Methods and means to promote gut absorption

The present invention relates to epidermal growth factor (EGF) producing lactic acid bacteria and their use to increase intestinal villi height and to promote gut absorption. In particular, the invention relates to EGF producing <i>Lactococcus lactis</i> and <i>Lactobacillus casei.</i> Said organisms may be especially useful to treat short bowel syndrome.

The efficiency of gut absorption is essential for a good food conversion. Gut adsorption is largely determined by the gut surface, which is function, amongst others, of the length of the gut and the height of the villi. In cases where an operative removal of a part of the gut is necessary, as in the case of cancer or Crohn's disease, this may result in decreased gut adsorption, resulting in an unsufficient food conversion and a shortage of nutrients, dehydratation and even potentially lethal metabolic changes. These syndromes caused by the extensive resection of the small intestine are known as the Short Bowel Syndrome. Several methods have been proposed to improve the post operational adaptation of and to enhance the gut absorption in patients with the Short Bowel Syndrome. <patcit id="pcit0001" dnum="US5288703A"><text>US5288703</text></patcit> discloses that both growth hormone and insulin like growth factor do have a positive effect on gut absorption in mammals. This positive effect can be enhanced by the administration of glutamine or glutamine equivalent. Administration of glutamine and growth hormone results in an increase of the villi length (Gu <i>et al. ,</i> 2001; Zhou <i>et al.,</i> 2001). <patcit id="pcit0002" dnum="US5972887A"><text>US5972887</text></patcit> demonstrated a reversal of the reduced intestinal mucosal mass and absorptive function in patients by the administration of low doses of exogenous Hepatocyte Growth Factor. Also the glucagon-like peptides GLP-1 and GLP-2 have been used with positive results. Studies on laboratory animals (Scott <i>et al.,</i> 1998) as wall as on humans (Jeppesen <i>et al.,</i> 2001) showed a positive correlation between an increase in concentration of GLP-2 and an improvement of the intestinal adaptation. Short Bowel patients, of whom the ileum has been removed show a decrease in food-induced secretion of GLP-2 (Jeppesen <i>et al.,</i> 1999). Especially those patients can be treated successfully with GLP-2. It has been shown that also leptin has a positive effect on intestinal adaptation in a rat model (Pearson <i>et al.,</i> 2001).

A lot of interest has been paid to the effect of Epidermal Growth Factor (EGF, urogastron). EGF is a relatively acid stable hormone that is produced in the salivary and the Brunner's glands. It is found in a wide variety of external secretions as well as in blood and amniotic fluid (Marti <i>et al</i>., 1989). The molecular weight of mature human EGF is 6.2 kDa (Carpenter <i>et al</i>., 1991). EGF is phylogenetically strongly conserved and is strongly cross-reactive between different species.

It is known that EGF increases the absorption of H₂O, Na⁺, Cl^- and glucose in a rabbit model (Opleta-Madsen <i>et al.</i> 1991). Moreover, EGF is stimulating the elongation of the villi. This results in an increase of the apical surface and a general increase in absorption of nutrients (Hardin <i>et al.,</i> 1999). Absorption of carbohydrates is further facilitated by the EGF-stimulated secretion of pancreatic amylase (Piiper <i>et al.,</i> 1994)

Several studies have shown a positive effect of the application of EGF in experimental animal models for Short bowel syndrome (Helmrath <i>et al.,</i> 1988; Chaet <i>et al.,</i> 1994; O'Loughlin <i>et al.,</i> 1994; Swaniker <i>et al.,</i>1996; Lukish <i>et al.,</i> 1997 ; Dunn <i>et al.,</i> 1997).

EGF-mediated effects after intestinal resection are strongly dose dependent: up to a certain limit, the adaptation increases with increasing doses. In intestinal studies, the normal dose is situated between 30 and 300µg/kg body weight/day. Systemical as well as enteral application seem effective. However, systemical application may be unwanted for possible side effects: several neoplasmas do have EGF receptors, and a general increase in EGF concentration in the blood might stimulate the formation of tumors. Enteral application of EGF, however, is less efficient as pepsin can process mature EGF into a truncated form that has only 25% of the initial biological activity (Playford <i>et al.,</i> 1995).

Surprisingly, we were able to demonstrate that EGF can be delivered in situ by recombinant lactic acid bacteria producing EGF. Efficient production and secretion of EGF by lactic acid bacteria is not evident, and needs optimalization of the coding sequence. Moreover, it can not be forecasted that the lactic acid bacteria sufficiently survive the passage through the stomach to produce the appropriate amount of EGF to stimulate growth of the villi, to promote nutrient absorption and to treat the short bowel syndrome.

It is a first aspect of the invention to provide an EGF producing lactic acid bacterium. Preferably, said lactic acid bacterium is secreting the EGF produced in the growth environment. Preferably, said lactic acid bacterium is a <i>Lactococcus lactis</i> or a <i>Lactobacillus casei.</i> Even more preferably, said lactic acid bacterium comprises SEQ ID N° 1 and/or SEQ ID N° 3. A preferred embodiment is an EGF producing <i>Lactococcus lactis</i> comprising SEQ ID N° 3. Another preferred embodiment is an EGF producing <i>Lactobacillus casei</i> comprising SEQ ID N°3.

Another aspect of the invention is the use of an EGF producing lactic acid bacterium according to the invention to promote gut absorption. Methods to measure gut absorption are know to the person skilled in the art. Still another aspect of the invention is the use of an EGF producing lactic acid bacterium according to the invention to treat the Short Bowel syndrome. Preferably, the lactic acid bacterium according to the invention is applied orally; it may be treated by any treatment know to the person skilled in the art to improve its survival during the passage of the intestinal system. As a non-limiting example, it may be freeze-dried or spray dried, and/or encapsulated in a suitable recipient so that the bacteria are only released in the small intestine. Encapsulation and treatments for delivery in the small intestine have been described, amongst others in <patcit id="pcit0003" dnum="US5972685A"><text>US5972685</text></patcit>, <patcit id="pcit0004" dnum="WO0018377A"><text>WO0018377</text></patcit> and <patcit id="pcit0005" dnum="WO0022909A"><text>WO0022909</text></patcit>.

The lactic acid bacterium, according to the invention, may be combined with other compounds, having a positive effect on gut absorption, and/or enhancing the positive effect of EGF. As a non-limited example, glutamine can be used in combination of the lactic acid bacterium according to the invention.

BRIEF DESCRIPTION OF THE FIGURES

<ul id="ul0001" list-style="none" compact="compact"><li><figref idref="f0001"><b>Figure 1</b></figref>: Outline of the construction of pT1hEGF. The construction of pT1mEGF is carried out in a similar way.</li><li><figref idref="f0002"><b>Figure 2</b></figref>: Expression of mEGF (A) and hEGF (B) in <i>L. lactis</i> and <i>L. casei.</i> Supernatant of the cultures as indicated is separated on a 20% polyacrylamide gel and the proteins are detected using a Western blot</li><li><figref idref="f0003"><b>Figure 3</b></figref>: Average villus length of the mice treated with either <i>Lactococcus lactis</i> or <i>Lactobacillus casei,</i> transformed with the empty vector pT1NX (pT1NX), with the vector pT1mEGF, expressing murine EGF (mEGF) or with the vector pT1hEGF expressing human EGF (hEGF). Medium BM9 treated mice are used as additional negative control (BM9)</li></ul>

EXAMPLES

Media and strains

<dl id="dl0001"><dt><i>M17:</i></dt><dd>- 5 g Bacto Tryptone - 5 g Bacto Soytone - 5 g Meat Digest - 2,5 g Yeast Digest - 0,5 g ascorbic acid - 0,25 g MgSO₄ -19 g disodium-β-glycerolphosphate in 1 l deionized H₂O</dd></dl><i>GM17:</i> M17 with 0.5% glucose <dl id="dl0002"><dt><i>Recuperation medium:</i></dt><dd>- 1 ml 2 × M17 - 0 .5 ml 2 M sucrose - 50 µl 20% glucose - 40 µl 1M MgCl₂ - 4 µl 1M CaCl₂ - 406 µl H₂O</dd></dl> Agar medium is obtained by adding 1.2 % agar <dl id="dl0003" compact="compact"><dt><i>BM9 expression medium</i></dt><dd>- 60 g Na₂HPO₄ - 30 g KH₂PO₄, - 10 g NH₄Cl - 5 g NaCl. - 50 Mm CO₃-buffer - 2 mM MgSO₄ - 0,1 mM CaCl₂ - 0,5% casiton (Difco) - 0,5% glucose in 1 liter H₂O</dd></dl><i>L. lactis</i> MG1363 is a plasmid and prophage free derivative of the <i>L. lactis</i> strain NCDO 712 (Gasson, 1983)

Example 1: optimising the EGF coding sequence for expression in <i>Lactococcus</i>

Both the murine as well as the human are available in the public databases (http//:www.ncbi.nlm.nih.gov accession number X04571 for hEGF and NM_010113 for mEGF). The coding sequences were adapted to optimize the expression in <i>Lactococcus.</i> On the base of these sequences, primer sets were designed to assemble the optimized coding sequences of both hEGF and mEGF. At the 3' end of the coding sequence, a Spel restricition site was introduced. The primers are shown in table 1 (hEGF) and table 2 (m EGF). <tables id="tabl0001" num="0001"><table frame="all"><title>Table 1 : oligo's used for assembly of hEGF, and the amount available</title><tgroup cols="3" colsep="0"><colspec colnum="1" colname="col1" colwidth="18mm" /><colspec colnum="2" colname="col2" colwidth="93mm" /><colspec colnum="3" colname="col3" colwidth="19mm" colsep="1" /><thead><row><entry namest="col1" nameend="col2" align="left" valign="top"><b>Sense</b></entry><entry valign="top" /></row></thead><tbody><row rowsep="0"><entry>HEGF01</entry><entry>AACTCAGATTCAGAATGTCCACTTTCACACGATGGTTACT</entry><entry>33,3 nmol</entry></row><row rowsep="0"><entry>HEGF02</entry><entry>GTTTGCACGATGGTGTTTGTATGTACATCGAAGCTCTTGA</entry><entry>34,8 nmol</entry></row><row rowsep="0"><entry>HEGF03</entry><entry>TAAATACGCTTGTAACTGTGTTGTTGGTTACATCGGTGAA</entry><entry>26,9 nmol</entry></row><row rowsep="0"><entry>HEGF04</entry><entry>CGTTGTCAATACCGTGATTTGAAATGGTGGGAACTTCGTT</entry><entry>28,8 nmol</entry></row><row><entry>HEGF05</entry><entry>AACTAGTCTGCAGAATCTAG</entry><entry>29,7 nmol</entry></row></tbody></tgroup><tgroup cols="3" colsep="0"><colspec colnum="1" colname="col1" colwidth="18mm" /><colspec colnum="2" colname="col2" colwidth="93mm" /><colspec colnum="3" colname="col3" colwidth="19mm" colsep="1" /><thead><row><entry namest="col1" nameend="col3" align="left" valign="top"><b>Antisense</b></entry></row></thead><tbody><row rowsep="0"><entry>HEGF06</entry><entry>CTAGATTCTGCAGACTAGTTAACGAAGTTCCCACCATTTC</entry><entry>31,1 nmol</entry></row><row rowsep="0"><entry>HEGF07</entry><entry>AAATCACGGTATTGACAACGTTCACCGATGTAACCAACAA</entry><entry>22,5 nmol</entry></row><row rowsep="0"><entry>HEGF08</entry><entry>CACAGTTACAAGCGTATTTATCAAGAGCTTCGATGTACAT</entry><entry>23,6 nmol</entry></row><row rowsep="0"><entry>HEGF09</entry><entry>ACAAACACCATCGTGCAAACAGTAACCATCGTGTGAAAGT</entry><entry>28,4 nmol</entry></row><row><entry>HEGF10</entry><entry>GGACATTCTGAATCTGAGTT</entry><entry>37,8 nmol</entry></row></tbody></tgroup></table></tables><tables id="tabl0002" num="0002"><table frame="all"><title>Table 2 : oligo's used for assembly of mEGF, and the amount available</title><tgroup cols="3" colsep="0"><colspec colnum="1" colname="col1" colwidth="18mm" /><colspec colnum="2" colname="col2" colwidth="93mm" /><colspec colnum="3" colname="col3" colwidth="19mm" colsep="1" /><thead><row><entry namest="col1" nameend="col3" align="left" valign="top"><b>Sense</b></entry></row></thead><tbody><row rowsep="0"><entry>MEGF01</entry><entry>AACTCATACCCAGGTTGTCCATCATCATACGATGGTTACT</entry><entry>29,7 nmol</entry></row><row rowsep="0"><entry>MEGF02</entry><entry>GTTTGAACGGTGGTGTTTGTATGCACATCGAATCACTTGA</entry><entry>28,0 nmol</entry></row><row rowsep="0"><entry>MEGF03</entry><entry>TTCATACACTTGTAACTGTGTTATCGGTTACTCAGGTGAT</entry><entry>20,0 nmol</entry></row><row rowsep="0"><entry>MEGF04</entry><entry>CGTTGTCAAACTCGTGATTTGCGTTGGTGGGAACTTCGTT</entry><entry>25,5 nmol</entry></row><row rowsep="0"><entry>MEGF05</entry><entry>AACTAGTCTGCAGAATCTAG</entry><entry>29,7 nmol</entry></row></tbody></tgroup><tgroup cols="3" colsep="0"><colspec colnum="1" colname="col1" colwidth="18mm" /><colspec colnum="2" colname="col2" colwidth="93mm" /><colspec colnum="3" colname="col3" colwidth="19mm" colsep="1" /><thead><row><entry namest="col1" nameend="col3" align="left" valign="top"><b>Antisense</b></entry></row></thead><tbody><row rowsep="0"><entry>MEGF06</entry><entry>CTAGATTCTGCAGACTAGTTAACGAAGTTCCCACCAACGC</entry><entry>33,4 nmol</entry></row><row rowsep="0"><entry>MEGF07</entry><entry>AAATCACGAGTTTGACAACGATCACCTGAGTAACCGATAA</entry><entry>30,2 nmol</entry></row><row rowsep="0"><entry>MEGF08</entry><entry>CACAGTTACAAGTGTATGAATCAAGTGATTCGATGTGCAT</entry><entry>27,3 nmol</entry></row><row rowsep="0"><entry>MEGF09</entry><entry>ACAAACACCACCGTTCAAACAGTAACCATCGTATGATGAT</entry><entry>26,2 nmol</entry></row><row><entry>MEGF10</entry><entry>GGACAACCTGGGTATGAGTT</entry><entry>40,3 nmol</entry></row></tbody></tgroup></table></tables>

The oligonucleotides were dissolved in water at a concentration of 100 µM, and used in a 10 times diluted concentration. 1 µl of each oligonucleotide is added to 10 µl Taq buffer, 8 µl 2mM Mg²⁺, 2 µl 0.5mM XTP, 5u Taq DNA polymerase (Boehringer, Mannheim, Germany) and 1 u Pfu DNA polymerase (Promega, Madison, USA). The reaction mixture is added up to 100µl with water. The PCR reaction is carried out for 300 sec at 94°C, followed by 30 times the cycle of 45 sec at 94°C, 30 sec at 48°C and 30 sec at 72°C, with a final step of 10 sec at 15°C. After the assembly hEGF and mEGF are amplified in a PCR mixture containing 1 µl Vent DNA-polymerase (New England Biolabs ; Beverly, USA), 10 µl Taq buffer, 4 µl 0.5mM XTP, 5 µl 0.5 µM of each primer, 1 µl template DNA, 1 µl 2 mM Mg₂SO₄ and 74 µl H₂O. In case of hEGF, HEGF01 and HEGF06 were used as primer, for mEGF, MEGF01 and MEGF06 were used. For hEGF, the same temperature schedule was used as for the first step. In case of mEGF the hybridization step was carried out at 52°C in stead of 48°C. After the assembly, the size of the optimized gene fragments was confirmed on a 2% agarose gel.

Example 2: construction of pT1hEGF and pT1mEGF and transformation into <i>Lactococcus lactis</i>

<i>Spe</i>I cut assembled EGF (both for hEGF and mEGF) is ligated into a <i>Nae</i>I and <i>Spe</i>I digested pT1NX (Steidler <i>et al.,</i> 1995), resulting in pT1hEGF and pT1mEGF. A schematic overview of the construction of pT1 hEGF is shown in <figref idref="f0001">figure 1</figref>. Plasmids are transformed into competent cells of <i>L. lactis</i> by electroporation. 50µl of cells are electroporated in a precooled cuvet of 2mm, at 25 µF, 2.5 kV and 400 Ω (Bio-Rad electroporator). <i>L. lactis</i> is made competent by growing a 1/100 dilution of a saturated culture, in 200 ml GM17 with 2.5% glycine, till an OD₆₀₀ of 0.5 (Wells <i>et al.,</i> 1993). After electroporation, 1 ml of recuperation medium is added, and the cells are incubated for 1.5 hour at 28°C. Cells are plated on GM17 solid medium, comprising 5 µg/ml erythromycin. For the transformation of <i>L. casei,</i> plasmid is isolated from <i>L. lactis</i> by on a Qiagen-tip 100, according to the instructions of the manufacturerer. The DNA is transformed into competent <i>L</i>. <i>casei</i> cells. <i>L. casei</i> cells are made competent by growing an 1/50 dilution of an overnight culture in 50 ml MRS (Oxoid LTD., Basingstoke, Hampshire, England) with 1% glycine at 37°C, till an OD₆₀₀ of 0.6. The cells are harvested and washed twice with 10 ml 5 mM Na₃PO₄ pH 7.4, 1 mM MgCl₂, and resuspended in 500 µl electroporation buffer (0.3 M sucrose, 5 mM Na₃PO₄ pH 7.4, 1 mM MgCl₂). 10 µl of DNA is added to 50 µl of competent cells and the electroporation is carried out in a BioRad electroporator. After electroporation, 450 µl MRS is added and the cells are incubated for 2 hours at 37°C. Cells are plated on MRS agar with 5 µg/ml erythromycin. The presence of the plasmid is confirmed using PCR.

Example 3: expression of EGF in <i>L. lactis</i> and <i>L. casei</i>

The transformed <i>L. lactis</i> strains MG1363 [pT1NX], MG1363 [pT1mEGF] and MG1363 [pT1hEGF] are pitched in 5 ml GM17 comprising 5 µg/ml erythromycin, and grown overnight at 30°C. This preculture is dilute 1/100 in 5 ml GM17 with erythromycin, and incubated for 3 hours at 28°C. The culture is centrifuged and resuspended in BM9 expression medium, and incubated overnight at 28°C. The transformed <i>L. casei</i> strains are grown under similar conditions, but using MRS as preculture, and BM9 as expression medium. To the culture supernatant, 1/10 volume sodium desoxycholate is added, and the mixture is kept on ice for 10 minutes. 1/10 of volume 100% TCA is added and the mixture is incubated on ice for 15 minutes. After centrifugation, the pellet is dissolved in 50 µl H₂O and 50 µl 1M Tris-HCl pH 9.5. The proteins are analyzed on a 20% Laemmli protein gel. Detection is carried out using a Western blot, with mouse polyclonal anti hEGF and rabbit anti mEGF as primary antibodies. Alkaline phosphatase labelled anti-mouse and anti-rabbit secondary antibodies were from Southern Biotechnology (Birmingham, USA). The results are summarized in <figref idref="f0002">figure 2</figref>.

Example 4: <i>in vivo</i> testing of mice, using the transformed lactic acid bacteria strains

In order to assess the effect of the transformed lactic acid bacteria and the growth of the villi and the gut adsorption, seven groups of Balb/c mice (IFFA CREDO CR Broekman/ Sulzfield) were treated either with a mEGF or hEGF expressing lactic acid bacterium strain. <i>L. lactis</i> and <i>L. casei</i> transformed with an empty vector pT1NX, or with BM9 medium was given to mice as a negative control. 600 µl of <i>L. casei</i> is pitched in 15 ml MRS with 10 µg/ml erythromycin. In the case of <i>L</i>. <i>lactis,</i> GM17 is used instead of MRS, and only 5 µg/ml erythromycin is used for selection. <i>L</i>. <i>casei</i> is incubated overnight at 37°C, for <i>L. lactis,</i> 30°C is used. The overnight culture is harvested by centrifugation, and the pellet is resuspended in 1.5 ml BM9 expression medium. 100 µl of this solution is supplied daily, for a period of four weeks. At the end of the experiment, the mice are sacrificed and the intestine is isolated. The tissue is fixated in buffered formaldehyde and thin sections are coloured using heamatoxylin and eosin G, for microsopic analyis of the villi. The length of the villi is measured at several points to obtain a representative average. All section were taken from the terminal ileum. The results are summarized in <figref idref="f0003">Figure 3</figref>. Especially <i>L. casei</i> [pT1hEGF] has a positive effect on villus growth, and should promote gut absorption.

REFERENCES

<ul id="ul0002" list-style="dash" compact="compact"><li><nplcit id="ncit0001" npl-type="s"><text>Carpenter, C.D., Ingraham, H.A., Cochet, C., Walton, G.M., Lazar, C.S., Sodawski, J.M., Rosenfeld, M.G. and Gill, G.N. (1991). Structural analysis of the transmembrane domain of the epidermal growth factor receptor. J Biol Chem. 266, 5750 - 5755</text></nplcit>.</li><li><nplcit id="ncit0002" npl-type="s"><text>Chaet, M.S., Arya, G., Ziegler, M.M. and Warner, B.W. (1994) Epidermal growth factor enhances intestinal adaptation after massive small bowel resection. J Pediatr Surg 29, 1035 - 1039</text></nplcit>.</li><li><nplcit id="ncit0003" npl-type="s"><text>Dunn, J.C., Parungo, C.P., Fonkalsrund, E.W., McFadden, D.W. and Ashley, S.W. (1997) Epidermal growth factor selectively enhances functional enterocyte adaptation after massive small bowel resection. J Surg Res. 67, 90 - 93</text></nplcit>.</li><li><nplcit id="ncit0004" npl-type="s"><text>Gasson, M.J. (1983) Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J Bacteriol 154, 1 - 9</text></nplcit>.</li><li><nplcit id="ncit0005" npl-type="s"><text>Gu, Y., Wu, Z.H., Xie, J.X., Jin, D.Y. and Zhuo, H.C. (2001) Effects of growth hormone (rhGH) and glutamine supplemented parenteral nutrition on intestinal adaptation in short bowel rats. Clin Nutr 20, 159 - 166</text></nplcit>.</li><li><nplcit id="ncit0006" npl-type="s"><text>Hardin, J.A., Chung, B., O'Loughlin, E.V. and Gall, D.G. (1999) The effect of epidermal growth factor on brush border surface area and function in the distal remnant following resection in the rabbit. Gut 44, 26 - 32</text></nplcit>.</li><li><nplcit id="ncit0007" npl-type="s"><text>Helmrath, M.A., Shin, C.E., Fox, J.W., Erwin, C.R. and Warner, B.W. (1988) Adaptation after small bowel resection is attenuated by sialoadenectomy : the role for endogenous epidermal growth factor. Surgery 124, 848 - 854</text></nplcit>.</li><li><nplcit id="ncit0008" npl-type="s"><text>Jeppesen, P.B., Hartmann, B., Hansen, B.S., Thulesen, J., Holst, J.J., Mortensen P.B. (1999) Impaired meal stimulated glucagon-like peptide 2 response in ileal resected short bowel patients with intestinal failure. Gut 45, 559 - 563</text></nplcit>.</li><li><nplcit id="ncit0009" npl-type="s"><text>Jeppesen, P.B., Hartmann, B., Thulesen, J., Graff, J., Lohmann, J., Hansen, B.S., Tofteng, F., Poulsen, S.S., Madsen, J.L., Holst, J.J. and Mortensen, P.B. (2001) Glucagon-like peptide 2 improves nutrient absorption and nutritional status in short-bowel patients with no colon. Gastroenterology 120, 806 - 815</text></nplcit>.</li><li><nplcit id="ncit0010" npl-type="s"><text>Lukish, J., Schwartz, M.Z., Rushin, J.M. and Riordan, G.P. (1997) A comparison of the effect of growth factors on intestinal function and structure in short bowel syndrome. J Pediatr Surg 32,1652 -1655</text></nplcit>.</li><li><nplcit id="ncit0011" npl-type="s"><text>Marti, U., Burwen, S.J. and Jones, A.L. (1989) Biological effects of epidermal growht factor, with emphasis on the gastrointestinal tract and liver : an update. Hepatology 9, 126 -138</text></nplcit>.</li><li><nplcit id="ncit0012" npl-type="s"><text>O'Loughlin, E., Winter, M., Shun, A., Hardin, J.A. and Gall, D.G. (1994) Structural and functional adaptation following jejunal resection in rabbits: effect of epidermal growth factor. Gastroenterology 107, 87 - 93</text></nplcit>.</li><li><nplcit id="ncit0013" npl-type="s"><text>Opleta-Madsen, K., Hardin, J. and Gall, D.G. (1991) Epidermal growth factor upregulates intestinal electrolyte and nutrient transport. Am J Physiol 260, G807 - 814</text></nplcit>.</li><li><nplcit id="ncit0014" npl-type="s"><text>Pearson, P.Y., O'Connor, D.M. and Schwartz, M.Z. (2001) Novel effect of leptin on small intestine adaptation. J Surg Res 97,192 -195</text></nplcit>.</li><li><nplcit id="ncit0015" npl-type="s"><text>Piiper, A., Stryjek-Kaminska, D., Stein, J., Caspary, W.F. and Zeuzem, S. (1994) Tyrphostins inhibit secretagogue-induced 1,4,5-IP3 production and amylase release in pancreatic acini. Am J Physiol. 266 G363-371</text></nplcit>.</li><li><nplcit id="ncit0016" npl-type="s"><text>Playford, R.J., Marchbank, T., Calnan, D.P., Calam, J., Royston, P., Batten, J.J. and Hansen, H.F. (1995) Epidermal growth factor is digested to smaller, less active forms in acidic gastric juice. Gastroenterology 108, 92 -101</text></nplcit>.</li><li><nplcit id="ncit0017" npl-type="s"><text>Scott, R.B., Kirk, D., MacNaughton, W.K. and Meddings, J.B. (1998) GLP-2 augments the adaptive response to massive intestinal resection in rat. Am J Physiol 275, G911 - 921</text></nplcit>.</li><li><nplcit id="ncit0018" npl-type="s"><text>Swaniker, F., Guo, W., Diamond, J. and Fonkalsrud, E.W. (1996) Delayed effects of epidermal growth factor after extensive small bowel resection. J Pediatr Surg 31, 56 - 60</text></nplcit>.</li><li><nplcit id="ncit0019" npl-type="s"><text>Wells, J.M., Wilson, P.W. and Le Page, R.W. (1993) Improved cloning vectors and transformation procedure for Lactococcus lactis. J Appl Bacteriol 74, 629 - 636</text></nplcit>.</li><li><nplcit id="ncit0020" npl-type="s"><text>Zhou, X., Li, Y.X., Li, N. and Li J.S. (2001) Effect of bowel rehabilitative therapy on structural adaptation of remnant small intestine: animal experiment. World J Gastroenterol 7, 66 - 73</text></nplcit>.</li></ul>

SEQUENCE LISTING

<ul id="ul0003" list-style="none"><li>&lt;110&gt; VLAAMS INTERUNIVERSITAIR INSTITUUT VOOR BIOTECHNOLOGIE VZW UNIVERSITEIT GENT</li><li>&lt;120&gt; METHODS AND MEANS TO PROMOTE GUT ABSORPTION</li><li>&lt;130&gt; LST -EGF-V117</li><li>&lt;150&gt; <patcit id="pcit0006" dnum="EP02077532A"><text>EP 02077532.6</text></patcit> &lt;151&gt; 2002-06-19</li><li>&lt;160&gt; 24</li><li>&lt;170&gt; PatentIn version 3.1</li><li>&lt;210&gt; 1 &lt;211&gt; 166 &lt;212&gt; DNA &lt;213&gt; Homo sapiens</li><li>&lt;220&gt; &lt;221&gt; CDS &lt;222&gt; (1) .. (150) &lt;223&gt;</li><li>&lt;220&gt; &lt;221&gt; misc_feature &lt;223&gt; hEGF</li><li>&lt;400&gt; 1 <img file="EP1513545B1_D0001.tif" /></li><li>&lt;210&gt; 2 &lt;211&gt; 50 &lt;212&gt; PRT &lt;213&gt; Homo sapiens</li><li>&lt;220&gt; &lt;221&gt; misc_feature &lt;223&gt; hEGF</li><li>&lt;400&gt; 2 <img file="EP1513545B1_D0002.tif" /></li><li>&lt;210&gt; 3 &lt;211&gt; 166 &lt;212&gt; DNA &lt;213&gt; Mus musculus</li><li>&lt;220&gt; &lt;221&gt; CDS &lt;222&gt; (1) .. (150) &lt;223&gt;</li><li>&lt;220&gt; &lt;221&gt; misc_feature &lt;223&gt; mEGF</li><li>&lt;400&gt; 3 <img file="EP1513545B1_D0003.tif" /></li><li>&lt;210&gt; 4 &lt;211&gt; 50 &lt;212&gt; PRT &lt;213&gt; Mus musculus</li><li>&lt;220&gt; &lt;221&gt; misc_feature &lt;223&gt; mEGF</li><li>&lt;400&gt; 4 <img file="EP1513545B1_D0004.tif" /></li><li>&lt;210&gt; 5 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; HEGF01</li><li>&lt;400&gt; 5 aactcagatt cagaatgtcc actttcacac gatggttact     40</li><li>&lt;210&gt; 6 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; HEGF02</li><li>&lt;400&gt; 6 gtttgcacga tggtgtttgt atgtacatcg aagctcttga     40</li><li>&lt;210&gt; 7 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; HEGF03</li><li>&lt;400&gt; 7 taaatacgct tgtaactgtg ttgttggtta catcggtgaa</li><li>&lt;210&gt; 8 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; HEGF04</li><li>&lt;400&gt; 8 cgttgtcaat accgtgattt gaaatggtgg gaacttcgtt     40</li><li>&lt;210&gt; 9 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; HEGF05</li><li>&lt;400&gt; 9 aactagtctg cagaatctag     20</li><li>&lt;210&gt; 10 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; HEGF06</li><li>&lt;400&gt; 10 ctagattctg cagactagtt aacgaag ttc ccaccatttc     40</li><li>&lt;210&gt; 11 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; HEGF07</li><li>&lt;400&gt; 11 aaatcacggt attgacaacg ttcaccgatg taaccaacaa     40</li><li>&lt;210&gt; 12 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; HEGF08</li><li>&lt;400&gt; 12 cacagttaca agcgtattta tcaagagctt cgatgtacat     40</li><li>&lt;210&gt; 13 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; HEGF09</li><li>&lt;400&gt; 13 acaaacacca tcgtgcaaac agtaaccatc gtgtgaaagt     40</li><li>&lt;210&gt; 14 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; HEGF10</li><li>&lt;400&gt; 14 ggacattctg aatctgagtt     20</li><li>&lt;210&gt; 15 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; MEGF01</li><li>&lt;400&gt; 15 aactcatacc caggttgtcc atcatcatac gatggttact     40</li><li>&lt;210&gt; 16 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Seque nce</li><li>&lt;220&gt; &lt;223&gt; MEGF02</li><li>&lt;400&gt; 16 gtttgaacgg tggtgtttgt atgcacatcg aatcacttga     40</li><li>&lt;210&gt; 17 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; MEGF03</li><li>&lt;400&gt; 17 ttcatacact tgtaactgtg ttatcggtta ctcaggtgat     40</li><li>&lt;210&gt; 18 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; MEGF04</li><li>&lt;400&gt; 18 cgttgtcaaa ctcgtgattt gcgttggtgg gaacttcgtt     40</li><li>&lt;210&gt; 19 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; MEGF05</li><li>&lt;400&gt; 19 aactagtctg cagaatctag 20</li><li>&lt;210&gt; 20 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; MEGF06</li><li>&lt;400&gt; 20 ctagattctg cagactagtt aacgaagttc ccaccaacgc     40</li><li>&lt;210&gt; 21 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; MEGF07</li><li>&lt;400&gt; 21 aaatcacgag tttgacaacg atcacctgag taaccgataa     40</li><li>&lt;210&gt; 22 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; MEGF08</li><li>&lt;400&gt; 22 cacagttaca agtgtatgaa tcaagtgatt cgatgtgcat     40</li><li>&lt;210&gt; 23 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequ ence</li><li>&lt;220&gt; &lt;223&gt; MEGF09</li><li>&lt;400&gt; 23 acaaacacca ccgttcaaac agtaaccatc gtatgatgat     40</li><li>&lt;210&gt; 24 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence</li><li>&lt;220&gt; &lt;223&gt; MEGF10</li><li>&lt;400&gt; 24 ggacaacctg ggtatgagtt     20</li></ul>