Virus retardation apparatus

Description of equivalent WO 2004105858 A2

VIRUS RETARDATION METHOD AND APPARATUS

In the past, a spread of a virus that entered a human body, was attempted to be retarded by means of a chemical. However the virus could not be directly retarded in the human body after the virus entered the human body.

The present method and apparatus directly effects a virus that has entered a human body by means of X-ray bursts. The present method relates to irradiating a human body with a series of X-ray bursts, to energize a section of RNA of the virus within a human body. The X-ray bursts that effect amino acid bases on the backbone of the virus, are used. The X-rays bursts, that have selected frequencies and selected energy levels, to effect the bases in the RNA of a virus, are used to irradiate a human body. RNA of a virus within a human body that has been infected by the virus, is retarded in its spread and existence.

The method further relates to a step of determining a sequence of bases that are in a a section of an RNA helix strand of RNA of the virus. A sequence of frequencies, for a series of bursts of X-rays needed to effect a section of a complete strand of RNA of the virus, is determined. The series of bursts of X-ray irradiation of the body is generated, to cover the series of bases of at least the determined section of RNA.

In a preferred embodiment, a series of amino acid bases of a section of a SARS virus, is determined. A series of approximately 20 bases is determined.

An X-ray burst having a frequency of 9.25 (10expl6) cycles per second, corresponding to 383 electron volts, is used to energize a T amino acid base in the series of bases. An X-ray burst having a frequency corresponding to 268 electron volts, is used to energize a G base in the series of bases. An X-ray burst having a frequency corresponding to 283 electron volts, is used to energize an A amino acid base in the series of bases. An X-ray burst having a frequency of corresponding to 392 electron volts, is used to energize a C amino acid base in the series of bases.

The series of bursts of X-rays is made to irradiate a human body, that has been infected with a virus, for a time duration such as 200 seconds. Twenty bases are covered with a 10 second time interval between two successive X-ray bursts.

The above 383 and 392 electron volt frequencies of x-ray bursts are absorbed by nitrogen atoms of the T and C amino acid bases of the virus. The above 283 and 268 electron volt frequencies of x-ray bursts are absorbed by carbon atoms of the A and G amino acid bases of the virus.

Nitrogen-hydrogen type hydrogen bonds, made by T and C amino acid bases of the RNA of the virus, are effected by the described X-ray bursts. Carbon-hydrogen type hydrogen bonds, made with A and G amino acid bases of the RNA of the virus, are effected by the described X-ray bursts. Hydrogen bonds with the amino acid bases of the virus are effected by the X-ray bursts.

The X-ray bursts are generated by four X-ray guns of an X-ray apparatus. The X- ray dose level from the X-ray guns is kept low compared with a normal chest x-ray level.

SUMMARY OF THE INVENTION

An X-ray apparatus for retarding a virus in a human body comprising four X-ray guns, each of the four X-ray guns generating a separate frequency of an X-ray burst, a first separate frequency tuned to energize an amino acid base A, a second separate frequency tuned to energize an amino acid base G, a third separate frequency tuned to energize an amino acid base T, and a fourth separate frequency tuned to energize an amino acid base C.

DESCRIPTION OF THE DRAWING

Figure 1 is a perspective view of apparatus having four X-ray guns, the apparatus for irradiating a human body with a series of X-ray bursts from the X-ray guns.

DESCRIPTION OF THE PREFERRED EMBODIMENT

Figure 1 shows an X-ray apparatus 10. The x-ray apparatus 10 has an X-ray gun 12, an X-ray gun 14, an X-ray gun 16, and an X-ray gun 18. Each X-ray gun generates a burst of X-rays having a separate selected frequency. X-ray gun 12 generates a burst of X-rays having a frequency of 383 electron volts. X-ray gun 14 generates a burst of X- rays having a frequency of 392 electron volts. X-ray gun 16 generates a burst of X-rays having a frequency of 283 electron volts. X-ray gun 18 generates a burst of X-rays having a frequency of 267 electron volts.

The X-ray machine 10 irradiates a human body 20 with a series of bursts of X-rays, each burst having a frequency selected to hit an amino acid base of section of RNA of a SARS virus in a human body 10.

Each base of a series of amino acid bases AAATGGGACCTTATTATTAG of a section of RNA would be energized by an X-ray burst of series of X-ray bursts. The series of X-ray bursts have a series of frequencies. The series of frequencies, in electron volts, is 283, 283, 283, 383, 268, 268, 268, 283, 392, 392, 383, 383, 283, 383, 383, 283, 383, 383, 283, and 268. - .