Primers and kits for the detection of Chlamydia trachomatis
Abstract
A FORMAT TO DESCRIBE FOR HYBRIDIZATION, AN AMPLIFIED DNA PCR ON A SOLID SUPPORT, IS DESCRIBED. AFTER MARBETTING THE AMPLIFIED DNA WITH BIOTIN, THIS IS CAPTURED BY THE PAR-BASE HYBRIDIZATION OF A SPECIFIC PROBE OF AN OLIGONUCLEOTIC THAT IS JOINED TO A SOLID SUPPORT, AND IN THIS WAY, THE DNA IS DETECTED WITH A CHROMOGENICAL DETECTION DETECTION OF BIROMENICAL DETECTION . IN A SPECIFIC FORM ELECTED, THE PROBES THAT MAKE POSSIBLE THE DETECTION OF CLAMIDIA TRACOMATIS ARE DESCRIBED.

Term
Term ended
Projected expiry passed 27 September 2010, 16 years ago.
- Priority
- Filed
- Published
- Projected expiry
- Today
25 claims: 8 independent, 17 dependent
- 1ES 2 140 372 T3 REIVINDICACIONES 1. Un procedimiento para la deteccióon de una secuencia de óacido nucleico diana etiquetada, amplificada a partir de una muestra biolóogica que comprende la hibridacioón de la citada secuencia de óacido nucleico diana con por lo menos una sonda de captura de oligonuclóeotidos, que tiene una secuencia de óacido nucleico substancialmente complementaria a la citada secuencia diana, encontróandose dicha sonda de captura unida a un soporte sóolido de poliestireno, y la determinacioón de la presencia del marcador, asociada con las citada secuencia diana, caracterizado por el hecho de que, la sonda de captura, se une al citado soporte sóolido de poliestireno, vóa una proteóna intermedia.
- 2El procedimiento seguón la reivindicacióon 1, en donde la citada proteóna intermedia, es albuómina de suero bovino.
- 3El procedimiento seguón una cualquiera de las reivindicaciones 1 y 2, en donde, el citado soporte soólido de poliestireno, es una placa de microvaloracióon que tiene una pluralidad de senos.
- 4El procedimiento seguón una cualquiera de las reivindicaciones 1 a 3, en donde las citadas sondas de captura, estóan adicionados de una cola, con homopolómeros de trifosfatos de desoxirribonucleóotidos.
- 5El procedimiento seguón una cualquiera de las reivindicaciones 1 a 4, en donde la citada hibridacioón, se lleva a cabo en presencia de tiocianto de guanidina.
- 6El procedimiento seguón una cualquiera de las reivindicaciones 1 a 5, en donde el citado material marcador, es biotina.
- 7El procedimiento seguón la reivindicacioón 6, en donde el citado marcador de biotina, se incorpora a la citada secuencia diana de óacido nucleico, o se une a ella, durante la amplificacióon de la citada secuencia diana, mediante reaccióon en cadena de la polimerasa.
- 8El procedimiento seguón la reivindicacioón 7, en donde el citado marcador de biotina, se incorpora al interior de la citada secuencia diana de aócido nucleico, utilizando cebadores 5'0-biotinilados, durante la amplificacióon de la reaccioón en cadena de la polimerasa.
- 9El procedimiento seguón una cualquiera de las reivindicaciones 6 a 8, en donde la citada deteccióon con marcador de biotina, se realiza mediante la adicioón de complejo de avidinaperoxidasa de róabano picante, y reaccióon con agente cromogóenico y substrato, para desarrollar una senal colorimetrica.
- 10El procedimiento seguón la reivindicacioón 9, en donde la cuantificacioón de la citada hibridacioón por captura, se determina por mediacióon de medicióon de la densidad óoptica de la intensidad de las senales de color desarrolladas.
- 11Un ensayo de hibridacióon de óacido nucleico, que comprende las etapas de:(a) proporcionar una muestra biolóogica que comprende una secuencia de óacido nucleico;(b) la conduccióon de la reaccioón en cadena de la polimerasa en la citada muestra, utilizando cebadores seleccionados para realizar la amplificacióon de aócidos nucleicos que tienen la citada secuencia diana, y la incorporacióon, en tal amplificacióon, de un material marcador capaz de una deteccióon subsiguiente;(c) proporcionar una sonda de captura de oligonucleoótidos, que tiene una secuencia de óacido nucleico substancialmente complementaria a la citada secuencia diana;(d) la unióon de lo citada sonda de captura a los senos de una placa de microvaloracioón, de poliestireno, vóa una proteóna intermediaria;(e) la contactacioón de la citada placa de microvaloracióon, que tiene la citada sonda de captura unida, con el producto amplificado de la etapa (b), en presencia de tiocianato de guanidina;y (f) la determinacioón de la presencia de la citada secuencia diana, mediante la deteccióon del citado marcador.
- 12El ensayo de hibridacióon seguón la reivindicacióon 11, en donde la citada proteóna intermedia, es albuómina de suero bovino.
- 13El ensayo de hibridacioón seguón las reivindicaciones 11 oó 12, en donde la citada secuencia diana, se marca para la deteccióon subsiguiente, mediante la incorporacioón de cebadores de oligonucleoótidos 5'-biotinilados durante la amplificacióon por reaccióon en cadena de la polimerasa, de secuencias diana.
- 14Un equipo de diagnoóstico, a modo de “kit”, para la deteccioón de una secuencia diana de aócido nucleico, que comprende por lo menos una placa de microvaloracióon, de poliestireno, que tiene una pluralidad de senos y que tienen unida a óestos, vóa una proteóna intermedia, por lo menos una sonda de captura de oligonucleoótidos que tiene una secuencia de óacido nucleico substancialmente complementaria a la citada secuencia diana.
- 15EL equipo de diagnoóstico, a modo de “kit”, seguón la reivindicacióon 14, que comprende adicionalmente por lo menos un reactivo para la conduccióon de la amplificacioón de la secuencia diana de óacido nucleico mediante la reaccióon en cadena de la polimerasa e hibridacioón de la citada sonda de captura en la citada secuencia diana.
- 16El equipo de diagnóostico, a modo de “kit”, seguón la reivindicacióon 15, que comprende por lo menos un cebador de PCR biotinilado a travóes de una modificacioón del brazo de engarce en el extremo 5'.
- 17El equipo de diagnoóstico, a modo de “kit”, seguón una cualquiera de las reivindicaciones 14 a 16, en donde la citada proteóna intermedia, es albuómina de suero bovino.
- 18El equipo de diagnoóstico, a modo de “kit”, seguón una cualquiera de las reivindicaciones 14 a 17, que es apropiado para la deteccioón de Clhamydia trachomatis, que comprende cebadores que se unen a las siguientes secuencia:5' CCTGACTTGTTGTTACAGGAATCCC 3' y 5' GTGTTCTTATTGTTCTGGGGAAGAGG 3' o 5' CCGCACGTTCTCTCAAGCAGGAC 3' y 5' GTCTGACGGTTCTTAAGCTGGGAG 3'
- 19El equipo de diagnoóstico, a modo de “kit” de una cualquiera de las reivindicaciones 14 a 18, 27 ES 2 que comprende una sonda que se une a las siguientes secuencias:5' GGCTTGCAGAGTTCTATAGTGCTATG 3' o 5' TTCCGGAGCGAGTTACGAAGACA 3'.
- 20Un procedimiento seguén una cualquiera de las reivindicaciones 1 a 10, o un ensayo de hibridaciéon de aécido nucleico seguén una cualquiera de las reivindicaciones 11 a 13, en donde la citada muestra bioloégica, contiene Chlamydia trachomatis y, su secuencia de éacido nucleico diana, se ha amplificado mediante la reacciéon en cadena de la polimerasa, utilizando cebadores, que son oligonucleéotidos, que se uniraén a las siguientes secuencias:5' CCTGACTTGTTGTTACAGGAATCCC 3' y 5' GTGTTCTTATTGTTCTGGGGAAGAGG 3'
- 21El procedimiento seguén la reivindicaciéon 21, en donde la citada sonda de captura, es un oligonucleoétido que se une a la siguiente secuencia:5' GGCTTGCAGAGTTCTATAGTGCTATG 3'
- 22Un procedimiento seguén una cualquiera de las reivindicaciones 1 a 10, o un ensayo de hi372 T3 28 bridacioén de éacido nucleico seguén una cualquiera de las reivindicaciones 11 a 13, en donde la citada muestra bioléogica, contiene Chlamydia trachomatis y, la secuencia de éacido nucleico, se ha amplificado mediante la reacciéon en cadena de la polimerasa, utilizando cebadores, que son oligonucleéotidos que se uniraén a las siguientes secuencias:5' CCGCACGTTCTCTCAAGCAGGAC 3' y 5' GTCTGACGGTTCTTAAGCTGGGAG 3'
- 23El procedimiento de la reivindicaciéon 22, en donde la citada sonda de captura, es un oligonucleéotido que se une a las siguientes secuencias:5' TTCCGGAGCGAGTTACGAAGACA 3'.
- 24Una placa de microvaloraciéon, de poliestireno, de utilidad en el ensayo de hibridaciéon de una secuencia diana amplificada de éacido nucleico, que tiene una pluralidad de senos y una sonda de captura de oligonucleoétidos unida ellos, véa una proteéna intermediaria, teniendo la citada sonda de captura una secuencia de aécido nucleico substancialmente complementaria a la citada secuencia diana.
- 25La placa de microvaloracioén seguén las reivindicaciones 26 éo 26, en donde la citada proteéna intermediaria, es albuémina de suero bovino. NOTA INFORMATIVA:Conforme a la reserva del art. 167.2 del Convenio de Patentes Europeas (CPE) y a la Disposición Transitoria del RD 2424/1986, de 10 de octubre, relativo a la aplicacion del Convenio de Patente Europea, las patentes europeas que designen a España y solicitadas antes del 7-10-1992, no producirán ningún efecto en Espana en la medida en que confieran proteccion a productos quámicos y farmaceuticos como tales. Esta informacioán no prejuzga que la patente estáeo no incluáda en la mencionada reserva.
Independent claims25
221 paragraphs in 20 sections, as filed
- 28036 Madrid
IS 2 140 372 T3
DESCRIPTION
Method and equipment to detect a target nucleic acid using capture probes immobilized on a polystyrene support by an intermediate protein.
The present invention provides a format for the capture by hybridization of DNA amplified by polymerase chain reaction (PCR) on a solid polystyrene support that possesses an increased protein binding capacity. Preferably, such a solid support is a microtiter plate, having a plurality of sinuses. After amplifying the target DNA (for example with biotin) during the amplification in the PCR reaction, the labeled DNA is specifically captured by base pair hybridization to an amplicon-specific oligonucleotide capture probe, which is has joined in a passive way to the bosom of micro-titration. If biotin is used as a marker, add an avidin: HPR complex and react either (a) with hydrogen peroxide substrate and o-phenylenediamine chromogen (OPD), or (b) with hydrogen peroxide substrate. Tetramethylbenzylidine (TMB) hydrogen and chromogen. A colorimetric signal is developed, which allows the quantitative detection of the DNA amplified by PCR.
The sensitivity of plate capture of biotinylated PCR products has been found to be comparable to the sensitivity using radiolabeled probes in Southern blot and oligonucleotide hybridization (OH) hybridization assays. The plate capture format, however, offers some advantages: (a) faster assay time; (b) a less labor-intensive assay format, without the use of a radiolabeled probe, and (c), an objective, quantitative evaluation of hybridization.
Another aspect of the invention is the diagnosis of specific disease states by detecting the presence of specific DNA sequences that characterize the causative organism. Specific primers and probes have been discovered for one of these microorganisms, namely Chlamydia trachomatis.
Still another aspect of the invention is the provision of kits, by way of kits, for the detection of DNA sequences, kits that comprise the solid polystyrene support and sets of PCR reagents including the specific primers and pre-selected probes for the Amplification of the target DNA sequences that hybridize with the capture probes. Such kits as a "kit" would also include, in a typical form, the enzyme or enzymes necessary for the PCR reaction, preferably a thermostable enzyme such as Taq polymerase (thermus aquéticus). In the case of the use of the microtiter plate, these will also include microtiter plates with the capture probes for the specific target sequence, already attached to them.
US Patent Numbers 4,683,195 and 4,683,202 disclose procedures for amplifying DNA sequences by a technique well known in the art as "polymerase chain reaction" (PCR). The polymerase chain reaction is a procedure in which DNA is specifically amplified by multiple synthesis of complementary strand primer amplification (Saiki et al., Science, 230: 1350-1354 and 239; 487-491; 1985 , 1988). The PCR product, amplified up to 10<sup>6</sup>-10<sup>7</sup> sometimes, it is a DNA fragment of a discrete size (amplicen) that can be detected by gel electrophoresis, or by means as described herein. In summary: PCR involves the preparation of short oligonucleotide primers, which correspond to the opposite ends of a known "target" sequence, which one tries to amplify and subsequently detect. In this procedure, DNA or RNA is extracted from cells, tissues, body fluids, and the like. The nucleic acid is denatured and the oligonucleotide primers are added in molar excesses, together with dNTPS (deoxyribonucleotide triphosphates) and a DNA polymerase enzyme, such as, preferably, heat stable Taq polymerase. After subsequent heat denaturation, cooled to allow primer annealing, and primer extension by DNA polymerase, the "long products", beginning with the respective primers, are produced complementary to the two original strands. This procedure is repeated and, after a second cycle, two original strands are produced, two long products from cycle 1, two new "long products", and two "short products". The length of these short products (amplicons) is equal to the number of nucleotides between both primers and including both primers. With additional cycles, additional "long products" are produced, increasing in a linear fashion with each cycle. However, the generation of amplicons increases at an exponential growth rate with each cycle and, through this amplification, the detection of extremely small amounts of DNA is made possible.
Through the use of PCR technology, the detection of specific DNA sequences present in minute quantities is possible. Several of these techniques involve the use of various hybridized probes attached to certain materials.
As will be fully described later in this patent application document, the present invention utilizes the fixation of a capture DNA sequence in micro-titration sinuses and the subsequent detection by hybridization to labeled amplicons (viz., biotinylated). The invention also involves the use of guanidine thioisocyanate in the hybridization stage. Some procedures that have been described in the specialized bibliography are relevant here. Two reports of this type describe the immobilization of broad target DNAs in microtiter sinuses, followed by the hybridization of these targets to biotinylated oligonucleotics or DNA probes with the displaced nick.
IS 2 140 372 T3
Cooky and colleagues, according to an article published in Nucleic Acids Research, 16: 4077-4095 (1988), immobilized target DNA of the bacteriophage Ml3 in micro-titration sinuses of Immulon® 2 plates, by incubating the target DNA in 1M ammonium acetate, during 1.5-2 hours, at a temperature of 37 ° C. The immobilized target DNA was detected after hybridization to oligonucleotide probes labeled at the ends with biotin, or internally labeled with biotin, followed by the addition of a streptavidin-HPR complex and hydrogen peroxide / o-phenylenediamine (OPD) to colorimetric detection of hybridization.
Negata and colleagues, according to an article published in FEBS Lett., 183: 179-382 (1985), immobilized target lamda DNA in micro-titration sinuses in PBS containing 0.1 M MgCl2. After incubation during the whole night. At room temperature, followed by removal of the solution, the plate was irradiated with rays of ultraviolet light. Hybridization with a biotinylated lambda DNA probe (with translated nick) was followed by complexation with avidin-betagaloctisidase. Fluorescence was measured after the addition of the substrate, 4-methylumbelliferyl-beta-D-galactooside.
Hevey and colleagues, in US Patent No.<sup>°</sup> 4,228,237, described a procedure that uses biotin that reacts to avidin (covalently linked to an enzyme), to detect a ligand in liquid medium. Our present procedure differs in that the ligand is directly tagged with biotin, not with a biotin-tagged anti-intermediate ligand. In addition to this, several other preceding disclosures describe specific hybridization probes, and diagnose the use of these; for example, US Patent No.<sup>° </sup>4,358,535 (by Flakkow et al.) And European Patent Application EP No.<sup>°</sup> 82301804.9 (publication no.<sup>°</sup> 63,879; Yale University). The latter describes the use of biotin-labeled DNA probes, detected by enzymes linked to specific antibodies to avidin or biotin.
Ranki and colleagues, in US Patent No.<sup>°</sup> 4,486,539, describe the use of two nucleic acid reagents that do not overlap each other (one of them attached to a solid support and the other labeled), to detect and identify microbes through DNA hybridization. The present invention differs from this in the fact that the target nucleic acid was itself labeled, and does not require the use of an additional labeled nucleic acid probe for detection.
Stabinsky, in US Patent No.<sup>° </sup>4,751,177 describe a DNA detection procedure in which the target DNA hybridizes in solution to a mediator polynucleootide and a labeled polynucleotide probe. The mediator polynucleootide, in turn, is complementary to a polynucleootide immobilized on a solid support. The present invention differs in that, (a) the target is tagged during amplification; no reporter tagged group is needed for detection and, (b), the capture probe is directly attached to a solid support, without the use of a mediator polynucleotide.
Guanidine thiocyanate (GuSCN) has been used in the extraction of cells and the subsequent hybridization of nucleic acid. For example, Thompson and Gillespie, Anal. Bichem., 163: 281-291 (1987), prepared radiolabeled RNA probes to detect DNA or RNA targets. In a dot-blot transfer format, the sample labeled<sup>32</sup>p, was hybridized in 5 M GuSCN / 0.1 M ethylenediaminetetrakoetic acid (EDTA), disodium salt, pH 8.0. Pellegrino and colleagues, in an article published in BioTtechniques, 5: 452-459 (1987), described a solution hybridization to detect HIV-RNA in blood cells. Blood cells were dissolved in 5 M / GuSCN and 0.1 M EDTA, and hybridized with a radiolabeled RNA probe in the same solution at room temperature. The precipitated TCA hybrids were collected on membranes and the radioactivity was determined by scintillation counter measurement. Gillespie, in International Patent Application No.<sup>°</sup> PCT / US87 / 01023, (International Publication No.<sup>°</sup> WO 87/06621), describes the use of guanidine thioisocyanate for molecular hybridization, using a labeled probe to detect target DNA bound to a solid support. The patent describes the use of GuSCN for molecular hybridization, in a concentration range of 3M-6.5M, at room temperature. The format for such hybridization includes binding of the target nucleic acid to a nitrocellulose or nylon membrane (dotblot blot or Southern blot), prehybridization, to a GuSCN radiolabeled probe, washed and detected by auto-radiography.
RK Saiki and colleagues, in an article published in 1989 in Proc. Natl. Acad. Sci. USA, 86, pages 6,230-6-234, and in European Patent Publication No.<sup>°</sup> 237,362, reveal a format for the detection of PCR amplified DNA, using a capture probe attached to a nylon membrane.
British patent n<sup>°</sup> 2202528, describes a procedure for testing nucleic acids using a capture probe attached to a solid material such as polystyrene.
Kavai and colleagues, in an article published in 1982 in J. Immunol. Meth. 48, pages 169-175, and R. Rubin and colleagues, in an article published in 1983 in Immunol. Meth. 63, pages 359366, reveal enzyme-linked immunosorbent assays (ELISAs) for the measurement of antibodies in native DNA, where the DNA antigen is bound to polystyrene, via a methylated bovine serum albumin.
The invention refers to a format for the hybridization of target DNA, which has the characteristics specified in the appended claims.
Brief description of the drawings
Figure 1 illustrates the preparation of a chemical linker arm, which was modified to facilitate biotinylation of oligonucleotide PCR primers.
Figure 2 illustrates the results of an autoradiogram of PCR products, linked to
ES 2 140 372 T3 a Nytran® membrane.
Figure 3 illustrates the results of the oligonucleotide (OH) hybridization assay, using PCR products from Example 6. Detailed description of the invention
The terms "oligonucleootide" and "primer", used in this patent application document, have the meaning defined in the aforementioned US Patent No.
4,683,202. The term "capture probe", as used herein, is defined as an oligonucleotide that is complementary or substantially complementary to the sequences of the amplicoon, within the limits of the primers. In the present preferred embodiment, the capture probe is not provided with the addition of a tail, but could be provided with the addition of a tail, with deoxyribonucleotides or ribonucleotides.
In the practice of the present invention, primers and probes are selected to be "substantially conventional" to the different strands of the target sequence to be amplified.
For one of the specific forms of presentation described in this patent application document, two sets of PCR primers and capture probes were selected from the nucleotide sequence of the cryptic plaosmid of the Chlamydia trachomatis L1 serovar (Hatt et al., Nucleic Acids Research, 16: 4053-4067, 1988). This enables the specific amplification and detection of C. trachomatis. For other general purposes, the selection of primers and probes for individual targets will be as described in the aforementioned patent no.<sup>°</sup> 4.683.202.
As an alternative and improvement of the known techniques for capturing the amplified sequence (amplicon), resulting from the application of PCR, as described previously in this patent application document, the present invention, in its form presentation, uses an oligonucleotide capture probe, passively bound to the sinuses of a micro-titration plate in order to capture biotin-labeled amplicons (by sequence-specific hybridization). Horseradish peroxidase and avidin are then used in the biotinylated amplicons, and their reaction with the substrate (hydrogen peroxide) and chromogen (either OPD or TMB), results in a quantitative colorimetric signal.
Again, as described in the aforementioned US Patent No.<sup>°</sup>
4,683,202, the deoxyribonucleotide triphosphates DATP, DCTP, DGTP and TTP are also added to the mixture of the synthesis, in appropriate quantities and, the resulting solution, is heated to a temperature of approximately 90<sup>°</sup>-100<sup>°</sup>C for about 0.5 to 10 minutes to separate template strands. After this heating period, the solutions were rapidly cooled to the temperature that is preferable for template primer annealing. To this mixture, an appropriate agent is added to induce or catalyze the primer extension reaction and the reaction is allowed to occur under conditions known in the art of this technique. The induction agent can be any compound or system that works to fulfill the synthesis of primer extension products, including enzymes. Appropriate enzymes for this purpose include for example Escherichia coli (E. coli) DNA polymerase I, Klenow Fragment of E. Coli DNA polymerase, T4 DNA polymerase, other available DNA polymerases, reverse transcriptase, and other enzymes, preferably including heat-stable enzymes (namely Taq DNA polymerase), which facilitated the incorporation of nucleootides in proper form to form the primer extension products that are complementary to each nucleic acid strand.
The newly synthesized strand and its complementary nucleic acid strand form a double-stranded molecule, the strands of which are separated using any denaturation procedure to provide single-stranded molecules, preferably hot.
In single-stranded template molecules, new nucleic acid is synthesized. If necessary, additional enzymes, nucleotides and primers can be added for the reaction, to proceed under the conditions described above. Again, the synthesis starts at one end (end) of the oligonucleotide primers and proceeds along the individual strands of the template, to produce complementary nucleic acid by primer extension.
The steps of strand separation and extension product synthesis can be repeated as often as necessary to produce the desired amount of amplified nucleic acid sequence.
General labeling techniques
In general, in the present invention, any material (molecule, atom) can be used to provide an indication of "signal" that is detectable (and preferably quantifiable) and that can bind or incorporate nucleic acid.
In a preferred embodiment of the present invention, two procedures are employed to prepare amplicons that incorporate biotin markers during PCR amplification. In the first case, biontin-11-DUTP (an anaologue of TTP, chemically modified with a biotin marker), partially replaces TTP in the PCR reaction. Biotin-11DUTP is incorporated by Taq DNA polymerase during primer extension and the resulting DNA product is "internally" tagged with biotin.
In the second case, a chemical "linker arm" is attached to the 5 'end of the oligonucleootides, attached to a solid support. In the preferred embodiment of the present invention, the "linker arm", as used in this patent application document, is a molecule that is preferentially attached to the end of the 5 'primer (by means of the chemistry of the phosphoroamadite) and is capable of covalently linking an amino group or groups to the oligonucleootide. The amino groups, in turn, are biotinylated with biotin-X-NHS: These biotin-tagged oligonucleootides, when
ES 2 140 372 T3 are used as primers in the PCR reaction, they generate amplicons that are biotinylated at their 5 'end.
The "linker arm" can be any molecule that is long enough to act as a spacer agent to distance the marker from the oligonucleotide sequence, and thus can lead to the binding of one or more suitable markers. , thermostable enzymes or ligands.
In the preferred embodiment of the present invention, one of these two, or both biotin labeling procedures, (incorporation of biotin-11-DUTP primers and biotin-labeled 5 'primers, can be used to label the amplified products of PCR.
In addition to biontin, other labels can be used in the present invention, including radiolabeled composite products, luminescent or fluorescent reagents, electron densifying reagents, thermostable enzymes, ligands, hapten-based antibody complexes, and chelating systems. The alternative markers must be compatible with the temperature conditions of the PCR amplification, as well as with the conditions of denaturation and hybridization by capture.
One such example of surrogate markers includes digoxigenin-11-dUTP, which, like biotin-11-dUTP, is incorporated by taq polymerase into amplified, labeled DNA. Digoxigenin-tagged amplicons can then be detected with an antibody to digoxigenin conjugated to alkaline phosphatase, followed by standard calorimetric detection, as shown here.
Another example of an alternative marker is deoxynucleootide triphosphates. <sup>32</sup>P-tagged, which can also be used to partially replace unlabeled deoxynucleootide triphosphates. The extent of capture hybridization could be determined, for example, by scintillation counter measurement of removable micro-titre sinuses (described later, in step 2), after capture and cleanup hybridization.
Solid polystyrene support
The capture plate or support used in the present invention would be a solid polystyrene support that has an enhanced protein binding capacity. In the art of this technique, various treatments of such support are known to comply with such intensification (for example, irradiation with<sup>60</sup>Co).
The solid polystyrene support can take any of several forms: for example, micro-titration plates, micro-magnetic particles (available from Advanced Magnetics, Inc.); pearls, strips, long rods, etc.
In a preferred way, the polystyrene support used in the present invention would be a microtiter plate having an enhanced protein binding capacity and a plurality of sinuses or pits, the most preferred of these microtiter plates being known as "Dynatech Immulon® 2" (Dynatech Laboratories, Inc., Chantilly, VA, supplied by Fisher Scientific).
General hybridization techniques
An amplicon-specific oligonucleotide capture probe is passively attached to the sinuses of an Immulon polystyrene microtiter plate.<sup>1</sup>® 2, at a concentration of 25 ng DNA / sinus, in a 1 M ammonium acetate solution. Such microtiter plates have a multiplicity of sinuses and, in this way, provide a high air area and, at the same time, allow the possibility of a high number of simultaneous tests (eg 96).
As an alternative to the passive binding described above, of this capture probe, in the present invention, a method of binding to the solid polystyrene support is used, via an intermediate protein (eg, BSA).
The hybridization step of the present invention, in a particular way the "capture hybridization", is preferably carried out in the presence of a 1M guanidine thiocyanate, disodium salt of 20 mM ethylenediaminetetraacetic acid (EDTA), at a pH value 8.0. The range of concentrations to accomplish capture hybridization on the micro-titration plate is preferably 0.5 to 2.0 molar GuSCN, and especially preferably 1.0 to 2.0 M.
Other reagents can also be used to carry out the capture hybridization. For example, a solution of ammonium thiocyanate (0.5 to 5.0 M and preferably 5.0 M) can be used in place of guanidine thiocyanate.
Another possible substitute for guanidine thiocyanate is the reagent consisting of: 30% (V7V) deionized formamide; 3 x SSPE [1 x SSPE = 0.18MNaCl, 10mMNaPO4 · pH7.7; 1 mM EDTA]; 5% (weight / volume) dextran sulfate; 0.1% Triton X-100 (octylfhenoxypolyethoxyethanol: Sigma Chemical., St. Louis. MO).
The format for this type of hybridization includes the following stages:
1. Capture probe preparation
two. Capture Plate Preparation, Microtiter Plate
3. Dilution and denaturing of labeled, amplified DNA
Four. Capture hybridization
5. Washed
6. Blocking
7. Avidin addition: horseradish peroxidase
8. Washed
9. Substrate and chromogen addition: Color development
10. Plate reading (quantification)
These stages will now be described in detail.
1. Capture probe preparation
The capture probes, referred to herein, are selected to be "substantially complementary" to the amplicon sequences, within the limits of the primers. For
ES 2 140 372 T3 therefore, capture probes must be sufficiently complementary to specifically hybridize to amplicons under capture hybridization conditions. In the present preferred embodiment of the invention, the capture probes topically contain 20-200 nucleotides.
In addition, more than one hybridization probe can be used, and additional capture probes can be used to capture the same or opposite strand of the labeled ampicoon.
Although the capture probe is defined here as "amplification sequences within the limits of the primers", primers themselves, or oligonucleotides containing primer sequence, can also be used as capture probes. It should however be noted that when such types of oligonucleotides are used as capture probes, they must compete, during hybridization with PCR primers that have not been removed from the reaction products.
The capture probes and PCR primers referred to in this patent application have been synthesized on a MilliGen 7500 DNA synthesizer (MilliGen / Bioresearch, Inc., Butlington, MA), using standard chomic methods based on beta-cyanoethylphophoric acid, although other procedures known to those skilled in this art are possible. Before their use, the capture probes and the PCR primers were partially purified by either electrophoresis through 15% polyacrylamide gels (weight / volume), or by spinning column (see example
3). The final, partially purified capture probes and primers were suspended in water, their concentration was determined spectrophotometrically, and stored at a temperature of 4<sup>°</sup>C until its need for use.
Although the capture probe, as described in this patent application document, is produced synthetically, it does not necessarily have to be so. This can also be obtained as a subset of a naturally obtained DNA, prepared by natural means (restriction endonuclease digestion).
two. Capture Plate Preparation
The oligonucleotide capture probe is preferably attached to the sinuses of a polystyrene micro-titration plate, Dynatech Immulon® 2 (Dynatech Laboratories, Inc., Chantilly, VA., Supplied by Fisher Scientific). The Immulon® 2 plate consists of an array of 96 miniature polystyrene test tubes (sinuses), arranged in a single plastic plate, designed for general use in solid phase microvolume immunoassay procedures. In the preferred form of presentation of the present invention, plates with flat bottom sinuses (400 μl volumetric capacity) are used, but it is assumed that they can also be used in sinuses and holes with the bottom in the form of " U "(300 μί volumetric capacity).
As another preferred form of presentation of the present invention, mention should be made of that in which the probe can also be attached to Removawell® bands from Immulon.<sup>1</sup>® 2 (Dynatech), which are removable strips of twelve Immulon polystyrene test tubes (sinuses)<sup>1</sup>® 2, which are provided on Removawell belt holders (Dynatech)<sup>1</sup>® in a microtiter plate format.
The oligonucleootide capture probe is diluted to provide 25 ng per sine of microtiter in 50 µ! of 1M ammonium acetate (Fisher Scientific, Fair Lawn NJ). "Blank sinuses" are also prepared by adding 1 M ammonium acetate (without oligonucleootide capture probe) to certain sinuses (to which PCR-labeled products for dummy hybridization were subsequently added). These blank sinuses are an indication of nonspecific gumming or stickiness of biotinylated DNA in sinuses of micro-titration plates, and are also used to calibrate the plate reading instrument (spectrophotometer) (See later in step 10).
The plate is sealed with mylar plate sealer (from Dynatech) and incubated at a temperature of 37<sup>°</sup>C overnight for passive fixation of the oligonucleootide capture probe to the polystyrene surface. If the plates are not to be used immediately, they are stored at a temperature of 4<sup>°</sup>C until these are needed. Plates stored in this way for up to six months did not show any significant difference in their ability to capture DNA.
Just before hybridization, the sinuses of the plates are washed twice with 200 μl of 2 x SSC [1 x SSC = 0.15M NaCl,; 15 mM sodium citrate buffer, pH 7.0] and once with 200 μ! of 2 x SSC, 0.1% (volume / volume) of Triton X100. All plate washes described herein are performed using a multi-channel pipette device (eg Titertek®), or can be performed using an automated washer suitable for microtiter plates.
3. Dilution and denaturation of labeled and amplified DNA
Biotinylated PCR products are dissolved (in a range between 1:10 to 1: 100 or more) in 1 M GuSCN (ultra-pure grade; Boehringer Mannheim Biochemicals, Indianapolis, IN), EDTA 20 mM, pH 8.0 (prepared from a 5x stock assortment), and heated to a temperature of 100<sup>°</sup>C for a period of five minutes, and rapidly cooled in an ice water bath. [The heating stage culminates the heat denaturation of the PCR products, and the rapid cooling process avoids the reassociation of amplicon strands, thus favoring hybridization to the oligonucleotide capture probes], Aliquots are loaded of 100 μ! on each breast, including the designated “blank” breasts (without capture probes) as described above (stage 2).
Four. Hybridization for capture
The specific capture of labeled and amplified DNA using oli6 capture probes
ES 2 140 372 T3 gonucleotides, is carried out by incubation at room temperature, for a period of time of 1-3 hours. During that time, the PCR amplicons are specifically captured by the oligonucleootide capture probe, based on the complementary sequence between the capture probe and the labeled amplicon.
5. Plate washing
After hybridization, the contents of all micro-titration sinuses are discarded and these sinuses are washed twice with 200 μΐ of 2 X SSC, 0.1% Triton X-100, (volume / volume), and four times with 200 µl of 0.2 x SSC of Triton X-100 at 0.1% (volume / volume) previously heated to a temperature of 37 ° C. These washes are carried out to eliminate biotinylated products not bound by union, of the microtitration breasts.
6. Blocking
After the washing process, the sinuses of the plate are "blocked" for a minimum period of 15-30 minutes, with 200 μl of a PBS solution, (PBS = 0.13 M NACl, 7 mM Na2HPO4, 3 mM Na2HPO4, pH 7,), 2% (w / v) bovine serum albumin (BSDA) (Sigma), 0.1% (v / v) Triton X-100. This "blocking" step is necessary to minimize nonspecific avidin: HPR binding in the microtiter sinuses.
7. Avidin: horseradish peroxidase
An avidin / peroxidase (HPR) complex (Vector Laboratories, Inc, Burlingname, CA) is dissolved at 1: 2000 in PBS, 0.1% (volume / volume) of Triton X-100, to a concentration 2.5 µg final avidin: HPR / ml. Fifty microliters of diluted avidin: HPR complex are added to each well and incubated for 30 minutes at room temperature. During this stage, the avidin: HPR complex binds tightly by binding to capture biotinylated products found in the breast. While the avidin: HPR complex is used in the present invention, a streptavidin: HPR complex can also be used instead. In the same way, other avidin (or streptavidin) complexed products can also be used, including: alkaline phosphatase, beta-galactosidase, luciferase, fluoresceon, Texas Red (Texas Red) or any other agents capable of generating a calorimetric signal, fluorescent or luminescent.
8. Washed
The sinuses of the micro-titration plate are then washed twice with 200 µl of PBS, 0.1% Triton X-100; and once with 200 µl PBS, 1 mM EDTA, and the final wash was incubated at room temperature for 1-10 minutes. These washes were carried out to eliminate the avidin: HRP complex, not bound by union, from the micro-titration sinuses, before proceeding with the addition of the chromogen.
9. Color development
Color development, in the preferred embodiment of the present invention, is performed using one of two chromogen systems: (a) hydrogen peroxide / OPD and (b) hydrogen peroxide / TMB.
(a) Hydrogen peroxide / OPD
After having removed the washing buffer (which has been described in step 8), 150 µl of OPD reagent [1.6 mg / ml of o-phenylenediamine disodium salt (Sigma), 0 , 0125% (volume / volume) of hydrogen peroxide (Fisher Scientific) in a 0.15 M phosphate / sodium citrate buffer, with a pH value equal to 8.0], thereby allowing the color development process in the dark, over a period of 1-30 minutes. Color development is stopped by adding 50 pl of H<sub>2</sub>SW<sub>4</sub> 4N.
(b) Hydrogen peroxide / TMB
After the final wash buffer (which has been described in step 8) has been removed, 100 µl of TMB color reagent is added to each breast. [The TMB color reagent consists of the fresh mixture of equal volumes of TMB peroxidase substrate (3,3 ', 5,5'-tetramethylbenzimide, at a concentration of 0.4 g / l in an orgaonic base; commercially available from Kirkergaard and Perry, Inc., Gaithersburg, MD) and hydrogen peroxide solution [0.02% (volume / volume) of hydrogen peroxide in a choric acid buffer; commercially available from Kirkegard and Perry, Inc.]. The reaction is allowed to proceed at room temperature in the dark for 1-30 minutes, after which time color development is stopped by the addition of 100 µl of 1 M phosphoric acid (H<sub>3</sub>PO<sub>4</sub>).
The TMB substrate produces a precipitate with a blue color. After the addition of phosphoric acid, a color change towards yellow occurs, with an ooptic density measured at 450 nm (see later in step 10). In addition to HPR, ODP and TMB substrates, other soluble substrates include:
2,2-azino-di (3-ethylbenzylthiazolinsulfonic acid) (ABTS), and 5-aminosalicholic acid (ASA). Insoluble substrates include 3-amino-9-ethylcarbozole (AEC) and 3,3-diaminobenzidene (DAB).
10. Plate reading (quantification)
After the color development has stopped, the optical density (OD) of the samples from each sinus is determined by reading an automated microtiter plate reader capable of performing a spectrophotometric determination (for example, InterMed Immunoreader® NJ-2000) at specific wavelengths for the chromogen used (see below).
The ooptic density (OD) of the blank sinuses is also determined [biotinylated PCR products added to the sinus without capture probes, as described in step 2]. This signal, (usually very low), is an indication of the false "non-specific" stickiness or stickiness of biotinylated products, rather than the signal resulting from the autoentic capture of biotinylated amplicons through hybridization with a capture probe. In this way, the ooptic density (OD) of the blank sinuses is subtracted from the ooptic density of the se7
ES 2 140 372 T3 samples, to provide an accurate quantification of false capture hybridization.
The appropriate wavelength to adjust the spectrophotometer (plate reader) is dependent on the specific chromogen used for the colorimetric reaction. Thus, if hydrogen peroxide / OPD is used, the correct wavelength setting is 490 nm; if hydrogen peroxide / TMB is used, the correct wavelength setting is 450 nm.
By using the present invention, various infectious diseases can be diagnosed through the detection of the presence of specific DNA sequences that characterize the causative microorganism; such as a bacterium (eg Chlamydia, Salmonella, etc.); viruses (for example epatitis virus); various parasites (for example those that induce malaria); etc. Specifically, the invention will be useful in the detection of Human Immunodeficiency Viruses 1 and 2 (HIV-1 and HIV-2), Human Lymphocytotrophic Viruses of T, I and II Cells (HTLV I and HTLV II ), Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Human Papilloma Virus (HPV), and Pneumocyctis carinii. As previously described in this patent application document, and as an additional form of presentation of the present invention, new capture probes and primers have been discovered that are specifically capable of being used in the detection of the organism Chlamydia trachomatis. . Such new probes and primers were described in detail in the specific examples that follow.
The present invention also offers particular advantages in the context of clone application. Through the use of micro-titration plates, a conveniently appropriate, rapid, simple, inexpensive, and sprayable assay procedure is provided. The test is highly accurate and sensitive when compared to conventional means and can be performed and conducted in the fraction of time normally required.
The reference examples now provided below are offered by way of illustration, but these are not intended to be limiting of the invention.
Reference example 1
Synthesis of biotin-11-dUTP
Biotin-11-dUTP was chemically synthesized by the procedures of Larger and colleagues. Proc. Natl. Acad. Scie. (USA), 78: 6633-6637 (1981), and suspended at a concentration of 0.4 mM in 100 mM Tris-HCl, pH 7.5, 0.4 EDTA 0.4 mM. The value of the biotin-11-dUTP: TTP ratio was optimized and the highest signal was obtained using a ratio value of 4: 1 (biotin-11-dUTP: TTP).
Reference example 2
Preparation of 5'biotinylated primers
All oligonucleotides used in PCR were synthesized on a MilliGen 7500 automated DNA synthesizer, by standard beta-cyanoethylphosphoramidite chemical processes, using standardized chemical procedures known to those skilled in this art of technology.
Oligonucleotides, prepared for use as biotinylated primers, were modified, as shown in Figure 1. The synoetic oligonucleootides, on solid support, were derived at the 5 'ends by reaction with the protected hexylaminophosphoradite [structure 1], followed by oxidation and deprotection, following standard procedures (McBride and Caruthers, Tetrahedron Letters, 24: 245-248, 1983 ), to provide 5'-amino tagged oligomers, [structure 2]. Reaction of [2] with N-hydroxysuccinimidyl osters of biotin derivatives, yielded 5'-biotinylated oligonucleotides [structure 3], in good productive yields, which were purified by polyacrylamide gel electrophoresis. (See below, reference example 3).
Reference example 3
Oligonucleootide purification
The oligonucleotides used as PCR primers or capture probes were purified according to one of the two following ways: (a) polyacrylamide gel electrophoresis, or (b), rotating column (a) Polyacrylamide gel electrophoresis
Aliquots of 100-250 µg of each oligonucleootide were vacuum dried, resuspended in a minimum volume of a gel loading buffer, [TBE (89mM trisborate, 89mM booric acid, 2mM EDTA); 90% (volume / volume) deionized formamide; 0.02% (w / v) bromophenol blue], heated to 100 ° C for 5 minutes, and rapidly cooled in an ice water bath. Samples were loaded onto a denaturing polyacrylamide gel [15% (w / v) acrylamide (acrylamide: bis-acrylamide, 29: 1) (IBI, New Haven, CT), urea (IBI) in TBE, 7 M) and The electrophoresis was carried out at a voltage of 650 volt, for a period of four hours. The DNA was visualized by UV shading on a thin layer chromatography plate (Eastman Kodak # 13254 cellulose), photographed, and the full length oligonucleootide gel band was excised. The gel fragment was triturated and DNA was eluted in water overnight. The DNA was further purified by pass over a C18 Sep-Pak cartridge.<sup>R</sup> (Waters Associates, Milford, MA), and eluted in acetonitrile (Fisher) at 40% (volume / volume). After evaporation to vacuum drying, the DNA was suspended in water and its concentration was determined by spectrophotometry. Standard concentrations were made with water and stored at 4 ° C until needed.
(b) Rotating column
Some capture probes and oligonucleotide primers were partially purified using Bio-SPin®, 6 columns (Bio-Rad. Inc .. Richmond, CA) in a rocking oscillating bucket rotor, at low centrifugal forces, following the manufacturer's instructions for the swivel column. After partial purification, the concentration of the oligonucleotides was determined by spec8
ES 2 140 372 T3 trophotometry and standard solutions were prepared with water and stored at a temperature of 4<sup>°</sup>C until needed.
Reference example 4
PCR conditions
Several primer pairs were empirically tested to determine their optimal temperature conditions for PCR amplification, paying particular attention to their annealing temperature.
Primer sets SK43 and SK44 (described by Kwok et al., J. Inf. DIs., 158: 1193-1197, 1998) were used for the detection of the HTLV-1 tax sequences. Using this pair of primers, a 100 µl PCR reaction consisted of: 1 x reaction buffer (RB) [10 x RB = 500 mM KCl; 100 mM Tris-HCl, pH 8.5; MgCl<sub>2</sub> 25 mM]; 200 µΜ each of dATP, dCTP, dGTP and TTP, 50 pmol each of SK43 and BK44, and 2 units of recombinant Taq DNA polymerase (RecombiTaq®, Cetus Perking Elmer, Norwalk. CT).
For experiments in which biotin-11-dUTP was incorporated, the contents of the reaction were as defined above, in the previous point, except for the fact that the 200 μΜ TTP were replaced with 160 μΜ biotin-11-dUTp, 40 μm TTP.
For the primer set SK43 and SK44, the temperature regimen for PCR began with a prolonged denaturation, at a temperature of 94<sup>°</sup>C, for a period of 5 minutes, followed by a reassociation step at a temperature of 50<sup>°</sup>C, for a period of time of 25 seconds, and a stage of elongation, at a temperature of 72<sup>°</sup>C, for a period of 1 minute. For the next 28 cycles, the temperature regime consisted of: denaturation at a temperature of 94<sup>°</sup>C, for a period of 25 seconds, reassociation at a temperature of 50<sup>°</sup>C, for a period of time of 25 seconds, and extended to a temperature of 72<sup>°</sup>C, for a period of 1 minute. The final cycle (30<sup>avo</sup> cycle) was: naturalization at a temperature of 94<sup>°</sup>C, for a period of 25 seconds, reassociation at a temperature of 50<sup>°</sup>C for a period of time of 25 seconds, and a prolonged elongation, at a temperature of 72<sup>°</sup>C, for a period of 10 minutes. After PCR amplification, 90 μl of reaction contents were removed from the mineral oil and stored at a temperature of 4<sup>°</sup>C, until analysis of the PCR products.
Reference example 5
Preparation of Positive and Negative Control Plasmid Templates
A plasmid (pTAX) containing all of the HTLV-1 tax genes was used as a positive control template. Plasmid DNA concentration was determined by spectrophotometry, and dilutions were made in water to provide known copy numbers of target DNA for PCR reactions. In this way, a positive control template was invented.
A heterologous plasmid with the HTLV-1 tax primer set was also used as a negative control. This plasmid pRT-POL, contained sequences of the polymerase region (pol) of HTLV-1. The plasmid DNA concentration was determined and diluted serially as described for PTAX. Plasmid concentrations were calculated to provide a known copy number in a specific volume added to the PCR reaction mixture (ie, 2 µl of template DNA added to 98 µl of the reaction mixture).
Reference example 6
Amplification of target HTLV-1 tax. Unlabeled amplicons
In order to directly compare three PCR detection systems, side by side, a known number of copies of the plasmid pTAX (from Reference Example 5) was amplified by PCR. The plasmid concentration was adjusted with water to provide 1,300, 100, 50, 10 or 10 template copies per reaction. The HTLV-1 tax SK43 / SK44 primer set (Kwok et al., J. Inf. Dis. 158; 1193-1197, 1988) was synthesized and purified by Bio-Spin® 6 spinning columns (described in Reference Example 3), and each primer was added to the PCR reaction at concentrations of 50 pmol.
Amplified DNA was generated by using each of the 200 μΜ dNTPs for PCR amplification. These unlabeled PCR products were used to determine the sensitivity of the Southern blot hybridization (Example 9) and oligonucleootide (OH) hybridization (Reference Example 10) assays. Amplification proceeded for 30 cycles, using reaction mixing conditions and temperature as described in reference example 4.
Reference example 7
Amplification of HTLV-1 tax, incorporation of biotin-11-DUTP
PCR amplification was also carried out with the primer set SK43 / SK44, to produce biotinylated amplicons, through the incorporation of biotin-11-dUTP. The conditions for this amplification of HTLV-1 tax were those described previously (reference example 6), except for the fact that the reaction mixture included dATP, dCTP and DGTP at 200 µΜ; biotin-11-DUTP at 160 µΜ; TTP at 40μΜ. The labeled PCR products were used to determine the detection sensitivity of plaque capture hybridization (Reference Example 8) and Southern blot hybridization (Reference Example 9). The amplification proceeded for 30 cycles, using the reaction mixture and the reaction conditions as described in reference example 4.
Reference Example 8
Plate Capture Assay
A capture plate was prepared by binding 25 ng of oligonucleotide "capture probe", SK45 (Kwok et al., J. Inf. Dis., 158; 1193-1197, 1998) in 1M ammonium acetate, to the sinuses from a Dynatech Immulon® plate, and incubating overnight at a temperature of 9
ES 2 140 372 T3 ture of 37<sup>°</sup>C. Biotinylated PCR products (reference example 7) were diluted to 1:25 and 1: 100 ratio values in 1M guanidine thiocyanate (GuSCN), heat denatured (five minutes, 100<sup>°</sup>C), and rapidly cooled in an ice water bath. For each sample and control, 100 μ! to each of the four microtiter sinuses (triplicate SK45 capture probe sinuses, and one "blank" sinus), and incubated for hybridization for two hours at room temperature. The contents of the plates were discarded and the plates were washed, blocked and treated with avidin: horseradish peroxidase, as described above in step 9. After adding H<sub>2</sub>OR<sub>2</sub> and ODP, color development was determined at 490 nm, using a plate reader.
The results of the plaque capture hybridization are included below. With reference to Table 1, which is provided below, the capture by hybridization of biotinylated PCR products is illustrated using HTLV-1 primers, SK43 / SK44, specific for HTLV-1 tax, amplifying homoologous template (pTAX), and amplifying heteroologous template (pRT-POL). Biotin-11-dUTP was added as a precursor, in the PCR reaction (see reference example 7) and the conditions of the PCR were as described in reference example 4. The plate capture assay was performed as described. Samples were diluted at 1:25 and 1: 100 ratio values in 1 M GuSCN for hybridization, after which the plates were washed, blocked and treated with avidin-HRP (HPR = horseradish peroxidase) . OD490 optic density was determined after 35 minutes of color development, with H2O2 / OPD. The numbers presented below are mean values of triplicate samples.
TABLE 1
<td rowspan="3"></td><td colspan="2">Optical densities</td>
<td>OD490</td><td>OD490</td>
<td>1:25 dilution</td><td>1: 100 dilution</td>
<td>1300 copies pTAX</td><td> 1,693</td><td> 0,444</td>
<td>100 copies pTAX</td><td> 0,343</td><td> 0,117</td>
<td>50 pTAX copies</td><td> 0,300</td><td> 0,053</td>
<td>20 pTAX copies</td><td> 0,123</td><td> 0,040</td>
<td>10 pTAX copies</td><td> 0,031</td><td> 0,029</td>
<td colspan="3">Negative controls:</td>
<td>No mold</td><td> 0,007</td><td> 0,026</td>
<td> 10<sub>4</sub> pTR-POL copies</td><td> 0,000</td><td> 0,042</td>
The detection limit for this assay appeared to be 20 copies of clean target plasmid (the OD490 of the 1:25 dilution was 0.0123). The negative control "no template", and the negative control using a heteroologous amplification template, gave values of 0.007 and 0.000, respectively, at a dilution of 1:25, and of 0.026 and 0.042, respectively, at a dilution of 1 / 100. Reference example 9
Agarose Gel Electrophoresis and Southern Blot Hybridization
Aliquots (25 μ ^ of both PCR products, labeled (Reference Example 6) and biotin-labeled (Reference Example 7) were vacuum dried, resuspended in 5 μl of water and 2 μl of gel loading buffer. agarose [0.25% (weight / volume) of bromophenol blue, 0.25% (weight / volume) of xylene cyanol, 30% (volume / volume) of glycerol], and loaded, in MuSieve® GTC (FMC BioProduts, Rockland, ME) 3% (w / v) / “Sea Kem” (FMC) agarose gel in 1% (w / v) TBE, containing 0.5 μg / n! of ethidium bromide. The gel was visualized with a UV transluminator and photographed. The gel was then treated for 30 minutes in 0.5N NaOH, 1M NaCl, and for 30 minutes in 0.5M Tris-HCl, pH 7 , 5, and was transferred overnight with Nytran membranes<sup>1</sup>® (Schleicher and Schuell, Inc., Keene, HN), in high concentration salt, following standardized procedures known to the person skilled in this art. The blot ("Southern Blot") was then cooked for 30 minutes at a temperature of 75<sup>°</sup>Cyse prehybridized 1-4 hours at 37<sup>°</sup>C in a sealed bag containing 6 x SSPE [1 x SSPE = 0.18 M NaCl, 10 mM NaPO4, pH, 7.7, 1 mM EDTA], 1% (w / v) sodium dodecyl sulfate (SDS) (Aodrich Chemical Co., Milwakaukee, WI); 10 x Denhardt's reagent [1% w / v each of Ficolls (Pharmacia, Piscataway, NJ), polyvinylpyrrolidone (Sigma)], and BSA (Sigma)]; and 50 μg / m! of salmon sperm DNA, heat denatured and rapidly cooled.
In Figure 2, the PCR amplification was as described in reference examples 6 and 7 and the conditions for electrophoresis, blotting and hybridization were as described in this reference example.
In the upper half of the photograph, biotin-labeled PCR products from Reference Example 7 are shown: 1,300, 100, 50, 20, and 10 copy amplified products of pTAX (lanes 1-5, respectively); "no template" PCR negative control (lane 6).
In the lower half of the photograph, the unlabeled PCR products from Reference Example 6 are shown: 1,300, 100, 50, 20, and 10 copy amplified products of pTAX (lanes 1-5, respectively); "no template" PCR negative control (lane 6).
A SK45 amplicon-specific probe was labeled with <sup>32</sup>P-ATP, using Kinase polynucleootide (Boehringen Mannheim Biochemicals), using standardized procedures in the art of this technique: For hybridization, this radiolabeled probe was added to a hybridization buffer (6 x SSPE, 1% (weight / (weight) , SDS), at a rate of 4.1 x 10<sup>6</sup> cpm / transfer. After hybridization at a temperature of 60<sup>°</sup>C for a period of 2-3 hours, the blot was subjected to severe washing and placed under a Kodak X-OMAT AR film, overnight, at a temperature of -80<sup>°</sup>C, with an intensifying screen.
IS 2 140 372 T3
After overnight exposure, the detection limit for Southern blotting was 10 copies of target plasmid pTAX for PCR products that were not biotinylated (Reference Example 6), and 20 copies of target plasmid for non-biotinylated products. Biotinylated PCR (Comparative Example 7). (See the photograph of the autoradiogram, figure 2.). The negative "no template" PCR control did not provide detectable products on autoradiography. Reference Example 10
Oligonucleotide hybridization assay
With reference to Figure 3, the OH assay conditions (OH = oligonucleootide hybridization) (preparation of the labeled probe, denaturation and annealing conditions for poyacrylamide gel electrophoresis) were those described in this reference example.
The photograph shown is an exhibition throughout the night (-80<sup>°</sup>C, with intensifying screen on Kodak X-OMAT AR film) of an autoradiogram, showing the signal generated by each of the 1,300, 100, 50, 20, or 10 copies of pTAX (bands 1-5, respectively); "no template" PCR negative control (lane 6); 10<sup>4</sup> Jurkat cells constitutively expressing HTLV-1 tax, amplified by PCR (lane 7). 10<sup>4</sup> Jurkat cells extracted, amplified by PCR (lane 8). The OH negative control in which no amplified DNA was added to the<sup>32</sup>P-S45 for OH assay (lane 9).
The unlabeled PCR products of the SK43 / SK44 primer set (Reference Example 6) were analyzed by the oligonucleootide hybridization assay (OH assay) to determine the detection limit for this format. The procedure was essentially as described by Abbot and colleagues in J. Inf. Dis. 158: 1158-1169 (1988) for liquid hybridization (LH). Thirty microliters of products amplified by PCR were added at 10 μ! of a probe mix containing 250,000 400,000 cpm of SK45 probe<sup>32</sup>P-taggedA, diluted in 44 mM EDTA, 66 mM NaCl. The DNA mixture was denatured at a temperature of 95<sup>°</sup>C, for a period of five minutes, followed immediately by probe reassociation, at a temperature of 55<sup>°</sup>C, for a period of 15 minutes. 10 microliters of agarose gel loadable buffer (Reference Example 9) was added and half volume loaded to a 10% (w / v) native polyacrylamide gel (acrylamide: bis-acrylamide, 19: 1) in TBE. Electrophoresis was at a voltage of 200 volts, until the bromophenol blue reached the front of the bottom gel. The top half of the gel was exposed to Kodak X-Omat AR film for 3 hour exposures and overnight at -80<sup>°</sup>C, with an intensifying screen.
After a three hour exposure (not shown) or after overnight (Figure 3), ten copies of amplified target plasmid pTAX can be clearly seen as a specific band. The negative control "no template" and other negative products did not produce bands. Reference example 11
Comparison essay and discussion of the results
The plaque capture assay (reference example 8) was compared to conventional assays, Southern blot hybridization (reference example 9), and oligonucleootide (OH) hybridization assay (reference example 10), for the Ability to detect monomeric numbers of HTLV-1 DNA copies, after 30 cycles of PCR amplification (reference examples 6 and 7). Each of the three detection systems tested (plaque capture assay, Southern blot assay, and OH assay), were essentially comparable in their ability to detect small numbers of clean target plasmid copies after thirty cycles of PCR amplification. . Plaque capture was found to detect 20 copies, Southern blot 10-20 copies, and OH 10 copies of clean target. Of the three detection systems, the plaque assay is the fastest, providing a definitive result within hours. In addition, the plate assay provides numerical OD values, as opposed to subjective autoradiogram bands with the Southern blot and OH assays. Therefore, the present invention enables the objective numerical determination of "positivity" of a sample, and the calculation of a target "cut-off" value for the lower limits of positivity (this cut-off value, in a DO value ( ooptic density), below which, the samples are considered as being negative with a calculated degree of statistical significance).
The DO values, provided by the plaque assay, also allow the quantitative determination of a "signal to noise" ratio value, which is of importance in the validation of a diagnostic assay. For the Southern blot and OH assay hybridization formats, the "signal to noise" ratio can only be estimated by visual evaluation of the autoradiograph signal.
Reference example 12
Chlamydia trachmatis sequence detection
Two sets of capture primers and probes were synthesized to specifically detect Chlamydia trachommatis. The oligunucleotide sequences were chosen from the cryptic plaosmid of the serovar C. trachomatis L1 (Hatt et al., Nucleic Acids Research, 16: 4053-4067, 1988).
Primer set A, generated a specific 208 bp (base pairs) amplicon, using the following primers:
CP — 24 (25-mer, + polarity, bases 195-219)
5 'GGT ATT CCT GTA ACA ACA AGT CAG G 3'
Namely, the primer is any oligonucleotide that bound to the following sequence, or caused elongation through it:
IS 2 140 372 T3
5 'C CTG ACT TGT TGT TAC AGG ATT CCC 3'
CP-27 (26-mer, polarity-, bases 377-402)
5 'CCT CTT CCC CAG ACC AAT AAG AAC AC 3'
Namely, the primer is any oligonucleotide that bound to the following sequence, or caused elongation through it:
5 'GT GTT CTT ATT GTT CTG GGG AAG AGG 3'
The specific amplicoon of primer set A of 208 bp, was detected with the capture probe CP-35:
CP 35 (26-mer, polarity-, bases 235-260)
5 'CAT AGC ACT ATA GAA CTC TGC AAG CC 3'
Namely, the probe is any oligonucleotide that binds to the following sequence:
5 'GG CTT GCA GAC TTC TAT AGT GTC ATG 3'
The Chlamydia primer set, B, generated a specific 173 bp amplicon, using the following primers:
CP-37 (23-mer, + polarity, bases 678-700)
5 'GTC CTG CTT GAG AGA ACG TGC GG 3'
Namely, the primer is any oligonucleootide that bound to the following sequence, or caused elongation through it:
5 'CC GCA CGT TCT TCT AAG CAG GAC 3'
CP-38 (24-mer, polarity-, bases 827-850)
5 'CTC CCA GCT TAA GAA CCG TCA GAC 3'
Namely, the primer is any oligonucleotide that bound to the following sequence, or caused elongation through it:
5 'GTC TGA CGG TTC TTA AGC TGG GAG 3'
The 173 bp amplicon of primer set B was detected with the CP-39 capture probe:
CP-39 (23-mer, polarity-, bases 726-748)
5 'TGT CTT CGT AAC TCG CTC CGG AA 3'
Namely, the primer, is any oligonucleootide that bound to the following sequence
5 'TT CCG GAC CGA GTT ACG AAG ACA 3'
Primer set B was used to amplify target plaosmid pCHL-1. Using 5'-biotinylated primers, the target was amplified with 30 cycles of PCR, and the biotinylated products were examined by capture hybridization (Table 2). After 30 minutes of color development (TMB / H<sub>2</sub>OR<sub>2</sub>), a small number of starting pCHL-1 copies, as small as 20, were detectable (1:25 dilution, OD<sub>450</sub> = 0.140), with negligible background signal) (OD<sub>450</sub> = 0.009 for 1:25 dilution).
TABLE 2
<td></td><td colspan="2">Optical densities</td>
<td></td><td>OD450</td><td>OD450</td>
<td></td><td>1:25 dilution</td><td>1: 100 dilution</td>
<td> 10<sup>4</sup> pCHL-1 copies</td><td> > 1,500</td><td> > 1,500</td>
<td> 10<sup>3</sup> pCHL-1 copies</td><td> > 1.500</td><td> 1.286</td>
<td> 10<sup>2</sup> pCHL-1 copies</td><td> 0,686</td><td> 0,170</td>
<td>50 copies pCHL-1</td><td> 0,215</td><td> 0,050</td>
<td>20 copies pCHL-1</td><td> 0,140</td><td> 0,035</td>
<td colspan="3">Negative control:</td>
<td>No mold</td><td> 0,009</td><td> 0,000</td>
Reference Example 13
Detection of McCoy cells and chomic isolates infected with Chlamydia Trachomatis
McCoy cells, either not inoculated or infected with C. trachomatis, were lysed in 2SP (20 mM sodium phosphate buffer, pH 7.2, 2M sucrose), with a content of 100 μg / ml of proteinase K, and 1% Tween-20, and were incubated at a temperature of 55 ° C, for a period of time of 1 hour, followed by an incubation at a temperature of 95<sup>°</sup>C for 10 minutes. Primer set A (reference example 12) was used in a 30-cycle PCR amplification and the products were examined by plaque assay, as described in comparative example 8. After 10 minutes of color development, both sets of 10 and 100 McCoy's infected cells, when added in 10<sup>5 </sup>McCoy uninfected cells, provided CD450 values> 2,000 (for both 1/25 and 1/100 dilutions of products in GuSCN). The cells extracted and amplified alone, (10<sup>5</sup> cells), provided OD450 values> 0.050.
Clinical specimens, previously graded for the extension of cytopathic effects (CPE) [in an extension or ranges from "negative" (not CPE) to 4+ (the most prominent CPEs), were extracted in the same way and amplified for 30 PCR cycles, using primer set A. The results of this assay are shown in Table 3:
TABLE 3
<td rowspan="2">Appraisal of culture</td><td rowspan="2">Volume of lysate specimen</td><td colspan="2">OD450</td>
<td>1/25 dilution in GuSCN</td><td>1/100 dilution in GuSCN</td>
<td> 4+</td><td>90 μl</td><td> > 2,000</td><td> 1,686</td>
<td> 1+</td><td>90 μl</td><td> 0,145</td><td> 0,086</td>
<td>Negative</td><td>90 μl</td><td> < 0,050</td><td> < 0,050</td>
<td> 4+</td><td>10 μl</td><td> > 2,000</td><td> 1,417</td>
<td> 1+</td><td>10 μ!</td><td> 0,050</td><td> 0,050</td>
<td>Negative</td><td>10 μl</td><td> < 0,050</td><td> < 0,050</td>
In summary, in this patent application, new ways of labeling and detecting amplified PCR products are described. These tagging and capture procedures offer al12
There are 2 advantages over conventional detection procedures:
1. Biotinylation and capture of PCR products in microtiter plates, in a faster assay. The plaque assay, in the present invention, can be performed within 2 hours, compared to about 6-24 hours for the OH assay, and as long as 48 hours for Southern blotting and hybridization.
two. The plate assay format is less labor intensive and can be automated for the analysis of
372 T3 24 large numbers of samples.
3. Unlike other assay formats examined, the plate assay format does not require the preparation, purification, or handling of hazardous radioactive probes of high specific activity.
Four. Capture of biotinylated products by plaque assay provides an objective, quantitative evaluation of hybridization; the calculation of a statistical cut-off point for the positivity of samples; and the quantitative calculation of a value of the "signal to noise" ratio.
Contents20
3 sheets
Sheet 1 Sheet 2 Sheet 3
37 members in 14 offices
Priority claims5
| Document | Office | Kind | Date |
|---|---|---|---|
| 19890414542 | United States of America | – | |
| 41454289 | United States of America | A | |
| 41454289 | United States of America | A | |
| 90118620 | – | – | – |
| US19890414542 | – | – | – |
Members37
| Document | Office | Kind | |
|---|---|---|---|
| NO904240D0 | Norway | D0 | |
| CA2026280A1 | Canada | A1 | |
| NO904240L | Norway | L | |
| EP0420260A2 | European Patent Office (EPO) | A2 | |
| AU6329090A | Australia | A | |
| ZA907706B | South Africa | B | |
| IL95800D0 | Israel | D0 | |
| BR9004881A | Brazil | A | |
| JPH03206898A | Japan | A | |
| EP0420260A3 | European Patent Office (EPO) | A3 | |
| US5232829A | United States of America | A | |
| NZ235463A | New Zealand | A | |
| NZ247522A | New Zealand | A | |
| IL95800A | Israel | A | |
| AU7280494A | Australia | A | |
| AU685144B2 | Australia | B2 | |
| NO302204B1 | Norway | B1 | |
| JP2719225B2 | Japan | B2 | |
| AU6189498A | Australia | A | |
| EP0875583A2 | European Patent Office (EPO) | A2 | |
| EP0875583A3 | European Patent Office (EPO) | A3 | |
| EP0420260B1 | European Patent Office (EPO) | B1 | |
| AT187499T | Austria | T | |
| ATE187499T1 | Austria | T1 | |
| DE69033387D1 | Germany | D1 | |
| ES2140372T3This record | Spain | T3 | |
| DK0420260T3 | Denmark | T3 | |
| DE69033387T2 | Germany | T2 | |
| AU723602B2 | Australia | B2 | |
| CA2026280C | Canada | C | |
| EP0875583B1 | European Patent Office (EPO) | B1 | |
| AT345398T | Austria | T | |
| ATE345398T1 | Austria | T1 | |
| DE69034232D1 | Germany | D1 | |
| DK0875583T3 | Denmark | T3 | |
| DE69034232T2 | Germany | T2 | |
| ES2275292T3 | Spain | T3 |
1 legal event, as the office reported them to INPADOC
Events
| Event | Code | |
|---|---|---|
| Definitive protectionFG2A | FG2A |
Numbers
- Publication
- 2140372
- Publication, DOCDB
- 2140372
- Publication, EPODOC
- ES2140372T
- Application
- 90118620
- Application, DOCDB
- 90118620
- Application, EPODOC
- ES19900118620T
Titles2
- Spanish
- METODO Y EQUIPO PARA DETECTAR UN ACIDO NUCLEICO DIANA USANDO SONDAS DE CAPTURA INMOVILIZADAS SOBRE UN SOPORTE DE POLIESTIRENO POR UNA PROTEINA INTERMEDIA.
- English
- METHOD AND EQUIPMENT TO DETECT A DIANA NUCLEIC ACID USING IMMOBILIZED CAPTURE PROBES ON A POLYSTYRENE SUPPORT BY AN INTERMEDIATE PROTEIN.
Classification
- CPC, 3
- C12Q1/6816
- C12Q1/6832
- C12Q1/689
- IPC, 6
- C12M1 00
- C07H21 04
- C12N15 09
- C12N15 11
- C12Q1 48
- C12Q1 68