Human anti-il-23 antibodies, compositions, methods and uses

TECHNICAL MEMORY

HUMAN ANTI-IL-23 ANTIBODIES, COMPOSITIONS, METHODS AND USES

FIELD OF THE INVENTION

The present invention relates to antibodies, including the specified portions or variants, specific for at least one IL-23 protein or a fragment thereof, as well as anti-idiotype antibodies and nucleic acids encoding such anti-IL antibodies. -23p19, complementary nucleic acids, vectors, host cells and methods of preparation and use thereof, including therapeutic formulations, administration and devices.

BACKGROUND OF THE INVENTION

Interleukin (IL)-12 is a secreted heterodimeric cytokine comprising 2 disulfide-linked glycosylated protein subunits, designated p35 and p40 for their approximate molecular weights. IL-12 is produced primarily by antigen-presenting cells, and drives cell-mediated immunity by binding to a two-chain receptor complex, which is expressed on the surface of T cells or natural killer (NK) cells. The IL-12 receptor beta 1 chain, (IL-12Rp1) binds to the p40 subunit of IL-12, providing the primary interaction between IL-12 and its receptor. However, it is IL-12p35 ligation of the second chain of the receptor, IL-12Rp2, that confers intracellular signaling (eg, STAT4 phosphorylation) and activation of the receptor-bearing cell (Presky et al. , nineteen ninety six). IL-12 signaling concurrently with antigen presentation is thought to invoke T cell differentiation to the T1 helper (Th1) phenotype, characterized by interferon gamma (IFN) production._k) (Trinchieri, 2003). Th1 cells are believed to promote immunity to certain intracellular pathogens, generate complement-fixing antibody isotypes, and contribute to immune surveillance of tumors. Thus, IL-12 is thought to be a significant component for host immune defense mechanisms.

It was discovered that the p40 protein subunit of IL-12 can also associate with a separate protein subunit, designated p19, to form a novel cytokine, IL-23 (Oppman et al. 2000). IL-23 also signals via a two-chain receptor complex. Since the p40 subunit is shared between IL-12 and IL-23, it follows that the IL-12Rpi chain is also shared between IL-12 and IL-23. However, it is IL-23p19 ligation of the second component of the IL-23 receptor complex, IL-23R, that confers IL-23-specific intracellular signaling (eg, STAT3 phosphorylation) and subsequent IL-17 production. by T cells (Parham et al., 2002; Aggarwal et al., 2003). Recent studies have shown that the biological functions of IL-23 are distinct from IL-12, despite the structural similarity between the two cytokines (Langrish et al., 2005).

Abnormal regulation of IL-12 and Th1 cell populations has been associated with many immune-mediated diseases, since neutralization of IL-12 by antibodies is effective in treating animal models of psoriasis, multiple sclerosis (MS), arthritis rheumatoid, inflammatory bowel disease, insulin-dependent (type 1) diabetes mellitus, and uveitis (Leonard et al., 1995; Hong et al., 1999; Malfait et al., 1998; Davidson et al., 1998). However, since these studies were directed at the shared p40 subunit, both IL-12 and IL-23 were neutralized in vivo. Therefore, it is not clear whether IL-23 or IL-12 mediate disease, or whether both cytokines need to be inhibited to suppress disease. Recent studies have confirmed using IL-23p19-deficient mice or IL-23-specific antibody neutralization, that IL-23 inhibition may provide equivalent benefit to anti-IL-12p40 strategies (Cua et al., 2003, Murphy et al., 2003). others, 2003, Benson et al., 2004). Therefore, there is increasing evidence for the specific role of IL-23 in immune-mediated disease. Neutralization of IL-23 without inhibiting IL-12 pathways could then be an effective therapy for immune-mediated disease with limited impact on the important immune mechanism of host defense. This would represent a significant improvement over current therapeutic options.

BRIEF DESCRIPTION OF THE INVENTION

The present invention provides isolated mammalian, including without limitation human, antibodies that bind to the p19 subunit of IL-23, anti-IL-23p19 antibodies (also referred to as IL-23p19 antibodies), immunoglobulins, fragments, cut and other specified portions and variants thereof, as well as anti-IL-23p19 antibody compositions, anti-IL-23p19 idiotype antibodies, antisense or antisense nucleic acids, vectors, host cells compositions, combinations, formulations, devices, transgenic animals, transgenic plants, and methods of preparation and use thereof.

In one aspect, the present invention provides isolated nucleic acid molecules that comprise, are complementary to, or hybridize to, a polynucleotide encoding specific anti-IL-23p19 antibodies or anti-idiotype antibodies, comprising at least one specified sequence, domain , portion or variant thereof. The present invention also provides recombinant vectors comprising said anti-IL-23p19 antibody nucleic acid molecules, host cells containing said nucleic acids and/or recombinant vectors, as well as methods of preparation and/or use of said nucleic acids. antibody, vectors and/or host cells.

The present invention also provides at least one method of expressing at least one anti-IL-23p19 antibody or anti-IL-23p19 idiotype antibody, in a host cell, comprising culturing a host cell as described herein, under conditions where at least one anti-IL-23p19 antibody is expressed in detectable and/or recoverable amounts.

The present invention also provides at least one composition comprising (a) an isolated nucleic acid encoding the anti-IL-23p19 antibody and/or the antibody described herein; and (b) a suitable and/or pharmaceutically acceptable carrier or diluent.

The present invention also provides at least one anti-IL-23p19 antibody method or composition for delivering a therapeutically effective amount to modulate or treat at least one IL-23p19-related condition in a cell, tissue, organ, animal, or patient, and/or before, during, or after a related condition, as known and/or as described herein.

The present invention also provides at least one composition, device and/or method of delivering a therapeutically or prophylactically effective amount of at least one anti-IL23p19 antibody according to the present invention.

The present invention also provides at least one anti-IL-23p 19 antibody method or composition for diagnosing at least one IL-23 related condition in a cell, tissue, organ, animal or patient and/or, before, after , or during a related condition, as known and/or as described herein.

The present invention also provides at least one composition, device and/or delivery method for the diagnosis of at least one anti-IL-23p19 antibody according to the present invention.

Also provided is a medical device comprising at least one isolated mammalian anti-IL23p19 antibody, wherein the device is suitable for contacting or administering the anti-IL-23p19 antibody, the anti-idiotypic IL-23p19 antibody , the nucleic acid molecule, compound, protein and/or composition.

Also provided is an article of manufacture for pharmaceutical or diagnostic use in humans, comprising packaging material and a container comprising a solution or lyophilized form of at least one isolated anti-IL-23p19 antibody of the present invention. Optionally the article of manufacture may have the container as a component of a delivery device or system.

Furthermore, the present invention provides any invention described herein.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1A shows that human IL-23p19 antibodies specifically bind to hrlL23 but not to hrlL-12 or the hrp40 monomer. An anti-IL-12/IL-23 p40 antibody is shown to bind IL-23, IL-12 and the p40 monomer.

Figure 1B shows that human IL-23p19 antibodies bind human IL-23 but not murine IL-23 or its subunits.

Figure 2 shows the binding of IL-23 to two of the IL-23p19 antibodies of the invention immobilized on a plate.

Figure 3A shows that MOR04083 and MOR04190 antibodies block normal IL-23/IL-23R binding.

Figure 3B shows that MOR04083 and MOR04190 antibodies do not block normal IL-23/IL-12β1 binding.

Figure 3C shows that the MOR04083, MOR04190 and MOR04217 antibodies do not inhibit the binding of IL-12 to IL-2Rpi-Fe.

Figure 4 shows that the IL-23p19 antibodies of the invention MOR04083 and MOR04190 inhibit hrlL-23-mediated STAT 3 phosphorylation.

Figure 5A shows that the IL-23p19 antibodies of the invention MOR04083 and MOR04190 inhibit recombinant hrlL-23 mediated IL-17 production.

Figure 5B shows that the IL-23p19 antibodies of the invention MOR04083 and MOR04190 inhibit native hrlL-23-mediated IL-17 production.

Figure 5C shows that the IL-23p19 antibodies of the invention MOR04083 and MOR04190 inhibit native IL-23-mediated IL-17 production from the cynomolgus monkey.

Figure 6 shows that the IL-23p19 antibodies of the invention MOR04083 and MOR04190 do not inhibit hrlL-12-mediated IFN^ production.

Figures 7A-7C show that the IL-23p19 antibodies of the invention MOR04083, MOR04190 and MOR04217 compete cross-competing with each other for binding to hulL-23.

Figure 8 shows that the IL-23p19 antibodies of the invention MOR05028, 05038, 05040, 05042, 05045, 05049, and 05053 inhibit recombinant hrlL-23-mediated IL-17 production.

Figure 9 shows that the IL-23p19 antibodies of the invention MOR05028, 05038, 05040, 05042, 05045, 05049, and 05053 block the normal invention of IL-23/IL-23R.

Figure 10 shows that the IL-23p19 antibodies of the invention 5040^aEV and 3759^EQ/QSof the invention specifically bind to hrlL-23 but not to hrlL-12 or the hrp40 monomer, comparable to the murine anti-IL-23p19 monoclonal antibody, mAb23A. The anti-IL-12/IL-23p40 antibody mAb12A is shown to bind IL-23, IL-12 and the p40 monomer.

Figure 11A shows that the IL-23p19 antibodies of the invention 5040^Q/EV and 3759^EQ/QSthey block the normal binding of IL-23/IL-23R.

Figure 11B shows that the IL-23p19 antibodies of the invention 5040^Q/EV and 3759^EQ'^QS they do not block the normal binding of IL-23/IL-12Rpi.

Figure 11C shows that the IL-23p19 antibodies of the invention 5040^Q/EV and 3759^EQ/QS they do not inhibit the binding of IL-12 to 12Ι4β1 -Fe.

Figure 12 shows that the IL-23p19 antibodies of the invention 5040^σΕν and 3759^EQ/QS do not inhibit IFN production_V induced by IL-12 in NK92MI cells.

Figure 13 shows that the IL-23p19 antibodies of the invention 5040^OEV and 3759^EQ/QSthey inhibit recombinant hrlL-23-mediated IL-17 production.

Figure 14 shows that the IL-23p19 antibodies of the invention 5040^Q/EV and 3759^EQ/QSthey inhibit native hrlL-23-mediated IL-17 production.

Figure 15 shows that the IL-23p19 antibodies of the invention 5040^Q/EV and 3759^EQ/QSinhibit cynomolgus monkey native IL-23-mediated IL-17 production.

Figure 16A shows that the IL-23p 19 antibodies of the invention 5040^Q/EV and 3759^EQ'^QS, and mAb23A, compete for the binding of IL-23 to immobilized mAb23A.

Figure 16B shows that the IL-23p 19 antibodies of the invention 5040^Q/EV and 3759^EQ/QS, and to a lesser extent mAb23A, compete with the binding of IL-23 to mAb 5040^QEV immobilized.

Figure 16C shows that the IL-23p19 antibodies of the invention 5040^Q/EV and 3759^EQQSof the invention, and mAb23A, compete with the binding of IL-23 to mAb 3759^AND“^QS immobilized.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides isolated, recombinant and/or synthetic anti-IL-23p19 antibodies, including, without limitation, mammalian antibodies (eg, human antibodies) and IL-23p19 anti-idiotype antibodies thereto, as well as compositions and encoding nucleic acid molecules comprising at least one polynucleotide encoding at least one anti-IL-23p19 antibody or anti-idiotype antibody. The present invention further includes, without limitation, methods of preparation and use of said nucleic acids and antibodies and anti-idiotype antibodies, including diagnostic and therapeutic compositions, methods and devices.

As used herein, an "anti-IL-23p19 antibody", "IL-23p19 antibody", "anti-IL-23p19 antibody portion" or "anti-IL-23p19 antibody fragment" and/or "antibody variant" anti-IL

23ρ19" and the like, include any protein or peptide that contains a molecule that comprises at least a portion of an immunoglobulin molecule, such as, for example, without limitation, at least one heavy chain complementarity determining region (CDR). or light chain or a ligand binding portion thereof, a heavy chain or light chain variable region, a heavy chain or light chain constant region, a framework region, or any portion thereof, or at least a portion of an IL-23 receptor or binding protein, that can be incorporated into an antibody of the present invention. Said antibody optionally also affects a specific ligand, for example, without limitation, said antibody modulates, decreases, increases, antagonizes, agonizes, mitigates, alleviates, blocks, inhibits, suppresses and/or prevents at least one activity and/or binding of IL-23, or IL-23 receptor binding or activity, in vitro, in situ and/or in vivo. As a non-limiting example, a suitable anti-IL-23p19 antibody, specified portion or variant of the present invention may bind to at least one IL-23 molecule, or specified portions, variants or domains thereof. A suitable specified anti-IL23p19 antibody, portion or variant, can optionally also affect at least one of IL-23p19 activity or function, such as for example, without limitation, RNA, DNA or protein synthesis, IL-23 release, IL-23 receptor signaling, IL-23 clearance from the membrane, IL-23 activity, IL-23 production and/or synthesis.

The term "antibody" also encompasses antibodies, digestion fragments, specified portions and variants thereof, including without limitation antibody mimetics or comprising antibody portions that mimic the structure and/or function of an antibody or specified fragment or portion thereof. itself, including without limitation single chain antibodies, single domain antibodies, and fragments thereof. Functional fragments include antigen-binding fragments that bind to human IL-23p19. For example, the invention encompasses without limitation antibody fragments capable of binding to IL-23p19 or portions thereof, including without limitation Fab (for example by papain digestion), Fab' (for example by pepsin digestion and partial reduction ) and F(ab')₂ (for example by pepsin digestion), facb (for example by plasmin digestion), pFc' (for example by pepsin or plasmin digestion), Fd (for example by pepsin digestion, partial reduction and reaggregation), Fv or scFv (eg by molecular biological techniques) (see, eg, Colligan, "Immunology", supra).

These fragments can be produced by enzymatic cleavage or synthetic or recombinant techniques, as is known in the art and described herein. Antibodies can also be produced in a variety of truncated forms using antibody genes into which one or more stop codons have been introduced 5' of the natural stop site. For example, a combination gene can be designed that encodes a heavy chain portion of F(ab')₂ to include DNA sequences encoding the CH! and/or the hinge region of the heavy chain. The different antibody portions can be chemically linked together by conventional techniques, or can be prepared as a contiguous protein using genetic engineering techniques.

The term "human antibody" as used herein includes antibodies having variable and constant regions derived from, or closely matching, human germ-line immunoglobulin sequences. Human antibodies of the invention may include amino acid residues not encoded by human germline sequences (eg, mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). Thus, as used herein, the term "human antibody" refers to an antibody in which substantially every part of the protein (eg, CDR, backbone, C domains)_L, C_h (for example C._h1 C_h2 C_h3), hinge, (V_L, V_h)) is substantially similar to a human germ-line antibody. Human antibodies have been classified based on their amino acid sequence similarities; see for example http://people.crvst.bbk.ac.uk/~ubcg07s/. In this way, an antibody with a similar linear sequence can be chosen as a template to create "humanized antibodies", using a sequence similarity search.

"Humanization" (also called CDR reconfiguration or grafting) is now a well-established technique to reduce the immunogenicity of monoclonal antibodies (mAbs) from xenogeneic (commonly rodent) sources, and to enhance effector functions (ADCC, complement activation). , C1q binding). The modified mAb is constructed by genetic engineering using molecular biology techniques; however, simple grafting of rodent complementarity determining regions (CDRs) into human scaffolds often results in loss of binding affinity and/or specificity of the original mAb. To humanize an antibody, the humanized antibody design includes variations such as conservative amino acid substitutions in residues of the CDRs, and resubstitution of rodent mAb residues in the human framework regions (backmutations). The positions can be discerned or identified by sequence comparison for structural analysis, or by analysis of a 3D structural homology model of the variable regions. The affinity maturation process has more recently used phage collections to vary amino acids at chosen positions. Similarly, many approaches have been used to choose the most suitable human structures in which to graft the rodent CDR's. As the data sets of known parameters for antibody structures increase, the sophistication and refinement of these techniques increases. Consensus or germline sequences of a single antibody or fragments of the framework sequences can be used, within each light or heavy chain variable region of several different human mAbs. Another humanization approach is to modify only the surface residues of the rodent sequence with the more common residues found in human mAbs, and has been called "coating" or "charging." Human Ig sequences are described, for example, at www.ncbi.nlm.nih.gov/entrez/query.fcgi; www.ncbi.nih.gov/igblast; www.atcc.org/phage/hdb.html; www.kabatdatabase.com/top.html; www.antibodyresource.com/onlinecomp.html; www.appliedbiosystems.com;www.biodesign.com;antibody.bath.ac.uk; www.unizh.ch; www.cryst.bbk.ac.uk/~ubcg07s; Kabat et al., "Sequences of Proteins of Immunological Interest", US Dept. Health (1983), each fully incorporated by reference. Often, the human or humanized antibody is substantially non-immunogenic in humans.

Similarly, antibodies designated primate (monkey, baboon, chimpanzee, etc.), rodent (mouse, rat, rabbit, guinea pig, hamster, and the like), and other mammals designate such antibodies as species, subgenus, genus, subfamily and family. Additionally, chimeric antibodies can include any combination of the above. Such changes or variations optionally and preferably retain or reduce immunogenicity in humans or other species relative to unmodified antibodies. In this way, a human antibody is different from a chimeric or humanized antibody.

It is indicated that a human antibody may be produced by a non-human animal, or prokaryotic or eukaryotic cell, capable of expressing functionally rearranged human immunoglobulin genes (eg heavy chain and/or light chain). Furthermore, when a human antibody is a single chain or single domain antibody, it may comprise a linker peptide not found in native human antibodies. For example, an Fv may comprise a peptide linker, eg, from about two to eight glycine residues or other amino acid residues, that connects the heavy chain variable region and the light chain variable region. Such linker peptides are considered to be of human origin.

Bispecific, heterospecific, heteroconjugate, or the like antibodies that are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens may also be used. In the present case, one of the binding specificities is for at least one IL-23p19 protein subunit, the other is for any other antigen. Methods for making bispecific antibodies are known. Traditionally, the recombinant production of bispecific antibodies is based on the coexpression of two immunoglobulin heavy chain-light chain pairs, where the two heavy chains have different specificities ( Milsen and Cuello, Nature 305:537 (1983 )). Due to the random distribution of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, only one of which has the correct bispecific structure. Purification of the correct molecule is usually done by several affinity chromatography steps. Similar procedures are described, for example, in WO 93/08829; US patents Nos. 6210668, 6193967, 6132992, 6106833, 6060285, 6037453, 6010902, 5989530, 5959084, 5959083, 5932448, 5833985, 5821333, 5807706, 5643759, 5601819, 5582996, 5496549, 4676980, WO 91/00360, WO 92/00373, EP 03089 , Traunecker et al., EMBO J. 10:3655 (1991), Suresh et al., Methods in Enzymology 121:210 (1986), each incorporated herein by reference in their entirety.

Anti-IL-23p19 antibodies useful in the methods and compositions of the present invention may optionally be characterized by high affinity binding to IL-23p19, and optionally and preferably have low toxicity. In particular, a specified antibody, fragment or variant of the invention is useful in the present invention, in which individual components such as variable regrowth, constant region and framework, individually and/or collectively, optionally and preferably, possess low immunogenicity. Antibodies that can be used in the invention are optionally characterized by their ability to treat patients for prolonged periods, with measurable relief of symptoms and low and/or acceptable toxicity. Low or acceptable immunogenicity and/or high affinity, as well as other suitable properties, may contribute to the therapeutic results achieved. “Low immunogenicity” is defined here as the incidence of titratable titers of antibodies to anti-IL-23p19 antibody in patients treated with anti-IL-23p19 antibody, in less than 25% of treated patients, preferably in fewer than 10% of treated patients, at the recommended dose for the recommended course of therapy during the treatment period.

The isolated nucleic acids of the present invention can be used to produce at least one anti-IL-23p19 antibody or specified variant thereof, which can be used to measure or effect in a cell, tissue, organ, or animal (including mammals and humans), the diagnosis, monitoring, modulation, treatment, alleviation, aid in the prevention of incidence, or reduction of symptoms of at least one IL-23-related condition, selected without limitation from at least one of: an immune disorder or disease, a cardiovascular disease or disorder, an infectious, malignant, and/or neurological disorder or disease, or other known or specified IL-23-related condition.

Such a method may comprise administering an effective amount of a composition or a pharmaceutical composition comprising at least one anti-IL-23p19 antibody, to a cell, tissue, organ, animal or patient in need of such modulation, treatment, alleviation, prevention or reduction of symptoms, effects or mechanisms. The effective amount may comprise an amount of about 0.001 mg/kg to 500 mg/kg by single (for example bolus), multiple or continuous administration, or to obtain a serum concentration of 0.01-5000 pg/ml in the serum by single administration. , multiple or continuous, or any effective scale or value therein, as made and determined using known methods described herein or known in the relevant arts.

Antibodies of the present invention - Production and generation

At least one anti-IL-23p19 antibody of the present invention may optionally be produced by a cell line, a mixed cell line, an immortalized cell, or a clonal population of immortalized cells, as is well known; see, for example, Ausubel et al., ed. “Current Protocols in Molecular Biology”, John Wiley & Sons, Inc., New York (1987-2001); Sambrook et al., "Molecular Cloning: A Laboratory Manual," 2^to edition, Cold Spring Harbor, New York (1989); Harlow and

Lane, "Antibodies, a Laboratory Manual," Cold Spring Harbor, New York (1989); Colligan et al., eds., "Current Protocols in Immunology," John Wiley & Sons Inc., New York (1994-2001); Colligan et al., "Current Protocols in Protein Science", John Wiley & Sons, New York (1997-2001), each incorporated herein by reference in its entirety.

Antibodies that are specific for human IL-23p19 proteins or fragments thereof can be obtained from recombinant human antibody libraries using a suitable antigen, such as an isolated IL-23p19 protein and/or a portion thereof (including synthetic molecules such as synthetic peptides). Other specific or general antibodies may be similarly developed including, without limitation, mammalian antibodies. Preparation of immunogenic antigens and isolation of antibodies from human libraries can be performed using any suitable technique.

In one approach, a recombinant antibody is obtained by phage display using antibody libraries (Hoogenboom HR., “Overview of antibody phage-display technology and its applications” Methods in Molecular Biology 178:1-37, 2002). In a preferred approach, a recombinant human Fab is isolated from the HuCal Gold™ library developed by MorphoSys, AG (Kretzschmar, 2002), subsequently enhanced in activity by CDR cassette diversification (Knappik et al., 2000; Krebs et al., 2001).

Recombinant human antibodies recovered from phage display libraries can be engineered to replace certain residues with specific amino acids corresponding to the consensus or specific human antibody sequences. These sequences are identified through database comparisons of known human germline or rearranged antibodies.

Known human Ig sequences are set forth for example at www.ncbi.nlm.nih.gov/entrez/query.fcgi;www.ncbi.nih.gov/igblast;www.atcc.org/phage/hdb.html; www.mrccpe.cam.ac.uk/ALIGNMENTS.php; www.kabatdatabase.com/top.html;ftp.ncbi.nih.gov/repository/kabat; www.imgt.cines.fr.8104/;www.biochem.unizh.ch/antibody/index.html;www.sciquest.com;www.abcam.com; www.antibodyresource.com/onlinecomp.html; www.public.iastate.edu/'-pedro/research'-tools.html; www.whfreeman.com/immunology/CH05/kuby05.htm; www.hhmi.org/grants/lectures/1996/vlab;

www.path.cam.ac.uk/~mrc7/mikeimages.html;mcb.harvard.edu/BioLinks/lmmunology.html; www.immunologylink.com; pathbox. wustl.edu/~hcenter/index.html; www.appliedbiosystems.com; www.nal.usda.gov/awic/pubs/antibody; www.rn.ehime~u.acjp/~yasuhito/Elisa.html; www.biodesign.com; www.cancerresearchuk.org;www.biotech.ufl.edu;www.isac-net.org;baserv.uci.kun.nl/~jraats/links1 .html; www.recab.uni-hd.de/immuno.bme.nwu.edu; www.mrc-cpe.cam.ac.uk; www.ibt.unam.mx/vir/\/_m¡ce.html; http://www.bioinf.org.uk/abs; antibody.bath.ac.uk; www.unizh.ch; www.cryst.bbk.ac.uk/~ubcg07s; www.nimr.mrc.ac.uk/CC/ccaewg/ccaewg.html; www.path.cam.ac.uk/~mrc7/humanisation/TAHHP.html; www.ibt.unam.mx/vir/structure/stat_aim.html;www.biosci.missouri.edu/smithgp/index.html;www.jerini.de; Kabat et al., "Sequences of Proteins of Immunological Interest", US Dept. Health (1983), each incorporated herein by reference in its entirety.

Such replaced amino acid sequences can be used to reduce immunogenicity or to reduce, increase, or modify binding, affinity, activation rate, inactivation rate, avidity, specificity, half-life, or any other suitable characteristic, as is known in the art. In general, CDR residues are directly and very substantially involved in affecting antigen binding.

Optionally human antibodies can be engineered with retention of high affinity for the antigen and other favorable biological properties. To achieve this goal, human antibodies can optionally be prepared by means of a method of analyzing the parental sequences and various engineered concept products, using three-dimensional models of the parental, engineered, and human sequences. Three-dimensional immunoglobulin models are commonly available and familiar to those skilled in the art. Computer programs are available that illustrate and visually present the likely three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays allows analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, that is, analysis of residues that affect the ability of the candidate immunoglobulin to bind its antigen. In this way, residues from the parental and reference human sequences can be selected and combined in order to obtain the desired characteristic of the antibody, eg, affinity for the target antigen. Alternatively or in addition to the above procedures, engineering can be done empirically by CDR cassette diversification and selection of the desired activity, as described in the MorphoSys HuCaL system (Knappik et al., 2000; Krebs et al., 2001).

Furthermore, the IL-23p19 antibody of the present invention may comprise a human germ line light chain structure. In particular embodiments, the light chain germline sequence is selected from human VK sequences including, without limitation, Α1, A10, A11, A14, A17, A18, A19, A2, A20, A23, A26, A27, A3, A30, A5, A7, B2, B3, L1, L10, L11, L12, L14, L15, L16, L18, L19, L2, L20, L22, L23, L24, L25, L4/18a, L5, L6, L8, L9, 01,011,012, 014, 018, 02, 04, and 08. In some embodiments, this light chain human germline structure is selected from V1-11, V1-13, V1-16, V1-17, V1-18, V1-19, V1-2, V1-20, V1- 22, V1-3, V1-4, V1-5, V1-7, V1-9, V2-1, V2-11, V2-13, V2-14, V2-15, V2-17, V2-19, V2-6, V2-7, V2-8, V3-2, V3-3, V3-4, V4-1, V4-2, V4-3, V4-4, V4-6, V5-1, V5- 2, V5-4, and V5-6. See PCT WO 2005/005604 for a description of the different germ line sequences.

In other embodiments, the IL-23 antibody of the present invention may comprise a human germline heavy chain structure. In particular embodiments, this heavy chain human germline structure is selected from VH1-18, VH1-2, VH1-24, VH1-3, VH1-45, VH146, VH1-58, VH1-69, VH1-8, VH2-26, VH2-5, VH2-70, VH3-11, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, VH3-30, VH3-33, VH3- 35, VH3-38, VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-7, VH3-72, VH3-73, VH3-74, VH3-9, VH4-28, VH4-31, VH4-34, VH4-39, VH4-4, VH4-59, VH4-61, VH5-51, VH6-1, and VH7-81. See PCT WO 2005/005604 for a description of the different germ line sequences.

In particular embodiments, the light chain variable region and/or heavy chain variable region comprise a framework region or at least a portion of a framework region (for example, containing 2 or 3 subregions, such as FR2 and FR3). In some modalities, at least FRL1, FRL2, FRL3, or FRL4, she is fully human. In other modalities, at least FRH1, FRH2, FRH3, or FRH4, it is fully human. In some embodiments, at least FRL1, FRL2, FRL3, or FRL4, is a germline sequence (eg, human germline), or comprises human consensus sequences for the particular structure (readily available from sequencing sources). known human Ig, previously described). In other embodiments, at least FRH1, FRH2, FRH3, or FRH4, is a germline sequence (eg, human germline), or comprises human consensus sequences for the particular structure. In preferred embodiments, the frame region is a human frame region.

Engineering the antibodies of the present invention can be performed using any known method, for example, without limitation, those described by Winter (Jones et al., Nature 321 :522 (1986); Riechmann et al.; Nature 332:323 (1988), Verhoeyen et al., Science 239:1534 (1988), Sims et al., J Immunol 151:2296 (1993), Chothia and Lesk, J Mol Biol 196:901 (1987), Carter et al. others, Proc. Nati. Acad. Sci. USA 89:4285 (1992) Presta et al., J. Immunol. 151: 2623 (1993), US patents: 5723323, 5976862, 5824514, 5817483, 5814476, 5763192, 5723323, 5,766886, 5714352, 6204023, 6180370, 5693762, 5585, 5585, 558, 55. 4816567, PCT/: US98/16280, US96/18978, US91/09630, US91/05939, US94/01234, GB89/01334, GB91/01134, GB92/01755; WO90/14443, WO90/14424, W090/14430, EP 229246, each of which is fully incorporated herein by reference, including references cited therein.

In some embodiments, the antibody comprises an altered (eg, mutated) Fc region. For example, in some embodiments the Fe region has been altered to reduce or increase the effector functions of the antibody. In some embodiments, the Fe region is an isotype selected from IgM, IgA, IgG, IgE, or another isotype.

Alternatively or additionally, it may be useful to combine amino acid modifications with one or more additional amino acid modifications that alter C1q binding and/or the complement-dependent cytotoxicity (CDC) function of the Fe region of an IL binding molecule. -23p19. The binding polypeptide of particular interest may be one that binds C1q and exhibits complement-dependent cytotoxicity. Polypeptides with pre-existing Clq binding activity, which optionally also have the ability to mediate CTC, can be modified to increase one or both of these activities. Amino acid modifications that alter C1q and/or modify its complement-dependent cytotoxicity function are described, for example, in WO 0042072, which is incorporated herein by reference.

As described above, an F region of the IL-23p19 antibody of the present invention can be engineered, with altered effector function, for example, by modifying C1q binding and/or FcyR binding, thereby changing CDC activity. and/or ADCC activity. The "effector functions" are those responsible for activating or decreasing a biological activity (for example in a subject). Examples of effector functions include, without limitation: C1 q binding; complement dependent cytotoxicity (CDC); Fe receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; negative regulation of cell surface receptors (eg B cell receptor; BCR), etc. Such effector functions may require the Fe region to be combined with a binding domain (for example, an antibody variable domain), and can be determined using various tests (for example, Fe binding tests, ADCC tests, CDC, etc.).

For example, a variant Fc region of the IL-23P19 antibody can be generated, with enhanced C1q binding and enhanced FcyRIII binding (eg, having both enhanced ADCC and enhanced CDC activity). Alternatively, if it is desired to reduce or abolish effector function, a variant Fe region with reduced CDC activity and/or reduced ADCC activity can be engineered. In other embodiments, only one of these activities can be increased and optionally the other activity can also be reduced (eg, to generate a variant Fe region with enhanced ADCC activity but reduced CDC activity, and vice versa).

Fe mutations can also be introduced and engineered to alter its interaction with the neonatal Fe receptor (FcRn) and improve its pharmacokinetic properties. A collection of human Fe variants with improved FcRn binding has been described (Shields et al., 2001, “High resolution mapping of the binding site on human IgG 1 for FcyRI, FcyRIl, FcyRIII, and FcRn and design of lgG1 variants with improved binding to the FcyR”, J. Biol. Chem. 276:6591-6604).

Another type of amino acid substitution serves to alter the glycosylation pattern of the Fe region of the IL-23p19 antibody. Glycosylation of an Fe region is normally N-linked or O-linked. N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue. O-linked glycosylation refers to the attachment of one of the sugars N-acetylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxyproline or 5-hydroxylysine may also be used. The recognition sequences for the enzymatic attachment of the carbohydrate moiety to the asparagine side chain peptide sequences are asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline. Thus, the presence of any of these peptide sequences in a polypeptide creates a potential glycosylation site.

The glycosylation pattern can be altered, for example, by deleting one or more glycosylation sites found in the polypeptide, and/or adding one or more glycosylation sites that are not present in the polypeptide. Addition of glycosylation sites to the Fe region of an IL-23p19 antibody is conveniently accomplished by altering the amino acid sequence so that it contains one or more of the tripeptide sequences described above (for N-linked glycosylation sites). An exemplary glycosylation variant has an amino acid substitution of Asn residue 297 of the heavy chain. The alteration can also be made by the addition or substitution of one or more serine or threonine residues to the original polypeptide sequence (for O-linked glycosylation sites). Additionally, a change from Asn 297 to Ala can remove one of the glycosylation sites.

In some embodiments, the IL-23p19 antibody of the present invention is expressed in cells that express beta-(1,4)-N-acetylglucosaminyltransferase III (GnT III), such that GnT III adds GIcNAc to the IL-23p19 antibody. . Methods for producing antibodies in this way are provided in WO/9954342, WO/03011878, patent publication 20030003097A1, and Umana et al., Nature Biotechnology, 17:176-180, Feb. 1999.

Using peptide display libraries the screening and selection of antibodies for specific binding to proteins or similar fragments can be conveniently accomplished. This method includes screening large collections of peptides to select individual members that have the desired function or structure. The selection of antibodies from peptide display libraries is well known in the art. The displayed peptide sequences can be from 3 to 5000 or more amino acids in length, often from 5-100 amino acids in length, and often from about 8 to 25 amino acids in length. In addition to direct chemical synthesis methods to generate peptide libraries, several recombinant DNA methods have been described. One type involves display of a peptide sequence on the surface of a bacteriophage or cell. Each bacteriophage or cell contains the nucleotide sequence that encodes the particular displayed peptide sequence. Such methods are described in PCT Patent Publication Nos. 91/17271, 91/18980, 91/19818 and

93/08278.

Other systems for generating peptide libraries have aspects of both in vitro chemical synthesis and recombinant methods. See PCT Patent Publication Nos. 92/05258, 92/14843, and 96/19256. See also US Patent Nos. 5,658,754; and 5,643,768. Peptide display collections, vectors, and selection kits are commercially available from vendors such as Invitrogen (Carlsbad, California) and Cambridge Antibody Technologies (Cambridge, UK). See, for example, US Pat. Nos. 4704692, 4939666, 4946778, 5260203, 5455030, 5518889, 5534621,5656730, 5763733, 5767260,5856456, awarded to Enzon; 5223409, 5403484, 5571698, 5837500, awarded to Dyax, 5427908, 5580717, awarded to Affymax; 5885793, assigned to Cambridge Antibody Technologies; 5750373, assigned to Genentech; 5618920, 5595898, 5576195,5698435, 5693493, 5698417, awarded to Xoma, Colligan, supra; Ausubel, supra-, or Sambrook, supra.

The antibodies of the present invention can also be prepared using at least one nucleic acid encoding an anti-IL-23p19 antibody, to provide transgenic animals or mammals, such as goats, cows, horses, sheep, rabbits, and the like, that produce such antibodies in their milk. These animals can be provided using known methods. See, for example, without limitation, US Pat. Nos. 5,827,690; 5,849,992; 4,873,316; 5,849,992; 5,994,616; 5,565,362; 5,304,489, and the like, each of which is fully incorporated herein by reference.

Additionally, the antibodies of the present invention can be prepared using at least one nucleic acid encoding an anti-IL-23p19 antibody to provide transgenic plants and cultivated plant cells (eg, without limitation, tobacco and corn) that produce such antibodies. , specified portions or variants, in parts of plants or in cultured cells thereof. As a non-limiting example, transgenic tobacco leaves expressing recombinant proteins have been used successfully to provide large amounts of recombinant proteins, for example using an inducible promoter. See for example Cramer et al., Curr. Top. Microbiol. Immunol. 240:95-118 (1999) and the references cited therein. Transgenic maize has also been used to express mammalian proteins in commercial production, with biological activities equivalent to those produced in other recombinant systems or purified from natural sources. See for example Hood et al., Adv. Exp. Med. Biol., 464:127-147 (1999) and references cited therein. Antibodies have also been produced in large amounts in seeds of transgenic plants, including antibody fragments, such as single chain antibodies (scFv's), including tobacco seeds and potato tubers. See, eg, Conrad et al., PlantMol. Biol. 38:101-109 (1998) and references cited therein. Thus, the antibodies of the present invention can also be produced using transgenic plants according to known methods. See also, eg, Fischer et al., Biotechnol. Appl. Biochem. 30:99-108 (Oct 1999); Ma et al., Trends Biotechnol. 13:522-7 (1995); Ma et al., Plant Physiol. 109:341-6 (1995); Whitelam et al., Biochem. Soc. Trans. 22:940-944 (1994); and references cited there.

The antibodies of the invention can bind to human IL-23p19 with a wide range of affinities (K_D.). In a preferred embodiment, at least one mAb of the present invention can optionally bind human IL-23p19 with high affinity. For example, a human mAb or another mAb can bind to human I L-23p 19 with a K_D. equal to or less than approximately 10'⁷ M, for example, without limitation, 0.1-9.9 (or any scale or value in that interval) X 10⁷,10'⁸,10 ⁹,10¹⁰,10'¹¹,10'¹²,10'¹³,10'¹⁴,10¹⁵, or any scale or value in that range, determined by surface plasmon resonance or the Kinexa method, as practiced by those skilled in the art. In one embodiment, the antibodies of the invention bind to human IL-23p 19 with a K_D. between about 4 and about 4400 pM.

The affinity or avidity of an antibody for an antigen can be determined experimentally using any suitable method (see for example Berzofsky et al., "AntibodyAntigen Interactions", in "Fundamental Immunology", Paul WE, ed. Raven Press, New York, New York (1984); Kuby Janis "Immunology", WH Freeman and Company, New York, New York (1992); and methods described therein). The measured affinity of a particular antibody-antigen interaction may vary if it is measured under different conditions (eg salt concentration, pH). In this way, affinity measurements and other antigen binding parameters (for example K_D., K_to, K_d) are preferably made with standard solutions of antibody and antigen and a standard buffer such as the one described here.

Competitive tests can be made with the antibody of the present invention to determine which proteins, antibodies, and other antagonists compete for binding to IL-23p19 with the antibody of the present invention, and/or share the epitope region. These tests, as the person skilled in the art knows, evaluate the competition between antagonists or ligands for a limited number of binding sites on a protein, for example p19. The protein and/or antibody is immobilized or insolubilized before or after competition, and the sample bound to the p19 subunit is separated from the unbound sample, for example, by decantation (when the protein/antibody was previously insolubilized), or by centrifugation (when the protein/antibody was precipitated after the competition reaction). Also, competitive binding can be determined by testing whether function is altered by the binding or non-binding of the antibody to the protein, eg, whether the antibody molecule inhibits or enhances enzyme activity, eg, of a tag. ELISA and other functional tests can be used, as is well known.

Some embodiments of the anti-IL-23p19 antibodies of the invention have the sequences shown in the sequence tables below. For example, an anti-IL23p19 antibody of the invention has one of the light chain CDR1 sequences of SEQ ID Nos: 46-51; one of the CDR2 light chain sequences of SEQ ID Nos: 52-57; one of the light chain CDR3 sequences of SEQ ID Nos: 58-79; one of the heavy chain CDR1 sequences of SEQ ID Nos: 1-6; one of the heavy chain CDR2 sequences of SEQ ID Nos: 7-39 and 146; and/or one of the heavy chain CDR3 sequences of SEQ ID Nos: 40-45.

nucleic acid molecules

Using the information provided herein, for example, the nucleotide sequences that encode at least 70-100% of the contiguous amino acids of at least one of the light chain variable regions of the antibodies of the invention (for example, SEQ ID NOS: 136-138 and 142-144), and at least one of the heavy chain variable regions of the antibodies of the invention (for example, SEQ ID NOs: 133-135 and 139-141), specified fragments, variants or consensus sequences thereof, or a deposited vector comprising at least one of these sequences, a nucleic acid molecule of the present invention encoding can be obtained by at least one anti-IL-23p19 antibody, using the methods described herein or those known in the art.

The nucleic acid molecules of the present invention may be in the form of RNA, for example mRNA, hnRNA, tRNA, or any other form, or in the form of DNA, including without limitation

cDNA and genomic DNA obtained by cloning or synthetic production or any combination thereof. The DNA can be triple-stranded, double-stranded, or single-stranded, or any combination thereof. Any portion of at least one strand of DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the antisense strand.

The isolated nucleic acid molecules of the present invention may include nucleic acid molecules that comprise an open reading frame (ORF), optionally with one or more introns, for example, without limitation, at least a specified portion of at least a CDR such as CDR1, CDR2 and/or CDR3 of at least one light chain (SEQ ID NOS: 46-51,52-57, or 58-79) or at least one heavy chain (SEQ ID NOS: 1-6 , 7-39, or 40-45); nucleic acid molecules comprising the coding sequence for an anti-IL-23p19 antibody or the variable region (for example the light chain variable regions of SEQ ID NOS: 82-85, 93-98, 100, 102, 113- 116 and 128-132, and the heavy chain variable regions of SEQ ID NOS: 80, 81,86-92, 99,101,103-112,117-127 and 147); and nucleic acid molecules comprising a nucleotide sequence substantially different from those described above but which, due to degeneracy of the genetic code, still encode at least one anti-IL-23p19 antibody as described herein and/or known elsewhere. The technique. Of course, the genetic code is well known. Thus, it would be routine for one skilled in the art to generate such degenerate nucleic acid variants that encode the specific anti-IL-23p19 antibodies of the present invention. See, for example, Ausubel et al., supra; and such nucleic acid variants are included in the present invention.

As indicated herein, nucleic acid molecules of the present invention comprising a nucleic acid encoding an anti-IL-23p19 antibody, may include without limitation those encoding the amino acid sequence of an antibody fragment, alone; the coding sequence of the entire antibody or a portion thereof; the coding sequence for an antibody, fragment or portion, as well as additional sequences such as the coding sequence for at least one signal leader or fusion peptide, with or without the aforementioned additional coding sequences, such as: at least one intron, together with additional non-coding sequences, including without limitation 5' and 3' non-coding sequences, such as transcribed non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals (eg ribosome binding and mRNA stability); an additional coding sequence that codes for additional amino acids such as those that provide additional functionality. In this manner, the antibody-encoding sequence can be fused to a marker sequence, eg, a peptide-encoding sequence that facilitates purification of the fused antibody comprising an antibody fragment or portion.

Polynucleotides that selectively hybridize to a polynucleotide as described herein

The present invention provides isolated nucleic acids that hybridize under selective hybridization conditions with a polynucleotide described herein. Thus, polynucleotides of this embodiment can be used to isolate, detect and/or quantify nucleic acids comprising said polynucleotides. For example, the polynucleotides of the present invention can be used to identify, isolate, or amplify full- or partial-length clones in a deposited library. In some embodiments, the polynucleotides are isolated genomic or cDNA sequences, or otherwise complementary to a cDNA from a human or mammalian nucleic acid library.

Preferably, the cDNA library comprises sequences that are at least 80% full length, preferably at least 85% or 90% full length, and most preferably at least 95% full length. cDNA libraries can be normalized to increase the representation of rare sequences. Typically, but not exclusively, hybridization conditions of low or moderate stringency are employed with sequences having low sequence identity to complementary sequences. Conditions of moderate and high stringency may optionally be employed for sequences of higher identity. Low stringency conditions allow selective hybridization of sequences that have approximately 70% sequence identity and can be used to identify orthologous or paralogous sequences.

Optionally, the polynucleotides of this invention will encode at least a portion of an antibody encoded by the polynucleotides described herein. The polynucleotides of this invention encompass nucleic acid sequences that can be used for selective hybridization with a polynucleotide encoding an antibody of the present invention. See, for example, Ausubel, supra-,

Colligan, supra, each fully incorporated by reference.

construction of nucleic acids

The isolated nucleic acids of the present invention can be made using (a) recombinant methods, (b) synthetic techniques, (c) purification techniques, and/or (d) combinations thereof, as is well known in the art.

Suitably, the nucleic acids may comprise sequences in addition to the polynucleotide of the present invention. For example, a multiple cloning site comprising one or more restriction endonuclease sites can be inserted into the nucleic acid to aid in isolation of the polynucleotide. Translatable sequences can also be inserted to help isolate the translated polynucleotide of the present invention. For example, a hexa-histidine tag provides a convenient means of purifying the proteins of the present invention. The nucleic acid of the present invention, excluding the coding sequence, is optionally a vector, adapter, or linker for cloning and/or expression of a polynucleotide of the present invention.

To optimize their function in cloning and/or expression, to aid in isolation of the polynucleotide, or to improve introduction of the polynucleotide into a cell, additional sequences may be added to said cloning and/or expression sequences. The use of cloning vectors, expression vectors, adapters and linkers is well known (see, for example, Ausubel, supra; or Sambrook, supra).

Recombinant methods to construct nucleic acids

The isolated nucleic acid compositions of this invention, such as RNA, cDNA, genomic DNA, or any combination thereof, can be obtained from biological sources using any cloning methodology known to those skilled in the art. In some embodiments, oligonucleotide probes that selectively hybridize under stringent conditions with the polynucleotides of the present invention are used to identify the desired sequence in a collection of cDNA or genomic DNA. RNA isolation and construction of genomic and cDNA libraries are well known to those of average skill in the art (see, eg, Ausubel, supra; or

Sambrook, supra).

Nucleic acid selection and isolation methods

A library of cDNA or genomics can be screened using a probe based on the sequence of a polynucleotide of the present invention, such as that described herein. The probes can be used to hybridize to genomic DNA or cDNA sequences to isolate homologous genes in the same or different organisms. Those skilled in the art will appreciate that various degrees of stringency of hybridization may be employed in the assay, and the hybridization or wash medium may be stringent. As hybridization conditions become more stringent, there must be a greater degree of complementarity between probe and target for duplex formation to occur. The degree of stringency can be controlled by one or more of temperature, ionic strength, pH, and the presence of a partially denaturing solvent, such as formamide. For example, the stringency of hybridization is conveniently varied by changing the polarity of the reagent solution, eg, by manipulating the concentration of the formamide within the range of 0% to 50%. The degree of complementarity (sequence identity) required for detectable binding varies according to the stringency of the hybridization medium and/or the wash medium. The degree of complementarity will optimally be 100% or 70-100%, or any scale or value within this range. However, it should be understood that minor sequence variations in the probes and primers can be compensated for by reducing the stringency of the hybridization and/or wash medium.

RNA or DNA amplification methods are well known and can be used in accordance with the present invention without further experimentation based on the teaching and guidance presented herein.

Known methods of DNA or RNA amplification include, without limitation, polymerase chain reaction (PCR) and related amplification processes (see, for example, the patents of

US Nos. 4,683,195, 4,683,202, 4,800,159, 4,965,188, to Mullis et al.; 4,795,699 and 4,921,794 to Tabor et al.; 5,142,033 from Innis; 5,122,464 to Wilson et al.; 5,091,310 from Innis; 5,066,584 to Gyllensten et al.; 4,889,818 to Gelfand et al.; 4,994,370 to Silver et al.; 4,766,067 from Biswas; 4,656,134 of

Ringold), and RNA-mediated amplification using antisense RNA as a template for the target sequence for double-stranded DNA synthesis (US Patent No. 5,130,238 to Malek et al., tradename NASBA); the entire contents of these references are incorporated herein by reference (see, for example, Ausubel, supra-, or Sambrook, supra}.

For example, polymerase chain reaction (PCR) technology can be used to amplify the polynucleotide sequences of the present invention and related genes, directly from genomic DNA or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone protein-encoding nucleic acid sequences for expression; to make nucleic acids to be used as probes to detect the presence of the desired mRNA in samples; for nucleic acid sequencing; or for other purposes. Examples of techniques suitable for directing the skilled in in vitro amplification methods are found in Berger, supra, Sambrook, supra, and Ausubel, supra, as well as US Patent No. 4,683,202 (1987) ; and Innis et al., "PCR Protocols, A Guide to Methods and Applications" ed. Academic Press Inc., San Diego, Calif. (1990). Kits for genomic PCR amplification are commercially available. See, for example, the Advantage-GC Genomic PCR kit (Clontech). Additionally, for example, T4 gene 32 protein (Boehringer Mannheim) can be used to improve the yield of long PCR products.

Synthetic methods to construct nucleic acids

The isolated nucleic acids of the present invention can also be prepared by direct chemical synthesis by known methods (see, for example, Ausubel et al., supra). Chemical synthesis generally produces a single-stranded oligonucleotide, which can be converted into double-stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template. One of skill in the art will recognize that although the chemical synthesis of DNA may be limited to sequences of about 100 or more bases, longer sequences can be obtained by ligation of shorter sequences.

Recombinant Expression Cassettes

The present invention also provides recombinant expression cassettes comprising a nucleic acid of the present invention. A nucleic acid sequence of the present invention, for example a genomic or cDNA sequence encoding an antibody of the present invention, can be used to construct a recombinant expression cassette that can be introduced into at least one desired host cell. A recombinant expression cassette will typically comprise a polynucleotide of the present invention, operably linked to transcription initiation regulatory sequences that will direct transcription of the polynucleotide in the host cell in question. Heterologous and non-heterologous (ie, endogenous) promoters can be employed to drive expression of the nucleic acids of the present invention.

In some embodiments, isolated nucleic acids that serve as promoter, enhancer, or other elements, can be introduced at the appropriate position (3', 5', or intron) in a non-heterologous fashion of a polynucleotide of the present invention. , in order to up- or down-regulate the expression of a polynucleotide of the present invention. For example, endogenous promoters can be altered in vivo or in vitro by mutation, deletion, and/or substitution.

Vectors and host cells

The present invention also relates to vectors that include isolated nucleic acid molecules of the present invention, host cells that are engineered with the recombinant vectors, and the production of at least one anti-IL-23p19 antibody by recombinant techniques. , as is well known in the art. See, eg, Sambrook et al., Ausubel et al., supra, each incorporated herein by reference in its entirety.

Optionally, the polynucleotides can be linked to a vector containing a selectable marker for propagation in a host. In general, a plasmid vector is introduced into a precipitate, such as a calcium phosphate precipitate, or into a complex with a charged lipid. If the vector is a virus, it can be packaged in vivo using a packaging cell line and then transduced into host cells.

The DNA insert must be operatively linked to an appropriate promoter. The expression constructs further contain transcription initiation and termination sites, and in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcripts expressed by the constructs will preferably include a translation initiation at the start and a stop codon (eg UAA, UGA or UAG) appropriately placed at the end of the mRNA to be translated, with UAA and UAG being preferred for expression in mammalian or eukaryotic cells.

Expression vectors will preferably but optionally include at least one selectable marker. Such markers include, without limitation, for example, methotrexate (MTX) resistance, dihydrofolate reductase (DHFR, US Patent Nos. 4,399,216; 4,634,665; 4,656,134; 4,956,288; 5,149,636; 5,179,017), ampicillin, neomycin (G418), mycophenolic acid or glutamine synthetase (GS, US Pat. Nos. 5,122,464; 5,770,359; 5,827,739), for eukaryotic cell culture, and tetracycline or ampicillin resistance genes for culture in E. coli and other bacteria or prokaryotes (the above patents incorporated herein by reference in their entirety). Appropriate culture media and conditions for the host cells described above are known in the art. Suitable vectors will be readily apparent to the skilled artisan. Introduction of a vector construct into a host cell can be effected by means of calcium phosphate transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other known methods. Such methods are described in the art, eg, Sambrook, supra, Chapters 1-4 and 16-18; Ausubel, supra, chapters 1,9,13,15,16.

At least one antibody of the present invention may be expressed in a modified form, eg a fusion protein, and may include not only secretion signals but also additional heterologous functional regions. For example, a region of additional amino acids, particularly charged amino acids, can be added to the N-terminus of an antibody, to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage. Peptide portions may also be added to an antibody of the present invention to facilitate purification. Such regions can be removed prior to final preparation of an antibody or at least a fragment thereof. Such methods are described in many standard laboratory manuals, such as Sambrook, supra, chapters 17.29-17.42 and 18.1-18.74; Ausubel, supra, chapters 16, 17 and 18.

Those of ordinary skill in the art are aware of many expression systems available for the expression of a nucleic acid encoding a protein of the present invention. Alternatively, the nucleic acids of the present invention can be expressed in a host cell by activation (by manipulation) in a host cell containing endogenous DNA encoding an antibody of the present invention. Such methods are well known, for example, as described in US Patent Nos. 5,580,734, 5,641,670; 5,733,746 and 5,733,761, incorporated herein in their entirety by reference.

Mammalian cells are illustrative of cell cultures useful for the production of antibodies, specified portions or variants thereof. Mammalian cell systems will frequently be in the form of cell monolayers, although mammalian cell suspensions or bioreactors may also be used. A number of suitable host cell lines capable of expressing intact glycosylated proteins have been developed in the art and include the cell lines COS-1 (eg ATCC CRL 1650), COS-7 (eg ATOO CRL-1651), HEK293, BHK21 (eg ATCC CRL-10), CHO (eg ATCC CRL 1610) and BSC-1 (eg ATCC CRL-26), Cos-7 cells, CHO cells, hep G2 cells, P3X63Ag8.653, SP2/0-Ag 14, 293 cells, HeLa cells, and the like, which are readily available, for example, from the American Type Culture Collection, Manassas, Virginia (www.atcc.org). Preferred host cells include cells of lymphoid origin, such as myeloma and lymphoma cells. Particularly preferred host cells are P3X63Ag8.653 (ATCC Accession Number CRL-1580) and SP2/0-Ag14 (ATCC Accession Number CRL-1851) cells. In a particularly preferred embodiment, the recombinant cell is a P3X63Ab8.653 or SP2/0Ag14 cell.

Expression vectors for these cells may include one or more of the following expression control sequences, without limitation, an origin of duplication; a promoter (eg, SV40 late or early promoters), the CMV promoter (US Patent Nos. 5,168,062; 5,385,839), an HSV tk promoter, a pgk (phosphoglycerate kinase) promoter, an EF-1 promoter alpha (U.S. Patent no. 5,266,491), at least one human immunoglobulin promoter; an enhancer, and/or processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites (for example a large SV40 poly-A T Ag addition site), and sequences of transcript termination. See for example Ausubel et al., supra, Sambrook et al., supra. Other cells useful for the production of the nucleic acids or proteins of the present invention are known and available, for example, from the American Type Culture catalog of cell lines and hybridomas.

Collection (www.atcc.org) or other known or commercial sources.

When eukaryotic host cells are used, polyadenylation or transcription termination sequences are typically incorporated into the vector. An example of a termination sequence is the polyadenylation sequence of the bovine growth hormone gene. Splicing sequences of the transcript may also be included. An example of a splice sequence is the VP1 intron of SV40 (Sprague et al., J. Virol. 45:773-781 (1983)). Additionally, gene sequences to control duplication in the host cell can be incorporated into the vector, as is known in the art.

purification of an antibody

An anti-IL-23p19 antibody can be recovered and purified from recombinant cell cultures by well-known methods including, without limitation, protein A purification, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography. , phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. High performance liquid chromatography ("HPLC") may also be employed for purification. See, for example, Colligan, "Current Protocols in Immunology", or "Current Protocols in Protein Science", John Wiley & Sons, New York, New York (1997-2000), for example chapters 1,4, 6, 8 , 9,10, each incorporated herein in its entirety by reference.

Antibodies of the present invention include naturally purified products, chemically synthesized products, and products produced by recombinant techniques from a eukaryotic host, eg, yeast, higher plant, insect, and mammalian cells. Depending on the host employed in a recombinant production procedure, the antibody of the present invention may be glycosylated or unglycosylated, with glycosylated being preferred. Such methods are described in many standard laboratory manuals, eg, Sambrook, supra, sections 17.37-17.42; Ausubel, supra, chapters 10,12,13,16,18 and 20; Colligan, "Protein Science," supra, chs. 12-14; all fully incorporated by reference.

Anti-IL-23p19 antibodies

An anti-IL-23p19 antibody according to the present invention includes any protein or peptide that contains a molecule that comprises at least a portion of an immunoglobulin molecule, for example, without limitation, at least one ligand-binding portion. (LBP), for example, without limitation, a complementarity determining region (CDR) of a heavy or light chain, or a ligand binding portion thereof, a heavy chain or light chain variable region, a framework region (for example, FR1, FR2, FR3, FR4, or fragment thereof, optionally comprising at least one substitution, insertion, or deletion), a heavy chain or light chain constant region (for example, that comprises at least one CH1, hingel, hinge2, hinge3, hinge4, CH2, or CH3, or fragment thereof, optionally comprising at least one substitution, insertion, or deletion), or any portion thereof, which can be incorporated into an antibody of the present invention. An antibody of the invention can include or be derived from any mammal, for example, without limitation, a human, mouse, rabbit, rat, rodent, primate, or any combination thereof, and the like.

Isolated antibodies of the present invention comprise the antibody amino acid sequences described herein encoded by any suitable polynucleotide, or any isolated or prepared antibody. Preferably, the human antibody or antigen-binding fragment binds to human IL-23p19 and thus partially or substantially neutralizes at least one biological activity of the protein. An antibody, or specified portion or variant thereof, that partially, or preferably substantially, neutralizes at least one biological activity of at least one IL-23 protein or fragment, can bind to the protein or fragment and thus inhibit activities mediated by binding of IL-23 to the IL-23 receptor, or through other IL-23-mediated or dependent mechanisms. As used herein, the term "neutralizing antibody" refers to an antibody that can inhibit an IL-23-dependent activity by about 20-120%, preferably at least about 10, 20, 30, 40, 50, 55 , 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100%, or more, depending on the assay. The ability of an anti-IL-23p19 antibody to inhibit an IL-23-dependent activity is preferably determined by at least one suitable test for IL-23 protein or receptor, as described herein and/or as known elsewhere. The technique. A human antibody of the invention may be of any class (IgG, IgA, IgM, IgE, IgD, etc.), or isotype, and may comprise a kappa or lambda light chain. In one embodiment, the human antibody comprises an IgG heavy chain or a defined fragment, eg, at least one of the isotypes, IgG 1, IgG2, IgG3, or IgG4 (eg γ1, γ2, γ3, or γ4). Such antibodies can be prepared using a transgenic mouse or other non-human transgenic mammal comprising at least one human light chain transgene (for example IgG, IgA and IgM), as described herein and/or as known in the art. technique. In another embodiment, the anti-human IL-23p19 antibody comprises an IgG1 heavy chain and an IgG1 light chain.

At least one antibody of the invention binds to at least one epitope specific for at least one IL-23p19 protein, subunit, fragment, portion, or any combination thereof. The epitope may comprise at least one antibody binding region comprising at least a portion of the protein, said epitope preferably being comprised of at least one extracellular, soluble, hydrophilic, foreign, or cytoplasmic portion of the protein. The specified epitope may comprise any combination of at least one amino acid sequence of at least 1-3 amino acids, up to the entire specified portion of contiguous amino acid residues of SEQ ID NO: 145 (containing the initial 19 amino acid signal sequence for the p19 protein subunit) (or amino acid residues 74-86 of the p19 sequence without inclusion of the signal sequence), for example amino acid residues 93, 93 -94, 93-95, 93-96, 97-99, 100-102 of SEQ ID NO: 145, etc., which includes any portion or combination of these sequences.

Generally, the antibody or antigen-binding fragment of the present invention will comprise an antigen-binding region comprising at least one complementarity-determining region (CDR1, CDR2, and CDR3) or variant of at least one chain variable region. heavy; and at least one complementarity determining region (CDR1, CDR2, and CDR3) or variant of at least one light chain variable region. Optionally, the CDR sequences can be derived from human germline sequences, or from sequences that closely match germline sequences. For example, CDR's from a synthetic library derived from original mouse CDR's can be used. As a non-limiting example, the antibody or antigen-binding portion or variant may comprise at least one of the heavy chain CDR3s, for example selected from SEQ ID NOS: 1-6, 7-39 and 146, or 40 -45, and/or a light chain CDR3, for example selected from SEQ ID NOS: 46-51, 52-57, or 58-79. In a particular embodiment, the antibody or antigen-binding fragment may have an antigen-binding region that comprises at least a portion of at least one heavy chain CDR (ie, CDR1, CDR2, and/or CDR3) ( for example those described herein). In another particular embodiment, the antibody, or antigen-binding portion or variant, may have an antigen-binding region comprising at least a portion of at least one light chain CDR (i.e., CDR1, CDR2, and/or or CDR3) (for example those described herein).

In a preferred embodiment, the three heavy chain CDR's and the three light chain CDR's of the antibody or antigen-binding fragment can be prepared by chemically linking the various portions of the antibody (eg, CDR's, backbone) using conventional techniques, preparing and expressing a nucleic acid molecule (ie, one or more), encoding the antibody, using conventional recombinant DNA techniques, or using any other suitable method.

The anti-IL-23p19 antibody may comprise at least one of: a heavy or light chain variable region having a defined amino acid sequence. For example, in a preferred embodiment, the anti-1L-23p 19 antibody comprises at least one of: at least one heavy chain variable region optionally selected from SEQ ID NOS: 80,81,86-92, 99,101,103- 112,117-127, and 147, and/or at least one light chain variable region optionally selected from SEQ ID NOS: 82-85, 93-98,100,102,113-116, and 128-132. Antibodies that bind to human IL-23p19 and that comprise a defined heavy or light chain variable region can be prepared using appropriate methods. The specified antibody, portion or variant can be expressed using the encoding nucleic acid or portion thereof in a suitable host cell.

amino acid codes

The amino acids that make up the anti-IL-23p19 antibodies of the present invention are frequently abbreviated. Amino acid designations may be indicated by designating the amino acid with its one-letter code, its three-letter code, name, or three-nucleotide codons, as is well understood in the art (see Alberts B. et al., "Molecular Biology of the Cell”, third edition, Garland

Publishing Inc. New York, 1994). An anti-IL-23p19 antibody of the present invention may include one or more amino acid substitutions, deletions, or additions, whether from natural mutations or human manipulation, as specified herein. Amino acids in an anti-IL-23p19 antibody of the present invention that are essential for function can be identified by known methods, such as site-directed mutagenesis or alanine scanning mutagenesis (for example, Ausubel, supra, chs 8 15; Cunningham and Wells, Science 244:1081-1085 (1989)). This latter procedure introduces unique alanine mutations at each residue in the molecule. The resulting mutant molecule is then tested for biological activity, eg, at least IL-23 neutralizing activity. Sites that are critical for antibody binding can also be identified by structural analysis such as crystallization, nuclear magnetic resonance, or photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904 (1992), and from You and others, Science 255:306-312 (1992)).

The anti-IL-23p19 antibodies of the present invention may include, without limitation, at least a selected portion, sequence, or combination of 5 to all contiguous amino acids of the variable region sequences of SEQ ID NOS: 82-85, 93-98,100,102,113-116, and 128-132 and SEQ ID NOS: 80, 81,86-92, 99, 101, 103-112,117-127, and 147.

Non-limiting variants that can increase or maintain at least one of the mentioned activities include, without limitation, any of the above polypeptides that also comprises at least one mutation that corresponds to at least one substitution in the residues, which varies between the variant amino acid sequences described.

An anti-IL-23p19 antibody may optionally comprise a polypeptide with an amino acid sequence that varies from the sequences described herein (eg, one or more conservative substitutions of the sequences provided herein). Also, more specifically, the present invention comprises amino acid sequence variants of a light chain variable region of SEQ ID NOS: SEQ ID NOS: 82-85, 93-98,100,102,113-116, and 128-132, or the sequence of amino acids from a heavy chain variable region of SEQ ID NOS: 80, 81,86-92, 99,101,103-112,117-127, and 147.

As will be appreciated by those skilled in the art, the present invention includes at least one biologically active antibody of the present invention. Biologically active antibodies have a specific activity of at least 20%, 30%, or 40%, and preferably at least 50%, 60%, or 70%, and preferably at least 80%, 90%, or 95%- 100% or more than the known natural (not synthetic), endogenous or related antibody. Methods for testing and quantifying enzyme activity and substrate specificity are well known to those skilled in the art.

In another aspect, the invention relates to human antibodies and antigen-binding fragments, as described herein, which are modified by covalent attachment of an organic moiety. Such modifications can produce an antibody or antigen-binding fragment with improved pharmacokinetic properties (eg, increased serum half-life in vivo). The organic portion may be a linear or branched hydrophilic polymeric group, fatty acid group, or fatty acid ester group. In particular embodiments, the hydrophilic polymeric group may have a molecular weight of from about 800 to about 120,000 Daltons, and may be a polyalkane glycol (for example, polyethylene glycol (PEG), polypropylene glycol (PPG)), carbohydrate polymer, amino acid polymer, or polyvinylpyrrolidone. , and the fatty acid or fatty acid ester group may comprise from about eight to about forty carbon atoms.

Modified antibodies and antigen-binding fragments of the invention may comprise one or more organic moieties that are covalently linked to the antibody, directly or indirectly. Each organic moiety that is linked to an antibody or antigen-binding fragment of the invention can independently be a hydrophilic polymeric group, a fatty acid group or a fatty acid ester group. As used herein, the term "fatty acid" encompasses monocarboxylic acids and dicarboxylic acids. A "hydrophilic polymer group," as the term is used herein, refers to an organic polymer that is more soluble in water than in octane. For example, polylysine is more soluble in water than in octane. Thus, the invention includes an antibody modified by the covalent attachment of polylysine. Hydrophilic polymers suitable for modifying the antibodies of the invention can be linear or branched and include, for example, polyalkane glycols (for example PEG, monomethoxy polyethylene glycol (mPEG), PPG, and the like), carbohydrates (for example dextran, cellulose, oligosaccharides, polysaccharides and the like), hydrophilic amino acid polymers (for example polylysine, pollarginin, pollaspartate and the like), polyalkane oxides (for example polyethylene oxide, polypropylene oxide and the like) and polyvinylpyrrolidone. Preferably, the hydrophilic antibody-modifying polymer of the invention has a molecular weight of from about 800 to about 150,000 Daltons as a separate molecular entity. For example, you can use

PEG_5OOoy peg₂₀.000, where the subscript is the average molecular weight of the polymer in Daltons. The hydrophilic polymeric group may be substituted with one to about six alkyl, fatty acid, or fatty acid ester groups. Hydrophilic polymers that are substituted with a fatty acid or fatty acid ester group can be prepared using suitable methods. For example, a polymer comprising an amino group may be coupled with a fatty acid carboxylate or fatty acid ester; and an activated carboxylate (eg activated with Ν,Ν-carbonyldiimidazole) on a fatty acid or fatty acid ester, may be coupled with a hydroxyl group on a polymer.

The fatty acids and fatty acid esters for modifying the antibodies of the invention may be saturated or may contain one or more units of unsaturation. Fatty acids that are suitable for modifying the antibodies of the invention include, for example, n-dodecanoate (Ci₂, laurate), n-tetradecanoate (C₁₄, myristate), n-octadecanoate (C₁₈, stearate), n-eicosanoate (C₂₀, arachidate), n-docosanoate (C₂₂, behenate), n-triacontanoate (C₃₀), n-tetracontanoate (C₄₀), c/s-A9-octadecanoate (0_Ί8, oleate), Δ5.8,11,14-eicosatetraenoate all c/s (C₂₀, arachidonate), octanedioic acid, tetradecanedioic acid, octadecanedioic acid, docosanedioic acid, and the like. Suitable fatty acid esters include dicarboxylic acid monoesters comprising a linear or branched lower alkyl group. The lower alkyl group may comprise from one to about twelve carbon atoms, preferably from one to about six carbon atoms.

Modified human antibodies and antigen-binding fragments can be prepared using suitable methods, such as reaction with one or more modifying agents. A "modifying agent" as used herein refers to a suitable organic group (eg hydrophilic polymer, fatty acid, fatty acid ester) that comprises an activating group. An "activating group" is a chemical moiety or functional group that under the appropriate conditions can react with a second chemical group, thereby forming a covalent bond between the modifying agent and the second chemical group. For example, amine reactive activating groups include electrophilic groups such as tosylate, mesylate, halogen (chloro, bromo, fluoro, iodo), N-hydroxysuccinimyl (NHS) esters, and the like. Activating groups that can react with thiols include, for example, maleimide, iodoacetyl, acryloyl, pyridyldisulfides, 5-thiol-2-nitrobenzoic acid thiol (TNB-thiol), and the like. An aldehyde functional group can be coupled to amine- or hydrazide-containing molecules, and an azide group can react with a trivalent phosphorus group to form phosphoramidate or phosphorimide bonds. Suitable methods for introducing activating groups into molecules are known in the art (see, for example, Hermanson GT, "Bioconjugate Techniques, Academic Press, San Diego, California (1996)). An activating group can be linked directly to the organic group (eg hydrophilic polymer, fatty acid, fatty acid ester), or via a linker moiety, eg a divalent group from C_rC12, where one or more carbon atoms may be replaced with a heteroatom such as oxygen, nitrogen, or sulfur. Suitable linker moieties include, for example, tetraethylene glycol, (CH₂)₃-, -NH-(CH₂)₆-NH-, -(CH₂)₂-NH- and -CH₂-O-CH₂-CH₂-O-CH₂-CH₂-O-CH-NH-. Modifying agents comprising a linker moiety can be produced, for example, by reacting a mono-Boc-alkyldiamine (eg mono-Boc-ethylenediamine, mono-Boc-diaminohexane), with a fatty acid in the presence of 1-ethyl- 3-(3-dimethylaminopropyl)carbodiimide (EDC), to form an amide bond between the free amine and the fatty acid carboxylate. The Boc protecting group can be removed from the product by treatment with trifluoroacetic acid (TFA) to expose a primary amine that can be coupled with another carboxylate as described, or reacted with maleic anhydride, and the resulting product cyclized to produce an activated maleimido derivative of the fatty acid derivative (see, for example, Thompson et al., WO 92/16221, the entire teaching of which is incorporated herein by reference).

The modified antibodies of the invention can be produced by reacting a human antibody or antigen-binding fragment with a modifying agent. For example, the organic moieties can be linked to the antibody in a non-site-specific manner using an amine-reactive modifying agent, for example a PEG NHS ester. Modified human antibodies or antigen-binding fragments thereof can also be prepared by reducing disulfide bonds (eg, intrachain disulfide bonds) from an antibody or antigen-binding fragment. The reduced antibody or antigen-binding fragment can then be reacted with a thiol-reactive modifying agent to produce the modified antibody of the invention. Human antibodies and their modified antigen-binding fragments, comprising an organic portion that is linked to specific sites on an antibody of the present invention, can be prepared using suitable methods, such as reverse proteolysis (Fisch et al., Bioconjugate Chem. , 3:147-153 (1992); Werlen et al., Bioconjugate Chem., 5:411-417 (1994); Kumaran et al., Protein Sci., 6(10):2233-2241 (1997); Itoh et al. , Bioorg.Chem. 24(1): 59-68 (1996); Capellas et al., Biotechnol. Bioeng., 56(4):456-463 (1997)), and the methods described in Hermanson GT, "Bioconjugate Techniques", Academic Press, San Diego, California (1996).

Anti-idiotype antibodies for anti-IL-23p19 antibody compositions

In addition to monoclonal anti-IL-23p19 antibodies, the present invention is also directed to an anti-idiotypic (anti-ld) antibody, specific for such antibodies of the invention. An anti-ld antibody is an antibody that recognizes unique determinants generally associated with the antigen binding region of another antibody. The anti-ld can be prepared by immunizing an animal of the same species and genetic type (eg mouse strain) as the source of the Id antibody, with the antibody or a CDR-containing region thereof. The immunized animal will recognize and respond to the idiotypic determinants of the immunizing antibody and will produce an anti-ld antibody. The anti-ld antibody can also be used as an "immunogen" to induce an immune response in another animal, producing the so-called anti-anti-Id antibody.

The present invention also provides at least one anti-IL23p19 antibody composition comprising at least one, at least two, at least three, at least four, at least five, at least six or more anti-IL23p19 antibodies. -IL-23p19, as described herein and/or as known in the art, provided in a non-natural composition, mixture, or form. These compositions comprise non-natural compositions containing at least one or two specified full-length, C-terminally and/or N-terminally deleted vanants, domains, fragments or variants of the amino acid sequence of the anti-IL-23p19 antibody, selected from the group consisting of 70-100% of the contiguous amino acids of SEQ ID NOS: 1-132,146 and 147, or specified fragments, domains or variants thereof. Preferred anti-IL-23p19 antibody compositions include at least one or two full-length fragments, domains, or variants of at least one CDR or LBR containing portions of the anti-IL-23p19 antibody sequence described herein, for example 70-100% of SEQ ID NOS: 1-132,146 and 147, or specified fragments, domains or variants thereof. Additional preferred compositions comprise 40-99% of at least one of 70-100% of SEQ IDs

NOS: 1-132,146 and 147, or specified fragments, domains or variants thereof. These composition percentages are by weight, volume, concentration, molarity, or molality as liquid or dry solutions, mixtures, suspensions, emulsions, particles, powders, or colloids, as known in the art or described herein.

Antibody compositions comprising additional therapeutically active ingredients

Antibody compositions of the invention may optionally comprise an effective amount of at least one compound or protein selected from at least one of: an anti-infective drug, a cardiovascular (CV) system drug, a central nervous system (CNS) drug, an autonomic nervous system (ANS) drug, a respiratory tract drug, a gastrointestinal tract drug ( Gl), a hormonal drug, a fluid or electrolyte balance drug, a hematology drug, an antineoplastic agent, an immunomodulatory drug, an ophthalmic, otic, or nasal drug, a topical drug, a nutritional drug, or the like. Such drugs are well known, including their formulations, indications, dosing, and administration presented here (see, for example, "Nursing 2001 Handbook of Drugs," 21^to edition, Springhouse Corp., Springhouse, Pennsylvania, 2001; "Health Professional's Drug Guide 2001", ed., Shannon, Wilson, Stang, Prentice-Hall, Inc, Upper Saddle River, NJ; "Pharmacotherapy Handbook," Wells et al., ed., Appleton & Lange, Stamford, Connecticut, each of which is incorporated herein by reference).

The anti-infective drug may be at least one selected from amebicides or at least one antiprotozoal, anthelmintic, antifungal, antimalarial, antituberculous, or at least one antileprosy, aminoglycosides, penicillins, cephalosporins, tetracyclines, sulfonamides, fluoroquinolones, antivirals, macrolide antiinfectives , and miscellaneous anti-infectives. The CV drug may be at least one selected from inotropic, antiarrhythmic, antianginal, antihypertensive, antilipidemic, and miscellaneous cardiovascular drugs. The CNS drug may be at least one selected from non-narcotic analgesics or at least one selected from antipyretics, nonsteroidal anti-inflammatory drugs, narcotics or at least one opioid analgesic, sedative-hypnotics, anticonvulsants, antidepressants, anxiolytics, antipsychotics, stimulants central nervous system, antiparkinsonian, and miscellaneous central nervous system drugs. The ANS drug may be at least one selected from cholinergics (parasympathomimetics), anticholinergics, adrenergics (sympathomimetics), adrenergic blockers (sympatholytics), skeletal muscle relaxants, and neuromuscular blockers. The respiratory tract drug may be at least one selected from antihistamines, bronchodilators, expectorants or at least antitussives, and miscellaneous respiratory drugs. The Gl tract drug may be at least one selected from antacids or at least an adsorbent or at least one antiflatulent, digestive enzyme or at least one gallstone solubilizer, antidiarrheal, laxative, antiemetic and antiulcer drug. The hormonal drug may be at least one selected from corticosteroids, androgens or at least one anabolic steroid, estrogen or at least one progestin, gonadotropin, antidiabetic drug or at least one glucagon, thyroid hormone, thyroid hormone antagonist, pituitary hormone, and parathyroid-type drug. The fluid and electrolyte balance drug may be at least one selected from diuretics, electrolytes or at least one replacement solution, acidulant or at least alkalinizer. The hematologic drug may be at least one selected from hematinic, anticoagulant, blood-derived, and thrombolytic enzymes. The antineoplastic agents may be at least one selected from alkylating drugs, antimetabolites, antibiotic antineoplastics, hormonal balance-disrupting antineoplastics, and miscellaneous antineoplastics. The immunomodulatory drug can be at least one selected from immunosuppressants, vaccines or at least one toxoid, antitoxin or at least one antivenom, immune serum, and biological response modifier. The ophthalmic, otic and nasal drugs may be at least one selected from ophthalmic anti-infectives, ophthalmic anti-inflammatories, miotics, mydriatics, ophthalmic vasoconstrictors, miscellaneous ophthalmic, otic and nasal drugs. The topical drug may be at least one selected from local anti-infectives, scabicides, or at least one topical pediculicide or corticosteroid. The nutritional drug can be at least one selected from vitamins, minerals or calories; see for example the contents of the “Nursing 2001 Drug Handbook”, supra.

The amebicide or antiprotozoal may be at least one selected from atovaquone, chloroquine hydrochloride, chloroquine phosphate, metronidazole, metronidazole hydrochloride, and pentamidine isethionate. The anthelmintic may be at least one selected from mebendazole, pyrantel pamoate and thiabendazole. The antifungal may be at least one selected from amphotericin B, amphotericin B cholesteryl sulfate complex, amphotericin B lipid complex, liposomal amphotericin B, fluconazole, flucytosine, micronized griseofulvin, ultramicronized griseofulvin, itraconazole, ketoconazole, nystatin, and hydrochloride. of terbinafine. The antimalarial may be at least one selected from chloroquine hydrochloride, chloroquine phosphate, doxycycline, hydroxychloroquine sulfate, mefloquine hydrochloride, primaquine phosphate, pyrimethamine, and pyrimethamine with sulfadoxine. The antituberculous or antileprotic may be one selected from clofazimine, cycloserine, dapsone, ethambutol hydrochloride, isoniazid pyrazinamide, rifabutin, rifampin, rifapentine, and streptomycin sulfate. The aminoglycoside may be at least one selected from amikacin sulfate, gentamicin sulfate, neomycin sulfate, streptomycin sulfate, and tobramycin sulfate. The penicillin can be at least one selected from amoxicillin/clavulanate potassium, amoxicillin trihydrate, ampicillin, ampicillin sodium, ampicillin trihydrate, ampicillin sodium/sulbactan sodium, cloxacillin sodium, dicloxacillin sodium, mezlocillin sodium, nafcillin Sodium, Oxacillin Sodium, Benzathine Penicillin G, Penicillin G Potassium, Penicillin G Procaine, Penicillin G Sodium, Penicillin V Potassium, Piperacillin Sodium, piperacillin sodium/tazobactam sodium, tricarcillin disodium and tricalcillin disodium/clavulanate potassium. The cephalosporin may be at least one selected from cefaclor, cefadroxil, cefazolin sodium, cefdinir, cefepime hydrochloride, cefexime, cefmetazole sodium, cefonocid sodium, cefoperazone sodium, cefotaxime sodium, cefotetan disodium, cefoxitin sodium, cefpodoxime proxetil, cefprozil, ceftazidime, ceftibuten, ceftizoxime sodium, ceftriaxone sodium, cefuroxime axetil, cefuroxime sodium, cephalexin hydrochloride, cephalexin monohydrate, cephradine, and loracarbef. The tetracycline may be at least one selected from demeclocycline hydrochloride, doxycycline calcium, doxycycline hyclate, doxycycline hydrochloride, doxycycline monohydrate, minocycline hydrochloride, and tetracycline hydrochloride. The sulfonamide may be at least one selected from cotrimoxazole, sulfadiazine, sulfamethoxazole, sulfisoxazole, and acetyl sulfisoxazole. The fluoroquinolone may be at least one selected from alatrofloxacin mesylate, ciprofloxacin, enoxacin, levofloxacin, lomefloxacin hydrochloride, nalidixic acid, norfloxacin, ofloxacin, sparfloxacin, and trovafloxacin mesylate. The fluoroquinolone may be at least one selected from alatrofloxacin mesylate, ciprofloxacin, enoxacin, levofloxacin, lomefloxacin hydrochloride, nalidixic acid, norfloxacin, ofloxacin, sparfloxacin, and trovafloxacin mesylate. The antiviral may be at least one selected from abacavir sulfate, acyclovir sodium, amantadine hydrochloride, amprenavir, cidofovir, delavirdine mesylate, didanosine, efavirenz, famciclovir, fomivirsen sodium, foscarnet sodium, ganciclovir, indinavir sulfate, lamivudine, lamivudine/zidovudine, nelfinavir mesylate, nevirapine, oseltamivir phosphate, ribavirin, rimantadine hydrochloride, ritonavir, saquinavir, saquinavir mesylate, stavudine, valacyclovir hydrochloride, zalcitabine, zanamivir, and zidovudine. The macrolide anti-infective may be at least one selected from azithromycin, clarithromycin, dirithromycin, erythromycin base, erythromycin estolate, erythromycin ethylsuccinate, erythromycin lactobionate and erythromycin stearate. The miscellaneous anti-infective agent may be at least one selected from aztreonam, bacitracin, chloramphenicol sodium succinate, clindamycin hydrochloride, clindamycin palmitate hydrochloride, clindamycin phosphate, imipenem and cilastatin sodium, meropenem, nitrofurantoin in macrocrystals, nitrofurantoin in microcrystals, quinupristin/dalfopristin, spectinomycin hydrochloride, trimethoprim, and vancomycin hydrochloride (see, for example, p. 24-214 of the “Nursing 2001 Drug Handbook”).

The inotropic agent can be at least one selected from amrinone lactate, digoxin, and milrinone lactate. The antiarrhythmic agent may be at least one selected from adenosine, amiodarone hydrochloride, atropine sulfate, bretylium tosylate, diltiazem hydrochloride, disopyramide, disopyramide phosphate, esmolol hydrochloride, flecainide acetate, ibutilide fumarate, lidocaine hydrochloride. , mexiletine hydrochloride, moricizine hydrochloride, phenytoin, phenytoin sodium, procainamide hydrochloride, propafenone hydrochloride, propranolol hydrochloride, quinidine bisulfate, quinidine gluconate, quinidine polygalacturonate, quinidine sulfate, sotalol, tocainide hydrochloride, and verapamil hydrochloride. The antianginal agent may be at least one selected from amlodipidine besilate, amyl nitrite, bepridil hydrochloride, diltiazem hydrochloride, isosorbide dinitrate, isosorbide mononitrate, nadolol, nicardipine hydrochloride, nifedipine, nitroglycerin, propranolol hydrochloride , verapamil and verapamil hydrochloride. The antihypertensive agent may be at least one selected from acebutolol hydrochloride, amlodipine besilate, atenolol, benazepril hydrochloride, betaxolol hydrochloride, bisoprolol fumarate, candesartan cilexetil, captopril, carteolol hydrochloride, carvedilol, clonidine, clonidine hydrochloride, Diazoxide, Diltiazem Hydrochloride, Doxazosin Mesylate, Enalaprilat, Enalapril Maleate, Eprosartan Mesylate, Felodipine, Fenoldopam Mesylate, Fosinopril Sodium, guanabenz acetate, guanadrel sulfate, guanfacine hydrochloride, hydralazine hydrochloride, irbesartan, isradipine, labetalol hydrochloride, lisinopril, losartan potassium, methyldopa, methyldopate hydrochloride, metoprolol succinate, metoprolol tartrate, minoxidil, moexipril hydrochloride, nadolol , nicardipine hydrochloride, nifedipine, nisoldipine, sodium nitroprusside, penbutolol sulfate, perindopril erbumine, phentolamine mesylate, pindolol, prazosin hydrochloride, propranolol hydrochloride, quinapril hydrochloride, ramipril, telmisartan, terazosin hydrochloride, timolol maleate, trandolapril, valsartan and verapamil hydrochloride. The antilipidemic agent may be at least one selected from atorvastatin calcium, cerivastatin sodium, cholestyramine, colestipol hydrochloride, fenofibrate (micronized), fluvastatin sodium, gemfibrozil, lovastatin, niacin, pravastatin sodium, and simvastatin. The miscellaneous CV drug may be at least one selected from abciximab, alprostadil, arbutamine hydrochloride, cilostazol, clopidogrel bisulfate, dipyridamole, eptifbatide, midodrine hydrochloride, pentoxyfilline, ticlopidine hydrochloride, and tirofiban hydrochloride (see, for example, pp. 215-336 of the “Nursing 2001 Drug Handbook”).

The non-narcotic analgesic or antipyretic may be at least one selected from paracetamol, aspirin, choline magnesium trisalicylate, diflunisal and magnesium salicylate. The nonsteroidal anti-inflammatory drug may be at least one selected from celecoxib, diclofenac potassium, diclofenac sodium, etodolac, fenoprofen calcium, flurbiprofen, ibuprofen, indomethacin, indomethacin sodium trihydrate, ketoprofen, ketorolac tromethamine, nabumetone, naproxen, naproxen sodium, oxaprozin, piroxicam, rofecoxib, and sulindac. The narcotic or opioid analgesic may be at least one selected from alfentanil hydrochloride, buprenorphine hydrochloride, butorphanol tartrate, codeine phosphate, codeine sulfate, fentanyl citrate, fentanyl transdermal system, transmucosal fentanyl, hydromorphone hydrochloride , meperidine hydrochloride, methadone hydrochloride, morphine hydrochloride, morphine sulfate, morphine tartrate, nalbuphine hydrochloride, oxycodone hydrochloride, oxycodone pectinate, oxymorphone hydrochloride, pentazocine hydrochloride, pentazocine hydrochloride and naloxone hydrochloride, pentazocine lactate, propoxyphene hydrochloride, propoxyphene napsylate, remifentanil hydrochloride, sufentanil citrate, and tramadol hydrochloride. The sedative-hypnotic may be at least one selected from doral hydrate, estazolam, flurazepam hydrochloride, pentobarbital, pentobarbital sodium, phenobarbital sodium, secobarbital sodium, temazepam, triazolam, zaleplon, and zolpidem tartrate. The anticonvulsant may be at least one selected from acetazolamide sodium, carbamazepine, clonazepam, clorazepate dipotassium, diazepam, divalproex sodium, ethosuximide, fosphenytoin sodium, gabapentin, lamotrigine, magnesium sulfate, phenobarbital, phenobarbital sodium, phenytoin, phenytoin sodium, phenytoin sodium (prolonged), primidone, tiagabine hydrochloride, topiramate, sodium valproate, and valproic acid. The antidepressant may be at least one selected from amitriptyline hydrochloride, amitriptyline pamoate, amoxapine, bupropion hydrochloride, citalopram hydrobromide, clomipramine hydrochloride, desipramine hydrochloride, doxepin hydrochloride, fluoxetine hydrochloride, imipramine hydrochloride, pamoate imipramine, mirtazapine, nefazodone hydrochloride, nortriptyline hydrochloride, paroxetine hydrochloride, phenelzine sulfate, sertraline hydrochloride, tranylcypromine sulfate, trimipramine maleate, and venlafaxine hydrochloride. The anxiolytic drug may be at least one selected from alprazolam, busplrone hydrochloride, chlordiazepoxide, chlordiazepoxide hydrochloride, clorazepate dipotassium, diazepam, doxepin hydrochloride, hydroxyzine embonate, hydroxyzine hydrochloride, hydroxyzine pamoate, lorazepam, meprobamate, midazolam hydrochloride. and oxazepam. The antipsychotic drug may be at least one selected from chlorpromazine hydrochloride, clozapine, fluphenazine decanoate, fluephenazine enanthate, fluphenazine hydrochloride, haloperidol, haloperid decanoate lactate, loxapine hydrochloride, loxapine succinate, mesoridazine, molindone hydrochloride, olanzapine, perphenazine, pimozide, prochlorperazine, quetiapine fumarate, risperidone, thioridazine hydrochloride, thiothixene, thiothixene hydrochloride and trifluoperazine hydrochloride. The central nervous system stimulant may be at least one selected from amphetamine sulfate, caffeine, dextroamphetamine sulfate, doxapram hydrochloride, methamphetamine hydrochloride, methylphenidate hydrochloride, modafinil, pemoline, and phentermine hydrochloride. The antiparkinsonian agent may be at least one selected from amantadine hydrochloride, benztropine mesylate, biperiden hydrochloride, biperiden lactate, bromocriptine mesylate, carbidopa-levodopa, entacapone, levodopa, pergolide mesylate, pramipexole dihydrochloride, ropinirole hydrochloride, selegiline hydrochloride, tolcapone and trihexyphenidyl hydrochloride. The miscellaneous central nervous system drug may be at least one selected from bupropion hydrochloride, donepezil hydrochloride, droperidol, fluvoxamine maleate, lithium carbonate, lithium citrate, naratriptan hydrochloride, nicotine polacrilex, nicotine transdermal system, propofol , rizatriptan benzoate, sibutramine hydrochloride monohydrate, sumatriptan succinate, tacrine hydrochloride, and zolmitriptan (see, for example, p. 337-530 of the “Nursing 2001 Drug Handbook”).

The cholinergic (eg, parasympathomimetic) agent may be at least one selected from betanocol chloride, edrophonium chloride, neostigmine bromide, neostigmine methylsulfate, physostigmine salicylate, and pyridostigmine bromide. The anticholergic may be at least one selected from atropine sulfate, dicyclomine hydrochloride, glycopyrrolate, hyoscyamine, hyoscyamine sulfate, propantheline bromide, scopolamine, scopolamine butylbromide, and scopolamine hydrobromide. The adrenergic (sympathomimetic) may be at least one selected from dobutamine hydrochloride, dopamine hydrochloride, metaraminol bitartrate, norepinephrine bitartrate, phenylephrine hydrochloride, pseudoephedrine hydrochloride and pseudoephedrine sulfate. The adrenergic (sympatholytic) blocker may be at least one selected from dihydroergotamine mesylate, ergotamine tartrate, methysergide maleate and propranolol hydrochloride. The skeletal muscle relaxant may be at least one selected from baclofen, carisoprodol, chlorzoxazone, cyclobenzaprine hydrochloride, dantrolene sodium, methocarbamol, and tizanidine hydrochloride. The neuromuscular blocker may be at least one selected from atracurium besilate, cisatracurium besilate, doxacurium chloride, mivacurium chloride, pancuronium bromide, pipecuronium bromide, rapacuronium bromide, rocuronium bromide, succinylcholine chloride, tubocurarine chloride and vecuronium bromide (see, for example, p. 531-84 of the "Nursing 2001 Drug Handbook").

The antihistamimic may be at least one selected from brompheniramine maleate, cetirizine hydrochloride, chlorpheniramine maleate, clemastine fumarate, cyproheptadine hydrochloride, diphenhydramine hydrochloride, fexofenadine hydrochloride, loratadine, promethazine hydrochloride, promethazine theoclate, and triprolidine. The bronchodilator may be at least one selected from albuterol, albuterol sulfate, aminophylline, atropine sulfate, ephedrine sulfate, epinephrine, epinephrine bitartrate, epinephrine hydrochloride, ipratropium bromide, isoproterenol, isoproterenol hydrochloride, isoproterenol sulfate, levalbuterol hydrochloride, metaproterenol sulfate, oxtriphylline, pirbuterol acetate, salmeterol xinafoate, terbutaline sulfate, and theophylline. The expectorant or antitussive may be at least one selected from benzonatate, codeine phosphate, codeine sulfate, dextromethorphan hydrobromide, diphenhydramine hydrochloride, guaifenesin, and hydromorphone hydrochloride. The miscellaneous respiratory drug may be at least one selected from acetylcysteine, beclomethasone dipropionate, beractant, budesonide, calfactant, cromolyn sodium, domase alfa, epoprostenol sodium, flunisolide, fluticasone propionate, montelukast sodium, nedocromil sodium, palivizumab , triamcinolone acetonide, zafirlukast and zileuton (see, for example, p. 585-642 of the "Nursing 2001 Drug Handbook").

The antacid, adsorbent or antiflatulent may be at least one selected from aluminum carbonate, aluminum hydroxide, calcium carbonate, magaldrate, magnesium hydroxide, magnesium oxide, simethicone and sodium bicarbonate. The digestive enzyme or gallstone solubilizer may be at least one selected from pancreatin, pancrelipase and ursodiol. The antidiarrheal may be at least one selected from attapulgite, bismuth subsalicylate, calcium polycarbophil, diphenoxylate hydrochloride and atropine sulfate, loperamide, octreotide acetate, tincture of opium and tincture of camphorated opium. The laxative may be at least one selected from bisacodyl, calcium polycarbophil, cascara sagrada, cascara sagrada aromatic fluid extract, cascara sagrada fluid extract, castor oil, calcium docusate, sodium docusate, glycerin, lactulose, magnesium, magnesium hydroxide, magnesium sulfate, methylcellulose, mineral oil, polyethylene glycol or electrolyte solution, psyllium, senna, and sodium phosphates. The antiemetic may be at least one selected from chlorpromazine hydrochloride, dimenhydrinate, dolasetron mesylate, dronabinol, granisetron hydrochloride, meclizine hydrochloride, metocloproamide hydrochloride, ondansetron hydrochloride, perphenazine, prochlorperazine, prochlorperazine edisylate, prochlorperazine maleate, promethazine hydrochloride, scopolamine, thiethylperazine maleate and trimethobenzamide hydrochloride. The antiulcer drug may be at least one selected from cimetidine, cimetidine hydrochloride, famotidine, lansoprazole, misoprostol, nizatidine, omeprazole, rabeprozole sodium, ranitidine, bismuth citrate, ranitidine hydrochloride, and sucralfate (see, for example, p. 643-95 of the “Nursing 2001 Drug Handbook”).

The corticosteroid may be at least one selected from betamethasone, betamethasone acetate or betamethasone sodium phosphate, betamethasone sodium phosphate, cortisone acetate, dexamethasone, dexamethasone acetate, dexamethasone sodium phosphate, fludrocortisone acetate, hydrocortisone, hydrocortisone acetate , hydrocortisone cypionate, hydrocortisone sodium phosphate, hydrocortisone sodium succinate, methylprednisolone, methylprednisolone acetate, methylprednisolone sodium succinate, prednisolone, prednisolone acetate, prednisolone sodium phosphate, prednisolone tebutate, prednisone, triamcinolone, triamcinolone acetonide, and triamcinolone diacetate. The androgen or anabolic steroid may be at least one selected from danazol, fluoxymesterone, methyltestosterone, nandrolone decanoate, nandrolone phenpropionate, testosterone, testosterone cypionate, testosterone enanthate, testosterone propionate, and testosterone transdermal system. The estrogen or progestin may be at least one selected from esterified estrogens, estradiol, estradiol cypionate, estradiol/norethindrone acetate transdermal system, estradiol valerate, (conjugated) estrogens, estropipate, ethinyl estradiol, ethinyl estradiol and desogestrel, ethinyl estradiol and diacetate of ethynodiol, ethinyl estradiol and desogestrel, ethinyl estradiol and ethynodiol diacetate, ethinyl estradiol and levonorgestrel, ethinyl estradiol and norethindrone, ethinyl estradiol and norethindrone acetate, ethinyl estradiol and norgestimate, ethinyl estradiol and norgestrel, ethinyl estradiol and norethindrone and ferrous acetate and fumarate, levonorgestrel, medroxyprogesterone acetate, mestranol and norethindrone, norethindrone, norethindrone acetate, norgestrel and progesterone. The gonadroptropin can be at least one selected from ganirelix acetate, gonadorelin acetate, histrelin acetate and menotropins. The antidiabetic or glucagon may be at least one selected from acarbose, chlorpropamide, glimepiride, glipizide, glucagon, glyburide, insulins, metformin hydrochloride, miglitol, pioglitazone hydrochloride, repaglinide, rosiglitazone maleate and troglitazone. The thyroid hormone can be at least one selected from levothyroxine sodium, liothyronine sodium, liotrix and thyroid. The thyroid hormone antagonist may be at least one selected from methimazole, potassium iodide, potassium iodide (saturated solution), propylthiouracil, radioactive iodine ('³¹ l-sodium iodide) and strong iodine solution. The pituitary hormone may be at least one selected from corticotropin, cosyntropin, desmopressin acetate, leuprolide acetate, depot corticotropin, somatrem, somatropin, and vasopressin. The parathyroid-type drug may be at least one selected from calcifediol, calcitonin (human), calcitonin (salmon), calcitriol, dihydrotachysterol, and etidronate disodium (see, for example, p. 696-796 of the “Nursing 2001 Drug Handbook”).

The diuretic may be at least one selected from acetazolamide, sodium acetazolamide, amiloride hydrochloride, bumetanide, chlorthalidone, sodium ethacrynate, ethacrynic acid, furosemide, hydrochlorothiazide, indapamide, mannitol, metolazone, spironolactone, torsemide, triamterene and urea. The electrolyte or replacement solution may be at least one selected from calcium acetate, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, calcium lactate, calcium phosphate (dibasic), calcium, calcium phosphate (tribasic), dextran (high molecular weight), dextran (low molecular weight), hetastarch, magnesium chloride, magnesium sulfate, potassium acetate, potassium bicarbonate, potassium chloride, potassium gluconate, Ringer's solution for injection, Ringer's solution for injection (lactated), and sodium chloride. The acidulant or alkalinizer can be at least one selected from sodium bicarbonate, sodium lactate and tromethamine (see, for example, p. 797-833 of the "Nursing 2001 Drug Handbook").

The hematinic may be at least one selected from ferrous fumarate, ferrous gluconate, ferrous sulfate, ferrous sulfate (dry), iron dextran, iron sorbitol, polysaccharide-iron complex, and sodium ferric gluconate complex. The anticoagulant may be at least one selected from ardeparin sodium, dalteparin sodium, danaparoid sodium, enoxaparin sodium, calcium heparin, heparin sodium, and warfarin sodium. The blood derivative may be at least one selected from 5% albumin, 25% albumin, antihemophilic factor, anti-coagulant inhibitor complex, antithrombin III (human), factor IX (human), factor IX complex , and plasma protein fractions. The thrombolytic enzyme can be at least one selected from alteplase, anistreplase, reteplase (recombinant), streptokinase and urokinase (see, for example, p. 834-66 of the "Nursing 2001 Drug Handbook").

The alkylating drug may be at least one selected from busulfan, carboplatin, carmustine, chlorambucil, cisplatin, cyclophosphamide, ifosfamide, lomustine, mechlorethamine hydrochloride, melphalan, melphalan hydrochloride, streptozocin, temozolomide and thiotepa. The antimetabolite may be at least one selected from capecitabine, cladribine, cytarabine, floxuridine, fludarabine phosphate, fluorouracil, hydroxyurea, mercaptopurine, methotrexate, methotrexate sodium, and thioguanine. The antineoplastic antibiotic may be at least one selected from bleomycin sulfate, dactinomycin, liposomal daunorubicin citrate, daunorubicin hydrochloride, doxorubicin hydrochloride, liposomal doxorubicin hydrochloride, epirubicin hydrochloride, idarubicin hydrochloride, mitomycin, pentostatin, plicamycin and valrubicin. . The antineoplastic that disrupts the hormonal balance may be at least one selected from anastrozole, bicalutamide, estramustine sodium phosphate, exemestane, flutamide, goserelin acetate, letrozole, leuprolide acetate, megestrol acetate, nilutamide, tamoxifen citrate, testolactone and toremifene citrate. The miscellaneous antineoplastic may be at least one selected from asparaginase, bacillus Calmette-Guerin (BCG) (live intravesical), dacarbazine, docetaxel, etoposide, etoposide phosphate, gemcitabine hydrochloride, irinotecan hydrochloride, mitotane, mitoxantrone hydrochloride, paclitaxel , pegaspargase, porfimer sodium, procarbazine hydrochloride, rituximab, teniposide, topotecan hydrochloride, trastuzumab, tretinoin, vinblastine sulfate, vincristine sulfate and vinorelbine tartrate (see, for example, p. 867-963 of the "Nursing 2001 Drug Handbook").

The immunosuppressant may be at least one selected from azathioprine, basiliximab, cyclosporine, daclizumab, lymphocyte immunoglobulin, muromonab-CD3, mycophenolate mofetil, mycophenolate mofetil hydrochloride, sirolime and tacrolimus. The vaccine or toxoid may be at least one selected from BCG vaccine, cholera vaccine, diphtheria and tetanus toxoids (adsorbed), diphtheria and tetanus toxoids and acellular pertussis vaccine adsorbed, diphtheria and tetanus toxoids and pertussis vaccine. Whole cell, Haemophilius b conjugate vaccines, Hepatitis A vaccine (inactivated), Hepatitis B vaccine (recombinant), influenza virus vaccine 1999-2000 trivalent types A and B (purified surface antigen), influenza virus vaccine 1999-2000 trivalent types A and B (subvirion or purified subvirion), influenza virus vaccine 1999- 2000 Trivalent Types A and B (Whole Virion), Japanese Encephalitis Virus Vaccine (Inactivated), Lyme Disease Vaccine (OspA Recombinant), Measles Mumps Rubella Virus Vaccine (Live), Measles, Mumps and Rubella Virus (live attenuated) Vaccine, Measles Virus Vaccine (live attenuated), Meningococcal Polysaccharide Vaccine, Measles Virus Vaccine (live), Plague Vaccine, Pneumococcal Vaccine (Polyvalent), Vaccine Poliovirus vaccine (inactivated), Poliovirus vaccine (live, oral, trivalent), Rabies vaccine (adsorbed), Rabies vaccine (human diploid cell), Rubella and mumps virus (live) vaccine, Rubella and mumps virus vaccine (alive, rubella, tetanus toxoid (adsorbed), tetanus toxoid (fluid), typhoid vaccine (oral), typhoid vaccine (parenteral), typhoid Vi polysaccharide vaccine, varicella virus vaccine, and yellow fever vaccine. The antitoxin or antivenom may be at least one selected from black widow spider antivenom, Crotalidae antivenom (polyvalent), diphtheria antitoxin (equine), and Micrurus fulvius antivenom. The immune serum may be at least one selected from cytomegalovirus immunoglobulin (intravenous), hepatitis B immunoglobulin (human), intramuscular immunoglobulin, intravenous immunoglobulin, rabies immunoglobulin (human), respiratory syncytial virus intravenous immunoglobulin (human), Rh immune globulin₀(D) (human), Rh immunoglobulin₀(D) intravenous (human), tetanus immunoglobulin (human), and varicella-zoster immunoglobulin. The biologic response modifier may be at least one selected from aldesleukin, epoetin alfa, filgrastim, glatiramer acetate injection, interferon alfacon-1, interferon alfa-2a (recombinant), interferon alfa-2b (recombinant), interferon beta-1a , interferon beta-1b (recombinant), interferon gamma-1b, levamisole hydrochloride, oprelvekin, and sargramostim (see, for example, p. 964-1040 of the “Nursing 2001 Drug Handbook”).

The ophthalmic anti-infective agent can be selected from bacitracin, chloramphenicol, ciprofloxacin hydrochloride, erythromycin, gentamicin sulfate, ofloxacin 0.3%, polymyxin B sulfate, sulfacetamide sodium 10%, sulfacetamide sodium 15%, sulfacetamide sodium 10%. 30%, tobramycin and vldarabine. The ophthalmic anti-inflammatory agent may be at least one selected from dexamethasone, dexamethasone sodium phosphate, diclofenac sodium 0.1%, fluorometholone, flurbiprofen sodium, ketorolac tromethamine, prednisolone acetate (suspension) and prednisolone sodium phosphate (solution). The miotic may be at least one selected from acetylcholine chloride, carbachol (intraocular), carbachol (topical), echothiophate iodide, pilocarpine, pilocarpine hydrochloride, and pilocarpine nitrate. The mydriatic may be at least one selected from atropine sulfate, cyclopentolate hydrochloride, epinephrine hydrochloride, epinephril borate, homatropine hydrobromide, phenylephrine hydrochloride, scopolamine hydrobromide, and tropicamide. The ophthalmic vasoconstrictor may be at least one selected from naphazoline hydrochloride, oxymetazoline hydrochloride, and tetrahydrozoline hydrochloride. The miscellaneous ophthalmic agent may be at least one selected from apraclonidine hydrochloride, betaxolol hydrochloride, brimonidine tartrate, carteolol hydrochloride, dipivefrin hydrochloride, dorzolamide hydrochloride, emedastine difumarate, fluorescein sodium, ketotifen fumarate, latanoprost, hydrochloride levobunolol, metipranolol hydrochloride, sodium chloride (hypertonic) and timolol maleate. The otic agent may be at least one selected from boric acid, carbamide peroxide, chloramphenicol, and triethanolamine polypeptide oleate condensate. The nasal drug may be at least one selected from beclomethasone diproplonate, budesonide, ephedrine sulfate, epinephrine hydrochloride, flunisolide, fluticasone propionate, naphazoline hydrochloride, oxymetazoline hydrochloride, phenylephrine hydrochloride, tetrahydrozoline hydrochloride, triamcinolone acetonide, and xylometazoline hydrochloride (see, for example, p. 1041-97 of the "Nursing 2001 Drug Handbook").

The local anti-infective agent may be at least one selected from acyclovir, amphotericin B, azelaic acid cream, bacitracin, butoconazole nitrate, clindamycin phosphate, clotrimazole, econazole nitrate, erythromycin, gentamicin sulfate, ketoconazole, mafenide acetate, metronidazole (topical), miconazole nitrate, mupirocin, naftifine hydrochloride, neomycin sulfate, nitrofurazone, nystatin, silver sulfadiazine, terbinafine hydrochloride, terconazole, tetracycline hydrochloride, tioconazole and tolnaftate. The scabicide or pediculicide may be at least one selected from crotamiton, lindane, permethrin and pyrethrins. The topical corticosteroid may be at least one selected from betamethasone dipropionate, betamethasone valerate, clobetasol propionate, desonide, desoxymethasone, dexamethasone, dexamethasone sodium phosphate, diflorasone diacetate, fluocinolone acetonide, fluocinonide, flurandrenolide, fluticasone propionate, halcionide , hydrocortisone, hydrocortisone acetate, hydrocortisone butyrate, hydrocortisone valerate, mometasone furoate, and triamcinolone acetonide (see, e.g. 1098-1136 of the “Nursing 2001 Drug Handbook”).

The vitamin or mineral may be at least one selected from vitamin A, vitamin B complex, cyanocobalamin, folic acid, hydroxocobalamin, calcium leucovorin, niacin, niacinamide, pyridoxine hydrochloride, riboflavin, thiamine hydrochloride, vitamin C, vitamin D , cholecalciferol, ergocalciferol, vitamin D analogue, doxercalciferol, paricalcitol, vitamin E, vitamin K analogue, phytonadione, sodium fluoride, sodium fluoride (topical), trace elements, chromium, copper, iodine, manganese, selenium and zinc. The caloric agent may be at least one selected from Amino Acid Infusions (crystalline), Amino Acid Infusions in Dextrose, Amino Acid Infusions with Electrolytes, Amino Acid Infusions with Electrolytes in Dextrose, Amino Acid Infusions for Liver Failure, Amino Acid Infusions for High metabolic stress, amino acid infusions for renal failure, dextrose, fat emulsions, and medium chain triglycerides (see, for example, p. 1137-63 of the “Nursing 2001 Drug Handbook”).

The anti-IL-23p19 antibody compositions of the present invention may further comprise at least any suitable and effective amount of a composition or pharmaceutical composition comprising at least one anti-IL-23p19 antibody that is contacted or administered to a cell, tissue, organ, animal or patient in need of said modulation, treatment or therapy, optionally further comprising, at least one agent selected from at least one TNF antagonist (eg, without limitation, a chemical or protein antagonist of TNF, monoclonal or polyclonal antibody or fragment of TNF, a soluble TNF receptor (eg, p55, p70, or p85), or fragment, fusion polypeptide thereof, or a small molecule TNF antagonist, for example TNF binding protein I or II (TBP-I or TBP-II), nerelimonmab, infliximab, etanercept, CDP-571, CDP-870, afelimomab, lenercept and the like), an antirheumatic (for example methotrexate, auranofin, aurothioglucose, azathioprine, etanercept, sodium gold thiomalate, hydroxychloroquine sulfate, leflunomide, sulfalazine), a muscle relaxant, a narcotic, a non-steroidal anti-inflammatory drug (ΑΙΝΕ) , an analgesic, an anesthetic, a sedative, a local anesthetic, a neuromuscular blocker, an antimicrobial (eg, aminoglycoside, antifungal, antiparasitic, antiviral, carbapenem, cephalosporin, fluoroquinolone, macrolide, penicillin, sulfonamide, tetracycline, other antimicrobial), an antisoriatic, corticosteroid, anabolic steroid, diabetic-related agent, mineral, nutrient, thyroid agent, vitamin, calcium-related hormone, antidiarrheal, antitussive, antiemetic, antiulcer , laxative, anticoagulant, erythropoietin (for example epoetin alfa), filgrastim (for example G-CSF, neupogen), sargramostim (GM-CSF, Leukine), an immunization, an immunoglobulin, an immunosuppressant (for example basiliximab, cyclosporine, daclizumab), growth hormone, hormone replacement drug, estrogen receptor modulator, mydriatic, cycloplegic, alkylating agent, antimetabolite, mitotic inhibitor, radiopharmaceutical agent, antidepressant, antimanic agent, antipsychotic, anxiolytic , hypnotic, sympathomimetic, stimulant, donepezil, tacrine, asthma medication, beta-agonist, inhalation steroid, leukotriene inhibitor, methylxanthine, cromolyn, epinephrine or analogue, dornase alfa (Pulmozyme), cytokine or cytokine antagonist. Non-limiting examples of such cytokines include, without limitation, any of IL-1 to IL-28 (eg, IL-1, IL-2, etc.). Suitable dosages are well known. See, for example, Wells et al., eds., "Pharmacotherapy Handbook", 2^to edition, Appleton and Lange, Stamford, Connecticut (2000); "PDR Pharmacopeia, Tarascon Pocket Pharmacopoeia 2000", deluxe edition, Tarascon Publishing, Loma Linda, California (2000), each of these references is fully incorporated herein by reference.

These anti-cancer or anti-infective agents may also include toxin molecules that associate, bind, co-formulate, or co-administer with at least one antibody of the present invention. The toxin can act to selectively kill the pathogenic cell or tissue. The pathogenic cell may be cancer or another cell. Such toxins may be, without limitation, purified or recombinant toxin or toxin fragment comprising at least one toxin-functional cytotoxic domain, for example selected from at least one of castor bean, diphtheria toxin, a poison toxin, or a bacterial toxin. The term toxin also includes both endotoxins and exotoxins produced by any bacterium or virus, natural, mutant, or recombinant, that can cause any pathological condition in humans and other mammals, including toxin shock that can result in death. These toxins may include, without limitation, heat labile enterotoxin (LT) and heat stable enterotoxin (ST) from E. enterotoxic coli, Shigella cytotoxin, Aeromonas enterotoxins, toxic shock syndrome toxin 1 (TSST-1), staphylococcal enterotoxin A (SEA), B (SEB) or C (SEO), streptococcal enterotoxins and the like. Such bacteria include, without limitation, strains of an enterotoxic E. coli (ETEC) species, E. enterohaemorrhagic coli (for example serotype 0157:H7 strains), Staphylococcus species (for example Staphylococcus aureus, Staphylococcus pyogenes), Shigella species (for example Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei), Salmonella species ( for example Salmonella typhi, Salmonella cholera-suis, Salmonella enteritidis), Clostridium species (for example Clostridium perfringens, Clostridium difficile, Clostridium botulinum), Camphilobacter species (for example Camphilobacterjejuni, Camphilobacter fetus), Heliobacter species (for example Heliobacter pylori), Aeromonas species (for example Aeromonas sobria, Aeromonas hydrophila, Aeromonas caviae), Pleisomonas shigelloides, Yersina enterocolitica, Vibrios species (for example Vibrios cholerae, Vibrios parahemolyticus), Klebsiella species, Pseudomonas aeruginos, and Streptococci. See, for example, Stein ed., "INTERNAL MEDICINE" 3^to ed., p. 1-13, Little, Brown and Co., Boston, (1990); Evans et al., eds., “Bacterial Infections of Humans: Epidemiology and Control, 2^to ed., p. 239-254, Plenum Medical Book Co., New York (1991); Mandell et al., "Principles and Practice of Infectious Diseases," 3^to ed., Churchill Livingstone, New York (1990); Berkow et al., eds., "The Merck Manual," 16^to edition, Merck and Co., Rahway, NJ, 1992; Wood et al., FEMS Microbiology Immunology, 76:121-134 (1991); Marrack et al., Science, 248:705-711 (1990), the contents of which are fully incorporated herein by reference.

The anti-IL-23p19 antibody compounds, compositions or combinations of the present invention may additionally comprise at least one of any suitable auxiliaries, for example, without limitation, diluent, binder, stabilizer, buffer, salt, lipophilic solvent, conservative, adjuvant or the like. Pharmaceutically acceptable auxiliaries are preferred. Non-limiting examples and methods of preparing such sterile solutions are well known in the art, for example, without limitation, Gennaro, "Remington's Pharmaceutical Sciences", 18^to edition, Mack Publishing Co. (Easton, Pennsylvania) 1990. Pharmaceutically acceptable carriers can be routinely selected that are suitable for the mode of administration, solubility, and/or stability of the anti-IL-23p19 antibody composition, fragment, or variant, such as is well known in the art or as described herein.

Pharmaceutical additives and excipients useful in the present composition include, without limitation, proteins, peptides, amino acids, lipids, and carbohydrates (for example, sugars, including monosaccharides, di-, tri-, tetra-, and oligosaccharides; modified sugars such as alditols, fatty acids, aldonics, esterified sugars and the like; and polysaccharides or sugar polymers), which may be present singly or in combination, comprising alone or in combination from 1% to 99.99% by weight or volume. Exemplary protein excipients include serum albumin, such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid/antibody components, which may also function in a buffering capacity, include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. Glycine is a preferred amino acid.

Carbohydrate excipients suitable for use in the invention include, for example, monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides such as lactose, sucrose, trehalose, cellobiose and the like; polysaccharides such as raffinose, melezitose, maltodextrins, dextrans, starches and the like; and alditols such as mannitol, xylitol, maltitol, lactitol, xylitol, sorbitol (glucitol), myo-inositol, and the like. The preferred carbohydrate excipients for use in the present invention are mannitol, trehalose and raffinose.

Anti-IL-23p19 antibody compositions may also include a buffer or pH adjusting agent, the buffer being a salt prepared from an organic acid or base. Representative buffers include organic acid salts such as citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or italic acid; Tris, tromethamine hydrochloride or phosphate buffers. Preferred buffers for use in the present compositions are organic acid salts, such as citrate.

Additionally, the anti-IL-23p19 antibody compositions of the invention may include polymeric excipients/additives such as polyvinylpyrrolidones, fcols (a polymeric sugar), dextrates (for example cyclodextrins, such as 2-hydroxypropyl-p-cyclodextrin), polyethylene glycols, flavoring agents, antimicrobial agents, sweeteners, antioxidants, anti-aesthetic agents, surfactants (for example polysorbates such as “TWEEN 20 and “TWEEN 80”), lipids (eg phospholipids, fatty acids), spheroids (eg cholesterol) and chelating agents (eg EDTA).

These and other known pharmaceutical excipients and/or additives suitable for use in anti-IL-23p19 antibody, portion or variant compositions according to the invention are known in the art, for example as described in "Remington: The Science & Practice of Pharmacy”, 19^toedition, Williams & Williams (1995), and in the “Physician's Desk Reference”, 52^to edition, Medical Economics, Montvale, NJ (1998), the disclosures of which are fully incorporated herein by reference. Preferred carrier or excipient materials are carbohydrates (eg saccharides and alditols) and buffers (eg citrate), or polymeric agents. An exemplary carrier molecule is the mucopolysaccharide hyaluronic acid, which may be useful for intra-articular delivery.

formulations

As indicated above, the invention provides stable formulations, preferably comprising a phosphate buffer with saline or a chosen salt, as well as preserved solutions and formulations containing a preservative and also all-purpose preserved formulations suitable for pharmaceutical or veterinary use, comprising at least one anti-IL23p19 antibody in a pharmaceutically acceptable formulation. Preserved formulations contain at least one known or optionally selected preservative from the group consisting of at least one of phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, phenylmercuric nitrite, phenoxyethanol, formaldehyde, chlorobutanol , magnesium chloride (for example hexahydrate), alkylparaben (methyl, ethyl, propyl, butyl and the like), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal, polymers, or mixtures thereof, in an aqueous diluent. Any suitable concentration or mixture as known in the art can be used, for example about 0.0015%, or any scale, value or fraction in that range. Non-limiting examples include: without preservative, mcresol approximately 0.1-2% (for example 0.2, 0.3, 0.4, 0.5, 0.9,1.0%), benzyl alcohol approximately 0.1-3% (for example 0.5, 0.9,1.1,1.5,1.9, 2.0, 2.5% ), thimerosal approx. 0.0010.5% (eg 0.005, 0.01%), phenol approx. example 0.00075, 0.0009, 0.001,0.002, 0.005, 0.0075, 0.009, 0.01,0.02, 0.05, 0.075, 0.09, 0.1,0.2, 0.3, 0.5, 0.75, 0.9,1.0%), and the like.

As indicated above, the invention provides an article of manufacture comprising packaging material and at least one vial comprising a solution of at least one anti-IL23p19 antibody with pre-established buffers and/or preservatives, optionally in an aqueous diluent. , wherein said packaging material comprises a label indicating that said solution can be kept for a period of 1, 2,3,4, 5, 6, 9,12,18, 20, 24, 30,36, 40, 48, 54,60, 66, 72 hours or more. The invention further comprises an article of manufacture comprising packaging material, a first bottle comprising at least one lyophilized anti-IL-23p19 antibody, and a second bottle comprising an aqueous pre-established buffer or preservative diluent, wherein said packaging material comprises a label that instructs a patient to reconstitute the anti-IL-23p19 antibody in the aqueous diluent to form a solution that can be maintained for a period of twenty-four hours or more.

The anti-IL-23p19 antibody used in accordance with the present invention may be produced by recombinant means, including from mammalian cell or transgenic preparations, or may be purified from other biological sources, as described herein or as known in the art. .

The range of anti-IL-23p19 antibody in the product of the present invention includes amounts that produce after reconstitution, if in a wet/dry system, concentrations from about 1.0 pg/mL to about 1000 mg/mL, although they are operable. lower and higher concentrations, and depend on the delivery vehicle considered; for example, for solution formulations it will be different than for a transdermal patch, or for pulmonary, transmucosal or osmotic, or micropump delivery methods.

Preferably, the aqueous diluent optionally comprises a pharmaceutically acceptable preservative. Preferred preservatives include those selected from the group consisting of phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, alkylparaben (methyl, ethyl, propyl, butyl, and the like), benzalkonium chloride, benzethonium chloride , sodium dehydroacetate and thimerosal, or mixtures thereof. The concentration of the preservative used in the formulation is a concentration sufficient to produce an antimicrobial effect. Such concentrations depend on the selected preservative and are easily determined by the skilled artisan.

Preferably, and optionally, other excipients may be added to the diluent, for example isotonicity agents, buffers, antioxidants, and preservation enhancers. An isotonicity agent, such as glycerin, is commonly used at known concentrations. Preferably a physiologically tolerated buffer is added to give better pH control. The formulations can cover a wide range of pH's, eg pH from about 4 to about 10, with preferred ranges from about 5 to about 9, and a pH range from about 6.0 to about 8.0 is most preferred. Preferably, the formulations of the present invention have a pH between about 6.8 and about 7.8. Preferred buffers include phosphate buffers, preferably sodium phosphate, particularly phosphate buffered saline (PBS).

To reduce aggregation, other additives such as pharmaceutically acceptable solubilizers such as Tween 20 (polyoxyethylene(20)-sorbitan monolaurate), Tween 40 (polyoxyethylene(20)-sorbitan monopalmitate), Tween 40 (polyoxyethylene(20)-sorbitan monopalmitate) may optionally be added to the formulations or compositions. 80 (polyoxyethylene(20)-sorbitan monooleate), Pluronic F68 (polyoxyethylene and polyoxypropylene block copolymers), and PEG (polyethylene glycol), or nonionic surfactants such as polysorbate 20 or 80 or poloxamer 184 or 188, Pluronic® polyols, other block copolymers, and chelants such as EDTA and EGTA. These additives are particularly useful if a pump or plastic container is used to deliver the formulation. The presence of the pharmaceutically acceptable surfactant reduces the tendency of the protein to aggregate.

The formulations of the present invention can be prepared by a process that comprises mixing at least one anti-IL-23p19 antibody and a preservative selected from the group consisting of phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, alkylparaben (methyl, ethyl, propyl, butyl, and the like), benzalkonium chloride, sodium dehydroacetate, and thimerosal, or mixtures thereof, in aqueous diluent. Mixing of the anti-IL-23p19 antibody (at least one) and preservative in an aqueous diluent is accomplished using conventional dilution and mixing procedures. To prepare a suitable formulation, for example, a suitable measured amount of at least one anti-IL-23p19 antibody in buffer is combined with the desired preservative in buffer, in amounts sufficient to provide the protein and preservative. at the desired concentrations. The person of average skill in the art would recognize variations of this procedure. For example, the order in which the components are added; if additional additives are used; the temperature and pH at which the formulation is prepared; all are factors that can be optimized according to the concentration and means of administration used.

The claimed formulations may be provided to patients as clear solutions or as double vials comprising one vial of at least one lyophilized anti-IL23p19 antibody that is reconstituted with a second vial containing water, a preservative, and/or excipients, preferably a phosphate buffer and/or saline and a chosen salt in an aqueous diluent. Either a single vial of solution or two vials for reconstitution, they can be used multiple times and may suffice for a single application or multiple cycles of patient treatment application, thus providing a more convenient treatment regimen than currently available. .

The present claimed articles of manufacture are useful for administration for a period ranging from immediately to twenty-four hours or longer. Accordingly, the currently claimed articles of manufacture offer significant advantages to the patient. The formulations of the invention can optionally be stored safely at temperatures from about 2°C to about 40°C and retain the biological activity of the protein for long periods, allowing a label on the package to indicate that the solution can be kept and /or use for a period of 6,12,18, 24, 36, 48, 72 or 96 hours or more. If preserved diluent is used, said label may include an indication of use for up to 1-12 months, half a year, a year and a half, and/or two years.

Solutions of at least one anti-IL-23p19 antibody of the invention can be prepared by a process comprising mixing at least one antibody in an aqueous diluent. Mixing is effected using conventional dissolving and mixing procedures. To prepare a suitable diluent, eg, a suitable measured amount of at least one antibody in water or buffer, is combined in amounts sufficient to provide the protein and optionally a preservative or buffer at the desired concentrations. A person of average skill in the art would recognize variations of this procedure. For example, the order in which the components are added; if additional additives are used; the temperature and pH at which the formulation is prepared; These are all factors that can be optimized according to the concentration and the means of administration used.

The claimed products may be provided to patients as clear solutions or as double vials comprising one vial of at least one lyophilized anti-IL-23p19 antibody that is reconstituted with a second vial containing the aqueous diluent. Either a single vial of solution or two vials for reconstitution, they can be used multiple times and may suffice for a single application or multiple cycles of patient treatment application, thus providing a more convenient treatment regimen than currently available. .

The claimed products may be provided indirectly to patients by supplying pharmacies, clinics or others of these institutions and facilities with clear solutions or double vials comprising one vial of at least one lyophilized anti-IL-23p19 antibody that is reconstituted with a second vial containing the aqueous diluent. The clear solution in this case can be up to a liter or even larger in size, providing a large reservoir from which smaller portions of the antibody solution can be recovered, once or multiple times for transfer to smaller vials for dispensing. by the pharmacy or clinic to its clients and/or patients.

Known devices that comprise these single vial systems include pen-injector devices for delivery of a solution, such as BD Pens, BD Autojector®, Humaject®, NovoPen®, BD® Pen, AutoPen®, and OptiPen®, GenotropinPen®, GenotronormPen®, HumatroPen®, Reco-Pen®, RoferonPen®, Biojector®, Iject®, J-tip Needle-Free Injector®, Intraject®, MediJect®, for example, made or developed by Becton Dickenson (Franklin Lakes , New Jersey, www.bectondickenson.com), Disetronic (Burgdorf, Switzerland - www.disetronic.com; Bioject, Portland, Oregon (www.bioject.com); National Medical Products, Weston Medical (Peterborough, UK - www.westonmedical.com), Medi-Ject Corp (Minneapolis , Minnesota, www.mediject.com) Recognized devices comprising a double vial system include pen-injector systems, for reconstituting a lyophilized drug in a cartridge for delivery of the reconstituted solution, such as the HumatroPen®. Examples of other suitable devices include prefilled syringes, autoinjectors, needleless injectors, and needleless iv infusion sets.

Products currently claimed include packaging material. The packaging material provides, in addition to the information required by regulatory agencies, the conditions under which the product can be used. The packaging material of the present invention provides instructions for the patient to reconstitute the anti-IL-23p19 antibody in the aqueous diluent, to form a solution, and to use the solution for a period of 2-24 hours or longer, for the product. wet/dry from two vials. For the single vial solution product, the label indicates that the single vial solution can be used for a period of 2-24 hours or longer. The currently claimed products are useful for human use as a pharmaceutical.

The formulations of the present invention may be prepared by a process comprising mixing at least one anti-IL-23p19 antibody and a selected buffer, preferably a phosphate buffer containing saline or a selected salt. Mixing of the anti-IL23p19 antibody and buffer in an aqueous diluent is accomplished using conventional dilution and mixing procedures. To prepare a suitable formulation, for example, a measured amount of at least one antibody in water or buffer is combined with the desired buffering agent in water, in amounts sufficient to provide the protein and buffer at the desired concentrations. A person of average skill in the art would recognize variations of this procedure. For example, the order in which the components are added; if additional additives are used; the temperature and pH at which the formulation is prepared; These are all factors that can be optimized according to the concentration and the means of administration used.

Claimed stable or preserved formulations may be provided to patients as clear solutions or as double vials comprising one vial of at least one lyophilized anti-IL-23p19 antibody that is reconstituted with a second vial containing a preservative or buffer, and excipients in an aqueous diluent. Either a single vial of solution or two vials for reconstitution, they can be reused multiple times and may suffice for a single treatment or multiple patient treatment cycles, thus providing a more convenient treatment regimen than currently available.

Other formulations or methods for stabilizing the anti-IL-23p19 antibody can produce a non-clear solution of lyophilized powder comprising the antibody. Among non-transparent solutions are formulations comprising particulate suspensions, said particles being a composition containing the anti-IL-23p19 antibody in a structure of variable dimension and known variously as a microsphere, microparticle, nanoparticle, nanosphere, or liposome. Such formulations of relatively homogeneous, essentially spherical particles containing an active agent can be made by contacting an aqueous phase containing the active agent and a polymer in a non-aqueous phase, followed by evaporation of the non-aqueous phase to cause the coalescence of the particles from the aqueous phase, as taught in US 4,589,330. Porous microparticles can be prepared using a first phase containing the active agent and a polymer dispersed in a continuous solvent, and removing said solvent from the suspension by means of freeze-drying or dilution-extraction-precipitation, as taught in US 4,818,542. Preferred polymers for such preparations are natural or synthetic copolymers or polymers selected from the group consisting of gelatin, agar, starch, arabinogalactan, albumin, collagen, polyglycolic acid, polylactic acid, glycolide L(-)-lactide, poly(epsilon-caprolactone) , poly(epsilon-caprolactone-CO-lactic acid), poly(epsiloncaprolactone-CO-glycolic acid), poly(B-hydroxybutyric acid), polyethylene oxide, polyethylene, poly(2-alkyl-cyanoacrylate), poly(hydroxyethyl methacrylate), polyamides, poly(amino acids), poly(2-hydroxyethyl-DLaspartamide), poly(urea ester), poly¡(L-phenylalanine/ethylene glycol/1,6-diisocyanatohexane), and poly(methyl methacrylate) ). Particularly preferred polymers are polyesters, such as polyglycolic acid, polylactic acid, glycolide-L(-)-lactide, poly(epsilon-caprolactone), poly(epsilon-caprolactone-CO-lactic acid), and poly(epsilon-caprolactone- CO-glycolic acid). Useful solvents for dissolving the polymer and/or active agent include: water, hexafluoroisopropanol, methylene chloride, tetrahydrofuran, hexane, benzene, or hexafluoroacetone sesquihydrate. The method of dispersing the active agent-containing phase with a second phase may include forcing said first phase through an orifice in a nozzle to affect droplet formation.

Dry powder formulations can be produced by methods other than lyophilization, for example by spray drying or extraction of the solvent by evaporation or precipitation from a crystalline composition, followed by one or more steps to remove the aqueous or non-aqueous solvent. The preparation of a spray-dried antibody formulation is taught in US

6,019,968. Antibody-based dry powder compositions can be produced by spray-drying solutions or suspensions of the antibody and optionally excipients in a solvent, under conditions to provide a respirable dry powder. Solvents can include polar compounds such as water and ethanol, which can easily dry out. Antibody stability can be improved by performing spray-drying procedures in the absence of oxygen, for example under a nitrogen blanket, or by using nitrogen as the drying gas. Another relatively dry formulation is a dispersion of a plurality of perforated microstructures, dispersed in a suspending medium typically comprising a hydrofluoroalkane propellant, as taught in WO 9916419. The stabilized dispersions can be administered to a patient's lung using a metered dose inhaler. Buchi Ltd or Niro Corp. manufacture equipment useful for the commercial preparation of spray dried drugs.

Anti-IL-23p19 antibody of the stable or preserved formulations or solutions described herein can be administered to a patient in accordance with the present invention via a variety of delivery methods including se or im injection; transdermal, pulmonary, transmucosal delivery, implant, osmotic pump, cartridge, micropump, or other means appreciated by the skilled artisan, as is well known in the art.

therapeutic applications

The present invention also provides a method for modulating or treating at least one IL-23-related disease, in a cell, tissue, organ, animal, or patient, as known in the art or described herein, using at least least one IL-23p19 antibody of the present invention, eg, by administering to or contacting the cell, tissue, organ, animal, or patient, with a therapeutically effective amount of the IL-23p19 antibody. The present invention also provides a method for modulating or treating at least one IL-23-related disease in a cell, tissue, organ, animal, or patient, including without limitation, at least one of: obesity, immune disease, cardiovascular, infectious disease, malignant disease or neurological disease.

The present invention also provides a method for modulating or treating at least one IL-23-related immune disease in a cell, tissue, organ, animal, or patient, including without limitation, at least one of: rheumatoid arthritis, juvenile rheumatoid arthritis, systemic juvenile rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, gastric ulcer, seronegative arthropathies, osteoarthritis, osteolysis, aseptic detachment of orthopedic implants, inflammatory bowel disease, ulcerative colitis, systemic lupus erythematosus, antiphospholipid syndrome, iridocyclitis/uveitis/optic neuritis, idiopathic pulmonary fibrosis, systemic vasculitis/Wegener's granulomatosis, sarcoidosis, orchitis/vasectomy reversal procedures, allergic/atopic diseases, asthma, allergic rhinitis, eczema, allergic contact dermatitis, allergic conjunctivitis, hypersensitivity pneumonitis, transplants, organ transplant rejection, graft-versus-host disease, systemic inflammatory response, sepsis syndrome, gram positive sepsis, gram negative sepsis, culture negative sepsis, fungal sepsis, neutropenic fever, urosepsis, meningococcemia, trauma/hemorrhage, burns, exposure to ionizing radiation, acute pancreatitis, adult respiratory distress syndrome, rheumatoid arthritis, alcohol-induced hepatitis, chronic inflammatory conditions, sarcoidosis, Crohn's disease, sickle cell disease, diabetes, nephrosis, atopic diseases, hypersensitivity reactions, allergic rhinitis, hay fever, perennial rhinitis, conjunctivitis, endometriosis, asthma, urticaria, systemic anaphylaxis, dermatitis, pernicious anemia, hemolytic disease, thrombocytopenia, graft rejection of any organ or tissue, kidney transplant rejection, heart transplant rejection, liver transplant rejection, pancreas transplant rejection, heart transplant rejection lung, bone marrow transplant (BMT) rejection, skin allograft rejection, cartilage transplant rejection, bone graft rejection, small intestine transplant rejection, fetal thymus implant rejection, parathyroid transplant rejection, xenograft rejection of any organ or tissue, allograft rejection, anti-receptor hypersensitivity reactions, Graves' disease, Raynaud's disease, insulin-resistant type B diabetes, asthma, myasthenia gravis, antibody-mediated cytotoxicity, type III hypersensitivity reactions, POEMS syndrome (polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy and skin changes syndrome), polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy, skin changes syndrome, antiphospholipid syndrome, pemphigus, scleroderma, mixed connective tissue disease, idiopathic Addison's disease, diabetes mellitus, hepatitis chronic active, primary biliary cirrhosis, vitiligo, vasculitis, MI post-cardiotomy syndrome, type IV hypersensitivity, contact dermatitis, hypersensitivity pneumonitis, allograft rejection, granulomas due to intracellular organisms, drug susceptibility, metabolic idiopathy, Wilson's disease, hemachromatosis, alpha-1-antitrypsin deficiency, diabetic retinopathy, Hashimoto's thyroiditis, osteoporosis, hypothalamic-pituitary-adrenal axis assessment, cirrhosis primary biliary tract, thyroiditis, encephalomyelitis, cachexia, cystic fibrosis, neonatal chronic lung disease, chronic obstructive pulmonary disease (COPD), familial hematophagocytic lymphohistiocytosis, dermatological conditions, psoriasis, alopecia, nephrotic syndrome, nephritis, glomerular nephritis, acute renal failure, hemodialysis, uremia, toxicity, preeclampsia, okt3 therapy, anti-cd3 therapy, cytokine therapy, chemotherapy, radiation therapy (including for example, without limitation, asthenia, anemia, cachexia and the like), chronic salicylate poisoning, and the like, see, for example, the "Merck Manual", 12^to-17^to editions, Merck & Company, Rahway, NJ (1972,1977,1982,1987,1992,1999), “Pharmacotherapy Handbook”, Wells et al., eds., second edition, Appleton and Lange, Stamford, Connecticut (1998, 2000 ), each fully incorporated by reference.

The present invention also provides a method for modulating or treating at least one cardiovascular disease in a cell, tissue, organ, animal, or patient, including, without limitation, at least one of: cardiac shock syndrome, myocardial infarction, congestive heart failure, stroke, ischemic attack, hemorrhage, acute coronary syndrome, arteriosclerosis, atherosclerosis, restenosis, diabetic atherosclerotic disease, hypertension, arterial hypertension, renovascular hypertension, syncope, shock, systemic syphilis cardiovascular, heart failure, cor pulmonale, primary pulmonary hypertension, cardiac arrhythmias, atrial ectopic beats, atrial flutter, atrial fibrillation (sustained or paroxysmal), post-perfusion syndrome, cardiopulmonary bypass inflammation response, chaotic or multifocal atrial tachycardia, regular narrow QRS tachycardia, specific arrhythmias, ventricular fibrillation, bundle-of-His arrhythmias, atrioventricular block, bundle branch block , myocardial ischemic disorders, coronary artery disease, angina pectoris, myocardial infarction, cardiomyopathy, dilated congestive cardiomyopathy, restrictive cardiomyopathy, valvular heart diseases, endocarditis, pericardial disease, cardiac tumors, aortic and peripheral aneurysms, aortic dissection, inflammation of the aorta, occlusion of the abdominal aorta and its ramifications, peripheral vascular disorders, arterial occlusive disorders, disease peripheral atherosclerotic disease, thromboangiitis obliterans, functional peripheral arterial disorders, Raynaud's phenomenon and disease, acrocyanosis, erythromelalgia, venous diseases, venous thrombosis, varicose veins, arteriovenous fistula, lymphoderma, lipedema, unstable angina, reperfusion injury, post-pump syndrome, ischemia-reperfusion injury, and the like. Said method may optionally comprise administering an effective amount of a composition or pharmaceutical composition comprising at least one anti-IL-23p 19 antibody, to a cell, tissue, organ, animal or patient in need of said modulation, treatment or therapy.

The present invention also provides a method for modulating or treating at least one IL-23-related infectious disease in a cell, tissue, organ, animal, or patient, including, without limitation, at least one of: acute or chronic bacterial infection, acute or chronic infectious or parasitic conditions, including bacterial, viral and fungal infections, HIV infection/HIV neuropathy, meningitis, hepatitis (e.g. A, B or C, or similar), septic arthritis, peritonitis, pneumonia, epiglottitis, E. coli 0157:h7, hemolytic uremic syndrome/thrombolytic thrombocytopenic purpura, malaria, dengue haemorrhagic fever, leishmaniasis, leprosy, toxic shock syndrome, streptococcal myositis, gas gangrene, mycobacterium tuberculosis, Mycobacterium avium intracellulare, Pneumocystis carinii pneumonia, inflammatory disease pelvic, orchitis/epididymitis, legionella, Lyme disease, influenza A, Epstein-Barr virus, virus-associated hemophagocytic syndrome, viral encephalitis/aseptic meningitis, and the like.

The present invention also provides a method for modulating or treating at least one IL-23-related malignancy in a cell, tissue, organ, animal, or patient, including, without limitation, at least one of: leukemia, acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphocytic leukemia, B-cell, T-cell or FAB ALL, acute myeloid leukemia (AML), acute myelogenous leukemia, chronic myelocytic leukemia (CML), chronic lymphocytic leukemia (CLL) , hairy cell leukemia, myelodysplastic syndrome (MDS), lymphoma, Hodgkin's disease, malignant lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, multiple myeloma, Kaposi's sarcoma, colorectal carcinoma, pancreatic carcinoma, Nasopharyngeal carcinoma, malignant histiocytosis, paraneoplastic/hypercalcemia syndrome of malignancy, solid tumors, bladder cancer, breast cancer, colorectal cancer, endometrial cancer, head cancer, neck cancer, hereditary non-polypous cancer, Hodgkin's lymphoma, liver cancer, lung cancer, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell carcinoma, testicular cancer, adenocarcinomas, sarcomas, malignant melanoma, hemangioma, metastatic disease, cancer-related bone resorption, cancer-related bone pain, and the like.

The present invention also provides a method for modulating or treating at least one IL-23-related neurological disease in a cell, tissue, organ, animal, or patient, including, without limitation, at least one of: neurodegenerative diseases, sclerosis multiple, migraine headache, AIDS dementia complex, demyelinating diseases such as multiple sclerosis and acute transverse myelitis; extrapyramidal and cerebellar disorders such as lesions of the corticospinal system; basal ganglia disorders; hyperkinetic movement disorders such as Huntington's chorea and senile chorea, drug-induced movement disorders, such as those induced by drugs that block CNS dopamine receptors; hypokinetic movement disorders such as Parkinson's disease; progressive supranuclear palsy; structural lesions of the cerebellum; spinocerebellar degenerations such as spinal ataxia, Friedreich's ataxia, cerebellar cortical degeneration, multiple system degeneration (Mencel, Dejeñne-Thomas, Shi-Drager and Machado-Joseph); systemic disorders (Refsum's disease, abetalipoprotemia, ataxia, telangiectasia, and multisystem mitochondrial disorder); core demyelinating disorders such as multiple sclerosis, acute transverse myelitis; and motor unit disorders such as neurogenic muscular atrophies (anterior horn cell degeneration, such as amyotrophic lateral sclerosis, infantile spinal muscular atrophy, and juvenile spinal muscular atrophy); Alzheimer disease; Down syndrome in middle age; diffuse Lewy body disease; senile dementia of the Lewy body type; Wernicke Korsakoff syndrome; chronic alcoholism; Creutzfeldt-Jakob disease; subacute sclerosing panencephalitis, Hallerrorden-Spatz disease; pugilistic madness; neurotraumatic injury (eg spinal cord injury, brain injury, concussion, repetitive concussion); pain; inflammatory pain; autism; depression; brain Atack; cognitive disorders; epilepsy; and the like. Said method may optionally comprise administering an effective amount of a composition or pharmaceutical composition comprising at least one TNF antibody or specified portion or variant, to a cell, tissue, organ, animal or patient in need of said modulation, treatment or therapy; see, for example, "The Merck Manual," 16^to edition, Merck & Company, Rahway, NJ (1992).

The present invention also provides a method of modulating or treating by incision, laceration wounds, blunt wounds (ie, wounds in which there is no disruption of the skin but there is damage to underlying structures), open wounds, wounds penetrating wounds, perforation wounds, puncture wounds, septic wounds, subcutaneous wounds, etc. Examples of sores are bed sores, canker sores, cold sores, pressure sores, etc. Examples of ulcers are, for example, peptic ulcer, duodenal ulcer, gastric ulcer, gouty ulcer, diabetic ulcer, hypertensive ischemic ulcer, stasis ulcer, venous ulcer, sublingual ulcer, submucosal ulcer, symptomatic ulcer, ulcer ulcer, ulcer tropical and venereal ulcer, for example caused by gonorrhea (including urethritis, endocervicitis and proctitis). Conditions related to wounds or sores that can be successfully treated in accordance with the invention are burns, carbuncles, tetanus, gas gangrene, scarlet fever, erysipelas, sycosis barbae, folliculitis, contagious impetigo, or bullous impetigo, etc. There is often some overlap in the use of the terms "wound" and "ulcer" and "wound" and "sore," and the terms are often used haphazardly. Therefore, as mentioned above, in the present context, the term “wound” encompasses the terms “ulcer”, “lesion”, “Make” and “infarction”, and the terms are used interchangeably unless otherwise indicated. another way.

The types of wounds that can be treated in accordance with the invention also include (i) general wounds, such as for example surgical, traumatic, infectious, ischemic, thermal, chemical and bullous wounds; (ii) specific wounds of the oral cavity, such as, for example, post-extraction wounds, endodontic wounds, especially in the treatment of cysts and abscesses, ulcers and lesions of bacterial, viral or autoimmune origin, mechanical, chemical, thermal, infectious and lichenoids; specific examples are herpes ulcers, aphthous stomatitis, acute necrotizing ulcerative gingivitis and burning mouth syndrome; and (iii) skin wounds, such as for example neoplasms, burns (eg chemical, thermal), lesions (bacterial, viral, autoimmune), bites and surgical incisions. Another way to classify wounds is as (i) minor tissue loss due to surgical incisions, minor abrasions, and minor bites, or (ii) significant tissue loss. This last group includes ischemic ulcers, pressure sores, fistulas, lacerations, severe bites, thermal burns and donor site wounds (soft and hard tissue) and infarcts.

Other wounds that are of importance with respect to the present invention are wounds such as ischemic ulcers, pressure sores, fistulas, severe bites, thermal burns, and donor site wounds. Ischemic ulcers and pressure sores are wounds that normally heal very slowly, and especially in such cases an improved and faster healing process is of great importance to the patient. In addition, the costs involved in treating patients suffering from such wounds are markedly reduced when healing is improved and occurs more rapidly.

Donor site injuries are injuries that occur for example in connection with the removal of hard tissue from one part of the body to another part of the body, for example in a transplant. Wounds resulting from such operations are very painful and therefore improved healing is very valuable. The term "skin" is used in a very broad sense encompassing the epidermal layer of the skin and - in those cases where the surface of the skin is more or less damaged - also the dermal layer of the skin. Apart from the stratum corneum, the epidermal layer of the skin is the outermost (epithelial) layer, and the deeper connective tissue layer of the skin is called the dermis.

The present invention also provides a method for modulating or treating psoriasis, psoriatic arthritis, Crohn's disease, multiple sclerosis and optic neuritis, among other diseases listed above as related to IL-23, in a cell, tissue, organ, animal or patient, including, without limitation, at least one of: immune disease, cardiovascular disease, infectious disease, malignant disease, and/or neurological disease. Said method may optionally comprise administering an effective amount of at least one composition or pharmaceutical composition comprising at least one anti-IL-23p19 antibody to a cell, tissue, organ, animal or patient in need of said modulation, treatment or therapy. .

Any method of the present invention may comprise administering an effective amount of a composition or pharmaceutical composition comprising at least one anti-IL23p19 antibody to a cell, tissue, organ, animal, or patient in need of such modulation, treatment, or therapy. Said method may optionally comprise co-administration or combination therapy to treat such diseases or disorders, wherein administration of said anti-IL-23p19 antibody, specified portion or variant thereof, further comprises administering, before, during and/or after, at least one agent selected from at least one TNF antagonist (for example, without limitation, a chemical or protein antagonist of TNF, antibody, or monoclonal or polyclonal fragment of TNF, a soluble TNF receptor (eg, p55, p70, or p85), or fragment, fusion polypeptide thereof, or a small molecule antagonist of TNF, eg, TNF binding protein I or II (TBP-I or TBP-II), nerelimonmab, infliximab, etanercept (Enbrel™), adalimulab (Humira™), CDP-571, CDP-870, afelimomab, lenercept, and the like), an antirheumatic (for example, methotrexate, auranofin, aurothioglucose, azathioprine , sodium gold thiomalate, hydroxychloroquine sulfate, leflunomide, sulfasalazine), a muscle relaxant, a narcotic, a non-steroidal anti-inflammatory drug (ΑΙΝΕ), an analgesic, anesthetic, a sedative, a local anesthetic, a neuromuscular blocker, an antimicrobial (for example aminoglycoside, antifungal, antiparasitic, antiviral, carbapenem , cephalosporin, fluoroquinolone, macrolide, penicillin, sulfonamide, tetracycline, other antimicrobial), an antipsoriatic, corticosteroid, anabolic steroid, diabetes-related agent, mineral, nutrient, thyroid agent, vitamin, calcium-related hormone, antidiarrheal, antitussive, antiemetic, antiulcer, laxative, anticoagulant, erythropoietin (eg epoetin alfa), filgrastim (eg G-CSF, Neupogen), sargramostim (GM-CSF, Leukine ), an immunization, an immunoglobulin, an immunosuppressant (for example basiliximab, cyclospoin, daclizumab), growth hormone, hormone replacement drug, estrogen receptor modulator, mydriatic, cycloplegic, Alkylating agent, antimetabolite, mitotic inhibitor, radiopharmaceutical agent, antidepressant, antimanic agent, antipsychotic, anxiolytic, hypnotic, sympathomimetic, stimulant, donepezil, tacrine, asthma medication, beta-agonist, inhalation steroid, leukotriene inhibitor, methylxanthine, cromolyn , epinephrine or analogue, dornase alfa (Pulmozyme), cytokine or cytokine antagonist. Suitable dosages are well known in the art. See, for example, Wells et al., eds., "Pharmacotherapy Handbook", 2^to edition, Appleton and Lange, Stamford, Connecticut (2000); “PDR Pharmacopeia, Tarascón Pocket Pharmacopoeia 2000”, deluxe edition, Tarascón Publishing, Loma Linda, California (2000), “Nursing 2001 Handbook of Drugs”, 21^to edition, Springhouse Corp., Springhouse, Pennsylvania, 2001; "Health Professional's Drug Guide" 2001, ed., Shannon, Wilson, Stang, Prentice-Hall, Inc, Upper Saddle River, New Jersey, each of which is fully incorporated herein by reference.

TNF antagonists suitable for the compositions, combination therapy, co-administration, devices and/or methods of the present invention (further comprising at least one antibody, specified portion and variant thereof of the present invention), include, without limitation , anti-TNF antibodies (eg, at least one TNF antagonist as defined above), antigen-binding fragments thereof, and receptor molecules that specifically bind TNF; compounds that prevent and/or inhibit TNF synthesis, TNF release or its action on target cells, such as thalidomide, tenidap, phosphodiesterase inhibitors (for example pentoxifylline and rolipram), adenosine A2b receptor agonists and receptor enhancers adenosine A2b; compounds that prevent and/or inhibit TNF receptor signaling, such as mitogen-activated protein (MAP) kinase inhibitors; compounds that block and/or inhibit the clearance of TNF from the membrane, such as metalloproteinase inhibitors; compounds that block and/or inhibit the activity of TNF, such as angiotensin converting enzyme (ACE) inhibitors (eg captopril); and compounds that block and/or inhibit TNF production and/or synthesis, such as MAP kinase inhibitors.

As used herein, a "tumor necrosis factor antibody," "TNF antibody," "TNFa antibody," or fragment, and the like, reduces, blocks, inhibits, abolishes, or prevents TNFa activity in vitro, in situ, and/or or preferably in vivo. For example, a suitable human TNF antibody of the present invention can bind TNFa and includes anti-TNF antibodies, antigen-binding fragments thereof, and specific mutants or domains thereof, which specifically bind TNFa. A suitable TNF antibody or fragment may also decrease, suppress, prevent and/or inhibit TNF RNA, DNA or protein synthesis, TNF release, TNF receptor signalling, TNF clearance from the membrane, TNF activity. of TNF, the production and/or synthesis of TNF.

An example of a TNF antibody or antagonist is the cA2 chimeric antibody. Additional examples of anti-TNF monoclonal antibodies that can be used in the present invention are described in the literature (see, for example, US Patent No. 5,231,024, Moller, A. et al., Cytokine 2(3) :162-169 (1990), US Application No. 07/943,852 (filed September 11, 1992), Rathjen et al., International Publication No. WO 91/02078 (published February 21, 1991); Rubin et al., Patent Publication No. EPO 0 218 868 (published April 22, 1987); Yone et al., EPO Patent Publication No. 0 288 088 (October 26, 1988); Liang et al., Biochem. Biophys Res. Comm. 137:847-854 (1986); Meager et al., Hybridoma 6:035-311 (1987); Fendly et al., Hybridoma 6:359369 (1987); Bangman et al., Hybridoma 6:489-507 (1987); and Hirai et al., J. Immunol. Meth. 96:57-62 (1987)).

TNF receptor molecules

Preferred TNF receptor molecules useful in the present invention are those that bind TNFα with high affinity (see for example Feldmann et al., International Publication No. WO 92/07076 (published April 30, 1992); Schall et al. others, Ce//61:361-370 (1990) and Loetscher et al., Cell 61:351-359 (1990), such references are fully incorporated herein by reference), and which optionally possess low immunogenicity. In particular, the 55kDa (p55 TNF-R) and 75kDa (p75 TNF-R) TNF cell surface receptors are useful in the present invention. Also useful in the present invention are truncated forms of these receptors, which comprise the extracellular domains (ECDs) of the receptors, or functional portions thereof (see for example Corcoran et al., Eur. J. Biochem. 223:831- 840 (1994)). Truncated forms of the TNF receptors comprising the ECD have been detected in urine and serum as 30 kDa and 40 kDa TNFα inhibitory binding proteins (Engelmann H. et al., J. Biol. Chem. 265:1531 -1536 (1990)). Multimeric TNF receptor molecules and TNF immunoreceptor fusion molecules, and derivatives and fragments or portions thereof, are further examples of TNF receptor molecules that are useful in the methods and compositions of the present invention.

The TNF receptor multimeric molecules useful in the present invention comprise the entire ECD, or a functional portion thereof, of two or more TNF receptors linked via one or more polypeptide linkers, or other non-peptide linkers such as polyethylene glycol ( PEG). An example of such a TNF immunoreceptor fusion molecule is the TNF receptor/IgG fusion protein. TNF immunoreceptor fusion molecules and methods of their production have been described in the literature (Lesslauer et al., Eur. J. Immunol. 27:2883-2886 (1991); Ashkenazi et al., Proc. Nati. Acad. Sel USA 88:10535-10539 (1991), Peppel et al., J. Exp. Med./74:1483-1489 (1991), Kolls et al., Proc. Nati. Acad. Sci. USA 91:215-219 ( 1994); Butler et al., Cytokine 6(6):616-623 (1994); Baker et al., Eur. J. Immunol. 24:2040-2048 (1994); Beutler et al., US Patent No. . 5,447,851; and US Patent Application No. 08/442,133 (filed May 16, 1995), each of which is incorporated herein by reference). Methods for producing immunoreceptor fusion molecules can also be found in Capon et al., US Patent No. 5,116,964; Capon et al., US Patent No. 5,225,538; and Capon et al., Nature 337:525-531 (1989), which are incorporated herein in their entirety by reference.

Cytokines include any known cytokines; see for example CopewithCytokines.com. Cytokine antagonists include without limitation any antibody, fragment, or mimetic, any soluble receptor, fragment, or mimetic, any small molecule antagonist, or any combination thereof.

therapeutic treatments

Any method of the present invention may comprise a method of treating a disorder mediated by IL-23, which comprises administering an effective amount of a composition or pharmaceutical composition comprising at least one anti-IL-23p19 antibody, to a cell, tissue , organ, animal or patient in need of said modulation, treatment or therapy. Said method may optionally comprise co-administration or combination therapy to treat said diseases or disorders, wherein administration of said anti-IL-23p19 antibody (at least one), specified portion or variant thereof, also comprises administering before, at at the same time, or after, at least one agent selected from at least one anti-infective drug, a cardiovascular (CV) system drug, a central nervous system (CNS) drug, an autonomic nervous system (ANS) drug, a respiratory tract drug, a gastrointestinal (GI) tract drug, a hormonal drug, an electrolyte balance drug, a hematology drug, an antineoplastic drug, an immunomodulatory drug , ophthalmic, otic, nasal, topical, nutrient, or the like, at least one TNF antagonist (for example, without limitation, a TNF antibody or fragment thereof, a soluble TNF receptor or fragment thereof, fusion proteins thereof, or a small molecule TNF antagonist), an antirheumatic (for example methotrexate, auranofin, aurothioglucose, azathioprine, etanercept, sodium gold thiomalate, hydroxychloroquine sulfate, leflunomide, sulfasalazine), a muscle relaxant, a narcotic, a non-steroidal anti-inflammatory drug (ΑΙΝΕ), an analgesic, an anesthetic, a sedative, a local anesthetic, a neuromuscular blocker, an antimicrobial (for example aminoglycoside, antifungal, antiparasitic, antiviral, carbapenem, cephalosporin, fluoroquinolone, macrolide, penicillin, sulfonamide, tetracycline, other antimicrobial), an antisoriatic, corticosteroid, anabolic steroid, diabetes-related agent, mineral, nutrient, thyroid agent, vitamin, calcium-related hormone, antidiarrheal, antitussive, antiemetic, antiulcer, laxative, anticoagulant, erythropoietin (for example epoetin alfa), filgrastim (for example G-CSF, neupogen), sargramostim (GM-CSF, Leukine), an immunization, an immunoglobulin, an immunosuppressant (for example basiliximab, cyclosporine, daclizumab), growth hormone, hormone replacement drug, estrogen receptor modulator, mydriatic, cycloplegic, alkylating agent, antimetabolite, mitotic inhibitor, agent radiopharmaceutical, antidepressant, antimanic agent, antipsychotic, anxiolytic, hypnotic, sympathomimetic, stimulant, donepezil, tacrine, asthma medication, beta-agonist, inhalation steroid, leukotriene inhibitor, methylxanthine, cromolyn, epinephrine or analog, dornase alfa (Pulmozyme), cytokine or cytokine antagonist. These drugs are well known, including formulations, indications, dosing, and administration (see, for example, "Nursing 2001 Handbook of Drugs," 21^to edition, Springhouse Corp., Springhouse, Pennsylvania, 2001; "Health Professional's Drug Guide" 2001, ed., Shannon, Wilson, Stang, Prentice-Hall, Inc, Upper Saddle River, NJ; "Pharmacotherapy Handbook," Wells et al., ed., Appleton & Lange, Stamford, Connecticut, each of which is incorporated herein by reference).

Typically, treatment of pathological conditions is effected by administering an effective amount or dose of at least one anti-IL-23p19 antibody composition totaling, on average, a range of at least 0.01 mg to 500 mg, of at least at least one anti-1L-23p 19 antibody per kg patient weight per dose, and preferably at least about 0.1 mg to 100 mg antibody/kg patient weight per single or multiple administration, depending on the specific activity of the active agent contained in the composition. Alternatively, the effective serum concentration may comprise 0.1-5000 pg/ml serum concentration per single or multiple administration. Suitable dosages are known to medical professionals, and will of course depend on the particular disease state, the specific activity of the composition administered, and the particular patient undergoing treatment. In some cases, to achieve the desired therapeutic amount it may be necessary to provide repeat administration, ie repeated individual administrations of a particular monitored or metered dose, wherein individual administrations are repeated until the desired daily dose or effect is achieved.

Optionally, preferred doses may include approximately 0.1-99 mg/kg/administration, and/or 100-500 mg/kg/administration, or any range, value, or fraction thereof, or to achieve a serum concentration of approximately 0.1 -5000 pg/ml for single or multiple administration, or any scale, value or fraction thereof. A preferred dose range for the anti-IL-23p 19 antibody of the present invention is from about 1 mg/kg, up to about 3 mg/kg, about 6 mg/kg, or about 12 mg/kg of patient body weight. .

Alternatively, the dose administered may vary depending on known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; age, health and weight of the recipient; nature and magnitude of symptoms, type of concurrent treatment, frequency of treatment and desired effect. Usually a dosage of active ingredient may be from about 0.1 mg/kg to 100 mg/kg of body weight. To obtain the desired results, 0.1 mg/kg to 50 mg/kg, and preferably 0.1 mg/kg to 10 mg/kg per administration, or in sustained release form, are usually effective.

As a non-limiting example, treatment may be given to humans or animals as a single or periodic dosage of about 0.1 mg/kg to 100 mg/kg of at least one antibody of the present invention, or any range, value, or fraction. thereof, per day, on at least one of days 1-40, or alternatively or additionally at least one of weeks 1-52, or alternatively or additionally one of years 1-20, or any combination thereof the same, using single, infusion, or repeated doses.

Dosage forms (compositions) suitable for internal administration generally contain from about 0.001 mg to about 500 mg of active ingredient per unit or container. In these pharmaceutical compositions, the active ingredient will ordinarily be present in an amount of about 0.5-99.999% by weight based on the total weight of the composition.

For parenteral administration, the antibody may be formulated as a solution, suspension, emulsion, or lyophilized powder in association with, or provided separately, a pharmaceutically acceptable parenteral vehicle. Examples of such vehicles are water, saline, Ringer's solution, dextrose solution, and 1-10% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used. The vehicle or lyophilized powder may contain additives that maintain isotonicity (eg sodium chloride, mannitol) and chemical stability (eg buffers and preservatives). The formulation is sterilized by any known or suitable technique.

Suitable pharmaceutical carriers are described in the most recent edition of "Remington's Pharmaceutical Sciences", A. Osol, a standard reference text in this field.

alternative administration

Many ways known and developed in accordance with the present invention can be used to administer pharmaceutically effective amounts of at least one anti-IL23p19 antibody of the present invention. Although pulmonary administration is used in the present disclosure, other modes of administration may be used in accordance with the present invention with suitable results. The IL-23p19 antibodies of the present invention can be delivered in a vehicle, as a solution, emulsion, colloid, or suspension, or as a dry powder using any of a variety of devices and methods suitable for administration by inhalation or other modes herein. described or known in the art.

Formulations v enteral administration

Formulations for parenteral administration may contain as common excipients sterile water or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes, and the like. Aqueous or oily solutions for injection can be prepared using an appropriate emulsifier or wetting agent and suspending agent according to known methods. Agents for injection may be a harmless, non-orally administrable diluting agent, such as an aqueous solution or a sterile injectable solution or suspension in a solvent. As usable vehicle or solvent, the following are suitable: water, Ringer's solution, isotonic saline solution, etc.; as an ordinary solvent or suspending solvent, a sterile non-volatile oil can be used. Any type of non-volatile oil and fatty acid can be used for these purposes, including natural, synthetic or semi-synthetic fatty oils or fatty acids; natural, synthetic or semi-synthetic mono-, di- or triglycerides. Parenteral administration is known and includes, without limitation, conventional means of injections, a gas pressured needleless injection device as described in US Pat.

US Patent No. 5,851,198, and a laser piercing device as described in US Patent No. 5,839,446, fully incorporated herein by reference.

alternative supply

The invention further relates to the administration of at least one anti-IL23p19 antibody by parenteral, subcutaneous, intramuscular, intravenous, intraarticular, intrabronchial, intraabdominal, intracapsular, intracartilaginous, intracavitary, intracelial, intracerebellar, intracerebroventricular, intracolic, intracervical, intragastric, intrahepatic, intramyocardial, intraosteal, intrapelvic, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, bolus, vaginal, rectal, buccal, sublingual, intranasal, or transdermal. A composition of at least one anti-IL-23p19 antibody can be prepared for use by parenteral administration (subcutaneous, intramuscular or intravenous) or any other route of administration, particularly in the form of liquid solutions or suspensions; particularly for use in vaginal or rectal administration, in semi-solid forms such as, for example, without limitation, creams and suppositories; for buccal or sublingual administration, eg, without limitation, in the form of tablets or capsules; or for intranasal administration, for example, without limitation, in the form of powders, nasal drops or sprays or certain agents; or for transdermal administration, for example, without limitation, in a gel, ointment, lotion, suspension, or patch delivery system with chemical enhancers such as dimethyl sulfoxide, to modify the structure of the skin or to increase drug concentration in the skin. transdermal patch (Junginger et al. in "Drug Permeation Enhancement"; Hsieh, DS, Eds., p. 59-90 (Marcel Dekker, Inc. New York 1994), fully incorporated herein by reference), or with oxidizing agents that allow formulations containing proteins and peptides to be applied to the skin (WO 98/53847), or with application of electric fields to create transient transport pathways, such as electroporation, or to increase the mobility of loaded drugs through the skin, such as iontophoresis, or ultrasound application, such as sonophoresis (U.S. Pat. Nos. 4,309,989 and 4,767,402) (prior publications and patents are fully incorporated herein by reference).

Pulmonary/nasal administration

For pulmonary administration, preferably a composition of at least one anti-IL-23p19 antibody is delivered in a particle size effective to reach the lower airways of the lung or sinuses. In accordance with the invention, at least one anti-IL-23p19 antibody may be delivered by any of a variety of known nasal or inhalation devices for administration of a therapeutic agent by inhalation. These devices, capable of delivering aerosol formulations into the nasal cavity or alveoli of a patient, include metered dose inhalers, nebulizers, dry powder generators, atomizers, and the like. Other devices suitable for directing pulmonary or nasal delivery of antibodies are also known in the art. All of these devices can make use of formulations suitable for delivery of the antibody in an aerosol. Said aerosols may be comprised of solutions (both aqueous and non-aqueous) or solid particles.

Metered dose inhalers such as the Ventolin® metered dose inhaler typically use a propellant gas and require activation during inspiration (see for example WO 94/16970, WO 98/35888). Dry powder inhalers such as the Turbuhaler™ (Astra), Rotahalei® (Glaxo), Diskus® (Glaxo), Spiros™ (Dura), devices marketed by Inhale Therapeutics, and the Spinhaler® powder inhaler (Fisons), use activation by breathing a mixed dust (US 4668218, Astra, EP 237507 Astra, WO 97/25086, Glaxo, WO 94/08552, Dura, US 5458135, Inhale, WO 94/06498, Fisons, fully incorporated herein by reference). Nebulizers such as Aradigm AERx™, Ultravent ® Nebulizer (Mallinckrodt) and Acorn II ® Nebulizer (Marquest Medical Products) (US 5404871, Aradigm, WO 97/22376), the above references being fully incorporated herein by reference, produce aerosols of solutions, while MDIs, dry powder inhalers, etc., generate small particle aerosols. These specific examples of commercially available inhalation devices are considered representative of specific devices suitable for the practice of this invention, and are not intended to limit the scope of the invention.

Preferably, a composition comprising at least one anti-IL-23p 19 antibody is delivered by means of a dry powder inhaler or atomizer. There are several desirable features of an inhalation device for delivering at least one antibody of the present invention. For example, delivery via the inhalation device is conveniently reliable, reproducible, and accurate. The inhalation device can optionally deliver small dry particles, for example less than about 1 pm, preferably about 1-5 pm for good breathability.

Administration of IL-23o19 antibody compositions as a spray

A spray including an IL-23p19 antibody composition can be produced by forcing a suspension or solution of at least one anti-IL-23p19 antibody through a nozzle under pressure. Nozzle size and configuration, applied pressure, and liquid feed rate can be chosen to achieve the desired output and desired particle size. An electrospray can be produced by means of an electric field in contact with a capillary or nozzle feed. Suitably, the particles of a composition of at least one anti-IL-23p19 antibody delivered by a spray have a particle size of less than about 10 µm, preferably in the range of about 1 µm to about 5 µm, and preferably from about 2 pm to about 3 pm.

Formulations of a composition of at least one anti-IL-23p19 antibody, suitable for use with a spray, typically include the antibody composition in an aqueous solution at a concentration of from about 0.1 mg to about 100 mg of a composition per at least one anti-IL-23p19 antibody, per ml of solution, or mg/ml, or any range, value, or fraction within that range. The formulation may include agents such as an excipient, buffer, isotonicity agent, preservative, surfactant, and preferably zinc. The formulation can also include agents or excipients to stabilize the antibody composition, such as a buffer, reducing agent, filler protein, or carbohydrate. Filler proteins useful in formulating antibody compositions include albumin, protamine, or the like. Typical carbohydrates useful in formulating antibody compositions include sucrose, mannitol, lactose, trehalose, glucose, or the like. The antibody composition formulation may also include a surfactant that can reduce or prevent surface-induced aggregation of the antibody composition caused by atomization of the solution when forming an aerosol. Various conventional surfactants may be employed, such as polyoxyethylene fatty acid esters and alcohols and polyoxyethylene sorbitol fatty acid esters. The amounts generally vary between 0.001% and 14% by weight of the formulation. Especially preferred surfactants for purposes of this invention are polyoxyethylene sorbitan monooleate, polysorbate 80, polysorbate 20, or the like. Additional agents known to formulate a protein, such as IL23p19 antibodies, or specified portions or variants, may also be included in the formulation.

Administration of IL-23o19 Antibody Compositions by Nebulizer

The antibody compositions of the invention can be administered by means of a nebulizer, such as for example a jet nebulizer or an ultrasonic nebulizer. Typically, a jet fogger uses a source of compressed air to create a high-velocity stream of air through an orifice. As the gas expands beyond the nozzle, a region of low pressure is created that draws the antibody composition solution through a capillary tube connected to a reservoir of liquid. The liquid stream from the capillary tube is cut into unstable filaments and droplets as it exits the tube, creating the aerosol. A range of configurations, flow rates, and baffle types can be used to obtain the desired performance characteristics of a given jet fogger. In an ultrasonic nebulizer, high frequency electrical energy is used to create vibrational, mechanical energy, typically using a piezoelectric transducer. This energy is transmitted to the antibody composition formulation, either directly or through a coupling fluid, creating an aerosol that includes the antibody composition. Suitably, the antibody composition particles delivered by a nebulizer have a particle size of less than about 10 pm, preferably in the range of about 1 pm to about 5 pm, and preferably about 2 pm to about 3 pm.

Formulations of at least one anti-IL-23p19 antibody suitable for use with a nebulizer, either jet or ultrasonic, typically include a concentration of about 0.1 mg to about 100 mg of at least one anti-IL-23p antibody protein. 19 for my solution. The formulation may include agents such as an excipient, a buffer, an isotonicity agent, a preservative, a surfactant, and preferably zinc. The formulation can also include an excipient or agent to stabilize the composition of at least one anti-IL-23p19 antibody, such as a buffer, reducing agent, filler protein, or carbohydrate. Filler proteins most useful for formulating a composition of at least one anti-IL23p19 antibody include albumin, protamine, or the like. Typical carbohydrates useful for formulating at least one anti-IL-23p19 antibody include sucrose, mannitol, lactose, trehalose, glucose, or the like. The formulation of at least one anti-IL-23p19 antibody may also include a surfactant that can reduce or prevent surface-induced aggregation of at least one anti-IL-23p19 antibody, caused by atomization of the solution upon forming. a spray. Various conventional surfactants such as polyoxyethylene fatty acid esters and alcohols and polyoxyethylene sorbitan fatty acid esters may be employed. The amounts generally vary between 0.001% and 4% by weight of the formulation. Especially preferred surfactants for purposes of this invention are polyoxyethylene sorbitan monooleate, polysorbate 80, polysorbate 20, or the like. Agents known to formulate a protein, such as an antibody protein, may also be included in the formulation.

Administration of the IL-23p19 antibody compositions by means of a metered dose inhaler

In a metered dose inhaler (MDI), a propellant, at least one anti-IL-23p19 antibody, and any other excipients or additives are contained in a canister as a mixture including a liquefied compressed gas. Activation of the metering valve releases the mixture as an aerosol containing particles preferably in the size range of less than about 10 pm, preferably about 1 pm to 5 pm, and most preferably about 2 pm to 3 pm. The desired aerosol particle size can be obtained using an antibody composition formulation produced by various methods known to those skilled in the art, including jet milling, spray drying, critical point condensation, or the like. Preferred MDIs include those manufactured by 3M or Glaxo, and employing a chlorinated hydrocarbon propellant. Formulations of at least one anti-1L-23p19 antibody for use with a metered dose inhaler device will generally include a finely divided powder containing at least one anti-1L-23p19 antibody as a suspension in a non-aqueous medium, for example suspended in a propellant with the aid of a surfactant. The propellant can be any conventional material used for this purpose, such as a chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon or a hydrocarbon, including thichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol and 1,1,1,2-tetrafluoroethane, HFA-134a (hydrofluoroalkane-134a) , HFA-227 (hydrofluoroalkane-227), or the like. Preferably the propellant is a hydrofluorocarbon. The surfactant may be chosen to stabilize the anti-IL-23p19 antibody (at least one) as a suspension in the propellant, to protect the active agent against chemical degradation and the like. Suitable surfactants include sorbitan trioleate, soy lecithin, oleic acid, or the like. In some cases solution sprays using solvents such as ethanol are preferred. Additional agents known to formulate a protein may also be included in the formulation. One of ordinary skill in the art will recognize that the methods of the present invention can be carried out by pulmonary administration of compositions of at least one anti-IL-23p19 antibody via devices not described herein.

Formulations and oral administration

Formulations for oral administration are based on the co-administration of adjuvants (for example, resorcinols and nonionic surfactants such as polyoxyethylene oleyl ether and n-hexadecylpolyethylene ether), to artificially increase the permeability of the intestinal walls, as well as on the coadministration of enzyme inhibitors (eg pancreatic trypsin inhibitors, diisopropylfluorophosphate (DFF) and trasilol) to inhibit enzymatic degradation. Formulations for delivering hydrophilic agents including protein and antibody, and a combination of at least two surfactants, for oral, buccal, mucosal, nasal, pulmonary, transmembrane vaginal or rectal administration are taught in US 6,309,663. The active constituent compound of the solid-type dosage form for oral administration may be mixed with at least one additive, including sucrose, lactose, cellulose, mannitol, trehalose, raffinose, maltitol, dextran, starches, agar, alginates, chitins. , chitosans, pectins, gum tragacanth, gum arabic, gelatin, collagen, casein, albumin, synthetic or semi-synthetic polymer and glyceride. These dosage forms may also contain other types of additives, for example inactive diluting agent, lubricant such as magnesium stearate, paraben, preservative such as sorbic acid, ascorbic acid, alpha-tocopherol, antioxidant such as cistern, disintegrant, binder, thickener, buffering agent, sweetening agent, flavoring agent, perfume agent, etc.

Tablets and pills can be further processed into enteric coated preparations. Liquid preparations for oral administration include emulsion, syrup, elixir, suspension and solution preparations suitable for medical use. These preparations may contain inactive diluting agents commonly used in the said field, for example water. Liposomes have also been described as drug delivery systems for insulin and heparin (US Pat. No. 4,239,754). More recently, artificial mixed amino acid polymer microspheres (proteinoids) have been used to deliver pharmaceutical agents (US Patent No. 4,925,673). In addition, carrier compounds described in US Patent No. 5,879,681, and US Patent No. 5,5,871,753, are used to deliver orally biologically active agents that are known in the art.

Formulations and mucosal administration

A formulation for orally administering a bioactive agent encapsulated in one or more biocompatible polymer or copolymer excipients, preferably a biodegradable polymer or copolymer, produces microcapsules which, due to their adequate size, allow the agent to reach the follicle lymphatic aggregates and are incorporated. by these, otherwise known as the animal's "Peyer's patch" or "GALT", without loss of effectiveness due to passage of the agent through the gastrointestinal tract. Similar follicle lymphatic aggregates can be found in the bronchial tubes (BALT) and in the small intestine. The tissues described above are generally referred to as mucosa-associated lymphoreticular tissues (MALT). For absorption across mucosal surfaces, compositions and methods of delivery of at least one anti-IL-23p19 antibody include an emulsion comprising a plurality of submicron particles, a mucoadhesive macromolecule, a bioactive peptide, and an aqueous phase. continuous that promotes absorption across mucosal surfaces, achieving mucoadhesion of emulsion particles (US Patent No. 5,514,670). Suitable mucosal surfaces for application of the emulsions of the present invention may include corneal, conjunctival, buccal, sublingual, nasal, vaginal, pulmonary, gastric, intestinal, and rectal routes of administration. Formulations for vaginal or rectal administration, for example suppositories, may contain as excipients, for example, polyalkylene glycols, petrolatum, cocoa butter and the like. Formulations for intranasal administration may be solid and may contain, for example, lactose as an excipient, or may be aqueous or oily solutions of nasal drops. For buccal administration, excipients include sugars, calcium stearate, magnesium stearate, pregelatinized starch, and the like (US Patent No. 5,849,695).

Formulations and transdermal administration

For transdermal administration, the anti-IL-23p19 antibody is encapsulated in a delivery device such as a liposome or nanoparticles, microparticles or microcapsule or polymeric microspheres (collectively referred to as microparticles, unless otherwise indicated). Various suitable devices are known, including microparticles made of synthetic polymers, such as polyhydroxy acids such as polylactic acid, polyglycolic acid, and copolymers thereof, polyorthoesters, polyanhydrides, and polyphosphazenes, and natural polymers such as collagen, polyamino acids, albumin, and other proteins. alginate and other polysaccharides, and combinations thereof (US Patent No. 5,814,599).

Administration and prolonged release formulations

Sometimes it may be convenient to deliver the compounds of the present invention to the subject for prolonged periods, eg, for periods of one week to one year, in a single administration. Various depot, implant, or depot dosage forms can be used. For example, a dosage form may contain a harmless pharmaceutically acceptable salt of the compounds that have a low degree of solubility in body fluids, for example (a) an acid addition salt with a polybasic acid such as phosphoric acid, sulfuric, citric acid, tartaric acid, tannic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalene mono- or disulfonic acids, polygalacturonic acid and the like; (b) a salt with a polyvalent metal cation such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium and the like, or with an organic cation formed from, for example, NN dibenzylethylenediamine or ethylenediamine; or (c) combinations of (a) and (b), for example a zinc tannate salt. Additionally, the compounds of the present invention or, preferably a relatively insoluble salt such as those just mentioned, may be formulated into a gel suitable for injection, for example an aluminum monostearate gel, for example with sesame oil. Particularly preferred salts are zinc salts, zinc tannate salts, pamoate salts, and the like. Other types of slow release depot formulation for injection would contain the compound or salt dispersed to be encapsulated in a non-antigenic, innocuous, slowly degrading polymer, such as for example a polylactic acid/polyglycolic acid polymer, for example as described in US Patent No. 3,773,919. Compounds or, preferably relatively insoluble salts as described above, can also be formulated into silastic cholesterol matrix pellets, particularly for use in animals. Additional depot or slow release implant formulations, for example gas or liquid liposomes, are known from the literature (US Patent No. 5,770,222 and "Sustained and Controlled Ftelease Drug Delivery Systems", JR Robinson ed., Marcel Dekker, Inc., New York, 1978).

Having generally described the invention, it will be more readily understood by reference to the following examples which are provided by way of illustration and are not to be construed as limiting.

EXAMPLES

EXAMPLE 1

Isolation of human specific anti-human IL-23 antibodies by phage display

General methods for the selection of antigen-specific antibodies from HuCAL™ libraries prepared on MorphoSys have been described (Knappik et al., 2000; Krebs et al., 2001; Rauchenberger et al., 2003). Vh region-specific pool subsets from the HuCAL Gold™ fab library (Kretzschmar & von Ruden, 2002) were used for screening for antibodies against recombinant human IL-23 (hrlL-23). Several different selection strategies were used including:

1. Selection against recombinant IL-23 protein that was immobilized directly on plastic, with or without pre-adsorption of the library on recombinant human IL-12 protein (hrlL-12) also directly adsorbed on plastic. Recombinant hIL-23 and hIL-12 proteins were produced at Centocor.

2. Selection with recombinant IL-23 protein in solution, followed by recovery of bound phage by capture of the hlL-23 protein onto an immobilized hrlL-12p40 mAb. Selections were performed with or without pre-adsorption of the library onto the recombinant hrlL-12 protein captured with the same mAb.

3. Selection with chemically biotinylated hrlL-23 protein in solution, followed by capture of bound phage with SA-coated magnetic beads. Selections were made with or without hrlL-12 protein in molar excess as a competitor.

Recovered phagemid DNA was bulk converted into a Fab expression vector, and individual clones were selected after transformation for their binding to hrlL-23 but not hrlL-12. Sequencing of the positive clones identified 76 unique Fabs.

EXAMPLE 2

Fab characterization

Positive Fabs were produced and purified as described previously (Knappik et al., 2000; Krebs et al., 2001; Rauchenberger et al., 2003), and binding specificity to hrIL-23 but not to hrlL-12, nor to hrIL-23 was confirmed. the p40 subunit of hrlL-12, (hrp40) in assays similar to those described below in Example 3. Confirmed Fabs were analyzed for (1) inhibition of hrlL-23 binding to human IL-23 receptor (hlL-23R) or human IL-12 receptor β1 (hlL-12Rpi), (2) absence inhibition of hrlL-12 binding to IL-12RILP1, (3) inhibition of hrlL-23 binding to TALL-104 cells naturally expressing IL-23R and IL-12Rp1, and (4) affinity binding to hrlL -23, hrlL-12 and the hrp40 subunit. Binding specificity and affinity are summarized in Table 1, and inhibition of hrlL23 binding to hlL-23R is listed in Table 2. In Table 1 Fab12A is a reference standard derived from an IL-specific mAb -12p40. In Table 2 IL-23R-Fc is a reference standard that corresponds to the extracellular domain of human IL-23R fused to a human Fe.

In general, receptor inhibition tests were similar to those described below in Example 4 for mAb derivatives of these Fabs. An additional test was to measure the inhibition of rhlL-23 binding to TALL104 cells. These cells express the human IL-23 and IL-12R beta 1 receptors. Of the 13 candidate Fabs 10 had the desired activity profile of lack of reactivity with human IL-12 or p40 proteins in any test, and at least partial inhibition of rhlL-23 binding to the IL-23 receptor. The CDR sequences of six of the Fabs (4083, 4190, 4205, 4217, 4649, and 4658) are shown in Table 4 (in bold). The complete V region sequences for these Fabs are shown in Table 8.

Fab production in a human lqG1 format

Candidate Fabs were cloned into human IgG 1 /kappa or lambda mAb format vectors, and produced by transient transfection into HEK293 cells for further analysis as mAbs. Overall, 11 of the 13 active Fabs showed a desired profile as mAbs. They are specific for IL-23 and at least partially inhibited the binding of human IL-23 to the human IL-23R-Fc fusion protein (Table 3). The tests and results are cited in the following examples.

EXAMPLE 3

Subunit specificity of hlL-23p19 mAbs derived from antibody phage display

Purified mouse anti-hIL-23 mAbs were evaluated in a cytokine capture ELISA for their antigen subunit specificity. Briefly, IL-23 mAbs were plated and incubated with 100 ng/ml of hrlL-23, hrlL-12 and hrp40, respectively. After incubation with biotinylated anti-p40 mAb, binding was detected using HRP-conjugated streptavidin. An anti-p40 mAb and an anti-IL-12 mAb (20C2, No. Catalog 555065, BD Pharmingen, San Diego, California), with known specificity.

Figures 1A and 1B show the binding specificity for two of these mAbs, MOR04083 (same as 4083) and MOR04190 (same as 4190). Figure 1A shows that the mAbs specifically bind to hrlL-23 but not to hrlL-12 or the hrp40 monomer. As the IL-23p19 subunit must covalently associate with p40 to be secreted from mammalian cells, IL-23 mAbs that do not recognize the p40 monomer must bind to the IL-23p19 subunit alone, or to a binding epitope of the p40. p19-p40 heterodimer. Therefore, these IL-23 mAbs are referred to as the IL-23p19 mAbs. In comparison, all 3 proteins (hrlL-23, hrlL-12 and hrp40) bind to mAb 12A, a neutralizing human anti-p40 specific antibody. Figure 1B shows that the same mAbs do not bind to murine IL-23 or murine p40. In a reverse format, the immobilized mAbs have similar binding curves to hrlL-23 in solution (Figure 2), consistent with their comparable binding affinity as Fabs (Figure 1). The binding specificity of these and the other candidate mAbs is summarized in Table 3.

EXAMPLE 4

Inhibition of IL23 receptor binding by IL-23P19 mAbs

To demonstrate that the IL-23p19 mAbs are neutralizing antibodies against the p19 subunit, the mAbs tested for inhibition of IL-23 and IL-23R binding. In this experiment, a human IL-23R-Fc fusion protein was immobilized on a plate. This fusion protein consists of the extracellular domain of the human IL-23 receptor fused to a human Fe segment. Biotinylated hrlL-23 was added to the plate, either alone or after preincubation with individual IL-23p19 mAbs. Soluble IL-23R (IL-23R-Fc) was used as a positive control. IL-23 binding was detected with HRP-conjugated streptavidin. As shown in Figure 3A, mAbs MOR04083 and MOR04190 prevent IL-23/IL-23R binding with approximately 3-fold less potency than soluble IL-23R-Fc. There was also no inhibition by B21M, a mAb with unrelated specificity. In contrast, when IL-12R31 was immobilized on a plate, these mAbs did not inhibit IL-23/IL-12Rpi binding (Figure 3B). IL-23 binding was inhibited by the p40 neutralizing mAb CNTO 1275 (same as mAb 12A), as expected. Similarly, these mAbs did not block IL-12/IL-12R31 binding (Figure 3C). CNTO 1275 again served as a positive control. The selective inhibition of IL-23/IL-23R binding, and the absence of interference with the binding of IL-12 or IL-23 to IL-12Rp1, also shows that these IL-23p19 mAbs do not bind to the subunit. p40 and therefore are neutralizing human anti-IL-23p19 antibodies. Receptor inhibition studies with these mAbs are summarized in Table 3.

EXAMPLE 5

Neutralization of IL-23 Biological Function with IL-23d19 mAbs

IL-23 is known to induce intracellular STAT3 phosphorylation and IL-17 production by T cells. Therefore, the ability of IL-23p 19 mAbs to inhibit these biological functions of IL-23 was tested. 23 human.

In one experiment, natural killer (NKL) cells were stimulated with hrlL-23, alone or after incubation with mAbs MOR04083 and MOR0190, at 20 ug/ml and 10 ug/ml, respectively. mAb 12A (1 ug/ml) was the positive control and C8.3 (10 ug/ml), a non-neutralizing anti-human p40 mAb, the negative control. The treated cells were stained with fluorochrome-conjugated anti-phospho-STAT3 antibodies and analyzed by intracellular flow cytometry (Figure 4). These mAbs completely inhibit STAT3 phosphorylation, albeit with a lower potency than the neutralizing anti-p40 mAb 12A. The lower potency of the IL-23p19 mAbs probably reflects their relatively weak affinity.

In another experiment, freshly isolated murine splenocytes were treated with hrlL-23 preincubated with titrated IL-23p19 mAbs or control mAbs. HrlL-23 without preincubation with antibody was used as a positive control. After three days of culture, cell supernatants were collected and analyzed by ELISA using a double IL-17 ELISA kit (R&D Systems). As shown in Figure 5A, the IL-23p19 mAbs MOR04083 and MOR04190 inhibited hrlL-23-mediated IL-17 production. These mAbs also inhibited IL-17 production induced by native IL-23 produced by human (Figure 5B) and cynomolgus monkey (Figure 5C) PBMC's.

In comparison, the ability of IL-23p19 mAbs to inhibit IFN production was tested._V induced by hrlL-12. Briefly, NK92MI cells were treated with IL-12 preincubated with titrated IL23p19 mAbs or control mAbs (Figure 6). IL-12 without antibody preincubation was used as a negative control, and CNTO 1275 as a positive control. ELISA analysis performed 24 hours after stimulation did not show any effect of IL-23p19 mAbs MOR04083 and 4190 on IFN production._and induced by IL-12, demonstrating that the antibodies do not bind to or neutralize the p40 subunit shared by IL-12 and IL-23. The results of these tests are summarized in Table 3.

EXAMPLE 6

Epitope identification of IL-23d19 mAbs

Competitive binding assays were performed to determine whether the neutralizing IL-23p19 mAbs bind to similar or different IL-23p19 epitopes. The results for mAbs MOR04083, MOR04190 and MOR04217 are shown in Figure 7. IL-23 mAbs were plated individually onto ELISA plates. Competing mAbs were added, followed by the addition of biotinylated hrIL-23. As a positive control the same mAb was used for depositing as the competitor mAb ("self-competition"). IL-23 binding was detected using streptavidin. The three mAbs showed cross competition to varying degrees, indicating binding at spatially related sites.

EXAMPLE 7

Affinity maturation of candidate neutralizing Fabs

Fabs MOR04083, 04190, 04649 and 04658 were selected for independent affinity maturation based on previous characterization in Fab and mAb formats. Using the cassette feature of the HuCal™ system (Knappik et al., 2000), two variant phage libraries were constructed for each Fab, one for variable light chain (VL) region CDR3, and the other for CDR3.

CDR2 of the heavy chain variable region (VH). These pools were selected against biotinylated hrlL-23 in solution under varying stringency of washout and antigen concentration. 35 unique Fabs were recovered, each showing improved binding activity over the initial parent Fab. Subsequently, three additional Fabs (5267, 5268 and 5269; all VLCDR3 variants of 4083) were selected in a second round of selection. The CDR sequences of the parental Fabs, the mature derivatives of the VL-CDR3 or VH-CDR2 libraries, and variants of those sequences are shown in Tables 4A and 4B. Table 8 shows the complete sequences of the V region.

EXAMPLE 8

Production and characterization of affinity mature Fabs

The selected 38 Fabs were produced, purified and characterized essentially as described in Examples 2-4 above. Ten of the Fabs gave very low yields or showed inhomogeneous patterns on size exclusion chromatography and were excluded from further analysis. The remaining 28 Fabs were analyzed for their binding specificity, affinity, and inhibition of receptor binding. All Fabs were specific for IL-23p19 and had a 10-500 fold higher affinity for hrlL-23 than the corresponding parental Fabs (Tables 5 and 6). All showed IQ values₅₀ improved for inhibition of hrlL-23 binding to the IL-23R-Fc fusion protein and, like the parent Fabs, did not inhibit the binding of IL-23 and IL-12 to the IL-12Rb1 receptor Fe fusion protein (tables 5 and 6). As expected from these results, none of the Fabs inhibited the binding of hrlL-23 to TALL-104 cells, as measured by flow cytometry, consistent with a similar lack of inhibition with the parental Fabs.

EXAMPLE 9

Production and characterization of affinity mature Abs in a mAb format

Thirty-four of the 35 selected Fabs were cloned into human IgG1/kappa or lambda mAb format vectors, and produced as mAbs by transient transfection into HEK293 cells for further analysis. All antibodies were tested for inhibition of IL-17 production as described above in Example 5 (Table 7). In most cases, each of the mature derivatives was more potent than its corresponding parent, with improvements in CI₅₀ up to 200 times. Biochemical properties of the 34 mAbs were assessed by SDS-PAGE and size exclusion chromatography for indications of aggregation, chain heterogeneity, and incomplete disulfide bond formation between heavy and light chains and in the hinge region.

From the combined biochemical and activity analysis, 7 mAbs were selected for further analysis, at least one from each original parental antibody. Antibodies MOR05058 and 05059, derived from the MOR04649 VL CDR3 diversity libraries, were excluded from this set (see Examples 10 and 11). All selected candidates inhibited IL-17 production induced by native IL-23 from human (FIG. 8) and cynomolgus monkey (not shown) PBMCs. As expected, all inhibited the binding of hrIL-23 to the hrIL-23R-Fc fusion protein with greater potency than the control IL-23A mAb (Figure 9). With the possible exception of MOR05053, these selected mAbs did not inhibit native IL-12 bioactivity (not shown), consistent with the lack of binding of those available as Fabs to the hrlL-12 protein.

EXAMPLE 10

Production and characterization of cross-chain combination mAbs

Parental MOR04190, 04649 and 4658 Fabs produced the improved Fabs from the VH CDR2 and VL CDR3 diversity collections. Fabs derived from MOR04649 were of particular interest due to their relatively potent activity from both types of libraries. However, the parent MOR04649 Fab contains a predicted but potentially unfavorable linked N-glycosylation site in VH CDR2 that is not present in any of the 6 improved Fabs derived from the VH CDR2 library. To eliminate this glycosylation site and test the potential for enhanced activity, the heavy chains of MOR05042 and 05045 were expressed with the light chains of MOR05058 and 5059 in HEK293 cells (Table 4C -mAbs 42-58, 42-59,45-58 , and 45-59). None of the combinations were more potent antagonists (IL-17 production and inhibition of IL-23 binding to IL-23R) than the respective donor strand mAbs, and each showed a greater tendency for aggregation based on exclusion chromatography. in size (not shown).

EXAMPLE 11

Substitutional mutaenesis of selected mature mAbs and their characterization

Amino acid substitutions were introduced into selected mAbs to eliminate the predicted N-linked glycosylation site or to conform the amino termini of the variable regions to their closest predicted human germline V region sequence. The predicted N-linked glycosylation site in the Vh of 5058 and 5059 (NYS in CDR2, same as in the parental Vh of MOR04649), was removed by substitution of arginine (4649r) or aspartic acid (4649d) for asparagine in the position 59 (direct numbering). The CDR sequences of these VH regions are shown in Table 4A and the complete V region sequences are given in Table 8. These variants were produced by transient expression in HEK 293 cells and purified by protein A affinity chromatography. These mAbs showed improved potency over the parental antibodies in their inhibition of IL-17 production. The arginine substitution in MOR05059 had the best profile based on activity and biochemical characterization and was named mAbs 3759 (Table 4C).

mAbs 5040 and 3759 were selected as the primary guides based on their activities and biochemical characterization. Amino acid substitutions were introduced for conformance with human germline antibody sequence and a single amino acid substitution was made in the VL=5040 region to reverse a frame mutation back to germline, substituting a valine for threonine. in position 86.

The amino acid sequences changed from the original mAb format were as follows:

VH VL antibody

5040 E(3) to Q D(1) to E, T(86) to V

3759

Q(1)E(3)aEQ

D(1)l(2) to QS

The change from E3 to Q in VH in the two antibodies is the reversion of an E substitution introduced by cloning the Fab into the mAb format vector. Q was present at this position in the original Fabs and can be used as a variant to the E substitution in various mAbs.

These variants are designated as 5040^Q/EV and 3759^EQ'^QS. The component V regions of 5040^Q/EV they are 5040 VH and 4190^EV VL (table 4C). The component V regions of 3759^EQ/QS they are 4649r^AND VH and 5059^whats VL (table 4C). The sequences of the CDRs and the complete V regions of the component chains of the two antibodies are shown in tables 4 and 8, respectively. Similar substitutions can be identified for any of the candidates by comparison with their predicted human germline sequences.

mAbs 5040^Q/EV and 3759^EQ/QS were produced by transient expression in HEK 293 cells and purified by protein A affinity chromatography. These mAbs retain full specificity for human IL-23 relative to IL-12 and p40, as shown in Figure 10. These mAbs inhibit the binding of recombinant human IL-23 to IL-23R-Fc, and are more potent than the reference, mAb23A (Figure 11A). As expected from their specificity profile, they do not inhibit the binding of IL-23 (Figure 11B) or IL-12 (Figure 11C) to IL-12Rpi. Consistent with this pattern of receptor inhibition, these mAbs do not inhibit IFN production._and induced by IL-12 in NK92M1 cells (Figure 12), but inhibited IL-17 production induced by recombinant (Figure 13) and native (Figure 14) IL-17 in murine splenocytes. These mAbs also show very strong inhibition of IL-17 induction by native cynomolgus monkey IL-23 ( Figure 15 ), showing a high degree of cross-reactivity with cynomolgus monkey IL-23. These mAbs also inhibited STAT3 phosphorylation induced in human NK cells by recombinant human IL-23 (not shown).

mAbs 5040^Q/EV and 3759^EQ/QS they recognize closely located epitopes on IL-23, as shown by their inhibition of mAB23A binding (Figure 16A) and their reciprocal competition with one another (Figures 16B and 16C). The mAb23A epitope has been mapped onto human p19 in the region around I93-G105:l₉₃HQGLIFYEKLLG₁₀₅.

The competition results show that the epitopes for mAbs 5040^Q/EV and 3759^EQ/QSThey are in the same region.

EXAMPLE 12

Coding sequence variants of mAbs 5040°^EV and 3759^EQ/QS and its characterization

The coding sequence of the variable regions of the antibodies was engineered into three different coding sequence variants to assess the impact on the expression of these proteins. The first variant used the codons obtained from the original collection, with a few nucleotide substitutions to remove consensus mRNA splice sites. The second variant, germline codon swapping (GCE), was designed by aligning the variable region amino acid sequences with germline genes, identifying the closest matching germline gene, and replacing the coding sequence codons. original with the synonymous codons that are used in the germline gene. At positions where the amino acid residue does not have a match to germline genes, the original codon was replaced with the codon that is used at the highest frequency in highly expressed human proteins. The third codon variant was designed by replacing the initial antibody codons with the codon that is used at the highest frequency in highly expressed human proteins. Each codon variant was expressed, as measured by transient transfection in HEK 293 cells and CHO cells. This result shows that stable cell line transfectants can be established in these cells and probably other host cells, and the most highly expressed variant can be used for development of a production cell line. The mAbs are evaluated as described in Example 11, in addition to further analysis of functional and biochemical and biophysical properties. Table 9 shows the heavy and light chain variable nucleotide sequences for mAb 5040 variants.^Q'^EV and 3759^EQ/QS.

For purposes of this invention, 70-100% amino acid or nucleotide sequence identity is determined (i.e., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,100, or any scale or value within these), using a suitable computer algorithm, as is known in the art.

EXAMPLE 13

Anti-IL-23p19 antibody in the mouse model of psoriasis

The mAb 3759 variant^EQQS was evaluated for its ability to suppress aspects of psoriasis in a humanized mouse model. Unlesioned skin from psoriasis patients was transplanted into immunodeficient mice and after acceptance of the grafts, the psoriatic process was activated by intradermal injection of autologous activated T cells. Mice were treated intraperitoneally once a week with 10 mg/kg of antibody. Control mice were treated with vehicle or cyclosporine A. The body weights of the mice were determined on a weekly basis.

After three weeks of treatment, the mice were euthanized and the transplanted skin biopsies were evaluated for epidermal thickness, cytokeratin 16, and the numbers of HLA-DR and K¡-67 positive cells in the epidermis.

This study shows that the anti-IL23p19 antibody was effective in inhibiting epidermal thickening and keratinocyte proliferation (eg, Ki-67 staining), at a dose of 10 mg/kg. The degree of inhibition was comparable to that achieved with cyclosporine A. Antibody treatment was not associated with significant suppression of HLA-DR or cytokeratin 16. Cyclosporine A treatment also had no significant effect on HLA-DR or cytokeratin 16. These data suggest that the antibody may be effective in suppressing epidermal hyperplasia in psoriasis.

The humanized mouse model of psoriasis is based on the experiments described by WroneSmith et al., 1996, "Dermal injection of immunocytes induces psoriasis". J.Clin. Invest. 98:1878-1887. It is the only preclinical model available in which the effects of drugs on the development of a human psoriatic lesion can be monitored in vivo. To run the model, unlesioned skin biopsies (5 mm) from psoriasis patient volunteers are transplanted into immunocompromised recipient mice. Simultaneously, patients donate blood from which peripheral blood mononuclear cells (PBMC) are isolated and stored cold. PBMCs are stimulated with superantigen for a 48 hour period prior to intradermal injection into autologous transplanted skin (three weeks post-transplantation). The injected activated cells react with human skin resulting in hyperproliferation of the epidermis. The lesion is characterized by elongated ridges (regular and irregular) and marked epidermal hyperplasia of keratinocytes with impaired differentiation.

materials v methods

test substance

Ab molecular weight

Water solubility

company control

Reference compound

Molecular weight

Supplier

Lot Number

Catalog number

Storage conditions

Vehicle for reference compound

Hydroxypropylcellulose (HPC)

Supplier

Lot Number

Catalog number

Storage conditions : 150,000 daltons : >20 mg/ml : PBS : Cyclosporin A : 1202.63 daltons : Wako GmbH : EWP5926 :039-16301 :2-10Ό : Nippon Soda Co., Ltd Japan : HPLC-L 9004-64-2 : NDA-1011 :±21O

The test substance was tested in the humanized mouse model of psoriasis in a formulation agent. Compounds were stored at 4°C until use. Cyclosporin A and hydroxypropyl cellulose solution (CsA carrier) were provided and prepared by TNO. 0.5% hydroxypropyl cellulose was prepared in distilled water and sterilized at a temperature of 120°C for 25 minutes. After sterilization, the HPC was stored at 4°C until used. Immediately prior to intraperitoneal treatment, the required amount of CsA was weighed out and mixed with vehicle using a mortar and pestle. A stable homogeneous suspension was prepared by mixing a required amount of CsA powder with the HPC vehicle, to a total volume of 200 μΙ per mouse (resuspended seconds before treatment).

Mice

Nomenclature: NIH-/ysA Foxn1^wildebeest BtkX strain code 201 (homozygous); Origin: Most commonly referred to as NIH-III, developed at the National Institutes of Health, Bethesda. In addition to the nude gene, which results in the absence of thymus and T cell function, this mouse has two other important mutations to regulate the function of the immune system. These are designated as the x-linked (xid) and beige (bg) immune defect. Beige mice have a severe deficiency in natural killer (NK) cells (Roder et al., 1979). Mice with the xid mutation have functional defects in B lymphocytes (Scher et al., 1980). This triple deficiency has the effect that these mice can serve as hosts for tumor lines, which will not grow or grow very slowly in hairless mice. The engraftment of human hematopoietic stem cells into bg-nu-kid mice has been described by Kamel-Reid and Dick (1988). The extent of T-independent NK cell and B lymphocyte deficiency in NIH-III has not been established. Color: Hairless, light to dark gray pigmented skin.

Male BNX mice (NIH-lll homozygous), 8 weeks old, were provided by Charles River (USA) and supplied to TNO. They were acclimatized to laboratory conditions for at least seven days before transplanting. Mice were kept in ventilated rooms with 9-11 air changes per hour and were kept at a temperature of 22 ± 3°C and an average relative humidity of 55% (40-70%). The lighting was artificial with a sequence of 12 hours of light and 12 hours of darkness. Prior to transplantation, mice were individually housed in type 2 macrolon cages on sawdust. After transplantation the mice were individually housed in ventilated cages. The health report for these mice received from the supplier showed no pathogens in these animals.

Prior to transplantation into the mice, they were acclimatized for one week. After transplantation, transplant-accepted mice (determined by gross examination with respect to general appearance, damage, wounds, integration, and redness) were randomized into treatment groups. The randomization criteria applied were the prevention of:

1. Union of matched donor biopsies into a pool.

2. The distribution of matched donor biopsies into dose escalated groups as much as possible.

Sixty-one transplanted mice (out of a total of 72 transplanted mice) were considered suitable for inclusion in the study, and this allowed 9 groups of mice (6 to 7 mice per group).

Subsequently, activated PBMCs from the patients (0.5x10⁶/transplant) were injected into the autologous transplants (day 0). In general, the phenotypes of activated PBMCs (after culture for 48 hours and before injection), regularly determined by flow cytometry (not evaluated in this study), show CD3+ cells (20-85% of the total cell population). ), CD4+ cells (20-60% of the total CD3 population), CD8+ cells (20-55% of the total CD3 population), CD4+ CD8+ (5-20% of the total CD3 population), CD25+ cells ( 30-65% of the total CD3 population), HLA-DR+ cells (5-20% of the total CD3 population), CD69+HLA-DR+ cells combined (10-55% of the total CD3 population), CD54+ cells (50-85% of the total CD3 population ), and CD49d+ cells (10-60% of the total CD3 population). Furthermore, most of the aforementioned activation and migration markers are upregulated compared to day 0 or 1 after in vitro activation by SEB.

Mice were treated from day -1 to day 21 by intraperitoneal administration of 200 μΙ of compound or vehicle. A control group was treated orally with CsA. The effect of anti-IL2319 antibody treatment was evaluated in a 21-day study at a weekly ip dose of 10 mg/kg. Vehicle (PBS) treated mice served as negative control. Cyclosporin A (20 mg/kg, orally) was administered once daily for a period of 21 days and served as a positive control. Body weight was measured once a week, starting 3 days before starting treatment.

outcome parameters

Epidermal thickness (pm)

HLA-DR (epidermis)

Ki-67 (epidermis)

Cytokeratin 16 (epidermis)

Preparation of skin biopsies and transplantation

Informed consent was obtained from all skin donors. All adult patients were clinically diagnosed by a dermatologist as suffering from psoriasis vulgaris. Patients did not have extensive psoriasis and did not exceed a PASI score of 6. Patients did not undergo light therapy or any systemic therapy (eg, methotrexate, cyclosporine, or any TNF-α-targeted therapy). Patients were accepted as donors if they used corticosteroids locally, when necessary, or basic creams to prevent skin dryness.

Age, sex, or disease duration/history were not part of the inclusion or exclusion criteria.

Three non-lesional skin biopsies (5 mm in diameter) and approximately 30 ml of blood were obtained from each psoriasis patient. After taking the skin biopsies and removing subcutaneous fat, the skin biopsies were stored in sterile tubes containing sterile surgical dressings moistened with saline at a temperature of approximately +4°C. Transport of the skin and blood to the laboratory took place within 7 hours after collection. Peripheral blood mononuclear cells (PBMCs) were isolated from the blood by density centrifugation and stored cold at -140O.

Skin biopsies were transplanted into immunodeficient BNX mice into the panicle carnosum (posterior neck region) after full-thickness surgical removal of the skin from the mice. Human skin biopsies replaced freshly removed mouse skin and were covered with Op-site surgical tape (Smith and Nephew, Hoofddorp, The Netherlands), followed by regular surgical tape. Mice were checked once a day for the integrity of the bandages. In case of loss or damage to the bandage, a new bandage was immediately applied.

Three weeks after transplantation, the biopsies integrated well into the mouse tissue; they maintained all human characteristics and did not overgrow mouse tissue. Before the mice were randomly assigned to the different treatment groups, the biopsies were examined and recorded with respect to their general appearance, damage, or wounds, and differences in skin color from the biopsies belonging to the donor. Subsequently only intact biopsies were included and randomized into the study as described above. Biopsies were not included in case of graft damage/wounding, or in case a biopsy belonging to a donor differed widely with respect to skin color. Subsequently, these integrated and embedded transplants were injected with superantigen-activated autologous PBMCs (see below).

Donor peripheral blood mononuclear cells

Donor PBMCs were cultured for a period of 48 hours in IMDM (Biowhitaker, Lot No. 2MB0103) supplemented with fetal calf serum (10%) and stimulated with 1 pg/ml staphylococcal enterotoxin B (SEB; Toxin Technology). , Florida, USA; Lot No. 51497B), in the presence of 40 U/ml recombinant human IL-2 (Preprotech Inc, supplied by Tebu-bio cat.no. 200-02). Cells were grown in 24-well flat bottom culture plates (Costar). After culturing for 48 hours, cells were harvested and washed twice with PBS containing 0.5% bovine serum albumin, and once with PBS alone. PBMCs were resuspended in PBS at 5 χ 10⁶ viable cells per ml, and 10ΟμΙ were injected intradermally into the autologous skin transplants to initiate abnormal psoriatic differentiation.

Biopsy tissue cryopreservation and serum collection

To obtain human biopsy tissues, mice were euthanized by asphyxiation with

CO₂. Biopsies were removed keeping a small edge of mouse skin attached. Promptly after dissection, biopsies were embedded in Tissue-Tec and frozen in liquid nitrogen for storage in labeled aluminum containers. Immediately after sacrifice, blood was collected by cardiac puncture into non-clotted tubes. Blood samples were allowed to clot at room temperature for 45 minutes. Before centrifugation (1400 RPM for 10 minutes at 4Ό), samples were placed on melted ice for 1 hour. Immediately after centrifuging, the serum supernatants were collected and stored at -80O.

Histological evaluation

Histological staining was performed on cryopreserved tissues. Diagonal cross sections (10 pm) were prepared, covering all skin layers (not shown: the stratum corneum and epidermis from the transplanted biopsy are located on top; murine tissue forms the basement for transplanted human skin).

Hematoxylin staining to determine epidermal thickness

Three selected sections from the center of the biopsy were stained with hematoxylin-eosin and evaluated at 200-fold magnification. Thickness was measured using the LeicaQWin image analysis and processing system (Leica Imaging Systems Ltd, version 2.2a, Cambridge, England). Ridge thickness was measured as a representative parameter for lesion development. If no clear ridges (or inter-ridges) were present, a mean value was given assuming the epidermis is one long ridge. The result of a minimum of 4 microscopic observations was included in the average thickness of each section. From this the average ("corrected") epidermal thickness was calculated by correction for microscopic magnification.

HLA-DR staining

Two sections per biopsy were stained with mouse anti-human HLA-DR (NCL-LN3 antigen, Nova Castra, lot 109207) and evaluated at 400x microscopic magnification. The total number of positive cells in the epidermis in representative sections was determined and reported as the number of HLA-DR positive cells per observation. From each section the minimum result of 4 microscopic observations was included in the mean value [epidermal and dermal immunohistochemical stains of psoriasis patients with plaque lesion show increased HLA-DR expression, providing further support for the hypothesis that mechanisms immunologic play an important role in the pathogenesis of psoriasis; see also Gotlieb et al., J. Exp. Med, 1986].

Ki-67 staining (gueratinocyte proliferation)

Two sections were stained with mouse anti-human Ki-67 (BD Biosciences 556003) and evaluated at 400x microscopic magnification. The total number of positive cells in the epidermis in representative sections was determined and presented as the number of Ki-67 positive cells per mm.². For each section, the results of a minimum of 4 microscopic observations were included as the mean value [KI-67 is a cell cycle specific protein that can detect actively dividing cells; in psoriatic skin lesions, Ki-67 is a highly specific marker for keratinocyte or epidermal hyperproliferation, which is a key feature of psoriasis; see also Wraight et al., J. Invest. Dermatol, 1997],

CK-16 staining (cytokeratin 16 expression)

A representative section was stained with mouse anti-human cytokeratin 16 (Chemicon, Cat. no CBL273, expiration date February 2007), and evaluated at 400x microscopic magnification. Cytokeratin-16 expression in the epidermis was determined according to a scoring method to assess the distribution of CK-16 on a 3-point scale, described by Jongh et al., J. Invest Dermatol 125:1163-1173, 2005. . According to the scoring scale, a score of 0 represents the absence of CK-16, a score of 1 represents the patchy distribution of CK-16, and a score of 2 represents a continuous distribution of CK-16. For each biopsy section the entire length of the epidermis was evaluated. Cumulative scores and incidence by group were determined and presented [regulation of keratinocyte differentiation is particularly important in psoriasis, and one of the important markers of differentiating hyperproliferative and psoriatic skin is cytokeratin 16; see also Bigliardi et al., J. Invest. Dermatol, 2000].

Statistic analysis

Basic statistical analyzes were performed as follows: The significance of differences between all treatment groups was treated using analysis of variance (ANOVA). Each significant ANOVA was followed by post hoc LSD tests (least significant difference), to determine the significance of the difference between each treatment group and the control group. All statistical analyzes were performed using the statistical software program SPSS 11.5 for Windows (SPSS Inc., Chicago, Illinois, USA).

Interpretation of p values:

• p< 0.05 indicates statistically significant differences • 0.05 < p < 0.10 is considered a trend • p > 0.10 is considered non-significant

Mice treated with PBS are presented as "vehicle". Mice treated with 20 mg/kg cyclosporin A are presented as CsA (20 mg/kg).

Transplant

For this study, 24 patients with psoriasis donated 3 non-lesional skin biopsies and 26 to 30 ml of blood. In this way, a total of 72 biopsies were transplanted. Three weeks after transplantation, 11 transplants were considered unsuitable for inclusion in the study. Therefore, a total of 61 mice (85%) could be included in this study. For randomization and inclusion criteria see also “2.2 Study design” and “2.5 Preparations from skin biopsies and transplants”.

Due to baseline staining (even after restaining new sections of fresh tissue), some of the HLA-DR stained slides could not be evaluated. Staining controls showed no irregularities (see below) and unfortunately there is no explanation for this. The controls that were used were a reference tissue section that showed similar results as in previous experiments, a reference tissue section of lesioned skin that showed corresponding HLA-DR expression as in previous experiments, and finally, by On histology slides, a tissue section with an IgG2b isotype antibody control was included, which did not show false-positive results or high baseline staining.

Test Pattern Features

Histological evaluation of vehicle-treated mice, 21 days after injection of SEB-activated PBMCs, showed an average epidermis thickness of 176.8 ± 28.1,29.7 ± 8.0 Ki-67 positive cells per mm.² in the epidermis, 14.9 ± 7.1 HLA-DR positive cells per mm² in the epidermis, and a cumulative score of 6 for CK-16 expression in the epidermis.

Treatment with CsA resulted in a significant reduction in epidermal thickness to 105.5 ±

11.3 pm (p=0.003) compared to vehicle-treated mice. These results correspond to a reduction of 40% compared to the vehicle. The number of Ki-67 positive cells decreased significantly to 15.6 ± 4.3 per mm²; p=0.027.

The number of HLA-DR positive cells decreased to 9.6 ± 4.6 per mm², but this effect did not reach statistical significance. CK-16 expression decreased to a cumulative score of 3, but this did not reach significance. None of the treatments showed a significant change in body weight compared to vehicle.

Antibody treatment effect

epidermal thickness:

Anti-IL23p19 antibody treatment showed significant suppression of epidermal thickening (120.0 ± 17.4 pm) at a dose of 10 mg/kg (p=0.020).

Ki-67:

IP treatment with anti-IL23p19 antibody at a dose of 10 mg/kg resulted in significant suppression of keratinocyte proliferation (p=0.010).

HLA-DR:

Treatment was not associated with significant suppression of HLA-DR.

CK-16:

Although CK-16 expression was clearly associated with an inhibitory effect after treatment with CsA and anti-IL23p19 antibody, the treatment did not reach statistical significance.

conclusions

In this study, intraperitoneally administered anti-IL23p19 antibody, once a week at a dose of 10 mg/kg, was evaluated for its effect on the development of psoriasis on non-lesional skin of psoriasis patients. transplanted into immunodeficient mice.

Treatment was started one day before injection of activated autologous T cells and continued until 21 days after PBMC injection. Treatment with PBS (vehicle) served as a negative control. Cyclosporine A (20 mg/kg, oral) served as a positive control. Body weight, epidermal thickness, keratinocyte proliferation (Ki-67 positive cells), cytokeratin 16 score, and the number of HLA-DR positive cells were evaluated.

CsA treatment significantly suppressed epidermal thickening and keratinocyte proliferation (Ki-67 positive cells) by 40% (p=0.007) and 53% (p=0.027), respectively, compared to vehicle control. Anti-IL23p19 antibody treatment at 10 mg/kg showed a significant effect on suppression of epidermal thickening in 32%, and keratinocyte (Ki-67) proliferation in 41%, compared to vehicle control.

None of the treatments showed significant inhibition of HLA-DR or CK16 expression. The lack of efficacy of CsA, or any of the compounds on HLA-DR expression could be associated with insufficient immunological activity in general, as determined by HLA-DR expression at the time of sacrificing the mice, 21 days later. of PBMC injection. Compared to previous studies, the results show less HLA-DR expression without substantial explanation. Furthermore, none of the compounds showed an effect on body weight. The body weight was evaluated in view of the welfare of the animal. Weight loss or growth inhibition is a common side effect of murine treatment with CsA or immunosuppressive agents in general. Taken together, treatment with the anti-IL23p19 antibody seems a promising proposition in the treatment of psoriasis.

TABLE 1

Binding specificity of candidate Fabs

<td></td><td colspan="5">ELISA specificity: antigens in immobilized</td><td colspan="2">Biacore (capture Fab) K_D.</td>

<td>MOOR</td><td>IL-CNT</td><td>IL-R&amp;</td><td>IL-CNT</td><td>IL-R&amp;</td><td>p4R&amp;</td><td>IL-CNT</td><td>IL-CNT</td>

<td> 408</td><td> +</td><td>no</td><td></td><td>no</td><td>no</td><td> 1</td><td>No</td>

<td> 408</td><td> +</td><td>no</td><td></td><td>no</td><td>no</td><td> 3</td><td>no union; n:</td>

<td> 418</td><td> +</td><td>no</td><td></td><td> 11</td><td> 11</td><td> 7</td><td>No</td>

<td> 419</td><td> +</td><td>no</td><td></td><td>no</td><td>no</td><td> 1</td><td>No</td>

<td> 420</td><td> +</td><td> +</td><td></td><td></td><td></td><td> 14</td><td>light</td>

<td> 421</td><td> +</td><td> +</td><td></td><td></td><td></td><td> 4</td><td>light</td>

<td> 423</td><td> +</td><td> +</td><td></td><td></td><td></td><td> 6</td><td>light</td>

<td> 449</td><td> +</td><td> +</td><td></td><td></td><td></td><td> 19</td><td> 110</td>

<td> 464</td><td> +</td><td> +</td><td></td><td></td><td></td><td> 1</td><td>No</td>

<td> 464</td><td> +</td><td> +</td><td></td><td></td><td></td><td> 7</td><td>No</td>

<td> 465</td><td> +</td><td> +</td><td></td><td></td><td></td><td> 16</td><td>No</td>

<td> 465</td><td> +</td><td> +</td><td></td><td></td><td> +</td><td> 6</td><td>No</td>

<td> 465</td><td> +</td><td> +</td><td></td><td></td><td> -</td><td> 1</td><td>No</td>

<td>Fabl2</td><td> +</td><td> +</td><td> +</td><td> +</td><td> +</td><td> 1</td><td> 0.</td>

TABLE 2

Clgode Fabs candidates in the hrll--23/hll--23R test

<td>MOOR#</td><td>IC50 [nM]</td>

<td> 4083</td><td> 4.6+/-3.9</td>

<td> 4086</td><td>incomplete inhibition</td>

<td> 4185</td><td> 280</td>

<td> 4190</td><td> 4.8+/-2</td>

<td> 4205</td><td> 38</td>

<td> 4217</td><td> 16</td>

<td> 4235</td><td> 190</td>

<td> 4491</td><td>10 - 50% inhibition</td>

<td> 4647</td><td> 2.1</td>

<td> 4649</td><td> 0.2+/-0.2</td>

<td> 4651</td><td> 36</td>

<td> 4655</td><td> 286</td>

<td> 4658</td><td> 0.7</td>

<td>IL-23R-Fc</td><td> 1.8+/-1.8</td>

Characterization of parental antibodies in a mAb format

<td rowspan="3">Production test of lL-1'7 induced by 1L-23</td><td>Neutralization of IL-23 native gird</td><td> +</td><td> +</td><td> +</td><td> +</td><td>5z</td><td>5z</td><td>5 z</td><td>5 z</td><td>5 ζ</td><td>Ζ</td><td>Ζ</td><td>5 Ζ</td><td>5 Ζ</td><td>5 ζ</td><td>5 Ζ</td><td>5 Ζ</td><td>5 z</td><td>5z</td>

<td>Ave φZ ünt ya j ra ra ·-' α Ü a) 2 dj Z5</td><td> +</td><td> +</td><td> +</td><td> +</td><td>•either</td><td> 3</td><td>•or £</td><td> •0</td><td> 13</td><td> 13 §</td><td> 13</td><td> 13</td><td>Ό Ζ</td><td> 13</td><td> 13</td><td> 13</td><td> 13</td><td> 13 §</td>

<td>fl :2 ί- ο -H go z</td><td> +</td><td> +</td><td> +</td><td> +</td><td></td><td> +</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> * +</td><td>ΐ •fr * +</td><td> +</td><td> +</td><td> +</td>

<td>Bioassay of IL-12 in NK92M1</td><td>ss S x 3S 6 VD M</td><td></td><td></td><td></td><td></td><td>T3 ÍZ</td><td>T3 ÍZ</td><td> 13</td><td>T5</td><td>13 ÍZ</td><td></td><td></td><td></td><td></td><td>13 Z</td><td></td><td> +</td><td> +</td><td> +</td>

<td>pSTAT3 test</td><td>S α = o S o •Ό -d ¿ λ 5 ·5 B u C q 0</td><td>Ξ or 1Λ AND⁺</td><td>either ra +</td><td>-Ηφ 53 * 1 (S++</td><td>either ra +</td><td>Φ +</td><td>EITHER 75</td><td> 0· «</td><td>α α</td><td>Ό</td><td>Φ ra</td><td>0 π</td><td>Φ ra</td><td>Ο) ra</td><td>go. ra</td><td>φ ¢3</td><td>Φ ra</td><td>13 !z</td><td>0 ra +</td>

<td rowspan="3">Biochemical evidence of receptor binding</td><td>ύ «s d</td><td> +</td><td> +</td><td> +</td><td> +</td><td> +</td><td> +</td><td> +</td><td> +</td><td></td><td> +</td><td> +</td><td> +</td><td></td><td></td><td></td><td> +</td><td> +</td><td> +</td>

<td>in I heard H^w</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>dd 2 · w^m ra + H fl</td><td> +</td>

<td>d = d</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>+ 5Γ</td>

<td>Union of 1L-23</td><td>in I HEARD⁷³ Ί « μ-1 v/2 α s M.J. 3</td><td>cn Cl</td><td>cn Q.</td><td>cn Cl</td><td>cn Q.</td><td>CN Q.</td><td>CN £</td><td>CN CL</td><td> 0. £</td><td>CN £</td><td>CN Ε</td><td>CN Ε</td><td>Φ £</td><td>*CN x</td><td>* φ £</td><td>* CN £</td><td>0 If α in heard d 0) TO</td><td>φ 't Cl in 04 dol z</td><td>0 Tf Cl in 01 d 0) ύ</td>

<td>niAb</td><td> £ 0 2</td><td>g COQO or raf</td><td>g EITHER CN raf</td><td>g cn raf φ raf</td><td>g 00V) &lt;0 raf</td><td>go, O OI 4</td><td>EITHER OI rar</td><td>IT) X raff</td><td>Ό, in οι ^f</td><td>ΟCN Οraf</td><td>&gt; TtΌraf</td><td>CN raf raf</td><td>Tj φ -t</td><td>lOj X φ raf</td><td>φ X to raf</td><td>go, go, Φ raf</td><td>in CN raff</td><td>Φ oi raf</td><td>TfΦ raff</td>

Q

What or

<img file="ECSP088591A_D0001.tif" />

Causes cell death at high concentration

Unrealized

<img file="ECSP088591A_D0002.tif" />

+Ά.

I > + + *

or CN

TABLE 4A

He variable region CDR sequences of candidate antibodies

<td>clone #</td><td>VH</td><td>H-CDR1 (SEQ ID NO:)</td><td>H-CDR2 (SEQ ID NO:)</td><td>H-CDR3 (SEQ ID NO:)</td><td>Comments</td>

<td> 4083</td><td>AI</td><td>NYAIS (1)</td><td>GHPMFGYANYAQKFQG (7)</td><td>DIYAGMDV (40)</td><td>primary hit</td>

<td> 5028</td><td></td><td></td><td>GÜPVFGFTHYAQKFQG (8)</td><td></td><td>affinity maturation</td>

<td> 4190</td><td>AI</td><td>SNYIS (2)</td><td>GIIPIFGI lANYAQKFQG (9)</td><td>SKKGMYGGWTYP LMMFDL (41)</td><td>primary hit</td>

<td> 5033</td><td></td><td></td><td>IIIPPIGNAWYAQKFQG (10)</td><td></td><td>affinity maturation</td>

<td> 5034</td><td></td><td></td><td>LIDPNFGGAYYAQKFQG (eleven)</td><td></td><td>affinity maturation</td>

<td> 5036</td><td></td><td></td><td>LIDPVFGGAYYAQKFQG (12)</td><td></td><td>affinity maturation</td>

<td> 5037</td><td></td><td></td><td>LIDPMFGGAYYAQKFQG (13)</td><td></td><td>affinity maturation</td>

<td> 5038</td><td></td><td></td><td>1 \ \ 1TT .GGTWYAQKFQG (14)</td><td></td><td>affinity maturation</td>

<td> 5040</td><td></td><td></td><td>ISPGTGINAYYAQKFQG (fifteen)</td><td></td><td>affinity maturation</td>

<td>4190x</td><td></td><td></td><td>Z1Z2Z3Z4Z5Z6Z7Z8Z9Z ]_Q YAQK FQG!!(16)</td><td></td><td>predicted</td>

<td> 4205</td><td> 5</td><td>NYWIS (3)</td><td>WIRPGDSDTRYSPSFEG (17)</td><td>HYYGMDY (42)</td><td>primary hit</td>

<td> 4217</td><td> 3</td><td>1.1.1.1.1 sywit (4)</td><td>VSYISSSGSSTYYADSVKG (18)</td><td>GTFWSFGNYFAN (43)</td><td>primary hit</td>

<td> 4649</td><td> 5</td><td>NYWIG(5)</td><td>IIDPSNSYTNYSPSFQG (19)</td><td>WYYKPFDV (44)</td><td>primary hit</td>

<td>4649r</td><td></td><td></td><td>IIDPSNSYTRYSPSFQG (20)</td><td></td><td>Δ glycosylation site</td>

<td>4649r^you</td><td></td><td></td><td>IIDPSNSYTRYSPSFQG</td><td></td><td>substitutions the most</td>

<td>4649d</td><td></td><td></td><td>IIDPSNSYTDYSPSFQG (21)</td><td></td><td>Δ glycosylation site</td>

<td> 5041</td><td></td><td></td><td>nSPTGSVTWYSPSFQG;(22)</td><td></td><td>affinity maturation</td>

<td> 5042</td><td></td><td></td><td>IISPTGSSTWYSPSFQG(23)</td><td></td><td>affinity maturation</td>

<td> 5043</td><td></td><td></td><td>FISPDGSHTWYSPSFQG (24)</td><td></td><td>affinity maturation</td>

<td> 5044</td><td></td><td></td><td>IISPSGSTTWYSPSFQG:(25)</td><td></td><td>affinity maturation</td>

<td> 5045</td><td></td><td></td><td>TTSPTGSATWYSPSFQG (26)</td><td></td><td>affinity maturation</td>

<td> 5046</td><td></td><td></td><td>IIDPVSSWTKYSPSFQG (27)</td><td></td><td>affinity maturation</td>

<td>4649x</td><td></td><td></td><td>III₁XP₂x₃SX4TX₅YSPSFQG* * (28)</td><td></td><td>predicted</td>

<td> 4658</td><td> 3</td><td>SFGMS (6)</td><td>NISSSGSS—TYYADSVKG (29)</td><td>YWGTPYLMQFDN (Four. Five)</td><td>primary hit</td>

TABLE 4A (Continued)

<td>clone #</td><td>VH</td><td>H-CDR1 (SEQ ID NO:)</td><td>H-CDR2 (SEQ ID NO:)</td><td>H-CDR3 (SEQ ID NO:)</td><td>Comments</td>

<td> 5039</td><td></td><td></td><td>NIEHKYLNYATYYAASVK G(30)</td><td></td><td>affinity maturation</td>

<td> 5047</td><td></td><td></td><td>NilÍHKYLGYATSYAASVKG (146)</td><td></td><td>affinity maturation</td>

<td> 5048</td><td></td><td></td><td>NIEHKFMGYTTYYAAGVK G(31)</td><td></td><td>affinity maturation</td>

<td> 5049</td><td></td><td></td><td>GIEHKYLSYTTHYAASVKG (32)</td><td></td><td>affinity maturation</td>

<td> 5050</td><td></td><td></td><td>SIEHKYTGYTTYYAAPVKG (33)</td><td></td><td>affinity maturation</td>

<td> 5051</td><td></td><td></td><td>QIEHKYLSYTTLYAASVKG (3. 4)</td><td></td><td>affinity maturation</td>

<td> 5052</td><td></td><td></td><td>SHZHKYLSYTTFYAASVKG (35)</td><td></td><td>affinity maturation</td>

<td> 5053</td><td></td><td></td><td>NIEGKYTSYTTYYAASVKG (36)</td><td></td><td>affinity maturation</td>

<td> 5054</td><td></td><td></td><td>GIEHKYLSYATLYAASVKG (37)</td><td></td><td>affinity maturation</td>

<td> 5055</td><td></td><td></td><td>NIEHKYT.GYATVYAASVK d(38)</td><td></td><td>affinity maturation</td>

<td> 5056</td><td></td><td></td><td>SIEHKYLSYATYYAAGVKG (39)</td><td></td><td>affinity maturation</td>

<td></td><td></td><td></td><td></td><td></td><td></td>

All antibodies expressed as Fabs have Q at residue 3 in Vh, whereas when expressed as mAbs, most have E at residue 3.

**X! is D or S; x₂ is S, V, D, or T; x₃ is N, S, or G; x₄ is Y, W, T, II, V, S, or A;

x₅ is N, D, R, K, or W!! Z is G, I, or L; z₂ is I or S; z₃ is I, P, N, or D; z₄ is P, G, or A; z₅ is I, Μ, P,

T, Η, Ν, or V; z₆ is F, I, G, or L; z₇ G or I; z₈ is H, Y, N, or G; z₉ is A or T; z_it is N,.W, or Y ++aj is S or A; to₂is T or G; to₃is P or L; to₄ is Y or N; to₅ is S, M, or L; to₆ is I or V ##bi is T, F, D, or S; b₂ is S, I, A, T, R, or L; b₃ is Ν, T, L, S, or G; b₄ is T, Y, S, or I;

b₅ is P or L; b₆ is it F or P

TABLE 4B

V Le region CDR sequences of candidate antibodies

<td>clone #</td><td>VL</td><td>L-CDR1 (SEQ ID NO:)</td><td>L-CDR2 (SEQ ID NO:)</td><td>L-CDR3 (SEQ ID NO:)</td><td>Comments</td>

<td> 4083</td><td>k3</td><td>RASQSVLGNYLA (46)</td><td>GASSRAT (52)</td><td>HQYGSISTT (58)</td><td>primary hit</td>

<td> 5267</td><td></td><td></td><td></td><td>QQYSHLLIT (59)</td><td>affinity maturation</td>

<td> 5268</td><td></td><td></td><td></td><td>QQYSHISLT (60)</td><td>affinity maturation</td>

<td> 5269</td><td></td><td></td><td></td><td>QQFAHILLT (61)</td><td>affinity maturation</td>

<td> 4190</td><td>k3</td><td>RASQSVSSNYLA (47)</td><td>YASRRAT (53)</td><td>QQTSNTPFT (62)</td><td>primary hit</td>

<td> 4190^EV</td><td></td><td></td><td></td><td>QQTSNTPFT</td><td>More substitutions The &amp; V86</td>

<td> 5029</td><td></td><td></td><td></td><td>QQFITYLPT (63)</td><td>affinity maturation</td>

<td> 5030</td><td></td><td></td><td></td><td>QQDALSPFT (64)</td><td>affinity maturation</td>

<td> 5031</td><td></td><td></td><td></td><td>QQDRGTPFT (65)</td><td>affinity maturation</td>

<td> 5032</td><td></td><td></td><td></td><td>QQSLNIPFT (66)</td><td>affinity maturation</td>

<td> 5057</td><td></td><td></td><td></td><td>QQDTSSPFT (67)</td><td>affinity maturation</td>

<td>4190x</td><td></td><td></td><td></td><td>QQb^b^b^FT## (68)</td><td>predicted</td>

<td> 4205</td><td>λι</td><td>SGSSSNIGSYYVN (48)</td><td>GNTHRPS (54)</td><td>OTYASLGPGEV (69)</td><td>primary hit</td>

<td> 4217</td><td>id</td><td>RASQSIFYNLA (49)</td><td>GASNRAT (55)</td><td>QQYSSEPVT (70)</td><td>primary hit</td>

<td> 4649</td><td>λΐ</td><td>TGSSSNIGSGYDVH (fifty)</td><td>GNSKRPS (56)</td><td>SSWT—PSSW (71)</td><td>primary hit</td>

<td> 5058</td><td></td><td></td><td></td><td>SSWTDTPNMIV (72)</td><td>affinity maturation</td>

<td> 5059</td><td></td><td></td><td></td><td>ASWTDGLSLW (73)</td><td>affinity maturation</td>

<td> 5059^whats</td><td></td><td></td><td></td><td>ASWTDGLSLW</td><td>More substitutions Ql, S2</td>

<td>4649x</td><td></td><td></td><td></td><td>cL_τ S WT Da cL₃ cL₄cL₅d, V+ + (74) ~</td><td>predicted</td>

<td> 4658</td><td>λ2</td><td>TGTSSDVGGYNSVS (51)</td><td>SVSSRPS (57)</td><td>SSYDTNKPLW (75)</td><td>primary hit</td>

<td> 5060</td><td></td><td></td><td></td><td>GSYDVYGRFYV (76)</td><td>affinity maturation</td>

<td> 5061</td><td></td><td></td><td></td><td>SSYYFYLQRIV (77)</td><td>affinity maturation</td>

<td> 5062</td><td></td><td></td><td></td><td>QTYYFSYSGPV (78)</td><td>affinity maturation</td>

<td> 5063</td><td></td><td></td><td></td><td>GSWDPIFSYEV (79)</td><td>affinity maturation</td>

TABLE 4C

Antibodies produced, purified and evaluated

<td>Name of Ab</td><td>VH</td><td>VL</td><td>Fab**</td><td>MAb*</td><td>Comments</td>

<td> 4083</td><td> 4083</td><td> 4083</td><td>x</td><td>x</td><td></td>

<td> 5028</td><td> 5028</td><td> 4083</td><td>x</td><td>x</td><td></td>

<td> 5267**</td><td> 4083</td><td> 5267</td><td>x</td><td>(in progress)</td><td></td>

<td> 5268**</td><td> 4083</td><td> 5268</td><td>x</td><td>(in progress)</td><td></td>

<td> 5269**</td><td> 4083</td><td> 5269</td><td>x</td><td>(in progress)</td><td></td>

<td> 4190</td><td> 4190</td><td> 4190</td><td>x</td><td>x</td><td></td>

<td> 5033</td><td> 5033</td><td> 4190</td><td></td><td>x</td><td></td>

<td> 5034</td><td> 5034</td><td> 4190</td><td>x</td><td>x</td><td></td>

<td> 5036</td><td> 5036</td><td> 4190</td><td>x</td><td>x</td><td></td>

<td> 5037</td><td> 5037</td><td> 4190</td><td></td><td>x</td><td></td>

<td> 5038</td><td> 5038</td><td> 4190</td><td>x</td><td>x</td><td></td>

<td> 5040</td><td> 5040</td><td> 4190</td><td></td><td>x</td><td></td>

<td> 5040^and/tíV</td><td> 5040</td><td> 4190'</td><td></td><td>x</td><td>Vh-Q3 retro-substitution in mAb</td>

<td> 5029**</td><td> 4190</td><td> 5029</td><td></td><td>x</td><td></td>

<td> 5030**</td><td> 4190</td><td> 5030</td><td></td><td>x</td><td></td>

<td> 5031**</td><td> 4190</td><td> 5031</td><td></td><td>x</td><td></td>

<td> 5032**</td><td> 4190</td><td> 5032</td><td></td><td>x</td><td></td>

<td> 5057**</td><td> 4190</td><td> 5057</td><td></td><td>x</td><td></td>

<td> 4205</td><td> 4205</td><td> 4205</td><td>x</td><td>x</td><td></td>

<td> 4217</td><td> 4217</td><td> 4217</td><td>x</td><td>x</td><td></td>

<td> 4649</td><td> 4649</td><td> 4649</td><td>x</td><td>x</td><td></td>

<td> 5041</td><td> 5041</td><td> 4649</td><td>x</td><td>x</td><td></td>

<td> 5042</td><td> 5042</td><td> 4649</td><td>x</td><td>x</td><td></td>

<td> 42-58</td><td> 5042</td><td> 5058</td><td></td><td>x</td><td>Pair 5058 VL with VH lacking CDR2 glycosylation site</td>

<td> 42-59</td><td> 5042</td><td> 5059</td><td></td><td>x</td><td>Pair 5059 VL with VH lacking CDR2 glycosylation site</td>

<td> 5043</td><td> 5043</td><td> 4649</td><td>x</td><td>x</td><td></td>

<td> 5044</td><td> 5044</td><td> 4649</td><td>x</td><td>x</td><td></td>

<td> 5045</td><td> 5045</td><td> 4649</td><td>x</td><td>x</td><td></td>

<td> 45-58</td><td> 5045</td><td> 5058</td><td></td><td>x</td><td>Pair 5058 VL with VH lacking CDR2 glycosylation site</td>

<td> 45-59</td><td> 5045</td><td> 5059</td><td></td><td>x</td><td>Pair 5059 VL with VH lacking CDR2 glycosylation site</td>

<td>Ab's name</td><td>VH</td><td>VL</td><td>Fab**</td><td>MAb*</td><td>Comments</td>

<td> 5046</td><td> 5046</td><td> 4649</td><td>x</td><td>x</td><td></td>

<td> 5058</td><td> 4649</td><td> 5058</td><td>x</td><td>x</td><td></td>

<td> 5059</td><td> 4649</td><td> 5058</td><td>x</td><td>x</td><td></td>

<td> 3758</td><td>4649r</td><td> 5058</td><td></td><td>x</td><td></td>

<td> 3759</td><td>4649r</td><td> 5059</td><td></td><td>x</td><td></td>

<td> 3759^tWb</td><td> 4649?</td><td> 5059^QS</td><td></td><td>x</td><td>Vh-Q3 substitution in mAb</td>

<td> 3658</td><td>4649d</td><td> 5058</td><td></td><td>x</td><td></td>

<td> 3659</td><td>4649d</td><td> 5059</td><td></td><td>x</td><td></td>

<td> 4658</td><td> 4658</td><td> 4658</td><td>x</td><td>x</td><td></td>

<td> 5039</td><td> 5039</td><td> 4658</td><td>x</td><td>x</td><td></td>

<td> 5047</td><td> 5047</td><td> 4658</td><td>x</td><td>x</td><td></td>

<td> 5048</td><td> 5048</td><td> 4658</td><td>x</td><td>x</td><td></td>

<td> 5049</td><td> 5049</td><td> 4658</td><td>x</td><td>x</td><td></td>

<td> 5050</td><td> 5050</td><td> 4658</td><td>x</td><td>x</td><td></td>

<td> 5051</td><td> 5051</td><td> 4658</td><td></td><td>x</td><td></td>

<td> 5052</td><td> 5052</td><td> 4658</td><td>x</td><td>x</td><td></td>

<td> 5053</td><td> 5053</td><td> 4658</td><td>x</td><td>x</td><td></td>

<td> 5054</td><td> 5054</td><td> 4658</td><td></td><td>x</td><td></td>

<td> 5055</td><td> 5055</td><td> 4658</td><td>x</td><td>x</td><td></td>

<td> 5056</td><td> 5056</td><td> 4658</td><td>x</td><td>x</td><td></td>

<td> 5060</td><td> 4658</td><td> 5060</td><td>x</td><td>x</td><td></td>

<td> 5061</td><td> 4658</td><td> 5061</td><td>x</td><td>x</td><td></td>

<td> 5062</td><td> 4658</td><td> 5062</td><td>x</td><td>x</td><td></td>

<td> 5063</td><td> 4658</td><td> 5063</td><td>x</td><td>x</td><td></td>

* Except as indicated in the "comments" column, position 3 on the heavy chain was Q in Fabs and E in mAbs.

** The mature affinity kappa light chains of 4083 and 4190 contain a T to V substitution relative to the parents in FW3 (FAVYYC). V is a germ line residue at this position.

# Several Fabs listed as “affinity mature” showed some aggregation during purification and were therefore not tested. They were previously evaluated as hits as raw samples.

TABLE 5

Characterization of Affinity Mature Fabs: Specificity, Receptor Neutralization, and Affinity

<td>MOOR#</td><td>Collection</td><td>k_D.[pM] SET (n:l)</td><td>IC₅₀ [nM] IL23/IL-23R (n: 1-4)</td><td>IL- 23/IL- 12RP1</td><td>IL-12 (R&amp;D) /IL-12Rpl</td><td>specificity ELISA</td><td>FACS (TALL104)</td>

<td> 4083</td><td> -</td><td> 1600</td><td> 7.1±8.3</td><td>okay</td><td>okay</td><td>okay</td><td> -</td>

<td> 5028</td><td>H-CDR2</td><td> 133</td><td> 0.43±0.58</td><td>okay</td><td>okay</td><td>okay</td><td> -</td>

<td> 5267</td><td rowspan="3">L-CDR3</td><td> 2000</td><td> 0.14</td><td>okay</td><td>okay</td><td>na</td><td>na</td>

<td> 5268</td><td> 660</td><td> 0.15</td><td>okay</td><td>okay</td><td>na</td><td>na</td>

<td> 5269</td><td> 960</td><td> 0.2</td><td>okay</td><td>okay</td><td>na</td><td>na</td>

<td> 4190</td><td> -</td><td> 4400</td><td> 1.3+1.5</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5034</td><td rowspan="4">H-CDR2</td><td> 126</td><td> 0.4±0.15</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5036</td><td> 32</td><td> 0.32±0.02</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5038</td><td> 38</td><td> 0.17+0.05</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 4649</td><td> 1100</td><td> 1.2</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5041</td><td rowspan="6">H-CDR2</td><td> 41</td><td> 0.07±0.04</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5042</td><td> 4</td><td> 0.06+0.03</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5043</td><td> 18</td><td> 0.05+0.03</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5044</td><td> 43</td><td> 0.05±0.04</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5045</td><td> 9</td><td> 0.05±0.02</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5046</td><td> 23</td><td> 0.08+0.01</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5058</td><td rowspan="2">L-CDR3</td><td> 33</td><td> 0.11+0.08</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5059</td><td> 93</td><td> 0.69±0.72</td><td>okay</td><td>okay</td><td>okay</td><td></td>

TABLE 6

Characterization of affinity mature Fabs: specificity, receptor neutralization, and affinity

<td>MOOR#</td><td>Collection</td><td>k_D. [p.m] SET(n:l)</td><td>IC₅₀ [nM] IL23/IL-23R (no: 1-4)</td><td>IL- 23/IL- 12R01</td><td>IL-12 (R&amp;D) /IL-12R31</td><td>ELISA specificity</td><td>FACS (TALL104)</td>

<td> 4658</td><td> -</td><td> 4300</td><td> 14</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5039</td><td rowspan="9">H-CDR2</td><td> 27</td><td> 0.1+0.09</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5047</td><td> 36</td><td> 0.13+0.1</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5048</td><td> 20</td><td> 0.1+0.1</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5049</td><td> 7</td><td> 0.39+0.62</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5050</td><td> 23</td><td> 0.89+1.15</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5052</td><td> 10</td><td> 0.58+0.74</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5053</td><td> 27</td><td> 0.98+1.3</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5055</td><td> 29</td><td> 0.79+1.0</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5056</td><td> 65</td><td> 0.52+0.68</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5060</td><td rowspan="4">L-CDR3</td><td> 142</td><td> 1.0+1.14</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5061</td><td> 58</td><td> 1.25+1.49</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5062</td><td> 98</td><td> 1.34+1.5</td><td>okay</td><td>okay</td><td>okay</td><td></td>

<td> 5063</td><td> 69</td><td> 0.32+0.25</td><td>okay</td><td>okay</td><td>okay</td><td></td>

TABLE 7

Characterization of affinity mature antibodies in mAb format: Inhibition of IL-17 production

<td>mAb</td><td>Cl₅₀, µg/ml</td>

<td> 5042</td><td> 0.00127</td>

<td> 5045</td><td> 0.001396</td>

<td> 5040</td><td> 0.002641</td>

<td> 5058</td><td> 0.002847</td>

<td> 5041</td><td> 0.003007</td>

<td> 5054</td><td> 0.003227</td>

<td> 5053</td><td> 0.00493</td>

<td> 5059</td><td> 0.01062</td>

<td> 5044</td><td> 0.01414</td>

<td> 5043</td><td> 0.01439</td>

<td> 5049</td><td> 0.01616</td>

<td> 5048</td><td> 0.01624</td>

<td> 5052</td><td> 0.0178</td>

<td> 5047</td><td> 0.02342</td>

<td> 5050</td><td> 0.02766</td>

<td> 5038</td><td> 0.02815</td>

<td> 5046</td><td> 0.04281</td>

<td> 5029</td><td> 0.04907</td>

<td>mAb23A</td><td> 0.05415</td>

<td> 5030</td><td> 0.06458</td>

<td> 5051</td><td> 0.0663</td>

<td> 5055</td><td> 0.09155</td>

<td> 5056</td><td> 0.09198</td>

<td> 5028</td><td> 0.1039</td>

<td> 5057</td><td> 0.1103</td>

<td> 5039</td><td> 0.1606</td>

<td> 5036</td><td> 0.1702</td>

<td> 5032</td><td> 0.1716</td>

<td> 5034</td><td> 0.1854</td>

<td> 5063</td><td> 0.1981</td>

<td> 5062</td><td> 0.1989</td>

<td> 5031</td><td> 0.2149</td>

<td> 4190</td><td> 0.218</td>

<td> 4649</td><td> 0.2758</td>

<td> 5033</td><td> 0.2834</td>

<td> 5061</td><td> 0.3087</td>

<td> 5037</td><td> 0.3364</td>

<td> 4083</td><td> 1.395</td>

<td> 4658</td><td> 1.956</td>

Inhibition of hrlL-23 binding to the IL-23R-Fc fusion protein. IQ values₅₀ of the titration curves.

The mAbs (see Table 4C) are listed in order of decreasing potency. Mature antibodies are grouped according to their respective parents: pink (5028 is out of 4083); (5040, 5038, 5029, 5030, 5057, 5036, 5032, 5034, 5033, and 5037 are with 4190); (5042, 5045, 5058, 5041,5059, 5044, 5043, 5046, and 4083 are with 4649); (5054, 5053, 5049, 5048, 5052, 5047, 5050, 5051, 5055, 5056, 5039, 5063, 5062, and 5061 are with 4658). #MAb 23A is a murine anti-human IL-23 reference mAb.

TABLE 8

Sequences of initial IL-23p19 mAbs and their mature and engineered derivatives

Family MOR04083 (SEQ ID NOS: 80 & Bl>

Yo

117

4083 Va (1} gVQLVQSGAEVKjÍPGSSVKVSCÍASGG^yourPSMYAT8WVAQAI^heSQGT>FWHGGIimFGYANYACKFt¡GRVTITADESTBTA

YMELSSIiBSE QTAVY YCABDIYAGKDVWGQGf L VIVES

5028 VA (1)

Οναΐνοεβαενκιΐβνκνδακαβεβτγηΐμδιτνηαωόαειειτμεείιρνϊώίϊιίτμκκnselia.νΐιταιεβ'ϊετλ.

(SEQ ID NOS: B2-S5>

108

4083 GO(I)

DIVLIQSPMLSLSPGERAILSCSASQSyLmMWYQQKFljQAFRII.IVáSá^AlSVPARFS&amp;SGSGTDmTr^Yes,

EPBDFAmCHQYG_SI_5TTFSQSTKVEIK

5ii8 n (i.)

ΕΐνΐΤ383ΑΪΙ.δΙ₎3Ρ6ΕίΙΑΤΙι3αΐΑ8®νΑ0ΝϊΙιΑϊ1ϊςΰΚΡ6ΰΑ£¹Β1ΙιΙΪΞΑ88ΚΑΤ6νΡΑΒΡ865686Ι0ΡΚ ΤΙ33Β

EPEDF&amp;VHCqQYBbiBIiTFGQGTKVEIK

5267 Vk (1)

ΟΐνΐΤ03ΡΑΓ:,5Ι>5Ι>5ΕΚήΤΙ5α«.5ΚνΐΒ6ΓΉΛ«ϊς0ΚΒδ0ΑΪ®ΙιΙ.ΙΪδΑ33»ΑΤδνΡΑ»ϊ^,363588ΙδΡΤ1Τΐ33ϋ

EPEDFAVYyCqQYEhlilTFGQGTKVEIK

5269 VA (1)

Βΐνυτς35ΑΤΙ₁3Ι.3Ρ(3ΕΒΑΤΙ₁3σΒΑ5υ3'Κ.ΙΜΙΪΪ*ΉΪΟ0ΚΡ6βΜϊα₁1ΐν3Α33ΚΜβνΡΜΪΡ5β3Β36ΤΒΕΤΜ:ΐ83Ι

EPEDFAmCqQfahlllTFGQGTKVBIK

Family MOR04190 (SKQ ID NOS: 85-92)

MOR04217 (SSQ ID OU; 101) i

121

4217 wh (1)

CgtavBSGi^vQPGGS?x8i^MaGmeswiTwraQ&amp;°iasiatw8yi3S5SSCTyyAa5vstaRK!SgRD»gMre^

7íiWSLRKEDTAVrfCAagrrwSFS?nTaMtÍGQ6TOTVSS (SEQ ID NO; 102) i

107

4217 vk ¡1)

Βΐ™τα3ΡΑΙ'1£1ΞΚΕΚ1Τη5εΒΑ3Ο£ΐΙΎΝΙΑΝΪ0ί)ΚΡ(5ΟΛ1'Χ1₁Ι₁ϊϊ&lt;2Α51ίίΑΤί3νρ?ιΙίΓΚ6ίΰ::βΤΙ)ΓίΊ_!ΐΐΞ3ηΕ paPFamcoQYgSEPVTFeQgrKVEiK

TABLE 8 (Continued)

Family MOR04649 (SEQ ID NOS; 103-112) i

117

4645 wh (1)

QVQLVaSGSSVKÍtPGESLRIgCKSSaySFStiYirNe&amp;VgGMPSKSr.Et-ÍMiÍlTBPSÍiSYT.WSPSrQitOVTISRPKSISIA

ΥΐΓ/ ΐ3ίΐ;^.3ητΑ^7ϊΰΑ0.ωϊϊχ.ρΓρνίνΓς3ΓΒντ '/εί;

46493 wh (1)

QV0LVQ6(a3VKB^BjUa^aKGSCySF5S¥aiGaiVR0HPGíKIIBWM0ri0PSNSYTdYSPSFQGQVTISADKSrSTA

YU^ssLmo^YYCMjrmcpTCfflSG^LVTVSS

4645r Vh (1) CVfitVíüSeMV!Kl><^LKISaiG8eíSF6NÍWGIWI«W£«ffiI£#IMGriDPSJrSYftYSPSF0GCVTÍ5.%t>£SISTR

ΪΜΡίΞ£1ΚΑ6Ο1ΜΪΪΟΑ3.ϊΙΥΥΚΡΕΒ\Τ>Κ3Ο6ΐΙΛ'ΤνΞ5

4645? Vh (1) eVQEVQSGMVIKPGSSaasCKGSGYSlSinrWIGlWRQKPGKSISWGIIOPSlSJTrYSSBFQGaV'íISADKSISTA

YtQMSSLKASEíTAMYYCARIJYYKBFDVWSQGTLVTVSS

5046 wh (1)

QVQLVQSGMWPCESjKISCKGSGYSFSKYWIG'/ÍVBñMPGKGtBWMGIIBmSuXKXSPilFSGQVTISAOKSISXA

YI43WS5mSPMMyXCARWYXKPíOVW0CGTIiVIVS5

5044 vh CU

QVQ1VQSGAEVKKPGE8L3ISCKGSGYSPSHYKI GWRQKMKGIBSMGIISPSgStrwYS PS E'QGQVXISADKSl STA

YDOWSSLKASBWjMYYCAAWYYKPPSWÍGQSTLVTVSS

5043 Vh íl)

CVQIVQ3GJffiVKXPBmKI3CKeSCTSPSMYWIG»1.'ROMPGKGtEWGflB?djShTwy87!^YoS,?QGaVTISADKr>IS?A

Yr.QjJSSLKASrTMYYCARKYYKPFDVHGKGClVfííS

5041, Vhíl)

QTOLVQSGamKPGESlKISCKSSGYSFSBYKIGWTOOMPGKGÍEWÍÍSIlBPtgSvTwysPSFQBQV'l'ISAElKSISTA

5042 Vn (1) aWSLVCSGJlEVKKPGESI.ÍÍÍSCKGSGlot'SMYWIGWVRÜMSGKGLEHFiGIIsPhgSsTwySPSE'QGaWISADKSISTA

ΥΙ,0»δ3^Α5ΒΤΑΜΥϊα®ΗϊΧΚΡΡ0ν®6β6ΤηντνΒδ

5045 vn (1)

QVQLVQSGAEVKKPGESLSISCKGSGYSFSKYWISWVMKfGKGLEKMeilBPtgSaTwYSPSFQGQVTISADKSISrA

ΥΙΰΗ38ΐ:&lt;Α3ϋΖΜ1ΥΥΟΑΑΗΥΥΚΡΡ0νΜδΟ6ϊΐ;ντν3δ * consensus N-linked glycosylation site at 4649 Vh (SEQ ID NOS; 113-Π6)

111

4645 VI (1) PIVL1^PSVS6APGQRVIISCYSS^:CSeYDvaWYQCI^TMBaa:YGSSKRP6SVPa&lt;F8GSK8GTSaSiAltG

Ρα53ΡΒΆΡΐϊΟ33?>Τ—PSSWGGGIKLIVL

5058 VL (lj~

DIVLtOPPSVaGMSQBVTISCTiSSSSlISGSGYDVHJíYCOliGTAKMiIXGXSKRPSevmFSGSKSGISASIAn'G

ΙΟεΕΡΕΑΟΪΪβΩΒϊΓΙ'ίΙΐΡηιιιίνΓβεεΤΧΙ,Τνΐ,

5059 NAV £1)

ΚνΐΧαί?ΡβνΒβΆ?ΘΟΒνΤΙ6€Τ0335ΝΙ'3Ξ8ΪΕνΗΗϊα2ΡΡ«ΤΑΡΚΡ1 γ®$^5ΰνΡθα?568Κε6ΐΐΑ5!ΛΙΪβ

LQSSDEADYYCaSWTügLSlWFGGSmm

5059¾d!

3^ΜΙ'1 ενδεΑ£βα^ Ι3εΤ8333Μ3ε3Υ0νΗΗΪ 2ββΡ5ϊΆΡΚ6ΡΙ%Ν3ΚΒΡ3&lt;Γ/^Ρ3Ξ5Κ3σΤ5Ά£ΐΛ.Γ1Ό

J.QSEDKADYYCaSWTdglSlWPGGC'.l'KLIVL

TABLE 8 (Continued)

Family MOR04658 (SEQ ID NOS: 117-127) i

123

4658 Vh (1) FSStWH'VaaaPSRGLSWVSMXSSS— ¡s8STy;AcsvK(^isRDNSsm)n^s»iffinTAmcMawgm-wQroiiwcc6n>vim

50^8 Vb. (1

QVCSV2SGGGL V01H385Mttl3CAASGPΓPSSraHSHVRα»aKCLBWWebkfiβeytTTflUgV»aFf^SR^l¢SKlr

ILXLQtKSXKSOTAVXÍCARVBGmiiíCPDKWSQSTLVTVSS

3030 % (1J

0νΰΙ>νΕ50ίί6ϊνΡε6δΜΠ>3αΑΑ66ΡΤΡ55ΡΒΜ8«νΚζίΑΡ6Κ8ϊιΒΗν33ΐβΙιΧγϋ&γίΤΪΥΑβρ νΚ6Β»νΙΚ1«5

TLYLQ.WSLMSpnvyyCMlYWOTPl'JMffONWGQGT&amp;VWGS

5053 Vh íl)

QV^VBSSSaiVQíGSSlM.SCiASeFIFSSÍ'KlSfíVRaKPGKGlEWSínehkytsytm'AaSVKGRFTISRDirSKN

ΤΜΙΟΜΝ31ΗΑΕΟΤΑ\'ΣΪΟΜίϊ»ΰΤΡΪΙιΜΟΡβΝΗζθαΤΙ₃ντνεε

503S Vh [1)

QV^VES6GQiV0PGGSmSC3aSGPT?SSFffleíllVRaAPSKSU3WSintfiJryIr.yaiyyAaSW!l?1^,IYES«»tStQt

TMLQMNSIilÜ^DrAmCARrWGTFyiííQFDBWeQGf&amp;VTVSS

5055 Vb íl>

2νΕ1.νΕ5ζα0Ι^ν0ΡΕ631ΒΙ.5σήΑ5εΡΓΪ383ΞΚ8νΜ10ΑΡ2Κ6Ι₁Είνν5ΝΙβ&amp;ΧϊΐεγΒΐνϊΑΔ8νκΕΙίΡΤΐΏΚΒΝβϊ(Ν

ΤΑΪΐαΜίεΚΑΒΕΤΑνίϊΟΑΙΙΪ»6ΪΡϊυίΟΓΟ»5!6(3εΤίντν55

5056 wh1}

0ν0ΐνΕ3δ55Ι>νοΡΰ53ϊΤΙι30ΑΛ$αΕΤ335?5Μ5»1^ίΒαΑΡεΚ3Ι£ϊ^,ϊν£Βΐθί1Κν .ΒΪ3ΐϊϊΔ35νΚ5ΗΡΤΙ8&0ΝδΧΚ rLYLQMNSI>añEDTAVYrCAR™GT8YMQmWGQGTI,VTVS8 sosa vh íd δνθΙ,νΕ36&3Ιί8.ν61θ8^,ΤΡδ3?6Μ5»νΚΟΑ?6Κα£κν58ΐίί1ι)ς5'Ϊ8ϊΡΓίϊΑ«$νκκΗ,ίΊΙ61ΜΗεΚΚ Triri>CMk'SE.&SBD?AVYyCA»YKI<;rPYMOFDTVWWGSSQG

S049 Vh (1)

0ν2πνΐ!56ε6Εν0Ι>δθ8ΕΚ. 80ΑΑ3&νΤΡ5δϊ6Μ5ΗνΗ0Α?6Κ(ΠιΕ1«ν39ΐβϊι!ίγ13?ίΒ'.ΪΛ&3νΚ3ΒΙΠ1Η3

ITEM_JYI,aMff55aAEB?AVWCSD'ft-JGT?YMIFDNWG2GÍLVTVSS

3051 Vb (1} (¡νοΐ&amp;νΐϊ.5&lt;366ΐνοΡ3δ8υα₁8α«.εΒΡΤΓ88Ρ6Μ5?ίνΚί»ΡεΚ5Ε3ΐνεςΐ6ΗΑ71Β?ΐΤ1ΪΑΒ3νΚ0ΑΚΤΙ3ΚΟΗ3ΚΝ TLYIXWSI.SMIWAVYyMICTGTPEMQFIWBOGTjVTVSS

5054 Vh(1) (SEQ ID NO: 147]

5047 wh (1)

ÜVümgGGGLVaPGGSlP.LSBAASGFTFSSFGXSWHQAKKGLEWSli lehkyj.GvalsYAítSVKGRFriERDN'SKNTLYLQMNSL·

I'AnjirAV'Zl'CíX'WGTPyiOlGrDNWCOGOLVTViS (SEO ID NOS: 128-132) i

111

4658 VA (1) pmTO?Asvs&lt;%FeQsxtTsaixassTOgwsvswyQQaKaamMiysvssREsgvsNRFsesKssiCTasiTisc

KK [>E ADI YC¿ίϊβΤΗΚΡίνγΡΞί^ΤΚΙί.'Vi

5061 VI> !11

DXAiy'QPASVSGSPGQSITISCTfiTSSDVGGYKGVStíYQQHPGÍtAÍKLMiySVSSRPSGVSHRFSSSKSG'mSITrSS

Α0ΑΕ3ΕΆ0ΥΚ3δϊγίν1ί.ϊίνΡΕΕ3ΙΚί,?νΐ_Ι

5062 VL (1}

PÍM.SQÉASVSGSRaCSITISCTSÍSSDVGGÍiíSVSeYQQHPGKAPKnKrySVSSRBSGVSMRFSSSKSeNrASlTIÍG

1βΑΕΒΕΑ0Υϊσ9ί:ϊγΓ3γΒ9ρν?0Εε^,ΓΚΙ.ϊνΐ

5060 VI, (1) &amp;IM₁TarASV3G5PGQSniüCTGTSSBVfi6yh'5VSHyQQñPGRAFKMI¥3VSSRPSe'7YES®FSGSKSGBTASL?ISG

LQAÉDEÁDi'YCgsyOvyprfyVFGGGIÍXrVL

5063 VL il)

3Ι?ιΧ,Ί0ΡΆ8ν8ΰ5ΡσαβΡ'ί'ΐεεΤίϊΤ550ν2«ΥΒ^,5ν3»ΐίί31ΐ?6ΙίΑί^,Κϋ4ΐϊ3ν33Εί^ϊ£ε'>.5®Γε35Κε6ΚΙΑ5ί,Τΐ5ε

LaMDEADYYCgSwPpifsynVFGGGmWL·

TABLE 9

nucleotide sequences

IL-23 p!9 5040^q/evVH-GCE (SEQ ID NO:133): (the amino acid sequence of .VH is 5040Vh)

QVQ i VCS 6 Λ Ε VKKPGSS 1 CAGGTGCAGC tggtgcagtc tggggctgag gtgaagaagc CTGGGTCCTC GTCCACGTCG ACCACGTCAG ACCCCGACTC CACTTCTTCG GACCCAGGAS

CDR1

- VKVSCKA SGG ZPS S Ν YI

GGTGAAGGTC TQCTCCAAGG CTTCTGGAGG CACCTTCAGC AGCAACTACA CCACTTCCAO AGGACGTTCC GAAGACCTCC GTGGAAGTCG TCGTTGATGT • 5 WV ROA PGQG LEW MGI lül TC.AGCTGGGT GCGACAGGCC CC-GGACAAG GGCTTGAGTG GATGGGGATC AGTCGACCCA CGCTGTCCGG GGACCYGTGC CCGAACTCAC CTACCCCTAG

CDR2

SPOT GINAYYAQKFQGR * 151 AGCCCTGGCA CCGGTATCAA CGCATACTAC GCACAGAAGT GCCAGGGCAG tcgggaccgt ggccatagtt gcgtatgatg cgtgtcttca aggtcccgtc • VTITADES - 3 TAY MEAS

201 A.3TCACQATT ACCSCGGAOG AATCCACGAG CACAGCCTAC ATGGAGCTGA

TCAGTGCTAA YGGCGCCTGC TTAGGTGCTC GTGTCGGATG TACCTCGACT

Cl®3 * SLR SBD Ί AVYYCARSK 251 GCAGCCTGAG ATCTGAGGAC ACGGCCGTGT ATTACTGTGC GAGAAGCAAG

CGTCGGACTC TAGACTCCTG TGCCGGCACA TAATGACACG CTCTTCGTTC

CDR3

KGMYGGW TYF L Μ MFDLW * 3G1 AASGGCñTGT ACGGCGGCTG GACCTACCCC CTEATGAiTGT TCGACCTGIS TTCCCGTACA TGCCGCCGXC CTGGATGGGG GACTACTACA AGCT3GACAC • GQGTLVT VSS

351 GGGCCAGGGC ACCCTGGTGA CCGTGAGCAG C

CCCGGTCCCG YGGGACCACT GGCACYCSTC G

TABLE 9 (Continued)

IL-23 p!9 5040^q/ev

<td>VH-HCO (SEQ IDNO:134):</td><td>(the amino acid sequence of VH is 5040Vh)</td>

QYQLVQSGAEVKKPGSS *

CASGTGCAC-C TGGTGCAGAG CGGCGCCGAG GTGAAGMGC CCGGCAGCAG GTCCACGTCG ACCACGTCTC GCCGCGGCTC CACTTCTTCG GGCCGTCGTC

COSI 'VKV SCKA SGG TE* SSNYI

CGTGAAGGTG AGCTGCAAGG CCAGCGGCGG CACCTTCASC AGCññCTACA GCACTTCCAC TCGACGTTCC GGTCGCCGCC GTGGAAGTCG TCGTTGATGT

S w VRQAPGQG LEW MGI

101 TCAGCTGGGT GCGCCAGGCC CCCGGCCAGG GCCTGGAGTG GATGGGCATC

AGTCGACCCA CGCGGTCCGGGGGCCGGTCC CGSACCTCAC CTACCC3TAG

GDRl *^f » *MA· rte ** 1W F* rt· rt» S» rt Hr RF ftf Ή* V «Ai · *# ™

SBGTGINAYYAQKFQGR 151 AGCCCCGGCA CCGGCATCAA CGCCTACTAC GCCCAGAAGT TCCAGGGCCG

TCGGGGCCGT GGCCGTAGTT GCGGATGATG CGGGTCTICA AGGTCCCGGC

VTIIADE STS TAY Μ ELS 201 CGTGACCATC ACCGCCGACG AGAGCACCAG CACCGCCTAC ATGGAGCTGA

GCACTGGTAG TGGCGGCTGC TCTCGTGGTC GTGGCGGATG TACCTCGACT

SLR SED TAV ϊ YCAR 3K

251 GCAGCCTGCG CAGCGAGGAC ACCGCCGTGT ACTACTGCGC CCGCAGCAAG

CG'íCSGACGC GTCSCTCCTG TGGCGGCACA TGATGACSCG GGCGTCGTTC

CDR3

Af 'w Λ» Ae fh 4rt Λ* Λ* A» A» A f rt ¿\j ffb «w irf A iWi^—m «· rff r· r·^ f· *1^ f^f rjf f^_ f^i Rf Rjf r¿ λ, f^ Rf f^

KGKYGGWTXPL Μ M E DLW *

301 AAGGGCATGT ACGGCGGCTG GACCTACCCC CTCATGATGT TCGACCTGTG TTCCCGTACA TGCCGCCGAC CTGGATGGGG GACTACTACA AGCTGGACAC * GQGTI, VT VES

351 GGGCCAGGGC ACCCTSGTGA CCGTGAGCAG C

CCCGGTCCCG TGGGACCACT GGCACTCGTC G

TABLE 9 (Continued)

IL-23 p!9 5040^q/ev

VH-MOR (SEQ ID NO:135): (the amino acid sequence of VH is 5040Vh)

GVQLVQSGAEVKKPGSS^r

CAGGTGOAAT TGGTTCAGTC SGGCGCGGAA GSGAAAAAñC CGGGCAGCAG GTCCACGm ACCAAGTCAG ACCGCGCCfT CACTTTTTTG GCCCGTCGTC

CDR1

Λ» n R*

- VKV 3 CKASGGT ? SS Ν YI

OGTGAMGTG AGCTGCAAAG gctccggagg cactttttct tctaattata GCACTTTCAC TCQACGTTTC GGÁGGCCTCC GTGAAAAAGA AGATTAATAT • S $ VK 0 A PGQG LEW 14 31

101 TTTCTTGGGT GCGCCAAGCC CCTGGGCAGG GTCTCGAGTG GMGGGCATT MAGAACCCA CGCGGTTCGG GGACCCGTCC CAGAGCTCAC CTACCCGTAA

CDR2

SPGT GX 11 AYYAQKFQGR '

151 TCTOCTSGTA CCGGXAiTAA TGCTTMTAT GCTCAGAAGT TTCAGGGTCG

AGA5GA.CCAT GACCATAATT ACGAATAMA CGAGTCTTCA AAGTCCCAÜC

- VTITADE 3 7 5 TAY Μ ELS

201 GGTGACCATT ACCGCGGATG AAAGCACCAG CACCGCGTAT ATGGAACTGA CCACXGGTAA TGGCGCÚTAC TTTCGTSG'fÜ G'WSGCGCATA 'fACCtTGACT

Ii R SED TAVYYCARSK

251 GCAGCCTGCG TAGCGAAGXT ACGGCCGTGT ATTATTGCGC GCGTCTTAAG

CSTCGGACGC ATCGCTTCTA T6CCGGCACA TAATAACGCG CGCAAGATTC

CDR3

IfUat- >SL MKr luru «J1V IUM <ΐΑΙ>ν *w IMK1 *f >«1V «/·« 'ν'·

K β MYGS « TYPLMFDLW ' 301 AAGGGTATGT ATGSTGGITG GACITATCC1 CTTATGATG* TTQATCTTTG TTCCCATACA TACCACCAAC CTGAATAGGA GAATACTACA AACTAGAAAC

-GQG? IVTVS 5

351 GGGCCAAGGC ACCCTGGTGA GGGTIAGCTD A

CCCGGTTCCG TGGGACCACT GCCAATCGAG T

TABLE 9 (Continued)

IL-23 pl9 5040^q/ev

<td>VK-HCO (SEQ Π)ΝΟ:136):</td><td>(VK amino acid sequence is 4190^')</td>

ISIVL TQS Ξ Α T

GAGATCGXGC TGACCCAGAG CCCCGCCACC

CTCTAGCACG ACTGGGTCTC GGGGCGGTGG

L $ LSPGE ' CTGAGCCTGA GCCCCGGCC-A 3ACTCGGACT CGGGGCCGCT

CDR1 • RATLSCRASQSVS Ξ N ϊ I.

GCGCGCCACC CTGAGCTGCC GCGCCAGCCA GAGCGTGAGC AGCAACTACC CGÜGCGGTGG GACTCGACGG CGCGGTCGGT CTCGCACTCG TCGTTGATGG * AWYQQKPGQA PRL 1ΤΪ

101 TGGCCTGGTA CCAGCAGAAG CCCGGCC.AGG CCCtXCGCCT GCTGA2CTAC ACCGGACCAT GGtCGTCSÍC GGGCCGGTCC GGGGGGCGGA CGACTAGATG

CDS.2

Ajw »íí ^•vi'-^-VrwíMnfíK

YASRRATGVE ARES GSG *

151 TACGCCAGCC GCCGCGCCAC CGGCGTGCCC GCCCGCTTCA GCSGCAGCGG ATGGGGTCGG CGGCGCGGT6 GDCGCAGGGG CGGGCGAAGT CGCCGTCGCC

SGTDETLTIS SLE PEDE 201 CAGCGGCACC GACTTCACCC TGACCATCAG CAGCCIGGAG CCCGAGGACT GTCGCCGTGG CTGAASTGGG ACTGGTAG'l'C GTCGGACCTC GGGC'íOCTGA

CDR3 • AVYYC 0 Q Ϊ S *í TFFTFG

251 TCGCCGTGTA CTACTGCCAG CAGACCAGCA ACACCGCCII CACCTTCfiGC AGCGGCACAT GATGACGGTC GTCTGGTCGT TGTGGGGGAA GTGGAAGCCG

QGTKVEIA

301 CAGGGCACCA AGGTGGAGAT CAAG

GTCCCGTGGT TCCACCTCTA GTTC

TABLE 9 (Continued)

IL-23 p!9 5040^q/ev

VK-HCO (SEQ ID NO: 137): (VK amino acid sequence is 4190^)

EIVLTQS PAT LSL 3 PGE

GAAATTGTGT TGACACAGTC TCCAGCCACC CTGTCTTTGT CTCCAGGGGA CTTTAACACA ACTGTGTCAG AGGTCGGTGG GACAGAAACA GAGGTCCCCT

CW1 tXi iru rti frf v rrf * ^ΊΎΓ *VA» A» 'ΐ 'Τ .Ύ ** V.·,· *M a· « *u i-* n* « V*. &lt;w A* • RATLSCRA 3 QSVSSNYI,

AASAGCCACC CTCTCCTGCA GGGGCAGTCA GA.GTGTTAGC AGCAACTACT TTCTCGGTGG GAGAGQACGT CCCGGTCAGT CTCACAATCS TCGTTGATGA

AHA» A, Hl

-AWYQQKPGQAFRLIY

101 IAGCCTGGTA CCÁACAGAM CCTGGCCAGG CTCCCAGGCT CCTCATCTAT ATCGGACCAT GGTTGTCTT? GGACCGGTCC GAGGGTCCGA GGAGtAGATA

CDR2

YA 5 R RAT GV ? ARES G 5 G 151 TACGCATCCC GCaGGGCCAC TGGCGTGCCA GCCAGGTTCA GTGGCAGTGG

ATGCGTAGGG CGTCCCGGTG ACCGCACGGT CGGTCCMGT CACCGTCACC

SGTDFTL TXS 3 LEFEDF

201 GTCTGGGACA GACTTCACTC TCACCATCAG CAGCCTAGAG CCTGñA&amp;ATT

CAGACCCTGT CTGMÜTC-AG AGTGGTAGTC GTCGGATCTC GGACTTCTAA

CDR3

A. Α ιΜ ΑΙΑ

- AV ϊ YCQ ϋ TSN TPF TFG

251 TlOCAGT'm TTACTGTCAG CAGACTTCTA ATACTCCTTT TACCTTTGGC

AACGTCAAAT ñATGACAGTC GTCTGAAGAT TATGAGGAAA ATGGAAACOG

QGTKVEIK

3Q1 CAGGGTACGA AAGTTGAíAT ΤΑΆΑ

G7CCCAT-3CT TTCAACTTTA ATTT

TABLE 9 (Continued)

IL-23 pl9 5040^q/ev

VK-HCO ÍSEQ ID NO:138): (the amino acid sequence of. VK is 4190%

Ε IV I> TQSP Ά TLS 1 £ PGE *

GAGATCGTGC TGACCCAGAG CCCGGCGACC CTGAGCCTGT CTCOGGGCGA CTCTAGCACG ACTGGGTCTC GGGCCGCTGG GACTCGGACA GAGGCCCGCT

CDR1' &amp; AT LSCR ASO Ξ VSSNYL

ACGTGCGACC CTGAGCTGCA GAGCGAGCCA GTCTGTTTCT TCTAATTATC TGCACGC'rGG GACTCGACGT CTCGCTCGGT CAGACAMGA AGATTAATAG • AWY 0 CKPG 0 Ά FRLLIY

101 TGGCTTGGTA CCAGCAGAAA CCAGGTCAAG CACCGCGTCT ΑΤΤΑΜΫΪΑΤ ACCGñACCAT G3TCGTGTTT GGTCCA3TTC STGGCGCAGñ ΤΑΤΤΆΑΑΤΑ

CDR2

YAS R. RAÍ GVPARF SG £ G ·

151 TATGCTTCTC GTCGTGCAAC TGGGGTCCCG GCGCGTTTTA GCGGCTCTGG

AIACGAAGAG CAGCACGTTG ACCCCAGGGC CGCSCAAAAT CGCCGAGACC • SGT DFTL TIS Ξ I» E PEDE

201 ATCCGGCACG GATTTTACCC TGACCATTAG CAGCCTGGAA CCYGAAGACT

TAGGCCGTGC CTAAAAT6GG ACTGSTAATC GTCGGACCTT GGACTTCTGA

CDR3 • AVYYCQQT s NT ? FTFG 251 7T3C®3TSTA TTATTGCCAG GAGACTTCTA ATACTCCTTT TACCTTTGGC

AACGCCA.CAT MTAACGGTC GTCTGAAGAT TATGAGGAAA AIGGAAACCG

QG Γ KV Ε IX

301 CAGGGTACGA AAGTTGAAAT ÍAAAA.

GTCCCATGCT T5*CAACTTTA ATTÍ

TABLE 9 (Continued)

IL-23 pl9 3759^eq;qs

VH-GCE (SEQ ID NO:139): (the amino acid sequence of VH is 46491^)

EVQL VQ 5 g AEVKKP &amp; BS X GAGGTGCAGC TG&amp;TGCAGTC TGG&amp;GCAGAG GYGWAAGC CCGGGGWsTC CTCCACGTCG ACCACGTCAG ACCTCG'TCTC CACTTTTTX GGCCCCTCAG

CDR1

- Il XI 3 CKG 3 GY 3 F 5 Ñ YK Γ 51 TCTGAAGATC TCCTSTAAGG GTTCTGGATA CAGCTTTAGC AACTACTGGA AGACTTOTAG AGGACMTCC CAAGACCTAT GüCGAAATCG TTGATGACCT *WV-VV f IfMJVW ' GWV &amp; Q Μ PGXSB 3 íi M 3 I

101 TCGGCIGGGT GCGCCAGATG CXGGGaAAG GCCTGGAGTG GATGGGGATC AGCCGACCCA CGCGGTCTAC GSGCCCTTTC CGGACCTCAC CTACCCCTAG

CDR2

IDP 3 1Ϊ S ϊ TR Ϊ SPSF 2 GQ ·

151 ATCGACCCTA' GCAMOTTA CACCAGATAC AGCCCGTGCT ICCSAfiGCCA

TAGCIGGGAT CGTTGAGAAT GTQGTCTATG TCGGGCAGGA AGGTTCCGGT ν T Ϊ 8 A &amp; S SIS TAI s QWS 201 GGTCACCATC TCAGCCGACA A&amp;TCCATCAG CACCGCCTAC CTGOAG-GGA

CCAGTGSTAG AGTCGGCTGT ICAGGTAGTC GTGGCGGATG GACGTCACCT * SL KAS &amp; TA » YYCA SL Η Ϊ

251 GCAGCCTGAA GGCCSCGGAC AXGCCAlGT ATTACTGTGC GAGATGGTAC

CGECGGACT2 CCGGAGCCTG IXXGTACA EAATGACACG CTCTACCATG

<img file="ECSP088591A_D0003.tif" />

ϊ KPF Ώ VWGQGT L. V ϊ VSS TACñAGCCCr TCGACGTGTG GGGCCAGGGC ACCCTGGFGA CCGTGAGCAG

ATGTTCGGGA AGCTGCACAC CCCGGFCCCG ÍGGGACCACT GGCACTCGTC r' kü

TABLE 9 (Continued)

IL-23 pl9 3759^eq;qs

VH-HCO (SEQ ID NO: 140): (the amino acid sequence of VH is 4649Y)

EVGL VQSGAE VKKP GES *

GAGGTGCAGC TGGTGCAGAG CGGCGCCGAG GIGAAGAAGC CCGGCGAGAG CTCCACGTCG ACCACGTCTC GGCGCGGGTC CACTTCTTCG GGCCGCÍCTC cmi 'LKI SC K. GSG Ϊ SES Ν ϊ 5Ϊ I '

CCTGAAGAIC AGCTGCMGG GCMCGGCTA CAGCTTCASC AACTACTGGA GGACTTCTAG TCGACGTTCC CGTCGCCGAT GTCGAAGTCG XTGATGACC• GWVRQM PGKG LEW UBI λ 01 TCGGCTGGGT GCGCCAGATG CCCGGCAAGG GCCTGGAGTG GMSGGCATC AGCCGACCCA CGGCGCCGCTACG

CDR2 w w+w rwn» iW * ** η **V

JDI? S » s YTKYSP 8 FQGQ '

<img file="ECSP088591A_D0004.tif" />

<img file="ECSP088591A_D0005.tif" />

MCGACCCCA GCAACAC-CTA CACCCGCTAC AGCCCCAGCT TCCAGGGCCA TAGCTGGGGT CGTTG^CGAT GTGGCCGATG TCGGGGTCGA AGGICCCGGr

- VSX SAÜS SIS

GGTGACCATC AGCGCCGACA AGAGCATCAG

CCACTGGTAG TCGCGGCTGT TC?CG'J:AG'K

T AY L Q ÍJ S CACCGCCl'AC CTGCAGTGGA

GTGGCGñATGGACGTSACCT

- S 1 ,K ASO TA Μ YYCARWY

2S1 GQAGCCTGSA GGCCAGCGAC ACOGCCMGT ACTACT6CGC CCGCTG3TAC

CG-TCGGACTT CCGí^CGC^S TGÚCGGWA TGATGACGCG GGCGACCATG

CDR3

XK ,PF ti VWGQGTI ν ϊ VSS TACMGCCCT TCGACGTGTG GGGCCAGGGC ACXCTGGTGA CCGTGA.GCAG ATGTTCGGGA AGCTGCACAC CÜCGGrCCCG TGGGACCJCT GGCACTCGTC

301

TABLE 9 (Continued)

IL-23 pl9 3759^eq;qs

VH-MOR (SEQ ID NO: 141): (the amino acid sequence of VH is 4649r¹;

EVQLVQSGAE gaggtgcaat tggttcagag cggcgcggaa crAXACGTTA accaagtctc ccccccccn

VK£P

G7GAAAMAC i

CACTTITTTG (¹ GES '

CGGGCGAAAG

GCCCGCTTTTC

LKI

CCTG3UAATT

GGACTTITAA : SGY

GTTCCSGATA

CAAGGCCTAI

SCKG

AGCTGCAAAG

XCGACGTTTC '

CDRL

H* ÍM-4W i%i rv -M toA nynr AATTATTGGA $ FS ?τ&lt;χτιίτ?τ aaggaaaaga ttaataacc?

&lt;V-?W-V

- G Ti V

TTGGZTGGGT

MCCAACCCA

HQM

GCG C CAGATG CGCGGTCTAC

CÜR2 íy-V »A»|>VH»x rV **# +Η >X> '«ibi

IDPS

ATCGATCCGT I ÍAGCTAfífíCA. 1 ? GKGCCEGGGAAGG^:GGACCCTTCC ;

! LEW gtctcgagtg cagagctcac

H 6 I gmgggcatt CTACXCGTAA

- VT 1 GGTGACCAl'r CGACU'GGTAA ; xs γ τ ry

CTAATASCTA TACCCGCTAT GATTATCGAT ATGGGÍJGATA

S Ά D

TCGCGCCJAT

KSIS

AAAGCATTAG

TOCGTAATC

PS } 0 GQ '

TECAGGGCCA AAGTCCCGGT

SF to ; TCTCCGAGCTAGAGGCTCGA

TAY

CACCGCGTAT

GTGGCGTASTING

LQWS'

CTTCMTGGA

GAAGTTACCT' SLK

GCASCCTGAA CGTCGGACTT

ASO

ACCGAGCS-AY

TCGGTCGCTA : YCA

ATTATTGCGC

TAATAACGCG

TAKΪ

ACGGCCMGT .

TGCCGGTACA dVmAJiVAifU rwy

GCGTTGGTAT

CGCAACCATA cdr3

30’

Al Ar faJ- -Μ Al ΛΤ-Ά1 |V

YKPFDVW

TMAAGCCTTTTGATGTTTG

ATATTCGGAA AACTACAAAC

GQG

GGGCCMGGC

CCCGGtTCCG 'Γ LVTVS Ξ accctggtga CGGTTAGCTC tgggaccact gccaatggag

351 TO

you

TABLE 9 (Continued)

IL-23 pl9 3759^eq;qs

VL-CtCE (SEQ ID NO: 142): (the amino acid sequence of .VL is 5059®)

QSVL r OP PSV SGAPGQR * CA-STC2G2GG TGACGC2M3CC GCCTCCñGTG TCTGGGGCCC CAGGGCASAG GTCAGACACG ACTGGGTCGG CGGGAGTCAC A5ACCCCGGG GTCCCGTCTC!

CDR1 ν τ iac ? g be nig sgyd

GGTCACCATC TCCfGCACTG GGAGCAGCTC CAACATCGGG AGCGGTTATG ccagtsgtag aggacgtgac CCTCGTCGAG GTTGIAGCCC TCGCCAATAC tííwfYes^^ w iyjw

VHW Ϊ Q c Ii PGTAPKLLI

101 MGTAOACTG GTACCAGCAG CTTCCAGGAA CAGCCCCCM ACTCCTCATG TACATGTGAC CATGGTCG1C GAAGGTCCTT GTCGGGGGYl TGAGGAGTAG

CDR2 vkrMMr rtl'»tV

YGKSKRP s GV PDRF SGS * 151 TATGGfAACA gcaagcggcc ctcaggggtc cctgaccgat tctctggcic asmattgt cgttcgccgg gagtccccag GGACTGGCTA agagaccgag

K s G- ESAS LA 1 TG L QSED 2Ú1 CAAGTCTGGC ACCECAGCCT CCCTGGCCAT CACTGGGCTC CAGAGCGAGG

GTTOAGACCG TGGAGTCGGA GGGACCGQTA GTGACCOGAG GTCTCGCTCC

CPR3 • SADYYCA 8 WT Ώ GLS b V

251 ATGñQÜCTGA miTACI-GC GCCAGCT5GA CCGACGGCCT GAGCCTGGTG fACTCCGACT AATAMGAC&amp; CGGTCGACCT GGCTGCCGGA CTCGGACCAC

VFGGGTKL Τ VLG

301 GTGTTCGGCG GCGGCACCAA GCTGACCGTG t^GGGC

CACAAGCCGC CGCCGTGGTT CGACEGGCAC SACCCG

TABLE 9 (Continued)

IL-23 pl9 3759^eq;qs

VL-HCO (SEQ ID NO: 143): (the amino acid sequence of VL is 5059^QS)

<img file="ECSP088591A_D0006.tif" />

QSVLTQP PSV SSAP GQR '

TGACCCASCC CCOCAGCGtG AGCGGCGCCC QCGGCCAGCG =?:r.^GCACG aCTGGGSOGG GGGGTCGCAC TCGCCGCSGG GGCCSGTCGC

C0R1 'VTI S£T0- sss NIG $ GYD ·

CGTGACCATC AGCIGCACCG GCAGCAGCAG CMCATCGGC AGCGGCÜACG

GCACTGGTAG 2CGACSTGGC CGTCGGCGTC GTTGTAGCCG TCGCCGÁfGC ' VHJ? YQ 0 &amp; p GIAPK til

3.Ü1 ACGTGCiCTG STACCAGCAG CTGCCCGGCA CCGCCCCCto GCTGCTGATC

TGCACGTGAC CATGGrCGTC GAC5GGCCGT GQCGGGGGTT CGACGACTAG

CDR2 and 6 jt$ir rpsgvpdrf sgs1.51

TACSGCJÜVCA GCAAGCGCCC CAGCGGCGTG CCCGACCGCT TCAGCGGCAG ATGCCGTTGT CGTTC0CGGG STC3CCGCAC GGGCTGGCGA AGTCGCCGTC

- KSGT s A s 1 A ϊ TGLQSE ü 501 CAAíjMCGSC ACCAGCGCCA Gm'GGCCAT CACCGGCCTC CAGAGCGAGG

GTTCTCGCCG TGGTCGCGGT CGGACCGGTA GTGGCC3GAG GTTCOTCC

CDti.3

Λ_,Λ..r_v λ„. &lt;μ rrw rvm 'γ .β» .w.

fí A i> ACGAGGCCGA TGCYCCCíGCT

YYC

CTACTACTG?

GATGMGACA

GCCAGCTGGA

CGGTCGACCT 'SGI»

CCGACGGCC?

GGCTGCCGGA

SLV GAGCCTGOTG CTCGGACCAC

VFGG CJ TKLTVLQ

301 GTGTTCGGCG GCGGCACCAA GCTGACCS2G CTGGGC

CACAASCCGC CGCCGTGGTT CGACTGGCAC GACCCG

TABLE 9 (Continued)

IL-23 pl9 3759^eq;qs

VL-MOR (SEQ ID NO: 144): (the amino acid sequence of .VL is 5059^Λ)

QSV 1 TQP rsv

SGA 1? GQA *

C&amp;GÜGCGTGC TGACCCAGCC GCCTTCAGTG AGTGGCGCAC CAGGrCAGCG GSCSCGCACG ACTSGGTCGG CSGAAGTCAC TCACCGCGTG GTCCAGTCGC

CDR1 ·», 'V *«»»« e· Ai* “V * *»·*

VTI SCTG SS 3 Ν I β SGXD

TGTGñCCATC TCGTGTACGG GCAGCAGCAG CAACATTGGT TCIGGTTATG ACACTGSTAG AGCACATGCC CGTCGfCGTC GÍTGTAACCA AGACCAATAC • V Η β YQ Ώ KPGTA ? KLDX

101 ATGTGCASTG GTACCAGCAG TTGCCCGGGA CGGCGCCGAA ACTTCIGATT TACACC2AAC CATGGTCGEC MCGGGCCCI GCCGCGGCTT TGAAGACTAA

Cl&amp;2

YGSKRP 3 GVPDRFSGS *

131 TATGGTAATT CTAAGCGTCC CTCAGGCGTG CCGGATCGTT TTAGCGGATC ATACOTTM GATTCGCAGG GAGTCCGCAC GGCCTAGCAA AATCGCCEAG • K 8 GTSASLAI TC-L QSED ·

CAAAAGCGGC ACCAGCGCGA GCOTTGCGAT TACGGGCCTG CAAAGCGAAG GTmCGCCG TGGIOGCGCT CGGAACGCTA MGCCCGGÁC GTTTOGCTTC

CDS.3

TXlrS- *1» rw .“i*. no_r 1^. «Ji jwi -yV —1* Ifl rW -*»¹ *ΐ'ιΐ' *BTW r41T ^Uirbji 1Ί0 W

EAD Ϊ YCAS Wf TDG Ii SIV

251 ACGAAGCGGA TTATWTGC GCITOTGGA CTSJVPGSTCT TTCTCTTGK' TGC2TCGCCT AAEAATAACG CGAAG&amp;ACCT GACTACCA6A AAGAGAACAA

VFGGGTKLTVLS

02 GTGTTÍGGCG GGGG&amp;1CGM GTWICCGTT CTTGG3

CAOAMCCGC CGCCGSGCTT GAATTGGCAA GAACCG

TABLE 10

SEQ ID NO:145 (human IL-23p19 subunit)

<td>met 1</td><td colspan="2">Leu Gly</td><td>Be</td><td>arg c</td><td>To the</td><td>Val</td><td>met</td><td colspan="2">leu leu 10</td><td>read</td><td>read</td><td colspan="3">Leu Pro Trp fifteen</td><td>Thr</td>

<td>To the</td><td>gln</td><td>Yes, and</td><td>arg</td><td>To the</td><td>Val</td><td>Pro</td><td>gly</td><td>gly</td><td>Be</td><td>Be</td><td>Pro</td><td>TLutl</td><td>trp</td><td>ihr</td><td>gln</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Cys</td><td>gln</td><td>gln</td><td>read</td><td>Be</td><td>gln</td><td>Lys</td><td>leu.</td><td>Cys</td><td>ihr</td><td>read</td><td colspan="2">Trp Wing</td><td>Be</td><td>To the</td><td>Bis</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Pro</td><td>read</td><td>Val</td><td>gly</td><td>hey</td><td>met</td><td>Asp</td><td>read</td><td>arg</td><td>glu</td><td>glu</td><td colspan="2">Gly Asp</td><td>glu</td><td>glu</td><td>Thr</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Thr</td><td>asn</td><td>Asp</td><td>Val</td><td>Pro</td><td>his</td><td>lies</td><td>gln</td><td>Cys</td><td>gly</td><td>Asp</td><td>gly</td><td>Cys</td><td>Asp</td><td>Pro</td><td>gln</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>gly</td><td>read</td><td colspan="2">Arg Asp</td><td>aan</td><td>Be</td><td>gln</td><td>Phe</td><td>cys</td><td>read</td><td>gln</td><td>arg</td><td>IL®</td><td>his</td><td>gln</td><td>gly</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td><td></td><td></td><td> 55</td><td></td>

<td>read</td><td>i.le</td><td>Ph®</td><td>íyr</td><td>glu</td><td>Lys</td><td>read</td><td>read</td><td>gly</td><td>Be</td><td>Asp</td><td>lies</td><td>Ph®</td><td>Thr</td><td>gly</td><td>glu</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td>pro</td><td>Be</td><td>read</td><td>read</td><td>?ro</td><td>ASp</td><td>Be</td><td>Pro</td><td>Val</td><td>To the</td><td>gln</td><td>read</td><td>his</td><td>To the</td><td>Be</td><td>read</td>

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td>12C</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

<td>read</td><td>gly</td><td>read</td><td>Be</td><td>gln</td><td>read</td><td>read</td><td>gln</td><td>Pro</td><td>glu</td><td>ciy</td><td>his</td><td>his</td><td>trp</td><td>glu</td><td>Thr</td>

<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>

<td>gln</td><td>Gl.r.</td><td>lies</td><td>Pro</td><td>Be</td><td>read</td><td>Be</td><td>Pro</td><td>Be</td><td>gj.il</td><td>Pro</td><td>lrp</td><td>gln</td><td>arg</td><td>read</td><td>read</td>

<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td>16C</td>

<td>read</td><td>are</td><td>Ph®</td><td>Ly$</td><td>lies</td><td>read</td><td>arg</td><td>be</td><td>read</td><td>gln</td><td>To the</td><td>phe</td><td>Val</td><td>Going</td><td>Val</td><td>To the</td>

165 170 .175

Ala Are Val Phe Ala His Gly Ala Ala Thr Leu Ser Pro

180 185

TABLE 11

<td>Treatment</td><td>Epidermal thickness (pm) Mean ±SEM</td><td>Ki-67 (1) Half ±SEM</td><td>HLA-DR (1), Mean ±SEM</td><td>CK-16. Cumulative score and incidence (2)</td><td>Body weight at end point (% of initial weight) ±SEM</td>

<td>Vehicle</td><td> 176.8 ±28.1</td><td> 29.7 + 8.0</td><td> 14.9 + 7.1</td><td> 6 (4/7)</td><td> 109.9 + 0.7</td>

<td>CsA (20</td><td> 105.5 ± 11.3^$</td><td> 15.6 ±4.3^$</td><td> 9.6 ±4.6</td><td> 3 (2/7)</td><td> 105.9 ±2.1</td>

<td>mg/kg)</td><td></td><td></td><td></td><td></td><td></td>

<td>Antibody</td><td> 120.0 ± 17.4*</td><td> 12.3 ±3.7*</td><td> 7.9 + 4.9</td><td> 3 (2/6)</td><td> 112.3 ±1.0</td>

anti-IL23pl9 (10 mg/kg)

Number of positive cells per mm² of epidermis.

Histology scoring system according to Jongh et al, J. Invest Dermatol 125: 11631173,2005

epidermal thickness:

ANOVA P = 0.010

Post hoc LSD tests:

$p = 0.003 compared to vehicle * p = 0.001 compared to vehicle ** p = 0.025 compared to vehicle # p &lt; 0.001 compared to vehicle ## p = 0.063 compared to vehicle &amp;p = 0.020 compared to the Ki-67 vehicle:

ANOVA P = 0.009

Post hoc LSD tests:

$p = 0.027 compared to vehicle * p = 0.008 compared to vehicle ** p = 0.048 compared to vehicle # p = 0.007 compared to vehicle ## p = 0.031 compared to vehicle &amp;p = 0.010 compared to vehicle

HLA-DR:

ANOVA P = 0.768

CK-16:

ANOVA P=0.573

Body weight:

ANOVA P=0.691

It will be apparent that the invention can be practiced in other manner than that particularly described in the above description and examples. Many modifications and variations of the present invention are possible in light of the above teachings and are therefore within the scope of the appended claims.