Modulators of foxp3 expression

MODULATORS OF FOXP3 EXPRESSION

LIST OF SEQUENCES

This application is submitted together with a sequence listing in electronic format. The Sequence Listing is provided as a file titled BIOL0344WOSEQ_ST25.txt, created on November 11, 2019, which is 698 kb in size. Information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD

The present embodiments provide methods, compounds, and compositions useful for inhibiting the expression of FOXP3, which may be useful in treating, preventing, or ameliorating cancer.

BACKGROUND

Foxp3 is a lineage-defining transcription factor for regulatory T cells (Tregs) that controls a restricted set of genes associated with immunosuppression. Tregs suppress immunity (including antitumor immunity) through multiple effector mechanisms. The presence of Tregs in the tumor has a poor prognostic outcome in multiple types of cancer. Tregs do not possess a unique signaling protein or surface marker that might allow targeting with biological agents. FOXP3 cannot be targeted by conventional small molecule or monoclonal antibodies.

COMPENDIUM

Certain embodiments provided herein are directed to potent and tolerable compounds and compositions useful for inhibiting FOXP3 expression, which may be useful for treating, preventing, ameliorating, or slowing the progression of cancer. In some embodiments, the cancer is associated with an immunosuppressive microenvironment or stroma. Certain embodiments are directed to compounds and compositions useful for the inhibition of FOXP3 expression on Tregs, which may be useful for treating, preventing, ameliorating, or slowing the progression of cancer associated with immunosuppressive Tregs.

DETAILED DESCRIPTION

It will be understood that both the foregoing general description and the following detailed description are merely explanatory and illustrative and do not limit the claims as claimed. In this document, the use of the singular includes the plural unless specifically stated otherwise. The use of or, as used herein, means and/or unless otherwise indicated. Furthermore, the use of the term include, as well as other forms such as

I give as included and included, it is not limiting.

The section headings used in this document are for organizational purposes only and should not be construed as limiting the subject matter being described. All documents or portions of documents cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records, are incorporated herein by expressly by reference to the portions of the document discussed herein as well as in its entirety.

It is understood that the sequence set forth in each SEQ ID NO of the examples contained herein is independent of any modification to a sugar moiety, internucleoside linkage, or nitrogenous base. In this sense, the compounds defined in a SEQ ID NO can independently comprise one or more modifications in a sugar moiety, a link between nucleosides or a nitrogenous base. Compounds described with an ION number indicate a combination of nitrogenous base sequence, chemical modification, and motif.

Unless otherwise indicated, the following terms have the following meanings:

2'-Deoxynucleoside refers to a nucleoside comprising a 2'-H(H)furanosyl-type sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2'-deoxynucleoside may comprise a modified nitrogenous base or may comprise an RNA (uracil) nitrogenous base.

2'-O-methoxyethyl (also 2'-MOE and 2'-O(CH2)2-OCH3) refers to an O-methoxyethyl type modification at the 2' position of a furanosyl ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

2'-MOE nucleoside (also 2'-O-methoxyethyl nucleoside) refers to a nucleoside comprising a 2'-MOE modified sugar moiety.

2'-Substituted nucleoside or 2-modified nucleoside refers to a nucleoside comprising a 2'-substituted or 2'-modified sugar moiety. 2'-Substituted or 2-modified, as used herein, referring to a sugar moiety, refers to a sugar moiety comprising at least one 2'-substituent group other than H or OH .

"3' target site" refers to the nucleotide of a target nucleic acid that is complementary to the nucleotide nearest the 3' position of a particular compound.

"5' target site" refers to the nucleotide of a target nucleic acid that is complementary to the nearest 5' nucleotide of a compound.

Three particular.

5-Methylcytosine refers to a cytosine with a methyl group attached to the 5-position.

Approximately means within ±10% of a value. For example, if it is indicated that the compounds exerted approximately 70% inhibition of FOXP3, it follows that the FOXP3 levels are inhibited within the range of 60% to 80%.

Administration or "administer" refers to the routes of introduction of a compound or composition provided herein into an individual in order for it to carry out its intended function. An example of a route of administration that may be used includes, but is not limited to, parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

Concomitantly administered or co-administration refers to the administration of two or more compounds in any manner in which the pharmacological effects of both are manifested in the patient. Coadministration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. It is not necessary that the effects of both compounds manifest themselves at the same time. The effects need only overlap over a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequential.

"Amelioration" refers to an improvement or decrease in at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, the improvement includes a delay or slowing down in the progression or severity of one or more indicators of a condition or disease. The progression or severity of the indicators can be determined by subjective or objective measures, which are known to those skilled in the art.

"Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

Antibody, as used in this disclosure, refers to an immunoglobulin or a fragment or derivative thereof and encompasses any polypeptide that comprises an antigen binding site, regardless of whether it is produced in vitro or in vivo. The term includes, but is not limited to, polyclonal, monoclonal, monospecific, polyspecific, nonspecific, humanized, single-chain, chimeric, synthetic, recombinant, hybrid, mutated, and graft antibodies. Unless modified by the term intact, such as in intact antibodies, for purposes of this disclosure, the term antibody also includes antibody fragments such as Fab, F(ab')2, Fv, scFv, Fd, dAb, and others. antibody fragments that maintain the antigen-binding function, that is, the

Four ability to bind, for example, to CTLA-4 or PD-L1, specifically. Typically, fragments of this type would comprise an antigen binding domain.

"Anti-CTLA-4 antibody" refers to an antibody or antigen-binding fragment thereof that specifically binds to a CTLA-4 polypeptide. Illustrative anti-CTLA-4 antibodies are described, for example, in US Patent Nos. 6,682,736; 7,109,003; 7,123,281; 7,411,057; 7,824,679; 8,143,379; 7,807,797; and 8,491,895 (Tremelimumab is 11.2.1, therein), which are incorporated herein by reference. Tremelimumab (US Patent No. 6,682,736) is an exemplary anti-CTLA-4 antibody.

"Anti-OX40 antibody" refers to an antibody or antigen-binding fragment thereof that specifically binds to OX40. Antibodies against OX40 include monoclonal and polyclonal antibodies that are specific for OX40 and antigen-binding fragments thereof. In certain aspects, anti-OX40 antibodies as described herein are monoclonal antibodies (or antigen-binding fragments thereof), eg, murine, humanized, or fully human monoclonal antibodies. In a particular embodiment, the antibody against OX40 is an OX40 receptor agonist, such as the mouse anti-human OX40 monoclonal antibody (9B12) described by Weinberg et al., J Immunother 29, 575-585 (2006). In another embodiment, an antibody against OX40 is MEDI0562, as described in US 2016/0137740, incorporated herein by reference. In other embodiments, the antibody that specifically binds to OX40, or an antigen-binding fragment thereof, binds to the same epitope of OX40 as mAb 9B12.

"Anti-PD-L1 antibody" refers to an antibody or antigen-binding fragment thereof that specifically binds to a PD-L1 polypeptide. Exemplary anti-PD-L1 antibodies are described, for example, in US2013/0034559, US Patent Nos. 8,779,108 and 9,493,565 which are incorporated herein by reference. Durvalumab (MEDI4736) is an illustrative anti-PD-L1 antibody. Other anti-PD-L1 antibodies include BMS-936559 (Bristol-Myers Squibb) and MPDL3280A (atezolizumab) (Roche).

"Anti-PD-1 antibody" refers to an antibody or antigen-binding fragment thereof that specifically binds to a PD-1 polypeptide. Exemplary anti-PD-1 antibodies are described, for example, in US Patent Nos. 7,521,051; 8,008,449; 8,354,509; 9,073,994; 9,393,301; 9402899; and 9,439,962, which are incorporated herein by reference. Exemplary anti-PD-1 antibodies include, without limitation, nivolumab, pembrolizumab, pidilizumab, and AMP-514.

Antigen-binding domain, antigen-binding fragment, and binding fragment refer to a part of an antibody molecule that comprises the amino acids responsible for specific binding between antibody and antigen. In some cases, when an antigen is large, the antigen-binding domain may bind only a part of the antigen. A portion of the antigenic molecule that

Five is responsible for specific interactions with the antigen-binding domain called an epitope or antigenic determinant. An antigen-binding domain typically comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH), however, need not comprise both. For example, a so-called Fd antibody fragment consists solely of a VH domain, but still retains part of the antigen-binding function of the intact antibody. Antigen-binding fragments of an antibody can be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies. Binding fragments include Fab, Fab', F(ab')2, Fv, and single chain antibodies. An antibody that is not a bispecific or bifunctional antibody is understood to have each of its binding sites identical. Digestion of antibodies with the enzyme, papain, results in two identical antigen-binding fragments, also known as Fab fragments, and one Fc fragment, which have no antigen-binding activity but have the ability to crystallize. Digestion of antibodies with the enzyme, pepsin, results in the F(ab')2 fragment in which the two arms of the antibody molecule remain linked and comprise two antigen-binding sites. The F(ab')2 fragment has the ability to crosslink antigen. The term Fv, when used herein, refers to the minimal fragment of an antibody that retains both antigen recognition and antigen binding sites. Fab, when used herein, refers to a fragment of an antibody comprising the light chain constant domain and the heavy chain CH1 domain.

MAb refers to a monoclonal antibody. Antibodies of the present disclosure comprise, without limitation, whole native antibodies, bispecific antibodies; chimeric antibodies; Fab, Fab', single chain V region fragments (scFv), fusion polypeptides and unconventional antibodies.

Antisense activity means any measurable and/or detectable activity that can be attributed to hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound. for the target

Antisense compound refers to a compound that comprises an oligonucleotide and optionally one or more additional features, such as a conjugate group or end group. Examples of antisense compounds include single-stranded and double-stranded compounds such as oligonucleotides, ribozymes, siRNA, shRNA, single-stranded RNA, and occupancy-based compounds.

"Antisense inhibition" refers to the reduction of the levels of a target nucleic acid in the presence of an antisense compound complementary to the target nucleic acid as compared to the levels of the target nucleic acid in

Six absence of the antisense compound.

Antisense mechanisms are all those mechanisms that involve the hybridization of a compound with a target nucleic acid, where the result or effect of the hybridization is either the degradation of the target or the occupancy of the target with the concomitant paralysis of the cellular machinery. involved, for example, transcription or splicing.

Antisense oligonucleotide refers to an oligonucleotide having a sequence of nitrogenous bases that is complementary to a target nucleic acid or region or segment thereof. In certain embodiments, an antisense oligonucleotide can be specifically hydrolyzed to obtain a target nucleic acid or a region or segment thereof.

Bicyclic nucleoside or BNA refers to a nucleoside that comprises a bicyclic sugar moiety. "Bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety comprising two rings, where the second ring is formed by a bridge connecting two of the first ring atoms, so that a bicyclic structure is formed. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

"Branching group" refers to a group of atoms having at least 3 positions that are capable of forming covalent bonds with at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting ligands attached to an oligonucleotide via a conjugated linker and/or a cleavable moiety.

Moiety that is targeted to a cell refers to a conjugated group or a portion of a conjugated group that is capable of binding to a particular cell type or cell types.

Constrained ethyl or cEt refers to a bicyclic furanosyl-type sugar moiety comprising a bridge connecting the 4'-carbon and the 2'-carbon, where the bridge has the formula: 4'-CH(CH3)-O-2'.

cEt nucleoside refers to a nucleoside comprising a cEt-modified sugar moiety.

Chemical modification in a compound describes substitutions or changes by chemical reactions of any of the units in the compound relative to the original state of that unit. Modified nucleoside refers to a nucleoside that independently contains a modified sugar moiety and/or a modified nitrogenous base. "Modified oligonucleotide" refers to an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar and/or a modified nitrogenous base.

Seven

"Chemically distinct region" refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region containing 2'-O-methoxyethyl nucleotides is chemically distinct from a region containing unmodified 2'-O-methoxyethyl nucleotides.

Chimeric antisense compounds refers to antisense compounds that contain at least 2 chemically distinct regions, each position having a plurality of subunits.

Chirally enriched population means a plurality of molecules of identical molecular formula, where the number or percentage of molecules in the population that contain a stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same stereochemical configuration at the same particular chiral center in the population in case the particular chiral center was stereorandom. Chirally-enriched populations of molecules that have multiple chiral centers in each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

Cleavable bond refers to any chemical bond that can be broken. In certain embodiments, a cleavable bond is selected from: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a disulfide, or a peptide.

Cleavable moiety refers to a bond or group of atoms that cleaves under physiological conditions, eg, within a cell, animal, or human.

Complementary, in reference to an oligonucleotide, means that the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two sequences of nitrogenous bases line up in opposite directions. Pairings of nitrogenous bases or complementary nitrogenous bases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), to adenine (A) and uracil (U), cytosine ( C) and guanine (G), and 5-methylcytosine (^mC) and guanine (G) unless otherwise specified. The complementary oligonucleotides and/or nucleic acids need not exhibit nitrogenous base complementarity at each nucleoside and these may include one or more nitrogenous base mismatches. In contrast, fully complementary or 100% complementary, in reference to oligonucleotides, refers to such oligonucleotides containing nitrogenous base pairings at each nucleoside without any nitrogenous base mismatches.

Conjugate group refers to a group of atoms that is attached to a

Eight oligonucleotide. Conjugated groups include a conjugated moiety and a conjugated linker that joins the conjugated moiety to the oligonucleotide.

"Conjugate linker" means a group of atoms comprising at least one bond connecting a conjugated moiety to an oligonucleotide.

"Conjugated moiety" means a group of atoms that is attached to an oligonucleotide through a conjugated linker.

Contiguous, in the context of an oligonucleotide, refers to nucleosides, nitrogenous bases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" refers to nucleobases that are immediately adjacent to each other in a sequence.

Designing or designed for refers to the process of designing a compound that will specifically hybridize to a selected nucleic acid molecule.

Diluent means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically desirable or necessary. For example, the diluent in an injected composition can be a liquid, eg, saline.

Differently modified refers to chemical modifications or chemical substituents that are different from each other, including the absence of modifications. Thus, for example, an MOE nucleoside and an unmodified DNA-like nucleoside are differently modified even though the DNA-like nucleoside is unmodified. Similarly, DNA and RNA are modified differently even though both are naturally occurring unmodified nucleosides. Nucleosides that are the same except that they comprise different nitrogenous bases are not modified differently. For example, a nucleoside comprising a sugar modified with 2'-OMe and an unmodified adenine nitrogenous base and a nucleoside comprising a 2'-OMe modified sugar and an unmodified thymine nitrogenous base are not differently modified. .

Dose refers to a specified amount of a compound or pharmaceutical agent given in a single administration or over a specified period of time. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desirable, the desired dose may require a volume that is not readily accommodating in a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the compound or pharmaceutical agent is administered by infusion over a prolonged period of time or continuously. Doses can be defined as the amount of pharmaceutical agent per hour, day, week, or month.

Nine

A dosage regimen is a combination of doses designed to achieve one or more desired effects.

"Double-stranded antisense compound" refers to an antisense compound comprising two oligomeric compounds that are complementary to each other and that form a duplex, and where one of the two aforementioned oligomeric compounds comprises an oligonucleotide.

"Effective amount" refers to that amount of compound sufficient to exert a desired physiological result in an individual in need of the compound. The effective amount may vary between individuals depending on the physical and health status of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, the assessment of the individual's medical condition, and other relevant factors.

Efficacy refers to the ability to produce a desired effect.

Expression includes all the functions by which the information encoded by a gene is converted into structures present in and operating in a cell. Such structures include, without limitation, the products of transcription and translation.

"Gap oligomer" refers to an oligonucleotide comprising an internal region containing a plurality of nucleosides that participate in RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct. to the nucleoside or nucleosides comprising the outer regions. The inner region may be referred to as a hollow and the outer regions may be referred to as side segments.

Hybridization refers to the renaturation of oligonucleotides and/or nucleic acids. Although not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding, between complementary nitrogenous bases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a target nucleic acid.

"Immediately adjacent" means that there are no intermediate elements between immediately adjacent elements of the same type (eg, there are no intermediate nitrogenous bases between immediately adjacent nitrogenous bases).

"Immune checkpoint inhibitor" means an agent that inhibits the expression or activity of a protein that inhibits an immune response. In one embodiment, an immune checkpoint inhibitor is an agent that inhibits

Ten pathways of CTLA-4 or PD-1. Particular checkpoint inhibitors include antibodies that inhibit PD-1, PD-L1, or CTLA-4.

"Immunomodulatory agent" means an agent that enhances an immune response (eg, antitumor immune response). Exemplary immunomodulatory agents of the present disclosure include antibodies, such as an anti-CTLA-4 antibody, an anti-PD-L1 antibody, an anti-PD-1 antibody, and antigenic fragments of any of these and OX40 agonists, including proteins , such as OX40 ligand fusion protein, antibody against OX40 or fragments thereof. In one embodiment, the immunomodulatory agent is an immune checkpoint inhibitor.

Subject refers to a human or non-human animal selected for treatment or therapy.

"Inhibit expression or activity" refers to a reduction or blocking of expression or activity relative to expression or activity in a control or untreated sample and does not necessarily indicate a complete elimination of expression or activity.

Internucleoside linkage refers to a group or linkage that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. Modified internucleoside linkage refers to any internucleoside linkage that is not a naturally occurring phosphate-type internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.

Elongated oligonucleotides are those that contain one or more additional nucleosides compared to an oligonucleotide described herein, eg, a parent oligonucleotide.

"Linked nucleosides" refers to adjacent nucleosides linked together by an internucleoside linkage.

"Linker nucleoside" means a nucleoside that links an oligonucleotide to a conjugated moiety. Linker nucleosides are located within the conjugate linker of a compound. Linker nucleosides are not considered part of the oligonucleotide portion of a compound, even if they are contiguous with the oligonucleotide.

Mismatch or noncomplementary refers to a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, nitrogenous bases including, but not limited to, a universal nitrogenous base, inosine, and hypoxanthine are capable of hybridizing to at least one nitrogenous base, but still mismatch or are not complementary to the nitrogenous base to which they are hybridized. hybridize. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides align is a nucleobase with

Eleven mismatch or non-complementary.

Modular refers to changing or adjusting a feature in a cell, tissue, organ, or organism. For example, "modulating FOXP3 RNA" can refer to increasing or decreasing the level of FOXP3 RNA and/or FOXP3 protein in a cell, tissue, organ, or organism. A modulator effects change in the cell, tissue, organ, or organism. For example, a FOXP3 compound can be a modulator that reduces the amount of FOXP3 RNA and/or FOXP3 protein in a cell, tissue, organ, or organism.

MOE stands for methoxyethyl.

Monomer refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

"Motif" refers to the pattern of modified and/or unmodified sugar residues, nitrogenous bases, and/or internucleoside linkages, in an oligonucleotide.

Natural or of natural origin refers to being found in nature.

Modified non-bicyclic sugar or modified non-bicyclic sugar moiety means a sugar moiety that comprises a modification, such as a substituent, that does not bridge between two sugar atoms to form a second ring.

Nucleic acid refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

Nitrogenous base refers to a heterocyclic moiety capable of annealing to a base of another nucleic acid. As used herein, a naturally occurring nitrogenous base is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A modified nitrogenous base is a naturally occurring nitrogenous base that is chemically modified. A universal base or universal nitrogenous base is a nitrogenous base other than a naturally occurring nitrogenous base and a modified nitrogenous base and is capable of pairing with any nitrogenous base.

Nitrogenous base sequence means the order of contiguous nitrogenous bases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage.

Nucleoside refers to a compound comprising a nitrogenous base and a sugar moiety. The nitrogenous base and the rest of the sugar are, each independently, modified or unmodified. Modified nucleoside means a nucleoside comprising a modified nitrogenous base and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nitrogenous base.

Twelve

Oligomeric compound refers to a compound that comprises a single oligonucleotide and optionally one or more additional features, such as a conjugate group or end group.

Oligonucleotide refers to a polymer of linked nucleosides, each of which may be modified or unmodified, independently of one another. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides. Modified oligonucleotide means an oligonucleotide in which at least one sugar, nitrogenous base or internucleoside linkage is modified. Unmodified oligonucleotide means an oligonucleotide that does not comprise any sugar, nitrogenous base, or internucleoside modifications.

Parent oligonucleotide refers to an oligonucleotide whose sequence is used as the basis for designing further oligonucleotides of similar sequence but with different lengths, motifs, and/or chemical properties. Newly designed oligonucleotides may have the same sequence as the original oligonucleotide or an overlapping sequence.

Parenteral administration refers to administration by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, eg, intrathecal or intracerebroventricular administration.

Pharmaceutically acceptable carrier or diluent means any substance suitable for use in administration to an individual. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water for injection.

"Pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds, ie, salts that retain the desired biological activity of the parent compound and do not confer undesired toxicological effects on it.

Pharmaceutical agent refers to a compound that provides a therapeutic benefit when administered to an individual.

Pharmaceutical composition refers to a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition may comprise one or more compounds or a salt thereof and a sterile aqueous solution.

"Phosphorothioate linkage" means a modified phosphate linkage in which one of the non-bridged oxygen atoms is replaced by a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage.

"Phosphorus moiety" refers to a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorous moiety comprises a mono-, di-, or

Thirteen triphosphate, or phosphorothioate.

Portion refers to a defined number of contiguous (ie, linked) nitrogenous bases of a nucleic acid. In certain embodiments, a moiety is a defined number of contiguous nitrogenous bases of a target nucleic acid. In certain embodiments, a moiety is a defined number of contiguous nitrogenous bases of an oligomeric compound.

Prevent refers to delaying or anticipating the onset, development, or progression of a disease, disorder, or condition for a period of time ranging from minutes to indefinitely.

Prodrug means a compound in one form outside the body that, when administered to an individual, is metabolized to another form within the organism or cells thereof. In certain embodiments, the metabolized form is the active, or more active, form of the compound (eg, drug). Normally, the conversion of a prodrug within the organism is facilitated by the action of enzymes (eg, endogenous or viral enzymes) or chemical agents present in cells or tissues and/or by physiological conditions.

Reduce means to decrease to a lesser scope, size, amount, or number.

RefSeq# is a unique combination of letters and numbers assigned to a sequence to indicate that the sequence is for a particular target transcript (eg, target gene). Such sequence and information about the target gene (collectively, the record of the gene) can be found in a database of genetic sequences. Genetic sequence databases include the NCBI Reference Sequence Database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).

Region is defined as a portion of the target nucleic acid that contains at least one identifiable structure, function, or feature.

"RNAi compound" refers to an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and/or a protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimetics.

Segments are defined as subportions or smaller portions of regions in a nucleic acid.

Side effects refers to physiological conditions and/or diseases attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities,

Fourteen myopathies and malaise. For example, increased serum aminotransferase levels may indicate liver toxicity or abnormal liver function. For example, an increase in bilirubin may indicate liver toxicity or an abnormality in liver function.

Single-stranded, in reference to a compound, refers to the compound containing only one oligonucleotide. "Self-complementary" refers to an oligonucleotide that hybridizes at least partially to itself. A compound consisting of an oligonucleotide, where the compound oligonucleotide is self-complementary, is a single-stranded compound. A single chain compound may be capable of binding to a complementary compound to form a duplex.

Sites are defined as unique positions of nitrogenous bases in a target nucleic acid.

"Specifically hybridizable" refers to an oligonucleotide that has a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

To specifically inhibit, with reference to a target nucleic acid, means to reduce or block the expression of the target nucleic acid while exhibiting little, minimal, or no effects on non-target nucleic acids. The reduction does not necessarily indicate a complete elimination of the expression of the target nucleic acid.

Conventional cell assay means assays described in the examples and reasonable variations thereof.

Standard in vivo experiment means the procedures described in the examples and reasonable variations thereof.

Stereorandom chiral center, in the context of a population of molecules of identical molecular formula, means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be, but is not necessarily equal to, the number of molecules having the (R) configuration. of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a bond between stereorandom phosphorothioate nucleosides.

Sugar moiety means an unmodified sugar moiety or a modified sugar moiety. Unmodified sugar moiety or unmodified sugar means a 2'-OH(H) furanosyl moiety, as found in RNA (an unmodified RNA sugar moiety) or to a 2'-H(H) moiety , as found in DNA (a sugar moiety of unmodified DNA). Unmodified sugar residues

Fifteen contain one hydrogen each at the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. Modified sugar moiety or modified sugar means a modified furanosyl sugar moiety or a sugar substitute. Modified furanosyl sugar moiety means a furanosyl sugar comprising a non-hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain embodiments, a modified furanosyl sugar moiety is a 2'-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.

"Sugar substitute" refers to a modified sugar moiety that contains a non-furanosyl moiety that can attach a nitrogenous base to another group, such as an internucleoside linkage, conjugate group, or end group in an oligonucleotide. Modified nucleosides comprising sugar substitutes can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides have the ability to hybridize to complementary compounds or nucleic acids.

Synergistic or synergizing refers to an effect of a combination that is greater than the addition of the effects of each component separately at the same doses.

FOXP3 means any FOXP3 nucleic acid or protein. FOXP3 nucleic acid means any nucleic acid encoding FOXP3. For example, in certain embodiments, a FOXP3 nucleic acid includes a DNA sequence encoding FOXP3, an RNA sequence transcribed from a DNA encoding FOXP3 (including genomic DNA comprising introns and exons), and an mRNA sequence encodes FOXP3. "FOXP3 mRNA" means an mRNA encoding a FOXP3 protein. The target can be quoted in both upper and lower case.

"FOXP3-specific inhibitor" refers to any agent capable of specifically inhibiting the expression or activity of FOXP3 RNA and/or FOXP3 protein at the molecular level. For example, specific inhibitors of FOXP3 include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of FOXP3 RNA and/or FOXP3 protein.

"Target gene" refers to a gene that encodes a target.

Targeting means the specific hybridization of a compound to a target nucleic acid to induce a desired effect.

Target nucleic acid, target RNA, target RNA transcript, and target nucleic acid mean a nucleic acid that can be targeted by the compounds described herein.

"Target region" means a portion of a target nucleic acid that is targeted by one or more compounds.

Sixteen

"Target segment" means the nucleotide sequence of a target nucleic acid to which a compound is directed. "5' target site" refers to the nucleotide of a target segment closest to the 5' position. "3' target site" refers to the nucleotide of a target segment closest to the 3' position.

Terminal group refers to a chemical group or group of atoms that is covalently attached to one end of an oligonucleotide.

"Therapeutically effective amount" refers to an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.

"Treating" refers to administering a compound or pharmaceutical composition to an animal for the purpose of effecting an alteration or amelioration of a disease, disorder or condition in the animal.

CERTAIN EMBODIMENTS

Certain embodiments provide methods, compounds, and compositions for inhibiting FOXP3 expression.

Certain embodiments provide compounds that target a FOXP3 nucleic acid. In certain embodiments, the FOXP3 nucleic acid has the sequence set forth in RefSeq or GENBANK reference no. NM_014009.3 (SEQ ID NO: 1); NT_011568.12_TRUNC_11907130_11921808_COMP (SEQ ID NO: 2);

NM_001114377.1 (SEQ ID NO: 3);

NC_000023.11_TRUNC_49247001_49273000_C0MP (SEQ ID NO: 4); or UCSC reference no. UC064ZFP.1 corresponding to the genomic coordinates chrX:49,251,334-49,259,240 in the GRCh38/hg38 set (SEQ ID NO: 5); each of which is incorporated by reference in its entirety. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single chain. In certain embodiments, the compound is double-stranded.

Certain embodiments provide a compound comprising a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single chain. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide from 9 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, the compound is an antisense compound or a

Seventeen oligomeric compound. In certain embodiments, the compound is single chain. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide of 10 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single chain. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide from 11 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single chain. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 11 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide from 12 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single chain. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 12 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide of 16 to 80 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single chain. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NO: 9-3246. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single chain. In certain embodiments, the compound is double-stranded.

Eighteen In certain embodiments, a compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a portion of 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nitrogenous bases complementary to a portion of equal length at nucleotides 2269-2284 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a portion of 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nitrogenous bases complementary to a portion of equal length at nucleotides 1233-1248, 2156-2171, 2735-2750, 4661-4676, 7307-7322, 7331-7346, 7980-7995, 11581-11596, or 12396-12411 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and complementary to a portion of equal length at nucleotides 2269-2284 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide is from 10 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide 8 to 80 linked nucleosides in length and complementary to nucleotides 1233-1248, 2156-2171, 2735-2750, 4661-4676, 7307-7322, 7331-7346, 7980-7995. , 11581-11596, or 12396-12411 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a sequence of nitrogenous bases comprising at least a portion of 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nitrogenous bases from any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length . In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length and having a sequence of nitrogenous bases comprising any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

Nineteen·

In certain embodiments, a compound comprises a modified oligonucleotide 16 linked nucleosides in length having a sequence of nitrogenous bases consisting of any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575.

In certain embodiments, a compound targeting FOXP3 is ION 1063734. Of the more than 3,000 compounds that were tested as described in the Examples section below, ION 1062428, 1062641, 1062835, 1062937, 1063268, 1063649, 1063655, 1063734 , 1064096, or 1064313 emerged as the top most prominent compounds.

In certain embodiments, any of the above modified oligonucleotides comprises at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nitrogenous base.

In certain embodiments, any of the above modified oligonucleotides comprise at least one modified sugar. In certain embodiments, at least one modified sugar comprises a 2'-O-methoxyethyl group. In certain embodiments, at least one modified sugar is a bicyclic sugar such as a 4'-CH(CH3)-O-2' group, a 4'-CH2-O-2' group, or a 4'-(CH2) group. 2-O-2'.

In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage such as a phosphorothioate internucleoside linkage.

In certain embodiments, any of the above modified oligonucleotides comprise at least one modified nitrogenous base such as 5-methylcytosine.

In certain embodiments, any of the above modified oligonucleotides comprise:

a gap segment made up of linked deoxynucleosides;

a 5' side segment made up of linked nucleosides; and a 3' side segment made up of linked nucleosides;

wherein the gap segment is located between the 5' side segment and the 3' side segment and where each nucleoside in each side segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 16 to 80 linked nucleosides in length having a sequence of nitrogenous bases comprising the sequence set forth in any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511 , 1755, 2492, or 2575. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length having a sequence of nitrogenous bases comprising the sequence set forth in any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511 , 1755, 2492, or 2575. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length having a sequence of nitrogenous bases consisting of the

Twenty sequence indicated in any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 16-80 linked nucleobases in length having a sequence of nucleobases comprising the sequence set forth in any one of SEQ ID NO: 9-3246, wherein the oligonucleotide modified includes:

a gap segment made up of linked deoxynucleosides;

a 5' side segment made up of linked nucleosides; and a 3' side segment made up of linked nucleosides;

wherein the gap segment is located between the 5' side segment and the 3' side segment and where each nucleoside in each side segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 16-80 linked nucleobases in length having a sequence of nucleobases comprising the sequence set forth in any one of SEQ ID NO: 449, 501, 544, 794 , 1293, 1307, 1511, 1755, 2492, or 2575, wherein the modified oligonucleotide comprises:

a gap segment made up of linked deoxynucleosides;

a 5' side segment made up of linked nucleosides; and a 3' side segment made up of linked nucleosides;

wherein the gap segment is located between the 5' side segment and the 3' side segment and where each nucleoside in each side segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 16-80 linked nucleobases in length having a sequence of nucleobases comprising the sequence set forth in any one of SEQ ID NO: 449, 501, 544, 794 , 1293, 1307, 1511, 1755, 2492, or 2575, wherein the modified oligonucleotide comprises:

a gap segment made up of ten linked deoxynucleosides;

a 5' side segment consisting of three linked nucleosides; and a 3' side segment consisting of three linked nucleosides;

wherein the gap segment is located between the 5' side segment and the 3' side segment, wherein each nucleoside of each side segment comprises a

Twenty-one cEt; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 16-80 linked nucleobases in length having a sequence of nucleobases comprising the sequence set forth in SEQ ID NO: 449, wherein the modified oligonucleotide comprises:

a gap segment made up of ten linked deoxynucleosides;

a 5' side segment consisting of three linked nucleosides; and a 3' side segment consisting of three linked nucleosides;

wherein the gap segment is located between the 5' side segment and the 3' side segment, wherein each nucleoside in each side segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

In certain embodiments, a compound comprises or consists of ION 1063734 or a salt thereof having the following chemical structure:

<img file="ECSP21040508A_D0001.tif" />

Twenty two

In certain embodiments, a compound comprises or consists of the sodium salt of ION 1063734, which has the following chemical structure:

<img file="ECSP21040508A_D0002.tif" />

In any of the above embodiments, the compound or oligonucleotide may exhibit a complementarity of at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% with respect to to a nucleic acid encoding FOXP3.

In any of the above embodiments, the compound may be single chain. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound.

In any of the above embodiments, the compound can be 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30 , from 15 to 50, from 16 to 30, from 16 to 50, from 17 to 30, from 17 to 50, from 18 to 22, from 18 to 24, from 18 to 30, from 18 to 50, from 19 to 22 , 19 to 30, 19 to 50, or 20 to 30 linked nucleosides in length. In certain embodiments, the compound comprises or consists of an oligonucleotide.

In certain embodiments, the compounds or compositions provided herein comprise a salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

Twenty three

In certain embodiments, the compounds or compositions described herein are very well tolerated, as demonstrated by exhibiting at least one of the following increases: an increase in alanine transaminase (ALT) or aspartate transaminase (AST) not greater than 4-fold, 3-fold, or 2-fold relative to saline-treated animals or an increase in liver, spleen, or liver weights kidney not more than 30%, 20%, 15%, 12%, 10%, 5% or 2% compared to animals treated with a control. In certain embodiments, the compounds or compositions described herein are very well tolerated, as demonstrated by no increase in ALT or AST relative to animals treated with a control. In certain embodiments, the compounds or compositions described herein are very well tolerated, as demonstrated by no increase in liver, spleen, or kidney weights relative to control animals.

Certain embodiments provide a composition comprising the compound of any of the aforementioned embodiments or a salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity of less than about 40 centipoise (cP), less than about 30 centipoise (cP), less than about 20 centipoise (cP), less than about 15 centipoise (cP), or less than about 10 centipoise (cP). In certain embodiments, the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 100 mg/ml, about 125 mg/ml, about 150 mg/ml, about 175 mg/ml, about 200 mg/ml, about 225 mg/ml, about 250 mg/ml, about 275 mg/ml, or about 300 mg/ml. In certain embodiments, the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature or about 20°C, about 21°C, about 22°C, about 23°C, about 24 °C, approximately 25°C, approximately 26°C, approximately 27°C, approximately 28°C, approximately 29°C or approximately 30°C.

CERTAIN INDICATIONS

Certain embodiments provided herein are directed to methods of inhibiting FOXP3 expression, which may be useful in treating, preventing, or ameliorating cancer in an individual, by administration of a compound that targets FOXP3. In certain embodiments, the compound can be a specific inhibitor of FOXP3. In certain embodiments, the compound can be an antisense compound, an oligomeric compound, or an oligonucleotide targeting FOXP3.

Examples of cancers that can be treated, prevented, and/or ameliorated with the compounds and methods provided herein include

Twenty-four FOXP3 Treg-positive cancers (FOXP3+) in the microenvironment or stromal or tumor-draining lymph nodes, lung cancer, non-small cell lung carcinoma (NSCLC), small cell lung carcinoma (SCLC), squamous cell carcinoma (SCC) , head and neck cancer, head and neck squamous cell carcinoma (HNSCC), gastrointestinal cancer, large intestine cancer, small intestine cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, hepatocellular carcinoma (HCC), esophageal cancer, pancreatic cancer, bile duct cancer, gastric cancer, urothelial cancer, breast cancer, triple negative breast cancer (TNBC), ovarian cancer, cancer endometrial cancer, cervical cancer, prostate cancer, mesothelioma, sarcomas (for example, epithelioid, rhabdoid, and synovial), chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, hematologic cancer, hematopoietic cancer, myeloma, multiple myeloma (MM), B-cell malignancies, lymphoma, B-cell lymphoma, Hodgkin's lymphoma, lymphoma of T lymphocytes, leukemia, or acute lymphocytic leukemia (ALL).

In certain embodiments, the B cell lymphoma is a B cell non-Hodgkin lymphoma. Examples of B-cell non-Hodgkin lymphoma that can be treated with compounds provided herein include, but are not limited to, diffuse large B-cell lymphoma (DLBCL), activated B-cell lymphoma (ABC-DLBCL), B-cell lymphoma Germinal center lymphoma (GCB-DLBCL), follicular lymphoma, mucosa-associated lymphatic tissue lymphoma (MALT), small lymphocytic lymphoma, chronic lymphocytic leukemia, mantle cell lymphoma (MCL), Burkitt lymphoma, mediastinal large B-cell lymphoma, Waldenstrom macroglobulinemia, nodal marginal zone B-cell lymphoma (NMZL), splenic marginal zone lymphoma (SMZL), intravascular large B-cell lymphoma, primary effusion lymphoma, and lymphomatoid granulomatosis.

In certain embodiments, T-cell lymphoma that can be treated with the compounds provided herein includes, but is not limited to, peripheral T-cell lymphoma and anaplastic large cell lymphoma (ALCL).

In certain embodiments, the leukemia that can be treated with the compounds provided herein includes, but is not limited to, acute lymphocytic leukemia (ALL).

In certain embodiments, the breast cancer has one or more of the following characteristics: it is androgen receptor positive, it is androgen dependent for its growth; it is negative for the estrogen receptor (ER), it does not depend on estrogens for its growth; it is negative for the progesterone receptor, it does not depend on progesterone for its growth; or is negative for Her2/neu. In certain embodiments, the breast cancer is triple negative for ER, PR, and HER2 (ER-, PR-, HER2-). In certain embodiments, the breast cancer is triple negative and AR positive (ER-, PR-, HER2-, AR+). In certain embodiments, breast cancer is negative for

Twenty-fiveER and positive for AR (ER-, AR+). In certain embodiments, the breast cancer is ER-positive and AR-positive (ER+, AR+). In certain embodiments, the breast cancer is apocrine. Apocrine breast cancers are usually triple negative, meaning the cells do not express ER, PR, or HER2 receptors and are usually, but not necessarily, positive for RA. In certain embodiments, an apocrine breast cancer is triple negative for ER, PR and HER2 and positive for AR (ER-, PR-, HER2-, AR+). In certain embodiments, an apocrine breast cancer is ER negative and AR positive (ER-, AR+). In certain embodiments, an apocrine breast cancer originates from the sweat gland of the breast. In certain embodiments, an apocrine breast cancer is a ductal cancer or a cancer cell of the breast. In certain embodiments, an apocrine breast cancer may exhibit any one or more of the following features: a large amount of eosinophilic granular cytoplasm, well-defined margins, large vesicular nuclei, a nuclear to cytoplasmic ratio of approximately 1:2, and/or or accumulations of secreted granules in the apical cytoplasm that are known as apical snouts. In certain embodiments, the breast cancer is an ER-negative, AR-positive (ER-, AR+) molecular apocrine breast cancer. In certain aspects, an ER-negative, AR-positive (ER-, AR+) molecular apocrine breast cancer may further be PR-positive, PR-negative, HER2-negative, or HER2-positive. In certain embodiments, the breast cancer is HER2 positive. In certain embodiments, the breast cancer is PR-positive. In certain embodiments, the breast cancer is ER-positive. Breast cancer can be identified as positive or negative for hormone receptors, such as ER, PR, or HER2, by standard histological techniques. For example, in some embodiments, histology samples of breast cancer can be classified as triple negative (ER-, PR-, HER2-) when less than 1% of the cells demonstrate nuclear staining for estrogen and progesterone receptors and the Immunohistochemical staining for HER2 shows a 0-fold, 1-fold, or 2-fold positive score and a FISH ratio (HER2 gene signals to chromosome 17 signals) of less than 1.8 according to the relevant ASCO and CAP guidelines. (Meyer, P. et al., PLoS ONE 7(5): e38361 (2012)).

In certain embodiments, a method of treating, preventing, or ameliorating cancer in an individual comprises administering to the individual a compound comprising a specific FOXP3 inhibitor, thereby treating, preventing, or ameliorating cancer. In certain embodiments, the compound comprises an antisense compound directed to FOXP3. In certain embodiments, the compound comprises an oligonucleotide targeting FOXP3. In certain embodiments, a compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, a compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NO:

twenty six

9-3246. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, a compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length having a sequence of nitrogenous bases comprising any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755 , 2492, or 2575. In certain embodiments, a compound comprises a modified oligonucleotide having a sequence of nitrogenous bases consisting of any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575. In In any of the above embodiments, the modified oligonucleotide can be from 10 to 30 linked nucleosides in length. In certain embodiments, the compound is ION 1062428, 1062641, 1062835, 1062937, 1063268, 1063649, 1063655, 1063734, 1064096, or 1064313. In any of the above embodiments, the compound may be single-chain or double-chain. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administration of the compound inhibits or reduces immunosuppression, Treg immunosuppressive activity, cancer cell proliferation, tumor growth, or metastasis. In certain embodiments, administration of the compounds induces or activates anticancer or antitumor immunity; the anticancer or antitumor immune response; activation or infiltration of immune cells; activation or infiltration of inflammatory cells; activation or infiltration of effector immune cells; activation or infiltration of T lymphocytes; activation or infiltration of CD8 T lymphocytes; NK cell activation or infiltration; activation or infiltration of macrophages and dendritic cells; the inflammation; or the expression of inflammatory cytokines or chemokines.

In certain embodiments, a method of inhibiting FOXP3 expression in an individual who has or is at risk of cancer comprises administering to the individual a compound comprising a specific FOXP3 inhibitor, thereby inhibiting FOXP3 expression in the individual. individual. In certain embodiments, administration of the compound inhibits FOXP3 expression in Treg cells, tumor microenvironment, tumor stroma, Treg-infiltrated tumors, immune cells, lymphoid tissue, lymph nodes, or Foxp3+ intratumor cells. In certain embodiments, the individual has or is at risk of having a FOXP3 Treg-positive (FOXP3+) cancer in the microenvironment or stromal or tumor-draining lymph nodes, lung cancer, non-small cell lung carcinoma (NSCLC ), small cell lung carcinoma (SCLC), squamous cell carcinoma (SCC), head and neck cancer, head and neck squamous cell carcinoma (HNSCC), gastrointestinal cancer, large intestine cancer, small intestine cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, hepatocellular carcinoma (HCC), esophageal cancer, pancreatic cancer, bile duct cancer, gastric cancer, urothelial cancer, breast, triple negative breast cancer (TNBC), ovarian cancer, endometrial cancer, cervical cancer,

Twenty-seven prostate cancer, mesothelioma, sarcomas (eg, epithelioid, rhabdoid, and synovial), chordoma, kidney cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma , Merkel cell carcinoma, hematologic cancer, hematopoietic cancer, myeloma, multiple myeloma (MM), B-cell malignancies, lymphoma, B-cell lymphoma, Hodgkin lymphoma, T-cell lymphoma, leukemia or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound directed to FOXP3. In certain embodiments, the compound comprises an oligonucleotide targeting FOXP3. In certain embodiments, the compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length having a sequence of nitrogenous bases comprising any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755 , 2492, or 2575. In certain embodiments, the compound comprises a modified oligonucleotide having a sequence of nitrogenous bases consisting of any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575. In In any of the above embodiments, the modified oligonucleotide can be from 10 to 30 linked nucleosides in length. In certain embodiments, the compound is ION 1062428, 1062641, 1062835, 1062937, 1063268, 1063649, 1063655, 1063734, 1064096, or 1064313. In any of the above embodiments, the compound may be single-chain or double-chain. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administration of the compound inhibits or reduces immunosuppression, Treg immunosuppressive activity, cancer cell proliferation, tumor growth, or metastasis. In certain embodiments, administration of the compounds induces or activates anticancer or antitumor immunity; the anticancer or antitumor immune response; activation or infiltration of immune cells; activation or infiltration of inflammatory cells; activation or infiltration of effector immune cells; activation or infiltration of T lymphocytes; activation or infiltration of CD8 T lymphocytes; NK cell activation or infiltration; activation or infiltration of macrophages and dendritic cells; the inflammation; or the expression of inflammatory cytokines or chemokines. In certain embodiments, the individual is identified as having, or at risk of having, cancer.

In certain embodiments, a method of inhibiting the expression of FOXP3 in a

Twenty Eighth Cell comprises contacting the cell with a compound comprising a specific inhibitor of FOXP3, thereby inhibiting the expression of FOXP3 in the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a Treg cell, tumor microenvironment cell, tumor stromal cell, tumor-infiltrating Treg cell, immune cell, lymphoid cell, lymph node cell, or Foxp3+ intratumoral cell. In certain embodiments, the cell is found in the tumor microenvironment, tumor stroma, or a lymph node of an individual who has or is at risk for cancer. In certain embodiments, the cancer is a FOXP3 Treg-positive (FOXP3+) cancer in the microenvironment or the stromal or tumor-draining lymph nodes, lung cancer, non-small cell lung carcinoma (NSCLC), small cell lung carcinoma ( SCLC), squamous cell carcinoma (SCC), head and neck cancer, head and neck squamous cell carcinoma (HNSCC), gastrointestinal cancer, large intestine cancer, small intestine cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, hepatocellular carcinoma (HCC), esophageal cancer, pancreatic cancer, bile duct cancer, gastric cancer, urothelial cancer, breast cancer, triple negative breast cancer (TNBC), cancer of the ovarian, endometrial cancer, cervical cancer, prostate cancer, mesothelioma, sarcomas (for example, epithelioid, rhabdoid, and synovial), chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, Merkel cell carcinoma, hematologic cancer, hematopoietic cancer, myeloma, multiple myeloma (MM), B-cell malignancies, lymphoma, B-cell lymphoma, Hodgkin lymphoma, T-cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound directed to FOXP3. In certain embodiments, the compound comprises an oligonucleotide targeting FOXP3. In certain embodiments, the compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length having a sequence of nitrogenous bases comprising any one of SEQ ID NO: 449, 501,544, 794, 1293, 1307, 1511, 1755, 2492 , or 2575. In certain embodiments, the compound comprises a modified oligonucleotide having a sequence of nitrogenous bases consisting of any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575. In any of the above embodiments, the modified oligonucleotide can have from 10 to 30

Twenty-nine linked nucleosides in length. In certain embodiments, the compound is ION 1062428, 1062641, 1062835, 1062937, 1063268, 1063649, 1063655, 1063734, 1064096, or

1064313. In any of the above embodiments, the compound can be single-chain or double-chain. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound.

In certain embodiments, a method of reducing or inhibiting immunosuppression, Treg immunosuppressive activity, cancer cell proliferation, tumor growth, or metastasis in an individual having or at risk for cancer comprises administering to the individual a compound comprising a specific inhibitor of FOXP3, thereby reducing or inhibiting immunosuppression, Treg immunosuppressive activity, cancer cell proliferation, tumor growth or metastasis in the individual. In certain embodiments, a method of inducing or activating anti-cancer or anti-tumor immunity; the anticancer or antitumor immune response; activation or infiltration of immune cells; activation or infiltration of inflammatory cells; activation or infiltration of immune effector cells; activation or infiltration of T lymphocytes; activation or infiltration of CD8 T lymphocytes; NK cell activation or infiltration; activation or infiltration of macrophages and dendritic cells; or the expression of inflammatory cytokines or chemokines in an individual who has or is at risk of cancer comprises administering to the individual a compound comprising a specific inhibitor of FOXP3. In certain embodiments, the individual has or is at risk of having a FOXP3 Treg-positive (FOXP3+) cancer in the microenvironment or stromal or tumor-draining lymph nodes, lung cancer, non-small cell lung carcinoma (NSCLC ), small cell lung carcinoma (SCLC), squamous cell carcinoma (SCC), head and neck cancer, head and neck squamous cell carcinoma (HNSCC), gastrointestinal cancer, large intestine cancer, small intestine cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, hepatocellular carcinoma (HCC), esophageal cancer, pancreatic cancer, bile duct cancer, gastric cancer, urothelial cancer, breast, triple negative breast cancer (TNBC), ovarian cancer, endometrial cancer, cervical cancer, prostate cancer, mesothelioma, sarcomas (for example, epithelioid, rhabdoid and synovial), chordoma, renal cancer, Renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, Merkel cell carcinoma, hematologic cancer, hematopoietic cancer, myeloma, multiple myeloma (MM), malignancies of B cells, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound directed to FOXP3. In certain embodiments, the compound comprises an oligonucleotide targeting FOXP3. In certain embodiments, the compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. in certain

Thirty embodiments, the compound comprises a modified oligonucleotide 16 to 80 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length having a sequence of nitrogenous bases comprising any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755 , 2492, or 2575. In certain embodiments, the compound comprises a modified oligonucleotide having a sequence of nitrogenous bases consisting of any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575. In In any of the above embodiments, the modified oligonucleotide can be from 10 to 30 linked nucleosides in length. In certain embodiments, the compound is ION 1062428, 1062641, 1062835, 1062937, 1063268, 1063649, 1063655, 1063734, 1064096, or 1064313. In any of the above embodiments, the compound may be single-chain or double-chain. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having, or at risk of having, cancer.

Certain embodiments are directed to a compound comprising a specific inhibitor of FOXP3 for use in the treatment of cancer. In certain embodiments, the cancer is a cancer that is FOXP3-positive (FOXP3+) Tregs in the microenvironment or the stroma or tumor-draining lymph nodes, lung cancer, non-small cell lung carcinoma (NSCLC), small cell lung carcinoma (SCLC), squamous cell carcinoma (SCC), head and neck cancer, head and neck squamous cell carcinoma (HNSCC), gastrointestinal cancer, large intestine cancer, small intestine cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, hepatocellular carcinoma (HCC), esophageal cancer, pancreatic cancer, bile duct cancer, gastric cancer, urothelial cancer, breast cancer, triple negative breast cancer (TNBC ), ovarian cancer, endometrial cancer, cervical cancer, prostate cancer, mesothelioma, sarcomas (for example, epithelioid, rhabdoid, and synovial), chordoma, kidney cancer, renal cell carcinoma (RCC), brain cancer , neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, Merkel cell carcinoma, hematologic cancer, hematopoietic cancer, myeloma, multiple myeloma (MM), B-cell malignancies, lymphoma, B-cell lymphoma, lymphoma of Hodgkin's, T-cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound directed to FOXP3. In certain embodiments, the compound comprises an oligonucleotide targeting FOXP3. In certain embodiments, the compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases from any of the sequences

Thirty-one nitrogenous bases of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length having a sequence of nitrogenous bases comprising any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755 , 2492, or 2575. In certain embodiments, the compound comprises a modified oligonucleotide having a sequence of nitrogenous bases consisting of any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575. In In any of the above embodiments, the modified oligonucleotide can be from 10 to 30 linked nucleosides in length. In certain embodiments, the compound is ION 1062428, 1062641, 1062835, 1062937, 1063268, 1063649, 1063655, 1063734, 1064096, or 1064313. In any of the above embodiments, the compound may be single-chain or double-chain. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound.

Certain embodiments are directed to a compound comprising a specific inhibitor of FOXP3 for use in reducing or inhibiting immunosuppression, Treg immunosuppressive activity, cancer cell proliferation, tumor growth, or metastasis in an individual having cancer. . Certain embodiments are directed to a compound comprising a FOXP3 inhibitor for use in inducing or activating anticancer or antitumor immunity; the anticancer or antitumor immune response; activation or infiltration of immune cells; activation or infiltration of inflammatory cells; activation or infiltration of effector immune cells; activation or infiltration of T lymphocytes; activation or infiltration of CD8 T lymphocytes; NK cell activation or infiltration; activation or infiltration of macrophages and dendritic cells; the inflammation; or the expression of inflammatory cytokines or chemokines in an individual having cancer. In certain embodiments, the cancer is a cancer that is FOXP3-positive (FOXP3+) Tregs in the microenvironment or the stroma or tumor-draining lymph nodes, lung cancer, non-small cell lung carcinoma (NSCLC), small cell lung carcinoma (SCLC), squamous cell carcinoma (SCC), head and neck cancer, head and neck squamous cell carcinoma (HNSCC), gastrointestinal cancer, large intestine cancer, small intestine cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, hepatocellular carcinoma (HCC), esophageal cancer, pancreatic cancer, bile duct cancer, gastric cancer, urothelial cancer, breast cancer, triple negative breast cancer (TNBC ), ovarian cancer, endometrial cancer, cervical cancer, prostate cancer, mesothelioma, sarcomas (for example, epithelioid, rhabdoid, and synovial), chordoma, kidney cancer, renal cell carcinoma (RCC), brain cancer , neuroblastoma, glioblastoma,

Thirty-Give Skin Cancer, Melanoma, Basal Cell Carcinoma, Merkel Cell Carcinoma, Hematologic Cancer, Hematopoietic Cancer, Myeloma, Multiple Myeloma (MM), B-Cell Malignancies, Lymphoma, B-Cell Lymphoma, Hodgkin's Lymphoma , T-cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound directed to FOXP3. In certain embodiments, the compound comprises an oligonucleotide targeting FOXP3. In certain embodiments, the compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length having a sequence of nitrogenous bases comprising any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755 , 2492, or 2575. In certain embodiments, the compound comprises a modified oligonucleotide having a sequence of nitrogenous bases consisting of any one of SEQ ID NO: 449, 501,544, 794, 1293, 1307, 1511, 1755, 2492, or 2575. In any of In the above embodiments, the modified oligonucleotide can be from 10 to 30 linked nucleosides in length. In certain embodiments, the compound is ION 1062428, 1062641, 1062835, 1062937, 1063268, 1063649, 1063655, 1063734, 1064096, or 1064313. In any of the above embodiments, the compound can be single-chain or double-chain. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound.

Certain embodiments refer to the use of a compound comprising a specific FOXP3 inhibitor for the manufacture or preparation of a medicament for treating cancer. Certain embodiments refer to the use of a compound comprising a specific FOXP3 inhibitor for the preparation of a medicament for treating cancer. In certain embodiments, the cancer is a cancer that is FOXP3-positive (FOXP3+) Tregs in the microenvironment or the stroma or tumor-draining lymph nodes, lung cancer, non-small cell lung carcinoma (NSCLC), small cell lung carcinoma (SCLC), squamous cell carcinoma (SCC), head and neck cancer, head and neck squamous cell carcinoma (HNSCC), gastrointestinal cancer, large intestine cancer, small intestine cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, hepatocellular carcinoma (HCC), esophageal cancer, pancreatic cancer, bile duct cancer, gastric cancer, urothelial cancer, breast cancer, triple negative breast cancer (TNBC ), ovarian cancer, endometrial cancer, cervical cancer, prostate cancer,

Thirty-three mesothelioma, sarcomas (eg, epithelioid, rhabdoid, and synovial), chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, carcinoma Merkel cell tumor, hematologic cancer, hematopoietic cancer, myeloma, multiple myeloma (MM), B-cell malignancies, lymphoma, B-cell lymphoma, Hodgkin lymphoma, T-cell lymphoma, leukemia or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound directed to FOXP3. In certain embodiments, the compound comprises an oligonucleotide targeting FOXP3. In certain embodiments, the compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length having a sequence of nitrogenous bases comprising any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755 , 2492, or 2575. In certain embodiments, the compound comprises a modified oligonucleotide having a sequence of nitrogenous bases consisting of any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575. In In any of the above embodiments, the modified oligonucleotide can be from 10 to 30 linked nucleosides in length. In certain embodiments, the compound is ION 1062428, 1062641, 1062835, 1062937, 1063268, 1063649, 1063655, 1063734, 1064096, or 1064313. In any of the above embodiments, the compound may be single-chain or double-chain. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound.

Certain embodiments relate to the use of a compound comprising a specific FOXP3 inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting immunosuppression, Treg immunosuppressive activity, cancer cell proliferation, tumor growth, or metastasis in an individual who has cancer. Certain embodiments refer to the use of a compound comprising a FOXP3 inhibitor for the manufacture or preparation of a medicament for inducing or activating anticancer or antitumor immunity; the anticancer or antitumor immune response; activation or infiltration of immune cells; activation or infiltration of inflammatory cells; activation or infiltration of effector immune cells; activation or infiltration of T lymphocytes; activation or infiltration of CD8 T lymphocytes; NK cell activation or infiltration; activation or infiltration of macrophages and dendritic cells; the inflammation; or the expression of inflammatory cytokines or chemokines in a

Thirty-four individual who has cancer. In certain embodiments, the cancer is a cancer that is FOXP3-positive (FOXP3+) Tregs in the microenvironment or the stroma or tumor-draining lymph nodes, lung cancer, non-small cell lung carcinoma (NSCLC), small cell lung carcinoma (SCLC), squamous cell carcinoma (SCC), head and neck cancer, head and neck squamous cell carcinoma (HNSCC), gastrointestinal cancer, large intestine cancer, small intestine cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, hepatocellular carcinoma (HCC), esophageal cancer, pancreatic cancer, bile duct cancer, gastric cancer, urothelial cancer, breast cancer, triple negative breast cancer (TNBC ), ovarian cancer, endometrial cancer, cervical cancer, prostate cancer, mesothelioma, sarcomas (for example, epithelioid, rhabdoid, and synovial), chordoma, kidney cancer, renal cell carcinoma (RCC), brain cancer , neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, Merkel cell carcinoma, hematologic cancer, hematopoietic cancer, myeloma, multiple myeloma (MM), B-cell malignancies, lymphoma, B-cell lymphoma, lymphoma of Hodgkin's, T-cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound directed to FOXP3. In certain embodiments, the compound comprises an oligonucleotide targeting FOXP3. In certain embodiments, the compound comprises a modified oligonucleotide from 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 9- 3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a modified oligonucleotide from 16 to 80 linked nucleosides in length having a sequence of nitrogenous bases comprising any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755 , 2492, or 2575. In certain embodiments, the compound comprises a modified oligonucleotide having a sequence of nitrogenous bases consisting of any one of SEQ ID NO: 449, 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575. In In any of the above embodiments, the modified oligonucleotide can be from 10 to 30 linked nucleosides in length. In certain embodiments, the compound is ION 1062428, 1062641, 1062835, 1062937, 1063268, 1063649, 1063655, 1063734, 1064096, or 1064313. In any of the above embodiments, the compound may be single-chain or double-chain. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound.

In any of the above methods or uses, the compound can be targeted to FOXP3. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example, a modified oligonucleotide from 8 to 80

Thirty-five linked nucleosides in length, 10 to 30 linked nucleosides in length, 12 to 30 linked nucleosides in length, or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nitrogenous base sequences set forth in SEQ ID NO: 1-5. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nitrogenous base. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a 2'-O-methoxyethyl or bicyclic sugar, and the modified nitrogenous base is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment made up of linked deoxynucleosides; a 5' side segment made up of linked nucleosides; and a 3' flank segment made up of linked nucleosides, wherein the gap segment is located immediately adjacent to and between the 5' flank segment and the 3' flank segment and where each nucleoside in each flank segment comprises a modified sugar.

In any of the above embodiments, the modified oligonucleotide can be from 12 to 30, from 15 to 30, from 15 to 25, from 15 to 24, from 16 to 24, from 17 to 24, from 18 to 24, from 19 to 24, from 20 to 24, from 19 to 22, from 20 to 22, from 16 to 20 or 17 or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nitrogenous base sequences set forth in SEQ ID NO: 1-5. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside bond, at least one modified sugar, and/or at least one modified nitrogenous base. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a 2'-O-methoxyethyl or bicyclic sugar, and the modified nitrogenous base is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment made up of 2'-linked deoxynucleosides; a 5' side segment made up of linked nucleosides; and a 3' flank segment made up of linked nucleosides, wherein the gap segment is located immediately adjacent to and between the 5' flank segment and the 3' flank segment and where each nucleoside in each flank segment comprises a modified sugar.

In any of the above methods or uses, the compound may comprise or consist of a modified oligonucleotide from 16 to 80 linked nucleosides in length and having a sequence of nitrogenous bases comprising any one of SEQ ID NO: 9-3246, where the modified oligonucleotide comprises:

a gap segment made up of linked 2'-deoxynucleosides;

a 5' side segment made up of linked nucleosides; and a 3' side segment made up of linked nucleosides;

wherein the gap segment is located between the 5' side segment and the

Thirty-six 3' lateral segment and where each nucleoside of each lateral segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

In any of the above methods or uses, the compound may comprise or consist of a modified oligonucleotide 16-80 ligated nucleobases in length having a sequence of nucleobases comprising the sequence indicated in any one of SEQ ID NO: 449 , 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575, wherein the modified oligonucleotide comprises:

a gap segment made up of linked deoxynucleosides;

a 5' side segment made up of linked nucleosides; and a 3' side segment made up of linked nucleosides;

wherein the gap segment is located between the 5' side segment and the 3' side segment and where each nucleoside in each side segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

In any of the above methods or uses, the compound may comprise or consist of a modified oligonucleotide 16-80 ligated nucleobases in length having a sequence of nucleobases comprising the sequence indicated in any one of SEQ ID NO: 449 , 501, 544, 794, 1293, 1307, 1511, 1755, 2492, or 2575, wherein the modified oligonucleotide comprises:

a gap segment made up of ten linked deoxynucleosides;

a 5' side segment consisting of three linked nucleosides; and a 3' side segment consisting of three linked nucleosides;

wherein the gap segment is located between the 5' side segment and the 3' side segment, wherein each nucleoside in each side segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 16-80 linked nucleobases in length having a sequence of nucleobases comprising the sequence set forth in SEQ ID NO: 449, wherein the modified oligonucleotide comprises:

a gap segment made up of ten linked deoxynucleosides;

a 5' side segment consisting of three linked nucleosides; and

Thirty-seven a 3' lateral segment consisting of three linked nucleosides;

wherein the gap segment is located between the 5' side segment and the 3' side segment, wherein each nucleoside in each side segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

In any of the above methods or uses, the compound may comprise or consist of ION 1063734 or a salt thereof, having the following chemical structure:

<img file="ECSP21040508A_D0003.tif" />

In any of the above methods or uses, the compound may comprise or consist of ION 1063734, which has the following chemical structure:

<img file="ECSP21040508A_D0004.tif" />

In any of the above methods or uses, the compound can be administered parenterally. For example, in certain embodiments, the compound can be administered by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, eg, intrathecal or intracerebroventricular administration.

CERTAIN COMBINATIONS AND COMBINATION THERAPIES

In certain embodiments, a first agent comprising a compound described herein is administered together with one or more secondary agents. In certain embodiments, said second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, said second agents are designed to treat a different disease, disorder, or condition than the first agent described herein. In certain embodiments, a first agent is designed to treat an unwanted side effect of a second agent. In certain embodiments, the second agents are co-administered with the first agent to treat an unwanted effect of the first agent. In certain embodiments, said second agents are designed to treat an unwanted side effect of one or more of the pharmaceutical compositions described herein. In certain embodiments, the second agents are co-administered with the first agent to produce a combined effect. in certain

Thirty-nine embodiments, the second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, co-administration of the first and second agents allows the use of lower doses than would be necessary to achieve a therapeutic or prophylactic effect if the agents were administered as stand-alone therapy.

In certain embodiments, one or more compounds or compositions provided herein are administered together with one or more secondary agents. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents are prepared in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents are prepared separately.

In certain embodiments, a secondary agent is selected from: innate immune cell activators, including, but not limited to, TLR agonists (eg, MEDI9197) and STING agonists (eg, MK-1454); inhibitors of immunoinhibitory mediators, including, but not limited to, CD39 and CD73 inhibitors (eg, oleclumab), IDO1 inhibitors (eg, epacadostat), and arginase inhibitors (eg, INCB001158); activators of costimulatory T-cell receptors, including, but not limited to, CD137 agonists (eg, urelumab, utomilumab), CD27 agonists (eg, varlimumab), and CD40 agonists (eg, MEDI5083); inhibitors of inhibitory T-cell receptors, including, but not limited to, LAG3 inhibitors (eg, relatlimab), TIM3 inhibitors (eg, LY3321367), and TIGIT inhibitors (eg, tiragolumab); inhibitory Treg receptor activators, including, but not limited to, GITR agonists (eg, MEDI1873); NK cell activation strategies, including, but not limited to, NKG2a (eg, monalizumab); cancer vaccines (eg, Sipuleucel-T); and immunogenic removal of the tumor, including, but not limited to, oncolytic viruses, radiation, photodynamic therapy, and chemotherapy (eg, anthracyclines, oxaliplatin, etc.).

In certain embodiments, a secondary agent is selected from immuno-oncology (IO) agents; immune checkpoint inhibitors; immunomodulatory agents; inhibitors of the PD1-PDL1/2 pathway; PD-L1 inhibitors, including, but not limited to, durvalumab, avelumab, and atezolizumab; PD-1 inhibitors, including, but not limited to, nivolumab and pembrolizumab; CTLA-4 inhibitors, including, but not limited to, ipilimumab and tremelimumab; STAT3 inhibitors, including, but not limited to, STAT3 siRNA, STAT3 antisense oligonucleotides, and danvatirsen (AZD9150); and adenosine 2A receptor (A2AR) antagonists, including but not limited to AZD4635.

Certain embodiments refer to the use of a compound targeting FOXP3 as

Forty is described herein, in combination with a secondary agent. In particular embodiments, said use is in a method of treating a patient suffering from cancer, including, but not limited to, a cancer that has FOXP3-positive Tregs (FOXP3+) in the microenvironment or the stromal or blood-draining lymph nodes. tumor, lung cancer, non-small cell lung carcinoma (NSCLC), small cell lung carcinoma (SCLC), squamous cell carcinoma (SCC), head and neck cancer, head and neck squamous cell carcinoma (HNSCC), gastrointestinal cancer, large intestine cancer, small intestine cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, hepatocellular carcinoma (HCC), esophageal cancer, pancreatic cancer, bile duct cancer, gastric cancer, urothelial cancer, breast cancer, triple negative breast cancer (TNBC), ovarian cancer, endometrial cancer, cervical cancer, prostate cancer, mesothelioma, sarcomas (eg, epithelioid, rhabdoid and synovial), chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, Merkel cell carcinoma, hematologic cancer, hematopoietic cancer, myeloma , multiple myeloma (MM), B-cell malignancies, lymphoma, B-cell lymphoma, Hodgkin lymphoma, T-cell lymphoma, leukemia or acute lymphocytic leukemia (ALL). In certain embodiments, a secondary agent is selected from immuno-oncology (IO) agents; immune checkpoint inhibitors; immunomodulatory agents; inhibitors of the PD1-PDL1/2 pathway; PD-L1 inhibitors, including, but not limited to, durvalumab, avelumab, and atezolizumab; PD-1 inhibitors, including, but not limited to, nivolumab and pembrolizumab; CTLA-4 inhibitors, including, but not limited to, ipilimumab and tremelimumab; STAT3 inhibitors, including, but not limited to, STAT3 siRNA, STAT3 antisense oligonucleotides, and danvatirsen (AZD9150).

Certain embodiments refer to a combination of a FOXP3 targeting compound as described herein and a secondary agent, such as an agent selected from: immuno-oncology (IO) agents; immune checkpoint inhibitors; immunomodulatory agents; inhibitors of the PD1-PDL1/2 pathway; PD-L1 inhibitors, including, but not limited to, durvalumab, avelumab, and atezolizumab; PD-1 inhibitors, including, but not limited to, nivolumab and pembrolizumab; CTLA-4 inhibitors, including, but not limited to, ipilimumab and tremelimumab; STAT3 inhibitors, including, but not limited to, STAT3 siRNA, STAT3 antisense oligonucleotides, and danvatirsen (AZD9150).

In certain embodiments, the FOXP3 targeting compound as described herein and the secondary agent are used in combination treatment by simultaneously, separately, or sequentially administering the two agents. In certain embodiments, the two agents are formulated as a fixed-dose combination product. In other embodiments, the two agents are provided to the patient as separate units, which can be taken simultaneously or serially (sequentially).

Forty-one

In certain embodiments, a FOXP3 targeting compound as described herein is used, in combination with an immunomodulatory agent, such as an anti-PD-L1 antibody (or antigen-binding fragment thereof), an anti-PD-L1 antibody, -PD-1 (or an antigen-binding fragment thereof), an anti-CTLA-4 antibody (or an antigen-binding fragment thereof), or an OX40 agonist (eg, an OX40 ligand fusion protein or an OX40 agonist antibody or an antigen-binding fragment thereof).

In certain embodiments, a FOXP3 targeting compound as described herein is used, in combination with an immune checkpoint inhibitor, such as an anti-PD-L1 antibody (or antigen-binding fragment thereof). , an anti-PD-1 antibody (or an antigen-binding fragment thereof) or an anti-CTLA-4 antibody (or an antigen-binding fragment thereof).

Anti-PD-L1 antibodies are known in the art. Exemplary anti-PD-L1 antibodies include: MEDI4736 (durvalumab), MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105, and MPDL3280A (atezolizumab).

Anti-PD-1 antibodies are known in the art. Exemplary anti-PD-1 antibodies include: nivolumab, pembrolizumab, pidilizumab, and AMP-514.

Anti-CTLA-4 antibodies are known in the art. Exemplary anti-CTLA-4 antibodies include: tremelimumab and ipilimumab, also designated MDX-010 (or BMS-734016).

Agonists and antibodies to OX40 are known in the art. Exemplary agonists and/or antibodies to OX40 include: MEDI6383, 9B12, and MEDI0562.

In one embodiment, the combination includes the antisense oligonucleotide Ionis 651987 or a salt thereof and at least one immunomodulator selected from the group consisting of: MEDI4736, MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105, nivolumab, pembrolizumab , pidilizumab, MPDL3280A, tremelimumab, ipilimumab, MEDI0562 and MEDI0562.

In one embodiment, the combination includes the anti-PD-L1 antibody MEDI4736 (duvalumab) and ION 1063734.

In one embodiment, the combination includes ION 1063734, the anti-PD-L1 antibody MEDI4736 (durvalumab), and the anti-CTLA-4 antibody tremelimumab.

CERTAIN ANTI-PD-L1 ANTIBODIES

Included in this disclosure are antibodies that specifically bind and inhibit PD-L1.

Durvalumab (MEDI4736) is an exemplary anti-PD-L1 antibody that is selective for a PD-L1 polypeptide and blocks the binding of PD-L1 to PD-1 and CD80 receptors. Durvalumab can alleviate PD-L1-mediated suppression of human T cell activation in vitro and inhibits tumor growth in a model of

Forty-one I give xenograft by a T-lymphocyte-dependent mechanism.

Information regarding durvalumab (or fragments thereof) for use in the methods provided herein can be found in US Patent No. 8,779,108, the disclosure of which is incorporated herein by reference in its entirety. The crystallizable fragment (Fc) domain of durvalumab contains a triple mutation in the IgG1 heavy chain constant domain that reduces binding to the C1q component of complement and to Fcy receptors responsible for mediating antibody-dependent cell-mediated cytotoxicity ( ADCC). In certain embodiments, MEDI4736 or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 2.14H9OPT antibody as disclosed in the US Patents US Nos. 8,779,108 and 9493565, which are incorporated herein by reference in their entireties.

There are numerous anti-PD-L1 antibodies in published references that could be presented in this disclosure, including compounds under development and/or in clinical trials, such as: durvalumab (MEDI4736), MPDL3280A, BMS936559, 2.7A4, AMP-714, and MDX-1105. Patent specifications that disclose anti-PD-L1 antibodies that may be useful in the present disclosure include: US Patent Nos. 7,943,743; 8,383,796; 9,102,725; 9,273,135 (BMS/Medarex), US2006/0153841 (Dana Farber), US2011/0271358 (Dana Farber), US Patent Nos. 8,552,154 and 9,102,727 (Dana Faber), US Patent No. 8,217,149 (Genentech), including US Patents 8,217,149 issued, US2012/0039906 (INSERM), US2016/0031990 (Amplimmune), US Patents #8,779,108 (MedImmune - for durvalumab/MEDI4726 and 2.7A4), US2014/0044738 (Amplimmune - for AMP-714) and US2010/0285039 (John's Hopkins University). Each such disclosure is incorporated herein by reference in its entirety.

CERTAIN ANTI-CTLA-4 ANTIBODIES

Antibodies that specifically bind to CTLA-4 and inhibit CTLA-4 activity are useful in enhancing an antitumor immune response. Information regarding tremelimumab (or its antigen-binding fragments) for use in the methods provided herein may be found in US 6 682 736 (cited as 11.2.1, the disclosure of which is incorporated herein). for reference in its entirety. Tremelimumab (also known as CP-675,206, CP-675, CP-675206, and ticilimumab) is a human IgG2 monoclonal antibody that is highly selective for CTLA-4 and blocks the binding of CTLA-4 to CD80 (B7.1) and CD86. (B7.2). It has been shown to result in immune activation in vitro and some patients treated with tremelimumab have shown tumor regression. In certain embodiments, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein

Forty-three documents comprise the variable heavy chain and variable light chain CDR sequences of the 11.2.1 antibody as disclosed in US Patent No. 6,682,736, which is incorporated herein by reference in its entirety.

Other anti-CTLA-4 antibodies are described, for example, in US 20070243184. In one embodiment, the anti-CTLA-4 antibody is Ipilimumab, also designated MDX-010; BMS-734016.

CERTAIN OX40 AGONISTS

OX40 agonists interact with the OX40 receptor on CD4+ T cells during or shortly after priming by an antigen, resulting in an increased CD4+ T cell response against the antigen. An OX40 agonist that interacts with the OX40 receptor on antigen-specific CD4+ T cells can increase T cell proliferation compared to the response to antigen alone. The elevated response against the antigen can be maintained for a substantially longer period of time than in the absence of an OX40 agonist. Therefore, stimulation via an OX40 agonist potentiates the antigen-specific immune response by enhancing T-lymphocyte recognition of antigens, eg, tumor cells. OX40 agonists are described, for example, in US Patent Nos. 6,312,700, 7,504,101, 7,622,444, and 7,959,925, which are incorporated herein by reference in their entireties. Methods of using such agonists in the treatment of cancer are described, for example, in US2015/0098942 and US2015/0157710, each of which is incorporated herein by reference in its entirety.

OX40 agonists include, but are not limited to, OX40-binding molecules, eg, binding polypeptides, eg, OX40 ligand (OX40L) or an OX40-binding fragment, variant, or derivative thereof, such as soluble extracellular ligand domains and fusion proteins of OX40L, and anti-OX40 antibodies (eg, monoclonal antibodies, such as humanized monoclonal antibodies) or an antigen-binding fragment, variant, or derivative thereof. Examples of anti-OX40 monoclonal antibodies are described, for example, in US Patent Nos. 5,821,332 and 6,156,878, the disclosures of which are incorporated herein by reference in their entirety. In certain embodiments, the anti-OX40 monoclonal antibody is 9B12 or an antigen-binding fragment, variant, or derivative thereof, as described in Weinberg, AD, et al. J Immunother 29, 575-585 (2006), which is incorporated herein by reference in its entirety. In another embodiment, an antibody against OX40 is MEDI0562, as described in US 2016/0137740.

In other embodiments, the antibody that specifically binds OX40, or an antigen-binding fragment thereof, binds to the same epitope of OX40 as the 9B12 mAb. An exemplary humanized OX40 antibody is described by Morris et al., Mol Immunol. May 2007; 44(12): 3112-3121. 9B12 is a murine anti-OX40 IgG1 mAb directed against the extracellular domain of human OX40 (CD134) (Weinberg, AD, et al. J

Forty-four Immunother 29, 575-585 (2006)). It was selected from a panel of anti-OX40 monoclonal antibodies due to its ability to elicit an agonist response for signaling, stability, and the high level of OX40 production by the hybridoma. For use in clinical applications, mAb 9B12 is equilibrated with phosphate buffered saline at pH 7.0 and its concentration adjusted to 5.0 mg/mL by diafiltration.

OX40 ligand (OX40L) (also variously referred to as tumor necrosis factor ligand superfamily member 4, gp34, TAX transcriptionally activated glycoprotein-1, and CD252) is found largely on antigen presenting cells (APCs) , and can be induced in activated B lymphocytes, dendritic cells (DC), Langerhans cells, plasmacytoid DC, and macrophages (Croft, M., (2010) Ann Rev Immunol 28:57-78). Other cells, including activated T lymphocytes, NK cells, mast cells, endothelial cells, and smooth muscle cells can express OX40L in response to inflammatory cytokines (Id). OX40L specifically binds to the OX40 receptor. The human protein is described in US Patent 6,156,878. Mouse OX40L is described in US Patent 5,457,035. OX40L is expressed on the surface of cells and includes an intracellular receptor binding domain, a transmembrane receptor binding domain, and an extracellular receptor binding domain. A functionally active soluble form of OX40L can be produced by deleting the intracellular and transmembrane domains, as described, for example, in US Patent Nos. 5,457,035; 6,312,700; 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670, the disclosures of which are incorporated herein for all purposes. A functionally active form of OX40L is a form that retains the ability to specifically bind OX40, ie, possesses an OX40 receptor binding domain. An example is amino acids 51 to 183 of human OX40L. Methods of determining the ability of an OX40L molecule or derivative to specifically bind to OX40 are discussed below. Methods for producing and using OX40L and its derivatives (such as derivatives that include an OX40-binding domain) are described in US Patent Nos. 6,156,878; 6,242,566; 6,528,055; 6,528,623;

7,098,184; and 7,125,670, who also describe proteins comprising the soluble form of OX40L linked to other peptides, such as human immunoglobulin (Ig) Fc regions, which can be produced to facilitate purification of OX40 ligand from cultured cells or to enhance the purification of OX40L. stability of the molecule after in vivo administration to a mammal (see also US Patent Nos. 5,457,035 and 7,959,925, both being incorporated herein by reference in their entirety).

Also included in the definition of OX40L are OX40 ligand variants that vary in amino acid sequence from naturally occurring OX40 ligand molecules but retain the ability to specifically bind to an OX40 receptor. Such variants are described in US Patent Nos. 5,457,035; 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670. In one embodiment, an OX40L mutant is used.

Forty-five that has lost the ability to bind OX40, eg, amino acids 51 to 183, in which phenylalanine at position 180 of the human OX40L receptor-binding domain is replaced with alanine (F180A).

OX40 agonists include a fusion protein in which one or more OX40L domains are linked to one or more additional protein domains. OX40L fusion proteins that can be used as OX40 agonists are described in US Patent No. 6,312,700, the disclosure of which is incorporated herein by reference in its entirety. In one embodiment, an OX40 agonist includes an OX40L fusion polypeptide that self-assembles into a multimeric (eg, trimeric or hexameric) OX40L fusion protein. Such fusion proteins are described, for example, in US Patent No. 7,959,925, which is incorporated herein by reference in its entirety. The multimeric OX40L fusion protein shows increased efficacy in enhancing the antigen-specific immune response in a subject, in particular, a human subject, due to its ability to spontaneously assemble into highly stable trimers and hexamers.

In another embodiment, an OX40 agonist capable of assembly into a multimeric form includes a fusion polypeptide comprising, in the N-terminal to C-terminal direction: an immunoglobulin domain, wherein the immunoglobulin domain includes an Fc domain, a trimerization domain, wherein the trimerization domain includes a coiled helix trimerization domain, and a receptor-binding domain, wherein the Fc-binding domain receptor is a receptor-binding domain of OX40, eg, an OX40L or an OX40-binding fragment, variant or derivative thereof, wherein the fusion polypeptide can self-assemble into a trimeric fusion protein. In one aspect, an OX40 agonist capable of assembly into a multimeric form is capable of binding to the OX40 receptor and stimulating at least one OX40-mediated activity. In certain aspects, the OX40 agonist includes an OX40 ligand extracellular domain.

The trimerization domain of an OX40 agonist capable of assembly into a multimeric form serves to promote self-assembly of OX40L fusion polypeptide molecules into a trimeric protein. In this manner, an OX40L fusion polypeptide with a trimerization domain self-assembles into a trimeric OX40L fusion protein. In one aspect, the trimerization domain is an isoleucine zipper domain or other coiled-coil polypeptide structure. Supercoiled helix trimerization domains include: TRAF2 (GENBANK ® reference no. Q12933, amino acids 299-348); thrombospondin 1 (reference no.

PO7996, amino acids 291-314); Matrilin-4 (reference no. O95460, amino acids 594-618); CMP (matrilin-1) (reference no. NP-002370, amino acids 463-496); HSF1 (reference no. AAX42211, amino acids 165-191); and Cubilin (reference no. NP-001072, amino acids 104-138). In certain specific aspects, the trimerization domain includes a TRAF2 trimerization domain, a trimerization domain

Forty-six of Matrilina-4 or a combination thereof.

OX40L FP is an OX40 IgG4P ligand fusion protein that specifically binds to, and triggers signaling by, the human OX40 receptor, a member of the TNFR superfamily. OX40L FP is also disclosed in US2016/0024176, incorporated herein by reference in its entirety. OX40L FP is composed of three distant domains: (1) human OX40 ligand extracellular receptor-binding domains (RBDs) that form homotrimers and bind to the OX40 receptor; (2) isoleucine zipper trimerization domains from TNFR-associated factor 2 that stabilize the homotrimeric structure of the OX40 ligand RBDs; and (3) human IgG4 crystallizable fragment gamma (Fcy) domains that facilitate Fcy receptor stacking of the fusion protein when bound to OX40 receptors and contain a serine to proline substitution at position 228 (of according to EU numbering) in the hinge regions (IgG4P) to promote the stability of two sets of OX40 ligand RBD homotrimers. The IgG4P Fc domain is directly fused to an isoleucine zipper trimerization domain derived from residues 310-349 of human tumor necrosis factor 2 (TRAF2). Fused to the C-terminus of the TRAF2 domain are amino acid residues 51-183 of the extracellular receptor-binding domain (RBD) of human OX40L (gene name TNFSF4). The TRAF2 domain stabilizes the homotrimeric structure of OX40L RBDs to allow OX40 binding and activation, while the IgG4P Fc domain confers stability to serum, dimerization of OX40L trimers, and facilitates Fcy receptor clustering of the hexameric fusion protein. . A variant of OX40L FP possesses a phenylalanine (F) to alanine (A) mutation at the amino acid corresponding to position 180 in OX40L. Another OX40L FP variant has the IgG4P Fc domain replaced by a human IgG1 Fc domain. In particular embodiments, the OX40 agonist for use in the present disclosure is one of the OX40L FP variants.

In particular embodiments, the OX40 agonist for use in the present disclosure has been modified to increase its serum half-life. For example, the serum half-life of an OX40 agonist can be increased by its conjugation to a heterologous molecule, such as serum albumin, an antibody Fc region, or PEG. In certain embodiments, OX40 agonists can be conjugated to other therapeutic agents or toxins to form immunoconjugates and/or fusion proteins. In certain embodiments, the OX40 agonist may be formulated to facilitate administration and promote stability of the active ingredient.

ANTIBODY DERIVATIVES

Antibodies for use in the present disclosure (eg, anti-CTLA-4, anti-PD-L1, anti-PD-1, anti-OX40) may include variants of these sequences that retain the ability to specifically bind to their targets. Said variants can be obtained from the sequence of these antibodies by a person skilled in the art using techniques well known in the art. For example, you can perform

Forty-seven amino acid substitutions, deletions or additions in the FRs and/or CDRs. While changes in the FRs are usually designed to improve the stability and immunogenicity of the antibody, changes in the CDRs are usually designed to increase the affinity of the antibody for its target. FR variants also include allotypes of naturally occurring immunoglobulins. Such affinity-increasing changes can be determined empirically by standard techniques that involve altering the CDR and studying the affinity of the antibody for its target. For example, conservative amino acid substitutions can be made in any of the disclosed CDRs. Various alterations can be made according to the methods described in Antibody Engineering, 2.^to ed., Oxford University Press, ed. Borrebaeck, 1995. These include, but are not limited to, nucleotide sequences that are altered by substitution of different codons encoding a functionally equivalent amino acid residue in the sequence, thereby producing a silent change. For example, nonpolar amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Positively charged (basic) amino acids include arginine, lysine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

Derivatives and analogs of the antibodies of the present disclosure can be produced by a variety of techniques well known in the art, including synthetic and recombinant methods (Maniatis (1990) Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, and Bodansky et al (1995) The Practice of Peptide Synthesis, 2nd ed., Spring Verlag, Berlin, Germany). Analogous rearrangement or combinatorial techniques are also disclosed by Stemmer (Nature (1994) 370: 389-391), who describes the technique in relation to a β-lactamase gene but notes that the approach can be used for the generation of antibodies.

Novel VH or VL regions carrying one or more sequences derived from the sequences disclosed herein can be generated using random mutagenesis of one or more selected VH and/or VL genes. One such technique, error-prone PCR, is described by Gram et al. (Proc. Nat. Acad. Sci. USA (1992) 89: 3576-3580).

Another method that can be used is to direct mutagenesis to the CDRs of the VH or VL genes. Such techniques are disclosed by Barbas et al (Proc. Nat. Acad. Sci. USA (1994) 91: 3809-3813) and Schier et al. (J. Mol. Biol. (1996) 263: 551-567).

Similarly, one or more or all three CDRs can be inserted into a repertoire of VH or VL domains, which are subsequently screened for a CTLA-4 or PD-L1-specific antigen-binding fragment.

An immunoglobulin variable domain domain will comprise at least one of the CDRs as set forth herein and, optionally, intermediate framework regions of the scFv fragments, as set forth herein.

Forty-eight document. The portion may include at least about 50% of one or both of FR1 and FR4, with 50% being 50% C-terminal of FR1 and 50% N-terminal of FR4. Additional residues at the N-terminus or C-terminus of the substantial part of the variable domain may be those not normally associated with naturally occurring variable domain regions. For example, the construction of antibodies by recombinant DNA techniques may result in the introduction of N- or C-terminal residues encoded by introduced linkers to facilitate cloning or other manipulation steps. Other manipulation steps include the introduction of linkers to join variable domains to additional protein sequences including immunoglobulin heavy chain constant regions, other variable domains (eg, in diabody production), or protein markers, as discussed further below. detail below.

One of skill will recognize that antibodies for use in the present disclosure may comprise antigen-binding fragments that contain only a CDR from a VL or VH domain. Any one of the single-chain specific binding domains can be used to detect complementary domains capable of forming a two-domain specific antigen-binding fragment that is capable, for example, of binding to CTLA-4 and PD-L1.

Antibodies for use in the present disclosure described herein may bind to another functional molecule, eg, another peptide or protein (albumin, another antibody, etc.). For example, antibodies can be linked by chemical crosslinking or by recombinant methods. Antibodies can also be linked to one of a variety of non-proteinaceous polymers, eg, polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, as set forth in US Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192; or 4,179,337. Antibodies can be chemically modified by covalent conjugation to a polymer, for example, to increase their circulating half-life. Exemplary polymers and methods for coupling them are also shown in US Patent Nos. 4,766,106; 4,179,337; 4,495,285 and 4,609,546.

Antibodies can also be altered to have a glycosylation pattern that differs from the native pattern. For example, one or more carbohydrate residues can be removed and/or one or more glycosylation sites added to the original antibody. The addition of glycosylation sites to the antibodies disclosed herein can be accomplished by altering the amino acid sequence to contain art-known consensus sequences of glycosylation sites. Another means of increasing the number of carbohydrate residues in antibodies is by chemical or enzymatic coupling of glycosides to amino acid residues of the antibody. Such methods are described in WO 87/05330 and in Aplin et al. (1981) CRC Crit. Rev. Biochem., 22: 259-306. Removal of any carbohydrate moieties from the antibodies can be accomplished chemically or enzymatically, for example, as described by Hakimuddin et al.

Forty-nine (1987) Arch. Biochem. Biophys., 259: 52; and Edge et al. (1981) Anal. Biochem., 118: 131 and by Thotakura et al. (1987) Met. Enzymol., 138: 350. Antibodies can also be labeled with a detectable or functional label. Detectable labels include radiolabels, such as 131I or 99Tc, which can also be attached to antibodies using standard chemistry. Detectable markers also include enzymatic markers, such as horseradish peroxidase or alkaline phosphatase. Detectable markers further include chemical moieties such as biotin, which can be detected by binding to a specific related detectable moiety, eg, labeled avidin.

Antibodies in which the CDR sequences differ only insubstantially from those set forth herein are encompassed within the scope of the present disclosure. Typically, an amino acid is substituted with a related amino acid that has similar charge, hydrophobic, or stereochemical characteristics. Such substitutions would be within the usual powers of an expert. Unlike CDRs, more substantial changes can be made to FRs without adversely affecting the binding properties of an antibody. Changes to FRs include, but are not limited to, humanizing a residue of non-human origin or engineering certain framework residues that are important for antigen contact or binding site stabilization, for example, by changing class or subclass of the constant region, changing specific amino acid residues that can alter effector function, such as Fc receptor binding, for example, as described in US Patent Nos. 5,624,821 and 5,648,260 and Lund et al. (1991) J. Immun. 147: 2657-2662 and Morgan et al. (1995) Immunology 86: 319-324 or changing the species from which the constant region is derived.

One skilled in the art will appreciate that the modifications described above are not completely exhaustive and that other modifications will be obvious to one skilled in the art in view of the teachings of the present disclosure.

CERTAIN COMPOUNDS

In certain embodiments, the compounds described herein can be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a sequence of nitrogenous bases complementary to that of a target nucleic acid.

In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a sequence of nitrogenous bases complementary to that of a target nucleic acid.

In certain embodiments, a compound or antisense compound is

Fifty single-stranded. Said single-chain compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, said oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the single-stranded antisense compound or oligomeric compound oligonucleotide comprises a self-complementary sequence of nitrogenous bases.

In certain embodiments, the compounds are double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nitrogenous base in the modified oligonucleotide is replaced with a uracil nitrogenous base. In certain embodiments, the compound comprises a conjugated group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, the two modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide is 12-30 linked nucleosides in length and the second modified oligonucleotide is 12-30 linked nucleosides in length. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NO: 9-3246.

In certain embodiments, the antisense compounds are double-stranded. Such double-stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of said double-stranded antisense compounds comprises or consists of a modified oligonucleotide and optionally a conjugate group. The oligonucleotide of the second oligomeric compound of said double-stranded antisense compound may be modified or unmodified. One or both oligomeric compounds of a double-stranded antisense compound may comprise a conjugate group. Oligomeric compounds of double-stranded antisense compounds may include non-complementary leaving nucleosides.

Examples of single-stranded and double-stranded compounds include, without limitation, oligonucleotides, siRNAs, oligonucleotides that target microRNAs, and single-stranded RNAi compounds such as short-haired RNA (shRNA), single-stranded siRNAs (ssRNA), and microRNA mimetics.

In certain embodiments, a compound described herein has a sequence of nitrogenous bases which, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a nucleic acid.

Fifty-one target to which it is directed.

In certain embodiments, a compound described herein comprises an oligonucleotide 10 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide from 12 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 22 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide from 14 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 14 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide from 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide from 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide from 18 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 21 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 to 30 linked subunits in length. In other words, such oligonucleotides have 12 to 30 subunits attached, 14 to 30 subunits attached, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits. , 17-30 subunits, 17-20 subunits, 18-30 subunits, 18-20 subunits, 18-21 subunits, 20-30 subunits, or 12-22 subunits joined in length, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide 14 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 linked subunits in length. In certain embodiments, a compound described herein comprises a

Fifty-two oligonucleotide of 20 linked subunits in length. In other embodiments, a compound described herein comprises an oligonucleotide of 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, from 16 to 30, from 16 to 50, from 17 to 30, from 17 to 50, from 18 to 22, from 18 to 24, from 18 to 30, from 18 to 50, from 19 to 22, from 19 to 30, 19 to 50, or 20 to 30 joined subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,42, 43, 44, 45, 46, 47, 48, 49, 50, 51,52, 53, 54, 55, 56, 57, 58, 59, 60, 61,62, 63, 64, 65, 66, 67, 68, 69, 70, 71,72, 73, 74, 75, 76, 77, 78, 79, or 80 joined subunits in length or a range defined by any two of the above values. In some embodiments, the attached subunits are nucleotides, nucleosides, or nitrogenous bases.

In certain embodiments, the compound may further comprise additional features or elements, such as a conjugated group, that bind to the oligonucleotide. In certain embodiments, said compounds are antisense compounds. In certain embodiments, said compounds are oligomeric compounds. In embodiments where a conjugated group comprises a nucleoside (ie, a nucleoside that links the conjugated group to the oligonucleotide), the nucleoside of the conjugated group is not counted in the length of the oligonucleotide.

In certain embodiments, the compounds may be shortened or truncated. For example, a single subunit can be removed from the 5' end (5' truncation) or, alternatively, from the 3' end (3' truncation). A shortened or truncated compound targeted to a FOXP3 nucleic acid may have two subunits deleted from the 5' end, or alternatively, may have two subunits deleted from the 3' end of the compound. Alternatively, the removed nucleosides may be dispersed throughout the compound.

When there is a single additional subunit present in an elongated compound, the additional subunit may be located at the 5' or 3' end of the compound. When two or more subunits are present, the two added subunits may be adjacent to each other, for example, in a compound having two added subunits at the 5' end (5' addition) or alternatively, at the 3' end (3' addition). ) of the compound. Alternatively, the added subunits can be dispersed throughout the compound.

It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and/or introduce mismatched bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305-7309; Gautschi et al. J. Natl. Cancer Inst. 2001 March, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in sequence, chemistry, and motifs can produce large differences in one or more of several properties needed for clinical development (Seth et al. J. Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).

Fifty-three In certain embodiments, the compounds described herein are RNA interference (RNAi) compounds including double-stranded RNA compounds (also referred to as small interfering RNAs or siRNAs) and single-stranded RNAi (or ssRNA) compounds. Such compounds act at least in part through the RISC pathway to degrade and/or entrap a target nucleic acid (thus, they include microRNA compounds/microRNA mimetics). The term siRNA, as used herein, is intended to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence-specific iRNA, for example, small interfering RNA (siRNA), dsRNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), a small interfering oligonucleotide, small interfering nucleic acid, small interfering modified oligonucleotide, Chemically modified siRNA, RNA silencing a gene after transcription (RNAsgtt) and others. In addition, the term RNAi, as used herein, is intended to be equivalent to other terms used to describe sequence-specific RNA interference, such as gene silencing upon transcription, inhibition of translation or epigenetics.

In certain embodiments, a compound described herein can comprise any of the FOXP3-targeting oligonucleotide sequences described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least a contiguous 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nitrogenous base portion of any one of SEQ ID NO: 9-3246 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NO: 9-3246 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) instead of thymine (T) in any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on FOXP3 targeted by any of SEQ ID NO: 9-3246 and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position on the sugar contains a halogen (such as a fluoro group; 2'-F) or contains an alkoxy group (such as a methoxy group; 2'-F). '-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, said at least one 2'-F type sugar modification and at least one 2'-OMe type sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6 , 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nitrogenous bases along one strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides that are not a naturally occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate and phosphorodithioate linkages. The compounds can also be chemically modified nucleic acid molecules, as described in US Patent 6,673,661. In other embodiments, the compound

Fifty-four contains one or two locked strands, as described, for example, in WO 00/63364, filed April 19, 2000.

In certain embodiments, the first strand of the compound is a siRNA leader strand and the second strand of the compound is a siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound is 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length. In certain embodiments, the first or second strand of the compound may comprise a conjugated group.

In certain embodiments, a compound described herein can comprise any of the FOXP3-targeting oligonucleotide sequences described herein. In certain embodiments, the compound is single chain. In certain embodiments, said compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nitrogenous bases of any one of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises the nucleobase sequence of any of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is present instead of thymine (T) in any of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises a nucleobase sequence complementary to the FOXP3 site that serves as a target for any of SEQ ID NO: 9-3246. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position on the sugar contains a halogen (such as a fluoro group; 2'-F) or contains an alkoxy group (such as a methoxy group; 2'-F). '-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, said at least one 2'-F type sugar modification and at least one 2'-OMe type sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6 , 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nitrogenous bases along one strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides that are not a naturally occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate and phosphorodithioate linkages. The compounds can also be chemically modified nucleic acid molecules, as described in US Patent 6,673,661. In other embodiments, the compound contains a locked strand, as disclosed, for example, in WO 00/63364, filed April 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compound can comprise a conjugated group.

In certain embodiments, the compounds described herein comprise modified oligonucleotides. Certain modified oligonucleotides have one or more asymmetric centers and therefore give rise to enantiomers,

Fifty-five diastereomers and other stereoisomeric configurations that can be defined, in terms of absolute stereochemistry, as (R) or (S), as α or β for example for sugar anomers, or as (D) or (L) for example for amino acids etc Modified oligonucleotides provided herein include all of these possible isomers, including their racemic and optically pure forms, unless otherwise specified. Similarly, all cis and trans isomers and tautomeric forms are also included.

The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or a radioactive isotope of the indicated element. For example, compounds herein comprising hydrogen atoms encompass all possible substitutions with deuterium for each of the 1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include, but are not limited to:²H o³H instead of 1H,¹³C o¹⁴C instead of¹²c,¹⁵n instead of¹⁴No,¹⁷or or¹⁸Or instead of¹⁶or and³³Yes,³⁴Yes,³⁵yes³⁶S instead of³²S. In certain embodiments, non-radioactive isotopic substitutions may confer novel properties that are beneficial for use as a therapeutic or research tool. In certain embodiments, the radioactive isotope substitutions may make the compound suitable for research or diagnostic purposes, such as an imaging assay.

CERTAIN MECHANISMS

In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. In certain embodiments, the compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, the compounds described herein selectively affect one or more target nucleic acids. Said compounds comprise a sequence of nitrogenous bases that hybridizes to one or more target nucleic acids, resulting in one or more desired antisense activities and does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids of such as to result in significant unwanted antisense activity.

In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in the uptake of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H-mediated cleavage of target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex does not necessarily have to be unmodified DNA. In certain embodiments, the compounds described herein are what

Fifty-six sufficiently similar to DNA to trigger RNase H activity. In addition, in certain embodiments, one or more non-DNA-like nucleosides are tolerated in the gap of a gapped oligomer.

In certain antisense activities, the compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in the cleavage of target nucleic acid by Argonaute. The compounds that are loaded onto the RISC are RNAi compounds. RNAi compounds can be double-stranded (siRNA) or single-stranded (msRNA).

In certain embodiments, hybridization of the compounds described herein to a target nucleic acid does not result in the uptake of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in the disruption of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound with a target nucleic acid results in the inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in impaired translation of the target nucleic acid.

Antisense activities can be observed directly or indirectly. In certain embodiments, the observation or detection of an antisense activity involves the observation or detection of a change in an amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the splice variant ratio of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.

TARGET NUCLEIC ACIDS, TARGET REGIONS AND NUCLEOTIDE SEQUENCES

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide that comprises a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic, and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region lies entirely within an intron. In certain embodiments, the target region encompasses an intron/exon intersection. In certain embodiments, the target region is at least 50% within an intron.

Nucleotide sequences encoding FOXP3 include, without limitation, the following: RefSEQ # NM_014009.3 (SEQ ID NO: 1);

Fifty seven

NT_011568.12_TRUNC_11907130_11921808_COMP (SEQ ID NO: 2);

NM_001114377.1 (SEQ ID NO: 3);

NC_000023.11_TRUNC_49247001_49273000_C0MP (SEQ ID NO: 4); or UCSC reference no. UC064ZFP.1 corresponding to the genomic coordinates chrX:49,251,334-49,259,240 in the GRCh38/hg38 set (SEQ ID NO: 5); each of which is incorporated by reference in its entirety.

HYBRIDIZATION

In some embodiments, hybridization occurs between a compound disclosed herein and a FOXP3 nucleic acid. The most common hybridization mechanism involves hydrogen bonding (eg, Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding) between complementary nitrogenous bases of the nucleic acid molecules.

Hybridization can take place under various conditions. Hybridization conditions are sequence dependent and determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein can specifically hybridize to a FOXP3 nucleic acid.

COMPLEMENTARITY

An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two sequences of nitrogenous bases align in opposite directions. Pairings of nitrogenous bases or complementary nitrogenous bases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), to adenine (A) and uracil (U), cytosine ( C) and guanine (G), and 5-methylcytosine (mC) and guanine (G) unless otherwise specified. The complementary oligonucleotides and/or nucleic acids need not exhibit nitrogenous base complementarity at each nucleoside and these may include one or more nitrogenous base mismatches. An oligonucleotide is fully complementary or 100% complementary when such oligonucleotides contain nitrogenous base pairings at each nucleoside without any nitrogenous base mismatches.

In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. Non-complementary nitrogenous bases between a compound and a FOXP3 nucleic acid can be tolerated, as long as the compound is still capable of hybridizing.

Fifty-eight specifically to a target nucleic acid. In addition, a compound can hybridize to one or more segments of a FOXP3 nucleic acid in such a way that intervening or adjacent segments are not involved in the hybridization event (eg, a loop, mismatch, or hairpin structure). .

In certain embodiments, the compounds provided herein or a portion thereof are at least up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a FOXP3 nucleic acid, a target region, target segment, or a specified portion thereof. In certain embodiments, the compounds provided herein or a specific portion thereof are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or anywhere in between these ranges, complementary to a FOXP3 nucleic acid, target region, target segment, or specific portion thereof . The percentage complementarity of a compound with a target nucleic acid can be determined using routine methods.

For example, a compound in which 18 of the 20 nitrogenous bases of the compound are complementary to a target region and therefore could specifically hybridize, could represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases can be clustered or intercalated with complementary nucleobases and need not be contiguous with respect to each other or with respect to complementary nucleobases. As such, a compound that is 18 nucleobases in length that has four noncomplementary nucleobases that are flanked by two regions of complete complementarity with the target nucleic acid would have an overall complementarity of 77.8% with the target nucleic acid. The percentage of complementarity of a compound with a region of a target nucleic acid can be routinely determined using BLAST programs (Basic Local Alignment Search Tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). The percentage of homology as well as the identity or complementarity of the sequences can be determined, for example, with the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computational Group, University Research Park , Madison Wis.), using the default parameters, which employ the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

In certain embodiments, the compounds described herein, or specific portions thereof, are fully complementary (ie, 100% complementary) to a target nucleic acid or a specific portion thereof. For example, a compound may be completely complementary to a FOXP3 nucleic acid or target region or target segment or target sequence thereof. As used herein, "fully complementary" means that each nitrogenous base of a

Compound fifty-nine is complementary to the corresponding nitrogenous base of a target nucleic acid. For example, a 20 nitrogen base compound will be fully complementary to a target sequence 400 nitrogen bases in length as long as there is a corresponding 20 nitrogen base portion of the target nucleic acid that is fully complementary to the compound. The term "fully complementary" can also be used to refer to a specific portion of the first and/or second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound may be fully complementary to a target sequence 400 nucleobases in length. The 20 nitrogen base portion of the 30 nitrogen base compound will be fully complementary to the target sequence if the target sequence has a corresponding 20 nitrogen base portion in which each nitrogen base is complementary to the 20 nitrogen base portion of the compound . Likewise, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

In certain embodiments, the compounds described herein comprise one or more nitrogenous bases mismatched relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced due to such a mismatch, but activity against a non-target component is reduced by a greater amount. Thus, in certain such embodiments, the selectivity of the compound is improved. In certain embodiments, the mismatch is specifically located within an oligonucleotide having a gapped oligomer motif. In certain such embodiments, the mismatch is found at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain such embodiments, the mismatch is found at position 9, 8, 7, 6, 5, 4, 3, 2, 1 starting from the 3' end of the gap region. In certain such embodiments, the mismatch is found at position 1, 2, 3, or 4 starting from the 5' end of the gap region. In certain such embodiments, the mismatch is found at position 4, 3, 2, or 1 starting from the 3' end of the gap region. In certain embodiments, the mismatch is specifically located within an oligonucleotide that does not have a gapped oligomer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatch is found at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

The location of a non-complementary nitrogenous base can be at the 5' end or the 3' end of the compound. Alternatively, the non-complementary nitrogenous base(s) may be at an internal position in the compound. When there are two or more non-complementary nitrogenous bases

Sixty present, these can be contiguous (ie, joined) or non-contiguous. In one embodiment, a non-complementary nitrogenous base is located in the flanking segment of a gapped oligomeric oligonucleotide.

In certain embodiments, compounds described herein as being or up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nitrogenous bases in length comprise no more than 4, no more than 3 , no more than 2 or no more than 1 non-complementary nitrogenous base relative to a target nucleic acid, such as a FOXP3 nucleic acid or a specified portion thereof.

In certain embodiments, the compounds described herein having, or having up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27 , 28, 29, or 30 nitrogenous bases in length comprise not more than 6, not more than 5, not more than 4, not more than 3, not more than 2, or not more than 1 noncomplementary nitrogenous base relative to an acid target nucleic acid, such as a FOXP3 nucleic acid or a specified portion thereof.

In certain embodiments, the compounds described herein also include those that are complementary to a portion of a target nucleic acid. The term "portion" as used herein refers to a defined number of contiguous (ie, linked) nitrogenous bases within a region or segment of a target nucleic acid. A moiety can also refer to a defined number of contiguous nitrogenous bases of a compound. In certain embodiments, the compounds are complementary to at least an 8 nitrogenous base portion of a target segment. In certain embodiments, the compounds are complementary to at least a 9 nitrogenous base portion of a target segment. In certain embodiments, the compounds are complementary to at least a 10 nitrogenous base portion of a target segment. In certain embodiments, the compounds are complementary to at least an 11 nitrogenous base portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nitrogenous base portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nitrogenous base portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nitrogenous base portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nitrogenous base portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nitrogenous base portion of a target segment. Also contemplated are compounds that are complementary with respect to at least a portion of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nitrogenous bases of a target segment or a range defined by any two of these values.

IDENTITY

The compounds provided herein may also have

Sixty-one defined percent identity to a nucleotide sequence, SEQ ID NO, or to a particular compound represented by a specific ION number or portion thereof. In certain embodiments, the compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, the compounds described herein are modified oligonucleotides. As used herein, a compound is identical to the sequence disclosed herein if it has the same nitrogenous base pairing ability. For example, an RNA containing uracil instead of thymidine in a described DNA sequence would be considered identical to the DNA sequence, since both uracil and thymidine pair with adenine. Shortened and elongated versions of the compounds described herein are also contemplated, as well as compounds containing non-identical bases relative to the compounds provided herein. Non-identical bases may be adjacent to each other or may be scattered throughout the compound. The percent identity of a compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, the compounds described herein or portions thereof are or are at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95% %, 96%, 97%, 98%, 99% or 100% identical to one or more compounds or SEQ ID NO or a portion thereof, disclosed herein. In certain embodiments, the compounds described herein are approximately 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage in between, with respect to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number or portion thereof wherein the compounds comprise an oligonucleotide having one or plus unpaired nitrogenous bases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatch is found at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

In certain embodiments, the compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared to a portion of the same length of the target nucleic acid. In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nitrogenous bases is compared to a portion of equal length of the target nucleic acid.

In certain embodiments, the compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared to a portion of the same length of the target nucleic acid. In certain embodiments, a slice of 8, 9, 10, 11, 12, 13, 14, 15,

sixty and give

16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nitrogenous bases with an equal length portion of the target nucleic acid.

CERTAIN MODIFIED COMPOUNDS

In certain embodiments, the compounds described herein comprise or consist of oligonucleotides consisting of linked oligonucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or they can be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., it comprises at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nitrogenous base) and/or at least one linkage between modified nucleosides).

A. MODIFIED NUCLEOSIDES

Modified nucleosides comprise a modified sugar moiety or a modified nitrogenous base or both a modified sugar moiety and a modified nitrogenous base.

1. MODIFIED SUGAR REMAINS

In certain embodiments, the sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, the modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, the modified sugar moieties are sugar substitutes. Said sugar substitutes may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, the modified sugar moieties are non-bicyclic sugar moieties that comprise a furanosyl ring with one or more acyclic substituents, including, but not limited to, substituents at the 2', 4', and/or 5' positions. In certain embodiments, one or more acyclic substituents on the non-bicyclic modified sugar moieties are branched. Examples of suitable 2'-substituent groups for modified non-bicyclic sugar moieties include, without limitation: 2'-F, 2'-OCH3 (OMe or O-methyl), and 2'-O(CH2)2OCH3 (MOE ). In certain embodiments, the substituent groups at the 2' position are selected from: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10 alkoxy, O-substituted C1-C10 alkoxy, O-C1-C10 alkyl, O-substituted C1-C10 alkyl, S- alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl , aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl and the substituent groups at the 2' position described in Cook et al., US 6,531,584; Cook et al., US 5,859,221; and Cook et al., US 6,005,087. Certain embodiments of these substituent groups at the 2' position may be further substituted with one or more substituent groups independently selected from: hydroxyl, amino,

Sixty-three alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of 4'-substituent groups for modified linearly non-bicyclic sugar moieties include, but are not limited to, alkoxy (eg, methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128 . Examples of suitable 5'-substituent groups for modified non-bicyclic sugar moieties include, without limitation: 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al. ., US2010/190837 and Rajeev et al., US2013/0203836.

In certain embodiments, a 2'-substituted nucleoside or a 2'-modified non-bicyclic nucleoside comprises a sugar moiety comprising a linear 2'-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3,

O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rm and Rn is, independently, H, a substituted or unsubstituted C1-C10 alkyl or amino protecting group.

In certain embodiments, a 2'-substituted nucleoside or a 2'-modified non-bicyclic nucleoside comprises a sugar moiety comprising a linear 2'-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O( CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2 and OCH2C(=O)-N(H)CH3 (NMA).

In certain embodiments, a 2'-substituted nucleoside or a 2'-modified non-bicyclic nucleoside comprises a sugar moiety comprising a linear 2'-substituent group selected from: F, OCH3, and OCH2CH2OCH3.

Nucleosides comprising modified sugar moieties, such as modified non-bicyclic sugar moieties, are named according to the position(s) of the substitution(s) on the nucleoside sugar moiety. For example, nucleosides comprising 2'-substituted or 2-modified sugar residues are referred to as 2'-substituted or 2-modified nucleosides.

Certain modified sugar moieties comprise a bridging sugar substituent which forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and 2' furanose ring atoms. Examples of such sugar substituents that bridge between the 4' and 2' positions include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2) 3-2', 4'-CH2-O-2'(LNA), 4'-CH2-S-2', 4'-(CH2)2-O-2'(ENA), 4'-CH(CH3 )-O-2' (referred to as restricted ethyl or cEt when in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'- CH(CH2OCH3)-O-2' (restricted MOE or cMOE) and analogs thereof (see, for example, Seth et al., US 7,399,845, Bhat et al., US 7,569,686, Swayze et al., US 7,741,457 and Swayze et al., US

Sixty-four8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, for example, Seth et al., US 8,278,283), 4'-CH2-N (OCH3)-2' and analogs thereof (see, for example, Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, for example, Allerson et al., US 7,696,345 and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, for example, Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, for example, Seth et al., US 8,278,426), 4'-C (RaRb)-N(R)-O-2', 4'-C(RaRb)-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N( R)-O-2', where each R, Ra and Rb is, independently, H, a protecting group or C1-C12 alkyl (see, for example, Imanishi et al., US 7,427,672 ).

In certain embodiments, said bridges between the 4' and 2' positions independently comprise 1 to 4 attached groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO -, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O- , -Si(Ra)2-, -S(=O)x- and -N(Ra)-;

where:

x is 0, 1, or 2;

n is 1, 2, 3 or 4;

each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, aryl C5-C20, substituted C5-C20 aryl, heterocyclo radical, substituted heterocyclo radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl(C (=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfoxyl (S(=O)-J1); and each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, C5 aryl -Substituted C20, acyl (C(=O)-H), substituted acyl, a heterocyclo radical, a substituted heterocyclo radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invents. Drugs, 2001,2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001,3, 239-243; Wengel et al., US 7,053,207, Imanishi et al., US 6,268,490, Imanishi et al. US 6,770,748, Imanishi et al., US RE44,779; Wengel et al., US 6,794,499, Wengel et al., US 6,670,461; Wengel et al., US 7,034,133, Wengel et al.,

Sixty-five document US 8,080,644; Wengel et al., US 8,034,909; Wengel et al., US 8,153,365; Wengel et al., US 7,572,582; and Ramasamy et al., US 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., US 7,547,684; Seth et al., US 7,666,854; Seth et al., US 8,088,746; Seth et al., US paper 7,750,131; Seth et al., US 8,030,467; Seth et al., US 8,268,980; Seth et al., US 8,546,556; Seth et al., US 8,530,640; Migawa et al., US 9,012,421; Seth et al., US 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined according to their isomeric configuration. For example, an LNA nucleoside (described herein) can take the α-L configuration or the β-D configuration.

<img file="ECSP21040508A_D0005.tif" />

LNA (β-D configuration) α-L-LNA (α-L configuration) bridging = 4'-CH2-O-2' bridging = 4'-CH2-O-2'

Bicyclic nucleosides of the α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA type have been incorporated into oligonucleotides that exhibited antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365 -6372). Herein, the general descriptions of bicyclic nucleosides include both isomeric configurations. When specific nucleoside positions (eg, LNA or cEt) are identified in illustrative embodiments herein, they assume the β-D configuration, unless otherwise specified.

In certain embodiments, the modified sugar moieties comprise one or more non-bridged sugar substituents and one or more bridged sugar substituents (e.g., 5'-substituted and bridged 4'-position sugars). 2').

In certain embodiments, the modified sugar moieties are sugar substitutes. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, for example, by a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties further comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar substitutes comprise a sulfur atom at the 4' position and a substitution at the 2' position (see, for example, Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and /or the 5' position.

Sixty-six

In certain embodiments, sugar substitutes comprise rings containing a number of atoms other than 5. For example, in certain embodiments, a sugar substitute comprises a six-membered tetrahydropyran (THP). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, a hexitol nucleic acid (HNA), anitol nucleic acid (ANA), mannitol nucleic acid (MNA) (see, for example, Leumann, CJ. Bioorg. &amp; Med. Chem. 2002, 10, 841-854), fluoro HNA:

yO'T^Bx

F

F-HNA (F-HNA, see, for example, Swayze et al., US 8,088,904; Swayze et al., US 8,440,803; and Swayze et al., US 9,005,906, F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran) and nucleosides comprising modified THP compounds having the formula:

<img file="ECSP21040508A_D0006.tif" />

where, independently, for each of said modified THP nucleosides:

Bx is a nitrogenous base moiety;

T3 and T4 are each, independently, an internucleoside linking group that links the modified THP nucleoside to the residue of an oligonucleotide or one of T3 and T4 is an internucleoside linker that links the THP nucleoside to the residue of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a conjugated linking group, or a 5' or 3' end group; qi, q2, q3, q4, q5, q6 and q? are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and Ri and R2 are each independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJi, N3, OC(=X)Ji, OC(=X)NJiJ2, NJ3C(=X)NJiJ2, and CN, where X is O, S, or NJi and each Ji, J2, and J3 is independently H or C1-C6 alkyl.

In certain embodiments, modified THP nucleosides are provided, where qi, q2, q3, q4, q5, q6, and q? are each H. In certain embodiments, at least one of the groups qi, q2, q3, q4, q5, q6, and q? is not H. In certain embodiments, at least one of the groups qi, q2, q3, q4, what5, what6 and what? it's methyl. In certain embodiments, modified THP nucleosides are provided, where one of the Ri and R2 groups is F.

Sixty-seven In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

In certain embodiments, the sugar substitutes comprise rings containing more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685 ; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). The term morpholino, as used herein, refers to a sugar substitute having the following structure:

<img file="ECSP21040508A_D0007.tif" />

In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituent groups to the above morpholino structure. Such sugar substitutes are referred to herein as modified morpholinos.

In certain embodiments, the sugar substitutes comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar substitutes include, without limitation: a peptide nucleic acid (PNA), acyclic butyl nucleic acid (see, for example, Kumar et al., Org. Biomol. Chem., 2013 , 11, 5853-5865) and nucleosides and oligonucleotides described in Mancharan et al., US2013/130378.

Many other ring systems are known in the art that are sugar substitutes and bicyclic and tricyclic sugars that can be used in the modified nucleosides.

2. MODIFIED NITROGEN BASES

Modifications or substitutions of nitrogenous bases (or bases) differ structurally from naturally occurring or synthetic unmodified nitrogenous bases, even though they are functionally interchangeable with them. Both natural and modified nitrogenous bases are capable of participating in hydrogen bonding. Such nucleobase modifications may confer nuclease stability, binding affinity, or some other beneficial biological properties to antisense compounds.

In certain embodiments, the compounds described herein comprise modified oligonucleotides. In certain embodiments, the modified oligonucleotides comprise one or more nucleosides that comprise an unmodified nitrogenous base. In certain embodiments, the oligonucleotides

Sixty-eight modified ones comprise one or more nucleosides comprising a modified nitrogenous base. In certain embodiments, the modified oligonucleotides comprise one or more nucleosides that do not comprise any nitrogenous bases, which are called abasic nucleosides.

In certain embodiments, the modified nitrogenous bases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nitrogenous bases are selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- propynyl (C=C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosiluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8 -thioalkyl, 8-hydroxy, 8-aza and other 8-substituted, 5-halo purines, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2 -N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl-4-N-benzoylcytosine,

5-methyl-4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Other modified nitrogenous bases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazafenoxazin-2-one (G-clamp ). Modified nitrogenous bases can also include those in which the purine or pyrimidine base has been replaced by other heterocycles, for example, 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nitrogenous bases include those disclosed in Merigan et al., US document 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley &amp; Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

Publications teaching the preparation of some of the aforementioned nitrogenous bases, as well as other modified nitrogenous bases include, without limitation, Manoharan et al., US2003/0158403, Manoharan et al., US2003/0175906; Dinh et al., US 4,845,205; Spielvogel et al., US 5,130,302; Rogers et al., US 5,134,066; Bischofberger et al., US 5,175,273; Urdea et al., document US 5,367,066; Benner et al., US 5,432,272; Matteucci et al., US 5,434,257; Gmeiner et al., US 5,457,187; Cook et al., US 5,459,255; Froehler et al., US 5,484,908; Matteucci et al., US 5,502,177; Hawkins et al., US 5,525,711; Haralambidis et al., US 5,552,540; Cook et al., US 5,587,469; Froehler et al., US 5,594,121; Switzer et al.,

Sixty-nine US 5,596,091; Cook et al., US 5,614,617; Froehler et al., US 5,645,985; Cook et al., US 5,681,941; Cook et al., US 5,811,534; Cook et al., US 5,750,692; Cook et al., US 5,948,903; Cook et al., US 5,587,470; Cook et al., US 5,457,191; Matteucci et al., US 5,763,588; Froehler et al., US 5,830,653; Cook et al., document US 5,808,027; Cook et al., US 6,166,199; and Matteucci et al., US 6,005,096.

In certain embodiments, compounds targeted to a FOXP3 nucleic acid comprise one or more modified nitrogenous bases. In certain embodiments, the modified nitrogenous base is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

3. MODIFIED NUCLEOSIDE LINKAGES

The bond between naturally occurring nucleosides of RNA and DNA is a 3' to 5' phosphodiester bond. In certain embodiments, compounds described herein having one or more modified, i.e., non-naturally occurring, internucleoside linkages are typically selected from compounds having naturally occurring internucleoside linkages because of their desirable properties, such as eg, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, the populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages, wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in the random selection of the stereochemical configuration of each phosphorothioate linkage. However, as will be well understood by those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides that comprise one or more phosphorothioate internucleoside linkages in a particular independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the union of type

Seventy particular phosphorothioate is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, for example, the methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014) and document WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate indicated in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides that have at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising phosphorothioates (Rp) and/or (S p) comprise one or more of the following formulas, respectively, where B indicates a nitrogenous base:

<img file="ECSP21040508A_D0008.tif" />

<img file="ECSP21040508A_D0009.tif" />

Unless otherwise indicated, the chiral internucleoside linkages of modified oligonucleotides described herein may be stereorandom or in a particular stereochemical configuration.

In certain embodiments, compounds targeted to a FOXP3 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

In certain embodiments, the compounds described herein comprise oligonucleotides. Oligonucleotides with modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom, as well as internucleoside linkages that do not contain any phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods for preparing phosphorous-containing and non-phosphorus-containing joints are in common use.

In certain embodiments, the nucleosides of the modified oligonucleotides can be linked together using any internucleoside linkage. the two classes

Seventy-one major internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphates, which contain a phosphodiester (P=O) bond (also called naturally occurring or unmodified linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (P =S), and phosphorodithioates (HS-P=S). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-) ; siloxane (-O-SIH2-O-) and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, as compared to naturally occurring phosphate-like linkages, can be used to alter, usually increase, the nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages containing a chiral atom can be prepared as a racemic mixture or as separate enantiomers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Those skilled in the art will be familiar with methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages.

Neutral internucleoside linkages include, but are not limited to, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N( H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl and thioformacetal ( 3'-S-CH2-O-5'). Other neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester, and amides (see, for example: Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds. ., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Other neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

In certain embodiments, the oligonucleotides comprise modified internucleoside junctions arranged along the oligonucleotide or a region thereof following a defined pattern or modified internucleoside junction motif. In certain embodiments, the internucleoside linkages are arranged following a gap-like motif. In such embodiments, the internucleoside linkages in each of the two flanking regions are different from the internucleoside linkages in the gap region. In certain embodiments, the internucleoside linkages in the flanking regions are of the phosphodiester type and the internucleoside linkages in the gap region are of the phosphorothioate type. The nucleoside motif is selected independently, such that such oligonucleotides having a gap-type internucleoside junction motif may or may not have a gap-type nucleoside motif and, if they have a nucleoside motif of the hollow type, the lengths of the side regions and the hollow region may or may not be the same.

In certain embodiments, the oligonucleotides comprise a region that

Seventy-one contains an alternate internucleoside splicing motif. In certain embodiments, the oligonucleotides comprise a region of uniformly modified internucleoside junctions. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate, and at least one internucleoside linkage is of the phosphorothioate type.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located at most 3 nucleosides from the 3' end of the oligonucleotide.

In certain embodiments, the oligonucleotides comprise one or more methylphosphonate linkages. In certain embodiments, oligonucleotides having a gapmer-type nucleoside motif comprise a linkage motif comprising all phosphorothioate-type linkages except one or two methylphosphonate-type linkages. In certain embodiments, a methylphosphonate-type linkage is found in the core gap of an oligonucleotide having a gapmer-type nucleoside motif.

In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages such that nuclease resistance is maintained. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate nucleoside linkages and the number and position of phosphodiester nucleoside linkages such that nuclease resistance is maintained. In certain embodiments, the number of phosphorothioate internucleoside linkages can be reduced and the number of phosphodiester nucleoside interlinkages can be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages can be reduced and the number of phosphodiester nucleoside linkages can be increased, while still maintaining nuclease resistance. In certain embodiments, it is desirable

Seventy-three reduce the number of phosphorothioate internucleoside linkages while preserving nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester internucleoside linkages while maintaining nuclease resistance.

CERTAIN REASONS

In certain embodiments, the compounds described herein comprise oligonucleotides. The oligonucleotides may have a motif, eg, a pattern of modified and/or unmodified sugar residues, nitrogenous bases, and/or internucleoside linkages. In certain embodiments, the modified oligonucleotides comprise one or more modified nucleosides that comprise a modified sugar. In certain embodiments, the modified oligonucleotides comprise one or more modified nucleosides that comprise a modified nitrogenous base. In certain embodiments, the modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nitrogenous bases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar residues, nitrogenous bases, and internucleoside linkages are each independent of the others. Thus, a modified oligonucleotide can be described according to its sugar motif, nitrogenous base motif, and/or internucleoside splicing motif (the nitrogenous base motif, as used herein, describes modifications to independent nitrogenous bases). of the sequence of nitrogenous bases).

A. CERTAIN SUGAR REASONS

In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise one or more types of modified sugar residues and/or unmodified sugar residues arranged along the oligonucleotide or region thereof following a defined pattern or sugar motif. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications mentioned herein.

In certain embodiments, the modified oligonucleotides comprise or consist of a region having a gapmer motif, which contains two outer regions or lateral segments and a central or inner region or gap. The three regions of a gapmer motif (the 5' side segment, the gap, and the 3' side segment) form a contiguous nucleoside sequence where at least some of the nucleoside sugar residues in each of the side segments differ. of at least some of the sugar moieties of the nucleosides in the gap. Specifically, at least the sugar residues of the nucleosides in each side segment that are closest to the gap (the nucleoside closest to the 3' position of the 5' side segment and the nucleoside closest to the 5' position of the 3' side segment). ') differ from the rest of

Seventy-four sugars of adjacent gap nucleosides, thus defining the boundary between the flanks and the gap (ie, the flank/gap intersection). In certain embodiments, the sugar moieties within the void are the same as one another. In certain embodiments, the gap includes one or more nucleosides that have a sugar moiety that differs from the sugar moiety of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two side segments are the same as each other (symmetrical gapped oligomer). In certain embodiments, the 5' side segment sugar motif differs from the 3' side segment sugar motif (asymmetric gapped oligomer).

In certain embodiments, the side segments of a gapped oligomer comprise 1-5 nucleosides. In certain embodiments, the side segments of a gapped oligomer comprise 2-5 nucleosides. In certain embodiments, the side segments of a gapped oligomer comprise 3-5 nucleosides. In certain embodiments, the nucleosides of a gapped oligomer are all modified nucleosides.

In certain embodiments, the gap of a gapped oligomer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapped oligomer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapped oligomer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapped oligomer comprises 10 nucleosides. In a certain embodiment, each gap nucleoside of a gapmer is an unmodified 2'-deoxy nucleoside.

In certain embodiments, the gapped oligomer is a deoxy gapped oligomer. In such embodiments, the nucleosides in the gapped oligomer portion of each sidebar/gap intersection are unmodified 2'-deoxynucleosides and the nucleosides in the sidebar portions of each sidebar/gap intersection are modified nucleosides. In certain such embodiments, each nucleoside in the gap is an unmodified 2'-deoxynucleoside. In certain such embodiments, each nucleoside in each side segment is a modified nucleoside.

In certain embodiments, a modified oligonucleotide has a completely modified sugar motif, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside in the region comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotides comprise or consist of a region having a fully modified sugar moiety, where each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a

Seventy-five uniformly modified comprise the same 2' modification.

In certain embodiments, a modified oligonucleotide may comprise a sugar motif described in Swayze et al., US2010/0197762; Freier et al., document US2014/0107330; Freier et al., US2015/0184153; and Seth et al., US2015/0267195, each of which is incorporated herein by reference in its entirety.

Certain embodiments provided herein are directed to modified oligomeric compounds useful for inhibiting the expression of target nucleic acids, which may be useful for treating, preventing, ameliorating, or slowing the progression of a disease associated with said target nucleic acid. In certain embodiments, the modified oligomeric compounds comprise antisense oligonucleotides that are gapmers having certain sugar motifs. In certain embodiments, the gapmer sugar motifs provided herein can be combined with any nucleobase sequence and any internucleoside linkage motif to form potent antisense oligonucleotides.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a 16 linked nucleoside long modified oligonucleotide having the motif: ekk-d9-kkee, where d represents a 2' sugar -deoxyribose, k represents a cEt nucleoside, and e represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject is afflicted with cancer. In certain embodiments, administration of the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified 16 nucleoside linked oligonucleotide in length having the motif: k-d9-kekeke, where d represents a 2' sugar -deoxyribose, k represents a cEt nucleoside, and e represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject is afflicted with cancer. In certain embodiments, administration of the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified 16 nucleoside linked oligonucleotide in length having the motif: kkk-d8-kekek, where d represents a 2' sugar -deoxyribose, k represents a cEt nucleoside, and e represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject is afflicted with cancer. In certain embodiments, administration of the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified 16 nucleoside linked oligonucleotide in length having the motif: kkk-d9-keke, where d represents a 2' sugar -deoxyribose, k represents a cEt nucleoside, and

Seventy-six e represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject is afflicted with cancer. In certain embodiments, administration of the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified 16-linked nucleoside oligonucleotide in length having the motif: kk-d9-kdkdk, where d represents a 2' sugar -deoxyribose, k represents a cEt nucleoside, and e represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject is afflicted with cancer. In certain embodiments, administration of the compound to the subject treats the subject's cancer.

In certain embodiments, a compound comprises a modified oligonucleotide 16 linked nucleosides in length having the motif: kk-d9-eeekk, where d represents a 2'-deoxyribose sugar, k represents a cEt nucleoside, and e represents a nucleoside of cEt. 2'-MOE. In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified 16-linked nucleoside oligonucleotide in length having the motif: kk-d9-eeekk, where d represents a 2' sugar -deoxyribose, k represents a cEt nucleoside, and e represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject is afflicted with cancer. In certain embodiments, administration of the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified 16 nucleoside linked oligonucleotide in length having the motif: kk-d9-ekeke, where d represents a 2' sugar -deoxyribose, k represents a cEt nucleoside, and e represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject is afflicted with cancer. In certain embodiments, administration of the compound to the subject treats the subject's cancer.

B. CERTAIN MOTIVES OF NITROGENOUS BASES

In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and/or unmodified nitrogenous bases arranged along the oligonucleotide or a region thereof following a defined motif or pattern. In certain embodiments, each nitrogenous base is modified. In certain embodiments, none of the nitrogenous bases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytokine is modified. In certain embodiments, some or all of the cytosine-like nitrogenous bases in a modified oligonucleotide are 5-methylcytosines.

Seventy-seven

In certain embodiments, the modified oligonucleotides comprise a block of modified nitrogenous bases. In certain such embodiments, the block is located at the 3' end of the oligonucleotide. In certain embodiments, the block is located no more than 3 nucleosides from the 3' end of the oligonucleotide. In certain embodiments, the block is located at the 5' end of the oligonucleotide. In certain embodiments, the block is located no more than 3 nucleosides from the 5' end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapped oligomer motif comprise a nucleoside comprising a modified nitrogenous base. In certain such embodiments, a nucleoside comprising a modified nitrogenous base is positioned in the core gap of an oligonucleotide having a gapped oligomer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nitrogenous base is selected from: a 2-thiopyrimidine and a 5-propinopyrimidine.

C. CERTAIN MOTIVES OF BINDINGS BETWEEN NUCLEOSIDES

In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or a region thereof following a defined motif or pattern. In certain embodiments, essentially each internucleoside linkage group is a phosphate (P=O) internucleoside linkage. In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate internucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapped oligomer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the flanking segments are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified.

4. CERTAIN MODIFIED OLIGONUCLEOTIDES

In certain embodiments, the compounds described herein comprise modified oligonucleotides. In certain embodiments, the above modifications (sugar, nitrogenous base, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, the modified oligonucleotides are characterized by their modification, motifs, and overall lengths. In certain embodiments, such parameters are independent of each other. Therefore, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapped oligomer sugar motif may be modified or unmodified and may or may not follow the pattern of

Seventy-eight modification of the oligomer with gaps from the modifications of the sugars. For example, the internucleoside linkages within the flank regions of a gapped oligomer sugar may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Similarly, such gapmer-like oligonucleotides may comprise one or more modified nitrogenous bases independent of the gapmer pattern of sugar modifications. Furthermore, in certain cases, an oligonucleotide is described by a general length or range and by lengths or length ranges of two or more regions (for example, regions of nucleosides having specified sugar modifications), in such cases, it may be possible selecting numbers for each interval that result in an oligonucleotide having an overall length that lies outside the specified interval. In such circumstances, both elements must be fulfilled. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B and C, where region A consists of 2-6 linked nucleosides having a specified modified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif and region C consists of 2-6 linked nucleosides having a specified modified sugar motif. Such embodiments do not include modified oligonucleotides, where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (although these numbers of nucleosides are allowed among the requirements for A, B and C) because the overall length of said oligonucleotide is 22, which exceeds the upper limit of the general length of the modified oligonucleotide (20). Herein, if a description of an oligonucleotide is silent about one or more parameters, such parameters are not limited. Thus, a modified oligonucleotide, which has only been described as having a sugar gap oligomer motif without further description, may have any length, internucleoside splicing motif and nitrogenous base motif. Unless otherwise indicated, all modifications are independent of the nucleobase sequence.

CERTAIN CONJUGATED COMPOUNDS

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally, one or more conjugate groups and/or end groups. Conjugated groups consist of one or more conjugated moieties and a conjugated linker that joins the conjugated moiety to the oligonucleotide. Conjugated groups can be attached to either or both ends of an oligonucleotide and/or to any internal position. In certain embodiments, the conjugate groups are attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either end or both ends of an oligonucleotide are end groups. In certain embodiments of this type, the conjugate groups or end groups are

Seventy-nine linked to the 3' and/or 5' end of the oligonucleotides. In certain such embodiments, conjugate groups (or end groups) are attached to the 3' end of the oligonucleotides. In certain embodiments, the conjugate groups are linked near the 3' end of the oligonucleotides. In certain embodiments, conjugate groups (or end groups) are attached to the 5' end of the oligonucleotides. In certain embodiments, the conjugate groups are linked near the 5' end of the oligonucleotides.

In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a compound has a sequence of nitrogenous bases that is complementary to a target nucleic acid. In certain embodiments, the oligonucleotides are complementary to a messenger RNA (mRNA). In certain embodiments, the oligonucleotides are complementary to a sense transcript.

Examples of end groups include, but are not limited to, conjugated groups, blocking groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. CERTAIN CONJUGATED GROUPS

In certain embodiments, the oligonucleotides are covalently attached to one or more conjugated groups. In certain embodiments, the conjugated groups modify one or more properties of the bound nucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, loading and removal. In certain embodiments, the conjugated groups confer a new property to the attached oligonucleotide, eg, fluorophores or reporter groups that enable detection of the oligonucleotide.

Certain conjugated groups and conjugated moieties have been previously described, for example: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Mancharan et al. , Bioorg. Med. Chern. Lett., 1994, 4, 1053-1060), a thioether, for example, hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sel., 1992, 660, 306-309 Manoharan et al., Bioorg Med Chern Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucí. Acids Res., 1992, 20, 533-538), an aliphatic chain, for example, do-decanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, for example, di-hexadecyl-rac-glycerol or 1,2 triethylammonium -di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nuci. Acids Res., 1990, 18, 3777-3783), a polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides &amp; Nucleotides, 1995, 14, 969-973) or acetic adamantane, a palmityl moiety (Mishra et al. , Biochim. Biophys. Acta, 1995, 1264, 229-237), -an octadecylamine or hexylamino-carbonyl-oxy-cholesterol moiety (Crooke et al., J. Pharmacol. Exp. Then, 1996, i,

Eighty

923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038/mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740) or a GalNAc pool (eg WO2014/179620).

1. CONJUGATED REMAINS

Conjugated moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (eg, GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugated moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-acid -triiodobenzoic, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfonamide, an antidiabetic agent, an antibacterial agent, or an antibiotic.

2. CONJUGATED CONNECTORS

The conjugated moieties are attached to the oligonucleotides through conjugated linkers. In certain compounds, a conjugated group is a single chemical bond (ie, the conjugated moiety is attached to an oligonucleotide via a conjugated linker via a single bond). In certain embodiments, the conjugated linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

In certain embodiments, a conjugated linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamine. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorous moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linker moieties, eg, those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a

Eighty-one compound and the other is selected to bind to a conjugate group. Some examples of functional groups used in a bifunctional linking moiety include, but are not limited to, electrophilic to react with nucleophilic groups and nucleophilic to react with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugated linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO),

succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl, where a non-limiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, the conjugated linkers comprise 1-10 linker nucleosides. In certain embodiments, said linker nucleosides are modified nucleosides. In certain embodiments, said linker nucleosides comprise a modified sugar moiety. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine, or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine,

6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is normally desirable that the linker nucleosides be cleaved from the compound after it reaches a target tissue. Consequently, the linker nucleosides are normally linked to each other and to the rest of the compound by cleavable bonds. In certain embodiments, said cleavable bonds are phosphodiester bonds.

Herein, the linker nucleosides are not considered part of the oligonucleotide. Accordingly, in embodiments where a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percentage of complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a linker conjugate comprising linker nucleosides, linker nucleosides are not taken into account for the length of the oligonucleotide and are not used to determine the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, a compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugated group comprising 1-10 linker nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is greater than 30. Alternatively, a compound can

Eighty-one I mean a modified oligonucleotide consisting of 8-30 nucleosides and no conjugated groups. The total number of contiguous linked nucleosides in said compound is no more than 30. Unless otherwise indicated, conjugated linkers comprise no more than 10 linker nucleosides. In certain embodiments, linker conjugates comprise no more than 5 linker nucleosides. In certain embodiments, linker conjugates comprise no more than 3 linker nucleosides. In certain embodiments, linker conjugates comprise no more than 2 linker nucleosides. In certain embodiments, linker conjugates comprise no more than 1 linker nucleoside.

In certain embodiments, it is desirable that a conjugated group be cleaved from the oligonucleotide. For example, under certain circumstances, compounds comprising a particular conjugated moiety are better taken up by a particular cell type, but once the compound has been taken up, it is desirable that the conjugated moiety be cleaved to release the unconjugated oligonucleotide or original. Therefore, certain conjugates may comprise one or more cleavable moieties, typically within the conjugated linker. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms that comprises at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved within a cell or subcellular compartment such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes such as nucleases.

In certain embodiments, a cleavable bond is selected from: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugated moiety or conjugated group.

In certain embodiments, a cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are attached to each other and/or to the remainder of the compound via cleavable bonds. In certain embodiments, said cleavable linkages are unmodified phosphodiester linkages. In certain embodiments, a cleavable moiety is a 2'-deoxynucleoside that is attached to the 3'- or 5'-terminal nucleoside of an oligonucleotide via an internucleoside phosphate linkage and is covalently attached to the conjugate linker moiety or conjugated moiety via a cleavable moiety. phosphate or phosphorothioate. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

COMPOSITIONS AND METHODS FOR FORMULATING PHARMACEUTICAL COMPOSITIONS

The compounds described herein can be mixed with pharmaceutically acceptable active or inert substances for the preparation of

Eighty-three pharmaceutical compositions or formulations. The compositions and methods of formulating the pharmaceutical compositions depend on a number of criteria, including, but not limited to, the route of administration, the degree of disease, or the dose to be administered.

Certain embodiments provide pharmaceutical compositions that comprise one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compounds. In certain embodiments, such a pharmaceutical composition consists of a sterile saline solution and one or more compounds. In certain embodiments, the sterile saline solution is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compounds and sterile water. In certain embodiments, a pharmaceutical composition consists of a compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compounds and phosphate buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compounds and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. The compositions and methods of formulating the pharmaceutical compositions depend on a number of criteria, including, but not limited to, the route of administration, the degree of disease, or the dose to be administered.

A compound described herein targeted to a FOXP3 nucleic acid can be used in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, the methods described herein employ a pharmaceutical composition comprising a compound that targets a FOXP3 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, when administered to an animal, including a human, is capable of providing (directly or indirectly). ) the biologically active metabolite or a residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or

Eighty-four consists of a modified oligonucleotide. Accordingly, for example, the disclosure also refers to pharmaceutically acceptable salts of the compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound, which are cleaved by endogenous nucleases in the body, to form the active compound.

In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

EXAMPLES

The following Examples describe the screening process to identify the most prominent compounds that target FOXP3. Of the more than 3,000 oligonucleotides that were evaluated, IONs 1062428, 1062641, 1062835, 1062937, 1063268, 1063649, 1063655, 1063734, 1064096, or 1064313 emerged as the top most prominent compounds.

NON-LIMITING DESCRIPTION AND INCORPORATION BY REFERENCE

Although the sequence listing that accompanies this presentation identifies each sequence as RNA or DNA as necessary, in reality, these sequences can be modified with any combination of chemical modifications. The person skilled in the art will readily understand that such a designation as RNA or DNA to describe the modified oligonucleotides is, in certain cases, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2'-OH sugar moiety and a thymine base could be described as DNA having a modified sugar (2'-OH instead of the natural 2'-H of DNA). or as an RNA that has a modified base (thymine (methylated uracil) instead of the natural uracil of the RNA).

Accordingly, the nucleic acid sequences provided herein including, but not limited to, those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA including, but not limited to, such nucleic acids having modified nitrogenous bases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence ATCGATCG encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified including, but not limited to, such compounds comprising RNA Bases, such as those with the sequence AUCGAUCG and those with some DNA bases and some RNA bases such as AUCGATCG and compounds that have other modified nitrogenous bases such as AT^mCGAUCG, where^mC indicates a cytosine base comprising a methyl group at position 5.

Although certain compounds, compositions, and methods described herein

Eighty-five documents have been specifically described in connection with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to be limiting thereto. Each of the references listed in the present application are incorporated herein by reference in their entirety.

EXAMPLE 1: ANTISENSE INHIBITION OF HUMAN FOXP3 IN LNCAP CELLS BY CET GAPMERES

Modified oligonucleotides targeting a Foxp3 nucleic acid were designed and their effect at the Foxp3 mRNA level was assessed in vitro. The modified oligonucleotides were evaluated in a series of experiments having similar culture conditions. The results for each experiment are presented in the separate tables below. LNCaP cells grown at a density of 30,000 cells per well were transfected by electroporation with 3,000 nM of modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and Foxp3 mRNA levels were measured by real-time quantitative RT-PCR. The RTS35925 human primer and probe set (direct sequencing) was used.

CTACTTCAAGTTCCACAACATGC, referred to herein as SEQ ID NO: 6; reverse sequence CCAGTGGTAGATCTCATTGAGTG, referred to herein as SEQ ID NO: 7; probe sequence

CCTTTCACCTACGCCACGCTCAT, referred to herein as SEQ ID NO: 8) to quantify mRNA levels. Foxp3 mRNA levels were adjusted according to total RNA content, quantified by RIBOGREEN®. Results are presented in the tables below as percent Foxp3 mRNA amount control relative to untreated control cells (% UTC). Oligonucleotides with control percentage values ​​marked with an asterisk (*) target the amplicon region of the primer and probe set. Additional assays can be used to measure the potency and efficiency of the modified oligonucleotides that target the amplicon region.

The newly designed oligonucleotides in the tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, where the central gap segment comprises ten 2'-deoxynucleosides and is flanked by lateral segments in the 5' direction and in the 3' direction comprising three nucleosides each. Each nucleoside in the 5' flanking segment and each nucleoside in the 3' flanking segment possesses a cEt-like sugar modification. The internucleoside linkages along each gapped oligomer are phosphorothioate (P=S) linkages. All cytosine residues along each gapped oligomer are 5-methylcytosines.

The start site indicates the nucleoside closest to the 5' position that the gapped oligomer targets in the human gene sequence. The termination site indicates the nucleoside closest to the 3' position that the gapped oligomer has as

Eighty-six target in the human gene sequence. Each gapmer listed in the tables below addresses SEQ ID NO: 1 (GENBANK reference # NM_014009.3) or SEQ ID NO: 2 (the complement of GENBANK reference # NT_011568.12 truncated between nucleotides 11907130 to 11921808) or SEQ ID NO: 3 (GENBANK reference no. 5 NM_001114377.1) or SEQ ID NO: 4 (the complement of GENBANK reference no.

NC_000023.11 truncated between nucleotides 49247001 to 49273000) or SEQ ID NO: 5 (UCSC reference no. UC064ZFP.1 corresponding to genomic coordinates chrX:49,251,334-49,259,240 or set GRCh38/hg38). N/A indicates that the antisense oligonucleotide does not target that particular gene sequence with 10-100% complementarity. ND indicates that the % UTC has not been defined for that particular modified oligonucleotide in that particular experiment. The activity of that modified oligonucleotide can be defined in a different experiment.

TABLE 1

INHIBITION OF FOXP3 RNA BY GAPMERES 3-10-3 CET 15 TARGETING SEQ ID NO: 1 AND 2

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 895287</td><td> 1168</td><td> 1183</td><td> 12038</td><td> 12053</td><td>TTGAAGTAGTCCATGT</td><td> 58*</td><td> 9</td>

<td> 910921</td><td> 7</td><td> 22</td><td> 407</td><td> 422</td><td>AllllllCGATGAGT</td><td> 49</td><td> 10</td>

<td> 910925</td><td> 77</td><td> 92</td><td> 477</td><td> 492</td><td>1 ll lAlACCGAGAAGA</td><td> 45</td><td> 11</td>

<td> 910929</td><td> 376</td><td> 391</td><td> 6914</td><td> 6929</td><td>TGCGATGGTGGCATGG</td><td> 44</td><td> 12</td>

<td> 910933</td><td> 564</td><td> 579</td><td> 7727</td><td> 7742</td><td>GGCTGATCATGGCTGG</td><td> 35</td><td> 13</td>

<td> 910937</td><td> 765</td><td> 780</td><td> 8411</td><td> 8426</td><td>CACCATTTGCCAGCAG</td><td> 50</td><td> 14</td>

<td> 910941</td><td> 1000</td><td> 1015</td><td>N/A</td><td>N/A</td><td>TCGGATGATGCCACAG</td><td> 42</td><td> 15</td>

<td> 910945</td><td> 1144</td><td> 1159</td><td>N/A</td><td>N/A</td><td>AACTCTGGGAATGTGC</td><td> 72</td><td> 16</td>

<td> 910949</td><td> 1416</td><td> 1431</td><td> 13826</td><td> 13841</td><td>TGCGGAACTCCAGCTC</td><td> 127</td><td> 17</td>

<td> 910953</td><td> 1591</td><td> 1606</td><td> 14001</td><td> 14016</td><td>GTGGAAACCTCACTTC</td><td> 62</td><td> 18</td>

<td> 910957</td><td> 1802</td><td> 1817</td><td> 14212</td><td> 14227</td><td>GAAGTAATCTGTGCGA</td><td> 37</td><td> 19</td>

<td> 910961</td><td> 2114</td><td> 2129</td><td> 14524</td><td> 14539</td><td>GAATTCTAACAGGCCG</td><td> 36</td><td> 20</td>

<td> 910965</td><td> 2216</td><td> 2231</td><td> 14626</td><td> 14641</td><td>GGTA llll GGCAAGG</td><td> 23</td><td> 21</td>

<td> 910969</td><td> 2336</td><td> 2351</td><td>N/A</td><td>N/A</td><td>CGGTACTGTGGGTTGG</td><td> 19</td><td> 22</td>

<td> 910973</td><td> 1851</td><td> 1866</td><td> 14261</td><td> 14276</td><td>AGGGACAGGATTGTGA</td><td> 54</td><td> 23</td>

<td> 910977</td><td> 726</td><td> 741</td><td>N/A</td><td>N/A</td><td>CCGAAAGGGTGCTGTC</td><td> 81</td><td> 24</td>

<td> 910981</td><td> 164</td><td> 179</td><td>N/A</td><td>N/A</td><td>GTCCAAGGGCAGGCTT</td><td> 44</td><td> 25</td>

<td> 910985</td><td> 618</td><td> 633</td><td> 7781</td><td> 7796</td><td>GGCCAGGCCGGGCCTT</td><td> 88</td><td> 26</td>

<td> 910989</td><td> 63</td><td> 78</td><td> 463</td><td> 478</td><td>GAAAAACCACGCTGTA</td><td> 65</td><td> 27</td>

<td> 910993</td><td> 772</td><td> 787</td><td> 8418</td><td> 8433</td><td>TTGCAGACACCATTTG</td><td> 88</td><td> 28</td>

<td> 911000</td><td> 1267</td><td> 1282</td><td> 13497</td><td> 13512</td><td>TGGTAGATCTCATTGA</td><td> 69*</td><td> 29</td>

<td> 911004</td><td> 2108</td><td> 2123</td><td> 14518</td><td> 14533</td><td>TAACAGGCCGTGTGTG</td><td> 72</td><td> 30</td>

<td> 911008</td><td> 1859</td><td> 1874</td><td> 14269</td><td> 14284</td><td>GTTGAGTGAGGGACAG</td><td> 54</td><td> 31</td>

<td> 911012</td><td> 2272</td><td> 2287</td><td>N/A</td><td>N/A</td><td>AGGCATGGATCAGGGC</td><td> 32</td><td> 32</td>

<td> 911016</td><td> 57</td><td> 72</td><td> 457</td><td> 472</td><td>CCACGCTGTACGGTGT</td><td> 39</td><td> 33</td>

<td> 911020</td><td> 1257</td><td> 1272</td><td> 13487</td><td> 13502</td><td>CATTGAGTGTCCGCTG</td><td> 65*</td><td> 34</td>

<td> 911024</td><td> 382</td><td> 397</td><td> 6920</td><td> 6935</td><td>TGCAGCTGCGATGGTG</td><td> 59</td><td> 35</td>

Eighty-seven

<td> 911028</td><td> 1741</td><td> 1756</td><td> 14151</td><td> 14166</td><td>GGCTGCAGGGCTCGAC</td><td> 25</td><td> 36</td>

<td> 911032</td><td> 55</td><td> 70</td><td> 455</td><td> 470</td><td>ACGCTGTACGGTGTGG</td><td> 17</td><td> 37</td>

<td> 911036</td><td> 898</td><td> 913</td><td> 9488</td><td> 9503</td><td>AGAGACTGTACCATCT</td><td> 121</td><td> 38</td>

<td> 911040</td><td> 2112</td><td> 2127</td><td> 14522</td><td> 14537</td><td>ATTCTAACAGGCCGTG</td><td> 55</td><td> 39</td>

<td> 911044</td><td> 2110</td><td> 2125</td><td> 14520</td><td> 14535</td><td>TCTAACAGGCCGTGTG</td><td> 56</td><td> 40</td>

<td> 911048</td><td> 770</td><td> 785</td><td> 8416</td><td> 8431</td><td>GCAGACACCATTTGCC</td><td> 95</td><td> 41</td>

<td> 911052</td><td> 163</td><td> 178</td><td>N/A</td><td>N/A</td><td>TCCAAGGGCAGGCTTG</td><td> 76</td><td> 42</td>

<td> 911056</td><td> 2282</td><td> 2297</td><td>N/A</td><td>N/A</td><td>GTCTAAGCTGAGGCAT</td><td> 51</td><td> 43</td>

<td> 911060</td><td> 133</td><td> 148</td><td> 533</td><td> 548</td><td>CAGAAAAGGATCAGCC</td><td> 63</td><td> 44</td>

<td> 911064</td><td> 900</td><td> 915</td><td> 9490</td><td> 9505</td><td>CCAGAGACTGTACCAT</td><td> 90</td><td> 45</td>

<td> 911068</td><td>N/A</td><td>N/A</td><td> 8373</td><td> 8388</td><td>GCCGAAAGGGTGCTGG</td><td> 73</td><td> 46</td>

<td> 911072</td><td>N/A</td><td>N/A</td><td> 13638</td><td> 13653</td><td>TGCCTATGAGCCCAGA</td><td> 106</td><td> 47</td>

<td> 911076</td><td>N/A</td><td>N/A</td><td> 13697</td><td> 13712</td><td>CGTCAACCTCTGAGGC</td><td> 111</td><td> 48</td>

<td> 911080</td><td>N/A</td><td>N/A</td><td> 658</td><td> 673</td><td>GTACATCCCACTGTAC</td><td> 90</td><td> 49</td>

<td> 911084</td><td>N/A</td><td>N/A</td><td> 1386</td><td> 1401</td><td>GACAATGGTGTGAAGT</td><td> 36</td><td> 50</td>

<td> 911088</td><td>N/A</td><td>N/A</td><td> 1569</td><td> 1584</td><td>CTAATTTGGTTACAGA</td><td> 39</td><td> 51</td>

<td> 911092</td><td>N/A</td><td>N/A</td><td> 2137</td><td> 2152</td><td>GTTAATAACCATTCCA</td><td> 50</td><td> 52</td>

<td> 911096</td><td>N/A</td><td>N/A</td><td> 2390</td><td> 2405</td><td>CTCTATAGTAAATGGA</td><td> 78</td><td> 53</td>

<td> 911100</td><td>N/A</td><td>N/A</td><td> 2663</td><td> 2678</td><td>TAAATGCCCAGATCC</td><td> 54</td><td> 54</td>

<td> 911104</td><td>N/A</td><td>N/A</td><td> 3219</td><td> 3234</td><td>TGACAATTGCCCCTCT</td><td> 115</td><td> 55</td>

<td> 911108</td><td>N/A</td><td>N/A</td><td> 3358</td><td> 3373</td><td>TGCATTTCGGTGAGGC</td><td> 44</td><td> 56</td>

<td> 911112</td><td>N/A</td><td>N/A</td><td> 4082</td><td> 4097</td><td>AGATTTAAAGGATCCT</td><td> 60</td><td> 57</td>

<td> 911116</td><td>N/A</td><td>N/A</td><td> 4291</td><td> 4306</td><td>TGACATGGGTGCTGGT</td><td> 45</td><td> 58</td>

<td> 911120</td><td>N/A</td><td>N/A</td><td> 5167</td><td> 5182</td><td>GGTATTAAGTTCTTAG</td><td> 21</td><td> 59</td>

<td> 911124</td><td>N/A</td><td>N/A</td><td> 5704</td><td> 5719</td><td>GCTCATGCTACACCCCC</td><td> 37</td><td> 60</td>

<td> 911128</td><td>N/A</td><td>N/A</td><td> 5966</td><td> 5981</td><td>TGGATTGGGTGCAAAA</td><td> 60</td><td> 61</td>

<td> 911132</td><td>N/A</td><td>N/A</td><td> 6111</td><td> 6126</td><td>GACTTAATCTGAAGCT</td><td> 50</td><td> 62</td>

<td> 911136</td><td>N/A</td><td>N/A</td><td> 6376</td><td> 6391</td><td>CACTTGAGAGCTGTTT</td><td> 70</td><td> 63</td>

<td> 911140</td><td>N/A</td><td>N/A</td><td> 6642</td><td> 6657</td><td>TGAGATACTCGACCAC</td><td> 95</td><td> 64</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 24</td><td> 65</td>

<td> 911148</td><td>N/A</td><td>N/A</td><td> 7644</td><td> 7659</td><td>GCACATGTGGGCTGTG</td><td> 69</td><td> 66</td>

<td> 911152</td><td>N/A</td><td>N/A</td><td> 7964</td><td> 7979</td><td>ATCTTTAAGGTTCTGC</td><td> 23</td><td> 67</td>

<td> 911156</td><td>N/A</td><td>N/A</td><td> 8561</td><td> 8576</td><td>CTACTTATTGGGATGA</td><td> 50</td><td> 68</td>

<td> 911160</td><td>N/A</td><td>N/A</td><td> 8686</td><td> 8701</td><td>CTTATTATACATACGA</td><td> 77</td><td> 69</td>

<td> 911164</td><td>N/A</td><td>N/A</td><td> 8824</td><td> 8839</td><td>GATTCTAGAGCCTGGC</td><td> 39</td><td> 70</td>

<td> 911168</td><td>N/A</td><td>N/A</td><td> 9505</td><td> 9520</td><td>GCATTACCTGCTGCTC</td><td> 85</td><td> 71</td>

<td> 911172</td><td>N/A</td><td>N/A</td><td> 9603</td><td> 9618</td><td>CTTTATACCAGCCCTC</td><td> 68</td><td> 72</td>

<td> 911176</td><td>N/A</td><td>N/A</td><td> 9878</td><td> 9893</td><td>CCTGAATGTGAGGTTA</td><td> 51</td><td> 73</td>

<td> 911180</td><td>N/A</td><td>N/A</td><td> 10317</td><td> 10332</td><td>TGCTTTAACAACTCAG</td><td> 16</td><td> 74</td>

<td> 911184</td><td>N/A</td><td>N/A</td><td> 10546</td><td> 10561</td><td>TACATTCGCATCATGA</td><td> 33</td><td> 75</td>

<td> 911188</td><td>N/A</td><td>N/A</td><td> 10690</td><td> 10705</td><td>GTATTTATTAGAGCAC</td><td> 59</td><td> 76</td>

<td> 911192</td><td>N/A</td><td>N/A</td><td> 11343</td><td> 11358</td><td>AGGATTAGGAGCTTGG</td><td> 33</td><td> 77</td>

<td> 911196</td><td>N/A</td><td>N/A</td><td> 11615</td><td> 11630</td><td>GAATTACTTAGCAGGG</td><td> 47</td><td> 78</td>

<td> 911200</td><td>N/A</td><td>N/A</td><td> 11825</td><td> 11840</td><td>CCAAAATAGTTCTCCCC</td><td> 49</td><td> 79</td>

<td> 911204</td><td>N/A</td><td>N/A</td><td> 11885</td><td> 11900</td><td>AGGTACTGTTTGCTGA</td><td> 65</td><td> 80</td>

<td> 911208</td><td>N/A</td><td>N/A</td><td> 12242</td><td> 12257</td><td>CACATTTGAGGCACGG</td><td> 42</td><td> 81</td>

<td> 911212</td><td>N/A</td><td>N/A</td><td> 12289</td><td> 12304</td><td>AGGTTTGGATTTGCGG</td><td> 45</td><td> 82</td>

<td> 911216</td><td>N/A</td><td>N/A</td><td> 12398</td><td> 12413</td><td>GGCTAI 1 1 IAIGGGTC</td><td> 64</td><td> 83</td>

Eighty-eight-

<td> 911220</td><td>N/A</td><td>N/A</td><td> 12706</td><td> 12721</td><td>GGGAATATCTGGTATC</td><td> 62</td><td> 84</td>

<td> 911224</td><td>N/A</td><td>N/A</td><td> 12812</td><td> 12827</td><td>GATCAGTTTGGATTCA</td><td> 63</td><td> 85</td>

<td> 911228</td><td>N/A</td><td>N/A</td><td> 12898</td><td> 12913</td><td>GGACATGGTTAGGTGG</td><td> 61</td><td> 86</td>

TABLE 2

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910922</td><td> 11</td><td> 26</td><td> 411</td><td> 426</td><td>CCAAA III Illi CGA1</td><td> 61</td><td> 87</td>

<td> 910926</td><td> 80</td><td> 95</td><td> 480</td><td> 495</td><td>TGCI II IATACCGAGA</td><td> 11</td><td> 88</td>

<td> 910930</td><td> 485</td><td> 500</td><td> 7550</td><td> 7565</td><td>GTGCATGAAATGTGGC</td><td> 25</td><td> 89</td>

<td> 910934</td><td> 694</td><td> 709</td><td> 8271</td><td> 8286</td><td>GGATTTGGGAAGGTGC</td><td> 59</td><td> 90</td>

<td> 910938</td><td> 873</td><td> 888</td><td> 9463</td><td> 9478</td><td>GGAGACATTGTGCCCT</td><td> 45</td><td> 91</td>

<td> 910942</td><td> 1022</td><td> 1037</td><td> 11178</td><td> 11193</td><td>TACGATGCAGCAGGAG</td><td> 59</td><td> 92</td>

<td> 910946</td><td> 1174</td><td> 1189</td><td> 12044</td><td> 12059</td><td>TGGAACTTGAAGTAGT</td><td> 24*</td><td> 93</td>

<td> 910950</td><td> 1434</td><td> 1449</td><td> 13844</td><td> 13859</td><td>GCCTCTGGCTCCGTTT</td><td> 126</td><td> 94</td>

<td> 910954</td><td> 1656</td><td> 1671</td><td> 14066</td><td> 14081</td><td>CAAAGGATATGATGGG</td><td> 76</td><td> 95</td>

<td> 910958</td><td> 1896</td><td> 1911</td><td> 14306</td><td> 14321</td><td>GTGTACTGAGGCAGGC</td><td> 13</td><td> 96</td>

<td> 910962</td><td> 2116</td><td> 2131</td><td> 14526</td><td> 14541</td><td>GTGAATTCTAACAGGC</td><td> 25</td><td> 97</td>

<td> 910966</td><td> 2217</td><td> 2232</td><td> 14627</td><td> 14642</td><td>GGGTAIIIIII GGCAAG</td><td> 46</td><td> 98</td>

<td> 910970</td><td> 2360</td><td> 2375</td><td>N/A</td><td>N/A</td><td>AGCTCGGCTGCAGTTT</td><td> 41</td><td> 99</td>

<td> 910974</td><td> 434</td><td> 449</td><td> 7499</td><td> 7514</td><td>GCCCAGCCGTGCCCCG</td><td> 64</td><td> 100</td>

<td> 910978</td><td> 69</td><td> 84</td><td> 469</td><td> 484</td><td>CGAGAAGAAAAACCAC</td><td> 30</td><td> 101</td>

<td> 910982</td><td> 1464</td><td> 1479</td><td> 13874</td><td> 13889</td><td>GGCCAGGTGTAGGGTT</td><td> 75</td><td> 102</td>

<td> 910986</td><td> 1310</td><td> 1325</td><td> 13540</td><td> 13555</td><td>GGCAGGATGGTTTCTG</td><td> 99</td><td> 103</td>

<td> 910990</td><td> 500</td><td> 515</td><td> 7663</td><td> 7678</td><td>CACCGTTGAGAGCTGG</td><td> 39</td><td> 104</td>

<td> 910994</td><td> 768</td><td> 783</td><td> 8414</td><td> 8429</td><td>AGACACCATTTGCCAG</td><td> 62</td><td> 105</td>

<td> 910997</td><td> 148</td><td> 163</td><td> 548</td><td> 563</td><td>GGTGAAGTGGACTGAC</td><td> 25</td><td> 106</td>

<td> 911001</td><td> 1400</td><td> 1415</td><td> 13810</td><td> 13825</td><td>ATCCACGGTCCACACA</td><td> 96</td><td> 107</td>

<td> 911005</td><td> 1219</td><td> 1234</td><td>N/A</td><td>N/A</td><td>GCCCAGCGGATGAGCG</td><td> 33*</td><td> 108</td>

<td> 911009</td><td> 1657</td><td> 1672</td><td> 14067</td><td> 14082</td><td>GCAAAGGATATGATGG</td><td> 59</td><td> 109</td>

<td> 911013</td><td> 2277</td><td> 2292</td><td>N/A</td><td>N/A</td><td>AGCTGAGGCATGGATC</td><td> 62</td><td> 110</td>

<td> 911017</td><td> 1739</td><td> 1754</td><td> 14149</td><td> 14164</td><td>CTGCAGGGCTCGACTG</td><td> 50</td><td> 111</td>

<td> 911021</td><td> 902</td><td> 917</td><td> 9492</td><td> 9507</td><td>CTCCAGAGACTGTACC</td><td> 82</td><td> 112</td>

<td> 911025</td><td> 38</td><td> 53</td><td> 438</td><td> 453</td><td>AGCCGCAGACCTCTCT</td><td> 39</td><td> 113</td>

<td> 911029</td><td> 65</td><td> 80</td><td> 465</td><td> 480</td><td>AAGAAAAACCACGCTG</td><td> 70</td><td> 114</td>

<td> 911033</td><td> 2111</td><td> 2126</td><td> 14521</td><td> 14536</td><td>TTCTAACAGGCCGTGT</td><td> 57</td><td> 115</td>

<td> 911037</td><td> 818</td><td> 833</td><td> 8464</td><td> 8479</td><td>GAGGAAGTCCTCTGGC</td><td> 43</td><td> 116</td>

<td> 911041</td><td> 875</td><td> 890</td><td> 9465</td><td> 9480</td><td>GAGGAGACATTGTGCC</td><td> 43</td><td> 117</td>

<td> 911045</td><td> 879</td><td> 894</td><td> 9469</td><td> 9484</td><td>TCTGGAGGAGACATTG</td><td> 62</td><td> 118</td>

<td> 911049</td><td> 327</td><td> 342</td><td> 6865</td><td> 6880</td><td>CTCGAAGATCTCGGCC</td><td> 69</td><td> 119</td>

<td> 911053</td><td> 64</td><td> 79</td><td> 464</td><td> 479</td><td>AGAAAAAACCACGCTGT</td><td> 46</td><td> 120</td>

<td> 911057</td><td> 2109</td><td> 2124</td><td> 14519</td><td> 14534</td><td>CTAACAGGCCGTGTGT</td><td> 49</td><td> 121</td>

<td> 911061</td><td> 1850</td><td> 1865</td><td> 14260</td><td> 14275</td><td>GGGACAGGATTGTGAC</td><td> 53</td><td> 122</td>

<td> 911065</td><td> 1598</td><td> 1613</td><td> 14008</td><td> 14023</td><td>CAAGACAGTGGAAACC</td><td> 45</td><td> 123</td>

<td> 911069</td><td>N/A</td><td>N/A</td><td> 13585</td><td> 13600</td><td>GGCCATCCCAGTCACC</td><td> 72</td><td> 124</td>

Eighty-nine·

<td> 911073</td><td>N/A</td><td>N/A</td><td> 13670</td><td> 13685</td><td>ACCAACAACCCATCAT</td><td> 107</td><td> 125</td>

<td> 911077</td><td>N/A</td><td>N/A</td><td> 13663</td><td> 13678</td><td>ACCCACATCCCCGTTCC</td><td> 55</td><td> 126</td>

<td> 911081</td><td>N/A</td><td>N/A</td><td> 745</td><td> 760</td><td>ATTAAGTACTTCACCT</td><td> 75</td><td> 127</td>

<td> 911085</td><td>N/A</td><td>N/A</td><td> 1447</td><td> 1462</td><td>ATATGGACTCTGGTCA</td><td> 34</td><td> 128</td>

<td> 911089</td><td>N/A</td><td>N/A</td><td> 1828</td><td> 1843</td><td>AAAAATGCACGCCCCC</td><td> 62</td><td> 129</td>

<td> 911093</td><td>N/A</td><td>N/A</td><td> 2163</td><td> 2178</td><td>GCTATATATGTAATGG</td><td> 16</td><td> 130</td>

<td> 911097</td><td>N/A</td><td>N/A</td><td> 2522</td><td> 2537</td><td>ATAACCATTGCAGTAC</td><td> 33</td><td> 131</td>

<td> 911101</td><td>N/A</td><td>N/A</td><td> 2734</td><td> 2749</td><td>GTGAATAGTCAGTCCA</td><td> 21</td><td> 132</td>

<td> 911105</td><td>N/A</td><td>N/A</td><td> 3246</td><td> 3261</td><td>TCATTAGGTGTCTGCA</td><td> 17</td><td> 133</td>

<td> 911109</td><td>N/A</td><td>N/A</td><td> 3711</td><td> 3726</td><td>CAATCAAGG liliCGG</td><td> 35</td><td> 134</td>

<td> 911113</td><td>N/A</td><td>N/A</td><td> 4083</td><td> 4098</td><td>TAGATTTAAAGGATCC</td><td> 45</td><td> 135</td>

<td> 911117</td><td>N/A</td><td>N/A</td><td> 4442</td><td> 4457</td><td>CCAGAllllllCCGCCA</td><td> 48</td><td> 136</td>

<td> 911121</td><td>N/A</td><td>N/A</td><td> 5275</td><td> 5290</td><td>AGTATAGAAGGGTTCT</td><td> 38</td><td> 137</td>

<td> 911125</td><td>N/A</td><td>N/A</td><td> 5819</td><td> 5834</td><td>CAGCATGGCAAGTGAC</td><td> 66</td><td> 138</td>

<td> 911129</td><td>N/A</td><td>N/A</td><td> 6042</td><td> 6057</td><td>AGTGACATGGGllllA</td><td> 34</td><td> 139</td>

<td> 911133</td><td>N/A</td><td>N/A</td><td> 6197</td><td> 6212</td><td>GCTATTGTAACAGTCC</td><td> 20</td><td> 140</td>

<td> 911137</td><td>N/A</td><td>N/A</td><td> 6497</td><td> 6512</td><td>GTACATGTACATACCC</td><td> 59</td><td> 141</td>

<td> 911141</td><td>N/A</td><td>N/A</td><td> 6992</td><td> 7007</td><td>ACAGTAAAGGTCGGCA</td><td> 49</td><td> 142</td>

<td> 911145</td><td>N/A</td><td>N/A</td><td> 7422</td><td> 7437</td><td>GGCCATCCTGATCCTC</td><td> 59</td><td> 143</td>

<td> 911149</td><td>N/A</td><td>N/A</td><td> 7866</td><td> 7881</td><td>GCCTACACTGCTCACA</td><td> 44</td><td> 144</td>

<td> 911153</td><td>N/A</td><td>N/A</td><td> 8186</td><td> 8201</td><td>CACCTATGGAGGCTGT</td><td> 86</td><td> 145</td>

<td> 911157</td><td>N/A</td><td>N/A</td><td> 8565</td><td> 8580</td><td>CTTACTACTTATTGGG</td><td> 78</td><td> 146</td>

<td> 911161</td><td>N/A</td><td>N/A</td><td> 8687</td><td> 8702</td><td>TCTTATTATACATACG</td><td> 61</td><td> 147</td>

<td> 911165</td><td>N/A</td><td>N/A</td><td> 8859</td><td> 8874</td><td>TGGCATGAGGAGTAGC</td><td> 57</td><td> 148</td>

<td> 911169</td><td>N/A</td><td>N/A</td><td> 9506</td><td> 9521</td><td>GGCATTACCTGCTGCT</td><td> 78</td><td> 149</td>

<td> 911173</td><td>N/A</td><td>N/A</td><td> 9604</td><td> 9619</td><td>CCTTTATACCAGCCCT</td><td> 59</td><td> 150</td>

<td> 911177</td><td>N/A</td><td>N/A</td><td> 9921</td><td> 9936</td><td>GGGCATGTTTGGAGCT</td><td> 58</td><td> 151</td>

<td> 911181</td><td>N/A</td><td>N/A</td><td> 10330</td><td> 10345</td><td>GGCTATTTGCATTTGC</td><td> 28</td><td> 152</td>

<td> 911185</td><td>N/A</td><td>N/A</td><td> 10551</td><td> 10566</td><td>ATCTGTACATTCGCAT</td><td> 28</td><td> 153</td>

<td> 911189</td><td>N/A</td><td>N/A</td><td> 10691</td><td> 10706</td><td>CGTATTTATTAGAGCA</td><td> 41</td><td> 154</td>

<td> 911193</td><td>N/A</td><td>N/A</td><td> 11446</td><td> 11461</td><td>GCGGATGCA MM CCC</td><td> 32</td><td> 155</td>

<td> 911197</td><td>N/A</td><td>N/A</td><td> 11617</td><td> 11632</td><td>TGGAATTACTTAGCAG</td><td> 47</td><td> 156</td>

<td> 911201</td><td>N/A</td><td>N/A</td><td> 11826</td><td> 11841</td><td>GCCAAAATAGTTCTCC</td><td> 42</td><td> 157</td>

<td> 911205</td><td>N/A</td><td>N/A</td><td> 11909</td><td> 11924</td><td>GTCAACACCCGTGTCC</td><td> 57</td><td> 158</td>

<td> 911209</td><td>N/A</td><td>N/A</td><td> 12243</td><td> 12258</td><td>TCACATTTGAGGCACG</td><td> 38</td><td> 159</td>

<td> 911213</td><td>N/A</td><td>N/A</td><td> 12295</td><td> 12310</td><td>TGGTTTAGGTTTGGAT</td><td> 68</td><td> 160</td>

<td> 911217</td><td>N/A</td><td>N/A</td><td> 12406</td><td> 12421</td><td>TAGCTTTAGGCTATTT</td><td> 72</td><td> 161</td>

<td> 911221</td><td>N/A</td><td>N/A</td><td> 12771</td><td> 12786</td><td>GATGATTGCAGTGAGG</td><td> 40</td><td> 162</td>

<td> 911225</td><td>N/A</td><td>N/A</td><td> 12820</td><td> 12835</td><td>GGGAATTTGATCAGTT</td><td> 79</td><td> 163</td>

<td> 911229</td><td>N/A</td><td>N/A</td><td> 12928</td><td> 12943</td><td>GTTTGAATTATCGAGT</td><td> 59</td><td> 164</td>

TABLE 3

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910923</td><td> 12</td><td> 27</td><td> 412</td><td> 427</td><td>TCCAAA llllll CGA</td><td> 52</td><td> 165</td>

Ninety-

<td> 910927</td><td> 178</td><td> 193</td><td> 6716</td><td> 6731</td><td>GGCATCGGGTCCTTGT</td><td> 51</td><td> 166</td>

<td> 910931</td><td> 507</td><td> 522</td><td> 7670</td><td> 7685</td><td>GGGCATCCACCGTTGA</td><td> 57</td><td> 167</td>

<td> 910935</td><td> 709</td><td> 724</td><td> 8286</td><td> 8301</td><td>TTCCTGGGTGCACTGG</td><td> 56</td><td> 168</td>

<td> 910939</td><td> 944</td><td> 959</td><td> 9739</td><td> 9754</td><td>CTGCATGGCACTCAGC</td><td> 33</td><td> 169</td>

<td> 910943</td><td> 1024</td><td> 1039</td><td> 11180</td><td> 11195</td><td>GCTACGATGCAGCAGG</td><td> 29</td><td> 170</td>

<td> 910947</td><td> 1260</td><td> 1275</td><td> 13490</td><td> 13505</td><td>TCTCATTGAGTGTCCG</td><td> 27*</td><td> 171</td>

<td> 910951</td><td> 1552</td><td> 1567</td><td> 13962</td><td> 13977</td><td>GGCCTATCATCCCTGC</td><td> 96</td><td> 172</td>

<td> 910955</td><td> 1799</td><td> 1814</td><td> 14209</td><td> 14224</td><td>GTAATCTGTGCGAGCA</td><td> 19</td><td> 173</td>

<td> 910959</td><td> 1922</td><td> 1937</td><td> 14332</td><td> 14347</td><td>GATGATGCAGCTTTGA</td><td> 19</td><td> 174</td>

<td> 910963</td><td> 2117</td><td> 2132</td><td> 14527</td><td> 14542</td><td>GGTGAATTCTAACAGG</td><td> 26</td><td> 175</td>

<td> 910967</td><td> 2303</td><td> 2318</td><td>N/A</td><td>N/A</td><td>TAAATGAGTAGTTCCT</td><td> 37</td><td> 176</td>

<td> 910971</td><td> 992</td><td> 1007</td><td>N/A</td><td>N/A</td><td>TGCCACAGATGAAGCC</td><td> 63</td><td> 177</td>

<td> 910975</td><td> 72</td><td> 87</td><td> 472</td><td> 487</td><td>TACCGAGAAAAAAC</td><td> 56</td><td> 178</td>

<td> 910979</td><td> 1855</td><td> 1870</td><td> 14265</td><td> 14280</td><td>AGTGAGGGACAGGATT</td><td> 36</td><td> 179</td>

<td> 910983</td><td> 2072</td><td> 2087</td><td> 14482</td><td> 14497</td><td>CCTCAGATCCTGAGGG</td><td> 81</td><td> 180</td>

<td> 910987</td><td> 421</td><td> 436</td><td> 7486</td><td> 7501</td><td>CCGGAGGGTGCCACCA</td><td> 52</td><td> 181</td>

<td> 910991</td><td> 1092</td><td> 1107</td><td> 11248</td><td> 11263</td><td>CAAACAGGCTGTCAGG</td><td> 65</td><td> 182</td>

<td> 910995</td><td> 78</td><td> 93</td><td> 478</td><td> 493</td><td>Clll IATACCGAGAAG</td><td> 38</td><td> 183</td>

<td> 910998</td><td> 1374</td><td> 1389</td><td> 13784</td><td> 13799</td><td>CGCTCTCCACCCGCAC</td><td> 41</td><td> 184</td>

<td> 911002</td><td> 42</td><td> 57</td><td> 442</td><td> 457</td><td>TGGAAGCCGCAGACCT</td><td> 28</td><td> 185</td>

<td> 911006</td><td> 2287</td><td> 2302</td><td>N/A</td><td>N/A</td><td>CTGCAGTCTAAGCTGA</td><td> 63</td><td> 186</td>

<td> 911010</td><td> 423</td><td> 438</td><td> 7488</td><td> 7503</td><td>CCCCGGAGGGTGCCAC</td><td> 62</td><td> 187</td>

<td> 911014</td><td> 1892</td><td> 1907</td><td> 14302</td><td> 14317</td><td>ACTGAGGCAGGCTTCC</td><td> 16</td><td> 188</td>

<td> 911018</td><td> 1458</td><td> 1473</td><td> 13868</td><td> 13883</td><td>GTGTAGGGTTGGAACA</td><td> 84</td><td> 189</td>

<td> 911022</td><td> 599</td><td> 614</td><td> 7762</td><td> 7777</td><td>GGAGAAGACCCCAGTG</td><td> 55</td><td> 190</td>

<td> 911026</td><td> 66</td><td> 81</td><td> 466</td><td> 481</td><td>GAAGAAAAACCACGCT</td><td> 56</td><td> 191</td>

<td> 911030</td><td> 2355</td><td> 2370</td><td>N/A</td><td>N/A</td><td>GGCTGCAGTTTATTGG</td><td> 36</td><td> 192</td>

<td> 911034</td><td> 132</td><td> 147</td><td> 532</td><td> 547</td><td>AGAAAAGGATCAGCCT</td><td> 65</td><td> 193</td>

<td> 911038</td><td> 1459</td><td> 1474</td><td> 13869</td><td> 13884</td><td>GGTGTAGGGTTGGAAC</td><td> 70</td><td> 194</td>

<td> 911042</td><td> 59</td><td> 74</td><td> 459</td><td> 474</td><td>AACCACGCTGTACGGT</td><td> 44</td><td> 195</td>

<td> 911046</td><td> 131</td><td> 146</td><td> 531</td><td> 546</td><td>GAAAAGGATCAGCCTG</td><td> 52</td><td> 196</td>

<td> 911050</td><td> 326</td><td> 341</td><td> 6864</td><td> 6879</td><td>TCGAAGATCTCGGCCC</td><td> 94</td><td> 197</td>

<td> 911054</td><td> 1517</td><td> 1532</td><td> 13927</td><td> 13942</td><td>CACCAGTTTGGCCCCT</td><td> 39</td><td> 198</td>

<td> 911058</td><td> 52</td><td> 67</td><td> 452</td><td> 467</td><td>CTGTACGGTGTGGAAG</td><td> 51</td><td> 199</td>

<td> 911062</td><td> 76</td><td> 91</td><td> 476</td><td> 491</td><td>TTTATACCGAGAAGAA</td><td> 38</td><td> 200</td>

<td> 911070</td><td>N/A</td><td>N/A</td><td> 13594</td><td> 13609</td><td>GGCACTTGAGGCCATC</td><td> 74</td><td> 201</td>

<td> 911074</td><td>N/A</td><td>N/A</td><td> 13661</td><td> 13676</td><td>CCACATCCCGTTCCTC</td><td> 62</td><td> 202</td>

<td> 911078</td><td>N/A</td><td>N/A</td><td> 13570</td><td> 13585</td><td>CGCCACCTCAGAGGAG</td><td> 104</td><td> 203</td>

<td> 911082</td><td>N/A</td><td>N/A</td><td> 1258</td><td> 1273</td><td>AACTGATGCTCACTCT</td><td> 66</td><td> 204</td>

<td> 911086</td><td>N/A</td><td>N/A</td><td> 1495</td><td> 1510</td><td>TGCAGAATCGAGCTCA</td><td> 27</td><td> 205</td>

<td> 911090</td><td>N/A</td><td>N/A</td><td> 1923</td><td> 1938</td><td>CATAATAATACTCACC</td><td> 63</td><td> 206</td>

<td> 911094</td><td>N/A</td><td>N/A</td><td> 2189</td><td> 2204</td><td>CAAATGATGAATTGGG</td><td> 23</td><td> 207</td>

<td> 911098</td><td>N/A</td><td>N/A</td><td> 2610</td><td> 2625</td><td>GGGTTTATTGTGTGTC</td><td> 13</td><td> 208</td>

<td> 911102</td><td>N/A</td><td>N/A</td><td> 2766</td><td> 2781</td><td>TGAGATAATTAGGGAG</td><td> 25</td><td> 209</td>

<td> 911106</td><td>N/A</td><td>N/A</td><td> 3269</td><td> 3284</td><td>CCCTTCTACGCTGTCT</td><td> 39</td><td> 210</td>

Ninety-one-

<td> 911110</td><td>N/A</td><td>N/A</td><td> 3753</td><td> 3768</td><td>GCCAATACAGAGCCCA</td><td> 9</td><td> 211</td>

<td> 911114</td><td>N/A</td><td>N/A</td><td> 4155</td><td> 4170</td><td>ACAGATACTGGGACCC</td><td> 34</td><td> 212</td>

<td> 911118</td><td>N/A</td><td>N/A</td><td> 4660</td><td> 4675</td><td>GCATAGATACATTTCC</td><td> 15</td><td> 213</td>

<td> 911122</td><td>N/A</td><td>N/A</td><td> 5541</td><td> 5556</td><td>GGCIIIICAGGATCCT</td><td> 57</td><td> 214</td>

<td> 911126</td><td>N/A</td><td>N/A</td><td> 5937</td><td> 5952</td><td>TAGACATGAAGAGTCT</td><td> 69</td><td> 215</td>

<td> 911130</td><td>N/A</td><td>N/A</td><td> 6108</td><td> 6123</td><td>TTAATCTGAAGCTGGA</td><td> 64</td><td> 216</td>

<td> 911134</td><td>N/A</td><td>N/A</td><td> 6271</td><td> 6286</td><td>TCCTA HH GCCCCAG</td><td> 48</td><td> 217</td>

<td> 911138</td><td>N/A</td><td>N/A</td><td> 6498</td><td> 6513</td><td>GGTACATGTACATACC</td><td> 59</td><td> 218</td>

<td> 911142</td><td>N/A</td><td>N/A</td><td> 7068</td><td> 7083</td><td>TGCATAAGTCACAGAC</td><td> 45</td><td> 219</td>

<td> 911146</td><td>N/A</td><td>N/A</td><td> 7561</td><td> 7576</td><td>GTCCATACCTGGTGCA</td><td> 51</td><td> 220</td>

<td> 911150</td><td>N/A</td><td>N/A</td><td> 7886</td><td> 7901</td><td>GAGTACTGCAATTCAG</td><td> 45</td><td> 221</td>

<td> 911154</td><td>N/A</td><td>N/A</td><td> 8495</td><td> 8510</td><td>GTAGACTGGCACAGGC</td><td> 72</td><td> 222</td>

<td> 911158</td><td>N/A</td><td>N/A</td><td> 8581</td><td> 8596</td><td>AGTTTAGCTCTTGCAT</td><td> 36</td><td> 223</td>

<td> 911162</td><td>N/A</td><td>N/A</td><td> 8710</td><td> 8725</td><td>GGGTAAATAACAGCAC</td><td> 17</td><td> 224</td>

<td> 911166</td><td>N/A</td><td>N/A</td><td> 9385</td><td> 9400</td><td>GGTGACCACGACAGGC</td><td> 62</td><td> 225</td>

<td> 911170</td><td>N/A</td><td>N/A</td><td> 9538</td><td> 9553</td><td>CACTATCCCTATCCCT</td><td> 50</td><td> 226</td>

<td> 911174</td><td>N/A</td><td>N/A</td><td> 9646</td><td> 9661</td><td>CCAGGCTACGGTCTTC</td><td> 64</td><td> 227</td>

<td> 911178</td><td>N/A</td><td>N/A</td><td> 10311</td><td> 10326</td><td>AACAACTCAGGATCAC</td><td> 28</td><td> 228</td>

<td> 911182</td><td>N/A</td><td>N/A</td><td> 10378</td><td> 10393</td><td>GGTTACATAGCTGGTC</td><td> 19</td><td> 229</td>

<td> 911186</td><td>N/A</td><td>N/A</td><td> 10625</td><td> 10640</td><td>TTGAATAGGGCTCTTT</td><td> 51</td><td> 230</td>

<td> 911190</td><td>N/A</td><td>N/A</td><td> 10692</td><td> 10707</td><td>CCGTATTTATTAGAGC</td><td> 49</td><td> 231</td>

<td> 911194</td><td>N/A</td><td>N/A</td><td> 11447</td><td> 11462</td><td>AGCGGATGCAIIIICC</td><td> 21</td><td> 232</td>

<td> 911198</td><td>N/A</td><td>N/A</td><td> 11683</td><td> 11698</td><td>TGGATAGGTGAGCTCG</td><td> 34</td><td> 233</td>

<td> 911202</td><td>N/A</td><td>N/A</td><td> 11846</td><td> 11861</td><td>TTATTCTTTGCACCAC</td><td> 33</td><td> 234</td>

<td> 911206</td><td>N/A</td><td>N/A</td><td> 11921</td><td> 11936</td><td>TGAGATCTCACCGTCA</td><td> 83</td><td> 235</td>

<td> 911210</td><td>N/A</td><td>N/A</td><td> 12245</td><td> 12260</td><td>GGTCACATTTGAGGCA</td><td> 49</td><td> 236</td>

<td> 911214</td><td>N/A</td><td>N/A</td><td> 12303</td><td> 12318</td><td>CTGGATGGTGGTTTAG</td><td> 82</td><td> 237</td>

<td> 911218</td><td>N/A</td><td>N/A</td><td> 12528</td><td> 12543</td><td>GTATTGACATACTGGG</td><td> 35</td><td> 238</td>

<td> 911222</td><td>N/A</td><td>N/A</td><td> 12777</td><td> 12792</td><td>AGCGATGATGATTGCA</td><td> 64</td><td> 239</td>

<td> 911226</td><td>N/A</td><td>N/A</td><td> 12821</td><td> 12836</td><td>AGGGAATTTGATCAGT</td><td> 43</td><td> 240</td>

<td> 911230</td><td>N/A</td><td>N/A</td><td> 13042</td><td> 13057</td><td>CCAACTTAAGGGTCAG</td><td> 42</td><td> 241</td>

TABLE 4

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910924</td><td> 54</td><td> 69</td><td> 454</td><td> 469</td><td>CGCTGTACGGTGTGGA</td><td> 13</td><td> 242</td>

<td> 910928</td><td> 269</td><td> 284</td><td> 6807</td><td> 6822</td><td>GGCTTTGGGTGCAGCC</td><td> 96</td><td> 243</td>

<td> 910932</td><td> 560</td><td> 575</td><td> 7723</td><td> 7738</td><td>GATCATGGCTGGGCTC</td><td> 28</td><td> 244</td>

<td> 910936</td><td> 749</td><td> 764</td><td> 8395</td><td> 8410</td><td>TGGGTAGGAGCTCTGG</td><td> 27</td><td> 245</td>

<td> 910940</td><td> 946</td><td> 961</td><td> 9741</td><td> 9756</td><td>GCCTGCATGGCACTCA</td><td> 43</td><td> 246</td>

<td> 910944</td><td> 1028</td><td> 1043</td><td> 11184</td><td> 11199</td><td>AGCAGCTACGATGCAG</td><td> 53</td><td> 247</td>

<td> 910948</td><td> 1309</td><td> 1324</td><td> 13539</td><td> 13554</td><td>GCAGGATGGTTTCTGA</td><td> 99</td><td> 248</td>

<td> 910952</td><td> 1562</td><td> 1577</td><td> 13972</td><td> 13987</td><td>GCACATCCAGGGCCTA</td><td> 25</td><td> 249</td>

ninety and give

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 10</td><td> 250</td>

<td> 910960</td><td> 2113</td><td> 2128</td><td> 14523</td><td> 14538</td><td>AATTCTAACAGGCCGT</td><td> 25</td><td> 251</td>

<td> 910964</td><td> 2180</td><td> 2195</td><td> 14590</td><td> 14605</td><td>GTCTGCACGGGACTCA</td><td> 33</td><td> 252</td>

<td> 910968</td><td> 2304</td><td> 2319</td><td>N/A</td><td>N/A</td><td>ATAAATGAGTAGTTCC</td><td> 28</td><td> 253</td>

<td> 910972</td><td> 324</td><td> 339</td><td> 6862</td><td> 6877</td><td>GAAGATCTCGGCCCTG</td><td> 47</td><td> 254</td>

<td> 910976</td><td> 2301</td><td> 2316</td><td>N/A</td><td>N/A</td><td>AATGAGTAGTTCCTCT</td><td> 35</td><td> 255</td>

<td> 910980</td><td> 71</td><td> 86</td><td> 471</td><td> 486</td><td>ACCGAGAAGAAAAACC</td><td> 18</td><td> 256</td>

<td> 910984</td><td> 385</td><td> 400</td><td>N/A</td><td>N/A</td><td>AGCTGCAGCTGCGATG</td><td> 44</td><td> 257</td>

<td> 910988</td><td> 75</td><td> 90</td><td> 475</td><td> 490</td><td>TTATACCGAGAAAGAAA</td><td> 68</td><td> 258</td>

<td> 910992</td><td> 1893</td><td> 1908</td><td> 14303</td><td> 14318</td><td>TACTGAGGCAGGCTCT</td><td> 27</td><td> 259</td>

<td> 910996</td><td> 36</td><td> 51</td><td> 436</td><td> 451</td><td>CCGCAGACCTCTCTCT</td><td> 36</td><td> 260</td>

<td> 910999</td><td> 2302</td><td> 2317</td><td>N/A</td><td>N/A</td><td>AAATGAGTAGTTCCTC</td><td> 50</td><td> 261</td>

<td> 911003</td><td> 413</td><td> 428</td><td> 7478</td><td> 7493</td><td>TGCCACCATGACTAGG</td><td> 62</td><td> 262</td>

<td> 911007</td><td> 985</td><td> 1000</td><td> 9780</td><td> 9795</td><td>GATGAAGCCTTGGTCA</td><td> 50</td><td> 263</td>

<td> 911011</td><td> 1901</td><td> 1916</td><td> 14311</td><td> 14326</td><td>TTTGAGTGTACTGAGG</td><td> 12</td><td> 264</td>

<td> 911015</td><td> 1849</td><td> 1864</td><td> 14259</td><td> 14274</td><td>GGACAGGATTGTGACA</td><td> 56</td><td> 265</td>

<td> 911019</td><td> 1792</td><td> 1807</td><td> 14202</td><td> 14217</td><td>GTGCGAGCAGCTGAGG</td><td> 13</td><td> 266</td>

<td> 911023</td><td> 79</td><td> 94</td><td> 479</td><td> 494</td><td>GCIII IATACCGAGAA</td><td> 5</td><td> 267</td>

<td> 911027</td><td> 725</td><td> 740</td><td>N/A</td><td>N/A</td><td>CGAAAGGGTGCTGTCC</td><td> 78</td><td> 268</td>

<td> 911031</td><td> 727</td><td> 742</td><td>N/A</td><td>N/A</td><td>GCCGAAAGGGTGCTGT</td><td> 48</td><td> 269</td>

<td> 911035</td><td> 147</td><td> 162</td><td> 547</td><td> 562</td><td>GTGAAGTGGACTGACA</td><td> 43</td><td> 270</td>

<td> 911039</td><td> 62</td><td> 77</td><td> 462</td><td> 477</td><td>AAAAAACCACGCTGTAC</td><td> 61</td><td> 271</td>

<td> 911043</td><td> 2280</td><td> 2295</td><td>N/A</td><td>N/A</td><td>CTAAGCTGAGGCATGG</td><td> 35</td><td> 272</td>

<td> 911047</td><td> 659</td><td> 674</td><td> 8236</td><td> 8251</td><td>GGACACCCATTCCAGG</td><td> 59</td><td> 273</td>

<td> 911051</td><td> 116</td><td> 131</td><td> 516</td><td> 531</td><td>GGCTTGTGGGAAACTG</td><td> 17</td><td> 274</td>

<td> 911055</td><td> 158</td><td> 173</td><td>N/A</td><td>N/A</td><td>GGGCAGGCTTGGTGAA</td><td> 82</td><td> 275</td>

<td> 911059</td><td> 43</td><td> 58</td><td> 443</td><td> 458</td><td>GTGGAAGCCGCAGACC</td><td> 23</td><td> 276</td>

<td> 911063</td><td> 1169</td><td> 1184</td><td> 12039</td><td> 12054</td><td>CTTGAAGTAGTCCATG</td><td> 49*</td><td> 277</td>

<td> 911067</td><td>N/A</td><td>N/A</td><td> 8302</td><td> 8317</td><td>GTCCACTGACCTGTCC</td><td> 111</td><td> 278</td>

<td> 911071</td><td>N/A</td><td>N/A</td><td> 13600</td><td> 13615</td><td>TGCGATGGCACTTGAG</td><td> 51</td><td> 279</td>

<td> 911075</td><td>N/A</td><td>N/A</td><td> 13564</td><td> 13579</td><td>CTCAGAGGAGCTCACC</td><td> 87</td><td> 280</td>

<td> 911079</td><td>N/A</td><td>N/A</td><td> 13595</td><td> 13610</td><td>TGGCACTTGAGGCCAT</td><td> 119</td><td> 281</td>

<td> 911083</td><td>N/A</td><td>N/A</td><td> 1275</td><td> 1290</td><td>GCTACTAGGGTGAACA</td><td> 22</td><td> 282</td>

<td> 911087</td><td>N/A</td><td>N/A</td><td> 1547</td><td> 1562</td><td>AATAGCTAACACTTCG</td><td> 32</td><td> 283</td>

<td> 911091</td><td>N/A</td><td>N/A</td><td> 2068</td><td> 2083</td><td>GGAGTAAGGACATGAC</td><td> 27</td><td> 284</td>

<td> 911095</td><td>N/A</td><td>N/A</td><td> 2233</td><td> 2248</td><td>ATCATAAGCATCACAA</td><td> 49</td><td> 285</td>

<td> 911099</td><td>N/A</td><td>N/A</td><td> 2639</td><td> 2654</td><td>TATAAGT i iTAACACC</td><td> 62</td><td> 286</td>

<td> 911103</td><td>N/A</td><td>N/A</td><td> 2941</td><td> 2956</td><td>TGTATTGCAAAGCAAC</td><td> 38</td><td> 287</td>

<td> 911107</td><td>N/A</td><td>N/A</td><td> 3357</td><td> 3372</td><td>GCATTTCGGTGAGGCC</td><td> 39</td><td> 288</td>

<td> 911111</td><td>N/A</td><td>N/A</td><td> 3802</td><td> 3817</td><td>TGCCTTTGGTCTGGGC</td><td> 56</td><td> 289</td>

<td> 911115</td><td>N/A</td><td>N/A</td><td> 4248</td><td> 4263</td><td>CACTATGACAAGCCCC</td><td> 29</td><td> 290</td>

<td> 911119</td><td>N/A</td><td>N/A</td><td> 4945</td><td> 4960</td><td>TCCCTTATGGCCCCCA</td><td> 25</td><td> 291</td>

<td> 911123</td><td>N/A</td><td>N/A</td><td> 5629</td><td> 5644</td><td>TTCTATTGTCCTCACC</td><td> 68</td><td> 292</td>

<td> 911127</td><td>N/A</td><td>N/A</td><td> 5938</td><td> 5953</td><td>ATAGACATGAAGAGTC</td><td> 50</td><td> 293</td>

<td> 911131</td><td>N/A</td><td>N/A</td><td> 6109</td><td> 6124</td><td>CTTAATCTGAAGCTGG</td><td> 22</td><td> 294</td>

<td> 911135</td><td>N/A</td><td>N/A</td><td> 6309</td><td> 6324</td><td>CATCTTGCCGGAGCTG</td><td> 26</td><td> 295</td>

<td> 911139</td><td>N/A</td><td>N/A</td><td> 6564</td><td> 6579</td><td>CCCATAGTTGCACCCC</td><td> 44</td><td> 296</td>

<td> 911143</td><td>N/A</td><td>N/A</td><td> 7174</td><td> 7189</td><td>ACTACAATACGGCCTC</td><td> 44</td><td> 297</td>

Ninety three

<td> 911147</td><td>N/A</td><td>N/A</td><td> 7572</td><td> 7587</td><td>GCCCATTCACCGTCCA</td><td> 48</td><td> 298</td>

<td> 911151</td><td>N/A</td><td>N/A</td><td> 7963</td><td> 7978</td><td>TCTTTAAGGTTCTGCA</td><td> 40</td><td> 299</td>

<td> 911155</td><td>N/A</td><td>N/A</td><td> 8496</td><td> 8511</td><td>GGTAGACTGGCACAGG</td><td> 33</td><td> 300</td>

<td> 911159</td><td>N/A</td><td>N/A</td><td> 8684</td><td> 8699</td><td>TATTATACATACGAGA</td><td> 81</td><td> 301</td>

<td> 911163</td><td>N/A</td><td>N/A</td><td> 8767</td><td> 8782</td><td>AGA Illi GATCAAGAC</td><td> 25</td><td> 302</td>

<td> 911167</td><td>N/A</td><td>N/A</td><td> 9399</td><td> 9414</td><td>GAAGATTCCATGCAGG</td><td> 75</td><td> 303</td>

<td> 911171</td><td>N/A</td><td>N/A</td><td> 9540</td><td> 9555</td><td>CGCACTATCCCTATCC</td><td> 12</td><td> 304</td>

<td> 911175</td><td>N/A</td><td>N/A</td><td> 9868</td><td> 9883</td><td>AGGTTAGGTTCCCTGC</td><td> 34</td><td> 305</td>

<td> 911179</td><td>N/A</td><td>N/A</td><td> 10316</td><td> 10331</td><td>GCTTTAACAACTCAGG</td><td> 10</td><td> 306</td>

<td> 911183</td><td>N/A</td><td>N/A</td><td> 10451</td><td> 10466</td><td>GGTTATGTGGCACCCT</td><td> 21</td><td> 307</td>

<td> 911187</td><td>N/A</td><td>N/A</td><td> 10686</td><td> 10701</td><td>TTATTAGAGCACAGGT</td><td> 72</td><td> 308</td>

<td> 911191</td><td>N/A</td><td>N/A</td><td> 10716</td><td> 10731</td><td>TGGAATCCCACAAAAC</td><td> 61</td><td> 309</td>

<td> 911195</td><td>N/A</td><td>N/A</td><td> 11611</td><td> 11626</td><td>TACTTAGCAGGGTCCC</td><td> 37</td><td> 310</td>

<td> 911199</td><td>N/A</td><td>N/A</td><td> 11684</td><td> 11699</td><td>GTGGATAGGTGAGCTC</td><td> 29</td><td> 311</td>

<td> 911203</td><td>N/A</td><td>N/A</td><td> 11864</td><td> 11879</td><td>TGACATAAGTTGTATC</td><td> 46</td><td> 312</td>

<td> 911207</td><td>N/A</td><td>N/A</td><td> 11994</td><td> 12009</td><td>ATGAATCAAGCCCCAT</td><td> 95</td><td> 313</td>

<td> 911211</td><td>N/A</td><td>N/A</td><td> 12284</td><td> 12299</td><td>TGGATTTGCGGACAGG</td><td> 33</td><td> 314</td>

<td> 911215</td><td>N/A</td><td>N/A</td><td> 12324</td><td> 12339</td><td>CAGAATTTGGCATGCT</td><td> 51</td><td> 315</td>

<td> 911219</td><td>N/A</td><td>N/A</td><td> 12530</td><td> 12545</td><td>GTGTATTGACATACTG</td><td> 67</td><td> 316</td>

<td> 911223</td><td>N/A</td><td>N/A</td><td> 12790</td><td> 12805</td><td>GGATTACAGAGTCAGC</td><td> 36</td><td> 317</td>

<td> 911227</td><td>N/A</td><td>N/A</td><td> 12893</td><td> 12908</td><td>TGGTTAGGTGGTTAGG</td><td> 59</td><td> 318</td>

<td> 911231</td><td>N/A</td><td>N/A</td><td> 13242</td><td> 13257</td><td>GGGTATGGTTGTTCTG</td><td> 38</td><td> 319</td>

TABLE 5

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 32</td><td> 65</td>

<td> 1062005</td><td> 1</td><td> 16</td><td> 401</td><td> 416</td><td>TTCGATGAGTGTGTGC</td><td> 43</td><td> 320</td>

<td> 1062037</td><td> 118</td><td> 133</td><td> 518</td><td> 533</td><td>CTGGCTTGTGGGAAAC</td><td> 30</td><td> 321</td>

<td> 1062069</td><td> 310</td><td> 325</td><td> 6848</td><td> 6863</td><td>TGGAAGGTTCCCCCTG</td><td> 110</td><td> 322</td>

<td> 1062101</td><td> 422</td><td> 437</td><td> 7487</td><td> 7502</td><td>CCCGGAGGGTGCCACC</td><td> 212</td><td> 323</td>

<td> 1062133</td><td> 594</td><td> 609</td><td> 7757</td><td> 7772</td><td>AGACCCCAGTGGCGGT</td><td> 69</td><td> 324</td>

<td> 1062165</td><td> 752</td><td> 767</td><td> 8398</td><td> 8413</td><td>CAGTGGGTAGGAGCTC</td><td> 150</td><td> 325</td>

<td> 1062197</td><td> 869</td><td> 884</td><td> 9459</td><td> 9474</td><td>ACATTGTGCCCTGCCC</td><td> 24</td><td> 326</td>

<td> 1062229</td><td> 1049</td><td> 1064</td><td> 11205</td><td> 11220</td><td>GACGACAGGGCCTTGG</td><td> 53</td><td> 327</td>

<td> 1062261</td><td> 1181</td><td> 1196</td><td> 12051</td><td> 12066</td><td>CATGTTGTGGAACTTG</td><td> 65*</td><td> 328</td>

<td> 1062293</td><td> 1423</td><td> 1438</td><td> 13833</td><td> 13848</td><td>CGTTTCTTGCGGAACT</td><td> 105</td><td> 329</td>

<td> 1062325</td><td> 1592</td><td> 1607</td><td> 14002</td><td> 14017</td><td>AGTGGAAACCTCACTT</td><td> 86</td><td> 330</td>

<td> 1062357</td><td> 1848</td><td> 1863</td><td> 14258</td><td> 14273</td><td>GACAGGATTGTGACAT</td><td> 43</td><td> 331</td>

<td> 1062389</td><td> 2026</td><td> 2041</td><td> 14436</td><td> 14451</td><td>GCACACCCCTGTGTTG</td><td> 61</td><td> 332</td>

<td> 1062421</td><td> 2208</td><td> 2223</td><td> 14618</td><td> 14633</td><td>TGGCAAGGCAGTGTGT</td><td> 68</td><td> 333</td>

<td> 1062453</td><td>N/A</td><td>N/A</td><td> 8298</td><td> 8313</td><td>ACTGACCTGTCCTTCC</td><td> 318</td><td> 334</td>

<td> 1062485</td><td>N/A</td><td>N/A</td><td> 13599</td><td> 13614</td><td>GCGATGGCACTTGAGG</td><td> 143</td><td> 335</td>

<td> 1062549</td><td>N/A</td><td>N/A</td><td> 684</td><td> 699</td><td>TACCTGGCTGGAATCA</td><td> 64</td><td> 336</td>

<td> 1062581</td><td>N/A</td><td>N/A</td><td> 866</td><td> 881</td><td>ACAGCATTTCAAGTTG</td><td> 113</td><td> 337</td>

Ninety-four-

<td> 1062613</td><td>N/A</td><td>N/A</td><td> 1108</td><td> 1123</td><td>GATCGATGGAGTGTGG</td><td> 104</td><td> 338</td>

<td> 1062645</td><td>N/A</td><td>N/A</td><td> 1237</td><td> 1252</td><td>AATGTAAAGGTCCTCG</td><td> 23</td><td> 339</td>

<td> 1062678</td><td>N/A</td><td>N/A</td><td> 1337</td><td> 1352</td><td>AAAGCGATACAAGCAA</td><td> 30</td><td> 340</td>

<td> 1062710</td><td>N/A</td><td>N/A</td><td> 1475</td><td> 1490</td><td>AGCCCTGAACAACCTG</td><td> 67</td><td> 341</td>

<td> 1062742</td><td>N/A</td><td>N/A</td><td> 1721</td><td> 1736</td><td>CGGCACTTGGTCAAAT</td><td> 102</td><td> 342</td>

<td> 1062774</td><td>N/A</td><td>N/A</td><td> 1877</td><td> 1892</td><td>ATAGGACAACCIIIIG</td><td> 40</td><td> 343</td>

<td> 1062806</td><td>N/A</td><td>N/A</td><td> 2074</td><td> 2089</td><td>CTATTAGGAGTAAGGA</td><td> 172</td><td> 344</td>

<td> 1062838</td><td>N/A</td><td>N/A</td><td> 2159</td><td> 2174</td><td>TATATGTAATGGCTGA</td><td> 11</td><td> 345</td>

<td> 1062870</td><td>N/A</td><td>N/A</td><td> 2391</td><td> 2406</td><td>CCTCTATAGTAAATGG</td><td> 62</td><td> 346</td>

<td> 1062902</td><td>N/A</td><td>N/A</td><td> 2585</td><td> 2600</td><td>GCTAAGTATTTACTGT</td><td> 68</td><td> 347</td>

<td> 1062934</td><td>N/A</td><td>N/A</td><td> 2731</td><td> 2746</td><td>AATAGTCAGTCCATTA</td><td> 46</td><td> 348</td>

<td> 1062966</td><td>N/A</td><td>N/A</td><td> 2866</td><td> 2881</td><td>GAAAGCTTGGACATGG</td><td> 34</td><td> 349</td>

<td> 1062998</td><td>N/A</td><td>N/A</td><td> 3067</td><td> 3082</td><td>GCGAGAGGAGGATTGC</td><td> 65</td><td> 350</td>

<td> 1063030</td><td>N/A</td><td>N/A</td><td> 3244</td><td> 3259</td><td>ATTAGGTGTCTGCAGG</td><td> 74</td><td> 351</td>

<td> 1063062</td><td>N/A</td><td>N/A</td><td> 3389</td><td> 3404</td><td>GAGATCTAGGCTTGGA</td><td> 21</td><td> 352</td>

<td> 1063094</td><td>N/A</td><td>N/A</td><td> 3641</td><td> 3656</td><td>ATCACCACGCTCTGGC</td><td> 31</td><td> 353</td>

<td> 1063126</td><td>N/A</td><td>N/A</td><td> 3863</td><td> 3878</td><td>CCAAATACATGGCCAC</td><td> 133</td><td> 354</td>

<td> 1063158</td><td>N/A</td><td>N/A</td><td> 4102</td><td> 4117</td><td>ATCATAGAACAGCATT</td><td> 19</td><td> 355</td>

<td> 1063190</td><td>N/A</td><td>N/A</td><td> 4223</td><td> 4238</td><td>AGACCTGGCCCTTCTT</td><td> 122</td><td> 356</td>

<td> 1063222</td><td>N/A</td><td>N/A</td><td> 4402</td><td> 4417</td><td>CCGGGCTTCATCGACA</td><td> 99</td><td> 357</td>

<td> 1063253</td><td>N/A</td><td>N/A</td><td> 4555</td><td> 4570</td><td>TCCCTTTCTGACTGGG</td><td> 198</td><td> 358</td>

<td> 1063285</td><td>N/A</td><td>N/A</td><td> 4710</td><td> 4725</td><td>AGAGCTAAGAATTTCTC</td><td> 65</td><td> 359</td>

<td> 1063317</td><td>N/A</td><td>N/A</td><td> 5080</td><td> 5095</td><td>CTGGGAGAGCACTGGT</td><td> 62</td><td> 360</td>

<td> 1063349</td><td>N/A</td><td>N/A</td><td> 5274</td><td> 5289</td><td>GTATAGAAGGGTTCTG</td><td> 43</td><td> 361</td>

<td> 1063381</td><td>N/A</td><td>N/A</td><td> 5482</td><td> 5497</td><td>CAGCCAACCCCATTAT</td><td> 134</td><td> 362</td>

<td> 1063413</td><td>N/A</td><td>N/A</td><td> 5655</td><td> 5670</td><td>CTGTCCAAGCCACGCA</td><td> 96</td><td> 363</td>

<td> 1063445</td><td>N/A</td><td>N/A</td><td> 5855</td><td> 5870</td><td>AGGAGGCGAGTCCAGG</td><td> 65</td><td> 364</td>

<td> 1063477</td><td>N/A</td><td>N/A</td><td> 6012</td><td> 6027</td><td>AAGGACCGAGCTGACA</td><td> 39</td><td> 365</td>

<td> 1063509</td><td>N/A</td><td>N/A</td><td> 6133</td><td> 6148</td><td>GCGAGAAGTGGGTAGA</td><td> 47</td><td> 366</td>

<td> 1063541</td><td>N/A</td><td>N/A</td><td> 6280</td><td> 6295</td><td>TCCTCGGAGTCCTATT</td><td> 163</td><td> 367</td>

<td> 1063573</td><td>N/A</td><td>N/A</td><td> 6449</td><td> 6464</td><td>GGCTTGCCTGCCCACG</td><td> 65</td><td> 368</td>

<td> 1063605</td><td>N/A</td><td>N/A</td><td> 6969</td><td> 6984</td><td>GTCCAGGTACCCCACC</td><td> 100</td><td> 369</td>

<td> 1063637</td><td>N/A</td><td>N/A</td><td> 7171</td><td> 7186</td><td>ACAATACGGCCTCCTC</td><td> 127</td><td> 370</td>

<td> 1063669</td><td>N/A</td><td>N/A</td><td> 7376</td><td> 7391</td><td>ACTGCAAGCCCACATG</td><td> 84</td><td> 371</td>

<td> 1063701</td><td>N/A</td><td>N/A</td><td> 7802</td><td> 7817</td><td>CTGAGGTGTTACCAGG</td><td> 35</td><td> 372</td>

<td> 1063733</td><td>N/A</td><td>N/A</td><td> 7968</td><td> 7983</td><td>CTGCATCTTTAAGGTT</td><td> 60</td><td> 373</td>

<td> 1063765</td><td>N/A</td><td>N/A</td><td> 8045</td><td> 8060</td><td>GCTTAAAGACGGCCAT</td><td> 88</td><td> 374</td>

<td> 1063796</td><td>N/A</td><td>N/A</td><td> 8559</td><td> 8574</td><td>ACTTTATTGGGATGAAG</td><td> 92</td><td> 375</td>

<td> 1063828</td><td>N/A</td><td>N/A</td><td> 8848</td><td> 8863</td><td>GTAGCAGGGCAAAGCA</td><td> 69</td><td> 376</td>

<td> 1063860</td><td>N/A</td><td>N/A</td><td> 9051</td><td> 9066</td><td>TAAGGGTTGTGTGTAG</td><td> 318</td><td> 377</td>

<td> 1063892</td><td>N/A</td><td>N/A</td><td> 9413</td><td> 9428</td><td>TGCCTAAGTAGGGAGA</td><td> 78</td><td> 378</td>

<td> 1063924</td><td>N/A</td><td>N/A</td><td> 9644</td><td> 9659</td><td>AGGCTACGGTCTTCCC</td><td> 68</td><td> 379</td>

<td> 1063956</td><td>N/A</td><td>N/A</td><td> 9960</td><td> 9975</td><td>AGAGGGTTTGTAAGTA</td><td> 155</td><td> 380</td>

<td> 1063988</td><td>N/A</td><td>N/A</td><td> 10527</td><td> 10542</td><td>ATAAATTACCACCAGC</td><td> 55</td><td> 381</td>

<td> 1064020</td><td>N/A</td><td>N/A</td><td> 10757</td><td> 10772</td><td>TTTCAAAGCAAGGACG</td><td> 113</td><td> 382</td>

<td> 1064052</td><td>N/A</td><td>N/A</td><td> 11379</td><td> 11394</td><td>ATGGAGCTCCTTTGCA</td><td> 219</td><td> 383</td>

<td> 1064084</td><td>N/A</td><td>N/A</td><td> 11550</td><td> 11565</td><td>AGGCATGGCCCCAATC</td><td> 109</td><td> 384</td>

<td> 1064118</td><td>N/A</td><td>N/A</td><td> 11622</td><td> 11637</td><td>GCTCCTGGAATTACTT</td><td> 38</td><td> 385</td>

Ninety-five-

<td> 1064150</td><td>N/A</td><td>N/A</td><td> 11717</td><td> 11732</td><td>GCTAAGCCCACAGGCC</td><td> 215</td><td> 386</td>

<td> 1064182</td><td>N/A</td><td>N/A</td><td> 11803</td><td> 11818</td><td>TGAAAAGAAGCGGAGT</td><td> 98</td><td> 387</td>

<td> 1064214</td><td>N/A</td><td>N/A</td><td> 11910</td><td> 11925</td><td>CGTCAACACCCGTGTC</td><td> 93</td><td> 388</td>

<td> 1064246</td><td>N/A</td><td>N/A</td><td> 11978</td><td> 11993</td><td>GCAGGACCTCCTAGCT</td><td> 203</td><td> 389</td>

<td> 1064278</td><td>N/A</td><td>N/A</td><td> 12199</td><td> 12214</td><td>GGAATGGAGGAACCCA</td><td> 256</td><td> 390</td>

<td> 1064310</td><td>N/A</td><td>N/A</td><td> 12384</td><td> 12399</td><td>TCCAGGAGAGGGTTAG</td><td> 123</td><td> 391</td>

<td> 1064342</td><td>N/A</td><td>N/A</td><td> 12578</td><td> 12593</td><td>ATCAAATGGGTGTTAC</td><td> 102</td><td> 392</td>

<td> 1064374</td><td>N/A</td><td>N/A</td><td> 12781</td><td> 12796</td><td>AGTCAGCGATGATGAT</td><td> 64</td><td> 393</td>

<td> 1064406</td><td>N/A</td><td>N/A</td><td> 12924</td><td> 12939</td><td>GAATTATCGAGTATCT</td><td> 57</td><td> 394</td>

<td> 1064438</td><td>N/A</td><td>N/A</td><td> 13217</td><td> 13232</td><td>AAGGGATCAGGACTGA</td><td> 188</td><td> 395</td>

TABLE 6

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 60</td><td> 65</td>

<td> 1062006</td><td> 2</td><td> 17</td><td> 402</td><td> 417</td><td>TTTCGATGAGTGTGTG</td><td> 38</td><td> 396</td>

<td> 1062038</td><td> 119</td><td> 134</td><td> 519</td><td> 534</td><td>CCTGGCTTGTGGGAAA</td><td> 67</td><td> 397</td>

<td> 1062070</td><td> 311</td><td> 326</td><td> 6849</td><td> 6864</td><td>CTGGAAGGTTCCCCCT</td><td> 109</td><td> 398</td>

<td> 1062102</td><td> 424</td><td> 439</td><td> 7489</td><td> 7504</td><td>GCCCCGGAGGGTGCCA</td><td> 202</td><td> 399</td>

<td> 1062134</td><td> 595</td><td> 610</td><td> 7758</td><td> 7773</td><td>AAGACCCCAGTGGCGG</td><td> 47</td><td> 400</td>

<td> 1062166</td><td> 754</td><td> 769</td><td> 8400</td><td> 8415</td><td>AGCAGTGGGTAGGAGC</td><td> 77</td><td> 401</td>

<td> 1062198</td><td> 876</td><td> 891</td><td> 9466</td><td> 9481</td><td>GGAGGAGACATTGTGC</td><td> 119</td><td> 402</td>

<td> 1062230</td><td> 1050</td><td> 1065</td><td> 11206</td><td> 11221</td><td>GGACGACAGGGCCTTG</td><td> 164</td><td> 403</td>

<td> 1062262</td><td> 1183</td><td> 1198</td><td> 12053</td><td> 12068</td><td>CGCATGTTGTGGAACT</td><td> 27*</td><td> 404</td>

<td> 1062294</td><td> 1426</td><td> 1441</td><td> 13836</td><td> 13851</td><td>CTCCGTTTCTTGCGGA</td><td> 136</td><td> 405</td>

<td> 1062326</td><td> 1593</td><td> 1608</td><td> 14003</td><td> 14018</td><td>CAGTGGAAACCTCACT</td><td> 117</td><td> 406</td>

<td> 1062358</td><td> 1852</td><td> 1867</td><td> 14262</td><td> 14277</td><td>GAGGGACAGGATTGTG</td><td> 134</td><td> 407</td>

<td> 1062390</td><td> 2028</td><td> 2043</td><td> 14438</td><td> 14453</td><td>GGGCACACCCCTGTGT</td><td> 194</td><td> 408</td>

<td> 1062422</td><td> 2209</td><td> 2224</td><td> 14619</td><td> 14634</td><td>TTGGCAAGGCAGTGTG</td><td> 20</td><td> 409</td>

<td> 1062454</td><td>N/A</td><td>N/A</td><td> 8299</td><td> 8314</td><td>CACTGACCTGTCCTTC</td><td> 117</td><td> 410</td>

<td> 1062486</td><td>N/A</td><td>N/A</td><td> 13601</td><td> 13616</td><td>CTGCGATGGCACTTGA</td><td> 115</td><td> 411</td>

<td> 1062550</td><td>N/A</td><td>N/A</td><td> 685</td><td> 700</td><td>TTACCTGGCTGGAATC</td><td> 91</td><td> 412</td>

<td> 1062582</td><td>N/A</td><td>N/A</td><td> 867</td><td> 882</td><td>GACAGCATTTCAAGTT</td><td> 139</td><td> 413</td>

<td> 1062614</td><td>N/A</td><td>N/A</td><td> 1109</td><td> 1124</td><td>AGATCGATGGAGTGTG</td><td> 107</td><td> 414</td>

<td> 1062646</td><td>N/A</td><td>N/A</td><td> 1238</td><td> 1253</td><td>AAATGTAAAGGTCCTC</td><td> 28</td><td> 415</td>

<td> 1062679</td><td>N/A</td><td>N/A</td><td> 1338</td><td> 1353</td><td>TAAAGCGATACAAGCA</td><td> 100</td><td> 416</td>

<td> 1062711</td><td>N/A</td><td>N/A</td><td> 1476</td><td> 1491</td><td>CAGCCCTGAACAACCT</td><td> 83</td><td> 417</td>

<td> 1062743</td><td>N/A</td><td>N/A</td><td> 1723</td><td> 1738</td><td>ATCGGCACTTGGTCAA</td><td> 63</td><td> 418</td>

<td> 1062775</td><td>N/A</td><td>N/A</td><td> 1878</td><td> 1893</td><td>AATAGGACAACCIIII</td><td> 143</td><td> 419</td>

<td> 1062807</td><td>N/A</td><td>N/A</td><td> 2075</td><td> 2090</td><td>CCTATTAGGAGTAAGG</td><td> 140</td><td> 420</td>

<td> 1062839</td><td>N/A</td><td>N/A</td><td> 2160</td><td> 2175</td><td>ATATATGTAATGGCTG</td><td> 31</td><td> 421</td>

<td> 1062871</td><td>N/A</td><td>N/A</td><td> 2392</td><td> 2407</td><td>ACCTCTATAGTAAATG</td><td> 67</td><td> 422</td>

<td> 1062903</td><td>N/A</td><td>N/A</td><td> 2609</td><td> 2624</td><td>GGTTTATTGTGTGTCA</td><td> 14</td><td> 423</td>

<td> 1062935</td><td>N/A</td><td>N/A</td><td> 2732</td><td> 2747</td><td>GAATAGTCAGTCCATT</td><td> 54</td><td> 424</td>

<td> 1062967</td><td>N/A</td><td>N/A</td><td> 2868</td><td> 2883</td><td>TAGAAAGCTTGGACAT</td><td> 156</td><td> 425</td>

Ninety-six

<td> 1062999</td><td>N/A</td><td>N/A</td><td> 3069</td><td> 3084</td><td>GTGCGAGAGGAGGATT</td><td> 111</td><td> 426</td>

<td> 1063031</td><td>N/A</td><td>N/A</td><td> 3245</td><td> 3260</td><td>CATTAGGTGTCTGCAG</td><td> 37</td><td> 427</td>

<td> 1063063</td><td>N/A</td><td>N/A</td><td> 3390</td><td> 3405</td><td>TGAGATCTAGGCTTGG</td><td> 41</td><td> 428</td>

<td> 1063095</td><td>N/A</td><td>N/A</td><td> 3642</td><td> 3657</td><td>CATCACCACGCTCTGG</td><td> 110</td><td> 429</td>

<td> 1063127</td><td>N/A</td><td>N/A</td><td> 3864</td><td> 3879</td><td>CCCAAATACATGGCCA</td><td> 77</td><td> 430</td>

<td> 1063159</td><td>N/A</td><td>N/A</td><td> 4104</td><td> 4119</td><td>GAATCATAGAACAGCA</td><td> 20</td><td> 431</td>

<td> 1063191</td><td>N/A</td><td>N/A</td><td> 4228</td><td> 4243</td><td>TCTGAAGACCTGGCCC</td><td> 90</td><td> 432</td>

<td> 1063223</td><td>N/A</td><td>N/A</td><td> 4406</td><td> 4421</td><td>TGCGCCGGGCTTCATC</td><td> 87</td><td> 433</td>

<td> 1063254</td><td>N/A</td><td>N/A</td><td> 4575</td><td> 4590</td><td>CTGCACTGTCTGTTGG</td><td> 176</td><td> 434</td>

<td> 1063286</td><td>N/A</td><td>N/A</td><td> 4712</td><td> 4727</td><td>CCAGAGCTAAGAATTC</td><td> 81</td><td> 435</td>

<td> 1063318</td><td>N/A</td><td>N/A</td><td> 5083</td><td> 5098</td><td>GGCCTGGGAGAGCACT</td><td> 153</td><td> 436</td>

<td> 1063350</td><td>N/A</td><td>N/A</td><td> 5276</td><td> 5291</td><td>GAGTATAGAAGGGTTC</td><td> 68</td><td> 437</td>

<td> 1063382</td><td>N/A</td><td>N/A</td><td> 5496</td><td> 5511</td><td>TGGAAGGGACTGCCCA</td><td> 145</td><td> 438</td>

<td> 1063414</td><td>N/A</td><td>N/A</td><td> 5656</td><td> 5671</td><td>CCTGTCCAAGCCACGC</td><td> 19</td><td> 439</td>

<td> 1063446</td><td>N/A</td><td>N/A</td><td> 5856</td><td> 5871</td><td>AAGGAGGCGAGTCCAG</td><td> 103</td><td> 440</td>

<td> 1063478</td><td>N/A</td><td>N/A</td><td> 6013</td><td> 6028</td><td>GAAGGACCGAGCTGAC</td><td> 163</td><td> 441</td>

<td> 1063510</td><td>N/A</td><td>N/A</td><td> 6135</td><td> 6150</td><td>AGGCGAGAAGTGGGTA</td><td> 53</td><td> 442</td>

<td> 1063542</td><td>N/A</td><td>N/A</td><td> 6281</td><td> 6296</td><td>CTCCTCGGAGTCCTAT</td><td> 95</td><td> 443</td>

<td> 1063574</td><td>N/A</td><td>N/A</td><td> 6455</td><td> 6470</td><td>GCACCTGGCTTGCCTG</td><td> 67</td><td> 444</td>

<td> 1063606</td><td>N/A</td><td>N/A</td><td> 6981</td><td> 6996</td><td>CGGCACCTGTAGGTCC</td><td> 141</td><td> 445</td>

<td> 1063638</td><td>N/A</td><td>N/A</td><td> 7172</td><td> 7187</td><td>TACAATACGGCCTCCT</td><td> 86</td><td> 446</td>

<td> 1063670</td><td>N/A</td><td>N/A</td><td> 7377</td><td> 7392</td><td>CACTGCAAGCCCACAT</td><td> 66</td><td> 447</td>

<td> 1063702</td><td>N/A</td><td>N/A</td><td> 7803</td><td> 7818</td><td>GCTGAGGTGTTACCAG</td><td> 109</td><td> 448</td>

<td> 1063734</td><td>N/A</td><td>N/A</td><td> 7980</td><td> 7995</td><td>GAIIIIGACATTCTGC</td><td> 11</td><td> 449</td>

<td> 1063766</td><td>N/A</td><td>N/A</td><td> 8046</td><td> 8061</td><td>AGCTTAAAGACGCCA</td><td> 147</td><td> 450</td>

<td> 1063797</td><td>N/A</td><td>N/A</td><td> 8560</td><td> 8575</td><td>TACTTATTGGGATGAA</td><td> 75</td><td> 451</td>

<td> 1063829</td><td>N/A</td><td>N/A</td><td> 8850</td><td> 8865</td><td>GAGTAGCAGGGCAAAG</td><td> 183</td><td> 452</td>

<td> 1063861</td><td>N/A</td><td>N/A</td><td> 9052</td><td> 9067</td><td>CTAAGGGTTGTGTGTA</td><td> 235</td><td> 453</td>

<td> 1063893</td><td>N/A</td><td>N/A</td><td> 9414</td><td> 9429</td><td>GTGCCTAAGTAGGGAG</td><td> 105</td><td> 454</td>

<td> 1063925</td><td>N/A</td><td>N/A</td><td> 9645</td><td> 9660</td><td>CAGGCTACGGTCTTCC</td><td> 62</td><td> 455</td>

<td> 1063957</td><td>N/A</td><td>N/A</td><td> 9961</td><td> 9976</td><td>CAGAGGGTTTGTAAGT</td><td> 102</td><td> 456</td>

<td> 1063989</td><td>N/A</td><td>N/A</td><td> 10541</td><td> 10556</td><td>TCGCATCATGAGAAAT</td><td> 82</td><td> 457</td>

<td> 1064021</td><td>N/A</td><td>N/A</td><td> 11113</td><td> 11128</td><td>GCTTAAACTTCCCACT</td><td> 106</td><td> 458</td>

<td> 1064053</td><td>N/A</td><td>N/A</td><td> 11380</td><td> 11395</td><td>CATGGAGCTCCTTTGC</td><td> 182</td><td> 459</td>

<td> 1064085</td><td>N/A</td><td>N/A</td><td> 11551</td><td> 11566</td><td>GAGGCATGGCCCCAAT</td><td> 211</td><td> 460</td>

<td> 1064119</td><td>N/A</td><td>N/A</td><td> 11633</td><td> 11648</td><td>GGAAAGGAGGTGCTCC</td><td> 92</td><td> 461</td>

<td> 1064151</td><td>N/A</td><td>N/A</td><td> 11719</td><td> 11734</td><td>CTGCTAAGCCCACAGG</td><td> 140</td><td> 462</td>

<td> 1064183</td><td>N/A</td><td>N/A</td><td> 11804</td><td> 11819</td><td>TTGAAAAGAAGCGGAG</td><td> 141</td><td> 463</td>

<td> 1064215</td><td>N/A</td><td>N/A</td><td> 11913</td><td> 11928</td><td>CACCGTCAACACCCGT</td><td> 63</td><td> 464</td>

<td> 1064247</td><td>N/A</td><td>N/A</td><td> 11980</td><td> 11995</td><td>ATGCAGGACCTCCTAG</td><td> 244</td><td> 465</td>

<td> 1064279</td><td>N/A</td><td>N/A</td><td> 12200</td><td> 12215</td><td>GGGAATGGAGGAACCC</td><td> 112</td><td> 466</td>

<td> 1064311</td><td>N/A</td><td>N/A</td><td> 12385</td><td> 12400</td><td>GTCCAGGAGAGGGTTA</td><td> 241</td><td> 467</td>

<td> 1064343</td><td>N/A</td><td>N/A</td><td> 12579</td><td> 12594</td><td>GATCAAATGGGTGTTA</td><td> 84</td><td> 468</td>

<td> 1064375</td><td>N/A</td><td>N/A</td><td> 12784</td><td> 12799</td><td>CAGAGTCAGCGATGAT</td><td> 77</td><td> 469</td>

<td> 1064407</td><td>N/A</td><td>N/A</td><td> 12925</td><td> 12940</td><td>TGAATTATCGAGTATC</td><td> 53</td><td> 470</td>

<td> 1064439</td><td>N/A</td><td>N/A</td><td> 13219</td><td> 13234</td><td>GTAAGGGATCAGGACT</td><td> 136</td><td> 471</td>

TABLE 7

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

Ninety-seven

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 20</td><td> 65</td>

<td> 1062008</td><td> 4</td><td> 19</td><td> 404</td><td> 419</td><td>lllllCGATGAGTGTG</td><td> 9</td><td> 472</td>

<td> 1062040</td><td> 128</td><td> 143</td><td> 528</td><td> 543</td><td>AAGGATCAGCCTGGCT</td><td> 67</td><td> 473</td>

<td> 1062072</td><td> 313</td><td> 328</td><td> 6851</td><td> 6866</td><td>CCCTGGAAGGTTCCCC</td><td> 49</td><td> 474</td>

<td> 1062104</td><td> 459</td><td> 474</td><td> 7524</td><td> 7539</td><td>GGAGTGCCTGTAAGTG</td><td> 13</td><td> 475</td>

<td> 1062136</td><td> 597</td><td> 612</td><td> 7760</td><td> 7775</td><td>AGAAGACCCCAGTGGC</td><td> 47</td><td> 476</td>

<td> 1062168</td><td> 766</td><td> 781</td><td> 8412</td><td> 8427</td><td>ACACCATTTGCCAGCA</td><td> 59</td><td> 477</td>

<td> 1062200</td><td> 878</td><td> 893</td><td> 9468</td><td> 9483</td><td>CTGGAGGAGACATTGT</td><td> 62</td><td> 478</td>

<td> 1062232</td><td> 1091</td><td> 1106</td><td> 11247</td><td> 11262</td><td>AAACAGGCTGTCAGGG</td><td> 101</td><td> 479</td>

<td> 1062264</td><td> 1185</td><td> 1200</td><td> 12055</td><td> 12070</td><td>GTCGCATGTTGTGGAA</td><td> 10*</td><td> 480</td>

<td> 1062296</td><td> 1430</td><td> 1445</td><td> 13840</td><td> 13855</td><td>CTGGCTCCGTTTCTTG</td><td> 130</td><td> 481</td>

<td> 1062328</td><td> 1595</td><td> 1610</td><td> 14005</td><td> 14020</td><td>GACAGTGGAAACCTCA</td><td> 15</td><td> 482</td>

<td> 1062360</td><td> 1854</td><td> 1869</td><td> 14264</td><td> 14279</td><td>GTGAGGGACAGGATTG</td><td> 58</td><td> 483</td>

<td> 1062392</td><td> 2040</td><td> 2055</td><td> 14450</td><td> 14465</td><td>GTGTAGGCCTCTGGGC</td><td> 45</td><td> 484</td>

<td> 1062424</td><td> 2212</td><td> 2227</td><td> 14622</td><td> 14637</td><td>lllllGGCAAGGCAGT</td><td> 61</td><td> 485</td>

<td> 1062456</td><td>N/A</td><td>N/A</td><td> 8301</td><td> 8316</td><td>TCCACTGACCTGTCCT</td><td> 73</td><td> 486</td>

<td> 1062488</td><td>N/A</td><td>N/A</td><td> 13603</td><td> 13618</td><td>AGCTGCGATGGCACTT</td><td> 116</td><td> 487</td>

<td> 1062520</td><td>N/A</td><td>N/A</td><td> 553</td><td> 568</td><td>ACCTTGGTGAAGTGGA</td><td> 63</td><td> 488</td>

<td> 1062552</td><td>N/A</td><td>N/A</td><td> 687</td><td> 702</td><td>CCTTACCTGGCTGGAA</td><td> 187</td><td> 489</td>

<td> 1062584</td><td>N/A</td><td>N/A</td><td> 879</td><td> 894</td><td>CAGTTGCACCTGGACA</td><td> 111</td><td> 490</td>

<td> 1062616</td><td>N/A</td><td>N/A</td><td> 1111</td><td> 1126</td><td>GGAGATCGATGGAGTG</td><td> 37</td><td> 491</td>

<td> 1062648</td><td>N/A</td><td>N/A</td><td> 1259</td><td> 1274</td><td>GAACTGATGCTCACTC</td><td> 26</td><td> 492</td>

<td> 1062681</td><td>N/A</td><td>N/A</td><td> 1340</td><td> 1355</td><td>TCTAAAGCGATACAAG</td><td> 97</td><td> 493</td>

<td> 1062713</td><td>N/A</td><td>N/A</td><td> 1490</td><td> 1505</td><td>AATCGAGCTCACCCCA</td><td> 76</td><td> 494</td>

<td> 1062745</td><td>N/A</td><td>N/A</td><td> 1726</td><td> 1741</td><td>ACAATCGGCACTTGGT</td><td> 34</td><td> 495</td>

<td> 1062777</td><td>N/A</td><td>N/A</td><td> 1886</td><td> 1901</td><td>GAGCATAAAATAGGAC</td><td> 57</td><td> 496</td>

<td> 1062809</td><td>N/A</td><td>N/A</td><td> 2077</td><td> 2092</td><td>ACCCTATTAGGAGTAA</td><td> 144</td><td> 497</td>

<td> 1062841</td><td>N/A</td><td>N/A</td><td> 2234</td><td> 2249</td><td>CATCATAAGCATCACA</td><td> 19</td><td> 498</td>

<td> 1062873</td><td>N/A</td><td>N/A</td><td> 2396</td><td> 2411</td><td>CTTAACCTCTATAGTA</td><td> 51</td><td> 499</td>

<td> 1062905</td><td>N/A</td><td>N/A</td><td> 2616</td><td> 2631</td><td>GATCTTGGGTTTATTG</td><td> 81</td><td> 500</td>

<td> 1062937</td><td>N/A</td><td>N/A</td><td> 2735</td><td> 2750</td><td>AGTGAATAGTCAGTCC</td><td> 17</td><td> 501</td>

<td> 1062969</td><td>N/A</td><td>N/A</td><td> 2905</td><td> 2920</td><td>CCTGGTATAAGAACAG</td><td> 23</td><td> 502</td>

<td> 1063001</td><td>N/A</td><td>N/A</td><td> 3100</td><td> 3115</td><td>GGACACATGCATGGAG</td><td> 73</td><td> 503</td>

<td> 1063033</td><td>N/A</td><td>N/A</td><td> 3248</td><td> 3263</td><td>AGTCATTAGGTGTCTG</td><td> 23</td><td> 504</td>

<td> 1063065</td><td>N/A</td><td>N/A</td><td> 3392</td><td> 3407</td><td>CCTGAGATCTAGGCTT</td><td> 48</td><td> 505</td>

<td> 1063097</td><td>N/A</td><td>N/A</td><td> 3658</td><td> 3673</td><td>ACTGACATGCCTCCAT</td><td> 54</td><td> 506</td>

<td> 1063129</td><td>N/A</td><td>N/A</td><td> 3884</td><td> 3899</td><td>GTCCACTCTGGAACAA</td><td> 91</td><td> 507</td>

<td> 1063161</td><td>N/A</td><td>N/A</td><td> 4123</td><td> 4138</td><td>GTATAACCACCAGGACC</td><td> 63</td><td> 508</td>

<td> 1063193</td><td>N/A</td><td>N/A</td><td> 4236</td><td> 4251</td><td>CCCCTAGCTCTGAAGA</td><td> 69</td><td> 509</td>

<td> 1063225</td><td>N/A</td><td>N/A</td><td> 4414</td><td> 4429</td><td>CGGCCGGATGCGCCGG</td><td> 120</td><td> 510</td>

<td> 1063256</td><td>N/A</td><td>N/A</td><td> 4584</td><td> 4599</td><td>GCCGGCTTCCTGCACT</td><td> 100</td><td> 511</td>

<td> 1063288</td><td>N/A</td><td>N/A</td><td> 4714</td><td> 4729</td><td>GGCCAGAGCTAAGAAT</td><td> 71</td><td> 512</td>

<td> 1063320</td><td>N/A</td><td>N/A</td><td> 5094</td><td> 5109</td><td>CTCCGAACAAGGGCCT</td><td> 30</td><td> 513</td>

<td> 1063352</td><td>N/A</td><td>N/A</td><td> 5313</td><td> 5328</td><td>CTGAGTTGGGCACACA</td><td> 58</td><td> 514</td>

Ninety-eight-

<td> 1063384</td><td>N/A</td><td>N/A</td><td> 5521</td><td> 5536</td><td>TCCTGGTCTGAGAGGA</td><td> 76</td><td> 515</td>

<td> 1063416</td><td>N/A</td><td>N/A</td><td> 5686</td><td> 5701</td><td>GCCTCAAATGCCCACT</td><td> 61</td><td> 516</td>

<td> 1063448</td><td>N/A</td><td>N/A</td><td> 5858</td><td> 5873</td><td>GCAAGGAGGCGAGTCC</td><td> 55</td><td> 517</td>

<td> 1063480</td><td>N/A</td><td>N/A</td><td> 6015</td><td> 6030</td><td>TGGAAGGACCGAGCTG</td><td> 101</td><td> 518</td>

<td> 1063512</td><td>N/A</td><td>N/A</td><td> 6139</td><td> 6154</td><td>GAGAAGGCGAGAAGTG</td><td> 150</td><td> 519</td>

<td> 1063544</td><td>N/A</td><td>N/A</td><td> 6293</td><td> 6308</td><td>GTCTCGGACTTTCTCC</td><td> 57</td><td> 520</td>

<td> 1063576</td><td>N/A</td><td>N/A</td><td> 6483</td><td> 6498</td><td>CCACACATGCCCCACG</td><td> 102</td><td> 521</td>

<td> 1063608</td><td>N/A</td><td>N/A</td><td> 6983</td><td> 6998</td><td>GTCGGCACCTGTAGGT</td><td> 50</td><td> 522</td>

<td> 1063640</td><td>N/A</td><td>N/A</td><td> 7175</td><td> 7190</td><td>GACTACAATACGGCCT</td><td> 52</td><td> 523</td>

<td> 1063672</td><td>N/A</td><td>N/A</td><td> 7382</td><td> 7397</td><td>CTCTGCACTGCAAGCC</td><td> 30</td><td> 524</td>

<td> 1063704</td><td>N/A</td><td>N/A</td><td> 7867</td><td> 7882</td><td>AGCCTACACTGCTCAC</td><td> 60</td><td> 525</td>

<td> 1063736</td><td>N/A</td><td>N/A</td><td> 8001</td><td> 8016</td><td>TGTAAAGCTCTGTGGT</td><td> 43</td><td> 526</td>

<td> 1063768</td><td>N/A</td><td>N/A</td><td> 8048</td><td> 8063</td><td>GAAGCTTAAAGACGGC</td><td> 42</td><td> 527</td>

<td> 1063799</td><td>N/A</td><td>N/A</td><td> 8563</td><td> 8578</td><td>TACTACTTATTGGGAT</td><td> 52</td><td> 528</td>

<td> 1063831</td><td>N/A</td><td>N/A</td><td> 8852</td><td> 8867</td><td>AG GAGTAGCAGGGCAA</td><td> 60</td><td> 529</td>

<td> 1063863</td><td>N/A</td><td>N/A</td><td> 9054</td><td> 9069</td><td>TGCTAAGGGTTGTGTG</td><td> 37</td><td> 530</td>

<td> 1063895</td><td>N/A</td><td>N/A</td><td> 9425</td><td> 9440</td><td>TCCGCCTGGCAGTGCC</td><td> 40</td><td> 531</td>

<td> 1063927</td><td>N/A</td><td>N/A</td><td> 9687</td><td> 9702</td><td>ACATGAGGCCTCAGCC</td><td> 91</td><td> 532</td>

<td> 1063959</td><td>N/A</td><td>N/A</td><td> 9963</td><td> 9978</td><td>GTCAGAGGGTTTGTAA</td><td> 64</td><td> 533</td>

<td> 1063991</td><td>N/A</td><td>N/A</td><td> 10543</td><td> 10558</td><td>ATTCGCATCATGAGAA</td><td> 33</td><td> 534</td>

<td> 1064023</td><td>N/A</td><td>N/A</td><td> 11115</td><td> 11130</td><td>AGGCTTAAACTTCCCA</td><td> 60</td><td> 535</td>

<td> 1064055</td><td>N/A</td><td>N/A</td><td> 11383</td><td> 11398</td><td>CAGCATGGAGCTCCTT</td><td> 27</td><td> 536</td>

<td> 1064087</td><td>N/A</td><td>N/A</td><td> 11554</td><td> 11569</td><td>GGTGAGGCATGGCCCC</td><td> 57</td><td> 537</td>

<td> 1064121</td><td>N/A</td><td>N/A</td><td> 11653</td><td> 11668</td><td>GAIIIICCTTGGTCAG</td><td> 119</td><td> 538</td>

<td> 1064153</td><td>N/A</td><td>N/A</td><td> 11728</td><td> 11743</td><td>CTCTGATCCCTGCTAA</td><td> 84</td><td> 539</td>

<td> 1064185</td><td>N/A</td><td>N/A</td><td> 11810</td><td> 11825</td><td>CCGAGGTTGAAAAGAA</td><td> 87</td><td> 540</td>

<td> 1064217</td><td>N/A</td><td>N/A</td><td> 11919</td><td> 11934</td><td>AGATTCTCACCGTCAAC</td><td> 107</td><td> 541</td>

<td> 1064249</td><td>N/A</td><td>N/A</td><td> 11984</td><td> 11999</td><td>CCCCATGCAGGACCTC</td><td> 129</td><td> 542</td>

<td> 1064281</td><td>N/A</td><td>N/A</td><td> 12202</td><td> 12217</td><td>TTGGGAATGGAGGAAC</td><td> 106</td><td> 543</td>

<td> 1064313</td><td>N/A</td><td>N/A</td><td> 12396</td><td> 12411</td><td>CTAT ii TATGGGTCCA</td><td> 14</td><td> 544</td>

<td> 1064345</td><td>N/A</td><td>N/A</td><td> 12584</td><td> 12599</td><td>TTAAGGATCAAATGGG</td><td> 74</td><td> 545</td>

<td> 1064377</td><td>N/A</td><td>N/A</td><td> 12786</td><td> 12801</td><td>TACAGAGTCAGCGATG</td><td> 60</td><td> 546</td>

<td> 1064409</td><td>N/A</td><td>N/A</td><td> 12927</td><td> 12942</td><td>TTTGAATTATCGAGTA</td><td> 66</td><td> 547</td>

<td> 1064441</td><td>N/A</td><td>N/A</td><td> 13221</td><td> 13236</td><td>AGGTAAGGGATCAGGA</td><td> 83</td><td> 548</td>

TABLE 8

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 24</td><td> 65</td>

<td> 1062009</td><td> 5</td><td> 20</td><td> 405</td><td> 420</td><td>IIIIIIICGATGAGTGT</td><td> 29</td><td> 549</td>

<td> 1062041</td><td> 143</td><td> 158</td><td> 543</td><td> 558</td><td>AGTGGACTGACAGAAA</td><td> 39</td><td> 550</td>

<td> 1062073</td><td> 314</td><td> 329</td><td> 6852</td><td> 6867</td><td>GCCCTGGAAGGTTCCC</td><td> 114</td><td> 551</td>

<td> 1062105</td><td> 461</td><td> 476</td><td> 7526</td><td> 7541</td><td>GAGGAGTGCCTGTAAG</td><td> 61</td><td> 552</td>

<td> 1062137</td><td> 600</td><td> 615</td><td> 7763</td><td> 7778</td><td>GGGAGAAGACCCCAGT</td><td> 86</td><td> 553</td>

<td> 1062169</td><td> 771</td><td> 786</td><td> 8417</td><td> 8432</td><td>TGCAGACACCATTTGC</td><td> 75</td><td> 554</td>

Ninety nine-

<td> 1062201</td><td> 895</td><td> 910</td><td> 9485</td><td> 9500</td><td>GACTGTACCATTCTCTC</td><td> 87</td><td> 555</td>

<td> 1062233</td><td> 1098</td><td> 1113</td><td> 11254</td><td> 11269</td><td>GGACAGCAAACAGGCT</td><td> 87</td><td> 556</td>

<td> 1062265</td><td> 1186</td><td> 1201</td><td> 12056</td><td> 12071</td><td>GGTCGCATGTTGTGGA</td><td> 10*</td><td> 557</td>

<td> 1062297</td><td> 1433</td><td> 1448</td><td> 13843</td><td> 13858</td><td>CCTCTGGCTCCGTTTC</td><td> 95</td><td> 558</td>

<td> 1062329</td><td> 1596</td><td> 1611</td><td> 14006</td><td> 14021</td><td>AGACAGTGGAAACCTC</td><td> 85</td><td> 559</td>

<td> 1062361</td><td> 1856</td><td> 1871</td><td> 14266</td><td> 14281</td><td>GAGTGAGGGACAGGAT</td><td> 16</td><td> 560</td>

<td> 1062393</td><td> 2041</td><td> 2056</td><td> 14451</td><td> 14466</td><td>TGTGTAGGCCTCTGGG</td><td> 23</td><td> 561</td>

<td> 1062425</td><td> 2215</td><td> 2230</td><td> 14625</td><td> 14640</td><td>GTAI 1 1 1 IGGCAAGGC</td><td> 19</td><td> 562</td>

<td> 1062457</td><td>N/A</td><td>N/A</td><td> 8304</td><td> 8319</td><td>CTGTCCACTGACCTGT</td><td> 39</td><td> 563</td>

<td> 1062489</td><td>N/A</td><td>N/A</td><td> 13609</td><td> 13624</td><td>ACTTTGAGCTGCGATG</td><td> 64</td><td> 564</td>

<td> 1062521</td><td>N/A</td><td>N/A</td><td> 554</td><td> 569</td><td>CACCTTGGTGAAGTGG</td><td> 70</td><td> 565</td>

<td> 1062553</td><td>N/A</td><td>N/A</td><td> 688</td><td> 703</td><td>ACCTTACCTGGCTGGA</td><td> 58</td><td> 566</td>

<td> 1062585</td><td>N/A</td><td>N/A</td><td> 880</td><td> 895</td><td>TCAGTTGCACCTGGAC</td><td> 48</td><td> 567</td>

<td> 1062617</td><td>N/A</td><td>N/A</td><td> 1112</td><td> 1127</td><td>AGGAGATCGATGGAGT</td><td> 67</td><td> 568</td>

<td> 1062649</td><td>N/A</td><td>N/A</td><td> 1260</td><td> 1275</td><td>AGAACTGATGCTCACT</td><td> 41</td><td> 569</td>

<td> 1062682</td><td>N/A</td><td>N/A</td><td> 1341</td><td> 1356</td><td>CTCTAAAGCGATACAA</td><td> 94</td><td> 570</td>

<td> 1062714</td><td>N/A</td><td>N/A</td><td> 1491</td><td> 1506</td><td>GAATCGAGCTCACCCC</td><td> 56</td><td> 571</td>

<td> 1062746</td><td>N/A</td><td>N/A</td><td> 1727</td><td> 1742</td><td>AACAATCGGCACTTGG</td><td> 31</td><td> 572</td>

<td> 1062778</td><td>N/A</td><td>N/A</td><td> 1887</td><td> 1902</td><td>GGAGCATAAAATAGGA</td><td> 116</td><td> 573</td>

<td> 1062810</td><td>N/A</td><td>N/A</td><td> 2078</td><td> 2093</td><td>CACCCTATTAGGAGTA</td><td> 94</td><td> 574</td>

<td> 1062842</td><td>N/A</td><td>N/A</td><td> 2235</td><td> 2250</td><td>CCATCATAAGCATCAC</td><td> 24</td><td> 575</td>

<td> 1062874</td><td>N/A</td><td>N/A</td><td> 2397</td><td> 2412</td><td>TCTTAACCTCTATAGT</td><td> 46</td><td> 576</td>

<td> 1062906</td><td>N/A</td><td>N/A</td><td> 2618</td><td> 2633</td><td>CTGATCTTGGGTTTAT</td><td> 63</td><td> 577</td>

<td> 1062938</td><td>N/A</td><td>N/A</td><td> 2736</td><td> 2751</td><td>GAGTGAATAGTCAGTC</td><td> 10</td><td> 578</td>

<td> 1062970</td><td>N/A</td><td>N/A</td><td> 2920</td><td> 2935</td><td>GCAAAACAGTGTGGCC</td><td> 65</td><td> 579</td>

<td> 1063002</td><td>N/A</td><td>N/A</td><td> 3125</td><td> 3140</td><td>GATAGTGAGAGACATT</td><td> 98</td><td> 580</td>

<td> 1063034</td><td>N/A</td><td>N/A</td><td> 3249</td><td> 3264</td><td>AAGTCATTAGGTGTCT</td><td> 28</td><td> 581</td>

<td> 1063066</td><td>N/A</td><td>N/A</td><td> 3393</td><td> 3408</td><td>TCCTGAGATCTAGGCT</td><td> 83</td><td> 582</td>

<td> 1063098</td><td>N/A</td><td>N/A</td><td> 3666</td><td> 3681</td><td>CCTGACTGACTGACAT</td><td> 113</td><td> 583</td>

<td> 1063130</td><td>N/A</td><td>N/A</td><td> 3886</td><td> 3901</td><td>CTGTCCACTCTGGAAC</td><td> 69</td><td> 584</td>

<td> 1063162</td><td>N/A</td><td>N/A</td><td> 4124</td><td> 4139</td><td>AGTATAACCACCAGGAC</td><td> 36</td><td> 585</td>

<td> 1063194</td><td>N/A</td><td>N/A</td><td> 4243</td><td> 4258</td><td>TGACAAGCCCCTAGCT</td><td> 112</td><td> 586</td>

<td> 1063226</td><td>N/A</td><td>N/A</td><td> 4418</td><td> 4433</td><td>ATGGCGGCCGGATGCG</td><td> 147</td><td> 587</td>

<td> 1063257</td><td>N/A</td><td>N/A</td><td> 4586</td><td> 4601</td><td>CAGCCGGCTTCCTGCA</td><td> 122</td><td> 588</td>

<td> 1063289</td><td>N/A</td><td>N/A</td><td> 4719</td><td> 4734</td><td>CACTTGGCCAGAGCTA</td><td> 29</td><td> 589</td>

<td> 1063321</td><td>N/A</td><td>N/A</td><td> 5095</td><td> 5110</td><td>GCTCCGAACAAGGGCC</td><td> 59</td><td> 590</td>

<td> 1063353</td><td>N/A</td><td>N/A</td><td> 5314</td><td> 5329</td><td>ACTGAGTTGGGCACAC</td><td> 63</td><td> 591</td>

<td> 1063385</td><td>N/A</td><td>N/A</td><td> 5522</td><td> 5537</td><td>ATCCTGGTCTGAGAGG</td><td> 52</td><td> 592</td>

<td> 1063417</td><td>N/A</td><td>N/A</td><td> 5727</td><td> 5742</td><td>CCAATTTCTGGCCCTC</td><td> 51</td><td> 593</td>

<td> 1063449</td><td>N/A</td><td>N/A</td><td> 5859</td><td> 5874</td><td>GGCAAGGAGGCGAGTC</td><td> 29</td><td> 594</td>

<td> 1063481</td><td>N/A</td><td>N/A</td><td> 6016</td><td> 6031</td><td>CTGGAAGGACCGAGCT</td><td> 80</td><td> 595</td>

<td> 1063513</td><td>N/A</td><td>N/A</td><td> 6140</td><td> 6155</td><td>GGAGAAGGCGAGAAGT</td><td> 46</td><td> 596</td>

<td> 1063545</td><td>N/A</td><td>N/A</td><td> 6303</td><td> 6318</td><td>GCCGGAGCTGGTCTCG</td><td> 85</td><td> 597</td>

<td> 1063577</td><td>N/A</td><td>N/A</td><td> 6563</td><td> 6578</td><td>CCATAGTTGCACCCCA</td><td> 37</td><td> 598</td>

<td> 1063609</td><td>N/A</td><td>N/A</td><td> 6985</td><td> 7000</td><td>AGGTCGGCACCTGTAG</td><td> 56</td><td> 599</td>

<td> 1063641</td><td>N/A</td><td>N/A</td><td> 7176</td><td> 7191</td><td>GGACTACAATACGGCC</td><td> 47</td><td> 600</td>

<td> 1063673</td><td>N/A</td><td>N/A</td><td> 7387</td><td> 7402</td><td>AAATACTCTGCACTGC</td><td> 101</td><td> 601</td>

<td> 1063705</td><td>N/A</td><td>N/A</td><td> 7868</td><td> 7883</td><td>TAGCCTACACTGCTCA</td><td> 72</td><td> 602</td>

100

100

Hundred-

<td> 1063737</td><td>N/A</td><td>N/A</td><td> 8006</td><td> 8021</td><td>AGCTTTGTAAAGCTCT</td><td> 30</td><td> 603</td>

<td> 1063769</td><td>N/A</td><td>N/A</td><td> 8049</td><td> 8064</td><td>AGAAGCTTAAAGACGG</td><td> 68</td><td> 604</td>

<td> 1063800</td><td>N/A</td><td>N/A</td><td> 8564</td><td> 8579</td><td>TTACTACTTATTGGGA</td><td> 124</td><td> 605</td>

<td> 1063832</td><td>N/A</td><td>N/A</td><td> 8854</td><td> 8869</td><td>TGAGGAGTAGCAGGGC</td><td> 47</td><td> 606</td>

<td> 1063864</td><td>N/A</td><td>N/A</td><td> 9055</td><td> 9070</td><td>CTGCTAAGGGTTGTGT</td><td> 88</td><td> 607</td>

<td> 1063896</td><td>N/A</td><td>N/A</td><td> 9503</td><td> 9518</td><td>ATTACCTGCTGCTCCA</td><td> 72</td><td> 608</td>

<td> 1063928</td><td>N/A</td><td>N/A</td><td> 9688</td><td> 9703</td><td>AACATGAGGCCTCAGC</td><td> 80</td><td> 609</td>

<td> 1063960</td><td>N/A</td><td>N/A</td><td> 10283</td><td> 10298</td><td>TCTTAGAGTCAGAGGG</td><td> 30</td><td> 610</td>

<td> 1063992</td><td>N/A</td><td>N/A</td><td> 10545</td><td> 10560</td><td>ACATTCGCATCATGAG</td><td> 60</td><td> 611</td>

<td> 1064024</td><td>N/A</td><td>N/A</td><td> 11116</td><td> 11131</td><td>GAGGCTTAAACTTCCC</td><td> 34</td><td> 612</td>

<td> 1064056</td><td>N/A</td><td>N/A</td><td> 11386</td><td> 11401</td><td>GGGCAGCATGGAGCTC</td><td> 83</td><td> 613</td>

<td> 1064088</td><td>N/A</td><td>N/A</td><td> 11560</td><td> 11575</td><td>AGAGTGGGTGAGGCAT</td><td> 94</td><td> 614</td>

<td> 1064122</td><td>N/A</td><td>N/A</td><td> 11654</td><td> 11669</td><td>CGA Illi CCTTGGTCA</td><td> 26</td><td> 615</td>

<td> 1064154</td><td>N/A</td><td>N/A</td><td> 11729</td><td> 11744</td><td>TCTCTGATCCCTGCTA</td><td> 94</td><td> 616</td>

<td> 1064186</td><td>N/A</td><td>N/A</td><td> 11811</td><td> 11826</td><td>CCCGAGGTTGAAAAGA</td><td> 63</td><td> 617</td>

<td> 1064218</td><td>N/A</td><td>N/A</td><td> 11920</td><td> 11935</td><td>GAGATTCTCACCGTCAA</td><td> 69</td><td> 618</td>

<td> 1064250</td><td>N/A</td><td>N/A</td><td> 11987</td><td> 12002</td><td>AAGCCCCATGCAGGAC</td><td> 80</td><td> 619</td>

<td> 1064282</td><td>N/A</td><td>N/A</td><td> 12240</td><td> 12255</td><td>CATTTGAGGCACGGCT</td><td> 105</td><td> 620</td>

<td> 1064314</td><td>N/A</td><td>N/A</td><td> 12399</td><td> 12414</td><td>AGGCTAT TT IAIGGGT</td><td> 70</td><td> 621</td>

<td> 1064346</td><td>N/A</td><td>N/A</td><td> 12585</td><td> 12600</td><td>GTTAAGGATCAAATGG</td><td> 78</td><td> 622</td>

<td> 1064378</td><td>N/A</td><td>N/A</td><td> 12787</td><td> 12802</td><td>TTACAGAGTCAGCGAT</td><td> 105</td><td> 623</td>

<td> 1064410</td><td>N/A</td><td>N/A</td><td> 12936</td><td> 12951</td><td>CAGAGATGGTTTGAAT</td><td> 75</td><td> 624</td>

<td> 1064442</td><td>N/A</td><td>N/A</td><td> 13222</td><td> 13237</td><td>TAGGTAAGGGATCAGG</td><td> 76</td><td> 625</td>

EXAMPLE 2: ANTISENSE INHIBITION OF HUMAN FOXP3 IN SUP-M2 CELLS BY CET GAPMERES

Modified oligonucleotides targeting a Foxp3 nucleic acid were designed and their effect at the Foxp3 mRNA level was assessed in vitro. The modified oligonucleotides were evaluated in a series of experiments having similar culture conditions. The results for each experiment are presented in the separate tables below. SUP-M2 cells grown at a density of 60,000 cells per well were treated using free uptake with 3,000 nM of modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and Foxp3 mRNA levels were measured by real-time quantitative RT-PCR. The RTS35925 human primer and probe set was used to quantify mRNA levels. Foxp3 mRNA levels were adjusted according to total RNA content, quantified by RIBOGREEN®. Results are presented in the tables below as percent Foxp3 mRNA amount control relative to untreated control cells (% UTC). Oligonucleotides with control percentage values ​​marked with an asterisk (*) target the amplicon region of the primer and probe set. Additional assays can be used to measure the potency and efficiency of the modified oligonucleotides that target the amplicon region.

The newly designed oligonucleotides in the tables below were designed as 3-10-3 cEt gapmers. The gapmeres have a length of 16

101

101

One hundred-one nucleosides, where the central gap segment comprises ten 2'-deoxynucleosides and is flanked by lateral segments in the 5' direction and in the 3' direction comprising three nucleosides each. Each nucleoside in the 5' flanking segment and each nucleoside in the 3' flanking segment possesses a cEt-like sugar modification. The internucleoside linkages along each gapped oligomer are phosphorothioate (P=S) linkages. All cytosine residues along each gapped oligomer are 5-methylcytosines. The start site indicates the nucleoside closest to the 5' position that the gapped oligomer targets in the human gene sequence. The termination site indicates the nucleoside 10 closest to the 3' position that the gapped oligomer targets in the human gene sequence. Each gapmer listed in the tables below addresses SEQ ID NO: 1 or SEQ ID NO.: 2. N/A indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity. ND indicates that %UTC is not defined for that specific modified oligonucleotide in that specific experiment. The activity of that modified oligonucleotide can be defined in a different experiment.

TABLE 9

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 21</td><td> 250</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 37</td><td> 65</td>

<td> 1062005</td><td> 1</td><td> 16</td><td> 401</td><td> 416</td><td>TTCGATGAGTGTGTGC</td><td> 20</td><td> 320</td>

<td> 1062037</td><td> 118</td><td> 133</td><td> 518</td><td> 533</td><td>CTGGCTTGTGGGAAAC</td><td> 63</td><td> 321</td>

<td> 1062069</td><td> 310</td><td> 325</td><td> 6848</td><td> 6863</td><td>TGGAAGGTTCCCCCTG</td><td> 142</td><td> 322</td>

<td> 1062101</td><td> 422</td><td> 437</td><td> 7487</td><td> 7502</td><td>CCCGGAGGGTGCCACC</td><td> 135</td><td> 323</td>

<td> 1062133</td><td> 594</td><td> 609</td><td> 7757</td><td> 7772</td><td>AGACCCCAGTGGCGGT</td><td> 85</td><td> 324</td>

<td> 1062165</td><td> 752</td><td> 767</td><td> 8398</td><td> 8413</td><td>CAGTGGGTAGGAGCTC</td><td> 66</td><td> 325</td>

<td> 1062197</td><td> 869</td><td> 884</td><td> 9459</td><td> 9474</td><td>ACATTGTGCCCTGCCC</td><td> 101</td><td> 326</td>

<td> 1062229</td><td> 1049</td><td> 1064</td><td> 11205</td><td> 11220</td><td>GACGACAGGGCCTTGG</td><td> 78</td><td> 327</td>

<td> 1062261</td><td> 1181</td><td> 1196</td><td> 12051</td><td> 12066</td><td>CATGTTGTGGAACTTG</td><td> 111*</td><td> 328</td>

<td> 1062293</td><td> 1423</td><td> 1438</td><td> 13833</td><td> 13848</td><td>CGTTTCTTGCGGAACT</td><td> 105</td><td> 329</td>

<td> 1062325</td><td> 1592</td><td> 1607</td><td> 14002</td><td> 14017</td><td>AGTGGAAACCTCACTT</td><td> 67</td><td> 330</td>

<td> 1062357</td><td> 1848</td><td> 1863</td><td> 14258</td><td> 14273</td><td>GACAGGATTGTGACAT</td><td> 101</td><td> 331</td>

<td> 1062389</td><td> 2026</td><td> 2041</td><td> 14436</td><td> 14451</td><td>GCACACCCCTGTGTTG</td><td> 84</td><td> 332</td>

<td> 1062421</td><td> 2208</td><td> 2223</td><td> 14618</td><td> 14633</td><td>TGGCAAGGCAGTGTGT</td><td> 66</td><td> 333</td>

<td> 1062453</td><td>N/A</td><td>N/A</td><td> 8298</td><td> 8313</td><td>ACTGACCTGTCCTTCC</td><td> 133</td><td> 334</td>

<td> 1062485</td><td>N/A</td><td>N/A</td><td> 13599</td><td> 13614</td><td>GCGATGGCACTTGAGG</td><td> 68</td><td> 335</td>

<td> 1062517</td><td>N/A</td><td>N/A</td><td>N/A</td><td>N/A</td><td>GGCGAGGCTCCTGAGA</td><td> 92</td><td> 626</td>

<td> 1062549</td><td>N/A</td><td>N/A</td><td> 684</td><td> 699</td><td>TACCTGGCTGGAATCA</td><td> 101</td><td> 336</td>

<td> 1062581</td><td>N/A</td><td>N/A</td><td> 866</td><td> 881</td><td>ACAGCATTTCAAGTTG</td><td> 132</td><td> 337</td>

<td> 1062613</td><td>N/A</td><td>N/A</td><td> 1108</td><td> 1123</td><td>GATCGATGGAGTGTGG</td><td> 65</td><td> 338</td>

102

102

hundred- give

<td> 1062645</td><td>N/A</td><td>N/A</td><td> 1237</td><td> 1252</td><td>AATGTAAAGGTCCTCG</td><td> 27</td><td> 339</td>

<td> 1062678</td><td>N/A</td><td>N/A</td><td> 1337</td><td> 1352</td><td>AAAGCGATACAAGCAA</td><td> 87</td><td> 340</td>

<td> 1062710</td><td>N/A</td><td>N/A</td><td> 1475</td><td> 1490</td><td>AGCCCTGAACAACCTG</td><td> 85</td><td> 341</td>

<td> 1062742</td><td>N/A</td><td>N/A</td><td> 1721</td><td> 1736</td><td>CGGCACTTGGTCAAAT</td><td> 96</td><td> 342</td>

<td> 1062774</td><td>N/A</td><td>N/A</td><td> 1877</td><td> 1892</td><td>ATAGGACAACCIIIIG</td><td> 113</td><td> 343</td>

<td> 1062806</td><td>N/A</td><td>N/A</td><td> 2074</td><td> 2089</td><td>CTATTAGGAGTAAGGA</td><td> 70</td><td> 344</td>

<td> 1062838</td><td>N/A</td><td>N/A</td><td> 2159</td><td> 2174</td><td>TATATGTAATGGCTGA</td><td> 25</td><td> 345</td>

<td> 1062870</td><td>N/A</td><td>N/A</td><td> 2391</td><td> 2406</td><td>CCTCTATAGTAAATGG</td><td> 108</td><td> 346</td>

<td> 1062902</td><td>N/A</td><td>N/A</td><td> 2585</td><td> 2600</td><td>GCTAAGTATTTACTGT</td><td> 52</td><td> 347</td>

<td> 1062934</td><td>N/A</td><td>N/A</td><td> 2731</td><td> 2746</td><td>AATAGTCAGTCCATTA</td><td> 78</td><td> 348</td>

<td> 1062966</td><td>N/A</td><td>N/A</td><td> 2866</td><td> 2881</td><td>GAAAGCTTGGACATGG</td><td> 47</td><td> 349</td>

<td> 1062998</td><td>N/A</td><td>N/A</td><td> 3067</td><td> 3082</td><td>GCGAGAGGAGGATTGC</td><td> 103</td><td> 350</td>

<td> 1063030</td><td>N/A</td><td>N/A</td><td> 3244</td><td> 3259</td><td>ATTAGGTGTCTGCAGG</td><td> 45</td><td> 351</td>

<td> 1063062</td><td>N/A</td><td>N/A</td><td> 3389</td><td> 3404</td><td>GAGATCTAGGCTTGGA</td><td> 26</td><td> 352</td>

<td> 1063094</td><td>N/A</td><td>N/A</td><td> 3641</td><td> 3656</td><td>ATCACCACGCTCTGGC</td><td> 38</td><td> 353</td>

<td> 1063126</td><td>N/A</td><td>N/A</td><td> 3863</td><td> 3878</td><td>CCAAATACATGGCCAC</td><td> 73</td><td> 354</td>

<td> 1063158</td><td>N/A</td><td>N/A</td><td> 4102</td><td> 4117</td><td>ATCATAGAACAGCATT</td><td> 26</td><td> 355</td>

<td> 1063190</td><td>N/A</td><td>N/A</td><td> 4223</td><td> 4238</td><td>AGACCTGGCCCTTCTT</td><td> 125</td><td> 356</td>

<td> 1063222</td><td>N/A</td><td>N/A</td><td> 4402</td><td> 4417</td><td>CCGGGCTTCATCGACA</td><td> 108</td><td> 357</td>

<td> 1063253</td><td>N/A</td><td>N/A</td><td> 4555</td><td> 4570</td><td>TCCCTTTCTGACTGGG</td><td> 108</td><td> 358</td>

<td> 1063285</td><td>N/A</td><td>N/A</td><td> 4710</td><td> 4725</td><td>AGAGCTAAGAATTTCTC</td><td> 108</td><td> 359</td>

<td> 1063317</td><td>N/A</td><td>N/A</td><td> 5080</td><td> 5095</td><td>CTGGGAGAGCACTGGT</td><td> 111</td><td> 360</td>

<td> 1063349</td><td>N/A</td><td>N/A</td><td> 5274</td><td> 5289</td><td>GTATAGAAGGGTTCTG</td><td> 64</td><td> 361</td>

<td> 1063381</td><td>N/A</td><td>N/A</td><td> 5482</td><td> 5497</td><td>CAGCCAACCCCATTAT</td><td> 139</td><td> 362</td>

<td> 1063413</td><td>N/A</td><td>N/A</td><td> 5655</td><td> 5670</td><td>CTGTCCAAGCCACGCA</td><td> 79</td><td> 363</td>

<td> 1063445</td><td>N/A</td><td>N/A</td><td> 5855</td><td> 5870</td><td>AGGAGGCGAGTCCAGG</td><td> 92</td><td> 364</td>

<td> 1063477</td><td>N/A</td><td>N/A</td><td> 6012</td><td> 6027</td><td>AAGGACCGAGCTGACA</td><td> 53</td><td> 365</td>

<td> 1063509</td><td>N/A</td><td>N/A</td><td> 6133</td><td> 6148</td><td>GCGAGAAGTGGGTAGA</td><td> 47</td><td> 366</td>

<td> 1063541</td><td>N/A</td><td>N/A</td><td> 6280</td><td> 6295</td><td>TCCTCGGAGTCCTATT</td><td> 116</td><td> 367</td>

<td> 1063573</td><td>N/A</td><td>N/A</td><td> 6449</td><td> 6464</td><td>GGCTTGCCTGCCCACG</td><td> 134</td><td> 368</td>

<td> 1063605</td><td>N/A</td><td>N/A</td><td> 6969</td><td> 6984</td><td>GTCCAGGTACCCCACC</td><td> 65</td><td> 369</td>

<td> 1063637</td><td>N/A</td><td>N/A</td><td> 7171</td><td> 7186</td><td>ACAATACGGCCTCCTC</td><td> 92</td><td> 370</td>

<td> 1063669</td><td>N/A</td><td>N/A</td><td> 7376</td><td> 7391</td><td>ACTGCAAGCCCACATG</td><td> 56</td><td> 371</td>

<td> 1063701</td><td>N/A</td><td>N/A</td><td> 7802</td><td> 7817</td><td>CTGAGGTGTTACCAGG</td><td> 78</td><td> 372</td>

<td> 1063733</td><td>N/A</td><td>N/A</td><td> 7968</td><td> 7983</td><td>CTGCATCTTTAAGGTT</td><td> 56</td><td> 373</td>

<td> 1063765</td><td>N/A</td><td>N/A</td><td> 8045</td><td> 8060</td><td>GCTTAAAGACGGCCAT</td><td> 96</td><td> 374</td>

<td> 1063796</td><td>N/A</td><td>N/A</td><td> 8559</td><td> 8574</td><td>ACTTTATTGGGATGAAG</td><td> 70</td><td> 375</td>

<td> 1063828</td><td>N/A</td><td>N/A</td><td> 8848</td><td> 8863</td><td>GTAGCAGGGCAAAGCA</td><td> 156</td><td> 376</td>

<td> 1063860</td><td>N/A</td><td>N/A</td><td> 9051</td><td> 9066</td><td>TAAGGGTTGTGTGTAG</td><td> 136</td><td> 377</td>

<td> 1063892</td><td>N/A</td><td>N/A</td><td> 9413</td><td> 9428</td><td>TGCCTAAGTAGGGAGA</td><td> 103</td><td> 378</td>

<td> 1063924</td><td>N/A</td><td>N/A</td><td> 9644</td><td> 9659</td><td>AGGCTACGGTCTTCCC</td><td> 67</td><td> 379</td>

<td> 1063956</td><td>N/A</td><td>N/A</td><td> 9960</td><td> 9975</td><td>AGAGGGTTTGTAAGTA</td><td> 78</td><td> 380</td>

<td> 1063988</td><td>N/A</td><td>N/A</td><td> 10527</td><td> 10542</td><td>ATAAATTACCACCAGC</td><td> 41</td><td> 381</td>

<td> 1064020</td><td>N/A</td><td>N/A</td><td> 10757</td><td> 10772</td><td>TTTCAAAGCAAGGACG</td><td> 81</td><td> 382</td>

<td> 1064052</td><td>N/A</td><td>N/A</td><td> 11379</td><td> 11394</td><td>ATGGAGCTCCTTTGCA</td><td> 89</td><td> 383</td>

<td> 1064084</td><td>N/A</td><td>N/A</td><td> 11550</td><td> 11565</td><td>AGGCATGGCCCCAATC</td><td> 168</td><td> 384</td>

<td> 1064118</td><td>N/A</td><td>N/A</td><td> 11622</td><td> 11637</td><td>GCTCCTGGAATTACTT</td><td> 91</td><td> 385</td>

<td> 1064150</td><td>N/A</td><td>N/A</td><td> 11717</td><td> 11732</td><td>GCTAAGCCCACAGGCC</td><td> 81</td><td> 386</td>

103

103

Hundred three

<td> 1064182</td><td>N/A</td><td>N/A</td><td> 11803</td><td> 11818</td><td>TGAAAAGAAGCGGAGT</td><td> 80</td><td> 387</td>

<td> 1064214</td><td>N/A</td><td>N/A</td><td> 11910</td><td> 11925</td><td>CGTCAACACCCGTGTC</td><td> 114</td><td> 388</td>

<td> 1064246</td><td>N/A</td><td>N/A</td><td> 11978</td><td> 11993</td><td>GCAGGACCTCCTAGCT</td><td> 104</td><td> 389</td>

<td> 1064278</td><td>N/A</td><td>N/A</td><td> 12199</td><td> 12214</td><td>GGAATGGAGGAACCCA</td><td> 133</td><td> 390</td>

<td> 1064310</td><td>N/A</td><td>N/A</td><td> 12384</td><td> 12399</td><td>TCCAGGAGAGGGTTAG</td><td> 45</td><td> 391</td>

<td> 1064342</td><td>N/A</td><td>N/A</td><td> 12578</td><td> 12593</td><td>ATCAAATGGGTGTTAC</td><td> 89</td><td> 392</td>

<td> 1064374</td><td>N/A</td><td>N/A</td><td> 12781</td><td> 12796</td><td>AGTCAGCGATGATGAT</td><td> 64</td><td> 393</td>

<td> 1064406</td><td>N/A</td><td>N/A</td><td> 12924</td><td> 12939</td><td>GAATTATCGAGTATCT</td><td> 99</td><td> 394</td>

<td> 1064438</td><td>N/A</td><td>N/A</td><td> 13217</td><td> 13232</td><td>AAGGGATCAGGACTGA</td><td> 112</td><td> 395</td>

TABLE 10

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 19</td><td> 250</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 41</td><td> 65</td>

<td> 1062006</td><td> 2</td><td> 17</td><td> 402</td><td> 417</td><td>TTTCGATGAGTGTGTG</td><td> 31</td><td> 396</td>

<td> 1062038</td><td> 119</td><td> 134</td><td> 519</td><td> 534</td><td>CCTGGCTTGTGGGAAA</td><td> 86</td><td> 397</td>

<td> 1062070</td><td> 311</td><td> 326</td><td> 6849</td><td> 6864</td><td>CTGGAAGGTTCCCCCT</td><td> 131</td><td> 398</td>

<td> 1062102</td><td> 424</td><td> 439</td><td> 7489</td><td> 7504</td><td>GCCCCGGAGGGTGCCA</td><td> 99</td><td> 399</td>

<td> 1062134</td><td> 595</td><td> 610</td><td> 7758</td><td> 7773</td><td>AAGACCCCAGTGGCGG</td><td> 57</td><td> 400</td>

<td> 1062166</td><td> 754</td><td> 769</td><td> 8400</td><td> 8415</td><td>AGCAGTGGGTAGGAGC</td><td> 37</td><td> 401</td>

<td> 1062198</td><td> 876</td><td> 891</td><td> 9466</td><td> 9481</td><td>GGAGGAGACATTGTGC</td><td> 107</td><td> 402</td>

<td> 1062230</td><td> 1050</td><td> 1065</td><td> 11206</td><td> 11221</td><td>GGACGACAGGGCCTTG</td><td> 81</td><td> 403</td>

<td> 1062262</td><td> 1183</td><td> 1198</td><td> 12053</td><td> 12068</td><td>CGCATGTTGTGGAACT</td><td> 66*</td><td> 404</td>

<td> 1062294</td><td> 1426</td><td> 1441</td><td> 13836</td><td> 13851</td><td>CTCCGTTTCTTGCGGA</td><td> 115</td><td> 405</td>

<td> 1062326</td><td> 1593</td><td> 1608</td><td> 14003</td><td> 14018</td><td>CAGTGGAAACCTCACT</td><td> 118</td><td> 406</td>

<td> 1062358</td><td> 1852</td><td> 1867</td><td> 14262</td><td> 14277</td><td>GAGGGACAGGATTGTG</td><td> 68</td><td> 407</td>

<td> 1062390</td><td> 2028</td><td> 2043</td><td> 14438</td><td> 14453</td><td>GGGCACACCCCTGTGT</td><td> 128</td><td> 408</td>

<td> 1062422</td><td> 2209</td><td> 2224</td><td> 14619</td><td> 14634</td><td>TTGGCAAGGCAGTGTG</td><td> 19</td><td> 409</td>

<td> 1062454</td><td>N/A</td><td>N/A</td><td> 8299</td><td> 8314</td><td>CACTGACCTGTCCTTC</td><td> 70</td><td> 410</td>

<td> 1062486</td><td>N/A</td><td>N/A</td><td> 13601</td><td> 13616</td><td>CTGCGATGGCACTTGA</td><td> 114</td><td> 411</td>

<td> 1062550</td><td>N/A</td><td>N/A</td><td> 685</td><td> 700</td><td>TTACCTGGCTGGAATC</td><td> 129</td><td> 412</td>

<td> 1062582</td><td>N/A</td><td>N/A</td><td> 867</td><td> 882</td><td>GACAGCATTTCAAGTT</td><td> 42</td><td> 413</td>

<td> 1062614</td><td>N/A</td><td>N/A</td><td> 1109</td><td> 1124</td><td>AGATCGATGGAGTGTG</td><td> 59</td><td> 414</td>

<td> 1062646</td><td>N/A</td><td>N/A</td><td> 1238</td><td> 1253</td><td>AAATGTAAAGGTCCTC</td><td> 40</td><td> 415</td>

<td> 1062679</td><td>N/A</td><td>N/A</td><td> 1338</td><td> 1353</td><td>TAAAGCGATACAAGCA</td><td> 82</td><td> 416</td>

<td> 1062711</td><td>N/A</td><td>N/A</td><td> 1476</td><td> 1491</td><td>CAGCCCTGAACAACCT</td><td> 123</td><td> 417</td>

<td> 1062743</td><td>N/A</td><td>N/A</td><td> 1723</td><td> 1738</td><td>ATCGGCACTTGGTCAA</td><td> 44</td><td> 418</td>

<td> 1062775</td><td>N/A</td><td>N/A</td><td> 1878</td><td> 1893</td><td>AATAGGACAACCIIII</td><td> 74</td><td> 419</td>

<td> 1062807</td><td>N/A</td><td>N/A</td><td> 2075</td><td> 2090</td><td>CCTATTAGGAGTAAGG</td><td> 127</td><td> 420</td>

<td> 1062839</td><td>N/A</td><td>N/A</td><td> 2160</td><td> 2175</td><td>ATATATGTAATGGCTG</td><td> 24</td><td> 421</td>

<td> 1062871</td><td>N/A</td><td>N/A</td><td> 2392</td><td> 2407</td><td>ACCTCTATAGTAAATG</td><td> 103</td><td> 422</td>

<td> 1062903</td><td>N/A</td><td>N/A</td><td> 2609</td><td> 2624</td><td>GGTTTATTGTGTGTCA</td><td> 5</td><td> 423</td>

<td> 1062935</td><td>N/A</td><td>N/A</td><td> 2732</td><td> 2747</td><td>GAATAGTCAGTCCATT</td><td> 64</td><td> 424</td>

<td> 1062967</td><td>N/A</td><td>N/A</td><td> 2868</td><td> 2883</td><td>TAGAAAGCTTGGACAT</td><td> 100</td><td> 425</td>

104

104

one hundred-four-

<td> 1062999</td><td>N/A</td><td>N/A</td><td> 3069</td><td> 3084</td><td>GTGCGAGAGGAGGATT</td><td> 71</td><td> 426</td>

<td> 1063031</td><td>N/A</td><td>N/A</td><td> 3245</td><td> 3260</td><td>CATTAGGTGTCTGCAG</td><td> 59</td><td> 427</td>

<td> 1063063</td><td>N/A</td><td>N/A</td><td> 3390</td><td> 3405</td><td>TGAGATCTAGGCTTGG</td><td> 23</td><td> 428</td>

<td> 1063095</td><td>N/A</td><td>N/A</td><td> 3642</td><td> 3657</td><td>CATCACCACGCTCTGG</td><td> 117</td><td> 429</td>

<td> 1063127</td><td>N/A</td><td>N/A</td><td> 3864</td><td> 3879</td><td>CCCAAATACATGGCCA</td><td> 40</td><td> 430</td>

<td> 1063159</td><td>N/A</td><td>N/A</td><td> 4104</td><td> 4119</td><td>GAATCATAGAACAGCA</td><td> 39</td><td> 431</td>

<td> 1063191</td><td>N/A</td><td>N/A</td><td> 4228</td><td> 4243</td><td>TCTGAAGACCTGGCCC</td><td> 61</td><td> 432</td>

<td> 1063223</td><td>N/A</td><td>N/A</td><td> 4406</td><td> 4421</td><td>TGCGCCGGGCTTCATC</td><td> 78</td><td> 433</td>

<td> 1063254</td><td>N/A</td><td>N/A</td><td> 4575</td><td> 4590</td><td>CTGCACTGTCTGTTGG</td><td> 93</td><td> 434</td>

<td> 1063286</td><td>N/A</td><td>N/A</td><td> 4712</td><td> 4727</td><td>CCAGAGCTAAGAATTC</td><td> 69</td><td> 435</td>

<td> 1063318</td><td>N/A</td><td>N/A</td><td> 5083</td><td> 5098</td><td>GGCCTGGGAGAGCACT</td><td> 71</td><td> 436</td>

<td> 1063350</td><td>N/A</td><td>N/A</td><td> 5276</td><td> 5291</td><td>GAGTATAGAAGGGTTC</td><td> 70</td><td> 437</td>

<td> 1063382</td><td>N/A</td><td>N/A</td><td> 5496</td><td> 5511</td><td>TGGAAGGGACTGCCCA</td><td> 119</td><td> 438</td>

<td> 1063414</td><td>N/A</td><td>N/A</td><td> 5656</td><td> 5671</td><td>CCTGTCCAAGCCACGC</td><td> 51</td><td> 439</td>

<td> 1063446</td><td>N/A</td><td>N/A</td><td> 5856</td><td> 5871</td><td>AAGGAGGCGAGTCCAG</td><td> 127</td><td> 440</td>

<td> 1063478</td><td>N/A</td><td>N/A</td><td> 6013</td><td> 6028</td><td>GAAGGACCGAGCTGAC</td><td> 104</td><td> 441</td>

<td> 1063510</td><td>N/A</td><td>N/A</td><td> 6135</td><td> 6150</td><td>AGGCGAGAAGTGGGTA</td><td> 43</td><td> 442</td>

<td> 1063542</td><td>N/A</td><td>N/A</td><td> 6281</td><td> 6296</td><td>CTCCTCGGAGTCCTAT</td><td> 33</td><td> 443</td>

<td> 1063574</td><td>N/A</td><td>N/A</td><td> 6455</td><td> 6470</td><td>GCACCTGGCTTGCCTG</td><td> 59</td><td> 444</td>

<td> 1063606</td><td>N/A</td><td>N/A</td><td> 6981</td><td> 6996</td><td>CGGCACCTGTAGGTCC</td><td> 113</td><td> 445</td>

<td> 1063638</td><td>N/A</td><td>N/A</td><td> 7172</td><td> 7187</td><td>TACAATACGGCCTCCT</td><td> 54</td><td> 446</td>

<td> 1063670</td><td>N/A</td><td>N/A</td><td> 7377</td><td> 7392</td><td>CACTGCAAGCCCACAT</td><td> 48</td><td> 447</td>

<td> 1063702</td><td>N/A</td><td>N/A</td><td> 7803</td><td> 7818</td><td>GCTGAGGTGTTACCAG</td><td> 76</td><td> 448</td>

<td> 1063734</td><td>N/A</td><td>N/A</td><td> 7980</td><td> 7995</td><td>GAIIIIGACATTCTGC</td><td> 3</td><td> 449</td>

<td> 1063766</td><td>N/A</td><td>N/A</td><td> 8046</td><td> 8061</td><td>AGCTTAAAGACGCCA</td><td> 116</td><td> 450</td>

<td> 1063797</td><td>N/A</td><td>N/A</td><td> 8560</td><td> 8575</td><td>TACTTATTGGGATGAA</td><td> 42</td><td> 451</td>

<td> 1063829</td><td>N/A</td><td>N/A</td><td> 8850</td><td> 8865</td><td>GAGTAGCAGGGCAAAG</td><td> 112</td><td> 452</td>

<td> 1063861</td><td>N/A</td><td>N/A</td><td> 9052</td><td> 9067</td><td>CTAAGGGTTGTGTGTA</td><td> 69</td><td> 453</td>

<td> 1063893</td><td>N/A</td><td>N/A</td><td> 9414</td><td> 9429</td><td>GTGCCTAAGTAGGGAG</td><td> 48</td><td> 454</td>

<td> 1063925</td><td>N/A</td><td>N/A</td><td> 9645</td><td> 9660</td><td>CAGGCTACGGTCTTCC</td><td> 113</td><td> 455</td>

<td> 1063957</td><td>N/A</td><td>N/A</td><td> 9961</td><td> 9976</td><td>CAGAGGGTTTGTAAGT</td><td> 75</td><td> 456</td>

<td> 1063989</td><td>N/A</td><td>N/A</td><td> 10541</td><td> 10556</td><td>TCGCATCATGAGAAAT</td><td> 58</td><td> 457</td>

<td> 1064021</td><td>N/A</td><td>N/A</td><td> 11113</td><td> 11128</td><td>GCTTAAACTTCCCACT</td><td> 118</td><td> 458</td>

<td> 1064053</td><td>N/A</td><td>N/A</td><td> 11380</td><td> 11395</td><td>CATGGAGCTCCTTTGC</td><td> 122</td><td> 459</td>

<td> 1064085</td><td>N/A</td><td>N/A</td><td> 11551</td><td> 11566</td><td>GAGGCATGGCCCCAAT</td><td> 143</td><td> 460</td>

<td> 1064119</td><td>N/A</td><td>N/A</td><td> 11633</td><td> 11648</td><td>GGAAAGGAGGTGCTCC</td><td> 125</td><td> 461</td>

<td> 1064151</td><td>N/A</td><td>N/A</td><td> 11719</td><td> 11734</td><td>CTGCTAAGCCCACAGG</td><td> 86</td><td> 462</td>

<td> 1064183</td><td>N/A</td><td>N/A</td><td> 11804</td><td> 11819</td><td>TTGAAAAGAAGCGGAG</td><td> 55</td><td> 463</td>

<td> 1064215</td><td>N/A</td><td>N/A</td><td> 11913</td><td> 11928</td><td>CACCGTCAACACCCGT</td><td> 58</td><td> 464</td>

<td> 1064247</td><td>N/A</td><td>N/A</td><td> 11980</td><td> 11995</td><td>ATGCAGGACCTCCTAG</td><td> 131</td><td> 465</td>

<td> 1064279</td><td>N/A</td><td>N/A</td><td> 12200</td><td> 12215</td><td>GGGAATGGAGGAACCC</td><td> 113</td><td> 466</td>

<td> 1064311</td><td>N/A</td><td>N/A</td><td> 12385</td><td> 12400</td><td>GTCCAGGAGAGGGTTA</td><td> 88</td><td> 467</td>

<td> 1064343</td><td>N/A</td><td>N/A</td><td> 12579</td><td> 12594</td><td>GATCAAATGGGTGTTA</td><td> 81</td><td> 468</td>

<td> 1064375</td><td>N/A</td><td>N/A</td><td> 12784</td><td> 12799</td><td>CAGAGTCAGCGATGAT</td><td> 98</td><td> 469</td>

<td> 1064407</td><td>N/A</td><td>N/A</td><td> 12925</td><td> 12940</td><td>TGAATTATCGAGTATC</td><td> 86</td><td> 470</td>

<td> 1064439</td><td>N/A</td><td>N/A</td><td> 13219</td><td> 13234</td><td>GTAAGGGATCAGGACT</td><td> 66</td><td> 471</td>

TABLE 11

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

105

105

One hundred dnco THAT THE SEQ ID NO: 1 AND 2 HAVE AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 18</td><td> 250</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 36</td><td> 65</td>

<td> 1062008</td><td> 4</td><td> 19</td><td> 404</td><td> 419</td><td>lllllCGATGAGTGTG</td><td> 13</td><td> 472</td>

<td> 1062040</td><td> 128</td><td> 143</td><td> 528</td><td> 543</td><td>AAGGATCAGCCTGGCT</td><td> 111</td><td> 473</td>

<td> 1062072</td><td> 313</td><td> 328</td><td> 6851</td><td> 6866</td><td>CCCTGGAAGGTTCCCC</td><td> 92</td><td> 474</td>

<td> 1062104</td><td> 459</td><td> 474</td><td> 7524</td><td> 7539</td><td>GGAGTGCCTGTAAGTG</td><td> 78</td><td> 475</td>

<td> 1062136</td><td> 597</td><td> 612</td><td> 7760</td><td> 7775</td><td>AGAAGACCCCAGTGGC</td><td> 98</td><td> 476</td>

<td> 1062168</td><td> 766</td><td> 781</td><td> 8412</td><td> 8427</td><td>ACACCATTTGCCAGCA</td><td> 119</td><td> 477</td>

<td> 1062200</td><td> 878</td><td> 893</td><td> 9468</td><td> 9483</td><td>CTGGAGGAGACATTGT</td><td> 64</td><td> 478</td>

<td> 1062232</td><td> 1091</td><td> 1106</td><td> 11247</td><td> 11262</td><td>AAACAGGCTGTCAGGG</td><td> 129</td><td> 479</td>

<td> 1062264</td><td> 1185</td><td> 1200</td><td> 12055</td><td> 12070</td><td>GTCGCATGTTGTGGAA</td><td> 5*</td><td> 480</td>

<td> 1062296</td><td> 1430</td><td> 1445</td><td> 13840</td><td> 13855</td><td>CTGGCTCCGTTTCTTG</td><td> 91</td><td> 481</td>

<td> 1062328</td><td> 1595</td><td> 1610</td><td> 14005</td><td> 14020</td><td>GACAGTGGAAACCTCA</td><td> 71</td><td> 482</td>

<td> 1062360</td><td> 1854</td><td> 1869</td><td> 14264</td><td> 14279</td><td>GTGAGGGACAGGATTG</td><td> 76</td><td> 483</td>

<td> 1062392</td><td> 2040</td><td> 2055</td><td> 14450</td><td> 14465</td><td>GTGTAGGCCTCTGGGC</td><td> 201</td><td> 484</td>

<td> 1062424</td><td> 2212</td><td> 2227</td><td> 14622</td><td> 14637</td><td>lllllGGCAAGGCAGT</td><td> 154</td><td> 485</td>

<td> 1062456</td><td>N/A</td><td>N/A</td><td> 8301</td><td> 8316</td><td>TCCACTGACCTGTCCT</td><td> 74</td><td> 486</td>

<td> 1062488</td><td>N/A</td><td>N/A</td><td> 13603</td><td> 13618</td><td>AGCTGCGATGGCACTT</td><td> 123</td><td> 487</td>

<td> 1062520</td><td>N/A</td><td>N/A</td><td> 553</td><td> 568</td><td>ACCTTGGTGAAGTGGA</td><td> 60</td><td> 488</td>

<td> 1062552</td><td>N/A</td><td>N/A</td><td> 687</td><td> 702</td><td>CCTTACCTGGCTGGAA</td><td> 130</td><td> 489</td>

<td> 1062584</td><td>N/A</td><td>N/A</td><td> 879</td><td> 894</td><td>CAGTTGCACCTGGACA</td><td> 81</td><td> 490</td>

<td> 1062616</td><td>N/A</td><td>N/A</td><td> 1111</td><td> 1126</td><td>GGAGATCGATGGAGTG</td><td> 93</td><td> 491</td>

<td> 1062648</td><td>N/A</td><td>N/A</td><td> 1259</td><td> 1274</td><td>GAACTGATGCTCACTC</td><td> 78</td><td> 492</td>

<td> 1062681</td><td>N/A</td><td>N/A</td><td> 1340</td><td> 1355</td><td>TCTAAAGCGATACAAG</td><td> 104</td><td> 493</td>

<td> 1062713</td><td>N/A</td><td>N/A</td><td> 1490</td><td> 1505</td><td>AATCGAGCTCACCCCA</td><td> 208</td><td> 494</td>

<td> 1062745</td><td>N/A</td><td>N/A</td><td> 1726</td><td> 1741</td><td>ACAATCGGCACTTGGT</td><td> 84</td><td> 495</td>

<td> 1062777</td><td>N/A</td><td>N/A</td><td> 1886</td><td> 1901</td><td>GAGCATAAAATAGGAC</td><td> 93</td><td> 496</td>

<td> 1062809</td><td>N/A</td><td>N/A</td><td> 2077</td><td> 2092</td><td>ACCCTATTAGGAGTAA</td><td> 133</td><td> 497</td>

<td> 1062841</td><td>N/A</td><td>N/A</td><td> 2234</td><td> 2249</td><td>CATCATAAGCATCACA</td><td> 101</td><td> 498</td>

<td> 1062873</td><td>N/A</td><td>N/A</td><td> 2396</td><td> 2411</td><td>CTTAACCTCTATAGTA</td><td> 106</td><td> 499</td>

<td> 1062905</td><td>N/A</td><td>N/A</td><td> 2616</td><td> 2631</td><td>GATCTTGGGTTTATTG</td><td> 207</td><td> 500</td>

<td> 1062937</td><td>N/A</td><td>N/A</td><td> 2735</td><td> 2750</td><td>AGTGAATAGTCAGTCC</td><td> 76</td><td> 501</td>

<td> 1062969</td><td>N/A</td><td>N/A</td><td> 2905</td><td> 2920</td><td>CCTGGTATAAGAACAG</td><td> 86</td><td> 502</td>

<td> 1063001</td><td>N/A</td><td>N/A</td><td> 3100</td><td> 3115</td><td>GGACACATGCATGGAG</td><td> 95</td><td> 503</td>

<td> 1063033</td><td>N/A</td><td>N/A</td><td> 3248</td><td> 3263</td><td>AGTCATTAGGTGTCTG</td><td> 49</td><td> 504</td>

<td> 1063065</td><td>N/A</td><td>N/A</td><td> 3392</td><td> 3407</td><td>CCTGAGATCTAGGCTT</td><td> 77</td><td> 505</td>

<td> 1063097</td><td>N/A</td><td>N/A</td><td> 3658</td><td> 3673</td><td>ACTGACATGCCTCCAT</td><td> 32</td><td> 506</td>

<td> 1063129</td><td>N/A</td><td>N/A</td><td> 3884</td><td> 3899</td><td>GTCCACTCTGGAACAA</td><td> 123</td><td> 507</td>

<td> 1063161</td><td>N/A</td><td>N/A</td><td> 4123</td><td> 4138</td><td>GTATAACCACCAGGACC</td><td> 135</td><td> 508</td>

<td> 1063193</td><td>N/A</td><td>N/A</td><td> 4236</td><td> 4251</td><td>CCCCTAGCTCTGAAGA</td><td> 106</td><td> 509</td>

<td> 1063225</td><td>N/A</td><td>N/A</td><td> 4414</td><td> 4429</td><td>CGGCCGGATGCGCCGG</td><td> 158</td><td> 510</td>

<td> 1063256</td><td>N/A</td><td>N/A</td><td> 4584</td><td> 4599</td><td>GCCGGCTTCCTGCACT</td><td> 145</td><td> 511</td>

<td> 1063288</td><td>N/A</td><td>N/A</td><td> 4714</td><td> 4729</td><td>GGCCAGAGCTAAGAAT</td><td> 52</td><td> 512</td>

<td> 1063320</td><td>N/A</td><td>N/A</td><td> 5094</td><td> 5109</td><td>CTCCGAACAAGGGCCT</td><td> 41</td><td> 513</td>

106

106

A hundred and six

<td> 1063352</td><td>N/A</td><td>N/A</td><td> 5313</td><td> 5328</td><td>CTGAGTTGGGCACACA</td><td> 93</td><td> 514</td>

<td> 1063384</td><td>N/A</td><td>N/A</td><td> 5521</td><td> 5536</td><td>TCCTGGTCTGAGAGGA</td><td> 170</td><td> 515</td>

<td> 1063416</td><td>N/A</td><td>N/A</td><td> 5686</td><td> 5701</td><td>GCCTCAAATGCCCACT</td><td> 91</td><td> 516</td>

<td> 1063448</td><td>N/A</td><td>N/A</td><td> 5858</td><td> 5873</td><td>GCAAGGAGGCGAGTCC</td><td> 57</td><td> 517</td>

<td> 1063480</td><td>N/A</td><td>N/A</td><td> 6015</td><td> 6030</td><td>TGGAAGGACCGAGCTG</td><td> 101</td><td> 518</td>

<td> 1063512</td><td>N/A</td><td>N/A</td><td> 6139</td><td> 6154</td><td>GAGAAGGCGAGAAGTG</td><td> 109</td><td> 519</td>

<td> 1063544</td><td>N/A</td><td>N/A</td><td> 6293</td><td> 6308</td><td>GTCTCGGACTTTCTCC</td><td> 217</td><td> 520</td>

<td> 1063576</td><td>N/A</td><td>N/A</td><td> 6483</td><td> 6498</td><td>CCACACATGCCCCACG</td><td> 95</td><td> 521</td>

<td> 1063608</td><td>N/A</td><td>N/A</td><td> 6983</td><td> 6998</td><td>GTCGGCACCTGTAGGT</td><td> 122</td><td> 522</td>

<td> 1063640</td><td>N/A</td><td>N/A</td><td> 7175</td><td> 7190</td><td>GACTACAATACGGCCT</td><td> 83</td><td> 523</td>

<td> 1063672</td><td>N/A</td><td>N/A</td><td> 7382</td><td> 7397</td><td>CTCTGCACTGCAAGCC</td><td> 91</td><td> 524</td>

<td> 1063704</td><td>N/A</td><td>N/A</td><td> 7867</td><td> 7882</td><td>AGCCTACACTGCTCAC</td><td> 69</td><td> 525</td>

<td> 1063736</td><td>N/A</td><td>N/A</td><td> 8001</td><td> 8016</td><td>TGTAAAGCTCTGTGGT</td><td> 61</td><td> 526</td>

<td> 1063768</td><td>N/A</td><td>N/A</td><td> 8048</td><td> 8063</td><td>GAAGCTTAAAGACGGC</td><td> 34</td><td> 527</td>

<td> 1063799</td><td>N/A</td><td>N/A</td><td> 8563</td><td> 8578</td><td>TACTACTTATTGGGAT</td><td> 158</td><td> 528</td>

<td> 1063831</td><td>N/A</td><td>N/A</td><td> 8852</td><td> 8867</td><td>AGGAGTAGCAGGGCAA</td><td> 76</td><td> 529</td>

<td> 1063863</td><td>N/A</td><td>N/A</td><td> 9054</td><td> 9069</td><td>TGCTAAGGGTTGTGTG</td><td> 108</td><td> 530</td>

<td> 1063895</td><td>N/A</td><td>N/A</td><td> 9425</td><td> 9440</td><td>TCCGCCTGGCAGTGCC</td><td> 25</td><td> 531</td>

<td> 1063927</td><td>N/A</td><td>N/A</td><td> 9687</td><td> 9702</td><td>ACATGAGGCCTCAGCC</td><td> 111</td><td> 532</td>

<td> 1063959</td><td>N/A</td><td>N/A</td><td> 9963</td><td> 9978</td><td>GTCAGAGGGTTTGTAA</td><td> 63</td><td> 533</td>

<td> 1063991</td><td>N/A</td><td>N/A</td><td> 10543</td><td> 10558</td><td>ATTCGCATCATGAGAA</td><td> 188</td><td> 534</td>

<td> 1064023</td><td>N/A</td><td>N/A</td><td> 11115</td><td> 11130</td><td>AGGCTTAAACTTCCCA</td><td> 119</td><td> 535</td>

<td> 1064055</td><td>N/A</td><td>N/A</td><td> 11383</td><td> 11398</td><td>CAGCATGGAGCTCCTT</td><td> 98</td><td> 536</td>

<td> 1064087</td><td>N/A</td><td>N/A</td><td> 11554</td><td> 11569</td><td>GGTGAGGCATGGCCCC</td><td> 86</td><td> 537</td>

<td> 1064121</td><td>N/A</td><td>N/A</td><td> 11653</td><td> 11668</td><td>GAIIIICCTTGGTCAG</td><td> 51</td><td> 538</td>

<td> 1064153</td><td>N/A</td><td>N/A</td><td> 11728</td><td> 11743</td><td>CTCTGATCCCTGCTAA</td><td> 139</td><td> 539</td>

<td> 1064185</td><td>N/A</td><td>N/A</td><td> 11810</td><td> 11825</td><td>CCGAGGTTGAAAAGAA</td><td> 150</td><td> 540</td>

<td> 1064217</td><td>N/A</td><td>N/A</td><td> 11919</td><td> 11934</td><td>AGATTCTCACCGTCAAC</td><td> 142</td><td> 541</td>

<td> 1064249</td><td>N/A</td><td>N/A</td><td> 11984</td><td> 11999</td><td>CCCCATGCAGGACCTC</td><td> 96</td><td> 542</td>

<td> 1064281</td><td>N/A</td><td>N/A</td><td> 12202</td><td> 12217</td><td>TTGGGAATGGAGGAAC</td><td> 151</td><td> 543</td>

<td> 1064313</td><td>N/A</td><td>N/A</td><td> 12396</td><td> 12411</td><td>CTAT ii TATGGGTCCA</td><td> 13</td><td> 544</td>

<td> 1064345</td><td>N/A</td><td>N/A</td><td> 12584</td><td> 12599</td><td>TTAAGGATCAAATGGG</td><td> 65</td><td> 545</td>

<td> 1064377</td><td>N/A</td><td>N/A</td><td> 12786</td><td> 12801</td><td>TACAGAGTCAGCGATG</td><td> 82</td><td> 546</td>

<td> 1064409</td><td>N/A</td><td>N/A</td><td> 12927</td><td> 12942</td><td>TTTGAATTATCGAGTA</td><td> 83</td><td> 547</td>

<td> 1064441</td><td>N/A</td><td>N/A</td><td> 13221</td><td> 13236</td><td>AGGTAAGGGATCAGGA</td><td> 150</td><td> 548</td>

TABLE 12

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 17</td><td> 250</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 53</td><td> 65</td>

<td> 1062009</td><td> 5</td><td> 20</td><td> 405</td><td> 420</td><td>IIIIIIICGATGAGTGT</td><td> 35</td><td> 549</td>

<td> 1062041</td><td> 143</td><td> 158</td><td> 543</td><td> 558</td><td>AGTGGACTGACAGAAA</td><td> 117</td><td> 550</td>

<td> 1062073</td><td> 314</td><td> 329</td><td> 6852</td><td> 6867</td><td>GCCCTGGAAGGTTCCC</td><td> 94</td><td> 551</td>

<td> 1062105</td><td> 461</td><td> 476</td><td> 7526</td><td> 7541</td><td>GAGGAGTGCCTGTAAG</td><td> 103</td><td> 552</td>

107

107

One hundred and seven

<td> 1062137</td><td> 600</td><td> 615</td><td> 7763</td><td> 7778</td><td>GGGAGAAGACCCCAGT</td><td> 107</td><td> 553</td>

<td> 1062169</td><td> 771</td><td> 786</td><td> 8417</td><td> 8432</td><td>TGCAGACACCATTTGC</td><td> 159</td><td> 554</td>

<td> 1062201</td><td> 895</td><td> 910</td><td> 9485</td><td> 9500</td><td>GACTGTACCATTCTCTC</td><td> 126</td><td> 555</td>

<td> 1062233</td><td> 1098</td><td> 1113</td><td> 11254</td><td> 11269</td><td>GGACAGCAAACAGGCT</td><td> 122</td><td> 556</td>

<td> 1062265</td><td> 1186</td><td> 1201</td><td> 12056</td><td> 12071</td><td>GGTCGCATGTTGTGGA</td><td> 1*</td><td> 557</td>

<td> 1062297</td><td> 1433</td><td> 1448</td><td> 13843</td><td> 13858</td><td>CCTCTGGCTCCGTTTC</td><td> 110</td><td> 558</td>

<td> 1062329</td><td> 1596</td><td> 1611</td><td> 14006</td><td> 14021</td><td>AGACAGTGGAAACCTC</td><td> 117</td><td> 559</td>

<td> 1062361</td><td> 1856</td><td> 1871</td><td> 14266</td><td> 14281</td><td>GAGTGAGGGACAGGAT</td><td> 95</td><td> 560</td>

<td> 1062393</td><td> 2041</td><td> 2056</td><td> 14451</td><td> 14466</td><td>TGTGTAGGCCTCTGGG</td><td> 32</td><td> 561</td>

<td> 1062425</td><td> 2215</td><td> 2230</td><td> 14625</td><td> 14640</td><td>GTA III IIGGCAAGGC</td><td> 14</td><td> 562</td>

<td> 1062457</td><td>N/A</td><td>N/A</td><td> 8304</td><td> 8319</td><td>CTGTCCACTGACCTGT</td><td> 160</td><td> 563</td>

<td> 1062489</td><td>N/A</td><td>N/A</td><td> 13609</td><td> 13624</td><td>ACTTTGAGCTGCGATG</td><td> 63</td><td> 564</td>

<td> 1062521</td><td>N/A</td><td>N/A</td><td> 554</td><td> 569</td><td>CACCTTGGTGAAGTGG</td><td> 144</td><td> 565</td>

<td> 1062553</td><td>N/A</td><td>N/A</td><td> 688</td><td> 703</td><td>ACCTTACCTGGCTGGA</td><td> 141</td><td> 566</td>

<td> 1062585</td><td>N/A</td><td>N/A</td><td> 880</td><td> 895</td><td>TCAGTTGCACCTGGAC</td><td> 118</td><td> 567</td>

<td> 1062617</td><td>N/A</td><td>N/A</td><td> 1112</td><td> 1127</td><td>AGGAGATCGATGGAGT</td><td> 100</td><td> 568</td>

<td> 1062649</td><td>N/A</td><td>N/A</td><td> 1260</td><td> 1275</td><td>AGAACTGATGCTCACT</td><td> 82</td><td> 569</td>

<td> 1062682</td><td>N/A</td><td>N/A</td><td> 1341</td><td> 1356</td><td>CTCTAAAGCGATACAA</td><td> 125</td><td> 570</td>

<td> 1062714</td><td>N/A</td><td>N/A</td><td> 1491</td><td> 1506</td><td>GAATCGAGCTCACCCC</td><td> 112</td><td> 571</td>

<td> 1062746</td><td>N/A</td><td>N/A</td><td> 1727</td><td> 1742</td><td>AACAATCGGCACTTGG</td><td> 56</td><td> 572</td>

<td> 1062778</td><td>N/A</td><td>N/A</td><td> 1887</td><td> 1902</td><td>GGAGCATAAAATAGGA</td><td> 97</td><td> 573</td>

<td> 1062810</td><td>N/A</td><td>N/A</td><td> 2078</td><td> 2093</td><td>CACCCTATTAGGAGTA</td><td> 95</td><td> 574</td>

<td> 1062842</td><td>N/A</td><td>N/A</td><td> 2235</td><td> 2250</td><td>CCATCATAAGCATCAC</td><td> 76</td><td> 575</td>

<td> 1062874</td><td>N/A</td><td>N/A</td><td> 2397</td><td> 2412</td><td>TCTTAACCTCTATAGT</td><td> 105</td><td> 576</td>

<td> 1062906</td><td>N/A</td><td>N/A</td><td> 2618</td><td> 2633</td><td>CTGATCTTGGGTTTAT</td><td> 63</td><td> 577</td>

<td> 1062938</td><td>N/A</td><td>N/A</td><td> 2736</td><td> 2751</td><td>GAGTGAATAGTCAGTC</td><td> 21</td><td> 578</td>

<td> 1062970</td><td>N/A</td><td>N/A</td><td> 2920</td><td> 2935</td><td>GCAAAACAGTGTGGCC</td><td> 112</td><td> 579</td>

<td> 1063002</td><td>N/A</td><td>N/A</td><td> 3125</td><td> 3140</td><td>GATAGTGAGAGACATT</td><td> 73</td><td> 580</td>

<td> 1063034</td><td>N/A</td><td>N/A</td><td> 3249</td><td> 3264</td><td>AAGTCATTAGGTGTCT</td><td> 77</td><td> 581</td>

<td> 1063066</td><td>N/A</td><td>N/A</td><td> 3393</td><td> 3408</td><td>TCCTGAGATCTAGGCT</td><td> 101</td><td> 582</td>

<td> 1063098</td><td>N/A</td><td>N/A</td><td> 3666</td><td> 3681</td><td>CCTGACTGACTGACAT</td><td> 148</td><td> 583</td>

<td> 1063130</td><td>N/A</td><td>N/A</td><td> 3886</td><td> 3901</td><td>CTGTCCACTCTGGAAC</td><td> 121</td><td> 584</td>

<td> 1063162</td><td>N/A</td><td>N/A</td><td> 4124</td><td> 4139</td><td>AGTATAACCACCAGGAC</td><td> 54</td><td> 585</td>

<td> 1063194</td><td>N/A</td><td>N/A</td><td> 4243</td><td> 4258</td><td>TGACAAGCCCCTAGCT</td><td> 121</td><td> 586</td>

<td> 1063226</td><td>N/A</td><td>N/A</td><td> 4418</td><td> 4433</td><td>ATGGCGGCCGGATGCG</td><td> 103</td><td> 587</td>

<td> 1063257</td><td>N/A</td><td>N/A</td><td> 4586</td><td> 4601</td><td>CAGCCGGCTTCCTGCA</td><td> 124</td><td> 588</td>

<td> 1063289</td><td>N/A</td><td>N/A</td><td> 4719</td><td> 4734</td><td>CACTTGGCCAGAGCTA</td><td> 88</td><td> 589</td>

<td> 1063321</td><td>N/A</td><td>N/A</td><td> 5095</td><td> 5110</td><td>GCTCCGAACAAGGGCC</td><td> 177</td><td> 590</td>

<td> 1063353</td><td>N/A</td><td>N/A</td><td> 5314</td><td> 5329</td><td>ACTGAGTTGGGCACAC</td><td> 62</td><td> 591</td>

<td> 1063385</td><td>N/A</td><td>N/A</td><td> 5522</td><td> 5537</td><td>ATCCTGGTCTGAGAGG</td><td> 138</td><td> 592</td>

<td> 1063417</td><td>N/A</td><td>N/A</td><td> 5727</td><td> 5742</td><td>CCAATTTCTGGCCCTC</td><td> 115</td><td> 593</td>

<td> 1063449</td><td>N/A</td><td>N/A</td><td> 5859</td><td> 5874</td><td>GGCAAGGAGGCGAGTC</td><td> 65</td><td> 594</td>

<td> 1063481</td><td>N/A</td><td>N/A</td><td> 6016</td><td> 6031</td><td>CTGGAAGGACCGAGCT</td><td> 75</td><td> 595</td>

<td> 1063513</td><td>N/A</td><td>N/A</td><td> 6140</td><td> 6155</td><td>GGAGAAGGCGAGAAGT</td><td> 95</td><td> 596</td>

<td> 1063545</td><td>N/A</td><td>N/A</td><td> 6303</td><td> 6318</td><td>GCCGGAGCTGGTCTCG</td><td> 108</td><td> 597</td>

<td> 1063577</td><td>N/A</td><td>N/A</td><td> 6563</td><td> 6578</td><td>CCATAGTTGCACCCCA</td><td> 135</td><td> 598</td>

<td> 1063609</td><td>N/A</td><td>N/A</td><td> 6985</td><td> 7000</td><td>AGGTCGGCACCTGTAG</td><td> 126</td><td> 599</td>

<td> 1063641</td><td>N/A</td><td>N/A</td><td> 7176</td><td> 7191</td><td>GGACTACAATACGGCC</td><td> 118</td><td> 600</td>

108

108

One hundred and eight-

<td> 1063673</td><td>N/A</td><td>N/A</td><td> 7387</td><td> 7402</td><td>AAATACTCTGCACTGC</td><td> 105</td><td> 601</td>

<td> 1063705</td><td>N/A</td><td>N/A</td><td> 7868</td><td> 7883</td><td>TAGCCTACACTGCTCA</td><td> 118</td><td> 602</td>

<td> 1063737</td><td>N/A</td><td>N/A</td><td> 8006</td><td> 8021</td><td>AGCTTTGTAAAGCTCT</td><td> 117</td><td> 603</td>

<td> 1063769</td><td>N/A</td><td>N/A</td><td> 8049</td><td> 8064</td><td>AGAAGCTTAAAGACGG</td><td> 11</td><td> 604</td>

<td> 1063800</td><td>N/A</td><td>N/A</td><td> 8564</td><td> 8579</td><td>TTACTACTTATTGGGA</td><td> 103</td><td> 605</td>

<td> 1063832</td><td>N/A</td><td>N/A</td><td> 8854</td><td> 8869</td><td>TGAGGAGTAGCAGGGC</td><td> 72</td><td> 606</td>

<td> 1063864</td><td>N/A</td><td>N/A</td><td> 9055</td><td> 9070</td><td>CTGCTAAGGGTTGTGT</td><td> 104</td><td> 607</td>

<td> 1063896</td><td>N/A</td><td>N/A</td><td> 9503</td><td> 9518</td><td>ATTACCTGCTGCTCCA</td><td> 142</td><td> 608</td>

<td> 1063928</td><td>N/A</td><td>N/A</td><td> 9688</td><td> 9703</td><td>AACATGAGGCCTCAGC</td><td> 80</td><td> 609</td>

<td> 1063960</td><td>N/A</td><td>N/A</td><td> 10283</td><td> 10298</td><td>TCTTAGAGTCAGAGGG</td><td> 45</td><td> 610</td>

<td> 1063992</td><td>N/A</td><td>N/A</td><td> 10545</td><td> 10560</td><td>ACATTCGCATCATGAG</td><td> 57</td><td> 611</td>

<td> 1064024</td><td>N/A</td><td>N/A</td><td> 11116</td><td> 11131</td><td>GAGGCTTAAACTTCCC</td><td> 104</td><td> 612</td>

<td> 1064056</td><td>N/A</td><td>N/A</td><td> 11386</td><td> 11401</td><td>GGGCAGCATGGAGCTC</td><td> 157</td><td> 613</td>

<td> 1064088</td><td>N/A</td><td>N/A</td><td> 11560</td><td> 11575</td><td>AGAGTGGGTGAGGCAT</td><td> 133</td><td> 614</td>

<td> 1064122</td><td>N/A</td><td>N/A</td><td> 11654</td><td> 11669</td><td>CGA lili CCTTGGTCA</td><td> 42</td><td> 615</td>

<td> 1064154</td><td>N/A</td><td>N/A</td><td> 11729</td><td> 11744</td><td>TCTCTGATCCCTGCTA</td><td> 71</td><td> 616</td>

<td> 1064186</td><td>N/A</td><td>N/A</td><td> 11811</td><td> 11826</td><td>CCCGAGGTTGAAAAGA</td><td> 118</td><td> 617</td>

<td> 1064218</td><td>N/A</td><td>N/A</td><td> 11920</td><td> 11935</td><td>GAGATTCTCACCGTCAA</td><td> 71</td><td> 618</td>

<td> 1064250</td><td>N/A</td><td>N/A</td><td> 11987</td><td> 12002</td><td>AAGCCCCATGCAGGAC</td><td> 154</td><td> 619</td>

<td> 1064282</td><td>N/A</td><td>N/A</td><td> 12240</td><td> 12255</td><td>CATTTGAGGCACGGCT</td><td> 140</td><td> 620</td>

<td> 1064314</td><td>N/A</td><td>N/A</td><td> 12399</td><td> 12414</td><td>AGGCTAT í í lAlGGGT</td><td> 102</td><td> 621</td>

<td> 1064346</td><td>N/A</td><td>N/A</td><td> 12585</td><td> 12600</td><td>GTTAAGGATCAAATGG</td><td> 117</td><td> 622</td>

<td> 1064378</td><td>N/A</td><td>N/A</td><td> 12787</td><td> 12802</td><td>TTACAGAGTCAGCGAT</td><td> 125</td><td> 623</td>

<td> 1064410</td><td>N/A</td><td>N/A</td><td> 12936</td><td> 12951</td><td>CAGAGATGGTTTGAAT</td><td> 67</td><td> 624</td>

<td> 1064442</td><td>N/A</td><td>N/A</td><td> 13222</td><td> 13237</td><td>TAGGTAAGGGATCAGG</td><td> 79</td><td> 625</td>

TABLE 13

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 40</td><td> 250</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 28</td><td> 65</td>

<td> 1062010</td><td> 6</td><td> 21</td><td> 406</td><td> 421</td><td>lllllllCGATGAGTG</td><td> 22</td><td> 627</td>

<td> 1062042</td><td> 145</td><td> 160</td><td> 545</td><td> 560</td><td>GAAGTGGACTGACAGA</td><td> 58</td><td> 628</td>

<td> 1062074</td><td> 316</td><td> 331</td><td> 6854</td><td> 6869</td><td>CGGCCCTGGAAGGTTC</td><td> 149</td><td> 629</td>

<td> 1062106</td><td> 462</td><td> 477</td><td> 7527</td><td> 7542</td><td>GGAGGAGTGCCTGTAA</td><td> 89</td><td> 630</td>

<td> 1062138</td><td> 614</td><td> 629</td><td> 7777</td><td> 7792</td><td>AGGCCGGGCCTTGAGG</td><td> 138</td><td> 631</td>

<td> 1062170</td><td> 793</td><td> 808</td><td> 8439</td><td> 8454</td><td>ACCTTCTCACATCCGG</td><td> 61</td><td> 632</td>

<td> 1062202</td><td> 896</td><td> 911</td><td> 9486</td><td> 9501</td><td>AGACTGTACCATCTCT</td><td> 135</td><td> 633</td>

<td> 1062234</td><td> 1100</td><td> 1115</td><td> 11256</td><td> 11271</td><td>CCGGACAGCAAACAGG</td><td> 105</td><td> 634</td>

<td> 1062266</td><td> 1248</td><td> 1263</td><td> 13478</td><td> 13493</td><td>TCCGCTGCTTCTCTGG</td><td> 7*</td><td> 635</td>

<td> 1062298</td><td> 1449</td><td> 1464</td><td> 13859</td><td> 13874</td><td>TGGAACACCTGCTGGG</td><td> 231</td><td> 636</td>

<td> 1062330</td><td> 1599</td><td> 1614</td><td> 14009</td><td> 14024</td><td>GCAAGACAGTGGAAAC</td><td> 88</td><td> 637</td>

<td> 1062362</td><td> 1887</td><td> 1902</td><td> 14297</td><td> 14312</td><td>GGCAGGCTCTCTGTGT</td><td> 84</td><td> 638</td>

<td> 1062394</td><td> 2042</td><td> 2057</td><td> 14452</td><td> 14467</td><td>CTGTGTAGGCCTCTGG</td><td> 50</td><td> 639</td>

<td> 1062426</td><td> 2245</td><td> 2260</td><td> 14655</td><td> 14670</td><td>GAGTGAGGTGAGTGGC</td><td> 43</td><td> 640</td>

109

109

Hundred nine

<td> 1062458</td><td>N/A</td><td>N/A</td><td> 8321</td><td> 8336</td><td>GAGGATCCTTCCCAGC</td><td> 156</td><td> 641</td>

<td> 1062490</td><td>N/A</td><td>N/A</td><td> 13610</td><td> 13625</td><td>CACTTTGAGCTGCGAT</td><td> 185</td><td> 642</td>

<td> 1062522</td><td>N/A</td><td>N/A</td><td> 555</td><td> 570</td><td>TCACCTTGGTGAAGTG</td><td> 137</td><td> 643</td>

<td> 1062554</td><td>N/A</td><td>N/A</td><td> 689</td><td> 704</td><td>GACCTTACCTGGCTGG</td><td> 105</td><td> 644</td>

<td> 1062586</td><td>N/A</td><td>N/A</td><td> 884</td><td> 899</td><td>AllllCAGTTGCACCT</td><td> 123</td><td> 645</td>

<td> 1062618</td><td>N/A</td><td>N/A</td><td> 1113</td><td> 1128</td><td>AAGGAGATCGATGGAG</td><td> 140</td><td> 646</td>

<td> 1062650</td><td>N/A</td><td>N/A</td><td> 1261</td><td> 1276</td><td>CAGAACTGATGCTCAC</td><td> 53</td><td> 647</td>

<td> 1062683</td><td>N/A</td><td>N/A</td><td> 1342</td><td> 1357</td><td>CCTCTAAAGCGATACA</td><td> 70</td><td> 648</td>

<td> 1062715</td><td>N/A</td><td>N/A</td><td> 1492</td><td> 1507</td><td>AGAATCGAGCTCACCC</td><td> 67</td><td> 649</td>

<td> 1062747</td><td>N/A</td><td>N/A</td><td> 1728</td><td> 1743</td><td>CAACAATCGGCACTTG</td><td> 117</td><td> 650</td>

<td> 1062779</td><td>N/A</td><td>N/A</td><td> 1889</td><td> 1904</td><td>AGGGAGCATAAAATAG</td><td> 135</td><td> 651</td>

<td> 1062811</td><td>N/A</td><td>N/A</td><td> 2079</td><td> 2094</td><td>ACCCCTATTAGGAGT</td><td> 101</td><td> 652</td>

<td> 1062843</td><td>N/A</td><td>N/A</td><td> 2237</td><td> 2252</td><td>AACCATCATAAGCATC</td><td> 78</td><td> 653</td>

<td> 1062875</td><td>N/A</td><td>N/A</td><td> 2398</td><td> 2413</td><td>CTCTTAACCTCTATAG</td><td> 133</td><td> 654</td>

<td> 1062907</td><td>N/A</td><td>N/A</td><td> 2619</td><td> 2634</td><td>GCTGATCTTGGGTTTA</td><td> 38</td><td> 655</td>

<td> 1062939</td><td>N/A</td><td>N/A</td><td> 2737</td><td> 2752</td><td>TGAGTGAATAGTCAGT</td><td> 59</td><td> 656</td>

<td> 1062971</td><td>N/A</td><td>N/A</td><td> 2940</td><td> 2955</td><td>GTATTGCAAAGCAACA</td><td> 217</td><td> 657</td>

<td> 1063003</td><td>N/A</td><td>N/A</td><td> 3133</td><td> 3148</td><td>GAACAAGAGATAGTGA</td><td> 118</td><td> 658</td>

<td> 1063035</td><td>N/A</td><td>N/A</td><td> 3251</td><td> 3266</td><td>TTAAGTCATTAGGTGT</td><td> 56</td><td> 659</td>

<td> 1063067</td><td>N/A</td><td>N/A</td><td> 3395</td><td> 3410</td><td>AGTCCTGAGATCTAGG</td><td> 55</td><td> 660</td>

<td> 1063099</td><td>N/A</td><td>N/A</td><td> 3668</td><td> 3683</td><td>AGCCTGACTGACTGAC</td><td> 52</td><td> 661</td>

<td> 1063131</td><td>N/A</td><td>N/A</td><td> 3905</td><td> 3920</td><td>CCCTAGGGCCTCAGTC</td><td> 144</td><td> 662</td>

<td> 1063163</td><td>N/A</td><td>N/A</td><td> 4125</td><td> 4140</td><td>TAGTATAACACCAGGA</td><td> 44</td><td> 663</td>

<td> 1063195</td><td>N/A</td><td>N/A</td><td> 4245</td><td> 4260</td><td>TATGACAAGCCCCTAG</td><td> 156</td><td> 664</td>

<td> 1063227</td><td>N/A</td><td>N/A</td><td> 4421</td><td> 4436</td><td>GTCATGGCGGCCGGAT</td><td> 121</td><td> 665</td>

<td> 1063258</td><td>N/A</td><td>N/A</td><td> 4589</td><td> 4604</td><td>GGGCAGCCGGCTTCCT</td><td> 209</td><td> 666</td>

<td> 1063290</td><td>N/A</td><td>N/A</td><td> 4720</td><td> 4735</td><td>ACACTTGGCCAGAGCT</td><td> 102</td><td> 667</td>

<td> 1063322</td><td>N/A</td><td>N/A</td><td> 5117</td><td> 5132</td><td>ACAGGAGTGTGGGTCT</td><td> 164</td><td> 668</td>

<td> 1063354</td><td>N/A</td><td>N/A</td><td> 5318</td><td> 5333</td><td>CAGCACTGAGTTGGGC</td><td> 106</td><td> 669</td>

<td> 1063386</td><td>N/A</td><td>N/A</td><td> 5524</td><td> 5539</td><td>TAATCCTGGTCTGAGA</td><td> 113</td><td> 670</td>

<td> 1063418</td><td>N/A</td><td>N/A</td><td> 5728</td><td> 5743</td><td>CCCAATTTCTGGCCCT</td><td> 95</td><td> 671</td>

<td> 1063450</td><td>N/A</td><td>N/A</td><td> 5860</td><td> 5875</td><td>GGGCAAGGAGGCGAGT</td><td> 76</td><td> 672</td>

<td> 1063482</td><td>N/A</td><td>N/A</td><td> 6017</td><td> 6032</td><td>GCTGGAAGGACCGAGC</td><td> 199</td><td> 673</td>

<td> 1063514</td><td>N/A</td><td>N/A</td><td> 6158</td><td> 6173</td><td>GAATGGGCTGGTGGCA</td><td> 103</td><td> 674</td>

<td> 1063546</td><td>N/A</td><td>N/A</td><td> 6363</td><td> 6378</td><td>TTTCAAGCCTCAGGCC</td><td> 169</td><td> 675</td>

<td> 1063578</td><td>N/A</td><td>N/A</td><td> 6565</td><td> 6580</td><td>CCCCATAGTTGCACCC</td><td> 48</td><td> 676</td>

<td> 1063610</td><td>N/A</td><td>N/A</td><td> 6986</td><td> 7001</td><td>AAGGTCGGCACCTGTA</td><td> 162</td><td> 677</td>

<td> 1063642</td><td>N/A</td><td>N/A</td><td> 7195</td><td> 7210</td><td>ACACATAGCTATGCTC</td><td> 125</td><td> 678</td>

<td> 1063674</td><td>N/A</td><td>N/A</td><td> 7388</td><td> 7403</td><td>CAAATACTCTGCACTG</td><td> 104</td><td> 679</td>

<td> 1063706</td><td>N/A</td><td>N/A</td><td> 7869</td><td> 7884</td><td>ATAGCCTACACTGCTC</td><td> 219</td><td> 680</td>

<td> 1063738</td><td>N/A</td><td>N/A</td><td> 8009</td><td> 8024</td><td>ACTAGCTTTGTAAAGC</td><td> 150</td><td> 681</td>

<td> 1063770</td><td>N/A</td><td>N/A</td><td> 8056</td><td> 8071</td><td>CTGGCAGAGAAGCTTA</td><td> 207</td><td> 682</td>

<td> 1063801</td><td>N/A</td><td>N/A</td><td> 8566</td><td> 8581</td><td>TCTTACTACTTATTGG</td><td> 88</td><td> 683</td>

<td> 1063833</td><td>N/A</td><td>N/A</td><td> 8856</td><td> 8871</td><td>CATGAGGAGTAGCAGG</td><td> 291</td><td> 684</td>

<td> 1063865</td><td>N/A</td><td>N/A</td><td> 9056</td><td> 9071</td><td>GCTGCTAAGGGTTGTG</td><td> 176</td><td> 685</td>

<td> 1063897</td><td>N/A</td><td>N/A</td><td> 9504</td><td> 9519</td><td>CATTACCTGCTGCTCC</td><td> 120</td><td> 686</td>

<td> 1063929</td><td>N/A</td><td>N/A</td><td> 9689</td><td> 9704</td><td>AAACATGAGGCCTCAG</td><td> 214</td><td> 687</td>

<td> 1063961</td><td>N/A</td><td>N/A</td><td> 10285</td><td> 10300</td><td>GATCTTAGAGTCAGAG</td><td> 111</td><td> 688</td>

110

110

Hundred ten

<td> 1063993</td><td>N/A</td><td>N/A</td><td> 10547</td><td> 10562</td><td>GTACATTCGCATCATG</td><td> 80</td><td> 689</td>

<td> 1064025</td><td>N/A</td><td>N/A</td><td> 11117</td><td> 11132</td><td>AGAGGCTTAAACTTCC</td><td> 131</td><td> 690</td>

<td> 1064057</td><td>N/A</td><td>N/A</td><td> 11445</td><td> 11460</td><td>CGGATGCA Illi CCCA</td><td> 250</td><td> 691</td>

<td> 1064089</td><td>N/A</td><td>N/A</td><td> 11564</td><td> 11579</td><td>GTCCAGAGTGGGTGAG</td><td> 78</td><td> 692</td>

<td> 1064123</td><td>N/A</td><td>N/A</td><td> 11655</td><td> 11670</td><td>CCGA MM CCTTGGTC</td><td> 111</td><td> 693</td>

<td> 1064155</td><td>N/A</td><td>N/A</td><td> 11735</td><td> 11750</td><td>TCAAGGTCTCTGATCC</td><td> 96</td><td> 694</td>

<td> 1064187</td><td>N/A</td><td>N/A</td><td> 11813</td><td> 11828</td><td>TCCCCGAGGTTGAAAA</td><td> 173</td><td> 695</td>

<td> 1064219</td><td>N/A</td><td>N/A</td><td> 11922</td><td> 11937</td><td>CTGAGATTCCACCGTC</td><td> 121</td><td> 696</td>

<td> 1064251</td><td>N/A</td><td>N/A</td><td> 11990</td><td> 12005</td><td>ATCAAGCCCCATGCAG</td><td> 144</td><td> 697</td>

<td> 1064283</td><td>N/A</td><td>N/A</td><td> 12241</td><td> 12256</td><td>ACATTTGAGGCACGGC</td><td> 86</td><td> 698</td>

<td> 1064315</td><td>N/A</td><td>N/A</td><td> 12430</td><td> 12445</td><td>TAGGGCAAGGTGCAGA</td><td> 86</td><td> 699</td>

<td> 1064347</td><td>N/A</td><td>N/A</td><td> 12586</td><td> 12601</td><td>AGTTAAGGATCAAATG</td><td> 172</td><td> 700</td>

<td> 1064379</td><td>N/A</td><td>N/A</td><td> 12788</td><td> 12803</td><td>ATTACAGAGTCAGCGA</td><td> 105</td><td> 701</td>

<td> 1064411</td><td>N/A</td><td>N/A</td><td> 12937</td><td> 12952</td><td>CCAGAGATGGTTTGAA</td><td> 186</td><td> 702</td>

<td> 1064443</td><td>N/A</td><td>N/A</td><td> 13223</td><td> 13238</td><td>TTAAGGTAAGGGATCAG</td><td> 113</td><td> 703</td>

TABLE 14

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 895475</td><td>N/A</td><td>N/A</td><td> 4422</td><td> 4437</td><td>CGTCATGGCGGCCGGA</td><td> 96</td><td> 704</td>

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 27</td><td> 250</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 42</td><td> 65</td>

<td> 1062011</td><td> 8</td><td> 23</td><td> 408</td><td> 423</td><td>AAMMMICGA T GAG</td><td> 80</td><td> 705</td>

<td> 1062043</td><td> 146</td><td> 161</td><td> 546</td><td> 561</td><td>TGAAGTGGACTGACAG</td><td> 83</td><td> 706</td>

<td> 1062075</td><td> 318</td><td> 333</td><td> 6856</td><td> 6871</td><td>CTCGGCCCTGGAAGGT</td><td> 106</td><td> 707</td>

<td> 1062107</td><td> 463</td><td> 478</td><td> 7528</td><td> 7543</td><td>TGGAGGAGTGCCTGTA</td><td> 64</td><td> 708</td>

<td> 1062139</td><td> 615</td><td> 630</td><td> 7778</td><td> 7793</td><td>CAGGCCGGGCCTTGAG</td><td> 95</td><td> 709</td>

<td> 1062171</td><td> 796</td><td> 811</td><td> 8442</td><td> 8457</td><td>AAGACCTCTCACATC</td><td> 80</td><td> 710</td>

<td> 1062203</td><td> 897</td><td> 912</td><td> 9487</td><td> 9502</td><td>GAGACTGTACCATTCTC</td><td> 145</td><td> 711</td>

<td> 1062235</td><td> 1101</td><td> 1116</td><td> 11257</td><td> 11272</td><td>TCCGGACAGCAAACAG</td><td> 120</td><td> 712</td>

<td> 1062267</td><td> 1251</td><td> 1266</td><td> 13481</td><td> 13496</td><td>GTGTCCGCTGCTTCTC</td><td> 3*</td><td> 713</td>

<td> 1062299</td><td> 1450</td><td> 1465</td><td> 13860</td><td> 13875</td><td>TTGGAACACCTGCTGG</td><td> 48</td><td> 714</td>

<td> 1062331</td><td> 1738</td><td> 1753</td><td> 14148</td><td> 14163</td><td>TGCAGGGCTCGACTGG</td><td> 42</td><td> 715</td>

<td> 1062363</td><td> 1894</td><td> 1909</td><td> 14304</td><td> 14319</td><td>GTACTGAGGCAGGCTC</td><td> 57</td><td> 716</td>

<td> 1062395</td><td> 2043</td><td> 2058</td><td> 14453</td><td> 14468</td><td>TCTGTGTAGGCCTCTG</td><td> 11</td><td> 717</td>

<td> 1062427</td><td> 2268</td><td> 2283</td><td>N/A</td><td>N/A</td><td>ATGGATCAGGGCTCAG</td><td> 28</td><td> 718</td>

<td> 1062459</td><td>N/A</td><td>N/A</td><td> 8322</td><td> 8337</td><td>CGAGGATCCTTCCCAG</td><td> 144</td><td> 719</td>

<td> 1062491</td><td>N/A</td><td>N/A</td><td> 13611</td><td> 13626</td><td>CCACTTTGAGCTGCGA</td><td> 98</td><td> 720</td>

<td> 1062523</td><td>N/A</td><td>N/A</td><td> 556</td><td> 571</td><td>CTCACCTTGGTGAAGT</td><td> 131</td><td> 721</td>

<td> 1062555</td><td>N/A</td><td>N/A</td><td> 690</td><td> 705</td><td>AGACCTTACCTGGCTG</td><td> 108</td><td> 722</td>

<td> 1062587</td><td>N/A</td><td>N/A</td><td> 885</td><td> 900</td><td>AAIIIICAGTTGCACC</td><td> 96</td><td> 723</td>

<td> 1062619</td><td>N/A</td><td>N/A</td><td> 1114</td><td> 1129</td><td>AAAGGAGATCGATGGA</td><td> 80</td><td> 724</td>

<td> 1062651</td><td>N/A</td><td>N/A</td><td> 1263</td><td> 1278</td><td>AACAGAACTGATGCTC</td><td> 77</td><td> 725</td>

<td> 1062684</td><td>N/A</td><td>N/A</td><td> 1343</td><td> 1358</td><td>TCCTCTAAAGCGATAC</td><td> 99</td><td> 726</td>

<td> 1062716</td><td>N/A</td><td>N/A</td><td> 1493</td><td> 1508</td><td>CAGAATCGAGCTCACC</td><td> 58</td><td> 727</td>

111

111

Hundred eleven

<td> 1062748</td><td>N/A</td><td>N/A</td><td> 1730</td><td> 1745</td><td>TCCAACAATCGGCACT</td><td> 78</td><td> 728</td>

<td> 1062780</td><td>N/A</td><td>N/A</td><td> 1894</td><td> 1909</td><td>AGTAGAGGGAGCATAA</td><td> 100</td><td> 729</td>

<td> 1062812</td><td>N/A</td><td>N/A</td><td> 2080</td><td> 2095</td><td>AACACCCTATTAGGAG</td><td> 77</td><td> 730</td>

<td> 1062844</td><td>N/A</td><td>N/A</td><td> 2253</td><td> 2268</td><td>CTATTTGACTGTATAA</td><td> 134</td><td> 731</td>

<td> 1062876</td><td>N/A</td><td>N/A</td><td> 2407</td><td> 2422</td><td>GTACCCACACTCTTAA</td><td> 100</td><td> 732</td>

<td> 1062908</td><td>N/A</td><td>N/A</td><td> 2623</td><td> 2638</td><td>TAATGCTGATCTTGGG</td><td> 36</td><td> 733</td>

<td> 1062940</td><td>N/A</td><td>N/A</td><td> 2739</td><td> 2754</td><td>ATTGAGTGAATAGTCA</td><td> 69</td><td> 734</td>

<td> 1062972</td><td>N/A</td><td>N/A</td><td> 2943</td><td> 2958</td><td>ATTGTATTGCAAAGCA</td><td> 62</td><td> 735</td>

<td> 1063004</td><td>N/A</td><td>N/A</td><td> 3144</td><td> 3159</td><td>CGAGCAAGAGAGAACA</td><td> 126</td><td> 736</td>

<td> 1063036</td><td>N/A</td><td>N/A</td><td> 3252</td><td> 3267</td><td>GTTAAGTCATTAGGTG</td><td> 27</td><td> 737</td>

<td> 1063068</td><td>N/A</td><td>N/A</td><td> 3396</td><td> 3411</td><td>GAGTCCTGAGATCTAG</td><td> 62</td><td> 738</td>

<td> 1063100</td><td>N/A</td><td>N/A</td><td> 3710</td><td> 3725</td><td>AATCAAGG Illi CGGG</td><td> 69</td><td> 739</td>

<td> 1063132</td><td>N/A</td><td>N/A</td><td> 3906</td><td> 3921</td><td>TCCCTAGGGCCTCAGT</td><td> 81</td><td> 740</td>

<td> 1063164</td><td>N/A</td><td>N/A</td><td> 4126</td><td> 4141</td><td>ATAGTATAACACCAGG</td><td> 31</td><td> 741</td>

<td> 1063196</td><td>N/A</td><td>N/A</td><td> 4246</td><td> 4261</td><td>CTATGACAAGCCCCTA</td><td> 96</td><td> 742</td>

<td> 1063259</td><td>N/A</td><td>N/A</td><td> 4591</td><td> 4606</td><td>CTGGGCAGCCGGCTTC</td><td> 104</td><td> 743</td>

<td> 1063291</td><td>N/A</td><td>N/A</td><td> 4721</td><td> 4736</td><td>GACACTTGGCCAGAGC</td><td> 100</td><td> 744</td>

<td> 1063323</td><td>N/A</td><td>N/A</td><td> 5118</td><td> 5133</td><td>AACAGGAGTGTGGGTC</td><td> 61</td><td> 745</td>

<td> 1063355</td><td>N/A</td><td>N/A</td><td> 5321</td><td> 5336</td><td>TCACAGCACTGAGTTG</td><td> 82</td><td> 746</td>

<td> 1063387</td><td>N/A</td><td>N/A</td><td> 5526</td><td> 5541</td><td>TATAATCCTGGTCTGA</td><td> 100</td><td> 747</td>

<td> 1063419</td><td>N/A</td><td>N/A</td><td> 5729</td><td> 5744</td><td>CCCCAATTTCTGGCCC</td><td> 54</td><td> 748</td>

<td> 1063451</td><td>N/A</td><td>N/A</td><td> 5862</td><td> 5877</td><td>CAGGGCAAGGAGGCGA</td><td> 77</td><td> 749</td>

<td> 1063483</td><td>N/A</td><td>N/A</td><td> 6018</td><td> 6033</td><td>AGCTGGAAGGACCGAG</td><td> 79</td><td> 750</td>

<td> 1063515</td><td>N/A</td><td>N/A</td><td> 6161</td><td> 6176</td><td>ACAGAATGGGCTGGTG</td><td> 118</td><td> 751</td>

<td> 1063547</td><td>N/A</td><td>N/A</td><td> 6367</td><td> 6382</td><td>GCTGTTTCAAGCCTCA</td><td> 67</td><td> 752</td>

<td> 1063579</td><td>N/A</td><td>N/A</td><td> 6582</td><td> 6597</td><td>GGACATGTCCCGAGGG</td><td> 51</td><td> 753</td>

<td> 1063611</td><td>N/A</td><td>N/A</td><td> 6987</td><td> 7002</td><td>AAAGGTCGGCACCTGT</td><td> 190</td><td> 754</td>

<td> 1063643</td><td>N/A</td><td>N/A</td><td> 7196</td><td> 7211</td><td>GACACATAGCTATGCT</td><td> 116</td><td> 755</td>

<td> 1063675</td><td>N/A</td><td>N/A</td><td> 7390</td><td> 7405</td><td>TTCAAATACTCTGCAC</td><td> 107</td><td> 756</td>

<td> 1063707</td><td>N/A</td><td>N/A</td><td> 7870</td><td> 7885</td><td>AATAGCCTACACTGCT</td><td> 205</td><td> 757</td>

<td> 1063739</td><td>N/A</td><td>N/A</td><td> 8010</td><td> 8025</td><td>GACTAGCTTTGTAAAG</td><td> 94</td><td> 758</td>

<td> 1063771</td><td>N/A</td><td>N/A</td><td> 8106</td><td> 8121</td><td>CGAAAACCCTGACTCC</td><td> 147</td><td> 759</td>

<td> 1063802</td><td>N/A</td><td>N/A</td><td> 8567</td><td> 8582</td><td>ACTTTACTACTTATTG</td><td> 93</td><td> 760</td>

<td> 1063834</td><td>N/A</td><td>N/A</td><td> 8857</td><td> 8872</td><td>GCATGAGGAGTAGCAG</td><td> 85</td><td> 761</td>

<td> 1063866</td><td>N/A</td><td>N/A</td><td> 9098</td><td> 9113</td><td>GTGCAAAGGCCTGGCT</td><td> 167</td><td> 762</td>

<td> 1063898</td><td>N/A</td><td>N/A</td><td> 9507</td><td> 9522</td><td>TGGCATTACCTGCTGC</td><td> 128</td><td> 763</td>

<td> 1063930</td><td>N/A</td><td>N/A</td><td> 9690</td><td> 9705</td><td>CAAACATGAGGCCTCA</td><td> 127</td><td> 764</td>

<td> 1063962</td><td>N/A</td><td>N/A</td><td> 10301</td><td> 10316</td><td>GATCACAGTGTTTGGG</td><td> 30</td><td> 765</td>

<td> 1063994</td><td>N/A</td><td>N/A</td><td> 10578</td><td> 10593</td><td>TAAACCCCCCTGGCCT</td><td> 65</td><td> 766</td>

<td> 1064026</td><td>N/A</td><td>N/A</td><td> 11119</td><td> 11134</td><td>CCAGAGGCTTAAACTT</td><td> 120</td><td> 767</td>

<td> 1064058</td><td>N/A</td><td>N/A</td><td> 11448</td><td> 11463</td><td>GAGCGGATGCAIIIC</td><td> 69</td><td> 768</td>

<td> 1064090</td><td>N/A</td><td>N/A</td><td> 11573</td><td> 11588</td><td>GTAGCTGGAGTCCAGA</td><td> 61</td><td> 769</td>

<td> 1064124</td><td>N/A</td><td>N/A</td><td> 11656</td><td> 11671</td><td>CCCGAT IIICCIIGGI</td><td> 154</td><td> 770</td>

<td> 1064156</td><td>N/A</td><td>N/A</td><td> 11736</td><td> 11751</td><td>GTCAAGGTCTCTGATC</td><td> 100</td><td> 771</td>

<td> 1064188</td><td>N/A</td><td>N/A</td><td> 11821</td><td> 11836</td><td>AATAGTTCTCCCCGAG</td><td> 95</td><td> 772</td>

<td> 1064220</td><td>N/A</td><td>N/A</td><td> 11923</td><td> 11938</td><td>CCTGAGATTCCACCGT</td><td> 153</td><td> 773</td>

<td> 1064252</td><td>N/A</td><td>N/A</td><td> 11991</td><td> 12006</td><td>AATCAAGCCCCATGCA</td><td> 133</td><td> 774</td>

<td> 1064284</td><td>N/A</td><td>N/A</td><td> 12278</td><td> 12293</td><td>TGCGGACAGGTTTGGG</td><td> 30</td><td> 775</td>

112

112

One hundred twelve

<td> 1064316</td><td>N/A</td><td>N/A</td><td> 12432</td><td> 12447</td><td>TTTAGGGCAAGGTGCA</td><td> 85</td><td> 776</td>

<td> 1064348</td><td>N/A</td><td>N/A</td><td> 12587</td><td> 12602</td><td>AAGTTAAGGATCAAAT</td><td> 122</td><td> 777</td>

<td> 1064380</td><td>N/A</td><td>N/A</td><td> 12789</td><td> 12804</td><td>GATTACAGAGTCAGCG</td><td> 102</td><td> 778</td>

<td> 1064412</td><td>N/A</td><td>N/A</td><td> 12950</td><td> 12965</td><td>TTTAGGTCAGAAGCCA</td><td> 171</td><td> 779</td>

<td> 1064444</td><td>N/A</td><td>N/A</td><td> 13224</td><td> 13239</td><td>ATTAGGTAAGGGATCA</td><td> 122</td><td> 780</td>

TABLE 15

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 9</td><td> 65</td>

<td> 1062012</td><td> 10</td><td> 25</td><td> 410</td><td> 425</td><td>CAAAIlli IIICGA1 G</td><td> 65</td><td> 781</td>

<td> 1062044</td><td> 149</td><td> 164</td><td> 549</td><td> 564</td><td>TGGTGAAGTGGACTGA</td><td> 25</td><td> 782</td>

<td> 1062076</td><td> 319</td><td> 334</td><td> 6857</td><td> 6872</td><td>TCTCGGCCCTGGAAGG</td><td> 89</td><td> 783</td>

<td> 1062108</td><td> 464</td><td> 479</td><td> 7529</td><td> 7544</td><td>CTGGAGGAGTGCCTGT</td><td> 74</td><td> 784</td>

<td> 1062140</td><td> 633</td><td> 648</td><td>N/A</td><td>N/A</td><td>TGATCCCAGGTGGGAG</td><td> 92</td><td> 785</td>

<td> 1062172</td><td> 798</td><td> 813</td><td> 8444</td><td> 8459</td><td>CGAAGACCTTCTCACA</td><td> 106</td><td> 786</td>

<td> 1062204</td><td> 901</td><td> 916</td><td> 9491</td><td> 9506</td><td>TCCAGAGACTGTACCA</td><td> 76</td><td> 787</td>

<td> 1062236</td><td> 1102</td><td> 1117</td><td> 11258</td><td> 11273</td><td>CTCCGGACAGCAAACA</td><td> 92</td><td> 788</td>

<td> 1062268</td><td> 1253</td><td> 1268</td><td> 13483</td><td> 13498</td><td>GAGTGTCCGCTGCTTC</td><td> 5*</td><td> 789</td>

<td> 1062300</td><td> 1453</td><td> 1468</td><td> 13863</td><td> 13878</td><td>GGGTTGGAACACCTGC</td><td> 85</td><td> 790</td>

<td> 1062332</td><td> 1740</td><td> 1755</td><td> 14150</td><td> 14165</td><td>GCTGCAGGGCTCGACT</td><td> 60</td><td> 791</td>

<td> 1062364</td><td> 1895</td><td> 1910</td><td> 14305</td><td> 14320</td><td>TGTACTGAGGCAGGCT</td><td> 42</td><td> 792</td>

<td> 1062396</td><td> 2050</td><td> 2065</td><td> 14460</td><td> 14475</td><td>CGCTGCTTCTGTGTAG</td><td> 31</td><td> 793</td>

<td> 1062428</td><td> 2269</td><td> 2284</td><td>N/A</td><td>N/A</td><td>CATGGATCAGGGCTCA</td><td> 28</td><td> 794</td>

<td> 1062460</td><td>N/A</td><td>N/A</td><td> 8323</td><td> 8338</td><td>GCGAGGATCCTTCCCA</td><td> 73</td><td> 795</td>

<td> 1062492</td><td>N/A</td><td>N/A</td><td> 13612</td><td> 13627</td><td>CCCACTTTGAGCTGCG</td><td> 55</td><td> 796</td>

<td> 1062524</td><td>N/A</td><td>N/A</td><td> 557</td><td> 572</td><td>ACTCACCTTGGTGAAG</td><td> 112</td><td> 797</td>

<td> 1062556</td><td>N/A</td><td>N/A</td><td> 691</td><td> 706</td><td>AAGACCTTACCTGGCT</td><td> 72</td><td> 798</td>

<td> 1062588</td><td>N/A</td><td>N/A</td><td> 928</td><td> 943</td><td>CATCAAGAGCTAAGAG</td><td> 96</td><td> 799</td>

<td> 1062620</td><td>N/A</td><td>N/A</td><td> 1115</td><td> 1130</td><td>GAAAGGAGATCGATGG</td><td> 72</td><td> 800</td>

<td> 1062652</td><td>N/A</td><td>N/A</td><td> 1265</td><td> 1280</td><td>TGAACAGAACTGATGC</td><td> 36</td><td> 801</td>

<td> 1062685</td><td>N/A</td><td>N/A</td><td> 1350</td><td> 1365</td><td>AAGGGTCTCCTCTAAA</td><td> 62</td><td> 802</td>

<td> 1062717</td><td>N/A</td><td>N/A</td><td> 1494</td><td> 1509</td><td>GCAGAATCGAGCTCAC</td><td> 53</td><td> 803</td>

<td> 1062749</td><td>N/A</td><td>N/A</td><td> 1731</td><td> 1746</td><td>GTCCAACAATCGGCAC</td><td> 57</td><td> 804</td>

<td> 1062781</td><td>N/A</td><td>N/A</td><td> 1895</td><td> 1910</td><td>AAGTAGAGGGAGTASTING</td><td> 41</td><td> 805</td>

<td> 1062813</td><td>N/A</td><td>N/A</td><td> 2081</td><td> 2096</td><td>GAACACCCTATTAGGA</td><td> 63</td><td> 806</td>

<td> 1062845</td><td>N/A</td><td>N/A</td><td> 2255</td><td> 2270</td><td>ACCTATTTGACTGTAT</td><td> 56</td><td> 807</td>

<td> 1062877</td><td>N/A</td><td>N/A</td><td> 2408</td><td> 2423</td><td>AGTACCCACACTCTTA</td><td> 52</td><td> 808</td>

<td> 1062909</td><td>N/A</td><td>N/A</td><td> 2624</td><td> 2639</td><td>CTAATGCTGATCTTGG</td><td> 22</td><td> 809</td>

<td> 1062941</td><td>N/A</td><td>N/A</td><td> 2741</td><td> 2756</td><td>TTATTGAGTGAATAGT</td><td> 54</td><td> 810</td>

<td> 1062973</td><td>N/A</td><td>N/A</td><td> 2945</td><td> 2960</td><td>GAATTGTATTGCAAAG</td><td> 45</td><td> 811</td>

<td> 1063005</td><td>N/A</td><td>N/A</td><td> 3145</td><td> 3160</td><td>GCGAGCAAGAGAGAAC</td><td> 58</td><td> 812</td>

<td> 1063037</td><td>N/A</td><td>N/A</td><td> 3253</td><td> 3268</td><td>GGTTAAGTCATTAGGT</td><td> 19</td><td> 813</td>

<td> 1063069</td><td>N/A</td><td>N/A</td><td> 3398</td><td> 3413</td><td>TAGAGTCCTGAGATCT</td><td> 95</td><td> 814</td>

<td> 1063101</td><td>N/A</td><td>N/A</td><td> 3713</td><td> 3728</td><td>CACAATCAAGG UUC</td><td> 21</td><td> 815</td>

113

113

One hundred thirteen

<td> 1063133</td><td>N/A</td><td>N/A</td><td> 3946</td><td> 3961</td><td>TAGGGCCTCTTGCCTA</td><td> 110</td><td> 816</td>

<td> 1063165</td><td>N/A</td><td>N/A</td><td> 4127</td><td> 4142</td><td>AATAGTATAACACCAG</td><td> 35</td><td> 817</td>

<td> 1063197</td><td>N/A</td><td>N/A</td><td> 4249</td><td> 4264</td><td>CCACTATGACAAGCCC</td><td> 29</td><td> 818</td>

<td> 1063228</td><td>N/A</td><td>N/A</td><td> 4438</td><td> 4453</td><td>AllllllCCGCCATTGA</td><td> 76</td><td> 819</td>

<td> 1063260</td><td>N/A</td><td>N/A</td><td> 4608</td><td> 4623</td><td>GGACCTAGAGGGCCGG</td><td> 69</td><td> 820</td>

<td> 1063292</td><td>N/A</td><td>N/A</td><td> 4722</td><td> 4737</td><td>GGACACTTGGCCAGAG</td><td> 53</td><td> 821</td>

<td> 1063324</td><td>N/A</td><td>N/A</td><td> 5125</td><td> 5140</td><td>CGTGAGAAACAGGAGT</td><td> 20</td><td> 822</td>

<td> 1063356</td><td>N/A</td><td>N/A</td><td> 5331</td><td> 5346</td><td>CCGTTCCACCTCACAG</td><td> 38</td><td> 823</td>

<td> 1063388</td><td>N/A</td><td>N/A</td><td> 5527</td><td> 5542</td><td>CTATAATCCTGGTCTG</td><td> 64</td><td> 824</td>

<td> 1063420</td><td>N/A</td><td>N/A</td><td> 5739</td><td> 5754</td><td>TCAGAGTTCACCCCAA</td><td> 48</td><td> 825</td>

<td> 1063452</td><td>N/A</td><td>N/A</td><td> 5863</td><td> 5878</td><td>TCAGGGCAAGGAGGCG</td><td> 61</td><td> 826</td>

<td> 1063484</td><td>N/A</td><td>N/A</td><td> 6019</td><td> 6034</td><td>CAGCTGGAAGGACCGA</td><td> 87</td><td> 827</td>

<td> 1063516</td><td>N/A</td><td>N/A</td><td> 6162</td><td> 6177</td><td>CACAGAATGGGCTGGT</td><td> 46</td><td> 828</td>

<td> 1063548</td><td>N/A</td><td>N/A</td><td> 6374</td><td> 6389</td><td>CTTGAGAGCTGTTTCA</td><td> 59</td><td> 829</td>

<td> 1063580</td><td>N/A</td><td>N/A</td><td> 6584</td><td> 6599</td><td>TGGGACATGTCCCGAG</td><td> 59</td><td> 830</td>

<td> 1063612</td><td>N/A</td><td>N/A</td><td> 6988</td><td> 7003</td><td>TAAAGGTCGGCACCTG</td><td> 84</td><td> 831</td>

<td> 1063644</td><td>N/A</td><td>N/A</td><td> 7197</td><td> 7212</td><td>GGACACATAGCTATGC</td><td> 43</td><td> 832</td>

<td> 1063676</td><td>N/A</td><td>N/A</td><td> 7424</td><td> 7439</td><td>GAGGCCATCCTGATCC</td><td> 52</td><td> 833</td>

<td> 1063708</td><td>N/A</td><td>N/A</td><td> 7871</td><td> 7886</td><td>GAATAGCCTACACTGC</td><td> 75</td><td> 834</td>

<td> 1063740</td><td>N/A</td><td>N/A</td><td> 8012</td><td> 8027</td><td>TTGACTAGCTTTGTAA</td><td> 34</td><td> 835</td>

<td> 1063772</td><td>N/A</td><td>N/A</td><td> 8107</td><td> 8122</td><td>TCGAAAAACCCTGACTC</td><td> 75</td><td> 836</td>

<td> 1063803</td><td>N/A</td><td>N/A</td><td> 8580</td><td> 8595</td><td>GTTTAGCTCTTGCATC</td><td> 41</td><td> 837</td>

<td> 1063835</td><td>N/A</td><td>N/A</td><td> 8860</td><td> 8875</td><td>TTGGCATGAGGAGTAG</td><td> 61</td><td> 838</td>

<td> 1063867</td><td>N/A</td><td>N/A</td><td> 9107</td><td> 9122</td><td>GGACGGCCTGTGCAAA</td><td> 81</td><td> 839</td>

<td> 1063899</td><td>N/A</td><td>N/A</td><td> 9508</td><td> 9523</td><td>CTGGCATTACCTGCTG</td><td> 91</td><td> 840</td>

<td> 1063931</td><td>N/A</td><td>N/A</td><td> 9691</td><td> 9706</td><td>ACAAACATGAGGCCTC</td><td> 74</td><td> 841</td>

<td> 1063963</td><td>N/A</td><td>N/A</td><td> 10305</td><td> 10320</td><td>TCAGGATCACAGTGTT</td><td> 19</td><td> 842</td>

<td> 1063995</td><td>N/A</td><td>N/A</td><td> 10579</td><td> 10594</td><td>CTAAACCCCCCTGGCC</td><td> 71</td><td> 843</td>

<td> 1064027</td><td>N/A</td><td>N/A</td><td> 11120</td><td> 11135</td><td>CCCAGAGGCTTAAACT</td><td> 87</td><td> 844</td>

<td> 1064059</td><td>N/A</td><td>N/A</td><td> 11449</td><td> 11464</td><td>TGAGCGGATGCAllll</td><td> 59</td><td> 845</td>

<td> 1064091</td><td>N/A</td><td>N/A</td><td> 11575</td><td> 11590</td><td>TAGTAGCTGGAGTCCA</td><td> 16</td><td> 846</td>

<td> 1064125</td><td>N/A</td><td>N/A</td><td> 11657</td><td> 11672</td><td>CCCCGAl lll CCllGG</td><td> 32</td><td> 847</td>

<td> 1064157</td><td>N/A</td><td>N/A</td><td> 11737</td><td> 11752</td><td>AGTCAAGGTCTCTGAT</td><td> 75</td><td> 848</td>

<td> 1064189</td><td>N/A</td><td>N/A</td><td> 11822</td><td> 11837</td><td>AAATAGTTCTCCCCGA</td><td> 42</td><td> 849</td>

<td> 1064221</td><td>N/A</td><td>N/A</td><td> 11924</td><td> 11939</td><td>GCCTGAGATTCCACCG</td><td> 42</td><td> 850</td>

<td> 1064253</td><td>N/A</td><td>N/A</td><td> 11992</td><td> 12007</td><td>GAATCAAGCCCCATGC</td><td> 75</td><td> 851</td>

<td> 1064285</td><td>N/A</td><td>N/A</td><td> 12282</td><td> 12297</td><td>GATTTGCGGACAGGTT</td><td> 67</td><td> 852</td>

<td> 1064317</td><td>N/A</td><td>N/A</td><td> 12433</td><td> 12448</td><td>GTTTAGGGCAAGGTGC</td><td> 77</td><td> 853</td>

<td> 1064349</td><td>N/A</td><td>N/A</td><td> 12589</td><td> 12604</td><td>TGAAGTTAAGGATCAA</td><td> 69</td><td> 854</td>

<td> 1064381</td><td>N/A</td><td>N/A</td><td> 12793</td><td> 12808</td><td>ATGGGATTACAGAGTC</td><td> 40</td><td> 855</td>

<td> 1064413</td><td>N/A</td><td>N/A</td><td> 12951</td><td> 12966</td><td>CTTTAGGTCAGAAGCC</td><td> 72</td><td> 856</td>

<td> 1064445</td><td>N/A</td><td>N/A</td><td> 13225</td><td> 13240</td><td>GATTAGGTAAGGGATC</td><td> 104</td><td> 857</td>

TABLE 16

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

114

114

One hundred fourteen

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 29</td><td> 65</td>

<td> 1062007</td><td> 3</td><td> 18</td><td> 403</td><td> 418</td><td>IlliCGATGAGTGTGT</td><td> 12</td><td> 858</td>

<td> 1062039</td><td> 121</td><td> 136</td><td> 521</td><td> 536</td><td>AGCCTGGCTTGTGGGA</td><td> 68</td><td> 859</td>

<td> 1062071</td><td> 312</td><td> 327</td><td> 6850</td><td> 6865</td><td>CCTGGAAGGTTCCCCC</td><td> 65</td><td> 860</td>

<td> 1062103</td><td> 425</td><td> 440</td><td> 7490</td><td> 7505</td><td>TGCCCCGGAGGGTGCC</td><td> 87</td><td> 861</td>

<td> 1062135</td><td> 596</td><td> 611</td><td> 7759</td><td> 7774</td><td>GAAGACCCCAGTGGCG</td><td> 47</td><td> 862</td>

<td> 1062167</td><td> 762</td><td> 777</td><td> 8408</td><td> 8423</td><td>CATTTGCCAGCAGTGG</td><td> 76</td><td> 863</td>

<td> 1062199</td><td> 877</td><td> 892</td><td> 9467</td><td> 9482</td><td>TGGAGGAGACATTGTG</td><td> 63</td><td> 864</td>

<td> 1062231</td><td> 1060</td><td> 1075</td><td> 11216</td><td> 11231</td><td>GACCAGGCTGGGACGA</td><td> 42</td><td> 865</td>

<td> 1062263</td><td> 1184</td><td> 1199</td><td> 12054</td><td> 12069</td><td>TCGCATGTTGTGGAAC</td><td> 2*</td><td> 866</td>

<td> 1062295</td><td> 1428</td><td> 1443</td><td> 13838</td><td> 13853</td><td>GGCTCCGTTTCTTGCG</td><td> 214</td><td> 867</td>

<td> 1062327</td><td> 1594</td><td> 1609</td><td> 14004</td><td> 14019</td><td>ACAGTGGAAACCTCAC</td><td> 48</td><td> 868</td>

<td> 1062359</td><td> 1853</td><td> 1868</td><td> 14263</td><td> 14278</td><td>TGAGGGACAGGATTGT</td><td> 75</td><td> 869</td>

<td> 1062391</td><td> 2037</td><td> 2052</td><td> 14447</td><td> 14462</td><td>TAGGCCTCTGGGCACA</td><td> 67</td><td> 870</td>

<td> 1062423</td><td> 2211</td><td> 2226</td><td> 14621</td><td> 14636</td><td>MM GGCAAGGCAGTG</td><td> 54</td><td> 871</td>

<td> 1062455</td><td>N/A</td><td>N/A</td><td> 8300</td><td> 8315</td><td>CCACTGACCTGTCCTT</td><td> 114</td><td> 872</td>

<td> 1062487</td><td>N/A</td><td>N/A</td><td> 13602</td><td> 13617</td><td>GCTGCGATGGCACTTG</td><td> 74</td><td> 873</td>

<td> 1062551</td><td>N/A</td><td>N/A</td><td> 686</td><td> 701</td><td>CTTACCTGGCTGGAAT</td><td> 78</td><td> 874</td>

<td> 1062583</td><td>N/A</td><td>N/A</td><td> 868</td><td> 883</td><td>GGACAGCATTTCAAGT</td><td> 60</td><td> 875</td>

<td> 1062615</td><td>N/A</td><td>N/A</td><td> 1110</td><td> 1125</td><td>GAGATCGATGGAGTGT</td><td> 61</td><td> 876</td>

<td> 1062647</td><td>N/A</td><td>N/A</td><td> 1251</td><td> 1266</td><td>GCTCACTCTCATAAAA</td><td> 67</td><td> 877</td>

<td> 1062680</td><td>N/A</td><td>N/A</td><td> 1339</td><td> 1354</td><td>CTAAAGCGATACAAGC</td><td> 43</td><td> 878</td>

<td> 1062712</td><td>N/A</td><td>N/A</td><td> 1489</td><td> 1504</td><td>ATCGAGCTCACCCCAG</td><td> 11</td><td> 879</td>

<td> 1062744</td><td>N/A</td><td>N/A</td><td> 1725</td><td> 1740</td><td>CAATCGGCACTTGGTC</td><td> 46</td><td> 880</td>

<td> 1062776</td><td>N/A</td><td>N/A</td><td> 1879</td><td> 1894</td><td>AAATAGGACAACCTTT</td><td> 74</td><td> 881</td>

<td> 1062808</td><td>N/A</td><td>N/A</td><td> 2076</td><td> 2091</td><td>CCCTATTAGGAGTAAG</td><td> 58</td><td> 882</td>

<td> 1062840</td><td>N/A</td><td>N/A</td><td> 2162</td><td> 2177</td><td>CTATATATGTAATGGC</td><td> 14</td><td> 883</td>

<td> 1062872</td><td>N/A</td><td>N/A</td><td> 2395</td><td> 2410</td><td>TTAACCTCTATAGTAA</td><td> 58</td><td> 884</td>

<td> 1062904</td><td>N/A</td><td>N/A</td><td> 2615</td><td> 2630</td><td>ATCTTGGGTTTATTGT</td><td> 21</td><td> 885</td>

<td> 1062936</td><td>N/A</td><td>N/A</td><td> 2733</td><td> 2748</td><td>TGAATAGTCAGTCCAT</td><td> 34</td><td> 886</td>

<td> 1062968</td><td>N/A</td><td>N/A</td><td> 2873</td><td> 2888</td><td>CAGAATAGAAAGCTTG</td><td> 60</td><td> 887</td>

<td> 1063000</td><td>N/A</td><td>N/A</td><td> 3088</td><td> 3103</td><td>GGAGAGCCAGAGTGCA</td><td> 81</td><td> 888</td>

<td> 1063032</td><td>N/A</td><td>N/A</td><td> 3247</td><td> 3262</td><td>GTCATTAGGTGTCTGC</td><td> 3</td><td> 889</td>

<td> 1063064</td><td>N/A</td><td>N/A</td><td> 3391</td><td> 3406</td><td>CTGAGATCTAGGCTTG</td><td> 46</td><td> 890</td>

<td> 1063096</td><td>N/A</td><td>N/A</td><td> 3645</td><td> 3660</td><td>CATCATCACCACGCTC</td><td> 60</td><td> 891</td>

<td> 1063128</td><td>N/A</td><td>N/A</td><td> 3865</td><td> 3880</td><td>TCCCAAATACATGGCC</td><td> 70</td><td> 892</td>

<td> 1063160</td><td>N/A</td><td>N/A</td><td> 4122</td><td> 4137</td><td>TATAACACCAGGACCT</td><td> 66</td><td> 893</td>

<td> 1063192</td><td>N/A</td><td>N/A</td><td> 4235</td><td> 4250</td><td>CCCTAGCTCTGAAGAC</td><td> 71</td><td> 894</td>

<td> 1063224</td><td>N/A</td><td>N/A</td><td> 4412</td><td> 4427</td><td>GCCGGATGCGCCGGGC</td><td> 84</td><td> 895</td>

<td> 1063255</td><td>N/A</td><td>N/A</td><td> 4582</td><td> 4597</td><td>CGGCTTCCTGCACTGT</td><td> 85</td><td> 896</td>

<td> 1063287</td><td>N/A</td><td>N/A</td><td> 4713</td><td> 4728</td><td>GCCAGAGCTAAGAATT</td><td> 64</td><td> 897</td>

<td> 1063319</td><td>N/A</td><td>N/A</td><td> 5093</td><td> 5108</td><td>TCCGAACAAGGGCCTG</td><td> 25</td><td> 898</td>

<td> 1063351</td><td>N/A</td><td>N/A</td><td> 5277</td><td> 5292</td><td>GGAGTATAGAAGGGTT</td><td> 35</td><td> 899</td>

<td> 1063383</td><td>N/A</td><td>N/A</td><td> 5497</td><td> 5512</td><td>CTGGAAGGGACTGCCC</td><td> 67</td><td> 900</td>

<td> 1063415</td><td>N/A</td><td>N/A</td><td> 5685</td><td> 5700</td><td>CCTCAAATGCCCACTC</td><td> 65</td><td> 901</td>

115

115

Hundred fifteen

<td> 1063447</td><td>N/A</td><td>N/A</td><td> 5857</td><td> 5872</td><td>CAAGGAGGCGAGTCCA</td><td> 74</td><td> 902</td>

<td> 1063479</td><td>N/A</td><td>N/A</td><td> 6014</td><td> 6029</td><td>GGAAGGACCGAGCTGA</td><td> 40</td><td> 903</td>

<td> 1063511</td><td>N/A</td><td>N/A</td><td> 6136</td><td> 6151</td><td>AAGGCGAGAAGTGGGT</td><td> 24</td><td> 904</td>

<td> 1063543</td><td>N/A</td><td>N/A</td><td> 6290</td><td> 6305</td><td>TCGGACTTTCTCCTCG</td><td> 45</td><td> 905</td>

<td> 1063575</td><td>N/A</td><td>N/A</td><td> 6466</td><td> 6481</td><td>GCAGAGGTCCAGCACC</td><td> 70</td><td> 906</td>

<td> 1063607</td><td>N/A</td><td>N/A</td><td> 6982</td><td> 6997</td><td>TCGGCACCTGTAGGTC</td><td> 87</td><td> 907</td>

<td> 1063639</td><td>N/A</td><td>N/A</td><td> 7173</td><td> 7188</td><td>CTACAATACGGCCTCC</td><td> 62</td><td> 908</td>

<td> 1063671</td><td>N/A</td><td>N/A</td><td> 7378</td><td> 7393</td><td>GCACTGCAAGCCCACA</td><td> 40</td><td> 909</td>

<td> 1063703</td><td>N/A</td><td>N/A</td><td> 7804</td><td> 7819</td><td>GGCTGAGGTGTTACCA</td><td> 46</td><td> 910</td>

<td> 1063735</td><td>N/A</td><td>N/A</td><td> 8000</td><td> 8015</td><td>GTAAAGCTCTGTGGTT</td><td> 19</td><td> 911</td>

<td> 1063767</td><td>N/A</td><td>N/A</td><td> 8047</td><td> 8062</td><td>AAGCTTAAAGACGGCC</td><td> 59</td><td> 912</td>

<td> 1063798</td><td>N/A</td><td>N/A</td><td> 8562</td><td> 8577</td><td>ACTACTTATTGGGATG</td><td> 90</td><td> 913</td>

<td> 1063830</td><td>N/A</td><td>N/A</td><td> 8851</td><td> 8866</td><td>GGAGTAGCAGGGCAAA</td><td> 50</td><td> 914</td>

<td> 1063862</td><td>N/A</td><td>N/A</td><td> 9053</td><td> 9068</td><td>GCTAAGGGTTGTGTGT</td><td> 58</td><td> 915</td>

<td> 1063894</td><td>N/A</td><td>N/A</td><td> 9417</td><td> 9432</td><td>GCAGTGCCTAAGTAGG</td><td> 87</td><td> 916</td>

<td> 1063926</td><td>N/A</td><td>N/A</td><td> 9685</td><td> 9700</td><td>ATGAGGCCTCAGCCTG</td><td> 100</td><td> 917</td>

<td> 1063958</td><td>N/A</td><td>N/A</td><td> 9962</td><td> 9977</td><td>TCAGAGGGTTTGTAAG</td><td> 49</td><td> 918</td>

<td> 1063990</td><td>N/A</td><td>N/A</td><td> 10542</td><td> 10557</td><td>TTCGCATCATGAGAAA</td><td> 101</td><td> 919</td>

<td> 1064022</td><td>N/A</td><td>N/A</td><td> 11114</td><td> 11129</td><td>GGCTTAAACTTCCCAC</td><td> 91</td><td> 920</td>

<td> 1064054</td><td>N/A</td><td>N/A</td><td> 11382</td><td> 11397</td><td>AGCATGGAGCTCCTTT</td><td> 38</td><td> 921</td>

<td> 1064086</td><td>N/A</td><td>N/A</td><td> 11552</td><td> 11567</td><td>TGAGGCATGGCCCCAA</td><td> 106</td><td> 922</td>

<td> 1064120</td><td>N/A</td><td>N/A</td><td> 11652</td><td> 11667</td><td>Allll CCTTGGTCAGG</td><td> 30</td><td> 923</td>

<td> 1064152</td><td>N/A</td><td>N/A</td><td> 11727</td><td> 11742</td><td>TCTGATCCCTGCTAAG</td><td> 74</td><td> 924</td>

<td> 1064184</td><td>N/A</td><td>N/A</td><td> 11805</td><td> 11820</td><td>GTTGAAAAGAAGCGGA</td><td> 30</td><td> 925</td>

<td> 1064216</td><td>N/A</td><td>N/A</td><td> 11916</td><td> 11931</td><td>TTCTCACCGTCAACACC</td><td> 81</td><td> 926</td>

<td> 1064248</td><td>N/A</td><td>N/A</td><td> 11981</td><td> 11996</td><td>CATGCAGGACCTCCTA</td><td> 59</td><td> 927</td>

<td> 1064280</td><td>N/A</td><td>N/A</td><td> 12201</td><td> 12216</td><td>TGGGAATGGAGGAACC</td><td> 68</td><td> 928</td>

<td> 1064312</td><td>N/A</td><td>N/A</td><td> 12394</td><td> 12409</td><td>Am TATGGGTCCAGG</td><td> 27</td><td> 929</td>

<td> 1064344</td><td>N/A</td><td>N/A</td><td> 12582</td><td> 12597</td><td>AAGGATCAAATGGGTG</td><td> 70</td><td> 930</td>

<td> 1064376</td><td>N/A</td><td>N/A</td><td> 12785</td><td> 12800</td><td>ACAGAGTCAGCGATGA</td><td> 75</td><td> 931</td>

<td> 1064408</td><td>N/A</td><td>N/A</td><td> 12926</td><td> 12941</td><td>TTGAATTATCGAGTAT</td><td> 83</td><td> 932</td>

<td> 1064440</td><td>N/A</td><td>N/A</td><td> 13220</td><td> 13235</td><td>GGTAAGGGATCAGGAC</td><td> 70</td><td> 933</td>

TABLE 17

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 18</td><td> 250</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 35</td><td> 65</td>

<td> 1062013</td><td> 13</td><td> 28</td><td> 413</td><td> 428</td><td>ATCCAAA m HHCG</td><td> 83</td><td> 934</td>

<td> 1062045</td><td> 150</td><td> 165</td><td> 550</td><td> 565</td><td>TTGGTGAAGTGGACTG</td><td> 84</td><td> 935</td>

<td> 1062077</td><td> 320</td><td> 335</td><td> 6858</td><td> 6873</td><td>ATCTCGGCCCTGGAAG</td><td> 114</td><td> 936</td>

<td> 1062109</td><td> 466</td><td> 481</td><td> 7531</td><td> 7546</td><td>TCCTGGAGGAGTGCCT</td><td> 91</td><td> 937</td>

<td> 1062141</td><td> 635</td><td> 650</td><td>N/A</td><td>N/A</td><td>GTTGATCCCAGGTGGG</td><td> 45</td><td> 938</td>

<td> 1062173</td><td> 799</td><td> 814</td><td> 8445</td><td> 8460</td><td>TCGAAGACCTTCTCAC</td><td> 105</td><td> 939</td>

<td> 1062205</td><td> 945</td><td> 960</td><td> 9740</td><td> 9755</td><td>CCTGCATGGCACTCAG</td><td> 104</td><td> 940</td>

116

116

One hundred and sixteen

<td> 1062237</td><td> 1103</td><td> 1118</td><td> 11259</td><td> 11274</td><td>CCTCCGGACAGCAAAC</td><td> 133</td><td> 941</td>

<td> 1062269</td><td> 1256</td><td> 1271</td><td> 13486</td><td> 13501</td><td>ATTGAGTGTCCGCTGC</td><td> 34*</td><td> 942</td>

<td> 1062301</td><td> 1454</td><td> 1469</td><td> 13864</td><td> 13879</td><td>AGGGTTGGAACACCTG</td><td> 160</td><td> 943</td>

<td> 1062333</td><td> 1742</td><td> 1757</td><td> 14152</td><td> 14167</td><td>TGGCTGCAGGGCTCGA</td><td> 57</td><td> 944</td>

<td> 1062365</td><td> 1897</td><td> 1912</td><td> 14307</td><td> 14322</td><td>AGTGTACTGAGGCAGG</td><td> 25</td><td> 945</td>

<td> 1062397</td><td> 2063</td><td> 2078</td><td> 14473</td><td> 14488</td><td>CTGAGGGTACTGACGC</td><td> 13</td><td> 946</td>

<td> 1062429</td><td> 2270</td><td> 2285</td><td>N/A</td><td>N/A</td><td>GCATGGATCAGGGCTC</td><td> 69</td><td> 947</td>

<td> 1062461</td><td>N/A</td><td>N/A</td><td> 8324</td><td> 8339</td><td>GGCGAGGATCCTTCCC</td><td> 117</td><td> 948</td>

<td> 1062493</td><td>N/A</td><td>N/A</td><td> 13613</td><td> 13628</td><td>GCCCACTTTGAGCTGC</td><td> 122</td><td> 949</td>

<td> 1062525</td><td>N/A</td><td>N/A</td><td> 559</td><td> 574</td><td>ACACTCACCTTGGTGA</td><td> 152</td><td> 950</td>

<td> 1062557</td><td>N/A</td><td>N/A</td><td> 692</td><td> 707</td><td>AAAGACCTTACCTGGC</td><td> 41</td><td> 951</td>

<td> 1062589</td><td>N/A</td><td>N/A</td><td> 929</td><td> 944</td><td>GCATCAAGAGCTAAGA</td><td> 109</td><td> 952</td>

<td> 1062621</td><td>N/A</td><td>N/A</td><td> 1116</td><td> 1131</td><td>GGAAAGGAGATCGATG</td><td> 120</td><td> 953</td>

<td> 1062653</td><td>N/A</td><td>N/A</td><td> 1267</td><td> 1282</td><td>GGTGAACAGAACTGAT</td><td> 77</td><td> 954</td>

<td> 1062686</td><td>N/A</td><td>N/A</td><td> 1351</td><td> 1366</td><td>CAAGGGTCTCCTCTAA</td><td> 114</td><td> 955</td>

<td> 1062718</td><td>N/A</td><td>N/A</td><td> 1496</td><td> 1511</td><td>CTGCAGAATCGAGCTC</td><td> 54</td><td> 956</td>

<td> 1062750</td><td>N/A</td><td>N/A</td><td> 1747</td><td> 1762</td><td>GAGAAACAACCGGAAT</td><td> 91</td><td> 957</td>

<td> 1062782</td><td>N/A</td><td>N/A</td><td> 1896</td><td> 1911</td><td>TAAGTAGAGGGAGCAT</td><td> 39</td><td> 958</td>

<td> 1062814</td><td>N/A</td><td>N/A</td><td> 2083</td><td> 2098</td><td>ATGAACACCCTATTAG</td><td> 96</td><td> 959</td>

<td> 1062846</td><td>N/A</td><td>N/A</td><td> 2256</td><td> 2271</td><td>AACCTATTTGACTGTA</td><td> 93</td><td> 960</td>

<td> 1062878</td><td>N/A</td><td>N/A</td><td> 2409</td><td> 2424</td><td>CAGTACCCACACTCTT</td><td> 100</td><td> 961</td>

<td> 1062910</td><td>N/A</td><td>N/A</td><td> 2625</td><td> 2640</td><td>CCTAATGCTGATCTTG</td><td> 72</td><td> 962</td>

<td> 1062942</td><td>N/A</td><td>N/A</td><td> 2742</td><td> 2757</td><td>GTTATTGAGTGAATAG</td><td> 74</td><td> 963</td>

<td> 1062974</td><td>N/A</td><td>N/A</td><td> 2952</td><td> 2967</td><td>GGGTATTGAATTGTAT</td><td> 69</td><td> 964</td>

<td> 1063006</td><td>N/A</td><td>N/A</td><td> 3151</td><td> 3166</td><td>CAAAGAGCGAGCAAGA</td><td> 85</td><td> 965</td>

<td> 1063038</td><td>N/A</td><td>N/A</td><td> 3254</td><td> 3269</td><td>TGGTTAAGTCATTAGG</td><td> 6</td><td> 966</td>

<td> 1063070</td><td>N/A</td><td>N/A</td><td> 3399</td><td> 3414</td><td>CTAGAGTCCTGAGATC</td><td> 82</td><td> 967</td>

<td> 1063102</td><td>N/A</td><td>N/A</td><td> 3714</td><td> 3729</td><td>CCACAATCAAGGlili</td><td> 47</td><td> 968</td>

<td> 1063134</td><td>N/A</td><td>N/A</td><td> 3947</td><td> 3962</td><td>ATAGGGCCTCTTGCCT</td><td> 117</td><td> 969</td>

<td> 1063166</td><td>N/A</td><td>N/A</td><td> 4129</td><td> 4144</td><td>CAAATAGTATAACACC</td><td> 101</td><td> 970</td>

<td> 1063198</td><td>N/A</td><td>N/A</td><td> 4338</td><td> 4353</td><td>CCGAGAACTGGCTGCC</td><td> 51</td><td> 971</td>

<td> 1063229</td><td>N/A</td><td>N/A</td><td> 4439</td><td> 4454</td><td>GAllll CCGCCATTG</td><td> 120</td><td> 972</td>

<td> 1063261</td><td>N/A</td><td>N/A</td><td> 4610</td><td> 4625</td><td>GAGGACCTAGAGGGCC</td><td> 100</td><td> 973</td>

<td> 1063293</td><td>N/A</td><td>N/A</td><td> 4725</td><td> 4740</td><td>CCTGGACACTTGGCCA</td><td> 142</td><td> 974</td>

<td> 1063325</td><td>N/A</td><td>N/A</td><td> 5139</td><td> 5154</td><td>TTAGAACATTACTGCG</td><td> 46</td><td> 975</td>

<td> 1063357</td><td>N/A</td><td>N/A</td><td> 5370</td><td> 5385</td><td>TAAACTCTCTGGTGTG</td><td> 88</td><td> 976</td>

<td> 1063389</td><td>N/A</td><td>N/A</td><td> 5528</td><td> 5543</td><td>CCTATAATCCTGGTCT</td><td> 43</td><td> 977</td>

<td> 1063421</td><td>N/A</td><td>N/A</td><td> 5744</td><td> 5759</td><td>CCCCATCAGAGTTCAC</td><td> 59</td><td> 978</td>

<td> 1063453</td><td>N/A</td><td>N/A</td><td> 5870</td><td> 5885</td><td>CTGGATCTCAGGGCAA</td><td> 93</td><td> 979</td>

<td> 1063485</td><td>N/A</td><td>N/A</td><td> 6020</td><td> 6035</td><td>GCAGCTGGAAGGACCG</td><td> 78</td><td> 980</td>

<td> 1063517</td><td>N/A</td><td>N/A</td><td> 6192</td><td> 6207</td><td>TGTAACAGTCCTGGCA</td><td> 118</td><td> 981</td>

<td> 1063549</td><td>N/A</td><td>N/A</td><td> 6377</td><td> 6392</td><td>CCACTTGAGAGCTGTT</td><td> 46</td><td> 982</td>

<td> 1063581</td><td>N/A</td><td>N/A</td><td> 6585</td><td> 6600</td><td>CTGGGACATGTCCCGA</td><td> 159</td><td> 983</td>

<td> 1063613</td><td>N/A</td><td>N/A</td><td> 6989</td><td> 7004</td><td>GTAAAGGTCGGCACCT</td><td> 113</td><td> 984</td>

<td> 1063645</td><td>N/A</td><td>N/A</td><td> 7240</td><td> 7255</td><td>ACCTACTTGGCCCCAG</td><td> 67</td><td> 985</td>

<td> 1063677</td><td>N/A</td><td>N/A</td><td> 7427</td><td> 7442</td><td>TGAGAGGCCATCCTGA</td><td> 93</td><td> 986</td>

<td> 1063709</td><td>N/A</td><td>N/A</td><td> 7872</td><td> 7887</td><td>AGAATAGCCTACACTG</td><td> 88</td><td> 987</td>

<td> 1063741</td><td>N/A</td><td>N/A</td><td> 8013</td><td> 8028</td><td>TTTGACTAGCTTTGTA</td><td> 65</td><td> 988</td>

117

117

One hundred seventeen

<td> 1063773</td><td>N/A</td><td>N/A</td><td> 8109</td><td> 8124</td><td>CCTCGAAAACCCTGAC</td><td> 39</td><td> 989</td>

<td> 1063804</td><td>N/A</td><td>N/A</td><td> 8582</td><td> 8597</td><td>GAGTTTAGCTCTTGCA</td><td> 20</td><td> 990</td>

<td> 1063836</td><td>N/A</td><td>N/A</td><td> 8863</td><td> 8878</td><td>ATGTTGGCATGAGGAG</td><td> 70</td><td> 991</td>

<td> 1063868</td><td>N/A</td><td>N/A</td><td> 9108</td><td> 9123</td><td>GGGACGGCCTGTGCAA</td><td> 104</td><td> 992</td>

<td> 1063900</td><td>N/A</td><td>N/A</td><td> 9524</td><td> 9539</td><td>CTTACCCTCCACCGCC</td><td> 83</td><td> 993</td>

<td> 1063932</td><td>N/A</td><td>N/A</td><td> 9692</td><td> 9707</td><td>CACAAACATGAGGCCT</td><td> 45</td><td> 994</td>

<td> 1063964</td><td>N/A</td><td>N/A</td><td> 10306</td><td> 10321</td><td>CTCAGGATCACAGTGT</td><td> 47</td><td> 995</td>

<td> 1063996</td><td>N/A</td><td>N/A</td><td> 10580</td><td> 10595</td><td>CCTAAACCCCCCTGGC</td><td> 124</td><td> 996</td>

<td> 1064028</td><td>N/A</td><td>N/A</td><td> 11121</td><td> 11136</td><td>ACCCAGAGGCTTAAAC</td><td> 111</td><td> 997</td>

<td> 1064060</td><td>N/A</td><td>N/A</td><td> 11450</td><td> 11465</td><td>GTGAGCGGATGCATTT</td><td> 60</td><td> 998</td>

<td> 1064092</td><td>N/A</td><td>N/A</td><td> 11577</td><td> 11592</td><td>TATAGTAGCTGGAGTC</td><td> 65</td><td> 999</td>

<td> 1064126</td><td>N/A</td><td>N/A</td><td> 11658</td><td> 11673</td><td>ACCCCGAIIIICCIIG</td><td> 74</td><td> 1000</td>

<td> 1064158</td><td>N/A</td><td>N/A</td><td> 11741</td><td> 11756</td><td>TGACAGTCAAGGTCTC</td><td> 113</td><td> 1001</td>

<td> 1064190</td><td>N/A</td><td>N/A</td><td> 11823</td><td> 11838</td><td>AAAATAGTTCTCCCCG</td><td> 41</td><td> 1002</td>

<td> 1064222</td><td>N/A</td><td>N/A</td><td> 11926</td><td> 11941</td><td>AGGCCTGAGATCTCAC</td><td> 70</td><td> 1003</td>

<td> 1064254</td><td>N/A</td><td>N/A</td><td> 11993</td><td> 12008</td><td>TGAATCAAGCCCCATG</td><td> 125</td><td> 1004</td>

<td> 1064286</td><td>N/A</td><td>N/A</td><td> 12283</td><td> 12298</td><td>GGATTTGCGGACAGGT</td><td> 16</td><td> 1005</td>

<td> 1064318</td><td>N/A</td><td>N/A</td><td> 12434</td><td> 12449</td><td>CGTTTAGGGCAAGGTG</td><td> 97</td><td> 1006</td>

<td> 1064350</td><td>N/A</td><td>N/A</td><td> 12616</td><td> 12631</td><td>TGAGATGAAGGAGTTG</td><td> 142</td><td> 1007</td>

<td> 1064382</td><td>N/A</td><td>N/A</td><td> 12795</td><td> 12810</td><td>GAATGGGATTACAGAG</td><td> 92</td><td> 1008</td>

<td> 1064414</td><td>N/A</td><td>N/A</td><td> 12952</td><td> 12967</td><td>GCTTTAGGTCAGAAGC</td><td> 105</td><td> 1009</td>

<td> 1064446</td><td>N/A</td><td>N/A</td><td> 13226</td><td> 13241</td><td>GGATTAGGTAAGGGAT</td><td> 105</td><td> 1010</td>

TABLE 18

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 18</td><td> 250</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 42</td><td> 65</td>

<td> 1062014</td><td> 35</td><td> 50</td><td> 435</td><td> 450</td><td>CGCAGACCTCTCTCTT</td><td> 57</td><td> 1011</td>

<td> 1062046</td><td> 151</td><td> 166</td><td> 551</td><td> 566</td><td>CTTGGTGAAGTGGACT</td><td> 67</td><td> 1012</td>

<td> 1062078</td><td> 321</td><td> 336</td><td> 6859</td><td> 6874</td><td>GATCTCGGCCCTGGAA</td><td> 33</td><td> 1013</td>

<td> 1062110</td><td> 467</td><td> 482</td><td> 7532</td><td> 7547</td><td>GTCCTGGAGGAGTGCC</td><td> 69</td><td> 1014</td>

<td> 1062142</td><td> 658</td><td> 673</td><td> 8235</td><td> 8250</td><td>GACACCCATTCCAGGC</td><td> 78</td><td> 1015</td>

<td> 1062174</td><td> 800</td><td> 815</td><td> 8446</td><td> 8461</td><td>TTCGAAGACCTTCCA</td><td> 131</td><td> 1016</td>

<td> 1062206</td><td> 979</td><td> 994</td><td> 9774</td><td> 9789</td><td>GCCTTGGTCAGTGCCA</td><td> 36</td><td> 1017</td>

<td> 1062238</td><td> 1104</td><td> 1119</td><td> 11260</td><td> 11275</td><td>GCCTCCGGACAGCAAA</td><td> 98</td><td> 1018</td>

<td> 1062270</td><td> 1258</td><td> 1273</td><td> 13488</td><td> 13503</td><td>TCATTGAGTGTCCGCT</td><td> 75*</td><td> 1019</td>

<td> 1062302</td><td> 1455</td><td> 1470</td><td> 13865</td><td> 13880</td><td>TAGGGTTGGAACACCT</td><td> 82</td><td> 1020</td>

<td> 1062334</td><td> 1743</td><td> 1758</td><td> 14153</td><td> 14168</td><td>TTGGCTGCAGGGCTCG</td><td> 30</td><td> 1021</td>

<td> 1062366</td><td> 1898</td><td> 1913</td><td> 14308</td><td> 14323</td><td>GAGTGTACTGAGGCAG</td><td> 12</td><td> 1022</td>

<td> 1062398</td><td> 2064</td><td> 2079</td><td> 14474</td><td> 14489</td><td>CCTGAGGGTACTGACG</td><td> 49</td><td> 1023</td>

<td> 1062430</td><td> 2271</td><td> 2286</td><td>N/A</td><td>N/A</td><td>GGCATGGATCAGGGCT</td><td> 75</td><td> 1024</td>

<td> 1062462</td><td>N/A</td><td>N/A</td><td> 8325</td><td> 8340</td><td>GGGCGAGGATCCTTCC</td><td> 53</td><td> 1025</td>

<td> 1062494</td><td>N/A</td><td>N/A</td><td> 13634</td><td> 13649</td><td>TATGAGCCCAGACCCA</td><td> 95</td><td> 1026</td>

<td> 1062526</td><td>N/A</td><td>N/A</td><td> 560</td><td> 575</td><td>GACACTCACCTTGGTG</td><td> 96</td><td> 1027</td>

118

118

One hundred eighteen

<td> 1062558</td><td>N/A</td><td>N/A</td><td> 693</td><td> 708</td><td>TAAGACCTTACCTGG</td><td> 87</td><td> 1028</td>

<td> 1062590</td><td>N/A</td><td>N/A</td><td> 931</td><td> 946</td><td>AGGCATCAAGAGCTAA</td><td> 107</td><td> 1029</td>

<td> 1062622</td><td>N/A</td><td>N/A</td><td> 1117</td><td> 1132</td><td>AGGAAAGGAGATCGAT</td><td> 107</td><td> 1030</td>

<td> 1062654</td><td>N/A</td><td>N/A</td><td> 1268</td><td> 1283</td><td>GGGTGAACAGAACTGA</td><td> 56</td><td> 1031</td>

<td> 1062687</td><td>N/A</td><td>N/A</td><td> 1352</td><td> 1367</td><td>CCAAGGGTCTCCTCTA</td><td> 95</td><td> 1032</td>

<td> 1062719</td><td>N/A</td><td>N/A</td><td> 1497</td><td> 1512</td><td>CCTGCAGAATCGAGCT</td><td> 68</td><td> 1033</td>

<td> 1062751</td><td>N/A</td><td>N/A</td><td> 1748</td><td> 1763</td><td>CGAGAAAACACCGGAA</td><td> 69</td><td> 1034</td>

<td> 1062783</td><td>N/A</td><td>N/A</td><td> 1897</td><td> 1912</td><td>TTAAGTAGAGGGAGCA</td><td> 25</td><td> 1035</td>

<td> 1062815</td><td>N/A</td><td>N/A</td><td> 2084</td><td> 2099</td><td>GATGAACACCCTATTA</td><td> 126</td><td> 1036</td>

<td> 1062847</td><td>N/A</td><td>N/A</td><td> 2258</td><td> 2273</td><td>CTAACCTATTTGACTG</td><td> 70</td><td> 1037</td>

<td> 1062879</td><td>N/A</td><td>N/A</td><td> 2410</td><td> 2425</td><td>CCAGTACCCACACTCT</td><td> 85</td><td> 1038</td>

<td> 1062911</td><td>N/A</td><td>N/A</td><td> 2626</td><td> 2641</td><td>ACCTAATGCTGATCTT</td><td> 72</td><td> 1039</td>

<td> 1062943</td><td>N/A</td><td>N/A</td><td> 2748</td><td> 2763</td><td>GATAAAGTTATTGAGT</td><td> 79</td><td> 1040</td>

<td> 1062975</td><td>N/A</td><td>N/A</td><td> 2953</td><td> 2968</td><td>TGGGTATTGAATTGTA</td><td> 43</td><td> 1041</td>

<td> 1063007</td><td>N/A</td><td>N/A</td><td> 3152</td><td> 3167</td><td>ACAAAGAGCGAGCAAG</td><td> 136</td><td> 1042</td>

<td> 1063039</td><td>N/A</td><td>N/A</td><td> 3255</td><td> 3270</td><td>CTGGTTAAGTCATTAG</td><td> 26</td><td> 1043</td>

<td> 1063071</td><td>N/A</td><td>N/A</td><td> 3401</td><td> 3416</td><td>ACCTAGAGTCCTGAGA</td><td> 132</td><td> 1044</td>

<td> 1063103</td><td>N/A</td><td>N/A</td><td> 3716</td><td> 3731</td><td>CCCCACAATCAAGGTT</td><td> 78</td><td> 1045</td>

<td> 1063135</td><td>N/A</td><td>N/A</td><td> 3949</td><td> 3964</td><td>TCATAGGGCCTCTTGC</td><td> 92</td><td> 1046</td>

<td> 1063167</td><td>N/A</td><td>N/A</td><td> 4132</td><td> 4147</td><td>CTTCAAATAGTATAAC</td><td> 101</td><td> 1047</td>

<td> 1063199</td><td>N/A</td><td>N/A</td><td> 4339</td><td> 4354</td><td>TCCGAGAACTGGCTGC</td><td> 62</td><td> 1048</td>

<td> 1063230</td><td>N/A</td><td>N/A</td><td> 4440</td><td> 4455</td><td>AGA lllllCCGCCATT</td><td> 102</td><td> 1049</td>

<td> 1063262</td><td>N/A</td><td>N/A</td><td> 4611</td><td> 4626</td><td>AGAGGACCTAGAGGGC</td><td> 66</td><td> 1050</td>

<td> 1063294</td><td>N/A</td><td>N/A</td><td> 4726</td><td> 4741</td><td>GCCTGGACACTTGGCC</td><td> 41</td><td> 1051</td>

<td> 1063326</td><td>N/A</td><td>N/A</td><td> 5140</td><td> 5155</td><td>CTTAGAACATTACTGC</td><td> 33</td><td> 1052</td>

<td> 1063358</td><td>N/A</td><td>N/A</td><td> 5398</td><td> 5413</td><td>TAGGAAGTGTTTCCGT</td><td> 82</td><td> 1053</td>

<td> 1063390</td><td>N/A</td><td>N/A</td><td> 5529</td><td> 5544</td><td>TCCTATAATCCTGGTC</td><td> 103</td><td> 1054</td>

<td> 1063422</td><td>N/A</td><td>N/A</td><td> 5765</td><td> 5780</td><td>GTAGAAGCTTCTCTAC</td><td> 100</td><td> 1055</td>

<td> 1063454</td><td>N/A</td><td>N/A</td><td> 5923</td><td> 5938</td><td>CTGGCATTAAATATGT</td><td> 94</td><td> 1056</td>

<td> 1063486</td><td>N/A</td><td>N/A</td><td> 6030</td><td> 6045</td><td>TTTAGCTTGAGCAGCT</td><td> 100</td><td> 1057</td>

<td> 1063518</td><td>N/A</td><td>N/A</td><td> 6193</td><td> 6208</td><td>TTGTAACAGTCCTGGC</td><td> 44</td><td> 1058</td>

<td> 1063550</td><td>N/A</td><td>N/A</td><td> 6378</td><td> 6393</td><td>TCCACTTGAGAGCTGT</td><td> 52</td><td> 1059</td>

<td> 1063582</td><td>N/A</td><td>N/A</td><td> 6586</td><td> 6601</td><td>GCTGGGACATGTCCCG</td><td> 84</td><td> 1060</td>

<td> 1063614</td><td>N/A</td><td>N/A</td><td> 6990</td><td> 7005</td><td>AGTAAAGGTCGGCACC</td><td> 98</td><td> 1061</td>

<td> 1063646</td><td>N/A</td><td>N/A</td><td> 7244</td><td> 7259</td><td>CCTCACCTACTTGGCC</td><td> 32</td><td> 1062</td>

<td> 1063678</td><td>N/A</td><td>N/A</td><td> 7428</td><td> 7443</td><td>GTGAGAGGCCATCCTG</td><td> 85</td><td> 1063</td>

<td> 1063710</td><td>N/A</td><td>N/A</td><td> 7873</td><td> 7888</td><td>CAGAATAGCCTACACT</td><td> 85</td><td> 1064</td>

<td> 1063742</td><td>N/A</td><td>N/A</td><td> 8015</td><td> 8030</td><td>AllllGACTAGCTTTG</td><td> 53</td><td> 1065</td>

<td> 1063774</td><td>N/A</td><td>N/A</td><td> 8110</td><td> 8125</td><td>GCCTCGAAAACCCTGA</td><td> 30</td><td> 1066</td>

<td> 1063805</td><td>N/A</td><td>N/A</td><td> 8587</td><td> 8602</td><td>TCTCAGAGTTTAGCTC</td><td> 60</td><td> 1067</td>

<td> 1063837</td><td>N/A</td><td>N/A</td><td> 8864</td><td> 8879</td><td>CATGTTGGCATGAGGA</td><td> 40</td><td> 1068</td>

<td> 1063869</td><td>N/A</td><td>N/A</td><td> 9110</td><td> 9125</td><td>GAGGGACGGCCTGTGC</td><td> 108</td><td> 1069</td>

<td> 1063901</td><td>N/A</td><td>N/A</td><td> 9525</td><td> 9540</td><td>CCTTACCCTCCACCGC</td><td> 35</td><td> 1070</td>

<td> 1063933</td><td>N/A</td><td>N/A</td><td> 9693</td><td> 9708</td><td>GCACAAACATGAGGCC</td><td> 111</td><td> 1071</td>

<td> 1063965</td><td>N/A</td><td>N/A</td><td> 10307</td><td> 10322</td><td>ACTCAGGATCACAGTG</td><td> 77</td><td> 1072</td>

<td> 1063997</td><td>N/A</td><td>N/A</td><td> 10581</td><td> 10596</td><td>ACCTAAACCCCCCTGG</td><td> 75</td><td> 1073</td>

<td> 1064029</td><td>N/A</td><td>N/A</td><td> 11124</td><td> 11139</td><td>GTGACCCAGAGGCTTA</td><td> 105</td><td> 1074</td>

<td> 1064061</td><td>N/A</td><td>N/A</td><td> 11451</td><td> 11466</td><td>TGTGAGCGGATGCATT</td><td> 80</td><td> 1075</td>

119

119

One hundred and nineteen

<td> 1064093</td><td>N/A</td><td>N/A</td><td> 11578</td><td> 11593</td><td>ATATAGTAGCTGGAGT</td><td> 71</td><td> 1076</td>

<td> 1064127</td><td>N/A</td><td>N/A</td><td> 11659</td><td> 11674</td><td>CACCCCGAI IIICCII</td><td> 66</td><td> 1077</td>

<td> 1064159</td><td>N/A</td><td>N/A</td><td> 11743</td><td> 11758</td><td>GATGACAGTCAAGGTC</td><td> 70</td><td> 1078</td>

<td> 1064191</td><td>N/A</td><td>N/A</td><td> 11824</td><td> 11839</td><td>CAAAATAGTTCTCCCC</td><td> 30</td><td> 1079</td>

<td> 1064223</td><td>N/A</td><td>N/A</td><td> 11929</td><td> 11944</td><td>TACAGGCCTGAGATCT</td><td> 69</td><td> 1080</td>

<td> 1064255</td><td>N/A</td><td>N/A</td><td> 11995</td><td> 12010</td><td>GATGAATCAAGCCCCA</td><td> 55</td><td> 1081</td>

<td> 1064287</td><td>N/A</td><td>N/A</td><td> 12296</td><td> 12311</td><td>GTGGTTTAGGTTTGGA</td><td> 13</td><td> 1082</td>

<td> 1064319</td><td>N/A</td><td>N/A</td><td> 12453</td><td> 12468</td><td>TAGAGTAAGAGCTGGG</td><td> 64</td><td> 1083</td>

<td> 1064351</td><td>N/A</td><td>N/A</td><td> 12638</td><td> 12653</td><td>TCTGAGAAGGCATTGG</td><td> 73</td><td> 1084</td>

<td> 1064383</td><td>N/A</td><td>N/A</td><td> 12809</td><td> 12824</td><td>CAGTTTGGATTCAGGA</td><td> 55</td><td> 1085</td>

<td> 1064415</td><td>N/A</td><td>N/A</td><td> 12953</td><td> 12968</td><td>GGCTTTAGGTCAGAAG</td><td> 133</td><td> 1086</td>

<td> 1064447</td><td>N/A</td><td>N/A</td><td> 13229</td><td> 13244</td><td>CTGGGATTAGGTAAGG</td><td> 110</td><td> 1087</td>

TABLE 19

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 33</td><td> 250</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 36</td><td> 65</td>

<td> 1062015</td><td> 37</td><td> 52</td><td> 437</td><td> 452</td><td>GCCGCAGACCTCTCTC</td><td> 32</td><td> 1088</td>

<td> 1062047</td><td> 153</td><td> 168</td><td>N/A</td><td>N/A</td><td>GGCTTGGTGAAGTGGA</td><td> 48</td><td> 1089</td>

<td> 1062079</td><td> 322</td><td> 337</td><td> 6860</td><td> 6875</td><td>AGATCTCGGCCCTGGA</td><td> 122</td><td> 1090</td>

<td> 1062111</td><td> 483</td><td> 498</td><td> 7548</td><td> 7563</td><td>GCATGAAATGTGGCCT</td><td> 120</td><td> 1091</td>

<td> 1062143</td><td> 661</td><td> 676</td><td> 8238</td><td> 8253</td><td>CTGGACACCCATTCCA</td><td> 126</td><td> 1092</td>

<td> 1062175</td><td> 801</td><td> 816</td><td> 8447</td><td> 8462</td><td>CTTCGAAGACCTTCTC</td><td> 103</td><td> 1093</td>

<td> 1062207</td><td> 980</td><td> 995</td><td> 9775</td><td> 9790</td><td>AGCCTTGGTCAGTGCC</td><td> 125</td><td> 1094</td>

<td> 1062239</td><td> 1111</td><td> 1126</td><td> 11267</td><td> 11282</td><td>CACAGGTGCCTCCGGA</td><td> 165</td><td> 1095</td>

<td> 1062271</td><td> 1259</td><td> 1274</td><td> 13489</td><td> 13504</td><td>CTCATTGAGTGTCCGC</td><td> 79*</td><td> 1096</td>

<td> 1062303</td><td> 1456</td><td> 1471</td><td> 13866</td><td> 13881</td><td>GTAGGGTTGGAACACC</td><td> 140</td><td> 1097</td>

<td> 1062335</td><td> 1744</td><td> 1759</td><td> 14154</td><td> 14169</td><td>TTTGGCTGCAGGGCTC</td><td> 35</td><td> 1098</td>

<td> 1062367</td><td> 1899</td><td> 1914</td><td> 14309</td><td> 14324</td><td>TGAGTGTACTGAGGCA</td><td> 31</td><td> 1099</td>

<td> 1062399</td><td> 2065</td><td> 2080</td><td> 14475</td><td> 14490</td><td>TCCTGAGGGTACTGAC</td><td> 108</td><td> 1100</td>

<td> 1062431</td><td> 2273</td><td> 2288</td><td>N/A</td><td>N/A</td><td>GAGGCATGGATCAGGG</td><td> 42</td><td> 1101</td>

<td> 1062463</td><td>N/A</td><td>N/A</td><td> 8326</td><td> 8341</td><td>AGGGCGAGGATCCTTC</td><td> 106</td><td> 1102</td>

<td> 1062495</td><td>N/A</td><td>N/A</td><td> 13636</td><td> 13651</td><td>CCTATGAGCCCAGACC</td><td> 144</td><td> 1103</td>

<td> 1062527</td><td>N/A</td><td>N/A</td><td> 561</td><td> 576</td><td>GGACACTCACCTTGGT</td><td> 113</td><td> 1104</td>

<td> 1062559</td><td>N/A</td><td>N/A</td><td> 694</td><td> 709</td><td>TTAAAGACCTTACCTG</td><td> 116</td><td> 1105</td>

<td> 1062591</td><td>N/A</td><td>N/A</td><td> 932</td><td> 947</td><td>GAGGCATCAAGAGCTA</td><td> 90</td><td> 1106</td>

<td> 1062623</td><td>N/A</td><td>N/A</td><td> 1119</td><td> 1134</td><td>GGAGGAAAGGAGATCG</td><td> 149</td><td> 1107</td>

<td> 1062655</td><td>N/A</td><td>N/A</td><td> 1271</td><td> 1286</td><td>CTAGGGTGAACAGAAC</td><td> 55</td><td> 1108</td>

<td> 1062688</td><td>N/A</td><td>N/A</td><td> 1358</td><td> 1373</td><td>CCCGCCCCAAGGGTCT</td><td> 56</td><td> 1109</td>

<td> 1062720</td><td>N/A</td><td>N/A</td><td> 1503</td><td> 1518</td><td>GCTAAGCCTGCAGAAT</td><td> 96</td><td> 1110</td>

<td> 1062752</td><td>N/A</td><td>N/A</td><td> 1749</td><td> 1764</td><td>ACGAGAAAACACCGGA</td><td> 130</td><td> 1111</td>

<td> 1062784</td><td>N/A</td><td>N/A</td><td> 1907</td><td> 1922</td><td>TAGGGTTAGCTTAAGT</td><td> 46</td><td> 1112</td>

<td> 1062816</td><td>N/A</td><td>N/A</td><td> 2085</td><td> 2100</td><td>AGATGAACACCCTATT</td><td> 72</td><td> 1113</td>

<td> 1062848</td><td>N/A</td><td>N/A</td><td> 2259</td><td> 2274</td><td>ACTAACCTATTTGACT</td><td> 89</td><td> 1114</td>

120

120

One hundred twenty

<td> 1062880</td><td>N/A</td><td>N/A</td><td> 2411</td><td> 2426</td><td>TCCAGTACCCACACTC</td><td> 83</td><td> 1115</td>

<td> 1062912</td><td>N/A</td><td>N/A</td><td> 2627</td><td> 2642</td><td>CACCTAATGCTGATCT</td><td> 63</td><td> 1116</td>

<td> 1062944</td><td>N/A</td><td>N/A</td><td> 2761</td><td> 2776</td><td>TAATTAGGGAGAAGAT</td><td> 101</td><td> 1117</td>

<td> 1062976</td><td>N/A</td><td>N/A</td><td> 2954</td><td> 2969</td><td>CTGGGTATTGAATTGT</td><td> 57</td><td> 1118</td>

<td> 1063008</td><td>N/A</td><td>N/A</td><td> 3153</td><td> 3168</td><td>CACAAAGAGCGAGCAA</td><td> 108</td><td> 1119</td>

<td> 1063040</td><td>N/A</td><td>N/A</td><td> 3256</td><td> 3271</td><td>TCTGGTTAAGTCATTA</td><td> 76</td><td> 1120</td>

<td> 1063072</td><td>N/A</td><td>N/A</td><td> 3402</td><td> 3417</td><td>CACCTAGAGTCCTGAG</td><td> 130</td><td> 1121</td>

<td> 1063104</td><td>N/A</td><td>N/A</td><td> 3739</td><td> 3754</td><td>CATCATCAGACTCTCT</td><td> 114</td><td> 1122</td>

<td> 1063136</td><td>N/A</td><td>N/A</td><td> 3950</td><td> 3965</td><td>TTCATAGGGCCTCTTG</td><td> 74</td><td> 1123</td>

<td> 1063168</td><td>N/A</td><td>N/A</td><td> 4151</td><td> 4166</td><td>ATACTGGGACCCCTGG</td><td> 123</td><td> 1124</td>

<td> 1063200</td><td>N/A</td><td>N/A</td><td> 4340</td><td> 4355</td><td>TTCCGAGAACTGGCTG</td><td> 48</td><td> 1125</td>

<td> 1063231</td><td>N/A</td><td>N/A</td><td> 4441</td><td> 4456</td><td>CAGAllllll CCGCCA1</td><td> 84</td><td> 1126</td>

<td> 1063263</td><td>N/A</td><td>N/A</td><td> 4613</td><td> 4628</td><td>GTAGAGGACCTAGAGG</td><td> 50</td><td> 1127</td>

<td> 1063295</td><td>N/A</td><td>N/A</td><td> 4742</td><td> 4757</td><td>GGTCACTTCTGAAGCT</td><td> 71</td><td> 1128</td>

<td> 1063327</td><td>N/A</td><td>N/A</td><td> 5142</td><td> 5157</td><td>GGCTTAGAACATTACT</td><td> 98</td><td> 1129</td>

<td> 1063359</td><td>N/A</td><td>N/A</td><td> 5399</td><td> 5414</td><td>TTAGGAAGTGTTTCGT</td><td> 109</td><td> 1130</td>

<td> 1063391</td><td>N/A</td><td>N/A</td><td> 5530</td><td> 5545</td><td>ATCCTATAATCCTGGT</td><td> 128</td><td> 1131</td>

<td> 1063423</td><td>N/A</td><td>N/A</td><td> 5768</td><td> 5783</td><td>CCTGTAGAAGCTTCTC</td><td> 82</td><td> 1132</td>

<td> 1063455</td><td>N/A</td><td>N/A</td><td> 5930</td><td> 5945</td><td>GAAGAGTCTGGCATTA</td><td> 73</td><td> 1133</td>

<td> 1063487</td><td>N/A</td><td>N/A</td><td> 6031</td><td> 6046</td><td>llllAGCTTGAGCAGC</td><td> 174</td><td> 1134</td>

<td> 1063519</td><td>N/A</td><td>N/A</td><td> 6194</td><td> 6209</td><td>ATTGTAACAGTCCTGG</td><td> 54</td><td> 1135</td>

<td> 1063551</td><td>N/A</td><td>N/A</td><td> 6379</td><td> 6394</td><td>CTCCACTTGAGAGCTG</td><td> 81</td><td> 1136</td>

<td> 1063583</td><td>N/A</td><td>N/A</td><td> 6587</td><td> 6602</td><td>GGCTGGGACATGTCCC</td><td> 147</td><td> 1137</td>

<td> 1063615</td><td>N/A</td><td>N/A</td><td> 6991</td><td> 7006</td><td>CAGTAAAGGTCGGCAC</td><td> 188</td><td> 1138</td>

<td> 1063647</td><td>N/A</td><td>N/A</td><td> 7305</td><td> 7320</td><td>TCGAGTAACl llllAA</td><td> 44</td><td> 1139</td>

<td> 1063679</td><td>N/A</td><td>N/A</td><td> 7429</td><td> 7444</td><td>GGTGAGAGGCCATCCT</td><td> 108</td><td> 1140</td>

<td> 1063711</td><td>N/A</td><td>N/A</td><td> 7874</td><td> 7889</td><td>TCAGAATAGCCTACAC</td><td> 121</td><td> 1141</td>

<td> 1063743</td><td>N/A</td><td>N/A</td><td> 8017</td><td> 8032</td><td>ACA llllGACTAGCTT</td><td> 40</td><td> 1142</td>

<td> 1063775</td><td>N/A</td><td>N/A</td><td> 8111</td><td> 8126</td><td>AGCCTCGAAAACCCTG</td><td> 145</td><td> 1143</td>

<td> 1063806</td><td>N/A</td><td>N/A</td><td> 8597</td><td> 8612</td><td>GAACCCACAGTCTCAG</td><td> 110</td><td> 1144</td>

<td> 1063838</td><td>N/A</td><td>N/A</td><td> 8875</td><td> 8890</td><td>AATAAGGCTGGCATGT</td><td> 110</td><td> 1145</td>

<td> 1063870</td><td>N/A</td><td>N/A</td><td> 9113</td><td> 9128</td><td>GTGGAGGGACGGCCTG</td><td> 92</td><td> 1146</td>

<td> 1063902</td><td>N/A</td><td>N/A</td><td> 9535</td><td> 9550</td><td>TATCCCTATCCCTTAC</td><td> 180</td><td> 1147</td>

<td> 1063934</td><td>N/A</td><td>N/A</td><td> 9694</td><td> 9709</td><td>GGCACAAACATGAGGC</td><td> 117</td><td> 1148</td>

<td> 1063966</td><td>N/A</td><td>N/A</td><td> 10310</td><td> 10325</td><td>ACAACTCAGGATCACA</td><td> 62</td><td> 1149</td>

<td> 1063998</td><td>N/A</td><td>N/A</td><td> 10582</td><td> 10597</td><td>CACCTAAACCCCCCTG</td><td> 114</td><td> 1150</td>

<td> 1064030</td><td>N/A</td><td>N/A</td><td> 11157</td><td> 11172</td><td>GTCGGATGATGCCTGG</td><td> 81</td><td> 1151</td>

<td> 1064062</td><td>N/A</td><td>N/A</td><td> 11452</td><td> 11467</td><td>TTGTGAGCGGATGCAT</td><td> 91</td><td> 1152</td>

<td> 1064094</td><td>N/A</td><td>N/A</td><td> 11579</td><td> 11594</td><td>AATATAGTAGCTGGAG</td><td> 43</td><td> 1153</td>

<td> 1064128</td><td>N/A</td><td>N/A</td><td> 11660</td><td> 11675</td><td>CCACCCCGAllllCCl</td><td> 125</td><td> 1154</td>

<td> 1064160</td><td>N/A</td><td>N/A</td><td> 11744</td><td> 11759</td><td>GGATGACAGTCAAGGT</td><td> 50</td><td> 1155</td>

<td> 1064192</td><td>N/A</td><td>N/A</td><td> 11827</td><td> 11842</td><td>TGCCAAAATAGTTCTC</td><td> 88</td><td> 1156</td>

<td> 1064224</td><td>N/A</td><td>N/A</td><td> 11930</td><td> 11945</td><td>CTACAGGCCTGAGATC</td><td> 114</td><td> 1157</td>

<td> 1064256</td><td>N/A</td><td>N/A</td><td> 11996</td><td> 12011</td><td>GGATGAATCAAGCCCC</td><td> 97</td><td> 1158</td>

<td> 1064288</td><td>N/A</td><td>N/A</td><td> 12318</td><td> 12333</td><td>TTGGCATGCTCTGGCC</td><td> 118</td><td> 1159</td>

<td> 1064320</td><td>N/A</td><td>N/A</td><td> 12455</td><td> 12470</td><td>GTTAGAGTAAGAGCTG</td><td> 101</td><td> 1160</td>

<td> 1064352</td><td>N/A</td><td>N/A</td><td> 12639</td><td> 12654</td><td>TTCTGAGAAGGCATTG</td><td> 118</td><td> 1161</td>

<td> 1064384</td><td>N/A</td><td>N/A</td><td> 12822</td><td> 12837</td><td>CAGGGAATTTGATCAG</td><td> 92</td><td> 1162</td>

121

121

one hundred twenty one

<td> 1064416</td><td>N/A</td><td>N/A</td><td> 12961</td><td> 12976</td><td>GATGACTTGGCTTTAG</td><td> 83</td><td> 1163</td>

<td> 1064448</td><td>N/A</td><td>N/A</td><td> 13240</td><td> 13255</td><td>GTATGGTTGTTCTGGG</td><td> 101</td><td> 1164</td>

TABLE 20

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910956</td><td> 1800</td><td> 1815</td><td> 14210</td><td> 14225</td><td>AGTAATCTGTGCGAGC</td><td> 23</td><td> 250</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 40</td><td> 65</td>

<td> 1062016</td><td> 40</td><td> 55</td><td> 440</td><td> 455</td><td>GAAGCCGCAGACCTCT</td><td> 53</td><td> 1165</td>

<td> 1062048</td><td> 156</td><td> 171</td><td>N/A</td><td>N/A</td><td>GCAGGCTTGGTGAAGT</td><td> 48</td><td> 1166</td>

<td> 1062080</td><td> 323</td><td> 338</td><td> 6861</td><td> 6876</td><td>AAGATCTCGGCCCTGG</td><td> 131</td><td> 1167</td>

<td> 1062112</td><td> 484</td><td> 499</td><td> 7549</td><td> 7564</td><td>TGCATGAAATGTGGCC</td><td> 39</td><td> 1168</td>

<td> 1062144</td><td> 662</td><td> 677</td><td> 8239</td><td> 8254</td><td>CCTGGACACCCATTCC</td><td> 42</td><td> 1169</td>

<td> 1062176</td><td> 802</td><td> 817</td><td> 8448</td><td> 8463</td><td>TCTTCGAAGACCTTCT</td><td> 76</td><td> 1170</td>

<td> 1062208</td><td> 981</td><td> 996</td><td> 9776</td><td> 9791</td><td>AAGCCTTGGTCAGTGC</td><td> 92</td><td> 1171</td>

<td> 1062240</td><td> 1112</td><td> 1127</td><td> 11268</td><td> 11283</td><td>CCACAGGTGCCTCCGG</td><td> 49</td><td> 1172</td>

<td> 1062272</td><td> 1261</td><td> 1276</td><td> 13491</td><td> 13506</td><td>ATTCCATTGAGTGTCC</td><td> 74*</td><td> 1173</td>

<td> 1062304</td><td> 1460</td><td> 1475</td><td> 13870</td><td> 13885</td><td>AGGTGTAGGGTTGGAA</td><td> 41</td><td> 1174</td>

<td> 1062336</td><td> 1746</td><td> 1761</td><td> 14156</td><td> 14171</td><td>TGTTTGGCTGCAGGGC</td><td> 19</td><td> 1175</td>

<td> 1062368</td><td> 1900</td><td> 1915</td><td> 14310</td><td> 14325</td><td>TTGAGTGTACTGAGGC</td><td> 3</td><td> 1176</td>

<td> 1062400</td><td> 2068</td><td> 2083</td><td> 14478</td><td> 14493</td><td>AGATCCTGAGGGTACT</td><td> 72</td><td> 1177</td>

<td> 1062432</td><td> 2274</td><td> 2289</td><td>N/A</td><td>N/A</td><td>TGAGGCATGGATCAGG</td><td> 54</td><td> 1178</td>

<td> 1062464</td><td>N/A</td><td>N/A</td><td> 8327</td><td> 8342</td><td>GAGGGCGAGGATCCTT</td><td> 40</td><td> 1179</td>

<td> 1062496</td><td>N/A</td><td>N/A</td><td> 13637</td><td> 13652</td><td>GCCTATGAGCCCAGAC</td><td> 67</td><td> 1180</td>

<td> 1062528</td><td>N/A</td><td>N/A</td><td> 567</td><td> 582</td><td>GAGCAGGGACACTCAC</td><td> 210</td><td> 1181</td>

<td> 1062560</td><td>N/A</td><td>N/A</td><td> 728</td><td> 743</td><td>TAAGTCTTCTGCCATT</td><td> 23</td><td> 1182</td>

<td> 1062592</td><td>N/A</td><td>N/A</td><td> 937</td><td> 952</td><td>GATGAGAGGCATCAAG</td><td> 140</td><td> 1183</td>

<td> 1062624</td><td>N/A</td><td>N/A</td><td> 1142</td><td> 1157</td><td>CAAGAAAAGAGAGCGG</td><td> 39</td><td> 1184</td>

<td> 1062656</td><td>N/A</td><td>N/A</td><td> 1273</td><td> 1288</td><td>TACTAGGGTGAACAGA</td><td> 77</td><td> 1185</td>

<td> 1062689</td><td>N/A</td><td>N/A</td><td> 1393</td><td> 1408</td><td>TACGGTTGACAATGGT</td><td> 36</td><td> 1186</td>

<td> 1062721</td><td>N/A</td><td>N/A</td><td> 1533</td><td> 1548</td><td>CGTGAGCACTTACTTT</td><td> 80</td><td> 1187</td>

<td> 1062753</td><td>N/A</td><td>N/A</td><td> 1750</td><td> 1765</td><td>AACGAGAAACAACCGG</td><td> 26</td><td> 1188</td>

<td> 1062785</td><td>N/A</td><td>N/A</td><td> 1908</td><td> 1923</td><td>CTAGGGTTAGCTTAAG</td><td> 81</td><td> 1189</td>

<td> 1062817</td><td>N/A</td><td>N/A</td><td> 2086</td><td> 2101</td><td>AAGATGAACACCCTAT</td><td> 78</td><td> 1190</td>

<td> 1062849</td><td>N/A</td><td>N/A</td><td> 2260</td><td> 2275</td><td>GACTAACCTATTTGAC</td><td> 66</td><td> 1191</td>

<td> 1062881</td><td>N/A</td><td>N/A</td><td> 2419</td><td> 2434</td><td>AGTCTGGCTCCAGTAC</td><td> 89</td><td> 1192</td>

<td> 1062913</td><td>N/A</td><td>N/A</td><td> 2628</td><td> 2643</td><td>ACACCTAATGCTGATC</td><td> 95</td><td> 1193</td>

<td> 1062945</td><td>N/A</td><td>N/A</td><td> 2763</td><td> 2778</td><td>GATAATTAGGGAGAAG</td><td> 30</td><td> 1194</td>

<td> 1062977</td><td>N/A</td><td>N/A</td><td> 2955</td><td> 2970</td><td>GCTGGGTATTGAATTG</td><td> 75</td><td> 1195</td>

<td> 1063009</td><td>N/A</td><td>N/A</td><td> 3154</td><td> 3169</td><td>ACACAAAGAGCGAGCA</td><td> 119</td><td> 1196</td>

<td> 1063041</td><td>N/A</td><td>N/A</td><td> 3257</td><td> 3272</td><td>GTCTGGTTAAGTCATT</td><td> 67</td><td> 1197</td>

<td> 1063073</td><td>N/A</td><td>N/A</td><td> 3405</td><td> 3420</td><td>TCCCACCTAGAGTCCT</td><td> 78</td><td> 1198</td>

<td> 1063105</td><td>N/A</td><td>N/A</td><td> 3742</td><td> 3757</td><td>GCCATCATCAGACTC</td><td> 34</td><td> 1199</td>

<td> 1063137</td><td>N/A</td><td>N/A</td><td> 3951</td><td> 3966</td><td>CTTCATAGGGCCTCTT</td><td> 35</td><td> 1200</td>

<td> 1063169</td><td>N/A</td><td>N/A</td><td> 4152</td><td> 4167</td><td>GATACTGGGACCCCTG</td><td> 38</td><td> 1201</td>

122

122

One hundred and twenty-two

<td> 1063201</td><td>N/A</td><td>N/A</td><td> 4356</td><td> 4371</td><td>CACCCCACAGGTTTCG</td><td> 46</td><td> 1202</td>

<td> 1063232</td><td>N/A</td><td>N/A</td><td> 4443</td><td> 4458</td><td>CCCAGA llllCCGCC</td><td> 70</td><td> 1203</td>

<td> 1063264</td><td>N/A</td><td>N/A</td><td> 4631</td><td> 4646</td><td>GAGATGATCTGTCTGG</td><td> 47</td><td> 1204</td>

<td> 1063296</td><td>N/A</td><td>N/A</td><td> 4800</td><td> 4815</td><td>ATTTCGGTGCAAATGG</td><td> 54</td><td> 1205</td>

<td> 1063328</td><td>N/A</td><td>N/A</td><td> 5143</td><td> 5158</td><td>GGGCTTAGAACATTAC</td><td> 65</td><td> 1206</td>

<td> 1063360</td><td>N/A</td><td>N/A</td><td> 5416</td><td> 5431</td><td>GAACTCCACTTCTTTC</td><td> 52</td><td> 1207</td>

<td> 1063392</td><td>N/A</td><td>N/A</td><td> 5592</td><td> 5607</td><td>TCCGGGCCCCCTGCTG</td><td> 65</td><td> 1208</td>

<td> 1063424</td><td>N/A</td><td>N/A</td><td> 5769</td><td> 5784</td><td>GCCTGTAGAAGCTTCT</td><td> 97</td><td> 1209</td>

<td> 1063456</td><td>N/A</td><td>N/A</td><td> 5931</td><td> 5946</td><td>TGAAGAGTCTGGCATT</td><td> 179</td><td> 1210</td>

<td> 1063488</td><td>N/A</td><td>N/A</td><td> 6032</td><td> 6047</td><td>Glll lAGCTTGAGCAG</td><td> 31</td><td> 1211</td>

<td> 1063520</td><td>N/A</td><td>N/A</td><td> 6195</td><td> 6210</td><td>TATTGTAACAGTCCTG</td><td> 30</td><td> 1212</td>

<td> 1063552</td><td>N/A</td><td>N/A</td><td> 6381</td><td> 6396</td><td>CCCTCCACTTGAGAGC</td><td> 33</td><td> 1213</td>

<td> 1063584</td><td>N/A</td><td>N/A</td><td> 6589</td><td> 6604</td><td>TTGGCTGGGACATGTC</td><td> 39</td><td> 1214</td>

<td> 1063616</td><td>N/A</td><td>N/A</td><td> 6993</td><td> 7008</td><td>CACAGTAAAGGTCGGC</td><td> 71</td><td> 1215</td>

<td> 1063648</td><td>N/A</td><td>N/A</td><td> 7306</td><td> 7321</td><td>ATCGAGTAACllllllA</td><td> 14</td><td> 1216</td>

<td> 1063680</td><td>N/A</td><td>N/A</td><td> 7430</td><td> 7445</td><td>GGGTGAGAGGCCATCC</td><td> 229</td><td> 1217</td>

<td> 1063712</td><td>N/A</td><td>N/A</td><td> 7876</td><td> 7891</td><td>ATTCAGAATAGCCTAC</td><td> 105</td><td> 1218</td>

<td> 1063744</td><td>N/A</td><td>N/A</td><td> 8018</td><td> 8033</td><td>GACA III GACTAGCT</td><td> 5</td><td> 1219</td>

<td> 1063776</td><td>N/A</td><td>N/A</td><td> 8115</td><td> 8130</td><td>CCTGAGCCTCGAAAAC</td><td> 72</td><td> 1220</td>

<td> 1063807</td><td>N/A</td><td>N/A</td><td> 8599</td><td> 8614</td><td>TTGAACCCACAGTCTC</td><td> 44</td><td> 1221</td>

<td> 1063839</td><td>N/A</td><td>N/A</td><td> 8876</td><td> 8891</td><td>GAATAAGGCTGGCATG</td><td> 90</td><td> 1222</td>

<td> 1063871</td><td>N/A</td><td>N/A</td><td> 9172</td><td> 9187</td><td>TTGGAAGTGTGGTGAG</td><td> 49</td><td> 1223</td>

<td> 1063903</td><td>N/A</td><td>N/A</td><td> 9536</td><td> 9551</td><td>CTATCCCTATCCCTTA</td><td> 56</td><td> 1224</td>

<td> 1063935</td><td>N/A</td><td>N/A</td><td> 9695</td><td> 9710</td><td>TGGCACAAACATGAGG</td><td> 131</td><td> 1225</td>

<td> 1063967</td><td>N/A</td><td>N/A</td><td> 10312</td><td> 10327</td><td>TAACAACTCAGGATCA</td><td> 28</td><td> 1226</td>

<td> 1063999</td><td>N/A</td><td>N/A</td><td> 10583</td><td> 10598</td><td>TCACCCTAAACCCCCCT</td><td> 34</td><td> 1227</td>

<td> 1064031</td><td>N/A</td><td>N/A</td><td> 11159</td><td> 11174</td><td>TTGTCGGATGATGCCT</td><td> 33</td><td> 1228</td>

<td> 1064063</td><td>N/A</td><td>N/A</td><td> 11455</td><td> 11470</td><td>CllllG TGAGCGGATG</td><td> 50</td><td> 1229</td>

<td> 1064095</td><td>N/A</td><td>N/A</td><td> 11580</td><td> 11595</td><td>GAATATAGTAGCTGGA</td><td> 12</td><td> 1230</td>

<td> 1064129</td><td>N/A</td><td>N/A</td><td> 11661</td><td> 11676</td><td>TCCACCCCGAllllCC</td><td> 177</td><td> 1231</td>

<td> 1064161</td><td>N/A</td><td>N/A</td><td> 11747</td><td> 11762</td><td>CCAGGATGACAGTCAA</td><td> 26</td><td> 1232</td>

<td> 1064193</td><td>N/A</td><td>N/A</td><td> 11848</td><td> 11863</td><td>ATTTATTCTTTGCACC</td><td> 75</td><td> 1233</td>

<td> 1064225</td><td>N/A</td><td>N/A</td><td> 11931</td><td> 11946</td><td>TCTACAGGCCTGAGAT</td><td> 77</td><td> 1234</td>

<td> 1064257</td><td>N/A</td><td>N/A</td><td> 12017</td><td> 12032</td><td>AGGAACTCTGTCAGAG</td><td> 39</td><td> 1235</td>

<td> 1064289</td><td>N/A</td><td>N/A</td><td> 12321</td><td> 12336</td><td>AATTTGGCATGCTCTG</td><td> 186</td><td> 1236</td>

<td> 1064321</td><td>N/A</td><td>N/A</td><td> 12456</td><td> 12471</td><td>AGTTAGAGTAAGAGCT</td><td> 160</td><td> 1237</td>

<td> 1064353</td><td>N/A</td><td>N/A</td><td> 12647</td><td> 12662</td><td>GATGAAGGTTCTGAGA</td><td> 39</td><td> 1238</td>

<td> 1064385</td><td>N/A</td><td>N/A</td><td> 12824</td><td> 12839</td><td>GTCAGGGAATTTGATC</td><td> 89</td><td> 1239</td>

<td> 1064417</td><td>N/A</td><td>N/A</td><td> 12965</td><td> 12980</td><td>ATGGGATGACTTGGCT</td><td> 81</td><td> 1240</td>

<td> 1064449</td><td>N/A</td><td>N/A</td><td> 13243</td><td> 13258</td><td>TGGGTATGGTTGTTCT</td><td> 42</td><td> 1241</td>

TABLE 21

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910950</td><td> 1434</td><td> 1449</td><td> 13844</td><td> 13859</td><td>GCCTCTGGCTCCGTTT</td><td> 109</td><td> 94</td>

123

123

One hundred twenty three

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 12</td><td> 65</td>

<td> 1062017</td><td> 44</td><td> 59</td><td> 444</td><td> 459</td><td>TGTGGAAGCCGCAGAC</td><td> 32</td><td> 1242</td>

<td> 1062049</td><td> 161</td><td> 176</td><td>N/A</td><td>N/A</td><td>CAAGGGCAGGCTTGGT</td><td> 120</td><td> 1243</td>

<td> 1062081</td><td> 325</td><td> 340</td><td> 6863</td><td> 6878</td><td>CGAAGATCTCGGCCCT</td><td> 52</td><td> 1244</td>

<td> 1062113</td><td> 486</td><td> 501</td><td> 7551</td><td> 7566</td><td>GGTGCATGAAATGTGG</td><td> 34</td><td> 1245</td>

<td> 1062145</td><td> 663</td><td> 678</td><td> 8240</td><td> 8255</td><td>CCCTGGACACCCATTC</td><td> 57</td><td> 1246</td>

<td> 1062177</td><td> 803</td><td> 818</td><td> 8449</td><td> 8464</td><td>CTCTTCGAAGACCTTC</td><td> 127</td><td> 1247</td>

<td> 1062209</td><td> 982</td><td> 997</td><td> 9777</td><td> 9792</td><td>GAAGCCTTGGTCAGTG</td><td> 35</td><td> 1248</td>

<td> 1062241</td><td> 1116</td><td> 1131</td><td> 11272</td><td> 11287</td><td>TACCCCACAGGTGCCT</td><td> 53</td><td> 1249</td>

<td> 1062273</td><td> 1268</td><td> 1283</td><td> 13498</td><td> 13513</td><td>GTGGTAGATCTCATTG</td><td> 61*</td><td> 1250</td>

<td> 1062305</td><td> 1461</td><td> 1476</td><td> 13871</td><td> 13886</td><td>CAGGTGTAGGGTTGGA</td><td> 18</td><td> 1251</td>

<td> 1062337</td><td> 1756</td><td> 1771</td><td> 14166</td><td> 14181</td><td>GTGAAGGCTCTGTTTG</td><td> 37</td><td> 1252</td>

<td> 1062369</td><td> 1902</td><td> 1917</td><td> 14312</td><td> 14327</td><td>GTTTGAGTGTACTGAG</td><td> 23</td><td> 1253</td>

<td> 1062401</td><td> 2070</td><td> 2085</td><td> 14480</td><td> 14495</td><td>TCAGATCCTGAGGGTA</td><td> 123</td><td> 1254</td>

<td> 1062433</td><td> 2275</td><td> 2290</td><td>N/A</td><td>N/A</td><td>CTGAGGCATGGATCAG</td><td> 36</td><td> 1255</td>

<td> 1062465</td><td>N/A</td><td>N/A</td><td> 8328</td><td> 8343</td><td>GGAGGGCGAGGATCCT</td><td> 100</td><td> 1256</td>

<td> 1062497</td><td>N/A</td><td>N/A</td><td> 13642</td><td> 13657</td><td>AATGTGCCTATGAGCC</td><td> 136</td><td> 1257</td>

<td> 1062529</td><td>N/A</td><td>N/A</td><td> 624</td><td> 639</td><td>CCCGCCGTGCCTACCT</td><td> 21</td><td> 1258</td>

<td> 1062561</td><td>N/A</td><td>N/A</td><td> 740</td><td> 755</td><td>GTACTTCACCTTTAAG</td><td> 33</td><td> 1259</td>

<td> 1062593</td><td>N/A</td><td>N/A</td><td> 938</td><td> 953</td><td>GGATGAGAGGCATCAA</td><td> 54</td><td> 1260</td>

<td> 1062625</td><td>N/A</td><td>N/A</td><td> 1143</td><td> 1158</td><td>GCAAAAAAGAGAGAGCG</td><td> 127</td><td> 1261</td>

<td> 1062657</td><td>N/A</td><td>N/A</td><td> 1274</td><td> 1289</td><td>CTACTAGGGTGAACAG</td><td> 60</td><td> 1262</td>

<td> 1062690</td><td>N/A</td><td>N/A</td><td> 1394</td><td> 1409</td><td>CTACGGTTGACAATGG</td><td> 44</td><td> 1263</td>

<td> 1062722</td><td>N/A</td><td>N/A</td><td> 1570</td><td> 1585</td><td>TCTAATTTGGTTACAG</td><td> 55</td><td> 1264</td>

<td> 1062754</td><td>N/A</td><td>N/A</td><td> 1751</td><td> 1766</td><td>AAACGAGAAACAACCG</td><td> 40</td><td> 1265</td>

<td> 1062786</td><td>N/A</td><td>N/A</td><td> 1910</td><td> 1925</td><td>ACCTAGGGTTAGCTTA</td><td> 93</td><td> 1266</td>

<td> 1062818</td><td>N/A</td><td>N/A</td><td> 2087</td><td> 2102</td><td>TAAGATGAACACCCTA</td><td> 125</td><td> 1267</td>

<td> 1062850</td><td>N/A</td><td>N/A</td><td> 2261</td><td> 2276</td><td>AGACTAACCTATTTGA</td><td> 41</td><td> 1268</td>

<td> 1062882</td><td>N/A</td><td>N/A</td><td> 2436</td><td> 2451</td><td>CTGGGTTTGTCCCAGA</td><td> 119</td><td> 1269</td>

<td> 1062914</td><td>N/A</td><td>N/A</td><td> 2630</td><td> 2645</td><td>TAACACCTAATGCTGA</td><td> 128</td><td> 1270</td>

<td> 1062946</td><td>N/A</td><td>N/A</td><td> 2767</td><td> 2782</td><td>CTGAGATAATTAGGGA</td><td> 52</td><td> 1271</td>

<td> 1062978</td><td>N/A</td><td>N/A</td><td> 2956</td><td> 2971</td><td>GGCTGGGTATTGAATT</td><td> 36</td><td> 1272</td>

<td> 1063010</td><td>N/A</td><td>N/A</td><td> 3155</td><td> 3170</td><td>CACACAAAGAGCGAGC</td><td> 45</td><td> 1273</td>

<td> 1063042</td><td>N/A</td><td>N/A</td><td> 3267</td><td> 3282</td><td>CTTCTACGCTGTCTGG</td><td> 57</td><td> 1274</td>

<td> 1063074</td><td>N/A</td><td>N/A</td><td> 3425</td><td> 3440</td><td>GGAGAGAGCCAGAACC</td><td> 30</td><td> 1275</td>

<td> 1063106</td><td>N/A</td><td>N/A</td><td> 3748</td><td> 3763</td><td>TACAGAGCCCATCATC</td><td> 52</td><td> 1276</td>

<td> 1063138</td><td>N/A</td><td>N/A</td><td> 3968</td><td> 3983</td><td>AGTCAGGCAGCTTGCT</td><td> 42</td><td> 1277</td>

<td> 1063170</td><td>N/A</td><td>N/A</td><td> 4153</td><td> 4168</td><td>AGATACTGGGACCCCT</td><td> 69</td><td> 1278</td>

<td> 1063202</td><td>N/A</td><td>N/A</td><td> 4363</td><td> 4378</td><td>CATCCCCACCCCACA</td><td> 142</td><td> 1279</td>

<td> 1063233</td><td>N/A</td><td>N/A</td><td> 4444</td><td> 4459</td><td>GCCCAGA lllllCCGC</td><td> 51</td><td> 1280</td>

<td> 1063265</td><td>N/A</td><td>N/A</td><td> 4632</td><td> 4647</td><td>GGAGATGATCTGTCTG</td><td> 72</td><td> 1281</td>

<td> 1063297</td><td>N/A</td><td>N/A</td><td> 4801</td><td> 4816</td><td>GATTTCGGTGCAAATG</td><td> 95</td><td> 1282</td>

<td> 1063329</td><td>N/A</td><td>N/A</td><td> 5159</td><td> 5174</td><td>GTTCTTAGTCTCCTGG</td><td> 20</td><td> 1283</td>

<td> 1063361</td><td>N/A</td><td>N/A</td><td> 5418</td><td> 5433</td><td>GAGAACTCCACTTCTT</td><td> 121</td><td> 1284</td>

<td> 1063393</td><td>N/A</td><td>N/A</td><td> 5602</td><td> 5617</td><td>CCACAATGGCTCCGGG</td><td> 51</td><td> 1285</td>

<td> 1063425</td><td>N/A</td><td>N/A</td><td> 5818</td><td> 5833</td><td>AGCATGGCAAGTGACA</td><td> 41</td><td> 1286</td>

<td> 1063457</td><td>N/A</td><td>N/A</td><td> 5932</td><td> 5947</td><td>ATGAAGAGTCTGGCAT</td><td> 130</td><td> 1287</td>

<td> 1063489</td><td>N/A</td><td>N/A</td><td> 6033</td><td> 6048</td><td>GGlll lAGCTTGAGCA</td><td> 63</td><td> 1288</td>

124

124

One hundred twenty four-

<td> 1063521</td><td>N/A</td><td>N/A</td><td> 6196</td><td> 6211</td><td>CTATTGTAACAGTCCT</td><td> 86</td><td> 1289</td>

<td> 1063553</td><td>N/A</td><td>N/A</td><td> 6395</td><td> 6410</td><td>CAATGGTTGTTTCCCCC</td><td> 33</td><td> 1290</td>

<td> 1063585</td><td>N/A</td><td>N/A</td><td> 6592</td><td> 6607</td><td>GCATTGGCTGGGACAT</td><td> 93</td><td> 1291</td>

<td> 1063617</td><td>N/A</td><td>N/A</td><td> 6994</td><td> 7009</td><td>CCACAGTAAAGGTCGG</td><td> 46</td><td> 1292</td>

<td> 1063649</td><td>N/A</td><td>N/A</td><td> 7307</td><td> 7322</td><td>GATCGAGTAACIIII</td><td> 16</td><td> 1293</td>

<td> 1063681</td><td>N/A</td><td>N/A</td><td> 7555</td><td> 7570</td><td>ACCTGGTGCATGAAAT</td><td> 50</td><td> 1294</td>

<td> 1063713</td><td>N/A</td><td>N/A</td><td> 7878</td><td> 7893</td><td>CAATTCAGAATAGCCT</td><td> 53</td><td> 1295</td>

<td> 1063745</td><td>N/A</td><td>N/A</td><td> 8019</td><td> 8034</td><td>TGACAIIIGACTAGC</td><td> 25</td><td> 1296</td>

<td> 1063777</td><td>N/A</td><td>N/A</td><td> 8134</td><td> 8149</td><td>AIIIIGAGCTTCCCAC</td><td> 146</td><td> 1297</td>

<td> 1063808</td><td>N/A</td><td>N/A</td><td> 8600</td><td> 8615</td><td>TTTGAACCCACAGTCT</td><td> 160</td><td> 1298</td>

<td> 1063840</td><td>N/A</td><td>N/A</td><td> 8877</td><td> 8892</td><td>GGAATAAGGCTGGCAT</td><td> 46</td><td> 1299</td>

<td> 1063872</td><td>N/A</td><td>N/A</td><td> 9181</td><td> 9196</td><td>GAGATAATGTTGGAAG</td><td> 97</td><td> 1300</td>

<td> 1063904</td><td>N/A</td><td>N/A</td><td> 9537</td><td> 9552</td><td>ACTATCCCTATCCCTT</td><td> 95</td><td> 1301</td>

<td> 1063936</td><td>N/A</td><td>N/A</td><td> 9787</td><td> 9802</td><td>CACCACAGATGAAGCC</td><td> 48</td><td> 1302</td>

<td> 1063968</td><td>N/A</td><td>N/A</td><td> 10313</td><td> 10328</td><td>TTAACAACTCAGGATC</td><td> 145</td><td> 1303</td>

<td> 1064000</td><td>N/A</td><td>N/A</td><td> 10585</td><td> 10600</td><td>AGTCACCTAAACCCCC</td><td> 87</td><td> 1304</td>

<td> 1064032</td><td>N/A</td><td>N/A</td><td> 11300</td><td> 11315</td><td>TTACCTGGGAATGTGC</td><td> 50</td><td> 1305</td>

<td> 1064064</td><td>N/A</td><td>N/A</td><td> 11456</td><td> 11471</td><td>GCIIIIGTGAGCGGAT</td><td> 27</td><td> 1306</td>

<td> 1064096</td><td>N/A</td><td>N/A</td><td> 11581</td><td> 11596</td><td>CGAATATAGTAGCTGG</td><td> 21</td><td> 1307</td>

<td> 1064130</td><td>N/A</td><td>N/A</td><td> 11662</td><td> 11677</td><td>ATCCACCCCGAIIIIC</td><td> 111</td><td> 1308</td>

<td> 1064162</td><td>N/A</td><td>N/A</td><td> 11769</td><td> 11784</td><td>TGCAAGAGGTTAAATG</td><td> 129</td><td> 1309</td>

<td> 1064194</td><td>N/A</td><td>N/A</td><td> 11861</td><td> 11876</td><td>CATAAGTTGTATCATT</td><td> 116</td><td> 1310</td>

<td> 1064226</td><td>N/A</td><td>N/A</td><td> 11932</td><td> 11947</td><td>GTCTACAGGCCTGAGA</td><td> 51</td><td> 1311</td>

<td> 1064258</td><td>N/A</td><td>N/A</td><td> 12018</td><td> 12033</td><td>GAGGAACTCTGTCAGA</td><td> 122</td><td> 1312</td>

<td> 1064290</td><td>N/A</td><td>N/A</td><td> 12322</td><td> 12337</td><td>GAATTTGGCATGCTCT</td><td> 50</td><td> 1313</td>

<td> 1064322</td><td>N/A</td><td>N/A</td><td> 12457</td><td> 12472</td><td>GAGTTAGAGTAAGAGC</td><td> 51</td><td> 1314</td>

<td> 1064354</td><td>N/A</td><td>N/A</td><td> 12648</td><td> 12663</td><td>GGATGAAGGTTCTGAG</td><td> 89</td><td> 1315</td>

<td> 1064386</td><td>N/A</td><td>N/A</td><td> 12825</td><td> 12840</td><td>GGTCAGGGAATTTGAT</td><td> 134</td><td> 1316</td>

<td> 1064418</td><td>N/A</td><td>N/A</td><td> 13014</td><td> 13029</td><td>TTAAGAGTCAGGCTGG</td><td> 59</td><td> 1317</td>

<td> 1064450</td><td>N/A</td><td>N/A</td><td> 13244</td><td> 13259</td><td>GTGGGTATGGTTGTTC</td><td> 90</td><td> 1318</td>

TABLE 22

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910950</td><td> 1434</td><td> 1449</td><td> 13844</td><td> 13859</td><td>GCCTCTGGCTCCGTTT</td><td> 109</td><td> 94</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 21</td><td> 65</td>

<td> 1062018</td><td> 46</td><td> 61</td><td> 446</td><td> 461</td><td>GGTGTGGAAGCCGCAG</td><td> 49</td><td> 1319</td>

<td> 1062050</td><td> 172</td><td> 187</td><td> 6710</td><td> 6725</td><td>GGGTCCTTGTCCAAGG</td><td> 43</td><td> 1320</td>

<td> 1062082</td><td> 328</td><td> 343</td><td> 6866</td><td> 6881</td><td>CCTCGAAGATCTCGGC</td><td> 112</td><td> 1321</td>

<td> 1062114</td><td> 487</td><td> 502</td><td> 7552</td><td> 7567</td><td>TGGTGCATGAAATGTG</td><td> 137</td><td> 1322</td>

<td> 1062146</td><td> 664</td><td> 679</td><td> 8241</td><td> 8256</td><td>TCCCTGGACACCCATT</td><td> 37</td><td> 1323</td>

<td> 1062178</td><td> 804</td><td> 819</td><td> 8450</td><td> 8465</td><td>GCTCTTCGAAGACCTT</td><td> 35</td><td> 1324</td>

<td> 1062210</td><td> 984</td><td> 999</td><td> 9779</td><td> 9794</td><td>ATGAAGCCTTGGTCAG</td><td> 52</td><td> 1325</td>

<td> 1062242</td><td> 1117</td><td> 1132</td><td> 11273</td><td> 11288</td><td>CTACCCCACAGGTGCC</td><td> 80</td><td> 1326</td>

<td> 1062274</td><td> 1293</td><td> 1308</td><td> 13523</td><td> 13538</td><td>AGAAGGCAAACATGCG</td><td> 41</td><td> 1327</td>

125

125

One hundred twenty-five-

<td> 1062306</td><td> 1463</td><td> 1478</td><td> 13873</td><td> 13888</td><td>GCCAGGTGTAGGGTTG</td><td> 35</td><td> 1328</td>

<td> 1062338</td><td> 1757</td><td> 1772</td><td> 14167</td><td> 14182</td><td>TGTGAAGGCTCTGTTT</td><td> 86</td><td> 1329</td>

<td> 1062370</td><td> 1903</td><td> 1918</td><td> 14313</td><td> 14328</td><td>TGTTTGAGTGTACTGA</td><td> 46</td><td> 1330</td>

<td> 1062402</td><td> 2071</td><td> 2086</td><td> 14481</td><td> 14496</td><td>CTCAGATCCTGAGGGT</td><td> 88</td><td> 1331</td>

<td> 1062434</td><td> 2276</td><td> 2291</td><td>N/A</td><td>N/A</td><td>GCTGAGGCATGGATCA</td><td> 41</td><td> 1332</td>

<td> 1062466</td><td>N/A</td><td>N/A</td><td> 8329</td><td> 8344</td><td>AGGAGGGCGAGGATCC</td><td> 43</td><td> 1333</td>

<td> 1062498</td><td>N/A</td><td>N/A</td><td> 13645</td><td> 13660</td><td>CCCAATGTGCCTATGA</td><td> 55</td><td> 1334</td>

<td> 1062530</td><td>N/A</td><td>N/A</td><td> 643</td><td> 658</td><td>CCAGAGGGCCCCTGAC</td><td> 52</td><td> 1335</td>

<td> 1062562</td><td>N/A</td><td>N/A</td><td> 741</td><td> 756</td><td>AGTACTTCACCTTTAA</td><td> 17</td><td> 1336</td>

<td> 1062594</td><td>N/A</td><td>N/A</td><td> 940</td><td> 955</td><td>AAGGATGAGAGGCATC</td><td> 158</td><td> 1337</td>

<td> 1062626</td><td>N/A</td><td>N/A</td><td> 1180</td><td> 1195</td><td>TAGGCTGGATGCTGGC</td><td> 167</td><td> 1338</td>

<td> 1062658</td><td>N/A</td><td>N/A</td><td> 1276</td><td> 1291</td><td>TGCTACTAGGGTGAAC</td><td> 126</td><td> 1339</td>

<td> 1062691</td><td>N/A</td><td>N/A</td><td> 1395</td><td> 1410</td><td>ACTACGGTTGACAATG</td><td> 39</td><td> 1340</td>

<td> 1062723</td><td>N/A</td><td>N/A</td><td> 1576</td><td> 1591</td><td>CATGATTCTAATTTGG</td><td> 21</td><td> 1341</td>

<td> 1062755</td><td>N/A</td><td>N/A</td><td> 1773</td><td> 1788</td><td>AGTCAGGGATGTTTAT</td><td> 50</td><td> 1342</td>

<td> 1062787</td><td>N/A</td><td>N/A</td><td> 1911</td><td> 1926</td><td>CACCTAGGGTTAGCTT</td><td> 134</td><td> 1343</td>

<td> 1062819</td><td>N/A</td><td>N/A</td><td> 2088</td><td> 2103</td><td>ATAAGATGAACACCCCT</td><td> 42</td><td> 1344</td>

<td> 1062851</td><td>N/A</td><td>N/A</td><td> 2262</td><td> 2277</td><td>AAGACTAACCTATTTG</td><td> 48</td><td> 1345</td>

<td> 1062883</td><td>N/A</td><td>N/A</td><td> 2437</td><td> 2452</td><td>GCTGGGTTTGTCCCAG</td><td> 71</td><td> 1346</td>

<td> 1062915</td><td>N/A</td><td>N/A</td><td> 2632</td><td> 2647</td><td>TTTAAACCCTAATGCT</td><td> 98</td><td> 1347</td>

<td> 1062947</td><td>N/A</td><td>N/A</td><td> 2768</td><td> 2783</td><td>TCTGAGATAATTAGGG</td><td> 101</td><td> 1348</td>

<td> 1062979</td><td>N/A</td><td>N/A</td><td> 2958</td><td> 2973</td><td>ATGGCTGGGTATTGAA</td><td> 24</td><td> 1349</td>

<td> 1063011</td><td>N/A</td><td>N/A</td><td> 3178</td><td> 3193</td><td>GGATACATAGAGACAA</td><td> 57</td><td> 1350</td>

<td> 1063043</td><td>N/A</td><td>N/A</td><td> 3276</td><td> 3291</td><td>GCCAGGGCCCTTCTAC</td><td> 114</td><td> 1351</td>

<td> 1063107</td><td>N/A</td><td>N/A</td><td> 3750</td><td> 3765</td><td>AATACAGAGCCCATCA</td><td> 50</td><td> 1352</td>

<td> 1063139</td><td>N/A</td><td>N/A</td><td> 3971</td><td> 3986</td><td>GAAAGTCAGGCAGCTT</td><td> 43</td><td> 1353</td>

<td> 1063171</td><td>N/A</td><td>N/A</td><td> 4156</td><td> 4171</td><td>CACAGATACTGGGACC</td><td> 60</td><td> 1354</td>

<td> 1063203</td><td>N/A</td><td>N/A</td><td> 4366</td><td> 4381</td><td>GCAGATACCCCACCCCC</td><td> 24</td><td> 1355</td>

<td> 1063234</td><td>N/A</td><td>N/A</td><td> 4449</td><td> 4464</td><td>GACTTGCCCAGAlili</td><td> 28</td><td> 1356</td>

<td> 1063266</td><td>N/A</td><td>N/A</td><td> 4633</td><td> 4648</td><td>TGGAGATGATCTGTCT</td><td> 48</td><td> 1357</td>

<td> 1063298</td><td>N/A</td><td>N/A</td><td> 4802</td><td> 4817</td><td>CGATTTCGGTGCAAAT</td><td> 37</td><td> 1358</td>

<td> 1063330</td><td>N/A</td><td>N/A</td><td> 5160</td><td> 5175</td><td>AGTTCTTAGTCTCCTG</td><td> 9</td><td> 1359</td>

<td> 1063362</td><td>N/A</td><td>N/A</td><td> 5420</td><td> 5435</td><td>TTGAGAACTCCACTTC</td><td> 70</td><td> 1360</td>

<td> 1063394</td><td>N/A</td><td>N/A</td><td> 5606</td><td> 5621</td><td>CCTCCACAATGGCTC</td><td> 28</td><td> 1361</td>

<td> 1063426</td><td>N/A</td><td>N/A</td><td> 5820</td><td> 5835</td><td>CCAGCATGGCAAGTGA</td><td> 46</td><td> 1362</td>

<td> 1063458</td><td>N/A</td><td>N/A</td><td> 5933</td><td> 5948</td><td>CATGAAGAGTCTGGCA</td><td> 32</td><td> 1363</td>

<td> 1063490</td><td>N/A</td><td>N/A</td><td> 6034</td><td> 6049</td><td>GGGT í í TAGCTTGAGC</td><td> 35</td><td> 1364</td>

<td> 1063522</td><td>N/A</td><td>N/A</td><td> 6198</td><td> 6213</td><td>GGCTATTGTAACAGTC</td><td> 112</td><td> 1365</td>

<td> 1063554</td><td>N/A</td><td>N/A</td><td> 6398</td><td> 6413</td><td>GGGCAATGGTTGTTTC</td><td> 82</td><td> 1366</td>

<td> 1063586</td><td>N/A</td><td>N/A</td><td> 6593</td><td> 6608</td><td>GGCATTGGCTGGGACA</td><td> 110</td><td> 1367</td>

<td> 1063618</td><td>N/A</td><td>N/A</td><td> 6996</td><td> 7011</td><td>TGCCACAGTAAAGGTC</td><td> 47</td><td> 1368</td>

<td> 1063650</td><td>N/A</td><td>N/A</td><td> 7308</td><td> 7323</td><td>AGATCGAGTAACllll</td><td> 8</td><td> 1369</td>

<td> 1063682</td><td>N/A</td><td>N/A</td><td> 7556</td><td> 7571</td><td>TACCTGGTGCATGAAA</td><td> 58</td><td> 1370</td>

<td> 1063714</td><td>N/A</td><td>N/A</td><td> 7879</td><td> 7894</td><td>GCAATTCAGAATAGCC</td><td> 49</td><td> 1371</td>

<td> 1063746</td><td>N/A</td><td>N/A</td><td> 8020</td><td> 8035</td><td>CTGACAT TT TGACTAG</td><td> 35</td><td> 1372</td>

<td> 1063778</td><td>N/A</td><td>N/A</td><td> 8146</td><td> 8161</td><td>ACAAGGCCTCTCATTT</td><td> 58</td><td> 1373</td>

<td> 1063809</td><td>N/A</td><td>N/A</td><td> 8623</td><td> 8638</td><td>GCCAGTCAGGGATGGA</td><td> 55</td><td> 1374</td>

<td> 1063841</td><td>N/A</td><td>N/A</td><td> 8878</td><td> 8893</td><td>TGGAATAAGGCTGGCA</td><td> 37</td><td> 1375</td>

126

126

one hundred twenty-six

<td> 1063873</td><td>N/A</td><td>N/A</td><td> 9203</td><td> 9218</td><td>CTTGAGCCTGGCCAGA</td><td> 87</td><td> 1376</td>

<td> 1063905</td><td>N/A</td><td>N/A</td><td> 9539</td><td> 9554</td><td>GCACTATCCCTATCCC</td><td> 16</td><td> 1377</td>

<td> 1063937</td><td>N/A</td><td>N/A</td><td> 9789</td><td> 9804</td><td>CTCACCACAGATGAAG</td><td> 62</td><td> 1378</td>

<td> 1063969</td><td>N/A</td><td>N/A</td><td> 10314</td><td> 10329</td><td>TTTAACAACTCAGGAT</td><td> 72</td><td> 1379</td>

<td> 1064001</td><td>N/A</td><td>N/A</td><td> 10588</td><td> 10603</td><td>GAAAGTCACCTAAACC</td><td> 35</td><td> 1380</td>

<td> 1064033</td><td>N/A</td><td>N/A</td><td> 11302</td><td> 11317</td><td>TCTTACCTGGGAATGT</td><td> 145</td><td> 1381</td>

<td> 1064065</td><td>N/A</td><td>N/A</td><td> 11457</td><td> 11472</td><td>AGCIIIIGTGAGCGGA</td><td> 54</td><td> 1382</td>

<td> 1064097</td><td>N/A</td><td>N/A</td><td> 11582</td><td> 11597</td><td>CCGAATATAGTAGCTG</td><td> 54</td><td> 1383</td>

<td> 1064131</td><td>N/A</td><td>N/A</td><td> 11664</td><td> 11679</td><td>GAATCCACCCCGATTT</td><td> 56</td><td> 1384</td>

<td> 1064163</td><td>N/A</td><td>N/A</td><td> 11771</td><td> 11786</td><td>GATGCAAGAGGTTAAA</td><td> 43</td><td> 1385</td>

<td> 1064195</td><td>N/A</td><td>N/A</td><td> 11863</td><td> 11878</td><td>GACATAAGTTGTATCA</td><td> 87</td><td> 1386</td>

<td> 1064227</td><td>N/A</td><td>N/A</td><td> 11934</td><td> 11949</td><td>GAGTCTACAGGCCTGA</td><td> 38</td><td> 1387</td>

<td> 1064259</td><td>N/A</td><td>N/A</td><td> 12019</td><td> 12034</td><td>GGAGGAACTCTGTCAG</td><td> 41</td><td> 1388</td>

<td> 1064291</td><td>N/A</td><td>N/A</td><td> 12323</td><td> 12338</td><td>AGAATTTGGCATGCTC</td><td> 43</td><td> 1389</td>

<td> 1064323</td><td>N/A</td><td>N/A</td><td> 12458</td><td> 12473</td><td>GGAGTTAGAGTAAGAG</td><td> 76</td><td> 1390</td>

<td> 1064355</td><td>N/A</td><td>N/A</td><td> 12649</td><td> 12664</td><td>AGGATGAAGGTTCTGA</td><td> 77</td><td> 1391</td>

<td> 1064387</td><td>N/A</td><td>N/A</td><td> 12847</td><td> 12862</td><td>TTCGGTGTGGAGTGAG</td><td> 82</td><td> 1392</td>

<td> 1064419</td><td>N/A</td><td>N/A</td><td> 13016</td><td> 13031</td><td>GGTTAAGAGTCAGGCT</td><td> 40</td><td> 1393</td>

<td> 1064451</td><td>N/A</td><td>N/A</td><td> 13245</td><td> 13260</td><td>TGTGGGTATGGTTGTT</td><td> 35</td><td> 1394</td>

TABLE 23

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910950</td><td> 1434</td><td> 1449</td><td> 13844</td><td> 13859</td><td>GCCTCTGGCTCCGTTT</td><td> 200</td><td> 94</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 14</td><td> 65</td>

<td> 1062019</td><td> 49</td><td> 64</td><td> 449</td><td> 464</td><td>TACGGTGTGGAAGCCG</td><td> 65</td><td> 1395</td>

<td> 1062051</td><td> 174</td><td> 189</td><td> 6712</td><td> 6727</td><td>TCGGGTCCTTGTCCAA</td><td> 38</td><td> 1396</td>

<td> 1062083</td><td> 329</td><td> 344</td><td> 6867</td><td> 6882</td><td>GCCTCGAAGATCTCGG</td><td> 67</td><td> 1397</td>

<td> 1062115</td><td> 488</td><td> 503</td><td> 7553</td><td> 7568</td><td>CTGGTGCATGAAATGT</td><td> 62</td><td> 1398</td>

<td> 1062147</td><td> 669</td><td> 684</td><td> 8246</td><td> 8261</td><td>CCGGCTCCCTGGACAC</td><td> 61</td><td> 1399</td>

<td> 1062179</td><td> 810</td><td> 825</td><td> 8456</td><td> 8471</td><td>CCTCTGGCTCTTCGAA</td><td> 148</td><td> 1400</td>

<td> 1062211</td><td> 987</td><td> 1002</td><td> 9782</td><td> 9797</td><td>CAGATGAAGCCTTGGT</td><td> 39</td><td> 1401</td>

<td> 1062243</td><td> 1118</td><td> 1133</td><td> 11274</td><td> 11289</td><td>GCTACCCCACAGGTGC</td><td> 108</td><td> 1402</td>

<td> 1062275</td><td> 1312</td><td> 1327</td><td> 13542</td><td> 13557</td><td>GTGGCAGGATGGTTTC</td><td> 52</td><td> 1403</td>

<td> 1062307</td><td> 1482</td><td> 1497</td><td> 13892</td><td> 13907</td><td>CTTGATCTTGAGGTCA</td><td> 59</td><td> 1404</td>

<td> 1062339</td><td> 1764</td><td> 1779</td><td> 14174</td><td> 14189</td><td>GGCTGGTTGTGAAGGC</td><td> 40</td><td> 1405</td>

<td> 1062371</td><td> 1904</td><td> 1919</td><td> 14314</td><td> 14329</td><td>TTGTTTGAGTGTACTG</td><td> 64</td><td> 1406</td>

<td> 1062403</td><td> 2076</td><td> 2091</td><td> 14486</td><td> 14501</td><td>GGGACCCTCAGATCCTG</td><td> 78</td><td> 1407</td>

<td> 1062435</td><td> 2283</td><td> 2298</td><td>N/A</td><td>N/A</td><td>AGTCTAAGCTGAGGCA</td><td> 68</td><td> 1408</td>

<td> 1062467</td><td>N/A</td><td>N/A</td><td> 8330</td><td> 8345</td><td>TAGGAGGGCGAGGATC</td><td> 90</td><td> 1409</td>

<td> 1062499</td><td>N/A</td><td>N/A</td><td> 13646</td><td> 13661</td><td>CCCCAATGTGCCTATG</td><td> 93</td><td> 1410</td>

<td> 1062531</td><td>N/A</td><td>N/A</td><td> 644</td><td> 659</td><td>ACCAGAGGGCCCCTGA</td><td> 95</td><td> 1411</td>

<td> 1062563</td><td>N/A</td><td>N/A</td><td> 742</td><td> 757</td><td>AAGTACTTCACCTTTTA</td><td> 50</td><td> 1412</td>

<td> 1062595</td><td>N/A</td><td>N/A</td><td> 1002</td><td> 1017</td><td>CGGGAGAAAGAGAGGC</td><td> 38</td><td> 1413</td>

<td> 1062627</td><td>N/A</td><td>N/A</td><td> 1183</td><td> 1198</td><td>CTCTAGGCTGGATGCT</td><td> 65</td><td> 1414</td>

127

127

one hundred twenty seven

<td> 1062659</td><td>N/A</td><td>N/A</td><td> 1287</td><td> 1302</td><td>TGCAATCCTCCTGCTA</td><td> 117</td><td> 1415</td>

<td> 1062692</td><td>N/A</td><td>N/A</td><td> 1397</td><td> 1412</td><td>AAACTACGGTTGACAA</td><td> 71</td><td> 1416</td>

<td> 1062724</td><td>N/A</td><td>N/A</td><td> 1577</td><td> 1592</td><td>GCATGATTCTAATTTG</td><td> 5</td><td> 1417</td>

<td> 1062756</td><td>N/A</td><td>N/A</td><td> 1784</td><td> 1799</td><td>TCCAAGGAAGCAGTCA</td><td> 78</td><td> 1418</td>

<td> 1062788</td><td>N/A</td><td>N/A</td><td> 1914</td><td> 1929</td><td>ACTCACCTAGGGTTAG</td><td> 92</td><td> 1419</td>

<td> 1062820</td><td>N/A</td><td>N/A</td><td> 2089</td><td> 2104</td><td>AATAAGATGAACACCC</td><td> 73</td><td> 1420</td>

<td> 1062852</td><td>N/A</td><td>N/A</td><td> 2305</td><td> 2320</td><td>GGACTTTCTAAGCACA</td><td> 48</td><td> 1421</td>

<td> 1062884</td><td>N/A</td><td>N/A</td><td> 2438</td><td> 2453</td><td>CGCTGGGTTTGTCCCA</td><td> 65</td><td> 1422</td>

<td> 1062916</td><td>N/A</td><td>N/A</td><td> 2634</td><td> 2649</td><td>Gill IAACACCTAATG</td><td> 65</td><td> 1423</td>

<td> 1062948</td><td>N/A</td><td>N/A</td><td> 2790</td><td> 2805</td><td>GGAGTATGGTTTAACA</td><td> 38</td><td> 1424</td>

<td> 1062980</td><td>N/A</td><td>N/A</td><td> 2961</td><td> 2976</td><td>CCCATGGCTGGGTATT</td><td> 109</td><td> 1425</td>

<td> 1063012</td><td>N/A</td><td>N/A</td><td> 3179</td><td> 3194</td><td>GGGATACATAGAGACA</td><td> 78</td><td> 1426</td>

<td> 1063044</td><td>N/A</td><td>N/A</td><td> 3277</td><td> 3292</td><td>GGCCAGGGCCCTTCTA</td><td> 100</td><td> 1427</td>

<td> 1063076</td><td>N/A</td><td>N/A</td><td> 3491</td><td> 3506</td><td>GAATGGTAGCCCAGGT</td><td> 64</td><td> 1428</td>

<td> 1063108</td><td>N/A</td><td>N/A</td><td> 3751</td><td> 3766</td><td>CAATACAGAGCCCATC</td><td> 73</td><td> 1429</td>

<td> 1063140</td><td>N/A</td><td>N/A</td><td> 3972</td><td> 3987</td><td>TGAAAGTCAGGCAGCT</td><td> 73</td><td> 1430</td>

<td> 1063172</td><td>N/A</td><td>N/A</td><td> 4157</td><td> 4172</td><td>CCACAGATACTGGGAC</td><td> 97</td><td> 1431</td>

<td> 1063204</td><td>N/A</td><td>N/A</td><td> 4367</td><td> 4382</td><td>GGCAGATACCCCACCC</td><td> 73</td><td> 1432</td>

<td> 1063235</td><td>N/A</td><td>N/A</td><td> 4450</td><td> 4465</td><td>CGACTTGCCCAGATTT</td><td> 59</td><td> 1433</td>

<td> 1063267</td><td>N/A</td><td>N/A</td><td> 4659</td><td> 4674</td><td>CATAGATACATTCTCA</td><td> 65</td><td> 1434</td>

<td> 1063299</td><td>N/A</td><td>N/A</td><td> 4804</td><td> 4819</td><td>ACCGATTTCGGTGCAA</td><td> 65</td><td> 1435</td>

<td> 1063331</td><td>N/A</td><td>N/A</td><td> 5161</td><td> 5176</td><td>AAGTTCTTAGTCTCCT</td><td> 19</td><td> 1436</td>

<td> 1063363</td><td>N/A</td><td>N/A</td><td> 5421</td><td> 5436</td><td>CTTGAGAACTCCACTT</td><td> 69</td><td> 1437</td>

<td> 1063395</td><td>N/A</td><td>N/A</td><td> 5609</td><td> 5624</td><td>AAGCCCTCCCACAATGG</td><td> 53</td><td> 1438</td>

<td> 1063427</td><td>N/A</td><td>N/A</td><td> 5821</td><td> 5836</td><td>TCCAGCATGGCAAGTG</td><td> 74</td><td> 1439</td>

<td> 1063459</td><td>N/A</td><td>N/A</td><td> 5934</td><td> 5949</td><td>ACATGAAGAGTCTGGC</td><td> 37</td><td> 1440</td>

<td> 1063491</td><td>N/A</td><td>N/A</td><td> 6036</td><td> 6051</td><td>ATGGGT TT IAGCI TGA</td><td> 21</td><td> 1441</td>

<td> 1063523</td><td>N/A</td><td>N/A</td><td> 6199</td><td> 6214</td><td>AGGCTATTGTAACAGT</td><td> 52</td><td> 1442</td>

<td> 1063555</td><td>N/A</td><td>N/A</td><td> 6399</td><td> 6414</td><td>AGGGCAATGGTTGTTT</td><td> 132</td><td> 1443</td>

<td> 1063587</td><td>N/A</td><td>N/A</td><td> 6603</td><td> 6618</td><td>GGTCAAAGCAGGCATT</td><td> 30</td><td> 1444</td>

<td> 1063619</td><td>N/A</td><td>N/A</td><td> 7005</td><td> 7020</td><td>CCCGCCCAGTGCCACA</td><td> 23</td><td> 1445</td>

<td> 1063651</td><td>N/A</td><td>N/A</td><td> 7309</td><td> 7324</td><td>GAGATCGAGTAACTTT</td><td> 27</td><td> 1446</td>

<td> 1063683</td><td>N/A</td><td>N/A</td><td> 7557</td><td> 7572</td><td>ATACCTGGTGCATGAA</td><td> 72</td><td> 1447</td>

<td> 1063715</td><td>N/A</td><td>N/A</td><td> 7880</td><td> 7895</td><td>TGCAATTCAGAATAGC</td><td> 59</td><td> 1448</td>

<td> 1063747</td><td>N/A</td><td>N/A</td><td> 8021</td><td> 8036</td><td>GCTGACA ϋϋ GACTA</td><td> 63</td><td> 1449</td>

<td> 1063779</td><td>N/A</td><td>N/A</td><td> 8147</td><td> 8162</td><td>CACAAGGCCTCTCATT</td><td> 78</td><td> 1450</td>

<td> 1063810</td><td>N/A</td><td>N/A</td><td> 8658</td><td> 8673</td><td>CGAGAGAAGCTAAGTA</td><td> 71</td><td> 1451</td>

<td> 1063842</td><td>N/A</td><td>N/A</td><td> 8879</td><td> 8894</td><td>GTGGAATAAGGCTGGC</td><td> 50</td><td> 1452</td>

<td> 1063874</td><td>N/A</td><td>N/A</td><td> 9210</td><td> 9225</td><td>CTCACCACTTGAGCCT</td><td> 70</td><td> 1453</td>

<td> 1063906</td><td>N/A</td><td>N/A</td><td> 9541</td><td> 9556</td><td>GCGCACTATCCCCTATC</td><td> 74</td><td> 1454</td>

<td> 1063938</td><td>N/A</td><td>N/A</td><td> 9790</td><td> 9805</td><td>GCTCACCACAGATGAA</td><td> 88</td><td> 1455</td>

<td> 1063970</td><td>N/A</td><td>N/A</td><td> 10315</td><td> 10330</td><td>CTTTAACAACTCAGGA</td><td> 57</td><td> 1456</td>

<td> 1064002</td><td>N/A</td><td>N/A</td><td> 10615</td><td> 10630</td><td>CTCTTTACCACCCAAC</td><td> 96</td><td> 1457</td>

<td> 1064034</td><td>N/A</td><td>N/A</td><td> 11304</td><td> 11319</td><td>ATTCTTACCTGGGAAT</td><td> 110</td><td> 1458</td>

<td> 1064066</td><td>N/A</td><td>N/A</td><td> 11458</td><td> 11473</td><td>AAGCIIII GTGAGCGG</td><td> 79</td><td> 1459</td>

<td> 1064098</td><td>N/A</td><td>N/A</td><td> 11583</td><td> 11598</td><td>GCCGAATATAGTAGCT</td><td> 70</td><td> 1460</td>

<td> 1064132</td><td>N/A</td><td>N/A</td><td> 11665</td><td> 11680</td><td>CGAATCCACCCCCGATT</td><td> 114</td><td> 1461</td>

<td> 1064164</td><td>N/A</td><td>N/A</td><td> 11773</td><td> 11788</td><td>AGGATGCAAGAGGTTA</td><td> 45</td><td> 1462</td>

128

128

Hundred twenty eight

<td> 1064196</td><td>N/A</td><td>N/A</td><td> 11865</td><td> 11880</td><td>CTGACATAAGTTGTAT</td><td> 117</td><td> 1463</td>

<td> 1064228</td><td>N/A</td><td>N/A</td><td> 11936</td><td> 11951</td><td>GTGAGTCTACAGGCCT</td><td> 46</td><td> 1464</td>

<td> 1064260</td><td>N/A</td><td>N/A</td><td> 12021</td><td> 12036</td><td>GTGGAGGAACTCTGTC</td><td> 78*</td><td> 1465</td>

<td> 1064292</td><td>N/A</td><td>N/A</td><td> 12325</td><td> 12340</td><td>TCAGAATTTGGCATGC</td><td> 59</td><td> 1466</td>

<td> 1064324</td><td>N/A</td><td>N/A</td><td> 12459</td><td> 12474</td><td>AGGAGTTAGAGTAAGA</td><td> 97</td><td> 1467</td>

<td> 1064356</td><td>N/A</td><td>N/A</td><td> 12650</td><td> 12665</td><td>TAGGATGAAGGTTCTG</td><td> 84</td><td> 1468</td>

<td> 1064388</td><td>N/A</td><td>N/A</td><td> 12848</td><td> 12863</td><td>GTTCGGTGTGGAGTGA</td><td> 82</td><td> 1469</td>

<td> 1064420</td><td>N/A</td><td>N/A</td><td> 13017</td><td> 13032</td><td>GGGTTAAGAGTCAGGC</td><td> 12</td><td> 1470</td>

<td> 1064452</td><td>N/A</td><td>N/A</td><td> 13246</td><td> 13261</td><td>GTGTGGGTATGGTTGT</td><td> 66</td><td> 1471</td>

TABLE 24

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910950</td><td> 1434</td><td> 1449</td><td> 13844</td><td> 13859</td><td>GCCTCTGGCTCCGTTT</td><td> 202</td><td> 94</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 30</td><td> 65</td>

<td> 1062020</td><td> 50</td><td> 65</td><td> 450</td><td> 465</td><td>GTACGGTGTGGAAGCC</td><td> 41</td><td> 1472</td>

<td> 1062052</td><td> 175</td><td> 190</td><td> 6713</td><td> 6728</td><td>ATCGGGTCCTTGTCCA</td><td> 37</td><td> 1473</td>

<td> 1062084</td><td> 330</td><td> 345</td><td> 6868</td><td> 6883</td><td>CGCCTCGAAGATCTCG</td><td> 80</td><td> 1474</td>

<td> 1062116</td><td> 490</td><td> 505</td><td>N/A</td><td>N/A</td><td>AGCTGGTGCATGAAAT</td><td> 104</td><td> 1475</td>

<td> 1062148</td><td> 670</td><td> 685</td><td> 8247</td><td> 8262</td><td>GCCGGCTCCCTGGACA</td><td> 96</td><td> 1476</td>

<td> 1062180</td><td> 811</td><td> 826</td><td> 8457</td><td> 8472</td><td>TCCTCTGGCTCTTCGA</td><td> 100</td><td> 1477</td>

<td> 1062212</td><td> 999</td><td> 1014</td><td>N/A</td><td>N/A</td><td>CGGATGATGCCACAGA</td><td> 101</td><td> 1478</td>

<td> 1062244</td><td> 1120</td><td> 1135</td><td> 11276</td><td> 11291</td><td>TGGCTACCCACAGGT</td><td> 90</td><td> 1479</td>

<td> 1062276</td><td> 1367</td><td> 1382</td><td> 13777</td><td> 13792</td><td>CACCCGCACAAAGCAC</td><td> 111</td><td> 1480</td>

<td> 1062308</td><td> 1484</td><td> 1499</td><td> 13894</td><td> 13909</td><td>TCCTTGATCTTGAGGT</td><td> 113</td><td> 1481</td>

<td> 1062340</td><td> 1790</td><td> 1805</td><td> 14200</td><td> 14215</td><td>GCGAGCAGCTGAGGCA</td><td> 70</td><td> 1482</td>

<td> 1062372</td><td> 1906</td><td> 1921</td><td> 14316</td><td> 14331</td><td>GGTTGTTTGAGTGTAC</td><td> 9</td><td> 1483</td>

<td> 1062404</td><td> 2077</td><td> 2092</td><td> 14487</td><td> 14502</td><td>TGGGACCCTCAGATCCT</td><td> 72</td><td> 1484</td>

<td> 1062436</td><td> 2284</td><td> 2299</td><td>N/A</td><td>N/A</td><td>CAGTCTAAGCTGAGGC</td><td> 42</td><td> 1485</td>

<td> 1062468</td><td>N/A</td><td>N/A</td><td> 8331</td><td> 8346</td><td>ATAGGAGGGCGAGGAT</td><td> 114</td><td> 1486</td>

<td> 1062500</td><td>N/A</td><td>N/A</td><td> 13647</td><td> 13662</td><td>TCCCCAATGTGCCTAT</td><td> 111</td><td> 1487</td>

<td> 1062532</td><td>N/A</td><td>N/A</td><td> 645</td><td> 660</td><td>TACCAGAGGGCCCCTG</td><td> 99</td><td> 1488</td>

<td> 1062564</td><td>N/A</td><td>N/A</td><td> 744</td><td> 759</td><td>TTAAGTACTTCACCTT</td><td> 56</td><td> 1489</td>

<td> 1062596</td><td>N/A</td><td>N/A</td><td> 1006</td><td> 1021</td><td>ATGGCGGGAGAAAGAG</td><td> 36</td><td> 1490</td>

<td> 1062628</td><td>N/A</td><td>N/A</td><td> 1184</td><td> 1199</td><td>GCTCTAGGCTGGATGC</td><td> 107</td><td> 1491</td>

<td> 1062660</td><td>N/A</td><td>N/A</td><td> 1294</td><td> 1309</td><td>GGCACCTTGCAATCCT</td><td> 36</td><td> 1492</td>

<td> 1062693</td><td>N/A</td><td>N/A</td><td> 1398</td><td> 1413</td><td>TAAACTACGGTTGACA</td><td> 114</td><td> 1493</td>

<td> 1062725</td><td>N/A</td><td>N/A</td><td> 1587</td><td> 1602</td><td>CCAATATATAGCATGA</td><td> 22</td><td> 1494</td>

<td> 1062757</td><td>N/A</td><td>N/A</td><td> 1785</td><td> 1800</td><td>ATCCAAGGAAGCAGTC</td><td> 88</td><td> 1495</td>

<td> 1062789</td><td>N/A</td><td>N/A</td><td> 1917</td><td> 1932</td><td>AATACTCACCTAGGGT</td><td> 79</td><td> 1496</td>

<td> 1062821</td><td>N/A</td><td>N/A</td><td> 2107</td><td> 2122</td><td>GCAAATCAATAAGGGA</td><td> 40</td><td> 1497</td>

<td> 1062853</td><td>N/A</td><td>N/A</td><td> 2313</td><td> 2328</td><td>GTAGGAAAGGACTTTC</td><td> 76</td><td> 1498</td>

<td> 1062885</td><td>N/A</td><td>N/A</td><td> 2459</td><td> 2474</td><td>CACACATAGGGCTTGG</td><td> 26</td><td> 1499</td>

<td> 1062917</td><td>N/A</td><td>N/A</td><td> 2638</td><td> 2653</td><td>ATAAG IIIAACACCT</td><td> 56</td><td> 1500</td>

<td> 1062949</td><td>N/A</td><td>N/A</td><td> 2803</td><td> 2818</td><td>ACTGGAGGACCATGGA</td><td> 115</td><td> 1501</td>

129

129

One hundred and twenty nine

<td> 1062981</td><td>N/A</td><td>N/A</td><td> 2987</td><td> 3002</td><td>TAAGAAGGGCAAGGT</td><td> 81</td><td> 1502</td>

<td> 1063013</td><td>N/A</td><td>N/A</td><td> 3180</td><td> 3195</td><td>AGGGATACATAGAGAC</td><td> 88</td><td> 1503</td>

<td> 1063045</td><td>N/A</td><td>N/A</td><td> 3288</td><td> 3303</td><td>GAGTAGACAAGGGCCA</td><td> 82</td><td> 1504</td>

<td> 1063077</td><td>N/A</td><td>N/A</td><td> 3540</td><td> 3555</td><td>GTCCAACCTGTGGGAA</td><td> 118</td><td> 1505</td>

<td> 1063109</td><td>N/A</td><td>N/A</td><td> 3752</td><td> 3767</td><td>CCAATACAGAGCCCAT</td><td> 74</td><td> 1506</td>

<td> 1063141</td><td>N/A</td><td>N/A</td><td> 3986</td><td> 4001</td><td>TCCTTGGAACCATCTG</td><td> 48</td><td> 1507</td>

<td> 1063173</td><td>N/A</td><td>N/A</td><td> 4159</td><td> 4174</td><td>CTCCACAGATACTGGG</td><td> 65</td><td> 1508</td>

<td> 1063205</td><td>N/A</td><td>N/A</td><td> 4368</td><td> 4383</td><td>GGGCAGATACCCCACC</td><td> 92</td><td> 1509</td>

<td> 1063236</td><td>N/A</td><td>N/A</td><td> 4452</td><td> 4467</td><td>CCCGACTTGCCCAGAT</td><td> 67</td><td> 1510</td>

<td> 1063268</td><td>N/A</td><td>N/A</td><td> 4661</td><td> 4676</td><td>AGCATAGATACATTCT</td><td> 32</td><td> 1511</td>

<td> 1063300</td><td>N/A</td><td>N/A</td><td> 4805</td><td> 4820</td><td>TACCGATTTCGGTGCA</td><td> 71</td><td> 1512</td>

<td> 1063332</td><td>N/A</td><td>N/A</td><td> 5162</td><td> 5177</td><td>TAAGTTCTTAGTCTCC</td><td> 24</td><td> 1513</td>

<td> 1063364</td><td>N/A</td><td>N/A</td><td> 5422</td><td> 5437</td><td>ACTTGAGAACTCCACT</td><td> 100</td><td> 1514</td>

<td> 1063396</td><td>N/A</td><td>N/A</td><td> 5611</td><td> 5626</td><td>GAAAGCCCTCCACAAT</td><td> 98</td><td> 1515</td>

<td> 1063428</td><td>N/A</td><td>N/A</td><td> 5822</td><td> 5837</td><td>ATCCAGCATGGCAAGT</td><td> 79</td><td> 1516</td>

<td> 1063460</td><td>N/A</td><td>N/A</td><td> 5935</td><td> 5950</td><td>GACATGAAGAGTCTGG</td><td> 58</td><td> 1517</td>

<td> 1063492</td><td>N/A</td><td>N/A</td><td> 6037</td><td> 6052</td><td>CATGGGI 1 1 IAGCI IG</td><td> 78</td><td> 1518</td>

<td> 1063524</td><td>N/A</td><td>N/A</td><td> 6200</td><td> 6215</td><td>GAGGCTATTGTAACAG</td><td> 53</td><td> 1519</td>

<td> 1063556</td><td>N/A</td><td>N/A</td><td> 6400</td><td> 6415</td><td>GAGGGCAATGGTTGTT</td><td> 38</td><td> 1520</td>

<td> 1063588</td><td>N/A</td><td>N/A</td><td> 6635</td><td> 6650</td><td>CTCGACCACCTGAGCC</td><td> 133</td><td> 1521</td>

<td> 1063620</td><td>N/A</td><td>N/A</td><td> 7036</td><td> 7051</td><td>AACCACTTCCTGTGCC</td><td> 85</td><td> 1522</td>

<td> 1063652</td><td>N/A</td><td>N/A</td><td> 7310</td><td> 7325</td><td>GGAGATCGAGTAACTT</td><td> 22</td><td> 1523</td>

<td> 1063684</td><td>N/A</td><td>N/A</td><td> 7558</td><td> 7573</td><td>CATACCTGGTGCATGA</td><td> 97</td><td> 1524</td>

<td> 1063716</td><td>N/A</td><td>N/A</td><td> 7881</td><td> 7896</td><td>CTGCAATTCAGAATAG</td><td> 66</td><td> 1525</td>

<td> 1063748</td><td>N/A</td><td>N/A</td><td> 8028</td><td> 8043</td><td>CGCAGGTGCTGACATT</td><td> 56</td><td> 1526</td>

<td> 1063780</td><td>N/A</td><td>N/A</td><td> 8148</td><td> 8163</td><td>CCACAAGGCCTCTCAT</td><td> 149</td><td> 1527</td>

<td> 1063811</td><td>N/A</td><td>N/A</td><td> 8659</td><td> 8674</td><td>TCGAGAGAAGCTAAGT</td><td> 112</td><td> 1528</td>

<td> 1063843</td><td>N/A</td><td>N/A</td><td> 8887</td><td> 8902</td><td>TGGGAACAGTGGAATA</td><td> 66</td><td> 1529</td>

<td> 1063875</td><td>N/A</td><td>N/A</td><td> 9211</td><td> 9226</td><td>ACTCACCACTTGAGCC</td><td> 101</td><td> 1530</td>

<td> 1063907</td><td>N/A</td><td>N/A</td><td> 9542</td><td> 9557</td><td>TGCGCACTATCCCTAT</td><td> 92</td><td> 1531</td>

<td> 1063939</td><td>N/A</td><td>N/A</td><td> 9793</td><td> 9808</td><td>GTCGCTCACCACAGAT</td><td> 66</td><td> 1532</td>

<td> 1063971</td><td>N/A</td><td>N/A</td><td> 10341</td><td> 10356</td><td>CTGGCAAGTCTGGCTA</td><td> 61</td><td> 1533</td>

<td> 1064003</td><td>N/A</td><td>N/A</td><td> 10616</td><td> 10631</td><td>GCTCTTTACCACCCAA</td><td> 63</td><td> 1534</td>

<td> 1064035</td><td>N/A</td><td>N/A</td><td> 11305</td><td> 11320</td><td>CATTCTTACCTGGGAA</td><td> 99</td><td> 1535</td>

<td> 1064067</td><td>N/A</td><td>N/A</td><td> 11460</td><td> 11475</td><td>GGAAGCIIIIGIGAGC</td><td> 56</td><td> 1536</td>

<td> 1064099</td><td>N/A</td><td>N/A</td><td> 11584</td><td> 11599</td><td>GGCCGAATATAGTAGC</td><td> 98</td><td> 1537</td>

<td> 1064133</td><td>N/A</td><td>N/A</td><td> 11666</td><td> 11681</td><td>GCGAATCCACCCCGAT</td><td> 63</td><td> 1538</td>

<td> 1064165</td><td>N/A</td><td>N/A</td><td> 11774</td><td> 11789</td><td>AAGGATGCAAGAGGTT</td><td> 78</td><td> 1539</td>

<td> 1064197</td><td>N/A</td><td>N/A</td><td> 11866</td><td> 11881</td><td>CCTGACATAAGTTGTA</td><td> 86</td><td> 1540</td>

<td> 1064229</td><td>N/A</td><td>N/A</td><td> 11941</td><td> 11956</td><td>ACAAGGTGAGTCTACA</td><td> 144</td><td> 1541</td>

<td> 1064261</td><td>N/A</td><td>N/A</td><td> 12089</td><td> 12104</td><td>ACCCAGCGGATGAGCG</td><td> 39*</td><td> 1542</td>

<td> 1064293</td><td>N/A</td><td>N/A</td><td> 12326</td><td> 12341</td><td>GTCAGAATTTGGCATG</td><td> 75</td><td> 1543</td>

<td> 1064325</td><td>N/A</td><td>N/A</td><td> 12460</td><td> 12475</td><td>AAGGAGTTAGAGTAAG</td><td> 171</td><td> 1544</td>

<td> 1064357</td><td>N/A</td><td>N/A</td><td> 12651</td><td> 12666</td><td>CTAGGATGAAGGTTCT</td><td> 55</td><td> 1545</td>

<td> 1064389</td><td>N/A</td><td>N/A</td><td> 12849</td><td> 12864</td><td>GGTTCGGTGTGGAGTG</td><td> 98</td><td> 1546</td>

<td> 1064421</td><td>N/A</td><td>N/A</td><td> 13018</td><td> 13033</td><td>TGGGTTAAGAGTCAGG</td><td> 32</td><td> 1547</td>

<td> 1064453</td><td>N/A</td><td>N/A</td><td> 13256</td><td> 13271</td><td>GGTTAGATGGGTGTGG</td><td> 82</td><td> 1548</td>

130

130

One hundred thirty·

TABLE 25

INHIBITION OF FOXP3 MRNA BY 3-10-3 CET GAPMERS

WHICH HAVE SEQ ID NO: 1 AND 2 AS A TARGET

<td>compound number</td><td>SEQ ID NO: 1 Start site</td><td>SEQ ID NO: 1 Termination site</td><td>SEQ ID NO: 2 Start site</td><td>SEQ ID NO: 2 Termination site</td><td>Sequence (5' to 3')</td><td>FOXP3 (% of UTC)</td><td>SEQ ID NO</td>

<td> 910950</td><td> 1434</td><td> 1449</td><td> 13844</td><td> 13859</td><td>GCCTCTGGCTCCGTTT</td><td> 93</td><td> 94</td>

<td> 911144</td><td>N/A</td><td>N/A</td><td> 7355</td><td> 7370</td><td>TGCTATGATCATCCCC</td><td> 49</td><td> 65</td>

<td> 1062021</td><td> 51</td><td> 66</td><td> 451</td><td> 466</td><td>TGTACGGTGTGGAAGC</td><td> 40</td><td> 1549</td>

<td> 1062053</td><td> 176</td><td> 191</td><td> 6714</td><td> 6729</td><td>CATCGGGTCCTTGTCC</td><td> 81</td><td> 1550</td>

<td> 1062085</td><td> 331</td><td> 346</td><td> 6869</td><td> 6884</td><td>CCGCCTCGAAGATCTC</td><td> 67</td><td> 1551</td>

<td> 1062117</td><td> 494</td><td> 509</td><td>N/A</td><td>N/A</td><td>TGAGAGCTGGTGCATG</td><td> 129</td><td> 1552</td>

<td> 1062149</td><td> 672</td><td> 687</td><td> 8249</td><td> 8264</td><td>GTGCCGGCTCCCTGGA</td><td> 83</td><td> 1553</td>

<td> 1062181</td><td> 816</td><td> 831</td><td> 8462</td><td> 8477</td><td>GGAAGTCCTCTGGCTC</td><td> 98</td><td> 1554</td>

<td> 1062213</td><td> 1001</td><td> 1016</td><td>N/A</td><td>N/A</td><td>GTCGGATGATGCCACA</td><td> 85</td><td> 1555</td>

<td> 1062245</td><td> 1124</td><td> 1139</td><td> 11280</td><td> 11295</td><td>TCCATGGCTACCCCAC</td><td> 115</td><td> 1556</td>

<td> 1062277</td><td> 1368</td><td> 1383</td><td> 13778</td><td> 13793</td><td>CCACCCGCACAAAGCA</td><td> 114</td><td> 1557</td>

<td> 1062309</td><td> 1485</td><td> 1500</td><td> 13895</td><td> 13910</td><td>TTCCTTGATCTTGAGG</td><td> 89</td><td> 1558</td>

<td> 1062341</td><td> 1791</td><td> 1806</td><td> 14201</td><td> 14216</td><td>TGCGAGCAGCTGAGGC</td><td> 72</td><td> 1559</td>

<td> 1062373</td><td> 1907</td><td> 1922</td><td> 14317</td><td> 14332</td><td>AGGTTGTTTGAGTGTA</td><td> 8</td><td> 1560</td>

<td> 1062405</td><td> 2078</td><td> 2093</td><td> 14488</td><td> 14503</td><td>TTGGGACCTCAGATCC</td><td> 72</td><td> 1561</td>

<td> 1062437</td><td> 2285</td><td> 2300</td><td>N/A</td><td>N/A</td><td>GCAGTCTAAGCTGAGG</td><td> 66</td><td> 1562</td>

<td> 1062469</td><td>N/A</td><td>N/A</td><td> 8332</td><td> 8347</td><td>GATAGGAGGGCGAGGA</td><td> 128</td><td> 1563</td>

<td> 1062501</td><td>N/A</td><td>N/A</td><td> 13648</td><td> 13663</td><td>CTCCCCAATGTGCCTA</td><td> 87</td><td> 1564</td>

<td> 1062533</td><td>N/A</td><td>N/A</td><td> 663</td><td> 678</td><td>GCTGGGTACATCCCAC</td><td> 127</td><td> 1565</td>

<td> 1062565</td><td>N/A</td><td>N/A</td><td> 746</td><td> 761</td><td>CATTAAGTACTTCACC</td><td> 104</td><td> 1566</td>

<td> 1062597</td><td>N/A</td><td>N/A</td><td> 1007</td><td> 1022</td><td>GATGGCGGGAGAAAGA</td><td> 96</td><td> 1567</td>

<td> 1062629</td><td>N/A</td><td>N/A</td><td> 1185</td><td> 1200</td><td>AGCTCTAGGCTGGATG</td><td> 108</td><td> 1568</td>

<td> 1062661</td><td>N/A</td><td>N/A</td><td> 1297</td><td> 1312</td><td>CCCGGCACCTTGCAAT</td><td> 87</td><td> 1569</td>

<td> 1062694</td><td>N/A</td><td>N/A</td><td> 1399</td><td> 1414</td><td>CTAAACTACGGTTGAC</td><td> 107</td><td> 1570</td>

<td> 1062726</td><td>N/A</td><td>N/A</td><td> 1613</td><td> 1628</td><td>GTTAATTGAATAAAGC</td><td> 113</td><td> 1571</td>

<td> 1062758</td><td>N/A</td><td>N/A</td><td> 1797</td><td> 1812</td><td>CCCIIIICAGGAATCC</td><td> 81</td><td> 1572</td>

<td> 1062790</td><td>N/A</td><td>N/A</td><td> 1918</td><td> 1933</td><td>TAATACTCACCTAGGG</td><td> 99</td><td> 1573</td>

<td> 1062822</td><td>N/A</td><td>N/A</td><td> 2109</td><td> 2124</td><td>TGGCAAATCAATAAGG</td><td> 95</td><td> 1574</td>

<td> 1062854</td><td>N/A</td><td>N/A</td><td> 2316</td><td> 2331</td><td>CAAGTAGGAAAGGACT</td><td> 101</td><td> 1575</td>

<td> 1062886</td><td>N/A</td><td>N/A</td><td> 2460</td><td> 2475</td><td>TCACACATAGGGCTTG</td><td> 59</td><td> 1576</td>

<td> 1062918</td><td>N/A</td><td>N/A</td><td> 2649</td><td> 2664</td><td>CCATTCAAGATATAAG</td><td> 50</td><td> 1577</td>

<td> 1062950</td><td>N/A</td><td>N/A</td><td> 2804</td><td> 2819</td><td>AACTGGAGGACCATGG</td><td> 115</td><td> 1578</td>

<td> 1062982</td><td>N/A</td><td>N/A</td><td> 3017</td><td> 3032</td><td>TCAACTGATGCTGCCT</td><td> 53</td><td> 1579</td>

<td> 1063014</td><td>N/A</td><td>N/A</td><td> 3181</td><td> 3196</td><td>TAGGGATACATAGAGA</td><td> 121</td><td> 1580</td>

<td> 1063046</td><td>N/A</td><td>N/A</td><td> 3308</td><td> 3323</td><td>ACTGAGCACGGAGAGG</td><td> 100</td><td> 1581</td>

<td> 1063078</td><td>N/A</td><td>N/A</td><td> 3562</td><td> 3577</td><td>CCCCACACTGTGATCG</td><td> 76</td><td> 1582</td>

<td> 1063110</td><td>N/A</td><td>N/A</td><td> 3754</td><td> 3769</td><td>CGCCAATACAGAGCCC</td><td> 109</td><td> 1583</td>

<td> 1063142</td><td>N/A</td><td>N/A</td><td> 3987</td><td> 4002</td><td>CTCCTTGGAACCATCT</td><td> 56</td><td> 1584</td>

<td> 1063174</td><td>N/A</td><td>N/A</td><td> 4163</td><td> 4178</td><td>CAGGCTCCACAGATAC</td><td> 85</td><td> 1585</td>

<td> 1063206</td><td>N/A</td><td>N/A</td><td> 4369</td><td> 4384</td><td>AGGGCAGATACCCCAC</td><td> 158</td><td> 1586</td>

131

131

One hundred thirty one

<td> 1063237</td><td>N/A</td><td>N/A</td><td> 4454</td><td> 4469</td><td>CCCCCGACTTGCCCAG</td><td> 32</td><td> 1587</td>

<td> 1063269</td><td>N/A</td><td>N/A</td><td> 4662</td><td> 4677</td><td>AAGCATAGATACATTC</td><td> 69</td><td> 1588</td>

<td> 1063301</td><td>N/A</td><td>N/A</td><td> 4806</td><td> 4821</td><td>ATACCGATTTCGGTGC</td><td> 119</td><td> 1589</td>

<td> 1063333</td><td>N/A</td><td>N/A</td><td> 5163</td><td> 5178</td><td>TTAAGTTCTTAGTCTC</td><td> 39</td><td> 1590</td>

<td> 1063365</td><td>N/A</td><td>N/A</td><td> 5423</td><td> 5438</td><td>GACTTGAGAACTCCAC</td><td> 110</td><td> 1591</td>

<td> 1063397</td><td>N/A</td><td>N/A</td><td> 5613</td><td> 5628</td><td>TTGAAAGCCCTCCACA</td><td> 119</td><td> 1592</td>

<td> 1063429</td><td>N/A</td><td>N/A</td><td> 5826</td><td> 5841</td><td>ACGGATCCAGCATGGC</td><td> 35</td><td> 1593</td>

<td> 1063461</td><td>N/A</td><td>N/A</td><td> 5936</td><td> 5951</td><td>AGACATGAAGAGTCTG</td><td> 114</td><td> 1594</td>

<td> 1063493</td><td>N/A</td><td>N/A</td><td> 6048</td><td> 6063</td><td>AGTCAAAGTGACATGG</td><td> 71</td><td> 1595</td>

<td> 1063525</td><td>N/A</td><td>N/A</td><td> 6202</td><td> 6217</td><td>AGGAGGCTATTGTAAC</td><td> 85</td><td> 1596</td>

<td> 1063557</td><td>N/A</td><td>N/A</td><td> 6401</td><td> 6416</td><td>TGAGGGCAATGGTTGT</td><td> 79</td><td> 1597</td>

<td> 1063589</td><td>N/A</td><td>N/A</td><td> 6636</td><td> 6651</td><td>ACTCGACCACCTGAGC</td><td> 140</td><td> 1598</td>

<td> 1063621</td><td>N/A</td><td>N/A</td><td> 7043</td><td> 7058</td><td>ACCCAGAAACCACTTC</td><td> 112</td><td> 1599</td>

<td> 1063653</td><td>N/A</td><td>N/A</td><td> 7311</td><td> 7326</td><td>TGGAGATCGAGTAACT</td><td> 23</td><td> 1600</td>

<td> 1063685</td><td>N/A</td><td>N/A</td><td> 7559</td><td> 7574</td><td>CCATACCTGGTGCATG</td><td> 117</td><td> 1601</td>

<td> 1063717</td><td>N/A</td><td>N/A</td><td> 7888</td><td> 7903</td><td>CAGAGTACTGCAATTC</td><td> 73</td><td> 1602</td>

<td> 1063749</td><td>N/A</td><td>N/A</td><td> 8029</td><td> 8044</td><td>TCGCAGGTGCTGACAT</td><td> 97</td><td> 1603</td>

<td> 1063781</td><td>N/A</td><td>N/A</td><td> 8185</td><td> 8200</td><td>ACCTATGGAGGCTGTG</td><td> 78</td><td> 1604</td>

<td> 1063812</td><td>N/A</td><td>N/A</td><td> 8662</td><td> 8677</td><td>AGGTCGAGAGAAGCTA</td><td> 131</td><td> 1605</td>

<td> 1063844</td><td>N/A</td><td>N/A</td><td> 8888</td><td> 8903</td><td>TTGGGAACAGTGGAAT</td><td> 119</td><td> 1606</td>

<td> 1063876</td><td>N/A</td><td>N/A</td><td> 9228</td><td> 9243</td><td>CTGCATGTCAGGCCTG</td><td> 85</td><td> 1607</td>

<td> 1063908</td><td>N/A</td><td>N/A</td><td> 9543</td><td> 9558</td><td>TTGCGCACTATCCCTA</td><td> 51</td><td> 1608</td>

<td> 1063940</td><td>N/A</td><td>N/A</td><td> 9794</td><td> 9809</td><td>GGTCGCTCACCACAGA</td><td> 73</td><td> 1609</td>

<td> 1063972</td><td>N/A</td><td>N/A</td><td> 10373</td><td> 10388</td><td>CATAGCTGGTCCTGCT</td><td> 61</td><td> 1610</td>

<td> 1064004</td><td>N/A</td><td>N/A</td><td> 10621</td><td> 10636</td><td>ATAGGGCTCTTTACCA</td><td> 83</td><td> 1611</td>

<td> 1064036</td><td>N/A</td><td>N/A</td><td> 11306</td><td> 11321</td><td>CCATTCTTACCTGGGA</td><td> 110</td><td> 1612</td>

<td> 1064068</td><td>N/A</td><td>N/A</td><td> 11465</td><td> 11480</td><td>CGAAAGGAAGCIIIIG</td><td> 152</td><td> 1613</td>