Glucose transport mutants for production of biomaterial

<u>CROSS-REFERENCE TO RELATED APPLICATIONS</u>

0001This application claims priority to <patcit id="pcit0001" dnum="US41616602P" dnum-type="L"><text>U. S. Provisional Application 60/416,166, filed October 4, 2002</text></patcit> and to <patcit id="pcit0002" dnum="US37493102P" dnum-type="L"><text>U. S. Provisional Application 60/374,931, filed October 4, 2002</text></patcit>,

<u>TECHNICAL FIELD</u>

0002The present invention relates to genetically engineering metabolic pathways in bacterial host cells and provides methods and systems for the production of desired products in the engineered host cells. In particular, the invention relates to the enhancement of glucose transport in host strains, which were originally capable of using a phosphoenolpyruvate (PEP):phosphotransferase transport system (PTS) for glucose transport, by reducing PTS phosphoenolpyruvate (PEP) consumption and redirecting PEP or PEP precursors into a desired metabolic pathway, such as the common aromatic amino acid pathway.

<u>BACKGROUND ART</u>

0003Many industrially important microorganisms use glucose as their main carbon source to produce biosynthetic products. Therefore, cost-effective and efficient biosynthetic production of these products require that a carbon source, such as glucose be converted to said products at a high percentage yield. To meet this heed, it would be advantageous to increase the influx of carbon sources into and through various metabolic pathways, such as the common aromatic pathway, the tricarboxylic acid (TCA) pathway, and the anaplerotic oxaloacetate synthetic pathway.

0004In the initial stage of host cell carbohydrate metabolism, each glucose molecule is converted to two molecules of phosphoenolpyruvate (PEP) in the cytosol. PEP is one of the major metabolic building blocks that cells use in their biosynthetic routes. For example, PEP may be further converted to pyruvate and chemical reactions that convert glucose to pyruvate are referred to as the Embden-Meyerhoff pathway. All of the metabolic intermediates between the initial glucose carbohydrate and the final product, pyruvate, are phosphorylated compounds. Bacteria, which ferment glucose through the Embden-Meyerhof pathway, such as members of <i>Enterobacteriacea</i> and <i>Vibrionaceae,</i> are described in <nplcit id="ncit0001" npl-type="s"><text>Bouvet et al., (1989) International Journal of Systematic Bacteriology, 39:61-67</text></nplcit>. Pyruvate may then by metabolized to yield-products such as lactate, ethanol, formate, acetate and acetyl CoA. (See <figref idref="f0001">Figures 1A</figref> and <figref idref="f0002">1B</figref>).

0005In addition to the Embden-Meyerhof pathway, many bacteria posses an active transport system known as the phosphoenolpyruvate (PEP) - dependent phosphotransferase transport system (PTS). This system couples the transport of a carbon source, such as glucose to its phosphorylation. The phosphoryl group is transferred sequentially from PEP to enzyme I and from enzyme I to protein HPr. The actual translocation step is catalyzed by a family of membrane bound enzymes (called enzyme II), each of which is specific for one or a few carbon sources. Reference is made to <nplcit id="ncit0002" npl-type="s"><text>Postma et al., (1993) Phosphoenolpyruvate: Carbohydrate Phosphotransferase Systems in Bacteria, Microbiol. Reviews. 57:543 - 594</text></nplcit> and<nplcit id="ncit0003" npl-type="b"><text> Postma P.W. (1996) Phosphotransferase System for Glucose and Other Sugars. In: Neidhardt et al., Eds. ESCHERICHIA COLI AND SALMONELLA TYPHIMURIUM: CELLULAR AND MOLECULAR BIOLOGY. Vol. 1. Washington, D.C. ASM Press pp 127 - 141</text></nplcit>. However, due to the fact that PTS metabolizes PEP to phosphorylate the carbon source, the PTS system decreases the efficiency of carbon substrate conversion to a desired product. In glycolysis, two molecules of PEP are formed for every molecule of glucose catabolized. However, one molecule of PEP is required for PTS to function, leaving only one molecule of PEP available for other biosynthetic reactions.

0006Due to the role of PEP as a central metabolite, numerous approaches have been utilized to increase PEP supply in the cell and some of these are listed below: <ol id="ol0001" compact="compact" ol-style=""><li>a) eliminating pyruvate kinase activity by producing <i>pyk</i> mutants. Pyruvate kinase catalyzes the conversion of PEP to pyruvate. (<nplcit id="ncit0004" npl-type="s"><text>Mori et al., (1987) Agric. Biol. Chem. 51:129-138</text></nplcit>);</li><li>b) eliminating PEP carboxylase activity by producing <i>ppc</i> mutants. PEP carboxylase catalyzes the conversion of PEP to oxaloacetate. (<nplcit id="ncit0005" npl-type="s"><text>Miller et al., (1987) J. Ind. Microbiol. 2:143-149</text></nplcit>);</li><li>c) amplifying the expression of <i>pps</i> which encodes PEP synthase. PEP synthase catalyzes the conversion of pyruvate to PEP (<patcit id="pcit0003" dnum="USSN08307371A" dnum-type="L"><text>USSN 08/307,371</text></patcit>); and</li><li>d) increasing the supply of D-erythrose-4-phosphate (E4P) by for example overexpression of a transketolase gene (<i>tkt</i>A or <i>tkt</i>B) (<patcit id="pcit0004" dnum="US5168056A"><text>US Patent 5,168,056</text></patcit>) or overexpression of the transaldolase gene (<i>tal</i>A) (<nplcit id="ncit0006" npl-type="s"><text>lida et al., (1983) J. Bacteriol. 175:5375-5383</text></nplcit>). Transketolase catalyzes the conversion of D-fructose-6-phosphate to E4P and transaldolase catalyzes the conversion of D-sedoheptulose-7-phosphate plus glyceraldehyde -3-phosphate to E4P plus fructose-6-phophate.</li></ol>

0007In addition to the above listed approaches, researchers have looked at methods of decreasing PTS:PEP dependent consumption by eliminating or modifying the function of the PTS. This approach is also attractive because PEP is twice as energetic as ATP. Many of these efforts focus on using an inactive PTS system. Examples of studies manipulating the PTS system include: <ol id="ol0002" compact="compact" ol-style=""><li>a) restoring a glucose phenotype (Glu⁺) in PTS inactivated <i>E. coli</i> cells by introducing the genes <i>glf</i> and <i>glk</i> which encode a glucose-facilitated diffusion protein and glucokinase, respectively, from <i>Zymomonas mobilis,</i> wherein the <i>E</i>. <i>coli</i> cells have an inactivated PTS due to a deletion of the <i>pstHIcrr</i> operon (<patcit id="pcit0005" dnum="US5602030A"><text>USP 5,602,030</text></patcit> and <nplcit id="ncit0007" npl-type="s"><text>Snoep et al., (1994) J. Bact. 176:2133 - 2135</text></nplcit>) and</li><li>b) subjecting PTS^-/Glu^-<i>E</i>. <i>coli</i> strains to continuous culture selection on glucose and obtaining Glu+ revertants (PTS^-/Glu⁺) with the capacity to obtain growth rates similar or higher than that of wild-type PTS^-/Glu^- strains. (<nplcit id="ncit0008" npl-type="s"><text>Flores et al., (2002) Metab. Eng 4:124 -137</text></nplcit>;<nplcit id="ncit0009" npl-type="s"><text> Flores et al., (1996) Nature Biotechnol. 14:620 - 623</text></nplcit> and <patcit id="pcit0006" dnum="WO9634961A"><text>WO96/34961</text></patcit>).</li></ol>

0008However, these approaches have various limitations. In general, the use of heterologous genes does not always work efficiently in new hosts. Additionally, membrane proteins, such as a glucose-facilitated diffusion protein, are usually intimately associated with lipids in the cell membrane and these can vary from species to species. Introduced soluble proteins such as glucokinase, may be subject to protease degradation. Further the use of spontaneous mutations in a cell to regain a phenotype can have unpredictable outcomes, and for industrial processes it is desirable to use completely characterized strains.

0009Contrary to the methods previously described, the present invention increases carbon flow to metabolic pathways in bacterial strains capable of transporting glucose without consuming PEP during the process. The conserved PEP or PEP precursors can then be redirected into a given metabolic pathway for enhanced production of a desired product. These strains are generated in cells having an inactivated PEP-dependent PTS by modifying an endogenous chromosomal regulatory region that is operably linked to a glucose assimilation protein and more specifically to a glucose transporter and/or a glucose phosphorylating protein, to restore or re-attain the ability of the cell to use glucose as a carbon source while maintaining an inactivated PTS. These cells are designated PTS^-/Glu⁺.

<u>SUMMARY OF THE INVENTION</u>

0010Accordingly, there is provided by the present invention a method according to claim 1.

0011In a first aspect, the invention pertains to a method of increasing carbon flow into a metabolic pathway of a PTS^-/Glu^- bacterial host cell which was originally capable of utilizing a phosphotransferase transport system (PTS) for carbohydrate transport which comprises a) modifying an endogenous chromosomal regulatory region which is operably linked to a nucleic acid encoding a glucose assimilation protein in a PTS^-/Glu^- host cell by transforming the PTS^-/Glu^- host cell with a DNA construct comprising a promoter and DNA flanking sequences corresponding to upstream (5') regions of the glucose assimilation protein; b) allowing integration of the DNA construct to restore a Glu+ phenotype; and c) culturing the transformed host cell under suitable culture conditions, wherein the carbon flow into a metabolic pathway of the transformed host cell is increased compared to the carbon flow into the same metabolic pathway in a corresponding PTS bacterial host cell cultured under essentially the same culture conditions. In one embodiment of the method the promoter is a non-host cell promoter or a modified endogenous promoter. In a second embodiment the glucose assimilation protein is a glucose transporter, preferably a galactose permease obtained from <i>E</i>. <i>coli</i> or a glucose transporter having at least 80% sequence identity thereto. In a third embodiment the glucose assimilation protein is a phosphorylating protein, preferably a glucokinase obtained from <i>E</i>. <i>coli</i> or a glucokinase having at least 80% sequence identity thereto. In a fourth embodiment of the method the bacterial host cell is selected from the group consisting of <i>E</i>. <i>coli</i> cells, <i>Bacillus</i> cells and <i>Pantoea</i> cells. In a fifth embodiment, the PTS^-/Glu^- host cell is obtained from a PTS cell by deletion of one or more genes selected from the group consisting of <i>pts</i>I, <i>pts</i>H and <i>crr.</i> In a sixth embodiment, the PTS^-/Glu⁺ host cell is transformed with a polynucleotide encoding a protein selected from the group consisting of a transketolase, a transaldolase, a phosphoenolpyruvate synthase, DAHP synthase, DHQ synthase, DHQ dehydratase, shikimate dehydrogenase, shikimate kinase EPSP synthase and chorismate synthase.

0012In a second aspect, the invention pertains to a method as described in the first aspect and further comprising modifying an endogenous chromosomal regulatory region which is operably linked to a nucleic acid encoding a glucokinase in the PTS^-/Glu^- host cell by transforming the PTS^-/Glu^- host cell with a second DNA construct comprising a promoter and DNA flanking sequences corresponding to upstream (5') regions of the glucokinase.

0013In a third aspect, the invention pertains to a method for increasing the production of a desired product in a PTS^-/Glu^- bacterial host cell originally capable of utilizing a PTS for carbohydrate transport which comprises a) transforming a bacterial host cell having a PTS^-/Glu^- phenotype with a DNA construct comprising a promoter, wherein said DNA construct is chromosomally integrated into the PTS^-/GLu^- host cell replacing an endogenous promoter which is operably linked to a nucleic acid encoding a glucose assimilation protein; b) culturing the transformed bacterial host cell under suitable conditions; c) allowing expression of the glucose assimilation protein to obtain a host cell having a PTS^- /Glu⁺ phenotype; and d) obtaining an increased amount of a desired product in the transformed bacterial host cell compared to the amount of the desired product produced in a corresponding PTS bacterial cell cultured under essentially the same culture conditions, wherein said desired product is selected from the group consisting of pyruvate, PEP, lactate, acetate, glycerol, succinate, ethanol and chorismate. In one embodiment the host cell is selected from the group consisting of <i>E</i>. <i>coli</i> cells, <i>Bacillus</i> cells and <i>Pantoea</i> cells. In a second embodiment the glucose assimilation protein is a galactose permease obtained from <i>E</i>. <i>coli</i> or a glucose transporter having at least 80% sequence identity thereto. In a third embodiment, the glucose assimilation protein is a glucokinase obtained from <i>E</i>. <i>coli</i> or a glucokinase having at least 70% sequence identity thereto.

0014In a fourth aspect, the invention pertains to a method of increasing carbon flow into a metabolic pathway of a PTS^-/Glu^- bacterial host cell originally capable of utilizing a phosphotransferase transport system (PTS) for carbohydrate transport which comprises a) modifying an endogenous chromosomal regulatory region which is operably linked to a nucleic acid encoding a galactose permease in a PTS^-/Glu^- host cell by transforming the PTS^-/Glu^- host cell with a first DNA construct comprising a promoter and DNA flanking sequences corresponding to upstream (5') regions of the galactose permease; b) modifying an endogenous chromosomal regulatory region which is operably linked to a nucleic acid encoding a glucokinase in the PTS^-/Glu^- host cell by transforming the PTS^-/Glu^- host cell with a second DNA construct comprising a promoter and DNA flanking sequences corresponding to upstream (5') regions of the glucokinase; c) allowing integration of the first and the second DNA constructs, wherein the first DNA construct replaces an endogenous promoter of the nucleic acid encoding the galactose permease and the second DNA construct replaces an endogenous promoter of the nucleic acid encoding the glucokinase wherein both the galactose permease and the glucokinase are expressed in the host cell and wherein said expression results in an increase in carbon flow into a metabolic pathway of the transformed host cell compared to carbon flow into the same metabolic pathway in the corresponding unaltered PTS^-/GLu^- bacterial cell. In one embodiment the metabolic pathway is the common aromatic pathway. In a second embodiment the method further comprises transforming the PTS^-/Glu^- host cell with a polynucleotide encoding a protein selected from the group consisting of a transketolase, a transaldolase and a phosphoenolpyruvate synthase.

0015In a fifth aspect, the invention pertains to a method of restoring a Glu+ phenotype to a PTS^-/Glu^- bacterial host cell which was originally capable of utilizing a phosphotransferase transport system (PTS) for carbohydrate transport which comprises a) modifying an endogenous chromosomal regulatory region which is operably linked to a nucleic acid encoding a glucose transporter in a PTS^-/Glu^- host cell by transforming the PTS^-/Glu^- host cell with a first DNA construct comprising a promoter and DNA flanking sequences corresponding to upstream (5') regions of the glucose transporter, b) allowing integration of the first DNA construct, wherein the first DNA construct replaces an endogenous promoter of the nucleic acid encoding the glucose transporter; and c) allowing expression of the glucose transporter, wherein said expression restores a Glu+ phenotype to the PTS^-/Glu^- host cell. In a preferred embodiment the method according to this aspect further comprises modifying an endogenous chromosomal regulatory region which is operably linked to a nucleic acid encoding a glucokinase in the PTS^-/Glu^- host cell by transforming the PTS^-/Glu^- host cell with a second DNA construct comprising an exogenous promoter and DNA flanking sequences corresponding to upstream (5') regions of the glucokinase; allowing integration of the second DNA construct wherein the second DNA construct replaces an endogenous promoter of the nucleic acid encoding the glucokinase; and allowing expression of the glucokinase. In one embodiment the restored Glu⁺ cells have a specific growth rate of at least about 0.4 hr^-1. In another embodiment the glucose transporter is a galactose permease.

0016In a sixth aspect the invention pertains to a method of increasing phosphoenolpyruvate (PEP) availability in a bacterial host cell which comprises a) selecting a bacterial host cell having a PTS^-/Glu^- phenotype, wherein the bacterial host was originally capable of utilizing a phosphotransferase transport system (PTS) for carbohydrate transport; b) modifying an endogenous chromosomal regulatory sequence of the selected bacterial host cell comprising transforming said selected bacterial host cell with a DNA construct comprising a promoter, wherein said DNA construct is chromosomally integrated into the selected bacterial host cell replacing an endogenous promoter which is operably linked to a nucleic acid encoding a glucose assimilation protein; c) culturing the transformed bacterial host cell under suitable conditions; and d) allowing expression of the glucose assimilation protein to obtain an altered host cell having a PTS^-/Glu⁺ phenotype, wherein the PEP availability is increased compared to the PEP availability in a corresponding unaltered PTS bacterial host cell cultured under essentially the same culture conditions. In one embodiment the glucose assimilation protein is a galactose permease and the DNA construct comprises an exogenous promoter which replaces the endogenous promoter of the galactose permease. In another embodiment the glucose assimilation protein is a glucokinase and the DNA construct comprises an exogenous promoter which replaces the endogenous promoter of a glucokinase.

0017In an eighth aspect, the invention pertains to a method for increasing the growth rate of a PTS^-/Glu^- bacterial host cell originally capable of utilizing a phosphotransferase transport system (PTS) for carbohydrate transport which comprises, a) modifying an endogenous chromosomal regulatory region which is operably linked to a nucleic acid encoding a galactose permease in a PTS^-/Glu^- host cell by transforming the PTS^-/Glu^-host cell with a first DNA construct comprising an exogenous promoter and DNA flanking sequences corresponding to (5') upstream region of the galactose permease; b) modifying an endogenous regulatory region which is operably linked to a nucleic acid encoding a glucokinase in the PTS^-/Glu^- host cell by transforming the PTS^-/Glu^- host cell with a second DNA construct comprising an exogenous promoter and DNA flanking sequences corresponding to upstream (5') regions of the glucokinase; c) allowing integration of the first and the second DNA constructs, wherein the first DNA construct replaces the endogenous promoter of the nucleic acid encoding the galactose permease and the second DNA construct replaces the endogenous promoter of the nucleic acid encoding the glucokinase d) culturing the transformed bacterial host cell under suitable conditions; and e) allowing expression of the galactose permease and the glucokinase from the modified regulatory regions to obtain an altered bacterial cell having an increase specific growth rate compared to the specific growth rate of a corresponding unaltered PTS bacterial host cell cultured under essentially the same culture conditions.

0018In a ninth aspect, the invention pertains to a method for increasing the production of a desired product in a PTS^-/Glu^-<i>E. coli</i> host cell originally capable of utilizing a PTS for carbohydrate transport which comprises a) modifying an endogenous chromosomal regulatory region which is operably linked to a nucleic acid encoding a galactose permease in an <i>E</i>. <i>coli</i> PTS^-/Glu^- cell by transforming the <i>E</i>. <i>coli</i> PTS^-/Glu^- cell with a first DNA construct comprising an exogenous promoter and DNA flanking sequences corresponding to upstream (5') regions of the galactose permease; b) modifying an endogenous chromosomal regulatory region which is operably linked to a nucleic acid encoding a glucokinase in the <i>E</i>. <i>coli</i> PTS^-/Glu^- cell by transforming the <i>E</i>. <i>coli</i> PTS^-/Glu^- cell with a second DNA construct comprising an exogenous promoter and DNA flanking sequences corresponding to upstream (5') regions of the glucokinase; c) culturing the transformed <i>E. coli PTS^-</i>/<i>Glu</i>^- cell under suitable conditions to allow expression of the galactose permease and expression of the glucokinase; and d) obtaining an increased amount of a desired product in the transformed <i>E</i>. <i>coli</i> cells compared to the amount of the desired product in a corresponding PTS^-/Glu^-<i>E</i>. <i>coli</i> cell cultured under essentially the same culture conditions wherein the desired product is ethanol, chorismate or succinate.

0019In a tenth aspect, the invention pertains to the transformed bacterial cells obtained according to the methods of the first through ninth aspects. In one preferred embodiment, the transformed bacterial cells are <i>E</i>. <i>coli</i> cells, <i>Bacillus</i> cells or <i>Pantoea</i> cells.

<u>BRIEF DESCRIPTION OF THE DRAWINGS</u>

0020<figref idref="f0001">Figures 1A</figref> and <figref idref="f0002">1B</figref> illustrate the pathways of central carbon metabolism in <i>E</i>. <i>coli,</i> showing derivation of the carbon skeletons for various desired compounds including compounds in the biosynthesis of amino acids. From <figref idref="f0001">figure 1A</figref> it can be observed that (a) glucose is transported across the cell membrane by a galactose permease (GalP) transport protein and (b) that glucose moves across the membrane to be phosphorylated by PEP in the PTS system. The phosphorylation of glucose by the PTS is the major consumer of PEP in PTS cells and the percentages shown in the figure represent the amount of PEP channeled into competing pathways as described by <nplcit id="ncit0010" npl-type="b"><text>Holms (1986) The central metabolic pathways of Escherichia coli: relationship between flux and control at a branch point, efficiency of conversion to biomass, and excretion of acetate. In: CURRENT TOPICS IN CELLULAR REGULATION, Vol. 28, pp. 69-105 Academic Press, New York</text></nplcit>. For example, 66% of the PEP produced is used in the PTS system. The following metabolic systems are schematically illustrated in the figure: Embden-Meyerhoff pathway (glycolysis), the pentose phosphate pathway, tricarboxylic acid (TCA) pathway, common aromatic pathway, and the Entner-Doudoroff pathway.

0021The following abbreviations are used in the figure and throughout the disclosure: PEP = phosphoenolpyruvate; DAHP = 3-deoxy-D-arabino-heptulosonate 7-phosphate; DHQ = 3-dehydroquinate; DHS = 3-dehydroshikimate; SHK = shikimate; S3P = shikimate 3-phosphate; EPSP = 5-enolpyruvyl shikimate 3-phosphate; PHE = phenylalanine; TYR = tyrosine; TRP = tryptophan; Pyk = pyruvate kinase, which is encoded by the gene <i>pyk</i>; and Ppc = PEP carboxylase, which is encoded by the gene <i>ppc</i>. Further, the following genes are illustrated for the common aromatic pathway: <i>aroB</i> which encodes DHQ synthase; <i>aroD</i> which encodes DHQ dehydratase; <i>aroE</i> which encodes shikimate dehydrogenase; <i>aroL</i> and <i>aroK</i> which encode shikimate kinase; <i>aroA</i> which encodes EPSP synthase and <i>aroC</i> which encodes chorismate synthase. While not specifically illustrated, one skilled in the art is aware that <i>aroG</i>, <i>aroF</i> and <i>aroH</i> encode the three isozymes of DAHP synthase which catalyzes the conversion of Erythrose-4P (E4P) and PEP to DAHP in <i>E</i>. <i>coli.</i><figref idref="f0001 f0002">Figure 1</figref> B illustrates the varied compounds, the production of which, may be enhanced by an increase in carbon flux and PEP availability according to the methods encompassed by the invention.

0022<figref idref="f0003">Figure 2</figref> illustrates the DNA sequence of the GalP-ptrc DNA cassette as set forth in SEQ ID NO. 1 cloned into the R6K vector (creating pR6K-galP). Italics and bold nucleotide sequences represent the loxP sequences; bold and underlined nucleotide sequences represent the chloramphenicol acetyltransferase (CAT) gene in reverse orientation to <i>gal</i>P; underlined sequences represent the -35 region (TTGACA) and the -10 region (TATAAT) of the <i>trc</i> promoter; the italicized nucleotides represent the <i>lac</i> operator of the <i>trc</i> promoter; and the bold nucleotides represent the <i>gal</i>P ATG start codon. (Reference is made to example 1B).

0023<figref idref="f0004">Figure 3</figref> illustrates the DNA sequences of the galP-trc DNA cassette after removal of the CAT gene (SEQ ID NO. 2). The bold nucleotides represent the <i>gal</i>P upstream sequence; italicized nucleotides represent a single loxP site, and bold and italics nucleotides represent the <i>trc</i> promoter region, wherein the -35 box and the -10 box are underlined. (Reference is made to example 1 E).

0024<figref idref="f0005">Figure 4</figref> illustrates the DNA sequence of the glk-trc DNA cassette as set forth in SEQ ID NO. 3 and which was used to clone into the R6K vector. Italics and bold nucleotide sequences represent the loxP sequences; bold and underlined nucleotide sequences represent the CAT gene in reverse orientation to <i>glk</i>; underlined sequences represent the - 35 region (CTGACA) and the -10 region (TATAAT) of a <i>trc</i> derivative promoter; the italicized nucleotides represent the <i>lac</i> operator of the <i>trc</i> promoter; and the bold nucleotides represent the <i>glk</i> ATG start codon. (Reference is made to example 1F).

0025<figref idref="f0006">Figure 5</figref> illustrates a plasmid map of pMCGG and reference is made to example1G. The <i>gal</i>P and <i>glk</i> open reading frames (orfs) were cloned into pACYC177, each under the control of the <i>trc</i> promoter. Trc = <i>trc</i> promoter; galP = galactose permease coding sequence; glk = glucokinase coding sequence; KmR' = kanamycin resistance marker of pACYC177 (interrupted by cloned genes); Amp = ampicillin resistance marker of pACYC177 and ori = plasmid origin of replication.

0026<figref idref="f0006">Figure 6</figref> illustrates a plasmid map of pTrcm42 and reference is made to example 1A. LoxP = loxP sites; trc = trc promoter, laclq = gene encoding the Lacl^q repressor protein; CAT = CAT encoding gene; 5S = 5StRNA; rrnBT1 and 2 = ribosomal RNA terminators; Amp = ampicillin resistance gene of pTrc99a; and ori = pMB1origin of replication.

0027<figref idref="f0007">Figures 7A and 7B. Figure 7A</figref> illustrates a diagram of a schematic promoter DNA integration cassette comprising loxP-CAT-loxP-ptrc. DNA homology to a desired site of integration is added by PCR such that it flanks the entire cassette and reference is made to example 1 E and 1F. loxP = loxP sites; CAT = chloramphenicol acetyltransferaces gene; trc = <i>trc</i> promoter; and ATG = start codon of the glucose assimilation gene targeted for integration of the DNA cassette. <figref idref="f0007">Figure 7B</figref> illustrates a plasmid map of pR6K-galP-trc, which was created by amplifying the DNA cassette of <figref idref="f0007">figure 7A</figref> flanked by 40- bp of homology to the regulatory region of <i>gal</i>P from 221 -183 bp upstream of the ATG start codon of <i>gal</i>P (5' flank) and 40 bp upstream of and including the ATG start codon of <i>gal</i>P (3' flank) wherein ploxP = plasmid encoded loxP; loxP = introduced loxP sequences from the DNA cassette; trc= <i>trc</i> promoter; Km = kanamycin resistance gene; CAT is as defined above and ori = R6K plasmid origin of replication.

0028<figref idref="f0008 f0009 f0010 f0011 f0012 f0013 f0014 f0015">Figure 8</figref> illustrates the nucleotide sequence of plasmid pSYCO101 (SEQ ID NO. 4).

0029<figref idref="f0016">Figure 9</figref> depicts a plasmid map of pSYCO101, wherein DAR1 (dihydroxyacetone phosphate reductase) and GPP2 (glycerol-phosphate phosphatase) are glycerol pathway genes; STR(R) is a spectinomycin resistance encoding gene; pSC101 ori is an origin of replication of the plasmid; AspA term is an aspartate ammonia lyase gene terminator; dhaB1-3, dhaX, and orf W, X, Y are 1, 3 propanediol pathway genes; Thratten is an <i>E</i>. <i>coli</i> threonine operon attenuator; TonB term is an <i>E. coli tonB</i> gene terminator; trc is the <i>trc</i> promoter and <i>Eco</i>R1 is the <i>Eco</i>R1 restricion enzyme sites in pSYCO101. (Reference is made to example 1H).

0030<figref idref="f0017">Figures 10A and 10B</figref> illustrate cell growth and the production of glycerol and 1,3-propanediol over fermentation time (h) in a PTS^-/Glu⁺<i>E</i>. <i>coli</i> with a plasmid encoded PEP-independent glucose transport system. The PTS^-/Glu^- strain, KLpts7 (example 1 D) was transformed with pMCGG (example 1 G) and with pSYCO101 and the resultant strain was tested and analyzed for cell growth, glycerol and 1,3-propanediol production. Optical density (OD₆₀₀) is represented by - ◆ -, glycerol concentration is represented by - ▲ -, and 1, 3-propanediol concentration is represented by - ■ -.

0031<figref idref="f0018">Figures 11A and 11B</figref> illustrate cell growth and the production of glycerol and 1, 3-propanediol over fermentation time (h) in a PTS^-/Glu⁺<i>E</i>. <i>coli</i> with the expression of <i>galP</i> controlled by a chromosomally integrated <i>trc</i> promoter and that of <i>glk</i> by natural regulation. The PTS^-/Glu^-, KLpts7 (example 1 D) was made <i>Glu</i>⁺ by integration of the <i>trc</i> promoter at the <i>galP</i> target site to yield strain KlgalP-ptrc (example 1 E). This strain was transformed with pSYCO103 and analyzed by fermentation (example 2). The parameters examined include, for <figref idref="f0018">figure 11A</figref> cell density (OD₆₀₀) ( - ◆ - ) and for <figref idref="f0018">figure 11B</figref> glycerol concentration (-▲-) and 1, 3-propanediol concentration (- ■ -).

0032<figref idref="f0019">Figures 12A and 12B</figref> illustrate cell growth and the production of glycerol and 1, 3-propanediol over fermentation time (h) in a PTS^-/Glu⁺<i>E</i>. <i>coli</i> with the expression of <i>galP</i> and <i>glk</i> controlled by a chromosomally integrated <i>trc</i> promoter. The PTS^-/Glu^-, KLpts7 (example 1D) was made Glu+ by integration of the trc promoter at the <i>galP</i> and <i>glk</i> target sites to yield strain KLGG (example 1F). This strain was transformed with pSYCO101 and analyzed by fermentation (example 3). The parameters examined include, for <figref idref="f0019">figure 12A</figref> cell density (OD₆₀₀) (- ◆ -) and for <figref idref="f0019">figure 12B</figref> glycerol concentration (-▲-) and 1, 3-propanediol concentration (- ■ -).

0033Figure 13 is a map of plasmid pVHGalPglk11 as descirbed in example 1G.

0034Figure 14A - E illustrates the nucleotide sequences (SEQ ID NO. 25) and coding sequences for galP and Glk (SEQ ID NO. 26) of pVHGa1Pglk11.

<u>DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS</u>

0035The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such techniques are explained fully in the literature, such as, <nplcit id="ncit0011" npl-type="b"><text>MOLECULAR CLONING: A LABORATORY MANUAL, second edition (Sambrook et al., 1989) Cold Spring Harbor Laboratory Press</text></nplcit>; <nplcit id="ncit0012" npl-type="b"><text>CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F.M. Ausubel et al., eds., 1987 and annual updates</text></nplcit>); <nplcit id="ncit0013" npl-type="b"><text>GENE EXPRESSION TECHNOLOGY, (Goeddel, D. ed., 1991</text></nplcit>, <nplcit id="ncit0014" npl-type="b"><text>METHODS IN ENZYMOLOGY Vol. 185 Academic Press, San Diego, CA</text></nplcit>); <nplcit id="ncit0015" npl-type="b"><text>GUIDE To PROTEIN PURIFICATION (Deutshcer M. P. ed., 1989</text></nplcit>, <nplcit id="ncit0016" npl-type="b"><text>METHODS IN ENZYMOLOGY, Academic Press, San Diego, CA</text></nplcit>); <nplcit id="ncit0017" npl-type="b"><text>PCR PROTOCOLS:A GUIDE TO METHODS AND APPLICATIONS (Innis et al., 1990, Academic Press, San Diego, CA</text></nplcit>); <nplcit id="ncit0018" npl-type="b"><text>OLIGONUCLEOTIDE SYNTHESIS (M.J. Gait, ed., 1984</text></nplcit>);<nplcit id="ncit0019" npl-type="b"><text> PCR: THE POLYMERASE CHAIN REACTION, (Mullis et al., eds., 1994</text></nplcit>); <nplcit id="ncit0020" npl-type="b"><text>MANUAL OF INDUSTRIAL MICROBIOLOGY AND BIOTECHNOLOGY, Second Edition (A.L. Demain, et al., eds. 1999</text></nplcit>); <nplcit id="ncit0021" npl-type="b"><text>MANUAL OF METHODS FOR GENERAL BACTERIOLOGY (Phillipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips, eds), pp. 210-213 American Society for Microbiology, Washington, DC</text></nplcit>.; and<nplcit id="ncit0022" npl-type="b"><text> BIOTECHNOLOGY: A TEXTBOOK OF INDUSTRIAL MICROBIOLOGY, (Thomas D. Brock) Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass</text></nplcit>.

Definitions.

0036Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. <nplcit id="ncit0023" npl-type="b"><text>Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994</text></nplcit>) and <nplcit id="ncit0024" npl-type="b"><text>Hale and Marham, THE HARPER DICTIONARY OF BIOLOGY, Harper Perennial, New York (1991</text></nplcit>) provide one of skill with general dictionaries of many of the terms used in this invention.

0037Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated nucleic acids are written left to right in the 5' to 3' orientation and amino acid sequences are written left to right in amino to carboxy orientation, respectively.

0038The headings provided herein are not limitations of the various aspects or embodiments of the invention which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

0039The phosphotransferase system (PTS) (E.C. 2.7.1.69) refers to the phosphoenolpyruvate-dependent sugar uptake system. This is a system of transporter proteins that participate in transport and phosphoenolpyruvate dependent phosphorylation of several sugars. The system is comprised of two phosphoproteins, enzyme I and HPr, which are common to all PTS carbohydrates and catalyze the transfer of a phosphoryl group from PEP to the carbohydrate specific membrane bound enzyme II and then to the carbohydrate. In some cases enzyme III is positioned between HPr and enzyme II. To distinguish the various enzymes II and enzymes III, a three letter superscript is used to indicate which carbohydrate is the preferred substrate. For example Enzyme II^glc means glucose is the preferred substrate. However other substrates may be used.

0040The terms "PtsI" and "Enzyme I" refer to the phosphotransferase EC 2.7.3.9 encoded by <i>pts</i>I in <i>E</i>. <i>coli.</i> The terms "HPr" and "PtsH" refer to the phosphocarrier protein encoded by <i>pts</i>H in <i>E. coli.</i> The terms "glucose-specific IIA component", "Enzyme II^glc" and "Crr" refer to EC 2.7.1.69 encoded by <i>crr</i> in <i>E. coli.</i> The PTS comprises PtsI, PtsH and Crr and functionally equivalent proteins.

0041The terms "PTS^- /Glu^- phenotype" and "PTS^-/Glu^-" mean a host cell which has a significantly reduced ability to utilize glucose as a carbon source because the PEP-dependent PTS is inactivated compared to the corresponding wild-type PTS cell. Effectively, less PEP is utilized to transport glucose than in the wild-type PTS cell.

0042"Restoring the glucose ⁺ (Glu⁺) phenotype" means a host cell capable of using glucose as a carbon source despite the inactivation of the PTS. Further a "PTS^-/Glu⁺ phenotype" as used herein means a PTS^-/Glu^- host cell that has a restored Glu⁺ phenotype.

0043"Increased phosphoenolpyruvate (PEP) availability" means increasing the amount of intracellular PEP which enhances carbon committed to a metabolic or productive pathway, said PEP which would otherwise have been metabolized in the PTS for phosphorylation of glucose.

0044The phrase" increasing carbon flow" means increasing the availability of carbon substrates to metabolic or productive pathways, said carbon substrate which would otherwise be diverted by the metabolism of PEP in the PTS. Carbon flow to a particular pathway can be measured by well know methods such as gas chromatography and mass spectroscopy. Carbon flow as measured by produced product may be at least 2%, 5%, 10%, 15%, 20%, 25%, 30%, or greater than the carbon flow in a corresponding PTS cell grown under essentially the same growth conditions.

0045The term " specific growth rate (µ)" refers to the increase of mass or cell number per time. In one embodiment of the invention a cell having a restored Glu⁺ phenotype will have a specific growth rate (µ) of about at least 0.3 hr^-1, at least 0.4 hr^-1, at least 0.5 hr^-1, at least 0.6 hr^-1, at least 0.7 hr^-1 and at least 0.8 hr^-1 when grown on glucose.

0046The terms "regulatory region" and "regulatory sequence" are used interchangeably herein and mean a nucleic acid sequence that is operably linked with a coding region of a gene to effect expression of the coding region. A regulatory sequence can inhibit, repress or promote expression of the operably linked coding sequence or translation of the mRNA. Examples of regulatory sequences include promoters, enhancers, ribosome binding sites, operators and silencers.

0047An "endogenous chromosomal regulatory region" and "homologous chromosomal regulatory region" refer to a chromosomal regulatory region, which naturally occurs in a host cell and which is operably linked to a polynucleotide encoding a glucose assimilation protein in said host cell.

0048The term "promoter" as used herein refers to a regulatory nucleic acid sequence that functions to direct transcription of a downstream gene or genes. A promoter according to the invention comprises two consensus regions. The first consensus region is centered about 10 base pairs (bp) upstream from the start site of transcription initiation and is referred to as the -10 consensus region (also the -10 box or <i>Pribnow</i> box). The second consensus region is centered about 35 bp upstream of the start site and is referred to as the -35 consensus box or sequence. A linker or spacer sequence is positioned between the consensus boxes and generally comprises 14 to 20 bp.

0049An "exogenous promoter" as used herein is a promoter, other than a naturally occurring promoter, which is operably linked to an endogenous coding region of a glucose assimilation protein of interest in a host cell and includes but is not limited to non-native promoters, synthetic promoters, and modified naturally occurring promoters. Modified naturally occurring promoters include native endogenous promoters which are operably linked to a polynucleotide encoding a glucose assimilation protein, wherein the native promoter has been altered and then reintroduced into a host cell chromosome and include native endogenous promoters which are not operably linked to an endogenous coding region of a glucose assimilation protein.

0050The terms "derivative promoter", "modified promoter" and "variant promoter" mean a promoter, wherein at least one nucleotide of the promoter has been altered. In one preferred embodiment, a derivative promoter will comprise a modification, such as a substitution, of at least one nucleotide of the -35 box of the promoter.

0051"Under transcriptional control" or "transcriptionally controlled" are terms well understood in the art that indicate that transcription of a polynucleotide sequence, usually a DNA sequence, depends on its being operably linked to an element which contributes to the initiation of, or promotes, transcription.

0052"Operably linked" refers to a juxtaposition wherein the elements are in an arrangement allowing them to be functionally related. For example, a promoter is operably linked to a coding sequence if it directs transcription of the sequence.

0053"Under translational control" is a term well understood in the art that indicates a regulatory process that occurs after the messenger RNA has been formed.

0054As used herein the term "gene" means a DNA segment that is involved in producing a polypeptide and includes regions preceding and following the coding regions as well as intervening sequences (introns) between individual coding segments (exons).

0055The terms "polynucleotide" and "nucleic acid", used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. These terms include a single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, DNA constructs and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches.

0056A "structural sequence" is a putative polynucleotide sequence of DNA that encodes the formation of a product. A structural sequence can encode the amino acid sequence of a polypeptide chain having messenger RNA is its primary product. A structural sequence can also encode the formation of an RNA with structural or regulatory function.

0057As used herein, the term "vector" refers to a polynucleotide construct designed to introduce nucleic acids into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, cassettes and the like. In the specific case of a DNA cassette, the DNA may be generated <i>in vitro</i> by PCR or any other suitable techniques.

0058The term "over expressed" means an increased number of copies of the same gene product in a host cell.

0059The terms "protein" and "polypeptide" are used interchangeability herein. The 3-letter code for amino acids as defined in conformity with the IUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN) is used throughout this disclosure. It is also understood that a polypeptide may be coded for by more than one nucleotide sequence due to the degeneracy of the genetic code.

0060As used herein when describing proteins, and genes that encode them, the term for the gene is not capitalized and is italics, i.e. <i>glkA.</i> The term for the protein is generally not italicized and the first letter is capitalized, i.e. GlkA.

0061"A glucose assimilation protein" or "an enzyme involved in glucose assimilation" means an enzyme or protein that enables a host cell to utilize glucose as a carbon source. Enzymes and proteins involved in glucose assimilation include those involved in glucose transport across the cell membrane and those involved in phosphorylation of glucose to glucose-6-phosphate.

0062"A phosphorylating enzyme" means an enzyme that catalyzes the reaction of glucose to glucose 6-phospahte. <maths id="math0001" num=""><math display="block"><mi>Glucose</mi><mo>+</mo><mi>ATP</mi><mo>⁢</mo><mover><mo>→</mo><msup><mi>Mg</mi><mrow><mn>2</mn><mo>+</mo></mrow></msup></mover><mo>⁢</mo><mi>glucose</mi><mspace width="1em" /><mn>6</mn><mo>-</mo><mi>phosphate</mi><mo>+</mo><mi>ADP</mi></math><img file="EP1546312B1_D0001.tif" /></maths> Enzymes known to catalyze this reaction include hexokinases (E.C. No.: 2.7.1.1) and glucokinases (E. C. No. 2.7.1.2). Glucokinase is encoded by <i>glk</i> in <i>E</i>. <i>coli.</i>

0063A "transport protein" or "transporter" refers to a protein that catalyzes the movement of a molecule across a cell membrane. In a preferred embodiment, the transporter, also referred to as a permease is a glucose transporter. A glucose transporter catalyzes the active transport of glucose across a cell membrane into the cytoplasm. A glucose transporter may also catalyze the transport of other sugars. One example of a glucose transporter is a galactose-proton symporter (also known as a galactose permease), GalP. GalP is encoded by <i>galP</i> in <i>E</i>. <i>coli</i> (<nplcit id="ncit0025" npl-type="s"><text>Henderson et al., (1990) Phil. Trans. R. Soc., London 326:391-410</text></nplcit>).

0064"Active transport" refers to the transport of a compound into a cell that is coupled to an expenditure of energy. One example emcompassed by the invention is the use of membrane potential by glucose transporters.

0065As used herein a "selectable marker" refers to a gene capable of expression in a host cell which allows for ease of selection of those hosts containing an introduced nucleic acid or vector. Examples of such selectable markers include but are not limited to antimicrobials (e.g. kanamycin, erythromycin, actinomycin, chloramphenicol, spectinomycin, and tetracycline). The designation "Cm^R" and "CAT" for example both refer to the same gene, a chloramphenicol resistance gene and also known as the chloroamphenicol acetyltransferase gene.

0066A "flanking sequence" refers to any sequence that is either upstream or downstream of the sequence being discussed (e.g. for genes A, B, and C; gene B is flanked by the A and the C gene sequences). In some embodiments, a flanking sequence is present on only a single side (either 3' or 5') of a DNA fragment, but in preferred embodiments, each side of the sequence being discussed is flanked.

0067The term wild-type refers to a native or naturally occurring host cell or host cell sequence.

0068As used herein, the term "endogenous" refers to a nucleic acid or protein encoded by a nucleic acid naturally occurring in the host. The term "exogenous" refers to a nucleic acid or protein from a different host cell strain. An exogenous sequence can be a non-host sequence and a synthetically modified native sequence.

0069The term "homologous" means of the same organism, strain or species. A "homologous sequence" is a sequence that is found in the same genetic source or species. For example if a host strain lacks a specific gene, but the same gene is found in other strains of the same species the gene would be considered a homologous sequence. The term "heterologous" means of a different organism, strain or species and more specifically refers to nucleic acid or amino acid sequences not naturally occurring in the host cell.

0070The terms "transformation", "transduction" and "transfection" refer to the incorporation or introduction of new polynucleotides into a cell. The introduced polynucleotides may be integrated into the chromosomal DNA or introduced as extra chromosomal replicating sequences.

0071The terms "isolated" or "purified" as used herein refer to an enzyme, nucleic acid, protein, peptide or co-factor that is removed from at least one component with which it is naturally associated.

0072"Desired product" as used herein refers to the desired compound into which a carbon substrate is bioconverted. Exemplary desired products are succinate, lysine, glycerol, methionine, threonine, isoleucine, pyruvate, ethanol, formate, acetate, DAHP, DHQ, DHS, SHK, S3P, EPSP, chorismate, phenylalanine, tyrosine, tryptophan, and ascorbic acid intermediates.

0073As used herein, the term "carbon source" encompasses suitable carbon substrates ordinarily used by microorganisms, such as 6 carbon sugars, including but not limited to glucose (G), gulose, lactose, sorbose, fructose, idose, galactose and mannose all in either D or L form, or a combination of 6 carbon sugars, such as glucose and fructose, and/or 6 carbon sugar acids. Preferred carbon substrates include glucose and fructose.

0074The terms "non-functional", "inactivated" and "inactivation" when referring to a gene or a protein means that the known normal function or activity of the gene or protein has been eliminated or highly diminished. Inactivation which renders the gene or protein non-functional includes such methods as deletions, mutations, substitutions, interruptions or insertions in the nucleic acid sequence.

0075A "host cell" is a cell capable of receiving introduced, heterologous polynucleotides. In one embodiment the host cell is a gram-negative or gram-positive bacteria.

0076As used herein, the term "bacteria" refers to any group of microscopic organisms that are prokaryotic, i.e., that lack a membrane-bound nucleus and organelles. All bacteria are surrounded by a lipid membrane that regulates the flow of materials in and out of the cell. A rigid cell wall completely surrounds the bacterium and lies outside the membrane. There are many different types of bacteria, some of which include, but are not limited to <i>Bacillus, Streptomyces, Pseudomonas,</i> and strains within the families of Enterobacteriaceae.

0077As used herein, the family "Enterobacteriaceae " refers to bacterial strains having the general characteristics of being gram negative and being facultatively anaerobic. Included in the family of <i>Enterobacteriaceae</i> are <i>Erwinia</i>, <i>Enterobacter</i>, <i>Gluconobacter</i>, <i>Klebsiella</i>, <i>Escherichia, Acetobacter, Coymebacteria</i> and <i>Pantoea.</i>

0078An "altered bacterial host" or "modified bacterial host" according to the invention is a genetically engineered bacterial cell having a PTS^-/Glu⁺ phenotype.

0079An "unaltered bacterial host cell" refers to a bacterial host cell which uses PTS to transport and phosphorylate glucose or a PTS^-/Glu^- cell.

0080As used herein "chromosomal integration" is a process whereby an introduced polynucleotide is incorporated into a host cell chromosome. The process preferably takes place by homologous recombination. Homologous recombination is the exchange of DNA fragments between two DNA molecules wherein the homologous sequences of the introduced polynucleotide align with homologous regions of the host cell chromosome and the sequence between the homologous regions of the chromosome is replaced by the sequences of the introduced polynucleotide in a double crossover.

0081A "target site" is intended to mean a predetermined genomic location within a host cell chromosome where integration of a DNA construct is to occur.

0082As used herein, "modifying" the level of protein or enzyme activity produced by a host cell refers to controlling the levels of protein or enzymatic activity produced during culturing, such that the levels are increased or decreased as desired.

0083As used herein, the term "modified" when referring to nucleic acid or a polynucleotide means that the nucleic acid has been altered in some way as compared to a wild type nucleic acid, such as by mutation in; substitution of; insertion of; deletion of part or all of the nucleic acid; or by being operably linked to a transcriptional control region. As used herein the term "mutation" when referring to a nucleic acid refers to any alteration in a nucleic acid such that the product of that nucleic acid is partially or totally inactivated. Examples of mutations include but are not limited to point mutations, frame shift mutations and deletions of part or all of a gene.

0084A polynucleotide or polypeptide having a certain percentage (for example, 80%, 85%, 90%, 95%, 96%, 97% or 99%) of "sequence identity" to another sequence means that, when aligned, that percentage of bases or amino acids are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in <nplcit id="ncit0026" npl-type="b"><text>CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F.M. Ausubel et al., eds., 1987) Supplement 30</text></nplcit>, section 7.7.18. Preferred programs include the GCG Pileup program, FASTA (<nplcit id="ncit0027" npl-type="s"><text>Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444-2448</text></nplcit>) and BLAST (<nplcit id="ncit0028" npl-type="b"><text>BLAST Manual, Altschul et al., Natl. Cent. Biotechnol. Inf., Natl Library Med. (NCBI NLM), NIH, Bethesda MD</text></nplcit> and <nplcit id="ncit0029" npl-type="s"><text>Altschul et al., (1997) NAR 25:3389-3402</text></nplcit>). Another preferred alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania), preferably using default parameters, which are as follows: mismatch = 2; open gap = 0; extend gap = 2. Another sequence software program that could be used is the TFastA Data Searching Program available in the Sequence Analysis Software Package Version 6.0 (Genetic Computer Group, University of Wisconsin, Madison, WI). One skilled in the art will recognize that sequences encompassed by the invention are also defined by the ability to hybridize under stringent conditions with the sequences exemplified.

0085A nucleic acid is "hybridizable" to another nucleic acid when a single stranded form of the nucleic acid can anneal to the other nucleic acid under appropriate conditions of temperature and solution ionic strength. Hybridization and washing conditions are well known and exemplified in Sambrook 1989, <i>supra</i> (see in particular chapters 9 and 11). Low stringency hybridization conditions correspond to a Tm of 55°C (for example, 5X SSC, 0.1% SDS, 0.25 milk and no formamide or 5X SSC, 0.5% SDS and 30% formamide). Moderate stringency conditions correspond to a 6X SSC, 0.1% SDS, 0.05% milk with or without formamide, and stringent conditions correspond to for example, a Tm of 65°C and 0.1X SSC, 0.1 % SDS.

0086It is well understood in the art that the acidic derivatives of saccharides and other compounds such as organic acids, may exist in a variety of ionization states depending upon their surrounding media, if in solution, or out of solution from which they are prepared if in solid form. The use of a term, such as, for example, gluconic acid or acetic acid to designate such molecules is intended to include all ionization states of the organic molecule referred to. Thus, for example, "gluconic acid" and "gluconate" refer to the same organic moiety, and are not intended to specify particular ionization states or chemical forms.

0087The term "culturing" as used herein refers to fermentative bioconversion of a carbon substrate to a desired product within a reactor vessel. Bioconversion means contacting a microorganism with a carbon substrate to convert the carbon substrate to the desired product.

0088As used herein, the term "comprising" and its cognates are used in their inclusive sense; that is, equivalent to the term "including" and its corresponding cognates.

0089"A," "an" and "the" include plural references unless the context clearly dictates otherwise.

0090"Allowing the production of a desired product from a carbon source, wherein the production of the desired product is enhanced compared to the production of the desired product in a corresponding unaltered bacterial host cell" means contacting the substrate, e.g. carbon source, with the PTS^-/Glu⁺ bacterial cell to produce the desired product.

Preferred Embodiments.

0091The present invention is directed to a method for increasing carbon flow into a desired metabolic pathway of a host cell originally capable of utilizing a PTS for carbohydrate transport, said method including the steps of selecting a host cell which is effectively phenotypically PTS^- and modifying at least one homologous chromosomal regulatory region, which is operably linked to a chromosomal nucleic acid which encodes a polypeptide involved in glucose assimilation, resulting in the restoration of a glucose⁺ phenotype and thereby increasing the carbon flow into and through a desired metabolic pathway.

A. PTS host cells.

0092A general review of the PTS can be found in (<nplcit id="ncit0030" npl-type="s"><text>Postma et al., 1993, Microbiol. Rev. 57:543-594</text></nplcit>; <nplcit id="ncit0031" npl-type="s"><text>Romano et al., 1979, J. Bacteriol. 139:93-97</text></nplcit> and <nplcit id="ncit0032" npl-type="b"><text>Saier et al. 1990, In: BACTERIAL ENERGETICS pp. 273-299, T.A. Krulwich, Ed. Academic Press, NY</text></nplcit>). Host cells or strains useful in the present invention include any organism capable of utilizing a PTS system for carbohydrate transport. This includes prokaryotes belonging to the genus <i>Escherichia, Corynebacterium, Brevibacterium, Bacillus, Pseudomonas, Streptomyces, Pantoea</i> or <i>Staphylococcus.</i> A list of suitable organisms is provided in Table 1. The inactivation of the PTS in any of these organisms should potentially increase carbon flux and PEP (and PEP precursor) availability in the cell for alternative metabolic routes and consequently could increase production of desired compounds (e.g., aromatics) from such cells. <tables id="tabl0001" num="0001"><table frame="none"><title><u>Table 1</u></title><tgroup cols="2" colsep="0"><colspec colnum="1" colname="col1" colwidth="58mm" /><colspec colnum="2" colname="col2" colwidth="93mm" /><thead><row><entry valign="top">Host cell</entry><entry valign="top">Reference</entry></row></thead><tbody><row rowsep="0"><entry><i>Escherichia coli</i></entry><entry><nplcit id="ncit0033" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Salmonella typhimurium</i></entry><entry><nplcit id="ncit0034" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Klebsiella pneumoniae</i></entry><entry><nplcit id="ncit0035" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Bacillus subtilis</i></entry><entry><nplcit id="ncit0036" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Mycoplasma capricolum</i></entry><entry><nplcit id="ncit0037" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Acholeplasma florum</i></entry><entry><nplcit id="ncit0038" npl-type="s"><text>Navas-Castillo et al. (1993) Biochimie 75:675-679</text></nplcit></entry></row><row rowsep="0"><entry><i>Staphylococcus aureus</i></entry><entry><nplcit id="ncit0039" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Staphylococcus carnosus</i></entry><entry><nplcit id="ncit0040" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Staphylococcus xylosus</i></entry><entry><nplcit id="ncit0041" npl-type="s"><text>Wagner et al. (1993) Mol. Gen. Genet. 24:33-41</text></nplcit></entry></row><row rowsep="0"><entry><i>Rhodobacter capsulatus</i></entry><entry><nplcit id="ncit0042" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Rhodopseudomonas sphaeroides</i></entry><entry><nplcit id="ncit0043" npl-type="s"><text>Meadow et al. (1990) Annu. Rev. Biochem. 59:497-542</text></nplcit></entry></row><row rowsep="0"><entry><i>Streptococcus (Enterococcus) faecalis</i></entry><entry><nplcit id="ncit0044" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Streptococcus mutans</i></entry><entry><nplcit id="ncit0045" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Streptococcus salivarius</i></entry><entry><nplcit id="ncit0046" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Streptococcus sanguis</i></entry><entry><nplcit id="ncit0047" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Streptococcus sobrinus</i></entry><entry><nplcit id="ncit0048" npl-type="s"><text>Chen et al. (1993) Infect. Immun. 61:2602-2610</text></nplcit></entry></row><row rowsep="0"><entry><i>Erwinia chrysanthemi</i></entry><entry><nplcit id="ncit0049" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Xanthmonas campestris</i></entry><entry><nplcit id="ncit0050" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Corynebacterium glutamicum</i></entry><entry><nplcit id="ncit0051" npl-type="s"><text>Cocaign et al. (1993) Appl. Microbiol. and Biotechnol. 40:526-530</text></nplcit></entry></row><row rowsep="0"><entry><i>Brevibacterium lactofermentum</i></entry><entry><nplcit id="ncit0052" npl-type="s"><text>K-H Yoon (1993) Abstr. Ann. Meet. Am. Soc. Microbiol. 0 - 25</text></nplcit></entry></row><row rowsep="0"><entry><i>Bifidiobacterium breve</i></entry><entry><nplcit id="ncit0053" npl-type="s"><text>Degnan et al. (1993) Arch. Microbiol. 160:144-151</text></nplcit></entry></row><row rowsep="0"><entry><i>Azospirillum brasiliense</i></entry><entry><nplcit id="ncit0054" npl-type="s"><text>Chattopadhyay et al. (1993) J. Bacteriol. 175:3240-3243</text></nplcit></entry></row><row rowsep="0"><entry><i>Listeria monocytogenes</i></entry><entry><nplcit id="ncit0055" npl-type="s"><text>Mitchell et al., (1993) J. Bacteriol. 175:2758-2761</text></nplcit>.</entry></row><row rowsep="0"><entry><i>Spirocheta aurantia</i></entry><entry><nplcit id="ncit0056" npl-type="s"><text>Meadow et al. (1990) Annu. Rev. Biochem. 59:497-542</text></nplcit></entry></row><row rowsep="0"><entry><i>Lactobacillus brevis</i></entry><entry><nplcit id="ncit0057" npl-type="s"><text>Meadow et al. (1990) Annu. Rev. Biochem. 59:497-542</text></nplcit></entry></row><row rowsep="0"><entry><i>Lactobacillus buchneri</i></entry><entry><nplcit id="ncit0058" npl-type="s"><text>Meadow et al. (1990) Annu. Rev. Biochem. 59:497-542</text></nplcit></entry></row><row rowsep="0"><entry><i>Lactobacillus casei</i></entry><entry><nplcit id="ncit0059" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Lactococcus cremoris</i></entry><entry><nplcit id="ncit0060" npl-type="s"><text>Benthin et al. (1993) Biotechnol. Bioeng. 42:440-448</text></nplcit></entry></row><row rowsep="0"><entry><i>Lactococcus lactis</i></entry><entry><nplcit id="ncit0061" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Pseudomonas aeruginosa</i></entry><entry><nplcit id="ncit0062" npl-type="s"><text>Meadow et al. (1990) Annu. Rev. Biochem. 59:497-542</text></nplcit></entry></row><row rowsep="0"><entry><i>Vibrio alginolyticus</i></entry><entry><nplcit id="ncit0063" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit></entry></row><row rowsep="0"><entry><i>Vibrio furnissii</i></entry><entry><nplcit id="ncit0064" npl-type="s"><text>Yu et al. (1993), J. Biol. Chem. 268:9405-9409</text></nplcit></entry></row><row rowsep="0"><entry><i>Vibrio parahaemolytica</i></entry><entry><nplcit id="ncit0065" npl-type="s"><text>Meadow et al. (1990) Annu. Rev. Biochem. 59:497-542</text></nplcit></entry></row></tbody></tgroup></table></tables>

0093Preferred host strains are those known to be useful in producing aromatic compounds, including strains selected from the genera <i>Escherichia, Corynebacterium, Brevibacterium, Pantoea</i> and <i>Bacillus.</i> The genus <i>Pantoea</i> includes all members known to those of skill in the art, including but not limited to <i>P</i>. <i>citrea, P. ananatis, P. stewartii, P. agglomerans, P. punctata</i> and <i>P. terrea.</i> Useful <i>Bacillus</i> strains include cells of <i>B</i>. <i>subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. coaglulans, B. ciculans, B. lautus</i> and <i>B. thuringiensis.</i>

B. Selection of PTS

<u>-</u>

/Glu

<u>-</u>

host cells.

0094Selection of PTS^- cells can be achieved using techniques available to those skilled in the art. Inactivation will effectively reduce PEP phosphorylation to undetectable levels as measured by PEP-dependent phosphorylation of 2-deoxy-D-glucose using the protocols described by<nplcit id="ncit0066" npl-type="s"><text> Gachelin, G. (1969). Biochem. Biophys. Acta. 34:382-387</text></nplcit>;<nplcit id="ncit0067" npl-type="s"><text> Romero, et al., (1979) J. Bact. 139:93-97</text></nplcit>; or <nplcit id="ncit0068" npl-type="s"><text>Bouvet and Grimont., (1987) Ann. Inst. Pasteur/Microbiol. 138:3-13</text></nplcit>. Also PEP phosphorylation assays are useful in determining the level of PTS^-expression.

0095PST^-/GlU^- host cells may be selected from PTS wild-type host cells by inactivation of at least one gene encoding part or all of the enzymes comprising the PTS. By way of example, in one embodiment, the PTS is inactivated by the deletion of at least one gene selected from the group consisting of <i>pts</i>I, <i>pts</i>H and <i>crr</i> encoding the El, HPr and IIA^Glc proteins of the PTS respectively (<nplcit id="ncit0069" npl-type="s"><text>Postma, et al (1993) Microbiol. Rev. 57:543-594</text></nplcit>). In other embodiments, at least two of the genes are inactivated. The nucleotide sequences of <i>pts</i>I, <i>pus</i>H and <i>crr</i> have been determined (<nplcit id="ncit0070" npl-type="s"><text>Saffen et al., (1987) J. Biol. Chem. 262:16241-16253</text></nplcit>; <nplcit id="ncit0071" npl-type="s"><text>Fox et al., (1984) Biochem. Soc. Trans. 12:155-157</text></nplcit>; <nplcit id="ncit0072" npl-type="s"><text>Weigel et al., (1982) J. Biol. Chem. 257:14461-14469</text></nplcit> and <nplcit id="ncit0073" npl-type="s"><text>DeReuse et al., (1988) J. Bacteriol. 176:3827-3837</text></nplcit>). In other embodiments, the inactivation of all three genes <i>pts</i>I, <i>pts</i>H and <i>crr</i> by deletion will effectively reduced PEP phosphorylation to undetectable levels.

0096Generally, methodology employed in the present invention to inactivate the PTS is as follows. It is known that in <i>E</i>. <i>coli</i> the <i>pts</i>I, <i>pts</i>H and <i>crr</i> are linked together in an operon. The <i>ptsHIcrr</i> operon in <i>E</i>. <i>coli</i> strains JM101 (<nplcit id="ncit0074" npl-type="s"><text>Yanisch-Perron et al. (1985) Gene 33:103 - 119</text></nplcit>) and strain PB103 (<patcit id="pcit0007" dnum="WO8701130A"><text>Mascarenhas (1987) PCT WO/87/01130</text></patcit>) was inactivated by deletion using a generalized transduction method as described by <nplcit id="ncit0075" npl-type="b"><text>Silhavy, et al. (1984) In: EXPERIMENTS WITH GENE FUSIONS, pp 110-112, Cold Spring Harbor Laboratory Press, NY</text></nplcit>. P1vir phage was used to perform the transduction and strain TP2811 (<nplcit id="ncit0076" npl-type="s"><text>Levy et al., (1990) Gene 86:27 - 33</text></nplcit>) was used as the donor of the <i>ptsHIcrr</i> deletion. The process was carried out in two stages. First, a cell-free suspension of phage was prepared by growing bacteriophage P1vir on strain TP2811. In the TP2811 strain most of the <i>ptsHIcrr</i> operon has been deleted and a kanamycin-resistant marker was inserted in the same DNA region (<nplcit id="ncit0077" npl-type="s"><text>Levy et al., (1990) Gene 86:27-33</text></nplcit>). The obtained P1vir lysate was able to transduce the <i>ptsHIcrr</i> deletion and kanamycin resistance marker simultaneously. Secondly, these phage were used to infect the recipient strains, JM101 or PB103 and transductants were selected by plating the infected cells on MacConkey-glucose plates containing kanamycin. After incubating the plates for 16 hours at 37°C, several white colonies appeared.

0097The recipient strains (JM101 and PB103) are kanamycin sensitive and form red colonies on MacConkey-glucose plates. The MacConkey-glucose plates contain an indicator dye that, depending on the pH, can vary from white to deep red. If the cells can transport glucose at a fast rate, normally they will secrete organic acids and produce red colonies. If glucose transport is diminished or absent, the cells will not produce organic acids and the colonies will be white. This enables one to ascertain whether the host cell exhibits a glucose⁺ or glucose^- phenotype.

0098Transduction of the resulting kanamycin resistant colonies were white, which indicates that the ability of the cells to assimilate glucose was affected, and it is believed this is due to the transfer of the <i>ptsHIcrr</i> operon deletion. To corroborate this assumption transductants can be selected and inoculated in minimal medium containing glucose as the only carbon source. One would expect after incubation (for 12 hours at 37°C) the transductants would have no detectable cell growth and the PTS parent strains JM101 and PB103 would grow very well and reference is made to <patcit id="pcit0008" dnum="WO9634961A"><text>WO 96/34961</text></patcit>. This result was observed and based on these results, the PTS^- derivative of JM101 was designated PB11 and the PTS^- derivative of PB103 was designated NF6.

0099Another test for the absence of the PTS system is based on the fact that PTS^-strains become resistant to the antibiotic fosfomycin <nplcit id="ncit0078" npl-type="s"><text>Cordaro et al., (1976) J. Bacteriol 128:785-793</text></nplcit>.

0100While the above methodology is a preferred means of providing an inactivated PTS (PTS^-/Glu^-) other methods can also be used. One further nonlimiting method includes inserting or modifying a repressor binding region operably linked with a gene encoding an expressed protein such that the expression of the gene occurs in the presence of a specific molecule. For example, the lac operator is a DNA sequence recognized by the Lac repressor. If this operator is located in the proper position, relative to the promoter, then if the repressor is bound to the operator, it will interfere with the binding of the RNA polymerase and block gene transcription. This blockage can be removed by the addition of the inducer IPTG (isopropyl-β-D-thiogalactoside). The level of repression and/or induction will depend on the strength of the promoter, the location and sequence of the operator, as well as the amount of the repressor and the inducer (<nplcit id="ncit0079" npl-type="s"><text>Muller J. et al., (1996) J. Mol. Biol. 257:21-29</text></nplcit>). The lac operator is used to regulate a number of promoters, among them several variants of the lac promoter and the hybrid <i>trc</i> promoter.

0101Another nonlimiting method to affect a PTS^-/Glu^- phenotype includes the incorporation of a promoter which affects the expression of the structural gene sequence when certain conditions are present. For example, the Pm promoter from the TOL plasmid can be used to control gene expression. In this system, gene expression is achieved when benzoate or toluate is added to the media. (<nplcit id="ncit0080" npl-type="s"><text>Mermod et al., (1986) J. Bact. 167:447-454</text></nplcit>). Still a further nonlimiting method to affect a PTS^- phenotype is to after the mRNA stability as described by <nplcit id="ncit0081" npl-type="s"><text>Carrier and Keasling (1997) Biotechnol. Prog. 13:699-708</text></nplcit>.

0102However, to increase or redirect carbon flow to desired metabolic pathways in inactivated PTS host cells, glucose transport and phosphorylation must be deregulated or amplified.

C. Restoring the glucose

<u>+</u>

phenotype

.

0103While not wanting to be limited by theory, it is thought that the modification of alternative glucose assimilation pathways compensates for the inability to actively transport glucose by the PTS, thereby allowing the host cell to utilize PEP otherwise metabolized in the transport of glucose for other purposes.

0104Once a PTS^-/Glu^- host cell is obtained, a homologous chromosomal regulatory region, operably linked to a chromosomal nucleic acid encoding a polypeptide involved in glucose assimilation is modified to restore a glucose⁺ phenotype, thereby obtaining a PTS^-/Glu⁺ phenotype. The regulatory region that is operably linked to the expression of the polypeptide involved in glucose assimilation can be an operator, a promoter, an inhibitor or a repressor.

0105In one preferred embodiment, a DNA cassette comprising a regulatory region including a promoter is introduced into a PTS^-/Glu^- host cell and a homologous chromosomal regulatory region operably linked to a chromosomal nucleic acid encoding a polypeptide involved in glucose assimilation is modified to restore a glucose⁺ phenotype.

D. Construction of DNA integration cassettes comprising regulatory regions.

0106Typically a DNA cassette or construct according to the invention which is useful for modifying endogenous chromosomal regulatory regions in a PTS^-/Glu^- host includes regulatory sequences, such as promoters. In another embodiment, the DNA cassette further includes a selectable marker and sequences allowing autonomous replication or chromosomal integration, such as recombinase recognition sites. In another embodiment the DNA cassette further includes flanking sequences, which are located upstream (5') and downstream (3') of the recombinase recognition sites.

Promoters -

0107In one embodiment, the regulatory region comprising the DNA cassette includes a promoter. In further embodiments, the promoter is an exogenous promoter. In other embodiments the exogenous promoter is a non-native promoter and derivatives thereof. In further embodiments, the promoter is a native promoter which in its native endogenous form is not operably linked to a polynucleotide encoding a glucose assimilation protein. In some embodiments the exogenous promoter is a modified naturally occurring promoter, which in its native endogenous form is linked to a polynucleotide encoding a glucose assimilation protein, wherein the native promoter has been altered and then reintroduced into a host cell chromosome. For example the native promoter could be modified at the -35 region, the -10 region or the linker region or the native promoter could include a modification of a repressor binding site. In other embodiments, the native promoter, is one that is not linked to a polynucleotide encoding a glucose transporter such as a galactose-proton symporter, and more specifically to <i>gal</i>P. Further in other embodiments, the native promoter, is one that is not linked to a polynucleotide encoding a phosphorylating protein such as glucokinase, and more specifically is not linked to <i>glk.</i> A regulatory region and specifically including a promoter useful in a DNA cassette according to the invention includes sequences of between about 20 to 200 bp, of between about 20 to 150 bp and of between about 20 to 100 bp.

0108Preferably the promoter will be stronger that the naturally occurring endogenous wild-type promoter and will result in increased expression of the glucose assimilation protein. Those skilled in the art will recognize that various methodologies are known to determine the relative strength of the promoters. Promoter strength can be quantified using <i>in vitro</i> methods that measure the kinetics of binding of the RNA polymerase to a particular piece of DNA, and also allows the measurement of transcription initiation (<nplcit id="ncit0082" npl-type="b"><text>Hawley D.K et al., Chapter 3: in: PROMOTERS: STRUCTURE AND FUNCTION. R.L/ Rodriguez and M.J. Chamberlin eds. Praeger Scientific. New York</text></nplcit>). Also <i>in vivo</i> methods may be used also to quantify promoter strength. For example a promoter can be fused to a reporter gene and the efficiency of RNA synthesis measured. <nplcit id="ncit0083" npl-type="s"><text>Deuschle et al., (1986) (EMBO J. 5: 2987-2994</text></nplcit>.) determined the strength of 14 <i>E. coli</i> promoters using 3 different reporter genes. These promoters include the following trc, tacl, D/E20, H207, N25, G25, J5, A1, A2, A3, L, Lac, LacUV5, Con, ß-lactamase (bla), T5"early" P_L, and H/McC. Each of these promoters or derivatives thereof may be used as exogenous promoters in accordance with the present invention.

0109Additionally, a modified naturally occurring promoter and a native promoter, which in its native endogenous form is not linked to a polynucleotide encoding a glucose assimilation protein may be used according to the invention. Native promoters may be determined by various exemplary methods. While not wanting to be limited, in one embodiment, sequencing of the particular genome may be performed and putative promoter sequences identified using computerized searching algorithms, For example a region of a genome may be sequences and analyzed for the presence of putative promoters using Neural Network for Promoter Prediction software (NNPP). NNPP is a time delayed neural network consisting mostly of two feature layers, one for recognizing TATA-boxes and one for recognizing so called, "initiators" which are regions spanning the transcription start site. Both feature layers are combined into one output unit. The putative sequences may then be cloned into a cassette suitable for preliminary characterization in <i>E. coli</i> and/or direct characterization in <i>E</i>. <i>coli.</i> In another embodiment, identification of consensus promoter sequences can be identified by homology analysis, for example by using BLAST. The putative promoter sequence may then be cloned into a cassette suitable for preliminary characterization in <i>E</i>. <i>coli.</i>

0110While numerous promoters and their derivatives may be used, preferred promoters include, the <i>trc</i> promoter and derivatives thereof (<nplcit id="ncit0084" npl-type="s"><text>Amann et al., (1983) Gene 25:167-178</text></nplcit>). The <i>trc</i> promoter is illustrated in <figref idref="f0003">figure 2</figref> wherein the -35 box is TTGACA and the -10 box is TATAAT. Another preferred promoter is the <i>tac</i> promoter. The nucleic acid sequence of the <i>tac</i> promoter and the <i>trc</i> promoter is the same with the exception of the linker region. The linker region of <i>tac</i> promoter differs by 1 bp. (<nplcit id="ncit0085" npl-type="s"><text>Russell and Bennett (1982) Gene 20:231-243</text></nplcit>).

0111Another preferred promoter is a glucose isomerase (GI) promoter (also known as a xylose isomerase promoter). Reference is made to <nplcit id="ncit0086" npl-type="s"><text>Amore et al. (1989) Appl. Microbiol. Biotechnol. 30:351-357</text></nplcit>. The sequence of a short segment of the GI promoter (+50 to -7 of the -10 box) is set forth in SEQ ID NO. 5 5' CGAGCCGTCACGCCC<u>TTGACA</u>ATGCCACATCCTGAGCA<u>AATAAT</u> 3' wherein the -35 box is represented by TTGACA and the -10 box is represented by AATAAT.

0112A derivative promoter may include a modification to at least one nucleotide in a position corresponding to a nucleotide in the -35 box, linker region or -10 box. In a preferred embodiment these derivative promoters are altered in a position corresponding to a position in the -35 box. Particularly preferred derivative promoters include a modification to a -35 box corresponding to TTGACA and TTTACA. Some TTGACA modifications include TTGAAA, TTCAC and CTGACA. One particular modification is to the position corresponding to position -35. Particularly preferred derivative promoters also include a modification to a -10 box corresponding to TATAAT, TAAGAT and TATGTT. Linker regions may also be modified (<nplcit id="ncit0087" npl-type="s"><text>Burr et al., (2000) NAR 28:1864-1870</text></nplcit>). Preferably linker regions whether modified or unmodified are between 14 to 20 bp in length, preferably 16 bp, 17 bp, 18 bp and 19 bp. Those skilled in the art are well aware of methods used to make modifications in promoters and the present invention is not limited by these methods. One exemplary method includes use of the Quikchange Kit (Stratagene); Reference is also made to <patcit id="pcit0009" dnum="WO9807846A"><text>WO 98/07846</text></patcit>; <nplcit id="ncit0088" npl-type="s"><text>Russell and Bennett (1982) Gene 231-243</text></nplcit> and <nplcit id="ncit0089" npl-type="s"><text>Sommer et al. (2000) Microbiol.146:2643-2653</text></nplcit>.

0113Further preferred derivatives promoters include <i>trc</i> derivative promoters. The <i>trc</i> derivative promoter may include at least one modification in the -35 consensus box, the -10 consensus box or the linker region. The modification may be an insertion, substitution, or deletion. In a preferred embodiment the <i>trc</i> derivative promoter includes at least one modification to the -35 box. For example in <i>E</i>. <i>coli</i> since the codon at position -30 is adenine (A), it may be substituted with thymine (T), guanine (G) and cytosine (C); since the codon at position -31 is C it may be substituted with A, T and G; since the codon at position -32 is A, it may be substituted with T, G and C; since the codon at position -33 is G it may be substituted with C, T and A; since the codon at position -34 is T it may be substituted with A, C and G; and since the codon at position -35 is T, it may be substituted with A, G and C. One particularly preferred trc derivative promoter includes a modification to the codon at position -35 and most preferably a modification wherein T is substituted with C.

0114Other preferred <i>trc</i> derivative promoters include a modification in the -10 box. For example, since the nucleotide at -7 is T, it may be substituted with a nucleotide selected from the group consisting of C, G, and A.; since the nucleotide at -8 is A, it may be substituted with a nucleotide selected from the group consisting of C, G, and T; since the nucleotide at -9 is G, it may be substituted with a nucleotide selected from the group consisting of C, T, and A; since the nucleotide at -10 is A, it may be substituted with a nucleotide selected from the group consisting of C, G, and T; since -11 is A, it may be substituted with a nucleotide selected from the group consisting of T, G, and C; and since - 12 is T, it may be substituted with a nucleotide selected from the group consisting of A, C, and G.

Selective markers and recombinase recognition sites -

0115A DNA cassette encompassed by the invention will include a selectable marker and a number of genes can be used to detect insertion of the gene in <i>E. coli.</i> Some of these genes confer selectable phenotypes. In this case, media conditions can be established so that only colonies which have expression of these genes activated will grow. Other genes confer phenotypes which can be screened. A screenable phenotype can often yield information about levels of gene expression. While any desired marker can be used, based on these properties, useful antibiotic resistance (Anb^R) markers include but are not limited to, Cm^R, Km^R and Gm^R. A preferred non-limiting example of a selectable marker is a chloramphenicol acetyltransferase (CAT) gene.

0116In a preferred embodiment, a DNA cassette comprising the promoter to be integrated into a host cell chromosome at a target site will include a selectable marker flanked on both sides by a recombinase recognition site. Recombinase sites are well known in the art and generally fall into two distinct families based on their mechanism of catalysis and reference is made to <nplcit id="ncit0090" npl-type="s"><text>Huang et al., (1991) NAR. 19:443</text></nplcit>; <nplcit id="ncit0091" npl-type="s"><text>Datsenko and Warner (2000) Proc. Natl. Acad. Sci 97:6640-6645</text></nplcit> and <nplcit id="ncit0092" npl-type="s"><text>Nunes-Duby, D, et al, (1998) NAR 26:391-406</text></nplcit>. Preferably the recognition sites are the same.

0117One well known recombination system is the <i>Saccharomyces</i> Flp/FRT recombination system, which comprises a Flp enzyme and two asymmetric 34 bp FRT minimum recombination sites (<nplcit id="ncit0093" npl-type="s"><text>Zhu et al., (1995) J. Biol. Chem 270:11646-11653</text></nplcit>). A FRT site comprises two 13 bp sequence inverted and imperfectly repeated, which surround an 8 bp core asymmetric sequence where crossing-over occurs. (<nplcit id="ncit0094" npl-type="s"><text>Huffman et al., (1999) J. Mol. Biol. 286:1-13</text></nplcit>)

0118One preferred recombinase system is the Cre/loxP site-specific recombination system of bacteriophage P1, which comprises a Cre enzyme and two asymmetric 34 bp <i>lox</i>P recombination sites (<nplcit id="ncit0095" npl-type="s"><text>Sternberg and Hamilton (1981) J. Mol. Biol. 150:467-486</text></nplcit>); <nplcit id="ncit0096" npl-type="s"><text>Palmeros, B, et al (2000) Gene 247:255-264</text></nplcit>; <nplcit id="ncit0097" npl-type="s"><text>Hoess et al. (1986) NAR 14:2287-2300</text></nplcit>; <nplcit id="ncit0098" npl-type="s"><text>Sauer B. (1994) Curr. Opinions in Biotechnol. 5:521-527</text></nplcit>). A l<i>oxP</i> site comprises two 13 bp sequences, inverted and imperfectly repeated, which surround an 8 bp core asymmetric sequence, where crossing-over occurs. The Cre-dependent intramolecular recombination between two parallel <i>loxP</i> sites results is excision of any intervening DNA sequence as a circular molecule, producing two recombination products, each containing one <i>loxP</i> site (<nplcit id="ncit0099" npl-type="s"><text>Kilby et al., (1993) Trends Genet. 9:414-421</text></nplcit>).

Homologous flanking regions -

0119An integration DNA cassette according to the invention may also include nucleic acid sequences homologous to upstream (5') regions of a gene encoding a glucose assimilation protein. These homologous sequences will preferably flank the first recombinase recognition site (5' thereto) and the promoter (3' thereto). Nucleic acid sequences homologous to upstream (5') regions of a gene encoding a glucose assimilation protein include sequences derived from a) a sequence 5' to the endogenous regulatory region that is targeted for modification, and b) a sequence 3' of the endogenous regulatory region that is targeted for modification. The 3' sequence may include parts of a glucose assimilation protein coding sequence. A homologous flanking sequence may include from about 2 to 300 bp, about 5 to 200 bp, about 5 to 150 bp, about 5 to 100 bp and about 5 to 50 bp.

Isolation of genes and glucose assimilation proteins -

0120Methods of obtaining a desired gene from bacterial cells are common and well known in the art of molecular biology. For example, if a sequence of a gene is known, suitable genomic libraries may be created and screened. Once a sequence is isolated the DNA may be amplified using standard techniques such as polymerase chain reaction (PCR) (<patcit id="pcit0010" dnum="US4683202A"><text>USP 4,683,202</text></patcit>) to obtain amounts of DNA by restriction. Also reference is made to Sambrook et al., <i>supra.</i> For the purpose of the present invention, upstream sequences as defined above of any gene encoding a glucose assimilation protein is suitable for use in the disclosed methods.

0121In one embodiment, a gene encoding a glucose assimilation protein is a glucose transporter. Transporters are discussed in <nplcit id="ncit0100" npl-type="b"><text>Saier et al., (1998) ADVANCES IN MICROBIAL PHYSIOLOGY, Poole, R. K. Ed. pp 81-136 Academic press, San Diego, CA</text></nplcit>. In general, the glucose transporters as defined herein fall with the Transport Council (TC) classification of transport class 2 (GALP) and/or transport class 4 (PTS).

0122A preferred glucose transporter is GalP, which is encoded by <i>galP</i> in <i>E</i>. <i>coli.</i> One of skill in the art will appreciate that genes encoding GalP isolated from sources other than <i>E</i>. <i>coli</i> will also be suitable for use in the present invention. Moreover, proteins functioning as glucose transporters and having at least 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97% and 98% amino acid sequence identity to GalP from <i>E</i>.<i>coli</i> will be suitable for use according to the invention.

0123Additionally publicly available computer programs can be used to determine sequences with identity to a glucose assimilation protein and specifically to a glucose transporter. Preferred programs include the GCG Pileup program, FASTA (<nplcit id="ncit0101" npl-type="s"><text>Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444-2448</text></nplcit>) and BLAST (<nplcit id="ncit0102" npl-type="b"><text>BLAST Manual, Altschul et al., Natl. Cent. Biotechnol. Inf., Natl Library Med. (NCBI NLM), NIH, Bethesda MD</text></nplcit> and <nplcit id="ncit0103" npl-type="s"><text>Altschul et al., (1997) NAR 25:3389-3402</text></nplcit>).

0124By using BLAST at least 3 permeases with protein sequence similarity to GalP have been found. For example, <i>ara</i>E with 64% protein sequence identity; <i>xy</i>/E with 34% protein sequence identity and <i>yaa</i>U with 23% protein sequence identity. These peremases may also function as glucose transporters.

0125In many cases, transporter proteins are highly regulated in cells and commonly the expression of transporter genes is induced by the presence of a substrate in the media. The glucose transporter, galactose permease (GalP) from <i>E</i>. <i>coli</i> is induced by galactose, but the preferred substrate is glucose (<nplcit id="ncit0104" npl-type="s"><text>Henderson &amp; Maidenn (1990). Phil. Trans. R. Soc. Lond. 326: 391-410</text></nplcit>). In <i>E.coli</i>, besides GalP, other permeases can recognize and transport glucose, for example: <ol id="ol0003" compact="compact" ol-style=""><li>(a) the high affinity galactose transport system encoded by the mglBCA genes (<nplcit id="ncit0105" npl-type="s"><text>Hogg et al. (1991) Mol. Gen. Genet. 229:453-459</text></nplcit> and<nplcit id="ncit0106" npl-type="s"><text> Ferenci T. (1996) FEMS Microbiol. Rev. 18:301-317</text></nplcit>); and</li><li>(b) the mannose PTS system, where the membrane component PtsM has a broad substrate specificity and is capable of transporting glucose and fructose (<nplcit id="ncit0107" npl-type="s"><text>Postma &amp; Lengeler (1985) Microbial Rev. 49:232-269</text></nplcit> and <nplcit id="ncit0108" npl-type="s"><text>Erni et al., (1987) J. Biol. Chem. 262:5238-5247</text></nplcit>).</li></ol> Further the product of the ptsG gene, which normally is part of the glucose-PTS system, can be converted by mutagenesis to a PTS-independent transporter, that functions as a glucose assimilation protein and more specifically as a glucose-facilitator. (<nplcit id="ncit0109" npl-type="s"><text>Ruijteret al (1992) J. Bact. 174: 2843-2850</text></nplcit> and <nplcit id="ncit0110" npl-type="s"><text>Erni et al (1986), J. Biol. Chem 261:16398-16403</text></nplcit>).

0126Besides the well characterized examples above, other glucose transporters include those cataloged in the TransportDB database. This is a relational database describing the predicted cytoplasmic membrane transport protein complement for organisms whose complete genome sequence is available (http://66.93.129.133/transporter/wb/index.html).

0127In another embodiment, the glucose assimilation protein is a phosphorylating protein. The phosphorylating protein may be a hexokinase and preferably is a glucokinase. One preferred glucokinase is Glk and reference is made to NCBI (NC 000913). As indicated above for glucose transporters, other glucose phosphorylating enzymes may be identified using the computer programs such as FASTA, GCG Pileup and BLASTA.

0128<i>E. coli</i> includes other glucose phosphorylating enzymes as suggested by the result of <nplcit id="ncit0111" npl-type="s"><text>Flores et al. (2002) Met. Eng. 4:124-137</text></nplcit> and <nplcit id="ncit0112" npl-type="s"><text>Curtis et al. (1975) J. Bacteriol. 122:1189-1199</text></nplcit>). When <i>glk</i> was interrupted in <i>E</i>. <i>coli,</i> the cells had a residual glucose phosphorylating activity of 22 to 32% compared to a wild-type strain. A BLAST search of the <i>E.coli</i> genome using the Glk sequence, did not showed any protein with a level of sequence identity of greater than 34%. This may indicate that the measured glucokinase activity depends on one or more enzyme(s) not or distantly related to Glk. Some of these glucose assimilation proteins which may contribute to glucokinase activity are listed below: <tables id="tabl0002" num="0002"><table frame="all"><tgroup cols="3"><colspec colnum="1" colname="col1" colwidth="24mm" /><colspec colnum="2" colname="col2" colwidth="50mm" colsep="0" /><colspec colnum="3" colname="col3" colwidth="22mm" /><thead><row><entry valign="top"><i>Gene name</i></entry><entry namest="col2" nameend="col3" align="left" valign="top"><u>Current annotation in the NCBI database</u></entry></row></thead><tbody><row><entry>gntK</entry><entry>gluconate kinase 2</entry><entry>NP 417894</entry></row><row><entry>idnK</entry><entry>gluconate kinase</entry><entry>NP 418689</entry></row><row><entry>kdgK</entry><entry>Ketodeoxygluconokinase</entry><entry>NP 417983</entry></row><row><entry>galK</entry><entry>Galactokinase</entry><entry>NP 415278</entry></row><row><entry>pfkA</entry><entry>6-phosphofructokinase</entry><entry>NP 418351</entry></row><row><entry>rbsK</entry><entry>ribokinase</entry><entry>NP 418208</entry></row><row><entry>fruK</entry><entry>1-phosphofructokinase</entry><entry>NP 416673</entry></row><row><entry>yoaC(b1511)</entry><entry>putative kinase</entry><entry>NP 416028</entry></row><row><entry>yajF(b0394)</entry><entry>possible transcriptional regulator</entry><entry>NP 414928</entry></row><row><entry>ycfX(b1119)</entry><entry>putative transcriptional regulator</entry><entry>NP 415637</entry></row><row><entry>fucl</entry><entry>L-fuculokinase</entry><entry>NP 417283</entry></row></tbody></tgroup></table></tables>

0129This list is not exhaustive, and it is suggested by the inventors that by using the proper mutagenesis-selection protocols, these and/or other kinases can be modified to increase their ability to phosphorylate glucose.

E. Introduction of DNA cassettes into PTS

<u>-</u>

/Glu

<u>-</u>

cells -

0130Once suitable DNA cassettes are constructed they may be introduced into plasmids or directly used to transform appropriate PTS^-/Glu^- host cells. Plasmids which can be used as vectors in bacterial organisms are well known and reference is made to <nplcit id="ncit0113" npl-type="b"><text>Maniatis, et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2d Edition (1989</text></nplcit>) AND<nplcit id="ncit0114" npl-type="b"><text> MOLECULAR CLONING: A LABORATORY MANUAL, second edition (Sambrook et al., 1989</text></nplcit>) and <nplcit id="ncit0115" npl-type="b"><text>Bron, S, Chapter 3, Plasmids, in MOLECULAR BIOLOGY METHODS FOR BACILLUS, Ed. Harwood and Cutting, (1990) John Wiley &amp; Sons Ltd.</text></nplcit>

0131Useful vectors in the present invention include the vectors pSYCO101 (<figref idref="f0008 f0009 f0010 f0011 f0012 f0013 f0014 f0015">Figures 8</figref> and <figref idref="f0016">9</figref>), and the pSYCO 101 derivative plasmids pSYCO103 and pSYCO106; pKD46; pR6K-ECHO (Invitrogen); pJW168 (<nplcit id="ncit0116" npl-type="s"><text>Palmeros et al., 2000 Gene, 247:255 - 264</text></nplcit>); ptrcM2; <i>ptrc</i>99A; pTrc99 (Pharmacia); pACYC177; pMCGG; pSC101; pKD46 (<nplcit id="ncit0117" npl-type="s"><text>Datsenko and Wanner.(2000) PNAS 97:6640-6645</text></nplcit>); and pKP32 (<patcit id="pcit0011" dnum="WO01012833A"><text>WO 01/012833</text></patcit>).

0132Introduction of a DNA cassette and other vectors into a host cell may be accomplished by known transfer techniques. These gene transfer techniques include transformation, transduction, conjugation and protoplast fusion. Gene transfer is the process of transferring a gene or polynucleotide to a cell or cells wherein exogenously added DNA is taken up by a bacterium. General transformation procedures are taught in <nplcit id="ncit0118" npl-type="b"><text>CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (vol. 1, edited by Ausubel et al., John Wiley &amp; Sons, Inc. 1987, Chapter 9</text></nplcit>) and include calcium phosphate methods, transformation using DEAE-Dextran and electroporation. A variety of transformation procedures are known by those of skill in the art for introducing nucleic acids in a given host cell. (Reference is also made to <patcit id="pcit0012" dnum="USP5032514A"><text>USP 5,032,514</text></patcit>; <nplcit id="ncit0119" npl-type="s"><text>Potter H. (1988) Anal. Biochem 174:361-373</text></nplcit>; <nplcit id="ncit0120" npl-type="b"><text>Sambrook, J. et al., MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Harbor Laboratory Press (1989</text></nplcit>); and <nplcit id="ncit0121" npl-type="b"><text>Ferrari et al., Genetics, pgs 57 - 72 in BACILLUS, Harwood et al., Eds. Plenum Publishing Corp</text></nplcit>).

0133The introduction of a DNA cassette comprising a promoter and upstream sequences of a gene encoding a glucose assimilation protein into a PTS^-/Glu^- host cell results in modification of the endogenous chromosomal regulatory region, preferably by replacement of the endogenous regulatory region. In one embodiment, the DNA cassette includes an exogenous promoter and the promoter of the endogenous regulatory region is replaced. The introduced regulatory sequence (including the promoter) is chromosomally integrated into the PTS^-/Glu^- cell and the introduced sequence becomes operably linked with a coding sequence of the glucose assimilation protein replacing endogenous regulatory sequences. In a preferred embodiment, a selectable marker gene, which was introduced with the integrating DNA cassette is removed, preferably by using the methods described in <nplcit id="ncit0122" npl-type="s"><text>Palmeros et al. (2000) Gene 247:255-264</text></nplcit>. The expression of the glucose assimilation protein, which is linked to the exogenous promoter, results in a cell having a glucose⁺ phenotype. Bacterial strains having a glucose⁺ phenotype (PTS^-/Glu⁺), as disclosed herein are also encompassed by the present invention.

0134In a further embodiment, the modified endogenous regulatory region is the regulatory region of a glucose transporter. In a preferred embodiment, the glucose transporter gene encodes GalP from <i>E</i>. <i>coli</i> and glucose transporters having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97% and 98% amino acid sequence identity to GalP from <i>E</i>. <i>coli.</i> In another embodiment, the modified endogenous regulatory region is the regulatory region of a phosphorylating protein. In a preferred embodiment, the phosphorylating protein is a glucokinase and more preferrably a Glk from <i>E</i>. <i>coli</i> and phosphorylating proteins having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97% and 98% amino acid sequence identity to Glk from <i>E</i>. <i>coli.</i>

0135In one embodiment, the obtained PTS^-/Glu⁺ cells having a modified endogenous regulatory sequence operably linked to a glucose assimilation protein, and particularly to a modified endogenous regulatory sequence operably linked to a galactose permease and a modified endogenous regulatory sequence operably linked to a glucokinase according to the invention, will be capable of increased production of a desired compound compared to a wild type host cell. The desired compounds include the compounds illustrated in <figref idref="f0002">Figure 1B</figref>. Particularly preferred compounds include dihydroxyacetone-P, glycerol, 1, 3-propanediol, pyruvate, lactate, chorismate, tryptophan, phenylalanine, tyrosine, oxaloacetate, aspartate, asparagine, tyrosine, succinate, ethanol, and acetyl-CoA. In particular the desired compounds include pyruvate, chorismate and succinate.

F. Further modifications of PTS

<u>-</u>

/Glu

<u>+</u>

cells -

0136The PTS^-/Glu⁺ cells obtained according to the method of the invention may further include heterologous polynucleotides encoding one or more proteins which direct carbon flow into and through the common aromatic pathway. The heterologous polynucleotide may be introduced into a PTS^-/Glu⁺ cell either prior to, during or following the reversion to a Glu⁺ phenotype.

0137In one embodiment a PTS^-/Glu⁺ cell according to the invention may overexpress a transketolase, which is encoded by a <i>tktA</i> or <i>tktB</i>. Transketolase is a pentose phosphate pathway enzyme that catalyzes two separate reactions each of which produces E4P as a product. (See <figref idref="f0001 f0002">Figure 1</figref>). Amplification (overexpression) of the <i>tktA</i> gene, by introduction of nucleic acid sequences encoding transketolase may result in an increase in intracellular concentrations of the aromatic precursor E4P (<patcit id="pcit0013" dnum="US5168056A"><text>US Patent 5,168,056</text></patcit>).

0138In another embodiment, one or more of the genes (<i>aro</i>G, <i>aro</i>F and <i>aro</i>H) encoding DAHP synthase may be introduced or amplified in a PTS^-/Glu⁺ cell according to the invention. The increased expression of both E4P and DAHP synthase can result in a significant increase in carbon committed to the aromatic pathway compared to strains containing elevated DAHP synthase activity alone (<patcit id="pcit0014" dnum="US5168056A"><text>US Patent 5,168,056</text></patcit>).

0139Thus in one embodiment the invention concerns a host cell which creates a surge of carbon flow due to the amplification of transketolase in addition to a host cell which conserves PEP via inactivation of the PTS (PTS^-).

0140It should be noted that as the host cell is cultured in conditions which create an increase in carbon flow into the aromatic pathway, it may be necessary to identify and overcome rate-limiting steps in the pathway. This methodology is available to the artisan, see, for example, <patcit id="pcit0015" dnum="US5168056A"><text>US Pat. Nos. 5,168,056</text></patcit> and <patcit id="pcit0016" dnum="US5776736A"><text>5,776,736</text></patcit>.

0141As an example, in the following conversion <chemistry id="chem0001" num="0001"><img file="EP1546312B1_D0002.tif" /></chemistry> under conditions that create a surge of carbon flow into the pathway of, for example PTS^-/Glu⁺ and Tkt overexpressed strains, the activity level of DHQ synthase is insufficient to consume DAHP as fast as it is formed. As a result of this natural rate-limiting step at <i>aroB,</i> DAHP accumulates and is excreted into the culture supernatant. This allows DAHP accumulation to be used as a means of testing the increased intracellular PEP levels resulting from the PTS^-/Glu⁺ strains.

0142In addition to increasing the carbon flux through the aromatic pathway, the following genes may be overexpressed in PTS^-/Glu⁺ cells according to the invention: <i>pps</i> which encodes PEP synthase in <i>E. coli</i> (see <patcit id="pcit0017" dnum="US5985617A"><text>US Pat. No. 5,985,617</text></patcit>) and <i>talA</i> which encodes transaldolase (<nplcit id="ncit0123" npl-type="s"><text>lida et al. (1993) J. Bacterial. 175:5375-5383</text></nplcit>). Further any gene encoding an enzyme that catalyzes reactions within the common aromatic pathway (for example, DAHP synthase (aroF, aroG, aroH), DHQ synthase (aroB), DHQ dehydratase (aroD), shikimate dehydrogenase (aroE), shikimate kinase (aroL, aroK), EPSP synthase (aroA) and chorismate synthase (aroC) may be amplified in the PTS^-/Glu⁺ cells encompassed by the present invention.

0143It will be readily apparent to those skilled in the art, that a variety of different genes can be overexpressed depending on the desired product.

0144In one embodiment, if the desired product is chorismate, a PTS^-/Glu⁺ cell according to the invention may overexpress any one of the genes in the aromatic pathway including the genes coding for the enzymes DAHP synthase, DHQ synthase; DHQ dehydratase; shikimate dehydrogenase; shikimate kinase; EPSP synthase and chorismate synthase.

0145In one embodiment, if the desired product is tryptophan, any of the genes in the tryptophan-specific segment of the aromatic pathway may be amplified, including the genes coding for the enzymes tryptophan synthase (trpA and trpB), phosphoribosyl anthranilate isomerase-indoleglycerol phosphate synthase (trpC), anthranilate phosphoribosyl transferase (trpD) and anthranilate synthase (trpE). In another embodiment the gene (tnaA) encoding tryptophanase may be deleted.

0146In another embodiment, if the desired product is pyruvate a PTS^-/Glu⁺ cell according to the invention may be genetically engineered to overexpress <i>pyk.</i> This gene encodes a pyruvate kinase. If the desired compound is oxaloacetate a PTS^-/Glu⁺ cell according to the invention may be genetically engineered to overexpress a <i>ppc</i> which encodes a PEP carboxylase (EC 4.1.1.31).

0147If the desired compound is catechol, the PTS^-/Glu⁺ cell according to the invention may be further transformed with DNA encoding one or more of the following enzyme(s): DAHP synthase (aroF, aroG, aroH); 3-dehydroquinate (DHQ) synthase (aroB); transketolase (tktA or tktB); 3-dehydroshikimate (DHS) dehydratase (aroZ) or protocatechuate (PCA) decarboxylase (aroY) (see <patcit id="pcit0018" dnum="US5272073A"><text>US Patents 5,272,073</text></patcit> and <patcit id="pcit0019" dnum="US5629181A"><text>5,629,181</text></patcit>).

0148Furthermore, by way of example, if the desired product is adipic acid, one or more of the following enzyme(s) may be overexpressed (by amplification of the corresponding gene): 3-dehydroshikimate (DHS) dehydratase (aroZ); protocatechuate (PCA) decarboxylase (aroY) or catechol 1,2-dioxygenase (catA); and, optionally, transketolase (tktA or tktB); DAHP synthase (aroF, aroG, aroH) or DHQ synthase (aroB) in a PTS^-/Glu⁺ cell according to the invention. (See <patcit id="pcit0020" dnum="US5487987A"><text>US Patent 5,487,987</text></patcit>).

0149If the desired product is indigo, the PTS^-/Glu⁺ cell according to the invention may be further transformed with DNA encoding a polypeptide analog of a tryptophan synthase beta-subunit and DNA encoding an aromatic dioxygenase enzyme. (See <patcit id="pcit0021" dnum="US5374543A"><text>US Patent 5,374,543</text></patcit>).

0150Thus, having provided a PTS^-/Glu⁺ strain which conserves PEP resulting in an increase in carbon flux into a metabolic pathway, such as the aromatic amino acid pathway, glycolysis, the TCA cycle, and the pentose phosphate pathway, by redirecting PEP and PEP precursors, the inventors have provided a host system which can be utilized for enhanced production of desired compounds in comparison to the production of the same compounds in a corresponding PTS host cell.

G. Cell Cultures and fermentations -

0151Methods suitable for the maintenance and growth of bacterial cells are well known and reference is made to the <nplcit id="ncit0124" npl-type="b"><text>MANUAL OF METHODS OF GENERAL BACTERIOLOGY, Eds. P. Gerhardt et al., American Society for Microbiology, Washington DC (1981</text></nplcit>) and <nplcit id="ncit0125" npl-type="b"><text>T.D. Brock in BIOTECHNOLOGY: A TEXTBOOK OF INDUSTRIAL MICROBIOLOGY, 2nd ed. (1989) Sinauer Associates, Sunderland, MA</text></nplcit>.

Cell Precultures

0152Typically cell cultures are grown at 25 to 32°C, and preferably about 28 or 29°C in appropriate media. Exemplary growth media useful in the present invention are common commercially prepared media such as but not limited to Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth or Yeast medium (YM) broth. These may be obtained from for example, GIBCO/BRL (Gaithersburg, MD). Other defined or synthetic growth media may be used and the appropriate medium for growth of the particular bacterial microorganism will be known by one skilled in the art of microbiology or fermentation science. Suitable pH ranges preferred for the fermentation are between pH 5 to pH 8. Preferred ranges for seed flasks are pH 7 to pH 7.5 and preferred ranges for the reactor vessels are pH 5 to pH 6. It will be appreciated by one of skill in the art of fermentation microbiology that a number of factors affecting the fermentation processes may have to be optimized and controlled in order to maximize the ascorbic acid intermediate production. Many of these factors such as pH, carbon source concentration, and dissolved oxygen levels may affect enzymatic processes depending on the cell types used for ascorbic acid intermediate production.

0153The production of desired products can proceed in a fermentative environment, that is, in an <i>in vivo</i> environment, or a non-fermentative environment, that is, in an <i>in vitro</i> environment; or combined <i>in vivo</i>/<i>in vitro</i> environments. The fermentation or bioreactor may be performed in a batch process or in a continuous process.

Fermentation Media

0154Fermentation media in the present invention must contain suitable carbon substrates which will include but are not limited to monosaccharides such as glucose, oligosaccharides such as lactose or sucrose, polysaccharides such as starch or cellulose and unpurified mixtures from a renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt. Additionally the carbon substrate may also be one-carbon substrates such as carbon. While it is contemplated that the source of carbon utilized in the present invention may encompass a wide variety of carbon containing substrates and will only be limited by the choice of organism, the preferred carbon substrates include glucose and/or fructose and mixtures thereof. By using mixtures of glucose and fructose in combination with the modified genomes described elsewhere in this application, uncoupling of the oxidative pathways from the catabolic pathways allows the use of glucose for improved yield and conversion to the desired ascorbic acid intermediate while utilizing the fructose to satisfy the metabolic requirements of the host cells.

0155Although it is contemplated that all of the above mentioned carbon substrates are suitable in the present invention preferred are the carbohydrates glucose, fructose or sucrose. The concentration of the carbon substrate is from about 55% to about 75% on a weight/weight basis. Preferably, the concentration is from about 60 to about 70%on a weight/weight basis. The inventors most preferably used 60% or 67% glucose.

0156In addition to an appropriate carbon source, fermentation media must contain suitable minerals, salts, vitamins, cofactors and buffers suitable for the growth or the cultures and promotion of the enzymatic pathway necessary for ascorbic acid intermediate production.

Batch and Continuous Fermentations

0157The present process employs either a batch, fed-batch or continuous fermentation method for its culture systems. These methods are well known in the art and examples may be found in Brock, <i>supra.</i> A classical batch fermentation is a closed system where the composition of the media is set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the media is inoculated with the desired organism or organisms and fermentation is permitted to occur adding nothing to the system. Typically, however, a "batch" fermentation is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. In batch systems the metabolite and biomass compositions of the system change constantly up to the time the fermentation is stopped. Within batch cultures cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die. Cells in log phase generally are responsible for the bulk of production of end product or intermediate.

0158A variation on the standard batch system is the Fed-Batch system. Fed-Batch fermentation processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the fermentation progresses. Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Measurement of the actual substrate concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO₂.

0159Although in the present invention a batch or fed-batch method is preferred, a continuous fermentation method may also be used. Continuous fermentation is an open system where a defined fermentation media is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth. Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration. For example, one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate. In other systems a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to media being drawn off must be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, <i>supra.</i>

0160The manner and method of carrying out the present invention may be more fully understood by those of skill in the art by reference to the following examples, which examples are not intended in any manner to limit the scope of the present invention or of the claims directed thereto.

<u>EXPERIMENTAL</u>

EXAMPLE 1 - Construction

of PTS

<u>-</u>

<i>E. coli</i> Strains with <i>trc</i> Promoters

A). Construction of the <i>loxP</i>-CAT-<i>loxP</i>-trc cassette, plasmid pTrcM42.

0161Linear DNA was obtained from plasmid pTrc99a (Pharmacia) digested with the restriction enzymes <i>Hind</i>III and <i>Nco</i>I according to the supplier's instructions (New England Biolabs). After purification, the ends of the digested DNA were filled by T4DNA polymerase as described by Sambrook et al. <i>supra.</i> The resulting blunt-end, linear DNA was circularized according standard protocols and transformed into <i>E</i>. <i>coli</i> TOP-10 competent cells (Invitrogen, Carlsbad, CA). Cells were plated on Luria-agar (LA) plates (LB medium containing 5 g/L yeast extract; 10 g/L tryptone, and 10g/L NaCl plus 2% agar) containing 50 micrograms/ml of carbenicillin. After 16 hrs. of incubation at 37 ⁰C, four colonies were chosen for further analysis. Purified plasmid DNA was obtained from these colonies and subjected to restriction enzymes analysis. It was confirmed that the 4 colonies contained the same plasmid and that the DNA region between <i>Hind</i>III and <i>Nco</i>I was deleted. The resulting plasmid was named pTrc1.

0162Plasmid pTrc1 contains only one recognition site for the restriction enzyme BspM1, located approximately 120 bp upstream of the -35 region of the <i>trc</i> promoter. That location was selected to introduce an excisable selectable marker. pTrc1 was digested with the <i>Bsp</i>M1 enzyme according to the instructions of the supplier (New England Biolabs). The linear pTrc1 was gel-purified using a QIAquick gel extraction kit (QIAGEN), filled in with T4 DNA polymerase as described by Sambrook, <i>supra,</i> and ligated to a <i>lox</i>P-CAT-<i>lox</i>P DNA cassette. The <i>lox</i>P-CAT-<i>lox</i>P DNA cassette was obtained from plasmid pLoxCAT2 (<nplcit id="ncit0126" npl-type="s"><text>Palmeros et al., (2000) Gene 247:255-264</text></nplcit>) digested with <i>Stu</i>1 and <i>Bam</i> H1. The ligation mixture was transformed into <i>E.coli</i> TOP-10 competent cells (Invitrogen) and plated on Luria-agar plates containing 50 micrograms/ml of carbenicillin and 20 micrograms/ml of chloramphenicol. After 16 hrs of incubation at 37⁰C, several colonies appeared on the plate. Some of these colonies were transferred to a fresh LB plate containing carbenicillin and chloramphenicol. After plasmid purification and restriction enzyme analysis, two plasmids containing the <i>lox</i>P-CAT-l<i>ox</i>P-trc with the <i>lox</i>P-CAT-<i>lox</i>P cassette in the same and in the opposite orientation relative to the <i>trc</i> promoter were selected and designated pTrcm41 and pTrcm42 (<figref idref="f0006">Figure 6</figref>).

B). Construction of a <i>trc</i> promoter replacement template for <i>gal</i>P (pR6KgalP)

0163A DNA cassette containing the <i>trc</i> promoter and <i>lac</i> operator with an upstream loxP-CAT-IoxP cassette was amplified by PCR from pTrcm42 using the primer set of GalA/GalP2 GalA: (SEQ ID NO. 6) <img file="EP1546312B1_D0003.tif" /> GalP2: (SEQ ID NO. 7) <img file="EP1546312B1_D0004.tif" />

0164The primer pair incorporated 40 bp of homology to the <i>galP</i> upstream region to each end of the PCR product. The amplification used 30 cycles of (95°C for 1 min; 55°C for 1 min; 72°C for 2 min) using Taq polymerase (Roche). This DNA cassette was cloned into Echo pUni/His5 R6K vector (Invitrogen) and transformed into <i>E</i>. <i>coli</i> Pir1 cells. Positive clones were confirmed by restriction enzyme digest to release the fragment. This construct was designated pR6KgalP.

C). Construction of a <i>trc</i> promoter replacement template for <i>glk</i> (pR6Kglk).

0165A DNA cassette containing the <i>trc</i> promoter and <i>lac</i> operator with an upstream loxP-CAT-loxP cassette was amplified by PCR from pTrcm42 using the primer set of GlkA/Glk2. GlkA: (SEQ ID NO. 8) <img file="EP1546312B1_D0005.tif" /> Glk2: (SEQ ID NO. 9) <img file="EP1546312B1_D0006.tif" />

0166The primer pair incorporated 40 bp of homology to the <i>glk</i> upstream region to each end of the PCR product. The amplification used 30 cycles of (95°C for 1 min; 55°C for 1 min; 72°C for 2 min) using Taq polymerase (Roche). This DNA cassette was cloned into Echo pUni/His5 R6K vector (Invitrogen) and transformed into <i>E. coli</i> Pir1 cells. Positive clones were confirmed by restriction enzymes and the plasmid was designated pR6Kglk

D). Construction of an <i>E</i>. <i>coli ptsHIcrr</i> deletion strain KLpts7

0167A PTS^- (Δ <i>ptsHIcrr</i>) strain of <i>E. coli</i> KLndh81 (KLp23ndh), was obtained by replacing the entire operon comprising <i>ptsH, ptsl</i> and <i>crr</i> with a kanamycin resistance marker (<nplcit id="ncit0127" npl-type="s"><text>Levy et al., (1990) Gene 86:27-33</text></nplcit>). This was done by P1 <i>virtransduction</i> using the phage lysate 2611 NF9pykF::Gm as described in <nplcit id="ncit0128" npl-type="s"><text>Flores et al., (1996) Nature Biotechnol., 14:620-623</text></nplcit>. The deletion of the operon was confirmed by amplification of the region by PCR with primers (ptsHF/crrR) that hybridized to regions upstream or downstream of the deletion, and by plating the colonies on MacConkey (lactose^-) agar + 1 % glucose. ptsHF (SEQ ID NO. 23) 5' AGAATTGCAACAGTAATGCCAGCTTGTTAAAAATGCGTA 3' crrR (SEQ ID NO. 24) 5' CCTGTTTTGTGCTCAGCTCATCAGTGGCTTGCTGAA 3'

0168Those colonies with a deletion in the glucose::PTS system exhibited a white phenotype on these plates as they were no longer able to utilize the glucose and generate acid. This strain was designated KLpts7.

E). Replacement of the natural promoter of <i>gal</i>P with the synthetic exogenous <i>trc</i> promoter by linear DNA cassette transformation.

0169A DNA cassette comprising a loxP-CAT-loxP-ptrc with 40 bp of flanking DNA on each end with homology to the <i>E. coli galP</i> upstream region was generated using rTth RNA polymerase (Perkin Elmer), pR6K-galP (SEQ ID NO. 1) as the template and the primer pairs GalA/GalP2 (SEQ ID NO. 6/SEQ ID NO. 7). The PCR product was transformed into electro-competent KLpts7 cells containing pKD46 for integration using the lambda Red system as described in <nplcit id="ncit0129" npl-type="s"><text>Datsenko and Wanner (2000), Proc. Natl. Acad. Sci. USA 97:6640-6645</text></nplcit>. Integration of this cassette resulted in the replacement of the regulatory region from 36-183 bp upstream of the <i>galP</i> ATG start codon. (For reference see GenBank Accession # U28377) with a loxP-CAT-loxP-ptrc cassette to provide strain KLpts::galP-trc.

0170Colonies were selected on LA plates containing 10 µg/ml chloramphenicol. The integration was confirmed by PCR analysis using the primer pair GalA/GalP2 (SEQ ID NO.6/SEQ ID NO. 7) (amplifying the integration site to give a 1.4 kb product) and the primer pair GalB1/GalC11 (amplifying the integration site, including upstream and downstream regions to give a 2.1 kb product). GalB1 (SEQ ID NO. 10) 5' ACTTTGGTCGTGAACATTTCCCGTGGGAAA 3' GalC11 (SEQ ID NO. 11) 5' AGAAAGATAAGCACCGAGGATCCCGATA 3'

0171PCR parameters were 1 min at 95°C; 1 min at 55°C; 2 min at 72°C, 30 cycles using <i>Taq</i> DNA polymerase or r<i>Tth</i> polymerase as suggested by the manufacturer. This strain, KLpts::galP-trc, was plated on MacConkey agar (lactose^-) +1% glucose. The colonies exhibited a slightly red phenotype compared to KLpts7 which was white, indicating that the former strain was able to make acid from glucose while the latter strain (parent) was not. This confirmed the expression of <i>gal</i>P and that the GalP allowed uptake of glucose. The promoter region was sequenced to confirm the presence of the promoter. The chloramphenicol marker was removed using the Cre recombinase as described in (<nplcit id="ncit0130" npl-type="s"><text>Palmeros et al. (2000) Gene 247:255-264</text></nplcit> and the removal was confirmed by PCR using the primer set GalB1/GalC11 (SEQ ID NO. 10/SEQ ID NO. 11). The resultant strain was designated KLgalP-ptrc.

F). Replacement of the natural glucokinase promoter with the synthetic exogenous trc promoter (KLGG) by linear DNA cassette transformation.

0172A DNA cassette consisting of loxP-CAT-loxP-ptrc with 40 bp of flanking DNA with homology to the upstream region of <i>glk</i> was prepared as described for the <i>galP</i> DNA cassette in example 1 E) above. The primer set used was GlkA/Glk2 (SEQ ID NO. 8 and SEQ ID NO. 9) that adds the flanking DNA from 149-189 upstream of the <i>glk</i> ATG to the 5' end and from <i>glk</i> ATG to 37 bp upstream of the ATG to the 3' end (<i>glk</i> accession number AE000327). The template used for the PCR amplification was pR6Kglk with the r<i>Tth</i> polymerase (Perkin Elmer). The glk-trc DNA cassette was transformed into electro-competent KLgalP-trc cells containing the pKD46 plasmid as described by Datsenko and Wanner (2000) <i>supra.</i> Positive clones were selected on LA agar containing 10 µg/ml chloramphenicol. Integration of the cassette was confirmed by PCR using the primer set GlkB1/GlkC11 and the PCR program described in construction of KLgalP-trc. GlkB1 is the forward primer that binds beginning at 700 bp upstream of the <i>glk</i> ATG and GlkC11 binds beginning at 500 bp downstream of the <i>glk</i> ATG start codon. GlkB1 (SEQ ID NO. 12) 5' AACAGGAGTGCCAAACAGTGCGCCGA 3' GlkC11 (SEQ ID NO. 13) 5' CTATTCGGCGCAAAATCAACGTGACCGCCT 3'

0173Colonies were plated onto MacConkey agar (lactose-) + 1% glucose. Colonies exhibited a deep red color, indicating an increase in the conversion of glucose to acid compared to the parent (KLgalP-trc). The chloramphenicol marker was removed using the Cre recombinase as described in Palmeros et al., <i>supra</i> and removal was confirmed by PCR using the primer set GlkB1/GlkC11 to give a 1.3 kb product. The resultant strain was designated KLGG.

G). Construction of the PEP-independent glucose transport system from ptrc cloned into pACYC177 (pMCGG).

0174A moderate copy number plasmid that allowed expression of <i>gal</i>P and <i>glk</i> from the <i>trc</i> promoter was constructed. A 3040 bp <i>Acc</i>I fragment containing <i>ga</i>lP and <i>glk</i> each under the control of <i>trc</i> promoters was isolated from plasmid pVHGalPglk11 (Figure 13). Plasmid pVHGalPglk11 is a low copy number plasmid derived from the pCL1920 vector (<nplcit id="ncit0131" npl-type="s"><text>Lemer et al. (1990) NAR 18:4631</text></nplcit>) that carries the resistance to the Spectinomycin antibiotic and the <i>gal</i>P and <i>glk</i> genes from <i>E. coli</i> under the control of <i>trc</i> promoters. The nucleotide sequence (SEQ ID NO. 25) of the 3040 bp DNA fragment obtained by AccI digestion is illustrated in Figure 14A -E. The ends were filled in using standard procedures (Sambrook et al., supra). This blunt-ended fragment was cloned into the <i>Cla</i>I site of pACYC177 (New England Biolabs) thereby inactivating the kanamycin resistance gene. Colonies were screened for growth on carbenicillin (100 micrograms/ml) and lack of growth on kanamycin (10 micrograms/ml). Plasmid DNA was isolated from a positive clone by standard method and the presence of the desired fragment was confirmed by restriction enzyme digestion using <i>Xba</i>I which cuts only 1 time within the cloned fragment, and separately with <i>Bam</i>HI which has two recognition sites in the plasmid. This enabled the inventors to determine the orientation of the inserted fragment. This plasmid was designated pMCGG.

H). Construction of the pSYCO constructs.

0175The utility of the PTS^-/Glu⁺ strains (examples 1E - G) to convert carbon from glucose to a product was tested by plasmids carrying genes encoding enzymes that carry out conversion of DHAP to 1, 3 propanediol. The pSYCO constructs were pSC101 (Stratagene) based plasmids that carry genes for conversion of DHAP (dihydroxyacetone-P) to glycerol (<i>dar</i>1 and <i>gpp</i>2) from Saccharomyces cerevisiae (referred to as the glycerol pathway) and subsequently glycerol to 1, 3 -propanediol (<i>dha</i>B1-3, <i>dha</i>X, or<i>f</i>W, X, and Y from <i>Klebsiella,</i> (referred to as the 1,3-propanediol pathway). The pSYCO constructs used in the current examples were pSYCO101, 103 and 106 and reference is made to <figref idref="f0008 f0009 f0010 f0011 f0012 f0013 f0014 f0015">figures 8</figref> and <figref idref="f0016">9</figref> which depict the nucleotide sequence and plasmid map of pSYCO 101, respectively. The pSYCO103 construct is identical to pSYCO101 except the DNA region which includes the glycerol pathway genes and the two <i>Eco</i>R1 sites in the opposite orientation to that of pSYCO101. The pSYCO106 construct is identical to pSYCO103 except for the removal of the 126 bp of non-coding plasmid DNA between the <i>Eco</i>R1 sites and bp 10589 - 11145 as indicated in <figref idref="f0016">figure 9</figref>. For the experiments described herein, the plasmids are functionally equivalent.

EXAMPLE 2 - Constitutive expression of <i>galP</i> encoding galactose permease from the chromosome of a strain lacking a PEP-PTS system for glucose uptake.

0176The production of glycerol and 1,3-propanediol in an PTS^-/Glu⁺<i>E. coli</i> strain having a Glu+ phenotype was determined. The PTS^-/Glu⁺<i>E. coli</i> strain was obtained by transformation of the PTS^-/Glu^- strain (KLpts7) with pMCGG (example 1 G) by standard procedures (Sambrook et al. <i>supra</i>) to create KLpts7/pMCGG or by chromosomal integration of the <i>trc</i> promoter to replace the endogenous native <i>gal</i>P promoter in KLpts7 creating a KIgalP-ptrc (example 1E). Both KLpts7/pMCGG and KIgalP-ptrc were transformed by standard procedures (Sambrook et al., supra) with a plasmid carrying the pathways for glycerol and 1,3 -propanediol production. The production of cell mass, glycerol and 1, 3-propanediol was tested in fermentations. A standard fermentation was carried out as follows: A 500 ml seed flask was grown at 35°C in standard 2YT medium (Sambrook et al. <i>supra</i>) for 4 - 6 hours with shaking at 200 rpm, This seed culture was used to incubate a 14 L fermentor which was run in glucose excess conditions at 35°C, pH 6.8, for 60 h in a TN2 medium consisting of - (g/L): K₂HPO₄ (13.6); KH₂PO₄ (13.6): MgSO₄. 7H₂O (2); citric acid monohydrate (2), ferric ammonium citrate (0.3), (NH₄)₂SO₄ (3.2) yeast extract (5) solution of trace elements (1ml) and pH adjusted to 6.8. The solution of trace elements contained (g/L) citric acid. H₂O (4.0), MnSO₄. H₂O (3.0), NaCl (1.0), FeSO₄.7H₂O (0.10), CoCL₂.6H₂0 (0.10), ZnSO₄.7H₂O (0.10), CuSO₄ .5H₂O (0.01), H₃BO₃ (0.01) and Na₃MoO₄ .2H₂O (0.01) The fermentation was analyzed for cell density by determining the optical density (OD) of the culture at 600nM in a spectrophotometer and glycerol and 1,3-propanediol concentrations were determined using HPLC.

Isolation and identification of 1,3-propanediol:

0177The conversion of glucose to glycerol and 1,3-propanediol was monitored by HPLC. Analyses were performed using standard techniques and materials available to one of skill in the art of chromatography. One suitable method utilized a Waters Alliance HPLC system using RI detection. Samples were injected onto a Aminex HPX87H column (7.8 mm x 300 mm, BioRad, Hercules, CA) equipped with a Cation H Refill Cartridge precolumn (4.6 mm x 30 mm, Biorad, Hercules, CA), temperature controlled at 50°C, using 5 mM H₂SO₄ as mobile phase at a flow rate of 0.4 ml/min. The system was calibrated weekly against known concentration standards. Typically, the retention times of glucose, glycerol, 1,3-propanediol, and acetate were 12.7 min, 19.0 min, 25.2 min, and 21.5 min, respectively.

0178In this example, two systems were compared. In the first system, the <i>trc</i> promoter was integrated into the <i>galP</i> target site (<i>galP</i> locus-see example 1E) allowing the <i>E</i>. <i>coli</i> strain to produce glucokinase under the natural regulation of <i>glk</i> and in the second system, the <i>trc</i> promoter was integrated into both the <i>gal</i>P target site and the <i>glk</i> target site (<i>glk</i> loci - see example 1F). <figref idref="f0017">Figures 10</figref> and <figref idref="f0018">11</figref> illustrate the fermentation results for KLpts7/pMCGG and KLgalP-ptrc transformed with pSYCO101 and pSYCO103, respectively.

0179The plasmid encoded glucose transport system in KLpts7/pMCGG allowed the strain to grow to high cell density (<figref idref="f0017">Figure 10A</figref>) and produce glycerol and 1, 3-propanediol (<figref idref="f0017">Figure 10B</figref>). However, the amount of glycerol and 1,3-propanediol produced relative to the cell mass was low approx 7 g/L of 1,3 propanediol for an OD₆₀₀ of 194. In contrast, as shown in <figref idref="f0018">figure 11</figref>, KIgalP-ptrc produced much less cell mass in the fermentation and more product approx. 61 g/L 1,3-propanediol and 36 g/L glycerol (<figref idref="f0018">Figure 11B</figref>) for an OD₆₀₀ of 70 (<figref idref="f0018">Figure 11A</figref>).

0180By constitutively expressing <i>galP</i> on the chromosome from the <i>trc</i> promoter the flux of carbon from glucose was increased into the pathway for the desired products, glycerol and 1, 3-propanediol rather than into pathways to produce cell mass.

EXAMPLE 3 - Constitutive expression of <i>galP</i> and <i>glk</i> from the chromosome of a PTSstrain.

0181The PTS^-/Glu^- strain, KLpts7 was made Glu⁺ by integration of the <i>trc</i> promoter at the <i>gal</i>P and <i>glk</i> target sites to create strain KLGG and reference is made to example 1 above. The strain was transformed by standard procedures with pSYCO101. The production of cell mass, glycerol and 1, 3-propanediol was tested in a standard fermentation (see example 2).

0182As illustrated in <figref idref="f0018">Figures 11</figref> and <figref idref="f0019">12</figref>, in comparison to KI<i>gal</i>P-trc, KLGG grew more rapidly (at T 33.9, KLGG had obtained an OD₆₀₀ of 24.7 while the OD₆₀₀ of KIgalP was 19.6). KLGG produced 70 g/L of 1, 3-propanediol compared with 61 g/L produced by strain KIgalP-trc. Additionally, the peak concentration was reached earlier in the KLGG fermentation (56.8 h compared to 62.7 hours for KIgalP). The constitutive expression of <i>galP</i> and <i>glk</i> by chromosomal integration of the <i>trc</i> promoter therefore produces more 1, 3-propanediol in less fermentation time than the constitutive expression of only <i>galP</i>.

EXAMPLE 4 - Selection and analysis of a fast growing PTS

<u>-</u>

/Glu

<u>+</u>

strain of <i>E</i>. <i>coli</i>.

0183The long lag phase in growth while producing glycerol and 1,3-propanediol demonstrated in fermentation studies of the strain KLGG (in example 3 above) was repeatable in shake flask experiments as shown in table 2 below for KLGG at 24 and 48 hours. <tables id="tabl0003" num="0003"><table frame="all"><title>Table 2</title><tgroup cols="7"><colspec colnum="1" colname="col1" colwidth="15mm" /><colspec colnum="2" colname="col2" colwidth="16mm" /><colspec colnum="3" colname="col3" colwidth="15mm" /><colspec colnum="4" colname="col4" colwidth="41mm" /><colspec colnum="5" colname="col5" colwidth="24mm" /><colspec colnum="6" colname="col6" colwidth="28mm" /><colspec colnum="7" colname="col7" colwidth="21mm" /><thead><row><entry valign="middle">Strain</entry><entry valign="middle">Time (h)</entry><entry valign="middle">OD 600</entry><entry valign="middle">Glucose Consumed (g/L)</entry><entry valign="middle">Glycerol (g/L)</entry><entry valign="middle">1,3-propanediol</entry><entry valign="middle">Molar Yield</entry></row></thead><tbody><row><entry>KLGG</entry><entry>24</entry><entry>6</entry><entry>5.5</entry><entry align="char" char=".">2.6</entry><entry align="char" char=".">1.5</entry><entry align="char" char=".">1.6</entry></row><row><entry>KLGG</entry><entry>48</entry><entry>20</entry><entry>21</entry><entry align="char" char=".">9.9</entry><entry align="char" char=".">2.7</entry><entry align="char" char=".">1.2</entry></row><row><entry>FMP</entry><entry>16</entry><entry>16.5</entry><entry>24.6</entry><entry align="char" char=".">9.2</entry><entry align="char" char=".">3.2</entry><entry align="char" char=".">1.1</entry></row></tbody></tgroup><tgroup cols="7" rowsep="0"><colspec colnum="1" colname="col1" colwidth="15mm" /><colspec colnum="2" colname="col2" colwidth="16mm" /><colspec colnum="3" colname="col3" colwidth="15mm" /><colspec colnum="4" colname="col4" colwidth="41mm" /><colspec colnum="5" colname="col5" colwidth="24mm" /><colspec colnum="6" colname="col6" colwidth="28mm" /><colspec colnum="7" colname="col7" colwidth="21mm" /><tbody><row><entry namest="col1" nameend="col7" align="justify">Molar yield is (moles glycerol + moles 1,3-propanediol/mole glucose consumed</entry></row></tbody></tgroup></table></tables>

0184To decrease the fermentation time a fast growing variant of KLGG was selected by growing KLGG in a fermentor in TM2 and glucose excess conditions at 35°C pH 6.8. Cells were harvested at early log phase (for example see T31 in <figref idref="f0019">Figure 12A</figref>) and plated for isolated colonies on L agar. Isolated colonies were screened for variants which produced glycerol and 1, 3-propanediol when transformed with pSYCO at concentrations equivalent to KLGG. A variant was identified and designated FMP. FMP exhibited a performance equivalent to KLGG but accomplished the same performance in 16 h of shake flask growth compared to 48 h for KLGG (table 2).

0185Shake flasks experiments were done in TM2 with 2% glucose +spectinomycin at a concentration of 50 microgram/ml and B₁₂ at 2 milligram/liter. An overnight culture of the strain with the pSYCO plasmid was grown in LB+spectinomycin (50 microgram/ml) at 37°C with shaking at 200 rpm. The shake flasks were inoculated with 200 microliters of the overnight culture (10 mls of culture in 250 ml baffled flask) and grown at 34°C with shaking at 200 rpm. The cultures were analyzed for cell density (OD₆₀₀) and consumption of glucose and production of glycerol and 1, 3-propanediol by HPLC. (Reference is made to example 2).

0186Analysis of the fast growing variant:: The FMP variant was analyzed for glucokinase activity, relative levels of <i>glk</i> mRNA and the gene and promoter sequence. As shown in table 3 the glucokinase activity of FMP was increased 3 fold over that of KLGG, from 0.08 units to 0.22 units. This suggests either a mutation in the coding region resulting in a more active enzyme or an increase in the amount of enzyme present. <tables id="tabl0004" num="0004"><table frame="all"><title>Table 3</title><tgroup cols="2"><colspec colnum="1" colname="col1" colwidth="17mm" /><colspec colnum="2" colname="col2" colwidth="59mm" /><thead><row><entry valign="top">STRAIN</entry><entry valign="top">Glucokinase activity (micromoles/min, mg protein in 1.0 mL)</entry></row></thead><tbody><row><entry>KLGG</entry><entry align="char" char=".">0.083074232</entry></row><row><entry>FMP</entry><entry align="char" char=".">0.218672457</entry></row></tbody></tgroup></table></tables>

0187To test the expression levels, the relative levels of glk mRNA was determined and reference is made to Table 4A and 4B. Using a light cycler, data is generated in the form of crossing times. The lower the crossing time, the more mRNA is present. The crossing times for <i>galP</i> were equivalent in KLGG and FMP indicating similar levels of mRNA in both strains. The crossing times of <i>glk</i> in FMP was lower than that of KLGG (15.7 compared to 18.47, respectively) and the ratio of the average crossing times was 1.18 (KLGG-<i>glk</i>:FMP-<i>glk</i>), which indicated that more glk mRNA was present in the FMP strain. Samples were tested in duplicate (1 or 2) and the average (Avg.) was taken. Averages were used to determine the ratios (<i>glk</i>-K/<i>glk</i>-F represents KLGG <i>glk</i> and FMP <i>glk,</i> respectively). <tables id="tabl0005" num="0005"><table frame="all"><title>Table 4A</title><tgroup cols="10"><colspec colnum="1" colname="col1" colwidth="15mm" /><colspec colnum="2" colname="col2" colwidth="14mm" /><colspec colnum="3" colname="col3" colwidth="14mm" /><colspec colnum="4" colname="col4" colwidth="17mm" /><colspec colnum="5" colname="col5" colwidth="14mm" /><colspec colnum="6" colname="col6" colwidth="14mm" /><colspec colnum="7" colname="col7" colwidth="15mm" /><colspec colnum="8" colname="col8" colwidth="14mm" /><colspec colnum="9" colname="col9" colwidth="14mm" /><colspec colnum="10" colname="col10" colwidth="17mm" /><thead><row><entry namest="col1" nameend="col10" align="center" valign="top">Crossing Time</entry></row><row><entry valign="top">Strain</entry><entry valign="top"><i>ga</i>/P1</entry><entry valign="top"><i>ga</i>/P2</entry><entry valign="top"><i>ga</i>/P Avg</entry><entry valign="top"><i>g</i>/<i>k</i>1</entry><entry valign="top"><i>g</i>/<i>k</i>2</entry><entry valign="top"><i>g</i>/<i>k</i> Avg</entry><entry valign="top"><i>rrs</i>H1</entry><entry valign="top"><i>rrs</i>H2</entry><entry valign="top"><i>rrs</i>H Avg</entry></row></thead><tbody><row><entry>KLGG</entry><entry align="char" char=".">18.48</entry><entry align="char" char=".">18.42</entry><entry align="char" char=".">18.45</entry><entry align="char" char=".">18.47</entry><entry align="char" char=".">18.46</entry><entry align="char" char=".">18.47</entry><entry align="char" char=".">11.64</entry><entry align="char" char=".">11.67</entry><entry align="char" char=".">11.66</entry></row><row><entry>FMP</entry><entry align="char" char=".">17.75</entry><entry align="char" char=".">17.72</entry><entry align="char" char=".">17.74</entry><entry align="char" char=".">15.69</entry><entry align="char" char=".">15.7</entry><entry align="char" char=".">15.7</entry><entry align="char" char=".">11.7</entry><entry align="char" char=".">11.7</entry><entry align="char" char=".">11.7</entry></row></tbody></tgroup></table></tables><tables id="tabl0006" num="0006"><table frame="all"><title>Table 4B</title><tgroup cols="6"><colspec colnum="1" colname="col1" colwidth="15mm" /><colspec colnum="2" colname="col2" colwidth="32mm" /><colspec colnum="3" colname="col3" colwidth="31mm" /><colspec colnum="4" colname="col4" colwidth="37mm" /><colspec colnum="5" colname="col5" colwidth="28mm" /><colspec colnum="6" colname="col6" colwidth="21mm" /><thead><row><entry namest="col1" nameend="col6" align="center" valign="top">Ratios</entry></row><row><entry valign="top">Strain</entry><entry valign="top"><i>rrs</i>H Avg./ <i>ga</i>/P Avg.</entry><entry valign="top"><i>rrs</i>H Avg./ <i>g</i>/<i>k</i> Avg.</entry><entry valign="top"><i>ga</i>/P-K Avg./ <i>g</i>/<i>k</i>-F Avg.</entry><entry valign="top"><i>ga</i>/P-K'/ <i>ga</i>/P-F'</entry><entry valign="top"><i>g</i>/<i>k</i>-K/ <i>g</i>/<i>k</i>-F</entry></row></thead><tbody><row><entry>KLGG</entry><entry align="char" char=".">0.63</entry><entry align="char" char=".">0.63</entry><entry align="char" char=".">1.0</entry><entry>1.04</entry><entry>1.18</entry></row><row><entry>FMP</entry><entry align="char" char=".">0.66</entry><entry align="char" char=".">0.75</entry><entry align="char" char=".">0.88</entry><entry /><entry /></row></tbody></tgroup></table></tables>

0188Sequence analysis was done on the KLGG and FMP <i>glk</i> gene and the <i>trc</i> promoter. No mutations were found in the glk coding sequence of FMP. The sequence of the <i>trc</i> promoter was determined by amplification by PCR from the chromosome of KLGG and FMP using glkB1/glkBC11 primers. Sequencing was also performed using the primer <i>Trc</i>F (SEQ ID NO. 14) 5' GCTGTGCAGGTCGTAAATCACTGCATAATT 3'

0189A single mutation from G to A was identified in the lac operator of the <i>trc</i> promoter in FMP as indicated below. TGGAATTGTGAGCGGATAACAATT: wild type lac operator (KLGG) (SEQ ID NO. 15) TGGAATTGTGAACGGATAACAATT: lac operator (FMP) (SEQ ID NO. 16)

0190This mutation has been previously described (<nplcit id="ncit0132" npl-type="b"><text>THE OPERON, Miller, JH and Reznikoff, WS eds., 1980, p190-192</text></nplcit> and references therein) as one of the O^c operator constitutive mutations which increases expression of the linked gene(s) and decreases the affinity of the operator for the lac repressor. This effectively would increase the transcription of <i>glk</i> from the promoter and this was demonstrated by the increase in enzyme activity. The variant strain grows faster because there is more glucokinase to phosphorylate the incoming glucose and more G-6-P will be delivered into central metabolism.

Assays for glucokinase were done under the following conditions:

0191100 mM Phosphate Buffer pH 7.2, 5 mM MgCl₂, 500 mM NADP, 5 mM ATP, 2 Units of Glucose-6-Phosphate Dehydrogenase. This assay detects the conversion of glucose and ATP to glucose-6-phosphate by monitoring the appearance of NADPH₂ in the following scheme: <ul id="ul0001" list-style="none" compact="compact"><li>Glucose + ATP → Glucose-6-phosphate + ADP</li><li>Glucose-6-phosphate + NADP +2H → Glucono-1,5-lactone-6-phosphate + NADPH₂</li></ul>

0192<u>Light Cycler Determination of relative levels of mRNA of <i>gal</i>P, <i>glk</i> and the 16S rRNA gene (<i>rrsH</i>) as a control in shake flask experiments. -</u> The strains KLGG and FMP were grown in 10 mls of TM2 +2% glucose to an OD₆₀₀ of 20. The cultures were poured directly into liquid nitrogen in a 50 ml conical tube and RNA was purified as described below. The following primers were used: <ul id="ul0002" list-style="none" compact="compact"><li>For <i>gal</i>P GalP-R1 5' GTGTCTTCTTCCTGCCAGAC 3' (SEQ ID NO. 17) GalP-F1 5' CCTGCAACAGTACGCCAAG 3' (SEQ ID NO. 18)</li><li>For <i>glk</i> Glk-R1 5' CATCTGGTCCATGTCGATAAGC 3' (SEQ ID NO. 19) Glk-F1 5' GCGGTTGTCAGCTTTCACAA 3'(SEQ ID NO. 20)</li><li>For <i>rrs</i>H rrsH-F1 5' AGCTGGTCTGAGAGGATG 3' (SEQ ID NO. 21) rrsH-R1 5' AATTCCGATTAACGCTTGC 3' (SE ID NO. 22)</li></ul> The light cycler reactions were made according to the manufacturer's protocol using Lightcycler RNA Amplication Kit SYBR Green I (Roche) adjusted for 10 µl reactions. A total of 500 ng of RNA were used per reaction. The program used was: target temperature 55°C; incubation time 10 min., and temperature transition rate 20°C/sec.

0193The RNA isolation procedure included growing a strain in a shake flask under appropriate conditions as specified in example 4 above and harvesting by pipeting 7 to 10 mls directly into liquid nitrogen in 50 ml conical tubes. The samples were frozen at -70°C until ready for use. In general, standard procedures were used for RNA isolation with the following initial adjustments: 50 ml tubes of frozen sample were placed in a dry ice bucket; 15 ml of phenol:chloroform (1:1) and 1.5 ml of 3M NaOAc pH 4.8 were added to each 50 ml tube; a small amount of the frozen sample (ca 500 to 2000 µl of broth) was added to a prechilled (with dry ice) coffee grinder; additional dry ice (2 or 3 small pieces) was added to the coffee grinder and samples were ground for at least 1 min; the grinder was tapped to get all material into the grinder cap, and the cap, which contained the frozen ground cell broth and residual dry ice, was removed; an equal amount of 2X RNA extraction buffer was quickly pipetted into the cap; frozen material was stirred into a slurry using a disposable sterile loop and then placed into conical tubes containing 15 ml phenol:chloroform/NaOAc; mixed and placed on ice. Standard procedures known in the art were then followed. (Sambrook et al., <i>supra</i>).