

Lane 2 5 μg of total RNA from pS330 / C127 cell line 9

Lane 3 5 g of total RNA from pS330 / C127 cell line 14

Lane 4 5 μg of total RNA from pS330 / C127 cell line 20

Size markers are indicated on the left.

IS 2 188 592 T3

Figure 12 shows a circular map of the expression vector pS339, constructed as described in Example 7. This expression vector mediates the expression of recombinant human kappa-caseone in the mammary glandular in transgogenic animals.

Figure 13 shows the structure of the recombinant murine WAP / kappa-caseone gene in pS339. WAP exons are shown as solid boxes, numbered I-IV. The kappa-caseone cDNA is shown as an open box and the restriction sites used for insertion of the cDNA, KpnI and SalI are shown. Restriction sites for targeting elements and for recombinant gene isolation are also indicated. The transcriptional direction of the recombinant gene is indicated by an arrow.

Figure 14 is a schematic representation of the location of the PCR primers used for the identification of transgogenic animals for human kappa-caseone, as described in Example 7. The 5 'primer is complementary to the sequences within the sequence. Murine WAP starting from position -148 bp upstream of the fusion position between WAP and the kappa-caseone cDNA. The 3 'primer is complementary to kappa-caseone cDNA sequences that terminate 338 bp downstream from the fusion position.

Figure 15 is an agarose gel showing PCR analysis of potentially transgenic mice resulting from an experiment as described in Example 7. DNA was prepared from isolated mouse tails samples and used in PCR screening experiments with the primers described in Example 7 and Fig. 15. The resulting samples of PCR amplified DNA were separated on 1% agarose gels and stained with ethidium bromide. M: molecular weight markers, sizes in kb are indicated on the left. Lane 1, positive control. PCR product generated from the amplification using the plasmid pS339 as a DNA model. Lane 2, negative control. PCR analysis of DNA prepared from a non-transgenic mouse. Lanes 3-13, PCR screening of DNA samples prepared from different individual mice, potentially representing founder transgeonic animals. In lanes 7 and 13 a band generated by PCR is clearly visible, which shows that the biopsies used for DNA preparation were collected from transgenic animals in these samples. The expected size of the PCR amplified fragment, 486 bp, is indicated on the right.

Figure 16 shows the result of a Western blot analysis of milk samples derived from a non-transgenic mouse, and from a transgenic mouse for the recombinant WAP1 kappa-caseone gene of pS339, (line 11-11). The proteins were separated on SDS-PAGE and transferred to Immobilin membranes (Millipore), and visualized with rabbit polyclonal antibodies labeled with alkaline phosphatase and cultured against high purity human kappa-caseone (Example 2).

Track 1 2 μl of milk derived from a transgenic pS339 mouse, line 11-11.

Track 2 2 μl of milk derived from a non-transgenic mouse.

Figure 17 shows the structure of a recombinant murine WAP / kappa-caseon minigene containing intron kappa-caseon sequences, as described in Example 7. The WAP exoon is shown as a solid box. The kappa-caseona exons are shown as open boxes, numbered 1-5. The DNA fragments of human and murine origin are fused at the indicated restriction sites.

Figure 18 shows the structure of a recombinant murine WAP / kappacaseon minigene variant containing introon kappa-caseon sequences, as described in Example 7. The WAP exoon is shown as a solid box. The kappa-caseóna exons are shown as open boxes numbered 2-5. DNA fragments of human and murine origin are fused at the indicated restriction sites.

References

- EPO Publication No. 0 247 494

- EPO Publication No. 0 264 166 (Integrated Genetics, Inc.)

- EPO N Publication^° 0 279 582 (Baylor College of Medicine)

- PCT N Publication^° WO 82/04443 (Ohio University)

- PCT N Publication^° WO 88/00239 (Pharmaceutical Proteins Ltd.)

- PCT N Publication^° WO 88/01648 (Immunex Corporation)

- PCT Publication N^° WO 91/03551 (Tsi-Mason Research Institute)

IS 2 188 592 T3

- PCT Publication No. WO 91/08216 (Genpharm International)

- PCT Publication No. WO 92/03917 (Gen-Pharm International)

- Alexander, LJ, Stewart, AF, MacKinlay, AG, Kapelinskaya, TV, Tkach, TM, Gorodetsky, SI, Eur. J. Biochemistry, 178, 395-401, 1988.

- American Academy of Pediatrics, Committee on Nutrition: Commentary on Breast-Feeding and Infant Formulas, including proposed standards for formulas. Pediatrics 57, 278-285 (1976).

- American Academy of Pediatrics, Committee on Nutrition, Pediatrics 72, 359-363 (1983).

- Anderson, SA, Chinn, HI, Fisher, KD History and current status of infant formula. Am. J. Clin. Nutr. 35, 381-397, 1982.

- Aniansson, G., Andersson, B., Lindstedt, R. and Svanborg, C. Anti-adhesive activity of human casein against Streptococcus pneumoniae and Haemophilus influenzae. Microbial Pathogenesis 8, 315-323, 1990.

- Ausubel, FM, Brent, R., Kingston, RE, Moore, DD, Seidman, JG, Smith, JA, Struhl, K. (eds.), Current Protocols in Molecular Biology, John Wiley &amp; Sons, New York, 1987 .

- Axelsson, I., Jakobsson, I., Lindberg T. and Benediktsson B. Acta Pediatrica Scand. 75, 702-707 (1986).

- Azuma, N., Yamauchi, K., Mitsuoka. T. Bifidus growth-promoting activity of a glycomacropeptide derived from human kappa-casein. Agric Biol. Chem. 48: 2159-2162 (1984).

- Betteridge, KJ (1977) in: Embryo transfer in farm animals: a review of techniques and applications.

- Bezkorovainy, A., Grohlich, JD, Nichols, JH Isolation of a glycopeptide fraction with Lactobacillus bifidus subspecies pennsylvanicus growth-promoting activity from whole human milk casein. Amer. J. Clin. Nutr. 32: 14288-1432 (1979).

- Bollag et al. (1989) Ann. Rev. Genet. 23, 199-225.

- Bongso, TA &amp; Basrur, PK (1975) Vet. Rec. 96, 124-126.

- Brignon, G., Chtourou, A. and Ribadeau-Dumas, B. Preparation and amino acid sequence of human kappa-casein. FEBS Lett. 188, 48-54, 1985.

- Brinster, RL, Allen, JM, Behringer, RR, Gelinas, RE and Palmiter, RD Introns increase transcriptional efficiency in transgenic mice. Proc. Natl. Acad. Sci USA 85, 836-840, 1988.

- Camous et al. (1984) J. Reprod. Fert. 72, 779-785.

- Campbell, SM, Rosen, JM, Hennighausen, LG, Strech-Jurk, U. and Sippel, AE Comparison of the whey acidic protein genes of the rat and mouse. Nucleic Acids Res. 12, 8685-8697, 1984.

- Chiba, H., Tani, F. And Yoshikawa, M. Opioid antagonist peptides derived from kappa-casein. J. Dairy Res. 56, 363-366, 1989.

- Chobert, JM, Mercier, JC, Bahy, C. and Hazeó. G. FEBS Lett. 72, 173-178, 1976.

- Clark, AJ, Simons, P., Wilmut, I. And Lathe, R. Pharmaceuticals from transgenic livestock. TIBTECH 5, 20-24, 1987.

- Donahue. S. (1986) Genetic Engineering of Animals, ed. J. Warren Evans et al., Plenum.

- EMBL DATABASE July 23, 1991, Heidelberg, FRG; AC: M73628, Menon, RS et al. "Homo sapiens kappa-casein mRNA, 3 'end."

- Eyestone, WH et al. (1989) J. Reprod. Fert. 85, 715-720.

- Eyestone, WH (1989) "Factors affecting the development of early bovine embryos in vivo and in vitro." Ph.D. Thesis, University of Wisconsin.

IS 2 188 592 T3

- Fiat, AM and Jollóes, P. Caseins of various origins and biologically casein peptides and oligosaccharides: Structural and physiological aspects. Mol. Cell. Biochem. 87, 5-30, 1989.

- Fiat, AM, Jollóes, J., Aubert, JP, Loucheux-Lefebvre, MH and Jollóes, P. Eur. J. Biochem. 111, 333-339, 1980.

- Fitzgerald, RJ and Swaisgood, HE Binding of ions and hydrophobic probes to alpha-lactalbumin and kappa-casein as determined by analytical affinity chromatography. Arch. Biochem Biophys. 268, 239-48. 1989.

- Furet, JP, Mercier, JC, Soulier, S., Gaye, P., Huedelahaie, D. and Vilotte, JL Nucleotide sequence of ovine kappa-casein cDNA. Nucleic Acids Res. 18, 5286, 1990.

- Gandolfi et al. (1987) J. Reprod. Fert. 81, 23-28.

- Gordon et al. (1984), Methods in Enzymology, 101, 414.

- Graham, FL, and Van der Eb, AJ, Virology 52, 456-467, 1973.

- Hall, L., Emery, DC, Davies, MS, Parker, D. and Craig, RK Organization and sequence of the human alpha-lactalbumin gene. Biochem. J. 242. 735-742. 1987.

- Hambraeus, L., Forsum, E. and Lonnerdal, B. In: "Food and Immunology", pp. 116-124 (Eds. L. Hambraeus, LA Hanson and H. McFarlanes) Almquist and Wiksell (1977).

- Hammer et al. (1985), Nature, 315, 680.

- Hennighausen, LG, Ruiz, L. and Wall, R. Transgenic animals production of foreign proteins in milk. Curr. Opinions Biotechn. 1, 74-78, 1990.

- Heyman, Y. et al. (1987) Theriogenology 27, 5968.

- Higuchi, R. (1989) "Amplifications (A forum for PCR Users)." 2.1-3.

- Hogan B., Constantini, F. And Lacy, E. Manipulating the Mouse Embryo. A Laboratory Manual. Cold Spring Harbor Laboratory Press, 1986.

- Jaenisch, R. (1976), Proc. Natl. Acad. Sci. USA, 73, 1260-1264.

- Jolles, P., Parker, F., Floch, F., Migliore, D., Alliel, P., Zerial, A. and Weiner, GH Immunostimulating substances from human casein. J. Immunopharmacol. 3, 363-369, 1982.

- Jolles, P., Levy-Toledano, S., Fiat, AM, Soria, C., Gillessen, D., Thomaidis, A., Dunn, FW, Caen,

JP Analog between fibrinogen and casein. Effect on an undecapeptide isolated from kappa-casein on platelet function. Eur. J. Biochem. 158, 379-382, 1986.

- King, D. et al. (1988) Molecular Reproduction and Development 1, 57-62.

- Lonnerdal, B., Bergstrom, S., Andersson, Y., Hjalmarsson, K., Sundqvist, AK and Hernell, O. Cloning and sequencing of a cDNA encoding human milk beta-casein. FEBS Lett. 269, 153-156, 1990.

- Lusky, M. and Botchan, MR, Cell 36, 391-401, 1984.

- Marayama, S., Mitachi, H., Tanaka, H., Tomizuka, N., Suzuki, H. Studies on the active site and antihypertensive activity of angiotensin 1 converting enzyme inhibitors derived from casein. Agric. Biol. Chem. 51: 1581-1586 (1987).

- Menon, RS and Ham, RG Human beta-casein: partial cDNA sequence and apparent polymorphism. Nucleic Acids Res. 17, 2869, 1989.

- Miller, MJS, Witherly, SA and Clark, DA Casein: a milk protein with diverse biologic consequences. Proc.Soc.Exp.Biol.Med. 195, 143-159, 1990.

- Mount, SM A catalog of splice junction sequences. Nucleic Acid Research 10, 459-472, 1982.

- Newport, MJ and Henschel, MJ Pediatric Res. 18, 658-662 (1984).

IS 2 188 592 T3

- Nilsson, J., Blackberg, L., Carlsson, P., Enerback, S., Hernell, O. and Bjursell, G. cDNA cloning of human-milk bile-salt-stimulated lipase and evidence for its identity to pancreatic carboxylic ester hydrolase. Eur. J. Biochem. 192, 543-550, 1990.

- Packard, VS "Human Milk and Infant Formula", pp. 147-154. Academic Press (1982).

- Parrish et al. (1986) Theriogenology 25, 591-600.

- Parrish et al. (1988) Biol. Reprod. 38, 1171-1180.

- Pavlakis, GN, and Hamer, DH, Proc. Natl. Acad. Sci. USA 80, 397-401, 1983.

- Picken, RN, Mazaitis, AJ, Mass, WK, Rey, M. and Heyneker, H. Nucleotide sequence of the gene for heat-stable enterotoxin II of E. coli. Infect. Immun. 42, 269-275, 1983.

- Prather et al. (1987) Biol. Reprod. 37, 859-866.

- Rexroad et al. (1988) J. Anim. Sci. 66, 947-953.

- Roble et al. (1987) J. Anim. Sci. 64, 642-664.

- Rowland, SJJ Dairy Res. 9, 47-57, 1938.

- Rubnitz, J. and Subramani, S. (1984) Mol. Cell. Biol. 4, 2253-2258.

- Rumsey et al. (1974) J. Anim. Sci. 39, 386-391.

- Sambrook, J., Fritsch, EF and Maniatis, TE Molecular cloning, a laboratory manual. two^nd ed. Cold Spring Harbor Laboratory Press, 1989.

- Sarver, N., Byrne, JC, and Howell, PM, Proc. Natl. Acad. Sci. USA 79, 7147-7151, 1982.

- Sirard et al. (1988) Biol. Reprod. 39, 546-552.

- Stan, EY, Chernikov, MP Formation of a peptide inhibitor of gastric secretion from rat milk protein in vivo. Bull Exp. Biol. Med., 94; 1087-89 (1982).

- Studier, FW, Rosenberg, AH, Dunn, JJ and Dubendorff, JW Use of T7 RNA Polymerase to direct expression of cloned genes. In Methods in Enzymology, ed. David V. Goeddel, p. 60-89. Academic Press, 1990.

- Wall et al. (1985) Biol. Reprod. 32, 645-651.

- Williams et al. (1984) Theriogenology 22, 521-531.

- Yvon, M., Pelissier, JP, Characterization and kinetics of evacuation of peptides resulting from casein hydrolysis in the stomach of the calf. J. Agric. And Food Chem. 35: 148-156 (1987).

Examples

The following examples are intended to illustrate, but not limit, the present invention.

The construction of the expression systems of the invention, and the molecular biological characterization thereof, uses standard methods generally known in the recombinant DNA technique. Unless otherwise indicated, the methods used are those described by Sambrook et al., 1989; Ausubel and others, 1991.

Definitions

DNA hybridization

The DNA, for example on nitrocellulose filters, is moistened in 2 x SSC [1 x SSC: 0.15 M NaCl, 0.0015 M Na3-citrase, pH 7.0] and placed in a heat-sealed plastic bag with pre-heated (67 ° C) prehybridization solution. Pre-hybridization takes place for 2 h at 67 ° C, with gentle shaking of the bag. The solution is exchanged with the prewarmed (67 ° C) hybridization solution, a radioactive probe is added and hybridization is carried out at 67^°C for 18 h. The bag is gently shaken to ensure constant movement of the liquid over the nitrocellulose filters. After hybridization,

ES 2 188 592 T3 carries out a washing procedure.

The radioactive probe is prepared by known methods, for example as described in Sambrook et al., On the basis of the DNA sequence shown in SEQ ID NO: 1 or a part thereof, especially a coding part such as the nucleotides corresponding to amino acids 1-210 or an effective subsequence of the DNA sequence as defined above.

The prehybridization and hybridization solutions used are: 10 x Denhardt's, 4 x SSC, 0.1% SDS, 10 g / ml polyA, 50 g / ml of denatured DNA to be analyzed and the denatured radioactive probe (heat). Filters are washed in pre-heated solutions (67^°C): 10 x Denhardt, 2 x SSC, 0.1% SDS over 2 x 15 min. and 1 x SSC, 0.1% SDS for 4 x 15 min. The filters are air dried and covered with Vita-Wrap, and X-ray film is exposed to the filters for 3 h to 3 weeks with and without intensification screens.

Example 1

Purification of native kappa-casein from human milk

Human milk was centrifuged at 15,000 xg for 45 min, then removing the layer of buoyant fat. The skim milk was acidified with HCl to pH 4.3 and incubated under shaking for 1 h at room temperature and then centrifuged for 90 min at 18,000 x g. The resulting pellet (the caseone fraction) was dissolved or dialyzed in 20 mM ethanolamine, 6 M urea, pH 9.5 and then extracted several times by stirring in hexane. After extraction, the water-phase was dialyzed against water and lyophilized.

The lyophilized caseone fraction was dissolved in 50 mM imidazole-HCl pH 7.0, 0.5% SDS, 0.5% 2-mercaptoethanol, and incubated at 37^°C for 1h, and it was passed through a Sephadex G-200 column, 1.6 x 120 cm, equilibrated with the same buffer except that the 2-mercaptoethanol was 0.1%. Chromatography was carried out at 37^°C to avoid the formation of complexes, which were formed at 4^°It married as at room temperature. The eluted fractions in which the kappacaseone was expected to have eluted were analyzed for their carbohydrate content, and the fractions containing carbohydrates were pooled for further purification. The main impurity in this fraction was beta-caseone, which constituted approximately 90% of the proteone in the pool. The pool was dialyzed first against 40% methanol and then against 20 mM potassium phosphate buffer pH 6.8, 0.1% Tween 20, 0.01% 2-mercaptoethanol.

To remove the kappa-caseone from this impurity, the pool was passed through a 1 x 6.5 cm hydroxyapatite column, equilibrating with the same buffer against which the pool had been dialyzed, and eluted with a 0 potassium phosphate gradient. , 02-0.4 M. Also in this case the chromatography had to be carried out at 37^°C to avoid complex formation. Most of the kappa-caseóna was not attached to the column, while the beta-caseóna was almost completely attached. Unbound material was pooled, dialyzed against water, and lyophilized. The kappa-caseone was analyzed in SDS-PAGE, a diffuse and weak band was found at 35-40 kDa, but that was weakly stained with Coomassie Brilliant Blue.

The identity of the proteon was tested by amino acid analysis in which the isoleucine / leucine ratio is one of the most characteristic properties of the proteon. The proteon was also stained with Schiffs reagent, as would be expected in such a glycosylated protein.

Example 2

Production and purification of polyclonal reagent antibodies against kappa-casein

Kappa-caseone purified as described in Example 1 was used for immunization of rabbits. When reactive antiserum against kappa-caseone was obtained, it was reacted ("cross-reaction") with serum proteones and beta-caseone, as well as E.coli proteones when used for proteon blotting. Therefore, a series of methods were used to increase the specificity of the antiserum.

First, the antiserum was incubated with E.coli cell lysate to adsorb and precipitate non-specific antibodies reacted with E.coli proteones. The antiserum was centrifuged (5000 xg, 15 min) after incubation for one hour and the residue was removed. To further purify the antiserum, high purity recombinant beta-caseone was fixed to CNBr-activated Sepharose, and secondly, the antiserum was passed through this column several times to adsorb reactive antibodies against

ES 2 188 592 T3 beta-casein. Third, the native kappa-casein prepared from human milk as described in Example 1 was immobilized on CNBr-activated Sepharose and the antiserum was purified on this gel by affinity chromatography. Fourth, the antiserum was precipitated with serum proteins prepared from human milk. The antiserum purified through all these steps still reacted ("cross-reaction") to some degree with other milk proteins after its protein blotting analysis, but reacted much more intensely with kappa-casein when a protein sample was separated. milk by electrophoresis, electroblotting and staining using this antiserum.

The cross-reactivity can be explained by the fact that it is very difficult to prepare pure beta-casein and pure kappa-casein from human milk. Furthermore, caseins are always present in the serum fraction to a small degree in the same way that serum proteins are present in the casein fraction. This leads to a situation where it is difficult to obtain completely pure protein for immunization and it is also difficult to prepare casein columns that are completely free of other milk proteins. Therefore, the antisera obtained are ultimately enriched in specific antibodies rather than highly purified, although a large number of purification methods have been used.

Example 3

Cloning and sequencing of cDNA encoding human kappa-caselna

The construction of the expression systems of the invention, and the molecular biological characterization thereof, uses standard methods generally known in the recombinant DNA technique. Unless otherwise stated, the methods used are those described by Sambrook et al., 1989.

A human mammary glandular 8 / gt 11 cDNA library was prepared generated from mRNA prepared from a tissue biopsy isolated from a human mammary gland. The biopsy donor was a nursing woman. The library will be screened by immunological methods using the polyclonal kappa-casein antibodies prepared according to Example 2.

The buffers used were: TBS (50 mM Tris-HCl pH 7.9, 150 mM NaCl), TTBS (TBS containing 0.05% Tween 20).

The procedure used was as follows: E.coli Y1090 bacteria were cultured on LA plates containing 50: g / ml of carbenicillin. A single colony was isolated and grown overnight in a LB containing 0.2% maltose and 10 mM MgSO4. 0.4 ml of the culture was then mixed with dilute phage from the library and adsorption was allowed for 15 minutes at 37 ° C. The infected culture was then mixed with 7ml of soft agarose (0.75% agarose in LB and 10mM MgSO4). The soft agarose mixture was poured into 150 mm LA plates. Plates were incubated at 42^°C for approximately 3.5 h, until the plates were visible. Each plate was then covered with a membrane (DuPont NEN, Colony Plaque Screen ["colony plate membrane"]) previously saturated in 10 mM IPTG (Isopropyl-beta-D-thiogalactoside), and incubated overnight at 37^°C. The positions of the membranes were indicated before removing them. The membranes were then washed in TTBS, and incubated in TTBS containing 20% ​​FCS and the polyclonal kappa-casein antisera diluted 1:25 for 2 hours at room temperature. The membranes were washed twice for 5 minutes in TTBS at room temperature. Biotinylated goat-anti-rabbit IgG was added in TBS and the membranes were incubated for 1 hour at room temperature. The membranes were then washed again with TTBS twice for 5 minutes at room temperature. The conjugate of streptavidin and biotinylated alkaline phosphatase in TTBS was added, followed by a 1 hour incubation at room temperature. The next step was washing the membranes four times in TTBS for 5 minutes and rinsing three times in a buffer containing 50 mM Tris-HCl pH 9.8, 3mM MgCl2, 50: g / ml XP (5-bromo- 4-chloro-3-indolyl phosphate (Na salt) and 100: g / ml NBT (Nitroblue tetrasolium grade III) Approximately 100 positive colonies were identified by reaction with antibodies produced as described in Example 2.

Isolated colonies were purified by dilution and repeated screening. Phage DNA was prepared according to Sambrook et al. 1989 and DNA preparations were digested with EcoRI. The digested DNA was separated by agarose electrophoresis and a series of EcoRI fragments were cloned into alkaline phosphatase-treated EcoRI-digested pUC18 plasmids and then transformed into E.coli TG2. Transformants were selected on plates containing 50 μg / ml carbenicillin, 40 μg / ml X-gal (5-bromo-4-chloro-3-indolyl-beta-D-galactoside) and 1 mM IPTG (Isopropyl-beta -D-thiogalactoside). Plasmid DNA from a series of transformants was analyzed. One of these transformants found himself

ES 2 188 592 T3 containing a plaasmid containing a full-length cDNA fragment encoding human kappa-casein. This plaasmid was named pS 270, Figure 1. Plasmid DNA pS 270 was subjected to restriction analysis with endonucleases. The complete nucleotadic sequence of both strands of the kappa-casein coding region will be determined, using a T7 sequencing kit (Pharmacia, Uppsala, Sweden), in double-stranded templates as described by the vendor. Specific oligonucleotides complementary to pUC 18 or kappa-casein sequences were used as primers for sequencing reactions.

The nucleotadic sequence (SEQ ID NO: 1) contains a sufficient open reading frame to encode the complete amino acid sequence of a protein precursor of a kappa-caean consisting of 162 amino acids and a signal peptide of 20 amino acids (SEQ ID NO: 2 ).

Example 4

Cloning, sequencing and organization of human kappa-casein genomic fragments

To determine the structural organization and sequence of the human kappa-casein gene, libraries of human genomic DNA and human genomic DNA were screened and analyzed. Human gene libraries were obtained from Clontech (Palo Alto, USA). Libraries were constructed with placental DNA (catalog number HL1067J) or female leukocyte DNA (catalog number HL1111J) cloned into a lambaEMBL-3 vector. The average size of the inserts is 15 kb or 16 kb and the number of independent clones is 2.5x10⁶ or 1.7x10⁶, respectively. Human genoamic DNA preparations were extracted from human tissue samples or human cell lines. Human genetic DNA was also obtained from Clontech (catalog number 6550-2). To isolate recombinant phage containing exáon and introan sequences of the human kappa-casein gene, 195 individual bacterial colonies with a diameter of 150 mm and approximately 10⁴individual colonies per plate. The methods and solutions used were as described in the "Library Protocol Handbook: General Procedures for the Hybridization of Phage Libraries w / DNA Probes" (Clontech) ["Library Protocol Manual: general procedures for the hybridization of phage libraries with DNA probes ”] with some modifications as will become apparent from what follows.

The experiment was carried out essentially as follows. The numbers are given by quantity per plate. A sample of the phage library diluted in 0.1 ml of sterile diluent was prepared to obtain an estimated number of 10,000 cfu (colony forming units). 0.6 ml of culture in LB medium of E.coli strain NM 539 (obtained from Clontech) was infected with 10,000 cfu of recombinant phage and 0.3 M of SM buffer was added. The infected culture was incubated for 20 minutes at 37 ° C.

The culture was then mixed with agarose (top) (7.2 g agarose added per liter of LB) and poured onto the LB plates. Plates were incubated at 37^°C for about 7 hours. The plates were then cooled to 4^°C.

The plaque hybridization experiments were as follows. Membrane filters, Colony / Plaque Screen (DuPont, USA), were placed on top of the plates for 2-3 minutes. Filters were removed and floated in 0.5 M NaOH in plastic wrap for 2 minutes, side up, for DNA denaturation. This step will be repeated once to ensure efficient denaturation. The membrane filters were then transferred to a neutralizing solution, 1 M Tris-HCl pH 7.5, for 2 minutes for two times, to ensure efficient neutralization. The membrane filters were then allowed to dry.

To obtain a probe for DNA hybridization screening of membrane filters, pS270 was digested with EcoRI and an 857 bp fragment was separated by agarose electrophoresis, cut out and transferred to a polypropylene microcentrifuge tube. The isolated cDNA fragment will be labeled with³2P using a "multiprime" DNA labeling system (Amersham) according to the following procedure. Water was added in a ratio of 3 ml per gram of gel, and placed in boiling water for 7 minutes to melt the gel and denature the DNA. The tube will then be transferred to a 37 ° C water bath for at least 10 minutes. A volume of DNA / agarose solution, containing 25 ng of DNA, was added to the labeling reagent, according to the supplier's instructions.

The hybridization method was under stringent conditions at 65^°C according to the method described later in this document. The membrane filters were prehybridized by treatment in a 1% SDS solution, 1M NaCl, 10% dextraan sulfate in a bottle using a hibri32 oven.

ES 2 188 592 T3 dacioín (Hybaid) a 65^°C for at least 1 hour. After prehybridization, a solution containing denatured herring sperm DNA of a final concentration of 100 mg / ml and the DNA probe labeled with³²P at a concentration of less than 10 ng / ml (for a signal / noise ratio that is optimal) was added to the prehybridization solution, and the membrane filters were incubated at 65 ° C for 10-20 hours. To wash the membrane filters, the hybridization solution was removed. In the first step the membrane filters were washed in a 2xSSC (0.3M NaCl, 0.03M Na-citrate), 1% SDS solution twice for 5 minutes at room temperature. In the next step, the membrane filters were incubated in the same solution twice at 65^°C for 30 minutes. In a third step, the filters were washed twice at room temperature in 0.1xSSC. Finally, the membrane filters were placed on a filter paper sheet with the DNA facing up, and allowed to dry. The dried membrane filters were then exposed to X-ray film and autoradiographed.

Of the approximately 2x10⁶ Single colonies analyzed as described, three hybridized plates were detected and isolated. These three isolation solutions were named # 2, 41, and 42, respectively. After several "rescreening" experiments, the recombinant phage DNA was purified, according to Sambrook et al., 1989. The purified DNA was digested with SalI and the fragments representing the inserts were isolated by agarose electrophoresis.

The insert sizes were approximately: 18 kb in isolation solution # 2, 15 kb in isolation solution # 41, and 17 kb in solution # 42. These fragments were cloned into a SalI-digested linearized pUC19, resulting in pS457 (isolation solution # 2), pS458 (isolation solution # 41), pS459 (isolation solution # 42) (Figure 2). The insertions of the three colonies that hybridize to the kappa-casein cDNA probe of pS270 were analyzed by PCR, restriction mapping, and hybridization to oligonucleoites labeled with ³²P representing various regions of the kappa-casein gene. The fragments also hybridized to each other. The insert from isolation solution # 42 was shown to contain a large portion of the kappa-casein gene, although not the entire transcribed region. The cloned fragment in isolation solution # 2 was shown to show partial homology with isolation solution # 42. However, a number of discrepancies were observed between the two isolation solutions. It was demonstrated by comparison with human genoymic DNA using PCR analysis that isolation solution # 2 contains partially rearranged regions. The insert in isolation solution # 41 was shown to contain homologies to the 3 'end of the cDNA, and the insert was shown to extend downstream of the transcribed part of the kappa-caein gene. Thus, for the analysis and characterization of exion and introin sequences of kappa-casein and its organization, the insertion of isolation solution # 42 was selected.

The cloned fragment in pS459 (Figure 2) was characterized by restriction enzyme mapping, using EcoRI, HindIII, XbaI, AccI, PstI, KpnI, and SacI. The resulting restriction map is shown in Figure 5. The approximate positions of the exons and the approximate size of the introns were analyzed by PCR and electrophoresis. The results generated from clone pS459 were compared with the results obtained with the same PCR primers using human DNA as a template. The results generated from the two molds were identical.

To facilitate nucleotide sequence analysis, 18 restriction fragments derived from pS459 were isolated and subcloned into pUC19, resulting in pS461 / 478 (Figure 5). The orientation of the subcloned fragments was determined by PCR analysis. The following strategy was used: the combination of PCR primers located within the pUC19 sequence on each side of the cloning site, separately, and the other PCR primer with a defined orientation and specific for the subcloned fragment derived from kappa-casein, allowed the determination.

Insertions in the 18 pS461-478 plasmids were subjected to nucleotide sequence analysis. The complete nucleotide sequences for all subclones were determined using a T7 sequencing kit (Pharmacia, Sweden; United States Biochemical, USA) on double-stranded templates as described by the vendors. As primers for the sequencing reactions, specific oligonucleoitides complementary to pUC19 (E20 5 'GTTGGGTAACGCCAGGGTTTTC3' (SEQ ID NO: 5), SYM 1121 5'-CAGGAAACAGCTATGAC-3 '(SEQGTGTCGTC -3 '(SEQ ID NO: 7)) or primers complementary to kappa-casein (see Table 1).

IS 2 188 592 T3

TABLE 1

Primers used for human kappa-casein gene sequencing

<td>Primer</td><td>Location</td><td>Sequence</td><td>Direction</td><td>I KNOW THAT ID NOT:</td><td>Nucleotides</td>

<td>SYM 2271</td><td>Exon 4</td><td>AACCAACACCAGCTCCTGCC</td><td> 5'-3'</td><td> 4</td><td>10349-1Ó360</td>

<td>SYM 2272</td><td>Exon 5</td><td>AAGGAGAGTGTGAAGTAGTA</td><td> 3'-5'</td><td> 4</td><td> 12315-12296</td>

<td>SYM 2430</td><td>Exon 4</td><td>ACATAATACATTGGGACATA</td><td> 3'-5'</td><td> 4</td><td> 10079-10060</td>

<td>SYM 2445</td><td>Exon 4</td><td>CCGCTGAGGAATTTGGGCAT</td><td> 3'-5'</td><td> 4</td><td> 10215-10196</td>

<td>SYM 2446</td><td>Exon 4</td><td>TATCAGAAAACAGCTCCATA</td><td> 5'-3'</td><td> 4</td><td> 10042-10061</td>

<td>SYM 2448</td><td>Exon 5</td><td>ACCAAATTACTACTTCACAC</td><td> 5'-3'</td><td> 4</td><td> 12288-12308</td>

<td>SYM 2449</td><td>Exon 4</td><td>TTCAGTGGCAGGAGCTOGTG</td><td> 3'-5'</td><td> 4</td><td> 10374-10355</td>

<td>SYM 2767</td><td>Exon 4</td><td>ACACCAAGGAAATATCAAG</td><td> 5'-3'</td><td> 4</td><td> 10479-10498</td>

<td>SYM 2768</td><td>Exon 5</td><td>GCAATCAGTTGGCTTTATTG</td><td> 3'-5'</td><td> 4</td><td> 12442-12423</td>

<td>SYM 2921</td><td>Exon 2</td><td>AGGCAGGGTTAATGCCAGGG</td><td> 3'-5'</td><td> 3</td><td> 2241-2223</td>

<td>SYM 2922</td><td>Exon 3</td><td>TGCTGGTTGTTTCTGGTTT</td><td> 3'-5'</td><td> 4</td><td> 8849-8867</td>

<td>SYM 3255</td><td>Exon 3</td><td>CTGTGGAGGTTCAAAACC</td><td> 5'-3'</td><td> 4</td><td> 8836-8853</td>

<td>SYM 3272</td><td>Exon 1</td><td>CTTTCCTCGTGCCAGTCAGGTC</td><td> 3'-5'</td><td> 3</td><td> 45-24</td>

<td>SYM 3273</td><td>Exon 2</td><td>CAATAATGAAGAGTTTTCTTC</td><td> 5'-3'</td><td> 3</td><td> 2190-2210</td>

<td>SYM 3410</td><td>Intron 4</td><td>GCCATTATCCATTGGTCCAAG</td><td> 3'-5'</td><td> 4</td><td> 11182-11162</td>

<td>SYM 3411</td><td>Intron 4</td><td>CATAATTCTGGTTGCTATAAGAC</td><td> 5'-3'</td><td> 4</td><td> 10477-10499</td>

<td>SYM 3412</td><td>Intron 3</td><td>GAAGTATGGAACCCAGCAG</td><td> 3'-5'</td><td> 4</td><td> 9884-9902</td>

<td>SYM 3415</td><td>Intron 3</td><td>CAAAAGATTAGATAAAGAATTGTC</td><td> 3'-5'</td><td> 4</td><td> 9434-9411</td>

<td>SYM 3416</td><td>Intron 4</td><td>GACAAAGTGAAAATAATTGG</td><td> 5'-3'</td><td> 4</td><td> 10717-10736</td>

<td>SYM 3431</td><td>Intron 4</td><td>GTAGTCCCATGATATCACAG</td><td> 3'-5'</td><td> 4</td><td> 11391-11372</td>

<td>SYM 3445</td><td>Intron 4</td><td>CAAATGGGAGGCAAACCAAAC</td><td> 5'-3'</td><td> 4</td><td> 11748-11768</td>

<td>SYM 3470</td><td>Intron 3</td><td>GGTTTTAGACAGAAGGCATC</td><td> 3'-5'</td><td> 4</td><td> 8961-8942</td>

<td>SYM 3531</td><td>Intron 2</td><td>CTTAGCACAGACTCTGGCAC</td><td> 3'-5'</td><td> 4</td><td> 4392-4373</td>

<td>SYM 3532</td><td>Intron 2</td><td>GGATAGGATATTAGTAGAG</td><td> 5'-3'</td><td> 4</td><td> 4776-4794</td>

<td>SYM 3533</td><td>Intron 2</td><td>GTAAGCATAATTCATAGCATAG</td><td> 5'-3'</td><td> 4</td><td> 880-901</td>

<td>SYM 3534</td><td>Intron 2</td><td>ATACTTGTTGAGTGAATGAC</td><td> 3'-5'</td><td> 4</td><td> 5788-5769</td>

<td>SYM 3535</td><td>Intron 2</td><td>CAGTCAGTAGTTCCCAACC</td><td> 5'-3'</td><td> 4</td><td> 6004-6022</td>

<td>SYM 3536</td><td>Intron 2</td><td>GAAGCAACAGTAGTCTAACTG</td><td> 3'-5'</td><td> 4</td><td> 8670-8650</td>

IS 2 188 592 T3

<td>SYM 3537</td><td>Intron 2</td><td>CAAGCCACACGAAGGCCCAAC</td><td> 5'-3'</td><td> 1-</td><td> 6209-6229</td>

<td>SYM 3538</td><td>Intron 2</td><td>CAACTCTCCTGCCTCAGCC</td><td> 5^Z-3^Z</td><td> 4</td><td> 200-239</td>

<td>SYM 3539</td><td>Intron 2</td><td>CACCACACTTTTATGAACTGC</td><td> 3^Z-5^Z</td><td> 4</td><td> 3081-3061</td>

<td>SYM 3540</td><td>Intron 2</td><td>GAATGATTATTAAGATCAGTAG</td><td> 3'-5'</td><td> 4</td><td> 680-662</td>

<td>SYM 3541</td><td>Intron 2</td><td>GAGGTGCTGAAAGATTAAGTG</td><td> 5'-3'</td><td> 4</td><td> 4528-4548</td>

<td>SYM 3546</td><td>Intron 2</td><td>CCTCCCATTTGTCACTATCC</td><td> 3'-5'</td><td> 4</td><td> 75-56</td>

<td>SYM 3547</td><td>Exon 1</td><td>CAGCTCAACCTACTGCCAAC</td><td> 5^Z-3^Z</td><td> 3</td><td> 1-20</td>

<td>SYM 3548</td><td>Intron 2</td><td>CTTCTTCATGGAAGTACTCC</td><td> 3'-5'</td><td> 4</td><td> 2830-2811</td>

<td>SYM 3549</td><td>Intron 2</td><td>GAGCAGGCCGGACGATGTG</td><td> 3^Z-5^Z</td><td> 4</td><td> 403-384</td>

<td>SYM 3555</td><td>Intron 2</td><td>GATTACAGGTGTGAGCACAG</td><td> 3^Z-5^Z</td><td> 4</td><td> 4094-4075</td>

<td>SYM 3556</td><td>Intron 2</td><td>CAGTTACTAACGTCTGTGATAC</td><td> 5'-3'</td><td> 4</td><td> 1469-1490</td>

<td>SYM 3557</td><td>Intron 2</td><td>CAACAGAGGTGAGTGCCGC</td><td> 3^Z-5^Z</td><td> 4</td><td> 2249-2231</td>

<td>SYM 3558</td><td>Intron 2</td><td>GATTACAGGGTGAGACATGTG</td><td> 5^Z-3^Z</td><td> 4</td><td> 7959-7979</td>

<td>SYM 3567</td><td>Intron 2</td><td>CTGCACAAAATAAGTGTACAC</td><td> 3'-5'</td><td> 4</td><td> 1322-1302</td>

<td>SYM 3568</td><td>Intron 2</td><td>CCTCTGGATTAACATTGTTC</td><td> 5'-3'</td><td> 4</td><td> 5351-2370</td>

<td>SYM 3569</td><td>Intron 2</td><td>GTTTGAACTCTCACCACTC</td><td> 5'-3'</td><td> 4</td><td> 3431-3450</td>

<td>SYM 3570</td><td>Intron 2</td><td>GCTTCATGCCTGTGGTCCATG</td><td> 5^Z-3^Z</td><td> 4</td><td> 5037-5057</td>

<td>SYM 3571</td><td>Intron 2</td><td>CTCATCAATGGCCAGATCTTC</td><td> 3'-5'</td><td> 4</td><td> 5565-5545</td>

<td>SYM 3572</td><td>Intron 2</td><td>GAAGATAGATGTTGGGAAG</td><td> 5'-3'</td><td> 4</td><td> 6451-6469</td>

<td>SYM 3573</td><td>Intron 2</td><td>TCTCACTTTGATTGTATGTGGT</td><td> 3'-5'</td><td> 4</td><td> 7577-7557</td>

<td>SYM 3574</td><td>Intron 2</td><td>TAAGAATGAAAGAGGGGGTCG</td><td> 5'-3'</td><td> 4</td><td> 6910-6930</td>

<td>SYM 3575</td><td>Intron 2</td><td>GTAGATGATGAGGTGATGAGG</td><td> 3'-5'</td><td> 4</td><td> 7798-7778</td>

<td>SYM 3577</td><td>Intron 2</td><td>GTCTGACTGGAAGGGACCAG</td><td> 5^Z-3^Z</td><td> 4</td><td> 1638-1657</td>

<td>SYM 3578</td><td>Intron 2</td><td>GCAACACCTAAGCCATCTGTG</td><td> 3'-5'</td><td> 4</td><td> 2019-1998</td>

<td>SYM 3587</td><td>Intron 2</td><td>CATGAACTGAATGCAATCTC</td><td> 3'-5'</td><td> 4</td><td> 3879-3860</td>

<td>SYM 3588</td><td>Intron 2</td><td>GCTCTCATCTTGTATCTCAG</td><td> 3^Z-5^Z</td><td> 4</td><td> 7281-7262</td>

<td>SYM 3604</td><td>Intron 1</td><td>GGTAGATTTAGCCGATGTG</td><td> 3^Z-5^Z</td><td> 3</td><td> 2078-2060</td>

<td>SYM 3605</td><td>Intron 2</td><td>GCCTCAGCCTCCCGAGTAG</td><td> 3^Z-5^Z</td><td> 4</td><td> 7115-7097</td>

<td>SYM 3608</td><td>Intron 1</td><td>GTTCATGGCGATTCTCAAG</td><td> 5^Z-3^Z</td><td> 3</td><td> 1675-1693</td>

<td>SYM 3609</td><td>Intron 1</td><td>GATGACATCGTATGGGCAG</td><td> 5^Z-3^Z</td><td> 3</td><td> 837-855</td>

<td>SYM 3610</td><td>Intron 1</td><td>CTCCTTATTAATGCTTCAC</td><td> 3^Z-5^Z</td><td> 3</td><td> 757-739</td>

<td>SYM 3612</td><td>Intron 1</td><td>GTAGGATGGAATGGGAAGTG</td><td> 3^Z-5^Z</td><td> 3</td><td> 1342-1323</td>

The genomic fragment cloned into pS459 contains a large portion of the transcribed part of the human kappa-caseone gene. The complete sequence of all exons and introns cloned in pS459 is listed in SEQ ID NO: 4. The cloned sequence extends from the second introon to the sequences downstream of the last exon, and contains 11748 bp of introon sequences.

To obtain information about the length and sequence of the first introon of the human kappacaseone gene, a PCR experiment was designed. By making a comparison between the human cDNA sequence with the published cDNA of bovine kappa-caseon and the sequence and organization of genomic DNA, putative exoon / intro limits for the human kappa-caseon gene were postulated. A set of oligonucleotides to be used as primers were designed and synthesized.

ES 2 188 592 T3 of the PCR (SYM 3579 5'-ATCCCGGGCAGGGTTAATGCCAGGGC-3 '(SEQ ID NO: 8), SYM 3580 5'CGAAGCTTCAGCTCAACCTACTGCCAAC-3' (SEQ ID NO: 9), complementary to the sequences on both sides of the Postulated limit between exons 1 and 2. The results obtained in the experiment with

PCR with these primers indicated that the size of the first intron is approximately 2.1 kb. PCR fragments generated using SYM 3579 and SYM 3580, representing introon 1 and the partial sequence of exons 1 and 2, were cloned into XmaI and HindIII digested pUC19 for analysis. A detailed restriction map was obtained for the cloned fragments using EcoRI, HindIII, XbaI, AccI, PstI, KpnI and SacI (Figure 4). In order to exclude the potential risk of generation of mutations by PCR, independent transformants were analyzed, and the fragments generated by PCR were analyzed using the different DNA templates. To facilitate sequence analysis, 6 restriction fragments representing introon 1 sequences were isolated and subcloned into pUC 19, pS479-484 (Figure 6). The complete sequence of introon 1 of the human kappa-caseone gene was obtained by the methods described above. The plasmid pUC 19 that contained this PCR fragment with the sequence shown in SEQ ID NO: 3 (which comprises exoon 1 and part of exoon 2 in addition to introon 1) was identified and named pS460 (Figure 3).

The human kappa-caseone gene consists of 5 exons and four introns (Figure 4). The translational start is located in exoon 2 and the translational stop is located in exoon 4. The exons are relatively small, with a size range between 33 bp and 496 bp. The structure and organization of human exons are very similar to that of the bovine kappa-caseone gene (Alexander et al., 1988). The main structural difference between the human and bovine kappa-caseone genes is that the second introon of the human gene is much longer than its bovine counterpart.

As can be seen in Table 2, the exoon / introon limits are in accordance with the AG / GT rule and fit well with the consensus sequence suggested by Mount et al., 1982.

TABLE 2

Exoin-introin limits of the kappa-casein gene

Exon-intron boundaries of the kappa-casein gene Sequences at exon-intron links

Splice donor 'Splice 3' acceptor

<td>Exon</td><td> 1 -</td><td>Exon</td><td> 2</td><td>CGAGGAAAG</td><td>gtaatg ......</td><td>..... ctttag</td><td>GTGCAATAA</td>

<td>Exon</td><td> 2-</td><td>Exon</td><td> 3</td><td>CCTTTTTTG.</td><td></td><td>..... ccccag</td><td>GCTGTGGAG</td>

<td>Exon</td><td> 3-</td><td>Exon</td><td> 4</td><td>CAACCAGCA</td><td>gtaagt ......</td><td>..... ttgcag</td><td>TGCCATGAG</td>

<td>Exon</td><td> 4-</td><td>Exon</td><td> 5</td><td>TGTTGCGTC</td><td>gtaaat ......</td><td>..... ttatag</td><td>GACTTGCTG</td>

A comparison of the deduced amino acid sequences, derived from the cDNA sequence (SEQ ID NO: 1) and the genomic DNA sequence (SEQ ID NO: 4) reveals that the codon for the amino acid at position 110 (SEQ ID NO: 2) had changed from encoding for arginine (cDNA) to encoding for leucine (genoomic DNA, nucleotides 10255-10257 of SEQ ID NO: 4). This observation probably reflects the normal incidence of genetic variants.

Example 5

Expression of recombinant human kappa-casein in bacterial systems

To produce recombinant human kappa-caseone in E. coli, the coding sequence for kappa-casein was introduced into two different vectors. One vector contained a signal sequence in front of the kappa-casema coding sequence, while the other lacked such a signal sequence.

The cDNA encoding the pro-polypeptide for human kappa-caseone was isolated and cloned into pUC19, generating pS270, as described previously (Example 3). The cDNA was then introduced into an expression vector, pS339, which had been designed for the specific expression of certain states and tissues of recombinant human kappa-caseoin in transgenic animals, as described.

ES 2 188 592 T3 later (Example 7).

To facilitate introduction into expression vectors, a kappa-cason cDNA fragment containing a SalI restriction site just downstream of the translational stop codon was isolated from plasmid pS339. The SphI uonic site located downstream of the signal sequence was used to obtain a convenient site at the 5 'end. The restriction fragment of approximately 469 bp, derived from pS339 and digested with SphI and SalI, was isolated by agarose electrophoresis. This fragment was cloned into SphI and SalI digested pUC18, resulting in plasmid pS428.

To generate an expression vector encoding mature kappa-caseone without a peptide signal, the following three fragments were ligated. First, the main part of the kappa-caseone cDNA was isolated as a 481 bp fragment, from pS428 digested with SphI and BamHI. Second, synthetic oligonucleootides were designed to generate an NdeI restriction site in front of the kappa-caseone coding sequence in combination with a translational start codon. In addition, the synoetic oligonucleootides contain the sequence that encodes the eight amino acids of kappa-caseone that are not present in the pS339 fragment. These amino acids are the original amino terminus of mature human kappa-caseone. The sequences of the two synoetic oligonucleotides are, SYM 3047 5'-CTGGTTGTTTCTGGTTTTGAACCTCCA-3 '(SEQ ID NO: 10), and SYM 3048 5'-TATGGAGGTTCAAAACCAGAAACAACCAGCATG-3' (SEQ ID NO: 11).

Third, to provide regulatory elements, replication signals, and selection markers, plasmid pS26 was digested with NdeI and BamHI. The vector pS26 carries the bacteriophage T7 F10 and the terminator F (Studier et al., 1990), to regulate the expression of recombinant kappa-caseone. The vector pS26 also contains the origin of replication and the ampicillin resistance coding sequences of the plasmid pBR322.

These three fragments were ligated and transformed into competent E.coli cells. The transformants with the plaosmid were isolated. The plaosmid was analyzed by restriction mapping and sequence analysis, and was named pS415 (Figure 7).

With the aim of constructing an expression vector with a bacterial signal sequence in front of the coding sequence of mature human kappa-caseone, the following strategy was followed.

The selected bacterium signal sequence was the coding sequence for the thermostable enterotoxin II signal peptide, STII, from E. coli (Picken et al., 1983). First, to get the main part of the human kappa-caseone cDNA, the same SphI and BamHI fragment from pS428 used above was used. Second, to provide a coding sequence for the natural amino-terminal end of human kappa-caseone and to allow the introduction, in translational frame, of the STII signal sequence in front of the kappa-caeon sequence, the two oligonucleotides were synthesized. following: SYM 3240 5'-TATGCAGAGGTTCAAAAGCAGAAACAACCAGCATG-3 '(SEQID NO: 12) and SYM 3241 5'-CTGGTTGTTTCTGGTTTTGAACCTCTGCA-3' (SEQ ID NO: 13).

Third, in addition to providing regulatory elements, replication signals, and selection markers as described above, the sequence signal was derived from the digestion of the plasmid pS28 with NdeI and BamHI. This plaosmid is similar to pS26 except that the STII sequence signal is introduced downstream of the T7 promoter.

The ligation and transformation of these three fragments resulted in the expression vector pS425 (Figure 8). The vector pS425 was confirmed by sequence analysis and restriction mapping.

The expression vectors pS415 and pS425 were transformed into E.coli strains BL21 (DE3), BL21 (DE3) pLysS and BL21 (DE3) pLysE (Studier et al., 1990). The experiments were carried out as described by Studier et al., 1990. The results were analyzed by SDS-PAGE and immunoblotting using polyclonal antisera grown against human kappa-caeona (Example 2). The results obtained demonstrate that the recombinant human kappa-caseone was efficiently expressed as a non-glycosylated proteon of approximately 25 kDa, with the two different expression vectors, Figure 9.

IS 2 188 592 T3

Example 6

Recombinant human kappa-casein expression in mammalian cells

To produce recombinant human kappa caseone in mammalian cell culture systems, human kappa caseone cDNA was introduced into a eukaryotic expression vector.

Briefly, the vector contains the human kappa-caeone cDNA under the control of the upstream regulatory element, murine metallothioneone 1 (mMT-1) (Pavlakis and Hamer, 1983). The mRNA processing signals are provided by a genomic fragment that contains part of exoon II, introon II, exoon III, and elements downstream of the rabbit beta-globin gene, which is inserted downstream of the kappa-caseon cDNA. . This transcriptional unit was cloned into a vector containing the entire genome of bovine papillomavirus type 1 (BPV-1). The transcription was unidirectional for BPV-1 and the kappa-caseone transcriptional unit. For the propagation and selection of plaósmids in E. coli, the vector contained pML2d, a derivative of pBR322 (Sarver et al., 1982).

The following strategy was followed to construct this expression vector. To modify the ends of the kappa-caseon cDNA to facilitate its further cloning, a PCR experiment was carried out using pS270 as a template. Two synthetic oligonucleotides were designed for the amplification of kappa-caseone cDNA containing a BglII site at the 5 'end and a SalI site at the 3' end, SYM 2699 5'-GGGGTCGACTGGTGTTTTTATGCCGTAGGT-3 '(SEQ ID NO: 14 ) and SYM 27075'GAGAGAAGATCTGACTGGCACGAGGAAAGG-3 '(SEQ ID NO: 15). The PCR DNA was digested with BglII and SalI, separated by agarose electrophoresis and isolated as a 592 bp fragment. This fragment was ligated with the following two fragments. First, the plaosmid pS42 containing the entire BPV-1 genome, the rabbit beta-globin element, the sequences of the plasmid pML2d, and the upstream regulatory element mMT-1 were digested with SacI and SalI, and a fragment was isolated. of approximately 12.8 kb by agarose electrophoresis. The SacI uonic site was located in the mMT-1 sequence and the SalI uonic site was located upstream of the rabbit beta-globin element. Second, a plaosmid containing the entire mMT-1 gene, pS65, was digested with SacI and BglII to isolate the proximal part of the mMT-1 promoter element as an approximately 220 bp fragment. These three fragments were ligated and transformed into competent E.coli cells. Plasmids of approximately 13.6 kb were isolated and prepared from transformants for restriction mapping and sequence analysis. Due to mutations generated by PCR in the kappa-caseone cDNA sequence, it was necessary to combine the sequences of two plaosmids from different isolation solutions. Because the two isolation solutions contain mutations on both sides of the SphI site located in the kappa-caseone cDNA, the following method was used. The two plaosmids were digested with SacI and SphI, and SphI and SalI, separately, to obtain the correct kappa-caseone cDNA fragments. These two fragments were religated with the SalI and SacI fragment of pS42 as described above. Plasmid isolation solutions were prepared from some transformants and subjected to sequencing analysis and restriction mapping. The resulting expression vector was named pS330 (Figure 10).

The expression vector pS330 was co-transfected with a vector encoding the neomycin resistance gene controlled by Harvey's Sarcoma virus 5'-long terminal repeat (LRT) and polyadenylation signals from simian virus 40 (Lusky and Botchan, 1984) in murine cell lines C127 (ATCC CRL 1616) and Chinese hamster ovary cell lines (OHC), according to the colic precipitation method (Graham and van der Eb, 1973). The cells were cultured in F12-Dulbecco's Modified Eagles Medium (DMEM) (1: 1) supplemented with 10% fetal calf serum. Neomycin resistant cell clones were selected with 1.5 mg / ml (C127) or 0.5 mg / ml (OHC) of G418 (Gibco), and after

2-4 weeks resistant cell clones were isolated from the master plates and analyzed.

Cell culture media and conditioned cells were analyzed for production of recombinant human kappa-caseone by SDS-PAGE and immunoblotting using polyclonal antisera grown against human kappa-caseone (Example 2). To analyze the expression, RNA was prepared from the cells (Ausubel et al., 1991), separated by agarose-formaldehyde gel electrophoresis, and blots were made on membranes for hybridization with labeled human kappa-caseone probes.

The results obtained demonstrate the efficient expression of recombinant human kappa-caseone, figure 11.

IS 2 188 592 T3

Example 7

Expression of recombinant human kappa-caseone in transgonic animals

In order to achieve specific expression of certain stages and tissues in the lactating mammary gland in a transgenic animal of recombinant human kappa-casein, in order to be able to collect the recombinant protein from milk, the following strategies were used.

Two plasmids containing serum acidic protein (PAC) gene fragments were obtained from Dr. Lothar Hennighausen (Campbell et al., 1984). Genoemic fragments contain approximately 4.5 kb of upstream regulatory sequences, the entire transcribed region consists of 4 exons and 3 introns, and approximately 1.6 kb of 3 'flanking sequences.

To allow the introduction of the kappa-casein cDNA at the position of the unique KpnI site in PAC exeon 1, this site was modified by inserting a synthetic oligonucleotide linker at this position, SYM 2401 5'-CGTCGACGTAC-3 '( SEQIDNO: 16), and SYM 2402 5'-GTCGACGGTAC-3 '(SEQ ID NO: 17), resulting in the addition of a new SalI site 3' of the original KpnI site. Before inserting this linker, the unique SalI site naturally present in the third exoen was destroyed by digestion of SalI, the blunt end was generated by the “fill-in” reaction using the Klenow enzyme and religined. The plasmid containing the KpnI and SalI uenic sites in the first exoen is called pS314.

In order to modify the ends of the kappa-casein cDNA to facilitate introduction into this vector, a PCR experiment was carried out using pS270 as a template. Two synthetic oligonucleotides were designed for the amplification of the kappa-casein cDNA containing a KpnI site at the 5 'end and a SalI site at the 3' end, SYM 2699 5'-GGGGTCGACTGGTGTTTTATGCCGTAGGT3 '(SEQ ID NO: 14) SYM 2698 5'-GGTGGTACCATGAAGAGTTTTCTTCTAGTTG-3 '(SEQ ID NO: 18). The DNA generated with PCR was digested with KpnI and SalI, separated by agarose electrophoresis and isolated as a 566 bp fragment. This KpnI and SalI fragment was ligated with KpnI and Sal digested pS314. Transformants were isolated, and plasmids were prepared and analyzed by restriction mapping and sequencing.

To allow removal of the plasmid sequences, 5 'and 3' NotI linkers of the recombinant PAC / kappa-casein gene were inserted. The resulting expression vector is named pS339 (Figures 12 and 13). Before injection of the expression vector into the embryos, pS339 was digested with NotI and the PAC / kappa-casein fragment was isolated by agarose electrophoresis, followed by electroelution of the DNA. The eluted DNA was precipitated with ethanol and redissolved in Tris10mM (pH7.5) and 0.1mM EDTA for microinjection.

The experimental procedures used to obtain transgenic animals are described in Hogan et al., 1986.

The isolated fragments were injected, at a concentration of 3 ng / ml, into the pronucleus of C57B1 / 6JxCBA / 2J-f2 embryos obtained from donor mice prepared with 5 IU pregnant mare gonadotropin serum and 48 hours later. with 5 IU gonadotropin of human chorion for superovulation. Animals C57B1 / 6JxCBA / 2J-f2 were obtained from Bomholtgaard Breeding and Research Center Ltd. ["Bomholtgaard Research and Breeding Center, SL"], Ry, Denmark. After collecting the embryos from the oviducts, they were separated from the cumulus cells by treatment with hyaluronidase in M2 medium (Hogan et al., 1986). After washing, the embryos were transferred to M16 medium (Hogan et al., 1986) and left in an incubator with a 5% CO2 atmosphere. Injections were carried out in a microdroplet of M2 under light paraffin oil using Narishigi hydraulic micromanipulators and a Nikon inverted microscope equipped with Nomarski optics. After injections, healthy-looking embryos were implanted into C57B1 / 6JxCBA / 2J-f pseudoprepared vessels.₁ who had been given 0.37 ml of 2.5% avertin intraperitoneally.

Transgenic mice were identified by analysis of DNA prepared from docked tail samples. Tissue samples were incubated with proteinase K and extracted with phenol chloroform. The isolated DNA was used in polymerase chain reactions with primers that amplify specific fragments if the introduced heterologous DNA, represented by the expression vector fragment, is present. The animals were also analyzed by DNA hybridization experiments to confirm the PCR data and to identify possible rearrangements, the structure of the integrated vector elements, and to obtain information on the number of copies of the integrated vector elements.

IS 2 188 592 T3

In a series of experiments, 11 mice were tested. The PCR primers used for this screening were SYM 2228 complementary to the murine PAC sequences (5'-CTGTGTGGCAAGAAGGAAGTGTTGT-3 '(SEQID NO: 19)) and SYM 2603 complementary to the human kappa-casein cDNA sequence (5' -GGTTTGGGCGACGTACCACA-3 '(SEQ ID NO: 20)). The position of the two PCR primers is indicated in Figure 14. The expected size of the DNA amplified by PCR from the animals with the vector pS339 is 486 bp. The analysis resulted in the identification of two founder transgenic animals that carried the recombinant PAC / kappa-casein gene from pS339 (Figure 15), one male and one female.

Mice identified as carrying the vector DNA element pS339, founder animals, were mated and the F1 progeny were tested for transgenicity using the same procedures.

Milk samples were collected from lactating females in which 2 IU of oxytocin had been injected intraperitoneally, and 10 minutes later were anesthetized with 0.40 ml of 2.5% avertin intraperitoneally. A device for the collection of milk was attached to the nipples by means of silicone tubes and the milk was collected in 1.5 ml eppendorf tubes by gentle massage of the mammary glandula. The amount of milk varied, depending on the day of lactation, between 0.1 and 0.5 ml per mouse and collection. The collected milk was tested for the presence of recombinant human kappa-casein. This was done by SDS-PAGE, transfer to nitrocellulose membranes and incubation with polyclonal antibodies raised against native human kappa-casein. The results obtained demonstrate the expression of recombinant human kappa-casein in the milk of transgenic rats, figure 16.

Stable lines of transgenic animals are generated

In order to achieve a high level of expression of recombinant human kappa-casein in milk of transgenic animals using genomic fragments containing introin sequences derived from the human kappa-casein gene, the following expression vectors were constructed.

The first expression vector contained the complete sequences of introns 1, 3, and 4 of the human kappa-casein gene under transcriptional control of the regulatory sequences upstream of murine PAC. The downstream regulatory sequences and mRNA processing signals are provided by the genoymic fragment of human kappa-casein, which extends approximately 4.5 kb downstream of exoin 5. This expression vector construct is schematically illustrated in Figure 17.

Briefly, this expression vector is constructed as follows. Two synthetic oligonucleotides are synthesized that extend from the BsaJI cleavage site located in exon 2 to the Mn1I site located in exon 3. An EcoRI site is added upstream of the BsaJI site to facilitate subsequent cloning of this fragment; 5'-AATTCCCCTGGCATTAACCCTGCCTTTTTTG-3 '(SEQ ID NO: 21) and 5'-AAAAAAGGCAGGGTTAATGCCAGGGG-3' (SEQ ID NO: 22). Following annealing of these two synthetic oligonucleoitides, they were ligated with a 340 bp MnII / HindIII fragment derived from pS465, and introduced into EcoRI / HindIII digested pUC19. The cloned fragments are subjected to sequence analysis, and the insert is isolated as a BsaJI / HindIII fragment. This fragment is then ligated to a 0.66 kb XbaI / BsaJI fragment isolated from pS460. The XbaIIBsaJI fragment from pS460 and the BsaJI / HindIII fragment are then cloned into XbaI / HindIII digested pUC19. From this plaismid an XbaI / HindIII fragment of approximately 1 kb is isolated, and ligated with the PCR fragment described later.

To introduce a KpnI site into the 5 'untranslated leader sequence, a PCR fragment is generated containing an exoin 1 sequence and an intron 1 sequence that extends to the XbaI site. From this experiment, two PCR primers are synthesized, 5'-CCGGTACCAAGACCTGACTGGCACGAGGA-3 '(SEQ ID NO: 23), and 5'-ATTCTAGACCAGGCCTTATCT-3' (SEQ ID NO: 24). The resulting 0.77 kb fragment is then ligated to the 1 kb XbaI / HindIII fragment described above. These two fragments are cloned into KpnI / HindIII digested pCU19. A KpnI / HindIII fragment of approximately 1.8 kb containing the 5 'part of the kappa-casein minigene is isolated from the resulting plasmid.

In the next step, pS339 is digested with NotI and KpnI and the upstream PAC regulatory sequences are isolated as an approximately 4.5 kb fragment. This PAC fragment is then ligated to the 1.8 kb KpnI / HindIII fragment containing the 5 'part of the kappa-casein minigene, and cloned into the modified pUC19, pUC19-N, in which the EcoRI site has been changed to become a NotI site. The resulting plaismid, designated pPAC / K1-5 ', contains the PAC regulatory sequences 5' in front of the 5 'part of the kappa-casein minigene as a NotI / HindIII fragment of approximately

IS 2 188 592 T3

6.3 kb.

To complete the final expression vector, this 6.3 kb NotI / HindIII fragment is ligated to a SalI / partially HindIII digested fragment of approximately 7.8 kb derived from pS459, providing the 3 'residue of the transcribed portion and the non-transcribed 3 'flanking sequences of the kappa-caseone minigene. These two fragments are then ligated into digested pUC19-N SalI / NotI. The resulting recombinant PAC / kappa-caseone minigene is shown in Figure 18.

In the second expression vector, the translational initiation located in exon 2 of the human kappa-caseone gene is directly linked to the KpnI site located in exon 1 of the murine gene. The natural translational start of murine PAC is located just downstream of the KpnI site. Thus, it can be expected that the sequence around this position has evolved to provide optimal conditions for the initiation of translation. This recombinant gene is shown in Figure 18.

The vector is constructed as follows. A PCR fragment containing a KpnI site upstream of the translation start codon, ATG, was generated using the following synoetic oligonucleootides as primers; 5'-CCGGTACCATGAAGAGTTTTCTTCTAGTT-3 '(SEQ ID NO: 25), and 5'TTAAGCTTTACTTATGTTTTCATT-3' (SEQ ID NO: 26). The resulting 0.4 kb KpnI / HindIII fragment is then cloned into the digested pPAC / K1-5 'KpnI / HindIII (described above). The resulting plasmid, designated pPAC / K2-5 ', is used to complete the final expression vector. The same strategy described above is used. Briefly, the 4.9 kb NotI / HindIII fragment derived from pPAC / K2-5 'is ligated with an approximately 7.8 kb SalI / partially digested HindIII fragment derived from pS459. providing the 3 'residue of the transcribed part and the non-transcribed 3' flanking sequences of the mini kappa-caseone. These two fragments are then ligated into digested pUC19-N SalI / NotI. The resulting recombinant PAC / kappa-caseone minigene variant is shown in Figure 18.

These two kappa-caseone minigene fragments were also cloned under transcriptional control from other upstream regulatory sequences derived from other mammalian milk proteon genes, eg, beta-lactoglobulin and beta-caseone.

Example 8

Genetic variants of human kappa-casein

Human kappa-caseone is supposed to exist in a limited number of genetic variants. These variants will have a number of amino acid substitutions compared to the amino acid sequence deduced from the cDNA sequence shown in SEQ ID NO: 1. The assumption is based on the fact that most of the other species investigated to date present genetic variants, but also on the discrepancies found between the cDNA sequence obtained (SEQ ID NO: 1) and the genomic sequence as described in Example 4 and the partial sequence determined by Menon et al. Genetic variants, that is, analogs of the DNA sequence shown in SEQ ID NO: 1, can be isolated and characterized by the following procedure:

DNA is isolated from fresh human milk provided by donors with diverse genetic backgrounds (ethnicity). Anaologously, mRNA is isolated from fresh milk and cDNA is synthesized by reverse transcriptase methodology. DNA fragments are synthesized by PCR technique, using specific synoetic oligonucleotides, selected from regions with flanking sequences with pronounced discrepancies of their amino acids. The synthesized DNA fragments are isolated on agarose gels and sequenced by the dideoxy chain termination method.

Example 9

Maturation, fertilization and in vitro culture of bovine oocytes

Immature oocytes are obtained in large quantities (400-600 / doa) by aspiration of ovarian follicles obtained from slaughterhouses. Immature oocytes are cultured in vitro for a time before they become competent, to be fertilized. Once "matured", the oocytes are fertilized with sperm that has also been matured, or "trained" in vitro. The pronuclei of the fertilized oocyte are then injected with the transgene encoding the expression and secretion of human kappa-caseone. The zygotes resulting from this in vitro fertilization and microinjection are then cultured to the late morula or blastocyst phase (5-6 days) in a prepared medium, or "conditioned" by oviductal tissue. The

ES 2 188 592 T3 blasts are then non-surgically transferred to the recipient bovine species for the pregnancy balance, or analyzed to verify their integration into the transgene described in this document. In vitro maturation (IVM)

The ovaries are obtained immediately after slaughter in local slaughterhouses and the oocytes are recovered. Alternatively, live bovine oocytes are obtained by surgical, endoscopic, or transvaginal ultrasoonic methods. In all cases, the oocytes are aspirated from ovarian follicles (diameter 2-10 mm). After washing, the oocytes are placed in a maturation medium such as a medium consisting of M199 supplemented with 10% fetal bovine serum, and incubated for 24 hours at39^°C (Sirard et al. (1988) Biol. Repr. 39, 546-552).

In vitro fertilization (IVF)

Matured oocytes are fertilized with fresh or thawed sperm. The sperm is prepared for fertilization by first obtaining a sperm population enriched in its motility by a swim-up separation technique (Parrish et al., (1986) Theriogenologist 25, 591-600). The motile sperm is then added to a fertilization medium, consisting of a modified Tyrode's solution (Parrish et al., 1986, supra) supplemented with heparin to induce sperm capacitation (Parrish et al., 1988, Biol. Repr. 38, 1171-1180). Capacitation constitutes the final maturation process of sperm, which is essential for fertilization. Sperm and oocytes are co-cultured for 18 hours. A useful feature of this IVF method is that (in the case of frozen sperm) consistent and repeatable results are obtained once the optimal fertilization conditions for a specific ejaculate have been defined (Parrish et al., (1986), supra).

In vitro culture (IVC)

Conventional culture systems, which support the development of murine, rabbit, or human ovules, do not support the development of bovine embryos beyond the 8-16 cell stage. This problem has been overcome by preconditioning the culture medium with oviductal tissue. The oviduct-conditioned medium supported bovine embryos beyond the 8-16 cell stage to the blastocyst stage in vitro (Eyestone and First (1989) J. Reprod. Fert. 85, 715-720).

Bovine embryos did not yield to attempts to culture them in vitro past the 8-16 cell "block" until Camous et al. (1984) J. Reprod. Fert. 72, 779-785, demonstrated division of up to 216 cells when embryos were co-cultured with trophoblastic tissue.

The co-culture procedure was extended to oviductal tissue, based on the ability of homoo hetero-oviducts to support zygote development to blastocyst. Thus, bovine embryos co-cultured with oviductal tissue, or in a medium conditioned by oviductal tissue, developed from zygote to blastocyst in vitro (Eyestone and First (1989) J. Reprod. Fert. 85, 715-720; Eyestone, WH (1989) "Factors affecting the development of early bovine embryos in vivo and in vitro" ["Factors affecting the development of early bovine embryos in vivo and in vitro"], Doctoral Thesis, University of Wisconsin). Blasts have been produced in this system after superovulation and artificial insemination, or by in vitro maturation (IVM), and fertilization (IVF) of immature oocytes. Blasts produced in this way resulted in live pregnancies and calves upon transfer to recipient animals. The results obtained are the following:

(See TABLE on the next page)

IS 2 188 592 T3

<td>He passed</td><td>Efficiency (%)</td><td>Number (per 100)</td>

<td>VIM</td><td> 90</td><td> 90</td>

<td>VIF</td><td> 80</td><td> 72</td>

<td>VIC</td><td> 30</td><td> 22</td>

<td>Transfer of</td><td> 50</td><td> 1 1</td>

embryos (% pregnancies)

Therefore, from an initial daily production of 500 oocytes, it is expected that approximately 55 pregnancies will result.

Preparation of oviductal tissue

Co-culture and conditioning medium

1. Obtainment of oviducts after slaughter or by salpingectomy.

two. Collection of lumenal tissue by gentle scraping of intact oviducts with a glass plate.

3. Wash 5 times in 10 ml of tyrodes-hepes modified solution (Parrish et al., 1988, Biol. Reprod.

38, 1171-1180).

Four. Resuspension of the final tissue pellet in M199 + 10% fetal bovine serum in razoan 1 volume of tissue: 50 volumes of medium.

5. Tissue suspension can be used for embryo co-culture

6. Alternatively, the media can be conditioned for 48 hours; After centrifugation of the suspensioan, the supernatant can be used as an embryo culture medium. Conditioned medium can be stored at -70^°C, if desired. The conditioned medium should not be degraded for embryo culture (undiluted) (Eyestone, (1989), ibid).

Example 10

Microinjection of human kappa-casein transgene into bovine pronuclei

The DNA fragment containing the human kappa casein expression system is extracted from the vector by digestion with the appropriate restriction enzymes and separated on agarose gels. The fragment is purified by electroelution, phenol and chloroform extraction and ethanol precipitation (Maniatis et al.). The DNA fragment is dissolved and dialyzed in 10 mM Tris, 0.1 Mm EDTA pH 7.2 at a concentration of 1 to 2 µg / ml. The microinjection needles are filled with the dialyzed DNA solution.

Before in vitro fertilization, cumulus cells are removed from the egg by vortexing at full speed for 2 minutes or by pipetting the eggs up and down several times in a standard micropipette. Bovine pronuclei are initially injected as murine pronuclei (Hogan, B. et al. (1986) in: "Manipulating the mouse embryo" ["The manipulation of the mouse embryo"], Cold Spring Harbor Laboratory) with an additional step of centrifugation to visualize the pronuclei. The injection takes place 18-24 hours after fertilization. The timing varies depending on the bull used as the sperm source. Different batches of sperm cause the nuclei to become visible at different times.

In vitro fertilized and matured bovine oocytes are centrifuged in an eppendorf tube in 1 ml of tyrodes-hepes solution (Parrish, (1987)) at 14500 g for eight minutes (Wall et al., (1985), Biol. Reprod. 32, 645-651). The embryos are transferred to a drop of tyrodes-hepes solution on a slide coated with paraffin oil. Using a hydraulic system, the oocytes are fixed to a support of

ES 2 188 592 T3 oocytes such that both pronuclei are visible (using contrast interference or phase contrast optic). If necessary, the oocytes are moved to change their position in the holder to visualize the pronuclei. The injection needle is focused on the same plane of focus as one of the pronuclei. The needle is then traversed through the zona pelócida and the cytoplasm to the pronucleus. A small 13 µl volume (containing 20-100 copies of DNA) is injected into the pronucleus using a constant or pulsed flow (using a switch) of DNA solution from the needle. Alternatively, two embryonic stages of coells are centrifuged as described and the nuclei of both blastoomers are injected as described. The injected embryos are then transferred to a drop of co-culture medium as described in Example 6 in order to develop to the morula or blastocyst stage.

Example 11

Early detection of transgenesis with human kappa-casein transgene

Following microinjection of a construct as described in Example 7, the oocyte is cultured. An appropriate site from each embryo is divided and lysed (King, D. et al., (1988), Molecular Reproduction and Development 1, 57-62), proteolysis (Higuchi, R., (1989), “Amplifications (A forum for PCR Users ”[“ Amplifications (A forum for PCR users) ”] 2, 1-3) and digest. PCR is carried out as described above in Example 4 with sets of two primers, one in exoon 3 (SYM 3120) (see Table 1) and the other in exoon 4 (SYM 2887).

Example 12

Production of human kappa-casein in bovine milk

Bovine moorulas developed from microinjected oocytes are divided according to the Donahue method (Donahue, S., (1986), Genetic Engineering of Animals, ed. J. Warren Evans et al., Plenum). One half of the moorula is left in culture to develop to the blastocyst stage. The other half is subjected to DNA analysis as described in Example 8. Once the result of this analysis is known, the morula in culture develops to the blastocyst stage or as a source for nuclear transfer to enucleated zygotes. The transfer of blasts to synchronized cows is carried out according to the Betteridge method (Betteridge, KJ, (1977), in: "Embryo transfer in farm animals: a review of techniques and applications" farm: a review of techniques and applications ”].

Human kappa-caseone is detected in the milk of lactating transgenic progeny using the methods described in Example 8.

Deposits

The DNA plaosmid, named pS270 has been deposited in the collection of Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1 b, D-3300 Braunschweig, Germany, on January 17, 1992, in accordance with the provisions of the Treaty of Budapest, and has now been identified with accession number DSM 6878.

The DNA plaosmid, named pS459 and ps460 has been deposited in the collection of Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1 b, D-3300 Braunschweig, Germany, on January 20, 1993 in accordance with the provisions of the Treaty. from Budapest, and has now been identified by accession numbers DSM 7414 and DSM 7415.

The expression vectors named pS 330, 339, 415 and 425 have been deposited in the collection of Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1 b, D-3300 Braunschweig, Germany, on January 20, 1993, according to as stipulated in the Budapest Treaty, and has now been identified with the access numbers DSM 7410, DSM 7411, DSM 7412 and DSM 7413.