Susceptibility gene for myocardial infarction; methods of treatment
Abstract
This record has no abstract on file.
Term
Term ended
Projected expiry passed 16 October 2023, 2.9 years ago.
- Priority
- Filed
- Published
- Projected expiry
- Today
128 claims: 14 independent, 114 dependent
- 1Claims of equivalent WO 2004035741 A2 CLAIMS What is claimed is:1. Use of a leukotriene synthesis inhibitor for the manufacture of a medicament for treatment for myocardial infarction or susceptibility to myocardial infarction in an individual.
- 19A method of treatment for acute coronary syndrome in an individual, comprising administering leukotriene synthesis inhibitor to the individual, in a therapeutically effective amount.
- 38A method of decreasing risk of a subsequent myocardial infarction in an individual who has had at least one myocardial infarction, comprising administering a leukotriene synthesis inhibitor to the individual, in a therapeutically effective amount.
- 56A method of treatment for atherosclerosis in an individual, comprising administering a leukotriene synthesis inhibitor to the individual, in a therapeutically effective amount.
- 75A method of reducing leukotriene synthesis in an individual, comprising administering a leukotriene synthesis inhibitor to the individual, in a therapeutically effective amount.
- 95The method of any one of Claims 1 -93, wherein the leukotriene synthesis inhibitor is an agent selected from the group consisting of:a complement of a nucleic acid encoding a member ofthe leukotriene pathway;a binding agent of a member ofthe leukotriene pathway;an agent that alters expression of a nucleic acid encoding a member ofthe leukotriene pathway;an agent that alters posttranslational processing of a member ofthe leukotriene pathway;an agent that alters activity of a polypeptide member ofthe leukotriene pathway;an agent that alters activity of a leukotriene;an antibody to a leukotriene;and an agent that alters interaction among two or more members ofthe leukotriene pathway.
- 96The method of any one of Claims 1-93 , wherein the leukotriene synthesis inhibitor is an agent selected from the group consisting of:a FLAP nucleic acid binding agent;a 5-lipoxygenase binding agent;a leukotriene synthetase binding agent;a FLAP nucleic acid binding agent;a 5-liopoxygenase nucleic acid binding agent;a leukotriene synthetase nucleic acid binding agent;a peptidomimetic;a fusion protein;a prodrug;an antibody;an agent that alters FLAP nucleic acid expression;an agent that alters activity of a polypeptide encoded by a FLAP nucleic acid, a 5-lipoxygenase nucleic acid, or a leukotriene synthetase nucleic acid;an agent that alters posttranscriptional processing of a polypeptide encoded by a FLAP nucleic acid, a 5- lipoxygenase nucleic acid or a leukotriene synthetase nucleic acid;an agent that alters interaction of a FLAP nucleic acid with a FLAP nucleic acid binding agent;an agent that alters interaction of a 5- lipoxygenase nucleic acid with a 5-lipoxygenase nucleic acid binding agent;an agent that alters interaction of a leukotriene synthetase nucleic acid with a leukotriene synthetase nucleic acid binding agent;an agent that alters transcription of splicing variants encoded by a FLAP nucleic acid, a 5-lipoxygenase nucleic acid, or a leukotriene synthetase nucleic acid;and ribozymes.
- 97A method of assessing an individual for an increased risk of MI, comprising assessing the level of a leukotriene metabolite in the individual, wherein an increased level of leukotriene metabolites is indicative of an increased risk of MI.
- 100A method of assessing an individual for an increased risk of ACS, comprising assessing the levels of leukotriene metabolites in the individual, wherein an increased level of leukotriene metabolites is indicative of an increased risk of ACS.
- 103A method of assessing an individual for an increased risk of atherosclerosis, comprising assessing the levels of leulcotriene metabolites in the individual, wherein an increased level of leukotriene metabolites is indicative of an increased risk of atherosclerosis.
- 106A method of assessing response to treatment with a leukotriene synthesis inhibitor by an individual in a target population, comprising:a) assessing the level of a leukotriene in the individual before treatment with a leukotriene synthesis inhibitor;b) assessing the level of he leukotriene in the individual during or after treatment with the leukotriene synthesis inhibitor;c) comparing the level of the leukotriene before treatment with the level ofthe leukotriene during or after treatment, wherein a level ofthe leulcotriene during or after treatment that is significantly lower than the level of the leukotriene before treatment, is indicative of efficacy of treatment with the leukotriene synthesis inhibitor.
- 109A method of assessing response to treatment with a leukotriene synthesis inhibitor, by an individual in a target population, comprising:a) assessing the level of an inflammatory marker in the individual before treatment with a leukotriene synthesis inliibitor;b) assessing the level ofthe inflammatory marker in the individual during or after treatment with the leulcotriene synthesis inhibitor;c) comparing the level ofthe inflammatory marker before treatment with the level ofthe inflammatory marker during or after treatment, wherein a level ofthe inflammatory marker during or after treatment that is significantly lower than the level of mflarnmatory marker before treatment, is indicative of efficacy of treatment with the leulcotriene synthesis inhibitor.
- 111A method of treatment for myocardial infarction or susceptibility to myocardial infarction in an individual, comprising administering a leukotriene synthesis inhibitor to the individual in need thereof, in a therapeutically effective amount.
Independent claims14
485 paragraphs in 338 sections, as filed
Description of equivalent WO 2004035741 A2
SUSCEPTIBILITY GENE FOR MYOCARDIAL INFARCTION; METHODS OF TREATMENT
RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No. 60/449,331, filed on February 21, 2003, and claims the benefit of U.S. Provisional Application No. 60/419,433, filed on October 17, 2002. The entire teachings ofthe above applications are incorporated herein by reference.
BACKGROUND OF THE INVENTION
Myocardial infarction (MI) and Acute Coronary Syndrome (ACS), e.g., unstable angina, non-ST-elevation myocardial infarction (NSTEMI) or ST-elevation myocardial infarction (STEMI), are the leading causes of hospital admissions in industrialized countries. Cardiovascular disease continues to be the principle cause of death in the United States, Europe and
Japan. The costs ofthe disease are high both in terms of morbidity and mortality, as well as in terms ofthe financial burden on health care systems.
Myocardial infarction generally occurs when there is an abrupt decrease in coronary blood flow following a thrombotic occlusion of a coronary artery previously damaged by atherosclerosis, hi most cases, infarction occurs when an atherosclerotic plaque fissures, ruptures or ulcerates and when conditions favor thrombogenesis. In rare cases, infarction may be due to coronary artery occlusion caused by coronary emboli, congenital abnormalities, coronary spasm, and a wide variety of systemic, particularly inflammatory diseases. Medical risk factors for MI include cigarette smoking, diabetes, hypertension and serum total cholesterol levels > 200 mg/dL, elevated serum LDL cholesterol, and low serum HDL cholesterol. Event rates in individuals without a prior history of cardiovascular disease are about 1%. In individuals who have had a first MI or ACS, the risk of a repeat MI within the next year is 10-14%, despite maximal medical management including angioplasty and stent placement.
Atherosclerosis can affect vascular beds in many large and medium arteries. Myocardial infarction and unstable angina (acute coronary syndrome (ACS)) stem from coronary artery atherosclerosis, while ischemic stroke most f equently is a consequence of carotid or cerebral artery atherosclerosis. Limb ischemia caused by peripheral arterial occlusive disease (PAOD) may occur as a consequence of iliac, femoral and popliteal artery atherosclerosis. The atherosclerotic diseases remain common despite the wide-spread use of medications that inhibit thrombosis (aspirin) or treat medical risk factors such as elevated cholesterol levels in blood (statins), diabetes, or hypertension (diuretics and anti-hypertensives).
Atherosclerotic disease is initiated by the accumulation of lipids within the artery wall, and in particular, the accumulation of low-density lipoprotein (LDL) cholesterol. The trapped LDL becomes oxidized and internalized by macrophages. This causes the formation of atherosclerotic lesions containing accumulations of cholesterol-engorged macrophages, referred to as "foam cells". As disease progresses, smooth muscle cells proliferate and grow into the artery wall forming a "fibrous cap" of extracellular matrix enclosing a lipid-rich, necrotic core. Present in the arterial walls of most people throughout their lifetimes, fibrous atherosclerotic plaques are relatively stable. Such fibrous lesions cause extensive remodeling ofthe arterial wall, outwardly displacing the external, elastic membrane, without reduction in luminal diameter or serious impact on delivery of oxygen to the heart. Accordingly, patients can develop large, fibrous atherosclerotic lesions without luminal narrowing until late in the disease process. However, the coronary arterial lumen can become gradually narrowed over time and in some cases compromise blood flow to the heart, especially under high demand states such as exercise. This can result in reversible ischemia causing chest pain relieved by rest called stable angina. In contrast to the relative stability of fibrous atherosclerotic lesions, the culprit lesions associated with myocardial infarction and unstable angina (each of which are part ofthe acute coronary syndrome) are characterized by a thin fibrous cap, a large lipid core, and infiltration of inflammatory cells such as T- lymphocytes and monocyte/macrophages. Non-invasive imaging techniques have shown that most Mi's occur at sites with low- or intermediate- grade stenoses, indicating that coronary artery occlusion is due most frequently to rupture of culprit lesions with consequent formation of a thrombus or blood clot and not solely due to luminal narrowing by stenosis. Plaque rupture may be due to erosion or uneven thinning ofthe fibrous cap, usually at the margins ofthe lesion where macrophages enter, accumulate, and become activated by a local inflammatory process. Thinning ofthe fibrous cap may result from degradation ofthe extracellular matrix by proteases released from activated macrophages. These changes producing plaque instability and risk of MI may be augmented by production of tissue-factor procoagulant and other factors increasing the likelihood of thrombosis.
In acute coronary syndrome, the culprit lesion showing rupture or erosion with local thrombosis typically is treated by angioplasty or by balloon dilation and placement of a stent to maintain luminal patency. Patients experiencing ACS are at high risk for a second coronary event due to the multi-vessel nature of coronary artery disease with event rates approaching 10- 14% within 12 months after the first incident.
The emerging view of MI is as an inflammatory disease ofthe arterial vessel wall on preexisting chronic atherosclerotic lesions, sometimes triggering rupture of culprit lesions and leading to local thrombosis and subsequent myocardial infarction. The process that triggers and sustains arterial wall mflammation leading to plaque instability is unknown, however, it results in the release into the circulation of tumor necrosis factor alpha and interleukin-6. These and other cytokines or biological mediators released from the damaged vessel wall stimulate an inflammatory response in the liver causing elevation in several non-specific general inflammatory markers including C-reactive protein. Although not specific to atherosclerosis, elevated C-reactive protein (CRP) and serum amyloid A appear to predict risk for MI, perhaps as surrogates for vessel wall inflammation.
Although classical risk factors such as smoking, hyperlipidemia, hypertension, and diabetes are associated with many cases of coronary heart disease (CHD) and MI, many patients do not have involvement of these risk factors. In fact, many patients who exhibit one or more of these risk factors do not develop MI. Family history has long been recognized as one ofthe major risk factors. Although some ofthe familial clustering of MI reflects the genetic contribution to the other conventional risk factors, a large number of studies have suggested that there are significant genetic susceptibility factors, beyond those ofthe known risk factors (Friedlander Y, et al, Br. Heart J. 1985; 53:382-7, Shea S. et al, J. Am. Coll. Cardiol. 1984; 4:793-801, and Hopkins P.N., et al, Am. J. Cardiol. 1988; 62:703-7). Major genetic susceptibility factors have only been identified for the rare Mendelian forms of hyperlipidemia such as a familial hypercholesterolemia.
Genetic risk is conferred by subtle differences in genes among individuals in a population. Genes differ between individuals most frequently due to single nucleotide polymorphisms (SNP), although other variations are also important. SNP are located on average every 1000 base pairs in the human genome. Accordingly, a typical human gene containing 250,000 base pairs may contain 250 different SNP. Only a minor number of SNP are located in exons and alter the amino acid sequence ofthe protein encoded by the gene. Most SNP have no effect on gene function, while others may alter transcription, splicing, translation, or stability ofthe mRNA encoded by the gene. Additional genetic polymorphism in the human genome is caused by insertion, deletion, translocation, or inversion of either short or long stretches of DNA. Genetic polymoφhisms conferring disease risk may therefore directly alter the amino acid sequence of proteins, may increase the amount of protein produced from the gene, or may decrease the amount of protein produced by the gene. As genetic polymorphisms conferring risk of disease are uncovered, genetic testing for such risk factors is becoming important for clinical medicine. Examples are apolipoprotein E testing to identify genetic carriers of the apoE4 polymorphism in dementia patients for the differential diagnosis of Alzheimer's disease, and of Factor N Leiden testing for predisposition to deep venous thrombosis. More importantly, in the treatment of cancer, diagnosis of genetic variants in tumor cells is used for the selection ofthe most appropriate treatment regime for the individual patient. In breast cancer, genetic variation in estrogen receptor expression or heregulin type 2 (Her2) receptor tyrosine kinase expression determine if anti-estrogenic drugs (tamoxifen) or anti-Her2 antibody (Herceptin) will be incorporated into the treatment plan, hi chronic myeloid leukemia (CML) diagnosis ofthe Philadelphia chromosome genetic translocation fusing the genes encoding the Bcr and Abl receptor tyrosine kinases indicates that Gleevec (STI571), a specific inhibitor ofthe Bcr-Abl kinase should be used for treatment ofthe cancer. For CML patients with such a genetic alteration, inhibition ofthe Bcr-Abl kinase leads to rapid elimination ofthe tumor cells and remission from leukemia.
Many general inflammatory markers predict risk of coronary heart disease, although these markers are not specific to atherosclerosis. For example, Stein (Stein, S., Am J Cardiol , 87 (suppl):21A-26A (2001)) discusses the use of any one ofthe following serum inflarnmatory markers as surrogates for predicting risk of coronary heart disease including C-reactive protein (CRP), serum amyloid A, fibrinogen, interleukin-6, tissue necrosis factor-alpha, soluble vascular cell adhesion molecules (sNCAM), soluble intervascular adhesion molecules (sICAM), E-selectin, matrix metalloprotease type-1, matrix metalloprotease type-2, matrix metalloprotease type-3, and matrix metalloprotease type-9. Elevation in one more of these serum inflammatory markers is not specific to coronary heart disease but also occurs with age or in association with cerebrovascular disease, peripheral vascular disease, non-insulin dependent diabetes, osteoarthritis, bacterial infection, and sepsis. Serum C-reactive protein (CRP) is viewed as a convenient and sensitive marker of systemic inflammation. Generally CRP is measured in serum samples using commercially available enzyme-linked immunosorbent assays (EIA). Consistent across multiple published studies is the finding of a correlation between increased risk for coronary artery disease with increased serum CRP. For example, in the Women's Health Study, CRP was measured in 27,939 apparently healthy American women. The cut-off points for quintiles of serum CRP in women were: less than or equal to 0.49, more than 0.49 to 1.08, more than 1.08 to 2.09, more than 2.09 to 4.19, and more than 4.19 mg CRP per liter, see Ridker, P.M. et al., New England. J. Med., 347:
1557-1565 (2001). In comparison to the lowest quintile, and even when adjusting for age, every quintile more than 0.49 mg CRP per liter was associated with increased risk for coronary heart disease with the highest relative risk of 4.5 seen for those women in the highest quintile of serum CRP (more than 4.19 mg CRP per liter). A similar correlation between increased serum CRP and increased risk for coronary heart disease in women has been reported (Ridker, P.M et al, New Engld. J. Med., 342:836-843 (2000) and Bermudez, E.A. et .al., Arterioscler. Thromb. Vase. Biol, 22: 1668-1673 (2002)). Men also show a correlation between increased serum inflammatory markers such as CR and increased risk for coronary heart disease has been reported (Doggen, CJ.M. et al, J.. Internal Med, 248:406-414 (2000) and Ridker, P.M. et al, New England. J. Med, 336: 973-979 (1997)). Quintiles for serum CRP as reported by Doggen et al, were less than 0.65, more than 0.65 to 1.18, more than 1.18 to 2.07, more than 2.07 to 4.23, and more than 4.23 mg CRP per liter. Unlike women, elevated serum CRP correlates with increased relative risk for coronary heart disease only in the 4<sup>th</sup> and 5<sup>th</sup> quintiles of CRP (relative risk of 1.7x and 1.9x, respectively).
Serum CRP in women also has been measured in conjunction with lipid markers such as levels of serum low density lipoprotein-cholesterol (LDL-C). In the study by Ridker, P.M. et al (2002), serum CRP and LDL-C are minimally correlated, screening for both serum markers provided better prognostic indication than either alone. Thus, women with serum CRP above median values (more than 1.52 mg CRP per liter) and also serum LDL-C above median values (more than 123.7 mg LDL-C per deciliter) were at highest risk for coronary heart disease. Elevated CRP or other serum inflammatory markers is also prognostic for increased risk of a second myocardial infarct in patients with a previous myocardial infarct (Retterstol, L. et al, Atheroscler., 160: 433-440 (2002)). Since CRP is produced in the liver, there is no a priori mechanistic explanation for why elevation in CRP and other serum inflammatory markers should be prognostic for coronary artery disease. As discussed by Doggen,
C.J.M., et al, one or more ofthe following factors were speculated to account for the correlation observed: (1) intrinsic inflammation and tissue damage within arterial lesions, (2) prior infection by Helicobacter pylori or by Chlamydia pneumoniae, (3) release of peptide cytokines including interleukin- 6, or (4) activation ofthe complement system.
The end products ofthe leukotriene pathway are potent inflammatory lipid mediators derived from arachidonic acid. They can potentially contribute to development of atherosclerosis and destabilization of atherosclerotic plaques through lipid oxidation and/or proinflammatory effects. LTC4, LTD4, and LTE4, are known to induce vasoconstriction. Allen et al, Circulation,
97:2406-2413 (1998) described a novel mechanism in which atherosclerosis is associated with the appearance of a leukotriene receptor(s) capable of inducing hyperactivity of human epicardial coronary arteries in response to LTC4 and LTD4. LTB4, on the other hand, is a strong proinflammatory agent. Increased production of these end products, ofthe leukotriene pathway, could therefore serve as a risk factor for MI and atherosclerosis, whereas both inflammation and vasoconstriction vasospasm have a well established role in the pathogenesis of MI and atherosclerosis. It has also been shown that a heterozygous deficiency ofthe 5-LO enzyme in a knockout mouse model decreases atherosclerotic lesion size in LDLR-/- mice by about 95%.
(Mehrabian et al, Circulation Research. 91: 20 (2002)). However, such genetic evidence for leukotriene involvement in MI or atherosclerosis in humans has not been reported. Mehrabian et al. did report a very small genetic association study looking for correlation between promoter polymorphisms of 5-LO and carotid intimal thickening in normal individuals. However, their data paradoxically suggest that a lower amount of leukotriene production correlates with carotid atherosclerosis.
SUMMARY OF THE INVENTION
As described herein, a gene on chromosome 13ql2 has been identified as playing a major role in myocardial infarction (MI). This gene, herein after referred to as the MI gene, comprises nucleic acid that encodes 5-lipoxygenase activating protein (ALOX5AP or FLAP,) herein after referred to as FLAP. The invention pertains to methods of treatment (prophylactic and/or therapeutic) for certain diseases and conditions (e.g., MI, ACS, atherosclerosis) associated with FLAP or with other members ofthe leukotriene pathway (e.g., biosynthetic enzymes such as FLAP, arachidonate 4-lipoxygenase (5-LO), leukotriene C4 synthetase (LTC4S), leukotriene A4 hydrolase (LTA4H), leukotriene B4 12-hydroxydehydrogenase (LTB4DH)); receptors and/or binding agents ofthe enzymes; and receptors for the leukotrienes LTA4, LTB4, LTC4, LTD4, LTE4, Cys LTl , Cys LT2, including leukotriene B4 receptor 1 (BLTl), leukotriene B4 receptor 2 (BLT2), cysteinyl leukotriene receptor 1 (CysLTRl), cysteinyl leukotriene receptor 2 (CysLTR2). The methods include the following: methods of treatment for myocardial infarction or susceptibility to myocardial infarction; for acute coronary syndrome (e.g. , unstable angina, non-ST-elevation myocardial infarction (NSTEMI) or ST-elevation myocardial infarction (STEMI)); for decreasing risk of a second myocardial infarction; for atherosclerosis, such as for patients requiring treatment (e.g., angioplasty, stents, coronary artery bypass graft) to restore blood flow in arteries (e.g., coronary arteries); and/or for decreasing leukotriene synthesis (e.g. , for treatment of myocardial infarction). In the methods ofthe invention, a leukotriene synthesis inhibitor is administered to an individual in a therapeutically effective amount. The leukotriene synthesis inhibitor can be an agent that inhibits or antagonizes a member ofthe leukotriene synthesis pathway (e.g., FLAP, 5-LO, LTC4S, LTA4H, and LTB4DH). For example, the leukotriene synthesis inhibitor can be an agent that inhibits or antagonizes FLAP polypeptide activity (e.g., a FLAP inhibitor) and/or FLAP nucleic acid expression, as described herein (e.g., a FLAP nucleic acid antagonist), hi another embodiment, the leukotriene synthesis inhibitor is an agent that inhibits or antagonizes polypeptide activity and/or nucleic acid expression of another member ofthe leukotriene biosynthetic pathway (e.g. , LTC4S, LTA4H, LTB4DH). In preferred embodiments, the agent alters activity and/or nucleic acid expression of FLAP or of 5-LO. Preferred agents include those set forth in the Agent Table herein. In another embodiment, preferred agents can be: l-((4- chlorophenyl)methyl)-3-((l,l-dimethylethyl)thio)-alpha,alpha-dimethyl-5-( 2- quinolinylmethoxy)- lH-Indole-2-propanoic acid otherwise known as MK- 0591 , (R)-(+)-alpha-cyclopentyl-4-(2-quinolinylmethoxy)-Benzeneacetic acid otherwise known as BAY-x-1005, 3-(3-(l,l-dimethylethylthio-5-(quinoline-2- ylmethoxy)- 1 -(4-chloromethylphenyl)indole-2-yl)-2,2- dimethylpropionaldehyde oxime-0-2-acetic acid otherwise known as A-81834, optically pure enantiomers, salts, chemical derivatives, and analogues; or can be zileuton, atreleuton, 6-((3-fluoro-5-(tetrahydro-4-methoxy-2H-pyran- 4yl)phenoxy)methyl)-l-methyl-2(lH)-quinlolinone otherwise known as ZD- 2138, 1 -((4-chlorophenyl)methyl)-3-((l , 1 dimethylethyl)thio)-alpha,alpha- dimethyl-5-( 2-quinolinylmethoxy)-lH-Indole-2-propanoic acid otherwise known as MK-886, 4-(3-(4-(2-Methyl-imidazol-l-yl)-phenylsulfanyl)- phenyl)-tetrahydro-pyran-4-carboxylic acid amide otherwise known as C J- 13610, their optically pure enantiomers, salts, chemical derivatives, and analogues. In another embodiment, the agent alters metabolism or activity of a leukotriene (e.g. , LTA4, LTB4, LTC4, LTD4, LTE4, Cys LTl , Cys LT2), such as leukotriene antagonists or antibodies to leukotrienes, as well as agents which alter activity of a leukotriene receptor (e.g., : BLTl, BLT2, CysLTRl, and CysLTR2).
In certain embodiments ofthe invention, the individual is an individual who has at least one risk factor, such as an at-risk haplotype for myocardial infarction; an at-risk haplotype in the FLAP gene; a polymorphism in a FLAP nucleic acid; an at-risk polymorphism in the 5-LO gene promoter, diabetes; hypertension; hypercholesterolemia; elevated lp(a); obesity; a past or current smoker; an elevated inflammatory marker (e.g., a marker such as C-reactive protein (CRP), serum amyloid A, fibrinogen, a leukotriene, a leukotriene metabolite, interleukin-6, tissue necrosis factor-alpha, a soluble vascular cell adhesion molecule (sVCAM), a soluble intervascular adhesion molecule (sICAM), E-selectin, matrix metalloprotease type-1, matrix metalloprotease type-2, matrix metalloprotease type-3, and matrix metalloprotease type-9); increased LDL cholesterol and/or decreased HDL cholesterol; increased leukotriene synthesis; and/or at least one previous myocardial infarction, ACS, stable angina, atherosclerosis, requires treatment for restoration of coronary artery blood flow (e.g., angioplasty, stent, coronary artery bypass graft).
The invention pertains to use of leukotriene synthesis inhibitors for the manufacture of a medicament for the treatment of MI, ACS, and/or atherosclerosis, as described herein, as well as for the manufacture of a medicament for the reduction of leukotriene synthesis.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the multipoint non-parametric LOD scores of a linkage scan of 160 female patients in large extended pedigrees and genotyped using a 1000 framework map on chromosome 13. A LOD score suggestive of linkage of 2.5 was found at marker D13S289. The marker map for chromosome 13 that was used in the linkage analysis is shown in Table 1. FIG. 2 shows LOD score results for the families after adding 14 additional markers to the candidate region. The inclusion of additional microsatellite markers increased the information on sharing by decent from 0.7 to 0.8, around the markers that gave the highest LOD scores. The marker map used in the second step of linkage anaysis is shown in Table 2.
FIG. 3 A shows the results from a haplotype association case-control analysis of 437 female MI patients versus 721 controls using combinations 4 and 5 microsatellite markers to define the test haplotypes. Thep-value ofthe association is plotted on the y-axis and position of markers on the x-axis. Only haplotypes that show association with ajc-value < 10<sup>"5</sup> are shown in the figure. The most significant microsatellite marker haplotype association is found using markers DG13S 1103, DG13S166, DG13S1287, DG13S1061 and
DG13S301, with alleles 4, 0, 2, 14 and 3, respectively (p-value of 1.02x 10<sup>"7</sup>). Carrier frequency ofthe haplotype is 7.3% in female MI patients and 0.3% in controls. The segment that is common to all the haplotypes shown in the figure includes only one gene, FLAP. FIG. 3B shows the alleles ofthe markers defining the most significant microsatellite marker haplotypes. The segment defined with a black square is common to all the of most significantly associated haplotypes. The FLAP nucleic acid is located between makers DG 13 S 166 and D 13 S 1238. Two marker haplotype involving alleles 0 and -2 for markers DG13S166 and D13S1238, respectively, is found in excess in patients. Carrier frequency of this haploype is 27% in patients and 15.4% in controls (p-value 1 X 10<sup>"3</sup>). Therefore, association analysis confirms that the most tightly Mi-associated gene within the linkage peak is FLAP.
FIG. 4 shows the markers and genes around the FLAP (ALOX5 AP) gene.
FIG. 5 shows the relative location of key SNPs and exons ofthe ALOX5AP/FLAP gene (exons shown in vertical rectangles). Haplotype length varies between 33 to 68 kb.
FIG. 6A-6Y4 show the genomic sequence ofthe FLAP gene (SEQ ID NO: 1). FIG. 7 shows the amino acid sequence of FLAP (SEQ ID NO:2) and the mRNA of FLAP (SEQ ID NO: 3).
FIG. 8A-8U show the sequences ofthe FLAP nucleic acid flanking the SNPs that were identified by sequencing samples from patients (SEQ ID NOs: 398-535).
FIG. 9 shows a significant positive correlation between serum LTE4 levels and serum CRP levels.
DETAILED DESCRIPTION OF THE INVENTION Extensive genealogical information has been combined with powerful gene sharing methods to map a gene on chromosome 13ql2 that is associated with myocardial infarction. A genome wide search for susceptibility genes for MI, using a framework map of 1000 microsatellite markers, revealed a locus suggestive of linkage on 13ql2. Sixty families with 159 female MI patients that clustered within and including 6 meiotic events were used in linkage analysis. At first, only female MI patients were used in the linkage analysis in an effort to enrich for patients with stronger genetic factors contributing to their risk for MI. The epidemiological study of a population-based sample of Icelandic MI patients had previously suggested that the genetic factors for MI might be stronger for females than males, as the relative risk for siblings of female MI patients was significantly higher than the relative risk for siblings ofmale probands (1.59 (CI 1.47 - 1.73) vs. 1.35 (CI 1.28 - 1.42)) (unpublished data). The highest LOD score (2.5) was found at marker D13S289. The LOD score results for the families remained the same after adding 14 microsatellite markers to the candidate region. The inclusion of the additional markers increased the information on sharing by descent from 0.7 to 0.8, around the markers that gave the highest LOD scores. This linkage analysis mapped a gene contributing to MI to chromosome 13ql2.
The candidate MI locus on chromosome 13ql2 was then finely mapped with microsatellite markers. Patients with myocardial infarction and controls were initially genotyped with microsatellite markers with an average spacing between markers of less than 100Kb over the 12Mb candidate region. Initial haplotype association analysis that included all genotyped microsatellite markers across the MI candidate locus, resulted in several extended haplotypes composed of 4 and 5 microsatellite markers that were significantly associated with female MI (see, e.g. , Tables 4 and 5 below). A region common to all these extended haplotypes, is defined by markers DG13S166 and D13S1238. This region includes only one gene, the FLAP nucleic acid sequence. The two marker haplotype involving alleles 0 and -2 for markers DG13S166 and D13S1238, respectively, was found in excess in patients. Specific variants of the gene were then sought that were associated with MI. hi order to screen for SNPs in the FLAP gene, the whole gene was sequenced, both exons and introns. Initially, 9 SNPs identified within the gene were genotyped in patients and controls. Additional microsatellite markers close to or within the FLAP gene were also genotyped in all patients and controls. Five publicly known SNPs that are located within a 200Kb distance 5' to the FLAP gene were also genotyped in patients and controls. Haplotype ^association analysis in this case-control study including these additional markers showed several different variants ofthe same haplotype that were all significantly associated with female MI (see, e.g., Table 6).
Table 7 shows two haplotypes that are representative of these female MI risk haplotypes which are referred to herein as the female MI "at risk" haplotypes. The relative risk for male MI patients that had the female MI-"at risk" haplotype was increased (see, e.g., Table 7), indicating that the female MI-"at risk" haplotype also increased the risk of having an MI in males. These results further strengthened the hypothesis that the FLAP gene was an MI susceptibility gene.
SNP haplotype association to MI hi an effort to identify haplotypes involving only SNP markers that associate with MI, additional SNPs were identified by sequencing the FLAP gene and the region flanking the gene. Currently, a total of 45 SNPs in 1343 patients and 624 unrelated controls have been genotyped. Two correlated series of SNP haplotypes have been observed in excess in patients, denoted as A and B in Table 9. The length ofthe haplotypes varies between 33 and 69 Kb, and the haplotypes cover one or two blocks of linkage disequilibrium.
Both series of haplotypes contain the common allele 2 ofthe SNP SG13S25. All haplotypes in the A series contain the SNP DGOOAAHID, while all haplotypes in the B series contain the SNP DGOOAAHII. In the B series, the haplotypes B4, B5, and B6 have a relative risk (RR) greater than 2 and with allelic frequencies above 10%. The haplotypes in the A series have slightly lower RR and lower p-values, but higher frequency (15-16%). The haplotypes in series B and A are strongly correlated, i.e. the haplotypes in B define a subset ofthe haplotypes in A. Hence, haplotypes in series B are more specific than A. However, haplotypes in series A are more sensitive, i.e. they capture more individuals with the putative mutation, as is observed in the population attributable risk which is less for B than for A. Furthermore, these haplotypes show similar risk ratios and allelic frequencies for early-onset patients (defined as onset of first MI before the age of 55) and for both genders. In addition, analyzing various groups of patients with known risk factors, such as hypertension, high cholesterol, smoking and diabetes, do not reveal any significant correlation with these haplotypes, suggesting that the haplotypes in the FLAP gene represent an independent genetic susceptibility factor for MI. The FLAP nucleic acid encodes a 5-lipoxygenase activating protein, which, in combination with 5-lipoxygenase (5-LO), is required for leukotriene synthesis. FLAP acts coordinately with 5-LO to catalyze the first step in the synthesis of leukotrienes from arachidonic acid. It catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,ll,14-cis-eicosatetraenoic acid (5-HPETE), and further to the allylic epoxide 5 (S)-trans7,9 trans 11,14-cis- eicosatetraenoic acid (leukotriene A4, LTA4). The leukotrienes are a family of highly potent biological mediators of inflammatory processes produced primarily by bone marrow derived leukocytes such as monocytes, macrophages, and neurophils. Both FLAP and 5-LO are detected within atherosclerosis lesions, indicating that the vessel itself can be a source of leukotrienes. It is demonstrated herein that the MI- risk FLAP haplotype is associated with higher serum leukotriene levels. Increased production of leukotriene in individuals with pre-existing atherosclerosis lesions may lead to plaque instability or friability ofthe fibrous cap leading to local thrombotic events. If this occurs in coronary artery arteries it leads to MI or unstable angina. If it occurs in the cerebrovasculature it leads to stroke or transient ischemic attack. If it occurs in large arteries to the limbs, it causes or exacerbates limb ischemia in persons with peripheral arterial occlusive disease. Therefore, those with genetically influenced predisposition to produce higher leukotriene levels have higher risk for events due to pre-existing atherosclerosis such as MI.
Inhibitors of FLAP function impede translocation of 5-LO from the cytoplasm to the cell membrane and inhibit activation of 5-LO and thereby decrease leukotriene synthesis.
As a result of these discoveries, methods are now available for the treatment of myocardial infarction (MI) and acute coronary syndrome (ACS) through the use of leukotriene inhibitors, such as agents that inhibit leukotriene biosynthesis or antagonize signaling through leukotriene receptors.
The term, "treatment" as used herein, refers not only to ameliorating symptoms associated with the disease or condition, but also preventing or delaying the onset ofthe disease or condition; preventing or delaying the occurrence of a second episode ofthe disease or condition; and/or also lessening the severity or frequency of symptoms of the disease or condition.
In the case of atherosclerosis, "treatment" also refers to a minimization or reversal ofthe development of plaques. Methods are additionally available for assessing an individual's risk for MI or ACS. In preferred embodiment, the individual to be treated is an individual who is susceptible (at increased risk) for MI or ACS, such as an individual who is in one ofthe representative target populations described herein. REPRESENTATINETARGETPOPULATIONS
In one embodiment ofthe invention, an individual who is at risk for MI or ACS is an individual who has an at-risk haplotype in FLAP, as described herein.. In one embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers DGOOAAFIU, SG13S25, DG00AAJFF, DG00AAHII, SG13S32 and SG13S35 at the 13ql2 locus. In another embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers DGOOAAFIU, SG13S25, DG00AAHII, SG13S30 and SG13S42 at the 13ql2 locus, h a third embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers SG13S25, DG00AAHII, SG13S30 and SG13S42 at the 13ql2 locus. In a fourth embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers DGOOAAFIU, SG13S25, DGOOAAHID, B_SNP_310657 and SG13S32 at the
13ql2 locus, hi a fifth embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers SG13S25, DGOOAAHID, B_SNP_310657 and SG13S32 at the 13ql2 locus. Increased risk for MI or ACS in individuals with a FLAP at-risk haplotype is logically conferred by increased production of leukotrienes in the arterial vessel wall or in bone-marrow derived inflammatory cells within the blood and/or arterial vessel wall. It is shown herein that FLAP at-risk haplotypes are associated with high serum leukotriene E4 levels. It is further shown herein that serum leukotriene levels (specifically, leukotrieneE4) correlate with serum CRP levels in myocardial infarction patients. Therefore, FLAP genetic variation drives high leukotriene levels (within the blood vessel and/or systemically) which in turn drive higher CRP levels which has been shown as a risk factor for MI. Accordingly, individuals with a FLAP at-risk haplotype are likely to have elevated serum C-reactive protein. The level of serum C-reactive protein can be used as a surrogate for the level of arterial wall inflammation initiated by lipid deposition and athero genesis conferred by the presence ofthe at-risk FLAP haplotype.
In another embodiment ofthe invention, an individual who is at risk for MI or ACS is an individual who has a polymorphism in a FLAP gene, in which the presence of the polymorphism is indicative of a susceptibility to MI or ACS. The term "gene," as used herein, refers to not only the sequence of nucleic acids encoding a polypeptide, but also the promoter regions, transcription enhancement elements, splice donor/acceptor sites, and other non-transcribed nucleic acid elements. Representative polymorphisms include those presented in Table 3, below.
In a further embodiment ofthe invention, an individual who is at risk for MI or ACS is an individual who has an at-risk polymorphism in the 5-LO gene in the promoter region, as described herein.
In a fourth embodiment, an individual who is at risk for MI or ACS is an individual who has an elevated inflammatory marker. An "elevated inflammatory marker," as used herein, is the presence of an amount of an inflammatory marker that is greater, by an amount that is statistically significant, than the amount that is typically found in control individual(s) or by comparison of disease risk in a population associated with the lowest band of measurement (e.g. , below the mean or median, the lowest quartile or the lowest quintile) compared to higher bands of measurement (e.g., above the mean or median, the second, third or fourth quartile; the second, third, fourth or fifth quintile). An "inflammatory marker" refers to a molecule that is indicative ofthe presence of inflammation in an individual, for example, C- reactive protein (CRP), serum amyloid A, fibrinogen, leukotriene levels (e.g., leukotriene E4), leukotriene metabolites (e.g., cysteinyl leukotriene 1), interleukin-6, tissue necrosis factor-alpha, soluble vasculare cell adhesion molecules (sNCAM), soluble intervascular adhesion molecules (sICAM), E- selectin, matrix metalloprotease type-1, matrix metalloprotease type-2, matrix metalloprotease type-3, and matrix metalloprotease type-9) or other markers
(see, e.g., Doggen, C.J.M. et al, J. Internal Med, 2 5:406-414 (2000); Ridker, P.M. et al, New Englnd. J. Med. 1997: 336: 973-979, Rettersol, L. et al, 2002: 160:433-440; Ridker, P.M. et. al, New England. J. Med., 2002: 347: 1557-1565; Bermudez, E.A. et .al., Arterioscler. Thromb. Vase. Biol. , 2002: 22:1668-1673). In certain embodiments, the presence of such inflammatory markers can be measured in serum or urine.
In a fifth embodiment, an individual who is at risk for MI or ACS is an individual who has increased LDL cholesterol and/or decreased HDL cholesterol levels. For example, the American Heart Association indicates that an LDL cholesterol level of less than 100 mg/dL is optimal; from 100-129 mg/dL is near/above optimal; from 130-159 mg/dL is borderline high; from
160-189 is high; and from 190 and up is very high. Therefore, an individual who is at risk for MI or ACS because of an increased LDL cholesterol level is, for example, an individual who has more than 100 mg/dL cholesterol, such as an individual who has a near/above optimal level, a borderline high level, a high level or a very high level. Similarly, the American Heart Association indicates that an HDL cholesterol level of less than 40 mg/dL is a major risk factor for heart disease; and an HDL cholesterol level of 60 mg/dL or more is protective against heart disease. Thus, an individual who is at risk for MI or ACS because of a decreased HDL cholesterol level is, for example, an individual who has less than 60 mg/dL HDL cholesterol, such as an individual who has less than 40 mg/dL HDL cholesterol.
In a sixth embodiment, an individual who is at risk for MI or ACS is an individual who has increased leukotriene synthesis. "Increased leukotriene synthesis," as used herein, indicates an amount of production of leukotrienes that is greater, by an amount that is statistically significant, than the amount of production of leukotrienes that is typically found in control individual(s) or by comparison of leukotriene production in a population associated with the lowest band of measurement (e.g., below the mean or median, the lowest quartile or the lowest quintile) compared to higher bands of measurement (e.g. , above the mean or median, the second, third or fourth quartile; the second, third, fourth or fifth quintile). For example, the FLAP at-risk haplotypes correlate with increased serum leukotriene synthesis levels. An individual can be assessed for the presence of increased leukotriene synthesis by a variety of methods. For example, an individual can be assessed for an increased risk of MI, ACS or atherosclerosis, by assessing the level of a leukotriene metabolite (e.g., LTE4) in a sample (e.g., serum, plasma or urine) from the individual. An increased level of leukotriene metabolites is indicative of increased production of leukotrienes, and of an increased risk of MI, ACS or atherosclerosis.
In a further embodiment, an individual who is at risk for MI or ACS is an individual who has already experienced at least one MI or ACS event, or who has stable angina, and is therefore at risk for a second MI or ACS event. In another embodiment, an individual who is at risk for MI or ACS is an individual who has atherosclerosis or who requires treatment (e.g., angioplasty, stents, coronary artery bypass graft) to restore blood flow in arteries.
In additional embodiments, an individual who is at risk for MI or ACS is an individual who has diabetes; hypertension; hypercholesterolemia; elevated lp(a); obesity; and/or is a past or current smoker.
Individuals at risk for MI or ACS may fall into more than one of these representative target populations. For example, an individual may have experienced at least one MI or ACS event, and may also have an increased level of an inflammatory marker. As used therein, the term "individual in a target population" refers to an individual who is at risk for MI or ACS who falls into at least one ofthe representative target populations described above.
ASSESSMENT FOR AT-RISK HAPLOTYPES
A "haplotype," as described herein, refers to a combination of genetic markers ("alleles"), such as those set forth in Table 3. In a certain embodiment, the haplotype can comprise one or more alleles, two or more alleles, three or more alleles, four or more alleles, or five or more alleles. The genetic markers are particular "alleles" at "polymorphic sites" associated with FLAP. A nucleotide position at which more than one sequence is possible in a population (either a natural population or a synthetic population, e.g., a library of synthetic molecules), is referred to herein as a "polymorphic site". Where a polymorphic site is a single nucleotide in length, the site is referred to as a single nucleotide polymorphism ("SNP"). For example, if at a particular chromosomal location, one member of a population has an adenine and another member ofthe population has a thymine at the same position, then this position is a polymorphic site, and, more specifically, the polymorphic site is a SNP. Polymorphic sites can allow for differences in sequences based on substitutions, insertions or deletions. Each version ofthe sequence with respect to the polymorphic site is referred to herein as an "allele" ofthe polymorphic site. Thus, in the previous example, the SNP allows for both an adenine allele and a thymine allele.
Typically, a reference sequence is referred to for a particular sequence. Alleles that differ from the reference are referred to as "variant" alleles. For example, the reference FLAP sequence is described herein by SEQ ID NO:l. The term, "variant FLAP", as used herein, refers to a sequence that differs from SEQ ID NO:l, but is otherwise substantially similar. The genetic markers that make up the haplotypes described herein are FLAP variants. Additional variants can include changes that affect a polypeptide, e.g. , the FLAP polypeptide. These sequence differences, when compared to a reference nucleotide sequence, can include the insertion or deletion of a single nucleotide, or of more than one nucleotide, resulting in a frame shift; the change of at least one nucleotide, resulting in a change in the encoded amino acid; the change of at least one nucleotide, resulting in the generation of a premature stop codon; the deletion of several nucleotides, resulting in a deletion of one or more amino acids encoded by the nucleotides; the insertion of one or several nucleotides, such as by unequal recombination or gene conversion, resulting in an interruption ofthe coding sequence of a reading frame; duplication of all or a part of a sequence; transposition; or a rearrangement of a nucleotide sequence, as described in detail above. Such sequence changes alter the polypeptide encoded by a FLAP nucleic acid. For example, if the change in the nucleic acid sequence causes a frame shift, the frame shift can result in a change in the encoded amino acids, and/or can result in the generation of a premature stop codon, causing generation of a truncated polypeptide. Alternatively, a polymorphism associated with MI or a susceptibility to MI can be a synonymous change in one or more nucleotides (i.e., a change that does not result in a change in the amino acid sequence). Such a polymorphism can, for example, alter splice sites, affect the stability or transport of mRNA, or otherwise affect the transcription or translation ofthe polypeptide. The polypeptide encoded by the reference nucleotide sequence is the "reference" polypeptide with a particular reference amino acid sequence, and polypeptides encoded by variant alleles are referred to as "variant" polypeptides with variant amino acid sequences.
Haplotypes are a combination of genetic markers, e.g., particular alleles at polymorphic sites. The haplotypes described herein, e.g., having markers such as those shown in Table 3, are found more frequently in individuals with MI than in individuals without MI. Therefore, these haplotypes have predictive value for detecting MI or a susceptibility to MI in an individual. The haplotypes described herein are in some cases a combination of various genetic markers, e.g., SNPs and microsatellites.
Therefore, detecting haplotypes can be accomplished by methods known in the art for detecting sequences at polymorphic sites, such as the methods described above.
In certain methods described herein, an individual who is at risk for MI or ACS is an individual in whom an at-risk haplotype is identified. In one embodiment, the at-risk haplotype is one that confers a significant risk of MI. In one embodiment, significance associated with a haplotype is measured by an odds ratio. In a further embodiment, the significance is measured by a percentage. In one embodiment, a significant risk is measured as an odds ratio of at least about 1.2, including by not limited to: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9. In a further embodiment, an odds ratio of at least 1.2 is significant. In a further embodiment, an odds ratio of at least about 1.5 is significant. In a further embodiment, a significant increase in risk is at least about 1.7 is significant. In a further embodiment, a significant increase in risk is at least about 20%, including but not limited to about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 98%. In a ftirther embodiment, a significant increase in risk is at least about 50%. It is understood however, that identifying whether a risk is medically significant may also depend on a variety of factors, including the specific disease, the haplotype, and often, environmental factors. An at-risk haplotype in, or comprising portions of, the FLAP gene, in one where the haplotype is more frequently present in an individual at risk for MI or ACS (affected), compared to the frequency of its presence in a healthy individual (control), and wherein the presence ofthe haplotype is indicative of MI or ACS or susceptibility to MI or ACS. Standard techniques for genotyping for the presence of SNPs and/or microsatellite markers can be used, such as fluorescent based techniques (Chen, et al, Genome Res. 9, 492 (1999)), PCR, LCR, Nested PCR and other techniques for nucleic acid amplification. In a preferred embodiment, the method comprises assessing in an individual the presence or frequency of SNPs and/or microsatellites in, comprising portions of, the FLAP gene, wherein an excess or higher frequency ofthe SNPs and/or microsatellites compared to a healthy control individual is indicative that the individual has MI or ACS, or is susceptible to MI or ACS. See, for example, Table 3 (below) for SNPs and markers that can form haplotypes that can be used as screening tools. These markers and SNPs can be identified in at-risk haploptypes. For example, an at-risk haplotype can include microsatellite markers and/or SNPs such as those set forth in Table 3. The presence ofthe haplotype is indicative of MI or ACS, or a susceptibility to MI or ACS, and therefore is indicative of an individual who falls within a target population for the treatment methods described herein. Haplotype analysis involves defining a candidate susceptibility locus using LOD scores. The defined regions are then ultra-fine mapped with microsatellite markers with an average spacing between markers of less than 100Kb. All usable microsatellite markers that found in public databases and mapped within that region can be used. In addition, microsatellite markers identified within the deCODE genetics sequence assembly ofthe human genome can be used. The frequencies of haplotypes in the patient and the control groups using an expectation-maximization algorithm can be estimated (Dempster A. et al, 1977. J. R. Stot. Soc. B, 39:1-389). An implementation of this algorithm that can handle missing genotypes and uncertainty with the phase can be used. Under the null hypothesis, the patients and the controls are assumed to have identical frequencies. Using a likelihood approach, an alternative hypothesis where a candidate at-risk-haplotype, which can include the markers described herein, is allowed to have a higher frequency in patients than controls, while the ratios ofthe frequencies of other haplotypes are assumed to be the same in both groups is tested. Likelihoods are maximized separately under both hypotheses and a corresponding 1-df likelihood ratio statistics is used to evaluate the statistic significance.
To look for at-risk-haplotypes in the 1-lod drop, for example, association of all possible combinations of genotyped markers is studied, provided those markers span a practical region. The combined patient and control groups can be randomly divided into two sets, equal in size to the original group of patients and controls. The haplotype analysis is then repeated and the most significant p-value registered is determined. This randomization scheme can be repeated, for example, over 100 times to construct an empirical distribution of p-values. h one embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers DGOOAAFIU, SG13S25, DG00AAJFF, DGOOAAHII, SG13S32 and SG13S35 at the 13ql2 locus. In another embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers DGOOAAFIU, SG13S25, DGOOAAHII, SG13S30 and SG13S42 at the 13ql2 locus. In a third embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers SG13S25, DGOOAAHII, SG13S30 and SG13S42 at the 13ql2 locus. In a fourth embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers DGOOAAFIU, SG13S25, DGOOAAHID, B_SNP_310657 and SG13S32 at the 13ql2 locus.
METHODS OF THERAPY
The present invention encompasses methods of treatment (prophylactic and/or therapeutic) for MI or ACS in individuals, such as individuals in the target populations described above, as well as for other diseases and conditions associated with FLAP or with other members ofthe leukotriene pathway (e.g., for atherosclerosis). Members ofthe "leukotriene pathway," as used herein, include polypeptides (e.g., enzymes, receptors) and other molecules that are associated with production of leukotrienes: for example, enzymes such as FLAP, 5-LO, other leukotriene biosynthetic enzymes (e.g., leukotriene C4 synthetase, leukotriene A4 hydrolase); receptors or binding agents ofthe enzymes; leukotrienes such as LTA4, LTB4, LTC4, LTD4, LTE4, Cys LTl, and Cys LT2; and receptors of leukotrienes (e.g., leukotriene B4 receptor 1 (BLTl), leukotriene B4 receptor 2 (BLT2), cysteinyl leukotriene receptor 1 (CysLTRl), cysteinyl leukotriene receptor 2 (CysLTR2)).
In particular, the invention relates to methods of treatment for myocardial infarction or susceptibility to myocardial infarction (for example, for individuals in an at-risk population such as those described above); as well as methods of treatment for acute coronary syndrome (e.g., unstable angina, non-ST-elevation myocardial infarction (NSTEMI) or ST-elevation myocardial infarction (STEMI)); for decreasing risk of a second myocardial infarction; for atherosclerosis, such as for patients requiring treatment (e.g., angioplasty, stents, coronary artery bypass graft) to restore blood flow in arteries (e.g., coronary arteries); and/or for decreasing leukotriene synthesis (e.g., for treatment of MI or ACS). . The invention additionally pertains to use of one or more leukotriene synthesis inhibitors, as described herein, for the manufacture of a medicament for the treatment of MI, ACS, and/or atherosclerosis, e.g., using the methods described herein. In the methods ofthe invention, a "leukotriene synthesis inhibitor" is used.
In one embodiment, a "leukotriene synthesis inhibitor" is an agent that inhibits FLAP polypeptide activity and/or FLAP nucleic acid expression, as described herein (e.g., a nucleic acid antagonist), another embodiment, a leukotriene synthesis inhibitor is an agent that inhibits polypeptide activity and/or nucleic acid expression of another member ofthe leukotriene biosynthetic pathway (e.g., 5-LO; LTC4S; LTA4H; LTB4DH). In still another embodiment, a leukotriene synthesis inhibitor is an agent that alters activity or metabolism of a leukotriene (e.g., an antagonist of a leukotriene; an antagonist of a leukotriene receptor), i preferred embodiments, the leukotriene synthesis inhibitor alters activity and/or nucleic acid expression of FLAP or of 5-LO, or alters interaction between FLAP and 5-LO.
Leukotriene synthesis inhibitors can alter polypeptide activity or nucleic acid expression of a member ofthe leukotriene pathway by a variety of means, such as, for example, by catalytically degrading, downregulating or interfering with the expression, transcription or translation of a nucleic acid encoding the member ofthe leukotriene pathway; by altering posttranslational processing ofthe polypeptide; by altering transcription of splicing variants; or by interfering with polypeptide activity (e.g., by binding to the polypeptide, or by binding to another polypeptide that interacts with that member ofthe leukotriene pathway, such as a FLAP binding agent as described herein or some other binding agent of a member ofthe leukotriene pathway; by altering interaction among two or more members ofthe leukotriene pathway (e.g., interaction between FLAP and 5-LO); or by antagonizing activity of a member ofthe leukotriene pathway. Representative leukotriene synthesis inhibitors include the following: agents that inhibit activity of a member ofthe leukotriene biosynthetic pathway (e.g., FLAP, 5-LO), LTC4S, LTA4H, LTB4DH, such as the agents presented in the Agent Table below;
agents that inhibit activity of receptors of members ofthe leukotriene pathway, such as FLAP receptors, LTA4 receptors, LTB4 receptors, LTC4 receptors, LTD4 receptors, TLE4 receptors, Cys LTl receptors, Cys LT2 receptors, 5-LO receptors; BLTl; BLT2; CysLTRl; CysLTR2; agents that bind to the members ofthe leukotriene pathway, such as FLAP binding agents (e.g., 5-LO), agents that bind to receptors of members ofthe leukotriene pathway (e.g., leukotriene receptor antagonists); or agents that bind to a leukotriene (e.g., to LTA4, LTB4, LTC4, LTD4, LTE4, Cys LTl, Cys LT2) or otherwise affect (e.g., increase or decrease) activity ofthe leukotriene;
antibodies to leukotrienes;
antisense nucleic acids or small double-stranded interfering RNA, to nucleic acids encoding FLAP, 5-LO, or a leukotriene synthetase or other member ofthe leukotriene pathway, or fragments or derivatives thereof, including antisense nucleic acids to nucleic acids encoding the FLAP, 5-LO or leukotriene synthetase polypeptides, and vectors comprising such antisense nucleic acids (e.g., nucleic acid, cDNA, and/or mRNA, double-stranded interfering RNA, or a nucleic acid encoding an active fragment or derivative thereof, or an oligonucleotide; for example, the complement of one of SEQ ID Nos. 1 or 3, or a nucleic acid complementary to the nucleic acid encoding SEQ ID NO: 2, or fragments or derivatives thereof); peptidomimetics; fusion proteins or rodrugs thereof; ribozymes; other small molecules; and
other agents that alter (e.g., inhibit or antagonize) expression of a member ofthe leukotriene pathway, such as FLAP or 5-LO nucleic acid expression or polypeptide activity, or that regulate transcription of FLAP splicing variants or 5-LO splicing variants (e.g., agents that affect which splicing variants are expressed, or that affect the amount of each splicing variant that is expressed).
More than one leukotriene synthesis inhibitor can be used concurrently, if desired.
The therapy is designed to alter activity of a FLAP polypeptide, a 5- LO polypeptide, or another member ofthe leukotriene pathway in an individual, such as by inhibiting or antagonizing activity. For example, a leukotriene synthesis inhibitor can be administered in order to decrease synthesis of leukotrienes within the individual, or to downregulate or decrease the expression or availability o the FLAP nucleic acid or specific splicing variants ofthe FLAP nucleic acid. Downregulation or decreasing expression or availability of a native FLAP nucleic acid or of a particular splicing variant could minimize the expression or activity of a defective nucleic acid or the particular splicing variant and thereby minimize the impact ofthe defective nucleic acid or the particular splicing variant. Similarly, for example, a leukotriene synthesis inhibitor can be admmistered in order to downregulate or decrease the expression or availability ofthe nucleic acid encoding 5-LO or specific splicing variants ofthe nucleic acid encoding 5-LO.
The leukotriene synthesis inhibitor(s) are administered in a therapeutically effective amount (i.e., an amount that is sufficient to treat the disease or condition, such as by ameliorating symptoms associated with the disease or condition, preventing or delaying the onset ofthe disease or condition, and/or also lessening the severity or frequency of symptoms ofthe disease or condition). The amount which will be therapeutically effective in the treatment of a particular individual's disease or condition will depend on the symptoms and severity ofthe disease, and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness ofthe disease or disorder, and should be decided according to the judgment of a practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
In preferred embodiments ofthe invention, the leukotriene synthesis inhibitor agent is an agent that inhibits activity of FLAP and or of 5-LO. Preferred agents include the following, as set forth in the Agent Table:
<img file="WO2004035741A2_D0001.tif" />
<img file="WO2004035741A2_D0002.tif" />
In preferred methods of he invention, the agents set forth in the Agent Table can be used for prophylactic and/or therapeutic treatment for diseases and conditions associated with FLAP or with other members ofthe leukotriene pathway, or with increased leukotriene synthesis. In particular, they can be used for treatment for myocardial infarction or susceptibility to myocardial infarction, such as for individuals in an at-risk population as described above, (e.g. , based on identified risk factors such as elevated cholesterol, elevated C- reactive protein, and/or genotype); for individuals suffering from acute coronary syndrome, such as unstable angina, non-ST-elevation myocardial infarction (NSTEMI) or ST-elevation myocardial infarction (STEMI); for decreasing risk of a subsequent myocardial infarction, such as in individuals who have already had one or more myocardial infarctions; for treatment of atherosclerosis, such as in patients requiring treatment (e.g., angioplasty, stents, coronary artery bypass graft) to restore blood flow in arteries (e.g., coronary arteries); and/or for decreasing leukotriene synthesis (e.g., for treatment of myocardial infarction).
In one preferred embodiment ofthe invention, the leukotriene synthesis inhibitor is an inhibitor of FLAP such as l-((4- chlorophenyl)methyl)-3-((l,l-dimethylethyl)thio)-alpha,alpha-dimethyl-5-( 2- quinolinylmethoxy)- lH-Indole-2-propanoic acid otherwise known as MK- 0591 , (R)-(+)-alpha-cyclopentyl-4-(2-quinolinylmethoxy)-Benzeneacetic acid otherwise known as BAY-x-1005, 3-(3-(l<sub>J</sub>l-dimethylethylthio-5-(quinoline-2- ylmethoxy)- 1 -(4-chloromethylphenyl)indole-2-yl)-2,2- dimethylpropionaldehyde oxime-0-2-acetic acid otherwise known as A-81834, their optically pure enantiomers, salts, chemical derivatives, analogues, or other compounds inhibiting FLAP that effectively decrease leukotriene biosynthesis when administered to humans. In another preferred embodiment ofthe invention, the leukotriene synthesis inhibitor is an inhibitor of 5LO such as zileuton, atreleuton, 6-((3- fluoro-5-(tetrahydiO-4-methoxy-2H-pyran-4yl)phenoxy)methyl)-l-methyl- 2(lH)-quinlolinone otherwise known as ZD-2138, l-((4- chlorophenyl)methyl)-3 -((1,1 dimethylethyl)thio)-alpha,alpha-dimethyl-5 -( 2- quinolinylmethoxy)-lH-Indole-2-propanoic acid otherwise known as MK-886, 4-(3-(4-(2-Methyl-imidazol-l-yl)-phenylsulfanyl)-phenyl)-tetrahydro-pyran-4- carboxylic acid amide otherwise known as CJ-13610, their optically pure enantiomers, salts, chemical derivatives, analogues or other compounds inhibiting 5-LO that effectively decrease leukotriene biosynthesis when administered to humans.
The compound can be represented by the following formula:
<img file="WO2004035741A2_D0003.tif" />
or a pharmaceutically acceptable salt thereof, wherein M is selected from the group consisting of hydrogen, a pharmaceutically acceptable cation, and a pharmaceutically acceptable metabolically cleavable group; B is a straight or branched divalent alkylene group of from one to twelve carbon atoms; Z is thiazolyl, optionally substituted with alkyl of from one to six carbon atoms or haloalkyl of from one to six carbon atoms; L is selected from the group consisting of (a) alkylene of from 1-6 carbon atoms, (b) alkenylene of from 2-6 carbon atoms, (c) alkynylene of from 2-6 carbon atoms, (d) hydroxyalkyl of 1-6 carbon atoms, (e) >C=O, (f) >C=N-OR<sub>1;</sub> where Ri is hydrogen or d -C<sub>6</sub> alkyl, (g) - (CHRl)<sub>n</sub> (CO)(CHR<sub>2</sub>)<sub>m</sub>, where n and are independently selected from an integer from one to six and Ri and R<sub>2</sub> are independently selected from hydrogen and d - C<sub>6</sub> -alkyl, (h) ~(CHRι)<sub>n</sub> C=NOR<sub>2</sub>, where Ri, R<sub>2</sub> and n are as defined above; (i) - (CHRι)<sub>n</sub> ON=CR<sub>2</sub>, where R<sub>h</sub> R<sub>2</sub> and n are as: defined above; (j) -(CHRι)<sub>n</sub> -O- (CHR<sub>2</sub>)<sub>m</sub> -, where Ri, R , n and m are as defined above, (k) -(CHRι)<sub>n</sub> -NR<sub>2</sub> (CHR<sub>3</sub>)<sub>m</sub> -, where Ri, R<sub>2</sub>, n and m are as defined above and R<sub>3</sub> is selected from hydrogen and Ci -C<sub>6</sub> -alkyl; (1) -(CHRι)<sub>n</sub> -S- CHR<sub>2</sub>)<sub>m</sub> -, where R<sub>ls</sub> R<sub>2</sub>, n and m are as defined above; and (m) -(CHRι)<sub>n</sub> -(SO<sub>2</sub>)-(CHR )<sub>m</sub> -, where Ri, R , n and are as defined above; A is carbocyclic aryl optionally substituted with alkyl of from one to six carbon atoms, haloalkyl of from one to six carbon atoms, hydroxyalkyl of from one to six carbon atoms, alkoxy of from one to twelve carbon atoms, alkoxyalkoxyl in which the two alkoxy portions may each independently contain from one to six carbon atoms, alkylthio of from one to six carbon atoms, hydroxy, halogen, cyano, amino, alkylamino of from one to six carbon atoms, dialkylamino in which the two alkyl groups may independently contain from one to six carbon atoms, alkanoylamino of from two to eight carbon atoms, N-alkanoyl-N- alkylamino in which the alkanoyl is of from two to eight carbon atoms and the alkyl group is of from one to six carbon atoms, alkylaminocarbonyl of from two to eight carbon atoms, dialkylaminocarbonyl in which the two alkyl groups are independently of from one to six carbon atoms, carboxyl, alkoxycarbonyl or from two to eight carbon atoms, phenyl, optionally substituted with alkyl of from one to six carbon atoms, haloalkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, hydroxy or halogen, phenoxy, optionally substituted with alkyl of from one to six carbon atoms, haloalkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, hydroxy or halogen, and phenylthio, optionally substituted with alkyl of from one to six carbon atoms, haloalkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, hydroxy or halogen. Preferably, the compound is a compound or pharmaceutically acceptable salt thereof having the name (R)-N-{3-[-5-(4-fluorophenylmethyl)thiazo-2-yl]- lmethyl-2-propynyl}-N-hydroxyurea. See U.S. Patent No. 4,615,596, incorporated herein by reference. The compound is represented by the following formula:
<img file="WO2004035741A2_D0004.tif" /> or a pharmaceutically acceptable salt thereof, wherein A is selected from the group consisting of straight or branched divalent alkylene of from one to twelve carbon atoms and divalent cycloalkylene of from three to eight carbon atoms; j is selected from the group consisting of hydrogen, alkylthio of from one to six carbon atoms, phenylthio, optionally substituted with alkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, or halogen, phenylalkylthio in which the alkyl portion contains from one to six carbon atoms, and the phenyl group is optionally substituted with alkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, or halogen, R<sub>2</sub> is selected from the group consisting of -COOB wherein B is selected from hydrogen, a pharmaceutically acceptable cation, or a metabolically cleavable group, - COOalkyl where the alkyl portion contains from one to six carbon atoms, - COOalkylcarbocyclicaryl where the alkyl portion contains from one to six carbon atoms and the aryl portion is optionally substituted with alkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, or halogen, -CONR<sub>5</sub> Rs wherein R<sub>5</sub> is selected from the group consisting of hydrogen, hydroxyl, alkyl of from one to six carbon atoms, and alkoxy of from one to six carbon atoms, and R<sub>6</sub> is selected from the group consisting of hydrogen and alkyl of from one to six carbon atoms, -COR<sub>6</sub>, and -OH; R<sub>3</sub> is selected from the group consisting of phenylalkyl in which the alkyl portion contains from one to six carbon atoms, and the phenyl group is optionally substituted with alkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, or halogen, 4 is selected from the group consisting of thiazolylalkyloxy in which the alkyl portion contains from one to six carbon atoms, and the heteroaryl portion is optionally substituted with alkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, or halogen, and thiazolyloxy optionally substituted with alkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, or halogen. See U.S. Patent No. 5,288,743, incorporated herein by reference. The compound can be represented by the formula:
<img file="WO2004035741A2_D0005.tif" />
or a pharmaceutically acceptable salt thereof, wherein M is selected from the group consisting of hydrogen, and a pharmaceutically acceptable cation;
B is a straight or branched divalent alkylene group of from one to twelve carbon atoms; Z is selected from the group consisting of: (a) furyl, optionally substituted with alkyl of from one to six carbon atoms, or haloalkyl of from one to six carbon atoms, and (b) thienyl, optionally substituted with alkyl of from one to six carbon atoms, or haloalkyl of from one to six carbon atoms; and L is alkylene of from 1-6 carbon atoms; A is phenyl optionally substituted with alkyl of from one to six carbon atoms, haloalkyl of from one to six carbon atoms, hydroxyalkyl of from one to six carbon atoms, alkoxy of from one to twelve carbon atoms, alkoxyalkoxyl in which the two alkoxy portions may each independently contain from one to six carbon atoms, alkylthio of from one to six carbon atoms, hydroxy, halogen, cyano, amino, alkylamino of from one to six carbon atoms, dialkylamino in which the two alkyl groups may independently contain from one to six carbon atoms, alkanoylamino of from two to eight carbon atoms, N-alkanoyl-N- alkylamino in which the alkanoyl is of from two to eight carbon atoms and the alkyl group is of from one to six carbon atoms, alkylaminocarbonyl of from two to eight carbon atoms, dialkylaminocarbonyl in which the two alkyl groups are independently of from one to six carbon atoms, carboxyl, alkoxycarbonyl of from two to eight carbon atoms, phenyl, optionally substituted with alkyl of from one to six carbon atoms, haloalkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, hydroxy or halogen, phenoxy, optionally substituted with alkyl of from one to six carbon atoms, haloalkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, hydroxy or halogen, or phenylthio, optionally substituted with alkyl of from one to six carbon atoms, haloalkyl of from one to six carbon atoms, alkoxy of from one to six carbon atoms, hydroxy or halogen. Preferably, the compound is a compound or a pharmaceutically acceptable salt thereof selected from the group consisting of: N-{3-(5-(4-fluorophenylmethyl)fur-2-yl)-3- butyn-2-yl}-N-hydroxyurea; N-{3-(5-(4-fluorophenylmethyl)-2-thienyl)-l- methyl-2-proρynyl} -N-hydroxyurea; (R)-N- {3 -(5 -(4-fluorophenylmethyl)-2- thienyl)-l-methyl-2-propynyl}-N-hydroxyurea; and (R)-N-{3-(5-(4- chlorophenylmethyl)-2-thienyl)-l -methyl-2-propynyl} -N-hydroxyurea; (S)-N- {3- [5-(4-fluorophenylmethyl)-2-thienyl]-l-methyl-2-propynyl} -N-hydroxyurea. See U.S. Patent No. 5,288,751, incoφorated by reference herein. The compound can be represented by the formula:
<img file="WO2004035741A2_D0006.tif" />
or a pharmaceutically acceptable salt thereof, wherein A is selected from the group consisting of straight or branched divalent alkylene of one to twelve carbon atoms, straight or branched divalent alkenylene of two to twelve carbon atoms, and divalent cycloalkylene of three to eight carbon atoms; R<sup>1</sup> is alkylthio of one to six carbon atoms; R<sup>6</sup> is selected from the group consisting of hydrogen and alkyl of one to six carbon atoms; R<sup>7</sup> is selected from the group consisting of (carboxyl)alkyl in which the alkyl portion is of one to six carbon atoms, (alkoxycarbonyl)alkyl in which the alkoxycarbonyl portion is of two to six carbon atoms and the alkyl portion is of one to six carbon atoms, (aminocarbonyl)alkyl in which the alkyl portion is of one to six carbon atoms, ((alkylamino)carbonyl)alkyl in which each alkyl portion independently is of one to six carbon atoms, and ((dialkylamino)carbonyl)alkyl in which each alkyl portion independently is of one to six carbon atoms; R<sup>3</sup> is phenylalkyl in which the alkyl portion is of one to six carbon atoms; R<sup>4</sup> is 2-, 3- or 6-quinolylmethoxy, optionally substituted with alkyl of one to six carbon atoms, haloalkyl of one to six carbon atoms, alkoxy of one to twelve carbon atoms, halogen, or hydroxy. Preferably the compound is selected from the group consisting of: 3-(3-l,l-dimethylethylthio)-5-(quinolin-2- ylrnethoxy- 1 -(4-chlorophenylmethyl )-indol-2-yl)-2,2-dimethylρropionaldehyde oxime-O-2 acetic acid; 3-(3-(l,l-dimethylethylthio)-5-(quinolin-2-ylmethoxy)-l- (4-chloro-phenylmethyl) indol-2-yl)-2,2-dimethylpropionaldehyde oxime-O-2-(3- methyl)butyric acid; 3-(3-(l,l-dimethylethylthio)-5-(6,7-dichloroquinolin-2- ylmethoxy)- 1 -(4-chlorophenylmethyl) indol-2-yl)-2,2-dimethylpropionaldehyde oxime-O-2-acetic acid; and 3-(3-(l,l-dimethylethylthio)-5-(6-fluoroquinolin-2- ylmethoxy)-l -(4chlorophenylmethyl) indol-2-yl)-2,2 -dimethylpropionaldehyde oxime-O-2-propionic acid; or a pharmaceutically acceptable salt or ester thereof. See U.S. Patent No. 5,459,150, incoφorated by reference herein. The compound can be represented by the formula:
Q<sup>1</sup> -X- -Ar CT
or pharmaceutically acceptable salts thereof , wherein Q is a 9-, 10- or 11- membered bicyclic heterocyclic moiety containing one or two nitrogen heteroatoms and optionally containing a further heteroatom selected from nitrogen, oxygen and sulphur, and Q may optionally bear up to four substituents selected from halogeno, hydroxy, cyano, formyl, oxo, thioxo, (l-4C)alkyl, (3- 4C)alkenyl, (3-4C)alkynyl, (l-4C)alkoxy, fluoro-(l-4C)alkyl, hydroxy-(l- 4C)alkyl, (2-5C)alkanoyl, phenyl, benzoyl and benzyl, and wherein said phenyl, benzoyl and benzyl substituents may optionally bear one or two substituents selected from halogeno, (l-4C)alkyl and (l-4C)alkoxy; X is oxy, thio, sulphinyl or sulphonyl; Ar is phenylene, pyridinediyl, pyrimidinediyl, thiophenediyl, furandiyl, thiazolediyl, oxazolediyl, thiadiazolediyl or oxadiazolediyl which may optionally bear one or two substituents selected from halogeno, cyano, trifluoromethyl, hydroxy, amino, (l-4C)alkyl, (l-4C)alkoxy, (1- 4C)alkylamino and di-(l-4C)alkylamino; and Q is selected from the groups ofthe formulae II and III:
<img file="WO2004035741A2_D0007.tif" />
H IE
wherein R is hydrogen, (2-5C)alkanoyl or benzoyl, and wherein said benzoyl group may optionally bear one or two substituents selected from halogeno, (1-
4C)alkyl and (l-4C)alkoxy; R is (l-4C)alkyl; and R is hydrogen or (l-4C)alkyl; or R and R are linked to form a methylene, vinylene, ethylene or trimethylene group. Preferably, the compound is selected from the group consisting of: (2S,4R)-4-[5- fluoro-3-(l-methyl-2-oxo-l,2,3,4-tetrahydroquinolin-6-ylthio)ρhenyl]-4-hydroxy- 2-ethyltetrahydroρyran, (2S,4R)-4-[5-fluoro-3-(l-methyl-2-oxo-l,2,3,4- tetrahydroquinolin-6-ylsulphonyl)phenyl]-4-hydroxy-2-methyltetrahydropyran, (2S,4R)-4-hydroxy-2-methyl-4-[2-(l-methyl-2-oxo-l,2,3,4-tetrahydroquinolin-6- ylthio)thiazol-5 -yljtetrahydropyran, (2S,4R)-4-hydroxy-2-methyl-4-[2-(l -methyl- 2-oxo-l,2,3,4-tetrahydroquinolin-6-ylsulphonyl)thiazol-5-yl]tetrahydropyran, (2S,4R)-4-[2-(7-fluoro-l -methyl-2-oxo-l ,2,3,4-tetrahydroquinolin-6- ylthio)thiazol-5-yl]-4-hydroxy-2-methyltetrahydropvran, (2S,4R)-4-hydroxy-2- methyl-4-[2-(l-methyl-2-oxoindolin-5-ylthio)thiazol-5-yl]tetrahydropyran, (2S,4R)-4-hydroxy-2-methyl-4-[2-( 1 -methyl-2-oxo- 1 ,2,3 ,4-tetrahydroquinolin-6- ylthio)thien-4-yl]tetrahydropyran, (2S,4R)-4-hydroxy-2-methyl-4-[2-(l-methyl-2- oxo- 1 ,2,3 ,4-tetrahydroquinolin-6-ylsulphonyl)thien-4-yl]tetrahydropyran,
(2S,4R)-4-hydroxy-2-methyl-4-[2-(l-methyl-2-oxo-l,2,3,4-tetrahydroquinolin-6- ylthio)thien-5-yl]tetrahydropyran, (2S,4R)-4-hydroxy-2-methyl-4-[2-(l-methyl~2- oxo-l,2-dihydroquinolin-6-ylthio)thien-4-yl]tetrahydropyran, (2S,4R)-4-hydroxy- 2-methyl-4-[2-(l,8-dimethyl-2-oxo-l,2,3,4-tetrahydroquinolin-6-ylthio)thien-4- yljtetrahydropyran, 4-[2-(8-fluoro-l-methyl-2-oxo-l,2,3,4-tetrahydroquinolin-6- ylthio)thien-4-yl]-4-hydroxy-2-methyltetrahydropyran, 4-[2-(7-fluoro-l-methyl-2- oxo-l,2,3,4-tetrahydroquinolin-6-ylthio)thien-4-yl]-4-hydroxy-2- methyltetrahydropyran, (2S,4R)-4-hydroxy-2-methyl-4-[2-(l-methyl-2- oxoindolin-5-ylthio)thien-4-yl]tetrahydropyran, (2S,4R)-4-hydroxy-2-methyl-4- [3-(l-methyl-2-oxo-l,2,3,4-tetrahydroquinolin-6-ylthio)phenyl]tetrahydropyran, (2S,4R)-4-hydroxy-2-methyl-4-[3-(l-methyl-2-oxo-l,2,3,4-tetrahydroquinolin-6- ylsulphonyl)phenyl]tetrahydropyran, (2S,4R)-4-[3-(l-ethyl-2-oxo-l,2,3,4- tetrahydroquinolin-6-ylthio)phenyl]-4-hydroxy-2-methyltetralιydropyran, (2S,4R)-4-[3-(7-fluoro-l-methyl-2-oxo-l,2,3,4-tetrahydroquinolin-6- ylthio)phenyl] -4-hydroxy-2-methyltetrahydropyran, (2S,4R)-4-hydroxy-2-methyl- 4-[3-(l-methyl-2-oxo-l,2-dihydroquinolin-6-ylthio)phenyl]tetrahydropyran, (2S,4R)-4-[3-(8-chloro- 1 -methyl-2-oxo- 1 ,2,3 ,4-tetrahydroquinolin-6- ylthio)phenyl] -4-hydroxy-2-methyltetrahydropyran and (2S,4R)-4-hydroxy-2-methyl-4-[3-(l-methyl-2-oxoindolin-5- ylthio)ρhenyl]tetrahydropyran. See EP 623614 B 1 , incoφorated herein by reference.
The compound can be represented by the formula: OR<sup>1</sup>
Q- -A1'_ -X' -Ar- -R 2
R ι3
wherein Q is a 10-membered bicyclic heterocyclic moiety containing one or two nitrogen heteroatoms which bears one or two thioxo substituents, and which heterocyclic moiety may optionally bear one, two or three further substituents selected from halogeno, hydroxy, cyano, amino, (l-4C)alkyl, (l-4C)alkoxy, fluoro-(l-4C)alkyl, (l-4C)alkylamino, di-[(l-4C)alkyl]amino, amino-(l-4C)alkyl, (l-4C)alkylamino-(l-4C)alkyl, di-[(l-4C)alkyl]amino-(l-4C)alkyl, phenyl and phenyl-(l-4C)alkyl, and wherein said phenyl or phenyl-(l-4C)alkyl substituent may optionally bear a substituent selected from halogeno, (l-4C)alkyl and (1- 4C)alkoxy; wherein A is a direct link to X or is (l-3C)alkylene; wherein X is oxy, tliio, sulphinyl, sulphonyl or imino; wherein Ar is phenylene which may optionally bear one or two substituents selected from halogeno, hydroxy, amino, nitro, cyano, carbamoyl, ureido, (l-4C)alkyl, (l-4C)alkoxy, (l-4C)alkylamino, di-[(l- 4C)alkyl] amino, fluoro-(l-4C)alkyl and (2-4C)alkanoylamino; or Ar is pyridylene; wherein R is (l-4C)alkyl, (3-4C)alkenyl or (3-4C)alkynyl; and wherein R and R together form a group ofthe formula -A-X- A- which, together with the carbon atom to which A and A are attached, defines a ring having 5 to 7 ring atoms, wherein A and A, which may be the same or different, each is (1- 3C)alkylene and X is oxy, thio, sulphinyl or sulphonyl, and which ring may bear one, two or three substituents, which may be the same or different, selected from hydroxy, (l-4C)alkyl and (l-4C)alkoxy; or wherein R and R together form a group ofthe formula -A-X- A- which, together with the oxygen atom to which A is attached and with the carbon atom to which A is attached, defines a ring having 5 to 7 ring atoms, wherein A and A, which may be the same or different, each is (1- 3C)alkylene and X is oxy, thio, sulphinyl or sulphonyl, and which ring may bear one, two or three (l-4C)alkyl substituents, and wherein R is (l-4C)alkyl, (2- 4C)alkenyl or (2-4C)alkynyl; or a pharmaceutically-acceptable salt thereof. Preferably, the compound is selected from the group consisting of: 4-(5-fluoro-3- ( 1 -methyl-2-thioxo- 1 ,2-dihydroquinolin-6-ylmethoxy)phenyl] -4- ethoxytetrahydropyran and 4-(5-fluoro-3-(l-methyl-2-thioxo-l<sub>5</sub>2,3,4- tetrahydroquinolin-6-lmethoxy)phenyl]-4-methoxytetrahydropyran, 4-(5-fluoro-3- (l-methyl-2-thioxo-l,2,3,4-tetrahydroquinolin-6-ylthio)phenyl]-4- methoxytetrahydropyran and pharmaceutically-acceptable salt thereof. See EP 466452 Bl, incoφorated herein by reference.
The compound can be a substituted 4-(quinolin~2-61-methoxy)phenylacetic acid derivative represented by the following formula:
<img file="WO2004035741A2_D0008.tif" />
or pharmaceutically acceptable salt thereof , wherein R represents a group of the formula:
R<sup>z</sup>
/
-OR<sup>z</sup> or -N
\
R° R<sup>2</sup> and R<sup>3</sup> are identical or different and represent hydrogen, lower alkyl, phenyl, benzyl or a group ofthe formula:
<img file="WO2004035741A2_D0009.tif" />
R<sup>4</sup> represents hydrogen, lower alkyl, phenyl or benzyl, which can optionally be substituted by hydroxyl, carboxyl, lower alkoxycarbonyl, lower alkylthio, heteroaryl or carbamoyl, R<sup>5</sup> represents hydrogen, lower alkyl, phenyl or benzyl, R<sup>6</sup> represents a group ofthe formula -COR<sup>5</sup> or -CO<sup>2</sup> R<sup>5</sup>, R<sup>7</sup> represents hydrogen, lower alkyl or phenyl, Y represents a group ofthe formula:
<img file="WO2004035741A2_D0010.tif" />
wherein R<sup>8</sup> represents hydrogen, lower alkyl or phenyl and n denotes a number of 0 to 5, Z represents norbornyl, or represents a group ofthe formula: <img file="WO2004035741A2_D0011.tif" />
wherein R<sup>9</sup> and R<sup>10</sup> are identical or different and denote hydrogen, lower alkyl or phenyl, or R<sup>9</sup> and R<sup>10</sup> can together form a saturated carbocyclic ring having up to 6 carbon atoms and m denotes a number from 1 to 6, and A and B are identical or different and denote hydrogen, lower alkyl or halogen, or a pharmaceutically acceptable salt thereof. Preferably the compounds are selected from the group consisting of: 2-[4-(quinolin-2-yl-methoxy)phenyl]-2-cyclopentylacetic acid, 2-[4- (quinolin-2-yl-methoxy)phenyl]-2-cyclohexylacetic acid, and 2-[4-(quinolin-2-yl- methoxy)phenyl]-2-cycloheptylacetic acid, (+)-enantiomer of 2-[4-(quinolin-2-yl- methoxy)phenyl]-2-cyclopentylacetic acid, (-)-enantiomer of 2-[4-(quinolin-2-yl- methoxy)ρhenyl]-2-cyclopentylacetic acid and pharmaceutically acceptable salts thereof. See U.S. Patent No. 4,970,215, incoφorated herein by reference.
The compound can be represented by the formula:
<img file="WO2004035741A2_D0012.tif" />
wherein R, R, R, R and R are independently hydrogen, halogen, lower alkyl, lower alkenyl, lower alkynyl, -CF3, -CN, -NO2, -N3, -C(OH)RR, -CO2R, -SR, -S(O)R, -S(O)2R, -S(O)2NRR,-OR,-NRR, -C(O)R or -(CH2)tR; R is hydrogen, -CH3, -CF3, -C(O)H, X-R or X-R; R and R are independently: alkyl, - (CH2)uPh(R)2 or -(CH2)uTh(R)2; R is -CF3 or R; R is hydrogen or X-R; each R is independently hydrogen or lower alkyl, or two R's on same carbon atom are joined to form a cycloalkyl ring of 3 to 6 carbon atoms; R is hydrogen, lower alkyl or -CH2R;
R is lower alkyl or -(CH2)rR; R is -CF3 or R; R is hydrogen, -C(O)R, R, or two R 's on the same nitrogen may be joined to form a monocyclic heterocyclic ring of 4 to 6 atoms containing up to 2 heteroatoms chosen from O, S or N; R is hydrogen, - CF3, lower alkyl, lower alkenyl, lower alkynyl or -(CH2)rR; R is -(CH2)s-C(RR)- (CH2)s-R or -CH2C(O)NRR; R is hydrogen or lower alkyl; R is a) a monocyclic or bicyclic heterocyclic ring containing from 3 to 9 nuclear carbon atoms and 1 or 2 nuclear hetero-atoms selected from N, S or O and with each ring in the heterocyclic radical being formed of 5 or 6 atoms, or b) the radical -R; R is alkyl or C(O)R; R is phenyl substituted with 1 or 2 R groups; R is hydrogen, halogen, lower alxyl, lower alkoxy, lower alkylthio, lower alkylsulfonyl, lower alkylcarbonyl, -CF3, - CN,
-NO2 or -N3; R is alkyl, cycloalkyl, monocyclic monoheterocyclic ring; R is the residual structure of a standard amino acid, or R and R attached to the same N can cyclize to form a proline residue; m is 0 to 1; n is 0 to 3; p is 1 to 3 when m is 1; p is 0 to 3 when m is 0; r is 0 to 2; s is 0 to 3; t is 0 to 2; u is 0 to 3; v is O or 1;
W is 0, S or NR; X is 0, or NR; X is C(O), CRR, S, S(O) or S(O)2; X is C(O), CRR, S(O)2 or a bond; Y is X or X; Q is -CO2R, -C(O)NHS(O)2R, -NHS(O)2R, -S(O)2NHR -C(O)NRR, -CO2R, -C(O)NRR, -CH2OH, or IH- or 2H-tetrazol-5- yl; and the pharmaceutically acceptable salts thereof. Preferred embodiments ofthe compounds are selected from the following and pharmaceutically acceptable salts thereof: -[N-(p-chlorobenzyl)-3-(t-butylthio)-5-(quinolin-2-ylmethoxy)indol-2-yl]-
2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-3-methyl-5-(quinolin-2-ylmethoxy)indol-2-yl]-
2,2-dimethylpropanoic acid; 3-[N-(ρ-t-butylthiobenzyl)-3-(t-butylthio)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-3-(phenylthio)-5-(quinolin-2-ylmethoxy)indol-
2-yl]-2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-3-(phenylsulfonyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethyl propanoic acid, N-oxide;
3-[N-(p-chlorobenzyl)-3-(phenylsulfonyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-3-(phenylsulfinyl)-5-(quinolin-2- ylmethoxy)indol-2-yl] -2,2-dimethylpropanoic acid; 3-[N-(p-chlorobenzyl)-5-(quinolin-2-ylmethoxy)indol-2-yl]-2,2- dimethylpropanoic acid;;
3-[N-(p-chlorobenzyl)-3-benzoyl-5-(quinolin2-ylmethoxy)indol-2-yl]-
2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-3-benzyl-5-(quinolin-2-ylmethoxy)indol-2-yl]- 2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-3-(3,3-dimethyl-l-oxo-l-butyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid;
2-[N-(p-chlorobenzyl)-3-(t-butylthio)-5-(quinolin-2-ylmethoxy)indol-
2-yl]ethoxyethanoic acid; 3-[N-(p-chlorobenzyl)-3-(3,3-dimethyl-l-butyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-3-(t-butylthio)-5-(quinolin-2-ylmethoxy)indol-
2-yl]-2-methylpropanoic acid;
3-[N-(p-chlorobenzyl)-3-methyl-5-(6,7-dichloroquinolin-2- yhnethoxy)indol-2-yl] -2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-3-methyl-5-(7-chloroquinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-4-allyl-5-(quinolin-2-ylmethoxy)-3-(t- butylthio)indol-2-yl] -2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-4-allyl-5-(quinolin-2-ylmethoxy)indol-2-yl]- 2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-6-(quinolin-2-ylmethoxy)-3-(t-butylthio)indol-
2-yl]-2,2-dimethylpropanoic acid;
3-[N-(p-chlorobenzyl)-4-(quinolin-2-ylmethoxy)-3-(t-butylthio)indol-
2-yl]-2,2-dimethylpropanoic cid; 3-[N-(p-chlorobenzyl)-7-(quinolin-2-ylmethoxy)-3-(t-butylthio)indol-
2-yl]-2,2-dimethylpropanoic acid;
2-[2-[N-(p-chlorobenzyl)-3-(t-butylthio)-5-(quinolin-2- ylmethoxy)indol-2-yl] ethoxyjpropanoic acid;
3-[N-(p-chlorobenzyl)-4-(quinolin-2-ylmethoxy)indol-2-yl]-2,2- dimethylpropanoic acid;;
3-[N-methyl-3-(p-chlorobenzoyl)-6-(quinolin-2-ylmethoxy)indol-2- yl]-2,2-dimethylpropanoic acid,
3-[N-methyl-3-(p-chlorobenzyl)-6-(quinolin-2-ylmethoxy)indol-2-yl]-
2,2-dimethylpropanoic acid, 3-[N-(4-chlorobenzyl)-3-i-propoxy-5-(quinolin-2-ylmethoxy)indol-2- yl] -2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-(t-butylthio)-5-(quinolin-2-yl-methoxy)indol-
2-yl]-2-ethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-trifluoroacetyl-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-(3,3-dimethyl-l-oxo-l-butyl)-5-(quinolin-2- ylmethoxy)indol-2-yl] -2-methylpropanoic acid,
3-[3-(3,3-dimethyl-l-oxo-l-butyl-5-(quinolin-2-ylmethoxy)indol-2- yl]-2,2-dimethylpropanoic acid, 3-[N-(4-triflouromethylbenzyl)-3-(3,3-dimethyl-l-oxo-l-butyl)-5-
(quinolin-2-yl-methoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-benzyl-3-(3 ,3 -dimethyl- 1 -oxo- 1 -butyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(3-methoxybenzyl)-3-(3,3-dimethyl-l-oxo-l-butyl)-5-(quinolin- 2-yhnethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-allyl-3-(3,3-dimethyl-l-oxo-l-butyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(4-methoxybenzyl)-3-(3,3-dimethyl-l-oxo-l-butyl)-5-(quinolin- 2-ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3 -[N-methyl-3 -(3,3 -dimethyl- 1 -oxo-3-butyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid,
3-[3-(4-chlorobenzyl)-6-(quinolin-2-ylmethoxy)indol-2-yl]-2,2- dimethylpropanoic acid.
3-[N-(pheιιylsulfonyl)-3-(4-chlorobenzyl)-6-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-benzyl-3-(4-chlorobenzyl)-6-(quinolin-2-ylmethoxy)indol-2-yl]-
2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-(t-butylsulfonyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(4-chlorobenzyl)-3-(t-butylsulfinyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid,
3-[N-allyl-3-(4-chlorobenzyl)-6-(quinolin-2-ylmethoxy)indol-2-yl]- 2,2-dimethylpropanoic acid,
3-[N-(n-propyl)-3-(4-chlorobenzyl)-6-(quinoline-2-ylmethoxy)indol-2- yl]-2,2-dimethylpropanoic acid, 3-[N-ethyl-3-(4-chlorobenzyl)-6-(quinolin-2-ylmethoxy)indol-2-yl]-
2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-(4-t-butylbenzoyl)-5-(quinolin-2-yl- methoxy)indol-2-yl]-2,2-dimethylproρanoic acid, 3-[N-(4-chlorobenzyl)-3-(4-chlorobenzoyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyI)-3-(l,l-dimethylethyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(4-chlorobenzyl)-3-acetyl-5-(quinolin-2-ylmethoxy)indol-2-yl]- 2,2-dimethylpropanoic acid
3-[N-(4-chlorobenzyl)-3-cycloρropanecarbonyl-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-(3-cyclopentylpropanoyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylρroρanoic acid, 3-[N-(4-chlorobenzyl)-3-(3-methylbutanoyl)-5-(quinolin-2-yl- methoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(4-chlorobenzyl)-3-proρanoyl-5-(quinolin-2-ylmethoxy)indol-2- yl]-2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3 -(2-methyIpropanoyl)-5 -(quinoiin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3_[N-(4-chlorobenzyl)-3-trimethylacetyl-5-(quinolin-2- ylmethoxy)indol-2-yl] -2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-phenylacetyl-5-(quinolin-2-yhnethoxy)indol- 2-yl]-2,2-dimethylpropanoic acid,
3-[N-(4-fluorobenzyl)-3-(3,3-dimethyl-l-oxo-l-butyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(4-bromobenzyl)-3-(3,3-dimethyl-l-oxo-l-butyl)-5-(quinolin-2- ylmethoxy)indol-2-yl] -2,2-dimethylpropanoic acid, 3-[N-(4-iodobenzyl)-3-(3,3-dimethyl-l-oxo-l-butyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylρropanoic acid, 3-[N-(4-chlorobenzyl)-3-(l , l-dimethylbutyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-(l,l-dimethylpropyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylρropanoic acid, 3-[N-(3-fluorobenzyl)-3-(l,l-dimethylethyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(4-chlorobenzyl)-3-(3-methylethyl)-5-(quinolin-2- ylmethoxy)indol-2-yl] -2,2-dimethylpropanoic acid, 3-[N-(4-chlorobenzyl)-3-cyclopropyl-5-(quinolin-2-ylmethoxy)indol- 2-yl]-2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-(l-methyl-l-cyclopropyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(4-chlorobenzyl)-3-cyclopentyl-5-(quinolin-2-ylmethoxy)indol-2- yl]-2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-cyclohexyl-5-(quinolin-2-ylmethoxy)indol-2- yl]-2,2-dimethylρropanoic acid, 3-[N-(4-chlorobenzyl)-3-( alpha , alpha -dimethylbenzyl)-5-(quinolin- 2-ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-(2-{4-chloro- alpha , alpha -dimethylbenzyl}- 5-(quinolin-2-ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(4-chlorobenzyl)-3-(l-adamantyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(4-chlorobenzyl)-3-((l -adamantyl)methyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(l , 1 -dimethylethyl)-3-(4-chlorobenzyl)-6-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid, 3-[N-(l,l-dimethylpropyl)-3-(4-chlorobenzyl)-6-(quinoline-2- ylmethoxy)indol-2-yl]-2,2-dimethylpropanoic acid,
3-[N-(4-chlorobenzyl)-3-(3,3-dimethyl-l-oxo-l-butyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2-diethylpropanoic acid, methyl 3-[N-(4-chlorobenzyl)-3,6-bis(acetyl)-5-(quinolin-2- ylmethoxy)indol-2-yl]-2,2 dimethyl propanoate or methyl 3-[N-(4-chlorobenzyl)-3,6-bis(cyclopropanecarbonyl)-5-
(quinolin-2-ylmethoxy)indol-2-yl]-2,2-dimethyl propanoate. See EP 419049 Bl, incoφorated herein by reference.
The term "alkyl" refers to a monovalent group derived from a straight or branched chain saturated hydrocarbon by the removal of a single hydrogen atom. Alkyl groups are exemplified by methyl, ethyl, n- and iso-propyl, n-, sec-, iso- and tert-butyl, and the like. The term "hydroxyalkyl" represents an alkyl group, as defined above, substituted by one to three hydroxyl groups with the proviso that no more than one hydroxy group may be attached to a single carbon atom ofthe alkyl group. The term "alkylamino" refers to a group having the structure -NHR wherein R' is alkyl, as previously defined, examples of alkylamino include methylamino, ethylarnino, iso-propylamino and the like. The term "alkylaminocarbonyl" refers to an alkylamino group, as previously defined, attached to the parent molecular moiety through a carbonyl group. Examples of alkylaminocarbonyl include methylamino- carbonyl, ethylaminocarbonyl, iso-propylaminocarbonyl and the like. The term "alkylthio" refers to an alkyl group, as defined above, attached to the parent molecular moiety tlirough a sulfur atom and includes such examples as methylthio, ethylthio, propylthio, n-, sec- and tert-butylthio and the like. The term "alkanoyl" represents an alkyl group, as defined above, attached to the parent molecular moiety through a carbonyl group. Alkanoyl groups are exemplified by forrnyl, acetyl, propionyl, butanoyl and the like. The term
"alkanoylamino" refers to an alkanoyl group, as previously defined, attached to the parent molecular moiety through a nitrogen atom. Examples of alkanoylamino include formamido, acetamido, and the like. The term "N- alkanoyl-N-alkylamino" refers to an alkanoyl group, as previously defined, attached to the parent molecular moiety through an aminoalkyl group.
Examples of N-alkanoyl-N-alkylamino include N-methylformamido, N- methyl-acetamido, and the like. The terms "alkoxy" or "alkoxyl" denote an alkyl group, as defined above, attached to the parent molecular moiety through an oxygen atom. Representative alkoxy groups include methoxyl, ethoxyl, propoxyl, butoxyl, and the like. The term "alkoxyalkoxyl" refers to an alkyl group, as defined above, attached through an oxygen to an alkyl group, as defined above, attached in turn through an oxygen to the parent molecular moiety. Examples of alkoxyalkoxyl include methoxymethoxyl, methoxyethyoxyl, ethoxyethoxyl and the like. The term "alkoxyalkyl" refers to an alkoxy group, as defined above, attached through an alkylene group to the parent molecular moiety. The term "alkoxycarbonyl" represents an ester group; i.e., an alkoxy group, attached to the parent molecular moiety through a carbonyl group such as methoxycarbonyl, ethoxycarbonyl, and the like. The term "alkenyl" denotes a monovalent group derived from a hydrocarbon containing at least one carbon-carbon double bond by the removal of a single hydrogen atom. Alkenyl groups include, for example, ethenyl, propenyl, butenyl, l-methyl-2-buten-l-yl and the like. The term "alkylene" denotes a divalent group derived from a straight or branched chain saturated hydrocarbon by the removal of two hydrogen atoms, for example methylene, 1,2-ethylene, 1,1-ethylene, 1,3-propylene, 2,2-dimethylpropylene, and the like. The term "alkenylene" denotes a divalent group derived from a straight or branched chain hydrocarbon containing at least one carbon-carbon double bond. Examples of alkenylene include -CH=CH-, -CH<sub>2</sub> CH=CH-, - C(CH<sub>3</sub>)=CH-, -CH<sub>2</sub> CH=CHCH<sub>2</sub> -, and the like. The term "cycloalkylene" refers to a divalent group derived from a saturated carbocyclic hydrocarbon by the removal of two hydrogen atoms, for example cyclopentylene, cyclohexylene, and the like. The term "cycloalkyl" denotes a monovalent group derived from a monocyclic or bicyclic saturated carbocyclic ring compound by the removal of a single hydrogen atom. Examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, bicyclo[2.2.1]heptanyl, and bicyclo[2.2.2]octanyl. The term "alkynylene" refers to a divalent group derived by the removal of two hydrogen atoms from a straight or branched chain acyclic hydrocarbon group containing a carbon-carbon triple bond. Examples of alkynylene include -CH≡CH-, -CH≡CH-CH<sub>2</sub> -, -CH≡CH- CH(CH )-, and the like. The term "carbocyclic aryl" denotes a monovalent carbocyclic ring group derived by the removal of a single hydrogen atom from a monocyclic or bicyclic fused or non-fused ring system obeying the "4n+2 p electron" or Huckel aromaticity rule. Examples of carbocyclic aryl groups include phenyl, 1- and 2-naphthyl, biphenylyl, fluorenyl, and the like. The term "(carbocyclic aryl)alkyl" refers to a carbocyclic aryl ring group as defined above, attached to the parent molecular moiety tlirough an alkylene group. Representative (carbocyclic aryl)alkyl groups include phenylmethyl, phenylethyl, phenylpropyl, 1-naphthylmethyl, and the like. The term "carbocyclicarylalkoxy" refers to a carbocyclicaryl alkyl group, as defined above, attached to the parent molecular moiety through an oxygen atom. The term "carbocyclic aryloxyalkyl" refers to a carbocyclic aryl group, as defined above, attached to the parent molecular moiety through an oxygen atom and thence through an alkylene group. Such groups are exemplified by phenoxymethyl, 1- and 2-naphthyloxymethyl, phenoxyethyl and the like. The term "(carbocyclic aryl)alkoxyalkyl" denotes a carbocyclic aryl group as defined above, attached to the parent molecular moiety through an alkoxyalkyl group. Representative (carbocyclic aryl)alkoxyalkyl groups include phenylmethoxymethyl, phenylethoxymethyl, 1- and 2-naphthylmethoxyethyl, and the like. "Carbocyclic arylthioalkyl" represents a carbocyclic aryl group as defined above, attached to the parent molecular moeity through a sulfur atom and thence through an alklyene group and are typified by phenylthiomethyl, 1- and 2-naphthylthioethyl and the like. The term
"dialkylamino" refers to a group having the stracture -NR'R" wherein R and R" are independently selected from alkyl, as previously defined. Additionally, R and R" taken together may optionally be -(CH<sub>2</sub>)kk — where kk is an integer of from 2 to 6. Examples of dialkylamino include, dimethylamino, diethylaminocarbonyl, methylethylamino, piperidino, and the like. The term
"halo or halogen" denotes fluorine, chlorine, bromine or iodine. The term "haloalkyl" denotes an alkyl group, as defined above, having one, two, or three halogen atoms attached thereto and is exemplified by such groups as chloromethyl, bromoethyl, trifluoromethyl, and the like. The term "hydroxyalkyl" represents an alkyl group, as defined above, substituted by one to three hydroxyl groups with the proviso that no more than one hydroxy group may be attached to a single carbon atom ofthe alkyl group. The term "phenoxy" refers to a phenyl group attached to the parent molecular moiety through an oxygen atom. The term "phenylthio" refers to a phenyl group attached to the parent molecular moiety through a sulfur atom. The term
"pyridyloxy" refers to a pyridyl group attached to the parent molecular moiety through an oxygen atom. The terms "heteroaryl" or "heterocyclic aryl" as used herein refers to substituted or unsubstituted 5- or 6-membered ring aromatic groups containing one oxygen atom, one, two, three, or four nitrogen atoms, one nitrogen and one sulfur atom, or one nitrogen and one oxygen atom. The term heteroaryl also includes bi-or tricyclic groups in which the aromatic heterocyclic ring is fused to one or two benzene rings. Representative heteroaryl groups are pyridyl, thienyl, indolyl, pyrazinyl, isoquinolyl, pyrrolyl, pyrimidyl, benzothienyl, furyl, ber_zo[b]furyl, imidazolyl, thiazolyl, carbazolyl, and the like. The term "heteroarylalkyl" denotes a heteroaryl group, as defined above, attached to the parent molecular moiety through an alkylene group. The term "heteroaryloxy" denotes a heteroaryl group, as defined above, attached to the parent molecular moiety through an oxygen atom. The term "heteroarylalkoxy" denotes a heteroarylalkyl group, as defined above, attached to the parent molecular moiety through an oxygen atom.
NUCLEIC ACID THERAPEUTIC AGENTS In another embodiment, a nucleic acid ofthe invention; a nucleic acid complementary to a nucleic acid ofthe invention; or a portion of such a nucleic acid (e.g., an oligonucleotide as described below); or a nucleic acid encoding a member ofthe leukotriene pathway (e.g., 5-LO), can be used in "antisense" therapy, in which a nucleic acid (e.g., an oligonucleotide) which specifically hybridizes to the mRNA and/or genomic DNA of a nucleic acid is administered or generated in situ. The antisense nucleic acid that specifically hybridizes to the mRNA and/or DNA inhibits expression of the polypeptide encoded by that mRNA and/or DNA, e.g., by inhibiting translation and/or transcription. Binding ofthe antisense nucleic acid can be by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interaction in the major groove ofthe double helix. An antisense construct can be delivered, for example, as an expression plasmid as described above. When the plasmid is transcribed in the cell, it , produces RNA that is complementary to a portion ofthe mRNA and/or DNA that encodes the polypeptide for the member ofthe leukotriene pathway (e.g., FLAP or 5-LO). Alternatively, the antisense construct can be an oligonucleotide probe that is generated ex vivo and introduced into cells; it then inhibits expression by hybridizing with the mRNA and/or genomic DNA ofthe polypeptide. h one embodiment, the oligonucleotide probes are modified oligonucleotides that are resistant to endogenous nucleases, e.g., exonucleases and/or endonucleases, thereby rendering them stable in vivo. Exemplary nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA
(see also U.S. Pat. Nos. 5,176,996, 5,264,564 and 5,256,775). Additionally, general approaches to constructing oligomers useful in antisense therapy are also described, for example, by Nan der Krol et al. (Biotechniques 6:958-976 (1988)); and Stein et al. (Cancer Res. 48:2659-2668 (1988)). With respect to antisense DΝA, oligodeoxyribonucleotides derived from the translation initiation site are preferred.
To perform antisense therapy, oligonucleotides (mRΝA, cDΝA or DΝA) are designed that are complementary to mRΝA encoding the polypeptide. The antisense oligonucleotides bind to mRΝA transcripts and prevent translation. Absolute complementarity, although preferred, is not required. A sequence "complementary" to a portion of an RΝA, as referred to herein, indicates that a sequence has sufficient complementarity to be able to hybridize with the RΝA, forming a stable duplex; in the case of double- stranded antisense nucleic acids, a single strand ofthe duplex DΝA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length ofthe antisense nucleic acid, as described in detail above. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RΝA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures. The oligonucleotides used in antisense therapy can be DNA, RNA, or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotides can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotides can include other appended groups such as peptides (e.g. for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, Proc. Natl. Acad. Sci. USA 86:6553-6556 (1989); Lemairre et al, Proc. Natl. Acad. Sci. USA 84:648-652 (1987); PCT International Publication No. WO 88/09810) or the blood-brain barrier (see, e.g., PCT International
Publication No. WO 89/10134), or hybridization-triggered cleavage agents (see, e.g., Krol et al, BioTechniques 6:958-976 (1988)) or intercalating agents. (See, e.g., Zon, Pharm.Res. 5: 539-549 (1988)). To this end, the oligonucleotide may be conjugated to another molecule (e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization- triggered cleavage agent).
The antisense molecules are delivered to cells that express the member ofthe leukotriene pathway in vivo. A number of methods can be used for delivering antisense DNA or RNA to cells; e.g., antisense molecules can be injected directly into the tissue site, or modified antisense molecules, designed to target the desired cells (e.g., antisense linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systematically. Alternatively, in a preferred embodiment, a recombinant DNA construct is utilized in which the antisense oligonucleotide is placed under the control of a strong promoter (e.g. , pol III or pol II). The use of such a construct to transfect target cells in the patient results in the transcription of sufficient amounts of single stranded RNAs that will form complementary base pairs with the endogenous transcripts and thereby prevent translation ofthe mRNA. For example, a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense
RNA. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art and described above. For example, a plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct that can be introduced directly into the tissue site. Alternatively, viral vectors can be used which selectively infect the desired tissue, in which case administration may be accomplished by another route (e.g., systemically).
In another embodiment ofthe invention, small double-stranded interfering RNA (RNA interference (RNAi)) can be used. RNAi is a post- transcription process, in which double-stranded RNA is introduced, and sequence-specific gene silencing results, though catalytic degradation ofthe targeted mRNA. See, e.g., Elbashir, S.M. et al, Nature 411:494-498 (2001); Lee, N.S., Nature Biotech. 19:500-505 (2002); Lee, S-K. et al, Nature Medicine 8(7):68l-686 (2002); the entire teachings of these references are incoφorated herein by reference.
Endogenous expression of a member ofthe leukotriene pathway (e.g., FLAP, 5-LO) can also be reduced by inactivating or "knocking out" the gene or its promoter using targeted homologous recombination (e.g., see Smithies et al, Nature 317:230-234 (1985); Thomas & Capecchi, Cell 51:503-512 (1987); Thompson et al, Cell 5:313-321 (1989)). For example, an altered, nonfunctional gene of a member ofthe leukotriene pathway (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous gene (either the coding regions or regulatory regions ofthe gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express the gene in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation ofthe gene. The recombinant DNA constructs can be directly administered or targeted to the required site in vivo using appropriate vectors, as described above. Alternatively, expression of non-altered genes can be increased using a similar method: targeted homologous recombination can be used to insert a DNA construct comprising a non-altered functional gene, or the complement thereof, or a portion thereof, in place of an gene in the cell, as described above. In another embodiment, targeted homologous recombination can be used to insert a DNA construct comprising a nucleic acid that encodes a polypeptide variant that differs from that present in the cell. Alternatively, endogenous expression of a member ofthe leukotriene pathway can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region ofthe member ofthe leukotriene pathway (i.e., the promoter and/or enhancers) to form triple helical structures that prevent transcription ofthe gene in target cells in the body. (See generally, Helene, C, Anticancer Drug Des., 6(6):569-84 (1991); Helene, C. et al, Ann. N.Y. Acad. Sci. 660:27-36 (1992); and Maher, L. J., Bioassays 14(12):807-15 (1992)). Likewise, the antisense constructs described herein, by antagonizing the normal biological activity of one ofthe members ofthe leukotriene pathway, can be used in the manipulation of tissue, e.g., tissue differentiation, both in vivo and for ex vivo tissue cultures. Furthermore, the anti-sense techniques (e.g., microinjection of antisense molecules, or transfection with plasmids whose transcripts are anti-sense with regard to a nucleic acid RNA or nucleic acid sequence) can be used to investigate the role of one or more members ofthe leukotriene pathway in the development of disease-related conditions. Such techniques can be utilized in cell culture, but can also be used in the creation of transgenic animals.
The therapeutic agents as described herein can be delivered in a composition, as described above, or by themselves. They can be administered systemically, or can be targeted to a particular tissue. The therapeutic agents can be produced by a variety of means, including chemical synthesis; recombinant production; in vivo production (e.g., a transgenic animal, such as U.S. Pat. No. 4,873,316 to Meade et al), for example, and can be isolated using standard means such as those described herein. In addition, a combination of any ofthe above methods of treatment (e.g., administration of non-altered polypeptide in conjunction with antisense therapy targeting altered mRNA for a member ofthe leukotriene pathway; administration of a first splicing variant in conjunction with antisense therapy targeting a second splicing variant) can also be used.
The invention additionally pertains to use of such therapeutic agents, as described herein, for the manufacture of a medicament for the treatment of MI, ACS, and/or atherosclerosis, e.g., using the methods described herein.
MONITORING PROGRESS OF TREATMENT
The current mvention also pertains to methods of monitoring the response of an individual, such as an individual in one ofthe target populations described above, to treatment with a leukotriene synthesis inhibitor. Because the level of inflammatory markers can be elevated in individuals who are in the target populations described above, an assessment ofthe level of inflammatory markers of he individual both before, and during, treatment with the leukotriene synthesis inhibitor will indicate whether the treatment has successfully decreased production of leukotrienes in the arterial vessel wall or in bone-marrow derived inflammatory cells.
For example, in one embodiment ofthe invention, an individual who is a member of a target population of individuals at risk for MI or ACS (e.g. , an individual in a target population described above, such as an individual at-risk due to a FLAP Ml-haplotype) can be assessed for response to treatment with a leukotriene synthesis inhibitor, by examining leukotriene levels in the individual. Serum, plasma or urinary leukotrienes (e.g., leukotriene E4, cysteinyl leukotriene 1), or ex vivo production of leukotrienes (e.g., in blood samples stimulated with a calcium ionophore to produce leukotrienes) can be measured before, and during or after treatment with the leukotriene synthesis inhibitor. The leukotriene level before treatment is compared with the leukotriene level during or after treatment. The efficacy of treatment is indicated by a decrease in leukotriene production: a level of leukotriene during or after treatment that is significantly lower than the level of leukotriene before treatment, is indicative of efficacy. A level that is lower during or after treatment can be shown, for example, by decreased serum or urinary leukotrienes, or decreased ex vivo production of leukotrienes. A level that is "significantly lower", as used herein, is a level that is less than the amount that is typically found in control individual(s), or is less in a comparison of disease risk in a population associated with the other bands of measurement (e.g. , the mean or median, the highest quartile or the highest quintile) compared to lower bands of measurement (e.g., the mean or median, the other quartiles; the other quintiles). hi another embodiment ofthe invention, an individual who is a member of a target population of individuals at risk for MI or ACS (e.g., an individual in a target population described above, such as an individual at-risk due to elevated C-reactive protein) can be assessed for response to treatment with a leukotriene synthesis inhibitor, by examining levels of inflammatory markers in the individual. For example, levels of an inflammatory marker in an appropriate test sample (e.g., serum, plasma or urine) can be measured before, and during or after treatment with the leukotriene synthesis inhibitor.
The level ofthe inflammatory marker before treatment is compared with the level ofthe inflammatory marker during or after treatment. The efficacy of treatment is indicated by a decrease in the level ofthe inflammatory marker, that is, a level ofthe inflammatory marker during or after treatment that is significantly lower (e.g., significantly lower), than the level of inflammatory marker before treatment, is indicative of efficacy. Representative inflammatory markers include: C-reactive protein (CRP), serum amyloid A, fibrinogen, a leukotriene, a leukotriene metabolite (e.g., cysteinyl leukotriene 1), interleukin-6, tissue necrosis factor-alpha, soluble vascular cell adhesion molecules (sNCAM), soluble intervascular adhesion molecules (sICAM), E- selectin, matrix metalloprotease type-1, matrix metalloprotease type-2, matrix metalloprotease type-3, and matrix metalloprotease type-9. hi a preferred embodiment, the marker is CRP. PHARMACEUTICAL COMPOSITIONS
The present invention also pertains to pharmaceutical compositions comprising agents described herein, for example, an agent that is a leukotriene synthesis inhibitor as described herein. For instance, a leukotriene synthesis inhibitor can be formulated with a physiologically acceptable carrier or excipient to prepare a pharmaceutical composition. The carrier and composition can be sterile. The formulation should suit the mode of administration.
Suitable pharmaceutically acceptable carriers include but are not limited to water, salt solutions (e.g., NaCl), saline, buffered saline, alcohols, glycerol, ethanol, gum arabic, vegetable oils, benzyl alcohols, polyethylene glycols, gelatin, carbohydrates such as lactose, amylose or starch, dextrose, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid esters, hydroxymethylcellulose, polyvinyl pyrolidone, etc., as well as combinations thereof. The pharmaceutical preparations can, if desired, be mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and/or aromatic substances and the like which do not deleteriously react with the active agents. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, polyvinyl pyrolhdone, sodium saccharine, cellulose, magnesium carbonate, etc.
Methods of introduction of these compositions include, but are not limited to, intradermal, intramuscular, intraperitoneal, intraocular, intravenous, subcutaneous, topical, oral and intranasal. Other suitable methods of introduction can also include gene therapy (as described below), rechargeable or biodegradable devices, particle acceleration devices ("gene guns") and slow release polymeric devices. The pharmaceutical compositions of this invention can also be administered as part of a combinatorial therapy with other agents. The composition can be formulated in accordance with the routine procedures as a pharmaceutical composition adapted for administration to human beings. For example, compositions for intravenous administration typically are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic to ease pain at the site ofthe injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water, saline or dextrose/water. Where the composition is administered by injection, an ampule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to admiiiistration.
For topical application, nonsprayable forms, viscous to semi-solid or solid forms comprising a carrier compatible with topical application and having a dynamic viscosity preferably greater than water, can be employed. Suitable formulations include but are not limited to solutions, suspensions, emulsions, creams, ointments, powders, enemas, lotions, sols, liniments, salves, aerosols, etc., which are, if desired, sterilized or mixed with auxiliary agents, e.g., preservatives, stabilizers, wetting agents, buffers or salts for influencing osmotic pressure, etc. The agent may be incoφorated into a cosmetic formulation. For topical application, also suitable are sprayable aerosol preparations wherein the active ingredient, preferably in combination with a solid or liquid inert carrier material, is packaged in a squeeze bottle or in admixture with a pressurized volatile, normally gaseous propellant, e.g. , pressurized air. Agents described herein can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
The agents are administered in a therapeutically effective amount. The amount of agents which will be therapeutically effective in the treatment of a particular disorder or condition will depend on the nature ofthe disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness ofthe symptoms, and should be decided according to the judgment of a practitioner and each patient's circumstances. Effective doses may be extrapolated from dose- response curves derived from in vitro or animal model test systems.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more ofthe ingredients ofthe pharmaceutical compositions ofthe invention. Optionally associated with such containers) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use of sale for human administration. The pack or kit can be labeled with information regarding mode of administration, sequence of drug administration (e.g., separately, sequentially or concurrently), or the like. The pack or kit may also include means for reminding the patient to take the therapy. The pack or kit can be a single unit dosage ofthe combination therapy or it can be a plurality of unit dosages. In particular, the agents can be separated, mixed together in any combination, present in a single vial or tablet. Agents assembled in a blister pack or other dispensing means is preferred. For the puφose of this invention, unit dosage is intended to mean a dosage that is dependent on the individual pharmacodynamics of each agent and administered in FDA approved dosages in standard tune courses.
NUCLEIC ACIDS OF THE INVENTION FLAP Nucleic Acids, Portions and Variants
In addition, the invention pertains to isolated nucleic acid molecules comprising a human FLAP nucleic acid. The term, "FLAP nucleic acid," as used herein, refers to an isolated nucleic acid molecule encoding FLAP polypeptide. The FLAP nucleic acid molecules ofthe present invention can be RNA, for example, mRNA, or DNA, such as cDNA and genomic DNA. DNA molecules can be double-stranded or single-stranded; single stranded RNA or DNA can be either the coding, or sense strand or the non-coding, or antisense strand. The nucleic acid molecule can include all or a portion ofthe coding sequence ofthe gene or nucleic acid and can further comprise additional non-coding sequences such as introns and non-coding 3' and 5' sequences (including regulatory sequences, for example, as well as promoters, transcription enhancement elements, splice donor/acceptor sites, etc.).
For example, a FLAP nucleic acid can consist of SEQ ID NOs: 1 or 3 or the complement thereof, or to a portion or fragment of such an isolated nucleic acid molecule (e.g., cDNA or the nucleic acid) that encodes FLAP polypeptide (e.g., a polypeptide such as SEQ ID NO: 2). In a preferred embodiment, the isolated nucleic acid molecule comprises a nucleic acid molecule selected from the group consisting of SEQ ID NOs: 1 or 3, or their complement thereof.
Additionally, the nucleic acid molecules ofthe invention can be fused to a marker sequence, for example, a sequence that encodes a polypeptide to assist in isolation or purification ofthe polypeptide. Such sequences include, but are not limited to, those that encode a glutathione-S-transferase (GST) fusion protein and those that encode a hemagglutinin A (HA) polypeptide marker from influenza. An "isolated" nucleic acid molecule, as used herein, is one that is separated from nucleic acids that normally flank the gene or nucleic acid sequence (as in genomic sequences) and/or has been completely or partially purified from other transcribed sequences (e.g., as in an RNA library). For example, an isolated nucleic acid ofthe invention may be substantially isolated with respect to the complex cellular milieu in which it naturally occurs, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. In some instances, the isolated material will form part of a composition (for example, a crude extract containing other substances), buffer system or reagent mix. In other circumstances, the material may be purified to essential homogeneity, for example as determined by PAGE or column chromatography such as HPLC. In certain embodiments, an isolated nucleic acid molecule comprises at least about 50, 80 or 90% (on a molar basis) of all macromolecular species present. With regard to genomic DNA, the term "isolated" also can refer to nucleic acid molecules that are separated from the chromosome with which the genomic DNA is naturally associated. For example, the isolated nucleic acid molecule can contain less than about 5 kb, including but not limited to 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotides which flank the nucleic acid molecule in the genomic DNA ofthe cell from which the nucleic acid molecule is derived.
The nucleic acid molecule can be fused to other coding or regulatory sequences and still be considered isolated. Thus, recombinant DNA contained in a vector is included in the definition of "isolated" as used herein. Also, isolated nucleic acid molecules include recombinant DNA molecules in heterologous host cells, as well as partially or substantially purified DNA molecules in solution. "Isolated" nucleic acid molecules also encompass in vivo and in vitro RNA transcripts ofthe DNA molecules ofthe present invention. An isolated nucleic acid molecule or nucleic acid sequence can include a nucleic acid molecule or nucleic acid sequence that is synthesized chemically or by recombinant means. Therefore, recombinant DNA contained in a vector is included in the definition of "isolated" as used herein. Also, isolated nucleotide sequences include recombinant DNA molecules in heterologous organisms, as well as partially or substantially purified DNA <sup>'</sup> molecules in solution. In vivo and in vitro RNA transcripts ofthe DNA molecules ofthe present invention are also encompassed by "isolated" nucleotide sequences. Such isolated nucleotide sequences are useful in the manufacture ofthe encoded polypeptide, as probes for isolating homologous sequences (e.g., from other mammalian species), for gene mapping (e.g., by in situ hybridization with chromosomes), or for detecting expression ofthe nucleic acid in tissue (e.g. , human tissue), such as by Northern blot analysis.
The present invention also pertains to nucleic acid molecules which are not necessarily found in nature but which encode a FLAP polypeptide (e.g. , a polypeptide having an amino acid sequence comprising an amino acid sequence of SEQ ID NOs: 2), or another splicing variant of a FLAP polypeptide or polymoφhic variant thereof. Thus, for example, DNA molecules that comprise a sequence that is different from the naturally occurring nucleic acid sequence but which, due to the degeneracy ofthe genetic code, encode a FLAP polypeptide ofthe present invention are also the subjects of this invention. The invention also encompasses nucleotide sequences encoding portions (fragments), or encoding variant polypeptides such as analogues or derivatives of a FLAP polypeptide. Such variants can be naturally occurring, such as in the case of allelic variation or single nucleotide polymoφhisms, or non-naturally-occurring, such as those induced by various mutagens and mutagenic processes. Intended variations include, but are not limited to, addition, deletion and substitution of one or more nucleotides that can result in conservative or non-conservative amino acid changes, including additions and deletions. Preferably the nucleotide (and/or resultant amino acid) changes are silent or conserved; that is, they do not alter the characteristics or activity of a FLAP polypeptide. In one preferred embodiment, the nucleotide sequences are fragments that comprise one or more polymoφhic microsatellite markers, hi another preferred embodiment, the nucleotide sequences are fragments that comprise one or more single nucleotide polymoφhisms in a FLAP nucleic acid (e.g., the single nucleotide polymoφhisms set forth in Table 3, below).
Other alterations ofthe nucleic acid molecules ofthe invention can include, for example, labeling, methylation, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates), charged linkages (e.g., phosphorothioates, phosphorodithioates), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids). Also included are synthetic molecules that mimic nucleic acid molecules in the ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone ofthe molecule. The invention also pertains to nucleic acid molecules that hybridize under high stringency hybridization conditions, such as for selective hybridization, to a nucleic acid sequence described herein (e.g., nucleic acid molecules which specifically hybridize to a nucleic acid sequence encoding polypeptides described herein, and, optionally, have an activity ofthe polypeptide). In one embodiment, the invention includes variants described herein which hybridize under high stringency hybridization conditions (e.g., for selective hybridization) to a nucleic acid sequence comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 or 3 or the complement thereof, hi another embodiment, the invention includes variants described herein which hybridize under high stringency hybridization conditions (e.g., for selective hybridization) to a nucleic acid sequence encoding an amino acid sequence of SEQ ED NO: 2 or a polymoφhic variant thereof. In a preferred embodiment, the variant that hybridizes under high stringency hybridizations has an activity of a FLAP. Such nucleic acid molecules can be detected and/or isolated by specific hybridization (e.g., under high stringency conditions). "Specific hybridization," as used herein, refers to the ability of a first nucleic acid to hybridize to a second nucleic acid in a manner such that the first nucleic acid does not hybridize to any nucleic acid other than to the second nucleic acid (e.g., when the first nucleic acid has a higher similarity to the second nucleic acid than to any other nucleic acid in a sample wherein the hybridization is to be perfoπned). "Stringency conditions" for hybridization is a term of art which refers to the incubation and wash conditions, e.g., conditions of temperature and buffer concentration, which permit hybridization of a particular nucleic acid to a second nucleic acid; the first nucleic acid may be perfectly (i.e., 100%) complementary to the second, or the first and second may share some degree of complementarity that is less than perfect (e.g., 70%, 75%, 85%, 95%). For example, certain high stringency conditions can be used which distinguish perfectly complementary nucleic acids from those of less complementarity. "High stringency conditions", "moderate stringency conditions" and "low stringency conditions" for nucleic acid hybridizations are explained on pages 2.10.1-2.10.16 and pages 6.3.1-6.3.6 in Current Protocols in Molecular Biology (Ausubel, F.M. et al, "Current Protocols in Molecular Biology", John Wiley & Sons, (1998), the entire teachings of which are incoφorated by reference herein). The exact conditions which determine the stringency of hybridization depend not only on ionic strength (e.g., 0.2X
SSC, 0.1X SSC), temperature (e.g., room temperature, 42°C, 68°C) and the concentration of destabilizing agents such as formamide or denaturing agents such as SDS, but also on factors such as the length ofthe nucleic acid sequence, base composition, percent mismatch between hybridizing sequences and the frequency of occurrence of subsets of that sequence within other non- identical sequences. Thus, equivalent conditions can be determined by varying one or more of these parameters while maintaining a similar degree of identity or similarity between the two nucleic acid molecules. Typically, conditions are used such that sequences at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 95% or more identical to each other remain hybridized to one another. By varying hybridization conditions from a level of stringency at which no hybridization occurs to a level at which hybridization is first observed, conditions which will allow a given sequence to hybridize (e.g., selectively) with the most similar sequences in the sample can be determined. Exemplary conditions are described in Krause, M.H. and S.A.
Aaronson, Methods in Enzymology 200: 546-556 (1991), and in, Ausubel, et al, "Current Protocols in Molecular Biology" , John Wiley & Sons, (1998), which describes the determination of washing conditions for moderate or low stringency conditions. Washing is the step in which conditions are usually set so as to determine a minimum level of complementarity ofthe hybrids.
Generally, starting from the lowest temperature at which only homologous hybridization occurs, each °C by which the final wash temperature is reduced (holding SSC concentration constant) allows an increase by 1% in the maximum extent of mismatching among the sequences that hybridize. Generally, doubling the concentration of SSC results in an increase in T<sub>ra</sub> of -
17°C. Using these guidelines, the washing temperature can be determined empirically for high, moderate or low stringency, depending on the level of mismatch sought.
For example, a low stringency wash can comprise washing in a solution containing 0.2X SSC/0.1 % SDS for 10 minutes at room temperature; a moderate stringency wash can comprise washing in a prewarmed solution (42°C) solution containing 0.2X SSC/0.1% SDS for 15 minutes at 42°C; and a high stringency wash can comprise washing in prewarmed (68°C) solution containing 0.1X SSC/0.1%SDS for 15 minutes at 68°C. Furthermore, washes can be performed repeatedly or sequentially to obtain a desired result as ' known in the art. Equivalent conditions can be determined by varying one or more ofthe parameters given as an example, as known in the art, while maintaining a similar degree of identity or similarity between the target nucleic acid molecule and the primer or probe used. The percent homology or identity of two nucleotide or amino acid sequences can be determined by aligning the sequences for optimal comparison puφoses (e.g., gaps can be introduced in the sequence of a first sequence for optimal alignment). The nucleotides or amino acids at corresponding positions are then compared, and the percent identity between the two sequences is a function ofthe number of identical positions shared by the sequences (i.e., % identity = # of identical positions/total # of positions x
100). When a position in one sequence is occupied by the same nucleotide or amino acid residue as the corresponding position in the other sequence, then the molecules are homologous at that position. As used herein, nucleic acid or amino acid "homology" is equivalent to nucleic acid or amino acid "identity". In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, for example, at least 40%, in certain embodiments at least 60%, and in other embodiments at least 70%, 80%, 90% or 95% ofthe length ofthe reference sequence. The actual comparison ofthe two sequences can be accomplished by well-known methods, for example, using a mathematical algorithm. A preferred, non-limiting example of such a mathematical algorithm is described in Karlin et al, Proc. Natl. Acad. Sci. USA 90:5873-5877 (1993). Such an algorithm is incoφorated into the NBLAST and XBLAST programs (version 2.0) as described in Altschul et al, Nucleic Acids Res. 25:389-3402 (1997). When utilizing BLAST and Gapped BLAST programs, the default parameters ofthe respective programs (e.g. ,
NBLAST) can be used. In one embodiment, parameters for sequence comparison can be set at score=100, wordlength=12, or can be varied (e.g., W=5 or W=20).
Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller,
CABIOS 4(1): 11-17 (1988). Such an algorithm is incoφorated into the ALIGN program (version 2.0) which is part ofthe GCG sequence alignment software package (Accelrys, Cambridge, UK). When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
Additional algorithms for sequence analysis are known in the art and include ADNANCE and ADAM as described in Torellis and Robotti, Comput. Appl Biosci. 10:3-5 (1994); and FASTA described in Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444-8 (1988).
In another embodiment, the percent identity between two amino acid sequences can be accomplished using the GAP program in the GCG software package using either a BLOSUM63 matrix or a PAM250 matrix, and a gap weight of 12, 10, 8, 6, or 4 and a length weight of 2, 3, or 4. In yet another embodiment, the percent identity between two nucleic acid sequences can be accomplished using the GAP program in the GCG software package using a gap weight of 50 and a length weight of 3.
The present invention also provides isolated nucleic acid molecules that contain a fragment or portion that hybridizes under highly stringent conditions to a nucleic acid sequence comprising SEQ ID NO: 1 or 3 or the complement of SEQ ID NO: 1 or 3, and also provides isolated nucleic acid molecules that contain a fragment or portion that hybridizes under highly stringent conditions to a nucleic acid sequence encoding an amino acid sequence ofthe invention or polymoφhic variant thereof. The nucleic acid fragments ofthe invention are at least about 15, for example, at least about 18, 20, 23 or 25 nucleotides, and can be 30, 40, 50, 100, 200 or more nucleotides in length. Longer fragments, for example, 30 or more nucleotides in length, encoding antigenic polypeptides described herein are particularly useful, such as for the generation of antibodies as described below.
Probes and Primers In a related aspect, the nucleic acid fragments ofthe invention are used as probes or primers in assays such as those described herein. "Probes" or "primers" are oligonucleotides that hybridize in a base-specific manner to a complementary strand of nucleic acid molecules. Such probes and primers include polypeptide nucleic acids, as described in Nielsen et al( Science 254:1497-1500 (1991)). A probe or primer comprises a region of nucleic acid that hybridizes to at least about 15, for example about 20-25, and in certain embodiments about 40, 50 or 75, consecutive nucleotides of a nucleic acid ofthe invention, such as a nucleic acid comprising a contiguous nucleic acid sequence of SEQ ID NOs: 1 or 3 or the complement of SEQ ID Nos: 1 or 3, or a nucleic acid sequence encoding an amino acid sequence of SEQ ID NO: 2 or polymoφhic variant thereof, hi preferred embodiments, a probe or primer comprises 100 or fewer nucleotides, in certain embodiments, from 6 to 50 nucleotides, for example, from 12 to 30 nucleotides. In other embodiments, the probe or primer is at least 70% identical to the contiguous nucleic acid sequence or to the complement ofthe contiguous nucleotide sequence, for example, at least 80% identical, in certain embodiments at least 90% identical, and in other embodiments at least 95% identical, or even capable of selectively hybridizing to the contiguous nucleic acid sequence or to the complement ofthe contiguous nucleotide sequence. Often, the probe or primer further comprises a label, e.g., radioisotope, fluorescent compound, enzyme, or enzyme co- factor.
The nucleic acid molecules ofthe invention such as those described above can be identified and isolated using standard molecular biology techniques and the sequence information provided herein. For example, nucleic acid molecules can be amplified and isolated using the polymerase chain reaction and synthetic oligonucleotide primers based on one or more of SEQ ID NOs: 1 or 3, or the complement thereof, or designed based on nucleotides based on sequences encoding one or more ofthe amino acid sequences provided herein. See generally PCR Technology: Principles and
Applications for DNA Amplification (ed. H. A. Erlich, Freeman Press, NY, NY, 1992); PCR Protocols: A Guide to Methods and Applications (Eds. Innis et al, Academic Press, San Diego, CA, 1990); Mattila et al, Nucl. Acids Res. 19:4967 (1991); Eckert et al, PCR Methods and Applications 1:17 (1991); PCR (eds. McPherson et a , IRL Press, Oxford); and U.S. Patent 4,683,202.
The nucleic acid molecules can be amplified using cDNA, mRNA or genomic DNA as a template, cloned into an appropriate vector and characterized by DNA sequence analysis.
Other suitable amplification methods include the ligase chain reaction (LCR) (see Wu and Wallace, Genomics 4:560 (1989), Landegren et al, Science 241 :1077 (1988), transcription amplification (Kwoh^t al, Proc. Natl.
Acad. Sci. USA 86:1173 (1989)), and self-sustained sequence replication (Guatelli et al, Proc. Nat. Acad. Sci. USA 87:1874 (1990)) and nucleic acid based sequence amplification (NASBA). The latter two amplification methods involve isothermal reactions based on isothermal transcription, which produce both single stranded RNA (ssRNA) and double stranded DNA
(dsDNA) as the amplification products in a ratio of about 30 or 100 to 1, respectively.
The amplified DNA can be labeled, for example, radiolabeled, and used as a probe for screening a cDNA library derived from human cells, mRNA in zap express, ZIPLOX or other suitable vector. Corresponding clones can be isolated, DNA can obtained following in vivo excision, and the cloned insert can be sequenced in either or both orientations by art recognized methods to identify the correct reading frame encoding a polypeptide ofthe appropriate molecular weight. For example, the direct analysis ofthe nucleic acid molecules ofthe present invention can be accomplished using well- known methods that are commercially available. See, for example, Sambrook et al, Molecular Cloning, A Laboratory Manual (2nd Ed., CSHP, New York 1989); Zyskind et al, Recombinant DNA Laboratory Manual, (Acad. Press, 1988)). Using these or similar methods, the polypeptide and the DNA encoding the polypeptide can be isolated, sequenced and further characterized.
Antisense nucleic acid molecules ofthe invention can be designed using the nucleotide sequences of SEQ ID NOs: 1 or 3 and/or the complement of one or more of SEQ ID NOs: 1 or 3 and/or a portion of one or more of SEQ ID NOs: 1 or 3 or the complement of one or more of SEQ ID NOs: 1 or 3 and/or a sequence encoding the amino acid sequences of SEQ ID NOs: 2 or encoding a portion of one or more of SEQ ID NOs: 1 or 3 or their complement. They can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid molecule (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability ofthe molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Alternatively, the antisense nucleic acid molecule can be produced biologically using an expression vector into which a nucleic acid molecule has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid molecule will be of an antisense orientation to a target nucleic acid of interest).
The nucleic acid sequences can also be used to compare with endogenous DNA sequences in patients to identify one or more ofthe disorders related to FLAP, and as probes, such as to hybridize and discover related DNA sequences or to subtract out known sequences from a sample. The nucleic acid sequences can further be used to derive primers for genetic fingeφrinting, to raise anti-polypeptide antibodies using DNA immunization techniques, and as an antigen to raise anti-DNA antibodies or elicit immune responses. Portions or fragments ofthe nucleotide sequences identified herein
(and the corresponding complete gene sequences) can be used in numerous ways as polynucleotide reagents. For example, these sequences can be used to: (i) map their respective genes on a chromosome; and, thus, locate gene regions or nucleic acid regions associated with genetic disease; (ii) identify an individual from a minute biological sample (tissue typing); and (iii) aid in forensic identification of a biological sample. Additionally, the nucleotide sequences ofthe invention can be used to identify and express recombinant polypeptides for analysis, characterization or therapeutic use, or as markers for tissues in which the corresponding polypeptide is expressed, either constitutively, during tissue differentiation, or in diseased states. The nucleic acid sequences can additionally be used as reagents in the screening and/or diagnostic assays described herein, and can also be included as components of kits (e.g., reagent kits) for use in the screening and/or diagnostic assays described herein.
Vectors
Another aspect ofthe invention pertains to nucleic acid constructs containing a nucleic acid molecule of SEQ ID NOs: 1 or 3 or the complement thereof (or a portion thereof). Yet another aspect o the invention pertains to nucleic acid constructs containing a nucleic acid molecule encoding an amino acid of SEQ ID NO: 2 or polymoφhic variant thereof. The constructs comprise a vector (e.g., an expression vector) into which a sequence ofthe invention has been inserted in a sense or antisense orientation. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non- episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors, such as expression vectors, are capable of directing the expression of genes or nucleic acids to which they are operably linked, hi general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno- associated viruses) that serve equivalent functions. Preferred recombinant expression vectors ofthe invention comprise a nucleic acid molecule ofthe invention in a form suitable for expression ofthe nucleic acid molecule in a host cell. This means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis ofthe host cells to be used for expression, which is operably linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" or "operatively linked" is intended to mean that the nucleic acid sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression ofthe nucleic acid sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, "Gene Expression Technology", Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those which direct constitutive expression of a nucleic acid sequence in many types of host cell and those which direct expression ofthe nucleic acid sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice ofthe host cell to be transformed and the level of expression of polypeptide desired. The expression vectors ofthe invention can be introduced into host cells to thereby produce polypeptides, including fusion polypeptides, encoded by nucleic acid molecules as described herein.
The recombinant expression vectors ofthe invention can be designed for expression of a polypeptide ofthe mvention in prokaryotic or eukaryotic cells, e.g., bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, supra. Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase. Another aspect ofthe invention pertains to host cells into which a recombinant expression vector ofthe invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope ofthe term as used herein. A host cell can be any prokaryotic or eukaryotic cell. For example, a nucleic acid molecule ofthe invention can be expressed in bacterial cells (e.g., E. coli), insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.
Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing a foreign nucleic acid molecule
(e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DΕAΕ-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (supra), and other laboratory manuals. For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene or nucleic acid that encodes a selectable marker (e.g., for resistance to antibiotics) is generally introduced into the host cells along with the gene or nucleic acid of interest. Preferred selectable markers include those that confer resistance to drugs, such as G418, hygromycin and methofrexate. Nucleic acid molecules encoding a selectable marker can be introduced into a host cell on the same vector as the nucleic acid molecule ofthe invention or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid molecule can be identified by drug selection (e.g., cells that have incoφorated the selectable marker gene or nucleic acid will survive, while the other cells die).
A host cell ofthe invention, such as a prokaryotic host cell or eukaryotic host cell in culture can be used to produce (i.e., express) a polypeptide ofthe invention. Accordingly, the invention further provides methods for producing a polypeptide using the host cells ofthe invention. In one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding a polypeptide ofthe invention has been introduced) in a suitable medium such that the polypeptide is produced. In another embodiment, the method further comprises isolating the polypeptide from the medium or the host cell.
The host cells ofthe invention can also be used to produce nonhuman transgenic animals. For example, in one embodiment, a host cell ofthe invention is a fertilized oocyte or an embryonic stem cell into which a nucleic acid molecule ofthe invention has been introduced (e.g., an exogenous FLAP nucleic acid, or an exogenous nucleic acid encoding a FLAP polypeptide). Such host cells can then be used to create non-human transgenic animals in which exogenous nucleotide sequences have been introduced into the genome or homologous recombinant animals in which endogenous nucleotide sequences have been altered. Such animals are useful for studying the function and/or activity ofthe nucleic acid sequence and polypeptide encoded by the sequence and for identifying and/or evaluating modulators of their activity. As used herein, a "fransgenic animal" is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in which one or more ofthe cells ofthe animal include a fransgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens and amphibians. A fransgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome ofthe mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues ofthe transgenic animal. As used herein, an "homologous recombinant animal" is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell ofthe animal, e.g., an embryonic cell of the animal, prior to development ofthe animal.
Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009, U.S. Pat. No. 4,873,191 and in Hogan, Manipulating t/?e Mouse Embryo (Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1986). Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley, Current Opinion in BioTechnology 2:823-829 (1991) and in PCT Publication Nos. WO 90/11354, WO 91/01140, WO 92/0968, and WO 93/04169. Clones of the non-human transgenic animals described herein can also be produced according to the methods described in Wilmut et al, Nature 385:810-813 (1997) and PCT Publication Nos. WO 97/07668 and WO 97/07669.
POLYPEPTIDES OF THE INVENTION The present invention also pertains to isolated polypeptides encoded by
FLAP nucleic acids ("FLAP polypeptides"), and fragments and variants thereof, as well as polypeptides encoded by nucleotide sequences described herein (e.g., other splicing variants). The term "polypeptide" refers to a polymer of amino acids, and not to a specific length; thus, peptides, oligopeptides and proteins are included within the definition of a polypeptide.
As used herein, a polypeptide is said to be "isolated" or "purified" when it is substantially free of cellular material when it is isolated from recombinant and non-recombinant cells, or free of chemical precursors or other chemicals when it is chemically synthesized. A polypeptide, however, can be joined to another polypeptide with which it is not normally associated in a cell (e.g. , in a "fusion protein") and still be "isolated" or "purified." The polypeptides ofthe invention can be purified to homogeneity. It is understood, however, that preparations in which the polypeptide is not purified to homogeneity are useful. The critical feature is that the preparation allows for the desired function ofthe polypeptide, even in the presence of considerable amounts of other components. Thus, the invention encompasses various degrees of purity. In one embodiment, the language "substantially free of cellular material" includes preparations ofthe polypeptide having less than about 30% (by dry weight) other proteins (i.e., contaminating protein), less than about 20% other proteins, less than about 10% other proteins, or less than about 5% other proteins.
When a polypeptide is recombinantly produced, it can also be substantially free of culture medium, i.e., culture medium represents less than about 20%, less than about 10%, or less than about 5% ofthe volume ofthe polypeptide preparation. The language "substantially free of chemical precursors or other chemicals" includes preparations ofthe polypeptide in which it is separated from chemical precursors or other chemicals that are involved in its synthesis. In one embodiment, the language "substantially free of chemical precursors or other chemicals" includes preparations ofthe polypeptide having less than about 30% (by dry weight) chemical precursors or other chemicals, less than about 20% chemical precursors or other chemicals, less than about 10% chemical precursors or other chemicals, or less than about 5% chemical precursors or other chemicals.
In one embodiment, a polypeptide ofthe invention comprises an amino acid sequence encoded by a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 or 3, or the complement of SEQ ID NO: 1 or 3, or portions thereof, or a portion or polymoφhic variant thereof. However, the polypeptides ofthe invention also encompass fragment and sequence variants. Variants include a substantially homologous polypeptide encoded by the same genetic locus in an organism, i.e., an allelic variant, as well as other splicing variants. Variants also encompass polypeptides derived from other genetic loci in an organism, but having substantial homology to a polypeptide encoded by a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ED NOs: 1 or 3 or their complement, or portions thereof, or having substantial homology to a polypeptide encoded by a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of nucleotide sequences encoding SEQ ED NO: 2 or polymoφliic variants thereof. Variants also include polypeptides substantially homologous or identical to these polypeptides but derived from another organism, i.e., an ortholog. Variants also include polypeptides that are substantially homologous or identical to these polypeptides that are produced by chemical synthesis. Variants also include polypeptides that are substantially homologous or identical to these polypeptides that are produced by recombinant methods.
As used herein, two polypeptides (or a region ofthe polypeptides) are substantially homologous or identical when the amino acid sequences are at least about 45-55%, in certain embodiments at least about 70-75%, and in other embodiments at least about 80-85%, and in others greater than about 90% or more homologous or identical. A substantially homologous amino acid sequence, according to the present invention, will be encoded by a nucleic acid molecule hybridizing to SEQ ID NO: 1 or 3 or portion thereof, under stringent conditions as more particularly described above, or will be encoded by a nucleic acid molecule hybridizing to a nucleic acid sequence encoding SEQ ID NO: 2 or a portion thereof or polymoφhic variant thereof, under stringent conditions as more particularly described thereof. The invention also encompasses polypeptides having a lower degree of identity but having sufficient similarity so as to perform one or more ofthe same functions performed by a polypeptide encoded by a nucleic acid molecule ofthe invention. Similarity is determined by conserved amino acid substitution. Such substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Conservative substitutions are likely to be phenotypically silent. Typically seen as conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and He; interchange ofthe hydroxyl residues Ser and Thr, exchange ofthe acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange ofthe basic residues Lys and Arg and replacements among the aromatic residues Phe and
Tyr. Guidance concerning which amino acid changes are likely to be phenotypically silent are found in Bowie et al, Science 247:1306-1310 (1990).
A variant polypeptide can differ in amino acid sequence by one or more substitutions, deletions, insertions, inversions, fusions, and truncations or a combination of any of these. Further, variant polypeptides can be fully functional or can lack function in one or more activities. Fully functional variants typically contain only conservative variation or variation in non- critical residues or in non-critical regions. Functional variants can also contain substitution of similar amino acids that result in no change or an insignificant change in function. Alternatively, such substitutions may positively or negatively affect function to some degree. Non-functional variants typically contain one or more non-conservative amino acid substitutions, deletions, insertions, inversions, or truncation or a substitution, insertion, inversion, or deletion in a critical residue or critical region.
Amino acids that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine- scanning mutagenesis (Cunningham et al, Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity in vitro, or in vitro prohferative activity. Sites that are critical for polypeptide activity can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol. Biol. 224:899-904 (1992); de Vos et al, Science 255:306-312 (1992)). The invention also includes fragments ofthe polypeptides ofthe invention. Fragments can be derived from a polypeptide encoded by a nucleic acid molecule comprising SEQ ID NO: 1 or 3, or the complement of SEQ ID NO: 1 or 3 (or other variants). However, the invention also encompasses fragments ofthe variants ofthe polypeptides described herein. As used herein, a fragment comprises at least 6 contiguous amino acids. Useful fragments include those that retain one or more ofthe biological activities of the polypeptide as well as fragments that can be used as an immunogen to generate polypeptide-specific antibodies. Biologically active fragments (peptides which are, for example, 6, 9,
12, 15, 16, 20, 30, 35, 36, 37, 38, 39, 40, 50, 100 or more amino acids in length) can comprise a domain, segment, or motif that has been identified by analysis ofthe polypeptide sequence using well-known methods, e.g., signal peptides, extracellular domains, one or more transmembrane segments or loops, ligand binding regions, zinc finger domains, DNA binding domains, acylation sites, glycosylation sites, or phosphorylation sites.
Fragments can be discrete (not fused to other amino acids or polypeptides) or can be within a larger polypeptide. Further, several fragments can be comprised within a single larger polypeptide. In one embodiment a fragment designed for expression in a host can have heterologous pre- and pro-polypeptide regions fused to the amino terminus of the polypeptide fragment and an additional region fused to the carboxyl terminus ofthe fragment.
The invention thus provides chimeric or fusion polypeptides. These comprise a polypeptide ofthe invention operatively linked to a heterologous protein or polypeptide having an amino acid sequence not substantially homologous to the polypeptide. "Operatively linked" indicates that the polypeptide and the heterologous protein are fused in-frame. The heterologous protein can be fused to the N-terminus or C-terminus ofthe polypeptide. In one embodiment the fusion polypeptide does not affect function ofthe polypeptide er se. For example, the fusion polypeptide can be a GST-fusion polypeptide in which the polypeptide sequences are fused to the C-terminus ofthe GST sequences. Other types of fusion polypeptides include, but are not limited to, enzymatic fusion polypeptides, for example beta- galactosidase fusions, yeast two-hybrid GAL fusions, poly-His fusions and Ig fusions. Such fusion polypeptides, particularly poly-His fusions, can facilitate the purification of recombinant polypeptide. In certain host cells (e.g. , mammalian host cells), expression and/or secretion of a polypeptide can be increased using a heterologous signal sequence. Therefore, in another embodiment, the fusion polypeptide contains a heterologous signal sequence at its N-terminus.
EP-A-O 464 533 discloses fusion proteins comprising various portions of immunoglobulin constant regions. The Fc is useful in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232 262). In drug discovery, for example, human proteins have been fused with Fc portions for the puφose of high-throughput screening assays to identify antagonists. Bennett et al, Journal of Molecular Recognition, 5:52-58 (1995) and Johanson et al, The Journal of Biological Chemistry, 270,16:9459-9471 (1995). Thus, this invention also encompasses soluble fusion polypeptides containing a polypeptide ofthe invention and various portions ofthe constant regions of heavy or light chains of immunoglobulins of various subclasses (IgG, IgM, IgA, IgE).
A chimeric or fusion polypeptide can be produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of nucleic acid fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive nucleic acid fragments which can subsequently be annealed and re-amplified to generate a chimeric nucleic acid sequence (see Ausubel et al, Current Protocols in Molecular Biology, 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST protein). A nucleic acid molecule encoding a polypeptide ofthe invention can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the polypeptide. The isolated polypeptide can be purified from cells that naturally express it, purified from cells that have been altered to express it (recombinant), or synthesized using known protein synthesis methods. In one embodiment, the polypeptide is produced by recombinant DNA techniques. For example, a nucleic acid molecule encoding the polypeptide is cloned into an expression vector, the expression vector introduced into a host cell and the polypeptide expressed in the host cell. The polypeptide can then be isolated from the cells by an appropriate purification scheme using standard protein purification techniques.
The polypeptides ofthe present invention can be used to raise antibodies or to elicit an immune response. The polypeptides can also be used as a reagent, e.g., a labeled reagent, in assays to quantitatively determine levels ofthe polypeptide or a molecule to which it binds (e.g., a ligand) in biological fluids. The polypeptides can also be used as markers for cells or tissues in which the corresponding polypeptide is preferentially expressed, either constitutively, during tissue differentiation, or in diseased states. The polypeptides can be used to isolate a corresponding binding agent, e.g., ligand, such as, for example, in an interaction trap assay, and to screen for peptide or small molecule antagonists or agonists ofthe binding interaction. For example, because members ofthe leukotriene pathway including FLAP bind to receptors, the leukotriene pathway polypeptides can be used to isolate such receptors.
ANTIBODIES OF THE INVENTION
Polyclonal and/or monoclonal antibodies that specifically bind one form ofthe polypeptide or nucleic acid product (e.g., a polypeptide encoded by a nucleic acid having a SNP as set forth in Table 3), but not to another form of the polypeptide or nucleic acid product, are also provided. Antibodies are also provided which bind a portion of either polypeptide encoded by nucleic acids ofthe invention (e.g., SEQ ID NO: 1 or SEQ ID NO:3, or the complement of SEQ ED NO: 1 or SEQ ED NO:3), or to a polypeptide encoded by nucleic acids ofthe invention that contain a polymoφhic site or sites. The invention also provides antibodies to the polypeptides and polypeptide fragments ofthe invention, or a portion thereof, or having an amino acid sequence encoded by a nucleic acid molecule comprising all or a portion of SEQ ID NOs: 1 or 3, or the complement thereof, or another variant or portion thereof.
The term "antibody" as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that specifically binds an antigen. A molecule that specifically bmds to a polypeptide ofthe invention is a molecule that binds to that polypeptide or a fragment thereof, but does not substantially bind other molecules in a sample, e.g., a biological sample, which naturally contains the polypeptide. Examples of immunologically active portions of immunoglobulin molecules include F(ab) and F(ab') fragments which can be generated by treating the antibody with an enzyme such as pepsin. The invention provides polyclonal and monoclonal antibodies that bind to a polypeptide ofthe invention. The term "monoclonal antibody" or "monoclonal antibody composition", as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of a polypeptide ofthe invention. A monoclonal antibody composition thus typically displays a single binding affinity for a particular polypeptide ofthe invention with which it immunoreacts.
Polyclonal antibodies can be prepared as described above by immunizing a suitable subject with a desired immunogen, e.g., polypeptide of the invention or fragment thereof. The antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized polypeptide. If desired, the antibody molecules directed against the polypeptide can be isolated from the mammal (e.g., from the blood) and ftirther purified by well- known techniques, such as protein A chromatography to obtain the IgG fraction. At an appropriate time after immunization, e.g., when the antibody titers are highest, antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein, Nature 256:495-497 (1975), the human B cell hybridoma technique (Kozbor et al, Immunol Today 4:72 (1983)); the EBV-hybridoma technique (Cole et al,
Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, 1985, Inc., pp. 77- 96); or frioma techniques. The technology for producing hybridomas is well known (see generally Current Protocols in Immunology (1994) Coligan et al. (eds.) John Wiley & Sons, Inc., New York, NY). Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with an immunogen as described above, and the culture supematants ofthe resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds a polypeptide ofthe invention. Any ofthe many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the pvupose of generating a monoclonal antibody to a polypeptide ofthe invention (see, e.g., Current Protocols in Immunology, supra; Galfre et al, Nature 266:55052 (1977); R.H. Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Coφ., New York, New York (1980); and Lerner,
YaleJ. Biol. Med. 54:387-402 (1981). Moreover, the ordinarily skilled worker will appreciate that there are many variations of such methods that also would be useful.
Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal antibody to a polypeptide ofthe invention can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g, an antibody phage display library) with the polypeptide to thereby isolate immunoglobulin library members that bind the polypeptide. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27- 9400-01 ; and the Stratagene Sur ZAP™ Phage Display Kit, Catalog No.
240612). Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, U.S. Patent No. 5,223,409; PCT Publication No. WO 92/18619; PCT Publication No. WO 91/17271; PCT Publication No. WO 92/20791; PCT Publication No. WO 92/15679; PCT Publication No. WO
93/01288; PCT Publication No. WO 92/01047; PCT Publication No. WO 92/09690; PCT Publication No. WO 90/02809; Fuchs et al, Bio/Technology 9: 1370-1372 (1991); Hay et al, Hum. Antibod. Hybridomas 3:81-85 (1992); Huse et al, Science 246:1275-1281 (1989); Griffiths et al, EMBO J. 12:725- 734 (1993).
Additionally, recombinant antibodies, such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope ofthe invention. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art.
In general, antibodies ofthe invention (e.g., a monoclonal antibody) can be used to isolate a polypeptide ofthe invention by standard techniques, such as affinity chromatography or immunoprecipitation. A polypeptide- specific antibody can facilitate the purification of natural polypeptide from cells and of recombinantly produced polypeptide expressed in host cells.
Moreover, an antibody specific for a polypeptide ofthe invention can be used to detect the polypeptide (e.g., in a cellular lysate, cell supernatant, or tissue sample) in order to evaluate the abundance and pattern of expression ofthe polypeptide. Antibodies can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, e.g. , to, for example, determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin and aequorin, and examples of suitable radioactive material include <sup>125</sup>L <sup>131</sup>I, <sup>35</sup>S o <sup>3</sup>H.
As described above, antibodies to leukotrienes can be used in the methods ofthe invention. The methods described herein can be used to generate such antibodies for use in the methods.
DIAGNOSTIC ASSAYS
The nucleic acids, probes, primers, polypeptides and antibodies described herein can be used in methods of diagnosis of MI or diagnosis of a susceptibility to MI or to a disease or condition associated with an MI gene, such as FLAP, as well as in kits useful for diagnosis of MI or a susceptibility to MI or to a disease or condition associated with FLAP. In one embodiment, the kit useful for diagnosis of MI or susceptibility to MI, or to a disease or condition associated with FLAP comprises primers as described herein, wherein the primers contain one or more ofthe SNPs identified in Table 3.
In one embodiment ofthe invention, diagnosis of MI or susceptibility to MI (or diagnosis of or susceptibility to a disease or condition associated with FLAP), is made by detecting a polymoφhism in a FLAP nucleic acid as described herein. The polymoφhism can be an alteration in a FLAP nucleic acid, such as the insertion or deletion of a single nucleotide, or of more than one nucleotide, resulting in a frame shift alteration; the change of at least one nucleotide, resulting in a change in the encoded amino acid; the change of at least one nucleotide, resulting in the generation of a premature stop codon; the deletion of several nucleotides, resulting in a deletion of one or more amino acids encoded by the nucleotides; the insertion of one or several nucleotides, such as by unequal recombination or gene conversion, resulting in an interruption ofthe coding sequence ofthe gene or nucleic acid; duplication of all or a part ofthe gene or nucleic acid; transposition of all or a part ofthe gene or nucleic acid; or rearrangement of all or a part ofthe gene or nucleic acid. More than one such alteration may be present in a single gene or nucleic acid. Such sequence changes cause an alteration in the polypeptide encoded by a FLAP nucleic acid. For example, if the alteration is a frame shift alteration, the frame shift can result in a change in the encoded amino acids, and/or can result in the generation of a premature stop codon, causing generation of a truncated polypeptide. Alternatively, a polymoφhism associated with a disease or condition associated with a FLAP nucleic acid or a susceptibility to a disease or condition associated with a FLAP nucleic acid can be a synonymous alteration in one or more nucleotides (i.e., an alteration that does not result in a change in the polypeptide encoded by a FLAP nucleic acid). Such a polymoφhism may alter splicing sites, affect the stability or transport of mRNA, or otherwise affect the transcription or translation ofthe nucleic acid. A FLAP nucleic acid that has any ofthe alteration described above is referred to herein as an "altered nucleic acid."
In a first method of diagnosing MI or a susceptibility to MI, hybridization methods, such as Southern analysis, Northern analysis, or in situ hybridizations, can be used (see Current Protocols in Molecular Biology,
Ausubel, F. et al, eds., John Wiley & Sons, including all supplements through 1999). For example, a biological sample from a test subject (a "test sample") of genomic DNA, RNA, or cDNA, is obtained from an individual suspected of having, being susceptible to or predisposed for, or carrying a defect for, a susceptibility to a disease or condition associated with a FLAP nucleic acid
(the "test individual"). The individual can be an adult, child, or fetus. The test sample can be from any source which contains genomic DNA, such as a blood sample, sample of amniotic fluid, sample of cerebrospinal fluid, or tissue sample from skin, muscle, buccal or conjunctival mucosa, placenta, gastrointestinal tract or other organs. A test sample of DNA from fetal cells or tissue can be obtained by appropriate methods, such as by amniocentesis or chorionic villus sampling. The DNA, RNA, or cDNA sample is then examined to determine whether a polymoφhism in an MI nucleic acid is present, and/or to determine which splicing variant(s) encoded by the FLAP is present. The presence ofthe polymoφhism or splicing variant(s) can be indicated by hybridization ofthe nucleic acid in the genomic DNA, RNA, or cDNA to a nucleic acid probe. A "nucleic acid probe," as used herein, can be a DNA probe or an RNA probe; the nucleic acid probe can contain at least one polymoφhism in a FLAP nucleic acid or contains a nucleic acid encoding a particular splicing variant of a FLAP nucleic acid. The probe can be any of the nucleic acid molecules described above (e.g. , the nucleic acid, a fragment, a vector comprising the nucleic acid, a probe or primer, etc.).
To diagnose MI or a susceptibility to MI (or a disease or condition associated with FLAP), the test sample containing a FLAP nucleic acid is contacted with at least one nucleic acid probe to form a hybridization sample. A preferred probe for detecting mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to mRNA or genomic DNA sequences described herein. The nucleic acid probe can be, for example, a full-length nucleic acid molecule, or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to appropriate mRNA or genomic DNA. For example, the nucleic acid probe can be all or a portion of one of SEQ ID NOs: 1 and 3, or the complement thereof or a portion thereof; or can be a nucleic acid encoding all or a portion of one of SEQ ID NO: 2. Other suitable probes for use in the diagnostic assays ofthe invention are described above (see e.g. , probes and primers discussed under the heading,
"Nucleic Acids ofthe Invention"). The hybridization sample is maintained under conditions that are sufficient to allow specific hybridization ofthe nucleic acid probe to a FLAP nucleic acid. "Specific hybridization," as used herein, indicates exact hybridization (e.g., with no mismatches). Specific hybridization can be performed under high stringency conditions or moderate stringency conditions, for example, as described above. In a particularly preferred embodiment, the hybridization conditions for specific hybridization are high stringency.
Specific hybridization, if present, is then detected using standard methods. If specific hybridization occurs between the nucleic acid probe and
FLAP nucleic acid in the test sample, then the FLAP has the polymoφhism, or is the splicing variant, that is present in the nucleic acid probe. More than one nucleic acid probe can also be used concurrently in this method. Specific hybridization of any one ofthe nucleic acid probes is indicative of a polymoφhism in the FLAP nucleic acid, or ofthe presence of a particular splicing variant encoding the FLAP nucleic acid, and is therefore diagnostic for a disease or condition associated with FLAP or a susceptibility to a disease or condition associated with FLAP (e.g., MI).
In Northern analysis (see Current Protocols in Molecular Biology, Ausubel, F. et al, eds., John Wiley & Sons, supra) the hybridization methods described above are used to identify the presence of a polymoφhism or a particular splicing variant, associated with a disease or condition associated with or a susceptibility to a disease or condition associated with FLAP (e.g., MI). For Northern analysis, a test sample of RNA is obtained from the individual by appropriate means. Specific hybridization of a nucleic acid probe, as described above, to RNA from the individual is indicative of a polymoφhism in a FLAP nucleic acid, or ofthe presence of a particular splicing variant encoded by a FLAP nucleic acid, and is therefore diagnostic for the disease or condition associated with FLAP, or for susceptibility to a disease or condition associated with FLAP (e.g., MI). For representative examples of use of nucleic acid probes, see, for example, U.S. Patents No. 5,288,611 and 4,851,330.
Alternatively, a peptide nucleic acid (PNA) probe can be used instead of a nucleic acid probe in the hybridization methods described above. PNA is a DNA mimic having a peptide-like, inorganic backbone, such as N-(2- aminoethyl)glycine units, with an organic base (A, G, C, T or U) attached to the glycine nitrogen via a methylene carbonyl linker (see, for example, Nielsen, P.E. et al, Bioconjugate Chemistry 5, American Chemical Society, p. 1 (1994). The PNA probe can be designed to specifically hybridize to a nucleic acid having a polymoφhism associated with a disease or condition associated with FLAP or associated with a susceptibility to a disease or condition associated with FLAP (e.g., MI). Hybridization ofthe PNA probe to a FLAP nucleic acid as described herein is diagnostic for the disease or condition or the susceptibility to the disease or condition. In another method ofthe invention, mutation analysis by restriction digestion can be used to detect an altered nucleic acid, or nucleic acids containing a polymoφhism(s), if the mutation or polymoφhism in the nucleic acid results in the creation or elimination of a restriction site. A test sample contah ing genomic DNA is obtained from the individual. Polymerase chain reaction (PCR) can be used to amplify a FLAP nucleic acid (and, if necessary, the flanking sequences) in the test sample of genomic DNA from the test individual. RFLP analysis is conducted as described (see Current Protocols in Molecular Biology, supra). The digestion pattern ofthe relevant DNA fragment indicates the presence or absence ofthe alteration or polymoφhism in the FLAP nucleic acid, and therefore indicates the presence or absence of a disease or condition associated with FLAP or the susceptibility to a disease or condition associated with FLAP (e.g., MI).
Sequence analysis can also be used to detect specific polymoφhisms in the FLAP nucleic acid. A test sample of DNA or RNA is obtained from the test individual. PCR or other appropriate methods can be used to amplify the nucleic acid, and/or its flanking sequences, if desired. The sequence of a FLAP nucleic acid, or a fragment ofthe nucleic acid, or cDNA, or fragment of the cDNA, or mRNA, or fragment ofthe mRNA, is determined, using standard methods. The sequence ofthe nucleic acid, nucleic acid fragment, cDNA, cDNA fragment, mRNA, or mRNA fragment is compared with the known nucleic acid sequence ofthe nucleic acid, cDNA (e.g., one or more of
SEQ ID NOs: 1 or 3, and/or the complement of SEQ ID NO: 1 or 3), or a nucleic acid sequence encoding SEQ ID NO: 2 or a fragment thereof) or mRNA, as appropriate. The presence of a polymoφhism in the FLAP indicates that the individual has disease or a susceptibility to a disease associated with FLAP (e.g. , MI).
Allele-specific oligonucleotides can also be used to detect the presence of polymoφhism(s) in the FLAP nucleic acid, through the use of dot-blot hybridization of amplified oligonucleotides with allele-specific oligonucleotide (ASO) probes (see, for example, Saiki, R. et al, Nature
324:163-166 (1986)). An "allele-specific oligonucleotide" (also referred to herein as an "allele-specific oligonucleotide probe") is an oligonucleotide of approximately 10-50 base pairs, for example, approximately 15-30 base pairs, that specifically hybridizes to a FLAP nucleic acid, and that contains a polymoφhism associated with a disease or condition associated with FLAP or a susceptibility to a disease or condition associated with FLAP (e.g., MI). An allele-specific oligonucleotide probe that is specific for particular polymoφhisms in a FLAP nucleic acid can be prepared, using standard methods (see Current Protocols in Molecular Biology, supra). To identify polymoφhisms in the nucleic acid associated with disease or susceptibility to disease, a test sample of DNA is obtained from the individual. PCR can be used to amplify all or a fragment of a FLAP nucleic acid, and its flanking sequences. The DNA containing the amplified FLAP nucleic acid (or fragment ofthe nucleic acid) is dot-blotted, using standard methods (see Current Protocols in Molecular Biology, supra), and the blot is contacted with the oligonucleotide probe. The presence of specific hybridization ofthe probe to the amplified FLAP is then detected. Specific hybridization of an allele- specific oligonucleotide probe to DNA from the individual is indicative of a polymoφhism in the FLAP, and is therefore indicative of a disease or condition associated with FLAP or a susceptibility to a disease or condition associated with FLAP (e.g. , MI).
An allele-specific primer hybridizes to a site on target DNA overlapping a polymoφhism and only primes amplification of an allelic form to which the primer exhibits perfect complementarity. See Gibbs, Nucleic Acid Res. 17, 2427-2448 (1989). This primer is used in conjunction with a second primer which hybridizes at a distal site. Amplification proceeds from the two primers, resulting in a detectable product which indicates the particular allelic form is present. A control is usually performed with a second pair of primers, one of which shows a single base mismatch at the polymoφhic site and the other of which exhibits perfect complementarity to a distal site. The single-base mismatch prevents amplification and no detectable product is formed. The method works best when the mismatch is included in the 3'-most position ofthe oligonucleotide aligned with the polymoφhism because this position is most destabilizing to elongation from the primer (see, e.g., WO 93/22456). With the addition of such analogs as locked nucleic acids (LNAs), the size of primers and probes can be reduced to as few as 8 bases. LNAs are a novel class of bicyclic DNA analogs in which the 2' and 4' positions in the furanose ring are joined via an O-methylene (oxy-LNA), S-methylene (thio- LNA), or amino methylene (amino-LNA) moiety. Common to all of these LNA variants is an affinity toward complementary nucleic acids, which is by far the highest reported for a DNA analog. For example, particular all oxy- LNA nonamers have been shown to have melting temperatures of 64 °C and 74 °C when in complex with complementary DNA or RNA, respectively, as oposed to 28 °C for both DNA and RNA for the corresponding DNA nonamer. Substantial increases in T<sub>m</sub> are also obtained when LNA monomers are used in combination with standard DNA or RNA monomers. For primers and probes, depending on where the LNA monomers are included (e.g., the 3' end, the 5'end, or in the middle), the T<sub>m</sub> could be increased considerably. hi another embodiment, arrays of oligonucleotide probes that are complementary to target nucleic acid sequence segments from an individual, can be used to identify polymoφhisms in a FLAP nucleic acid. For example, in one embodiment, an oligonucleotide array can be used. Oligonucleotide arrays typically comprise a plurality of different oligonucleotide probes that are coupled to a surface of a substrate in different known locations. These oligonucleotide arrays, also described as "Genechips™," have been generally described in the art, for example, U.S. Pat. No. 5,143,854 and PCT patent publication Nos. WO 90/15070 and WO 92/10092. These arrays can generally be produced using mechanical synthesis methods or light directed synthesis methods that incoφorate a combination of photolithographic methods and solid phase oligonucleotide synthesis methods. See Fodor et al, Science 251:767-777 (1991); Pirrung et al, U.S. Pat. 5,143,854; (see also PCT
Application WO 90/15070); Fodor et al, PCT Publication WO 92/10092; and U.S. Pat. 5,424,186, the entire teachings of each of which are incoφorated by reference herein. Techniques for the synthesis of these arrays using mechanical synthesis methods are described in, e.g., U.S. Pat. 5,384,261, the entire teachings of which are incoφorated by reference herein. In another example, linear arrays can be utilized.
Once an oligonucleotide array is prepared, a nucleic acid of interest is hybridized with the array and scanned for polymoφhisms. Hybridization and scanning are generally carried out by methods described herein and also in, e.g. , published PCT Application Nos. WO 92/10092 and WO 95/11995, and
U.S. Pat. No. 5,424,186, the entire teachings of which are incoφorated by reference herein. In brief, a target nucleic acid sequence that includes one or more previously identified polymoφhic markers is amplified using well- known amplification techniques, e.g., PCR. Typically, this involves the use of primer sequences that are complementary to the two strands ofthe target sequence both upstream and downstream from the polymoφhism. Asymmetric PCR techniques may also be used. Amplified target, generally incoφorating a label, is then hybridized with the array under appropriate conditions. Upon completion of hybridization and washing ofthe array, the array is scanned to determine the position on the array to which the target sequence hybridizes. The hybridization data obtained from the scan is typically in the form of fluorescence intensities as a function of location on the array, hi a reverse method, a probe, containing a polymoφhism, can be coupled to a solid surface and PCR amplicons are then added to hybridize to these probes. Although primarily described in terms of a single detection block, e.g. , detection of a single polymoφhism arrays can include multiple detection blocks, and thus be capable of analyzing multiple, specific polymoφhisms. It will generally be understood that detection blocks may be grouped within a single array or in multiple, separate arrays so that varying, optimal conditions may be used during the hybridization ofthe target to the array. For example, it may often be desirable to provide for the detection of those polymoφhisms that fall within G-C rich stretches of a genomic sequence, separately from those falling in A-T rich segments. This allows for the separate optimization of hybridization conditions for each situation. Additional uses of oligonucleotide arrays for detection of polymoφhisms can be found, for example, in U.S. Patents Nos. 5,858,659 and 5,837,832, the entire teachings of which are incoφorated by reference herein. Other methods of nucleic acid analysis can be used to detect polymoφhisms in a nucleic acid described herein, or variants encoded by a nucleic acid described herein. Representative methods include direct manual sequencing
(Church and Gilbert, Proc. Natl. Acad. Sci. USA 81:1991-1995 (1988); Sanger, F. et al, Proc. Natl Acad. Sci, USA 74:5463-5467 (1977); Beavis et al. U.S. Pat. No. 5,288,644); automated fluorescent sequencing; singlestranded conformation polymoφhism assays (SSCP); clamped denaturing gel electrophoresis (CDGE); denaturing gradient gel electrophoresis (DGGE)
(Sheffield, V.C. et al, Proc. Natl. Acad. Sci. USA 86:232-236 (1989)), mobility shift analysis (Orita, M. et al, Proc. Natl. Acad. Sci. USA 86:2766- 2770 (1989)), restriction enzyme analysis (Flavell et al, Cell 15:25 (1978); Geever, et al, Proc. Natl. Acad. Sci. USA 78:5081 (1981)); heteroduplex analysis; chemical mismatch cleavage (CMC) (Cotton et al, Proc. Natl. Acad. Sci. USA 85:4397-4401 (1985)); RNase protection assays (Myers, R.M. et al,
Science 230:1242 (1985)); use of polypeptides which recognize nucleotide mismatches, such as E. coli mutS protein; allele-specific PCR, for example.
In one embodiment ofthe invention, diagnosis of a disease or condition associated with FLAP (e.g., MI) or a susceptibility to a disease or condition associated with FLAP (e.g. , MI) can also be made by expression analysis by quantitative PCR (kinetic thermal cycling). This technique utilizing TaqMan <sup>®</sup> can be used to allow the identification of polymoφhisms and whether a patient is homozygous or heterozygous. The technique can assess the presence of an alteration in the expression or composition ofthe polypeptide encoded by a FLAP nucleic acid or splicing variants encoded by a
FLAP nucleic acid. Further, the expression ofthe variants can be quantified as physically or functionally different.
In another embodiment ofthe invention, diagnosis of MI or a susceptibility to MI (or of another disease or condition associated with FLAP) can also be made by examining expression and/or composition of a FLAP polypeptide, by a variety of methods, including enzyme linked immunosorbent assays (ΕLISAs), Western blots, immunoprecipitations and immunofluorescence. A test sample from an individual is assessed for the presence of an alteration in the expression and/or an alteration in composition of the polypeptide encoded by a FLAP nucleic acid, or for the presence of a particular variant encoded by a FLAP nucleic acid. An alteration in expression of a polypeptide encoded by a FLAP nucleic acid can be, for example, an alteration in the quantitative polypeptide expression (i.e., the amount of polypeptide produced); an alteration in the composition of a polypeptide encoded by a FLAP nucleic acid is an alteration in the qualitative polypeptide expression (e.g., expression of an altered FLAP polypeptide or of a different splicing variant). In a preferred embodiment, diagnosis of disease or condition associated with FLAP or a susceptibility to a disease or condition associated with FLAP is made by detecting a particular splicing variant encoded by that FLAP variant, or a particular pattern of splicing variants. Both such alterations (quantitative and qualitative) can also be present.
An "alteration" in the polypeptide expression or composition, refers to an alteration in expression or composition in a test sample, as compared with the expression or composition of polypeptide by a FLAP nucleic acid in a control sample. A confrol sample is a sample that corresponds to the test sample (e.g., is from the same type of cells), and is from an individual who is not affected by the disease or a susceptibility to a disease or condition associated with a FLAP nucleic acid. An alteration in the expression or composition ofthe polypeptide in the test sample, as compared with the control sample, is indicative of disease or condition associated with FLAP or a susceptibility to a disease or condition associated with FLAP (e.g., MI). Similarly, the presence of one or more different splicing variants in the test sample, or the presence of significantly different amounts of different splicing variants in the test sample, as compared with the control sample, is indicative of a susceptibility to a disease or condition associated with a FLAP nucleic acid. Various means of examining expression or composition ofthe polypeptide encoded by a FLAP nucleic acid can be used, including: spectroscopy, colorimetry, electrophoresis, isoelectric focusing and immunoassays (e.g., David et al, U.S. Pat. 4,376,110) such as immunoblotting (see also Current Protocols in Molecular Biology, particularly Chapter 10). For example, in one embodiment, an antibody capable of binding to the polypeptide (e.g., as described above), preferably an antibody with a detectable label, can be used. Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab')<sub>2</sub>) can be used. The term "labeled", with regard to the probe or antibody, is intended to encompass direct labeling ofthe probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
Western blotting analysis, using an antibody as described above that specifically binds to a polypeptide encoded by an altered FLAP (e.g., by a FLAP having a SNP as shown in Table 3), or an antibody that specifically binds to a polypeptide encoded by a non-altered nucleic acid, or an antibody that specifically binds to a particular splicing variant encoded by a nucleic acid, can be used to identify the presence in a test sample of a particular splicing variant or of a polypeptide encoded by a polymoφhic or altered FLAP, or the absence in a test sample of a particular splicing variant or of a polypeptide encoded by a non-polymoφhic or non-altered nucleic acid. The presence of a polypeptide encoded by a polymoφhic or altered nucleic acid, or the absence of a polypeptide encoded by a non-polymoφhic or non-altered nucleic acid, is diagnostic for disease or condition associated with FLAP or a susceptibility to a disease or condition associated with, as is the presence (or absence) of particular splicing variants encoded by the FLAP nucleic acid. In one embodiment of this method, the level or amount of polypeptide encoded by a FLAP nucleic acid in a test sample is compared with the level or amount ofthe polypeptide encoded by the FLAP in a control sample. A level or amount ofthe polypeptide in the test sample that is higher or lower than the level or amount ofthe polypeptide in the control sample, such that the difference is statistically significant, is indicative of an alteration in the expression ofthe polypeptide encoded by the FLAP, and is diagnostic for disease or condition, or for a susceptibility to a disease or condition, associated with that FLAP. Alternatively, the composition ofthe polypeptide encoded by a FLAP nucleic acid in a test sample is compared with the composition ofthe polypeptide encoded by the FLAP in a control sample (e.g., the presence of different splicing variants). A difference in the composition ofthe polypeptide in the test sample, as compared with the composition ofthe polypeptide in the control sample, is diagnostic for a disease or condition, or for a susceptibility to a disease or condition, associated with that FLAP, hi another embodiment, both the level or amount and the composition ofthe polypeptide can be assessed in the test sample and in the control sample. A difference in the amount or level ofthe polypeptide in the test sample, compared to the control sample; a difference in composition in the test sample, compared to the control sample; or both a difference in the amount or level, and a difference in the composition, is indicative of a disease or condition, or a susceptibility to a disease or condition, associated with FLAP (e.g., MI).
The invention further pertains to a method for the diagnosis and identification of susceptibility to myocardial infarction in an individual, by identifying an at-risk haplotype in FLAP. In one embodiment, the at-risk haplotype is one which confers a significant risk of MI. In one embodiment, significance associated with a haplotype is measured by an odds ratio, hi a further embodiment, the significance is measured by a percentage. In one embodiment, a significant risk is measured as an odds ratio of at least about 1.2, including by not limited to: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9. In a further embodiment, an odds ratio of at least 1.2 is significant, hi a further embodiment, an odds ratio of at least about 1.5 is significant, hi a further embodiment, a significant increase in risk is at least about 1.7 is significant. In a further embodiment, a significant increase in risk is at least about 20%, including but not limited to about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95, and 98%. In a further embodiment, a significant increase in risk is at least about 50%. It is understood however, that identifying whether a risk is medically significant may also depend on a variety of factors, including the specific disease, the haplotype, and often, environmental factors.
The invention also pertains to methods of diagnosing a susceptibility to myocardial infarction in an individual, comprising screening for an at-risk haplotype in the FLAP nucleic acid that is more frequently present in an individual susceptible to myocardial infarction (affected), compared to the frequency of its presence in a healthy individual (control), wherein the presence ofthe haplotype is indicative of susceptibility to myocardial infarction. Standard techniques for genotyping for the presence of SNPs and/or microsatellite markers that are associated with myocardial infarction can be used, such as fluorescent based techniques (Chen, et al, Genome Res. 9, 492 (1999), PCR, LCR, Nested PCR and other techniques for nucleic acid amplification. In a preferred embodiment, the method comprises assessing in an individual the presence or frequency of SNPs and/or microsatellites in the FLAP nucleic acid that are associated with myocardial infarction, wherein an excess or higher frequency ofthe SNPs and/or microsatellites compared to a healthy control individual is indicative that the individual is susceptible to myocardial infarction. See table 9for SNPs that comprise haplotypes that can be used as screening tools. See also Table 3 that sets forth SNPs and markers for use as screening tools. hi one embodiment, the at-risk haplotype is characterized by the presence of polymoφhism(s) represented in Table 3. For example, DGOOAAFIU at position 256047, where the SNP can be a "C" or a "T"; SG13S25 at position 283477, where the SNP can be a "G" or an "A";
DG00AAJFF at position 287889, where the SNP can be a "G" or an "A"; DGOOAAHII at position 294503, where the SNP can be a "G" or an "A"; DGOOAAHID at position 296020, where the SNP can be a "T" or an "A"; B_SNP_310657 at position 310657, where the SNP can be a "G" or an "A"; SG13S30 at position 312056, where the SNP can be a "G" or a "T"; SG13S32 at position 316763, where the SNP can be a "C" or an "A"; SG13S42 at position 320393, where the SNP can be a "G" or an "A"; and SG13S35 at position 324333, where the SNP can be a "G" or an "A".
Kits (e.g., reagent kits) useful in the methods of diagnosis comprise components useful in any ofthe methods described herein, including for example, hybridization probes or primers as described herein (e.g., labeled probes or primers), reagents for detection of labeled molecules, restriction enzymes (e.g., for RFLP analysis), allele-specific oligonucleotides, antibodies which bind to altered or to non-altered (native) FLAP polypeptide, means for amplification of nucleic acids comprising a FLAP, or means for analyzing the nucleic acid sequence of a nucleic acid described herein, or for analyzing the amino acid sequence of a polypeptide as described herein, etc. In one embodiment, a kit for diagnosing MI or susceptibility to MI can comprise primers for nucleic acid amplification of a region in the FLAP nucleic acid comprising an at-risk haplotype that is more frequently present in an individual having MI or susceptible to MI. The primers can be designed using portions ofthe nucleic acids flanking SNPs that are indicative of MI. In a particularly preferred embodiment, the primers are designed to amplify regions ofthe FLAP nucleic acid associated with an at-risk haplotype for MI, as shown in Table 9, or more particularly the haplotype defined by the following SNP markers: In one embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers DGOOAAFIU, SG13S25, DGOOAAJFF, DGOOAAHII, SG13S32 and SG13S35 at the 13ql2 locus. In one particular embodiment, the presence ofthe alleles T, G, G, G, A and G at DGOOAAFIU, SG13S25, DGOOAAJFF, DGOOAAHII, SG13S32 and SGI 3 S35, respectively (the B6 haplotype), is diagnostic of susceptibility to myocardial infarction. In another embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers DGOOAAFIU, SG13S25, DGOOAAHII, SG13S30 and SG13S42 at the 13ql2 locus. In one particular embodiment, the presence ofthe alleles T, G, G, G and A at DGOOAAFIU, SG13S25, DGOOAAHII, SG13S30 and SG13S42, respectively
(the B5 haplotype), is diagnostic of susceptibility to myocardial infarction, hi a third embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers SG13S25, DGOOAAHII, SG13S30 and SG13S42 at the 13ql2 locus. In one particular embodiment, the presence of the alleles G, G, G and A at SG13S25, DGOOAAHII, SG13S30 and SG13S42 , respectively (the B4 haplotype), is diagnostic of susceptibility to myocardial infarction. In a fourth embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers DGOOAAFIU, SG13S25, DGOOAAHID, B_SNP_310657 and SG13S32 at the 13ql2 locus. In one particular embodiment, the presence ofthe alleles T, G, T, G and A at DGOOAAFIU, SG13S25, DGOOAAHID, B_SNP_310657 and SG13S32, respectively (the A5 haplotype), is diagnostic of susceptibility to myocardial infarction, hi a fifth embodiment, a haplotype associated with a susceptibility to myocardial infarction comprises markers SG13S25, DGOOAAHID, B_SNP_310657 and SG13S32 at the 13ql2 locus, hi one particular embodiment, the presence ofthe alleles G, T, G and A at SG13S25,
DGOOAAHID, B_SNP_310657 and SG13S32, respectively (the A4 haplotype), is diagnostic of susceptibility to myocardial infarction.
SCREENING ASSAYS AND AGENTS IDENTIFIED THEREBY The invention provides methods (also referred to herein as "screening assays") for identifying the presence of a nucleotide that hybridizes to a nucleic acid ofthe invention, as well as for identifying the presence of a polypeptide encoded by a nucleic acid ofthe invention. In one embodiment, the presence (or absence) of a nucleic acid molecule of interest (e.g., a nucleic acid that has significant homology with a nucleic acid ofthe invention) in a sample can be assessed by contacting the sample with a nucleic acid comprising a nucleic acid ofthe invention (e.g., a nucleic acid having the sequence of one of SEQ ED NOs: lor 3 or the complement thereof, or a nucleic acid encoding an amino acid having the sequence of SEQ ID NO: 2, or a fragment or variant of such nucleic acids), under stringent conditions as described above, and then assessing the sample for the presence (or absence) of hybridization. In a preferred embodiment, high stringency conditions are conditions appropriate for selective hybridization. In another embodiment, a sample containing a nucleic acid molecule of interest is contacted with a nucleic acid containing a contiguous nucleic acid sequence (e.g., a primer or a probe as described above) that is at least partially complementary to a part of the nucleic acid molecule of interest (e.g., a FLAP nucleic acid), and the contacted sample is assessed for the presence or absence of hybridization. In a preferred embodiment, the nucleic acid containing a contiguous nucleic acid sequence is completely complementary to a part ofthe nucleic acid molecule of interest.
In any of these embodiments, all or a portion ofthe nucleic acid of interest can be subjected to amplification prior to performing the hybridization.
In another embodiment, the presence (or absence) of a polypeptide of interest, such as a polypeptide ofthe invention or a fragment or variant thereof, in a sample can be assessed by contacting the sample with an antibody that specifically hybridizes to the polypeptide of interest (e.g., an antibody such as those described above), and then assessing the sample for the presence (or absence) of binding ofthe antibody to the polypeptide of interest. In another embodiment, the invention provides methods for identifying agents (e.g., fusion proteins, polypeptides, peptidomimetics, prodrugs, receptors, binding agents, antibodies, small molecules or other drags, or ribozymes which alter (e.g., increase or decrease) the activity ofthe polypeptides described herein, or which otherwise interact with the polypeptides herein. For example, such agents can be agents which bind to polypeptides described herein (e.g., binding agent for members ofthe leukotriene pathway, such as FLAP binding agents); which have a stimulatory or inhibitory effect on, for example, activity of polypeptides ofthe invention; or which change (e.g., enhance or inhibit) the ability of the polypeptides of the invention to interact with members of the leukotriene pathway binding agents
(e.g., receptors or other binding agents); or which alter posttranslational processing ofthe leukotriene pathway member polypeptide, such as a FLAP polypeptide (e.g., agents that alter proteolytic processing to direct the polypeptide from where it is normally synthesized to another location in the cell, such as the cell surface; agents that alter proteolytic processing such that more polypeptide is released from the cell, etc.) In one embodiment, the invention provides assays for screening candidate or test agents that bind to or modulate the activity of polypeptides described herein (or biologically active portion(s) thereof), as well as agents identifiable by the assays. Test agents can be obtained using any ofthe numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound" library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K.S., Anticancer Drug Des. 12:145 (1997)).
In one embodiment, to identify agents which alter the activity of a FLAP polypeptide, a cell, cell lysate, or solution containing or expressing a FLAP polypeptide (e.g., SEQ ID NO: 2 or another splicing variant encoded by a FLAP nucleic acid, such as a nucleic acid comprising a SNP as shown in Table 3), or a fragment or derivative thereof (as described above), can be contacted with an agent to be tested; alternatively, the polypeptide can be contacted directly with the agent to be tested. The level (amount) of FLAP activity is assessed (e.g., the level (amount) of FLAP activity is measured, either directly or indirectly), and is compared with the level of activity in a control (i.e., the level of activity ofthe FLAP polypeptide or active fragment or derivative thereof in the absence ofthe agent to be tested). If the level of the activity in the presence ofthe agent differs, by an amount that is statistically significant, from the level ofthe activity in the absence ofthe agent, then the agent is an agent that alters the activity of a FLAP polypeptide. An increase in the level of FLAP activity in the presence ofthe agent relative to the activity in the absence ofthe agent, indicates that the agent is an agent that enhances (is an agonist of) FLAP activity. Similarly, a decrease in the level of FLAP activity in the presence ofthe agent, relative to the activity in the absence ofthe agent, indicates that the agent is an agent that inhibits (is an antagonist of) FLAP activity. In another embodiment, the level of activity of a FLAP polypeptide or derivative or fragment thereof in the presence ofthe agent to be tested, is compared with a control level that has previously been established. A statistically significant difference in the level ofthe activity in the presence ofthe agent from the control level indicates that the agent alters
FLAP activity.
The present invention also relates to an assay for identifying agents which alter the expression of a FLAP nucleic acid (e.g., antisense nucleic acids, fusion proteins, polypeptides, peptidomimetics, prodrugs, receptors, binding agents, antibodies, small molecules or other drags, or ribozymes; which alter (e.g., increase or decrease) expression (e.g., transcription or translation) ofthe nucleic acid or which otherwise interact with the nucleic acids described herein, as well as agents identifiable by the assays. For example, a solution containing a nucleic acid encoding a FLAP polypeptide (e.g. , a FLAP nucleic acid) can be contacted with an agent to be tested. The solution can comprise, for example, cells containing the nucleic acid or cell lysate containing the nucleic acid; alternatively, the solution can be another solution that comprises elements necessary for transcription/translation ofthe nucleic acid. Cells not suspended in solution can also be employed, if desired. The level and/or pattern of FLAP expression (e.g. , the level and/or pattern of mRNA or of protein expressed, such as the level and/or pattern of different splicing variants) is assessed, and is compared with the level and/or pattern of expression in a control (i.e., the level and/or pattern ofthe FLAP expression in the absence ofthe agent to be tested). If the level and/or pattern in the presence ofthe agent differ, by an amount or in a manner that is statistically significant, from the level and/or pattern in the absence ofthe agent, then the agent is an agent that alters the expression ofthe FLAP nucleic acid. Enhancement of FLAP expression indicates that the agent is an agonist of FLAP activity. Similarly, inhibition of FLAP expression indicates that the agent is an antagonist of FLAP activity. In another embodiment, the level and/or pattern of FLAP polypeptide(s) (e.g., different splicing variants) in the presence ofthe agent to be tested, is compared with a control level and/or pattern that have previously been established. A level and/or pattern in the presence ofthe agent that differs from the control level and/or pattern by an amount or in a manner that is statistically significant indicates that the agent alters FLAP expression.
In another embodiment ofthe invention, agents which alter the expression of a FLAP nucleic acid or which otherwise interact with the nucleic acids described herein, can be identified using a cell, cell lysate, or solution containing a nucleic acid encoding the promoter region ofthe FLAP nucleic acid operably linked to a reporter gene. After contact with an agent to be tested, the level of expression ofthe reporter gene (e.g., the level of mRNA or of protein expressed) is assessed, and is compared with the level of expression in a control (i.e., the level ofthe expression ofthe reporter gene in the absence ofthe agent to be tested). If the level in the presence ofthe agent differs, by an amount or in a manner that is statistically significant, from the level in the absence ofthe agent, then the agent is an agent that alters the expression ofthe FLAP nucleic acid, as indicated by its ability to alter expression of a nucleic acid that is operably linked to the FLAP nucleic acid promoter. Enhancement ofthe expression ofthe reporter indicates that the agent is an agonist of FLAP activity. Similarly, inhibition ofthe expression ofthe reporter indicates that the agent is an antagonist of FLAP activity. In another embodiment, the level of expression ofthe reporter in the presence ofthe test agent, is compared with a control level that has previously been established. A level in the presence ofthe agent that differs from the control level by an amount or in a manner that is statistically significant indicates that the agent alters expression.
Agents which alter the amounts of different splicing variants encoded by a FLAP nucleic acid (e.g., an agent which enhances activity of a first splicing variant, and which inhibits activity of a second splicing variant), as well as agents which are agonists of activity of a first splicing variant and antagonists of activity of a second splicing variant, can easily be identified using these methods described above.
In other embodiments ofthe invention, assays can be used to assess the impact of a test agent on the activity of a polypeptide relative to a FLAP binding agent. For example, a cell that expresses a compound that interacts with a FLAP nucleic acid (herein referred to as a "FLAP binding agent", which can be a polypeptide or other molecule that interacts with a FLAP nucleic acid, such as a receptor, or another molecule, such as 5-LO) is contacted with a FLAP in the presence of a test agent, and the ability ofthe test agent to alter the interaction between the FLAP and the FLAP binding agent is determined. Alternatively, a cell lysate or a solution containing the FLAP binding agent, can be used. An agent which binds to the FLAP or the FLAP binding agent can alter the interaction by interfering with, or enhancing the ability ofthe FLAP to bind to, associate with, or otherwise interact with the FLAP binding agent. Determining the ability ofthe test agent to bind to a
FLAP nucleic acid or a FLAP nucleic acid binding agent can be accomplished, for example, by coupling the test agent with a radioisotope or enzymatic label such that binding ofthe test agent to the polypeptide can be determined by detecting the labeled with <sup>125</sup>1, <sup>35</sup>S, <sup>14</sup>C or <sup>3</sup>H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, test agents can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product. It is also within the scope of this invention to determine the ability of a test agent to interact with the polypeptide without the labeling of any ofthe interactants. For example, a microphysiometer can be used to detect the interaction of a test agent with a FLAP or a FLAP binding agent without the labeling of either the test agent, FLAP, or the FLAP binding agent. McConnell, H.M. et al, Science 257:1906-1912 (1992). As used herein, a "microphysiometer" (e.g., Cytosensor™) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator ofthe interaction between ligand and polypeptide.
Thus, these receptors can be used to screen for compounds that are agonists for use in treating a disease or condition associated with FLAP or a susceptibility to a disease or condition associated with FLAP, or antagonists for studying a susceptibility to a disease or condition associated with FLAP (e.g., MI). Drags can be designed to regulate FLAP activation, that in turn can be used to regulate signaling pathways and transcription events of genes downstream or of proteins or polypeptides interacting with FLAP (e.g. , 5-LO). hi another embodiment ofthe invention, assays can be used to identify polypeptides that interact with one or more FLAP polypeptides, as described herein. For example, a yeast two-hybrid system such as that described by Fields and Song (Fields, S. and Song, O., Nature 340:245-246 (1989)) can be used to identify polypeptides that interact with one or more FLAP polypeptides. In such a yeast two-hybrid system, vectors are constructed based on the flexibility of a transcription factor that has two functional domains (a DNA binding domain and a transcription activation domain). If the two domains are separated but fused to two different proteins that interact with one another, transcriptional activation can be achieved, and transcription of specific markers (e.g., nutritional markers such as His and Ade, or color markers such as lacZ) can be used to identify the presence of interaction and transcriptional activation. For example, in the methods ofthe invention, a first vector is used which includes a nucleic acid encoding a DNA binding domain and also a FLAP polypeptide, splicing variant, or fragment or derivative thereof, and a second vector is used which includes a nucleic acid encoding a transcription activation domain and also a nucleic acid encoding a polypeptide which potentially may interact with the FLAP polypeptide, splicing variant, or fragment or derivative thereof (e.g., a FLAP polypeptide binding agent or receptor). Incubation of yeast containing the first vector and the second vector under appropriate conditions (e.g., mating conditions such as used in the Matchmaker™ system from Clontech (Palo Alto, California, USA)) allows identification of colonies that express the markers of interest. These colonies can be examined to identify the polypeptide(s) that interact with the FLAP polypeptide or fragment or derivative thereof. Such polypeptides may be useful as agents that alter the activity of expression of a FLAP polypeptide, as described above.
In more than one embodiment ofthe above assay methods ofthe present invention, it may be desirable to immobilize either the FLAP, the FLAP binding agent, or other components ofthe assay on a solid support, in order to facilitate separation of complexed from uncomplexed forms of one or both of the polypeptides, as well as to accommodate automation ofthe assay. Binding of a test agent to the polypeptide, or interaction ofthe polypeptide with a binding agent in the presence and absence of a test agent, can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein (e.g., a glutathione-S-transferase fusion protein) can be provided which adds a domain that allows a FLAP nucleic acid or a FLAP binding agent to be bound to a matrix or other solid support. hi another embodiment, modulators of expression of nucleic acid molecules ofthe invention are identified in a method wherein a cell, cell lysate, or solution containing a nucleic acid encoding a FLAP nucleic acid is contacted with a test agent and the expression of appropriate mRNA or polypeptide (e.g., splicing variant(s)) in the cell, cell lysate, or solution, is determined. The level of expression of appropriate mRNA or polypeptide(s) in the presence ofthe test agent is compared to the level of expression of mRNA or polypeptide(s) in the absence ofthe test agent. The test agent can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater (statistically significantly greater) in the presence ofthe test agent than in its absence, the test agent is identified as a stimulator or enhancer ofthe mRNA or polypeptide -Ill-
expression. Alternatively, when expression ofthe mRNA or polypeptide is less (statistically significantly less) in the presence ofthe test agent than in its absence, the test agent is identified as an inhibitor ofthe mRNA or polypeptide expression. The level of mRNA or polypeptide expression in the cells can be determined by methods described herein for detecting mRNA or polypeptide.
In yet another embodiment, the invention provides methods for identifying agents (e.g., fusion proteins, polypeptides, peptidomimetics, prodrags, receptors, binding agents, antibodies, small molecules or other drags, or ribozymes) which alter (e.g., increase or decrease) the activity of a member of leukotriene pathway binding agent, such as a FLAP binding agent (e.g., 5-LO), as described herein. For example, such agents can be agents which have a stimulatory or inhibitory effect on, for example, the activity of a member of leukotriene pathway binding agent, such as a FLAP binding agent; which change (e.g., enhance or inhibit) the ability a member of leukotriene pathway binding agents, (e.g., receptors or other binding agents) to interact with the polypeptides ofthe invention; or which alter posttranslational processing ofthe member of leukotriene pathway binding agent, (e.g., agents that alter proteolytic processing to direct the member ofthe leukotriene pathway binding agent from where it is normally synthesized to another location in the cell, such as the cell surface; agents that alter proteolytic processing such that more active binding agent is released from the cell, etc.). For example, the invention provides assays for screening candidate or test agents that bind to or modulate the activity of a member ofthe leukotriene pathway (or enzymatically active portion(s) thereof), as well as agents identifiable by the assays. As described above, test agents can be obtained using any ofthe numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound" library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K.S. Anticancer Drug Des., 12:145 (1997)). In one embodiment, to identify agents which alter the activity of a member ofthe leukotriene pathway (such as a FLAP binding agent, or an agent which binds to a member ofthe leukotriene pathway (a "binding agent")), a cell, cell lysate, or solution containing or expressing a binding agent (e.g., 5-LO, or a leukotriene pathway member receptor, or other binding agent), or a fragment (e.g., an enzymatically active fragment) or derivative thereof, can be contacted with an agent to be tested; alternatively, the binding agent (or fragment or derivative thereof) can be contacted directly with the agent to be tested. The level (amount) of binding agent activity is assessed (either directly or indirectly), and is compared with the level of activity in a control (i.e., the level of activity in the absence ofthe agent to be tested). If the level ofthe activity in the presence ofthe agent differs, by an amount that is statistically significant, from the level ofthe activity in the absence ofthe agent, then the agent is an agent that alters the activity ofthe member ofthe leukotriene pathway. An increase in the level ofthe activity relative to a control, indicates that the agent is an agent that enhances (is an agonist of) the activity. Similarly, a decrease in the level of activity relative to a control, indicates that the agent is an agent that inhibits (is an antagonist of) the activity, hi another embodiment, the level of activity in the presence ofthe agent to be tested, is compared with a control level that has previously been established. A level ofthe activity in the presence ofthe agent that differs from the control level by an amount that is statistically significant indicates that the agent alters the activity.
This invention further pertains to novel agents identified by the above- described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., a test agent that is a modulating agent, an antisense nucleic acid molecule, a specific antibody, or a polypeptide-binding agent) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein. In addition, an agent identified as described herein can be used to alter activity of a polypeptide encoded by a FLAP nucleic acid, or to alter expression of a
FLAP nucleic acid, by contacting the polypeptide or the nucleic acid (or contacting a cell comprising the polypeptide or the nucleic acid) with the agent identified as described herein.
The present invention is now illustrated by the following Examples, which are not intended to be limiting in any way. The teachings of all references cited are incoφorated herein in their entirety.
EXAMPLE 1: IDENTIFICATION OF GENE AND HAPLOTYPES ASSOCIATED WITH MI
SUBJECTS AND METHODS
Study population
Patients entering the study were defined from an infarction registry that includes all Mis (over 8,000 patients) in Iceland 1981-2000. This registry is a part ofthe World
Health Organization MONICA Project (The World Health Organization MONICA Project (monitoring trends and determinants in cardiovascular disease): a major international collaboration. (WHO MONICA Project Principal Investigators. J Clin. Epidemiol. 1988; 41:105-14). Diagnosis of all patients in the registry follow strict diagnostic rales based on symptoms, electrocardiograms, cardiac enzymes, and necropsy findings.
Blood samples from 570 female MI patients and 1380 male patients, both cases with a family history and sporadic cases were collected. For each patient that participated, blood was collected from 2 relatives (unaffected or affected). Their genotypes were used to help with construction of haplotypes.
Linkage analysis
One hundred and sixty female MI patients were clustered into large extended families such that each patient is related to at least one other patient within and including six meiotic events (e.g., 6 meiotic events separate second cousins). The information regarding the relatedness of patients was obtained from an encrypted genealogy database that covers the entire Icelandic nation (Gulcher et al, Eur. J. Hum. Genet. 8: 739-742 (2000)). A genomewide scan was performed using a framework map of 1000 microsatellite markers, using protocols described elsewhere (Gretarsdottir S., et al. Am. J. Hum. Genet., 70: 593-603, 2002)). The marker order and positions were obtained from deCODE genetics' high resolution genetic map (Kong A, et al, Nat. genet., 31: 241-247 (2002)). The population-based allelic frequencies were constructed from a cohort of more than 30,000 Icelanders who have participated in genetic studies of various disease projects. Additional markers were genotyped within the highest linkage peak on chromosome 13 to increase the information on identity by descent within the families. For those markers at least 180 Icelandic controls were genotyped to derive the population allele frequencies.
For statistical analysis, multipoint, affected-only allele-sharing methods were used to assess evidence for linkage. All results, both the LOD and the non-parametric linkage (NPL) score, were obtained using the program ALLEGRO (Gudbjartsson D.F., et al, Nat Genet., 25: 12-13(2000)). The baseline linkage analysis (Gretarsdottir S., et al, Am. J. Hum. Genet. 70: 593-
603, (2002)) uses the Spairs scoring function (Whittermore AS, and Haplern J A., Biometrics 50: 118-127 (1994)) and Kruglyak et al, Am. J. Hum. Genet, 58:1347-1363 (1996)) the exponential allele-sharing model (Kong A., and Cox N.J., Am. J. Hum. Genet. 61:1179-1188 (1997)), and a family weighting scheme which is halfway, on the log-scale, between weighing each affected pairs equally and weighing each family equally.
Ultra-fine mapping and haplotype analysis:
A candidate susceptibility locus was defined as the region under the LOD score curve where the score was one lod lower than the highest lod score. This region (approx. 12Mb) was ultra-finemapped with microsatellite markers with an average spacing between markers of less than 100Kb. All usable microsatellite markers found in public databases and mapped within that region were used. In addition, microsatellite markers identified within the deCODE genetics sequence assembly ofthe human genome were used.
Haplotype analysis.
The frequencies of haplotypes were estimated in the patient and the control groups using an expectation-maximization algorithm (Dempster A.P. et al, J. R. Stat. Soc. B. 39: 1-389 (1977)). An implementation of this algorithm that can handle missing genotypes and uncertainty with the phase was used. Under the null hypothesis, the patients and the controls are assumed to have identical frequencies. Using a likelihood approach, an alternative hypothesis where a candidate at-risk-haplotype is allowed to have a higher frequency in patients than confrols, while the ratios ofthe frequencies of other haplotypes are assumed to be the same in both groups was tested. Likelihoods are maximized separately under both hypothesis and a corresponding 1-df likelihood ratio statistics is used to evaluate the statistic significance.
To look for at-risk-haplotypes in the 1-lod drop, association of all possible combinations of genotyped markers was studied, provided those markers spanned a region of size less than 1000 Kb. Due to a certain amount of testing, the -values were adjusted using simulations. The combined patient and control groups were randomly divided into two sets, equal in size to the original group of patients and controls. The haplotype analysis was then repeated and the most significant p- value registered was observed. This randomization scheme was repeated over 100 times to construct an empirical distribution of p-values.
Results and Discussion
In a genome wide search for susceptibility genes for MI, a locus was mapped to a location on chromosome 13ql2. FIG. 1 shows the multipoint non-parametric LOD scores a linkage scan for a framework marker map on chromosome 13. A LOD score suggestive of linkage of 2.5 was found centered at marker D13S289. The marker map for chromosome 13 that was used in the linkage analysis is shown in Table 1. The LOD score at this location remained with increased number of microsatellite markers which increased information content ofthe linkage (FIG. 2).
A very large number of microsatellite markers were then added within the central 12 megabase (Mb) segment under the LOD score defined by the drop in one LOD from the peak marker. FIG. 3A shows the results from a haplotype association case-control analysis of 437 female MI patients versus 721 controls using combinations of 4 and 5 microsatellite markers to define the test haplotypes. The most significant microsatellite marker haplotype association across this entire 12 Mb segment was found using markers DG13S1103, DG13S166, DG13S1287, DG13S1061 and DG13S301, with alleles 4, 0, 2, 14 and 3, respectively (p-value of 1.02x 10<sup>"7</sup>). Carrier frequency of this haplotype is 7.3% in female MI patients and 0.3% in controls. There are several other haplotypes that show great association to MI that overlap the first haplotype. The 80Kb segment that is defined by two markers (DG13S166 and D13S1238) common to all the haplotypes shown in the figure includes only one gene, FLAP (ALOX5AP). A two marker haplotype involving alleles 0 and -2 for markers DG13S166 and D13S1238, respectively, is found in excess in patients. Carrier frequency of this haplotype was estimated to be 27% in female MI patients and 15.4% in controls (p- value 1 X 10<sup>"3</sup>) . This was our first evidence that variation in the FLAP gene contributes to MI risk.
To confirm this observation , the FLAP gene was sequenced in its entirety and numerous SNPs were defined. Many of these were used to genotype 437 female MI patients, 1049 male MI patients, and 811 controls, hi a case-control study ofthe MI patients using these data, several haplotypes were found, that were significantly over-represented in the female MI patients compared to controls (see Table 6). These haplotypes were highly correlated to each other since they are within a block of linkage disequilibrium covering the FLAP gene. Table 7 shows two haplotypes that are representative of these female MI risk haplotypes. They have relative risks of 2.4 and 4 and are carried by 23% and 13% of female MI patients, respectively. Table 8 shows that these same haplotypes show association to male MI although with lower relative risks. hi an effort to identify haplotypes involving only SNP markers that associate with MI, more SNPs were identified by sequencing the FLAP gene and the region flanking the gene. Currently, a total number of 45 SNPs have been genotyped on 1343 patients and 624 unrelated controls. Two correlated series of SNP haplotypes were observed in excess in patients, denoted as A and B in Table 9. The length ofthe haplotypes varies between 33 and 69 Kb, and the haplotypes cover one or two blocks of linkage disequilibrium. Both series of haplotypes contain the common allele 2 ofthe SNP SG13S25. All haplotypes in the A series contain the SNP DGOOAAHID, while all haplotypes in the B series contain the SNP DGOOAAHII. In the B series, the haplotypes
B4, B5, and B6 have a relative risk (RR) greater than 2 and with allelic frequencies above 10%. The haplotypes in A series have slightly lower RR and lower p-values, but higher frequency (15-16%). The haplotypes in series B and A are strongly correlated, i.e. the haplotypes in B define a subset ofthe haplotypes in A. Hence, haplotypes B are more specific than A. Haplotypes
A are however more sensitive, i.e. they capture more individuals with the putative mutation, as is observed in the population attributable risk which is less for B than for A. Furthermore, these haplotypes show similar risk ratios and allelic frequency for early-onset patients (defined as onset of first MI before the age of 55) and for both gender. In addition, analyzing various groups of patients with known risk factors, such as hypertension, high cholesterol, smoking and diabetes, did not reveal any significant correlation with these haplotypes, indicating that the haplotypes in the FLAP gene represent an independent genetic susceptibility factor for MI.
The FLAP gene encodes for a protein that is required for leukotriene synthesis (LTA4, LTB4, LTC4, LTD4, LTE4). Inhibitors of its function impede translocation of 5-lipoxygenase from the cytoplasm to the cell membrane and inhibit activation of 5-lipoxygenase. The leukotrienes are potent inflammatory lipid mediators derived from arachidonic acid that can potentially contribute to development of atherosclerosis and destabihzation of atherosclerotic plaques throu lipid oxidation and/or proinflammatory effects.
Allen et al, (Circulation. 97: 2406-2413(1998)) described a novel mechanism in which atherosclerosis is associated with the appearance of a leukotriene receptor(s) capable of inducing hyperreactivity of human epicardial coronary arteries in response to LTC4 and LTD4. Allen et al. show a photomicrograph of a section of human atherosclerotic coronary artery a positive staining of a number of members ofthe leukotriene pathway, including FLAP. Mehrabian et al. described the identification of 5-Lipoxygenase (5-LO) as a major gene contributing to atherosclerosis susceptibility in mice. Mehrabian et al. described that heterozygous deficiency for the enzyme in a knockout model decreased the atherosclerotic lesion size in LDL-/- mice by about 95%.
Mehrabian et al show that the enzyme is expressed abundantly in macrophage- rich regions of atherosclerotic lesions, and suggested that 5-LO and/or its products might act locally to promote lesion development (Mehrabian et al., Circulation Research. 91:120 (2002)). Studies of FLAP inhibition in animal models of atheroscerosis are scarce. However, in a rabbit model of acute MI assesssed 72 hours after coronary artery ligation the FLAP-inhibitor BAYxl005 markedly reduced mortality, from 65% to 25%, and blocked the increase in CPK and neutrophil accumulation as well as the ECG-changes observed in sham treated animals (J. Pharmacol. Exp. Ther., 276:332 (1996)).
Mutations and /or polymoφhisms within the FLAP nucleic acid, and other members ofthe same pathway (e.g., 5-lipoxygenase, LTA4 Hydrolase, LTB4 receptors, LTC4 Synthase, and CysLT2 receptor), that show association with the disease, can be used as a diagnostic test. The members ofthe 5-LO pathway in particular are valuable therapeutic targets for myocardial infarction.
Table 1 The marker map for chromosome 13 used in the linkage analysis.
<img file="WO2004035741A2_D0013.tif" /> Table 2 Marker Map for the second step of Linkage Analysis
<img file="WO2004035741A2_D0014.tif" /> Table 3 shows the five exons with positions that encode the FLAP protein, markers, polymoφhisms and SNPs identified within the genomic sequence by the methods described herein. One SNP, B_SNP_302465, is in the coding region. The polymoφhism, SNP 302465, does not change the amino acid sequence in the protein.
Table 3 Exons and SNPs in the Nucleic Acid Encoding FLAP
<img file="WO2004035741A2_D0015.tif" />
<img file="WO2004035741A2_D0016.tif" /><img file="WO2004035741A2_D0017.tif" /><img file="WO2004035741A2_D0018.tif" />
<img file="WO2004035741A2_D0019.tif" /> Table 4
Significant 4 microsatellite marker haplotypes. Length=length of haplotype in Mb. P-val=p-value. RR=Relative risk. N af=Number of patients. P al=allelic frequency of haplotype. P ca =carrier frequency of haplotype. N ct= number of controls. Alleles= alleles in the haplotype.
Markers= markers in the haplotype.
<img file="WO2004035741A2_D0020.tif" />
Alleles #'s: For SNP alleles A = 0, C = 1, G = 2, T = 3; for microsatellite alleles: the CEPH sample (Centre d'Etudes du Polymorphisme Humain, genomics repository) is used as a reference, the lower allele of each microsatellite in this sample is set at 0 and all other alleles in other samples are numbered according in relation to this reference. Thus allele 1 is 1 bp longer than the lower allele in the CEPH sample, allele 2 is 2 bp longer than the lower allele in the CEPH sample, allele 3 is 3 bp longer than the lower allele in the CEPH sample, allele 4 is 4 bp longer than the lower allele in the CEPH sample, allele -1 is 1 bp shorter than the lower allele in the CEPH sample , allele -2 is 2 bp shorter than the lower allele in the CEPH sample, and so on. Table 5
Significant 5 microsatellite marker haplotypes. Length=length of haplotype in Mb. P-val=p-value. RR=Relative risk. N af=Number of patients.
P al=allelic frequency of haplotype. P ca =carrier frequency of haplotype. N ct= number of controls. Alleles= alleles in the haplotype. Markers= markers in the haplotype
<img file="WO2004035741A2_D0021.tif" /><img file="WO2004035741A2_D0022.tif" /> Additional haplotypes were associated with MI, as shown in the following Tables.
5 Table 6 shows haplotypes in the FLAP region (FLAP and flanking nucleotide sequences) that are significantly associated with female MI.
<img file="WO2004035741A2_D0023.tif" /><img file="WO2004035741A2_D0024.tif" />
<img file="WO2004035741A2_D0025.tif" />
P-val: p-value for the association. N_aff: Number of patients used in the analysis.Aff. frq: haplotype frequency in patients. 40 N__ctrl: number of controls used in the analysis.Ctrl.frq: Haplotype frequency in controls. Rel_risk: Relative risk of the haplotype. PAR: population attributable risk. Info: information content.
Table 8 The frequencies ofthe female MI "at risk" haplotypes in male patients vs controls.
<img file="WO2004035741A2_D0026.tif" />
25 Table 9. The selected SNP haplotypes and the corresponding p-values, relative risk (RR), number of patients (#aff), allelic frequency in patients (aff.frq.), carrier frequency in patients (carr.frq.),number of controls (#con), allelic frequency in controls (con.frq.), population attributable risk (PAR). The patients used for this analysis were all unrelated Λvithin 4 meioses.
30
<img file="WO2004035741A2_D0027.tif" />
35
EXAMPLE 2 RELATIONSHIP BETWEEN MUTATION IN 5-LO PROMOTER AND MI A family of mutations in the G-C rich transcription factor binding region ofthe 5-LO gene has previously been identified. These mutations consist of deletion of one, deletion of two, or addition of one zinc finger (Spl/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are noπnally 5 Spl binding motifs in tandem.
These naturally occurring mutations in the human 5-LO gene promoter have been shown to modify transcription factor binding and reporter gene transcription. The capacity ofthe mutant forms of DNA to promote transcription of CAT reporter constructs have been shown to be significantly less than that ofthe wild type DNA (J Clin. Invest.Vobxme 99, Number 5,
March 1997, 1130-1137).
To test whether 5-LO is associated with the atherosclerotic diseases, particularly myocardial infarction (MI) in the human population, this promoter polymorphism, consisting of variable number of tandem Spl/Egr-1 binding sites, was genotyped in 1112 MI patients, 748 patients with PAOD, and 541 stroke patients.
The results, shown in Table 10, demonstrate that the wild type allele (which represents the allele with the most active promoter and thus with the highest expression ofthe 5-LO mRNA) is significantly associated with MI (RR=1.2, p<0.05). The results are consistent with a disease hypothesis that increased expression ofthe 5-LO plays a role in the pathogenesis of MI.
Table 10
N_aff Frq_aff N_ctrl Frq_ctrl Risk Ratio P-valu<
Ml patients 1112 0.8701 734 0.8501 1.1803 0.048
Independent 969 0.8720 734 0.8501 1.2013 0.037
Males 646 0.8740 734 0.8501 1.2232 0.039
Females 465 0.8645 734 0.8501 1.1249 0.180
Age of onset < 60 522 0.8745 734 0.8501 1.2286 0.046
Males 353 0.8768 734 0.8501 1.2542 0.053
Females 169 0.8698 734 0.8501 1.1779 0.202 EXAMPLE 3: ELEVATED LTE4 BIOSYNTHESIS IN INDIVIDUALS WITH THE FLAP MI-RISK HAPLOTYPE
Based on the known function ofthe end products ofthe leukotriene pathway and based on our 5-LO association data, the association ofthe FLAP haplotype with MI is best explained by increased expression and/or increased function of he FLAP gene. In other words, those individuals that have a "at risk" FLAP haplotype have either, or both, increased amount of FLAP, or more active FLAP. This would lead to increased production of leukotrienes in these individuals. To demonstrate this theory, LTE4, a downstream leukotriene metabolite, was measured in patient serum samples. A quantitative determination of LTE4 in human serum was performed by liquid chromatography coupled with tandem mass spectrometry. The protocol was performed as follows:
ANALYTICAL METHOD
Table PI (Protocol 1): List of Abbreviations
<img file="WO2004035741A2_D0028.tif" />
Apparatus and conditions
Table P2 Analytical apparatus and conditions
<img file="WO2004035741A2_D0029.tif" /> Scan mode Multiple reaction monitoring (MRM)
Compound Parent ion Daughter ion
LTE<sub>4</sub> 438.2 333.2
LTE<sub>4</sub>-d<sub>3</sub> 441.2 336.2
Other instruments
Table P3 The apparatus used for sample treatment and measurements
<img file="WO2004035741A2_D0030.tif" />
Materials
Table P4 Reagents for sample treatment and measurements
<img file="WO2004035741A2_D0031.tif" /> Table P5 Reference substances
<img file="WO2004035741A2_D0032.tif" />
Stock solutions
A stock solution of LTE<sub>4</sub> was prepared by the supplier at a concentration of lOOμg/ml in methanol. The stock solution was diluted to a concentration of 20/xg/ml in methanol and this working solution (WS-1) was kept refrigerated at 2-8°C.
An internal standard stock solution (LTE<sub>4</sub>-d<sub>3</sub>) was prepared by the supplier at concentration of 49.5/ιg/ml. The stock solution was diluted to a concentration of lμg/ml in methanol and this working solution was kept refrigerated at 2-8°C.
Preparation of spiking solutions, calibration standards and quality control samples Spiking solutions (SS) in the concentration range of 1 ng/ml to 10000 ng/ml were prepared by dilution ofthe working Solution. The following spiking solutions were prepared:
Table P6 Spiking solutions for calibration standards
<img file="WO2004035741A2_D0033.tif" /> 16 160/d of SS-3 was diluted to 1.0 ml with 70% MeOH/water
12 120μl of SS-3 was diluted to 1 0 ml with 70% MeOH/water
8.0 400 l of SS-5 was diluted to 1 0 ml with 70% MeOH/water
4.0 200μl of SS-5 was diluted to 1 0 ml with 70% MeOH/water
10 2.0 lOOμl of SS-5 was diluted to 1 0 ml with 70% MeOH/water
11 1.4 175μl of SS-8 was diluted to 1 0 ml with 70% MeOH/water
12 1.0 125μl of SS-8 was diluted to 1.0 ml with 70% MeOH/water
Table P7 Spiking solutions for quality controls
<img file="WO2004035741A2_D0034.tif" />
After preparation, spiking solutions for calibration standards and quality controls were kept refrigerated at 2-8°C.
Preparation of calibration standards and quality controls
Fresh calibration standards and quality controls (QCs) were prepared each day by spiking blank plasma as described in Tables P8 and P9, respectively. Table P8 Preparation of calibration standards
<img file="WO2004035741A2_D0035.tif" />
Table P9 Preparation of quality controls
<img file="WO2004035741A2_D0036.tif" />
Sample preparation
Aliquots of 400 μl of each study sample, calibration standards, QC samples and control blank are pipetted into an eppendorf vial. All samples apart from blank are then spiked with 20 μl of internal standard working solution and the samples are then vortex-mixed for few seconds. The pH ofthe plasma samples is adjusted to pH 4.5 using 60 μl of 10% acetic acid and centrifuged for 10 min. at 4100 rpm immediately before the extraction. The solid phase extraction 96-well plate is conditioned with 1 ml methanol and 1 ml water. Then 400μl ofthe plasma samples are loaded on the plate. Vacuum is applied, followed by drying the disk for 1 min. After being washed with 2ml water and 1 ml 30% methanol in 2% acetic acid. Next the plate is eluted with 0.6 ml methanol. The plate is then dried for few minutes. The methanol eluate is evaporated almost to dryness under a stream of nitrogen at 45°C. The residue is reconstituted in 30 μl mobile phase and vortex-mixed for few min. Subsequently, the solutions are centrifuged for 10 min at 10.000 rpm. and 10 μl are injected by the autosampler into the LC-MS/MS system for quantification.
PERFORMANCE OF MEASUREMENTS
The samples will be prepared and measured in batches and a typical batch will consist of:
One set of calibration standards, one extra lowest calibration standard and one blank. Samples collected from a 16 individuals and one set of control samples (C<sub>L</sub>, C , C<sub>H</sub>) Samples collected from a 17 individuals and one set of control samples (C<sub>L</sub>, C<sub>M</sub>, C<sub>H</sub>)
QUANTITATIVE DETERMINATION OF ANALYTE IN PLASMA SAMPLES The standard curve is calculated from the peak area ratios
ANALYTE/INTERNAL STANDARD of the calibration standards and their nominal ANALYTE concentrations. The unknown samples for LTE<sub>4</sub> were calculated from a quadratic regression equation where a weighted curve, I IX , is used. The measured peak area of the samples was converted into pictogram of ANALYTE per milliliter (pg/ml) of plasma according to the calculated equation for the standard curve.
The calculation ofthe regression for the standard curve and the calculations of the concentration ofthe unknown samples and the control samples are performed with MassLynx Software. ACCEPTANCE CRITERIA Calibration standards
The coefficient of determination (R ) for the calibration curve must exceed 0.98. The calibration curve included the concentration range from 50pg/ml -
1500pg/ml.
Concentration ofthe calibration standards must be within ±25% of their nominal value when recalculated from the regression equation. Calibration standards that fail these criteria (at most 3 in each run) are rejected and the calibration performed again with the remaining standards. If the standard curve is not accepted, the samples must be reanalyzed.
Control samples
At least two thirds ofthe analysed quality controls must be within ±25% of their nominal value when calculated from regression equation. If more than a third of the controls fail, the samples must be reanalyzed.
RESULTS
Table 11 (below) shows that the female MI "at risk" haplotype is more significantly associated with female MI patients who have high LTE4 levels (top 50th percentile), than with female MI patients who have low levels of LTE4 (bottom 50th percentile).
In addition, haplotype analysis, comparing female MI patients with high levels of LTE4 with female patients with low levels, showed that those with high levels had increased prevalence ofthe "at risk" haplotype by 1.6 fold (see Table 12). The results<sup>'</sup> show clearly that the "at risk" haplotypes are enriched in the MI patient group that has high levels of LTE4. The carrier frequency ofthe "at risk" haplotypes are 12% and 20%), respectively, in the whole female MI group, but go up to 15% and 24%, respectively, in the female MI group that has high levels of LTE4. Correspondingly, the carrier frequency ofthe "at risk" haplotypes decrease to 8% and 18%, -Ir¬
respectively, in the group of female MI that has low levels of LTE4 (Note carrier frequencies are twice the disease allele frequency times 1 minus the disease allele frequency plus the square ofthe disease allele frequency).
Note that LTE4 may simply reflect the leukotriene synthesis rate ofthe leukotriene synthetic pathway upstream ofthe key leukotriene metabolite involved in MI risk. For example, leukotriene B4 is probably more likely than leukotriene E4 to be involved in the inflammatory aspects of MI plaques but since B4 has a short half life, it is difficult to measure reliably in serum samples, while E4 has long term stability.
Table 11 Association ofthe at risk haplotypes for female MI, with female MI who also have high levels of LTE4 (>50pg/ml (roughly the upper 50th percentile). Less significant association between the at risk haplotype for female MI, with female MI who also have low levels of LTE4 (<50pg/ml).
<img file="WO2004035741A2_D0037.tif" />
P-val: p-value for the association N_aff: Number of patients used in the analysis Aff. frq haplotype frequency m patients N_ctrl number of controls used m the analysis Ctrl.frq: Haplotype frequency in controls Rel_risk Relative risk of the haplotype PAR population attributable risk Info: information content Table 12 Association between haplotypes that are most significantly associated with female MI, and serum LTE4 levels. Here, the group of affected individuals are defined as female MI patients with high serum LTE4 (higher than 50 pg/ml) and the control group is defined as female MI patients with low serum LTE4 (below 50 pg/ml)
<img file="WO2004035741A2_D0038.tif" />
P-val: p-value for the association. N_aff: Number of patients used in the analysis.Aff. frq: haplotype frequency in patients. N_ctrl: number of controls used in the analysis.Ctrl.frq: Haplotype frequency in controls. Rel_risk: Relative risk ofthe haplotype. PAR: population attributable risk. Info: information content.
EXAMPLE 4 ELEVATED LTE4 CORRELATED WITH ELEVATED C- REACTIVE PROTEIN (CRP)
The relationship between the increased production of leukotrienes and the inflammatory marker CRP, a well established risk factor for MI, was then explored. As shown in FIG. 9, a significant positive correlation was found between serum LTE4 levels and serum CRP levels.
EXAMPLE 5: ASSESSMENT OF LEVEL OF CRP IN PATIENTS WITH AT-RISK
HAPLOTYPE
The level of CRP in female patients with female MI at-risk haplotypes was assessed, in order to demonstrate the presence of a raised level of inflammatory marker in the presence ofthe female MI at-risk haplotype. Results are shown in
Table 13. The average CRP was elevated in those patients with the at-risk haplotype versus those without it. Table 13
All female patients no Mean CRP SE CRP affecteds: With haplotype. 155 4.91 8.7
Not with haplotype. 218 4.35 6.13
EXAMPLE 6: ELEVATED SERUM LTE4 LEVELS IN MI PATIENTS VERSUS CONTROLS
The end products ofthe leukotriene pathway are potent inflammatory lipid mediators that can potentially contribute to development of atherosclerosis and destabihzation of atherosclerotic plaques through lipid oxidation and/or proinflammatory effects. Examples one through five show that: 1) MI correlates with genetic variation at FLAP; 2) MI correlates with high expression promoter polymorphism at 5-LO; 3) C-reactive protein levels correlate with serum leukotriene E4; and 4) Patients with Mi-risk FLAP haplotypes have higher levels of serum leukotriene E4 and CRP. Based on these data, it was hypothesized that serum leukotriene E4 levels correlate with MI risk.
To test this hypothesis, LTE4, a downstream leukotriene metabolite, was measured in 488 female MI patient and 164 control serum samples. The LTE4 levels for the patients was higher than that for the controls using a one-sided Wilcoxon rank- sum test. The p-value ofthe difference was 0.0092 thus confirming our hypothesis. Therefore, elevated leukotriene E4 represents a risk factor for MI. Serum or plasma LTE4 levels may be used to profile the MI risk for individuals to aid in deciding which treatment and lifestyle management plan is best for primary or secondary MI prevention. In the same way other leukotriene metabolites may be used to risk profile for MI. SUMMARY
In summary, it has been found that: MI correlates with genetic variation at
FLAP; MI correlates with high expression promoter polymorphism at 5-LO; patients with female MI at-risk FLAP haplotypeis have higher levels of serum LTE4; LTE4 levels correlate with CRP levels in serum; and patients with MI at-risk FLAP haplotypes have elevated CRP.
Taken together, these results show that increased leukotriene synthesis is a risk factor for MI, especially but not only in females, and that this risk is driven in part by variants in FLAP and 5-LO genes and are captured in part by measurement of levels of serum LTE4 and CRP.
MARKERS UTILIZED HEREIN
Table 14: Position (Mb) of microsatellite markers sequence assembly (SA5), primers and size ofthe markers.
'nib Marker Forward Reverse size
25.0920 ACGGTGATGACGCCTACATT TCACATGGACCAATTACCTAGA
42DG13S2101 (SEQ ID NO: 4) A(SEQ ID NO: 5) 188
25.0920 CAAATTTCAGATGTGCCAACC ACGGTGATGACGCCTACATT(S
42DG13S48 (SEQ ID NO: 6) EQ ID NO: 7) 214
25.3965 ACCAGCCTTTGCTTAGGA(SEQ ID ACATTCTAGTGCTACAGGGTAC
04D13S1304 NO: 8) TC(SEQ ID NO: 9) 133
25.3965 TGTTCTGCACACGAACATTCT(SE TCCTGAGTCCTCTCCACCTG(S
35DG13S2105 Q ID NO: 10) EQ ID NO: 11) 104
25.4455 TGGGAATTAATGAAGAACAACAA CATGTTTCGAAGAACTCAAGAG 11 DG13S2106 A(SEQ ID NO: 12) G(SEQ ID NO: 13) 428
25.5449 AAATTACTTCATCTTGACGATAAC CTATTGGGGACTGCAGAGAG
20D13S1254 A(SEQ ID NO: 14) (SEQ ID NO: 15) 218
25.5449 GGGACTGCAGAGAGCAGAAG CAAGAAGGGAAATTCCTACGC
25DG13S2107 (SEQ ID NO: 16) (SEQ ID NO: 17) 95
25.5659 AGCCAGTGTCCACAAGGAAG GAGGGTGAGACACATCTCTGG
56DG13S55 (SEQ ID NO: 18) (SEQ ID NO: 19) 283
25.6057 AA TCGTGCCTCAGTTCCATC CCACCAGGAACAACACACAC
93DG13S54 ( (SSEEQ ID NO: 20) (SEQ ID NO: 21 ) 156
25.6196 TTGCTCTCCAGCCTGGGC (SEQ TTCCTCTGGCTGCCTGCG
93D13S625 ID NO: 22)<sub>^</sub> (SEQ ID NO: 23) 185
25.6874 ΠTGATTCCGTGGTCCATTA (SEQΓΓTA ΓTGGTCGGTGCACCTTT
22DG13S1479 ID NO: 24) (SEQ ID NO.25) 339
25.7493 GGTAGGTTGAAATGGGCTAACA T CATGACAAGGTGTTGGATTT
4 DG13S1440 (S Q D NOj_26) ( (_SEQ ID NO: 27) 153 25.9012 CCTCCTCTGCCATGAAGCTA CTATTTGGTCTGCGGGTTGT
12DG13S1890 (SEQ ID NO: 28) (SEQ ID NO: 29) 418
25.9280 ΓTTGAGCCCAGATCTAAGCAA AAATGTTAATGTCACCGACAAA 81 DG13S1879 (SEQ ID NO: 30) (SEQ ID NO: 31) 443
25.9326 TACTGGGTTATCGCCTGACC CCAATGGACCTCTTGGACAT
09DG13S1540 (SEQ ID NO: 32) (SEQ ID NO: 33) 152
25.9467 TTGAATGTTCATATATTTGTGGT CCCTCGTAATGAAACCTATTTG
43DG13S1889 G (SEQ ID NO: 34) A (SEQ ID NO: 35) 222
25.9486 CGGCACAGTCCTCAATA CAGGGTGTGGTGACAT (SEQ
79DG13S59 (SEQ ID NO: 36) ID NO: 37) 228
25.9523 TGTTTCTTTCTTTCTCTCTCTCTTTAAATGAGTTCAATGAGTTGTGG
47DG13S1894 C (SEQ ID NO: 38) (SEQ ID NO: 39) 209
25.9883 CAGAGAGGAACAGGCAGAGG AGTGGCTGGGAAGCCTTATT
60DG13S1545 (SEQ ID NO: 40) (SEQ ID NO:41) 394
26.0718 AGGTGAGAGAACAAACCTGTCTT GCCTTCCTTCTAAGGCCAAC
66DG13S1524 (SEQ ID NO: 42) (SEQ ID NO: 43) 115
26.1834 TGTTATACATTTCAATTTCACCTC GTACTCCAGCCGGGCAAC
92DG13S1491 A (SEQ ID NO: 44) (SEQ ID NO: 45) 286
26.2362 TTGTTCAGTGCTCTATAGTTACAA GGTCACAAAGCTATGCGATTA
89DG13S62 AGT (SEQ ID NO: 46) (SEQ ID NO: 47) 158
26.2734 TCAACAAGTGGATTAAGAAACTG CTGTTTATGGCTGAGAAGTATG
63D13S1244 TG (SEQ ID NO: 48) C (SEQ ID NO:49) 86
26.2869 TAGCAGGGTGCAGTCTA (SEQ ID ACCATACCACCACCACCATC
35DG13S64 NO:50) (SEQ ID NO: 51 ) 247
26.3145 ACTGTACTTCTGCCTGGGC (SEQ TTTTGTAATGCCTCAACCATG 01 D13S243 ID NO: 52) (SEQ ID NO: 53) 147
26.3271 CTGTAGACTTT ATCCCTGACTTACCAATGAATGATGAAGATTCCAC
84DG13S1529 TG (SEQ ID NO: 54) TC (SEQ ID NO: 55) 132
26.3387 TGACACCATGTCTTACTGTTTGC GAGGATACAATGAGAACCAAAT
67DG13S1908 (SEQ ID NO: 56) CTC (SEQ ID NO: 57) 224
26.3880 CCACAGAATGCTCCAAAGGT GAGTTCAAGTGATGGATGACG
34DG13S1546 (SEQ ID NO: 58) A (SEQ ID N0.59) 357
26.4358 C CA, GATAGATGAATAGGTGGATGG CACTGTTCCAAGTGCTTTGC 11 DG13S1444 A (SEQ ID NO: 60) (SEQ ID NO: 61) 193
26.4866 GCAGGGCAAACTGCCTTAT (SEQ TTTGGTGAAATGTCTGTTTATG
57DG13S1458 ID NO:62) G (SEQ ID NO: 63) 402
26.5045 CTCAACCTGGCTTCTACT (SEQ TACTCCTTAATAAACTCCCC
45D13S252 ID NO: 64) (SEQ ID NO: 65) 338
26.5082 T ATGCGTTGTGTGTGTG (SEQ ID GGGCCTTAGATTCTTGTAGTG 31 DG13S66 NNO:66) G (SEQ ID NO: 67) 217
27.1151 CTCGCATCTCGCTTCTCACT CTCAAGGGTCCAGTGGTTTG
20DG13S1554 (SEQ ID NO: 68) (SEQ ID NO: 69) 420
27.1406 TGTCCAGACTGCCTCCTACA TGCAACACCTGGTTCACAAT
75DG13S1907 (SEQ ID NO:70) (SEQ ID NO: 71) 131
27.1458 CACAGTGAGACTCTATCTCAAAA TCAGACTGGCTTAGACTGTGG
42D13S802 A (SEQ ID NO: 72) (SEQ ID NO: 73) 150
27.2406 YTTCCAAAGGCCAGGTG (SEQ CCATACAGTTTCCTAGGTTCTG
16DG13S1892 ID NO: 74) G (SEQ ID NO: 75) 373
27.2534 CACCTGGCCAAATGTTTGTT TGCTTGAATCCAGAGACTGC
52DG13S1849 (SEQ ID NO: 76) (SEQ ID NO: 77) 190
27.2738 ΓTGCGAGTCCTTGTGGAGT ACAGTCCGCTCCCTCCTAAT
60DG13S68 (SEQ ID NO: 78) (SEQ ID NO: 79) 238
27.2804 ATGCTTGGCCCTCAGTTT (SEQ TTGGCAACCCAAGCTAATATG 61 DG13S69 ID NO: 80) (SEQ ID NO:81 ) 296 27.4837 CTCCACAGTGACAGTGAGG (SEQ GAGAGGTTCCCAATCCC (SEQ
99D13S1250 ID NO:82) ID NO: 83) 160
27.6104 CATCAACCTCCCCACCAC (SEQ TATTTTTTCAGTCCCACAGTTA
06D13S1448 ID NO: 84) GC (SEQ ID NO:85) 227
27.6158 CAGCTCCTGGCCATATTTCT GAGCCATTTCTCTGGGTCTG
14DG13S574 (SEQ ID NO: 86) (SEQ ID NO:87) 153
27.6412 GGTCCGTGTCAACCCTTAGA CAGGTTGATGGGAGGGAAA 11 DG13S73 (SEQ ID NO: 88) (SEQ ID NO: 89) 198
27.6615 CGGGAAATGACAGTGAGACC TGCCTAGATTCTCCCGTAAG
07DG13S1532 (SEQ ID NO: 90) (SEQ ID NO: 91) 163
27.7053 GTGCCCAGCCAGATTC (SEQ ID GCCCCCAGTCAGGTTT (SEQ ID
47D13S1242 NO: 92) NO: 93) 198
27.8838 TTTCTCTCTCCACGGAATGAA AACCCATTCTCACAGGGTGTA
72DG13S576 (SEQ ID NO:94) (SEQ ID NO: 95) 199
27.8973 AGGAGTGTGGCAGCTT <sup>"</sup>GAG TGGATTCCCGTGAGTACCAG
65DG13S1917 (SEQ ID NO: 96) (SEQ ID NO: 97) 165
27.9321 ATGCTGGGATCACAGGC (SEQ ID AACCTGGTGGACTTTTGCT
54D13S217 NO: 98) (SEQ ID NO: 99) 170
28.0806 AGCATTTCCAATGGTGCTTT CATGTTGATATGCCTGAAGGA
32DG13S581 (SEQ ID NO: 100) (SEQ ID NO:101) 367
28.1653 CACTGTCTGCTGCCACTCAT AGAGATTATGTGATGTACCCTC
48DG13S1471 (SEQ ID NO:102) TCTAT(SEQ ID NO:103) 267
28.3032 CAAGCCTGGGACACAGAAAT TTTGCAGACACCACAACACA
52DG13S583 (SEQ ID NO: 104) (SEQ ID NO: 105) 264
28.3032 ATGACCTAGAAATGATACTGGC CAGACACCACAACACACATT
56D13S120 (SEQ ID NO: 106) (SEQ ID NO: 107) 175
28.3855 GGTTTAAAAACCTCATGCC ATCCCAAACTCTGTACTTATGT
66D13S1486 (SEQ ID NO: 108) AGG (SEQ ID NO: 109) 151
28.4155 TTTGCACATACACATAAGCGAAC CACAAATCCCGTGCACTAAA
30DG13S1024 (SEQ ID NO: 110) (SEQ ID NO: 111) 139
28.4155 ATTCCTGGGCTCATGGTACA TGCCGTCATCTGCTTTAGAA
30DG13S1510 (SEQ ID NO: 112) (SEQ ID NO: 113) 390
28.4303 CCTTGGCTGTTGTGACTGGT CACTCAGGTGGGAGGATCAC
08DG13S1495 (SEQ ID NO:114) (SEQ ID NO: 115) 285
28.5175 GCTGTTTCCTTGGCTTCTTCT CCCATACTTGAGATGACCATGA 41 DG13S1482 (SEQ ID NO: 116) (SEQ ID NO: 117) 291
28.5510 CACTTTGCCAGTAGCCTTGA TTGGGAAAGTTAACCCAGAGA
60DG13S1845 (SEQ 1D NQ:118) (SEQ ID NO: 119) 284
28.6349 TTGGGAAGAGCCATGAGAC CTCTGGGCATTGGAGGATTA
03DG13S1030 (SEQ ID NO: 120) (SEQ ID NO: 121) 354
28.6349 TTTGGGAAGAGCCATGAGAC AATGCCCATGTGCACTGTAG
03DG13S1467 (SEQ ID NO: 122) (SEQ ID NO: 123) 231
28.6866 GGGAGACAAGTCAGGTGAGG CTGAGTATGGAGTCTTCATCAT
07DG13S584 (SEQ ID NO: 124) TATC (SEQ ID NO: 125) 151
28.7940 TCGTCTCGAAGAAAGAAAGAAGA CACCATGGGTTAATTGCACA
32DG13S1519 (SEQ ID NO:126) (SEQ ID NO: 127) 286
28.8761 TGACGTGGGTTCAGGTTGTA AGTGCATTGGTGCCTTCTCT
56DG13S77 (SEQ ID NO: 128) (SEQ ID NO: 129) 220
28.9707 GGACTGCCAATTCTACAGCA TTCCATGGGAAATTTGGTC
23DG13S586 (SEQ ID NO: 130) (SEQ ID NO: 131) 151
28.9756 TGCTACTAGATTTGACCAACCA GACTTGTAAAGGATTTAGTGAT 41 DG13S79 (SEQ ID NO: 132) TTCG (SEQ ID O: 133) 128
29.0593 GTGGAAGGCCTCTCTTG TGCTTCTTGAGGGAAAGCAT
94DG13S80 (SEQ ID NO: 134) (SEQ ID NO: 135) 233 29.1261 CACGTGGTTCACCTCTCTAGG TTGGCCACTTATTTGTG
52DG13S82 (SEQ ID NO: 136) (SEQ ID NO: 137) 302
29.1546 CGATGAGTGACAGGGCT (SEQ ID CCTCGTGGGTGGAATAA 91 D13S1299 NO: 138) (SEQ ID NO: 139) 225
29.1547 TTGGCCATTAGCAATTAGCA CGTGGGTGGAATAAATCAGG
37DG13S85 (SEQ ID NO: 140) (SEQ ID NO: 141 ) 153
29.1584 GTTGAGGCAAGAGAATCACT GCACATTTACACCAGGGTG
62D13S629 (SEQ ID NO: 142) (SEQ ID NQ.143) 145
29.2240 CCTTCAGAGGATTTCCCTTTC CTGGTTTGACTCCAGCTTCA
60DG13S1934 (SEQ ID NO: 144) (SEQ ID NO: 145) 431
29.2454 TGTTCAAACCTAAGGTGCTTCA GAAACAACAACAACAACAACAA
62DG13S1098 (SEQ ID NO: 146) CA (SEQ ID NO: 147) 416
29.2598 CCTGGCACGGAATAGACACT GGCCTCCTTTGCTCTGAAG
40DG13S1104 (SEQ ID NO: 148) (SEQ ID NO: 149) 378
29.2944 CATCCCTGTGGCTGATTAAGA AACAGTTCCAGCCCGTTCTA
36DG13S1097 (SEQ ID NO: 150) (SEQ ID NO: 151) 162
29.3097 ΓTCAAAGGAATATCCAAGTGC TGGCGTACCATATAAACAGTTC
00DG13S1110 (SEQ ID NO: 152) TC (SEQ ID NO: 153) 265
29.3099 ΓTTCAAAGGAATATCCAAGTGC AAACGTGACACTTCCACACA
09DG13S86 (SEQ ID NO: 154) (SEQ ID NO: 155) 177
29.3599 TTCAATGAAGGTGCCGAAGT TGTCTATCCCAAAGCAA (SEQ 61 DG13S87 (SEQ ID NO: 156) ID NO: 157) 218
29.5224 GCAAGACTCTGTTGAAGAAGAAG TCCCTCTGTTTGAGTTTCTCG
43DG13S1111 A (SEQ ID NO: 158) (SEQ ID NO: 159) 110
29.5746 AGGCACAGTCGCTCATGTC (SEQ|AAAC ΓTTAGCTAATGGTGGTCA
65DG13S1101 ID NO: 160)' AA (SEQ ID NO. 161) 333
29.6227 TGTGATTCCAGGGAGCTATCA T AGGTGTGTGGAGGACAGCA
55DG13S1106 (SEQ ID NO. 162) ι i (fSEQ ID NO. 163) 416
29.6589 CCAGTTTCAGTTAGCCAAGTCTG GAGAGGGAATGAATGCAGGA
10DG13S172 (SEQ ID NO: 164) (SEQ ID NO: 165) 267
29.6657 GAGCATGTGTGACTTTCATATTC AGTGGCTATTCATTGCTACAGG
09D13S1246 AG(SEQ ID NO: 166) (SEQ ID NO: 167) 177
29.6725 TTGCTGGATGCTGG1 ΪTCTA(SEQ AAAGAGAGAGAGAAAGAGAAA 61 DG13S1103 ID NO: 168) GAAAGA(SEQ ID NO: 169) 264
29.8259 CTGGTTGAGCGGCATT(SEQ ID TGCAGCCTGGATGACA(SEQ
75D13S289 NO: 170) ID NO: 171) 260
29.8266 CCTATGGAAGCATAGGGAAGAA( CCCACTTCTGAGTCTCCTGAT( 31 DG13S166 SEQ ID NO: 172) SEQ ID NO: 173) 395
29.9066 GGGATGCAGAAAGGATGTGT(SE AAGAATGCTGGCCAACGTAA(S
89DG13S164 Q ID NO: 174) EQ ID NO: 177) 218
29.9067 CTCTCAGCAGGCATCCA(SEQ ID GCCAACGTAATTGACACCA(SE
00D13S1238 NO: 178) Q ID NO:179) 129
30.0313 CCTTAGGCCCCATAATCT(SEQ ID CAAATTCCTCAATTGCAAAAT(S
78D13S290 NO: 180) EQ ID NO:181) 176
30.0863 GGTCATTCAGGGAGCCATTC(SE CCATTATATTTCACCAAGAGGC
03D13S1229 Q ID NO: 182) TGC(SEQ ID NO: 183) 119
30.1928 TGCCTGGTCATCTACCCATT(SEQ TCTACTGCAGCGCTGATCTT(S
47DG13S1460 ID NO: 184) EQ ID NO: 185) 264
30.2176 CATTTATGAATGGAGGTGAAGC(SATGGGAGCTCAAAGGGAAAT(S
70DG13S1933 EQ ID NO: 186) EQ ID NO: 187) 186
30.3032 CAGCAGGAAGATGGACAGGT(SE CACACTGCATCACACATACCC(
13DG13S1448 Q ID NO: 188) SEQ ID NO: 189) 136
30.3178 TATGCCAGTATGCCTGCT(SEQ ID GTCACATCAGTCCAT TGC(SE 71 D13S1287 NO: 190) Q ID NO: 191) 232 30.3421 CCAAAGCAAGTAACCTCCTCA(SEAAACAATCACTGCCCTCTGG(S
02DG13S1061 Q ID NO: 192) EQ ID NO. 193) 227
30.5718 TGATGAAATTGCCTAGTGATGC(S GGATCCAATCGTACGCTACC(S
37DG13S1904 EQ ID NO: 194) EQ ID NO. 195) 136
30.6434 CGAATGGGTGACTAACAGCA(SE CTGGAGTGCAGGGACATGA(SE
38DG13S882 Q ID NO: 196) Q ID NO: 197) 378
30.6659 AAAGAAATATTCCAAGAAGAAAG TT« GCACAACTTTGTGTAGAGCA
37DG13S295 AAA(SEQ ID O: 198 ) (SEQ ID NO: 199) 279
30.6744 G GGGTATGTCTTTATTCTCGGCAG GTGCATTCACAGACCAGTCATT
68D13S1226 T A(SEQ ID NO: 200) (SEQ ID NO: 201) 219
30.6909 GGGCTTGAAGGCACTAAATGT(S CCAAGCAGTAATTCCTTCCTCA
59DG13S293 EQ ID NO: 202) (SEQ ID NO:203) 313
30.7124 ACCTAAACACCACGGACTGG(SE CAGGTATCGACATTCTTCCAAA
68DG13S1490 Q ID NO: 204) (SEQ ID NO: 205) 418
30.8244 TGGGAAGCCAGTAAAGTAGGAA( AAA G* AGACTCCACACATCCATT
83DG13S93 SEQ ID NO: 206) T( (SSEEQ ID NO: 207) 190
30.8248 AGGGCTATTCCTCAAGGTGTT(SETGCTAACACTACCCTCGCAAT(
59DG13S94 Q ID NO: 208) SEQ ID NO: 209) 332
30.9284 GGGCAGGAATCTCTGAAGTG CTCCACTGAGAAGCCAAGGA(S
29DG13S1534 (SEQ ID NO: 210) EQ ID NO. 211) 382
30.9403 AGGCCAAGCTGGTCCATAG(SEQ TCTCTCAAAGCCTCGCTCTC(S
69DG13S95 ID NO: 212) EQ ID NO: 213) 126
30.9702 CCTTTGAGGCTGGATCTGTT(SEQ]T TTCCTTATCATTCATTCCCTCA
38DG13S96 ID NO: 214) (SEQ ID NO: 215) 218
31.0388 AGATATTGTCTCCGTTCCATGA(S CCCAGATATAAGGACCTGGCT
7 D13S260 EQ ID NO: 216) A(SEQ ID NQ: 217) 163
31.0922 rTTAAGCCCTGTGGAATGTATTTX GACATTGCAGGTCAAGTAGGG(
94DG13S17 SEQ ID NO: 218) SEQ ID NO: 219) 157
31.2078 TGCATAAGGCTGGAGACAGA(SE CACAGCAGATGGGAGCAAA(SE
4 DG13S306 Q ID NO: 220) Q ID NO:221) 158
31.2605 GTGCATGTGCATACCAGACC(SE GGCAAGATGACCTCTGGAAA(S 21 DG13S18 Q ID NO: 222) EQ ID NO: 223) 319
31.2997 GTCCACTGCAGCACACAGAG(SE GCACTGGTAGATACATGCTAAC
20DG13S1905 Q ID NO: 224 ) G(SEQ ID NO: 225) 383
31.3532 GGGTATCTTGGCCAGGTGT(SEQ TGGCTAAGCACAATCCCTTT(S
30DG13S307 ID NO: 226) EQ ID NO: 227 ) 403
31.3551 TTTGTGTTCCAGGTGAGAATTG(S GAACCATATCCCAAGGCACT(S
35DG13S1062 EQ ID NO: 228) EQ ID NO: 229) 120
31.4143 AACCCAAATCAACAAACCAGA(SE AATGAATTCTGGGTCACATGC(
29DG13S1874 Q ID NO: 230) SEQ ID NO: 231 ) 404
31.4295 TTGTTCCCACATTCATTCTACA(S TTAAACTCGTGGCAAAGACG(S
62DG13S1093 EQ ID NO: 232) EQ ID NO: 233) 273
31.6265 CACCATGCCTGGCTCTTT(SEQ ID AACTTCTCCAGTTGTGTGGTTG
02DG13S1059 NO: 234) (SEQ ID NO: 235) 330
31.7237 AGCTGAGCTCATGCCACT(SEQ CAAGACCTTGTGCATTTGGA(S
49DG13S1086 ID NO: 236) EQ ID NO: 237) 155
31.7460 AGCCAGACATGGTAGTGTGC(SE GCAATAACTCACACATCAGCAA
74DG13S1515 Q ID NO: 238) (SEQ ID NO:239) 417
31.8557 CCTACCATTGACACTCTCAG(SEQ TAGGGCCATCCATTCT(SEQ ID
32D13S171 ID NO: 240) NO: 241 ) 231
31.9173 ACCAAGATATGAAGGCCAAA(SE CCTCCAGCTAGAACAATGTGAA
32DG13S1092 Q ID NO: 242) (SEQ ID NO: 243) 176
32.0028 TGTCCATAGCTGTAGCCCTGT(SECTCAATGGGCATCTTTAGGC(S
52DG13S1449 Q ID NO: 244) EQ ID NO: 245) 279 32.0729 TGTAATTCAACGACTGGTGTCC(S|AGC TTCTGATGGTTGCTGGT(S
57DG13S1489 EQ ID NO: 246) EQ ID NO: 247) 130
32.0839 CAAACAAACAAACAAGCAAACC(S TGGACGTTTCTTTCAGTGAGG(
89DG13S312 EQ ID NO: 248) SEQ ID NO: 249) 349
32.1251 TGATAACTTACCAGCATGTGAGC(TCACCTCACCTAAGGATCTGC(
77DG13S1511 SEQ ID NO: 250 ) SEQ ID NO: 251 ) 314
32.1835 CATGCAATTGCCCAATAGAG(SE TTGGGCTTGTCTACCTAGTTCA
47DG13S314 Q ID NO: 252 )_ (SEQ ID NO: 253 ) 335
32.1953 TGGGTTCCTCATACTGGAGTG(S GCCTGAGCTCCAAGCTCTTT(S
58DG13S1090 EQ ID NO: 254 ) EQ ID NO: 255 ) 169
32.2510 GCTGCACGTATTTGTTGGTG(SE AAACAGCAGAAATGGGAACC(S
38DG13S1071 Q ID NO: 256 ) EQ ID NO: 257 ) 239
32.3568 CCGTGGGCTATCAATTTCTG(SEQAAGATGCAATCTGGTTTCCAA(
95DG13S1068 ID NO: 258 ) SEQ ID NO: 259 ) 238
32.3730 CCCAAGACTGAGGAGGTCAA(SE GCTGACGGAGAGGAAAGAGA(
40DG13S1077 Q ID NO: 260 ) SEQ ID NO: 261 ) 374
32.4227 TGACAAGGGTGTGGTTATGG CCGCACTTTCTCTTCTGGAC
80DG13S1906 (SEQ ID NO: 262) (SEQ ID NO:263) 425
32.5115 TGAGAAGCCTGGGCATTAAG ACAAGCTCATCCAGGGAAAG
90DG13S316 (SEQ ID NO: 264) (SEQ ID NO: 265 ) 243
32.6105 TTi GGAAAGGAAGAAAGGAAGG TTGAAACCTAAATGCCACCTG
17DG13S317 (SEQ ID NO: 266) (SEQ ID NO:267) 215
32.6107 ACCTGTTGTATGGCAGCAGT GGTTGACTCTTTCCCCAACT
13D13S1493 (SEQ ID NO: 268) (SEQ ID NO: 269) 248
32.7898 AGAGCTGATCTGGCCGAAG (SEQ GGTGGACACAGAATCCACACT
94DG13S1558 ID NO:270) (SEQ ID NO: 271) 399
32.8659 GGCCTGAAAGGTATCCTC (SEQ TCCCACCATAAGCACAAG (SEQ
50D13S267 ID NO:272) ID NO: 273 ) 160
32.9614 TCAACCTAGGATTGGCATTACA TCTAGGATTTGTGCCTTTCCA
10DG13S1478 (SEQ ID NO: 274) (SEQ ID NO: 275) 38
33.0099 GACGTCTTAGGATTGACTTCTGC CCAAATACACATTCTTAAAGGG
22DG13S1513 (SEQ ID NO: 276) AAA (SEQ ID NO: 277) 173
33.1256 GACTGCAGATCGTGGGACTT TTCTCCAGAGAAACCAAACCA
96DG13S1461 (SEQ ID NO: 278) (SEQ ID NO: 279) 148
33.1684 ATTCGTGCAGCTGTTTCTGC GCATGACATTGTAAATGGAGG
68DG13S1551 (SEQ ID NO. 280) A (SEQ ID O:281) 263
33.2549 GGTGGGAATGTGTGACTGAA CCAGGTACAACATTCTCCTGAT
89DG13S1884 (SEQ ID NO. 282) (SEQ ID NO:283) 123
33.3401 TGCAGGTGGGAGTCAA (SEQ ID AAATAACAAGAAGTGACCTTCC
2 D13S1293 NO. 284) TA (SEQ ID NO: 285) 129
33.3469 TGTTCTCCTCACCCTGCTCT TTTCAGGCTAGGAAGATCCTTT
08DG13S326 (SEQ ID NO: 286) (SEQ ID NO: 287) 261
33.3926 M3GATGCATTCGGTTAGAG ACTGTCCTGTGCCTGTGCTT
29DG13S1518 (SEQ ID NO: 288) (SEQ ID NO: 289) 375
33.4055 CCTGAATAGGTGGAATTAAGATC TCAAGGAGCATACACACACAC
27DG13S23 AA (SEQ ID NO: 290 ) A (SEQ ID NO: 291) 107
33.4315 GTCCACCTAATGGCTCATTC CAAGAAGCACTCATG1 ΓGTG
36D13S620 (SEQ ID NO: 292) (SEQ ID NO: 293 ) 185
33.4370 AGCCTGTGATTGGCTGAGA (SEQ GGCTTACAGCTGCCTCCTTT
92DG13S1866 ID NO: 294 ) (SEQ ID NO: 295 ) 410
33.4957 CCCACAGAGCACTTTGTTAGA GCCTCCCTTAAGCTGTTATGC
18DG13S1927 (SEQ ID NO: 296) (SEQ ID NO: 297 ) 401
33.5034 CACTCTTTACTGCCAATCACTCC GCCGTGTGGGTGTATGAAT
40DG13S1503 (SEQ ID NO:298 ) (SEQ ID NO: 299 ) 226 33.5681 TTGTACCAGGAACCAAAGACAA CACAGACAGAGGCACATTGA
00DG13S332 (SEQ ID NO: 300) (SEQ ID NO: 301 ) 176
33.6758 GCTCTGGTCACTCCTGCTGT CATGCCTGGCTGATTGTTT 41 DG13S333 (SEQ ID NO: 302) (SEQ ID NO: 303 ) 446
33.7713 CCAACATCGGGAACTG (SEQ ID TGCATTCTTTAAGTCCATGTC
89D13S220 NO: 304) (SEQ ID NO: 305) 191
33.8180 CAGCAACTGACAACTCATCCA CCTCAATCCTCAGCTCCAAC 41 DG13S1919 (SEQ ID NO: 306 ) (SEQ ID NO.307) 255
33.8736 TCCTTCACAGCTTCAAACTCA AGTGAGAAGCTTCCATACTGGT
14DG13S1439 (SEQ ID NO: 308 ) (SEQ ID NO: 309) 239
33.9060 GCCAACCGTTAGACAAATGA CTACATGTGCACCACAACACC
65DG13S335 (SEQ ID NO: 310) (SEQ ID NO: 311) 201
33.9286 AGTTTATTGCCGCCGAGAG (SEQ ACCCACCACATTCACAAGC
53DG13S340 ID NO. 312) (SEQ ID NO: 313) 373
34.0194 CGATTGCCATGTCTCTTTGA GAGATCTGGCCTGGATTTGT
55DG13S1496 (SEQ ID NO: 314 ) (SEQ ID NO: 315 ) 155
34.0340 TGAGGCCAGCCTTACCTCTAT CCAGACATGGTGGCTTGT
89DG13S342 (SEQ ID NO: 316) (SEQ ID NO: 317) 366
34.0617 GAAGGAAGGAAGGGAAGGAA AAGGATGAGAAGAGTCCATGC
77DG13S344 (SEQ ID NOV 318) (SEQ ID NO: 319 ) 292
34.0672 AAATACCCTTTGAACAGACACAC TAGCTGAGCATGGTGGTACG
39DG13S345 (SEQ ID NO: 320) (SEQ ID NO: 321 ) 201
34.0778 XGACAAGACAGCAATCCAAA GCAGAACCCAGGCTACAGAT
74DG13S346 (SEQ ID NO: 322) (SEQ ID NO. 323 ) 152
34.0841 TCATTGTCAGCACAGAATGAACT( GGAGGGAGGGAAGAAAGAGA
38DG13S347 SEQ ID NO: 324) (SEQ ID NO: 325 ) 338
34.0843 GCAACACAGTGAAAGCCCA(SEQ ACAGGAGCATGCCACCATG(SE
26D13S624 ID NO: 326) Q ID NO: 327) 191
34.1560 GGGAAGAGGAGATTGACTTGTT( GGAACACCATCATTCCAACC(S
75DG13S339 SEQ ID NO: 328) EQ ID NO: 329) 232
34.1924 TACAAGCTCCACCGTCCTTC(SEQTGAGTTGCTGCCTCTTCAAA(S
78DG13S1926 ID NO: 330) EQ ID NO: 331) 261
34.2202 V GCTAATGGGCCAAGGAATA(SE GCTAAATGTCCTCATGAATAGC
27DG13S1469 Q Q ID NO: 332) C(SEQ ID NO: 333 ) 382
34.3014 P GTCCTGCAGACAGATGGTC(SE CCTCCGGAGTAGCTGGATTA(S 48 DG13S351 QQ ID NO: 334) EQ ID NO: 335 ) 294
34.3878 GAGACTGGCCCTCATTCTTG(SE AAGAAGCCAGAGACAAAGAAA
83DG13S26 Q ID NO: 336) TACA(SEQ ID NO: 337 ) 330
34.5354 CATCTATCTTTGGATTCAGTGGT TGCTCCCAACATCTTACCAG(S 41 DG13S30 G(SEQ ID NO: 338) EQ ID NO: 339 ) 388
34.5655 TGTCCTCTGGTCATTTCTATGGT( CATGAATGAGAAGTGATGAATG
9 DG13S1435 SEQ ID NO: 340) G (SEQ ID NO: 341 ) 235
34.6598 AACACGGGAAATTCCAACAG(SE TGAAGAACTGAAATTGCCAGTA
58DG13S1446 Q ID NO: 342) A(SEQ ID NO: 343 ) 379
34.7122 CAGACACTGTAAACTGGCTTCG( GCCACATTGCTATCAGCGTA(S
60DG13S356 SEQ ID NO: 344) EQ ID NO: 345) 212
34.7387 TGTCATAGGCTTGCGGTATTT(SE TTGGTAGGGTCCTTTCCTTT(SE
56DG13S357 Q ID NO: 346) Q ID NO: 347) 202
34.7705 GCCTGCTCACTGTTGTTTGA(SEQ CGGTTATCAGAGACTGGTGGT( 71 DG13S1032 ID NO: 348) SEQ ID NO: 349 ) 211
34.7996 GGCTTATTTCATGTACGGCTA(SE GGTTAAACTCTACTTAGTCCTG
79DG13S1557 Q ID NO: 350 ) ATGC(SEQ ID NO: 351 ) 158
34.8829 GAACTCTGCAGGCACCTCTT(SE CCTGAAGCGCTTGTACTGAA(S
3 DG13S1925 Q ID NO: 352 ) EQ ID NO: 353 ) 456 34.9326 TGTTGCGTACTCAGCCCATA GACAGGTGTCAAACGGGTCT(S
90DG13S1484 (SEQ ID NO:354) EQ ID NO: 355 ) 246
34.9425 TTGGCTTCTCGCTCTTTCTT(SEQ AGCCATCAGTCACATGCAAA
47DG13S360 ID NO: 356) (SEQ ID NO: 357 ) 350
34.9989 AGATCTCCAGGGCAGAGGAC(SE CCTTCCTCCCTCCTTCTCTC(SE
79DG13S1522 Q ID NO: 358) Q ID NO: 359 ) 355
35.0749 CGTCATTGATCCCAATCATCT(SE GGCTGATAGCCTCCCTTGTA
62DG13S1517 Q ID NO: 360 ) (SEQ ID NO:361) 235
35.0749 GAGAGAGAGCAGCTTGCATGT(S GGCTGATAGCCTCCCTTGTA(S
62DG13S1521 EQ ID NO:362) EQ ID NO:363) 172
35.1268 ACCTTTCAAGCTTCCGGTTT(SEQ TTCCATCCGTCCATCTATCC(SE
82DG13S364 ID NO: 364) Q ID NO: 365) 172
35.3286 TTAAAGTCACTTGTCTGTGGTCA( ΠΎGTAGGAATCAAGTCAAATA
63DG13S1036 SEQ ID NO: 366 ) ATGTA(SEQ ID NO: 367) 216
35.3353 CAAACATCACACTGGGCAAA(SE V GCTTTGGAATCTTTCTTGCT(S
64DG13S367 Q ID NO: 368) EEQ ID NO: 369) 301
35.3719 CTGCCAGGATGTCAGCATT(SEQ TCCACACTTTCTCATCACCTAA
57DG13S1901 ID NO: 370) A(SEQ ID NO: 371) 440
35.4202 CTTTCGGAAGCTTGAGCCTA(SE CCCAAGACCACTGCCATATT(S
95DG13S1037 Q ID NO: 372) EQ ID NO: 373) 269
35.4258 TGACAGGTm GGGTATATTGGA(STGCTTAATGTAGTGGCAGCA(S 41 DG13S1854 EQ ID NO: 374) EQ ID NO: 375) 124
35.5060 TCCTGCCTTTGTGAATTCCT(SEQ GTTGAATGAGGTGGGCATTA(S
53DG13S1038 ID NO: 376) EQ ID NO: 377) 334
35.5472 CCATTTAATCCTCCAGCCATT(SE GCTCCACCTTGTTACCCTGA(S
10DG13S1039 Q ID NO: 378) EQ ID NO: 379) 167
35.6092 ACAACCCTGGAATCTGGACT(SE GAAGGAAAGGAAAGGAAAGAA
52DG13S1840 Q ID NO: 380} A(SEQ ID NO: 381) 217
35.6192 TGACAAGACTGAAACTTCATCAG( GATGCTTGCTTTGGGAGGTA(S
86DG13S369 SEQ ID NO: 382) EQ ID NO: 383) 257
35.6279 TTGAGGACCTGTCGTTACG (SEQ TTATAGAGCAGTTAAGGCACA 11 D13S305 ID NO: 384) (SEQ ID NO: 385) 394
35.6566 TGAGGGTGGTAAGCCCTTATT(SEGGAGTTGTGGCCTCTCTCTCT(
59DG13S375 Q ID NO: 386) SEQ ID NO: 387) 192
35.7603 AAGCAAATATGCAAAATTGC(SEQ TCCTTCTGTTTCTTGACTTAAC
68D13S219 ID NO: 388) A (SEQ ID NO: 389) 125
35.8258 TGCTAAGAGGGCAGATCTCA(SE GGCTCATAGCCAATTTCTCC
52DG13S378 Q ID NO: 390) (SEQ ID NO: 391) 324
35.8321 CGGCATTCTCAATAACCTCAA TCTTTGATGAGGATCAATTAGT
2 DG13S32 (SEQ ID NO: 392) GG (SEQ ID NO: 393) 214
35.8729 ACGCACACACACACACACAC TGCCTCTGTAATCCTGTGTAGC
36DG13S1549 (SEQ ID NO: 394) (SEQ ID NO:395) 260
35.9123 GCTCTAAGGTGGGTCCCAATA GGGAATGACAAGATCAGTTTAC 21 DG13S1473 (SEQ ID NO:396) C (SEQ ID NO: 397) 163
All references cited herein are incorporated by reference in their entirety. While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope ofthe invention encompassed by the appended claims.
Contents338
42 members in 8 offices
Priority claims14
| Document | Office | Kind | Date |
|---|---|---|---|
| 419433P | United States of America | – | |
| 41943302 | United States of America | P | |
| 41943302 | United States of America | P | |
| 449331P | United States of America | – | |
| 44933103 | United States of America | P | |
| 44933103 | United States of America | P | |
| 0332556 | United States of America | W | |
| 0332556 | United States of America | W | |
| 419433P | – | – | – |
| 449331P | – | – | – |
| US20020419433P | – | – | – |
| US2003032556 | – | – | – |
| US20030449331P | – | – | – |
| WO2003US32556 | – | – | – |
Members42
| Document | Office | Kind | |
|---|---|---|---|
| CA2502357A1 | Canada | A1 | |
| CA2502359A1 | Canada | A1 | |
| WO2004035741A2 | World Intellectual Property Organization (WIPO) | A2 | |
| WO2004035746A2 | World Intellectual Property Organization (WIPO) | A2 | |
| AU2003290527A1 | Australia | A1 | |
| AU2003301305A1 | Australia | A1 | |
| WO2004035741A3 | World Intellectual Property Organization (WIPO) | A3 | |
| CA2539276A1 | Canada | A1 | |
| WO2005027886A2 | World Intellectual Property Organization (WIPO) | A2 | |
| WO2004035746A3 | World Intellectual Property Organization (WIPO) | A3 | |
| US2005112611A1 | United States of America | A1 | |
| US2005113408A1 | United States of America | A1 | |
| WO2005027886A3 | World Intellectual Property Organization (WIPO) | A3 | |
| EP1562973A2 | European Patent Office (EPO) | A2 | |
| AU2005210657A1 | Australia | A1 | |
| CA2553928A1 | Canada | A1 | |
| WO2005075022A2 | World Intellectual Property Organization (WIPO) | A2 | |
| EP1579010A2This record | European Patent Office (EPO) | A2 | |
| US2005272051A1 | United States of America | A1 | |
| US2005282855A1 | United States of America | A1 | |
| US2006019269A1 | United States of America | A1 | |
| JP2006508180A | Japan | A | |
| WO2005075022A3 | World Intellectual Property Organization (WIPO) | A3 | |
| EP1670445A2 | European Patent Office (EPO) | A2 | |
| CA2602265A1 | Canada | A1 | |
| WO2006105439A2 | World Intellectual Property Organization (WIPO) | A2 | |
| EP1718284A2 | European Patent Office (EPO) | A2 | |
| EP1562973A4 | European Patent Office (EPO) | A4 | |
| MXPA06008516A | Mexico | A | |
| WO2006105439A3 | World Intellectual Property Organization (WIPO) | A3 | |
| US2007280917A1 | United States of America | A1 | |
| JP2007538003A | Japan | A | |
| EP1871908A2 | European Patent Office (EPO) | A2 | |
| US2008293750A1 | United States of America | A1 | |
| US7507531B2 | United States of America | B2 | |
| EP1579010A4 | European Patent Office (EPO) | A4 | |
| US2010216863A1 | United States of America | A1 | |
| US7851486B2 | United States of America | B2 | |
| EP1871908B1 | European Patent Office (EPO) | B1 | |
| AT539168T | Austria | T | |
| ATE539168T1 | Austria | T1 | |
| US8158362B2 | United States of America | B2 |
15 legal events, as the office reported them to INPADOC
Over the term
Point at a mark for the eventEvents
| Event | Code | |
|---|---|---|
| Application deemed to be withdrawnWithdrawn18D | 18D | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWNSTAA | STAA | |
| Supplementary search report drawn up and despatchedA4 | A4 | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | |
| Request for extension of the european patent (deleted)DAX | DAX | |
| Request for examination filed17P | 17P | |
| Designated contracting statesAK | AK | |
| Request for extension of the european patentAX | AX | |
| Public reference made under article 153(3) epc to a published international application that has entered the european phaseORIGINAL CODE: 0009012PUAI | PUAI |
Numbers
- Publication
- 1579010
- Publication, DOCDB
- 1579010
- Publication, EPODOC
- EP1579010
- Application
- 3809013
- Application, DOCDB
- 03809013
- Application, EPODOC
- EP20030809013
Titles3
- German
- MYOKARDINFARKT-SUSZEPTIBILITÄTSGEN;BEHANDLUNGSVERFAHREN
- English
- SUSCEPTIBILITY GENE FOR MYOCARDIAL INFARCTION; METHODS OF TREATMENT
- French
- GENE DE SUSCEPTIBILITE POUR L'INFARCTUS DU MYOCARDE, ET PROCEDES DE TRAITEMENT
Classification
- CPC, 11
- A61K31/47
- A61K38/00
- C07K14/4705
- C12Q1/6883
- C12Q2600/156
- G01N2800/324
- A61P3/06
- A61P43/00
- A61P9/00
- A61P9/02
- A61P9/10
- IPC, 9
- C12Q1 68
- A61K31 47
- A61K38 00
- A61K38 17
- A61P9 10
- C07H21 04
- C07K14 435
- C07K14 47
- G01N33 53
Designated states2
- Contracting states, 1
- Türkiye
- Extension states, 1
- North Macedonia