Synthetic genes and bacterial plasmids devoid of cpg

FIELD OF THE INVENTION

0001The present application relates to synthetic genes and to plasmids entirely devoid of CpG.

TECHNOLOGICAL BACKGROUND

0002Plasmids are genetic elements essentially found in bacteria, formed by a deoxyribonucleic acid molecule, most often circular, the replication of which is autonomous and independent of that of genomic DNA. Natural plasmids isolated from a very wide variety of bacteria are capable of performing several cellular functions. The first, vital for all plasmids, is that responsible for their replication, generally carried out in synchrony with the replication of genomic DNA and cell division. In addition to the region necessary for replication of the plasmid, all natural plasmids carry genes which code for proteins whose function most often remains unknown due to the lack of specific investigation of these genes. The number of genes present on a plasmid determines the size of this plasmid, the smallest natural plasmids containing only two to three genes. The properties of plasmids very early attracted researchers to make them vehicles of transport and expression of genes in prokaryotic cells as eukaryotes. The very rapid progress observed in the fields of molecular biology of nucleic acids and proteins over the past two decades is partly due to the use of recombinant plasmids constructed from fragments of natural DNA of plasmid or other origin. Cellular DNA, and even chemically synthesized. The four bases adenine (A), guanine (G), cytosine (C) and thymine (T) which constitute the deoxyribonucleic acid (DNA) are distributed in 16 dinucleotide configurations namely CG, GC, TA, AT, CC, GG , TT, AA, TG, CA, AG, CT, AC, GT, GA and TC. Analysis of the qualitative distribution of dinucleotides in the DNA of the thousands of plasmids whose sequences are known reveals that the 16 dinucleotides are always present in all natural or laboratory-constructed plasmids. However, the analysis of the quantitative distribution of the dinucleotides of the plasmids shows large disparities which are, in part only, a function of the percentage of each of the four bases of DNA. Indeed, the comparison of the observed frequencies of each of the dinucleotides to those of the frequencies calculated on the basis of a random association between two bases for a given plasmid can highlight significant differences for several dinucleotides in the direction of an over- representation or on the contrary an under-representation (<nplcit id="ncit0001" npl-type="s"><text>Campbell A., Mrazek J. and Karlin S. (1999) Proc Natl Acad Sci USA 96, 9184-9</text></nplcit>). The differences observed in the distribution of certain dinucleotides, not always the same ones, of natural plasmids isolated from bacteria of phylogenically distant species have been explained by differences in specificity in the repair, recombination and replication mechanisms acting on cellular DNA.

0003Gene transfers <i>in vitro</i> in cultured cells and <i>in vivo</i> in various animals there are practices in great development with the aim on the one hand of better understanding the cellular functioning, and on the other hand in order to apply these techniques to cellular and gene therapies. None of the viral vectors and plasmid vectors among the panoply of vectors available for gene transfer in animals has taken a decisive advantage over the others because each has advantages but also disadvantages. There is, however, one application where naked or complexed plasmid DNA with various substances to facilitate the transport of DNA to the nucleus is the subject of intense research activity, namely that of vaccinating DNA. The principle of vaccinating DNA is based on the immune responses observed in laboratory animals treated by intramuscular, intradermal injection or inhalation with plasmid DNA coding for an antigenic peptide. It is now well established that a first consequence of the introduction of plasmid DNA from the bacteria <i>E.coli</i> in the body of an experimental animal via the intravenous and muscular routes is the rapid production of various cytokines by immune system guard cells (<nplcit id="ncit0002" npl-type="s"><text>Krieg AM and Kline JN (2000) Immunopharmacology 48, 303-305</text></nplcit>). This response is extremely specific for bacterial DNA since DNA extracted from animal cells does not cause such induction of cytokines under the same conditions. The cellular mechanisms involved in this immune response are far from fully understood. However, we know that the discriminatory recognition between bacterial DNA and DNA of animal origin is made at the level of structural differences relating to the methylation of certain cytosines of the molecule. In fact, mammalian DNA is naturally methylated at the level of the cytosine of all the CG dinucleotides (hereafter written CpG) with the exception of short zones of high density in CpG called CpG islets present in functional regions at the level of certain promoters. DNA extracted from<i>E.coli</i> does not exhibit this type of methylation by absence of the enzymatic activity capable of accomplishing this modification in this bacterium. It is nevertheless possible to methylate the CpGs of the plasmid DNA extracted from<i>E.coli</i> in a test tube with an appropriate enzyme. Under these conditions methylated DNA<i>in vitro</i> loses a large part of its immunostimulatory activity compared to the unmethylated control DNA. The<i>E. coli strain K12</i> from which almost all the mutant strains used for the production of plasmid DNA contain an enzymatic activity (DNA methylase dcm (<nplcit id="ncit0003" npl-type="s"><text>Palmer BR and Marinus MG (1994) Gene 143, 1-12</text></nplcit>) leading to the methylation of cytosine found in the CC (A / T) GG nucleic context. All plasmid gene transfer vectors contain this sequence in variable numbers and therefore their DNA molecule contains methylated cytosines which are not found in the DNA of mammals. This form of methylation specific to<i>E.coli</i> thus introduces another difference in the methylation of cytosines between bacterial DNA and that of mammals which could contribute to the immunostimulatory power of plasmid DNA.

0004The frequency of CpG in DNA from primates and rodents is generally much lower than that expected based on the frequency of cytosines and guanines. The deficit in CpG is dependent for a given DNA fragment on the biological role of this fragment, the intergenic regions contain only one fifth of the expected frequency while the exons have a less marked deficit and at the other extreme some promoters containing a large CpG island have a percentage of CpG close to that expected. Analysis of data from the sequencing of cDNAs and human chromosomes nevertheless reveals wide heterogeneities in the frequency of CpG for promoter regions and cDNAs. This observation is illustrated by the cDNA of the human gene coding for interleukin 2 which has only one CpG. Similarly, part of the promoter of this gene containing the TATA box does not contain CpG but on the other hand the upstream part rich in sites for recognition of transcription factors contains CpG. The 3 'regions of the genes formed by the 3' UTR (untranslated regions) and the polyadenylation and end of transcription sequences are rather poor in CpG. It is not unusual to find regions immediately downstream of genes lacking CpG in humans. However, the human sequencing data available at the end of 2000 did not make it possible to highlight a single transcriptional unit formed by the promoter regions of transcription, a gene with or without intron and the polyadenylation region which is entirely lacking CpG. The situation of CpG in<i>E.coli</i> is quite different from that of animal cells since the frequency of CpG in the genomic DNA of this bacterium is in slight excess compared to the calculated frequency. The same is true for the CpGs of natural plasmids isolated from hospital strains of<i>'E.coli.</i> Recombinant plasmids resulting from genetic engineering, used for gene transfer, show variations in their CpG numbers which depend on the origin of the fragments inserted into the vector. Sequence analysis of several dozen recombinant plasmids<i>of E. coli</i> taken randomly from the GenBank database show that the plasmids poorest in CpG have at most a 50% deficit in the number of their CpGs.

0005Attempts to reduce the CpG content have been carried out for the lac gene, but have not resulted in the synthesis of functional genes entirely devoid of CpG (<nplcit id="ncit0004" npl-type="s"><text>Henry et al. 1999 CR ACAD. SCI. PARIS, vol. 322, pages 1061-1070</text></nplcit>; <nplcit id="ncit0005" npl-type="s"><text>Skopek et al. 1996 Mutation Research, vol. 349, pages 163-172</text></nplcit>).

0006The present invention provides products and methods for synthesizing plasmid DNA in <i>E.coli</i> which is completely devoid of CpG and whose cytosines placed in the context CC (A / T) GG are not methylated. To the knowledge of the Applicant, this is the first description of such products which have such a structure while retaining their function.

DETAILED DESCRIPTION OF THE INVENTION

0007The present invention provides means for producing plasmids which are functional in a prokaryotic organism such as <i>Escherichia coli,</i> and which are however entirely devoid of CpG. More particularly, it provides means making it possible to produce plasmids which are entirely devoid of CpG and which are furthermore free from methylation at the cytosine level in the CC (A / T) GG nucleic context. The present application thus relates to methods as described in claim 1 for the production of such plasmids, as well as to the constituent elements of these plasmids, namely genes devoid of CpG which can be expressed in <i>E. coli,</i> promoters devoid of CpG adapted to the expression of said genes, and origins of replication devoid of CpG adapted to the bacterial transformation of said plasmids. The present application also relates to the biotechnological and medical applications of these products. Each of these products has the particular characteristic of being entirely devoid of CpG, while having retained its functionality in a prokaryote such as<i>E. coli.</i>The present application also describes a strain <i>E. coli</i> specially adapted for the production of plasmids according to the invention, this strain having the particular characteristic of allowing stable replication of these plasmids and of the genetic material which they transport, without altering their function, and without inducing methylation at the level of CC (A / T) GG sites (strain comprising a gene <i>dcm</i> inactivated). One of the common concepts linking the various aspects of the invention is therefore to make it possible to produce plasmids which are entirely devoid of CpG and which have nevertheless retained their functional properties in a prokaryote such as <i>E. coli.</i>To the knowledge of the Applicant, this is the first description of such means.

0008The present application thus relates to a method for the production of a plasmid which is vector of at least one gene, and which is entirely devoid of CpG, characterized in that a plasmid is constructed by assembling fragments of enzyme by enzymatic ligation DNA all devoid of CpG corresponding to an origin of replication of the plasmid and to the elements constituting a transcriptional unit for said at least one gene, and in that this plasmid is transferred into a strain of<i>Escherichia coli</i> expressing protein <i>pi</i> for replication of the plasmid and characterized in that the origin of replication of the plasmid is the R6K gamma origin modified by elimination of CpG ..

0009Plasmids isolated from wild-type strains of bacteria generally perform three functions related to replication, namely initiation of DNA replication, control of replication and stable maintenance of the plasmid during successive divisions. Plasmids constructed in the laboratory do not always exhibit all of these functions. The number of copies of the plasmids is, for example, very often increased compared to the parent plasmid, denoting that elements of the control of replication have been modified. Plasmid R6K contains three origins of replication<i>alpha, gamma</i> and <i>beta,</i> linked on the same DNA fragment (<nplcit id="ncit0006" npl-type="s"><text>Filutowicz M. and Rakowski SA (1998) Gene 223, 195-204</text></nplcit>). Each of the origins is activated by the initiation protein<i>pi</i> specific for R6K, encoded by the R6K gene <i>pir.</i> The three origins need, to be functional, a 277 bp sequence, known to the skilled person under the name of core, located in the center of the fragment carrying the three origins, and also of a fragment additional single positioned in <i>cis</i> that is to say, present on the same DNA molecule. When the sequences of origins<i>alpha</i> and <i>beta</i> are deleted, the origin <i>gamma</i> remaining allows autonomous duplication of the plasmid provided that the gene <i>pir</i> be present in <i>cis</i> on the plasmid or in <i>trans</i> on the chromosome of the bacteria. The inventors have chosen to focus more specifically on the smallest of the three origins, namely the origin<i>gamma,</i> which has the advantage of containing all the elements necessary for controlled replication of the plasmid, namely the core and an adjacent activating sequence. The core is formed by a protein binding sequence<i>pi</i> repeated 7 times and with a sequence rich in AT. The activator region contains binding sites for several cellular proteins of the bacteria required for stable maintenance of the plasmid. The number of copies of the plasmids containing the only origin<i>gamma</i> depends on protein <i>pi,</i> mutant forms of <i>pi</i> leading to a large increase in the number of copies of the plasmid were isolated and characterized. As presented in more detail in the examples below, the inventors have succeeded in constructing, from the origin of replication of the plasmid R6K gamma, origins of replication which no longer exhibit any CpG, while retaining their intact functionality. It can be noted that the particular choice of R6K gamma as starting material, namely the choice of a small replicon which has only a reduced number of CpGs, is a particularly relevant choice, insofar as when l we start from other plasmids such as those of the pUC series, we cannot obtain plasmids without CpG which remain functional: all attempts by the inventors to chemically reconstruct the minimum sequence pUC by replacing the CpG cytosines with a guanine or an adenine have resulted in DNA fragments having lost all functional replication activity. The plasmids which comprise an origin of replication without CpG according to the invention have retained their capacity to replicate stably inside a prokaryotic cell such as<i>E. coli,</i> and <i>E. coli</i> K12 in particular, insofar as they are of course provided with the pi protein necessary for the activation of replication (<i>pir</i> wild or <i>pir</i> mutated as <i>pir</i>116 in <i>cis</i> or in <i>trans</i>). An origin of replication for plasmid according to the invention is characterized in that its sequence corresponds to that of the origin of R6K gamma replication in which each G of the CpGs of the repeated region of the core has been replaced by an A, a C or a T, where each C of the CpGs has been replaced by a G, an A or a T. Were thus obtained different origins of replication without CpG, which surprisingly, were still capable of performing the functions of original replication of plasmids in E. coli, and moreover, were capable of performing these functions for genes and transcriptional units which themselves lacked CpG. The examples below give some illustrations (cf. origins R6K gamma M2A, R6K gamma M2C, R6K gamma M2T in examples 7-10). The present application relates more particularly to any origin of replication, the sequence of which comprises the sequence SEQ ID No. 12 or the sequence SEQ ID No. 13 (<figref idref="f0018">Figures 12</figref> and <figref idref="f0020 f0021 f0022">14</figref>). It has also been demonstrated that the pi protein binding sequence may not be repeated 7 times, as observed in the standard R6K gamma origin with CpG, but that the number may be limited to 5 or 6, without altering the functions of the origin of replication. The present application thus relates to any origin of replication according to the invention as defined above, which would only comprise 5 or 6 repetitions of the binding sequence of the pi protein. Thanks to these origins of functional replication without CpG, the inventors were able to construct different plasmids, which, remarkably, have retained their functions as transfection vectors.

0010The creation of plasmids<i>E.coli</i> lacking CpG necessarily requires the availability of functional genes (expressible in a prokaryote such as <i>E. coli</i>) which do not contain CpG. Thus, the selection of bacteria transformed by recombinant plasmid DNA involves a gene whose protein confers a dominant advantage on the bacteria. Most often, the selective marker is provided by a gene for resistance to an antibiotic active on the bacteria.<i>E. coli.</i> Analysis of the sequences of resistance genes in their wide variety used in <i>E.coli</i> shows that without any exception all contain CpGs, very often in very high numbers for the resistance genes originating from the Streptomyces producing the antibiotic of selection. Likewise, it is necessary to have reporter genes which are CpG-free while remaining functional. Now, an analysis of several hundred chromosomal and plasmid genes from the bacteria <i>E.coli</i> whose well-characterized sequences are available in several databases reveal that all the genes without exception whose size is greater than 250 bp consist of the 16 dinucleotides. The present invention demonstrates that it is nevertheless possible to construct functional genes in E. coli which are devoid of CpG. The inventors have in fact developed a method for obtaining genes lacking CpG while being expressible in<i>E. coli.</i> This method is based on the synthesis of a polynucleotide sequence by following the amino acid sequence of a protein which can be expressed in <i>E. coli,</i> by assigning to each amino acid a nucleotide codon chosen from those which, according to the genetic code, and taking into account the degeneration of this code, correspond to this amino acid, but eliminating from this choice:<ol id="ol0001" compact="compact"><li>i. all codons containing a CpG in their sequence: the codons ACG (Thr), CCG (Pro), GCG (Ala), TCG (Ser), CGA (Arg), CGC (Arg), CGG (Arg) and CGT are concerned (Arg), and</li><li>ii. codons ending with a C when the codon which follows it directly begins with a G. Examples of a gene thus obtained include the NeoΔCpG gene (SEQ ID NO: 316;<i>cf</i>: example 11).</li></ol>

0011According to an alternative embodiment of the invention, the codons whose frequencies are low in proteins of human origin will also be eliminated from said choice: the codons ATA (Ile), CTA (Leu), GTA (Val) and TTA are concerned. (Leu). The set of possible codons therefore corresponds, according to this variant, to the following set: GCA (Ala), GCC (Ala), GCT (Ala), AGA (Arg), AGG (Arg), AAC (Asn), AAT (Asn), GAC (Asp), GAT (Asp), TGC (Cys), TGT (Cys), CAA (Gln), CAG (Gln), GAA (Glu), GAG (Glu), GGA (Gly), GGC (Gly), GGG (Gly), GGT (Gly), CAC (His), CAT (His), ATC (Ile), ATT (Ile), CTC (Leu), CTG (Leu), CTT (Leu), TTG (Leu), AAA (Lys), AAG (Lys), TTC (Phe), TTT (Phe), CCA (Pro), CCC (Pro), CCT (Pro), TCA (Ser), TCC (Ser), TCT (Ser), AGC (Ser), AGT (Ser), ACA (Thr), ACC (Thr), ACT (Thr), TAC (Tyr), TAT (Tyr), GTC (Val) GTG (Val), GTT (Val), to which rule ii must of course apply. above. Examples of a gene obtained in accordance with this variant embodiment include in particular the LacZ ΔCpG gene (positions 3 to 3056 of SEQ ID NO: 9;<i>cf.</i> example 5).

0012Preferably, said choice of codon will also be made so as to avoid structures which are not favorable for the messenger RNA, such as the presence of splicing sequences, direct or inverted repeat sequences, hairpin structures or signals. polyadenylation. The number and size variety of genes synthesized by this method are illustrated in the examples below which show that it is thus possible to design the synthesis of genes entirely devoid of CpG which nevertheless remains functional in <i>E. coli.</i> As reference protein, one can choose any protein which can be expressed by <i>E. coli,</i> for example a protein encoded by an antibiotic resistance gene such as the zeocin resistance genes^® (phleomycin), hygromycin, blasticidine, puromycin, or a protein encoded by a reporter gene such as <i>lake</i>Z.

0013The present application describes such a method of obtaining genes lacking CpG expressible in <i>E. coli,</i> as well as any gene of at least 250 bp which is likely to be obtained by this method. More specifically, the present request is aimed at:<ul id="ul0001" list-style="dash" compact="compact"><li>any gene whose sequence includes the sequence SEQ ID N ° 1 from position 3 to position 374 (<figref idref="f0001">Figure 1</figref>), the sequence SEQ ID N ° 3 from position 3 to position 1025 (<figref idref="f0003">Figure 3</figref>), the sequence SEQ ID N ° 5 from position 3 to position 422 (<figref idref="f0005">Figure 5</figref>), the sequence SEQ ID N ° 7 from position 3 to position 599 (<figref idref="f0007">Figure 7</figref>), as well as any use of these genes as selection markers, and</li><li>any gene whose sequence includes the sequence SEQ ID N ° 9 from position 3 to position 3056 (<i>cf.</i><figref idref="f0011 f0012">Figure 9</figref>), and any gene whose sequence includes the sequence SEQ ID NO: 316 (positions 3 to 797 of the DNA sequence presented in <figref idref="f0026">Figure 18</figref> (coding for SEQ ID NO: 317), as well as any use of such a gene as a reporter gene.</li></ul>

0014The expression of a plasmid gene also requires the availability of promoters adapted to the cell hosting the plasmid. Complete knowledge of the genome of<i>E.coli</i> for several years has facilitated the study of various non-coding elements presenting particular functions. The results of work on the nature of promoters of<i>E.coli</i> are continuously updated and made public on the PromEC website, accessible via the Internet (http://bioinfo.md.huji.ac.il/marg/promec). An analysis of the 471 well-defined promoters of the base -75 to +25 with respect to the +1 point of transcription initiation reveals that only 6 of them do not have CpG. The addition of each of the 6 promoters chemically synthesized and placed upstream of the lacZ gene coding for the β-galactosidase of<i>E</i>.<i>coli</i> has been shown to be negative for revealing the activity of this reporter gene. The lack of strong homology with the consensus sequences of the canonical boxes -10 and -35 suggests that the strength of these promoters is weak and, in turn, that these promoters could be regulated by induction conditions to be defined for each of them. An analysis of well-characterized promoters of<i>E.coli</i> revealed that only about ten did not contain CpG at the level of specific boxes for recognition by RNA polymerase. Bibliographic research further revealed that these promoters were all of an inducible nature by various stimuli, a situation sometimes desired but most often neglected for a constitutive nature of the expression. The inventors have in turn succeeded, by random PCR assembly of fragments having short consensus sequences lacking CpG drawn from several strong promoters, in developing novel promoters which are suitable for the expression of genes without CpG in <i>E</i>. <i>coli,</i> and which have the particular advantage of being very strong constitutive promoters and of being entirely devoid of CpG. Example 6 below illustrates the construction of the unique promoter EM2K by this technology. The present application relates more particularly to any promoter whose sequence comprises the sequence SEQ ID NO: 11 (<i>cf.</i><figref idref="f0017">Figure 11</figref>). Characterized terminators of transcription in <i>E.coli</i> are formed by short sequences, several of which do not have CpG, and the inventors have been able to verify that such terminators actually perform their function when associated with <i>E. coli</i> to a promoter and a gene without CpG according to the invention. The present application thus relates to any transcriptional unit which comprises at least one gene without CpG according to the invention, and at least one promoter without CpG according to the invention. Such a transcriptional unit can also comprise at least one terminator without CpG. The invention thus provides, for the first time, a nucleotide set which is entirely devoid of CpG, and which can nevertheless be expressed in E.<i>coli</i> ensuring its normal functions.

0015The present application thus relates to any plasmid which comprises an origin of replication according to the invention. Such plasmids can also comprise a gene without CpG according to the invention and / or a promoter without CpG according to the invention and / or a transcription terminator without CpG, or a transcriptional unit according to the invention. The plasmids according to the invention therefore have the advantage of being able to present no CpG in their structure, while still being capable of ensuring the functions of expression vectors. Examples of such plasmids are given in the examples below.

0016The present application relates more particularly to any plasmid of SEQ ID NO: 14 (<figref idref="f0023">Figure 15</figref>).

0017Also within the scope of the present application is any cell transformed with at least one element selected from the group consisting of genes without CpG according to the invention, promoters without CpG according to the invention, origins of replication without CpG according to invention, the plasmids without CpG according to the invention. Such a cell according to the invention can also comprise a gene coding for a pi protein, such as<i>pir</i> wild or <i>pir</i> mutated <i>pir</i>116. Advantageously, a cell transformed according to the invention is a cell <i>of. coli.</i>

0018To replicate a plasmid according to the invention in a sufficient number of functional copies, a person skilled in the art has at his disposal many bacteria, such as, for example, <i>E. coli</i> K12 which are conventionally used for plasmid replication purposes. However, the original K12 strain of<i>E.coli</i> has a DNA methylase, which introduces a methyl group on all the cytosines placed in the CC (A / T) GG context of the genomic and plasmid DNA of the bacterium. All the various strains of the K12 line have this activity due to a methylase encoded by the gene<i>dcm</i> (<nplcit id="ncit0007" npl-type="s"><text>Palmer BR and Marinus MG (1994) Gene 143, 1-12</text></nplcit>). Insofar as the methylation of the plasmid DNAs prepared from the strains<i>dcm</i>⁺ of<i>E.coli</i> leads to a modification of the DNA molecule not intended for the transfer of genes into eukaryotic cells, the inventors have developed a strain which allows both the functioning of the plasmids with the R6K origin <i>gamma</i> without CpG in accordance with the invention, and obtaining plasmid DNA lacking methylation at the sites <i>dcm</i>. For this, a new gene has been constructed by the inventors by deleting the gene<i>dcm</i> from position +3 after ATG to position -14 before TGA in the gene <i>dcm</i> of a strain <i>pir116 (cf.</i> example 10 below). The gene <i>dcm</i> is located in a chromosomal region whose sequence can be obtained via GenBank with the accession number D90835 (cloneKohara # 344: 43.5-43.9 min).

0019A deletion in the (-) gene brings the additional advantage of avoiding any reversion of the gene to the wild form. Mutant strains<i>dcm</i> were thus produced by the inventors; they do not show any negative phenotype which could alter the growth of bacteria or modify the quality and quantity of plasmid DNA. More specifically, an optimized strain of<i>E. coli</i> was built by targeted gene silencing <i>dcm</i> from a parent strain expressing a mutated pi protein at a site leading to an increase in the copy number of plasmids without CpG. This optimized strain allows a production of quality and in abundance of the plasmid DNAs objects of this invention devoid of CpG and free from methylation on the cytosines of the sites.<i>dcm.</i> The present application therefore relates to any cell comprising a gene coding for the pi protein, which is transformed by the dcm gene deleted according to the invention, and any method of replication of plasmids which comprises the transformation of such a cell with a plasmid, and the culture of the transformed cell under conditions suitable for the replication of this plasmid.

0020The present application thus relates to a method for the production of a plasmid entirely devoid of CpG and free from methylation at the level of cytosine in the nucleic context CC (A / T) GG, characterized in that a plasmid is produced according to the invention by replication in a strain of<i>Escherichia coli</i> expressing the deficient pi protein for the methylation system <i>dcm.</i>

0021Also falls within the scope of the present application any kit for the production of plasmids, which comprises at least one cell according to the invention. These kits are particularly suitable for the replication of plasmids according to the invention, in order to avoid that these plasmids, the structure of which is devoid of CpG, are moreover, during their replication, methylated in CC (A / T) GG.

0022The invention thus provides a complete set of transformation means devoid of CpG: genes without CpG, promoters without CpG, transcriptional units without CpG, origins of replication for plasmid without CpG, plasmids without CpG, cells specially adapted for replication of plasmids without cytosine methylation. These new means find direct applications for the genetic transformation of cells for biotechnological or medical purposes. Such products are indeed exceptionally well suited to the production of DNA vaccine compositions intended for humans or animals.

0023The invention is illustrated by the following examples, in which reference is made to the figures:<ul id="ul0002" list-style="dash" compact="compact"><li><figref idref="f0001">Figure 1</figref> : sequence of the Sh ble ΔCpG gene (without CpG),</li><li><figref idref="f0002">Figure 2</figref> : list of oligonucleotides used for the assembly of the Sh ble ΔCpG gene,</li><li><figref idref="f0003">Figure 3</figref> : sequence of the Hph ΔCpG gene,</li><li><figref idref="f0004">Figure 4</figref> : list of oligonucleotides used for assembling the Hph ΔCpG gene,</li><li><figref idref="f0005">Figure 5</figref> : sequence of the Bsr ΔCpG gene,</li><li><figref idref="f0006">Figure 6</figref> : list of oligonucleotides used for the assembly of the Bsr ΔCpG gene,</li><li><figref idref="f0007">Figure 7</figref> : sequence of the Pac ΔCpG gene,</li><li><figref idref="f0008 f0009 f0010">Figure 8</figref> : list of oligonucleotides used for the assembly of the Pac ΔCpG gene,</li><li><figref idref="f0011 f0012">Figure 9</figref> : sequence of the LacZ ΔCpG gene,</li><li><figref idref="f0013">Figure 10A</figref> : list of oligonucleotides used for the assembly of the first third of the LacZ ΔCpG gene,</li><li><figref idref="f0014 f0015">Figure 10B</figref> : list of oligonucleotides used for the assembly of the second third of the LacZ ΔCpG gene,</li><li><figref idref="f0016">Figure 10C</figref> : list of oligonucleotides used for the assembly of the third third of the LacZ ΔCpG gene,</li><li><figref idref="f0017">Figure 11</figref>: sequence of the EM7 promoter (1-), degenerate oligonucleotides (2-) used to construct the EM2K promoter devoid of CpG (3-),</li><li><figref idref="f0018">Figure 12</figref> : sequence of origin of replication R6K gamma M2A,</li><li><figref idref="f0019">Figure 13</figref> : list of oligonucleotides used for the assembly of the R6K gamma M2A replication origin,</li><li><figref idref="f0020 f0021 f0022">Figure 14</figref> : sequence of the R6K gamma origin of the plasmid pGTR6Kneoc9 delimited by the PacI sites,</li><li><figref idref="f0023">Figure 15</figref> : sequence of the plasmid pSh-LacZΔCpG,</li><li><figref idref="f0024">Figure 16</figref> : map of the plasmid pShΔCpG,</li><li><figref idref="f0025">Figure 17</figref> : map of the plasmid pSh-LacZΔCpG,</li><li><figref idref="f0026">Figure 18</figref> : sequence of the NeoΔCpG gene (without CpG) [position 3 to 797 of DNA sequence = SEQ ID NO: 316; protein sequence = SEQ ID NO: 317],</li><li><figref idref="f0027">Figure 19</figref> : sequence of the oligonucleotides SEQ ID NO: 318 to SEQ ID NO: X used for the assembly of the NeoΔCpG gene.</li></ul>

EXAMPLE 1:

Construction of the Sh ble gene for resistance to Zeocin devoid of CpG

0024The Sh wheat gene ΔCpG whose sequence presented in <figref idref="f0001">figure 1</figref> (position 3 to 377 of SEQ ID NO: 1) was synthesized from an assembly of overlapping oligonucleotides (size 20-40 bp) whose sequences are given in the <figref idref="f0002">figure 2</figref>. The assembly method is done in three stages, the first consists in the phosphorylation of the oligonucleotides of the coding strand, in a second stage all the oligonucleotides of the two strands are associated by hybridization and ligation and, in the last stage, the gene is amplified by PCR. This method has been used successfully for the synthesis of all the synthetic genes mentioned in Examples 1, 2, 3, 4, 5. The method is detailed for the Sh ble ΔCpG gene: The 10 oligonucleotides from OL26199 to OL27099 (<figref idref="f0002">figure 2</figref>) corresponding to the coding strand are phosphorylated according to the following procedure: 1 μl of each of the oligonucleotides taken up in water at 250 μM are mixed in a microtube containing 15 μl of water to bring the final solution to a concentration of 100 picomoles per microliter . 5 μl of this solution are then mixed with 10 μl of polynucleotide-Kinase buffer concentrated 10 times, 0.4 μl of a 50 mM ATP solution, 85 μl of water and 1 μl of the enzyme (at 10 u / µl) and the whole is incubated for 4 hours at 37 ° C (solution A). A solution of the oligonucleotides of the non-coding strand is made up by mixing 1 μl of each oligonucleotide (OL27199 to OL28199; cf. <figref idref="f0002">figure 2</figref>) and <figref idref="f0001">1</figref> µl of oligonucleotide OL26099 (<figref idref="f0002">figure 2</figref>) in which 43 µl of water are added in order to obtain a final solution of 54 picomoles per µl (solution B). The assembly of the gene is carried out first by mixing 10 μl of solution A, 1 μl of solution B, 6 μl of a KCI solution at 100 mM, 3 μl of a solution of NP-40 at 0 , 5%, 4 µl of a 50 mM MgCl2 solution, 3 µl of a 10 mM ATP solution and 7.5 µl of Pfu ligase (30 units) then the mixture is heated in a programmable thermal cycler 3 minutes at 95 ° C then 3 minutes at 80 ° C before undergoing 3 cycles of one minute at 95 ° C, followed by a passage from 95 ° C to 70 ° C in 1 minute, then from 70 ° C to 55 ° C in 1 hour and finally 2 hours at 55 ° C. Then the mixture of the assembled oligonucleotides is amplified with the primers OL26099 and OL27199. The amplification product is purified on a Promega column, digested with the restriction enzymes NcoI and NheI and cloned in the plasmid pMOD1LacZ (wt) linearized by NcoI and NheI. The plasmid DNA sequences of 2 zeocin-resistant clones which appeared after transformation of the strain of<i>E.coli</i> GT100 (available from Invivogen) by mixing the ligation between the vector fragment and the PCR fragment, were found to conform to the desired sequence presented in <figref idref="f0001">Figure 1</figref>. This synthetic gene placed under the dependence of the bacterial promoter EM7 (vector pMOD1Sh ΔCpG) confers resistance to zeocine identical to that provided by the same vector containing the native gene<i>Sh ble</i> with the strain of<i>E.coli</i> GT100 receiver.

EXAMPLE 2:

Construction of the Hph gene for resistance to hygromycin lacking CpG

0025The synthetic gene Hph ΔCpG (sequence SEQ ID NO: 3 presented in <figref idref="f0003">Figure 3</figref>) was constructed according to the method described in Example 1. The two strands were synthesized using oligonucleotides of 60 bases plus two oligonucleotides of 30 bases with an overlapping region of 30 bases. The assembly of the different oligonucleotides presented in<figref idref="f0004">Figure 4</figref> was carried out by a final PCR with the sense oligonucleotides TTCAGCTGAGGAGAGGCACATC (SEQ ID NO: 299) and reverse CTCAGGATCCGCTAGCTAAT (SEQ ID NO: 300) according to the experimental conditions mentioned in the previous example. The amplified and purified fragment (1068 bp) was then digested with the restriction enzymes BspHI and NheI and cloned into the vector pMOD2 LacZ (wt) in which the NcoI site of pMOD1 is replaced by the BspHI site. Selection of clones<i>E.coli</i> containing this recombinant vector was carried out on FastMedia medium^™ Hygro Agar (Cayla). The sequence SEQ ID NO: 3 of the<figref idref="f0003">figure 3</figref> was confirmed by sequencing on the two strands of the plasmid DNA of two clones resistant to hygromycin. This synthetic gene placed under the dependence of the bacterial promoter EM7 (vector pMOD2 Hph ΔCpG) confers a resistance to hygromycin B at least equal to that provided by the same vector containing the native gene Hph with the strain of<i>E.coli</i> GT100 receiver.

EXAMPLE 3:

Construction of the blasticidin resistance Bsr gene lacking CpG.

0026The Bsr ΔCpG gene, the sequence of which is presented in <figref idref="f0005">figure 5</figref> (SEQ ID NO: 5) was synthesized from the oligonucleotides indicated in 6 following the method described in Example 1. The mixture of oligonucleotides assembled was amplified with the primers OL64 and OL76 (cf. <figref idref="f0006">Figure 6</figref>). The amplified and purified fragment was then digested with the restriction enzymes BspHI and NheI and cloned into the vector pMOD2 LacZ (wt). Selection of clones<i>E.coli</i> containing this recombinant vector was carried out on FastMedia medium^™ Blasti Agar (Cayla). The sequence SEQ ID NO: 5 of the<figref idref="f0005">figure 5</figref> was confirmed by sequencing on the two strands of the plasmid DNA of two clones resistant to blasticidin. This synthetic gene placed under the dependence of the bacterial promoter EM7 (vector pMOD2 Bsr ΔCpG) confers a resistance to blasticidine identical to that provided by the same vector containing the native gene Bsr with the strain d<i>'E.coli</i> GT100 receiver.

EXAMPLE 4:

Construction of the Pac gene for puromycin lacking CpG

0027The BspHI-NheI fragment (Pac ΔCpG gene; SEQ ID NO: 7) whose sequence is presented in <figref idref="f0007">figure 7</figref> was synthesized by an assembly of the oligonucleotides indicated in <figref idref="f0008 f0009 f0010">Figure 8</figref>. The mixture of assembled oligonucleotides was amplified with the primers sense pur24 (AGGACCATCATGACTGAG; SEQ ID NO: 301) and reverse pur25 (ATCATGTCGAGCTAGCTC; SEQ ID NO: 302). The purified BspHI-NheI fragment was cloned into the plasmid pMOD2LacZ (wt) between the BspHI and NheI sites. The plasmid DNA sequences of 2 clones of the GT100 strain resistant to puromycin appeared on the FastMedia medium^™ puro Agar (Cayla) after transformation by the ligation product between the vector fragment and the PCR fragment, were found to conform to the desired sequence presented in <figref idref="f0007">Figure 7</figref>. The synthetic gene Pac ΔCpG placed under the dependence of the bacterial promoter EM7 (vector pMOD2 Pac ΔCpG) confers a resistance to puromycin slightly superior to that provided by the same vector containing the native gene<i>pac</i> with the GT100 receptor strain of<i>E. coli.</i>

EXAMPLE 5:

Construction of the LacZ gene devoid of CpG encoding the β-galactosidase of

E. coli

0028The synthetic LacZ ΔCpG gene (SEQ ID NO: 9 presented in <figref idref="f0011 f0012">Figure 9</figref>) was built according to the method described in the previous examples. Given the size of the gene to be produced (more than 3000 bp), the construction was carried out in three distinct parts while conserving the restriction sites EcoRV and SacI at the same sites as on the native sequence of the gene<i>lake</i>Z. For each part, the two strands were synthesized using 40-base oligonucleotides plus two 20-base oligonucleotides with an overlapping region of 20 bases. The first region corresponds to the NcoI-EcoRV fragment (Part I), the second region corresponds to the EcoRV-SacI fragment (Part II) and the third region corresponds to the SacI-NheI fragment. The assembly of the different oligonucleotides presented in the<figref idref="f0013">figures 10A</figref> (oligonucleotides used for the assembly of part I), 10B (oligonucleotides used for the assembly of part II), 10C (oligonucleotides used for the assembly of part III), was carried out by PCR according to the same conditions described in the previous examples. The progressive cloning of the three parts of the synthetic gene was carried out in the vector pMOD1 LacZ (wt). The functionality of each cloned part as well as that of the complete synthetic gene present on the vector pMOD1 LacZ has been demonstrated by the revelation of the β-galactosidase activity on FastMedia medium.^™ Amp Xgal Agar (Cayla) of the recombinant clones obtained in the strain MC1061ΔLac. The complete synthetic gene LacZ ΔCpG put under the dependence of the promoter, EM7 gives 30% less β-galactosidase activity (luminometric assay of culture protein extracts) compared to the expression of the native LacZ gene in the same plasmid environment .

EXAMPLE 6:

Construction of a strong promoter

E.coli

lacking CpG

0029The bacterial promoter EM7 present on the pMOD1 type vectors is a synthetic, constitutive and strong promoter in <i>E. coli.</i> Its sequence which contains 3 CpG (SEQ ID NO: 297 in <figref idref="f0017">Figure 11</figref>) served as a reference for developing a bacterial promoter devoid of CpG. We produced degenerate "linker" oligonucleotides at 4 locations (indicated W, D, W and H on the sequence SEQ ID NO: 298 in<figref idref="f0017">Figure 11</figref>) and compatible with the AseI and NcoI restriction sites. These different oligos were hybridized and cloned in pMOD1 ShtΔCpG between the AseI and NcoI restriction sites of the EM7 promoter. After selection of the recombinant clones on FastMedia medium^™Zeo Agar and determination of the promoter sequence of the most zeocin-resistant clone, we have retained the EM2K promoter (sequence SEQ ID NO: 11 in <figref idref="f0017">Figure 11</figref>) as a bacterial promoter devoid of CpG.

EXAMPLE 7:

Summary of R6K origins

gamma

lacking CpG

0030The PacI DNA fragment containing the R6K gamma M2A origin (SEQ ID NO: 12 in <figref idref="f0018">Figure 12</figref>) was synthesized by PCR from the assembly of the oligonucleotides indicated in <figref idref="f0019">Figure 13</figref>. The assembly of the R6K gamma M2A fragment was amplified with the primers RK15 (GCAGGACTGAGGC<u>TTAATTAA</u>ACCTTAAAAC; SEQ ID NO: 303) and RK16 (AAGTCTCCAGG<u>TTAATTAA</u>GATCAGCAGTTC; SEQ ID NO: 304), and the fragments after digestion with the PacI enzyme were cloned into a plasmid (pGTCMVneo) containing the kanamycin resistance gene and the origin of replication pUC bounded by 2 PacI sites. Many transformants of the GT97 strain (which expresses the pi protein) were analyzed and were only selected from clones containing a plasmid with a high copy and preserved after several subcultures in the absence of kanamycin. It was found after sequencing that the ori fragment of most of these plasmids could have a reduced number (5-6) of repeated sequences instead of the 7 of the natural origin of the plasmid R6K. One of these new sequences of synthetic gamma R6K origin devoid of CpG is presented in SEQ ID NO: 13 in<figref idref="f0020 f0021 f0022">Figure 14</figref>. Two other versions of the R6K gamma origin in which the G of each CpG present in the repeated sequences (22 bp element repeated several times in the binding region of the pi protein) has been replaced by a C to give the origin (R6K gamma M2C) or a T to give the origin (R6K gamma M2T) were synthesized in an analogous manner. The functionality of these new R6K gamma origins in which the G of the CpGs of repeated sequences is replaced by a C or by a T, added to the example of the origin of the <figref idref="f0019">Figure 13</figref> where the G is replaced by an A demonstrates that the CpGs of these repeated sequences have no role in the functionality of the origin.

EXAMPLE 8:

Assembly of plasmid vectors entirely devoid of CpG expressing a resistance gene in

E.coli

0031Firstly, a PacI-PacI cassette containing the bacterial promoter EM2K, the gene for resistance to Zeocin Sh ΔCpG followed by a bacterial terminator without CpG was produced. For this, "linker" oligonucleotides containing the terminator sequence<i>tl</i> from the intergenic region <i>rpsO-pnp</i> of<i>E.coli</i> were hybridized and cloned between the NheI and PacI sites of the vector pMOD1 EM2K Sh ΔCpG:<ul id="ul0003" list-style="none" compact="compact"><li>"Linker" oligonucleotides: rpsO-1 (5 '-> 3'): CTAGCTGAGTTTCAGAAAAGGGGGCCTGAGTGGCCCCTTTTTTCAACTTAAT SEQ ID NO: 305 rpsO-2 (5 '-> 3'): TAAGTTGAAAAAAGGGGCCACTCAGGCCCCCTTTTCTGAAACTCAG SEQ ID NO: 306</li></ul>

0032The recombinant vector obtained (pMOD1 EM2K Sh ΔCpG Term) was verified by sequencing at the level of the terminator sequence which does not naturally contain CpG. The EM2K-Sh ΔCpG -Term cassette contained in this vector was then amplified by PCR to bound it on both sides by PacI sites using the following primers:<ul id="ul0004" list-style="none" compact="compact"><li>PACI-UP (5 '-> 3'): ATCGTTAATTAAAACAGTAGTTGACAATTAAACATTGGC SEQ ID NO: 307</li><li>PACI-DOWN (5 '-> 3'): ATCGTTAATTAAGTTGAAAAAAGGGGCC SEQ ID NO: 308</li></ul>

0033This amplified fragment was then purified and cut with PacI and then assembled with the PacI fragment containing the R6K gamma ΔCpG origin described in Example 7. After transformation of this ligation mixture into the strain GT97 (which expresses the pi protein) and selection on FastMedia medium^™Zeo, the analysis of the recombinant clones obtained revealed two possible orientations of the PacI-PacI fragment containing the R6K gamma ΔCpG origin. The orientation retained in the pSh ΔCpG is represented in<figref idref="f0024">Figure 16</figref>.

EXAMPLE 9:

Assembly of a plasmid vector entirely devoid of CpG expressing the zeocin resistance gene and the β-galactosidase gene in

E. coli.

0034The vector pSh ΔCpG described in Example 8 (<figref idref="f0024">Figure 16</figref>) was used to insert the synthetic LacZ gene devoid of CpG between the EcoRI and NheI sites. For this, "linker" oligonucleotides, EcoRI and NcoI compatible, containing a consensus sequence of ribosome binding site of<i>E.coli</i> were hybridized and cloned with the LacZΔCpG NcoI-NheI fragment of pMOD1 LacZΔCpG between the EcoRI and NheI sites of the vector pMOD1 EM2K ShΔCpG.

"Linker" oligonucleotides used:

0035<ul id="ul0005" list-style="none" compact="compact"><li>rbs-1 (5 '-> 3'): AATTCTGAGGAGAAGCT SEQ ID NO: 309</li><li>rbs-2 (5 '-> 3'): CATGAGCTTCTCCTCAG SEQ ID NO: 310</li></ul>

0036The transformation of this ligation mixture in the GT97 strain (which expresses the pi protein) and the selection on FastMedia medium^™Zeo Xgal made it possible to obtain recombinant clones containing the vector pSh-LacZΔCpG (<figref idref="f0023">Figures 15</figref> and <figref idref="f0025">17</figref>). This vector co-expresses, under the dependence of the bacterial promoter EM2K, in the artificial operon system the genes ShΔCpG and LacZΔCpG.

EXAMPLE 10

: Obtaining a strain

of E. coli

expressing the mutant protein

pi116

and carrying a deletion in the gene

dcm.

0037The gene <i>pir</i> coding for the pi protein essential for the initiation of the replication of the R6K origin <i>gamma</i> as well as the mutated gene <i>pir116</i> leading to an increase in the number of copies of R6K plasmids <i>gamma</i> have been introduced in a functional form into various strains of<i>E.coli</i> K12 by different groups. Strains of this type can be obtained from<i>E.coli</i> Genetic Stock Center (http://cgsc.biology.yale.edu), and are also commercially available from companies specializing in the supply of biological material for research. This is the case for example of the pir1 strains (<i>pir116</i>) and pir2 (<i>wild pir</i>) offered by the company Invitrogen whose products can be purchased in all European countries. The GT 97 strain of line K12, of genome Δ<i>lac169 hsdR514 endA1 recA1 codBA uidA (ΔMluI) :: pir 116</i> (available from InvivoGen), was chosen for its hardiness, the consistency of the DNA preparations of the R6K plasmids <i>gamma</i> and its high levels of competence among several K12 strains <i>pir</i> of distinctive genotype for some genes. The introduction of a deletion in the gene<i>dcm</i> of the GT 97 strain was carried out as follows: Two regions of DNA of 1.8 kb and 1.5 kb, respectively bordering the initiation codon ATG (fragment A) and the stop codon TGA (fragment B) of the gene <i>dcm</i> were amplified by PCR. Fragment A was amplified with the pair of primers OLdcmAF (TTTT<u>GCGGCCGCT</u>TGCTGCGCCAGCAACTAATAACG; SEQ ID NO: 311) and OLdcmAR (CCTT<u>GGATCC</u>TGGTAAACACGCACTGTCCGCCAATCGATTC; SEQ ID NO: 312) and fragment B was amplified with the pair of primers OLdcmBF (TTTT<u>GGATCC</u>TCAGCAAGAGGCACAACATG; SEQ ID NO: 313) and OLdcmBR (TTTT<u>CTCGAGA</u>AACGGCAGCTCTGATACTTGCTTC; SEQ ID NO: 314). The restriction sites for the enzymes NotI (GCGGCCGC) BamHI (GGATCC) and XhoI (CTCGAG) were introduced into the primers in order to associate the fragment A and the fragment B between them by forming a genetic element bounded by the NotI and XhoI. The gene region<i>dcm</i> is thus reconstituted by creating a deletion which extends from the position +3 after the ATG to the position -14 before the TGA. This genetic element was cloned into pKO3 (<nplcit id="ncit0008" npl-type="s"><text>Link AJ, Phillips D. and Church GM (1997) J Bacteriol 179, 6228-37</text></nplcit>), a vector developed for allele replacement in <i>Escherichia coli</i> with thermosensitive replication between the NotI and SalI sites to give the plasmid designated pKO3Δdcm. This plasmid was co-transformed in strain GT97 with a plasmid which expresses the RecA protein (pFL352). A transformant containing the two plasmids was cultured at a non-permissive temperature (42 ° C.) in the presence of chloramphenicol to select clones which have integrated, by homologous recombination, pKO3Δdcm into the bacterial chromosome. A chloramphenicol-resistant subclone at 42 ° C. was then cultivated at 30 ° C. on a medium containing a high concentration of sucrose (5%) to counter-select the strains which after a second homologous recombination event have exchanged the chromosomal region. of the gene <i>dcm</i> with the homologous fragment cloned into the plasmid. The deletion introduced into the retained clone (GT106) was verified by PCR with the pair of primers OldcmAF and OldcmBR generating a fragment of a size smaller than that obtained with the parental strain and by PCR with the primer OldcmBR and a primer positioned outside the exchanged region (OldcmCF TTTTGCGGCCGCGTTGCGGTATTACCCTTGTC; SEQ ID NO: 315). The genotype <i>dcm</i> GT106 strain was confirmed by introducing therein and into GT106 a plasmid containing a restriction site of the enzyme SexAI subject to methylation dcm. The plasmid purified from GT106 is cleaved by SexAI while it is resistant to the enzyme when it is purified from GT97. This last strain designated GT106 has the same growth characteristics of the parental strain GT97 and, as expected, no negative modification in the amount of DNA of the R6K plasmids. <i>gamma</i> was observed, only the quality of the DNA estimated by the absence of methylation of the cytosines of the sites <i>dcm</i> has been improved. The GT106 strain will be available from Invivogen from the day of filing of this patent application.

EXAMPLE

11- production of the neo-resistance neomycin gene lacking CpG.

0038The Neo ΔCpG gene, the sequence of which is presented in <figref idref="f0026">figure 18</figref> (position 3 to 797 of DNA sequence presented in <figref idref="f0026">Figure 18</figref> = SEQ ID NO: 316; protein sequence = SEQ ID NO: 317) was synthesized from an assembly of overlapping oligonucleotides (size 20-40 bp) whose sequences are given in the<figref idref="f0027">figure 19</figref>. The assembly method is carried out in three stages, the first consists in the phosphorylation of the oligonucleotides of the coding strand, in a second stage, all of the oligonucleotides of the two strands are associated by hybridization and ligation and, in the last stage, the gene is amplified by PCR. The 20 oligonucleotides from SEQ ID NO: 319 to SEQ ID NO: 338 (<figref idref="f0027">Figure 19</figref>) corresponding to the coding strand are phosphorylated according to the following procedure: 1 μl of each of the oligonucleotides taken up in water at 250 μM are mixed in a microtube containing 50 μl of water to bring the final solution to a concentration of 100 picomoles per microliter . 5 μl of this solution are then mixed with 10 μl of 10-fold concentrated polynucleotide kinase buffer, 0.4 μl of a 50 mM ATP solution, 85 μl of water and 1 μl of the enzyme (at 10 u / µl) and the whole is incubated for 4 hours at 37 ° C then 5 minutes at 95 ° C (solution A). A solution of the oligonucleotides of the non-coding strand is made up by mixing 1 μl of each oligonucleotide (SEQ ID NO: 339 to SEQ ID NO: 360; <figref idref="f0027">Figure 19</figref>) and <figref idref="f0001">1</figref> µl of the oligonucleotide SEQ ID NO: 318 (<figref idref="f0027">figure 19</figref>) in which 106 μl of water are added in order to obtain a final solution of 54 picomoles per μl (solution B). The gene is assembled first by mixing 10 µl of solution A, 1 µl of solution B, 6 µl of 100 mM KCl solution, 3 µl of a solution of the NP- surfactant 40 to 0.5%, 4 µl of a 50 mM MgCl2 solution, 3 µl of a 10 mM ATP solution and 7.5 µl of Pfu ligase (30 units) then the mixture is heated in a programmable thermal cycler 3 minutes at 95 ° C then 3 minutes at 80 ° C before undergoing 3 cycles of one minute at 95 ° C, followed by a passage from 95 ° C to 70 ° C in 1 minute, then from 70 ° C to 55 ° C in 1 hour and finally 2 hours at 55 ° C. Then the mixture of the assembled oligonucleotides is amplified with the primers NO1 and NO22. The amplification product is purified on a Promega column, digested with the restriction enzymes BspHI and NheI and cloned in the plasmid pMOD2LacZ (wt) linearized with BspHI and NheI. The plasmid DNA sequences of 2 kanamycin-resistant clones, which appeared after transformation of the strain of<i>E. coli</i> GT100 (available from Invivogen) by mixing the ligation between the vector fragment and the PCR fragment, were found to conform to the sequence presented in <figref idref="f0026">Figure 18</figref>. This synthetic gene placed under the dependence of the bacterial promoter EM7 (vector pMOD2Néo ΔCpG) confers a resistance to kanamycin identical to that provided by the same vector containing the native neo gene with the strain<i>of. coli</i> GT100 receiver. The neo BspHI-NheI fragment of the plasmid pMOD2Néo ΔCpG was then introduced into the plasmid pSh ΔCpG of the<figref idref="f0024">figure 16</figref> linearized by NcoI-NheI to give after ligation and transformation in <i>E. coli</i> the plasmid pNéoΔCpG.

SEQUENCE LISTING

0039<ul id="ul0006" list-style="none"><li><110> CAYLA</li><li><120> SYNTHETIC GENES AND BACTERIAL PLASMIDS DEVOID OF CpG</li><li><130> FP - D. 0200862</li><li><140> <patcit id="pcit0001" dnum="FR0200862W"><text>PCT / FR02 / 00862</text></patcit> <141> 2002-03-11</li><li><150> <patcit id="pcit0002" dnum="FR0103274"><text>FR01 / 03274</text></patcit> <151> 2001-03-09</li><li><160> 360</li><li><170> PatentIn version 3.1</li><li><210> 1 <211> 396 <212> DNA <213> Artificial Sequence</li><li><220> <223> CpG-Free shable <220> <221> CDS <222> (3) .. (374) <223></li><li><400> 1 <img file="EP1366176B2_D0001.tif" /></li><li><210> 2 <211> 124 <212> PRT <213> Artificial Sequence</li><li><220> <223> CpG-Free sh ble <400> 2<img file="EP1366176B2_D0002.tif" /></li><li><210> 3 <211> 1040 <212> DNA <213> Artificial sequence</li><li><220> <223> CpG-Free Hph <220> <221> CDS <222> (3) .. (1025) <223></li><li><400> 3 <img file="EP1366176B2_D0003.tif" /><img file="EP1366176B2_D0004.tif" /></li><li><210> 4 <211> 341 <212> PRT <213> Artificial Sequence</li><li><220> <223> CpG-Free Hph</li><li><400> 4 <img file="EP1366176B2_D0005.tif" /><img file="EP1366176B2_D0006.tif" /></li><li><210> 5 <211> 442 <212> DNA <213> Artificial Sequence</li><li><220> <223> CpG-Free Bsr <220> <221> CDS <222> (3) .. (422) <223></li><li><400> 5 <img file="EP1366176B2_D0007.tif" /><img file="EP1366176B2_D0008.tif" /></li><li><210> 6 <211> 140 <212> PRT <213> Artificial Sequence</li><li><220> <223> cpG-Free Bsr <400> 6<img file="EP1366176B2_D0009.tif" /></li><li><210> 7 <211> 614 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0007" list-style="none"><li><220> <223> CpG-Free Pac <220> <221> CDS <222> (3) .. (599) <223></li><li><400> 7 <img file="EP1366176B2_D0010.tif" /></li><li><210> 8 <211> 199 <212> PRT <213> Artificial Sequence</li><li><220> <223> CpG-Free Pac <400> 8<img file="EP1366176B2_D0011.tif" /></li><li><210> 9 <211> 3071 <212> DNA <213> Artificial Sequence</li><li><220> <223> CpG-Free Lacz <220> <221> CDS <222> (3) .. (3056) <223></li><li><400> 9 <img file="EP1366176B2_D0012.tif" /><img file="EP1366176B2_D0013.tif" /><img file="EP1366176B2_D0014.tif" /><img file="EP1366176B2_D0015.tif" /><img file="EP1366176B2_D0016.tif" /></li></ul><ul id="ul0008" list-style="none"><li><210> 10 <211> 1018 <212> PRT <213> Artificial Sequence</li><li><220> <223> CpG-Free Lacz <400> 10<img file="EP1366176B2_D0017.tif" /><img file="EP1366176B2_D0018.tif" /><img file="EP1366176B2_D0019.tif" /><img file="EP1366176B2_D0020.tif" /><img file="EP1366176B2_D0021.tif" /></li><li><210> 11 <211> 66 <212> DNA <213> Artificial Sequence</li><li><220> <223> CpG-Free constitutive promotor</li><li><400> 11 <img file="EP1366176B2_D0022.tif" /></li><li><210> 12 <211> 320 <212> DNA <213> Artificial Sequence</li><li><220> <223> CpG-Free replication origin</li><li><400> 12 <img file="EP1366176B2_D0023.tif" /></li><li><210> 13 <211> 273 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0009" list-style="none"><li><220> <223> CpG-Free replication origin</li><li><400> 13 <img file="EP1366176B2_D0024.tif" /></li><li><210> 14 <211> 3852 <212> DNA <213> Artificial Sequence</li><li><220> <223> SEQ ID NO: 14 = CpG-Free pSh-LacZ plasmid; SEQ ID NO: 15 = SEQ ID NO: 14 CDS from 83 to 454 (SEQ ID NO: 2) + SEQ ID NO: 14 CDS from 483 to 3536 (SEQ ID NO: 10)</li><li><220> <221> CDS <222> (83) .. (454) <223></li><li><220> <221> CDS <222> (483) .. (3536) <223></li><li><400> 14 <img file="EP1366176B2_D0025.tif" /><img file="EP1366176B2_D0026.tif" /><img file="EP1366176B2_D0027.tif" /><img file="EP1366176B2_D0028.tif" /><img file="EP1366176B2_D0029.tif" /><img file="EP1366176B2_D0030.tif" /></li><li><210> 15 <211> 1142 <212> PRT <213> Artificial Sequence</li><li><220> <223> SEQ ID NO: 14 = CpG-Free psh-Lacz plasmid; SEQ ID NO: 15 = SEQ ID No: 14 CDS from 83 to 454 (SEQ ID NO: 2) + SEQ ID NO: 14 CDS from 483 to 3536 (SEQ ID NO: 10)</li><li><400> 15 <img file="EP1366176B2_D0031.tif" /><img file="EP1366176B2_D0032.tif" /><img file="EP1366176B2_D0033.tif" /><img file="EP1366176B2_D0034.tif" /><img file="EP1366176B2_D0035.tif" /></li><li><210> 16 <211> 40 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0010" list-style="none"><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 16 aactcagctg aggaggcaga ccatggccaa gttgaccagt 40</li><li><210> 17 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 17 gctgtcccag tgctcacagc cagggatgtg gctggagctg 40</li><li><210> 18 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 18 ttgagttctg gactgacagg ttggggttct ccagagattt 40</li><li><210> 19 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Sh ble</li><li><400> 19 tgtggaggat gactttgcag gtgtggtcag agatgatgtc 40</li><li><210> 20 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 20 accctgttca tctcagcagt ccaggaccag gtggtgcctg 40</li><li><210> 21 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 21 acaacaccct ggcttgggtg tgggtgagag gactggatga 40</li><li><210> 22 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 22 gctgtatgct gagtggagtg aggtggtctc caccaacttc 40</li><li><210> 23 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Sh ble</li><li><400> 23 agggatgcca gtggccctgc catgacagag attggagagc 40</li><li><210> 24 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CPG-Free sh ble</li><li><400> 24 agccctgggg gagagagttt gccctgagag acccagcagg 40</li><li><210> 25 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 25 caactgtgtg cactttgtgg cagaggagca ggactgagga 40</li><li><210> 26 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li></ul><ul id="ul0011" list-style="none"><li><400> 26 taagaattca gctagctcga c 21</li><li><210> 2-7 <211> 41 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 27 gtcgagctag ctgaattctt atcctcagtc ctgctcctct g 41</li><li><210> 28 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Sh ble</li><li><400> 28 ccacaaagtg cacacagttg cctgctgggt ctctcagggc 40</li><li><210> 29 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 29 aaactctctc ccccagggct gctctccaat ctctgtcatg 40</li><li><210> 30 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 30 gcagggccac tggcatccct gaagttggtg gagaccacct 40</li><li><210> 31 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 31 cactccactc agcatacagc tcatccagtc ctctcaccca 40</li></ul><ul id="ul0012" list-style="none"><li><210> 32 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 32 cacccaagcc agggtgttgt caggcaccac ctggtcctgg 40</li><li><210> 33 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Sh ble</li><li><400> 33 actgctgaga tgaacagggt gacatcatct ctgaccacac 40</li><li><210> 34 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 34 ctgcaaagtc atcctccaca aaatctctgg agaaccccaa 40</li><li><210> 35 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 35 cctgtcagtc cagaactcaa cagctccagc cacatccctg 40</li><li><210> 36 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 36 gctgtgagca ctgggacagc actggtcaac ttggccatgg 40</li><li><210> 37 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free sh ble</li><li><400> 37 tctgcctcct cagctgagtt 20</li><li><210> 38 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 38 tgagatcacc ggttcagctg aggaggcaca tcatgaagaa acctgaactg acagcaactt 60</li><li><210> 39 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 39 ctgttgagaa gtttctcatt gaaaaatttg attctgtttc tgatctcatg cagctgtctg 60</li><li><210> 40 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li></ul><ul id="ul0013" list-style="none"><li><400> 40 aaggtgaaga aagcagagcc ttttcttttg atgttggagg aagaggttat gttctgaggg 60</li><li><210> 41 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 41 tcaattcttg tgctgatggt ttttacaaag acagatatgt ttacagacac tttgcctctg 60</li><li><210> 42 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 42 ctgctctgcc aattccagaa gttctggaca ttggagaatt ttctgaatct ctcacctact 60</li><li><210> 43 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 43 gcatcagcag aagagcacaa ggagtcactc tccaggatct ccctgaaact gagctgccag 60</li><li><210> 44 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 44 ctgttctgca acctgttgct gaagcaatgg atgccattgc agcagctgat ctgagccaaa 60</li><li><210> 45 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 45 cctctggatt tggtcctttt ggtccccaag gcattggtca gtacaccact tggagggatt 60</li><li><210> 46 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 46 tcatttgtgc cattgctgat cctcatgtct atcactggca gactgtgatg gatgacacag 60</li><li><210> 47 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 47 tttctgcttc tgttgctcag gcactggatg aactcatgct gtgggcagaa gattgtcctg 60</li><li><210> 48 <211> 60 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0014" list-style="none"><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 48 aagtcagaca cctggtccat gctgattttg gaagcaacaa tgttctgaca gacaatggca 60</li><li><210> 49 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 49 gaatcactgc agtcattgac tggtctgaag ccatgtttgg agattctcaa tatgaggttg 60</li><li><210> 50 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 50 ccaacatttt tttttggaga ccttggctgg cttgcatgga acaacaaaca agatattttg 60</li><li><210> 51 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 51 aaagaagaca cccagaactg gctggttccc ccagactgag agcctacatg ctcagaattg 60</li><li><210> 52 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 52 gcctggacca actgtatcaa tctctggttg atggaaactt tgatgatgct gcttgggcac 60</li><li><210> 53 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 53 aaggaagatg tgatgccatt gtgaggtctg gtgctggaac tgttggaaga actcaaattg 60</li><li><210> 54 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 54 caagaaggtc tgctgctgtt tggactgatg gatgtgttga agttctggct gactctggaa 60</li><li><210> 55 <211> 60 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0015" list-style="none"><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 55 acaggagacc ctccacaaga cccagagcca aggaatgaat attagctagc ggatcctgag 60</li><li><210> 56 <211> 30 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 56 ctcaggatcc gctagctaat attcattcct 30</li><li><210> 57 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 57 tggctctggg tcttgtggag ggtctcctgt ttccagagtc agccagaact tcaacacatc 60</li><li><210> 58 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 58 catcagtcca aacagcagca gaccttcttg caatttgagt tcttccaaca gttccagcac 60</li><li><210> 59 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 59 cagacctcac aatggcatca catcttcctt gtgcccaagc agcatcatca aagtttccat 60</li><li><210> 60 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 60 caaccagaga ttgatacagt tggtccaggc caattctgag catgtaggct ctcagtctgg 60</li><li><210> 61 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 61 gggaaccagc cagttctggg tgtcttcttt caaaatatct tgtttgttgt tccatgcaag 60</li><li><210> 62 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 62 ccagccaagg tctccaaaaa aaaatgttgg caacctcata ttgagaatct ccaaacatgg 60</li></ul><ul id="ul0016" list-style="none"><li><210> 63 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 63 cttcagacca gtcaatgact gcagtgattc tgccattgtc tgtcagaaca ttgttgcttc 60</li><li><210> 64 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 64 caaaatcagc atggaccagg tgtctgactt caggacaatc ttctgcccac agcatgagtt 60</li><li><210> 65 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 65 catccagtgc ctgagcaaca gaagcagaaa ctgtgtcatc catcacagtc tgccagtgat 60</li><li><210> 66 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 66 agacatgagg atcagcaatg gcacaaatga aatccctcca agtggtgtac tgaccaatgc 60</li><li><210> 67 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 67 cttggggacc aaaaggacca aatccagagg tttggctcag atcagctgct gcaatggcat 60</li><li><210> 68 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 68 ccattgcttc agcaacaggt tgcagaacag ctggcagctc agtttcaggg agatcctgga 60</li><li><210> 69 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-Free Hph</li><li><400> 69 gagtgactcc ttgtgctctt ctgctgatgc agtaggtgag agattcagaa aattctccaa 60</li><li><210> 70 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 70 tgtccagaac ttctggaatt ggcagagcag cagaggcaaa gtgtctgtaa acatatctgt 60</li></ul><ul id="ul0017" list-style="none"><li><210> 71 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 71 ctttgtaaaa accatcagca caagaattga ccctcagaac ataacctctt cctccaacat 60</li><li><210> 72 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 72 caaaagaaaa ggctctgctt tcttcacctt cagacagctg catgagatca gaaacagaat 60</li><li><210> 73 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 73 caaatttttc aatgagaaac ttctcaacag aagttgctgt cagttcaggt ttcttcatga 60</li><li><210> 74 <211> 30 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Hph</li><li><400> 74 tgtgcctcct cagctgaacc ggtgatctca 30</li><li><210> 75 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 75 aggaggcaca tcatgaagac cttcaacatc tctcagcagg 40</li><li><210> 76 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 76 atctggagct ggtggaggtc gccactgaga agatcaccat 40</li><li><210> 77 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 77 gctctatgag gacaacaagc accatgtcgg ggcggccatc 40</li><li><210> 78 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-Free Bsr</li><li><400> 78 aggaccaaga ctggggagat catctctgct gtccacattg 40</li><li><210> 79 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 79 aggcctacat tggcagggtc actgtctgtg ctgaagccat 40</li><li><210> 80 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 80 tgccattggg tctgctgtga gcaacgggca gaaggacttt 40</li></ul><ul id="ul0018" list-style="none"><li><210> 81 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 81 gacaccattg tggctgtcag gcacccctac tctgatgagg 40</li><li><210> 82 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 82 tggacagatc catcagggtg gtcagcccct gtggcatgtg 40</li><li><210> 83 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 83 cagagagctc atctctgact atgctcctga ctgctttgtg 40</li><li><210> 84 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 84 ctcattgaga tgaatggcaa gctggtcaaa accaccattg 40</li><li><210> 85 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 85 aggaactcat ccccctcaag tacaccagga actaaacctg 40</li><li><210> 86 <211> 21 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 86 aattcagcta gctcgacatg at 21</li><li><210> 87 <211> 41 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 87 tcatgtcgag ctagctgaat tcaggtttag ttcctggtgt a 41</li><li><210> 88 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 88 cttgaggggg atgagttcct caatggtggt tttgaccagc 40</li><li><210> 89 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 89 ttgccattca tctcaatgag cacaaagcag tcaggagcat 40</li><li><210> 90 <211> 40 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0019" list-style="none"><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 90 agtcagagat gagctctctg cacatgccac aggggctgac 40</li><li><210> 91 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 91 caccctgatg gatctgtcca cctcatcaga gtaggggtgc 40</li><li><210> 92 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 92 ctgacagcca caatggtgtc aaagtccttc tgcccgttgc 40</li><li><210> 93 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 93 tcacagcaga cccaatggca atggcttcag cacagacagt 40</li><li><210> 94 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 94 gaccctgcca atgtaggcct caatgtggac agcagagatg 40</li><li><210> 95 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 95 atctccccag tcttggtcct gatggccgcc ccgacatggt 40</li><li><210> 96 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 96 gcttgttgtc ctcatagagc atggtgatct tctcagtggc 40</li><li><210> 97 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-Free Bsr</li><li><400> 97 gacctccacc agctccagat cctgctgaga gatgttgaag 40</li><li><210> 98 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Bsr</li><li><400> 98 gtcttcatga tgtgcctcct 20</li><li><210> 99 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-Free Pac</li><li><400> 99 ctcactatag gaggaccatc atgactgagt acaaacccac agtgaggctg gcaaccagag 60</li></ul><ul id="ul0020" list-style="none"><li><210> 100 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 100 atgatgttcc aagagctgtg agaacactgg ctgctgcttt tgcagactac cctgcaacaa 60</li><li><210> 101 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 101 ggcacacagt tgaccctgac aggcacattg agagggtgac agaactgcaa gaactcttcc 60</li><li><210> 102 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 102 tcaccagagt gggactggac attggaaaag tttgggttgc agatgatgga gctgctgttg 60</li><li><210> 103 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 103 cagtttggac aacacctgag tctgttgaag ctggtgctgt ttttgctgaa attggaccaa 60</li><li><210> 104 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 104 gaatggctga gctctctgga agcaggctgg cagcacaaca acaaatggaa ggtctgctgg 60</li><li><210> 105 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 105 caccacacag gccaaaagag ccagcttggt ttctggcaac tgttggagtg agccctgacc 60</li><li><210> 106 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 106 accagggaaa gggtctggga tctgctgttg ttctgcctgg agttgaagct gctgaaaggg 60</li><li><210> 107 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 107 ctggagttcc tgcctttctg gaaacttctg ctcccagaaa cctgcctttt tatgaaagac 60</li><li><210> 108 <211> 60 <212> DNA <213> Artificial sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li></ul><ul id="ul0021" list-style="none"><li><400> 108 tgggattcac tgtgacagct gatgttgagg ttccagaagg cccaagaact tggtgcatga 60</li><li><210> 109 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 109 caaggaagcc tggagcttaa acctgagcta gctcgacatg ataagataca ttgatgagtt 60</li><li><210> 110 <211> 30 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 110 aactcatcaa tgtatcttat catgtcgagc 30</li><li><210> 111 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 111 tagctcaggt ttaagctcca ggcttccttg tcatgcacca agttcttggg ccttctggaa 60</li><li><210> 112 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 112 cctcaacatc agctgtcaca gtgaatccca gtctttcata aaaaggcagg tttctgggag 60</li><li><210> 113 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 113 cagaagtttc cagaaaggca ggaactccag ccctttcagc agcttcaact ccaggcagaa 60</li><li><210> 114 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 114 caacagcaga tcccagaccc tttccctggt ggtcagggct cactccaaca gttgccagaa 60</li><li><210> 115 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 115 accaagctgg ctcttttggc ctgtgtggtg ccagcagacc ttccatttgt tgttgtgctg 60</li><li><210> 116 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 116 ccagcctgct tccagagagc tcagccattc ttggtccaat ttcagcaaaa acagcaccag 60</li><li><210> 117 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 117 cttcaacaga ctcaggtgtt gtccaaactg caacagcagc tccatcatct gcaacccaaa 60</li><li><210> 118 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li></ul><ul id="ul0022" list-style="none"><li><400> 118 cttttccaat gtccagtccc actctggtga ggaagagttc ttgcagttct gtcaccctct 60</li><li><210> 119 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 119 caatgtgcct gtcagggtca actgtgtgcc ttgttgcagg gtagtctgca aaagcagcag 60</li><li><210> 120 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 120 ccagtgttct cacagctctt ggaacatcat ctctggttgc cagcctcact gtgggtttgt 60</li><li><210> 121 <211> 30 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-Free Pac</li><li><400> 121 actcagtcat gatggtcctc ctatagtgag 30</li><li><210> 122 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 122 atcactatag gagggccacc atggaccctg ttgtgctgca 40</li><li><210> 123 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 123 ggtggccctc ctatagtgat 20</li><li><210> 124 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 124 aaggagagac tgggagaacc ctggagtgac ccagctcaac 40</li><li><210> 125 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 125 ggttctccca gtctctcctt tgcagcacaa cagggtccat 40</li><li><210> 126 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 126 agactggctg cccaccctcc ctttgcctct tggaggaact 40</li><li><210> 127 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 127 ggagggtggg cagccagtct gttgagctgg gtcactccag 40</li><li><210> 128 <211> 40 <212> DNA <213> Artificial Sequence</li></ul><ul id="ul0023" list-style="none"><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 128 ctgaggaagc caggacagac aggcccagcc agcagctcag 40</li><li><210> 129 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 129 gtctgtcctg gcttcctcag agttcctcca agaggcaaag 40</li><li><210> 130 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 130 gtctctcaat ggagagtgga ggtttgcctg gttccctgcc 40</li><li><210> 131 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 131 tccactctcc attgagagac ctgagctgct ggctgggcct 40</li><li><210> 132 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 132 cctgaagctg tgcctgagtc ttggctggag tgtgacctcc 40</li><li><210> 133 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 133 gactcaggca cagcttcagg ggcagggaac caggcaaacc 40</li><li><210> 134 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 134 cagaggctga cactgttgtg gtgcccagca actggcagat 40</li><li><210> 135 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG -free Lacz</li><li><400> 135 cacaacagtg tcagcctctg ggaggtcaca ctccagccaa 40</li><li><210> 136 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 136 gcatggctat gatgccccca tctacaccaa tgtcacctac 40</li><li><210> 137 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 137 tgggggcatc atagccatgc atctgccagt tgctgggcac 40</li><li><210> 138 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 138 cccatcactg tgaacccccc ttttgtgccc actgagaacc 40</li><li><210> 139 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 139 ggggggttca cagtgatggg gtaggtgaca ttggtgtaga 40</li><li><210> 140 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 140 ccactggctg ctacagcctg accttcaatg ttgatgagag 40</li></ul><ul id="ul0024" list-style="none"><li><210> 141 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 141 caggctgtag cagccagtgg ggttctcagt gggcacaaaa 40</li><li><210> 142 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 142 ctggctgcaa gaaggccaga ccaggatcat ctttgatgga 40</li><li><210> 143 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 143 tctggccttc ttgcagccag ctctcatcaa cattgaaggt 40</li><li><210> 144 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 144 gtcaactctg ccttccacct ctggtgcaat ggcaggtggg 40</li><li><210> 145 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 145 aggtggaagg cagagttgac tccatcaaag atgatcctgg 40</li><li><210> 146 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 146 ttggctatgg ccaagacagc aggctgccct ctgagtttga 40</li><li><210> 147 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 147 gctgtcttgg ccatagccaa cccacctgcc attgcaccag 40</li><li><210> 148 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 148 cctctctgcc ttcctcagag ctggagagaa caggctggct 40</li><li><210> 149 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 149 ctctgaggaa ggcagagagg tcaaactcag agggcagcct 40</li><li><210> 150 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 150 gtcatggtgc tcaggtggtc tgatggcagc tacctggaag 40</li><li><210> 151 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 151 gaccacctga gcaccatgac agccagcctg ttctctccag 40</li><li><210> 152 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LaCz</li><li><400> 152 accaagacat gtggaggatg tctggcatct tcagggatgt 40</li></ul><ul id="ul0025" list-style="none"><li><210> 153 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 153 catcctccac atgtcttggt cttccaggta gctgccatca 40</li><li><210> 154 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 154 gagcctgctg cacaagccca ccacccagat ttctgacttc 40</li><li><210> 155 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 155 tgggcttgtg cagcaggctc acatccctga agatgccaga 40</li><li><210> 156 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 156 catgttgcca ccaggttcaa tgatgacttc agcagagctg 40</li><li><210> 157 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 157 ttgaacctgg tggcaacatg gaagtcagaa atctgggtgg 40</li><li><210> 158 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 158 tgctggaggc tgaggtgcag atgtgtggag aactcagaga 40</li><li><210> 159 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 159 ctgcacctca gcctccagca cagctctgct gaagtcatca 40</li><li><210> 160 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 160 ctacctgaga gtcacagtga gcctctggca aggtgagacc 40</li><li><210> 161 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 161 tcactgtgac tctcaggtag tctctgagtt ctccacacat 40</li><li><210> 162 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 162 caggtggcct ctggcacagc cccctttgga ggagagatca 40</li><li><210> 163 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li></ul><ul id="ul0026" list-style="none"><li><400> 163 gctgtgccag aggccacctg ggtctcacct tgccagaggc 40</li><li><210> 164 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 164 ttgatgagag aggaggctat gctgacagag tcaccctgag 40</li><li><210> 165 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 165 atagcctcct ctctcatcaa tgatctctcc tccaaagggg 40</li><li><210> 166 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 166 gctcaatgtg gagaacccca agctgtggtc tgctgagatc 40</li><li><210> 167 <211> 40 <212> DNA <213> Artificial sequence</li><li><220> <223> assembling oligo for cpG-free LacZ</li><li><400> 167 tggggttctc cacattgagc ctcagggtga ctctgtcagc 40</li><li><210> 168 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 168 cccaacctct acagggctgt tgtggagctg cacactgctg 40</li><li><210> 169 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 169 acagccctgt agaggttggg gatctcagca gaccacagct 40</li><li><210> 170 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 170 atggcaccct gattgaagct gaagcctgtg atgttggatt 40</li><li><210> 171 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 171 agcttcaatc agggtgccat cagcagtgtg cagctccaca 40</li><li><210> 172 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 172 cagagaagtc aggattgaga atggcctgct gctgctcaat 40</li><li><210> 173 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 173 tctcaatcct gacttctctg aatccaacat cacaggcttc 40</li><li><210> 174 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 174 ggcaagcctc tgctcatcag gggagtcaac aggcatgagc 40</li><li><210> 175 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 175 ctgatgagca gaggcttgcc attgagcagc agcaggccat 40</li><li><210> 176 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 176 accaccctct gcatggacaa gtgatggatg aacagacaat 40</li><li><210> 177 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 177 ttgtccatgc agagggtggt gctcatgcct gttgactccc 40</li><li><210> 178 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 178 ggtgcaagat atcctgctga tgaagcagaa ctccgcctac 40</li><li><210> 179 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 179 tcagcaggat atcttgcacc attgtctgtt catccatcac 40</li><li><210> 180 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 180 gtaggcggag ttctgcttca 20</li></ul><ul id="ul0027" list-style="none"><li><210> 181 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 181 tcattagcag gatatcttgc 20</li><li><210> 182 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 182 gcaagatatc ctgctaatga agcagaacaa cttcaatgct 40</li><li><210> 183 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 183 gggtagtgag agcacctgac agcattgaag ttgttctgct 40</li><li><210> 184 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 184 gtcaggtgct ctcactaccc caaccaccct ctctggtaca 40</li><li><210> 185 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 185 gccatacctg tcacacaggg tgtaccagag agggtggttg 40</li><li><210> 186 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 186 ccctgtgtga caggtatggc ctgtatgttg ttgatgaagc 40</li><li><210> 187 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 187 tgccatgtgt ctcaatgttg gcttcatcaa caacatacag 40</li><li><210> 188 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 188 caacattgag acacatggca tggtgcccat gaacaggctc 40</li><li><210> 189 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 189 agccacctgg ggtcatctgt gagcctgttc atgggcacca 40</li><li><210> 190 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 190 acagatgacc ccaggtggct gcctgccatg tctgagagag 40</li><li><210> 191 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 191 tctctgcacc atcctggtca ctctctcaga catggcaggc 40</li><li><210> 192 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 192 tgaccaggat ggtgcagaga gacaggaacc acccctctgt 40</li><li><210> 193 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 193 tgcccagaga ccagatgatc acagaggggt ggttcctgtc 40</li><li><210> 194 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 194 gatcatctgg tctctgggca atgagtctgg acatggagcc 40</li><li><210> 195 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 195 ctgtagagag catcatggtt ggctccatgt ccagactcat 40</li><li><210> 196 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 196 aaccatgatg ctctctacag gtggatcaag tctgttgacc 40</li><li><210> 197 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 197 atactgcaca ggtctgctgg ggtcaacaga cttgatccac 40</li><li><210> 198 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 198 ccagcagacc tgtgcagtat gaaggaggtg gagcagacac 40</li><li><210> 199 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 199 agatgatgtc tgtggctgtg gtgtctgctc cacctccttc 40</li><li><210> 200 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 200 cacagccaca gacatcatct gccccatgta tgccagggtt 40</li><li><210> 201 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 201 gggaagggct ggtcctcatc aaccctggca tacatggggc 40</li><li><210> 202 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 202 gatgaggacc agcccttccc tgctgtgccc aagtggagca 40</li><li><210> 203 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 203 cagagagagc cacttcttga tgctccactt gggcacagca 40</li><li><210> 204 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 204 tcaagaagtg gctctctctg cctggagaga ccagacctct 40</li><li><210> 205 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 205 gtgcatattc acacaggatc agaggtctgg tctctccagg 40</li><li><210> 206 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 206 gatcctgtgt gaatatgcac atgcaatggg caactctctg 40</li><li><210> 207 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 207 cagtacttgg caaagcctcc cagagagttg cccattgcat 40</li><li><210> 208 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 208 ggaggctttg ccaagtactg gcaagccttc agacagtacc 40</li><li><210> 209 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 209 aaatcctcct tgcagcctgg ggtactgtct gaaggcttgc 40</li><li><210> 210 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 210 ccaggctgca aggaggattt gtgtgggact gggtggacca 40</li><li><210> 211 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 211 catcatactt gatgagagat tggtccaccc agtcccacac 40</li></ul><ul id="ul0028" list-style="none"><li><210> 212 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 212 atctctcatc aagtatgatg agaatggcaa cccctggtct 40</li><li><210> 213 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 213 ccaaagtctc ctccataggc agaccagggg ttgccattct 40</li><li><210> 214 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 214 gcctatggag gagactttgg tgacaccccc aatgacaggc 40</li><li><210> 215 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 215 caggccattc atgcagaact gcctgtcatt gggggtgtca 40</li><li><210> 216 <211> 40 <212> DNA <213> Artificial sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 216 agttctgcat gaatggcctg gtctttgcag acaggacccc 40</li><li><210> 217 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 217 cctctgtgag ggcagggtga ggggtcctgt ctgcaaagac 40</li><li><210> 218 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 218 tcaccctgcc ctcacagagg ccaagcacca gcaacagttc 40</li><li><210> 219 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 219 ccagacagcc tgaactggaa gaactgttgc tggtgcttgg 40</li><li><210> 220 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 220 ttccagttca ggctgtctgg acagaccatt gaggtgacat 40</li><li><210> 221 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 221 gtgcctgaag aggtactcag atgtcacctc aatggtctgt 40</li><li><210> 222 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 222 ctgagtacct cttcaggcac tctgacaatg agctcctgca 40</li><li><210> 223 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 223 tgcaggagct cattgtcaga 20</li><li><210> 224 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 224 gtaatttaac aatgagctcc tgcactggat ggtggccctg 40</li><li><210> 225 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 225 ggagctcatt gttaaattac 20</li><li><210> 226 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 226 gatggcaagc ctctggcttc tggtgaggtg cctctggatg 40</li><li><210> 227 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 227 gaagccagag gcttgccatc cagggccacc atccagtgca 40</li><li><210> 228 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 228 tggcccctca aggaaagcag ctgattgaac tgcctgagct 40</li><li><210> 229 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 229 ctgctttcct tgaggggcca catccagagg cacctcacca 40</li><li><210> 230 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 230 gcctcagcca gagtctgctg gacaactgtg gctaacagtg 40</li><li><210> 231 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free LacZ</li><li><400> 231 cagcagactc tggctgaggc agctcaggca gttcaatcag 40</li><li><210> 232 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 232 agggtggttc agcccaatgc aacagcttgg tctgaggcag 40</li><li><210> 233 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 233 gcattgggct gaaccaccct cactgttagc cacagttgtc 40</li><li><210> 234 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 234 gccacatctc tgcatggcag cagtggaggc tggctgagaa 40</li><li><210> 235 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 235 ctgccatgca gagatgtggc ctgcctcaga ccaagctgtt 40</li><li><210> 236 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 236 cctctctgtg accctgcctg ctgcctctca tgccatccct 40</li><li><210> 237 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 237 caggcagggt cacagagagg ttctcagcca gcctccactg 40</li><li><210> 238 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 238 cacctgacaa catctgaaat ggacttctgc attgagctgg 40</li><li><210> 239 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 239 atttcagatg ttgtcaggtg agggatggca tgagaggcag 40</li></ul><ul id="ul0029" list-style="none"><li><210> 240 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 240 gcaacaagag atggcagttc aacaggcagt ctggcttcct 40</li><li><210> 241 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 241 gaactgccat ctcttgttgc ccagctcaat gcagaagtcc 40</li><li><210> 242 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 242 gtctcagatg tggattggag acaagaagca gctcctcacc 40</li><li><210> 243 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 243 ctccaatcca catctgagac aggaagccag actgcctgtt 40</li><li><210> 244 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 244 cctctcaggg accaattcac cagggctcct ctggacaatg 40</li><li><210> 245 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 245 gtgaattggt ccctgagagg ggtgaggagc tgcttcttgt 40</li><li><210> 246 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 246 acattggagt gtctgaggcc accaggattg acccaaatgc 40</li><li><210> 247 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free LacZ</li><li><400> 247 ggcctcagac actccaatgt cattgtccag aggagccctg 40</li><li><210> 248 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 248 ttgggtggag aggtggaagg ctgctggaca ctaccaggct 40</li><li><210> 249 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 249 ccttccacct ctccacccaa gcatttgggt caatcctggt 40</li><li><210> 250 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 250 gaggctgccc tgctccagtg cacagcagac accctggctg 40</li><li><210> 251 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 251 cactggagca gggcagcctc agcctggtag tgtccagcag 40</li><li><210> 252 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 252 atgctgttct gatcaccaca gcccatgctt ggcagcacca 40</li><li><210> 253 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 253 tgtggtgatc agaacagcat cagccagggt gtctgctgtg 40</li><li><210> 254 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free LacZ</li><li><400> 254 aggcaagacc ctgttcatca gcagaaagac ctacaggatt 40</li><li><210> 255 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 255 tgatgaacag ggtcttgcct tggtgctgcc aagcatgggc 40</li><li><210> 256 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 256 gatggctctg gacagatggc aatcacagtg gatgtggagg 40</li><li><210> 257 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 257 gccatctgtc cagagccatc aatcctgtag gtctttctgc 40</li><li><210> 258 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 258 ttgcctctga cacacctcac cctgcaagga ttggcctgaa 40</li><li><210> 259 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 259 gtgaggtgtg tcagaggcaa cctccacatc cactgtgatt 40</li><li><210> 260 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 260 ctgtcaactg gcacaggtgg ctgagagggt gaactggctg 40</li><li><210> 261 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 261 ccacctgtgc cagttgacag ttcaggccaa tccttgcagg 40</li><li><210> 262 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 262 ggcttaggcc ctcaggagaa ctaccctgac aggctgacag 40</li><li><210> 263 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 263 ttctcctgag ggcctaagcc cagccagttc accctctcag 40</li><li><210> 264 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 264 ctgcctgctt tgacaggtgg gacctgcctc tgtctgacat 40</li><li><210> 265 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 265 ccacctgtca aagcaggcag ctgtcagcct gtcagggtag 40</li><li><210> 266 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 266 gtacacccct tatgtgttcc cttctgagaa tggcctgagg 40</li><li><210> 267 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 267 ggaacacata aggggtgtac atgtcagaca gaggcaggtc 40</li><li><210> 268 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 268 tgtggcacca gggagctgaa ctatggtcct caccagtgga 40</li><li><210> 269 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 269 ttcagctccc tggtgccaca cctcaggcca ttctcagaag 40</li><li><210> 270 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 270 ggggagactt ccagttcaac atctccaggt actctcagca 40</li><li><210> 271 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 271 gttgaactgg aagtctcccc tccactggtg aggaccatag 40</li><li><210> 272 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 272 acagctcatg gaaacctctc acaggcacct gctccatgca 40</li><li><210> 273 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 273 gagaggtttc catgagctgt tgctgagagt acctggagat 40</li></ul><ul id="ul0030" list-style="none"><li><210> 274 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 274 gaggagggaa cctggctgaa cattgatggc ttccacatgg 40</li><li><210> 275 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 275 ttcagccagg ttccctcctc tgcatggagc aggtgcctgt 40</li><li><210> 276 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 276 gcattggagg agatgactct tggtctcctt ctgtgtctgc 40</li><li><210> 277 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 277 agagtcatct cctccaatgc ccatgtggaa gccatcaatg 40</li><li><210> 278 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free LacZ</li><li><400> 278 tgagttccag ttatctgctg gcaggtacca ctatcagctg 40</li><li><210> 279 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free LacZ</li><li><400> 279 cagcagataa ctggaactca gcagacacag aaggagacca 40</li><li><210> 280 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for cpG-free Lacz</li><li><400> 280 gtgtggtgcc agaagtaaac ctgagctagc agtccatgat 40</li><li><210> 281 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 281 gtttacttct ggcaccacac cagctgatag tggtacctgc 40</li><li><210> 282 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for CpG-free Lacz</li><li><400> 282 atcatggact gctagctcag 20</li><li><210> 283 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 283 gcaggactga ggcttaatta aaccttaaaa cctttaaaag 40</li><li><210> 284 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 284 ccttatatat tctttttttt cttataaaac ttaaaacctt 40</li><li><210> 285 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 285 agaggctatt taagttgctg atttatatta attttattgt 40</li><li><210> 286 <211> 50 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 286 tcaaacatga gagcttagta catgaaacat gagagcttag tacattagcc 50</li><li><210> 287 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 287 atgagagctt agtacattag ccatgagggt ttagttcatt aaacatgaga gcttagtaca 60</li><li><210> 288 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 288 ttaaacatga gagcttagta catgaaacat gagagcttag tacatactat caacaggttg 60</li><li><210> 289 <211> 30 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 289 aactgctgat cttaattaac ctggagactt 30</li><li><210> 290 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 290 aagtctccag gttaattaag atcagcagtt caacctgttg atagtatgta ctaagctctc 60</li><li><210> 291 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 291 atgtttcatg tactaagctc tcatgtttaa tgtactaagc tctcatgttt aatgaactaa 60</li><li><210> 292 <211> 60 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 292 accctcatgg ctaatgtact aagctctcat ggctaatgta ctaagctctc atgtttcatg 60</li><li><210> 293 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 293 tactaagctc tcatgtttga acaataaaat taatataaat 40</li><li><210> 294 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 294 cagcaactta aatagcctct aaggttttaa gttttataag 40</li><li><210> 295 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A repplication origin</li><li><400> 295 aaaaaaaaga atatataagg cttttaaagg ttttaaggtt 40</li><li><210> 296 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> assembling oligo for R6K gamma M2A replication origin</li><li><400> 296 taattaagcc tcagtcctgc 20</li><li><210> 297 <211> 66 <212> DNA <213> Artificial Sequence</li><li><220> <223> EM7 promotor <400> 297<img file="EP1366176B2_D0036.tif" /></li><li><210> 298 <211> 66 <212> DNA <213> Artificial Sequence</li><li><220> <223> degenerated oligo for assembling the GpG-Free EM2K promotor</li><li><400> 298 <img file="EP1366176B2_D0037.tif" /></li><li><210> 299 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> sense oligo for the assembly of SEQ ID No: 38-74 oligos</li><li><400> 299 ttcagctgag gaggcacatc 20</li><li><210> 300 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> reverse oligo for the assembly of SEQ ID NO: 38-74 oligos</li><li><400> 300 ctcaggatcc gctagctaat 20</li><li><210> 301 <211> 18 <212> DNA <213> Artificial Sequence</li><li><220> <223> sense primer pure 24</li><li><400> 301 aggaccatca tgactgag 18</li><li><210> 302 <211> 18 <212> DNA <213> Artificial Sequence</li><li><220> <223> reverse reverse primer 25</li><li><400> 302 atcatgtcga gctagctc 18</li><li><210> 303 <211> 31 <212> DNA <213> Artificial Sequence</li><li><220> <223> RK15 primer</li><li><400> 303 gcaggactga ggcttaatta aaccttaaaa c 31</li><li><210> 304 <211> 31 <212> DNA <213> Artificial Sequence</li><li><220> <223> RK16 primer</li><li><400> 304 aagtctccag gttaattaag atcagcagtt c 31</li><li><210> 305 <211> 52 <212> DNA <213> Artificial Sequence</li><li><220> <223> rps0-1 oligo linker</li><li><400> 305 ctagctgagt ttcagaaaag ggggcctgag tggccccttt tttcaactta at 52</li><li><210> 306 <211> 46 <212> DNA <213> Artificial Sequence</li><li><220> <223> rps0-2 oligo linker</li><li><400> 306 taagttgaaa aaaggggcca ctcaggcccc cttttctgaa actcag 46</li><li><210> 307 <211> 39 <212> DNA <213> Artificial Sequence</li><li><220> <223> PACI-UP primer</li><li><400> 307 atcgttaatt aaaacagtag ttgacaatta aacattggc 39</li><li><210> 308 <211> 28 <212> DNA <213> Artificial Sequence</li><li><220> <223> PACI-DOWN primer</li><li><400> 308 atcgttaatt aagttgaaaa aaggggcc 28</li><li><210> 309 <211> 17 <212> DNA <213> Artificial Sequence</li><li><220> <223> rbs-1 oligo linker</li><li><400> 309 aattctgagg agaagct 17</li><li><210> 310 <211> 17 <212> DNA <213> Artificial Sequence</li><li><220> <223> rbs-2 oligo linker</li><li><400> 310 catgagcttc tcctcag 17</li><li><210> 311 <211> 36 <212> DNA <213> Artificial Sequence</li><li><220> <223> OL dcm AF primer</li><li><400> 311 ttttgcggcc gcttgctgcg ccagcaacta ataacg 36</li><li><210> 312 <211> 41 <212> DNA <213> Artificial Sequence</li><li><220> <223> OL dcm AR primer</li><li><400> 312 ccttggatcc tggtaaacac gcactgtccg ccaatcgatt c 41</li><li><210> 313 <211> 30 <212> DNA <213> Artificial Sequence</li><li><220> <223> OL dcm BF primer</li><li><400> 313 ttttggatcc tcagcaagag gcacaacatg 30</li><li><210> 314 <211> 35 <212> DNA <213> Artificial sequence</li><li><220> <223> OL dcm BR primer</li><li><400> 314 ttttctcgag aaacggcagc tctgatactt gcttc 35</li><li><210> 315 <211> 32 <212> DNA <213> Artificial Sequence</li><li><220> <223> OL dcm CF primer</li><li><400> 315 ttttgcggcc gcgttgcggt attacccttg tc 32</li><li><210> 316 <211> 795 <212> DNA <213> Artificial Sequence</li><li><220> <223> Neo DeltaCpG <220> <221> CDS <222> (1) .. (795) <223> neo gene without CpG</li><li><400> 316 <img file="EP1366176B2_D0038.tif" /><img file="EP1366176B2_D0039.tif" /></li><li><210> 317 <211> 264 <212> PRT <213> Artificial Sequence</li><li><220> <223> Neo DeltaCpG</li><li><400> 317 <img file="EP1366176B2_D0040.tif" /><img file="EP1366176B2_D0041.tif" /></li></ul><ul id="ul0031" list-style="none"><li><210> 318 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 318 cattaccggt aggcacatca tgattgaaca agatggccta 40</li><li><210> 319 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 319 catgcaggtt ctccagctgc ctgggttgag agactgtttg 40</li><li><210> 320 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 320 gctatgactg ggcacagcag accattggtt gctctgatgc 40</li><li><210> 321 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 321 agcagttttc agactttcag cccaaggcag gccagtcctt 40</li><li><210> 322 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 322 tttgtaaaga cagacctcag tggggctctc aatgagctcc 40</li><li><210> 323 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 323 aggatgaggc tgccagactc tcctggttgg caacaactgg 40</li><li><210> 324 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 324 ggtcccctgt gcagctgtcc ttgatgtggt cacagaagct 40</li><li><210> 325 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 325 ggaagggact ggctcctact aggtgaggtg cctgggcagg 40</li><li><210> 326 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 326 acctcctttc ctctcaccta gctccagctg agaaagtgtc 40</li><li><210> 327 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeTtacpG</li><li><400> 327 aatcatggct gatgccatga gaagactcca cacccttgac 40</li><li><210> 328 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 328 ccagccacct gcccctttga ccaccaggcc aagcacagga 40</li><li><210> 329 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 329 tagagagggc cagaaccagg atggaggctg gcctggtgga 40</li><li><210> 330 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 330 ccaagatgac ttggatgaag aacaccaggg cctggcccct 40</li><li><210> 331 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 331 gctgaactat ttgccaggct caaggcatcc atgccagatg 40</li><li><210> 332 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 332 gtgaggacct agtggtgact catggggatg cctgccttcc 40</li><li><210> 333 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 333 caacatcatg gttgaaaatg gaaggttctc tggcttcata 40</li><li><210> 334 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 334 gactgtggca ggctgggagt ggctgacagg taccaggaca 40</li><li><210> 335 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 335 ttgccctagc aaccagggac atagcagaag agctaggggg 40</li><li><210> 336 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 336 agagtgggca gacaggttcc tagtgctcta tggcattgca 40</li><li><210> 337 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 337 gcccctgact cccagagaat tgccttctac agacttcttg 40</li><li><210> 338 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 338 atgagttctt ctaaagctag ctgatcctga tagctgttcg 40</li><li><210> 339 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 339 cgaacagcta tcaggatcag 20</li><li><210> 340 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 340 ctagctttag aagaactcat caagaagtct gtagaaggca 40</li><li><210> 341 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 341 attctctggg agtcaggggc tgcaatgcca tagagcacta 40</li><li><210> 342 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 342 ggaacctgtc tgcccactct ccccctagct cttctgctat 40</li><li><210> 343 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 343 gtccctggtt gctagggcaa tgtcctggta cctgtcagcc 40</li><li><210> 344 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 344 actcccagcc tgccacagtc tatgaagcca gagaaccttc 40</li><li><210> 345 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 345 cattttcaac catgatgttg ggaaggcagg catccccatg 40</li><li><210> 346 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 346 agtcaccact aggtcctcac catctggcat ggatgccttg 40</li><li><210> 347 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 347 agcctggcaa atagttcagc aggggccagg ccctggtgtt 40</li><li><210> 348 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 348 cttcatccaa gtcatcttgg tccaccaggc cagcctccat 40</li><li><210> 349 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 349 cctggttctg gccctctcta tcctgtgctt ggcctggtgg 40</li><li><210> 350 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 350 tcaaaggggc aggtggctgg gtcaagggtg tggagtcttc 40</li><li><210> 351 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 351 tcatggcatc agccatgatt gacactttct cagctggagc 40</li><li><210> 352 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 352 taggtgagag gaaaggaggt cctgcccagg cacctcacct 40</li><li><210> 353 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 353 agtaggagcc agtcccttcc agcttctgtg accacatcaa 40</li><li><210> 354 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 354 ggacagctgc acaggggacc ccagttgttg ccaaccagga 40</li><li><210> 355 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 355 gagtctggca gcctcatcct ggagctcatt gagagcccca 40</li><li><210> 356 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 356 ctgaggtctg tctttacaaa aaggactggc ctgccttggg 40</li><li><210> 357 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltacpG</li><li><400> 357 ctgaaagtct gaaaactgct gcatcagagc aaccaatggt 40</li><li><210> 358 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 358 ctgctgtgcc cagtcatagc caaacagtct ctcaacccag 40</li><li><210> 359 <211> 40 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 359 gcagctggag aacctgcatg taggccatct tgttcaatca 40</li><li><210> 360 <211> 20 <212> DNA <213> Artificial Sequence</li><li><220> <223> oligo for construction of Neo DeltaCpG</li><li><400> 360 tgatgtgcct accggtaatg 20</li></ul>