Dimer of a peptide derived from the C-terminal sequence of human superoxide dismutase facilitating the penetration of a substance into cells and/or cell nuclei

0001The present invention relates to an amino acid sequence having the capacity to facilitate the penetration of a substance of interest inside cells and / or cell nuclei.

0002Having the tools to efficiently transfer substances of interest from the outside to the inside of cells, and more particularly cell nuclei, is a considerable asset in the field of biotechnology, and particularly to produce proteins, or peptides, to regulate gene expression, or to analyze and screen intracellular signaling pathways, or to analyze the properties of a given substance on said cell.

0003Another important application of such tools relates to the field of gene therapy since, until now, the various methods of gene therapy come up against the same need, which is not optimally satisfied, which is to be able to have vectors capable of transferring into the cytoplasm and / or the nucleus of the cells of the host organism to be treated with biologically active principles, without, however, altering either the host genome, nor the biological properties of said active ingredients transferred.

0004Several techniques have so far been developed for transferring DNA into cells, but none is really satisfactory. One of them, derived from the Mandel and Higa technique, based on the acquisition by E. coli of the susceptibility to transformation by treatment with CaCl₂ consists in coprecipitating the DNA with calcium phosphate or DEA-dextran, and in introducing the precipitate obtained directly into the cell or the nucleus. This method, in addition to being toxic, is not selective.

0005Another method of direct introduction of DNA, electroporation, consists in subjecting the cells to a brief electric shock of a few thousand volts, which allows DNA to pass through the cytoplasmic membrane and to enter the cell. This method is very toxic to cells, causing high mortality and great variability depending on the cells used.

0006Other methods use screening for the entry of the gene into cells by receptors on their membranes. DNA can then enter the cell via either a specific ligand for these receptors, or antibodies specific for membrane constituents. The DNA-ligand complex thus enters the cell through an endocytosis process. This method is limited by the fact that there is a significant destruction of the complex used in the lysosomal vesicles. Several methods have been developed to overcome these drawbacks, but none is entirely satisfactory.

0007The patent <patcit id="pcit0001" dnum="US5635383A"><text>US No. 5,635,383</text></patcit> describes another type of complex vector, based on polylysine, for the transfer of nucleic acids into cells.

0008The patent <patcit id="pcit0002" dnum="US5521291A"><text>US No. 5,521,291</text></patcit> describes another method based on the use of a conjugate formed from a virus linked to a substance having a high affinity for DNA via an antibody. Such conjugates are of heavy use, and certain risks are linked to the use of viruses.

0009To try to overcome these drawbacks, it has been described in patent application no. <patcit id="pcit0003" dnum="WO9702840A"><text>WO 97/02840</text></patcit>, a process implemented <i>in vitro</i> which consists of using murine anti-DNA antibodies or their F (ab ') fragments₂ and Fab 'capable of penetrating inside living cells, as immunovectors for the intracytoplasmic and / or intranuclear transfer of biologically active substances. Although these vectors are very effective, their use can be complex in certain applications. In addition, the use of molecules of the size and complexity of the antibodies can represent a significant drawback in their handling and implementation.

0010In patent application no. <patcit id="pcit0004" dnum="WO9907414A"><text>WO 99/07414</text></patcit>, it has been described that it is possible to use <i>in vitro</i> peptides derived from murine anti-DNA antibodies, disclosed in the application <patcit id="pcit0005" dnum="WO9702840A"><text>WO 97/02840</text></patcit> cited above, as vectors for intracytoplasmic and intranuclear internalization of biologically active substances.

0011Although these murine peptide vectors are encoded by the germ line and do not carry a mutation, and therefore should be antigenically similar to those encountered in humans, the risk of an immune reaction in humans does not can be excluded.

0012Requirement <patcit id="pcit0006" dnum="WO9856938A"><text>WO 98/56938</text></patcit> describes the use of lipoproteins, in particular low and very low density lipoproteins, in the in vivo transfer of nucleic acid.

0013There is therefore a real need for peptides and amino acid sequences which overcomes the drawbacks described above, namely capable of being used as, or in, a vector for cellular internalization in humans and which would not present any of the risks. mentioned above.

0014It is known that a very large number of cellular regulations depend on the interactions between proteins and glycosaminoglycans (GAG) of the cell surface (1-6) [the figures in bold, between bibliographical appendix]. Such interactions occur, for example, in the control of hemostasis (7), in the proliferation of smooth muscle cells (8), in the expression of the activity of growth factors (9), in the expression lipolytic activity of enzymes (10), in the integrity of the extracellular matrix (11) and others. In a given system, these biological effects are due to the interaction of one or a limited number of proteins with GAGs on the cell surface. GAGs are constituents very conserved during evolution, present on the surface of all eukaryotic cells. GAGs are saccharide polymers; for example heparin is a polymer of the disaccharide (α-1, 4-2-iduronic acid → D-glucosamine and the chondroitins sulfates are polymers of the disaccharide N-acetyl chondrosine, containing a large number of sulfate groups and therefore negatively charged . The proteins which react specifically with GAGs all contain, in their sequence, one or more peptide segments which are responsible for the interaction of these proteins with GAGs. The length of these segments varies from one protein to another ranging from four to thirty amino acids. Almost all of these peptides are positively charged and contain a high number of basic amino acids, especially lysine and arginine. These amino acids have been shown to play a major role in the interaction of these proteins with GAGs (1-6).

0015Peptides binding to GAGs or more generally to aminoglycans, and in particular to heparin, heparan sulfate and chondroitin sulfates (peptides generally designated by PLH, for "peptide binding to heparin", even if the heparin is only an example of an aminoglycan) can be of origin that an example of an aminoglycan) can be of natural origin, like the peptides described above, or artificial. They can be used in their native or polymer form (dimer, trimer, etc.).

0016It has been found, unexpectedly, according to the present invention, that these peptides can be used as well <i>in vivo</i> that<i>in vitro</i> as agents for internalizing substances of interest in cells.

0017Indeed, implement <i>in vivo</i> a technique known in <i>in vitro</i> involves determining several parameters (bioavailability, immune reactions, etc.) which do not intervene during the tests <i>in vitro,</i> in an enclosed space. In addition, such a transfer of<i>in vitro</i> to the<i>in vivo</i> remains quite hazardous, due to the many potential interactions that may interfere with manipulation <i>in vivo</i> (immune reaction, side effects, blocking or inhibition of the active ingredients, rejection, etc.); therefore there is little expectation of reasonable success in an application<i>in vivo</i> of a technique <i>in vitro.</i>

0018Thus, according to a first aspect, the present invention relates to an amino acid sequence which has the capacity to facilitate the penetration of a substance of interest inside cells and / or cell nuclei, and which is characterized in that said sequence has less than 25 amino acids and consists of a dimer of a peptide derived from the C-terminal part of the sequence of human superoxide dismutase capable of reacting in vivo with heparin-type aminoglycans, chondroitin sulfates and their derivatives.

0019The research carried out within the framework of the present invention made it possible to demonstrate that the penetration of the peptides is completely inhibited by the incubation of the cells at 4 ° C. In addition, it is partially inhibited by inhibitors of cell metabolism such as sodium azide (ATPase inhibitor), genistein (tyrosine kinase and ATP binding inhibitor). The internalization mechanism of the peptides of the invention, and therefore of the substances of interest coupled to said peptides, is therefore energy dependent. The vectorization using the peptides of the invention is therefore remarkable in that it does not fall under a passive system but on the contrary is carried out via a receptor. The amino acid sequences according to the invention are therefore characterized, in addition to their ability to react<i>in vivo</i> with aminoglycans, aminoglycans sulfates, chondroitins and chondroitins sulfates, by their capacity to bind to a receptor of the cell membrane and to cross said cell membrane thanks to this receptor. Thus, the amino acid sequences of the invention are distinguished from peptide transporters of the prior art capable of crossing the cell membrane passively.

0020The peptides according to the invention are therefore remarkable in that they have the capacity to be able to cross cell membranes by an active mechanism, then to lodge in the cytoplasm and / or the nucleus of cells and thus allow to have available a vector whose use is not limited, when passing through the cell, by the size of the substances to be transported. In fact, the vectors of the invention are capable of transporting drugs, ranging from small chemical molecules (low molecular weight) to proteins or nucleic acids of plasmid type (high molecular weight). The use of these vectors thus opens up a new avenue of intracellular protein therapy or gene therapy. This particular penetration capacity of the vectors of the invention makes it possible to preferentially target the "drugs" in the cells, thus contributing to a potential reduction in the toxicity of the drugs and a potential increase in the efficacy index.

0021By "derivatives of heparin or of chondroitin sulfates" or by "aminoglycans of the type of heparin or of chondroitins sulfates", is meant any product or by-product as defined in the publications cited in references (1) to ( 3).

0022By "facilitating penetration" is meant to facilitate the passage, or the translocation, of a substance from the external medium into the intracellular medium, and very particularly into the cytoplasm and / or the nucleus of the cell. This penetration can be determined by various methods, such as for example a cell penetration test comprising a first stage of incubation of the amino acid sequence in the presence of cells in culture, followed by a stage of fixing and permeabilization of these cells, then a revelation of the presence of said amino acid sequence inside the cell. The revelation step can be carried out with another incubation in the presence of antibodies labeled and directed against said sequence, followed by detection in the cytoplasm or in the immediate vicinity of or even within the cell nucleus, of the immunological reaction between the sequence and the labeled antibody. The revelation can also be carried out by labeling an amino acid sequence according to the invention and by detecting the presence of said labeling in these cellular compartments. A cell penetration test has been described for example in patent application no. <patcit id="pcit0007" dnum="WO9702840A"><text>WO 97/02840</text></patcit> cited above.

0023By "substance of interest" means any product of interest, in particular, biological, pharmaceutical, diagnostic, tracing, or food. They may be nucleic acids (ribonucleic acid, deoxyribonucleic acid) which may be of various origins, and in particular human, viral, animal, eukaryotic or prokaryotic, vegetable, synthetic, etc., and which may have a variable size, ranging from the simple oligonucleotide to the genome or genome fragment. It can also be a viral genome or a plasmid. The substance can also be a protein, such as an enzyme, a hormone, a cytokine, an apolipoprotein, a growth factor, an antigen, an antibody, etc. It can also be a toxin, an antibiotic, an antiviral molecule or an immunomodulator.

0024In general, the substance of interest can be any active principle of medicament, whether it is a chemical, biochemical, natural or synthetic product. They can be small molecules, with a molecular weight of the order of 500 D or large molecules like proteins of several thousand daltons.

0025The substance of interest can be directly active or can be activated <i>in situ</i> by the amino acid sequence, by a separate agent, or by environmental conditions.

0026The invention extends its scope to associations of the amino acid sequence with a substance of interest as defined above.

0027In a preferred embodiment of the present invention, in order to mitigate the risks described above, the amino acid sequence is encoded by the germ line, and therefore does not carry any mutations (substitution, deletion, addition, etc.) .

0028In the present invention, an especially preferred amino acid sequence is derived from a protein synthesized by a human cell. Advantageously, said protein synthesized by a human cell is chosen from proteins which bind to aminoglycans of the heparin or chondroitin sulfate type.

0029Generally, the amino acid sequence includes a high number of basic amino acids, as is the case in lysine, arginine or histidine, for example.

0030"High number" means at least 3.

0031One type of preferred amino acid sequence, for the implementation of the present invention, consists of an olimer corresponding to one of the following formulas a) (XBBBXXBX)_not ; b) (XBBXBX)_not; c) (BBX_mYBBX_o)_not; d) (XBBXXBX)_not ; and e) (BXBB)_not ; in which :<ul id="ul0001" list-style="none" compact="compact"><li>B is a basic amino acid; X is a non-basic amino acid, preferably hydrophobic, such as alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, valine or also tyrosine; Y represents either a direct bond or 1 to 20 amino acids; m is an integer between 0 and 5; n = 2, preferably between 1 and 3; and o is an integer between 0 and 5.</li><li>Generally, amino acid sequences have less than 25 amino acids.</li></ul>

0032Advantageously, the amino acid sequences according to the invention comprise from 6 to 25 amino acids.

0033The preferred amino acid sequence for the implementation of the present invention is that identified by SEQ ID NO: 26, on the annexed list which forms part of the present description.

0034A particularly interesting amino acid sequence is the sequence SEQ ID NO: 1 <b>(not claimed),</b> insofar as (1) in at least dimeric state, it has the expected properties and (2) in monomeric or polymeric state, it confers, on another amino acid sequence to which it is coupled, said properties or considerably potentiates these properties when said sequence already possesses them. Similarly, the peptides designated HBP3 and (HBP3) 2, have this potentiating capacity.

0035The peptides as defined above are capable of transporting, inside the cells, molecules which are associated with them covalently or non-covalently, and are thus effective vectors for the intracellular transfer of the substances of interest.

0036The present invention demonstrates that the coupling of peptides as defined above with polypeptide vectors capable of penetrating inside the cells considerably increases the translocation power of these vectors.

0037The present invention also demonstrates that the coupling of peptides as defined above, or of their polymeric forms, with a ligand, whose function is to react with a receptor present on the cell membrane, considerably increases the capacity of this ligand. to attach to the cell membrane.

0038According to another of its aspects, the present invention relates to the use of the amino acid sequences defined above for the preparation of compositions intended for the transfer of substances of interest into cells. This capacity of the peptides of the invention is advantageous for allowing the transport of active substances through biological membranes and very particularly across the blood-brain, hematoretinal, intestinal, pulmonary barriers. The peptides of the invention have the advantage of being able to be used in administration forms suitable both for the active substance to which they are coupled and for the type of targeted cell, in particular those requiring the crossing of the above barriers.

0039In another embodiment, the present invention relates to the use of said amino acid sequences in a peptide vector. These vectors, due to the properties of said amino acid sequences, can be easily used for intracytoplasmic and intranuclear transfer in humans, without any risk for the latter, nor any degradation of the substance of interest coupled to the vector.

0040To achieve this goal, it is necessary in particular that a vector is capable of transporting relatively large quantities of molecules inside the cells and that it is not recognized as a foreign antigen by the human immune system.

0041Table 1 below indicates for several peptides of the invention their level of intracytoplasmic and / or intranuclear penetration coupled with a low molecular weight marker allowing their detection such as biotin or fluorescein (Marq) or a substance of interest organic (Subst).

0042The results reported in Table 1 are based on the experimental data reported below.<tables id="tabl0001" num="0001"><table frame="all"><title><u style="single">Table 1</u></title><tgroup cols="6"><colspec colnum="1" colname="col1" colwidth="17mm" /><colspec colnum="2" colname="col2" colwidth="21mm" /><colspec colnum="3" colname="col3" colwidth="19mm" /><colspec colnum="4" colname="col4" colwidth="19mm" /><colspec colnum="5" colname="col5" colwidth="15mm" /><colspec colnum="6" colname="col6" colwidth="15mm" /><thead><row><entry valign="top">Peptide</entry><entry align="center" valign="top">SEQ ID NO</entry><entry namest="col3" nameend="col4" align="center" valign="top">intracytoplasmic</entry><entry namest="col5" nameend="col6" align="center" valign="top">intranuclear</entry></row><row><entry valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top">Mark</entry><entry align="center" valign="top">Subst</entry><entry align="center" valign="top">Mark</entry><entry align="center" valign="top">Subst</entry></row></thead><tbody><row><entry>HBP1</entry><entry align="center">1</entry><entry align="center">+/-</entry><entry align="center">ND</entry><entry align="center">-</entry><entry align="center">-</entry></row><row><entry>(HBP1)₂</entry><entry align="center">2</entry><entry align="center">+/-</entry><entry align="center">+</entry><entry align="center">-</entry><entry align="center">-</entry></row><row><entry>(HBP1)₃</entry><entry align="center">3</entry><entry align="center">++</entry><entry align="center">++</entry><entry align="center">+/-</entry><entry align="center">+/-</entry></row><row><entry /><entry align="center">4</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">5</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">6</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">7</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">8</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">9</entry><entry /><entry /><entry /><entry /></row><row><entry /><entry align="center">10</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">11</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">12</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">13</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">14</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">15</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">16</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry>HBP4</entry><entry align="center">17</entry><entry align="center">+/-</entry><entry align="center">ND</entry><entry align="center">-</entry><entry align="center">-</entry></row><row><entry>HBP5</entry><entry align="center">18</entry><entry align="center">+/-</entry><entry align="center">ND</entry><entry align="center">-</entry><entry align="center">-</entry></row><row><entry>(HPB5)₂</entry><entry align="center">19</entry><entry align="center">+</entry><entry align="center">+</entry><entry align="center">-</entry><entry align="center">-</entry></row><row><entry>HBP2</entry><entry align="center">20</entry><entry align="center">+</entry><entry align="center">++</entry><entry align="center">-</entry><entry align="center">-</entry></row><row><entry>HBP6</entry><entry align="center">21</entry><entry align="center">+++</entry><entry align="center">+++</entry><entry align="center">+/-</entry><entry align="center">+/-</entry></row><row><entry /><entry align="center">22</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">23</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">24</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">25</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry>(HBP3)₂</entry><entry align="center">26</entry><entry align="center">+++</entry><entry align="center">+++</entry><entry align="center">+</entry><entry align="center">+</entry></row><row><entry /><entry align="center">27</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">28</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">29</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry>HBP7</entry><entry align="center">30</entry><entry align="center">+++</entry><entry align="center">+++</entry><entry align="center">+</entry><entry align="center">+/-</entry></row><row><entry /><entry align="center">31</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry /><entry align="center">32</entry><entry align="center" /><entry align="center" /><entry align="center" /><entry align="center" /></row><row><entry>HBP8</entry><entry align="center">33</entry><entry align="center">+/-</entry><entry align="center">+/-</entry><entry align="center">-</entry><entry align="center">-</entry></row><row><entry>HBP9</entry><entry align="center">34</entry><entry align="center">+/-</entry><entry align="center">+/-</entry><entry align="center">-</entry><entry align="center">-</entry></row><row><entry>HBP10</entry><entry align="center">35</entry><entry align="center">+/-</entry><entry align="center">+/-</entry><entry align="center">++</entry><entry align="center">++</entry></row><row><entry>HBP11</entry><entry align="center">36</entry><entry align="center">++</entry><entry align="center">++</entry><entry align="center">+/-</entry><entry align="center">+/-</entry></row><row><entry>HBP12</entry><entry align="center">37</entry><entry align="center">+/-</entry><entry align="center">+/-</entry><entry align="center">-</entry><entry align="center">-</entry></row><row><entry>HBP13</entry><entry align="center">38</entry><entry align="center">++</entry><entry align="center">++</entry><entry align="center">+/-</entry><entry align="center">+/-</entry></row><row><entry>HBP15</entry><entry align="center">39</entry><entry align="center">+/-</entry><entry align="center">+</entry><entry align="center">+++</entry><entry align="center">+++</entry></row></tbody></tgroup></table></tables>

0043These results indicate that the peptides which are capable of massive nuclear translocation are those whose positive charge is mainly constituted by the presence of arginine and the almost total absence of lysine.

0044A first group of peptides comprises the amino acid sequences capable of permitting the penetration of a substance of interest into the cell but little or not into the nucleus. By way of example, mention may be made of peptides of sequence SEQ ID NO: 2, 3, 17, 18, 19, 20, 21, 33, 34, 37 and 38.

0045A second group of peptides, that of the present invention, comprises the amino acid sequences capable of permitting the penetration of a substance of interest into the cell and into the nucleus of the cell. By way of example, mention may be made of the peptide of sequences SEQ ID NO: 26.

0046A vector according to the present invention is characterized in that it consists of, or comprises, an amino acid sequence as defined above.

0047As a variant, the vector is based on the coupling, on the one hand, of amino acid sequences reacting with aminoglycans and, on the other hand, of new peptides originating from the variable part of human anti-DNA antibodies. The coupling within the same molecule of amino acid sequences reacting with aminoglycans and of peptides derived from the variable parts of human anti-DNA antibodies results in the preparation of a peptide vector which is particularly effective for translocation and intracellular transfer of substances of interest, especially when the amino acid sequences reacting with aminoglycans are of human origin.

0048This association, moreover, gives rise to a translocation and transfer vector which is particularly suitable for use in humans. Indeed, as indicated above, although the peptide vectors of murine origin known from<patcit id="pcit0008" dnum="WO9702840A"><text>WO 97/02840</text></patcit> are encoded by the germ line and do not carry mutations, and therefore should be antigenically close to those encountered in humans, their injection in humans may induce an immune reaction. The peptide vector formed from the PLH according to the present invention and from peptides derived from anti-DNA antibodies, both of human origin, encoded by the germ line and not carrying mutations, avoids this problem.

0049The general characteristics of these peptides derived from human anti-DNA antibodies are close to those of the peptides of murine origin described in the patent application. <patcit id="pcit0009" dnum="WO9907414A"><text>WO 99/07414</text></patcit>, while possessing additional properties which distinguish them from the latter, namely:<ol id="ol0001" compact="compact"><li>1) they require, to penetrate inside the cells, an active metabolism of the cells (culture temperature of between 25 and 39 ° C, and preferably 37 ° C), while the murine peptides are much less dependent;</li><li>2) they react much less strongly with DNA than murine vectors;</li><li>3) their penetration capacity is not significantly influenced by the molecule they will transport inside the cell;</li><li>4) they penetrate cells of human origin better than those of other origins.</li></ol>

0050A vector consisting of a PLH and one or more antibody fragments, preferably polyreactive, and more particularly one or more fragments from the hypervariable regions of the antibodies has been produced according to the present invention. Preferably, the vector which is the subject of the invention is characterized in that it comprises a fragment of the heavy chain of an antibody.

0051In the patent application <patcit id="pcit0010" dnum="WO9907414A"><text>WO 99/07414</text></patcit> above, only fragments of a monoclonal IgG, which is a small, low molecular weight monomeric immunoglobulin, have been used. The present invention demonstrates for the first time that it is also possible to use a fragment derived from an IgM, which is a pentamer immunoglobulin, of very high molecular weight. Indeed, until now, to the knowledge of the applicant, no one had carried out research on the use of an IgM fragment as a vector for cellular internalization, because of the dissuasive nature of the large size and the high molecular weight of such fragments.

0052The present invention therefore relates to a cell internalization vector, characterized in that it comprises one or more PLH and one or more fragments of an IgM, or of an IgG.

0053Preferably, said vector comprises all or part of the CDR2 region of an antibody. Alternatively, said vector comprises all or part of the CDR3 region of an antibody. More particularly, said vector contains at least one CDR3 region of an anti-human DNA antibody, selected from the group consisting of RTT79, NE-1, and RT72.

0054In another variant, the vector object of the present invention can also comprise all or part of the CDR2 region, and all or part of the CDR3 region.

0055By "all or part" it should be understood that the vector of the invention can comprise either the whole of the CDR region concerned, or only a part of it, provided that the vector retains the capacity to penetrate cells (functional counterpart). By "part of CDR region" is meant a CDR region devoid of one or more terminal amino acids. It can also be a CDR region in which one or more internal residues have been deleted or substituted by other amino acids, preferably amino acids of the same nature (basic amino acids, for example).

0056Some of the examples given in this patent application are based on the use of SEQ ID NO: 1 from human lipoprotein B but, for those skilled in the art, it is obvious that any natural or artificial PLH can be used.

0057As indicated above, a vector according to the present invention is particularly well suited for the transport and the intracellular and intranuclear transfer of substances of interest.

0058The present invention therefore aims to provide a vector as described above, characterized in that it comprises a substance of interest naturally, or not naturally, which can be incorporated into the cells and / or the nuclei of said cells.

0059More particularly, the present invention relates to a vector whose penetration capacity is substantially independent of the nature of the substance of interest which is coupled to it. This characteristic, specific to these human vectors by comparison with murine vectors, is of capital interest for the envisaged use of these vectors. But the invention is also interested in vectors which are adapted to the substance of interest which is coupled to it.

0060The term "coupling" means any type of interaction allowing a physical association between the substance of interest and the vector. It can be a cleavable or non-cleavable coupling depending on the biological medium and / or the substance of interest transported by the peptides of the invention or alternatively cleavable by physical means applied to the organism to which administered the vector coupled to the active substance. Thus, the expression of the biological effect of the substance may require that it be released from the vector. As an example of a substance of interest which it is preferable for it to be released from the vector, mention may be made of doxorubicin.

0061However, the interaction must be strong enough so that the vector does not dissociate before or during cell penetration. For this reason, the preferred coupling according to the invention is covalent coupling, it could however be a non-covalent coupling. The substance of interest can be coupled directly to the peptide either at one of these terminal ends or at the level of a side chain of one of the amino acids. The substance of interest can also be coupled indirectly via a linker either at one of the terminal ends of the peptides or at the level of a side chain of one of the amino acids.

0062The coupling can be carried out by any chemical, biochemical or enzymatic or genetic coupling process known to those skilled in the art, but it will generally be preferred to use a homo- or heterofunctional bridging reagent of the 4- (N-maleimidomethyl) cyclohexane-1 type. -succinimidylcarboxylate (SMCC). Mention may also be made, as coupling means, of those chosen from: bi or multifunctional agents containing alkyl, aryl, aralkyl or peptide groups, esters, aldehydes or alkyl, aryl or aralkyl acids, anhydride, sulfhydrile, or carboxyl groups such as derivatives of maleymil benzoic acid, maleymil propionic acid and succynimidyl derivatives, groups derived from bromide or cianogen chloride, carbonyldiimidazole, succinimide esters or sulphonic halides.

0063In another embodiment of the present invention, the coupling of said substance of interest can also be carried out by any genetic engineering technique known to those skilled in the art. By "genetic engineering" is meant the use of an expression vector in which the DNA coding for the vector peptides is cloned in phase 5 'and / or 3' from the DNA complementary to the gene for interest. The expression of the fusion protein is placed under the control of a promoter. The expression system can be used in a prokaryotic or eukaryotic host cell for the production of the fusion protein.

0064In a first embodiment, the coupling of said substance of interest is carried out at the N-terminal end of the amino acid sequence according to the invention. In a second embodiment of the invention, the coupling of said substance of interest is carried out at the C-terminal end of said sequence.

0065Surprisingly, it has been shown that the vector which is the subject of the invention is capable of potentiating the biological activity and, potentially, of reducing the toxicity of said coupled substance. The present invention therefore also relates to a vector characterized in that it makes it possible to increase the biological activity of the substance of interest to which it is coupled.

0066It has also been shown that the vector object of the invention allows transfection <i>in vitro</i> cells.

0067In a particular embodiment of the invention, the vector is coupled to the substance of interest via at least one molecule (called "anchor molecule") having a strong natural affinity for the substance d interest in internalizing. The natural affinity of the anchor molecule for the substance of interest allows the transporter to interact, in a non-covalent manner, with said substance of interest, and thus to entrain it during intracellular displacements.

0068Another particularly advantageous advantage of this type of transporter consists in that, due to the natural affinity of the anchoring molecule for the substance of interest, the coupling between these two elements takes place in a completely natural manner, without any chemical or biochemical interaction.

0069This type of transporter is particularly advantageous in the case where the substance of interest, by its size and / or its structure, proves difficult to couple directly to the amino acid sequence. This type of transporter can also prove to be particularly useful when the substance of interest is not very stable, and any chemical interaction for its coupling could deteriorate it, or modify its activity.

0070In addition, the transporter according to the invention may not be specific for a single substance of interest, but may on the contrary allow the internalization in cells and / or cell nuclei of several different substances of interest.

0071The invention also relates to eukaryotic cells which contain an amino acid sequence according to the present invention. It also relates to eukaryotic cells which contain a vector and / or a transporter according to the invention. It also relates to any type of eukaryotic cell which has been transfected with a vector and / or transporter according to the present invention.

0072The invention also relates to a transfer method <i>in vitro</i> of a substance of interest inside a cell, and of increasing the biological activity of said substances of interest which comprises the following steps:<ol id="ol0002" compact="compact"><li>a) coupling the substance to an amino acid sequence, to a vector, or to a transporter in accordance with the invention, as described above, and</li><li>b) incubating the cell with said coupling product at a culture temperature allowing active metabolism of said cell.</li></ol>

0073Such a temperature is between 25 and 39 ° C, preferably 37 ° C.

0074The present invention also relates to a composition comprising, as active principle, either vectors or transporters loaded with at least one substance of interest in accordance with the present invention, or eukaryotic cells which have been transfected in accordance with the present invention. It also relates to the use of such compositions for the formulation and preparation of biological, pharmaceutical, cosmetic and agro-food products.

0075The invention extends its scope to the basic or pharmaceutically acceptable acid addition salts, hydrates, esters, solvates, precursors, metabolites or stereoisomers, of said vectors and transporters loaded with at least one substance of interest. The invention also extends its scope to pharmaceutical formulations comprising a vector or a transporter loaded with at least one substance of interest in association with a pharmaceutically acceptable vehicle, diluent or excipient.

0076The expression "pharmaceutically acceptable salts" refers to the non-toxic salts of the amino acid sequences according to the invention which can generally be prepared by reacting the free base with a suitable organic or inorganic acid. These salts retain the biological efficiency and the properties of the free bases. As representative examples of such salts, mention may be made of water-soluble and water-insoluble salts, such as acetates, ansonates (4,4-diaminostilbene-2,2'-disulfonates), benzenesulfonates, benzonates, bicarbonates, bisulfates, bitartrates, borates, bromides , buryrates, calcium edetates, camsylates, carbonates, chlorides, citrates, clavulariates, dihydrochlorides, edetates, edisylates, estolates, esylates, fumarates, gluceptates, gluconates, glutamates, glycolylarsanylates, hexafluorophosphates, hexylresorcinates, hydrabamines, hydrobromides, hydrochlorides, hydroxynaphtoates, iodides, isothionates, lactates, lactobionates, laurates, malates, maleates, mandelates, mesylates, methylbromides, methylnitrates, methylsulphates, nitrates -napsyl oleates, oxalates, palmitates, pamoates (1,1-methylene-bis-2-hydroxy-3-naphthoates, emboates), pantothenates, phosphates / diphosphates, picrates, polygalacturonates, propionates, p-toluenesulfonates, salicylates, stearates, subacetates, succinates, sulfates, sulfosalicylates, suramates, tannates, tartrates, teoclates, tosylates, triethiodides, valerates and N-methylglucamine ammonium salts.

0077A subject can be treated with a pharmaceutically effective amount of a peptide, a vector or a transporter according to the invention, loaded with at least one substance of interest. The expression "pharmaceutically effective amount" means an amount capable of causing enough substance of interest to penetrate the biological or medical response of a tissue, system, animal or human as expected by the researcher or the attending physician.

0078The invention also relates to pharmaceutical compositions suitable for the introduction of a substance of interest into a cell or a cell nucleus. The compositions comprise an effective amount of a vector or transporter according to the invention, loaded with at least one substance of interest, alone or in combination with one or more pharmaceutically acceptable carriers. The compositions are particularly useful in that they have very low toxicity, or are not toxic.

0079The administration of the vectors or transporters according to the invention, or of their salts, loaded with at least one substance of interest, can be done by any of the modes of administration accepted for therapeutic agents. These methods include systemic administration, for example oral, nasal, parenteral, or topical administration, for example transdermal, or even central administration, for example intracranially, or even intraoccular administration.

0080Oral administration can be by means of tablets, capsules, soft capsules (including delayed or prolonged-release formulations), pills, powders, granules, elixirs, tinctures, suspensions, syrups and emulsions. This form of presentation is more particularly adapted to the passage of the intestinal barrier.

0081Parenteral administration is generally by subcutaneous, intramuscular or intravenous injection or by infusion. The injectable compositions can be prepared in conventional forms, either in suspension or liquid solution or in solid form suitable for extemporaneous dissolution in a liquid. This form of presentation is more particularly adapted to the passage of the blood-brain barrier.

0082One possibility for parenteral administration uses the implantation of a slow-release or prolonged-release system which ensures the maintenance of a constant level of dose, for example, according to <patcit id="pcit0011" dnum="US3710795A"><text>US-A-3,710,795</text></patcit>.

0083For intranasal administration, suitable intranasal vehicles can be used.

0084For transdermal administration, transdermal skin patches well known to those skilled in the art can be used. A transdermal release system allows continuous administration.

0085Other preferred topical preparations include creams, ointments, lotions, aerosol sprays and gels.

0086Depending on the intended mode of administration, the compounds can be in solid, semi-solid or liquid form.

0087For solid compositions, such as tablets, pills, powders or granules in the free state or included in capsules, the active principle can be combined with: a) diluents, for example lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine; b) lubricants, for example silica, talc, stearic acid, its magnesium or calcium salt and / or polyethylene glycol; c) binders, for example magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidone; if appropriate, d) disintegrants, for example starch, agar, alginic acid or its sodium salt, or effervescent mixtures; and / or e) absorbents, colors, flavors and sweeteners. The excipients can be, for example, mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate and the like in pharmaceutical grade.

0088For semi-solid compositions, such as suppositories, the excipient may, for example, be a fatty emulsion or suspension, or based on polyalkylene glycol, such as polypropylene glycol.

0089Liquid compositions, in particular injectable or to be included in a soft capsule, can be prepared for example by dissolution, dispersion, etc. of the active ingredient in a pharmaceutically pure solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, an oil and the like.

0090The vectors or transporters according to the invention, loaded with at least one substance of interest, can also be administered in the form of delivery systems of the liposome type, such as in the form of small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, containing cholesterol, stearylamine or phosphatidylcholines. In one embodiment, a film of liquid components can be hydrated with an aqueous solution of the drug to form a lipid layer encapsulating the drug, as described in <patcit id="pcit0012" dnum="US5262564A"><text>US-A-5,262,564</text></patcit>.

0091The compositions according to the invention can be sterilized and / or contain non-toxic adjuvants and auxiliary substances such as preserving, stabilizing, wetting or emulsifying agents, agents promoting dissolution, salts for regulating the osmotic pressure. and / or pads. In addition, they may also contain other substances of therapeutic interest. The compositions are prepared, respectively, by conventional methods of mixing, granulation or coating and they contain from approximately 0.1 to 75%, preferably from approximately 1 to 50%, of active principle.

0092The vectors or transporters according to the invention, loaded with at least one substance of interest, can also be coupled with soluble polymers such as targetable drug carriers. Such polymers may include polyvinylpyrrolidone, the pyran copolymer, polyhydroxypropyl-methacrylamide-phenol, polyhydroxy-ethyl-aspanamide-phenol or poly (ethylene oxide) -polylysine substituted with palmitoyl residues. In addition, the compounds according to the present invention can be coupled to a class of biodegradable polymers useful for achieving controlled release of a drug, for example, poly (lactic acid), poly (epsilon-caprolactone), poly ( hydroxybutyric acid), polyorthoesters, polyacetals, polydihydropyranes, polycyanoacrylates and crosslinked or amphipatic block hydrogel copolymers.

0093The dosage for the administration of the vectors or transporters according to the invention, loaded with at least one substance of interest, is chosen according to a variety of factors including the type, species, age, weight, sex and the medical condition of the subject; the severity of the condition to be treated; the route of administration; the state of the renal and hepatic functions of the subject and the nature of the particular compound, or salt, used. A normally experienced doctor or veterinarian will readily determine, and prescribe, the effective amount of the carrier or carrier loaded with the substance of interest desired to prevent, counteract or halt the progress of the medical condition to be treated.

0094Any of the above pharmaceutical compositions can contain from 0.1 to 99%, preferably 1 to 70% of active ingredient.

0095By way of examples, the oral dosages of the vectors or transporters according to the invention, loaded with at least one substance of interest, when they are used for the indicated effects, will be between approximately 0.05 and 1,000 mg / day orally and preferably supplied in the form of tablets containing 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100.0, 250.0, 500.0 and 1,000.0 mg of active ingredient. The effective plasma levels of the vectors or transporters loaded with at least one substance of interest will be in the range of 0.002 mg to 50 mg per kg of body weight per day.

0096The vectors or transporters according to the invention, loaded with at least one substance of interest, can be administered in the form of single daily doses, or the total daily dosage can be administered in two, three or four doses per day.

0097In a particular application, the present invention relates to a diagnostic agent, for implementation <i>in vitro,</i> consisting of or enclosing at least one vector, a transporter and / or a cell in accordance with the invention. Such a diagnostic agent can also be used<i>in vivo</i>.

0098The present invention therefore also relates to a diagnostic kit which comprises said diagnostic agent. More particularly, the diagnostic kit comprises, in one or more containers, a predetermined quantity of a composition according to the invention.

0099Likewise, the amino acid sequence according to the invention, or a vector and / or a transporter containing this amino acid sequence, or cells transfected using said vector can be used. <i>in vivo</i> for preventive purposes, for example and without limitation, for the prevention of viral infections , metastases, cell apoptosis (degenerative diseases, tissue ischemia, etc.), or for therapeutic purposes, for example treatment infectious diseases (viral, bacterial ...), cancer and pathological neo-angiogenesis.

0100Other advantages and characteristics of the invention will appear from the following exemplary embodiments with reference to the appended drawings.

I -

MATERIAL AND METHOD.

1)

Cell lines.

at)

Normal cells:

0101<ul id="ul0002" list-style="dash" compact="compact"><li>PtK2, kangaroo rat kidney fibroblasts</li><li>3T3, mouse embryo fibroblasts</li><li>HUVEC, human endothelial cells</li><li>CHO, Chinese hamster ovary cells</li><li>HUVEC, endothelial cells transfected with a cell multiplication gene</li><li>CHO, hamster kidney cells</li><li>CHO-745, cells of the CHO line defective for the synthesis of xylosyltransferase.</li></ul>

b)

Tumor cells.

0102<ul id="ul0003" list-style="dash" compact="compact"><li>H1299, human lung carcinoma</li><li>HH9, human breast tumor epithelial cells transfected with a gene encoding a growth factor</li><li>MCF7, human tumor epithelial cells</li><li>MCF7 ras, MCF7 cells transfected with the ras gene</li><li>HeLa, human cervical carcinoma</li><li>HCT 116, human colon carcinoma</li><li>HT-29, human colon adenocarcinoma</li><li>LS174T, human colon adenocarcinoma</li><li>B16-F10, murine melanoma cells</li><li>Daudi, human Burkitt lymphoma</li></ul>

vs)

Culture of cells:

0103<ul id="ul0004" list-style="dash" compact="compact"><li>The cells are cultured in DMEM medium containing 2% L-glutamine, 1% sodium pyruvate, penicillin (100 U / ml), streptomycin (100 µg / ml) and 10% fetal calf serum (medium complete) at 37 ° C in the presence of 5% CO₂.</li><li>CHO and CHO-745 cells are grown in MEM alpha medium containing 2% L-glutamine, 1% sodium pyruvate, penicillin (100 U / ml), streptomycin (100µg / ml) and 6% calf serum fetal (complete medium) at 37 ° C in the presence of 5% CO2</li></ul>

2)

Preparation of peptides.

at)

Chemical synthesis.

0104The peptide syntheses were carried out according to techniques known to those skilled in the art (Altergen and Neosystem). They are implemented in solid phase on Fmoc resin. The cleavage is carried out with trifluoroacetic acid (TFA) and the peptides were purified on a semi-preparative HPLC-CR C5 column and eluted with a 0.1% TFA solution and an acetonitrile gradient (10-70% ) in the TFA. The lyophilized peptides were dissolved in 0.15 M NaCl.

b)

Molecular construction allowing the preparation of proteins comprising peptides of the invention.

0105Molecular biology techniques make it possible to construct plasmids which, once introduced into suitable cells, allow the synthesis of vectorized macromolecules.

-

Construction of expression vectors for recombinant proteins:

0106FIG. 10 in the appendix represents the preparation of vectors allowing the expression of recombinant proteins containing the peptide sequences of the invention. The prokaryotic vector pQE30 (Qiagen) allows the expression of genes in the form of fusion proteins (or recombinant proteins) with the sequence 6XHis. This vector carries the origin of replication ColE1, the strong promoter of phage T5 inducible by IPTG, the gene for β-lactamase conferring resistance to ampicillin and a multiple cloning site 3 'to the coding sequence l 6XHis tag allowing the cloning of a complementary DNA in phase with the 6Xhis sequence.

0107The 63-mer complementary oligonucleotides:<ul id="ul0005" list-style="none" compact="compact"><li>. PAV1U: 5'gatccgtaaaacgaggactaaaactacgacacgtacgaccacgag taacacgaatggacgtaa 3 '</li><li>. PAV1L: 5'gatcttacgtccattcgtgttactcgtggtcgtacgtgtcgtagt tttagtcctcgttttacg-3 '</li></ul>are hybridized. The DNA segment obtained has a 5 'BamHI site and a 3' BglII site. It codes (bold characters) for the PAV1 peptide sequence: VKRGLKLRHVRPRVTRMDV. This fragment is cloned at the BamHI site of the vector pQE30. The complementary DNAs (cDNAs) encoding the Zebra viral protein (BZLF1) of the Epstein-Barr virus (EBV) or the Zebra protein deleted from its nuclear localization domain (nls) of 35 amino acids were obtained by PCR. They were cloned at the BamHI site of the His-PAV1 or pQE30 vector. The resulting plasmids allow the expression of recombinant His proteins₆-Zebra-PAV1, His₆-ZebraΔn1s-PAV1, His₆ - Zebra and His₆-ZebraΔn1s after transformation of E. coli bacteria.

-

Induction, extraction and purification of recombinant proteins

0108The production of the recombinant proteins is induced at 37 ° C by addition of IPTG (isopropyl-β-D-thiogalactopyranoside) at 1 mM to the bacterial cultures in exponential growth phase in Luria Bertani medium supplemented with 40 μg / ml of ampicillin. 12 hours after addition of IPTG, the bacteria are centrifuged at 5700 g for 15 min. at 4 ° C. The bacterial pellet is taken up in 5 volumes of denaturing lysis buffer (20 mM Tris-HCl pH7.8; 0.5M NaCl; 10% glycerol; 6M Guanidine-HCl). After an incubation of 20 min. at room temperature with slow stirring, the lysate is clarified by centrifugation for 30 min. at 15000g at 4 ° C. The supernatant containing the recombinant protein is stored at -80 ° C.

0109The 6XHis recombinant proteins are purified by affinity chromatography on a column of "TALON" resin (CLONTECH) previously equilibrated with denaturing lysis buffer. After 3 successive washes of the resin with 10 volumes of denaturing lysis buffer containing 10 mM of imidazole, the recombinant protein bound to the column is renatured by a gradient of 6 to 0 M of Guanidine-HCl in 20 mM Tris-HCl buffer pH7 .8; 0.5M NaCl; 10% glycerol; 0.5 mM PMSF. The recombinant protein is eluted by a gradient from 20 mM to 1 M imidazole pH 8.0. The different eluates are analyzed on a 12% SDS-Acrylamide denaturing gel. The fractions containing the purified protein are combined and dialyzed for 2 hours at 4 ° C. against the 20 mM HEPES pH 7.5 buffer, 150 mM NaCl. The protein is concentrated, aliquoted and quickly frozen in liquid nitrogen and stored at -80 ° C.

3)

Peptides used.

at)

Non-functionalized peptides.

0110The following sequences (SEQ ID NO: 1 to SEQ ID NO: 48) are listed in the appendix, in accordance with standard ST-25.

0111SEQ ID NO: 1. Peptide reacting with heparin and derived from the amino acid sequence (3358-3372) of human lipoprotein B (12), also referred to below as HBP1.

0112SEQ ID NO: 2. Peptide reacting with the heparin dimer of SEQ ID NO: 1, also designated below (HBP1) 2.

0113SEQ ID NO: 3. Peptide reacting with the trimeric heparin of SEQ ID NO: 1, also designated below (HBP1) 3.

0114SEQ ID NO: 4. Peptide corresponding to the hypervariable CDR3 region of the murine anti-DNA monoclonal antibody F4.1 (13).

0115SEQ ID NO: 5. Peptide containing SEQ ID NO: 1 and SEQ ID NO: 4.

0116SEQ ID NO: 6. Peptide containing part of the CDR2 and CDR3 regions of the murine monoclonal antibody F4.1 (13).

0117SEQ ID NO: 7. Peptide containing SEQ ID NO: 1 and SEQ ID NO: 6.

0118SEQ ID NO: 8. Peptide corresponding to the CDR3 hypervariable region of the human anti-DNA monoclonal antibody RTT79 (14).

0119SEQ ID NO: 9. Peptide containing SEQ ID NO: 1 and SEQ ID NO: 8.

0120SEQ ID NO: 10. Peptide reacting with heparin and containing SEQ ID NO: 1 and the sequence of the peptide corresponding to the CDR3 hypervariable region of the human anti-DNA monoclonal antibody NE-1 (15), also designated below -after under No. 1047.

0121SEQ ID NO: 11. Peptide containing SEQ ID NO: 1 and the sequence of the peptide corresponding to the hypervariable region CDR3 of the human anti-DNA monoclonal antibody RT72 (16).

0122SEQ ID NO: 12. Peptide containing the NLS (nuclear localization signal) sequence of 3T3 cells and SEQ ID NO: 6.

0123SEQ ID NO: 13. Peptide containing SEQ ID NO: 1 and the sequence of the CDR2 and CDR3 regions of the human anti-DNA NE-1 monoclonal antibody.

0124SEQ ID NO: 14. Peptide containing part of the CDR3 region of the murine monoclonal antibody F4.1 and of SEQ ID NO: 6.

0125SEQ ID NO: 15. Peptide containing twice the sequence of the peptide corresponding to the CDR3 hypervariable region of the human anti-DNA NE-1 monoclonal antibody.

0126SEQ ID NO: 16. Peptide resulting from the inclusion, in position 13-19, of SEQ ID NO: 1 in SEQ ID NO: 15.

0127SEQ ID NO: 17. Peptide reacting with heparin derived from the amino acid sequence of human lipoprotein E (12), also designated HBP4.

0128SEQ ID NO: 18. Peptide reacting with heparin derived from the amino acid sequence of agrin (17), protein of the extracellular matrix which regulates the differentiation of the neuromuscular junction.

0129SEQ ID NO: 19. Dimer of SEQ ID NO: 18.

0130SEQ ID NO: 20. Peptide reacting with heparin derived from the amino acid sequence of "insulin growth factor binding protein" (18).

0131SEQ ID NO: 21. Peptide reacting with heparin and derived from the amino acid sequence of the C-terminal part of the A chain of platelet growth factor (19), also designated HPB6.

0132SEQ ID NO: 22. Peptide containing 12 lysines (K) and SEQ ID NO: 6.

0133SEQ ID NO: 23. Peptide containing 12 lysines (K) and SEQ ID NO: 5.

0134SEQ ID NO: 24. Peptide with antimicrobial activity (29).

0135SEQ ID NO: 25. Peptide reacting with heparin and corresponding to the sequence of “insulin-like growth factor-binding protein” (18), also referred to below as HBP2.

0136SEQ ID NO: 26. Peptide reacting with heparin and dimer of a peptide derived from the C-terminal part of the sequence of human superoxide dismutase (20), also designated below (BPH₃)₂.

0137SEQ ID NO: 27. Peptide reacting with heparin and corresponding to the sequence SEQ ID NO: 26 in which the amino acids are in configuration D.

0138SEQ ID NO: 28. Peptide reacting with heparin and whose sequence derives from the sequence SEQ ID NO: 26 and contains the RGD motif selectively binding the αv integrins (21).

0139SEQ ID NO: 29. Peptide reacting with heparin and consisting of the peptides of SEQ ID NO: 1 and SEQ ID NO: 17, also referred to below as HBP1-HBP4.

0140SEQ ID NO: 30. Peptide reacting with heparin and derived from the C-terminal part of the epidermal cell growth factor (EGF) sequence (22), also referred to below as HBP7.

0141SEQ ID NO: 31. Peptide reacting with heparin and corresponding to the peptide whose sequence is SEQ ID NO: 12 where the amino acids are in the duplex position.

0142SEQ ID NO: 32. Peptide reacting with heparin and corresponding to the sequence SEQ ID NO: 30 in which the amino acids are in configuration D.

0143SEQ ID NO: 33. Peptide reacting with heparin and containing part of the sequence of the acid growth factor (aFGF) of fibroblasts (6), also referred to below as HBP8.

0144SEQ ID NO: 34. Peptide reacting with heparin and containing part of the sequence of basic growth factor (bFGF) of fibroblasts, also referred to below as HBP9. (23).

0145SEQ ID NO: 35. Peptide reacting with heparin and corresponding to a C-terminal part of the sequence of intestinal mucins (24), also referred to below as HBP10.

0146SEQ ID NO: 36. Peptide reacting with heparin and containing part of the C-terminal sequence of human γ interferon (25), also referred to below as HBP11.

0147SEQ ID NO: 37. Peptide reacting with heparin and containing part of the sequence of the p40 subunit of human interleukin 12 (26), also referred to below as HBP12.

0148SEQ ID NO: 38. Peptide reacting with heparin and containing part of the factor 1α sequence derived from stromal cells (27), also referred to below as HBP13.

0149SEQ ID NO: 39. Peptide reacting with heparin and comprising a part of the sequence of the “heparin binding protein” (CAP37) (28), also referred to below as HBP15.

0150SEQ ID NO: 40. Peptide reacting with heparin corresponding to the peptide of sequence SEQ ID NO: 10 (1047) supplemented with 13 lysines at the N-terminal.

0151SEQ ID NO: 41. Peptide reacting with heparin corresponding to the peptide of sequence SEQ ID NO: 28 ((HBP3) 2) supplemented with 13 lysines at the N-terminal.

0152SEQ ID NO: 42. Peptide reacting with heparin corresponding to the peptide of sequence SEQ ID NO: 39 (HBP10) supplemented with 13 lysines at the N-terminal.

0153SEQ ID NO: 43. Peptide exhibiting antimicrobial activity and containing the peptides of sequences SEQ ID NO: 10 (1047) and SEQ ID NO: 24.

0154SEQ ID NO: 44. Peptide exhibiting antimicrobial activity and containing the peptides of sequences SEQ ID NO: 24 and SEQ ID NO: 30 (HBP7).

0155SEQ ID NO: 45. Peptide exhibiting antimicrobial activity and containing the peptides of sequences SEQ ID NO: 24 and SEQ ID NO: 38 (HBP13).

0156SEQ ID NO: 46. Peptide comprising the peptide of sequence SEQ ID NO: 26 (HBP₃)₂ added in N-terminal glycine-phthaloyl.

0157SEQ ID NO: 47. Peptide comprising the peptide of sequence SEQ ID NO: 21 (HBP6) added at the N-terminal of a salicylyl motif.

0158SEQ ID NO: 48. Peptide comprising the peptide of sequence SEQ ID NO: 21 (HBP6) added at the C-terminal of a salicylyl motif.

b)

Functionalized peptides.

0159These peptides correspond to SEQ ID NO: 1 to 48 above but bearing, on the N-terminal side, either a cysteine ​​which allows covalent coupling to substances of interest (see below) or biotin allowing the non-covalent association of peptides with streptavidin or avidin conjugated to peroxidase (see points (1) and (2) below)

II -

Peptide penetration mechanism.

1)

Involvement of glycosaminoglycans (GAG).

0160Peptides enter cells through GAG-mediated endocytosis present on the membranes of all eukaryotic cells. Tests have been carried out to see their role in the penetration of peptides.

a) Heparin (50 μg / ml) was incubated with the cells for 1 hour before adding the peptide-peroxidase conjugates at 0.2 / μg / ml for 2 hours. The cells were then lysed and the peroxidase assayed.

0161Heparin at 50 µg / ml completely inhibits the internalization of all peptides in H1299 and HeLa cells.

0162The amount of heparin necessary to inhibit 50% of the penetration of peptides coupled to peroxidase was evaluated with these two types of cells, by incubating the cells with the peptide-peroxidase conjugates with increasing concentrations of heparin. The results of the inhibition of the internalization of the peptides are expressed in heparin concentration (g / ml) in Table 2 below.<tables id="tabl0002" num="0002"><table frame="all"><title><u style="single">Table 2</u></title><tgroup cols="3"><colspec colnum="1" colname="col1" colwidth="26mm" /><colspec colnum="2" colname="col2" colwidth="50mm" /><colspec colnum="3" colname="col3" colwidth="50mm" /><thead><row><entry valign="top" /><entry align="center" valign="top">Peptide SEQ ID NO: 26 (BPH₃)₂</entry><entry align="center" valign="top">Peptide SEQ ID NO: 21 (HBP6)</entry></row></thead><tbody><row><entry>3T3 cells</entry><entry align="center">14.5 µg / ml</entry><entry align="center">4,1</entry></row><row><entry>HeLa cells</entry><entry align="center">8,5</entry><entry align="center">2,3</entry></row></tbody></tgroup></table></tables>

0163These experiments demonstrate the role of heparan sulfates in the penetration of peptides.

b) CHO-745 cells are derived from CHO cells. They are deficient in xylosyltransferase which participates in the formation of chondroitin and heparan sulfates in the membrane. The peptide-avidin peroxidase complexes do not penetrate into CHO-745 cells, regardless of the peptide tested.

0164This demonstrates the importance of heparan sulfate chondroitins of the cell membrane in the penetration of peptides.

2)

Involvement of cell metabolism.

0165In order to understand the biological mechanisms by which peptides enter cells and their compartmentalisation, experiments are made with drugs, whose action on certain cellular compartments is specific. The peptide-peroxidase was incubated with H1299 cells at a concentration of 0.2 μg / ml for 2 hours with or without the presence of drugs. The cells were lysed and the peroxidase assayed in the cell lysate.

0166Table 3 below reports the percentage of inhibition of internalization of the peptides calculated relative to the values ​​given by the lysate of the cells incubated without drugs.<tables id="tabl0003" num="0003"><table frame="all"><title><u style="single">Table 3</u></title><tgroup cols="4"><colspec colnum="1" colname="col1" colwidth="41mm" /><colspec colnum="2" colname="col2" colwidth="42mm" /><colspec colnum="3" colname="col3" colwidth="42mm" /><colspec colnum="4" colname="col4" colwidth="42mm" /><thead><row><entry valign="top" /><entry align="center" valign="top">Peptide SEQ ID NO: 26 (BPH₃)₂</entry><entry align="center" valign="top">Peptide SEQ ID NO: 30 (HBP7)</entry><entry align="center" valign="top">Peptide SEQ ID NO: 35 (HBP10)</entry></row></thead><tbody><row><entry>temperature (4 ° C)</entry><entry align="center">100</entry><entry align="center">100</entry><entry align="center">100</entry></row><row><entry>sodium azide (0.1%)</entry><entry align="center">70</entry><entry align="center">70</entry><entry align="center">50</entry></row><row><entry>sodium chlorate (80mM)</entry><entry align="center">51</entry><entry align="center">69</entry><entry align="center">27</entry></row><row><entry>ammonium chloride (50mM)</entry><entry align="center">76</entry><entry align="center">70</entry><entry align="center">30</entry></row><row><entry>genistein (200µM)</entry><entry align="center">59</entry><entry align="center">68</entry><entry align="center">70</entry></row><row><entry>chloroquine (100µM)</entry><entry align="center">82</entry><entry align="center">79</entry><entry align="center">76</entry></row></tbody></tgroup></table></tables>

0167The penetration of the tested peptides is completely inhibited by the incubation of the cells at 4 ° C. with all the peptides. It is partially inhibited by inhibitors of cell metabolism such as sodium azide (ATPase inhibitor), genistein (tyrosine kinase and ATP binding inhibitor). The internalization mechanism is therefore dependent on energy.

0168The penetration of the HBP3 and HBP7 peptides is inhibited by the same order of magnitude by chloroquine, which reflects internalization in the same compartments of the cell cytoplasm (endosomal vesicles, endoplasmic reticulum) while sodium chlorate and ammonium chloride (which avoids the acidification of endosomal vesicles thus inhibiting intracellular traffic) intervenes much less on the internalization of the peptide of sequence SED ID NO: 35. This suggests that peptides enter cells by mechanisms similar to those used by different toxins without, however, exhibiting toxicity. The intracellular routes to the Golgi zone and the retrograde traffic appear to be distinct depending on the peptides.

III -

RESULTS.

1)

Evaluation of the capacity of peptides to react with DNA and with heparin.

0169The capacity of the peptides to bind to DNA and heparin is evaluated on ELISA plates sensitized with DNA or heparin. Dilutions of the biotinylated peptides are deposited on the plates and their fixation is demonstrated using streptavidin conjugated to peroxidase. Peroxidase activity is revealed with orthodianisidine and H₂0₂ as a substrate.

0170The avidity of peptides SEQ ID NO: 25 to 39 for various proteoglycans (Kd x 10^-9M) heparin and chondroitin sulfates is evaluated by the quantity of peptides necessary to obtain 50% of fixation on the various antigens. The results are reported in Table 4 below.<tables id="tabl0004" num="0004"><table frame="all"><title><u style="single">Table 4</u></title><tgroup cols="5"><colspec colnum="1" colname="col1" colwidth="25mm" /><colspec colnum="2" colname="col2" colwidth="18mm" /><colspec colnum="3" colname="col3" colwidth="27mm" /><colspec colnum="4" colname="col4" colwidth="27mm" /><colspec colnum="5" colname="col5" colwidth="27mm" /><thead><row><entry align="center" valign="top">Peptides</entry><entry align="center" valign="top">Heparin</entry><entry align="center" valign="top">Chondroitin A</entry><entry align="center" valign="top">Chondroitin B</entry><entry align="center" valign="top">Chondroitin C</entry></row></thead><tbody><row><entry align="center">(HBP1)₃</entry><entry align="center">41</entry><entry align="center">37</entry><entry align="center">41</entry><entry align="center">35</entry></row><row><entry align="center">HBP2</entry><entry align="center">70</entry><entry align="center">60</entry><entry align="center">40</entry><entry align="center">100</entry></row><row><entry align="center">(HBP3)₂</entry><entry align="center">20</entry><entry align="center">51</entry><entry align="center">43</entry><entry align="center">6</entry></row><row><entry align="center">(BPH₃) 2RGD</entry><entry align="center">407</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry></row><row><entry align="center">HBP6</entry><entry align="center">16</entry><entry align="center">135</entry><entry align="center">110</entry><entry align="center">12</entry></row><row><entry align="center">HBP7</entry><entry align="center">54</entry><entry align="center">78</entry><entry align="center">58</entry><entry align="center">19</entry></row><row><entry align="center">HBP8</entry><entry align="center">168</entry><entry align="center">225</entry><entry align="center">260</entry><entry align="center">110</entry></row><row><entry align="center">HBP9</entry><entry align="center">45</entry><entry align="center">47</entry><entry align="center">47</entry><entry align="center">25</entry></row><row><entry align="center">HBP10</entry><entry align="center">78</entry><entry align="center">112</entry><entry align="center">229</entry><entry align="center">39</entry></row><row><entry align="center">HBP11</entry><entry align="center">382</entry><entry align="center">287</entry><entry align="center">301</entry><entry align="center">205</entry></row><row><entry align="center">HBP12</entry><entry align="center">295</entry><entry align="center">176</entry><entry align="center">173</entry><entry align="center">93</entry></row><row><entry align="center">HBP13</entry><entry align="center">56</entry><entry align="center">56</entry><entry align="center">38</entry><entry align="center">16</entry></row><row><entry align="center">HBP15</entry><entry align="center">100</entry><entry align="center">100</entry><entry align="center">100</entry><entry align="center">100</entry></row></tbody></tgroup></table></tables>

0171It appears from this table that the avidity for heparin of the peptides SEQ ID NO: 33 (HBP8), 36 (HBP11) and 37 (HBP12) is clearly lower (> 100x10^-9M) than that of the other peptides which is on average between 20 and 80 × 10^-9M. The avidity of the different peptides with the sulfates of chondroitins A, B, and C is on the whole of the same order of magnitude as that for heparin. Thus the avidity of the peptides SEQ ID NO: 34 (HBP9) and SEQ ID NO: 38 (HBP13) both for heparin and for the 3 chondroitins is 46-50 x10^-9M, while that of the peptides SEQ ID NO: 33 (HBP8), 36 (HBP11) and 37 (HBP12), both for heparin and for the 3 chondroitins, is> 100x10^-9M. The modified peptide SEQ ID NO: 28 (HBP3 + RGD) has lost its affinity for heparin.

2)

Evaluation of the penetration of peptides into cells.

0172The cells are cultured in the presence of the various peptides carrying, on the N-terminal side, biotin at decreasing concentrations (50 to 6 μg / ml) in the culture medium for variable times (1-18 hours).

0173At the end of the culture, the cells are washed three times with PBS (0.15 M NaCl buffered with 0.01 M potassium phosphate buffer pH 7.4) and then fixed for 15 minutes in ethanol at -20 ° C . The penetration of the peptide is evaluated after incubation for 30 minutes with streptavidin conjugated to peroxidase (abbreviated as S-PO for streptavidin-peroxidase). Then the S-PO is removed and the cells are washed. The activity of internalized peroxidase is revealed by diaminobenzidine in the presence of H₂0₂ and the cells are examined under a microscope (30).

0174Examination under the microscope has shown that all the peptides SEQ ID NO: 25 to 48 give positive cytochemical stains at a concentration of 6 μg / ml, although of varying intensity depending on the peptides.

3)

Evaluation of the penetration into cells of peptide / peroxidase conjugates.

0175To directly evaluate the penetration of the peptides while avoiding the avidin-peroxidase bias, some of the peptides of sequence SEQ ID NO: 25 to 48 were covalently conjugated via the cysteine ​​in position C -terminal of the peptide to peroxidase.

0176The coupling of the peptides with the peroxidase was carried out as follows: One mg of maleimide-activated peroxidase (Sigma) in 100 μl of sodium phosphate buffer, 0.15M NaCl, 5mM EDTA is added with 1 mg of peptide. After 2 hours at laboratory temperature, the β-mercaptoethanol is added to a final concentration of 1.5 mM for 15 minutes. The elimination of the uncoupled peptide is done by centrifugation on ultrafiltration membranes (cutoff threshold = 30,000 daltons, Sartorius), followed by three washes in 0.1M sodium phosphate buffer, pH 7.4 containing 0.15M NaCl.

0177The H1299 cells are incubated for 2 hours with the conjugates at increasing concentrations of peptide-peroxidase in the culture medium and then washed with PBS. The cells are lysed and the amount of internalized peptide is evaluated by assaying the peroxidase in the cell lysate with reference to a curve established with the peptide-peroxidase.

0178The amount of internalized peptide (pg / 10³ cells) according to the concentrations of conjugate in the culture medium is shown in Table 5 below.<tables id="tabl0005" num="0005"><table frame="all"><title><u style="single">Table 5</u></title><tgroup cols="5"><colspec colnum="1" colname="col1" colwidth="38mm" /><colspec colnum="2" colname="col2" colwidth="26mm" /><colspec colnum="3" colname="col3" colwidth="17mm" /><colspec colnum="4" colname="col4" colwidth="21mm" /><colspec colnum="5" colname="col5" colwidth="19mm" /><thead><row><entry valign="top">Concentration (µg / ml)</entry><entry align="center" valign="top">0,01</entry><entry align="center" valign="top">0,1</entry><entry align="center" valign="top">0,5</entry><entry align="center" valign="top">1</entry></row></thead><tbody><row><entry>Peptide SEQ ID NO: 28</entry><entry align="center">0,006 (0,006)*</entry><entry align="center">1,7 (1,6)</entry><entry align="center">37,9 (7,6)</entry><entry align="center">8860 (8,8)</entry></row><row><entry>Peptide SEQ ID NO: 34</entry><entry align="center">0,002 (0,01)</entry><entry align="center">1,4 (1, 4)</entry><entry align="center">40,7 (8,14)</entry><entry align="center">109 (10,9)</entry></row></tbody></tgroup><tgroup cols="5" rowsep="0"><colspec colnum="1" colname="col1" colwidth="38mm" /><colspec colnum="2" colname="col2" colwidth="26mm" /><colspec colnum="3" colname="col3" colwidth="17mm" /><colspec colnum="4" colname="col4" colwidth="21mm" /><colspec colnum="5" colname="col5" colwidth="19mm" /><tbody><row><entry namest="col1" nameend="col5" align="justify">*: percentage of the quantity of internalized peroxidase compared to the quantity deposited.</entry></row></tbody></tgroup></table></tables>

0179It appears that the higher the concentration of peptide-peroxidase conjugate in the culture medium, the more the internalized quantity increases.

0180To compare the penetration of the conjugates according to the cell type, the cells of different lines were incubated with 0.2 μg / ml of peptide-peroxidase conjugate for 2 hours and the amount of peroxidase assayed in the lysates. Table 6 and Table 6a below give the results obtained expressed in pg / 10³ cells. The quantity of each peptide internalized in the different lines only varies from one to two in general.

0181The internalization of the peptides HBP3 (SEQ ID NO: 26) and HBP7 (SEQ ID NO: 30) in configuration D (SEQ ID NO: 27 and 32 respectively) is of the same order of magnitude as that of the homologous peptides in configuration L. The same is true with the peptide of SEQ ID NO: 30 and its counterpart of SEQ ID NO: 31, which has an amino acid sequence in the two-sided position.<tables id="tabl0006" num="0006"><table frame="all"><title><u style="single">Table 6:</u> Internalization of peptide peroxidase (pg / 10³ cells)</title><tgroup cols="4"><colspec colnum="1" colname="col1" colwidth="28mm" /><colspec colnum="2" colname="col2" colwidth="22mm" /><colspec colnum="3" colname="col3" colwidth="25mm" /><colspec colnum="4" colname="col4" colwidth="24mm" /><thead><row><entry align="center" valign="top" /><entry namest="col2" nameend="col4" align="center" valign="top">Cell lines</entry></row><row><entry align="center" valign="top">Peptides</entry><entry align="center" valign="top">3Q3</entry><entry align="center" valign="top">H1299</entry><entry align="center" valign="top">HeLa</entry></row></thead><tbody><row><entry align="center">1047</entry><entry align="center">35</entry><entry align="center">10</entry><entry align="center">4.7</entry></row><row><entry align="center">(HBP1) 3</entry><entry align="center">24.6</entry><entry align="center">17.7</entry><entry align="center">11.2</entry></row><row><entry align="center">(HBP3) 2</entry><entry align="center">41</entry><entry align="center">27.8</entry><entry align="center">14.9</entry></row><row><entry align="center">HBP6</entry><entry align="center">83.7</entry><entry align="center">21.9</entry><entry align="center">13.2</entry></row><row><entry align="center">HBP7</entry><entry align="center">48.8</entry><entry align="center">22.5</entry><entry align="center">11</entry></row><row><entry align="center">HBP8 *</entry><entry align="center">7.6</entry><entry align="center">3.6</entry><entry align="center">2.1</entry></row><row><entry align="center">HBP9 *</entry><entry align="center">9</entry><entry align="center">3.8</entry><entry align="center">3.4</entry></row><row><entry align="center">HBP10</entry><entry align="center">23.3</entry><entry align="center">7.9</entry><entry align="center">5.3</entry></row><row><entry align="center">HBP11</entry><entry align="center">20.3</entry><entry align="center">10.6</entry><entry align="center">4.4</entry></row><row><entry align="center">HBP12 *</entry><entry align="center">5.7</entry><entry align="center">4.3</entry><entry align="center">2.5</entry></row><row><entry align="center">HBP13</entry><entry align="center">18.1</entry><entry align="center">9.1</entry><entry align="center">4.1</entry></row></tbody></tgroup></table></tables><tables id="tabl0007" num="0007"><table frame="all"><title><u style="single">Table 6bis</u> : Internalization of peptide-peroxidase (pg / 10³ cells)</title><tgroup cols="4"><colspec colnum="1" colname="col1" colwidth="40mm" /><colspec colnum="2" colname="col2" colwidth="22mm" /><colspec colnum="3" colname="col3" colwidth="25mm" /><colspec colnum="4" colname="col4" colwidth="23mm" /><thead><row><entry align="center" valign="top" /><entry namest="col2" nameend="col4" align="center" valign="top">Cell lines</entry></row><row><entry align="center" valign="top">Peptides</entry><entry align="center" valign="top">3Q3</entry><entry align="center" valign="top">H1299</entry><entry align="center" valign="top">HeLa</entry></row></thead><tbody><row><entry align="center">(HBP3)₂</entry><entry align="center">72,9</entry><entry align="center">67,4</entry><entry align="center">11,4</entry></row><row><entry align="center">(HBP3)₂ Configuration D</entry><entry align="center">63,7</entry><entry align="center">59,1</entry><entry align="center">4,1</entry></row><row><entry align="center">HBP7</entry><entry align="center">44,2</entry><entry align="center">63,3</entry><entry align="center">3,6</entry></row><row><entry align="center">HBP7 Configuration D</entry><entry align="center">50</entry><entry align="center">56,7</entry><entry align="center">7,7</entry></row><row><entry align="center">HBP7 duplex</entry><entry align="center">75,9</entry><entry align="center">70,6</entry><entry align="center">8,7</entry></row></tbody></tgroup><tgroup cols="4" rowsep="0"><colspec colnum="1" colname="col1" colwidth="40mm" /><colspec colnum="2" colname="col2" colwidth="22mm" /><colspec colnum="3" colname="col3" colwidth="25mm" /><colspec colnum="4" colname="col4" colwidth="23mm" /><tbody><row><entry namest="col1" nameend="col4" align="justify">* at the limit of the dosing method and therefore of the significance.</entry></row></tbody></tgroup></table></tables>

4)

Evaluation <i>in vitro</i> of the cytotoxic activity of ribonuclease A (RNase A) conjugated to the peptides.

01825 mg of bovine RNase A are dissolved in 1 ml of 0.1M sodium phosphate buffer, pH 7 containing 0.15 NaCl.

01831 mg of SMCC is dissolved in 50 µl of dimethyl sulfoxide (final solution 20 mg / ml).

0184RNase A is activated by adding 12.5 µl of the SMCC solution to 200 µl of the RNase A solution (molar ratio = 10 molecules of SMCC for 1 molecule of RNase A).

0185The reaction is carried out for 30 minutes at laboratory temperature.

0186The excess reagent is removed by centrifugation on ultrafiltration membranes (cut-off threshold = 5,000 Da, Vivascience) followed by 3 washes with 0.1 M sodium phosphate buffer containing 0.15 M NaCl.

0187The coupling with the peptide is then carried out in a peptide: RNase A molar ratio of 6: 1 in the 0.1 M sodium phosphate buffer, pH 7, containing 0.15 M NaCl for 3 hours at room temperature.

0188The excess uncoupled peptide is removed by centrifugation as in the previous step.

0189The amount of peptide coupled to RNase A is evaluated by the molecular weight of the bands obtained after coupling on an SDS-polyacrylamide gel containing 15% acrylamide.

at)

Evaluation <i>in vitro</i> of the cytotoxic activity of Rnase on HH9 cells.

0190The cells are seeded the day before in 96-well plates at a rate of 10³ cells per well.

0191The following day, the supernatant is aspirated and replaced with 100 μl of medium containing successive dilutions of RNase A-vector or of native RNase A and the culture continued for 72 hours.

0192The wells are then added with 50 μl of a solution of MTT (3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyl tetrazolium bromide) at 1 mg / ml in the culture medium and cultured for 4 hours.

0193The supernatant is removed and the wells are added with 100 μl of dimethyl sulfoxide. After dissolution of the crystals, the coloration is read at 550 nm.

0194The results are calculated as a percentage of the average optical density obtained in the cell wells containing the dilutions of the samples to be tested and of the optical density of the wells having received only medium. These results are represented graphically at the<figref idref="f0001">figure 1</figref>.

0195As is clear from the <figref idref="f0001">figure 1</figref>, native RNase A has no cytotoxic activity. The average cytotoxicity of 50% is obtained at RNase A-vector concentrations between 33 and 100 µg / ml, that is to say between the molar concentrations of 2 to 7x10^-7Mr.

b)

Evaluation <i>in vitro</i> of the cytotoxic activity of peptide-RNase conjugates on Hela cells.

0196The different peptide-RNase conjugates have been tested on various cell lines. The results are expressed in IC50 which corresponds to the concentration of the peptide-RNase conjugate giving 50% inhibition of cell growth after 72 hours of culture.

0197Table 7 summarizes the results obtained. It appears that all the conjugates have distinct cytotoxic activities and that some of them have little cytotoxic power.<tables id="tabl0008" num="0008"><table frame="all"><title><u style="single">Table 7</u></title><tgroup cols="9"><colspec colnum="1" colname="col1" colwidth="26mm" /><colspec colnum="2" colname="col2" colwidth="13mm" /><colspec colnum="3" colname="col3" colwidth="15mm" /><colspec colnum="4" colname="col4" colwidth="13mm" /><colspec colnum="5" colname="col5" colwidth="17mm" /><colspec colnum="6" colname="col6" colwidth="11mm" /><colspec colnum="7" colname="col7" colwidth="14mm" /><colspec colnum="8" colname="col8" colwidth="13mm" /><colspec colnum="9" colname="col9" colwidth="17mm" /><thead><row><entry valign="top" /><entry namest="col2" nameend="col9" align="center" valign="top">Cell lines</entry></row><row><entry valign="top">Peptide-RNase</entry><entry align="center" valign="top">HT29</entry><entry align="center" valign="top">H1299</entry><entry align="center" valign="top">HH9</entry><entry align="center" valign="top">HUVEC</entry><entry align="center" valign="top">3Q3</entry><entry align="center" valign="top">MCF7</entry><entry align="center" valign="top">HeLa</entry><entry align="center" valign="top">B16.F10</entry></row></thead><tbody><row><entry>(HBP1) 3-</entry><entry align="center">70</entry><entry align="center">100</entry><entry align="center">20</entry><entry align="center">80</entry><entry align="center">40</entry><entry align="center">90</entry><entry align="center">60</entry><entry align="center">25</entry></row><row><entry>(HBP1) 2-</entry><entry align="center">nt *</entry><entry align="center">25</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry></row><row><entry>HBP1-4-</entry><entry align="center">nt</entry><entry align="center">25</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">6</entry><entry align="center">nt</entry></row><row><entry>BPH 3-</entry><entry align="center">10</entry><entry align="center">12</entry><entry align="center">2</entry><entry align="center">15</entry><entry align="center">3</entry><entry align="center">15</entry><entry align="center">7</entry><entry align="center">12</entry></row><row><entry>HBP6-</entry><entry align="center">45</entry><entry align="center">3</entry><entry align="center">3</entry><entry align="center">50</entry><entry align="center">3</entry><entry align="center">20</entry><entry align="center">12</entry><entry align="center">nt</entry></row><row><entry>BPH -7</entry><entry align="center">45</entry><entry align="center">50</entry><entry align="center">2</entry><entry align="center">50</entry><entry align="center">6</entry><entry align="center">25</entry><entry align="center">15</entry><entry align="center">nt</entry></row><row><entry>BPH 8-</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">>100</entry><entry align="center">nt</entry></row><row><entry>HBP9-</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">100</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">nt</entry><entry align="center">>100</entry><entry align="center">nt</entry></row><row><entry>BPH 10-</entry><entry align="center">>100</entry><entry align="center">150</entry><entry align="center">33</entry><entry align="center">>100</entry><entry align="center">50</entry><entry align="center">150</entry><entry align="center">25</entry><entry align="center">nt</entry></row><row><entry>BPH 11-</entry><entry align="center">>100</entry><entry align="center">>100</entry><entry align="center">60</entry><entry align="center">>100</entry><entry align="center">60</entry><entry align="center">>100</entry><entry align="center">20</entry><entry align="center">nt</entry></row><row><entry>BPH 12-</entry><entry align="center">>100</entry><entry align="center">>100</entry><entry align="center">>100</entry><entry align="center">>100</entry><entry align="center">40</entry><entry align="center">>100</entry><entry align="center">>100</entry><entry align="center">nt</entry></row><row><entry>BPH 13-</entry><entry align="center">40</entry><entry align="center">100</entry><entry align="center">8</entry><entry align="center">65</entry><entry align="center">14</entry><entry align="center">>100</entry><entry align="center">3</entry><entry align="center">nt</entry></row><row><entry>BPH 14-</entry><entry align="center">>100</entry><entry align="center">250</entry><entry align="center">>100</entry><entry align="center">>100</entry><entry align="center">55</entry><entry align="center">90</entry><entry align="center">25</entry><entry align="center">nt</entry></row><row><entry>HBP 1047-</entry><entry align="center">>100</entry><entry align="center">250</entry><entry align="center">60</entry><entry align="center">>100</entry><entry align="center">55</entry><entry align="center">90</entry><entry align="center">30</entry><entry align="center">>100</entry></row></tbody></tgroup><tgroup cols="9" rowsep="0"><colspec colnum="1" colname="col1" colwidth="26mm" /><colspec colnum="2" colname="col2" colwidth="13mm" /><colspec colnum="3" colname="col3" colwidth="15mm" /><colspec colnum="4" colname="col4" colwidth="13mm" /><colspec colnum="5" colname="col5" colwidth="17mm" /><colspec colnum="6" colname="col6" colwidth="11mm" /><colspec colnum="7" colname="col7" colwidth="14mm" /><colspec colnum="8" colname="col8" colwidth="13mm" /><colspec colnum="9" colname="col9" colwidth="17mm" /><tbody><row><entry namest="col1" nameend="col9" align="justify">* nt: no</entry></row></tbody></tgroup></table></tables>

5)

Evaluation <i>in vivo</i> of cytotoxic activity of RNase A conjugated to peptides on human tumors grafted on athymic mice (nude).

01986 week old female nude mice were injected subcutaneously with 3x10⁶ HH9 cells in a volume of 50 µl in the left flank.

0199On day 9 after the transplant, the mice received twice a week, peritumoral injection, 100 μg of Rnase, or 65 μg of peptide (BPH₃)₂ or 65 µg of peptide (BPH₃)₂ + 100 µg of Rnase, or 100 µg of peptide conjugate (HBP3)₂-RNase or HBP6-Rnase conjugate. On day 26, the mice were killed and their tumors weighed.

0200The growth inhibition of the HH9 tumors treated with the peptide-RNase conjugates is given in table 8. The growth inhibition of the tumors of the treated mice is calculated relative to the average weight of the tumors of mice having received NaCl.<tables id="tabl0009" num="0009"><table frame="all"><title><u style="single">Table 8</u></title><tgroup cols="7"><colspec colnum="1" colname="col1" colwidth="26mm" /><colspec colnum="2" colname="col2" colwidth="12mm" /><colspec colnum="3" colname="col3" colwidth="17mm" /><colspec colnum="4" colname="col4" colwidth="30mm" /><colspec colnum="5" colname="col5" colwidth="28mm" /><colspec colnum="6" colname="col6" colwidth="24mm" /><colspec colnum="7" colname="col7" colwidth="24mm" /><thead><row><entry valign="top">Rnase Group</entry><entry align="center" valign="top">NaCl</entry><entry align="center" valign="top">(HBP3)₂</entry><entry align="center" valign="top">(HBP3)₂ + RNase</entry><entry align="center" valign="top">(HBP3)₂ -Rnase</entry><entry align="center" valign="top">HBP6-Rnase</entry><entry align="center" valign="top">HBP7-Rnase</entry></row></thead><tbody><row><entry>Tumors*</entry><entry align="center">1720</entry><entry align="center">1560</entry><entry align="center">1500</entry><entry align="center">790</entry><entry align="center">810</entry><entry align="center">830</entry></row><row><entry>Inhibition**</entry><entry align="center">-</entry><entry align="center">10</entry><entry align="center">13</entry><entry align="center">54</entry><entry align="center">53</entry><entry align="center">52</entry></row></tbody></tgroup><tgroup cols="7" rowsep="0"><colspec colnum="1" colname="col1" colwidth="26mm" /><colspec colnum="2" colname="col2" colwidth="12mm" /><colspec colnum="3" colname="col3" colwidth="17mm" /><colspec colnum="4" colname="col4" colwidth="30mm" /><colspec colnum="5" colname="col5" colwidth="28mm" /><colspec colnum="6" colname="col6" colwidth="24mm" /><colspec colnum="7" colname="col7" colwidth="24mm" /><tbody><row><entry namest="col1" nameend="col7" align="justify">* average tumor weight of 6 mice in the same group in mg **%</entry></row></tbody></tgroup></table></tables>

0201The 3 peptide-RNase conjugates inhibit tumor growth in an equivalent manner, while the peptide alone or with RNase added has little effect.

6)

Evaluation of the penetration of substances using transporters coupled to peptides.

0202If we now come to the carriers according to the invention, Table 9 below gives some examples of carriers and substances of interest for which they have a strong affinity.<tables id="tabl0010" num="0010"><table frame="all"><title><u style="single">Table 9</u></title><tgroup cols="2"><colspec colnum="1" colname="col1" colwidth="50mm" /><colspec colnum="2" colname="col2" colwidth="83mm" /><thead><row><entry align="center" valign="top">CARRIERS</entry><entry align="center" valign="top">SUBSTANCES OF INTEREST</entry></row></thead><tbody><row><entry>Peptide - Protein A</entry><entry>Human or rabbit IgG</entry></row><row><entry>Peptide - Protein G</entry><entry>Bovine, goat or mouse IgG</entry></row><row><entry>Peptide - F (abl) 2 anti-IgG</entry><entry>All IgG of the same species</entry></row><row><entry>Peptide - IgG anti-peroxidase</entry><entry>Peroxidase and any molecule containing peroxidase</entry></row><row><entry>Peptide - F (abl) 2 anti-RNase</entry><entry>Ribonuclease A</entry></row><row><entry>Peptide - Concanavalin A</entry><entry>A large number of glycoproteins</entry></row><row><entry>Peptide - Streptavidin - Avidin</entry><entry>Biotin and any molecule containing biotin</entry></row></tbody></tgroup></table></tables>

0203In the table above, the generic term "peptide" means "amino acid sequence according to the invention".

0204Protein A is a protein isolated from <i>Staphyloccocus aureus</i> which has a molecular weight of 42,000 Da. The characteristic property of this protein is its great affinity for the Fc part of IgG. This property allows it to fix 2 to 4 IgG molecules without interacting with the active sites of the antibodies. Protein A is of interest for human, rabbit and rat IgG, and certain mouse IgG.

0205Protein G, originally, is a protein of 30,000 to 35,000 Da isolated from the cell wall of bacterial strains C or D of streptococci. The G protein marketed by SIGMA is a recombinant protein of 17,000 Da which contains two IgG binding domains. Like protein A, protein G has a strong affinity for the Fc fraction of IgG, but it will mainly be used for bovine, mouse and sheep IgG.

0206The F (ab ')₂ come from antibodies. Use will be made, as examples, of sheep IgG anti-mouse IgG obtained from an immune sheep serum. They are purified by affinity chromatography, in which the solid phase consists of mouse IgG fixed on polyacrylamide-agarose beads. It is a purification by an immunoabsorbent which allows the specific binding of anti-mouse IgG sheep IgG by an antigen-antibody reaction. This antigen-antibody bond is dissociated by an acid pH. The careful digestion of IgG with proteolytic enzymes makes it possible to obtain different antibody fragments. Using pepsin, F (ab ') fragments are obtained₂ bivalent, reduced in size (PM = 92,000 Da), and Fc fragments fully digested into small polypeptides. The removal of the Fc fragment makes it possible to reduce the size of the antibodies and simplifies the coupling with the peptides. The realization of a peptide-F transporter (ab ')₂ anti-IgG will allow a large variety of mouse IgG to be internalized in large quantities.

0207IgG anti-peroxidase is a monoclonal antibody of the isotype IgGl which is isolated from ascites of mice. It is purified by affinity chromatography on protein G (GammaBind Plus Sepharose: Pharmacia). This antibody has a strong affinity for peroxidase, and by the same, for all molecules containing peroxidase. Peroxidase (PO) is an enzyme extracted from black radish with a molecular weight of 44,000 Da, which can be associated very easily with many molecules. The production of an anti-PO peptide-IgG transporter will make it possible to internalize PO and any substance containing PO in cells.

0208Concanavalin, extracted from <i>Canavalia ensiformis,</i> is a lectin which has an affinity for the α-D-mannosyl and α-D-glucosyl terminal groups of proteins. This property allows it to react with many glycoproteins. The creation of a peptide-concanavalin transporter will make it possible to internalize numerous glycoproteins or glycolized molecules in cells.

0209Streptavidin, a molecule of 60,000 Da extracted from <i>Streptomyces avidinii,</i> and avidin, extracted from egg white, both have four recognition sites for biotin. Their affinity constant for this small molecule is very high (KD = 10^-13M) which allows them to interact with all substances containing biotin. The production of a peptide-streptavidin or peptide-avidin transporter will make it possible to internalize biotin and any molecule containing biotin in cells.

0210The examples detailed below illustrate the production and use of such conveyors.

at)

Evaluation of the penetration of bovine ribonuclease A (RNase A) transported by a peptide-F transporter (ab ')

<u style="single">2</u>

, anti-RNase in cells.

0211Gentle digestion of anti-RNase IgG with a proteolytic enzyme, pepsin, makes it possible to obtain the F (ab ') fragments₂. This digestion, which takes place in a sodium acetate solution pH 4.5 with 2% pepsin, allows the fragmentation of the Fc fragment of the IgG without altering the active sites of the antibody.

0212Two mg of antibody F (ab ')₂ anti-RNase in 1 ml of 0.1 M potassium phosphate buffer pH 7.4 are added to 110 μg of SMCC [succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate] in 11 μl of dimethyl sulfoxide. The solution is incubated for 45 minutes at laboratory temperature. The excess reagents are removed by centrifugation on ultrafiltration membranes (cutoff threshold = 10,000 Da, Vivascience), followed by three washes in 10 mM sodium phosphate buffer, pH 7 containing 0.5 M NaCl and 5 mM EDTA.

0213The coupling with the peptide is then done in a molar ratio of 6 peptides for 1 F (ab ')₂ in 10 mM sodium phosphate buffer, pH 7, containing 0.5 M NaCl and 5 mM EDTA for three hours at laboratory temperature. Then, the excess of uncoupled peptide is completely eliminated by centrifugation on ultrafiltration membranes, as in the previous step.

0214These transporters [peptide-F (ab ')₂ anti-RNase] are added to ribonuclease A in complete culture medium and the solution is incubated for 1 hour at laboratory temperature. The molar ratio of this reaction is 2 RNase / 1 F (ab ')₂.

0215To assess the penetration of RNase A under the microscope, cells are cultured in the presence of complexes [peptide-F (ab ')₂ anti-RNase] -RNase A diluted to decreasing concentrations of RNase A (from 100 to 6 µg / ml) in culture medium for 4 hours at 37 ° C.

0216At the end of the incubation, the cells are washed three times with PBS, then fixed for 15 minutes in absolute ethanol at -20 ° C. RNase penetration is evaluated after incubation for 1 hour with an anti-RNase antibody coupled to peroxidase. The cells are then washed with PBS and the activity of the peroxidase is revealed by diaminobenzidine in the presence of H₂O₂.

0217To measure the amount of internalized RNase A, the cells are trypsinized, transferred to microtubes and counted. They are washed twice by centrifugation with PBS then the pellet is suspended in 220 μl of lysis buffer (tris buffer, 0.1M, pH 8, 0.5% Nonidet 40). The amount of RNase A present in the cell lysate is measured by ELISA on plates sensitized with rabbit anti-RNase A antibody and revealed by a rabbit anti-RNase A antibody conjugate coupled to peroxidase, with reference to a standard curve established with RNase.

0218The results grouped in Table 10 illustrate the internalization of RNase A by the transporter F (ab ')₂ anti-RNase and internalization of RNase covalently coupled to the peptide inside HeLa cells.<tables id="tabl0011" num="0011"><table frame="all"><title><u style="single">Table 10</u></title><tgroup cols="4"><colspec colnum="1" colname="col1" colwidth="69mm" /><colspec colnum="2" colname="col2" colwidth="41mm" /><colspec colnum="3" colname="col3" colwidth="30mm" /><colspec colnum="4" colname="col4" colwidth="26mm" /><thead><row><entry valign="top" /><entry align="center" valign="top"><b>Carrier + RNase A</b></entry><entry align="center" valign="top"><b>Peptide-RNase A</b></entry><entry align="center" valign="top"><b>Native RNase</b></entry></row></thead><tbody><row><entry>Amount of internalized RNase (pg / 10⁴ cells)</entry><entry align="center">476</entry><entry align="center">433</entry><entry align="center">0</entry></row></tbody></tgroup></table></tables>

b) Evaluation of the penetration of mouse IgG (IgG) transported by a peptide-F transporter (ab ')

<u style="single">2,</u>

anti mouse IgG in cells.

0219Peptide-F transporters (ab ')₂ anti-mouse IgG are obtained according to the technique described above.

0220These transporters [peptide-F (ab ')₂ anti-IgG] are added to mouse IgG in 0.5 M NaCl buffer. The solution is incubated for 1 hour at laboratory temperature. The molar ratio of this reaction is 1 F (ab ')₂/ 1 IgG. After one hour of incubation, the complexes formed are diluted in complete culture medium.

0221To assess the penetration of IgG under the microscope, cells are cultured in the presence of complexes [peptide-F (ab ')₂ anti-IgG] -IgG diluted to decreasing concentrations of IgG (from 100 to 6 µg / ml) in complete culture medium for 4 hours at 37 ° C.

0222At the end of the incubation, the cells are washed three times with PBS, then fixed for 15 minutes in absolute ethanol at -20 ° C. IgG penetration is evaluated after incubation for 1 hour with an antibody anti-IgG coupled with peroxidase. The cells are then washed with PBS and the activity of the peroxidase is revealed by diaminobenzidine in the presence of H₂O₂.

0223To measure the amount of internalized IgG, the cells are trypsinized, transferred to microtubes and counted. They are washed twice by centrifugation with PBS then the pellet is suspended in 220 μl of lysis buffer (0.1 M tris buffer, pH 8, 0.5% Nonidet 40). The amount of IgG present in the cell lysate is measured by ELISA on plates sensitized with anti-IgG sheep antibody and revealed by an anti-IgG sheep antibody conjugate coupled to peroxidase, by reference to a standard curve. established with IgG. Peroxidase activity is revealed with orthodianisidine and H₂O₂.

0224The same transporter [peptide-F (ab ')₂ anti-IgG] can carry a wide variety of mouse IgG inside cells.

0225The results grouped in Table 11 illustrate the internalization of the various mouse or possibly rat IgGs within HeLa cells via the same transporter [peptide-F (ab ')₂ anti-IgG].<tables id="tabl0012" num="0012"><table frame="all"><title><u style="single">Table 11</u></title><tgroup cols="2"><colspec colnum="1" colname="col1" colwidth="47mm" /><colspec colnum="2" colname="col2" colwidth="66mm" /><thead><row><entry valign="top" /><entry align="center" valign="top">Amount of internalized IgG (pg / 10⁴ cells)</entry></row></thead><tbody><row><entry>Transporter + anti-p53 IgG</entry><entry align="center">1100</entry></row><row><entry>Transporter + anti-p21 IgG</entry><entry align="center">1200</entry></row><row><entry>Carrier + anti-PO IgG</entry><entry align="center">695</entry></row><row><entry>Carrier + biotinylated IgG</entry><entry align="center">153</entry></row><row><entry>Transporter + mouse IgG</entry><entry align="center">5960</entry></row><row><entry>Carrier + F.4.1</entry><entry align="center">3200</entry></row><row><entry>F.4.1.</entry><entry align="center">1299</entry></row></tbody></tgroup><tgroup cols="2" rowsep="0"><colspec colnum="1" colname="col1" colwidth="47mm" /><colspec colnum="2" colname="col2" colwidth="66mm" /><tbody><row><entry namest="col1" nameend="col2" align="justify">Anti-p53 IgG: murine monoclonal antibody specific for the p53 protein. Anti-p21 IgG: monoclonal antibody specific for the p21 protein derived from a rat-rat hybridoma, reacting with anti-mouse IgG antibodies. Anti-PO IgG: murine monoclonal antibody specific for peroxidase F.4.1: murine anti-DNA monoclonal antibody which alone penetrates inside the cells.</entry></row></tbody></tgroup></table></tables>

c) Evaluation of the penetration of peroxidase (PO) or of molecules containing peroxidase transported by a peptide-IgG anti-PO transporter in the cells.

0226Two mg of monoclonal IgG antibody specific for peroxidase or their F (ab ') fragment₂ in 110 ml of 0.1 M potassium phosphate buffer, pH 7.4, are added to 110 μg of SMCC [succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate] in 11 μl of dimethyl sulfoxide. The solution is incubated for 45 minutes at laboratory temperature. The excess reagents are removed by centrifugation on ultrafiltration membranes (cutoff threshold = 10,000 Da, Vivascience), followed by three washes in 10 mM sodium phosphate buffer, pH 7 containing 0.5 M NaCl and 5 mM EDTA.

0227The coupling with the peptide is then carried out in a molar ratio of 6 peptides for 1 IgG or 1 F (ab ')₂ in 10 mM sodium phosphate buffer, pH 7, containing 0.5 M NaCl and 5 mM EDTA for three hours at laboratory temperature. Then, the excess of uncoupled peptide is completely eliminated by centrifugation on ultrafiltration membranes, as in the previous step.

0228These transporters [anti-PO peptide-IgG] are added to the peroxidase or to the biotinylated peroxidase in 0.5 M NaCl buffer. The solution is incubated for 1 hour at laboratory temperature. The molar ratio of this reaction is 2 PO / 1 IgG or F (ab ')₂.

0229To assess the penetration of PO or PO-containing molecules under the microscope, the cells are cultured in the presence of the [peptide-anti-PO IgG] -PO complexes at decreasing concentrations of PO or of PO-containing molecules (100 to 6 µg / ml) in culture medium for 4 hours at 37 ° C.

0230At the end of the culture, the cells are washed three times with PBS, then fixed for 15 minutes in absolute ethanol at -20 ° C. The cells are then washed with PBS and the penetration of PO or molecules containing PO is evaluated by the activity of the peroxidase revealed by diaminobenzidine in the presence of H₂O₂

0231To measure the amount of internalized PO, the cells are trypsinized, transferred to microtubes and counted. They are washed twice by centrifugation with PBS then the pellet is suspended in 220 μl of lysis buffer (0.1 M tris buffer, pH 8, 0.5% Nonidet 40). The amount of PO present in the cell lysate is measured by ELISA on plates sensitized with anti-peroxidase mouse antibody and revealed with ortho-dianisidine and H₂O₂ by reference to a standard PO curve.

0232The results grouped in Table 12 illustrate the internalization of PO and biotinylated PO inside HeLa cells via the transporter [anti-PO peptide-IgG].<tables id="tabl0013" num="0013"><table frame="all"><title><u style="single">Table 12</u></title><tgroup cols="3"><colspec colnum="1" colname="col1" colwidth="78mm" /><colspec colnum="2" colname="col2" colwidth="29mm" /><colspec colnum="3" colname="col3" colwidth="24mm" /><thead><row><entry valign="top" /><entry align="center" valign="top">Peroxidase (PO)</entry><entry align="center" valign="top">PO-biotinylated</entry></row></thead><tbody><row><entry>Quantity of internalized molecules (pg / 10⁴ cells)</entry><entry align="center">2100</entry><entry align="center">1700</entry></row></tbody></tgroup></table></tables>

d) Evaluation of the penetration of IgG transported by a peptide-protein A transporter into the cells.

0233One mg of protein A in 0.5 ml of 0.1 M sodium phosphate buffer pH 7 is added to 120 μg of SMCC [succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate] in 12 μl of dimethyl sulfoxide. The solution is incubated for 45 minutes at laboratory temperature. The excess reagents are removed by centrifugation on ultrafiltration membranes (cutoff threshold = 10,000 Da, Vivascience), followed by three washes in 0.1 M sodium phosphate buffer, pH 7 containing 0.15 M of NaCl.

0234The coupling with the peptide is then carried out in a molar ratio of 6 peptides for 1 protein A in the 0.1 M sodium phosphate buffer, pH 7, containing 0.15 M NaCl for three hours at laboratory temperature. Then, the excess of uncoupled peptide is completely eliminated by centrifugation on ultrafiltration membranes, as in the previous step.

0235These transporters [peptide-protein A] are added to IgG in 0.15M NaCl buffer. The solution is incubated for 20 minutes at laboratory temperature. The molar ratio of this reaction is 2 IgG / 1 protein A.

0236To evaluate the penetration of IgG under the microscope, the cells are cultured in the presence of the [peptide-protein A] -IGG complexes diluted to decreasing concentrations of IgG (100 to 6 μg / ml) in culture medium, for 4 hours at 37 ° C.

0237At the end of the culture, the cells are washed three times with PBS, then fixed for 15 minutes in absolute ethanol at -20 ° C. IgG penetration is evaluated after incubation for 1 hour with an anti-IgG antibody coupled to PO or with PO alone for anti-PO IgG. This step is not necessary when internalizing IgG conjugated to PO (for example: rabbit IgG-PO). The cells are then washed with PBS and the activity of the peroxidase is revealed by diaminobenzidine in the presence of H₂O_2.

0238To measure the amount of internalized IgG, the cells are trypsinized, transferred to microtubes and counted. They are washed twice by centrifugation with PBS then the pellet is suspended in 220 μl of lysis buffer (0.1 M tris buffer, pH 8, 0.5% Nonidet 40). The amount of IgG present in the cell lysate is measured by ELISA on plates sensitized with anti-IgG antibody and revealed by an anti-IgG antibody conjugate coupled to peroxidase, by reference to a standard curve established with IgG . PO activity is revealed with ortho-dianisidine and H₂O₂. The results grouped in Table 13 illustrate the internalization of different IgGs within HeLa cells via the transporter [peptide-protein A].<tables id="tabl0014" num="0014"><table frame="all"><title><u style="single">Table 13</u></title><tgroup cols="4"><colspec colnum="1" colname="col1" colwidth="66mm" /><colspec colnum="2" colname="col2" colwidth="23mm" /><colspec colnum="3" colname="col3" colwidth="32mm" /><colspec colnum="4" colname="col4" colwidth="14mm" /><thead><row><entry valign="top" /><entry align="center" valign="top">Rabbit-PO IgG</entry><entry align="center" valign="top">Anti-PO mouse IgG</entry><entry align="center" valign="top">IVIg</entry></row></thead><tbody><row><entry>Amount of internalized IgG (pg / 10⁴ cells)</entry><entry align="center">10800</entry><entry align="center">480</entry><entry align="center">26000</entry></row></tbody></tgroup></table></tables>

7)

Transport of doxorubicin.

0239Anthracyclines like doxorubicin are among the most active agents in the treatment of human cancers. Their mode of entry into cells has not yet been resolved. What we do know is that they are quickly transported into the nucleus of cells. Their toxicity, probably due to their wide distribution throughout the body, is a limitation in treatment, preventing the use of a large amount.

0240We wanted to define whether the coupling of doxorubicin to BPH peptides would improve its capacity to inhibit the growth of human tumors while reducing the toxicity of the drug.

at)

Coupling of peptides to doxorubicin

0241Doxorubicin, the amino group of which is protected, is treated with 4-maleimidobutyric acid in the presence of carbodiimide, which results in the formation of an ester bond between the hydroxyl of doxorubicin and the carboxyl of maleimidobutiric acid. The maleimide group thus introduced into doxorubicin reacts with the cysteine ​​present at the -C or -N terminal of the peptide.

0242Following the general scheme, the following conjugates were prepared: 1047-doxorubicin; HBP1-doxorubicin; HBP3-doxorubicin; HBP6-doxorubicin; HBP7-doxorubicin; HBP10-doxorubicin; HBP13-doxorubicin.

b)

Evaluation <i>in vitro</i> of the biological activity of doxorubicin conjugated to peptides.

0243To evaluate the biological activity of the peptide-doxorubin conjugates, the growth inhibition of the tumor cells in culture is measured.

0244The cells are seeded the day before in 96-well plates at the rate of 10 'cells per well. The next day, the supernatant is aspirated and replaced with 100 μl of medium containing successive dilutions of peptide-doxorubicin or native doxorubicin (10^-6 M-10^-8 M) and the culture continued for 48 hours.

0245The wells are then added with 50 μl of MTT (3- (4,5-dimethylthiazol-2yl) -2,5-diphenyl tetrazolium bromide) at 1 mg / ml in the culture medium and cultured for 4 hours. The supernatant is removed and the wells are added with 100 μl of dimethylsulfoxide. After dissolution of the crystals, the coloration is read at 550 nm.

0246The results are calculated as a percentage of the average optical density obtained in the cell wells containing the dilutions of the samples to be tested and of the optical density of the wells having received only medium. They are expressed in molar concentration giving 50% inhibition of cell growth and are reported in Table 14 below.<tables id="tabl0015" num="0015"><table frame="all"><title><u style="single">Table 14</u></title><tgroup cols="9"><colspec colnum="1" colname="col1" colwidth="34mm" /><colspec colnum="2" colname="col2" colwidth="15mm" /><colspec colnum="3" colname="col3" colwidth="15mm" /><colspec colnum="4" colname="col4" colwidth="18mm" /><colspec colnum="5" colname="col5" colwidth="18mm" /><colspec colnum="6" colname="col6" colwidth="15mm" /><colspec colnum="7" colname="col7" colwidth="15mm" /><colspec colnum="8" colname="col8" colwidth="16mm" /><colspec colnum="9" colname="col9" colwidth="19mm" /><thead><row><entry align="center" valign="top" /><entry namest="col2" nameend="col9" align="center" valign="top">Cell lines</entry></row><row><entry align="center" valign="top" /><entry align="center" valign="top">H1299</entry><entry align="center" valign="top">HH9</entry><entry align="center" valign="top">HeLa</entry><entry align="center" valign="top">B16. F10</entry><entry align="center" valign="top">K562</entry><entry align="center" valign="top">K562R</entry><entry valign="top">MCF7 *</entry><entry align="center" valign="top">MCF7R *</entry></row></thead><tbody><row><entry align="center">Doxoru bicine native</entry><entry align="center">3x10^-7</entry><entry align="center">3x10^-7</entry><entry align="center">2x10^-7</entry><entry align="center">1x10^-7</entry><entry>4x10^-8</entry><entry align="center">3x10-⁶</entry><entry align="center">2x10^-7</entry><entry align="center">2x10^-4</entry></row><row><entry align="center">(HBP1)₃ -Doxo</entry><entry align="center">7x10^-7</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">2x10^-7</entry><entry align="center">5x10^-6</entry><entry>6x10^-7</entry><entry align="center">1x10^-4</entry></row><row><entry align="center">(HBP3) ₂ -Doxo</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">1x10^-7</entry><entry align="center">3x10^-6</entry><entry align="center">5x10^-7</entry><entry align="center">2.5x10^-4</entry></row><row><entry align="center">HBP6-Doxo</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">3x10^-7</entry><entry align="center">5x10^-6</entry><entry align="center">6x10^-7</entry><entry align="center">6.5x10^-4</entry></row><row><entry align="center">HBP7-Doxo</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">1x10^-6</entry><entry align="center">1x10^-5</entry><entry align="center">7x 10^-7</entry><entry align="center">4x10^-4</entry></row><row><entry align="center">HBP10-Doxo</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">8x10^-7</entry><entry align="center">1x10^-5</entry><entry align="center">5x10^-7</entry><entry align="center">3.5x10^-4</entry></row><row><entry align="center">HBP13-Doxo</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">nt *</entry><entry align="center">4x10^-7</entry><entry align="center">5x10^-5</entry><entry align="center">6x10^-7</entry><entry align="center">4.5x10^-4</entry></row><row><entry align="center">HBP-1047-Doxo</entry><entry align="center">7x10^-7</entry><entry align="center">nt *</entry><entry align="center">2.5x10^-7</entry><entry align="center">5x10^-7</entry><entry>2x10^-7</entry><entry align="center">5x10^-6</entry><entry align="center">8x10^-7</entry><entry align="center">1x10^-3</entry></row></tbody></tgroup></table></tables>

0247It seems that, <i>in vitro,</i> the sensitivity of cells to peptide-doxorubicin conjugates is of the same order of magnitude as that of native doxorubicin. Doxorubicin resistant lines (K562R and MCF7R) require a higher concentration of doxorubicin.

vs)

Evaluation <i>in vivo</i> of the anti-tumor activity of peptide-doxorubicin conjugates.

0248Naked mice are injected with 3x10⁶ HH9 cells subcutaneously in the flank. On day 19 after the transplant of the cells, the tumors are measured and 4 groups of 6 mice are formed which receive in peritumoral injection either NaCl, or native doxorubicin or the conjugates 1047-doxorubicin or HBP1-doxorubine at a rate of 30 μg doxorubicin or equivalent conjugates every two weeks. Tumors are measured and their volume calculated. On day 60, after the injection of a total of 120 µg of doxorubicin or equivalent, tumor growth is inhibited by 77% with the 1047-doxorubicin conjugate, by 84% with the HBP1-doxorubicin conjugate and by 79%, respectively. with doxorubicin alone, which demonstrates that <i>in vivo</i> these conjugates are at least as effective as native doxorubicin.

d)

Evaluation <i>in vivo</i> toxicity of peptide-doxorubicin conjugates.

0249The intravenous injection of doxorubicin or doxorubicin-peptide makes it possible to compare the toxicity of the various preparations. The estimation is made by the weight loss of the mice (5 mice per group). Two experiments were made: Experiment 1: the mice received 200 μg by injection 3 days apart, ie 600 μg of doxorubicin or peptide-doxorubicin equivalent in total. The mice are weighed the day after the last injection. Experiment 2: The mice received 2 injections of 200 μg of doxorubicin or peptide-doxorubicin equivalent one week apart, ie 400 μg in total, and are weighed the day after the last injection. Table 15 below reports the weight loss of mice treated with doxorubicin or peptide-doxorubicin conjugates. The average weight loss is calculated relative to the average weight of the mice having received NaCl.<tables id="tabl0016" num="0016"><table frame="all"><title><u style="single">Table 15</u></title><tgroup cols="8"><colspec colnum="1" colname="col1" colwidth="18mm" /><colspec colnum="2" colname="col2" colwidth="13mm" /><colspec colnum="3" colname="col3" colwidth="14mm" /><colspec colnum="4" colname="col4" colwidth="14mm" /><colspec colnum="5" colname="col5" colwidth="14mm" /><colspec colnum="6" colname="col6" colwidth="14mm" /><colspec colnum="7" colname="col7" colwidth="15mm" /><colspec colnum="8" colname="col8" colwidth="15mm" /><thead><row><entry valign="top">Groups</entry><entry align="center" valign="top">NaCl</entry><entry align="center" valign="top">Doxo.</entry><entry align="center" valign="top">HBP3</entry><entry align="center" valign="top">HBP6</entry><entry align="center" valign="top">HBP7</entry><entry align="center" valign="top">HBP10</entry><entry align="center" valign="top">HBP13</entry></row><row><entry valign="top">Exp. 1</entry><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /></row></thead><tbody><row><entry>Weight</entry><entry align="center">23,11</entry><entry align="center">16,06</entry><entry align="center">21,45</entry><entry align="center">20,3</entry><entry align="center">19,11</entry><entry align="center">21,15</entry><entry align="center">** nt</entry></row><row><entry>Loss*</entry><entry align="center">-</entry><entry align="center">31*</entry><entry align="center">8</entry><entry align="center">12</entry><entry align="center">18</entry><entry align="center">9</entry><entry align="center">-</entry></row></tbody></tgroup><tgroup cols="8"><colspec colnum="1" colname="col1" colwidth="18mm" /><colspec colnum="2" colname="col2" colwidth="13mm" /><colspec colnum="3" colname="col3" colwidth="14mm" /><colspec colnum="4" colname="col4" colwidth="14mm" /><colspec colnum="5" colname="col5" colwidth="14mm" /><colspec colnum="6" colname="col6" colwidth="14mm" /><colspec colnum="7" colname="col7" colwidth="15mm" /><colspec colnum="8" colname="col8" colwidth="15mm" /><thead><row><entry valign="top">Exp. 2</entry><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /></row></thead><tbody><row><entry>Weight</entry><entry align="center">31,4</entry><entry align="center">26,7</entry><entry align="center">29,5</entry><entry align="center">29,5</entry><entry align="center">31,4</entry><entry align="center">32,5</entry><entry align="center">30</entry></row><row><entry>Loss*</entry><entry align="center">-</entry><entry align="center">15</entry><entry align="center">6</entry><entry align="center">6</entry><entry align="center">0</entry><entry align="center">0</entry><entry align="center">4</entry></row></tbody></tgroup><tgroup cols="8" rowsep="0"><colspec colnum="1" colname="col1" colwidth="18mm" /><colspec colnum="2" colname="col2" colwidth="13mm" /><colspec colnum="3" colname="col3" colwidth="14mm" /><colspec colnum="4" colname="col4" colwidth="14mm" /><colspec colnum="5" colname="col5" colwidth="14mm" /><colspec colnum="6" colname="col6" colwidth="14mm" /><colspec colnum="7" colname="col7" colwidth="15mm" /><colspec colnum="8" colname="col8" colwidth="15mm" /><tbody><row><entry namest="col1" nameend="col8" align="justify">*:% **: not tested</entry></row></tbody></tgroup></table></tables>At the dose of 600 μg, the mice having received the native doxorubicin lose 31% of their weight whereas those having received the peptide-doxorubicin lose only 18 to 8% of their weight. The 400 µg dose results in a 15% weight loss in mice receiving native doxorubicin, whereas with the peptide-doxorubicin conjugates, the loss is not significant.

8)

Transport of cytochrome C.

0250Cytochrome C is a hemoprotein that makes up the lipid-mitochondrial protein complex. It plays a vital role in cellular oxidations in plants and mammals. It is formed of a single polypeptide chain of 104 amino acids (molecular weight 13000 daltons) with the heme group attached to the cysteine ​​residues. The release of cytochrome C from the mitochondria into the cytosol leads to apoptosis of the cells by activation of the caspases.

at)

Coupling of cytochrome C to peptides.

02514 mg of cytochrome C in 930 µl of 0.1M sodium phosphate buffer, pH7 containing 0.15M NaCl are added 540 µg of SMCC (succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate) in 54 µl of dimethyl sulfoxide and the solution is incubated for 30 minutes at laboratory temperature. The excess reagent is removed by centrifugation on ultrafiltration membranes (cutoff threshold = 10,000 daltons, Sartorius), followed by three washes in 0.1M sodium phosphate buffer, pH7 containing 0.15M NaCl.

0252The coupling with the peptide is then carried out in a molar ratio of 10 peptides for 1 cytochrome C in 1 ml of 0.1M sodium phosphate buffer, pH 7 containing 0.15 M NaCl, for 3 hours at laboratory temperature. Then, the excess of uncoupled peptide is removed by centrifugation / filtration as in the previous step.

b)

Evaluation of the penetration of peptide-cytochrome C conjugates into cells.

0253The evaluation of the penetration of the cytochrome C peptide conjugates is carried out with conjugates prepared with peptides carrying a biotin on the N-terminal side.

0254H1299 cells are cultured in the presence of the different peptide (biotinylated) -cytochrome C conjugates at decreasing concentrations (100 to 25 μg / ml) in the culture medium for 4 hours at 37 ° C. At the end of the culture, the cells are washed three times with PBS, then fixed for 15 minutes in ethanol at -20 ° C. The penetration of the peptide-biotin-cytochrome C conjugate is evaluated after incubation for 60 minutes with avidin coupled to peroxidase. The cells are then washed with PBS and the activity of the peroxidase is revealed by diaminobenzidine in the presence of H₂O₂.

0255The penetration dependent on the concentration of the conjugates in the culture medium is evaluated under the microscope by the intensity of the coloration expressed by crosses. Table 16 shows the penetration of peptide-cytochrome C conjugates into cells.<tables id="tabl0017" num="0017"><table frame="all"><title><u style="single">Table 16</u></title><tgroup cols="4"><colspec colnum="1" colname="col1" colwidth="36mm" /><colspec colnum="2" colname="col2" colwidth="11mm" /><colspec colnum="3" colname="col3" colwidth="10mm" /><colspec colnum="4" colname="col4" colwidth="10mm" /><tbody><row><entry>Concentration (µg / ml)</entry><entry align="center">100</entry><entry align="center">50</entry><entry align="center">25</entry></row><row><entry>Native Cytochrome C</entry><entry align="center">-*</entry><entry align="center">-</entry><entry align="center">-</entry></row><row><entry>1047-cytochrome C</entry><entry align="center">+++</entry><entry align="center">++</entry><entry align="center">+</entry></row></tbody></tgroup><tgroup cols="4" rowsep="0"><colspec colnum="1" colname="col1" colwidth="36mm" /><colspec colnum="2" colname="col2" colwidth="11mm" /><colspec colnum="3" colname="col3" colwidth="10mm" /><colspec colnum="4" colname="col4" colwidth="10mm" /><tbody><row><entry namest="col1" nameend="col4" align="justify">+++ intense; ++: positive; + weakly positive; - negative.</entry></row></tbody></tgroup></table></tables>

0256The table above shows that the native cytochrome C does not penetrate into the cells and that the 1047-cytochrome C conjugate effectively penetrates up to 25 μg / ml.

c) Assessment of biological activity <i>in vitro</i> peptide-cytochrome C conjugates.

0257H1299 or HT29 cells (3 x 10⁴ cells / well) are cultured in 96-well plates for 48 hours at 37 ° C. in the complete RPMI culture medium supplemented with decreasing concentrations (200-3 μg / ml) of native cytochrome C or conjugated to the peptides and the culture continued. for 48 hours.

0258The wells are then added with 50 μl of MTT (3 -, (4,5-dimethylthiazol-2yl) -2,5-diphenyl tetrazolium bromide) at 1 mg / ml in the culture medium and cultured for 4 hours.

0259The supernatant is removed and the wells are added with 100 μl of dimethylsulfoxide. After dissolution of the crystals, the coloration is read at 550 nm.

0260The results are calculated as a percentage of the average optical density obtained in the cell wells containing the dilutions of the samples to be tested and of the optical density of the wells having received only medium. Table 17 shows the inhibition of cell growth by peptide-ubiquitin conjugates.<tables id="tabl0018" num="0018"><table frame="all"><title><u style="single">Table 17</u></title><tgroup cols="7"><colspec colnum="1" colname="col1" colwidth="36mm" /><colspec colnum="2" colname="col2" colwidth="11mm" /><colspec colnum="3" colname="col3" colwidth="11mm" /><colspec colnum="4" colname="col4" colwidth="10mm" /><colspec colnum="5" colname="col5" colwidth="12mm" /><colspec colnum="6" colname="col6" colwidth="12mm" /><colspec colnum="7" colname="col7" colwidth="10mm" /><thead><row><entry valign="top">On the H1299 cells</entry><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /></row></thead><tbody><row><entry>Concentration (µg / ml)</entry><entry align="center">100</entry><entry align="center">50</entry><entry align="center">25</entry><entry align="center">12,5</entry><entry align="center">6</entry><entry align="center">3</entry></row><row><entry>Native Cytochrome C</entry><entry align="center">0*</entry><entry align="center">0</entry><entry align="center">0</entry><entry align="center">0</entry><entry align="center">0</entry><entry align="center">0</entry></row><row><entry>1047-cytochrome C</entry><entry align="center">46</entry><entry align="center">40</entry><entry align="center">29</entry><entry align="center">15</entry><entry align="center">14</entry><entry align="center">0</entry></row></tbody></tgroup><tgroup cols="7"><colspec colnum="1" colname="col1" colwidth="36mm" /><colspec colnum="2" colname="col2" colwidth="11mm" /><colspec colnum="3" colname="col3" colwidth="11mm" /><colspec colnum="4" colname="col4" colwidth="10mm" /><colspec colnum="5" colname="col5" colwidth="12mm" /><colspec colnum="6" colname="col6" colwidth="12mm" /><colspec colnum="7" colname="col7" colwidth="10mm" /><thead><row><entry valign="top">On HT29 cells</entry><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /></row></thead><tbody><row><entry>Concentration (µg / ml)</entry><entry align="center">200</entry><entry align="center">100</entry><entry align="center">50</entry><entry align="center">25</entry><entry align="center">12,5</entry><entry align="center" /></row><row><entry>Native Cytochrome C</entry><entry align="center">12*</entry><entry align="center">19</entry><entry align="center">10</entry><entry align="center">0</entry><entry align="center">0</entry><entry align="center" /></row><row><entry>1047-cytochrome C</entry><entry align="center">28</entry><entry align="center">23</entry><entry align="center">23</entry><entry align="center">0</entry><entry align="center">0</entry><entry align="center" /></row><row><entry>HBP3-cytochrome C</entry><entry align="center">42</entry><entry align="center">22</entry><entry align="center">15</entry><entry align="center">0</entry><entry align="center">0</entry><entry align="center" /></row><row><entry>HBP6-cytochrome C</entry><entry align="center">41</entry><entry align="center">18</entry><entry align="center">12</entry><entry align="center">2</entry><entry align="center">0</entry><entry align="center" /></row><row><entry>HBP7-cytochrome C</entry><entry align="center">35</entry><entry align="center">14</entry><entry align="center">5</entry><entry align="center">0</entry><entry align="center">0</entry><entry align="center" /></row></tbody></tgroup><tgroup cols="7" rowsep="0"><colspec colnum="1" colname="col1" colwidth="36mm" /><colspec colnum="2" colname="col2" colwidth="11mm" /><colspec colnum="3" colname="col3" colwidth="11mm" /><colspec colnum="4" colname="col4" colwidth="10mm" /><colspec colnum="5" colname="col5" colwidth="12mm" /><colspec colnum="6" colname="col6" colwidth="12mm" /><colspec colnum="7" colname="col7" colwidth="10mm" /><tbody><row><entry namest="col1" nameend="col7" align="justify">*% of inhibition calculated relative to the growth of cells having received only culture medium</entry></row></tbody></tgroup></table></tables>

0261The table above shows the efficacy of peptide-cytochrome C conjugates on two types of cells. Native cytochrome C does not inhibit growth. At 50 µg / ml the most effective peptide on HT29 cells is peptide 1047, the peptides HBP3 and HBP6 give intermediate values, while the peptide HBP) ​​is not very active at this concentration.

9) Transport of anti-tumor and anti-inflammatory substances using the peptides of the invention.

Transport of phthalic acid derivative.

0262N-phthalimidoglutarimide (thalidomide) is a molecule which has a wide variety of properties such as the teratogenic effect, the reduction of TNF-α production by monocytes, the suppression of angiogenesis. It has been shown that the teratogenic activity depends on the glutarimide residue while the antiangiogenic effect depends on the phthaloyl group. We therefore prepared the peptide SEQ ID NO: 46 derived from the peptide SEQ ID NO: 26 (HBP3)₂ to which was added N-terminal glycyl phthaloyl. well having received only medium. The technique used to test the activity of phthaloyl-HBP3 is the same as that described above for aspirin.

0263The results of the inhibition of the growth (%) of the HT29 cells shown in Table 18 are calculated as a percentage of the average optical density obtained in the cell wells containing the dilutions of the samples to be tested and of the average optical density of the wells cells having received only medium.<tables id="tabl0019" num="0019"><table frame="all"><title><u style="single">Table 18</u></title><tgroup cols="5"><colspec colnum="1" colname="col1" colwidth="36mm" /><colspec colnum="2" colname="col2" colwidth="12mm" /><colspec colnum="3" colname="col3" colwidth="11mm" /><colspec colnum="4" colname="col4" colwidth="11mm" /><colspec colnum="5" colname="col5" colwidth="11mm" /><thead><row><entry valign="top">Concentration (µg / ml)</entry><entry align="center" valign="top">1000</entry><entry align="center" valign="top">500</entry><entry align="center" valign="top">200</entry><entry align="center" valign="top">100</entry></row></thead><tbody><row><entry>Phthaloyl-HBP3</entry><entry align="center">66</entry><entry align="center">28</entry><entry align="center">29</entry><entry align="center">20</entry></row><row><entry>HBP3</entry><entry align="center">2</entry><entry align="center">0</entry><entry align="center">0</entry><entry align="center" /></row></tbody></tgroup><tgroup cols="5" rowsep="0"><colspec colnum="1" colname="col1" colwidth="36mm" /><colspec colnum="2" colname="col2" colwidth="12mm" /><colspec colnum="3" colname="col3" colwidth="11mm" /><colspec colnum="4" colname="col4" colwidth="11mm" /><colspec colnum="5" colname="col5" colwidth="11mm" /><tbody><row><entry namest="col1" nameend="col5" align="justify">*%</entry></row></tbody></tgroup></table></tables>

0264It appears that the phthaloyl derivative inh ibes the growth of HT29 cells.

10)

Increase in the activity of antimicrobial substances using peptides of the invention.

Lysozyme.

0265Lysozyme is one of the major constituents of granules of human polynuclear lymphocytes. It is also found in secretions. It is a muraminidase. Lysozyme lyses and kills Gram-positive microorganisms by modifying the peptidoglycans on their surface. Since lysozyme cannot easily penetrate the outer membrane of the bacteria, coupling lysozyme to peptides can help penetration

-

Coupling of peptides with lysozyme.

02668 mg of lysozyme in 2.7 ml of 0.1M sodium phosphate buffer, pH7 containing 0.15M NaCl are added with 1.8 mg of SMCC (succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate) in 186 ml µl of dimethyl sulfoxide and the solution is incubated for 30 minutes at laboratory temperature. The excess reagent is removed by centrifugation on ultrafiltration membranes (cutoff threshold = 5000 daltons, Sartorius), followed by three washes in 0.1M sodium phosphate buffer, pH7 containing 0.15M NaCl.

0267The coupling with the peptide is then carried out in a molar ratio of 5 peptides for 1 lysozyme in 1 ml of 0.1M sodium phosphate buffer, pH7 containing 0.15M NaCl, for 3 hours at laboratory temperature. Then the excess of uncoupled peptide is removed by centrifugation on membranes, as in the previous step.

-

Evaluation of the activity of lysozyme coupled to peptides.

0268The Escherischia coli gram-positive bacterial strain (ATCC25922) is cultured up to the semi-logarithmic phase in Luria-Bertani (LB) medium. The bacteria are collected by centrifugation and resuspended in the medium 1% bacto-peptone at a concentration of 5x10⁵ cfu / ml (colony forming unit / ml) The lysozyme or the peptide-lysozyme conjugates are diluted from half to half (256 to 0.5 μg / ml in the bacto-peptone medium and 50 μl are distributed in 96-well plates. µl of the dilution of bacteria are then added to each well After 16 hours of incubation at 37 ° C, 10 µl of each well is spread on plates of agar in LB medium. After 18 hours of incubation at 37 ° C, the minimum bactericidal concentration (MBC) is determined as the concentration of lysozyme or lysozyme-peptide which inhibits 75% of growth.

-

Results.

0269Table 19 reports growth inhibition of <i>E. coli</i> (MBC µg / ml).<tables id="tabl0020" num="0020"><table frame="all"><title><u style="single">Table 19</u></title><tgroup cols="2"><colspec colnum="1" colname="col1" colwidth="33mm" /><colspec colnum="2" colname="col2" colwidth="13mm" /><tbody><row><entry>Native lysozyme</entry><entry>> 256</entry></row><row><entry>1047-Lysozyme</entry><entry>32</entry></row><row><entry>(HBP1)₃-Lysozyme</entry><entry>4</entry></row><row><entry>(HBP3)₂-Lysozyme</entry><entry>16</entry></row><row><entry>HBP6-Lysozyme</entry><entry>16</entry></row></tbody></tgroup></table></tables>

0270Peptide-lysozyme conjugates have more effective antibacterial activity than that of native lysozyme.

REFERENCES

0271<ol id="ol0003" compact="compact"><li>1) <nplcit id="ncit0001" npl-type="s"><text>Cardin AD &amp; Weintraub HJR Artheriosclerosis 9:21 (1989</text></nplcit>)</li><li>2) <nplcit id="ncit0002" npl-type="s"><text>Merton B. et al. Annu. Rev. Cell Biol. 8: 365 (1992</text></nplcit>)</li><li>3) <nplcit id="ncit0003" npl-type="s"><text>David G. FASEB J. 7: 1023 (1993</text></nplcit>)</li><li>4) <nplcit id="ncit0004" npl-type="s"><text>Salmivira M &amp; Jalkanen M Experentia 51: 863 (1995</text></nplcit>)</li><li>5) <nplcit id="ncit0005" npl-type="s"><text>Caldwell et al. Int. J. Biochem. Cell Biol. 28: 203 (1996</text></nplcit>)</li><li>6) <nplcit id="ncit0006" npl-type="s"><text>Fromm JR et al. Arch. Biochem. Bioph. 343: 92 (1997</text></nplcit>)</li><li>7) <nplcit id="ncit0007" npl-type="s"><text>Hirsch J. New Engl. J. Med. 324: 1565 (1991</text></nplcit>)</li><li>8) <nplcit id="ncit0008" npl-type="s"><text>Castellot JJ et al. J. Cell Biol. 102: 1979 (1986</text></nplcit>)</li><li>9) <nplcit id="ncit0009" npl-type="s"><text>Ruoslahti E. &amp; Yamazuchi Y. Cell 64: 867 (1991</text></nplcit>)</li><li>10) <nplcit id="ncit0010" npl-type="s"><text>Robinson DS Adv.Lip. Res. 1: 1 (1963</text></nplcit>)</li><li>11) <nplcit id="ncit0011" npl-type="s"><text>Kallunski P. &amp; Tryggvason KJ Cell Biol. 116: 559 (1992</text></nplcit>)</li><li>12) <nplcit id="ncit0012" npl-type="s"><text>Cardin AD et al. Biochem. Biophys. Res. Com. 154: 741 (1988</text></nplcit>)</li><li>13) <nplcit id="ncit0013" npl-type="s"><text>Avrameas A. et al. Proc. Natl. Acad. Sci. 95: 5601 (1998</text></nplcit>)</li><li>14) <nplcit id="ncit0014" npl-type="s"><text>Stevenson FK et al. J. Autoimmunity 6: 809 (1993</text></nplcit>)</li><li>15) <nplcit id="ncit0015" npl-type="s"><text>Hirabayashi Y. et al. Scand. J. Immunol. 37: 533 (1993</text></nplcit>)</li><li>16) <nplcit id="ncit0016" npl-type="s"><text>Kalsi JK et al. Lupus 4: 375 (1995</text></nplcit>)</li><li>17) <nplcit id="ncit0017" npl-type="s"><text>Campanelli JT, Gayer GG and Scheller RH Development (1996) 122: 1663-1672</text></nplcit></li><li>18) <nplcit id="ncit0018" npl-type="s"><text>Fowlkes JL, Thrailkill KM, George-Nascimento C., Rosenberg CK &amp; Serra DM. Endocrinol (1997) 138: 2280-2285</text></nplcit>.</li><li>19) <nplcit id="ncit0019" npl-type="s"><text>Maher DW, Lee BA &amp; Donoghue DJ Mol Cell Biol (1989) 9: 2251-2253</text></nplcit>.</li><li>20) <nplcit id="ncit0020" npl-type="s"><text>Inoue M., Watanabe N., Morino Y., Tanaka Y., Amachi T &amp; Sasaki J. FEBS (1990) 269: 89-92</text></nplcit>.</li><li>21) <nplcit id="ncit0021" npl-type="s"><text>Pasqualini R., Koivunen E. &amp; Ruoslahti E. Nature Biotech. (1997) 15: 542-546</text></nplcit></li><li>22) <nplcit id="ncit0022" npl-type="s"><text>Arkonac BM, Foster LC, Sibinga NES, Patterson C, Lai K, Tsai JC, Lee ME, Perrella MA &amp; Haber E. J Biol Chem (1998) 273: 4400-4405</text></nplcit>.</li><li>23) <nplcit id="ncit0023" npl-type="s"><text>Yayon A, Klagsbrun M, Esko JD, Leder P. &amp; Ornitz DM .. Cell (1991) 64: 841-848</text></nplcit>.</li><li>24) <nplcit id="ncit0024" npl-type="s"><text>Gongqiao XU, Fornster GG &amp; Fornster JF Glyconjug J. (1996) 13: 81-90</text></nplcit>.</li><li>25) <nplcit id="ncit0025" npl-type="s"><text>Lortat-Jacob H &amp; Grimaud JA. FEBS (1991) 280: 152-154</text></nplcit>.</li><li>26) <nplcit id="ncit0026" npl-type="s"><text>Hasan M., Najjam S., Gordon MY, Gibbs RV &amp; Rider CC. J Immunol (1999) 162: 1064-1070</text></nplcit>.</li><li>27) <nplcit id="ncit0027" npl-type="s"><text>Amara A, Lorthioir O, Valenzuela A, Magerus A, Thelen M, Montes M, Virelizier JL, Delepierre M, Baleux F, J. Biol. Chem. (1999) 272: 200-204</text></nplcit>.</li><li>28) <nplcit id="ncit0028" npl-type="s"><text>Pohl J, Pereira HA, Martin NM &amp; Spitznagel JK. Aminoacid sequence of CAP37 FEBS (1990) 272: 200-204</text></nplcit>.</li><li>29) <nplcit id="ncit0029" npl-type="s"><text>Javad for MM, Juban MM, Lo WCJ, Bishop SM, lberty JB. Cowell SSM, Becher CL &amp; McLaughilin ML. J Med Chem (1996) 39: 3107-3113</text></nplcit></li><li>30) <nplcit id="ncit0030" npl-type="b"><text>Ternynck T. and Avrameas S. "Techniques immunoenzymatiques" Editions INSERM (1987</text></nplcit>)</li></ol>

SEQUENCE LIST

0272<ul id="ul0006" list-style="none"><li>110> DIATOS SA</li><li>120> AMINO ACID SEQUENCES TO FACILITATE THE PENETRATION OF A SUBSTANCE OF INTEREST INSIDE CELLS AND / OR CELLULAR CORES.</li><li>130> 12052 / PCT / EP / DIV</li><li>140> <patcit id="pcit0013" dnum="FROO02621W"><text>PCT / FROO / 02621</text></patcit> 141> 2001-03-01</li><li>150> <patcit id="pcit0014" dnum="FR0002621"><text>FR00 / 02621</text></patcit> 151> 2000-03-01</li><li>160> 48</li><li>170> PatentIn version 3.0</li><li>210> 1 211> 7 212> PRT 213> Homo sapiens</li><li>400> 1 <img file="EP1526183B1_D0001.tif" /></li><li>210> 2 211> 14 212> PRT 213> Homo sapiens</li><li>400> 2 <img file="EP1526183B1_D0002.tif" /></li><li>210> 3 211> 21 212> PRT 213> Homo sapiens</li><li>400> 3 <img file="EP1526183B1_D0003.tif" /></li><li>210> 4 211> 11 212> PRT 213> Mus musculus x Rattus norvegicus</li><li>400> 4 <img file="EP1526183B1_D0004.tif" /></li><li>210> 5 211> 18 212> PRT 213> Homo sapiens-Mus musculus-Rattus Norvegicus</li><li>400> 5 <img file="EP1526183B1_D0005.tif" /></li><li>210> 6 211> 20 212> PRT 213> Mus musculus x Rattus norvegicus</li><li>400> 6 <img file="EP1526183B1_D0006.tif" /></li><li>210> 7 211> 27 212> PRT 213> Homo sapiens-Mus musculus-Rattus Norvegicus</li><li>400> 7 <img file="EP1526183B1_D0007.tif" /></li><li>210> 8 211> 17 212> PRT 213> Homo sapiens</li><li>400> 8 <img file="EP1526183B1_D0008.tif" /></li><li>210> 9 211> 24 212> PRT 213> Homo sapiens</li><li>400> 9 <img file="EP1526183B1_D0009.tif" /></li><li>210> 10 211> 19 212> PRT 213> Homo sapiens</li><li>400> 10 <img file="EP1526183B1_D0010.tif" /></li><li>210> 11 211> 19 212> PRT 213> Homo sapiens</li><li>400> 11 <img file="EP1526183B1_D0011.tif" /></li><li>210> 12 211> 27 212> PRT 213> Mus musculus x Rattus norvegicus</li><li>400> 12 <img file="EP1526183B1_D0012.tif" /></li><li>210> 13 211> 31 212> PRT 213> Homo sapiens</li><li>400> 13 <img file="EP1526183B1_D0013.tif" /></li><li>210> 14 211> 28 212> PRT 213> Mus musculus x Rattus norvegicus</li><li>400> 14 <img file="EP1526183B1_D0014.tif" /></li><li>210> 15 211> 24 212> PRT 213> Homo sapiens</li><li>400> 15 <img file="EP1526183B1_D0015.tif" /></li><li>210> 16 211> 31 212> PRT 213> Homo sapiens</li><li>400> 16 <img file="EP1526183B1_D0016.tif" /></li><li>210> 17 211> 8 212> PRT 213> Homo sapiens</li><li>400> 17 <img file="EP1526183B1_D0017.tif" /></li><li>210> 18 211> 4 212> PRT 213> Homo sapiens</li><li>400> 18 <img file="EP1526183B1_D0018.tif" /></li><li>210> 19 211> 8 212> PRT 213> Homo sapiens</li><li>400> 19 <img file="EP1526183B1_D0019.tif" /></li><li>210> 20 211> 12 212> PRT 213> Homo sapiens</li><li>400> 20 <img file="EP1526183B1_D0020.tif" /></li><li>210> 21 211> 17 212> PRT 213> Homo sapiens</li><li>400> 21 <img file="EP1526183B1_D0021.tif" /></li><li>210> 22 211> 32 212> PRT 213> Mus musculus x Rattus norvegicus</li><li>400> 22 <img file="EP1526183B1_D0022.tif" /></li><li>210> 23 211> 30 212> PRT 213> Mus musculus x Rattus norvegicus</li><li>400> 23 <img file="EP1526183B1_D0023.tif" /></li><li>210> 24 211> 14 212> PRT 213> Homo sapiens</li><li>900> 24 <img file="EP1526183B1_D0024.tif" /></li><li>210> 25 211> 18 212> PRT 213> Homo sapiens</li><li>400> 25 <img file="EP1526183B1_D0025.tif" /></li><li>210> 26 211> 18 212> PRT 213> Homo sapiens</li><li>400> 26 <img file="EP1526183B1_D0026.tif" /></li><li>210> 27 211> 18 212> PRT 213> Homo sapiens</li><li>220> 221> misc_feature 222> () .. () 223> All amino acids are in configuration D 400> 27<img file="EP1526183B1_D0027.tif" /><img file="EP1526183B1_D0028.tif" /></li><li>210> 28 211> 16 212> PRT 213> Homo sapiens</li><li>400> 28 <img file="EP1526183B1_D0029.tif" /></li><li>210> 29 211> 15 212> PRT 213> Homo sapiens</li><li>400> 29 <img file="EP1526183B1_D0030.tif" /></li><li>210> 30 211> 15 212> PRT 213> Homo sapiens</li><li>400> 30 <img file="EP1526183B1_D0031.tif" /></li><li>210> 31 211> 16 212> PRT 213> Homo sapiens</li><li>220> 221> misc_feature 222> () .. () 223> The amino acids are in the duplex position</li><li>400> 31 <img file="EP1526183B1_D0032.tif" /></li><li>210> 32 211> 14 212> PRT 213> Homo sapiens</li><li>220> 221> misc_feature 222> () .. () 223> All the amino acids are in configuration D.</li><li>400> 32 <img file="EP1526183B1_D0033.tif" /></li><li>210> 33 211> 13 212> PRT 213> Homo sapiens</li><li>400> 33 <img file="EP1526183B1_D0034.tif" /></li><li>210> 34 211> 15 212> PRT 213> Homo sapiens</li><li>400> 34 <img file="EP1526183B1_D0035.tif" /></li><li>210> 35 211> 14 212> PRT 213> Homo sapiens</li><li>400> 35 <img file="EP1526183B1_D0036.tif" /></li><li>210> 36 211> 10 212> PRT 213> Homo sapiens</li><li>400> 36 <img file="EP1526183B1_D0037.tif" /></li><li>210> 37 211> 13 212> PRT 213> Homo sapiens</li><li>400> 37 <img file="EP1526183B1_D0038.tif" /></li><li>210> 38 211> 12 212> PRT 213> Homo sapiens</li><li>400> 38 <img file="EP1526183B1_D0039.tif" /></li><li>210> 39 211> 17 212> PRT 213> Homo sapiens</li><li>400> 39 <img file="EP1526183B1_D0040.tif" /></li><li>210> 40 211> 32 212> PRT 213> Homo sapiens</li><li>400> 40 <img file="EP1526183B1_D0041.tif" /></li><li>210> 41 211> 31 212> PRT 213> Homo sapiens</li><li>400> 41 <img file="EP1526183B1_D0042.tif" /></li><li>210> 42 211> 27 212> PRT 213> Homo sapiens</li><li>400> 42 <img file="EP1526183B1_D0043.tif" /></li><li>210> 43 211> 21 212> PRT 213> synthetic peptide</li><li>400> 43 <img file="EP1526183B1_D0044.tif" /></li><li>210> 44 211> 29 212> PRT 213> Synthetic peptide</li><li>400> 44 <img file="EP1526183B1_D0045.tif" /></li><li>210> 45 211> 26 212> PRT 213> Synthetic peptide</li><li>400> 45 <img file="EP1526183B1_D0046.tif" /></li><li>210> 46 211> 18 212> PRT 213> Homo sapiens</li><li>220> 221> misc_feature 222> () .. () 223> Glycine-phthaloyl residue in N-terminal position (X).</li><li>400> 46 <img file="EP1526183B1_D0047.tif" /></li><li>210> 47 211> 18 212> PRT 213> Homo sapiens</li><li>220> 221> misc_feature 222> () .. () 223> Presents a salicylyl motif (named X) in the N-terminal position.</li><li>400> 47 <img file="EP1526183B1_D0048.tif" /></li><li>210> 48 211> 19 212> PRT 213> Homo sapiens</li><li>220> 221> mise_feature 222> () .. () 223> Presents a salicylyl motif (named X) in the C-terminal position.</li><li>400> 48 <img file="EP1526183B1_D0049.tif" /></li></ul>