EP1578933B1

Compositions and methods for si-rna inhibition of angiogenesis

Abstract

This record has no abstract on file.

EP1578933B1, drawing sheet 1 — Sheet 1 of 18

Term

Term ended

Expired 18 July 2023, 3.2 years ago.

82 claims: 7 independent, 75 dependent

1
An isolated short interfering ribonucleic acid (siRNA) comprising a sense RNA strand from about 19 to about 25 nucleotides in length and an antisense RNA strand from about 19 to about 25 nucleotides in length, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence identical to a target sequence in human vascular endothelial growth factor (VEGF) mRNA wherein said target sequence is selected from SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52 and SEQ ID No. 56.
17
A recombinant plasmid comprising nucleic acid sequences for expressing a short interfering ribonucleic acid (siRNA) comprising a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence identical to a target sequence in human vascular endothelial growth factor (VEGF) mRNA wherein said target sequence is selected from SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52 and SEQ ID No. 56.
22
A recombinant viral vector comprising nucleic acid sequences for expressing a short interfering ribonucleic acid (siRNA) comprising a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence identical to a target sequence in human vascular endothelial growth factor (VEGF) mRNA wherein said target sequence is selected from SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52 and SEQ ID No. 56.
29
A pharmaceutical composition comprising an effective amount of a short interfering ribonucleic acid (siRNA) and a pharmaceutically acceptable carrier, wherein the siRNA comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence identical to a target sequence in human vascular endothelial growth factor (VEGF) mRNA wherein said target sequence is selected from SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52 and SEQ ID No. 56.
35
An effective amount of short interfering ribonucleic acid (siRNA) comprising a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence identical to a target sequence in human vascular endothelial growth factor (VEGF) mRNA for use in inhibiting expression of human vascular endothelial growth factor (VEGF) mRNA in a subject wherein said target sequence is selected from SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52 and SEQ ID No. 56.
63
An effective amount of short interfering ribonucleic acid (siRNA) comprising a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence identical to a target sequence in human vascular endothelial growth factor (VEGF) mRNA wherein said target sequence is selected from SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52 and SEQ ID No. 56 for use in preventing angiogenesis.
71
An effective amount of short interfering ribonucleic acid (siRNA) comprising a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence identical to a target sequence in human vascular endothelial growth factor (VEGF) mRNA wherein said target sequence is selected from SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52 and SEQ ID No. 56 for use in treating angiogenic disease such that angiogenesis associated with angiogenic disease is inhibited.

Independent claims7

165 paragraphs in 1 section, as filed

Cross Reference to Related Application

0001This application claims the benefit of <patcit id="pcit0001" dnum="US39841702P" dnum-type="L"><text>U.S. provisional patent application serial no. 60/398,417, filed on July 24, 2002</text></patcit>, and <patcit id="pcit0002" dnum="US29422802A" dnum-type="L"><text>U.S. nonprovisional patent application serial no. 10/294,228, filed November 14, 2002</text></patcit>.

Reference to Government Grant

0002The invention described herein was supported in part by NIH/NEI grant no. R01-EY10820, EY-13410 and EY12156. The U.S. government has certain rights in this invention.

Field of the Invention

0003This invention relates to the regulation of gene expression by small interfering RNA, in particular for treating diseases or conditions involving angiogenesis.

Background of the Invention

0004Angiogenesis, defined as the growth of new capillary blood vessels or "neovascularization," plays a fundamental role in growth and development. In mature humans, the ability to initiate angiogenesis is present in all tissues, but is held under strict control. A key regulator of angiogenesis is vascular endothelial growth factor ("VEGF"), also called vascular permeability factor ("VPF"). VEGF exists in at least four different alternative splice forms in humans VEGF121, VEGF165, VEGF189 and VEGF206), all of which exert similar biological activities.

0005Angiogenesis is initiated when secreted VEGF binds to the Flt-1 and Flk-1/KDR receptors (also called VEGF receptor 1 and VEGF receptor 2), which are expressed on the surface of endothelial cells. Flt-1 and Flk-1/KDR are transmembrane protein tyrosine kinases, and binding of VEGF initiates a cell signal cascade resulting in the ultimate neovascularization in the surrounding tissue.

0006Aberrant angiogenesis, or the pathogenic growth of new blood vessels, is implicated in a number of conditions. Among these conditions are diabetic retinopathy, psoriasis, exudative or "wet" age-related macular degeneration ("ARMD"), rheumatoid arthritis and other inflammatory diseases, and most cancers. The diseased tissues or tumors associated with these conditions express abnormally high levels of VEGF, and show a high degree of vascularization or vascular permeability.

0007ARMD in particular is a clinically important angiogenic disease. This condition is characterized by choroidal neovascularization in one or both eyes in aging individuals, and is the major cause of blindness in industrialized countries.

0008A number of therapeutic strategies exist for inhibiting aberrant angiogenesis, which attempt to reduce the production or effect of VEGF. For example, anti-VEGF or anti-VEGF receptor antibodies (<nplcit id="ncit0001" npl-type="s"><text>Kim ES et al. (2002), PNAS USA 99: 11399-11404</text></nplcit>), and soluble VEGF "traps" which compete with endothelial cell receptors for VEGF binding (<nplcit id="ncit0002" npl-type="s"><text>Holash J et al. (2002), PNAS USA 99: 11393-11398</text></nplcit>) have been developed. Classical VEGF "antisense" or aptamer therapies directed against VEGF gene expression have also been proposed (<patcit id="pcit0003" dnum="US20010021772A" dnum-type="L"><text>U.S. published application 2001/0021772 of Uhlmann et al.</text></patcit>). However, the anti-angiogenic agents used in these therapies can produce only a stoichiometric reduction in VEGF or VEGF receptor, and the agents are typically overwhelmed by the abnormally high production of VEGF by the diseased tissue. The results achieved with available anti-angiogenic therapies have therefore been unsatisfactory.

0009RNA interference (hereinafter "RNAi") is a method of post-transcriptional gene regulation that is conserved throughout many eukaryotic organisms. RNAi is induced by short (i.e., <30 nucleotide) double stranded RNA ("dsRNA") molecules which are present in the cell (<nplcit id="ncit0003" npl-type="s"><text>Fire A et al. (1998), Nature 391: 806-811</text></nplcit>). These short dsRNA molecules, called "short interfering RNA" or "siRNA," cause the destruction of messenger RNAs ("mRNAs") which share sequence homology with the siRNA to within one nucleotide resolution (<nplcit id="ncit0004" npl-type="s"><text>Elbashir SM et al. (2001), Genes Dev, 15: 188-200</text></nplcit>). It is believed that the siRNA and the targeted mRNA bind to an "RNA-induced silencing complex" or "RISC", which cleaves the targeted mRNA. The siRNA is apparently recycled much like a multiple-turnover enzyme, with 1 siRNA molecule capable of inducing cleavage of approximately 1000 mRNA molecules. siRNA-mediated RNAi degradation of an mRNA is therefore more effective than currently available technologies for inhibiting expression of a target gene.

0010Elbashir SM et al. (2001), supra, has shown that synthetic siRNA of 21 and 22 nucleotides in length, and which have short 3' overhangs, are able to induce RNAi of target mRNA in a Drosophila cell lysate. Cultured mammalian cells also exhibit RNAi degradation with synthetic siRNA (<nplcit id="ncit0005" npl-type="s"><text>Elbashir SM et al. (2001) Nature, 411: 494-498</text></nplcit>), and RNAi degradation induced by synthetic siRNA has recently been shown in living mice (<nplcit id="ncit0006" npl-type="s"><text>McCaffrey AP et al. (2002), Nature, 418: 38-39</text></nplcit>; <nplcit id="ncit0007" npl-type="s"><text>Xia H et al. (2002), Nat. Biotech. 20: 1006-1010</text></nplcit>). The therapeutic potential of siRNA-induced RNAi degradation has been demonstrated in several recent in vitro studies, including the siRNA-directed inhibition of HIV-1 infection (<nplcit id="ncit0008" npl-type="s"><text>Novina CD et al. (2002), Nat. Med. 8: 681-686</text></nplcit>) and reduction of neurotoxic polyglutamine disease protein expression (Xia H et al. (2002), supra).

0011What is needed, therefore, are agents which selectively inhibit expression of VEGF or VEGF receptors in catalytic or sub-stoichiometric amounts.

Summary of the Invention

0012The present invention is directed to siRNAs having the sequence shown in SEQ ID NO 97, 98, 50, 51, 52, 56 which specifically target and cause RNAi-induced degradation of mRNA from VEGF, Flt-1 and Flk-1/KDR genes. The siRNA compounds and compositions of the invention are used to inhibit angiogenesis, in particular for the treatment of cancerous tumors, age-related macular degeneration, and other angiogenic diseases.

0013Thus, the invention provides an isolated siRNA which targets human VEGF mRNA, human Flt-1 mRNA, human Flk-1/KDR mRNA, or an alternative splice form, mutant or cognate thereof. The siRNA comprises a sense RNA strand and an antisense RNA strand which form an RNA duplex. The sense RNA strand comprises a nucleotide sequence identical to a target sequence of about 19 to about 25 contiguous nucleotides in the target mRNA.

0014The invention also provides recombinant plasmids and viral vectors which express the siRNA of the invention, as well as pharmaceutical compositions comprising the siRNA of the invention and a pharmaceutically acceptable carrier.

0015The invention further provides a method of inhibiting expression of human VEGF mRNA, human Flt-1 mRNA, human Flk-1/KDR mRNA, or an alternative splice form, mutant or cognate thereof, comprising administering to a subject an effective amount of the siRNA of the invention such that the target mRNA is degraded.

0016The invention further provides a method of inhibiting angiogenesis in a subject, comprising administering to a subject an effective amount of an siRNA targeted to human VEGF mRNA, human Flt-1 mRNA, human Flk-1/KDR mRNA, or an alternative splice form, mutant or cognate thereof.

0017The invention further provides a method of treating an angiogenic disease, comprising administering to a subject in need of such treatment an effective amount of an siRNA targeted to human VEGF mRNA, human Flt-1 mRNA, human Flk-1/KDR mRNA, or an alternative splice form, mutant or cognate thereof, such that angiogenesis associated with the angiogenic disease is inhibited.

Brief Description of the Drawings

0018<ul id="ul0001" list-style="none" compact="compact"><li><figref idref="f0001">FIGS. 1A and 1B</figref> are a histograms of VEGF concentration (in pg/ml) in hypoxic 293 and HeLa cells treated with no siRNA ("-"); nonspecific siRNA ("nonspecific"); or siRNA targeting human VEGF mRNA ("VEGF"). VEGF concentration (in pg/ml) in non-hypoxic 293 and HeLa cells is also shown. Each bar represents the average of four experiments, and the error is the standard deviation of the mean.</li><li><figref idref="f0002">FIG. 2</figref> is a histogram of murine VEGF concentration (in pg/ml) in hypoxic NIH 3T3 cells treated with no siRNA ("-"); nonspecific siRNA ("nonspecific"); or siRNA targeting human VEGF mRNA ("VEGF"). Each bar represents the average of six experiments and the error is the standard deviation of the mean.</li><li><figref idref="f0003">FIG. 3</figref> is a histogram of human VEGF concentration (pg/total protein) in retinas from mice injected with adenovirus expressing human VEGF ("AdVEGF") in the presence of either GFP siRNA (dark gray bar) or human VEGF siRNA (light grey bar). Each bar represent the average of 5 eyes and the error bars represent the standard error of the mean.</li><li><figref idref="f0004">FIG. 4</figref> is a histogram showing the mean area (in mm2) of laser-induced CNV in control eyes given subretinal injections of GFP siRNA (N=9; "GFP siRNA"), and in eyes given subretinal injections of mouse VEGF siRNA (N=7; "Mouse VEGF siRNA"). The error bars represent the standard error of the mean.</li><li><figref idref="f0005">FIG. 5</figref> is a schematic representation of pAAVsiRNA, a cis-acting plasmid used to generate a recombinant AAV viral vector of the invention. "ITR": AAV inverted terminal repeats; "U6": U6 RNA promoters; "Sense": siRNA sense coding sequence; "Anti": siRNA antisense coding sequence; "PolyT": polythymidine termination signals.</li><li><figref idref="f0006 f0007">Fig. 6</figref> shows histograms of the mean area (in mm2) of laser-induced CNV in treatment in mouse eyes injected (A) subretinally or (B) intravitreally with a mouse anti-VEGF siRNA ("mVEGFI.siRNA") or control siRNA ("GFP1.siRNA"). The error bars represent the standard error of the mean. (C) is a histogram of the mean area (in mm2) of laser-induced CNV in mouse eyes injected intravitreally with: phosphate-buffered saline with no siRNA at 1 day post-laser induction ("PBS"; CNV area measured at 14 days post-laser induction); control siRNA at 14 days post-laser induction ("GFP1.siRNA"; CNV area measured at 21 days post-laser induction); or a mouse anti-VEGF siRNA at 14 days post-laser induction ("mVEGF1.siRNA"; CNV area measured at 21 days post-laser induction). The error bars represent the standard error of the mean.</li><li><figref idref="f0008">Fig. 7</figref> is a graph of the percent of VEGF ("%VEGF") protein in mouse eyes injected sub-retinally with human anti-VEGF siRNA ("Cand5") and control siRNA ("GFP1.siRNA") at 0 (n=2; pre-siRNA injection), 6 (n=3), 10 (n=3) and 14 (n=3) days post-injection. %VEGF = ([VEGF] in the Cand5 eye/[VEGF] in the GFP1.siRNA eye) *100.</li></ul>

Detailed Description of the Invention

0019Unless otherwise indicated, all nucleic acid sequences herein are given in the 5' to 3' direction The invention specifically relates to SEQ ID NO. 97, 98, 50, 51 52, 56. All references to other SEQ ID Nos are illustrative and do not define the invention. Also, all deoxyribonucleotides in a nucleic acid sequence are represented by capital letters (e.g., deoxythymidine is "T"), and ribonucleotides in a nucleic acid sequence are represented by lower case letters (e.g., uridine is "u").

0020Compositions and methods comprising siRNA targeted to VEGF, Flt-1 or Flk-1/KDR mRNA are advantageously used to inhibit angiogenesis, in particular for the treatment of angiogenic disease. The siRNA of the invention are believed to cause the RNAi-mediated degradation of these mRNAs, so that the protein product of the VEGF, Flt-1 or Fllc-1/KDR genes is not produced or is produced in reduced amounts. Because VEGF binding to the Flt-1 or Flk-1/hDR receptors is required for initiating and maintaining angiogenesis, the siRNA-mediated degradation of VEGF, Flt-1 or Flk-1/KDR mRNA inhibits the angiogenic process.

0021The invention therefore provides isolated siRNA comprising short doublestranded RNA from about 17 nucleotides to about 29 nucleotides in length, preferably from about 19 to about 25 nucleotides in length, that are targeted to the target mRNA. The siRNA comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (hereinafter "base-paired"). As is described in more detail below, the sense strand comprises a nucleic acid sequence which is identical to a target sequence contained within the target mRNA.

0022The sense and antisense strands of the present siRNA can comprise two complementary, single-stranded RNA molecules or can comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded "hairpin" area. Without wishing to be bound by any theory, it is believed that the hairpin area of the latter type of siRNA molecule is cleaved intracellularly by the "Dicer" protein (or its equivalent) to form an siRNA of two individual base-paired RNA molecules (see Tuschl, T. (2002), supra).

0023As used herein, "isolated" means altered or removed from the natural state through human intervention. For example, an siRNA naturally present in a living animal is not "isolated," but a synthetic siRNA, or an siRNA partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated siRNA can exist in substantially purified form, or can exist in a non-native environment such as, for example, a cell into which the siRNA has been delivered.

0024As used herein, "target mRNA" means human VEGF, Flt-1 or Flk-1/KDR mRNA, mutant or alternative splice forms of human VEGF, Flt-1 or Flk-1/KDR mRNA, or mRNA from cognate VEGF, Flt-1 or Flk-1/KDR genes.

0025As used herein, a gene or mRNA which is "cognate" to human VEGF, Flt-1 or Flk-1/KDR is a gene or mRNA from another mammalian species which is homologous to human VEGF, Flt-1 or Flk-1/KDR. For example, the cognate VEGF mRNA from the mouse is given in SEQ ID NO: 1.

0026Splice variants of human VEGF are known, including VEGF121 (SEQ ID NO: 2), VEGF165 (SEQ ID NO: 3), VEGF189 (SEQ ID NO: 4) and VEGF206 (SEQ ID NO: 5). The mRNA transcribed from the human VEGF, Flt-1 (SEQ ID NO: 6) or Flk-1/KDR (SEQ ID NO: 7) genes can be analyzed for further alternative splice forms using techniques well-known in the art. Such techniques include reverse transcription-polymerase chain reaction (RT-PCR), northern blotting and in-situ hybridization. Techniques for analyzing mRNA sequences are described, for example, in Busting SA (2000), J. Mol. Endocrinol. 25: 169-193, the entire disclosure of which is herein incorporated by reference. Representative techniques for identifying alternatively spliced mRNAs are also described below.

0027For example, databases that contain nucleotide sequences related to a given disease gene can be used to identify alternatively spliced mRNA. Such databases include GenBank, Embase, and the Cancer Genome Anatomy Project (CGAP) database. The CGAP database, for example, contains expressed sequence tags (ESTs) from various types of human cancers. An mRNA or gene sequence from the VEGF, Flt-1 or Flk-1/KDR genes can be used to query such a database to determine whether ESTs representing alternatively spliced mRNAs have been found for a these genes.

0028A technique called "RNAse protection" can also be used to identify alternatively spliced VEGF, Flt-1 or Flk-1/KDR mRNAs. RNAse protection involves translation of a gene sequence into synthetic RNA, which is hybridized to RNA derived from other cells; for example, cells from tissue at or near the site of neovascularization. The hybridized RNA is then incubated with enzymes that recognize RNA:RNA hybrid mismatches. Smaller than expected fragments indicate the presence of alternatively spliced mRNAs. The putative alternatively spliced mRNAs can be cloned and sequenced by methods well known to those skilled in the art.

0029RT-PCR can also be used to identify alternatively spliced VEGF, Flt-1 or Flk-1/KDR mRNAs. In RT-PCR, mRNA from the diseased tissue is converted into cDNA by the enzyme reverse transcriptase, using methods well-known to those of ordinary skill in the art. The entire coding sequence of the cDNA is then amplified via PCR using a forward primer located in the 3' untranslated region, and a reverse primer located in the 5' untranslated region. The amplified products can be analyzed for alternative splice forms, for example by comparing the size of the amplified products with the size of the expected product from normally spliced mRNA, e.g., by agarose gel electrophoresis. Any change in the size of the amplified product can indicate alternative splicing.

0030mRNA produced from mutant VEGF, Flt-1 or Flk-1/KDR genes can also be readily identified through the techniques described above for identifying alternative splice forms. As used herein, "mutant" VEGF, Flt-1 or Flk-1/KDR genes or mRNA include human VEGF, Flt-1 or Flk-1/KDR genes or mRNA which differ in sequence from the VEGF, Flt-1 or Flk-1/KDR sequences set forth herein. Thus, allelic forms of these genes, and the mRNA produced from them, are considered "mutants" for purposes of this invention.

0031It is understood that human VEGF, Flt-1 or Flk-1/KDR mRNA may contain target sequences in common with their respective alternative splice forms, cognates or mutants. A single siRNA comprising such a common targeting sequence can therefore induce RNAi-mediated degradation of different RNA types which contain the common targeting sequence.

0032The siRNA of the invention can comprise partially purified RNA, substantially pure RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, including modifications that make the siRNA resistant to nuclease digestion.

0033One or both strands of the siRNA of the invention can also comprise a 3' overhang. As used herein, a "3' overhang" refers to at least one unpaired nucleotide extending from the 3'-end of a duplexed RNA strand.

0034Thus in one embodiment, the siRNA of the invention comprises at least one 3' overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxynucleotides) in length, preferably from 1 to about 5 nucleotides in length, more preferably from 1 to about 4 nucleotides in length, and particularly preferably from about 2 to about 4 nucleotides in length.

0035In the embodiment in which both strands of the siRNA molecule comprise a 3' overhang, the length of the overhangs can be the same or different for each strand. In a most preferred embodiment, the 3' overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA of the invention can comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic acid ("uu").

0036In order to enhance the stability of the present siRNA, the 3' overhangs can be also stabilized against degradation. In one embodiment, the overhangs are stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine nucleotides in the 3' overhangs with 2'-deoxythymidine, is tolerated and does not affect the efficiency of RNAi degradation. In particular, the absence of a 2' hydroxyl in the 2'-deoxythymidine significantly enhances the nuclease resistance of the 3'overhang in tissue culture medium.

0037In certain embodiments, the siRNA of the invention comprises the sequence AA(N19)TT or NA(N21), where N is any nucleotide. These siRNA comprise approximately 30-70% GC, and preferably comprise approximately 50% G/C. The sequence of the sense siRNA strand corresponds to (N19)TT or N21 (i.e., positions 3 to 23), respectively. In the latter case, the 3' end of the sense siRNA is converted to TT. The rationale for this sequence conversion is to generate a symmetric duplex with respect to the sequence composition of the sense and antisense strand 3' overhangs. The antisense RNA strand is then synthesized as the complement to positions 1 to 21 of the sense strand.

0038Because position 1 of the 23-nt sense strand in these embodiments is not recognized in a sequence-specific manner by the antisense strand, the 3'-most nucleotide residue of the antisense strand can be chosen deliberately. However, the penultimate nucleotide of the antisense strand (complementary to position 2 of the 23-nt sense strand in either embodiment) is generally complementary to the targeted sequence.

0039In another embodiment, the siRNA of the invention comprises the sequence NAR(N17)YNN, where R is a purine (e.g., A or G) and Y is a pyrimidine (e.g., C or U/T). The respective 21-nt sense and antisense RNA strands of this embodiment therefore generally begin with a purine nucleotide. Such siRNA can be expressed from pol III expression vectors without a change in targeting site, as expression of RNAs from pol III promoters is only believed to be efficient when the first transcribed nucleotide is a purine.

0040The siRNA of the invention can be targeted to any stretch of approximately 19-25 contiguous nucleotides in any of the target mRNA sequences (the "target sequence"). Techniques for selecting target sequences for siRNA are given, for example, in <nplcit id="ncit0009" npl-type="s"><text>Tuschl T et al., "The siRNA User Guide," revised Oct. 11, 2002</text></nplcit>, the entire disclosure of which is herein incorporated by reference. "The siRNA User Guide" is available on the world wide web at a website maintained by Dr. Thomas Tuschl, Department of Cellular Biochemistry, AG 105, Max-Planck-Institute for Biophysical Chemistry, 37077 Göttingen, Germany, and can be found by accessing the website of the Max Planck Institute and searching with the keyword "siRNA." Thus, the sense strand of the present siRNA comprises a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA.

0041Generally, a target sequence on the target mRNA can be selected from a given cDNA sequence corresponding to the target mRNA, preferably beginning 50 to 100 nt downstream (i.e., in the 3' direction) from the start codon. The target sequence can, however, be located in the 5' or 3' untranslated regions, or in the region nearby the start codon (see, e.g., the target sequences of SEQ ID NOS: 73 and 74 in Table 1 below, which are within 100 nt of the 5'-end of the VEGF121 cDNA

0042For example, a suitable target sequence in the VEGF121 cDNA sequence is: <ul id="ul0002" list-style="none" compact="compact"><li>TCATCACGAAGTGGTGAAG (SEQ ID NO: 8)</li></ul>

0043Thus, an siRNA of the invention targeting this sequence, and which has 3' uu overhangs on each strand (overhangs shown in bold), is: <ul id="ul0003" list-style="none" compact="compact"><li>5'-ucaucacgaaguggugaaguu-3' (SEQ ID NO: 9)</li><li>3'-uuaguagugcuucaccacuuc-5' (SEQ ID NO: 10)</li></ul>

0044An siRNA of the invention targeting this same sequence, but having 3' TT overhangs on each strand (overhangs shown in bold) is: <ul id="ul0004" list-style="none" compact="compact"><li>5'-ucaucacgaaguggugaagTT-3'(SEQ ID NO: 11)</li><li>3'-TTaguagugcuucaccacuuc-5' (SEQ ID NO: 12)</li></ul>

0045Other VEGF121 target sequences from which siRNA of the invention can be derived are given in Table 1. It is understood that all VEGF121 target sequences listed in Table 1 are within that portion of the VEGF121 alternative splice form which is common to all human VEGF alternative splice forms. Thus, the VEGF121 target sequences in Table 1 can also target VEGF165, VEGF189 and VEGF206 mRNA. Target sequences which target a specific VEGF isoform can also be readily identified. For example, a target sequence which targets VEGF165 mRNA but not VEGF121 mRNA is AACGTACTTGCAGATGTGACA (SEQ ID NO: 13). Exemplary target sequences for human Flt-1 are given in SEQ ID NOS: 91 - 504, and exemplary target sequences for human Flk-1/KDR are given in SEQ ID NOS: 505 - 864. <tables id="tabl0001" num="0001"><table frame="all"><title>Table 1 - VEGF Target Sequences</title><tgroup cols="5"><colspec colnum="1" colname="col1" colwidth="57mm" /><colspec colnum="2" colname="col2" colwidth="21mm" /><colspec colnum="3" colname="col3" colwidth="10mm" /><colspec colnum="4" colname="col4" colwidth="57mm" /><colspec colnum="5" colname="col5" colwidth="22mm" /><thead><row><entry valign="top">target sequence</entry><entry align="center" valign="top">SEQ ID NO:</entry><entry rowsep="0" valign="top" /><entry valign="top">target sequence</entry><entry align="center" valign="top">SEQ ID NO:</entry></row></thead><tbody><row><entry>GTTCATGGATGTCTATCAG</entry><entry align="center">14</entry><entry rowsep="0" /><entry>TCCCTGTGGGCCTTGCTCA</entry><entry align="center">30</entry></row><row><entry>TCGAGACCCTGGTGGACAT</entry><entry align="center">15</entry><entry rowsep="0" /><entry>GCATTTGTTTGTACAAGAT</entry><entry align="center">31</entry></row><row><entry>TGACGAGGGCCTGGAGTGT</entry><entry align="center">16</entry><entry rowsep="0" /><entry>GATCCGCAGACGTGTAAAT</entry><entry align="center">32</entry></row><row><entry>TGACGAGGGCCTGGAGTGT</entry><entry align="center">17</entry><entry rowsep="0" /><entry>ATGTTCCTGCA.AAAACACA</entry><entry align="center">33</entry></row><row><entry>CATCACCATGCAGATTATG</entry><entry align="center">18</entry><entry rowsep="0" /><entry>TGTTCCTGCAAAAACACAG</entry><entry align="center">34</entry></row><row><entry>ACCTCACCAAGGCCAGCAC</entry><entry align="center">19</entry><entry rowsep="0" /><entry>AAACACAGACTCGCGTTGC</entry><entry align="center">35</entry></row><row><entry>GGCCAGCACATAGGAGAGA</entry><entry align="center">20</entry><entry rowsep="0" /><entry>AACACAGACTCGCGTTGCA</entry><entry align="center">36</entry></row><row><entry>CAAATGTGAATGCAGACCA</entry><entry align="center">21</entry><entry rowsep="0" /><entry>ACACAGACTCGCGTTGCAA</entry><entry align="center">37</entry></row><row><entry>ATGTGAATGCAGACCAAAG</entry><entry align="center">22</entry><entry rowsep="0" /><entry>CACAGACTCGCGTTGCAAG</entry><entry align="center">38</entry></row><row><entry>TGCAGACCAAAGAAAGATA</entry><entry align="center">23</entry><entry rowsep="0" /><entry>GGCGAGGCAGCTTGAGTTA</entry><entry align="center">39</entry></row><row><entry>AGAAAGATAGAGCAAGACA</entry><entry align="center">24</entry><entry rowsep="0" /><entry>ACGAACGTACTTGCAGATG</entry><entry align="center">40</entry></row><row><entry>GAAAGATAGAGCAAGACAA</entry><entry align="center">25</entry><entry rowsep="0" /><entry>CGAACGTACTTGCAGATGT</entry><entry align="center">41</entry></row><row><entry>GATAGAGCAAGACAAGAAA</entry><entry align="center">26</entry><entry rowsep="0" /><entry>CGTACTTGCAGATGTGACA</entry><entry align="center">42</entry></row><row><entry>GACAAGAAAATCCCTGTGG</entry><entry align="center">27</entry><entry rowsep="0" /><entry>GTGGTCCCAGGCTGCACCC</entry><entry align="center">43</entry></row><row><entry>GAAAATCCCTGTGGGCCTT</entry><entry align="center">28</entry><entry rowsep="0" /><entry>GGAGGAGGGCAGAATCATC</entry><entry align="center">44</entry></row><row><entry>AATCCCTGTGGGCCTTGCT</entry><entry align="center">29</entry><entry /><entry>GTGGTGAAGTTCATGGATG</entry><entry align="center">45</entry></row><row><entry>AATCATCACGAAGTGGTGAAG</entry><entry align="center">46</entry><entry rowsep="0" /><entry>AAGCATTTGTTTGTACAAGATCC</entry><entry align="center">62</entry></row><row><entry>AAGTTCATGGATGTCTATCAG</entry><entry align="center">47</entry><entry rowsep="0" /><entry>AAGATCCGCAGACGTGTAAATGT</entry><entry align="center">63</entry></row><row><entry>AATCGAGACCCTGGTGGACAT</entry><entry align="center">48</entry><entry rowsep="0" /><entry>AAATGTTCCTGCAAAAACACAGA</entry><entry align="center">64</entry></row><row><entry>AATGACGAGGGCCTGGAGTGT</entry><entry align="center">49</entry><entry rowsep="0" /><entry>AATGTTCCTGCAAAAACACAGAC</entry><entry align="center">65</entry></row><row><entry>AACATCACCATGCAGATTATG</entry><entry align="center">50</entry><entry rowsep="0" /><entry>AAAAACACAGACTCGCGTTGCAA</entry><entry align="center">66</entry></row><row><entry>AAACCTCACCAAGGCCAGCAC</entry><entry align="center">51</entry><entry rowsep="0" /><entry>AAAACACAGACTCGCGTTGCAAG</entry><entry align="center">67</entry></row><row><entry>AAGGCCAGCACATAGGAGAGA</entry><entry align="center">52</entry><entry rowsep="0" /><entry>AAACACAGACTCGCGTTGCAAGG</entry><entry align="center">68</entry></row><row><entry>AACAAATGTGAATGCAGACCA</entry><entry align="center">53</entry><entry rowsep="0" /><entry>AACACAGACTCGCGTTGCAAGGC</entry><entry align="center">69</entry></row><row><entry>AAATGTGAATGCAGACCAAAG</entry><entry align="center">54</entry><entry rowsep="0" /><entry>AAGGCGAGGCAGCTTGAGTTAAA</entry><entry align="center">70</entry></row><row><entry>AATGCAGACCAAAGAAAGATA</entry><entry align="center">55</entry><entry rowsep="0" /><entry>AAACGAACGTACTTGCAGATGTG</entry><entry align="center">71</entry></row><row><entry>AAAGAAAGATAGAGCAAGACA</entry><entry align="center">56</entry><entry rowsep="0" /><entry>AACGAACGTACTTGCAGATGTGA</entry><entry align="center">72</entry></row><row><entry>AAGAAAGATAGAGCAAGACAA</entry><entry align="center">57</entry><entry rowsep="0" /><entry>AAGTGGTCCCAGGCTGCACCCAT</entry><entry align="center">73</entry></row><row><entry>AAGATAGAGCAAGACAAGAAAAT</entry><entry align="center">58</entry><entry rowsep="0" /><entry>AAGGAGGAGGGCAGAATCATCAC</entry><entry align="center">74</entry></row><row><entry>AAGACAAGAAAATCCCTGTGGGC</entry><entry align="center">59</entry><entry rowsep="0" /><entry>AAGTGGTGAAGTTCATGGATGTC</entry><entry align="center">75</entry></row><row><entry>AAGAAAATCCCTGTGGGCCTTGC</entry><entry align="center">60</entry><entry rowsep="0" /><entry>AAAATCCCTGTGGGCCTTGCTCA</entry><entry align="center">76</entry></row><row><entry>AATCCCTGTGGGCCTTGCTCAGA</entry><entry align="center">61</entry><entry /><entry>GGCAGAATCATCACGAAGTGG</entry><entry align="center">81</entry></row><row><entry>CCTGGTGGACATCTTCCAGGA</entry><entry align="center">82</entry><entry rowsep="0" /><entry>CACACACTCGCGTTGCAAGGC</entry><entry align="center">87</entry></row><row><entry>GAGATCGAGTACATCTTCAAG</entry><entry align="center">83</entry><entry rowsep="0" /><entry>TCACCATGCAGATTATGCGGA</entry><entry align="center">88</entry></row><row><entry>TGGAGTGTGTGCCCACTGAGG</entry><entry align="center">84</entry><entry rowsep="0" /><entry>TAGAGCAAGACAAGAA.AATCC</entry><entry align="center">89</entry></row><row><entry>GAGCTTCCTACAGCACAACAA</entry><entry align="center">85</entry><entry /><entry>CCGCAGACGTGTAAATGTTCC</entry><entry align="center">90</entry></row><row><entry>TTGCTCAGAGCGGAGAAAGCA</entry><entry align="center">86</entry><entry namest="col3" nameend="col5" align="left" /></row></tbody></tgroup></table></tables>

0046The siRNA of the invention can be obtained using a number of techniques known to those of skill in the art. For example, the siRNA can be chemically synthesized or recombinantly produced using methods known in the art, such as the Drosophila in vitro system described in <patcit id="pcit0004" dnum="US20020086356A" dnum-type="L"><text>U.S. published application 2002/0086356 of Tuschl et al.</text></patcit>, the entire disclosure of which is herein incorporated by reference.

0047Preferably, the siRNA of the invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. The siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions. Commercial suppliers of synthetic RNA molecules or synthesis reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA) and Cruachem (Glasgow, UK).

0048Alternatively, siRNA can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing siRNA of the invention from a plasmid include, for example, the U6 or H1 RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment.

0049The siRNA expressed from recombinant plasmids can either be isolated from cultured cell expression systems by standard techniques, or can be expressed intracellularly at or near the area of neovascularization in vivo. The use of recombinant plasmids to deliver siRNA of the invention to cells in vivo is discussed in more detail below.

0050siRNA of the invention can be expressed from a recombinant plasmid either as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.

0051Selection of plasmids suitable for expressing siRNA of the invention, methods for inserting nucleic acid sequences for expressing the siRNA into the plasmid, and methods of delivering the recombinant plasmid to the cells of interest are within the skill in the art. See, for example <nplcit id="ncit0010" npl-type="s"><text>Tuschl, T. (2002), Nat. Biotechnol, 20: 446-448</text></nplcit>; <nplcit id="ncit0011" npl-type="s"><text>Brummelkamp TR et al. (2002), Science 296: 550-553</text></nplcit>; <nplcit id="ncit0012" npl-type="s"><text>Miyagishi M et al. (2002), Nat. Biotechnol. 20: 497-500</text></nplcit>; <nplcit id="ncit0013" npl-type="s"><text>Paddison PJ et al. (2002), Genes Dev. 16: 948-958</text></nplcit>; <nplcit id="ncit0014" npl-type="s"><text>Lee NS et al. (2002), Nat. Biotechnol. 20: 500-505</text></nplcit>; and <nplcit id="ncit0015" npl-type="s"><text>Paul CP et al. (2002), Nat. Biotechnol. 20: 505-508</text></nplcit>, the entire disclosures of which are herein incorporated by reference.

0052A plasmid comprising nucleic acid sequences for expressing an siRNA of the invention is described in Example 7 below. That plasmid, called pAAVsiRNA, comprises a sense RNA strand coding sequence in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter, and an antisense RNA strand coding sequence in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter. The plasmid pAAVsiRNA is ultimately intended for use in producing an recombinant adeno-associated viral vector comprising the same nucleic acid sequences for expressing an siRNA of the invention.

0053As used herein, "in operable connection with a polyT termination sequence" means that the nucleic acid sequences encoding the sense or antisense strands are immediately adjacent to the polyT termination signal in the 5' direction. During transcription of the sense or antisense sequences from the plasmid, the polyT termination signals act to terminate transcription.

0054As used herein, "under the control" of a promoter means that the nucleic acid sequences encoding the sense or antisense strands are located 3' of the promoter, so that the promoter can initiate transcription of the sense or antisense coding sequences.

0055The siRNA of the invention can also be expressed from recombinant viral vectors intracellularly at or near the area of neovascularization in vivo. The recombinant viral vectors of the invention comprise sequences encoding the siRNA of the invention and any suitable promoter for expressing the siRNA sequences. Suitable promoters include, for example, the U6 or H1 RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment. The use of recombinant viral vectors to deliver siRNA of the invention to cells in vivo is discussed in more detail below.

0056siRNA of the invention can be expressed from a recombinant viral vector either as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.

0057Any viral vector capable of accepting the coding sequences for the siRNA molecule(s) to be expressed can be used, for example vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g, lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism of the viral vectors can also be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses. For example, an AAV vector of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like.

0058Selection of recombinant viral vectors suitable for use in the invention, methods for inserting nucleic acid sequences for expressing the siRNA into the vector, and methods of delivering the viral vector to the cells of interest are within the skill in the art. See, for example, <nplcit id="ncit0016" npl-type="s"><text>Domburg R (1995), Gene Therap. 2: 301-310</text></nplcit>; <nplcit id="ncit0017" npl-type="s"><text>Eglitis MA (1988), Biotechniques 6: 608-614</text></nplcit>; <nplcit id="ncit0018" npl-type="s"><text>Miller AD (1990), Hum Gene Therap. 1: 5-14</text></nplcit>; and <nplcit id="ncit0019" npl-type="s"><text>Anderson WF (1998), Nature 392: 25-30</text></nplcit>, the entire disclosures of which are herein incorporated by reference.

0059Preferred viral vectors are those derived from AV and AAV. In a particularly preferred embodiment, the siRNA of the invention is expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector comprising, for example, either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV) promoter.

0060A suitable AV vector for expressing the siRNA of the invention, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in <nplcit id="ncit0020" npl-type="s"><text>Xia H et al. (2002), Nat. Biotech. 20: 1006-1010</text></nplcit>.

0061Suitable AAV vectors for expressing the siRNA of the invention, methods for constructing the recombinant AAV vector, and methods for delivering the vectors into target cells are described in <nplcit id="ncit0021" npl-type="s"><text>Samulski R et al. (1987), J. Virol. 61: 3096-3101</text></nplcit>; <nplcit id="ncit0022" npl-type="s"><text>Fisher KJ et al. (1996), J. Virol., 70: 520-532</text></nplcit>; <nplcit id="ncit0023" npl-type="s"><text>Samulski R et al. (1989), J. Virol. 63: 3822-3826</text></nplcit>; <patcit id="pcit0005" dnum="US5252479A"><text>U.S. Pat. No. 5,252,479</text></patcit>; <patcit id="pcit0006" dnum="US5139941A"><text>U.S. Pat. No. 5,139,941</text></patcit>; International Patent Application No. <patcit id="pcit0007" dnum="WO9413788A"><text>WO 94/13788</text></patcit>; and International Patent Application No. <patcit id="pcit0008" dnum="WO9324641A"><text>WO 93/24641</text></patcit>, the entire disclosures of which are herein incorporated by reference. An exemplary method for generating a recombinant AAV vector of the invention is described in Example 7 below.

0062The ability of an siRNA containing a given target sequence to cause RNAi-mediated degradation of the target mRNA can be evaluated using standard techniques for measuring the levels of RNA or protein in cells. For example, siRNA of the invention can be delivered to cultured cells, and the levels of target mRNA can be measured by Northern blot or dot blotting techniques, or by quantitative RT-PCR. Alternatively, the levels of VEGF, Flt-1 or Flk-1/KDR receptor protein in the cultured cells can be measured by ELISA or Western blot. A suitable cell culture system for measuring the effect of the present siRNA on target mRNA or protein levels is described in Example 1 bellow.

0063RNAi-mediated degradation of target mRNA by an siRNA containing a given target sequence can also be evaluated with animal models of neovascularization, such as the ROP or CNV mouse models. For example, areas of neovascularization in an ROP or CNV mouse can be measured before and after administration of an siRNA. A reduction in the areas of neovascularization in these models upon administration of the siRNA indicates the down-regulation of the target mRNA (see Example 6 below).

0064As discussed above, the siRNA of the invention target and cause the RNAi-mediated degradation of VEGF, Flt-1 or Flk-1/KDR mRNA, or alternative splice forms, mutants or cognates thereof. Degradation of the target mRNA by the present siRNA reduces the production of a functional gene product from the VEGF, Flt-1 or Flk-1/KDR genes. Thus, the invention provides a method of inhibiting expression of VEGF, Flt-1 or Flk-1/KDR in a subject, comprising administering an effective amount of an siRNA of the invention to the subject, such that the target mRNA is degraded. As the products of the VEGF, Flt-1 and Flk-1/KDR genes are required for initiating and maintaining angiogenesis, the invention also provides a method of inhibiting angiogenesis in a subject by the RNAi-mediated degradation of the target mRNA by the present siRNA.

0065As used herein, a "subject" includes a human being or non-human animal. Preferably, the subject is a human being.

0066As used herein, an "effective amount" of the siRNA is an amount sufficient to cause RNAi-mediated degradation of the target mRNA, or an amount sufficient to inhibit the progression of angiogenesis in a subject.

0067RNAi-mediated degradation of the target mRNA can be detected by measuring levels of the target mRNA or protein in the cells of a subject, using standard techniques for isolating and quantifying mRNA or protein as described above.

0068Inhibition of angiogenesis can be evaluated by directly measuring the progress of pathogenic or nonpathogenic angiogenesis in a subject; for example, by observing the size of a neovascularized area before and after treatment with the siRNA of the invention. An inhibition of angiogenesis is indicated if the size of the neovascularized area stays the same or is reduced. Techniques for observing and measuring the size of neovascularized areas in a subject are within the skill in the art; for example, areas of choroid neovascularization can be observed by ophthalmoscopy.

0069Inhibition of angiogenesis can also be inferred through observing a change or reversal in a pathogenic condition associated with the angiogenesis. For example, in ARMD, a slowing, halting or reversal of vision loss indicates an inhibition of angiogenesis in the choroid. For tumors, a slowing, halting or reversal of tumor growth, or a slowing or halting of tumor metastasis, indicates an inhibition of angiogenesis at or near the tumor site. Inhibition of non-pathogenic angiogenesis can also be inferred from, for example, fat loss or a reduction in cholesterol levels upon administration of the siRNA of the invention.

0070It is understood that the siRNA of the invention can degrade the target mRNA (and thus inhibit angiogenesis) in substoichiometric amounts. Without wishing to be bound by any theory, it is believed that the siRNA of the invention causes degradation of the target mRNA in a catalytic manner. Thus, compared to standard anti-angiogenic therapies, significantly less siRNA needs to be delivered at or near the site of neovascularization to have a therapeutic effect.

0071One skilled in the art can readily determine an effective amount of the siRNA of the invention to be administered to a given subject, by taking into account factors such as the size and weight of the subject; the extent of the neovascularization or disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic. Generally, an effective amount of the siRNA of the invention comprises an intercellular concentration at or near the neovascularization site of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or lesser amounts of siRNA can be administered.

0072The present methods can be used to inhibit angiogenesis which is non-pathogenic; i.e., angiogenesis which results from normal processes in the subject. Examples of non-pathogenic angiogenesis include endometrial neovascularization, and processes involved in the production of fatty tissues or cholesterol. Thus, the invention provides a method for inhibiting non-pathogenic angiogenesis, e.g., for controlling weight or promoting fat loss, for reducing cholesterol levels, or as an abortifacient.

0073The present methods can also inhibit angiogenesis which is associated with an angiogenic disease; i.e., a disease in which pathogenicity is associated with inappropriate or uncontrolled angiogenesis. For example, most cancerous solid tumors generate an adequate blood supply for themselves by inducing angiogenesis in and around the tumor site. This tumor-induced angiogenesis is often required for tumor growth, and also allows metastatic cells to enter the bloodstream.

0074Other angiogenic diseases include diabetic retinopathy, age-related macular degeneration (ARMD), psoriasis, rheumatoid arthritis and other inflammatory diseases. These diseases are characterized by the destruction of normal tissue by newly formed blood vessels in the area of neovascularization. For example, in ARMD, the choroid is invaded and destroyed by capillaries. The angiogenesis-driven destruction of the choroid in ARMD eventually leads to partial or full blindness.

0075Preferably, an siRNA of the invention is used to inhibit the growth or metastasis of solid tumors associated with cancers; for example breast cancer, lung cancer, head and neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, esophagus cancer, gastrointestinal cancer, glioma, liver cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor, multiple myeloma; skin cancer (e.g., melanoma), lymphomas and blood cancer.

0076More preferably, an siRNA of the invention is used to inhibit choroidal neovascularization in age-related macular degeneration.

0077For treating angiogenic diseases, the siRNA of the invention can administered to a subject in combination with a pharmaceutical agent which is different from the present siRNA. Alternatively, the siRNA of the invention can be administered to a subject in combination with another therapeutic method designed to treat the angiogenic disease. For example, the siRNA of the invention can be administered in combination with therapeutic methods currently employed for treating cancer or preventing tumor metastasis (e.g., radiation therapy, chemotherapy, and surgery). For treating tumors, the siRNA of the invention is preferably administered to a subject in combination with radiation therapy, or in combination with chemotherapeutic agents such as cisplatin, carboplatin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen.

0078In the present methods, the present siRNA can be administered to the subject either as naked siRNA, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector which expresses the siRNA.

0079Suitable delivery reagents for administration in conjunction with the present siRNA include the Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes. A preferred delivery reagent is a liposome.

0080Liposomes can aid in the delivery of the siRNA to a particular tissue, such as retinal or tumor tissue, and can also increase the blood half-life of the siRNA. Liposomes suitable for use in the invention are formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example as described in <nplcit id="ncit0024" npl-type="s"><text>Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9: 467</text></nplcit>; and <patcit id="pcit0009" dnum="US4235871A"><text>U.S. Pat. Nos. 4,235,871</text></patcit>, <patcit id="pcit0010" dnum="US4501728A"><text>4,501,728</text></patcit>, <patcit id="pcit0011" dnum="US4837028A"><text>4,837,028</text></patcit>, and <patcit id="pcit0012" dnum="US5019369A"><text>5,019,369</text></patcit>, the entire disclosures of which are herein incorporated by reference.

0081Preferably, the liposomes encapsulating the present siRNA comprises a ligand molecule that can target the liposome to a particular cell or tissue at or near the site of angiogenesis. Ligands which bind to receptors prevalent in tumor or vascular endothelial cells, such as monoclonal antibodies that bind to tumor antigens or endothelial cell surface antigens, are preferred.

0082Particularly preferably, the liposomes encapsulating the present siRNA are modified so as to avoid clearance by the mononuclear macrophage and reticuloendothelial systems, for example by having opsonization-inhibition moieties bound to the surface of the structure. In one embodiment, a liposome of the invention can comprise both opsonization-inhibition moieties and a ligand.

0083Opsonization-inhibiting moieties for use in preparing the liposomes of the invention are typically large hydrophilic polymers that are bound to the liposome membrane. As used herein, an opsonization inhibiting moiety is "bound" to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids. These opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the macrophage-monocyte system ("MMS") and reticuloendothelial system ("RES"); e.g., as described in <patcit id="pcit0013" dnum="US4920016A"><text>U.S. Pat. No. 4,920,016</text></patcit>, the entire disclosure of which is herein incorporated by reference. Liposomes modified with opsonization-inhibition moieties thus remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called "stealth" liposomes.

0084Stealth liposomes are known to accumulate in tissues fed by porous or "leaky" microvasculature. Thus, target tissue characterized by such microvasculature defects, for example solid tumors, will efficiently accumulate these liposomes; see <nplcit id="ncit0025" npl-type="s"><text>Gabizon, et al. (1988), P.N.A.S, USA, 18: 6949-53</text></nplcit>. In addition, the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation in the liver and spleen. Thus, liposomes of the invention that are modified with opsonization-inhibition moieties can deliver the present siRNA to tumor cells.

0085Opsonization inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number-average molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons. Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable. In addition, the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide. The opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups.

0086Preferably, the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called "PEGylated liposomes."

0087The opsonization inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques. For example, an N-hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a membrane. Similarly, a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH3 and a solvent mixture such as tetrahydrofuran and water in a 30:12 ratio at 60 °C.

0088Recombinant plasmids which express siRNA of the invention are discussed above. Such recombinant plasmids can also be administered directly or in conjunction with a suitable delivery reagent, including the Mirus Transit LT1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes. Recombinant viral vectors which express siRNA of the invention are also discussed above, and methods for delivering such vectors to an area of neovascularization in a patient are within the skill in the art.

0089The siRNA of the invention can be administered to the subject by any means suitable for delivering the siRNA to the cells of the tissue at or near the area of neovascularization. For example, the siRNA can be administered by gene gun, electroporation, or by other suitable parenteral or enteral administration routes.

0090Suitable enteral administration routes include oral, rectal, or intranasal delivery.

0091Suitable parenteral administration routes include intravascular administration (e.g. intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue administration (e.g., peri-tumoral and intra-tumoral injection, intra-retinal injection or subretinal injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct (e.g., topical) application to the area at or near the site of neovascularization, for example by a catheter or other placement device (e.g., a corneal pellet or a suppository, eye-dropper, or an implant comprising a porous, non-porous, or gelatinous material); and inhalation. Suitable placement devices include the ocular implants described in <patcit id="pcit0014" dnum="US5902598A"><text>U.S. Pat. Nos. 5,902,598</text></patcit> and <patcit id="pcit0015" dnum="US6375972A"><text>6,375,972</text></patcit>, and the biodegradable ocular implants described in <patcit id="pcit0016" dnum="US6331313B"><text>U.S. Pat. No 6,331,313</text></patcit>, the entire disclosures of which are herein incorporated by reference. Such ocular implants are available from Control Delivery Systems, Inc. (Watertown, MA) and Oculex Pharmaceuticals, Inc. (Sunnyvale, CA).

0092In a preferred embodiment, injections or infusions of the siRNA are given at or near the site of neovascularization. More preferably, the siRNA is administered topically to the eye, e.g. in liquid or gel form to the lower eye lid or conjunctival cul-de-sac, as is within the skill in the art (see, e.g., <nplcit id="ncit0026" npl-type="s"><text>Acheampong AA et al, 2002, Drug Metabol. and Disposition 30: 421-429</text></nplcit>, the entire disclosure of which is herein incorporated by reference).

0093Typically, the siRNA of the invention is administered topically to the eye in amounts of from about 5 microliters to about 75 microliters, for example from about 7 microliters to about 50 microliters, preferably from about 10 microliters to about 30 microliters. It is understood that topical instillation in the eye of siRNA in volumes greater than 75 microliters can result in loss of siRNA from the eye through spillage and drainage. Thus, it is preferable to administer a high concentration of siRNA (e.g., 100-1000 nM) in as small a volume as possible.

0094A particularly preferred parenteral administration route is intraocular administration. It is understood that intraocular administration of the present siRNA can be accomplished by injection or direct (e.g., topical) administration to the eye, as long as the administration route allows the siRNA to enter the eye. In addition to the topical routes of administration to the eye described above, suitable intraocular routes of administration include intravitreal, intraretinal, subretinal, subtenon, peri- and retro-orbital, trans-corneal and trans-scleral administration. Such intraocular administration routes are within the skill in the art; see, e.g., and Acheampong AA et al, 2002, supra; and <nplcit id="ncit0027" npl-type="s"><text>Bennett et al. (1996), Hum. Gene Ther. 7: 1763-1769 </text></nplcit>and <nplcit id="ncit0028" npl-type="s"><text>Ambati J et al., 2002, Progress in Retinal and Eye Res. 21: 145-151</text></nplcit>, the entire disclosures of which are herein incorporated by reference.

0095The siRNA of the invention can be administered in a single dose or in multiple doses. Where the administration of the siRNA of the invention is by infusion, the infusion can be a single sustained dose or can be delivered by multiple infusions. Injection of the agent directly into the tissue is at or near the site of neovascularization preferred. Multiple injections of the agent into the tissue at or near the site of neovascularization are particularly preferred.

0096One skilled in the art can also readily determine an appropriate dosage regimen for administering the siRNA of the invention to a given subject. For example, the siRNA can be administered to the subject once, such as by a single injection or deposition at or near the neovascularization site. Alternatively, the siRNA can be administered to a subject multiple times daily or weekly. For example, the siRNA can be administered to a subject once weekly for a period of from about three to about twenty-eight weeks, more preferably from about seven to about ten weeks. In a preferred dosage regimen, the siRNA is injected at or near the site of neovascularization (e.g., intravitreally) once a week for seven weeks. It is understood that periodic administrations of the siRNA of the invention for an indefinite length of time may be necessary for subjects suffering from a chronic neovascularization disease, such as wet ARMD or diabetic retinopathy.

0097Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of siRNA administered to the subject can comprise the total amount of siRNA administered over the entire dosage regimen.

0098The siRNA of the invention are preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art. Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, "pharmaceutical formulations" include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the invention are within the skill in the art, for example as described in <nplcit id="ncit0029" npl-type="b"><text>Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985</text></nplcit>), the entire disclosure of which is herein incorporated by reference.

0099The present pharmaceutical formulations comprise an siRNA of the invention (e.g., 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a physiologically acceptable carrier medium. Preferred physiologically acceptable carrier media are water, buffered water, saline solutions (e.g., normal saline or balanced saline solutions such as Hank's or Earle's balanced salt solutions), 0.4% saline, 0.3% glycine, hyaluronic acid and the like.

0100Pharmaceutical compositions of the invention can also comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents. Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.

0101For topical administration to the eye, conventional intraocular delivery reagents can be used. For example, pharmaceutical compositions of the invention for topical intraocular delivery can comprise saline solutions as described above, corneal penetration enhancers, insoluble particles, petrolatum or other gel-based ointments, polymers which undergo a viscosity increase upon instillation in the eye, or mucoadhesive polymers. Preferably, the intraocular delivery reagent increases corneal penetration, or prolongs preocular retention of the siRNA through viscosity effects or by establishing physicochemical interactions with the mucin layer covering the corneal epithelium.

0102Suitable insoluble particles for topical intraocular delivery include the calcium phosphate particles described in <patcit id="pcit0017" dnum="US6355271B"><text>U.S. Pat. No. 6,355,271 of Bell et al.</text></patcit>, the entire disclosure of which is herein incorporated by reference. Suitable polymers which undergo a viscosity increase upon instillation in the eye include polyethylenepolyoxypropylene block copolymers such as poloxamer 407 (e.g., at a concentration of 25%), cellulose acetophthalate (e.g., at a concentration of 30%), or a low-acetyl gellan gum such as Gelrite® (available from CP Kelco, Wilmington, DE). Suitable mucoadhesive polymers include hydrocolloids with multiple hydrophilic functional groups such as carboxyl, hydroxyl, amide and/or sulfate groups; for example, hydroxypropylcellulose, polyacrylic acid, high-molecular weight polyethylene glycols (e.g., >200,000 number average molecular weight), dextrans, hyaluronic acid, polygalacturonic acid, and xylocan. Suitable corneal penetration enhancers include cyclodextrins, benzalkonium chloride, polyoxyethylene glycol lauryl ether (e.g., Brij® 35), polyoxyethylene glycol stearyl ether (e.g., Brij® 78), polyoxyethylene glycol oleyl ether (e.g., Brij® 98), ethylene diamine tetraacetic acid (EDTA), digitonin, sodium taurocholate, saponins and polyoxyethylated castor oil such as Cremaphor EL.

0103For solid compositions, conventional nontoxic solid carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.

0104For example, a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, preferably 25%-75%, of one or more siRNA of the invention. A pharmaceutical composition for aerosol (inhalational) administration can comprise 0.01-20% by weight, preferably 1%-10% by weight, of one or more siRNA of the invention encapsulated in a liposome as described above, and propellant. A carrier can also be included as desired; e.g., lecithin for intranasal delivery.

0105The invention will now be illustrated with the following non-limiting examples. The animal experiments described in Examples 4-6 and 8-9 were performed using the University of Pennsylvania institutional guidelines for the care and use of animals in research. The animal experiment described in Example 10 will be performed in accordance with the Standard Operating Procedures of Sierra Biomedical, 587 Dunn Circle, Sparks, NV, 89431.

Example 1 - siRNA Transfection and Hypoxia Induction In Vitro

0106siRNA Design - A 19 nt sequence located 329 nt from the 5' end of human VEGF mRNA was chosen as a target sequence: AAACCTCACCAAGGCCAGCAC (SEQ ID NO: 51). To ensure that it was not contained in the mRNA from any other genes, this target sequence was entered into the BLAST search engine provided by NCBI. The use of the BLAST algorithm is described in <nplcit id="ncit0030" npl-type="s"><text>Altschul et al. (1990), J. Mol. Biol. 215: 403-410</text></nplcit> and <nplcit id="ncit0031" npl-type="s"><text>Altschul et al. (1997), Nucleic Acids Res. 25: 3389-3402</text></nplcit>, the disclosures of which are herein incorporated by reference in their entirety. As no other mRNA was found which contained the target sequence, an siRNA duplex was synthesized to target this sequence (Dharmacon Research, Inc., Lafayette, CO).

0107The siRNA duplex had the following sense and antisense strands. sense: 5'-accucaccaaggccagcacTT-3' (SEQ ID NO: 77). antisense: 5'-gugcuggccuuggugagguTT-3' (SEQ ID NO: 78).

0108Together, the siRNA sense and antisense strands formed a 19 nt doublestranded siRNA with TT 3' overhangs (shown in bold) on each strand. This siRNA was termed "Candidate 5" or "Cand5." Other siRNA which target human VEGF mRNA were designed and tested as described for Cand5.

0109An siRNA targeting the following sequence in green fluorescent protein (GFP) mRNA was used as a nonspecific control: GGCTACGTCCAGCGCACC (SEQ ID NO: 79). The siRNA was purchased from Dharmacon (Lafayette, CO).

0110siRNA Transfection and Hypoxia Induction In Vitro - Human cell lines (293; Hela and ARPE19) were separately seeded into 24-well plates in 250 microliters of complete DMEM medium one day prior to transfection, so that the cells were ∼50% confluent at the time of transfection. Cells were transfected with 2.5 nM Cand5 siRNA, and with either no siRNA or 2.5 nM non-specific siRNA (targeting GFP) as controls. Transfections were performed in all cell lines with the "Transit TKO Transfection" reagent, as recommended by the manufacturer (Mirus).

0111Twenty four hours after transfection, hypoxia was induced in the cells by the addition of desferoxamide mesylate to a final concentration of 130 micromolar in each well. Twenty four hours post-transfection, the cell culture medium was removed from all wells, and a human VEGF ELISA (R&D systems, Minneapolis, MN) was performed on the culture medium as described in the Quantikine human VEGF ELISA protocol available from the manufacturer, the entire disclosure of which is herein incorporated by reference.

0112As can be seen in <figref idref="f0001">Fig. 1</figref>, RNAi degradation induced by Cand5 siRNA significantly reduces the concentration of VEGF produced by the hypoxic 293 and HeLa cells. There was essentially no difference in the amount of VEGF produced by hypoxic cells treated with either no siRNA or the non-specific siRNA control. Similar results were also seen with human ARPE19 cells treated under the same conditions. Thus, RNA interference with VEGF-targeted siRNA disrupts the pathogenic up-regulation of VEGF in human cultured cells in vitro.

0113The experiment outlined above was repeated on mouse NIH 3T3 cells using a mouse-specific VEGF siRNA (see Example 6 below), and VEGF production was quantified with a mouse VEGF ELISA (R&D systems, Minneapolis, MN) as described in the Quantikine mouse VEGF ELISA protocol available from the manufacturer, the entire disclosure of which is herein incorporated by reference. Results similar to those reported in <figref idref="f0001">Fig. 1</figref> for the human cell lines were obtained.

Example 2 - Effect of Increasing siRNA Concentration on VEGFProduction in Human Cultured Cells

0114The experiment outlined in Example 1 was repeated with human 293, HeLa and ARPE19 cells using a range of siRNA concentrations from 10 nM to 50 nM. The ability of the Cand5 siRNA to down-regulate VEGF production increased moderately up to approximately 13 nM siRNA, but a plateau effect was seen above this concentration. These results highlight the catalytic nature of siRNA-mediated RNAi degradation of mRNA, as the plateau effect appears to reflect VEGF production from the few cells not transfected with the siRNA. For the majority of cells which had been transfected with the siRNA, the increased VEGF mRNA production induced by the hypoxia is outstripped by the siRNA-induced degradation of the target mRNA at siRNA concentrations greater than about 13 nM.

Example 3 - Specificity of siRNA Targeting

0115NIH 3T3 mouse fibroblasts were grown in 24-well plates under standard conditions, so that the cells were ∼50% confluent one day prior to transfection. The human VEGF siRNA Cand5 was transfected into a NIH 3T3 mouse fibroblasts as in Example 1. Hypoxia was then induced in the transfected cells, and murine VEGF concentrations were measured by ELISA as in Example 1.

0116The sequence targeted by the human VEGF siRNA Cand5 differs from the murine VEGF mRNA by one nucleotide. As can be seen in <figref idref="f0002">Fig. 2</figref>, the human VEGF siRNA has no affect on the ability of the mouse cells to up-regulate mouse VEGF after hypoxia. These results show that siRNA induced RNAi degradation is sequence-specific to within a one nucleotide resolution.

Example 4 - In Vivo delivery of siRNA to Murine Retinal PigmentEpithelial Cells

0117VEGF is upregulated in the retinal pigment epithelial (RPE) cells of human patients with age-related macular degeneration (ARMD). To show that functional siRNA can be delivered to RPE cells in vivo, GFP was expressed in mouse retinas with a recombinant adenovirus, and GFP expression was silenced with siRNA. The experiment was conducted as follows.

0118One eye from each of five adult C57/Black6 mice (Jackson Labs, Bar Harbor, ME) was injected subretinally as described in Bennett et al. (1996), supra., with a mixture containing ∼1x108 particles of adenovirus containing eGFP driven by the CMV promoter and 20 picomoles of siRNA targeting eGFP conjugated with transit TKO reagent (Mirus).

0119As positive control, the contralateral eyes were injected with a mixture containing ∼1x108 particles of adenovirus containing eGFP driven by the CMV promoter and 20 picomoles of siRNA targeting human VEGF conjugated with transit TKO reagent (Mirus). Expression of GFP was detected by fundus ophthalmoscopy 48 hours and 60 hours after injection. Animals were sacrificed at either 48 hours or 60 hours post-injection. The eyes were enucleated and fixed in 4% paraformaldehyde, and were prepared either as flat mounts or were processed into 10 micron cryosections for fluorescent microscopy.

0120No GFP fluorescence was detectable by ophthalmoscopy in the eyes which received the siRNA targeted to GFP mRNA in 4 out of 5 mice, whereas GFP fluorescence was detectable in the contralateral eye which received the non-specific control siRNA. A representative flat mount analyzed by fluorescence microscopy showed a lack of GFP fluorescence in the eye which received GFP siRNA, as compared to an eye that received the non-specific control siRNA. Cryosections of another retina showed that the recombinant adenovirus efficiently targets the RPE cells, and when the adenovirus is accompanied by siRNA targeted to GFP mRNA, expression of the GFP transgene is halted.

0121While there is some GFP fluorescence detectable by fluorescence microscopy in eyes that received siRNA targeted to GFP mRNA, the fluorescence is greatly suppressed as compared to controls that received non-specific siRNA. These data demonstrate that functional siRNA can be delivered in vivo to RPE cells.

Example 5 In Vivo Expression and siRNA-Induced RNAiDegradation of Human VEGF in Murine Retinas

0122In order to demonstrate that siRNA targeted to VEGF functioned in vivo, an exogenous human VEGF expression cassette was delivered to mouse RPE cells via an adenovirus by subretinal injection, as in Example 4. One eye received Cand5 siRNA, and the contralateral eye received siRNA targeted to GFP mRNA. The animals were sacrificed 60 hours post-injection, and the injected eyes were removed and snap frozen in liquid N2 following enucleation. The eyes were then homogenized in lysis buffer, and total protein was measured using a standard Bradford protein assay (Roche, Germany). The samples were normalized for total protein prior to assaying for human VEGF by ELISA as described in Example 1.

0123The expression of VEGF was somewhat variable from animal to animal. The variability of VEGF levels correlated well to those observed in the GFP experiments of Example 4, and can be attributed to some error from injection to injection, and the differential ability of adenovirus to delivery the target gene in each animal. However, there was a significant attenuation of VEGF expression in each eye that received VEGF siRNA, as compared to the eyes receiving the non-specific control siRNA (<figref idref="f0004">Figure 4</figref>). These data indicate that the Cand5 siRNA was potent and effective in silencing human VEGF expression in murine RPE cells in vivo.

Example 6 - Inhibition of Choroidal Neovascularization in theMouse CNV Model

0124There is evidence that choroidal neovascularization in ARMD is due to the upregulation of VEGF in the RPE cells. This human pathologic condition can be modeled in the mouse by using a laser to burn a spot on the retina ("laser photo-coagulation" or "laser induction"). During the healing process, VEGF is believed to be up-regulated in the RPE cells of the burned region, leading to re-vascularization of the choroid. This model is called the mouse choroidal neovascularization ("CNV") model.

0125For rescue of the mouse CNV model, a mouse siRNA was designed that incorporated a one nucleotide change from the human "Cand5" siRNA from Example 1. The mouse siRNA specifically targeted mouse VEGF mRNA at the sequence AAACCUCACCAAAGCCAGCAC (SEQ ID NO: 80). Other siRNA that target mouse VEGF were also designed and tested. The GFP siRNA used as a nonspecific control in Example 1 was also used as a non-specific control here.

0126Twenty four hours after laser induction, one eye from each of eleven adult C57/Black6 mice (Jackson Labs, Bar Harbor, ME) was injected subretinally with a mixture containing ∼1x108 particles of adenovirus containing LacZ driven by the CMV promoter and 20 picomoles of siRNA targeting mouse VEGF conjugated with transit TKO reagent (Mirus), as in Example 4. As a control, contralateral eyes received a mixture containing ∼1x108 particles of adenovirus containing LacZ driven by the CMV promoter and 20 picomoles of siRNA targeting GFP conjugated with transit TKO reagent (Mirus).

0127Fourteen days after the laser treatment, the mice were perfused with fluorescein and the area of neovascularization was measured around the burn spots. Areas of the burn spots in the contra-lateral eye were used as a control. The site of neovascularization around the burn spots in animals that received siRNA targeting mouse VEGF was, on average, 1/4 the area of the control areas. These data support the use of VEGF-directed siRNA (also called "anti-VEGF siRNA") for therapy of ARMD.

Example 7 - Generation of an Adeno-Associated Viral Vector forExpression of siRNA

0128A "cis-acting" plasmid for generating a recombinant AAV vector for delivering an siRNA of the invention was generated by PCR based subcloning, essentially as described in Samulski R et al. (1987), supra. The cis-acting plasmid was called "pAAVsiRNA."

0129The rep and cap genes of psub201 were replaced with the following sequences in this order: a 19 nt sense RNA strand coding sequence in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter, and a 19 nt antisense RNA strand coding sequence in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter. A schematic representation of pAAVsiRNA is given if <figref idref="f0005">Fig. 5</figref>.

0130A recombinant AAV siRNA vector was obtained by transfecting pAAVsiRNA into human 293 cells previously infected with El-deleted adenovirus, as described in Fisher KJ et al. (1996), supra. The AAV rep and cap functions were provided by a trans-acting plasmid pAAV/Ad as described in Samulski R et al. (1989), supra. Production lots of the recombinant AAV siRNA vector were titered according to the number of genome copies/ml, as described in Fisher KJ et al. (1996), supra.

Example 8 - VEGF-Directed siRNA Inhibits ExperimentalChoroidal Neovascularization

0131The ability of murine VEGF-directed siRNA to inhibit experimental laser-induced choroidal neovascularization (CNV) in mice was tested as follows.

0132The retinas of adult female C57BL/6 mice were laser photocoagulated using an 810 nm diode laser (75 um, 140 mw, 0.10 seconds) (OcuLight Six; IRIS Medical, Mountain View, CA). Three laser spots were applied to both eyes of each mouse. Thirty-six hours following laser photocoagulation, an siRNA targeted to mouse VEGF ("mVEGF1.siRNA") was delivered subretinally or intravitreally to one eye of each mouse. For subretinal injection, the siRNA was conjugated with Transit TKO transfection reagent (Mirus) and mixed with recombinant adenovirus (rAdenovirus). For intravitreal injection, the siRNA was delivered in the absence of transfection reagent and rAdenovirus. As a control, the contralateral eyes of each mouse received subretinal or intravitreal injections of identical formulations with an siRNA targeted to GFP ("GFP1.siRNA"), which has no homology to mouse VEGF.

0133Fourteen days following laser treatment, all animals were perfused with high molecular weight FITC-dextran, choroidal flat mounts were prepared as described above, and the flat mounts were photographed and analyzed microscopically in a masked fashion. The area of CNV in each flat mount was measured with Openlab software (Improvision, Boston, MA). The mean areas of CNV in eyes treated with mVEGF1.siRNA were significantly smaller than those areas from GFP1.siRNA-treated eyes for both subretinal (<figref idref="f0006">Fig. 6A</figref>; P<0.003) and intravitreal (<figref idref="f0006">Fig. 6B</figref>; P<0.04) delivery.

0134In a second experiment, the retinas of adult female C57BL/6 mice were laser photocoagulated as described above, and the animals were divided into control and test groups. One day following laser photocoagulation, phosphate buffered saline was delivered intravitreally to the animals of the control group, which were perfused with dextran-fluorescein 14 days after laser treatment. Choroidal flat mounts were then prepared and the areas of CNV in each flat mount were measured as above.

0135Fourteen days following laser photocoagulation, mVEGF1.siRNA was delivered by intravitreal injection into one eye of each mouse in the test group. Contralateral eyes were injected with GFP1.siRNA as a control. The test group animals were perfused with high molecular weight dextran-fluorescein 21 days after laser treatment. Choroidal flat mounts were then prepared and the areas of CNV in each flat mount were measured, as above.

0136In this latter experiment, the anti-VEGF siRNA was administered during CNV growth, as opposed to before CNV growth, and thus is more representative of the condition of human patients presenting with wet AMD. As can be seen from <figref idref="f0006 f0007">Fig. 6</figref>, the mean areas of CNV in mVEGF1.siRNA-treated eyes were significantly smaller than those areas measured in GFP1.siRNA-treated eyes (<figref idref="f0007">Fig. 6C</figref>; P<0.05). The mean areas of CNV in mVEGF1.siRNA-treated eyes at day 21 and control ("PBS") eyes at day 14 were not significantly different (<figref idref="f0007">Fig. 6C</figref>; P=0.469).

0137The results of these experiments indicate that age-related macular degeneration can be treated with anti-VEGF siRNA.

Example 9 - In Vivo RNA Interference of Human VEGF Induced byanti-VEGF siRNA in Murine RPE Cells

0138The ability of Cand5 siRNA to induce RNAi of VEGF in vivo over time was evaluated as follows.

0139AAV.CMV.VEGF, which expresses human VEGF from an adeno-associated viral vector, was generously provided by Dr. A. Auricchio. AAV.CMV.VEGF was injected subretinally and bilaterally in eyes of five C57Bl/6 mice. Twenty-eight days after injection of AAV.CMV.VEGF, Cand5 siRNA was delivered by intravitreal injection into one eye and control GFP1.siRNA was delivered by intravitreal injection in the contralateral eye of each animal.

0140At day 0 (pre-siRNA injection), and at 6, 10 and 14 days after siRNA injection, the mice were sacrificed and the eyes were snap frozen in liquid nitrogen following enucleation. The eyes were then homogenized in lysis buffer (Roche, Basel, Switzerland), and total protein was measured using a Bradford assay, as in Example 5 above. Two mice were used for the 0 day time point (n=2), and three mice each were used for the 6, 10 and 14 day time points (n=3). The samples were normalized for total protein prior to assaying for human VEGF by ELISA, according to the manufacturer's recommendations (R&D systems, Minneapolis, Minnesota). Percent of VEGF (%VEGF) for each mouse was calculated as the concentration of VEGF ("[VEGF]") in the eye injected with Cand5 divided by the [VEGF] in the eye injected with GFP1.siRNA, multiplied by 100.

0141As can be seen from <figref idref="f0008">Figure 7</figref>, a single injection of Cand5 induced an RNAi-mediated decrease in VEGF levels of approximately 70% by day 6 post-siRNA injection, with a reduction in VEGF production of approximately 35% continuing through at least day 14 post-siRNA injection. These results indicate that siRNA directed against human VEGF is capable of inducing RNAi of human VEGF in vivo for a sustained period of time.

Example 10 - In Vivo RNA Interference of VEGF in Monkeys withAnti-VEGF siRNA

0142It is expected that 10 naïve cynomolgus monkeys (Macaca fascicularis) will be subjected to laser photocoagulation of the retina in both eyes to induce choroidal neovascularization ("CNV"). The following represents the intended experimental plan to evaluate the ability of Cand5 siRNA to reduce the area of CNV in the monkeys. As the VEGF RNA sequence targeted by Cand5 is identical in both Homo sapiens and M. fascicularis, Cand5 is expected to induce RNAi of M. fascicularis VEGF RNA.

0143The experiment will be carried out by Sierra Biomedical ("SBi"), 587 Dunn Circle, Sparks, NV, 89431, in accordance with SBi's Standard Operating Procedures. All monkeys will undergo a full pre-study health screen consisting of a physical examination, hematologic and ophthalmologic evaluations, serum chemistry, and electroretinography ("ERG"). A pre-study fluorescein angiography of the monkeys' eyes will also be performed, and intraocular pressure will be measured pre-study and at two additional time points during the study period.

0144On day zero, both eyes of all 10 monkeys will be laser photocoagulated to induce choroidal neovascularization. The animals will receive twice-daily cageside observations and a once-daily qualitative assessment of food consumption throughout the experiment. At 14 days post laser induction, the monkeys will receive intravitreally one 50 microliter dose of a Treatment or Control formulation (see below) in each eye, in a randomized, double-blind fashion. For example, a given animal could receive a Treatment 1 dose in the right eye, and a Control dose in the left eye. Another animal could receive a Treatment 1 dose in the right eye, and a Treatment 3 dose in the left eye. It is expected that four eyes will receive each formulation, for a total of 1 control and four treatment groups of four eyes each.

0145The formulations will be: Control - balanced saline solution ("BSS") alone; Treatment 1 - 1 mg/ml Cand5 in BSS; Treatment 2 - 2.5 mg/ml Cand5 in BSS; Treatment 3 - 5 mg/ml Cand5 in BSS; and Treatment 4 - 10 mg/ml Cand5 in BSS. Prior to injection, it is expected that the pH, osmolarity, and the absorbance at 260 nm of each formulation will be measured.

0146After laser induction, a fluorescein angiography will be performed on both eyes of each monkey weekly up through the seventh week after laser induction. The monkeys will then be sacrificed, and a complete necropsy will be performed with a full tissue collection (∼45 tissues including a vitreous sample) and histopathologic evaluation of the collected tissues. An ERG will be taken pre-necropsy.

0147It is expected that the laser-induced areas of CNV will be reduced upon administration of the Cand5 siRNA, with the CNV area decreasing with increasing dose of Can5. However, a plateau effect such as is described above in Example 2 may be observed. The Cand5 siRNA is not expected to effect any other organ or tissue except the choroid in the eye.

SEQUENCE LISTING

0148<ul id="ul0005" list-style="none"><li><110> The Trustees of the University of Pennsylvania Tolentino, Michael J. Reich, Samuel Jotham</li><li><120> Compositions and Methods for siRNA Inhibition of Angiogenesis</li><li><130> 43826-1 PC</li><li><150> <patcit id="pcit0018" dnum="US60398417B"><text>US 60/398,417</text></patcit> <151> 2002-07-24</li><li><150> <patcit id="pcit0019" dnum="US10294228B"><text>US 10/294,228</text></patcit> <151> 2002-11-14</li><li><160> 864</li><li><170> FastSEQ for Windows Version 4.0</li><li><210> 1 <211> 2250 <212> DNA <213> Mus musculus</li><li><400> 1 <img file="EP1578933B1_D0001.tif" /><img file="EP1578933B1_D0002.tif" /></li><li><210> 2 <211> 444 <212> DNA <213> Homo sapiens</li><li><400> 2 <img file="EP1578933B1_D0003.tif" /></li><li><210> 3 <211> 576 <212> DNA <213> Homo sapiens</li><li><400> 3 <img file="EP1578933B1_D0004.tif" /></li><li><210> 4 <211> 648 <212> DNA <213> Homo sapiens</li><li><400> 4 <img file="EP1578933B1_D0005.tif" /></li><li><210> 5 <211> 670 <212> DNA <213> Homo sapiens</li><li><400> 5 <img file="EP1578933B1_D0006.tif" /></li><li><210> 6 <211> 1137 <212> DNA <213> Homo sapiens</li><li><400> 6 <img file="EP1578933B1_D0007.tif" /></li><li><210> 7 <211> 5830 <212> DNA <213> Homo sapiens</li><li><400> 7 <img file="EP1578933B1_D0008.tif" /><img file="EP1578933B1_D0009.tif" /><img file="EP1578933B1_D0010.tif" /></li><li><210> 8 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 8 tcatcacgaa gtggtgaag 19</li><li><210> 9 <211> 21 <212> RNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 9 ucaucacgaa guggugaagu u 21</li><li><210> 10 <211> 21 <212> RNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 10 cuucaccacu ucgugaugau u 21</li><li><210> 11 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><221> misc_RNA <222> (1) ... (19) <223> ribonucleotide</li><li><221> misc feature <222> (20) ... (21) <223> deoxyribonucleotide</li><li><400> 11 ucaucacgaa guggugaagt t 21</li><li><210> 12 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><221> misc_RNA <222> (1) ... (19) <223> ribonucleotides</li><li><221> misc feature <222> (20) ... (21) <223> deoxyribonucleotides</li><li><400> 12 cuucaccacu ucgugaugat t 21</li><li><210> 13 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 13 aacgtacttg cagatgtgac a 21</li><li><210> 14 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 14 gttcatggat gtctatcag 19</li><li><210> 15 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 15 tcgagaccct ggtggacat 19</li><li><210> 16 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 16 tgacgagggc ctggagtgt 19</li><li><210> 17 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 17 tgacgagggc ctggagtgt 19</li><li><210> 18 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 18 catcaccatg cagattatg 19</li><li><210> 19 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 19 acctcaccaa ggccagcac 19</li><li><210> 20 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 20 ggccagcaca taggagaga 19</li><li><210> 21 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 21 caaatgtgaa tgcagacca 19</li><li><210> 22 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 22 atgtgaatgc agaccaaag 19</li><li><210> 23 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 23 tgcagaccaa agaaagata 19</li><li><210> 24 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 24 agaaagatag agcaagaca 19</li><li><210> 25 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 25 gaaagataga gcaagacaa 19</li><li><210> 26 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 26 gatagagcaa gacaagaaa 19</li><li><210> 27 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 27 gacaagaaaa tccctgtgg 19</li><li><210> 28 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 28 gaaaatccct gtgggcctt 19</li><li><210> 29 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 29 aatccctgtg ggccttgct 19</li><li><210> 30 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 30 tccctgtggg ccttgctca 19</li><li><210> 31 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 31 gcatttgttt gtacaagat 19</li><li><210> 32 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 32 19 gatccgcaga cgtgtaaat 19</li><li><210> 33 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 33 19 atgttcctgc aaaaacaca 19</li><li><210> 34 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 34 19 tgttcctgca aaaacacag 19</li><li><210> 35 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 35 19 aaacacagac tcgcgttgc 19</li><li><210> 36 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 36 19 aacacagact cgcgttgca 19</li><li><210> 37 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 37 acacagactc gcgttgcaa 19</li><li><210> 38 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 38 cacagactcg cgttgcaag 19</li><li><210> 39 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 39 ggcgaggcag cttgagtta 19</li><li><210> 40 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 40 acgaacgtac ttgcagatg 19</li><li><210> 41 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 41 cgaacgtact tgcagatgt 19</li><li><210> 42 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 42 cgtacttgca gatgtgaca 19</li><li><210> 43 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 43 gtggtcccag gctgcaccc 19</li><li><210> 44 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 44 ggaggagggc agaatcatc 19</li><li><210> 45 <211> 19 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 45 gtggtgaagt tcatggatg 19</li><li><210> 46 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 46 aatcatcacg aagtggtgaa g 21</li><li><210> 47 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 47 aagttcatgg atgtctatca g 21</li><li><210> 48 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 48 aatcgagacc ctggtggaca t 21</li><li><210> 49 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 49 21 aatgacgagg gcctggagtg t 21</li><li><210> 50 <211> 21 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0006" list-style="none"><li><220> <223> Targeting sequence</li><li><400> 50 21 aacatcacca tgcagattat g 21</li><li><210> 51 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 51 21 aaacctcacc aaggccagca c 21</li><li><210> 52 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 52 21 aaggccagca cataggagag a 21</li><li><210> 53 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 53 21 aacaaatgtg aatgcagacc a 21</li><li><210> 54 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 54 aaatgtgaat gcagaccaaa g 21</li><li><210> 55 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 55 aatgcagacc aaagaaagat a 21</li><li><210> 56 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 56 aaagaaagat agagcaagac a 21</li><li><210> 57 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 57 aagaaagata gagcaagaca a 21</li><li><210> 58 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 58 aagatagagc aagacaagaa aat 23</li><li><210> 59 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 59 aagacaagaa aatccctgtg ggc 23</li><li><210> 60 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 60 aagaaaatcc ctgtgggcct tgc 23</li><li><210> 61 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 61 aatccctgtg ggccttgctc aga 23</li><li><210> 62 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 62 aagcatttgt ttgtacaaga tcc 23</li><li><210> 63 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 63 aagatccgca gacgtgtaaa tgt 23</li><li><210> 64 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 64 aaatgttcct gcaaaaacac aga 23</li><li><210> 65 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 65 aatgttcctg caaaaacaca gac 23</li><li><210> 66 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 66 aaaaacacag actcgcgttg caa 23</li><li><210> 67 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 67 aaaacacaga ctcgcgttgc aag 23</li><li><210> 68 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 68 aaacacagac tcgcgttgca agg 23</li><li><210> 69 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 69 aacacagact cgcgttgcaa ggc 23</li><li><210> 70 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 70 aaggcgaggc agcttgagtt aaa 23</li><li><210> 71 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 71 aaacgaacgt acttgcagat gtg 23</li><li><210> 72 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 72 aacgaacgta cttgcagatg tga 23</li><li><210> 73 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 73 aagtggtccc aggctgcacc cat 23</li><li><210> 74 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 74 aaggaggagg gcagaatcat cac 23</li><li><210> 75 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 75 aagtggtgaa gttcatggat gtc 23</li><li><210> 76 <211> 23 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 76 aaaatccctg tgggccttgc tca 23</li><li><210> 77 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><221> misc_RNA <222> (1)...(19) <223> ribonucleotides</li><li><221> misc feature <222> (20) ... (21) <223> deoxyribonucleotides</li><li><400> 77 accucaccaa ggccagcact t 21</li><li><210> 78 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><221> misc_RNA <222> (1)...(19) <223> ribonucleotides</li><li><221> misc_feature <222> (20) ... (21) <223> deoxyribonucleotides</li><li><400> 78 gugcuggccu uggugaggut t 21</li><li><210> 79 <211> 18 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 79 ggctacgtcc agcgcacc 18</li><li><210> 80 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 80 aaaccucacc aaagccagca c 21</li><li><210> 81 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 81 ggcagaatca tcacgaagtg g 21</li><li><210> 82 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 82 cctggtggac atcttccagg a 21</li><li><210> 83 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 83 gagatcgagt acatcttcaa g 21</li><li><210> 84 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 84 tggagtgtgt gcccactgag g 21</li><li><210> 85 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 85 gagcttccta cagcacaaca a 21</li><li><210> 86 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 86 ttgctcagag cggagaaagc a 21</li><li><210> 87 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 87 cacacactcg cgttgcaagg c 21</li><li><210> 88 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 88 tcaccatgca gattatgcgg a 21</li><li><210> 89 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 89 tagagcaaga caagaaaatc c 21</li><li><210> 90 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 90 ccgcagacgt gtaaatgttc c 21</li><li><210> 91 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 91 aagcaggcca gacactgcat c 21</li><li><210> 92 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 92 aatgcagggg ggaagcagcc c 21</li><li><210> 93 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 93 aagcagccca taaatggtct t 21</li><li><210> 94 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 94 aaatggtctt tgcctgaaat g 21</li><li><210> 95 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 95 aatggtcttt gcctgaaatg g 21</li><li><210> 96 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 96 aaatggtgag taaggaaagc g 21</li><li><210> 97 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 97 aatggtgagt aaggaaagcg a 21</li><li><210> 98 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 98 aaggaaagcg aaaggctgag c 21</li><li><210> 99 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 99 aaagcgaaag gctgagcata a 21</li><li><210> 100 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 100 aagcgaaagg ctgagcataa c 21</li><li><210> 101 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 101 aaaggctgag cataactaaa t 21</li><li><210> 102 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 102 aaggctgagc ataactaaat c 21</li><li><210> 103 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 103 aactaaatct gcctgtggaa g 21</li><li><210> 104 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 104 aaatctgcct gtggaagaaa t 21</li><li><210> 105 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 105 aatctgcctg tggaagaaat g 21</li><li><210> 106 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 106 aagaaatggc aaacaattct g 21</li><li><210> 107 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 107 aaatggcaaa caattctgca g 21</li><li><210> 108 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 108 aatggcaaac aattctgcag t 21</li><li><210> 109 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 109 aaacaattct gcagtacttt a 21</li><li><210> 110 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 110 aacaattctg cagtacttta a 21</li><li><210> 111 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 111 aattctgcag tactttaacc t 21</li><li><210> 112 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 112 aaccttgaac acagctcaag c 21</li><li><210> 113 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 113 aacacagctc aagcaaacca c 21</li><li><210> 114 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 114 aagcaaacca cactggcttc t 21</li><li><210> 115 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 115 aaaccacact ggcttctaca g 21</li><li><210> 116 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 116 aaccacactg gcttctacag c 21</li><li><210> 117 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 117 aaatatctag ctgtacctac t 21</li><li><210> 118 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 118 aatatctagc tgtacctact t 21</li><li><210> 119 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 119 aaagaagaag gaaacagaat c 21</li><li><210> 120 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 120 aagaagaagg aaacagaatc t 21</li><li><210> 121 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 121 aagaaggaaa cagaatctgc a 21</li><li><210> 122 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 122 aaggaaacag aatctgcaat c 21</li><li><210> 123 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 123 aaacagaatc tgcaatctat a 21</li><li><210> 124 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 124 aacagaatct gcaatctata t 21</li><li><210> 125 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 125 aatctgcaat ctatatattt a 21</li><li><210> 126 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 126 aatctatata tttattagtg a 21</li><li><210> 127 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 127 aaatccccga aattatacac a 21</li><li><210> 128 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 128 aatccccgaa attatacaca t 21</li><li><210> 129 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 129 aaattataca catgactgaa g 21</li><li><210> 130 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 130 aattatacac atgactgaag g 21</li><li><210> 131 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 131 aaggaaggga gctcgtcatt c 21</li><li><210> 132 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 132 aagggagctc gtcattccct g 21</li><li><210> 133 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 133 aacatcactg ttactttaaa a 21</li><li><210> 134 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 134 aaaaaagttt ccacttgaca c 21</li><li><210> 135 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 135 21 aaaaagtttc cacttgacac t 21</li><li><210> 136 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 136 aaaagtttcc acttgacact t 21</li><li><210> 137 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 137 aaagtttcca cttgacactt t 21</li><li><210> 138 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 138 aagtttccac ttgacacttt g 21</li><li><210> 139 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 139 aaaacgcata atctgggaca g 21</li><li><210> 140 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 140 aaacgcataa tctgggacag t 21</li><li><210> 141 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 141 aacgcataat ctgggacagt a 21</li><li><210> 142 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 142 aatctgggac agtagaaagg g 21</li><li><210> 143 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 143 aaagggcttc atcatatcaa a 21</li><li><210> 144 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 144 aagggcttca tcatatcaaa t 21</li><li><210> 145 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 145 aaatgcaacg tacaaagaaa t 21</li><li><210> 146 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 146 aatgcaacgt acaaagaaat a 21</li><li><210> 147 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li></ul><ul id="ul0007" list-style="none"><li><400> 147 21 aacgtacaaa gaaatagggc t 21</li><li><210> 148 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 148 21 aaagaaatag ggcttctgac c 21</li><li><210> 149 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 149 21 aagaaatagg gcttctgacc t 21</li><li><210> 150 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 150 21 aaatagggct tctgacctgt g 21</li><li><210> 151 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 151 21 aatagggctt ctgacctgtg a 21</li><li><210> 152 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 152 aagcaacagt caatgggcat t 21</li><li><210> 153 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 153 aacagtcaat gggcatttgt a 21</li><li><210> 154 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 154 aatgggcatt tgtataagac a 21</li><li><210> 155 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 155 aagacaaact atctcacaca t 21</li><li><210> 156 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 156 aaactatctc acacatcgac a 21</li><li><210> 157 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 157 aactatctca cacatcgaca a 21</li><li><210> 158 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 158 aaaccaatac aatcatagat g 21</li><li><210> 159 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 159 aaccaataca atcatagatg t 21</li><li><210> 160 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 160 aatacaatca tagatgtcca a 21</li><li><210> 161 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 161 aatcatagat gtccaaataa g 21</li><li><210> 162 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 162 aaataagcac accacgccca g 21</li><li><210> 163 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 163 aataagcaca ccacgcccag t 21</li><li><210> 164 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 164 aagcacacca cgcccagtca a 21</li><li><210> 165 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 165 aaattactta gaggccatac t 21</li><li><210> 166 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 166 aattacttag aggccatact c 21</li><li><210> 167 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 167 aattgtactg ctaccactcc c 21</li><li><210> 168 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 168 aacacgagag ttcaaatgac c 21</li><li><210> 169 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 169 aaatgacctg gagttaccct g 21</li><li><210> 170 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 170 aatgacctgg agttaccctg a 21</li><li><210> 171 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 171 aaaaaaataa gagagcttcc g 21</li><li><210> 172 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 172 aaaaaataag agagcttccg t 21</li><li><210> 173 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 173 aaaaataaga gagcttccgt a 21</li><li><210> 174 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 174 aaaataagag agcttccgta a 21</li><li><210> 175 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 175 aaataagaga gcttccgtaa g 21</li><li><210> 176 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 176 aataagagag cttccgtaag g 21</li><li><210> 177 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 177 aagagagctt ccgtaaggcg a 21</li><li><210> 178 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 178 aaggcgacga attgaccaaa g 21</li><li><210> 179 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 179 aattgaccaa agcaattccc a 21</li><li><210> 180 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 180 aaagcaattc ccatgccaac a 21</li><li><210> 181 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 181 aagcaattcc catgccaaca t 21</li><li><210> 182 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 182 aattcccatg ccaacatatt c 21</li><li><210> 183 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 183 aacatattct acagtgttct t 21</li><li><210> 184 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 184 aaaatgcaga acaaagacaa a 21</li><li><210> 185 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 185 aatgcagaac aaagacaaag g 21</li><li><210> 186 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 186 aacaaagaca aaggacttta t 21</li><li><210> 187 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 187 aaagacaaag gactttatac t 21</li><li><210> 188 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 188 aagacaaagg actttatact t 21</li><li><210> 189 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 189 aaaggacttt atacttgtcg t 21</li><li><210> 190 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 190 aaggacttta tacttgtcgt g 21</li><li><210> 191 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 191 aaggagtgga ccatcattca a 21</li><li><210> 192 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 192 aaatctgtta acacctcagt g 21</li><li><210> 193 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 193 aatctgttaa cacctcagtg c 21</li><li><210> 194 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 194 aacacctcag tgcatatata t 21</li><li><210> 195 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 195 aaagcattca tcactgtgaa a 21</li><li><210> 196 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 196 aagcattcat cactgtgaaa c 21</li><li><210> 197 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 197 aaacatcgaa aacagcaggt g 21</li><li><210> 198 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 198 aacatcgaaa acagcaggtg c 21</li><li><210> 199 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 199 aaaacagcag gtgcttgaaa c 21</li><li><210> 200 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 200 aaacagcagg tgcttgaaac c 21</li><li><210> 201 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 201 aacagcaggt gcttgaaacc g 21</li><li><210> 202 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 202 aaaccgtagc tggcaagcgg t 21</li><li><210> 203 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 203 aaccgtagct ggcaagcggt c 21</li><li><210> 204 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 204 aaccgtagct ggcaagcggt c 21</li><li><210> 205 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 205 aaagtgaagg catttccctc g 21</li><li><210> 206 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 206 aagtgaaggc atttccctcg c 21</li><li><210> 207 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 207 aaggcatttc cctcgccgga a 21</li><li><210> 208 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 208 aagttgtatg gttaaaagat g 21</li><li><210> 209 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 209 aaaagatggg ttacctgcga c 21</li><li><210> 210 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 210 aaagatgggt tacctgcgac t 21</li><li><210> 211 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 211 aagatgggtt acctgcgact g 21</li><li><210> 212 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 212 aaatctgctc gctatttgac t 21</li><li><210> 213 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 213 aatctgctcg ctatttgact c 21</li><li><210> 214 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 214 aattatcaag gacgtaactg a 21</li><li><210> 215 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 215 aaggacgtaa ctgaagagga t 21</li><li><210> 216 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 216 aactgaagag gatgcaggga a 21</li><li><210> 217 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 217 aagaggatgc agggaattat a 21</li><li><210> 218 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 218 aattatacaa tcttgctgag c 21</li><li><210> 219 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 219 aatcttgctg agcataaaac a 21</li><li><210> 220 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 220 aaaacagtca aatgtgttta a 21</li><li><210> 221 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 221 aaacagtcaa atgtgtttaa a 21</li><li><210> 222 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 222 aacagtcaaa tgtgtttaaa a 21</li><li><210> 223 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 223 aaatgtgttt aaaaacctca c 21</li><li><210> 224 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 224 aatgtgttta aaaacctcac t 21</li><li><210> 225 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 225 aaaaacctca ctgccactct a 21</li><li><210> 226 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 226 aaaacctcac tgccactcta a 21</li><li><210> 227 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 227 aaacctcact gccactctaa t 21</li><li><210> 228 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 228 aacctcactg ccactctaat t 21</li><li><210> 229 <211> 21 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0008" list-style="none"><li><220> <223> Targeting sequence</li><li><400> 229 aattgtcaat gtgaaacccc a 21</li><li><210> 230 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 230 aatgtgaaac cccagattta c 21</li><li><210> 231 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 231 aaaccccaga tttacgaaaa g 21</li><li><210> 232 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 232 aaccccagat ttacgaaaag g 21</li><li><210> 233 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 233 aaaaggccgt gtcatcgttt c 21</li><li><210> 234 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 234 aaaggccgtg tcatcgtttc c 21</li><li><210> 235 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 235 aaggccgtgt catcgtttcc a 21</li><li><210> 236 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 236 aaatcctgac ttgtaccgca t 21</li><li><210> 237 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 237 aatcctgact tgtaccgcat a 21</li><li><210> 238 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 238 aacctacaat caagtggttc t 21</li><li><210> 239 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 239 aatcaagtgg ttctggcacc c 21</li><li><210> 240 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 240 aagtggttct ggcacccctg t 21</li><li><210> 241 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 241 aaccataatc attccgaagc a 21</li><li><210> 242 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 242 aatcattccg aagcaaggtg t 21</li><li><210> 243 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 243 aagcaaggtg tgacttttgt t 21</li><li><210> 244 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 244 aaggtgtgac ttttgttcca a 21</li><li><210> 245 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 245 aataatgaag agtcctttat c 21</li><li><210> 246 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 246 aatgaagagt cctttatcct g 21</li><li><210> 247 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 247 aagagtcctt tatcctggat g 21</li><li><210> 248 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 248 aacatgggaa acagaattga g 21</li><li><210> 249 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 249 aaacagaatt gagagcatca c 21</li><li><210> 250 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 250 aacagaattg agagcatcac t 21</li><li><210> 251 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 251 aattgagagc atcactcagc g 21</li><li><210> 252 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 252 aataatagaa ggaaagaata a 21</li><li><210> 253 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 253 aatagaagga aagaataaga t 21</li><li><210> 254 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 254 aaggaaagaa taagatggct a 21</li><li><210> 255 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 255 aaagaataag atggctagca c 21</li><li><210> 256 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 256 aagaataaga tggctagcac c 21</li><li><210> 257 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 257 aataagatgg ctagcacctt g 21</li><li><210> 258 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 258 aagatggcta gcaccttggt t 21</li><li><210> 259 <211> 21 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0009" list-style="none"><li><220> <223> Targeting sequence</li><li><400> 259 aatttctgga atctacattt g 21</li><li><210> 260 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 260 aatctacatt tgcatagctt c 21</li><li><210> 261 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 261 aataaagttg ggactgtggg a 21</li><li><210> 262 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 262 aaagttggga ctgtgggaag a 21</li><li><210> 263 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 263 aagttgggac tgtgggaaga a 21</li><li><210> 264 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 264 aagaaacata agcttttata t 21</li><li><210> 265 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 265 aaacataagc ttttatatca c 21</li><li><210> 266 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 266 aacataagct tttatatcac a 21</li><li><210> 267 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 267 aagcttttat atcacagatg t 21</li><li><210> 268 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 268 aaatgggttt catgttaact t 21</li><li><210> 269 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 269 aatgggtttc atgttaactt g 21</li><li><210> 270 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 270 aacttggaaa aaatgccgac g 21</li><li><210> 271 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 271 aaaaaatgcc gacggaagga g 21</li><li><210> 272 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 272 aaaaatgccg acggaaggag a 21</li><li><210> 273 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 273 aaaatgccga cggaaggaga g 21</li><li><210> 274 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 274 aaatgccgac ggaaggagag g 21</li><li><210> 275 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 275 aatgccgacg gaaggagagg a 21</li><li><210> 276 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 276 aaggagagga cctgaaactg t 21</li><li><210> 277 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 277 aaactgtctt gcacagttaa c 21</li><li><210> 278 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 278 aactgtcttg cacagttaac a 21</li><li><210> 279 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 279 aacaagttct tatacagaga c 21</li><li><210> 280 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 280 aagttcttat acagagacgt t 21</li><li><210> 281 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 281 aataacagaa caatgcacta c 21</li><li><210> 282 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 282 aacagaacaa tgcactacag t 21</li><li><210> 283 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 283 aacaatgcac tacagtatta g 21</li><li><210> 284 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 284 aatgcactac agtattagca a 21</li><li><210> 285 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 285 aagcaaaaaa tggccatcac t 21</li><li><210> 286 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 286 aaaaaatggc catcactaag g 21</li><li><210> 287 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 287 aaaaatggcc atcactaagg a 21</li><li><210> 288 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 288 aaaatggcca tcactaagga g 21</li><li><210> 289 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 289 aaatggccat cactaaggag c 21</li><li><210> 290 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 290 aatggccatc actaaggagc a 21</li><li><210> 291 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 291 aaggagcact ccatcactct t 21</li><li><210> 292 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 292 aatcttacca tcatgaatgt t 21</li><li><210> 293 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 293 aatgtttccc tgcaagattc a 21</li><li><210> 294 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 294 aagattcagg cacctatgcc t 21</li><li><210> 295 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 295 aatgtataca caggggaaga a 21</li><li><210> 296 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 296 aagaaatcct ccagaagaaa g 21</li><li><210> 297 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 297 aaatcctcca gaagaaagaa a 21</li><li><210> 298 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 298 aatcctccag aagaaagaaa t 21</li><li><210> 299 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 299 aagaaagaaa ttacaatcag a 21</li><li><210> 300 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 300 aaagaaatta caatcagaga t 21</li><li><210> 301 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 301 aagaaattac aatcagagat c 21</li><li><210> 302 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 302 aaattacaat cagagatcag g 21</li><li><210> 303 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 303 aattacaatc agagatcagg a 21</li><li><210> 304 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 304 aatcagagat caggaagcac c 21</li><li><210> 305 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 305 aagcaccata cctcctgcga a 21</li><li><210> 306 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 306 aaacctcagt gatcacacag t 21</li><li><210> 307 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 307 aacctcagtg atcacacagt 20</li><li><210> 308 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 308 aatggtgtcc ccgagcctca g 21</li><li><210> 309 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 309 aaaaacaacc acaaaataca a 21</li><li><210> 310 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 310 aaaacaacca caaaatacaa c 21</li><li><210> 311 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 311 aaacaaccac aaaatacaac a 21</li><li><210> 312 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 312 aacaaccaca aaatacaaca a 21</li><li><210> 313 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 313 aaccacaaaa tacaacaaga g 21</li><li><210> 314 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 314 aaaatacaac aagagcctgg a 21</li><li><210> 315 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 315 aaatacaaca agagcctgga a 21</li><li><210> 316 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 316 aatacaacaa gagcctggaa t 21</li><li><210> 317 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 317 aacaagagcc tggaattatt t 21</li><li><210> 318 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 318 aagagcctgg aattatttta g 21</li><li><210> 319 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 319 aattatttta ggaccaggaa g 21</li><li><210> 320 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 320 aagcagcacg ctgtttattg a 21</li><li><210> 321 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 321 aaagagtcac agaagaggat g 21</li><li><210> 322 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 322 aagagtcaca gaagaggatg a 21</li><li><210> 323 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 323 aagaggatga aggtgtctat c 21</li><li><210> 324 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 324 aaggtgtcta tcactgcaaa g 21</li><li><210> 325 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 325 aaagccacca accagaaggg c 21</li><li><210> 326 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 326 aagccaccaa ccagaagggc t 21</li><li><210> 327 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 327 aaccagaagg gctctgtgga a 21</li><li><210> 328 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 328 aagggctctg tggaaagttc a 21</li><li><210> 329 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 329 aaagttcagc atacctcact g 21</li><li><210> 330 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 330 aagttcagca tacctcactg t 21</li><li><210> 331 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 331 aaggaacctc ggacaagtct a 21</li><li><210> 332 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 332 aacctcggac aagtctaatc t 21</li><li><210> 333 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 333 aagtctaatc tggagctgat c 21</li><li><210> 334 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 334 aatctggagc tgatcactct a 21</li><li><210> 335 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 335 aacatgcacc tgtgtggctg c 21</li><li><210> 336 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 336 aaccctcttt atccgaaaaa t 21</li><li><210> 337 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 337 aaaaatgaaa aggtcttctt c 21</li><li><210> 338 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 338 aaaatgaaaa ggtcttcttc t 21</li><li><210> 339 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 339 aaatgaaaag gtcttcttct g 21</li><li><210> 340 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 340 aatgaaaagg tcttcttctg a 21</li><li><210> 341 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 341 aaaaggtctt cttctgaaat a 21</li><li><210> 342 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 342 aaaggtcttc ttctgaaata a 21</li><li><210> 343 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 343 aaggtcttct tctgaaataa a 21</li><li><210> 344 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 344 aaataaagac tgactaccta t 21</li><li><210> 345 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 345 aataaagact gactacctat c 21</li><li><210> 346 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 346 aaagactgac tacctatcaa t 21</li><li><210> 347 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 347 aagactgact acctatcaat t 21</li><li><210> 348 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 348 aattataatg gacccagatg a 21</li><li><210> 349 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 349 aatggaccca gatgaagttc c 21</li><li><210> 350 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 350 aagttccttt ggatgagcag t 21</li><li><210> 351 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 351 aagtgggagt ttgcccggga g 21</li><li><210> 352 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 352 aaactgggca aatcacttgg a 21</li><li><210> 353 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 353 aactgggcaa atcacttgga a 21</li><li><210> 354 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 354 aaatcacttg gaagaggggc t 21</li><li><210> 355 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 355 aatcacttgg aagaggggct t 21</li><li><210> 356 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 356 aagaggggct tttggaaaag t 21</li><li><210> 357 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence <400> 357 aaaagtggtt caagcatcag c 21</li><li><210> 358 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 358 aaagtggttc aagcatcagc a 21</li><li><210> 359 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 359 aagtggttca agcatcagca t 21</li><li><210> 360 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 360 aagcatcagc atttggcatt a 21</li><li><210> 361 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 361 aagaaatcac ctacgtgccg g 21</li><li><210> 362 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 362 aaatcaccta cgtgccggac t 21</li><li><210> 363 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 363 aatcacctac gtgccggact g 21</li><li><210> 364 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 364 aaaatgctga aagagggggc c 21</li><li><210> 365 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 365 aaatgctgaa agagggggcc a 21</li><li><210> 366 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 366 aatgctgaaa gagggggcca c 21</li><li><210> 367 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 367 aaagaggggg ccacggccag c 21</li><li><210> 368 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 368 aagagggggc cacggccagc g 21</li><li><210> 369 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li></ul><ul id="ul0010" list-style="none"><li><400> 369 aaagctctga tgactgagct a 21</li><li><210> 370 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 370 aagctctgat gactgagcta a 21</li><li><210> 371 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 371 aaaaatcttg acccacattg g 21</li><li><210> 372 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 372 aaaatcttga cccacattgg c 21</li><li><210> 373 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 373 aaatcttgac ccacattggc c 21</li><li><210> 374 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 374 aatcttgacc cacattggcc a 21</li><li><210> 375 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 375 aacgtggtta acctgctggg a 21</li><li><210> 376 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 376 aacctgctgg gagcctgcac c 21</li><li><210> 377 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 377 aagcaaggag ggcctctgat g 21</li><li><210> 378 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 378 aaggagggcc tctgatggtg a 21</li><li><210> 379 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 379 aatactgcaa atatggaaat c 21 <210> 380 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 380 aaatatggaa atctctccaa c 21</li><li><210> 381 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 381 aatatggaaa tctctccaac t 21</li><li><210> 382 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 382 aaatctctcc aactacctca a 21</li><li><210> 383 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 383 aatctctcca actacctcaa g 21</li><li><210> 384 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 384 aactacctca agagcaaacg t 21</li><li><210> 385 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 385 aagagcaaac gtgacttatt t 21</li><li><210> 386 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 386 aaacgtgact tattttttct c 21</li><li><210> 387 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 387 aacgtgactt attttttctc a 21</li><li><210> 388 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 388 aacaaggatg cagcactaca c 21</li><li><210> 389 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 389 aaggatgcag cactacacat g 21</li><li><210> 390 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 390 aagaaagaaa aaatggagcc a 21</li><li><210> 391 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 391 aaagaaaaaa tggagccagg c 21</li><li><210> 392 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 392 aagaaaaaat ggagccaggc c 21</li><li><210> 393 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 393 aaaaaatgga gccaggcctg g 21</li><li><210> 394 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 394 aaaaatggag ccaggcctgg a 21</li><li><210> 395 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 395 aaaatggagc caggcctgga a 21</li><li><210> 396 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 396 aaatggagcc aggcctggaa c 21</li><li><210> 397 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 397 aatggagcca ggcctggaac a 21</li><li><210> 398 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 398 aacaaggcaa gaaaccaaga c 21</li><li><210> 399 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 399 aaggcaagaa accaagacta g 21</li><li><210> 400 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 400 aagaaaccaa gactagatag c 21</li><li><210> 401 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 401 aaaccaagac tagatagcgt c 21</li><li><210> 402 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 402 aaccaagact agatagcgtc a 21</li><li><210> 403 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 403 aagactagat agcgtcacca g 21</li><li><210> 404 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 404 aaagctttgc gagctccggc t 21</li><li><210> 405 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 405 aagctttgcg agctccggct 20</li><li><210> 406 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 406 aagataaaag tctgagtgat g 21</li><li><210> 407 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 407 aaaagtctga gtgatgttga g 21</li><li><210> 408 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 408 aaagtctgag tgatgttgag g 21</li><li><210> 409 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 409 aagtctgagt gatgttgagg a 21</li><li><210> 410 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 410 aagaggagga ttctgacggt t 21</li><li><210> 411 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 411 aaggagccca tcactatgga a 21</li><li><210> 412 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 412 aagatctgat ttcttacagt t 21</li><li><210> 413 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 413 aagtggccag aggcatggag t 21</li><li><210> 414 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 414 aaagtgcatt catcgggacc t 21</li><li><210> 415 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 415 aagtgcattc atcgggacct g 21</li><li><210> 416 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 416 aaacattctt ttatctgaga a 21</li><li><210> 417 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 417 aacattcttt tatctgagaa c 21</li><li><210> 418 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence <400> 418 aacaacgtgg tgaagatttg t 21</li><li><210> 419 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 419 aacgtggtga agatttgtga t 21</li><li><210> 420 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 420 aagatttgtg attttggcct t 21</li><li><210> 421 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 421 aagaaccccg attatgtgag a 21</li><li><210> 422 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 422 aaccccgatt atgtgagaaa a 21</li><li><210> 423 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 423 aaaaggagat actcgacttc c 21</li><li><210> 424 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 424 aaaggagata ctcgacttcc t 21</li><li><210> 425 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 425 aaggagatac tcgacttcct c 21</li><li><210> 426 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 426 aaatggatgg ctcctgaatc t 21</li><li><210> 427 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 427 aatggatggc tcctgaatct a 21</li><li><210> 428 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 428 aatctatctt tgacaaaatc t 21</li><li><210> 429 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 429 aaaatctaca gcaccaagag c 21</li><li><210> 430 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 430 aaatctacag caccaagagc g 21</li><li><210> 431 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 431 aatctacagc accaagagcg a 21</li><li><210> 432 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 432 aagagcgacg tgtggtctta c 21</li><li><210> 433 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 433 aaatcttctc cttaggtggg t 21</li><li><210> 434 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li></ul><ul id="ul0011" list-style="none"><li><400> 434 aatcttctcc ttaggtgggt c 21</li><li><210> 435 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 435 aaatggatga ggacttttgc a 21</li><li><210> 436 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 436 aatggatgag gacttttgca g 21</li><li><210> 437 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 437 aaggcatgag gatgagagct c 21</li><li><210> 438 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 438 aaatctatca gatcatgctg g 21</li><li><210> 439 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 439 aatctatcag atcatgctgg a 21</li><li><210> 440 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 440 aaaagaaagg ccaagatttg c 21</li><li><210> 441 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 441 aaagaaaggc caagatttgc a 21</li><li><210> 442 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 442 aagaaaggcc aagatttgca g 21</li><li><210> 443 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 443 aaaggccaag atttgcagaa c 21</li><li><210> 444 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 444 aaggccaaga tttgcagaac t 21</li><li><210> 445 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 445 aagatttgca gaacttgtgg a 21</li><li><210> 446 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 446 aacttgtgga aaaactaggt g 21</li><li><210> 447 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 447 aaaaactagg tgatttgctt c 21</li><li><210> 448 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 448 aaaactaggt gatttgcttc a 21</li><li><210> 449 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 449 aaactaggtg atttgcttca a 21</li><li><210> 450 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 450 aactaggtga tttgcttcaa g 21</li><li><210> 451 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 451 aagcaaatgt acaacaggat g 21</li><li><210> 452 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 452 aaatgtacaa caggatggta a 21</li><li><210> 453 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 453 aatgtacaac aggatggtaa a 21</li><li><210> 454 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 454 aacaggatgg taaagactac a 21</li><li><210> 455 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 455 aaagactaca tcccaatcaa t 21</li><li><210> 456 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 456 aagactacat cccaatcaat g 21</li><li><210> 457 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 457 aatcaatgcc atactgacag g 21</li><li><210> 458 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 458 aatgccatac tgacaggaaa t 21</li><li><210> 459 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 459 aaatagtggg tttacatact c 21</li><li><210> 460 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 460 aatagtgggt ttacatactc a 21</li><li><210> 461 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 461 aactcctgcc ttctctgagg a 21</li><li><210> 462 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 462 aaggaaagta tttcagctcc g 21</li><li><210> 463 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 463 aaagtatttc agctccgaag t 21</li><li><210> 464 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 464 aagtatttca gctccgaagt t 21</li><li><210> 465 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 465 aagtttaatt caggaagctc t 21</li><li><210> 466 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 466 aattcaggaa gctctgatga t 21</li><li><210> 467 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 467 aagctctgat gatgtcagat a 21</li><li><210> 468 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 468 aaatgctttc aagttcatga g 21</li><li><210> 469 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 469 aatgctttca agttcatgag c 21</li><li><210> 470 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 470 aagttcatga gcctggaaag a 21</li><li><210> 471 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 471 aaagaatcaa aacctttgaa g 21</li><li><210> 472 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 472 aagaatcaaa acctttgaag a 21</li><li><210> 473 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 473 aatcaaaacc tttgaagaac t 21</li><li><210> 474 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 474 aaaacctttg aagaactttt a 21</li><li><210> 475 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 475 aaacctttga agaactttta c 21</li><li><210> 476 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 476 aacctttgaa gaacttttac c 21</li><li><210> 477 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 477 aagaactttt accgaatgcc a 21</li><li><210> 478 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 478 aacttttacc gaatgccacc t 21</li><li><210> 479 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence <400> 479 aatgccacct ccatgtttga t 21</li><li><210> 480 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 480 aaacccaagg cctcgctcaa g 21</li></ul><ul id="ul0012" list-style="none"><li><210> 481 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 481 aaacccaagg cctcgctcaa g 21</li><li><210> 482 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 482 aacccaaggc ctcgctcaag a 21</li><li><210> 483 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 483 aaggcctcgc tcaagattga c 21</li><li><210> 484 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 484 aagattgact tgagagtaac c 21</li><li><210> 485 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 485 aaccagtaaa agtaaggagt c 21</li><li><210> 486 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 486 aaaagtaagg agtcggggct g 21</li><li><210> 487 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 487 aaagtaagga gtcggggctg t 21</li><li><210> 488 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 488 aagtaaggag tcggggctgt c 21</li><li><210> 489 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 489 aaggagtcgg ggctgtctga t 21</li><li><210> 490 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 490 aaggcaagcg caggttcacc t 21</li><li><210> 491 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 491 gcacccagca catcatgcaa g 21</li><li><210> 492 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 492 ggctgagcat aactaaatct g 21</li><li><210> 493 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 493 gcttctacag ctgcaaatat c 21</li><li><210> 494 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 494 gagctcgtca ttccctgccg g 21</li><li><210> 495 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 495 ccaaagcaat tcccatgcca a 21</li><li><210> 496 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 496 tgctgagcat aaaacagtca a 21</li><li><210> 497 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 497 ttgcatagct tccaataaag t 21</li><li><210> 498 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 498 agtgatcaca cagtggccat c 21</li><li><210> 499 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 499 gatgaagttc ctttggatga g 21</li><li><210> 500 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 500 tacacatgga gcctaagaaa g 21</li><li><210> 501 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 501 gagctccggc tttcaggaag a 21</li><li><210> 502 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 502 tctacagcac caagagcgac g 21</li><li><210> 503 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 503 tctgatgatg tcagatatgt a 21</li><li><210> 504 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 504 gcctcgctca agattgactt g 21</li><li><210> 505 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 505 aaaaagacat acttacaatt a 21</li><li><210> 506 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 506 aaaagacata cttacaatta a 21</li><li><210> 507 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 507 aaagacatac ttacaattaa g 21</li><li><210> 508 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 508 aagacatact tacaattaag g 21</li><li><210> 509 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 509 aattaaggct aatacaactc t 21</li><li><210> 510 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 510 aaggctaata caactcttca a 21</li><li><210> 511 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 511 aatacaactc ttcaaattac t 21</li><li><210> 512 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 512 aactcttcaa attacttgca g 21</li><li><210> 513 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 513 aaattacttg caggggacag a 21</li><li><210> 514 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 514 aattacttgc aggggacaga g 21</li><li><210> 515 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 515 aataatcaga gtggcagtga g 21</li><li><210> 516 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 516 aatcagagtg gcagtgagca a 21</li><li><210> 517 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 517 aaagggtgga ggtgactgag t 21</li><li><210> 518 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 518 aagggtggag gtgactgagt g 21</li><li><210> 519 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 519 aagacactca caattccaaa a 21</li><li><210> 520 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 520 aattccaaaa gtgatcggaa a 21</li><li><210> 521 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 521 aaaagtgatc ggaaatgaca c 21</li><li><210> 522 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 522 aaagtgatcg gaaatgacac t 21</li><li><210> 523 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 523 aagtgatcgg aaatgacact g 21</li><li><210> 524 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 524 aaatgacact ggagcctaca a 21</li><li><210> 525 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 525 aatgacactg gagcctacaa g 21</li><li><210> 526 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 526 aagtgcttct accgggaaac t 21</li><li><210> 527 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 527 aaactgactt ggcctcggtc a 21</li><li><210> 528 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 528 aactgacttg gcctcggtca t 21</li><li><210> 529 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence <400> 529 aagattacag atctccattt a 21</li><li><210> 530 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 530 aacatggagt cgtgtacatt a 21</li><li><210> 531 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 531 aacaaaaaca aaactgtggt g 21</li><li><210> 532 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 532 aaaaacaaaa ctgtggtgat t 21</li><li><210> 533 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 533 aaaacaaaac tgtggtgatt c 21</li><li><210> 534 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 534 aaacaaaact gtggtgattc c 21</li><li><210> 535 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 535 aacaaaactg tggtgattcc a 21</li><li><210> 536 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 536 aaaactgtgg tgattccatg t 21</li><li><210> 537 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 537 aaactgtggt gattccatgt c 21</li><li><210> 538 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 538 aactgtggtg attccatgtc t 21</li><li><210> 539 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 539 aaatctcaac gtgtcacttt g 21</li><li><210> 540 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence <400> 540 aatctcaacg tgtcactttg t 21</li><li><210> 541 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 541 aacgtgtcac tttgtgcaag a 21</li><li><210> 542 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 542 aagataccca gaaaagagat t 21</li><li><210> 543 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 543 aaaagagatt tgttcctgat g 21</li><li><210> 544 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 544 aaagagattt gttcctgatg g 21</li><li><210> 545 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 545 aagagatttg ttcctgatgg t 21</li><li><210> 546 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 546 aacagaattt cctgggacag c 21</li><li><210> 547 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 547 aatttcctgg gacagcaaga a 21</li><li><210> 548 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 548 aagaagggct ttactattcc c 21</li><li><210> 549 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 549 aagggcttta ctattcccag c 21</li><li><210> 550 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 550 aagcaaaaat taatgatgaa a 21</li><li><210> 551 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 551 aaaaattaat gatgaaagtt a 21</li><li><210> 552 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 552 aaaattaatg atgaaagtta c 21</li><li><210> 553 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 553 aaattaatga tgaaagttac c 21</li><li><210> 554 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 554 aattaatgat gaaagttacc a 21</li><li><210> 555 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 555 aatgatgaaa gttaccagtc t 21</li><li><210> 556 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 556 aaagttacca gtctattatg t 21</li><li><210> 557 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 557 aagttaccag tctattatgt a 21</li><li><210> 558 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 558 aattgaacta tctgttggag a 21</li><li><210> 559 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 559 aactatctgt tggagaaaag c 21</li><li><210> 560 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 560 aaaagcttgt cttaaattgt a 21</li><li><210> 561 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 561 aaagcttgtc ttaaattgta c 21</li><li><210> 562 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 562 aagcttgtct taaattgtac a 21</li><li><210> 563 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li></ul><ul id="ul0013" list-style="none"><li><400> 563 aaattgtaca gcaagaactg a 21</li><li><210> 564 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 564 aattgtacag caagaactga a 21</li><li><210> 565 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 565 aagaactgaa ctaaatgtgg g 21</li><li><210> 566 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 566 aactgaacta aatgtgggga t 21</li><li><210> 567 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 567 aactaaatgt ggggattgac t 21</li><li><210> 568 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 568 aaatgtgggg attgacttca a 21</li><li><210> 569 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 569 aatgtgggga ttgacttcaa c 21</li><li><210> 570 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 570 aactgggaat acccttcttc g 21</li><li><210> 571 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 571 aatacccttc ttcgaagcat c 21</li><li><210> 572 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 572 aagcatcagc ataagaaact t 21</li><li><210> 573 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 573 aagaaacttg taaaccgaga c 21</li><li><210> 574 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 574 aaacttgtaa accgagacct a 21</li><li><210> 575 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 575 aacttgtaaa ccgagaccta a 21</li><li><210> 576 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 576 aaaccgagac ctaaaaaccc a 21</li><li><210> 577 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 577 aaccgagacc taaaaaccca g 21</li><li><210> 578 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 578 aaaaacccag tctgggagtg a 21</li><li><210> 579 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 579 aaaacccagt ctgggagtga g 21</li><li><210> 580 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 580 aaacccagtc tgggagtgag a 21</li><li><210> 581 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 581 aacccagtct gggagtgaga t 21</li><li><210> 582 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 582 aagaaatttt tgagcacctt a 21</li><li><210> 583 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 583 aaatttttga gcaccttaac t 21</li><li><210> 584 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 584 aatttttgag caccttaact a 21</li><li><210> 585 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 585 aactatagat ggtgtaaccc g 21</li><li><210> 586 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 586 aacccggagt gaccaaggat t 21</li><li><210> 587 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 587 aaggattgta cacctgtgca g 21</li><li><210> 588 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 588 aagaagaaca gcacatttgt c 21</li><li><210> 589 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 589 aagaacagca catttgtcag g 21</li><li><210> 590 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 590 aacagcacat ttgtcagggt c 21</li><li><210> 591 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li></ul><ul id="ul0014" list-style="none"><li><400> 591 aaaaaccttt tgttgctttt g 21</li><li><210> 592 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 592 aaaacctttt gttgcttttg g 21</li><li><210> 593 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 593 aaaccttttg ttgcttttgg a 21</li><li><210> 594 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 594 aaccttttgt tgcttttgga a 21</li><li><210> 595 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 595 aagtggcatg gaatctctgg t 21</li><li><210> 596 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 596 aatctctggt ggaagccacg g 21</li><li><210> 597 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 597 aagccacggt gggggagcgt g 21</li><li><210> 598 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 598 aatccctgcg aagtaccttg g 21</li><li><210> 599 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 599 aagtaccttg gttacccacc c 21</li><li><210> 600 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 600 aaataaaatg gtataaaaat g 21</li><li><210> 601 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 601 aataaaatgg tataaaaatg g 21</li><li><210> 602 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 602 aaaatggtat aaaaatggaa t 21</li><li><210> 603 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 603 aaatggtata aaaatggaat a 21</li><li><210> 604 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 604 aatggtataa aaatggaata c 21</li><li><210> 605 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 605 aaaaatggaa taccccttga g 21</li><li><210> 606 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 606 aaaatggaat accccttgag t 21</li><li><210> 607 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 607 aaatggaata ccccttgagt c 21</li><li><210> 608 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 608 aatggaatac cccttgagtc c 21</li><li><210> 609 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 609 aatacccctt gagtccaatc a 21</li><li><210> 610 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 610 aatcacacaa ttaaagcggg g 21</li><li><210> 611 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 611 aattaaagcg gggcatgtac t 21</li><li><210> 612 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 612 aaagcggggc atgtactgac g 21</li><li><210> 613 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 613 aagcggggca tgtactgacg a 21</li><li><210> 614 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 614 aagtgagtga aagagacaca g 21</li><li><210> 615 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 615 aaagagacac aggaaattac a 21</li><li><210> 616 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 616 aagagacaca ggaaattaca c 21</li><li><210> 617 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 617 aaattacact gtcatcctta c 21</li><li><210> 618 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 618 aattacactg tcatccttac c 21</li><li><210> 619 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 619 aatcccattt caaaggagaa g 21</li><li><210> 620 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 620 aaaggagaag cagagccatg t 21</li><li><210> 621 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 621 aaggagaagc agagccatgt g 21</li><li><210> 622 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 622 aagcagagcc atgtggtctc t 21</li><li><210> 623 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 623 aaatctctaa tctctcctgt g 21</li><li><210> 624 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li></ul><ul id="ul0015" list-style="none"><li><400> 624 aatctctaat ctctcctgtg g 21</li><li><210> 625 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 625 aatctctcct gtggattcct a 21</li><li><210> 626 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 626 aaacgctgac atgtacggtc t 21</li><li><210> 627 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 627 aacgctgaca tgtacggtct a 21</li><li><210> 628 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 628 aagagtgcgc caacgagccc a 21</li><li><210> 629 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 629 aacgagccca gccaagctgt c 21</li><li><210> 630 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 630 aagctgtctc agtgacaaac c 21</li><li><210> 631 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 631 aaacccatac ccttgtgaag a 21</li><li><210> 632 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 632 aacccatacc cttgtgaaga a 21</li><li><210> 633 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 633 aagaatggag aagtgtggag g 21</li><li><210> 634 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 634 aatggagaag tgtggaggac t 21</li><li><210> 635 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 635 aagtgtggag gacttccagg g 21</li><li><210> 636 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 636 aaataaaatt gaagttaata a 21</li><li><210> 637 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 637 aataaaattg aagttaataa a 21</li><li><210> 638 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 638 aaaattgaag ttaataaaaa t 21</li><li><210> 639 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 639 aaattgaagt taataaaaat c 21</li><li><210> 640 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 640 aattgaagtt aataaaaatc a 21</li><li><210> 641 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 641 aagttaataa aaatcaattt g 21</li><li><210> 642 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 642 aataaaaatc aatttgctct a 21</li><li><210> 643 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 643 aaaaatcaat ttgctctaat t 21</li><li><210> 644 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 644 aaaatcaatt tgctctaatt g 21</li><li><210> 645 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 645 aaatcaattt gctctaattg a 21</li><li><210> 646 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 646 aatcaatttg ctctaattga a 21</li><li><210> 647 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 647 aatttgctct aattgaagga a 21</li><li><210> 648 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 648 aattgaagga aaaaacaaaa c 21</li><li><210> 649 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 649 aaggaaaaaa caaaactgta a 21</li><li><210> 650 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 650 aaaaaacaaa actgtaagta c 21</li><li><210> 651 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 651 aaaaacaaaa ctgtaagtac c 21</li><li><210> 652 <211> 21 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0016" list-style="none"><li><220> <223> Targeting sequence</li><li><400> 652 aaaacaaaac tgtaagtacc c 21</li><li><210> 653 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 653 aaacaaaact gtaagtaccc t 21</li><li><210> 654 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 654 aacaaaactg taagtaccct t 21</li><li><210> 655 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 655 aaaactgtaa gtacccttgt t 21</li><li><210> 656 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 656 aaactgtaag tacccttgtt a 21</li><li><210> 657 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 657 aactgtaagt acccttgtta t 21</li><li><210> 658 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 658 aagtaccctt gttatccaag c 21</li><li><210> 659 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 659 aagcggcaaa tgtgtcagct t 21</li><li><210> 660 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 660 aaatgtgtca gctttgtaca a 21</li><li><210> 661 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 661 aatgtgtcag ctttgtacaa a 21</li><li><210> 662 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 662 aaatgtgaag cggtcaacaa a 21</li><li><210> 663 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 663 aatgtgaagc ggtcaacaaa g 21</li><li><210> 664 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 664 aagcggtcaa caaagtcggg a 21</li><li><210> 665 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 665 aacaaagtcg ggagaggaga g 21</li><li><210> 666 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 666 aaagtcggga gaggagagag g 21</li><li><210> 667 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 667 aagtcgggag aggagagagg g 21</li><li><210> 668 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 668 aaattacttt gcaacctgac a 21</li><li><210> 669 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 669 aattactttg caacctgaca t 21</li><li><210> 670 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 670 aacctgacat gcagcccact g 21</li><li><210> 671 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 671 aacctcacat ggtacaagct t 21</li><li><210> 672 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 672 aagcttggcc cacagcctct g 21</li><li><210> 673 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 673 aatccatgtg ggagagttgc c 21</li><li><210> 674 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 674 aagaacttgg atactctttg g 21</li><li><210> 675 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 675 aacttggata ctctttggaa a 21</li><li><210> 676 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 676 aaattgaatg ccaccatgtt c 21</li><li><210> 677 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 677 aattgaatgc caccatgttc t 21</li><li><210> 678 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 678 aatgccacca tgttctctaa t 21</li><li><210> 679 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 679 aatagcacaa atgacatttt g 21</li><li><210> 680 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 680 aaatgacatt ttgatcatgg a 21</li><li><210> 681 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 681 aatgacattt tgatcatgga g 21</li><li><210> 682 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 682 aagaatgcat ccttgcagga c 21</li><li><210> 683 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 683 aatgcatcct tgcaggacca a 21</li><li><210> 684 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 684 aaggagacta tgtctgcctt g 21</li><li><210> 685 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 685 aagacaggaa gaccaagaaa a 21</li><li><210> 686 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 686 aagaccaaga aaagacattg c 21</li><li><210> 687 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 687 aagaaaagac attgcgtggt c 21</li><li><210> 688 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 688 aaaagacatt gcgtggtcag g 21</li><li><210> 689 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 689 aaagacattg cgtggtcagg c 21</li><li><210> 690 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 690 aagacattgc gtggtcaggc a 21</li><li><210> 691 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 691 21 aaacctggag aatcagacga c 21</li><li><210> 692 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 692 aacctggaga atcagacgac a 21</li><li><210> 693 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 693 aatcagacga caagtattgg g 21</li><li><210> 694 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 694 aagtattggg gaaagcatcg a 21</li><li><210> 695 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 695 aaagcatcga agtctcatgc a 21</li><li><210> 696 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 696 aagcatcgaa gtctcatgca c 21</li><li><210> 697 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 697 aatccccctc cacagatcat g 21</li><li><210> 698 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 698 aaagataatg agacccttgt a 21</li><li><210> 699 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 699 aagataatga gacccttgta g 21</li><li><210> 700 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 700 aatgagaccc ttgtagaaga c 21</li><li><210> 701 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 701 aagactcagg cattgtattg a 21</li><li><210> 702 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 702 aaggatggga accggaacct c 21</li><li><210> 703 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 703 aaccggaacc tcactatccg c 21</li></ul><ul id="ul0017" list-style="none"><li><210> 704 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 704 aacctcacta tccgcagagt g 21</li><li><210> 705 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 705 aaggaggacg aaggcctcta c 21</li><li><210> 706 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 706 aaggcctcta cacctgccag g 21</li><li><210> 707 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 707 aaaagtggag gcatttttca t 21</li><li><210> 708 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 708 aaagtggagg catttttcat a 21</li><li><210> 709 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 709 aagtggaggc atttttcata a 21</li><li><210> 710 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 710 aatagaaggt gcccaggaaa a 21</li><li><210> 711 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 711 aaggtgccca ggaaaagacg a 21</li><li><210> 712 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 712 aaaagacgaa cttggaaatc a 21</li><li><210> 713 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 713 aaagacgaac ttggaaatca t 21</li><li><210> 714 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 714 aagacgaact tggaaatcat t 21</li><li><210> 715 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 715 aacttggaaa tcattattct a 21</li><li><210> 716 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 716 aaatcattat tctagtaggc a 21</li><li><210> 717 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 717 aatcattatt ctagtaggca c 21</li><li><210> 718 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 718 aagcgggcca atggagggga a 21</li><li><210> 719 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 719 aatggagggg aactgaagac a 21</li><li><210> 720 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 720 aactgaagac aggctacttg t 21</li><li><210> 721 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 721 aagacaggct acttgtccat c 21</li><li><210> 722 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 722 aactcccatt ggatgaacat t 21</li><li><210> 723 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 723 aacattgtga acgactgcct t 21</li><li><210> 724 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 724 aacgactgcc ttatgatgcc a 21</li><li><210> 725 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 725 aaatgggaat tccccagaga c 21</li><li><210> 726 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 726 aatgggaatt ccccagagac c 21</li><li><210> 727 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 727 aattccccag agaccggctg a 21</li><li><210> 728 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 728 aagctaggta agcctcttgg c 21</li><li><210> 729 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 729 aagcctcttg gccgtggtgc c 21</li><li><210> 730 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 730 aagtgattga agcagatgcc t 21</li><li><210> 731 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 731 aagcagatgc ctttggaatt g 21</li><li><210> 732 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 732 aattgacaag acagcaactt g 21</li><li><210> 733 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 733 aagacagcaa cttgcaggac a 21</li><li><210> 734 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 734 aacttgcagg acagtagcag t 21</li><li><210> 735 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 735 aaaatgttga aagaaggagc a 21</li><li><210> 736 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 736 aaatgttgaa agaaggagca a 21</li><li><210> 737 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 737 aatgttgaaa gaaggagcaa c 21</li><li><210> 738 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 738 aaagaaggag caacacacag t 21</li><li><210> 739 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 739 aagaaggagc aacacacagt g 21</li><li><210> 740 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 740 aaggagcaac acacagtgag c 21</li><li><210> 741 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 741 aacacacagt gagcatcgag c 21</li><li><210> 742 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 742 aactcaagat cctcattcat a 21</li><li><210> 743 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 743 aagatcctca ttcatattgg t 21</li><li><210> 744 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 744 aatgtggtca accttctagg t 21</li><li><210> 745 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 745 aaccttctag gtgcctgtac c 21</li><li><210> 746 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 746 aagccaggag ggccactcat g 21</li><li><210> 747 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 747 aattctgcaa atttggaaac c 21</li><li><210> 748 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 748 aaatttggaa acctgtccac t 21</li><li><210> 749 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 749 aatttggaaa cctgtccact t 21</li><li><210> 750 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 750 aaacctgtcc acttacctga g 21</li><li><210> 751 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 751 aacctgtcca cttacctgag g 21</li><li><210> 752 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 752 aagagaaatg aatttgtccc c 21</li><li><210> 753 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 753 aaatgaattt gtcccctaca a 21</li><li><210> 754 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 754 aatgaatttg tcccctacaa g 21</li><li><210> 755 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 755 aatttgtccc ctacaagacc a 21</li><li><210> 756 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 756 aagaccaaag gggcacgatt c 21</li><li><210> 757 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 757 aaaggggcac gattccgtca a 21</li><li><210> 758 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 758 aaggggcacg attccgtcaa g 21</li><li><210> 759 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 759 aagggaaaga ctacgttgga g 21</li><li><210> 760 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 760 aaagactacg ttggagcaat c 21</li><li><210> 761 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 761 aagactacgt tggagcaatc c 21</li><li><210> 762 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 762 aatccctgtg gatctgaaac g 21</li><li><210> 763 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 763 aaacggcgct tggacagcat c 21</li><li><210> 764 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 764 aacggcgctt ggacagcatc a 21</li><li><210> 765 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 765 aagtccctca gtgatgtaga a 21</li><li><210> 766 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 766 aagaagagga agctcctgaa g 21</li><li><210> 767 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 767 aagaggaagc tcctgaagat c 21</li><li><210> 768 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 768 aagctcctga agatctgtat a 21</li><li><210> 769 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 769 aagatctgta taaggacttc c 21</li><li><210> 770 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 770 aaggacttcc tgaccttgga g 21</li><li><210> 771 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 771 aagtggctaa gggcatggag t 21</li><li><210> 772 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 772 aagggcatgg agttcttggc a 21</li><li><210> 773 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 773 aaagtgtatc cacagggacc t 21</li><li><210> 774 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 774 aagtgtatcc acagggacct g 21</li><li><210> 775 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 775 aaatatcctc ttatcggaga a 21</li><li><210> 776 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 776 aatatcctct tatcggagaa g 21</li><li><210> 777 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 777 aatatcctct tatcggagaa g 21</li><li><210> 778 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 778 aagaacgtgg ttaaaatctg t 21</li><li><210> 779 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 779 aacgtggtta aaatctgtga c 21</li><li><210> 780 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 780 aaaatctgtg actttggctt g 21</li><li><210> 781 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 781 aaatctgtga ctttggcttg g 21</li><li><210> 782 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 782 aatctgtgac tttggcttgg c 21</li><li><210> 783 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 783 aaagatccag attatgtcag a 21</li><li><210> 784 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 784 aagatccaga ttatgtcaga a 21</li><li><210> 785 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 785 aaaaggagat gctcgcctcc c 21</li><li><210> 786 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 786 aaaggagatg ctcgcctccc t 21</li><li><210> 787 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 787 aaggagatgc tcgcctccct t 21</li><li><210> 788 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 788 aaatggatgg ccccagaaac a 21</li><li><210> 789 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 789 aatggatggc cccagaaaca a 21</li><li><210> 790 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 790 aaacaatttt tgacagagtg t 21</li><li><210> 791 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 791 aacaattttt gacagagtgt a 21</li><li><210> 792 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 792 aatttttgac agagtgtaca c 21</li><li><210> 793 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 793 aatccagagt gacgtctggt c 21</li><li><210> 794 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 794 aaatattttc cttaggtgct t 21</li><li><210> 795 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 795 aatattttcc ttaggtgctt c 21</li><li><210> 796 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 796 aaagattgat gaagaatttt g 21</li><li><210> 797 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 797 aagattgatg aagaattttg t 21</li><li><210> 798 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 798 aagaattttg taggcgattg a 21</li><li><210> 799 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 799 aattttgtag gcgattgaaa g 21</li><li><210> 800 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 800 aaagaaggaa ctagaatgag g 21</li><li><210> 801 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 801 aagaaggaac tagaatgagg g 21</li><li><210> 802 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 802 aaggaactag aatgagggcc c 21</li><li><210> 803 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 803 aactagaatg agggcccctg a 21</li><li><210> 804 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 804 aatgagggcc cctgattata c 21</li><li><210> 805 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 805 aaatgtacca gaccatgctg g 21</li><li><210> 806 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 806 aatgtaccag accatgctgg a 21</li><li><210> 807 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 807 aacatttggg aaatctcttg c 21</li><li><210> 808 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 808 aaatctcttg caagctaatg c 21</li><li><210> 809 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 809 aatctcttgc aagctaatgc t 21</li><li><210> 810 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 810 aagctaatgc tcagcaggat g 21</li><li><210> 811 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 811 aatgctcagc aggatggcaa a 21</li><li><210> 812 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 812 aaagactaca ttgttcttcc g 21</li><li><210> 813 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 813 aagactacat tgttcttccg a 21</li><li><210> 814 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 814 aagaggattc tggactctct c 21</li><li><210> 815 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 815 aagtatgtga ccccaaattc c 21</li><li><210> 816 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 816 aaattccatt atgacaacac a 21</li><li><210> 817 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 817 aattccatta tgacaacaca g 21</li><li><210> 818 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 818 aacacagcag gaatcagtca g 21</li><li><210> 819 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 819 aatcagtcag tatctgcaga a 21</li><li><210> 820 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 820 aacagtaagc gaaagagccg g 21</li><li><210> 821 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 821 aagcgaaaga gccggcctgt g 21</li><li><210> 822 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 822 aaagagccgg cctgtgagtg t 21</li><li><210> 823 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 823 aagagccggc ctgtgagtgt a 21</li><li><210> 824 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 824 aaaaacattt gaagatatcc c 21</li><li><210> 825 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 825 aaaacatttg aagatatccc g 21</li><li><210> 826 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 826 aaacatttga agatatcccg t 21</li><li><210> 827 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 827 aacatttgaa gatatcccgt t 21</li><li><210> 828 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 828 aagatatccc gttagaagaa c 21</li><li><210> 829 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 829 aagaaccaga agtaaaagta a 21</li><li><210> 830 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 830 aaccagaagt aaaagtaatc c 21</li><li><210> 831 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 831 aagtaaaagt aatcccagat g 21</li><li><210> 832 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 832 aaaagtaatc ccagatgaca a 21</li><li><210> 833 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 833 aaagtaatcc cagatgacaa c 21</li><li><210> 834 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 834 aagtaatccc agatgacaac c 21</li><li><210> 835 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 835 aatcccagat gacaaccaga c 21</li><li><210> 836 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 836 aaccagacgg acagtggtat g 21</li><li><210> 837 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 837 aagagctgaa aactttggaa g 21</li><li><210> 838 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 838 aaaactttgg aagacagaac c 21</li><li><210> 839 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 839 aaactttgga agacagaacc a 21</li><li><210> 840 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 840 aactttggaa gacagaacca a 21</li><li><210> 841 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 841 aagacagaac caaattatct c 21</li><li><210> 842 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 842 aaccaaatta tctccatctt t 21</li><li><210> 843 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 843 aaattatctc catcttttgg t 21</li><li><210> 844 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 844 aattatctcc atcttttggt g 21</li><li><210> 845 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 845 aatggtgccc agcaaaagca g 21</li><li><210> 846 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 846 aaaagcaggg agtctgtggc a 21</li><li><210> 847 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 847 aaagcaggga gtctgtggca t 21</li><li><210> 848 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 848 aagcagggag tctgtggcat c 21</li><li><210> 849 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 849 aaggctcaaa ccagacaagc g 21</li><li><210> 850 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 850 aaaccagaca agcggctacc a 21</li><li><210> 851 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 851 aaccagacaa gcggctacca g 21</li><li><210> 852 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 852 aagcggctac cagtccggat a 21</li><li><210> 853 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 853 aagcagaact tttaaagctg a 21</li><li><210> 854 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 854 gacatactta caattaaggc t 21</li><li><210> 855 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 855 gatttgttcc tgatggtaac a 21</li><li><210> 856 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 856 ttttgagcac cttaactata g 21</li><li><210> 857 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 857 gagccatgtg gtctctctgg t 21</li><li><210> 858 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 858 ggtgatctcc ttccacgtga c 21</li><li><210> 859 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 859 gtggtcaggc agctcacagt c 21</li><li><210> 860 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 860 cggtgattgc catgttcttc t 21</li><li><210> 861 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 861 ttctaggtgc ctgtaccaag c 21</li><li><210> 862 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 862 tgtatccaca gggacctggc g 21</li><li><210> 863 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 863 taccagacca tgctggactg c 21</li><li><210> 864 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> Targeting sequence</li><li><400> 864 ttatctccat cttttggtgg a 21</li></ul>

Every citation, both ways

Citations
Document	Relation	Office	Cited during
US8470792B2	Cited by	United States of America	Applicant
US9150863B2	Cited by	United States of America	Applicant
US8946403B2	Cited by	United States of America	Applicant
US8202845B2	Cited by	United States of America	Applicant
US8541384B2	Cited by	United States of America	Applicant
US8546345B2	Cited by	United States of America	Applicant
WO9504142A	Cites	World Intellectual Property Organization (WIPO)	–
WO02096927A	Cites	World Intellectual Property Organization (WIPO)	–
REICH S J ET AL: "Small interfering RNA (siRNA) targeting VEGF effectively inhibits ocular neovascularization in a mouse model" MOLECULAR VISION, SN, ATLANTA,, US, vol. 9, no. 31, 30 May 2003 (2003-05-30), pages 210-216, XP002343182 ISSN: 1090-0535	Non-patent	–	–
SHU X ET AL: "Sphingosine kinase mediates vascular endothelial growth factor-induced activation of Ras and mitogen-activated protein kinases" MOLECULAR AND CELLULAR BIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, WASHINGTON, US, vol. 22, no. 22, November 2002 (2002-11), pages 7758-7768, XP002999707 ISSN: 0270-7306	Non-patent	–	–
HOUCK ET AL: 'The vascular endothelial growth factor family: identification of a fourth molecular species and characterization of alternative splicing of RNA' MOLECULAR ENDOCRINOLOGY vol. 12, 1991, pages 1806 - 1814, XP000613073	Non-patent	–	–
ELBASHIR ET AL: 'RNA interference is mediated by 21- and 22-nucleotide RNAs' GENES AND DEVELOPMENT vol. 15, 2001, pages 188 - 200, XP002204651	Non-patent	–	–
SHI ET AL: 'Inhibition of renal cell carcinoma angiogenesis and growth by antisense oligonucleotides targeting vascular endothelial growth factor' BRITISH JOURNAL OF CANCER vol. 87, 2002, pages 119 - 126, XP002995137	Non-patent	–	–
BRANTL S.: 'Antisense-RNA regulation and RNA interference' BIOCHIMICA BIOPHYSICA ACTA vol. 1575, 2002, pages 15 - 25, XP004356720	Non-patent	–	–

55 members in 16 offices

This recordMember, by publication datePriority claim6 more offices are in the list below

Priority claims5

Priority claims
Document	Office	Kind	Date
398417P	United States of America	–	2002-07-24
39841702	United States of America	P	2002-07-24
294228	United States of America	–	2002-11-14
29422802	United States of America	A	2002-11-14
0322444	United States of America	W	2003-07-18

Members55

Family members, oldest first
Document	Office	Kind
CA2493499A1	Canada	A1	2004-01-29
US2004018176A1	United States of America	A1	2004-01-29
WO2004009769A2	World Intellectual Property Organization (WIPO)	A2	2004-01-29
AU2003253995A1	Australia	A1	2004-02-09
MXPA05001000A	Mexico	A	2005-05-16
MXPA05001000A	Mexico	A	2005-05-16
KR20050056944A	Republic of Korea	A	2005-06-16
EP1578933A2	European Patent Office (EPO)	A2	2005-09-28
IL166274A0	Israel	A0	2006-01-15
JP2006505251A	Japan	A	2006-02-16
WO2004009769A3	World Intellectual Property Organization (WIPO)	A3	2006-04-13
US7148342B2	United States of America	B2	2006-12-12
US2006286073A1	United States of America	A1	2006-12-21
US2006292120A1	United States of America	A1	2006-12-28
US2007003523A1	United States of America	A1	2007-01-04
US2007037760A1	United States of America	A1	2007-02-15
US2007037761A1	United States of America	A1	2007-02-15
US2007037762A1	United States of America	A1	2007-02-15
US2007149471A1	United States of America	A1	2007-06-28
EP1578933A4	European Patent Office (EPO)	A4	2007-09-19
AU2003253995B2	Australia	B2	2007-12-13
US7345027B2	United States of America	B2	2008-03-18
US2008188437A1	United States of America	A1	2008-08-07
US2009104259A1	United States of America	A1	2009-04-23
US7674895B2	United States of America	B2	2010-03-09
EP1578933B1This record	European Patent Office (EPO)	B1	2010-03-10
AT460500T	Austria	T	2010-03-15
ATE460500T1	Austria	T1	2010-03-15
DE60331683D1	Germany	D1	2010-04-22
IL166274A	Israel	A	2010-05-31
EP2192187A2	European Patent Office (EPO)	A2	2010-06-02
ES2340843T3	Spain	T3	2010-06-10
PT1578933E	Portugal	E	2010-06-17
US2010168207A1	United States of America	A1	2010-07-01
US7750143B2	United States of America	B2	2010-07-06
DK1578933T3	Denmark	T3	2010-07-12
EP2192187A3	European Patent Office (EPO)	A3	2010-08-25
NZ537833A	New Zealand	A	2010-08-27
EP1578933B9	European Patent Office (EPO)	B9	2010-09-15
KR20110063597A	Republic of Korea	A	2011-06-10
EP2345718A2	European Patent Office (EPO)	A2	2011-07-20
IL196798A0	Israel	A0	2011-07-31
EP2345718A3	European Patent Office (EPO)	A3	2011-11-16
IL196798A	Israel	A	2012-02-29
CY1110141T1	Cyprus	T1	2012-05-23
EP2192187B1	European Patent Office (EPO)	B1	2013-04-17
KR101280269B1	Republic of Korea	B1	2013-07-15
US8541384B2	United States of America	B2	2013-09-24
US8546345B2	United States of America	B2	2013-10-01
JP5337337B2	Japan	B2	2013-11-06
US2014056969A1	United States of America	A1	2014-02-27
US8946403B2	United States of America	B2	2015-02-03
US2015110861A1	United States of America	A1	2015-04-23
US9150863B2	United States of America	B2	2015-10-06
CA2493499C	Canada	C	2016-04-12

92 legal events, as 13 offices reported them to INPADOC

Over the term

Point at a mark for the event

Events

Legal events, newest first
	Event	Code	Office
2021-05-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2021-04-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2021-04-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2021-03-31	Gb: european patent ceased through non-payment of renewal feeCeasedGBPC	GBPC	EP
2021-02-02	Application deemed withdrawn, or ip right lapsed, due to non-payment of renewal feeWithdrawnR119	R119	DE
2019-12-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2019-10-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2019-10-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2018-07-26	Fee paymentPLFP	PLFP	FR
2017-07-26	Fee paymentPLFP	PLFP	FR
2016-07-26	Fee paymentPLFP	PLFP	FR
2015-09-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2015-07-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-11-28	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-09-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-08-07	Announcement of lapse in spainLapsedFD2A	FD2A	ES
2014-07-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-06-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-05-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-05-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-05-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-05-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-04-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-04-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-04-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-04-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-04-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-04-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-04-23	Patent lapsedLapsedMM4A	MM4A	IE
2014-04-04	Lapse due to non-payment of feesLapsedML	ML	GR
2014-03-15	Lapse because of not paying annual feesLapsedMM01	MM01	AT
2014-03-04	Ep patent has lapsedLapsedEUG	EUG	SE
2014-02-28	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2014-02-28	Patent ceasedCeasedPL	PL	CH
2014-02-24	Ep patent lapsedLapsedEBP	EBP	DK
2014-02-12	Lapsed because of non-payment of the annual feeLapsedV1	V1	NL
2014-01-31	Be: lapsedLapsedBERE	BERE	EP
2014-01-28	Annulment/lapse due to non-payment of fees, searched and examined patentLapsedLAPSE DUE TO NON-PAYMENT OF FEESMM4A	MM4A	PT
2013-03-29	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2013-01-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2013-01-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2012-12-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2012-12-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2012-12-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2012-11-30	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2012-11-30	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2012-10-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2012-10-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2012-10-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2012-10-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2012-09-28	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2012-09-28	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2011-10-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2011-10-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2011-08-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2011-02-16	No opposition filedOpposition26N	26N	EP
2011-01-14	No opposition filed within time limitOppositionORIGINAL CODE: 0009261PLBE	PLBE	EP
2011-01-14	Information on the status of an ep patent application or granted ep patentGrantedSTATUS: NO OPPOSITION FILED WITHIN TIME LIMITSTAA	STAA	EP
2010-11-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2010-11-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2010-11-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2010-10-29	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2010-10-29	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2010-08-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2010-07-21	Ep patent validated in greeceEP	EP	GR
2010-07-12	Ep patent with danish claimsT3	T3	DK
2010-06-29	Translation of granted ep patentGrantedTRGR	TRGR	SE
2010-06-17	Translation is availableAVAILABILITY OF NATIONAL TRANSLATIONSC4A	SC4A	PT
2010-06-10	Definitive protectionFG2A	FG2A	ES
2010-06-09	Translation files for an european patent granted for nl, confirming art. 52 par. 1 or 6 of the patents act 1995GrantedT3	T3	NL
2010-05-31	New agentNV	NV	CH
2010-04-22	Corresponds to:REF	REF	EP
2010-04-14	European patents granted designating irelandGrantedFG4D	FG4D	IE
2010-03-15	European patent takes effect as a national patent in ch/liEP	EP	CH
2010-03-10	Designated contracting statesAK	AK	EP
2010-03-10	European patent grantedGrantedFG4D	FG4D	GB
2010-02-05	(expected) grantORIGINAL CODE: 0009210GRAA	GRAA	EP
2010-01-27	Grant fee paidORIGINAL CODE: EPIDOSNIGR3GRAS	GRAS	EP
2009-09-03	Despatch of communication of intention to grant a patentORIGINAL CODE: EPIDOSNIGR1GRAP	GRAP	EP
2007-11-21	First examination report despatched17Q	17Q	EP
2007-09-19	Supplementary search report drawn up and despatchedA4	A4	EP
2006-08-30	Information provided on ipc code assigned before grantRIC1	RIC1	EP
2006-08-30	Information provided on ipc code assigned before grantRIC1	RIC1	EP
2006-08-30	Information provided on ipc code assigned before grantRIC1	RIC1	EP
2006-08-30	Information provided on ipc code assigned before grantRIC1	RIC1	EP
2006-08-30	Information provided on ipc code assigned before grantRIC1	RIC1	EP
2006-05-05	Availability of information related to the publication of the international search reportORIGINAL CODE: 0009015PUAK	PUAK	EP
2005-11-16	Request for extension of the european patent (deleted)DAX	DAX	EP
2005-09-28	Request for examination filed17P	17P	EP
2005-09-28	Designated contracting statesAK	AK	EP
2005-09-28	Request for extension of the european patentAX	AX	EP
2005-08-12	Public reference made under article 153(3) epc to a published international application that has entered the european phaseORIGINAL CODE: 0009012PUAI	PUAI	EP

Compositions and methods for si-rna inhibition of angiogenesis

Abstract

Term

SEQUENCE LISTING

Priority claims5

Members55

Over the term

Events

Numbers

Titles3

Classification

Designated states27