Rna interference for the treatment of gain-of-function disorders
16 claims: 7 independent, 9 dependent
- 1An effective amount of a RNAi agent selected from siRNA and shRNA agents for use in treating Huntington's disease caused by a mutation within the htt gene encoding a gain-of-function mutant huntingtin protein, by targeting a non-disease causing single nucleotide polymorphism located at a site distinct from a disease causing mutation within the htt gene encoding the mutant huntingtin protein, such that sequence-specific interference of said gene occurs, wherein the RNAi agent targets a polymorphic region within the gene which is distinct from an expanded CAG region within the mutant gene.
- 6An RNAi agent comprising a first strand comprising about 16-25 nucleotides homologous to a region of a gene encoding a gain-of-function mutant huntingtin protein, said region comprising a non-disease causing single nucleotide polymorphism located at a site distinct from a disease causing mutation, and a second strand comprising about 16-25 nucleotides complementary to the first strand, wherein the RNAi agent directs target specific cleavage of a mRNA transcribed from the gene encoding the mutant huntingtin protein.
- 7The RNAi agent of anyone of the preceding claims, wherein said polymorphism is either selected from the group comprising PI-P5, or selected from the group comprising P6-P43.
- 16An RNAi agent selected from siRNA and shRNA for use in treating Huntington's disease by identifying a single nucleotide polymorphism within the htt gene encoding a gain-of-function mutant huntingtin protein and administering the RNAi agent targeting said polymorphism such that the mutant protein is decreased, wherein the polymorphism is a non-disease causing single nucleotide polymorphism located at a site distinct from a disease mutation within a polymorphic region which is distinct from an expanded CAG region within the mutant gene.
Independent claims7
141 paragraphs in 1 section, as filed
<u>Background of the Invention</u>
0001RNA interference (RNAi) is the mechanism of sequence-specific, post-transcriptional gene silencing initiated by double-stranded RNAs (dsRNA) homologous to the gene being suppressed. dsRNAs are processed by Dicer, a cellular ribonuclease III, to generate duplexes of about 21 nt with 3'-overhangs (small interfering RNA, siRNA) which mediate sequence-specific mRNA degradation. In mammalian cells siRNA molecules are capable of specifically silencing gene expression without induction of the unspecific interferon response pathway. Thus, siRNAs have become a new and powerful alternative to other genetic tools such as antisense oligonucleotides and ribozymes to analyze gene function. Moreover, siRNA's are being developed for therapeutic purposes with the aim of silencing disease genes in humans.
0002Trinucleotide repeat diseases comprise a recently recognized group of inherited disorders. The common genetic mutation is an increase in a series of a particular trinucleotide repeat. To date, the most frequent trinucleotide repeat is CAG, which codes for the amino acid glutamine. At least 9 CAG repeat diseases are known and there are more than 20 varieties of these diseases, including Huntington's disease, Kennedy's disease and many spinocerebellar diseases. These disorders share a neurodegenerative component in the brain and/or spinal cord. Each disease has a specific pattern of neurodegeneration in the brain and most have an autosomal dominant inheritance.
0003The onset of the diseases generally occurs at 30 to 40 years of age, but in Huntington's disease CAG repeats in the huntingtin gene of >60 portend a juvenile onset.
0004Recent research by the instant inventors has shown that the genetic mutation (increase in length of CAG repeats from normal <36 in the huntingtin gene to >36 in disease) is associated with the synthesis of a mutant huntingtin protein, which has >36 polyglutamines (Aronin et al., 1995). It has also been shown that the protein forms cytoplasmic aggregates and nuclear inclusions (Difiglia et al., 1997) and associates with vesicles (Aronin et al., 1999). The precise pathogenic pathways are not known.
0005Huntington's disease (and by implication other trinucleotide repeat diseases) is believed to be caused, at least in part, by aberrant protein interactions, which cause impairment of critical neuronal processes, neuronal dysfunction and ultimately neuronal death (neuro degeneration in brain areas called the striatum and cortex). In the search for an effective treatment for these diseases, researchers in this field emphasized understanding the pathogenesis of the disease and initially sought to intercede at the level of the presumed aberrant protein interactions. However, there is no effective treatment for Huntington's disease or other trinucleotide repeat diseases. Moreover, it is now appreciated that multiple abnormal processes might be active in these types of disease.
<u>Summary of the Invention</u>
0006The present invention is defined in and by the appended claims.
0007Other RNAi-based methods for destroying mutant genes have been proposed in which siRNAs are targeted to, for example, a point mutation occurring in a single allele in the mutant gene (e.g., the point mutation in the superoxide dismutase (SOD) gene associated with amyotrophic lateral sclerosis (ALS)). However, there is a key difference between ALS and trinucleotide repeat diseases, such as Huntington's disease. ALS has a point mutation in one allele as the genetic change whereas trinucleotide repeat diseases have an expanded CAG repeat region in one allele as the genetic change. Use of RNAi against the expanded CAG repeat region has potential complications. Over 80 normal genes with CAG repeat regions are known to exist in cells. Thus, siRNAs targeting these CAG repeats cannot be used without risking widespread destruction of normal CAG repeat-containing mRNAs. Likewise, targeting non-allele-specific sites would result in loss of both normal and mutant huntingtin causes neuronal dysfunction.
0008The invention utilizes RNA interference technology (RNAi) against selected polymorphic regions (<i>i.e</i>., regions containing allele-specific or allelic polymorphisms) which are distinct from the site of mutation in the genes encoding mutant proteins. The instant invention provides effective treatments for gain-of-function diseases resulting from deletion mutations, insertion mutations, point mutations, and the like, provided that the mutant gene encodes a protein having a function not normally associated with wild type protein.
0009The instant invention provides an effective treatment for Huntington's disease (HD). The invention may also provide effective treatments for other polyglutamine disorders and/or trinucleotide repeat disease, as described in detail herein.
0010In one embodiment, the mutant protein contains an expanded polyglutamine region. In another one embodiment, the gene encoding the mutant protein contains an expanded trinucleotide repeat region.
0011The invention may use RNAi agents homologous to an allelic polymorphism within the gene encoding, for example, a mutant huntingtin protein for the treatment of Huntington's disease. In a preferred embodiment, the RNAi agent may target an allelic polymorphism selected from the group consisting of P1-P5. In a further preferred embodiment, the RNAi agent may target an allelic polymorphism selected from the group consisting of P6-P43.
0012In a further embodiment, the invention provides RNAi agents comprising of a first and second strand each containing 16-25 nucleotides. The first strand of the present invention may be homologous to a region of a gene encoding a gain-of-function mutant protein, wherein the nucleotide sequence of the gain-of-function mutant protein comprises an allelic polymorphism. The second strand includes 16-25 nucleotides complementary to the first strand. The RNAi agent can also have a loop portion comprising 4-11, e.g., 4, 5, 6, 7, 8, 9, 10, 11, nucleotides that connects the two nucleotides sequences. The target region of the mRNA sequence may be located in a 5' untranslated region (UTR) or a 3' UTR of the mRNA of a mutant protein.
0013The invention may provide an expression construct comprising an isolated nucleic acid that encodes a nucleic acid molecule with a first sequence of 16-25 nucleotides homologous to an allelic polymorphism within, for example, the gene encoding a mutant huntingtin protein. The expression construct can be for example, a viral vector, retroviral vector, expression cassette or plasmid. The expression construct can also have an RNA polymerase II promoter sequence or RNA Polymerase II promoter sequence, such as, U6 snRNA promoter of H1 promoter.
0014In yet other embodiments, the present invention provides host cells e.g.,) mammalian cells) comprising nucleic acid molecules and expression constructs of the present invention.
0015In still other embodiments, the present invention provides therapeutic compositions comprising the nucleic acid molecules of the invention and a pharmaceutically acceptable carrier.
0016Other features and advantages of the invention will be apparent from the following detailed description and claims.
<u>Brief Description of the Drawings</u>
0017<ul id="ul0001" list-style="none" compact="compact"><li><figref idref="f0001 f0002 f0003 f0004 f0005 f0006 f0007 f0008 f0009 f0010 f0011">Figure 1a-k</figref>: Human huntingtin gene, nucleotide sequence (SEQ ID NO:1)</li><li><figref idref="f0012 f0013">Figure 2a-b</figref>: Human huntingtin protein, amino acid sequence (SEQ ID NO:2)</li><li><figref idref="f0014">Figure 3</figref>: Sense (SEQ ID NO: 3) and antisense (SEQ ID NO: 4) of the huntingtin (htt) target RNA sequence</li><li><figref idref="f0015">Figure 4</figref>: Thermodynamic analysis of siRNA strand 5' ends for the siRNA duplex</li><li><figref idref="f0016 f0017 f0018">Figure 5a-c</figref>: <i>In vitro</i> RNAi reactions programmed with siRNA targeting a polymorphism within the huntingtin (htt) mRNA. (a) Standard siRNA. (b) siRNA improved by reducing the base-pairing strength of the 5' end of the antisense strand of the siRNA duplex. (c) siRNA improved by reducing the unpairing the 5' end of the anti-sense strand of the siRNA duplex.</li><li><figref idref="f0019">Figure 6a-b</figref>. RNAi of endogenous Htt protein in HeLa cells. (a) Immunoblot of human Htt protein. (b) Quantification of same.</li></ul>
<u>Detailed Description of the Invention</u>
0018The present invention utilizes RNA interference technology (RNAi) against allelic polymorphisms located within a gene encoding a gain-of-function mutant protein. RNAi destroys the corresponding mutant mRNA with nucleotide specificity and selectivity. RNA agents of the present invention are targeted to polymorphic regions of a mutant gene, resulting in cleavage of mutant mRNA. These RNA agents, through a series of protein-nucleotide interactions, function to cleave the mutant mRNAs. Cells destroy the cleaved-mRNA, thus preventing synthesis of corresponding mutant protein e.g., the huntingtin protein.
0019The invention may use RNAi agents homologous to an allelic polymorphism within the gene encoding, for example, a mutant huntingtin protein for the treatment of Huntington's disease. The RNAi agent may target allelic polymorphism selected from the group consisting of P1-P5. The RNAi agent may target an allelic polymorphism selected from the group consisting of P6-P43.
0020In a further embodiment, the invention provides RNAi agents comprising of a first and second strand each containing 16-25 nucleotides. The first strand of the present invention may be homologous to a region of a gene encoding a gain-of-function mutant protein, wherein the nucleotide sequence of the gain-of-function mutant protein comprises an allelic polymorphism. The second strand includes 16-25 nucleotides complementary to the first strand. The RNAi agent can also have a loop portion comprising 4-11, e.g., 4, 5, 6, 7, 8, 9, 10, 11, nucleotides that connect the two nucleotides sequences. The target region of the mRNA sequence may be located in a 5' untranslated region (UTR) or a 3' UTR of the mRNA of a mutant protein.
0021The invention may provide an expression construct comprising an isolated nucleic acid that encodes a nucleic acid molecule with a first sequence of 16-25 nucleotides homologous to an allelic polymorphism within, for example, the gene encoding a mutant huntingtin protein. The expression construct can be for example, a viral vector, retroviral vector, expression cassette or plasmid. The expression construct can also have an RNA polymerase II promoter sequence or RNA Polymerase II promoter sequence, such as, U6 siRNA promoter of H1 promoter.
0022In yet other embodiments, the present invention provides host cells e.g.,) mammalian cells) comprising nucleic acid molecules and expression constructs of the present invention.
0023In still other embodiments, the present invention provides therapeutic compositions comprising the nucleic acid molecules of the invention and a pharmaceutically acceptable carrier.
0024So that the invention may be more readily understood, certain terms are first defined.
0025The term "nucleoside" refers to a molecule having a purine or pyrimidine base covalently linked to a ribose or deoxyribose sugar. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine and thymidine. Additional exemplary nucleosides include inosine, 1-methyl inosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, <sup>2</sup>N-methylguanosine and <sup>2,2</sup>N,N-dimethylguanosine (also referred to as "rare" nucleosides). The term "nucleotide" refers to a nucleoside having one or more phosphate groups joined in ester linkages to the sugar moiety. Exemplary nucleotides include nucleoside monophosphates, diphosphates and triphosphates. The terms "polynucleotide" and "nucleic acid molecule" are used interchangeably herein and refer to a polymer of nucleotides joined together by a phosphodiester linkage between 5' and 3' carbon atoms.
0026The term "RNA" or "RNA molecule" or "ribonucleic acid molecule" refers to a polymer of ribonucleotides. The term "DNA" or "DNA molecule" or deoxyribonucleic acid molecule" refers to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally (e.g., by DNA replication or transcription of DNA, respectively). RNA can be post-transcriptionally modified. DNA and RNA can also be chemically synthesized. DNA and RNA can be single-stranded (i. e., ssRNA and ssDNA, respectively) or multi-stranded (e.g., double stranded, <i>i.e.,</i> dsRNA and dsDNA, respectively). "mRNA" or "messenger RNA" is single-stranded RNA that specifies the amino acid sequence of one or more polypeptide chains. This information is translated during protein synthesis when ribosomes bind to the mRNA.
0027As used herein, the term "small interfering RNA" ("siRNA") (also referred to in the art as "short interfering RNAs") refers to an RNA (or RNA analog) comprising between about 10-50 nucleotides (or nucleotide analogs) which is capable of directing or mediating RNA interference. Preferably, a siRNA comprises between about 15-30 nucleotides or nucleotide analogs, more preferably between about 16-25 nucleotides (or nucleotide analogs), even more preferably between about 18-23 nucleotides (or nucleotide analogs), and even more preferably between about 19-22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21 or 22 nucleotides or nucleotide analogs). The term "short" siRNA refers to a siRNA comprising ∼21 nucleotides (or nucleotide analogs), for example, 19, 20, 21 or 22 nucleotides. The term "long" siRNA refers to a siRNA comprising ∼24-25 nucleotides, for example, 23, 24, 25 or 26 nucleotides. Short siRNAs may, in some instances, include fewer than 19 nucleotides, e.g., 16, 17 or 18 nucleotides, provided that the shorter siRNA retains the ability to mediate RNAi. Likewise, long siRNAs may, in some instances, include more than 26 nucleotides, provided that the longer siRNA retains the ability to mediate RNAi absent further processing, e.g., enzymatic processing, to a short siRNA.
0028The term "nucleotide analog" or "altered nucleotide" or "modified nucleotide" refers to a non-standard nucleotide, including non-naturally occurring ribonucleotides or deoxyribonucleotides. Preferred nucleotide analogs are modified at any position so as to alter certain chemical properties of the nucleotide yet retain the ability of the nucleotide analog to perform its intended function. Examples of positions of the nucleotide which may be derivitized include the 5 position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine, etc.; the 6 position, e.g., 6-(2-amino)propyl uridine; the 8-position for adenosine and/or guanosines, e.g., 8-bromo guanosine, 8-chloro guanosine, 8-fluoroguanosine, etc. Nucleotide analogs also include deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-modified (e.g., alkylated, e.g., N6-methyl adenosine, or as otherwise known in the art) nucleotides; and other heterocyclically modified nucleotide analogs such as those described in <nplcit id="ncit0001" npl-type="s"><text>Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310</text></nplcit>.
0029Nucleotide analogs may also comprise modifications to the sugar portion of the nucleotides. For example the 2' OH-group may be replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NH<sub>2</sub>, NHR, NR<sub>2</sub>, COOR, or OR, wherein R is substituted or unsubstituted C<sub>1</sub>-C<sub>6</sub> alkyl, alkenyl, alkynyl, aryl, etc. Other possible modifications include those described in <patcit id="pcit0001" dnum="US5858988A"><text>U.S. Patent Nos. 5,858,988</text></patcit>, and <patcit id="pcit0002" dnum="US6291438A"><text>6,291,438</text></patcit>.
0030The phosphate group of the nucleotide may also be modified, e.g., by substituting one or more of the oxygens of the phosphate group with sulfur (e.g., phosphorothioates), or by making other substitutions which allow the nucleotide to perform its intended function such as described in, for example, <nplcit id="ncit0002" npl-type="s"><text>Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21</text></nplcit>, <nplcit id="ncit0003" npl-type="s"><text>Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45</text></nplcit>, <nplcit id="ncit0004" npl-type="s"><text>Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5): 317-25</text></nplcit>, <nplcit id="ncit0005" npl-type="s"><text>Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85</text></nplcit>, and <patcit id="pcit0003" dnum="US5684143A"><text>U.S. Patent No. 5,684,143</text></patcit>. Certain of the above-referenced modifications (e.g., phosphate group modifications) preferably decrease the rate of hydrolysis of, for example, polynucleotides comprising said analogs in vivo or in vitro.
0031The term "oligonucleotide" refers to a short polymer of nucleotides and/or nucleotide analogs. The term "RNA analog" refers to an polynucleotide (e.g., a chemically synthesized polynucleotide) having at least one altered or modified nucleotide as compared to a corresponding unaltered or unmodified RNA but retaining the same or similar nature or function as the corresponding unaltered or unmodified RNA. As discussed above, the oligonucleotides may be linked with linkages which result in a lower rate of hydrolysis of the RNA analog as compared to an RNA molecule with phosphodiester linkages. For example, the nucleotides of the analog may comprise methylenediol, ethylene diol, oxymethylthio, oxyethylthio, oxycarbonyloxy, phosphorodiamidate, phophoroamidate, and/or phosphorothioate linkages. Preferred RNA analogues include sugar- and/or backbone-modified ribonucleotides and/or deoxyribonucleotides. Such alterations or modifications can further include addition of non-nucleotide material, such as to the end(s) of the RNA or internally (at one or more nucleotides of the RNA). An RNA analog need only be sufficiently similar to natural RNA that it has the ability to mediate (mediates) RNA interference.
0032As used herein, the term "RNA interference" ("RNAi") refers to a selective intracellular degradation of RNA. RNAi occurs in cells naturally to remove foreign RNAs (e.g., viral RNAs). Natural RNAi proceeds via fragments cleaved from free dsRNA which direct the degradative mechanism to other similar RNA sequences. Alternatively, RNAi can be initiated by the hand of man, for example, to silence the expression of target genes.
0033An RNAi agent having a strand which is "sequence sufficiently complementary to a target mRNA sequence to direct target-specific RNA interference (RNAi)" means that the strand has a sequence sufficient to trigger the destruction of the target mRNA by the RNAi machinery or process.
0034As used herein, the term "isolated RNA" (e.g., "isolated siRNA" or "isolated siRNA precursor") refers to RNA molecules which are substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
0035The term "in vitro" has its art recognized meaning, e.g., involving purified reagents or extracts, e.g., cell extracts. The term "in vivo" also has its art recognized meaning, e.g., involving living cells, e.g., immortalized cells, primary cells, cell lines, and/or cells in an organism.
0036As used herein, the term "transgene" refers to any nucleic acid molecule, which is inserted by artifice into a cell, and becomes part of the genome of the organism that develops from the cell. Such a transgene may include a gene that is partly or entirely heterologous (<i>i.e.,</i> foreign) to the transgenic organism, or may represent a gene homologous to an endogenous gene of the organism. The term "transgene" also means a nucleic acid molecule that includes one or more selected nucleic acid sequences, e.g., DNAs, that encode one or more engineered RNA precursors, to be expressed in a transgenic organism, e.g., animal, which is partly or entirely heterologous, <i>i.e.,</i> foreign, to the transgenic animal, or homologous to an endogenous gene of the transgenic animal, but which is designed to be inserted into the animal's genome at a location which differs from that of the natural gene. A transgene includes one or more promoters and any other DNA, such as introns, necessary for expression of the selected nucleic acid sequence, all operably linked to the selected sequence, and may include an enhancer sequence.
0037A gene "involved" in a disease or disorder includes a gene, the normal or aberrant expression or function of which effects or causes the disease or disorder or at least one symptom of said disease or disorder
0038The term "gain-of-function mutation" as used herein, refers to any mutation in a gene in which the protein encoded by said gene (<i>i.e.,</i> the mutant protein) acquires a function not normally associated with the protein (<i>i.e.,</i> the wild type protein) causes or contributes to a disease or disorder. The gain-of-function mutation can be a deletion, addition, or substitution of a nucleotide or nucleotides in the gene which gives rise to the change in the function of the encoded protein. The gain-of-function mutation may change the function of the mutant protein or cause interactions with other proteins. The gain-of-function mutation may cause a decrease in or removal of normal wild-type protein, for example, by interaction of the altered, mutant protein with said normal, wild-type protein.
0039The term "polymorphism" as used herein, refers to a variation (e.g., a deletion, insertion, or substitution) in a gene sequence that is identified or detected when the same gene sequence from different sources subjects (but from the same organism) are compared. For example, a polymorphism can be identified when the same gene sequence from different subjects (but from the same organism) are compared. Identification of such polymorphisms is routine in the art, the methodologies being similar to those used to detect, for example, breast cancer point mutations. Identification can be made, for example, from DNA extracted from a subject's lymphocytes, followed by amplification of polymorphic regions using specific primers to said polymorphic region. Alternatively, the polymorphism can be identified when two alleles of the same gene are compared. A variation in sequence between two alleles of the same gene within an organism is referred to herein as an "allelic polymorphism". The polymorphism can be at a nucleotide within a coding region but, due to the degeneracy of the genetic code, no change in amino acid sequence is encoded. Alternatively, polymorphic sequences can encode a different amino acid at a particular position, but the change in the amino acid does not affect protein function. Polymorphic regions can also be found in non-encoding regions of the gene.
0040The term "polyglutamine domain," as used herein, refers to a segment or domain of a protein that consist of a consecutive glutamine residues linked to peptide bonds. In one embodiment the consecutive region includes at least 5 glutamine residues.
0041The term "expanded polyglutamine domain" or "expanded polyglutamine segment", as used herein, refers to a segment or domain of a protein that includes at least 35 consecutive glutamine residues linked by peptide bonds. Such expanded segments are found in subjects afflicted with a polyglutamine disorder, as described herein, whether or not the subject has shown to manifest symptoms.
0042The term "trinucleotide repeat" or "trinucleotide repeat region" as used herein, refers to a segment of a nucleic acid sequence e.g.,) that consists of consecutive repeats of a particular trinucleotide sequence. The trinucleotide repeat may include at least 5 consecutive trinucleotide sequences. Exemplary trinucleotide sequences include, but are not limited to, CAG, CGG, GCC, GAA, CTG, and/or CGG.
0043The term "trinucleotide repeat diseases" as used herein, refers to any disease or disorder characterized by an expanded trinucleotide repeat region located within a gene, the expanded trinucleotide repeat region being causative of the disease or disorder. Examples of trinucleotide repeat diseases include, but are not limited to spino-cerebellar ataxia type 12 spino-cerebellar ataxia type 8, fragile X syndrome, fragile XE Mental Retardation, Friedreich's ataxia and myotonic dystrophy. Preferred trinucleotide repeat diseases for treatment according to the present invention are those characterized or caused by an expanded trinucleotide repeat region at the 5' end of the coding region of a gene, the gene encoding a mutant protein which causes or is causative of the disease or disorder. Certain trinucleotide diseases, for example, fragile X syndrome, where the mutation is not associated with a coding region may not be suitable for treatment according to the present invention, as there is no suitable mRNA to be targeted by RNAi. By contrast, disease such as Friedreich's ataxia may be suitable for treatment according to the methodologies of the invention because, although the causative mutation is not within a coding region (<i>i.e.,</i> lies within an intron), the mutation may be within, for example, an mRNA precursor (e.g., a pre-spliced mRNA precursor).
0044The term "polyglutamine disorder" as used herein, refers to any disease or disorder characterized by an expanded of a (CAG)<sub>n</sub> repeats at the 5' end of the coding region (thus encoding an expanded polyglutamine region in the encoded protein). In one embodiment, polyglutamine disorders are characterized by a progressive degeneration of nerve cells. Examples of polyglutamine disorders include but are not limited to: Huntington's disease, spino-cerebellar ataxia type 1, spino-cerebellar ataxia type 2, spino-cerebellar ataxia type 3 (also know as Machado-Joseph disease), and spino-cerebellar ataxia type 6, spino-cerebellar ataxia type 7 and dentatoiubral-pallidoluysian atrophy.
0045The phrase "examining the function of a gene in a cell or organism" refers to examining or studying the expression, activity, function or phenotype arising therefrom.
0046Various methodologies of the instant invention include step that involves comparing a value, level, feature, characteristic, property, etc. to a "suitable control", referred to interchangeably herein as an "appropriate control". A "suitable control" or "appropriate control" is any control or standard familiar to one of ordinary skill in the art useful for comparison purposes. A "suitable control" or "appropriate control" may be a value, level, feature, characteristic, property, etc. determined prior to performing an RNAi methodology, as described herein. For example, a transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristic or property, genotype, phenotype, etc. can be determined prior to introducing an RNAi agent of the invention into a cell or organism. A "suitable control" or "appropriate control" may be a value, level, feature, characteristic, property, etc. determined in a cell or organism, e.g., a control or normal cell or organism, exhibiting, for example, normal traits. A "suitable control" or "appropriate control" is a predefined value, level, feature, characteristic, property, etc.
0047Various aspects of the invention are described in further detail in the following subsections.
I.
Polyglutamine disorders
0048Polyglutamine disorders are a class of disease or disorders characterized by a common genetic mutation. In particular, the disease or disorders are characterized by an expanded repeat of the trinucleotide CAG which gives rise, in the encoded protein, to an expanded stretch of glutamine residues. Polyglutamine disorders are similar in that the diseases are characterized by a progressive degeneration of nerve cells. Despite their similarities, polyglutamine disorders occur on different chromosomes and thus occur on entirely different segments of DNA. Examples of polyglutamine disorders include Huntington's disease, Dentatorubropallidoluysian Atrophy, Spinobulbar Muscular atrophy, Spinocerebellar Ataxia Type 1, Spinocerebellar Ataxia Type 2, Spinocerebellar Ataxia Type 3, Spinocerebellar Ataxia Type 6 and Spinocerebellar Ataxia Type 7 (Table 3). <tables id="tabl0001" num="0001"><table frame="all"><title><b>Table 1.</b> Polyslutamine disorders</title><tgroup cols="6" colsep="0"><colspec colnum="1" colname="col1" colwidth="58mm" /><colspec colnum="2" colname="col2" colwidth="16mm" /><colspec colnum="3" colname="col3" colwidth="19mm" /><colspec colnum="4" colname="col4" colwidth="41mm" /><colspec colnum="5" colname="col5" colwidth="16mm" /><colspec colnum="6" colname="col6" colwidth="17mm" colsep="1" /><thead><row rowsep="0"><entry>Disease</entry><entry>Gene</entry><entry>Locus</entry><entry>Protein</entry><entry>CAG repeat size</entry><entry /></row><row><entry /><entry /><entry /><entry /><entry>Normal</entry><entry>Disease</entry></row></thead><tbody><row rowsep="0"><entry valign="bottom">Spinobulbar muscular atrophy (Kennedy disease)</entry><entry valign="bottom"><i>AR</i></entry><entry valign="bottom">Xq13-21</entry><entry valign="bottom">Androgen receptor (AR)</entry><entry valign="bottom">9-36</entry><entry valign="bottom">38-62</entry></row><row rowsep="0"><entry valign="bottom">Huntington's disease</entry><entry valign="bottom"><i>HD</i></entry><entry valign="bottom">4p16.3</entry><entry valign="bottom">Huntingtin</entry><entry valign="bottom">6-35</entry><entry valign="bottom">36-121</entry></row><row rowsep="0"><entry valign="bottom">Dentatorubral-pallidoluysian atrophy (Haw-River syndrome)</entry><entry valign="bottom"><i>DRPLA</i></entry><entry valign="bottom">12p13.31</entry><entry valign="bottom">Atrophin-1</entry><entry valign="bottom">6-35</entry><entry valign="bottom">49-88</entry></row><row rowsep="0"><entry valign="bottom">Spinocerebellar ataxia type 1</entry><entry valign="bottom"><i>SCA1</i></entry><entry valign="bottom">6p23</entry><entry valign="bottom">Ataxin-1</entry><entry valign="bottom">6-44<sup>a</sup></entry><entry valign="bottom">39-82</entry></row><row rowsep="0"><entry valign="bottom">Spinocerebellar ataxia type 2</entry><entry valign="bottom"><i>SCA2</i></entry><entry valign="bottom">12q24.1</entry><entry valign="bottom">Ataxin-2</entry><entry valign="bottom">15-31</entry><entry valign="bottom">36-63</entry></row><row rowsep="0"><entry valign="bottom">Spinocerebellar ataxia type 3 (Machado-Joseph disease)</entry><entry valign="bottom"><i>SCA3</i> (<i>MJD1</i>)</entry><entry valign="bottom">14q32.1</entry><entry valign="bottom">Ataxin-3</entry><entry valign="bottom">12-40</entry><entry valign="bottom">55-84</entry></row><row rowsep="0"><entry valign="bottom">Spinocerebellar ataxia type 6</entry><entry valign="bottom"><i>SCA6</i></entry><entry valign="bottom">19p13</entry><entry valign="bottom">α<sub>1A</sub>-Voltage-dependent calcium channel subunit</entry><entry valign="bottom">4-18</entry><entry valign="bottom">21-33</entry></row><row><entry valign="bottom">Spinocerebellar ataxia type 7</entry><entry valign="bottom"><i>SCA7</i></entry><entry valign="bottom">13p12-13</entry><entry valign="bottom">Ataxin-7</entry><entry valign="bottom">4-35</entry><entry valign="bottom">37-306</entry></row></tbody></tgroup><tgroup cols="6" rowsep="0"><colspec colnum="1" colname="col1" colwidth="58mm" /><colspec colnum="2" colname="col2" colwidth="16mm" /><colspec colnum="3" colname="col3" colwidth="19mm" /><colspec colnum="4" colname="col4" colwidth="41mm" /><colspec colnum="5" colname="col5" colwidth="16mm" /><colspec colnum="6" colname="col6" colwidth="17mm" /><tbody><row><entry namest="col1" nameend="col6" align="justify"><sup>a</sup>Alleles with 21 or more repeats are interrupted by 1-3 CAT units; disease alleles contain pure CAG tracts.</entry></row></tbody></tgroup></table></tables>
0049Polyglutamine disorders of the invention are characterized by (e.g., domains having between about 30 to 35 glutamine residues, between about 35 to 40 glutamine residues, between about 40 to 45 glutamine residues and having about 45 or more glutamine residues. The polyglutamine domain typically contains consecutive glutamine residues (Q n>36).
II.
Huntington Disease
0050Huntington's disease, inherited as an autosomal dominant disease, causes impaired cognition and motor disease. Patients can live more than a decade with severe debilitation, before premature death from starvation or infection. The disease begins in the fourth or fifth decade for most cases, but a subset of patients manifest disease in teenage years. The genetic mutation for Huntington's disease is a lengthened CAG repeat in the huntingtin gene. CAG repeat varies in number from 8 to 35 in normal individuals (Kremer et al., 1994). The genetic mutation e.g.,) an increase in length of the CAG repeats from normal less than 36 in the huntingtin gene to greater than 36 in the disease is associated with the synthesis of a mutant huntingtin protein, which has greater than 36 polyglutamates (Aronin et al., 1995). In general, individuals with 36 or more CAG repeats will get Huntington's disease. Prototypic for as many as twenty other diseases with a lengthened CAG as the underlying mutation, Huntington's disease still has no effective therapy. A variety of interventions -- such as interruption of apoptotic pathways, addition of reagents to boost mitochondrial efficiency, and blockade of NMDA receptors -- have shown promise in cell cultures and mouse model of Huntington's disease. However, at best these approaches reveal a short prolongation of cell or animal survival.
0051Huntington's disease complies with the central dogma of genetics: a mutant gene serves as a template for production of a mutant mRNA; the mutant mRNA then directs, synthesis of a mutant protein (Aronin et al., 1995; DiFiglia et al., 1997). Mutant huntingtin (protein) probably accumulates in selective neurons in the striatum and cortex, disrupts as yet determined cellular activities, and causes neuronal dysfunction and death (Aronin et al., 1999; Laforet et al., 2001). Because a single copy of a mutant gene suffices to cause Huntington's disease, the most parsimonious treatment would render the mutant gene ineffective. Theoretical approaches might include stopping gene transcription of mutant huntingtin, destroying mutant mRNA, and blocking translation. Each has the same outcome -- loss of mutant huntingtin.
III.
Huntingtin Gene
0052The disease gene linked to Huntington's disease is termed Huntington or (htt). The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The two transcripts differ with respect to their 3' untranslated regions (Lin et al., 1993). Both messages are predicted to encode a 348 kilodalton protein containing 3144 amino acids. The genetic defect leading to Huntington's disease is believed to confer a new property on the mRNA or alter the function of the protein. The amino acid sequence of the human huntingtin protein is set forth in <figref idref="f0012 f0013">Figure 2</figref> (SEQ ID NO:2).
0053A consensus nucleotide sequence of the human huntingtin gene (cDNA) is set forth in <figref idref="f0001 f0002 f0003 f0004 f0005 f0006 f0007 f0008 f0009 f0010 f0011">Figure 1</figref> (SEQ ID NO:1). The coding region consists of nucleotides 316 to 9750 of SEQ ID NO:1. The two alternative polyadenylation signals are found at nucleotides 10326 to 10331 and nucleotides 13644 to 13649, respectively. The corresponding two polyadenylation sites are found at nucleotides 10348 and 13672, respectively. The first polyadenylation signal/site is that of the 10.3 kb transcript. The second polyadenylation signal/site is that of the 13.7 kb transcript, the predominant transcript in brain.
0054Five (5) polymorphisms in the human htt gene were identified as described in Example I. An additional 38 polymorphisms in the huntingtin gene sequence have been identified <i>via</i> SNP (single nucleotide polymorphism) analysis (see Table 3). The polymorphisms set forth in Tables 2 and 3 represent preferred sites to target <i>via</i> single-nucleotide-specific RNAi, as described herein. <tables id="tabl0002" num="0002"><table frame="none"><title><b>Table 2.</b> Polymorphic sites (P) in the htt gene of human cell lines.</title><tgroup cols="6" rowsep="0"><colspec colnum="1" colname="col1" colwidth="37mm" /><colspec colnum="2" colname="col2" colwidth="18mm" /><colspec colnum="3" colname="col3" colwidth="18mm" /><colspec colnum="4" colname="col4" colwidth="18mm" /><colspec colnum="5" colname="col5" colwidth="18mm" /><colspec colnum="6" colname="col6" colwidth="18mm" colsep="0" /><thead><row rowsep="1"><entry align="center" valign="top"><u>Cell line</u></entry><entry align="center" valign="top"><u>P1 (2886)</u></entry><entry align="center" valign="top"><u>P2 (4034)</u></entry><entry align="center" valign="top"><u>P3 (6912)</u></entry><entry align="center" valign="top"><u>P4 (7222)</u></entry><entry align="center" valign="top"><u>P5 (7246)</u></entry></row></thead><tbody><row rowsep="1"><entry align="center" valign="middle">GFP-Htt (9kb construct)</entry><entry align="center" valign="middle">C</entry><entry align="center" valign="middle">G</entry><entry align="center" valign="middle">A</entry><entry align="center" valign="middle">T</entry><entry align="center" valign="middle">C</entry></row><row rowsep="1"><entry align="center" valign="middle">HeLa</entry><entry align="center" valign="middle">t</entry><entry align="center" valign="middle">a</entry><entry align="center" valign="middle">A</entry><entry align="center" valign="middle">g</entry><entry align="center" valign="middle">C</entry></row><row rowsep="1"><entry align="center" valign="middle">HEK 293T</entry><entry align="center" valign="middle">t</entry><entry align="center" valign="middle">a</entry><entry align="center" valign="middle">G</entry><entry align="center" valign="middle">g</entry><entry align="center" valign="middle">t</entry></row><row rowsep="1"><entry align="center" valign="middle">HepG2</entry><entry align="center" valign="middle">t</entry><entry align="center" valign="middle">a</entry><entry align="center" valign="middle">G</entry><entry align="center" valign="middle">g</entry><entry align="center" valign="middle">t</entry></row><row><entry align="center" valign="middle">FP-4</entry><entry align="center" valign="middle">t</entry><entry align="center" valign="middle">a</entry><entry align="center" valign="middle">g, A</entry><entry align="center" valign="middle">g</entry><entry align="center" valign="middle">t, C</entry></row></tbody></tgroup></table></tables><tables id="tabl0003" num="0003"><table frame="all"><title><b>Table 3.</b> Polymorphic sites (P) in the human htt gene identified by SNP analysis.</title><tgroup cols="6"><colspec colnum="1" colname="col1" colwidth="23mm" colsep="0" /><colspec colnum="2" colname="col2" colwidth="15mm" /><colspec colnum="3" colname="col3" colwidth="21mm" /><colspec colnum="4" colname="col4" colwidth="16mm" colsep="0" /><colspec colnum="5" colname="col5" colwidth="17mm" /><colspec colnum="6" colname="col6" colwidth="29mm" /><thead><row><entry align="right" valign="top" /><entry align="center" valign="top" /><entry valign="top">consensus</entry><entry namest="col4" nameend="col5" align="left" valign="top">polymorphism</entry><entry valign="top">db xref</entry></row></thead><tbody><row><entry align="right">complement</entry><entry align="center">103</entry><entry>G</entry><entry>A</entry><entry align="center">P6</entry><entry>dbSNP:396875</entry></row><row><entry align="right">complement</entry><entry align="center">432</entry><entry>T</entry><entry>C</entry><entry align="center">P7</entry><entry>dbSNP:473915</entry></row><row><entry align="right">complement</entry><entry align="center">474</entry><entry>C</entry><entry>A</entry><entry align="center">P8</entry><entry>dbSNP:603765</entry></row><row><entry align="right" /><entry align="center">1509</entry><entry>T</entry><entry>C</entry><entry align="center">P9</entry><entry>dbSNP:1065745</entry></row><row><entry align="right">complement</entry><entry align="center">1857</entry><entry>T</entry><entry>C</entry><entry align="center">P10</entry><entry>dbSNP:2301367</entry></row><row><entry align="right" /><entry align="center">3565</entry><entry>G</entry><entry>C, A</entry><entry align="center">P11, P12</entry><entry>dbSNP:1065746</entry></row><row><entry align="right" /><entry align="center">3594</entry><entry>T</entry><entry>G</entry><entry align="center">P13</entry><entry>dbSNP:1143646</entry></row><row><entry align="right" /><entry align="center">3665</entry><entry>G</entry><entry>C</entry><entry align="center">P14</entry><entry>dbSNP:1065747</entry></row><row><entry align="right">complement</entry><entry align="center">4122</entry><entry>G</entry><entry>A</entry><entry align="center">P15</entry><entry>dbSNP:363099</entry></row><row><entry align="right">complement</entry><entry align="center">4985</entry><entry>G</entry><entry>A</entry><entry align="center">P16</entry><entry>dbSNP:363129</entry></row><row><entry align="right">complement</entry><entry align="center">5480</entry><entry>T</entry><entry>G</entry><entry align="center">P17</entry><entry>dbSNP:363125</entry></row><row><entry align="right" /><entry align="center">6658</entry><entry>T</entry><entry>G</entry><entry align="center">P18</entry><entry>dbSNP:1143648</entry></row><row><entry align="right">complement</entry><entry align="center">6912</entry><entry>T</entry><entry>C</entry><entry align="center">P19</entry><entry>dbSNP:362336</entry></row><row><entry align="right">complement</entry><entry align="center">7753</entry><entry>G</entry><entry>A</entry><entry align="center">P20</entry><entry>dbSNP:3025816</entry></row><row><entry align="right">complement</entry><entry align="center">7849</entry><entry>G</entry><entry>C</entry><entry align="center">P21</entry><entry>dbSNP:3025814</entry></row><row><entry align="right">complement</entry><entry align="center">8478</entry><entry>T</entry><entry>C</entry><entry align="center">P22</entry><entry>dbSNP:2276881</entry></row><row><entry align="right" /><entry align="center">8574</entry><entry>T</entry><entry>C</entry><entry align="center">P23</entry><entry>dbSNP:2229985</entry></row><row><entry align="right">complement</entry><entry align="center">9154</entry><entry>C</entry><entry>A</entry><entry align="center">P24</entry><entry>dbSNP:3025807</entry></row><row><entry align="right" /><entry align="center">9498</entry><entry>T</entry><entry>C</entry><entry align="center">P25</entry><entry>dbSNP:2229987</entry></row><row><entry align="right">complement</entry><entry align="center">9699</entry><entry>G</entry><entry>A</entry><entry align="center">P26</entry><entry>dbSNP:362308</entry></row><row><entry align="right">complement</entry><entry align="center">9809</entry><entry>G</entry><entry>A</entry><entry align="center">P27</entry><entry>dbSNP:362307</entry></row><row><entry align="right">complement</entry><entry align="center">10064</entry><entry>T</entry><entry>C</entry><entry align="center">P28</entry><entry>dbSNP:362306</entry></row><row><entry align="right">complement</entry><entry align="center">10112</entry><entry>G</entry><entry>C</entry><entry align="center">P29</entry><entry>dbSNP:362268</entry></row><row><entry align="right">complement</entry><entry align="center">10124</entry><entry>G</entry><entry>C</entry><entry align="center">P30</entry><entry>dbSNP:362305</entry></row><row><entry align="right">complement</entry><entry align="center">10236</entry><entry>T</entry><entry>G</entry><entry align="center">P31</entry><entry>dbSNP:362304</entry></row><row><entry align="right">complement</entry><entry align="center">10271</entry><entry>G</entry><entry>A</entry><entry align="center">P32</entry><entry>dbSNP:362303</entry></row><row><entry align="right">complement</entry><entry align="center">10879</entry><entry>G</entry><entry>A</entry><entry align="center">P33</entry><entry>dbSNP:1557210</entry></row><row><entry align="right">complement</entry><entry align="center">10883</entry><entry>G</entry><entry>A</entry><entry align="center">P34</entry><entry>dbSNP:362302</entry></row><row><entry align="right">complement</entry><entry align="center">10971</entry><entry>C</entry><entry>A</entry><entry align="center">P35</entry><entry>dbSNP:3025805</entry></row><row><entry align="right">complement</entry><entry align="center">11181</entry><entry>G</entry><entry>A</entry><entry align="center">P36</entry><entry>dbSNP:362267</entry></row><row><entry align="right">complement</entry><entry align="center">11400</entry><entry>C</entry><entry>A</entry><entry align="center">P37</entry><entry>dbSNP:362301</entry></row><row><entry namest="col1" nameend="col2" align="right">11756..11757</entry><entry>G</entry><entry>-</entry><entry align="center">P38</entry><entry>dbSNP:5855774</entry></row><row><entry align="right" /><entry align="center">12658</entry><entry>G</entry><entry>A</entry><entry align="center">P39</entry><entry>dbSNP:2237008</entry></row><row><entry align="right">complement</entry><entry align="center">12911</entry><entry>T</entry><entry>C</entry><entry align="center">P40</entry><entry>dbSNP:362300</entry></row><row><entry align="right">complement</entry><entry align="center">13040</entry><entry>G</entry><entry>A</entry><entry align="center">P41</entry><entry>dbSNP:2530595</entry></row><row><entry align="right" /><entry align="center">13482</entry><entry>G</entry><entry>A</entry><entry align="center">P42</entry><entry>dbSNP:1803770</entry></row><row><entry align="right" /><entry align="center">13563</entry><entry>G</entry><entry>A</entry><entry align="center">P43</entry><entry>dbSNP:1803771</entry></row></tbody></tgroup></table></tables>
0055The present invention targets mutant huntingtin using RNA interference (Hutvagner et al., 2002). One strand of double-stranded RNA (siRNA) complements a polymorphic region within the mutant huntingtin mRNA. After introduction of siRNA into neurons, the siRNA partially unwinds, binds to polymorphic region within the huntingtin mRNA in a site-specific manner, and activates an mRNA nuclease. This nuclease cleaves the huntingtin mRNA, thereby halting translation of the mutant huntingtin. Cells rid themselves of partially digested mRNA, thus precluding translation, or cells digest partially translated proteins. Neurons survive on the wild-type huntingtin (from the normal allele); this approach prevents the ravages of mutant huntingtin by eliminating its production.
IV.
siRNA Design
0056siRNAs are designed as follows. First, a portion of the target gene (e.g., the htt gene) is selected that includes the polymorphism. Exemplary polymorphisms are selected from the 5' untranslated region of a target gene. Cleavage of mRNA at these sites should eliminate translation of corresponding mutant protein. Polymorphisms from other regions of the mutant gene are also suitable for targeting. A sense strand is designed based on the sequence of the selected portion. Preferably the portion (and corresponding sense strand) includes about 19 to 25 nucleotides, e.g., 19, 20, 21, 22, 23, 24 or 25 nucleotides. More preferably, the portion (and corresponding sense strand) includes 21, 22 or 23 nucleotides. The skilled artisan will appreciate, however, that siRNAs having a length of less than 19 nucleotides or greater than 25 nucleotides can also function to mediate RNAi. Accordingly, siRNAs of such length are also within the scope of the instant invention provided that they retain the ability to mediate RNAi. Longer RNAi agents have been demonstrated to ellicit an interferon or PKR response in certain mammalian cells which may be undesirable. Preferably the RNAi agents of the invention do not ellicit a PKR response (<i>i.e.,</i> are of a sufficiently short length). However, longer RNAi agents may be useful, for example, in cell types incapable of generating a PRK response or in situations where the PKR response has been downregulated or dampened by alternative means.
0057The sense strand sequence is designed such that the polymorphism is essentially in the middle of the strand. For example, if a 21-nucleotide siRNA is chosen, the polymorphism is at, for example, nucleotide 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 (<i>i.e.,</i> 6, 7, 8, 9, 10,11, 12, 13, 14, 15 or 16 nucleotides from the 5' end of the sense strand. For a 22-nucleotide siRNA, the polymorphism is at, for example, nucleotide 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16. For a 23-nucleotide siRNA, the polymorphism is at, for example, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16. For a 24-nucleotide siRNA, the polymorphism is at, for example, 9, 10, 11,12, 13, 14 or 16. For a 25-nucleotide siRNA, the polymorphism is at, for example, 9, 10, 11, 12, 13, 14, 15, 16 or 17. Moving the polymorphism to an off-center position may, in some instances, reduce efficiency of cleavage by the siRNA. Such compositions, <i>i.e.,</i> less efficient compositions, may be desireable for use if off-silencing of the wild-type mRNA is detected.
0058The antisense strand is routinely the same length as the sense strand and include complementary nucleotides. The strands may be fully complementary, <i>i.e</i>., the strands are blunt-ended when aligned or annealed. The strands may align or anneal such that 1-, 2- or 3-nucleotide overhangs are generated, <i>i.e.,</i> the 3' end of the sense strand extends 1, 2 or 3 nucleotides further than the 5' end of the antisense strand and/or the 3' end of the antisense strand extends 1, 2 or 3 nucleotides further than the 5' end of the sense strand. Overhangs can comprise (or consist of) nucleotides corresponding to the target gene sequence (or complement thereof). Alternatively, overhangs can comprise (or consist of) deoxyribonucleotides, for example dTs, or nucleotide analogs, or other suitable non-nucleotide material.
0059To facilitate entry of the antisense strand into RISC (and thus increase or improve the efficiency of target cleavage and silencing), the base pair strength between the 5' end of the sense strand and 3' end of the antisense strand can be altered, e.g., lessened or reduced, as described in detail in <patcit id="pcit0004" dnum="US47538603P" dnum-type="L"><text>U.S. Provisional patent application nos. 60/475,386</text></patcit> entitled <i>"Methods and Compositions for Controlling Efficacy of RNA Silencing"</i> (filed June 2, 2003) and <patcit id="pcit0005" dnum="US60475331B"><text>60/475,331</text></patcit> entitled <i>"Methods and Compositions for Enhancing the Efficacy and Specificity of RNAi"</i> (filed June 2, 2003). The base-pair strength may be less due to fewer G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the second or sense strand than between the 3' end of the first or antisense strand and the 5' end of the second or sense strand. The base pair strength may be less due to at least one mismatched base pair between the 5' end of the first or antisense strand and the 3' end of the second or sense strand. Preferably, the mismatched base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C and U:U. The base pair strength may be less due to at least one wobble base pair, e.g., G:U, between the 5' end of the first or antisense strand and the 3' end of the second or sense strand. The base pair strength may be less due to at least one base pair comprising a rare nucleotide, e.g., inosine (I). Preferably, the base pair is selected from the group consisting of an I:A, I:U and I:C. The base pair strength may be less due to at least one base pair comprising a modified nucleotide. The modified nucteotide may be selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G, and 2,6-diamino-A.
0060The design of siRNAs suitable for targeting the htt polymorphisms set forth in Table 2 is described in detail below <tables id="tabl0004" num="0004"><table frame="none"><tgroup cols="4" colsep="0" rowsep="0"><colspec colnum="1" colname="col1" colwidth="19mm" /><colspec colnum="2" colname="col2" colwidth="55mm" /><colspec colnum="3" colname="col3" colwidth="33mm" /><colspec colnum="4" colname="col4" colwidth="28mm" /><tbody><row><entry>P1 DNA</entry><entry>TGTGCTGACTCTGAGGAACAG</entry><entry align="center">(SEQ ID NO:5)</entry><entry /></row><row><entry>sense</entry><entry>UGUGCUGACUCUGAGGAACAG</entry><entry align="center">(SEQ ID NO:6)</entry><entry /></row><row><entry>antisense</entry><entry>ACACGACUGAGACUCCUUGUC</entry><entry align="center">(blunt-ends, 21-mer)</entry><entry>(SEQ ID NO:7)</entry></row><row><entry namest="col1" nameend="col4" align="left">(2-nt overhangs) see <figref idref="f0016 f0017 f0018">Figure 5</figref></entry></row><row><entry /><entry /><entry align="center" /><entry /></row><row><entry /><entry /><entry align="center" /><entry /></row><row><entry>P2 DNA</entry><entry>CATACCTCAAACTGCATGATG</entry><entry align="center">(SEQ ID NO:8)</entry><entry /></row><row><entry>sense</entry><entry>CAUACCUCAAACUGCAUGAUG</entry><entry align="center">(SEQ ID NO:9)</entry><entry /></row><row><entry>antisense</entry><entry>GUAUGGAGUUUGACGUACUAC</entry><entry align="center">(blunt ends, 21-mer)</entry><entry>(SEQ ID NO:10)</entry></row><row><entry /><entry /><entry align="center" /><entry /></row><row><entry>P3 DNA</entry><entry>GCCTGCAGAGCCGGCGGCCTA</entry><entry align="center">(SEQ ID NO:11)</entry><entry /></row><row><entry>sense</entry><entry>GCCUGCAGAGCCGGCGGCCUA</entry><entry align="center">(SEQ ID NO:12)</entry><entry /></row><row><entry>antisense</entry><entry>CGGACGUCUCGGCCGCCGGAU</entry><entry align="center">(blunt ends, 21-mer)</entry><entry>(SEQ ID NO:13)</entry></row><row><entry /><entry /><entry align="center" /><entry /></row><row><entry>P4 DNA</entry><entry>ACAGAGTTT<i>G</i>TGACCCACGCC</entry><entry align="center">(SEQ ID NO:14)</entry><entry /></row><row><entry>sense</entry><entry>ACAGAGUUUGUGACCCACGCC</entry><entry align="center">(SEQ ID NO:15)</entry><entry /></row><row><entry>antisense</entry><entry>UGUCUCAAACACUGGGUGCGG</entry><entry align="center">(blunt ends, 21-mer)</entry><entry>(SEQ ID NO:16)</entry></row><row><entry /><entry /><entry align="center" /><entry /></row><row><entry /><entry /><entry align="center" /><entry /></row><row><entry>P5 DNA</entry><entry>TCCCTCATC<i>T</i>ACTGTGTGCAC</entry><entry align="center">(SEQ ID NO:17)</entry><entry /></row><row><entry /><entry /><entry align="center" /><entry /></row><row><entry>sense</entry><entry>UCCCUCAUCUACUGUGUGCAC</entry><entry align="center">(SEQ ID NO:18)</entry><entry /></row><row><entry>antisense</entry><entry>AGGGAGUAGAUGACACACGUG</entry><entry align="center">(blunt ends, 21 mer)</entry><entry>(SEQ ID NO:19)</entry></row></tbody></tgroup></table></tables>
0061siRNAs can be designed according to the above exemplary teachings for any other polymorphisms found in the htt gene. Moreover, the technology is applicable to targeting any other disease gene having associated polymorphisms, <i>i.e.,</i> non-disease causing polymorphisms.
0062To validate the effectiveness by which siRNAs destroy mutant mRNAs (e.g., mutant huntingtin mRNA), the siRNA is incubated with mutant cDNA (e.g., mutant huntingtin cDNA) in a <i>Drosophila</i>-based <i>in vitro</i> mRNA expression system. Radiolabeled with <sup>32</sup>P, newly synthesized mutant mRNAs (e.g., mutant huntingtin mRNA) are detected autoradiographically on an agarose gel. The presence of cleaved mutant mRNA indicates mRNA nuclease activity. Suitable controls include omission of siRNA and use of wild-type huntingtin cDNA. Alternatively, control siRNAs are selected having the same nucleotide composition as the selected siRNA, but without significant sequence complementarity to the appropriate target gene. Such negative controls can be designed by randomly scrambling the nucleotide sequence of the selected siRNA; a homology search can be performed to ensure that the negative control lacks homology to any other gene in the appropriate genome. In addition, negative control siRNAs can be designed by introducing one or more base mismatches into the sequence.
0063Sites of siRNA-mRNA complementation are selected which result in optimal mRNA specificity and maximal mRNA cleavage.
0064While the instant invention primarily features targeting polymorphic regions in the target mutant gene (e.g., in mutant htt) distinct from the expanded CAG region mutation, the skilled artisan will appreciate that targeting the mutant region may have applicability as a therapeutic strategy in certain situations. Targeting the mutant region can be accomplished using siRNA that complements CAG in series. The siRNA<sup>cag</sup> would bind to mRNAs with CAG complementation, but might be expected to have greater opportunity to bind to an extended CAG series. Multiple siRNA<sup>cag</sup> would bind to the mutant huntingtin mRNA (as opposed to fewer for the wild type huntingtin mRNA); thus, the mutant huntingtin mRNA is more likely to be cleaved. Successful mRNA inactivation using this approach would also eliminate normal or wild-type huntingtin mRNA. Also inactivated, at least to some extent, could be other normal genes (approximately 70) which also have CAG repeats, where their mRNAs could interact with the siRNA. This approach would thus rely on an attrition strategy -- more of the mutant huntingtin mRNA would be destroyed than wild type huntingtin mRNA or the other approximately 69 mRNAs that code for polyglutamines.
V.
RNAi Agents
0065The present invention includes siRNA molecules designed, for example, as described above. The siRNA molecules of the invention can be chemically synthesized, or can be transcribed <i>in vitro</i> from a DNA template, or <i>in vivo</i> from e.g., shRNA, or, by using recombinant human DICER enzyme, to cleave <i>in vitro</i> transcribed dsRNA templates into pools of 20- ,21- or 23- bp duplex RNA mediating RNAi. The siRNA molecules can be designed using any method known in the art.
0066Instead of the RNAi agent being an interfering ribonucleic acid, e.g., an siRNA or shRNA as described above, the RNAi agent may encode an interfering ribonucleic acid, e.g., an shRNA, as described above. In other words, the RNAi agent can be a transcriptional template of the interfering ribonucleic acid. Thus, RNAi agents of the present invention can also include small hairpin RNAs (shRNAs), and expression constructs engineered to express siRNAs. Transcription of shRNAs is initiated at a polymerase III (pol III) promoter, and is thought to be terminated at position 2 of a 4-5-thymine transcription termination site. Upon expression, shRNAs are thought to fold into a stem-loop structure with 3'UU-overhangs; subsequently, the ends of these shRNAs are processed, converting the shRNAs into siRNA-like molecules of about 21-23 nucleotides (Brummelkamp et al., 2002; Lee et al., 2002. <i>supra;</i> Miyagishi et al., 2002; Paddison et al., 2002, <i>supra;</i> Paul et al., 2002, <i>supra;</i> Sui et al., 2002 <i>supra;</i> Yu et al., 2002, <i>supra.</i> More information about shRNA design and use can be found on the internet at the following addresses: katahdin.cshl.org:9331/RNAi/docs/BseRI-BamHI_Strategy.pdf and katahdin.cshl.org:9331/RNAi/docs/Web_version_of_PCR_strategy1.pdf.
0067Expression constructs of the present invention include any construct suitable for use in the appropriate expression system and include, but are not limited to, retroviral vectors, linear expression cassettes, plasmids and viral or virally-derived vectors, as known in the art. Such expression constructs can include one or more inducible promoters, RNA Pol III promoter systems such as U6 snRNA promoters or H1 RNA polymerase III promoters, or other promoters known in the art. The constructs can include one or both strands of the siRNA. Expression constructs expressing both strands can also include loop structures linking both strands, or each strand can be separately transcribed from separate promoters within the same construct. Each strand can also be transcribed from a separate expression construct. (Tuschl, T., 2002, <i>supra</i>).
0068Synthetic siRNAs can be delivered into cells by methods known in the art, including cationic liposome transfection and electroporation. However, these exogenous siRNA generally show short term persistence of the silencing effect (4∼5 days in cultured cells), which may be beneficial in only certain embodiments. To obtain longer term suppression of the target genes (<i>i.e</i>., mutant genes) and to facilitate delivery under certain circumstances, one or more siRNA can be expressed within cells from recombinant DNA constructs. Such methods for expressing siRNA duplexes within cells from recombinant DNA constructs to allow longer-term target gene suppression in cells are known in the art, including mammalian Pol III promoter systems (e.g., H1 or U6/snRNA promoter systems (Tuschl, T., 2002, <i>supra)</i> capable of expressing functional double-stranded siRNAs; (Bagella et al., 1998; Lee et al., 2002, <i>supra;</i> Miyagishi et al., 2002, <i>supra;</i> Paul et al., 2002, <i>supra;</i> Yu et al., 2002), <i>supra;</i> Sui et al., 2002, <i>supra).</i> Transcriptional termination by RNA Pol III occurs at runs of four consecutive T residues in the DNA template, providing a mechanism to end the siRNA transcript at a specific sequence. The siRNA is complementary to the sequence of the target gene in 5'-3' and 3'-5' orientations, and the two strands of the siRNA can be expressed in the same construct or in separate constructs. Hairpin siRNAs, driven by H1 or U6 snRNA promoter and expressed in cells, can inhibit target gene expression (Bagella et al., 1998; Lee et al., 2002, <i>supra;</i> Miyagishi et al., 2002, <i>supra;</i> Paul et al., 2002, <i>supra;</i> Yu et al., 2002), <i>supra;</i> Sui et al., 2002, <i>supra).</i> Constructs containing siRNA sequence under the control of T7 promoter also make functional siRNAs when cotransfected into the cells with a vector expressing T7 RNA polymerase (Jacque et al., 2002, <i>supra).</i> A single construct may contain multiple sequences coding for siRNAs, such as multiple regions of the gene encoding mutant htt, targeting the same gene or multiple genes, and can be driven, for example, by separate PolIII promoter sites.
0069Animal cells express a range of noncoding RNAs of approximately 22 nucleotides termed micro RNA (miRNAs) which can regulate gene expression at the post transcriptional or translational level during animal development. One common feature of miRNAs is that they are all excised from an approximately 70 nucleotide precursor RNA stem-loop, probably by Dicer, an RNase III-type enzyme, or a homolog thereof. By substituting the stem sequences of the miRNA precursor with sequence complementary to the target mRNA, a vector construct that expresses the engineered precursor can be used to produce siRNAs to initiate RNAi against specific mRNA targets in mammalian cells (Zeng et al., 2002, <i>supra</i>). When expressed by DNA vectors containing polymerase III promoters, micro-RNA designed hairpins can silence gene expression (McManus et al., 2002, <i>supra).</i> MicroRNAs targeting polymorphisms may also be useful for blocking translation of mutant proteins, in the absence of siRNA-mediated gene-silencing. Such applications may be useful in situations, for example, where a designed siRNA caused off-target silencing of wild type protein.
0070Viral-mediated delivery mechanisms can also be used to induce specific silencing of targeted genes through expression of siRNA, for example, by generating recombinant adenoviruses harboring siRNA under RNA Pol II promoter transcription control (Xia et al., 2002, <i>supra).</i> Infection of HeLa cells by these recombinant adenoviruses allows for diminished endogenous target gene expression. Injection of the recombinant adenovirus vectors into transgenic mice expressing the target genes of the siRNA results in <i>in vivo</i> reduction of target gene expression. Id. In an animal model, whole-embryo electroporation can efficiently deliver synthetic siRNA into post-implantation mouse embryos (Calegari et al., 2002). In adult mice, efficient delivery of siRNA can be accomplished by "high-pressure" delivery technique, a rapid injection (within 5 seconds) of a large volume of siRNA containing solution into animal <i>via</i> the tail vein (Liu et al.,1999, <i>supra;</i> McCaffrey et al., 2002, <i>supra;</i> Lewis et al., 2002. Nanoparticles and liposomes can also be used to deliver siRNA into animals.
0071The nucleic acid compositions of the invention include both unmodified siRNAs and modified siRNAs as known in the art, such as crosslinked siRNA derivatives or derivatives having non nucleotide moieties linked, for example to their 3' or 5' ends. Modifying siRNA derivatives in this way may improve cellular uptake or enhance cellular targeting activities of the resulting siRNA derivative as compared to the corresponding siRNA, are useful for tracing the siRNA derivative in the cell, or improve the stability of the siRNA derivative compared to the corresponding siRNA.
0072Engineered RNA precursors, introduced into cells or whole organisms as described herein, will lead to the production of a desired siRNA molecule. Such an siRNA molecule will then associate with endogenous protein components of the RNAi pathway to bind to and target a specific mRNA sequence for cleavage and destruction. In this fashion, the mRNA to be targeted by the siRNA generated from the engineered RNA precursor will be depleted from the cell or organism, leading to a decrease in the concentration of the protein encoded by that mRNA in the cell or organism. The RNA precursors are typically nucleic acid molecules that individually encode either one strand of a dsRNA or encode the entire nucleotide sequence of an RNA hairpin loop structure.
0073The nucleic acid compositions of the invention can be unconjugated or can be conjugated to another moiety, such as a nanoparticle, to enhance a property of the compositions, e.g., a pharmacokinetic parameter such as absorption, efficacy, bioavailability, and/or half-life. The conjugation can be accomplished by methods known in the art, e.g., using the methods of <nplcit id="ncit0006" npl-type="s"><text>Lambert et al., Drug Deliv. Rev.:47(1), 99-112 (2001</text></nplcit>) (describes nucleic acids loaded to polyalkylcyanoacrylate (PACA) nanoparticles); <nplcit id="ncit0007" npl-type="s"><text>Fattal et al., J. Control Release 53(1-3):137-43 (1998</text></nplcit>) (describes nucleic acids bound to nanoparticles); <nplcit id="ncit0008" npl-type="s"><text>Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994</text></nplcit>) (describes nucleic acids linked to intercalating agents, hydrophobic groups, polycations or PACA nanoparticles); and <nplcit id="ncit0009" npl-type="s"><text>Godard et al., Eur. J. Biochem. 232(2):404-10 (1995</text></nplcit>) (describes nucleic acids linked to nanoparticles).
0074The nucleic acid molecules of the present invention can also be labeled using any method known in the art; for instance, the nucleic acid compositions can be labeled with a fluorophore, e.g., Cy3, fluorescein, or rhodamine. The labeling can be carried out using a kit, e.g., the SILENCER™ siRNA labeling kit (Ambion). Additionally, the siRNA can be radiolabeled, e.g., using <sup>3</sup>H, <sup>32</sup>P, or other appropriate isotope.
0075Moreover, because RNAi is believed to progress via at least one single-stranded RNA intermediate, the skilled artisan will appreciate that ss-siRNAs (e.g., the antisense strand of a ds-siRNA) can also be designed (e.g., for chemical synthesis) generated (e.g., enzymatically generated)or expressed (e.g., from a vector or plasmid) as described herein and utilized according to the claimed methodologies. Moreover, in invertebrates, RNAi can be triggered effectively by long dsRNAs (e.g., dsRNAs about 100 - 1000 nucleotides in length, preferably about 200- 500, for example, about 250, 300, 350, 400 or 450 nucleotides in length) acting as effectors of RNAi. (<nplcit id="ncit0010" npl-type="s"><text>Brondani et al., Proc Natl Acad Sci U S A. 2001 Dec 4;98(25):14428-33. Epub 2001 Nov 27</text></nplcit>).
VI.
Methods of Introducing RNAs, Vectors, and Host Cells
0076Physical methods of introducing nucleic acids include injection of a solution containing the RNA, bombardment by particles covered by the RNA, soaking the cell or organism in a solution of the RNA, or electroporation of cell membranes in the presence of the RNA. A viral construct packaged into a viral particle would accomplish both efficient introduction of an expression construct into the cell and transcription of RNA encoded by the expression construct. Other methods known in the art for introducing nucleic acids to cells may be used, such as lipid-mediated carrier transport, chemical-mediated transport, such as calcium phosphate, and the like. Thus the RNA may be introduced along with components that perform one or more of the following activities: enhance RNA uptake by the cell, inhibit annealing of single strands, stabilize the single strands, or other-wise increase inhibition of the target gene.
0077RNA may be directly introduced into the cell (<i>i.e.,</i> intracellularly); or introduced extracellularly into a cavity, interstitial space, into the circulation of an organism, introduced orally, or may be introduced by bathing a cell or organism in a solution containing the RNA. Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are sites where the RNA may be introduced.
0078The cell having the target gene may be from the germ line or somatic, totipotent or pluripotent, dividing or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like. The cell may be a stem cell or a differentiated cell. Cell types that are differentiated include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of the endocrine or exocrine glands.
0079Depending on the particular target gene and the dose of double stranded RNA material delivered, this process may provide partial or complete loss of function for the target gene. A reduction or loss of gene expression in at least 50%, 60%, 70%, 80%, 90%, 95% or 99% or more of targeted cells is exemplary. Inhibition of gene expression refers to the absence (or observable decrease) in the level of protein and/or mRNA product from a target gene. Specificity refers to the ability to inhibit the target gene without manifest effects on other genes of the cell. The consequences of inhibition can be confirmed by examination of the outward properties of the cell or organism (as presented below in the examples) or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (FACS).
0080For RNA-mediated inhibition in a cell line or whole organism, gene expression is conveniently assayed by use of a reporter or drug resistance gene whose protein product is easily assayed. Such reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentarnycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracyclin. Depending on the assay, quantitation of the amount of gene expression allows one to determine a degree of inhibition which is greater than 10%, 33%, 50%, 90%, 95% or 99% as compared to a cell not treated according to the present invention. Lower doses of injected material and longer times after administration of RNAi agent may result in inhibition in a smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of targeted cells). Quantization of gene expression in a cell may show similar amounts of inhibition at the level of accumulation of target mRNA or translation of target protein. As an example, the efficiency of inhibition may be determined by assessing the amount of gene product in the cell; mRNA may be detected with a hybridization probe having a nucleotide sequence outside the region used for the inhibitory double-stranded RNA, or translated polypeptide may be detected with an antibody raised against the polypeptide sequence of that region.
0081The RNA may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of material may yield more effective inhibition; lower doses may also be useful for specific applications.
0082The efficacy of an RNAi agent of the invention (e.g., an siRNA targeting a polymorphism in a mutant gene) may be tested for its ability to specifically degrade mutant mRNA (e.g., mutant htt mRNA and/or the production of mutant huntingtin protein) in cells, in particular, in neurons (e.g., striatal or cortical neuronal clonal lines and/or primary neurons). Also suitable for cell-based validation assays are other readily transfectable cells, for example, HeLa cells or COS cells. Cells are transfected with human wild type or mutant cDNAs (e.g., human wild type or mutant huntingtin cDNA). Standard siRNA, modified siRNA or vectors able to produce siRNA from U-looped mRNA are co-transfected. Selective reduction in mutant mRNA (e.g., mutant huntingtin mRNA) and/or mutant protein (e.g., mutant huntingtin) is measured. Reduction of mutant mRNA or protein can be compared to levels of normal mRNA or protein. Exogenously-introduced normal mRNA or protein (or endogenous normal mRNA or protein) can be assayed for comparison purposes. When utilizing neuronal cells, which are known to be somewhat resistant to standard transfection techniques, it may be desirable to introduce RNAi agents (e.g., siRNAs) by passive uptake.
VII.
Methods of Treatment:
0083The present invention enables both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disease or disorder caused, in whole or in part, by a gain of function mutant protein. The disease or disorder may be a trinucleotide repeat disease or disorder. The disease or disorder may be a polyglutamine disorder. The disease or disorder may be a disorder associated with the expression of huntingtin and in which alteration of huntingtin, especially the amplification of CAG repeat copy number, leads to a defect in huntingtin gene (structure or function) or huntingtin protein (structure or function or expression), such that clinical manifestations include those seen in Huntington's disease patients.
0084"Treatment", or "treating" as used herein, is defined as the application or administration of a therapeutic agent (e.g., a RNA agent or vector or transgene encoding same) to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient, who has the disease or disorder, a symptom of disease or disorder or a predisposition toward a disease or disorder, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease or disorder, the symptoms of the disease or disorder, or the predisposition toward disease.
0085The invention enables a method for preventing in a subject, a disease or disorder as described above, by administering to the subject a therapeutic agent (e.g., an RNAi agent or vector or transgene encoding same). Subjects at risk for the disease can be identified by, for example, any or a combination of diagnostic or prognostic assays as described herein. Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the disease or disorder, such that the disease or disorder is prevented or, alternatively, delayed in its progression.
0086The invention may pertain to methods treating subjects therapeutically, <i>i.e</i>., alter onset of symptoms of the disease or disorder. The invention may involve contacting a cell expressing a gain-of-function mutant with a therapeutic agent (e.g., a RNAi agent or vector or transgene encoding same) that is specific for a polymorphism within the gene, such that sequence specific interference with the gene is achieved. These methods can be performed <i>in vitro</i> (e.g., by culturing the cell with the agent) or, alternatively, <i>in vivo</i> (e.g., by administering the agent to a subject).
0087With regards to both prophylactic and therapeutic methods of treatment, such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics. "Pharmacogenomics", as used herein, refers to the application of genomics technologies such as gene sequencing, statistical genetics, and gene expression analysis to drugs in clinical development and on the market. More specifically, the term refers the study of how a patient's genes determine his or her response to a drug (e.g., a patient's "drug response phenotype", or "drug response genotype"). Thus, the invention enables methods for tailoring an individual's prophylactic or therapeutic treatment with either the target gene molecules of the present invention or target gene modulators according to that individual's drug response genotype. Pharmacogenomics allows a clinician or physician to target prophylactic or therapeutic treatments to patients who will most benefit from the treatment and to avoid treatment of patients who will experience toxic drug-related side effects.
0088Therapeutic agents can be tested in an appropriate animal model. For example, an RNAi agent.(or expression vector or transgene encoding same) as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with said agent. Alternatively, a therapeutic agent can be used in an animal model to determine the mechanism of action of such an agent. For example, an agent can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent can be used in an animal model to determine the mechanism of action of such an agent.
VIII.
Pharmaceutical Compositions
0089The invention pertains to uses of the above-described agents for prophylactic and/or therapeutic treatments as described infra. Accordingly, the modulators (e.g., RNAi agents) of the present invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the nucleic acid molecule, protein, antibody, or modulatory compound and a pharmaceutically acceptable carrier. As used herein the language "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
0090A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, intraperitoneal, intramuscular, oral (e.g., inhalation), transdermal (topical), and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
0091Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
0092Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
0093Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
0094For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
0095Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
0096The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
0097The active compounds may be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in <patcit id="pcit0006" dnum="US4522811A"><text>U.S. Patent No. 4,522,811</text></patcit>.
0098It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
0099Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit large therapeutic indices are preferred. Although compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
0100The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the EC50 (<i>i.e.,</i> the concentration of the test compound which achieves a half-maximal response) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
0101The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
0102This invention is further illustrated by the following examples which should not be construed as limiting.
<u>EXAMPLES</u>
0103Unlike other types of autosomal dominant diseases, Huntington's disease does not contain a point mutation e.g.,) single nucleotide change. Therefore, the strategy to design siRNA directed against a point mutation in the disease allele cannot be implemented. Instead, the present invention directs designed siRNAs against polymorphisms in the Huntingtin gene, of which there are about 30 available in GenBank. The present invention also identifies the polymorphism in the Huntington disease allele which differs from the wild type allele, so that siRNA destroys only the disease mRNA and leaves intact the wild type (normal) allele mRNA. Thus, only the mutant Huntingtin protein is destroyed and the normal protein is intact.
<u>Example I: Testing of RNAi agents (e.g., siRNAs) against mutant htt in <i>Drosophila</i> lysates</u>
0104A siRNA targeting position 2886 in the htt mRNA was designed as described <i>supra.</i> The sequence of the siRNA is depicted in <figref idref="f0016">Figure 5a</figref> (SEQ ID NO:24 sense; 25 anti-sense). Synthetic RNA (Dharmacon) was deprotected according to the manufacturer's protocol. siRNA strands were annealed (Elbashir et al., 2001a).
0105Target RNAs were prepared as follows. Target RNAs were transcribed with recombinant, histidine-tagged, T7 RNA polymerase from PCR products as described (Nykänen et al., 2001; Hutvágner et al., 2002). PCR templates for htt sense and antisense were generated by amplifying 0.1 ng/ml (final concentration) plasmid template encoding htt cDNA using the following primer pairs: htt sense target, 5'-GCG TAA TAC GAC TCA CTA TAG GAA CAG TAT GTCTCA GAC ATC-3' (SEQ ID NO:30) and 5'-UUCG AAG UAU UCC GCG UAC GU-3' (SEQ ID NO:31); htt anti-sense target, 5'-GCG TAA TAC GAC TCA CTA TAG GAC AAG CCT AAT TAG TGA TGC-3' (SEQ ID NO:32) and 5'-GAA CAG TAT GTC TCA GAC ATC-3' (SEQ ID NO:33).
0106The siRNA was tested using an <i>in vitro</i> RNAi assay, featuring <i>Drosophilia</i> embryo lysates. <i>In vitro</i> RNAi reactions and analysis was carried out as previously described (Tuschl et al., 1999; Zamore et al., 2000; Haley et al., 2003). Target RNAs were used at ∼ 5 nM concentration so that reactions are mainly under single-turnover conditions. Target cleavage under these conditions is proportionate to siRNA concentration.
0107<figref idref="f0016">Figure 5a</figref> shows the efficacy of the siRNA directed against position 2886 in the mutant htt. The data clearly demonstrate that the siRNA directs cleavage of the sense target to a greater degree than observed for the anti-sense target. However, it is noticed that this first-designed siRNA did not produce a very active molecule, at least in this in <i>vitro</i> assay. Thermodynamic analysis of the base pair strength at the two ends of the siRNA duplex indicated roughly equivalent base pair strengths. <figref idref="f0015">Figure 4</figref> depicts the thermodynamic analysis of siRNA sense (SEQ ID NO:20; 22 respectively) and antisense (SEQ ID NO:21; 23 respectively) strand 5' ends for the siRNA duplex in 5a. ΔG (kcal/mole) was calculated in 1M NaCl at 37°C.
0108To improve the efficacy of the designed siRNA duplex, the 5' end of the sense strand or position 19 of the anti-sense strand of the htt siRNA tested in <figref idref="f0016">Figure 5a</figref> was altered to produce siRNA duplexes in which the 5' end of the sense strand was either fully unpaired (<figref idref="f0018">Figure 5c</figref>; SEQ ID NO: 28 sense; SEQ ID NO:29 anti-sense) or in an A:U base pair (<figref idref="f0017">Figure 5b</figref>; SEQ ID NO:26 sense; SEQ ID NO:27 anti-sense). The unpairing the 5' end of an siRNA strand-the sense strand, in this case-causes that strand to function to the exclusion of the other strand. When the htt sense strand 5' end was present in an A:U base pair and the htt anti-sense strand 5' end was in a G:C pair, the sense strand dominated the reaction (<figref idref="f0017 f0018">Figure 5b-c</figref>), but the htt anti-sense strand retained activity similar to that seen for the originally-designed siRNA.
<u>Example II: RNAi knockdown of Htt protein in cultured cells</u>
0109In a first experiment, siRNAs targeting a polymorphism in the htt mRNA (<i>i.e.,</i> the polymorphism at position 2886 in the htt mRNA) were tested for their ability to down-regulate endogenous Htt protein in HeLa cells. HeLa cells were cultures and transfected as follows. HeLa cells were maintained at 37°C in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) supplemented with 10% fetal bovine serum (FBS), 100 unit/ml penicillin and 100 µg/ml streptomycin (Invitrogen). Cells were regularly passaged at sub-confluence and plated at 70% confluency 16 hours before transaction. Lipofectamine™ (Invitrogen)-mediated transient transfection of siRNAs were performed in duplicate 6-well plates (Falcon) as described for adherent cell lines by the manufacturer. A standard transfection mixture containing 100-150 nM siRNA and 9-10 µl Lipofectamine™ in 1 ml serum-reduced OPTI-MEM<sup>®</sup> (Invitrogen) was added to each well. Cells were incubated in transfection mixture at 37C for 6 hours and further cultured in antibiotic-free DMEM. For Western blot analysis at various time intervals, the transfected cells were harvested, washed twice with phosphate buffered saline (PBS, Invitrogen), flash frozen in liquid nitrogen, and stored at -80°C for analysis.
0110Three siRNAs were tested against a common target sequence in exon 1 and four siRNAs were tested for the position 2886 polymorphism. Western blot analysis was performed as follows. Cells treated with siRNA were harvested as described above and lysed in ice-cold reporter lysis buffer (Promega) containing protease inhibitor (complete, EDTA-free, 1 tablet/10 ml buffer, Roche Molecular Biochemicals). After clearing the resulting lysates by centrifugation, protein in clear lysates was quantified by Dc protein assay kit (Bio-Rad). Proteins in 60 µg of total cell lysate were resolved by 10% SDS-PAGE, transferred onto a polyvinylidene difluoride membrane (PVDF, Bio-Rad), and immuno-blotted with antibodies against CD80 (Santa Cruz). Protein content was visualized with a BM Chemiluminescence Blotting Kit (Roche Molecular Biochemicals). The blots were exposed to x-ray film (Kodak MR-1) for various times (30 s to 5 min). <figref idref="f0019">Figure 6a</figref> depicts the results of the Western analysis. Tubulin served as the loading control. The data are quantified and normalized in <figref idref="f0019">Figure 6b</figref>. Of the siRNAs tested, 2886-4, reproducibly showed enhanced efficacy in cultured HeLa cells (<figref idref="f0019">Figure 6</figref>). This siRNA also reproducibly showed enhanced efficacy <i>in vitro</i> (not shown). GFP siRNA is a control siRNA that shares no sequence homology with htt mRNA.
0111siRNAs against polymorphic regions in the htt mRNA can likewise be tested in cells transfected with human htt cDNA or in cells transfected with htt reporter constructs. Lipofectamine™ (Invitrogen)-mediated transient cotransfections of cDNAs or reporter plasmids and siRNAs are performed as described <i>supra.</i> To test the ability of siRNAs to target htt reported constructs, RNAi was used to inhibit GFP-htt expression in cultured human Hela cell lines. Briefly, HeLa cells were transfected with GFP-htt siRNA duplex, targeting the GFP-htt mRNA sequence. To analyze RNAi effects against GFP-htt, lysates were prepared from siRNA duplex-treated cells at various times after transfection. Western blot experiments were carried out as described supra. Briefly, HeLa cells were harvested at various times post transfection, their protein content was resolved on 10% SDS-PAGE, transferred onto PVDF membranes, and immunoblotted with appropriate antibodies. Results of this study indicated that siRNA against GFP can eliminate expression of GFP-htt expression in Hela cells transfected with the GFP-htt gene. For studies targeting exogenously introduces htt, procedures are as described except that anti-Htt antibodies are used for immunoblotting.
0112RNAi can be used to inhibit htt expression in cultured neuronal cells as well. Exemplary cells include PC12 (Scheitzer et al., Thompson et al.) and NT3293 (Tagle et al.) cell lines as previously described. Additional exemplary cells include stably-transfected cells, e.g. neuronal cells or neuronally-derived cells. PC12 cell lines expressing exon 1 of the human huntingtin gene (Htt) can be used although expression of exon 1 reduces cell survival. GFP-Htt PC12 cells having an inducible GFP-Htt gene can also be used to test or validate siRNA efficacy.
<u>Example III: Htt siRNA delivery in an <i>in vivo</i> setting</u>
0113R6/2 mice models (expressing the R6/2 human htt cDNA product) are an accepted animal model to study the effectiveness of siRNA delivery in an <i>in vivo</i> setting. Genetically engineered R6/2 mice were used to test the effectiveness of siRNA at the 5' terminus of huntingtin mRNA. Htt siRNA was injected into the striatum of R6/2 mice through an Alzet pump. Mice were treated for 14 days with the siRNA/Alzet pump delivery system.
0114Results of this study indicated that two mice receiving the siRNA with Trans-IT TKO (Mirus) as either a 20 or 200 nM solution at 0.25µl/hour showed no deterioration of motor impairment from day 67 to day 74. Generally, these R6/2 are expected to have a continued reduction in rotarod beyond day 60.
<u>References</u>
0115<ul id="ul0002" list-style="none" compact="compact"><li><nplcit id="ncit0011" npl-type="s"><text>Aronin et al., Neuron, Nov; 15(5):1193-201 (1995</text></nplcit>)</li><li><nplcit id="ncit0012" npl-type="s"><text>Aronin et al., Phil Trans Royal Society, June 29; 354 (1386):995-1003 (1999</text></nplcit>)</li><li><nplcit id="ncit0013" npl-type="s"><text>Bagella et al., J. Cell. Physiol. 177:206-213 (1998</text></nplcit>)</li><li><nplcit id="ncit0014" npl-type="s"><text>Brummelkamp et al., Science 296:550-553 (2002</text></nplcit>)</li><li><nplcit id="ncit0015" npl-type="s"><text>Calegari et al., Proc. Natl. Acad. Sci. USA 99(22):14236-40 (2002</text></nplcit>)</li><li><nplcit id="ncit0016" npl-type="s"><text>Difiglia et al., Science, Sep 26;277(5334):1990-3 (1997</text></nplcit>)</li><li><nplcit id="ncit0017" npl-type="s"><text>Elbashir et al., Genes Dev 15, 188-200 (2001a</text></nplcit>)</li><li><nplcit id="ncit0018" npl-type="s"><text>Haley et al., Methods 30, 330-336 (2003</text></nplcit>)</li><li><nplcit id="ncit0019" npl-type="s"><text>Hutvágner and Zamore, Science 297, 2056-2060 (2002</text></nplcit>)</li><li>Jacque et al., (2002)</li><li>Kremer <i>et al.,</i> (1994)</li><li><nplcit id="ncit0020" npl-type="s"><text>Laforet et al., J. Neurosci., Dec 1;21(23):9112-23 (2001</text></nplcit>)</li><li><nplcit id="ncit0021" npl-type="s"><text>Lee et al., EMBO J. 21: 4663-4670.(2002</text></nplcit>)</li><li><nplcit id="ncit0022" npl-type="s"><text>Lewis et al., Nature Genetics 32:107-108 (2002</text></nplcit>)</li><li>Lin et al., (1993)</li><li>Liu et al., (1999)</li><li><nplcit id="ncit0023" npl-type="s"><text>McCaffrey et al., Gene Ther. 2002 Dec;9(23):1563 (2002</text></nplcit>)</li><li><nplcit id="ncit0024" npl-type="s"><text>McManus et al., RNA 8, 842-850 (2002</text></nplcit>)</li><li><nplcit id="ncit0025" npl-type="s"><text>Miyagishi et al.,Nature Biotechnol. 20:497-500 (2002</text></nplcit>)</li><li><nplcit id="ncit0026" npl-type="s"><text>Nykänen et al., Cell 107, 309-321 (2001</text></nplcit>)</li><li><nplcit id="ncit0027" npl-type="s"><text>Paddison et al., Genes Dev 16,948-958. (2002</text></nplcit>)</li><li><nplcit id="ncit0028" npl-type="s"><text>Paul et al., Nat Biotechnol 20, 505-508 (2002</text></nplcit>)</li><li>Scheitzer et al.</li><li><nplcit id="ncit0029" npl-type="s"><text>Sui et al., Proc Natl Acad Sci USA 99, 5515-5520 (2002</text></nplcit>)</li><li>Tagle et al.</li><li>Thompson et al.</li><li><nplcit id="ncit0030" npl-type="s"><text>Tuschl, T., Nat Biotechnol. 2002 May;20(5):446-8 (2002</text></nplcit>)</li><li><nplcit id="ncit0031" npl-type="s"><text>Tuschl et al., Genes Dev 13, 3191-3197 (1999</text></nplcit>)</li><li>Xia et al., (2002)</li><li><nplcit id="ncit0032" npl-type="s"><text>Yohrling G.J. et al., Mol Cell Neurosci. May;23(1):28-38 (2003</text></nplcit>)</li><li><nplcit id="ncit0033" npl-type="s"><text>Yu et al., Proc Natl Acad Sci U S A 99, 6047-6052 (2002</text></nplcit>)</li><li><nplcit id="ncit0034" npl-type="s"><text>Zamore et al., Cell 101, 25-33 (2000</text></nplcit>)</li><li><nplcit id="ncit0035" npl-type="s"><text>Zamore et al., Nature Medicine, volume 9 Number 3 pp 266 - 267 (2003</text></nplcit>)</li><li>Zeng et al., (2002)</li></ul>
SEQUENCE LISTING
0116<ul id="ul0003" list-style="none"><li><110> University of Massachusetts ARONIN, Neil ZAMORE, Phillip D.</li><li><120> RNA INTERFERENCE FOR THE TREATMENT OF GAIN-OF-FUNCTION DISORDERS</li><li><130> UMY-083PC</li><li><150><patcit id="pcit0007" dnum="WO60502678A"><text> 60/502678</text></patcit> <151> 2003-09-12</li><li><160> 33</li><li><170> FastSEQ for Windows Version 4.0</li><li><210> 1 <211> 13672 <212> DNA <213> Homo sapiens</li><li><400> 1 <img file="EP1670518B1_D0001.tif" /><img file="EP1670518B1_D0002.tif" /><img file="EP1670518B1_D0003.tif" /><img file="EP1670518B1_D0004.tif" /><img file="EP1670518B1_D0005.tif" /></li><li><210> 2 <211> 3144 <212> PRT <213> Homo sapiens</li><li><400> 2 <img file="EP1670518B1_D0006.tif" /><img file="EP1670518B1_D0007.tif" /><img file="EP1670518B1_D0008.tif" /><img file="EP1670518B1_D0009.tif" /><img file="EP1670518B1_D0010.tif" /><img file="EP1670518B1_D0011.tif" /><img file="EP1670518B1_D0012.tif" /></li><li><210> 3 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 3 ugcagcugau caucgaugug cugacccuga ggaacaguuc 40</li><li><210> 4 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 4 gaacuguucc ucagggucag cacaucgaug aucagcugca 40</li><li><210> 5 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 5 tgtgctgact ctgaggaaca g 21</li><li><210> 6 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 6 ugugcugacu cugaggaaca g 21</li><li><210> 7 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 7 cuguuccuca gagucagcac a 21</li><li><210> 8 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 8 catacctcaa actgcatgat g 21</li><li><210> 9 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 9 cauaccucaa acugcaugau g 21</li><li><210> 10 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 10 caucaugcag uuugagguau g 21</li><li><210> 11 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 11 gcctgcagag ccggcggcct a 21</li><li><210> 12 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 12 gccugcagag ccggcggccu a 21</li><li><210> 13 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 13 uaggccgccg gcucugcagg c 21</li><li><210> 14 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 14 acagagtttg tgacccacgc c 21</li><li><210> 15 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 15 acagaguuug ugacccacgc c 21</li><li><210> 16 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 16 ggcguggguc acaaacucug u 21</li><li><210> 17 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 17 tccctcatct actgtgtgca c 21</li><li><210> 18 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 18 ucccucaucu acugugugca c 21</li><li><210> 19 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 19 gugcacacag uagaugaggg a 21</li><li><210> 20 <211> 5 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 20 ugugc 5</li><li><210> 21 <211> 7 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 21 gcacauc 7</li><li><210> 22 <211> 5 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 22 guugc 5</li><li><210> 23 <211> 7 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 23 ggaagag 7</li><li><210> 24 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 24 ugugcugacc cugaggaaca g 21</li><li><210> 25 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 25 guuccucagg gucagcacau c 21</li><li><210> 26 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 26 ugugcugacc cugaggaaaa g 21</li><li><210> 27 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 27 uuuccucagg gucagcacau c 21</li><li><210> 28 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 28 ugugcugacc cugaggaaaa g 21</li><li><210> 29 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 29 guuccucagg gucagcacau c 21</li><li><210> 30 <211> 42 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 30 gcgtaatacg actcactata ggaacagtat gtctcagaca tc 42</li><li><210> 31 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 31 uucgaaguau uccgcguacg u 21</li><li><210> 32 <211> 42 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 32 gcgtaatacg actcactata ggacaagcct aattagtgat gc 42</li><li><210> 33 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> synthetic construct</li><li><400> 33 gaacagtatg tctcagacat c 21</li></ul>
31 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31
Every citation, both ways
| Document | Relation | Office |
|---|---|---|
| WO03013437A | Cites | World Intellectual Property Organization (WIPO) |
| WO2004042027A | Cites | World Intellectual Property Organization (WIPO) |
| WO2004047872A | Cites | World Intellectual Property Organization (WIPO) |
| US2003144239A1 | Cites | United States of America |
| DING H ET AL: "Selective silencing by RNAi of a dominant allele that causes amyotrophic lateral sclerosis" AGING CELL, BLACKWELL PUBLISHING,, GB, vol. 2, 2003, pages 209-217, XP002389534 ISSN: 1474-9718 | Non-patent | – |
| CAPLEN N J ET AL: "Rescue of polyglutamine-mediated cytotoxicity by double-stranded RNA-mediated RNA interference" HUMAN MOLECULAR GENETICS, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 11, no. 2, 15 January 2002 (2002-01-15), pages 175-184, XP002380705 ISSN: 0964-6906 | Non-patent | – |
| NELLEMANN C ET AL: "Inhibition of Huntingtin synthesis by antisense oligonuleotides" MOLECULAR AND CELLULAR NEUROSCIENCES, SAN DIEGO, US, vol. 16, October 2000 (2000-10), pages 313-323, XP002960853 ISSN: 1044-7431 | Non-patent | – |
| GOTO J ET AL: "SUPPRESSION OF HUNTINGTIN GENE EXPRESSION BY SIRNA: A POSSIBLE THERAPEUTIC TOOL FOR HUNTINGTON'S DISEASE" NEUROLOGY, LIPPINCOTT WILLIAMS & WILKINS, PHILADELPHIA, US, vol. 60, no. 5, SUPPL 1, 11 March 2003 (2003-03-11), page A286, XP009029181 ISSN: 0028-3878 | Non-patent | – |
| SCHWARZ DIANNE S ET AL: "Designing siRNA that distinguish between genes that differ by a single nucleotide" PLOS GENETICS, vol. 2, no. 9, September 2006 (2006-09), pages 1307-1318, XP002434423 ISSN: 1553-7390(print) 1553-7404(ele | Non-patent | – |
| MACDONALD M E ET AL: "A NOVEL GENE CONTAINING A TRINUCLEOTIDE REPEAT THAT IS EXPANDED AND UNSTABLE ON HUNTINGTON'S DISEASE CHROMOSOMES" CELL, CELL PRESS, CAMBRIDGE, NA, US, vol. 72, 26 March 1993 (1993-03-26), pages 971-983, XP000199501 ISSN: 0092-8674 | Non-patent | – |
| MILLER V.M. ET AL: 'Allele-specific silencing of dominant disease genes' PNAS vol. 100, no. 12, June 2003, pages 7195 - 7200, XP002278730 | Non-patent | – |
| FLUITER K. ET AL: 'Killing cancer by targeting genes that cancer cells have lost: allele-specific inhibition, a novel approach to the treatment of genetic disorders' CELL MOL. LIFE SCI. vol. 60, no. 5, May 2003, pages 834 - 843, XP002985258 | Non-patent | – |
33 members in 7 offices
Priority claims9
| Document | Office | Kind | Date |
|---|---|---|---|
| 502678P | United States of America | – | |
| 50267803 | United States of America | P | |
| 50267803 | United States of America | P | |
| 2004029968 | United States of America | W | |
| 2004029968 | United States of America | W | |
| 2004029968 | – | – | – |
| 502678P | – | – | – |
| US20030502678P | – | – | – |
| WO2004US29968 | – | – | – |
Members33
| Document | Office | Kind | |
|---|---|---|---|
| CA2579638A1 | Canada | A1 | |
| WO2005027980A1 | World Intellectual Property Organization (WIPO) | A1 | |
| EP1670518A1 | European Patent Office (EPO) | A1 | |
| EP1670518A4 | European Patent Office (EPO) | A4 | |
| CA2662704A1 | Canada | A1 | |
| WO2008005562A2 | World Intellectual Property Organization (WIPO) | A2 | |
| WO2008005562A3 | World Intellectual Property Organization (WIPO) | A3 | |
| EP2046993A2 | European Patent Office (EPO) | A2 | |
| US2009118206A1 | United States of America | A1 | |
| US2009186410A1 | United States of America | A1 | |
| EP2046993A4 | European Patent Office (EPO) | A4 | |
| US7947658B2 | United States of America | B2 | |
| US2011172291A1 | United States of America | A1 | |
| US8680063B2 | United States of America | B2 | |
| EP1670518B1This record | European Patent Office (EPO) | B1 | |
| ES2485848T3 | Spain | T3 | |
| US2014370597A1 | United States of America | A1 | |
| EP2821085A2 | European Patent Office (EPO) | A2 | |
| EP2821085A3 | European Patent Office (EPO) | A3 | |
| CA2579638C | Canada | C | |
| US9434943B2 | United States of America | B2 | |
| US2017051283A1 | United States of America | A1 | |
| US10344277B2 | United States of America | B2 | |
| US2020024599A1 | United States of America | A1 | |
| EP2821085B1 | European Patent Office (EPO) | B1 | |
| PT2821085T | Portugal | T | |
| DK2821085T3 | Denmark | T3 | |
| EP3760234A2 | European Patent Office (EPO) | A2 | |
| ES2808561T3 | Spain | T3 | |
| EP3760234A3 | European Patent Office (EPO) | A3 | |
| US11299734B2 | United States of America | B2 | |
| EP3760234B1 | European Patent Office (EPO) | B1 | |
| ES2969371T3 | Spain | T3 |
79 legal events, as 11 offices reported them to INPADOC
Over the term
Point at a mark for the eventEvents
| Event | Code | Office | |
|---|---|---|---|
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Ep patent has lapsedLapsedEUG | EUG | SE | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Patent expired after termination of 20 yearsExpiredPE20 | PE20 | GB | |
| Announcement of lapse in spainLapsedFD2A | FD2A | ES | |
| Expiry of rightR071 | R071 | DE | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Opt-out of the competence of the unified patent court (upc) registeredP01 | P01 | EP | |
| Change of representativeR082 | R082 | DE | |
| Change of representativeR082 | R082 | DE | |
| Fee paymentPLFP | PLFP | FR | |
| Fee paymentPLFP | PLFP | FR | |
| Fee paymentPLFP | PLFP | FR | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Patent lapsedLapsedMM4A | MM4A | IE | |
| No opposition filed against granted patent, or epo opposition proceedings concluded without decisionGrantedR097 | R097 | DE | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Patent ceasedCeasedPL | PL | CH | |
| No opposition filedOpposition26N | 26N | EP | |
| No opposition filed within time limitOppositionORIGINAL CODE: 0009261PLBE | PLBE | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: NO OPPOSITION FILED WITHIN TIME LIMITSTAA | STAA | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| No opposition filed against granted patent, or epo opposition proceedings concluded without decisionGrantedR097 | R097 | DE | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Invalidation of extension of european patentsMG9D | MG9D | LT | |
| Deletion acc. to par. 5 (withdrawal of the translation of the ep patent)MK05 | MK05 | AT | |
| Discontinued in the netherlands as no translation has been filedVDEP | VDEP | NL | |
| Translation of granted ep patentGrantedTRGR | TRGR | SE | |
| Definitive protectionFG2A | FG2A | ES | |
| Dpma publication of mentioned ep patent grantGrantedR096 | R096 | DE | |
| European patents granted designating irelandGrantedFG4D | FG4D | IE | |
| Reference to at number (ep patent validated in austria)REF | REF | AT | |
| European patent takes effect as a national patent in ch/liEP | EP | CH | |
| Designated contracting statesAK | AK | EP | |
| Request for extension of the european patentAX | AX | EP | |
| European patent grantedGrantedFG4D | FG4D | GB | |
| (expected) grantORIGINAL CODE: 0009210GRAA | GRAA | EP | |
| Grant fee paidORIGINAL CODE: EPIDOSNIGR3GRAS | GRAS | EP | |
| Intention to grant announcedINTG | INTG | EP | |
| Intention to grant announcedINTG | INTG | EP | |
| Information on inventor provided before grant (corrected)RIN1 | RIN1 | EP | |
| Information on inventor provided before grant (corrected)RIN1 | RIN1 | EP | |
| Despatch of communication of intention to grant a patentORIGINAL CODE: EPIDOSNIGR1GRAP | GRAP | EP | |
| Information related to disapproval of communication of intention to grant by the applicant or resumption of examination proceedings by the epo deletedORIGINAL CODE: EPIDOSDIGR1GRAJ | GRAJ | EP | |
| Despatch of communication of intention to grant a patentORIGINAL CODE: EPIDOSNIGR1GRAP | GRAP | EP | |
| First examination report despatched17Q | 17Q | EP | |
| Supplementary search report drawn up and despatchedA4 | A4 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Request for examination filed17P | 17P | EP | |
| Designated contracting statesAK | AK | EP | |
| Request for extension of the european patentAX | AX | EP | |
| Public reference made under article 153(3) epc to a published international application that has entered the european phaseORIGINAL CODE: 0009012PUAI | PUAI | EP |
Numbers
- Publication
- 1670518
- Publication, DOCDB
- 1670518
- Publication, EPODOC
- EP1670518
- Application
- 47839808
- Application, DOCDB
- 04783980
- Application, EPODOC
- EP20040783980
Titles3
- German
- RNA-INTERFERENZ ZUR BEHANDLUNG VON FUNKTIONSZUNAHMESTÖRUNGEN
- English
- RNA INTERFERENCE FOR THE TREATMENT OF GAIN-OF-FUNCTION DISORDERS
- French
- ARN INTERFERENCE POUR LE TRAITEMENT DE TROUBLES A GAIN DE FONCTION
Classification
- CPC, 5
- C07H21/04
- A61K48/00
- C12N15/113
- C12N2310/14
- C12N2510/00
- IPC, 4
- A61K48 00
- C07H21 04
- C12N15 11
- C12N15 113
Designated states2
- Contracting states, 1
- Türkiye
- Extension states, 1
- North Macedonia
