Formation of array of membranes and apparatus therefor
Abstract
An array of membranes comprising amphipathic moleculesis formed using an apparatus comprising a support defining an array of compartments. Volumes comprising polar medium are provided within respective compartments and a layer comprising apolar medium is provided extending across the openings with the volumes. Polar medium is flowed across the support to displace apolar medium and form a layer in contact with the volumes, forming membranes comprising amphipathic molecules at the interfaces. In one construction of the apparatus, the support that comprises partitions which comprise inner portions and outer portions. The inner portions define inner recesses without gaps therebetween that are capable of constraining the volumes comprising polar medium contained in neighbouring inner recesses from contacting each other. The outer portions extend outwardly from the inner portions and have gaps allowing the flow of an apolar medium across the substrate.

Term
7.1 yearsleft in the term
Expires 23 October 2033.
- Priority
- Filed
- Granted
- Today
- Expires
68 claims: 3 independent, 65 dependent
- 1A method of forming an array of membranes comprising amphipathic molecules, the method comprising:providing an apparatus comprising a support that comprises partitions defining an array of compartments having openings through which polar medium may be introduced, the partitions comprising inner portions and outer portions, the inner portions defining inner recesses of the compartments without gaps therebetween that are capable of constraining volumes comprising polar medium, that may be disposed in neighbouring inner recesses, from contacting each other, and the outer portions being set back from the edges of the inner recesses as viewed from the openings, extending outwardly from the inner portions and having gaps allowing the flow of an apolar medium across the support;disposing polar medium and apolar medium onto the support to provide the volumes comprising polar medium within respective compartments so that the volumes comprising polar medium are constrained from contacting the volumes comprising polar medium in neighbouring compartments, and a layer comprising apolar medium extending across the openings in the support in contact with the volumes comprising polar medium;and flowing polar medium across the openings in the support to displace apolar medium and form a layer comprising polar medium extending across the openings in the support in contact with the volumes comprising polar medium and membranes comprising amphipathic molecules at the interfaces between the layer comprising polar medium and the volumes comprising polar medium.
- 10The method according to any one of claims 1 to 9, wherein the volumes comprising polar medium fill the inner recesses, and the inner recesses and the outer portions of the partitions have dimensions selected so that the volumes comprising polar medium form a meniscus across the inner recess and the layer comprising polar medium fonns meniscuses across the outer portions, which meniscuses extend towards each other to an extent that brings the layer comprising polar medium in contact with the volumes comprising polar medium.
- 25The method according to any one of claims 1 to 24, wherein the support further comprises respective electrodes in each compartment making electrical contact with the volumes comprising polar medium, the step of disposing polar medium and apolar medium onto the support provides volumes comprising polar medium within respective compartments in electrical contact with the respective electrodes.
- 28The method according to any one of claims 1 to 27, wherein the support further comprises a common electrode arranged so that the common electrode makes electrical contact with the layer comprising polar medium, when the layer comprising polar medium is disposed extending across the support over the openings.
- 36The method according to any one of claims 1 to 35, wherein the layer comprising polar medium extending across the openings in the support does not make contact with edges of the inner recesses as viewed from the openings;and/or the volumes comprising polar medium within respective compartments do not make contact with the edge of the inner recesses from which the outer portions are set back. Date Reçue/Date Received 2021-01-08
- 37An apparatus for forming an array of volumes comprising polar medium, the apparatus comprising a support that comprises partitions which comprise inner portions and outer portions, the inner portions defining inner recesses without gaps therebetween that are capable of constraining volumes comprising polar medium that may be contained in neighbouring inner recesses from contacting each other, and the outer portions being set back from edges of the inner recesses as viewed towards the openings and extending outwardly from the inner portions and having gaps allowing the flow of an apolar medium across the substrate, wherein the inner recesses contain respective volumes of polar medium, and the support further comprises a layer comprising polar medium extending across the support with apolar medium around the outer portions of the partitions and with the layer of polar medium in contact with the volumes comprising polar medium, membranes comprising amphipathic molecules being formed at the interfaces between the layer comprising polar medium and the volumes comprising polar medium.
- 51The apparatus according to any one of claims 37 to 50, wherein the layer comprising polar medium extending across the openings in the support does not make contact with the edges of the inner recesses as viewed from the openings;and/or the volumes comprising polar medium within each inner recess do not make contact with the edge of the inner recesses from which the outer portions are set back. Date Reçue/Date Received 2021-01-08
- 55An apparatus for forming an array of volumes comprising polar medium, the apparatus comprising a support that comprises partitions which comprise inner portions and outer portions, the inner portions defining inner recesses without gaps therebetween that are capable of constraining volumes comprising polar medium that may be contained in neighbouring inner recesses from contacting each other, and the outer portions being set back from edges of the inner recesses as viewed towards the openings and extending outwardly from the inner portions and having gaps allowing the flow of an apolar medium across the substrate, wherein the inner recesses contain respective volumes of polar medium, and the support further comprises a layer comprising apolar medium extending across the support in contact with the volumes comprising polar medium.
Independent claims43
537 paragraphs in 75 sections, as filed
Formation of Array of Membranes and Apparatus Therefor
In some aspects, the present invention relates to the formation of an array of membranes comprising amphipathic molecules using an array of volumes of polar medium. A further aspect relates to an apparatus suitable for forming an array of membranes. In other aspects, the present invention relates to the formation of an array of volumes of polar medium. Such an array of volumes of a polar medium may be used in a range of applications, including the formation of membranes comprising amphipathic molecules.
Spatially defined arrays of small volumes of fluid in the nanolitre to picolitre range may be used in a wide range of biological, pharmaceutical and other analytical applications. A droplet array provides the opportunity to facilitate high throughput processing of small volumes of individual droplets or groups of droplets and may be used for example to compartmentalise reactions, cell sorting and screening applications such as protein crystallisation, analysis of blood or spinal fluid and waste processing. The ability to address and replace the volumes of fluid in the array is an important aspect, for example for carry ing out reactions on the volumes and replenishing the array. Microfluidic static droplet arrays arc disclosed in Lab Chip. 2011, 11,3949.
Lipid bilayers are thin polar membranes formed from two layers of lipid molecules. Lipid bilayers are found in cell membranes of most living organisms and are usually composed of phospholipids. They are impermeable to most hydrophilic molecules and ions, and enable cells to regulate their salt concentrations and pH by pumping ions across the lipid bilayer using transmembrane proteins known as ion pumps. Lipid bilayers. or more generally bilayers of amphipathic molecules, also serve as excellent platforms for a range of experimental studies. Holden et al, J. Am. Chem. Soc. 2007, 129, 8650-8655 disclose the formation of functional bionetworks of aqueous droplets comprising lipid bilayers provided between droplets. Such networks can act as light sensors, batteries and electrical components by incorporating pumps, channels and pores into the bilayers. Sackmann, Science, New Series, Vol 271, No.5245 (Jan 5,1996), pp. 43-48 provides a review of the scientific and practical applications of supported lipid-protein bilayers including their use in electrooptical biosensors. Jung et al, J. Am. Chem. Soc., 2009, 131 (3), 1006-1014 have developed optical assays for the detection of protein ligand binding on supported bilayers.
The ability to form a membrane of amphipathic molecules betw een two droplets of aqueous solution in a hydrophobic medium such as oil has been demonstrated in WO-2008/012552. Each droplet comprises a layer of amphipathic molecules encapsulating a hydrophilic medium, the droplet being provided in a hydrophobic medium. The droplets are brought into contact to form the membrane of amphipathic molecules therebetween. Electrodes may be provided within the hydrophilic interior of each droplet in order to measure ion flow across the bilayer. A droplet array may be provided in a container having an array of micromachined dimples in w hich individual droplets may rest
Another application disclosed in WO-2009/024775 is to form membranes of amphipathic
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 molecules between the volumes of hydrophilic medium in an array and a layer of hydrophilic medium formed by a hydrated support in contact with the volumes of hydrophilic medium. This document discloses a method for producing a droplet interface bilayer, wherein droplets are prepared by contacting an oil/lipid solution with an aqueous solution and the resulting droplets of aqueous solution are brought into contact with an aqueous agarose gel support layer.
It is desirable to use membranes of amphipathic molecules to hold membrane proteins. The provision of ion channel nanoporcs in highly resistive amphipathic bilayers for the detection of DNA has been previously well documented. Aqueous solutions are provided on either side of the amphipathic bilayer and ion flow through the nanopore takes place under a potential gradient. DNA may be caused to translocate the pore and the change in ion flow during translocation of DNA through the pore may be measured in order to determine its nucleotide sequence. The lipid bilayer may be suspended across an aperture by methods well known in the art such as patch clamping or painting. As an alternative, WO-2009/077734 discloses a plurality of individually addressable lipid bilayers formed across an array of microw ell apertures, each microw ell containing an electrode and an aqueous medium in contact with the lipid bilayer.
A first aspect of the present invention is concerned with convenient and effective formation of an array of membranes comprising amphipathic molecules.
According to the first aspect of the present invention, there is provided a method of forming an array of membranes comprising amphipathic molecules, the method comprising:
providing an apparatus comprising a support defining an array of compartments having openings through which polar medium may be introduced;
disposing polar medium and apolar medium onto the support to provide volumes comprising polar medium within respective compartments so that the volumes polar medium are constrained from contacting volumes comprising polar medium in neighbouring compartments, and a layer comprising apolar medium extending across the openings in the support in contact with the volumes comprising polar medium; and flowing polar medium across the openings in the support to displace apolar medium and form a layer comprising polar medium extending across the openings in the support in contact with the volumes comprising polar medium and membranes comprising amphipathic molecules at the interfeces between the layer comprising polar medium and the volumes comprising polar medium.
Such a method provides a convenient and effective way to form an array of membranes comprising amphipathic molecules. Use of an apparatus that comprises a support defining an array of compartments having openings, allows an array of volumes comprising polar medium to be disposed within the respective compartments through the openings. As a result, the volumes comprising polar medium are constrained from contacting volumes comprising polar medium in neighbouring compartments, thereby allowing the volumes of polar medium to be used independently, facilitating a range of array-based applications. Such an apparatus may be made to accommodate volumes of any
CA 02829440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 selected size. Typically, the volumes comprising polar medium may have an average volume in the range from 0.4pL to 400nL.
To form membranes comprising amphipathic molecules, there is provided a layer comprising apolar medium extending across the openings in the support in contact with the volumes comprising polar medium. Polar medium is flowed across the openings in the support to displace apolar medium and form a layer comprising polar medium extending across the openings in the support in contact with the volumes comprising polar medium. The membranes comprising amphipathic molecules arc formed at the interfaces between the layer comprising polar medium and the volumes comprising polar medium. In general, and as described further below, the amphipathic molecules may be provided in the layer comprising apolar medium and/or the polar medium flowed across the openings in the support.
This provides a convenient and effective way to form the membranes. By displacing the apolar medium apolar medium by the polar medium, the membranes are reliably formed.
There are now described various methods of forming an array of membranes.
Several different methods may be applied for disposing the volumes comprising polar medium within respective compartments. The particular method used depends in part on the structure of the support and whether the individual volumes of polar medium are preformed prior to addition to the support or formed subsequently following addition of polar medium to the support. The support may comprise gaps between the compartments or alternatively the support may be provided without gaps between compartments. A first and second types of possible method will now be described.
In the first type of possible method for disposing the volumes comprising polar medium within respective compartments, the volumes are pre-formed before disposition in the compartments. Some possible techniques for this are as follows.
In one possible technique, the polar medium and apolar medium may be disposed onto the support by forming an emulsion of the volumes comprising polar medium in an apolar medium and flowing the emulsion over the support.. In this case, volumes comprising polar medium within the apolar medium are introduced into the compartments through the openings. This allows the compartments to be filled in a straightforward manner. The dimensions of the individual volumes of polar medium as well as that of the compartment may be selected such that a single volume of polar medium is provided per compartment.
The partitions of the support may comprises gaps that allow flow of apolar medium between the compartments, as described in more detail below. The gaps are chosen to be of a size that constrains the volumes of polar medium within the compartments whereas the apolar medium is able to flow between the gaps.
The emulsion may further comprise the amphipathic molecules. This facilitates the formation of the membranes w hen polar medium is flowed across the openings in the support to form the layer comprising polar medium The presence of the amphipathic molecules also stabilises the emulsion.
CA 02899440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
Typically, the emulsion contains more volumes comprising polar medium than the number of compartments. The excess of volumes comprising polar medium assists in filling a reasonably large proportion of the compartments. Accordingly, to remove the excess volumes comprising polar medium, the support may be washed with the apolar medium. This washing may be performed leaving volumes comprising polar medium inside compartments, and leaving a layer of the apolar medium used for washing as the layer of apolar medium extending across the openings in the support in contact with the volumes comprising polar medium.
In another possible technique, volumes comprising polar medium may be dispensed directly into individual compartments, for example by acoustic droplet injection. With this technique, the dispensing may be controlled such that the correct number of volumes comprising the polar medium are dispensed without the need to remove excess volumes.
Where the volumes comprising polar medium are preformed, they may be droplets of an aqueous buffer solution. Such droplets are easy to form and manipulate.
Where the volumes comprising polar medium are preformed, they may be beads of an aqueous gel. Such beads are again easy to form and manipulate and may be shaped as desired
Advantageously, the aqueous gel may be a bead, which being relatively hard, provides advantages in manipulating the volumes comprising polar medium. Advantages in filling the compartments may be obtained by flowing an emulsion or suspension of the beads over the support under positive pressure. The use of a bead which resists the pressure permits relatively high positive pressures to be used.
In the second type of possible method, the respective volumes comprising polar medium may be provided in respective compartments by disposing polar medium onto the support, so that the polar medium enters into the compartments through the openings and the layer comprising apolar medium is provided subsequently, for example by flowing the apolar medium across the support, or by another technique such as spraying.
The polar medium may be disposed onto the support by flowing polar medium across the support Excess polar medium may thereafter be displaced, leaving discrete volumes comprising polar medium in the compartments. In one example, a gas is flowed across the substrate to displace the excess polar medium between the step of flowing polar medium and the step of flowing apolar medium. In another example, the apolar medium is flow ed across the substrate layer comprising apolar medium, this flow' itself displacing the excess polar medium.
Alternatively, the polar medium may be disposed onto the support by injecting discrete volumes comprising polar medium into the compartments.
An advantage of providing the individual volumes of polar medium in this way is that the polar medium may be added to the support in the absence of amphiphilic molecules
The support may be pre-treated with a pre-treatment apolar medium prior to disposing the respective volumes comprising polar medium in the respective compartments. In the case where the
CA 02899440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 polar medium is disposed onto the support by flowing polar medium across the support, advantageously, the partitions of the support may comprises gaps that allow flow of apolar medium between the compartments, as described in more detail below. In this case, a pretreatment may provide some degree of sealing of the gaps connecting the respective compartments, thereby constraining the flow of polar medium between the gaps so that the polar medium enters into the compartments through the openings. This assists in the eventual formation of discrete volumes of polar medium by reducing the tendency of the volumes in neighbouring compartments to contact each other. This is particularly beneficial where no amphiphilic molecules are initially present in the volumes of polar media provided within the array of compartments as they may easily converge if they contact one another.
The addition of pretreatment may also be used change the contact angle between the pretreated material of the support and a volume of polar medium disposed within a compartment. The pretreatment may be used for example to increase the phobicity of die support to the polar medium and provide a volume having a more convex shape in order to optimise formation of the membrane at the interface between the volume of polar medium and the layer of polar medium. The use of a pretreatment to alter the phobicity of the support to a desired level permits the use of a wider number of materials to be considered in making die support. This can be useful for example in the case where a particular material is desirable from a manufacturing point of view' but does not have the correct properties with regards to the polar and apolar media. The layer compnsing apolar medium may further comprise the amphipathic molecules. This facilitates the formation of the membranes when polar medium is flowed across the openings in the support to form the layer comprising polar medium.
In one example, the apolar medium may comprise the amphipathic molecules prior to the addition of the layer of apolar medium to the support. Alternatively, the amphipathic molecules may be added to the layer of apolar medium following addition of the layer to the support.
Where the layer comprising apolar medium further comprises the amphipathic molecules, between die steps of providing a layer comprising apolar medium extending across the openings in the support in contact with the volumes comprising polar medium and flowed across the openings in the support, the apparatus may be left for a period of time in order to allow’ the amphipathic molecules to migrate to the interface between the layer comprising apolar medium and the volumes comprising polar medium.
In another example, the polar medium that is flowed across the openings in the support may further comprise the amphipathic molecules. This similarly facilitates the formation of the membranes w'hen polar medium is flowed across the openings in the support to form the layer comprising polar medium.
In yet another example, the pre-treatment of apolar medium may further comprise amphipathic molecules, so that the membranes comprising amphipathic molecules are formed after
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 the step of flowing polar medium across the openings in the support to form a layer comprising polar medium.
The membranes comprising amphipathic molecules may be used for a range of applications such as detection of an analyte at the membrane interface, determination of a property of the membrane interface, or passage of an analyte across one or more membrane interfaces. In some applications, the membranes may be used to analyse a sample comprising an analyte, for example a biological sample.
In one type of application, there may be used membrane proteins, such as ion channels or pores that are inserted into the membranes comprising amphipathic molecules. The membrane proteins may initially be contained in the volumes comprising polar medium or in the layer comprising polar medium. Alternatively the membrane proteins may be provided in the apolar medium. The membrane proteins typically spontaneously insert in the membranes comprising amphipathic molecules. Insertion of the membrane proteins into the membrane can be assisted where necessary’ for example by means such as the application of a potential difference across the membrane.
Some applications may use measurement of electrical properties across the membranes, for example ion current flow. To provide for such measurements, the support may further comprise respective electrodes in each compartment making electrical contact with the volumes comprising polar medium. Other types of measurements may be carried out for example optical measurements such as fluorescence measurements and FET measurements. Optical measurements and electrical measurements may be carried out simultaneously (Heron AJ et al., J Am Chem Soc. 2009;131(5):1652-3).
In the case that the apparatus comprises respective electrodes in each compartment, the pretreatment, where used, preferably docs not cover the electrode surface and is localised elsewhere on the support.
The apparatus may further comprise a common electrode arranged so that the common electrode makes electrical contact with the layer comprising polar medium, when disposed extending across the support over the openings.
The apparatus may’ further comprise an electrical circuit connected between the common electrode and the respective electrodes in each compartment, the electrical circuit being arranged to take electrical measurements. Such electrical measurements may be dependent on a process occurring at or through the membranes comprising amphipathic molecules.
In the embodiment of forming an array of membranes whereby an emulsion of volumes comprising polar medium in an apolar medium is formed and flowed over the support, a stable emulsion is required in order to prevent the volumes of polar medium from merging with each other. Merging of volumes gives rise to larger volumes which may be unable to be accommodated in a compartment and which also gives rise to an increased range of sizes of volumes. Droplet merging
CA 02829440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 may be prevented or minimised by adding amphiphilic molecules to the apolar medium or polar medium prior to forming the emulsion such that a volume of polar medium is effectively coated with a layer of amphiphilic molecules. However this can in some circumstances give rise to an increased electrical resistance between the electrode and the volume of polar medium due the electrode being coated with amphiphilic molecules. In an alternative embodiment of forming an array of membranes w'hereby the individual volumes of polar medium are provided in the respective compartments prior to the addition of amphiphilic molecules, the volumes of polar medium arc able to directly contact the electrode surfaces.
The support may have a variety of advantageous constructions.
The support may comprise a base and partitions extending from the base that define the compartments and constrain the volumes comprising polar medium from contacting volumes comprising polar medium in neighbouring compartments.
In a first possible type of construction of the support, the partitions comprise inner portions and outer portions, the inner portions defining inner recesses of the compartments without gaps therebetween, the volumes comprising polar medium being disposed within the inner recesses of the respective compartments, and the outer portions extending outwardly from the inner portions defining outer portions of the compartments and in which gaps allowing the flow of apolar medium between the compartments are formed. Effectively, the the gaps in the partitions extend partway to the base. This construction has advantages of providing reliable and controlled foimation of the membranes.
Where the apparatus comprises respective electrodes provided in each compartment, the electrodes may be provided at the base.
The volumes comprising polar medium may fill the inner recesses. The gaps between the outer portions assist in filling of the inner recesses. A meniscus may therefore form across the inner recess. Particular advantage is achieved in the case that polar medium is disposed in respective compartments by flowing polar medium across the support, and excess polar medium is displaced by a displacing fluid, which may be a gas or may be the apolar medium flowed across the substrate to form the layer. In this case, the gaps between the outer portions assist in permitting flow of the displacing fluid across the substrate, so that the apolar medium fills the inner recesses.
The gaps between the outer portions assist the formation of membranes by allowing the displacement of apolar medium betw een the compartments when the polar medium is brought into contact with the polar medium in the recesses.
The inner recesses and the outer portions of the partitions may have dimensions selected for the volumes comprising polar medium to form a meniscus across the inner recess and the layer comprising polar medium may form meniscuses across the outer portions. Those meniscuses extend towards each other to an extent that brings the layer comprising polar medium in contact with the volumes comprising polar medium. Thus the geometry controls the formation of the membranes providing reliability in the formation This also allows control of the size and stability of the
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 membranes comprising amphipathic molecules.
The outer portions arc set back from the edges of the inner recesses as viewed from the openings. Although not essential, this assists the functions described above of assisting in the filling of the inner recesses by polar medium and in the layer comprising polar medium forming meniscuses across the outer portions.
The outer portions may be pillars extending from the inner portion.
The support may be designed as follows to facilitate formation of the membranes comprising amphipathic molecules.
Advantageously, the outer ends of the partitions may extend in a common plane. This improves the adhesion of the layer comprising polar medium to the support and therefore improves the stability' of formation of the membranes comprising amphipathic molecules.
The edges of the outer ends of the partitions provide pinning of the layer comprising polar medium to the support. Advantageously, to assist such pinning, the partitions may be designed so that the total length per compartment of the edges of the outer ends of the partitions in the common plane is greater than the largest circumference of the largest notional sphere that can be accommodated within the compartments.
The inner recesses and/or outer portions may have surfaces having a patterning that is arranged to retain apolar medium, for example a plurality of indentations that extend outw ardly of the compartments, or in general any microfabricated surface features. The retention of apolar medium may advantageously be used to change the surface properties of the substrate, for example to control the formation of membranes in an application where they are formed.
Apolar medium provided retained by the patterning may serve to change the contact angle between tire volumes of polar medium and the support. This can in some embodiments increase the phobicity of the support to the polar medium and provide volumes of polar medium having a more convex outer surface. This may subsequently result in a smaller membrane formed at the interface between tire volume of polar medium and the layer of polar medium. The base of the compartments typically do not have microfabricated surface features, such that any' pretreatment of apolar medium added to the apparatus is localised and retained at the partitions. As such contact between the respective electrodes in the base of each compartment, if present, and the pretreatment, if present, is minimised.
According to a second aspect of the present invention, there is provided an apparatus for forming an array of volumes comprising polar medium, the apparatus comprising a support that comprises partitions which comprise inner portions and outer portions, the inner portions defining inner recesses without gaps therebetween that are capable of constraining volumes comprising polar medium that may be contained in neighbouring inner recesses from contacting each other, and the outer portions extending outwardly from the inner portions and having gaps allowing the flow of an apolar medium across the substrate.
CA 02829440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
An apparatus in accordance with the second aspect of the present invention may be used as the apparatus in the first aspect of the present invention.
In a second possible type of construction of the support, the partitions may have gaps extending to the base allowing the flow’ of apolar medium between the compartments. This facilitates filling of the compartments with the volumes comprising polar medium because the gaps allow for displacement of the apolar medium that may enter the compartments beforehand
In a third possible type of construction of the support, the partitions may have no gaps allowing the flow of apolar medium betw een the compartments. This type of construction has the advantage of maximising the electrical isolation of the compartments.
According to a third aspect of the present invention, there is provided an apparatus for holding volumes comprising polar medium comprising:
a support comprising a base and partitions that extend from the base and define an array of compartments containing an apolar medium; and at least some of the compartments also containing volumes comprising polar medium within the apolar medium that are constrained by the partitions from contacting volumes comprising polar medium in neighbouring compartments.
The apparatus according to the second and third aspects of the invention may be used as a droplet array in a wide range of biological, pharmaceutical or industrial applications, as discussed above.
An apparatus in accordance with the third aspect of the present invention may be used as the apparatus in the first aspect of the present invention, or in a fourth aspect of the invention, according to which, there is provided a method of forming an array of volumes comprising polar medium, the method comprising:
providing a support comprising a base and partitions extending from the base and defining an array of compartments; and disposing an apolar medium in the compartments and volumes comprising polar medium w ithin the apolar medium in at least some of the compartments so that the volumes comprising polar medium in respective compartments are constrained by the partitions from contacting volumes comprising polar medium in neighbouring compartments.
Such a support provides a convenient and effective way to hold an array of volumes comprising polar medium within the apolar medium. The partitions constrain the volumes comprising polar medium in respective compartments from contacting volumes comprising polar medium in neighbouring compartments, thereby allowing volumes, which may be individual volumes, of polar medium to be used independently, facilitating a range of array-based applications. Such an apparatus may be made to accommodate volumes of any selected size. Typically, the volumes comprising polar medium might have an average diameter in the range from 5gm to 500pm, or an average volume in the range from 0.4pL to 400nL.
CA 02889440 2015-04-24
WO 2014/064443
PCT/GB2013/052766
The support is easy to fill with the volumes comprising the polar medium. In one possible technique, the volumes comprising polar medium may be disposed within the compartments by forming an emulsion of the volumes comprising polar medium in an apolar medium and flowing the emulsion over the support. This allows the compartments to be filled in a straightforward manner. Typically, the emulsion contains more volumes comprising polar medium than the number of compartments. The excess of volumes comprising polar medium assists in filling a reasonably large proportion of the compartments. Accordingly, to remove the excess volumes comprising polar medium, the support may be washed with the apolar medium. This washing may be performed leaving volumes comprising polar medium inside compartments.
In another technique, volumes comprising polar medium may be dispensed directly into individual compartments, for example by acoustic droplet injection. With this technique, the dispensing may be controlled such that the correct number of volumes comprising the polar medium are dispensed without the need to remove excess volumes.
The support may be used to form membranes comprising amphipathic molecules between the volumes comprising polar medium and a layer comprising polar medium. That is, a layer comprising polar medium may be disposed extending across the support over the openings of the compartments and in contact via the amphipathic membrane with at least some of the volumes comprising polar medium. The membranes comprising amphipathic molecules are formed at the interfaces between the layer comprising polar medium and the volumes comprising polar medium.
In an embodiment, the amphipathic molecules may be provided in the volumes comprising polar medium and/or the apolar medium in order to provide a layer comprising amphipathic molecules around the volumes comprising polar medium disposed within the compartments prior to provision of the layer comprising polar medium.
If for example the volumes comprising the polar medium arc provided in the form of liquid droplets in the apolar medium, the presence of a layer of amphipathic molecules around the volumes reduces the tendency of the volumes to merge with each other. Thus it is preferable that the amphipathic molecules are added to either the apolar medium or the volumes comprising the polar medium before formation of the droplets in the apolar medium. If the individual droplets do not contact each other prior to being introduced into the compartments, the droplets of polar medium may be provided in the apolar medium in the absence of amphipathic molecules. In this latter case, the amphipathic molecules may be subsequently added, for example in the layer comprising polar medium, in order to provide a layer of amphipathic molecules around the volumes comprising the polar medium provided within the apolar medium.
The membranes comprising amphipathic molecules may be used for a range of applications such as detection of an analyte at the membrane interface, determination of a property’ of the membrane interface, or passage of an analyte across one or more membrane interfaces In some applications, the membranes may be used to analyse a sample comprising an analyte, for example a
CA 02889440 2015-04-24
WO 2014/064443
PCT/GB2013/052766 biological sample.
In one type of application, there may be used membrane proteins, such as ion channels or pores that are inserted into the membranes comprising amphipathic molecules. The membrane proteins may initially be contained in the volumes comprising polar medium or in the layer comprising polar medium. Alternatively the membrane proteins may be provided in the apolar medium. This causes the membrane proteins to spontaneously insert, after formation of membranes comprising amphipathic molecules.
Some applications may use measurement of electrical properties across the membranes, for example ion current flow. To provide for such measurements, the support may further comprise respective electrodes in each compartment making electrical contact with the volumes comprising polar medium. Other types of measurements may be carried out for example optical measurements such as fluorescence measurements and FET measurements. Optical measurements and electrical measurements may be carried out simultaneously (Heron AJ et al., J Am Chem Soc. 2009:131(5):1652-3).
A compartment may contain a single volume of polar medium. Alternatively, a compartment may comprise more than one volume of polar medium, for example two volumes. The volumes comprising polar medium may be provided one on top of the other. The membranes comprising amphipathic molecules may be formed at the interfaces betw een a layer comprising polar medium and the volumes comprising polar medium. Membranes proteins may be provided at the interface between the volumes comprising polar medium to provide an ion or analyte transport pathway between the electrode and the hydrophilic layer.
The compartments of the array may be arranged in various ways, for example in a square packed, rectangular packed or hexagonal packed arrangement.
The apparatus may further comprise a common electrode arranged so that the common electrode makes electrical contact with the layer comprising polar medium, when disposed extending across the support over the openings.
The apparatus may further comprise an electrical circuit connected between tire common electrode and the respective electrodes in each compartment, the electrical circuit being arranged to take electrical measurements. Such electrical measurements may be dependent on a process occurring at or through the membranes comprising amphipathic molecules.
The support may have a variety of advantageous constructions.
In a first possible type of construction, the partitions may have gaps allowing the flow of apolar medium betw een the compartments. This facilitates filling of the compartments with the volumes comprising polar medium because the gaps allow for displacement of the apolar medium that may enter the compartments beforehand.
In a construction having gaps, a first possibility’ is for the gaps to extend to the base. This construction has the advantage that the flow of apolar medium may occur between the compartments.
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
In a construction having gaps, a second possibility is for the gaps to extend partway to the base. For example, the support may have a construction in which the partitions comprise inner portions defining the inner portions of the compartments without gaps therebetween and outer portions that extend outwardly from the inner portion defining the inner portions of the compartments and in which said gaps are formed. This construction has the advantage that the electrical isolation of the compartments is improved whilst still permitting the flow of apolar medium between the compartments.
In a second possible type of construction, the partitions may have no gaps allowing the flow of apolar medium between the compartments. This type of construction has the advantage of maximising the electrical isolation of the compartments.
In this second possible type of construction, the partitions may have a profile as viewed across the support that comprises, around individual compartments, one or more salient portions which serve to reduce the contact between a volume of polar medium and the inner partition surface. This reduction in the contact surface area reduces the surface tension between the volume of polar medium and the inner partition surface and enables the volume to move w ithin a compartment more easily and for example move to the base of the compartment in order to contact the electrode surface. The dimensions and number of salient portions provided around the surface of an inner partition of a compartment may vary. The reduction in contact between the droplet and the inner partitions surface enables a larger droplet to be incorporated than would have otherw ise been possible in the absence of such salient portions.
The partitions may comprise one or more re-entrant portions providing channels allowing outflow of apolar medium displaced by entry of a volume of polar medium into the compartment. Such a profile is advantageous in filling of the compartments with the volumes comprising polar medium because the re-entrant portions allow for displacement of the apolar medium that may enter the compartments beforehand. The dimensions of a channel may vary'. The apolar medium is more easily displaced through channels having a greater cross-sectional area. The partitions may comprise both one or more salient portions and one or more re-entrant portions. The dimensions of tire one or more re-entrant portions may also determine the extent of surface contact between a volume of the polar medium and the inner partition surface.
The support may be designed as follows to facilitate formation of the membranes comprising amphipathic molecules.
Advantageously, the outer ends of the partitions may extend in a common plane. This improves the adhesion of the layer comprising polar medium to the support and therefore improves the stability of formation of the membranes comprising amphipathic molecules.
The edges of the outer ends of fee partitions provide pinning of fee layer comprising polar medium to the support. Advantageously, to assist such pinning, the partitions may be designed so that fee total length per compartment of fee edges of the outer ends of fee partitions in fee common plane
CA 02899440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 is greater than the largest circumference of the largest notional sphere that can be accommodated within the compartments.
The dimensions of the openings of the compartments may be selected so that when the layer comprising polar medium is provided extending across the support over the openings, the layer comprising polar medium forms a meniscus extending into the compartment to an extent that brings the layer comprising polar medium in contact with at least some of the volumes comprising polar medium. This allows control of the size and stability of the membranes comprising amphipathic molecules. In the construction where the gaps extend partway down the base defining inner and outer portions, the arrangement and dimensions of the outer portions will determine whether the meniscus is pinned at the outer portions or the inner portions.
The following comments about the polar and apolar media apply to all the aspects of the present invention.
The polar medium may be a hydrophilic medium. The apolar medium may be a hydrophobic medium. In a particular embodiment, a single volume of polar medium is provided in a compartment.
The volumes comprising polar medium are typically volumes comprising an aqueous medium, for example an aqueous buffer solution.
The polar medium of respective volumes provided in the compartments may be the same or different. The volumes may each comprise different substances or differing concentrations of the same substance. For example, the volumes comprising polar medium may contain varying amounts of a substance A and the polar layer may comprise a substance B wherein a detectable interaction or reaction may occur between A and B. In this way substance B may pass through the ion-channels into the respective volumes comprising the polar medium. By detecting the individual interactions or reactions, for example a fluorescent signal, a multitude of ion channel experiments may be carried our simultaneously for example to determine an optimal reaction or interaction between B and A.
The layer comprising polar medium may typically comprise an aqueous medium, for example an aqueous buffer solution.
The polar medium of the layer may be the same or different polar medium as the respective volumes provided in the compartments. They may comprise different substances or differing concentrations of the same substance.
Embodiments of the present invention will now be described by way of non-limitative example with reference to the accompanying drawings, in which:
Fig. 1 is an image in plan view of an apparatus holding an array of volumes of polar medium;
Fig. 2 is a partial plan view of the support of the apparatus of Fig. 1 ;
Fig. 3 is a cross-sectional side view of a single compartment of the support taken along line III-ΠΙ in Fig. 2;
Fig. 4 is an isometric projection of an alternative pattern for pillars of the partitions defining compartments:
CA 02899440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
Fig. 5 is a plan view of the pillars in the pattern of Fig. 4;
Figs. 6 and 7 arc isometric projections of further alternative patterns for the pillars;
Figs. 8 and 9 are plan views of further alternative patterns for the pillars;
Fig. 10 is an isometric projection of an alternative pattern for pillars of the partitions defining compartments;
Fig. 11 is a plan view of the pillars in the partem of Fig. 10;Fig. 12 is an isometric projection of a first alternative construction for the partitions;
Fig. 13 is a plan view of the partitions of Fig. 12; Fig. 14 is a cross-sectional side of a single compartment of a support of the apparatus in which tlie partitions have a second alternative construction.
Fig. 15 is an isometric projection of the second alternative construction for the partitions;
Fig. 16 is apian view of ihe partitions of Fig. 15;
Fig. 17 is an isometric projection of a modified construction for the partitions;
Fig. 18 is a plan view of the partitions of Fig. 17;
Fig. 19 is an isometric projection of a modified construction for the partitions;
Fig. 20 is a plan view of the partitions of Fig. 19;
Fig. 21 is an isometric projection of a modified construction for the partitions;
Fig. 22 is a plan view of the partitions of Fig. 21 ;
Fig. 23 is an isometric projection of a modified construction for the partitions;
Fig. 24 is a plan view of the partitions of Fig. 23;
Fig. 25 is an isometric projection of a modified construction for the partitions;
Fig. 26 is a plan view of the partitions of Fig. 25;
Fig. 27 is a diagram of a flow cell assembly incorporating an array;
Fig. 28 is an image of droplets of aqueous solution made by a microfluidic flow junction;
Fig. 29 is a schematic cross-sectional view of an apparatus containing a bead protruding out of a compartment;
Fig. 30 is a schematic cross-sectional view of an apparatus containing plural volumes of hydrophilic medium;
Fig. 31 is a cross-sectional view of part of the apparatus provided with a layer of polar medium;
Fig. 32 is a set of schematic side views of a compartment in successive steps of a method;
Fig. 33 is a set of schematic side views of a compartment in successive steps of a method;
Fig. 34 is a schematic side view of a compartment having a pre-treatment apolar medium applied;
Fig. 35 is a side view of a compartment at the start point of a computer simulation;.
Figs. 36 (A) and (B) arc side views of a compartment during the computer simulation; Fig. 36C is a confocal image of a compartment in which an inner recess is filled with a
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 volume of polar medium; Fig. 37 arc side views of compartments of different size during a computer simulation; Fig. 38 is a set of images of a support in the construction of Fig. 21 in which inner recesses are filled with volumes of polar medium;
Fig. 39 are images of a support in the construction of Fig. 19 in which inner recesses are filled with volumes of polar medium:
Figs. 40 (A) and (B) arc images of a support in the construction of Fig. 19 after formation of an array of membranes, and
Fig. 40(C) is a schematic side view of a compartment having a formed membrane.
Fig. 41 is agraph of current against time showing electrical data obtained for measurement of ion current flow through an MspA nanopore;
Fig. 42 is a diagram of an electrical circuit of the apparatus;
Fig. 43 is agraph of lifetime against size for various volumes of polar medium;
Figs. 44(a) to (c) are schematic side views of a droplets of different size in a compartment; Figs 45 and 46 are schematic cross-sectional views of the apparatus of the type shown in Figs 15 and 16;
Fig. 47 is a side view of a meniscus formed across the opening of a compartment;
Fig. 48 shows current traces as a function of time in ms showing helicase-controlled DNA movement through an MspA-(B2C) nanoporc which is inserted in tri-block co-polymcr under an applied potential of 180 mV, wherein A and B show examples of two helicase-controlled DNA translocations through MspA nanopores.
Fig. 49 shows a current trace showing characteristic block levels corresponding to the presence (block labelled 2) and absence (block labelled 1) of thrombin;
Fig. 50 shows a Brightfield image of a chip which has been exposed to MspA-(B2C) (SEQ ID NO: 1) nanopores; and
Fig. 51 shows an Brightfield image of chip which has not been exposed to MspA-(B2C) (SEQ ID NO: 1) nanopores.
The specification refers to various sequences as follows.
SEQ ID NO: 1 shows the amino-acid sequence of MspA-(B2C). The amino-acid sequence of MspA-(B2C) is a variant of SEQ ID NO: 2 with the following mutations G75S/G77S/L88N/Q126R.
SEQ ID NO: 2 shows the amino acid sequence of the mature form of the MS-B1 mutant of the MspA monomer. This mutant lacks the signal sequence and includes the following mutations: D90N, D91N, D93N, D118R, D134Rand E139K.
SEQ ID NO: 3 shows one of the polynucleotide sequences used in Example 5. It is connected at its 3’ end to the 5’ end of SEQ ID NO: 4 via four spacer units.
SEQ ID NO: 4 shows one of the poljnuclcotidc sequences used in Example 5. It is connected al its 5’ end lo the 3' end of SEQ ID NO: 3 via four spacer units.
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
SEQ ID NO: 5 shows the polynucleotide sequence encoding one subunit of a-hemolysinE111N/K147N (a-HL-NN; (Stoddart, D. S., et al, (2009), Proceedings of the National Academy of Sciences of the United States of America 106, p7702-7707).
SEQ ID NO: 6 shows the amino acid sequence of one subunit of a -HL-NN.
SEQ ID NO: 7, shown below, is the polynucleotide sequence of an aptamer, where X is an abasic site. XXXXXXXXXXXXXXXXXXXXXXXAAAAAAAGGTTGGTGTGGTTGG This sequence docs not comply with WIPO ST.25 and so has not been included in the sequence listing.
SEQ ID NO: 8 shows the polynucleotide sequence of a strand of DNA . The strand has a BHQ1 label attached to the thymine at position 1 in the sequence and a FAM label attached to the thymine at position 15 in the sequence.
SEQ ID NO: 9 shows the polynucleotide sequence encoding the MspA-(B2C) mutant MspA monomer. The amino-acid sequence of MspA-(B2C) is a variant of SEQ ID NO: 2 with the following mutations G75S/G77S/L88N/Q126R.
SEQ ID NO: 10 shows the polynucleotide sequence encoding the MS-B1 mutant of the MspA monomer. This mutant includes the following mutations: D90N, D91N, D93N, DI 18R, D134R and E139K.
Fig. 1 shows an apparatus 1 holding an array of volumes 2 of a polar medium in apolar medium. The apparatus 1 comprises a support 3 providing an array of compartments 4. In use, all the compartments 4 contain apolar medium. At least some of the compartments 4 (in this example most of the compartments 4) contain single volumes 2 of a polar medium in the apolar medium.
The construction of the support 3 is shown in more detail in Figs. 2 and 3. The support 3 comprises a base 5 and partitions 6 that extend from the base 5. The partitions 6 comprise plural pillars 7 that extend out from the base 5 as shown in Fig. 3, in this example perpendicularly. The compartments 4 have openings provided at the distal ends of the pillars 7. These openings provide communication from the compartments 4 into the space adjacent the support 3, and volumes of polar medium may be introduced into the compartments 4 through the openings.
The pillars 7 may have different shapes as shown in Fig. 2 so that they define the compartments 4 in a regular square array. The pillars 7 are shaped so that they constrain the volumes 2 of polar medium in the compartments 4 from contacting volumes 2 comprising polar medium in neighbouring compartments. In this example, the pillars 7 include a cross-shaped pillar 7a in the comers of compartments 4 with arms protruding into the compartment 4 and further pillars 7b along the each side of the compartment 4, with gaps 8 between the cross-shaped pillars 7a and the further pillars 7b. The compartments 4 are arranged such that the volumes 2 of polar medium are physicallyseparated from each other. This prevents the volumes 2 of polar medium from merging or contacting each other to form interfaces. This provides a very stable array of volumes 2 of polar medium which is capable of being stored over a long period of time. Herein, the terms inner” and outer” describe relative locations within the compartments 4 from the openings at the outer end towards the base 5 at the inner end.
The pillars 7 have gaps 8 therebetween. In this example, the gaps 8 extend the entire distance from the openings to the base 5. The gaps 8 are of sufficient size to allow the flow of an apolar medium between the compartments 4, whilst maintaining the separation of the volumes 2 of polar medium in the compartments 4. The provision of gaps 8 allows the apolar medium to flow between the compartments 4. This greatly aids in filling of the compartments 4 as apolar medium may be displaced by a volume 2 of polar medium entering a compartment 4 through an opening. The gaps 8 also allow the level of apolar medium in the support 3 to be controlled and equalised across the array. The gaps 8 between the pillars 7 are such that the volumes 2 of polar medium are constrained from moving through the gaps 8 between the compartments 4 or from contacting volumes 2 comprising polar medium in neighbouring compartments.
Optionally, a dam 10 may be provided around the perimeter of the support 3 which aids in filling the peripheral edges of the support 3 with apolar medium. One or more channels 11 may be provided in the dam 10 through which apolar medium may be introduced or drained from the support 3.
The support 3 may be prepared from a range of different materials having a high electrical resistance, including without limitation undoped crystalline silicon (i.e a silicon wafer), SU8, polycarbonate, and/or polyester, and including any combination of these or other materials. The support 3 may be manufactured using conventional techniques for such materials, including, without limitation, deposition and removal techniques for example etching or laser processing.
As shown in Fig. 3, the base 5 comprises a substrate 12. The substrate 12 supports an electrode 13 in each compartment 4. In this example, the electrodes 13 are shown recessed into the substrate 12, but they could alternatively be deposited as an outer layer on an exposed surface of the substrate 12. The electrodes 13 are provided to make electrical contact with the volumes 2 of polar medium contained in the compartments 4 and are discussed in more detail below.
The substrate 12 may comprise a surface coating 14 that is optional. The surface coating 14 may provide a high resistance outer layer. One possible combination of materials for the base 5 is that the base is made of undoped crystalline silicon (i .e. a silicon wafer) and the coating 14 to be made of SU8. In the example shown in Fig. 2, the surface coating 14 is provided on top of the substrate 12 and so has apertures 15 aligned with the electrodes 13 to allow electrical contact between the electrodes 13 and the volumes 2 of polar medium. As an alternative the electrodes 12 could be patterned in the same layer as the surface coating 14 or on top of the surface coating 14.
The partitions 6 may be made of the same or different material to the base 12 of the support 3 and may have the same or different surface properties. The partitions 6 are typically apolar and may be made for example from Permex™. The partitions 6 may optionally comprise a surface coating (not shown) to modify their electrical and/or physical properties.
The particular shapes and arrangement of the pillars 7 shown in Fig. 2 is not essential and the □ate Reçue/Date Received 2020-05-28
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 pillars 7 may have a variety of different shapes to define the compartments 4 so as to constrain the volumes 2 of polar medium in the compartments 4 from contacting volumes 2 comprising polar medium in neighbouring compartments. By way of example, Figs. 4 to 8 show some examples of alternative shapes and arrangements for the pillars 7, as follows.
Figs. 4 and 5 show a support 3 wherein the partitions 6 comprise pillars 7 including crossshaped pillars 7a and further pillars 7b in a similar arrangement to Fig. 2. Thus the pillars 7 are combined w ith short and long pitches to prevent merging of the volumes 2 of polar medium and improve pillar stability.
Figs. 6 to 9 show other supports 3 in which the pillars 7 have modified shapes and patterns. In each case, pillars 7 have gaps 8 that extend the entire distance from the openings to the base 5. The pillars 7 are arranged in a pattern that defines compartments 4 in regions of the support 3 where the pillars 7 are widely spaced from each other. The gaps 8 between the pillars 7 are such that the volumes 2 of polar medium are constrained from moving between the compartments 4 or from contacting volumes 2 comprising polar medium in neighbouring compartments.ln Fig.6, the partitions 6 comprise an array of circular pillars 7d .
In Fig. 7 the partitions 6 comprise an array of tri-star pillars 7g. The tri-star pillars 7g have three aims with curved re-entrant sides and enlarged ends. The tri-star pillars 7g define a plurality of compartments 4, with three tri-star pillars 7g equi-spaced around each compartment. In Figs. 8 and 9, the partitions 6 comprise an array of cross-shaped pillars 7h and T-shapcd pillars 7i, respectively, defining a plurality of compartments 4. The cross-shaped pillars 7g and T-shaped pillars 7h have reentrant sides.
In these examples of Figs. 7 to 9, the number of pillars 7 that are required to provide a compartment 4 is less than for example the arrangement of Figs. 2 or 6. The provision of a reduced number of pillars 7 makes fabrication of the array easier and increases the mechanical resilience of the individual pillars
It has also been found that the circular pillars as shown in Fig. 6 are mechanically less resilient and are more prone to collapse, or distortion than the more structurally resilient pillars of for example Fig. 4 or Figs. 7 to 9, especially for pillars 7 of heights of the order of lOOpm and pillar widths of the order of 25pm. Pillars 7 having a higher width:height ratio are therefore preferred.
Figs. 11 and 12 show a support 3 wherein the partitions 6 comprise pillars 7 including crossshaped pillars 7a and further pillars 7b having the same overall arrangement as Fig. 4 except for a modification that the surfaces 62 of the cross-shaped pillars 7a and further pillars 7b are micro-patterned with a patterning as follow s. In particular, those surfaces 62 are indented with a plurality of indentations 63 that extend outwardly of the compartment 4, along the entire length of the cross-shaped pillars 7a and further pillars 7b. In this example, the indentations 63 are rectangular in cross-section.
The surfaces 62 between the indentations 63 lie in a common curved plane extending around
CA 02889440 2015-04-24
WO 2014/064443
PCT/GB2013/052766 the compartment 4. These surfaces 62 physically constrain a volume 2 of polar medium inside the compartment 4. Thus, the dimensions of the surfaces 62 control the size of the volume 2 of polar medium that may be accommodated in the compartment 4.
The indentations 63 hold apolar medium that reduces the surface area of the partitions 6 that is in contact with a volume 2 of polar medium. This modifies the surface properties of the pillars 7, repel ling polar medium and therefore assisting in constraining a volume 2 of polar medium held in the compartment 4, and in allowing entry of the polar medium into the compartment. In general, the patterning could comprise other surfaces features to achieve this effect.
The indentations 63 and surfaces 62 have widths that are small compared to the size of the volume of volume 2 of polar medium held in the compartment 4. The indentations 63 and surfaces 62 have widths preferably of at most 20pm, more preferably of at most ΙΟμτη. For example, if the dimensions of a compartment 4 are characterised with reference to the diameter d of the largest notional sphere that can be accommodated within the compartment 4, then the indentations 63 and surfaces 62 have widths that are at most 0. Id, preferably at most 0 05d. In a typical example where the diameter d is 140pm, the indentations 63 and surfaces 62 have widths that are 5pm.
The depth of the indentations 63 is chosen to allow the channels to retain the apolar medium. In the example of Figs 11 and 12, the channels have a depth of 5pm, providing an aspect ratio of 1:1. However, deeper indentations 63 provide more effective retention of apolar medium.
In all the constructions shown in the figures, the pillars 7 have the same height so that the outer ends 9 of the pillars 7 extend in a common plane, as shown in Fig. 3, to provide the support 3 with a brush-like planar upper surface. Whi 1st the provision of pillars having the same height is a preferred construction, constructions may be provided having pillars of differing heights.
There will now be described some alternative constructions for the partitions 6 in which the partitions 6 do not have pillars 7 and gaps 8 extending the entire distance to the base 5. In general, reducing the depth of any gaps in the partitions can increase the electrical isolation between compartments 4 and reduce the tendency for offset currents between the electrodes 13 of different compartments 4, for example if the apolar medium becomes hydrated sufficiently to provide an electrical conductivity path between electrodes 13. Apart from the alternative constructions of the partitions 6, supports 2 otherwise have the same construction as described above.
A first alternative construction for the partitions is shown in Figs. 12 and 13 and arranged as follow s. In the first alternative construction, the partitions 6 have no gaps allowing the flow' of apolar medium between the compartments 4. In particular, the partitions 6 have recesses 30 that define the compartments 4 without gaps between those compartments 4. The partitions 6 may be formed by a common body 31 extending from the base 5. In that case, the base 5 has planar surfaces forming the inner ends of the compartments 4. The common body 31 may be formed as a separate layer laminated with the base 5, but alternatively may be integral with the base 5 and the recesses 30 formed by removing material.
CA 02889440 2015-04-24
WO 2014/064443
PCT/GB2013/052766
In this example, the partitions 6 have a profile as viewed across the support 3 that is the same as the profile of the inner portion 20 of the partitions in the second alternative construction. That is, the profile is undulating and comprises, around individual compartments 4, plural salient portions 32 that protrude into the compartment 4 and plural re-entrant portions 33 where the compartment 4 protrudes into the partitions 6.
The salient portions 32 are arranged physically to constrain a volume 2 of polar medium inside the compartment 4. Thus, the dimensions of the salient portions 32 control the size of the volume 2 of polar medium that may be accommodated in the compartment 4.
The re-entrant portions 33 provide channels that extend outside a volume 2 of polar medium accommodated in the compartment 4. Therefore, the re-entrant portions 33 allow outflow of apolar medium displaced by entry of a volume 2 of polar medium into the compartment 4.
This undulating structure also reduces the surface area of the partitions 6 that is in contact with a volume 2 of polar medium. This serves to allow the a volume 2 of polar medium to move to the base of the compartment 4 and thereby assist in making electrical contact with the electrode 13.
In principle, any number of re-entrant portions 33 could in principle be provided such as 3,4, 5. 6 etc. However one w ould need to balance the number of salient portions 32 with the contact surface for the volume 2 of polar medium.
The salient portions 32 as shown in Fig 12 have rounded edges. Alternatively the salient portions 32 may have sharp edges. Such sharp edges may reduce further the extent of contact between the edge of the compartment 4 and the volume 2 of polar medium. Conversely, sharp edges may puncture the layer of amphiphilic molecules. It is advantageous to reduce the extent of contact of the volume 2 of polar medium with the inner surface of the compartment 4. Having salient portions 32 enables larger volumes 2 of the polar medium to be used for a given volume of compartment 4.
As can be seen from Fig. 12, the dimensions and shape of the re-entrant portions 33 determines the surface area which is capable of being contacted by a volume 2 of polar medium. The salient portions 32 and re-entrant portions 33 are interrelated in that generally the greater the crosssectional width of the re-entrant portion 33, the greater the reduction in surface area of the walls of the compartment 4.
Thus, compared to the constructions described above, in the first alternative construction, the partitions 6 provide the same function of constraining the volumes 2 of polar medium and preventing them from contacting or merging, but the electrical isolation between compartments 4 is increased due to the absence of gaps in the partitions 6. The absence of gaps in the partitions 6 also reduces the beneficial effect of allowing flow of apolar medium between compartments 4, but this is to some extent mitigated when filling compartments 4 by the re-entrant portions 33 providing channels allowing outflow of displaced apolar medium which assists insertion of a volume 2 of polar medium. This allows for a volume 2 of polar medium of maximum size to be inserted, the movement of which is constrained by the salient portions 32.
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
The partitions 6 have the same height so that the outer ends 34 of the partitions 6 extend in a common plane, as shown in Fig. 12, to provide the support 3 with a brush-like planar upper surface.
There will now be described some alternative constructions for the partitions 6 in which the partitions 6 comprise inner portions defining inner recesses of the compartments without gaps therebetween, and outer portions extending outwardly from the inner portions defining outer portions of the compartments with gaps allowing the flow of apolar medium between the compartments. Thus, effectively the gaps extend partway to the base 5. Apart from the alternative constructions of the partitions 6, the follow ing supports 2 otherwise have the same construction as described above.
A second alternative construction for the partitions is shown in Figs. 14,15 and 16 and arranged as follows.
The apparatus 1 for holding an array of volumes 2 of a polar medium in apolar medium comprises a support 3 providing an array of compartments 4. In use, all the compartments 4 contain apolar medium, and at least some of the compartments 4 contain single volumes 2 of a polar medium in the apolar medium.
The support 3 comprises a base 5 and partitions 6 that extend from the base 5. Herein, the terms “inner” and “outer” describe relative locations within the compartments 4 from the openings at the outer end towards the base 5 at the inner end.
As described in more detail below’, the partitions 6 define compartments 4 having openings provided at the distal ends of the partitions 6. These openings provide communication from the compartments 4 into the space adjacent the support 3, and volumes of polar medium may be introduced into the compartments 4 through the openings. The compartments 4 are arranged such that the volumes 2 of polar medium are physically separated from each other. This prevents the volumes 2 of polar medium from merging or contacting each other to form interfaces. This provides a very stable array of volumes 2 of polar medium which is capable of being stored over a long period of time.
Optionally, a dam (taking the form shown in Fig. 1) may be provided around the perimeter of the support 3 which aids in filling the peripheral edges of the support 3 with apolar medium. One or more channels may be provided in the dam through which apolar medium may be introduced or drained from the support 3.
The support 3 may be prepared from a range of different materials having a high electrical resistance, including without limitation undoped crystalline silicon (i.e. a silicon wafer), SU8, polycarbonate, and/or polyester, and including any combination of these or other materials. The support 3 may be manufactured using conventional techniques for such materials, including, without limitation, deposition and removal techniques for example etching or laser processing.
The base 5 comprises a substrate 12. The substrate 12 supports an electrode 13 in each compartment 4. In this example, the electrodes 13 are shown recessed into the substrate 12. but they could alternatively be deposited as an outer layer on an exposed surface of the substrate 12. The electrodes 13 are provided to make electrical contact with the volumes 2 of polar medium contained
CA 02889640 2015-04-24
WO 2014/064443 PCT/GB2013/052766 in the compartments 4 and are discussed in more detail below.
The substrate 12 may optionally comprise a surface coating. The surface coating may provide a high resistance outer layer. One possible combination of materials for the base 5 is that the base 5 is made of undoped crystalline silicon (i.e. a silicon wafer) and the coating to be made of SU8. Such a surface coating may be provided on top of the substrate 12 with apertures aligned with the electrodes 13 to allow electrical contact between the electrodes 13 and the volumes 2 of polar medium. As an alternative, the electrodes 12 could be patterned in the same layer as the surface coating or on top of the surface coating.
The partitions 6 may be made of the same or different material to the base 12 of the support 3 and may have tlie same or different surface properties. The partitions 6 are typically apolar and may be made for example from Permex. The partitions 6 may optionally comprise a surface coating (not shown) to modify their electrical and/or physical properties.
Figs. 15 and 16 show a particular arrangement of the partitions 6, but this is is not essential and the partitions 6 may have a variety of different arrangements to define the compartments 4 so as to constrain the volumes 2 of polar medium in the compartments 4 from contacting volumes 2 comprising polar medium in neighbouring compartments.
In the arrangement of Figs. 15 and 16, the partitions 6 comprise inner portions 20 and outer portions 21.
The inner portions 20 of the partitions 6 define inner recesses 22 that form the inner portions of the compartments 4 without gaps between those inner portions of the compartments 4. The inner portions 20 of the partitions 6 may be formed by a common body extending from the base 5. In that case, the base 5 has planar surfaces forming the inner ends of the compartments 4. The inner portions 20 may be formed as a separate layer laminated with the base 5 after removal of material to form apertures that become the inner recesses 5. Alternatively the inner portions 20 may be integral with the base 5 and the recesses 22 formed by removing material of the integral member.
In this example, the inner portions 20 of the partitions 6 have a profile as viewed across the support 3 that is circular around individual compartments 4.
The outer portions 21 of the partitions 6 extend outwardly from the inner portions 20 and define the outer portions of the compartments 4 In this example, the outer portions 21 of the partitions 6 comprise plural pillars 23 that extend out from the inner portions 20 of the partitions 6 as shown in Fig. 15, in this example perpendicularly, with a similar pattern to the pillars 7 in the construction of the partitions 6 shown in Figs. 4 and 5. In particular, a cross-shaped pillar 23a in the comers of the compartments 4 with arms extending towards the compartment 4 and plural further pillars 23b along the each side of the compartment 4, with gaps 24 between the cross-shaped pillars 23a and the further pillars 23b, and between the further pillars 23b.
The pillars 23 have gaps 24 therebetween In this example, the gaps 24 extend to the inner portions 20 of the partitions and hence only partway to the base 5. The gaps 24 are of sufficient size to
CA 02889640 2015-04-24
WO 2014/064443 PCT/GB2013/052766 allow fee flow of an apolar medium betw een the compartments 4, whilst maintaining the separation of fee volumes 2 of polar medium in the compartments 4. The provision of gaps 24 allows the apolar medium to flow between fee compartments 4. This aids in filling of fee compartments 4 as apolar medium may be displaced by a volume 2 of polar medium entering a compartment 4. Further description of this is given below. The gaps 24 also allows the level of apolar medium in the support 3 to be controlled and equalised across the array. Thus, compared to the constructions described above, in fee second alternative construction, the partitions 4 provide the same function of constraining the volumes 2 of polar medium and preventing them from contacting or merging, and the gaps 24 provide fee same function to the gaps 8 of allowing flow of apolar medium between compartments 4. However, fee electrical isolation between compartments 4 is increased due to the absence of gaps in fee inner portions 20.
The pillars 23 are set back from the edges of the inner recesses 22 as viewed from the openings of those inner recesses 22. This creates a step on the upper surface of fee inner portions 20 of fee partitions 6 between any given pillar 23 and the adjacent inner recesses 22.
The pillars 23 have the same height so that the outer ends 25 of the pillars 24 extend in a common plane, as shown in Fig. 15, to provide the support 3 w ith a brush-like planar upper surface.
The relative hei ghts of fee inner portions 20 and outer portions 21 of the partitions 6 may be varied In one typical embodiment, the inner portions 20 have a height of 90um and a diameter of 170pm, and outer portions 21 have a height of 60pm.
In this example, fee inner portions of the partitions further comprise two re-entrant portions 28. As can be seen from Figs. 15 and 16, the dimensions of the re-entrant portions are relatively small compared to the inner surface of compartment 4.
A modified construction for the partitions is shown in Figs. 17 and 18. This is similar to the construction of Figs. 15 and 16 except for fee following modifications.
Firstly, the inner recesses 22 formed by the inner portions 20 of the partitions 6 have a profile as viewed from fee openings of fee compartments 4 across fee support 3 that is not circular. In particular, fee profile is undulating and comprises, around individual compartments 4, plural salient portions 26 that protrude into fee compartment 4 and plural re-entrant portions 27 where fee compartment 4 protrudes into fee partitions 6.
The salient portions 26 are arranged physically to constrain a volume 2 of polar medium inside the compartment 4. Thus, fee dimensions of the salient portions 26 control the size of the volume 2 of polar medium feat may be accommodated in fee compartment 4.
The re-entrant portions 27 provide channels that extend outside a volume 2 of polar medium accommodated in the compartment 4. Effectively therefore, the inner portions 20 of the partitions 6 have surfaces fear are indented wife a plurality of channels that extend outwardly of the inner recesses 22. Therefore, the re-entrant portions 27 allow outflow’ of apolar medium displaced by entry of a volume 2 of polar medium into the compartment 4.
CA 02889640 2015-04-24
WO 2014/064443 PCT/GB2013/052766
This undulating structure also reduces the surface area of the partitions 6 that is in contact with a volume 2 of polar medium. This serves to allow a volume 2 of polar medium to move to the base of the compartment 4 and thereby assist in making electrical contact with the electrode 13.
In principle, any number of re-entrant portions 27 could in principle be provided such as 3,4, 5, 6 etc However one would need to balance the number of salient portions 26 with the contact surface for the volume 2 of polar medium.
Secondly, the pillars 23 of the outer portions 21 of the partitions 6 have a different pattern. In particular, a cross-shaped pillar 23c in the comers of the compartments 4 with arms extending in a direction along the side of the compartment 4 and a pair of further pillars 23c along the each side of the compartment 4, with gaps 24 between the cross-shaped pillars 23c and the further pillars 23d, and between the further pillars 23d. This is enable the pillars 23 to fit on the inner portion 20, but the pillars 23 have the same function and effect.
The salient portions 26 as shown in Fig. 17 have rounded edges. Alternatively the salient portions 26 may have sharper edges. It is advantageous to reduce the extent of contact of the volume 2 of polar medium with the inner surface of the compartment 4. Having salient portions 26 enables larger volumes 2 of the polar medium to be used for a given volume of compartment 4.
As can be seen from Fig. 17, tire dimensions and shape of the re-entrant portions 27 determines the surface area which is capable of being contacted by a volume 2 of polar medium The salient portions 26 and re-entrant portions 27 arc interrelated in that generally the greater the crosssectional width of the re-entrant portion 27, the greater the reduction in surface area of the walls of the compartment 4.
Amodified construction for the partitions 6 is shown in Figs. 19 and 20. This is similar to the construction of Fig. 15 except for a modification that the surfaces 64 of the inner recesses 22 and die surfaces 66 of the pillars 23 have a patterning described further below’.
A yet further modified construction for the partitions 6 is shown in Figs. 21 and 22. This is the same as the construction of Fig. 19 except for the size of die patterning.
A yet further modified construction for the partitions 6 is shown in Figs. 23 and 24. This is the same as the construction of Fig. 15 except for a modification that the surfaces 64 of the inner recesses 22 (but not the surfaces 66 of the pillars 23) have a patterning as described below.
A yet further modified construction for the partitions 6 is shown in Figs. 25 and 26.
The patterning on the various surfaces of the compartments 4 show n in Figs. 19 to 26will now be described in more detail
In particular, the surfaces 64 of the inner recesses 22 are indented with a plurality of indentations 65 that extend outwardly of the inner recesses 22, and hence outwardly of the compartments 4, along the entire length of inner recesses 22. In this example, the indentations 65 arc rectangular in cross-section. Similarly, surfaces 66 of the pillars 23 are indented with a plurality of
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 indentations 67 that extend outwardly of the compartments 4 (except in the construction of Fig. 15). In this example, the indentations 67 arc rectangular in cross-section.
The surfaces 64 of each inner recesses 22 between the indentations 65 lie in a common curved plane extending around the inner recess 22. These surfaces 64 physically constrain a volume 2 of polar medium inside the inner recess 22. Thus, the dimensions of the surfaces 64 control the size of the volume 2 of polar medium that may be accommodated in the inner recess 22.
The indentations 65 hold polar medium that reduces the surface area of the partitions 6 that is in contact with a volume 2 of polar medium. This modifies the surface properties of the pillars 7, repelling polar medium and therefore assisting in constraining a volume 2 of polar medium held in the inner recess 22, and in allowing entry of tire polar medium into the inner recess 22. In general, the patterning could comprise other surfaces features to achieve this effect.
An initial prc-treatment of apolar medium 70 is applied as described below. The indentations 65 and 67 assist in spreading the pre-treatment of apolar medium 70 by wicking it over the substrate 3.
The pre-treatment of apolar medium 70 added to the partitions 6 is held within the indentations 65 by surface tension/capillarity which serves to increase the phobicity of the partitions 6 to the polar medium and therefore the contact angle betw een the volume 2 of polar medium and the partitions 6. This helps define the shape of the meniscus of the volume 2 of polar medium. Indentations 65 having a high capillarity arc preferred as they retain the apolar medium more effectively and prevent or hinder flow of apolar medium onto the surface of the electrode 12. Thus polar medium added subsequently to the compartments is able to directly contact the electrodes 13.
The indentations 65 and surfaces 64 have widths according to an embodiment preferably of at most 20pm, more preferably of at most 10pm. The indentations 65 and surfaces 64 have widths that is small compared to the size of the volume of volume 2 of polar medium held in the inner recess 22. For example, if the dimensions of the inner recess 22 are characterised with reference to the diameter d of the largest notional sphere that can be accommodated within the inner recess 22, then the indentations 65 and surfaces 64 have widths that are preferably at most O.ld. more preferably at most 0.05d. By way of example, where the inner recess 22 has a depth of 90pm, the outer portions 23 have a height of 30pm and the diameter d is 140pm, the indentations 65 and surfaces 64 may have widths that are 5 pm. Similarly, in the construction of Fig. 19, the indentations 65 and surfaces 64 have widths that arc 5pm.
The depth of the indentations 65 is chosen to allow the channels to retain the polar medium. By way of example, in the construction of Fig. 19, the indentations 65 have a depth of 5 pm, providing an aspect ratio of 1:1.
However, deeper indentations 65 provide more effective capture and retention of polar medium. By way of example, in the construction of Fig 25 and Fig. 21, the indentations 65 have a depth of 50pm, providing an aspect ratio of 10:1. This captures and retains oil more effectively within
CA 02889640 2015-04-24
WO 2014/064443 PCT/GB2013/052766 the channels due to higher capillarity. The available droplet diameter d is 100pm. An added benefit of the higher aspect wells is that they provide a smaller droplet diameter which in turn provides a smaller amphipathic membrane area.
The surfaces 66 of the pillars 23 between the indentations 67 lie in a common curved plane extending around the inner recess 22. The indentations 67 hold polar medium which repels the apolar medium. The pre-treatment of apolar medium 70 added to the partitions 6 is held within the indentations 65 by surface tcnsion/capillarity which serves to increase the phobicity of the partitions 6 to the polar medium and thereby assists in the filling of the inner recess 22.
The indentations 67 and surfaces 66 have widths preferably of at most 20pm, more preferably of at most 10pm. The indentations 67 and surfaces 66 have widths that is small compared to the size of the volume of volume 2 of polar medium held in the inner recess 22. For example, if the dimensions of the inner recess 22 are characterised with reference to the diameter d of the laigest notional sphere that can be accommodated within the inner recess 22, then the indentations 65 and surfaces 64 have widths that are preferably at most 0. Id. more preferably at most 0.05d. By way of example, where the inner recess 22 has a depth of 90pm, the outer portions 23 have a height of 30pm and the diameter d is 140pm, the indentations 65 and surfaces 64 may have widths that are 5pm. However, deeper indentations 67 provide more effective retention of polar medium, but it is difficult to provide higher aspect indentations 67 due to the limited space.
The following comments apply to the support 3 with any of the above-described constructions.
The support 3 may comprise any number of compartments 4. The support 3 may comprise, for example, number of compartments 4 in the range from 2 to 10<sup>6</sup>, but may typically be in the range from 100 to 100,000.
An individual compartment 4 has a notional cross-sectional area defined by the spacing between the partitions 6 and a notional volume defined by' the height of the partitions 6. The notional volume is typically the same for all compartments 4 of the array.
As in the examples above, the compartments 4 may have irregularly shaped peripheries as viewed across the support 3. Irrespective of the shape of the compartments 4, in the case where a compartment contains a single volume of the polar medium, the dimensions of a compartment 4 may be characterised with reference to the largest notional sphere that can be accommodated within the compartment 4. That is approximately the size of the largest volume 2 of polar medium that could be accommodated in the case that the volumes 2 of polar medium are spherical (which is not essential). Indeed, in the case where the volumes of polar medium are liquid, they can deform depending upon the dimensions of the compartment and the surface properties of the support. Such a size may typically be between 50pm and 500pm, more ty pically between 70pm and 200pm
The array will typically contain volumes 2 of polar medium of a substantially' similar size.
The dimensions of the compartment 4 may be chosen depending upon the size of the volumes
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 of polar medium to be contained. The volumes 2 of polar medium typically have an average diameter in the range from 5pm to 500pm or an average volume in the range from 0.4pL to 400nL. The density of the compartments 4 in the support 3 is therefore dependent upon the size of the volumes 2 of polar medium and the particular arrangement of the partitions 6.
In the above examples, the partitions 6 have a regularly repeating pattern so that the compartments 4 have the same size and shape across the support 3 and are arranged in a regular array. This is not essential. The partitions 6 and compartments 4 may have alternatively have differing shapes and/or sizes across the support 3 and/or the compartments 4 may be arranged in an irregular array
Tire nature of the polar medium of the volumes 2 of polar medium is as follow s.
The polar medium may be a hydrophilic medium. The hydrophilic medium may for example comprise an aqueous medium.
In one example, the polar medium of the volumes 2 is an aqueous buffer solution. The buffer solution may comprise a supporting electrolyte.
The array may be filled with an emulsion or filled with volumes of apolar and polar volumes by use of a flow-cell assembly such as shown in Fig. 27. In Fig. 27, an array 101 attached to an ASIC/PCB 105 is inserted into the array retainer 102. A protective gasket 107 is placed on the surface of the array and the array is affixed to the fluidic module 103 using screws 109. Fluid may be flowed over the surface of the array in order to fill the compartments. Valve rotor 110 may be rotated in order to fluidically seal the flow cell. Fluid enters the flow-cell from a fluid reservoir (not shown) and exits the flow cell, as shown by the arrows.
In an example where the volumes 2 are pre-formed before being disposed in the compartments, the volumes 2 may be droplets of an aqueous buffer solution. In that case, they may be made in conventional manner, for example using a microfluidic flow T-junction 40 as shown in Fig. 28 comprising a first flow channel 41 containing the polar medium and a second flow channel 42 comprising the apolar medium. The two flow channels 41 and 42 intersect at the T-junction spontaneously forming droplets 43 which flow downstream from the T-junction and may be collected in a vessel 44 as an emulsion of the droplets 43 in the apolar medium. The size of the droplets 43 is determined by the flow rates of the polar and apolar fluids as well as the width of the apertures of the respective flow channels 41 and 42. Fig. 28 also shows droplets 43 that have been formed by the Tj unction 40.
Droplets may be provided having different amounts of substances, by for example providing a third flow channel containing a different polar medium to the first flow channel which intersects with the first channel to form a common flow’ channel prior to intersecting at the T -junction. The flow rates of the third and first flow channels may be varied to provide droplets having vatying ratios of components.
In another example where the volumes 2 are pre-formed before being disposed in the
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 compartments, the volumes 2 of polar medium may be beads of an aqueous gel, such as an agarose gel. The gel may comprise an aqueous buffer solution as the liquid phase. The buffer solution may comprise a supporting electrolyte. Examples of such are non-crosslinked or crosslinked hydrogels such as agarose or sepharose. A bead may be formed in-situ from a droplet for example by cooling or crosslinking with UV. A bead introduced into the apolar medium may form a droplet, for example by melting. The volume of polar medium may be provided w ithin a porous plastic or glass bead.
Where the volumes 2 of polar medium arc beads of an aqueous gel, they may have sufficient rigidity to protrude out of the compartments. Fig. 29 shows an apparatus that is an example of this. In this example, the bead protrude above the height of the partitions 6 and the meniscus 52 is formed as shown.
It may be the case that, when the volumes 2 of polar medium are beads of an aqueous gel, foe leakage currents between foe compartments 4 is reduced. Gel beads can be made in a conventional manner in T-piece droplet maker by merging a stream liquid gel at an elevated temperature into a stream of foe apolar medium and allowing to cool, thereby to form an emulsion of beads of gel in foe apolar medium. Gel beads may also be easier to locate onto a spiked electrode in foe well and are generally more dimensionally stable.
In foe case of using gels, shapes other than spherical may be created, for example elongate cigar shaped structures which might be employed in deep recesses (thus maximising foe internal volume of the volume 2 of polar medium). This would have the advantage of extending the lifetime of foe volume 2 of polar medium for example if foe redox mediator were contained within foe volume 2 of polar medium.
The aqueous gel may be a cross-linked gel. These are gels in which the matrix is cross-linked, which increases the hardness of the gel, providing a higher structural integrity than gels that are not cross-linked. For example, agarose gels may be cross-linked. Beads of cross-linked gel arc commercially available and may be mixed with apolar medium to form an emulsion of beads of gel in foe apolar medium. One possibility is cross-linked agarose beads with a particle size of 160pm and an agarose content of 6.8-7.2% (as available for example from WorkBeadsTM200SEC, BioWorks), which are highly porous and physically stable. The beads may be supplied from the manufacturer and may be coated with an amphipathic layer by introducing foe beads into an apolar medium containing amphipathic molecules. This also permits an easier method of manufacture of such volumes 2 of polar medium.
Cross-linked gels may also provide advantages in inserting volumes 2 of polar medium into compartments 4 during manufacture foe apparatus 1 as described below.
Although in the above examples, a single volume 2 of polar medium is contained in an individual compartment, as an alternative plural volumes 2 of polar medium may be contained in a compartment 4. As an example of this. Fig. 30 shows an apparatus 1 in which two volumes 2 of polar medium are provided within a single compartment 4. The volumes 2 of polar medium are positioned
CA 02889440 2015-04-24
WO 2014/064443
PCT/GB2013/052766 on top of each other and may have a further layer 50 comprising polar medium provided in contact with one of the volumes 2 of polar medium. An membrane comprising amphipathic molecules may be provided at any interface between volumes 2 of polar medium, as well as at the interface between one of the volumes 2 of polar medium and the layer 50 of polar medium. Ion channels may also be provided in any such membranes. Provision of plural volumes 2 of polar medium in a compartment 4, for example as shown in Fig. 30, may increase the effective amount of the polar medium relative to the volume of the compartment 4. This provides advantages such as enabling a larger amount of mediator to be provided.
The nature of the apolar medium is as follows.
The apolar medium may be a hydrophobic medium.
The apolar medium may comprise a hydrocarbon or an oil or a mixture thereof. Suitable oils include silicone oil, AR20 or hexadecane. The apolar medium may be substantially immiscible with the polar medium of the volumes 2.
The apparatus 1 holding the array of volumes 2 of polar medium in a support 3. as described above, may have a wide range of biological, pharmaceutical and other analytical applications. It provides the opportunity to facilitate high throughput processing of small volumes 2 or groups of volumes 2 and may be used for example to compartmentalise reactions, cell sorting and screening applications such as protein crystallisation, analysis of blood or spinal fluid and waste processing. The ability to address and replace the volumes 2 of polar medium in the array is an important aspect, for example for carrying out reactions on the volumes 2 and replenishing the array.
In some applications, the apparatus 1 holding the array of volumes 2 of polar medium in a support 3, as described above, may be provided with a laser 50 of a polar medium as shown in Fig. 31 (which illustrates by way of example the case that the volumes 2 of polar medium are droplets in an apolar medium). The layer 50 of a polar medium extends across the support 3 over the openings of the compartments 4. Thus the layer 50 of a polar medium rests on the partitions 6. The lay er 50 of a polar medium is also in contact with at least some of the volumes 2 of polar medium preferably all of them. Membranes comprising amphipathic molecules are formed at the interfaces 51 between the layer 50 of polar medium and the volumes 2 of polar medium.
In order to form the membranes comprising amphipathic molecules, the amphipathic molecules may initially be provided in any one of more of the volumes 2 of polar medium, the layer of apolar medium or the layer 50 of a polar medium. In any of these cases, the membranes may form when the layer 50 of polar medium is flowed across the support 3. In the case of the amphipathic molecules being provided in the volumes 2 of polar medium, the volumes 2 of polar medium disposed within the compartments 4 may comprise a layer of amphipathic molecules around the surfaces thereof prior to provision of the layer 50 of a polar medium. In the case of the amphipathic molecules being provided in the layer 50 of a polar medium, the layer 50 of a polar medium may comprise a layer of amphipathic molecules on the surface that is brought into contact with the volumes 2 of polar
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 medium.
The membranes comprising amphipathic molecules form at the at the interfaces 51 when the layer 50 of polar medium and the volumes 2 of polar medium are brought into contact. The membranes comprising amphipathic molecules separate the layer 50 of polar medium and the volumes 2 of polar medium.
The polar medium of the layer 50 may be the same or different material as the volumes 2 of polar medium. The polar medium of the layer 50 may be a hydrophilic medium. The hydrophilic medium may for example comprise an aqueous medium. In one example, the hydrophilic medium of the layer 50 comprises an aqueous buffer solution. The buffer solution may comprise a supporting electrolyte.
The nature of the amphipathic molecules is as follows.
The amphipathic molecules may be of any type that is capable of forming a membrane at the interfaces 51 between the layer 50 of polar medium and the volumes 2 of polar medium.
The method and apparatus of the invention is suitable for use with numerous different types of amphipathic molecules.
In one example, the amphipathic molecules may comprise a lipid, which may have a single component or a mixture of components, as is conventional when forming lipid bilayers.
Any lipids that form a lipid bilayer may be used. The lipids are chosen such that a lipid bilaycr having the required properties, such as surface chaigc, ability’ to support membrane proteins, packing density or mechanical properties, is formed. The lipids can comprise one or more different lipids. For instance, the lipids can contain up to 100 lipids. The lipids preferably contain 1 to 10 lipids. The lipids may comprise naturally-occurring lipids and/or artificial lipids.
The lipids typically comprise a head group, an interfacial moiety and two hydrophobic tail groups which may be the same or different. Suitable head groups include, but arc not limited to, neutral head groups, such as diacylglycerides (DG) and ceramides (CM); zwitterionic head groups, such as phosphatidylcholine (PC), phosphatidylethanolamine (PE) and sphingomyelin (SM); negatively charged head groups, such as phosphatidylglycerol (PG); phosphatidylserine (PS), phosphatidylinositol (PI), phosphatic acid (PA) and cardiolipin (CA); and positively charged headgroups, such as trimethylammonium-Propane (TAP). Suitable interfacial moieties include, but are not limited to, naturally-occurring interfacial moieties, such as glycerol-based or ceramide-based moieties. Suitable hydrophobic tail groups include, but arc not limited to, saturated hydrocarbon chains, such as lauric acid (n-Dodecanolic acid), myristic acid (n-Tetradecononic acid), palmitic acid (n-Hexadecanoic acid), stearic acid (n-Octadecanoic) and arachidic (n-Eicosanoic); unsaturated hydrocarbon chains, such as oleic acid (cis-9-Octadecanoic); and branched hydrocarbon chains, such as phytanoyl The length of the chain and the position and number of toe double bonds in the unsaturated hydrocarbon chains can vary. The length of the chains and the position and number of the branches, such as metoyl groups, in the branched hydrocarbon chains can vary. The hydrophobic tail groups can be linked to the interfacial moiety as an ether or an ester.
The lipids can also be chemically-modified. The head group or the tail group of the lipids may be chemically-modified. Suitable lipids whose head groups have been chemically-modified include, but are not limited to, PEG-modified lipids, such as l,2-Diacyl-sn-Glycero-3-Phosphoethanolamine-N -[Methoxy(Polyethylene glycol)-2000]; functionionalised PEG Lipids, such as 1,2-Distearoyl-snGlycero-3 Phosphoethanolamine-N-[Biotinyl(Polyethylene Glycol)2000]; and lipids modified for conjugation, such as l,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine-N-(succinyl) and l,2-Dipalmitoyl-snGlycero-3-PhosphoethanolamineN-(Biotinyl). Suitable lipids whose tail groups have been chemically-modified include, but are not limited to, polymerisable lipids, such as l^-bis(10,12-tricosadiynoyl)-sn-Glycero-3-Phosphocholine; fluorinated lipids, such as l-Palmitoyl-2-(16- Fluoropalmitoyl)-sn-Glycero-3-Phosphocholine; deuterated lipids, such as l,2-Dipalmitoyl-D62-sn- Glycero-3-Phosphocholine; and ether linked lipids, such as l,2-Di-O-phytanyl-sn-Glycero-3- Phosphocholine. Examples of suitable lipids include without limitation phytanoyl lipids such as l,2-diphytanoyl-.wi-glycero-3-phosphocholine (DPhPC) and 1,2diphytanoyl-.sn-glycero-3-phosphoethanolaniine (DPhPE). However such naturally occurring lipids are prone to biological degradation for example by proteins or detergents and are not able to withstand high voltages. Preferably the amphipathic layer is non-naturally occurring Amphipathic polymer membranes are preferred over lipid membranes due to their ability to withstand higher voltages.
In another example, the amphipathic molecules may comprise an amphipathic compound comprising a first outer hydrophilic group, a hydrophobic core group, and a second outer hydrophilic group, wherein each of the first and second outer hydrophilic groups is linked to the hydrophobic core group.
Some such amphipathic compounds are disclosed in the International Patent Application Publication WO2014/064444 filed October 23,2013 entitled “Droplet Interfaces”.
Other such amphipathic compounds are disclosed in US-6,916,488 which discloses a number of polymeric materials that can be employed in die apparatus 1 as planar amphipathic membranes. In particular triblock copolymers are disclosed, for example silicon triblock copolymer membranes such as poly(2-methyloxazoline )-block-poly(dimethylsiloxane)-block-poly(2-methyloxazoline) (PMOXAPDMS-PMOXA).
The use of such triblock copolymers as amphipathic membranes in the present invention is particularly preferred due to their ability to withstand high voltages, their robustness as w’ell as their ability to withstand biological degradation from detergents and proteins. Their ability to withstand biological degradation allows the direct application and measurement of biological samples to the array, such as for example blood or serum. The polar layer applied to the top surface may be the sample to be determined. Examples of silicone triblock polymers that may be employed are 7-22-7 PMOXA-PDMS-PMOXA, 6-45-6 PMOXA-PE-PMOXA and 6-30-6 PMOXA-PDMS-PMOXA, □ate Reçue/Date Received 2020-05-28
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 where the nomenclature refers to the number of subunits. For example, 6-30-6 PMOXA-PDMSPMOXA is comprised of 30 PDMS monomer units and 6 PMOXA monomer units.
Depending on the nature of the amphipathic molecules, the membranes may be bilayers of the amphipathic molecules or may be monolayers of the amphipathic molecules
Some possible methods of forming an array of volumes 2 in the apparatus 1 are as follows.
First, there is provided the apparatus 1 comprising the support 3 arranged as described above.
In a first type of method, the volumes 2 of polar medium arc pre-formed in the apolar medium before disposition in the compartments. There will now be described an example of this type of method in which first an emulsion of the volumes 2 of a polar medium in an apolar medium is made using tire methods mentioned above.
The amphipathic molecules may be provided to the volumes 2 of a polar medium or the apolar medium. This may be achieved simply by adding the amphipathic molecules to the emulsion and whereupon they migrate to the interfaces between the volumes 2 of a polar medium and the apolar medium. Alternatively the amphipathic molecules may be added to the apolar medium prior to forming the emulsion.
To dispose the polar medium and apolar medium on the support 3, the emulsion is flowed over the support 3. This has the effect that the apolar medium flows into the compartments 4 and respective volumes 2 of polar medium within the apolar medium further flow into at least some of the compartments 4 through the openings. This has been found to occur naturally as the emulsion flows over the upper surface of the support 3, assisted by the design of the support 3 as describe above. The apolar medium and volumes 2 of polar medium are drawn into the array by capillary forces. In addition in supports 2 having gaps between compartments 4, the apolar medium flows between compartments through the gaps.
The emulsion typically contains more volumes 2 of polar medium than the number of compartments to ensure that a relatively large proportion of the compartments 4 are populated with volumes 2 of polar medium. The excess volumes 2 of a polar medium may be removed by washing the support 3 with the apolar medium. The washing leaves volumes 2 of polar medium in die compartments and leaves a layer of the apolar medium used for washing as a layer of apolar medium extending across the openings in contact with the volumes 2 of polar medium.
In this method, the emulsion may further comprise the amphipathic molecules. This facilitates the formation of the membranes when polar medium is flowed across the openings in the support to form a layer comprising polar medium, as described below. The presence of the amphipathic molecules also stabilises the emulsion.
The relative viscosities of the polar medium of the volumes 2 and apolar medium may be selected to be sufficiently similar that volumes 2 of a polar medium does flowing the emulsion over the support 3 do not float at the surface of the apolar medium away from the support 3. It is noted however that typically the volumes 2 of polar medium are draw n and held within the compartments 4
CA 02889660 2015-04-24
WO 2014/064443 PCT/GB2013/052766 by capillary forces such that even if an apolar medium of a higher density than the volumes 2 of polar medium is used, the volumes 2 of a polar medium tend to remain within the apolar medium at the electrode surface.
This method also intrinsically provides a layer comprising apolar medium that extends across the openings of the compartments 4 in contact with the volumes 2 of polar medium in the compartments 4. being the apolar medium of the emulsion, or the apolar medium used to wash the supports.
A dye may be incorporated into the volumes 2 of polar medium such that the presence of droplets in the array may be more easily visualised. A coloured dye, preferably of a different colour to that added to the volumes 2 of polar medium may be added to the apolar medium to more easily visualise the distribution of the apolar medium across the support 3 The incorporation of dyes within the volumes 2 of polar medium and/or apolar medium may be employed as a quality control check during fabrication to ensure that the compartments 4 are sufficiently populated with volumes 2 of polar medium and/or the apolar medium is properly distributed.
When the volumes 2 of polar medium are beads of an aqueous cross-linked gel, the emulsion may be flowed over the support 3 under positive pressure. This is possible because the cross-linked gels are hander and able to withstand the pressure, which is chosen having regard to the mechanical properties of the cross-linked gel. In contrast, beads of gel and droplets of solution can have a greater tendency to deform and merge underpressure. The use of such a positive pressure assists in filling of the compartments 4. This is particular advantageous when using a support with the first alternative construction or other constructions without gaps between the compartments, which are in general terms harder to fill.
In another example of the first type of method in which the volumes 2 of polar medium are pre-formed in the apolar medium, the volumes comprising polar medium may be dispensed directly into individual compartments, for example by acoustic droplet injection. With this technique, the dispensing may be controlled such that the correct number of volumes comprising the polar medium are dispensed without the need to remove excess volumes. In one embodiment of this technique, die substrate 3 comprises compartments 4 without gaps in the partitions, in which case it is desirable that the width of the volumes 2 of polar medium is less than the width of the opening of the compartment 4. The volume 2 may consist of a polar medium or comprise a polar medium within an apolar medium. In another embodiment, the substrate 3 comprises compartments 4 having gaps 8 in the partitions 6, wherein the gaps 8 extend fully from the openings to the base 5 of the support 3 . In a yet further embodiment, the substrate 3 comprises compartments 4 having gaps 8 in the partitions 6, w'herein the gaps may extend partially from the openings to the base 5. In the case that the gaps extend fully from the openings to the base of the support, a pretreatment may be advantageously added to the support prior to the addition of the volumes in order to constrain the droplets and prevent them from merging.
CA 02889640 2015-04-24
WO 2014/064443 PCT/GB2013/052766
In a second type of method, the volumes 2 of polar medium are formed in the compartments 4 from a larger amount of polar medium that is flowed into the cell. Examples of such methods will now be described with reference to the schematic flow diagrams of Figs. 32 to 34 which show the support 3 in successive steps of the method. In Fig. 32, the support 3 is of the type described above in which the partitions 6 comprise inner portions 20 defining inner recesses 21 without gaps, and outer portions 21 with gaps 23 In Fig. 32, the support 3 is illustrated schematically, and could for example be any of the second to eleventh alterative constructions described above.
First the support 3 is provided as shown in Fig. 32(a).
The support 3 is pre-treated with a pre-treatment apolar medium 70 as shown in Fig. 32(b). The pre-treatment apolar medium 70 may be of the same or different material from the layer of apolar medium subsequently applied as described below.
The pre-treatment apolar medium 70 (which may be diluted in a solvent) is added to the substrate 3 (for example by pipette) and allowed to spread across the substrate by capillarity. The pretreatment apolar medium 70 collects inside the comers of the inner recess 22 and around the pillars 23 of fee outer portions 21, in particular in the comers between fee pillars 23 and fee upper surface of the inner portion 20.
Next, polar medium 71 and apolar medium 74 are disposed on the support 3 as follows.
Polar medium 71 is flowed across the support 3 so feat fee polar medium 71 enters into the compartments 4 through the openings, as shown in Fig. 32(c). One way of doing this is to attach one end of the apparatus 1 to a flow cell 60. At least a portion of the are of fee electrode 13 is free from apolar medium and therefore the volume 2 of polar medium makes electrical contact with the electrode 13.
In contrast to the first type of method wherein the volumes 2 of polar medium and the apolar medium arc disposed on the support 3 together, for example in an emulsion, herein the layer of apolar medium is provided subsequently.
Excess polar medium 71 is removed by flowing a displacement fluid having a different phase from the polar medium across the substrate 3, leaving fee volumes 2 comprising polar medium in fee compartments 4. Two alternative approaches for this are described.
The first approach is illustrated in Figs. 32(d) and (e). In the first approach, the displacement fluid is apolar medium 74 which is flowed across the substrate 3 as shown in Fig. 32(d). Clipping of the polar medium 71 takes place at the outer edge of the inner portion, as shown in Fig 32(c). Relaxation of the volume of polar medium takes place as shown by Fig 32(j) to leave the volumes 2 comprising polar medium in the compartments 4. This first approach leaves a layer 73 comprising apolar medium extending across the openings of the compartments 4 in contact with the volumes 2 comprising polar medium.
The second approach is illustrated in Figs. 32(f) to (i) which steps occur instead of Figs. 32(d) and (e). In fee second approach, the displacement fluid is a gas 72 which is flowed across the substrate 3 as shown in Fig. 32(f). Clipping of the polar medium 71 takes place at the outer edge of the inner portion, as shown in Fig 32(g), leaving the volumes 2 comprising polar medium in the compartments 4 and a layer of the gas 72 extending across the openings of the compartments 4 in contact with the volumes 2 comprising polar medium, as shown in Fig. 32(h) The gas 72 is preferably inert, and may be air or any other gas.
Thereafter, apolar medium 74 is flowed across the substrate 3, as shown in Fig 32(i), displacing the gas 72 to provide a layer 73 comprising apolar medium extending across the openings of the compartments 4 in contact with the volumes 2 comprising polar medium, as shown in Fig. 32(j). As an alternative to being flowed, the layer 73 of apolar medium 74 could be provided across the substrate 3 using some other technique such as spraying.
In each of the first and second approaches, the displacement fluid flows across the support 3, through the gaps in the outer portions 21 and therefore scrapes across the openings of the compartments 4 to displace orclip the excess polar medium. Thus, the geometry' and physical properties of the outer portions 21 and the inner recesses 22, including the effect of the indentations 65 when present, control the process of disposing the volumes 2 of polar medium in the inner recesses 22. The effectiveness of clipping and the ultimate shape of the volume 2 of polar medium is determined by a number of factors such as the relative heights of the outer portions 21 and inner recesses 20, the aspect ratio of the inner recesses 20. The dimensions of the inner recesses 22 and the outer portions 21 of the partitions 6 are ideally selected so that the volumes 2 comprising polar medium form a meniscus across the inner recess 22 as shown in Fig. 32(h) and (j).
By way of a counter-example, Fig. 33(a) shows steps of a method corresponding to that of Fig. 32, except that the support 3 having a larger ratio of pillar height to depth of the inner recess compared to that of Fig. 32. Due to the increased pillar height, clipping of the polar medium by the displacing fluid takes place at the outer edge 15 of the pillar as opposed to the outer edge 10 of the inner recess as shown in Fig. 33(e). Ibis results in a larger volume of polar medium being retained in the compartment 4 as shown by Fig. 33(f). Due to the increased volume of the polarmedium in the compartment a larger interface is formed following flowing of the polar medium over the support, as shown in Fig 33(h). In general the smaller the membrane interface, the lower the noise and electrical resistance. Thus the membrane interface as shown in the method of Fig. 32 is preferred to the membrane interface as shown in the method of Fig. 33.
As regards specific dimensions of the geometry; it should be noted that the optimum dimensions are very much dependent upon the material system, including respective surface energies of the material of the substrate 3, the apolar medium and the polar medium. Also because filling is a dynamic process, it also depends to some extent upon the flow rate across the substrate 3. Thus the preferred dimensions dependent on the material system. Any reference to particular dimensions herein hold for a material system where the substrate 3 is the epoxy' resin TMMS, the apolar medium is silicone oil AR20 and the polar medium is IM KC1.
□ate Reçue/Date Received 2020-05-28
CA 02889440 2015-04-24
WO 2014/064443
PCT/GB2013/052766
As an alternative to flowing polar medium 71 across the support into the compartments 4 and then removing the excess polar medium by flowing a displacement fluid, the volumes 2 could be disposed on the support by injecting discrete volumes 2 of polar medium into the compartments 4 through air, for example using a printing technique. In that case the apolar medium 74 is then subsequently disposed on the support.
The pre-treatment apolar medium 70 also has a beneficial role in the formation of volumes 2 of polar medium.
Firstly, in the case of compartments 4 having gaps therebetween, the pre-treatment apolar medium 70 sits in the gaps and seals them against flow of the polar medium. This assists in forming discrete volumes of polar medium by reducing the tendency of the volumes in neighbouring compartments to contact and merge
Secondly, the pre-treatment apolar medium 70 may also serve to coat the support 3 and may modify the surface properties in a beneficial way. Depending on the surface properties of the support 3 and the properties of the pre-treatment apolar medium 70, the addition of pre-treatment apolar medium 70 may change the contact angle between the support 3 and a volume of polar medium disposed within a compartment. The pre-treatment apolar medium 70 may be used for example to increase the phobicity of the support 3 to the polar medium and provide a volume having a more convex shape. The use of a pretreatment to alter the phobicity of the support 3 to a desired level permits the use of a wider number of materials to be considered m making the support 3. This can be useful for example in the case where a particular material is desirable from a manufacturing point of view but does not have appropriate material properties.
The aspect ratio of the inner recesses 22 is an important consideration. Aspect ratios (length: width) that are too large can result in a meniscus of die pre-treatment apolar medium 70 forming which spans the electrode 13 as illustrated in Fig 34(b). If the aspect ratio (depth d : width w) is too small, clipping can result in the removal of polar medium from the compartment. Desirably, the inner recesses 22 have a ratio of depth to width, where the width of an inner recesses is defined as the diameter of the largest notional sphere that can be accommodated within the inner recess 22, that is at least 1:3, preferably at least 2:3. Desirably, the inner recesses 22 have a ratio of depth to width, where the width of an inner recesses is defined as the diameter of the largest notional sphere that can be accommodated within the inner recess, that is at most 3:1, preferably at most 3:2.
The effectiveness of clipping and the ultimate shape of the volume of polar medium is determined by a number of factors such as the relative values of height (h) of the outer portions, the depth (d) of the inner recess, the width (w) of the inner recess and the length (1) between a respective outer portion and an inner recess of a compartment, as shown in . 34(a). The optimum dimensions for forming the array also depend upon factors such as the relative surface energies of the material of the support, the apolar medium and the polar medium. The process for forming an array also depends upon the flow rate of the apolar and polar media across the support.
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
A computer simulation of the second approach will now be described.
Fig. 35 shows the start point of the computer simulation, where the substrate 3 has been pretreated with a pre-treatment apolar medium 70, in this example oil, and then filled with a polar medium 71, in this example an aqueous buffer solution. Fig. 35 also shows the front of the apolar medium 74 in its start point before being flowed across the substrate 3.
Figs. 36(A) and (B) show' the computer simulation after the apolar medium 74 has flowed across the substrate 3, Fig 36(A) showing the initial state and Fig. 36(B) showing the steady state after the system has been allowed to relax. Fig. 36(B) shows that the volume 2 of polar medium has pinned to the surfaces of the inner recess 22.
Fig. 36(C) shows a confocal image of a compartment 4 of tlie substrate containing a volume 2 of polar medium. As predicted by the computer simulation, the volume 2 of polar medium has pinned to the surfaces of the inner recess 22.
Fig. 37 shows a relaxation from the initial to steady state, similar to that of Figs. 36(A) and (B), in simulations for inner recesses 22 having w idths of 130pm. 110pm and 90pm. all of which show' pinning of the volume 2 of polar medium to the surfaces of the inner recess 22. These results also show that the meniscus of the volume 2 of polar medium, at its interface with the apolar medium, does not protrude above the edges of the inner recess 22, which helps to achieve membrane size control.
Figs. 38(A) and (B) arc images show ing the formation of volumes 2 of polar medium, in this case aqueous buffer solution, in the construction of Fig. 21. Uniform volumes 2 of polar medium were observed, pinned to the surfaces of the inner recess 22.
Figs. 39(A) and (B) are images showing the formation of volumes 2 of polar medium, in this case aqueous buffer solution, in the construction of Fig. 19. Uniform volumes 2 of polar medium were observed, pinned to the surfaces of the inner reccss 22.
The pre-treatment apolar medium 70 may comprise the amphipathic molecules but this risks the amphipathic molecules providing an electrically insulating layer across the electrode 13, so it is preferred that the pre-treatment apolar medium 70 does not comprise the amphipathic molecules.
The layer 73 comprising apolar medium may comprise amphipathic molecules. The apolar medium 74 which is flowed across the substrate 3 may comprise the amphipathic molecules. Alternatively, the apolar medium 74 which is flowed across the substrate 3 may not comprise the amphipathic molecules so that the initially provided a layer 73 similarly does not comprise the amphipathic molecules, in which case the amphipathic molecules may be subsequently added to the layer 73 comprising apolar medium.
In any of those cases, after formation of the layer 73 comprising apolar medium, the apparatus 1 is left for a period of time that allows the amphipathic molecules to migrate to the interface between the layer 73 comprising apolar medium and the volumes 2 comprising polar medium. Typically the apparatus 1 may be incubated for a period of time of the order of 30mins.
As another alternative, the amphipathic molecules may be provided in the polar medium 75 that is subsequently flowed across the support 3 as described below. A method of forming an array of membranes using the apparatus 1 is performed by forming an array of volumes 2 by the method described above, and then performing the following steps. These steps are illustrated in Fig. 32 for that method of forming an array of volumes 2 of polar medium but is generally applicable to any of the methods of forming an array of volumes 2 of polar medium described herein.
Polar medium is flowed across the support 3 to cover the openings of the compartments, as shown in Fig. 3 2(k). The polar medium displaces the apolar medium of the layer 73 comprising apolar medium to form a layer 75 comprising polar medium extending across the openings in the support 3 as shown in Fig. 32(1). Fig. 40(C) shows a more detailed view. The layer 75 comprising polar medium is brought in contact with the volumes 2 comprising polar medium forming an interface 77 with each of the volumes 2 comprising polar medium.
In the case that the amphipathic molecules are already present, membranes comprising amphipathic molecules are formed at the interfaces 77. This occurs simply by flowing the polar medium over the support 3.
Alternatively, the amphipathic molecules may be provided in the polar medium 75 that is subsequently flowed across the support 3. In that case, after formation of the layer 75 comprising polar medium, the apparatus 1 is left for a period of time that allows the amphipathic molecules to migrate to the interfaces 77 between the layer 75 comprising polar medium and the volumes 2 comprising polar medium, and thereby form the membranes. Typically the apparatus 1 may be incubated for a period of time of the order of 30mins.Fig. 31 shows an equivalent example for the case that the volume 2 of polar medium is a droplet in the apolar medium introduced into the compartment 4 using an emulsion as described above, showing the layer 50 of polar medium that has been formed by flowing polar medium across the support 3 in the same way.
The geometry and physical properties of the outer portions 21, including the effect of the indentations 67 when present, control the geometry’ of the layer 75 comprising polar medium extending across the support 3. The dimensions of the inner recesses 22 and the outer portions 21 of the partitions 6 are selected having regard to the dimensions of the inner recesses 22 so that the volumes 2 comprising polar medium form a meniscus across the outer portions 21 as shown in Fig. 32(1). The meniscuses of the volumes 2 comprising polarmedium and the layer 75 comprising polar medium extend towards each other to an extent that brings them into contact. Thus the geometry controls the formation of the membranes providing reliability in that formation. This also allows control of the size and stability of the membranes comprising amphipathic molecules.
The relative heights of the pillars to the inner recesses is therefore a design consideration. In the case of a particular material system where the substrate 2 is made of epoxy resin TMMS, the apolar medium is silicone oil AR20 and the polar medium is IM KC1, when the height of the pillar was 60pm and the height of the inner recess was 90 pm ( 1:1.5), clipping of the volume 2 of polar □ate Reçue/Date Received 2020-05-28
CA 02889640 2015-04-24
WO 2014/064443 PCT/GB2013/052766 medium took place at the upper edge of the partition 6, which resulted in a volume 2 of polar medium which protruded from the inner recess. This resulted in a ‘muffin’ shaped droplet with a large membrane area (large interface). Whilst this membrane can work, it is not an ideal shape, as larger membranes are prone to more leaks, have a higher capacitance and are often electrically more noisy. In the case of the material system mentioned above, ratios of the height of the pillars to the iner recesses of 30:90 and 30:120 were shown to be effective.
By way of example, Figs. 40(A) and 40(B) arc images of a support 3 with the construction of Fig. 19 in which membranes have been formed in the case of the polar medium being an aqueous buffer solution.
The apparatus I may be kept in the state with or without the layer 75 of polar medium, in storage or during transport from a manufacturing facility’ to the point of use of the apparatus 1. The layer 50 of polar medium may be applied after such storage or transport, if not already present.
In the first type of method of forming the volumes 2 of polar medium wherein the volumes 2 of polar medium are pre-formed as droplets in an emulsion, in order for the droplets to be incorporated into the compartments 4, they need to be provided w ithin a fairly narrow range of size distribution and therefore it is necessary for the emulsion to be stable. The formation of a stable emulsion may be achieved by’ the presence of amphiphilic molecules which form interfaces between the droplets and apolar medium. In the absence of amphiphilic molecules, the emulsion is unstable. This tends to result in some degree of mctgmg of the droplets to form larger droplets which arc unable to fit correctly within the compartments 4.
A potential drawback however with the method of providing a stable emulsion is that during the process of filling the compartments 4, the apolar medium tends to coat the surfaces of the electrodes 13 provided in each compartment 4 resulting in a layer between the electrode 13 and the volume 2 of polar medium that is an electrically resistive. Electrical contact between the electrode 13 and the volume 2 of polar medium may be necessary’ requirement if it is desired to sense electrical signals such as ion flow across a membrane. The presence of amphiphilic molecules in the layer across tire electrode 13 further exacerbates the problem of poor electrical contact. Due to the presence of both apolar and polar groups, it is difficult to displace amphiphilic molecules from the surface of the electrode 13 by modifying its surface characteristics.
The second type of method may be applied to reduce the problem of poor electrical contact by assembling individual volumes 2 of polar medium in the compartments 4 in the absence of amphiphilic molecules. The apolar medium added to the substrate 3 is largely localised at the surface of the partitions 6 and away from the electrode 13. Thus, the pre-treatment apolar medium 70 mayfurther comprises the amphipathic molecules, so that the membranes comprising amphipathic molecules are formed after the step of flowing polar medium 8 across the support 3 to displace apolar medium and form a layer of polar medium.
However, if the pre-treatment apolar medium 70 does not include amphipathic molecules, the
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 volumes 2 of polar medium are assembled in the absence of the stabilising amphiphilic molecules, and so merging of volumes between neighbouring compartments is much more of an issue. As such, semi-closed structures are preferred (structures comprising partitions having no or few gaps provided on the surfaces of wells) due to the fact that the individual volumes are confined within the wells. However the method will also work to some extent with open structures (pillars having gaps that extend the height of the compartments) due to the fact that the pre-treatment apolar medium 70 can, depending upon the separation between the pillars, partially span the gaps between the partitions thus effectively providing a semi-closed structure.
The apparatus 1 may have membrane proteins inserted into the membranes comprising amphipathic molecules formed at the interfaces 51 The membrane proteins may be ion channels or pores.
Such membrane proteins that are capable of insertion into the membranes comprising amphipathic molecules may initially be provided in either or both of the layer 50 of polar medium and the volumes 2 of polar medium, prior to bringing the layer 50 of polar medium and the volumes 2 of polar medium into contact. In some material systems, bringing the layer 50 of polar medium and the volumes 2 of polar medium into contact to form the membranes comprising amphipathic molecules may cause the membrane proteins to spontaneously insert into the membranes. Insertion of the membrane proteins into the membrane can be assisted w here necessary’ for example by means such as the application of a potential difference across the membrane 2.
Alternatively the membrane proteins may be provided in the apolar medium.
The membrane proteins may be used to perform analysis of a sample in the layer 50 of polar medium.
To facilitate this, the layer 50 of polar medium may comprise the sample to be analysed at the time it is initially added. As an alternative, the layer 50 of polar medium may be provided as described above without the sample to be analysed. This allow s the apparatus to be prepared for storage and transportation prior to use. In that case, prior to performing the analysis, there may be carried out a step of displacing the layer 50 of polar medium by a further layer of polar medium that comprises the sample to be analysed.
Membrane proteins that are ion channels may be used to measure the translocation of an analyte through the ion channel by measurement of current flow’ under a potential difference applied across the ion channel. The membrane itself is highly resistive and has a resistance typically of the order of 1GQ or greater. Thus ion flow takes places substantially exclusively through the ion channel. By way of example, Fig. 41 shows electrical data obtained for measurement of ion current flow through an MspA nanopore illustrating pore insertion.
The ion channel may be a nanopore for determining the sequence of a polynucleotide The current may be measured wherein the magnitude and duration of each current episode may be used to determine the sequence. The array may comprise an enzyme for control of translocation of the polynucleotide through a nanopore.
The ion channel may be provided in the layer 50 of polar medium external to the volumes 2 of polar medium. It is possible that more than one ion channel may insert into the membrane or none at all. In practice there will be a Poisson distribution of ion channels in the membranes. Following insertion of the ion channels, the membranes may be measured, for example by measurement of ion flow through the channel, in order to determine which membranes contain a single ion channel. Droplets containing a single channel may be selected for further experimentation. The percentage of droplet interfaces containing single ion channels may be optimised by varying the concentration of ion channels in the polar medium.
Alternatively the ion channel may be provided in the apolar medium. Formation of an ion channel in a membrane may be checked optically by for example providing a fluorophore in the polar interior of the droplet and a quencher in the polar meniscus layer. If an ion channel is present in the membrane at the interface 51, the quencher and fluorophore will come within close proximity of one another, extinguishing the fluorescent signal.
The magnitude of ion flow is dependent upon the potential difference applied across the ion channel and therefore is it desirable to provide a stable reference potential. Both members of tire redox couple are required in order to provide a stable reference potential. However, one member may be provided and the other member generated in situ, for example by oxidation or reduction of the redox member present.
Electrical measurements may be taken as follows.
The apparatus 1 further comprises a common electrode 60 arranged above the support 3 as shown in Fig. 31 so that the common electrode 60 makes electrical contact with the layer 50 of polar medium once it has been provided.
As shown in Fig. 42, the apparatus 1 further comprises an electrical circuit 61 connected between the common electrode 60 and the respective electrodes 13 in each compartment 4 The electrical circuit 13 is arranged to take the electrical measurements and may have a conventional construction, for example as discussed in more detail in WO-2009/077734.
The electrical circuit 61 is configured to take electrical measurements dependent on a process occurring at or through the membranes. Where a sample containing an analyte is provided, for example in the layer of a polar medium, the process may analyse the sample. The polar medium of the layer 50 applied to the support 3 may be for example the liquid sample to be analysed. This sample may be a biological sample such as blood, serum, urine, interstitial fluid, tears or sperm. The liquid sample may be derived from a solid or semi-solid sample. The sample may be agricultural, environmental or industrial in origin. It may be a forensic sample.
An electrochemical measurement apparatus typically comprises working, counter and reference electrodes wherein a potentiostat measures the potential difference between the working and □ate Reçue/Date Received 2020-05-28
CA 02889640 2015-04-24
WO 2014/064443 PCT/GB2013/052766 reference electrodes and measures current flow between the working and counter electrodes. Because no current flow takes place through the reference electrode a constant potential difference is maintained between the reference electrode and working electrode. Alternatively, a two electrode system may be employed, as is the case with the apparatus 1, wherein a potential is provided between a counter and a counter/reference electrode and ion flow takes place between these electrodes. This however results in consumption of one or the other member of the redox couple depending upon the polarity of the potential applied. The rate of consumption of the redox member is dependent upon the magnitude of the ion flow.
In the case of measurement of the translocation of a polynucleotide, the polynucleotide is caused to translocate the pore under a positive potential applied across the pore. Application of a positive potential results in the oxidation of one member of the redox couple which ultimately will become depleted. Once depletion of a redox member occurs, the reference potential will start to drift, therefore limiting the lifetime of the measurement. In the case of one or both members of the redox couple provided within the droplet the lifetime of the measurement is dependent upon the amount of the reduced member of the redox couple, which in turn is dependent upon the concentration of the redox member and the droplet volume.
The apparatus 1 provides a stable array of volumes 2 of polar medium on which membranes may be formed in-situ. Such an array has advantages over an apparatus comprising an array of individual apertures across which suspended amphipathic membranes arc provided. In the latter ease, it is possible that leakage can occur at the membrane edges over time. By contrast volumes 2 of polar medium contained in an apolar medium are extremely stable. Amphipathic membranes formed from triblock copolymers are very stable and resistant to biological degradation. However it has proved very' difficult to provide amphipathic membranes made from triblock copolymers, in particular silicon triblock copolymers, across an array of microwcll apertures by methods such as described in WO2009/077734. By contrast it is relatively straightforward to prepare silicon triblock droplets. This enables nanopore arrays to be provided having very stable membranes and having a low susceptibility to biological attack. This also enables the direct application of samples such as biological samples to the amphipathic membrane.
The apparatus 1 would typically be single use. Thereafter the components of the apparatus 1, namely the biological sample, the volumes 2 of polar medium and apolar medium may be simply removed from the support 3, and the support 3 cleaned and rcpopulatcd with volumes 2 of polar medium and apolar medium. This allows reuse of the silicon chip and the electrode array comprising the array and the electrodes, which are expensive components of the array chip. It also allows for replenishment of the redox couple.
A particular application is wherein the apparatus lis housed in a single use handheld device for use with a computation means such as a laptop. Data is generated by the device and transmitted to the compulation means by USB or other transmission means. The computation means would typically comprise a stored algorithm by which to generate event and base calling data.
Alternatively the apparatus 1 could be housed in a reusable device wherein the device comprises flow’ conduits allow ing the array to be cleaned by flushing with solution stored in on-board fluid reservoirs.
Having regard to the electrical requirements, the electrodes 13 may be arranged as follows.
Tire electrodes 13 provide an electrical contact to tire volumes 2 of polar medium and may be used to provide a potential difference across tire membrane of amphipathic molecules. Electrical connections may extend from the electrodes 13 through the support 3 to an electrical circuit.
Tire electrodes 13 may be of any shape, for example circular. An individual electrode 13 may extend across the whole width of a compartment 4 or across a partial width thereof. In general, the electrodes 13 may protrude above the base 5 or may be integral with the base 5.
Some or all surfaces of the compartments 4 may be hydrophobic, including the outer surfaces of toe partitions 6 inside the compartments 4. This assists positioning of a volume 2 of polar medium on an electrode 13 and thereby facilitates toe making of an electrical contact.
The electrodes 13 may include other features to assist the making of an electrical contact to toe volumes 2 of polar medium.
One option is for the exposed surfaces of toe electrodes 13 may be roughened, for example by provision of a layer of Pt black on a Pt electrode.
Another option is for the electrodes 13 to comprise spikes protruding into the compartment 4 to penetrate the volumes of polar medium. Following penetration of a volume 2 of polar medium by a spike it tends to reform around the electrode effectively resealing the volume 2 of polar medium.
Exposed surfaces of toe electrodes 13 may be hydrophilic and/or surfaces of the compartments 4 around the electrodes 13, for example toe exposed surfaces of toe surface coating 14, that may be hydrophobic. This can reduce toe tendency of the apolar medium to coat the exposed surfaces of the electrodes and thereby act as an electrically insulating layer.
The electrode 13 may be a reference electrode such as Ag/AgCl in order to provide a stable reference potential with respect to a counter electrode. Alternatively the electrode 13may be an electrochemically inert material such as Au. Pt. Pd or C and toe electrode potential provided by one or both members of a redox couple located within the polar interior of toe droplet. Types of redox couples that may be employed are for example Fe(II)/Fe(III), Ru (III)/Ru (II) and ferrocene/ferrocinium. Specific examples of redox couples that may be employed are ferri/ferrocyanide, ruthenium hexamine and ferrocene monocarboxylic acid.
Fig. 43 shows toe droplet lifetime for various droplet diameters for ferro/ferricyanide as toe redox couple. As can be seen from the graph, a 200mM concentration of ferrocyanide in a 200pm diameter droplet has a lifetime of approximately 140hrs for a current flow of lOOpA.
The support 3 is designed as follows to assist toe formation of membranes of amphipathic molecules.
□ate Reçue/Date Received 2020-05-28
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
As shown in Fig. 31, the layer 50 of polar medium forms a meniscus 57 that protrudes into the compartments 4 to contact the volumes 2 of polar medium. All the constructions of the support 3 described above provide the advantage that the upper surfaces of the partitions 6 assist in the formation and pinning of the meniscus 52. In particular, the various, convoluted shapes of the upper surface of the partitions 6 provides pinning points for the layer 50 of polar medium in order to form the meniscus 52
A meniscus formed in a conventional square type of w ell structure is not pinned uniformly around the edges of the well. As such, stresses on the meniscus are created at the comers of the well. In order to optimise meniscus formation in a well ty pe structures, it is beneficial to provide further features on the wells in order to pin the polar layer. All the constructions of the support 3 described above provide such features, being for example the convoluted shapes of the various pillars 7 and 23 and the undulating shape of the common body 31 around the recess 30. The meniscus 52 may be pinned around these undulations effectively creating a more distributed pinned meniscus 52 in the compartment 4.
In general terms, such pinning is achieved in the constructions of the support 3 described above because in each case the total length per compartment 4 of the edges of the outer ends of the partitions 6 in the common plane is greater than the largest circumference of tire largest notional sphere that can be accommodated within the compartments 4..
The layer 50 of polar medium forms the meniscus 52 with the partitions 6 which extends into the compartment 4 and contacts the volume 2 of polar medium provided therein to form a membrane. The compartments 4 are designed with openings having dimensions selected so that the layer of a polar medium when applied will form a meniscus 52 extending into the compartment 4 to an extent that brings the layer 50 of polar medium into contact with at least some of the volumes 2 of polar medium.
The ability to form a membrane is dependent upon the height of the volume 2 of polar medium within the compartment 4 and the extent to which the meniscus 52 extends into the compartment 4. This in turn is dependent upon tire surface interaction between the partitions 6, the polar medium and the apolar medium, as well as the dimensions and shape of the compartment 4 defined by the partitions 6. These parameters, and/or the sizes of the volumes 2 of polar medium, may be selected such that a polar medium applied to the top surface of the support 3 w ill spontaneously form membranes with the volumes 2 of polar medium.
This is illustrated schematically in Figs. 44(a) to (c) for the case that the volumes 2 of polar medium are droplets in the apolar medium. Fig. 44(a) shows the case that there is no contact between the layer 50 of polar medium and the volume 2 of polar medium so that a membrane is not formed due the volume 2 of polar medium being too small and/or the meniscus 52 not extending sufficiently into the compartment 4.
Fig. 44(b) shows the case w hereby the volume 2 of polar medium and the meniscus 52 just contact one another. However, the size of the membrane may be insufficient. Also the membrane formation may be sensitive to other parameters. The size of the volume 2 of polar medium is temperature dependent and a small drop in temperature can result in contraction of the volume 2 of polar medium leading to the non-formation of a membrane. Furthermore, whilst the volumes 2 of polar medium are designed to be substantially similar in size, a small variation in the droplet size may occur, resulting in unreliable membrane formation.
Fig. 44(c) shows the case where the volume 2 of polar medium is made larger and/or the meniscus 52 extends further into the compartment 4 such that a substantial droplet interface is formed. This reduces the chances that the membrane will not be formed as well as providing a large surface area for ion channel insertion.
Figs. 45 and 46 are schematic cross-sectional views of the apparatus 1 of the type shown in Figs. 15 to 18 wherein the partitions 6 comprise inner portions 20 and outer portions 21 that comprise pillars 23 having gaps 24 therebetween, for the case that the volumes 2 of polar medium are droplets in the apolar medium. Figs. 45 and 46 show the influence of the height and density of the pillars 23 on the pinning of the meniscus 52.
In Fig. 45, the meniscus 52 is pinned at the edges of the inner portions 20 and not the pillars 23. Additional apolar medium is pinned at the interface between the pillar 23 and the edge of the recesses 22 of the inner portion 20. The pillars 23 therefore serve to control the distribution of apolar medium but do not influence the formation of the meniscus 52 which is controlled by the recesses 22.
In Fig. 46, the arrangement of the pillars 23 is such that the meniscus 52 is determined by the pillars 23 themselves and not the recesses 22 in the inner portions 20. In Fig. 46, two sets of pillars 23 are provided between neighbouring compartments 4 on the inner portions 20 of the partitions 4. Alternatively for example, a single pillar might be provided having a larger height than that shown in Fig. 1.
Whether the meniscus 52 forms according to that of Fig. 45 or 46 will depend upon the arrangement and relative dimensions of the pillars 23 of the outer portions 21 and the recesses 22 of the inner portions 20.
Compartments 4 with no gaps between the partitions 6 have the tendency to flood with apolar medium. This is disadvantageous as this prevents formation of the membrane interface between the two volumes 2 of the hydrophilic medium.
Fig. 47 shows a meniscus 52 formed by a polar liquid at the surface of the support 3. The size and degree of curvature of the meniscus 52 of the layer 50 of polar medium applied to the upper surface of the support 3 can be controlled across a wide range. The curvature of the meniscus 52 will be determined by the contact angle between the polar liquid and the partitions 6, which is a property' of the material system of the polar medium, the apolar medium and the surface properties of the partitions 6. It will also be determined by the dimensions across the opening of the compartment 4 on which the meniscus 52 is formed and the height of the partitions 6.
□ate Reçue/Date Received 2020-05-28
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
For example, for a compartment 4 having a width b betw een the partitions 6, a height c and a contact angle 0 betw een the surface of the pillar and the meniscus 52, a meniscus 52 w ill be formed above the base of the compartment when: c_<sub><</sub> 1 — sin0 b ” 2 — cos&
The distance h that the meniscus 52 extends into the compartment can be determined, and can be controlled in combination with the size of the volumes 2 of polar medium to control the size of the meniscus 52. Conceptually, assuming a perfectly spherical volume 2 of polar medium of diameter d, an interface will be formed betw een the meniscus 52 and the volume 2 of polar medium w hen the diameter d > c-h. For a diameter d of 150gm, Permex being the material of the partitions 6 and a the polar medium of the layer 50 being IM HEPES, suitable values for b and c are 6=150pm, a=30pm, c<170pm.
For a pillar array, menisci 52 are formed on the partitions 6 in what is known as a superhydrophobic or Fakir state. The Fakir state occurs when:
cosO < (— 1 + 4—φθ a where a is the pillar thickness and where 0<sub>S</sub> is a dimensionless term which is equal to the fraction of solid in contact with the liquid.
Although the above examples are given assuming a perfectly spherical volume 2 of polar medium for ease of understanding, this might not be the case. In the case of a gel, the volume 2 of polar medium may be designed to have other shapes. Furthermore, even if the shape prior to entering the compartment 4 is spherical in shape, it may deform to some extent depending upon the nature of interaction w'ith the support 3 and/or surface of the electrode 13, thus changing the height of the volume 2 of polar medium after it is contained in the compartment 4. This factor also needs to be taken into account when assessing the height of the volume 2 of polar medium in order to be able to spontaneously form membranes.
The widths and heights of the compartments 4 may be selected as follows. To take account of the differing profiles of the compartments 4 across the support 3, for this purpose, the width of a compartment 4 is defined as the diameter of the largest notional sphere that can be accommodated within the compartment 4.
The width of the compartment 4 may be chosen to be a value less than 2 times the average diameter of the volumes of polar medium in order to avoid the possibility that more than one volume 2 of polar medium may be contained in a side by side relationship within a compartment 4 where desirable. Where the volume of polar medium is a liquid droplet, the compartment width may have a value less than 2 times, for example 1.75 times the width, to take account of the fact that the droplets may deform, thus reducing their average width.
For the case that the volumes 2 of polar medium are droplets in the apolar medium, the width
CA 02889640 2015-04-24
WO 2014/064443 PCT/GB2013/052766 of fee compartment 4 may further be chosen to be a value greater than the average diameter of a volume 2 of polar medium such that it may freely insert into the compartment 4. For this purpose, the width will typically be at least 1.05 times the average diameter of the volumes 2 of polar medium. The width will typically be at most 1.5 times the average diameter of fee volumes 2 of polar medium. Widths greater than this provide the possibility that the volume 2 of polar medium may move within the compartment 4. Ideally the volume 2 of polar medium is provided in a closely packed arrangement within fee compartment 4.
The height of the compartment 4 is determined by fee height of the partitions 6. The height of the compartment 4 is chosen depending upon the size of the volumes 2 of polar medium and the ability to form a membrane wife a polar liquid. The pillar height is typically between 1.1 and 1 3x fee height of the droplet in fee droplet zone. The compartments 4 may have heights that are at least 1.1 times the average diameter of the volumes of polar medium. The compartments 4 may have heights that are at most 1.3 times the average diameter of the volumes of polar medium. In a particular embodiment where fee volume of polar medium is a bead, it may extend beyond fee height of the partitions.
Some examples of experiments performed using an apparatus 1 as described above will now be given. In various examples, fee apparatus 1 was formed as an array chip.
The first example is as follows.
Droplets of polar medium in apolar medium may be prepared as follows. 2mg/ml of 6-30-6 PMOXA-PDMS-PMOXA triblock copolymer was dissolved in AR20 silicon oil to provide fee apolar medium. The polar medium consisting of 625mM NaCl,75mM potassium ferrocyanide and 25mM potassium ferricyanide in lOOmM HEPES. Droplets were prepared in a microfluidic T - junction (Chip type: Dolomite, part no. 3000158) having two intersecting channels of 300pm width. The channels narrow towards fee intersection to provide channel widths at the intersection of 105 pm. The polar and apolar solutions were flowed along the channels at respective solution flow rates of 34ul/min and 15-17ul/min to provide droplets having a droplet size of between 150-160pm.
The flow rates can be varied to provide droplets of different dimensions.
A silicon wafer having an array of Pt connectors spaced apart by 200pm by 225pm was coated with a 2-3pm layer of SU photoresist. Pennex pillars were added to fee base support by a standard photolithographic process wherein uncrosslinked Pennex precursor is applied to the base and the precursor cross linked by exposure to U V light through a patterned mask. The uncrosslinked precursor was subsequently washed away to reveal the pillar structure. The resulting array was a 38 x 128 droplet zone with a pillar shape according to Fig. 2. The pillar height was 160pm. Droplets of 145pm in diameter were added to the array in the form of an AR20 oil/droplet emulsion as described above.
The emulsion was applied to the top surface of the array and oil and droplets were drawn into the array by capillary action Excess droplets were removed by flowing AR20 silicon oil over the
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 array. The droplets were held in the array by surface tension.
The array was placed into a flow cell and the polar medium containing an MspA protein nanopore was flowed over the surface of the array to provide ion channels in the droplet interfaces.
Droplet interfaces containing single MspA nanopores were selected for experimentation and measurement of DNA was carried out by measuring ion flow’ through the individual nanopores during translocation of DNA.
The second example is as follows.
Apparatuses were prepared according to the following general method.
Array chips were fabricated in clean-room facilities. A 6 in Si wafer with a 1 pm thermal oxide (SiMat) was used a base support. Tire wafer was initially treated with 200 W, 02 plasma in a plasma processor (Oxford Instruments), it then underwent a dehydration bake at 150 °C for 15 minutes in a hotplate (Electronic Micro Systems Ltd). The w afer was coated with a 1pm layer of SU-8 2 photoresist (MicroChem Corp.) in a spin-coater (Electronic Micro Systems Ltd, 3000 rpm for 30 seconds), soft baked at 65 °C and 2 min at 95 °C in a hotplate, flood exposed (110 mj/cm2) in a UV mask aligner (Quintel Corp.) and then post-exposure baked (PEB) for 1 min at 65 °C followed by 2 min at 95 °C in a hotplate. The w’afer is then spin-coated with a 120 pm thick layer of SU-8 3050 (1250 rpm for 30 s) and soft baked for 5 min at 65 °C followed by 2.5 h at 95 °C in a level hot plate. After cooling, it is exposed (260 mj/cm2) in the mask aligner using the photomask patterned with the microfluidic network. A PEB is then carried out: 2 min at 65 °C and 15 min at 95 °C. The channel features are developed by immersion of the wafer in Microposit EC Solvent (Rhom Haas Electronic Materials), in an appropriately size beaker, and shaken for 10 min and finally rinsed. Once the channels have been formed, the wafer is treated w ith 02 plasma for 1 min at 200W to promote adhesion of the top layer and the SU-8 resist.
The channels arc scaled with a layer of 100 pm thick film laminate resist, SUEX (DJ DevCorp) using a Exclam-Plus laminator (GMP) with the top roller set at 45 °C, with a pressure setting at 1 nun thickness and a speed of 50 cm/min. A post lamination bake of 3 min at 65 °C was then carried out. After cooling, the SLEX layer was exposed ( 1400 mJ/cm2) using the fluidic port mask. It should be noted that the protective polymer layer on the laminate is left on. The PEB is 3 min at 65°C followed by 7 min at 95 °C, again with the protective film on. The wafer is then developed using propylene glycol monomethyl ether acetate (Sigma-Aldrich) for 10 min and rinsed thoroughly with isopropanol, making sure the all residual developer is rinsed from the interior of the channels. The wafers are finally hard baked at 150 °C for 1 h and diced into individual array chips.
Example 1
This example describes the method used to produce the triblock co-polymer droplets which w'ere used to fill the interconnecting droplet zones on the array.
Materials and Methods
The T-junction chips were prepared for droplet generation by affixing nanoporl assemblies
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 (Upchurch Scientific) as fluidic interfaces.
The droplet generation mechanism in a T-junction is well documented in the literature [Garstecki et al.. Lab Chip, 2006,6,437-446 and Thorsen et al., Physical Review Letters, 2001,86, 18,4163-4166], Taking into account the fluid viscosities of the reagents involved the chosen Tjunction geometry’ was 50 gm channel width for both cases (oil and buffer).
1.1 - Droplet reagents
In order to make aqueous phase droplets in oil, buffer was used as the disperse phase, while a silicon oil (e.g. AR20), was used as the continuous phase. Both buffer and triblock co-polymercontaining oil were prepared as described below.
A solution of buffer (buffer 1) was prepared by adding 298mg of KC1 (99.99% Purity, Sigma) to 10 mL of degassed DI water. To this solution 30.35mg of 2-Amino-2-(hydroxymethyl)-l,3propancdiol (99.9%, Sigma) was added. The solution was buffered to pH 8 using small quantities of HC1 and NaOH. 316.5mg of K2[Fe(CN)6] (99.9%, Sigma) and 82.3mg of K3[Fe(CN)6] (99.9%, Sigma) was added to the solution and stirred until dissolved.
Oil-triblock co-polymer solution was prepared by adding 20 mg of polymer (6-33-6, PMOXA-PDMS-PMOXA, PolymerSource) to 1 mL of AR20 (99%, Sigma). The polymer was left stirring in the oil for 24 hrs until all of the polymer had dissolved.
1.2 - Droplet generation setup
The droplet generation setup consisted of two syringe pumps (Elite, Harvard Apparatus), two gastight syringes (Hamilton), peak tubing (Upchurch Scientific), and a custom made T-junction microfluidic chip. Once the syringes were loaded with oil and buffer and mounted on the syringe pumps, the peak tubing was used to establish the fluidic connections to the ports on the chip. The oil syringe was connected to the continuous phase channel input while the buffer was connected to the disperse phase channel input.
Both syringe pumps were set to infuse at a flow rate of 10 pL/min, which produced an average droplet size (diameter) of 129.46 pm, with a standard deviation of 10.87 pm. The droplets were then collected in a vial.
Example 2
This example describes the method used to produce droplet-interface-bilayers (DIBs) using a number of different tri-block co-polymers in different oils. The ability to form bilayers and to allow’ insertion of biological nanoporcs (such as mutants of MspA) was also investigated. Materials and Methods
Experiments 2.1,2.3 and 2.4 were carried out on the below’ combinations of tri-block copolymer and oil.
- 6-33-6 (PMOXA-PDMS-PMOXA) PolymerSource (20 mg/mL) in AR20 oil (polyphenylmcthylsiloxanc, Sigma Aldrich).
- 6-33-6 (PMOXA-PDMS-PMOXA) PolymerSource (20 mg/mL) in PDMS-OH 65cSt oil
CA 02889660 2015-04-24
WO 2014/064443 PCT/GB2013/052766 (poly(dimethylsiloxane), hydroxyl terminated. Sigma Aldrich).
- 6-45PE-6 (PMOXA-PE-PMOXA, where PE = a polyelcthylene hydrocarbon chain approximately 45 carbon atoms in length.) PolymerSource (20 mg/mL) in hexadecane (99.9%, Sigma Aldrich).
- 6-32-6 (PMOXA-PDMS-PMOXA) HighForce (20 mg/mL) in AR20 oil (polyphenylmethylsiloxane, Sigma Aldrich).
2.1 - Droplet stability experiments
Droplet stability was measured off-line by preparing solutions of buffer and triblock ABA polymer in various oils. A small 0.5 cm<sup>2</sup> tray was prepared using polycarbonate and a glass slide. The tray was filled with oil. To the oil, IpL buffer droplets were added and monitored over 24hrs. Droplets that exhibited only a small degree of merging were progressed to electrical DIBs testing. 2.2 - Experimental set-up
The experimental system was as follows. A 700B axopatch was connected inside a shielded box containing two micro-manipulators. The entire faraday cage was placed on an inverted microscope (Nikon) such that it was possible to view the manipulation of the droplets from underneath. This allowed the droplets to be moved without opening the Faraday cage.
Within the Faraday cage, the electrodes of the 700B axopatch were connected via pure gold (Au) wire
The Au was prepared for use in the droplet setup by flaming the end such that the wire formed a small gold bead. The Au wire was cleaned by emersion in conc.HNOj for 30 s, and washed thoroughly with DI water. The ball-ended wire was then repeatedly moved through a liquid agarose solution prepared from the buffer (5% wt low-melt agarose, Lonza ' Buffer 400 mM KC1, 75 mM K2[Fe(CN)6] (99.9%, Sigma) and 25 mM K3[Fe(CN)6] (99.9%, Sigma), lOmM Tris). Once a small bead had formed on the end the agarose was allowed to cool, and the wire was stored in an excess of buffer solution in order to come to equilibrium
The droplet chamber was mounted on the stage within the Faraday cage, and fee electrodes were mounted such that both fell within the central section of the chamber. The manipulators were situated such feat a full range of movement in X and Y directions were achievable by both electrodes over the area of the chamber. The chamber was then filled to the brim with the AR20 tri-block copolymer solution and allowed to stand for a few minutes IpL of buffer w as pipetted directly onto each of the agarose tipped Au wires and both electrodes were moved directly under the AR20/triblock co-polvmer solution. The droplets were left under the solution for 30 s before movement.
2.3 - Bilayer formation
To form a membrane wife the droplet pair, a waveform of ±20 mV was applied to the electrodes in addition to a bias voltage of 180 mV. The current response was monitored as fee indicator of the formation of a capacitive membrane. The droplets were carefully brought together such that contact between the two buffer volumes was made. The droplets were left in this slate until a
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 membrane was formed. In situations where the membrane growth was very slow’, the droplets were moved in the XY direction, which forced exclusion of the AR20/triblock co-polymcr between the droplets and facilitated membrane growth.
2.4 - Nanopore insertion experiments
In order to insert trans-membrane pores across the membrane, a 0.0005 mg/ml solution of MspA-(B2C) (SEQ ID NO: 1 and 9) was added to the buffer that formed the analyte. Insertion of the pore was observed by an instantaneous increase in current. This was performed in the absence of the waveform, but under die applied bias potential.
Results
Tire different tri-block co-polyiner and oil combinations that were investigated are shown in Table 1 below.
<td> Tri-Block Co-Polymer</td><td> Oil</td><td> Off-line Stability Test</td><td> Membrane Formation</td><td> MspA-(B2C) Pore Insertion</td>
<td> 6-33-6 PolymerSource</td><td> AR20</td><td> stable droplets formed</td><td> capacitive membrane growth observed</td><td> pores inserted</td>
<td> 6-33-6 PolymerSource</td><td> PDMS-OH 65cSt</td><td> stable droplets formed</td><td> capacitive membrane growth observed</td><td> pores inserted</td>
<td> 6-45PE-6 PolymerSource</td><td> C16</td><td> stable droplets formed</td><td> capacitive membrane growth observed</td><td> pores inserted</td>
<td> 6-32-6 HighForce</td><td> AR20</td><td> stable droplets formed</td><td> capacitive membrane growth observed</td><td> pores inserted</td>
Table 1
Capacitive membrane growth and pore insertion was observed for all of the tri-block copolymer/oils tested. Membrane growth and MspA-(B2C) (SEQ ID NO: 1 and 9) pore insertion were observed for the 6-33-6 PolymerSource tri-block co-polymer used with AR20 silicone oil. Membrane growth and pore insertion were observed for the 6-45PE-6 PolymerSource used with hexadecane as an example of a triblock co-polymcr which does not have the PDMS central core structure.
Example 3
This example describes the method used to produce the array chips which are assembled with patterned interconnecting droplet zones.
Materials and Methods
3.1 - Array Chip formation
3.1.1 Array chip fabrication
The array chips were fabricated in clean-room facilities. A 6 in Si wafer with a 1 pm thermal oxide (SiMat) was used as abase for the support The wafer was initially treated wife 200 W, O<sub>2 </sub>plasma in a plasma processor (Oxford Instruments), it then underw ent a dehydration bake at 150°C for 15 minutes in a hotplate (Electronic Micro Systems Ltd). The w afer was coated with a 1pm layer
CA 02889440 2015-04-24
WO 2014/064443
PCT/GB2013/052766 of SU-8 2 photoresist (MicroChem Corp.) in a spin-coater (Electronic Micro Systems Ltd, 3000 rpm for 30 seconds), soft baked at 65 °C and 2 min at 95 °C in a hotplate, flood exposed (110 mJ/cm<sup>2</sup>) in a UV mask aligner (Quintal Corp.) and then post-exposure baked (PEB) for 1 min at 65 °C followed by 2 min at 95°C in a hotplate The wafer was then spin-coated with a 120um thick layer of SU-8 3050 (1250 rpm for 30 s) and soft baked for 5 min at 65 °C followed by 2.5 h at 95 °C in a level hot plate. Aftercooling, it was exposed (260 mJ/cm<sup>2</sup>) in the mask aligner using the photomask patterned with the microfluidic network. A PEB was then carried out: 2 min at 65 °C and 15 min at 95 °C. The channel features were developed by immersion of the wafer in Microposit EC Solvent (Rhom Haas Electronic Materials), in an appropriately size beaker, and shaken for 10 min and finally rinsed. Once the channels had been formed, the wafer was treated with O2 plasma for 1 tnin at 200W to promote adhesion of the top layer and the SU-8 resist.
The channels were sealed with a layer of 100 pm thick film laminate resist, SUEX (DJ DevCorp) using a Exclam-Plus laminator (GMP) with the top roller set at 45 °C, with a pressure setting at 1 mm thickness and a speed of 50 cm/min. A post lamination bake of 3 min at 65 °C was then carried out. After cooling, the SUEX layer was exposed (1400 mJ/cm<sup>2</sup>) using the fluidic port mask. It should be noted that the protective polymer layer on the laminate was left on. The PEB was 3 min at 65°C followed by 7 min at 95 <sup>C</sup>C, again with the protective film on. The wafer was then developed using propylene glycol monomethyl ether acetate (Sigma-Aldrich) for 10 min and rinsed thoroughly with isopropanol, making sure the all residual developer was rinsed from the interior of the channels. The wafers were finally hard baked at 150 °C for 1 h and diced into individual chips. 3.1.2 Open Structure array chip fabrication
The functional structure array chips were fabricated in clean-room facilities. A 6 inch Si wafer (Silex) containing bias and electrodes was used as substrate. The wafer was initially treated with 200 W, O2 plasma in a plasma processor (Oxford Instruments), it then underwent a dehydration bake at 150 °C for 15 minutes in a hotplate (Electronic Micro Systems Ltd). The wafer was coated with a 1pm layer of SU-8 2 photoresist (MicroChem Corp.) in a spin-coater (Electronic Micro Systems Ltd, 3000 rpm for 30 seconds), soft baked at 65 °C and 2 min at 95 <sup>C</sup>C in a hotplate, exposed (110 mJ/cm<sup>2</sup>) in a UV mask aligner (Quintel Corp.) with a Seed layer mask. The wafer was then postexposure baked (PEB) for 1 min at 65 °C followed by 2 min at 95 °C in a hotplate and developed in EC Solvent for 1 min. The Seed layer function was to improve adhesion of the high aspect ratio and it also ensured that only the desired area of the electrodes was exposed to solution.
A layer of dry-film resist TMMF 2030 (Tokyo Ohka Kogyo Co. Ltd. ) was applied to the wafer using an Excelam-Plus roll laminator (GMP Co. Ltd.) with a top roll temperature of 85 °C. The process was then repeated five times, to achieve a 150 pm thickness. The wafer was then exposed to UV in the mask aligner using a Pillar structure mask A PEB at 95 °C was carried out in a hotplate for 10 min previous to development of the resist in EC Solvent for 12 min. The wafer was then treated with a 200 W O2 plasma and hard baked in an oven al 200 °C for 1 h.
CA 02889640 2015-04-24
WO 2014/064443 PCT/GB2013/052766
At this stage the wafer with the formed pillar structure was diced into individual devices and packaged onto ASIC-containing PCBs.
3.1.3 Closed Structure array chip fabrication
This type of functional structure was fabricated in the same base substrate as the open structure array chip fabrication, i.e. a Silex wafer containing bias and electrodes. A Seed layer was formed in the same way as described in die previous section. Then the wafer was laminated with four layers of TMMF 2030 dry-film resist, with the same process parameters as described above. These four layers, with an overall thickness of 120 pm, were then exposed using the Wells mask. The wafer was subsequently laminated with a fifth layer of TMMF 2030 and exposed using the Pillars mask. The wafers then underwent a PEB at 95 °C for 10 min, were developed in EC Solvent for 12 min, 2 min O<sub>2</sub> plasma at 200 W and a hard bake at 200 °C for Ih.
At this stage the wafer with the formed well and pillar structures, was diced into individual devices and packaged onto ASIC-containing PCBs.
Example 4
This example describes the method used to populate the array chips, which were assembled with patterned interconnecting droplet zones, with tri-block copolymer droplets formed using the method detailed in Example 1.
Materials and Methods
4.1 - Membrane formation on Open Structure arrays
To dispense the droplets onto the array of interconnecting droplet zones, a 1000 pL micropipette (Gibson) was used. The pipette tip was cut by 1 mm to, enlarge the orifice and prevent droplet mergmg due to shear stress. The droplets w ere then slowly dispensed onto the surface of the interconnecting droplet zones, ensuring that the entire area was cover with a large excess. Most of the excess droplet solution was then removed by inclining the array, in order to allow gravity to remove the excess droplets which had not been captured in the droplet zones. At this point, a flow cell large enough to fit the entire area of the array was placed on top of it, sealed and then filled with oil. This step was carried out because droplets can stick to one another and flushing the flow cell with oil removes the remaining droplets from the top of the capture array. Finally, tri-block co-polymer membranes were formed between each individual droplet and a common aqueous volume by flushing the bulk of the oil away and substituting it for an aqueous phase i.e. buffer 1. As the oil was displaced from the flow cell, the aqueous solution came into contact with the top part of the capture structure as well as the top of each droplet. The self assembled triblock copolymer layer prevented the two aqueous phases from mergmg; providing the droplet was big enough to be in contact with the bulk aqueous solution. The cross-section of the apparatus 1 is as shown in Fig. 31.
Example 5
This example describes the insertion of MspA-(B2C) (SEQ ID NO: 1 and 9) pores into triblock co-polymer droplets (6-33-6 PolymerSource droplets in AR20 (Sigma Aldrich) and helicase
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 controlled DNA movement through the nanopore. The droplets used in these experiments were made of cross-linked agarose beads (Bio-Works) (140-150 pm) which had been coated in tri-block copolymer in AR20 silicone oil.
Materials and Methods
5.1 - Agarose Bead Preparation
The cross-linked agarose beads were obtained from Bio-Works in a broad range of sizes (130250 pm). The droplets were then sieved using filters to obtain beads that were in the size range 140150 pm and stored in pure water. The beads were then centrifuged and buffer exchanged (625 mM KC1,75 mM potassium ferrocyanide. 25 mM potassium ferricyanide, 100 mM CAPS, pH 10.0) at least 5 times. Immediately after the final buiTer exchange and centrifuge step (to remove excess water) the beads were extracted and immersed in 10 mg/mL 6-33-6 PolymerSource triblock copolymer in AR20 silicone oil. The beads were briefly vortexed for 30sec in the oil, and left to stand for 1 hour.
5.2 - Membrane formation
Cross-linked agarose beads in 6-33-6 PolymerSource triblock co-polymer/AR20 were added to the array, and manually inserted into the interconnecting droplet zones. Immediately after filling, a small amount of 10 mg/mL 6-33-6 PolymerSource triblock co-polymer/AR20 (-50uL) was added to the surface of the array to immerse the beads and keep them under oil. They were incubated in this state for 5 mins. After this the chip was assembled and buffer (625 mM KC1,75 mM potassium ferrocyanide, 25 mM potassium ferricyanide, 100 mM CAPS, pH 10.0) was immediately flowed through. The array was then ready fortesting.
5.3 - Pore insertion and helicase controlled DNA movement
In order for pores to insert into the triblock co-polymer, a solution of buffer (625 mM KC1, 75 mM potassium ferrocyanide, 25 mM potassium ferricyanide, 100 mM CAPS, pH 10.0) with MspA(B2C) (SEQ ID NO: 1 and 9) was flowed overthe array. A holding potential of-180 mV was applied and pores were allowed to enter bilayers until at least 10% occupancy was achieved. Once pores had inserted, then buffer solution (625 mM KC1, 75 mM potassium ferrocyanide, 25 mM potassium ferricyanide, 100 mM CAPS. pH 10.0) containing no MspA-(B2C) (SEQ ID NO: 1 and 9) was then flowed overthe array to prevent further pores inserting into the tri-block co-polymer. In order to observe helicase-controlled DNA movement, a solution containing DNA (SEQ ID NO: 3 connected via 4 spacer groups to SEQ ID NO: 4, 1 nM), helicase enzyme (100 nM), dTTP (5 mM), Mg2+ (10 mM) in buffer (625 mM KG, 75 mM potassium ferrocyanide, 25 mM potassium ferricyanide, 100 mM CAPS, pH 10.0) was flowed overthe array. A holding potential of+180 mV was applied and helicase-controlled DNA movement was observed.
Results
Upon the exposure of the tn-block co-polymcr covered agarose droplets to MspA-(B2C) nanopores, insertion of the pores into lire tri-block co-polymer were observed. On the addition of
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
DNA (SEQ ID NO: 3 connected via 4 spacer groups to SEQ ID NO: 4,1 nM) and helicase enzyme to the system, helicase controlled DNA translocation through the MspA-(B2C) nanopore was observed. Two example current traces showing helicase-controlled DNA movement through nanopores inserted into agarose droplets are shown in Fig. 48A and B.
Example 6
This example describes the insertion of alpha-hemolysin-(El 11N/K147N)<sub>7</sub>(SEQ ID NO: 5 and 6) pores into tri-block co-polymcr droplets (6-33-6 PolymcrSourcc droplets in AR20 (Sigma Aldrich) and how this system was used to detect the presence of the protein thrombin. The droplets used in these experiments were made of low melt agarose.
Materials and Methods
6.1 - Agarose Bead Preparation
The droplet generation setup consisted of two syringe pumps (Elite, Harvard Apparatus), two gastight syringes (Hamilton), peak tubing (Upchurch Scientific), and a custom made T-junction microfluidic chip. Once the syringes were loaded with 6-33-6 triblock copolymer in AR20 oil in one and 2% low melt agarose (Lonza) in buffer (625 mM KC1, 75 mM potassium ferrocyanide, 25 mM potassium ferricyanide, 100 mM CAPS. pH 10.0) in the other and mounted on the syringe pumps, the peak tubing was used to establish the fluidic connections to the ports on the chip. The oil syringe was connected to the continuous phase channel input while the buffer was connected to the disperse phase channel input. In order to make agarose droplets, the set-up was placed in an oven at 50 °C in order for the agarose solution to remain fluid during the droplet generation process.
Both svnnge pumps were set to infuse at a flow rate of 10 pL/min for the agarose in buffer and 25 pL/min for the 6-33-6 in AR20 oil, which produced an average droplet size (diameter) of 150 pm, with a standard deviation of 5 pm. The droplets were then collected in a vial.
6.2 - Membrane formation
The tri-block co-polymer membrane was formed as described in Example 5.
6.3 - Pore insertion and detection of the protein thrombin
In order for pores to insert into the triblock co-polymer, a solution of buffer (625 mM KCL 75 mM potassium ferrocyanide, 25 mM potassium ferricyanide, 100 mM CAPS, pH 10.0) with alphahemolysin-(El 11N/K147N)<sub>7</sub>(SEQ ID NO: 5 and 6) was flowed over the array. A holding potential of +180 mV was applied and pores were allowed to enter bilayers until at least 10% occupancy was achieved. Once pores had inserted, then buffer solution (625 mM KC1, 75 mM potassium ferrocyanide, 25 mM potassium ferricyanide, 100 mM CAPS, pH 10.0) containing no alphahemolysin-(El 11N/K147N)<sub>7</sub>(SEQ ID NO: 5 and 6) was then flow ed over the array to prevent further pores inserting into the tri-block co-polymer. In order to observe thrombin binding to an aptamer, a solution containing the aptamer (SEQ ID NO: 7, 1 pM) and thrombin (1 pM) in buffer (625 mM KC1, 75 mM potassium ferrocyanide, 25 mM potassium ferricyanide, 100 mM CAPS, pH 10.0) was flowed over the array. A holding potential of+180 mV was applied and characteristic block levels
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 corresponding to the presence and absence of thrombin were detected. Results
Upon the exposure of the tri-block co-polymer covered agarose droplets to alpha-hemolysin(E111N/K147N); (SEQ ID NO: 5 and 6) nanopores, insertion of the pores into the tri-block copolymer was observed. On the addition of thrombin and aptamer (SEQ ID NO: 7) to the system, characteristic block levels corresponding to the presence and absence of thrombin were observed. Current traces were obtained showing the block produced in the absence of bound thrombin (1) and in the presence of thrombin (2), as shown in Fig. 49 which is a current trace (which is low-pass filtered) showing characteristic block levels corresponding to the presence (block labelled 2) and absence (block labelled 1). Example 7
This example describes how optical measurements were used to determine whether MspA(B2C) (SEQ ID NO: 1 and 9) pores had inserted into triblock copolymer droplets.
Materials and Methods 7.1 - Droplet Formation With the ExoI/DNA buffer 1 (962.5 μΜ KCI, 7.5 mM potassium ferrocyanide, 2.5 mM potassium ferricyanide, 100 mM CAPS (pHlO), 50 μΜ EDTA, 50 nM Eco Exol, 5 μΜ FAM/BHQ1labelled PolyT 30mer (SEQ ID NO: 8)) and triblock copolymer (6-30-6) in AR20 oil in separate 1 mL Hamilton syringes, droplets were prepared by flowing at 16 pL/min (buffer 1) and 4 pL/min (triblock copolymer in oil), respectively through a Dolomite T-piece.
7.2 - Array Population and Pore Insertion
Using a 200 pL pipette tip with the end cut off, 200 pL of droplets were pipette onto four clean arrays. Excess droplets were washed off with 2 mg/mL Triblock 6-30-6 in oil. 500 pL of buffer 2 (962.5 μΜ KCI, 7.5 mM potassium ferrocyanide, 2.5 mM potassium ferricyanide, 100 mM CAPS (pH 10), 50 μΜ EDTA) was then flowed over each of the four arrays in order to cover the droplets. Brightfield images of each array were obtained using the fluorescence microscope.
Buffers 3 and 4 were then prepared as shown in the Table 2 below. Buffer 3 (which contained MspA-(B2C) nanopores) (500 pL) was flowed over two arrays and Buffer 4 (which contained no nanopores as a control) was flowed over the other two arrays. Buffer 3 and 4 were left on the arrays for 30 minutes before Mg2+ containing buffer (buffer 5 - 0.5 M MgCh, 100 mM CAPS, pHlO, 7.5 mM potassium ferrocyanide, 2.5 mM potassium ferricyanide) was flowed across all four arrays. The arrays were then left overnight at room temperature before acquiring Brightfield and FITC (2 s exposure) images of each array using a 5x lens.
<td></td><td> Buffer 3</td><td> Buffer 4</td>
<td> MspA-(B2C)</td><td> 7.5 pL</td><td></td>
<td> Storage buffer</td><td> -</td><td> 7.5 pL</td>
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766
Buffer 2 1492.5 pL | 1492.5 pL
Storage buffer = 50 mM Tris HC1, pH 9.0, 100 mM NaCl, 0.1% DDM Table 2
Results
This example describes how optical measurements can be used to determine whether MspA(B2C) (SEQ ID NO: 1 and 9) pores have inserted into triblock copolymer droplets. MspA-(B2C) (SEQ ID NO: 1 and 9) pores were allowed to insert into triblock copolymer droplets, which contained Exol enzyme and fluorphore/quencher-labeled DNA substrate (SEQ ID NO: 8). By subsequently flowing a Mg<sup>2</sup>‘-containing buffer across the top of the droplets, flow of Mg<sup>2</sup> cations into the droplets, through inserted nanopores, activated the Exol. allowing it to digest the fluorophore/quencher DNA, resulting in a fluorescence increase. The arrays that were treated with MspA-(B2C) (SEQ ID NO: 1 and 9) containing buffer (buffer 3) showed bright spots on the arrays which indicates that pores have inserted into the droplets, as shown in Fig. 50. Fig. 51 shows a control experiment where buffer which contained no MspA-(B2C) (SEQ ID NO: 1 and 9) (buffer 4) was used. The absence of bright spots shows that under control conditions (absence of MspA-(B2C) nanopores) Mg<sup>2</sup>’ cannot penetrate the triblock copolymer, therefore, preventing activation of the enzyme and an increase in fluorescence. By comparison of Fig. 50 and Fig. 51 it is clear that the droplets which were exposed to buffer containing nanopores showed bright spots which corresponded to insertion of nanopores into the triblock copolymer.
Example 8
This example describes the method used to populate the arrays, which were assembled with patterned interconnecting droplet zones.
Materials and Methods
8.2 Membrane formation on semi-closed Structure arrays
Using a micropipette, 50uL of a 150pL AR20/lml hexane mixture was dispensed onto the surface of a dry' array at a temperature of 100 °C and left for 1 h to allow the oil to be distributed through the array surface by capillarity and for the hexane to evaporate. The array was mounted on an array holder and a 1.5 mm thick gasket was placed on it, aligned m such a way that the array was completely open and surrounded. The buffer intended to fill in each of the individual wells was then dispensed on top of the array (700 pL); the gasket should contain the buffer volume. The array was then placed in a vacuum chamber and pumped down to 25 mbar for 1 min such that volumes of buffer were provided in the wells It was then removed from the vacuum chamber and placed on a flow cell assembly clamp, where a flow cell was aligned to the holder and clamped to seal the assembly. An AR20 flow-front (700 pL) was then slowly pushed through the flow cell with a pipette; in this step the individual aqueous volumes contained within the wells were separated from the bulk and encapsulated in oil. This step was followed by a 5 mL air flow-front which displaced the excess oil out of the flow cell. The flow cell was then unclamped and disassembled allowing 30 pL of oil with a 10 mg/mL
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 concentration of tri-block co-polymer (TBCP) to be dispensed on top of the array and left to incubate for 20 min. After the incubation step the excess oil was removed by placing the array at 90° and allowing it to flow off the array so it can be dried with a tissue. At this stage the aqueous volumes were ready to form TBCP membranes.
Once the wells had been filled with aqueous and TBCP had been introduced into the system the array was then assembled into an assay flow cell, where buffer was then introduced. As the buffer flow’ front travelled over the array, it displaced any excess oil left allow ing the bulk buffer volume to form TBCP membranes.
Example 9
This example describes the method used to populate arrays with volumes of polar and apolar media according to that shown in Figs. 21 and 22 and as shown schematically Fig. 32.
Oil pretreatment
An array was subjected to an oil preconditioning with a small amount of AR-20 silicone oil to fill the micro-patterning of the well and cover the pillars and surface in a thin oil film. A 1mL syringe barrel of a Harvard syringe pump was primed with AR-20 oil and the dispense speed set to 2pl/sec. 1 7pl of AR20 silicone oil was dispensed onto the centre of a hexagonal close packed array of dimensions 6.04mm x 14.47 mm having 2048 compartments spaced with a pitch of 200pm, a well height of 90pm and a pillar height of 30pm and allowed to spread through the array. The array was then subjected to 100 deg. C in an oven for 30mins and subsequently removed and allowed to cool. The array was inspected to ensure the oil had reached the edges of the array before use.
Buffer filling
10ml of buffer (600mM KCI, lOOmM Hepes, 75mM Potassium Ferrocyanide (II), 25mM Potassium Ferricyanide (III), pH 8) was degassed and loaded into a flow-cell reservoir. The array was placed in the flow-cell as shown in Fig. 27 and the array was filled with buffer under vacuum (approx. 35mBar) to provide volumes of buffer in the compartments.
Oil filling
Immediately following die buffer filling step, 5pl of 10mg/ml TBCP/AR-20 was added to the flowcell and flowed over the top of the array under vacuum. This was left to incubate for approx. 5 minute to ensure that the TBCP covered the entire array. Excess buffer was removed from the non-array areas and excess oil was removed from the array under vacuum.
Addition of buffer layer
Following the oil filling step, a further amount of buffer was flowed over the array in order to provide a buffer layer/TBCP/volume of buffer interface. The layer of buffer also minimises evaporation of w'ater from the volumes of buffer in the compartments.
Example 10
This example describes how the method used to populate the arrays described in Example 8 was modified in order to produce confocal microscopy images show ing the unifotm population of the
CA 02889440 2015-04-24
WO 2014/064443 PCT/GB2013/052766 interconnecting droplet zones and membrane formation. The images show that the aqueous volumes pinned to the walls of the wells resulting in the control of membrane size.
Materials and Methods
The various images described above were taken by confocal imaging. In order to render the 5 materials involved in the experiments distinguishable in confocal microscopy, fluorescent dyes were diluted in the reagents. The oil (AR20) was dyed with BODIPY 493/503 (green) and the buffer solution, which formed the discrete volumes, was dyed with Sulforhodaminc B (red). The remaining materials were not dyed and therefore appear as dark regions in the confocal images. In membrane formation experiments (shown in Figs. 39 and 40) the incubation oil, with 10 mg/mL of TBCP, was also dyed with BODIPY 493/503. The bulk buiTer which was flowed over the array after the first aqueous volume had pinned to the walls of the inner wells was not dyed. The confocal microscopy samples were prepared with die above reagents using the method described in the previous section (Example 8), and then imaged using a Nikon Al Confocal Microscope.
The embodiments of the present invention for which an exclusive property or privilege is claimed are defined as follows:
1. A method of forming an array of membranes comprising amphipathic molecules, the
Contents75
38 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32 Sheet 33 Sheet 34 Sheet 35 Sheet 36 Sheet 37 Sheet 38
28 members in 8 offices
Priority claims5
| Document | Office | Kind | Date |
|---|---|---|---|
| 61718899 | United States of America | – | |
| 201261718899 | United States of America | P | |
| 13131214 | United Kingdom | – | |
| 201313121 | United Kingdom | A | |
| 2013052766 | United Kingdom | W |
Members28
| Document | Office | Kind | |
|---|---|---|---|
| GB201313121D0 | United Kingdom | D0 | |
| CA2889660A1 | Canada | A1 | |
| WO2014064443A2 | World Intellectual Property Organization (WIPO) | A2 | |
| WO2014064443A3 | World Intellectual Property Organization (WIPO) | A3 | |
| AU2013336429A1 | Australia | A1 | |
| EP2911781A2 | European Patent Office (EPO) | A2 | |
| CN104918696A | China | A | |
| US2015265994A1 | United States of America | A1 | |
| JP2015535179A | Japan | A | |
| AU2013336429B2 | Australia | B2 | |
| CN104918696B | China | B | |
| JP6495823B2 | Japan | B2 | |
| CN109569458A | China | A | |
| JP2019134704A | Japan | A | |
| EP2911781B1 | European Patent Office (EPO) | B1 | |
| EP3613499A1 | European Patent Office (EPO) | A1 | |
| US10814298B2 | United States of America | B2 | |
| JP6835892B2 | Japan | B2 | |
| US2021086160A1 | United States of America | A1 | |
| US11084015B2 | United States of America | B2 | |
| CN109569458B | China | B | |
| CA2889660CThis record | Canada | C | |
| US2022023819A1 | United States of America | A1 | |
| US2024253004A1 | United States of America | A1 | |
| US2024253005A1 | United States of America | A1 | |
| US2025033016A1 | United States of America | A1 | |
| US12350637B2 | United States of America | B2 | |
| US12458945B2 | United States of America | B2 |
8 legal events, as the office reported them to INPADOC
Over the term
Point at a mark for the eventEvents
| Event | Code | |
|---|---|---|
| Maintenance fee for patent paidMPN | MPN | |
| Fee paidST27 STATUS EVENT CODE: A-4-4-U10-U00-U101 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE REQUEST RECEIVEDU00 | U00 | |
| Full renewal or maintenance fee paidST27 STATUS EVENT CODE: A-4-4-U10-U11-U102 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE FEE PAYMENT PAID IN FULLU11 | U11 | |
| Maintenance fee for patent paidMPN | MPN | |
| Fee paidST27 STATUS EVENT CODE: A-4-4-U10-U00-U101 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE REQUEST RECEIVEDU00 | U00 | |
| Full renewal or maintenance fee paidST27 STATUS EVENT CODE: A-4-4-U10-U11-U102 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE FEE PAYMENT DETERMINED COMPLIANTU11 | U11 | |
| Full renewal or maintenance fee paidST27 STATUS EVENT CODE: A-4-4-U10-U11-U102 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE FEE PAYMENT PAID IN FULLU11 | U11 | |
| Examination requestEEER | EEER |
Numbers
- Publication
- 2889660
- Application
- 2889660
Titles2
- English
- FORMATION OF ARRAY OF MEMBRANES AND APPARATUS THEREFOR
- French
- FORMATION DE GROUPEMENT DE MEMBRANES ET APPAREIL POUR CELLE-CI
Classification
- CPC, 15
- B01J19/0046
- B01L3/5088
- G01N33/48721
- B01J2219/00317
- B01J2219/00585
- B01J2219/00659
- B01J2219/00734
- B01L2200/0642
- B01L2400/086
- B01J2219/00313
- B01J2219/00351
- B01J2219/00736
- C12Q1/6869
- G01N33/573
- G01N2333/974
- IPC, 3
- B01J19 00
- B01L3 00
- G01N33 487