EP1364065B1

Polynucleotides for use as tags and tag complements, manufacture and use thereof

Abstract

This record has no abstract on file.

EP1364065B1, drawing sheet 1 — Sheet 1 of 52

Term

Term ended

Expired 25 January 2022, 4.7 years ago.

30 claims: 19 independent, 11 dependent

1
A composition comprising a plurality of minimally cross-hybridizing oligonucleotide tag complements, wherein:(a) each oligonucleotide is free of either cytosine or guanine residues, (b) no two cytosine or guanine residues are located adjacent each other in an oligonucleotide and any two cytosine or guanine residues are separated by at most 6 non-cytosine or non-guanine residues, respectively, (c) the number of cytosine or guanine residues in each oligonucleotide does not exceed L/4 where L is the number of bases in the oligonucleotide, (d) the length of each oligonucleotide differs by no more than five bases from the average length of all oligonucleotides in the composition, (e) each oligonucleotide does not contain 4 or more contiguous identical nucleotides, (f) the number of guanine or cytosine residues in each oligonucleotide does not vary from the average number of guanine or cytosine residues in all other oligonucleotides of the composition by more than one, (g) each tag complement contains a guanine residue or a cytosine residue respectively, within seven residues of an end of the oligonucleotide, (h) when each oligonucleotide tag complement is exposed to hybridization conditions comprising 0.2M NaCl, 0.1M Tris, 0.08% Triton X-100, pH 8.0 at 37°C, the maximum degree of hybridization between the tag complement and a tag not fully complementary to the tag complement does not exceed 30% of the degree of hybridization between the tag complement and its fully complementary tag;and (i) wherein each oligonucleotide is between 18 and 30 nucleotides in length.
2
A composition according to claims 1 wherein each oligonucleotide is free of cytosine residues.
3
A composition according to any one of the preceding claims wherein when each oligonucleotide tag complement is exposed to hybridization conditions comprising 0.2M NaCl, 0.1M Tris, 0.08% Triton X-100, pH 8.0 at 37°C, the maximum degree of hybridization between the tag complement and a tag not fully complementary to the tag complement does not exceed 25% of the degree of hybridization between the tag complement and its fully complementary tag.
4
A composition according to any one of the preceding claims wherein when each oligonucleotide tag complement is exposed to hybridization conditions comprising 0.2M NaCl, 0.1M Tris, 0.08% Triton X-100, pH 8.0 at 37°C, the maximum degree of hybridization between the tag complement and a tag not fully complementary to the tag complement does not exceed 20% of the degree of hybridization between the tag complement and its fully complementary tag.
5
A composition according to any one of the preceding claims wherein when each oligonucleotide tag complement is exposed to hybridization conditions comprising 0.2M NaCl, 0.1M Tris, 0.08% Triton X-100, pH 8.0 at 37°C, the maximum degree of hybridization between the tag complement and a tag not fully complementary to the tag complement does not exceed 15% of the degree of hybridization between the tag complement and its fully complementary tag.
6
A composition according to any one of the preceding claims wherein the length of each oligonucleotide in the composition is identical.
7
A composition according to any one of the preceding claims wherein the number of guanine or cytosine residues in each oligonucleotide is the same.
8
A composition according to any one of the preceding claims wherein each oligonucleotide is between 22 and 26 nucleotides in length.
9
A composition according to any one of the preceding claims wherein each oligonucleotide comprises 24 residues.
11
A composition according to any one of the preceding claims, wherein the tag complements are attached to a solid phase support.
14
A composition according to any one of the preceding claims wherein the composition comprises 150 tag complements.
15
A composition according to any of the preceding claims, comprising one hundred and sixty tag complements, or comprising one hundred and seventy tag complements, or comprising one hundred and eighty tag complements, or comprising one hundred and ninety tag complements, or comprising two hundred tag complements, or comprising two hundred and twenty tag complements, or comprising two hundred and forty tag complements, or comprising two hundred and sixty tag complements, or comprising two hundred and eighty tag complements, or comprising three hundred tag complements, or comprising four hundred tag complements, or comprising five hundred tag complements, or comprising six hundred tag complements, or comprising seven hundred tag complements, or comprising eight hundred tag complements, or comprising nine hundred tag complements, or comprising one thousand tag complements.
16
A kit for sorting and identifying polynucleotides comprising one or more solid phase supports comprising a plurality of spatially discrete regions, each region having a uniform population of substantially identical tag complements covalently attached thereto and the tag complements each being selected from a composition of minimally cross-hybridising oligonucleotides defined in any one of claims 1 to 15.
21
A method of analyzing a biological sample comprising a plurality of nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method comprising:(a) hybridizing the molecule and a primer, the primer having a 5'-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements as defined in any one of claims 1 to 15 and a 3'-end extending to immediately adjacent the locus;(b) enzymatically extending the 3'-end of the primer in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of enzymatic incorporation onto the 3'-end of a growing nucleotide strand;(ii) causes termination of said extension;and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus;(c) specifically hybridizing the extended primer formed in step (b) to a tag complement having the tag complement sequence of (a);and (d) detecting the nucleotide derivative incorporated into the primer in step (b) so as to identify the base located at the locus of the nucleic acid molecule;wherein each tag of (a) is unique for each nucleic acid molecule and steps (a) and (b) are carried out with said nucleic molecules in the presence of each other.
24
A method of determining the presence of a target suspected of being contained in a mixture, the method comprising the steps of:(i) labelling the target with a first label;(ii) providing a first detection moiety capable of specific binding to the target and including a first tag;(iii) exposing a sample of the mixture to the detection moiety under conditions suitable to permit said specific binding of the moiety and target;(iv) providing a family of tag complements as defined in any one of claims 1 to 15 wherein the family contains a first tag complement having a sequence complementary to that of the first tag;(v) exposing the sample to the family of tag complements under conditions suitable to permit specific hybridization of the first tag and its tag complement;(vi) determining whether a said first detection moiety hybridized to a first said tag complement is bound to a said labelled target in order to determine the presence or absence of said target in the mixture.
27
The method of any one of claims 24 to 26 wherein said target is selected from the group consisting of organic molecules, antigens, proteins, polypeptides, antibodies and nucleic acids.
28
The method of any one of claims 24 to 27, wherein said target is an antigen and said first molecule is an antibody specific for said antigen.
29
The method of any one of claims 24 to 28, wherein the antigen is a polypeptide or protein and the labelling step includes conjugation of fluorescent molecules, digoxigenin, biotinylation and the like.
30
The method of any one of claims 24 to 27, wherein said target is a nucleic acid and the labelling step includes incorporation of fluorescent molecules, radiolabelled nucleotide, digoxigenin, biotinylation and the like.

Independent claims19

148 paragraphs in 8 sections, as filed

FIELD OF THE INVENTION

0001This invention relates to families of oligonucleotide tags for use, for example, in sorting molecules. Members of a given family of tags can be distinguished one from the other by specific hybridization to their tag complements.

BACKGROUND OF THE INVENTION

0002Specific hybridization of oligonucleotides and their analogs is a fundamental process that is employed in a wide variety of research, medical, and industrial applications, including the identification of disease-related polynucleotides in diagnostic assays, screening for clones of novel target polynucleotides, identification of specific polynucleotides in blots of mixtures of polynucleotides, therapeutic blocking of inappropriately expressed genes and DNA sequencing. Sequence specific hybridization is critical in the development of high throughput multiplexed nucleic acid assays. As formats for these assays expand to encompass larger amounts of sequence information acquired through projects such as the Human Genome project, the challenge of sequence specific hybridization with high fidelity is becoming increasingly difficult to achieve.

0003In large part, the success of hybridization using oligonucleotides depends on minimizing the number of false positives and false negatives. Such problems.have made the simultaneous use of multiple hybridization probes in a single experiment i.e. multiplexing, particularly in the analysis of multiple gene sequences on a gene microarray, very difficult. For example, in certain binding assays, a number of nucleic acid molecules are bound to a chip with the desire that a given "target" sequence will bind selectively to its complement attached to the chip. Approaches have been developed that involve the use of oligonucleotide tags attached to a solid support that can be used to specifically hybridize to the tag complements that are coupled to probe sequences. <patcit id="pcit0001" dnum="WO9317126A"><text>Chetverin et al. (WO 93/17126</text></patcit>) uses sectioned, binary oligonucleotide arrays to sort and survey nucleic acids. These arrays have a constant nucleotide sequence attached to an adjacent variable nucleotide sequence, both bound to a solid support by a covalent linking moiety. These binary arrays have advantages compared with ordinary arrays in that they can be used to sort strands according to their terminal sequences so that each strand binds to a fixed location on an array. The design of the terminal sequences in this approach comprises the use of constant and variable sequences. United States Patent Nos. <patcit id="pcit0002" dnum="US6103463A"><text>6,103,463</text></patcit> and <patcit id="pcit0003" dnum="US6322971B"><text>6,322,971 issued to Chetverin et al</text></patcit>. on August 15, 2000 and November 27, 2001, respectively.

0004This concept of using molecular tags to sort a mixture of molecules is analogous to molecular tags developed for bacterial and yeast genetics (<nplcit id="ncit0001" npl-type="s"><text>Hensel et al., Science; 269, 400-403: 1995</text></nplcit> and <nplcit id="ncit0002" npl-type="s"><text>Schoemaker et al., Nature Genetics; 14, 450-456: 1996</text></nplcit>). Here, a method termed "signature tagged" mutagenesis in which each mutant is tagged with a different DNA sequence is used to recover mutant genes from a complex mixture of approximately 10,000 bacterial colonies. In the tagging approach of <patcit id="pcit0004" dnum="WO9731256A"><text>Barany et al. (WO 9731256</text></patcit>), known as the "zip chip", a family of nucleic acid molecules, the "zip-code addresses", each different from each other, are set out on a grid. Target molecules are attached to oligonucleotide sequences complementary to the "zipcode addresses," referred to as "zipcodes," which are used to specifically hybridize to the address locations on the grid. While the selection of these families of polynucleotide sequences used as addresses is critical for correct performance of the assay, the performance has not been described.

0005Working in a highly parallel hybridization environment requiring specific hybridization imposes very rigorous selection criteria for the design of families of oligonucleotides that are to be used. The success of these approaches is dependent on the specific hybridization of a probe and its complement. Problems arise as the family of nucleic acid molecules cross-hybridize or hybridize incorrectly to the target sequences. While it is common to obtain incorrect hybridization resulting in false positives or an inability to form hybrids resulting in-false negatives, the frequency of such results must be minimized.. In order to achieve this goal certain thermodynamic properties of forming nucleic acid hybrids must be considered. The temperature at which oligonucleotides form duplexes with their complementary sequences known as the Tm (the temperature at which 50% of the nucleic acid duplex is dissociated) varies according to a number of sequence dependent properties including the hydrogen bonding energies of the canonical pairs A-T and G-C (reflected in GC or base composition), stacking free energy and, to a lesser extent, nearest neighbour interactions. These energies vary widely among oligonucleotides that are typically used in hybridization assays. For example, hybridization of two probe sequences composed of 24 nucleotides, one with a 40% GC content and the other with a 60% GC content, with its complementary target under standard conditions theoretically may have a 10°c difference in melting temperature (Mueller et al., Current Protocols in Mol. Biol.; 15, 5:1993). Problems in hybridization occur when the hybrids are allowed to form under hybridization conditions that include a single hybridization temperature that is not optimal for correct hybridization of all oligonucleotide sequences of a set. Mismatch hybridization of non-complementary probes can occur forming duplexes with measurable mismatch stability (<nplcit id="ncit0003" npl-type="s"><text>Santalucia et al., Biochemistry; 38: 3468-77, 1999</text></nplcit>). Mismatching of duplexes in a particular set of oligonucleotides can occur under hybridization conditions where the mismatch results in a decrease in duplex stability that results in a higher Tm than the least stable correct duplex of that particular set. For example, if hybridization is carried out under conditions that favor the AT-rich perfect match duplex sequence, the possibility exists for hybridizing a GC-rich duplex sequence that contains a mismatched base having a melting temperature that is still above the correctly formed AT-rich duplex. Therefore, design of families of oligonucleotide sequences that can be used in multiplexed hybridization reactions must include consideration for the thermodynamic properties of oligonucleotides and duplex formation that will reduce or eliminate cross hybridization behavior within the designed oligonucleotide set.

0006The development of such families of tags has been attempted over the years with varying degrees of success. There are a number of different approaches for selecting sequences for use in multiplexed hybridization assays. The selection of sequences that can be used as zipcodes or tags in an addressable array has been described in the patent literature in an approach taken by Brenner and co-workers. United States Patent No. <patcit id="pcit0005" dnum="US5654413A"><text>5,654,413</text></patcit> describes a population of oligonucleotide tags (and corresponding tag complements) in which each oligonucleotide tag includes a plurality of subunits, each subunit consisting of an oligonucleotide having a length of from three to six nucleotides and each subunit being selected from a minimally cross hybridizing set, wherein a subunit of the set would have at least two mismatches with any other sequence of the set. Table II of the Brenner patent specification describes exemplary groups of 4mer subunits that are minimally cross hybridizing according to the aforementioned criteria. In the approach taken by Brenner, constructing non cross-hybridizing oligonucleotides, relies on the use of subunits that form a duplex having at least two mismatches with the complement of any other subunit of the same set. The ordering of subunits in the construction of oligonucleotide tags is not specifically defined.

0007Parameters used in the design of tags based on subunits are discussed in <patcit id="pcit0006" dnum="WO9731256A"><text>Barany et al. (WO 9731256</text></patcit>). For example, in the design of polynucleotide sequences that are for example 24 nucleotides in length (24mer) derived from a set of four possible tetramers in which each 24mer "address" differs from its nearest 24mer neighbour by 3 tetramers. They discuss further that, if each tetramer differs from each other by at least two nucleotides, then each 24mer will differ from the next by at least six nucleotides. This is determined without consideration for insertions or deletions when forming the alignment between any two sequences of the set. In this way a unique "zip code" sequence is generated. The zip code is ligated to a label in a target dependent manner, resulting in a unique "zip code" which is then allowed to hybridize to its address on the chip. To minimize cross-hybridization of a "zip code"'to other "addresses", the hybridization reaction is carried out at temperatures of 75-80°C. Due to the high temperature conditions for hybridization, 24mers that have partial homology hybridize to a lesser extent than sequences with perfect complementarity and represent 'dead zones'. This approach of implementing stringent hybridization conditions for example, involving high temperature hybridization, is also practiced by Brenner et. al.

0008The current state of technology for designing non-cross hybridizing tags based on subunits does not provide sufficient guidance to construct a family of relatively large numbers of sequences with practical value in assays that require stringent non-cross hybridizing behavior.

0009A multiplex sequencing method has been described in United States Patent No. <patcit id="pcit0007" dnum="US4942124A"><text>4,942,124, which issued to Church on July 17, 1990</text></patcit>. The method requires at least two vectors which differ from each other at a tag sequence. It is stated that a tag sequence in one vector will not hybridize under stringent hybridization conditions to a tag sequence (i.e., complementary probes do not cross-hybridize) in another vector. Exemplary stringent hybridization conditions are given as 42°C in 500-1000 mM sodium phosphate buffer. A set of 42 20-mer tag sequences, all of which lack G residues, is given in <figref idref="f0003">Figure 3</figref> of the specification. Details of how the sequences were obtained are not provided, although Church states that initially 92 were chosen on the basis of their having sufficient sequence diversity to insure uniqueness.

0010So while it is possible for a person knowledgeable in the field to design a small number of non-cross hybridizing tags, it is difficult to design a larger number such tags. A co-pending application of the owner of this patent application describes such a set of 210 non-cross hybridizing tags that have a practical value. A method described in international patent application No. <patcit id="pcit0008" dnum="CA0100141W"><text>PCT/CA 01/00141</text></patcit> published under <patcit id="pcit0009" dnum="WO0159151A"><text>WO 01/59151 on August 16, 2001</text></patcit>. Little guidance is provided, however, for the provision of a larger set, say 1000 or so, of non-cross hybridizing tags. Since having sets of approximately 1000 non-cross hybridizing tags, or more, would be of considerable-practical value, it would be useful to develop such a set.

0011Thus, while it is desirable with such arrays to have, at once, a large number of address molecules, the address molecules should each be highly selective for its own complement sequence: While such an array provides the advantage that the family of molecules making up the grid is entirely of design, and does not rely on sequences as they occur in nature, the provision of a family of molecules, which is sufficiently large and where each individual member is sufficiently selective for its complement over all the other zipcode molecules (i.e., where there is sufficiently low cross-hybridization, or cross-talk) continues to elude researchers.

SUMMARY OF INVENTION

0012A family of 1168 sequences was obtained using a computer algorithm to have desirable hybridization properties for use in nucleic acid detection assays. The sequence set of 1168 oligonucleotides was partially characterized in hybridization assays, demonstrating the ability of family members to correctly hybridize to their complementary sequences with minimal cross hybridization. These are the sequences having SEQ ID NOs:1 to 1168 of Table I.

0013Variant families of sequences (seen as tags or tag complements) of a family of sequences taken from Table I are also part of the invention. For the purposes of discussion, a family or set of oligonucleotides will often be described as a family of tag complements, but it will be understood that such a set could just easily be a family of tags.

0014A family of complements is obtained from a set of oligonucleotides based on a family of oligonucleotides such as those of Table I. To simplify discussion, providing a family of complements based on the oligonucleotides of Table I will be described.

0015Firstly, the groups of sequences based on the oligonucleotides of Table I can be represented as shown in Table IA. <tables id="tabl0001" num="0001"><img file="EP1364065B1_D0001.tif" /></tables><tables id="tabl0002" num="0002"><img file="EP1364065B1_D0002.tif" /></tables><tables id="tabl0003" num="0003"><img file="EP1364065B1_D0003.tif" /></tables><tables id="tabl0004" num="0004"><img file="EP1364065B1_D0004.tif" /></tables><tables id="tabl0005" num="0005"><img file="EP1364065B1_D0005.tif" /></tables><tables id="tabl0006" num="0006"><img file="EP1364065B1_D0006.tif" /></tables><tables id="tabl0007" num="0007"><img file="EP1364065B1_D0007.tif" /></tables><tables id="tabl0008" num="0008"><img file="EP1364065B1_D0008.tif" /></tables><tables id="tabl0009" num="0009"><img file="EP1364065B1_D0009.tif" /></tables><tables id="tabl0010" num="0010"><img file="EP1364065B1_D0010.tif" /></tables><tables id="tabl0011" num="0011"><img file="EP1364065B1_D0011.tif" /></tables><tables id="tabl0012" num="0012"><img file="EP1364065B1_D0012.tif" /></tables><tables id="tabl0013" num="0013"><img file="EP1364065B1_D0013.tif" /></tables><tables id="tabl0014" num="0014"><img file="EP1364065B1_D0014.tif" /></tables><tables id="tabl0015" num="0015"><img file="EP1364065B1_D0015.tif" /></tables><tables id="tabl0016" num="0016"><img file="EP1364065B1_D0016.tif" /></tables><tables id="tabl0017" num="0017"><img file="EP1364065B1_D0017.tif" /></tables><tables id="tabl0018" num="0018"><img file="EP1364065B1_D0018.tif" /></tables><tables id="tabl0019" num="0019"><img file="EP1364065B1_D0019.tif" /></tables><tables id="tabl0020" num="0020"><img file="EP1364065B1_D0020.tif" /></tables><tables id="tabl0021" num="0021"><img file="EP1364065B1_D0021.tif" /></tables><tables id="tabl0022" num="0022"><img file="EP1364065B1_D0022.tif" /></tables>

0016In Table IA, each of the numerals 1 to 3 (numeric identifiers) represents a nucleotide base and the pattern of numerals 1 to 3 of the sequences in the above list corresponds to the pattern of nucleotide bases present in the oligonucleotides of Table I, which oligonucleotides have been found to be non-cross-hybridizing, as described further in the detailed examples. Each nucleotide base is selected from the group of nucleotide bases consisting of A, C, G, and T/U. A particularly preferred embodiment of the invention, in which a specific base is assigned to each numeric identifier is shown in Table I, below.

0017In one broad aspect, the invention is a composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences as specified by numeric identifiers set out in Table IA. In the sequences, each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: <ul id="ul0001" list-style="none" compact="compact"><li>for any pair of sciences of the set: <ul id="ul0002" list-style="none" compact="compact"><li>M1 ≤ 16, M2 ≤ 13 M3 ≤ 20, M4 ≤ 16, and M5 ≤ 19, where: <ul id="ul0003" list-style="none" compact="compact"><li>M1 is the maximum number of matches for any alignment in which there are no internal indels;</li><li>M2 is the maximum length of a block of matches for any alignment;</li><li>M3 is the maximum number of matches for any alignment having a maximum score;</li><li>M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and</li><li>M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score;</li><li>wherein: <ul id="ul0004" list-style="none" compact="compact"><li>the score of an alignment is determined according to the equation (A x m). - (B x mm) - (C x (og + eg))- (D x eg)), wherein: <ul id="ul0005" list-style="none" compact="compact"><li>for each of (i) to (iv): <ol id="ol0001" compact="compact"><li>(i) m = 6, mm = 6, og = 0 and eg = 6,</li><li>(ii) m = 6, mm = 6, og = 5 and eg = 1,</li><li>(iii) m = 6, mm = 2, og = 5 and eg = 1, and</li><li>(iv) m = 6, mm = 6, og = 6 and eg = 0,</li></ol></li></ul></li></ul></li></ul></li></ul></li></ul><ol id="ol0002" compact="compact"><li>A is the total number of matched pairs of bases in the alignment;</li><li>B is the total number of internal mismatched pairs in the alignment;</li><li>C is the total number of internal gaps in the alignment; and</li><li>D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and</li></ol> wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv).

0018An explanation of the meaning of the parameters set out above is given in the section describing detailed embodiments.

0019In another broad aspect, the invention is a composition containing molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences as set out in Table IA wherein each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: <ul id="ul0006" list-style="none" compact="compact"><li>for any pair of sequences of the set: <ul id="ul0007" list-style="none" compact="compact"><li>M1 ≤19, M2 ≤ 17, M3 ≤ 21, M4 ≤ 18, and M5 ≤ 20, where: <ul id="ul0008" list-style="none" compact="compact"><li>M1 is the maximum number of matches for any alignment in which there are no internal indels;</li><li>M2 is the maximum length of a block of matches for any alignment;</li><li>M3 is the maximum number of matches for any alignment having a maximum score;</li><li>M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and</li><li>MS is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score;</li><li>wherein the score of an alignment is determined according to the equation (A x m) - (B x mm) - (C x (og + eg)) - (D x eg)), wherein: <ul id="ul0009" list-style="none" compact="compact"><li>for each of (i) to (iv) : <ol id="ol0003" compact="compact"><li>(i) m = 6, mm = 6, og = 0 and eg = 6,</li><li>(ii) m = 6, mm = 6, og = 5 and eg = 1,</li><li>(iii) m = 6, mm = 2, og = 5 and eg = 1, and</li><li>(iv) m = 6, mm = 6, og = 6 and eg = 0,</li></ol></li></ul></li></ul></li></ul></li></ul><ol id="ol0004" compact="compact"><li>A is the total number of matched pairs of bases in the alignment;</li><li>B is the total number of internal mismatched pairs in the alignment;</li><li>C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignments; and</li></ol> wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv).

0020In another broad aspect, the invention is a composition comprising molecules for use as tags or tag complement wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences set out in Table IA wherein each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: <ul id="ul0010" list-style="none" compact="compact"><li>for any pair of sequences of the set: <ul id="ul0011" list-style="none" compact="compact"><li>M1 ≤ 19, M2 ≤ 17, M3 ≤ 21, M4 ≤ 18, and M5 ≤ 20, where: <ul id="ul0012" list-style="none" compact="compact"><li>M1 is the maximum number of matches for any alignment in which there are no internal indels;</li><li>M2 is the maximum length of a block of matches for any alignment;</li><li>M3 is the maximum number of matches for any alignment having a maximum score;</li><li>M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score, wherein: <ul id="ul0013" list-style="none" compact="compact"><li>the score of an alignment is determined according to the equation 3A - B - 3C - D, wherein: <ol id="ol0005" compact="compact"><li>A is the total number of matched pairs of bases in the alignment;</li><li>B is the total number of internal mismatched pairs in the alignment;</li><li>C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and</li></ol></li></ul></li></ul></li></ul></li></ul>

0021In preferred aspects, the invention provides a composition in which, for the group of 24mer sequences in which 1 = A, 2 = T and 3 = G, under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement, for all said oligonucleotides of the composition, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the composition does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement.

0022More preferably, the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and up to 10, more preferably between 1 and up to 9, more preferably between 1 and up to 8, more preferably between 1 and up to 7, more preferably between 1 and up to 6, and more preferably between 1 and up to 5.

0023It is also preferred that the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 25%, more preferably does not exceed 20%, more preferably does not exceed 15%, more preferably does not exceed 10%, more preferably does not exceed 5%.

0024Even more preferably, the above-referenced defined set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37°C.

0025In the composition, the defined set of conditions can include the group of 24mer sequences being covalently linked to beads.

0026In a particular preferred aspect, for the group of 24mers the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 15% of the degree of hybridization between said sequence and its complement and the degree of hybridization between each sequence and its complement varies by a factor of between 1 and up to 9, and for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 20% of the degree of hybridization of the oligonucleotide and its complement.

0027It is possible that each 1 is one of A, T/U, G and C; each 2 is one of A, T/U, G and C; and each 3 is one of A, T/U, G and C; and each of 1, 2 and 3 is selected so as to be different from all of the others of 1, 2 and 3. More preferably, 1 is A or T/U, 2 is A or T/U and 3 is G or C. Even more preferably, 1 is A, 2 is T/U, and 3 is G.

0028In certain preferred composition, each of the oligonucleotides is from twenty-two to twenty-six bases in length, or from twenty-three to twenty-five, and preferably, each oligonucleotide is of the same length as every other said oligonucleotide.

0029In a particularly preferred embodiment, each oligonucleotide is twenty-four bases in length.

0030It is preferred that no oligonucleotide contains more than four contiguous bases that are identical to each other.

0031It is also preferred that the number of G's in each oligonucleotide does not exceed L/4 where L is the number of bases in said sequence.

0032For reasons described below, the number of G's in each said oligonucleotide is preferred not to vary from the average number of G's in all of the oligonucleotides by more than one. Even more preferably, the number of G's in each said oligonucleotide is the same as every other said oligonucleotide. In the embodiment disclosed below in which oligonucleotides were tested, the sequence of each was twenty-four bases in length and each oligonucleotide contained 6 G's.

0033It is also preferred that, for each nucleotide, there is at most six bases other than G between every pair of neighboring pairs of G's.

0034Also, it is preferred that, at the 5'-end of each oligonucleotide at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence of the oligonculeotide is a G. Similarly, it is preferred, at the 3'-end of each oligonucleotide that at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence of the oligonucleotide is a G.

0035It is possible to have sequence compositions that include one hundred and sixty said molecules, or that include one hundred and seventy said molecules, or that include one hundred and eighty said molecules, or that include one hundred and ninety said molecules, or that include two hundred said molecules, or that include two hundred and twenty said molecules, or that include two hundred and forty said molecules, or that include two hundred and sixty said molecules, or that include two hundred and eighty said molecules, or that include three hundred said molecules, or that include four hundred said molecules, or that include five hundred said molecules, or that include six hundred said molecules, or that include seven hundred said molecules, or that include eight hundred said molecules, or that include nine hundred said molecules, or that include one thousand said molecules.

0036It is possible, in certain applications, for each molecule to be linked to a solid phase support so as to be distinguishable from a mixture containing other of the molecules by hybridization to its complement. Such a molecule can be linked to a defined location on a solid phase support such that the defined location for each molecule is different than the defined location for different others of the molecules.

0037In certain embodiments, each solid phase support is a microparticle and each said molecule is covalently linked to a different microparticle than each other different said molecule.

0038In another broad aspect, the invention is a composition comprising a set of 150 molecules for use as tags or tag complements wherein each molecule includes an oligonucleotide having a sequence of at least sixteen nucleotide bases wherein for any pair of sequences of the set: <ul id="ul0014" list-style="none" compact="compact"><li>M1 ≤ 19/24 × L1, M2 ≤ 17/24 x L1, M3 ≤ 21/24 x L1, M4 ≤ 18/24 x L1, M5 ≤ 20/24 x L1, where L1 is the length of the shortest sequence of the pair, where: <ul id="ul0015" list-style="none" compact="compact"><li>M1 is the maximum number of matches for any alignment of the pair of sequences in which there are no internal indels;</li><li>M2 is the maximum length of a block of matches for any alignment of the pair of sequences;</li><li>M3 is the maximum number of matches for any alignment of the pair of sequences having a maximum score;</li><li>M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of the pair of sequences of maximum score; and</li><li>MS is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of the pair of sequences of maximum score, wherein: <ul id="ul0016" list-style="none" compact="compact"><li>the score of an alignment is determined according to the equation (A x m) - (B x mm) - (C x (og + eg)) - (D x eg)), wherein: <ul id="ul0017" list-style="none" compact="compact"><li>for each of (i) to (iv) : <ol id="ol0006" compact="compact"><li>(i) m = 6, mm = 6, og = 0 and eg = 6,</li><li>(ii) m = 6, mm = 6, og = 5 and eg = 1,</li><li>(iii) m = 6, mm = 2, og a 5 and eg = 1, and</li><li>(iv) m = 6, mm = 6, og = 6 and eg = 0,</li></ol></li><li>A is the total number of matched pairs of bases in the alignment;</li><li>B is the total number of internal mismatched pairs in the alignment;</li><li>C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and</li></ul></li></ul></li></ul></li></ul> wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv).

0039In yet another broad aspect, the invention is a composition that includes a set of 150 molecules for use as tags or tag complements wherein each molecule has an oligonucleotide having a sequence of at least sixteen nucleotide bases wherein for any pair of sequences of the set : <ul id="ul0018" list-style="none" compact="compact"><li>M1 ≤ 19, M2 ≤ 17, M3 ≤ 21, M4 ≤ 18, and M5 ≤ 20, where: <ol id="ol0007" compact="compact"><li>M1 is the maximum number of matches for any alignment of the pair of sequences in which there are no internal indels;</li><li>M2 is the, maximum length of a block of matches for any alignment of the pair of sequences;</li><li>M3 is the maximum number of matches for any alignment of the pair of sequences having a maximum score;</li><li>M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of the pair of sequences of maximum score; and</li><li>M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of the pair of sequences of maximum score, wherein: <ul id="ul0019" list-style="none" compact="compact"><li>the score of a said alignment is determined according to the equation 3A - B - 3C - D, wherein: <ol id="ol0008" compact="compact"><li>A is the total number of matched pairs of bases in the alignment;</li><li>B is the total number of internal mismatched pairs in the alignment;</li><li>C is the total number of internal gaps in the alignment; and</li><li>D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment.</li></ol></li></ul></li></ol></li></ul>

0040In certain embodiments of the invention, each sequence is between eighteen and thirty bases in length, or between twenty and twenty-eight bases in length, or between twenty-one and twenty-seven bases in length, or between twenty-two and twenty-six bases in length.

0041Often, each sequence is of the same length as every other said sequence. In particular embodiments disclosed herein, each sequence is twenty-four bases in length.

0042Again, no sequence contains more than four contiguous bases that are identical to each other, etc., as described above.

0043The composition is such that, under a defined set of conditions, the maximum degree of hybridization between an oligonucleotide and any complement of a different oligonucleotide of the composition does not exceed about 30% of the degree of hybridization between said oligonucleotide and its complement, more preferably 20%, more preferably 15%, more preferably 10%, more preferably 6%.

0044The set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37°C, and the oligonucleotides are preferably covalently linked to microparticles. Of course it is possible that these specific conditions be used for determining the level of hybridization.

0045It is also preferred that under such a defined set of conditions, the degree of hybridization between each oligonucleotide and its complement varies by a factor of between 1 and up to 8, more preferably up to 7, more preferably up to 6, more preferably up to 5. In a particular disclosed embodiment, the observed variance in the degree of hybridization was a factor of only 5.3, i.e., the degree of hybridization between each oligonucleotide and its complement varied by a factor of between 1 and 5.6.

0046In certain preferred embodiments, under the defined set of conditions, the maximum degree of hybridization between a said oligonucleotide and any complement of a different oligonucleotide of the composition does not exceed about 15%, more preferably 10%, more preferably 6%.

0047In one preferred embodiment, the set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37°C, and the oligonucleotides are covalently linked to microparticles.

0048Also, under the defined set of conditions, it is preferred that the degree of hybridization between each oligonucleotide and its complement varies by a factor of between 1 and up to 8, more preferably up to 7, more preferably up to 6, more preferably up to 5.

0049Any composition of the invention can include one hundred and sixty of the oligonucleotide molecules, or one hundred and seventy of the oligonucleotide molecules, or one hundred and eighty of the oligonucleotide molecules, or one hundred and ninety of the oligonucleotide molecules, or two hundred of the oligonucleotide molecules, or two hundred and twenty of the oligonucleotide molecules, or two hundred and forty of the oligonucleotide molecules, or two hundred and sixty of the oligonucleotide molecules, or two hundred and eighty of the oligonucleotide molecules, or three hundred of the oligonucleotide molecules, or four hundred of the oligonucleotide molecules, or five hundred of the oligonucleotide molecules, or six hundred of the oligonucleotide molecules, or seven hundred of the oligonucleotide molecules, or eight hundred of the oligonucleotide molecules, or nine hundred of the oligonucleotide molecules, or one thousand or more of the oligonucleotide molecules.

0050A composition of the invention can be a family of tags, or it can be a family of tag complements.

0051An oligonucleotide molecule belonging to a family of molecules of the invention can have incorporated thereinto one more analogues of nucleotide bases, preference being given those that undergo normal Watson-Crick base pairing.

0052The invention includes kits for sorting and identifying polynucleotides. Such a kit can include one or more solid phase supports each having one or more spatially discrete regions, each such region having a uniform population of substantially identical tag complements covalently attached. The tag complements are made up of a set of oligonucleotides of the invention.

0053The one or more solid phase supports can be a planar substrate in which the one or more spatially discrete regions is a plurality of spatially addressable regions.

0054The tag complements can also be coupled to microparticles. Microparticles preferably each have a diameter in the range of from 5 to 40 µm.

0055Such a kit preferably includes microparticles that are spectrophotometrically unique, and therefore distinguisable from each other according to conventional laboratory techniques. Of course for such kits to work, each type of microparticle would generally have only one tag complement associated with it, and usually there would be a different oligonucleotide tag complement associated with (attached to) each type of microparticle.

0056The invention includes methods of using families of oligonucleotides of the invention.

0057One such method is of analyzing a biological sample containing a biological sequence for the presence of a mutation or polymorphism at a locus of the nucleic acid. The method includes: <ol id="ol0009" compact="compact"><li>(A) amplifying the nucleic acid molecule in the presence of a first primer having,a 5'-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form an amplified molecule with a 5'-end with a sequence complementary to the sequence of the tag;</li><li>(B) extending the amplified molecule in the presence of a polymerase and a second primer having 5'-end complementary the 3'-end of the amplified sequence, with the 3'-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: .(i) capable of incorporation during transciption by the polymerase onto the 3'-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified sequence;</li><li>(C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and</li><li>(D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid.</li></ol>

0058In another method of the invention, a biological sample containing a plurality of nucleic acid molecules is analyzed for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule. This method includes steps of: <ol id="ol0010" compact="compact"><li>(A) amplifying the nucleic acid molecule in the presence of a first primer having a 5'-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form an amplified molecule with a 5'-end with a sequence complementary to the sequence of the tag;</li><li>(B) extending the amplified molecule in the presence of a polymerase and a second primer having 5'-end complementary the 3'-end of the amplified sequence, the 3'-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3'-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified molecule;</li><li>(C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and</li><li>(D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid; wherein each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other.</li></ol>

0059Another method includes analyzing a biological sample that contains a plurality of double stranded complementary nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule. The method includes steps of: <ol id="ol0011" compact="compact"><li>(A) amplifying the double stranded molecule in the presence of a pair of first primers, each primer having an identical 5'-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form amplified molecules with 5'-ends with a sequence complementary to the sequence of the tag;</li><li>(B) extending the amplified molecules in the presence of a polymerase and a pair of second primers each second primer having a 5'-end' complementary a 3'-end of the amplified sequence, the 3'-end of each said second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3'-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other;</li><li>(C) specifically hybridizing each of the second primers to a tag complement having the tag complement sequence of (A); and</li><li>(D) detecting the nucleotide derivative incorporated into the second primers in (B) so as to identify the base located at said locus;</li></ol> wherein the sequence of each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other.

0060In yet another aspect, the invention is a method of analyzing a biological sample containing a plurality of nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method including steps of: <ol id="ol0012" compact="compact"><li>(a) hybridizing the molecule and a primer, the primer having a 5'-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention and a 3'-end extending to immediately adjacent the locus;</li><li>(b) enzymatically extending the 3'-end of the primer in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of enzymatic incorporation onto the 3'-end of a growing nucleotide strand; (ii) causes termination of said extension; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus;</li><li>(c) specifically hybridizing the extended primer formed in step (b) to a tag complement having the tag complement sequence of (a); and</li><li>(d) detecting the nucleotide derivative incorporated into the primer in step (b) so as to identify the base located at the locus of the nucleic acid molecule;</li></ol> wherein each tag of (a) is unique for each nucleic acid molecule and steps (a) and (b) are carried out with said nucleic molecules in the presence of each other.

0061The derivative can be a dideoxy nucleoside triphosphate.

0062Each respective complement can be attached as a uniform population of substantially identical complements in spacially discrete regions on one or more solid phase support(s).

0063Each tag complement can include a label, each such label being different for respective complements, and step (d) can include detecting the presence of the different labels for respective hybridization complexes of bound tags and tag complements.

0064Another aspect of the invention includes a method of determining the presence of a target suspected of being contained in a mixture. The method includes the steps of: <ol id="ol0013" compact="compact"><li>(i) labelling the target with a first label;</li><li>(ii) providing a first detection moiety capable of specific binding to the target and including a first tag;</li><li>(iii) exposing a sample of the mixture to the detection moiety under conditions suitable to permit (or cause) said specific binding of the molecule and target;</li><li>(iv) providing a family of suitable tag complements of the invention wherein the family contains a first tag complement having a sequence complementary to that of the first tag;</li><li>(v) exposing the sample to the family of tag complements under conditions suitable to permit (or cause) specific hybridization of the first tag and its tag complement;</li><li>(vi) determining whether a said first detection moiety hybridized to a first said tag complement is bound to a said labelled target in order to determine the presence or absence of said target in the mixture.</li></ol>

0065Preferably , the first tag complement is linked to a solid support at a specific location of the support and step (vi) includes detecting the presence of the first label at said specified location.

0066Also, the first tag complement can include a second label and step (vi) includes detecting the presence of the first and second labels in a hybridized complex of the moiety and the first tag complement.

0067Further, the target can be selected from the group consisting of organic molecules, antigens, proteins, polypeptides, antibodies and nucleic acids. The target can be an antigen and the first molecule can be an antibody specific for that antigen.

0068The antigen is usually a polypeptide or protein and the labelling step can include conjugation of fluorescent molecules, digoxigenin, biotinylation and the like.

0069The target can be a nucleic acid and the labelling step can include incorporation of fluorescent molecules, radiolabelled nucleotide, digoxigenin, biotinylation and the like.

DETAILED DESCRIPTION OF THE INVENTION

FIGURES

0070Reference is made to the attached figures in which, <ul id="ul0020" list-style="none" compact="compact"><li><figref idref="f0001">Figure 1</figref> illustrates generally the steps followed to obtain a family of sequences of the present invention;</li><li><figref idref="f0002">Figure 2</figref> shows the intensity of the signal (MFI) for each perfectly matched sequence (probe sequences indicated in Table I) and its complement (target, at 50 fmol) obtained as described in Example 1;</li><li><figref idref="f0003">Figure 3</figref> is a three dimensional representation showing cross-hybridization observed for the sequences of <figref idref="f0002">Figure 2</figref> as described in Example 1. The results shown in <figref idref="f0002">Figure 2</figref> are reproduced along the diagonal of the drawing; and</li><li><figref idref="f0004">Figure 4</figref> is illustrative of results obtained for an individual target (SEQ ID NO:90, target No. 90) when exposed to the 100 probes of Example 1. The MFI for each bead is plotted.</li></ul>

DETAILED EMBODIMENTS

0071The invention provides a method for sorting complex mixtures of molecules by the use of families of oligonucleotide sequence tags. The families of oligonucleotide sequence tags are designed so as to provide minimal cross hybridization during the sorting process. Thus any sequence within a family of sequences will not significantly cross-hybridize with any other sequence derived from that family under appropriate hybridization conditions known by those skilled in the art. The invention is particularly useful in highly parallel processing of analytes.

Families of Oligonucleotide Sequence Tags

0072The present invention includes a family of 24mer polynucleotides that have been demonstrated to be minimally cross-hybridizing with each other. This family of polynucleotides is thus useful as a family of tags, and their complements as tag complements.

0073In order to be considered for inclusion into the family, a sequence had to satisfy a certain number of rules regarding its composition. For example, repetitive regions that present potential hybridization problems such as four or more of a similar base (e.g., AAAA or TTTT) or pairs of Gs were forbidden. Another rule is that each sequence contains exactly six Gs and no Cs, in order to have sequences that are more or less isothermal. Also required for a 24mer to be included is that there must be at most six bases between every neighboring pair of Gs. Another way of putting this is that there are at most six non-Gs between any two consecutive Gs. Also, each G nearest the 5'-end (resp. 3'-end) of its oligonucleotide (the left-hand (resp. right-hand) side as written in Table I) was required to occupy one of the first to seventh positions (counting the 5'-terminal (resp. 3'-terminal) position as the first position.)

0074The process used to design families of sequences that do not exhibit cross-hybridization behavior is illustrated generally in <figref idref="f0001">Figure 1</figref>). Depending on the application for which these families of sequences will be used, various rules are designed. A certain number of rules can specify constraints for sequence composition (such as the ones described in the previous paragraph). The other rules are used to judge whether two sequences are too similar. Based on these rules, a computer program can derive families of sequences that exhibit minimal or no cross-hybridization behavior. The exact method used by the computer program is not crucial since various computer programs can derive similar families based on these rules. Such a program is for example described in international patent application No. <patcit id="pcit0010" dnum="CA0100141W"><text>PCT/CA 01/00141</text></patcit> published under <patcit id="pcit0011" dnum="WO0159151A"><text>WO 01/59151 on August 16, 2001</text></patcit>. Other programs can use different methods, such as the ones summarized below.

0075A first method of generating a maximum number of minimally cross-hybridizing polynucleotide sequences starts with any number of non-cross-hybridizing sequences, for example just one sequence, and increases the family as follows, A certain number of sequences is generated and compared to the sequences already in the family. The generated sequences that exhibit too much similarity with sequences already in the family are dropped. Among the "candidate sequences" that remain, one sequence is selected and added to the family. The other candidate sequences are then compared to the selected sequence, and the ones that show too much similarity are dropped. A new sequence is selected from the remaining candidate sequences, if any, and added to the family, and so on until there are no candidate sequences left. At this stage, the process can be repeated (generating a certain number of sequences and comparing them to the sequences in the family, etc.) as often as desired. The family obtained at the end of this method contains only minimally cross-hybridizing sequences.

0076A second method of generating a maximum number of minimally cross-hybridizing polynucleotide sequences starts with a fixed-size family of polynucleotide sequences. The sequences of this family can be generated randomly or designed by some other method. Many sequences in this family may not be compatible with each other, because they show too much similarity and are not minimally cross-hybridizing. Therefore, some sequences need to be replaced by new ones, with less similarity! One way to achieve this consists of repeatedly replacing a sequence of the family by the best (that is, lowest similarity) sequence among a certain number of (for example, randomly generated) sequences that are not part of the family. This process can be repeated until the family of sequences shows minimal similarity, hence minimal cross-hybridizing, or until a set number of replacements has occurred. If, at the end of the process, some sequences do not obey the similarity rules that have been set, they can be taken out of the family, thus providing a somewhat smaller family that only contains minimally cross-hybridizing sequences. Some additional rules can be added to this method in order to make it more efficient, such as rules to determine which sequence will be replaced.

0077Such methods have been used to obtain the 1168 non-cross-hybridizing tags of Table I that are the subject of this patent application.

0078One embodiment of the invention is a composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on the group of sequences set out in Table IA, wherein each of the numeric identifiers 1 to 3 (see the Table) is a nucleotide base selected to be different from the others of 1 to 3. According to this embodiment, several different families of specific sets of oligonucleotide sequences are described, depending upon the assignment of bases made to the numeric identifiers.1 to 3.

0079The sequences contained in Table I have a mathematical relationship to each other, described as follows.

0080Let S and T be two DNA sequences of lengths s and t respectively. While the term "alignment" of nucleotide sequences is widely used in the field of biotechnology, in the context of this invention the term has a specific meaning illustrated here. An alignment of S and T is a 2xp matrix A (with p ≥ s and p ≥ t) such that the first (or second) row of A contains the characters of S (or T respectively) in order, interspersed with p-s (or p-t respectively) spaces. It assumed that no column of the alignment matrix contains two spaces, i.e., that any alignment in which a column contains two spaces is ignored and not considered here. The columns containing the same base in both rows are called matches, while the columns containing different bases are called mismatches. Each column of an alignment containing a space in its first row is called an insertion and each colmun containing a space in its second row is called a deletion while a column of the alignment containing a space in either row is called an indel. Insertions and deletions within a sequence are represented by the character '-'. A gap is a continuous sequence of spaces in one of the rows (that is neither immediately preceded nor immediately followed by another space in the same row), and the length of a gap is the number of spaces in that gap. An internal gap is one in which its first space is preceded by a base and its last space is followed by a base and an internal indel is an indel belonging to an internal gap. Finally, a block is a continuous sequence of matches (that is neither immediately preceded nor immediately followed by another match), and the length of a block is the number of matches in that block. In order to illustrate these definitions, two sequences S = TGATCGTAGCTACGCCGCG (of length s = 19; SEQ ID NO:1169) and T = CGTACGATTGCAACGT (of length t = 16; SEQ ID NO:1170) are considered. Exemplary alignment R1 of S and T (with p = 23) is: <tables id="tabl0023" num="0023"><img file="EP1364065B1_D0023.tif" /></tables>

0081Columns 1 to 4, 9, 10, 12 and 20 to 23 are indels, columns 6, 7, 8, 11, 13, 14, 16, 17 and 18 are matches, and columns 5, 15 and 19 are mismatches. Columns 9 and 10 form a gap of length 2, while columns 16 to 18 form a block of length 3. Columns 9, 10 and 12 are internal indels.

0082A score is assigned to the alignment A of two sequences by assigning weights to each of matches, mismatches and gaps as follows: <ul id="ul0021" list-style="bullet" compact="compact"><li>the reward for a match m,</li><li>the penalty for a mismatch mm,</li><li>the penalty for opening a gap og,</li><li>the penalty for extending a gap eg.</li></ul>

0083Once these values are set, a score to each column of the alignment is assigned according to the following rules: <ul id="ul0022" list-style="none" compact="compact"><li>1. assign 0 to each column preceding the first match and to each column following the last match.</li><li>2. for each of the remaining columns, assign m if it is a match, -mm if it is a mismatch, -og-eg if it is the first indel of a gap, -eg if it is an indel but not the first indel of a gap.</li></ul> The score of the alignment A is the sum of the scores of its columns. An alignment is said to be of maximum score if no other alignment of the same two sequences has a higher score (with the same values of m, mm, og and eg). A person knowledgeable in the field will recognize this method of scoring an alignment as scoring a local (as opposed to global) alignment with affine gap penalties (that is, gap penalties that can distinguish between the first indel of a gap and the other indels). It will be appreciated that the total number of indels that open a gap is the same as the total number of gaps and that an internal indel is not one of those assigned a 0 in rule (1) above. It will also be noted that foregoing rule (1) assigns a 0 for non-internal mismatches. An internal mismatch is a mismatch that is preceded and followed (not necessarily immediately) by a match.

0084As an illustration, if the values of m, mm, og and eg are set to 3, 1, 2 and 1 respectively, alignment R1 has a score of 19, determined as shown below: <tables id="tabl0024" num="0024"><img file="EP1364065B1_D0024.tif" /></tables> Note that for two given sequences S and T, there are numerous alignments. There are often several alignments of maximum score.

0085Based on these alignments, five sequence similarity measures are defined as follows. For two sequences S and T, and weights {m, mm, og, eg }:<ul id="ul0023" list-style="bullet"><li>M1 is the maximum number of matches over all alignments free of internal indels;</li><li>M2 is the maximum length of a block over all alignments;</li><li>M3 is the maximum number of matches over all alignments of maximum score;</li><li>M4 is the maximum sum of the lengths of the longest two blocks over all alignments of maximum score;</li><li>M5 is the maximum sum of the lengths of all the blocks of length at least 3, over all alignments of maximum score.</li></ul> Notice that, by definition, the following inequalities between these similarity measures are obtained: M4 ≤ M3 and M5 ≤ M3. Also, in order to determine M2 it is sufficient to determine the maximum length of a block over all alignments free of internal indels. For two given sequences, the values of M3 to M5 can vary depending on the values of the weights {m, mm, og, eg }, but not M1 and M2.

0086For weights {3, 1, 2, 1}, the illustrated alignment is not a maximum score alignment of the two example sequences. But for weights {6, 6, 0, 6} it is; hence this alignment shows that for these two example sequences, and weights {6, 6, 0, 6}, M2 ≥ 3, M3 ≥ 9, M4 ≥ 6 and M5 ≥ 6. In order to determine the exact values of M1 to M5, all the necessary alignments need to be considered. M1 and M2 can be found by looking at the s+t-1 alignments free of internal indels, where s and t are the lengths of the two sequences considered. Mathematical tools known as dynamic programming can be implemented on a computer and used to determine M3 to M5 in a very quick way. Using a computer program to do these calculations, it was determined that: <ul id="ul0024" list-style="bullet" compact="compact"><li>with the weights {6, 6, 0, 6}, M1 = 8, M2 = 4, M3 = 10, M4 = 6 and M5 = 6;</li><li>with the weights {3, 1, 2, 1), M1 = 8, M2 = 4, M3 = 10, M4 = 6 and M5 = 4.</li></ul> According to the preferred embodiment of this invention, two sequences S and T each of length 24 are too similar if at least one of the following happens: <ul id="ul0025" list-style="bullet"><li>M1 > 16 or</li><li>M2 > 13 or</li><li>M3 > 20 or</li><li>M4 > 16 or</li><li>M5 > 19</li></ul> when using either weights {6, 6, 0, 6}, or {6, 6, 5, 1}, or {6, 2, 5, 1}, or {6, 6, 6, 0}. In other words, the five similarity measures between S and T are determined for each of the above four sets of weights, and checked against these thresholds (for a total of 20 tests).

0087The above thresholds of 16, 13, 20, 16 and 19, and the above sets of weights, were used to obtain the sequences listed in Table I. Additional sequences can thus be added to those of Table I as long as the above alignment rules are obeyed for all sequences.

0088It is also possible to alter thresholds M1, M2, etc., while remaining within the scope of this invention. It is thus possible to substitute or add sequences to those of Table I, or more generally to those of Table IA to obtain other sets of sequences that would also exhibit reasonably low cross-hybridization. More specifically, a set of 24mer sequences in which there are no two sequences that are too similar, where too similar is defined as: <ul id="ul0026" list-style="bullet"><li>M1 > 19 or</li><li>M2 > 17 or</li><li>M3 > 21 or</li><li>M4 > 18 or</li><li>M5 > 20</li></ul> when using either weights {6, 6, 0, 6}, or {6, 6, 5, 1), or {6, 2, 5, 1}, or {6, 6, 6, 0}, would also exhibit low cross-hybridization. Reducing any of the threshold values provides sets of sequences with even lower cross-hybridization. Alternatively, 'too similar' can also be defined as: <ul id="ul0027" list-style="bullet"><li>M1 > 19 or</li><li>M2 > 17 or</li><li>M3 > 21 or</li><li>M4 > 18 or</li><li>M5 > 20</li></ul> when using either weights {3, 1, 2, 1}. Alternatively, other combinations of weights will lead to sets of sequences with low cross-hybridization.

0089Notice that using weights {6, 6, 0, 6} is equivalent to using weights {1, 1, 0, 1}, or weights {2, 2, 0, 2} , ... (that is, for any two sequences, the values of M1 to M5 are exactly the same whether weights {6, 6, 0, 6} or {1, 1, 0, 1} or {2, 2, 0, 2} or any other multiple of {1, 1, 0, 1} is used).

0090When dealing with sequences of length other than 24, or sequences of various lengths, the definition of similarity can be adjusted. Such adjustments are obvious to the persons skilled in the art. For example, when comparing a sequence of lengths L1 with a sequence of length L2 (with L1<L2), they can be considered as.too similar when <ul id="ul0028" list-style="none" compact="compact"><li>M1 > 19/24 x L1</li><li>M2 > 17/24 x L1</li><li>M3 > 21/24 x L1</li><li>M4 > 18/24 x L1</li><li>M5 > 20/24 x L1</li></ul> when using either weights {6, 6, 0, 6}, or {6, 6, 5, 1}, or {6, 2, 5, 1} or {6, 6, 6, 0}.

0091Polynucleotide sequences can be composed of a subset of natural bases most preferably A, T and G. Sequences that are deficient in one base possess useful characteristics, for example, in reducing potential secondary structure formation or reduced potential for cross hybridization with nucleic acids in nature. Also, it is preferable to have tag sequences that behave isothermally. This can be achieved for example by maintaining a constant base composition for all sequences such as six Gs and eighteen As or Ts for each sequence. Additional sets of sequences can be designed by extrapolating on the original family of non-cross-hybridizing sequences by simple methods known to those skilled in the art.

0092In order to validate the sequence set, a subset of sequences from the family of 1168 sequence tags was selected and characterized, in terms of the ability of these sequences to form specific duplex structures with their complementary sequences, and the potential for cross-hybridization within the sequence set. See Example 1, below. The subset of 100 sequences was randomly selected, and analyzed using the Luminex100 LabMAP™ platform. The 100 sequences were chemically immobilized onto the set of 100 different Luminex microsphere populations, such that each specific sequence was coupled to one spectrally distinct microsphere population. The pool of 100 microsphere-immobilized probes was then hybridized with each of the 100 corresponding complementary sequences. Each sequence was examined individually for its specific hybridization with its complementary sequence, as well as for its non-specific hybridization with the other 99 sequences present in the reaction. This analysis demonstrated the propensity of each sequence to hybridize only to its complement (perfect match), and not to cross-hybridize appreciably with any of the other oligonucleotides present in the hybridization reaction.

0093It is within the capability of a person skilled in the art, given the family of sequences of Table I, to modify the sequences, or add other sequences while largely retaining the property of minimal cross-hybridization which the polynucleotides of Table I have been demonstrated to have.

0094There are 1168 polynucleotide sequences given in Table I. Since all 1168 of this family of polynucleotides can work with each other as a minimally cross-hybridizing set, then any plurality of polynucleotides that is a subset of the 1168 can also act as a minimally cross-hybridizing set of polynucleotides. An application in which, for example, 30 molecules are to be sorted using a family of polynucleotide tags and tag complements could thus use any group of 30 sequences shown in Table I. This is not to say that some subsets may be found in a practical sense to be more preferred than others. For example, it may be found that a particular subset is more tolerant of a wider variety of conditions under which hybridization is conducted before the degree of cross-hybridization becomes unacceptable.

0095It may be desirable to use polynucleotides that are shorter in length than the 24 bases of those in Table I. A family of subsequences (i.e., subframes of the sequences illustrated) based on those contained in Table I having as few as 10 bases per sequence could be chosen, so long as the subsequences are chosen to retain homological properties between any two of the sequences of the family important to their non cross-hybridization.

0096The selection of sequences using this approach would be amenable to a computerized process. Thus for example, a string of 10 contiguous bases of the first 24mer of Table I could be selected: AAATTGTGAAAGATTGTTTGTGTA (SEQ ID NO:1).

0097The same string of contiguous bases from the second 24mer could then be selected and compared for similarity against the first chosen sequence: GTTAGAGTTAATTGTATTTGATGA (SEQ ID NO:2). A systematic pairwise comparison could then be carried out to determine if the similarity requirements are violated. If the pair of sequences does not violate any set property, a 10mer subsequence can be selected from the third 24mer sequence of Table I, and compared to each of the first two 10mer sequences (in a pairwise fashion to determine its compatibility therewith, etc. In this way a family of 10mer sequences may be developed.

0098It is within the scope of this invention, to obtain families of sequences containing 11mer, 12mer, 13mer, 14mer, 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, 22mer and 23mer sequences by analogy to that shown for 10mer sequences.

0099It may be desirable to have a family of sequences in which there are sequences greater in length than the 24mer sequences shown in Table I. It is within the capability of a person skilled in the art, given the family of sequences shown in Table I, to obtain such a family of sequences. One possible approach would be to insert into each sequence at one or more locations a nucleotide, non-natural base or analogue such that the longer sequence should not have greater similarity than any two of the original non-cross-hybridizing sequences of Table I and the addition of extra bases to the tag sequences should not result in a major change in the thermodynamic properties of the tag sequences of that set for example the GC content must be maintained between 10%-40% with a variance from the average of 20%. This method of inserting bases could be used to obtain, for example, a family of sequences up to 40 bases long.

0100Given a particular family of sequences that can be used as a family of tags (or tag complements), e.g., those of Table I, a skilled person will readily recognize variant families that work equally as well.

0101Again taking the sequences of Table I for example, every T could be converted to an A and vice versa and no significant change in the cross-hybridization properties would be expected to be observed. This would also be true if every G were converted to a C.

0102Also, all of the sequences of a family could be taken to be constructed in the 5'-3' direction, as is the convention, or all of the constructions of sequences could be in the opposition direction (3'-5').

0103There are additional modifications that can be carried out. For example, C has not been used in the family of sequences. Substitution of C in place of one or more G's of a particular sequence would yield a sequence that is at least as low in homology with every other sequence of the family as was the particular sequence chosen for modification. It is thus possible to substitute C in place of one or more G's in any of the sequences shown in Table I. Analogously, substituting of C in place of one or more A's is possible, or substituting C in place of one or T's is possible.

0104It is preferred that the sequences of a given family are of the same, or roughly the same length. All the sequences of a family of sequences of this invention have a length that is within five bases of the base-length of the average of the family. Mere Preferably, all sequences are within four bases of the average base-length. More preferably, all or almost all sequences are within three bases of the average base-length of the family. Better still, all or almost all sequences have a length that is within two of the base-length of the average of the family, and even better still, within one of the base-length of the average of the family.

0105It is also possible for a person skilled in the art to derive sets of sequences from the family of sequences described in this specification and remove sequences that would be expected to have undesirable hybridization properties.

Methods For Synthesis Of Oligonucleotide Families

0106Preferably oligonucleotide sequences of the invention are synthesized directly by standard phosphoramidite synthesis approaches and the like (<nplcit id="ncit0004" npl-type="s"><text>Caruthers et al, Methods in Enzymology; 154, 287-313: 1987</text></nplcit>; <nplcit id="ncit0005" npl-type="s"><text>Lipshutz et al, Nature Genet.; 21, 20-24: 1999</text></nplcit>; <nplcit id="ncit0006" npl-type="s"><text>Fodor et al, Science; 251, 763-773: 1991</text></nplcit>). Alternative chemistries, involving non natural bases such as peptide nucleic acids or modified nucleosides that offer advantages in duplex stability may also be used (<nplcit id="ncit0007" npl-type="s"><text>Hacia et al; Nucleic Acids Res ;27: 4034-4039, 1999</text></nplcit>; <nplcit id="ncit0008" npl-type="s"><text>Nguyen et al, Nucleic Acids Res.;27, 1492-1498: 1999</text></nplcit>; <nplcit id="ncit0009" npl-type="s"><text>Weiler et al, Nucleic Acids Res.; 25, 2792-2799:1997</text></nplcit>). It is also possible to synthesize the oligonucleotide sequences of this invention with alternate nucleotide backbones such as phosphorothioate or phosphoroamidate nucleotides. Methods involving synthesis through the addition of blocks of sequence in a stepwise manner may also be employed (<nplcit id="ncit0010" npl-type="s"><text>Lyttle et al, Biotechniques, 19: 274-280 (1995</text></nplcit>). Synthesis may be carried out directly on the substrate to be used as a solid phase support for the application or the oligonucleotide can be cleaved from the support for use in solution or coupling to a second support.

Solid Phase Supports

0107There are several different solid phase supports that can be used with the invention. They include but are not limited to slides, plates, chips, membranes, beads, microparticles and the like. The solid phase supports can also vary in the materials that they are composed of including plastic, glass, silicon, nylon, polystyrene, silica gel, latex and the like. The surface of the support is coated with the complementary tag sequences by any conventional means of attachment.

0108In preferred embodiments, the family of tag complement sequences is derivatized to allow binding to a solid support. Many methods of derivatizing a nucleic acid for binding to a solid support are known in the art (<nplcit id="ncit0011" npl-type="b"><text>Hermanson G., Bioconjugate Techniques; Acad. Press: 1996</text></nplcit>). The sequence tag may be bound to a solid support through covalent or non-covalent bonds (<nplcit id="ncit0012" npl-type="s"><text>Iannone et al, Cytometry; 39: 131-140, 2000</text></nplcit>; <nplcit id="ncit0013" npl-type="s"><text>Matson et al, Anal. Biochem.; 224: 110-106, 1995</text></nplcit>; <nplcit id="ncit0014" npl-type="s"><text>Proudnikov et al, Anal Biochem; 259: 34-41, 1998</text></nplcit>; <nplcit id="ncit0015" npl-type="s"><text>Zammatteo et al, Analytical Biochemistry; 280:143-150, 2000</text></nplcit>). The sequence tag can be conveniently derivatized for binding to a solid support by incorporating modified nucleic acids in the terminal 5' or 3' locations.

0109A variety of moieties useful for binding to a solid support (e.g., biotin, antibodies, and the like), and methods for attaching them to nucleic acids, are known in the art. For example, an amine-modified nucleic acid base (available from, eg., Glen Research) may be attached to a solid support (for example, Covalink-NH, a polystyrene surface grafted with secondary amino groups, available from Nunc) through a bifunctional crosslinker (e.g., bis(sulfosuccinimidyl suberate), available from Pierce). Additional spacing moieties can be added to reduce steric hindrance between the capture moiety and the surface of the solid support.

Attaching Tags to Analytes for Sorting

0110A family of oligonucleotide tag sequences can be conjugated to a population of analytes most preferably polynucleotide sequences in several different ways including but not limited to direct chemical synthesis, chemical coupling, ligation, amplification, and the like. Sequence tags that have been synthesized with primer sequences can be used for enzymatic extension of the primer on the target for example in PCR amplification.

Detection of Single Nucleotide Polymorphisms Using Primer Extension

0111There are a number of areas of genetic analysis where families of non-cross-hybridizing sequences can be applied including disease diagnosis, single nucleotide polymorphism analysis, genotyping, expression analysis and the like. One such approach for genetic analysis, referred to as the primer extension method (also known as Genetic Bit Analysis (<nplcit id="ncit0016" npl-type="s"><text>Nikiforov et al, Nucleic Acids Res.; 22, 4167-4175: 1994</text></nplcit>; <nplcit id="ncit0017" npl-type="s"><text>Head et al Nucleic Acids Res.; 25, 5065-5071: 1997</text></nplcit>)), is an extremely accurate method for identification of the nucleotide located at a specific polymorphic site within genomic DNA. In standard primer extension reactions, a portion of genomic DNA containing a defined polymorphic site is amplified by PCR using primers that flank the polymorphic site. In order to identify which nucleotide is present at the polymorphic site, a third primer is synthesized such that the polymorphic position is located immediately 3' to the primer. A primer extension reaction is set up containing the amplified DNA, the primer for extension, up to 4 dideoxynucleoside triphosphates (each labeled with a different fluorescent dye) and a DNA polymerase such as the Klenow subunit of DNA Polymerase 1. The use of dideoxy nucleotides ensures that a single base is added to the 3' end of the primer, a site corresponding to the polymorphic site. In this way the identity of the nucleotide present at a specific polymorphic site can be determined by the identity of the fluorescent dye-labeled nucleotide that is incorporated in each reaction. One major drawback to this approach is its low throughput. Each primer extension reaction is carried out independently in a separate tube. Universal sequences can be used to enhance the throughput of primer extension assay as follows. A region of genomic DNA containing multiple polymorphic sites is amplified by PCR. Alternatively, several genomic regions containing one or more polymorphic sites each are amplified together in a multiplexed PCR reaction. The primer extension reaction is carried out as described above except that the primers used are chimeric, each containing a unique universal tag at the 5' end and the sequence for extension at the 3' end. In this way, each gene-specific sequence would be associated with a specific universal sequence. The chimeric primers would be hybridized to the amplified DNA and primer extension is carried out as described above. This would result in a mixed pool of extended primers, each with a specific fluorescent dye characteristic of the incorporated nucleotide. Following the primer extension reaction, the mixed extension reactions are hybridized to an array containing probes that are reverse complements of the universal sequences on the primers. This would segregate the products of a,number of primer extension reactions into discrete spots. The fluorescent dye present at each spot would then identify the nucleotide incorporated at each specific location. A number of additional methods for the detection of single nucleotide polymorphisms, including but not limited to, allele specific polymerase chain reaction (ASPCR), allele specific -primer extension (ASPE) and oligonucleotide ligation assay (OLA) can be performed by someone skilled in the art in combination with the tag sequences described herein.

Kits Using Families Of Tag Sequences

0112The families of non cross-hybridizing sequences may be provided in kits for use in for example genetic analysis. Such kits include at least one set of non-cross-hybridizing sequences in solution or on a solid support. Preferably the sequences are attached to microparticles and are provided with buffers and reagents that are appropriate for the application. Reagents may include enzymes, nucleotides, fluorescent labels and the like that would be required for specific applications. Instructions for correct use of the kit for a given application will be provided.

EXAMPLES

EXAMPLE 1 - Cross Talk Behavior of Sequence on Beads

0113A group of 100 sequences, randomly selected from Table I, was tested for feasibility for use as a family of minimally cross-hybridizing oligonucleotides. The 100 sequences selected are separately indicated in Table I along with the numbers assigned to the sequences in the tests.

0114The tests were conducted using the Luminex LabMAP™ platform available from Luminex Corporation, Austin, Texas, U.S.A. The one hundred sequences, used as probes, were synthesized as oligonucleotides by Integrated DNA Technologies (IDT, Coralville, Iowa, U.S.A.). Each probe included a C6 aminolink group coupled to the 5'-end of the oligonucleotide through a C12 ethylene glycol spacer. The C6 aminolink molecule is a six carbon spacer containing an amine group that can be used for attaching the oligonucleotide to a solid support. One hundred oligonucleotide targets (probe complements), the sequence of each being the reverse complement of the 100 probe sequences, were also synthesized by IDT. Each target was labelled at its 5'-end with biotin. All oligonucleotides were purified using standard desalting procedures, and were reconstituted to a concentration of approximately 200 µM in sterile, distilled water for use. Oligonucleotide concentrations were determined spectrophotometrically using extinction coefficients provided by the supplier.

0115Each probe was coupled by its amino linking group to a carboxylated fluorescent microsphere of the LapMAP system according to the Luminex100 protocol. The microsphere, or bead, for each probe sequence has unique, or spectrally distinct, light absorption characteristics which permits each probe to be distinguished from the other probes. Stock bead pellets were dispersed by sonication and then vortexing. For each bead population, five million microspheres (400 µL) were removed from the stock tube using barrier tips and added to a 1.5 mL Eppendorf tube (USA Scientific). The microspheres were then centrifuged, the supernatant was removed, and beads were resuspended in 25 µL of 0.2 M MES (2-(N-morpholino)ethane sulfonic acid) (Sigma), pH 4.5, followed by vortexing and sonication. One nmol of each probe (in a 25 µL volume) was added to its corresponding bead population. A volume of 2.5 µL of EDC cross-linker (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Pierce), prepared immediately before use by adding 1.0 mL of sterile ddH2O to 10 mg of EDC powder, was added to each microsphere population. Bead mixes were then incubated for 30 minutes at room temperature in the dark with periodic vortexing. A second 2.5 µL aliquot of freshly prepared EDC solution was then added followed by an additional 30 minute incubation in the dark. Following the second EDC incubation, 1.0 mL of 0.02% Tween-20 (BioShop) was added to each bead mix and vortexed. The microspheres were centrifuged, the supernatant was removed, and the beads were resuspended in 1.0 mL of 0.1% sodium dodecyl sulfate (Sigma). The beads were centrifuged again and the supernatant removed. The coupled beads were resuspended in 100 µL of 0.1 M MES pH 4.5. Bead concentrations were then determined by diluting each preparation 100-fold in ddH2O and enumerating using a Neubauer BrightLine Hemacytometer. Coupled beads were stored as individual populations at 8°C protected from light.

0116The relative oligonucleotide probe density on each bead population was assessed by Terminal Deoxynucleotidyl Transferase (TdT) end-labelling with biotin-ddUTPs. TdT was used to label the 3'-ends of " single-stranded DNA with a labeled ddNTP. Briefly, 180 µL of the pool of 100 bead populations (equivalent to about 4000 of each bead type) to be used for hybridizations was pipetted into an Eppendorf tube and centrifuged. The supernatant was removed, and the beads were washed in 1x TdT buffer. The beads were then incubated with a labelling reaction mixture, which consisted of 5x TdT buffer, 25mM CoCl2, and 1000 pmol of biotin-16-ddUTP (all reagents were purchased from Roche). The total reaction volume was brought up to 85.5 µL with sterile, distilled H2O, and the samples were incubated in the dark for 1 hour at 37°C. A second aliquot of enzyme was added, followed by a second 1 hour incubation. Samples were run in duplicate, as was the negative control, which contained all components except the TdT. In order to remove unincorporated biotin-ddUTP, the beads were washed 3 times with 200 µL of hybridization buffer, and the beads were resuspended in 50 µL of hybridization buffer following the final wash. The biotin label was detected spectrophotometrically using SA-PE (streptavidin-phycoerythrin conjugate). The streptavidin binds to biotin and the phycoerythrin is spectrally distinct from the probe beads. The 10mg/mL stock of SA-PE was diluted 100-fold in hybridization buffer, and 15 µL of the diluted SA-PE was added directly to each reaction and incubated for 15 minutes at 37°Celsius. The reactions were analyzed on the Luminex100 LabMAP. Acquisition parameters were set to measure 100 events per bead using a sample volume of 50 µL.

0117The results obtained are shown in <figref idref="f0002">Figure 2</figref>. As can be seen the Mean Fluorescent Intensity (MFI) of the beads varies from 840.3 to 3834.9, a range of 4.56-fold. Assuming that the labelling reactions are complete for all of the oligonucleotides, this illustrates the signal intensity that would be obtained for each type of bead at this concentration if the target (i.e., labelled complement) was bound to the probe sequence to the full extent possible.

0118The cross-hybridization of targets to probes was evaluated as follows. 100 oligonucleotide probes linked to 100 different bead populations, as described above, were combined to generate a master bead mix, enabling multiplexed reactions to be carried out. The pool of microsphere-immobilized probes was then hybridized individually with each biotinylated target. Thus, each target was examined individually for its specific hybridization with its complementary bead-immobilized sequence, as well as for its non-specific hybridization with the other 99 bead-immobilized universal sequences present in the reaction. For each hybridization reaction, 25 µL bead mix (containing about 2500 of each bead population in hybridization buffer) was added to each well of a 96-well Thermowell PCR plate and equilibrated at 37°C. Each target was diluted to a final concentration of 0.002 fmol/µL in hybridization buffer, and 25 µL (50 fmol) was added to each well, giving a final reaction volume of 50 µL. Hybridization buffer consisted of 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 and hybridizations were performed at 37°C for 30 minutes. Each target was analyzed in triplicate and six background samples (i.e. no target) were included in each plate. A SA-PE conjugate was used as a reporter, as described above. The 10 mg/mL stock of SA-PE was diluted 100-fold in hybridization buffer, and 15 µL of the diluted SA-PE was added directly to each reaction, without removal of unbound target, and incubated for 15 minutes at 37°C. Finally, an additional 35 µL of hybridization buffer was added to each well, resulting in a final volume of 100 µL per well prior to analysis on the Luminex100 LabMAP. Acquisition parameters were set to measure 100 events per bead using a sample volume of 80 µL.

0119The percent hybridization was calculated for any event in which the NET MFI was at least 3 times the zero target background. In other words, a calculation was made for any sample where (MFIsample-MFIzero target background) /MFIzero target background ≥ 3.

0120The net median fluorescent intensity (MFIsample-MFIzero target background) generated for all of the 10,000 possible target/probe combinations was calculated. As there are 100 probes and 100 targets, there are 100 x 100 = 10,0000 possible different interactions possible of which 100 are the result of perfect hybridizations. The remaining 9900 result from hybridization of a target with a mismatched probe. A cross-hybridization event is then defined as a non-specific event whose net median fluorescent intensity exceeds 3 times the zero target background. In other words, a cross-talk calculation is only be made for any sample where (MFIsample-MFIzero target background) /MFIzero target background ≥ 3. Cross-hybridization events were quantified by expressing the value of the cross-hybridization signal as a percentage of the perfect match hybridization signal with the same-probe.

0121The results obtained are illustrated in <figref idref="f0003">Figure 3</figref>. The ability of each target to be specifically recognized by its matching probe is shown. Of the possible 9900 non-specific hybridization events that could have occurred when the 100 targets were each exposed to the pool of 100 probes, 6 events were observed. Of these 6 events, the highest non-specific event generated a signal equivalent to 5.3% of the signal observed for the perfectly matched pair (i.e. specific hybridization event).

0122Each of the 100 targets was thus examined individually for specific hybridization with its complement sequence as incorporated onto a microsphere, as well as for non-specific hybridization with the complements of the other 99 target sequences. Representative hybridization results for target (complement of probe 90, Table I) are shown in <figref idref="f0004">Figure 4</figref>. Probe 90 was found to hybridize only to its perfectly-matched target. No cross-hybridization with any of the other 99 targets was observed.

0123The foregoing results demonstrate the possibility of incorporating the 1168 sequences of Table I, or any subset thereof, into a multiplexed system with the expectation that most if not all sequences can be distinguished from the others by hybridization. That is, it is possible to distinguish each target from the other targets by hybridization of the target with its precise complement and minimal hybridization with complements of the other targets.

EXAMPLE 2 - Tag sequences used in sorting polynucleotides

0124The family of non cross hybridizing sequence tags or a subset thereof can be attached to oligonucleotide probe sequences during synthesis and used to generate amplified probe sequences. In order to test the feasibility of PCR amplification with non cross hybridizing sequence tags and subsequently addressing each respective sequence to its appropriate location on two-dimensional or bead arrays, the following experiment was devised. A 24mer tag sequence can be connected in a 5'-3' specific manner to a p53 exon specific sequence (20mer reverse primer). The connecting p53 sequence represents the inverse complement of the nucleotide gene sequence. To facilitate the subsequent generation of single stranded DNA post-amplification the tag-Reverse primer can be synthesized with a phosphate modification (PO4) on the 5'-end. A second PCR primer can also be generated for each desired exon, represented by the Forward (5'-3') amplification primer. In this instance the Forward primer can be labeled with a 5'-biotin modification to allow detection with Cy3-avidin or equivalent.

0125A practical example of the aforementioned description is as follows: For exon 1 of the human p53 tumor suppressor gene sequence the following tag-Reverse primer (SEQ ID NO:1171) can be generated: <img file="EP1364065B1_D0025.tif" />

0126The numbering above the Exon-1 reverse primer represents the genomic nucleotide positions of the indicated bases.

0127The corresponding Exon-1 Forward primer sequence (SEQ ID NO:1172) is as follows: <img file="EP1364065B1_D0026.tif" />

0128In combination these primers will amplify a product of 214 bp plus a 24 bp tag extension yielding a total size of 238 bp.

0129Once amplified, the PCR product can be purified using a QIAquick PCR purification kit and the resulting DNA can be quantified. To generate single stranded DNA, the DNA is subjected to λ-exonuclease digestion thereby resulting in the exposure of a single stranded sequence (anti-tag) complementary to the tag-sequence covalently attached to the solid phase array. The resulting product is heated to 95°C for 5 minutes and then directly applied to the array at a concentration of 10-50 nM. Following hybridization and concurrent sorting, the tag-Exon 1 sequences are visualized using Cy3-streptavidin. In addition to direct visualization of the biotinylated product, the product itself can now act as a substrate for further analysis of the amplified region, such as SNP detection and haplotype determination.

DEFINITIONS

0130Non-cross-hybridization: Describes the absence of hybridization between two sequences that are not perfect complements of each other.

0131Cross-hybridization: The hydrogen bonding of a single-stranded DNA sequence that is partially but not entirely complementary to a single-stranded substrate.

0132Homology or Similarity: How closely related two or more separate strands of DNA are to each other, based on their base sequences.

0133Analogue: The symbols A, G, T/U, C take on their usual meaning in the art here. In the case of T and U, a person skilled in the art would understand that these are equivalent to each other with respect to the inter-strand hydrogen-bond (Watson-Crick) binding properties at work in the context of this invention. The two bases are thus interchangeable and hence the designation of T/U. A chemical, which resembles a nucleotide base is an analogue thereof. A base that does not normally appear in DNA but can substitute for the ones, which do, despite minor differences in structure. Analogues particularly useful in this invention are of the naturally occurring bases can be inserted in their respective places where desired. Such an analogue is any non-natural base, such as peptide nucleic acids and the like that undergoes normal Watson-Crick pairing in the same way as the naturally occurring nucleotide base to which it corresponds.

0134Complement: The opposite or "mirror" image of a DNA sequence. A complementary DNA sequence has an "A" for every "T" and a "C" for every "G". Two complementary strands of single stranded DNA, for example a tag sequence and its complement, will join to form a double-stranded molecule.

0135Complementary DNA (cDNA): DNA that is synthesized from a messenger RNA template; the single- stranded form is often used as a probe in physical mapping.

0136Oligonucleotide: Refers to a short nucleotide polymer whereby the nucleotides may be natural nucleotide bases or analogues thereof.

0137Tag: Refers to an oligonucleotide that can be used for specifically sorting analytes with at least one other oligonucleotide that when used together do not cross hybridize. <tables id="tabl0025" num="0025"><img file="EP1364065B1_D0027.tif" /></tables><tables id="tabl0026" num="0026"><img file="EP1364065B1_D0028.tif" /></tables><tables id="tabl0027" num="0027"><img file="EP1364065B1_D0029.tif" /></tables><tables id="tabl0028" num="0028"><img file="EP1364065B1_D0030.tif" /></tables><tables id="tabl0029" num="0029"><img file="EP1364065B1_D0031.tif" /></tables><tables id="tabl0030" num="0030"><img file="EP1364065B1_D0032.tif" /></tables><tables id="tabl0031" num="0031"><img file="EP1364065B1_D0033.tif" /></tables><tables id="tabl0032" num="0032"><img file="EP1364065B1_D0034.tif" /></tables><tables id="tabl0033" num="0033"><img file="EP1364065B1_D0035.tif" /></tables><tables id="tabl0034" num="0034"><img file="EP1364065B1_D0036.tif" /></tables><tables id="tabl0035" num="0035"><img file="EP1364065B1_D0037.tif" /></tables><tables id="tabl0036" num="0036"><img file="EP1364065B1_D0038.tif" /></tables><tables id="tabl0037" num="0037"><img file="EP1364065B1_D0039.tif" /></tables><tables id="tabl0038" num="0038"><img file="EP1364065B1_D0040.tif" /></tables><tables id="tabl0039" num="0039"><img file="EP1364065B1_D0041.tif" /></tables><tables id="tabl0040" num="0040"><img file="EP1364065B1_D0042.tif" /></tables><tables id="tabl0041" num="0041"><img file="EP1364065B1_D0043.tif" /></tables><tables id="tabl0042" num="0042"><img file="EP1364065B1_D0044.tif" /></tables><tables id="tabl0043" num="0043"><img file="EP1364065B1_D0045.tif" /></tables><tables id="tabl0044" num="0044"><img file="EP1364065B1_D0046.tif" /></tables><tables id="tabl0045" num="0045"><img file="EP1364065B1_D0047.tif" /></tables><tables id="tabl0046" num="0046"><img file="EP1364065B1_D0048.tif" /></tables>

0138All references referred to in this specification are incorporated herein by reference.

0139The scope of protection sought for the invention described herein is defined by the appended claims. It will also be understood that any elements recited above or in the claims, can be combined with the elements of any claim. In particular, elements of a dependent claim can be combined with any element of a claim from which it depends, or with any other compatible element of the invention.

0140This application claims priority from United States Provisional Patent Application Nos. <patcit id="pcit0012" dnum="US60263710B"><text>60/263,710</text></patcit> and <patcit id="pcit0013" dnum="US60303799B"><text>60/303,799</text></patcit>, filed January 25, 2001 and July 10, 2001. Both of these documents are incorporated herein by reference.

Contents8

Every citation, both ways

Citations
Document	Relation	Office
EP0698792A	Cites	European Patent Office (EPO)
EP0799897A	Cites	European Patent Office (EPO)
WO0058516A	Cites	World Intellectual Property Organization (WIPO)
WO0159151A	Cites	World Intellectual Property Organization (WIPO)
US5654413A	Cites	United States of America
NIEMEYER CHRISTOF M ET AL: "DNA-directed immobilization: Efficient, reversible, and site-selective surface binding of proteins by means of covalent DNA-streptavidin conjugates" ANALYTICAL BIOCHEMISTRY, ACADEMIC PRESS, SAN DIEGO, CA, US, vol. 268, no. 1, 1 March 1999 (1999-03-01), pages 54-63, XP002176566 ISSN: 0003-2697	Non-patent	–
SOUTHERN E ET AL: "MOLECULAR INTERACTIONS ON MICROARRAYS" NATURE GENETICS, NEW YORK, NY, US, vol. 21, no. SUPPL, January 1999 (1999-01), pages 5-9, XP000865979 ISSN: 1061-4036 cited in the application	Non-patent	–

66 members in 10 offices

This recordMember, by publication datePriority claim

Priority claims5

Priority claims
Document	Office	Kind	Date
263710P	United States of America	–	2001-01-25
26371001	United States of America	P	2001-01-25
303799P	United States of America	–	2001-07-10
30379901	United States of America	P	2001-07-10
0200089	Canada	W	2002-01-25

Members66

Family members, oldest first
Document	Office	Kind
CA2435551A1	Canada	A1	2002-08-01
CA2435612A1	Canada	A1	2002-08-01
WO02059354A2	World Intellectual Property Organization (WIPO)	A2	2002-08-01
WO02059355A2	World Intellectual Property Organization (WIPO)	A2	2002-08-01
AU2002229435C1	Australia	C1	2002-08-06
WO02059354A3	World Intellectual Property Organization (WIPO)	A3	2003-06-26
EP1364065A3	European Patent Office (EPO)	A3	2003-10-02
WO02059355A3	World Intellectual Property Organization (WIPO)	A3	2003-10-02
EP1356117A2	European Patent Office (EPO)	A2	2003-10-29
EP1364065A2	European Patent Office (EPO)	A2	2003-11-26
JP2004522440A	Japan	A	2004-07-29
JP2004526433A	Japan	A	2004-09-02
BR0206746A	Brazil	A	2004-11-16
BR0206746A	Brazil	A	2004-11-16
BR0206747A	Brazil	A	2004-11-30
BR0206747A	Brazil	A	2004-11-30
US2005089851A1	United States of America	A1	2005-04-28
US2005191625A1	United States of America	A1	2005-09-01
US7226737B2	United States of America	B2	2007-06-05
AU2002229435B2	Australia	B2	2007-06-07
AU2007214344A1	Australia	A1	2007-09-20
US2007244310A1	United States of America	A1	2007-10-18
AU2002227829B2	Australia	B2	2007-12-20
US2008014587A1	United States of America	A1	2008-01-17
AU2008201349A1	Australia	A1	2008-04-17
AU2002227829C1	Australia	C1	2009-03-05
US7608398B2	United States of America	B2	2009-10-27
JP2010000086A	Japan	A	2010-01-07
US7645868B2	United States of America	B2	2010-01-12
JP4422963B2	Japan	B2	2010-03-03
US2010112705A1	United States of America	A1	2010-05-06
AU2008201349B2	Australia	B2	2010-05-27
US2010216133A1	United States of America	A1	2010-08-26
US2010216134A1	United States of America	A1	2010-08-26
US2010216135A1	United States of America	A1	2010-08-26
JP4588976B2	Japan	B2	2010-12-01
US7846668B2	United States of America	B2	2010-12-07
US7846669B2	United States of America	B2	2010-12-07
US7846670B2	United States of America	B2	2010-12-07
US7846734B2	United States of America	B2	2010-12-07
US2010311957A1	United States of America	A1	2010-12-09
US2011039726A1	United States of America	A1	2011-02-17
US2011039727A1	United States of America	A1	2011-02-17
US2011039728A1	United States of America	A1	2011-02-17
US2011046010A1	United States of America	A1	2011-02-24
US7914997B2	United States of America	B2	2011-03-29
US7927808B2	United States of America	B2	2011-04-19
US7927809B2	United States of America	B2	2011-04-19
US7943322B2	United States of America	B2	2011-05-17
EP2325336A1	European Patent Office (EPO)	A1	2011-05-25
EP2327794A2	European Patent Office (EPO)	A2	2011-06-01
US7960537B2	United States of America	B2	2011-06-14
EP2327794A3	European Patent Office (EPO)	A3	2011-09-14
CA2435551C	Canada	C	2011-10-25
EP1364065B1This record	European Patent Office (EPO)	B1	2012-02-22
AT546545T	Austria	T	2012-03-15
ATE546545T1	Austria	T1	2012-03-15
DK1364065T3	Denmark	T3	2012-05-14
ES2382542T3	Spain	T3	2012-06-11
JP5189569B2	Japan	B2	2013-04-24
US8624014B2	United States of America	B2	2014-01-07
EP2325336B1	European Patent Office (EPO)	B1	2014-06-11
CA2435612C	Canada	C	2014-12-23
BRPI0206747B1	Brazil	B1	2017-03-21
BRPI0206746B1	Brazil	B1	2017-05-02
BRPI0206746B8	Brazil	B8	2021-07-27

58 legal events, as 11 offices reported them to INPADOC

Over the term

Point at a mark for the event

Events

Legal events, newest first
	Event	Code	Office
2022-07-29	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2022-05-03	Announcement of lapse in spainLapsedFD2A	FD2A	ES
2022-04-29	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2022-02-25	Patent expired because of reaching the maximum lifetime of a patentExpiredMK	MK	BE
2022-02-16	Patent expired after termination of 20 yearsExpiredPE20	PE20	GB
2022-01-31	Ep patent expiredExpiredEUP	EUP	DK
2022-01-26	Patent expired because of reaching the maximum lifetime of a patentExpiredMK	MK	NL
2022-01-25	Expiry of rightR071	R071	DE
2021-05-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2021-05-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2021-05-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2021-05-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2021-05-31	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2021-04-30	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2021-04-30	Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP	PGFP	EP
2018-01-25	Fee paymentPLFP	PLFP	FR
2017-01-25	Fee paymentPLFP	PLFP	FR
2016-01-26	Fee paymentPLFP	PLFP	FR
2015-07-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2015-06-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2015-01-19	Fee paymentPLFP	PLFP	FR
2014-01-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2013-10-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2013-10-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2013-10-23	Patent lapsedLapsedMM4A	MM4A	IE
2013-08-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2013-08-30	Patent ceasedCeasedPL	PL	CH
2013-03-21	No opposition filed against granted patent, or epo opposition proceedings concluded without decisionGrantedR097	R097	DE
2013-01-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2013-01-30	No opposition filedOpposition26N	26N	EP
2012-12-28	No opposition filed within time limitOppositionORIGINAL CODE: 0009261PLBE	PLBE	EP
2012-12-28	Information on the status of an ep patent application or granted ep patentGrantedSTATUS: NO OPPOSITION FILED WITHIN TIME LIMITSTAA	STAA	EP
2012-11-30	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2012-10-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2012-09-28	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2012-09-15	Deletion acc. to par. 5 (withdrawal of the translation of the ep patent)MK05	MK05	AT
2012-08-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2012-08-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2012-08-31	Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25	PG25	EP
2012-07-25	Lt: invalidation of european patent or patent extensionLTIE	LTIE	EP
2012-06-11	Definitive protectionFG2A	FG2A	ES
2012-06-06	Translation filed for an european patent granted for nl, confirming art. 52 par. 1 or 6 of the patents act 1995GrantedT3	T3	NL
2012-05-14	Ep patent with danish claimsT3	T3	DK
2012-04-19	Dpma publication of mentioned ep patent grantGrantedR096	R096	DE
2012-03-28	European patents granted designating irelandGrantedFG4D	FG4D	IE
2012-03-15	Reference to at number (ep patent validated in austria)REF	REF	AT
2012-02-29	European patent takes effect as a national patent in ch/liEP	EP	CH
2012-02-22	Designated contracting statesAK	AK	EP
2012-02-22	Request for extension of the european patentAX	AX	EP
2012-02-22	European patent grantedGrantedFG4D	FG4D	GB
2012-01-25	Party data changed (applicant data changed or rights of an application transferred)RAP1	RAP1	EP
2012-01-20	(expected) grantORIGINAL CODE: 0009210GRAA	GRAA	EP
2011-11-25	Grant fee paidORIGINAL CODE: EPIDOSNIGR3GRAS	GRAS	EP
2011-07-19	Despatch of communication of intention to grant a patentORIGINAL CODE: EPIDOSNIGR1GRAP	GRAP	EP
2003-11-26	Request for examination filed17P	17P	EP
2003-11-26	Designated contracting statesAK	AK	EP
2003-11-26	Request for extension of the european patentAX	AX	EP
2003-10-10	Public reference made under article 153(3) epc to a published international application that has entered the european phaseORIGINAL CODE: 0009012PUAI	PUAI	EP