Fab i inhibitors

Description of equivalent WO 03088897 A2

TITLE

0002Fab I Inhibitors

0003FIELD OF THE INVENTION This invention relates to pharmaceutically active compounds which inhibit Fab I and are useful for the treatment of bacterial infections.

BACKGROUND OF THE INVENTION

0005While the overall pathway of saturated fatty acid biosynthesis is similar in all organisms, the fatty acid synthase (FAS) systems vary considerably with respect to their structural organization. Vertebrates and yeast possess a FAS in which all the enzymatic activities are encoded on one or two polypeptide chains, respectively, and the acyl carrier protein (ACP) is an integral part of the complex. In contrast, in bacterial FAS, each of the reactions is catalyzed by a distinct, mono-functional enzyme and the ACP is a discrete protein. Therefore, there is considerable potential for the selective inhibition of the bacterial system by antibacterial agents.

0006Fab I (previously designated EnvM) functions as an enoyl-ACP reductase (Bergler, et al, (1994), J.Biol.Chem. 269, 5493-5496) in the final step of the four reactions involved in each cycle of bacterial fatty acid biosynthesis. In this pathway, the first step is catalyzed by β-ketoacyl-ACP synthase, which condenses malonyl-ACP with acetyl-CoA (FabH, synthase III). In subsequent rounds, malonyl-ACP is condensed with the growing-chain acyl-ACP (FabB and FabF, synthases I and II, respectively). The second step in the elongation cycle is ketoester reduction by NADPH-dependent β-ketoacyl-ACP reductase (FabG). Subsequent dehydration by β-hydroxyacyl-ACP dehydrase (either FabA or FabZ) leads to trans-2-enoyl-ACP, which in turn is converted to acyl-ACP by NADH-dependent enoyl-ACP reductase (Fab I). Further rounds of this cycle, adding two carbon atoms per cycle, eventually lead to palmitoyl-ACP (16C), where upon the cycle is stopped largely due to feedback inhibition of Fab I by palmitoyl-ACP (Heath, et al, (1996), J.Biol.Chem. 271, 1833-1836). Thus, Fab I is a major biosynthetic enzyme and is a key regulatory point in the overall synthetic pathwayof bacterial fatty acid biosynthesis. Therefore, Fab I is an ideal target for antibacterial intervention.

0007Studies have shown that diazaborine antibiotics inhibit fatty acid, phospholipid and lipopolysaccharide (LPS) biosynthesis and that the antibacterial target of these compounds is Fab I. For example, derivative 2bl8 from Grassberger, et al, (1984) J. Med Chem 27, 947-953 has been reported to be a non-competitive inhibitor of Fab I (Bergler, et al, (1994) J.Biol.Chem. 269, 5493-5496). Also, plasmids containing the Fab I gene from diazaborine resistant S. typhimurium conferred diazaborine resistance in E.coli (Turnowsky, et al, (1989) J.Bacteriol, 171, 6555-6565). Furthermore, inhibition of Fab I either by diazaborine or by raising the temperature in a Fab I temperature sensitive mutant is lethal. These results demonstrate that Fab I is essential to the survival of the organism (Bergler, et al, (1994) J.Biol.Chem. 269, 5493-5496).

0008Recent studies have shown that Fab I is also the target for the broad spectrum antibacterial agent triclosan (McMurry, et al, (1998) Nature 394, 531-532). A crystal structure of the E. Coli Fab I complexed with NAD and triclosan shows that triclosan acts as a site-directed, very potent inhibitor of Fab I by mimicking its natural substrate (Levy, et al, (1999) Nature 398, 383-384). Ward, et al ((1999) Biochem. 38, 12514-12525) have shown that there is no evidence for the formation of a covalent complex between Fab I and triclosan, which would be analogous to the diazaborines; triclosan differs from these compounds in that it is a reversible inhibitor of Fab I. The structural data for the complex of Fab I with NAD and triclosan provides important information about Fab I as a therapeutic target.

0009Importantly, it has now been discovered that certain compounds are Fab I inhibitors and have antibacterial activity, and, therefore, may be useful for the treatment of bacterial infections in mammals, particularly in man.

SUMMARY OF THE INVENTION

0011This invention comprises compounds, as described hereinafter, which inhibit Fab I and are useful in the treatment of bacterial infections.

0012This invention is also a pharmaceutical composition comprising compounds of the instant invention according and a pharmaceutically acceptable carrier. This invention is a method of treating bacterial infections by inhibiting Fab I. In a particular aspect, the compounds of this invention are useful as antibacterial agents.

DETAILED DESCRIPTION

0014This invention comprises compounds of the formula (I):

0015<img file="WO03088897A2_D0001.tif" /><img file="WO03088897A2_D0002.tif" />

001610

0017<img file="WO03088897A2_D0003.tif" /><img file="WO03088897A2_D0004.tif" />

0018R¹ is H, Cι_₄alkyl, -Cθ-6alkyl-Ar, -(CH₂)I.3N(R')₂, or -(CH₂)i.3OR'; <img file="WO03088897A2_D0005.tif" /> or C3.gcycloalkyl;

0019R³is

0020<img file="WO03088897A2_D0006.tif" /><img file="WO03088897A2_D0007.tif" />

0021R⁴isHorCι_ alkyl;

0022indicates that one of the two designated bonds is a double bond and the other is a single bond;

0023R5 is CH₂ when the bond to which it is attached is a double bond; or R^ is H or Ci _4alkyl when the bond to which it is attached is a single bond; R⁶isHorCι_ alkyl; each R⁷ independently is H, Ci -όalkyl, -Cθ-6alkyl-Ar, -(CH2)i_3N(R')2, or <img file="WO03088897A2_D0008.tif" />

0024R⁸isHorCι_ alkyl;

0025R9 and R" independently are H or Ci _4alkyl;

0026R¹⁰ is Chalky., NCR' , NHC(O)R', NHCH₂C(O)R' or NHC(O)CH=CHR'; Y* is NCR' . NHC(O)R', NHCH C(0)R' or NHC(O)CH=CHR'; each X independently is H, C^alkyl, CH₂OH, OR', SR', CN, N(R')₂, CH₂N(R')2,

0027NO₂, CF₃, CO₂R', CON(R')₂, COR', NR'C(0)R', F, Cl, Br, I or -S(O)_rCF₃;

0028X* is -(CH₂)ι_3C(O)N(R')-(CH2)ι_3-Ar or-(CH₂)ι.3C(O)N(R')-(CH₂)ι.3-Het; W is S or O; Q is Hor C1.4a.kyl; each R' independently is H, Ci-6alkyl, -Cθ-6alkyl-Ar or -Cθ-6alkyl-Het; and r is 0, 1 or 2; or a pharmaceutically acceptable salt thereof.

0029Additionally, this invention comprises compounds of formula (II):

0030<img file="WO03088897A2_D0009.tif" /> wherein:

0031<img file="WO03088897A2_D0010.tif" />

0032R¹ is H or Ci _₄alkyl;

0033R^ is H, C^alkyl or C3_6cycloalkyl;

0034R³ is

0035<img file="WO03088897A2_D0011.tif" />

0036<img file="WO03088897A2_D0012.tif" /><img file="WO03088897A2_D0013.tif" />

0037R⁴ is H or Cι _4alkyl;

0038<img file="WO03088897A2_D0014.tif" /> indicates that one of the two designated bonds is a double bond and the other is a single bond; R^ is CH2 when the bond to which it is attached is a double bond; or R^ is H or

0039Cι_4alkyl when the bond to which it is attached is a single bond; R⁶ is H or Cι -4alkyl; R⁷ is H, Ci-6alkyl or -C_υ-6alkyl-Ar;

0040Y is H, Cι _₄alkyl, N(R')2_> NHC(O)R\ NHCH₂C(0)R' or NHC(O)CH=CHR'; each X independently is H, C^alkyl, CH₂OH, OR', SR', CN, N(R')2, CH2N(R')2,

0041NO₂, CF3, CO₂R', C0N(R')₂, COR', NRC(O)R', F, Cl, Br, I or -S(O)_rCF₃; W is S or O; <img file="WO03088897A2_D0015.tif" /> M is CH₂ or O; L is CH₂ or C(O);

0042E is O or NR'; each R' independently is H, Ci -βalkyl or -Cθ-6alkyl-Ar; and r is 0, 1 or 2; or a pharmaceutically acceptable salt thereof. Also, this invention comprises compounds of formula (III):

0043<img file="WO03088897A2_D0016.tif" /> wherein: Dl to D^ form an accessible substituted seven-membered ring, which may be saturated or unsaturated, optionally containing up to two heteroatoms chosen from the group of O, S and N wherein S and N may be optionally oxidized;

0044R^{1 1} is Ci -galkyl; and R" is H or Cι _₆alkyl; or a pharmaceutically acceptable salt thereof.

0045This invention includes, but is not limited to, the following compounds:

0046(E)-3-(6-aminopyridin-3-yl)-N-(4,6-dichloro-l-methyl-l/ -indol-2-ylmethyl)-N- methylacrylamide; (E)-3-(2-aminopyrimidin-5-yl)-N-(2-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide;

0047(E)-3-(6-aminopyridin-3-yl)-N-( 1 -ethyl- 1 -indol-3-ylmethyl)-N- methy lacry lamide ;

0048(E)-3-(6-aminopyridin-3-yl)-N-(l-isopropyl-lH-indol-3-ylmethyl)-N- methylacrylamide;

0049(E)-N-methyl-N-(l -methyl- lH-indol-3-ylmethyl)-3-[6-(pyridin-2-ylamino)pyridin- 3-yl]acrylamide;

0050(E)-3-(6-aminopyridm-3-yl)-N-(l,4-dimethyl-lH-indol-3-ylmethyl)-N- methylacrylamide; (E)-3-(6-aminopyridin-3-yl)-N-(3,3-dimethyl-3H-indene-l-ylmethyl)-N- methylacrylamide;

0051(E)-3-(2-aminopyrimidin-5-yl)-N-methyl-N-(l-methyl-lH-pyrrolo[2,3--7]pyridin-3- ylmethyl)acrylamide;

0052(E)-N-methyl-N-(l-methyl-lH-pyrrolo[2,3-Z?]pyridin-3-ylmethyl)-3-(7-oxo-5,6,7,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide;

0053(E)-N-methyl-N-(2-methylbenzo[-j]thiophen-3-ylmethyl)-3-(7-oxo-5,6,7,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide;

0054(E)-N-methyl-N-(2-methyl- lH-indol-3-ylmethyl)-3-(3-methyl-2-oxo- 1,2,3,4- tetrahy dropyrido [2,3--./] pyrimidi n -6-y l)acry 1 amide; (E)-3-(3H-imidazo[4,5-i]pyridin-6-yl)-N-methyl-N-(l-methyl-lH-indol-3- ylmethyl)acrylamide;

0055(E)-3-(3,4-dihydro-2//-pyrido[3,2- 7]-l,4-oxazin-7-yl)-N-methyl-N-(l-methyl-lH- indol-3-ylmethyl)acrylamide;

0056(E)-N-(lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylamide; (E)-3-(6-aminopyridin-3-yl)-N-(5-methoxy-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide;

0057(E)-3-(6-aminopyridin-3-yl)-N-(4-rnethoxy-l -methyl- lH-indol-3-ylmethyl)-N- methylacrylamide; (E)-3-(6-aminopyridin-3-yl)-N-(lH-indol-3-ylmethyl)-N-methylacrylamide

0058(E)-3-(6-aminopyridin-3-yl)-N-(7-chloro-l-methyl-l//-indol-3-ylmethyl)-N- methylacrylamide;

0059(E)-N-methyl-N-(l-methyl-lH-indol-2-ylmethyl)-3-[6-[N- (methylaminocarbonylmethyl)amino]pyridin-3-yl]acrylamide; (E)-3-(6-amino-5-(methoxycarbonyl)pyridin-3-yl)-N-(l-methyl-lH-indol-3- ylmethyl)-N-methylacrylamide;

0060(E)-N-(l-benzyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylamide;

0061(E)-3-(6-aminopyridin-3-yl)-N-(7-methoxy-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide;

0062(E)-N-methyl-N-(l-methyl-lH-indol-3-ylmethyl)-3-(3-methyl-2-oxo-l,2,3,4- tetrahydropyrido[2,3--flpyrirιudin-6-yl)acrylamide;

0063(E)-N-methyl-3-(7-oxo-5 ,6,7,8-tetrahydro- 1 ,8-naphthyridin-3-yl)-N-( 1 ,2,7- trimethyl-lH-indol-3-ylmethyl)acrylamide; (E)-N-[l-(2-dimethylaminoethyl)-lH-indol-3-ylmethyl]-N-methyl-3-(7-oxo-

00645,6,7, 8-tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0065(E)-N-(7-chloro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0066(E)-3-[6-amino-5-[[N-methyl-N-(2-methyl-l//-indol-3- ylmethyl)amino]carbonylethyl]pyridin-3-yl]-N-methyl-N-(2-methyl-lH-indol-3- ylmethyl)acrylamide;

0067(E)-N-(2,3-dihydro-lH-3a-azacyclopenta[α]indene-8-ylmethyl)-N-methyl-3-(7- oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0068(E)-N-methyl-N-(2-methyl-l//-indol-3-ylmethyl)-3-(2-oxo-2,3-dihydro-l/7- pyrτolo[2,3-&amp;]pyridin-5-yl)acrylamide;

0069(E)-N-( 1 -ethyl-5 -fluoro- lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5 ,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0070(E)-N-(7-chloro-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3 -y 1 )acry la ide ; (E)-3-(6-aminopyridin-3-yl)-N-(6-chloro-l-methyl-lH-indol-3-ylmethyl)-N- methy lacry 1 amide ; (E)-N-(5-fluoro-l -methyl- lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylarnide;

0071(E)-N-(6-fluoro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide; (E)-N-(7-fluoro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide;

0072(E)-3-(6-aminopyridin-3-yl)-N-(7-hydroxy-l-methyl-l/ -indol-3-ylmethyl)-N- methylacrylamide;

0073(E)-3-(6-aminopyridin-3-yl)-N-(6-fluoro-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide;

0074(E)-3-(6-aminopyridin-3-yl)-N-(5-chloro-l-methyl-lH-indol-3-ylmethyl)-N- methy lacry lamide ;

0075(E)-3-(6-aminopyridin-3-yl)-N-(4-chloro-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide; (E)-N-methyl-3-(8-oxo-6,7,8,9-tetrahydro-5/ -pyrido[2,3-Z?]azepin-3- yl)acrylamide;

0076(E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]-N-methyl-N-(2-methyl- 1 H-indol-3-ylmethyl)acrylamide;

0077(E)-3-[6-[N-(carboxymethyl)amino]pyridin-3-yl]-N-methyl-N-(2-methyl-lH-indol- 3-ylmethyl)acrylamide;

0078(E)-N-methyl-N-(2-methyl-lH-indol-3-ylmethyl)-3-[6-[N- (methylaminocarbonylmethyl)amino]pyridin-3-yl]acrylamide;

0079(E)-N-(7-chloro-l-methyl-lH-indol-3-ylmethyl)-3-[6-[N- (methoxycarbonylmethyl)amino]pyridin-3-yl]-N-methylacrylamide; (E)-2,N-dimethyl-N-(2-methyl-lH-indol-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro- l,8-naphthyridin-3-yl)acrylamide;

0080(E)-3-[6-[N-(carboxymethyl)amino]pyridin-3-yl]-N-(7-chloro-l-methyl-lH-indol- 3-ylmethyl)-N-methylacrylamide;

0081(E)-N-(7-chloro-l-methyl-lr7-indol-3-ylmethyl)-N-methyl-3-[6-[N- (methylaminocarbonylmethyl)amino]pyridin-3-yl]acrylamide;

0082(E)-3,N-dimethyl-N-(2-methyl-lH-indol-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro- l,8-naphthyridin-3-yl)acrylamide;

0083(E)-3-(6-aminopyridin-3-yl)-N-(4-fluoro-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide; (E)-3-(6-aminopyridin-3-yl)-N-(5-fluoro-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide; (E)-3-(6-aminopyridin-3-yl)-N-(7-fluoro-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide;

0084(E)-3-(6-aminopyridin-3-yl)-N-(7-methoxycarbonyl-l -methyl- lH-indol-3- ylmethyl)-N-methylacrylamide; (E)-3-(6-aminopyridin-3-yl)-N-(7-fluoro-l /-indol-3-ylmethyl)-N- methylacrylamide;

0085(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(l,2,7-trimethyl-l//-indol-3- ylmethyl)acrylamide;

0086(E)-N-methyl-N-(2-methyl-l /-indol-3-ylmethyl)-3-(8-oxo-6,7,8,9-tetrahydro-5H- pyrido[2,3-b]azepin-3-yl)acrylamide;

0087(E)-3-(6-aminopyridin-3-yl)-N-(7-chloro-lH-indol-3-ylmethyl)-N- methylacrylamide;

0088(E)-3-(6-aminopyridin-3-yl)-N-(2-chloro-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide; (E)-N-(2-chloro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0089(E)-N-(5-chloro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide;

0090(E)-N-(4-fluoro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide;

0091(E)-N-(6-chloro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide;

0092(E)-3-(6-aminopyridin-3-yl)-N-(4-fluoro-l /-indol-3-ylmethyl)-N- methylacrylamide; (E)-3-(6-aminopyridin-3-yl)-N-(7 -carboxy- l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide;

0093(E)-N-(l,7-dimethyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro- l,8-naphthyridin-3-yl)acrylamide;

0094(E)-N-(l,6-dimethyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro- l,8-naphthyridin-3-yl)acrylamide;

0095(E)-N-(l,4-dimethyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro- l,8-naphthyridin-3-yl)acrylamide;

0096(E)-N-(3,3-dimethyl-3H-indene-l-ylmethyl)-N-methyl-3-(7-oxo-5,6J,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide; (E)-N-(l,5-dimethyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro- l,8-naphthyridin-3-yl)acrylamide; (E)-N-(7-methoxy-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0097(E)-N-(7-hydroxy-l -methyl- l//-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide; N-Methyl-N-(2-methyl-l/ -indol-3-ylmethyl)-3-(4-methyl-3-oxo-2,3,4,5- tetrahydro- lH-pyrido[2,3-e]- 1 ,4-diazepin-7-yl)acrylamide;

0098(E)-N-[l-(2-hydroxyethyl)-lH-indol-3-ylmethyl]-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0099(E)-N-(4-chloro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0100(E)-N-methyl-N-(l -methyl- lH-indol-3-ylmethyl)-3-(8-oxo-6,7,8,9-tetrahydro-5H- pyrido[2,3-£]azepin-3-yl)acrylamide;

0101(E)-N-(4-methoxy-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide; (E)-N-(5-methoxy-l -methyl- lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide;

0102(E)-N-(6-methoxy-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0103(E)-N-(naphthalen-2-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylamide;

0104(E)-N-(quinolin-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylamide;

0105(E)-N-(l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(6-amino-7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide; (E)-N-(l-ethyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylamide;

0106(E)-N-(naphthalen-l-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylamide;

0107(E)-N-(benzofuran-2-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylamide;

0108(E)-3-(6-aminopyridin-3-yl)-N-(6-methoxycarbonyl-l-methyl-l/ -indol-3- ylmethyl)-N-methylacrylamide;

0109(E)-N-methyl-N-(2-methyl-lH-indol-3-ylmethyl)-3-[3-(2-methoxyethyl)-2-oxo- l,2,3,4-te-rahydropyrido[2,3---/]pyrimidin-6-yl]acrylamide; (E)-N-(l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-[6-(methoxycarbonyl)-7-oxo-

01105,6,7, 8-tetrahydro-l,8-naphthyridin-3-yl]acrylamide; (E)-3-(6-aminopyridin-3-yl)-N-(l,3-dimethyl-lH-pyrrolo[2,3-fe]pyridin-3- ylmethyl)-N-methylacrylamide;

0111(E)-N-(l,3-dimethyl-lH-pyrrolo[2,3-b]pyridin-3-ylmethyl)-N-methyl-3-(7-oxo- 5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylamide; (E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(l-methyl-lH-pyrrolo[2,3-c]pyridin-3- ylmethyl)acrylamide;

0112(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(l-methyl-lH-pyrrolo[3,2-c]pyridin-3- ylmethyl)acrylamide;

0113(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(l-methyl-lH-pyrrolo[3,2--j]pyridin-3- ylmethyl)acrylamide;

0114(E)-N-methyl-N-(l-methyl-lH-pyrrolo[2,3-c]pyridin-3-ylmethyl)-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0115(E)-N-methyl-N-(l-methyl-l /-pyrrolo[3,2-c]pyridin-3-ylmethyl)-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide; (E)-N-methyl-N-(l-methyl-lH-pyrrolo[3,2-b]pyridin-3-ylmethyl)-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide;

0116(E)-3-(6-aminopyridin-3-yl)-N-(benzofuran-3-ylmethyl)-N-methylacrylamide;

0117(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(3-methylbenzofuran-2- ylmethyl)acrylamide; (E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(2-methylbenzofuran-3- ylmethyl)acrylamide;

0118(E)-N-(benzofuran-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylamide;

0119(E)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide;

0120(E)-N-methyl-N-(2-methylbenzofuran-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro- l,8-naphthyridin-3-yl)acrylamide;

0121(E)-(6-aminopyridin-3-yl)-N-methy 1-N- [ 1 -( 1 -methyl- lH-indol-2- yl)ethyl]acrylamide; (E)-(6-aminopyridin-3-yl)-N-methyl-N-[l-(l-methyl-lH-indol-3- yl)ethyl]acrylamide;

0122(E)-N-methyl-N-[l-(l-methyl-lH-indol-2-yl)ethyl]-3-(7-oxo-5,6,7,8-tetrahydro- 1 ,8-naphfhyridin-3-yl)acrylamide; and

0123(E)-N-methyl-N-[l-(l -methyl- lH-indol-3-yl)ethyl]-3-(7-oxo-5,6,7,8-tetrahydro- l,8-naphthyridin-3-yl)acrylamide; or a pharmaceutically acceptable salt thereof. Also included in this invention are pharmaceutically acceptable addition salts and complexes of the compounds of this invention. In cases wherein the compounds of this invention may have one or more chiral centers, unless specified, this invention includes each unique racemic compound, as well as each unique nonracemic compound. In cases in which compounds have unsaturated carbon-carbon double bonds, both the cis (Z) and trans (E) isomers are within the scope of this invention. In cases wherein

0124O compounds may exist in tautomeric forms, such as keto-enol tautomers, such as --'"^-- OR' and --^^-r , each tautomeric form is contemplated as being included within this invention, whether existing in equilibrium or locked in one form by appropriate substitution with R\ The meaning of any substituent at any one occurrence is independent of its meaning, or any other substituent's meaning, at any other occurrence.

0125Also included in this invention are prodrugs of the compounds of this invention. Prodrugs are considered to be any covalently bonded carriers which release the active parent drug in vivo. The compounds of this invention inhibit Fab I. Inhibition of this enzyme is useful in the treatment of bacterial infections. Also, the compounds of this invention may be useful as antifungal agents. Additionally, the compounds may be useful in combination with known antibiotics.

0126Abbreviations and symbols commonly used in the peptide and chemical arts are used herein to describe the compounds of this invention.

0127Ci -4alkyl as applied herein means an optionally substituted alkyl group of 1 to 4 carbon atoms, and includes methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl and t-butyl. C galkyl additionally includes pentyl, n-pentyl, isopentyl, neopentyl and hexyl and the simple aliphatic isomers thereof. Co_4alkyl and Co._β lkyl additionally indicates that no alkyl group need be present (e.g., that a covalent bond is present).

0128Any Ci _4alkyl or C^.g alkyl may be optionally substituted with the group R^x, which may be on any carbon atom that results in a stable structure and is available by conventional synthetic techniques. Suitable groups for R^x are C^alkyl, OR , SR', CN, N(R')₂, CH₂N(R')₂, -NO₂, -CF₃, -CO₂R' -CON(R')₂, -COR', -NR'C(O)R', F, Cl, Br, I, or -S(O)_rCF3, wherein R' and r are as defined for formula (I) compounds.

0129Halogen or halo means F, Cl, Br, and I.

0130Ar, or aryl, as applied herein, means phenyl or naphthyl, or phenyl or naphthyl substituted by one to three substituents, such as those defined above for alkyl, or substituted by methylenedioxy. Het, or heterocycle, indicates an optionally substituted five or six membered monocyclic ring, or a nine or ten-membered bicyclic ring containing one to three heteroatoms chosen from the group of nitrogen, oxygen and sulfur, which are stable and available by conventional chemical synthesis. Illustrative heterocycles are benzofuryl, benzimidazolyl, benzopyranyl, benzothienyl, furyl, imidazolyl, indolinyl, morpholinyl, piperidinyl, piperazinyl, pyrrolyl, pyrrolidinyl, tetrahydropyridinyl, pyridinyl, thiazolyl, thienyl, quinolinyl, isoquinolinyl, and tetra- and perhydro- quinolinyl and isoquinolinyl. Any accessible combination of up to three substituents on the Het ring, such as those defined above for alkyl, that are available by chemical synthesis and are stable are within the scope of this invention.

0131Certain radical groups are abbreviated herein. t-Bu refers to the tertiary butyl radical, Boc refers to the t-butyloxycarbonyl radical, Fmoc refers to the fluorenylmethoxycarbonyl radical, Ph refers to the phenyl radical, Cbz refers to the benzyloxycarbonyl radical, Bn refers to the benzyl radical, Me refers to methyl, Et refers to ethyl, Ac refers to acetyl, Alk refers to C^alkyl, Nph refers to 1- or 2-naphthyl and cHex refers to cyclohexyl. Tet refers to 5-tetrazolyl.

0132Certain reagents are abbreviated herein. DCC refers to dicyclohexylcarbodiimide, DMAP refers to dimethylaminopyridine, EDC refers to l-(3-dimethylaminopropyl)-3- ethylcarbodiimide, hydrochloride, HOBt refers to 1 -hydroxy benzotriazole, THF refers to tetrahydrofuran, DIEA refers to diisopropylethylamine, DEAD refers to diethyl azodicarboxylate, PPh3 refers to triphenylphosphine, DIAD refers to diisopropyl azodicarboxylate, DME refers to dimethoxyethane, DMF refers to dimethylformamide, NBS refers to N-bromosuccinimide, Pd/C refers to a palladium on carbon catalyst, PPA refers to polyphosphoric acid, DPPA refers to diphenylphosphoryl azide, BOP refers to benzotriazol-l-yloxy-tris(dimethyl-amino)phosphonium hexafluorophosphate, HF refers to hydrofluoric acid, TEA refers to triethylamine, TFA refers to trifluoroacetic acid, PCC refers to pyridinium chlorochromate.

0133In particular, compounds of this invention are prepared by the general methods described in the Schemes hereinafter.

0134Scheme I

0135<img file="WO03088897A2_D0017.tif" />

0136(a) benzyl acrylate, Pd(OAc)₂, P(o-tol)3, (i-Pr)₂NEt, propionitrile; (b) 1.0 N NaOH, MeOH; (c) l-methyl-2-(methylaminomethyl)indole, EDC, HOBt • H₂O, Et3N, DMF.

0137A suitable haloaromatic derivative, for instance 2-amino-5-bromopyridine (1-1), reacts with an appropriate α,β-unsaturated ester, for example benzyl acrylate, in a Heck- type reaction (see Heck, Org. Reactions 1982, 27, 345) to afford 1-2. The reaction is mediated by a palladium(O) species, and generally is conducted in an inert solvent, such as CH3CN, propionitrile, or toluene, in the presence of an appropriate acid scavenger, such as triethylamine (E.3N) or diisopropylethylamine ((i-Pr)₂NEt). Typical sources of the palladium(O) species include palladium (II) acetate (Pd(OAc)₂) and palladium(II) chloride (PdCl₂), and oftentimes phosphine ligands, for instance triphenylphosphine (PPh3) or tri- ortho-tolylphosphine (P(tol)3), are included. The ethyl ester of 1-2 is hydrolyzed using aqueous base, for example, LiOH in aqueous THF or NaOH in aqueous methanol or ethanol, and the intermediate carboxylate salt is acidified with a suitable acid, for instance TFA or HCl, to afford the carboxylic acid 1-3. The carboxylic acid of 1-3 is converted to an activated form using, for example, EDC and HOBt, or SOCl , and the activated form is subsequently reacted with an appropriate amine, for instance l-methyl-2- (methylaminomethyl)indole, in a suitable solvent such as DMF, CH₂C1₂, or CH3CN, to afford 1-4. Depending on whether acid neutralization is required, an added base, such as triethylamine (Et3N), diisopropylethylamine ((i-Pr)₂NEt), or pyridine, may be used. Many additional methods for converting a carboxylic acid to an amide are known, and can be found in standard reference books, such as "Compendium of Organic Synthetic Methods", Vol. I - VI (published by Wiley-Interscience), or Bodansky, "The Practice of Peptide Synthesis" (published by Springer- Verlag). Scheme II

0138<img file="WO03088897A2_D0018.tif" />

0139(a) NaH, Mel, DMF; (b) CH₃NH₂, H₂0, MeOH; (c) LiAlH₄, THF.

0140The amine coupling partners used in the present invention were prepared by established methods well-known to those of skill in the art. For example, amine H-4 is prepared by the straightforward procedure outlined in Scheme II. Commercially available ethyl indole-2-carboxylate (II-l) is deprotonated with a suitable base, generally sodium hydride (NaH), and the intermediate sodium salt is reacted with an appropriate alkylating agent, for instance methyl iodide, to afford II-2. Polar solvents such as DMF , THF, or mixtures thereof are generally preferred for this reaction. Compound II-2 can be conveniently converted to II-3 by reaction with an excess of an amine, such as methylamine, in a polar solvent, generally H₂0 or a mixture of H2O and methanol. Alternatively, the ester of II-2 can be saponified under standard conditions, typically with an alkali metal hydroxide such as LiOH, NaOH, or KOH, in an aqueous solvent, such as THF, ethanol, or methanol, and the resulting carboxylic acid can be converted to the desired amide. Typical methods for forming amides are described in Scheme I. Reduction of the amide II-3 to the amine H-4 is typically accomplished with lithium aluminum hydride (LiAlH4) in refluxing THF, although many other methods can be used to reduce amides to amines. Such methods are well-known to those of skill in the art, and can be found in standard reference volumes, such as "Compendium of Organic Synthetic Methods" (published by Wiley-Interscience). Scheme III

0141<img file="WO03088897A2_D0019.tif" />

0142(a) CH NH₂, MeOH; (b) NaBH₄, EtOH.

0143The amine coupling partners used in the present invention can also be prepared by the reductive amination of an appropriate aldehyde (Scheme III). This method, which is well-known to those of skill in the art, involves the initial conversion of an aldehyde to an intermediate imine, which is subsequently reduced, oftentimes in situ, to afford the amine. For example, the commercially-available aldehyde III-l reacts with an appropriate amine, for instance methylamine, in a suitable solvent, typically methanol, to afford the imine III- 2. Reaction of III-2 with a suitable reducing agent, for example sodium borohydride, sodium cyanoborohydride or sodium (triacetoxy)borohydride, gives the amine IH-3.

0144Scheme IV

0145<img file="WO03088897A2_D0020.tif" />

0146<img file="WO03088897A2_D0021.tif" />

0147(a) LiAlH₄, THF; (b) Br₂, AcOH; (c) 48% HBr; (d) (MeO₂C)₂CH₂, NaH, DMF, THF; (e) NaOH, H O, MeOH, (f) HCl, H₂0, MeOH; (g) acryloyl chloride, Et₃N, CH₂C1₂; (h) Pd(OAc)₂, P(o-tol)3, (i-Pr)₂NEt, propionitrile.

0148Commercially available 2-aminonicotinic acid (IV-1) is reduced to alcohol IV-2 under standard conditions (L.A1H4, THF), and the aromatic ring of IV -2 is brominated using, for example, bromine or N-bromosuccinimide (NBS), in a suitable solvent such as CH2CI2, acetic acid (AcOH), or mixtures thereof, to afford IV-3. On reaction with 48% aqueous HBr, IV-3 is converted to bromide IV-4, which reacts with a diester of malonic acid, for instance dimethyl malonate, under basic conditions, to afford the naphthyridone derivative IV-5. Typical basic conditions include an alkali metal hydride, for instance sodium hydride, in a neutral solvent such as DMF, THF, or mixtures thereof, or an alkali metal alkoxide, such as sodium methoxide or sodium ethoxide, in an alcoholic solvent such as with methanol or ethanol. Saponification and neutralization under standard conditions affords an intermediate carboxylic acid (not shown), which is typically not isolated, but is subject to decarboxylation on gentle warming to afford the naphthyridone IV-6. This compound reacts with acrylamide IV-8 in a Heck-type reaction as described in Scheme I to afford IV-9. Alternatively, IV-6 might be converted to IV-9 according to the general procedure described in Scheme I for the conversion of I-l to 1-4. The acrylamide IV-8 is conveniently prepared by reaction of amine IV-7 (see Scheme I) with an activated form of acrylic acid in an amide bond-forming reaction. Typical conditions for the formation of amides are described in Scheme I, and are well-known to those of skill in the art.

0149Scheme V

0150<img file="WO03088897A2_D0022.tif" />

0151(a) CH₃NH₂, H₂0, THF; (b) (MeO)₂C=O, NaOMe, MeOH; (c) compound IV-8, Pd(OAc)₂, P(o-tol)₃, (i-Pr) NEt, propionitrile.

0152Benzylic bromide V-l, prepared as described in Scheme IV, reacts with an amine, for example aqueous methylamine, to afford benzylic amine V-2. Polar solvents such as THF, DMF, DMSO, or mixture thereof, are generally preferred for this reaction. V-2 reacts with a dialkyl carbonate, preferably dimethyl carbonate, in the presence of a suitable base, typically sodium methoxide, in an alcoholic solvent, generally methanol, to afford the cyclic urea derivative V-3. This compound is converted to V-4 by reaction with compound IV-8 as described in Scheme IV.

0153Scheme VI

0154<img file="WO03088897A2_D0023.tif" />

01554 5 6

0156(a) SnCl₂ • H₂O, EtOH; (b) 96% HCO₂H; (c) TrCl, Et₃N, CH₂C1₂; (d) benzyl acrylate, Pd(OAc)₂, P(o-tol)₃, (i-Pr)₂NEt, propionitrile; (e) 4 N HCl/dioxane; (f) NaOH, H₂O, MeOH.

0157The nitro group of commercially available 2-amino-5-bromo-3-nitropyridine (VI- 1) is reduced under standard conditions using, for example, tin (II) chloride in EtOH. The resulting diamine, VI-2, reacts with formic acid, or an appropriate equivalent, to afford the imidazopyridine derivative VI-3. This compound is converted to a suitably protected derivative, for instance the N-trityl protected derivative VI-4, by reaction with trityl chloride in the presence of an appropriate base, typically triethylamine or diisopropylethylamine. Typical solvents for this reaction include CH₂C1₂, DMF, or mixtures thereof. The protecting group for the amine must be compatible with subsequent chemistry, and must be readily removable when desired. Methods for the protection of amines are well-known to those of skill in the art, and are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley- Interscience). VI-4 is converted to VI-5 according to the general procedure described in Scheme I. The trityl protecting group is removed under standard acidic conditions (see Greene above), and the ester is saponified as in Scheme I to afford VI-6.

0158Scheme VII

0159<img file="WO03088897A2_D0024.tif" />

0160(a) PhCHO, Ac₂O; (b) O₃, CH₂C1₂, then DMS; (c) H₂NOH ^■ HCl, (i-Pr)₂NEt, EtOH; (d) p-TsCl, KOH, acetone, H₂0; (e) KOAc, EtOH, H O; (f) Br₂, CH₂C1₂; (g) tert-butyl acrylate, Pd(OAc)₂, P(o-tol) , (i-Pr)₂NEt, propionitrile; (h) 4.0 N HCl/dioxane; (i) 2- methyl-3-(methylaminomethyl)indole, EDC, HOBt • H₂0, (i-Pr)₂NEt, DMF.

0161Commercially-available tetrahydroquinoline (VII-1) is condensed with an appropriate aldehyde, typically benzaldehyde (PhCHO), under standard conditions to afford the olefinic derivative VII-2. Oxidative cleavage of the exocyclic olefin affords ketone VII-3. Generally, ozonolysis in a neutral solvent, such as methylene chloride (CH₂C1₂), methanol (MeOH), or mixtures thereof, followed by in situ reduction of the intermediate ozonide with an appropriate reducing agent, usually dimethylsulfide, is the method of choice for this transformation. Compound VII-3 is converted to the 7-membered lactam derivative VII-6 as described by Jδssang-Yanagida and Gansser (J. Het. Chem. 1978, 5, 249-251). This procedure involves conversion of the ketone of VII-3 to the corresponding oxime VII-4, which is subsequently converted to the O-tosyl derivative VII-5. A Beckmann-type rearrangement of VII-5 affords the lactam VII-6. Bromination of VII-6 with a suitable brominating agent, such as bromine (Br₂) or N-bromosuccinimide (NBS), affords the bromo derivative VII-7. Typical solvents for a bromination reaction include CH C1₂, CCI4, MeOH, AcOH, or mixtures thereof. Bromide VII-7 reacts with an appropriate ,β-unsaturated ester, for example tert-butyl acrylate, in a Heck-type reaction as described in Scheme I to afford VII-8. The tert-butyl ester of VII-8 is cleaved to the corresponding carboxylic acid VII-9 under standard acidic conditions. Typical conditions for this transformation are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-Interscience). VII-9 is converted to VII-10 by the general method described in Scheme I.

0162Scheme VIII

0163<img file="WO03088897A2_D0025.tif" />

0164(a) (Boc)₂O, THF; (b) NaH, ethyl bromoacetate, THF; (c) TFA, CH₂C1₂; (d) Et₃N, toluene; (e) N-methyl-N-(2-methyl-lH-indol-3-ylmethyl)acrylamide, Pd(OAc)₂, P(o-tol)3, (i-Pr)₂NEt, propionitrile.

0165Compound VIII-1, prepared as described in Scheme V, reacts with two equivalents of an appropriate acylating agent, preferably di-tert-butyl dicarbonate, to afford VIII-2. As discussed in Scheme VI, the protecting group for the amines must be compatible with subsequent chemistry, and must be readily removable when desired. VIII-2 is deprotonated with a suitable base, generally sodium hydride (NaH), and the intermediate sodium salt is reacted with an appropriate alkylating agent, for instance ethyl bromoacetate, to afford VIII-3. Polar solvents such as DMF , THF, or mixtures thereof are generally preferred for this reaction. The Boc protecting groups are removed under standard acidic conditions (see Greene above) to afford VIII-4, which undergoes cyclization to compound VIII-5 on exposure to a suitable base, typically triethylamine (Et3N) or diisopropylethylamine ((i-Pr)₂NEt). An inert solvent, such as toluene, is preferred. VIII-5 is converted to VIII-6 by the general method described in Scheme IV.

0166Scheme IX

0167<img file="WO03088897A2_D0026.tif" />

0168(a) 2-aminopyridine, sodium tert-butoxide, tris(dibenzylideneacetone)dipalladium(0), 1,3- bis(diphenylphosphino)propane, toluene.

0169Commercially available 2,5-dibromopyridine (IX-1) reacts with 2-aminopyridine in the presence of a suitable base, typically sodium tert-butoxide, to afford the dipyridylamine derivative IX-2. The reaction is mediated by a suitable palladium (0) catalyst, such as tris(dibenzylideneacetone)dipalladium(0), in the presence of an appropriate ligand, for example l,3-bis(diphenylphosphino)propane. A neutral solvent such as toluene is preferred.

0170Scheme X

0171<img file="WO03088897A2_D0027.tif" />

0172(a) N-(Diphenylmethylene)glycine ethyl ester, NaH, DMF; (b) N-methyl-N-(l-methyl-lH- indol-3-ylmethyl)acrylamide, Pd(OAc) , P(ø-tol)3, (i-Pr)₂NEt, propionitrile; (c) HCl, dioxane, H₂0.

0173Benzylic bromide V-l, prepared as described in Scheme IV, reacts with an appropriate a-aminoester equivalent, for example N-(diphenylmethylene)glycine ethyl ester, under basic conditions, to provide X-2. A polar, aprotic solvent, such as DMF, THF, DME, or mixtures thereof, is generally preferred, and sodium hydride is typically the base of choice, although LDA or LiN(TMS)₂ might also be used. Alternatively, the reaction might be conducted in an alcoholic solvent, such as methanol or ethanol, with an alkali metal alkoxide, for example sodium methoxide or sodium ethoxide, as the base. The diphenylmethylene group is conveniently removed under acidic conditions, such as HCl in aqueous dioxane. Other conditions for the removal of a diphenylmethylene group are known to those of skill in the art, and can be found in the chemical literature or in standard reference volumes, such as Greene (see above). Acid addition salts of the compounds are prepared in a standard manner in a suitable solvent from the parent compound and an excess of an acid, such as hydrochloric, hydrobromic, hydrofluoric, sulfuric, phosphoric, acetic, trifluoroacetic, maleic, succinic or methanesulfonic. Certain of the compounds form inner salts or zwitterions which may be acceptable. Cationic salts are prepared by treating the parent compound with an excess of an alkaline reagent, such as a hydroxide, carbonate or alkoxide, containing the appropriate cation; or with an appropriate organic amine. Cations such as Li⁺, Na⁺, K⁺, Ca⁺⁺, Mg⁺⁺ and NH4^"1" are specific examples of cations present in pharmaceutically acceptable salts. This invention also provides a pharmaceutical composition which comprises a compound according to the instant invention and a pharmaceutically acceptable carrier. Accordingly, the compounds of the present invention may be used in the manufacture of a medicament. Pharmaceutical compositions of the compounds of this invention prepared as hereinbefore described may be formulated as solutions or lyophilized powders for parenteral administration. Powders may be reconstituted by addition of a suitable diluent or other pharmaceutically acceptable carrier prior to use. The liquid formulation may be a buffered, isotonic, aqueous solution. Examples of suitable diluents are normal isotonic saline solution, standard 5% dextrose in water or buffered sodium or ammonium acetate solution. Such formulation is especially suitable for parenteral administration, but may also be used for oral administration or contained in a metered dose inhaler or nebulizer for insufflation. It may be desirable to add excipients such as polyvinylpyrrolidone, gelatin, hydroxy cellulose, acacia, polyethylene glycol, mannitol, sodium chloride or sodium citrate.

0174Alternately, these compounds may be encapsulated, tableted or prepared in a emulsion or syrup for oral administration. Pharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition. Solid carriers include starch, lactose, calcium sulfate dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin. Liquid carriers include syrup, peanut oil, olive oil, saline and water. The carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax. The amount of solid carrier varies but, preferably, will be between about 20 mg to about 1 g per dosage unit. The pharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulating, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms. When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion or an aqueous or non-aqueous suspension. Such a liquid formulation may be administered directly p.o. or filled into a soft gelatin capsule.

0175For rectal administration, the compounds of this invention may also be combined with excipients, such as cocoa butter, glycerin, gelatin or polyethylene glycols, and molded into a suppository. For topical administration, the compounds of this invention may be combined with diluents to take the form of ointments, gels, pastes, creams, powders or sprays. The compositions which are ointments, gels, pastes or creams contain diluents, for example, animal and vegetable fats, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures of these substances. The compositions which are powders or sprays contain diluents, for example, lactose, talc, silicic acid, aluminum hydroxide, calcium silicate and polyamide powder, or mixtures of these substances. Additionally, for topical ophthalmologic administration, the typical carriers are water, mixtures of water and water miscible solvents, such as lower alkanols or vegetable oils, and water-soluble non-toxic polymers, for example cellulose derivatives, such as methyl cellulose. The compounds described herein are inhibitors of Fab I, and are useful for treating bacterial infections. For instance, these compounds are useful for the treatment of bacterial infections, such as, for example, infections of upper respiratory tract (e.g. otitis media, bacterial tracheitis, acute epiglottitis, thyroiditis), lower respiratory (e.g. empyema, lung abscess), cardiac (e.g. infective endocarditis), gastrointestinal (e.g. secretory diarrhoea, splenic abscess, retroperitoneal abscess), CNS (e.g. cerebral abscess), eye (e.g. blepharitis, conjunctivitis, keratitis, endophthalmitis, preseptal and orbital cellulitis, darcryocystitis), kidney and urinary tract (e.g. epididymitis, intrarenal and perinephric abscess, toxic shock syndrome), skin (e.g. impetigo, folliculitis, cutaneous abscesses, cellulitis, wound infection, bacterial myositis), and bone and joint (e.g. septic arthritis, osteomyelitis). Also, the compounds of this invention may be useful as antifungal agents. Additionally, the compounds may be useful in combination with known antibiotics.

0176The compounds of this invention are administered to the patient, in a manner such that the concentration of drug is sufficient to treat bacterial infections. The pharmaceutical composition containing the compound is administered at an oral dose of between about 10 mg to about 1000 mg, taken once or several times daily, in a manner consistent with the condition of the patient. Preferably, the oral dose would be about 50 mg to about 500 mg, although the dose may be varied depending upon the age, body weight and symptoms of the patient. For acute therapy, parenteral administration is preferred. An intravenous infusion of the compound of formula (I) in 5% dextrose in water or normal saline, or a similar formulation with suitable excipients, is most effective, although an intramuscular bolus injection is also useful. The precise level and method by which the compounds are administered is readily determined by one skilled in the art.

0177The compounds may be tested in one of several biological assays to determine the concentration of compound which is required to have a given pharmacological effect. Cloning of S. aureus Fabl:

0178The fabl gene was cloned from the chromosomal DNA of S. aureus strain WCTJH29 using the polymerase chain reaction. Amplification was performed using Taq DNA polymerase (BRL) and the following primers: 5'-

0179CGCCTCGAGATGTTAAATCTTGAAAACAAAACATATGTC-3' and 5 - CGCGGATCCAATCAAGTCAGGTTGAAATATCCA-3' (Xhol and BamHL sites underlined). The resulting fragment was then digested with Xhol and BamHl and ligated into Xhol- and βαmHI-digested expression vector pET-16b (Novagen), producing pET- Hisi0"/^αW- The gene sequence of fabl was confirmed by automated cycle sequencing using an Applied Biosystems model 377 machine. The untagged version of pET-fabl was constructed by digesting <img file="WO03088897A2_D0028.tif" /> with Ncol and Ndel to remove a 97 bp fragment encoding the His 10 tag, the factor Xa cleavage site and the first 8 amino acids of Fabl, and replacing it with a linker encoding the first 8 amino acids of Fabl plus a glycine residue between the initiator methionine and the lysine at position 2. This plasmid was called pET- fabl. The linker was made by annealing the following two oligonucleotides: 5'- CATGGGCTTAAATCTTGAAAACAAAACA-3' and 5 -

0180TATGTTTTGTTTTCAAGATTTAAGCC-3'. The linker sequence in pET -fabl was confirmed by dideoxy sequencing. Only native Fabl was used for compound evaluation. For overproduction of native Fabl, plasmid pET-fabl was transformed into BL21(DE3) (Novagen) cells, to form strain BL21(DE3):pET-/ W.

0181Purification of S. aureus Fabl

0182S. aureus Fabl was expressed as soluble protein to 10% of total cell protein, 400g cells being recovered from 15L fermentation in tryptone phosphate medium. The cells were lysed and the sample centrifuged. The resulting supernatant was filtered and purified using three consecutive chromatography columns: ion-exchange (Sourse 15Q), dye-affinity (Blue sepharose), and size exclusion chromatography columns (Superose 12). After each column the Fabl containing fractions were pooled, concentrated, and checked for purity and biological activity.

0183Cloning/Expression Haemophilus influenzae Fabl

0184The Fabl gene was PCR amplified from Haemophilus influenzae (Ql) genomic DNA.

0185Oligonucleotide primers were designed with unique restriction sites at both the N' and C terminal ends of the gene to allow efficient sub-cloning into the expression vector pPROLar.

FORWARD PRIMER

0187Kpnl 5' GCGGTACCCATGCGCTTGGTTTTCTTAGAAATATTG '3 REVERSE PRIMER Notl 5' GCGGCCGCTTATTCTTCGCCTAATTCGCCCATTGC '3

0188PCR amplification was performed using Pfu Turbo DΝA polymerase as per the instructions of the manufacturer (Stratagene). The following cycling conditions were used: 95 °C for 3 minutes followed by 30 cycles of 94 °C 1 minute, 55 °C 1 minute and 72 °C 3 minutes. A final extension at 72 °C for 5 minutes was carried out. PCR products of expected size for Haemophilus influenzae Fabl were cloned into the PCR cloning vector TOPO TA 2.1 as per instructions of the manufacturer (Invitrogen). The fidelity of the presumptive PCR amplified Haemophilus influenzae Fabl gene was confirmed by DΝA sequencing on both strands using an ABI 377 Automative DΝA Sequencer (Applied Biosystems). pPROLar was digested with Kpnl and Notl restriction endonucleases using conditions as recommended by the supplier (New England Biolabs). Purification of the linear plasmid, was achieved using agarose gel purification and the Qia-quick gel purification kit as per the protocol supplied by the manufacturer (Qiagen). The Haemophilus influenzae Fabl gene was excised from TOPO TA 2.1 by Kpnl and Notl restriction endonuclease digestion and purified as above. Subsequent fragment/vector ligations were carried out using T4 DNA ligase, using conditions supplied by the manufacturer (Promega).

0189Transformations into E. coli TOP 10 competent cells were performed using the protocol as supplied by the manufacturer (Invitrogen). Verification of the resultant clones was carried out using colony PCR and restriction endonuclease digestion. Positive clones were then transformed into the expression strain E. coli DH5^»PRO, which expresses AraC in addition to the lac repressor.

0190Subsequent clones were then evaluated for expression at small-scale using the conditions as recommended by the manufacturer (Clontech). Expression analysis showed over-expressed protein bands of correct size for Haemophilus influenzae Fabl clearly visible by SDS PAGE. Protein identity was further confirmed by peptide mass fingerprinting. Further analysis by N-terminal Amino Acid sequencing of the purified protein showed that the N- terminus starts 35 residues downstream of the presumptive initiation codon. DNA sequence analysis also highlighted the presence of a ribosome binding site upstream and correctly spaced from the new initiation codon. These findings match perfectly with E. coli Fabl and the protein is also now a similar size to other Fabls. The over-expression construct has managed to use the correct ribosome binding site and start at the correct ATG to give the correct protein.

0191Purification of H. influenzae Fabl

0192One liter of cells containing the H. influenzae Fabl expression construct were grown to an OD600 of 0.6. Expression was induced as described above and the cells were grown for a further 3 h and then harvested. The cell pellet was re-suspended in 10 ml 50 mM Tris pH 7.5, 1 mM PMSF, 1 mM benzamidine, 1 mM DTT (buffer A) and lysed by sonication. Cell debris was removed by centrifugation. The supernatant was loaded onto a Hi-load Q (16/10) column (Pharmacia) equilibrated in buffer A. Protein was eluted over a 200 mL gradient of 0-100% buffer B, where buffer B is buffer A + 1 M KC1. Fractions containing Fabl were identified by SDS PAGE and by their Fabl activity and pooled.

01931.5 M ammonium sulfate was added to the pooled fractions and these were then loaded onto a Hi-load phenyl sepharose (16/10) column (Pharmacia) equilibrated in 50 mM Tris pH 7.5, 1 mM PMSF, 1 mM benzamidine, 1 mM DTT, 1.5 M ammonium sulfate. Proteins were eluted with a gradient of ammonium sulfate (1.5 to 0 M) over 200 mL. Fractions containing Fabl were identified as above and pooled. The pooled fractions were buffer exchanged into 100 M Tris, pH 7.5, 2 mM DTT and glycerol was then added to 50%. The protein was stored at -20 °C. The identity of the protein was confirmed by N-terminal sequencing and MALDI mass spectrometry.

0194Cloning of E. coli Fabl:

0195A PCR fragment of correct size for E. coli Fabl was PCR amplified from E. coli chromosomal DNA, subcloned into the TOPO TA cloning vector, and verified by colony PCR + restriction endonuclease analysis. The presumptive E. coli Fabl PCR fragment was subcloned into the expression vector pBluePet. The Fabl clone was transformed into E. coli strain BL21(DE3). Small Scale expression studies show an over-expressed protein band of correct molecular weight (-28 Kda) for E. coli Fabl clearly visible following Coomassie staining of SDS PAGE gels. DNA sequencing of the E. coli Fabl expression constructs illustrated that no errors were apparent. N' terminal amino acid sequencing has confirmed the over-expressed protein band to be E. coli Fabl.

0196Purification of E. coli Fabl

0197E. coli Fabl was expressed as soluble protein to 15% of total cell protein, 120g cells being recovered from 3L fermentation in shake flasks in modified terrific broth. The cells were lysed and the sample centrifuged. The resulting supernatant was filtered and purified using three consecutive chromatography columns: ion-exchange (Sourse 15Q), dye-affinity (blue sepharose), and size exclusion (superose 12). After each column the Fabl containing fractions were pooled, concentrated and checked for purity and biological activity.

0198S aureus Fabl Enzyme Inhibition Assay (NADH):

0199Assays were carried out in half-area, 96-well microtitre plates. Compounds were evaluated in 50-uL assay mixtures containing 100 mM NaADA, pH 6.5 (ADA = N-[2- acetamido]-2-iminodiacetic acid), 4 % glycerol, 0.25 mM crotonoyl CoA, 1 mM NADH, and an appropriate dilution of S. aureus Fabl. Inhibitors were typically varied over the range of 0.01-10 uM. The consumption of NADH was monitored for 20 minutes at 30 °C by following the change in absorbance at 340 nm. Initial velocities were estimated from an exponential fit of the non-linear progress curves represented by the slope of the tangent at t = 0 min. Kilo's were estimated from a fit of the initial velocities to a standard, 4-parameter model and are typically reported as the mean ± S.D. of duplicate determinations. Triclosan, a commercial antibacterial agent and inhibitor of Fabl, is currently included in all assays as a positive control. Compounds of this invention have IC5 'S from about 5.0 micromolar to about 0.05 micromolar. S aureus Fabl Enzyme Inhibition Assay (NADPH):

0200Assays were carried out in half-area, 96-well microtitre plates. Compounds were evaluated in 150-uL assay mixtures containing 100 mM NaADA, pH 6.5 (ADA = N-[2- acetamido]-2-iminodiacetic acid), 4 % glycerol, 0.25 mM crotonoyl CoA, 50 uM NADPH, and an appropriate dilution of S. aureus Fabl. Inhibitors were typically varied over the range of 0.01-10 uM. The consumption of NADPH was monitored for 20 minutes at 30 °C by following the change in absorbance at 340 nm. Initial velocities were estimated from an exponential fit of the non-linear progress curves represented by the slope of the tangent at t = 0 min. IC5Q'S were estimated from a fit of the initial velocities to a standard, 4-parameter model and are typically reported as the mean ± S.D. of duplicate determinations. Triclosan, a commercial antibacterial agent and inhibitor of Fabl, is currently included in all assays as a positive control.

0201H. influenzae Fabl Enzyme Inhibition Assay:

0202Assays are carried out in half-area, 96-well microtiter plates. Compounds are evaluated in 150-uL assay mixtures containing 100 mM MES, 51 mM diethanolamine, 51 mM triethanolamine, pH 6.5 (MES = 2-(N-morpholino)ethanesulfonic acid), 4% glycerol, 25 uM crotonoyl-ACP, 50 uM NADH, and an appropriate dilution of H. influenzae Fabl

0203(approximately 20 nM). Inhibitors are typically varied over the range of 0.01-10 uM. The consumption of NADH is monitored for 20 minutes at 30 °C by following the change in absorbance at 340 nm. Initial velocities are estimated from an exponential fit of the nonlinear progress curves. IC50's are estimated from a fit of the initial velocities to a standard, 4-parameter model, and are typically reported as the mean ± S.D. of duplicate determinations. The apparent Ki is calculated assuming the inhibition is competitive with crotonoyl-ACP. A proprietary lead compound is currently included in all assays as a positive control.

0204E. coli Fabl Enzyme Inhibition Assay:

0205Assays were carried out in half-area, 96-well microtitre plates. Compounds were evaluated in 150-uL assay mixtures containing 100 mM NaADA, pH 6.5 (ADA = N-[2- acetamido]-2-iminodiacetic acid), 4 % glycerol, 0.25 mM crotonoyl CoA, 50 uM NADH, and an appropriate dilution of E. coli Fabl. Inhibitors were typically varied over the range of 0.01-10 uM. The consumption of NADH was monitored for 20 minutes at 30 °C by following the change in absorbance at 340 nm. Initial velocities were estimated from an exponential fit of the non-linear progress curves represented by the slope of the tangent at t = 0 min. IC5o's were estimated from a fit of the initial velocities to a standard, 4-parameter model and are typically reported as the mean ± S.D. of duplicate determinations. Triclosan, a commercial antibacterial agent and inhibitor of Fabl, is currently included in all assays as a positive control. Compounds of this invention have IC5Q'S from about 100.0 micromolar to about 0.05 micromolar.

0206Preparation and purification of crotonoyl-ACP:

0207Reactions contained 5 mg/mL E. coli apo-ACP, 0.8 mM crotonoyl-CoA (Fluka), 10 mM MgCl , and 30 uM S. pneumoniae ACP synthase in 50 mM NaHEPES, pH 7.5. The mixture was gently mixed on a magnetic stirrer at 23 °C for 2 hr, and the reaction was terminated by the addition of 15 mM EDTA . The reaction mixture was filtered through a 0.2 micron filter (Millipore) and applied to a MonoQ column (Pharmacia) equilibrated with 20 mM Tris-Cl, pH 7.5. The column was washed with buffer until all non-adherent material was removed (as observed by UV detection), and the crotonoyl-ACP was eluted with a linear gradient of 0 to 400 mM NaCl.

0208S. aureus Fabl Enzyme Inhibition Assay using crotonoyl-ACP:

0209Assays are carried out in half-area, 96-well microtitre plates. Compounds are evaluated in 150 uL assay mixtures containing 100 mM NaADA, pH 6.5 (ADA = N-(2-acetamido)-2- iminodiacetic acid), 4 % glycerol, 25 uM crotonoyl-ACP, 50 uM NADPH, and an appropriate dilution of S. aureus Fab I (approximately 20 nM). Inhibitors are typically varied over the range of 0.01-10 uM. The consumption of NADPH is monitored for 20 minutes at 30 °C by following the change in absorbance at 340 nm. Initial velocities are estimated from a linear fit of the progress curves. IC50's are estimated from a fit of the initial velocities to a standard, 4-parameter model (Equation 1) and are typically reported as the mean ± S.D. of duplicate determinations. Compounds of this invention in this assay have IC5Q'S from about 100.0 micromolar to about 0.04 micromolar. The apparent Ki is calculated from Equation 2 assuming the inhibition is competitve with crotonoyl-ACP.

0210Equation 1: v = Range/(l+[I]/IC50) s + Background

0211Equation 2: Ki(app) = IC50/(l+[S]/Ks) Antimicrobial Activity Assay:

0212Whole-cell antimicrobial activity was determined by broth microdilution using the National Committee for Clinical Laboratory Standards (NCCLS) recommended procedure, Document M7-A4, "Methods for Dilution Susceptibility Tests for Bacteria that Grow Aerobically". The compound was tested in serial two-fold dilutions ranging from 0.06 to 64 mcg/mL. Test organisms were selected from the following laboratory strains: Staphylococcus aureus Oxford, Staphylococcus aureus WCUH29, Streptococcus pneumoniae ERY2, Streptococcus pneumoniae 1629, Streptococcus pneumoniae N 1387, Enterococcus faecalis I, Enterococcus faecalis 7, Haemophilus influenzae Ql, Haemophilus influenzae NEMC1, Moraxella Catarrhalis 1502, Escherichia coli 7623 AcrABEFD+, Escherichia coli 120 AcrAB-, Escherichia coli MG1655, Escherichia coli MG1658. The minimum inhibitory concentration (MIC) was determined as the lowest concentration of compound that inhibited visible growth. A mirror reader was used to assist in determining the MIC endpoint.

0213One skilled in the art would consider any compound with a MIC of less than 256 μg/mL to be a potential lead compound. Preferably, the compounds used in the antimicrobial assays of the present invention have a MIC value of less than 128 μg/mL. Most preferably, said compounds have a MIC value of less than 64 μg/mL.

0214The examples which follow are intended in no way to limit the scope of this invention, but are provided to illustrate how to make and use the compounds of this invention. Many other embodiments will be readily apparent to those skilled in the art.

EXAMPLES

0216General

0217Proton nuclear magnetic resonance (1H NMR) spectra were recorded at either 300 or 400 MHz, and chemical shifts are reported in parts per million (δ) downfield from the internal standard tetramethylsilane (TMS). Abbreviations for NMR data are as follows: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet, dd = doublet of doublets, dt = doublet of triplets, app = apparent, br = broad. J indicates the NMR coupling constant measured in Hertz. CDCI3 is deuteriochloroform, DMSO-d6 is hexadeuteriodimethylsulfoxide, and CD3OD is tetradeuteriomethanol. Mass spectra were obtained using electrospray (ES) ionization techniques. Elemental analyses were performed by Quantitative Technologies Inc., Whitehouse, NJ. Melting points were obtained on a Thomas-Hoover melting point apparatus and are uncorrected. All temperatures are reported in degrees Celsius. Analtech Silica Gel GF and E. Merck Silica Gel 60 F-254 thin layer plates were used for thin layer chromatography. Flash chromatography was carried out on E. Merck Kieselgel 60 (230-400 mesh) silica gel. Analytical HPLC was performed on Beckman chromatography systems. Preparative HPLC was performed using Gilson chromatography systems. ODS refers to an octadecylsilyl derivatized silica gel chromatographic support. YMC ODS-AQ® is an ODS chromatographic support and is a registered trademark of YMC Co. Ltd., Kyoto, Japan. PRP-1® is a polymeric (styrene-divinylbenzene) chromatographic support, and is a registered trademark of Hamilton Co., Reno, Nevada. Celite® is a filter aid composed of acid-washed diatomaceous silica, and is a registered trademark of Manville Corp., Denver, Colorado.

0218Preparation 1

0219Preparation of (E)-3-(6-aminopyridin-3-yl)acrylic acid (Method A)

0220a) Benzyl (E)-3-(6-aminopyridin-3-yl)acrylate

0221A solution of 2-amino-5-bromopyridine (2.25 g, 13.0 mmole), benzyl acrylate (3.2 g, 19.7 mmole), Pd(OAc)₂ (0.31 g, 1.4 mmole), tri-ort .o-tolylphosphine (0.73 g, 2.4 mmole), and diisopropylethylamine (3.5 mL, 20.0 mmole) in propionitrile (50 mL) was heated at reflux overnight. The dark mixture was filtered through celite®, and the filtrate was concentrated. Flash chromatography on silica gel (3% MeOH/CH2θ2) gave the title compound (1.3 g, 39%): MS (ES) m e 255 (M + H)+.

0222b) (E)-3-(6-Aminopyridin-3-yl)acrylic acid

0223A solution of benzyl (E)-3-(6-aminopyridin-3-yl)acrylate (1.3 g, 5.1 mmole) and 1.0 N NaOH (10 mL, 10 mmole) in MeOH was heated at reflux overnight. The solution was concentrated in vacuo, and the residue was dissolved in H2O. The pH was adjusted to 6 with dilute HCl, and the solid precipitate was collected by suction filtration and dried to give the title compound (0.6 g, 72%) as a white solid: MS (ES) m/e 165 (M + H)⁺. Preparation 2

0224Preparation of (E)-3-(6-aminopyridin-3-yl)acrylic acid (Method B)

0225a) (E)-3-(6-Aminopyridin-3-yl)acrylic acid

0226Acrylic acid (23 mL, 0.33 mole) was added carefully to a solution of 2-amino-5- bromopyridine (25.92 g, 0.15 mole) and Na C0₃ (55.64 g, 0.53 mole) in H₂0 (600 mL). PdCl2 (0.53 g, 0.003 mole) was then added, and the mixture was heated at reflux. After 24 hr, the reaction was cooled to RT and filtered, and the filtrate was adjusted to pH 6 with aqueous HCl. Additional H2O (0.5 L) was added to improve mixing, and the mixture was stirred for 1 hr. The pH was readjusted to 6, then the solid was collected by suction filtration. The filter pad was washed sequentially with H2O (2 x 0.5 L), cold absolute EtOH (100 mL), and Et2θ (2 x 250 mL). Drying in high vacuum at elevated temperature gave the title compound (15.38 g, 62%) as a tan solid: IH NMR (300 MHz, DMSO-d₆) δ 8.11 (d, J = 2.0 Hz, 1 H), 7.75 (dd, J = 8.7, 2.0 Hz, 1 H), 7.43 (d, J = 15.8 Hz, 1 H), 6.53 (s, 2 H), 6.45 (d, J = 8.7 Hz, 1 H), 6.22 (d, J = 15.8 Hz, 1 H); MS (ES) m/e 165 (M + H)+.

0227Preparation 3

0228Preparation of (E)-3-(2-aminopyrimidin-5-yl)acrylic acid

0229a) Benzyl (E)-3-(2-aminopyrimidin-5-yl)acrylate

0230According to the procedure of Preparation 1 (a), except substituting 5-bromo-2- aminopyrimidine (1.95 g, 11.2 mmole) for 2-amino-5-bromopyridine, the title compound (2.25 g, 79%) was prepared as a light orange solid: MS (ES) m/e 256 (M + H)+.

0231b) (E)-3-(2-Aminopyrimidin-5-yl)acrylic acid

0232According to the procedure of Preparation 1 (b), except substituting benzyl (E)-3- (2-aminopyrimidin-5-yl)acrylate (2.93 g, 11.5 mmole) for benzyl (E)-3-(6-aminopyridin-3- yl)acrylate, the title compound (1.71 g, 90%) was prepared as an off-white solid: MS (ES) m/e 166 (M + H)+. Preparation 4

0233Preparation of 6-bromo-3.4-dihydro-l//-L8-naphthyridin-2-one

0234a) 2-Amino-3-(hydroxymethyl)pyridine

0235Solid 2-aminonicotinic acid (199 g, 1.44 mole) was added in portions over 4 hr to 1.0 M LiAlH4 in THF (3 L, 3 mole) with stirring under Argon. An ice-bath was applied to control the temperature below 30 °C. After the addition was complete, the reaction was heated at reflux for 16 hr, then was cooled to 0 °C and carefully quenched by sequential addition of H₂0 (120 mL), 15% NaOH in H₂0 (120 mL), and H₂0 (350 mL). The resulting thick suspension was stirred for 1 hr, then was filtered through a pad of celite®. The filter pad was rinsed with THF (1 L), and the filtrate was concentrated to dryness to give the title compound (156 g, 87%) as a pale yellow waxy solid: MS (ES) m e 125.1 (M + H)+; 1H NMR (400 MHz, DMSO-d₆) δ 7.84 (dd, 1 H), 7.37 (m, 1 H), 6.53 (dd, 1 H), 5.65 (br s, 2 H), 5.16 (t, 1 H), 4.34 (d, J = 4.6 Hz, 2 H).

0236b) 2-Amino-5-bromo-3-(hydroxymethyl)pyridine hydrobromide

0237To a stirred solution of 2-amino-3-(hydroxymethyl)pyridine (156 g, 1.257 mole) in HOAc (2.5 L) at ambient temperature was added bromine (64.1 mL, 1.257 mole) dropwise over 1 hr. A suspension began to form during the addition. An exotherm to 36 °C was controlled with an ice bath. After the addition, the reaction mixture was stirred at ambient temperature overnight. The yellow precipitate was filtered, washed with ether and air-dried to give the title compound (289 g, 81%): MS (ES) m/e 203.2 (M + H)⁺; 1H NMR (400 MHz, DMSO-d₆, free base) δ 7.89 (d, J = 2.3 Hz, 1 H), 7.52 (s, 1 H), 5.92 (br s, 2 H), 5.29 (br s, 1 H), 4.30 (s, 2 H).

0238c) 2-Amino-5-bromo-3-(bromomethyl)pyridine hydrobromide

0239A suspension of 2-amino-5-bromo-3-(hydroxymethyl)pyridine hydrobromide (289 g, 1.02 mole) in 48% aqueous HBr (2.9 L) was heated at reflux for 12 hrs. Complete solution occurred during heating. The reaction mixture was cooled and a crystalline precipitate formed. This was filtered and washed with ethyl acetate and air dried to give the title compound (305 g, 86 %).

0240d) Methyl (±)-6-bromo-2-oxo- 1 ,2,3 ,4-tetrahydro- 1 H- 1 ,8-naphthyridine-3-carboxylate To a solution of dimethyl malonate (224 g, 1.7 mole) in DMF (2 L) and THF (2 L) stirred under argon and chilled to 3 °C with an ice-acetone bath was added NaH (60% Nujol dispersion, 69.2 g, 1.7 mole) in portions over 1.5 hr. The anion solution was stirred for 15 min at ca. 5 °C, then 2-amino-5-bromo-3-(bromomethyl)pyridine hydrobromide (200 g, 0.56 mole) was added in portions over 15 min. The reaction mixture was allowed to warm to ambient temperature during overnight stirring and then was heated to 80 °C for 2 hr. The reaction was then cooled and filtered and the precipitate was washed with ethyl acetate. This solid was then vigorously stirred in 2 L water for 15 min and again filtered and air-dried to give the title compound (113 g, 71 %): MS (ES) m/e 286 (M + H)⁺.

0241e) 6-Bromo-3,4-dihydro-lH-l,8-naphthyridin-2-one To a suspension of methyl (±)-6-bromo-2-oxo-l,2,3,4-tetrahydro-lH-l,8- naphthyridine-3-carboxylate (170 g, 0.596 mole) in CH3OH (10 L) was added 1.0 M NaOH (2.5 L). The reaction mixture was stirred and heated at reflux for 5 hrs and then cooled to ambient temperature. The suspension was acidified with 1.0 M HCl (3.0 L) and then was stirred and heated at reflux overnight. The reaction slurry was cooled and filtered and the solid was washed with water and vacuum dried to give the title compound (122 g of the hydrate, 90 %) as an off-white solid, HPLC purity, 94 %: MS (ES) m/e 228 (M + H)+.

0242Preparation 5

0243Preparation of 6-bromo-3-methyl-3.4-dihydro-lH-pyridor2.3--J1pyrimidin-2-one

0244a) 2-Amino-5-bromo-3-(methylaminomethyl)pyridine

0245A solution of 2-amino-5-bromo-3-(hydroxymethyl)pyridine (5.00 g, 24.6 mmole), from Preparation 4 (b), in 48% aqueous ΗBr (50 mL) was heated at reflux for 12 hrs. The reaction was concentrated and toluene was used to azeotrope the residual Η2O. The resulting light brown solid was placed under high vacuum overnight and used directly.

0246A solution of the 2-amino-3-(bromomethyl)-5-bromopyridine hydrobromide salt (prepared above) in 40% aqueous methylamine (50 mL) and THF (50 mL) was stirred at RT overnight in a pressure bottle. The reaction solution was concentrated and extracted with EtOAc (2 x 100 mL). The combined organic phases were washed with H2O, dried over Na2Sθ4 and concentrated. Purification on silica gel afforded the title compound (4.25 g, 80 %) as a yellow oil: MS (ES) m/e 217 (M + H)+.

0247b) 6-Bromo-3-methyl-3,4-dihydro-l/ -pyrido[2,3-( |pyrimidin-2-one To a solution of 2-amino-5-bromo-3-(methylaminomethyl)pyridine (2.0 g, 9.3 mmole) in dichloroethane (50 mL) was added l,l'-carbonyldiimidazole (1.9 g, 11.5 mmole). The reaction was heated at 50 °C overnight and concentrated. The residue was purified on silica gel (9: 1 CHCI3/CH3OH containing 5% NH4OH) to give the title compound (1.72 g, 77 %) as an off-white solid: MS (ES) m/e 243 (M + H)+.

0248Preparation 6

0249Preparation of (E)-3-(3H-imidazor4,5-fr1pyridin-6-yl)acrylic acid

0250a) 5-Bromo-2,3-diaminopyridine To a suspension of 2-amino-5-bromo-3-nitropyridine (2.0 g, 9.17 mmole) in absolute EtOH (50 mL) was added SnCl2 hydrate (9.3 g, 41.3 mmole), then the mixture was heated to reflux. After 3 hr the mixture was cooled to RT and concentrated. The residue was taken up in 2.0 M NaOH and extracted with EtOAc (3x). The combined organic layers were dried (MgS04), filtered, and concentrated to give the title compound (1.69 g, 98%) which was sufficiently pure for use in the next step: MS (ES) m/e 188/190 (M + H)⁺.

0251b) 6-Bromo-3H-imidazo[4,5-b]pyridine

02525-Bromo-2,3-diaminopyridine (1.69 g, 8.99 mmole) was taken up in 96% formic acid (50 mL) and heated to reflux. After 18 hr the mixture was cooled to RT and concentrated. The residue was taken up in H2O and the pH was adjusted to 7 with 2.0 M NaOH. The title compound (1.54 g, 87%) was collected as a solid by filtration, washed with H₂0, and dried in vacuo: MS (ES) m/e 198/200 (M + H)+.

0253c) 6-Bromo-4-trityl-3H-imidazo[4,5-&amp;]pyridine

0254To a suspension of 6-bromo-3H-imidazo[4,5-b]pyridine (1.2 g, 6.06 mmole) in CH₂C1₂ (30 mL) was added Et₃N (1.3 mL, 9.09 mmole) then trityl chloride (2.03 g, 7.27 mmole) at RT. After 72 hr the mixture was washed with H2O (2x) and brine, then was dried (MgSθ4), filtered, and concentrated under reduced pressure to afford the title compound. This was used directly in the next step.

0255d) Benzyl (E)-3-(4-trityl-3H-imidazo[4,5-b]pyridin-6-yl)acrylate

0256A solution of 6-bromo-4-trityl-3/ -imidazo[4,5-b]pyridine (from step a) (6.06 mmole), benzyl acrylate (1.18 g, 7.27 mmole), Pd(OAc)2 (67 mg, 0.30 mmole), P(o-tolyl)3 (183 mg, 0.6 mmole), and (i-Pr)2NEt (2.64 mL, 15.15 mmole) in propionitrile (30 mL) was degassed (3 x ^/vacuum) then heated to reflux. After 4 hr the mixture was cooled to RT and concentrated. Flash chromatography on silica gel (30% EtOAc/hexanes) gave the title compound (1.75 g, 55% over 2 steps) as an off-white foam: 1H NMR (400 MHz, CDCI3) δ 8.24 (d, J = 2.0 Hz, 1 H), 8.19 (d, J = 2.0 Hz, 1 H), 8.06 (s, 1 H), 7.77 (d, J = 16.0 Hz, 1 H), 7.42-7.11 (m, 20 H), 6.48 (d, J = 16.0 Hz, 1 H), 5.25 (s, 2 H).

0257d) (E)-3-(3 /-Imidazo[4,5-Z?]pyridin-6-yl)acrylic acid

0258Benzyl (E)-3-(4-trityl-3H-imidazo[4,5-b]pyridin-6-yl)acrylate (1.75 g, 3.35 mmole) was dissolved in 4 N HCl in dioxane (20 mL). After 1 hr the mixture was concentrated. The residue was taken up in 1: 1 MeOH/H₂0 (15 mL). 2.0 N NaOH (15 mL, 15 mmole) was added and the mixture was heated to reflux. After 18 hr the mixture was cooled to RT and concentrated to approximately 1/3 volume. The mixture was adjusted to pH 4 using 10% HCl. The solid was collected by filtration, washed with H2O, and dried in vacuo to give the title compound (329 mg, 52% over 2 steps) as a white solid: 1H NMR (400 MHz, d⁶-DMSO) δ 9.10 (s, 1 H), 8.94 (s, 1 H), 8.84 (s, 1 H), 8.20 (d, J = 16.0 Hz, 1 H), 7.10 (d, J = 16.0 Hz, 1 H).

0259Preparation 7

0260Preparation of (E)-3-(3,4-dihydro-2//-pyridor3.2-ol-1.4-oxazin-7-yl)acrylic acid

0261a) 3 ,4-Dihydro-2H-pyrido[3,2-b] - 1 ,4-oxazine

0262To a suspension of 2H-pyrido[3,2-b]-l,4-oxazin-3(4H)-one (2.0 g, 13.3 mmole) in dry THF (40 mL) was added a solution of LiAlH in THF (1.0 M, 26.6 mL, 26.6 mmole) slowly at 0°C. After 1 hr the mixture was quenched with 2.0 M NaOH until a solid formed. The mixture was dried (MgS04), filtered, and concentrated under reduced pressure to give the title compound (1.44 g, 79%) as a white solid which was sufficiently pure for use in the next step: MS (ES) m/e 137 (M + H)⁺.

0263b) 4-(tert-Butoxycarbonyl)-3,4-dihydro-2//-pyrido[3,2-b]-l,4-oxazine

0264To a solution of 3,4-dihydro-2H-pyrido[3,2-i]-l,4-oxazine (1.44 g, 10.6 mmole) and di-tert-butyl dicarbonate (2.78 g, 12.7 mmole) in dry THF (50 mL) was added a solution of LiHMDS in THF (1.0 M, 12.7 mL, 12.7 mmole) dropwise at 0°C. After 30 min the mixture was quenched with saturated NH4CI and extracted with EtOAc (3x). The combined organic layers were dried (MgS04), filtered, and concentrated. Flash chromatography on silica gel (40% EtOAc/hexanes) gave the title compound (2.0 g, 80%) as a clear oil: MS (ES) m/e 237 (M + H)+.

0265c) 4-(tert-Butoxycarbonyl)-7-bromo-3,4-dihydro-2H-pyrido[3,2-Z?]-l,4-oxazine To a solution of 4-(tert-butoxycarbonyl)-3,4-dihydro-2H-pyrido[3,2-b]-l,4-oxazine

0266(2.0 g, 8.46 mmole) in MeOH (40 mL) was added Br2 (0.53 mL, 10.2 mmole) dropwise at 0°C. After 1 hr the mixture was concentrated. The residue was taken up in 1: 1 Et2θ/hexanes and filtered. The filtrate was concentrated under reduced pressure to give the title compound (1.27 g, 48%) as an oil which solidified under vacuum: 1H NMR (400 MHz, CDC1₃) δ 8.10 (s, 1 H), 7.33 (s, 1 H), 4.25 (m, 2 H), 3.92 (m, 2 H), 1.54 (s, 9 H).

0267d) (E)-3-[4-(tert-Butoxycarbonyl)-3,4-dihydro-2H-pyrido[3,2--j]-l,4-oxazin-7-yl]acrylic acid

0268A solution of 4-(tert-butoxycarbonyl)-7-bromo-3,4-dihydro-2H-pyrido[3,2- >]-l,4- oxazine (1.27 g, 4.03 mmole), benzyl acrylate (785 mg, 4.84 mmole), Pd(OAc)2 (45 mg, 0.20 mmole), P(o-tolyl)3 (122 mg, 0.4 mmole), and (i-Pr)₂NEt (1.76 mL, 10.1 mmole) in propionitrile (20 mL) was degassed (3 x ^/vacuum) then heated to reflux. After 18 hr the mixture was cooled to RT and concentrated. Flash chromatography on silica gel (25% EtOAc/hexanes) gave the title compound (1.17 g, 73%) as a yellow oil: MS (ES) m/e 397 (M + Η)+.

0269e) (E)-3-(3,4-dihydro-2H-pyrido[3,2-fc][l,4]oxazin-7-yl)acrylic acid

0270(E)-3-[4-(tert-Butoxycarbonyl)-3,4-dihydro-2//-pyrido[3,2-b]-l,4-oxazin-7- yljacrylic acid (1.17 g, 2.95 mmole) was dissolved in 4 N HCl in dioxane (15 mL). After 72 hr the mixture was concentrated. The residue was taken up in 1: 1 MeOH/H2θ (20 mL). 1.0 N LiOH (15 mL, 15 mmole) was added and the mixture was heated to reflux. After 18 hr the mixture was cooled to RT and concentrated to approximately 1/3 volume. The mixture was adjusted to pH 6 using 10% HCl. The solid was collected by filtration, washed with H2O and dried in vacuo to give the title compound (315 mg, 52% over 2 steps): MS (ES) m/e 207 (M + H)+.

0271Preparation 8

0272Preparation of 5-bromo-2.2' -dipyridylamine To a stirred solution of 2,5-dibromopyridine (2.4 g, 10.1 mmole) in dry toluene (75 mL) were added 2-aminopyridine (1.0 g, 10.6 mmole), tris(dibenzylideneacetone)dipalladium(0) (183 mg, 0.2 mmole), 1,3- bis(diphenylphosphino)propane (165 mg, 0.4 mmole) and sodium tert-butoxide (1.35 g, 14 mmole). The reaction was purged with Ar then heated with stirring at 70 °C. After 4 h the reaction was cooled to RT, taken up in E-2O (200 mL), washed with brine, dried (MgS04) and concentrated to dryness. The remaining residue was purified by flash chromatography on silica gel (0.5% (5% NH4θH/MeOH)/CHCl3), triturated with hexane and dried under vacuum to give the title product (1.31 g, 52%) as a pale yellow solid: 1H NMR (400 MHz, CDC1₃) δ 9.88 (s, 1 H), 8.31 (s, 1 H), 8.23 (d, J = 4.8 Hz, 1 H), 7.83 (m, 2 H), 7.67 (t, 1 H), 7.62 (d, J = 8.4 Hz, 1 H), 6.90 (t, 1 H); MS (ES) m/e 250.0 (M + H)+.

0273Preparation 9

0274Preparation of l-methyl-2-(methylaminomethyl)-l /-indole

0275a) Ethyl 1 -methyl- lH-indole-2-carboxylate

0276NaH (60% dispersion in mineral oil, 8.02 g, 200.49 mmole) was washed with hexanes, then was suspended in dry DMF (530 mL). Solid ethyl indole-2-carboxylate (25.29 g, 133.66 mmole) was added portionwise over 5 - 10 min, allowing gas evolution to subside between additions. When the addition was complete, the yellow mixture was stirred for 15 min, then methyl iodide (42 mL, 668.3 mmole) was added all at once. The reaction was exothermic, and the internal temperature rose to 40 - 45°C. After 1 hr, the reaction was quenched with 10% NH4CI (100 mL) and concentrated on the rotavap (high vacuum). The residue was partitioned between Et2θ(500 mL) and H2O (100 L), and the layers were separated. The E-2O layer was washed with H2O (100 mL), dried (MgS04), and concentrated to leave the title compound (27.10 g, quantitative) as a light yellow solid. This was used without further purification: TLC (10% EtOAc/hexanes) Rf = 0.39.

0277b) N,l-Dimethyl-lH-indole-2-carboxamide

0278A suspension of ethyl l-methyl-lH-indole-2-carboxylate (27.10 g, 133.34 mmole) in 40% aqueous CH₃NH₂ (300 mL) and MeOH (30 mL) was stirred at RT. A solid tended to gradually creep up the walls of the flask, and was washed down periodically with MeOH.

0279The flask was tightly stoppered to keep the material inside the flask. As the reaction proceeded, the solid dissolved, but eventually the product began to precipitate. The reaction was stirred at RT for 5 days, then was concentrated to remove approximately 200 mL of the solvent. The remaining residue was diluted with H2O (300 mL), and the solid was collected by suction filtration and washed with H2O. Drying at 50 - 60°C in high vacuum left the title compound (23.45 g, 93%) as a faintly yellow solid: 1H NMR (300 MHz, CDCI3) δ 7.63 (d, J = 8.0 Hz, 1 H), 7.27 - 7.43 (m, 2 H), 7.10 - 7.20 (m, 1 H), 6.80 (s, 1 H), 6.10 - 6.30 (m, 1 H), 4.06 (s, 3 H), 3.01 (d, J = 4.9 Hz, 3 H).

0280c) l-Methyl-2-(methylaminomethyl)-lH-indole

0281A 3-liter 3-necked roundbottom flask equipped with overhead stirring was charged with N,l-dimethyl-l/ -indole-2-carboxamide (23.45 g, 124.58 mmole) and anhydrous THF (170 mL). The solution was stirred while a solution of LiAlH4 in THF (1.0 M, 250 mL,

0282250 mmole) was added via syringe. Gas was evolved during the addition of the first 50 mL of L1AIH4 solution. When the addition was complete, the resulting light yellow solution was heated at gentle reflux. After 23 hr, the reaction was cooled in ice and quenched by the sequential dropwise addition of H₂0 (9.5 mL), 15% NaOH (9.5 mL), and H 0 (28.5 mL). The mixture was stirred for 15 min, then was filtered through celite®, and the filter pad was washed thoroughly with THF. The filtrate was concentrated and the residue was flash chromatographed on silica gel (10% MeOH CHCl3 containing 0.5% cone. NH4OH). The title compound (20.17 g, 93%) was obtained as a light yellow oil: 1H NMR (300 MHz, CDCI3) δ 7.56 (d, J = 7.8 Hz, 1 H), 7.02 - 7.35 (m, 3 H), 6.38 (s, 1 H), 3.88 (s, 2 H), 3.75 (s, 3 H), 2.49 (s, 3 H).

0283Preparation 10

0284Preparation of l-methyl-3-(methylaminomethyl)-lH-indole (Method A)

0285a) Methyl l-methyl-lH-indole-3-carboxylate

0286NaH (60% dispersion in mineral oil, 8.56 g, 214.0 mmole) was added portionwise, allowing for gas evolution, to a solution of methyl lH-indole-3-carboxylate (25.00 g, 142.7 mmole) in DMF (350 mL) at 0 °C. When the NaH addition was complete, methyl iodide (44.4 mL, 713.5 mmole) was added at 0 °C. The reaction was stirred at 0 °C for 15 minutes then at RT overnight. The reaction was diluted with water and extracted with ethyl acetate.

0287The combined extracts were dried over K2CO3 and concentrated to afford the title compound (26.00 g, 96%) as an orange solid: MS (ES) m/e 190 (M + H)+.

0288b) N,l-Dimethyl-lH-indole-3-carboxamide A suspension of methyl l-methyl-l -indole-3-carboxylate (4.30 g, 22.74 mmole) in 40% aqueous CH3NH2 (400 mL) was stirred at RT. The flask was tightly stoppered to keep the material inside the flask. As the reaction proceeded the product began to precipitate. The reaction was stirred at RT for 3 days, then was concentrated to remove approximately 200 mL of the solvent. The remaining residue was diluted with H2O (500 mL), and the solid was collected by suction filtration and washed with H2O. Flash chromatography on silica gel (ethyl acetate) gave the title compound (2.4 g, 56%) as a white solid: MS (ES) m/e 189 (M + H)+.

0289c) l-Methyl-3-(methylaminomethyl)-lH-indole

0290A solution of L-AIH4 in THF (1.0 M, 5.20 mL, 5.2 mmole) was slowly added via syringe to a solution of N,l -dimethyl- lH-indole-3-carboxamide (0.50 g, 2.6 mmole) in anhydrous THF (15 mL). Gas was evolved during the addition of the first 2 mL of LiAlHψ solution. When the addition was complete, the resulting light yellow solution was heated at gentle reflux. After 23 hr, the reaction was cooled in ice and quenched by the sequential dropwise addition of H₂0 (0.5 mL), 1.0 N NaOH (0.5 mL), and H₂0 (0.5 mL). The mixture was stirred for 15 min, then was filtered through celite®, and the filter pad was washed thoroughly with THF. The filtrate was concentrated and the residue was flash chromatographed on silica gel (10% MeOH/CHCl3 containing 0.5% cone. NH4OH) to afford the title compound (0.30 g, 67%) as a light yellow oil: MS (ES) m/e 175 (M + H)⁺.

0291Preparation 11

0292Preparation of l-methyl-3-(methylaminomethyl)-lH-indole (Method B)

0293To a solution of l-methylindole-3-carboxaldehyde (10.0 g, 62.8 mmole) in MeOH (100 mL) was added a solution of 2.0 M CH₃NH₂ in MeOH (126 mL, 252.0 mmole). The reaction was stirred at RT for 2 hrs, then was concentrated to a light yellow oil. This oil was dissolved in EtOH (300 mL), and NaBH4 (2.38 g, 62.8 mmole) was added. After 2 hrs the reaction was concentrated to a slurry and dissolved in 1.0 N NaOH (75 mL). The aqueous solution was extracted with Et2θ (2 x 200 mL) and the combined organic fractions were dried over Na2Sθ4 and concentrated. Flash chromatography on silica gel (9: 1 CHC^/MeOH containing 5% NH4OH) and drying in high vacuum left the title compound (10.1 g, 92%) as a faintly yellow oil: MS (ES) m/e 175 (M + H)+. Preparation 12

0294Preparation of 2-methyl-3-(methylaminomethyl)indole

0295To a solution of 2-methylindole-3-carboxaldehyde (10.00 g, 62.84 mmole) in

0296MeOH (100 mL) was added 2 M CH₃NH₂ⁱⁿ MeOH (200 mL). After stirring for 3 hours at RT, the reaction solution was concentrated to a yellow oil which solidified under vacuum. This solid was dissolved in ethanol (350 mL) and NaBH4 (2.38 g, 62.8 mmole) was added. The reaction was stirred at RT for 6 hours, then was concentrated under vacuum. The remaining residue was diluted with saturated aqueous Na2Cθ3 (50 mL) and extracted with EtOAc (2 x 200 mL). The organic phase was separated, washed with brine, and dried over Na2Sθ4- Flash chromatography on silica gel (9: 1 CHC^/MeOH containing 5% NH4OH) and drying under high vacuum gave the title compound (6.88 g, 63%) as a faintly yellow viscous solid: MS (ES) m/e 175 (M + H)⁺.

0297Preparation 13

0298Preparation of 1.3-dimethyl-2-(methylaminomethyl)-l -indole

0299a) 1,3-Dimethyl-lH-indole

0300To a stirred solution of 3-methylindole (15.0 g, 114 mmole) in dry DMF (200 mL) was added NaH (60% dispersion in oil, 5.0 g, 125 mmole) in portions. Gas evolution was observed. The mixture was stirred for 30 min, then iodomethane (8 mL, 129 mmole) was added in one portion. The reaction became exothermic and was cooled in an ice bath. After 16 hr at RT, the reaction was concentrated under vacuum and the residue was taken up in ethyl acetate. The solution was washed with H2O then with brine, dried (MgSθ4), and concentrated to dryness. Purification by short path distillation under vacuum (bp 88- 92°C, 0.5 mmHg) gave the title compound (16.10 g, 97%) as a pale yellow oil: 1H NMR (400 MHz, CDCI3) δ 7.47 (d, J = 7.9 Hz, 1 H), 7.35 (d, J = 8.2 Hz, 1 H), 7.13 (t, 1 H), 7.06 (s, 1 H), 7.00 (t, 1 H), 3.71 (s, 3 H), 2.24 (s, 3 H).

0301b) l,3-Dimethyl-lH-indole-2-carboxaldehyde

0302To a stirred solution of phosphorus oxychloride (7.0 mL, 75 mmole) in DMF (25 mL) was added dropwise a solution of 1,3-dimethylindole (12.0 g, 83 mmole) in dry DMF (6.0 mL). The reaction was stirred at RT for 2 hr then was poured onto ice. The mixture was basified with a solution of NaOH (13.2 g, 330 mmole) in H2O (44 mL), then was extracted with Et2θ (2x 50 mL). The combined organic layers were washed with brine, dried (MgSθ4), and concentrated under vacuum. Flash chromatography on silica gel (10% ethyl acetate/hexanes) gave the title compound (13.03 g, 91%) as an off-white solid: LCMS (ES) m/e 174.2 (M + H)+; 1H NMR (400 MHz, CDC1 ) δ 10.16 (s, 1 H), 7.68 (d, J = 8.1 Hz, 1 H), 7.42 (t, 1 H), 7.32 (d, J = 8.5 Hz, 1 H), 7.15 (t, 1 H), 4.04 (s, 3 H), 2.63 (s, 3 H).

0303c) l,3-Dimethyl-2-(methylaminomethyl)-lH-indole

0304To l,3-dimethyl-l -indole-2-carboxaldehyde (13.0 g, 75 mmole) was added a solution of 2.0 M methylamine in methanol (150 mL, 300 mmole) and ΗOAc (4.3 mL, 75 mmole). The solution was stirred at RT for 4 hr, then was cooled to 0 °C, and sodium cyanoborohydride (5.0 g, 80 mmole) was added portionwise over 5 min. The reaction was then allowed to warm to RT. After 16 hr, the reaction was concentrated under vacuum and the residue was taken up in E-2O. The solution was washed with 1.0 N NaOΗ then with brine, dried (Na2S04), and concentrated to dryness. Flash chromatography on silica gel

0305(95:5 CΗC^/methanol containing 5% NH4OH) gave the title compound (7.34 g, 52%) as a yellow oil: ^lH NMR (400 MHz, CDCI3) δ 7.53 (d, J = 7.8 Hz, 1 H), 7.26 (d, J = 7.8 Hz, 1 H), 7.20 (t, 1 H), 7.09 (t, 1 H), 3.88 (s, 2 H), 3.76 (s, 3 H), 2.46 (s, 3 H), 2.32 (s, 3 H), 1.36 (br s, 1 H).

0306Preparation 14

0307Preparation of l-methyl-3-(methylaminomethyl)-lH-pyrrolor2.3-blpyridine

0308a) 1 -Methyl- lH-pyrrolo[2,3-b]pyridine

0309According to the procedure of Preparation 13 (a), except substituting 7-azaindole (2.28 g, 1.83 mmole) for the 3-methylindole, the title compound (1.4 g, 58%) was prepared as a yellow oil: MS (ES) m/e 133 (M + H)+.

0310b) 1 -Methyl- lH-pyrrolo[2,3-b]pyridine-3-carboxaldehyde

0311According to the procedure of Preparation 13 (b), except substituting 1 -methyl- 1H- pyrrolo[2,3-b]pyridine (0.7 g, 5.3 mmole) for the 1,3-dimethylindole, the title compound (0.4 g, 47%) was prepared as a white solid: MS (ES) m/e 161 (M + H)⁺.

0312c) l-Methyl-3-(methylaminomethyl)-l//-pyrrolo[2,3-Zj]pyridine According to the procedure of Preparation 13 (c), except substituting 1-methyl-lH- pyrrolo[2,3-b]pyridine-3-carboxaldehyde (0.4 g, 2.5 mmole) for the 1,3-dimethyl-lH- indole-2-carboxaldehyde, the title compound (0.2 g, 45%) was prepared as a yellow oil: MS (ES) m/e 176 (M + H)⁺.

0313Preparation 15

0314Preparation of 2-methyl-3-(methylaminomethyl)benzorElthiophene

0315a) 2-Methylbenzo[b]thiophene-3-carboxaldehyde

0316SnCl4 (20 mL, 67 mmole) was added over 5 min to a stirred solution of 2- methylbenzo[Z?]thiophene (5.0 g, 33.7 mmole) in CH2CI2 (75 mL) at 0 °C under argon. After 15 minutes, dichloromethyl methyl ether (3.7 mL, 41 mmole) was added. The reaction became a yellowish colored suspension. The reaction was allowed to warm to RT and stirred for 16 h, then was poured onto ice water (200 mL). The aqueous mixture was acidified with 1.0 N HCl (100 mL) and stirred until the suspension dissolved. The organic phase was separated, dried (MgS04), and concentrated under vacuum. Purification by flash chromatography on silica gel (10% ethyl acetate/hexane) gave the title compound (5.83 g, 98%) as a white crystalline solid: 1H NMR (400 MHz, CDCI3) δ 10.38 (s, 1 H), 8.61 (d, J = 8.1 Hz, 1 H), 7.77 (d, J = 8.0 Hz, 1 H), 7.48 (t, 1 H), 7.39 (t, 1 H), 2.93 (s, 3 H).

0317b) 2-Methyl-3-(methylaminomethyl)benzo[b]thiophene

0318According to the procedures of Preparation 1, except substituting 2- methylbenzo[-7]thiophene-3-carboxaldehyde (5.0 g, 28.4 mmole) for l-methylindole-3- carboxaldehyde, the title compound (4.89 g, 90%) was prepared as an oil which solidified in the freezer: !H NMR (400 MHz, CDCI3) δ 7.78 (d, J = 7.9 Hz, 1 H), 7.75 (d, J = 7.9 Hz, 1 H), 7.37 (t, 1 H), 7.29 (t, 1 H), 3.95 (s, 2 H), 2.60 (s, 3 H), 2.50 (s, 3 H).

0319Preparation 16

0320Preparation of 3-(methylaminomethyl)-lH-indole

0321a) 3-(Methylaminomethyl)-lH-indole

0322To a solution of indole-3-carboxaldehyde (5.4 g, 34.1 mmole) in MeOH (30 mL) was added a solution of 2.0 M CH3NH2 in MeOH (51.3 mL, 102.6 mmole). The reaction was stirred at RT overnight, then was concentrated to a light yellow oil. This oil was dissolved in EtOH (40 mL), and NaBH (1.3 g, 34.1 mmole) was added. After 16 hrs the reaction was concentrated to a slurry and dissolved in 10% Na2Cθ3(100 mL). The aqueous solution was extracted with EtOAc (2 x 200 mL) and the combined organic fractions were dried over Na2Sθ4 and concentrated. Drying in high vacuum left the title compound (5.2 g, 94%) as a faintly yellow oil: MS (ES) m/e 161 (M + H)⁺.

0323Preparation 17

0324Preparation of l-benzyl-3-(methylaminomethyl)-lH-indole

0325a) 3- [N-(Benzyloxycarbonyl)-N-methylaminomethyl] - lH-indole

0326N-(Benzyloxycarbonyloxy)succinimide (8.9 g, 35.7 mmole) was added to a solution of 3-(methylaminomethyl)-l/ -indole (5.2 g, 32.5 mmole), from Preparation 16, and triethylamine (5.0 mL, 65.7 mmole) in DMF (100 mL) at RT. The reaction was stirred overnight then was concentrated in vacuo. The residue was diluted with water and the mixture was extracted with ethyl acetate. The combined extracts were dried over Na2Sθ4 and concentrated. Flash chromatography on silica gel (33% ethyl acetate/hexanes) gave the title compound (7.0 g, 74%) as an off-white solid: MS (ES) m/e 295 (M + Η)⁺.

0327b) 3-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-l-benzyl-lH-indole

0328NaH (60% dispersion in mineral oil, 0.15 g, 3.8 mmole) was added portionwise, allowing for gas evolution, to a solution of 3-[N-(benzyloxycarbonyl)-N- methylaminomethylHH-indole (0.7 g, 2.5 mmole) in DMF (25 mL) at 0 °C. When the NaH addition was complete, benzyl bromide (1.2 mL, 10.0 mmole) was added at 0 °C. The reaction was stirred at 0 °C for 15 minutes then at RT overnight. The reaction was diluted with water and extracted with ethyl acetate. The combined extracts were dried over Na2Sθ4 and concentrated. Flash chromatography on silica gel (33% ethyl acetate/hexanes) gave the title compound (0.9 g, 93%) as an off white solid: MS (ES) m/e 385 (M + H)⁺.

0329c) 1 -Benzyl-3-(methylaminomethyl)- l /-indole

03303-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-l-benzyl-l -indole (0.9 g, 2.3 mmole) was added to a suspension of Pearlman's catalyst (about 0.30 g) in MeOH at RT in a Parr flask. The reaction was placed under 50 p.s.i. of H2 and shaken for 5 hr. The mixture was filtered through celite® and the filter pad was washed with MeOH. The filtrate was concentrated to afford the title compound (0.5 g, 86%) as a light yellow solid: <img file="WO03088897A2_D0029.tif" />

0331Preparation 18

0332Preparation of 2.3-dihydro-8-(methylaminomethyl)-lH-3a-azacyclopentarαlindene

0333a) 2,3-Dihydro- lH-3a-azacyclopenta[ ]indene-8-carboxaldehyde According to the procedure of Preparation 13 (b), except substituting 2,3-dihydro- l//-3a-azacyclopenta[α]indene (J. Med. Chem. 1965, 8, 700; 0.24 g, 1.53 mmole) for the 1,3-dimethylindole, the title compound (0.17 g, 60%) was prepared as a yellow solid: MS (ES) m/e l86 (M + H)+.

0334b) 2,3-Dihydro-8-(methylaminomethyl)-l -3a-azacyclopenta[α]indene

0335According to the procedure of Preparation 13 (c), except substituting 2,3-dihydro- l//-3a-azacyclopenta[ ]indene-8-carboxaldehyde (0.17 g, 0.92 mmole) for the 1,3- dimethyl-lH-indole-2-carboxaldehyde, the title compound (0.1 g, 54%) was prepared as a yellow oil: MS (ES) m/e 201 (M + H)+.

0336Preparation 19

0337Preparation of 1.4-dimethyl-3-(methylaminomethyl)-l//-indole

0338a) 1,4-Dimethyl-lH-indole

0339According to the procedure of Preparation 9 (a), except substituting 4-methylindole for ethyl indole-2-carboxylate, the title compound (1.5 g, 94%) was prepared as an amber oil: MS (ES) m/e 146.2 (M + H)+.

0340b) l,4-Dimethyl-lH-indole-3-carboxaldehyde

0341According to the procedure of Preparation 9 (b), except substituting 1,4-dimethyl- l /-indole for 1,3-dimethylindole, the title compound (1.8 g, 95%) was prepared as an amber oil: MS (ES) m/e 174.2 (M + H)⁺.

0342c) l,4-Dimethyl-3-(methylaminomethyl)-lH-indole According to the procedure of Preparation 11, except substituting 1,4-dimethyl-l//- indole-3-carboxaldehyde for 1,3-dimethyl-lH-indole-l -carboxaldehyde, the title compound (1.9 g, 99%) was prepared as an oil: MS (ES) m/e 189.0 (M + H)+.

0343Preparation 20

0344Preparation of (E)-3-(2-oxo-2,3-dihydro-lH-indol-5-yl)acrylic acid hydrochloride salt

0345a) 3,3,5-Tribromo-l,3-dihydropyrrolo[2,3-Z>]pyridin-2-one To a solution of 7-azaindole (5.0 g, 42.3 mmole) in H2O (210 mL) and tert-butanol

0346(210 mL) at RT was added Br2 (27 mL, 529.0 mmole) over 20 minutes. The reaction was stirred for 12 hr at RT and concentrated to an aqueous slurry. The reaction contents were made basic with solid NaHC03 and the remaining solid was filtered and washed with H2O. The filtered mass was dried under high vacuum to give the title compound (14.0 g, 89 %) as a brown solid: MS (ES) m/e 370 (M + H)⁺.

0347b) 5 -Bromo- 1 ,3 -dihydropy rrolo[2, 3 -b] pyridin-2-one

0348To a stirred solution of 3,3,5-tribromo-l,3-dihydropyrrolo[2,3--?]pyridin-2-one (2.0 g, 5.4 mmole) in acetic acid (50 mL) at RT was added Zn metal. The reaction became exothermic and was cooled by the use of an ice bath during the initial 30 minutes. After 5 hr the reaction was filtered through celite®, and the filter pad was washed with EtOAc. The filtrate was concentrated under vacuum and neutralized with saturated aqueous NaHCθ3 solution. The neutralized aqueous filtrate was then extracted with EtOAc (2 x 200 mL), and the combined organic extracts were dried over Na2S04 and concentrated to a solid. The solid was washed with hexanes and dried under high vacuum to give the title compound (0.36 g, 32%): MS (ES) m/e 215 (M + H)⁺. This was used without further purification.

0349c) tert-Butyl (E)-3-(2-oxo-2,3-dihydro-lH-indol-5-yl)acrylate A solution of 5-bromo-l,3-dihydropyrrolo[2,3-b]pyridin-2-one (2.0 g, 9.49 mmole), tert-butyl acrylate (1.8 g, 14.1 mmole), Pd(OAc)2 (0.32 g, 1.4 mmole), tή-ortho- tolylphosphine (0.57 g, 1.9 mmole), and diisopropylethylamine (4.9 mL, 28.2 mmole) in propionitrile (100 mL) and DMF (10 L) was heated at reflux overnight. The dark mixture was filtered through celite®, and the filtrate was concentrated. Flash chromatography on silica (9: 1 CHCI3/CH3OH containing 5% NH4OH) gave the title compound (0.80 g, 33%) as a light yellow solid. MS (ES) m/e 261 (M + H)+. d) (E)-3-(2-Oxo-2,3-dihydro-l/7-indol-5-yl)acrylic acid hydrochloride salt

0350To a stirred solution of rert-butyl (E)-3-(2-oxo-2,3-dihydro-lH-indol-5-yl)acrylate (0.80 g, 3.1 mmole) in CH2Cl2(50 mL) at RT was added trifluoroacetic acid (20 mL). After 1 hr the reaction solution was concentrated and the residue was dried under vacuum. An HCl solution (20 mL, 4 M in dioxane) was added and the mixture was concentrated under vacuum. The remaining solid was triturated with diethyl ether and filtered giving the title compound (0.74 g, 33%) as a white solid: MS (ES) m/e 205 (M + H - HC1)⁺.

0351Preparation 21

0352Preparation of l-ethyl-3-(methylaminomethyl)-l -indole

0353a) 3-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-l-ethyl-lH-indole According to the procedure of Preparation 17 (b), except substituting ethyl iodide

0354(0.92 mL, 11.44 mmole) for the benzyl bromide, the title compound (0.90 g, 98%) was prepared as a white solid: MS (ES) m/e 323 (M + H)⁺.

0355b) 1 -Ethyl-3-(methylaminomethyl)- lH-indole According to the procedure of Preparation 17 (c), except substituting 3-[N-

0356(benzyloxycarbonyl)-N-methylaminomethyl]-l-ethyl-l /-indole (0.90 g, 2.80 mmole) for the 3-[N-(benzyloxycarbonyl)-N-methylaminomethyl]-l-benzyl-l -indole, the title compound (0.50 g, 94%) was prepared as a white solid: MS (ES) m/e 189 (M + H)⁺.

0357Preparation 22

0358Preparation of l-isopropyl-3-(methylaminomethyl)-l /-indole

0359a) 3-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-l-isopropyl-lH-indole According to the procedure of Preparation 17 (b), except substituting isopropyl iodide (1.34 L, 11.84 mmole) for the benzyl bromide, the title compound (0.99 g, 99%) was prepared as a white solid: MS (ES) m/e 337 (M + H)⁺.

0360b) l-ethyl-3-(methylaminomethyl)-lH-indole According to the procedure of Preparation 17 (c), except substituting 3-[N-

0361(Benzyloxycarbonyl)-N-methylaminomethyl]-l -isopropyl- 1 //-indole (0.99 g, 2.98 mmole) for the 3-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-l-benzyl-l/ -indole, the title compound (0.49 g, 82%) was prepared as a white solid: MS (ES) m/e 405 (2M + H)+.

0362Preparation 23

0363Preparation of l-acetyl-3-(methylaminomethyl)-l/ -indole

0364a) l-Acetyl-3-(methylaminomethyl)indole

0365According to the procedure of Preparation 16 (a), except substituting N-acetyl-3- indole carboxaldehyde (1.33 g, 7.10 mmole), the title compound (1.40 g, 99%) was prepared as a light yellow oil: MS (ES) m/e 203 (M + H)+.

0366Preparation 24

0367Preparation of N-(lH-indol-3-ylmethyl)-N-methylacrylamide

0368a) N-( l -Indol-3-ylmethyl)-N-methylacrylamide Acryloyl chloride (0.33 mL, 4.10 mmole) was added to a solution of 3-

0369(methylaminomethyl)-l/ - indole (0.60 g, 3.70 mmole) and E-3N (1.03 mL ,7.40 mmole) in CH2CI2 (30 mL) at 0 °C. The reaction was held at 0 °C for ten minutes, then was stirred overnight at RT. The solution was concentrated in vacuo and the residue was diluted with water. The solution was extracted with ethyl acetate, and the combined organic extracts were washed with brine and dried over Na₂Sθ4. The title compound (0.64 g, 80%) was obtained as a light yellow solid: MS (ES) m/e 215 (M + H)⁺.

0370Preparation 25

0371Preparation of N-(l-benzyl-l -indol-3-yImethyl)-N-methylacrylamide

0372a) N-( 1 -Benzyl- lH-indol-3-ylmethyl)-N-methylacrylamide

0373According to the procedure of Preparation 24 (a), except substituting l-benzyl-3- (methylaminomethyl)-l//-indole (1.30 g, 5.20 mmole) for of 3-(methylaminomethyl)-lH- indole, the title compound (1.40 g, 89%) was a brown solid: MS (ES) m/e 305 (M + H)+. Preparation 26

0374Preparation of N-ri-(2-dimethylamino)-1. -indol-3-ylmethyll-N-methylacrylamide

0375a) N-[l-(2-dimethylamino)-lH-indol-3-ylmethyl]-N-methylacrylamide

0376According to the procedure of Preparation 25 (a), except substituting [l-(2- dimethylamino)]-3-(methylaminomethyl)-lH-indole (1.00 g, 2.74 mmole) for of 3- (methylaminomethyl)-l//-indole, the title compound (0.50 g, 79%) was a yellow solid: MS (ES) m/e 463 (2M + H)+.

0377Preparation 27

0378Preparation of 3-bromo-5.6.7.9-tetrahvdro-pyridor2,3-olazepin-8-one

0379a) 8-Benzylidene-5,6,7,8-tetrahydro-quinoline

0380Benzaldehyde (3.59 mL, 35.30 mmole) was added to a solution of 5,6,7,8- tetrahydro-quinoline (4.70 g, 35.30 mmole) in acetic anhydride (25 mL), and the solution was heated to reflux under a nitrogen atmosphere. After overnight at reflux, the reaction was concentrated in vacuo. The residue was diluted with water and extracted with ethyl acetate. The combined organic extracts were washed with brine, dried over Na2Sθ4, and concentrated. The residue was purified by flash chromatography on silica gel (33% EtOAc/hexanes) to give the title compound (4.50 g, 58%) as a waxy yellow solid after drying in vacuo: MS (ES) m/e 222 (M + H)+.

0381b) 6,7-Dihydro-5Z/-quinolin-8-one

0382A solution of 8-benzylidene-5,6,7,8-tetrahydro-quinoline (4.30 g, 19.4 mmole) in CH2CI2 (150 mL) was reacted with ozone at -78 °C for 30 minutes. Dimethyl sulfide (5 mL) was added, and the reaction was warmed to RT and stirred overnight. The mixture was concentrated in vacuo and the residue was purified by flash chromatography on silica gel (EtOAc). The title compound (2.20 g, 79%) was obtained as an off-white solid after drying in vacuo: MS (ES) m/e 148 (M + H)+.

0383c) 6,7-Dihydro-5H-quinolin-8-one oxime

0384According to the reported procedure (/. Het. Chem. 1978, 15, 249-251), 6,7- dihydro-5//-quinolin-8-one was reacted with hydroxylamine hydrochloride to afford the title compound (2.40 g, 96%) as a white solid after drying in vacuo: MS (ES) m/e 163 (M + H)+.

0385d) 6,7-Dihydro-5//-quinolin-8-one, O-toluenesulfonyloxime According to the reported procedure (J. Het. Chem. 1978, 15, 249-251), 6,7- dihydro-5H-quinolin-8-one oxime was reacted with p-toluenesulfonyl chloride to afford the title compound (4.00 g, 85%) as a white solid after drying in vacuo: MS (ES) m/e 317 (M + H +.

0386e) 5,6,7,9-Tetrahydro-pyrido[2,3-b]azepin-8-one

0387According to the reported procedure (/. Het. Chem. 1978, 15, 249-251), 6,7- dihydro-5//-quinolin-8-one, O-toluenesulfonyloxime was reacted to afford the title compound (1.00 g, 50%) as a white solid after drying in vacuo: MS (ES) m/e 163 (M + Η)+.

0388f) 3-Bromo-5,6,7,9-tetrahydro-pyrido[2,3-b]azepin-8-one

0389A 10 % solution of bromine (0.57 mL, 11.1 mmole) in CH2CI2 was added dropwise over 1 hr to a solution of 5,6,7,9-tetrahydro-pyrido[2,3-Z}]azepin-8-one (1.20 g, 7.4 mmole) in CH₂C1₂ at RT. The mixture was stirred at RT overnight, then was concentrated in vacuo. The residue was diluted with 10% Na₂C03 and extracted with EtOAc. The combined organics were dried over Na₂Sθ4 and concentrated. Flash chromatography on silica gel (EtOAc) gave the title compound (1.00 g, 56%) as a light yellow solid after drying in vacuo: MS (ES) m/e 241/243.

0390Preparation 28

0391Preparation of 5-bromo-2-(methylaminocarbonylmethyl)aminopyridine

0392a) 5-Bromo-2-(tert-butoxycarbonyl)aminopyridine To a solution of 2-amino-5-bromopyridine (27.56 g, 159 mmole) in THF (150 mL) was added di-tert-butyl dicarbonate (38 g, 174 mmole). The reaction was gradually heated to reflux. Vigorous gas evolution was observed initially, which subsided after approximately 10 min. After 18 hr at reflux, the reaction was concentrated to dryness. The residue was triturated with 1: 1 Et₂0/petroleum ether, filtered and dried under vacuum to give the title compound (34.79 g, 80%) as a white solid: 1H NMR (400 MHz, CDCI3) δ 8.49 (s, 1 H), 8.37 (dd, 1 H), 7.94 (d, J = 9.0 Hz, 1 H), 7.77 (dd, 1 H), 1.57 (s, 9 H). b) 5-Bromo-2-[N-(tert-butoxycarbonyl)-N-(methoxycarbonylmethyl)amino]pyridine To a solution of 5-bromo-2-(tert-butoxycarbonyl)aminopyridine (25.0 g, 91.5 mmole) in DMF (400 mL) was added portionwise with stirring a 60% dispersion of NaH in mineral oil (4.0 g, 100 mmole). The reaction was stirred for 15 min, then methyl bromoacetate (15 mL, 158.5 mmole) was added dropwise over 15 min. After stirring for 18 h at room temperature the reaction was concentrated to dryness. The remaining residue was taken up in EtOAc (200 mL) and H₂0 (200 mL) and filtered to remove insoluble material. The EtOAc phase was separated, washed with brine, dried (Na₂S04) and concentrated to dryness. Purification by flash chromatography on silica gel (10%

0393EtOAc/Hexane) gave the title compound (16.56 g, 50%): 1H NMR (400 MHz, CDC1₃) δ 8.33 (s, 1 H), 7.73 (d, J = 2.5 Hz, 1 H), 7.71 (d, J = 2.5 Hz, 1 H), 4.69 (s, 2 H), 3.75 (s, 3 H), 1.51 (s, 9 H).

0394c) 5-Bromo-2-(methoxycarbonylmethyl)aminopyridine

0395A 50% solution of TFA in CH₂C1₂ (200 mL) was added to 5-bromo-2-[N-(tert- butoxycarbonyl)-N-(methoxycarbonylmethyl)amino]pyridine (16.5 g, 46 mmole). After stirring for 45 min the reaction was concentrated to dryness, and the residue was diluted with 1.0 N Na₂Cθ3 (300 mL). The mixture was extracted with EtOAc (300 mL), and the organic layer was washed with brine, dried (Na₂S04), and concentrated to dryness under vacuum. The title compound (11.32 g, 100%) was obtained as a white solid: *H NMR (400 MHz, CDCI3) δ 8.13 (d, J = 2.3 Hz, 1 H), 7.48 (dd, 1 H), 6.40 (d, J = 8.8 Hz, 1 H), 4.95 (br s, IH), 4.12 (d, J = 5.5 Hz, 2 H), 3.78 (s, 3H).

0396d) 5-Bromo-2-(methylaminocarbonylmethyl)aminopyridine

0397A solution of 2.0 M methylamine in MeOH (75 mL) was added to 5-bromo-2- (methoxycarbonylmethyl)aminopyridine (2.9 g, 12 mmole). The reaction was stirred for 24 h then was concentrated to dryness. The residue was triturated with 10% petroleum ether/Et₂0 (100 mL), then was collected and dried under vacuum to give the title compound (2.96 g, 100%) as an off-white solid: MS (ES) m/e 244.2 (M + H)⁺.

0398Preparation 29

0399Preparation of methyl 2-amino-5-bromonicotinate

0400a) Methyl 2-aminonicotinate Concentrated H₂S04 (20 mL, 360 mmole) was added dropwise over 5 minutes to a suspension of 2-aminonicotinic acid (25 g, 181 mmole) in MeOH (400 mL), and the mixture was heated at reflux; a homogeneous solution formed within 5 min. After 72 h, the reaction was cooled to room temperature and concentrated under vacuum. The residue was basified with 1.0 N Na₂C0₃ (500 mL) (Gas evolution !) and extracted with EtOAc (500 mL). The organic layer was washed with brine, dried (Na₂Sθ4), and concentrated to dryness to give the title compound (19.6 g, 71%) as a white solid: 1H NMR (400 MHz, CDC1₃) δ 8.22 (dd, 1 H), 8.13 (dd, 1 H), 6.63 (dd, 1 H), 6.30 (br s, 2 H), 3.89 (s, 3 H).

0401b) Methyl 2-amino-5-bromonicotinate

0402Bromine (0.7 mL, 14 mmole) was added dropwise to a stirred solution of methyl 2- aminonicotinate (2.0 g, 13 mmole) in HOAc (50 mL). A suspension formed within 30 min. The reaction was allowed to stir at room temperature for 2 h, then was concentrated under vacuum. The residue was triturated with 1.0 N Na2θθ3 (50 mL) and the solid was collected by suction filtration. The solid was washed with H2O (50 mL) and dried under vacuum to give the title compound (2.95 g, 98%) as a pale yellow solid: 1H NMR (400 MHz, CDCI3) δ 8.24 (d, J = 2.5 Hz, 1 H), 8.23 ( d, J = 2.5 Hz, 1 H), 6.40 (br s, 2 H), 3.90 (s, 3 H).

0403Preparation 30

0404Preparation of (E)-3-r6-rN-(methoxycarbonylmethyl)aminolpyridin-3-yl1acrylic acid hydrochloride salt

0405a) tert-Butyl (E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]acrylate

0406A solution of 5-bromo-2-(methoxycarbonylmethyl)aminopyridine (4.69 g, 19.1 mmole, from Preparation 28 (c)), tert-butyl acrylate (11.2 mL, 76.5 mmole), DIEA (6.7 mL, 38.5 mmole), Pd(OAc)2 (215 mg, 1 mmole), and P(o-tol)3 (583 mg, 2 mmole) in propionitrile (100 mL) was purged with Ar, then was heated at reflux. After 18 h, the reaction was allowed to cool to room temperature then was concentrated to dryness. The residue was purified by flash chromatography on silica gel (40% EtOAc/hexane) to give the title compound (5.21 g, 93%) as a white solid: 1H NMR (400 MHz, CDCI3) δ 8.19 (s, 1 H), 7.62 (dd, 1 H), 7.47 (d, J = 16.0 Hz, 1 H), 6.48 (d, J = 8.7 Hz, 1 H), 6.17 (d, J = 15.9 Hz, 1 H), 5.21 (br s, 1 H), 4.20 (d, J = 5.4 Hz, 2 H), 3.79 (s, 3 H), 1.52 (s, 1 H). b) (E)-3-[6-[N-(Methoxycarbonylmethyl)amino]pyridin-3-yl]acrylic acid hydrochloride salt

0407A solution of 50% TFA in CH₂Cl2 (75 mL) was added to tert-butyl (E)-3-[6-[N- (methoxycarbonylmethyl)amino]pyridin-3-yl]acrylate (5.20 g, 17.8 mmole). The reaction was stirred at room temperature for 45 min then was concentrated under vacuum. The residue was taken up in 4.0 N HCl in dioxane (75 mL), stirred for 5 min, then concentrated to dryness under vacuum. The remaining solid was triturated with 1: 1 Et2θ/petroleum ether, filtered and dried under vacuum to give the title compound (4.87 g, 100%) as a white solid: MS (ES) m/e 237.2 (M + H)+.

0408Preparation 31

0409Preparation of (E)-3-(7-oxo-5.6.7.8-tetrahydro-l .8-naphthyridin-3-yl)acrylic acid hydrochloride salt

0410a) tert-Butyl (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylate

0411A solution of 6-bromo-3,4-dihydro-l//-l,8-naphthyridin-2-one (12.99 g, 57 mmole), tert-butyl acrylate (34 mL, 232 mmole), DIEA (21.2 mL, 122 mmole), Pd(OAc)2 (1.3 g, 5.8 mmole) and P(o-tol)3 (3.5 g, 11.5 mmole) in propionitrile (200 mL) and DMF (50 mL) was purged with Ar, then was heated at reflux. After 18 h the reaction was allowed to cool to room temperature and was concentrated to dryness. The residue was purified by flash chromatography on silica gel (2-4% MeOH CHCl3). The resulting residue was triturated with 1:1 Et2θ/petroleum ether, collected, and dried, and the resulting material was triturated with 1: 1 MeOH/H₂0, collected, and dried, to give the title compound (7.09 g, 45%) as an off-white solid: 1H NMR (400 MHz, d₆-DMSO) δ 10.70 (s, 1 H), 8.35 (d, J = 2.0 Hz, IH), 8.04 (s, 1 H), 7.50 (d, J = 16.0 Hz, 1 H), 6.51 (d, J = 16.0 Hz, 1 H), 2.89 (t, 2 H), 2.53 (t, 2 H), 1.48 (s, 9H); MS (ES) m/e 275.2 (M + H +.

0412b) (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylic acid hydrochloride salt

0413To tert-butyl (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylate (7.0 g, 25.5 mmole) was added 1: 1 TFA/CH₂C1₂ (100 mL). The reaction was stirred for 30 min, then was concentrated under vacuum. The residue was suspended in 4 N HCl/dioxane (100 mL), triturated, and concentrated to dryness. The resulting solid was triturated with Et₂0, collected, and dried under vacuum to give the title compound (6.55 g, 100%) as a off-white solid: 1H NMR (400 MHz, d₆-DMSO) δ 10.72 (s, 1 H), 8.35 (d, J = 2.0 Hz, 1 H), 8.04 (s, 1 H), 7.54 (d, J = 16.0 Hz, 1 H), 6.51 (d, J = 16.0 Hz, 1 H), 2.91 (t, 2 H), 2.53 (t, 2 H); MS (ES) /e 219.0 (M + H)+.

0414Preparation 32

0415Preparation of N-methyl-N-(l-methyl-l /-pyrrolof2.3-fclpyridin-ylmethyl)acrylamide

0416A solution of acryloyl chloride (0.43 g, 5.58 mmole) in CH2CI2 (10 L) was added dropwise with stirring to a solution of l-methyl-3-(methylaminomethyl)-l//-pyrrolo[2,3- 6]pyridine (0.93 g, 5.28 mmole) and triethylamine (0.8 mL, 5.8 mmole) in CH2CI2 (40 mL) at 0 °C under N . The reaction was allowed to warm to RT and stir for 1 hr, then was concentrated in vacuo. The residue was dissolved in 10% NaOH and extracted with CH2CI2 (3 x 20 mL). The extracts were dried (MgSθ4), filtered, and concentrated. The residual oil was flash chromatographed on silica gel (5% MeOH/CH₂Cl₂) to give the title compound (1.0 g, 80%) as a colorless oil: MS (ES) m/e 216 (M + H)+.

0417Preparation 33

0418Preparation of 7-fluoro-l-methyl-3-(methylaminomethyl)-lH-indole

0419a) 7-Fluoro-lH-indole-3-carboxaldehyde

0420According to the procedure of Preparation 11 (b), except substituting 7- fluoroindole (0.5 g, 3.7 mmole) for the 1,3 dimethylindole, the title compound (0.5 g, 83%) was prepared as a waxy solid: MS (ES) m/e 164 (M + H)⁺.

0421b) 7-Fluoro-l-methyl-lH-indole-3-carboxaldehyde

0422According to the procedure of Preparation 9 (a), except substituting 7-fluoro-lH- indole-3-carboxaldehyde (0.5 g, 3.1 mmole) for the ethyl indole-2-carboxylate, the title compound (0.23 g, 43%)was prepared as a viscous oil: MS (ES) m/e 178 (M + H)⁺.

0423c) 7-Fluoro- 1 -methyl-3-(methy laminomethyl)- 1 -indole

0424According to the procedure of Preparation 11 (c), except substituting 7-fluoro-l- methyl-l//-indole-3-carboxaldehyde (0.23, 1.3 mmole) for the l,3-dimethyl-l//-indole-2- carboxaldehyde, the title compound (0.18 g, 72%) was prepared as a viscous oil: MS (ES) m/e 193 (M + H)+. Preparation 34

0425Preparation of 6-fluoro-l-methyl-3-(methylaminomethyl)-lH-indole

0426a) 6-Fluoro-lH-indole-3-carboxaldehyde

0427According to the procedure of Preparation 11 (b), except substituting 6- fluoroindole (0.5 g, 3.7 mmole) for the 1,3-dimethylindole, the title compound (0.3 g, 50%) was prepared as a waxy solid: MS (ES) m/e 164(M + Η)⁺.

0428b) 6-Fluoro-l-methyl-l /-indole-3-carboxaldehyde

0429According to the procedure of Preparation 9 (a), except substituting 6-fluoro-lH- indole-3-carboxaldehyde (0.3 g, 1.8 mmole) for the ethyl indole-2-carboxylate, the title compound (0.3 g, 94%) was prepared as a viscous oil: MS (ES) m/e 178 (M + H)⁺.

0430c) 6-Fluoro-l-methyl-3-(methylaminomethyl)-lH-indole

0431According to the procedure of Preparation 11 (c), except substituting 6-fluoro-l- methyl-lH-indole-3-carboxaldehyde (0.3 g, 1.69 mmole) for the l,3-dimethyl-lH-indole-2- carboxaldehyde, the title compound (0.11 g, 35%) was prepared as a viscous oil: MS (ES) m/e 193 (M + Η)+.

0432Preparation 35

0433Preparation of 5-fluoro-l-methyl-3-(methylaminomethyl)-lH-indole

0434a) 5-Fluoro-lH-indole-3-carboxaldehyde

0435According to the procedure of Preparation 11 (b), except substituting 5- fluoroindole (0.5 g, 3.7 mmole) for the 1,3-dimethylindole, the title compound (0.3 g, 50%) was prepared as a waxy solid: MS (ES) m/e 164 (M + H)⁺.

0436b) 5-Fluoro-l-methyl-l/ -indole-3-carboxaldehyde

0437According to the procedure of Preparation 9 (a), except substituting 5-fluoro-lH- indole-3-carboxaldehyde (0.3 g, 1.8 mmole) for the ethyl indole-2-carboxylate, the title compound (0.16 g, 50%) was prepared as a viscous oil: MS (ES) m/e 178 (M + H)⁺.

0438c) 5-Fluoro-l-methyl-3-(methylaminomethyl)-lH-indole According to the procedure of Preparation 11 (c), except substituting 5-fluoro-l- methyl-l//-indole-3-carboxaldehyde (0.3 g, 1.69 mmole) for the 1,3 dimethyl- 1H-2 - carboxaldehyde, the title compound (0.11 g, 35%) was prepared as a viscous oil: MS (ES) m/e 193 (M + H)+.

0439Preparation 36

0440Preparation of 4-fluoro-l-methyl-3-(methylaminomethyl)-l/ -indole

0441a) 4-Fluoro-lH-indole-3-carboxaldehyde

0442According to the procedure of Preparation 11 (b), except substituting 4- fluoroindole (0.5 g, 3.7 mmole) for the 1,3-dimethylindole, the title compound (0.41 g, 68%) was prepared as a waxy solid: MS (ES) m/e 164(M + H)⁺.

0443b) 4-Fluoro-l-methyl-lN-indole-3-carboxaldehyde

0444According to the procedure of Preparation 9 (a), except substituting 4-fluoro-l /- indole-3-carboxaldehyde (0.41 g, 2.5 mmole) for the ethyl-indole-2-carboxylate, the title compound (0.24 g, 54%) was prepared as a viscous oil: MS (ES) m/e 178 (M + H)⁺.

0445c) 4-Fluoro-l-methyl-3-(methylaminomethyl)-l/ -indole

0446According to the procedure of Preparation 11 (c), except substituting 4-fluoro-l- methyl-l//-indole-3-carboxaldehyde (0.3 g, 1.69 mmole) for the l,3-dimethyl-l -indole-2- carboxaldehyde, the title compound (0.2 g, 77%)was prepared as a viscous oil: MS (ES) m/e 193 (M + H)⁺.

0447Preparation 37

0448Preparation of (l-ethyl-5-fluoro-3-(methylaminomethyl)-l//-indole

0449a) 5-Fluoro- lH-indole-3-carboxaldehyde

0450According to the procedure of Preparation 11 (b), except substituting 5- fluoroindole (0.5 g, 3.7 mmole) for the 1,3-dimethylindole, the title compound (0.3 g, 50%) was prepared as a waxy solid: MS (ES) m/e 164(M + H)⁺.

0451b) l-Ethyl-5-fluoro-l /-indole-3-carboxaldehyde According to the procedure of Preparation 9 (a), except substituting 5-fluoro-lH- indole-3-carboxaldehyde (0.41 g, 2.5 mmole) for the ethylindole-2-carboxylate, the title compound (0.20 g, 57%) was prepared as a viscous oil: MS (ES) m/e 191 (M + H)⁺.

0452c) l-Ethyl-5-fluoro-3-(methylaminomethyl)-lH-indole

0453According to the procedure of Preparation 11 (c), except substituting l-ethyl-5- fluoro-l//-indole-3-carboxaldehyde (0.2 g,1.9 mmole) for the l,3-dimethyl-lH-indole-2- carboxaldehyde, the title compound (0.1 g, 50%) was prepared as a viscous oil: MS (ES) m/e 207 (M + H)⁺.

0454Preparation 38

0455Preparation of 4.6-dichloro-l-methyl-2-(methylaminomethyl)-lH-indole

0456a) Ethyl 4,6-dichloro-l -methyl- l -indole-2-carboxylate

0457NaH (60% dispersion in mineral oil, 0.24 g, 6 mmole) was washed with hexanes, then was suspended in anhydrous DMF (16 mL). The mixture was cooled to 0 °C, and ethyl 4,6-dichloroindole-2-carboxylate (1.03 g, 4 mmole) was added. After 2-3 min, iodomethane (1.3 mL, 20 mmole) was added, and the mixture was warmed to RT. The mixture became thick, and stirring became difficult for several minutes. After 0.5 hr, the reaction was cooled to 0 °C and quenched with 10% NH4CI (2 mL). The mixture was concentrated to dryness, and the residue was partitioned between Et₂0 (50 mL) and H₂0 (10 mL). The layers were separated and the organic layer was washed with H₂0 (5 mL), dried (MgSO4), and filtered, and the filter pad was washed with a little CH₂C1₂.

0458Concentration afforded the title compound (1.06 g, 97%) as an off-white solid: ^H NMR (400 MHz, CDCI3) δ 7.34 (s, 1 H), 7.30 (s, 1 H), 7.17 (d, J = 1.5 Hz, 1 H), 4.39 (q, J = 7.1 Hz, 2 H), 4.05 (s, 3 H), 1.42 (t, J = 7.1 Hz, 3 H); MS (ES) m/e 272 and 274 (M + H)+.

0459b) N,l -Dimethyl- lH-indole-2-carboxamide

0460A suspension of ethyl 4,6-dichloro-l -methyl- l//-indole-2-carboxylate (1.06 g, 3.90 mmole) in 2.0 M CΗ3NΗ₂/CΗ3θΗ (40 mL) in a sealed pressure bottle was heated in an oil bath preset at 50 °C. A homogeneous solution formed within 2.5 hr. The reaction was kept at 50 °C for 17.5 hr, during which time a solid precipitated. The mixture was cooled to RT and poured into H₂0 (40 mL). The resulting mixture was concentrated on the rotavap to remove the methanol, and the solid was collected by suction filtration. This was washed with plenty of H₂0 and dried in high vacuum at 45-50 °C to afford the title compound (0.99 g, 99%) as an off-white solid: 1H NMR (400 MHz, CDC1₃) δ 7.29 (s, 1 H), 7.16 (d, J = 1.5 Hz, 1 H), 6.86 (s, 1 H), 6.21 (br s, 1 H), 4.02 (s, 3 H), 3.02 (d, J = 4.9 Hz, 3 H); MS (ES) m/e 257 and 259 (M + H)+.

0461c) 4,6-Dichloro-l-methyl-2-(methylaminomethyl)-l//-indole

0462A solution of 2.0 M BH3 • DMS in THF (3.6 mL, 7.2 mmole) was added to a solution of N,l-dimethyl-lH-indole-2-carboxamide (0.74 g, 2.88 mmole) in anhydrous THF (25 mL), and the reaction was heated at reflux. After 18 hr, the reaction was cooled to 0 °C and quenched with MeOH (5 mL). The solution was warmed to RT, stirred for 0.5 hr, then concentrated on the rotavap. The residue was re-concentrated from MeOH, then was purified by flash chromatography on silica gel (5% MeOH/CHCl3 containing 0.5 % cone. NH4OH). The title compound (197.5 mg, 28%) was obtained as a white solid: 1H NMR (400 MHz, CDCI3) δ 7.19 (dd, J = 1.5, 0.8 Hz, 1 H), 7.09 (d, J = 1.5 Hz, 1 H), 6.45 (s, 1 H), 3.88 (s, 2 H), 3.74 (s, 3 H), 2.50 (s, 3 H); MS (ES) m/e 212 and 214 (M + H - CH₃NH₂)+.

0463Preparation 39

0464Preparation of l,7-dimethyl-3-(methylaminomethyl)-lZ/-indole

0465a) 1,7-Dimethyl-lH-indole

0466According to the procedure of Preparation 13 (a), except substituting 7- methylindole for the 3-methylindole, the title compound (1.95 g, 90%) was obtained as a light-colored oil: MS (ES) m/e 146.2 (M + H)+.

0467b) 1 ,7-Dimethyl- l//-indole-3-carboxaldehyde

0468According to the procedure of Preparation 13 (b), except substituting 1,7- dimethylindole for the 1,2-dimethylindole, the title compound (1.85 g, 82%) was obtained as an off white solid: MS (ES) m/e 174.2 (M + H)+.

0469c) l,7-Dimethyl-3-(methylaminomethyl)-l//-indole

0470According to the procedure of Preparation 13 (c), except substituting 1,7-dimethyl- lH-indole-3-carboxylate for the l,3-dimethyl-l/ -indole-2-carboxylate, the title compound (0.74 g, 98%) was obtained as an amber oil: MS (ES) m/e 189.2 (M + H)+. Preparation 40

0471Preparation of 4-methoxy- 1 -methyl-3-(methylaminomethyl)- IH- indole

0472a) 4-Methoxy-l-methyl-lH-indole-3-carboxaldehyde

0473According to the procedure of Preparation 13 (b), except substituting l-methyl-4- methoxyindole for the 1,2-dimethylindole, the title compound (2.17 g, 93%) was obtained as an off white solid: MS (ES) /e 190.2 (M + Η)+.

0474b) 4-Methoxy-l-methyl-3-(methylaminomethyl)-lH-indole

0475According to the procedure of Preparation 13 (c), except substituting l-methyl-4- methoxy-lH-indole-3-carboxaldehyde for the l,3-dimethyl-lH-indole-2-carboxaldehyde, the title compound (2.0 g, 95%) was obtained as a white solid: MS (ES) m/e 205.2 (M + Η)+

0476Preparation 41

0477Preparation of 5-methoxy-l-methyl-3-(methylaminomethyl)-lH-indole

0478a) 5-Methoxy-l-methyl-lH-indole-3-carboxaldehyde

0479According to the procedure of Preparation 13 (a), except substituting 5-methoxy- lH-indole-3-carboxaldehyde for the 3-methyl-lH-indole-3-carboxaldehyde, the title compound (0.86 g, 92%) was obtained as a light tan solid: MS (ES) m/e 190.2 (M + H)⁺.

0480b) 5-Methoxy-l-methyl-3-(methylaminomethyl)-lH-indole

0481According to the procedure of Preparation 13 (c), except substituting 5-methoxy-l- methyl-lH-indole-3-carboxaldehyde for the l,3-dimethyl-lH-indole-2-carboxaldehyde, the title compound (0.85 g, 98%) was obtained as a light yellow oil: MS (ES) m/e 205.2 (M + H)⁺.

0482Preparation 42

0483Preparation of 7-methoxy-l-methyl-3-(methylaminomethyl)-lH-indole

0484a) 7-Methoxy-l-methyl-l//-indole According to the procedure of Preparation 13 (a), except substituting 7- methoxyindole for 3 -methyl indole, the title compound (1.55 g, 96%) was obtained as a tan solid: MS (ES) m/e 162.2 (M + H)+.

0485b) 7 -Methoxy- 1 -methyl- lH-indole-3-carboxaldehyde

0486According to the procedure of Preparation 13(b), except substituting 7-methoxy-l- methyl-lH-indole for the 1,2-dimethylindole, the title compound (1.6 g, 91%) was obtained as an off white solid: MS (ES) /e 190.2 (M + H)+.

0487c) 7-Methoxy-l-methyl-3-(methylaminomethyl)-lH-indole

0488According to the procedure of Preparation 13(c), except substituting 7-methoxy-l- methyl-lH-indole-3-carboxaldehyde for the l,3-dimethyl-lH-indole-2-carboxaldehyde, the title compound (1.6 g, 94%) was obtained as an amber oil: MS (ES) m/e 205.2 (M + H)⁺.

0489Preparation 43

0490Preparation of 7-chloro-l-methyl-3-(methylaminomethyl)-lH-indole

0491a) 7-Chloro-l -methyl- IH-indole According to the procedure of Preparation 13 (a), except substituting 7- chloroindole for the 3-methylindole, the title compound (2.2 g, 100%) was obtained as a white solid: MS (ES) m/e 166.2 (M + Η)⁺.

0492b) 7-Chloro- 1 -methyl- 1 H-indole-3-carboxaldehyde According to the procedure of Preparation 13 (b), except substituting 7-chloro-l- methyl-1 / -indole for the 1,2-dimethylindole, title compound (2.1 g, 84%) was obtained as a white solid: MS (ES) m/e 194.0 (M + H)+.

0493c) 7-Chloro- 1 -methyl-3-(methylaminomethyl)- IH-indole According to the procedure of Preparation 13 (c), except substituting 7-chloro-l- methyl-l//-indole-3-carboxaldehyde for the l,3-dimethyl-lH-indole-2-carboxaldehyde, the title compound (2.0 g, 93%) was obtained as an amber oil: MS (ES) m/e 209.2 (M + Η)+.

0494Preparation 44

0495Preparation of 6-chloro- l-methyl-3-(methylaminomethyl)- IH-indole a) 6-Chloro-l-methyl-lH-indole

0496According to the procedure of Preparation 13 (a), except substituting 6- chloroindole for the 3-methylindole, the title compound (2.2 g, 100%) was obtained as a white solid: MS (ES) m/e 166.2.0 (M + H)+.

0497b) 6-Chloro- 1 -methyl- lH-indole-3-carboxaldehyde

0498According to the procedure of Preparation 13 (b), except substituting 6-chloro-l- methyl- IH-indole for the 1,2-dimethylindole, title compound (2.2 g, 88%) was obtained as an amber oil: MS (ES) m/e 194.2 (M + Η)+.

0499c) 6-Chloro-l-methyl-3-(methylaminomethyl)- IH-indole

0500According to the procedure of Preparation 13 (c), except substituting 6-chloro-l- methyl-lH-indole-3-carboxaldehyde for the l,3-dimethyl-l -indole-2-carboxaldehyde, the title compound (2.1 g, 93%) was obtained as an amber oil: MS (ES) m/e 209.2 (M + Η)⁺.

0501Preparation 45

0502Preparation of 5-chloro-l-methyl-3-(methylaminomethyl)-lH-indole

0503a) 5-Chloro-l-rnethyl-l//-indole

0504According to the procedure of Preparation 13 (a), except substituting 5- chloroindole for the 3-methylindole, the title compound (2.0 g, 91%) was obtained as an amber oil: MS (ES) m/e 166.0 (M + H)+.

0505b) 5-Chloro-l-methyl-lH-indole-3-carboxaldehyde

0506According to the procedure of Preparation 13 (b), except substituting 5-chloro-l- methyl- IH-indole for the 1,2-dimethylindole, title compound (2.0 g, 83%) was obtained as an white solid: MS (ES) /e 194.0 (M + Η)+.

0507c) 5-Chloro-l-methyl-3-(methylaminomethyl)-lH-indole

0508According to the procedure of Preparation 13 (c), except substituting 5-chloro-l- methyl-lH-indole-3-carboxaldehyde for the ,3-dimethyl-lH-indole-2-carboxaldehyde, the title compound (2.1 g, 93%) was obtained as an amber oil: MS (ES) m/e 209.0 (M + Η)⁺. Preparation 46

0509Preparation of 4-chloro-l-methyl-3-(methylaminomethyD- IH-indole

0510a) 4-Chloro-l-methyl-lH-indole

0511According to the procedure of Preparation 13 (a), except substituting 4- chloroindole for the 3-methylindole, the title compound (2.2 g, 100%) was obtained as an amber oil: MS (ES) m/e 166.0 (M + Η)+.

0512b) 4-Chloro-l -methyl- lH-indole-3-carboxaldehyde

0513According to the procedure of Preparation 13 (b), except substituting 4-chloro-l- methyl- IH-indole for the 1,2-dimethylindole, title compound (1.9 g, 76%) was obtained as an off-white solid: MS (ES) m/e 194.0 (M + Η)⁺.

0514c) 4-Chloro-l-methyl-3-(methylaminomethyl)- IH-indole

0515According to the procedure of Preparation 13 (c), except substituting 4-chloro-l- methyl-lH-indole-3-carboxaldehyde for the l,3-dimethyl-lH-indole-2-carboxaldehyde, the title compound (1.75 g, 78%) was obtained as a yellow solid: MS (ES) m/e 209.0 (M + Η)+.

0516Preparation 47

0517Preparation of l.l-dimethyl-3-(methylaminomethyl)-3H-indene

0518a) l,l-Dimethyl-3//-indene-3-carboxaldehyde

0519The title compound was obtained in quantitative yield according to established literature procedures (Chem. Pharm. Bull. 1986, 34, 390-395; 7et. Lett. 1993, 34, 2979): 1H NMR (400 MHz, CDC1₃) δ 10.05 (s, 1 H), 8.05 (d, 2 H), 7.35 (m, 4 H), 1.40 (s, 6 H).

0520b) l,l-Dimethyl-3-(methylaminomethyl)-3//-indene

0521According to the procedure of Preparation 12, except substituting l,l-dimethyl-3H- indene-3-carboxaldehyde for the 2-methylindole-3-carboxaldehyde, the title compound (3 g, 81%;) was obtained as a reddish oil: MS (ES) m/e 188.2 (M + Η)+. Preparation 48

0522Preparation of 7-hydroxy-l-methyl-3-(methylaminomethyl)- IH-indole

0523a) 7-Benzyloxy-l -methyl- IH-indole

0524According to the procedure of Preparation 13 (a), except substituting 7- benzyloxyindole for the 3-methylindole, the title compound (4.8 g, 100%) was obtained as an amber oil: MS (ES) m/e 238.0 (M + Η)+.

0525b) 7-Benzyloxy-l-methyl-lH-indole-3-carboxaldehyde According to the procedure of Preparation 13 (b), except substituting 7-benzyloxy-

05261 -methyl- IH-indole for the 1,2-dimethylindole, title compound (4.5 g, 85%) was obtained as an oil: MS (ES) m/e 266.0 (M + Η)+.

0527c) 7-Benzyloxy-l-methyl-3-(methylaminomethyl)- IH-indole According to the procedure of Preparation 13 (c), except substituting 7-benzyloxy- l-methyl-lH-indole-3-carboxaldehyde for the l,3-dimethyl-lH-indole-2-carboxaldehyde, the title compound (3.7 g, 88%) was obtained as an oil: MS (ES) m/e 281.2 (M + Η)⁺.

0528d) 7-Hydroxy-l-methyl-3-(methylaminomethyl)- IH-indole According to the literature procedure (J. Org. Chem. 1978, 43, 4195-96), 7- benzyloxy-l-methyl-3-(methylaminomethyl)- IH-indole was hydrogenated to afford the title compound (300 mg, 79%) as a brown solid: MS (ES) m/e 191.2 (M + Η)+.

0529Preparation 49

0530Preparation of 3-(methylaminomethyl)-1.2.7-trimethyl- IH-indole

0531a) 1,2,7-Trimethyl- IH-indole

0532According to the procedure of Preparation 13 (a), except substituting 2,7- dimethylindole for the 3-methylindole, the title compound (960 mg, 87%) was obtained as an oil: MS (ES) m/e 160.2 (M + Η)+.

0533b) l,2,7-Trimethylindole-3-carboxaldehyde According to the procedure of Preparation 13 (b), except substituting 1,2,7- trimethyl- IH-indole for the 1,4-dimethylindole, the title compound (800 mg, 62%) was obtained as a light tan solid: MS (ES) m/e 188.2 (M + Η)+.

0534c) 3-(Methylaminomethy 1)- 1 ,2,7-trimethyl- IH-indole

0535According to the procedure of Preparation 13 (c) except substituting 1,2,7- trimethyl-lH-indole-3-carboxaldehyde for the l,3-dimethyl-lH-indole-2-carboxaldehyde, the title compound (570 mg, 71%) was obtained as an oil which slowly crystallized: MS (ES) m/e 405.4 (2M + Η)+.

0536Preparation 50

0537Preparation of 7-chloro-3-(methylaminomethyD- IH-indole

0538a) 7-Chloro- lH-indole-3-carboxaldehyde

0539According to the procedure of Preparation 13 (b), except substituting 7- chloroindole for the 1,2-dimethylindole, the title compound (0.48 g, 44%) was obtained as a white solid after recrystallization from hot EtOAc: MS (ES) m/e 180.0 (M + Η)⁺.

0540b) 7-Chloro-3-(methylaminomethyl)- IH-indole

0541According to the procedure of Preparation 13 (c), except substituting 7 -chloro- 1H- indole-3-carboxaldehyde for the l,3-dimethyl-lH-indole-2-carboxaldehyde, the title compound (440 mg, 92%) was obtained as an off white solid: MS (ES) m/e 195.2 (M + Η)⁺.

0542Preparation 51

0543Preparation of 2-(methylarninomefhyl)naphthalene

0544To a stirred solution of 40 wt% methylamine in H₂0 (50 mL, 581 mmole) in THF

0545(50 mL) at 0 °C was added 2-(bromomethyl)naphthalene (10 g, 43 mmole) in one portion. The reaction was allowed to warm to RT and stirred for 16 hr, then was then concentrated under vacuum. The residue was taken up in Et₂0 and washed with 1.0 N NaOH then with brine, dried (Na₂S04), and concentrated to dryness. Purification by flash chromatography on silica gel (98:2 to 9: 1 CHC methanol containing 5% NH4OH) gave the title compound (3.95 g, 54%) as a clear oil: 1H NMR (400 MHz, CDC1₃) δ 7.85 (m, 3 H), 7.79 (s, 1 H), 7.49 (m, 3 H), 3.94 (s, 2 H), 2.53 (s, 3 H).

0546Preparation 52

0547Preparation of 3-(methylaminomethyl)quinoline

0548A solution of 3-quinolinecarboxaldehyde (1.5 g,10 mmole), 2.0 M CH₃NH₂/MeOH (10 mL, 20 mmole), glacial AcOH (0.6 mL, 10 mmole), and NaBH₃CN (0.35 g, 11 mmole) in MeOH (20 mL) was stirred at RT overnight, then was concentrated in vacuo. The residue was diluted with 5% NaOH and extracted with CH₂C1₂. The combined organic extracts were washed with brine, dried over MgS04, and concentrated. Flash chromatography on silica gel (10% MeOH/CH₂Cl₂) gave the title compound (0.83 g, 24%) as a slightly yellow viscous oil: MS (ES) m/e 173 (M + H)+.

0549Preparation 53

0550Preparation of (E)-2-methyl-3-(7-oxo-5.6,7.8-tetrahydro-1.8-naphthyridin-3-yl)acrylic acid hydrochloride salt

0551a) tert-Butyl (E)-2-methyl-3-(7-oxo-5,6J,8-tetrahydro-l,8-naphthyridin-3-yl)acrylate According to the procedure of Preparation 31 (a), except substituting tert-butyl methacrylate (4.7 g, 33.2 mmole) for the tert-butyl acrylate, the title compound (2.7 g, 42 %) was prepared as a yellow solid: MS (ES) m/e 289 (M + H)⁺.

0552b) (E)-2-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylic acid hydrochloride salt

0553According to the procedure of Preparation 31 (b), except substituting tert-butyl (E)- 2-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylate (2.7 g, 9.3 mmole) for the tert-butyl (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylate, the title compound (2.5 g, 99 %) was prepared as a white solid: MS (ES) m/e 232 (M + H)⁺.

0554Preparation 54

0555Preparation of (E)-3-methyl-3-(7-oxo-5.6.7.8-tetrahydro-1.8-naphthyridin-3-yl)acrylic acid hydrochloride salt a) tert-Butyl (E)-3-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylate

0556According to the procedure of Preparation 31 (a), except substituting tert-butyl crotonate (4.7 g, 33.2 mmole) for the tert-butyl acrylate, the title compound (3.7 g, 58 %) was prepared as a yellow solid: MS (ES) m/e 289 (M + H)⁺.

0557b) (E)-3-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylic acid hydrochloride salt

0558According to the procedure of Preparation 31 (b), except substituting tert-butyl (E)- 3-methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylate (3.7 g, 12.8 mmole) for the tert-butyl (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylate, the title compound (3.4 g, 99 %) was prepared as a white solid: MS (ES) m/e 232 (M + H)⁺.

0559Preparation 55

0560Preparation of 7-bromo-4-methyl-1.2.4.5-tetrahydropyridor2,3-e1-l,4-diazepin-3-one

0561a) 5-Bromo-3-[N-(tert-butoxycarbonyl)-N-methylaminomethyl]-2-[N-(tert- butoxycarbonyl)amino]pyridine To a solution of 2-amino-5-bromo-3-(methylaminomethyl)pyridine (3.8 g, 17.6 mmole), from Preparation 5 (a), in THF was added di-tert-butyl dicarbonate (8.8 g, 40.5 mmole). The reaction was heated to reflux for 12 hr then was concentrated under vacuum. Flash chromatography on silica gel (1: 1 hexanes/EtOAc) gave the title compound (6.2 g, 85 %) as a white waxy solid: MS (ES) m/e 416 (M + H)⁺.

0562b) 5-Bromo-2-[(ethoxycarbonyl)methylamino]-3-(methylaminomethyl)-2-[N-(tert- butoxycarbonyl)amino]pyridine bis-trifluoroacetic acid salt

0563To a suspension of 60% NaH (0.46 g, 11.5 mmole) in THF (100 mL) at RT was added 5-bromo-3-[N-(tert-butoxycarbonyl)-N-methylaminomethyl]-2-[N-(tert- butoxycarbonyl)amino]pyridine (4.0 g, 9.61 mmole). After 30 min, ethyl bromoacetate (1.8 g, 10.6 mmole) was added. The reaction was stirred at RT for 12 hr, then was quenched with H₂0 (5 mL) and concentrated. The residue was dissolved in EtOAc (200 mL), and the solution was washed with H₂0 (100 mL), dried over Na₂S04, and concentrated under high vacuum to a light yellow solid. This was dissolved in CH₂C1₂ (50 mL) and trifluoroacetic acid (20 mL). After 2 hr, the reaction was concentrated under vacuum and the residue was purified flash chromatography on silica gel (95:5 CHCI3/CH3OH). The title compound (4.1 g, 80%) was obtained as a yellow solid: MS (ES) m/e 302 (M + H)+

0564c) 7-Bromo-4-methyl- 1 ,2,4,5-tetrahydropyrido[2,3-e]- 1 ,4-diazepin-3-one To a solution of 5-bromo-2-[(ethoxycarbonyl)methylamino]-3-

0565(methylaminomethyl)-2-[N-(terf-butoxycarbonyl)amino]pyridine bis-trifluoroacetic acid salt (4.1 g, 7.7 mmole) in toluene was added triethylamine (3.3 mL, 23.7 mmole). The reaction was heated at reflux for 72 hr then concentrated under vacuum. Flash chromatography on silica gel (9: 1 CHCI3/CH3OH containing 5% NH4OH) gave the title compound (1.4 g, 72 %) as a tan solid: MS (ES) m/e 256 (M + H)⁺.

0566Preparation 56

0567Preparation of (E)-3-(8-oxo-6,7,8.9-tetrahvdro-5H-pyridor2,3-E|azepin-3-yl)-acrylic acid hydrochloride salt

0568a) tert-butyl (E)-3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-Z)]azepin-3-yl)acrylate

0569A solution of 3-bromo-5,6,7,9-tetrahydro-pyrido[2,3-σ]azepin-8-one (1.00 g, 4.15 mmole), tert-butyl acrylate (0.67 mL, 4.60 mmole), DIEA (1.45 mL, 8.30 mmole), Pd(OAc)₂ (0.09 g, 0.42 mmole) and P(o-tol)₃ (0.25 g, 0.85 mmole) in propionitrile (25 mL) was purged with N₂ and then heated at reflux overnight. The dark mixture was filtered through a pad of celite®, and the filter pad was rinsed with acetonitrile (250 mL). The filtrate was concentrated in vacuo, and the residue was purified by flash chromatography on silica gel (ethyl acetate). The title compound (0.70 g, 58%) was obtained as a light yellow solid after drying in vacuo: MS (ES) m/e 289 (M + Η)⁺.

0570b) (E)-3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-b]azepin-3-yl)-acrylic acid hydrochloride salt

0571According to the procedure of Preparation 31 (b), except substituting tert-butyl (E)- 3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-Z?]azepin-3-yl)acrylate (0.70 g, 2.40 mmole) for the tert-butyl (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylate, the title compound (0.49 g, 77%) was obtained as an off-white solid after drying in vacuo: MS (ES) m/e 233 (M + Η)⁺. Preparation 57

0572Preparation of l-(2-hydroxyethyl)-3-(methylaminomethyl)- IH-indole

0573According to the reported literature procedure (J. Org. Chem. 1998, 63, 6721-6726) except substituting 3-[N-(benzyloxycarbonyl)-N-methylaminomethyl]-lH-indole (3.70 g, 12.60 mmole) for the 5-bromoindole, the title compound (4.00 g, 93%) was obtained as a yellow solid after drying in vacuo: MS (ES) m/e 338 (M + Η)⁺.

0574Preparation 58

0575Preparation of 2-chIoro-l-methyl-2-(methylaminomethyl)-lH-indole

0576a) 2-Chloro-lH-indole-3-carboxaldehyde To DMF (30 mL) with stirring at 0 °C was added dropwise phosphorus oxychloride

0577(10 mL, 107 mmole) over 5 minutes. The reaction was stirred for an additional 15 minutes, then oxindole (6.0 g, 45 mmole) was added portionwise over 5 min. The reaction was allowed to warm to RT and stirred for 18 h then was carefully poured into ice water (350 mL). The solution was stirred for 6 h after which time a suspension formed. The solids were filtered off, washed with cold water, pressed dry and dried under vacuum to give the title compound (6.83 g, 84%) as a yellowish solid: 1H NMR (400 MHz, d₆-DMSO) δ 10.0 (s, 1 H), 8.05 (dd, 1 H), 7.43 (dd, 1 H), 7.23-7.31 (m, 2 H); MS (ES) m/e 179.0 (M + H)+.

0578b) 2-Chloro-l-methyl-lH-indole-3-carboxaldehyde NaΗ (60% dispersion in mineral oil) (0.9 g, 22.5 mmole) was added portionwise over 5 min to a solution of 2-chloro-l -indole-3-carboxaldehyde (3.8 g, 21.2 mmole) and iodomethane (1.5 mL, 24 mmole) in DMF (50 mL) with stirring at 0 °C. The reaction was allowed to warm to RT and stir for 4 h, then was concentrated under vacuum. The remaining residue was taken up in EtOAc, and the solution was washed with water then brine, dried (MgS04), and concentrated to dryness. Trituration with 1: 1 Et₂0/petroleum ether, filtration, and drying under vacuum gave the title compound (3.10 g, 76%) as an off- white solid: 1H NMR (400 MHz, CDC1₃) δ 10.12 (s, 1 H), 8.29 (m , 1 H), 7.33 (m, 3 H), 3.81 (s, 3 H); MS (ES) m/e 194.0 (M + H)+.

0579c) 2-Chloro-l-methyl-2-(methylaminomethyl)-lH-indole

0580According to the procedure of Preparation 12, except substituting 2-chloro-l- methyl- lH-indole-3-carboxaldehyde (3.0 g, 15.5 mmole) for the l-methylindole-3- carboxaldehyde, the title compound (2.91 g, 90%) was prepared as an oil: 1H NMR (400 MHz, CDC1₃) δ 7.60 (d, J = 7.9 Hz, 1 H), 7.22 (m, 2 H), 7.13 (m, 1 H), 3.92 (s, 2 H), 3.71 (s, 3 H), 2.44 (s, 3 H).

0581Preparation 59

0582Preparation of 3-(benzhydrylideneamino)-6-bromo-3,4-dihydro-lH- 8-naphthyridin-2-one

0583NaΗ (60% dispersion in mineral oil, 1.2 g, 30 mmole) was added portionwise over

058410 min to a solution of N-(diphenylmethylene)glycine ethyl ester (8.0 g, 30 mmole) in DMF (150 mL) with stirring under Ar at 0 °C. The reaction was stirred for 15 min, then 2- amino-5-bromo-3-(bromomethyl)pyridine hydrobromide (5.0 g, 14.4 mmole) was added in one portion. The reaction was allowed to warm to RT and stir for 18 h, then was concentrated under vacuum. The remaining residue was taken up in EtOAc (150 mL), hexane (150 mL), and Η₂0 (150 mL). The resulting suspension was triturated and filtered, and the solid was dried under vacuum to give the title compound (3.27 g, 56%) as an off- white solid: ^!H NMR (400 MHz, d₆-DMSO) δ 10.92 (s, 1 H), 8.23 (s, 1 H), 7.86 (s, 1 H), 7.26-7.55 (m, 10 H), 4.05 (dd, 1 H), 3.10 (t, 2 H); MS (ES) m/e 406.0 (M + H)+.

0585Preparation 60

0586Preparation of 2-(methylaminomethyl)benzofuran

0587To a stirred solution of 2-benzofurancarboxaldehyde (2.22 g, 15.2 mmole) in

0588MeOH (5 mL) was added 2 M methylamine in MeOH (15 mL), HOAc (0.86 mL, 15 mmole), and NaB^CN (1.0 g, 15.9 mmole). The reaction was stirred for 18 h at RT then concentrated under vacuum. The remaining residue was taken up in Et₂0, and the solution was washed with 1 N NaOH then brine, dried (Na₂S04), and concentrated to dryness. Purification by flash chromatography on silica gel (5% (5% NH4OH in MeOH)/CHCl3) gave the title compound (1.23 g, 50%) as a pale yellow oil: MS (ES) m/e 162.4 (M + H)⁺.

0589Preparation 61

0590Preparation of methyl l-methyl-3-(methylaminomethyl)-lH-indole-7-carboxylate

0591a) Methyl l-methyl-lH-indole-7-carboxylate According to the procedure of Preparation 9 (a), except substituting methyl indole- 7-carboxylate for the ethyl indole-2-carboxylate, the title compound (2.4 g, 90%) was obtained as an oil: MS (ES) m/e 190.2 (M + H)+.

0592b) N-Methyl-7-methoxycarbonyl-lH-indole-3-carboxaldehyde

0593According to the procedure of Preparation 13 (b), except substituting methyl 1- methyl-l//-indole-7-carboxylate for the 1,3-dimethylindole, the title compound (1.8 g, 70%) was obtained as a white solid: MS (ES) m/e 218.2 (M + H)⁺.

0594c) Methyl l-methyl-3-(methylaminomethyl)-lH-indole-7-carboxylate

0595According to the procedure of Preparation 12, except substituting l-methyl-7- methoxycarbonyl- IH-indole 3-carboxaldehyde for the 2-methylindole-3-carboxaldehyde, the title compound (1.7 g, 92%) was obtained as an oil: MS (ES) m/e 233.2 (M + Η)⁺.

0596Preparation 62

0597Preparation of methyl l-methyl-3-(methylaminomethyl)-lH-indole-6-carboxylate

0598a) Methyl 1 -methyl- lH-indole-6-carboxylate According to the procedure of Preparation 9 (a), except substituting methyl indole-

05996-carboxylate for the ethyl indole-2-carboxylate, the title compound (2.5 g, 95%) was obtained as white solid: MS (ES) m/e 190.2 (M + Η)⁺.

0600b) N-Methyl-7-methoxycarbonyl- lH-indole-3-carboxaldehyde According to the procedure of Preparation 13 (b), except substituting methyl 1- methyl-l//-indole-6-carboxylate for the 1,3-dimethylindole, the title compound (2.6 g, 98%) was obtained as a white solid: MS (ES) m/e 218.2 (M + H)⁺.

0601c) Methyl l-methyl-3-(methylaminomethyl)-l//-indole-6-carboxylate According to the procedure of Preparation 12, except substituting l-methyl-7- methoxycarbonyl- IH-indole 3-carboxaldehyde for the 2-methylindole-3-carboxaldehyde, the title compound (1.9 g, 63%) was obtained as an oil: MS (ES) m/e 233.2 (M + Η)⁺. Preparation 63

0602Preparation of 6-methoxy-l-methyl-3-(methylaminomethyl)- IH-indole

0603a) 6-Methoxy-l -methyl- IH-indole

0604According to the procedure of Preparation 9 (a), except substituting 6-methoxy- IH- indole for the ethyl indole-2-carboxylate, the title compound (2.3 g, 95%) was obtained as an oil: MS (ES) m/e 162.2 (M + Η)+.

0605b) 6-Methoxy-l-methyl-lH-indole-3-carboxaldehyde

0606According to the procedure of Preparation 13 (b), except substituting 6-methoxy- 1- methyl- IH-indole for the 1,3-dimethylindole, the title compound (2.3 g, 82%) was obtained as a tan solid: MS (ES) m/e 190.2 (M + Η)+.

0607c) 6-Methoxy-l-methyl-3-(methylaminomethyl)-lH-indole

0608According to the procedure of Preparation 12, except substituting 6-methoxy- 1- methyl-lH-indole-3-carboxaldehyde for the 2-methylindole-3-carboxaldehyde, the title compound (2.1 g, 87%) was obtained as an oil: MS (ES) m/e 205.2 (M + Η)+.

0609Preparation 64

0610Preparation of 7-fluoro-3-(methylaminomethyl)- IH-indole

0611a) 7-Fluoro- lH-indole-3-carboxaldehyde According to the procedure of Preparation 13 (b), except substituting 7- fluoroindole (0.5 g, 3.7 mmole) for the 1,3-dimethylindole, the title compound (0.3 g, 55%) was prepared as a waxy solid: MS (ES) m/e 164 (M + Η)⁺.

0612b) 7-Fluoro-3-(methylaminomethyl)-l -indole According to the procedure of Preparation 13 (c),except substituting 7-fluoro-lH- indole-3-carboxaldehyde (0.5 g, 3.1 mmole) for the l,3-dimethyl-lH-indole-2- carboxaldehyde, the title compound (0.5 g, 90%) was prepared as a viscous oil: MS (ES) m/e 179 (M + Η)+. Preparation 65

0613Preparation of 4-fluoro-3-(methylaminomethyD- IH-indole

0614a) 4-Fluoro-lH-indole-3-carboxaldehyde

0615According to the procedure of Preparation 13 (b), except substituting 4- fluoroindole (0.4 g, 2.45 mmole) for the 1,3-dimethylindole, the title compound (0.31 g, 72%) was prepared as a viscous oil: MS (ES) m/e 164 (M + Η)⁺.

0616b) 4-Fluoro-3-(methylaminomethyl)-lH-indole

0617According to the procedure of Preparation 13 (c),except substituting 4-fluoro-lH- indole-3-carboxaldehyde for the l,3-dimethyl-lH-indole-2-carboxaldehyde, the title compound was prepared as a viscous oil: MS (ES) m/e 179 (M + Η)⁺.

0618Preparation 66

0619Preparation of 6-bromo-3-(2-methoxyethyl)-3.4-dihydro-lH-pyridor2,3--/lpyrimidin-2-one

0620a) 2-Amino-5-bromo-3-[(2-methoxyethyl)aminomethyl]pyridine 2-Methoxyethylamine (1.49 mL, 17.16 mmole) was added to a solution of 2-amino-

06215-bromo-3-(bromomethyl)pyridine hydrobromide (1.49 g, 4.29 mmole) and DIEA (2.24 mL, 12.87 mmole) in CΗ₂C1₂ (10 mL) at RT. The reaction was stirred overnight then was concentrated in vacuo. The residue was diluted with water and the solution was extracted with ethyl acetate. The combined organic extracts were washed with brine, dried over Na₂S04, and concentrated to afford the title compound (1.00 g, 90%) as a light brown liquid after drying in vacuo: MS (ES) m/e 260/262 (M + H)⁺.

0622b) 6-Bromo-3-(2-methoxyethyl)-3,4-dihydro-lH-pyrido[2,3---]pyrimidin-2-one l,l'-Carbonyldiimidazole (0.74 g, 4.60 mmole) was added to a solution of 2-amino- 5-bromo-3-[(2-methoxyethyl)aminomethyl]pyridine (1.00 g, 3.80 mmole) in 1,2- dichloroethane (35 mL) at RT. The reaction was heated at 65 °C with stirring overnight, then was concentrated in vacuo. Flash chromatography on silica gel (5% MeOΗ/CΗC^) gave title compound (0.90 g, 83%) as a yellow solid after drying in vacuo: MS (ES) m/e 286/288 (M + Η)+. The following examples illustrate methods for preparing the biologically active compounds of this invention from intermediate compounds such as those described in the foregoing Preparations.

0623Example 1

0624Preparation of (E)-3-(2-aminopyrimidin-5-yl)-N-(2-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide

0625a) N-Methyl-N-(2-methyl-lH-indol-3-ylmethyl)acrylamide

0626To a solution of 2-methyl-3-(methylaminomethyl)indole (1.5 g, 8.6 mmole) and triethylamine (1.7 g, 17.3 mmole) in CΗ₂C1₂ at 5 °C under a nitrogen atmosphere was added acryloyl chloride (0.86 g, 9.48 mmole). After 1 hr the reaction solution was poured into H₂0 (100 mL) and the layers were separated. The organic fraction was washed with H₂0 (100 mL) followed by brine and then dried over Na S04- Concentration under vacuum gave the title compound as an orange oil which solidified under high vacuum: MS (ES) m/e 457 (2M + H)⁺. This material was used without further purification.

0627b) (E)-3-(2-Aminopyrimidin-5-yl)-N-(2-methyl-lH-indol-3-ylmethyl)-N- methyl acrylamide

0628A solution of N-methyl-N-(2-methyl-lH-indol-3-ylmethyl)acrylamide (1.18 g, 6.5 mmole), 2-amino-5-bromopyrimidine (0.5 g, 2.9 mmole), Pd(OAc)₂ (0.11 g, 0.49 mmole), tri-ort io-tolylphosphine (0.17 g, 0.55 mmole), and diisopropylethylamine (1.5 mL, 8.6 mmole) in propionitrile (100 mL) and DMF (10 mL) was heated at reflux overnight. The dark mixture was filtered through celite®, and the filtrate was concentrated. Flash chromatography on silica gel (9: 1 CΗCI3/CΗ3OΗ containing 5% NH4OH) gave the title compound (1.2 g, 65%): MS (ES) m/e 372 (M + H)⁺.

0629Example 2

0630Preparation of (E)-N-methyl-N-(2-methyl-lH-indol-3-ylmethyl)-3-(3-methyl-2-oxo- 1.2,3.4-tetrahydropyrido[2,3-^1pyrimidin-6-yl)acrylamide

0631According to the procedure of Example 1 (b), except substituting 6-bromo-3- methyl-3,4-dihydro-lH-pyrido[2,3---]pyrimidin-2-one (1.2 g, 5.0 mmole) for the 2-amino- 5-bromopyrimidine, the title compound (73 %) was prepared as a light yellow solid: MS (ES) m/e 390 (M + H)+.

0632Example 3

0633Preparation of (E)-N-methyl-N-(l-methyl-lH-indol-3-ylmethyl)-3-(3-methyl-2-oxo- l,2,3,4-tetrahydropyridor2,3-.ϋpyrimidin-6-yl)acrylamide

0634a) N-Methyl-N-( 1 -methyl-indol-3-ylmethyl)acrylamide

0635According to the procedure of Example 1 (a), except substituting l-methyl-3- (methylaminomethyl)indole for the 2-methyl-3-(methylaminomethyl)indole, the title compound (1.7 g, 99%) was prepared as an orange oil that solidified under vacuum: MS (ES) m/e 229 (M + H)⁺. This material was used without further purification.

0636b) (E)-N-methyl-N-( 1 -methyl- lH-indol-3-ylmethyl)-3-(3-methyl-2-oxo- 1 ,2,3,4- tetrahydropyrido[2,3-- ]pyrimidin-6-yl)acrylamide

0637According to the procedure of Preparation 1 (b), except substituting N-methyl-N- (l-methyl-indol-3-ylmethyl)acrylamide (1.7 g, 7.5 mmole) for N-methyl-N-(2-methyl-lH- indol-3-ylmethyl)acrylamide, the title compound (70 %) was prepared as a light yellow solid: MS (ES) m/e 390 (M + Η)+.

0638Example 4

0639Preparation of (E)-N-methyI-N-(2-methyl-lH-indol-3-ylmethyl)-3-(2-oxo-2,3-dihvdro-lH- pyrrolor2.3-blpyridin-5-yl)acrylamide

0640To a solution of (E)-3-(2-oxo-2,3-dihydro-lH-indol-5-yl)acrylic acid hydrochloride salt (0.50 g, 2.1 mmole), hydroxybenzotriazole monohydrate (0.31 g, 2.3 mmole), diisopropylethylamine (0.80 mL, 4.6 mmole), and 2-methyl-3-(methylaminomethyl)indole (0.40 g, 2.3 mmole) in DMF (50 mL) at RT was added EDC (0.46, 2.3 mmole). After 12 hr the reaction solution was concentrated under vacuum and the residue was purified by flash chromatography on silica gel (9: 1 CΗCI3/CΗ3OΗ containing 5% NH4OH) to give the title compound (0.66 g, 88 %) as a light yellow solid: MS (ES) m/e 361 (M + H)⁺. Example 5

0641Preparation of (E)-3-(3H-imidazor4.5-felpyridin-6-yl)-N-methyl-N-(l -methyl- l//-indol-3- ylmethvDacrylamide

0642According to the procedure of Example 4, except substituting (E)-3-(3//- imidazo[4,5-b]pyridin-6-yl) acrylate (0.14 g, 0.74 mmole), from Preparation 6, for the (E)- 3-(2-oxo-2,3-dihydro-lH-indol-5-yl)acrylic acid hydrochloride salt, and substituting 1- methyl-3-(methylaminomethyl)indole (0.14 g, 0.81 mmole) for the 2-methyl-3- (methylaminomethyl)- IH-indole, the title compound (0.23 g, 89 %) was prepared as a light yellow solid: MS (ES) m/e 346 (M + Η)+.

0643Example 6

0644Preparation of (E)-3-(3.4-dihvdro-2H-pyridor3,2-ol-1.4-oxazin-7-yl)-N-methyl-N-(l- methyl-lH-indol-3-ylmethyl)acrylamide

0645According to the procedure of Example 4, except substituting (E)-3-(3,4-dihydro- 2H-pyrido[3,2-b][l,4]oxazin-7-yl)acrylic acid (0.11 g, 0.53 mmole), from Preparation 7, for the (E)-3-(2-oxo-2,3-dihydro-lΗ-indol-5-yl)acrylic acid hydrochloride salt, and substituting l-methyl-3-(methylaminomethyl) indole (0.10 g, 0.59 mmole) for the 2- methyl-3-(methylaminomethyl)-lH-indole, the title compound (0.16 g, 82 %) was prepared as a light yellow solid: MS (ES) m/e 363 (M + Η)⁺.

0646Example 7

0647Preparation of (E)-3- r6-amino-5 - r rN-methyl-N-(2-methyl- 1 H-indol-3- ylmethyl)aminolcarbonylethynpyridin-3-yll-N-methyl-N-(2-methyl-lH-indol-3- ylmethvDacrylamide

0648a) Ethyl (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl) acrylate

0649A solution of 6-bromo-3,4-dihydro-lH-l,8-naphthyridin-2-one (5.0 g, 21.9 mmole), from Preparation 4, ethyl acrylate (3.3 g, 32.9 mmole), Pd(OAc)₂ (1.1 g, 0.74 mmole), tri-ort/io-tolylphosphine (1.3 g, 4.4 mmole), and diisopropylethylamine (11.4 mL, 65.7 mmole) in propionitrile (200 mL) and DMF (25 mL) was heated at reflux overnight.

0650The dark mixture was filtered through celite®, and the filtrate was concentrated. Flash chromatography on silica gel (9:1 CHCI3/CH3OH containing 5% NH4OH) gave the title compound (3.0 g, 59 %) as a light yellow solid: MS (ES) m/e 233 (M + H)+.

0651b) (E)-3-[6-Amino-5-(2-carboxyethyl)pyridin-3-yl]acrylic acid hydrochloride salt Ethyl (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl) acrylate (1.54 g, 6.6 mmole) was dissolved in acetic acid (25 mL) and concentrated hydrochloric acid (25 mL) and the solution was heated to 100 °C. After 6 hr the solution was concentrated and the residue was dried under high vacuum. The resulting solid was triturated with diethyl ether and filtered to give a 1.46 g of a mixture of (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl) acrylic acid hydrochloride salt (82%) and the title compound (18%), both as white solids: MS (ES) m/e 218 (M + H)+ (major) and MS (ES) m/e 236 (M + H)+ (minor). This mixture was used without further purification.

0652c) (E)-3-[6-Amino-5-[[N-methyl-N-(2-methyl-lH-indol-3- ylmethyl)amino]carbonylethyl]pyridin-3-yl]-N-methyl-N-(2-methyl-lH-indol-3- ylmethy 1 )acry lamide

0653According to the procedure of Example 4, except substituting a mixture (1.46 g) of (E)-3-[6-amino-5-(2-carboxyethyl)pyridin-3-yl]acrylic acid hydrochloride salt and (E)-3- (7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl) acrylic acid hydrochloride salt for the (E)- 3-(2-oxo-2,3-dihydro-lH-indol-5-yl)acrylic acid hydrochloride salt, the title compound

0654(0.47 g) was prepared as a light yellow solid: MS (ES) m/e 549 (M + Η)⁺. (E)-N-Methyl- N-(2-methyl-lH-indol-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3- yl)acrylamide (1.56 g) was also obtained as a light yellow solid: MS (ES) m/e 375 (M + Η)+.

0655Example 8

0656Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(l-ethyl-lH-indol-3-ylmethyl)-N- methylacrylamide

0657EDC (0.56 g, 2.93 mmole) was added to a solution of (E)-3-(6-aminopyridin-3- yl)acrylic acid (0.48 g, 2.93 mmole), l-ethyl-3-(methylaminomethyl)-l //-indole (0.50 g. 2.66 mmole), ΗOBt ^■ Η2O (0.40 g, 2.93 mmole) and diisopropylethylamine (0.93 mL, 5.32 mmole) in DMF (30 mL) at RT. The reaction was stirred overnight then was concentrated in vacuo. The residue was diluted with water and extracted with ethyl acetate. The combined organic extracts were washed with brine and dried over Na2Sθ4- Flash chromatography on silica gel (10% MeOH CHCl3) gave title compound (0.46 g, 52%) as a yellow solid after drying in vacuo: MS (ES) m/e 335 (M + H)⁺.

0658Example 9

0659Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(l -isopropyl- lH-indol-3-ylmethyl)-N- methylacrylamide

0660EDC (0.51 g, 2.64 mmole) was added to a solution of (E)-3-(6-aminopyridin-3- yl)acrylic acid (0.43 g, 2.64 mmole), l-isopropyl-3-(methylaminomethyl)indole (0.49 g, 2.40 mmole), ΗOBt • Η2O (0.36 g, 2.64 mmole) and diisopropylethylamine (0.84 L 4.80 mmole) in DMF (40 mL) at RT. The reaction was stirred overnight then was concentrated in vacuo. The residue was diluted with water and extracted with ethyl acetate. The combined organic extracts were washed with brine and dried over Na2S04- Flash chromatography on silica gel (10% MeOH/CHCl3) gave the title compound (0.49 g, 58%) as a yellow solid after drying in vacuo: MS (ES) m/e 349 (M + H)⁺.

0661Example 10

0662Preparation of (E)-3-(6-aminopyridin-3-yl)-N-( lH-indol-3-ylmethyl)-N-methylacrylamide

0663EDC (1.03 g, 5.40 mmole) was added to a solution of (E)-3-(6-aminopyridin-3- yl)acrylic acid (0.89 g, 5.40 mmole), l-acetyl-3-(methylaminomethyl)indole (1.00 g, 4.95 mmole), ΗOBt • Η2O (0.73 g.,5.40 mmole) and diisopropylethylamine (1.72 mL, 9.90 mmole) in DMF (50 mL) at RT. The reaction was stirred overnight then was concentrated in vacuo. The residue was diluted with water and extracted with ethyl acetate. The combined organic extracts were washed with brine and dried over Na2S04- Flash chromatography on silica gel (5% MeOWCRCl^) gave the title compound (0.90 g, 52%) as a light yellow solid after drying in vacuo: MS (ES) m/e 307 (M + H)⁺.

0664Example 11

0665Preparation of (E)-N-(lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8-tetrahvdro-1.8- naphthyridin-3-yl)acrylamide A solution of 6-bromo-3,4-dihydro-lH-l,8-naphthyridin-2-one (0.64 g, 2.80 mmole), N-(lH-indol-3-ylmethyl)-N-methylacrylamide (0.60 g, 2.80 mmole), Pd(OAc)₂ (0.06 g, 0.28 mmole), tri-ort/io-tolylphosphine (0.17 g, 0.56 mmole) and diisopropylethylamine (0.73 mL, 4.2 mmole) in propionitrile (50 mL) was deoxygenated, then was heated to reflux under N₂ overnight. The dark mixture was filtered through a pad of celite®, and the filter pad was rinsed with acetonitrile (250 mL). The filtrate was concentrated in vacuo, and the residue was purified by flash chromatography on silica gel (10% MeOΗ/CΗCl3). The title compound (0.37 g, 37%) was obtained as a light yellow solid after drying in vacuo: MS (ES) m/e 361 (M + H)⁺.

0666Example 12

0667Preparation of (E)-N-(l-benzyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide

0668A solution of 6-bromo-3,4-dihydro-lH-l,8-naphthyridin-2-one (1.05 g, 4.60 mmole), N-(l -benzyl- lH-indol-3-ylmethyl)-N-methyl-acrylamide (1.40 g, 4.60 mmole), Pd(OAc)₂ (0.10 g, 0.46 mmole), tri-ort/io-tolylphosphine (0.28 g, 0.92 mmole) and diisopropylethylamine (1.20 mL 6.90 mmole) in propionitrile (75 mL) was deoxygenated, then was and heated to reflux under a N₂ overnight. The dark mixture was filtered through a pad of celite®, and the filter pad was rinsed with acetonitrile (300 mL). The filtrate was concentrated in vacuo, and the residue was purified by flash chromatography on silica gel (5% MeOΗ/CΗCl3). The title compound (0.70 g. 35%) was obtained as a light yellow solid after drying in vacuo: MS (ES) m/e 451 (M + H)⁺.

0669Example 13

0670Preparation of (E)-N-ri-(2-dimethylaminoethyl)-lH-indol-3-ylmethyll-N-methyl-3-(7-oxo- 5.6.7.8-tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0671A solution of 6-bromo-3,4-dihydro-lH-l,8-naphthyridin-2-one (0.61 g, 2.70 mmole), N-[l-(2-dimethylaminoethyl)-lH-indol-3-ylmethyl]-N-methyl-acrylamide (1.00 g, 3.50 mmole), Pd(OAc)₂ (0.08 g, 0.35 mmole), tri-ormo-tolylphosphine (0.21 g, 0.70 mmole), and diisopropylethylamine (0.91 mL, 5.25 mmole) in propionitrile (70 mL) was deoxygenated, then was and heated to reflux under a N₂ overnight. The dark mixture was filtered through a pad of celite®, and the filter pad was rinsed with acetonitrile (250 mL). The filtrate was concentrated in vacuo, and the residue was purified by flash chromatography on silica gel (10% MeOWC Cl^ containing 5% NH4OH in the MeOH). The title compound (0.20 g. 13%) was obtained as a light yellow solid after drying in vacuo: MS (ES) m/e 432 (M + H)⁺.

0672Example 14

0673Preparation of (E)-N-methyl-3-(8-oxo-6,7.8.9-tetrahydro-5H-pyridor2.3-fclazepin-3- yPacrylamide

0674A solution of 3-bromo-5,6,7,9-tetrahydro-pyrido[2,3-E)azepin-8-one (0.60 g, 2.50 mmole), N-(2-methyl-lH-indol-3-ylmethyl)-N-methylacrylamide (0.85 g, 3.75 mmole), Pd(OAc)₂ (0.06 g, 0.25 mmole), tri-ort/rø-tolylphosphine (0.15 g, 0.50 mmole) and diisopropylethylamine (0.87 mL, 5.00 mmole) in propionitrile (50 mL) was deoxygenated, then was and heated to reflux under a N₂ overnight. The dark mixture was filtered through a pad of celite®, and the filter pad was rinsed with acetonitrile (200 mL). The filtrate was concentrated in vacuo, and the residue was purified by flash chromatography on silica gel (10% MeOΗ/CΗCl3). The title compound (0.35 g. 35%) was obtained as a light tan solid after drying in vacuo: MS (ES) m/e 246 (M + H)⁺.

0675Example 15

0676Preparation of (E)-N-methyl-N-(l-methyl-lH-indol-3-ylmethyl)-3-r6-(pyridin-2- ylamino)pyridin-3-yllacrylamide

0677a) N-( 1 -methyl- lH-indol-3-ylmethyl)-N-methylacrylamide

0678To a stirred solution of l-methyl-3-(methylaminomethyl)- IH-indole (1.0 g, 5.7 mmole) and Et3N (0.8 mL, 5.7 mmole) in CΗ₂C1₂ (50 mL) at 0 °C was added acryloyl chloride (0.47 mL, 5.8 mmole) in one portion. After stirring for 1 h the reaction was washed with cold H₂0 and brine, then was dried (MgSθ4) and concentrated under vacuum. This material was used without further purification.

0679b) (E)-N-Methyl-N-(l-methyl-l//-indol-3-ylmethyl)-3-[6-(pyridin-2-ylamino)pyridin-3- yljacrylamide To a solution of N-(l -methyl- lH-indol-3-ylmethyl)-N-methylacrylamide, from

0680Example 1 (a), in propionitrile (50 mL) was added 5-bromo-2,2' -dipyridylamine (1.2 g, 4.8 mmole), DIEA (1.8 L, 10.3 mmole), Pd(OAc)₂ (112 mg, 0.5 mmole), and P(o-tol)₃ (304 mg, 1 mmole). The reaction was purged with Ar then stirred at reflux for 16 h. After cooling to room temperature the reaction was concentrated to dryness under vacuum. Flash chromatography on silica gel (3% (5% NH4θH/MeOH)/CHCl3), trituration with 1: 1 Et₂0/petroleum ether, filtration, and drying under vacuum gave the title compound (1.24 g, 65%) as an off-white solid: MS (ES) m/e 398.2 (M + H)⁺.

0681Example 16

0682Preparation of (E)-N-methyl-N-(2-methylbenzor ?1thiophen-3-ylmethyl)-3-(7-oxo-5,6J.8- tetrahydro- 1.8-naphthyridin-3-yl)acrylamide

0683a) N-(Benzo[b]thiophen-3-ylmethyl)-N-methylacrylamide

0684According to the procedure of Example 15 (a), except substituting 2-methyl-3- (methylaminomethyl)benzo[έ>]thiophene (1.0 g, 5.2 mmole) for l-methyl-3-

0685(methylaminomethyl)- IH-indole, the title compound was prepared. This was used without further purification.

0686b) (E)-N-Methyl-N-(2-methylbenzo[σ]thiophen-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro- l,8-naphthyridin-3-yl)acrylamide

0687According to the procedure of Example 15 (b), except substituting 6-bromo-3,4- dihydro-lH-l,8-naphthyridin-2-one (1.3 g, 5.7 mmole) for the 5-bromo-2,2'- dipyridylamine, the title compound (0.849 g, 42%) was prepared as a white solid: MS (ES) m/e 392.2 (M + Η)+.

0688Example 17

0689Preparation of (E)-N-methyl-N-(l-methyl-lH-indol-2-ylmethyl)-3-r6-rN- (methylaminocarbonylmethyl)aminolpyridin-3-yllacrylamide

0690a) N-(l-methyl-lH-indol-2-ylmethyl)-N-methylacrylamide

0691According to the procedure of Example 15 (a), except substituting l-methyl-2- (methylaminomethyl)- IH-indole (1.2 g, 6.9 mmole) for the l-methyl-3- (methylaminomethyl)- IH-indole, the title compound was prepared. This was used without further purification. b) (E)-N-Methyl-N-(l-methyl-lH-indol-2-ylmethyl)-3-[6-[N- (methylaminocarbonylmethyl)amino]pyridin-3-yl]acrylamide

0692According to the procedure of Example 15 (b), except substituting 5-bromo-2- (methylaminocarbonylmethyl)aminopyridine (1.5 g, 6.2 mmole) for the 5-bromo-2,2'- dipyridylamine, the title compound (1.7 g, 72%) was prepared as a white solid: MS (ES) m/e 392.2 (M + Η)+.

0693Example 18

0694Preparation of (E)-3-(6-amino-5-(methoxycarbonyι)pyridin-3-yl)-N-(l-methyl-lH-indol-3- ylmethvD-N-methylacrylamide

0695a) N-( 1 -methyl- 1 H-indol-2-ylmethyl)-N-methy lacrylamide

0696According to the procedure of Example 15 (a), except substituting l-methyl-2- (methylaminomethyl)- IH-indole (1.2 g, 6.9 mmole) for the l-methyl-3-

0697(methylaminomethyl)- IH-indole, the title compound was prepared. This was used without further purification.

0698b) (E)-3-(6-Amino-5-(methoxycarbonyl)pyridin-3-yl)-N-(l-methyl-lH-indol-3-ylmethyl)- N-methylacrylamide

0699According to the procedure of Example 15 (b), except substituting methyl 2-amino- 5-bromonicotinate (1.4 g, 6.1 mmole) for the 5-bromo-2,2' -dipyridylamine, the title compound (1.78 g, 77%) was prepared as a white solid: MS (ES) m/e 379.2 (M + Η)⁺.

0700Example 19

0701Preparation of (E)-3-r6-rN-(methoxycarbonylmethyl)aminolpyridin-3-yll-N-methyl-N-(2- methyl-lH-indol-3-ylmethyl)acrylamide

0702To a stirred solution of (E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3- yljacrylic acid hydrochloride salt (2.0 g, 7.3 mmole) in 1: 1 DMF/CΗ₂C1₂ (100 mL) was added 2-methyl-3-(methylaminomethyl)indole (1.3 g, 7.5 mmole), Et3N (2.1 mL, 15 mmole), and HOBt • H₂0 (1.0 g, 7.4 mmole), followed by EDC (1.4 g, 7.3 mmole). After stirring at room temperature for 18 h the reaction was concentrated to dryness. The residue was taken up in EtOAc, and the solution was washed with H₂0 then brine, dried (Na₂S04), and concentrated under vacuum. The remaining residue was purified by flash chromatography on silica gel (4% MeOH/CHC^) to give the title compound (2.08 g, 73%) as an off-white solid: MS (ES) m/e 393.2 (M + H)+.

0703Example 20

0704Preparation of ,E)-3-r6-rN-(carboxymethyl)aminolpyridin-3-yll-N-methyl-N-(2-methyl- l//-indol-3-ylmethyl)acrylamide

0705To a stirred solution of (E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]- N-methyl-N-(2-methyl-lH-indol-3-ylmethyl)acrylamide (0.5 g, 1.3 mmole) in dioxane (30 mL) was added 1 N NaOΗ (2 mL, 2 mmole). After stirring for 18 h the reaction was neutralized with 1 N ΗC1 (2 mL, 2 mmole) and concentrated to near dryness. The resulting suspension was diluted with Η₂0 and filtered. The solid was washed with H₂0 and dried under vacuum to give the title compound (505 mg, 100%) as a off-white solid: MS (ES) m/e 379.2 (M + H)+.

0706Example 21

0707Preparation of (E)-N-methyl-N-(2-methyl- lH-indol-3-ylmethyl)-3-r6-rN- (methylaminocarbonylmethyl)aminolpyridin-3-y 11 acrylamide

0708To (E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]-N-methyl-N-(2- methyl-lH-indol-3-ylmethyl)acrylamide (0.7 g, 1.8 mmole) was added a solution of 2.0 M methylamine in MeOΗ (50 mL). After stirring for 72 h the reaction was concentrated to dryness. The residue was triturated with Et₂0, filtered, and dried under vacuum to give the title compound (0.703 g, 100%.) as an off-white solid: MS (ES) m/e 392.2 (M + Η)+

0709Example 22

0710Preparation of (E)-3-(2-aminopyrimidin-5-yl)-N-methyl-N-(l-methyl-lH-pyrrolor2.3- άlpyridin-3-ylmethyl)acrylamide

0711A solution of 2-amino-5-bromopyrimidine (0.27 g, 1.55 mmole), N-methyl-N-(l- methyl-lH-pyrrolo[2,3-Z?]pyridin-3-ylmethyl)acrylamide (0.5 g, 2.33 mmole), Pd(OAc)₂ (0.037 g, 0.163 mmole), P(o-tolyl)₃ (0.085 g, 0.28 mmole), and (i-Pr)₂NEt (0.42 mL, 2.33 mmole) in propionitrile (20 mL) was degassed then heated to reflux. After 18 hr the mixture was cooled to RT and concentrated. Flash chromatography on silica gel (10% MeOH/CH₂Cl₂) gave the title compound (0.100 g, 18%): MS (ES) m/e 363 (M + H)+

0712Example 23

0713Preparation of (E)-N-methyl-N-(l-methyl-lH-pyrrolor2.3-blpyridin-3-ylmethyl)-3-(7-oxo- 5.6,7,8-tetrahvdro-1.8-naphthyridin-3-yl)acrylamide

0714According to the procedure of Example 22, except substituting 6-bromo-3,4- dihydro-lH-l,8-naphthyridin-2-one (0.352 g, 1.55 mmole) for the 2-amino-5- bromopyrimidine, the title compound (0.14 g, 16%) was prepared as a white powder: MS (ES) m/e 376 (M + Η)+.

0715Example 24

0716Preparation of (E)-N-(2.3-dihydro-lH-3a-azacyclopentar lindene-8-ylmethyl)-N-methyl-3- (7-oxo-5,6,7,8-tetrahvdro-l,8-naphthyridin-3-yl)acrylamide

0717EDC (0.192 g, 1.0 mmole) was added to a solution of (E)-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylic acid hydrochloride salt (0.254 g, 1.0 mmole), 2,3- dihydro-8-(methylaminomethyl)-lr/-3a-azacyclopenta[α]indene (0.2 g, 1.0 mmole), ΗOBt Η₂0 (0.135 g, 1.0 mmole), and Et₃N (0.15 mL, 1.1 mmole) in DMF (20 mL) at RT. The reaction was stirred overnight, then was poured into H₂0 (50 mL) and extracted with CH₂C1₂ (2 x 30 mL). The combined extracts were washed with brine and dried (MgS04). Flash chromatography on silica gel (5% MeOH/CH₂Cl₂) gave the title compound (0.1 g, 25%) a yellow solid: MS (ES) m/e 401 (M + H)⁺.

0718Example 25

0719Preparation of (E)-N-(l-ethyl-5-fluoro-l//-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8- tetrahydro- 1.8-naphthyridin-3-yl)acrylamide

0720According to the procedure of Example 24, except substituting (l-ethyl-5-fluoro-3- (methylaminomethyl)- IH-indole (0.1 g, 0.49 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[ ]indene, the title compound (0.028 g, 15%) was prepared as a white powder: MS (ES) m/e 407 (M + Η)⁺. Example 26

0721Preparation of (E)-N-(5-fluoro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8- tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0722According to the procedure of Example 24, except substituting 5-fluoro-l-methyl- 3-(methylaminomethyl)- IH-indole (0.13 g, 0.67 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[ ]indene, the title compound (0.1 g, 37%) was prepared as a slightly yellow crystalline solid: MS (ES) m/e 393 (M + Η)⁺.

0723Example 27

0724Preparation of (E)-N-(5-fluoro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide

0725According to the procedure of Example 24, except substituting 6-fluoro-l-methyl- 3-(methylaminomethyl)- IH-indole (0.12 g, 0.59 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[α]indene, the title compound (0.1 g, 43%) was prepared as a white crystalline solid: MS (ES) m/e 393 (M + Η)⁺.

0726Example 28

0727Preparation of (E -N-(7-fluoro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6J.8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide

0728According to the procedure of Example 24, except substituting 7-fluoro-l-methyl- 3-(methylaminomethyl)- IH-indole (0.18 g, 0.93 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[α]indene, the title compound (0.1 g, 27%) was prepared as a white powder: MS (ES) m/e 393 (M + Η)⁺.

0729Example 29

0730Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(6-fluoro-l -methyl- lH-indol-3-ylmethyl)-N- methylacrylamide According to the procedure of Example 24, except substituting 6-fluoro-l-methyl- 3-(methylaminomethyl)- IH-indole (0.11 g, 0.59 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[α]indene, and substituting (E)-3-(6-amino- pyridin-3-yl)acrylic acid (0.098 g, 0.59 mmole) for the (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylic acid hydrochloride salt, the title compound (0.1 g, 27%) was prepared as a white powder: MS (ES) m/e 339 (M + Η)⁺.

0731Example 30

0732Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(4,6-dichloro-l-methyl-lH-indol-2- ylmethyl)-N-methylacrylamide

0733EDC (84.4 mg, 0.44 mmole) was added all at once to a solution of (E)-3-(6-amino- pyridin-3-yl)acrylic acid (65.7 mg, 0.40 mmole), 4,6-dichloro-l -methyl-2-

0734(methylaminomethyl)- IH-indole (107.0 mg, 0.44 mmole), ΗOBt • Η₂0 (59.5 mg, 0.44 mmole), and Et3N (0.14 mL, 1.0 mmole) in anhydrous DMF (4 mL) at RT. After 17 hr, the reaction was concentrated to dryness and the residue was re-concentrated from CHC^/xylenes (2 x). Flash chromatography on silica gel (7% MeOH in 1: 1 EtOAc/CHCl3) gave the R_f 0.44 component (10% MeOH in 1 : 1 EtOAc/CHCl₃) as a foam. This was solidified by re-concentration from MeOH/EtOAc/CHCl3 several times. This material was triturated with hot EtOAc/MeOH, and the mixture was cooled to 0 °C. The title compound was collected by suction filtration. The filtrate was concentrated and the residue was triturated with EtOAc to afford additional title compound. The combined desired solids were dried in high vacuum at 50-60 °C to afford the title compound (108.9 mg, 70%) as a light yellow solid: 1H NMR (400 MHz, CDCI3) 1.8: 1 mixture of amide rotamers; δ 8.08 - 8.20 (2 x s, 1 H), 7.70 - 7.90 (2 x d, 1 H), 7.57 - 7.70 (2 x s, 1 H), 7.46 (d, J = 15.2 Hz, 1 H), 7.18 (s, 1 H), 6.97 (d, J = 15.2 Hz, 1 H), 6.45 and 6.15 (2 x m, 4 H), 5.02 and 4.82 (2 x s, 2 H), 3.60 - 3.80 (2 x s, 3 H), 2.99 and 3.11 (2 x s, 3 H); MS (ES) m/e 239 and 391 (M + H)+.

0735Example 31

0736Preparation of (E)-3-(6-aminopyridin-3-yl)-N-( 4-dimethyl-lH-indole-3-ylmethyl)-N- methylacrylamide To a stirred solution of 1,4-dimethy 1-3 -(methylaminomethyl)- IH-indole (188.2 mg, 1 mmole) and (E)-3-(6-aminopyridin-3-yl)acrylic acid (164 mg, 1 mmole) in dry DMF (12 mL) containing dry E-3N (4 mL) was added ΗOBt • Η₂0 (153 mg, 1 mmole) and EDC (191.8 mg, 1 mmole). The reaction was stirred overnight under argon at ambient temperature, then was concentrated in vacuo. The residue was partitioned between EtOAc and 5% NaHC03 solution, and the layers were separated. The organic layer was washed with brine, dried (MgS04), filtered, and concentrated. Flash chromatography on silica gel afforded the title compound (120 mg, 36%) as a white solid: MS (ES) m/e 335.2 (M + H)⁺. Anal. Calcd for C₂₀H₂₂N₄O • 0.25 H₂0: C, 70.88; H, 6.69; N, 16.53. Found: C, 71.11; H, 6.72; N, 16.36.

0737Example 32

0738Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(4-methoxy-l-methyl-lH-indol-3-ylmethyl)- N-methylacrylamide

0739According to the procedure of Example 31, except substituting 4-methoxy-l- methyl-3-(methylaminomethyl)- IH-indole for the l,4-dimethyl-3-(methylaminomethyl)- indole, the title compound (100 mg, 29%) was obtained as a light yellow solid: MS (ES) m/e 351.2 (M + Η)+. Anal. Calcd for C₂₀H₂₂N₄O₂ • 0.25 H₂0: C, 67.68; H, 6.39; N, 15.79. Found: C, 67.31; H, 6.21; N, 15.97.

0740Example 33

0741Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(5-methoxy-l-methyl-lH-indol-3-ylmethyl)- N-methylacrylamide

0742According to the procedure of Example 31, except substituting 5-methoxy-l- methyl-3-(methylaminomethyl)-l/ -indole for the l,4-dimethyl-3-(methylaminomethyl)- lH-indole, the title compound (110 mg, 31%) was obtained as a light tan solid: MS (ES) m/e 351.2 (M + Η)+. Anal. Calcd for C₂₀H₂₂N₄O₂ • 0.75 H₂0: C, 66.01; H, 6.51; N, 15.39. Found: C, 65.83; H, 6.29; N, 15.60. Example 34

0743Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(7-chloro-lH-indol-3-ylmethyl)-N- methylacrylamide

0744According to the procedure of Example 31, except substituting 7-chloro-l-methyl- 3-(methylaminomethyl)- IH-indole for the dimethyl-3-(methylaminomethyl)- IH-indole, the title compound (180 mg, 52%) as obtained as a yellow solid: MS (ES) m/e 355.2 (M + Η)+. Anal. Calcd for C19H19CIN4O • 0.25 H₂0: C, 63.51; H, 5.47; N, 15.59. Found: C, 63.55; H, 5.32; N, 15.68.

0745Example 35

0746Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(7-methoxy-l -methyl- lH-indol-3-ylmethyl)- N-methylacrylamide

0747According to the procedure of Example 31, except substituting 7-methoxy-l- methyl-3-(methylaminomethyl)- IH-indole for the l,4-dimethyl-3-(methylaminomethyl)- lH-indole, the title compound (140 mg, 40%) was obtained as a tan solid: MS (ES) m/e 351.2 (M + Η)⁺. Anal. Calcd for C₂₀H₂₂N₄O₂ • 0.5 H₂0: C, 66.83; H, 6.45; N, 15.58. Found: C, 66.81; H, 6.41; N, 15.19.

0748Example 36

0749Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(6-chloro- lH-indol-3-ylmethyl)-N- methy lacry lam ide

0750According to the procedure of Example 31, except substituting 6-chloro-l-methyl- 3-(methylaminomethyl)- IH-indole for the l,4-dimethyl-3-(methylaminomethyl)- IH-indole, the title compound (176 mg, 50%) was obtained as a yellow solid: MS (ES) m/e 355.2 (M + Η)+. Anal. Calcd for Ci 9H19CIN4O • 0.5 H₂0: C, 62.72; H, 5.54; N, 15.40. Found: C, 62.79; H, 5.20; N, 15.85. Example 37

0751Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(5-chloro- lH-indol-3-ylmethyl)-N- methylacrylamide

0752According to the procedure of Example 31, except substituting 5 -chloro- 1-methyl- 3-(methylaminomethyl)- IH-indole for the l,4-dimethyl-3-(methylaminomethyl)- IH-indole the title compound was obtained as a tan solid (176 mg, 54%): MS (ES) m/e 355.2 (M + Η)+. Anal. Calcd for C₁₉H₁₉ClN4θ • 0.25 H₂0: C, 63.51; H, 5.47; N, 15.59. Found: C, 63.63; H, 5.84; N, 15.83.

0753Example 38

0754Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(4-chloro-lH-indol-3-ylmethyl)-N- methylacrylamide

0755According to the procedure of Example 31, except substituting 4-Chloro-l-methyl- 3-(methylaminomethyl)- IH-indole for the l,4-dimethyl-3-(methylaminomethyl)-indole the title compound was obtained as a tan solid (150 mg, 42%): MS (ES) m/e 355.2 (M + Η)⁺. Anal. Calcd for C₁₉H₁₉C1N₄0 ^■ 0.25 H₂0: C, 63.51; H, 5.47; N, 15.59. Found: C, 63.33; H, 5.38; N, 15.34.

0756Example 39

0757Preparation of (E)-3-(6-aminopyridin-3-y1)-N-(3,3-dimethyl-3H-indene-l-ylmethyl)-N- methylacrylamide

0758According to the procedure of Example 31, except substituting l,l-dimethyl-3- (methylaminomethyl)-3H-indene for the l,4-dimethyl-3-(methylaminomethyl- IH-indole, the title compound (43 mg, 13%) was obtained as a white solid: MS (ES) m/e 334.2 (M + Η)+ Anal. Calcd for C₂₁H₂₃N₃0 • 0.75 H₂0: C, 72.70; H, 7.12; N, 12.11. Found: C, 72.38; H, 6.80; N, 11.69. Example 40

0759Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(7-hvdroxy-l-methyl-lH-indol-3-ylmethyl)- N-methylacrylamide

0760According to the procedure of Example 31, except substituting 7-hydroxy-l- methyl-3-(methylaminomethyl)-lH-indole for the l,4-dimethyl-3-(methylaminomethyl)- l/ -indole, the title compound was obtained as a tan solid (60 mg, 17.9 %): MS (ES) m/e 337.2 (M + Η)+. Anal. Calcd for C₁₉H₂₀N₄O₂ • 1.0 H₂0: C, 64.39; H, 6.26; N, 15.81. Found: C, 63.99; H, 5.78; N, 15.54.

0761Example 41

0762Preparation of (E)-N-methyl-3-(7-oxo-5.6J,8-tetrahydro-l,8-naphthyridin-3-yl)-N-( 1,2.7- trimethyl-lH-indol-3-ylmethyl)-acrylarnide

0763a) N-Methyl-N-( 1 ,2,7-trimethyl- lH-indol-3-ylmethyl)acrylamide To a cold solution (ice bath) of 3-(methylaminomethyl)-l,2,7-trimethyl-lH-indole

0764(570 mg, 2.8 mmole) in dry CΗ₂C1₂ (24 mL) was added dry Et₃N (0.25 mL, 2.9 mmole). The reaction was stirred in the cold under argon for 2 h then was poured into H₂0 (40 mL). The layers were separated, and the organic layer was washed with brine, dried (MgS04), filtered, and concentrated. The title compound (0.7 g, 97%) was obtained as a light orange solid: MS (ES) m/e 257.2 (M + H)+.

0765b) (E)-N-Methyl-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)-N-(l,2,7-trimethyl- lH-indol-3-ylrnethyl)-acrylamide

0766A mixture of N-methyl-N-(l,2,7-trimethyl-l -indol-3-ylmethyl)acrylamide (256 mg, 1 mmole) and 6-bromo-3,4-dihydro-lH-l,8-naphthyridin-2-one (227 mg, 1 mmole) in propionitrile (20 mL) was treated with DIEA (0.3 mL), Pd(OAc)₂ (29 mg, 0.13 mmole), and tri-o-tolylphosphine (50 mg, 0.16 mmole). The reaction was heated at reflux under argon for 10 h, then was cooled to RT and filtered through supercel. The filtrate was concentrated and the residue was purified by flash chromatography on silica gel to afford the title compound (100 mg, 25%) as an off-white solid: MS (ES) m/e 403.2 (M + Η)+. Anal. Calcd for C₂₄H₂₆N₄0₂^■ 2.75 H₂0: C, 63.77; H, 7.02; N, 12.39. Found: C, 63.81; H, 7.25; N, 11.90.

0767Example 42

0768Preparation of (E)-N-(7-chloro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6,7,8- tetrahvdro- 1 ,8-naphthyridin-3-yl)-acrylamide

0769A solution of 7-chloro-l-methyl-3-(methylaminomethyl)- IH-indole (104.3 mg, 0.5 mmole) and (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)-acrylic acid (109.1 mg, 0.5 mmole) in dry DMF (8 mL) was treated with dry Et3N ( 0.2 mL), ΗOBt • Η₂0 (76.5 mg, 0.5 mmole) and EDC (96 mg, 0.5 mmole). The solution was stirred at RT under argon for 20 h, then was concentrated. The oily residue was dissolved in MeOH and the solution was cooled. The precipitated solid was collected, washed with cold MeOH, and dried to give the title compound (95 mg, 47%): MS (ES) m/e 409.2 (M + H)+. Anal. Calcd for C₂₂H₂₁C1N₄0₂^■ 0.25 H₂0: C, 63.92; H, 5.24; N, 13.55. Found: C, 63.56; H, 5.14; N, 13.73.

0770Example 43

0771Preparation of (E)-N-(7-chloro-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahvdro-l,8-naphthyridin-3-yl)-acrylamide

0772According to the procedure of Example 42, except substituting 7-chloro-3- (methylaminomethyl)- IH-indole for the 7-chloro-l-methyl-3-(methylaminomethyl)-lH- indole, the title compound (25 mg, 13%) was obtained as an off white solid after chromatography on silica gel: MS (ES) m/e 395.0 (M + Η )⁺

0773Example 44

0774Preparation of (E)-2,N-dimethyl-N-(2-methyl-lH-indol-3-ylmethyl)-3-(7-oxo-5.6.7.8- tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0775According to the procedure of Example 4, except substituting (E)-2-methyl-3-(7- oxo-5,6,7, 8-tetrahydro-l,8-naphthyridin-3-yl)acrylic acid hydrochloride salt (0.50 g, 1.8 mmole) for the (E)-3-(2-oxo-2,3-dihydro-lH-indol-5-yl)acrylic acid hydrochloride salt, the title compound (0.64 g, 89 %) was prepared as a light yellow solid: MS (ES) m/e 389 (M + H)⁺.

0776Example 45

0777Preparation of (E)-3.N-dimethyl-N-(2-methyl-lH-indol-3-ylmethyl)-3-(7-oxo-5.6J.8- tetrahvdro-1.8-naphthyridin-3-yl)acrylamide

0778According to the procedure of Example 4, except substituting (E)-3-methyl-3-(7- oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylic acid hydrochloride salt (0.50 g, 1.8 mmole) for the (E)-3-(2-oxo-2,3-dihydro-lH-indol-5-yl)acrylic acid hydrochloride salt, the title compound (0.67 g, 92 %) was prepared as a light yellow solid: MS (ES) m/e 389 (M + Η)+.

0779Example 46

0780Preparation of (E)-N-methyl-N-(2-methyl- lH-indol-3-ylmethyl)-3-(4-methyl-3-oxo- 2.3,4,5-tetrahydro-lH-pyridor2,3-el-l,4-diazepin-7-yl)acrylamide

0781According to the procedure of Example 1, except substituting 7-bromo-4-methyl- l,2,4,5-tetrahydropyrido[2,3-e]-l,4-diazepin-3-one (0.50 g, 1.9 mmole) for the 2-amino-5- bromopyrimidine, the title compound (0.30 g, 62 %) was prepared as a light yellow solid: MS (ES) m/e 404 (M + Η)+.

0782Example 47

0783Preparation of (E)-N-methyl-N-(2-methyl-lH-indol-3-ylmethyl)-3-(8-oxo-6.7.8.9- tetrahydro-5H-pyridor2,3--?lazepin-3-yl)acrylamide

0784EDC (0.18 g, 0.96 mmole) was added to a solution of (E)-3-(8-oxo-6,7,8,9- tetrahydro-5//-pyrido[2,3-b]azepin-3-yl)acrylic acid hydrochloride salt (0.24 g, 0.87 mmole), 2-methyl-3-(methylaminomethyl)indole (0.15 g, 0.87 mmole), ΗOBt ^■ Η₂0 (0.13 g., 0.96 mmole) and diisopropylethylamine (0.45 mL, 2.61 mmole) in DMF (15 mL) at RT. The reaction was stirred overnight then was concentrated in vacuo. The residue was diluted with water and extracted with ethyl acetate. The combined organic extracts were washed with brine and dried over Na₂S04- Preparative HPLC on a Waters C-18 ODS A column (gradient: 20-100% H₂0/CH3CN) gave the title compound (0.13 g, 38%) as a light yellow solid after drying in vacuo: MS (ES) m/e 389 (M + H)+.

0785Example 48

0786Preparation of (E)-N-ri-(2-hydroxyethyl)-lH-indol-3-ylmethyll-N-methyl-3-(7-oxo- 5.6.7.8-tetrahvdro-1.8-naphthyridin-3-yl)acrylamide

0787EDC (0.54 g, 2.80 mmole) was added to a solution of (E)-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylic acid hydrochloride salt (0.71 g, 2.80 mmole), l-(2- hydroxyethyl)-3-(methylaminomethyl)- IH-indole (0.52 g, 2.55 mmole), ΗOBt • Η₂0 (0.38 g., 2.80 mmole) and diisopropylethylamine (1.11 mL, 6.40 mmole) in DMF (25 mL) at RT. The reaction was stirred overnight then was concentrated in vacuo. The residue was diluted with water and extracted with ethyl acetate. The combined organic extracts were washed with brine and dried over Na₂Sθ4. Flash chromatography on silica gel (20% EtOH/EtOAc) gave title compound (0.28 g, 27%) as an off-white solid after drying in vacuo: MS (ES) m/e 405 (M + H)+.

0788Example 49

0789Preparation of (E)-N-methyl-N-(l -methyl- lH-indol-3-ylmethyl)-3-(8-oxo-6.7.8.9- tetrahydro-5H-pyridor2.3-olazepin-3-yl)acrylamide )

0790EDC (0.06 g, 0.30 mmole) was added to a solution of (E)-3-(8-oxo-6,7,8,9- tetrahydro-5H-pyrido[2,3-b]azepin-3-yl)acrylic acid hydrochloride salt (0.07 g, 0.27 mmole), l-methyl-3-(methylaminomethyl)-lH-indole (0.05 g, 0.27 mmole), ΗOBt • Η2O (0.04 g., 0.30 mmole) and diisopropylethylamine (0.14 mL, 0.81 mmole) in DMF (15 mL) at RT. The reaction was stirred overnight then was concentrated in vacuo. The residue was diluted with water and extracted with ethyl acetate. The combined organic extracts were washed with brine and dried over Na2S04- Flash chromatography on silica gel (20% EtOH/EtOAc) gave title compound (0.05 g, 48%) as an off-white solid after drying in vacuo: MS (ES) m/e 389 (M + H)+. Example 50

0791Preparation of (E)-N-ri-(2-hvdroxyethyl)-lH-indol-3-ylmethyll-N-methyl-3-(7-oxo- 5.6.7.8-tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0792EDC (0.35 g, 1.81 mmole) was added to a solution of (E)-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylic acid hydrochloride salt (0.42 g, 1.65 mmole), 1- ethyl-3-(methylaminomethyl)-lH-indole (0.31 g, 1.65 mmole), ΗOBt ^■ Η₂0 (0.24 g., 1.81 mmole) and diisopropylethylamine (0.86 mL, 4.95 mmole) in DMF (15 mL) at RT. The reaction was stirred overnight then was concentrated in vacuo. The residue was diluted with water and extracted with ethyl acetate. The combined organic extracts were washed with brine and dried over Na2Sθ4- Flash chromatography on silica gel (10% EtOH EtOAc) gave title compound (0.39 g, 61%) as a light yellow solid after drying in vacuo: MS (ES) m/e 389 (M + H)⁺.

0793Example 51

0794Preparation of (E)-N-(7-chloro-l-methyl-lH-indol-3-ylmethyl)-3-r6-rN- (methoxycarbonylmethyl)aminolpyridin-3-yll-N-methylacrylamide

0795According to the procedure of Example 19, except substituting 7-chloro-l-methyl-

07963-(methylaminomethyl)-lH-indole (1.4 g, 6.7 mmole) for the 2-methyl-3- (methylaminomethyl)indole, the title compound (2.38 g, 84%) was prepared as a pale yellow solid: MS (ES) m/e 427.0 (M + Η)+.

0797Example 52

0798Preparation of (E)-3-r6-rN-(carboxymethyl)aminolpyridin-3-yll-N-(7-chloro-l-methyl-lH- indol-3-ylmethyl)-N-methylacrylamide

0799According to the procedure of Example 20, except substituting (E)-N-(7-chloro-l- methyl-lH-indol-3-ylmethyl)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]-N- methylacrylamide (0.75 g, 1.8 mmole) for the (E)-3-[6-[N- (methoxycarbonylmethyl)amino]pyridin-3-yl]-N-methyl-N-(2-methyl-l/ -indol-3- ylmethyl)acrylamide, the title compound (0.746 g, 100%) was prepared as a white solid: MS (ES) m/e 413.2 (M + H)+.

0800Example 53

0801Preparation of (E)-N-(7-chloro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-r6-rN- (methylaminocarbonylmethyl)aminolpyridin-3-yllacrylamide

0802According to the procedure of Example 21, except substituting (E)-N-(7-chloro-l- methyl-lH-indol-3-ylmethyl)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]-N- methylacrylamide (0.75 g, 1.8 mmole) for the (E)-3-[6-[N-

0803(methoxycarbonylmethyl)amino]pyridin-3-yl]-N-methyl-N-(2-methyl-lH-indol-3- ylmethyl)acrylamide, the title compound (0.721 g, 94%) was prepared as a white solid: MS (ES) m/e 426.0 (M + Η)+.

0804Example 54

0805Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(2-chloro-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide

0806According to the procedure of Example 31, except substituting 2-chloro-l-methyl- 2-(methylaminomethyl)- IH-indole (0.7 g, 3.0 mmole) for the l,4-dimethyl-3- (methylaminomethyl)- IH-indole, the title compound (0.935 g, 88%) was obtained as an off-white solid: MS (ES) m/e 355.2 (M + Η)⁺.

0807Example 55

0808Preparation of (E)-N-(2-chloro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8- tetrahvdro-1.8-naphthyridin-3-yl)acrylamide

0809According to the procedure of Example 24, except substituting 2-chloro-l-methyl- 2-(methylaminomethyl)-l//-indole (0.7 g, 3.0 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-l/ -3a-azacyclopenta[α]indene, the title compound (1.03 g, 84%) was obtained as a white solid: MS (ES) m/e 409.0 (M + Η)⁺. Example 56

0810Preparation of (E)-N-(naphthalen-2-ylmethyl)-N-methyl-3-(7-oxo-5.6J.8-tetrahydro- 1.8- naphthyridin-3-yl)acrylamide

0811According to the procedure of Example 24, except substituting 2- (methylaminomethyl)naphthalene (0.55 g, 3.2 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[α]indene, the title compound (0.871 g, 73%) was obtained as a white solid: MS (ES) m/e 372.2 (M + Η)+.

0812Example 57

0813Preparation of (E)-N-(l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(6-amino-7-oxo-5.6.7.8- tetrahydro- 1.8-naphthyridin-3-yl)acrylamide

0814a) (E)-N-(l-Methyl-lH-indol-3-ylmethyl)-N-methyl-3-[6-(benzhydrylideneamino)-7-oxo- 5 ,6,7,8-tetrahydro- 1 ,8-naphthyridin-3-yl] acrylamide

0815According to the procedure of Example 15, except substituting 3- (benzhydrylideneamino)-6-bromo-3,4-dihydro-lH-l,8-naphthyridin-2-one (3.5 g, 8.6 mmole) for the 5-bromo-2,2' -dipyridylamine, the title compound (3.72 g, 78%) was obtained as a pale yellow solid: MS (ES) m/e 554.4 (M + Η)⁺.

0816b) (E)-N-(l-Methyl-lH-indol-3-ylmethyl)-N-methyl-3-(6-amino-7-oxo-5,6,7,8-tetrahydro- l,8-naphthyridin-3-yl)acrylamide To a suspension of (E)-N-( 1 -methyl- lH-indol-3-ylmethyl)-N-methyl-3- [6-

0817(benzhydrylideneamino)-7-oxo-5,6,7,8-tetrahydro-l,8-naphthyridin-3-yl]acrylamide (0.5 g, 0.9 mmole) in dioxane (15 mL) was added 1 N ΗC1 (10 mL) with stirring at RT. After approximately 5 min the suspension cleared up then gradually reformed. After stirring for 1 h the reaction was neutralized with 1 N NaOΗ (10 mL) and concentrated to near dryness under vacuum. The resulting suspension was diluted with Η2O (20 mL) and filtered, and the solid was rinsed with cold H2O and dried under vacuum. The slightly pinkish solid was triturated with Et₂0, filtered, and dried under vacuum to give the title compound (248 mg, 71%) as an off-white solid: MS (ES) m/e 390.4 (M + H)⁺. Example 58

0818Preparation of (E)-N-(benzofuran-2-ylmethyl)-N-methyl-3-(7-oxo-5,6.7.8-tetrahvdro-l,8- naphthyridin-3-yl)acrylamide

0819According to the procedure of Example 4, except substituting (E)-3-(7-oxo-5,6,7,8- tetrahydro-l,8-naphthyridin-3-yl)acrylic acid hydrochloride salt (1.60 g, 6.3 mmole) for the (E)-3-(2-oxo-2,3-dihydro-lH-indol-5-yl)acrylic acid hydrochloride salt, and substituting 2- (methylaminomethyl)benzofuran (1.20 g, 6.9 mmole) for the 2-methyl-3- (methylaminomethyl)indole, the title compound (2.0 g, 90%) was prepared as a tan solid: MS (ES) m/e 363 (M + Η)+.

0820Example 59

0821Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(7-methoxycarbonyl-l-methyl-lH-indol-3- ylmethyl)-N-methylacrylamide

0822According to the procedure of Example 31, except substituting methyl l-methyl-3- (methylaminomethyl)-lH-indole-7 -carboxylate for the l,4-dimethyl-3- (methylaminomethyl)- IH-indole, the title compound (150 mg, 34%) was obtained, after trituration with diethyl ether, as an off-white solid: MS (ES) m/e 379.2 (M + Η)⁺. Anal. Calcd for C ₁H₂₂N₄0 • 0.25 H 0: C, 65.87; H, 5.92; N, 14.63. Found: C, 66.02; H, 5.71; N, 14.29.

0823Example 60

0824Preparation of (E)-3-(aminopyridin-3-yl)-N-methyl-N-( 1 ,2.7-trimethyl- 1 H-indol-3- ylmethvDacrylamide

0825According to the procedure of Example 31, except substituting 3-

0826(methylaminomethyl)-l,2,7-trimethyl-lH-indole for the l,4-dimethyl-3- (methylaminornethyl)-l/V-indole, the title compound (120 mg, 29%) was obtained, after trituration with ethyl acetate, as a light yellow solid: MS (ES) m/e 349.0 (M + Η)⁺. Anal. Calcd for C₂₁H₂₄N₄0 ^■ H₂0: C, 68.82; H, 7.69; N, 15.29. Found: C, 68.42; H, 6.86; N, 15.61. Example 61

0827Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(7-chloro-lZ/-indol-3-ylmethyl)-N- methylacrylamide

0828According to the procedure of Example 31, except substituting 7-chloro-3- (methylaminomethyl)- IH-indole for the l,4-dimethyl-3-(methylaminomethyl)- IH-indole, the title compound (150 mg, 25%) was obtained, after trituration with ethyl acetate, as a light yellow solid: MS (ES) m/e 341.0 (M + Η)+. Anal. Calcd for Ci gH₁₇N₄0 ^• 0.25 H₂0: C, 62.60; H, 5.10; N, 16.22. Found: C, 62.29; H, 5.01; N, 16.32.

0829Example 62

0830Preparation of (E)-N-(5-chloro-l-methyl-lH-indol-3ylmethyl-N-methyl-3-(7-oxo-5.6,7.8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide

0831According to the procedure of Example 42, except substituting 5-chloro-l-methyl- 3-(methylaminomethyl)- IH-indole for the 7-chloro-l-methyl-3-(methylaminomethyl)-lH- indole, the title compound (100 mg, 49%) was obtained as a light tan solid: MS (ES) m/e 409.0 (M + Η)+. Anal. Calcd for C₂₂H₂₁C1N₄0₂^• 0.5 H₂0: C, 63.23; H, 5.32; N, 13.40. Found: C, 63.19; H, 5.23; N, 13.45.

0832Example 63

0833Preparation of (E)-N-(6-chloro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6.7.8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide

0834According to the procedure of Example 42, except substituting 6-chloro-l-methyl-

08353-(methylaminomethyl)- IH-indole for the 7 -chloro- l-methyl-3-(methylaminomethyl)- IH- indole, the title compound (125 mg, 61%) was obtained as a light tan solid: MS (ES) m/e 409.0 (M + Η)+. Anal. Calcd for C₂₂H₂χClN₄θ2 ^■ 0.25 H₂0: C, 63.92; H, 5.24; N, 13.55. Found: C, 63.96; H, 4.98; N, 13.66. Example 64

0836Preparation of (E)-N-(1.7-dimethyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8- tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0837According to the procedure of Example 42, except substituting l,7-dimethyl-3- (methylaminomethyl)- IH-indole for the 7-chloro-l-methyl-3-(methylaminomethyl)- IH- indole, the title compound (100 mg, 51%) was obtained as a white solid: MS (ES) m/e 389.2 (M + Η)+. Anal. Calcd for C23H₂4N₄0₂^■ 0.25 H₂0: C, 70.29; H, 6.28; N, 14.25. Found: C, 70.06; H, 6.23; N, 14.29

0838Example 65

0839Preparation of (E)-N-(l.6-dimethyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide

0840According to the procedure of Example 42, except substituting l,6-dimethyl-3- (methylaminomethyl)- IH-indole for the 7-chloro-l-methyl-3-(methylaminomethyl)-lH- indole, the title compound (95 mg, 49%) was obtained as a white solid: MS (ES) m/e 389.2 (M + Η)+. Anal. Calcd for C23H24N4O2 ^■ 0.75 H₂0: C, 68.72; H, 6.39; N, 13.93. Found: C, 68.98; H, 6.07; N, 13.81.

0841Example 66

0842Preparation of (E)-N-(l,4-dimethyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6.7,i; tetrahvdro- 1.8-naphthyridin-3-yl)acrylamide

0843According to the procedure of Example 42, except substituting l,4-dimethyl-3- (methylaminomethyl)- l//-indole for the 7-chloro-l-methyl-3-(methylaminomethyl)-l//- indole, the title compound (90 mg, 46%) was obtained as a white solid: MS (ES) m/e 389.0 (M + Η)+. Anal. Calcd for C23H24N4O2 ^■ 0.5 H₂0: C, 69.50; H, 6.33; N, 14.10. Found: C, 69.40; H, 6.24; N, 14.20. Example 67

0844Preparation of (E)-N-( 1,5-dimethyl- lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8- tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0845According to the procedure of Example 42, except substituting l,5-dimethyl-3- (methylaminomethyl)- IH-indole for the 7-chloro-l-methyl-3-(methylaminomethyl)- IH- indole, the title compound (100 mg, 51%) was obtained as a white solid: MS (ES) m/e 389.2 (M + Η)+. Anal. Calcd for C₂₃H₂₄N₄0₂^• 0.125 H₂0: C, 70.70; H, 6.25; N, 14.34. Found: C, 70.75; H, 6.15; N, 14.38.

0846Example 68

0847Preparation of (E)-N-(7-methoxy-l-methyl-l//-indol-3-ylmethyl)-N-methyl-3-(7-oxo- 5,6,7.8-tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0848According to the procedure of Example 42, except substituting 7-methoxy-l- methyl-3-(methylaminomethyl)-lH-indole for the 7-chloro-l-methyl-3- (methylaminomethyl)- IH-indole, the title compound (85 mg, 42%) was obtained as an off- white solid: MS (ES) m/e 405.2 (M + Η)+. Anal. Calcd for C₂₃H₂₄N₄θ3: C, 68.30; H, 5.95; N, 13.85. Found: C, 67.95; H, 5.94; N, 13.94.

0849Example 69

0850Preparation of (E)-N-(7-hydroxy-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo- 5.6.7, 8-tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0851According to the procedure of Example 42, except substituting 7-hydroxy-l- methyl-3-(methylaminomethyl)-lH-indole for the 7-chloro-l-methyl-3- (methylaminomethyl)- IH-indole, the title compound (200 mg, 51%) was obtained as a tan solid: MS (ES) m/e 391.2 (M + Η)⁺. Anal. Calcd for C₂₂H₂₂N₄0₃- 0.75 H₂0: C, 65.41; H, 5.85; N, 13.86. Found: C, 65.25; H, 5.95; N, 13.79. Example 70

0852Preparation of (E)-N-(4-chloro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8- tetrahvdro- 1.8-naphthyridin-3-y Dacry lamide

0853According to the procedure of Example 42, except substituting 4-chloro-l-methyl- 3-(methylaminomethyl for the 7-chloro-l-methyl-3-(methylaminomethyl)- IH-indole, the title compound (100 mg, 49%) was obtained as a white solid: MS (ES) m/e 409.0 (M + Η)+. Anal. Calcd for C₂₂H₂₁C1N₄0₂: 0.75 H₂0: C, 62.55; H, 5.36; N, 13.26. Found: C, 62.71; H, 5.24; N, 13.15.

0854Example 71

0855Preparation of (E)-N-(4-methoxy- 1 -methyl- lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo- 5.6.7,8-tetrahydro-l,8-naphthyridin-3-yl)acrylamide

0856According to the procedure of Example 42, except substituting 4-methoxy-l- methyl-3-(methylaminomethyl)- IH-indole for the 7-chloro-l-methyl-3- (methylaminomethyl)-l //-indole, the title compound (65 mg, 32%) was obtained as an off- white solid: MS (ES) m/e 405.2 (M + Η)+. Anal. Calcd for C₂₃H₂₄N₄θ3 ^• 1.25 H₂0: C, 64.69; H, 6.19; N, 13.33. Found: C, 64.49; H, 5.94; N, 13.76

0857Example 72

0858Preparation of (E)-N-(5-methoxy-l -methyl- lH-indol-3-ylmethyl)-N-methyl-3-.7-oxo- 5.6.7.8-tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0859According to the procedure of Example 42, except substituting 5-methoxy-l- methyl-3-(methylarninomethyl)-lH-indole for the 7-chloro-l-methyl-3- (methylaminomethyl)- l -indole, the title compound (90 mg, 44%) was obtained as an off- white solid: MS (ES) m/e 405.2 (M + Η)+. Anal. Calcd for C₂₃H₂4N₄θ3 ^■ 0.5 H 0: C, 66.81; H, 6.09; N, 13.55. Found: C, 66.67; H, 5.96; N, 13.87. Example 73

0860Preparation of (E) 3-(6-aminopyridin-3-yl)-N-(7-carboxy-l -methyl- lH-indol-3-ylmethyl)- N-methylacrylamide

0861A solution of (E)-3-(6-aminopyridin-3-yl)-N-(7-methoxycarbonyl-l-methyl-lH- indol-3-ylmethyl)-N-methylacrylamide (76 mg, 0.2 mmole) in methanol (4 mL), water (2 mL), and tetrahydrofuran (2 mL) was treated with LiOΗ (39 mg, 1.6 mmole), and the reaction was stirred at ambient temperature for 48 h. The mixture was filtered, and the filtrate was acidified to pΗ 4.0-4.5 with 1.0 N ΗC1. The precipitate was collected, washed with water and dried giving the title compound (25 mg, 35%) as a white solid: MS (ES) m/e 365.2 (M + Η)+. Anal. Calcd for C₂₀H₂₀N₄O3 • 0.25 H₂0: C, 65.11: H, 5.60; N, 15.18. Found: C, 64.83; H, 5.52; N, 15.07.

0862Example 74

0863Preparation of (E)-N-(6-methoxy-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo- 5,6,7.8-tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0864According to the procedure of Example 42, except substituting 6-methoxy- 1- methyl-3-(methylaminomethyl)-lH-indole for the 7-chloro-l-methyl-3- (methylaminomethyl)-lH-indole, the title compound (65 mg, 32%) was obtained as a yellow solid: MS (ES) m/e 405.2 (M + Η)+. Anal. Calcd for C₂3H₂₄N₄θ3 ^■ H₂0: C, 65.38; H, 6.20; N, 13.26. Found: C, 65.36; H, 5.98; N, 13.16.

0865Example 75

0866Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(6-methoxycarbonyl-l-methyl-lH-indol-3- ylmethyl)-N-methylacrylamide

0867According to the procedure of Example 31, except substituting methyl l-methyl-3- (methylaminomethyl)-lH-indole-6-carboxylate for the l,4-dimethyl-3- (methylaminomethyl)- IH-indole, the title compound (168 mg, 39%) was obtained, after silica gel chromatography, as a white solid: MS (ES) m/e 379.2 (M + Η)⁺. Anal. Calcd for C₂₁H₂₂N₄0₃ • 0.125 H₂0: C, 66.25; H, 5.93; N, 14.71. Found: C, 66.60; H, 6.13; N, 14.18. Example 76

0868Preparation of (E)-N-(3.3-dimethyl-3H-indene-l-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8- tetrahvdro- 1.8-naphthyridin-3-yl)acrylamide

0869According to the procedure of Example 42, except substituting 3,3-dimethyl-l- (methylaminomethyl)-3H-indene for the 7-chloro-l-methyl-3-(methylaminomethyl)-lH- indole, the title compound (48 mg, 12%) was obtained, after silica gel chromatography, as a tan solid: MS (ES) m/e 388.2 (M + Η)+. Anal. Calcd for C₂3H₂₄N₄θ3 ^• 0.375 H₂0: C, 73.31; H, 6.51; N, 10.66. Found: C, 72.91; H, 6.37; N, 11.16.

0870Example 77

0871Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(4-fluoro-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide

0872According to the procedure of Example 24, except substituting 4-fluoro-l-methyl- 3-(methylaminomethyl)- IH-indole (0.2 g, 1.04 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[β]indene, and substituting (E)-3-(6-amino- pyridin-3-yl)acrylic acid (0.17 g, 1.04 mmole) for the (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylic acid hydrochloride salt, the title compound (0.11 g, 37%) was prepared as an off-white powder: MS (ES) m/e 339 (M + Η)⁺.

0873Example 78

0874Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(5-fluoro-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide

0875According to the procedure of Example 24, except substituting 5 -fluoro- 1-methyl-

08763-(methylaminomethyl)- IH-indole (0.2 g, 1.04 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[α]indene, and substituting (E)-3-(6-amino- pyridin-3-yl)acrylic acid (0.17 g, 1.04 mmole) for the (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylic acid hydrochloride salt, the title compound (0.14 g, 41%) was prepared as an off-white powder: MS (ES) m/e 339 (M + Η)⁺. Example 79

0877Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(7-fluoro-l-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide

0878According to the procedure of Example 24, except substituting 7-fluoro-l-methyl- 3-(methylaminomethyl)- IH-indole (0.2 g, 1.04 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[α]indene, and substituting (E)-3-(6-amino- pyridin-3-yl)acrylic acid (0.17 g, 1.04 mmole) for the (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylic acid hydrochloride salt, the title compound (0.1 g, 27%) was prepared as an off-white powder: MS (ES) m/e 339 (M + Η)⁺.

0879Example 80

0880Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(4-fluoro-lH-indol-3-ylmethyl)-N- methylacrylamide

0881According to the procedure of Example 24, except substituting 4-fluoro-3- (methylaminomethyl)- IH-indole (0.31 g, 1.74 mmole) for the 2,3-dihydro-8- (methylaminomethyl)- lH-3a-azacyclopenta[α]indene, and substituting (E)-3-(6-amino- pyridin-3-yl)acrylic acid (0.285 g, 1.74 mmole) for the (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylic acid hydrochloride salt, the title compound (0.2 g, 36%) was prepared as a white powder: MS (ES) m/e 325 (M + Η)⁺.

0882Example 81

0883Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(7-fluoro-lH-indol-3-ylmethyl)-N- methylacrylamide

0884According to the procedure of Example 24, except substituting 7-fluoro-3-

0885(methylaminomethyl)- IH-indole (0.31 g, 1.74 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[α]indene, and substituting (E)-3-(6-amino- pyridin-3-yl)acrylic acid (0.285 g, 1.74 mmole) for the (E)-3-(7-oxo-5,6,7,8-tetrahydro-l,8- naphthyridin-3-yl)acrylic acid hydrochloride salt, the title compound (0.1 g, 18%) was prepared as a white powder: MS (ES) m/e 325 (M + Η)⁺. Example 82

0886Preparation of (E)-N-(4-fluoro-l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8- tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide

0887According to the procedure of Example 24, except substituting 4-fluoro-l-methyl- 3-(methylaminomethyl)- IH-indole (0.13 g, 0.68 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[α]indene), the title compound (0.15 g, 56%) was prepared as an off-white powder: MS (ES) m/e 393 (M + Η)⁺.

0888Example 83

0889Preparation of (E)-N-(quinolin-3-ylmethyl)-N-methyl-3-(7-oxo-5.6.7.8-tetrahvdro-1.8- naphthyridin-3-yl)acrylamide

0890According to the procedure of Example 24, except substituting 3- (methylaminomethyl)quinoline (0.12 g, 0.67 mmole) for the 2,3-dihydro-8- (methylaminomethyι)-lH-3a-azacyclopenta[--]indene), the title compound (0.1 g, 40%) was prepared as an off-white powder: MS (ES) m/e 373 (M + Η)⁺.

0891Example 84

0892Preparation of (E)-N-(naphthalen-l-ylmethyl)-N-methyl-3-(7-oxo-5,6.7,8-tetrahvdro-1.8- naphthyridin-3-yl)acrylarnide

0893According to the procedure of Example 24, except substituting N-methyl- 1- naphthalenemethylamine hydrochloride (0.162 g, 0.95 mmole) for the 2,3-dihydro-8- (methylaminomethyl)-lH-3a-azacyclopenta[α]indene), the title compound (0.15 g, 43%) was prepared as a white powder: MS (ES) m/e 372 (M + Η)⁺.

0894Example 85

0895Preparation of (E)-N-methyl-N-(2-methyl- lH-indol-3-ylmethyl)-3-r3-(2-methoxyethyl)-2- oxo-1.2.3.4-tetrahydropyridor2.3---t1pyrimidin-6-yllacrylamide A solution of 6-bromo-3-(2-methoxyethyl)-3,4-dihydro-lH-pyrido[2,3- -/]pyrimidin-2-one (0.86 g, 3.00 mmole), N-(2-methyl-lH-indol-3-ylmethyl)-N- methylacrylamide (see Example 1 (a), 0.68 g, 3.00 mmole), Pd(OAc)₂ (0.07 g, 0.30 mmole), tri-ort/iσ-tolylphosphine (0.18 g, 0.60 mmole) and diisopropylethylamine (1.31 mL, 7.50 mmole) in propionitrile (50 mL) was deoxygenated, then was heated at reflux under N₂ overnight. The dark mixture was filtered through a pad of celite®, and the filter pad was rinsed with acetonitrile (250 mL). The filtrate was concentrated in vacuo, and the residue was purified by flash chromatography on silica gel (10% EtOAc/EtOΗ). The title compound (0.46 g, 36%) was obtained as a light yellow solid after drying in vacuo: MS (ES) m/e 434 (M + Η)+.

0896Example 86

0897Preparation of (E)-N-(l-methyl-lH-indol-3-ylmethyl)-N-methyl-3-(6-methoxycarbonyl-7- oxo-5.6.7.8-tetrahydro-l,8-naphthyridin-3-yl)acrylamide

0898According to the procedure of Example 15 (b), except substituting methyl (±)-6- bromo-2-oxo-l,2,3,4-tetrahydro-lH-l,8-naphthyridine-3-carboxylate (2.5 g, 8.8 mmole), from Preparation 4 (d), for the 5-bromo-2,2' -dipyridylamine, the title compound (1.82 g, 48%) was prepared as an off-white solid: MS (ES) m/e 433.4 (M + Η)⁺.

0899Example 87

0900Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(1.3-dimethyl-lH-pyrrolor2.3-fclpyridin-3- ylmethyl)-N-methylacrylamide

0901The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0902Example 88

0903Preparation of (E)-N-(1.3-dimethyl-lH-pyrrolor2.3--?lpyridin-3-ylmethyl)-N-methyl-3-(7- oxo-5,6.7.8-tetrahvdro-l,8-naphthyridin-3-yl)acrylamide The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0904Example 89

0905Preparation of (E -3-(6-aminopyridin-3-yl)-N-methyl-N-(l-methyl-lH-pyrrolor2.3- clpyridin-3-ylmethyl)acrylamide

0906The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0907Example 90

0908Preparation of (E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(l-methyl-lH-pyrrolor3,2- clpyridin-3-ylmethyl)acrylamide

0909The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0910Example 91

0911Preparation of (E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(l-methyl-lH-pyrrolor3,2- b1pyridin-3-ylmethyl)acrylamide

0912The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0913Example 92

0914Preparation of (E)-N-methyl-N-(l-methyl-lH-pyrrolor2.3-clpyridin-3-ylmethyl)-3-(7- oxo-5,6.7.8-tetrahydro-1.8-naphthyridin-3-yl)acrylamide The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0915Example 93

0916Preparation of (E)-N-methyl-N-(l-methyl-lH-pyrrolo[3.2-clpyridin-3-ylmethyl)-3-(7- oxo-5.6,7.8-tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0917The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0918Example 94

0919Preparation of (E)-N-methyl-N-(l-methyl-lH-pyrrolor3,2-blpyridin-3-ylmethyl)-3- (7-0X0-5,6,7, 8-tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0920The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0921Example 95

0922Preparation of (E)-3-(6-aminopyridin-3-yl)-N-(benzofuran-3-ylmethyl)-N- methylacrylamide

0923The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0924Example 96

0925Preparation of (E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(3-methylbenzofuran-2- ylmethvDacrylamide

0926The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0927- I l l - Example 97

0928Preparation of (E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(2-methylbenzofuran-3- ylmethvDacrylamide

0929The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0930Example 98

0931Preparation of (ΕVN-(benzofuran-3-ylmethylVN-methyl-3-(7-oxo-5,6,7,8-tetrahydro- 1 ,8-naphthyridin-3-yl)acrylamide

0932The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0933Example 99

0934Preparation of (E)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(7-oxo-5,6,7, 8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide

0935The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0936Example 100

0937Preparation of (E)-N-methyl-N-(2-methylbenzofuran-3-ylmethyl)-3-(7-oxo-5,6.7.8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide

0938The title compound is prepared following methods analogous to those described in the previous preparations and examples. Example 101

0939Preparation of (E)-(6-aminopyridin-3-yl)-N-methyl-N-ri-(l-methyl-lH-indol-2- vPethyljacrylamide

0940The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0941Example 102

0942Preparation of (E)-(6-aminopyridin-3-yl -N-methyl-N-ri-(l-methyl-lH-indol-3- yDethvHacrylamide

0943The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0944Example 103

0945Preparation of (E)-N-methyl-N-ri-(l-methyl-lH-indol-2-vnethyll-3-(7-oxo-5.6.7.8- tetrahydro-1.8-naphthyridin-3-yl)acrylamide

0946The title compound is prepared following methods analogous to those described in the previous preparations and examples.

0947Example 104

0948Preparation of (E)-N-methyl-N-ri-(l-methyl-lH-indol-3-yl ethyl1-3-(7-oxo-5.6.7.8- tetrahydro-l,8-naphthyridin-3-yl)acrylamide

0949The title compound is prepared following methods analogous to those described in the previous preparations and examples. Example 105

0950Parenteral Dosage Unit Composition

0951A preparation which contains 20 mg of the compound of Example 1 as a sterile dry powder is prepared as follows: 20 mg of the compound is dissolved in 15 mL of distilled water. The solution is filtered under sterile conditions into a 25 mL multi-dose ampoule and lyophilized. The powder is reconstituted by addition of 20 mL of 5% dextrose in water (D5W) for intravenous or intramuscular injection. The dosage is thereby determined by the injection volume. Subsequent dilution may be made by addition of a metered volume of this dosage unit to another volume of D5W for injection, or a metered dose may be added to another mechanism for dispensing the drug, as in a bottle or bag for IV drip infusion or other injection-infusion system.

0952Example 106

0953Oral Dosage Unit Composition

0954A capsule for oral administration is prepared by mixing and milling 50 mg of the compound of Example 1 with 75 mg of lactose and 5 mg of magnesium stearate. The resulting powder is screened and filled into a hard gelatin capsule.

0955Example 107

0956Oral Dosage Unit Composition

0957A tablet for oral administration is prepared by mixing and granulating 20 mg of sucrose, 150 mg of calcium sulfate dihydrate and 50 mg of the compound of Example 1 with a 10% gelatin solution. The wet granules are screened, dried, mixed with 10 mg starch, 5 mg talc and 3 mg stearic acid; and compressed into a tablet.

0958The above description fully discloses how to make and use the present invention. However, the present invention is not limited to the particular embodiments described hereinabove, but includes all modifications thereof within the scope of the following claims. The various references to journals, patents and other publications which are cited herein comprises the state of the art and are incorporated herein by reference as though fully set forth.