Combination therapy for the treatment of ocular neovascular disorders

For treating eye new blood vessel disease of the combined therapy

[0001] this utility model claims application to daily 2004*8 yue 26 daily application number is 1 200480031700 the invention name and the invention is different from that of the invention claims a patent application is claimed.

[0002] relative application

[0003] the request 2003*8 yue 27 day it is submitted with the american temporary application sequence number 60/498 407 law file 013 # eye p and 2004*3 yue 26 day it is submitted with the american temporary application sequence number 60/556 837 law file # eye 013p2 the priority of said document is in full text mode to work the invention reference. Invention belongs to the field of

[0004] this invention claims a pair of science and medical field. More specifically speaking the invention claims the utility model can effectively inhibit platelet-derived growth factor pdgf and vascular endothelial growth factor vegf the reagent composition for treating eye disease a new blood vessel.

[0005] invention background

[0006] angiogenesis but also is called the fresh blood vessel forming it comprises existing blood vessel to form new tree sprout and their use in the tissue surrounding the. A relevant process of angiogenesis vasculogenesis industry it comprises existing in the whole tissue in the middle of the endothelial cell and blood vessel and cell differentiation and then they are connected together to form the blood vessel.

[0007] angiogenesis it can be widely is present at the development period and it is presented on the wound healing period the health of the inner body so that it is convenient for the injury or damage then recovering blood flow into tissue. Will not be affected by angiogenesis and the formed tumour cancer and related. Actually in tumour tissue of the blood vessel is the breast cancer and cancer jean weidner natl inst 84: 1875-1887 prostate cancer and so on weidner am j pathol 143: 401-409 brain tumor and lancet 344 li: 82-86 and melanoma foss such as cancer res 56: 2900-2903 of the force of the electrode after index. Most close to the angiogenesis with many medical field of the other disease states are correlative comprises rheumatism medicine for curing skin disease of heart disease and ophthalmic. Specifically speaking it is not hoped or pathology tissue specific angiogenesis and some special disease states associated include rheumatoid arthritis atherosclerosis and psoriasis a fan and so on such as the trend of 16 s pharmacol sci: 57; And folkmannature med i: 27. The vascular permeability change is recognized as the normal physiology and pathology in the process takes the effect and so on cullinan bove endocrinol 133: 829; Senger such as cancer and metastasis reviews 12: 303. Although the blood vessel formation process in the said each kind of disease can be in the development of angiogenesis and tumor angiogenesis has many features but each may have because the surrounding cell the influence generated by the special characteristic of.

[0008] several eye disease relates to angiogenesis the change of. Such as diabetes retina pathological is that adult loss of the third and the reason of the american invention takes the number of people almost 7%- and wide blood vessel of generating event correlation. A proliferative retinal diseases associated with retinal in the periphery of the cell selection of the property loss and their loss caused by the relative capillary vessel of expansion and causes the blood flow increasing. The expansion of the capillary vessel of endothelial cell proliferation and forming external turning it forming a micro aneurysm and adjacent to the capillary vessel is blocked so as to micro aneurysm peripheral retina area is not pouring. Final branch blood vessel is present at the adjacent micro aneurysm between regions is and it can be seen with micro aneurysm the early diabetes retina pathological and the filling of a retina area of the clinical image. Micro aneurysm leakage and the capillary vessel can be the blood lead exudation and the blood. Once determining that the background diabetes retina pathological the initial stage of the said condition can develop many years time period of development of proliferative diabetic retinal diseases and causes about 5% of the invention case. The retina some area of continuous lost them the capillary vessel and become can not be injected so that the retina plate and other places that new blood vessel when the proliferative diabetic retina pathological. These new blood vessel growth into glass body and it is easy to the blood thus resulting in front of the retina the blood. The late proliferative diabetic retina disease in large amount of the glass body the blood can be filled with glass body of the cavity of the most. The new blood vessel with the fibre organization of proliferation which may be caused it is traction retinal detachment.

[0009] diabetes retina pathological main and sugar diabetes and the sustaining time of the relative; So any age and the people of diabetes patient life is long diabetes retina pathological the flow rate for the increasing. Laser therapeutic currently used for a proliferative and proliferation of diabetes retina pathological. Macular area surrounding the leakage of fine aneurysm focus the laser therapy the suffer from clinic is obvious the yellow spot of water of a patient vision the loss is reduced 50%. Of proliferative diabetic retinal diseases the whole retina caused by solidification of the whole retinal scattered on thousands of a small burning area to avoid macular; Of such treatment it can reduce the loss ratio less than 60%. Macular edema and proliferative diabetic retina disease in early cure of 95% it can prevent the patient grade five in time the invention is for curing late stage only can prevent the patient the invention is more than 50%. So the early diagnosis and treatment is important.

[0010] claims neonatal blood vessel forming the other end of the eye disease is age-related macular degeneration amd the invention claims a more than 65 the influence of concrete of 1/10 about the american of human disease. Of amd the characteristic is that the yellow spot of the retina central region of a series of pathology changing such varying with the reducing of the visual sensitivity especially the influence of the central sight. Amd claims a called as retinal pigment epithelium of monolayer cell it is located on the feeling of the lower part of the retina. These cells for nourishing and supporting and they are in contact with the retina part it comprises video colour the light sensation cell. Retinal pigment epithelium the glass film on the base film it is complex compound of amd the patient and it is thickened and hardened. New vein can be from the lower choroidal through glass film and including an abundance of vascular bed. The blood vessel which can not leak fluid or the retinal pigment epithelium and the lower part of the blood and it is also can be the retinal pigment epithelium and the feeling of retina is set between the hemorrhage. Then the fibre shape scar is formed by the harm sensitive cell in nutrition and causes the cell death from the centre so as to cause the visual sensitivity of the lost. This kind of age-related macular pathological change called as '' wet '' type of the reason is that the leakage of blood vessel and retinal edema of lower or blood. Wet type it only takes age-related macular proportion of 10% disease pathological changes but it causes the old people in the case so as to 90% of macular degeneration the method for the blind. '' drying '' type of age-related macular pathological changes claims a retinal pigment epithelium of decomposition and the upper surface of the light source cell loss. Dry type of pathological changes can reduce the vision it is normal and there is only 20 50-20 per 100 of the horizontal.

[0011] amd with the centre of vision the distortion of the target variable big or small or straight line the twisting bending or not there is a central section. In wet type of amd in the yellow spot area can pay attention to the feeling of retina small separating will not be affected by retinal the fresh blood vessel of film finally diagnosis it needs to fluorescein angiography. On the dry type in glass wart can interference macular area of the pigmentation mode. Glass wart is retinal pigment on the skin of the base film the verruca wart it is protruded into the cell so that the cell the front part of the expansion; They are used as age-related macular pathological change of dangerous factor because shang unclear. Present is not used for curing drying type of age-related macular pathological changes method of. Laser treatment is used for wet type of age-related macular pathological changes and the first and it eliminates the fresh blood vessel and the film and 18 month it prevents from about 50% of the patient is further vision loss. Will not be affected by the 60 months when there is only 20% of the patient it also has obvious effect.

[0012] industry which has been identified for the blood vessel the generation of a variety of molecular medium it comprises the steps of alkali resistance and acidic fibroblast growth factor bfgf afgf transforming growth factor alpha and beta tgfa tgf beta platelet-derived growth factor pdgf angiogenesis of platelet-derived growth of endothelial cell factor f1d ecgf interleukin il 8 8 and vascular endothelial growth factor vegf. The participation of angiogenesis stimulation the other object includes angiogenesis method 501 st angi p 501 st ietin l del 1 ovarian follicle of inhibiting hormone follistatin granulocyte colony stimulating factor g-csf hepatocyte growth factor hgf plantlet strip of midkine protein placenta growth factor a the protein ptn progranulin proliferation protein and tumour necrosis factor tnf alpha alpha. The angiogenesis the control also can through the body of production of angiogenesis the invention claims a negative regulator Comprises tumefaciens-mediated angioarrestin angiostatin and fibre protein solution proenzyme section of an anti-angiogenic antithrombin iii soft Bone derivatives inhibitor of complement *** i *** 59 section of endostatin endostatin collagen xviii segment fibre Connected protein fragments gro beta heparanase heparin a polymer they sugar sheet section of human chorionic gonadotropin hcg interferon A beta and y interferon induced protein model ip 10 interleukin 12 kringle 5 blood fibre protein solution proenzyme section of metal protease inhibitor hmps 2-methoxyl female left glycol placenta ribonucleic acid enzyme inhibitor and fibre protein lysozyme original activating agent of inhibiting blood platelet factor 4 pf4 lactogenic hormone 16kd segment proliferation protein related protein prp type retinol Tetrahydro-5 5 alcohol the quality of blood platelet reaction protein 1 ^ ? 1 5 blood vessel inhibitor element 501 st 38 3111 501 st 8*31 - 11 and blood vessel inhibitor vasostatin network calcium protein fragments.

[0013] the angiogenesis adjusting agent is similar as vegf with the tumour growth of the abnormal vascular the generation of positive modulators plays important role in the comprehensive parameter of the brown so as to control angiogenesis goldberg and rosen eds birkhauser basel and thomas j biol chem 271: 603-606. Is most close to the industry research institute of the signal conductive molecules rogf rogf b of the family member with the function because it is almost similar to the vessel around cell the form of the amplification and the normal functional aspect is begins to work the said blood vessel around cell when is called the wall of cells such as blood vessel smooth muscle glomerular film cell and cell zhou.

[0014] although to the development of wound healing and formed tumour associated with angiogenesis or neovascularization formed by the more but also need to confirm the angiogenesis and ocular angiogenesis between if there is difference. Even though it is very obviously according to the operation of the cardiac on the side branch blood vessel forming of angiogenesis it is possible to biologic it is good and it is suitable for biological only with the example of amd pathologic ocular neovascularization formed there is no known is good and it is usually caused loss of the invention has the comprehensive parameter in cell campochiaro j physiol 184: 301-10. So that although the accompanying fresh blood vessel forming molecular of the event of science and industry which obtains progress but still it needs to use the these understanding the development and application for treating new blood vessel disease of the other methods said diseases include eye new vascular disease and such as the amd and diabetes retina pathological along with the problem that the choroidal neovascularization formed of a disease.

[0015] invention summarized

[0016] industry which has been jing-qi to the vegf antigen and antibody pdgf agent composition with the treating ocular new blood vessel disease can provide synergistic therapeutic effects.

[0017] this invention is characterized in that it is used for treating patients are diagnostic or risk of developing the new vascular disease of patient the method of. The method comprises administering to said patient a vegf resisting agent and anti- pdgf agent as the main or assisting curing.

[0018] one aspect the invention claims a method for inhibiting the needs of patients a new blood vessel disease of the method and at the same time or separated about 90 days are given to patients by applying togf antagonist and vegf antagonist to realize the usage amount sufficient to inhibit the patient a new blood vessel disease.

[0019] the other side of the invention claims a method for treating with the requirement of the patient the method of the patient suffering from the diagnostic or the risk such as the new blood vessel disease through the same time or separated 90 days are given to patients by applying togf antagonist and vegf antagonist to realize enough in the treatment of patient the dosage of applying.

[0020] in these aspects of a specific embodiment of this invention method comprises the steps are separated one another about 10 days in the application i3dgf antagonist and vegf antagonist. The method of this invention is an embodiment of the togf antagonist and vegf antagonist in which are interval 5 days in the application of. The method of this invention is an embodiment of the togf antagonist and vegf antagonist is separated about 24 hours at the application of. The method of this invention specific embodiments the i3dgf antagonist and the vegf antagonist at the same time it is applied to.

[0021] in another embodiment of this invention method comprises using rogf antagonist it is b rogf antagonists. In another embodiment the method of this invention involves the administration of vegf antagonist it is a vegf antagonist.

[0022] in certain embodiments the invention claims a method of applying togf antagonists this utility model claims a nucleic acid molecule is body of the antisense rna molecules nucleic acid molecular rnai cyclic peptide protein polypeptide and antibody fragments the combination of the segment of the polymer or organic compound small. In another embodiment the method of this invention involves the administration of vegf antagonist the invention claims nucleic acid molecule is body of the antisense rna molecules nucleic acid molecular rnai cyclic peptide protein polypeptide and antibody fragments the combination of the segment of the polymer or organic compound small.

[0023] in a specific embodiment of this invention method comprises using vegf antagonist it is suitable for eye body is like 001. In another embodiment the method of this invention involves the administration of vegf antagonist it is the combination of antibody or its fragment.

[0024] in a specific embodiment of this invention method comprises using i3dgf antagonist it is suitable for antibody or its combination segment. On the other this utility model claims a specific embodiment of this invention method comprises using togf antagonist it is the antisense oligonucleotide.

[0025] the invention the one side of another embodiment the i3dgf antagonist and/or the vegf antagonist the front drug.

[0026] in one embodiment the method of this invention claims a method to inhibit or treat eye new blood vessel disease of the handle section. In some embodiments in this utility model is suitable for the invention claims a method for treating or inhibiting the eye new blood vessel disease of ischemic retinal diseases iris fresh blood vessel forming in eyes fresh blood vessel forming age-related macular degeneration cornea angiogenesis retinal forming fresh blood vessel forming choroidal neovascularization forming diabetic retinal ischemia or proliferative diabetic retina pathological. In another embodiment the method of this invention claims a method for inhibition or treatment of the need of the patient or the diagnosis of the patient or danger for the development of a disease of patient to the psoriasis or similar rheumatoid arthritis means of.

[0027] this invention also claims a structure comprising a vegf antagonist and togf antagonists and uses the medicinal carrier for medicinal composition. On one side and pdgf vegf antagonist the using amount is sufficient to inhibit the patient a new blood vessel disease.

[0028] on the one side of an embodiment of the pharmaceutical composition comprising togf antagonist it is b togf antagonists. In another embodiment the pharmaceutical composition comprising a vegf antagonist it is a vegf antagonist.

[0029] in some embodiments in this invention claims a pharmaceutical composition comprising togf antagonists this utility model claims a nucleic acid molecule is body of the antisense rna molecules nucleic acid molecular rnai cyclic peptide protein polypeptide and antibody fragments the combination of the segment of the polymer or organic compound small. In another embodiment the invention claims a pharmaceutical composition comprising a vegf antagonist the invention claims nucleic acid molecule is body of the antisense rna molecules nucleic acid molecular rnai cyclic peptide protein polypeptide and antibody fragments the combination of the segment of the polymer or organic compound small.

[0030] on the other specific embodiment this invention claims a pharmaceutical composition comprising a vegf antagonist it is suitable for eye body is like 001. In an embodiment of this invention pharmaceutical composition comprising a vegf antagonist it is the combination of antibody or its fragment.

[0031] in a specific embodiment this invention claims a pharmaceutical composition comprising i3dgf antagonist it is the combination of antibody or its fragment. On the other this utility model claims a specific embodiment this invention claims a pharmaceutical composition comprising togf antagonist it is the antisense oligonucleotide.

[0032] this invention claims a pharmaceutical composition can comprise can be medical carrier it comprises a small ball body and water gel preparation.

[0033] in another embodiment the togf antagonist and/or the vegf antagonist the front drug.

[0034] in another embodiment the invention claims a pharmaceutical composition the invention claims the inhibition or treatment of eye new blood vessel disease of the handle section. In some embodiments in this utility model is suitable for through the invention claims a traditional chinese medicine composition for treating or inhibiting the eye new blood vessel disease of ischemic retinal diseases iris fresh blood vessel forming in eyes fresh blood vessel forming age-related macular degeneration cornea angiogenesis retinal forming fresh blood vessel forming choroidal neovascularization forming diabetic retinal ischemia or proliferative diabetic retina pathological. In other embodiments in this invention claims a pharmaceutical composition provides for use in said the need of the patient or the diagnosis of the patient or danger for the development of a disease in a patient who has inhibition or treatment psoriasis or similar rheumatoid arthritis means of.

[0035] this invention also claims a structure comprising a f1dgf antagonist and vegf antagonist of the medicine pharmaceutical pack. On the one side of the invention claims a method embodiment the medicine bag comprises togf antagonist it is b togf antagonists. On the one side of another embodiment the medicine package includes a vegf antagonist it is a vegf antagonist.

[0036] in another embodiment the medicine package togf antagonist and vegf antagonist are respectively and independently dosage form for preparing. In another embodiment the medicine package i 3dgf antagonist and vegf antagonist the invention claims a preparing method of the.

[0037] at some specific embodiment of this invention the medicine comprising a vegf antagonist it is suitable for eye body is like 001. In other embodiments in this invention of medicine packet comprising a vegf antagonist it is the combination of antibody or its fragment.

[0038] in some embodiments in this invention of medicine packet comprises togf antagonist it is the combination of antibody or its fragment. On the other specific embodiment of this invention the medicine comprises togf antagonist it is the antisense oligonucleotide. On the one side of another embodiment the i 3dgf antagonist and/or the vegf antagonist the front drug.

[0039] attached drawing is the

[0040] picture 1 *** togf b the invention claims isolated nucleic acid sequence number number x 02811 the sequence of seq id no: 1 picture.

[0041] 1 *** image is human i3dgf b amino acid sequence of number code the sequence of seq id no caa 26579: 2 of picture.

0042 i c ] [ image is human togf a nucleic acid sequence number number x 06374 the sequence of seq id no: 11 of the sketch map.

[0043] image i d is human pdgf a polypeptide sequence number number the sequence of seq id no caa 29677: 12 of the sketch map.

[0044] picture 2 *** vegf the invention claims isolated nucleic acid sequence number number: Nm 003376 the sequence of seq id no: 3 picture.

[0045] picture 2 b is human vegf polypeptide amino acid sequence number number the sequence of seq id no np 003367: The sketch map.

[0046] picture 3 is a human i3dgfr b nucleic acid sequence number code nm 002609 the sequence of seq id no: 5 of the sketch map.

[0047] picture 3 b is human i3dgfr b polypeptide sequence number number the sequence of seq id no np 002600: 6 picture.

[0048] picture 3 c is a human pdgfr a nucleic acid sequence number code nm 006206 the sequence of seq id no: 13 picture.

[0049] 3 human pdgfr image d is a polypeptide sequence number number the sequence of seq id no np 006197: 14 of the sketch map.

[0050] 4 *** image is human vegfr flt i i nucleic acid sequence number number the sequence of seq id no 501 st 63657 af: 7 of the sketch map.

[0051] 4 b is human image vegfr flt i i polypeptide sequence number number the sequence of seq id no: 8 of the sketch map.

[0052] picture 4 c is 2 or human vegfr kdr flk l nucleic acid sequence number number of af 035121 seqidn0: 9 and the intention.

[0053] 4 image d is 2 or human vegfr kdr flk l polypeptide sequence number number aab 88005 seqidn0: 10 picture.

[0054] 5 is image comparing the reference processing cont gleevec processing agent and antigen pdgf macugen *** treatment to pegaptanib treatment of corneal vegf agent and fresh blood vessel forming detection result and macugen *** gleevec and the combination of the processing result and pdgf vegf antigen and combination therapy of the image display.

[0055] *** picture 6 is in contrast peg processing of the little mouse angle the angle of film film on the fresh blood vessel forming of fluorescence microscope image photo image display.

[0056] picture 6 b is the existing gleevec processing of the little mouse angle the angle of film film on the fresh blood vessel forming of fluorescence microscope image photo image display.

0057 c ] [ picture 6 is the existing macugen *** processing of the little mouse angle the angle of film film on the fresh blood vessel forming of fluorescence microscope image photo image display.

[0058] 6 image d is the invention is used for the macugen *** gleevec and the processing of the little mouse angle the angle of film film on the fresh blood vessel forming of fluorescence microscope image photo image display.

[0059] picture 7 a fluorescence microscope image photo image displaying indicating normal pressure corneal management system and it is not affected by the applying apb5 h gfr antibody against pdgf agent the influence of.

[0060] picture 7 b is a fluorescence microscope image photo image displaying indicating normal pressure corneal management system it is not limited by applying the influence of gleevec.

[0061] picture 7 c is a fluorescence microscope image photo image displaying indicating normal pressure corneal management system at the same time it is not limited by applying macugen *** mac and the influence of gleevec.

[0062] picture 7 d is a fluorescence microscope image photo image displaying indicating normal pressure corneal management system it is not limited by applied peg the influence of.

[0063] image 8 is laser induced choroidal neovascularization forming the measuring result of the image display device comparing the reference processing cont gleevec processing agent and antigen pdgf macugen *** treatment to pegaptanib processing agent and using vegf antigen and macugen *** gleevec combined processing result of the vegf antigen or antibody pdgf combination therapy.

[0064] image 9 is laser induced choroidal neovascularization forming the measuring result of the image display device comparing the reference processing cont apb5 processing of the antibody pgfr antibody it has a resisting pdgf agent and macugen pegaptanib processing to processing the vegf body and it is suitable for macugen and apb5 mac apb5 combination and the processing result of.

[0065] image is 10 retinal development model result display the image comparing the reference processing cont arc 127 processing and pdgf macugen agent and treatment to pegaptanib processing agent and using vegf antigen and arc macugen 127 combined processing and pdgf vegf antigen and combination therapy result.

[0066] an angle of film 11 is fresh blood vessel forming detection result of the image display device comparing the reference processing cont arc 127 processing and pdgf macugen agent and treatment to pegaptanib processing agent and using vegf antigen and arc macugen 127 combined processing and pdgf vegf antigen and combination therapy result.

[0067] image 12 a is the mouse according to the cornea in the middle of the cornea fresh blood vessel forming of fluorescence microscope image photo image display.

[0068] image 12 *** is in arc 127 processing of the little mouse cornea in the middle of the cornea fresh blood vessel forming of fluorescence microscope image photo image display.

0069 12 c ] [ image is present macugen processing of the little mouse cornea in the middle of the cornea fresh blood vessel forming of fluorescence microscope image photo image display.

[0070] 12 *** image is present in macugen and arc 127 processing of the little mouse cornea in the middle of the cornea fresh blood vessel forming of fluorescence microscope image photo image display.

[0071] an angle is 13 film of fresh blood vessel forming detection result of the image display device comparing the reference processing cont apb 5 processing and pdgf macugen agent and treatment to pegaptanib processing agent and using vegf antigen and macugen apb 5 combined processing and pdgf vegf antigen and combination therapy result.

[0072] 14 is an angle of film of fresh blood vessel forming detection result of the image display device comparing the reference processing cont apb 5 processing and pdgf macugen agent and treatment to pegaptanib processing agent and using vegf antigen and macugen apb 5 combined processing and pdgf vegf antigen and combination therapy result.

[0073] invention the specific

[0074] in this invention the invention to all of the patent and literature patent application this invention is receiving the reference.

[0075] defined

[0076] in the file to the phrase term and it has the following it has the meaning of. Unless the invention the invention the usage of the present technology and science and technology language with the invention belongs to technical field of common technology the common people can know the same meaning.

[0077] '' antagonists '' representation can be partially or completely inhibit the activity of the target molecule or generation of the reagent. Specifically speaking is a '' antagonists '' in the file selectively use time it can reduce the cost expressing pdgfr h gf vegfr vegf or gene expression level of mrna level of protein level or protein active agent. Antagonist an exemplary form comprises such as protein polypeptide polypeptide such as cyclic peptide antibody or antibody fragment peptide mimetics anti-sense nucleic acid molecules nucleic acid molecule it is suitable for the rnai and small organic molecular. Inhibiting vegf antagonist and / or vegfr togf pdgfr ligand and receptor of the target display the invention claims a non limiting elastic mechanism comprises inhibiting ligand synthetic and/or stability such as using the ligand target gene or nucleic acid anti-sense nucleic acid or rnai composition of the blocking body and the same source is the combination of such as using the ligand is against antibody or soluble receptor inducing source at the same suppressing receptor synthetic and/or stability such as using the target ligand receptor gene or nucleic acid anti-sense nucleic acid or rnai composition blocking body and it is the same source is the combination of such as the use of the receptor antibodies and the blocking body is the ligand at the same power the activation of using such as receptor tyrosine kinase inhibitors. The said antagonists can be directly or indirectly inhibiting ie molecular.

[0078] technology ] in the file the '' antibody '' is intended to comprising complete antibody such as any one of ige igm antibody igg iga and so on and it comprises a can be identified it is connected with the spine animal such as mammal egg white sugar and so on specific the reaction of their section. Antibody can be used regular technology fragmentation and said complete antigen in the manner of same screening these segments the use of. So the term comprises antibody molecules of protease cutting of the segment or recombinant preparation a part of it is able to the certain protein selectively react. Said protein enzymatic hydrolysis and / or recombination fragment of the non limiting examples includes fab f ab fab fv 2 ' ' and single chain antibody scfv and it includes the peptide linker of the combination of the v [l] and / or v structure domain ] [ h. Said scfv s s can be mentioned in covalent and noncovalent connected to form with two or more binding sites of the antibody. The invention claims a polyclonal antibody monoclonal antibody or antibody of other preparation and purifying recombinant antibody.

[0079] technology ] the '' body is a '' can be connected with the term '' nucleic acid ligand '' exchange using the same nucleic acid expressing the nucleic acid through it is suitable for special three-dimensional conformation with the ability it can combine with target molecule and it has the advantages of the antagonistic effect and inhibiting. Of this invention is target 3dgf vegf or i or their cognate receptor togfr or vegfr one so the using term or nucleic acid aptamer togf ligand or vegf or nucleic acid aptamer ligand or i3dgfr or nucleic acid aptamer ligand or vegfr or nucleic acid aptamer ligand. Said it is suitable for the inhibition of target can be realized by following ways carrying out: Target catalyst the combination of the change of target can be modified or changed target or target the function of the active mode and the target the reaction as a suicide inhibitors covalently attached with the target of promoting and other target molecule the reaction between. Is especially suitable for body may comprise multiple ribonucleotide unit deoxyribonucleic acid glucoside unit or the two kinds of nucleotide residue the mixture of. Body it also comprises one or more decorative through the base of the main chain or phosphoric acid ester unit such as the positive the invention further claims the.

[0080] '' antibody antagonists '' representing the invention the defined by the antibody molecules it can stop or significantly reduce or target togf vegf of one or more active. Such as vegf inhibitor antibody which can inhibit or reduce vegf stimulation of angiogenesis ability.

[0081] if the two sequences wherein each of the base are matched with it can form watson christopher g watson crick base and then the invention claims a nucleotide sequence is the other the invention claims a nucleotide sequence complementary to the '' ''. Terms '' complementary strand '' herein can be connected with the term '' complementary body '' exchange using. Nucleic acid chain the complementary body can be coding chain the complementary body or the coding chain body the complementary. 0082 ] [ phrase '' conservative residue '' or '' conservative amino acid substitutions '' representation is based on some common characteristics of the amino acid group. Determining independent amino acid between the common characteristic of the function of path analysis is at the same source biology of the corresponding proteins between the amino acid the variation of the normalized frequency. According to said analyzing can be determined of amino acid groups in one group of the amino acid preferably can be mutually exchanged it to the to the total protein of the structure of the influence on the other similar schulz gary e h and r schirmer principles of protein structure springer verlag 501 st in this way the angle of the amino acid component example comprises:

[0083] i having electric charge in group is composed of the asp lys or glu arg and it is composed of his

[0084] ii with positive electric charge of the component of thymus arg and it is composed of his

0085 ] and [ with negative charge is asp or glu is composed of

[0086] iv aromatic group is composed of a phe tyr trp and it is composed of

[0087] v ring group is composed of a nitrogen and it is composed of his trp

[0088] vi of the group consisting of aliphatic non-polar val or leu group is composed of ile

[0089] vii slightly polar group is met and is composed of cys

[0090] viii group is composed of the small residue ser thr asp asn gly ala gln glu and pro is composed of

[0091] ix aliphatic group is val leu lie met and cys composition and

[0092] x jr hydroxyl group is composed of the ser and it is composed of thr.

0093 ] and [ the upper surface of the group lists the outside of the each amino acid residue can be formed it the composition and the single amino acid for forming composition can be simply through the field of common use of the amino acid and letter and letter or the abbreviate indicated or jn 501 st

[0094] technology ] in the file the '' interaction '' actual of the upper surface of display comprising molecular between can detect the relation of or combining such as biological chemical interaction the egg albumen protein nucleic acid nucleic acid nucleic acids and proteins small molecule or nucleic acid molecular is small the mutual action between the.

Technology ] [ 0095 a '' interaction of '' protein expression can be the target protein interaction is combined and / or other way of combining pdgf or protein such as vegf protein or their corresponding with the same source acceptor.

[0096] in the file and the nucleic acid such as dna or rna relative technology a '' separation of the '' represents the present in the on macromolecule natural source of the other dnas or rnas are respectively separated molecular. Similar in the file and polypeptide which is corresponding to the operation of the '' separation of the '' representation and said polypeptide to the source in the other proteins are isolated protein molecule. In the file a technique for separating is expressed by the recombinant dna technology production is basically does not contain cell material virus material or culture medium of the nucleic acid or peptides or through the chemical synthesis time it basically does not contain chemical precursor or other chemical reagent.

[0097] '' for separating nucleic acid that '' surface comprising a nucleic acid fragment it is not as segment in the presence of natural and it will not take the natural state is found. Terms '' separation of the '' is also used to express a polypeptide which is from the other cell protein separated from and representation comprises purified recombinant polypeptide two.

[0098] technology ] in the file mark language '' '' '' and capable of detecting and marking '' representation can be detected molecule comprises but not limited to a radioisotope fluorophore chemical luminous enzyme enzyme part the microbial enzymes cofactor enzyme inhibitor dye metal ion ligand such as a biologic hapten such as pixel or. Terms '' fluorescent agent '' representing can exhibit measurable range of the fluorescent substance or other part of the. Can be used in this invention is used for marking the specific example comprises fluorescein rhodamine dan umbrella or ketone texas hong luminal nadph-cytochrome alpha beta half cream glycosidase and horseradish peroxidase.

[0099] '' gene in the cell of the expression level of '' represented by the cell of encoding the gene of stop the expression of the front and transcription mrna xin-sheng of transcription for processing the middle of the mature mrna and degradation product of level and it is composed of said gene albumen translation of horizontal.

[0100] technology ] in the file the '' '' expressing nucleic acid polynucleotide as deoxyribonucleic acid dna and and if suitable also represents a ribonucleic acid rna. This technology and also when the management and comprises nucleotide analogues of preparing dna rna or similar object as the same material and it is used for the embodiments of the single chain sense or antisense and a double stranded polynucleotide ests chromosome cdnas mrnas rrnas and can be called as nucleic acid molecules of the representative examples of.

- 0101 technology is a '' oligonucleotide '' expressing nucleic acid nucleic acid monomer or oligomer or polymer body it is composed of natural occurring of basic sugar and blood sugar the main chain is composed of the key. The term it also comprises modifying the or substituted by the oligomer includes a natural of the monomer or a part of them has a similar function of. Substituted by an oligomer of the whole is based on several factors which comprises increased cell taking or increasing intensity of the nucleic acid enzyme resistance and it is according to the field of the method known for public selected. Whole oligonucleotide or it is only a part can comprise substituted by the oligomer.

Technology ] [ 0102 a '' percentage at the same a magnetic '' representing two kinds of amino acid sequence or both nucleotide sequence of sequence at the same a magnetic. At the same a magnetic can be controlled by comparing each sequence confirming the position of them can be in order to compare for comparing the. When the comparative sequence of the same position is the same base or amino acid and takes the molecular in the position of the is the same; The same the position of the point to be same or similar of the amino acid residue such as the space and / or electric performance of similar occupied when said molecule can be called at the position which is homologous with the similar. Homology is similar or same capability to the percentage represented by sequence comparing all the position of the same or similar amino acid the number of the function of. Can be used in all kinds of comparing arithmetic and / or program comprises hidden markov model and hmm fasta blast. Hnim fasta and blast can be from following mechanism can be obtained: The national center for biotechnology information national library of the medicine of the national health institutes bethesda md and the european bioinformatic institute ebi. In an embodiment of the two sequence the percentage of the same and can be obtained through said gcg program determining the nick weight is 1 such as to each amino acid gap and it performs weighting is the same as it is comprised of two sequences between the amino acid or nucleotide mismatch. Is used for comparing the other techniques described in the document in: Methods in enzymology vol 266: Computer methods for macromolecular sequence analysis led doolittle academic press inc a division of the brace harcourt california san diego and co of america. If necessary allows the sequence in the gap of the comparison program is used for comparing said sequence. Smith waterman is a kind of allowing the sequence compared to existed in the gap of the algorithm and parameter meth biol 70 mol: 173-187. At the same time adopting needleman wunsch and comparison method of the gap program can be applied to the comparison sequence. Comprises using hmm to more technology and operation method of describing for the document in: Sequence structure and databanks: A practical approach led oxford university incorporated in and press bioinformatics ! systems and databases led kluwer academic publishers. Another searching strategy using the software mpsrch maspar the software in the computer is running. Mpsrch using smith watermnan of algorithm in large amount of the parallel computer the sequences to carry out grading. This utility model claims a method for improving the selection switch system of far away the matching ability and especially can be suffered by small gap and nucleotide sequence error. Can be nucleic acid coding the amino acid sequence is used to retrieve protein and dna database. Has independent of a sequence of data base describing for the document in: Methods in enzymology led and the upper doolittle. The database comprises number embl and japan the dna of the database ddbj.

[0103] '' completely matches with the surface of the '' display express double chain it is composed of the body of said double stranded polynucleotide or oligonucleotide chains each other to form the double chain structure and so on each chain is set on each of the nucleic acid is on another chain ribonucleotide the occurrence of the g watson christopher base matching. Language this technology also comprises which can be used nucleotide analogues selected from corresponding to such as deoxidizing inosine with 2-amido- purine nucleoside and so on the base. Target polynucleotide and oligonucleotide or polynucleotide between the double chain the main body of the mismatch the double chain is set on the body of the a pair of nucleotide it can not g watson christopher combined. The invention claims to the three chain body the term representing third chain is completely matched body is composed of the double chain body and the third chain is composed of wherein each nucleic acid is completely matches with the double chain is set on the body of the base the generation of hoogsteen or reverse hoogsteen combined.

V- 0104 ] [ terms '' rna interference rnai '' '' '' '' or sirna '' are represented by the one or more double-stranded rnas guide into target cell in order to reduce gene or genetic of the product of expression of any method the rna and the target gene at the same source especially the target gene such as vegf pdgf or rna at the same so as to make the signal source.

[0105] polymorphism variant may also include a '' single nucleotide polymorphisms snps '' wherein the polynucleotide sequence with a base the change of such as vegf 3dgf the i or one of the base the change of. Snps of the existence of the can be such as some people disease state or the disease state the orientation of the index.

[0106] characteristic '' is abnormal profile '' such as tumour cell biologic state indicating the disease state is changed the cell of each component the content of. Cell component comprises horizontal rna abundance protein level or protein active horizontal.

[0107] technology ] the language '' protein '' can be connected with the term '' '' '' peptide and polypeptide '' exchange using. Terms '' '' recombination albumen expressed by recombinant dna technology the production of the invention claims a protein of the general expression of the encoded protein or rna dna inserted into the appropriate expression carrier the expression carrier and it is used for transforming host cell to produce heterologous protein or rna. Other phrase '' '' source to the related to coding regroup protein is recombinant gene wherein the '' recombinant protein '' the meaning of which is comprised of it has natural protein the amino acid sequence or the like by a mutation producing amino acid sequence of protein said mutation comprising natural of protein existing in a substituted or lost.

[0108] technology ] in the file to language '' '' gene expression of nucleic acid sequence encoding such as between a target nucleic acid or its anti-sense transcription property that the nucleic acid sequence leading in the cell. For guiding the transgenic animal or cell to said transgenic is able to be partially or completely different source the source or the lead in the transgenic animal or cell of the endogenesis gene of homologous will not be affected by them is designed to be or has been in such a way is inserted into the cavity of said animal gene so as to change inserted into the cell gene group of such as it is inserted into the position which is different from natural gene of the position or it is inserted into the lead to the knocking. Transgenic also can be added in the form of a body in the cell of. Transgene may include one or several transcription regulatory sequence and any other nucleic acid such as intron and they can be selected the best of nucleic acid expression of necessary.

[0109] '' new blood vessel disease '' indicating the changes or not be influenced by the adjustment of the angiogenesis as the feature of the diseases associated with the same as cancer or conversion of neoplastic diseases and cancer except. New blood vessel disease of the example includes psoriasis rheumatoid arthritis and eye neovascular diseases including diabetes retina pathological and age-related macular degeneration.

[0110] technology ] in the file the '' fresh blood vessel forming '' and '' angiogenesis '' can be mutually exchanged to use. Fresh blood vessel forming and angiogenesis expression generating new blood vessel into the cell tissue or organ. Angiogenesis the control of the some diseases state changes and there are many occasions the lower part of the disease related to the pathology damage and it is not influenced by change of the control or is not easy to control angiogenesis relative. Long it is not limited by the adjustment of the angiogenesis the present various disease states in it comprises the endothelial cell abnormal growth as the feature disease and supports on the situation occurred in pathology damage comprising blood vessel leakage and permeability.

[0111] '' eye neovascular diseases is a '' in patient eyes or changed it is not limited by the adjustment of the angiogenesis as the feature disease. Example of the eye neovascular diseases is comprised of video nerve disk fresh blood vessel forming iris angiogenesis retinal forming fresh blood vessel forming choroidal neovascularization form an angle membrane fresh blood vessel forming glass body fresh blood vessel forming green body in the blood vessel yi pterygium macular edema disease diabetes retina pathological diabetic macular of raw water vessel of retina pathological retinal degeneration grape membrane inflammation retinal inflammatory disease and proliferative vitreous retina pathological change.

Technology ] [ 0112 a '' for treating '' subject a vascular disease '' '' or curing patients with new blood vessel disease of the testee representing the subject with the medicine for treating such as applying drug so as to reduce new blood vessel disease of the at least one symptom. It in the file operation of the '' '' for treating attention on the curing and improving new vein state or disease at least one of the symptom. It in the file '' treatment comprises administering '' opening or pharmaceutical composition for treating or preventing vascular disease eye new.

[0113] '' patient '' represents any animal. Terms '' animal '' comprises mammal including but not limited to human and other primate. The term it also comprises a domestic animal such as beef pork yangma dog and cat.

[0114] '' rogf '' or '' platelet-derived growth factor '' expression and influence angiogenesis or blood vessel formation process of the mammal platelet-derived growth factor. In the file operation of the '' rogf '' comprises togf of each sub rogf model comprises i a reference picture b and gf *** and h a reference picture i c and d. Other in the file operation of the '' pdgf '' representing togf related to angiogenesis factor i as 3dgf c and d togf they are the same source togf receptor stimulation effect for angiogenesis or blood vessel formation process. Specifically speaking is a '' togf '' representing growth factor kinds of any members it can i and the parameter such as togfr b picture 3 a and b or togfr a reference picture 3 c and d togf receptor binding; Ii activation and associated with a vegf receptor tyrosine kinase activity; And iii so it affects the blood vessel or blood vessel formation process. In the file operation of the '' togf '' a general expression growth factor this invention claims a kind of the following members it can through the combination and active reactive cell types of platelet-derived growth factor surface of the cell receptor pdgfr to the inducing dna synthesis and mitotic generating. Togfs can realize the special biology action it comprises such as: Directional cell migration chemotactic activation property and cell; Phosphatidase activity; With reinforced phosphatidyl muscle alcohol circulation and metabolism of prostaglandin; Stimulating reaction of cell of collagen and collagen synthesis enzyme; Change cell metabolism activity comprising a substrate with a cytokine production and lipoprotein absorption; The lack 3dgf i receptor cell proliferative in the reaction of the induced; And effective blood vessel active contractive. Terms '' togf '' representation comprises '' togf '' polypeptide and its corresponding '' togf '' coding gene or nucleic acid.

[0115] '' togf a '' togf representation of a chain polypeptide and the corresponding coding gene or nucleic acid.

[0116] '' togf '' b represents togf b chain polypeptide and the corresponding coding gene or nucleic acid.

[0117] '' vegf '' or '' vascular endothelial growth factor '' expression and influence angiogenesis or blood vessel formation process of the mammal vascular endothelial growth factor. In the file operation of the '' vegf '' comprising a vegf all kinds of subtype but also is called the blood vessel permeability factor vegf vpf and a reference picture 2 a and b they are connected through a vpf such as vegf gene of the variable is connected with the cutting generated by vegf 121 comprising a vegf 165 and vegf 189. Other in the file operation of the '' '' vegf expression of vegf related to angiogenesis factor such as pigf placenta growth factor vegf vegf vegf b c d and e vegf they are the same source vefg receptor stimulation effect for angiogenesis or blood vessel formation process. Specifically speaking is a '' '' vegf expression growth factor kinds of any members it can i and such as vegfr i flt the i picture 4 a and b vegfr kdr flk 1 or 2 the picture 4 a b c and d 3 or 4 flt vegfr vegf receptor binding; Ii activation and associated with a vegf receptor tyrosine kinase activity; And iii so it affects the blood vessel or blood vessel formation process. '' vegf '' terms freely the '' '' vegf polypeptide and its corresponding '' vegf '' coding gene or nucleic acid.

[0118] '' rogf antagonists '' representation can be partially or completely reducing or restraining activity togf or generation of the reagent. Togf antagonists can be directly or indirectly and it can reduce or inhibit special rogf such as rogf b. The outside of the '' antagonists '' the definition of the '' rogf antagonists '' may include can be used for togf ligand or the same source acceptor so as to reduce or inhibit i3dgf associated receptor signalling the reagent. The '' pdgf antagonists '' example comprises such as: Togf the target nucleic acid anti-sense nucleic acid or rnai composition; Pdgf is especially suitable for the body resisting pdgf antibody or soluble receptor togf of the bait it can prevent togf the same source acceptor binding; Target at the same source togf receptor pdgfr nucleic acid anti-sense nucleic acid or rnai composition; Pdgfr and it is suitable for resisting pdgfr body or antibody which can bind with same source togfr receptor; And togfr tyrosine kinase inhibitors.

[0119] '' vegf antagonist '' representation can be partially or completely reducing or restraining vegf from producing active or reagent. Vegf antagonist can be directly or indirectly reducing or restraining vegf special such as vegf 165. The outside of the '' antagonists '' defined in the same vegf antagonist '' '' may include can be used for vegf ligand or the same source acceptor so as to reduce or inhibit associated with a vegf receptor signalling the reagent. The '' vegf antagonist '' example comprises such as: Vegf the target nucleic acid anti-sense nucleic acid or rnai composition; Vegf antigen and antibody of the body resisting vegf or soluble vegf receptor of the bait it can prevent the source of the same vegf receptor binding; Target at the same source vegfr vegf receptor and nucleic acid anti-sense nucleic acid or rnai composition; It can combine with same source vegfr receptor antibody for resisting vegfr vegfr body or antibody; And vegfr tyrosine kinase inhibitors.

[0120] '' sufficient to inhibit new blood vessel disease of the '' quantity representing the invention combination for curing or preventing the new forming disease or other symptoms of the needed antagonists of effective amount of. For implementing this invention is used for therapeutic treatment of new vascular disease caused or cause the new blood vessel disease of the state of the active antagonists '' an effective amount of '' according to using method new blood vessel disease of the anatomy part of the patient the age of the body weight and the general healthy condition is changed. The doctor and veterinary determining the suitable scheme and the dosage of. Is called as the amount sufficient to inhibit blood vessel disease of the new amount.

[0121] through following detailed explain and claim the book of this invention the other feature and advantages.

[0122] polypeptide variants of x '' '' peptide x represents an amino acid sequence of a polypeptide comprising one or more amino acid residue change. The variant may have a '' conservative '' change in which a substituted amino acid has similar structure or chemical character such as leucine different substituted leucine. Han is in the variant may have the '' not conservative '' altering such as toner for amino acid substituted amino acid. Like small change can be further comprises amino acid or inserting or losing the two. Determining which of these amino acid residue which may be substituted inserting or shortcoming and it does not eliminate the biology and immunological active guide can be used in the field of know the computer program the software such as lasergene dnastar.

[0123] terms '' variant '' is used for representing more nucleotide sequence can be the gene or its coding sequence related to the polynucleotide sequence. The defined may also include such as '' allele of the '' '' shearing '' '' species '' or a variant of '' polymorphism ''. Shearing change body can be connected with the reference molecule and it has obvious at the same a magnetic. Will not be affected by the mrna during machining exon variable and connected with a common has more or less of the number of the polynucleotide. Which is corresponding to the polypeptide can be provided with an additional function domain or lack of the structure of. For changing body is on the object this utility model are not the same polynucleotide sequence. Is obtained the polypeptide each other and it has obvious of the amino acid at the same a magnetic. A state variable is specific species of the individual are specific gene of the polynucleotide sequence change of.

[0124] terms '' carrier '' representation can be turned transportation and it is connected to the other of nucleic acid nucleic acid molecule. A type of the carrier is added in the body can be dyed in vitro replication of the nucleic acid. With carrier which can be automatically copying and / or expression and it is connected with the carrier of a nucleic acid. Can guide can be operated and it is connected with the gene expression carrier in the file is called the '' expression carrier ''. It is usually used for recombinant dna technology in the expression carrier is usually '' plasmid '' in the form of the general expression ring double chain dna ring in the same carrier of the form of them is not connected with the dyeing body is combined with. In the specification of '' '' '' and plasmid carrier '' can be mutually exchanged to use because of the plasmid carrier is the most normal use in the form of. Will not be affected by the invention comprises this kind of other type the expression carrier and they have the same function and then they are in the field of the known.

[0125] * combination for curing

[0126] the invention is partly based on vegf togf and the activity of the special inhibiting effect it is used in the suitable growth factor antagonist as effective curing means for the treatment of patient there is a new blood vessel disease of the patient. I 3dgf antagonist and vegf antagonist the combination of the application claims method for treating eye new vascular disease of than single using any one and more antagonists medicine for treating benefit. The authentication proves that the two by the stimulation of retina endothelial cell system of angiogenesis method surface does not have shows obvious synergistic function for the research of the vegf pdgf agent and the combination effect is almost any material of ginseng and so on in castellon exp eye res 74: 523-35.

0127 ] and [ i3dgf vegf is a new blood vessel the body especially the eye growing in the important object stimulation. The invention is to inhibit togf vegf and biological activity to a combined therapy of the claims a method for treating or preventing a new blood vessel disease the invention claims a method for.

[0128] this invention claims the use of combination therapy for inhibiting new blood vessel disease of the method and composition. Specifically speaking the invention uses the cell in blood vessel of the two kinds of different cell the communication signal transmission path of the vegf togf and signal transmission as new vascular disease such as eyes new blood vessel disease of the treating target. This utility model claims a combining method is particularly useful for treatment of any number of the ocular neovascularization formed by such as the mark of ophthalmic diseases or conditions including but not limited to optic nerve disk fresh blood vessel forming iris angiogenesis retinal forming fresh blood vessel forming choroidal neovascularization form an angle membrane fresh blood vessel forming glass body fresh blood vessel forming green body in the blood vessel yi pterygium macular edema diabetic macular of raw water vessel of retina pathological retinal degeneration macular degeneration grape membrane inflammation retinal inflammatory disease and proliferative vitreous retina pathological change. Said combined treatment of inhibiting i 3dgf such as vegf togf b and a signal transmission such as vegf antagonist the composition of the single use the two comparing to the curing produces enhanced treatment effect. Although the lower part of the invention claims the example of this invention claims a single i3dgf antagonist and a vegf antagonist the combination of it is not only can understand the more antagonists combination can be needed by.

[0129] according to the invention claims an pdgf and the vegf combination therapy can be independently carried out or other combination for curing and it can be used in family medical clinic room hospital outpatient department of hospital supply room or. For curing common in the hospital from the beginning of the doctor can closely observation curative effect and performing any needed adjusting. Combination therapy duration dependent on the treatment of new blood vessel disease of the type of the patient age and the status of patient with diseases of the stage and types and patients to treat the reaction. The development of new blood vessel disease of the high risk human such as diabetes patient can be connected with the treatment and inhibiting or slowing the symptoms of the working. The invention claims one of the notable advantages are that the togf antagonist and vegf antagonist the composition for treating vascular disease new enables the application of low dosage of each antagonist and a small quantity of the total activity antagonists so it has low toxicity and side effect and low cost the invention claims a similar function of.

[0130] the combination for each component of the using dosage and frequency can be independently controlled. Such as a antagonists can be used for three times each day and a second antagonist can be applied for one time every day. Combination therapy can be that intermittent of the circular shape supply it comprises static stop period of time so as to make the patient's body the opportunity from any material the method still no side effect of recovering. Said antagonists also can be used for the preparation so that it is convenient for one time application can be used for transmitting two antagonists.

0131 ] and [ pdgf orange vegf antagonist target

[0132] i3dgf is initially from the blood platelet lysate for separating and it is determined existed in the serum and it is not in blood plasma of it is mainly used for promoting the growth activity. Wherein firstly displaying togf of promoting mitotic active effect of the connective tissue cells such as the fibroblast and smooth muscle cells and present in the culture in nerve cell of rubber. Industry which has been identified for the two kinds of homology togf in the same working model togf a and b they are formed by independent of the gene is located on and no 7 22# dyeing body of the code. From blood platelet of the main type of the ab the second heterologous polymer although the three can be the dimer of aa bb or ab are all natural the presence of. The translation after pdgf second polymer is processed to about 30kda the secretion of protein.

[0133] industry which has been identified the high affinity binding togf two kinds of cell surface protein alpha and beta heldin proc and natl acad sci usa 78: 3664; Williams proc and natl acad sci usa 79: 5867. The two kinds of comprises five immune globulin sample cell outer structure of a transmembrane structure domain and in the cell tyrosine kinase structure field the structure of it is composed of kinase inserting structure of separated from the. In the several years in industry the invention claims compounds of the three i 3dgf in the same working model the three receptors dimer alpha alpha or alpha/ beta and beta and beta specific. Receptor alpha at the same source second polymer and high affinity of combining the there are three i3dgf in the same working acceptor at the same source beta dimer only using high affinity of combining togf *** of the combined togf ab affinity of is about 10 times and alpha/ beta receptor heterologous second polymer can be combined with high affinity f1dgf bb and f1dgf ab westermark and heldin acta oncologica 32: 101. The specific mode is composed of almost similar to a chain it only can bind the alpha body and b chain can be combined with high affinity receptor alpha and beta subunit of the two power caused by.

[0134] total speaking the invention claims can inhibit one or more active agent i3dgf. These togf inhibitor or togf antagonists can be used for one or more in the form of the said ligand togf. Platelet-derived growth factor comprising a chain pdgf a and b chain pdgf-b at the same source or heterogenous dimer them through combining with two ends relative to the receptor tyrosine kinase receptor alpha - [ [ pdgfr [alpha] ] and [ beta ] receptor pdgfr ] and [ beta and dimerization exert effect. The other industry which has been identified for the said i3dgfr compound of two of protease activity ligand pdgf c and d togf in parameters such as cell 2 biol nat li: 302-9; Bergsten and so on nat cell 3 biol: 512-6; And uutele and circulation 103: 2242-47. Because said pdgfrs of different ligand binding specificity known pdgfr ] [ [ alpha alpha is it can combine with pdgf pdgf aa bb pdgf ab and cc pdgf; Pdgfr beta - [ [ beta is capable of combining pdgf bb and pdgf dd; Pdgfr ] [ [ alpha and beta on it can combine with pdgf ab pdgf bb pdgf cc and pdgf dd consult in betsholtz and bioessays 23: 494-507.

[0135] vegf is secreted disulfide bond which is connected with the same source dimer it can selectively stimulating endothelial cell proliferation and migration and generating matrix degradation enzyme conn proc and natl acad sci usa 87: 1323-1327; Ferrara and henzel biochem biophys res commun 161: 851-858; Pepper and biochem biophys res commun 181: 902-906; Unemori and so on cell j physiol 153: 557-562 they are form a new blood vessel which is needed the process of. Vegf in four form vegf 121 vegf 165 vegf 189 vegf 206 the because the vegf gene of the variable is connected with the cutting generated by the equal mol endocrinol 5 houck: 1806-1814 jischer and j biol chem 266: 11947-11954. Two is small it can be the form of diffusion is bigger the two form and keep it is located in the cell membrane is the invention is their the heparin with high affinity result. Vegf 165 but also can be used for the heparin binding and it is rich in the form of the. Vegf 121 which can not with heparin binding the unique shape is similar to the vegf receptor it has low affinity gitay goren and j biol chem 271: 5519-5523 and the lower of promoting mitotic effect and so on keyt j biol chem 271: 7788-7795. Vegf of the biology action it is composed of two kinds of tyrosine kinase and flt i receptor flk 1/ kdr mediated by their expression in great extent the upper limit to the source of endothelial cell de vries science and so on 255: 989-991; Millauer and so on cell 72: 835-846; Terman and 0ncogene 6: 519-524. Although two functional receptor expression is high affinity combining the need of the endothelial cell in the current and chemical properties and promoting mitotic signal transmission of similar is mainly through kdr the body to park and so on j biol chem 269: 25646-25654; Seetharam and so on 10 oncogene: 135-147; Waltenberger and j biol chem 26988-26995. Most close to the industry of the lack of vegf gene of the single allele carmeliet and nature 380: 435-439; Ferrara and nature 380: 439-442 flt 1 or on the two ends of allele fong and nature 376: 66-70 or flk 1 gene and nature 376 shalaby: 62-66 of the little mouse body is proved that the vegf vegf receptor and for blood vessel growth of importance. In each occasion is the blood vessel forming the obvious the abnormity cause the embryo to death.

[0136] the present known by the tissue hypoxia inducible compensation of blood vessel formation by vegf mediated levy and j biol chem 2746-2753; Shweiki and nature 359: 843-845. The human can be used in the research shows that the industry of angiogenesis retinal disease resistance of the glass body of the high concentration of the vegf but it without or not the activity of the fresh blood vessel forming disease state does not exist in the high concentration of the vegf. The experimental macular the operation is cut off after human choroidal tissue also exhibits high level of the vegf.

[0137] is not only is a unique of the known endothelial cell specificity mitogen the outside of the vegf is angiogenic growth factor in specific so that the inducing blood vessel the big molecule the permeability of the instantaneous increase the ability of the side surface so the primary and to substitute the name of the invention claims a blood vessel permeability factor vpf consult in john dvorak and immunol 122: 166-174; Senger science and so on 219: 983-985; Senger such as cancer res 46: 5629-5632. Increase the blood vessel permeability and caused by blood plasma proteins in the blood vessel outer space it is helpful for the deposition of the provided by migration of endothelial cells in the temporary substrate to form new blood vessel and am john dvorak pathol 146: 1029-1039. Permeability the high and it is actually new vein of the characteristic feature the tumour associated the blood vessel.

0138 ] and [ pdgf vegf antagonist orange

[0139] summary

[0140] this invention claims a can be used for blood vessel disease of the combination for treating togf and antagonists of the vegf inhibitors. Pdgf specific antagonist and vegf antagonist in the field of the known and it is simple and describing for the lower part of the. The current or has been a technology people can gain the other togf antagonist and vegf antagonist body and comprises an oligomer body anti-sense nucleic enzyme and composition rnai which can pass through the field of a conventional practical structure the specification of the teaching and guiding method for identifying and production it comprises the following further claims a part of the.

[0141] i3dgf antagonists

[0142] common pdgf such as pdgf-b inhibiting can be controlled by the invention claims a method to realize. Such as can be obtained it can inhibit the activity or i3dgf generate several sorts of togf antagonist and it can be used in the invention claims a method for. Exemplary togf antagonist is comprised of i 3dgf of the nucleic acid ligand or is like the context in the description. The said i3dgf antagonists can be such as resisting pdgf antibody or antibody fragment. It through inhibiting the combination of receptor makes said togf molecular deactivation. The nucleic acid in the horizontal upper inhibiting expression i 3dgf such as core and anti-sense rna enzyme rnai molecule nucleic acid molecules this invention can be used as antagonists of. Other togf antagonist peptide protein comprising a cyclic peptide or small organic compound. Other by damaging the lower part of signal transmission it can restrain pdgf of the signalling activity such as by using a micromolecule tyrosine kinase inhibitory antagonists comprises the following described an antagonist. Compound or agent and the i 3dgf antagonists effect of energy can be according to the field of the known method to confirm the external parameter can be seen in the document such as dai and gene s & dev 15: 1913-25; Zippel and eur j cell biol 50: 428-34; Zwiller oncogene 6 and so on and: 219-21 501 st

[0143] this invention also comprises the field the known togf antagonist and the context of the support and it belongs to common technology personnel knowledge in the range of any and the same reagent. Such as resisting togf the restraining of the antibody in the field of the known such as described in the usa patent 5 no 5 976 534 833 986 5 817 310 5 882 644 5 662 904 5 620 687 5 468 468 and pct wo 2003/025019 in those of the said document content to form the full text as the invention reference. The invention comprises n-phenyl-2-pyrimidine-amine derivatives which is antagonists togf such as claims the american patent number 5 521 184 and w 02003/013541 wo 2003/078404 wo 2003/099771 wo 2003/015282 wo 2004/05282 and in those of the said document to form the full text as the invention reference.

[0144] togf can stop the function of the small molecule in the field of the known such as described in the usa patent number 6 528 526 h gfr tyrosine kinase inhibitors 6 524 347 h gfr tyrosine kinase inhibitors 6 482 834 h gfr tyrosine kinase inhibitors 6 472 391 h gfr tyrosine kinase inhibitors 6 696 434 # 6 555 331 6 251 905 6# 245 667 5 760 6 207 990 141 5 700 822 5 618 837 and 5 731 326 in those of the said document content to form the full text as the invention reference

[0145] togf can stop the function of proteins and polypeptides as the field of the known such as described in the usa patent 6 no 350 731 h gf peptide analogue 5 952 304 in those of the said document content to form the full text as the invention reference.

[0146] is able to restrain the egf and/or togf receptor tyrosine kinase the double unit and bicyclic aryl and heteroaryl compounds as the field the known such as described to such as us patent 5 no 476 851 5 480 883 5 656 643 795 889 5 and 6 057 320 in those of the said document content to form the full text as the invention reference.

[0147] is used for inhibiting togf of the antisense oligonucleotide mentioned is the field of the known such as described in the usa patent 5 no 869 462*5 821 234 in those parts of each document content can full text mode to work the invention reference.

[0148] is used for inhibiting i3dgf body which is also named as nucleic acid ligand is the field the known such as described to such as us patent 6 no 582 918 6 229 002 6 207 816 5 668 264 674 5 685 and 5 723 594 in those parts of each document content can full text mode to work the invention reference.

[0149] this field the known used for inhibiting togf other compound comprises description of the american patent 5 no 238 950 5 418 5 135 674 892 5 693 610 5 700 822 5 700 823 5# 728 726 5 795 910 5 817 310 5 5 5 of 580 872 218 932 932 602 958 959 990 141 5 5 6 6 358 954 537 988*6 673 798 in those parts of each document content can form the full text the text Reference

[0150] vegf antagonist

[0151] vegf such as vegf inhibitor is a through a method for realizing. Such as vegf invention can restrain the activity or generate several sorts of vegf antagonist it is comprised of a nucleic acid molecule such as aptamers antisense rna enzyme core rnai vegf molecule and antibody can be obtained and it is can be used in this invention claims a method of. Example of vegf antagonist in an comprising a vegf of the nucleic acid ligand or the right is as follows the description file. The vegf a particularly useful for antagonists of the eye 001 the front is nx guangzhou it is modified by peg and it is suitable for body it can have high specificity and affinity combining the main soluble human at the same vegf and technology model parameter in the usa patent 6 no 011 020; 6 class 051 698; And 6 147 204. Said body is capable of the needle of the vegf of the high affinity antibody of the similar way and the loss of the vegf. Another using vegf body is suitable for eye 001 it is not in the form of pegylated. The other of the vegf antagonist can be such as vegf antigen antibody or antibody fragment. It through inhibition of the vegf receptor binding molecule the deactivation. The nucleic acid in the horizontal upper inhibiting vegf expression and stability of rna such as core and anti-sense rna enzyme rnai molecule nucleic acid molecule can be used as the invention claims a method and composition of an antagonist. Other comprising a vegf antagonist peptide protein and small cyclic peptide the organic compound. Such as vegf receptor it can combine with and without accompanying of the signalling activity of soluble truncated form and it also can be used as vegf antagonist. The vegf of the signalling activity can be controlled by destroying it the upper of the signal transduction inhibitor for example by using many antagonists comprising a vegf receptor tyrosine kinase activity small molecule inhibitors of the following the invention further claims the.

[0152] compound or agent has a vegf antagonist the function of the capacity can be according to the field of the know many kinds of standard method to confirm. Such as vegf the biological activity of one is through the vascular endothelial cell of the receptor binding for enhancing vascular permeability. The said interaction results in tightly connected with the inner surface of the relaxation after the effects caused by blood vessel of the fluid leakage. By vegf inducing blood vessel leakage can be used in the inner part of measuring through the tracking of the intradermal injection vegf caused by evans blue dye from the guinea pig vas system of the leakage to carry out dvorak and so on in vascular permeability factor and/or vascular endothelial growth factor microvascular hyperpermeability and angiogenesis and am j pathol 146: 1029. Similar which can be the measuring method for measuring resistance of the vegf antagonist of the biological activity the ability of.

[0153] in the blood vessel permeability measurement of the invention claims the example of the vegf 165 20-30 nm is 30 *** eyeool as 1 mu or candidate vegf antagonist in vitro ex vivo premixing and then through the internal injection and application of the guinea pig at the back of the hair and skin in. The injection after 30 minutes according to the standard method of injection site around the evans blue dye of the leakage of carrying out quantitative it makes use of the computer in the shape of the quantitative analysis system for implementing. Energy inhibiting vegf inducement indicator dye from the vessel system in the leakage of the compound is considered as the invention claims a method and composition of using antagonists.

[0154] is used for determining whether a compound is the vegf antagonist the other end of the measuring method is the so-called of corneal angiogenesis measuring. In the determining method which contains vegf 3 165 pmol methacyrate of the polymer deposition is embedded into the big mouse of the cornea in substrate and inducing blood vessel growth to enter into the normal and blood vessel cornea. And then the candidate vegf antagonist through vein inner path used in big mouse body to the dosage is lmg mg/kg 3mg mg/kg and 10mg- mg/kg per day one or two times using time is 5 days. In the treatment time and ending time of the main body the angle of film to micrographic. New blood vessel and cornea organization in the development and the degree of the candidate compound to the same suppressing action for the followed by microscope photo of standardization of the shape of the quantitative analysis the quantitative. And the phosphate buffered saline pbs processing compared with the invention can restrain the cornea in the middle of the vegf dependent angiogenesis of the compound is considered as the invention claims a method and composition of using antagonists of.

[0155] may be used in early ripening of retinal diseases of small mouse model of the candidate identifying vegf antagonist. In a useful in the example of the 7 and 8 9 7 and small mouse at the same honeycomb * is put in the indoor air or increasing the oxygen content and through abdomen membrane used in the phosphate buffered saline pbs prism or candidate vegf antagonist processing such as lmg mg/kg 3mg mg/kg or 10mg- mg/kg and astronautics process. Then through from the all processed and the control of mouse each eye 20 school tissue slice to carry out microscope identification and new vein and counting to estimate the measurement end point the new capillary vessel through the angle of the inner membrane outer membrane grows to the glass in body fluid. Relative not processed by the irradiation terms of the processing of the little mouse for retinal new vessel system with the reduction is determined as identifying and using vegf antagonist.

[0156] in another example the screening testing method used in the inner part of human tumour transplantation of heterogenous determining the candidate identifying vegf antagonist. In the screening assay in the embedded in the nude mice tumour of human body this utility model claims a graft 673 transverse striation muscle wilms tumour and cancer detected in the candidate vegf antagonist in the body of the function of. Then the candidate vegf antagonist treatment of mouse such as l 501 st mg/kg every day in the abdomen membrane is applied once in one after development in order to determine the tumour 200 mg. For the contrast of reagent to process the reference group. Is determined as with respect to light so it can restrain a 673 transverse striation muscle tumour growth and wilms tumour of the candidate compound is considered as the invention claims a method and composition of using antagonists of.

[0157] measuring vegf antagonist activity of other method is as follows the field the known and the context further describes.

[0158] this invention also comprises the field the known of vegf antagonist in an and the lower surface of the support of those and general knowledge technical personnel in the range of any and the same reagent. Such as vegf for the inhibition of antibody in the field of said Information such as described in patent number of america 6 524 583 6# 451 764 vrp antibody 077 6 6 448 # 403 6# 758 088 the vegf c 6 383 484 the vegf d 6 221 # 342 vegf antigen antibody 6 342 219 6 331 b 301 vegf antigen and 5 and 730 977 # pct claims wo 96/30046 wo 97/44453 and wo 98/45331 in those of the said document content to form the full text as the invention reference

[0159] vegf receptor antibodies of same as the field of the known such as described to such as us patent 5 no 84 301 5 542 874 955 5 311 6 365 # 157 and pct claims wo 04/003211 in those of the said document content to form the full text as the invention reference.

[0160] such as by inhibiting vegfr associated with tyrosine kinase activity blocking vegf the invention has the function of the small molecule in the field of the known such as described in the usa patent 6 no 514 971 6 448 277 6 414 148 6 362 336 6 291 455 6# 284 751 6 177 401 6071 921 and 6001 885 expression the type of retinol inhibitor in those parts of each document content of the full text can form the invention receiving the reference.

[0161] can stop the action of the vegf protein and polypeptide in the field of the known such as described in the usa patent number 6 576 608 6# 559 126 6 541 008 6 515 105 6 383 486 vegf receptor inducing 6 375 929 vegf receptor inducing 6 361 946 vefg peptide analogue inhibitor 6 348 333 vegf receptor inducing 6# 559 126 simple structure and the blocking of the vegf vegfr of the combination of the polypeptide 6 100 071 vegf receptor inducing and 5 952 199 in those parts of each document content can full text mode to work the invention reference

[0162] can be the medium and / or vegfr vegf gene expression and/or activity of rna interference rnai of the short interfering nucleic acid sina short interfering rna sirna double chain rna dsrna micro rna mirna and short hairpin rna shrna in the field of the known such as described in pct claims # wo 03/070910 in those of the said document content so as to form the full text as the invention reference.

[0163] is used for inhibiting vegf of the antisense oligonucleotide mentioned is the field of the known such as described to such as us patent 611 135 # 5 5 6 6 399 # 814 620 586 410 322 and 6 291 667 in those parts of each document content can full text mode to work the invention reference.

[0164] is used for restraining vegf from the proper body is also named as nucleic acid ligand is the field the known such as described to such as us patent 6 no 290 762 426 6 335 6 168 778 6 class 051 698 and 5 228 859 in those parts of each document content can full text mode to work the invention reference.

[0165] antagonist antibody

[0166] the invention comprises needle the vegf i3dgf and and their cognate togfr vegfr and receptor antagonist antibodies. Antibody of the invention antagonist which can interdict the ligand and receptor binding and source. This invention claims a togf antagonist antibodies it comprises a needle for i and 3dgf togfr of target antibody.

[0167] this invention claims antagonist antibodies comprises monoclonal antibodies inhibiting. Monoclonal antibody or its fragment comprises the immune globulin igg igm type such as igd ige iga and igg as subtype subtype or mixture thereof. Igg and its ya model is used for such as iggp igg2 igg2a igg2b igg ^ igg m. The igg subtype iggvkappi ^ kapp or igg 2b is used as the invention claims embodiments of. Can increase the section is truncated or modified by the antibody fragments having one or two complementary antigen combining part which shows the mammal 3dgf vegf or i or their receptors at the same source of high combination and neutralizing activity such as part of the body has is equal to said antibody of the combination part and it is composed of heavy and light chains of forming such as fab fv 2 2' or f ab fragment or a single chain fragment. Truncated the double chain segment if fv fab or f ab 2 ' is especially useful for. Such as the fragment may pass through the enzymatic method by using such as pawpaw protease or pepsin of enzyme elimination said antibody the fc portion of the chemical oxidation or through the antibody gene for genetic operation to obtain. The same as possible it is good it is used for genetic operation and the section short section. Said pdgf vegf antigen or anti-body or fragment which can be used solely or the mixture using.

[0168] said new type antibody antibody fragment thereof or mixture of ramification to i3dgf or vegf or other homologous receptor binding affinity with the ix kt7m ix kt12m or ix kt8m ix 10 nm or 1x10 9m 5x10 1qm range.

[0169] such as used for genetic operation of the antibody gene can be in the field of technical personnel the public known way from hybridoma cell to separate it into the culture of the antibodies producing cell and the cell of optical density can be used when known mode from said cell to separate mrna by using thiocyanate guanidine cracking cell using acetic acid sodium acid and phenol chloroform or isoamyl alcohol to extract the isopropyl alcohol precipitation and uses ethanol to wash so as to realize. Then using mrna by using the reverse transcriptase synthesis of cdna. Synthesis of cdna can be directly or the genetic operation after inserted into the suitable for animals fungi or bacteria virus carrier and a suitable host organism in expressing said genetic operation as such as fixed point mutagenesis lead into the inserted into the reverse is lost or base exchange. With germ or barm carrier is pbr 322 puc 18/19 pacyc 184 lambda or barm is used for cloning carrier the gene and such as escherichia coli ecoli or bacteria such as beer yeast sugar saccharomyces siccum item of yeast to express.

[0170] the invention also refers to synthetic f1dgf or antibody of cell vegf. Said cell comprises according to said method through conversion of animal fungus bacterial cell or yeast cell. They are advantageously the invention claims hybridoma cell or three trioma body tumour cell usually hybridoma cell. Such as the cross bred tumour cell can be realized by known way from the vegf 3dgf or i or their cognate the body immune animal production and separating them the production of antibody b of the cell selection of these cells vegf togf or binding antibodies and then makes these cell and such as people or animal such as mouse myeloma cell of human lymphoma yeast cell or different this utility model claims cross bred tumour cell fusion and a koehler and so on such as nature 256: 498 or by appropriate virus infection the cell so as to generate immortalized cell system. By fusing generated hybridoma cell line which is useful for the mice hybridoma cell line is especially useful for. The invention claims a hybridoma cell line which can secrete igg type for using antibody. The invention claims a mab antibody can be combined with high affinity and it reduces or middle and weak or togf vegf of the biology such as angiogenesis active.

[0171] this invention also comprises said pdgf vegf antigen or antibody of derivatives of them are kept the same vegf togf or inhibiting activity at the same time it changes with the their use as pharmaceutical agents related to the one or more other characteristics such as serum stability or and the production efficiency. The vegf antigen or antibody pdgf derivatives example comprises peptide is composed of the antibody of antigen Combination area derived peptide mimetics peptidomimetics and the solid or liquid carrier the combination of antibody or antibody fragment Polypeptide the carrier such polyethylene glycol glass synthetic polymers such as polyacrylamide polyethylene polypropylene polyethylene or antenna And polymer such as cellulose sepharose or agarose with enzyme or toxin or radiation or non radioactivity mark such as With 123 125 i i i 131 32p 35s 14c 51cr 36cl 57c 55fe 59f 501 st e 9° y 99mtc 75se conjugates of or the fluorescent or chemical luminescent mark covalent combination of antibody fragment or peptide said mark such as rhodamine fluorescein isothiocyanate salina algae haemoglobin Lan protein fluorescence amine metal chelate and biotin protein chain mildew resistance biotin protein or biotin

[0172] said new type antibody antibody fragment mixtures thereof and derivative can be directly in the drying after such as freezing and drying after the said carrier is adhered between or after with other pharmaceutically active and an auxiliary substance preparation and then it is used for producing medicinal preparation. And it can enhance the activity and auxiliary substance examples of this utility model is that its other antibody has the functions of microbial or suppressing microbial action of the antimicrobial active substance common such as antibiotics sulphonamide or anti-tumour agent water buffer salt water alcohol fat wax inert medium or other regular for parenteral of the product other substance such as amino acid thickening agent or sugar. The medical preparation can be used for controlling disease and it can be used for controlling the eye new vascular disease and it is comprised of amd and diabetes retina pathological the disease.

[0173] said new type antibody antibody fragment thereof or mixture derivative can be directly or in the said solid or liquid carrier enzyme toxin radiation or non radioactivity mark or the fluorescent or chemical luminescent mark combination and then it is used for therapeutic or diagnostic.

[0174] this invention claims a human or togf vegf monoclonal antibody can be controlled by the field of the known method to obtain any. Such as human 3dgf vegf or i or their cognate the body to the mammal to immune. Purification of human togf vegf and can be controlled by business channel is obtained from such as cell sciences norwood ma and other supplier that is purchased. Togf or other people or other at the same vegf receptor source can be used for human placental tissue it is convenient to purifying. Is used to generate antibody against human togf vegf or antibody of the mammal is not limited and it can be primate meshed teeth such as mouse rat and rabbit cattle or sheep goat dog.

[0175] then generate antibody of cells such as the spleen cell immunity of animal is extracted and myeloma cell fusion. Said myeloma cells in the field of the know such as may be used as the p 3x63 ag 8-653 ns being 0 or 1 p 3u1 cell. Cell fusion can be operated through the field of the known any conventional method so as to finish.

[0176] in the process of cell fusion operation between the back of the cell and then selecting the hat culture medium culture to select hybridoma. And then screening it can produce anti human monoclonal antibody hybridoma. Such as the screening can be controlled by sandwich elisa immune adsorption detection elisa or similar method to make the produced by the monoclonal antibody and the fixing of human or togf vegf or their at the same source acceptor the hole of the combined. In the field with the can be used for the immunity of animal immune globulin of antibody of specific as the second antibody the antibody is used as enzyme peroxidase alkaline phosphatase glucose oxidase beta d galactose glucoside amylase and mark by. Can be controlled by the said mark enzyme and the bottom of the reaction and the measurement generated by the colour to detect the marker. As base material can be used for producing 3 -diaminophenoxyl biphenyl amide 2 amino two adjacent connecting fennel amine 4- chlorine naphthol 4-amino-2- anti ratio lin adjacent and phenylene diamines.

[0177] through the operation may be selected and it can produce togf vegf or antibody against human antibody hybridoma. Then through conventional limiting dilution method or soft agar method clone selected by the hybridoma. If necessary can be used with blood serum or without blood serum the culture medium massive culture the clone of the hybrid tumor or can be connected from the abdominal cavity of mouse and it is recovered from ascites so as to get a lot of monoclonal hybridoma.

[0178] and then the selected antibody against human i3dgf or vegf monoclonal antibody selection it has the advantages of avoiding the corresponding to the body or the combination of receptor and activation for example in on the base of cell vegf or i 3dgf measuring system in the context in the ability of the monoclonal antibody is used for further analysis and operation. If said antibody blocking receptor and ligand binding and / or activation calling namely the experiment of monoclonal antibody with reduced or the human and i 3dgf or of the vegf togf or activity the ability of the vegf. Is model said monoclonal antibody can specifically identify and / or interfering human togf or vegf or their receptors at the same source of the key combination part.

[0179] this invention claims a monoclonal antibody and it also comprises the following method generated by the hybridization and recombinant antibody: Shearing resistance pdgf vegf or antibody variable comprises high variable structure domain and the constant domains such as humanized '' of the '' or anti-body light chain is connected to the heavy chain or from an object of the chain from another kind of the chain or fusion body and the heterologous protein without being affected source material or immunoglobulin type or subtype name and antibody fragments for example fab f ab jpfv only ] they have the desired the biological activity of needed. [ such as ginseng and american patent 4 no 816 567 and mage lamoyi in the monoclonal antibody production techniques and applications of pp 79-97 marcel dekker inc new york ].

[0180] so the operation of the '' monoclonal of the '' representing the obtained by the antibody the characteristic of the antibody is from a substantially homogenous group and it will not be reasonable and it is needed by any special method to generate antibody. Such as mainly used in the invention claims a monoclonal antibody can be used by the initial kohler and it is comprised of nature 256 milstein: 495 claims the hybridoma preparation method thereof or can be controlled by recombinant dna method for american patent 4 no 816 567 preparing. '' monoclonal antibody of the '' also can be used for the use of the literature described in the technical preparation of a bacteriophages library separating: Mccafferty and so on such as nature 348: 552-554.

[0181] non- human rat such as humanized antibody of '' of the '' shape is special embedded immune globulin chain immunoglobulins or fragments thereof as fv fab fab s f ab 2 or other antibody of antigen binding ya sequence it comprises from non- human immune globulin of the minimum sequence. Humanized antibody of the part of the human immune globulin receptor antibody thereof from receptor antibody of complementarity determining region cdrs from the residue of the utility model claims a human antibody such as mouse rat and rabbit cdrs of the residue of the substituted it has the need of specific affinity and power. In some occasions and the lower part of the human immune globulin to fv frame area the corresponding fr residue and the fr disabled people based on substituted. The humanized antibody can be comprised of it is not existed in the receptor antibody and it will not existed in the input or fr cdr sequence of the residue of a. Carry out the decoration is further improved and the most optimizing the characteristic of the antibody. Is a humanized antibody it basically includes at least one normal two variable structure of all the cdr area completely or basically all of them are corresponding to the human immune globulin to cdr residues of fr area and it is completely or basically all of them are corresponding to human immune globulin which has the sequence of fr residue. Said humanized antibody is optimally it also comprises immune globulin constant regions of fe at least a portion of the usually human immune globulin constant regions of.

[0182] non- human humanized antibody method for the field of the know. Generally from the non-human the source of one or more amino acid residue into a humanized antibody. The non-human amino acid residue is usually called '' input '' residue it is usually from '' input variable structure of the ''. Humanized basically can be used in winter and the same according to event method to perform jones and nature 321: 522-525; Riechmann and nature 332: 323-327; Verhoeyen 239 science and so on and: 1534-1536 wherein a grinding tooth type cdrs cdr sequence or substitute human antibodies of the corresponding sequence. The '' humanized antibody is a '' chimeric antibody wherein the business from a person of the corresponding sequence to replace the obvious less than the integrity of human variable structure of the sequence. Experiment of humanized antibody is usually human antibodies in which some *** r residue and the function of some fr residues from the grinding tooth type of the antibody similar points of the residue of the substituted.

[0183] selecting heavy and light chains of the variable structure of it is used for preparing humanized antibody to reduce the antigen is produced by it is a very important. According to the imaginary best matching of the '' '' method is grinding tooth type of the antibody variable structure domain sequence to the known human variable structure of the sequence of the whole library for screening. And then it is meshed teeth type sequence is closest to human sequence is used as humanized antibody the human framework and fr sims john immunol 151: 2296; And chothia and lesk j mol biol 196: 901. The invention claims a method for using from heavy chain light chain or a specific subtype of the human antibodies which has the sequence of specific frame structure. With the same framework can be used for several kinds of different humanized antibody carter proc and natl acad sci usa 89#: 4285; And presta and j immnol 151: 2623.

[0184] other important is that the humanized antibody wherein the left of the antigens high affinity and the other is in favour of the biology character of the. In order to realize this purpose according to a method for by use of the parent and humanized the sequence of three-dimensional model analysing the parent sequence and each concept of humanized of the product method for preparing humanized antibody. Three-dimensional immune globulin model can be widely obtained and it is the field of technical personnel the familiar. Can be obtained it is used for explaining and displaying selected candidate immune globulin sequence the possibility of a three-dimensional conformation of the structure of computer program. Checking said display to allow the analysis of the residue in the candidate immune globulin sequence of exerting function of the operation can use analysis the influence of candidate immune globulin and the antigen binding ability of the residue of a. So as to the sequence and there are input sequence is selected and the combining fr residue so as to obtain the need of the antibody property such as increasing of the target antigen of the affinity. Common cdr residues directly and the main reference ground and influence antigen binding.

[0185] this invention also comprises aiming at f1dgf vegf or human monoclonal antibody. The antibody can be through hybridoma preparation method thereof. Industry which has been described for producing human monoclonal antibody the human bone marrow tumour and the mouse heterogeneous myeloma cell system parameter such as visible kozbor j immunol 133 3001; Brodeur monoclonal antibody and production techniques and applications of pp 51-63 marcel dekker inc new york 1987; And boerner and j tmmunol 147: 86_95.

[0186] it can broadcast the transgene animal such as mouse the immunity and can in the absence of a source of the inner part of the immune globulin is generated under the premise of producing the human antibody spectrum. Such as industry sent to the embedded system and a mutation of mouse in antibody heavy chain is connected with the area jh gene homozygous caused loss of the antibodies producing completely inhibit. The invention claims a system of human immune globulin gene array to transfer this utility model claims a mutant of mouse body is caused to antigen under the attack to produce the human antibody in the parameter such as jakobovits proc and natl acad sci usa 90: 2551; Jakobovits and nature 362: 255-258; And bruggermann and so on in year tmmun *** 7: 33.

[0187] also the phage showing technology and nature 348 mccafferty: 552-553 which is used for immune not from the supply of the body of immunoglobulin variable v structure domain of gene spectrum the outside of the production of human antibodies and antibody fragments synthesis of said can be associated with the parameter such as johnson and so on in current opinion structural biology 3: 564-571. V gene segment of several source can be used for phage display and so on such as clackson nature 352: 624-628 the immunity from the mouse spleen the v gene of the small random combinatorial libraries in the separation of the variety of 1 * oxazole as antibody array. Can be constructed from not immunity of human body through the supply the v gene spectrum and it can basically according to the text the invention claims a technology to separate the diversity antigen arrays comprising the antigen antibody = j marks and mol biol 222: 581-597 and embo griffith or j 12: 725-734.

[0188] the natural immunity reaction of antibody gene with high ratio of accumulated mutant cells high temperature shift. The inlet some change can be produced with high affinity and it shows high affinity surface of immune globulin to b cell preferably in then the antigen of attack and is copied in chemical. By using a '' is called the chain group '' to the technology can simulate the natural process and marks parameters such as bio technol 10: 779-783. In the method pass through the bacteriophage display obtain the '' first '' human antibody affinity can be through from the immunity of the supply of the body is obtained by the v structure domain of gene naturally occurring the variant of the spectral components in turn instead of heavy and light chain v region gene is carried out improved. This technology can generate affinity of the nm in the range of the antibodies and antibody fragments. Waterhouse and so on the invention claims a method for preparing very large phage antibody spectrum of the policy nucl acids res 21: 2265-2266.

[0189] also can be improved gene from the group is used for grinding tooth type antibodies producing human antibodies in which the human antibody to the initial meshed teeth type antibody having similar affinity and specificity. According to the method it also is called the '' meter position marking '' through the bacteriophage display technique of obtaining the grinding tooth type antibody of the heavy or light chains v structure domain of human gene is v structure domain of gene the spectrum to replace so as to generate the grinding tooth type of human body embedded. Selecting the antigen that it can restore function and antigen binding part of the human variable structure of separating the surface of level control marking gametophyte of selecting. The repeat said process so as to replace the rest of the grinding tooth of similar v structure domain to obtain the human antibodies consult in pct wo 93/06213 1993*4 1 month date claims. The cdr grafting to be meshed teeth type antibody of the traditional humanized different this technology the invention claims complete human antibodies it does not have from grinding tooth type structure of the frame or cdr residues.

[0190] body which is antagonists

[0191] this invention claims the togf and/or vegf or other homologous receptor antagonist it is suitable for body. Body it is also named as nucleic acid ligand is a natural in the presence of nucleic acid it can be combined and antagonist and it generally it can restrain the previously selected target.

[0192] is especially suitable for body can be through the oligomer or production of oligonucleotides any known method for preparing. Many synthetic method for the field of the known. Including residual purine ribose nucleotide and it has proper 3' end are reversal of the chest and antisense nucleotide residue ortigao research and development 2: L29 l46 l 992 or is set in the 3' terminal of the two thio phosphoric acid ester bond so as to prevent is finally 3' the outer cutting nucleic acid enzyme degradation of the 2 ' 0 allyl modified by the oligomer can be controlled by solid phase beta- hydroxyl ethyl phosphoramidite chemical method such as nucleic acids res 12 sinha: 4539-4557 at any can be controlled by business channel of the obtained dna or rna combiner is set on the synthetic. This utility model claims a method is that the ribonucleotide w 0 tert-butyl second methyl silicon alkyl tbdms protection policy and j usman am chem soc 109: 7845-7854 and the there is a need to the 3' 0 phosphoramidite through the business channel of the obtained. Other amino methyl polystyrene can be used as support material the invention is because it the useful characteristic mccollum andrus and tetrahedron lett 32: 4069-4072. Can be used in synthesizing period through the use of business channel obtained by the fluoresceine phosphoramidite the fluoresceine is added to the substrate of the 5' end of rna. Common can be controlled by standard rna circulation synthesis aptamer oligomer. The assembly is completed through the sealing of small bottle at 55 degrees c the dense ammonia water ethanol 3: Lv v or processing for 8 hours removing the base of the instability of the protection group. Ethanol invention can restrain the 2 ' o tbdms group of the early rid of the base group of the premature not be removed in the protecting the alkali under the condition of the obtained ribonucleotide position of the cause obvious chain cracking j usman and am chem soc 109: 7845-7854. The freeze drying after using triethylamine third hydrogen fluoride and triethylamine or n-methyl pyrrolidone the mixture of 60 degrees c the processing tbdms protection of the oligomer 2 hours in the middle under the condition of fast and effectively remove a doll at least one of alkyl protecting groups in the parameter such as nucleic acids res 23 wincott: 2677-2684. Can then be used in butyl alcohol precipitation completely and protection oligomeric body wherein according to cathala and brunei is carried on in the method of nucleic acids res 18: 201. Purifying can be controlled by metamorphic polypropylene amide gel electrophoresis or through the ion exchange and hplc sproat nucleosides and nucleotides 14: 255-273 and reversed phase by the combination to carry out. As the cell is used in the acetone in this utility model claims a sodium chloride deposition the synthesis of the oligomer transformed into sodium salt of them. Then using small one time the gel of the filtering cylinder rid of trace amount of the residual salt of said column can be controlled by business channel to obtain. As the last step can be obtained through substrate auxiliary laser analyzing mass spectrometric analyzing method and nucleic acids res 21 pieles: 3191-3196 and nucleotide base composition analysis detecting the separation of the oligomer the authenticity of.

[0193] when said nucleotide sub-unit can be used for enzymatic when operating it is suitable for the body can be through the enzymatic method to produce. Such as may be formed by in vitro t7 rna polymerase reaction to prepare rna molecules. And said molecule it also can be used for expressing t7 bacterial strain or cell for preparing then from the cell separated from. The following character the discussed of the body and it can make the carrier and promoters directly connected to the cells to express.

[0194] said suitable body of this invention to other nucleic acid molecule similar also comprises chemical modified by nucleic acid. The nucleic acid diagnosis and therapeutic use thereof to be processed in one of the problem that it is phosphate ester in the form of oligonucleotide in body fluid in the show the needed before effect may be in the cell and a extracellular enzyme such as endonuclease and the outer cutting nucleic acid enzyme the high-speed degradation. To nucleic acid ligand carrying through some chemical decoration so as to improve the nucleic acid ligand in the body of stability or enhanced mediated or nucleic acid ligand of transmitting such as ginseng and american patent application 5 3# 660 985 the problem '' is high affinity nucleic acid ligands containing modified nucleotides '' said document is specially used for receiving the invention reference.

[0195] the invention the expected nucleic acid ligand modification including but not limited to the invention claims the other chemical group to the modification of nucleic acid ligand or the base is set on the body of the total nucleic acid ligand and additional charge it can be polarized hydrophobic hydrogen key combination electrostatic interaction and uncertainty fluxionality. Said modified comprising but not limited to use of 2' # position of the gum modified 5# position of the pyrimidine modified 8# position of a purine decorated on outer ring amine on the modified sulphur 4 uridine substituted 5 5 bromine or iodine substituted pyrimidine urine; Main chain modified thio phosphate or phosphoric acid alkyl ester modified methylation is not familiar with the base the combination such as abnormal base isobase abnormal cell and the glycoside isocytidine guanidine isoguanidine and. Modification may also include a and 5 ' - 3' modified if a sugar moiety the cap or modified. The invention certain embodiments of the middle of said nucleic acid ligand the rna molecules it is in the base pyridine residual sugar part of the 2 ' fluorine f modified 2'.

[0196] through the lead in this invention claims a modified to and along with the rna of the phosphoric acid ester the main chain modified and substituted can be greatly strengthened said body and the stability of. The other can be used in the core base nucleobase main body is carried out for many kinds of decoration this utility model claims a modified invention can restrain the degradation and it can increase the need of the nucleotide interaction or reduced it does not need to the nucleotide interaction. So once the body can be known sequence of the can through the file this invention claims the synthesis method or through the field of technical personnel the known method for decorating or substituted.

[0197] other modified comprising the modified by the base or modified by nucleic acid or modified by nucleic acid which are existed in the ribonucleic acid to a c g and u and deoxyribonucleic acid and a c t g and the standard of sugar base and / or phosphoric acid ester chemical main chain structure of the change mode. The range which is comprised of such as: Gm 2 '- methoxyl group guanine nucleotide am 2 '- methoxyl group adenosine acid c 2' cell fluorine pyrimidine nucleoside acid starch and uf 2' fluorine uridine acid adenine ar ribose nucleotide. Said suitable body may also include a cytosine or any cytosine related to the base comprises 5 methyl cytosine 4 acetyl cytosine 3-methyl cytosine 5 hydroxymethyl cytosine sulfur cytosine 5- halogenated cytosine 5 such as fluorinated cytosine 5 bromide cytosine 5 chloride cytosine and iodine substituted 5 cytosine 5 c alkyne cytosine 6 azo cell jiti steep 5 trifluoromethyl cell jiti n4 m steep bridge ethylene cell jiti steep ethanocytosine thiophene p high concentration cell glycoside phenothiazine cells glucosides cell carbazole compound and pyridine indole and cell thereof. Said suitable body may also be included in the guanine or any guanine related to the base contains 6 methyl guanine 1 methylyl guanine 2 methyl guanine 2-methyl guanine 7 methyl guanine -2-propyl guanine 6 propyl guanine 8 halogenated guanine 8 such as fluorinated guanine 8 bromide guanine 8 chloride guanine and 8 iodine substituted guanine 8 amino guanine 8 sulphydryl guanine 5 sulpho- alkyl guanine 8-hydroxy guanine 7 methyl guanine 8 nitrogen heterocyclic guanine 7 nitrogen guanine or 3 nitrogen guanine. Said body is also comprises one of adenine or any one of adenine related to the base contains 6 methyl one of adenine n6 isoamylene one of adenine n6 methyl one of adenine 1 methyl one of adenine 2-methyl one of adenine 2-methyl thio n6 isoamylene one of adenine 8 halogenated one of adenine such as fluorinated 8 one of adenine 8 bromide one of adenine 8 chloride one of adenine and 8 iodine substituted one of adenine 8 amino one of adenine 8 sulphydryl one of adenine 5 sulpho- alkyl one of adenine 8-hydroxy one of adenine 7 methyl halogenated one of adenine 2 one of adenine such as fluorinated 2 one of adenine 2 bromide one of adenine 2 chloride one of adenine 2 and iodine substituted one of adenine 2 2-bisethoxycarbonyl butyl one of adenine 8 nitrogen heterocyclic nitrogen purine 7 gland the gland the purine or 3 nitrogen gland the purine It also comprises urine pyridine or any urine pyridine which is relative to the alkali Base comprises a 5- halogenated urine pyridine and 5 such as fluorinated pyridine 5 bromide urine pyridine and 5 chloride 5 iodine substituted pyrimidine pyrimidine urine Carboxyl 5 - hydroxymethyl urine pyridine and 5 carboxyl methyl amino methyl sulfur urine pyridine and 5 carboxyl methyl amino pyrimidine urine - dihydro urine pyridine 1 methyl false urine pyridine and 5 methoxy aminomethyl sulfur urine pyridine and 5 '- methoxyl methyl urea hydroxide Pyrimidine 5 methoxy urine pyridine and 5 methyl sulfur urine pyridine sulfur urine pyridine 4 the urine pyridine and 5 urine pyridine and methyl Pyrimidine 5 hydroxyl acetic acid methyl ester urine pyridine and 5 hydroxyl acetic acid artificial urine pyridine and 5 methyl sulfur urine pyrimidine pyrimidine sulfur urine Amino - 3 3 3 n - 2 hydroxyl propyl urine pyridine and 5 methyl glycine methyl urine pyridine and 5 c alkyne urine pyridine 6 couples Urine pyridine or 4 nitrogen sulphur urine pyridine

[0198] this field the known the other decoration through the basic group mutation of the body example comprises but not limited to the 37c f r § 1.822 p *** in the lists of such as acetyl 5 cell 4 nucleotide carboxyl hydroxymethyl uridine 2 '- methoxyl methyl glycoside cell 5 aminomethyl thioridine carboxylic 2 5 methyl glycine methyl uridine dihydrogen uridine 2' 0 methyl false urine pyrimidine nucleoside b d galactosyl q queosine nucleic n6 inosine isoamylene adenosine 1 methyl adenosine 1 methyl false urine pyrimidine nucleoside 1 methyl methyl guanylic inosine 1 2 -dimethyl- guanylic 2-methyl adenosine 2-methyl guanylic 3- methyl glycoside cell 5 methyl glycoside cell n6 methyl adenosine guanylic 5 7 methyl methyl glycine methyl methoxy uridine 5 ammonia Methyl sulfur uridine b d gan lu glycosyl nucleoside mannosylqueosine 5 q o-methoxycarbonyl methyl uridine 5-jia Oxygen uridine 2-methyl thio n6 isoamylene adenosyl - n 9 b d furan ribose 2- methyl- thio purine base 6 Ammonia benzoyl threonine n 9 b d furan ribose a purine base 6 n-methyl amino benzoyl threonine urine Glycoside 5 hydroxyl acetic acid methyl ester uridine 5 hydroxyl acetic acid v wybutoxosine false urine jiti steep ribonucleotide q nucleotide sulfur Dai cell 5 methyl glycoside sulfur uridine sulfur sulphur uridine uridine 4 5 methyl uridine n 9 b d furan ribose base * Purine 6 amino benzoyl threonine 2' 5 501 st methyl methyl uridine 2' 501 st methyl uridine wybutosine 3 5 3-amino 3 carboxyl propyl uridine

[0199] it also comprises the following wen-xian described in the modified by nucleobase: American patent 687 # 3 808 687 808 845 205 3 4 5 5 130 302 134 066 5 175 273 5 367 066 5 432 272 5 457 187 5 459 255 5 484 908 room 502 5 5 177 525 711 5 552 540 5 587 469 # 5 594 121 5 596 091 5 614 617 5 645 985 5 830 653 5 763 588 005 096 and 5 6 681 941 The field of the well-known decoration process of nucleosides and nucleotides of the main chain variants example comprises but not limited to the Sample the change of the body it has advantages such as use of 2' ribose the substituents are as sh sch 3 f cl br 0 cn cn cf 3 0 cf3 s0ch3 S02 ch 3 0 n02 n02 n3 nh 3 2 0 ch2ch20ch 0 ch2 20n ch3 2 0 ch20ch2n ch3 2 o cl k 0 c 2-10 alkyl alkenyl 0 c 2-10 alkynyl s ci 10 s c 2-10 alkyl alkenyl stephen c 2-10 acetylene Base nh cl k c 2-10 alkyl -nh- alkenyl nh alkyne and 0 c 2-10 alkyl alkyl group 0 Needed by use of 2' ribose substituted base comprises w methoxyl group -2- 2 ' ' 0ch3 amino hydroxide radical c 2' 0ch2ch2ch2nh2 2' allyl 2' ch2 1 = 0 ch2 2' allyl 2' ch2 ch2 = 0 1 2 ' amino 2' nh2 2 2' and 3' fluorine f. The use of 2' substituent can be used in a blood sugar based on the upstream position of ribose or lower position of the base.

[0200] of this invention is especially suitable for body can be composed of the context of said nucleotide acid and/ or nucleotide analogues or the combination of the two components composition or is oligonucleotide analogues. Of this invention is especially suitable for body can be under the condition of without influence of the oligomer or togf of the vegf or other homologous receptor binding the function of the position of the upper part comprises nucleotide analogues.

[0201] with several technology and it can be applied to improving and strengthening nucleic acid ligand specific to the target molecule of the combination or to other is the main body of the selected. A technology is called as the outside of the '' genetics '' consult in 3 to 8 2 501 st middle 1^1 185 ' 19: 89# relates to the stochastic sequence of base of the selection of separated body is antagonists. Can be separated the body is a nucleic acid molecule it comprises the base may be about 12 to the forth tens of nucleotide sequence can be changed without changing the side is connected with the sequence. Industry the method is called as through the data collected by the ligand and selecting to selective evolution of the ligands by exponential enrichment selex. By the selex and associated method for preparing the invention is especially suitable for body antagonist compositions and methods for the field of the known and the teaching in middle of the document such as us patent 5 no 475 096 title '' nucleic acid as ligands '' and usa patent 5 no 270 163 title is '' identifying methods for nucleic acid ligands '' each parts of documents is special so as to form the full text as the invention reference. Common the selex method Method and specifically speaking vegf and togf aptamer and preparation are further described in the document in such as us patent application Unit 5 no 688 264 5 696 249 5 670 637 674 5 5 685 723 594 5 756 291 5 811 533 817 785 958 691 5 5 6 6 class 051 011 020 698 6 147 204 6 168 778 6 207 816 6 229 002 426 6 6 335 582 918 each parts of document content is received special operation the invention reference

[0202] simply selex invention claims a method from the candidate oligonucleotide of the mixture of selecting and using the same general method for selecting step by step of repeating and the selected target the combination of separated and amplification to obtain actual needs the random combination affinity and selective standard. From normal includes a random sequence of section of the nucleic acid mixture to start the selex method comprises the mixture in it is helpful for bonding under the condition of contact with the target from the industry of specifically binding to the target molecule nucleic acid in the invention claims an combination of nucleic acid separating the nucleic acid target compound from amplification of nucleic acid target compound on the separating the nucleic acid so as to obtain the nucleic acid rich in the body of the mixture and then repeating the combination of the separating step and amplification more than the need of the circulating times to obtain the target molecule it has high specificity high affinity of the nucleic acid ligand.

[0203] industry which is to realize the invention claims a special purpose of the basic selex method for improving. Such as us patent 5 no 707 796 title is '' method for selecting nucleic acids on the basis of the structure is described by using selex method and gel electrophoresis composition is selected having special structure feature of the nucleic acid molecule such as bending of the dna. American patent 5 no 177 763 title is '' systematic evolution of the ligands by exponential enrichment: Photoselection of the ligands and nucleic acid solution is selex claims a method and system for selecting a photoreactive group the nucleic acid based on the main body of the distribution selex method of said group can be combined and / or light cross linking and / or optical inactivation of the target molecule. American patent 5 no 580 737 title is '' high affinity nucleic acid ligands that discriminate between theophylline and caffeine '' claims a method and system for identifying high specific nucleic acid method of ligand the ligand can be distinguished closely related to molecule said method can be a peptide is called the counter selex. American patent number 567 5 588 title is '' systematic evolution of the ligands by exponential enrichment ! solution selex '' claims a based on selex method of it can effectively separate the target molecule has high appetency and low affinity oligonucleotide.

[0204] selex method comprises identifying comprising modified by nucleic acid with high affinity ligand said nucleic acid modified by nucleic acid it also can endows ligand of improving the characteristic such as improved in the body of stability or of improving the delivery characteristic. Said modified example comprises the core sugar and/or organic phosphate and/ or basic group on the position of the chemical substituted. Selex method for identifying it comprises modified by nucleic acid nucleic acid ligand description of the american patent 5 3# 660 985 in title is '' high affinity nucleic acid containing the ligands modified nucleotides '' claims a document in the 5 abrupt jiti and 2nd position is carried out by chemical modified nucleotide derivative oligonucleotide. American patent 5 no 580 737 is the same as above this invention claims a high specific nucleic acid ligand and it comprises one or plural amino 2 2 ' ' ' nh2 2 2' fluorine f and / or 0 c w methyl ome modified by nucleic acid. American patent application number 08/264 029 1994*6 moon il 22 on the title of the '' novel method of preparation of the known and use of 2' nucleosides novel modified by nucleophilic intramolecular displacement is abandoned it has now been described comprising various modified by w pyrimidine oligonucleotide.

[0205] selex method comprises the following steps selecting the oligonucleotide and the other selecting the oligonucleotide and the oligonucleotide functional unit assembly are respectively as us patent number 5 637 459 title of the '' ligands by evolution of the systematic enrichment exponential: Chimeric selex '' and usa patent number 5 683 867 title is '' systematic evolution of the ligands by exponential enrichment: Blended selex '' said. The aforesaid patents allow the oligonucleotide all kinds of shapes and the other character and it can effectively expand and copying character and other molecules of the needed character are combined together.

[0206] selex method further comprises the nucleic acid ligand and the lipophilic compound or a non-immunogenic high molecular weight compounds in the diagnostic or therapeutic compound combined in such as us patent 6 no 011 020 title '' nucleic acid as ligands complexes '' of said document to form the full text as the invention reference.

[0207] said body is antagonists can be realized by using computer analogue technique improved. Molecule simulation system the example of the quanta charmm and program polygen corporation waltham mass. Charmm carrying out energy minimized and molecular dynamics function. Quanta executing the molecular structure the construction of the figure simulating and analyzing. Quanta can be mutually construction decoration display and the analysis is between the surface of the present. The application can be used for determining the display and rna dna molecule of the secondary structure.

[0208] then it can check with said modified and each body function of use thereof it is suitable for the target togf vegf or the function of any suitable for measuring method such as i3dgf on the base of cell proliferation activity measuring.

[0209] decoration can be used in the selex method before or after. Selex method before modification of the with the same target selex the specificity and improving in the body of the stability of the nucleic acid ligand. The selex method after use of 2' oh nucleic acid ligand to embellish can be caused in the body and the stability is improved while it does not to nucleic acid ligand the jointing capability of generate negative affect.

[0210] can be used for producing of the invention is especially suitable for the main body of the other is the decoration field common technical personnel the known. Said decoration can be used in the selex method is performed after the identification of unmodified through the cooperation of the body of the modified or through adjusting the selex method is carried out in.

[0211] industry which has been found a normal speaking it is suitable for body or nucleic acid ligand and specifically speaking it is suitable for the vegf body is stable and so when the cap and 5 ' - 3' the cap when it is effective it is able to weaken the external the nucleic acid enzyme the susceptibility of and it improves the stability of the whole. It is an embodiment of this invention is based on common speaking it is suitable for the body and cap and specifically speaking the vegf antigen and body and cap wherein it uses the 5' end of the reverse ' 5 5 '- nucleotide cap structure and is set in the 3' terminal of 3 3 ' ' reverse cap structure of nucleotide. This invention claims an vegf and/or an pdgf body it is suitable for the nucleic acid ligand and the bottom of the 5' end is set with reverse ' 5 5 '- nucleotide cap and the 3' terminal with 3 or 3' reverse nucleotide cap.

[0212] some it is especially used in the invention is especially suitable for body is the vegf and body composition comprises but not limited to them the tail end is set with 5 '- 5 3 3 ' ' ' and reverse nucleotide cap structure of the combination of. The vegf antigen and the cap body can be suitable for the rna dna aptamer or has a mixture of the dna and rna composition of the body it is suitable for. Of this invention is suitable for resisting vegf aptamers sequence comprising nucleotide sequence of seq id n0 gaagaauugg: 15; Or nucleotide sequence uuggacgc seqidn0: 16; Or nucleotide sequence gugaaugc seqidn0: 17. It is especially used in the present invention the processing of the cap of the vegf antigen and body it has the following sequence:

[0213] x ' 5 5 '- cggaaucagugaaugcuuauacauccg 3; Si x the sequence of seq id no: 18

[0214] wherein each christoph g a and u are separately represented corresponding natural in the presence of nucleic acid glucoside guanidine cell one of adenine and urine saponin or the corresponding to the modified by nucleic acid; X ' 5 5 '- of the said suitable the main body of the 5' end of the cap of the reverse nucleotide; 3 3 ' ' x is the said suitable body 3' end of the cap of the reverse nucleotide; And the rest of the nucleic acid or modified by nucleic acid in turn through 3' 5 4' phosphate ester bond is connected with the. In some embodiments of the cap of the vegf antigen and the main body of the each single nucleotide acid ribose with use of 2' substituted if it is oh ribonucleic acid rnas the standard or h it is comprised of deoxyribonucleic acid dnas of the standard. In other embodiments in use of 2' ribose position of base is 0 cpltl alkyl group 0 c inherently f group alkenyl or nh 2-substituted based on substituted.

[0215] the more of the body of non limiting examples 3' 5 5' the cap of the vegf antigen and body and it has the following structure:

[0216] td-scdma si si cfgfflgfflararu fcfafflgfflufg fflafflafflufgfflc fufufafflufafflc fafflufcfcfgffl3 si time division td /

[0217] the sequence of seq id no: 19 of the '' gm '' representing 2 '- methoxyl group guanine nucleotide '' am '' representing 2 '- methoxyl group adenosine acid '' c f '' expressed cell use of 2' fluorine pyrimidine nucleoside nucleotide analogues '' starch and uf '' represents fluorine 2 ' urine '' or nucleotide analogues a represents one of adenine ribose nucleotide acid that '' '' thomas d expresses the oxygen ribose nucleotide analogues chest.

[0218] anti-sense nucleic enzyme and dna enzyme antagonists

[0219] i3dgf vegf and the target of the antisense oligonucleotide and nucleic acid by inhibiting from these signals the rnas of the white translation or through are respectively corresponding to the target the fixed i 3dgf mrns vegf or degradation of realizing togf or inhibition of vegf. The vegf togf and the target nucleic acid the invention claims the design and synthesis and togf vegf core enzyme and antisense oligonucleotide with the sequence. Design and synthesis antisense oligonucleotide and a method of enzyme is the field of the known. The invention claims the other guide.

[0220] the designing the specificity and effectively stop the expression of the target of the oligonucleotide the antisense odns and nucleic acid and anti-sense one of the problem that identifying target mrna in the antisense matching can be connected with the near position and it folds itself into a part of the self matching of the secondary structure. Assisted by computer the detecting rna it can be connected to provide arithmetic and molecular sieve combination of it can prepare aiming at large part of the target mrna of specific and effective enzyme core and / or antisense oligonucleotide. Actually industry the invention claims a plurality of target determining the antisense rna molecules or core enzyme inhibitor can be connected to provide a method for. The invention claims a method for using in vitro screening assay use thereof as much as possible of antisense oligosaccharide deoxynucleotide monia and so on in the nature med 2: 668-675; And milner and nature biotechnol 15: 537-541. The invention claims a method for using random odns ho library such as nucleic acids res 24: 1901-1907; Birikh such as rna 3: 429-437; And lima and j biol chem 272: 626-638. Can be obtained through rna enzyme h cutting monitoring can be connected to the position of the reference point and so on and the upper visible birikh; And ho and nature biotechnol 16: 59-63. H rna enzyme capable of catalyzing dna rna the double chain rna chain of the phosphate ester the main chain of the water and cutting.

[0221] in another method of claims the use of a random embedded with the chemical synthesis of odns the base which is used for identifying the rna enzyme h cutting of the in vitro for synthesizing rna target which is close to the position of the point. Then using primer extension to analyze and identify target molecule in the position parameter and so on and the upper visible lima. Is used to design the antisense rna in the target the other method is based on computer assistant the rna folding model. Several stories industry which has been claims the use of random enzyme core library screening and it can effectively cut the parameter such as rna 1 campbell: 598-609; Lieber and so on mol of cell biol 15: 540-551; And vaish and 36 biochem: 6459-6501.

[0222] odns and using rna enzyme h with a random or a random library of the other the outside of the method can be compared with the computer simulation it can more effectively lima on the same. Will not be affected by external for synthesizing rna of the utility model can not be the antisense predicted odns in the body is accessibility of the nearest to the observing surface of the polynucleotide annealing interaction by rna binding protein and the influence of the parameter such as visible tsuchihashi science 267: 99-102; Portman and embo j 13: 213-221; And bertrand j 13 and rossi embo: 2904-2912. Content is received the invention is used as the reference of the us patent 6 no 570 562 claims a method for in the presence of a cell extract under the condition of determining the mrna can be connected with the near position point of the composition and method said extract simulates condition of the inside of.

[0223] simple speaking the method relates to the cross under the condition of the reaction culture medium in the culture medium comprises a source of the inner part of the rna structure of integrated protein cell extract or because there is one or more rna binding protein and simulating cell extract or the natural rnas body is combined with a specific antisense odns core enzyme or dnazymes or the random or a random 0dn core enzyme or dnazyme library together raising temperature. For the rna in can be connected with the near position point complementary any of the antisense 0dn core enzyme or dnazyme can be connected with the cross point. Used in special library odn odns or when the rna enzyme h is the hybridization during the period of existing in or on the hybridization and then it is added to cut industry that has occurred the hybridization of rna. In the using enzyme or the nuclear dnazymes may exist three states of rna enzyme h but it is not necessary due to the generation of hybridization the enzyme core and can cut the rna dnazymes. In some occasions it is suitable to be used in the cell extract in random or a random odn library it comprises the source of mrna rna binding protein and rna enzyme ***.

[0224] can then be used in all kinds of method for identifying target rna is the structure of the antisense odns core enzyme or dnazymes and the generation of the cutting point. Such as can be used depending on the tail end of deoxynucleotide transferase of polymerase chain reaction tdpcr is used for this purpose a riggs nucleic acids and visible komura res 26: 1807-11. Through reverse transcription the step of rna moulding board is transferred into dna then tdpcr. In this invention tdpcr method needs to the 3' terminal through the use any proper depending on rna dna polymerase for example the reverse transcriptase to the target rna to be produced by the reverse transcription. The purpose is realized through the first primer odn pl the rna which is located in the research of the target rna molecules part of the lower reaches of the area that is the edge of rna molecules of the 5' 3' direction cross. In the presence of a dntps under the condition of the polymerase the pl the 3' terminal to copy the dna rna and through the antisense rna enzyme core h 0dn and enzyme or dnazyme generated by the cutting point stopping copying. New dna molecule is called as the first chain dna tdpcr has a method of pcr part of the first moulding board the effect of it is used to identify the existed in the rna which is corresponding to the accessible the target sequence.

[0225] such as then it can use tdpcr method it has the bird triphosphate rgtp of the reverse transcription dna in the presence of the tail end of deoxynucleotide transferase tdt under the condition of the reaction the dna molecule 3' terminal added with 2-4 rg tail. And then connected to the double link joint odn in a chain is set with 3' 2-4 protruding end of the rg 2-4 tail base matching. Then adding two pcr primer. The first one is connected with it and the primer lp tdpcr joint of chain complementarity the joint is connected to the rc 2-4 tail is set with weighting function of the lower part of chain. Another primer p1 can pl will not be affected by the same can be corresponding to the pl embedded in it and the target rna at least part of position pl in the combining area of the upper part of the area of complementary the rna molecules of the 3 '- 5 will not be affected by 3' direction which is located on the research of the target rna molecules of the part of the downstream. This utility model is that it is connected to the research to determine whether it is can be connected with the binding sites of the target rna molecules of the part p2 is complementary to the area of the upper part of the. Then in the presence of a dna polymerase and dntps under the condition of the known method to process pcr amplification primer and it is composed of the lp and p2 specific dna fragment. Can then through a known in the method of any one of capture amplification of the product and then using an automated apparatus for dna sequencing sequencing so as to provide the cutting point of the precise appraisal. Once determining that the said characteristics it can be combined to determine the sequence of antisense dna enzyme or core and the in vivo and in vitro using.

[0226] the specific expression gene of the antisense interference can be realized by using synthesis of antisense oligonucleotide sequences to realize the parameter such as hellencourt lefebvre d' and eur cyokine netw 6: 7; Agrawal tibtech 14: 376; And lev lehman and antisense therap cohen and smicek eds plenum press new york. Simple speaking antisense oligonucleotide sequences can be short the dna sequence it is usually of the body will not be affected by can be less to 7 polymer wagner and so on in the nature 372: 333 it is designed to target mrna complementary and forming rna: As duplex. This utility model claims a double chain body is formed it can prevent the relative with the processing cutting connected with the rotating operation and translation. Other some as nucleic acid sequence with the their hybridizing target mrna can be caused by cell rna enzyme h activity so as to cause the degradation of a mrna in calabretta and semin oncol 23: 78. In the field with the rna enzyme h will cut said double chain rna of the body of the component and it can be hidden in the release as to further and the target rna of the other molecule hybridization. Through as the gene group dna mutual effect produces the other end of the action mode of the said interaction form the triple screw it can be transcribed deactivation.

[0227] is taken as the file the discussed of antisense sequence of non limiting resistance compensating resistance or replacing examples of the enzyme core can be used for restraining gene function. The antisense for treating affected by the chemical computation of the factor for limiting the time the necessary especially. And then may be used as the target the same sequence of the enzyme core. Rna enzyme core is provided with catalytic capability of rna molecules it can cut target rna of the specific point. Enzyme core is composed of rna molecules the cutting amount is less than the i: 1 chemical measurement estimation of the number of parameter in hampel and tritz biochem 28: 4929-33; And nature 328 uhlenbeck: 596-600. This invention also uses enzyme nucleic sequence said sequence of the vegf or togf target mrna can be connected to the category of the structure of the area and it comprises a suitable catalyst centre. According to the field of the known and the invention further in the discussion method for preparing and delivering enzyme core. Enzyme core can be connected with the antisense sequence by using the combination of.

[0228] core which can catalyze the enzyme rna of the phosphate ester bond cutting. Industry which has been identified for the several core the enzyme of family is comprised of i group inner high molecule rna enzyme ding ping hepatitis b virus nucleic acid enzyme core and the hammer head the enzyme core and the initial from tobacco ring spot virus satellite of the negative strand rna strsv consult in sullivan investig dermatolog suppl 103: 95s; And usa patent number 5 225 347. And back two family from viroid and simulated virus enzyme the core is considered to be separated single body and the rolling circle replication generated during an oligomer of the visible symons tibs 14: 445-50; Symons ann rev biochem 61: 641-71. Hammer head and the base sequence of the enzyme core is usually it is suitable for being used for gene therapy of the reaction of the cutting mrnas. Is used for the invention claims a nuclear enzymes model is according to the field of the known method of selecting. Hair clip the enzyme core is used for clinical experiment and it is particularly useful for the type of. Of the enzyme core common length is 30-100 nucleotide.

[0229] is designed for catalytic cutting target mrna transcribes the invention claims a enzyme molecular in the field of the known such as seq id n0 togf: Vegf n0 1 and seq id: 3 and it also can be used in preventing mrna translation parameter such as in pct international claims # wo 90/11364; Sarver science and so on 247: 1222-1225 and usa patent 5 no 246 093. Although it is able to position of specific recognition sequence cutting with the core of enzyme can be used to destroy the specific mrnas the hammer head of the enzyme core the utility model is especially useful for. Hammer head the enzyme core is composed of a side area limited by the position of cutting mrnas the side area is formed with the target mrna the complementary base matching. Unique demand of target mrna with two base of the following sequence: 5' ug 3'. Hammer head of the enzyme core construction and production is the field of the known and more completely and describing for the document in nature and 334 gerlach = haseloff: 585 501 st

[0230] core of the invention also comprises enzyme rna endoribonuclease following it is called '' cech genic enzyme '' the thermophilic four film tetrahymena thermophila natural insect in the presence of the enzyme is called ivs or l 19ivs rna and the document in industry which has been thomas cech and the event to be fully reads parameter in zaug science and so on 224: 574-578; Zaug and cechscience 231: 470-475; Zaug and nature 324: 429-433; International patent application number b 88/04300; Been and cechcell 47: 207-216. Cech genic enzyme has eight base corresponding to the active site it can and the target rna sequence hybridized then generating target rna of the cutting. The invention comprises the enzyme target cech it is model core eight base corresponding to the active site sequence. Although the invention is not limited to the operation mechanism the particular theory the hammer head the enzyme core in this invention is used and using vegf togf and the direction of the antisense has advantages due to the newest and a hammer head the enzyme core via interdicting and/or rna translation of target mrna of specific cleavage of the.

[0231] positive such as the antisense method is like enzyme core can be composed of the modified by the oligonucleotide is composed of such as to improve the stability of the target and the delivering energy to the target mrna expression of the cell. With delivery claims a method for using the '' coding '' said core enzyme by dna constructs strong it is composed of pol pol ii iii or model of the promoter and the control from being infected the cell can produce sufficient amount of the core to destroy the enzyme target to make the signal and restrains the translation. Of the enzyme and antisense nucleotide molecule is different catalytic performance so it needs low in the cell concentration it realizes the effectiveness of.

[0232] the above described if necessary nucleic acid enzyme resistance is connected through the field of the known any method the invention claims a main body it will not disturb the antisense oligodeoxynucleotide or nucleic acid the biological activity of the normal use and transmitting method which is needed such as j a iyer org chem 55: 4693-99; Eckstein ann rev biochem 54: 367-402; Spitzer and ecksteinnucleic acids res 18: 11691-704; Woolf such as nucleic acids res 18: 1763-69; Shaw and nucleic acids such as res 18: 11691-704. Zheng-ru context it is suitable for the body of the described according to antisense oligonucleotide or core enzyme to process non limiting representative of decoration so as to strengthen the nucleic acid enzyme resistance it comprises modified phosphate ester the main chain is connected with the phosphorous or oxygen atom with short chain alkyl or cycloalkyl sugar short chain between bonds or hetero atoms or heterocyclic ring is set between the key sugar. These include such as making use of 2' fluoride of 0 methylation of phosphonic acid methyl ester thio phosphate ester phosphorodithioic acid ester and morpholine dai oligomer. Such as the antisense oligonucleotide or nucleic acid enzyme can have a thio phosphoric acid ester bond which is connected at the four six 3' terminal nucleotide base between. Other thio phosphoric acid ester bond can be connected with the nucleotide base. Thio phosphate ester antisense oligonucleotide the effective and the animal in vivo shows enough the pharmacokinetics of half period of concentration and do not typically shows obvious effect and so on toxicity ginseng agarwal tibtech 14: 376 it is a nucleic acid enzyme the resistance of. The odn as nucleic acid enzyme resistance can be in the 3' terminal having ring 9 nucleotide sequence the invention claims the nucleic acid sequence is cgcgaagcg. Resistance to organism fibroin biotin conjugation reaction of the utility model also can be used for improving odns as the serum nucleic acid enzyme degradation effect of protecting the visible boado and pardridge bioconj chem 3: 519-23. According to the concept in their 3' terminal the as odn agent to a single biotin. The resistance to organism fibroin the reaction time they form the closely nucleic acid enzyme resistance the compound with the un-conjugated odns compared with 6 times higher stability.

[0233] other research institute industry the surface of the antisense oligodeoxynucleotide the main body of the inner extending agarwal proc and natl acad sci usa 88: 7595. To push the method can be used as the circulation of removing foreign as of oligonucleotide scavenging machine it depends on the generation of extending attached to oligonucleotides in free: V of the tail end of the existing. So on the important position the upper part of the desulfurizing agent phosphate ester or biological environmental protection element and biotin protein to the can ensure the as oligodeoxynucleotide the stability of.

[0234] except of using the modified by the outside of the base can be prepared nucleotide analogs of the nucleotide the structure of the generation of the change of the said nucleotide analogues is more suitable to be used as therapeutic agent or of experimental reagent. Nucleotide analogues example is that peptide nucleic acid in the pm in dna or rna deoxidization ribose or ribose phosphoric acid ester is main chain polyamide main chain and replace it with the peptide in the condition of similar. Industry has been shown pna analogs which can resist of the enzyme degradation action and the internal and external it can prolong the service life of the. The enterprise has been shown pnas and complementary dna sequence of combining with dna molecule is stronger than. The observation is pna chain and dna chain between the charge repulsion caused by lack of. The oligonucleotide to the other modified comprising polymer main chain morpholine generation polymer main chain such as ginseng and american patent 034 # 5 506 the document content is took as the invention reference annular main chain or a ring main chain of the analogue or any other modified comprising can be improved of oligonucleotide of medicament dynamics characteristic of the modified.

[0235] the invention has the other aspects are referred to by using dna enzyme weakened target mrna expression of such as vegf or togf. Dna enzyme and anti-sense nucleic and enzyme technology some mechanism characteristic. Design dna enzyme so that they can identify the special target nucleic acid sequence of the image is more antisense oligonucleotide will not be affected by them can catalyse and specificity to cut the target nucleic acid of the enzyme core is more like.

[0236] there are two basic type of dna enzyme and the two enzymes are made up of santoro and joyce for identifying such as ginseng and american patent 6 no 110 462. 10-23 dna enzyme comprises ring shaped structure the structure is connected with the two arms. The two arms through identifying the target nucleic acid sequence the invention claims specificity of the ring shaped structure the invention claims a physiologically under the condition of catalytic function.

[0237] speaking is simple the design can specifically identify and and the cutting of target nucleic acids the dna enzyme to the field of the technical staff must be firstly identifying the unique target sequence. The invention can use the antisense oligonucleotide mentioned is the same method for realizing. In some cases in the special or important of sequence is rich g per of c about 18-22 nucleotides. High content of c or g help ensure dna enzyme and target sequence between the strong mutual effect of.

[0238] in the synthetic time of the dna enzyme the enzyme target signal the specific antisense recognition sequence which is separated from it is composed of two arms of the dna enzyme and the dna enzyme to the two ring is set on the special arm are.

[0239] preparation and application for dna enzyme the method can be the parameter such as u s 6110462. Similarly in vitro or in vivo delivery of nuclear dna enzyme the invention claims a method of this invention claims compounds of the core of the delivery of rna enzyme method of. The field of technology of people can be recognized at the 124 #; J and antisense oligonucleotide can be similar to the dna enzyme to process optionally modified so as to improve the stability and it improves the degradation resistant.

[0240] rnai antagonists

[0241] the invention certain embodiments of the use of the used for passing through rna interference rnai vegf togf and achieve the restraining of the material and method for. Rnai is sequence of specificity of the gene transcription method for restraining it can be in eukaryotic cells generating. Usually the method relates to the said sequence at the same source of the double chain rna dsrna inducing a specific sequence of the degradation of a mrna. Such as equal to specific single-chain mrna ss mrna sequence of the length of dsrna the expression of the can make the information is not stable so as to make the '' interference '' relative gene expression. It through an introducing dsrna capable of suppressing any selected based on the dsrna is equal to said gene mrna of the whole or the main part of. To watch when the length of the dsrna expressing time is executed by first ribonucleic acid enzyme inverted-door *** it is processed to the length of which is at least one 21-22 base pair of short of dsrna oligonucleotide. Rnai so it can be obtained through relative short and source dsrnas guiding or expression realizing. Practical which is corresponding to the short supply of the same dsrnas and it can be used it has some advantages such as the context the discussed.

[0242] mammalian cells with the double chain rna dsrna the influence of the at least two route. In rnai sequence of specific way which is firstly the initial dsrna is divided into the short interfering rnas si the above described. Sirnas with about 21 nucleotides of the sense and anti-sense strand the respective 3' terminal nucleotide with two convex ends of the forming of about 19 nucleotides of si rnas. Short interfering rnas are deemed to be provided to allow the specific signal the target rna is done with degradation of the sequence information. Opposite to a specific path is made by it has any dsrna sequence of triggering it only needs to its length is at least about 30 plurality of base to the needed. Non-specific used for generating reason is that dsrna activates the two enzymes: Pkr double chain rna activated protein kinase activity it can form the translation initiation factor eif2 carrying out phosphorylation so as to close the protein synthesis and use of 2' 5 ' - oligosaccharide adenosine acid synthetase 2' 5 ' as it is composed of the molecular power activation rna enzyme l this utility model relates to a target at all mrnas of non-specific enzyme. Said non-specific is to use it can represent the host to the stress or virus infection and reacting and it generally said non-specific path the influence of the invention claims a particularly useful in the method of the minimizing. Value pay attention is almost similar to that it needs long dsrnas for inducing a specific path so it is shorter than about 30 basic groups of a pair of dsrnas through the rnai realizing gene inhibiting is particularly useful in the parameter such as and hunter john biol chem 250: 409-17; Manche equal mol of cell biol 12: 5239-48; Minks and so on the 81***1 chem 254: 10180-3; And elbashir and nature 411: 494-8.

[0243] is used for realizing rnai some double-stranded oligonucleotide of the length is less than 30 to the basic groups and may comprise a ribonucleic acid with about 20 21 22 23 25 24 or 17 18 19 the base the. The invention claims a dsrna oligonucleotide optionally include 3' protruding end. Of non limiting example 2 nucleotide 3' protruding end can be used by any type of ribose nucleotide residue composition and even can be used by use of 2' de-oxy nucleotide residue is composed of rna this lowers the synthesis cost and can improve sirnas of the cell culture medium and the process of transfection cell of nucleic acid enzyme resistance elbashi and consult in nature 411: 494-8.

0244 [ 100 ] has 50 75 or even 500 base to one or more long dsrnas also can be used in the invention certain embodiments of the middle. Is used for realizing the rnai dsrnas an exemplary concentration is of about 0 grade 05 *** eta 0 1 *** eta 0 1 1 5 nm 501 st ^ 1.51 ^ 251 ^ 10***1 ^ as much as possible or pipe according to the processing of the cell the characteristic of the gene target and the field of technology of people can conveniently know the other factors can be used other concentration. Exemplary dsrnas can be used to chemical synthesis or using appropriate expression carrier is outside the body or liquid is produced. Exemplary synthetic rnas comprises using the field of the known method chemical synthesis of 21 plurality of nucleotide rnas such as acceleration rna phosphoramidite and thymidine phosphoramidite proligo de. Of the synthesized oligonucleotide can be used in the field of common method thereof deprotection and purification in the gel such as elbashir genes and dev 15: 188-200. Long rnas the promoter transcription such as the field of common t7rna polymerase promoter. Along two can be put in the direction of the outside of the promoter of the lower reaches of a target rna can be turned in said target of the two beams of chain so as to form with the need of the target sequence of the oligonucleotide dsrna.

[0245] is used to design of oligonucleotide specific sequence can be contained in the expression of target gene to make the signal of any continuous with the nucleotide sequence such as pdgf sequence of seq id no such as: Vegf 2 or a sequence of seq id no such as: 4. Can be used in the field of the known program and calculating method selecting proper target sequence. Besides it can according to the file the said selected sequence the best use thereof in order to measure certain single chain nucleic acid sequence of secondary structure and it allows choosing it is possible to carry out of the folding stop the expression of the exposure of single chain area of those of the sequence the design program. Is used for the design is reasonable and the oligonucleotide a method and composition can be such as ginseng and american patent number 6 251 588 the document content is took as the invention reference. Of an mrna is considered as linear molecule it comprises guide protein in the ribonucleotide sequence of in vivo synthesis of the information. Will not be affected by the industry research institute claims a large part of mrnas there is a large amount of second and third grade structure. Rna in the secondary structure element parts are connected according to the same rna molecules between different regions of the g watson christopher type of each other to form the. Important secondary structure element comprises the stator inner chain section of the clamping ring is double chain rna in the protrusion and inner ring. Third grade structure element is in the secondary structure element to contact with each other or the single chain contact area is formed in order to generate more complex three-dimensional structure. Many study industry the measuring the large amount of double chain rna the structure of the combination of function and have been derived can be used for forecasting secondary rna structure a series of rule and parameter such as jaeger proc and natl acad sci usa 86: 7706; And the turner ann rev biophys biophys chem 17: 167. The rule can be used to identify the rna structure piece wu and it is concretely used to identify the single-chain rna area it can be it can represent the target mrna silence rnai core enzyme or antisense technology it is especially used in the segment. So it can be used for identifying target mrna of specific section of the invention claims a method for designing mediated rnai of dsrna oligonucleotide and is used to design of this invention is suitable to enzyme core and the hammer head core enzyme compositions.

[0246] can be through the allogenetic target gene transfection the dsrna oligonucleotide guide to input cell wherein it uses the field such as the common liposome the carrier of the combination material such as lipofectamine 2000 rockville positive md life technologies such as producing the business to the adherent cell system the invention claims a. Target of the endogenesis gene of dsrna of oligonucleotide transfection can be used to carry out 01igofectamine life technologies. To the mammal cell system to said common the transfection coding hgfp of pad3 after can be controlled by fluorescence microscope technology detecting the transfection efficiency and so on cell kehlenback j biol 141: 863-74. The effectiveness of rnai can be used in the guiding dsrnas after passing through a measuring method in the form of any one of estimation. Said method comprises but not limited to using antibody of protein imprinting analyzing said antibody is protein synthesis control after which makes the source base turnover enough time and then identifying the target gene of the product and rna printing of trace analysis for detecting the existing target mrna level.

[0247] be used in this invention of rnai technology of other compositions method and application the invention claims to the document in: American patent 6 no 278 039 5 723 750*5 244 805 said document from the received text as reference.

[0248] receptor tyrosine kinase inhibitors antagonists

[0249] this invention also comprises the field the known tyrosine kinase antagonist and it change of the body and substitute the body and the substitute can be used in the field of a conventional technology to obtain and the existing technology of the teaching effect the invention reference. Togf cell vegf and the signal through the said togf receptor and realization of the vegf receptor tyrosine kinase mediated by phosphoric acid the event and cell the other parts of the contact and it affects the cell membrane of the combination of the signal transduction compound of the lower reaches of substrate protein. So it is used for togf and/or signal transmitted by the vegf receptor kinase stage antagonist it also can be used for implementing the method of this invention.

[0250] for such as i3dgfr or vegfr of the tyrosine kinase receptor enzyme to said with selective a plurality of types of tyrosine kinase inhibitor is known by the parameter such as visible spada myers exp opin and ther patents 5: 805 and bridges exp opin ther patents 5: 1245. The law and has a home lydon industry of the tyrosine kinase inhibitors anti-cancer drugs potential i 996 emerging: Prospect medicines for the improved 241-260. Such as us patent number 6 528 526 the invention claims substituted by the quinoxaline compounds which can selectively inhibit platelet-derived growth factor receptor pdgfr tyrosine kinase activity. Togfr tyrosine kinase activity of the known inhibitors quinoline comprises the inhibitor of it is composed of such as maguire james med chem 37: 2129 and dolle and j med chem 37: 2627 report. A type of based on phenyl amino pyrimidine inhibitors of the last it is composed of traxler and so on and it is composed of ep 564409 zimmerman biorg med chem lett 6: 1221-1226 buchdunger proc and so on and the nat acad sci usa 92: 2558 report. Can be used for restraining i3dgf receptor tyrosine kinase activity of quinazoline derivatives which comprises a double unit and bicyclic aryl compound and mixed aryl compound in the parameter such as wo 92/20642 quinoxaline derivatives consult in cancer res 54: 6106-6114 pyrimidine derivatives daily the patent application no 87834/94 and the methoxy quinoline derivatives parameter and abstracts of the annual 116 th meeting of the pharmaceutical society of japan 2 # paolo kanazawa 29 15-2 - c2.

[0251] vegfr tyrosine kinase inhibitor for example comprises cinnoline derivatives such as described in the usa patent 6 no 514 971 in those of the content of the patent so as to their full text mode to work the invention reference. Other such cinnoline derivative is also the known such as j med chem 38: 3482-7 claims 3 4- bromobenzene amine cinnoline; J c soc chem: 1152-5 claims chloride 4 6 phenoxyl cinnoline; J karnatak univ sci 29: 82-6 claims some 4 aniline base cinnoline; And indian j chem 11: 211-13 claims some 4 phenyl thio cinnoline. Other j karnatak univ 18: 25-30 the invention claims some 4 phenoxyl cinnoline j karnatak univ sci 29: 82-6 claims two compounds: 4 4-methoxyl phenyl amido 6 7 - dimethoxy cinnoline and 4 3-chlorophenyl amine 6 7 - dimethoxy cinnoline. On the outer 4# set with through the selected from no 510 a s a ch2 nh and a group of benzene ring which is connected with some cinnoline description for the document in: American patent number 5 017 579 american patent number 4 957 925 american patent number 4 994 474 and ep 0302793a 2.

[0252] is used for inhibiting vegfr togfr and / or other related compounds can be obtained through screening new type compound to the target receptor tyrosine kinase activity the influence of obtaining it and it can be used in conventional method for measuring. Candidate togfr vegfr or organic small molecule inhibitors of effectively restrain effect can be used on the base of cell system for detecting and monitoring to the field of the known the other measuring system.

[0253] example to for a vegf receptor tyrosine kinase activity of the invention claims a measuring the following. Said detection is that using flt ivegf receptor tyrosine kinase in a. Detail process is as follows: Under room temperature dissolving in the 20mm tris-hcl 7.5 3 mm the ph value of the two manganese chloride magnesium chloride mncl2 0.3 percent / 501 st: 12 1 - 1 / ^ sodium vanadate 0.2511 ^ 1111 and polyethylene glycol peg 20000 lmm disulfide su sugar alcohol and 3 g per mu mu lpoly glu ty; 4: L sigma buchs swiss 8 - 3 4 cm on the radial ^ ? 0.2 to 1% ^ di-methyl sulfoxide and 0-10 ^ 1 to detect the compound 3 ^ laser 1 enzyme solution and flt iong kinase i consult in structure domain and so on shibuya oncogene 5: 519-24 the cultivating at warm temperature 10 minutes. And then adding 10 mu 1 501 st than ethylene diamine tetraacetic acid edta ph 7 stop the reaction. Using multiple channel distribution device systems lab usa 1 to 20 mu and so on the sample is applied to the pvdf = 1-vinylidene fluoride polymer polyvinyl difluoride immobilon p film millipore american through the micro titration filter manifold and vacuum connecting. Can completely eliminate the liquid then 0.5% containing phosphoric acid h 3po4 in the water bath continuously washing the film and four times by ethanol to wash one time every time oscillator cultivating at warm temperature 10 minutes and then it is installed on the hewlett packard topcount manifold and the adding 10 mu i microscint rtm beta twinkling counter liquid after the measurement of radioactivity. Through the third concentration of each of the compound restraining percentage ratio of the linear regression analysis to measure ic5tl value consistency it is usually 501 st 01 to mol of 0 to 1 mol and 1 mu mol. Activity of tyrosine inhibitor compound ic5tl value can be used in 0.01 mu m 100 mu m range.

[0254] the induced vegfr vegf tyrosine kinase from the phosphoric acid activation and can be used for experiment the other in the cell is verified. Speaking it is simple and the permanent expressing human kdr vegfr vegf receptor and the rotation of the dyeing process of cho cells this invention is to six hole of the cell cultivation flat plate in the complete culture medium contains 10% fetal cow serum the fcs 37 degree c in the 5% of co2 in cultivating at warm temperature until the surface to about 80% of the joining. The culture medium it does not contain fcs contains 0.1 wt% bovine serum albumin in diluted to be detected the compound and it is added to the cell of the illumination it includes experiment and it does not contain compound culture medium. The temperature of 37 degree c the seed for 2 hours after adding vegf recombinant vegf final concentration is 20ng per ml. On the 37 degree and c the cultivating at warm temperature for 5 minutes then cooling washing with pbs cell two times and ma on each hole of 100 mu 1 cracking buffer solution cracking. And then the cracking liquid is operated centrifugal to remove cell core and using the commercial measure the protein biorad to measure the upper clean liquid of protein concentration. The cracking liquid then it can be directly used or need of the telephone c the storing 200°.

[0255] then carrying out the sandwich elisa to measure the the phosphorylation of kdr: Kdr the monoclonal antibody fixed on the black elisa plate to from packard of optiplate *** htrf 96. Then washing said flat board and it is used for pbs solution of 1 % fl-bsa saturated and the other free albumen combining point. And then the cell cracking liquid 20 mu g protein or hole and the alkaline phosphatase coupling and phosphoric acid tyrosine antibody such as py20: Ap to automatically transduction laboratories lexington ky together on the 4 degrees c the said flat board is incubated on the night. Again the paint of said flat board and then using the light emission ap substrate cdp star ready to use with emerald ii; Applied biosystems tropix bedford ma verification and phosphoric acid tyrosine capture antibody the the phosphorylation the combination of receptor. For packard top count which microplate scintillation counter measuring luminescence. Opposite to the stimulation of vegf or f1dgf and negative contrast is not used or vegf togf excitation signal the difference between the equal to vegf induced by the phosphorylation of kdr = 100%. Test substance of activated is used as vegf receptor inducing of kdr phosphoric acid % of the suppression calculation in the inducement of the maximum inhibit function of 1/2 of the material concentration is defined as led 5tl 50% inhibitory action and effective dosage. Activity of tyrosine inhibitor compound edjt in 0 to 6 001 *** mu m range of the 0 005 mu m 0 in the range of 5 mu m.

[0256] medicine preparation and therapeutic application

[0257] the vegf antigen and antibody pdgf agent can be used for curing neovascular diseases include psoriasis rheumatoid arthritis and eye new blood vessel disease. Particular interest of the invention is using the i 3dgf b antagonist compound with a vegf antagonist the compound of inhibiting such as macular degeneration or diabetes retina pathological pair of new blood vessel disease method for treating. So once the diagnosis of patient is risk of developing the new blood vessel disease or suffers this utility model claims a disease by using i 3dgf antagonist and vegf antagonist the compound of the patient carry out treatment and are respectively blocking of the vegf togf and a negative effect so as to inhibit new blood vessel disease of the development and reducing the fresh blood vessel forming the switch of the harmful effect. This invention implementing the method of it will not cause cornea edema. Zheng-ru context the discussed can be multiple i 3dgf and vegf antagonist in this invention is used for.

[0258] according to the invention claims an pdgf and the vegf combination therapy can be independently carried out or other combination for curing and it can be used in family medical clinic room hospital outpatient department or hospital this invention claims. General treatment in hospital so as to start of the doctor can closely observation curative effect and performing any needed adjusting. Combination therapy of the duration of depending on the treatment of new blood vessel disease of the type of the patient age and the status of patient with diseases of the stage and types and patients to treat the reaction. The development of new blood vessel disease of the high risk human such as diabetes patient can be connected with the treatment and inhibiting or slowing the symptoms of the working. The invention claims one of the notable advantages are that the i3dgf antagonist and vegf antagonist compound used for treating vascular disease new enables the application of low dosage of each antagonist and a small quantity of the total antagonist activity can be relatively low toxicity and side-effect and low cost the invention claims a similar function.

[0259] combination for treatment of each antagonists can be used by any suitable method is carried out it causes the other antagonists combination of said antagonists concentration and it can effectively treat new blood vessel disease. Such as each antagonists can be the suitable carrier material mixing and generally it takes the using quantity of the composition of the total weight of the 1-95%. Said composition is capable of opening hole and it is suitable for the parenteral such as vein inner muscle of inner skin and the lower part of the rectum and the nose or absorbing the application of dosage form provides. The composition may be in the form of such as tablet capsule pill powder particle suspension solution emulsion gel it comprises water gel paste cream ointment ointment delivery device suppository enema it can be injected by the implant pressurized spray or aerosol. Comprises an antagonist or two or more antagonists of the medicine composition can be according to routine pharmaceutical method for preparing the parameter such as remington: The practice and science of pharmacy 20th led led ann r williams to 2000 gennaro lippincott wilkins philadelphia encyclopedia of the pa and pharmaceutical technology eds swarbrick j and j c boylan 1988-2002 marcel dekker new york.

[0260] useful in one aspect of the vegf antagonist i3dgf and the combination for parenteral administration such as through the muscle in the abdomen membrane in the vein inner hole of the inner glass the inner part of the eyeball conjunctiva subtenon or the subcutaneous injection or implant or a systemic applying. For parenteral or systemic application of preparation comprises bacteria free water solution or non-aqueous solution or suspension emulsion. Can use many kinds of aqueous carrier such as water buffer the water salt water and so on. Other suitable medium for example comprises a propylene glycol polyglycol and vegetable oil and the hydrogel hydrogenation naphalenes and it can be injected in the organic esters such as oil acid ethyl ester. The said control agent may further include an auxiliary substance such as antiseptic qi *** wet qi *** buffer qi *** emulsifying agent and / or dispersing agent. Biological compatibility the biological degradable of the levorotary lactide polymerization of lactide and exchange ester copolymer or polyoxyethylene polyoxypropylene copolymer can be used for controlling active ingredient release.

[0261] also passing through port intake i3dgf and using vegf antagonist the compound of. For oral use the composition can be solid or liquid form the preparation according to traditional chinese medicine composition for producing field of any of the known method to carry out.

[0262] is used for oral administration solid dosage form comprises capsule pill tablet powder and grain. Common said medicine preparation which is non-toxic may be used for medicine excipient a mixed active ingredient such as i 3dgf small organic molecular vegf antagonist and small organic molecular antagonists. And said excipient comprises the following steps such as inert diluting agent such as calcium carbonate sodium carbonate milk sugar cane sugar glucose mannitol cellulose starch calcium phosphate sodium phosphate kaolin and else. It can make the bond for buffering agent and / or lubricating agent such as magnesium stearate. Pill tablet and also can be used for enteric coating preparing. The composition optionally comprises a sweetening agent flavouring agent colouring agent flavouring agent or preservative agent the invention claims preparation of the opening can be more.

[0263] said togf and such as vegf antagonist can be controlled by vitreous body of injector for intraocular applied to the eye and performing the film and lower subtenon injection. Other application way comprises the scleral eye after abdominal muscle and inner film inner vein inner. Other antagonists combination of using drug delivery device or intraocular implants delivery parameter in the text.

[0264] for oral application of liquid dosage form comprising a traditional chinese medicine can be used for emulsifying agent solution of suspension liquid syrup and soft capsule. These form comprises the field of common using the inert diluent such as water or oil medium and also comprises adjuvant as follows wetting agent emulsion and suspending agent.

[0265] in some occasions togf and the lower part of the vegf antagonist the combination also can be used for local partially using such as through the adhesive agent or by directly applied to areas such as patient it is easy to or suffering from a new blood vessel disease of the epidermis or hole or by iontophoresis.

[0266] is used for eyes use of the non-toxic and medicinal excipient the mixed preparation comprising an active ingredient of tablet. And said excipient can be such as inter diluent or filling material such as sugar cane sugar and sorbitol lubricant flow auxiliary agent and the bonding agent such as magnesium stearate stearic acid zinc oxide stearic acid silicon dioxide hydrogenated vegetable oil or talc.

[0267] said i3dgf and vegf antagonist can be used in the tablet or other medium to mix or can be separated. In an example first antagonists contained in the inner side of the tablet and the second antagonists at the outer side so as to the second antagonists of the part is in the first antagonist release before released. If necessary tablet in the form of antagonists can be used for drug delivery device for delivery parameter in the text.

[0268] common each antagonists the using quantity of the corresponding sufficient to inhibit or reduce or eliminate new blood vessel disease of the harmful effect or symptoms. The carrier material mixed to produce a single dosage antagonist activity of component dosage can be adjusted according to the treatment of subjects and a specific application mode change.

[0269] is requested to protect the combination of each one of antagonists of the dosage of the depending on several factors which comprises the condition of the severity of said state is mainly for treating or preventing and treating the people accepting the age of the weight and healthy. The switch is set at the outside of the specific patient the medicine of genomics pharmacogenomic gene type for the treatment of drug metabolism kinetic of medicament dynamics or effective force feature the influence of the information which can affect the use of the dosage of the. The field of technology of people can understand according to several factors slightly adjust the exact a single dosage of said factors comprises application of specific i 3dgf and vegf antagonist the combination of the using time of applying path preparation of the characteristic of the drainage speed is mainly for treating the vascular disease the new disease the severity of the invention claims a new blood vessel disease of the anatomy position such as an eye relative to the body cavity. Considering the invention claims a application path of different effect in the needed dosage of the larger wave motion of. Such as a normal in the oral administration for need to be compared to vein inner wall or glass body internal injection and application is higher the dosage of the horizontal. Can be controlled by standard experience of the optimized path adjusting the amount of the level changes the way is in the field of know. The exact curing effective dose and horizontal mode is usually the doctor it is mainly used for treating ophthalmic such as doctor considers the factor determined.

[0270] is in the human oral administration for the togf antagonist or vegf antagonist the dosage of the common at about 0.0 olmg about 200 mg per day in the range of ideally is about img ioomg and antenna is more ideal is about 5 to about 50mg and astronautics. Highest reaches about 200 mg per day the dosage of the can is necessary. In order through the injection of applying said f 1dgf antagonist or vegf antagonist the dosage is usually is about 0.1 mg and about 250 mg/l antenna ideally is about img about 20mg per day or about 3mg about 5 days or. Injection can be used for every day to about four times at most. Generally in the intestines and stomach application of the outer diameter or whole body can be applied to people when the said togf antagonists by using the combination of the vegf antagonist the dosage of the usually is about 0 img about 1500 mg per day or of about 0 and about 5 days or iomg of about 0 and about 5 5 days. Highest reaches about 3000 mg/l days the dosage of the can is necessary.

[0271] on the human eye using the said togf antagonists by using the combination of the vegf antagonist the dosage of the usually is about 0 15mg / omg about 3 days or 3mg of about 0 and about 3 days or omg of about 0 or natural img l omg.

[0272] such as the eye i3dgf b and using vegf body is a medicinal substance is 5-7 the ph value of the phosphoric acid buffer salt in water is prepared by. Can be added sodium hydroxide or hydrochloric acid adjusting ph to. The invention claims a work in the preparation is especially suitable for i3dgf b body and a body such as vegf is especially suitable for eye 001 uses three different concentration of individual prepared: 3mg per 100 mu l 1 and 2 mg per 100 mu lmg per 100 mu 1 is set on the set with a sterile 27# of the needle head of aseptic lml usp type i level glass in injector. Medicine products the combination of this invention is that it is not contain preservative and it can be used for glass body in one time injection by using. The said active ingredient is togf vegf b and a medicinal substance concentration is 30mg 20mg per ml water and water 10mg-. And said excipient is sodium chloride usp; Sodium dihydrogen phosphate monohydrate usp; Disodium hydrogen phosphate monohydrate compound usp; Sodium hydroxide usp; Hydrochloric acid usp; And water for injection usp. The form of the said togf b and a medicine is especially suitable for the vegf product is can be directly used for the aseptic solution in the form of the one-off of the glass used in injector the invention claims a. Before use at least 30 minutes will not be affected by no more than 4 hours the injector from the storage taking the solution to room temperature. Injector the content of the application relates to a with screw thread of the plastic cylinder piston rod is connected with the injector cylinder rubber plug. And then taking out the rubber end cap for using said product. Togf vegf a b and it is suitable for body is 100 mu 1 the vitreous body type injection application of applying third time interval 28 days. Patient every time it can be accepted by clinic or injection 3mg. If necessary the dosage is reduced to 2 mg or lmg and further to 0 lmg.

[0273] the application of medicine specifically it is determined by the components of the combined. At the needed dosage combination pdgf antagonists and vegf antagonist the weight ratio of is about 50: 1 and about 20: 1 about 10: 1 or about 4: About 1 2: 1 or about 1: 1.

[0274] there is a combination therapy comprising i3dgf body b and antagonist and it is suitable for body a vegf antagonist. Said antagonists as said i 3dgf body b is antagonists with a vegf antagonist body and the weight ratio of the from about 0 1 to about 5 0 to about 5 0*0 1 by using the combination of. The two antagonists pdgf b and a vegf antagonist the useful range of from about 0 to 5 to about 0 or 2 from about 2 0*0 5 will not be affected by the other by the ratio of the i from about 0 to about 1 0 is finally determined to said i3dgf b is the vegf antagonist and a body which is antagonists of selecting.

[0275] the compound in treatment of each of the medicine can be independently applied to each antenna 1-4 times a day using at least a long time and it can even it can make patients to the terminal applying. Chronic for a long time used in many cases need to indicating the. The dosage can be used as application of single agent or agent is divided into several. It needs the dosage of the corresponding to set the spacing time of construction used for a long time is at least a plurality of zhou time although several mouths or longer using time can be necessary.

0276 ] and [ method of treating the front of the new blood vessel disease outside comprises togf antagonist and vegf antagonist the compound of curing it can prevent the performance can be applied for preventing or delaying the disease outbreak. In the prevention and application of it is easy to the patient or the risk and special new blood vessel disease of the patient using the i 3dgf and vegf antagonist. The application of exact time selecting and using amount of depending on various factors such as patient the health condition of body weight and so on.

[0277] the invention claims a working embodiment which needs to be used for curing a mammalian applying said togf antagonist and vegf antagonist the compound of common so it can inject the medicine composition for use in the form using. The the combination of such as vegf pdgf b is a body and it is suitable for body can be used solely or in the two components of chinese traditional medicine composition for use in the form using. Common is preferably said application can be obtained through injecting or by using the drug delivery device to carry out. Parenteral systemic and the application is which can be accepted.

[0278] the file the discussed when said i3dgf antagonist and vegf antagonist at the same time using the application may be in the time is orderly carried out by or at the same time to orderly applying the method of this utility model claims a using mode. When said togf and vegf antagonist in turn using time of each component of the application may be formed by the same or different method for performing the. Will not be affected by the for sequentially administering to said may be used as the following method: At about 5 seconds time of applying said togf antagonists and more than about three times of injection and then each six zhou time continuously using vegf antagonist the more than about each year injection nine times. Said togf antagonists can be used in each vegf antagonist injection at the same time of applying or may be used as the number of times less the decided by the doctor weather. Orderly applying also includes combination the independent antagonists can be used at different times of applying or by different route for the application or to said two and they are combined as to provide advantageous effect of inhibiting such as new blood vessel disease. It needs to pointing out of the invention is through the injection application is especially useful for.

[0279] can make the invention claims a traditional chinese medicine composition for preparing the base the upper part of the application after ma on or the use after any predetermined time period releasing activity i 3dgf vegf antagonist and use thereof controlled release preparation. Includes togf antagonist and vegf antagonist of at least one of the medical composition can be sustained release composition in the form of the invention claims. Ma or sustained release composition of the utility model depends on the curing condition of the property of. If said state is composed of the acute or an emergency diseases is composed of the telephone usually used immediately release form carry out treatment has a long time release composition. To some preventive or long-term treatment to said sustained release composition and it also can be suitable.

[0280] in the control releasing agent applied in each antagonist is useful in the said antagonists solely or combined with i narrow for the therapeutic index such as lead of the harmful side effect or toxic reaction of blood plasma concentrations and lead to the therapeutic effect of blood plasma concentrations a difference between the small; General therapeutic index of ti is defined as a result of the dosage of ld 5tl and the effective dosage proportion of ed5tl; Ii in stomach and intestines in the narrow the absorption of the window; Or iii a biological short half life and so on one day it needs to frequently take medicine so that the plasma level maintained in the treatment of horizontal upper.

[0281] can adopt various strategy so as to obtain the controlled release of the releasing speed exceeds the therapeutic antagonists of degrading or metabolizing speed. Such as the controlled release can be controlled by proper selection parameter and the preparation is obtained comprises the materials such as proper controlled release composition and coating. The example comprises one or several unit tablet or capsule composition oil solution suspending liquid emulsion micro capsule small ball body nanometer particle nanoparticle patch and liposome. Used for preparing said sustained release or controlled release preparation method is the field of know.

[0282] comprises togf antagonist and/or vegf antagonist or the two medicinal composition also can be used for drug delivery device such as implant delivery. Said implant may be biodegradable and biocompatible implant or can be can not be biodegraded by the implant. Said implant can be active agent can or cannot permeate osmosis. Ophthalmic drug delivery device can be inserted into the eye of the cavity chamber the front or back cavity chamber or the scleral choroidal gap or glass the outer part of the blood vessel without area between the middle or on the implant. In an embodiment of the implant can be put in a blood pipe is set on the upper surface of the gong on the membrane so that it can carry out the medicine of the scleral diffusing the medicine to reach the need of the parts such as eyes eye in the slot and the yellow spot. Other through the scleral diffusion part can close to the fresh blood vessel forming part such as to close the part of macular.

[0283] the above described the invention claims an independent of chinese traditional medicine composition for combined in the medicine in. This invention claims a combination of the medicine the components of the provided in the form of. Can be at least two antagonists preparation of the single or preparing and independent the dosage of using. The invention claims antagonist in the salt in the form of preparation it is useful for.

[0284] common said medicine bag comprises a certain amount of togf antagonists and uses the medicinal carrier for medium or diluent and the bottom of the first unit dosage form of; Certain amount of vegf antagonist and it uses the medicinal carrier for medium or diluent and the bottom of the second unit dosage form of; And container. The container can be used for separating components and may include such as separated bottle or separated foil packaging. If it needs to the independent antagonist composition is also can be contained in the single is not separated in the container. Said the medicine may also include applying independent i 3dgf and vegf antagonist of the guide. When the independent component is in different dosage form application time so as to make the different dosage of the horizontal or application need by the processing method of doctor the problem that the combination of individual constituent the effect of the price of the medicine package which is particularly advantageous. In an embodiment of the said medicine bag is designed into every distributed one said togf and vegf antagonist the dosage of them can be used for the use of the expected. In another example the medicine bag is designed to be included in the package are placed side by side of the first row i 3dgf antagonist and vegf antagonist through the installed on the description of informing user to application of a pair of antagonists. One example of the medicine is a so called the air bubble blister packaging this packaging the medicine package industry the know.

[0285]

[0286] new blood vessel disease for inhibiting is made by any acceptable measuring blood vessel formation whether delay or reduced the invention claims a method for the assessment of. And it comprises directly observed and indirect estimation such as by the subjective evaluating and objective symptom or physiologically index. Such as treatment effect can be adjusted according to neovascularization forming a micro blood vessel illness blood vessel or vessel leakage of water or other any combination for preventing or restoring evaluation. Is used to evaluate new eye blood vessel disease of the inhibiting effect for curing effect also can be in order to stabilize or improving visual sensitivity of the determined.

[0287] in the determined special combination therapy for the treatment or prevention of eye neovascular diseases the effect it also can be composed of ophthalmology hospital the injection after several days and on the compact first-time injection at the front of the at least one month after the patient carry out clinic evaluation. Also can be adjusted according to ophthalmology hospital to the requirement of the former four month of every month one time to etdrs visual sensitivity kodak polychrome film camera and fluorescein angiography.

[0288] such as the evaluation i3dgf antagonist and vegf antagonist compound treating ocular neovascularization formed by the power to the research and it is applied once in one or several times the vitreous body injection 3dgf i b and is connected with a vegf body is the combination of such as eye 001 of pegylated in the form of which is used for patient the age-related macular degeneration relay the concave hole the lower subfoveal choroidal neovascularization formed by the patient according to the field of ophthalmology the know the standard method to carry out. The invention claims a work in research of the patient the age-related macular degeneration amd relay the hollowness and choroidal neovascularization cnv shape of the patient to accept togf b is a vegf body and it is suitable for main body and a second glass vivo injection. Monitoring said combination of effect such as through the ophthalmic evaluation. In the treatment of three months after the patient has the stable and improving eyesight etdrs image such as on the surface of the upper surface of the output line of sight 3 or more improve is considered as receiving the effective dosage of togf b is especially suitable for body and a vegf body is the combination of this invention is able to restrain the eye new blood vessel disease.

[0289] the working research example of the patient the age-related macular degeneration relay the concave hole and the lower cnv etdrs image on the surface is lower than the visual sensitivity 20/200 of the patient to accept togf b is a vegf body and it is suitable for main body and a second glass vivo injection. Initiating dosage is each time of the glass body injection 501 st 25mg each one of antagonists. Also test each of an antagonist 5 0 and 2 mg l 3mg the dosage of the. Also through the eye-ground photographing and fluorescein angiography to the whole surface of the ophthalmologic examination. Combined medicine of the product is can be directly used for the aseptic solution it is comprised of dissolved in iomm sodium phosphate and 0 with buffer solution sodium chloride injection liquid in the said b is togf body and a vegf and it is composed of the injection liquid to sterilized without heating the raw glass a combined icc of injector tube in the coating of piston body is connected with the plastic on plunger and the rubber end cover is connected to the advance connected with the needle head is 27 #. Said f1dgf b and a vegf body is suitable for each and a body lmg per ml 2 or 5 5 ml of water per ml iomg 20mg 30mg water or water the drug concentration of the invention claims the oligonucleotide representing content so as to provide 100 mu 1 volume delivery. The injection of the vegf i3dgf b and a body after it is about 3 months the sensitivity research and evaluating curing effect. In the treatment of the patient has the stable and improving eyesight etdrs image such as on the surface of the upper surface of which is 3 or more than one line of the vision of increased patient is considered as receiving the effective dose combination of i 3dgf b and a body is the same vegf inhibitor eye new blood vessel disease. Embodiment

[0290] the embodiment of invention claims preparation and application of the invention some way and it is not only can taste the limit the scope of this invention can be used as other method to obtain similar result.

[0291] embodiment 1: Angle la niu new blood vessel forming angle la nv

[0292] cornea fresh blood vessel forming it is widely applied to the animal model which allows clear eye displaying an abnormality in blood vessel growth. Growth and normal of the cornea without blood vessel blood vessel can excellently establishing the utility model becomes research institute of blood vessel of degradation of the suction of the model of. The invention claims a method for inducing test cornea nv through the muscle is exerted by using hydrochloric acid chlorine amine ketone 25mg mg/kg and toluene sufficient absorption iomg mg/kg or 6 the male c57bl mouse 18_20 g; Charles river wilmington ma to anesthesia. Topical application is more than 0 1 2 na0h. By using # 21 blade feather osaka nippon applied in parallel angle of film edge of the rotating motion of the cornea and an angular edge of the leather film. 7 days after two times every day through the web film in injection 25mg mg/kg of sodium pegaptanib macugen *** eyetech pharmaceuticals vegf new york ar n y and it is suitable for the reagent but also is called the eye 001 or through the tube feeding every day in two times for oral administration 501 st used for 5 mg/kg of gleevec ® or sti57 but also is called cgp 57148 b 2- phenyl amino pyrimidine associated with tyrosine kinase inhibiting resistance pdgf pharma novartis ag from purchasing agent basel swiss or the two mouse the processing time is 7 days. On corneal nv inducing after 14 days to make the small mouse intravenous receiving 20 mu g/ g by fluorescein isothiocyanate fitc coupled with knife bean agglutinin a agglutinin vector laboratories burlingame ca at the same time by using hydrochloric acid benzene a sufficient absorption chloride and hydrochloric acid amine as the depth of anesthesia. 30 minutes after picking out the small mouse hole and the cornea to flat sealing flat mounted. By fluorescence microscope operation display the cornea nv and using openlab software quantitative. Is comprised of a blood pipe is covered on a cornea the percentage of the cornea total area the percentage of formal calculation of.

[0293] research institute of the application of naoh after pegaptanib sodium and gleevec the cornea fresh blood vessel forming the influence of the cornea edge and corneal epithelium damage. Is not processed by gleevec and treatment of eye compared with the sodium pegaptanib macugen the processing exhibit of the animal blood vessel growth 19 6 to reduce the p = 0 0014 image 5. And contrast and gleevec of single treatment the animal with sodium and comparing with pegaptanib gleevec mac glee and processing of animal at the angle on the membrane shows new blood vessel growth of obviously reduced 35 6% p building 5 0 0001 image. On the weak blood vessel growth method of combined therapy at the same ratio pegaptanib sodium macugen single therapy and more effective 16% p building 0 0145.

[0294] the image 6*7 also claims a representative cornea fresh blood vessel forming of experiment result. Picture 6 d is a fluorescence microscope image photo image display surface and the picture 6 macugen c or gleevec picture 6 b processing the body is combined to the * * 3+61 to the treatment of corneal shows new blood vessel forming of effectively restrain. Picture 6 * is fluorescence microscope image photo image display the illumination of the peg processing the angle of film on the fresh blood vessel forming degree of. Graph 7 the invention claims a fluorescence microscope image photo image display representing a single picture 7 apb5 for processing image and 7 b gleevec treatment and combined processing graph 7 c only can restrain new blood vessel growth and does not affect the blood vessel forming. Picture 7 d is a fluorescence microscope image photo image display the illumination of the peg processing the angle of film on the fresh blood vessel forming degree of.

[0295] embodiment 2: Amidine network new blood vessel the paraffin niu cnv

[0296] experiment cnv is used as age-related macular degeneration amd model. In the mode of choroidal the blood vessel growth of the utility model breaks through the glass film and retina and into amd patient body is observed with the similar. The invention claims a method for inducing test cnv through the muscle is exerted by using hydrochloric acid chlorine amine ketone 25mg mg/kg and toluene sufficient absorption 10mg- mg/kg or 6 the male c57bl mouse 18-20 g; Charles river wilmington ma for anaesthesia and is used for 1 percent the product amide expanding pupil. Using diode laser solidification 75 mu pi *** speckle size and second duration 90mw oculight slr laser iridex mountain view ca and used as contact lens the hand-held cover glass sheet produce four burn. Burn part of the retina the back electrode of the 3 6 9 and the position of the 12 o'clock. The laser the generated air bubble indicates that the glass film the broken it is obtained choroidal neovascularization formed by the important factor so it only needs to the four burn is air bubble produced by the little mouse for the research. 7 days after two times every day through the web film in injection 25mg mg/kg pegaptanib of sodium or through every day in two times of feed pipe and 50mg kg gleevec ® or sti57 pharma novartis ag basel swiss or at the same time to carry out the two processes mouse 7 days time. In the using apb5 i3dgfrb cdhob anti-mouse antibody against pdgf agent to ebioscience sandiego from ca the experiment by means of peritoneal internal injection and every day in two times of applying 5 mg/kg antibody is used for the dyeing pecam of the flat sealing film in network the pulse measuring choroidal nv damage the area of. By fluorescence microscope technical inspection flat sealing and through openlab software quantitative.

0297 ] and [ not processed by the camera comparing with sodium pegaptanib macugen *** processing exhibit cnv the eye area it reduces the 24 percent p = 0 007 image 8. Opposite apb5 treatment of eye compared with the reference has no obvious difference compared with the reference cnv surface is reduced to 5 6. With the reference glasses or the sodium pegaptanib 22 % 011 p = 0 or *** 5 building 39 p 0 to 5% 0001 of single treatment of eye compared with the sodium pegaptanib apb5 and the second eye of the processing exhibit cnv area of obviously reduced 46% 001 p = 0 image 8.

[0298] in the using rogfrp inhibitor time by observing the tendency of the similar. Gleevec ® treatment of ophthalmic eye compared with the reference surface there is no remarkable difference that the picture 2 4 9. Will not be affected by using sodium pegaptanib macugen *** treatment of ocular cnv surface area and lighting display different least 27% p = 0 0034. Important is that the sodium pegaptanib gleevec and the processing of the animal macugen + gleevec with the reference eye compared with presenting a minimum amount of p cnv 46% building 0.0001 and sodium pegaptanib of single treatment of eye compared with presenting cnv surface is reduced 19% p = 0 0407 image 9.

[0299] embodiment 3: Niu bottle new type mouse

[0300] research of applying pegaptanib sodium macugen *** and arc 127 archemix corp cambridge ma it has the sequence of seq id no caggcuacgncgtagagcau cantgatccu: 20 parameters from the u s 6 582 918 of seqidn0: 146 said document to form the full text as the invention reference of the peg of the resistance is pdgf body or the two to the retinal vascular development of affecting the sequence is 6 20 and 30# set with fluorine 2 2' or deoxidizing uridine in 8 no 21 28*29 set with fluorine 2'- 2 ' deoxycytidine 17*31 no 9 the 15 position is set on the use of 2' 0 methyl 2' deoxidizing guanylic the 22# set with 0 2 2' methyl deoxidizing adenosine 10*23 # on the position of the '' n '' is set with six gan alcohol phosphoramidite and the 32# set with reversed direction of the t 3 or 3' that is connected with the. New of the mouse c57bl or 6 hours per day once injection of peritoneal cavity 1 501 st 501 st mu g arc 127*100 macugen mu g or the two at the back of the day o po starting. The p4 and the small mouse hole. The flat sealing retina is displayed on the retinal vascular system and by using pecam and ng 2 immune dyeing or by using fitc cona and through injecting fluorescence microscope operation analysis realizing.

[0301] injection arc 127 can be completely breaking cell wall zhao * is used for raising blood vessel of retina. Is connected with the reference unprocessed retina compared with the p4 observe the invention claims a small quantity of blood vessel growth. Opposite macugen will not disturb normal blood vessel growth. Will not be affected by the single use arc 127 processing of the little mouse for comparing macugen and arc 127 both treatment of mice shows similar but the obvious and it is more serious defect.

[0302] 10 in the image displaying the result of macugen the growth of blood vessel of retina does not influence. I3dgfr b antagonists arc 127 and influence blood vessel extending out and morphology. Macugen 127 arc will not be affected by the composition ratio they are exclusively for blood vessel the effect of it is more serious.

[0303] embodiment 4: Resistant pdgf phone body and an antibody of the vegf * and treating

[0304] in the embodiment of the cornea fresh blood vessel forming pdgf is model uses the resisting body and the vegf antigen and achieves combination therapy efficacy of. The invention claims a method for inducing test cornea nv through the muscle is exerted by using hydrochloric acid chlorine amine ketone 25mg mg/kg and toluene * * l 501 st mg/kg or 6 the male c57bl mouse 18_20 g; Charles river wilmington ma to anesthesia. Local application na0h 2y 0 1 2 mm. By using # 21 blade feather osaka nippon applied in parallel angle of film edge of the rotating motion of the cornea and an angular edge of the leather film. 7 days after by web film in injection 25mg mg/kg has the following structure 40kdpeg caggctacgcgtag agcatcatgatcctg it 5 ' - 3 n0 of seq id: 21 of the antibody pdgf body it is especially suitable for the representation of the last nucleotide along the direction reverse to direction of 3 or 3' that is connected with and describing the u s 6 221 # 342 the invention is receiving the reference in the 100 mu g of the vegf antigen antibody 2c3 combined processing of said mouse. On corneal nv inducing 14 days after the mouse intravenous receiving 20 mu g/ g by fluorescein isothiocyanate fitc coupled with knife bean agglutinin a agglutinin vector laboratories burlingame ca at the same time by using hydrochloric acid benzene a sufficient absorption chloride and hydrochloric acid amine as the depth of anesthesia. 30 minutes after picking out the small mouse hole and the cornea to flat sealing. By fluorescence microscope technology observation cornea nv and through openlab software quantitative. Is composed of blood vessel cover of the cornea percent is as the parent corneal surface area the percentage of the calculation of. The result shows combination therapy efficacy of high and it is suitable for pdgf body or the vegf antigen body single treatment the result of the.

[0305] the single experiment of test the two relative pdgf and it is suitable for body and the u s 6 221 # 342 in the description of 100 mu g of the vegf antigen antibody combining the effect of 2c3. Checking the pegylated and not of the peg in the form of two kinds as follows and it is suitable for body pdgf:

[0306] i caggcuacgn cgtagagcau cantgatccu to the sequence of seq id no: 20 u s consult in 6 of the sequence of seq id no 582 918: 146 said document to form the full text the text as reference the 6 20 and 30# set with fluorine 2 2' or deoxidizing uridine in 8 no 21 28*29 set with fluorine 2'- 2 ' deoxycytidine 17*31 no 9 the 15 position is set on the use of 2' 0 methyl 2' deoxidizing guanylic the 22# set with use of 2' 0 methyl 2' adenosine deoxidization 10*23 # on the position of the '' n '' is set with six gan alcohol phosphoramidite and the 32# set with reversed direction of the t 3 or 3' that is connected with the; And

[0307] ii caggcuacgn cgtagagcau cantgatccu to the sequence of seq id no: 22 consult in u s 5 723 594 of the sequence of seq id no: 87 said document to form the full text as the invention the reference position of the 8# C is set on the 0 methyl 2 deoxycytidine 9 31# 17 and the position of the gps is set on the methyl deoxidizing 2-0 -2 guanylic 22# on the position of a is set on the methyl deoxidizing 2-0 -2 one of adenine the 30# set with nail base 2 and 2-0 Oxygen uridine 6*20 # on the position of the u is set on deoxidizing 2-fluorine 2 the 21 uridine 29# 28 and is set on the position of the c With 2 2 fluorine deoxycytidine 10*23 # on the position of the n is set on the fifth alcohol pentaethylene gan Glycol phosphoramidite spacer and the 32# set with reversed direction of the t and 3' 3' is connected with the Provides proper comparison to detect and independent of the antibody pdgf body or it is suitable for the treatment of the vegf antigen compared with the combination therapy the improvement of the invention claims a new blood pipe is used for resisting. More than the result shows that the combination for curing effect is better than singly using and it is suitable for pdgf body or vegf antigen antibody of treatment the effectiveness of.

[0308] 5 embodiment: Pdgf the telephone body and the telephone body of the vegf * the combined energy yang amidine network the new blood vessel the paraffin niu cnv

[0309] in the embodiment using the choroidal neovascularization forming model uses the resisting pdgf prove that it is suitable for body and the vegf body it is suitable to be in blocking choroidal neovascularization formed in the aspect of combined therapy effect. Experiment of cnv is used as age-related macular degeneration amd model. In the mode of choroidal the blood vessel growth of break of glass and film into amd retina and the sufferer to observe the similar to the inducing experiment cnv through the muscle is exerted by using hydrochloric acid chlorine amine li 25mg mg/kg and toluene * * 10mg- mg/kg or 6 the male c57bl mouse 18_20 g; Charles river wilmington ma to anesthesia i and it is used to support the amide expanding pupil. Using diode laser solidification 75 mu m spot size 501 st 1 second duration 90mw oculight slr laser iridex mountain view ca and used as contact lens the hand-held cover glass sheet produce four burn. Said burn part of the retina the back of the electrode 9*12 point 3 6 position of the clock. The laser generated air bubble indicates that the glass film the broken it is obtained choroidal neovascularization formed by the important factor so it only needs to the four burn can generate the air bubble of the little mouse used for the research. 7 days after two times every day through the web film in injection 25mg mg/kg pegaptanib of the sodium treatment small mouse. In use and it is suitable for pdgf body the experiment that has the following structure 40kcipeg 5' caggctacgcgtagagcatcatga tcctgqlo ' s seq idn0: 21 wherein it expresses the last nucleotide are reversal direction of 3 or 3' that is connected with the 25mg mg/kg of the antibody pdgf body and it is suitable for using common sodium pegaptanib. Pecam is used for the dyeing of the flat sealing film in network the pulse measuring choroidal nv damage the area of. By fluorescence microscope technical inspection flat sealing and through openlab software quantitative. The result shows this utility model claims a combination therapy treatment of eye hole and the contrast or using singly or sodium pegaptanib pdgf and it is suitable for the processing of the eye compared with presenting obvious with smaller area cnv.

[0310] the independent experiment of the vegf antigen combination curing checking the two relative pdgf body and it is suitable for the effect of it pass through every day in two times of web film in injection 25mg mg/kg of realizing pegaptanibsodium. Experiment of the peg of the peg and not in the form of two kinds as follows and it is suitable for body pdgf:

[0311] i caggcuacgn cgtagagcau cantgatccu to the sequence of seq id no: Consult in 20 u s 6 582 918 of seqidn0: 146 said document to form the full text as the invention referring to 6 20 and 30# set with fluorine 2 2' or deoxidizing uridine in 8 no 21 28*29 set with fluorine 2'- 2 ' deoxycytidine 17*31 no 9 the 15 position is set on the use of 2' 0 methyl 2' deoxidizing guanylic the 22# set with use of 2' 0 methyl 2' adenosine deoxidization 10*23 # on the position of the '' n '' is set with six gan alcohol phosphoramidite and the 32# set with reversed direction of the t 3 or 3' that is connected with the; And

[0312] ii caggcuacgn cgtagagcau cantgatccu to the sequence of seq id no: 22 consult in u s 5 723 594 of the sequence of seq id no: 87 said document to form the full text as the invention referring to 8# position of c is set with 501 st 2 a methyl group deoxycytidine 9 31# 17 and the position of the gps is set with 2-0 -2 methyl deoxidizing guanylic 22# on the position of a is set on the methyl deoxidizing 2-0 -2 one of adenine the 30# set with methyl 2-0 -2 the deoxidizing uridine 6*20 # on the position of the u is set with 2 2# fluorine in the deoxidizing uridine 21 28 and 29# position of c is set with 2 2# fluorine deoxycytidine 10*23 # on the position of the n is set on the fifth alcohol gan phosphoramidite spacer and the 32# set with reversed direction of the t 3 or 3' that is connected with the. This invention provides suitable for comparison to detect and independent of the antibody for resisting vegf pdgf body or it is suitable for body comparing to the curing combination therapy with improved the invention claims a new blood pipe is used for. The result shows combination therapy in blocking choroidal neovascularization formed in the aspect of good effect for resisting pdgf body or it is suitable for the vegf body single treatment the effectiveness of.

[0313] embodiment 6: Angle la niu new blood vessel forming angle la nv degradation

[0314] 1 the embodiment of the cornea nv model is used for researching the vegf antigen pdgf body and it is suitable for the main body of the combined. 10 days then through every day in two times of web film in injection 25mg mg/kg of sodium pegaptanib macugen *** eyetech pharmaceuticals new york ar n y and it is suitable for the vegf agents and / or every day for once fertilization and 50mg mg/kg of the arc 127 archemix corp cambridge ma pdgf body and it has the following structure 40kdpeg 5 cag gctacgcgtagagcatcatga tcctgqlo ' s seq id *: 11 21 ' the representation of the last nucleotide are reversal direction of 3 3 ' ' is connected with the processing of the mouse 10 days time. On corneal nv inducing after the 20 days of picking out of the eye and the cornea to flat sealing. Using *** 31 dyeing bd biosciences pharmingen san diego ca display the cornea nv metamorph and uses software to carry out quantitative. Is comprised of a blood pipe is covered on a cornea the percentage of the cornea total area the percentage of formal calculation of.

[0315] in the pattern 11 and 12 in the invention claims sodium pegaptanib and / or arc 127 the application of naoh after the cornea fresh blood vessel so as to form a degradation film and the angle of edge and of the cornea epithelium damage of the action of. With the 20 days of the camera comparing with arc 127 of processing animal without showing the blood vessel growth obviously reduced. And the 10 days to 20 days compared to the comparison tables of the cornea that the fresh blood vessel forming increases 12 92%. With the 20 days of the camera than singly using the sodium pegaptanib macugen the processing exhibit of the animal blood vessel growth and reduces the 13.81% rho building 016. Compared with the reference for pegaptanib sodium and arc 127 processing of animal exhibiting cornea new blood vessel growth obviously reduced 26 85% p * 002.

[0316] embodiment 7: Angle la niu new blood vessel forming angle la nv degradation

[0317] 1 the embodiment of the cornea nv model is used for researching the vegf is especially suitable for body and the said togfb receptor antibodies combination. The 14 days after every day in two times of web film in injection 25mg mg/kg of sodium pegaptanib macugen vegf body it is suitable for resisting agents and / or two times every day through the pipe feed for oral administration and 50mg kg apb5 and said togfb receptor multi-clone antibody for treating small mouse 14 days. On corneal nv inducing 28 days after the mouse by mainline the route receives 20yg per g of isothiocyanate projecting light element coupled with knife bean agglutinin a agglutinin vector laboratories burlingame ca at the same time by using hydrochloric acid benzene a sufficient absorption chloride and hydrochloric acid amine as the depth of anesthesia. 30 minutes after picking out the small mouse hole and the cornea to flat sealing. By fluorescence microscope operation display the cornea nv and through openlab software quantitative. Is comprised of a blood pipe is covered on a cornea the percentage of the cornea total area the percentage of formal calculation of.

[0318] in the pattern 13 in the invention claims pegaptanib sodium and/or apb5 the application of naoh after the cornea fresh blood vessel so as to form a degradation film and the edge angle and corneal epithelium damage the influence of. Compared with the reference for pegaptanib sodium macugen the processing exhibit of the animal blood vessel growth and reduces the 8 3%. And the camera and comparing with sodium pegaptanib apb5 of processing animal the angle on the membrane shows obviously less new blood vessel growth 21 4%.

[0319] embodiment 8: Angle la niu new blood vessel forming angle la nv degradation additive agent for treatment of the sequence of

[0320] 1 the embodiment of the cornea nv models for studying and using vegf is especially suitable for body and the said togfb receptor antibody of the combination for curing the addition of a sequence of the influence of. 14 days then through every day in two times of web film in injection 25mg mg/kg of sodium pegaptanib macugen vegf body it is suitable for resisting agents and / or through the tube feeding every day in two times for oral administration and 50mg kg apb5 ebioscience san diego ca and the said f1dgfb receptor of polyclonal antibody in different time point of the processing time of the mouse 7 days. On corneal nv inducing 28 days after the mouse by mainline the route receives 20 mu g per g of isothiocyanate projecting light element coupled with knife bean agglutinin a agglutinin vector laboratories burlingame ca at the same time by using hydrochloric acid benzene a sufficient absorption chloride and hydrochloric acid amine as the depth of anesthesia. 30 minutes after picking out the small mouse hole and the cornea to flat sealing. By fluorescence microscope operation display the cornea nv and through openlab software quantitative. Is comprised of a blood pipe is covered on a cornea the percentage of the cornea total area the percentage of the calculation and the result picture the 14.

0321 ] and [ contrast compared with the application of naoh after cornea angiogenesis formed by the degradation and the angle of film edge and corneal epithelium damage of the first antenna 21-28 for using alone or in the sodium pegaptanib 14-21 antenna used individually apb5 is not subsequently used for performing the processing effect has small influence of. Compared with the reference 14-21 apb5 from the first antenna used for processing and the sodium pegaptanib 21-28 days in the process of animal on corneal of the upper surface of which is less a new blood vessel growth 13 4%.

[0322] the same program

[0323] it does not exceed the scope of this invention and mental under the premise of the said system and method for the all kinds of decoration and changing to the field of technology of workers to it is showed easily the. As much as possible tube the special combination is an ideal embodiment of the invention carries through the invention claims the application of the understand of the invention is the request of protection the invention does not should through the limitation to the specific implementing project. The field of technology of people can understand or it is only to make regular test under the condition of ensuring the document the description of the invention the embodiments of the plurality of the same program. The same method of optionally it comprises the invention in the range of.