Novel compositions, uses and methods for making them
14 claims: 5 independent, 9 dependent
- 1Claims of equivalent WO 2016141042 A2 CLAIMS WHA T IS CLAIMED IS:1 , A compound of Formula I: , or a pharmaceutically acceptable salt, esters prodrug, hydrate, or tautomer thereof;wherein: ¾ and Z 4 is N, CH, or CRi, provided any three N are non-adjacent;and further provided that one or more of Zi, Z 2 , Z3, and Z4 is CR;;each Rj is independently an optionally substituted d-Cg alkyl, tVCs heteroalkyl, C 2 -Cg alkenyl, Cz-Cg heteroalkenyl, C¾-Cg alkynyl, C 2 -Cg heteroalkynyl, Cj-Cg acyl, C?-Cg heteroacyi, C6- C10 aryl, C5-C12 heteroaryl, C7-C12 aryMkyl, or C6-C12 heteroarylalkyl group, or each Rj is independently H, halo, CF 3 , OR
- 22, NR2R
- 33, NR2OR3, NR2NR2R3, SR2, SOR2, SO2R2, SO2NR2R3, NR2SO2R3, NR2CON.R2R3, R2COOR3. NR 2 COR3, :CN, COOR2, COOH CONR2R3, OOCR2, CORa, or N0 2 ;and wherein ]¾ and R3 groups on the same atom or on adjacent atoms can be linked to fonn a 3-8 membered ring, optionally containing one or more N, O or S atoms;and each Ra and 3 groups, and each ring formed by linking R 2 and R3 groups together, is optionally substituted with one or more substituents selected from halo, =0, ^N-GN, -N-OR', =NR', OR', N(R')¾ SR', S0 2 R', S02 R' 2 , NR'SQ 2 R', NRCONR'2, NR'COOR", NR'CQR', CN, CQOR', CON(R')¾ OOCR', COR', and N0 2 , wherein each R' is independently H, Ci-C 6 alkyl C 2 -C 6 heteroalkyl, Ci-Cg acyl, C2-C6 heteroacyi, Ce-Cioaryl, C5-C10 heteroaryl, C7-C12 arylaikyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Ce ac l, C1-C0 heteroacyi, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, () and S;or each Rj is independently -W, -L-W, -X-L-A;wherein X is NR 6 , O, or S;W is an optionally substituted 4-7 membered azacyelic ring, optionally containing. an additional heteroatom selected from N, O and S as a ring member;L is a Cs-Cso alkylene, C1-C10 heteroalkylene, C 2 -C 1 0 alkenylene or C2-C10 heteroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=0), or C1-C6 alk l;and A is heterocycioalkyl, heteroaryl or NR4R5 where R 4 and R5 are independently H, optionally substituted Ci-Cg alkyl, Ca-Cg heteroalkyl, C 2 -Cg alkenyi, C2-C8 heteroalkenyl, Cs-Cg alkynyl, C 2 -C8 heteroalkynyl, Ci-Cg acyl, Ca-Cg heteroacyl, Ce-Cio aryl, Cy-Ci2 heteroaryl, C7-C12 arylalkyl, or Ce-Cn heteroarylalkyl group;R and R5 can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S;and each R 4 and R-, groups, and each ring formed by linking R4 and Rs groups together, is optionally substituted with one or more substituents selected from halo, =0, -N-CN, =N- OR * , =NR', OR', N(R')2, SR*, S0 2 R', S0 2 NR'2, NR'80 2 R ! , NR'CO R's, NR'COOR', NR'COR', CN, COOR.', CON(R') 2 , OOCR', COR * , and NO¾ wherein each R' is independently H, Ci-Cs alkyl, Ci-Ce heteroalkyl, Cj-Ce acyl, C2-C6 heteroacyl, Ce-CioaryL Cs-do heteroaryl, C7-C12 arylalkyl, or Ce-Cu heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, Cj-Cj alkyl, C1-C4 heteroalkyl, Ct- Ce acyl, Cj-C 6 heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;g is H optionally substituted Cj-Cg alkyl, Ca-Cg heteroalkyl, C;?~Cs alkenyi, C 2 -Cg heteroalkenyl, C2-C8 alkynyl, Cz-Cg heteroalkynyl, Ci-Cg acyl, C2-C8 heteroacyL Ce-Cio aryL Cs-Cf j heteroaryl, C7-C12 arylalkyl, or C.6-C12 heteroarylalkyl group, Re can be linked to R 4 or s to form a 3-8 membered ring;and R4 or R5 is optionall substituted with one or more substituents selected from halo, =0, =N-CN, =N-OR', -NR', OR', N(R')2, SR', S0 2 R', S0 2 NR' 2 , NR ! S02R', NR'CONR'2, NR'COOR', NR'COR', CN, COOR', CON(R') 2 , OOCR', COR', and NO ¾ wherein each R" is independently H, Ci-C 6 alkyl, C 2 -C 6 heteroalkyl, Ci-Ce acyl, C2-C6 heteroacyl, C ~Cio aryl, Cs-Cio heteroaryl, C7-C12 arylalkyl, or Ce-Ci 2 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, Cj-C alkyl, Ci-Gj heteroalkyl, Ci~C 6 acyl, Ci-Ce heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;Y is an optionally substituted 5-6 membered carbocyclic or heterocyclic ring;X;is an optionally substituted Ci-Cg alkyl, C 2 -Cg heteroalkyl, Cs-Cs alkenyl, C'2-Cs heteroalkenyl, C 2 -Cs alkynyl, Ca-Cs heteroalkynyl, Ci-Cg acyi, (¾-Cs heteroacyl, C -C10 aryl, C5-C12 heteroaryl, C 7 -Cr2 arylalkyl, or C6-C12 heteroarylalkyl group, optionally substituted with one or more halogens, =0, CF¾ CN, OR 7s N¾R¾ SR 7 SOaNRs ?, Ci-C 8 alkyl, C 2 -C§ heteroalkyl, Cs-Cs alkenyl, Ca-Cg heteroalkenyl, C2-C8 alkynyl, C2-C8 heteroalkynyl, Ci-Cg acyl, C2-C8 heteroacyl, Ce-Cio and, C5-C12 heteroaryl, C 7 -Ci2 arylalkyl, or C6-C12 heteroarylalkyl group, or;Xi is H, NR2R3, SOR2, SO2R2, SO2MR2R3, NR2SO2R3, R2CONR2R3, R2COOR3, NR2COR3, CN, COOR2, ester bioisostere, COOH, carboxy bioisostere, CONRaRa, amide bioisostere, OOCR 2s COR¾ o N0 2 ;and 11(E), a pharmaceutically acceptable salt, esters prodrug, hydrate, or tautomer thereof: wherein: Z2, Z-3 and Z 4 are independently CH or CRi;each Ri is independently an optionally substituted Ci-Cg alkyl, Cz-Cg heteroalkyl, C2-Q5 alkenyl, C2-Cg heteroalken l, Ca-Cg alkynyl, Ca-Cg heteroalkynyl, Ci-Cg acyl, Cj-Cs heteroacyl, Ce-Cio aryl, Cs-Ct2 heteroaryl, C7-C12 arylalkyl, or Ce-Cjj heteroarylalkyl group, or each is independently halo, CF 3 , OR¾ NR2R3, NR2OR3, NR2NR2R3, SR¾ SOR2, SO2R2, SO2NR3R3, NR2SO2R3, NR2CONR2R3, NR2COOR3, NR2COR3, CN, COOR2, COOH, CONR2R3, OOCR2, CORa, or NO2;or each Ri is independently -W, -L-W, -X-L-A;wherein X is NR 6 , O, or S;W is an optionally substituted 4-7 membered azacyciic ring, optionally containing an additional heteroatom selected from N, O and S as a ring member;L is a C1-C10 alkylene, C1-C10 heteroalkylene, C2- C10 alkenylene or C 2 -Cio heieroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=0), or Cl- C6 alkyl;and A is heterocycloalkyl, heteroaryl or NR4R5 where R and R5 are independently H, optionally substituted Cj-Cs alkyl, Cj-Cg heteroalkyl, C 2 -Cs alkenyl, C 2 -Cs heteroalkenyl, C 2 -Cs a!kynyi, C 2 -Cs heteroalkynyl, Ci-Cg acyl, Ca-Cg heteroacyl, Cg-Cio aryl, C5-C12 eteroaryl, C?~ Co arylalkyl, or Cs-Co heteroaryl .alkyl group;R and R5 can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S: and each R 4 and R 5 groups, and each ring formed by linking R 4 and R5 groups together, is optionally substituted with one or more substituents selected from halo, =0, = -CN, =N-OR', :=NR', OR', N(R') 2 , SR' S S0 2 R' ;SO2NR2, NR'SQaR", NR'CONR'a, NR'COOR', NR'COR', CM, COOR', C()N(R')2, OOCR', COR, and 0 2 , wherein each R* is independently H, Ci-C 6 alkyl, C2-C6 heteroalkyl, Ci~C acyl, C2-C15 heteroacyl, CVCto aryL C5-C10 heteroaryl. C-7-Cn arylalkyl, or G5-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, 0-C 4 alkyl, C1-C4 heteroalkyl, Ci~C 6 acyl, Cj-Ce heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;Re is H, optionally substituted Cj-Cg alkyl, CVCg heteroalkyl, C 2 -Cg alkenyl, C2-C8 heteroalkenyl, C 2 -Cs alkynyL C 2 -Cs heteroalkynyl, Ci-Cg acyl, C2-C8 heteroacyl, Ce-Cto aryl, C5-C12 "heteroaryl, C7- 12 arylalkyl, or C6~C.i2 heteroarylalkyl group;or Re can be linked to R 4 or R 5 to form a 3-8 membered ring;and R4 or R5 is optionally substituted with one or more substituents selected from halo, =0, :::: N-CN, =N-OR', =NR' S OR, N(R') 2 , SR\ S0 2 R", S02N ' 2 , NR'S0 2 R f , NR'CONR'2, NR'COOR', NR'COR', CN, COOR', CON(R OOCR', COR', and N0 2 , wherein each R' is independently H, Ci-Cs a!kyl, C 2 -C§ heteroalkyl, Ci-Ce acyl, C2-C6 heteroacyl,€$-Cw aryl, Cs-Cio heteroaryl, C7-C12 arylalkyl, or Ce-Cia heieroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1.-C4 alkyl, Ci-C heteroalkyl, Cf-C 6 acyl, Ci-Ce heteroacyl, hydroxy, amino, and ==0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;Y is an optionally substituted 5-6 membered carbocyclic or heterocyclic ring;Xi is an optionally substituted O-Cg alkyl, C2~Cg heteroalkyl, C 2 -Cs alkenyl, Cs-Cg heteroalkenyl, CVCg alkynyl, O-Cg heteroalkynyl, Ci-Cg acyl, C2-C8 heteroacyl, Cg-Cio aryl, C5-C12 heteroaryl, C 7 -Ci 2 arylalkyl. or Cg-Cn heteroarylalkyl group, or Xi is H, NR2R3, SOR2, SO2R2, S02NR2¾, R2S02R3, NRaCON¾R3, NR2COOR3, NR2COR3, CN, COOR2, COOH, polar substituent, carboxy bioisostere, CONR2R3, OOCR2, CORa, or NO2;wherein Ra and ¾ groups on the same atom, or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S;and each R 2 and ¾ groups, and each ring formed by Unking R 2 and R3 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N~CN, K-OR', =NR', OR', N(R')2, SR', SO2R', SOaNR's, NR'S0 2 R', R'CONR's, NR'COOR', NR'COR', CN, COOR', CON(R') 2 , OOCR', COR', and NO2, wherein each R' is independently H, Ci-C-6 alkyl, C2-C heteroalkyl, C1-C0 acyl, C2-C6 heteroacyl, Ce-Cjo aryL Cs-Cto heteroaryl, C7-C12 arylalkyl, or C¾-Ci2 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, Ct-C alkyl, C1-C4 heteroalkyl, Ci-Ce acyl, Ci-Cg heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from , O and S. , A compound of Formula 111(A), III(B) and ! 11(C): phamiaceutieaily acceptable salt, esters prodrug, hydrate, or tautomer thereof;wherein: L is a Ci-Cio alkvlene, C1-C10 heteroalkylene, C2-C10 alkenvlene or C2-C10 heteroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo ( O k or C1-C6 alkyl;A is heterocycloalkvl, heteroaryl or NR4R5 where R 4 and R¾ are independently H, optionally substituted Ci-Cs alkyl, C2-C.8 heteroalkyl Ca-Cg alkenyl, C2-C8 heteroalkenyi, Gj-Cg alkynyl, C2-C8 heteroalkynyl, Ci-Cg acyl, Cz-Cg heteroacyl, Cs-Cio aryl, Cs-Ci2 heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl group;R.4 and Rs can be linked to form a 3-8 mernbered ring, optionally containing one or more N, O or S;and each and R.5 groups, and each ring formed by linking R.4 and R5 groups together, is optionally substituted, with one or more substituents selected from halo, =0, ~ N-C , -N-OR', =NR.\ OR', N(R') 2 , 8R', S0 2 R' s SOa R'a, NR'SOsR', NR'CONR'a, NR'COOR', NR'COR', CN, COOR', CON(R ., OOCR', COR', and NO2, wherein each R f is independently H, Ci-Ce alkyl, C2-C6 heteroalkyl, Ci-Ce acyl, C2-C6 heteroacyl, Ce-Cio aryl, CS-CJO heteroaryl, C?-Ci2 arylalkyl, or C 6 -Ci2 heieroatylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C ·-€.·;heteroalkyl, Ci-C 6 acyl, Ci-Ce heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 mernbered ring optionally containing up to three heteroatoms selected from N, () and S;X is NR.6, O, or S;e is H, optionally substituted Cs-Ca alkyl, C 2 -Cg heteroalkyl, C 2 ~Cg aikenyl, Ca-Cg heteroaikenyl, C2- ¾ alkynyl, C2-C8 heteroalkynyl, Ci-Cs acyl, Ca-Cg heteroacyl, C-6-C10 aryl, C5-C12 heteroaryl, C7-C12 arylalkyi or C6-C12 heteroarylalkyl group;R f , can be linked to R4 or R5 to form a 3-8 mernbered ring;and R 4 or Rs is optionally substituted with one or more substituents selected from halo, =0, :::: N~€N, ^N-OR', =NR', OR', N(R')2, SR', SO2R, SC^N '^ 'SOaR*, NR'CONR'i, NR'COOR', NR'COR', CN, COOR', CON(R')2, OOCR', COR', and N0 2 , wherein each R' is independently H, Ci-Ce alkyl, C 2 -C 6 heteroalkyl, Cx- C-6 acyl, C2-C0 heteroacyl, C6-CtoaryI, Cs-Cio heteroaryl, C7-C12 arylalkyi, or Ce-Cu heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, Ci-C4 heteroalkyl, Ci-Ce acyl, C1-C4 heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 mernbered ring optionally containing up to three heteroatoms selected from N, O and S;Xj is an optionally substituted Ci-Cg alkyl, Ca-Cg heteroalkyl, Ca-Cg aikenyl, Ci-Cs heteroaikenyl, C2-C8 alkynyl, Ca-Cg heteroalkynyl, Ci-Cs acyl, C 2 -Cg heteroacyl, Cg-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyi, or C0-C12 heteroarylalkyl group, or Xt is H, NR2R3, SOR2, SO2R2, SO2NR2R3, NR2SO2R3, NR2CONR2R3, NR2COOR3, NR2COR3, CN, COOR2, ester bioisostere, COQH, carboxy bioisostere, CONR2R3, amide bioisostere, OOCR2, COR2, or NO2;(U)E, and (U)m are independently H, halogen, CF 3 , CN, OR?, NRsR¾ SR?, SOiNR Rsj, Ci-Cio alkyl, Ci-Cto heieroalkyl, C2-C10 alkenyl, or C2-C10 heteroalkenyl, each of whi ch, may be optionally substituted with one or more halogens, :::::: 0, or an optionally substituted 3-7 membered earbocyelic or heterocyclic ring;wherein R 2 and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more , O or S;and each 1¾ and R3 groups, and each ring formed by linking R 2 and ¾ groups together, is optionally substituted with one or more substituents selected from halo, -0, =N-CN, =N-OR', =NR', OR', N(R')2, SR', S0 2 R', SOaNR'z, NR'S fcR', NR'C Q NR'2, NR'COOR', NR'CQR', CN, COOR', CON(R' 2 , OOCR', COR 1 , and NO¾ wherein each R is independently H, C1-C0 alkyl, C2-C6 heieroalkyl, Cj-C-6 acyl, C2-C6 heteroacyl, Ce-Cio ryl, Cs-Cio heteroai l, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C heieroalkyl, C1-C6 ac l, Ci-Ce heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to for a 3-7 membered ring optionally containing up to three heteroatoms selected from N, and 8.
- 55 where R4 and R5 are independently II, optionally substituted€·-€·;alkyl, -Cx heteroalkyl. Cz-Cg alkenyl, Ca-Cg heteroalkenyl, C'2-Cs alkynyl, Ca-Cg heteroa!kynyl Ci-Cg acyl, C2-C8 heteroacyl, C
- 66-C10 aryl, C5-C12 heteroaryL ■C
- 77-C12 arylalkyl, or C 6 -Ci 2 heteroarylalkyl groupl; R and R5 can be linked to form a 3-8 membered ring, optionally containing one or more N, 0 or S; and each R4 and Rs groups, and each ring formed by linking R i and Rs groups together, is optionally substituted with one or .more substituents selected from halo, ), =N-CN, ~ N- O ', NR; OR 5 , N(R') 2 , SR', SO2R', SOaNR'a, NR'S0 2 R', NR'CONR'2, NR'COOR\ R'COR', CN, COOR', CON(R * ) ¾ OOCR * , COR", and N0 2 , wherein each R' is independently H, Ci-Ce alkyl, C?.-Ce heteroalkyl, Cj-Ce acyl, C2-C heteroacyl, Cg-Cjoaryl, Cs-Cio heteroaryl, C?-Cii arylalkyl, or C 6 -Ci2 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, Cj-C4 heteroalkyl, Ci~ C-6 acyl, Ci-Ce heteroacyl, hydroxy, amino, and ~ 0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from. N, O and S:X is N s 5 O, or S;Rs is H, optionally substituted Ci-Cg alkyl, Ca-Cg heteroalkyl, Ca-Cg aikenyl, Cs-Cg heteroalkenyl, C?.-Cg alkynyi, Ci-Cg heteroalkynyl, Ci-Cg acyl, C 2 -Cg heteroacyl, Cg-Cio aryL C-S-C12 heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl group;R.6 can be linked to R4 or R$ to form a 3-8 .membered ring;and R4 or Rs is optionally substituted with one or more substituents selected from halo, =0, =N-CN, =N-OR', =NR', OR'. N(R') 2 , SR', S0 2 R\ SOiNR , NR'S0 2 R', NR'CONR's, NR'COOR', NR'COR', CN, COOR', CON(R * )2, OOCR', COR', and NO2, wherein, each R' is independently H, Ci-Ce alkyl, C2-C6 heteroalkyl, Ci-Cs acyl, C2-C6 heteroacyl, Cg-Cio aryl, C5-C10 heteroaryl, C?-Cj 2 arylalkyl, or C -C12 heteroarylalkyl, each of which is optionally substituted, with one or more groups selected from halo, C1-C4 alkyl, Cs-C 4 heteroalkyl, Cj-Ce acyl. Ci-Qs heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;X2 is an optionally substituted Ci-Cg alkyl, Ci-Cg heteroalkyl, C 2 -Cg aikenyl, Ca-Cg heteroalkenyl, C 2 -Cg alkynyi, C 2 -Cg heteroalkynyl, Ci-Cg acyl, Cj-Cg heteroacyl, C s ¾-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or Ce-Cn heteroarylalkyl group;(U)n and (U) m are independently H, halogen, CF3, CN, ORi, NRgR% SR?, SO2NR8 , C1-C10 alkyl, Ct-d o heteroalkyl, Ca-Cio aikenyl, or C2-C10 heteroalkenyl, each of which may be optionally substituted with one or more halogens, =0, or an optionally substituted 3-7 raembered carbocyclic or heterocyclic ring;wherein R 2 and R 3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S;and each R 2 and ¾ groups, and each ring formed by linking R 2 and R 3 groups together, is optionally substituted with one or more substituents selected from halo, =0, -N-CN, =N-OR', =NR', OR', N(R')2, SR', SO2R 1 , SO2NR2, MR'S0 2 R', NR'CONR'2, NR'COOR', NR'COR', CN, COOR', C0N(R') 2 , OOCR', COR', and NOi, wherein each R f is independently H, Ci-C¼ alkyl, C2-C6 heteroalkyl, Ci-Cg acyl, C2-C6 heteroacyl, CV,-Cio aryl, Cs-Cfo heteroaryl, C7-C12 arylalkyl, or Ct-Cn heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, Ci-C* alkyl, CVd heteroalkyl, Ci-Cs acyl, Ci-Cs heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S, 5. The compound of Claim 4, wherein L is a bond, C1-C10 alkylene, C1-C10 eteroalkylene, C2-C10 alkenylene or C 2 -C 10 heteroalkenylexie linker, each of which is optionally substituted with one or more substituents selected from the group consisting of halogen, oxo ( ~ 0), or C1-C6 alkyl, 6. The compound of Claim 4. wherein A is eterocycloalkyl, heteroaryl, quaternary amine or NRj s where R4 and Rs are independently H, optionally substituted Ci-Cg alkyl, Cs-Cg heteroalkyl, Ci-Css alkenyl, Ci-Cg heteroalkenyl C 2 -Cg alkynyl, Ca-Cg heteroalkynyl, Ci-Cg acyl, C2-C8 heteroacyl, C s-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl group, 7. The compound of Claim 4, wherein 4 and R5 can be linked to form, a 3-8 membered ring, optionally containing one or more N, O or S ;and each ¾ and R 5 groups, and each ring formed by linking R 4 and 5 groups together, is optionally substituted with one or more substituents selected from halo, -O, -N-CN, =N-OR , „ =NR', OR f , N(R') 2 , SR', S0 2 R' s S0 2 NRS s NR8O2R', NR'CONR'2, NR'COOR', NR'COR*, CN, COOR', C0N(R') 2 , OOCR', COR', and NOa, wherein each R' is independently H, Ci-Ce alkyl, Ca-Cs heteroalkyl, Ci-Cg acyl, C 2 -C 6 heteroacyl Ce-Cio aryl Cs-Cio heteroaryl, C7-C12 arylalkyl, or C-6-C12 heteroarylalkyl each of which is optionally substituted with one or more groups selected from halo, Cj-C;alkyl, C1-C4 heteroalkyl, d-Ce acyi, Ci~C heteroacyl, hydroxy, amino, and =0;wherein two R* can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N , O and S.
- 1415. A. compound of Formula IV(A) and IV(B):or a pharmaceutically acceptable salt, esters prodrug, hydrate, or tautomer thereof;wherein: Bi is a bond or C-O, Ba is X-L-A;L is a t Cio alkylene, Ci-Cso heteroalkylene, C2-C1G alkenylene or C -Cio heteroalkenylene Sinker, each of which may be optionally substituted with one or more substituenis selected from the group consisting of halogen, oxo (=0), or C1-C6 alkyi;A is heterocycloalkyl, heteroaryl or NR4R5 wherein R4 and R5 are independently 11. optionally substituted Ci~Cs alkyi, Ci-Cn heteroalkyl, C2-C8 alkenyl, C 2 -Cs heteroalkenyl, C-2-Cs alkynyl, Ca-Cg heteroalkynyl, Ct-Cs aey.1, Ci-Cs heteroacyl, Cs-Cio aryl, Cs-Cia heteroaryl, C7-C12 arylalkyl, or CVC12 heteroarylalkyl group, or R 4 and Rs can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S;and each R4 and R5 groups, and each ring formed by linking R4 and 5 groups together, is optionally substituted with one or more substituenis selected from halo, =0, ==N-CN, ^N-O ', =NR', OR', N(R')2, SR ! , SCfctR', S0 2 NR'2 5 NR'S0 2 R', NR'CONR'2, NR'COOR', NR'COR;CN, COOR', CON(R')¾ OOCR\ COR', and NO2, wherein each R' is independently H, Ci-Ce alkyi, Cj-Ce heteroalkyl, Ct-Ce acyl, C2-C6 heteroacyl, Ce-Cio aryl, Cs-Cjo heteroaryl, CyCt2 arylalkyl, or Cg-Ciz heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyi, C1-C4 heteroalkyl, Ct-C-6 acyl, Ci-Cg heteroacyl, hydroxy, amino, and :=0;wherein two R ! can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from , O and S;X is CR R-6, NRe, 0, or S;wherein R 6 is H, optionally substituted Ci-Cg alkyl, Ca-Cs heteroalkyl, Ca-Cg alkenyl, C2-C8 heteroalkenyl, C2-C alkynyl, Ci-Cg hetero lkynyl, d-Cg acyl, Ca-Cg heteroaeyl, C6-C 1 0 aryl, C5-C 2 heteroaryl, C7-C12 arylaSkyl, or Ce-Cn heteroarylalkyi group;or R 6 can be linked to Rs or R5 to fonii a 3-8 membered ring;and 16. (U)n and (U) m are independently R halogen, CF3, CN, OR7, NRgR?, SR7, SO2.NR.sR9, Ci-Cio alkyl, C1-C10 heteroalkyl, C2-C10 alkenyl, or C2-Cio heteroalkenyl, each of which may be optionally substituted with one or more halogens,— O, or an optionally substituted 3-7 membered carboeyclie or heterocyclic ring, , or a pharmaceutically acceptable salt, esters prodrug, hydrate, or tautomer thereof;wherein: L is a bond, Ci-Cio alkylene, C1-C10 heteroalkylene, C Cio alkenylene or C2-C10 heteroalkenyl ene linker, each of which is optionally substituted with one or more substituents selected from the group consisting of halogen, oxo ( ::: 0), or Cj-Cs alkyl;A is heteroeycloaiky!, heteroaryl or NR4R5 where R and Rs are independently H, optionally substituted d-Cg alkyl, Ca-Cs heteroalkyl, C?.~Cg alkenyl, Ca-Cg heteroalkenyl C 2 -€g alkynyl, Ca-Cg heteroalkynyl, Ci-Cg acyl, Ca-Cg heteroaeyl, Cg-Cio aryl, C5-C12 heteroaryl, C7-C 12 arylalkyl, or CVC12 heteroarylalkyi group;¾ and R5 can be linked to form a 3-8 membered ring, optionally containing one or more , O or S;and each R4 and R5 groups, and each ring formed by linking R4 and Rs groups together, is optionally substituted with one or more substituents selected from halo, -O, -M-C , =N » OR\ =NR\ OR', N(R.')2, SR' S SO2 , S0 2 NR' 2s NR'SOaR', NR'CONR'2, NR'COOR, NR"COR ! , CN, CGOR", CON(R')2, OOCR', COR', andNCfc, wherein each R' is independently H, Ci-Cg alkyl, d-C-s heteroalkyl, Ci-Ce acyl, d-G;heteroaeyl, d-Cio aryl, C5-C 1 0 heteroaryl, C7-C 12 arylalkyl, or C6-C 12 heteroarylalkyi, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, Cf-C4 heteroalkyl, Ct- C6 acyl, Ct-Cfi heteroacyi, hydroxy, amino, and = : 0;wherein two R' can be Iinlced to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;X is NRe, O, or S;lis is H, optionally substituted Ci-Cg alkyl, C 2 -Cs heteroalkyl C 2 -Cs alkenyl, Ca-Cg heteroalkenyl, Ca-Cs alkynyh C 2 -Cg heteroalkynyl, Ci-Cg acyl, C Cg heteroacyi, Gs-Cio aryl, C5-C12 heteroaryl, C7-C0 arylalkyl, or C6-Cn heteroarylalkyl group;R.6 can be linked to R4 or R5 to form a 3-8 membered ring;and R or R$ is optionally substituted with one or more substituents selected from halo, =0, =N-CN, =N-OR', =NR' S OR', N(R')¾ SR', : S0 2 R' 5 80 2 NR' 2 , NR'SQaR', NR'CONR'2, NR'COOR', NR'COR', CN, COOR, €ON(R*)¾ OOCR', COR', and N0 2 , wherein each R ! is independently H, Ci-C 6 alkyl, C 2 -Cs heteroalkyl, Ci-Cs acyl, C2-C6 heteroacyi, Ce-Ci aryL Cs-Cjo heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, C Ce acyl, O-Cg heteroacyi hydroxy, amino, and ^ : 0;wherein two R f can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;Xz is H, Ci-Cio alkyl, Ci-Cio heteroalkyl, C2-C10 alkenyl, or C2-C10 heteroalkenyl, each of which is optionally substituted with one or more halogens, = 0, or an opiionally substituted 3-7 membered carbocyclic or heterocyclic ring;(Din and (U)ffl are independently H, halogen, CF3, CN, OR?, NRgRg, SR7, SO2NR8R9, Ci-Cio alkyl, Ci-Cio heteroalkyl, C2-C10 alkenyl, or C2-C10 heteroalkenyl, each of which is optionally substituted with one or more halogens, =0, or an optionally substituted 3-7 membered carbocyclic or heterocyclic ring;wherein R 2 and R3 groups on the same atom or on adjacent atoms can be linked to lorn: a 3-8 membered ring, optionally containing one or more N, O or S;and each R2 and R3 groups, and each ring formed by linking R 2 and R3 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, =N-OR', =NR', OR', N(R') 2 , SR', S0 2 R', S02NR'2, NR , S0 2 R' 5 NR'CONR'2, NR'COOR', NR'COR', CN, COOR', CON(R.% OOCR', COR', and NO2, wherein each IV is independently H, Ci-C 6 alkyl, CI-CG heteroalkyl, O-Cs acyl, C2-C6 heteroacyi, Cg-Cio aryl, C5-C10 heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroatylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, Ci-Gj heieroalkyl, Ci-C 6 acyl, Cj-Cfi heteroacyl, hydroxy, amino, and : :: 0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heieroatoms selected from N, O and S. , A com ound of Formula VI(A), VI(B) and VI(C): 5 r a pharmaceutically acceptable salt, esters prodrug, hydrate, or taittomer thereof;wherein: Bi is a bond or C ::: Q;B 2 is X-L-A;I, is a Ct-CjQ alkylene, Cj-Cio heteroalkylene, Ca-Cio alkenylene or C2-C10 heteroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consi sting of halogen, oxo ( ~ 0), or C1-C6 alkyl;A is heterocycloalkyl, heteroaryi or M¾Rs wherein R4 and R 5 are independently H, optionally substituted Ci-C« alkyl Ca-Cg heieroalkyl, Cz-C alkenyl, C 2 -CK heteroalkenyl, Cz-Cg alkynyl, Ca-Cg heteroalkynyl, Cj-Cg acyl, C 2 -Cs heteroacyl, CVCio aryl, C5-C12 heteroaryi, C7-C12 arylaikyl, or CVCu heteroarylalkyl group, or R4 and R 5 can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S;and each R4 and R5 groups, and each ring formed by linking R.;and R5 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, =N-OR' } -NR', OR', N(R')2, SR' S SO2R', SOaNR'a, NR'SO R', NR'CONR*2, NR'COOR', R'COR', CN, COOR', CON(R')¾ OOCR', COR', and NOa, wherein each R' is independently H, O-Ce alkyl. C2-C0 heteroalkyl, Ci-Q acyl, C2-C6 heteroacyl, Ce-Cio aryl, CS-CJO heteroaryi, C7-C12 arylaikyl, or C6-C12 heteroarylalkyl, each of which is optionally substit uted wi th one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, C\-Ce acyl, C -Ce heteroacyl, hydroxy, amino, and =0;wherein two R ! can be linked to form a 3-7 membered ring optionall containing up to three heteroatoms selected from N, O and S;X is CReRs, R 6 , O, or S;wherein R 6 is H, optionally substituted Ci-Cg alkyl, Ca-Cg heteroalkyl, C2-C3 alkenyl, C'2-Cs beteroalkenyi, C 2 -Cs alkynyl, Ci-Cg heteroalkynyl, Ci-Cg acyi, Ca-Cg heteroacyl C6-C10 aryl, C5-C12 heteroaryl C7-C12 arylalkyl, or Ce-Cn heteroarylalkyl group;or R 6 can be linked to R or R 5 to form a 3-8 membered ring;and (U)« and (U)m are independently H, halogen, CF 3s CN, OR7, NRsR 9 , SR 7 , S ( ¼NR*R9, Ci-Cio alkyl, Ci-Cio heteroalkyl, C Cs alkenyl, or C2-C10 heteroalkenyl each of which may be optionally substituted with one or more halogens,— O, or an optionally substituted 3-7 membered carboeyclic or 19. A compound of Formula ΥΠ: , or a ph rmaceutically acceptable salt, esters prodrug, hydrate, or tautomer thereof wherein;B is an optionally substituted 5-6 membered carboeyclic or heterocyclic ring;Zs is N or CX 2 ;each Zs and ¾ is N, CH, or CRi, provided any three are non-adjacent;and further provided that one or more of Z\, ' % ¾ and Z is CRi;each Ri is independently an optionally substituted Ci-Cs alkyl. C2-C8 heteroalkyl, C2-C8 alkenyl, C 2 -Cg heteroalkenyl, Ci-Cs alkynyl, C2-C8 heteroalkynyl, Ci-Cg acyl Ca-Cg heteroacyl, C - CJO aryl, Cs-Cn heteroaryl, C 7 -Cj2 arylalkyl, or C6~Ci 2 heteroarylalkyl group, or each Ri is independently H, halo, CF 3s OR¾ NR2R3, NR2OR3, NR2NR2R3, SRa, SGR 2 , SO2R2, SC NRaRa, NR2SO2R3, NR2CONR2R3, NR2COOR3, NR2COR3, CN, COOR2, COOH, CO R2R3, OOCR2, COR2, W O2;and wherein R2 and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S atoms;and each R2 and R3 groups, and each ring f 0 rmed b y linking R? and l groups together, is optionally substituted with one or more suhstituents selected from halo, =0, -N-CN, =N-OR', = R\ OR', N(R')2, SR', SG 2 R', S0 2 NR' 2 , NR'SOaR', NR'CONR¾ NR'COOR", R'COR-, CN, COOR', CON(R')2, OOCR", COR', and NO2, wherein each R* is independently H, Ci-C alkyl, C2-C6 heteroalkyl, Ci-Cg acyl, Ca-Cs heteroacyl, Ce-cio aryl, C5.C10 heteroaryl. C?-Ci2 arylalkyl, 0 r Ce-Cn heter 0 ar y ialk l, each of ic h is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Cg aeyl, Ci-Ce heteroacyl, hyd f ox y , amino, and ==0;wherein two R' can be linked to fonn a 3-7 membered ring optionally containing up to three heteroatoms selected from N, () and S;two Rl groups on adjacent atoms may form a carboxylie ring, heterocyclic ring, aryl or heteroaryl, each of which may be optionally substituted and/or fused with a cyclic ring;or each Ri is independently -W, -L~W, -X-L-A;wherein X is Nils, O, or S;W is an optionally substituted 4-7 membered azacyciic ring, optionally containing an additional heteroatom selected from N, 0 and S as a ring member;L is a Cj-Cio alkylene, Ci-Cio heieroalkyiene, C2-Cio aikenylene or C2-C50 heteroalkenyi ene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=0), or C1-C6 alkyl;and A is heterocycioalkyl, heteroaryl or NR4R5 where R and R5 are independently H, optionally substituted Ci-Cg alkyl, C 2 ~Cs heteroalkyl, Cs-Cg alkenyl, Cj-Cg heteroalkenyi C2-C alkynyl, Cz-Cg heteroalkynyl, Ci-Cg acyl, Ca-Cg heteroacyl, CVC10 aryl, C5-C12 heteroaryl, C?-Ci2 arylalkyl, or C -C12 heteroarylalkyl group;R4 and Rs can be linked to fonn a 3-8 membered ring, optionally containing one or more , O or S;and each R 4 and Rs groups, and each ring formed by linking R4 and R5 groups together, is optionally substituted with one or more substituents selected from halo, ::: Q, ^N-CN* -~N- OR', =NR\ OR, N(R*)2, SR', SCfcR', S0 2 NR' 2 , 'SCbR', NR'CONR'2, NR'COOR', N ' COR', CN, COOR', CON(R')2, OOCR', COR * , and N0 2 , wherein each R' is independently H, C«-Ce alkyl, C 2 -Gs heteroalkyl, Ci-Cg acyl, C2-C6 heteroacyl, Ce-Cio ryL Cs-Cto heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, Ci-CU heteroalkyl, CV C acyl, Ci-Cg heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;Re is H, optionally substituted Ci-Cg alkyl, C2-C8 heteroalkyl, Cs-Cg alkenyl, C2-C8 heteroalkenyi, C?.~Cg alkynyl, C2-C8 heteroalkynyl, Ci-Cg aeyl, C2~Cg heteroacyl, C $-Cjo aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or CVCn heteroarylalkyl group;Re can be linked to R* or R¾ to form a 3-8 membered ring;and R 4 or Rs is optionally substituted with one or more substituents selected from halo, =0, ^N-CN, =N-OR', -NR ! , OR', N(R')2, SR', S0 2 R', SO2NR' , NR'SCbR', NR'CONR'2, NR'COOR', NR'COR 1 , CN, COOR', CON(R')2, OOCR', COR*, and NOi, wherein each R' is independentiy H, Ci-C 6 alkyl, C 2 -C¼ heteroalkyi, Cj-Ce acyS, C2-C0 heteroacyl, Ce-Cioaryl, C5-C10 heteroaryl, C7-C12 arylaikyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, d-C alkyl, C1-C4 heteroalkyi, Cj-Cti acyl, Cs-Ce. heteroacyl, hydroxy, amino, and =0;wherein two R* can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;Xi is an optionally substituted Ct-Cg alkyl, C2-C8 heteroalkyi, CVCg alkenyl, C 2 -Cg heteroalkenyl, Ca-Cg alkynyl, C 2 -Cg heteroalkynyl, Ci-Cg acyl, Q-Cs heteroacyl, Ce-C-io aryl, C5-C12 heteroaryl, C7-C12 arylaikyl, or Ce-Cn heteroarylalkyl group, optionally substituted with one or more halogens, =0, CF 3 , CN, OR?, NRgR¾ SR?, SC NRgRg, Ci-Cg alkyl, C 2 ~Cg heteroalkyi, C 2 -Cg alkenyl, C -CN heteroalkenyl, C 2 -Cs alkynyl, Ca-Cg heteroalkynyl, Ci-Cg acyl, Ca-Cs heteroacyl Ce-Cjo aryl, CS-CJS heteroaryl, C7-C12 arylaikyl, or ( C12 heteroarylalkyl group, or;Xt is H, NR2R3, SOR 2s SO2R2, SO2NR2R3, NR2SO2R3, NR2CONR2R3, NR 2 CDOR¾ NR2COR3, CN, COOR2, ester bioisostere, COOH, carboxy bioisostere, CONR2R3, amide bioisostere, OOCR2, COR2, or N0 2 ;X 2 is, H, halogen, CF 3 , CR OR.?, NR S R¾ SR 7 , SQ 2 NRgR¾ Cj-Cio alkyl, Ci-Cio heteroalkyi, C 2 - Cio alkenyl. or C2-C10 heteroalkenyl, each of which may be optionally substituted with one or more halogens, =0, or an optional!} ' substituted 3-7 membered earbocy ic or heterocyclic ring;each X3, X4 and X5 is N or CRio;each Rio is independently an optionally substituted Ct-Cg alkyl, CVCg heteroalkyi, C 2 -Cs alkenyl, C 2 ~Cg heteroalkenyl, C 2 -Cg alkynyl, Ci-Ce heteroalkynyl, Ci-Cg acyl, C2-C8 heteroacyl, Gs-Cio aryl, C Cj2 heteroaryl, C7-C12 arylaikyl, or Ce-Cn heteroarylalkyl group, or each Ri is independently H, halo, CF 3 , OR2, NR2R3, NR 2 OR¾ R2NR2R3, SRa, SOR2, SO2R2, SO2NR2R3, NR 2 S0 2 R 3 , NR2CONR2R3, NR2COOR3, NR2COR3, CN, COQ¾ COOH, CONR2R3, OOCR2, COR2, or N0 2 ;and wherein R2 and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S atoms;and each Ra and R3 groups, and each ring formed by linking I½ and R3 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N~CN, -N-OR', =NR', OR', N(R')- 2 , SR', S02 ", S0 2 NR' 2 , NR'SOaR', NR'CON 'a, NR'COoR', NR'CGR', CN, COOR', c ON(R*)2 s OOCR', COR', and NG2, wherein each R' is independently H, Ci-Gs alkyl, C2-C6 heteroalkyl, Ci-C aeyl, C'j-Cft heteroacyl, CVCjo aryl, Cs-αο heteroaryl, C7-C12 aryialkyl, or C6-C12 heteroarylalkyl, each of which ,s optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Cg acyl, Ci-Cg heteroacyl, hydroxy, amino, and=0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;two io groups on adjacent atoms may form a earboxylic ring, heterocyclic ring, aryl or heteroaryl, each of which may be optionally substituted and/or fused with a cyclic ring;or each R o is independently -W, -L-W, -X-L-A;wherein X is NR 6 , O, or S;W is an optionally substituted 4-7 membered azacyclic ring, optional ly containing an additio al heteroatom selected from N, O and S as a ring member;L is a CVCio alkylene, C1-C10 heteroalkylene, C2-C10 alkenylene or C2-C10 heteroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (-0), or Ci-O, alkyl;and A is heterocycloalkyl, heteroaryl or NR s where R nd R 5 are independently H, optionally substituted Ct-Gs alkyl, C2-C8 heteroalkyl, Ca-Cg alkenyl, Ca-Cg heteroaikenyl, CVCg alkynyl, Cz-Cg heteroalkynyl, Ci-Cg acyl, - ~Cg heteroacyl, C Cso aryl, Cs-Ci2 heteroaryl, C7-C12 aryialkyl, or C Cr heteroarylalkyl group. A a compound of Formula VIII: , or a .pharmaceutically acceptable salt, esters prodrug, hydrate, or iauiomer thereof;wherein: Z 5 is N or CX 2;each Zi and 7A is N, CH, or CRs;each i is independently an optionally substituted C;-Cg alkyl, Ci-Ca heteroalkyl, Ca-Cs alkenyl, C2-C8 heteroalkenyl, Ca-Cg alkynyl, Ca-Cg heieroalkynyi, Ci-Cg acyl, C-2-Cg heteroacyl, C 6 - Cio aryl, Cs-Ci 2 beteroaryL C7-C12 aryialkyl, or Cs-Cn heteroarylalkyl. group, or each Ri is independently H, halo, CF 3 , OR 2 , NR2R3, R3OR3, NR2NR2R3, SR¾ SOR¾ SO2R2, SO2NR2R3. NR2SO2R3, NR2CO R2R3, NR2COOR3, R2COR3, CN, COOR2, COOI i, CONR2R3, OOCR2, COR.2, or NO?.;and wherein R 2 and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, 0 or S atoms;and each R 2 and R3 groups, and each ring formed by linking Ra and R3 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, :::: N-OR', =NR', OR", N(R' 2, SR.', S0 2 NR¾ NR'SOaR', NR'CONR'¾ NR'COOR', NR'COR', CN, COOR', CON(R ! )¾ OOCR', COR', and NO2, wherein each R' is independently H, Ci-Ce aikyl, C 2 -C 6 heteroalkyl, Ci-Ce acyl, Ca-Ce heteroacyl, Cg-Cioaryl, Cs-Cio heteroaryl, C7-C12 aryialkyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Ce acyl, G-Ce heteroacyl, hydroxy, amino, and ~ 0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;or each Ri is independently -W, -L-W, -X-L-A;wherein X is NR 6 , O, or S;W is an optionally substituted 4-7 membered azacyclic ring, optionally containing an additional heteroatom selected from N, O and S as a ring member;L is a C1-C10 alkylene, C1-C10 heteroalkyl ene, C2-C10 alkenylene or C2-C10 l eteroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=0), or C1-C6 alkyl;and A is heterocycloalkyl, heteroaryl or R R5 where R and R5 are independently H, optionally substituted Ci-Cg alkyl, C2-Cg heteroalkyl, C?-Ca alkenyl, C 2 -Cg heteroalkenyl, Ci-Cg alkynyl, Ca-Cg heieroalkynyi, Ci-Cg acyl, Ca-Cx heteroacyl, Ce-Cio aryl C5-C12 heteroaryl, C7-C12 aryialkyl, or Cg-Ci2 heteroarylalkyl group;R* and Rs can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S;and each t and Rs groups, and each ring formed by linking R4 and R5 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, -N- OR', =NR, OR, N(R')2, SR', S0 2 R', SCfcNR'a, NR'SOaR 1 , NR'CONR'a, NR'COOR', NR'COR', ON, COOR*, CON(R') 2 , OOCR', COR', and NO2, wherein each R' is independently H, Ct-Ce alkyl, C2-C6 heteroalkyl, Ci-Cg acyl, C2-C6 heteroacyl, CVdo aryl, Cs-Cio heteroaryl, C7-C52 arylalkyl, or C0-C12 heteroarylalkyl, each of which is optionally substituted with, one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci- C-6 acyl, Ci-Cg heieroacyl, hydroxy, amino, and -O;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;Re is H, optionally substituted Ci-Cg alkyl, Ca-Cg heteroalkyl. Ca-Cg alkenyl, Ci-Cg heteroalkenyl, C2-C8 alkynyl, C2-C8 heteroalkynyl, Ci-Cg acyl, Ca-Cg heteroacyl, CVC10 aryl, Cs-Ci2 heteroaryl, C 7 ~Cj 2 arylalkyl, or Cg-Cia heteroarylalkyl group;or Re can be linked to ¾ or 5 to form a 3-8 membered ring;and 4 or Rs is optionally substituted with one or more substituents selected from halo, =0, =N-CN, =N-OR', =NR', OR', N(R')2, SR'» SOaR', SO2NR2, NR'SOzR', NR'CONR'a, NR'COOR', NR'COR * , CN, COOR, CON(R) 2 , OOCR', COR', and O2, wherein each R F is independently H, Ci-C 6 alkyl, C2-G5 heteroalkyl, Ci-C 6 acyl, C2-C6 heteroacyl, Ce-Cio ryL C5-C10 heteroaryl, C7-C12 arylalkyl, or Ce-Cn heteroarylalkyl each of which is optionally substituted with one or more groups selected from halo, C1 -C4 alkyl, C1-C4 heteroalkyl, Ci-Cg acyl, Ci-Ce heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;Xj is an optionally substituted Ci-Cg alkyl, Ca-Cs heteroalkyl, Ca-Cg alkenyl, C2-C8 heteroalkenyl, Ca-Cg alkynyl, Ca-Cg heteroalkynyl, Ci-Cg acyl, C2-C8 heteroacyl, Cg-Cio aryl, Cs~Ci2 heteroaryl, C7-C12 arylalkyl, or C 6 -Ci2 heteroarylalkyl group, optionally substituted with one or more halogens, =0, CF3, CN, OR7, NRSRSJ, SR7, SO2N 8R9, Ci-Cg alkyl, Ca-Cg heteroalkyl, Ca-Cg alkenyl, Ca-Cg heteroalkenyl, Ca-Cg alkynyl, Ca-Cs heteroalkynyl, Ci-Cg acyl, C2-C8 heteroacyl, CV-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or Cti-Csa heteroarylalkyl group;or Xi is H, NRaRs, SOR¾ SO2R2, SO2N 2R3, NR2SO2R3, NR2CONR2R3, NR2CGQR3, NR2COR3, CN, COOR¾ ester bioisostere, COOH, carhoxy bioisostere, CONR2R3, amide bioisostere, X 2 is, H, halogen, CF3, CN, OR?, NRgRs, SR 7 , S0 2 NRa¾ C1-C10 alkyl, Ci-Cio heteroalkyl, C 2 - C10 alkenyl, or C2-C10 heteroaikenyL each of which may be optionally substituted with one or more halogens, =0, or an optionally substituted 3-7 membered carbocyclic or heterocyclic ring;each X3, X4 and X5 is N o CRw each Rio is independently an optionally substituted Ci-Cg alkyl, (¾-Cg heteroalkyl, C2-C8 alkenyl, Ci- s heteroalkenyl, CVCg alkynyl, C2-C8 heteroalkynyl, Ci-Cg acyl, C 2 -Cs heieroacyl, Cs-Ci aryl, C5-C12 heteroaryL C7-C12 aryiaikyi, or C0-C12 heteroaryialky! group, or each Ri is independently H, halo, CF 3 , OR2, NR2R3, NR2OR3, NR2NR2R3, SR¾ SORi, SQ2R2, SO2NR2R3, NR2SO2R3, NR2CONR2R3, NR2COOR3, NR2COR3, CN, COOR2, COOH, CONR2R3, OOCR2, COR2, or O2,;and wherein R 2 and R¾ groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S toms;and each R 2 and R groups, and each ring formed by linking R 2 and R3 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, -N-OR', -NR.', OR', N(R')¾ SR*, S0 2 R', SO2N 2, NR'SOaR', NR'CONRS, NR'COOR*, NR'COR', CN, COOR 1 , CQNCR^, OOCR', COR', and NO2, wherein each R is independently H, Ci-C ;alkyl, C2-C6 heteroalkyl, Ci-Cg acyl, Ca- e heteroacyl, CVCio aryl, C5-C10 heteroaryL C7-C12 arylalkyl, or Ce-Cn heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C1 heteroalkyl Ci- Ce acyl, Ci-Ce heteroacyl, hydroxy, amino, and ~ 0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S two Rio groups on adjacent atoms may form a carboxyiic ring, heterocyclic ring, aryl or heteroaryl, each of which may be optionally substituted and/or fused with a cyclic ring;or each Rio is independently -W, -L-W, -X-L-A;wherein: X is NRe, O, or S;W is an optionally substituted 4-7 membered azacyclic ring, optionally containing an additional heteroatom selected from N, O and S as a ring member;L is a Ci-Cio alkylene, Ci-Cio heteroalkylene, Cx-Cio alkenyiene or C 2 -Cio heteroalkeirylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=0), or Cl-Cg alkyl;and A is heterocycloalkyl, heteroaryl or NE4R5 where R 4 and R5 are independently H, optionally substituted Ci-Cg alkyl, C 2 -Cg lieteroalkyi, C 2 -Cg alkenyl, CVCg lieteroalkenyi, Ci-Cg alkynyi, C 2 -Cs heteroalkynyi, Ci-Cg acyl, C 2 -Cs heteroacyl, Ce-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyi, or Cs-C heieroarylalkyl group, compound of Formula XIV(A), XIV(B), XIV (C) and XIV (D): or a pharmaceutically acceptable salt, esters prodrug, hydrate, or tautomer thereof;wherein: Bi is a bond or C=0 and B 2 is X-L-A;L is a C1-C10 alkylene, C1-C10 heteroalkylene, C2-C10 alkenyiene or C2-C10 heteroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=Q), or C1-C6 alkyl;A is heterocycloalkyl, heteroaryl or NR 4 R5 wherein. R 4 and 5 are independently H, optionally substituted Cj-Cs alkyl, Ca-Cs heteroalkyl, C 2 -Cg alkenyl, Ca-Cg heteroalkenyi, Ca-Cs alkynyi, Ca-Cg heteroalkynyi, Cj-Cg acyl, C-2~Cg heteroacyl, Ce-Cio aryl, C5-C12 heteroaryl, C7-C 12 arylalkyi, or C 6 -Ci2 heteroarylalkyl group, or R 4 and Rs can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S;and each R| and R5 groups, and each ring formed by linking R 4 and R5 groups together, is optionally substituted with one or more substituents selected from halo, O, -N-CN, =N-OR\ =NR' S OR', N(R r )2, SR ( , SO K, S0 2 NR , 2 S NR ! S0 2 R * , NR'CO R'a, NR'COOR', NR'COR', CN, COOR', CON(R')¾ OOCR', COR', and NO2, wherein each R' is independently H, Ci-C¾ alkyl, C2-O;heteroalkyl Ci-Cg acyl, C2-C6 heteroacyl, Ce-Cio aryl, C5-C10 heteroaryl, C?-Cj2 arylalkyi, or ¾~Ci2 heteroarylalkyl , each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Ce acyl, Cj-C6 heteroacyl, hydroxy, amino, and =0;wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatorns selected from N. O and S;X is CReRe, NRe, O, or S;wherein e is H, optionally substituted Ci-Cs alkyl, Ca-Cs heteroalkyl, Ca-Cs alkenyl, Ca-Cs heteroalkenyl, C 2 ~Cg alkynyl Ca-Cg heteroalkynyl Ci-Cg acyl, C 2 -Cs heteroacyl, Ce-do aryl, Cs-Ci2 heteroaryL C?-Ci2 arylalkyl, or Ce-Cn heieroarylalkyl group;or Rfi can be linked to R 4 or Rs to form a 3-8 membered ring;Xa is ¾ halogen, CF 3 , CN, OR^ NRgR©, SR 7s 8G 2 NR g R. ¾ Ci-Cio alkyl, Ci-Cio heteroalkyl, Cade alkenyl, or Ca-do heteroalkenyl, each of which may be optionally substituted with one or more halogens, =0, or an. optionally substituted 3-7 membered earbocyc!ic or heterocyclic ring;(U)n and (U)m are independently H, halogen, CF 3 , CN, OR?, NRgRs, SR?, SOaNRs ^ Ci-Cio alkyl, Ci-Cjo heteroalkyl, C2-C10 alkenyl, or C2-C10 heteroalkenyl, each of which may be optionally substituted with one or more halogens, =0 . , or an optionally substituted 3-7 membered carbocyeiic or heterocyclic ring;each Χ3 » X4 and X5 is N or CRio;each Rio is independently an optionally substituted Ci-Cs alkyl, Ca-Cs heteroalkyl, Ca-d alkenyl, Ca-Cg heteroalkenyl, Ca-Cg alkynyl, Ca-Cs heteroalkynyl, Ci-Cg acyl, Ca-Cs heteroacyl, Cs-do aryl, Cs-Cia heteroaryl, C7-C12 arylalkyl, or C 6 -Ci2 heieroarylalkyl group, or each Ri is independently H, halo, CF3, OR2, NR2R3, NR.2OR3, NR2NR2R3, SR2, SOR2, SOaRa, SO2NR2R3, NR2SO2R3, NR2CONR2R3, NR2COOR3, NR2COR3, CN, COOR2, COOH, CONR2R3, OOCR¾ COR¾ or NO2;and wherein Ra and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S atoms;and each R 2 and R3 groups, and each ring formed by linking Ra and R3 groups together, is optionally substituted with one or more substituents selected from halo, =0, -N-CN, -N-QR', " -= : NR', OR f , N(R')2, SR, SO2R, SOaNR'a, NR'SOaR', NR'CONR'a, NR'COOR', NR'COR', CN, COOR, CON(R ! ) 2 , OOCR', COR', and NO2, wherein each R' is independently H, Ci-C-6 alkyl, Ca-Cg heteroalkyl, C1-C6 acyl, Ca-Ce heteroacyl, Cg-Cioaryl, C5-C10 heteroaryl, C7-C12 arylalkyl, or Cs-Cia heteroarylalkyL each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyL, Ci-Ce acy!, Ci-C, heteroacyl, hydroxy, amino, and =0;wherein two R ! can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;two ϊί.10 groups on adjacent atoms may form a carboxylic ring, heterocyclic ring, aryl or heteroafyl, each of which may be optionally substituted and/or fused with a cyclic ring;or each Rio is independently - , -L- , -X-L-A;wherein X is NR , O, or S;W is an optionall substituted 4-7 membered azacyclic ring, optionally containing an additional heteroatom selected from N, 0 and S as a ring member;L is a Ci-Cio alkylene, Ci~Cio heteroalkylene, C2-C10 alkenylene or C2-C30 heteroalkenyiene linker, each of hich may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (-0), or C1-C6 alkyl;and A is heterocyeloalkyl, heteroaryl or NR4R5 where R4 and Rs are independently H, optionally substituted Ci-Cg alkyl, Ci-Cs heteroalkyt, Ca-Cg alkenyl, Ca-Cg heteroalkenyl, Ca-Cg alkynyl, Ca-Cg heteroalkynyl, Ci-Cs acyl, C2-C3 heteroacyl, Cs-Cio aryl, Cs-Cii heteroaryl, C?~Ci2 arylalkyl,. or Cs-C heteroaryl alkyl. group. 22. A method for treating cancer in a subject comprising administering a therapeutically effective amount of a compound of any of Claims 1-21. 23 , The method of Claim 22, wherein the cancer is of the breast, lung, color ectum, liver, pancreas, lymph node, colon, prostate, brain, head and neck* skin, liver, kidney, blood or heart.
Independent claims7
640 paragraphs in 38 sections, as filed
Description of equivalent WO 2016141042 A2
NOVEL COMPOSITIONS, USES AND METHODS FOR MAKING THEM
STATEMENT REGARDING FEDERAL FUNDING
[001] This invention was made, in part, with government support under Federal Grant Number W81 XWH- 15-1-0224 awarded by the Department of Defense Office of the Congressionally
Directed Medical Research Programs, The government has certain rights in the invention.
CROSS-REFERENCE TO RELATED APPLICATIONS
[002] This application claims priority to U.S. Provisional Patent Application No, 62/128,208, filed March 4, 2015, and which is hereby incorporated by reference in its entirety.
FIELD OF THE INVENTION
[003] The present invention provides novel compounds and pharmaceutical composition thereof which may inhibit ceil proliferation and/or induce cell apoptosis. The present invention also provides methods of preparing such compoun ds and compositions, and methods of making and usi ng the same.
BACKGROUND OF THE INVENTIO
[004] Hypertrophy of the nucleolus, the cellular site for ribosome biogenesis, has been linked to malignant transformation for more than a hundred years. The ribosome is a RNA-protein complex that is responsible for the protein synthesis (translation) in the cell, Carcinogenesis, with the associated upregulation of growth and proliferation rates, requires a significant increase in the rate of translation and hence necessitates an increase in cellular ribosome content. Ribosome biogenesis is a highly complex energy-consuming process in which the synthesis of pre-rihosomal RNA by RNA Polymerase I (Pol I) serves as the rate limiting step.
{005] Not surprisingly, Pol I transcription in normal cells is tightly controlled, through the action of multiple tumor suppressor proteins (including p53, pRB and PTEN) which serve as inhibitors. The loss of such control due to mutations in tumor suppressor genes or activation of certain oncogenic pathways, such as cMye and PDK Ak mTOR, results in the hyperaetivation of Pol I transcription that is commonly found in malignancy,
[006] In addition to cancer, hyperaetivation of Pol I transcription has been linked to poor prognosis in multiple sclerosis and has been shown to play a role in the infections cycle of certain pathologic viruses, including cytomegalovirus, hepatitis B virus and hepatitis C virus. Therefore, agents that selectively disrupt Pol I transcription are conceptually attractive as anticancer, anti-inilammatory and antiviral therapeutics
SUMMARY OF THE INVENTION
[007] Provided herein are novel compounds and methods of treating or preventing any one of the diseases or conditions described herein comprising administering a therapeutically effective amown of a compound described herein, or a pharmaceutically acceptable salt or solvate thereof, to a mammal in need thereof, in specific embodiments, the compound inhibits ribosome biogenesis by inhibiting POLl transcription and the disease or condiiion is amenable to treatment or prevention by the inhibition of POLl transcription.
[008] In one aspect described herein is a method for treating or preventing cancer in a mammal comprising administering a therapeutically effective amount of a compound described herein, or a pharmaceutically acceptable salt, or solvate thereof, to the mammal in need thereof. In another aspect, described herein is a method for treating or preventing an inflammatory disease in a mammal comprising administering a therapeutically effective amount of a compound described herein, or a pharmaceutically acceptable salt, or solvate thereof, to the mammal in need thereof.
[009] In still another aspect, described herein is a method for treating or preventing a proliferative disorder in a mammal comprising administering a therapeutically effective amount of a compound described herein, or a pharmaceutically acceptable salt, or solvate thereof, to the mammal in need thereof In another aspect described herein is a method for treating or preventing a disease or disorder in a mammal comprising administering a therapeutically effective amount of a compound described herein, wherein the compound inhibits ribosome biogenesis by inhibiting POLl transcription.
z [010] Oilier objects, features and advantages of the compounds, methods and compositions described herein will become apparent from the following detailed description. It should he understood, however, that the detailed description and the specific examples, while indicating specific embodiments, are given by way of illustration only, since various changes and modifications within the spirit and scope of the instant disclosure will become apparent to those skilled in the art from this detailed description.
DETAILED DESCRIPTION OF THE INVENTION
Compounds
[0111 Compounds described herein, including pharmaceutically acceptable salts, prodrugs, active metabolites and pharmaceutically acceptable solvates thereof, inhibit ribosome biogenesis by inhibiting POLl transcription.
[0.12] In one aspect, the present invention provides a compound of Formula I:<img file="EP3300501A2_D0001.tif" />
and pharmaceutically acceptable salts, esters, prodrugs, hydrates and tautomers thereof- wherein:
[0i 3 j Z;<sub>:</sub>, and 7 is , CH, or CRi , provided any three N are non-adj cent; and further provided that one or more of Zi, Z<sub>2</sub>, Z<sub>3</sub>, and Z4 is CRj;
[014] each Ri is independently an optionally substituted Ci-Cg alkyl, Ci-Cg heteroalkyl, Ci-Cg alkeny!, OsHCe heteroalkenyl, Ca-Cg alkyftyl, Oz-Cg heteroalkyny^ Ci-Cg acyl, Cs-Cs heteroaeyl, Ce- Cio aryl, Cs-Ciz heteroaryl, C7-C32 arylalkyl, or C6-C12 heteroarylalkyl group, or each Rj is independently H, halo, CF¾ OR2, NR2R3, NR2OR3, NR2NR2R3, SR¾ SOR2, SQ2R2, SO2N.R2R3, NR2SO2R3, NR2CONR2R3, NR2COOR3, NR2COR3, CN, COOR2, COOH, CQMR<sub>2</sub>R¾ OOCR<sub>3></sub> COR¾ or NQ<sub>2</sub>;
[015] and wherein Ri and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring,, optionally containing one or more N, O or S atoms; and each R<sub>2</sub> and R3 groups, and each ring formed by linking R<sub>2</sub> and R3 groups together, is optionally substituted with one or more subsiituents selected from halo, = <sup>)</sup>, =N-CN, =N-OR', =NR'<sub>S</sub> OR", N(R<sup>*</sup>)¾ SR'<sub>S</sub> S0<sub>2</sub>R\ SOaN S, NR<sup>*</sup>S0<sub>2</sub>R', NR'CONR'2, NR'COOR<sup>*</sup>, NR'COR<sup>*</sup>, CN, COOR, CON(R OOCR', COR', and NC% wherein each R' is independently H, Ci-Cg alkyl, C2-C6 heteroalkyl, Ci-Ce acyl, C<sub>2</sub>-C<s heteroacyl, V Cio atyl, C5-C10 heteroaryl, C7-C12 arylalkyl, or Ce-Cia heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Cj-Ce acyl , Ci-Cfi heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from , O and S;
[016] or each Ri is independently -W, -L-W, -X-L-A; wherein X is NRe, O, or S; W is an optionally substituted 4-7 membered azacyclic ring, optionally containing an additional heteroatom selected from N, O and S as a ring member; L is a C1-C10 alkylene, C1 -C10 heteroalkylene, C2-C10 alkenylene or C2-C10 heteroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of h alogen, oxo (=0), or C1-C6 alkyl; and A is heteroeycloalkyl, heteroaryl or NR4R5 where R4 and R5 are independently H, optionally substituted Cf-Cg alkyl, C<sub>2</sub>-Cg heteroalkyl, C -Cs alkenyl, C2-C8 heteroalkenyl, Cz-Cg alkynyl, C<sub>2</sub>-Cs heteroalkynyl, Ci-Cg acyl, C2-C8 heteroacyl, Cs-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or C<sub>6</sub>- Ci2 heteroarylalkyl group.
[017] R<sub>4</sub> and R5 can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S; and each R<sub>4</sub> and R5 groups, and each ring formed by linking R4 and Rs groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, --N~OR', <sup>:::</sup> R<sup>'</sup>, OR', N(R')<sub>2</sub>, SR', S0<sub>2</sub>R', S0<sub>2</sub>NR'<sub>25</sub> NR'S feR', NR'CONR'2, NR'COOR', NR'COR', CN, COOR<sup>»</sup>, CON(R¾ OOCR<sup>1</sup>, COR', and NO2, wherein each R' is independently H, G-C<sub>6</sub> alkyl, C2-C0 heteroalkyl, Ci-C6 acyl, Ca-Cs heteroacyl, Ce-Cio aryl, C5-C10 heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, G-C heteroalkyl, Ci-C<<sub>></sub> acyl, Ci-C heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected frorn N, O and S;
[018] R<sub>6</sub> is H, optionally substituted Cj-Cs alkyl, C<sub>2</sub>-Cs heteroalkyl, C2-C.8 alkenyl, C?-Cs heteroalkenyl, Ca-Cg alkynyl, C<sub>2</sub>-Cs heteroalkynyl, Ci-Cg acyl, C Cg heteroacyl, GS-CIQ aryl, heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl group, [019] R<sub>6</sub> can be linked to R<sub>4</sub> or Rs to form a 3-8 rnembered ring; and R<sub>4</sub> or Rs is optionally substituted with one or more suhstituents selected from halo, =0. -N-CN, =N-OR', <sup>:::</sup>NR', OR', N(R')<sub>2</sub>, SR', SO2R', SO2NR2, MR'SOaR, NR'CONR'2, NR'COOR', NR'COR', CN, CGOR',
CON(R')2<sub>5</sub> OOCR', COR', and NC¾ wherein each R' is independently H, Ci-C<sub>6</sub> alkyl, Cz-Ce heteroalkyl, Ci-Ce acyi, C2-G5 heteroacyi Cs-Cioaryl, C5-C30 heteroaryl, C7-O2 arylalkyl or Ce-Cta heteroaryialkvl, each of which is optionally substituted with one or more groups selected from halo, CJ-C4 alkyl, C1-C4 heteroalkyl, C1-C0 acyi, Ct-C-6 heteroacyi, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 rnembered ring optionally containing up to three heteroatoms selected from , O and S;
[020] Y is an optionally substituted 5-6 rnembered carbocyclic or heterocyclic ring;
[021] Xi is an optionally substituted Ci-Cg alkyl, Ca-Cg heteroalkyl, C2-C8 alkenyl, C2-C8
heteroaikenyl, Ca-Cg alkynyl, Ca-Cs heteroalkynyl, Cj-Cg acyi, Ca-Cg heteroacyi, Cg-Cio aryi, C5-C12 heteroaryl C7-C12 arylalkyl, or Ce-Cn heteroaryialkvl group, optionally substituted with one or more halogens, =0, CF<sub>3</sub>, CN, OR<sub>7</sub>, N¾Ro, SR<sub>7</sub>, SO2NR8R9, Ci-Cg alkyl, C<sub>2</sub>-C<sub>8</sub> heteroalkyl, C<sub>2</sub>-Cg alkenyl, C -CH heteroaikenyl, C<sub>2</sub>~Cs alkynyl, C<sub>2</sub>-Cg heteroalkynyl, Ci-Cg acyi, C2-C8 heteroacyi, Cs- C10 aryi, C5-C12 heteroaryl, C7-C12 arylaikyl, or Ce-Cn heteroaryialkvl group; or
[022] X! is H, NR2R3. SOR2, SOaRa, SO2NR2R3, NR2SO2R3, NR2CONR2R3, NR2COOR3, NR2COR3, CN, COOR2, ester bioisostere, COOH, carboxy bioisostere, CONR2R3, amide bioisostere, OOCR?, CORa, or NO2.
[023] In one aspect, the present invention provides a compound of .Formula 11(A), 11(B), 11(C), 11(D) and 11(E),
<img file="EP3300501A2_D0002.tif" />
pharmaceutically acceptable salts, esters, prodrugs, hydrates and tautomers thereof; wherein:
[024] Z<sub>2</sub>, Z3 and Z<sub>4</sub> are independently CH or CRi;
[025] each R.i is independently an optionally substituted Ci-Cs alkyl, Cj-Cg heteroalkyl C'2-Cs alkenyl, CVCg heteroaikenyl C<sub>2</sub>-Cg alkynyl, Ci-Cs heteroalkynyl, Ci-Cg acyi C2-C8 heteroacyi, Ce- Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or Cg-Ci2 heteroaryl alkyl group, or each R is independently halo, CF<sub>3</sub>, OR¾ NR.2R3, NR3OR3, NR2NR2R3, SR2, SOR2, S0<sub>2</sub>Ra<sub>s</sub> SO2NR2R3,
NR<sub>a</sub>S0<sub>2</sub>R<sub>3</sub>, NR2CONR2R3, NR2COOR3, NR2COR3, CN, COOR2, COOH, CONR2R3, OOCR¾<img file="EP3300501A2_D0003.tif" />
[026] or each Ri is independently -W, -L-W, -X-L-A; wherein X is NR¾, O, or S; W is an optionally substituted 4-7 membered azacyclic ring, optionally containing an additional heteroatom selected from N, 0 and S as a ring member; L is a C1-C10 alkylene, C1-C10 heteroalkylene, C2-C10 alkenylene or C2-C10 heteroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (-0), or C1-C6 alkyl; and A is heterocycloaikyl, heteroaryl or NR4R5 where R4 and R5 are independently H, optionall substituted Ci-Cg alkyl, C:~Cs heteroalkyl, C<sub>2</sub>-Cg alkenyl, Cz~C% heteroalkeny!, Ca-Cs aikynyl, C2-C8 heteroalkynyl, Ci-Cg aeyl, C?~Cs heteroacyl, Qs-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or C$- C12 heteroarylalkyl group;
[027] R<sub>4</sub> and Rs can be linked to form a 3-8 membered ring, optionally containing one or more N, 0 or S; and each Ri and Rs groups, and each ring formed by linking R4 and R5 groups together, is optionally substituted with one or more substituents selected from halo, =0, <sup>~</sup>N-CN, =N-QR', <sup>::::</sup>NR', OR', N(R')2, SR*, SOaR', S<½NR¾ NR'SOaR', KR'CONR's, NR'COOR', NR'COR', CN, COOR', CON(R')?, OOCR', COR', and N0<sub>2</sub>, wherein each R<sup>*</sup> is independently H, Cj-Ce alkyl, C<sub>2</sub>-C<sub>6</sub> heteroalkyl, Ci-Ce acyl, C2-C6 heteroacyl, Ce-C-ioaryl, C5-C10 heteroaryl, C7-CJ2 arylalkyl, or Ce-Cn heteroarylalkyl, each of wliich is optionally substituted with one or more groups selected from halo, Ci-Ci alkyl, C<sub>1</sub>-C4 heteroalkyl, Ci-Ce acyl, Ci-Ce heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[028] R is H, optionally substituted Ci-Cs alkyl, Gi-Cs heteroalkyl, Ca-Cs alkenyl, C<sub>2</sub>-Cg heteroalkenyl, C<sub>2</sub>-Cg aikynyl, Ca-Cg heteroalkynyl, Ci-Cs acyl, C<sub>2</sub>-Cg heteroacyl, Ce-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or Ce-Cn heteroaiylalky! group; or Re can be linked to R4 or Rs to form a 3-8 membered ring; and R4 or R5 is optionally substituted with one or more substituents selected from halo, =0, =N-CN, ===N-OR', =NR.\ OR', N(R SR', SOaR', S0<sub>2</sub>NR'<sub>2</sub>, NR'S0<sub>2</sub>R<sup>*</sup>, NR'CONR'a, NR'COOR', NR'COR<sup>1</sup>, CN, COOR', CON(R<sup>!</sup>)<sub>¾</sub> OOCR', COR', arid N0<sub>2}</sub> wherein each R' is independently H, C;-C<sub>6</sub> alkyl, Cz-Ce heteroalkyl, Ci-Cs acyi, C2-C6 heteroacyl, Ce-Cioary!, C5-C50 heteroaryl, C?-Cj2 arylalkyl, or C6-C12 heteroaryl alkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ct-Cg acyl, C1-C0 heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from K, 0 and S:
[029] Y is an optionally substituted 5-6 memhered carbocyclic or heterocyclic ring;
[030] [ is an optionally substituted Ci-Cg alkyl, Cj-Cs heteroalkyl, Ca-Cg alkenyl, Ci~Cg heteroalkenyL C2-C alkynyi, C<sub>2</sub>-Cg heteroalkynyl, Ci-Cg acyi Cx-Ca heteroacyl, Ce-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl group, or Xi is H, NR2R3, SOR2, SO2R2, SO2NR2R3, NR2SQ2R3, NR2CONR2R3, NR2COOR3, NR2COR3, CN, COOR2, COOK, polar substituent, carboxy bioisostere, CO R2R3, OOCR2, COR2, or NO2;
[031] wherein R> and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 memhered ring, optionally containing one or more N, O or S; and each 2 and ¾ groups, and each ring formed by linking 2 and R3 groups together, is optionally substituted with one or more substituents selected from, halo, =0, =N-CN, =N-OR<sup>*</sup>, ~NR OR', N(R')2, SR', SO2R', SO2NR2, N 'SOiR', R'CONR'2, R'COOR', NR'COR.', CN, COOR<sup>1</sup>, CON(R<sup>,</sup>)<sub>2></sub> OOCR', COR', and NO¾ wherein each R' is independently H, Ct-C6 alkyl, Ca-Cs heteroalkyl, Ct-C-6 acyl, C2-C6 heteroacyl, Cg-Cio aryl, C5-C10 heteroaryl. C7-C12 arylalkyl, or C -C^ heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, CVC4 alkyl, C1-C4 heteroalkyl, Gj-Cg acyi, Ci-C<sub>6</sub> heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 rnenibered ring optionally containing up to three heteroatoms selected from N, O and S.
[032] In one aspect, the present invention provides a compound of Formula ΠΙ(Α), 111(B) and III(C):
<img file="EP3300501A2_D0004.tif" />
pharmaceutically acceptable salts, esters, prodrugs, hydrates and tautomers thereof; wherein: [033] L is a Ci-Cie alkylene, Cj-Cio heteroalkyiene, C2-C10 alkenylene or Ca-Cto heteroalkenylene linker, each of which ma be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=0), or C1-C6 alkyl;
[034] A is heterocycloalkyl, heteroaryl or R4R5 where R and R5 are independently H, optionally substituted Ci-Cg alkyl, C<sub>2</sub>-Cs heteroalkyl, C<sub>2</sub>-Cs alkenyl, C<sub>2</sub>-Cg heteroalkenyl, Ci-Cg alkynyl, Ci-Cs heteroalkynyl, Ci-Cs acyl, C<sub>2</sub>-Cg heteroacyl, Ce-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or Ce~ Ci2 heteroarylalkyl group,
[035] R4 and Rs can be linked to form a 3-8 membered ring, optionally containing one or more N<sub>s</sub> O or S; and each R and Rs groups, and each ring formed by linking R and Rs groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN<sub>5</sub> = -OR<sup>f</sup>, =NR', OR', N(R')2, SR', S0<sub>2</sub>R', SO2N 2, NR'S0<sub>2</sub>R', NRCONR'a, NR'COOR, NR'COR', CN, COOR, CON(R')<sub>2</sub>, OOCR', COR, and NO2, wherein each R! is independently H, C<sub>3</sub>-C<sub>6</sub> alkyl, C<sub>2</sub>-C<sub>6</sub> heteroalkyl, C3-C0 acyl, C2-Q5 heteroacyl, Qs-CioaryL C5-C10 heteroaryl, C7-C12 arylalkyl, or CVC12 heteroarylalkyl. each of which is optionally substituted with one or more groups selected trom halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Ce acyl, C1-C6 heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 inembered ring optionally containing up to three heteroatoms selected from N, 0 and S;
[036] X is NR6, 0, or S;
[037] R_s is H, optionally substituted Ci-Cg alkyl, C2-C8 heteroalkyl, C2-Q alkenyl, C2-C8 heteroalkenyl, Ca-Cg alkynyl, C<sub>2</sub>-Cg heteroalkynyl, Ci-Cg acyl, C<sub>2</sub>-Cs heteroacyl, Ce-Cio aryl, C5-C12 heteroaryl, C7-C<sub>1</sub>2 arylalkyl, or C6-C12 heteroarylalkyl group;
[038] e can be linked to R4 or R5 to form a 3-8 membered ring; and R<sub>4</sub> or Rs is optionally substituted with one or more substituents selected from halo, <sup>~</sup>0, -N-CN, -N-OR'. R. OR', N(R% SR.<sup>1</sup>, SO2R', SO2NR2, NR'SOsR*, NR'CONR'a, NR'COOR, <sup>'</sup>NR'COR<sup>1</sup>, CN, COOR',
C N(R')2, OOCR', COR', and NO2, wherein each R' is independently H, Ci-C<sub>6</sub> alkyl C<sub>2</sub>-C<sub>6</sub> heteroalkyl, Cj-Cg acyl, C<sub>2</sub>-Cs heteroacyl, Ce-OoaryL Cs-Cio heteroaryl, C7-C12 arylalkyl, or Cg-Cu heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C<sub>1</sub>-C4 heteroalkyl, Ci-C<sub>6</sub> acyl, Ci-Ce heteroacyl, hydroxy, amino, and wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
(039) Xi is an optionally substituted Ci-Cs alkyi, Cs-Cs heteroalkyl,€<sub>2</sub>~Cs alkenyl, Ca-Cg heteroalkenyl, Ci-Cs alkynyl, C Cg heteroalkynyl Ci-Cg aeyl, Ca-Cg heteroacyl, Cs-Cio aryl, C5-C12 heteroaryl, G?-Ci2 arylalkyl, or C6-C12 heteroarylalkyl group,, or Xi is H, NR2R3, SOR2, SO2R2, SO2NR2R3, NR2SO2R3, R2CONR2R3, NR2COOR.3, NR2COR3, CN, COOR2, ester bioisostere, COOH, carboxy bioisostere, CONR2.R3, amide bioisostere, OOCR2, COR2, or NO2;
[040] (U)<sub>n</sub> and (U)<sub>m</sub> are independently H, halogen, Cl¾, CN, OR<sub>7</sub>, NRsRy, SR<sub>7</sub>, S0<sub>2</sub> R*R¾ C1-C10 alkyi, CI-CJO heteroalkyl, CZ-CJO alkenyl, or C2-C10 heteroalkenyl, each of which may be optionally substituted with one or more halogens, =0, or an optionally substituted 3-7 membered carbocyclic or heterocyclic ring;
041 J wherein R<sub>2</sub> and R3 groups on the same atom or on adjacen atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S; and each R2 and R3 groups, and each ring formed by linking R<sub>2</sub> and R3 groups together, is optionally substituted with one or more substituents selected from halo, O, =N-CN, =N-OR<sup>*</sup>, -NR', OR<sup>1</sup>, N(R¾ SR', SOaR', SCfeNR'a, R<sup>,</sup>S02R<sup>i</sup><sub>J</sub> NR<sup>t</sup>CONR'<sub>2</sub>, NR'COOR', R'COR<sup>*</sup>, CN, COOR<sup>!</sup>, CON(R')2, OOCR', COR', and NOa, wherein each R' is independently H, Ci-Ce alkyi, C2-C6 heteroalkyl, Ci-Ce aeyl, C2-C6 heteroacyl, Cfi-Cio aryl, C5-C10 heteroaryl, C?-Ci2 aryialkyl, or CVCr? heteroarylalkyl, each of which is optionaily substituted with one or more groups selected from halo, C1-C4 alkyi, C1-C4 heteroalkyl, Cj-Cft aeyl, Ci~C<sub>6</sub> heteroacyl, hydroxy, amino, and -O; wherein two R<sup>*</sup> can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S,
042] Irs one aspect, the present invention provides a compound of Formula 111(A)(1), I0 (B)(1 ) and
<img file="EP3300501A2_D0005.tif" />
acceptable salts, esters, prodrugs, hydrates and tautomers thereof; wherein: [043] L is a Ci-Cto alkylene, Ci-Oo heteroalkylene, C<sub>2</sub>~Cto alkenylene or Ci-C\o heteroalkenylene linker, each of which may he optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=0), or C1-C6 alkyl;
[044] A is heterocycloalkyl, heteroaryl or NR4R5 where R4 and R5 are independently H, optionally substituted Cj-Cg alkyl, Cz-Cg heteroalkyl, C<sub>2</sub>~Cs alkenyl, C<sub>2</sub>-Cg heteroalkenyl C2-C8 alkynyl, (¾-Cg heteroalkynyl, Ci-Cs acyl, C2-C? heteroacyl, Cg-Cie aryl, C5-C12 heteroaryl, C?-Ci2 arylalkyl, or Ce- C12 heteroarylalkyl group,
[045] R4 and R5 can be linked to form a 3-8 membered ring, optionally containing one or more <sub>s</sub> O or S; and each R4 and Rs groups, and each ring formed by linking R and R5 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, =N-OR', -NR.', OR', (R'b, SR<sup>!</sup>, SCfcR', SOa R'i, NR'SCfcR', NR'CONR'2, NR'COOR', NR'COR<sup>'</sup>, CN, COOR', CON(R')<sub>2</sub>, OOCR', COR', and NO2, wherein each R' is independently H, Ct-C<sub>6</sub> alkyl, C2-&;
heteroalkyl, Ci-Ce acyl, C2-C6 heteroacyl, Ce-Cioaryl, C5-C10 heteroaryl, C7-Ct2 arylalkyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Cj- s acyl, Ci-Cg heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[046] X is NR<sub>6</sub>, O, or S;
[047] R6 is H, optionally substituted Ci-Cs alkyl, d-Cg heteroalkyl, Cz-Cs alkenyl, Ci~C heteroalkenyl, C2-C8 alkynyl, heteroalkynyl, Ci-Cg acyl, Ca-Cg heteroacyl, C¾-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or Ce-Cn heteroarylalkyl group;
[048| R6 can be linked to R4 or Rs to form a 3-8 membered ring; and R4 or R5 is optionally substituted with one or more substituents selected from halo, =0, =N-CN, =N-OR'<sub>s</sub> =NR', OR', N(R')<sub>2</sub>, SR<sup>f</sup>, S0<sub>2</sub>R*<sub>;</sub> S0<sub>2</sub>NR'¾ NR'S0<sub>2</sub>R*<sub>s</sub> NR'CONR'2, NR'COOR', NR'COR', CN, COOR',
CON(R<sup>r</sup>)2, OOCR', COR', and N0<sub>2s</sub> wherein each R' is independently H, Ci-Ce alkyl C<sub>2</sub>-Cg heteroalkyl, C Ce acyl, Ca-Ce heteroacyl, Cb-Cjo aryl, CS-CJO heteroaryl, C<sub>7</sub>-Ci<sub>2</sub> arylalkyl or Ce-Cii heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, O-C4 alkyl, C1-C4 heteroalkyL Ci-Ce acyl, Ci-Cg heteroacyl, hydroxy, amino, and <sup>~</sup>0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[049] X<sub>2</sub> is an optionally substituted Ci-C« alkyl, Ca-Cg heteroalkyl, Ci-Cg alkenyl, C-2-Cg heteroalkenyl, Ct-Cs alkynyl, Ca-Cg heteroalkyayl, d-d acyl, d-d heteroacyl, d- w aryl, Cs-Ci2 heteroaryL C7-C12 arylalkyl, or d-di heteroarylalkyl group;
[050] (U)<sub>fi</sub> and (U)<sub>ra</sub> are independently H, halogen, CF<sub>3</sub>, CN, OR<sub>7></sub> NR&R9, SR<sub>7</sub>, 8i¾ ¾R9, -do alkyl, Cj-Cio heteroalkyl, Ci-Cio alkenyl, or d-do heteroalkenyl, each of which may be optionally substituted with one or more halogens, =0, or an optionally substituted 3-7 membered earbocyclic or heterocyclic ring;
[051] wherein R2 and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S; and each R2 and R3 groups, and each ring formed by linking R2 and R3 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, -N-OR<sup>*</sup>, =NR', OR', N(R'>2, SR', SO>R\ SO2NR2, R'SOaR', NR'CONR'2, NR'COOR', NR'COR', CN, COOR', CO (R')<sub>2j</sub> OOCR', COR', and N()¾ wherein each R' is independently H, Ci~C6 alkyl, C2-C-6 heteroalkyl, Ci-Ce acyl -d heteroacyl, Cfi-Cio aryl, C5-C10 heteroaryi, C<sub>7</sub>-Ci2 arylalkyl, or d-Ca- heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Cfi acyl, Ci-Ce heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S.
[052] In some embodiments, L is a bond, Cj-Cio alkylene, CJ -CJO heteroalkylene, C<sub>2</sub>-Cfo alkeny iene or Ca-Cio heteroalkenylene linker, each of which is optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=€>), or Ci-Cs alkyl.
[053] In some embodiments, A is heterocyeloalkyl. heteroaryi ., quaternary amine or NR+Rs where i nd R.5 are independently H, optionally substituted Ci-Cg alkyl, C<sub>2</sub>-Cs heteroalkyl, -d alkenyl, C2-C8 heteroalkenyl, Ci-d alkynyl, -d heteroalkynyl, Cj-Cg acyl, C<sub>2</sub>-Cs heteroacyl, d~da aryl, C5-C12 heteroaryi, CVC;?. arylalkyl, or Cs-Cn heteroarylalkyl group.
[054] in some embodiments, R and R5 can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S; and each R4 and R5 groups, and each ring formed by linking R<sub>4</sub> and R5 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, =N-QR', <sup>~</sup>NR', OR', N(R')2, SR', S0<sub>2</sub>R'<sub>5</sub> S0<sub>2</sub>NR'¾ NR'SO>R', NR'CONR'2, NR'COOR',
NR'COR', CN, COOR', C0N(R')2, OOCR', COR<sup>!</sup>, and N0<sub>2s</sub> wherein each R' is independently B, Ci- C<sub>6</sub> a!kyi, C2-C6 heteroalkyl, C<sub>1</sub>-C4 acyl, C2-C6 heteroacyi, Cfj-Cio a L C5-C10 heteroaryl, C7-C12 arylalkyl, or C(,-Cu .heteroarylalkyl:, each of which is optionally substituted with one or more groups selected from halo, Ci-C* alkyl, C1-C4 heteroalkyl,€i-C<sub>6</sub> acyl, Cj-Cs heteroacyi, hydroxy, amino, and =0; wherein two R<sup>!</sup> can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S.
[055 J In some embodiments, X is NR&, O, or S.
[056] In some embodiments, ¾ is H, optionally substituted Ci-G« alkyl, C<sub>2</sub>-Cs heteroalkyl,: Ca-Cg aikenyl, C2-C8 heteroalkenyl, Ca-Cg alkynyl, C<sup>'</sup>2-Cg heteroalkynyl, Ci-Cg acyl, C<sub>2</sub>-Cg heteroacyi, C-6- C10 at l, C5-C12 heteroaryl, C?-Ct2 arylalkyl, or Cg-Cn heteroarylalkyl group,
|057] In some embodiments, g is linked to R or 5 to form a 3-8 membered ring; and R or Rs are optionally substituted with one or more substituents selected from halo, =0, -N-CN, -N-OR', =NR', OR', N(R<sup>,</sup>)<sub>2</sub>, SR, S0<sub>2</sub>R', SO2N 2, NR'SOaR', NR'CONR , NR'COOR', NR'COR', CN, COOR', CON(R')2, OOCR', COR', and N0<sub>2</sub>, wherein each R' is independently H, Ci-C<sub>6</sub> alkyl, C<sub>2</sub>-C<sub>6</sub> heteroalkyl, Cj-Cg acyl, C2- 4 heteroacyi, Cs-Cio aryl, C5-C10 heteroaryl, Ci-Cn arylalkyl, ot CVCo heteroarylalkyl, each of which is optionally substituted with, one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Cg acyl Ci-Ce heteroacyi, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, and S,
[058] In some embodiments, X<sub>2</sub> is II, C1-C10 alkyl, Ct-Cio heteroalkyl, C2-C10 alkenyl, or Ca-Cf o heteroalkeny!, each of which is optionally substituted with one or more halogens, =0, or an optionally substituted 3-7 membered carbocyelic or heterocyclic ring,
[059] In some embodiments, (U)<sub>fl</sub> and (U)m are independently H, halogen, CF¾ CN, OR?, NRgR. , SR% S0<sub>2</sub>NRgR.o, Ci-Cio alkyl, Cj-Cje heteroalkyl, C2-C10 alkenyl, or Cz-Cjo heteroalkenyl, each of which is optionall substituted with one or more halogens, =0, or an optionally substituted 3-7 membered carbocyelic or heterocyclic ring.
[060] In some embodiments, R<sub>2</sub> and R3 groups on the same atom or on adjacent atoms are linked to form a 3-8 membered ring, optionally containing one or more N, O or S; and each Ra and R3 groups, and each ring formed by linking ¾ and R<sub>3</sub> groups together, is optionally substituted with one or more substituents selected from halo, -0, -N-CN, -N-OR', =NR'<sub>S</sub> OR', N{R')<sub>2</sub>, SR', SO2R', S0<sub>2</sub>NR¾ NR<sup>!</sup>S0<sub>2</sub>R', NR'CONR'i, NR'COOR', NR'COR', CN, COOR', CQN(R')?, OOCR'. COR', and NO2, wherein each R' is independently H, Ct-Cs alkyl, C<sub>2</sub>-Cs heteroalkyl, Ci-Ce acyl, Cz-Cg heteroacyl, Cs- Cio aryl, Cs-Cto heteroaryl, C7-C12 arylalkyl, or C<sub>6</sub>~Ci2 heteroarylatkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C1 alkyl, C1-C4 heteroalkyl, Ci-Ce acyl, C1-G5 heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S.
[061] In some preferred embodiments, X¾ is H.
[062] In one aspect, the present invention provides compound of Formula IV(A) and IV (B),
<img file="EP3300501A2_D0006.tif" /> prodrugs, hydrates and tautomers thereof; wherein:
[063] Β<sub>Ϊ</sub> is a bond or CO, B<sub>2</sub> is X-L-A
[064] L is a C1-C 0 alkyl ene, Cr-Cje heteroalkylene, C2-C10 alkenyiene or C2-C10 heteroalkenylerse linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=0), or Cs-Cg alkyl;
[065] A is heterocycloalkyl, heteroaryl or NR4R5 wherein R4 and R5 are independently H, optionally substituted Ci-Cg alkyl, C2-C8 heteroalkyl, C<sub>2</sub>~Cs alkenyl, C-2-Cg heteroalkenyl, Ci-Cs alkyn l, C-2-Cg heteroalkynyl. Ci-Cg acyl, Ca-Ce heteroacyl, Ce-Cjo aryl, C5-C12 heteroaryl, C7-Cj2 aryialkyl, or C6-C12 heteroaryl alkyl group, or R and R5 can be linked to form a 3-8 membered ring, optionally containing one or more N, O or 8; and each R<sub>4</sub> and R5 groups, and each ring formed by linking R and R5 groups together, is optionally substituted with one or more substituents selected from halo, =0, = -CN, -N- OR", =NR', OR', N(R')2, SR', SO2R, SCfcNR'2, NR'S0<sub>2</sub>R', NR'CONR'2, NR'COOR', NR'COR', C <sub>S</sub> COOR', CON(R')2, OOCR', COR', andN0<sub>2</sub>, wherein each R* is independently H, Ci-Ge alkyl, C2-C6 heteroalkyl, Ci-Ce acyl, C2-C0 heteroacyl, Ce-Cio aryL C5-C10 heteroaryl C7-C12 aryialkyl, or C^-C
33 heteroarylalkyi, each of which is optionally substituted with one or more groups selected from halo, Ci- C alkyl, C1-C4 heteroalkyl, Ci-Ce acyl, O-Ce heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[066] X is CReRe, NRg, O, or S; wherein Rs is H, optionally substituted Ci-Cg alkyl, C<sub>2</sub>-Cs heteroalkyl, C<sub>2</sub>-Cg alkenyi, Cj-Cg heteroalkenyl, Cz-Cg alkynyl, C<sub>2</sub>-Cg heteroalkynyl, Ci-Cg acyl, C2- Cg heteroacyl, Ce-Cio aryl, C5-C12 heteroaryi, C7-C12 ary!alkyl, or C-6-C12 heteroarylalkyi group; or Re can be linked to R4 or R to form a 3-8 membered ring;
[067] (\J)n and (U)<sub>m</sub> are independently H, halogen, CF<sub>3}</sub> CN , OR?, NRSRP, SR7, SO2N RgR¾ CJ -do alkyl, C1-C10 heteroalkyl, C2-Cio alkenyi, or C2-C10 heteroalkeny l, each of which may be optionally substituted with one or more halogens, =0, or an optionally substituted 3-7 membered carbocyclic or heterocyclic ring.
[068] In one aspect, the present invention provides a compound of Formula V(A), Formula V(B),
and Formula V(C):<img file="EP3300501A2_D0007.tif" /> and pharmaceutically acceptable salts, esters, prodrugs, hydrates and tautomers thereof; wherein:
[069] L is a bond, C1-C10 alkylene, Ci-Cio heteroalkylene, C2-C10 alkenylene or C2-C10
heteroalkenyl ene linker, each of which is optionally substituted with one or more substituents
selected from the group consisting of halogen, oxo (-0), or C1-C6 alkyl;
[070] A is heterocycloalky/L heteroaryi or NR4R5 where R and R5 are independently H, optionally substituted Ci-Cg alkyl, C-2-Cg heteroalkyl, C<sub>2</sub>-Cg alkenyi, C Cg heteroalkenyl Ca-Cg alkynyl, Ci-Cg heteroalkynyl, Ci-Cg acyl, Ci-Cs heteroacyl, O-C.o and, C5-C12 heteroaryi, C7-C12 arylalkyl, or C<sub>6</sub>-
C12 heteroarylalkyi group,
[071] R4 and Rs can be linked to form a 3-8 membered ring, optionally containing one or more N,
O or S; and each R and Rs groups, and each ring formed by linking R4 and Rs groups together, is optionally substituted with one or more substituents selected from halo, <sup>:</sup>~0, =N-CN, =N-OR', -NR',
OR', {R')2. SR*, S0<sub>2</sub>R', SOzNR^, R'SOaR', NR'CONR. , NR'COOR', NR'COR', CN, COOR', CON(R')<sub>¾</sub> OOCR', COR', and NO<sub>¾</sub> wherein each R' is independently H, Ci-C<sub>6</sub> alkyl, C2-C6 heteroalkyl, Ci-Ce acyl, Ca-Ce heteroacyL Cs-Cioaryl, C5-C10 heteroaryl, C7-C12 arylalkyl, or Ce-Cn heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, €i~C4 alkyl, C5-C4 heteroalkyl, Ci-C<s acyl, C1-C0 heteroacyL hydroxy, amino, and <sup>~</sup>0; wherein two R' can be linked to form a 3-7 rnembered ring optionally containing up to three heteroatoms selected from N, O and S;
[072] X is NR<sub>6</sub>, <sup>(</sup>X or S;
[073] Έ.6 is H, optionally substituted Ci-Cg alkyl, C?-Cg heteroalkyl, C<sub>2</sub>-Cg alkenyl, C-2-Cg heteroalkenyl, C2-C alkynyl, C-2-Cs heteroalkynyl, Ci-Cg acyi, C<sub>2</sub>-Cg heteroacyL Ce-Cio aryl, C5-C12 heteroaryl, C7-O2 arylalkyl, or Cs-Cn heteroarylalkyl group;
[074] <sub>&</sub> can be linked to R<sub>4</sub> or R5 to form a 3-8 rnembered ring; and R or R5 is optionall substituted with one or more substituents selected from halo, <sup>:</sup>=G, =N-CN, =N-OR', = R', OR', N(R')2, SR', SOaR', S0<sub>2</sub>N '2<sub>5</sub> NR'S0<sub>2</sub>R<sup>!</sup>, NR'CONR'<sub>2</sub>, NR'COOR', NR'COR'. CN, COOR',
CON(R')2, OOCR.', COR', and NO2, wherein each R' is independently H, Ci-Cs alkyl, C2-C6 heteroalkyl, Ci-Cg acyl, Ca-Ce heteroacyL Cs-Cioaryl, Cs-Cio heteroaryl, C7-C12 arylalkyl, or Ce-Cn heteroarylalkyl, each of which is optionally substituted with one or more groups selected from ha!o, Cf-C4 alkyl, C1-C4 heteroalkyl, Ci-C« acyl, Ci-C<sub>6</sub> heteroacyL hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 rnembered ring optionally containing up to three heteroatoms selected from N, O and S;
[075] X<sub>2</sub> is II, Ci-Cjo alkyl, Cj-Cio heteroalkyl, C2-C10 alkenyl, or C2-C10 heteroalkenyl, e¾eh of which is optionally substituted with one or more halogens,— O, or an optionall substituted 3-7 rnembered carbocyclic or heterocyclic ring;
[076] (U)„ and (U)<sub>m</sub> are independently H, halogen, CF¾ CN, OR?, NRsR¾ SR<sub>7</sub>, S0<sub>2</sub>NRsR<>, Ci-Cio alkyl, Cj-Cio heteroalkyl, C2-C10 alkenyl, or C2-CJ0 heteroalkenyl, each of which is optionally substituted with one or more halogens, =0, or an opiionall substituted 3-7 rnembered carbocyclic or heterocyclic ring;
[077] wherein 2 and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 rnembered ring, optionally contaming one or more N, O or S: and each R2 and ¾ groups, and each ring formed by linking R2 and R3 groups together, is optionaily substituted with one or more subsiituents selected from halo, =0, =N-CN, =N-OR\ =NR<sup>*</sup>, OR', N(R')<sub>2</sub>, SR', S0<sub>2</sub>R<sup>!</sup>, SOaNR'a, NR'SOsR', NR'CONR'2, NR'COOR', NR'COR', CN, COOR', CQN(R')<sub>2</sub>, OOCR', COR', and Oa, wherein each R' is independently H, Ci-C<sub>6</sub> alkyl, C2-C0 heteroalkyl, Ci-Ce acyL C2-C6 heteroacyl, Cfi-Cio aryl, C5-C10 heteroaryl. C7-C12 arylalkyl, or CVC12 heteroaryl alkyl , each of which is optionally substituted with one or more groups selected from halo. C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Ce acyl, C]-C6 heteroacyl, hydroxy, amino, and =0; wherein two R" can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, 0 and S.
[078] In one as ect, the present invention provides a compound of Formula VI(A), Vi(B) and
VI(C): <img file="EP3300501A2_D0008.tif" /> , and pharmaceutically acceptable salts, esters, prodrugs, hydrates and tautomers thereof; wherein:
[079] Bi is a bond or CO;
[080] I¾ is X-L-A
[081] L is a Ci-Cio alkylene, d-Cio heteroalkylene, C<sub>2</sub>-Cio alkenylene or C<sub>2</sub>-C}o heteroalkenylene linker, each of which may be optionally substituted with one or more subsiituents selected from the group consisting of halogen, oxo (~0), or Ci-Cg alkyl;
[082] A is heterocycloalkyl, heteroaryl or NR4R5 wherein R and Rs are independently H, optionally substituted Ci-Cs alkyl, C<sub>2</sub>-Cf< heteroalkyl, Cz-Cs alkenyl, C2-C8 heteroalkenyl, Cz-Cs alkynyl, C<sub>2</sub>-Cs heteroaikynyl, Ci-Cg acyl, C2-C8 heteroacyl, Cg-Cio atyl, C5-C12 heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroaryl alkyl group, or R<sub>4</sub> and R<sub>5</sub> can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S; and each R and Rs groups, and each ring formed by linking R4 and R5 groups together, is optionally substituted with one or more subsiituents selected from halo, O, -N-CN, N-OR', =NR<sup>*</sup>, OR', N(R')2, SR', S0<sub>2</sub>R', SO2NR2, NR'SOaR', NRCONR'2, NR'COOR', NR'COR', CN, COOR', CON(R , OOCR', COR', and NO2, wherein each R' is independently H, Ci-Qs alkyl, C2-C6 heteroalkyl, Ci-Ce acyl, C2-C0 heteroacyl, Gs-Cio aryi, Cs-Cio heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Ce acyl, Ci~C« heteroacyl. hydroxy, amino, and <sup>:::</sup>0; wherem two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[083] X is CR&Re, N¾, O, or 8; wherein R<sub>6</sub> is H, optionally substituted Ci-Ce alkyl, C<sub>2</sub>-Cs heteroalkyl, Cz-Cg alkenyl, C<sub>2</sub>-Cs heteroalkenyl, Ca-Cg alkynyl, Cz-Cg heteroalkynyl, Ci-Cg acyl, C<sub>2</sub>- Cs heieroacyl, Ce-Cio aryl, C5-C12 heteroaryl, C?-Ci2 arylalkyl, or C6-C12 heteroarylalkyl group; or Re can be linked to R<sub>4</sub> or R<sub>5</sub> to form a 3-8 membered ring;
[084] (U}„ and (U)<sub>m</sub> are independently H, halogen, CF<sub>3</sub>, CN, GR<sub>7</sub>, NRsR¾ SR<sub>7</sub>, SQ2NR8R9, C1-C10 alkyl, Ci-Cio heteroalkyl, C2-C 0 alkenyl, or C2-C10 heteroalkenyl, each of which may be optionally substi uted with one or more halogens, =0, or an optionally substituted 3-7 membered carbocyclic or heterocyclic ring.
the present invention provides a compound of Formula VII:
<img file="EP3300501A2_D0009.tif" /> and pharmaceutically acceptable salts, esters, prodrugs, hydrates and tautomers thereof; wherein:
[086] B is an optionally substituted 5-6 membered carbocyclic or heterocyclic ring;
[087] Z-5 is or CX<sub>2</sub>;
[088] each Zj and 7A is N, CEL or CRj, provided any three N are non-adjacent; and further provided that one or more of Zj, Z2, Z<sub>3</sub>, and Z<sub>4</sub> is CRt;
each Ri is independently an optionally substituted Ci-Cg alkyl, C Cs heteroalkyl, Ca-Cg alkenyl, C2-
Cg heteroalkenyl, Ci-Cg alkynyl, Ca-Cs heteroalkynyl, Ci-Cg acyl. C2-C8 heieroacyl, Ce-Cw aryl, Cs-
Cj2 heteroaryl, C?-Ci2 arylalkyl, or CJS heteroarylalkyl group, or each Rs is independently H, halo, CF<sub>3</sub>, OR2, NR2R3, NR2OR3, NR2NR2R3, SR.2, SOR2, S0<sub>2</sub>R<sub>2</sub>, SO2NR2R3, NR2SO2R3,
NR2CO R2R3, NR2COOR3, NR2COR3, CN, COOR2, COOH, CONR2R3, OOCR¾ COR2, or NO2;
[089] and wherem ¾ and R3 groups on the same atom or on adjacent atoms can be linked to form a
3-8 membered ring, optionally containing one or more N, O or S atoms; and each R<sub>2</sub> and R3 groups, and each ring formed by linking R2 and R? groups together, is optionally substituted with one or more substitqenis selected from halo, =0, =N-CN, -N-OR*, =NR', OR', N(R')2, SR', S02R',
SOaNR'i, NR'SCbR', NR'CONR'<sub>2</sub>, NR'CQOR', NR'COR, CN, COOR', C()N(R')<sub>2</sub>, OOCR', COR', and NO?., wherein each R' is independently H, Ci-Ce alkyl, C2-C6 heteroalkyl, Ci-C<sub>6</sub> acyl, C2-C6
heteroacyl, Ce-Cio aryl, C5-C10 heteroaryl, C?-Ci<sub>2</sub> arylalkyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, Cf-C4 heteroalkyl, C1-C0 acyl, Ci-Cgheteroacyl, hydroxy, amino, and =0; wherei two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, <sup>(</sup>) and S;
[090] Two Rl groups on adjacent atoms may form a earboxylic ring, heterocyclic ring, aryl or heteroaryl, each of which may be optionally substituted and/or fused with a cyclic ring;
[091 ] or each Ri is independently -W, -L-W, -X-L-A; wherein X is NR&, O, or S; W is an optionally substituted 4-7 membered azacyclie ring, optionally containing an additional heteroatom selected from N, O and S as a ring member; L is a Cj-Cio alkylene, C1-C10 heteroa!kylene, C2-C10 alkenylene or C2-C<sub>1</sub>0 heteroalkenylene linker, each of which may he optionally substi tuted with one or more sixbstitoenis selected from the group consisting of halogen, oxo (=0), or C1-C-6 alkyl; and A is heterocycloalkyl, heteroaryl or NR<sub>4</sub>R5 where R and Rs are independently H, optionally substituted Ci-Cs alkyl, Qi-Cg heteroalkyl, C<sub>2</sub>~Cg aikenyl, Ca-Cg heteroalkenyl, C2-C8 alkynyl, G-Cg heteroaikynyh Ci-Cs acyl, Ca-Cg heteroacyl Ce-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or Cg- C12 heteroarylalkyl group,
[092] R,; and R5 can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S; and each R<sub>4</sub> and R5 groups, and each ring formed by linking R4 and Rs groups together, is optionally substituted with one or more substituents selected from halo, =0, -N-CN, =N-QR', =NR', OR', H(R% SR<sup>*</sup>, SO2R', S0<sub>2</sub>NR'<sub>2</sub>, NR'SChR', NR'CONR'a, R'COOR', NR'COR', CN, COOR', CON(R')<sub>¾</sub> OOCR', COR', and ΝΌ2, wherein each R' is independently H, Ci-Ce alkyl Ci-C heteroalkyl, Ct-Ce acyl, C2-C0 heteroacyl, Ce-Cioaryl, C5-C10 heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Ce acyl, Ci-C<sub>6</sub> heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[093] R<sub>6</sub> is H, optionally substituted Ci-Cg alkyl, C<sub>2</sub>~C<sub>8</sub> heteroalkyl, C2-C8 alkenyl, Ci-Cs lieteroalkenyl, Cz-Cg alkynyl, Ci-Cs heteroalkynyl, Ci-Cg acyl, C<sub>2</sub>-Cg heteroacyl. Ce-Cio aryl, Cs-Ci2 heteroaryl, Cj-Cn arylalkyl, or C<sub>6</sub>-Ci2 lieteroarylalkyl group; [094] R<sub>6</sub> can be linked to R4 or R$ to form a 3-8 membered ring; and R or Rs is optionally substituted with one or more substituents selected from halo, =0, = -CN, <sup>~</sup>N-OR', =NR', OR', N(R')<sub>2</sub>, SR., S0<sub>2</sub>R', SOaNR'a, NRSO2R<sup>1</sup>, NR'CONR'a, NR'COQ , NR'COR, CN, COOR,
CON(R')<sub>2</sub>, OOCR<sup>!</sup>, COR, and NO2, wherein each R' is independently H, Ci-Ce alk l, C2-C6 heteroalkyl, Ci-Cs acyl, C2-C6 heteroacyl, tVOoaryl, CVCio heteroaryl, C7-C12 arylalkyl, or CVC12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Cj-Qs acyl, C1-C6 heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatorns selected from N, O and S;
[095] Xj is an optionally substituted Ci-Cs alkyl, (¾.~£·8 heteroalkyl, C<sub>2</sub>-Cg alkenyl, CVCg heteroalkenyl, C2-C8 alkynyl, Ca-Cg heteroalkynyl, Ci-Cg acyl, C2-C8 heteroacyl, Cg-Oo aryl, Cs-Ca heteroaryl, C?-Ci2 arylalkyl, or C6-C12 heteroarylalkyl group, optionally substituted with one or more halogens, =0, CF<sub>3</sub>, CN, OR?, NR*R<>, SR<sub>7</sub>, SOaNRsRs, C1-C1 alkyl, C2-C8 heteroalkyl, C<sub>2</sub>-C<sub>8</sub> alkenyl, C2-C-8 heteroalkenyl, C Cs alkynyl, C2-C8 heteroalkynyl, Ci-Cg acyl, C?.~Cg heteroacyl, C<sub>6</sub>- Cio aryl, C5-C12 heteroaryl, C?-Cj2 arylalkyl, or Ce-Cij heteroarylalkyl group, or;
[096] Xi is H, NR2R3, SOR2, SO2R2, SO2NR2R3, NR2SG2R3, NR2CONR2R.1, NR2COOR3, NR2COR3, CN, COOR2, ester bioisostere, COOH, carboxy bioisostere, CONR2R3, amide bioisostere, OOCR<sub>2</sub>, COR<sub>2</sub>, or NO¾
[097] X<sub>2</sub> is H, halogen, CF<sub>3</sub>, CN, OR?, NRgR¾ SR?, SO2 R8R , C1-C10 alkyl, C1-C10 heteroalkyl, C2-C10 alkenyl, or C2-C to heteroalkenyl, each of which, may be optionally substituted with one or more halogens, =0, or an optionally substituted 3-7 membered carboeyelic or heterocyclic ring.
[098] each ¾, X<sub>4</sub> and X<sub>5</sub> is N or CR10
[099] each Rio is independently an optionally substituted Ci-Cg alkyl, C<sub>2</sub>-Cg heteroalkyl, C2-C8 alkenyl, C2-C8 heteroalkenyl, C<sub>2</sub>-Cs alkynyl, C2-C8 heteroalkynyl, Ci-Cg acyl, C<sub>2</sub>-Cs heteroacyl, C<sub>6</sub>- Cjo aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or Cg-Cia heteroarylalkyl group, or each Rt is independently H, halo, CF3, 0¾ NR2R3, NR2OR3, NR2NR2R3, SR<sub>2</sub>, SOR2, SO2R2, SO2NR2R3, NR2SO2R3, NR2CONR2.R3, NR2COOR3, NR2COR3, CN, COOR2, COOH, CONR2R3, OOCR<sub>2;</sub> COR<sub>2</sub>, or 0<sub>2</sub>; 0I00J and wherein Ra and R<sub>3</sub> groups on the same atom »r on adjacent atoms can be linked to form a 3- 8 membered ring, optionaUv containing one or more N, O or S atoms; and each R<sub>2</sub> and R<sub>3</sub> groups, and each ring formed by linking R<sub>2</sub> and R<sub>3</sub> groups together, is optionally substituted with one or more subsiituents selected from halo, =0, =N-CN, =N-OR*, =<sup>::</sup>NR', OR', (R')2<sub>5</sub> SR', S0<sub>2</sub>R<sup>!</sup><sub>;</sub> SC iNR'i, NR'SC R', NR'CO R'2, NR'COoR', NR'COR', CN, COOR', cON(R')<sub>2</sub>, OGCR', COR', and N0<sub>2s</sub> wherein <sub>e</sub>ach R' is independently H, d-Ce alkyl, Cj-Ce heteroalkyl, Ci-Ceaeyl, Ca-Ce heteroacyl, Ce- Cio aryl, Cs-cio heteroaryi, C--Ci2 aryialkyl, or CVda heteroarylalkyl, each of which is optionally substituted with one or more groups selected from ha!o, d-d alkyl, Ci-O heteroalkyl, d-Ce acyl, Ci~ C¾ heteroacyl, hydroxy, amino, and=0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[0101] Two Rio groups on adjacent atoms may form a carboxylic ring, heterocyclic ring, aryl or heteroaryi, each of which may be optionally substituted and/or fused with a cyclic ring; or each Rio is independently - W, -L-W, -X~L~A; wherein X is N¾, O, or S; W is an optionally substituted 4-7 membered azaeyelie ring, optionally containing an additional heteroatom selected from N, O and S as a ring member; L is a Ci-Cio alkylene, Ci-do heteroalkylene, C2-C10 alkenylene or C2-C10 lieteroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=0), or Ci-Cg alkyl; and A is heterocycloalkyl, heteroaryi or NR4R5 where R^and Rs are independently E, optionally substituted C.-Cs alkyl, Ca-Cg heteroalkyl, C<sub>2</sub>-Cs alkenyl, Cz-Cg heteroalkenyl, Ca-Cg a!kynyL Cs-Cg heteroalkynyl, Ci-Cg aeyl, C<sub>2</sub>- Cs heteroacyl, Ce-do aryl, C5-C12 heteroaryi, C7-Ci2 aryialkyl, or C -Cn heteroarylalkyl group.
present in vention provides a compound of Formula VIII:
<img file="EP3300501A2_D0010.tif" /> , and pharmaceutically acceptable salts, esters, prodrugs, hydrates and tautomers thereof; wherein:
[0103] Zs is N or CX¾
[0104] each Zi and Z is N<sub>}</sub> CH, or CRv, [0105] each Ri is independently an optionally substituted Cs-Cs alkyl, C2-C8 heteroalkyl, C<sub>2</sub>-C<sub>8</sub> alkenyl, C<sub>2</sub>~Cs heteroalkenyl, Ci-Cg alkynyl, C?-Cg heteroalkynyl, Ci-Cg acyl, C<sub>2</sub>-Cs heteroacyi, CV Cio aryl, Cs-Cn heteroaryl, C7-C12 arylalkyl, or Ce~Cn heteroarylalkyl group, or each Ri is independently H, halo, CF<sub>3</sub>, OR2, NR2R3, NR2OR3, NR2NR2R3, SR2, SOR¾ SO2R2, SO2 R2R3, NR2SO2R3, NR2CONR2R3, NR<sub>2</sub>COOR<sub>3</sub>, NR2COR.3, CN, COOR2, COOI L CONR2R3, OOCR2, COR2<sub>5</sub> or N0<sub>2</sub>;
[0106] and wherein Ra and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N. O or S atoms; and each R2 and R3 groups, and each ring formed by linking R2 and R3 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, =N-OR\ =NR\ OR', N(R')2, SR', S0<sub>2</sub>R'<sub>s</sub> SOaNR'z, R'S0<sub>2</sub>R<sup>f</sup>, NR'CONR'2, NR'COOR', NR'COR', CN, COOR', CO (R')2, OOCR", COR', and NO2. wherein each R' is independently H, Ci-Ce alkyl. C2-C6 heteroalkyl, Ci-Cg acyl, Ca-Cg heteroacyi, Cg- Cio aryl, Cs-Cio heteroaryl, C<sub>7</sub>-Ci<sub>2</sub> arylalkyl, or Ce- n heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, Cj~C4 alkyl, C1-C4 heteroalkyl, Ci-C« acyl, Ci-Cg heteroacyi, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[0107] or each Rj is independently -W, -L-W, -X-L-A; wherein X is NR<¾, O, or S; W is an optionally substituted 4-7 membered azacyclic ring, optionally containing an additional heteroatom selected from N, O and S as a ring member; L is a Ct-Cio alkylene, C1-C10 heteroalkylene, C2-C10 alkenylenc or C Cio heteroalkenylene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (=0), or C1-C6 alkyl; and A is heterocycloalkyi, heteroaryl or R4R5 w<sup>?</sup>here R and Rs are independently H, optionally substituted Ci-Cg alkyl, C<sub>2</sub>-O heteroalkyl, Ca-Cg alkenyl, Cs-Cg heteroalkenyl, C2-C8 alkynyl, C<sub>2</sub>-Cs
heteroalkynyl, Ci-Cs acyl, C<sub>2</sub>-Ca heteroacyi, Ce-Cio aryl, Cs-C{2 heteroaryl, C7-C12 arylalkyl, or Ce- C12 heteroarylalkyl group,
[0108] R4 and Rs can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S; and each R4 and Rs groups, and each ring formed by linking 4 and R.5 groups together, is optionally substituted with one or more substituents selected from halo, =0, =N-CN, =N-OR', ~NR', OR*, N(R')2, SR', S0<sub>2</sub>R', S02,NR'<sub>2</sub>, R<sup>!</sup>S0<sub>2</sub>R', NR'CONR'2, NR'COOR', NR'COR', CN, COOR', CONCR a, OOCR', COR', and NCh, wherein each R' is independently H, Ci-Cg alkyl, C<sub>2</sub>-C<sub>6</sub> heteroalkyl, Cj-Ce acyl, C2-C6 heteroacyl, Cfr-Cio aryl, C5-C10 heteroaryi, C7-O2 aryialkyl, or CVC12 heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C<sub>1</sub>-C4 alkyl, C<sub>1</sub>-C4 heteroalkyl, Ci-Cd acyl, Ci-Ce heteroacyl, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected<img file="EP3300501A2_D0011.tif" />
[0109] ¾ is H, optionally substituted Ci-Cs alkyl, Ci-Cg heteroalkyl, Ci-Cg alkenyl, C<sub>2</sub>-Cs
heteroalkenyl, C?-Cs alkynyl, C2-C8 heteroalkynyl, Ci-Cg acyl, Ci-Ca heteroacyl, Ce-Cio aryl, C5-C12 heteroaryi, C7-C12 aryialkyl, or C6-C12 heteroarylalkyl group,
[011G] R.& can be linked to R4 or R5 to form a 3-8 membered ring; and R or R5 is optionally substituted with one or more su.bstitu.ents selected from halo, =0, -N-CN, -N-OR.', =NR', OR, N(R SR'<sub>5</sub> S0<sub>2</sub>R<sup>!</sup>, SO2NR2, R'SObR, NR'CONR ¾ NR'COOR<sup>1</sup>, NR'COR', CN, COOK.',
CON(R')2, OOCR<sup>1</sup>, COR', and NO2, wherein each R' is independently EL Cj-C<sub>6</sub> alkyl C<sub>2</sub>-C<sub>6</sub> heteroalkyl, Ci-Cg acyl, Cs-Ce heteroacyl, CVCioaryl, C5-C10 heteroaryi, C?~Cn aryialkyl, or Ce-Cn heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-C¾ acyl, Ci-Cs heteroacyl, hydroxy, amino, and <sup>~</sup>-=0; wherein two R can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[0111] X; is an optionally substituted Ci-Cs alkyl, C<sub>2</sub>-Cg heteroalkyl, Cs-Cs alkenyl, Ca-Cg
heteroalkenyl, Ca-Cs alkynyl, j-Ck heteroalkynyl, Ci-Cg acyl, Ci-Cg heteroacyl, Ce-Cio aryl, Cs-Ci2 heteroaryi, C7-C12 aryialkyl, or Ce-Cn heteroarylalkyl group, optionally substituted with one or more halogens, =0, CF<sub>3</sub>, CN, OR.7, NR<sub>8</sub>R<sub>9</sub>, SR<sub>7</sub>, S0<sub>2</sub>NR<sub>g</sub>R<sub>9</sub>, Ci-Cg alkyl, C<sub>2</sub>-C<sub>8</sub> heteroalkyl, C<sub>2</sub>-Cg alkenyl, C<sub>2</sub>-Cg heteroalkenyl, Cs-Cg alkynyl, C<sub>2</sub>-Cg heteroalkynyl, Ci-Cs acyl, C<sub>2</sub>-Cg heteroacyl, C<sub>6</sub>- C<sub>10</sub> aryl, Cs- n heteroaryi, C7-C<sub>1</sub>2 aryialkyl, or C6-C<sub>12</sub> heteroarylalkyl group, or;
[0112] X{ is H, NR2R3, SOR2, SO2R2, SO2NR2R3, NR2SO2R3, NR2CONR.2R3, <sup>'</sup>NR2COOR3, NR2COR3, CN, COOR2, ester bioisostere, COOH, carboxy bioisostere, CONR2R3, amide bioisostere, OOCR2, COR2, or NO2;
7? [0113] X<sub>2</sub> is H, halogen, CF<sub>3</sub>, CN, OR?, NR<sub>S</sub>R.<sub>9</sub>, SR.7, SOaNRgRg, Ci-Cjo alkyl C1-C10 heteroalkyl, C2-C<sub>1</sub>0 alkenyl, or C2-C10 heteroalkenyl, each of which may be optionally substituted with one or mote halogens, =0, or an optionally substituted 3-7 membered carbocyclic or heterocyclic ring.
[0114] each X-¾, ¾ and X<sub>5</sub> is N or CR10
[01 1.5] each io is independently an optionally substituted Ci-Cg alkyl, C?~Cs heteroalkyl, C<sub>2</sub>-Cg alkenyl, C-t-Cg heteroalkenyl, C2-C8 alkynyl, C<sub>2</sub>-Cs heteroalkynyL Ci-Cg acyl, C2-C8 heteroacyi, C<sub>6</sub>- C10 aryl, Cs-C<sub>12</sub> heteroaryl, C7-C32 arylalkyl, or Ce-Cu heteroarylalkyl. group, or each Ri is independently H, halo, CF<sub>3></sub> QR<sub>2</sub>, NR2R3, NR3OR3, NR2NR2R3, SR2, SOR¾ SO2R2, SQ2NR2R3, R2SO2R3, NR2.CONR.2R3, NR.2COOR3, NR2COR3, CN, COOR2, COOH, CONR2R3, OOCR2,
COR<sub>2j</sub> or N0<sub>2</sub>;
[0116] and wherein R<sub>2</sub> and R3 groups on the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S atoms; and each R2 and R3 groups, and each ring formed by linking R<sub>2</sub> and R3 groups together, is optionally substituted wit one or more substituents selected from halo, O, =N-CN, =N-OR', -NR', OR', N(R')<sub>2</sub>, SR', S0<sub>2</sub>R', SCbNR^ NR'SOaR', NR'CONR'2, NR'COOR', NR'COR', CN, COOR', CON(R<sup>!</sup>)<sub>2</sub>, OOCR.', COR', and NO¾ wherein each R' is independently H, Ci-Ce alkyl, Ca-C^ heteroalkyl, Ci-Ce acyl, C2-C6 heteroacyi, Ce- Cioaryl, C5-C10 heteroaryl, C?-Cj2 arylalkyl, or Qs-Cu heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C1-C4 alkyl, C1-C4 heteroalkyl, Ci-Cg acyl, Ci-Cfi heteroacyi, hydroxy, amino, and =0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[0117] Two Rio groups on adjacent atoms may form a carboxylie ring, heterocyclic ring, aryl or heteroaryl, each of which may be optionally substituted and/or fused with a cyclic ring; or each Rio is independently -W, -L-W, -X-L-A; wherein X is NR$<sub>S</sub> O, or S; W is an optionally substituted 4-7 membered a/acye!ic ring, optionally containing an additional heteroatom selected from N, O and S as a ring member; L is a Cs-Cfo alkylene, C3-C10 heteroalkylene, C-2-Cio alkenylene or C<sub>2</sub>-Cio heteroalkenyiene linker, each of which may be optionally substituted with one or more substituents selected from the group consisting of halogen, oxo (==0), or C1-C6 alkyl; and A is helerocycloalkyi, heteroaryl or NR R5 where R4 and R5 are independently H, optionally substituted Cj-Cs alkyl, C2-C8 heteroaikyl, Ca-Cg alkenyl, Qt-Cg heteroalkenyl, C<sub>2</sub>-Cg alkynyl, C;?-Cs heteroaikynyl, Ci-Cg acyl, C2- Cg heteroacyl, C-6-C10 aryl, C5-C12 heteroaryl, C?~Ci2 arylalkyl, or C$~Cn. heteroarylalkyl group,
[0118] in one aspect, the present invention provides a compound of Formula XXV (A), XIV(B), XIV (C) and XIV (D):
<img file="EP3300501A2_D0012.tif" />
pharmaceutically acceptable salts, esters, prodrugs, hydrates and tautomers thereof; wherein;
1011 ] Bi is a bond or C=0 and B<sub>2</sub> is X-L-A:
[0120] L is a Cj-Cio alkylene, Ci-Cio heteroalkylene, C<sub>2</sub>-do alkenylene or C2-C50 heteroalkenylene linker, each of which may be optionally substituted with one or more substitueats selected from the group consisting of halogen, oxo (=0)<sub>5</sub> or C1-C0 alkyl;
[Θ121] A is heterocycloalkyl, heteroaryl or NR4R5 wherein R and R5 are independently H,
optionally substituted Ci-Cs alkyl, C2-C8 heteroaikyl, Ca-Cg alkenyl, C2-C8 heteroalkenyl, C2-C8 alkynyl, C<sub>2</sub>-Cg beteroalkynyl, Ct-Cg acyl, C<sub>2</sub>-Cg heteroacyl, Ce-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or C6-C12 heteroarylalkyl group, or R and Rs can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S; and each R and Rs groups, and each ring formed by linking R<sub>4</sub> and R5 groups together, is optionally substituted with one or more substituents selected from halo, O, -N-CN, -N-OR', -NR', OR', N(R')<sub>2</sub>, SR', S<¾R\ SCh R^, NR<sup>!</sup>S0<sub>2</sub>R, NR'CONR'2, NR'COOR', NR'COR', CN, COOR', CO (R OOCR'. COR', and N0<sub>2</sub>, wherein each R' is
independently H, Ct-Ce alkyl, Ca-Ce lieteroalkyl, Ci-(¾ acyl, C2-C6 heteroacyl, CVdo aryL Cs-Cio heteroaryl, C7-C12 arylalkyl, or Ce-Cu heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, Ci-C<sub>4</sub> alkyl, C1-C heteroalkyl, Cj-CV, acyl, Ci-Cg heteroacyl, hydroxy, amino, and <sup>:::</sup>0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[0122] X is CRi¾, NR.6, O, or S; wherein R<sub>6</sub> is H, optionally substituted Ci-Cg alkyl, C Cg heteroalkyl, C<sub>2</sub>-Cg alkenyl, C2-C8 heteroalkenyl, C<sub>2</sub>-Cs alkynyl, C<sub>2</sub>-Cg heteroalkynyl, Ci-Cg acyl, C2- C¾ heteroacyl, Ce-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or CVC12 heteroarylalkyl group; or R<sub>6</sub> can be linked to R or Rs to form a 3-8 membered ring;
[0123] X<sub>2</sub> is H<sub>5</sub> halogen, Ci C , OR?, NRgR¾ SR.?, SO2NR&R9, CI-CIQ alkyl, O-Cto heteroalkyi C2-Cto alkenyl, or C2-C10 heteroalkemd, each of which may be optionally substituted with one or more halogens, <sup>~:</sup> 0, or an optionally substituted 3-7 membered carbocyclic or heterocyclic ring.
[0124] (U)« and (U)<sub>M</sub> are independently H, halogen, CF¾ CN, OR?, NR&R9, SR7, SO2NRSR9, Ci-Oo alkyl, C<sub>1</sub>-C<sub>1</sub>0 heteroalkyi, C2-C<sub>1</sub>0 alkenyl, or C2-C10 heteroalkenyl, each of which may be optionally substituted with one or more halogens,— O, or an optionally substituted 3-7 membered carbocyclic or heterocyclic ring;
[0125] each X3, ¾ and X.¾ is N or CR10;
[0126] each Rio is independently an optionally substituted Ci-Cg alkyl, Ca-Cg heteroalkyi, Ci-Cg alkenyl, C<sub>2</sub>-Cg hetseroalkenyl, C -Cs alkynyl, C<sub>2</sub>-Cs heteroalkynyl Ci-Cg acyl, C2-C8 heteroacyl, C<sub>6</sub>- Cio aryl, C5-C<sub>1</sub>2 heteroaryl, C?-Cn arylalkyl, or C6-C12 heteroarylalkyl group, or each Ri is independently H, halo, CF<sub>3</sub>, OR2, NR2R3, NR2OR3, NR2NR2R3, SR2, SOR2, SO2R2, SO2NR2R3, R2SO2R3, NR2CONR2R3, NR2COOR3. NR2COR3, CN, COOR2, COOH, CO R2R3, QQCR¾ COR<sub>3</sub>, or N0<sub>2</sub>;
[0127] and wherein l¾ and R3 groups 011 the same atom or on adjacent atoms can be linked to form a 3-8 membered ring, optionally containing one or more N, O or S atoms; and each Ra and R<sub>3</sub> groups, and each ring fonned by linking R<sub>2</sub> and R3 groups together, is optionally substituted with one or more substituents selected from halo, -O, =N-CN, =N-OR<sup>!</sup>, =NR<sup>*</sup>, OR', N(R')<sub>2</sub>, SR', SO2R', S0<sub>2</sub>NR<sup>,</sup>2, NRSOiR', NR'CONR'2, NR'COOR', NR'CGR', CN, COOR<sup>»</sup>, CON(R')¾ OOCR', COR', and NO2, wherein each R' is independently I I, Ci-Cs alkyl, C2-C6 heteroalkyi, Ci-Cg acyl, C2-C6 heteroacyl, Cg~ C 10 aryl, Cs-Cio heteroaryl, C7-C12 arylalkyl, or Ce-Cn heteroarylalkyl, each of which is optionally substituted with one or more groups selected from halo, C<sub>1</sub>-C4 alkyl, Ct-Gj heteroalkyi, Ci-Gs acyl, Ci-Cg heteroacyl, hydroxy, amino, and <sup>::::</sup>0; wherein two R' can be linked to form a 3-7 membered ring optionally containing up to three heteroatoms selected from N, O and S;
[0128] Two io groups on adjacent atoms may form a earboxylic ring, heterocyclic ring, aryl or heteroaryl, each of which may be optionally substituted and/or fused with a cyclic ring; [0129] or each Rjo is independently -W, -L-W, -X-L-A; wherein X is NRe, O, or S; W is an optionally substituted 4-7 membered azacyclic ring, optionally containing an additional heteroatom selected from N, 0 and S as a ring member; L is a O-Cjo alkylene, Ci-Cto heteroalkylene, C2-C10 alkenylene or C2-C10 heteroalkenylene linker, each of which may be optionally substituted with one or m ore substituents selected from the group consisting of halogen, oxo (=0), or C1-C6 alkyl; and A is heterocycloalkyL heteroaryl or R R.5 where R and R¾ are independently II, optionally substituted Ci-Cg alkyl, C-2-Cs heteroalkyl, C2-C8 aikenyl, C<sub>2</sub>-€g heteroalkenyl, Ca-Cg alkynyl, C<sub>2</sub>-Cs
heteroalkynyl, Ci-Cs acyl, C<sub>2</sub>-Cs heteroacyl, Ce-Cio aryl, C5-C12 heteroaryl, C7-C12 arylalkyl, or C0- C12 heteroarylalk l group.
[0130] Any combinatio of the groups described above for the various variables is contemplated herein. Throughout the specification, groups and substituents thereof are chosen by one skilled in the field to provide stable moieties and compounds.
[0131] In one aspect, described herein are pharmaceutical compositions comprising a compound described herein, or a pharmaceutically acceptable salt, or solvate thereof, and at least one pharmaceutically acceptable excipient. in some embodiments, the pharmaceutical composition is formulated for administration to a mammal by intravenous administration, subcutaneous
administration, oral administration, inhalation, nasal administration, dermal administration, or ophthalmic administration. In some embodiments, the pharmaceutical composition is in the form of a tablet, a pill, a capsule, a liquid, a suspension, a gel, a dispersion, a solution, an emulsion, an ointment, or a lotion.
[0132] In one aspect, described herein is a method of treating or preventing any one of the diseases or conditions described herein comprising administering a therapeutically effective amount of a compound described herein, or a pharmaceutically acceptable salt, or solvate thereof, to a mammal in need thereof.
[0133] In another aspect, described herein is a method for treating or preventing cancer, or fibrosis, or combinations thereof in a mammal comprising administering a therapeutically effective amount of a compound described herein, or a pharmaceutically acceptable salt, or solvate thereof to the mammal in need thereof. [0134] In one aspect, described herein is a method for treating or preventing cancer i a mammal comprising administering a therapeutically effective amount of a compound described herein, or a pharmaceutically acceptable salt, or solvate thereof, to the mammal in need thereof. In some embodiments, the cancer is amenabie to treatment with an inhibitor of POL 1 transcription;. In some embodiments, the method further comprises admiaistering a second therapeutic agent to the mammal in addition to the compound described herein, or a pharmaceutically acceptable salt, or solvate thereof.
[0135] In one aspect, described herein is a method for treating or preventing an inflammator disease in a mammal comprising administering a therapeutically effective amount of a compound described herein, or pharmaceutically acceptable salt, or solvate thereof, to the mammal in need thereof. In some embodiments, the inflammatory disease is amenable to treatment with an inhibitor of POL 1 transcription. In some embodiments, the method further comprises administering a second therapeutic agent to the mammal in addition to the compound described herein, or a
pharmaceutically acceptable salt, or solvate thereof,
[0136] I one aspect, described herein is a method for treating or preventing a proliferative disorder in a mammal comprising administering a therapeutically effective amount of a compound described herein, or a pharmaceutically acceptable salt, or solvate thereof, to the mammal in need thereof. In some embodiments, the proliferative disorder is amenable: to treatment with an inhibitor of POL 1 transcription. In some embodiments, the method further comprises administering a second therapeutic agent to the mammal in addition to the compound described herein, or a
pharmaceutically acceptable salt, or solvate thereof.
[0137] in one aspect, described herein is a method for treating or preventing a disease or disorder in a mammal comprising administering a therapeutically effective amount of a compound described herein, wherein the compound inhibits ribosome biogenesis by inhibiting POL! transcription. In some embodiments, the method further comprises administering a second therapeutic agent to the mammal in addition to the compound described herein, or a pharxoaceutically acceptable salt, or solvate thereof.
[0138] In any of the aforementioned aspects are further embodiments in which the effective amount of the compound described herein, or a pharmaceutically acceptable salt thereof, is: (a) systemieally adiiiinistered to the mammal; and/or (h) adnxinistered orally to the mammal; and/or (c) intravenously administered to the mammal; and/or (d) administered by inhalation; and/or (e) t administered by nasal administration; or and/or (f) administered by injection to the mammal; and/or (g) administered topically to the mammal; and or (h) administered by ophthalmic administration; and/or (i) admmistered reetally to the mammal; and/or (j) administered non-systemically or locally to the mammal.
|Bi 39] In any of the aforementioned aspects are further embodiments comprising single
administrations of the effective amount of the compound, including further embodiments in which the compound is administered once a day to the mammal or the compound is administered to the mammal multiple times over the span of one day. In some embodiments, the compound is administered on a continuous dosing schedule, In some embodiments, the compound is
admmistered on a continuous daily dosing schedule.
[0140] in any of the aforementioned aspects involving the treatment ofPOLl transcription related diseases or conditions are further embodiments comprising administering at least one additional agent in addition to the administration of a compound described herein, or a pharmaceutically acceptable salt thereof. In various embodiments, each agent is administered in any order, including simultaneously,
[0141] In any of the embodiments disclosed herein, the mammal is a human.
[0142] In some embodiments, compounds provided herein are admmistered to a human.
[0143] In some embodiments, compounds provided herein are orally administered,
[0144] Articles of manufacture, which include packaging material, a compound described herein, or a pharmaceutically acceptable salt thereof, within the packaging material, and a label that indicates that the compound or composition, or pharmaceuiically acceptable salt, tautomers, pharmaceutically acceptable N-oxide, pharmaceutically active metabolite, pharmaceutically acceptable prodrug, or pharmaceutically acceptable solvate thereof, is used for inhibiting ribosome biogenesis by inhibiting POL1 transcription, or for the treatment, prevention or amelioration of one or more symptoms of a disease or condition that would benefit from inhibition of POL! transcription, are provided.
[0145] In one aspect, compounds described herein are in the form of pharmaceutically acceptabl e salts. As well, active metabolites of these compounds having the same type of activity are included in the scope of the present disclosure. In addition, the compounds described herein can exist in unsolvated as well as solvated forms with, pharmaceutically acceptable solvents such as water, ethano!, and the like. The solvated forms of the compounds presented herein are also considered to be disclosed herein,
[0146] "Pharmaceutically acceptable," as used herein, refers a material, such as a carrier or diluent, whi ch does not abrogat e the biological activity or properties of the compound, and is relativel y nontoxic, i.e. , the material is administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained,
|0147] The term "pharmaceutically acceptable salt" refers to a form of a therapeutically active agent that consists of a eationie form of the therapeutically active agent in combination with a suitable anion, or in alternative embodiments, an anionic form of the therapeutically active agent in combination with a suitable cation. Handbook of Pharmaceutical Salts: Properties, Selection and Use. international Union of Pure and Applied Chemistry, Wiley-VCH 2002. S.M. Berge, L.D. Bighley, D.C. Monkhouse, J. Pharm. Sci. 1977, 66, 1-19, P. H. Stahl and C. G. Wexmuth, editors, Handbook of Pharmaceutical Salts: Properties, Selection and Use, Weinheim/ZurichrWiley- VCH VHCA, 2002. Pharmaceutical salts typically are more soluble and more rapidly soluble in stomach and intestinal juices than non-ionic species and so are useful in solid dosage forms.
Furthermore, because their solubility often is a function of H, selective dissolution in one or another pan of the digestive tract is possible and this capability can be manipulated as one aspect of delayed and sustained release behaviors. Also, because the salt-forming molecule can be in equilibrium with a neutral form, passage through biological membranes can be adjusted.
[01.48] in some embodiments, pharmaceutically acceptable salts are obtained by reacting a compound described herein with an acid. In some embodiments, the compound described herein (i.e. free base form) is basic and is reacted with an organic acid or an inorganic acid, inorganic acids include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and metaphosphoric acid. Organic acids include, but are not limited to, l-hydroxy-2- naphihoic acid; 2,2-dichloroacetic acid; 2 -hydroxy etlmnesulfonic acid; 2-oxoglutaric acid; 4- aeetamidobenzoic acid; 4-ammosaiicylic acid; acetic acid: adipic acid; ascorbic acid (I,); aspartic acid (L); benzenesulfonic acid; benzoic acid; camphoric acid (÷); camphor- 10- sulfonic acid (+); capric acid (decanoic acid); caproic acid (hexanoic acid); caprylie acid (octanoic acid); carbonic acid; cinnamic acid; citric acid; cyclamic acid; dodecylsu!furic acid; ethane- 1, 2 -disnlfonic acid; ethanesulfonic acid; formic acid; rumaric acid; galactaric acid; gentisic acid; glucoheptonic acid (D); gluconic acid (D); glucuronic acid (D); glutamic acid; glutaric acid; glycerophosphoric acid; glyeolic acid; hippuric acid; isobutyric acid; lactic acid (DL); lactobionie acid; lauric acid; maleic acid; malic acid (- L); malonic acid; mandelic acid (DL); methanesalfonic acid; naphthalene- 1 ,5-disulfonic acid; naphthalene-2 -sulfonic acid; nicotinic acid: oleic acid; oxalic acid; palmitic acid; pamoic acid;
phosphoric acid; proprionic acid; pyrogiutamic acid (- L); salicylic acid; sebacic acid; stearic acid; succinic acid; sulfuric acid; tartaric acid (+ L); thiocyanie acid; toluenesulfonic acid (p); and undecylenic acid.
[0149] In some embodiments, a compound described herein is prepared as a chloride salt, sulfate salt, bromide salt, mesylate salt, maleate salt, citrate salt or phosphate salt. In some embodiments, a compound described herein is prepared as a hydrochloride salt,
[0150] In some embodiments, pharmaceutically acceptable salts are obtained by reacting a compound described herein with a base. In some embodiments, the compound described herein is acidic and is reacted with a base, in such situations, an acidic proton of the compound described herein is replaced by a metal ion, e.g., lithium, sodium, potassium, magnesium, calcium, or an aluminum ion, h some cases, compounds deseribed herein coordinate with an organic base, such as, but not limited to, ethanolamine, diethanolamine, trieihanolamine, tromethamine, meglumine, N- methylglucamine, dicyclohexyl amine, tris(hydroxymethyl)niethylamine. In other cases, compounds deseribed herein form salts with amino acids such as, but not limited to, arginine. lysine, and the like. Acceptable inorganic bases used to form salts with compounds that include an acidic proton, include, but are not limited to, aluminum hydroxide, calcium hydroxide, potassium hydroxide, sodium carbonate, potassium carbonate, sodium hydroxide, lithium hydroxide, and the like. In some embodiments, the compounds provided herein are prepared as a sodium salt, calcium salt, potassium salt, magnesium salt, meglumine salt, N-methylglucamine salt or ammonium salt. In some embodiments, the compounds provided herein are prepared as a sodium salt. [01511 It should he understood tha a reference to a pharmaceutically acceptable salt includes the solvent addition forms. In some embodiments, solvates contain either stoichiometric or non- stoichiometric amounts of a solvent, and are formed during the process of cry stall ization with pharmaceutically acceptable solvents such as water, etbanol, and the like. Hydrates are formed when the solvent is water, or alcoholates are formed when the solvent is alcohol. Solvates of compounds described herein are conveniently prepared or formed during the processes described herein. In addition, the compounds provided herein optionally exist in unsolvated as well as solvated forms.
[0152] The methods and formulations described herein include the use of N-oxides (if appropriate), crystalline forms (also known as polymorphs), or pharmaceutically acceptable sal ts of compounds described herein, as well as active metabolites of these compounds having the same type of activity.
[0153] In some embodiments, sites on the organic radicals (e.g. alkyl groups, aromatic rings) of compounds described herein are susceptible to various metabolic reactions. Incorporation of appropriate substituents on the organic radicals will reduce, minimize or eliminate this metabolic pathway. In specific embodiments, the appropriate substituent to decrease or eliminate the susceptibility of the aromatic ring to metabolic reactions is, by way of example only, a halogen, deuterium, an alkyl group, a haloalkyl group, or a deuteroalkyl group.
[0154] In another embodiment, the compounds described herein are labeled isotopically (e.g. with a radioisotope) or by another other means, including, but not limited to, the use of chromophores or fluorescent moieties, biolumineseent labels, or chemiluminescent labels.
[0155] Compounds described herein include isotopically-labeled compounds, wliich are identical to those recited in the various formulae and structures presented herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually fo und in nature. Examples of isotopes that ca be incorporated into the present compounds include isotopes of hydrogen, carbon, nitrogen, oxygen, fluorine and chlorine, such as, for example, ¾ <sup>3</sup>H, <sup>I3</sup>C, <sup>14</sup>C, <sup>15</sup>N, <sup>i 7</sup>0, <sup>35</sup>S, <sup>18</sup>F, <sup>36</sup>C1. In one aspect, isotopically-labeled compounds described herein, for example those into wliich radioactive isotopes such as <sup>3</sup>H and <sup>14</sup>C are incorporated, are useful in drug and or substrate tissue distribution assays. In one aspect, substitution with isotopes such as deuterium affords certain therapeutic advantages resulting from greater metabolic stability, such as, for example, increased in vivo half-life or reduced dosage requirements,
[0156] in some embodiments, the compounds described herein possess one or more stereocenters and each stereocenter exists independently in either the R or S configuration. The compounds presented herein include all diastereomeric, enantiomeric, atropisomers, and epimeric forms as well as the appropriate mixtures thereof. The compounds and methods provided herein include all eis, trans, syn, anti, entgegen (E), and zusammen (Z) isomers as well as the appropriate mixtures thereof.
[0157] individual stereoisomers are obtained, if desired, by methods such as, stereoselective synthesis and/or the separation of stereoisomers by chiral chromatographic columns. In certain embodiments, compounds described herein are prepai'ed as their individual stereoisomers by reacting a racemic mixture of the compound with an optically acti ve resolving agent to form a pair of diastereoisomerie compounds/salts, separating the diastereomers and recovering the optically pure enantiomers. In some embodiments, resolution of enantiomers is carried out using covalent diastereomeric derivatives of the compounds described herein. In another embodiment,
diastereomers are separated by separation/resolution techniques based upon differences in solubility. In other embodiments, separation of steroisomers is performed by chromatography or by the forming diastereomeric salts and separation by recrystallization, or chromatography, or any combination thereof. Jean Jacques, Andre Collet, Samuel H. Wilen, "Enantiomers, Race-mates and Resolutions", John Wiley And Sons, Inc., 198.1. In some embodiments, stereoisomers are obtained by
stereoselective synthesis.
[0158] In some embodiments, compounds described herein are prepared as prodrugs. A "prodrug" refers to an agent that is converted into the parent drug in vivo. Prodrugs are often useful because, in some situations, they are easier to administer than the parent drug. They are, for instance, bioavailable by oral administra tion whereas the parent is not Further or alternatively, the prodrug also has improved solubility in pharmaceutical compositions over the parent drug, In some embodiments, the design of a prodrug increases the effective water solubility. An example, without limitation, of a prodrug is a compound described herein, which is administered as an ester (the "prodrug") but then is metabolic-ally hydrolyzed to provide the active entity, A. further example of a prodrug is a short peptide (polyaminoacid) bonded to an acid group where the peptide is metabolized to reveal the active moiety, in certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically active form of the compound, In certain embodiments, a prodrug is enzymatically metabolized b one or more steps or processes to the biologically, pharmaceutically or therapeutical ly active form of the compound.
[0159] Prodrugs of the compounds described herein inciude, but are not l i mited to, esters, ethers, carbonates, thiocarbonates, N-acyl derivatives, N-aeyloxyalkyl derivatives, quaternary derivatives of tertiary amines, N-Mannich bases, Seniff bases, amino acid conjugates, phosphate esters, and sulfonate esters. For example, see Design of Prodrugs, Bundgaard, A. Ed., Elseview, 1 85 and Method in Enzymology, Widder, K. et ah, Ed.; Academic, 1985, vol. 42, p. 309-396; Bundgaard, H. "Design and Application of Prodrugs" in A Textbook of Drug Design and Development, rosgaard- Larsen and H. Bundgaard, Ed,, 1991, Chapter 5, p. 113-191; and Bundgaard, H., Advanced Drug Delivery Review, 1992, 8, 1-38, each of which is incorporated herein by reference.
[016 j In some embodiments, a hydroxy 1 group in the compounds disclosed herein is used to form a prodrug, wherein the hydroxy! group is incorporated into an acyloxyalkyl ester,
alkoxyearbonyloxyalkyl ester, alkyl ester, aryl ester, phosphate ester, sugar ester, ether, and the like. In some embodiments, a hydroxy! group in the compounds disclosed herein is a prodrug wherein the hydroxy! is then metabolized in vivo to provide a carboxylic acid group. In some embodiments, a carboxyl group is used to provide an ester or amide (i.e. the prodrug), which is then metabolized in vivo to provide a carboxylic acid group. In some embodiments, compounds described herein are prepared as alkyl ester prodrugs.
[0161] Prodrug forms of the herein described compounds, wherein the prodrug is metabolized in vivo to produce a compound described herein as set forth herein are included within the scope of the claims. In some cases, some of the herein-described compounds are a prodrug for another derivative or active compound.
[0162] In additional or further embodiments, the compounds described herein are metabolized upon administration to an organism in need to produce a metabolite that is then used to produce a desired effect, including a desired therapeutic effect.
[0163] A "metabolite" of a compound disclosed herein is a derivative of that compound that is formed when the compound is metabolized. The term "active metabolite" refers to a biologically active derivative of a compound that is formed whe the compound is metabolized. The term "metabolized," as used herein, refers to the sum of the processes (Including, but not limited to, hydrolysis reactions and reactions catalyzed by enzymes) by which a particular substance is changed by an organism. Thus, enzymes may produce specific structural alterations to a compound. For example, cytochrome P450 catalyzes a variety of oxidative and reductive reactions while uridine diphosphate giucuronyltransferases catalyze the transfer of an activated glucuronic-aeid molecule to aromatic alcohols, aliphatic alcohols, carboxylic acids, amines and free sulphydryl groups.
Metabolites of the compounds disclosed herein are optionall identified either by administration of compounds to a host and analysis of tissue samples from the host, or by incubation of compounds with hepatic cells in vitro and analysis of the resulting compounds.
Synthesis of Compounds
£0164] Compounds described herein are synthesized using standard synthetic techniques or using methods know in the art in combination with method described herein.
[0165] General synthetic method for preparing intermediates and compounds described herein is shown in Exemplary Scheme 1.
Exemplary Scheme 1
<img file="EP3300501A2_D0013.tif" />
(0166] Compounds of formula C are formed by reacting compounds of formula A with compound of formula B under known condensation conditions (See, e.g., Eur. J Org. Chem,, 2004, 546-551,, J Org. Chem,, 2006, 77, 5440-5447, Synthesis, 2003, 555-559, Eur. J. Org. Chem. , 2006, 3767-3770, Org. Lett, 2013, 15, 1854-1857, J Org. Chem.<sub>1</sub> 2007<sub>1</sub> 72, 9854-9856, Synleit, 2011, 1723-1726, Org. Lett, MIX 15, 4564-4567, Eur. J. Org, Chem., 2006, 3767-3770).
{0167] In certain instances the reaction of compounds A and compounds B lead in one step to compounds. C. in other instances two steps are needed to fonn compounds C from compounds A and B. First step is the formation of the condensation products followed by nucleophilic reaction under appropriate conditions.
[0168] Another general synthetic method for preparing starting materials described herein is shown in Exemplary Scheme 2.
Exemplary Scheme 2
<img file="EP3300501A2_D0014.tif" />
ZB(OH)<sub>2</sub>
<img file="EP3300501A2_D0015.tif" />
[0169] Reducti ve amination reaction between Compounds of Formula D and Compounds of Formula E followed by nucleophilic substitution of the chloro group leads to Compounds of Formula F, On the other hand, formation of amide from Compounds of Formula D and Compouns of Formula E, followed by nucleophilic substitution of the chloro group leads to compounds of Formula. G, The reaction of Compounds of Formula G using chlorinating reagents such as POC under appropriate conditions give Compounds of Formula H, Compounds of Formula H form via nucleophilic substitutions Compounds of Formula Ϊ or via carbon-carbon bond formation using known methods such as Suzuki coupling reaction Compounds of Formula J. [0170] General synthetic method for preparing starting materials described herein is shown in Exemplary Scheme 3.
Exemplary Scheme 3 <img file="EP3300501A2_D0016.tif" />
0171] Exemplary stallin materials useful in Exemplary Scheme 3 include:
<img file="EP3300501A2_D0017.tif" />
[0172] As used herein, "EWG" refers to an electron withdrawing group. As understood in the art, an electron withdrawing group is an atom or group thai draws electron density from neighboring atoms towards itself, usually by resonance or inductive effects.
[0173] in some embodiments, the preparation of the compounds described herein is made with the sequence of steps shown in Exemplary Scheme 4.
Exemplary Schem 4
<img file="EP3300501A2_D0018.tif" />
[0174] Compound 3 is prepared from the reaction of Reagents 1 and Reagent 2 using knoevenagel condensation. Compound 4 is prepared by reacting Compound 3 with reagent A-L-XH. The formation Compounds of Formula 5 from Compounds of Formula 4 is known in the art.
Compounds of Formula 6 are prepared by the coupling reaction of acid 5 and amines.
[0175] in some embodiments, the preparation of the compounds is made with the sequence of steps shown in Exemplary Scheme 5.
Exemplary Scheme 5
<img file="EP3300501A2_D0019.tif" />
[0176] In some embodiments, the preparation of the compounds is made with the sequence of steps shown in Exemplary Scheme 6. Exemplary Schem
<img file="EP3300501A2_D0020.tif" />
H.,NM¾ <img file="EP3300501A2_D0021.tif" />
[0177] In some embodiments, the preparation of the compounds is made with the sequence of steps shown in Exemplary Scheme 7,
!ary Scheme 7
<img file="EP3300501A2_D0022.tif" />
[0178] In some embodiments, the preparation of the compounds is made with the sequence of steps shown in Exemplary Scheme 8. Exemplary Scheme 8
<img file="EP3300501A2_D0023.tif" />
[0179] Non-limiting specific examples of A-L-XH in the compounds described herein are illustrated in Figure L
Fi ure 1
<img file="EP3300501A2_D0024.tif" /><img file="EP3300501A2_D0025.tif" />
[0186] Non-limiting specific examples of R3R2MH in the compounds described herein are illustrated in Figure 2.
Figure 2
<img file="EP3300501A2_D0026.tif" />
[0181} Figure 3 provides non-limiting representative examples of substi tuted
chloropyridmeearboxaldehyde.
Psgmre S
<img file="EP3300501A2_D0027.tif" /> [0182] Compounds described herein are also prepared according to Exemplary Scheme 9.
Exemplary Scheme 9
<img file="EP3300501A2_D0028.tif" />
1.831 Compounds of Formula 47 ¾» be prepared as follows:
<img file="EP3300501A2_D0029.tif" />
[0184] Compound 44 is prepared according to U.S. Patent No, 7,816,524, which is hereby incorporated by reference. The cMorination of Compounds of Formula 44 using chlorinating agent such as POCb leads to Compounds of Formula 45. Compounds of Formula 45 undergo nucleophilc siibstitoiion with Π.Χ .-Λ (as defined above) to yield Compounds of Formula 46, Compounds of Formula 47 reacts with jV^N-Dimethyfomiamide dimethy acetal to give Compounds of Formula 48. Compounds of Formula 48 react with substituted hydrazine or substituted amidine to yield
Compounds of Formula 49 and Compounds of Formula 50. respectively, [0185 j Figure 4 provides non-limiting representative examples of R2 1NH.
Figure 4
<img file="EP3300501A2_D0030.tif" />
<img file="EP3300501A2_D0031.tif" />
[0186J Compounds described herein are also prepared according to Exemplary Scheme 10.
<img file="EP3300501A2_D0032.tif" />
X - COOEt
<img file="EP3300501A2_D0033.tif" />
[0187] Compounds of Formula 3 are prepared from the reaction of Reagents 1 and Reagent 2 in appropriate sol vent and appropriate temperature in the presence of an amine. The acid of Formula 4 can be prepared from hydrolysis of Compounds of Formula 3 (X <sup>;;;</sup> COOEt) and subsequent amide
4 coupling leads to Compounds of Fomula 5,
[0188] Non-limiting specific examples that can be prepared by the method set forth in Exemplary Scheme 10 include:
<img file="EP3300501A2_D0034.tif" /> 18
<img file="EP3300501A2_D0035.tif" />
[01 W] Compounds described herein are also prepared according to Exemplary Scheme 11 ,
Exemplary Seherae 11
<img file="EP3300501A2_D0036.tif" />
[0190] The reductive amination of aldehyde or ketone reagents by 3-aniino-2,6-dieMoropyridine<sub>5</sub> followed by formation of a 6-membred ring by nucleophilie attack on 2-chloro give Compounds of Formula 51. Nucleophilie attack by A-L-XH (as defined above) Leads to Compounds of Formula 52. The amide formation from the reaction of 3-amino-2,6-dichloropyridine with acid or acid chloride derivative, and subsequent cvclization as described for Compounds of Formula 51 give Compounds of Formula 53,
[0191] Nucleophilie attack by A-L-XH (as defined above) leads to Compounds of Formula 54. The chlormation of Compounds of Fonnula 54 using chlorinating agent such as POC leads to
Compounds of Fonnula 55. Compounds of Fonnula 55 undergo nucieopliilc substitution with amines (R1 2 H as defined in figure 5) to yield Compounds of Formula 56 or C-C bond formation reaction such as Suzuki coupling to yield Compounds of Formula 57,
[0192] Compounds described herein are also prepared according to Scheme 12;
Exemplary Scheme 12
<img file="EP3300501A2_D0037.tif" />
[01 3 J Compounds of Formula 59 are prepared as described above. Nudeophilic attack by A-L-XH
(as defined in above) leads to Compounds of Formula 60.
[0194] Compounds described herein are also prepared according to Scheme 13.
Exemplary Scheme 13 <img file="EP3300501A2_D0038.tif" />
[0195] Compounds of Formula 63 are prepared as described above.
[0196] Figure 5 provides non-limiting representative examples of R2.R1NH used in the methods described herein,
Figure 5 <img file="EP3300501A2_D0039.tif" />
<img file="EP3300501A2_D0040.tif" /><img file="EP3300501A2_D0041.tif" />
Υΐ\ Compounds described herein are also prepared according to Scheme 14.
Exemplary Scheme 14
<img file="EP3300501A2_D0042.tif" />
RB(<sub>.</sub>OH)2
<img file="EP3300501A2_D0043.tif" />
[0198] Compounds of Formula C are formed by reacting Compounds of Formula A with Compound of Formula B in the presence of base such as sodium hydride.
[0199] in certain instances, the reaction of Compounds of Formula A and Compounds of Formula B lead in one step to Compounds of Formula D. In other insiances, two steps are needed to form Compounds of Formula D. First step is the formation of the amide products of Formula C followed by nucleophtlic reaction under appropriate conditions. [0200] Compounds of Formula E are formed by reacting Compounds of Formula D with known chlorinating agents. In certain instances, the treatment of Compounds of Formula E with nueleophiles formed Compounds of Formula F. in other instances, the Suzuki type reaction of Compounds of Formula E with substituted boronic acid derivatives formed Compounds of Formula G.
{0201] Another general synthetic method for preparing starting materials described herein is shown in Exemplary Scheme 15,
Exemplary Scheme 15
<img file="EP3300501A2_D0044.tif" />
[0202] Exemplary starting materials useful in Exemplary Scheme 15 include:
<img file="EP3300501A2_D0045.tif" />
10203] Another general synthetic method for preparing Com o nds of Formula ΠΙΙ (A) described herein is shown in Exemplary Scheme 16,
xemplary Scheme 16
<img file="EP3300501A2_D0046.tif" />
[0204] Compound Al reacts with compound A2 to form amide A3. Compound A3 undergoes a ring closure under basic conditions to form A4. NucieopMlic attack on A4 with A-L-XH as defined above leads to compound A5,
(02 51 Another general synthetic method for preparing Compounds of Formula 111(A)(1) described herein is shown in Exemplary Scheme 17.
Exemplary Scheme 17
<img file="EP3300501A2_D0047.tif" />
[0206] Compound A4 reacts with R-Br under basic condition to form A.6. NucieopMlic attack on A6 with A-L-XH as defined above leads to compound A7.
6207] Exemplar R-Br useful in Exemplary Scheme 17 include:
<img file="EP3300501A2_D0048.tif" /> 8] Other specific non-limiting examples prepared by the methods described herein include:
<img file="EP3300501A2_D0049.tif" /><img file="EP3300501A2_D0050.tif" /><img file="EP3300501A2_D0051.tif" /><img file="EP3300501A2_D0052.tif" />
CeriaiB Termiaol gy
[0209] Unless otherwise stated, the following ternis used in this application have the detimtions given below. The use of the term "including" as well as other forms, such as "include", "includes, and "included," is not limiting. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject, matter described.
[0210] As used herein, Ci-G<sub>x</sub> includes C1-C2, C1-C3 . . , C]-C<sub>x</sub>. By way of example only, a group designated as "C1-C4" indicates thai there are one to four carbon atoms in the moiety, i.e. groups containing 1 carbon atom, 2 carbon atoms, 3 carbon atoms or 4 carbon atoms, Thus, by way of example only, "C1-C4 alkyl" indicates that there are one to four carbon atoms in the alkyl group, ie„ the alkyl group is selected from among methyl, ethyl, propyl, fco-propyl, n-but l, isa-butyl, sec- butyl, and /-butyl,
[0211) An "alkyl" group refers to an aliphatic hydrocarbon group. The alkyl group is branched or straight chain. In some embodiments, the "alkyl" group lias 1 to 10 carbon atoms, ie. a Ci-Cioaikyl. Whenever it appears herein, a numerical range such as "1 to 10" refers to each Integer in the given range; e.g., "1 to 10 carbon atoms" means that the alkyl grou consist of 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc. , up to and including 10 carbon atoms, although the present definition also covers the occurrence of the term "alkyl" where no numerical ran ge is designated. In some embodiments, an alkyl is a Q-Coalkyl. In one aspect the alkyl is methyl, ethyl, propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, or t-butyl. Typical alk l groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, butyl, isobiityl, sec-butyl, tertiary butyl, pentyl, neopentyl, or hexyl, [0212] An "alkylene" group refers refers to a divalent alkyl radical. Any of the above mentioned monovalent alkyl groups may be an alkylene by abstraction of a second hydrogen atom from the alkyl. In some embodiments, an alkelene is a Ci-Cgalkylene, In other embodiments, an alkylene is a Ci-Ctalkylene. Typical alkylene groups include, but are not limited to, -CH2-. -CH(C¾)-, -C(CH3)2-, -CH2CH2-, -C¾CH(CH<sub>3</sub>)-, -CH<sub>2</sub>C(C¾)2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, and the like.
[0213] "Azacyelic" or "azaeyelic ring" refers to a saturated, partially unsaturated, or aromatic 3-7 membered monocyclic ring or an 8-12 membered fused bicyciic ring system containing at least one nitrogen atom. Such azaeyelic rings may optionally contain from 1-2 additional heteroatoms selected from N, O, and S as ring members, and may optionally be substituted to the extent such substitutions make chemical sense.
[0214] "Deuteroalkyl" refers to an alkyl group where 1 or more hydrogen atoms of an alkyl are- replaced with deuterium. [0215] The term "alkenyl" refers to a type of alkyl group in which at least one carbon-carbon double bond is present. In one embodiment, an alkenyl group<img file="EP3300501A2_D0053.tif" />
to the remaining portions of the alkenyl group, which may be the same or different, in some embodiments, R is H or an alkyl, Non-limiting examples of an alkenyl group include -CH-CEb, -<img file="EP3300501A2_D0054.tif" />
[0216] The term "alkynyl" refers to a type of alkyi group in which at least one carbon-carbon triple bond is present In one embodiment, an alkenyl group has the formula -C≡ -R, wherein R refers to the remaining portions of the alkynyl group. In some embodiments, R is H or an alkyl. Non- limiting examples of an alkynyl group include -C≡CH<sub>}</sub> -O CH3 -C≡CCH2CH3<sub>»</sub> ~CH2C≡CH,
[0217] An "alkoxy" group refers to a (alkyl)O- group, where alkyl is as defined herein,
[0218] The term "alkylamine" refers to the ---N(aikyl) H<sub>y</sub> group, where x is 0 and y is 2, or where x is 1 and y is 1, or where x is 2 and y is 0.
[0219] The term "aromatic" refers to a planar ring having a delocalized π-electron system containing 4n+2 % electrons, where n is an integer. The term "aromatic" includes both carbocyelic aryl ("aryl", e.g., phenyl) and heterocyclic aryl (or "heteroaryp' or "heteroaromatic") groups (e.g., pyridine). The term includes monocyclic or fused-ring polyeyelic (i.e., rings which share adjacent pairs of carbon atoms) groups.
[0220] The term "carbocyelic" or "carbocycle" refers to a ring or ring system where the atoms forming the backbone of the ring are all carbon atoms, The term thus distinguishes carbocyelic from "heterocyclic" rings or "heterocyeles" in which the ring backbone contains at least one atom which is different from carbon. In some embodiments, at least one of the two rings of a bicyclic carbocycle is aromatic. In some embodiments, both rings of a bicyclic carbocycle are aromatic.
[0221] As used herein, the term "aryl" refers to an aromatic ring wherein each of the atoms forming the ring is a carbon atom. In one aspect, aryl is phenyl or a naphthyl. In some embodiments, an aryl is a phenyl. In some embodiments, an aryl is a Ce-Cioaryl, Depending on the structure, an aryl group is a monoradical or a diradical (i.e., an a ylene group).
[0222] The term "cycloalkyl" refers to a monocyclic or polyeyelic aliphatic, non-aromatic radical, wherein each of the atoms forming the ring (/. e. skeletal atoms) is a carbon atom. In some embodiments, cycloalkyls are spirocyclie or bridged compounds. In some embodiments, cycioalkyls are optionally fused with an aromatic ring, and the point of attachment is at a carbon that is not an aromatic ring carbon atom. Cycloalkyl groups include groups having froni 3 to 10 ring atoms. In some embodiments, cycloalkyl groups are selected from among cyclopropyl, cyclohutyl,
cyciopentyl. cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cyclooctyl, spiro[2.2]pentyl, norbornyl and bicyeie[l.l.l]pentyl. In some embodiments, a cycloalkyl is a Cs-Cecycloalkyl, f0223] The term "halo" or, alternatively, "halogen" or "iiaiide" means fluoro, chloro, bromo or iodo. In some embodiments, halo is fluoro, chloro, or bromo,
[0224] The term "fluoroalkyl" refers to an alkyl in which one or more hydrogen atoms are replaced by a fluorine atom. In one aspect, a fiuoraikyl is a Cj-Csfluoroalkyl.
[0225] The term "heteroalkyl" refers to an alkyl group in which one or more skeletal atoms of the alkyl are selected from an atom other than carbon, e.g., oxygen, nitrogen (e.g. -Nil-, - (alkyl)-, sulfur, or combinations thereof. A heteroalkyl s attached to the rest of the molecule at a carbon atom of the heteroalkyl. In one aspect, a heteroalkyl is a Ci-Ce&eteroalk !.
[0226] The term "heterocycle" or "heterocyclic" refers to heteroaromatic rings (also known as heteroaryls) and heterocycloalkyl rings (also known as heteroalicyclic groups) containing one to four heteroatoms in the ring(s), where each heteroatom in the ring(s) is selected from Q, S and N, wherein each heterocyclic group has from 3 to 10 atoms in its ring system, and with the proviso that any ring does not contain two adjacent O or S atoms. Non-aromatic heterocyclic groups (also known as heterocycloalkyls) include rings ha ving 3 to 10 atoms in its ring system and aromatic heterocyclic, groups include rings having 5 to 10 atoms in its ring system. The heterocyclic groups include benzo- fused ring systems. Examples of non-aromatic heterocyclic groups are pyrrolidmyl,
teirahydrofiiranyi, dihydroiuranyl, tetrahydrothienyL oxazolidmonyl, tetrahydropyranyl,
dihydropyranyl, tetraliydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thioxanyl, piperazinyl, aziridinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxepanyl, thiepanyl, oxazepinyl, diazepinyl, thiazepinyl, 1,2,3,6-tetrahydropyridmyl, pyrralin~2-yl, pyrrolin-3-yl, IndoimyL 2H~pyranyl, 4H-pyranyl, dioxanyl, 1,3-dioxolanyl, pyrazolinyl, dithianyl, dithiolanyl, dihydropyranyl, dihydrothienyl, dihydrofuranyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 3- azabicyclo[3.1 ,0]hexanyl, 3-azabicyclo[4,1.0]heptanyl, 3H-indolyl, indolin-2-onyl, isoindolin-1- onyl, isomdoline-l,3-dionyl, 3,4-dihydfoisoquinolin-l(2H)-onyi, 3,4-dihydroqumolm-2(]H)-onyl, isomdoline-l,3-dithionyl, benzo[d]oxazol~2(3 I)-onyl, lH-benzo[d]imidazol-2(3H)-onyl, bei 2o d] tl iazol-2(3]:I)-onyi, and quinoliziiiyl. Examples of aromatic heterocyclic groups are pyridmyl, imidazolyl, pyriniidinyl, pyrazolyl, triazolyi, pyrazmyl, tetrazolyl, fui l, thienyl, isoxazolyl, ihiazoiyl, oxazoiyl, Lsotbiazolyi, pyrrolyl, quinolinyl, isoquino!inyl, indolyl,
benzimidazol i, benzofuranyl, eirmolinyl, indazolyL indoilzinyl, phthalazinyl, pyridazmyl, triazmy!, isoindolyl, pteridinyl, purinyl, oxadiazolyl, thiadiazolyl, furazanyi, benzofurazanyl,
benzothiophenyl, benzothiazolyl, benzoxazolyl, quinazolinyl, qumoxalinyl, naphthyridinyi, and iuropyridinyl. The foregoing groups are either C-attached (or C-linked) or A<sup>r»</sup>aitaehed where such is possible, For instance, a group derived from pyrrole includes both pyrrol-l-yi (yV-attached) or pyrral-3-yl (C-attached), Further, a group derived from imidazole includes imidazol-l-yl or imidazol-3-yl (both N-attached) or imidazol-2-yl, imidazol-4-yl or imidazol-5-yi (all C-attached), The heterocyclic groups include benzo-fused ring systems. Non-aromatic beierocycles are optionally substituted with one or two oxo (=0) moieties, such as pyrrolidin-2-one. In some embodiments, at least one of the two rings of a bicyeiic lieterocycle is aromatic. In some
embodiments, both rings of a bicyclic heterocycle are aromatic,
[0227] The terms "heteroaryl" or, alternatively, "heteroaromatic" refers to an aryl group that includes one or more ring heteroatoms selected from nitrogen, oxygen and sulfur. Illustrative examples of heteroaryl groups include monocyclic heteroaryls and bicyclic heteroaryls. Monocyclic heteroaryls include pyridinyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, fury!, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, pyridazmyl, triazinyl, oxadiazolyl, thiadiazolyl, and furazanyi, Bicyclic heteroaryls include indollzine, indole, benzofuran, benzothiophene, indazole, benzimidazole, purine, quinolizine, quinoline, isoquinoline, cinnoline, phthaiazine, quinazoline, quinoxaline, 1,8-naphthyridine, and pteridine. la some embodiments, a heteroaryl contains 0-4 N atoms in the ring. In some embodiments, a heteroaryl contains 1-4 N atoms in the ring. In some embodiments, a heteroaryl contains 0-4 N atoms, 0-1 O atoms, and 0-1 S atoms in the ring, In some embodiments, a heteroaryl contains 1-4 N atoms, 0-1 O atoms, and 0-1 S atoms in the ring, In some embodiments, heteroaiyl is a d-C^heteroaryi. In some embodiments, monocyclic heteroaryl is a Ci-Csheteroaryl. In some embodiments, monocyclic heteroaryl is a 5- membered or 6-m.erabered heteroaryl. In some embodiments, bicyelie heteroaryl is a Cg- C9heteroary).
[0228] A "heterocycloalkyi" or "heteroalicyclic" group refers to a cycloalkyl group that includes at least one heteroatom selected from nitrogen, oxygen and sulfur. In some embodiments, a heterocycloalkyi is fused with an aryl or heteroaryl. In some embodiments, the heterocycloalkyi is oxazolidinonyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydrotbienyl, tetrahydropyranyl,
tetrahydrotniopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, piperidm-2-onyl, pyiTolidme-2.5-ditiiionyi<sub>s</sub> pyrrolidme-2<sub>5</sub>5-dionyi pyrrolidinonyl, imidaxolidinyl, imidazoHdin-2- onyl, or thiazolidin-2-onyl. The term heteroalicyclic also includes all ring forms of the
carbohydrates, including but not limited to the monosaccharides, the disaccharides and the oligosaccharides. In one aspect, a heterocycloalkyi is a Ca-Cioheterocycloalkyl. In another aspect, a heterocycloalkyi is a<img file="EP3300501A2_D0055.tif" /> In some embodiments, a heterocycloalkyi contains 0-2 N atoms in the ring. In some embodiments, a heterocycloalkyi contains 0-2 N atoms, 0-2 O atoms and 0-1 S atoms In the ring.
[0229] The term "bond" or "single bond" refers to a chemical bond between two atoms, or two moieties when the atoms joined by the bond are considered to be part of larger substructure. In one aspect, when a group described herein is a bond, the referenced group is absent thereby allowing a bond to be formed between the remaining identified groups.
[0230] The term "moiety" refers to a specific segment or functional group of a molecule, Chemical moieties are often recognized chemical entities embedded in or appended to a molecule.
[0231] The term "optionally substituted" or "substituted" means that the referenced group is optionally substituted with one or more additional group(s) individually and independently selected from halogen, -CR -NH¾ -NH(alkyl), ~N(alky3)<sub>2</sub>, -OH, -CO2H, -CQ<sub>2</sub>a!kyl, -C(-G)NH<sub>¾</sub> - C(=0)NH(alkyl), -C(==0)N(alky!.)<sub>2</sub>, -S(=0)<sub>2</sub>N¾<sub>></sub> -S(-0)<sub>2</sub>NH(a!ky!), -S(-0)<sub>2</sub>N(alkyl)<sub>2</sub>, alkyl, cycloalkyl, fluoroa!ky!, heteroalkyl, alkoxy, fluoroalkoxy, heterocycloalkyi, aryl, heteroaryl, aryloxy, alkylthio, arylthio, alkyl sulfoxide, arylsulfoxide, alkylsulfone, and arylsulfbne. In some other embodiments, optional substituents are independently selected from halogen, -CN, -N¾, - lkyI), -<img file="EP3300501A2_D0056.tif" /> Chalk ! Cs-Cecycloalkyl, Ct-CUfluoroalkyl, Ci ¼fleteroalkyl, Ci-Gsalkoxy, C4-C luoroalkoxy, -SCi- CUalkyl, -S(<sup>:::</sup>Q)Ci~Ci.alkyl, and -S(-0)2Ci-C4alkyi. In some embodiments, optional substituents are independently selected from halogen, -CN, ~N%, -OH, -NH(C¾), -N(CH<sub>3</sub>)<sub>2</sub>, -C¾, -CH2CH3, -CF<sub>3</sub>, -QCH<sub>3</sub>, and -OCF3, in some embodiments, substituted groups are substituted with one or two of the preceding groups. In some embodiments, an optional substituent on an aliphatic carbon atom
(acyclic or cyclic) includes oxo (=0).
[0232] "Carboxylate bioisostere" or "carboxy bioisostere" as used herein refers to a moiety that is expected to be negatively charged to a substantial degree at physiological pH. In certain
embodiments, the carboxylate bioisostere is a moiety selected from the group consisting of:
<img file="EP3300501A2_D0057.tif" />
.0 , ,o . ,0 9 Q
7 1 - I—/<sup>'</sup> — i!-OH s » JLvLii<sub>"</sub>
HN-CN HN -Oi ! HN-OR" Q ' I 1! <img file="EP3300501A2_D0058.tif" /> and salts of the forgoing, wherein each R" is independently H or an optionally substituted member selected from the group consisting of CI-IO alkyl, C2-10 alkenyl, Ci-ia heteroalkyl, Cs-g carbocyclic ring; or R" is a CHO alkyl, C2-18 alkenyl, or C-MO heteroalkyl substituted with, an optionally substituted C -8 carbocyclic ring or C3-8 heterocyclic ring. [0233] Amide bioisostere and ester bioisostere as used herein refer to a moieties represented by the following examples:
<img file="EP3300501A2_D0059.tif" /> wherein each R" is independently H or an optionally substituted member selected from the group consisting of Ct-io alkyl, C2-10 alkenyl, C2-10 heteroalkyl, Cs-g carbocyclic ring; or R<sup>"</sup> is a CMO alkyl, C-x-w alkenyl, or C2- so heteroalkyl substituted with an optionally substituted C3.8 carbocyclic ring or C3-S heterocyclic ring.
[0234j The compounds presented herein may possess one or more stereocenters and each center may exist in the R or S configuration. The compounds presented herein include all diastereorneric, enantiomeric, and epimeric forms as well as the appropriate mixtures thereof Stereoisomers may be obtained, if desired, by methods known in the art. such as, for example, the separation of individual stereoisomers by cbira) chromatographic columns or by stereoselective synthesis.
[0235] A "quaternary amine" is a positively charged polyatomic ion of the structure NR <sup>+</sup>, where R is an alkyl or aryl group. The four (4) R groups that make up the quaternary amine may be the same or different and may be connected to one another. Quaternary amines can be prepared by the alkylation of tertiary amines, in a process called quatemization, as well as by other methods known in the ait.
[0236] The term "acceptable" with respect to a formulation, composition or ingredient, as used herein, means having no persistent detrimental effect on the general health of the subject being treated.
[0237] The term "modulate" as used herein, means to interact with a target either directly or indirectly so as to alter the activity of the target, including, by way of example only, to enhance the activity of the target, to inhibit the activity of the target, to limit the activity of the target, or to extend the activity of the target.
[0238] The term "modulator" as used herein, refers to a molecule that interacts with a target either directly or indirectly. The interactions include, but are not limited to, the interactions of an agonist, partial agonist, an inverse agonist, antagonist, degrader, or combinations thereof, in some embodiments, a modulator is an antagonist. In some embodiments, a modulator is a degrader,
[0239] The terms "administer," "administering", "administration," and the like, as used herein, refer to the methods that may be used to enable delivery of compounds or compositions to the desired site of biological action. These methods include, but are not limited to oral rou tes, intraduodenal routes, parenteral injection (including intravenous, subcutaneous, intraperitoneal, intramuscular, intravascular or infusion), topical and rectal administration. <sup>'</sup>Those of skill in the art are familiar with administration techniques that can be employed with the compounds and methods described herein. In some embodiments, the compounds and compositions described herein are administered orally.
[0240] The terms "co-administration" or the like, as used herein, are meant to encompass administration of the selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are admini tered by the same or different route of administration or at the same or different time.
[0241] The terms "effective amount" or "therapeutically effective amount," as used herein, refer to a sufficient amount of an agent or a compound being administered, which will relieve to some extent one or more of the symptoms of the disease or condition being treated. The result includes reduction and/or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. For example, an "effective amount" for therapeutic uses is the amount of the composition comprising a compound as disclosed herein required to provide a clinically significant decrease in disease symptoms. An appropriate "effective" amount in any individual case is optionally determined using techniques, such as a dose escalation study.
[0242] The terms "enhance" or "enhancing," as used herein, means to increase or prolong either in potency or duration a desired effect. Thus, in regard to enhancing the effect of therapeutic agents, the term "enhancing" refers to the ability to increase or prolong, either in potency or duration, the effect of other therapeutic agents on a system. An "enhanc g-effective amount," as used herein, refers to an amount adequate to enhance the effect of another therapeutic agent in a desired system.
[02431 The term "pharmaceutical combination" as used herein, means a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. The term "fixed combination" means that the active ingredients, e.g. compound described herein, or a pharmaceutically acceptable salt thereof, and a co-agent, are both administered to a patient simul aneously in the form of a single entity or dosage. The term "non-fixed combination" means that the active ingredients, e.g. a compound described herein, or a pharmaceutically acceptable salt thereof, and a co-agent, are administered io a patient as separate entities either simultaneously, concurrently or sequentially with no specific intervening time limits, wherein such administration provides effective levels of the two compounds in the body of the patient. The latter also applies to cock tail therapy, e.g. the administration of three or more active ingredients.
[0244] The terms "kit" and "article of manufacture" are used as synonyms.
[0245] The term "subject" or "patient'" encompasses mammals, Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and eats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. In one aspect, the mammal is a human.
[0246] The terms "treat," "treating<sup>'5</sup> or "treatment," as used herein, include alleviating, abating or ameliorating at least one symptom of a disease or condition, preventing additional symptoms, inhibiting the disease or condition, e.g., arresting the development of the disease or condition, relieving the disease or condition, causing regression of the disease or condition, relieving a condition caused by the disease or condition, or stopping the symptoms of the disease or condition either prophylaciically and/or therapeutically.
Pharroaceaticat Cogipo¾t tefis
[0247] In some embodiments, the compounds described herein are formulated into pharmaceutical compositions. Pharmaceutical compositions are formulated in a conventional manner using one or more pharmaceu tically acceptabl e inactive ingredients that facilitate processing of the active compounds into preparations that are used pharmaceutically. It is understood in the art that proper formulation is dependent upon the route of administration chosen, A summary of pharmaceutical compositions described herein s found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Eastern Pa.: Mack Publishing Company, 1995); Hoover, John E,<sub>5</sub> Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liherman, H.A, and Laehman, L, Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippineott Williams & Wilkins.1999), herein incorporated by reference for such disclosure.
[0248] In some embodiments, the compounds described herein are administered either alone or in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition. Administration of the compounds and compositions described herein can be effected by any method that enables delivery of the compounds to the site of action. These methods include, though are not limited to delivery via enteral routes (including oral, gastric or duodenal feeding tube, rectal suppository and recta! enema), parenteral routes (injection or infusion, including intraarterial, intracardiac, intradermal, intraduodenai, intramedullary, intramuscular, intraosseous, intraperitoneal, intrathecal, intravascular, intravenous, intravitreal, epidural and subcutaneous), inhalational, transdermal, traasmucosai, sublinguai, buccal and topical (including epicutaneous, dermal, enema, eye drops, ear drops, intranasal, vaginal) administrat on, although the most suitable route may depend upon for example the condition and disorder of the recipient. By way of example only, compounds described herein can be administered locally to the area in need of treatment, by for example, local infusion during surgery, topical application such as creams or ointments, injection, catheter, or implant, I<sup>'</sup>he administration can also be by direct injeotion at the site of a diseased tissue or organ.
[0249] In some embodiments, pharmaceutical compositions suitable for oral administration are presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in- ater liquid emulsion or a water-in-oil liquid emulsion, in some embodiments, the active ingredient is presented as a bolus, electuary or paste. [0250] Pharmaceutical compositions which can be used orally include tablets, push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. Tablets may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free- flowing form such as a powder or granules, optionally mixed with binders, inert diluents, or lubricating, surface active or dispersing agents. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. In some embodiments, the tablets are coated or scored and are formulated so as to provide slow or controlled release of the active ingredient therein. All formulations for oral administration should be in dosages suitable for such adminislration, The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols, in some embodiments, stabilizers are added. Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, tale, polyvinyl pyrrolidine, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or sol vent .mixtures. Dyestuffs or pigments may he- added to the tablets or Dragee coatings for identification or to characterize different combinations of active compound doses,
[0251] In some embodiments, pharmaceutical compositions are formulated for parenteral administration by injection, e.g.., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. The compositions may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in powder form or in a freeze- dried (lyopliiHzed) condition requiring only the addition of the sterile liquid carrier, for example, saline or sterile pyrogen-free water, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
[0252] Phamiaceiitical compositions for parenteral administi'ation include aqueous and non-aqueous (oily) sterile injection solutions of the active compounds which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions,
[0253] Pharmaceutical compositions may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds may be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
[0254] For buccal or sublingual administration, the compositions may take the form of tablets, lozenges, pastilles, or gels formulated in conventional manner. Such compositions may comprise the active ingredient in a flavored basis such as sucrose and acacia or tragacanth.
[0255] Pharmaceutical compositions may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter, polyethylene glycol, or other glycerides.
[0256] Pharmaceutical compositions may be administered topically, that is by non-systemic administration. This incl udes the application of a compound of the present invention externally to the epidermis or the buccal cavity and the instillation of such a compound into the ear, eye and nose, such that the compound does not significantly enter the blood stream, in contrast, systemic administration refers to oral, intravenous, intraperitoneal and intramuscular administration. [0257] Phamiaceuiical compositions suitable for topical administration include liquid or semi-liquid preparations suitable for penetration through the skin to the site of inflammation such as gels, liniments, lotions, creams, ointments or pastes, and drops suitable for administration to the eye, ear or nose. The active ingredient may comprise, for topical administration, from 0.001% to 10% w/w, for instance from 1% to 2% by weight of the formulation.
(0258] Pharmaceutical compositions for administration by inhalation are conveniently delivered from an insufflator, nebulizer pressurized packs or other convenient means of delivering an aerosol spray. Pressurized packs may comprise a suitable propeflant such as dichlorodifluorornethane, trichiorofiirorometliane, dichlorotetfafluofoethane, carbon dioxide or other suitable gas. in the case of a pressurized aerosol, the dosage unit may be determined by providing a val ve to deliver a metered amount. Alternati ely, for administration by inhalation or insufflation, pharmaceutical preparations may take the form of a dry powder composition, for example a powder mix of the compound and a suitable powder base such as lactose or starch. The powder composition may be presented in unit dosage form, in for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflator.
[0259] It should be understood that in addition to the ingredients particularly mentioned above, the compounds and compositions described herein may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral
administration may include flavoring agents.
Methods of Dosing and Treatment Regimens
[0260] In one embodiment, the compounds described herein, or a pharmaceutically acceptable salt thereof, are used in the preparation of medicaments for the treatment of diseases or conditions in a mammal that would benefit from inhibiting POL1 transcription. Methods for treating any of the diseases or conditions described herein in a mammal in need of such treatment, involves administration of pharmaceutical compositions that include at least one compound described herein or a pharmaceutically acceptable salt, active metabolite, prodrug, or pharmaceutically acceptable solvate thereof, in therapeutically effective amounts to said mammal.
[0261] In some embodiments, the invention provides methods of treating conditions associated with polymerase I transcript on, comprising: administering to a patient in need thereof an effective amount of a compound of the invention. In another embodiment, the invention provides a method of inhibiting polymerase I transcription: comprising, contacting the enzyme with a compound of the invention, In. a further embodiment, the invention provides a method of inhibiting polymerase I transcription: comprising, administering a first compound to a subject thai is converted in vivo to a compound of the invention.
[0262] "Conditions associated with polymerase I transcription" include disorders and diseases in which the inhibition of polymerase I transcription provides a therapeutic benefit, such as cancer, allergy/asthma, diseases and conditions of the immune system, inflammation, disease and conditions of the central nervous system (CNS), cardiovascular disease, viral infections, dermatoiogical disease, and diseases and conditions related to uncontrolled angiogenesis, and the like. Where general terms are used herein to describe conditions associated with polymerase I transcription it is understood that the more specifically described conditions mentioned in the various diagnostic manuals and other materials are included within the scope of this invention,
[0263] The term "cancer," as used herein refers to an abnormal growth of cells, which tend to proliferate in an uncontrolled way and, in some cases, to metastasize (spread). The types of cancer include, but is not limited to, solid tumors (such as those of the bladder, bowel, brain, breast, endometrium, heart, kidney, lung, lymphatic tissue (lymphoma), ovary, pancreas or other endocrine organ (thyroid), prostate, skin (melanoma) or hematological tumors (such as the leukemias), See, Ding X Z et al, Anticancer Drugs. 2005 June; 16(5):467-73. Review; Chen X et al., Clin Cancer Res, 2004 Oct., 1 ; 1Q(19):6703~9, each of which are incorporated by reference herein in their entirety.
[0264] For example, it is understood that the treatment of cancer includes trea tment of all neoplasia, regardless of their histopathological appearance. Particularly , the cancers that can be treated include, but are not limited to, cancer of blood, including myelofibrosis, leukemia (including acute
myelogenous leukemia, chronic myelogenous leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia), cancer of the skin, including melanoma, basal cell carcinoma, and squamous cell carcinoma, bone, liver, lung (including small-cell lung tumor, non small-cell lung cancer and bronchioalveolar cancer), brain, breast, prostate, larynx, gall bladder, pancreas, rectum, bile duct, parathyroid, thyroid, adrenal, neural tissue, bladder, spleen, head and neck, included the jaw, mouth, and nose, colon, stomach, testes, esophagus, uterus, cervix and vulva, colorectal, bronchi, bile duct, bladder, kidney, ovary, pancreas, multiple myeloma, lymphomas, basal cell carcinoma, squamous cell carcinoma of both ulcerating and papiliaiy type, osteo sarcoma, Ewing's sarcoma, veticulum cell sarcoma, myeloma, giant cell tumor, islet cell tumor, acute and chronic lymphocytic and
granulocytic tumors, hairy-cell tumor, adenoma, hyperplasia, medullary carcinoma,
pheochrornocytoma, mucosal neuronms, intestinal ganglioneuromas, hyperplastic corneal nerve tumor, marfanoid habitus tumor, Wilm's tumor, seminoma, ovarian tumor, leiomyomater tumor, cervical dysplasia and in situ carcinoma, neuroblastoma, retinoblastoma, myelodysplastic syndrome, mycosis .fungicide, rhabdomyosarcoma, astrocytoma, non-Hodgkin's lymphoma, Kaposi's sarcoma, osteogenic and other sarcoma, malignant hypercalcemia, polycythemia vera, adenocarcinoma, glioblastoma multiforma, glioma, lymphomas, epidermoid carcinomas, and other carcinomas and sarcomas,
[0265] Benign tumors may also be treated by the compounds of the present invention and include, but are not limited to, hemangiomas, hepatocellular adenoma, cavernous haemangioma, focal nodular hyperplasia, acoustic neuromas, neurofibroma, bile duct adenoma, bile duct cystanoma, fibroma, lipomas, leiomyomas, mesotheliomas, teratomas, myxomas, nodular regenerative hyperplasia, trachomas, pyogenic granulomas, and the like, and hamartoma conditions such as Peutz-Jeghers Syndrome (PJS), Cowden. disease, Bannayan~Riley-R.uvalcaba Syndrome (BRRS), Proteus syndrome, Lhermitte-Duclos disease and Tuberous Sclerosis (TSC).
[0266] The compounds of the present invention may also be used to treat abnormal cell proliferation due to insults to body tissue during surgery. These insults may arise as a result of a variety of surgical procedures such as joint surgery, bowel surgery, and cheloid scarring. Diseases that produce fibrotic tissue include emphysema. Repetitive motion disorders that may be treated using the present invention include carpal tunnel syndrome.
[0267] The compounds of the invention may also be useful in the prevention of restenosis thai is the control of undesired proliferation of normal cells in the vasculature in response to the introduction of stents in the treatment of vasculature disease.
[0268] Proliferative responses associated with organ transplantation that may be treated using Pol I transcription inhibitors of the invention include proliferative responses contributing to potential organ rejections or associated complications. Specifically, these proliferative responses may occur during transplantation of the heart, lung, liver, kidney, and other body organs or organ systems.
[0269] The compounds of the invention may also be useful the treatment of abnormal aagiogenesis including the abnormal angiogenesis accompanying rheumatoid arthritis, ischemic-reperfusion related brain, edema and Injury, cortical ischemia, ovarian hyperplasia and hypervascularity, (polycystic ovary syndrome), endometrios s, psoriasis, diabetic retinopaphy, and other ocular angiogenic diseases such as retinopathy of prematurity (retro lental fibroplastic), macul ar
degeneration, corneal graft rejection, neuroseular glaucoma, Oster Webber syndrome,
retinal/choroidal neuvascuiarization and corneal neovascularization, Best's disease, myopia, optic pits, Stargart's diseases, Pagets disease, vein occlusion, artery occlusion, sickle cell anemia, sarcoid, syphilis, pseudoxanthoma elastieum carotid abstractive diseases, chronic uveitis/vi iritis,
mycobacterial infections, Lyme's disease, systemic lupus erythematosus, retinopathy of prematurity, Bales disease, diabetic retinopathy, macular degeneration, Bechets diseases, infections causing a retinitis or chroiditis, presumed ocular histoplasmosis, pars planitis, chronic retinal detachment, hyperviscosity syndromes, toxoplasmosis, trauma and post-laser complications, diseases associated with rubesis (neovascularization of the angle), diseases caused by the abnormal proliferation of fibrovascular or fibrous tissue mcluding all forms of proliferative vitreoretinopathy, atopic keratitis, superior limbic keratitis, pterygium keratitis sicca, sjogrens, acne rosacea, phylectenulosis, diabetic retinopathy, retinopathy of prematurity, corneal graft rejection, Mooren's ulcer, Terrien's marginal degeneration, marginal keratolysis, polyarteritis, Wegener sarcoidosis, scleritis, pemphigoid radial keratotomy, neo vascular glaucoma and retralental fibroplasia, syphilis, Mycobacteria infections, lipid degeneration, chemical bums, bacterial ulcers, fungal ulcers, Herpes simplex infections, Herpes zoster infections, protozoan infections, and Kaposi sarcoma, Alzheimer's disease, Parkinson's disease amyotrophic lateral sclerosis (ALS), epilepsy, seizures, Huntington's disease, polyglutamine diseases, traumatic brain injury, ischemic and hemorrhaging stroke, cerebral ischemias or neurodegenerative disease, mcluding apoptosis-driven neurodegenerative disease, caused by traumatic injury, acute hypoxia, ischemia or glutamate neurotoxicity.
[0270] For example, it is understood that treatments of inflammation include, but are not limited to, acute pancreatitis, chronic pancreatitis, asthma, allergies, chronic obstructive pulmonary disease, adult respiratory distress syndrome and chronic inflammatory diseases associated with uncontrolled angiogenesis, inflammatory bowel diseases such as Crohn's disease and ulcerative colitis, psoriasis, sarcoidois, and rheumatoid arthritis, sarcoidosis, and multisystem granulomatous disorder.
[0271] For example, it is understood that, treatment of autoimmune includes, bu t is not limited to, glomerulonephritis, rheumatoid arthritis, systemic lupus erythematosus, scleroderma, chronic thyroiditis, Graves<sup>5</sup> disease, autoimmune gastritis, diabetes, autoimmune hemolytic anemia, autoimmune neutropenia, thrombocytopenia, atopic dermatitis, chronic active hepatitis, myasthenia gravis, multiple sclerosis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, psoriasis, graft vs. host disease, multiple sclerosis, or Sjoegren's syndrome.
[0272] In certain embodiments, the compositions containing the compound(s) described herein are administered for prophylactic and/or therapeutic treatments. In certain therapeutic applications, the compositions are administered to a patient already suffering from a disease or condition, in an amount sufficient to cure or at least partially arrest at least one of the symptoms of the disease or condition. Amounts effective for this use depend on the severity and course of the disease or condition, previous therapy, the patient's health status, weight, and response to the drags, and the judgment of the treating physician. Therapeutically effective amounts are optionally detennined by methods including, but. not limited to, a dose escalation and/or dose ranging clinical trial,
[0273] in prophylactic applications, compositions containing the compounds described herein are administered to a patient susceptible to or otherwise at risk of a particular disease, disorder or condition. Such an amount, is defined to be a ''prophy!actiealiy effective amount or dose." In this use, the precise amounts also depend on the patient's state of health, weight, and the like. When used in patients, effective amounts for this use will depend on the severity and course of the disease, disorder or condition, previous therapy, the patient's health status and response to the drugs, and the judgment of the treating physician. In one aspect, prophylactic treatments include administering to a mammal, who previously experienced at least, one symptom of the disease being treated and is currently in remission, a pharmaceutical composition comprising a compound described herein, or a pharmaceutically acceptable salt thereof, in order to prevent a return of the symptoms of the disease or condition. [0274] In certain embodiments wherein the patient's condition, does not improve, upon the doctor's discretion the administration of the compounds are administered chronically, that is, for an extended period of time, including throughout the duration of the patient's life in order to ameliorate or otherwise control or limit the symptoms of the patient's disease or condition.
[0275] In certain embodiments wherein a patient's status does improve, the dose of drug being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). In specific embodiments, the length of the drug holiday is between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, or more than 28 days. The dose reduction during a drug holiday is, by way of example only, by 10%- 100%, including by way of example only 10%, 15%, 20%. 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%.
[0276] Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, in specific embodiments, the dosage or the frequency of administration, or both, is reduced, as a function of the symptoms, to a level at which the improved disease, disorder or condition is retained. In certain embodiments, however, the patient requires intermittent trea tment on a long-term basis upon any recurrence of symptoms.
[0277] The amount of a given agent that corresponds to such an amount varies depending upon factors such as the particular compound, disease condition and its severity, the identity (e.g., weight, sex) of the subject or host in need of treatment, but nevertheless is determined according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, the condition being treated, and the subject or host being treated.
|0278] In general, however, doses employed for adult human treatment are typically in the range of 0.01 mg-5000 mg per day. In one aspect, doses employed for adult human treatment, are from about 1 mg to about 1000 mg per day. hi one embodiment, the desired dose is conveniently presented in a single dose or in divided doses administered simultaneously or at appropriate intervals, for example as two, three, four or more sub-doses per day.
[0279] In one embodiment, the daily dosages appropriate for the compound described herein, or a pharmaceutically acceptable salt thereof, are from about 0.01 to about 50 mg kg per body weight. In some embodiments, the daily dosage or the amount of active in the dosage form are lower or higher than the ranges indicated herein, based on a number of variables in regard to an individual treatment regime, in various embodiments, the daily and unit dosages are altered depending on a number of variables including, but not l imited to, the activity of the compound used, the disease or condition to he treated, the mode of administration, the requirements of the individ ual subject, the severity of the disease or condition being treated, and the judgment of the practitioner.
[0280] Toxicity and therapeutic efficacy of such therapeutic regimens are determined by standard phannaceuticai procedures in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 and the ED50. The dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50. In certain
embodiments, the data obtained from cell culture assays and animal studies are used in forniuiating the therapeutically effecti ve dai ly dosage range and/or the therapeutically effective unit dosage amount for use in mammals, including humans, in some embodiments, the daily dosage amount of the compounds described herein lies within a range of circulating concentrations that include the ED50 with minimal toxicity. In certain embodiments, the daily dosage range and/or the unit dosage amount varies within this range depending upon the dosage form employed and the route of administration utilized.
[0281] In any of the aforementioned aspects are further embodiments in which the effective amount of the compound described herein, or a pharmaceutically acceptable salt thereof,: is: (a) systemically administered to the mammal; and/or (b) administered orally to the mammal; and/or (c) intravenously administered to the mammal; and/or (d) administered by injection to the mammal; and/or (e) administered topically to the mammal; and/or (f) administered non-systemically or locally to the mammal.
[0282] In any of the aforementioned aspects are further embodiments comprising single
administmtiofts of the effective amount of the compound, including further embodiments in which (i) the compound is administered once a day; or (ii) the compound is administered to the mammal multiple times over the span of one day.
[0283] In any of the aforementioned aspects are further embodiments comprising multiple administrations of the effective amount of the compound, including further embodiments in which (i) the compound is administered continuously or intermittently: as in a single dose; (ii) the time between multiple administrations is every 6 hours; (iii) the compound is administered to the mammal every 8 hours; (iv) the compound is administered to the mammal every 12 hours; (v) the compound is administered to the mammal every 24 hours. In further or alternative embodiments, the method comprises a drug holiday, wherein the administration of the compound is temporarily suspended or the dose of the compound being administered is temporarily reduced; at the end of the drug holiday, dosing of the compound is resumed. In one embodiment the length of the drug holiday varies from 2 days to I year,
[0284] In certain Instances, it is appropriate to administer at least one compound described herein, of a pharmaceutically acceptable salt thereof, in combination with one or more other therapeutic agents, in certain embodiments, the pharmaceutical composition further comprises one or more anti-cancer agents.
[0285] In one embodiment, the therapeutic effectiveness of one of the compounds described herein is enhanced by administration of an adjuvant (i.e., by itself the adjuvant has minimal therapeutic- benefit but in combination with another therapeutic agent, the overall therapeutic benefit to the patient is enhanced), Or, in some embodiments, the benefit experienced by a patient is increased by administering one of the compounds described herein with another agent (which also includes a therapeutic regimen) that also has therapeutic benefit.
[0286] A wide variety of therapeutic agents may have a therapeutic additive or synergistic effect with the compounds according to the present invention. Combination therapies that comprise one or more compounds of the present invention with one or more other therapeutic agents can be used, for example, to: (1) enhance the therapeu tic effect(s) of the one or more compounds of the present invention and/or the one or more other therapeutic agents; (2) reduce the side effects exhibited by the one or more compounds of the present in vention and/or the one or more other therapeutic agents; and/or (3) reduce the effective dose of the one or more compounds of the present invention and/or the one or more other therapeutic agents. It is noted that combination therapy is intended to cover when agents are administered before or after each other (sequential therapy) as well as when the agents are administered at the same time.
[0287] Examples of such therapeutic agents that may be used in combination with the present compounds include, but are not limited to, anti-cell proliferation agents, anticancer agents, alkylating agents, antibiotic agents, antimetabofic agents, hormonal agents, plant-derived agents, and biologic agents.
[0288] Anti-cell proliferation agents useful in combination with, the compounds of the present invention include, but are not. limited to, retinoid acid and derivatives thereof, 2-methoxyestradioi, ANGIOSTATIN™ protein, ENDOSTATIN™ protein, suramin, squalamine, tissue inhibitor of metalloproteinase-L tissue inhibitor of metalloproteinase-2, plasminogen activator inhibitor- 1 , plasminogen activator inhibitor-!, card! age-derived inhibitor, paelitaxei platelet factor 4, protamine sulphate (clupeine), sulphated chitin derivatives (prepared from queen crab shells), sulphated polysaccharide peptidoglycan complex (sp-pg), staurosporine, modulators of matrix metabolism, including for example, proline analogs ((I-azetidine-2-carboxylic acid (LACA), cishydroxyproline, d,l-3,4-dehydroproline<sub>5</sub> thiaprolhie, beta-aminopropionittile fumarate, 4-propy 5-(4-pyridmyl)- 2(3H)-oxazoione, methotrexate, mitoxantrone, heparin, interferons, 2 macroglobulin-serum, chimp- 3, chymostatin, beta.~eyclodextrin tetradecasulfate, eponemycin; fumagillin, gold sodium thiomalate, d-penicillamine (CDPT), beta- 1 -anticollagenase-ser m, alpha-2-antiplasmin, bisantrene, lobenzarit disodium, «~(2-carboxyphenyl-4-cliloroantrrfonilic acid disodium. or "CCA", thalidomide, angostatic steroid, cargboxvnaminolmidazole, metalloproteinase inhibitors such as BB94. Other anti- angiogenesis agents thai may be used include antibodies, preferably monoclonal antibodies against these angiogenic growth factors: bFGF, aFGF, FGF-5, VEGF isoforrns, VEGF-C, HGF/SF and Ang- 1 /Ang~2.
[0289] Inhibitors ofmTO , PI3K, MEK, MAPK, PIM or BR . kinases are useful in combination with the compounds of the present invention. Specifically.<img file="EP3300501A2_D0060.tif" />
(2-fluoro~4-iodophenylamino)-8-methyl^^ useful in combination with the compounds of the present invention, Inhibitors of Hedgehog kinase are useful in combination with the compounds of the present invention, Proteasome inhibitors, in particular bortezomib is useful in combination with the compounds of the present invention,
[0290] NAB- inhibitors, VPS34 inhibitors, Aurora kinase, including Aurora A inhibitors, and EGFR inhibitors (both antibodies and kinase inhibitors) are useful in combination with the compounds of the present invention. [0291] Alkylating agents useful in combination with the compunds disclosed herein include, but are not limited to, biscliloroeihylainines (nitrogen mustards, e.g. chlorambucil, cyclophosphamide, ifosfarnide, mecWorethamine, rnelphalan, uracil mustard), aziridmes (e.g. thiotepa), alkyl alkone sulfonates (e.g. busulfan), nitrosoureas (e.g. eamiustine, lomustine, streptozocin), nonclassic alkylating agents (altretamine, daearbazine. and procarbazine), platinum compounds (carboplastin and cisplatin). Combination therapy including a polymerase I inliibitor and an alkylating agent is expected to have therapeutic synergistic effects in the treatment of cancer and reduce sides affects associated with these chemotherapeutic agents,
[0292] Examples of antibiotic agents use ful in combination with the compounds disclosed herein include, but are not limited to, anthracycliiies (e.g. doxorubicin, daunorubiein, epirubicin, idarubicm and anthracenedione), mitomycin C, bleomycin, dacttnomycin, plicatomycin. These antibiotic agents interfere with cell growth by targeting different cellular components.
[0293] Antimetabolic agents useful in combination with me compounds disclosed herein include, but are not limited to, fluorouracil (5-F!J), floxuridine (5-FUd ), methotrexate, leueovorm, hydroxyurea, thioguanine (6-TG), mercaptopurine (6-MP), eytarabine, pentostatin, fludarabine phosphate, cladribine (2-CDA), asparaginase, and gemcitabine. Combination therapy including a compound disclosed herein and an antimetabolic agent is expected to have therapeutic synergistic effects on cancer and reduce sides affects associated with these chemotherapeutic agents.
[0294] Hormonal agents useful in combination with the compounds disclosed herein include synthetic estrogens (e.g. diethylstibestrol), antiestrogens (e.g.<sub>,</sub> tamoxifen, toremifene, fluoxymesterol and raloxifene), antiandrogens (bieaiutamide, mlutamide, and f!utamide), aromatase inhibitors (e.g., aminoglutethimide, anastrozole and tetrazole), ketoconazole, goserelin acetate, ieuprolide, megestrol acetate and mifepristone. Combination therapy including a compound disclosed herein and a hormonal agent is expected to have therapeutic synergistic effects on cancer and reduce sides affects associated with these chemotherapeutic agents.
Plant-derived agents useful in combination with the compounds disclosed herein include, but are not limited to, vinca alkaloids (e.g., vincristine, vinblastine, vindesine, vinzolidine and vmorelbine), podophyllotoxins (e.g., etoposide (VP- 16) and tenyposide (VM-26)), taxanes (e.g.. paclitaxel and docetaxel). These plant-derived agents generally act as antimitotic agents that bind to tubulin and inhibit mitosis, Podophyllotoxins such as etoposi.de are believed to interfere with DNA synthesis by interacting with topoisomerase II, leading to DNA strand scission, Combmatioii therapy including a compound disclosed herein and a plant-derived agent is expected to have therapeutic synergistic effects on cancer and reduce sides affects associated with these chemotherapeutic agents
[0295] In any case, regardless of the disease, disorder or condition being treated, the overall benefit experienced by the patient is simply be additi ve of the two therapeutic agents or the patient experiences a synergistic benefit,
[0296] In certain embodiments, different therape tically-effective dosages of the compounds disclosed herein will be utilized in formulating pharmaceutical, composition and/or in treatment regimens when the compounds disclosed herein are administered in combination with one or more additional agent, such as an additional therapeutically effective drug, an adjuvant or the like.
Therapeutically-effective dosages of drags and other agents for use in combination treatment regimens is optionally determined by means similar to those set forth hereinabove for the actives themselves. Furthermore, the methods of prevention/treatmeni described herein encompasses the use of metronomic dosing, i.e., providing more frequent, lower doses in order to minimize toxic side effects. In some embodiments, a combination treatment regimen encompasses treatment regimens in which administration of a compound described herein, or a pharmaceutically acceptable salt thereof, is initiated prior to, during, or after treatment with a second agent described herein, and continues until any time during treatment with the second agent or after termination of treatment with the second agent. It also includes treatments in which a compound described herein, or a
pharmaceutically acceptable salt thereof, and the second agent being used in combination are administered simultaneously or at different times and/or at decreasing or increasing intervals during the treatment period. Combination treatment further includes periodic treatments that start and stop at various times to assist with the clinical management of the patient.
[0297] It is understood that the dosage regimen to treat, prevent, or ameliorate the condition(s) for which relief is sought, is modified in accordance with a variety of factors (e.g. the disease, disorder or condition from which the subject suffers; the age, weight, sex, diet, and medical condition of the subject). Thus, in some instances, the dosage regimen actually employed varies and, in some embodiments, deviates from the dosage regimens set forth herein. [0298] For combination therapies described herein, dosages of the coadministered compounds vary depending on the type of co-drug employed, on the specific drug employed, on the disease or condition being treated and so forth. In additional embodiments, when co-administered with one or more other therapeutic agents, the compound provided herein is administered either simultaneously with the one or more other therapeutic agents, or sequentially.
[0299] In combination therapies, the multiple therapeutic agent s (one of which is one of the compounds described herein) are administered in any order or even simultaneously. If
administration is simultaneous, the multiple therapeutic agents are, by way of example only, provided in a single, unified form, or in multiple forms (e.g., as a single pill or as two separate pills).
[0300] The compounds described herein, or a pharmaceutically acceptable salt thereof, as well as combination therapies, are administered before, during or after the occurrence of a disease or condition, and the timing of administering the composition containing a compound varies. Thus, in one embodiment, the compounds described herein are used as a prophylactic and are administered continuously to subjects with a propensity to develop conditions or diseases in order to prevent the occurrence of the disease or condition. In another embodiment, the compounds and compositions are administered to a subject during or as soon as possible after the onset of the symptoms, in specific embodiments, a compound described herein is administered as soon as is practicable after the onset of a disease or condition is detected or suspected, and for a length of time necessary for the treatment of the disease. In some embodiments, the length required for treatment varies, and the treatment length is adjusted to suit the specific needs of each subject. For example, in specific embodiments, a compound described herein or a formulation containing the compound is administered for at least 2 weeks, about 1 month to about 5 years.
[0301] in some embodiments, a compound described herein, or a pharmaceutically acceptable salt thereof, is administered in combination with chemotherapy, hormone blocking therapy, radiation therapy, monoclonal antibodies, or combinations thereof
[0302] Chemotherapy includes the use of one or more anti-cancer agents.
EXAMPLES
[0303] The following examples are provided for illustrative: purposes only and not to limit the scope of the cl aims provided herein.
[0304] Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified.
Exam le I
<img file="EP3300501A2_D0061.tif" />
[0305] A mixture of SM3 (648 mg, 4 mmol) in SXX.<sup>'</sup>b (20 ml) was re luxed for 4h and concentrated to get the acyl chloride (Compound 1). To a solution of 2-chloropyridin~3 -amine (512 mg, 4 mmol) in dry THF (20 ml) was added 60% NaH (480 mg, 12 mmol) at ice bath and stirred at ice bath for 0.5h.
[0306] A solution of the acyl chloride in dry THF (10 niL) was added and the reaction mixture was stirred at room temperature overnight. The mixture was diluted with EtOAc and washed with water, dried over NaaSO^ concentrated and purified by silica gel column (PE/EtOAc=5: 1-2:1) to get 1H- Benzoiinidazole-2»carboxylic acid (2~chloro-pyridin-3-yl)-amide (Compound 2) (320 mg, 32%yield) as gray solid. LC-MS: 273.1 [M M ]"
Example 2
<img file="EP3300501A2_D0062.tif" />
[0307] A mixture of Compound 2 (320 mg, 1 .17 mmol), Pd2(dba)3 (1.20 mg, 0.23 mmol), Xantphos
(130 mg, 0,23 mmol) and aCO (242 mg, 1.75 mmol) in dioxane (15 ml) was heated by microwave at 150°C for lh. After cooling, the mixture was poured into water, filtered and washed with EtOAc to get Compound 3 (270 mg, 82% yield) as gray solid. LC-MS: 237.2 ! M l j . xample 3
<img file="EP3300501A2_D0063.tif" />
[0308] A mixture of Compound 3 (230 mg, 0.97 mmol ) in POCh (10 ml) was stirred at. refluxing for 3h. After cooling, the mixture was concentrated washed, with EtOAc to get Compound 4 (210 mg, 85%yield) as gray solid. LC-MS: 255.2 [M-H f.
Example 4
<img file="EP3300501A2_D0064.tif" />
J 309] A mixture of Compound 4 (54 mg, 0.21 mmol), Pd2(dba)3 (22.2 mg, 0.042 mmol), Xantphos (23.6 mg, 0.042 mmol), 2CO3 (43 mg, 0.315 mmol) and l,Nl-dimethylethaiie-l,2-diamine (38 mg, 0. 42 mmol) in dioxane (2 ml) was stirred by microwave at 150 °C for lb. After cooling, the mixture was diluted with EtOAc, washed with water, concentrated and purified by pre-HPLC to get Compound 5 (16 mg, 25%yield) as pale yellow solid. LC-MS: 307,2 [M+l ,
Example 5
<img file="EP3300501A2_D0065.tif" />
[0310] Compound 6 is prepared according to the procedure described in Example 4: Yield<sup>::::</sup>32%, mg, pale yellow solid. LC-MS: 319.2 [M+l ]<sup>+</sup>. Ex mple 6
<img file="EP3300501A2_D0066.tif" />
[0311] Compound 7 is prepared according to the procedure deseribed in Example 4; Yieki<sup>:::</sup>33%, U- rag, pale yellow solid, LC-MS: 333,2 [M+ I .
Example 7
<img file="EP3300501A2_D0067.tif" />
[0312] Compound 8 is prepared according to the procedure described in Example 4: Yield=33%, 23 mg, pale yellow solid. LC-MS; 333.4 [M+l]<sup>+</sup>.
Example 8
<img file="EP3300501A2_D0068.tif" />
[0313] Compound 9 is prepared aecording to the procedure outlined in Example 4: Yield=32%, 380 mg, white solid. LC-MS: 286.9 [M+lf .
Example 9
<img file="EP3300501A2_D0069.tif" />
8Q [031 } Compound 10 is prepared according to the procedure outlined in Example 2: Yield=98%, 362 mg, off-white solid. LC-MS: 251.2 [M+l ,
Example U)
<img file="EP3300501A2_D0070.tif" />
[0315] Compound 11 is prepared according to the procedure outlined in Example 3: Yields 8%, 380 mg, brown solid. LC-MS: 269.2 [M+l]\
<img file="EP3300501A2_D0071.tif" />
[0316] Compound 12 is prepared according to the procedure outlined in Example 4; Yield=30%, 30 mg<sub>5</sub> pale yellow solid. LC-MS: 347.2 [M+lf<
Example 12
<img file="EP3300501A2_D0072.tif" />
[0317] Compound 13 is prepared according to the procedure outlined in Example 4: Yield=33%, 32 mg, pale yellow solid, LC-MS: 321.2 [M+lf. Example 12
<img file="EP3300501A2_D0073.tif" />
[0318] Compound 14 is prepared according to the procedure outlined in Example 4: Yield=28%, 28 mg<sub>9</sub> gray solid. LC-MS: 347.2 [M+lf,
Example 13
<img file="EP3300501A2_D0074.tif" />
[0319] Compound 15 is prepared according to the procedure outlined in Example 4; Yiei =18%, 18 mg, gray solid. LC-MS: 347.2 [M+lf.
Example 14
<img file="EP3300501A2_D0075.tif" />
[0320] Compound 16 is prepared according to the procedure outlined i Example 1 : Yield=79^ 900 mg, gray solid. LC-MS; 309.1 [M+l f, <img file="EP3300501A2_D0076.tif" />
[0321] Compound 17 is prepared accoixling to the procedure outlined in Example 2: Yield<sup>::::</sup>92%, 365 nig, gray solid. LC-MS: 271.1 [M+l]<sup>+</sup>.
Example 16
<img file="EP3300501A2_D0077.tif" />
[0322] Compound 18 is prepared according to the procedure outlined in Example 3: YieM~9§¾, 380 rng, brown solid. LC-MS: 289.1 [M H I .
Example 17
<img file="EP3300501A2_D0078.tif" />
[0323J Compound 19 is prepared according to the procedure outlined in Example 4: Yield=29%, 29 mg, gray solid. LC-MS: 367.2 [M+l]<sup>+</sup>.
Example 18
<img file="EP3300501A2_D0079.tif" /> [0324] Compound 20 is prepared according to the procedure outlined in Example 4: Yield-20%, 18 nig, gray solid. LC-MS: 341.1 [M-H]<sup>+</sup>.
Exam le 19
<img file="EP3300501A2_D0080.tif" />
[0325] Compound 21 is prepared according to the procedure outlined in Example 4: Yield=17%, mg, gray solid. LC-MS: 367.2 [M+l .
.Example 20
<img file="EP3300501A2_D0081.tif" />
[0326] Compound 22 is prepared according to the procedure ouiiined in Example 4: Yield-27%, 27 mg, gray solid. LC-MS: 367.2 [M+l]<sup>+</sup>.
Example 21
<img file="EP3300501A2_D0082.tif" />
[0327] Compound 23 is prepared according to the procedure outlined in Example 1 : Yield~-69%<sub>s</sub> 690 mg, gray solid. LC-MS: 274,1 [M+l]<sup>+</sup>.
§4 Example 22
<img file="EP3300501A2_D0083.tif" />
[0328] Compound 24 is prepared according to the procedure outlined in Example 2; Yieid=76%, 230 m¾ gray solid. LC-MS: 238.2 [M+l .
<img file="EP3300501A2_D0084.tif" />
[0329] Compound 25 is prepared according to the procedure outlined in Example 3 : Yield=99%, 250 mg, brown solid. LC-MS: 256.2 [M+lf.
Example 24
<img file="EP3300501A2_D0085.tif" />
[0330] Compound 26 is prepared according to the procedure outlined in Example 4: Yield<sup>1</sup> mg, gray solid. LC-MS; 334.0 Ί | \
Example 2.5
<img file="EP3300501A2_D0086.tif" /> 10331] Compound 27 is prepared according to the procedure outlined in Example 4: Yield=22¾, 16 mg, gray solid. LC-MS: 308.2 [M+l .
Example 26
<img file="EP3300501A2_D0087.tif" />
[0332} Compound 28 is prepared according to the procedure outlined in Example 4: Yield<sup>:;;</sup>23%. 18 mg, gray solid. LC-MS: 334.2 [M+l]<sup>+</sup>.
Example 27
<img file="EP3300501A2_D0088.tif" />
[0333] Compound 29 is prepared according to the procedure outlined in Example 4: Yieid<sup>:</sup> 28%. 23 mg, gray solid. LC-MS: 334,2 [M+l]<sup>1"</sup>>
Example 28
<img file="EP3300501A2_D0089.tif" />
[0334] Compound 30 is prepared according to the procedure outlined in Example I : Yield=65%, 520 mg,. gray solid. LC-MS: 274.1 [M+lf. Example 29
<img file="EP3300501A2_D0090.tif" />
[0335] Compound 3.1 is prepared according to the procedure outlined in Example 2<sup>*</sup>. Yield-97%, 270 nig, gray solid, LC-MS: 238,2 [M+lf.
a in pie 30
<img file="EP3300501A2_D0091.tif" />
[0336] Compound 32 is prepared according to the procedure outlined in Example 3: Yield-92%, 266mg, brown solid, LC-MS; 255.9 [M+lf .
Example 31
<img file="EP3300501A2_D0092.tif" />
[0337J Cornpaund 33 is prepared according to the procedure outlined in Example 4: Y d=26%, 20 mg, gray solid. LC-MS: 334.3 [M+lf,
Example 32
<img file="EP3300501A2_D0093.tif" /> [0338] Compound 34 is prepared according to the procedure outlined in Example 4: Yield 22%. 16 mg, gray solid. LC-MS: 308 [M+l]<sup>+</sup>.
Example 33
<img file="EP3300501A2_D0094.tif" />
[0339] Compound 35 is prepared according to the procedure outlined in Example 4; Yieid<sup>=;</sup>23%<sub>5</sub> 18 mg, gray solid. LC-MS: 334,2 [M+lf .
Exaftiple 34
<img file="EP3300501A2_D0095.tif" />
[0340] Compound 36 is prepared according to the procedure outlined in Example 4; Yield-28%, 23 mg, gray solid. LC-MS: 334.2 [M+1J\
Example 35
<img file="EP3300501A2_D0096.tif" />
[0341] Compound 37 is prepared according to the procedure outlined in Example 1 : Yield~76%<sub>5</sub> 740mg, brown solid. LC-MS: 307.1 [M+l . Example, 36
<img file="EP3300501A2_D0097.tif" />
[0342] Compound 38 is prepared according to the procedure outlined la Example 2; Yield<sup>;;;</sup>71 %. 220mg, brown solid. LC-MS: 271.1 [ ÷l]<sup>+</sup>.
Example 37
<img file="EP3300501A2_D0098.tif" />
[0343] Compound 39 is prepared according to the procedure outlined in Example 4: Yield=40%, 28 mg, yellow solid. LC-MS; 349.1 [M+l]<sup>+</sup>.
Example 38
<img file="EP3300501A2_D0099.tif" />
[0344} Compound 40 is prepared according to the procedure outlined in Example 4: Yield<sup>~</sup>32%, 23 mg, yellow solid. LC-MS: 323.0 [M+l]<sup>+</sup>.
Example
<img file="EP3300501A2_D0100.tif" />
[0345} A solution of compound 38 (370 mg, 1.37 mmol) and N-Methylhomopiperazine (313 mg, 2.75 mmol) in NMP (15 rnL) was stirred at 2()0°C by microwave for 71 . The mixture was concentrated and the residue was washed with MeOH to get 2-(4-Methyl-[l.,4jdfazepan-l-yi)-5H- 1,5,7,1 ib-tetraaza-ben:zxj c]fluorett-6-one (compound 41) (260 nig, Yiefd=54%) as brown solid. LC- MS: 349 Λ [M+i]<sup>+</sup>.
Example 40
<img file="EP3300501A2_D0101.tif" />
[0346] Compound 42 is prepared according to the procedure described in Example 38: Yield~28%, 16 mg, yellow solid. LC-MS: 349.3 [M+l f,
Example 41
<img file="EP3300501A2_D0102.tif" />
[0347] Compound 43 is prepared according to the procedure described in Example 3: Yield=98%, 270 mg, brown solid. LC-MS: 367.3 [M+lf . ExamnSe 42
<img file="EP3300501A2_D0103.tif" />
0348] A suspension of Compound 43 (70 rag, 0.1 1 mmol) in Cl¾N¾/EtOH (2M. 2 ml) was heated to reflux for 16h. Afte cooling, the mixture was concentrated, and the residue was added water and stirred at r.t« for lh, filtered, washed with CH3CN to get the desired product (68 mg<sub>s</sub> 98%yield) as yellow solid. LC-MS; 362.3 [M+lf .
Example 43
<img file="EP3300501A2_D0104.tif" />
[034 j Compound 45 is prepared according to the procedure described in Example 41 : LC-MS: Rt 1 .06 min, 392.4 [M+l
Example 44
<img file="EP3300501A2_D0105.tif" />
[0350] To asoiution of Compound SMS (0,96 g, 5 mmol) and Compound SM6 (1.02 g, 5 mmol) in 2- (20 fflL) in 2-Methoxyethanol (8 mL) was added EfeM (2 mL, 15 mmol) and the mixture was stirred at refluxing for 18h. After cooling, the mixture was filtered and washed with EtOH to get Compound 46 (940 mg, 55%yieid) as brown solid. LC-MS: 342.3 [M+l]<sup>+</sup>. Example 45
<img file="EP3300501A2_D0106.tif" />
[0351] To a suspension of Compound 46 (50 mg, 0.147 mmol) in EtOH (2 ml.) was added ΝΙ,ΝΙ- dimethy3etliane-l <sub>5</sub>2-dlamine (0.2 mL, 2.14 mmol) and the mixture was stirred at refluxing for 5h. After cooling, the mixture was filtered and washed with EtOH to give Compound 47 (30 rag, 53%yieid) as yellow solid. LC-MS: Ri=Ll 53min, 384.2 [M+lf.
Example 46
<img file="EP3300501A2_D0107.tif" />
03S2 J To a suspension of Compound 46 (0.6 g, 1.76 mmol) in EtOH (10 mL, 1 :1 v/v) was 4N NaOH (aq., 2.2 mL, 8.8 mmol) and the mixture was stirred at 60°C for 30 mic The mixture was acidified to pH 6 by addition of 2 N HCI and stirred at r.t, for 30min, the mixture was filtered and washed with water, dried to give Compound 48 (540 mg, 8%yield) as a yellow solid. LC-MS: Rt=1.38rnim 314.2 [M+lf.
Example 41
<img file="EP3300501A2_D0108.tif" /> [0353] To a mixture of Compound 48 (100 mg, 0.31 9 mmol), HATU (183 nig, 0.478 mraol) and (2S,6R)-2,6-dimethylpiperazme (73 mg, 0.638 mmol) in DMF (8 ml.) was added DIEA (0,2 ml,) and stirred at 50 Ό overnight. The mixture was poured into water and filtered, washed with water, purified by pre-HPLC to give Compound 49 (38 mg, 29%yield) as yellow solid. LC-MS:
Ri-1.207min, 410.0 [M+l]<sup>+</sup>
Example 48
[0354] Comp<img file="EP3300501A2_D0109.tif" />
26 mg, yellow solid. LC-MS: 410.2 [M+lf.
Example 49
<img file="EP3300501A2_D0110.tif" />
SM7 SM8
[0355] To a solution of SM7 (1 7.2 g, 100 mmol) and EtsN (27.7 ml, 200 mraol) in MeCN, ethyl carbonochioridate (14.2 ml, 150 mmol) was added drop wise at 0 °C and stirred at r.t. overnight. The reaction mixture was concentrated and dissolved in EtOAc, washed with ¾ , brine, then purified by silica gel column (Petro ether : EtOAc - 5 : 1) to give SMS as yellow oil (12.6 g, 51.6% yield). LC-MS: 245.1 [M+lf. Rxatapie 50
<img file="EP3300501A2_D0111.tif" />
[0356] To a solution of SMS (3.48 mmol) in EtOH, 10%Pd7C (70 mg) was added and stirred at r.t. for 2k The reaction mixture was filtered and the filtrate was concentrated and dried under vacuum to give Compound SM9: Yieid=89%, 480 mg, pale yellow oil LC-MS: 155.3 [M+lf .
Example 51
<img file="EP3300501A2_D0112.tif" />
357] To a solution of Compound SM5 (595 mg, 3,1 mmol) and Compound SM9 (480 mg. 3,1 mmol) in ethanol (8 mL) was added EtjN (1.2 niL, 8.6mmol) and the mixture was stirred at reflux for 18h, After cooling, the mixture was concentrated and the residue was diluted with EtOAc to get Compound 51 (430 mg, 47%yield) as brown solid. LC-MS: Rr=l . 73mm, 292,0 [M+l]<sup>+</sup>,
Example 52
<img file="EP3300501A2_D0113.tif" />
[0358] Compound 52 is prepared according to the procedure described in Example 41 : Yield=58%, 40 mg, yellow solid. LC-MS: 333.9 [M+lf. Example 53
<img file="EP3300501A2_D0114.tif" />
s<sub>1</sub> * reflux 53
[0359] Compound 53 is prepared according to the procedure described in Example 47: Yield-95%, 320 rag, yellow solid. LC-MS: 263.9 [M+1J<sup>+</sup>.
Example 54
<img file="EP3300501A2_D0115.tif" />
[0360] Compound 54 is prepared according to the procedure described in Example 47: Yield=13%, 18 tng, yellow solid. LC-MS: 360.0 [MHf.
Exam le 55
<img file="EP3300501A2_D0116.tif" />
[0361] Compound 54 is prepared according to the procedure described in Example 47: Yield=14%, 32 mg, yellow solid. LC-MS: 360.2 [M+1J<sup>+</sup>
Example 56
10362] Th following compounds are prepared according to the methods used for the preparation of compounds 52 and 53. <img file="EP3300501A2_D0117.tif" />
Example 57: Representative Cell-Based ICso Data
[0363] Inhibitory activity on cell proliferation of representative compounds of the invention was determined using an Alamar Blue cell viability assay as described hereafter,
[0364] 3000 cancer cells in 100 uL of cell cul ture media were plated in each well of a 96-weil clear bottom, black wall cell culture-pretreated plate.
[0365] The next day compounds are serially diluted (3-fold in cell culture media) across a 96-well polypropylene mother plate from row A to row F, to yield 6 concentrations (10 uM, 3.3 uM, 1.1 uM, 370 nM, 124 nM and 41 nM) for each test compound, Rows G and H contain only DMSO.
[0366] Once titrations are made, the media in plates with cells were disposed and 100 ί, of drug dilutions are transferred to plates with cells. After a ninety six-hour incubation at 37 °C, 10 uL of resazurin solution from Alamar Blue Cell Viability kit ( !nvitrogeii, Carlsbad, CA) was added to the media and cells were incubated at 37 °C for three more hours. At the end of this incubation the production of resofurin was measured using Spectrmax M2 microplate reader (Molecular Devices, Sunnyvale, CA)
Example 58; qRT-PC Assay for Selective Inhibition of UNA Polymerase I Transcription
]0367] 3000 cancer cells in 100 uL of ceil culture media were plated in each well of a 96-weil clear bottom, black wall cell culture-pretreated- plate. [0368] The next day compounds are serially diluted (3-fold in cell culture media) across a 96-weU polypropylene mother plate from row A to row F, to yield 6 concentrations ( 10 uM, 3.3 uM, 1.1 uM, 370 nM, 124 nM and 41 nM) for each test compound. Rows G and H contain only DMSO.
[0369] Once titrations are made, the media in plates with cells were disposed and 100 uL of drug dilutions are transferred to plates with cells. After a ninety six-hoar incubation at 37 °C, 10 uL of resazurin solution from Alamar Blue Cell Viability kit (mvitrogen. Carlsbad, CA) was added to the media and cells were incubated at 37 °C for three more hours.
[0370] At the end of this incubation the production of resofurin was measured using Spectrmax M2 microplate reader (Molecular Devices., Sunnyvale, CA)
[0371] The Pol I transcription assay was used to measure the compound-dependent inhibition of the synthesis of rRNA versus mRNA. Briefly, this procedare utilizes a quantitative real time polymerase chain reaction assay (qRT-PCR) to quantify the amount of newly synthesized rRNA and mRNA in cancer cells treated with the drugs. The format of this assay is the same for all cell lines tested.
Assay protocol is described hereafter.
[0372] 2* 10<sup>s</sup> cancer cells in 2 mL of cell culture media were plated in each well of a 6-well clear bottom, black wall cell culture-pretreated plate. The next day compounds are serially diluted (5-fold in cell culture media) in 15 mL conical tubes to yield 6 concentrations (25 uM, 5 uM, 1 uM, 200 nM, 40 nM and 8 nM) for each test compound.
[0373] Once titrations are made, the media in plates with cells were disposed and 2 mL of drug dilutions are transferred to plates with cells. After two-hour incubation at 37 °C, the media with dmg dilutions is disposed, the cells in the plate are washed once with 2 mL of ice-cold PBS and the total RN A from cells is isolated using R Aqueous^-Micro Total RNA Isolation Kit (Lechnoiogies, Carlsbad, CA) according to the manufacturer's protocol) and its concentration was determined using Ribogreen reagent (Life Lechnoiogies, Carlsbad, CA).
[0374J Relative levels of 45S pre-rRNA and c-myc mRNA were measured using Applied
Biosystems' (Foster City, CA) proprietary primers-probe set for c-myc mR A and custom primers probe set (forward primer: CCGCGCTCTACCTTACCTACCT (SEQ ID 1), reverse primer:
GCATGGCTTAATCT<sup>'</sup>TTGAGACAAG (SEQ ID 2), probe: <sup>'</sup>I GATCCTGCCAGTAGC (SEQ ID 3)) for pre-rRNA. Analysis was run on 7500HT Real Time PGR System (Applied Biosystems,
Foster City, CA).
E ample 59; Cell-Free Pol I Transcription Assay
[0375] To measure the direct effect of representative compounds on RNA Polymerase I
transcription, a nuclear extract-based assay was used. Assay protocol is described hereafter.
[0376] Compounds are serially diluted (5-fbld in cell culture media) across a 96- well polypropylene mother plate from row A to row E, to yield 5 concentrations (50 uM, 10 uM, 2 uM, 400 nM and 80 nM) for each test compound. Row G contained only DMSO,
[0377] Once titrations were made, the reaction mixture consisting of 30 g/uL DNA template corresponding to (-160/+379) region on rD A and 3 mg/mL nuclear extract isolated from HeLa S3 ceils in a buffer containing 10 mM Iris HC1 pH 8.0, 80 mM KC1, 0.8% polyvinyl alcohol, 10 mg/mL a-amanitin was combined with the test compounds and incubated at ambient for 20 min.
[0378] Transcription was initiated by addition of rNTP mix (New England Biolabs, Ipswich, MA) to a final concentration of 1 mM and was incubated for one hour at 30 °C. Afterwards DNase I was added and the reaction was further incubated for 2 hr at 37 °C.
DNase digestion was terminated by the addition of EDTA to final concentration of 10 mM, followed immediately by 10 min incubation at 75 °C, and then samples were transferred to 4 °C. The levels of resultant transcript were analyzed by qRT-PCR on 75001 IT Real Time PGR. System (Applied Biosystems, Foster City, GA) using the following primer-probe set: Pol I probe
ctctggcctaccggtgacccggcta, Pol I forward primer ge gacaegetgtcctctggcg and Pol I reverse primer ggctcaagcaggagcgcggc.
Example 60; Testing Inhibition of RNA Polymerase I and I! - Driven Transcriptions
[0379] MM231 cells were plated in a 6- well, format at 2*10 5 cells/well overnight. The next day the cells were treated by a dilution series (6 doses total: 25 uM, 5 uM, 1 uM, 200 nM, 40 nM, 8 nM) of test compounds. Two hours after the beginning of treatment cells were washed and lysed for RNA isolation that was performed using RNAqueous-Mini Total RNA Isolation kit (Ambion).
[0380] The resulting RNA concentrations were determined using Quant-iT RiboGreen RNA Assay Kit (Molecular Probes). Effect on RNA Polymerase I and R A Polymerase II -· driven transcription was assessed by monitoring resulting levels of 45 S pre-rRNA and cMYC mRNA respectively. For this we performed Taqmaii qRT-PCR assay using TaqMan<sup>®</sup> RNA-to-Ct™ 1-Step Kit (Life
Technologies) with custom primer-probe set for 45S pre-rRNA (Drygm et all 2009 Cancer Res 69:7653) and Hs00T534Q8 _ml primer-probe mix (Life Technologies) for cMYC mRNA. The assay was performeil on Applied Biosystems 7500 Fast Real-Time PCR System (ΑΒΪ) using Absolute Quantitation method. The data was analyzed using GraphPad Prism (GraphPad) soft are.
[0381] Representative Pol I transcription inhibition, in MM231 cell line, from quantitative PCR (QPCR) (Example 86 & Example 87) data is provided in Table 1.
Table 1
Compound ID 41 42 44 45 52 5
Pol l A B B A D D
++÷ indicates an activity of less tbaa 1 μΜ; ++ indicates an activity- of greater than i μΜ and less than 5 μΜ; + indicates an activity of greater than 5 μηι and less than 10 μΜ; and * indicates an activity of greater than 10 μΜ.
Ex mple 61 : Anti-Cancer Activity of Representative Compounds
0382] Representative cell proliferation inliibiiion from Alamar Blue assay (e.g. Example 84 herein) is provided in Table 2.
Table <sub>:</sub>2
Cell Line
Compound ID MDA-MB-231 SK-BR-3
1 B B
13 B B
15 B B
14 B B
19 B B
20 B B
22 C B
21 D D
26 B B
?7 B B
29 B B
28 B B
34 B B
36 B B Ceil Line
Compound ID MDA-MB-231 S -BR-3
35 B B
62 D D
61 D D
60 D D
63 D D
58 B B
57 B B
56 D D
A indicates an activity of less than 1 μ.Μ; and B indicates an activity of greater than 1 μΜ and less than 5 μΜ; C indicates an activity of greater than 5 μτη and less than 10 μΜ; and D indicates an activity of greater than 10 μΜ,
Example 62: Anti-Caneer Activity of Representative Compounds
[0383] Representative cell proliferation inhibition from Alamar Blue assay (e.g. Example 84 herein) is provided in Table 3.
Tabie 3
Compound ID
Cell line 5 52
SKM-1 1 B A
P12-
ICHIKAWA B B
THP-1 B B
KG-1 B B
NB-44 B B
ML-2 B B
MM231
SK-BR-3
A indicates an activity of less than 1 μΜ; aod B indicates an activity of greater than 1 μΜ and less than 5 μΜ; C indicates an activity of greater than 5 μιχι and leas than 10 μ ; and D indicates an activity of greater than 10 μΜ.
[§384] The above description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the invention. Various modi ft cations to these embodiments will be readily apparent to those skilled in the art, and the generic principles described herein can be applied to other embodiments without departing from the spirit or scope of the invention. Thus, it is to be understood that the description and drawings presented herein represent a presently preferred embodiment of the invention and are therefore representative of the subject matter which is broadly contemplated by the present invention. It is fuither understood that the scope of the present invention Mly encompasses other embodiments that may become obvious to those skilled i the art and that the scope of the present invention is accordingly not limited.
Contents38
130 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32 Sheet 33 Sheet 34 Sheet 35 Sheet 36 Sheet 37 Sheet 38 Sheet 39 Sheet 40 Sheet 41 Sheet 42 Sheet 43 Sheet 44 Sheet 45 Sheet 46 Sheet 47 Sheet 48 Sheet 49 Sheet 50 Sheet 51 Sheet 52 Sheet 53 Sheet 54 Sheet 55 Sheet 56 Sheet 57 Sheet 58 Sheet 59 Sheet 60 Sheet 61 Sheet 62 Sheet 63 Sheet 64 Sheet 65 Sheet 66 Sheet 67 Sheet 68 Sheet 69 Sheet 70 Sheet 71 Sheet 72 Sheet 73 Sheet 74 Sheet 75 Sheet 76 Sheet 77 Sheet 78 Sheet 79 Sheet 80 Sheet 81 Sheet 82 Sheet 83 Sheet 84 Sheet 85 Sheet 86 Sheet 87 Sheet 88 Sheet 89 Sheet 90 Sheet 91 Sheet 92 Sheet 93 Sheet 94 Sheet 95 Sheet 96 Sheet 97 Sheet 98 Sheet 99 Sheet 100 Sheet 101 Sheet 102 Sheet 103 Sheet 104 Sheet 105 Sheet 106 Sheet 107 Sheet 108 Sheet 109 Sheet 110 Sheet 111 Sheet 112 Sheet 113 Sheet 114 Sheet 115 Sheet 116 Sheet 117 Sheet 118 Sheet 119 Sheet 120 Sheet 121 Sheet 122 Sheet 123 Sheet 124 Sheet 125 Sheet 126 Sheet 127 Sheet 128 Sheet 129 Sheet 130
103 members in 34 offices
Priority claims9
| Document | Office | Kind | Date |
|---|---|---|---|
| 201562128208 | United States of America | P | |
| 201562128208 | United States of America | P | |
| 201562128208P | United States of America | – | |
| 2016020418 | United States of America | W | |
| 2016020418 | United States of America | W | |
| 201562128208P | – | – | – |
| US201562128208P | – | – | – |
| US2016020418 | – | – | – |
| WO2016US20418 | – | – | – |
Members103
| Document | Office | Kind | |
|---|---|---|---|
| CA2948173A1 | Canada | A1 | |
| CA2974960A1 | Canada | A1 | |
| WO2015172123A1 | World Intellectual Property Organization (WIPO) | A1 | |
| US2016077009A1 | United States of America | A1 | |
| US2016257678A1 | United States of America | A1 | |
| CA2978571A1 | Canada | A1 | |
| WO2016141042A2 | World Intellectual Property Organization (WIPO) | A2 | |
| WO2016141042A3 | World Intellectual Property Organization (WIPO) | A3 | |
| US2016326176A1 | United States of America | A1 | |
| AU2015255738A1 | Australia | A1 | |
| US9512123B2 | United States of America | B2 | |
| WO2016141042A4 | World Intellectual Property Organization (WIPO) | A4 | |
| KR20160144509A | Republic of Korea | A | |
| SG11201609171XA | Singapore | A | |
| PH12016502213A1 | Philippines | A1 | |
| PH12016502213B1 | Philippines | B1 | |
| NI201600168A | Nicaragua | A | |
| ECSP16088687A | Ecuador | A | |
| CN106459068A | China | A | |
| CL2016002798A1 | Chile | A1 | |
| EP3140305A1 | European Patent Office (EPO) | A1 | |
| EP3140305A4 | European Patent Office (EPO) | A4 | |
| PE20170131A1 | Peru | A1 | |
| KR20170042821A | Republic of Korea | A | |
| AU2017202145A1 | Australia | A1 | |
| AU2015255738B2 | Australia | B2 | |
| EA201692269A1 | Eurasian Patent Organization (EAPO) | A1 | |
| MX2016014555A | Mexico | A | |
| PE20170678A1 | Peru | A1 | |
| JP2017101038A | Japan | A | |
| JP2017514889A | Japan | A | |
| SG10201703658SA | Singapore | A | |
| ECSP17031525A | Ecuador | A | |
| AU2017203955A1 | Australia | A1 | |
| NZ725917A | New Zealand | A | |
| CN106995443A | China | A | |
| JP6188179B2 | Japan | B2 | |
| CL2017000372A1 | Chile | A1 | |
| US9758518B2 | United States of America | B2 | |
| EP3219716A1 | European Patent Office (EPO) | A1 | |
| AU2015255738C1 | Australia | C1 | |
| US2017334905A1 | United States of America | A1 | |
| CN107567448A | China | A | |
| JP2018507230A | Japan | A | |
| US2018079750A1 | United States of America | A1 | |
| EP3300501A2This record | European Patent Office (EPO) | A2 | |
| EP3140305B1 | European Patent Office (EPO) | B1 | |
| US9951066B2 | United States of America | B2 | |
| MX2017011116A | Mexico | A | |
| CA2948173C | Canada | C | |
| UA117182C2 | Ukraine | C2 | |
| PT3140305T | Portugal | T | |
| DK3140305T3 | Denmark | T3 | |
| ECSP18049420A | Ecuador | A | |
| TR2018009990T4 | Türkiye | T4 | |
| TR201809990T4 | Türkiye | T4 | |
| ES2679628T3 | Spain | T3 | |
| ZA201607573B | South Africa | B | |
| LT3140305T | Lithuania | T | |
| SMT201800418T1 | San Marino | T1 | |
| HRP20181105T1 | Croatia | T1 | |
| KR101890505B1 | Republic of Korea | B1 | |
| SI3140305T1 | Slovenia | T1 | |
| HK1247927A | Hong Kong, China | A | |
| HK1247927A1 | Hong Kong, China | A1 | |
| US2018291020A1 | United States of America | A1 | |
| KR20180118806A | Republic of Korea | A | |
| PL3140305T3 | Poland | T3 | |
| RS57493B1 | Serbia | B1 | |
| CN106459068B | China | B | |
| HUE039733T2 | Hungary | T2 | |
| AU2017202145B2 | Australia | B2 | |
| IL248638A | Israel | A | |
| IL248638B | Israel | B | |
| IL264454A | Israel | A | |
| IL264454D0 | Israel | D0 | |
| PH12017500660A1 | Philippines | A1 | |
| US10234395B2 | United States of America | B2 | |
| EP3300501A4 | European Patent Office (EPO) | A4 | |
| US2019233422A1 | United States of America | A1 | |
| BR122017003403A2 | Brazil | A2 | |
| US10442801B2 | United States of America | B2 | |
| BR112016026150B1 | Brazil | B1 | |
| KR102044648B1 | Republic of Korea | B1 | |
| CY1120935T1 | Cyprus | T1 | |
| US2019389860A1 | United States of America | A1 | |
| EA034235B1 | Eurasian Patent Organization (EAPO) | B1 | |
| US10590134B2 | United States of America | B2 | |
| US10745403B2 | United States of America | B2 | |
| US2020361937A1 | United States of America | A1 | |
| US2021094952A1 | United States of America | A1 | |
| US10975076B2 | United States of America | B2 | |
| JP2021066741A | Japan | A | |
| JP6878288B2 | Japan | B2 | |
| CN107567448B | China | B | |
| US2021317120A1 | United States of America | A1 | |
| CN106995443B | China | B | |
| US11618752B2 | United States of America | B2 | |
| US11623928B2 | United States of America | B2 | |
| CA2978571C | Canada | C |
22 legal events, as 2 offices reported them to INPADOC
Over the term
Point at a mark for the eventEvents
| Event | Code | Office | |
|---|---|---|---|
| Application deemed to be withdrawnWithdrawn18D | 18D | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWNSTAA | STAA | EP | |
| Opt-out of the competence of the unified patent court (upc) registeredP01 | P01 | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: EXAMINATION IS IN PROGRESSSTAA | STAA | EP | |
| First examination report despatched17Q | 17Q | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: EXAMINATION IS IN PROGRESSSTAA | STAA | EP | |
| Supplementary search report drawn up and despatchedA4 | A4 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Amendment of ipc main classPREVIOUS MAIN CLASS: C07D0471140000R079 | R079 | DE | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Request for validation of the european patent (deleted)DAV | DAV | EP | |
| Request for extension of the european patent (deleted)DAX | DAX | EP | |
| Request for examination filed17P | 17P | EP | |
| Designated contracting statesAK | AK | EP | |
| Request for extension of the european patentAX | AX | EP | |
| Public reference made under article 153(3) epc to a published international application that has entered the european phaseORIGINAL CODE: 0009012PUAI | PUAI | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: REQUEST FOR EXAMINATION WAS MADESTAA | STAA | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADESTAA | STAA | EP |
Numbers
- Publication
- 3300501
- Publication, DOCDB
- 3300501
- Publication, EPODOC
- EP3300501
- Application
- 167594019
- Application, DOCDB
- 16759401
- Application, EPODOC
- EP20160759401
Titles3
- German
- NEUARTIGE ZUSAMMENSETZUNGEN, VERWENDUNGEN UND VERFAHREN ZUR HERSTELLUNG DAVON
- English
- NOVEL COMPOSITIONS, USES AND METHODS FOR MAKING THEM
- French
- NOUVELLES COMPOSITIONS, LEURS UTILISATIONS ET LEURS PROCÉDÉS DE PRÉPARATION
Classification
- CPC, 6
- C07D471/14
- C07D487/14
- C07D471/04
- A61P35/00
- C07D471/22
- A61K31/4353
- IPC, 8
- C07D471 14
- C07D487 14
- C07D403 04
- C07D403 14
- A61K31 4375
- A61K31 519
- A61K31 4985
- A61K31 5025
Designated states3
- Contracting states, 1
- Türkiye
- Extension states, 1
- Montenegro
- Validation states, 1
- Republic of Moldova
