Pharmaceutical composition with a continuous liberation physiologically active component being stable in acid medium
20 claims: 3 independent, 17 dependent
- 1Farmaceutická kompozice s kontinuálním uvolňováním v kyselém prostředí stabilní fysiologicky účinné látky z materiálu kompozice do vodného prostředí fysiologického typu, vyznačená tím, že uvedenou fysiologicky účinnou látkou je polypeptid kovalentně kon^ugovaný s ve vodě rozpustným polymerem, přičemž tato fysilogicky účinná látka není významně hydrolyzována za podmínek, vyskytujících se v kompozici během periody použití kompozice, a je-li kompozice umístěna do vodného prostředí fysiologického typu, potom uvolňuje polypeptid do vodného prostředí fysiologického typu kontinuálním způsobem, přičemž toto v uvolňování má v podstatě monofázový profil v průběhu alespon jednoho týdne a k uvolňování polypeptidů dochází ve dvou následných fázích, kde v první fázi dochází k uvolňování difúzí z povrchu a v druhé fázi dochází k uvolňování v důsledku degradace materiálu kompozice, přičemž difuzní fáze a degradací indukovaná fáze se časově překrývají a v v k uvolňování polypeptidů dochází v průběhu alespoň jednoho týdne nebo kompozice absorbuje vodu kontinuálním způsobem a její absorpční profil je v podstatě monofázový, až do okamžiku, kdy došlo k degradaci materiálu kompozice a kdy byl v podstatě veškerý polypeptid uvolněn do vodného prostředí fysiologického typu v průběhu alespoň jednoho týdne.
- 2Farmaceutická kompozice podle nároku 1, vyznačená tím, že jedna molekula fysiologicky účinná látky obsahuje alespoň jednu molekulu ve vodě rozpustného polymeru na 3003 - 8030 Da molekulovou hmotnost polypeptidu.
- 33· Farmaceutická kompozice podle nároku 1 nebo 2, v yznačená tím, že polypeptid má alespoň jednu z • /.fo - 210 biologických vlastní přírodně se vyskytujícího G-CSF.
- 4Farmaceutická kompozice podle nároku 3, vyznačená t í m, že polypeptid je derivátem přírodně se vyskytujícího G-CSF, který má alespoň jednu z biologických vlastností přírodně se vyskytujícího G-CSF a stabilitu v roztoku alespoň 35% při 5 mg/ml, přičemž tento derivát w 17 17 má alespoň Cys nativní sekvence nahrazen zbytkem Ser 27 27 a Asp nativní sekvence nahrazen zbytkem Ser .
- 55· Farmaceutická kompozice podle nároku 4, vyznačená tím, že polypeptid obsahuje alespoň jednu další modifikaci zvolenou ze skupiny zahrnující:a/ Glu 11 nativní b/ Leu y nativní 2 7 c/ Lys J nativní d/ Gly 28 nativní e/ Gly 28 nativní f/ Ala 30 nativní Arg 30 , g/ Lys 34 nativní h/ Lys 40 nativní i/ Pro 44 nativní j/ Leu nativní k/ Gly 51 nativní 1/ Gly 55 nativní m/ Trp 5 ® nativní n/ Pro 80 nativní 0/ Pro 85 nativní p/ Pro 111 nativní q/ Thr 115 nativní r/ Thr 118 nativní s/ Tyr 185 nativní sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence sekvence je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen je nahrazen zbytkem Arg zbytkem Glu zbytkem Arg' zbytkem Ala zbytkem Ala 1 1 15 23 26 28 30 zbytkem Lys J nebo zbytkem zbytkem zbytkem zbytkem zbytkem zbytkem zbytkem zbytkem zbytkem zbytkem zbytkem zbytkem zbytkem Arg Arg Ala Lys Ala Ala Lys Ser Ser Glu Ser Ser Arg 44 49 51 55 58 63 65 1 1 1 115 1 16 165
- 6Farmaceutická kompozice podle nároku 4 nebo 5, vyznačená tím, že polypeptid je zvolen ze skupiny - 211 zahrnující:i/ /“Arg 11 ,Ser 17,27 ’ 60,65 7 lidský G-CSF, ii/ /“Glu 15 ,Ser 17 ’ 27 ,Ala 28 * 28 ,Lys 3 £7lidský G-CSF, iii/zfArg 11 ,Glu 15 ,Ser 17 ’ 27 ’ 60 ’ 85 ,Ala 28 ’ 28 ,Lys 3 £7lidský G-CSF iv/ /“Arg 11,40 ,Ser l7,27,80,85 7lidský G-CSF, v/ /“Arg 11 ’ 23 ,Ser 17,27,60 ’ 8 £7lidský G-CSF, vi/ /~~Arg 1 1 ’ 1 85 ,Glu 1 5 ,Ser 17 ’ 27 ’ 80 ’ 85 ,Ala 28 ’ 28 ,Lys 3 ° ’ 58 7lidský G-CSF, vii//7Arg 1 '1Glu ,5 ,,l )Ser’ 7 - 27 - 60 6 5-”5.'’6 )Ala 26,28 jLys 30 7 lidský G-CSF, viii/ /“Glu 15 ,Ser 17,27 ,Ala 28,28 ,Arg 3 27lidský G-CSF, ix/ /Ala 1 ,Thr 3 ,Tyr 4 ,Arg 5,11 ,Ser 17,27,80,85 7lidský G-CSF, x/ /“Ser 17 ’ 27,80,8 £7lidský G-CSF, xi/ /“Arg 11 ,Ser 17,27,6 27lidský G-CSF a xii//~Ser 17,27,85 _7lidský G-CSF.
- 7Farmaceutická kompozice podle nároku 1 nebo 2, vyzná č e n é t í m, že polypeptid je zvolen ze skupiny zahrnující G-CSF, lidský calcitonin, interleukin-2, interferon a lidský růstový hormon.
- 8Farmaceutická kompozice podle některého z předcházejících nároků, vyznačená tím, že ve vodě rozpustný polymer je zvolen ze skupiny zahrnující polyethylenglykolový nebo polypropylenglykolový homopolymer, polyoxy212 ethylovaný polyol nebo polyvinylalkohol, přičemž uvedený homopolymer je nesubstituovaný nebo substituovaný na jednom konci alkylovou skupinou.
- 9Farmaceutické kompozice podle nároku 7, vyznačená t í m , že ve vodě rozpustný polymer je zvolen ze skupiny zahrnující nesubstituovaný polyethylenglykol, monomethylpolyethylenglykol a polyoxyethylovaný glycerol.
- 10Farmaceutická kompozice podle nároku 8 nebo 9, v yznačená tím, že ve vodě rozpustný polymer má molekulovou hmotnost 1000 až 15300.
- 11Farmaceutická kompozice podle některého z nároků 1 až 6 a 8 až 10, vyznačená tím, že fysiologicky účinnou látkou je /Arg 11 , Ser 17 ’ 27 60,65-7 lidský G-CSF s methioninovou presekvenci nebo bez této presekvence, konjugovaný s monomethylpolyethylenglykolem, přičemž monomethylpolyethylenglykol má molekulovou hmotnost 2000 až 5000.
- 12Způsob přípravy farmaceutické kompozice podle některého z předcházejících nároků, vyznačený tím, že se materiál kompozice a fysiologicky účinná látka rozpustí v organickém rozpouštědle nebo jednotně disperguje v organickém nebo vodném médiu, načež se získaný roztok-—jjjgrgov nebo disperze vysuší a formulují do lékové formy, kťek-zaTVNλΛ 3hd rá je vhodná pro implantaci do těla živočicha. I gv A2 Ί l 6 ΙΙΙΛ 6 l OS.o α
- 1313· Způsob přípravy farmaceutické kompozice podle ně·· kterého z nároků 1 až 11, ve které materiálem kompozice je polylaktid, vyznačený tím, že se fysiolcgicky účinná látka inkorporuje do matrice obsahující poljyv laktid, který obsahuje alespoň 25 % molárních jednotek kyseliny mléčné a nejvýše 75 % molárních jednotek kyseliny glykolové, přičemž se fysiologicky účinná látka a materiál- kompozice jednotně promisí tavným zpracováním intimní pevné směsi fysiologický účinné látky a materiálu kompozice . - 213
- 1414·. Použití fysiologický účinné látky, která obsahuje polypeptid kovalentně konjugovaný s ve vodě rozpustným polymerem, při přípravě farmaceutické kompozice podle některého z nároků 1 až 11.
- 1515· Způsob léčení poruch krvetvorby u savců, vyznačený tím, že zahrnuje podání farmaceutické kompozice podle některého z nároků 1 až 11 savců, čímž se poskytne účinné množství polypeptidu konjugovaného s ve vodě rozpustným polymerem, přičemž uvedený polypeptid má v alespoň jednu z biologických vlastností přirozeně se vyskytujícího G-CSF.
- 16Způsob zastavení proliferace leukemických buněk u savců, vyznačen tím, že se savcům podá farmaceutická kompozice podle některého z nároků 1 až 11, čímž se poskytne účinné množství polypeptidu konjugovaného s ve vodě rozpustným polymerem, přičemž uvedený polypeptid má alespoň jednu z biologických vlastností přirozeně se vyskytujícího G-CSF.
- 17Způsob léčení osteoporosy nebo Pagetovy nemoci u člověka trpícího těmito onemocněními, vyznačený t í m, že zahrnuje podání farmaceutické kompozice podle některého z nároků 1 až 11, čímž se poskytne účinné množství lidského calcitoninu konjugovaného s ve vodě rozpustným polymerem.
- 18Způsob léčení nádorů nebo nedostatečnosti imunitního systému u savců, vyznačený tím, že se savcům podá farmaceutická kompozice podle některého z nároků 1 až 11, čímž se poskytne účinné množství interleukinu 2 konjugovaného s ve vodě rozpustným polymerem. 214
- 19Způsob léčení nádorů nebo virové infekce u savců, vyznačený tím, že se savcům podá farmaceutická kompozice podle některého z nároků 1 až 11, čímž se poskytne účinné množství interferonu konjugovaného s ve vodě rozpustným polymerem.
- 20Způsob stimulace růstu u lidí, vyznačený tím, že se lidem podá farmaceutická kompozice podle některého z nároků 1 až 11, čímž se poskytne účinné množství lidského růstového hormonu konjugovaného s ve vodě rozpustným polymerem.
Independent claims20
1,915 paragraphs in 98 sections, as filed
Sustained release pharmaceutical compositions of a physiologically active substance
Technical field
The invention relates to pharmaceutical compositions of physiologically active polypeptides which provide for the sustained release of polypeptides over a longer period of time when the pharmaceutical compositions are placed in an aqueous physiological type environment (as defined below).
Background Art? /
It has long been known that the sustained release of certain physiologically active substances over a prolonged period of time after a single administration of a corresponding pharmaceutical composition constitutes a significant practical advantage in clinical practice and that pharmaceutical compositions have been prepared which release long-term range of clinically useful drugs after oral administration. see, for example, Remington's Pharmaceutical Sciences, Lack Publishing Company, Saston, Pennsylvania, USA, 15th Edition, 1975, pp.1618-1631], after parenteral administration (ibid., pp. 1631-1643) and after topical administration (see, for example, GB 1 351 409). A suitable method of parenteral administration is by subdermal injection or implantation of a solid body, for example a pill or foil containing the drug, a large number of such implantable devices have already been described in the literature.
In particular, it is known that a suitable implantable device or injectable suspension of microparticles with long-term release of a physiologically active agent can be obtained by encapsulating the drug in a biodegradable polymer or dispersing the drug in a polymer matrix such that sustained release biological degradation of the polymer matrix used.
Suitable biodegradable polymers for polymers
<img file="CS9102285A3_D0001.tif" />
The use in sustained release pharmaceutical formulations of a physiologically active substance is known and includes polyesters which, when placed in an aqueous medium of physiological type, are progressively degradable by hydrolysis. A particular class of such polyesters used for this purpose are polyesters derived from hydroxycarboxylic acids, and many of the polyesters so far used relate to polymers derived from alpha-hydroxycarboxylic acids, in particular lactic acid in both racemic and optically active form, and from acid glycolic, and their copolymers are also contemplated; see, for example, U.S. Patents 3,773,919 and 3,887,699; Jackanicz et al., Contraception, 1973, 8, 227-234; Anderson et al., Ibid., 1976, 11, 375-384; Wise et al., Life Sciences, 1976, 19, 867-874; Woodland et al., Journal of Medicinal Chemistry, 1973, 16, 897-901; Yolles et al., Bulletin of the Parenteral Drug Association, 1976, 30, 306-312; Vise et al., Journal of Pharmacy and Pharmacology, 1978, 30, 686-689 and 1979, 31, 201-204.
It should be noted that sustained or prolonged drug release may be either continuous or discontinuous. For example, the release of a polypeptide from the polylactide polymer described in GB 1 325 209 is often preceded by a significant induction period during which no polypeptide is released, or such release of the polypeptide is biphasic and includes an initial period during which a certain amount is released.
a second period during which little or no amount of polypeptide is released, and finally a third period during which a substantial portion of the remaining amount of polypeptide is released. In contrast to this type of polypeptide release, the present invention provides a pharmaceutical composition of the polypeptide from which, apart from a relatively short initial induction period, the polypeptide is released continuously and during this continuous polypeptide release there is no time period during which only a small amount or
no amount of polypeptide at all. Thus, the term continuous release only defines a release profile of a physiologically active substance that is substantially monophasic, although it may have an inflection point, but by no means has a plateau phase in a graph in which the cumulative release of the active substance is plotted as a function of on time.
European Patent 58,481 describes sustained release pharmaceutical compositions that provide substantially monophasic release of stable polypeptides. These pharmaceutical compositions generally comprise a polylactide which is a polymer of lactic acid itself, a lactic acid-glycolic acid copolymer, a mixture of such polymers, a mixture of such copolymers or a mixture of such polymers and copolymers and an acid stable (as hereinafter defined) hydrolyzed under conditions in which the pharmaceutical composition will be found during its intended use period; if the composition is placed in an aqueous physiological type environment (as defined below), it releases said polypeptide into said physiological type aqueous medium continuously in a release profile of a polypeptide that is substantially monophasic, although it may have an inflection point but it has no platform phase in any case for at least one week.
As mentioned in said European Patent 58,481, said formulation relates to polypeptides that are stable under the conditions applicable to the claimed formulation. However, some polypeotides, such as native / years<sup>1</sup> Human G-CSFs are inherently unstable under such conditions and experience a number of problems stemming from this instability, including but not limited to aggregation tendencies.
The invention is based on the discovery that conjugation with a water-soluble polymer can eliminate or at least reduce the instability problems of some polypeptides that would otherwise not be stable under the stated conditions and would therefore not be adequately released.
The invention is also based on the discovery that the use of a physiologically active slaughter wherein the physiologically active polypeptide is covalently conjugated to a water-soluble polymer improves the release profile of the polypeptide as compared to the corresponding unconjugated polypeptide in sustained release pharmaceutical compositions.
Recently, MS Hora et al. published in Proceed. Intern Symp. Control. Rel. Bioact. Mater. 16, (1989). 268 'on pages 509-510 to prepare an interleukin-2 controlled release microsphere formulation. MS Hora et al. demonstrate that a three-phase release profile is achieved when pegylated interleukin-2 (IL-2) is covalently conjugated to polyethylene glycol (PPG), hereinafter referred to as PEG IL-2; the term pegylated is used herein to abbreviate polyethylene glycol (in the presence of fetal calf serum releases from poly (LL-lactido-co-glycolide) microspheres, and that in this case there is a 5-15 day delay representing the aforementioned induction period. MS Hora et al. attempts to overcome these problems by attempts to improve the wetting and resolubilization of PEG IL-2 using human serum albumin (HSA-human serum albumin).
However, these experiments lead to another problem, which is the presence of a solubilizing protein. The presence of such a protein in a pharmaceutical formulation is disadvantageous, inter alia, because it increases the risk of an adverse side reaction and compromises analytical accuracy.
In addition, the dissolution characteristics of said poly (DL-lactido-co-glycolide) polymer (especially if it is soluble or insoluble in benzene) or polydispersity (as defined below) are not defined in the above publication (MS Hora et al.) . Without this data and without a description of the preparative method, this work cannot be reproduced and the contents of the publication are thus unusable. It should further be noted that neither the molecular weight of polyethylene glycol (PEG) nor the degree of pegylation is defined in this publication, both of which are necessary if the content of the publication should be reproduced.
In view of the poor sustained release results obtained by VSHore et al. With pegylated IL-2, it appears particularly surprising that, in accordance with the invention, such a favorable drug release profile can be achieved using physiologically active polypeptides covalently conjugated to a water-soluble polymer.
SUMMARY OF THE INVENTION
The subject of the invention is a pharmaceutical composition continuously releasing an acid-stable (as defined below) physiologically active substance from the material of the composition to an aqueous physiological type (as hereinafter defined), characterized in that said acid-stable stable physiologically active substance the substance is a polypeptide covalently conjugated to a water-soluble polymer, wherein said substance is not substantially hydrolyzed under conditions of the composition during the period of intended use and composition
1) when placed in an aqueous physiological type environment, the polypeptide releases into said aqueous physiological type environment in a continuous manner with a substantially mono-phase polypeptide release profile (as defined below) for at least one week;
2) carries out two successive phases of polypeptide release, the first phase comprising the release of the polypeptide by diffusion from the surface and the second phase of the release in the
comprising releasing the polypeptide following degradation of the composition material, wherein said diffusion phase and said degradation-induced phase in the
overlap and release the polypeptide over a period of at least one week;
or
3) absorbs water in a continuous manner with a substantially mono-phase water absorption profile until the composition material has been degraded and substantially all of the polypeptide has been released into the physiological-type aqueous environment over a period of at least one week .
The present invention also provides a method of treating a hematopoietic disorder in a mammal comprising administering to the mammal a pharmaceutical composition of the invention, thereby providing an effective amount of a water-soluble polymer-conjugated polypeptide, wherein said polypeptide has at least one biological property naturally occurring. occurring G-CSF.
The invention also provides a method of arresting leukemia cell proliferation in a mammal comprising administering to the mammal a pharmaceutical composition of the invention, thereby providing an effective amount of a water-soluble polymer conjugated polypeptide, said polypeptide having at least one of the biological properties naturally occurring G-CSF.
The present invention also provides a method of treating osteoporosis or Paget's disease in a human suffering from such diseases comprising administering a pharmaceutical composition of the invention, thereby providing an effective amount of human calcitonin conjugated to a water-soluble polymer.
The present invention also provides a method of treating tumors or immunodeficiency in a mammal in which:
The method comprises administering to a mammal a pharmaceutical composition of the invention, thereby providing an effective amount of interleukin-2 conjugated to a water-soluble polymer.
The present invention also provides a method of treating tumors or viral infection in a mammal comprising administering to the mammal a pharmaceutical composition of the invention, thereby providing an effective amount of interferon / preferably interferon alpha, particularly interferon alpha<sub>2</sub>% conjugated to a water-soluble polymer.
The present invention also provides a method of stimulating growth in humans, comprising administering to a human a pharmaceutical composition of the invention, thereby providing an effective amount of human growth hormone conjugated to a water-soluble polymer.
The present invention also provides a process for the preparation of a pharmaceutical composition according to the invention, characterized in that the composition material and the physiologically active substance are dissolved in an organic solvent dissolving the substances or the composition material and the physiologically active substance are uniformly dispersed in an organic or aqueous medium. said mixture is dried and rendered in a form suitable for implantation into the body of an animal.
-iiyT)
Thus, for example, a solid composition suitable for implantation, suitably a solid depot preparation in the form of a roller, or a fine particulate preparation for injection can be prepared, for example, by grinding or micronization. This fine particle formulation can be formulated into a solution or emulsion suitable for injection.<sup>0</sup>^^^ ci. This treatment can be carried out, for example, in an aqueous medium or in an oil such as peanut oil, Μ θ 2 of the cremophor (see also Martindale The Extra Pharmacopoeia, EShO 28th Edition, p. 694). Carriers for the preparation of injections include carboxymethylcellulose (see also<sub>T</sub> , .
SF 10 F le le The Extra Pharmacopoeia, 28th edition, p. 947).
7a In the case of dispersing the composition material and the physiologically active substance, these substances are preferably dispersed in an aqueous medium.
The method of the invention may be used to prepare drug-releasing devices in the form of a rod, bead, foil or pill suitable for implantation into an animal body. The material of the composition may be, for example, a polylactide (e.g. as defined above) and may preferably have at least 25 mol%, preferably 40 mol%, lactic acid units and at most 75 mol% acid units t.<sup>1</sup> λΛ3Γ90ν | AZ31VK AJfcd i a'v $ nj L 6 ΙΪΙΛ 6 2 t Cgoo '8 Η 0 M • f-5
glycol, preferably in the form of blocks containing on average at least two identical monomer units. Said polylactide is preferably either soluble in benzene and has an intrinsic viscosity (1 g / 100 ml solution in benzene) less than 0.3 or insoluble in benzene and has an intrinsic viscosity (1 g / 100 ml solution in chloroform or dioxane) less than 4.
In the process according to the invention, customary lyophilizable solvents, such as acetic acid (preferably glacial acetic acid), are preferably used, which are frozen and subsequently de-lyophilized. It may be advantageous to separately prepare a first solution of the composition material in an organic solvent dissolving the material and a second solution of a physiologically active substance in an organic solvent dissolving the material before mixing the two solutions thus prepared. Preferably, the same solvent, preferably lyophilizable, is used to prepare said first solution and said second solution. This process is illustrated in European Patent 58,481. However, if desired, a melt treatment of an intimate solid mixture of the composition material and the physiologically active substance can be used.
The present invention also relates to a process for the preparation of a pharmaceutical composition according to the invention, wherein the composition material comprises a polylactide (as defined above), which may be in the form of a hydrogel, the method comprising incorporating a physiologically active substance into a polylactide-containing matrix. having at least 25 mol%, preferably 40 mol%, lactic acid units and at most 75 mol% glycolic acid units, wherein the method further comprises uniformly mixing the physiologically active agent and the material of the composition by melting the intimate solid mixture of the physiologically active agent and the coosion material.
The present invention also provides the use of a physiologically active agent which comprises a polypeptide covalently conjugated to a water-soluble polymer in the preparation of a pharmaceutical composition of the invention.
A / Physiologically active substance
In general, the greater the molecular weight of the polypeptide, the greater the number of water-soluble polymer molecules can be conjugated to the polypeptide to provide an optimal release profile of the active agent. Preferably, the at least one water-soluble polymer molecule is conjugated to a polypeptide having a molecular weight in
up to 8000 Da and at least one water-soluble polymer molecule are used for every 3000-8000 fa, especially 4000-65ΟΟ fa, of the polypeptide's molecular weight. A single polypeptide molecule can carry as many water-soluble polymer molecules as are consistent with the retention of the desired degree of biological activity. Indeed, under this pressure, the polypeptide is preferably conjugated to a maximum number of water-soluble polymer molecules. It should be noted that if there are multiple sites for conjugation to a water-soluble polymer on a given polypeptide, then; this maximum conjugation may result in a heterogeneous mixture of products. For example, if the polypeptide has 4 sites for conjugation to water-soluble molecules, then the maximum ratio of polypeptide to water-soluble polymer achieved may not be greater than, for example, 3.9.
A1 / Polypeptide
For example, a physiologically active agent used in a pharmaceutical composition of the invention may include human calcitonin, interleukin-2, human growth hormone or an interferon such as an interferor. alpha, for example interferon alpha, covalently conjugated to a water-soluble polymer, or preferably a polypeptide having at least one of the biological properties of naturally occurring C-CSF, and preferably part or all of the amino acid sequence of naturally occurring C-CSF,. covalently conjugated to a water-soluble polymer. Preferably said peptide does not carry. Thus, due to polypeptides having at least one of the biological properties of naturally occurring G-CSF, the cysteine at position 17 will preferably be absent or replaced by another amino acid such as alanine or preferably serine.
A.1.1 / Polypeptides having at least one of the biological properties of G-CSF, it is desirable to use a polypeptide having at least one of the biological properties of naturally occurring G-CSF, then any derivative having such properties may be used, but preferably the polypeptide used is a derivative of G -CSF described in European Patent Application 91303268.3, which discloses G-CSF derivatives having improved solution stability. Said European patent application discloses naturally occurring G-CSF derivatives having at least one of the biological properties of naturally occurring G-CSF with at least 35% solution stability (as defined below) at both 17 and čucbun concentrations.
27 Mar: native sequence replaced by Ser residue and Asn native or 5 mg / ml, said derivatives having at least Cys .du, 27 sequences replaced by Ser residue
Preferably said derivatives have at least one other modification from the group comprising:
<td>and/</td><td>Glu<sup>1 1</sup></td><td>native</td><td>sequence</td><td>Yippee</td><td>replaced</td><td>residual</td><td>Arg</td>
<td>b /</td><td>Leu<sup>15</sup></td><td>native</td><td>sequence</td><td>υθ</td><td>replaced</td><td>residual</td><td>Glu '<sup>5</sup></td>
<td>C/</td><td>Lys<sup>3</sup></td><td>native</td><td>sequence</td><td>ΰθ</td><td>replaced</td><td>residual</td><td>Arg<sup>23</sup></td>
<td>d /</td><td>Gly<sup>26</sup></td><td>native</td><td>sequence</td><td>Yippee</td><td>replaced</td><td>residual</td><td>Ala<sup>26</sup></td>
<td>E/</td><td>Gly<sup>28</sup></td><td>native</td><td>sequence</td><td>Yippee</td><td>replaced</td><td>residual</td><td>2S Ala</td>
<td>F/</td><td>Ala<sup>J</sup>°</td><td>native</td><td>sequence</td><td>Yippee</td><td>replaced</td><td>residui L</td><td>30 '• ys n</td>
<td>G/</td><td>τ 34 Lys</td><td>native</td><td>frequency</td><td>Yippee</td><td>replaced</td><td>i residual</td><td>'Gl: we'</td>
<td>h /</td><td><sub>γ</sub> AQ Lys</td><td>native</td><td>frequency</td><td>Yippee</td><td>replaced</td><td>. residuez</td><td>, <13 i Arg </td>
<td>and/</td><td>For<sup>44</sup></td><td>native</td><td>frequency</td><td>Yippee</td><td colspan="3">/O (replaced by Ala residue</td>
<td>j /</td><td>Leu<sup>49</sup></td><td>native</td><td>frequency</td><td>Yippee</td><td colspan="3">49 ! replaced by Lys</td>
<td>to/</td><td>Gly<sup>51</sup></td><td>native</td><td>sequence</td><td>Yippee</td><td>replaced</td><td>residual</td><td>Ala<sup>5</sup>’</td>
<td> 1/</td><td>Gly<sup>55</sup></td><td>native</td><td>sequence</td><td>Yippee</td><td>replaced</td><td>residual</td><td>Ala<sup>55</sup></td>
<td>m /</td><td>Trp<sup>58</sup></td><td>native</td><td>sequence</td><td>Yippee</td><td>replaced</td><td>residual</td><td>Lys<sup>58</sup></td>
<td>n /</td><td>p 60 For</td><td>native</td><td>sequence</td><td>Yippee</td><td>replaced</td><td>residual</td><td>Ser<sup>60</sup></td>
<td>O/</td><td>For<sup>0</sup>·'</td><td>native</td><td>sequence</td><td>”> A</td><td>replaced</td><td>residual</td><td>Ser<sup>65</sup></td>
<td>p /</td><td>For<sup>111</sup></td><td>native</td><td>sequence</td><td>Yippee</td><td>replaced</td><td>residual</td><td>Glu<sup>111</sup></td>
<td>q /</td><td>Thr<sup>115</sup></td><td>native</td><td>sequence</td><td>Yippee</td><td>replaced</td><td>residual</td><td>Ser ”<sup>5</sup></td>
<td>r /</td><td>Thr<sup>116</sup></td><td>native</td><td>sequence</td><td>“1 in * - ·</td><td>replaced</td><td>residual</td><td>Ser ”<sup>6</sup></td>
<td>with/</td><td>Tyr<sup>165</sup></td><td>native</td><td>sequence</td><td>HP O</td><td>replaced</td><td>residual</td><td>Arg<sup>165</sup></td>
Preference is given to the presence of at least one further modification selected from the group comprising modifications b / to s /, more preferably the presence of at least one further modification selected from the group comprising modifications b /, d /, e /, f /, n / o and especially is advantageous presence of further modification o /.
The further modification is more preferably selected from the group consisting of the following modifications:
i / Gin<sup>11</sup>, Pro<sup>80</sup>’<sup>85</sup> the native sequences are replaced by Arg<sup>11</sup>,
60,65 se:
ii / Ala<sup>1</sup>'<sup>1</sup>, Thr<sup>115,118</sup> the native sequences are replaced by Glu<sup>111</sup>, Ser<sup>115</sup>’<sup>116</sup>.58 iii / Gin<sup>11</sup>, Trp<sup>yC</sup>, Τ;<sup>ιυ></sup> native sequences are replaced by '<sup>165</sup>, Lys<sup>58</sup>, iv / Leu<sup>15</sup>, Gly<sup>26,2c</sup>, Ala<sup>30 </sup>Glu<sup>15</sup>, Ala<sup>26</sup>’<sup>28</sup>, Lys<sup>30</sup>, native sequences are replaced with / -44 in / xro .eu
Gly<sup>51</sup>’<sup>55</sup>, ,58
The Trp native sequences are replaced by Ly 1<sup>G</sup>, Ala ^^^<sup>1</sup>p ^.
Said further modification may also advantageously comprise at least one modification of the following modifications:
vi / Leu, Gly<sup>2</sup>^’<sup>2</sup>^, Ala<sup>30</sup> the native sequences are replaced by Glu '<sup>5</sup>, Ala<sup>26</sup>’<sup>2</sup>°, Arg<sup>30</sup>, vii /? ro<sup>G</sup> the native sequence is replaced by Ser<sup>D :?</sup>The native sequence is replaced with Ser<sup>G0, G</sup>or, n..11 ^ 65 ix / Glu. For native sequences, Arg? is replaced<sup>1</sup>, 'er'.
The above-defined modifications can, if desired, be introduced into any polypeptide chain having at least one of the biological properties of naturally occurring G-CSF so as to improve the stability of the molecule in solution. Modifications as defined above may be applied to those polypeptides that differ in amino acid composition from that described herein for naturally occurring G-CSF in the composition or location of one or more residues (e.g., by substitution) , terminal or internal additions and deletions.
Examples of such polypeptides are those that have been truncated, for example, by deletion, those that exhibit a higher resistance to hydrolysis (and therefore exhibit longer their effect than naturally occurring); furthermore, those that have been altered to remove the site for potential C-glycosylation (which may result in higher activity for yeast-produced substances) or where one or more cysteine residues have been removed or replaced by, for example, alanine or serine residues and are more easily isolatable in active form from microbial systems. Also included are polypeptides having one or more tyrosine residues replaced by phenylalanine and may be more or less bound to human G-CSF cell receptors. The proposed modifications of the aforementioned European Patent Application 91303868.3 may thus be applied, for example, to either a native G-CSF having a Cys native sequence 17 replaced by a residue of Ser or Qe's allelic variants and analogues known to possess at least one of the biological properties of naturally occurring G-CSF 3, for example as described in PCT patent document WO 87/01132, European patent document 243 153, European patent document 256 843, in European Patent Document 272 6-3, in Siochemical and Biophysical Research Communications / ~ 1989_7, Vol. 159, No.1, pp.103-111, Kuga T. et al. and U.S. Pat. No. 4,904,584.
that such G-CSF derivatives have better or unmodified peptides of unchanged biological activity or improved biological activity.
The stability of the solution was found to be substantially even attainable
Solution stability is measured herein by determining the percentage of G-CSF derivative that remains in solution in phosphate buffered saline for 14 days at 37 ° C at an initial concentration of 1mg / ml, 5mg / ml and / or 10mg / ml. The measurement of the stability of the solution is described in detail in Reference Example 26. Preferably, the G-CSF derivatives used in the pharmaceutical compositions of the invention will have a solution stability at a concentration of 5 mg / ml equal to at least 35%, more preferably at least 50% and particularly preferably at least 75%. at least in particular at least 85%> used in pharmaceuticals to have one of iv (, v), (vi), (vii), (viii), more preferably one of dal, vii (, viii) or ix (a)
Preferably, derivatives of G-CSF compositions of the invention are selected by further modifications i /, ii /, iii), or<sup>-</sup> ix /, which were mentioned above modifications i /, ii /, iv /, vi /
14 more preferably another modification ii (iv), vi (vii), viii (or ix).
Particularly preferred G-CSF derivatives for use in the pharmaceutical compositions of the invention in view of good solution stability include:
/ Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>7G-CSF / Clu<sup>15</sup>, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>26</sup>’<sup>28</sup>, Lys<sup>3</sup>° 7G-CSF, Arg<sup>11</sup>, Glu<sup>15</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>, Ala<sup>26</sup>’<sup>28</sup>, Lys<sup>3</sup>° -70-CSF, Arg<sup>1 1</sup> ’<sup>34</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>00</sup>’<sup>o5</sup>7G-CSF, Arg<sup>11</sup> ’<sup>4</sup>°, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>6</sup>^ / G-CSF,.<sub>T</sub>_4 <sub>iv</sub>,, 5.11 7,27,60,65 y.
(Ala ', Thr' Tyr '(G-CSF, ee)) Arg<sup>11</sup>, Glu<sup>15</sup>’<sup>111</sup>, Ser<sup>17,27,60</sup>’<sup>65,115</sup>’<sup>116</sup>. Ala<sup>26</sup>’<sup>28</sup>, Lys<sup>3</sup>G-CSF, Arg<sup>11</sup>’<sup>165</sup>, Glu<sup>15</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60565</sup>, Ala<sup>26</sup>’<sup>28</sup>, Lys<sup>30,58</sup>7C-CSF, Arg<sup>11</sup>, Glu<sup>15</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>, Ala<sup>26</sup>’<sup>28</sup>’<sup>44</sup>’<sup>51</sup>’<sup>55</sup>, Lys<sup>3</sup>0,49,58_7G_<sub>CSFj</sub> ,O<sub>lu</sub>15, m <sub>Sor</sub>17,27,60,65,115,116 <sub>Ala</sub>26.2S, 44, 51.5<sub>5)</sub> Lys<sup>30</sup>’<sup>4</sup>^’<sup>58</sup>7G-CSF / Glu<sup>15</sup>, Ser<sup>17,27</sup>, Ala<sup>26</sup>’<sup>28</sup>, Arg<sup>3</sup>° -7hu G-CSF.
Particularly preferred G-CSF derivatives for use in the pharmaceutical compositions of the invention in terms of excellent solution stability and good specific activity include:
- 15 i / / Arg<sup>11</sup>, Ser<sup>1</sup>^’<sup>2</sup>^’^<sup>O</sup>’<sup>6</sup>@ 17 G-CSF (ii) Glu<sup>1</sup>^, Ser<sup>17</sup>’<sup>27</sup>, Ala ^<sup>6</sup>’<sup>20</sup>, Lys<sup>3</sup>° _7G-CSF, iii / iv / v / vi / / Arg ', C-lu'<sup>5</sup>"ser"<sup>7</sup>’<sup>27</sup>’<sup>63</sup>’<sup>65</sup>'Ala<sup>26</sup>’<sup>28</sup>, Lsy<sup>3</sup>° _7g-CSF / ~ Ar<sub>G</sub> ’<sup>40</sup>, Ser<sup>1 7</sup> ><sup>27</sup> ’ <sup>63</sup><sup>65</sup>7g-CSF, Arg<sup>1</sup> '<sup>,23</sup>'Ser'<sup>7</sup>’<sup>z7</sup>’<sup>60</sup>’<sup>65</sup>_7g-CSF, <Arg ''<sup>65</sup>“Clu”<sup>7</sup>’<sup>27</sup>’<sup>63</sup>’<sup>65</sup>, Ala<sup>26</sup>’<sup>28</sup>, Lys<sup>30</sup>><sup>58</sup>7c-CSF vii / Arg<sup>11</sup>, Glu<sup>1</sup>^’<sup>111</sup>, Ser<sup>17</sup>’<sup>27</sup>60.65,115.116 ^^ 26.28 _ fys<sup>30</sup>7c-csF, viii // Glu<sup>1y</sup>, S?
/7,27 ,<sub>Ίο</sub>26,28 <sub>Λτ></sub>„30
J-Lc, Arg<sup>JU</sup>_7G-CSI ix // Ala, Thr,
5 <sup>1</sup> 1 b<sub>r</sub>-r> £ -r. <sup>5</sup> 'v - J --- it,
Ser<sup>1</sup>7’<sup>27</sup>’<sup>60</sup>’<sup>6</sup>5_<sub>/G</sub>_<sub>CSFj</sub> x / / Ser <sup>7</sup> >27,60,6? <sub>7</sub>xi // Arg '<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>> 5j<sub>G</sub>_<sub>cs? and</sub> kii // Ser<sup>1</sup>7’<sup>2</sup>7>°5_7<sub>G</sub>_<sub>cs?</sub> of which derivatives i (ii), (iii), (vi), (vii), (viii), (x), (xi) and (xii) are most preferred.
These latter human G-CSF derivatives not only have excellent solution stability but also improved specific activity relative to naturally occurring human G-CSF.
Methionine presequence may or may not be present in the polypeptides of the invention, although the presence of such a presequence is preferred.
With respect to the preparation of C-CSF derivatives for use in the pharmaceutical compositions of the invention, it has proved advantageous to use a pAT153-derived production vector comprising:
a promoter and an operator thereto, for example the trp promoter or T7A3 promoter. T7A3 is the A3 promoter of bacteriophage T7 / vz. Dunn JJ and Studier FW: J.kol. Biol. 166, 477-535 (1983). The complete nucleotide sequence of the ENA bacteriophage T7 and the location of genetic portions 17 are described in the above reference;
ii) a ribosome binding site sequence, for example, a trp ribosome leader binding site;
iii) a cioning site for the gene to be expressed;
iv) a T4 transcriptional terminal sequence / see SEQ ID NO.
and FIG.
v / cer sequence / Summers D. et al. MGG, 201, p.334338 (1985);
vi) tetracycline repressor gene / tetracycline repression gene / Tet R;
vii / gene responsible for tetracycline resistance of Tet A;
viii / multiple restriction enzyme recognition sequences
SEQ ID NO: 50 shows a sequence that contains an EcoRI restriction endonuclease cleavage site (nucleotides 16), a A3 promoter sequence (nucleotides 7-52), a leader sequence for the rib ribosome binding site (nucleotides 53-78), and a translation initiation codon. (nucleotides 79-81).
It may be advantageous to cultivate host cells capable of expressing a G-CSF derivative (as defined above) in a growth medium enriched in the culture medium with an addition containing yeast extract. It is preferred that the yeast extract substances are added after the start of the cultivation, but before the start of production monitoring. The dosing must be adjusted in such a way that the yeast extract is not depleted in the medium during cultivation. Furthermore, the use of a production vector with the T7A3 promoter is particularly preferred.
At the same time, culturing a host transformed with a recombinant vector carrying the G-CSF derivative genetic material (as defined above) in the presence of leucine and / or threonine in an amount sufficient to improve the accumulation of the G-CSF derivative may be advantageous. It is particularly advantageous to influence the fermentation by the presence of leucine, where the production vector used contains a trp promoter.
Purification of the G-CSF derivative could be accomplished by the procedure described in PCT Patent WO S7 / 01132, but there is no reference in this document to the removal of a detergent, in particular N-lauroylsarcosine salt (e.g. Sarkosyl), from G-CSF analogs prepared in said PCT. Detergent removal is preferably carried out in the presence of phosphate buffered saline (pH 7.2 - 7.5).
Phosphate buffer can be prepared from isotonic salts and may have the composition described in Example 3 · Other buffers are less useful in this regard because either less detergent removal occurs, especially N-lauroyisarcosine, or precipitated increases the amount of protein from the solution. Further, the diafiltration means is advantageously utilized in this step because it has been found that efficiency increases without inducing increased protein precipitation. For example, diafiltration is preferred to conventional diffusion dialysis. It has been found that the concentration of the detergent, especially N-lauroylsarcosine in the form of a salt, can be reduced below 1% if it decomposes during chromatography. As the possibility of detergent removal can be increased. by reducing its initial concentration, the detergent is already used at its minimum initial concentration; for example, for N-lauroylsarcosine, it is the same concentration that decomposes during chromatography.
Individual detergent concentrations range from
0.8 to 0.2%, preferably from 0.5 to 0.2%, preferably at a concentration of 0.3%.
In addition to the above, it has been found that the removal of a detergent such as N-lauroylsarcosine in the form of a salt (e.g., Sarkosyl) activates traces of proteolytic activity which may complicate product formation. Furthermore, it has been found that this proteolytic activity can be significantly reduced or eliminated if, after removal of the detergent by diafiltration, the pH is lowered below pH 7.0 by diafiltration or better by dialysis. Reduction or elimination of proteolytic activity can be achieved at a pH that is less than 7.0, but is high enough to exclude some possible hydrolysis of the polypeptide. A suitable pH is in the range of 6.0 to 4.5, preferably a pH of 5.8 to 5.0, especially a pH of 5.4. It is also an advantage that contaminants produced by E.coli and / or due to the presence of a degraded or improperly synthesized protein can be eliminated by precipitation due to a lower pH.
It is preferred that size-exclusion chromatography (gel chromatography) is used for purification, since otherwise the risk of proteolytic degradation increases and while the previous action (pH reduction) reduces the possibility of such degradation, it is difficult to eliminate it without using chromatography. .
It should further be noted that the already mentioned solution stability of G-CSF and its derivatives makes it possible to simplify the extraction process. The method for extracting the derivative defined above consists of:
1) suspending said inclusion particles in a detergent, in particular N-lauroylsarcosine in the form of a salt (sarcosyl),
2 / oxidation
3 / removing the detergent as previously described,
4) preserving the solution obtained by subsequent removal
A.1.2 / Other polypeptides
Human calcitonin is described in GB 1,270,595 and can be prepared, for example, by peptide synthesis or recombinant techniques (see, for example, European Patent Applications 77 689, 70 675, 95 351, 197 794, 201 511 and 308 067 and US Patents 3,891,614 and 3,926,9387. Preferably, human calcitonin covalently conjugated to a water-soluble polymer can be prepared by peptide synthesis due to the availability of the free N-terminal amino group and other free amine groups on a single lysine residue useful for covalent conjugation of the water-soluble polymer. Preparation of human calcitonir either by peptide synthesis or by recombinant techniques prior to conjugation to a water-soluble polymer may result in the formation of a heterogeneous mixture of products. However, if the relevant amino acid residue (s) is covalently conjugated to a water-soluble polymer prior to incorporation into the overall peptide synthesis, then there is no heterogeneous mixture of products but a single molecular unit is produced as the synthesis product. However, if desired, human calcitonin can, of course, be prepared either by peptide synthesis or by recombinant techniques before the human calcitonin thus prepared can be covalently conjugated to a water-soluble polymer.
Interleukin-2 is a soluble glycoprotein that improves the quality of the immune system and is produced by T lymphocytes upon activation by antigens or mitogens in the presence of interleukin-1. Interleukin-2 induces T-cell growth and proliferation, potentiates gamma-interferon release, 3-cell growth factor and B-cell differentiation factor, improves natural cell killing activity and restores T-cell function in diseases related to immune deficiency. Isolation of the human IL-2 gene has been described
S. Mita et al. In 3iochem, Res. Commun. 117, 114 (1983) and the microbial production of interleukin-2 has been described, for example, by "t<sub>ς</sub> Ί f ύ <
μ A cv.
In addition, various analogues of interleukin-2, such as e.g.
25 des-alanyl Ser IL-2; such analogs are described, for example, in U.S. Pat. Nos. 4,518,584 and 4,533,787. PCT Patent WO 87/00056 also described the conjugation of a polypeptide having IL-2 activity, such as said des-alanyl Ser IL-2 analogue, to polyethylene glycol. . Peptides having interleukin-2 activity, such as interleukin-2 itself and analogues thereof, as well as these peptides covalently conjugated to a water-soluble polymer, such as polyethylene glycol, are potentially useful in the treatment of cancer.
Human growth hormone (HGH) is a specific anabolic protein that promotes somatic growth, stimulates protein synthesis, regulates carbohydrate and fat metabolism, and increases serum somatomedin levels. The amino acid sequence of human growth hormone as well as the cloning and expression of DNA for human growth factor in bacteria is described by DV Goeddel et al. in Nature 281, 544 (1979), in Belgian patent 884 012 and in U.S. patent 4,342,832. Cloning and expression of DNA for human growth hormone in mammalian cells is described by GN Pavakis et al. v Why. Nati. Acad, Sci, USA 78,7398 (1981) and also in French Patent 2,534,273.
It should be noted that human growth hormone contains two types of protein, one having a molecular weight of 22 kDa and the other having a molecular weight of 20 kDa (see UJLewis et al.). J.Biol. Chem. 253, 2679-2687 (1978) and RN Singh and UJLewis, Prep. Biochem. 11,559-570 (1981). The human growth hormone variant with a molecular weight of 20 kDa (20K-HGH) accounts for 5-10% of the total amount of human growth hormone in the human anterior pituitary, blood plasma and urine. Analysis carried out to determine the amino acid sequence showed that the human growth hormone variant with a molecular weight of 20 kDa was different from the human growth hormone variant with a molecular
22 masses of 22 kDa differ only in that the amino acid sequence 32-46 is missing. The human growth hormone variant of 20 kDa has an otherwise comparable growth-promoting activity and all other biological activity except that it exhibits no or only reduced insulin activity. Molecular cloning of DNA encoding a 20 kDa variant of human growth hormone is described in 3iochimica et Biophysica Acta 949/1988 / 125-131 by N. Masuda et al.
Interferon is the name for a group of specific vertebrate proteins providing non-specific resistance to a wide range of viral infections affecting cell proliferation and modulating immune responses. Interferons have been extensively described in the literature [see, for example, C. Weissman, H. Weber, Prog. Nucl. Acid. Res. Mol. 3iol. 33, 251-300 (1986) and KC Zoon, Interfero 9, 1-12 (1987).
The three major components of the interferon family are referred to as alpha-interferon, beta-interferon and gamma-interferon, and are identified by their induction factors and the cell source from which they are derived (Nature 286, 110 (1980)). These interferons can be prepared by any desired technique, for example, using recombinant DNA technology. The preparation of alpha interferons has been described by S. Nagat et al., Nature 284, 316 (1980) and DV Goeddel et al., Nature 287, 411 (1980), although he described particularly well the preparation of alpha interferons<sub>2</sub> MDSdge et al., Nucleic Acids Research, Vol. 11, No. 18, 6419-6435 (1983).
Recombinant preparation of beta interferons has been described by T. Taniguchi et al., Proc. Nati. Acad. Sci. USA 77,
523 (1980) and R. Derynck et al., Nature 285, 542 (1980). Recombinant preparation of gamma interferons is described by FW Gray et al., Nature 295 »503 (1982) and the structure of the human gamma interferon gene has been described by PWGray and DV Goeddel, Nature 296» 859, 1982. Interferons are further described in Biotechnology and Genetic Engineering Rewiews, Vol. 2, pp. 215 (1984) MDEdge and R. Camble.
- 23 v
It should be noted that at least some interferons may be labile at a pH of about 8.5 ·
The interferon used is preferably interferon alpha or interferon beta, more preferably interferon alpha and particularly preferably interferon alpha<sub>2</sub>·
In general, peptides suitable for use in the invention may be prepared by recombinant techniques or peptide synthesis. Peptide synthesis may be a convenient preparative technique wherever the size of the peptide permits and where more than one free amino group (e.g., N-terminal amino group and one or more lysine residues) is present for covalent conjugation with a water-soluble polymer, examples of which The advantage of such a preparative technique is that that the lysine residue or lysine residues conjugated to a water-soluble polymer can be introduced at specific sites in the molecule, resulting in a single chemical individual and not a heterogeneous mixture of products resulting from a covalent conjugated water-soluble polymer with a peptide having several free amine groups .
Regardless of the preparative technique used, it may be advantageous to modify the peptide:
i) substituting existing moieties with other moieties, for example lysine moieties, for fixing water-soluble polymer molecules, ii) adding new such moieties for fixing water-soluble polymer molecules, for example<sup>IN</sup>N- and / or C-termini or elsewhere in the molecule, provided that this addition does not abolish or unacceptably reduce the activity of the peptide and / or iii) by substitution or removal of one or more such residues, for example lysine residues, to reduce the degree of molecule fixation in water soluble polymer, thereby reducing the heterogeneous nature of the product and / or preventing the fixation of the water-soluble polymer at the sites of the molecule, in which fixing the water-soluble polymer would cause cancellation or reduction of the activity of the peptide.
The covalent conjugation of water-soluble polymer molecules, such as polyethylene glycol, to an already formed peptide or to specific amino acids prior to the formation of the peptide can be accomplished by any suitable method, for example, by the following methods.
A.2 / Water-soluble polymer
The water-soluble polymer covalently conjugated to the polypeptide may be, for example, dextran or poly (vinyl pyrrolidone), although the preferred water-soluble polymer is preferably a polymer selected from polyethylene glycol, polypropylene glycol homopolymers, polyoxyethylated polyols and polyvinyl alcohol, said homopolymer substituted unsubstituted or at one end with an alkyl group.
Specific polymers with which the polypeptide is covalently conjugated are a polyethylene glycol (PEG) homopolymer or a polyoxyethylated polyol, provided that the polymers are water-soluble at room temperature. Examples of polyoxyethylated polyols include, for example, polyoxyethylated glycerol, polyoxyethylated sorbitol, or polyoxyethylated glucose.
The backbone glycerol chain of polyoxyethylated glycerol is identical to the glycerol chain, which naturally occurs in, for example, animal and human mono-, di- and triglycerides. Accordingly, this polymeric portion of the polymer-peptide conjugate cannot be viewed as a factor foreign to the body.
Preferably, said polymer is unsubstituted, but preferably is equal to 15,000, and particularly preferably is equal to 10,000.
If the polypeptide has at least one of the biological properties of naturally occurring G-CSF and when a water-soluble polymer is a polyethylene glycol homopolymer or a mono-methyl-substituted polyethylene glycol homopolymer, then the lowest molecular weight of the water-soluble polymer will normally be 1000, preferably 1250, particularly preferably 1500 and most preferably about 2000.
The polypeptide will be covalently conjugated to a water-soluble polymer such as polyethylene glycol, polypropylene glycol homopolymers, polyoxyethylated polyols and polyvinyl alcohol, wherein said homopolymer is unsubstituted or substituted at one end by an alkyl group.
For example, the above-described polypeptides may be conjugated to said polymer via:
1) free amino groups or free amino groups,
2) at least one carbohydrate residue on the protein; or
3) free sulfhydryl groups or free sulfhydryl groups which are optionally present in the native molecule or which are optionally incorporated into the molecule.
Such techniques are described in detail in PCT Patent Document WO 89/06546 in connection with IL-CSF.
In particular, the invention provides a process for preparing a G-CSF polypeptide (as defined above) covalently conjugated to a polyethylene glycol or a G-CSF polypeptide covalently conjugated to a polyoxyethylated polyol, comprising excess of an activated polyethylene glycol ester or carbonate or polyoxyethylated polyolUiS G-CSF polypeptide. . as defined above, thereby bringing X into contact • 1
25 ethylene glycol (PEG), monomethylpolyethylene glycol (mPEG) or polyoxyethylated glycerol (POG), especially monomethylpolyoxyethylene glycol (mPEG), the polymer preferably being linked to said polypeptide via an amide or urethane linkage formed, for example, from a 4-hydroxy-3-nitrobenzenesulfonate ester or N- hydroxysuccinimide ester of polyoxyethylated glycerol carboxylic acid, polyethylene glycol carboxylic acids or monomethylpolyethylene glycol carboxylic acids or from p-nitrophenyl carbonate or 2,4,5-trichlorophenyl carbonate of polyethylene glycol, monomethylpolyethylene glycol or polyoxyethylated glycerol. If desired, the polypeptide may be attached to the monomethylpolyethylene glycol via an amino acid or peptide as described by L. Sartore et al. in Appl. Biochem. Biotechnol. 27 45-54 (1991).
It is preferred that the molecular weight of the polymer be between about 300 and 100,000, more preferably between 350 and 40,000, depending, for example, on the particular peptide used. In this case, the molecular weight stated in connection with the water-soluble polymer is the average number molecular weight, but since said polymers should have a polydispersity (as defined below) of about 1, said average number molecular weight corresponds to approximately the average weight molecular weight.
The polyethylene glycol homopolymer may be unsubstituted but may also be substituted at one end by an alkyl group. Preferably, the alkyl group is a C 1 -C 4 alkyl group, and most preferably the alkyl group is a methyl group. Preferably, the polymer is an unsubstituted polyethylene glycol homopolymer, a monomethylsubstituted polyethylene glycol homopolymer, or a polyoxyethylated glycerol and has a lower molecular weight limit of preferably about 1000, more preferably 1250 and particularly preferably 1500, and an upper molecular weight limit of, for example, 20,000. This upper molecular weight limit may be up to 40,000, forming a C-CSF polypeptide that is substantially maximally conjugated to polyethylene glycol or polyoxyethylated polyol. Preferably, said activated polyethylene glycol carbonate or said activated polyoxyethylated polyol carbonate is prepared by contacting a polyethylene glycol or polyoxyethylated polyol which, in the form of a polyethylene glycol or polyoxyethylated polyol.
has at least one hydroxyl group, with chloroformate.
Preferably, the molar ratio of active ester or carbonate of polyethylene glycol or polyoxyethylated carbonate to G-CSF polypeptide is 200: 1 to 50: 1, more preferably 150: 1 to 50: 1, and most preferably about 100: 1.
The procedure used is the same as that described by Veronese et al. in Applied Biochem. and Biotech., 11: 141-152 (1985), subsequently used by Cetus Corporation for interleukin-2 and filed in U.S. Pat. No. 4,902,502 (filed on January 23, 1989).
If the conjugation of the water-soluble polymer to the polypeptide reduces the physiological activity of the polypeptide, and thus the biological activity of the resulting conjugate is less than the biological activity of the parent polypeptide, and in particular less than a certain acceptable limit, this deficiency may be overcome:
1) using a cleavable bond between the polypeptide and the water-soluble polymer such that upon release of the polypeptide-water-soluble polymer conjugate from the material of the composition in vivo, re-cleavage of the fragrant-soluble polymer from the polypeptide, which itself has again its original good physiological efficacy or
2) by constructing a polypeptide molecule (as described, for example, in U.S. Pat. No. 4,904,584) in such a way that conjugation of the water-soluble polymer occurs at sites of the polypeptide that do not significantly adversely affect the physiological activity of the conjugate.
If desired, said reduction in the physiological activity of the polypeptides can be simply eliminated or at least reduced to a minimum by increasing the amount of conjugate present in the pharmaceutical composition of the invention.
B. Composition Material
The material of the composition may be any suitable type of polymer or any suitable blend of polymers such as polylactide (as defined above) or a biodegradable hydrogel derived from an amphipathic block of copolymers (for example the hydrogel described in European patent V2,918) and mixtures of polylactides and said hydrogels. In particular, hydrogels whose linear or branched block copolymer component has a thermodynamic identity identical to that of a hydrophilic unit (water-soluble polymer) attached to the polypeptide may be used. Thus, for example, it may be particularly useful to use pegylated (polyethylene glycol) polypeptides with polyethylene glycol-containing amphipaths.
The material of the composition may thus be, for example, polylactide (as defined above), for example as described in European Patent Document 58,481.
The release of macroraolecular drugs from polylactides is dependent on the structure of the polylactides / i. on the distribution and length of comonomer units in lactic acid-glycolic acid copolymers, the molecular weight of homo- and lactic acid-glycolic acid copolymers, and on the molecular weight distribution or polydispersity of said homo- and copolymers. Consequently, preferred polylactides (but the choice of polylactides is not limited to these preferred polylactides / those polylactides that are insoluble in benzene and have an intrinsic viscosity of 17 (w / v) solution in chloroform at 25 C above 0.09) dl / g but less than 4 dl / g, or are soluble in benzene and have an intrinsic viscosity of 17 (w / v) solution in chloro29 form greater than 0.09 dl / g but less than 0.5 dl / g and more preferably less than 0.3 dl / g.
Another preferred class of polylactides are polylactides having a number average molecular weight greater than 2000 and having a controlled dispersity such that for a number average molecular weight of 2000 to 10000 the polydispersity is 1.2 to 5θ and for an average number molecular weight of 5θ'ΟΟ to 30000 polydispersity ranges from
1.4 to 15 · The preferred mean number average molecular weight ranges from 2000 to 20000. The viscosity properties of the solution and its measurement and the measurement of the molecular weight are described in Preparative methods of Polymer Chemistry, 2nd edition, pages 43 to 52, WR. Sorenson and Tod W. Campbell,
1968, Interscience Publishers.
These various properties of the polymer determine the degradation profile of both the polylactide itself and the pharmaceutical composition made based on such polylactide.
Said polylactide degradation profile includes the formation of micropores in the degrading polylactides, the uptake of water by the degrading polylactide, and finally the erosion or weight loss of the degrading polylactides. In this regard, the diffusion of the physiologically active agent through the polymer itself is a function of the solubility of the physiologically active agent and the size of the physiologically active agent molecule. For one or both of these reasons, the physiologically active substance may not be capable of diffusion through the polymer phase. In this case, the release of the physiologically active substance may occur by some other mechanism, for example through aqueous pores in the polymer matrix. It may therefore be desirable to use polymers having a continuous water uptake over time, which continuous uptake of water is related to the formation of aqueous micropores in a degrading matrix, which then degrades to soluble fragments and erodes.
While not wishing to be bound by theory, it is believed that covalent conjugation of the polypeptide to a water-soluble polymer, particularly polyoxyethylene polymers, to form a physiologically active agent
- JO (as defined above) advantageously affects the percolation threshold (as defined below) of a sustained release pharmaceutical composition. The percolation threshold is a function of the degree of incorporation of the physiologically active agent into the polymer matrix in the anhydrous composition and the degree of compatibility of the physiologically active agent with the polymer matrix, and the nature and degree of phase separation upon hydration of the composition.
The length of the polypeptide chain, the molecular weight of the water-soluble polymer, and the degree of incorporation of the water-soluble polymer are features that affect the compatibility of physiologically active substances.
If desired, the sustained release pharmaceutical compositions of the invention may have a short induction period of time before the physiologically active agent is released. The length of this induction period may vary depending on the amount of the physiologically active agent to be released and the time during which the amount of the physiologically active agent is to be released.
The sustained release pharmaceutical compositions of the invention are preferably in a non-micro capsule form, for example in the form of microspheres in which the physiologically active agent is dispersed throughout the polymer mass as well as on the surface, or in another microparticular form in which the physiologically active the fabric extends to the surface.
The sustained release pharmaceutical compositions of the invention may be deposited in the body of an animal (e.g., human) in need of treatment with a polypeptide, such as by intramuscular or subcutaneous injection or subdermal surgical implantation, as is conventional in clinical or veterinary practice.
B.1 / A process for the preparation of a sustained release pharmaceutical composition
The sustained release pharmaceutical compositions of the invention may be prepared by any suitable method. For example, the material for the composition as defined above may be used in the form of a solution in an organic solvent such as acetic acid (glacial) in which the physiologically active substance as defined above can be dissolved, as described in the European patent, for example. 58 481.
B.2 / Aqueous Way
The sustained release pharmaceutical compositions of the invention may also be prepared, for example, by forming an aqueous dispersion of a polymer or copolymer having one or more terminal carboxyl groups, said polymer or copolymer further characterized by having a weight average molecular weight of at least about 3000 and that is in the form of an ammonium or alkali metal salt, wherein at least 80% by weight of solids / dry matter / dispersion is capable of passing through a bacterial filter having a pore size of 200 m.
The preparation of such an aqueous polymer or copolymer dispersion can be accomplished by mixing a solution of the polymer or copolymer in a water-miscible organic solvent and at least a stoichiometric amount of a water-soluble ammonium or alkali metal or ammonium hydroxide or alkali metal hydroxide solution to form a dispersion of the corresponding ammonium or salt. an alkali metal polymer or copolymer in a mixed aqueous-organic solvent having a substantially neutral pH, and subsequent evaporation of the water-miscible organic solvent to form an aqueous dispersion of said polymer or copolymer salt, wherein at least 60% by weight of the solids of said dispersion are capable of passing through a bacterial filter having a pore size of 200 m @ -1.
For example, the polymer or copolymer used in the process described above may be selected from the group consisting of both homopolymers consisting of D-lactic acid polymer, L-lactic acid polymer, DL-lactic acid polymer, poly-D-lactide, poly-L-lactide and poly- DL-lactide, glycolic acid polymer, polyglycolide, poly-2-caprolactone and hydroxybutyric acid polymer, as well as copolymers derived from two or more monomers from which said homopolymers are derived, graft or branched block copolymers containing motors<sup>n</sup>of said homopolymers or copolymers; and a hydrophilic polymer selected from the group consisting of polyvinyl alcohol, polyvinylpyrrolidone, polyethylene oxide, polyethylene glycol, polyacrylamide, polymethacrylamide, dextran, alginic acid, sodium alginate, gelatin, or a copolymer of any two or more of said monomers.
Preferred polymers or copolymers for use in this aqueous process are homopolymers of D-lactic acid polymer, L-lactic acid polymer, DL-lactic acid polymer, poly-D-lactide, poly-L-lactide and poly-DL-lactide. and copolymers consisting of a copolymer of D-lactic acid and glycolic acid, a copolymer of L-lactic acid and glycolic acid, a copolymer of DL-lactic acid and glycolic acid, poly-L-lactide-glycolide, poly-Llactide-glycolide and poly-DL-lactide-glycolide.
A preferred water-miscible solvent for use in the process is acetone, 2-butanone (methylethylketone), dioxane, hexafluoroisopropanol, tetrahydrofuran, methanol, or ethanol, with a particularly preferred water-miscible solvent being acetone. A preferred water-soluble ammonium salt or alkali metal salt or water-soluble ammonium hydroxide or alkali metal hydroxide is sodium hydrogencarbonate, potassium hydrogencarbonate or ammonium bicarbonate, sodium carbonate, potassium carbonate or ammonium carbonate or sodium hydroxide, potassium hydroxide or ammonium hydroxide.
An alternative solvent for use in this aqueous process is a water-immiscible solvent such as
- JJ is in particular dichloromethane. The use of such a solvent results in an aqueous dispersion of the copolymer salt having a larger particle size.
The solution of the water-soluble ammonium or alkali metal salt or ammonium hydroxide or alkali metal hydroxide may be an aqueous solution or a solution in which a mixed solvent of water and a miscible organic solvent such as methanol or ethanol is used as the solvent.
The evaporation of the water miscible solvent is preferably carried out under reduced pressure and at a temperature as low as possible above ambient temperature.
If a solution of the polymer or copolymer in an organic solvent is added to said aqueous phase and the addition is complete before the solvent evaporation, then a high yield of particles capable of passing through a 200 m filter is only achieved if the concentration of polymer or copolymer in the organic solvent nepresahn<sup>E</sup>about 1.5% (w / w).
In this method, the mixing of the polymer or copolymer solution in a water-miscible organic solvent with a solution of a water-soluble ammonium salt, alkali metal salt, ammonium hydroxide or alkali metal hydroxide is preferably carried out under high shear mixing, for example in a Ystral homogenizer which is capable of stirring at up to 25,000 rpm, or similar devices.
Preferably, said pharmaceutical composition will not contain a solubilizing protein such as fetal calf serum (FCS-foetal calf serum) or human serum albumin (HSA-human serum albumin).
In preparing the pharmaceutical compositions of the present invention, the preferred parameters for a particular composition may be determined by a progressive approach (test method) based on the facts previously discussed.
<img file="CS9102285A3_D0002.tif" />
- 34, which can serve as an important guide. For some polypeptides, including interleukin-2 (IL-2), human growth hormone (HGH) and interferon alpha<sub>2</sub> / IFNalfa<sub>2</sub>1, the only parameter that can be advantageously modified in order to obtain the desired release profile of the active ingredient is the protein load that can be in the case of interleukin-2, human growth hormone and interferon
X alpha<sub>2</sub> preferably 5 to 20% by weight, more preferably 10 to 18% and particularly preferably about 12.5 to 16% by weight.
It should be noted that when working with water-soluble polymers such as polyethylene glycol, it has been found necessary to limit the degree of modification of the desired polypeptide when it is desired to maintain the high physiological activity of said polypeptide. Conjugation of an excessively water-soluble polymer to a physiologically active polypeptide has so far resulted in a substantial reduction or even complete loss of polypeptide activity. The need to limit the degree of modification of a polypeptide results in an increase in the heterogeneous distribution of a given number of water-soluble polymer molecules around the number (usually large number) of potential sites for modification. Such a high degree of heterogeneity may have little effect on parameters such as solubility and half-life, but may adversely affect fluidity and
the ease of release of the active ingredient from the sustained release pharmaceutical composition, since a heterogeneous mixture of isomers may limit the consistency and ease of release of the physiologically active ingredient from the composition.
Surprisingly, it has now been found that the G-CSF derivatives disclosed in European Patent Application 91303868.3 and, in particular, (Arg, Se, 7G-CSF) either without methionine or with methionine preference, preferably with methionine preference (they may undergo complete modification by covalent conjugation to the water-soluble polymer as defined above, in particular polyvinyl-ethylene glycol (PSG), such as monomethylpolyethylene glycol (m? SG), and to play to a significant extent at least one of the biological properties of naturally occurring G-CSF. For example, pegylated (polyethylene glycol) / G-CSF derivatives have been shown to retain the activity of native G-CSF in vitro to a factor of about 2. Dose response curves obtained in an in vivo study of pegylated / Arg<sup>11</sup>, Ser<sup>1</sup>Indeed, 7G-CSF has shown that said derivative has about twice the activity of native C-CSF. Such complete modification of the polypeptide results in a substantially lower number of representatives in the heterogeneous mixture of isomers, which substantially increases the consistency and completeness of the release of the physiologically active agent from the pharmaceutical composition in the corresponding sustained release pharmaceutical composition.
Thus, the most preferred physiologically active agent for use in the pharmaceutical composition of the present invention is pegylated (Arg).<sup>11</sup>, Ser<sup>1</sup> & Gt; 1,66, 6y. human G-CSF in which a methionine presection, although preferably present, may be present or absent in the G-CSF residue and wherein each polyethylene glycol residue has a molecular weight of 2000-5000 Da, wherein the ratio of the G-CSF residue to polyethylene glycol residues equal to 1: 3 to 1: 4, in particular about 1: 3,9 ·
C. / Definitions
The terms used in the specification and the claims have the following meanings:
The term physiological-type aqueous medium herein refers to the body, in particular, musculature or subcutaneous tissue, or the circulatory system of a warm-blooded animal, which in laboratory investigations may be imitated with aqueous liquids optionally buffered at physiological pH,
The term continuous release is used herein only for the purpose of defining a release profile of an active substance that is substantially monophasic, although it may have an inflection point, but by no means has a plateau phase in the diagram in which cumulative release is plotted. of the physiologically active substance as a function of time (for each time point on the ordinate axis, the total amount of physiologically active substance already released is plotted on the abscissa axis).
The term monophasic herein refers to continuous release over a period of time at which an inflection point may exist, but in no case there is a platform phase in the diagram in which the cumulative release of the physiologically active agent over time is plotted.
The term polylactide is used herein in a generic sense and includes polymers of lactic acid itself, lactic acid-glycolic acid copolymers, mixtures of such copolymers, and mixtures of such polymers and copolymers, wherein the lactic acid is either in racemic or optically active form.
The term stable in acidic environment is understood to mean a physiologically active substance stable under the conditions prevailing in the claimed formulation during the period of intended use. The pH of the claimed formulation will vary but will generally not be greater than 8 and normally will be less than 2. These pH values generally mean extreme values and the pH in the formulation will generally never be less than 2.5 or 3. The relevant temperature will normally be body mammalian temperature, generally up to about 40 ° C. The period of intended use may vary, for example, from 1 week to 6 months.
The term polydispersity is defined as Ew / En, where Ev; is the weight average molecular weight and En is the number average molecular weight. Absolute number average molecular weight measurements can be made by end group analysis or steam osmometry. The number and weight average molecular weight and polydispersity measurements can also be performed by size exclusion chromatography (gel chromatography) with respect to polystyrene standards.
The term percolation threshold is used herein to define the condition attained when the aqueous drug (physiologically active substance as defined above), respectively. the phase of said medicament reaches continuity with the external environment and with other constituents of the aqueous medicament / physiologically active substance as defined above / of the continuous release pharmaceutical composition of the invention.
The term naturally occurring G-CSF refers herein to those G-CSF known to exist in nature, and includes two polypeptides having the amino acid sequence set forth in SSQ ID No 32 (as defined later). The two polypeptides differ only in that the tripeptide insertion portion of Val-Ser-Glu is present between positions 35 and 36 in one polypeptide and is not present at all in the other polypeptide. The position numbering system used herein is based on a naturally occurring polypeptide without a Val-Ser-Glu insert, and the term native refers to that polypeptide without said Val-Ser-Glu insert. It should be noted that the modifications described herein are applicable to all naturally occurring G-CSF forms and their analogs as described above, and the consecutive revision of the polypeptide position numbers may necessarily depend on the form of the naturally occurring G-CSF selected for modification.
A term having at least one of the biological properties of naturally occurring G-CSF as used herein for a polypeptide means that the polypeptide is active in but one of the biological assays described in detail in WO 87/01132.
Brief description of the pictures
Fig. Fig. 1 Fig. 2 Fig. 4 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 Fig. 9 Fig. 10 Fig. 11 Fig. 12 Fig. 13 shows the nucleotide sequence of the 167 bp fragment. found in Reference Example 5;
shows the amino acid sequence and corresponding nucleotide sequence of native human / hu / G-CSF and restriction sites;
shows the amino acid sequence and the corresponding nucleotide frequency (Ser ') of hu G-CSF and restriction sites;
shows the nucleotide sequence of the T4 transcriptional terminus that comprises a (terminal) / terminal / restriction sites for SalI and HindIII and / / terminal restriction sites for SalI and Styl;
shows the restriction map of pT3357 (also referred to herein as pLB004);
shows the nucleotide sequence of the EcoRI-SalI fragment shown in Reference Example b / b / but without the interferon alpha gene sequence, and<sub>2</sub>;
shows the restriction map of pL3015 (also referred to herein as pICI 0083); shows the restriction map of pICI 1079;
shows the restriction map of pICI 54 (also referred to herein as pCC-54); shows the restriction map of pCG61;
shows the restriction map of pICI1107, wherein the shaded area represents the gene sequence encoding [Ser] - 7hu G-CSF;
shows the restriction map of pCG300 (also referred to herein as pICI 1295); shows the release of FbG 500 0 / et<sup>-1</sup> , Ser<sup>1</sup> ? ’
Fig. 14 Fig. 16 hu G-CSF from pharmaceutical compositions A and B (see examples 4 and 5) with continuous
releasing the active ingredient based on a copolymer of 59% d, 1-lactide and 50% glycolide, both of which are prepared by the glacial acetic acid process;
shows the release of unpegylated? ket<sup>1</sup> , i * T * 7 <sup>in -</sup>”
Ser7hu G-CSF from Pharmaceutical Compositions C and D (see Comparative Examples 1 and 2) with continuous release of the active ingredient based on a copolymer of 50% d, l-lactide and 50% glycolide, wherein composition C contains neoegylated alone<sup>-1</sup> ,
27 - ~~
Ser G / CSF and Composition D contains a mixture of unpegylated)<sup>—</sup>met<sup>-1</sup>, Ser<sup>1</sup>G-CSF and methyl-PEG 5000, and both compositions were prepared using glacial acetic acid;
shows the cumulative release of PEG 5000 / Met <sup>1</sup>, Ser<sup>1</sup>’<sup>2</sup>27hu G-CSF from two different pharmaceutical compositions G and H (see Example 24) with continuous release of the active ingredient based on a copolymer of 50? D, lactide and 50% glycolide, both compositions being prepared by an aqueous process;
<sub>w</sub> -L 1 shows cumulative release / Met, Ser<sup>1</sup>? '2 ? _7hu G-CSF from the pharmaceutical composition having a continuous action on the copolymer of 50% D, L-lactide and 50% glycolide / see comparative example 3 / which includes itself / I.'et<sup>-1</sup> , Ser<sup>1</sup> ’ <sup>2</sup>7 / hu G-CSF and a continuous release pharmaceutical composition based on copolymer 50, 6, 1-lactide and 50% glycolide. • 'Λ ·· ί · ^ ·, <4 \ ν ^ V<sup>1</sup>'<sup>4-</sup>' <sup>F</sup> \ <sup>></sup> ννύγΐί. '*,,.
Fig. 17 Fig. 1 δ (see Comparative Example 4), which contains a mixture (Met)<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>7hu G-CSF and methyl-PEG, both of which were prepared by an aqueous method;
shows the cumulative release of PEG 5000.-1 <sub>m</sub> 15 c 17.27 .π 26.28, 30<sub>7</sub>(met, Glu, Ser ', Ala', Lys - (hu G-CSF) from a pharmaceutical composition Ξ with a continuous release of the active ingredient based on a copolymer of 50% d, 1-lactide and 5θ% glycolide (see Comparative Example 3), from the same composition K (see Example 25) and from the same composition M (see Comparative Example 5), wherein composition kompozice was prepared by the glacial acetic acid process and compositions K and M were prepared by an aqueous method; and shows the cumulative release of PEG 5000 / Met<sup>1</sup>, Arg<sup>11</sup> , Ser<sup>17</sup>’<sup>27</sup>’<sup>60,65</sup>7hu C-CSF from a sustained release pharmaceutical composition F (see Example 4 (> L) see Example 26) and N (Comparative Example 6) based on a copolymer of 50% d, 1-lactide and 50% glycolide, wherein composition F is prepared by the glacial acetic acid process and the compositions L and N are prepared by an aqueous method.
In the following Reference Examples and Examples, reference is made to the following materials of the following composition:
Buffers for restriction enzymes
Stability: stable at -20 ° C
A ·, ·: 0.9. .-0.,: - ..: -:: - ~
<td>Folders</td><td colspan="5">The final concentration (πποΙ) / 17 dilution 1:13 ABL-H</td>
<td>Tris acetate</td><td> 33</td><td> —</td><td> —</td><td> —</td><td> —</td>
<td>Tris-HCl</td><td> -</td><td> 1 3</td><td> 1 3</td><td> 1 3</td><td> 50</td>
<td>Mg-acetate</td><td> 1 3</td><td> -</td><td> -</td><td> -</td><td> -</td>
<td>MgCl g</td><td> -</td><td> 5</td><td> 1 3</td><td> 1 3</td><td> 1 3</td>
<td>K-acetate</td><td> 66</td><td></td><td></td><td></td><td></td>
<td>NaCl</td><td> -</td><td> 1 33</td><td> -</td><td> 53</td><td> 1 03</td>
<td>Dithioerythritol (BTE)</td><td> -</td><td> -</td><td> 1</td><td> 1</td><td> 1</td>
<td>Dithiothreitol (DTT)</td><td> 0,5</td><td> -</td><td> -</td><td> -</td><td> -</td>
<td>Mercaptoethanol</td><td> -</td><td> 1</td><td> -</td><td> -</td><td> -</td>
<td>pH at 37 ° C</td><td> 7,9</td><td> 8,0</td><td> 7,5</td><td> 7,5</td><td> 7,5</td>
<td colspan="2">The above buffers</td><td colspan="4">are commercially available from the company</td>
Boehringer Mannheim.
Site-directed mtagenesis process / reference in example 4 ·
<td rowspan="2">Buffer 1</td><td rowspan="2"> 1 30 1 33 23</td><td colspan="4">mm Tris-HCl ph 8.3 have NaCl</td>
<td>mil</td><td colspan="3">MgClg</td>
<td>Buffer 2</td><td> 1 3</td><td>míí</td><td>Tris-HCl</td><td>pH</td><td>c, 0</td>
<td></td><td> 23</td><td>mM</td><td>NaCl</td><td></td><td></td>
<td></td><td> 1</td><td>mM</td><td>EDTA</td><td></td><td></td>
<td>Buffer 3</td><td> 12</td><td>mM</td>
<td></td><td> 30</td><td>mM</td>
<td></td><td> 1 0</td><td>peace</td>
<td></td><td> 8</td><td>mM</td>
<td>Buffer 4</td><td> 60</td><td>be quiet</td>
<td></td><td> 90</td><td>mM</td>
<td></td><td> 6</td><td>mM</td>
<td></td><td> 1 0</td><td>mM</td>
<td>Nucleotide mixture 1</td><td> : 250</td><td>^ uM</td>
/ phosphothiona
Tris-HCl pH 7.7
NaCl
LgCl<sub>2</sub>
2-mercaptoethanol
Tris-HCl ph 8.0
NaCl
HgCl<sub>2</sub>
DTT dATP, dGTP, dCT? = S derivative dCTP /, dTTP and 1 mM ATP
Nucleotide Mixture 2: 250 µM dATP, dGTP, dCTP, dTTP, and 350 µM ATP
Gene purification (TM)
Kit contains
1 / 6M sodium iodide
2) concentrated sodium chloride solution, Tris and EDTA for the preparation of sodium chloride / ethanol / water wash solution
3 / 1.5 ml milk glass ampoule containing
1.25 ml of silica matrix suspension in water.
This DNA purification technique is based on the method described by Vogelstein and Gillespia, published in Proceedings of the National Academy of Sciences USA (1979), vol. 76, p. 61 5 ·
However, any other method described in Molecular Cloning - Laboratory Manual, Second Edition, Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory, 1989) may be used.
Random Marked Kit - Product of Pharmacia No. 279250
The procedure is described in Molecular Cloning Laboratory Manual, Second Edition, Sambrook, Fritsch and Maniatis, pages 10.13-10.17 (published by Cold Spring Harbor Laboratory, 1569).
Sequence (TM)
Chemically modified T7 DNA polymerase
The modification is based on the procedure described by Tabor and Richardson in Proceedings of the National Academy of Sciences, USA, (1967), Vol. 64, pp. 4767-4771
Ultrogel AcA gels
A mixed matrix of polyacrylamide and agarose which, in synergy, provides high polyacrylamide resolution and agarose stiffness. Ultrogel AcA 54 contains 5% acrylamide poles and 4% agarose.
M9 minimal medium
Sodium chloride 0,5
Sodium hydrogen phosphate 6
Potassium dihydrogen phosphate 3
Ammonium chloride
Distilled water at 1
Other ingredients / 75ml
<td>300..ul</td><td>50% glucose</td>
<td>75 / Ul</td><td>1M MgSO<sub>4</sub></td>
<td>75 / ul</td><td>0.1M CaCl<sub>2</sub></td>
<td>75 / ul</td><td>4 mg / ml thiamine</td>
<td>75 / ul</td><td>20% casein amino acids</td>
Trace Element Stock Solution (TES)
3;'/'*'<sup>1</sup> 't <sup>with</sup> • ň X M M M M;;; ·; . ». Ť
- 44 The trace element stock solution has the following composition:
<td>A1C1<sub>3</sub>.6H<sub>2</sub>O</td><td>0.1 mg / l</td><td>100 / g / l</td>
<td>CoC1<sub>2</sub>.6H<sub>2</sub>0</td><td>0.04 mg / l</td><td>40 / UG / 1</td>
<td>KCr / SO /<sub>O</sub>. 1 2H. 0 4 2 2</td><td>0.01 mg / l</td><td>10 / Lg / l</td>
<td>CuCl<sub>2</sub>.2H<sub>2</sub>0</td><td>0.01 mg / l</td><td>10 / Ug / 1</td>
<td><sup>H</sup>3<sup>(B)</sup>°3</td><td>0.005 mg / l</td><td>5 / Ug / 1</td>
<td>KJ</td><td>0.1 mg / l</td><td>1 00 / ug / l</td>
<td>MnSO, .H., 0 4 2</td><td>0.1 mg / l</td><td>100 / gg / 1</td>
<td>NiSU..6H<sub>O</sub>0 4 2</td><td>0.0045 ng / l</td><td>4.5 / Ug / l</td>
<td>On<sub>O</sub>Mo0.2H<sub>O</sub>0 2 4 2</td><td>0.02 mg / l</td><td>20 / UG / 1</td>
<td>ZnSU. * 7H.O 4 2</td><td>0.02 mg / l</td><td>20 / g / l</td>
<td>and is added to the growth</td><td>media in concentration</td><td>0.5 ml / l</td>
T4 DNA ligase
T4 DNA ligase is described in Llolecular C-loning - Laboratory Manual, Second Edition, Sambrook, Fritdch and Maniatis 5 * 60-5,64 (published by Cold Spring Harbor Laboratory 1989) and in Weiss 3 et al. , J.Biol.Chem., Vol. 243, pp. 4543 (1968).
OXOIL-phosphate buffered saline
<td colspan="2">OXuIL-phosphate used herein</td>
<td>the solution is obtained from tablets Ingredients:</td><td>Dulbecco</td>
<td>Sodium chloride</td><td>8.0 g / l</td>
<td>Potassium chloride</td><td>0.2 g / l</td>
<td>Hydrogen phosphate sodium</td><td>1.15 g / l</td>
<td>Potassium dihydrogen phosphate</td><td>0.2 g / l</td>
<td>pH</td><td> 7,3*</td>
buffered physiological A having the following
27.7 mg of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide as a copolymer; weight average molecular weight 7673; polydispersity 2.59) is dissolved in 1.0 ml of glacial acetic acid. In addition, 1 ml of an aqueous solution of PEG 5000- [eta], Ser<sup>1 7</sup>The G-CSF (9 mg / ml) from Reference Example 3 was lyophilized and then dissolved in another 1 ml aliquot of glacial acetic acid. The two solutions are then mixed and the glass containers used are rinsed with 2 x 0.5 ml aliquots of glacial acetic acid. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained by lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 85 ° C and then formed into a 1 mm thick plate at that temperature. The plate is then chopped into fractions weighing approximately 10 mg. These fractions are then placed in plastic vials containing 2 ml of OXOID-phosphate buffered saline and 0.02% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG release 50θθ- / Μθί ~,
7 77
Ser-7hu G-CSF is determined by high pressure liquid chromatography of the collected medium and the cumulative amount of protein released is calculated from the results obtained at each time point (see Fig. 13).
Example 2
Sustained-release pharmaceutical composition containing PEG 5030- /<sup>_</sup>Met<sup>1</sup>, Ser<sup>17,27</sup>7-G-CSF
Glacial acetic acid procedure
Formulation B (15.36% protein content)
155.43 mg polylactide / 50% d, 1-lactide and 5θ% gly<sup>-</sup> .ΚΎπ &, -. Ϊ́'τΐ ··, ·. .
V. Λi 1Λ>! : ¼ ', vc-d £ 1:, -. X, - 47 collide in the form of copolymers; weight average molecular weight 7791.2; polydispersity 2.65) is dissolved in 2.0 ml of glacial acetic acid. In addition, 3.79 ml of an aqueous PPG 5000 solution was added. Eet ”<sup>1</sup> Serum (G-CSF) (from Reference Example 3) lyophilized (lyophilization residue weight was 104.94 mg) and then dissolved in another 2.0 mL glacial acetic acid aliquot. The two solutions are then mixed and the glass containers used are rinsed 4 times with 0.5 ml aliquots of glacial acetic acid. The resulting solution was immediately frozen in a dichloromethane / Erikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 70 ° C and then formed into a plate having a thickness of 1 mm. The plate is then cut into fractions having a weight of approximately 70 mg. These fractions were then placed in plastic vials containing 2 ml of OXO4 phosphate buffered saline and 0.02% sodium azide and stored at 37 ° C.
At regular intervals, the aqueous medium is separated and replaced with fresh buffer. Release of PPG 5000- / Met,
Ser <sup>í, <r</sup> The G-CSF was determined by high-pressure liquid chromatography of the collected medium and the accumulated amount of released protein was calculated from the obtained results for each time point (see Fig. 13).
Comparative Example 1
Sustained-release pharmaceutical composition comprising Z-Met alone <sup>1</sup>, Ser<sup>1</sup>G-CSF
Glacial acetic acid procedure
Formulation C (20-, ¾ protein content), 73 mg polylactides (50 f weight d, l-lactide)
48 and 50% by weight of a glycolide in the form of a copolymer; weight average molecular weight 7673; polydispersity 2.59) is dissolved in 2.0 ml of glacial acetic acid. In addition, 4.066 ml of an aqueous solution of & quot; Met<sup>-</sup>The GCSP (10.0 mg / ml) was lyophilized and then dissolved in another 2.0 ml aliquot of glacial acetic acid. The two solutions are then mixed and two more 0.5 ml aliquots of glacial acetic acid are used to rinse the glass containers used. The resulting solution was immediately frozen in a dichloromethane / Prikold bath and lyophilized overnight.
The powder obtained after freeze-drying is then thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and formed into a 1 mm thick plate. The molding is also carried out at a temperature of 95 ° C. The plate is then cut into fractions having a weight of about 74 mg. These fractions are then placed in plastic vials containing 2 ml of OXOID phosphate buffered saline and 0.32 phy sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release / Met<sup>-</sup> Serum G-CSF was determined by high-pressure liquid chromatography analysis of the collected medium and the cumulative amount of protein released was calculated for each time point (see FIG. 14).
Comparative Example 2
A sustained release pharmaceutical composition comprising / Met & lt; RTI ID = 0.0 & gt; Ser. & Lt; / RTI & gt;<sup>1</sup>?’<sup>2</sup>C-CSF and methyl-PPG 5000
Glacial acetic acid procedure
Formulation D (20% protein content)
120.66 mg of polylactide / 50% by weight of d, 1-lactide and 50% by weight of glycolide as a copolymer; weight average molecular weight 7673; polydispersity 2.59) is dissolved in 2.0 ml of glacial acetic acid. In addition, 3.935 ml of an aqueous solution / Met<sup>-1</sup>, Ser<sup>17,27</sup>The GCSF (10.0 mg / ml) was lyophilized and then dissolved in 2.0 ml of a solution containing 40.82 mg of methyl-PEG 5000 in glacial acetic acid. The two solutions are then mixed and two more 0.5 ml aliquots of glacial acetic acid are used to rinse the glass containers used. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is then thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and formed into a 1 mm thick plate at the same temperature. The plate is then cut into fractions having a weight of about 74 mg. These fractions are then placed in plastic vials containing 2 ml of OXOID phosphate buffered saline and 0.02% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer each time. The release of (Met, Ser) of G-CSF is determined by high-pressure liquid chromatography analysis of the collected medium and the cumulative amount of protein released is calculated for each time point (see FIG. 14).
Example 3 v
Sustained release pharmaceutical composition comprising PEG 5000- / met <sup>1</sup>, Glu<sup>17</sup>’<sup>27</sup>, Ala<sup>26,28</sup>, Lys<sup>3</sup>° -7hu G-CSF
Glacial acetic acid procedure
Formulation Ξ / 20% protein content /
120.34% polylactide / 50% by weight of d, l-lactide
50 and 50% glycolide in the form of a copolymer; weight average molecular weight 7673; polydispersity 2.59) is dissolved in 2.0 ml of glacial acetic acid. In addition, 3.738 ml of an aqueous solution of PEG 5000- Met<sup>-1</sup>, Glu<sup>1</sup>, Ser<sup>1</sup>? ', Ala<sup>2</sup>^’<sup>2S</sup>,
30— ~~ <sup>1</sup>
Lys (G-CSP (10.7 mg / ml)) from Comparative Example 8 was lyophilized and then dissolved in another 2.0 ml aliquot of glacial acetic acid. The two solutions are mixed and two more 0.5 ml aliquots of glacial acetic acid are used to rinse the glass containers used. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 85 ° C and then formed into a 1 mm thick plate at the same temperature. This plate is cut into fractions having a weight of approximately 70 mg. The obtained fractions are then placed in plastic vials containing 2 ml of OXU1D-FORFATE buffered saline and 0.02% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000 / Met-c-1 release<sup>1</sup> ^, Ser ^ '<sup>2</sup>^, Ala<sup>2</sup>^’<sup>2G</sup>, Lys<sup>3</sup>The G-CSF is determined by high-pressure liquid chromatography analysis of the collected medium and the cumulative amount of protein released is calculated for each time point.
Example 4
Sustained-release pharmaceutical composition containing PEG 5000- /<sup>-</sup>^<sup>-1</sup> , Arg<sup>1 1</sup> , Ser<sup>1 7,27</sup> ’<sup>60</sup>’<sup>65</sup>7-G-CSF
Glacial acetic acid procedure
Formulation F (20% protein content)
120.40 mg of polylactides / 57% by weight of d, 1-lactide and 50% by weight of glycolide as a copolymer; weight average molecular weight 7673, polydispersity 2.59) is dissolved in 2.0 ml glacial acetic acid. In addition, 3.478 ml of an aqueous solution of PEG 5000- Met<sup>-1</sup> Arg, Ser, 7, 27, 6, 65-7, g / ml (mg / ml) from Reference Example 7) is lyophilized and then dissolved in another 2.0 ml aliquot of glacial acetic acid. The two solutions are then mixed and two more 0.5 ml aliquots of glacial acetic acid are used to rinse the glass containers used. The resulting solution was immediately frozen in a dichloromethane / Brikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 85 ° C and then formed into a 1 mm thick plate at the same temperature. The plate is then cut into fractions having a weight of about 72 mg. These fractions were placed in plastic vials containing 2 ml of OXOID phosphate buffered saline and 0.02% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000 / Met release<sup>-</sup>', Arg'Ser'7'27 »q_qsp <sub>se</sub> It is determined by high pressure liquid chromatography analysis of a separate aqueous medium and the accumulated amount of protein released is determined from the results obtained for each time point at which the aqueous medium was collected (see Figure 18).
- Example 5
A sustained release pharmaceutical composition comprising PEG 5000-7β-G-CSF active
A. Glacial acetic acid procedure
120.11 mg of polylactides / 50% by weight of d, l-lactide
52 and 50% by weight of a glycolide in the form of a copolymer; wt-;
average molecular weight 5429; polydispersity
2.02) is dissolved in 20 ml of anhydrous glacial acetic acid. In addition, 3,736 ml of an aqueous solution of PEG 5000-:
The v-G-CSF is lyophilized and then dissolved in another
2.0 ml aliquot of glacial acetic acid. The two solutions are then mixed and an additional four 0.5 ml aliquots of glacial acetic acid are used to rinse the glass containers used. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 65 ° C and then formed into a 1 mm thick plate. This plate is cut into fractions having a weight of approximately 70 mg. The fractions obtained are placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in GXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and always replaced with fresh buffer. Release of PEG 5000- / Met<sup>-1</sup>7-G-CSF was determined by high pressure liquid chromatography analysis of a separate aqueous medium.
and the results obtained for each time period 'In the moments in which the aquatic environment was taken, it shall calculate | cumulated amounts of protein released / see below Table 1. |
IN"
B. Aqueous method 3 h,
4.0 g of polylactide / 50 wt% d, 1-lactide δ and 50 wt% glycolide in the form of a copolymer; weight% molecular weight 9429; polydispersity | '
2.02) was dissolved in 16.0 ml of dichloromethane and the solution was stirred under high shear stress conditions (homogenizer Ystral 1500). To this solution was added dropwise ml of an aqueous solution of sodium bicarbonate (20 mg / ml).
53 ml of distilled water are then added and a fine white dispersion is formed. The dichloromethane is then evaporated in a rotary evaporator. The dispersion obtained is immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. This sodium salt of the polymer is stored under vacuum at room temperature prior to use.
120.87 mg of sodium polymer salt are dispersed in 2.0 ml of distilled water. In addition, 3.732 ml of an aqueous solution of PEG 5383- / Met<sup>1</sup>The hu-CSF (13.7 mg / ml) was lyophilized and then dissolved in another 2.3 ml of distilled water. The resulting solution is added to the suspension and mixed. An additional four 0.5 ml aliquots of distilled water are used to rinse the glass containers used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 65 ° C and then formed into a plate having a thickness of 1 mm. This plate is cut into fractions having a weight of approximately 80 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000- / Met release<sup>-</sup>The G-CSF was determined by high pressure liquid chromatography analysis of a separate aqueous medium and the cumulative amount of protein released was calculated for each time point at which the aqueous medium was collected (see Table 1 below).
Example 6
Sustained-release pharmaceutical composition containing PEG 5333- /<sup>_</sup>Met<sup>_1</sup>, Ser<sup>1?</sup>7-G-CSF
A. Glacial acetic acid step 1
119.75 mg of polylactide / 50% by weight of 1,1-lactide and 50% by weight of glycolide as a copolymer; weight average molecular weight 9429; polydispersity í
2.02) is dissolved in 20 ml of anhydrous glacial acetic acid. In addition, 4.95 ml of an aqueous solution of PEG 5000 (Met, Ser 7hu G-CSF) (see Reference Example 13) (8.08 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of acetic acid. The two solutions were mixed and an additional four 0.5 cc aliquots of glacial acetic acid were used to wash the glass containers used. The solution obtained is immediately frozen in a dichloromethane / Lrikold bath and lyophilized
filies overnight.
The powder obtained after lyophilization is thoroughly mixed L using a hydraulic press with pressure plates heated to 65 ° C and then formed into a plate having a thickness of 1 mm. The plate is then cut into fractions having a weight of approximately 70 mg. The fractions obtained are placed in plastic vials containing 2.0 ml of 0.02%;
(w / v) sodium azide solution in OXOID phosphate buffered saline and stored at 37 ° C.
·/.'
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release of PEG 5000-? Met 1, Ser<sup>1</sup>The 7-G-CSF is determined by the analysis performed the cumulative amount of γ released protein is calculated for each time point at which the aqueous medium was separated (see Table 1 below).
S • 2 in '
B. Aqueous Way
1’;
V4.0 g of polylactide / 50 wt% d, 1-lactide No and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 9429; polydispersity
2.02) was dissolved in 16 ml of dichloromethane and the solution was stirred for 1.5 hours under high shear conditions (Ystral 1500 homogenizer). To the solution was added dropwise 4 mL of aqueous sodium bicarbonate solution (40 mg / mL). An additional 40 mL of distilled water was added to give a fine white dispersion. The dichloromethane was stripped off on a rotary evaporator. The dispersion obtained is immediately frozen in a dichloromethane / Brikold bath and lyophilized overnight. The sodium salt of the polymer is stored under vacuum at room temperature prior to use.
120.80 mg of sodium polymer salt are dispersed in 2.0 ml of distilled water. In addition, 4.95 ml of an aqueous PEG 5000- solution was seeded<sup>-1</sup> , Ser<sup>1 7</sup>The G-CSF (8.08 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of distilled water.
This solution is added to the suspension and mixed. An additional four 0.5 ml aliquots of distilled water are used to rinse the glass containers used. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 65 ° C and then formed into a 1 mm thick plate. The plate is then cut into fractions having a weight of approximately 80 mg. These fractions were placed in plastic vials containing 2.0 mL of a 0.02% (w / v) sodium azide solution in OXOIL phosphate buffered saline and then stored at 37 ° C.
The aqueous medium is separated at regular intervals and always replaced with fresh buffer. PEG 5000 / Met release<sup>-1</sup>, Ser<sup>17</sup>The G-CSP is determined by high pressure liquid chromatography analysis and the cumulative amounts of protein released are calculated for each time period in which the aqueous medium has been separated (see Table 1 below).
Example 7
Sustained release pharmaceutical composition effective
- 56 containing PEG 50θθ / Met<sup>-1 </sup>G-CSF irg ''<sup>16</sup>, ser ”.27.60,65 <sub>? hu</sub>
A. Glacial acetic acid procedure
120.72 mg of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 9429; polydispersity 2.02) is dissolved in 2.0 ml of anhydrous glacial acetic acid. In addition, 3.47 ml of an aqueous solution of PEG 5000 / Met<sup>1</sup>, Arg<sup>11</sup>’<sup>18</sup>, Ser<sup>1 7</sup> ’<sup>27</sup> ’<sup>80</sup> ’ <sup>85</sup>G-CSF (see Reference Example 19) (11.53 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid. The two solutions are mixed and four additional 0.5 ml aliquots of glacial acetic acid are used to rinse the glass containers used. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to a temperature of 65 Ca and then formed into a 1 mm thick plate. This plate is cut into fractions having a weight of approximately 65 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in OXOID phosphate buffered saline and stored at 37 ° C.
The aqueous media are separated at regular intervals and replaced with fresh buffer. PEG 5003 / Met release<sup>1</sup>, Arg<sup>11</sup>’<sup>18</sup>, Ser<sup>17,27,80,85</sup>The 7-G-CSF is determined by high pressure liquid chromatography analysis of a separate aqueous medium and the accumulated amount of protein released is calculated for each time point at which the aqueous medium was collected (see Table 1 below).
3. Aqueous Process i;
AND
AND
G.·
4.0 g of polylactide / 53% by weight d, 1-lactide and 50% by weight glycolide as a copolymer; weight average molecular weight 9429; polydispersity 2.02) is dissolved in 16.0 ml of dichloromethane and the resulting solution is stirred under high shear conditions (Ystral 1500 homogenizer). 4 ml of aqueous sodium bicarbonate solution (20 mg / ml) are added dropwise. An additional 40 ml of distilled water is added to the photom to form a fine white dispersion. The dichloromethane was stripped off on a rotary evaporator. The dispersion was immediately reversed in a dichloromethane / Drikola bath and lyophilized overnight. The sodium salt of the polymer is stored under vacuum at room temperature prior to use.
119.71 mg of said sodium polymer salt are dispersed in 2.0 ml of distilled water. In addition, 3.47 ml of an aqueous solution of PEG 5000-Met<sup>1</sup>, Arg<sup>11,1</sup>\ Ser<sup>1</sup>^’<sup>2</sup>? hu G-CSP (11.53 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of distilled water. This solution is added to the suspension and mixed. An additional four 0.5 ml aliquots of distilled water are used to rinse the glass containers used. The resulting solution was immediately frozen in a chichloromethane / Drikold bath and lyophilized overnight.
The sap obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 65 ° C and then formed into a 1 mm plate. This plate is cut into fractions having a weight of about 70 mg. These fractions were placed in plastic vials containing 2.0 mL of a 0.02% (w / v) solution of sodium azide in OXOID phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000 / Met release<sup>1</sup>, Arg<sup>11</sup>’<sup>1</sup> , Ser<sup>1</sup>> 60.65 → 7 G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the cumulative amount of released protein is calculated for each time point in which the aqueous medium has been separated.
58 A sustained release pharmaceutical composition comprising PEG 5000 - / Met<sup>-1</sup> , Arg<sup>11</sup>’<sup>23</sup>, p<sub>er</sub><sup>1</sup> 7.60.65 hu G-CSF (see Table 1 below).
Example 8
A. Glacial acetic acid procedure
120.11 mg of polylactide / 50% by weight of d, 1-lactide and 50% by weight of glycolide in the form of copolymers; weight average molecular weight 9429; Dissolve 2.02 / in 2.0 ml of anhydrous glacial acetic acid. In addition, 3.66 ml of an aqueous solution of PEG 5300 / Met \ Arg<sup>11</sup>’<sup>23</sup>, Ser<sup>1</sup> ? ’<sup>2</sup>The G-CSF (see Reference Example 14) (10.93 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid. The two solutions are mixed and four additional 0.5 ml aliquots of glacial acetic acid are used to rinse the glass containers used. The resulting solution was immediately frozen in a dichloromethane / Lrikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 65 ° C and then formed into a 1 mm thick plate. This plate is cut into fractions having a weight of approximately 80 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in OXOID phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 50000 / fMet release "<sup>1</sup>, Arg<sup>11</sup>’<sup>23</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>The 7-G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium, and from the results obtained for each time point in which the aqueous in the aqueous medium is separated.
- 59 medium, calculate the cumulated amounts of protein released (see Table 1 below).
B. Aqueous Way
4.0 g polylactide / 50 wt% glycolide and 50 wt% d, l-lactide as copolymer; weight average molecular weight 9429; polydispersity 2.02) is dissolved in 16 ml of dichloromethane and the solution is stirred under high shear conditions (Ystral 1503 homogenizer). 4 ml of an aqueous solution of sodium bicarbonate (20 mg / ml) was added dropwise to the solution. An additional 40 ml of distilled water was added and a fine white dispersion formed. The dichloromethane is then stripped off on a rotary evaporator. The dispersions were immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. The sodium salt of the polymer is stored under vacuum at room temperature prior to use.
120.71 mg of the sodium polymer salt are dispersed in 2.0 ml of distilled water. In addition, 3.66 ml of PEG 5000- aqueous solution.<sup>-</sup>Met<sup>-1</sup> , Arg<sup>11</sup>’<sup>23</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’°<sup>5</sup>_7hu G-CS? (10.93 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of distilled water. This solution is added to the suspension and mixed. To rinse the glass containers used, an additional four 0.5 ml aliquots of distilled water are used. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to a temperature of 65 Ca and then formed into a plate shape.
thickness 1 mm. The plate is then cut into fractions having a weight of approximately 70 mg. These fractions are then placed in plastic vials containing 1.0 ml of a 0.02% (w / v) solution of sodium azide in OXOID-phosphate buffered saline and stored at 37 ° C.
Repeats at regular intervals and always replaced with fresh buffer.
The aqueous release of PEG 5000-60 / Met was separated <sup>1</sup>, Arg<sup>11</sup>’<sup>23</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>The G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the accumulated amount of protein released is calculated for each time point at which the aqueous medium has been separated (see Table 1 below).
Example 9
Sustained-release pharmaceutical composition containing PEG 5900 / ~ Met '<sup>1</sup> , Arg<sup>11</sup>’<sup>34</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>6</sup>7-G-CSF
A. Glacial acetic acid procedure
120.65 mg of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 10691; polydispersity 1.75) is dissolved in 2.0 ml of anhydrous glacial acetic acid. In addition, 3.810 ml of an aqueous solution of PEG 5000 / Met<sup>1</sup>, Arg<sup>11</sup>’<sup>34</sup>, Ser<sup>17</sup>’<sup>27</sup>The G-CSF (see Reference Example 20) (10.5 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid. The two solutions are mixed and four additional 0.5 ml aliquots of glacial acetic acid are used to rinse the glass containers used. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with press plates heated to 90 ° C and then formed into a 1 mm plate. The plate is then cut into fractions having a weight of approximately 70 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) solution of sodium azide in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals
- 61 and always replaced with fresh buffer. PEG 5000- / Release<sup>-</sup>Met, Arg<sup>11</sup>'^ ^, Ser<sup>1</sup>7 ’ <sup>2</sup>7 > 60,65_7h<sub>at</sub> j.ggp <sub>se</sub> is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the cumulative amount of released protein is calculated from the results obtained for each time point at which the aqueous medium has been separated (see Table 1 below).
3. Water way
5.0 g of polylactide / 50% by weight of d, 1-lactide and 50% by weight of glycolide in the form of a copolymer; weight average molecular weight 10691; polydispersity 1.75) is dissolved in 20 ml of dichloromethane and the resulting solution is stirred under high shear stress conditions (Ystral 1500 homogenizer). To the solution was added dropwise 5 ml of an aqueous solution of sodium bicarbonate (20 mg / ml). Add another 50 ml of water to make fine
e. The dispersion is freeze-dried and lyophilized before the actual chloromethane is stripped off on a rotary evaporator and frozen in a dichloromethane bath overnight. This sodium salt of the polymer of use is stored under vacuum at room temperature.
120.15 mg of this sodium polymer salt are dispersed in 2.0 ml of distilled water. In addition, 3.810 ml of an aqueous solution of PEG 5000-<sup>-</sup>Met <sup>1</sup>, Arg<sup>11</sup>'^^, Ser<sup>1</sup>The G-CSF (10.5 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of distilled water. This solution is then added to the suspension and mixed. An additional four 0.5 ml aliquots of distilled water are used to rinse the chemical glass used. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with press plates heated to 90 ° C and then formed into a 1 mm thick plate. The plate is then cut into fractions having a weight of approximately 75 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in CXCID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000 / Eet release<sup>1</sup>, Arg<sup>11</sup>'34, Ser<sup>17</sup>’<sup>27</sup>The G-CSF was determined by high pressure liquid chromatography analysis of the separated aqueous medium and the accumulated amounts of released protein were calculated for each time point at which the aqueous medium was separated (see Table 1 below).
Example 10
Sustained-release pharmaceutical composition comprising PEG 5000 - / Eet<sup>-1</sup>, Arg<sup>11</sup>’<sup>40</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>6</sup> ^ 7hu G-CSF
A. Procedure with glacial acetic acid 1 µl
120.74 mg of polylactides / 50% by weight of d, 1-lactide and 50% by weight of glycolide in the form of copolymers; mass- .
its average molecular weight 10691; polydispersity 1.75 / se is dissolved in 2.0 ml of anhydrous glacial acetic acid. In addition, 3.77 ml of an aqueous solution of PEG 5000-7 / Me<sup>1</sup>, Arg<sup>11</sup>’<sup>40</sup>, Ser<sup>17,27</sup>’<sup>to0</sup>’<sup>65</sup>The G-CSF (see Reference Example 21) (10.6 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid. Both of these solutions. (4) A further 0.5 ml aliquot of glacial acetic acid was used to rinse the chemical glass used. . £
The solution obtained is immediately frozen in a dichloromethane bath
methane / Drikold and lyophilized overnight. / v
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and then formed into a plate shape o;
thickness 1 mm. This plate is then chopped into fractions r «»
63 having a weight of about 65 mg. These fractions are then placed in plastic vials containing 2.3 ml of a 3.02% (w / v) solution of sodium azide in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5333 / Met \ Arg release<sup>11</sup>’<sup>4</sup>^, g<sub>er</sub>17.27, o 3.65_j7j,<sub>at</sub> g.ggp <sub>se</sub> is determined by high pressure liquid chromatography analysis of a separate aqueous medium and the cumulative amount of protein released is calculated for each time point at which the aqueous medium was collected (see Table 1 below).
B. Aqueous Way
5.0 g of polylactide / 53% by weight of d, 1-lactide and 50% by weight of glycolide as a copolymer; weight average molecular weight 13691; polydispersity 1.75) is dissolved in 20 ml of dichloromethane and the resulting solution is stirred under high shear conditions (Ystral 1530 homogenizer). To the solution was added dropwise 5 ml of an aqueous solution of sodium bicarbonate (20 mg / ml). An additional 50 mL of distilled water was added and a fine white dispersion formed. The dichloromethane was stripped off on a rotary evaporator. The dispersions were immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. The sodium salt of the polymer is stored under vacuum at room temperature prior to use.
120.20 mg of sodium polymer salt are dispersed in 2.0 ml of distilled water. In addition, 3.77 ml of an aqueous solution of PEG 5300 / et.<sup>1</sup> , Arg<sup>11,40</sup>, Ser<sup>17</sup>’<sup>27</sup>’°<sup>3</sup>’<sup>65</sup>The G-CSP (13.6 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of distilled water. This solution is then added to the suspension and mixed thoroughly. X Another four 3.5 ml aliquots of distilled water are used to rinse the chemical glass used. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and then formed into a 1 mm thick plate. The plate is then cut into fractions having a weight of approximately 72 mg. These fractions are then placed in plastic vials containing 2.3 ml of a 0.32% (w / v) sodium azide solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000 / Met release<sup>1</sup>, Arg<sup>11</sup>’<sup>40</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>The G-CSF was determined by high pressure liquid chromatography analysis of the separated aqueous medium and the cumulative amount of protein released was calculated for each time point at which the aqueous medium was separated (see Table 1 below).
Example 11
Sustained-release pharmaceutical composition containing PEG '5330- /<sup>-</sup>Met <sup>1</sup>, Ala<sup>1</sup>, Thr<sup>3</sup>, Tyr<sup>4</sup>, Arg<sup>5,11 </sup>Ser<sup>17,27,60,65</sup> 7hu G-CSF
A. Glacial acetic acid procedure
119.79 ng polylactide / 60% d, 1-lactide and 50% glycolide in the form of a copolymer; weight average molecular weight 10691; polydispersity 1.75) is dissolved in 2.0 ml of anhydrous glacial acetic acid. In addition, 3.175 nl of an aqueous solution of PEG 5000 / "Met"<sup>1</sup>, Ala<sup>1</sup>, Thr<sup>3</sup>, Tyr<sup>4</sup>, Arg<sup>5</sup>’<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>The GCSF (see Reference Example 22) (12.6 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid.
An additional four 0.5 ml aliquots of glacial acetic acid are used to rinse the chemical glass used. The resulting solution was immediately frozen in a dichloromethane / lricold bath and lyophilized overnight.
The farce obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and then formed into a 1 mm thick plate. The plate is then chopped into fractions having a weight of approximately 0 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in 1xIT-fo state buffered saline and stored at 37 ° C.<sup>AT</sup>C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release of PEC-5000 / idet<sup>1</sup> , Ala<sup>1</sup>, Thr<sup>3</sup>, Tyr<sup>4</sup>, Arg<sup>5</sup>’<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’°<sup>5</sup>7h GCSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the cumulative amount of protein released is calculated for each time point at which the aqueous medium has been separated (see Table 1 below).
B. Aqueous Way
5.0 g of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 10691; polydispersity 1.75) is dissolved in 20 ml of dichloromethane and the resulting solution is stirred under high shear stress conditions (Ystral 1500 homogenizer). To this solution was added dropwise 5 ml of an aqueous solution of sodium bicarbonate (20 mg / ml). An additional 50 ml of distilled water is added and a fine white dispersion is formed. The dichloromethane is then stripped off on a rotary evaporator. The dispersions were immediately frozen in a dichloromethane / Lrikold bath and lyophilized overnight. The sodium polymer salt is stored under vacuum at ambient temperature prior to use.
119.67 mg of the sodium polymer salt are dispersed in 2.0 ml of distilled water. In addition, 3.175 ml of an aqueous solution of PEG 5030- / Met<sup>-1</sup>, Ala<sup>1</sup>, Thr<sup>3</sup>, Tyr<sup>4</sup>, Arg<sup>5</sup>’<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>_7hu G-CS? (12.6 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of distilled water. This solution is added to the suspension and mixed. An additional four 0.5 ml aliquots of distilled water are used to rinse the chemical glass used. The resulting solution was immediately frozen in a dichloromethane / Lrikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and then formed into a plate in a
1 mm thick. The plate is then cut into fractions having a weight of approximately 90 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in OXOIB-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release PEG 5000 / ~~ Met ”<sup>1</sup> , Ala<sup>1</sup>, Thr<sup>3</sup>, Tyr<sup>4</sup>, Arg<sup>5</sup>’<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>The GCSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium, and the accumulated amount of protein released is calculated from the results obtained for each time the aqueous medium has been separated (see Table 1 below).
Example
Sustained-release pharmaceutical composition comprising PEG 5000 - / met<sup>_1</sup>, Glu<sup>15</sup>, Ser<sup>17</sup>’^<sup>7</sup>, Ala<sup>26</sup>’<sup>28 </sup>Arg<sup>3</sup>° -7hu G-CSF
A. Glacial acetic acid procedure
120.25 mg of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 10691; polydispersity
- 67 1.75 / dissolve! in 2.0 ml of anhydrous glacial acetic acid. In addition, 2.699 ml of PEG 5000 / Met<sup>1</sup>, Glu<sup>15</sup>, Ser<sup>17,27</sup>, Ala<sup>26</sup>’<sup>28</sup>, Arg<sup>3</sup>(G-CSP) (see Reference Example 15) (13.6 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid. The two solutions are mixed and four additional 0.5 ml aliquots of glacial acetic acid are used to rinse the chemical glass used. The resulting solution was immediately frozen in a dichloromethane / Erikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with press plates heated to 90 ° C and then formed into a 1 mm thick plate. The plate is then chopped into fractions having a weight of approximately 100 mg. These fractions are then placed in plastic vials containing 2.0 ml of 0.02% (w / v) sodium azide in OXGIE-phosphate buffered saline and stored at 37 ° C.<sup>AT</sup>C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Releasing PeG 5000 / “Met”<sup>1</sup>, Glu<sup>15</sup>, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>26</sup>’<sup>28</sup>, Arg<sup>3</sup>The G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the amount of cumulative released protein is calculated for each time point at which the aqueous medium has been separated (see Table 1 below).
3. Water way
5.1 g of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 10691; polydispersity 1.75) is dissolved in 20 ml of dichloromethane and the resulting solution is stirred under high shear stress conditions (Ystral 1500 homogenizer). To this solution was added dropwise 5 ml of an aqueous solution of sodium bicarbonate (20 mg / ml). Add 5 more! A white fine dispersion is formed. The dichloromethane is then stripped off on a rotary evaporator. The dispersions were immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. This sodium salt is stored under vacuum at room temperature prior to use.
120.37 mg of this sodium polymer salt are dispersed in 2.0 ml of distilled water. In addition, 2.899 ml of an aqueous solution of Pie 5000- / met, C-±, Ser ', Ala', Arg / hu G-CSF (13.2 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of distilled water. This solution is added to the suspension and mixed. To rinse the chemical glassware used, an additional four 0.5 ml aliquots of distilled water are used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and then formed into a 1 mm thick plate. The plate is then chopped into fractions having a weight of approximately 100 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% solution (w / v) of sodium azide in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and always replaced with fresh buffer. Release of PEG 5000 / Met<sup>1</sup>, Glu<sup>15</sup>, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>26</sup>’<sup>28</sup>, Arg<sup>3</sup>° _7hu G-CS? is determined by HPLC analysis and the cumulative amount of protein released is calculated for each time point in which the aqueous medium has been separated (see Table 1 below).
Example 13
Sustained-release pharmaceutical composition comprising PEG 5000- / 7β-G-CSF <sub>3e</sub>r '<sup>7</sup>-<sup>27</sup>><sup>5</sup>-<sup>6</sup>“Glu”
A. Glacial acetic acid procedure
123.83 mg of polylactide / 53% by weight of d, 1-lactide and 53% by weight of glycolide in the form of copolymers; weight average molecular weight 13691; dissipation 1.75) is dissolved in 2.3 ml of anhydrous glacial acetic acid. In addition, 3.333 ml of an aqueous solution of PEG 5303 / MeT<sup>1</sup> , Ser<sup>17</sup> ’<sup>27</sup> ’<sup>11 5</sup>’<sup>11 6</sup>, Glu<sup>111</sup>The G-CSF (see Reference Example 16) (12.3 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid. The two solutions were mixed, and another four 3.5 ml aliquots of glacial acetic acid were used to rinse the chemical glass used. The resulting solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with heated pusher plates at a temperature of 93 ° C and then formed into a 1 mm thick plate. The plate is then cut into fractions of approximately 95 mg. The fractions are then placed in plastic vials containing 2.0 liters of a 3.32 $ solution (w / v) sodium azide in OXOID-phosphate buffered saline and stored at temperature 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5033 release<sup>1</sup> , Ser<sup>1 7</sup>’ <sup>27</sup> ’<sup>1 1 5</sup> ’<sup>1 1 6</sup>, Glu<sup>111</sup> The 7-G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the cumulative amount of protein released is calculated for each time point at which the aqueous medium has been separated (see Table 1 below).
B. Aqueous Way
5.3 g of polylactide / 53% by weight of d, 1-lactide and 50% by weight of glycolide in the form of copolymers; weight average molecular weight 13691; poiydispersita
- 70 1.75 (S5 is dissolved in 20 ml of dichloromethane and the solution is stirred under high shear stress conditions (Ystral 1500 homogenizer). To the solution was added dropwise 5.0 mL of aqueous sodium bicarbonate solution (20 mg / mL). An additional 50 mL of distilled water was added and a fine white dispersion formed. The dichloromethane was stripped off under reduced pressure in a rotary evaporator. The dispersions were immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. This sodium polymer chamber is stored under vacuum at room temperature prior to use.
119.83 mg of the sodium polymer salt is dispersed in 2.0 ml of distilled water. In addition, 3.333 ml of an aqueous solution of PEG 5000 - / Μβΐ<sup>-1</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>11 5</sup>’<sup>1 1 6</sup>, Glu<sup>11l</sup>The G-CSF (12.0 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of distilled water. This solution is then added to the suspension and mixed. An additional four 0.5 ml aliquots of distilled water are used to rinse the chemical glass used. The solution was then immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powders obtained after lyophilization were thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and then formed into a 1 mm thick plate. The plate is then cut into fractions having a weight of approximately 95 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000 / _ Met, Ser ^ 7,27,11 δ> 11 β q ^ release<sub>at</sub>11 The 7-hour G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the cumulative amount of protein released is calculated for each time point at which the aqueous medium has been separated (see Table 1 below).
Example 14 Substances Containing PEG 5000 - / Met<sup>-1</sup> , Arg<sup>11, l</sup>°<sup>5</sup>,
Ser<sup>17,27</sup>, a sustained release pharmaceutical composition comprising Lys<sup>5S</sup>7-G-CSF
A. Glacial acetic acid procedure
119.28 mg of polylactides / 50% by weight of d, 1-lactide and 50% by weight of glycolide as a copolymer; weight average molecular weight 10691; polydispersity 1.75) is dissolved in 2.0 ml of anhydrous glacial acetic acid. In addition, 2.224 ml of an aqueous PEG 5000 solution was added<sup>1</sup>, Arg<sup>11</sup>’<sup>165</sup>, Ser<sup>17</sup>’^<sup>7</sup>, Lys<sup>?8</sup>The G-CSF (17.905 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid. The two solutions are mixed and four additional 0.5 ml aliquots of glacial acetic acid are used to rinse the chemical glass used. The resulting solution was immediately frozen in a dichloromethane / Zrikold bath and lyophilized overnight.
The sap obtained after lyophilization is thoroughly mixed using a hydraulic press with press plates heated to 90 ° C and then formed into a 1 mm thick plate. The plate is then chopped into fractions having a weight of approximately 100 mg. These fractions are then placed in plastic vials containing 2.0 ml of 0.027 solution (w / v) sodium azide in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release of PZG 5000 / ~ Met<sup>1</sup>, Arg<sup>11</sup>’<sup>165</sup>, Ser<sup>17</sup>’<sup>27</sup>, Lys<sup>5b</sup>The 7-G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the accumulated amounts of protein released are calculated for each time point at which the aqueous medium has been separated (see Table 1 below).
B. Aqueous Way
5.0 g of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 10691; polydispersity 1.75) was dissolved in 20 ml of dichloromethane and placed in a high shear mixer (Ystral 1530 homogenizer). To the solution was added dropwise 5.0 mL of aqueous sodium bicarbonate (23 mg / mL). An additional 53 mL of distilled water was added and a fine white dispersion formed. The dichloromethane was stripped off on a rotary evaporator. The dispersions were immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. The sodium salt of the polymer is stored under vacuum at room temperature prior to use.
119.82 of the sodium polymer salt is dispersed in
2.3 ml of distilled water. In addition, 2.224 ml of an aqueous solution of PEG 5300 / Met \ Arg<sup>11</sup>*<sup>185</sup>, Ser<sup>17</sup>’<sup>27</sup>, Lys<sup>5</sup>\ _7hu G-CS? (17.585 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of distilled water. This solution is added to the suspension and mixed. An additional four 0.5 ml aliquots of distilled water are used to rinse the chemical glass used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and then formed into a plate with a thickness of about 1 mm. The plate is then cut into fractions having a weight of approximately 93 mg. These fractions were then placed in plastic vials containing 2.0 mL of a 0.02% (w / v) solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5300zfMet release<sup>1</sup>, Arg<sup>11</sup>’<sup>185</sup>, Ser<sup>17</sup>’<sup>27, Lys5 &</sup>The 7-G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the accumulated amount of protein released is calculated for each time point at which the aqueous medium has been separated (see Table 1 below).
Example 15
Sustained-release pharmaceutical composition comprising PEG 5000-7, Ser<sup>17</sup>’<sup>27</sup>, Lys<sup>49,5</sup>°, Ala<sup>44</sup>’<sup>51</sup>’<sup>55</sup> 7hu G-CSF
- 73 A. Glacial acetic acid procedure
119.83 mg of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide as a copolymer; weight average molecular weight 10691; polydispersity 1.75) is dissolved in 2.0 ml of anhydrous glacial acetic acid. In addition, 2.317 ml of an aqueous solution of PEG 5000 / "Met"<sup>1</sup>, Ser<sup>17</sup>»<sup>27</sup>, Lys<sup>45,58</sup>, Ala<sup>44</sup>’<sup>51</sup> ’<sup>55</sup>The G-CSF (see Reference Example 18) (17.262 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid. The two solutions are mixed and a further four 0.5 ml aliquots of glacial acetic acid are used to rinse the chemical glassware used. The solution was immediately frozen in a dichloromethane / Lrikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pusher plates heated to 90 ° C and then formed into a plate having a thickness of 1 mm. This plate is cut into fractions having a weight of approximately 100 mg. These fractions are then placed in plastic vials containing 2.0 mL of a 0.02: 0 solution (w / v) in OXGTD-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG / Met release<sup>-1</sup> ,> er
17.27 τ 49.55 Lys '',
Ala <sup>44</sup>’<sup>5</sup>1’<sup>55</sup> 7hu GC:
5OOOF se
- 74 is determined by HPLC analysis of the separated aqueous medium, and the cumulative amount of protein released is calculated for each time period in which the aqueous medium has been separated (see Table 1 below).
3. Water way
5.0 g of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 10691; polydispersity 1.75) was dissolved in 20 ml of dichloromethane and the resulting solution was stirred under high shear conditions (Ystral 1500 homogenizer). Add another 5θ ml of distilled water and form a fine white dispersion. The dichloromethane was stripped off on a rotary evaporator. The dispersions were immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. The sodium salt of the polymer is stored under vacuum at ambient temperature prior to use.
120.82 mg of said sodium polymer salt are dispersed in 2.0 ml of distilled water. In addition, 2.17 ml of an aqueous solution of PEG 5000- /<sup>-</sup>Met<sup>-1</sup> , Ser<sup>17</sup>’<sup>27</sup>, Lys<sup>49,58</sup>, Ala<sup>44,51</sup>’<sup>55</sup>The G-CSF (17.262 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of distilled water. This solution is added to the suspension and mixed. An additional four 0.5 ml aliquots of distilled water are used to rinse the chemical glass used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after freeze-drying is thoroughly mixed using hydraulic pressure with pressure plates heated to 95 ° C and then formed into a plate having a thickness of 1 mm. The plate is then chopped into fractions having a weight of approximately 100 mg. These fractions were then placed in plastic vials containing 2.0 mL of a 0.02% (w / v) sodium azide solution in CXO1D-phosphate.
- 75 buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000/5000 release<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>, Lys<sup>45</sup>’<sup>53</sup>, Ala<sup>44</sup> ’<sup>51</sup> ’ <sup>55</sup>The 7-G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the accumulated amount of protein released is calculated for each time point at which the aqueous medium has been separated (see Table 1 below).
Example 16
Sustained-release pharmaceutical composition comprising PEG 750- / i.et<sup>1</sup> , Arg<sup>11</sup>, Ser<sup>1 7</sup>’ <sup>27 Mar: 5 č0</sup>’<sup>ó5</sup>7-G-CSE
Glacial acetic acid procedure
150.11 mg of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 10691; polydispersity 1.75) is dissolved in 2.0 ml of anhydrous glacial acetic acid. In addition, 4.676 ml of an aqueous solution of PEG 750 / Met<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>1 7</sup>’<sup>27</sup> ’’ <sup>3;></sup>The G-CSE (see Reference Example 24) (6.55 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid. The two solutions are mixed and four additional 0.5 ml aliquots of glacial acetic acid are used to rinse the chemical glassware used. The solution was immediately frozen in a dichloromethane / Prikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 90 ° C. <sub>and</sub> doťot <sub>+</sub> The plate is shaped like a plate having a thickness of 1 mm. This plate is cut into fractions having a weight of approximately 75 mg. These fractions are then treated
- 76 are placed in plastic vials containing 2.0 e1 of a 0.02% solution (w / v) of sodium azide in OXOID-phosphate-buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release of FEG 750 / et<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>1 7,27</sup>The G-CSF was determined by high pressure liquid chromatography analysis of the separated aqueous medium, and the accumulated amount of protein released was calculated for each time point at which the aqueous medium was separated (see Table 1 below).
Example 17
Sustained-release pharmaceutical compositions contain PEG 2000- / meth<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>7-G-CSF
A. Glacial acetic acid procedure
140.32 mg polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 10691; polydispersity 1.75) is dissolved in 2.0 ml of anhydrous glacial acetic acid. In addition, 4,695 ml of aqueous PEG 2000 / Met solution '<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>1 7</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>The G-CSF (6.52 mg / ml) was filtered and then dissolved in an additional 2.0 ml of glacial acetic acid. The two solutions are mixed and four additional 0.5 ml aliquots of glacial acetic acid are used to rinse the chemical glassware used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 90 ° C and then formed into a 1 mm thick plate. The plate is then cut into fractions having a weight of approximately 70 mg. These fractions are placed in plastic vials containing 2.3 µl of a 0.02% (w / v) sodium azide solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 2000 / Met release<sup>-1</sup> , Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>The G-CSF was determined by high pressure liquid chromatography analysis of the separated aqueous medium and the accumulated amount of protein released was calculated for each time point at which the aqueous medium was separated (see Table 1 below).
3. Water way
5.0 g of polylactides / 50% by weight of d, 1-lactide and 50% by weight of glycolide in the form of copolymers; weight average molecular weight 10691; polydispersity 1.75) is dissolved in 20 ml of dichloromethane and the solution is stirred under high shear conditions (Ystral 1500 homogenizer). To the solution was added dropwise 5.0 mL of aqueous sodium bicarbonate solution (20 mg / mL). An additional 50 ml of distilled water is added and a fine white dispersion is formed. The dichloromethane was stripped off on a rotary evaporator. The dispersions were immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. This sodium salt is stored under vacuum at room temperature before use.
140.85 mg of said sodium polymer salt are dispersed in 2.0 ml of distilled water. In addition, 4,695 µl of an aqueous solution of PEG 2000 - / met<sup>-1</sup> , Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’°<sup>5</sup>The G-CSF (0.25 mg / ml) is lyophilized and then dissolved in an additional 2.0 ml of distilled water. This solution is added to the suspension and mixed. A further four 0.5 oil aliquots of distilled water are used to rinse the chemical glass used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed
- 7δ using a hydraulic press with pusher plates heated to a temperature of 90 ° C and then forming into a 1 mm thick plate. This plate is cut into fractions having a weight of approximately 70 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release of PSG 2000 / Met<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>The 7-G-CSF is determined by high pressure liquid chromatography analysis and the cumulative amount of protein released is calculated for each time point at which the aqueous medium has been separated (see Table 1 below).
- 79 Table ΙΑ
Release of G-CSF analogs from 1: 1 lactido-glycolide copolymer pharmaceutical formulations
<td>Example c ·</td><td>Process</td><td>Content protein % wt.</td><td>Content polymer % wt.</td><td>Number polymer /</td><td>Temperature pressing / ° 0 /</td>
<td>5A</td><td>GAA</td><td> 16,26</td><td> 48,81</td><td> 310</td><td> 65</td>
<td> 53</td><td>Aq</td><td> 1 6,1 6</td><td> 48,83</td><td> 310</td><td> 65</td>
<td>6A</td><td>GAA</td><td>1 b, 89</td><td> 50,56</td><td> 310</td><td> 65</td>
<td> 63</td><td>Aq</td><td> 16,84</td><td> 50,87</td><td> 310</td><td> 65</td>
<td>7A</td><td>GAA</td><td> 17,49</td><td> 52,79</td><td>Ji 0</td><td> 65</td>
<td> 73</td><td>Aq</td><td> 17,65</td><td> 52,82</td><td> 310</td><td> 65</td>
<td>OA '; i</td><td>GAA</td><td> 16,94</td><td> 50,88</td><td> 310</td><td> 65</td>
<td> 83</td><td>Aq</td><td> 1 6,88</td><td> 50,95</td><td> 310</td><td> 65</td>
<td>9A</td><td>GAA</td><td> 16,54</td><td> 49,87</td><td> 312</td><td>0 Λ ✓ v</td>
<td> 93</td><td>Aq</td><td> 16,60</td><td> 49,87</td><td> 312</td><td> 90</td>
<td>1 OA</td><td>GAA</td><td> 16,49</td><td> 49,77</td><td> 312</td><td> 35</td>
<td>1 OB</td><td>Aq</td><td> 15,73</td><td> 47,27</td><td> 312</td><td> 95</td>
<td>1 1A</td><td>GAA</td><td> 15,23</td><td> 45,60</td><td> 312</td><td> 95</td>
<td>1 1B</td><td>Aq</td><td> 14,87</td><td> 44,48</td><td> 312</td><td> 95</td>
<td>12A</td><td>GAA</td><td> 1 6,08</td><td> 48,35</td><td> 312</td><td> 90</td>
<td> 123</td><td>Aq</td><td> 16,12</td><td> 48,52</td><td> 3'2</td><td> 8 5</td>
<td>13A</td><td>GAA</td><td> 16,51</td><td>zc; C; > J></td><td> 312</td><td>C <sup>Λ</sup>·</td>
<td> 1 33</td><td>Aq</td><td> 16,38</td><td> 49,06</td><td> 312</td><td> 95</td>
<td>14A</td><td>GAA</td><td> 16,19</td><td> 48,27</td><td> 312</td><td>r- λ 7</td>
<td> 1 43</td><td>Aq</td><td> 15,92</td><td> 47,66</td><td> 312</td><td> 9 5</td>
Table IA / continued /
<td>1 5A</td><td>GAA</td><td> 15,63</td><td> 46,81</td><td> 312</td><td> 90</td>
<td> 1 53</td><td>Aq</td><td> 15,06</td><td> 45,48</td><td> 312</td><td> 95</td>
<td> 16</td><td>GAA</td><td> 19,17</td><td> 71 ,95</td><td> 312</td><td> 90</td>
<td>17A</td><td>GAA</td><td> 17,30</td><td> 60,93</td><td> 312</td><td> 90</td>
<td> 173</td><td>Aq</td><td> 17,56</td><td> 62,62</td><td> 312</td><td> 90</td>
The abbreviations GAA and Aq refer to the glacial acetic acid process and the aqueous process.
Table 13
<td>Speed</td><td>release</td><td colspan="3">protein from above</td><td>maceutic-</td>
<td colspan="6">compositions</td>
<td>Example</td><td colspan="2">Percentage</td><td>quantity</td><td colspan="2">The protein is released</td>
<td>C.</td><td>the day</td><td></td><td></td><td></td><td></td>
<td></td><td> 1</td><td> 4</td><td> 6</td><td> 11 16</td><td> 18</td>
<td>5A</td><td> 27,1</td><td> 36,5</td><td> 37,1</td><td> 37,5 37,5</td><td> 37,5</td>
<td> 53</td><td> 33,3</td><td> 37,5</td><td> 36,6</td><td> 39,1 40,1</td><td> 40,1</td>
<td>6A</td><td> 77,0</td><td> 96,4</td><td> 102,7</td><td> 106,7 111,3</td><td> 112,9</td>
<td>7A</td><td> 42,5</td><td> 55,9</td><td> 60,4</td><td> 64,5 67,9</td><td> 70,8</td>
<td> 73</td><td> 46,5</td><td> 59,5</td><td> 65,3</td><td> 74,5 60,7</td><td> 61,5</td>
<td>8A</td><td> 50,3</td><td> 66,4</td><td> 72,4</td><td> 76,2 65,2</td><td> 66,6</td>
<td> 83</td><td> 55,5</td><td> 76,4</td><td> 64,6</td><td> 87,6 69,5</td><td> 90,1</td>
- 81 Table IB / continued /
<td rowspan="2"></td><td colspan="6">Percentage of protein released</td>
<td>ke čni 1</td><td> 4</td><td> 8</td><td> 1 1</td><td> 15</td><td> 18</td>
<td>9A</td><td> 16,2</td><td> 21 ,8</td><td> 24,6</td><td> 40,1</td><td> 43,9</td><td></td>
<td>9B</td><td> 27,2</td><td> 37,3</td><td> 41,6</td><td> 45,0</td><td> 54,1</td><td></td>
<td>1 OA</td><td> 29,6</td><td> 41 ,3</td><td> 46,2</td><td></td><td></td><td></td>
<td> 1 03</td><td> 33,8</td><td> 51 ,1</td><td> 59,9</td><td> 64,6</td><td> 69,3</td><td></td>
<td>1 1A</td><td> 45,9</td><td> 60,1</td><td> 65,7</td><td></td><td></td><td></td>
<td>1 1B</td><td> 42,0</td><td> 66,0</td><td> 72,9</td><td> 74,6</td><td></td><td></td>
<td></td><td>Proceň</td><td>tické</td><td>amount</td><td colspan="3">protein released</td>
<td></td><td>the day</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> 1</td><td> 3</td><td> 8</td><td> 1 1</td><td> 15</td><td> 18</td>
<td>1 2A +</td><td> 56,3</td><td> 84,4</td><td> 99,4</td><td> 99,4</td><td></td><td></td>
<td> 123+</td><td> 51,7</td><td> 74,9</td><td> 89,3</td><td> 93,8</td><td> 99,2</td><td></td>
<td>13A +</td><td> 37,3</td><td> 67,7</td><td> 85,8</td><td> 1 08,6</td><td></td><td></td>
<td> 133</td><td> 36,2</td><td> 75,7</td><td> 95,2</td><td> 104,0</td><td> 105,2</td><td></td>
<td>1 4A +</td><td> 28,6</td><td> 47,2</td><td> 55,6</td><td> 74,3</td><td></td><td></td>
<td> 1 43+</td><td> 24,2</td><td> 48,3</td><td> 61 ,0</td><td> 77,8</td><td> 81 ,6</td><td></td>
<td>1 5A +</td><td> 58,1</td><td> 84,4</td><td> 96,0</td><td> 96,2</td><td></td><td></td>
<td> 1 53+</td><td> 50,3</td><td> 111,3</td><td> 127,2</td><td> 129,7</td><td> 131 ,9</td><td> 132,3</td>
<td></td><td colspan="2">Percentage</td><td>amount</td><td colspan="3">protein released</td>
<td></td><td>the day</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> 1</td><td>/ 1 T</td><td> 8</td><td> 1 1</td><td> 15</td><td> 18</td>
<td> 16</td><td> 6,2</td><td> 6,7</td><td> 6,8</td><td> 6,9</td><td> 6,9</td><td> 6,9</td>
<td>17A</td><td> 22,6</td><td> 32,7</td><td> 41 ,0</td><td> 43,1</td><td> 45,6</td><td> 46,5</td>
<td> 173</td><td> 26,2</td><td> 36,3</td><td> 42,8</td><td> 44,8</td><td> 48,2</td><td> 49,3</td>
HERE
- 82 +/
Example 18
Sustained-release pharmaceutical composition comprising PEG 5000 -<sup>1</sup> , Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>7hu G-CSF / lactide: glycolide = 80: 20 /
A. Glacial acetic acid procedure (protein content 5,52 $)
158.91 mg of polylactide / 80% by weight of d, 1-lactide and 20% by weight of glycolide in the form of copolymers; a weight average molecular weight of 7952; Dissolve 2.01) in 2.0 ml of anhydrous glacial acetic acid. In addition, 41.90 mg of lyophilized preparation PEG 5000 - / Eet<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>č5</sup>Dissolve G-CSF in an additional 2.0 mL of glacial acetic acid. Mix both solutions and rinse the used chemical glass with an additional four 0.5 ml aliquots of glacial acetic acid. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with press plates heated to 75 ° C and then formed into the above mentioned test fractions having a weight of approximately 80 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% solution (w / v) in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5300 / met<sup>-1</sup>, Arg<sup>11</sup>, Ser<sup>1 7</sup> ’<sup>27</sup> ’ ’ ^<sup>>></sup>The 7-G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the accumulated amount of protein released is calculated for each time point at which the aqueous medium has been separated.
Protein release from pharmaceutical formulation
Day_Reset /% /
<td> 1</td><td> 10,41</td>
<td> 4</td><td> 17,36</td>
<td> 7</td><td> 21 ,73</td>
<td> 1 1</td><td> 24,47</td>
<td> 14</td><td> 27,67</td>
<td> 18</td><td> 30,69</td>
Example 19
Sustained-release pharmaceutical composition containing PEG 5000- / Met <sup>1</sup>,
Arg '(17,27,60,65).
hu G-CSF (SO% polylactido-glycolide 50:50 and 20% methylpolyethylene glycol 2000_)
A. Procedure with glacial acetic acid (5.23% protein content)
The 159.87 hydrogel (80.7 wt% d, 1-lactidoglycolide copolymer, 19.3 wt% MePEG 2000) was dissolved in 2.0 ml anhydrous glacial acetic acid. In addition, 4b, 26 mg of lyophilized PEG 5000 - / Met<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>b5</sup>7-G-CSF (26.46% protein) was dissolved in an additional 2.0 mL of glacial acetic acid. The two solutions are mixed and four additional 0.5 µl aliquots of glacial acetic acid are used to rinse the chemical glassware used. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 60 ° C and then formed into the above-described test fractions having a weight of approximately 80 mg.
These fractions were then placed in plastic vials containing 2.0 ml of a 0.1% (w / v) sodium azide solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000 release / I.:et<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’’^<sup>5</sup>The 7-G-CSF is determined by high pressure liquid chromatography analysis and the cumulative amount of protein released is calculated from the results obtained for each time point in which the aqueous medium has been separated.
Protein release from the pharmaceutical composition
Day_Reset /% /
8 11 15
24.57 40, θ5 67.16 79.91 91, 57
Example 20
Sustained-release pharmaceutical composition comprising PEG 500 / µl<sup>1</sup> , Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>7hu G-CSF / 80 # 100: 0 lactido-glycolide copolymers and 20% methylpolyethyl glycol 2000 /
A. Procedure with glacial acetic acid (5.23 # protein content)
159.70 g of hydrogel (82.5% poly-d, lactide, 17.5% MePEG 2000) are dissolved in
2.0 ml anhydrous glacial acetic acid. In addition, 39.50 mg of lyophilized preparation PEG 500O- /<sup>_</sup>'éet<sup>-1</sup> , Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>87</sup>’^<sup>5</sup>Dissolve G-CSP (26.46 # mass protein) in an additional 2.0 mL of glacial acetic acid.
The two solutions are mixed and four additional 0.5 ml aliquots of glacial acetic acid are used to rinse the chemical glassware used. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 60 ° C and then formed into the above-described test fractions having a weight of approximately 70 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000 / Met release<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>80</sup>’<sup>85</sup>7 C-C3F is determined by high pressure liquid chromatography analysis and the cumulative amount of protein released is calculated from the results obtained for each time point in which the aqueous media has been separated.
Protein release from the pharmaceutical composition
Day_Reset /% /
25,19
8 1 1 15 18
63,52
86,20
93,67
97,50
98,88
Example 21
Pharmaceutical Composition Substances Containing PEG 5 with Continuous Release ΟΟΟ-Λ / θΙ '<sup>1</sup> , Arg<sup>1 1</sup> , Ser<sup>17</sup>’<sup>27</sup> effectively
S Λ
DJ, O5 7.
hu G-CSF (lactide-glycolide copolymer 50: 50)
A. Procedure with glacial acetic acid (4,14- 16 protein content)
160.34 mg of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; weight average molecular weight 9827; polydispersity 2.18) is dissolved in 2.0 ml of anhydrous glacial acetic acid. In addition, 40.73 ng of lyophilized preparation PSG 5000 Γ Met<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>_7hn G-CS? Dissolve in an additional 2.0 mL of glacial acetic acid. The two solutions are mixed and four additional 0.5 L aliquots of glacial acetic acid are used to rinse the chemical glass used. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 60 ° C and then formed into the above-described test fractions having a weight of approximately 60 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in UXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release of PSG 5θθθ<sup></sup>// Met<sup>-1</sup> , Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>The G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium, and the accumulated amount of protein released is calculated from the results obtained for each time point in which the aqueous medium is separated.
Protein release from the pharmaceutical composition
Day_Reset /% /
18,05
1 14
40,00 57,47 66,1 8 72,06 77,77
Example 22 '
<img file="CS9102285A3_D0003.tif" />
hu G-CSF (lactide-glycolide copolymer 75 ^ 25)
Glacial acetic acid procedure
161.46 mg of polylactide / 75 wt% d, 1-lactide and 25 wt% glycolide as a copolymer; weight average molecular weight 12938; polydispersity 1.81) is dissolved in 2.0 ml of anhydrous glacial acetic acid. In addition, 39.0 mg of lyophilized PEG TG50 preparation was dissolved in an additional 2.0 mL of glacial acetic acid. The two solutions are mixed and four additional 0.5 ml aliquots of glacial acetic acid are used to rinse the chemical glassware used. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with press plates heated to 75 ° C and then formed into the above-described test fractions having a weight of approximately 83 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in OXU1D-phosphate buffered saline.
The aqueous medium is separated at regular intervals.
<img file="CS9102285A3_D0004.tif" />
high pressure liquid chromatography
<img file="CS9102285A3_D0005.tif" />
Aí :;
environment, calculates the accumulated amount of protein released.
Release of protein from the pharmaceutical composition
Den_Quantities / 1 /
<td> 1</td><td> 7,82</td>
<td>AND * T</td><td> 12,27</td>
<td>r *> and</td><td> 15,46</td>
<td> 1 1</td><td> 17,25</td>
<td> 14</td><td> 19,38</td>
<td> 18</td><td> 21 ,06</td>
Example 23
Sustained release pharmaceutical composition containing PEG 5000- / Μβί Arg '<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>hu-G-CSF / lactide: glycolide = 100: 0 / op
7Procedure with glacial acetic acid (5.37% protein content)
158.67 polylactide / 100% d, 1-lactide and 0% glycolide; weight average molecular weight 9042; Dissolve polydispersity in 2.0 ml of anhydrous glacial acetic acid. Besides that
40.42 mg of lyophilized PEG preparation p000- / met<sup>-1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>The G-CSP was dissolved in an additional 2.3 mL of glacial acetic acid. The two solutions are mixed and four additional 0.5 ml aliquots of glacial acetic acid are used to rinse the chemical glassware used. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic plate press and heated.
at a temperature of 75 ° C and then formed into the above-described test fractions having a weight of approximately 73 mg.
These fractions were then placed in plastic vials containing 2.0 ml of 0.027 solution (w / v) sodium azide in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG release 5θ00Γ ~ Met<sup>-</sup>Arg<sup>1</sup>'Ser'<sup>7</sup>The G-CSF was determined by high pressure liquid chromatography analysis of the separated aqueous medium, and the cumulative amount of protein released was calculated for each time point at which the aqueous medium was separated.
Protein release from the pharmaceutical composition
Day_Reset /% /
<td> 1</td><td> 13,02</td>
<td> 4</td><td> 22,46</td>
<td> 7</td><td> 29,44</td>
<td> 11</td><td> 33,15</td>
<td> 14</td><td> 36,34</td>
<td> 18</td><td> 41 ,31</td>
Example 24
Sustained-release pharmaceutical composition containing PEG 5000- / Met ', Ser'<sup>7</sup>’<sup>27</sup>_7hu G-CSF Aqueous Method i / Formulation G / 207 Protein Content /
4.0 g polylactides / 50 7 wt% d, 1-lactide and 50 7 wt% glycolide in the form of a copolymer; weight average molecular weight 7673; polydispersity 2.59) is dissolved in 12 ml of dichloromethane and the solution is stirred under high shear conditions (Ystral 1500 homogenizer). To this solution, 4 ml of an aqueous solution of sodium bicarbonate (20 mg / ml) was added dropwise. An additional 60 ml of distilled water was added and a fine white dispersion formed. The dichloromethane is stripped off in a rotary evaporator. The solution was immediately frozen in a dichloromethane / Erikold bath and lyophilized overnight. This sodium polymer chamber is stored under vacuum at room temperature prior to use.
160.3% of this sodium sodium salt is dispersed in 2 ml of distilled water. In addition, 4.396 ml of an aqueous solution of PEG 5000 - / "Met"<sup>1</sup>, Ser<sup>17,27</sup>7 G-CSF (9.1 mg / ml) is diluted to 5 mg / ml distilled to a concentration of said GCSP analogue and added to said polymer salt suspension. An additional four 0.5 ml aliquots of distilled water are used to rinse the chemical glass used. The solution was immediately frozen in a dichloromethane / Erikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydral press with press plates heated to 90 ° C and then formed into a 1 mm thick plate. The plate is then chopped having a weight of approximately 105 mg. These fractions were placed in plastic vials containing 2 phosphate buffered saline and sodium and stored at 37 ° C.
of the frame was then treated with OXOIE 0.02% azide
The aqueous medium is separated at regular intervals and replaced with fresh buffer. The release of PEG 5000 / met, Ser / hu G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the cumulative amount of protein released is calculated for each time the aqueous medium has been separated.
ii) Formulation H / 20% protein content /
4.0 g of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide as a copolymer; mass average molecular weight 7791.2; The polydispersity 2.65) was dissolved in 16 ml of dichloromethane and the resulting solution was stirred under high shear conditions (Ystral 1503 homogenizer). An additional 40 ml of distilled water was added and a fine white dispersion formed. The dichloromethane was stripped off on a rotary evaporator. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. The sodium salt of the polymer is stored under vacuum at room temperature prior to use.
89.54 mg of said sodium polymer salt are dispersed in 2 ml of distilled water. 3.33 ml of an aqueous solution of PEG 5θθ- / Met \ Ser ^<sup>7,27</sup>(g-CSF (9 mg / ml)) is added to said polymer salt dispersion. To rinse the chemical glassware used, four additional 0.5 ml aliquots of distilled water were used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and then formed into a 1 mm thick plate. This plate is cut into fractions having a weight of approximately 63 mg. These fractions were then placed and placed in plastic vials containing 2 ml of OXOID phosphate buffered saline and 0.02% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release PSG 5000 / Met \ Ser ^<sup>7</sup> ’<sup>27</sup>The 7-G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the accumulated amount of protein released is calculated for each time point at which the aqueous medium has been separated. A comparison of the accumulated amounts of protein released from formulations G and H is shown in Figure 15.
Comparative example
Continuous-release pharmaceutical composition of an active substance containing a fireclay / met<sup>-1</sup>, Ser<sup>17,27</sup>7-G-CSF
Water way
Formulation ΐ / 20% protein content /
4.0 g of polylactide / 50 wt% d, 1-lactide and 53 wt% glycolide as a copolymer; weight average molecular weight 7791.2; polydispersity 2.65) is dissolved in 16 ml of dichloromethane and obtained; the solution was stirred under high shear stress conditions (Ystral 1530 homogenizer). To this solution was added dropwise 4 ml of an aqueous solution of sodium bicarbonate (23 mg / ml). An additional 43 ml of distilled water was added and a fine white dispersion formed. The dichloroethane is stripped off on a rotary evaporator. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. The sodium polymer salt is then stored under vacuum at room temperature.
160.20 mg of this sodium polymer salt is dispersed
in 2 ml of distilled water. 4.3 ml aqueous solution / Met<sup>-1</sup>, Ser<sup>17</sup>’<sup>27</sup>7 G-CSF (10.0 mg / ml) is diluted to 5 mg / ml with distilled water and the diluted solution is then added to the polymer salt suspension. An additional four 0.5 El aliquots of distilled water are used to rinse the chemical glass used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and then formed at the same temperature into a 1 mm thick plate. The plate is then cut into fractions having a weight of approximately 61 mg. These fractions are then placed in plastic vials containing 2 ml of OXOID-phosphate buffered saline and 15.
0.02% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release / Met<sup>-1</sup>,
27
Ser *<sup>1</sup>The G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the accumulated amount of protein released is calculated for each time point at which the aqueous medium has been separated, the protein release for pharmaceutical formulation I shown in FIG. lč.
Comparative Example 4
Sustained-release pharmaceutical composition comprising / met Ser<sup>17</sup> ’<sup>27</sup> 7-G-CSF and methyl-PDG5000
Water way
Formulation J (20% protein content)
4.0 g of polylactide / 50 wt% d, 1-lactide and 5 wt% glycolide in the form of a copolymer; weight average molecular weight 7791.2; polydispersity 2.65) is dissolved in 16 ml of dichloromethane and the resulting solution is stirred under high shear conditions (Ystral 1500 homogenizer) and 4 ml of aqueous sodium bicarbonate solution (20 mg / ml) are added dropwise. An additional 40 ml of distilled water was added and a fine white dispersion formed. The dichloromethane was stripped off on a rotary evaporator. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. The sodium polymer salt is then stored under vacuum at room temperature.
119.77 mg of said sodium salt poles. in 2 ml of distilled water. 4.1 ml of aqueous Ser<sup>17,27</sup>Dilute G-CSF (10.0 mg / ml) with an mg / ml aqueous solution containing 4:
Disperse the solution / fet<sup>-1</sup> , to a concentration of mg methoyl-rF0-94
5000 and the diluted solution is added to the polymer salt suspension. An additional four 0.5 ml aliquots of distilled water are used to rinse the chemical glass used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 95 ° C and then formed into a 1 mm thick plate. This plate is cut into fractions having a weight of approximately S3 mg. The plates are then placed in plastic vials containing 2 ml of OXOID phosphate buffered saline and 0.02% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release / Met,
7 27 —
Serum G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous aqueous medium and the cumulative amount of protein released is calculated for each time point at which the aqueous medium has been separated. Protein release from formulation J is shown in Figure 16.
Example 25
Sustained release pharmaceutical composition comprising PEG 5000- / Met <sup>1</sup>, Glu<sup>1</sup>^ Ser<sup>17</sup>’^<sup>7</sup>, Ala<sup>2</sup>^’<sup>2</sup>^, Lys<sup>3</sup>° -7hu G-CSF
Water way
Formulation K (20% protein content)
4.0 g of polylactides / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of copolymers; weight average molecular weight 7791.2; The polydispersity 2.65) is dissolved in 16 ml of dichloromethane and the resulting solution is stirred under high shear conditions (Ystral 150θ homogenizer). To this solution is added dropwise 4 ml of aqueous sodium bicarbonate solution (20 mg / ml). An additional 40 ml of distilled water was added and a fine white dispersion formed. The dichloromethane was stripped off on a rotary evaporator. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. The sodium polymer salt is then stored under vacuum at room temperature.
120.8 mg of said sodium polymer salt are dispersed in 2 ml of distilled water. To the polymer salt suspension was added 3.738 mL of an aqueous solution of P3G 5000- / MetI Glu<sup>15</sup>, Ser<sup>1</sup>'’<sup>27</sup>, Ala<sup>28</sup>’<sup>28</sup>Lys (hu G-CSP) 10.7 mg / ml. To rinse the chemical glassware used, four additional 0.5 ml aliquots of distilled water were used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 80 Ca and then formed at the same temperature into a
1 mm thick plate. The plate is then cut into fractions having a weight of approximately 95 mg. These fractions are then placed in plastic vials containing 2 ml of OXUID-phosphate buffered saline and 0.02% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000 / "Met" release<sup>1</sup>C-lu<sup>15</sup>, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>26</sup>’<sup>28</sup>, Lys<sup>3:)</sup>The 7-G-CSF is determined by high pressure liquid chromatography analysis of the separated aqueous medium, and the accumulated amount of protein released is calculated from the results obtained for each time point at which the aqueous medium has been separated. Release of protein from formulation K is shown in Figure 17 ·
EXAMPLE 26 Pharmaceutical Composition with Conjugate Substances Containing Hu 3-CS?
3- / Met<sup>-1</sup>. Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>55</sup> (A.Aqueous Method i) Formulation 1 (20% protein content), w <sub>and</sub> polylactide / 50 L of d, 1-lactide and 50% glycolide in the form of a copolymer; weight average molecular weight 7791.2; polydispersity 2.65) is dissolved in 16 ml of dichloromethane and the solution is stirred under high shear stress conditions (Xstral 1500 homogenizer). To this solution, 4 ml of an aqueous solution of sodium bicarbonate (20 mg / ml) was added dropwise. An additional 43 ml of distilled water was added and a fine white dispersion was formed. The dichloromethane was stripped off on a rotary evaporator. The solution was immediately frozen in a dichloromethane / Drokold bath and lyophilized overnight. The sodium polymer salt is then stored under vacuum at ambient temperature prior to use.
120.5 mg of the sodium polymer salt is dispersed in 2 ml of distilled water. To the obtained polymer salt suspension is added 3.478 ml of an aqueous PEG 5000- / net solution.<sup>-1</sup> , Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>7-G-CSF (11.5 mg / ml). Add another 4 x 0.5 ml of distilled water used to rinse the chemical glass used. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 90 ° C and then formed at the same temperature into a 1 mm thick plate. This plate is cut into fractions having a weight of approximately 84 mg. These fractions are then placed in plastic vials containing 2 ml of OXOID phosphate buffered saline and 0.02% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5000-97 / Met release<sup>1</sup>
Arg ser
17,27,60,65 y<sub>hu G</sub>_<sub>C</sub><
is determined by HPLC analysis of the separated aqueous medium and the accumulated amount of released protein is calculated from the results obtained for each time period in which the aqueous medium has been separated. Release of protein from formulation L is shown in Figure 18.
Comparative Example 5
Sustained-release pharmaceutical composition containing / Met alone<sup>1</sup>, Glu<sup>15</sup>, Ser<sup>17,27</sup>, Lys<sup>3</sup>° -7hu G-CSF
She lied to me
26,28
Water way
Formulation M (20% protein content)
4.0 g of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide as a copolymer; weight average molecular weight 7673; polydispersity 2.59) is dissolved in 12 ml of dichloromethane and the solution is stirred under high shear conditions (Ystral 1500 homogenizer). To this solution was added dropwise 4 ml of an aqueous solution of sodium bicarbonate (20 mg / ml). An additional 60 ml of distilled water is added and a fine white dispersion is formed. The dichloromethane was stripped off using a rotary evaporator. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. The sodium polymer salt is then stored under vacuum at room temperature before use.
160.93 mg of said sodium polymer salt are dispersed in 2 ml of distilled water. 4.124 ml of an aqueous solution<sup>1 </sup>Glu<sup>1</sup>Ser<sup>17</sup>’<sup>27</sup>, Ála<sup>2o, 2 £</sup>, Lys<sup>33</sup>7-G-CSF (9.7 mg / ml) was diluted to 5.0 mg / ml with distilled water and the diluted solution was then added to the polymer salt suspension.
Others are used to rinse the chemical glass used
- PS four 0.5 πΰ. aliquots of distilled water. The solution was immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 75 ° C and then formed at the same temperature into a 1 mm thick plate. The plate is then cut into fractions having a weight of approximately S1 mg. These fractions were then placed in plastic vials containing 2 ml of OXOID-phosphate buffered saline and 0.02% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. Release, Met, Glu<sup>15</sup>, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>2</sup>°’<sup>28</sup>, Lys<sup>3</sup>The G-CSF was determined by high pressure liquid chromatography analysis and the cumulative amount of protein released was calculated from the results obtained for each time point at which the aqueous medium was separated. Release of protein from formulation M is shown in Figure 17.
Comparative crop 6
Sustained-release pharmaceutical composition containing / Met <sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>o0</sup>’°<sup>5</sup>_7hu G-CSF Formulation N / 20% protein content /
2.0 g of polylactide / 50 wt% d, 1-lactide and 50 wt% glycolide in the form of a copolymer; polydispersity 2.59) is dissolved in 5 ml of dichloromethane and the solution is stirred under high shear stress conditions (Ystral 1,500 homogenizer). To this solution was added dropwise 2 ml of an aqueous solution of sodium bicarbonate (20 mg / ml). another 30 ml of distilled water is added and a fine white dispersion is formed. The dichloromethane was stripped off on a rotary evaporator. The solution was immediately frozen in a chloroform / Brikold bath and lyophilized overnight. The sodium polymer salt is then stored under vacuum at room temperature before use.
159.99 mg of said sodium polymer salt is dispersed in 2 ml of distilled water. 3.966 ml aqueous solution / met<sup>-1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>'' ^ _7hu G-CS? (10.33 mg / ml) was diluted to 5.3 mg / ml with distilled water and the diluted solution was added to the polymer salt suspension. An additional four 3.5 ml aliquots of distilled water are used to rinse the chemical glass used. The solution was immediately frozen in a dichloromethane / Erikold bath and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 95C and then formed at the same temperature into a 1 mm thick plate. The plate was cut into fractions having a weight of approximately 61 mg. These fractions are then placed in plastic vials containing 2 ml of υΧυΙΕ-phosphate buffered saline and 0.1% sodium azide and stored at 37 ° C.
The aqueous medium is separated at regular intervals. , 1 part and replaced with fresh buffer. Release / Met, Arg<sup>11</sup>, Ser<sup>1 7</sup> ’ <sup>27</sup> '' ° ^ _ / hu G-CS? is determined by HPLC analysis and the cumulative amount of protein released is calculated for each time point at which the aqueous medium is separated. Release of protein from formulation 1: is shown in Figure 16.
Example 27
A sustained release pharmaceutical composition comprising P2G 5333-human calcitonin
A. Procedure with glacial acetic acid (5.31 protein content) 356.23 mg polylactide / 55 1 d, 1-lactide
100 ALIGN! copolymers; weight medium; a dispersion of 1.75) with the dissolution of glycolide in;
(691 molecular weight 15 g in 4.0 ml glacial acid) acetic anhydride-free.
In addition, 2.955 ml of an aqueous solution of PEG 5000-human calcitonin (8.46 mg / ml) was lyophilized and then dissolved in an additional 2.0 ml of glacial acetic acid. The two solutions are mixed and a further 4 ml of a 1.0 ml aliquot of glacial acetic acid is used to rinse the chemical glass used. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 75 ° C and then extruded through a calibration die 16. The filtrate is then cut into fractions having a weight of approximately 10 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in OXGID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. The release of PEG 5000 human calcitonin is determined by high pressure liquid chromatography analysis and the cumulative amount of protein released is calculated for each time point at which the aqueous medium has been separated (see Table 2 below).
3. Water way
5.0 g of polylactide / 50% by weight of d, 1-lactide and 50% by weight of glycolide in the form of copolymers; weight average molecular weight 10691; dissipation 1.75) is dissolved in 20.0 ml of dichloromethane and the solution is stirred under high shear conditions (Ystral 15ΟΟ homogenizer). To this solution was added dropwise 5.0 ml of an aqueous solution of sodium bicarbonate (20 mg / ml). An additional 50 ml of distilled water is added and a fine is formed
101 white dispersions. The dichloromethane was stripped off on a rotary evaporator. The dispersions were immediately frozen on a Dichloromethane / Drikol bath and lyophilized overnight. The sodium polymer salt is then stored under vacuum at room temperature before use.
392.62 mg of said sodium polymer salt are dispersed in 4.0 ml of distilled water. In addition, 2.955 ml of an aqueous solution of PEG 5000'-human calcitonir (8.46 mg / ml) was lyophilized and then dissolved in an additional 2.0 µl of distilled water. This solution is then added to the suspension and mixed. An additional four 1.0 ml aliquots of distilled water are used to rinse the chemical glass used. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press with pressure plates heated to 60 ° C and then extruded through a calibration die 16. The extrudate is then cut into fractions having a weight of approximately 10 mg. These fractions are then placed in plastic vials containing 2.0 ml of a 0.02% (w / v) sodium azide solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. The release of PEG 5000 human calcitonin is determined by high pressure liquid chromatography analysis of the separated aqueous medium and the accumulated amount of protein released is calculated for each time point at which the aqueous medium has been separated (see Table 2 below).
AND
02
Table 2
In vitro peptide release (glacial acetic acid procedure)
77^377775://:-:5.
<td>Day</td><td>Fraction A Cumulated amount /% /</td><td>Fraction 3 cumulated amount /% /</td>
<td> 1</td><td> 15,4</td><td> 10,9</td>
<td> 2</td><td> 15,4</td><td> 10,9</td>
<td> 7</td><td> 15,4</td><td> 10,9</td>
<td>WITH</td><td> 56,5</td><td> 41 ,3</td>
<td> 1 6</td><td> 66,5</td><td> 57,2</td>
<td>Just</td><td>Fraction C cumulated amount /% /</td><td>Fraction L cumulated amount /% /</td>
<td> 1</td><td> 6,9</td><td> 7,9</td>
<td> 2</td><td> 6,9</td><td> 7,9</td>
<td> 7</td><td> 6,9</td><td> 7,9</td>
<td>Q</td><td> 27,9</td><td> 27,9</td>
<td> 16</td><td> 45,4</td><td> 31 ,6</td>
<td>Relaxation</td><td>peptides in vitro / aqueous</td><td>way</td>
<td>Day</td><td>Fraction A cumulated amount / 56 /</td><td>Fraction B cumulated amount /% /</td>
<td> 1</td><td> 20,9</td><td> 24,7</td>
<td> 2</td><td> 30,5</td><td> 35,6</td>
<td> 7</td><td> 41,5</td><td> 57,1</td>
<td>ε</td><td> 51,3 .</td><td> 72,3</td>
<td> 16</td><td> 65,0</td><td>SS, 3</td>
103
<td>Day</td><td>Fraction C cumulated amount /% /</td><td>Fraction D cumulated amount /% /</td>
<td> 1</td><td> 26,3</td><td> 2 0,5</td>
<td> 2</td><td> 32,0</td><td> 25,2</td>
<td> 7</td><td> 46,6</td><td> 36,4</td>
<td> 6</td><td> 53,9</td><td> 42,2</td>
<td> 1 6</td><td> 60,6</td><td> 49,9</td>
Example 28
A sustained release pharmaceutical composition comprising unpegylated human calcitonin
A. Procedure with glacial acetic acid (5% protein content)
473.50 mg of polylactide / 50% d, 1-lactide and 50% glycolide in the form of a copolymer; weight average molecular weight 13691; polydispersity 1.75) is dissolved in 4.0 ml of anhydrous glacial acetic acid. In addition, 25.56 mg of the lyophilized preparation of human calcitonin was also dissolved in an additional 2.0 mL of glacial acetic acid. The two solutions are mixed and four additional 2.0 ml aliquots of glacial acetic acid are used to rinse the used chemical dishes. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is then thoroughly mixed using a hydraulic press with pressure plates heated to 75 ° C and then extruded through a calibration die 16. The resulting extrudate is cut into fractions having a weight of approximately 19 mg. These fractions were then placed in plastic vials containing 2.0 mL of a 0.02% sodium azide solution in 0XOID phosphate buffered saline and stored at 37 ° C.
04
The aqueous media are separated at regular intervals and replaced with fresh buffer. The release of human calcitonin is determined by high pressure liquid chromatography analysis of the separated aqueous medium, and the accumulated amounts of protein released are calculated for each time point at which the aqueous medium has been separated. The analysis was performed on
On days 1, 2, 7, 8, and 16 days, no significant release of protein was observed during this time period.
3. Aqueous method (5.0 # protein content)
5.0 g of polylactide / 50% by weight of d, 1-lactide and 50% by weight of glycolide in the form of copolymers; weight average molecular weight 10691; polydispersity 1.75) was dissolved in 20.0 ml of dichloromethane and the solution was stirred under high shear conditions (Ystral 1500 homogenizer). 5.00 ml of aqueous sodium bicarbonate solution (20 mg / ml) was added dropwise to this solution. An additional 50 mL of distilled water was added and a fine white dispersion formed. The dichloromethane was stripped off on a rotary evaporator. The dispersions were immediately frozen in a dichloromethane / Drikold bath and lyophilized overnight. The sodium salt of the polymer is stored under vacuum at room temperature prior to use.
474.84 mg of said sodium polymer salt are dispersed in 4.3 ml of distilled water. In addition, 25.65 of the lyophilized preparation of human calcitonin is dissolved in 2.0 ml of distilled water. This solution is added to the suspension and mixed. An additional four 1.0 ml aliquots of distilled water were used to rinse the chemical glass used. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is then thoroughly mixed using a hydraulic press with pressure plates heated to a temperature of 55 ° C. <sup>3</sup>C and then extruded through the calibration die 16. The obtained extrudate is then cut into
135 a fraction having a weight of about 13 mg. These fractions are then placed in plastic vials containing 2.3 ml of a 3.32% (w / v) sodium azide solution in OXOID phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. The release of human calcitonin is determined by high pressure liquid chromatography analysis of the separated aqueous medium, and the accumulated amounts of protein released are calculated from the results obtained for each time point at which the aqueous medium has been separated. The analysis was performed on 1st,
On days 2, 7, and no. And day 16, no significant release of the protein was observed during this time period.
Example
Continuous pharmaceutical composition comprising PEG 5333-interleukin-2
Glacial acetic acid procedure (23.% release of activity) (PEG 5333-IL-2) protein content
113.42 mg of polylactide / 53% by weight of d, 1-lactide and 53% by weight of glycolide as a copolymer; weight average molecular weight 13691; polydispersity
1.75) is dissolved in 2.3 ml of anhydrous glacial acetic acid. In addition, 4.26 ml of an aqueous solution of PEG 5330IL-2 (7.35 mg / ml) is lyophilized and then dissolved in a further
1.3 ml glacial acetic acid. 2ba these solutions are mixed and a further four 3.5 ml aliquots of glacial acetic acid are used to rinse the chemical glass used. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is thoroughly mixed using a hydraulic press using 3 pressure plates.
It is formed into fractions as described above having a weight of approximately 30 mg. These fractions were then placed in plastic vials containing 2.3 mL of a 0.32% (w / v) sodium azide solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with fresh buffer. PEG 5330IL-2 release is determined by high-pressure liquid analysis.
<td colspan="2">time chromatography, in which the cumulated</td><td colspan="2" rowspan="2">and from the results obtained, for each of which the amount of protein released was separated in the aqueous environment (see: 3 /. Table 3</td>
<td>following</td><td>table</td>
<td>Relaxation</td><td>peptides</td><td>in vitro</td><td></td>
<td>Day</td><td></td><td>Fraction A</td><td>Fraction 3</td>
<td></td><td></td><td>cumulated</td><td>cumulated</td>
<td></td><td></td><td>amount</td><td>amount</td>
<td></td><td></td><td> /%/</td><td> /%/</td>
<td> 1</td><td></td><td> 31 ,3</td><td> 37,7</td>
<td> 2</td><td></td><td> 41 ,8</td><td> 41,1</td>
<td> 4</td><td></td><td> 43,9</td><td> 45,8</td>
<td> 8</td><td></td><td> 45,5</td><td> 47,3</td>
<td> 16</td><td></td><td> 46,5</td><td> 47,7</td>
Example 3θ
Sustained release pharmaceutical composition containing unpegylated interleukin-2 (IL-2)
Procedure with glacial acetic acid (23% protein content)
54.93 mg polylactides / 50% d, 1-lactide and 50% glycolide in the form of copolymers; 137- <7S -<sup>11</sup> ” '
L; Λ- ,!
average molecular weight 13691; polydispersity 1.75) is dissolved in 4.3 ml of anhydrous glacial acetic acid. In addition, 45.39 mg of lyophilized IL-2 preparation was also dissolved in an additional 1.3 mL of glacial acetic acid. The two solutions are mixed and a further 4, 3.5 ml aliquots of glacial acetic acid are used to rinse the chemical glass used. The solution is immediately frozen by immersion in liquid nitrogen and lyophilized overnight.
The powder obtained after lyophilization is then thoroughly blended using a hydraulic press with pressure plates heated to a temperature of 0 ° C and then formed into the fractions described above having a weight of approximately 33 mg. These fractions were then placed in plastic vials containing 2.3 mL of a 3.32% (w / v) sodium azide solution in OXOID-phosphate buffered saline and stored at 37 ° C.
The aqueous medium is separated at regular intervals and replaced with buffer. The release of IL-2 is determined by high pressure liquid chromatography analysis of the separated aqueous medium, and the cumulative amount of protein released is calculated from the results obtained for each time point at which the aqueous medium is separated. Analysis was performed on 1st, 2nd, 4th, £. and on day 16, with no significant release of said protein observed during this time period.
Reference example 1
Preparation / Met <sup>1</sup>7 G-CSP modified methylpolyethylene glycol 5330
A. Preparation / ~ Uet '<sup>1</sup>Human G-CSF and / Preparation of a synthetic prc / ket gene<sup>_1</sup>7 human G-CSP
DNA sequence (Figure 2 and 3PU TP No 4?) Encoding the polypeptide sequence of Figure 2 (human G-CS?)
-108 designed according to the following requirements:
1 / A single stranded cohesive end that permits ligation at appropriate plasmid sites;
2 / a number of sites in the restriction endonuclease gene to facilitate subsequent genetic manipulation;
3 / translation of the stop codon;
4 / codons at the 5 end of the coding region, selected to have a lot of A / T; additional codons selected according to their ability to prefer expression in E.coli.
The gene was composed of 18 nucleotides designated as SEQ ID No. 1 - SEQ ID No. 18 and listed below.
Preparation of oligonucleotides
The oligonucleotide sequences set forth below were prepared using an Applied Biosystems 380A DNA synthesizer from a nucleoside-2-cyanoethyl-N, N-diisopropylphosphoramide with a 5-dimethoxytrityl-protected base, wherein the protected nucleosides were coupled to a control porous glass carrier of 0.2 micromolar. Methodologies presented by Applied Biosystem Inc ..
Alternatively, oligonucleotide sequences can be prepared by the method described by Atkinson and Smith in Oligonucleotide Synthesis, and Practical Approach (MT Gait, Editor, IRL Press, Oxford, Washinton DC, pp. 35-81).
Oligonucleotide sequence preparation was subsequently streamlined using an Applied Biosystem 380A DNA synthesizer:
each oligonucleotide, after cleavage from the solid support and removal of all protecting groups, was dissolved in water (1 ml). To the oligonucleotide solution (400 µl) was added 3M sodium acetate solution (pH 5.6); 40 µl) and ethanol
The mixture was stored at -70 ° C for 20 hours. The resulting precipitate was centrifuged (13,000 rpm, 10 minutes) and the pellets washed with ethanol: water (7: 3, 200µl) and then dried rapidly in vacuo and dissolved in water (15µl) and in 10%. µl of formamide-dye mixture (10 mM NaOH, 0.5 mM EDTA, 0.01% bromophenol blue, 0.01% xylene cyanol, 80% formamide).
Oligonucleotides were purified on a 10% polyacrylamide gel in 5θ mM Tris-borate (pH 8.3) containing
8.3 M urea.
Oligonucleotides of the desired length have been identified in UV radiation / Narang et al., 1979, Methods in Enzymology, Vol. 68, 90-98]. The most desirable band was excised from the gel, electroeluted in 5 mM Tris-borate (pH 8.3) at 300 mV for 3-4 hours. The aqueous solutions were concentrated to 200 [mu] l by treatment with n-butanol (after stirring and vortexing the upper organic layer was removed). The purified nucleotides were precipitated at -70 ° C for 20 hours in 3 M sodium acetate solution by adding ethanol.
Compilation of gel
Oligonucleotides SEQ ID NO: 2 - SEQ ID NO: 17/400 pM each / (as defined below) were phosphorylated
T4 polynucleotide kinase (3.6 units) for 2 hours at 37 ° C in 25 µl of a solution containing ATP / 800 /? 2 µM containing 25 µM gamma<sup>J</sup> P ATP /, 100 µM spermidine, mM magnesium chloride, 50 nM Tris-HCl (pH 9.0) and 0.1 mM EDTA. The solutions were heated at 100 ° C for 5 minutes to complete the reaction, after which the vapors as shown in Table 1 were mixed to form double helices (duplexes) from A to I.
Oligonucleotides SEQ ID No. 1 and SEQ ID No. 18 (400 mM in 25 µl) were used non-phosphorylated. It was added
0.3 M sodium acetate solution (pH 5.6, 200 µl) and ethanol (850 µl) and the duplexes were precipitated at -20 ° C for hours. The obtained precipitates were isolated by centrifugation and washed with a 7: 3 by volume mixture of ethanol and water and then dissolved in water (50 µl). The nucleotide pairs were combined together by first heating the solutions to 100 ° C for 2 minutes in a boiling water bath. The bath was then slowly cooled to 40 ° C (for about 4 hours). Solutions containing 3 pairs of double helices were pooled as shown in Table 1, the groups formed (groups I-III) were lyophilized and then dissolved in 30 µl of a solution containing T4 DNA ligase (1 unit, BRL), 50 mM Tris (pH 7.6), 10 mM magnesium chloride, 5% (w / v) PEG 8000, 1 mM ATP, 1 mM DTT / BRL, Focus, Vol.8, No.1, 1986] and the DNA was ligated at 3 ° C for 5 minutes and then at 16 ° C for 20 hours. Then, 3 M sodium acetate solution (20 µl) and water (150 µl) were added and the product was precipitated by the addition of ethanol (750 µl) and cooled to -20 ° C for 20 hours. The precipitate was isolated by centrifugation, washed with ethanol (1 ml), then dissolved in water (15 µl) and a mixture of formamide and dye and purified on a 10% polyacrylamide gel in 50 mM Trisborate (pH 8.3), 1 mM EDTA and 8 * 3 M urea.
Strips corresponding to strands of approximately 173-186 bases were identified by the autoradiographic method and collectively isolated by electroelution from individual strips of gel as previously described for individual oligonucleotide sequences.
The DNA strands were combined by first heating the aqueous solution (50 µL) to 100 ° C for 2 minutes and then cooling to 40 ° C for 4 hours.
Groups I, II and III were joined together as described above, with the gene sequence shown in Figure 8. After precipitation, the gene was phosphorylated by T4 polynucleotide kinase as previously described for individual oligonucleotides and then dissolved in water.
Table 1
<td>Duplex</td><td>Oligonucleotide</td><td>Number of fences vrchním</td><td>in the chain bottom</td>
<td>AND</td><td>SEQ ID NO: 1 + SEQ ID NO: 2</td><td> 62</td><td> 64</td>
<td>(B)</td><td>SEQ ID NO: 3 + SEQ ID NO: 4</td><td> 60</td><td> 60</td>
<td>C</td><td>SEQ ID NO.5 + SEQ ID NO.6</td><td> 48</td><td> 51</td>
<td>D</td><td>SEQ ID NO: 7 + SEQ ID NO: 8</td><td> 63</td><td> 60</td>
<td>»- »</td><td>SEQ ID NO: 9 + SEQ ID NO: 10</td><td> 63</td><td> 63</td>
<td>F</td><td>SEQ ID No. 11 + SEQ ID No. 1 2</td><td> 60</td><td> 63</td>
<td>G</td><td>SEQ ID NO: 13 + SEQ ID NO: 14</td><td> 63</td><td> 60</td>
<td>H</td><td>SEQ ID NO. 15 + SEQ ID NO. 16</td><td> 60</td><td> 60</td>
<td>AND</td><td>SEQ ID NO. 17 + SEQ ID NO</td><td> 55</td><td> 53</td>
<td>AND</td><td>A + B + C</td><td> 170</td><td> 175</td>
<td>II</td><td>D + E + F</td><td> 186</td><td> 186</td>
<td>III</td><td>G + Η + I</td><td> 178</td><td> 173</td>
b / Cloning of the synthetic gene for / Met<sup>1</sup>7 human G-CSF
The synthetic gene described above was cloned into the plasmid vector pSTP1 (Windass et al., Nuclei Acid Research (1983), Vol. 10, page 6639].
To prepare the vector, 10 µg of pSTP1 was dissolved in water (37.7 µL) and 10 µB restriction buffer (4.5 µL / BCL). Next, restriction endonuclease Sal I (µl) (BCL, 8 units / yul) was added and the mixture was incubated for
112 hours at 37 ° C, when the linearized plasmid predominated in the mixture over the supercoiled and cleaved circular form of the plasmid. The DNA was precipitated with ethanol at 4 ° C for 3θ minutes, washed with a 7: 3 mixture of ethanol and water and then dissolved in water (39.5 µl), 1 ΟΧ H buffer (4.5 µl). BCL /. The restriction endonuclease EcoRI (2 µl) (BCL, 90 units / µl) was added to the mixture and incubated for 1 hour at 37 ° C, where a large EcoRI-SalI fragment predominated. The DNA was precipitated at -20 ° C for 20 hours, washed with a 7: 3 mixture of ethanol and water and then dissolved in water (20µl).
The large EcoRI-SalI fragment was purified on a 1% preparative agarose gel and then electroeluted and precipitated as previously described and finally dissolved in water (20 µl).
After ligation of the synthetic gene, the following mixture was incubated for 4 hours at 16 ° C:
DNA vector (2 µl of EcoRI-SalI fragment solution), synthetic gene (5 µl of aqueous solution described above),
5X ligase buffer (6? -250 mM Tris pH 7.6, 50 mM magnesium chloride, 25% (w / v) PEG 800, 0.5 mM DTT exBRL), water (15) µl)
T4 DNA ligase (2 µl, 1 unit / yul).
The DNA mixture (or 1 [mu] l of the modified ligation mixture or 2 [mu] l of 5X ligation diluted with water) was used directly to transform E. coli HB101 cells. The DNA (1 or 2) µl mixture was added to competent cells of the E.coli strain HB101 (20 µl, BRL) on ice and the mixture was incubated in an ice bath for 45 minutes and then subjected to heat shock by heating to 42 ° C. for 45 seconds. After additional minutes in ice, 100 µl of SOC buffer (2% bactotrypton, 0.5% yeast extract, 10 mM sodium chloride, 2.5 mM potassium chloride, 10 mM magnesium chloride, 10 ml of magnesium sulfate and 20 mM glucose) were added. and the mixture was incubated at 37 ° C for one hour.
Aliquots of the suspension were plated on L-agar plates containing 50 µl / ml ampicillin. Transformed cells were assayed for the presence of a cloned synthetic gene using the standard hybridization method described in Molecular Cloning: A Laboratory Manual, Maniatis et al. A total of 100 colonies were transferred to filters (Schleicher and Schuell), cultured at 37 ° C for 20 hours, lysed and heated.
Hybridization was performed at 65 ° C for 20 hours, when the filter was in contact with a radioactive assay prepared by labeling the oligonucleotide sequence of SEQ ID No. 1 with a random label set (Pharmacia). Five colonies, designated 1 to 5, which gave a positive hybridization signal were cultured in L medium (100 ml) at 37 ° C for 20 hours, and then the DNA plasmid was prepared by cesium chloride density gradient centrifugation as described in Molecular Cloning: A Laboratory Manual, Manitas et al. Cold Spring Harbor.
DNA was sequenced by the standard method of Sanger et al., Described in Proc. Nat. Acad. Sci. USA, 74, 54635467 (1977), based on chain termination using dideoxy nucleotide derivatives, using the Sequenase set (United States Biochemical Corporation). Oligonucleotides from SEQ ID 19 to SEQ ID No. 23 (see below) were used as sequencing primers.
Table 2
Code
SEQ ID NO 19 SEQ ID NO 20
Primer binding site
214-234 upper thread 333-353 upper thread
114
Table 2 / continued /
SEQ ID NO: 21
SEQ ID NO: 22
SEQ ID NO: 23
375-395 bottom thread 207-227 bottom thread
69- 93 bottom thread
Plasmid DNA from clone 5 contains the DNA sequences shown in FIG. The plasmid (pAG88) was used to transform competent cells of the following E. coli strain using a standard procedure:
H3101
CGSC 6300 (hereinafter also referred to as MSD 522).
E.coli strains HB101 and MSD522 (CGSC 6300) are freely available. For example, they may be obtained from the E. coli Genetic Stock Center, Yale University, USA. Further, E. coli H3101 may subsequently be obtained from, for example, BRL, GIBCOO Limited Unit 4, Cowley Miles Trading Estate, Longbridge Wax, Uxbridge, UB8 2ZG, Miiddlesex, GB or GIBCO Laboratories, Life Technologies Inc., 3175 Staley Road, Gand Island, NY 14072,
USA.
(c) Cloning of the Met & lt; 7 & gt; G-CSF gene into an expression vector
The above gene was cloned into the plasmid pICI 0020 as described in Reference Example 3 (c) to obtain the expression plasmid pICI 1056.
d / Fermentation
Plasmid pICI 1056 was transformed and fermented as described in Reference Example 3 (e) to obtain Met. <sup>1</sup> 7 of human G-CSF.
115 e / Purification
Purification was performed as described in the second purification procedure, allowing larger amounts of (~ Met) to be obtained.<sup>1</sup>7-G-CSF as described on pages 48 and 49 of PCT WO 87/01132, which ends with dialysis against phosphate buffer.
B. Preparation of "Met"<sup>1</sup>7-G-CSF modified methylpolyethylene glycol 5000
Solution / Met<sup>1</sup>The 7 G-CSF (300 mg) prepared as described in paragraph A is concentrated to a concentration of 8 mg / ml in 20 mM sodium acetate, 37 mM sodium chloride, pH 5.4 by ultrafiltration on an Amicon YM10 membrane (separation threshold: mol). wt. 10 kDa /. To this solution was then added an equal volume of 0.8 M sodium borate solution (pH 8.8) followed by methylpolyethylene glycol p-nitrophenyl carbonate having an approximate molecular weight of 5000 (Sigma Chemical Co.). (100 equivalents per mole)<sup>_1</sup>7-G-CSF / dissolved in water. The reaction is carried out at 20 ° C for 3 hours with gentle stirring, and 1 M ethanolamine hydrochloride (pH 8.0) (10 equivalents per mole of active methylpolyethylene glycol) is added to the reaction mixture. The pH of the reaction mixture is immediately adjusted to 5.4 by titration with 1 M acetic acid and the reaction mixture is diluted to a volume of 500 ml with 20 mM sodium acetate and 100 mM sodium chloride (pH 5.4).
The reaction mixture is then dialyzed against 10 liters of the same buffer using an Amicon CH2A-1S spiral container system equipped with an SIY30 membrane / separation threshold: mol / wt. 30 kDa until yellow p-nitrophenol is no longer visible in the retentate.
The retentate is then concentrated to a volume of about 300 ml and placed in a stirred membrane Amicon 8400 membrane-equipped cell.
YM30 (separation threshold: 30 kDa). The retentate is concentrated to a volume of ml and diluted again to a volume of 300 ml with 20 mM acetate
116 sodium and 100 mM sodium chloride (pH 4.5). This procedure was repeated four times and the product was finally concentrated to a volume of about 25 ml. This concentrate is chromatographed on a column (5 x 90 cm) of Ultrogel AcA54 which is equilibrated with 20 mM sodium acetate and 100 mM sodium chloride (pH 5.4).
Fractions containing the modified protein were identified by 280 nm light monitoring for protein detection and iodine / potassium iodide titration for methylpolyethylene glycol / CR Acad titration. Sci. Paris 274 1O17, 1972 /. The final product is concentrated to a concentration greater than 11.5 mg / ml by ultrafiltration through an Amicon YM30 membrane, filtered through a 0.22 µm filter under sterile conditions, and stored at 4 ° C for further studies. SDS-PAGE of the final modified product shows that no unreacted / f ~ Met 'remained<sup>1</sup>7-G-CSF and that all the product is of high molecular weight. Titration of the filtrates and retentates with the iodine / potassium iodide system showed that repeated diafiltration at pH 5.4 on the YM30 membrane / separation threshold: mol / wt. 30 kDa / effectively removed any non-protein-bound methylpolyethylene glycol.
The final product contained about 4 moles of methylpolyethylene glycol covalently bound to a mole of protein. The SpeQ specific activity of the unmodified derivative 0.8 x 10 U / mg decreased to 0.2 x 10 U / mg (25%) of the modified product. The product obtained was completely stable and showed no changes in specific activity in solution up to 10 mg / ml (protein) for 14 days at 37 ° C.
In this reference example, the pH control of the /? Met solution is carefully checked prior to pegylation <sup>1</sup>7-G-CSF to prevent or at least minimize dimerization.
Reference Example 2
Preparation<sup>-1</sup>7 methyl G-CSF modified with methylpolyethylene glycol 5000
117 The procedure of Reference Example 1 is repeated except that purification of? -Met<sup>_1</sup>The G-CSF is performed as follows.
The frozen cell paste (500 g) is lysed and the crude pellet fraction is separated, washed and solubilized as described in Reference Example 4 below. The sarcosyl-soluble extract is clarified by centrifugation at 30,000 xg for 3 minutes.
1 liter of acetone was added dropwise to 1 liter of the supernatant, with stirring at 4 ° C. The secreted protein is isolated after 10 minutes by centrifugation at 15,000 xg for 30 minutes and the supernatant is discarded. The resulting pellets were resolubilized in 40 mM sodium acetate, 6 M guanidine hydrochloride, pH 4.0 (500 ml) using a Polytron PT10-35 homogenizer, after which the solubilisate was stirred for one hour at 4 C and then subjected to complete dialysis in a Spectrapor dialysis machine. / separation threshold: mol.wt. 6-8 kDa / against 20 mM sodium acetate, pH 5.4.
The secreted protein was collected by centrifugation at 15,000 xg for 30 minutes and the supernatant was loaded onto a 50 ml CM cellulose column (Whatman CM52) equilibrated with 20 mM sodium acetate, pH 5.4. The column is eluted with the same buffer until Ε<sub>2</sub>The θθ of the eluate drops to background and is then washed (4 times the column volume) with 20 mM sodium acetate, pH 5.4, containing 20 mM sodium chloride. Product fractions containing ~ Met<sup>-1</sup>The 7 G-CSF was eluted with 37 mM NaCl in 20 mM sodium acetate, pH 5.4, after which the fractions obtained were pooled and either immediately modified with methylpolyethylene glycol 5000 or stored at -20 ° C prior to further use.
Reference Example 3
Preparation / Met \ Ser<sup>17.27</sup>7 methyl G-CSF modified with methylpolyethylene glycol 5000
118
A. Preparation «Me»<sup>1</sup> , Ser<sup>17</sup>’<sup>27</sup>_7G-CSF / human /
The procedure described in steps A and / and A b / of Reference Example 1 is repeated with the following modifications:
the oligonucleotides SEQ ID Nos. 24, 25, 26, and 27 (detailed below) will replace the oligonucleotides SEQ ID Nos. 1, 2, 3 and 4.
c / Cloning of the pro / Me gene<sup>1</sup> , Ser<sup>17</sup> ’<sup>27</sup>7 human G-CSF into an expression vector
The gene described above (see FIG. 3) was cloned into the plasmid vector pICI0020. This vector is derived from the plasmid pAT153, in which the 651 bp EciRI-AccI region is replaced by a 167 bp EcoRI-ClaI fragment consisting of:
1) a synthetic E.coli trp promoter and a leader sequence for the trp binding site on the ribosome,
2) translation initiation codon,
3 / multiple restriction enzyme recognition sequences derived from M13mp18, containing sites for KpnI, BamHI, SalI, PstI, SphI and HindIII,
4 / synthetic transcription termination sequences.
The LNA sequence of this region is shown in Figure 1 (see also SEQ ID NO.44).
PICI0020 expression vector was digested with KpnI (BCL) in 10 mM Tris-HCl (pH 7.5), 10 mM magnesium chloride for subsequent replenishment. The DNA was precipitated with ethanol at -20 ° C from a solution containing 0.3 M sodium acetate and the 3 cohesive ends were removed after treatment with T4 DNA polymerase for 10 minutes at 37 ° C in the following reaction mixture:
DNA / 1 / Ug / in water / 16 / µl / buffer for 1 ΟΧ T4 polymerase / 2yul /
0.33 M Tris-acetate pH 7.9 0.1 M magnesium acetate
119
0.66 M potassium acetate mM dithiothreitol mg / ml bovine serum albumin / BSA PENTAX fraction V / mM mixture dNTP / 1µl /
T4 DNA polymerase / µl; 2.5 units // UL BCL /.
Water (80 µl) was added and the mixture was extracted with 100 µl of phenol / chloroform followed by chloroform (100 µl). The DNA was precipitated with ethanol (250 µL) at -20 ° C after addition of sodium acetate (10 µL) and further digested with SalI (BCL) in 150 mM NaCl, 10 mM Tris-HCl (pH 7.5). the blunt end was purified on a 0.7% agarose gel and isolated by the Geneclean method (gel purification) according to the manufacturer's recommended procedure (Biol01, USA).
The synthetic gene was isolated from the pSTP1 vector as shown below. The vectors were digested with Seal and SalI (both derived from BCL) in 100 mM NaCl, 10 mM MgCl<sub>2</sub> and 10 mM TrisHCl (pH 7.5). The 530 bp fragment was purified from a 0.7% agarose gel and isolated by the Geneclean method according to the manufacturer's recommended procedure (Bio10l).
Prior to ligase treatment, a mixture of the Scal-SalI gene fragment (50 ng) and the pICI0020 vector fragment (100 ng) in a 20 µl solution containing 50 mM Tris-HCl (pH 7.6), 10 mM MgCl 2, 1 mM ATP, mM DTT, 5% (w / v) PEG 8000 and T4 DNA ligase / 2 units; BRL / incubated for 20 hours at 16 ° C. The resulting mixture was used to transform the respective E.col HB101 cells. Transformed cells were selected by growth on L-agar containing 50 µg / ml ampicillin and further tested for gene presence by hybridization of labeled colonies. <sup>32</sup>P (SEQ ID NO. 24). The DNA plasmid was prepared from 6 positively hybridizing colonies, purified by cesium chloride gradient centrifugation, and the sequence was determined by dideoxy sequencing.
The plasmid containing this gene was designated pICI 1080.
- 120 d / Subcloning of an expression set of genes containing the gene for / 'Met<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>7G-C3F, to M13mp18
The following subcloning was performed to provide a starting material for the preparation of the G-CSF derivatives described in detail in Reference Examples 7 and 8.
PICI1080 / Plasmid DNA
centrifugation in a cesium chloride density gradient was digested with EcoRI and SalI (BCL) according to the manufacturer's instructions. A small EcoRI-SalI fragment containing the trp promoter and / MetI Ser<sup>17</sup>’<sup>27</sup>The 7g-CSF gene was isolated from a 0.7% agarose gel using the Geneclean method. This fragment was inserted into the M13mp18 vector (DNA supplied by Amersham International) after its previous digestion with EcoRI-SalI (supplied by BCL). The fragments were ligated in 5x BRL buffer using the previously described BRL T4 DNA ligase. The mixture was used to transfect appropriate E. coli TG1 cells (selected from the calcium chloride method described by Mandel and Hig in Molecular Cloning - A Laboratory Manual - Maniatis et al., Cold Spring Harbor).
Transfected cells were suspended in top layer of TY agar (trypton-yeast agar) containing 2% XGal in dimethylformamide and 200 µl of TG1 E.coli cells harvested in the logarithmic growth phase, and further transfected cells were seeded on TY agar plates / containing 8 g tryptone, 5 g yeast extract, 5 g NaCl, 3> 75 g bactoagar in 500 ml sterile water, TY agar plates containing:
g of bactotrypton, 5 g of yeast extract, 5 g of NaCl,
7.5 g bactoagar in 500 ml sterile water. Four white plaques were collected and mixed with 4 x 2 ml of a 1% suspension of E.coli TG1 cells in TY culture medium (8 g tryptone, 5 g yeast extract, 5 g NaCl in 500 ml sterile water) and allowed to grow for 6 hours. hours at 37 ° C.
ml portions were then divided into two volumes of volumes
0.5 ml and 1.5 ml. The bacterial cells were then centrifuged in Eppendorf microcvents and the supernatants were transferred to sterile microtubes after centrifugation. 0.5 ml aliquots were frozen at -20 ° C and kept as a phage stock. Aliquots of 1.5 ml were used to prepare single stranded DNA according to the method described in Amersham International M1 3 sequencing handbook (see below). These DNA samples were further sequenced using the oligonucleotides of SEQ ID NO: 22, SEQ ID NO: 23, and M13 of the universal sequence primer. Reactions were performed according to the manufacturer's instructions with the Sequenase kit. All four clones contained the correct DNA sequence for β-Ser 7G-CSF.
Large-scale preparation of single-stranded DNA
The method of Amersham International Oligonucleotide Directed Mutagenesis was used to prepare single stranded DNA at 200-500 µg DNA / ml. The detailed workflow is described below.
To prepare single stranded DNA:
A. Preparation of 1 ml of phage material (stock)
1 / a single colony of TG1 E. coli grown on minimal glucose medium was grown overnight in 10 ml of 2x TY medium at 37 ° C with shaking; inoculate 20 ml of fresh medium to inoculate 10 µl of growth and shake for 3 hours at 37 ° C;
2/1 ml of 2x TY medium in a 10 ml sterile culture tube is inoculated with 100 µl of the culture prepared according to point 1, which is 3 hours old;
3) inoculate 1 ml of recombinant plaque culture; 4) incubate with shaking at 37 ° C and transfer to a centrifuge microtiter;
5) centrifuge at room temperature for 5 minutes; Pour the supernatant into a clean tube and leave
122 overnight at 4 ° C; prepare a culture
TGI E. coli cultured overnight for the next step.
B. Growth of 100 ml phage culture
1) inoculate 100 ml of 2x TY medium with 1 ml of Tg1 culture and shake until the turbidity absorbance of the culture medium reaches 0.3 at 500 nm;
2) 1 ml of phage supernatant prepared according to the instructions (see A5) is added to 100 ml of culture;
3) incubate for 5 hours with shaking at 37 ° C;
4) centrifuge at 5000 g at 4 ° C for 30 minutes;
5) transfer the supernatant to a clean centrifuge micro-cuvette; cells are left to prepare RF LNA;
6) 0.2% by volume of 20% (w / v) PEG 6000 in 2.5 M NaCl is added to the supernatant, mixed well and allowed to stand at 4 ° C for 1 hour;
7) centrifuge at 5000 g and 4 ° C for 20 minutes; decant the supernatant;
8) centrifuge at 5000 g and remove any remaining PEG / dextran;
9) the viral pellets are resuspended in 500 [mu] l of redistilled water and the suspension is transferred to a centrifuge micro-cuvette (1.5 ml);
10) centrifuged for 5 minutes and the supernatant is separated from the remaining cells and transferred to a clean centrifuge micro-cuvette;
11) 200 µl of 20% PEG 12.5 M NaCl was added to the supernatant, mixed well and allowed to stand at room temperature for 15 minutes;
12) centrifuge for 5 minutes, then decant the supernatant;
- 123 13 / centrifuge for 2 minutes and carefully remove all PEG / NaCl residues;
14) viral pellets are resuspended in 500 µl of redistilled water;
15) 200 µl of phenol saturated with 10 mM TrisHCl pH 8.0, 2 mM EDTA is added; brief vigorous stirring is performed;
16 / allow the cuvette to stand for 15 minutes at room temperature;
17 / centrifuged for 3 minutes;
18 / transfer the supernatant to a clean centrifuge tube;
19 (steps 15) to 18 are repeated;
20) add 500 µl of chloroform and extract the aqueous phase twice;
21) 50 µL of 3M sodium acetate and 1 ml of pure ethanol are added and the mixture is stirred;
22) The mixture is placed in a dry ice-ethanol bath for 20 minutes;
23 / centrifuge for 15 minutes;
24) each pellet was washed with 1 ml of -20 ° C ethanol;
The 25 pellets are dried to cloud and solubilized in 50 µl of redistilled water.
In this way, 100-200 µg of single stranded DNA can be prepared.
e) Fermentation of pICI 1080 was transformed into E.coli cells of strain MSD 522 / CGSC 6300 // shown in Reference Example 1A / b //. Recombinant cells were purified and stored in glycerol at -80 ° C.
A portion of the culture was harvested and inoculated onto L-ampicillin agar to separate single colonies when grown overnight at 37 ° C. The grown colony, which was found separately on agar broth, was harvested
124 and resuspended in 10 ml of L-ampicillin soil and 100 µl were immediately inoculated into 10 250 ml Erlenmeyer flasks containing 75 ml of L-ampicillin culture medium. After growing for 16 hours at 37 ° C on a reciprocating shaker, the flask contents were pooled and used as an inoculum for a fermenter containing 20 L of culture medium, LCM50.
Composition of culture medium LCM50
<td colspan="2">solubilized in distilled water component / g / 1 /</td>
<td>kh<sub>2</sub>p °<sub>4</sub></td><td> 3,0</td>
<td>On<sub>2</sub>HP0<sub>4</sub></td><td> 6,0</td>
<td>NaCl</td><td> 0,5</td>
<td>Casein hydrolyzate / Oxoid L41 /</td><td> 2,0</td>
<td>/NH./<sub>O</sub>S0. 4 2 4</td><td> 10,0</td>
<td>Yeast extract (Difco)</td><td> 10,0</td>
<td>Glycerol</td><td> 35,0</td>
<td>L-leucine</td><td> 2,5</td>
<td>L-threonine</td><td> 0,9</td>
<td>MgSO<sub>4</sub>. 7H<sub>2</sub>0</td><td> 0,5</td>
<td>CaCl<sub>2</sub>.2H<sub>2</sub>O</td><td> 0,03</td>
<td>Thiamin</td><td> 0,008</td>
<td>FeSO<sub>4</sub>/citric acid</td><td> 0,94/0,02</td>
<td>Trace Element Solution (TES)</td><td>0.5 ml</td>
Fermentations were carried out at 37 ° C and pH 6.7.
The pH was controlled and automatically controlled by the addition of 6 M sodium hydroxide. The oxygen partial pressure (dOT) was nauseated
- 125 out to 50% air saturation and was initially regulated by automatically increasing the speed of the fermenter stirrer. The air flow rate was initially 20 l / min, which corresponds to a flow rate of 1 volume of air per minute volume (VVM), and was increased to a flow rate of 50 l / min (2.5 VVM) as the stirrer speed approached 80 up to 90% of its maximum. Since the oxygen transfer rate (OTR) in the fermenters was unable to satisfy the oxygen consumption of OUR (bacteria) at a cell density in the medium higher than that corresponding to an absorbance equal to 50 at a wavelength of 550 nm under the conditions described, the oxygen partial pressure was The dOT / in the fermenter was maintained at 50% air saturation at higher cell densities. This was achieved by culturing cells whose density corresponded to an absorbance value of 50 at a wavelength of 550 nm in a limited amount of carbon source medium, followed by the addition of a trace amount of carbon source together with ammonium sulfate and yeast extract in an amount limiting bacterial growth rate.
Fermentations lasted 16 hours and during this time samples were taken to measure turbidity absorbance at 550 nm, cell dry matter and the amount of G-CSF in the cells. The amount of G-CSF formed was monitored by SDS-PAGE electrophoresis of whole cell lysates after staining with Coomassie blue gels.
At a time when the turbidity absorbance at a wavelength of 550 nm reached 25, a solution of casein hydrolyzate (100 g / L Oxoid L41) was added to the fermenter at 1.5 g / L per hour.
When the absorbance at 550 nm reached approximately 50, the carbon source was depleted resulting in a rapid increase in the oxygen partial pressure (dOT) from 50% air saturation. At this point, glycerol (470 g / l), yeast extract (118 g / l) and ammonium sulfate (118 g / l) were added to the medium at a rate that caused a reversal and a return to dOT retention.
126 % air saturation with stirring, reaching approximately 80% of maximum. After 13 to 14 hours, the addition of some substances was repeated. Only glycerol (715 g) and ammonium sulfate (143 g) were added to the medium. The rate of addition of casein hydrolyzate was maintained at 1.5 g / L per hour. After approximately 16 hours, when the presence of a large number of inclusion particles was detected microscopically in most cells, the cells were centrifuged in a Sorval RC3B centrifuge (7033 g, 3θ minutes, 4 ° C) and frozen at -83 ° C.
f / Purification
Frozen cells (500 g) were resuspended in 50 mM Tris-HCl, 25 mM EDTA, pH 8.0 (5 L) at 4 ° C in a Silverson model AXR homogenizer. Cell lysis in suspension was performed in a Manton-Gaulin homogenizer at 6000 psi (42 MPa) by three times extrusion of the suspension. This was followed by centrifugation for 30 minutes at 5000 g on a Sorvall RC3C centrifuge with a H6000A rotor. The supernatant was decanted after centrifugation and the pellet was frozen before further purification to -20 ° C.
up to 100 g of pellets were resuspended in 1% (w / v) deoxycholic acid (sodium salt) solution in 5 mM EDTA, with 5 mM dithiothreitol, 5θ mM TrisHCl, pH 9.0 (1200 ml) containing 1 mg / ml sodium azide in a Polytron homogenizer with PTA 20 at a speed set to 5. The suspension was stirred for 30 minutes at room temperature and centrifuged at 65 při g for 30 minutes in a Sorvall RC 5C centrifuge GSA rotor. The supernatant was removed again and the pellets were processed in the same manner as described above.
Next, the pellets were resuspended twice in 1 L of water and centrifuged at 15 µg for 20 minutes. The resulting precipitate containing inclusion particles was further solubilized in 2% (w / v) N-lauroyl sarcosine sodium salt in 5µM TrisHCl buffer 8.0 / 150 ml / s 1 mg / ml sodium azide. Sodium sulfate was added to a final concentration of 20
127 µm, and the mixture was then centrifuged at 30,000 g for 30 minutes on a Sorvall RC5C centrifuge with an SS34 rotor. The supernatant containing the desired derivative was frozen in 50 ml aliquots before further purification.
The solubilized derivative (20 ml) was thawed and filtered through a 5 µm filter to remove any solid particles. The filtrate was applied to a 5 x 90 cm (Ultrogel AcA54) column equilibrated with 0.3% (w / v) N-lauroylsarcosine (sodium salt) in 50 mM Tris-HCl buffer pH 8.0 containing 1 mg / ml sodium azide. The whole procedure was carried out at 4 ° C. This was followed by elution with the same buffer at a flow rate of 2.5 ml / min. The sieve was collected in 10 ml fractions. The fractions containing the derivative were pooled (approximately 100 mL) and stored at 4 ° C. Fractions with the desired derivative eluted from several columns were pooled and dialyzed against 10 mM phosphate buffer with 150 mM sodium chloride pH 7.4 (3 to 5 L) containing 1 mg / ml sodium azide in a membrane equipped Amicon CH2A-1S diafiltration device S1Y10 (separation threshold 10 kLa). The retentate was centrifuged at 30,000 g for 3 minutes in a Sorvall RC5C centrifuge with an SS34 rotor and the centrifuged supernatant was dialyzed against water containing 1 mg / ml sodium azide for 24 hours. This was followed by another 72 hour dialysis with a six-fold change in water. The resulting retentate was centrifuged at 30,000 g for 30 min and frozen at -20 ° C at a protein concentration of 1 mg / ml or lyophilized.
After diafiltration, the N-lauroylsarcosine concentration decreased below 0.001% (w / v) and, following dialysis against water, the concentration of this compound fell below the limit determined by the rpHPLC method (0.0001%).
B. Preparation / Met ', Ser'<sup>7</sup> ’ <sup>27</sup>7-G-CSF modified with methylpolyethylene glycol 5000
This product was prepared according to the procedure described in re128 of Reference Example 7. The final product contained about 4.1 moles of methylpolyethylene glycol covalently bound to one mole of protein. Specific biological activity / ~ Met ”<sup>1</sup> , Ser<sup>17,27</sup>7-G-CSF / 1.4 x 10 O<sup>9</sup> U / mg / decreased after modification
Q only at 2.4 x 10 U / mg (17%). This product was completely stable and showed no change in specific activity in solution up to 10 mg / ml (protein) in PBS at 37 ° C for 14 days. These results are identical to those found in Reference Example 7 and show the consistency of the results obtained with a given amine group arrangement.
Reference example 4
Preparation / “Met”<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>7-methyl-polyethylene glycol-modified human G-CSF 5000
The procedure of Reference Example 7 is repeated with the following exceptions:
the frozen cell paste (500 g) was resuspended at 4 ° C in 50 mM Tris-HCl, 25 mM EDTA pH 8.0 (5 L) using a Polytron PT6000 homogenizer. Cell lysis in suspension was performed in a Manton-Gaulin homogenizer at 6000 psi (42 MPa) by three times extrusion of the suspension. This was followed by centrifugation for 30 minutes at 4 ° C and 5000 g on a Sorvall RC3C centrifuge equipped with a H6000A rotor. The supernatant was discarded and the pellet fraction was stored at -20 ° C prior to purification.
The pellet fraction (200-250 g) was thawed and resuspended in 1% (w / v) deoxycholic acid (as sodium salt) in 5 mM EDTA, 5 mM dithiothreitol, mM Tris-HCl pH 9.0, containing 1 mg / ml sodium azide (3 liters) using a Polytron PT10-35 homogenizer equipped with a PTA20 sensor. The suspension is then stirred for 30 minutes at 20 ° C and centrifuged at 5000 g for 30 minutes on a Sorvall RC3C centrifuge equipped with a H6000A rotor. Decant the supernatant and process the pellet twice
- 129 in the same way. The pellet is resuspended twice in water (3 liters) and centrifuged at 5000 g for 30 minutes. The final pellet containing the inclusion particles is solubilized in 2% (w / v) N-lauroylsarcosine sodium (Sarkosyl) in 50 mM Tris-HCl pH 8.0 (300 ml) containing 1 mg / ml sodium azide. Copper sulphate (20 µM) was added and the mixture was stirred for 16 hours at 20 ° C before centrifugation at 30,000 g in a Sorvall RC5C centrifuge using an SS34 rotor. Further, the supernatant containing the derivative is immediately purified or stored at -20 ° C until use.
The solubilized derivative is adjusted to a total protein content of 15 mg / ml / ml <sup>ve</sup> 2% / mass / volume /
Sarcosyl in 50 mM Tris-HCl pH 8.0 containing 1 mg / ml sodium azide and allowed to flow through a 5 µM liter to remove any particles. An 80 ml aliquot of the filtrate was applied to a column (10 x 90 cm) of Sephacryl S200 HR in equilibrium with 0.3% (w / v) sarcosyl (sodium salt) in 50 mM TrisHCl pH 8.0 containing 1 mg / ml azide. sodium at 4 ° C. The column was then eluted with the same buffer at a flow rate of 10 ml / minute and 40 ml fractions were collected. Fractions containing the protein derivative are pooled and stored at 4 ° C.
The combined derivative fractions from several runs were pooled (about 1000 ml) and dialyzed against 10 liters of 10 mM sodium phosphate, 150 mM sodium chloride, pH 7.4 containing 1 mg / ml sodium azide using an Amicon CH2A-IS diafilter equipped with STY1 membrane. 0 (separation threshold 10 kDa). Optionally, the retentate is centrifuged at 15000g for 30 minutes on a Sorvall RC5C centrifuge using a GSA rotor and the clarified retentate is dialyzed in a Spectrapor 6-8 kDa dialysis tube for 24 hours against three variations (8 liters / 300 ml tetentate / 20 mM sodium acetate). ,
100 ALIGN! mM sodium chloride, pH 5.4 at 4 ° C. The precipitate formed is collected by centrifugation at 15θθg for 3θ minutes and the supernatant dialyzed against four variations of water (8 liters / 300 ml supernatant). The final retentate is
The 130 clarified by centrifugation at 15,000 g for 30 minutes and adjusted with 0.1 M sodium borate © to pH 8.0. The purified derivative is modified with methylpolyethylene glycol or stored at -20 ° C before use.
Reference example 5
Preparation / Met <sup>1</sup> , Ser<sup>17</sup>’<sup>27</sup>7 methyl G-CSF modified with methylpolyethylene glycol 5000
The procedure described in paragraph A of Reference Example 3 is repeated with the following exceptions:
duplex I is phosphorylated with T4 polynucleotide kinase and digested with Mstil (10 units) in 1 XH buffer (ScL); 30 µl for 2 hours at 37 ° C.
After ethanol precipitation, the 143 bp EcoRIMstIII fragment was run on a 10% polyacrylamide gel containing 7M urea, isolated by electroelution from the gel strip, and the DNA strands were pooled as described in Reference Example 1.
The above-described synthetic EcoRI-MstII fragment was cloned into the plasmid vector pAG88 described in Reference Example 1. To prepare the vector, pAG88 (10 µg) was digested with Mstil (20 units); BCL / v 1 XH buffer / BCL; 100 [mu] l for 2 hours at 37 [deg.] C. The DNA is then precipitated with ethanol from 0.3 M sodium acetate at -20 ° C and then digested with EcoRI / 20 units; BCL / v 1 XH buffer / BCL; 100 µl for 2 hours at 37 ° C. After ethanol precipitation, the large EcoRI-MstII fragment was purified on a 1% agarose gel and purified in vacuo. use of Geneclean according to the manufacturer's recommended procedure (Bio 101, USA). Ligation of the 143 bp gene fragment into the large EcoRI-MstII fragment was performed as described in Reference Example 1 (b). Colonies containing the synthetic fragment were confirmed by monitoring with a radioactive detection reagent prepared from the oligonucleotides (SEQ ID NO: 24) and the correct sequence-1314 (Fig. 1).
CE was confirmed by DNA sequencing as described in Reference Example 1. Plasmid containing the gene for [beta] Met<sup>1</sup> , Ser<sup>17.27</sup>The β-CSF was designated pICI1107. This gene was cloned into the expression vector pICI 0020 and purification was performed as described in Reference Example 3.
Reference example 6
Preparation of genes for human G-CSF derivatives using point mutations
The phosphothionate method of Eckstein et al:
Taylor, JW et al., Nucleic Acids Research (1985) Vol. , pp. 8749-8764;
Taylor, JW et al., Nucleic Acids Research (1985) s., Pp. 8765-8785;
Nakamaye, K. et al., Nucleic Acids Research (1986) Vol 9679-9698;
Sayers, JR et al., Nucleic Acids Research (1988) vol., Pp. 791-802.
The procedure was performed using a kit supplied by Amershan International. The method is set forth below and includes changes to the original method with respect to the use of more than one mutagenic oligonucleotide and the incubation temperature for oligonucleotides longer than 30 bases.
1 / Coupling of the mutant oligonucleotide to the single stranded DNA template:
Single-stranded DNA template / 1 / Ug / µl / 5.0 / U1
Phosphorylated mutant oligonucleotide / 1.6 pmol per 1<sub>/AT</sub>1 / 2.5 / µl
Buffer 1 3.5 / ul
Water 6.0 / ul
132
When two mutagenic oligonucleotides were used at one time, 2.5 µl (1.6 pmol) of each phosphorylated oligonucleotide was added to 5 µl of a single stranded DNA template (1 µg / µl) in 3.5 µl of Buffer 1. and 3.5 µl of water. When 3 mutagenic oligonucleotides were used, 2.5 µl (1.6 pmol per µl) of each phosphorylated oligonucleotide was added to 5 µl single-stranded DNA (1 µg) in buffer 1 and 1 µl water). In the case of oligonucleotides shorter than 3θ, the above components were placed in a sealed tube and heated in a water bath at 70 ° C for 3 minutes. Oligonucleotides longer than 30 bases were immersed in a boiling water bath for 3 minutes. The tubes were then transferred to a 37 ° C water bath for 30 minutes.
2 / Synthesis and ligation of mutant DNA strands:
DNA strands were pooled in the following reaction mixture:
Magnesium chloride (solution) (5 µl) Nucleotide mixture 19 µl (containing dCTP alpha S)
Water 6 µl Klenow fragment (6 units / 1.5) µl T4 DNA ligase (5 units / 2) µl
The above ingredients were left in a 16 ° C water bath overnight.
3 / Removal of unmutated single stranded DNA using centrifugal filter units
To the reaction mixture from point 2 was added:
Water
M sodium chloride
170 / ul
30 / ul.
133
250 µl of the sample was added to the top half of the filter unit and centrifuged at 1500 rpm for 10 minutes at room temperature in a Sorvall RT6000B centrifuge using a Sorvall H1000B swing out rotor. Samples are passed through two nitrocellulose membranes where single stranded DNA is captured and the double stranded DNA is captured in a collection tube after passing through the membrane.
To remove the remaining RF DNA, 100 µl of 500 mM NaCl was added to the sample and left for 10 minutes. The following ingredients were added to the filtrate:
3M sodium acetate / pH 6.0 / 28 / µl ice ethanol / -20 ° C / 700 / µl.
The mixture was then left in a dry ice / ethanol bath and then centrifuged in Eppendorf micro-flowers for 15 minutes. The precipitate was resuspended in 10 µl of buffer 2.
4 / Cleavage of non-mutated fibers with Nci I
To the reaction mixture mentioned in point 3 was added 65 µl of buffer 3 and 8 units of Nci I (1) (UI). The mixture was placed in a 37 ° C water bath for 90 minutes.
5 / Cleavage of unmutated fibers by exonuclease III
To the reaction mixture from point 4 was added:
500 mill NaCl 12 / U1 buffer 4 10 / U1 exonuclease III / 50 units / 2 / u1.
The mixture was transferred to a 37 ° C water bath and incubated for 30 minutes with 50 exonuclease units.
III decomposed approximately 3000 bases in 30 minutes. The mixture was then transferred to a 70 ° C water bath for 15 minutes to inactivate the enzyme.
134
6 / Polymerization and Ligation of DNA with Gapped / To the reaction mixture from point 5 was added:
nucleotide mix 2 1 3 / µl MgClg / rotrok / 5 / µl DNA polymerase I / 4 units / 1µl T4 DNA ligase / 2.5 units / 1 / µl
The mixture was transferred to a 16 ° C water bath for 3 hours.
7 / Transformation of competent host cells of E.coli TG1 DNA
300 µl of freshly prepared cell suspension of competent E. coli cells (prepared by Mandel and Hig method) were transformed with 20 µl of the reaction mixture described in step 6 (twice).
The transformed cells in the late logarithmic phase were transferred to TY agar and the incubation was overnight at 37 ° C.
The E.coli TG1 strain is freely available, for example, from the Genetic Stock Center, Yale University, USA and Amersham International plc Amersham Crying, Little Chalfont, Amersham, Buckinhamshire H07 9NA, GB is the supplier of their in vitro mutagenic system, oligonucleotide set 1523 /.
Reference Example 7
Preparation / Met ”<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>'θθ' ^<sup>5</sup>7 methyl G-CSF modified with methylpolyethylene glycol 5000
A. Preparation / Met \ Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup> *’^<sup>5</sup>7 human GCSF
The procedure described in Reference Example 6 was repeated with the mutated M13mp18 template containing the pro
135
Skw ^<sub>t</sub>. . //// ^ / ťťťť / Meť<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>7G-CSF described in Reference Example or 5. The mutant oligonucleotides used were designated as SEQ ID NO: 28 and SEQ ID NO: 29 (as shown below).
The ACG triplet of SEQ ID NO: 28 serves to convert GIn at position 11 to Arg, the first and last AGA triplets in SEQ ID NO: 29 encode Pro conversion at positions 65 and 60 to Ser. Mutagenesis was performed as described in Reference Example 6 using SEQ. ID # 29 as a mutagenic primer. Syl obtained a separate plaque that contained Pro 60 Ser and Pro 65 Ser changes. Single stranded DNA was prepared from this material as described in Reference Example 6. This DNA was used as a template for single mutagenesis using SEQ ID No. 28 as the mutation primer.
This procedure resulted in a plaque yield of greater than 100.
3 was screened by DNA sequencing as previously described. All changes were fully incorporated. Double helical RF DNA was prepared from one of the plaques by the large-scale single-stranded DNA procedure (step d in Reference Example 3) up to step S5.
7, 1513-1523 (and purified by cesium chloride density gradient blasting as described in Molecular cloning - a Laboratory Manual by Sambrook, Fritsch and Maniatise (Cold Spring Harbor Publication)).
Purified RF LNA was digested with EcoRI and SalI in buffer H as previously described and a small 619 bp fragment containing the trp promoter, ribosome binding site, translation initiation codon, and the pro / Me 'gene<sup>1</sup>, Ser<sup>17.27</sup>7 G-CSF was isolated from a 0.7 $ agarose gel using the Geneclean (TM) method. The fragment was ligated with T4 DNA ligase (BRL) in the appropriate buffer to the pICI0020 vector, digested with ScoRI-SalI, using a 2: 1 molar excess of insert to the vector essentially as previously described. The ligation mixture was used to transform cells
- 136 strains of E.coli HB101. Transformed cells were selected by growth on L-agar plates containing 50 µg / ml ampicillin. The colonies were then screened for the presence of insert DNA by the DNA plasmid restriction analysis prepared by Birnboim and Doly as described in Molecular Cloning and the Laboratory Manual of Sambrook, Fritsch and Maniatise (Cold Spring Harbor Publication). The colony-derived DNA plasmid containing the expected 619bp EcoRI-SalI insertion part was used to transform the strain MSD522 E.coli and the vector pICI1239.
Fermentation and purification were performed as described previously in Reference Example 3.
B. Preparation / Met '<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17,27,80,89</sup>_7 hu G-CSF modified with methylpolyethylene glycol 5000 pH solution / Met '<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>89</sup>7h of GCSF (418 mg) in water (400 ml) was adjusted to 8.0 by addition of 0.8 M sodium borate pH 8.8 and the solution was concentrated to a volume of 50 ml (8 mg / ml) by ultrafiltration through an Amicon YM10 membrane. (permeability limit 10 kDa). To this solution was added an equal volume of 0.8 M sodium borate, pH 8.8, followed by methylpolyethylene glycol p-nitrophenyl carbonate, a product of Sigma Chemical Co. Ltd. and has an approximate molecular weight of 5000 / 11.3 g, 100 equivalents, 20 equivalents per amine group in / f "Met"<sup>1</sup> , Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27,8</sup>θ *<sup>8</sup>Dissolve in water (100 ml). The reaction was carried out at room temperature with gentle stirring for 3 hours and terminated by addition of ethanolamine hydrochloride, pH 8.0 (10 equivalents per mole of active methylpolyethylene glycol).
The reaction mixture was concentrated by passing through an Amicon YM30 membrane (30 kDa cut-off) at 4 ° C to a final retentate volume of 50 mL. This retentate was diluted with 0.1 M ammonium bicarbonate, pH 8.0 (230 mL) and re-concentrated to a volume of 50 mL by repeated ultrafiltration. This procedure was repeated four times and the product finally
137 is concentrated to a final volume of about 25 ml. The concentrated product solution is then chromatographed on a column (5 x 90 cm) of Ultrogel AcA54 equilibrated with 10 ml of sodium phosphate, 150 mM sodium chloride, pH 7.4, containing 1 mg / ml sodium azide (PBS-azide). Fractions containing the modified protein are identified by monitoring the protein at 280 nm and polyethylene glycol titration with iodine / potassium iodide / CR Acad. Sci. , Paris 274 1617 (1972), merge and dialyz completely against water. The final product is concentrated by ultrafiltration through an Amicon YM30 membrane to a concentration greater than 11.5 mg / ml, filtered through a 0.22 µm filter under sterile conditions, and stored at 4 ° C before use.
Amino acid analysis of the protein after acid hydrolysis shows that in the final modified product a total of 51% of the starting / Met <sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>> 6Q, 65y-hu G-CSF. PAGS-SDS-analysis of the reaction mixture shows that no unreacted / Met 'remains<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’^’<sup>8</sup>G-CSF and that all of the product is of high molecular weight. Titration of the filtrate and retentate with the iodine / potassium iodide system shows that repeated ultrafiltration through a YM 30 membrane at pH 8.0 effectively removes all non-protein bound methylpolyethylene glycol derivatives. This was confirmed by Ultrogel Ac54 column chromatography.
Titration / Met '<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>7hu-G-CSF covalently bound to methylpolyethylene glycol in a potassium iodide / iodide system in combination with protein determination by amino acid analysis after acid hydrolysis indicates that 3.9 moles of methylpolyethylene glycol are bound to one mole of protein.
Specific biological activity / Met ”<sup>1</sup> , Arg<sup>11</sup>, Ser<sup>17,27,60</sup>’<sup>65</sup>7-G-CSF / 1.2 χ 10<sup>9</sup>U / mg / dropped to 2.2 x 10 after methylpolyethylene glycol modification<sup>8</sup>U (mg / 19%). The product was completely stable and showed no change in specific activity in solution up to 10 mg / ml (protein) in PBS at 37 ° C over 14 days.
- 138 Reference example 8
Preparation / “Met<sup>1</sup>, Glu<sup>15</sup>, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>26</sup>’<sup>28</sup>, Lys<sup>3</sup>7 methyl G-CSF modified with methyl polyethyl glycol 5000
A. Preparation / Met<sup>1</sup>, Glu<sup>15</sup>, Ser<sup>17</sup>»<sup>27</sup>, Ala 26 '<sup>28</sup>, Lys<sup>3</sup>77 of human G-CSF a / The procedure described in Reference Example 7 was repeated using the mutagenic template M13mp18 containing the gene for the “Me, Ser '7 G-CSF described in Reference Example 3 or 5. SEQ ID NO: 33 and SEQ ID NO: 34.
The TTC triplet of SEQ ID NO: 33 provides a Leu change at position 15 on Glu. In SEQ ID No. 34, the first TTT triplet introduces an Ala change at position 30 after Lys, and AGC triplets provide Gly changes at positions 28 and 26 to Ala. The mutagenesis process was performed essentially as described in Reference Example 6 as a double priming procedure, and the expression gene set was converted to an expression plasmid that gave pICI 1266.
b / Purification v
The frozen cells were lysed and the crude pellet fractions were separated as described in Reference Example 3. The inclusion particles present in the pellets and containing the desired protein were solubilized in a buffer prepared from sodium deoxycholic acid as described in the Reference Example. 3. The following modified method was then used to isolate the protein.
Crude pellet fractions (60-100 g) were thawed and resuspended in 25 mM EDTA, 50 mM Tris-HCl, pH 8.0 (1200 ml) in a Polytron homogenizer with a PTA 20 probe at a rotation speed of 5 · The suspension was stirred for 30 minutes at room temperature and centrifuged at
- 139 6500 g for 30 minutes in a Sorvall RC5C centrifuge using a GSA rotor. After decanting the supernatant, the pellets were processed twice more in the same manner as above. Next, the pellets were resuspended twice in water (1 liter) and centrifuged as described in Reference Example 3.
B. Preparation / Met<sup>-1</sup>, Glu<sup>1</sup>^, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>23</sup>’<sup>28</sup>, Lys<sup>3</sup>G-CSF modified with methylpolyethylene glycol 5000
This product was also prepared using the procedure described in Reference Example 7 using 100 molar equivalents of the reagent, although the derivative still contained a lysine residue at position 30. The final product contained about 4.7 moles of methylpolyethylene glycol covalently bound to one mole of protein. The increased incorporation rate of methylpolyethylene glycol is due to the presence of an extremely potent site for modification, which is reflected in a slightly increased molecular weight in PAGE-SDS analysis. The specific activity of the unmodified derivative (1.2 x 10 U / mg / η) for the modified product drops to 4.4 x 10 U / mg (3%). The product obtained is completely stable and shows no change in specific activity up to 10 mg / ml (protein) in PBS at 37 ° C over 14 days.
Reference example 9
The procedures of Reference Examples 1, 3 and 5 were repeated except that in the fermentation step (see, for example, Reference Example 3), the strain E.coli TG1 was used instead of the E.coli strain MSD 522.
Reference example 10
Alternative extraction procedure / 0Met<sup>_1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>80,8</sup>77 of human G-CSF
140
The procedure described in Reference Example 7 is repeated except that the extraction process is carried out as follows:
frozen cells (640 g) were resuspended at 4 ° C in 50 mM Tris-HCl, 5 mM EDTA, 5 mM dithiothreitol,
M urea, pH 8.0, containing 1 mg / ml sodium azide in a Polytron homogenizer with a PTA20 probe at a speed of 7/8. The cells were lysed in suspension in triplicate in a Manton-Gaulin Lab 60/60 homogenizer at 6000 psi (42 MPa) and washed with 1 liter buffer. Cooling was performed in a Conair cooler at -20 ° C. The lysed cells were further centrifuged at 5000 g for 30 min in a Sorvall RC3C centrifuge with a H6000A rotor.
After decanting the supernatant, the pellets (about 450 g) were resuspended in the same buffer (10 liters).
After stirring for 30 minutes at room temperature, the suspension was centrifuged for 31 minutes at 5000 rpm on a Sorvall RC3C centrifuge with a H6000A rotor. The supernatant was discarded again and the pellets were treated twice in the same manner as described above. Next, the pellets were suspended twice in water (10 liters) and centrifuged for 30 minutes at 5000 rpm. The thus treated pellets containing the washed inclusion particles were resuspended in Tris-HCl buffer pH 8.0 (1 liter / s 2% (w / v) N-lauroylsarcosine sodium salt containing 1 mg / ml sodium azide in a Polytron homogenizer a solution of 20 mM copper sulfate in water (1.5 ml) was added and the mixture was stirred at room temperature overnight. This was followed by centrifugation at 10,000 rpm for 3θ minutes on a Sorvall RC5C centrifuge with a GSA rotor.
The supernatant containing the specified derivative was filtered through a 5 µm pore filter to remove any impurities and solid particles, and further diluted six times with 50 mM Tris.HCl buffer pH 8.0 containing 1 mg / ml.
141 sodium azide (at 4 ° C). Diafiltration was also performed on an Amicon DC20 ultrafiltration apparatus equipped with a filter
S10Y10 with a permeability limit of 10 kDa at maximum pressure against a solution containing 10 mM sodium phosphate, 150 mM sodium chloride pH 7.4 / 90 liters / sec 1 mg / ml sodium azide.
At the end of the diafiltration a precipitate formed.
The retentate (total protein content 2.1 mg / ml, product content 1.7 mg / ml) was collected in polypropylene screw cap containers of 41a incubated overnight at 37 ° C. The resulting precipitate was centrifuged at 5000 rpm on a Sorvall RC3C centrifuge and the supernatant was stored at 4 ° C.
By SDS-PAGE and rpHPLC, it was shown that during the final procedure involving elevated temperature, contaminating E.coli proteins, oligomeric products and degradation products were selectively precipitated with some of the desired product, of which 85% remained in solution. The highly enriched purified product solution after heat treatment was fully biologically active and stable at 20 mg / ml at 37 ° C for more than two weeks without any indication of the possibility of proteolytic degradation. During this time, less than 20% of the product precipitated. This gave an excellent meioroduct for further chromatographic purification.
Reference Example 11
Preparation / “Met”<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>Human G-CSF using a production vector including the trp promoter and (plasmid pICI1239) (referenced in Reference Example 7) was digested with EcoRI and SalI in U buffer as previously described. A small EcoRI-SalI fragment containing the trp promoter, ribosome binding site, and the 'Met' gene<sup>1</sup>, Arg<sup>11</sup>
Ser<sup>17</sup>’<sup>27</sup>'θθ'<sup>85</sup>7 G-CSF was isolated from a 0.7% agarose gel by the Geneclean (TV) method. The vector fragment was prepared from plasmid pICI 0080 (see Reference Example 6), digested with EcoRI and XhoI in H buffer and the large EcoRI-XhoI fragment was isolated from a 0.7% agarose gel by the Geneclean method. A small EcoRI-SalI fragment was ligated into the EcoRI-Xhol vector fragment using a 2: 1 molar excess insert over the vector as previously described, and the ligation mixture was then used to transform E. coli MSD 522 cells. cells were selected by growth on L-agar plates containing tetracycline (15 / Ug / ml). Three colonies were selected and grown in minimal medium M9 (75 ml) containing the respective components and tetracycline (15 µg / ml) for 20 hours at 37 ° C on a shaker. Protein accumulation was monitored by evaluating the results after SDS-PAGE when the gel was stained with Coomassie blue.
Cell lysate samples were used for SDS-PAGE. All three clones contained expressed / Met<sup>-1</sup>, Ser<sup>17,27,60,65</sup>7 human G-CSF. The plasmid DNA of one of the colonies was designated pICI1327, and the promoter and gene sequences were verified by the standard dideoxy sequencing method described above.
b / Fermentation
Plasmid pICI 1237 was transformed into E. coli MSD 522 cells and the resulting recombinant cells were purified and maintained in glycerol at -80 ° C.
A portion of the culture was removed from the stock mixture and spread on tetracycline-containing agar plates to grow single colonies overnight at 37 ° C. After growth, a separately grown colony was harvested and resuspended in 10 ml of tetracycline culture medium and 100 µl was immediately used to inoculate 3 Erlenmeyer flasks (250 ml) containing 75 ml of tetracycline culture medium. After 16 hours of growth
- 143 on a shaker at 37 ° C, the contents of the grown cell flasks were used to inoculate a fermenter containing 20 liters of culture medium.
Composition of culture medium
<td>Component</td><td>Content / g / 1 /</td>
<td>kh<sub>2</sub>after<sub>4</sub></td><td> 3,0</td>
<td>On<sub>2</sub>H? 0</td><td> 6,0</td>
<td>NaCl</td><td> 0,5</td>
<td>Casein hydrolyzate / Oxoid L41 /</td><td> 2,0</td>
<td>/ nh<sub>4</sub>/<sub>2</sub>Sat<sub>4</sub></td><td> 10,0</td>
<td>Yeast Extract (Lifco)</td><td> 10,0</td>
<td>Glycerol</td><td> 35,0</td>
<td>L-leucine</td><td> 0,625</td>
<td>EgSO<sub>4</sub>.7H<sub>2</sub>O</td><td> 0,5</td>
<td>CaCl<sub>2</sub>.2H<sub>2</sub>O</td><td> 0,03</td>
<td>Thiamin</td><td> 0,008</td>
<td>FeSO4 / citric acid</td><td> 0,04/0,02</td>
<td>Trace Element Solution (TES)</td><td>0.5 ml / l</td>
<td>Tetracycline</td><td>10 mg / l</td>
<td colspan="2">solubilized in distilled</td>
<td>water</td><td></td>
The fermentations were carried out at 37 ° C and pH 6.7, which was automatically controlled by the addition of 6 M sodium hydroxide solution. The oxygen partial pressure (dOT) was set to 50¾ air saturation and was initially controlled automatically by adjusting the stirrer speed. The air flow rate was initially 201 / min, which corresponds to the flow rate
144 One volume of air, based on the volume of medium per minute (WM), was increased to 50 l / min (2.5 WM) when the stirrer speed reached 80-90% of its maximum. Since the oxygen transfer rate (OTR) in the fermenters was unable to satisfy the bacterial consumption at a cell density in the medium higher than that corresponding to an absorbance of 50 at 550 nm under the conditions described, the increase in oxygen transfer rate (dOT) was fermenter at higher cell densities maintained at 50% aeration at saturation. This effect was achieved by culturing cells whose density in the medium was 50 turbidity absorbance, measured at 550 nm, in a limited carbon source medium, followed by the addition of trace carbon source along with ammonium sulfate and yeast extract at a rate that limited bacterial growth rate.
Fermentations were carried out for 18 hours, during which time samples were taken during the cultivation and the turbidity absorbance at 550 nm, cell dry matter and the amount of 'Met' were measured.<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’°<sup>5</sup>7 G-CSF within cells. Quantity / “Met<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>The human G-CSF was monitored after staining of Coomassii blue gels after SDS-PAGE (SDS polyacrylic gel electrophoresis), which was performed on whole cell lysates of bacterial samples.
When the turbidity absorbance at the wavelength of 550 nm reached 35 (8 .mu.l), a casein hydrolyzate solution (100 g / l Oxoid L41) was added to the fermenter at 0.75 g / l. <sup>for</sup> hour.
During the cultivation, when the turbidity absorbance at 550 nm reached approximately 50, the carbon source was depleted resulting in a rapid increase in the oxygen partial pressure (dOT) from 50% air saturation. At this point, glycerol (470 g / l), yeast extract (118 g / l) and ammonium sulfate (118 g / l) were added to the medium in an amount that caused a turnover and a return to
145 returning the dOT to 50% air saturation with stirring, reaching approximately 70 to 80% of maximum. The rate of addition of casein hydrolyzate was still maintained at 0.75 g / l / h. After approximately 18 hours, when the presence of large amounts of inclusion particles in most cells was microscopically identified, the bacteria cells were centrifuged in a Sorvall RC3B centrifuge at 7000 g for 30 minutes at 4 ° C and frozen at -80 ° C.
c / Purification
Purification was performed as described in Reference Example 3 (b).
Reference example 12
Preparation / “Met”<sup>1</sup>, Ser<sup>17,27,6</sup>°<sup>,65</sup>Human G-CSF using a production vector including the T7A3 promoter and an EcoRI-SalI fragment containing the T7A3 promoter and a leader sequence for the ribosome binding site and the pro / "Met" gene<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>77 of human G-CSF was cloned into plasmid M13 mp18 as described in part d / of Reference Example 3. The sequence of the EcoRI-SalI fragment is expressed in SEQ ID NO: 47 and shown in Fig. 3; SEQ ID No. 47 contains the EcoRI restriction site (nucleotides 1-6), the sequence for the A4 promoter of bacteriophage T7 (nucleotides 7-52), the leader sequence for the trp ribosome binding site (nucleotides 53-7S), and the translation codon (nucleotides 79-). 81 /. Figure 3 shows the nucleotide sequence of / Met<sup>1</sup>, Ser<sup>17,27</sup>7 human G-CSF that terminates in the SalI restriction site. It will be appreciated that the 3 terminal ATG codon of SEQ ID NO: 47 immediately follows the ACT codon which encodes the threonine (amino acid 1) of Figure 3. This implies that the 5 'nucleotide sequence of AATTCAGT is not present in the EcoRI-SalI fragment. . The EcoRI-SalI fragment can thus be prepared by splicing from plasmid pICI 1295 (see Reference Example 31). Point mutagenesis
146 was made on a single stranded LNA as described in Reference Example 6, using the oligonucleotide of SEQ ID NO: 28 to change the codon for Gln at position 11 to the codon for Arg. The double-stranded RF DNA was prepared from plaque containing the Gin '' -> Arg '' change described in Reference Example 7, except for step B3, incubation for 3 hours instead of 5 hours, followed by EcoRI digestion (as previously described) and SnBI (as described in Reference Example 13).
The resulting 144 bp EcoRI-SnaBI fragment containing the T7A3 promoter, the leader sequence for the trp ribosome binding site and the Arg 'codon gene fragment was isolated and ligated with the EcoRI-SnaBI vector cleaved from pICI 1327 from * λ rc / containing codons for Ser and Ser <sup>5</sup> and is described in Reference Example 11 /. The ligation mixture was used to transform E. coli MSD522 cells, transformed cells were selected by growth on L-agar plates containing tetracycline (15 [mu] g / ml). Colony-derived DNA plasmid containing the putative T7A3 promoter and the gene sequence 'Met' ', Arg, Ser'<sup>7,27</sup>’<sup>60</sup>’<sup>65</sup>7 human G-CSF were identified by DNA sequencing of the isolated plasmid and designated as pICI 1386.
The fermentation was performed based on two alternative processes b / ac / see below. Procedure b) was carried out at 37 ° C and after 16 hours of fermentation as mentioned, 35 g / l of microbial biomass and the amount of "Met", Arg, Ser 'produced were recovered.<sup>7,27</sup>’<sup>6</sup>°’<sup>65</sup>7 human G-CSF was determined to 7 g / L culture medium. Process c / was carried out at a temperature of 33 ° C and the fermentation, according to the use of a lower culture temperature, proceeded more slowly. In this culture labeled c /, after 35 hours, 55 g / l of microbial biomass were obtained and the yield of "Met", Arg "<sup>7</sup>’<sup>27</sup>»65y human G-CSF was 15 g / L culture broth.
(b) E coli strain CGSC 6333 (genotype F ', X, lac), obtained from E. coli of the Genetic Stock Center, was trans
147 was formed with plasmid pICI 1386. The resulting strain CGSC 6300 (pICI 1386) was purified and stored in glycerol at -80 ° C. A portion of the culture was removed from the stock mixture and plated on L-tetracycline-containing agar plates so that single colonies could be isolated after growth / overnight for about 16 hours at 37 ° C.
A separately grown CGSC 6300 colony (pICI1386) was collected and resuspended in 10 ml of culture medium containing L-tetracycline and immediately afterwards 100 µl of this solution was used to inoculate each of the twenty Erlenmayer flasks (250 ml) containing 75 ml growth L-tetracycline media. After growing for 16 hours at 37 ° C on a shaker, the contents of all flasks were combined and used to inoculate a fermenter containing 20 liters of modified culture medium LCM50. The composition of the LCM50 culture medium is shown in Table 1.
Table 1
Composition of culture medium
<td>Modified culture medium</td><td>LCM50 / A /</td>
<td>Folders Folder lované</td><td>are dissolved in rainwater / g / 1 /</td>
<td>KH<sub>O</sub>P0. 2 4</td><td> 3,0</td>
<td>On<sub>2</sub>HP0<sub>4</sub></td><td> 6,0</td>
<td>NaCl</td><td> 0,5</td>
<td>Casein hydrolyzate / Oxoid L41 /</td><td> 2,0</td>
<td>/NH.ASO, 4 2 4</td><td> 10,0</td>
<td>Yeast extract / d ¥ co /</td><td> 20,0</td>
<td>Glycerol</td><td> 35,0</td>
<td>MgSO<sub>4</sub>.7H<sub>2</sub>O</td><td> 0,5</td>
148 Table 1 / continued /
CaCl<sub>2</sub>.2H<sub>2</sub>O
Thiamin
FeSO4 / citric acid Trace element solution (TES) Tetracycline
0,03
0,008
0.04 / 0.02 / 0.5 ml / 1 / / 10 mg / 1 /
The fermentation was carried out at 37 ° C and pH
6.7, which was automatically controlled by the addition of 6 M sodium hydroxide solution. The oxygen partial pressure (dOT) was stabilized at 50% air saturation and was initially regulated automatically by adjusting the stirrer speed. The air fraction was initially 20 l / min, which corresponds to the flow rate of one volume of air per minute volume (VVM) and was manually increased to 45 l / min when the stirrer speed reached its maximum (1000 rpm) .
Fermentation was carried out for 16 hours, during which time samples were taken to measure the turbidity absorbance of the culture (ODcj-r), the biomass concentration, the total micro -111 protein concentration and the amount of accumulated (Met, Arg, Ser<sup>17</sup>’<sup>27</sup>human G-CSF in bacterial cells. Accumulation Amount / Met<sup>-1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>Human G-CSF was monitored after staining of Coomassie blue gels after SDS-PAGE-electrophoresis, which was always performed with whole lysates of bacterial samples as described. The total microbial protein content was determined by the Lowry method. The yeast extract solution (225 g / l) was added to the fermenter 4.5 hours after the start of inoculation at a rate of 1.7 g / l / h.
When the carbon source (glycerol) was depleted in the growth medium, dOT rapidly decreased from 50% air saturation.
At this stage, nutrients containing glycerol (714 g / l) and ammonium sulfate (143 g / l) were added because the oxygen consumption rate (OUR) reached the maximum oxygen consumption rate in the fermenter (OTR) just before it was when the carbon source was depleted, nutrients were added to the fermenter in an amount that knew the growth of the bacteria to such an extent that the oxygen uptake rate (OUR) was approximately 80-90% of the maximum oxygen uptake rate in the fermenter (OTR). The nutrient addition rate was manually adjusted to the original rate and then dOT was maintained at a maximum of 5θ% aeration under the conditions described above.
c) The fermentation process described in (b) was repeated, but at 30 ° C for 35 hours. Except for the fermentation temperature of 30 ° C, the medium and fermentation conditions were the same as in (b).
d) Purification was performed as described in Reference Example 3 (f).
Reference Example 13
Preparation<sup>-1</sup>, Ser<sup>17</sup>J hu G-CSF
Procedure as described in Reference Example 5 for Preparation / Met ”<sup>1</sup>, Ser<sup>17</sup> ’<sup>27</sup>7 hu G-CSF was repeated with the following exceptions:
1 / Double helix LNAs for phosphorylation were prepared from the oligonucleotide sequences of SEQ ID Nos. 24, 25, 3 and 4, wherein SEQ ID Nos. 3 and 4 may be replaced by SEQ ID Nos. 26 and 27, which were used in Reference Examples 3. , 4 and 5;
2) The double helix DNA described in (1) was phosphorylated with T4 polynucleotide kinase but was digested with SnaBI (10 units) in 1 χ M buffer
150 (BCL, 30) at 37 ° C for 2 hours;
3) followed by ethanol purification, with the 72 bp EcoRI-SnaBI fragment purified instead of the 143 bp EcoRI-MstII fragment;
4) a synthetic EcoRI-SnaBI fragment was cloned into the plasmid vector pAG88 as described in Reference Example 1, and to prepare the vector, pAG88 was digested with SnaBI / 20 units, BCL / in 1 µM buffer (BCL, 100 µl) at at 37 ° C for 2 hours instead of Mstil in 1 χ H buffer;
5) followed by ethanol precipitation where the large EcoRI-SnaBI fragment was purified on a 1% agarose gel instead of the large EcoRI-MstII fragment;
6) a plasmid containing the Met, Ser7hu G-CSF gene was designated pICI 1105.
B. Preparation of "Met"<sup>1</sup>, Ser<sup>17</sup>7-methyl-polyethylene glycol-modified G-CSF 5000
Solution / Met<sup>-1</sup> , Ser<sup>17</sup>Dilute G-CSF (300mg, 6.25mg / ml) in water to a volume of 75ml with 1.1M sodium borate borate pH
8.9 to give a protein solution (4 mg / ml) in 0.4 M sodium borate, pH 8.7. To this solution was added dropwise an aqueous solution (75 ml) of methylpolyethylene glycol p-nitro phenyl carbonate with an approximate molecular weight of 5θθΟ (Sigma Chemical Co.). Ltd / 100 equivalents per mole of protein; 20 equivalents per amine group). The reaction mixture was stirred at room temperature for 3 hours, then quenched by the dropwise addition of ethanolamine hydrochloride pH 8 (10 equivalents per mole of active methylpolyethylene glycol). The reaction mixture was diluted to a volume of 350 mL with 0.1 M ammonium bicarbonate pH 8 and alternately concentrated and diluted with this solvent in an Amicon stirred cell equipped with a YM30 membrane (permeability limit of 3θ kDa) until a yellow color was no longer observed.
The final concentrate (25 ml) is then chromatographed
151 on a column (5 x 90 cm) of Ultrogel AcA54 equilibrated with PBSazide, which is also an eluent. Fractions containing the modified protein were identified by protein monitoring at 280 nm and methylpolyethylene glycol by titration with an iodine / iodide potassium system; these fractions are combined and totally dialyzed against water. This product was concentrated in an Amicon with a YM30 membrane (30 kDa cutoff limit) to a concentration of 5 mg / ml, and the concentrated solution was then filtered under sterile conditions through a 0.22 µm filter and stored at 4 ° C before use.
SLS-PAGE-electrophoresis of the final modified product shows that there was no unreacted? Met <sup>1</sup>, Ser<sup>l7</sup>7-G-CSF and that all the product is of high molecular weight. Titration of the retentates and filtrates with the iodine / potassium iodide system showed that repeated ultrafiltration at pH 8.0 on the YM30 membrane effectively removed all non-protein bound polyethylene glycol. The final product contains about 3.5 moles of methylpolyethylene glycol covalently bound to the protein. Specific activity of unmodified
The Q · derivative (0.8 x 10 U / mg) decreased by 0.8 χ 10/10% in the modified product. The product is completely stable and shows no change in specific activity in solution up to 10 mg / ml (protein) at 37 ° C over 14 days.
Reference Example 14
Preparation / “Met”<sup>1</sup>, Arg<sup>11</sup>’<sup>23</sup>, Ser<sup>17,27</sup>’<sup>60</sup>’<sup>65</sup>7 G-CSF modified with methylpolyethyl glycol 5000
A. Preparation / Met<sup>-1</sup>, Arg<sup>11</sup>’<sup>23</sup>, Ser<sup>17</sup>’<sup>27</sup>'θ °' ^<sup>5</sup>_7hu GCSF
Mutagenic template M13mp18 containing pro / “Met” gene<sup>1</sup>,
Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’6°’6<sup>5</sup>7-G-CSF was prepared as described in (d) of Reference Example 3 with the plasmid pICI
1239 replaced by pICI 1080. The procedure described in the reference
Example 152 was repeated using the above template with a mutagenic oligonucleotide named SEQ ID NO. This procedure caused a change in the codon for Lys at position 23 to the codon for Arg. Double helical RFDNA was prepared from one phage containing the desired change and the expression gene set was isolated and cloned as described in Reference Example 15 (see below) to obtain pICI 1388.
The other procedure used to obtain the title compound is the same as that described in Reference Examples 3 and 4.
B. Preparation / Met<sup>-1</sup>, Arg<sup>11</sup>’<sup>23</sup>, Ser<sup>17</sup> ’<sup>27</sup> ’<sup>80</sup>’<sup>85</sup>7-methyl-polyethylene glycol-modified G-CSF 5300
Solution / Met<sup>1</sup>, Arg<sup>11</sup>’<sup>23</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>85</sup>7h of G-CSF (300 mg) in 0.1 M sodium borate, pH 6.0 was concentrated to a volume of 37.5 ml by ultrafiltration through an Amicon YM10 membrane (10 kDa cut-off). To this solution was added an equal volume of 0.8 M sodium borate pH 8.8 and then methyl polyethylene glycol p-nitrophenyl carbonate having an approximate molecular weight of 5000 (Sigma Chemical Company Lfd // 100 equivalents per mole).<sup>-1</sup>, Arg<sup>11</sup>’<sup>23</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>80</sup>’<sup>8</sup>Hu 7 G-CSF (dissolved in water (75 ml)). The reaction was carried out at 20 ° C with gentle stirring for 3 hours, then quenched by the addition of 1 M ethanolamine hydrochloride pH 8.0 (15 ml, 10 equivalents per mole of active methylpolyethylene glycol). The reaction mixture was diluted to a volume of 500 ml with 0.1 M ammonium bicarbonate pH 3.0, then diafiltered against 10 liters of the same buffer using an Amicon CH2A-IS spiral cartridge equipped with a S1Y30 membrane (30 kDa cutoff) until the yellow color of p-nitrophenol is no longer visible in the retentate.
The retentate was concentrated to a volume of 300 mL and placed in an Amicon 8400 stirred cell equipped with a YM30 membrane (30 kDa cutoff). The retentate was concentrated to a volume of 50 ml and reconstituted to a volume of 300 ml of 0.1 M ammonium bicarbonate pH 8.0. This procedure was repeated four times and the product was finally concentrated to a volume of about 25 ml. The concentrated product solution is then chromatographed on a column (5 x 90 µm) of Ultrogel AcA54 in equilibrium with 10 mM sodium phosphate, 150 mM sodium chloride, pH 7.1 containing 1 mg / ml sodium azide (PBS-azide). Fractions containing the modified protein were identified by protein monitoring at 280 nm and methylpolyethylene glycol titration with iodine / potassium iodide / CR Acad. Sci., Paris 274, 1617 (1972); these fractions are combined and totally dialyzed against water. The final product is concentrated by ultrafiltration on an Amicon YM30 membrane to a concentration of & gt;
11.5 mg / ml, filtered through a 0.22 µm filter under sterile conditions and stored at 4 ° C before use.
SDS-PAGE-electrophoresis of the modified product showed that no unreacted / Met was left.<sup>-1</sup>, Arg<sup>11</sup>’<sup>2</sup>^,
Ser<sup>17</sup>’<sup>27</sup>’<sup>85</sup>7-G-CSF and that all the product is in the high molecular weight band during electrophoresis. Titration of the filtrates and retentates with the iodine / potassium iodide system showed that repeated diafiltration at pH 8.0 resulted in effective removal of all non-protein bound methylpolyethylene glycol on the YM30 membrane.
The final product contained about 3.5 moles of methyl polyethylene glycol covalently bound to the protein. Specific
Q activity of the unmodified derivative (2.5 x 1 CrU / mg) decreased to 3.5 x 10 U / mg / 14% for the modified derivative. · The product obtained was completely stable and showed no change in specific activity in solution up to 10 mg / ml (protein) at 37 ° C for 14 days.
Reference Example 15
Preparation / “Met <sup>1</sup>, Glu<sup>15</sup>, Ala<sup>20</sup>’<sup>28</sup>, Ser<sup>17,27</sup>Methylpolyethylene glycol 5000 modified G-CSF
A / Preparation / “Met<sup>-1</sup>, Glu<sup>15</sup>, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>2</sup>^’<sup>28</sup>, Arg
- 154 M13mp18 mutagenic template containing the β-Met gene<sup>1</sup>, Glu<sup>1</sup>5, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>28</sup>’<sup>28</sup>, Lys<sup>3</sup>The G-CSF was prepared as described in (d) of Reference Example 3, wherein plasmid pICI1266 was replaced with plasmid pICI1080.
The procedure described in Reference Example 7 was repeated using the above template with the mutagenic oligonucleotide designated SEQ ID No. 37. This changed the codon for Lys at position 30 to the codon for Arg. Double helical RF DNA was prepared from one phage containing the desired changes. An EcoRI-SalI expression gene set was isolated and cloned into pICI 0080 as described in Reference Example 11 to obtain pICI 1343.
Further work-up to give the title compound was carried out as described in Reference Example 7 and purification was carried out as described in Reference Example 8.
B / Preparation / “Met<sup>1</sup>, Glu<sup>15</sup>, Ala<sup>26</sup>’<sup>28</sup>, Ser<sup>17</sup>’<sup>27</sup>, Arg<sup>3</sup>Methyl G-CSF modified with methylpolyethylene glycol
This product was prepared as described in Reference Example 14. The final product contained 4 moles of methylpolyethylene glycol covalently bound to one mole of protein. The specific activity of the unmodified derivative (0.9 χ 1U / mg) decreased to 0.6 xg for the modified product
U (mg / 7%). The product obtained was completely stable and showed no change in specific activity in solution up to 10 mg / ml (protein) at 37 ° C for 14 days.
Reference Example 16
Preparation / “Met<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>115</sup>’<sup>118</sup>, Glu<sup>111</sup>7 methyl G-CSF modified with methylpolyethylene glycol 5000
A / Preparation / Met<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>115</sup>’<sup>116</sup>, Glu<sup>111</sup>Human G-CSF
Ά'β-Α
Repeat the procedure described in Reference Example 7 using the mutagenic template M13mp18 containing the pro / Met gene<sup>-1</sup>, Ser<sup>17</sup>’<sup>27</sup>7 The G-CSF described in Reference Example 3 or 5. The mutagenic oligonucleotide used is designated SEQ ID 30 (will be defined below).
The GCT triplet serves to convert Thr at position 116 to Ser, the AGA triplet serves to convert Thr at position 115 to Ser, and the TTC triplet serves to convert Ala at position 111 to Glu. The mutagenesis procedure essentially described in Reference Example 7 is used and the expression set of genes is transferred to an expression plasmid to give pICI 1243. Fermentation and purification were carried out as described in Reference Examples 3 and 4.
B / Preparation / “Met<sup>1</sup> , Ser<sup>17</sup>’<sup>27</sup>’<sup>115</sup>’<sup>116</sup>, Glu<sup>111</sup> 7hu G-CSF γ modified with methylopolethylene glycol 5000
This product was prepared as described in Reference Example 14. The final product contained about 4 moles of methylpolyethylene glycol covalently bound to a mole of protein. Specific activity of modified derivative / 0.7
S x 10 U / mg / decreased to 0.8 x 10 U / mg / 11 $ for the modified product. The product obtained was completely stable and showed no change in specific activity in solution up to 10 mg / ml (protein) at 37<sup>0</sup> for 14 days.
Reference Example 17
Preparation / “Met<sup>-1</sup>, Arg<sup>11</sup>’<sup>1</sup>^, Ser<sup>17</sup>’<sup>27</sup>Lys (R) 7-G-CSF modified with methylpolyethylene glycol 5000
A / Preparation / “Met”<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>Arg<sup>1</sup>Human G-CSF
The procedure described in the reference example is repeated. m using the mutagenic mlat3 Ml18 containing the pro / Met gene<sup>-1</sup>, Ser<sup>17.27</sup>7 G-CSF described in Reference Examples 3 and 5. The mutagenic oligonucleotides used are designated as SEQ ID NO: 28, SEQ ID NO: 31 and SEQ ID NO: 32 (to be defined below).
The TTT triplet of SEQ ID NO: 31 serves to convert Trp at position 58 to Lys, while in SEQ ID NO: 32 the second GCG triplet serves to convert Tyr at position 165 to Arg.
The mutagenesis procedure was initially performed as a double priming experiment using SEQ ID NO.31 and SEQ ID NO.32 as mutagenic oligonucleotides as described in Reference Example 6. Two plaques are obtained, both of which have a change of SEQ ID NO: 32 (Tyr 165 Arg) but have no change of SEQ ID NO: 31. a mutagenic template in double priming mutagenesis using SEQ ID NO: 28 and SEQ ID NO: 31 as mutagenic primers. Two plaques were obtained, both plaques having a complete set of changes and the expression set was transferred to the expression plasmid to give pICI 1246. Fermentation and purification were performed as described in Reference Examples 3 and 4.
B / Preparation / “Met”<sup>1</sup>, Arg<sup>11</sup>’<sup>165</sup>, Ser<sup>17</sup>’<sup>27</sup>, Lys<sup>58</sup>7-G-CSF modified with methylpolyethylene glycol 5000
This product was prepared as described in Reference Example 14. The final product contained ca.
4.5 moles of methylpolyethylene glycol covalently bound to a mole of protein. The specific activity of the unmodified derivative (0.8 x 10 ^ U / mg) decreased to 0.1 χ 10 for the modified product<sup>9</sup> U (mg / 13%). The product obtained would be completely stable and showed no change in specific activity in solution up to 10 mg / ml (protein) at 37 ° C for 14 days.
Reference Example 18
Preparation / “Met<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>44</sup>’<sup>51</sup>’<sup>55</sup>, Lys<sup>49,58</sup>7 methyl G-CSF modified with methylpolyethylene glycol 5000
157
A / Preparation / “Met<sup>-1</sup>, Ser<sup>17</sup>’<sup>27</sup>, Ala<sup>44</sup>’<sup>51,55</sup>, Lys<sup>49,58</sup>7 human G-CSF
The procedure described in Reference Example 7 is repeated using the mutagenic template M1 3nip18 containing Example 3 or 5. The oligonucleotides used are designated as SEQ ID NO.
In SEQ ID No.35, AGC triplets serve to convert Gly to Ala at position 51 and Pro to Ala at position 44, and the TTT triplet serves to convert Leu to Lys at position 49. In SSQ ID No.36, the TTT triplet serves to convert Trp to Lys at position 58 and the second AGC triplet serve to convert Gly to Aln at position 55.
Mutagenesis was performed as the double priming experiment described in Reference Example 6. 16 plaques were obtained. Eight plaques were screened by DNA sequencing as described in Reference Example 7. All plaques had changes of SEQ ID NO: 36 (Gly 55 Ala, Trp 58 Lys) but had no changes of SEQ ID NO: 35. single priming mutagenesis template using SEQ ID No. 35 as a mutagenic promoter. This provides 50 plaques, of which 3 of these plaques were screened by DNA sequencing and two of them had a complete set of changes. This expression set of genes was transformed into an expression plasmid to give pICI 1297. Fermentation and purification were performed as described in Reference Examples 3 and 4.
B / Preparation / “Met<sup>1</sup>, Ser<sup>17</sup>»<sup>27</sup>, Ala<sup>44</sup>’<sup>51</sup>’<sup>55</sup>, Lys<sup>49,58</sup>7-G-CSF modified with methylpolyethylene glycol 5000
This product was prepared as described in Reference Example 14. The final product contained about 3.5 moles of methylpolyethylene glycol covalently bound to a mole of protein. Specific activity of unmodified derivative / 0,75 x 1 θ<sup>9</sup> U / mg / decreased for modified product
158 Q
0.32 χ 10<sup>7</sup> U (mg / 47%). The product obtained was completely stable and showed no change in specific activity in solution up to 10 mg / ml (protein) at 37 ° C for 14 days.
Reference Example 19
Preparation / “Met”<sup>1</sup>, Arg<sup>11</sup>’<sup>16</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60,6</sup>Methylpolyethylene glycol-modified human GCSF 5000 A / Preparation / "^ e ^"<sup>1</sup>, Arg<sup>11</sup>’<sup>16</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>63</sup>’<sup>6</sup>^ 7 hu G-CSF
The procedure described in Reference Example 14 was repeated using the oligonucleotides designated SEQ ID NO: 42, which replaced the oligonucleotide of SEQ ID No. 38 here (said nucleotide used to convert the codon for Lys at position 16 to Arg), to give pICI 1387.
Further processing to obtain / "Met"<sup>1</sup>, Arg<sup>11</sup>*<sup>1</sup>^, Ser<sup>17</sup>’<sup>27</sup>The G-CSF and the purification of this compound was carried out as described in Reference Examples 3 and 4.
B / Preparation / “Met <sup>1</sup>, Arg<sup>11</sup>’<sup>1</sup>^, Ser<sup>17</sup>’<sup>27</sup>Methylpolyethylene glycol modified G-CSF 5000
This protein precipitates in total dialysis against water during the final step of the purification procedure described in Reference Example 4. The precipitate is redissolved in 0.1 M sodium borate pH 8.0 and modified with methylpolyethylene glycol 5000 as described in Reference Example 14. The final product contained 3.5 moles of methylpolyethylene glycol covalently bound to a mole of protein. Specific activity of unmodified derivative / 2.3 x 10 0<sup>9</sup>
Q
U / mg / decreased to 3.6 x 10 U / mg / 16% for the modified product. The product obtained was completely stable and showed no change in specific activity in solution up to 10 mg / ml (protein) at 37 ° C for 14 days.
159 Reference Example 20
Preparation<sup>1</sup> , Arg<sup>11</sup>’<sup>34</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>7 GCSF Methylpolyethylene Glycol Modified 5000 A (Preparation) Met<sup>-1</sup>, Arg<sup>11</sup>’<sup>34</sup>, Ser<sup>17</sup> ’<sup>27</sup> hu G-CSF
The procedure described in Reference Example 14 was repeated using the oligonucleotides designated SEQ ID No. 39, which replaced the oligonucleotide of SEQ ID No. 38 herein. Said oligonucleotide serves to convert the codon for Lys at position 34 to Arg to form pICI1389.
Further work-up to obtain the title compound and purification of this compound were carried out as described in Reference Examples 3 and 4.
B / Preparation / ^ Met<sup>1</sup>, Arg<sup>11</sup>’<sup>34</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>č5</sup>7 hu G-CSF modified with methylpolyethylene glycol 5000
This product was prepared as described in Reference Example 14. The final product contained about 4 moles of methylpolyethylene glycol covalently bound to a mole of protein. Specific activity of unmodified derivative
Q (1.4 x 10 U / mg) decreased the modified product to 2.0
Q x 10 U / mg (14%). The product obtained was completely stable and showed no change in specific activity in solution up to 10 mg / ml (protein) at 37 ° C for 14 days.
Reference example 21
Preparation / ”Met<sup>-1</sup>, Arg<sup>11</sup>’<sup>4</sup>^, Ser<sup>17</sup>’<sup>27</sup>Methylpolyethylene glycol modified human GCSF 5000 A (Preparation) Met<sup>-1</sup>, Arg<sup>11</sup>’<sup>4</sup>^, Ser<sup>17,27</sup>hu G-CSF
The procedure described in Reference Example 14 was repeated using the oligonucleotide of SEQ ID NO: 40, which replaces the oligonucleotide of SEQ ID NO: 38 here at 160. Said oligonucleotide serves to convert the codon for Lys at position 40 to Arg to form pICI 1390.
Further work-up to obtain the title compound and purification of this compound were carried out as described in Reference Examples 3 and 4.
B / Preparation / “Met<sup>-1</sup>, Arg<sup>11</sup>’<sup>40</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>7 hu G-CSF modified with methyl polyethylene glycol 5300
This product was prepared as described in Reference Example 14. The final product contained about 4 moles of methylpolyethylene glycol covalently bound to a mole of protein. The specific activity of the unmodified derivative q / 1.3 x 13 U / mg / decreased for the modified product to 3.3 x θ
0 The product obtained was completely stable and showed no change in specific activity in solution up to 13 mg / ml (protein) at 37 ° C for 14 days.
Reference Example 22
Preparation (Met), Ala<sup>1</sup>, Thr \ Tyr<sup>4</sup>'Arg ^'<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>7 methyl G-CSF modified with methylpolyethylene glycol 5000
A / Preparation / Met<sup>-1</sup>, Ala<sup>1</sup>, Thr \ Tyr<sup>4</sup>'Arg ^'<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>7 hu G-CSF
The procedure described in Reference Example 14 was repeated using the oligonucleotide of SEQ ID NO: 41, which replaced the oligonucleotide # 38 here, and used to convert the codons for Thr, Leu, Gly and Pro at positions 1, 3, 4, and 5 to Ala. , Thr, Tyr respectively. Arg to form pICI 1391. The polypeptide of this example illustrates that a modification of the invention can be applied to a polypeptide known to have G-CSF activity to improve stability in the flow of said polypeptide. A known polypeptide is /<sup>-</sup>Met <sup>1</sup>, Ala<sup>1</sup>, Thr<sup>3</sup>, Tyr<sup>4</sup>, Arg<sup>5</sup>, Ser<sup>17</sup>7-G-CSF, which is described in European Patent 272,703 (Kyowa Hakko Kogyo Co.). Ltd./.
Further work-up to obtain the title compound and purification were carried out as described in Reference Examples 3 and 4.
B / Preparation / ”Met<sup>-1</sup>, Ala<sup>1</sup>, THr<sup>3</sup>, Tyr<sup>4</sup>, Arg<sup>5</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>7 hu G-CSF modified with methylpolyethylene glycol 5000
This product was prepared as described in Reference Example 14. The final product contained about 4 moles of polyethylene glycol covalently bound to a mole of protein. Specific activity of unmodified derivative / 1.5 x
8
10<sup>7</sup> U / mg / decreased to 2.0 x 10 U / mg / 14% for the modified product. The product obtained was completely stable and showed no changes in specific activity in solution up to 10 mg / ml (protein) at 37 ° C for 14 days.
Reference Example 23
Preparation / Met<sup>-1</sup>, Arg<sup>11</sup>, Ser<sup>17,27,60,65</sup>7 G-CSF modified with methyl polyethylene glycol 2000 a) Preparation of methylpolyethylene glycol p-nitrophenyl carbonate with approximate molecular weight 2000
To a solution of p-nitrophenyl chloroformate (2.32 g, 11.5 mmol) in acetonitrile (250 mL) at 0-5 ° C was added, with stirring, an average molecular weight of 2000 (Sigma Chemical Co.Lzd .; 20 g (10 mmol) and then dropwise triethylamine (1.11 g); 1.53 ml, 11 moles). The mixture was then allowed to warm to room temperature and stirred for 24 hours at 20 ° C. The precipitated triethylammonium chloride is separated by filtration (0.46 g from a theoretical amount of 1.375 g) and the filtrate is diluted after dilution.
162 1 liter of diethyl ether (anhydrous) was allowed to stand at 0-5 ° C for 24 hours. The white precipitate was collected by filtration and reprecipitated by dissolving in a minimum volume of ethanol at 35-40 ° C and cooling to 0 ° C. This product was precipitated from a 1: 5 v / v mixture of acetonitrile and diethyl ether to give the final product, which was washed with ether and dried under vacuum to give 15.5 g of a white solid. Elemental microanalysis: 53.5% C, 9.1 # H, 0.4 # N, and 0 # Cl, indicating the absence of chloroformate in the final product.
b / Preparation / Met<sup>-1</sup> , Arg<sup>11</sup>, Ser<sup>1 7</sup> ’<sup>27 ,65</sup>7 hu G-CSF modified with methylopolyethylene glycol 2000
Solution / J4et<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>60</sup>’<sup>65</sup>7hu G-CSF (1.5 g) in PBS-azide (300 ml, 5 mg / ml) was dialyzed against 0.4 M sodium borate pH 8.8 (7 x 7 L) to a final volume of 375 ml / 4 mg (ml). To this solution was added dropwise an aqueous solution (375 ml) of methylpolyethylene glycol p-nitrophenyl carbonate having an approximate molecular weight of 2000 / 10.0 g, 60 equivalents, 12 equivalents per amine group v / Met.<sup>-1</sup>, Arg<sup>11</sup>, Ser<sup>17,27</sup>’^^’<sup>85</sup>7-G-CSF]. The reaction is carried out for 3 hours at room temperature with gentle stirring and terminated by dropwise addition of ethanolamine hydrochloride, pH 8.0 (10 equivalents per mole of active methylpolyethylene glycol).
The reaction mixture was concentrated on a YM10 membrane in an Amicon stirred cell (10 kDa cutoff limit) at 4 ° C to a final retentate volume of 50 mL. This retentate was diluted with 0.1 M ammonium bicarbonate pH 8.0 (450 mL) and re-concentrated to a previous volume of 50 mL. This operation is repeated seven times. The final concentrate was introduced into a second stirred Amicon cell with a YM30 membrane (30 kDa cut-off), diluted to a volume of 500 ml and concentrated to a volume of 50 ml. This procedure was repeated twice and the product was concentrated to a final volume of 50 ml. The concentrated product solution is chromatographed in two equal portions on a 5 x 90 cm column of Ultrogel
- 163 AcA54 in equilibrium with P3S-azide.
Fractions containing modified protein were identified by monotoric protein at 280 nm and methylpolyethylene glycol titration with iodine / potassium iodide / CR
Acad. Sci. Paris 274, 1617 (1972); these fractions are combined and totally dialyzed against water. The final aqueous solution was concentrated in a stirred cell Amicon with a θ3θ membrane to a volume of 50 mL. This concentrate is diluted to 501 ml with water, concentrated again and repeated five times. The final concentrate is filtered through a 0.22 µm filter under sterile conditions and stored at 4 ° C before use.
Protein evaluation by amino acid analysis after acid hydrolysis shows a total content of 47% / Met ”<sup>1</sup>,
Arg<sup>11</sup>, Ser<sup>l7</sup>*<sup>27</sup>G-CSF in the final modified product. SDS-PAGE electrophoresis of the reaction mixture after 3 hours and the final aqueous product solution showed that no unreacted protein remained and that all of the product was in the high molecular weight band.
Titration of the filtrates and retentates with the iodine / potassium iodide system showed that repeated ultrafiltration on the YM30 membrane removed substantially all protein-free methylpolyethylene glycol. This was confirmed by HPLC analysis of rpC4 (Dynamax 3θΟΑ 12 µm) using a gradient of 40-90% acetonitrile with 0.1% TFA in water-0.1% TFA, and monitoring UV absorption at 280 nm at in which a single peak was detected. The fractions were lyophilized, reconstituted with water and monitored for protein at 280 nm and for polyethylene glycol titration with iodine / potassium iodide, with one coincident peak detected. Any residual non-protein methylpolyethylene glycol would otherwise be detected as a distinctly separated pre-eluted positive peak.
Titration of iodine / potassium iodide / Met ”<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>657 hu G-CSF covalently bound to methylpolyethylene glycol 2000 gave indeterminate results and thus did not allow evaluation of PEG: protein ratios. The specific activity of the non-164 Q-derivative (1.2 x 13 µ / mg) decreased to 1.5 x 13 U / mg (13%) in the modified product. The product obtained was completely stable and showed no change in specific activity in PBS solution up to 10 mg / ml (protein) at 37 ° C for 14 days.
Reference example 24
Preparation / “Met<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>63</sup>’<sup>65</sup>7 G-CSF modified with methylpolyethylene glycol 750 a) Preparation of methylpolyethylene glycol p-nitrophenyl carbonate having an approximate molecular weight of 750
To a solution of p-nitrophenyl chloroformate (5.1 g & gt; 25.3 mmol) and cetonitrile (50 ml) at a temperature of 3-5 ° C was added, with stirring, an average molecular weight of 750 weight average methyl polyethylene glycol (Sigma Chemical Co.). Ltd; 20 g, 26.67 mmol) and then dropwise over 30 minutes triethylamine (2.69 g, 3.71 mL, 26.63 mmol). The reaction mixture was allowed to warm to room temperature and stirred for 8 hours. The precipitated triethylammonium hydrochloride was removed by filtration from the reaction mixture and the filtrate was diluted with diethyl ether / anhydrous; , Cooled to 0 ° C for four hours and filtered again. A total of 3.4 g of triethylammonium hydrochloride was isolated. The filtrate was evaporated under reduced pressure and dried in vacuo to give 23.5 g of a yellow waxy product.
Elemental microanalysis revealed zero chlorine content, indicating the absence of chloroformate in the final product.
Solution / Met<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup>’<sup>63</sup>’<sup>65</sup>7 hu G-CSF (250 mg) in PBS-azide (53 ml) was dialyzed against water and then against 0.4 M sodium borate pH 8.8. To the final solution (50 ml) at room temperature was added dropwise an aqueous solution (53 ml) of methylpolyethylene glycol 165 p-nitrophenyl carbonate with an approximate molecular weight of 750/100 equivalents, 20 equivalents per amino group in / "Met"<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17,27</sup>’<sup>6</sup>°’<sup>65</sup>7hu GG-CSF]. The reaction mixture was stirred at room temperature for 3 hours and quenched by the dropwise addition of ethanolamine hydrochloride pH 8 (10 equivalents per mole of active methylpolyethylene glycol).
The R-reaction mixture was then introduced into a stirred Amicon cell with a YM10 membrane (permeability limit of 10 kDa) and concentrated. The concentrate (25 ml) was diluted to a volume of 350 ml with 0.1 M ammonium bicarbonate pH 8 and concentrated to a volume of approximately 25 ml. This procedure is repeated five times. Final concentrate
(27 ml) is chromatographed on a column (5 x 90 cm) of Ultrogel Ac54 in equilibrium with PBS-azide, which also serves as the eluent. Fractions containing the modified protein were identified by monitoring the protein at 280 nm and methylpolyethylene glycol by titrating iodine / iodide potassium; these fractions are combined and totally dialyzed against water. The final product is concentrated in a stirred cell Amicon with a YM10 membrane. The final concentrate is filtered through 0.2 µm under sterile conditions and stored at 4 ° C before use.
Evaluation of the protein by amino acid analysis after acid hydrolysis shows a total yield of about 80% <sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27,</sup>6Q'6<sup>5</sup>7-G-CSF in the final modified product. The SDS-PAGE electrophoresis of the product shows one sharp band and thus shows that no unreacted / "Met" remains<sup>1</sup>, Arg<sup>11</sup>, Ser<sup>17,27</sup>’<sup>60,65</sup>7-G-CSF.
Titration of the filtrates and retentates with the iodine / potassium iodide system shows that repeated ultrafiltration at pH 8 through the YM10 membrane removed substantially all non-protein-bound methylpolyethylene glycol derivatives. Titration of iodine / potassium iodide / Met<sup>-1</sup>, Arg<sup>11</sup>, Ser<sup>17</sup>’<sup>27</sup> ’ ^<sup>7</sup>7hu G-CSF covalently bound to methylpolyethylene glycol gave very vague results and therefore did not allow to evaluate PEG: protein ratios. Specific biological activity neJ<sup>1</sup> ' ' ' '
<img file="CS9102285A3_D0006.tif" />
The 166 Q modified derivative (1.2 x 10 U / mg) decreased to 4 x 10 U / mg (33%) for the modified product. The product obtained was completely stable and showed no change in specific activity in PBS solution up to 10 mg / ml (protein) at 37 ° C for 14 days.
Reference Example 25
Characteristics of G-CSF derivatives before modification with methylpolyethylene glycol
Aqueous solution of derivatives of Reference Examples 1,3, 7, δ and 13 to 24 (protein concentration of about 1 mg / ml) were concentrated to a concentration of at least 11 mg / ml protein on an Amicon YM10 membrane at 4 ° C. The pH of the starting solution was to prevent precipitation during concentration
5.5 first adjusted to pH 8.5 by addition of ammonium hydroxide to give a final concentration of about 0.25 mM. After concentration, the pH of the solution dropped to about 8.0.
The protein concentration in the solution was adjusted to 10 mg / ml (determined from a 1 mg / ml solution giving a 1.0 g at 1.0 g) by adding 2-fold concentrated phosphate buffered saline. This 10 mg / ml solution of the derivative in 10 mM sodium phosphate, 150 mM sodium chloride, pH 7.4 (PBS) is a stock solution for determining homogeneity, identity, biological activity and stability in the prostein solution.
in
For each derivative, it was shown to be at least 95% single component by SDS-PAGE electrophoresis under reducing and non-reducing conditions and reverse phase high pressure liquid chromatography. Repeated amino acid analysis after acid hydrolysis in 6 N HCl at 110 ° C gave amino acid ratios in each derivative and accurate measurement of protein concentration in the stock solution. This protein concentration together with the average value of the bioassay titers obtained on at least six different days was
- 167 used to determine the specific activity of said derivatives. N-terminal sequence analysis and electrospray mass spectrometric analysis of selected derivatives confirmed the expected sequences and molecular weights.
Stock solutions of G-CSF derivatives modified with methylpolyethylene glycol (Reference Examples 1, 3, 7, 8, and 13 to 24) were prepared in the same manner to obtain the data presented in these Reference Examples.
Reference Example 26
Stability in solution of G-CSF and its derivatives
The approximate dilutions of the stock solution of G-CSF, its derivatives and these methyl-polyethylene glycol-modified G-CSF derivatives in phosphate buffered saline (P3S) at 4 ° C, described in Reference Example 25, were tested for solution stability. Solutions at 1 mg / ml, 5 mg / ml and sometimes 10 mg / ml protein in PBS were incubated at 37 ° C for 14 days.
These solutions were visually inspected at regular intervals for signs of clotting. After 14 days, each solution was centrifuged at 14,000 rpm for 20 minutes, the supernatant was removed by decantation, and the residual pellet was redissolved in PBS containing 1% (w / v) N-lauroylsarcosine. The total protein content of each supernatant and redissolved precipite was evaluated by measuring absorbance at 280 nm and the monomer content of unmodified G-CSF and its derivatives was determined by reversed phase high performance liquid chromatography. The results obtained were expressed as a percentage of the corresponding results obtained for solutions at the start of incubation and 1 mg / ml solutions incubated at 4 ° C for 14 days. Differences in total protein and monomer content were observed only in some of the re-dissolved pellets. In this way, the percentage can be determined for each initial concentration
Λ · '·. ',? .-. -
168 protein remaining in solution in the supernatants.
The following modification of G-CSF and all derivatives with methylpolyethylene glycol shows complete solution stability up to a concentration of 10 mg / ml as shown in Reference Examples 1, 3, 7, 8, and 13-24.
It was also shown that the specific activity of the product in each supernatant after incubation was the same as in the starting solution, with no differences observed in SDS-PAGE electrophoresis under reducing or non-reducing conditions.
Reference Example 27
Bio-determination
1 / Bio-determination of G-CSF
The cell line dependency factor, Paterson-G-CSF (FDCP-C-), obtained from the Paterson Institute in Manchester, GB, was cloned by limiting dilution in the presence of G-CSF.
A G-CSF sensitive clone, designated as EZ clone, was used to determine the activity of human recombinant G-CSF. 2,5 x 10<sup>3</sup> of FDCP-G clone E7 cells in 100 µl RPMI 1640 + 10% FCS was added to an equal volume of RPMI 1640 + 10% FCS containing G-CSF. Each G-CSF sample was measured twice in more than 10 dilutions. The final volume of RPMI 1640 (see Moore, GE et al., (1967), JAMA, 199, 519) + 10% FCS germinal calf serum / in each well of a microtiter plate (96 wells) was 200 µl. The microtiter plate was incubated at 37 ° C in 5 # CO<sub>2</sub> in a humidified incubator for 4 days. 1.0 µCi of the titrated thimidine was added to each well and incubated for 6 hours. Cells were harvested on a glass fiber filter and the level of radioactivity was determined by scintillation counting. It has been found that the level of incorporated tritiated thymidine is directly proportional to the amount of G-CSF present. Determination of FDCP-G
- 169 clone 17 was calibrated using recombinant human G-CSF obtained from Amershan International sg
a declared specific activity of 10 units / mg protein.
The activity of G-CSF samples was determined by comparison with known standard activity.
Units of G-CSF activity per ml were calculated according to the following formula:
Dilution of the G-CSF standard giving 50% of the highest incorporo-highest increment of ΙχG-CSF
Sample dilution giving 50%
Units / ml activity activity <sup>J</sup>H-thymidine growth incorporated <sup>3</sup>H-thymidine standard
2) Interleukin-2- (IL-2) -bio determination
Interleukin-2 was tested to determine the biology of activity by monitoring the growth of the mouse IL-2 dependent CTL cell line described by Robb et al. in J. Exp. Copper.
160 1126 1986 except that cells were incubated with IL-2 for 48 hours and modulated <sup>3</sup>H-thymidine for 6 to 8 hours.
3) Bio-determination of calcitonin using T47D cells
This calcitonin bioassay is based on the principle that the human breast cancer T47D cell line carries adenylate cyclase-coupled receptors for calcitonin / Martin et al. (1980) Biochem. Biophys. Res. Commun. 98: 150-156]. Stimulation of T47D cells with calcitonin results in the formation of increased intracellular levels of cyclic AMR, which can be quantified by radioimmunoassay. The amount of calcitonin or pegylated polyethylene glycol modified / calcitonin can be quantified in unknown samples by comparison with standard
- 170 curve prepared using known standard samples of caicitonin or pegylated calcitonin.
In this bioassay, T47D cells were prepared as suspensions in serous medium or phosphate buffered saline. These cells were aliquoted into test tubes and stimulated with standard calcitonin or pegylated calcitonin or with samples containing calcitonin or pegylated calcitonin in the presence of 10 M isobutylmethylxanthine for 23 minutes. Incubation was interrupted by placing the cell suspensions on a boiling water bath for five minutes. Cells were lysed by two freeze-thaw cycles in the presence of 0.31% Triton X-100 and dead cell debris was sedimented by centrifugation at 13,300 g for 5 minutes.
Cyclic AMP in the supernatant was quantified by radioimmunoassay using a commercially available TRK432 kit (Amersham International). The standard curve was obtained by plotting the amount of standard calcitonin or pegylated calcitonin versus quantified cyclic AMP levels. The amount of calcitonin or pegylated calcitonin in unknown samples is determined by interpolation from the corresponding standard curve.
Reference Example 28
Preparation of human calcitonin (hCT) modified with methylpolyethylene glycol 5000
Lyophilized chemically synthesized hCT was obtained from Cambridge Research Biochemicals, Gadbrook Park, Rudheath, Northwich, Cheshire, GB. Analysis of this product by ion exchange high pressure liquid chromatography and reverse phase chromatography yielded a single plk.
300 mg of this product in 75 ml of water was modified with methylpolyethylene glycol as described in Reference Example 3, except that 5 equivalents of modification were used per amine group in hCT
171 reagents. The reaction mixture was filtered through an Amicon YM10 membrane (10 kDa cut-off) at 4 ° C against 0.1 M ammonium bicarbonate pH 8.0 to remove unreacted hCT. The retentate was concentrated to a volume of 36 ml and then increased to 60 ml with 50 mM sodium phosphate pH 7.0 containing 1.7 M ammonium sulfate. This solution was chromatographed in five 12 ml batches on an 8 ml phenyl-superose column (Pharmacia) LKB in equilibrium with 50 mM sodium phosphate pH 7.0 containing 0.68 M ammonium sulfate. Under these conditions, free methylpolyethylene glycol is not fixed to the column and is eluted from the column. hCT modified with methylpolyethylene glycol was then eluted using 50 mM sodium phosphate pH 7.0.
The eluted peptide is dialyzed into water using a Spectrapor dialysis membrane (permeability limit of 6-8 kDa) and concentrated using an Amicon YM10 membrane at 4 ° C to a final concentration of 11 mg / ml as determined by amino acid analysis after acid hydrolysis. This product, which contained 1.5 moles of methylpolyethylene glycol covalently bound to a mole of hCT, retained biological activity and was free of unmodified starting material.
Reference Example 29
Preparation of human interleukin-2 (IL-2) modified with methylpolyethylene glycol 5,000
Lyophilized recombinant human IL-2 produced by E.coli was obtained from 3iosource International, California. SDS-PAGE electrophoresis was determined to be greater than 98% pure. Methods for the production of IL-2 in E.coli and its subsequent purification have already been described [Kato et al., Biochem. Biophys. Res. Commun. 130, 692 (1988); Liang et al. Biochem J. 229,429 (1985), Koths et al. U.S. Patent 4,569,790 (1986). A solution of 211 mg of IL-2 in 30 ml of water was modified with methylpolyethylene glycol with an approximate molecular weight of 1730 to 5303 and purified according to the procedures described in Reference Example 3 using 23 equivalents of an amino group modifying agent in IL-2. The final product included
3.4 moles of methylpolyethylene glycol per mole of protein and was free from unmodified starting product. It also retained biological activity.
Reference Example 33
Construction pICI 0380 a / Construction pTB357 / also referred to as pLB 004 /
Plasmid pTB357 utilizes a repressed factor determining resistance to tetracycline. This factor is found on plasmid RP4, which occurs in nature. This repression system stops expression of the tetA gene in the absence of tetracycline per rod from most drug resistance mechanisms that have constitutive expression.
This locus was first mapped to RP4, Barth and Grinter / J. Mol. 113, 455-474, 1977]. It was found to consist of adjacent genes: tetA, structural resistance gene and tetR, repressor gene, and this region was sequenced (Klock et al., J. Bacteriol., 161, 326-332, 1985). These genes are located on adjacent BglII-SmaI and SmaI-Snmal fragments. RP4 my only site for BglII, but has five sites for cleavage of Smalan (Lank, Lurz and Furste, Plasmid, 13, 333-337, 1983).
Cloning of the tetA + tetR genes
Plasmid RP4 is well described (Datta et al., J. Bacteriolog., 108, 1244, 1971) and is freely available. Further, plasmid RP4 is stored in the National Collection of Type Cultures, 61 Colindale Avenue, London, NW 5HT under numbers 50078 and 50437. E.coli strains containing this plasmid were grown on selective culture media and plasmid.
173 LNA was isolated on a larger scale according to the method of Holmes and Quigley (Holmes and Quigley, Anal.). Biochem. 114, 193-197,1981]. It was deproteinized with 2.5 M ammonium acetate and reprecipitated with isopropanol. This plasmid DNA was treated with BglII restriction endonuclease following the manufacturer's recommendations. Further, it was partially digested with Xmal using undiluted enzyme and a short incubation period. Xmal is the SmaI isoschizomer that produces 4-nucleotide cohesive termini at the cleavage site.
The plasmid pUC8 (Yanisch-Perron, Vieira and Messing, Gene, 33, 133-119, 1985) was prepared in a similar manner, the final form being obtained by digestion with BamHI and XmaI. RP4 fragments were cloned into this vector by ligation with T4 ligase at 12 ° C for 16 hours. The recombinant vector was used to transform competent E. coli C600 calcium chloride-treated cells (Maniatis et al., Cold Spring Harbor Laboratory, 1982). The cell cultures were then seeded on medium selective for tetracycline resistance.
The E.coli C600 is freely available from many sources, including several collections of microorganisms such as the E.coli Genetic Stock Center, Yale Univisity, USA under number GCSC 3004. The genotype of the E.coli C600 is K12 thr-1 leuBó thi-1 hsdS1 laccYI tonA21 CsupE44.
Several colonies with this resistance were tested for the putative phenotype (ampicillin and tetracycline resistance, but not kanamycin resistance, which is actually RP4 alone). Colonies with correct resistance were subjected to cloning analysis with isolated plasmid DNA (Holmes and Quigley). These preparations were digested with EcoRI and HindIII and analyzed by gel electrophoresis. The size of the cloned inserts was determined to be 2.45 kb, indicating a BglII-Xmal-Xmal fragment from RP4. The clone carrying this fragment containing the tetA and tetR genes was designated pTB344.
174 ii) Removal of the tet gene from pAT153
It was necessary to remove the tet gene from the pAT153 vector plasmid before inserting the tetA and tetR gene pools from RP4 into the predominant gene duplication that could be a source of genetic instability. Thus, the tet gene cannot be effectively suppressed by unrelated etR. Removal was accomplished by isolating pAT153 plasmid DNA and digesting with EcoRI and Aval. A synthetic oligonucleotide of SEQ ID NO: 56 was cloned between these sites:
5 'AATTCGCATGCGGATCCATCGATC 3'
3 'GCGTACGCCTAGGTAGCTAGAGCC 5'
These cohesive termini are complementary to the EcoRI and Aval cohesive termini and further comprise SphI, 3amHI and ClaI sites. After transformation and selection, colonies were tested for loss of the tetracycline resistance determining factor. Plasmid DNA from one clone was sequenced to confirm that it contained the predicted correct sequence. This plasmid was designated pCH19.
iii) Introduction of the tetA + tetR gene
The TetA and tetR genes were isolated from pTB344 on the EcoRI-PstI fragment. The pUCB vector was digested with SspI because it carries the same selection factor (ampicillin resistance) as pCH19. Plasmid DNA of pCH19 was digested with EcoRI and PstI and then ligated with the 2.45 kb fragment carrying the tet genes. The resulting recombinant plasmid was then used to transform E.coli C600 cells and the culture of the transformed cells was then selected for tetracycline resistance. The insertion of tet genes was determined to replace most of the bia genes in pCH19, which could cause the loss of the ampicillin resistance factor. This loss of ampicillin resistance from transformed cells was confirmed. Several clones were then
175 used to isolate the plasmid DNA that was subjected to restriction analysis. This confirmed that the constructed plasmid had the desired structure. The plasmid was designated pTB351 · iv / Cer sequence insertion
The naturally occurring plasmid ColSI is very stable in S. coli, while its derivatives pBR322 and pAT153 are not stable in E. coli. Summers and Sherratt (Cell, 36, 1097-1103, 1984) found that this is due to the fact that the derivatives do not contain a short (283 bp) sequence called cer, which is present in the parent plasmid. This sequence contains a specific site responsible for the decomposition of plasmid multimers that prevents the accumulation of these multimers resulting from homologous recombination. These multimers have a deleterious effect on the division process, which normally ensures stable properties of daughter plasmids during bacterial division.
The Cer sequence (Summers, D. et al., MGG, 201, 334-338, 1985) was isolated from plasmid pKS492 (enabled by D. Sherrat) as a 289 bp fragment by digestion with BamHI and Taql. Plasmid pTB351 was isolated as DNA from dams of the E.coli strain to prevent blocking of its Cla1 site by the dam + methylation system. This DNA was digested with BamHI and ClaI (both of which were introduced into a synthetic oligonucleotide for this cloning). The cer fragment was ligated with the digested vector and then used to transform E.coli C600 cells. Selection was performed for tetracycline resistance. Transformed cells were subjected to cloning analysis by Aval restriction endonuclease and gel electrophoresis. The presence of additional DNA zones means an increment of the cer fragment. Further restriction analyzes were performed to confirm the correct structure of the resulting plasmids. One of these plasmids was designated pTB357 (FIG. 5) and was also designated pLBOO4.
b) Plasmid pCH101
176
Plasmid pCH101 corresponds to plasmid pICI 0020 (see Example 1c) except that the ScoRI-SalI fragment (see FIG. 1) is replaced by a fragment consisting of SEQ ID NO: 50 (see also FIG. 6) and the interferon gene sequence alpha<sub>2</sub>as described by Edge MD et al., Nucleic Acids Research 1983, Vol. 11, 6419-6435 · 2 of this view, the 3'-terminal ATG codon
SEQ ID NO.53 immediately follows the TGT codon, which encodes a cysteine (amino acid 1) in the interferon alpha sequence<sub>2</sub>as described in Edge, MD et al.
Nucleic Acids Research. The 5 nucleotide sequences of GATCCATG and the complementary 3 'nucleotide sequences of GTAC are then deleted from the nucleotide sequence according to the foregoing reference.
c / Insertion of an expression gene set into pTB357
Expression set of genes consisting of the trp promoter, ribosome binding site and interferon alpha gene<sub>2</sub> was isolated from plasmid pCH101 (see previous point b) on the EcoRI-SphI restriction fragment. It was then ligated into the production vector (pTB357) (see previous point a) also digested with EcoRI and SphI. This DNA was used to transform competent E.coli C600 cells and after transformation, tetracycline resistant cells were isolated. Several of them were subjected to cloned DNA analysis to determine if an SstI restriction site, which was included on the expression set of genes, had been added. Clones that showed a positive result in this regard were subjected to restriction analysis to determine if the predicted composition of the engineered gene was correct.
In addition, clones were tested for their ability to produce interferon alpha protein<sub>2</sub> using Coomassie blue stained polyacrylamide-SDS gel electrophoresis. One of the clones was designated pLB005 · d / Insertion of the T4 transcription terminator into pTB244
177
The sequence of the T4 transcription terminator in the form of a fragment from SalI to HindIII (67 bp) / see SEQ ID NO: 48 and FIG.
4a) was inserted into the multi-cloning site of the intermediate pTB244 vector between SalI and HindIII sites. An SstI-SphI fragment containing most of the multicloning site and a T4 terminator was isolated from this vector. These were then inserted into pLB005, also cleaved by SstI and SphI, replacing the interferon alpha gene.<sub>2</sub>but retained a set of genes comprising the trp promoter. This constructed gene was subjected to cloning analysis and the plasmid was designated pLBO1.3 / Substitution of the multicloning site
The presence of a multiclonal site is not ideal in plasmid pBL013 for several reasons: SalI, BamHI and SmaI sites are not unique to the plasmid, but there are several. This fragment was therefore digested with SsI and XbaI (both sites on the vector only in one copy) and replaced by a synthetic oligonucleotide of SEQ ID NO: 51:
'AGCTCCATATGGTACCAGATCTCTCGAGAGTACTT
GGTATACCATGGTCTAGAGAGCTCTCATGAAGATc 5 '·
Clones were analyzed for the presence of new restriction sites and then subjected to sequencing. One such plasmid was designated pL3014. The new inserted cloning sites are: NdeI, KpnI, BglII, Whol and Seal, followed by Xbal and SalI, which follow.
f / Other modifications
It has been found that the adjacent Ssl and NdeI sites in pLB014 cannot be cleaved by both of them due to their proximity.
176 restriction endonucleases either suddenly or gradually.
Therefore, additional sequences were inserted between them. This was done by digesting pLB014 with SstI and KpnI and then inserting the synthetic oligonucleotide of SEQ ID NO: 52.
'AGCTCAGCTGCAGCATATGGTAC
GTCGACGTCGTATAC 5 '
Clones were tested for the presence of new PvuII or PstI sites and were subjected to sequencing. One of these plasmids was designated as pLB015 (= pICI 3080) (see FIG. 7). This plasmid is efficiently digested with SstI and NdeI over plasmid pLB014. This gave a site for insertion of different ribosome binding site sequences, correctly positioned with respect to the position of the trp promoter downstream of the replication, and NdeI further ensures that the ATG initiation codon of the gene will be expressed.
Reference example 31
Construction of plasmid pICI 1295 (also referred to as pCG300) a) pCG54 production from pICH 079 pICI1079 is ampicillin resistant, derived from pATI53 and contains the following elements between EcoRI and StylI restriction sites:
i / CI857 from phage λii / AP ^ promoter iii / synthetic ribosome binding site iv / synthetic gene sequence for interferon alpha<sub>2</sub> v / a synthetic transcription terminator sequence derived from phage T4 between SalI and StylI restriction sites; The DNA sequence for this term transcriptional transcript is shown in FIGS
SEQ ID NO: 53.
picli 079 is shown in FIG.
pICI1379 is based on the Budapest Treaty in the National Collection of Industrial and Marina Bacteria Limited (NCIMB), 23, St. Petersburg. Machar Drive, Aberdeen, AB2 1 SS, GB / NCIMB No. 40370, deposited 19.2.1991 /. pCG54 was constructed to be a suitable expression vector containing the same promoter, ribosome binding site sequence, and transcriptional terminator sequence as previously indicated, ie: Xβ1, R3S7 and T4, but lacking a gene sequence encoding the production of a specific protein . The plasmid constructed in this way could provide for the operation of a base expression vector containing the necessary transcriptional and translational elements to produce the desired protein that could be introduced into this vector by the following cloning procedures.
Vector construction was initiated by digestion of piCI 1379 with restriction endonucleases at EcoRI and SalI sites. In this cleavage, a vector fragment containing the base of the gene equipment of plasmid pICI1079 with plasmid replication genes and genes with antibiotic resistance and in addition the T4 sequence for the transcription terminator was released. The fragment was isolated on an agarose gel by a purification step using the Geneclean method for the final purification of the DNA fragment.
A second small DNA fragment of approximately 1.2 kb was introduced into this vector fragment. This second fragment can be obtained, for example, by DNA synthesis or by spot or PCR mutagenesis of the small restriction fragment EcoRI-SalI obtained from pICI1079 described above. This second fragment contains the same promoter and ribosomal binding site sequence as the original plasmid pICI1379, and additionally has EcoRI and SalI sites available at the 5 'and 3 ends, respectively, thereby providing compatible ligation ends.
60 fragment of pICI1079. The ligation reaction in the presence of Gibco-SRL T4 DNA ligase and the appropriate buffer resulted in a constructed plasmid pCG54.
Clones containing this constructed plasmid were isolated by transforming part of the ligation reaction mixture into competent cells of E. coli strain HB101.
The constructed plasmid pCG54 was 3.682 kb and contained the necessary features as shown in the map shown in FIG.
b) Production of pCG6l from pCG54 (also referred to as pICI54)
Synthetic oligonucleotide sequences were designed to include both natural sequences for the T7A3 promoter and sequences that could provide efficient translation of the initiator region, allowing flawless cloning of any polypeptide gene in their vicinity. RBS1, the trp ribosome binding sequence, was selected as a suitable sequence for the region mentioned at the second site. Therefore, two complementary oligonucleotides, designated SEQ ID NO: 54 and SEQ ID NO: 55, were synthesized to create a double stranded DNA kinker incorporating the T7A3 promoter sequence and for RBS1.
Oligonucleotides were prepared as 84-mers by a standard method using an ABI gene synthesizer. They were designed so that, in double stranded form, the synthetic fragments had restriction sites for EcoRI and KpnI endonucleases at the 5 'and 3' ends. Because of their length, the oligomers could not be purified by HPLC and were purified using acrylamide gel electrophoresis containing 10% acrylamide and 7 M urea.
During purification, the oligomers were first subjected to gel chromatography not only to determine if they were of the correct length, but also to determine whether the purified fraction contained predominantly the desired oligomers' Z- '·' · - 181 of the desired length and whether it had a high contaminant content. of small-sized oligonucleotides that arise as by-products of synthesis.
Acrylamide gels were prepared by a standard method with ammonium persulfate and Ν, Ν, Ν, N-tetramethylenediamine, used as a catalyst for gel polymerization.
The size of the nucleotides of interest requires their visualization after electrophorase. It was therefore necessary to radiolabel the samples with<sup>J</sup> ?. This allows the quality of the sample to be estimated after autoradiography electrophoresis.
Oligonucleotide samples were available in crude form, non-phosphorylated. These were then used for radiolabeling at the 5 'end by phosphorylation using the T4 polynucleotide kinase enzyme.
Oligomers were obtained after synthesis in non-phosphorylated form, and after purification, each oligomer was individually subjected to a phosphorylation reaction involving ATP to phosphorylate from
ends of each molecule in the presence of T4 polynucleotide kinase / see Molecular Cloning: A Laboratory Manual. 2nd Ed., Sambrook, Fritsch and Maniatis, pp. 5.68-5.71 /. After phosphorylation, two complementary oligonucleotides were joined together to form double-stranded DNA containing the T7A3 promoter and RBS1 sequences.
The vector molecule pCG54 was digested with the restriction endonucleases EcoRI and KpnI. This released the 2.3 kb vector fragment, the 1.1 kb fragment containing the λ-β-promoter and the RBS1 sequence. This cloning step was scheduled to remove the λ-β-RBSI sequences with the synthetic EcoRI-KpnI fragment containing the T7A3-P3S1 sequence. The 2.3 kb vector fragment obtained by digestion of pCG54 was purified by conventional gel electrophoresis and Geneclean methods to remove DNA from agarose fragments.
A synthetic EcoRI-KpnI fragment of 84 bp
182 was ligated into the vector molecule prepared above and the ligated DNA was used to transform E. coli HB131 cells.
The selection marker for recombinant clones was ampicillin resistance. After transformation, a number of colonies containing a recombinant plasmid were selected for further testing.
As such, the 84-mer synthetic fragment inserted into the vector during cloning was unsuitable for simple restriction analysis assays for recombinant plasmid DNA samples. Small size inserts are not visible on the agarose gel after electrophoresis. The fragment itself does not contain any restriction site for endonucleases that could be a suitable diagnostic evidence for its presence. Testing of recombinant clones was therefore performed by the colony hybridization method (see Grunstein and Hognes, why). Nati. Acad. Sci., 72, 3961,
Nitrocellulose filters containing immobilized plasmid DNA from recombinant clones were hybridized against a set prepared by random radiolabeling of the coupled synthetic oligonucleotides of SEQ ID NO: 54 and SEQ ID NO: 55. DNA was labeled with alpha-β-dCTP and incubated with Klenow polymerase at 37 ° C for 2 hours.
Recombinant colonies that showed a positive hybridization reaction were selected for plasmid DNA preparation. Plasmid DNA was prepared in each case in relatively large quantities by a cesium chloride density gradient centrifugation method to ensure the desired purity / see Molecular Cloning - A Laboratory Manual, 2nd Ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor Laboratory, 1989, pp. 1.42-1.52. DNA preparation by this method ensures a high quality of material suitable for further cloning and sequence analysis.
All plasmid DNA isolated from recombinant clones was placed in the second selection stage of sequence analysis to confirm that the oligonucleotide sequences
83 the cloned junction of the T7A3-RBS1 fragment itself is absolutely correct. The sequencing procedure used Sequenase and pBR322 UP (pBR 322 universal primer) was selected as the sequencing primer. Sequencing was carried out by the Langer method, utilizing chain termination using dideoxy nucleotide derivatives.
Clones containing the correct sequences were designated as a new expression engineered plasmid pCG61 which contains the T7A3 promoter, the RBS1 sequence, and the T4 terminator sequence (see FIG. 10).
c / Production of pCG300 / also referred to as pICI1295 /
Sequencing and synthetic procedures used in the construction of the G-CSF analog, Ser<sup>1 7</sup>’<sup>27</sup>The 7-sequence G-CSFs are described in Reference Example 3 (see Fig. 3). pICH107 was digested with Seal and then the large fragment was isolated by subsequent agarose gel electrophoresis and the Geneclean method. This fragment was then digested with SalI restriction endonuclease to obtain the gene / Met<sup>1</sup>, Ser<sup>17</sup>’<sup>27</sup>7hu G-CSF on a Scal-SalI fragment suitable for cloning into pCG61 (see FIG. 10).
Following SalI restriction, the desired fragment was re-isolated using an agarose gel purification technique.
The vector molecule pCG61 was digested with the restriction enzyme KpnI. Cleavage with this enzyme yields a 3 overhang that was then blunted using the T4 polymerase enzyme (see Molecular Cloning - A Laboratory Manuel, 2nd ed., Sambrook, Fritsch and Maniatis, pages 5.44-5.47). T4 polymerase activity was thermally inactivated by incubation at 70 ° C for 30 minutes and the LNA was precipitated with ethanol. The precipitate was dissolved in sterile distilled water and the dissolved DNA was digested with SalI. KpnI fragment
<img file="CS9102285A3_D0007.tif" />
184 (new blunt end) -SalI was precipitated with ethanol and then purified by gel electrophoresis and other purification techniques.
Scal-Sall / Met<sup>1</sup>, Ser<sup>17.27</sup>The 7 G-CSF was then ligated to the blunt end of the KpnI-SalI vector. The ligated DNA was transformed into E. coli, strain HB101. Selection of recombinant clones was performed with respect to ampicillin resistance.
Search for potential recombinant clones was performed by hybridization. The radiolabeled assay was prepared by random labeling of an EcoRI-SalI fragment (containing the gene sequence) "Met", Ser '7hu G-CSF) prepared from plasmid pICI1107. This was used for hybridization against colonies containing DNA that had been mobilized on the surface of a nitrocellulose filter. Subsequently, plasmid DNA was prepared from 24 clones that hybridized in this assay. All DNA was prepared by a quick mini-prep method / see 3irnboim and Boly, Nucleic Acid Research, 7,
1513, 1979]. These recombinant DNAs were subjected to a second stage restriction analysis. Linearization of DNA with BamHI, which has a single restriction site on the expression set of genes, is evidence of the presence of 'Met'.<sup>1</sup>, Ser<sup>17.27</sup>7hu G-CSF sequence.
Sequence analysis was performed to confirm the presence of [Met]<sup>1</sup>, Ser<sup>17,27</sup>7h of the G-CSF gene and to verify that the sequence is based on the cloning junction and everywhere in / Met <sup>1</sup>, Ser<sup>17,27</sup>The 7-G-CSF gene was correct. For this purpose, a larger amount of plasmid DNA sample was prepared from 16 recombinant clones using a cesium chloride density gradient centrifugation technique. The sequencing procedures were performed with respect to the sequencing procedure and the universal primer pBR322 (EcoRI) was selected as the sequencing primer. Two of the recombinant clones contained the correct sequence at the Seal end of the fragment / Met \ Ser<sup>17,27</sup>7-G-CSF and everywhere in the G-CSF peptide sequence itself. Clones were identified as an expression engineered plasmid pCG3-30 (see FIG. 1).
12/.
185 Information
Sequential length:
type:
spiral:
sequence topology for sequence ID # 1:
characteristics:
nucleic acid simple linear description: SEQ ID NO: 1:
AATTCAGT ACT CCA CTG GGT CCA GCA AGC TCT CTG CCG CAG TCT TTC 47 CTG CTG AAG TGT CTC 62
Information for sequence ID 2:
Sequence characteristics:
length: 64 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID No 2:
CTG TTC GAG ACA CTT CAG CAG GAA AGA CTG CGG CAG AGA GCT TGC 45 TGG ACC CAG TGG AGT ACTG 64
Information
Sequential length:
type:
spiral:
sequence topology for sequence ID # 3:
characteristics:
nucleic acid simple linear description: SEQ ID No 3:
GAA CAG GTA CGT AAA ATT CAA GGC GAT GGT GCG GCT
AAG CTG TGC GCA ACC 60
86
Information for sequence ID No.4: Sequence characteristics: length: 60 type:
spiral:
topology:
sequential description:
single linear nucleic acid SEQ ID NO 4:
TTT GTA GGT TGC CAG CTT TTC CTG AGC CGC ACC ATC GCC 45 '
TTG AAT TTT ATG TAC 60
Information for sequence ID 5:
Sequence characteristics:
length: 48 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID No 5:
TAC AAA CTG TGC CCT GAG GAA CTG GTG CTC GGT CAC
Information
Sequential length:
tyo:
spiral:
sequence topology for sequence ID # 6:
characteristics:
nucleic acid simple linear description: SEQ ID NO: 6:
CGG GAT CCC CAG
TTC CTC AGG GTG 45 52
187
Information for sequence ID 7:
Sequence characteristics:
length: 63 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID No 7:
GGG ATC CCG TGG GCT CCA CTG AGC TCT TGC CCG
Information for sequence ID No.8:
Sequence characteristics:
length: 60 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID No 8:
CTG GCT CAA GCA GCC TGG CAG TTG TAA AGC TTG GGA
Information for sequence ID 9:
Sequence characteristics:
length: 63 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID NO: 9:
AGC CAG CTG CTC 45 TCC GGT CTG TTC CTG TAC CAG
GCT CTA GAA GGC ATC TCT 63
• ΛΐΛΐ, Ί-ΓΓ,; »;. ·! · '·:' / ·» '. ·
77455774
- 188 Information for sequence No. 10:
Sequence characteristics:
.length: 63 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID No.10:
TTC AGG AGA GAT GCC
<td colspan="2">Information for sequence ID # 11:</td>
<td>Sequential</td><td>characteristics:</td>
<td>length:</td><td> 60</td>
<td>tyo:</td><td>nucleic acid</td>
<td>spiral:</td><td>simple</td>
<td>topology:</td><td>linear</td>
<td>sequential.</td><td>Description: SEQ ID NO: 11:</td>
CCT GAA TTG GCG CCC ACC GAC TTC GCT ACT ACC
CTG GAC ACA CTG CAG CTG
GAC
GTT GCC. 60
Information
Sequential length:
type:
spiral:
sequence topology for sequence ID no.12:
characteristics:
nucleic acid simple linear description: SEQ ID NO: 12:
TTG CCA TAT GGT AGT AGC GAA
- 159 Information for sequence ID no.13
Sequence characteristics:
length: 63 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID No.13:
ATA TGG CAA CAG ATG GAG ATG 63
Information for sequence ID no.14:
Sequence characteristics:
length: 60 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID NO: 14:
TGC TGG CAT CGC ACC CTG AGT CGG CTG CAG
<td>Information</td><td>for sequence ID 1 5:</td>
<td>Sequential</td><td>characteristics:</td>
<td>length:</td><td> 60</td>
<td>type:</td><td>nucleic acid</td>
<td>spiral:</td><td>simple</td>
<td>topology:</td><td>: linear</td>
<td>sequential</td><td>Description: SEQ ID 2.Ip:</td>
CCA GCA TTC GCC TCT GCT TTC
GTT GCC TCC CAT CTT 60
- 193 Information for sequence ID no.16:
Sequence characteristics:
length: 63 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID No 16:
GCT CTG AAG ATG GGA GGC AAC CAG AAC ACC GCC TGC
Information for sequence ID 17:
Sequence characteristics:
length: 55 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID No.17:
CAG AGC TTC CTC GAG GTG TCT TAC
Information for sequence ID no.18:
Sequence characteristics:
length: 53 type: nucleic acid spiral: simple topology: simple sequence description: SEQ ID No 8:
TCGACTTA CGG CTG GGC CAG GTG ACG CAG AAC
GAG GAA
<td></td><td></td><td></td>
<td></td><td>ji.ů-L ·. Υ ··<sub>; Λ</sub>-·~</td><td></td>
<td> -</td><td></td><td> - 191 -</td>
<td></td><td>Information</td><td>for sequence ID 19:</td>
<td></td><td>sequential</td><td>characteristics:</td>
<td></td><td>length:</td><td> 21</td>
<td></td><td>type:</td><td>nucleic acid</td>
<td></td><td>spiral:</td><td>simple</td>
<td></td><td>topology:</td><td>linear</td>
<td></td><td>sequential</td><td>Description: SEQ ID NO 19:</td>
TACAACTGGC AGGCTGCTTG A 2
Information for sequence ID no.20:
Sequence characteristics:
length: 21 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID No.20:
GACGTTGCCG ACTTCGCTAC T
<td>Information</td><td>for sequence ID 21:</td>
<td>Sequential</td><td>characteristics:</td>
<td>length:</td><td> 21</td>
<td>type:</td><td>nucleic acid</td>
<td>spiral:</td><td>simple</td>
<td>topology:</td><td>linear</td>
<td>sequential</td><td>Description: SEQ ID NO: 21:</td>
TGCCGGAGCC ata cccagtt c iOS
-7.74 ^ '· Λ>. ·
- 192 Information for sequence ID no.22:
Sequence characteristics:
length: 21 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID NO: 22:
GCCTGCCAGT TG 21AAGCTT G 21
Information
Sequential length:
type:
spiral:
sequence topology for sequence ID no.23:
characteristics:
nucleic acid simple linear description: SEQ ID NO: 23:
GCACCATCGC CTTGAATTTT ACGTAG 26
Information for sequence ID 24:
Sequence characteristics:
length: 62 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID NO: 24:
AATTCAGT ACT CCA CTG GGT CCA CCA AGC TCT CTG
CTG CTG AAG TCT CTC 62
<td></td><td><sup>1 1</sup> ~ s' 5 .0 - 193 -</td>
<td>Information</td><td>for sequence ID 6.22:</td>
<td>Sequential</td><td>characteristics:</td>
<td>length:</td><td> 21</td>
<td>type··</td><td>nucleic acid</td>
<td>. spiral:</td><td>simple</td>
<td>topology:</td><td>: linear</td>
<td>sequential</td><td>Description: SEQ ID 6.22:</td>
GCCTGCCAGT TG 21AAGCTT G 21
Information for sequence ID.23:
Sequence characteristics:
length: 26 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID NO: 23:
GCACCATCGC CTTGAATTTT ACGTAG 26
Information for sequence ID 24:
Sequence characteristics:
length: 62 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID NO: 24:
AATTCAGT ACT CCA CCTG GGT CCA CCTG AGC TCT CCTG CCG CAG CCT TTC 47
CTG CTG AAG TCT CTC 62
194
Information for IL sequence No.25: Sequence characteristics:
<td>length:</td><td> 64</td><td></td>
<td>type:</td><td>nucleic acid</td><td></td>
<td>spiral:</td><td>simple</td><td></td>
<td>topology:</td><td>linear</td><td></td>
<td>sequential description:</td><td>; SEQ ID No.25:</td><td> -</td>
<td>CTG TTC GAG AGA</td><td>CAG CAG GAA AGA CCT AGG CAG AGA GCT TGC</td><td> 45</td>
<td>TGG ACC CAG TGG AGT</td><td>ACTG</td><td> 64</td>
Information for sequence ID.26:
Sequence characteristics:
length: 60 type: nucleic acid spiral: simple topology: linear sequence description: SEQ IL No.26:
GAA CAG GTA GTA AAA ATT CAA GGT GCG GCT
AAG CTG TGC GCA ACC 60 Information
Sequential length:
type:
spiral:
sequence topology for sequence ID # 27 characteristic:
nucleic acid single linear description: SEQ ID NO: 27
TTT GTA GGT TGC GCA CAG CTT TTC CTG CAG
TTG AAT TTT ACG TAC 60
Information for sequence ID.28:
Sequence characteristics:
<img file="CS9102285A3_D0008.tif" />
length:
type:
spiral:
topology:
sequential description:
195 29 single linear nucleic acid SEQ ID NO: 28:
CTT CAG CAG AGA GC
Information for sequence ID no.29 Sequence characteristics:
length:
type:
spiral:
topology:
sequential description:
GC TTG GGA AGA GCA AGA single linear nucleic acid SEQ ID No.29:
GCT CAG AGA
Information for SEQ ID NO: 30
Sequence characteristics:
length: 40 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID NO: 30:
CTG TTG CCA TAT GCT
- 196 Information for sequence ID no.31:
Sequence characteristics:
length: 27 tyP<sup>:</sup> nucleic acid spiral: simple topology: linear sequence description: SEQ ID No-31:
GCT CAG TGG AGC TTT
Information for sequence ID no.32:
Sequence characteristics:
length: 27 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID NO: 32:
ACG CAG AAC GCG GCG
<td>Information</td><td>for sequence ID.33:</td>
<td>Sequential</td><td>characteristics:</td>
<td>length:</td><td> 29</td>
<td>type:</td><td>nucleic acid</td>
<td>spiral:</td><td>simple</td>
<td>topology:</td><td>: linear</td>
<td>sequential</td><td>Description: SEQ ID NO: 33:</td>
G TTC GAG AGA GTC TTC CAG GAA GTC AG
- 197 Information for sequence ID no.34
length:
type:
spiral:
topology:
sequential description:
single linear nucleic acid SEQ ID NO: 34:
C CTG CAG TTT GC AGC GCT AGC TTG AAT TTT AC
Information for sequence ID no.35: Sequence characteristics:
length:
type:
spiral:
topoloie:
sequential description:
single linear nucleic acid SEQ ID NO: 35:
CAG AGA GTG AGC
<td>Information</td><td>for sequence ID No.36:</td>
<td>Sequential</td><td>characteristics:</td>
<td>length:</td><td> 29</td>
<td>type:</td><td>nucleic acid</td>
<td>spiral:</td><td>simple</td>
<td>topology:</td><td>linear</td>
<td>sequential</td><td>Description: SEQ ID NO: 36:</td>
GCT CAG TGG AGG TTT CGG GAT AGC AG AG
-37: 7.3, ΛΖ, νν.
198 Information for sequence ID.37:
Sequence characteristics:
length: 30 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID NO: 37:
CAG CTT TTC CTG CAG ACG
<td>Information</td><td>for sequence ID no.38:</td>
<td>Sequential</td><td>characteristics:</td>
<td>length:</td><td> 29</td>
<td>type:</td><td>nucleic acid</td>
<td>spiral:</td><td>simple</td>
<td>topology:</td><td>: linear</td>
<td>sequential</td><td>Description: SEQ ID NO: 38:</td>
CC GCT GCC TTG AAT
<td>Information</td><td>for sequence ID 39:</td>
<td>Sequential</td><td>characteristics:</td>
<td>length:</td><td> 30</td>
<td>type:</td><td>nucleic acid</td>
<td>spiral:</td><td>simple</td>
<td>topology:</td><td>: linear</td>
<td>sequential</td><td>Description: SEQ ID NO: 39:</td>
;
\ %
ij;
*
GGT TGC GCA CAG ACG TTC CTG CAG AGC CGC .7 7 -Jt
- 199 -
<td colspan="2">Information for sequence ID40:</td>
<td>Sequential</td><td>characteristics:</td>
<td>length:</td><td> 29</td>
<td>type:</td><td>nucleic acid</td>
<td>spiral:</td><td>simple</td>
<td>topology:</td><td>linear</td>
<td>sequential</td><td>Description: SEQ ID NO: 40:</td>
G GTG GCA CAG
CAG C
Information for sequence ID no.4-1: Sequence characteristics:
length:
type:
spiral:
topology:
sequential description:
single linear nucleic acid SEQ ID NO: 41:
CG CGG CAG AGA GCT TGC
ACG GTA GGT TGG
<td>Information</td><td>for sequence ID no.42:</td>
<td>Sequential</td><td>characteristics:</td>
<td>length:</td><td> 31</td>
<td>type:</td><td>nucleic acid</td>
<td>spiral:</td><td>simple</td>
<td>topology:</td><td>linear</td>
<td>sequential</td><td>Description: SEQ ID NO: 42:</td>
G TAC CTG TTC GAG AGA
203
Information
Sequential length:
type:
sequential topology
Thr Pro 2
Ser Phe
Lys Ile
Lys Leu
Cys His
Ser Leu
Cys Pro 65
Leu Ser 75
Gin Gly for SEQ ID NO: 43:
characteristics:
174/177 amino acids amino acid linear
<td colspan="3">description:</td><td>SEQ</td><td colspan="4">ID n.43:</td>
<td>Leu</td><td>Gly</td><td>For 5</td><td>Ala</td><td>Ser</td><td>Ser</td><td>Leu</td><td>For 1 0</td>
<td>Leu</td><td>Leu 15 Dec</td><td>Lys</td><td>Cys</td><td>Leu</td><td>Glu</td><td>Gin 20 May</td><td>Wall</td>
<td>Gin 25</td><td>Gly</td><td>Asp</td><td>Gly</td><td>Ala</td><td>Ala 30</td><td>Leu</td><td>Gin</td>
<td>/Wall</td><td>Ser</td><td colspan="2">Glu / Cys m <sup>in</sup> ·</td><td>Ala</td><td>Thr</td><td>Tyr</td><td>Lys 40</td>
<td>For</td><td>Glu 45</td><td>Glu</td><td>Leu</td><td>Wall</td><td>Leu</td><td>Leu 50</td><td>Gly</td>
<td>Gly 55</td><td>Ile</td><td>For</td><td>Trp</td><td>Ala</td><td>For 60</td><td>Leu</td><td>Ser</td>
<td>Ser</td><td>Gin</td><td>Ala</td><td>Leu</td><td>Gin 73</td><td>Leu</td><td>Ala</td><td>Gly</td>
<td>Gin</td><td>Leu</td><td>His</td><td>Ser 83</td><td>Gly</td><td>Leu</td><td>Phe</td><td>Leu</td>
<td>Leu</td><td>Leu</td><td>Gin 90</td><td>Ala</td><td>Leu</td><td>Glu</td><td>Gly</td><td>Ile 95</td>
Gin
Arg
Glu
Leu
His
Ser
Cys
Tyr
Ser
Pro Thr Leu Gly Pro Thr Leu Gly 133 135
- 201 -
<td>Leu</td><td>Asp</td><td>Wall 11 0</td><td>Ala</td><td>Asp</td><td>Phe</td><td>Ala</td><td>Thr 115</td><td>Thr</td><td>Ile</td><td>Trp</td>
<td>Gin</td><td>Gin 120</td><td>Met</td><td>Glu</td><td>Glu</td><td>Leu</td><td>Gly 125</td><td>Met</td><td>Ala</td><td>For</td><td>Ala</td>
<td>Leu 130</td><td>Gin</td><td>For</td><td>Thr</td><td>Gin</td><td>Gly 135</td><td>Ala</td><td>Met</td><td>For</td><td>Ala</td><td>Phe 140</td>
<td>Ala</td><td>Ser</td><td>Ala</td><td>Phe</td><td>Gin 145</td><td>Arg</td><td>Arg</td><td>Ala</td><td>Gly</td><td>Gly 150</td><td>Wall</td>
<td>Leu</td><td>Wall</td><td>Ala</td><td>Ser 155</td><td>His</td><td>Leu</td><td>Gin</td><td>Ser</td><td>Phe 160</td><td>Leu</td><td>Glu</td>
<td>Wall</td><td>Ser</td><td>Tyr</td><td>Arg</td><td>Wall</td><td>Leu</td><td>Arg</td><td>His</td><td>Leu</td><td>Ala</td><td>Gin</td>
165 170
For (where m is 0 or 1).
Information for sequence ID.44:
Sequence characteristics:
length: 168 + 166 type: nucleic acid spiral: double topology: linear sequence description: SEQ ID NO: 44:
AATTCTGGCA AATATTCTGA AATGAGCTGT TGACAATTAA TCATCGAACT 50
GACCGT TTATAAGACT TTACTCGACA ACTGTTAATT AGTAGCTTGA
AGTTAACTAG TACGCAAGTT CACGTAAAAA GGGTATCGAC TCAATTGATC ATGCGTTCAA GTGCATTTTT CCCATAGCTG
- 202 AATGGTACCC GGGGATCCTC TAGAGTCGAC CTGCAGGCAT GCAAGCTTAG I40
TTACCATGGG CCCCTAGGAG ATCTCAGCTG GACGTCCGTA CGTTCGAATC 136
CCCGCCTAAT GAGCGGGCTT TTTTTTAT 1 68
GGGCGGATTA CTCGCCCGAA AAAAAATAGC 166
Information for sequence ID 45:
Sequence characteristics:
length: 534 tyP * · nucleotide with corresponding protein spiral: simple topology: linear sequence description: SEQ ID NO: 45:
AATTCAGT ACT CCA GGT CCA GCA AGC TCT CTG CCG CAG TCT TTC CTG 50 Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gin 'Ser Phe Leu
10
<td rowspan="2">CTG Leu 15 Dec</td><td rowspan="2">AAG TGT CTC GAA Lys Cys Leu Glu</td><td colspan="8">CAG GTA CGT AAA ATT CAA GGC GAT</td><td rowspan="2"> 98</td>
<td>Gin Val<sup>20</sup></td><td>Arg</td><td>Lys Ile</td><td>Gin 25</td><td>Gly</td><td>Asp</td><td>Gly Ala</td><td>Ala 30</td>
<td>CTG</td><td>CAG GAA AAG CTG</td><td>TGC GCA</td><td>ACC</td><td>TAC AAA</td><td>CTG</td><td>TGC</td><td>CAC</td><td>CCT GAG</td><td>GAA</td><td> 146</td>
<td>Leu</td><td>Gin Glu Lys Leu</td><td>Cys Ala</td><td>Thr</td><td>Tyr Lys</td><td>Leu</td><td>Cys</td><td>His</td><td>Pro Glu</td><td>Glu</td><td></td>
<td></td><td> 35</td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td> 45</td><td></td><td></td>
<td>CTG</td><td>GTG CTG CTC GGT</td><td>CAC TCT</td><td>CTG</td><td>GGG ATC</td><td>CCG</td><td>TGG</td><td>GCT</td><td>CCA CTG</td><td>AGC</td><td> 194</td>
<td colspan="9">Leu Val Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu</td><td>Ser</td><td></td>
<td></td><td> 50</td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td> 60</td><td></td><td></td>
<td>TCT</td><td>TGC CCG TCC CAA</td><td>GČT TTA</td><td>CAA</td><td>CTG GCA</td><td>GGC</td><td>TGC</td><td>TTG</td><td>AGC CAG</td><td>CTG</td><td> 242</td>
<td>Ser</td><td>Cys Pro Ser Gin</td><td>Ala Leu</td><td>Gin</td><td>Leu Ala</td><td>Gly</td><td>Cys</td><td>Leu</td><td>Ser Gin</td><td>Leu</td><td></td>
<td></td><td> 65</td><td></td><td> 70</td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td>
<td>CAC</td><td>TCG GGT CTG TTC</td><td>CTG TAC</td><td>CAG</td><td>GGT CTG</td><td>CTG</td><td>CAG</td><td>GCT</td><td>CTA GAA</td><td>GGC</td><td> 290</td>
<td>His</td><td>Ser Gly Leu Phe</td><td>Leu Tyr</td><td>Gin</td><td>Gly Leu</td><td>Leu</td><td>Gin</td><td>Ala</td><td>Leu Glu</td><td>Gly</td><td>AND</td>
<td></td><td> 80</td><td> 85</td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td>
- 203 -
<td rowspan="2">ATC TCT Ile Ser 95</td><td rowspan="2">CCT For</td><td rowspan="2">GAA TTG Glu Leu</td><td colspan="8">GGG CCC ACC CTG GAC</td><td rowspan="2">GTT Wall 1 1 0</td><td rowspan="2"> 338</td>
<td>Gly 1 00</td><td>For Thr Leu</td><td>Asp</td><td>Thr 105</td><td>Leu</td><td>Gin</td><td>Leu</td><td>Asp</td>
<td>GCC GAC</td><td>TTC</td><td>GCT ACT</td><td>ACC</td><td>ATA TGG CAA</td><td>CAG</td><td>ATG</td><td>GAG</td><td>GAA</td><td>CTG</td><td>GGT</td><td>ATG</td><td> 386</td>
<td>Ala Asp</td><td>Phe</td><td>Ala Thr</td><td>Thr</td><td>Ile Trp Gin</td><td>Gin</td><td>Met</td><td>Glu</td><td>Glu</td><td>Leu</td><td>Gly</td><td>Met</td><td></td>
<td></td><td></td><td> 115</td><td></td><td></td><td> 1 20</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td>
<td>GCT CCG</td><td>GCA</td><td>CTG CAG</td><td>CCG</td><td>ACT CAG GGT</td><td>GCG</td><td>ATG</td><td>CCA</td><td>GCA</td><td>TTC</td><td>GCC</td><td>TCT</td><td> 434</td>
<td>Ala Pro</td><td>Ala</td><td>Leu Gin</td><td>For</td><td>Thr Gin Gly</td><td>Ala</td><td>Met</td><td>For</td><td>Ala</td><td>Phe</td><td>Ala</td><td>Ser</td><td></td>
<td></td><td></td><td> 130</td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td>
<td>GCT TTC</td><td>CAG</td><td>CGG CGC</td><td>GCA</td><td>GGC GGT GTT</td><td>CTG</td><td>GTT</td><td>GCC</td><td>TCC</td><td>CAT</td><td>CTT</td><td>CAG</td><td> 482</td>
<td>Ala Phe</td><td>Gin</td><td>Arg Arg</td><td>Ala</td><td>Gly Gly Val</td><td>Leu</td><td>Wall</td><td>Ala</td><td>Ser</td><td>His</td><td>Leu</td><td>Gin</td><td></td>
<td></td><td> 145</td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td>
<td>AGC TTC</td><td>CTC</td><td>GAG GTG</td><td>TCT</td><td>TAC CGC GTT</td><td>CTG</td><td>GGT</td><td>CAC</td><td>CTG</td><td>GCC</td><td>CAG</td><td>CCG</td><td> 530</td>
<td>Ser Phe</td><td>Leu</td><td>Glu Val</td><td>Ser</td><td>Tyr Arg Val</td><td>Leu</td><td>Arg</td><td>His</td><td>Leu</td><td>Ala</td><td>C-ln</td><td>For</td><td></td>
<td> 160</td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td> 174</td><td></td>
<td>TAA G</td><td></td><td></td><td> 534</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td colspan="2">Information</td><td colspan="3">for sequence ID no.46:</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td colspan="2">Sequential</td><td colspan="3">characteristics:</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Length</td><td></td><td></td><td></td><td> 534</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>type:</td><td></td><td></td><td></td><td colspan="2">nucleotide s</td><td colspan="6">corresponding protein</td><td></td>
spiral: simple topology: linear sequence description: S2Q ID no.46:
204
AATTCAGT ACT CCA GGT CCA GCA AGC TCT CTG CCG CAG TCT TTC CTG 50
Thr Pro Leu Gly For Ala Ser Ser Leu For Gin Ser Phe Leu
5 10
<td colspan="16">CTG AAG TCT CTC GAA CAG GTA CGT AAA ATT CAA</td><td rowspan="2"> 98</td>
<td>Leu 15 Dec</td><td colspan="2">Lys Ser</td><td>Leu</td><td>Glu</td><td>Gin 20 May</td><td>Wall</td><td>Arg</td><td>Lys</td><td>Ile</td><td>Gin 25</td><td>Gly</td><td colspan="2">Ser Gly</td><td>Ala</td><td>Ala 30</td>
<td>CTG</td><td>CAG</td><td>GAA</td><td>AAG</td><td>CTG</td><td>TGC</td><td>GCA</td><td>ACC</td><td>TRAY</td><td>AAA</td><td>CTG</td><td>TGC</td><td>CAC</td><td>CCT</td><td>GAu</td><td>GAA</td><td> 146</td>
<td>Leu</td><td>Gin</td><td>Glu</td><td>Lys</td><td>Leu</td><td>Cys</td><td>Ala</td><td>Thr</td><td>Tyr</td><td>Lys</td><td>Leu</td><td>Cys</td><td>His</td><td>For</td><td>Glu</td><td>Glu</td><td></td>
<td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td>
<td>CTG</td><td>GTG</td><td>CTG</td><td>CTC</td><td>GGT</td><td>CAC</td><td>TCT</td><td>CTG</td><td>GGG</td><td>ATC</td><td>CCG</td><td>TGG</td><td>GCT</td><td>CCA</td><td>CTG</td><td>AGC</td><td> 194</td>
<td>Leu</td><td>Wall</td><td>Leu</td><td>Leu</td><td>Gly</td><td>His</td><td>Ser</td><td>Leu</td><td>Gly</td><td>Ile</td><td>For</td><td>Trp</td><td>Ala</td><td>For</td><td>Leu</td><td>Ser</td><td></td>
<td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td>
<td>TCT</td><td>TGC</td><td>CCG</td><td>TCC</td><td>CAA</td><td>GCT</td><td>TTA</td><td>CAA</td><td>CTG</td><td>GCA</td><td>GGC</td><td>TGC</td><td>TTG</td><td>AGC</td><td>CAG</td><td>CTG</td><td> 242</td>
<td>Ser</td><td>Cys</td><td>For</td><td>Ser</td><td>Gin</td><td>Ala</td><td>Leu</td><td>Gin</td><td>Leu</td><td>Ala</td><td>Gly</td><td>Cys</td><td>Leu</td><td>Ser</td><td>Gin</td><td>Leu</td><td></td>
<td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td>
<td>CAC</td><td>TCC</td><td>GGT</td><td>CTG</td><td>TTC</td><td>CTG</td><td>TRAY</td><td>CAG</td><td>GGT</td><td>CTG</td><td>CTG</td><td>CAG</td><td>GCT</td><td>CTA</td><td>GAA</td><td>GGC</td><td> 290</td>
<td>His</td><td>Ser</td><td>Gly</td><td>Leu</td><td>Phe</td><td>Leu</td><td>Tyr</td><td>Gin</td><td>Gly</td><td>Leu</td><td>Leu</td><td>Gin</td><td>Ala</td><td>Leu</td><td>Glu</td><td>Gly</td><td></td>
<td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td></td>
<td>ATC</td><td>TCT</td><td>CCT</td><td>GAA</td><td>TTG</td><td>GGG</td><td>CCC</td><td>ACC</td><td>CTG</td><td>GAC</td><td>ACA</td><td>CTG</td><td>CAG</td><td>CTG</td><td>GAC</td><td>GTT</td><td> 338</td>
<td>Ile</td><td>Ser</td><td>For</td><td>Glu</td><td>Leu</td><td>Gly</td><td>For</td><td>Thr</td><td>Leu</td><td>Asp</td><td>Thr</td><td>Leu</td><td>Gin</td><td>Leu</td><td>Asp</td><td>Wall</td><td></td>
<td> 95</td><td></td><td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td>
<td>GCC</td><td>GAC</td><td>TTC</td><td>GCT</td><td>ACT</td><td>ACC</td><td>ATA</td><td>TGG</td><td>CAA</td><td>CAG</td><td>ATG</td><td>GAG</td><td>GAA</td><td>CTG</td><td>GGT</td><td>ATG</td><td> 386</td>
<td>Ala</td><td>Asp</td><td>Phe</td><td>Ala</td><td>Thr</td><td>Thr</td><td>Ile</td><td>Trp</td><td>Gin</td><td>Gin</td><td>Met</td><td>Glu</td><td>Glu</td><td>Leu</td><td>Gly</td><td>Met</td><td></td>
<td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td>
<td>GCT</td><td>CCG</td><td>GCA</td><td>CTG</td><td>CAG</td><td>CCG</td><td>ACT</td><td>CAG</td><td>GGT</td><td>GCG</td><td>ATG</td><td>CCA</td><td>GCA</td><td>TTC</td><td>GCC</td><td>TCT</td><td> 434</td>
<td>Ala</td><td>For</td><td>Ala</td><td>Leu</td><td>Gin</td><td>For</td><td>Thr</td><td>Gin</td><td>Gly</td><td>Ala</td><td>Met</td><td>For</td><td>Ala</td><td>Phe</td><td>Ala</td><td>Ser</td><td></td>
<td></td><td></td><td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td>
- 205 -
<td rowspan="2">GCT Ala</td><td rowspan="2">TTC Phe</td><td colspan="2" rowspan="2">CAG CGG Gin Arg 145</td><td rowspan="2">CGC Arg</td><td colspan="12">GCA GGC GGT GTT GTC TCC CAT CTT CAG 482</td>
<td>Ala</td><td>Gly</td><td>Gly 150</td><td>Wall</td><td>Leu</td><td>Wall</td><td>Ala</td><td>Ser 155</td><td>His</td><td>Leu</td><td colspan="2">Gin</td>
<td>AGC</td><td>TTC</td><td>CTC</td><td>GAG</td><td>GTG</td><td>TCT</td><td>TRAY</td><td>CGC</td><td>GTT</td><td>CTG</td><td>CGT</td><td>CAC</td><td>CTG</td><td>GCC</td><td>CAG</td><td>CCG</td><td> 530</td>
<td>Ser</td><td>Phe</td><td>Leu</td><td>Glu</td><td>Wall</td><td>Ser</td><td>Tyr</td><td>Arg</td><td>Wall</td><td>Leu</td><td>Arg</td><td>His</td><td>Leu</td><td>Ala</td><td>Gin</td><td>For</td><td></td>
<td></td><td> 160</td><td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td> 174</td><td></td>
TAA G 534
Information for sequence ID.47:
sequence characteristics:
length: 81 type: nucleic acid spiral: simple topology: linear
GAATTCAACA AAACGGTTGA CAACATGAAG TAAACACGGT ACGATGTACC 50
ACAAGTTCAC GTAAAAAGGG TATCGACAATG 81
Information for sequence ID.48:
sequence characteristics:
length: 67 + 67 bases type: nucleotide spiral: double topology: linear
TCGACATTAT ATTACTAATT AATTGGGGAC CCTAGAGGTC CCCTTTTTTA TTTTAAAAAG 60 GTAATA TAATGATTAA TTAACCCCTG GGATCTCCAG GGGAAAAAAT AAAATTTTTC 56
CATGCGA
GTACGCTTCGA
206
Information for sequence ID No. 49:
Sequence characteristics:
length: 72 + 72 bases type: nucleic acid spiral: double topology: linear sequence description: SEQ ID NO: 49:
TCGACATTAT ATTACTAATT AATTGGGGAC CCTAGAGGTC CCCTTTTTTA TTTTAAAAG 60 GTAATA TAATGATTAA TTAACCCCTG GGATCTCCAG GGGAAAAAAT AAAATTTTC 56
CATGCGGATC CC 72
GTACGCCTAG GGGAAC '72
Information for sequence ID # 50:
Sequence characteristics:
length: 118 bases type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID NO: 50:
AATTCTGGCA AATATTCTGA AATGAGCTGT TGACAATTAA TCATCGAACT AGTTAACTAG TACGCAGAGC TCAATCTAGA GGGTATTAAT AATGTTCCCA TTGGAGGATG ATTAAATG
100 · 1 1 8
Information
Sequential length:
type:
spiral:
sequence topology for sequence ID # 51 · characteristics:
+ 35 bases nucleic acid double linear description: SEQ ID NO: 51:
- 2 06 AGCTCCATAT GGTACCAGAT CTCTCGAGAG TACTT
GGTATA CCATGGTCTA GAGAGCTCTC ATGAAGATC
Information for sequence ID.52:
Sequence characteristics:
length: 23 + 15 bases type: nucleic acid spiral: double topology: linear sequence description: SEQ ID NO: 52:
AGCTCAGCTG CAGGATATGG TAC GTCGAC GTCC-TATAC
Sequential Length Information:
type:
spiral:
sequence topology for sequence ID no.53:
characteristics:
+ 72 nucleic acid double linear description: SEQ ID NO: 53:
TCGACATTAT ATTACTAATT AATTGGGGAC CCTAGAGGTC CCCTTTTTTA TTTTAAAAAG 60
GTAATA TAATGATTAA TTAACCCCTG GGATCTCCAG GGGAAAAAAT AAAATTTTTC 56
CATGCGGATC CC 72
GTACGCCTAG GGGAAC 72
Information for sequence ID.54:
sequence characteristics:
length: 84 type: nucleic acid
208 spiral: simple topology: linear sequence description: SEQ ID No.54:
AAT TCA ACA AAA CGG TTG
Information for sequence ID no.55:
Sequence characteristics:
length: 76 type: nucleic acid spiral: simple topology: linear sequence description: SEQ ID No.55<sup>:</sup>
CAT TGT CGA TAC CCT TTT TAC GTG
TGT TTA CTT CAT GTT GTC
Information
Sequential length:
type:
spiral:
sequence topology for sequence ID no.56:
characteristics:
+ 24 nucleic acid double linear description: SEQ ID No.56:
AATTCGCATG CGGATCCATC GATC
GCGTAC GCCTAGGTAG CTAGAGCC
Contents98
16 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16
43 members in 23 offices
Priority claims23
| Document | Office | Kind | Date |
|---|---|---|---|
| 9016138 | United Kingdom | A | |
| 9016138 | United Kingdom | A | |
| 9018414 | United Kingdom | A | |
| 9018414 | United Kingdom | A | |
| 9018415 | United Kingdom | A | |
| 9018415 | United Kingdom | A | |
| 9018416 | United Kingdom | A | |
| 9018416 | United Kingdom | A | |
| 9018417 | United Kingdom | A | |
| 9018417 | United Kingdom | A | |
| 9018418 | United Kingdom | A | |
| 9018418 | United Kingdom | A | |
| 9016138 | – | – | – |
| 9018414 | – | – | – |
| 9018415 | – | – | – |
| 9018416 | – | – | – |
| 9018417 | – | – | – |
| GB19900016138 | – | – | – |
| GB19900018414 | – | – | – |
| GB19900018415 | – | – | – |
| GB19900018416 | – | – | – |
| GB19900018417 | – | – | – |
| GB19900018418 | – | – | – |
Members43
| Document | Office | Kind | |
|---|---|---|---|
| GB9016138D0 | United Kingdom | D0 | |
| GB9018414D0 | United Kingdom | D0 | |
| GB9018415D0 | United Kingdom | D0 | |
| GB9018416D0 | United Kingdom | D0 | |
| GB9018417D0 | United Kingdom | D0 | |
| GB9018418D0 | United Kingdom | D0 | |
| FI913410A0 | Finland | A0 | |
| GB9115207D0 | United Kingdom | D0 | |
| HU912442D0 | Hungary | D0 | |
| CA2047540A1 | Canada | A1 | |
| FI913410A | Finland | A | |
| FI913410A7 | Finland | A7 | |
| FI913410L | Finland | L | |
| GB2246295A | United Kingdom | A | |
| IE912365A1 | Ireland | A1 | |
| AU8123891A | Australia | A | |
| KR920002164A | Republic of Korea | A | |
| MX9100339A | Mexico | A | |
| EP0473268A2 | European Patent Office (EPO) | A2 | |
| MW2491A1 | Malawi | A1 | |
| CS228591A3This record | Czechoslovakia (until 1993) | A3 | |
| ZW9391A1 | Zimbabwe | A1 | |
| ZA915555B | South Africa | B | |
| PT98410A | Portugal | A | |
| ZM2991A1 | Zambia | A1 | |
| IL98831A0 | Israel | A0 | |
| IL98831D0 | Israel | D0 | |
| EP0473268A3 | European Patent Office (EPO) | A3 | |
| HUT60632A | Hungary | A | |
| JPH0532559A | Japan | A | |
| NZ238889A | New Zealand | A | |
| BG94861A | Bulgaria | A | |
| GB2246295B | United Kingdom | B | |
| US5320840A | United States of America | A | |
| AU655187B2 | Australia | B2 | |
| TW261539B | Taiwan Province of China | B | |
| US5773581A | United States of America | A | |
| JP3188292B2 | Japan | B2 | |
| EP0473268B1 | European Patent Office (EPO) | B1 | |
| AT251641T | Austria | T | |
| ATE251641T1 | Austria | T1 | |
| DE69133324D1 | Germany | D1 | |
| DE69133324T2 | Germany | T2 |
Numbers
- Publication, DOCDB
- 228591
- Publication, EPODOC
- CS228591
- Application
- 912285
- Application, DOCDB
- 228591
- Application, EPODOC
- CS19910002285
Titles
- English
- PHARMACEUTICAL COMPOSITION WITH A CONTINUOUS LIBERATION PHYSIOLOGICALLY ACTIVE COMPONENT BEING STABLE IN ACID MEDIUM
Classification
- CPC, 12
- C07K14/535
- A61K38/16
- A61K9/204
- A61K38/00
- A61K47/60
- A61K47/58
- A61K47/61
- A61K47/642
- A61P31/12
- A61P35/02
- A61P37/04
- A61K9/00
- IPC, 13
- A61K9 00
- A61K9 20
- A61K38 00
- A61K38 21
- A61K38 23
- A61K38 27
- A61K47 34
- A61K47 36
- A61K47 48
- A61P31 12
- A61P35 02
- A61P37 04
- C07K14 535
