Recombinant microorganism for the production of useful metabolites

CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685Recombinant microorganism for the production of useful metabolitesThe present invention relates to a recombinant microorganism characterized by having phosphoketolase activity, having a diminished or inactivated Embden-Meyerhof-Parnas pathway (EMPP) by inactivation of the gene(s) encoding the phosphofructokinase or by reducing the phosphofructokinase activity as compared to a non-modified microorganism or not possessing phosphofructokinase activity and having a diminished or inactivated oxidative branch of the pentose phosphate pathway (PPP) by inactivation of the gene(s) encoding the glucose-6-phosphate dehydrogenase or by reducing the glucose-6-phosphate dehydrogenase activity as compared to a non-modified microorganism or not possessing glucose-6-phosphate dehydrogenase activity.

Such a microorganism can be used for the production of useful metabolites such as acetone, isobutene or propene.For the past several decades, practitioners of metabolic engineering have endeavoured to provide biological solutions for the production of chemicals, thus, providing alternatives to more traditional chemical processes.

In general, biological solutions allow for the utilization of renewable feedstocks (e.g. sugars) and compete with existing petrochemical based processes. A multi-step, biological solution for the production of a chemical typically comprises a microorganism as the catalyst for the conversion of feedstock to a target molecule. A complete set of enzyme reactions for the production of a particular target molecule can be grouped into those belonging to central carbon pathways and those belonging to the product specific pathway.

The reactions belonging to central carbon and product specific pathways are linked in that redox (typically, NAD(P)H) and energetic (typically, ATP) constraints of each and every enzyme reaction must be accounted for in an overall balance contributing to the competitiveness of the process.

Historically, central carbon pathways of heterotrophs growing on sugars have been described as the Embden-Meyerhoff-Parnas pathway (EMPP), the pentose phosphate pathway (PPP), the Entner-Doudoroff pathway (EDP), and the phosphoketolase pathway (PKP) (see Gottschalk (1986), Bacterial Metabolism, 2nd Edition, Springer-Verlag, New York).

Each central pathway or combinations of central pathways offer advantages and disadvantages with respect to a specific target molecule.

In order to provide competitive bioprocesses, recombinant microorganisms with modifications involving the EMPP, PPP and EDP have been described (M.

Emmerling et al., Metab.

Eng. 1:117 (1999);1CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685L. 0.

Ingram et al., Appl.

Environ.

Microbiol. 53: 2420 (1987); C. T.

Trinh et al., Appl.

Environ.

Microbiol. 74:3634 (2008)).

More recently, recombinant microorganisms with modifications involving the PKP have been described (see Sondereager et al.

App!.

Environ.

Microbiol. 70 (2004), 2892-2897, US Patent 7,253,001, Chinen et al. J.

Biosci.

Bioeng. 103 (2007), 262-269, US Patent 7,785,858; Fleige et al., App!.

Microbiol.

Cell Physiol. 91 (2011), 769-776).The EMPP converts 1 mol glucose to 2 mol pyruvate (PYR).

When acetyl-CoA is desired, 1 mol PYR can be converted to 1 mol of acetyl-CoA with the concomitant generation of 1 mol CO2 and 1 mol NADH.

The sum of the reactions is given in Equation 1.glucose + 2 ADP + 2 H3PO4 + 2 CoA + 4 NAD+ 42 acetyl-CoA + 2 CO2 + 2 ATP + 2 H20 + 4 NADH + 4 H+ (Equation 1)The PPP provides a means to convert 1 mol glucose to 1 mol CO2 and 2 mol NADPH, with the concomitant generation of 0.67 mol fructose-6-phosphat (F6P) and 0.33 mol glyceraldehyde-3-phosphate (GAP).

The F6P and GAP thus formed must be metabolized by other reaction pathways, e.g. by the EMPP.

The EDP converts 1 mol glucose to 1 mol GAP and 1 mol PYR with the concomitant generation of 1 mol NADPH.

As with the PPP, the GAP thus formed must be metabolized by other reaction pathways.

The PKP provides a means to convert 1 mol glucose to 1 mol GAP and 1.5 mol acetyl phosphate (AcP).

When acetyl-CoA is desired, 1 equivalent of AcP plus 1 equivalent coenzyme A (CoA) can be converted to 1 equivalent acetyl-CoA and 1 equivalent inorganic phosphate (Pi) by the action of phosphotransacetylase.For specific target molecules derived from AcCoA moieties generated through the PKP and near redox neutrality to the AcCoA moieties, there exists a deficiency in the overall energy balance.

The PKP (and, similarly, the PPP and EDP) does not generate ATP for the conversion of glucose to glucose-6-phosphate.

In the case of phosphoenolpyruvate (PEP)-dependent glucose uptake, PEP must be generated by other means, e.g. through the EMPP.

Recycling GAP through the PKP exacerbates the issue, particularly when the product specific pathway provides little ATP.Sonderegger (loc. cit.) and US Patent 7,253,001 disclose recombinant Saccharomyces cerevisiae strains comprising native or overexpressed phosphoketolase activity together with overexpressed phosphotransacetylase to2CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685increase the yield in the conversion of glucose/xylose mixtures to ethanol.

These strains feature PEP-independent glucose uptake with both the EMPP and the PPP operative.Chinen (loc. cit.) and US Patent 7,785,858 disclose a recombinant bacterium selected from the group consisting of the Enterobacteriaceae familiy, Coryneform bacterium, and Bacillus bacterium comprising increased phosphoketolase activity for the conversion of glucose to target molecules which are produced via the intermediate acetyl-CoA, including the group consisting of L-glutamic acid, L-glutamine, L-proline, L-arginine, L-leucine, L-cysteine, succinate and polyhydroxybutyrate.

These strains feature PEP-dependent glucose uptake with the EMPP operative.

Notably, the activity of phosphofructokinase in the bacterium of US Patent 7,785,858 is reduced compared to that of a wild-type or non-modified strain (see page 33).Whether a particular microorganism utilizes PEP-independent glucose uptake or PEP-dependent glucose uptake impacts the overall energetic balance of a process.

For example, S. cerevisiae strains naturally employ PEP-independent glucose uptake while Escherichia coli strains naturally employ PEP-dependent glucose uptake. E. coli strains have been disclosed where PEP-dependent glucose uptake has been replaced with PEP-independent glucose uptake.

Flores et at. (Metabolic Engineering (2005) 7, 70-87) and US Patent 7,371,558.

In particular, US Patent 7,371,558 discloses the glucose uptake modification to increase the yield in the conversion of glucose to 1,3-propanediol.

The strains feature PEP-independent glucose uptake with both the EMPP and the PPP operative, notably with no phosphoketolase activity present.There is a need to develop recombinant microorganisms, comprising central carbon and product specific pathways that maximize the conversion of feedstock to product by best accommodating the redox and energetic constraints of enzyme reactions.

Applicants have addressed this need by providing the embodiments as defined in the claims.Thus, the present invention relates to a recombinant microorganism characterized by:a) having phosphoketolase activity;b) (i) having a diminished or inactivated Embden-Meyerhof-Parnas pathway (EMPP) by inactivation of the gene(s) encoding phosphofructokinase or by3CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685reducing phosphofructokinase activity as compared to a non-modified microorganism; or(ii) not possessing phosphofructokinase activityandc) (i) having a diminished or inactivated oxidative branch of the pentosephosphate pathway (PPP) by inactivation of the gene(s) encoding glucose-6-phosphate dehydrogenase or by reducing glucose-6-phosphate dehydrogenase activity as compared to a non-modified microorganism; or(ii) not possessing glucose-6-phosphate dehydrogenase activity.The microorganism according to the present invention is characterised by having phosphoketolase activity, so as to increase the flux of acetyl-CoA produced.

Usually, a microorganism converts glucose via the Embden-Meyerhof-Parnas pathway into pyruvate which can then be converted into acetyl-CoA by the enzyme pyruvate dehydrogenase.

However, this conversion is accompanied by the release of CO2 and, thus, one carbon atom is lost which might have been used in the production of useful metabolites.

In order to increase the amount of acetyl-CoA in a microorganism it is therefore desirable that acetyl-CoA is formed via a different pathway to avoid the loss of carbon atoms.

By using a microorganism having phosphoketolase activity, phosphate and fructose-6-phosphate are converted to erythrose-4-phosphate and acetylphosphate and the phosphotransacetylase further converts acetylphosphate into acetyl-CoA without loss of a carbon atom.

Thus, in the end, the yield of acetyl-CoA can be increased by using a microorganism having phosphoketolase activity.

Such a microorganism is capable of converting glucose into acetyl-CoA without loss of a carbon atom.

Recombinant microorganisms in which a phosphoketolase is naturally or heterologously expressed are disclosed in US 7,785,858 and US 7,253,001.The term "phosphoketolase activity" as used in the present invention means an enzymatic activity that is capable of converting D-xylulose-5-phosphate into D-glyceraldehyde-3-phosphate according to the following reaction:D-xylulose-5-phosphate + phosphate 4 D-glyceraldehyde-3-phosphate + acetyl-phosphate + wateror that is capable to catalyze the above shown reaction and that is also able to convert D-fructose-6-phosphate to D-erythrose-4-phosphate according to the following reaction:D-Fructose 6-phosphate + phosphate acetyl phosphate + D-erythrose 4-phosphate + water4CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685The former phosphoketolases are usually classified in EC 4.1.2.9 and the latter in EC 4.1.2.22.

Both types of phosphoketolases can be employed in the scope of the present invention.

Figure 1 shows schemes for the overall reactions using the two options of the phosphoketolase as described herein.This enzymatic activity can be measured by assays known in the art.

An example for such an assay is given in the Example section below.In the context of the present invention, a microorganism which has phosphoketolase activity can, e.g., be a microorganism which naturally has phosphoketolase activity or a microorganism that does not naturally have phosphoketolase activity and has been genetically modified to express a phosphoketolase or a microorganism which naturally has phosphoketolase activity and which has been genetically modified, e.g. transformed with a nucleic acid, e.g. a vector, encoding a phosphoketolase in order to increase the phosphoketolase activity in said microorganism.Microorganisms that inherently, i.e. naturally, have phosphoketolase activity are known in the art and any of them can be used in the context of the present invention.It is also possible in the context of the present invention that the microorganism is a microorganism which naturally does not have phosphoketolase activity but which is genetically modified so as to comprise a nucleotide sequence allowing the expression of a phosphoketolase.

Similarly, the microorganism may also be a microorganism which naturally has phosphoketolase activity but which is genetically modified so as to enhance the phosphoketolase activity, e.g. by the introduction of an exogenous nucleotide sequence encoding a phosphoketolase.The genetic modification of microorganisms to express an enzyme of interest will be described in detail below.The phosphoketolase expressed in the microorganism according to the invention can be any phosphoketolase, in particular a phosphoketolase from prokaryotic or eukaryotic organisms.

Prokaryotic phosphoketolases are described, e.g., from Lactococcus lactis and an example is given in the Example section.In a preferred embodiment of the present invention the phosphoketolase is an enzyme comprising an amino acid sequence as encoded by 5Q0005 shown in the Example section or a sequence which is at least n % identical to that amino acid sequence and having the activity of a phosphoketolase with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99.Preferably, the degree of identity is determined by comparing the respective sequence with the amino acid sequence of any one of the above-mentioned SEQ IDCA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685NOs.

When the sequences which are compared do not have the same length, the degree of identity preferably either refers to the percentage of amino acid residues in the shorter sequence which are identical to amino acid residues in the longer sequence or to the percentage of amino acid residues in the longer sequence which are identical to amino acid residues in the shorter sequence.

The degree of sequence identity can be determined according to methods well known in the art using preferably suitable computer algorithms such as CLUSTAL.When using the Clustal analysis method to determine whether a particular sequence is, for instance, 80% identical to a reference sequence default settings may be used or the settings are preferably as follows: Matrix: blosum 30; Open gap penalty: 10.0; Extend gap penalty: 0.05; Delay divergent: 40; Gap separation distance: 8 for comparisons of amino acid sequences.

For nucleotide sequence comparisons, the Extend gap penalty is preferably set to 5ØPreferably, the degree of identity is calculated over the complete length of the sequence.The phosphoketolase expressed in the microorganism according to the invention can be a naturally occurring phosphoketolase or it can be a phosphoketolase which is derived from a naturally occurring phosphoketolase, e.g. by the introduction of mutations or other alterations which, e.g., alter or improve the enzymatic activity, the stability, etc.Methods for modifying and/or improving the desired enzymatic activities of proteins are well-known to the person skilled in the art and include, e.g., random mutagenesis or site-directed mutagenesis and subsequent selection of enzymes having the desired properties or approaches of the so-called "directed evolution".For example, for genetic modification in prokaryotic cells, a nucleic acid molecule encoding phosphoketolase can be introduced into plasmids which permit mutagenesis or sequence modification by recombination of DNA sequences.

Standard methods (see Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA) allow base exchanges to be performed or natural or synthetic sequences to be added. DNA fragments can be ligated by using adapters and linkers complementary to the fragments.

Moreover, engineering measures which provide suitable restriction sites or remove surplus DNA or restriction sites can be used.

In those cases, in which insertions, deletions or substitutions are possible, in vitro mutagenesis, "primer repair", restriction or ligation can be used.

In general, a sequence analysis, restriction analysis and other methods of biochemistry and molecular biology are carried out as analysis methods.

The resulting phosphoketolase variants are then tested for the6CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685desired activity, e.g., enzymatic activity, with an assay as described above and in particular for their increased enzyme activity.As described above, the microorganism of the invention may be a microorganism which has been genetically modified by the introduction of a nucleic acid molecule encoding a phosphoketolase.

Thus, in a preferred embodiment, the recombinant microorganism is a recombinant microorganism which has been genetically modified to have an increased phosphoketolase activity.

This can be achieved e.g. by transforming the microorganism with a nucleic acid encoding a phosphoketolase. A detailed description of genetic modification of microorganisms will be given further below.

Preferably, the nucleic acid molecule introduced into the microorganism is a nucleic acid molecule which is heterologous with respect to the microorganism, i.e. it does not naturally occur in said microorganism.In the context of the present invention, an "increased activity" means that the expression and/or the activity of an enzyme, in particular of the phosphoketolase in the genetically modified microorganism is at least 10%, preferably at least 20%, more preferably at least 30% or 50%, even more preferably at least 70% or 80% and particularly preferred at least 90% or 100% higher than in the corresponding non-modified microorganism.

In even more preferred embodiments the increase in expression and/or activity may be at least 150%, at least 200% or at least 500%.

In particularly preferred embodiments the expression is at least 10-fold, more preferably at least 100-fold and even more preferred at least 1000-fold higher than in the corresponding non-modified microorganism.The term "increased" expression/activity also covers the situation in which the corresponding non-modified microorganism does not express a corresponding enzyme, e.g. phosphoketolase, so that the corresponding expression/activity in the non-modified microorganism is zero.Methods for measuring the level of expression of a given protein in a cell are well known to the person skilled in the art.

In one embodiment, the measurement of the level of expression is done by measuring the amount of the corresponding protein.

Corresponding methods are well known to the person skilled in the art and include Western Blot, ELISA etc.

In another embodiment the measurement of the level of expression is done by measuring the amount of the corresponding RNA.

Corresponding methods are well known to the person skilled in the art and include, e.g., Northern Blot.Methods for measuring the enzymatic activity of the phosphoketolase are known in the art and have already been described above.The microorganism according to the present invention is further characterised by having a diminished or inactivated Embden-Meyerhof-Parnas pathway (EMPP) by7CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685inactivation of the gene(s) encoding a phosphofructokinase or by reducing the phosphofructokinase activity as compared to a non-modified microorganism or by not possessing phosphofructokinase activity.

Thus, the microorganism is either a microorganism which naturally has an EMPP including phosphofructokinase activity but which has been modified, in particular genetically modified, so that the phosphofructokinase activity is either completely abolished or so that it is reduced compared to the corresponding non-modified microorganism, or the microorganism is a microorganism which naturally does not possess a phosphofructokinase activity.As already mentioned above, when glucose is processed via the EMPP to acetyl-CoA, one carbon atom is lost by the release of CO2 in the last step.

By introducing the phosphoketolase, this loss can be avoided.

Since fructose-6-phosphate is a substrate for the phosphoketolase, it is desirable that the pool of fructose-6-phosphate is kept at a high level in the microorganism in order to increase the yield in acetyl-CoA.

Since fructose-6-phosphate is also a substrate for an enzyme of the Embden-Meyerhof-Parnas pathway, i.e. the phosphofructokinase, the recombinant microorganism of the present invention has a reduced phosphofructokinase activity as compared to a non-modified microorganism or the gene(s) encoding a phosphofructokinase has/have been inactivated.

This ensures the flux of fructose-6-phosphate is directed to the phosphoketolase and to the production of acetyl-CoA without loss of 002 because fructose-6-phosphate or most of fructose-6-phosphate can no longer be processed via the Embden-Meyerhof-Parnas pathway.

Recombinant microorganisms in which a phosphoketolase is naturally or heterologously expressed and which have reduced phosphofructokinase activity are disclosed in US 7,785,858.The "phosphofructokinase activity" means an enzymatic activity that converts ATP and fructose-6-phosphate to ADP and fructose-1,6-bisphosphate (EC 2.7.1.11).

This enzymatic activity can be measured by assays known in the art as, for example, described by Kotlarz et al. (Methods Enzymol. (1982) 90, 60-70).The term "a microorganism which is characterised by having a diminished or inactivated Embden-Meyerhof-Parnas pathway (EMPP) by inactivation of the gene(s) encoding a phosphofructokinase or by reducing the phosphofructokinase activity as compared to a non-modified microorganism" preferably refers to a microorganism in which the inactivation of the gene(s) encoding a phosphofructokinase or the reduction of the phosphofructokinase activity as compared to a non-modified microorganism is achieved by a genetic modification of the microorganism which leads to said inactivation or reduction.8CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685In a preferred embodiment, the recombinant microorganism of the present invention is a recombinant microorganism that has an inactivated Embden-Meyerhof-Parnas pathway (EMPP) by inactivation of the gene(s) encoding a phosphofructokinase.

The inactivation of the gene(s) encoding a phosphofructokinase in the context of the present invention means that the gene(s) coding for phosphofructokinase which are present in the microorganism is (are) inactivated so that they are no longer expressed and/or do not lead to the synthesis of functional phosphofructokinase.

Inactivation can be achieved by many different ways known in the art.

The inactivation can, e.g., be achieved by the disruption of the gene(s) encoding the phosphofructokinase or by clean deletion of said gene(s) through the introduction of a selection marker.

Alternatively, the promoter of the gene(s) encoding the phosphofructokinase can be mutated in a way that the gene is no longer transcribed into mRNA.

Other ways to inactivate the gene(s) encoding the phosphofructokinase known in the art are: to express a polynucleotide encoding RNA having a nucleotide sequence complementary to the transcript of the phosphofructokinase gene(s) so that the mRNA can no longer be translated into a protein, to express a polynucleotide encoding RNA that suppresses the expression of said gene(s) through RNAi effect; to express a polynucleotide encoding RNA having an activity of specifically cleaving a transcript of said gene(s); or to express a polynucleotide encoding RNA that suppresses expression of said gene(s) through co-suppression effect.

These polynucleotides can be incorporated into a vector, which can be introduced into the microorganism by transformation to achieve the inactivation of the gene(s) encoding the phosphofructokinase.The term "inactivation" in the context of the present invention preferably means complete inactivation, i.e. that the microorganism does not show phosphofructokinase activity.

This means in particular that the microorganism does not show phosphofructokinase activity independent from the used growth conditions.

Preferably, "inactivation" means that the gene(s) encoding phosphofructokinase which are present in the microorganism are genetically modified so as to prevent the expression of the enzyme.

This can be achieved,e,g, by deletion of the gene or parts thereof wherein the deletion of parts thereof prevents expression of the enzyme, or by disruption of the gene either in the coding region or in the promoter region wherein the disruption has the effect that no protein is expressed or a dysfunctional protein is expressed.In a preferred embodiment, the recombinant microorganism of the present invention is a recombinant microorganism that has a diminished Embden-Meyerhof-Parnas pathway (EMPP) by reducing the phosphofructokinase activity as compared to a non-modified microorganism.

Preferably, this reduction is achieved by a genetic9CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685modification of the microorganism.

This can be achieved e.g., by random mutagenesis or site-directed mutagenesis of the promoter and/or the enzyme and subsequent selection of promoters and/or enzymes having the desired properties or by complementary nucleotide sequences or RNAi effect as described above. A detailed description of genetic modification of microorganisms will be given further below.In the context of the present invention, a "reduced activity" means that the expression and/or the activity of an enzyme, in particular of the phosphofructokinase, in the genetically modified microorganism is at least 10%, preferably at least 20%, more preferably at least 30% or 50%, even more preferably at least 70% or 80% and particularly preferred at least 90% or 100% lower than in the corresponding non-modified microorganism.

Methods for measuring the level of expression of a given protein in a cell are well known to the person skilled in the art.

Assays for measuring the reduced enzyme activity of a phosphofructokinase are known in the art.In another embodiment the microorganism according to the present invention is a microorganism which does not possess a phosphofructokinase activity.

This preferably means that such a microorganism naturally does not possess a phosphofructokinase activity.

This means that such a microorganism does naturally not contain in its genome a nucleotide sequence encoding an enzyme with phosphofructokinase activity.

Examples for such microorganisms are Zymomonas mobilis (J. S.

Suo et al., Nat.

Biotechnol. 23:63 (2005)) and Ralstonia eutropha (C.

Fleige et al., Appl.

Microb.

Cell Physiol. 91:769 (2011)).The microorganism according to the present invention is further characterised by having a diminished or inactivated oxidative branch of the pentose phosphate pathway (PPP) by inactivation of the gene(s) encoding a glucose-6-phosphate dehydrogenase or by reducing the glucose-6-phosphate dehydrogenase activity as compared to a non-modified microorganism or by not possessing glucose-6-phosphate dehydrogenase activity.

Thus, the microorganism is either a microorganism which naturally has a PPP including glucose-6-phosphate dehydrogenase activity but which has been modified, in particular genetically modified, so that the glucose-6-phosphate dehydrogenase activity is either completely abolished or so that it is reduced compared to the corresponding non-modified microorganism, or the microorganism is a microorganism which naturally does not possess a glucose-6-phosphate dehydrogenase activity.Diminishing or inactivating the oxidative branch of the pentose phosphate pathway further increases the yield in acetyl-CoA since glucose-6-phosphate will no longer beCA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685drawn through the pentose phosphate cycle.

All or almost all glucose-6-phosphate in the microorganism will be converted into fructose-6-phosphate which will then be further converted into acetyl-CoA.The "glucose-6-phosphate dehydrogenase activity" means an enzymatic activity that converts glucose-6-phosphate and NADP+ to 6-phosphoglucono-ö-lactone and NADPH (EC 1.1.1.49).

This enzymatic activity can be measured by assays known in the art as, for example, described by Noltmann et al. (J.

Biol.

Chem. (1961) 236, 1225-1230).The term "a microorganism which is characterised by having a diminished or inactivated oxidative branch of the pentose phosphate pathway (PPP) by inactivation of the gene(s) encoding a glucose-6-phosphate dehydrogenase or by reducing the glucose-6-phosphate dehydrogenase activity as compared to a non-modified microorganism" preferably refers to a microorganism in which the inactivation of the gene(s) encoding a glucose-6-phosphate dehydrogenase or the reduction of the glucose-6-phosphate dehydrogenase activity as compared to a non-modified microorganism is achieved by a genetic modification of the microorganism which leads to said inactivation or reduction.In a preferred embodiment, the recombinant microorganism of the present invention is a recombinant microorganism that has an inactivated oxidative branch of the pentose phosphate pathway (PPP) by inactivation of the gene(s) encoding a glucose-6-phosphate dehydrogenase.

The inactivation of the gene(s) encoding a glucose-6-phosphate dehydrogenase in the context of the present invention means that the gene(s) coding for glucose-6-phosphate dehydrogenase which is (are) present in the microorganism is (are) inactivated so that they are no longer expressed and/or do not lead to the synthesis of functional glucose-6-phosphate dehydrogenase.

Inactivation can be achieved by many different ways known in the art.

The inactivation can, e.g., be achieved by the disruption of the gene(s) encoding the glucose-6-phosphate dehydrogenase or by clean deletion of said gene(s) through the introduction of a selection marker.

Alternatively, the promoter of the gene(s) encoding the glucose-6-phosphate dehydrogenase can be mutated in a way that the gene(s) is/are no longer transcribed into mRNA.

Other ways to inactivate the gene(s) encoding the phosphofructokinase known in the art are: to express a polynucleotide encoding RNA having a nucleotide sequence complementary to the transcript of the glucose-6-phosphate dehydrogenase gene(s) so that the mRNA can no longer be translated into a protein, to express a polynucleotide encoding RNA that suppresses the expression of said gene(s) through RNAi effect; to express a polynucleotide encoding11CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685RNA having an activity of specifically cleaving a transcript of said gene(s); or to express a polynucleotide encoding RNA that suppresses expression of said gene(s) through co-suppression effect.

These polynucleotides can be incorporated into a vector, which can be introduced into the microorganism by transformation to achieve the inactivation of the gene(s) encoding the glucose-6-phosphate dehydrogenase.The term "inactivation" in the context of the present invention preferably means complete inactivation, i.e. that the microorganism does not show glucose-6-phosphate dehydrogenase activity.

This means in particular that the microorganism does not show glucose-6-phosphate dehydrogenase activity independent from the used growth conditions.Preferably, "inactivation" means that the gene(s) encoding glucose-6-phosphate dehydrogenase which are present in the microorganism are genetically modified so as to prevent the expression of the enzyme.

This can be achieved,e,g, by deletion of the gene or parts thereof wherein the deletion of parts thereof prevents expression of the enzyme, or by disruption of the gene either in the coding region or in the promoter region wherein the disruption has the effect that no protein is expressed or a dysfunctional protein is expressed.In a preferred embodiment, the recombinant microorganism of the present invention is a recombinant microorganism that has a diminished oxidative branch of the pentose phosphate pathway (PPP) by reducing the glucose-6-phosphate dehydrogenase activity as compared to a non-modified microorganism.

Preferably, this reduction is achieved by a genetic modification of the microorganism.

This can be achieved e.g., by random mutagenesis or site-directed mutagenesis of the promoter and/or the enzyme and subsequent selection of promoters and/or enzymes having the desired properties or by complementary nucleotide sequences or RNAi effect as described above. A detailed description of genetic modification of microorganisms will be given further below.In the context of the present invention, a "reduced activity" means that the expression and/or the activity of an enzyme, in particular of the glucose-6-phosphate dehydrogenase, in the genetically modified microorganism is at least 10%, preferably at least 20%, more preferably at least 30% or 50%, even more preferably at least 70% or 80% and particularly preferred at least 90% or 100% lower than in the corresponding non-modified microorganism.

Methods for measuring the level of expression of a given protein in a cell are well known to the person skilled in the art.

Assays for measuring the reduced enzyme activity of a glucose-6-phosphate dehydrogenase are known in the art.12CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685In another embodiment the microorganism according to the present invention is a microorganism which does not possess a glucose-6-phosphate dehydrogenase activity.

This preferably means that such a microorganism naturally does not possess a glucose-6-phosphate dehydrogenase activity.

This means that such a microorganism does naturally not contain in its genome a nucleotide sequence encoding an enzyme with glucose-6-phosphate dehydrogenase activity.

Examples for such microorganisms are Acinetobacter baylyi (Barbe et al., Nucl.

Acids Res. 32 (2004), 5766-5779), archae of the hyperthermophilic phylum such as Sulfolobus solfataricus (Nunn et al., J.

Biol.

Chem. 285 (2010), 33701-33709), Thermoproteus tenax, Thermoplasma acidophilum and Picrophilus torridus (Reher and Schonheit, FEBS Lett. 580 (2006), 1198-1204).In a further embodiment, the microorganism according to the present invention is further characterised by having fructose-1,6-bisphosphate phosphatase activity, preferably when grown on glucose.

Fructose-1,6-bisphosphate phosphatase is an enzyme participating in the gluconeogenesis hydrolyzing fructose-1,6-bisphosphate into fructose-6-phosphate and free phosphate.

However, in basically all organisms in the presence of glucose, fructose-1,6-bisphosphate phosphatase activity is repressed and glucose is processed through EMPP (glycolysis).

The microorganism of the present invention, which has phosphoketolase activity and which does not possess phosphofructokinase activity or in which phosphofructokinase activity is reduced or whose gene encoding the phosphofructokinase is inactivated, the yield of acetyl-CoA by conversion of fructose-6-phosphate with the phosphoketolase (EC 4.1.2.9 or EC 4.1.2.22) can be enhanced by ensuring the presence of fructose-1,6-bisphosphate phosphatase activity, for example by derepression of the fructose-1,6-bisphosphate phosphatase in the presence of glucose.

The presence of fructose-1,6-bisphosphate phosphatase activity results in the recycling of fructose-1,6-bisphosphate produced by fructose-1,6-bisphosphate aldolase into fructose-6-phosphate which can then again be converted via the phosphoketolase pathway to acetyl-CoA.

Indeed, the product acetyl phosphate of phosphoketolase interconverts into acetyl-CoA through the action of the enzyme phosphate acetyltransferase EC 2.3.1.8.

Thus, the recombinant microorganism of the present invention is capable of producing acetyl-CoA from glucose at a stoichiometry approaching 3:1.

The sum of the reactions is given in equation 2:glucose + ATP + 3 CoA 3 acetyl-CoA + ADP + H3PO4 + 2 H20(Equation 2)13CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685The term "fructose-1,6-bisphosphate phosphatase activity" means an enzymatic activity that converts fructose-1,6-bisphosphate and H20 to fructose-6-phosphate and phosphate (EC 3.1.3.11).

This enzymatic activity can be measured by assays known in the art as, for example, described by Hines et al. (J.

Biol.

Chem. (2007) 282, 11696-11704).

The terms "fructose-1,6-bisphosphate phosphatase activity" and "fructose-1,6-bisphosphate phosphatase" also cover enzymes which are bifunctional in the sense that they show a fructose-1-6-bisphosphate aldolase/phosphatase activity.

Such bifunctional enzymes are expressed in most archaeal and deeply branching bacterial lineages and, in most cases, are heat-stable.

Such enzymes are, for example, reported for Thermococcus kodakaraensis, Sulfolobus tokodaii, lgnicoccus hospitalis, Cenarchaeum symbiosum, Sulfolobus solfataricas, Thermus thermophilus, Thermoproteus neutrophilus, MooreIla thermoacetica and many others (see, e.g., Say and Fuchs (Nature 464 (2010), 1077); Fushinobu et al. (Nature 478 (2011), 538; Du et al. (Nature 478 (2011), 534).The term "fructose-1,6-bisphosphate phosphatase activity when grown on glucose" means that the microorganism expresses an enzyme with fructose-1,6-bisphosphate phosphatase activity when the microorganism is grown on glucose. "Grown on glucose" means that the microorganism is grown in a medium which contains inter alia glucose as carbon source.

Preferably, this term means that the microorganism is grown in a medium containing glucose as sole carbon source.In the context of the present invention, a microorganism which has fructose-16-bisphosphate phosphatase activity, in particular when grown on glucose, can, for example, be a microorganism which naturally has fructose-1,6-bisphosphate phosphatase activity, in particular when grown on glucose, or a microorganism that does not naturally have fructose-1,6-bisphosphate phosphatase activity, in particular when grown on glucose, and that has been genetically modified to express a fructose-1,6-bisphosphate phosphatase, in particular when grown on glucose.

It may also be a microorganism which naturally has fructose-1,6-bisphosphate phosphatase activity, in particular when grown on glucose, and which has been genetically modified, e.g. transformed with a nucleic acid, e.g. a vector, encoding a fructose-16-bisphosphate phosphatase in order to increase the phosphoketolase activity in said microorganism.Microorganisms that inherently, i.e. naturally, have fructose-1,6-bisphosphate phosphatase activity, in particular when grown on glucose, are known in the art and any of them can be used in the context of the present invention.It is also possible in the context of the present invention that the microorganism is a microorganism which naturally does not have fructose-1,6-bisphosphate14CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685phosphatase activity, in particular when grown on glucose, but which is genetically modified so as to be able to express a fructose-1,6-bisphosphate phosphatase, in particular, when grown on glucose.

This can be achieved, e.g., by mutating the promoter of the gene encoding the fructose-1,6-bisphosphate phosphatase in a way that the gene is no longer repressed when the microorganism is grown on glucose or the promoter can be replaced by another promoter e.g. a constitutive promoter which is not regulated when the microorganism is grown on glucose.Similarly, the microorganism may also be a microorganism which naturally has fructose-1,6-bisphosphate phosphatase activity, in particular when grown on glucose, but which is genetically modified so as to enhance/increase the fructose-1,6-bisphosphate phosphatase activity, in particular when grown on glucose, e.g. by the introduction of an exogenous nucleotide sequence encoding a fructose-1,6-bisphosphate phosphatase.The genetic modification of microorganisms to express an enzyme of interest will be described in detail below.The fructose-1,6-bisphosphate phosphatase according to the invention can be a naturally occurring fructose-1,6-bisphosphate phosphatase or it can be a fructose-1,6-bisphosphate phosphatase which is derived from a naturally occurring fructose-1,6-bisphosphate phosphatase, e.g. by the introduction of mutations or other alterations which, e.g., alter or improve the enzymatic activity, the stability, etc.

Methods for modifying and/or improving the desired enzymatic activities of proteins are well-known to the person skilled in the art and have been described above.

The resulting fructose-1,6-bisphosphate phosphatase variants are then tested for their properties, e.g. enzymatic activity or regulation.

Assays for measuring the enzyme activity of a fructose-1,6-bisphosphate phosphatase are known in the art.

In one embodiment the fructose-1,6-bisphosphate phosphatase is an enzyme which is not regulated by feed-back inhibition.In a preferred embodiment, the recombinant microorganism has been genetically modified to have an increased fructose-1,6-bisphosphate phosphatase activity.

This can be achieved e.g. by transforming the microorganism with a nucleic acid encoding a fructose-1,6-bisphosphate phosphatase. A detailed description of genetic modification of microorganisms will be given further below.In the context of the present invention, an "increased activity" means that the expression and/or the activity of an enzyme, in particular of the fructose-1,6-bisphosphate phosphatase, in the genetically modified microorganism when grown on glucose is at least 10%, preferably at least 20%, more preferably at least 30% or 50%, even more preferably at least 70% or 80% and particularly preferred at least 90% or 100`)/0 higher than in the corresponding non-modified microorganism whenCA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685grown on glucose.

In even more preferred embodiments the increase in expression and/or activity may be at least 150%, at least 200% or at least 500%.

In particularly preferred embodiments the expression is at least 10-fold, more preferably at least 100-fold and even more preferred at least 1000-fold higher than in the corresponding non-modified microorganism in particular when grown on glucose.Methods for measuring the level of expression of a given protein in a cell are well known to the person skilled in the art.

In one embodiment, the measurement of the level of expression is done by measuring the amount of the corresponding protein.

Corresponding methods are well known to the person skilled in the art and include Western Blot, ELISA etc.

In another embodiment the measurement of the level of expression is done by measuring the amount of the corresponding RNA.

Corresponding methods are well known to the person skilled in the art and include, e.g., Northern Blot.Methods for measuring the enzymatic activity of the fructose-1,6-bisphosphate are known in the art.In another embodiment, the microorganism according to the present invention is further characterised in that the EMPP is further diminished or inactivated by inactivation of the gene(s) encoding the glyceraldehyde 3-phosphate dehydrogenase or by reducing the glyceraldehyde 3-phosphate dehydrogenase activity as compared to a non-modified microorganism.

Further diminishing the EMPP at a step further downstream by diminishing or inactivating the glyceraldehyde 3-phosphate dehydrogenase ensures that none or almost none glyceraldehyde 3-phosphate that may be produced in the microorganism will be processed via the glycolysis to acetyl-CoA whereby one carbon atom would be lost by the release of CO2 in the last step catalysed by the pyruvate dehydrogenase.

Therefore, blocking the EMPP by diminishing or inactivating the glyceraldehyde 3-phosphate dehydrogenase activity further ensures that the overall flux is directed towards the phosphoketolase.The "glyceraldehyde 3-phosphate dehydrogenase activity" means an enzymatic activity that converts glyceraldehyde 3-phosphate, phosphate and NAD+ to 3-phospho-D-glyceroyi phosphate and NADH + H+ (EC 1.2.1.12).

This activity can be measured by assays known in the art as, for example, described by D'Alessio et al. (J.

Biol.

Chem. (1971) 246, 4326-4333).The term "a microorganism which is characterised by having a further diminished or inactivated Embden-Meyerhof-Parnas pathway (EMPP) by inactivation of the gene(s) encoding a glyceraldehyde 3-phosphate dehydrogenase or by reducing the glyceraldehyde 3-phosphate dehydrogenase activity as compared to a non-modified16CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685microorganism" preferably refers to a microorganism in which the inactivation of the gene(s) encoding a glyceraldehyde 3-phosphate dehydrogenase or the reduction of the glyceraldehyde 3-phosphate dehydrogenase activity as compared to a non-modified microorganism is achieved by a genetic modification of the microorganism which leads to said inactivation or reduction.In a preferred embodiment, the recombinant microorganism of the present invention is a recombinant microorganism in which the EMPP is further diminished or inactivated by inactivation of the gene(s) encoding the glyceraldehyde 3-phosphate dehydrogenase or by reducing the glyceraldehyde 3-phosphate dehydrogenase activity as compared to a non-modified microorganism.

The inactivation of the gene(s) encoding a glyceraldehyde 3-phosphate dehydrogenase in the context of the present invention means that the gene(s) coding for glyceraldehyde 3-phosphate dehydrogenase which is (are) present in the microorganism is (are) inactivated so that they are no longer expressed and/or do not lead to the synthesis of functional glyceraldehyde 3-phosphate dehydrogenase.

Inactivation can be achieved by many different ways known in the art.

The inactivation can, e.g., be achieved by the disruption of the gene(s) encoding the glyceraldehyde 3-phosphate dehydrogenase or by clean deletion of said gene(s) through the introduction of a selection marker.

Alternatively, the promoter of the gene encoding the glyceraldehyde 3-phosphate dehydrogenase can be mutated in a way that the gene(s) is/are no longer transcribed into mRNA.

Other ways to inactivate the gene(s) encoding the glyceraldehyde 3-phosphate dehydrogenase known in the art are: to express a polynucleotide encoding RNA having a nucleotide sequence complementary to the transcript of the glyceraldehyde 3-phosphate dehydrogenase gene(s) so that the mRNA can no longer be translated into a protein, to express a polynucleotide encoding RNA that suppresses the expression of said gene(s) through RNAi effect; to express a polynucleotide encoding RNA having an activity of specifically cleaving a transcript of said gene(s); or to express a polynucleotide encoding RNA that suppresses expression of said gene(s) through co-suppression effect.

These polynucleotides can be incorporated into a vector, which can be introduced into the microorganism by transformation to achieve the inactivation of the gene(s) encoding the glyceraldehyde 3-phosphate dehydrogenase.The term "inactivation" in the context of the present invention preferably means complete inactivation, i.e. that the microorganism does not show glyceraldehyde 3-phosphate dehydrogenase activity.

This means in particular that the microorganism does not show glyceraldehyde 3-phosphate dehydrogenase activity independent from the used growth conditions.Preferably, "inactivation" means that the gene(s) encoding glyceraldehyde 3-phosphate dehydrogenase which are present in the microorganism are genetically17CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685modified so as to prevent the expression of the enzyme.

This can be achieved,e,g, by deletion of the gene or parts thereof wherein the deletion of parts thereof prevents expression of the enzyme, or by disruption of the gene either in the coding region or in the promoter region wherein the disruption has the effect that no protein is expressed or a dysfunctional protein is expressed.In a preferred embodiment, the recombinant microorganism of the present invention is a recombinant microorganism that has a diminished EMPP by reducing the glyceraldehyde 3-phosphate dehydrogenase activity as compared to a non-modified microorganism.

Preferably, this reduction is achieved by a genetic modification of the microorganism.

This can be achieved e.g., by random mutagenesis or site-directed mutagenesis of the promoter and/or the enzyme and subsequent selection of promoters and/or enzymes having the desired properties or by complementary nucleotide sequences or RNAi effect as described above. A detailed description of genetic modification of microorganisms will be given further below.In the context of the present invention, a "reduced activity" means that the expression and/or the activity of an enzyme, in particular of the glyceraldehyde 3-phosphate dehydrogenase, in the genetically modified microorganism is at least 10%, preferably at least 20%, more preferably at least 30% or 50%, even more preferably at least 70% or 80% and particularly preferred at least 90% or 100% lower than in the corresponding non-modified microorganism.

Methods for measuring the level of expression of a given protein in a cell are well known to the person skilled in the art.

Assays for measuring the reduced enzyme activity of a glyceraldehyde 3-phosphate dehydrogenase are known in the art.The term "microorganism" in the context of the present invention refers to bacteria, as well as to fungi, such as yeasts, and also to algae and archaea.

In one preferred embodiment, the microorganism is a bacterium.

In principle any bacterium can be used.

Preferred bacteria to be employed in the process according to the invention are bacteria of the genus Bacillus, Clostridium, Corynebacterium, Pseudomonas, Zymomonas or Escherichia.

In a particularly preferred embodiment the bacterium belongs to the genus Escherichia and even more preferred to the species Escherichia coli.

In another preferred embodiment the bacterium belongs to the species Pseudomonas putida or to the species Zyrnomonas mobilis or to the species Corynebacterium glutamicum.In another preferred embodiment the microorganism is a fungus, more preferably a fungus of the genus Saccharomyces, Schizosaccharomyces, Aspergillus, Trichoderma, Kluyveromyces or Pichia and even more preferably of the species Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus niger,18CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685Trichoderma reesei, Kluyveromyces marxianus, Kluyveromyces lactis, Pichia pastoris, Pichia torula or Pichia utilis.In a more preferred embodiment, where the recombinant microorganism is a bacterium, the gene(s) encoding the PEP-dependent PTS transporter have been inactivated.

In the context of the present invention, inactivation means that the gene(s) coding for PEP-dependent PTS transporter which is (are) present in the microorganism is (are) inactivated so that they are no longer expressed and/or do not lead to the synthesis of functional PEP-dependent PTS transporter.

The inactivation of the gene(s) encoding the PEP-dependent PTS transporter should be such that the bacteria are no longer capable of transporting glucose via the PEP-dependent PTS transporter.PEP-dependent PTS transporter (e.g. from E. coli, B. subtilis) are known in the art.

An example for inactivation of the PEP-dependent PTS transporter is shown in the Example section below.Inactivation can be achieved by many different ways known in the art.

The inactivation can, e.g., be achieved by the disruption of the gene(s) encoding the PEP-dependent PTS transporter or by clean deletion of said gene(s) through the introduction of a selection marker.

Alternatively, the promoter of the gene(s) encoding the PEP-dependent PTS transporter can be mutated in a way that the gene(s) is (are) no longer transcribed into mRNA.

Other ways to inactivate the gene(s) encoding the PEP-dependent PTS transporter known in the art are: to express a polynucleotide encoding RNA having a nucleotide sequence complementary to the transcript of the PEP-dependent PTS transporter gene(s) so that the mRNA can no longer be translated into a protein, to express a polynucleotide encoding RNA that suppresses the expression of said gene(s) through RNAi effect; to express a polynucleotide encoding RNA having an activity of specifically cleaving a transcript of said gene(s); or to express a polynucleotide encoding RNA that suppresses expression of said gene(s) through co-suppression effect.

These polynucleotides can be incorporated into a vector, which can be introduced into the microorganism by transformation to achieve the inactivation of the gene(s) encoding the PEP-dependent PTS transporter.The term "recombinant" means that the microorganism of the present invention is genetically modified so as to contain a nucleic acid molecule encoding an enzyme as defined above as compared to a wild-type or non-modified microorganism or so that a gene encoding an enzyme as defined above has been deleted as compared to a wild-type or non-modified microorganism.19CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685A nucleic acid molecule encoding an enzyme as defined above can be used alone or as part of a vector.The nucleic acid molecules can further comprise expression control sequences operably linked to the polynucleotide comprised in the nucleic acid molecule.

The term "operatively linked" or "operably linked", as used throughout the present description, refers to a linkage between one or more expression control sequences and the coding region in the polynucleotide to be expressed in such a way that expression is achieved under conditions compatible with the expression control sequence.Expression comprises transcription of the heterologous DNA sequence, preferably into a translatable mRNA.

Regulatory elements ensuring expression in fungi as well as in bacteria, are well known to those skilled in the art.

They encompass promoters, enhancers, termination signals, targeting signals and the like.

Examples are given further below in connection with explanations concerning vectors.Promoters for use in connection with the nucleic acid molecule may be homologous or heterologous with regard to its origin and/or with regard to the gene to be expressed.

Suitable promoters are for instance promoters which lend themselves to constitutive expression.

However, promoters which are only activated at a point in time determined by external influences can also be used.

Artificial and/or chemically inducible promoters may be used in this context.The vectors can further comprise expression control sequences operably linked to said polynucleotides contained in the vectors.

These expression control sequences may be suited to ensure transcription and synthesis of a translatable RNA in bacteria or fungi.In addition, it is possible to insert different mutations into the polynucleotides by methods usual in molecular biology (see for instance Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA), leading to the synthesis of polypeptides possibly having modified biological properties.

The introduction of point mutations is conceivable at positions at which a modification of the amino acid sequence for instance influences the biological activity or the regulation of the polypeptide.Moreover, mutants possessing a modified substrate or product specificity can be prepared.

Preferably, such mutants show an increased activity.

Alternatively, mutants can be prepared the catalytic activity of which is abolished without losing substrate binding activity.Furthermore, the introduction of mutations into the polynucleotides encoding an enzyme as defined above allows the gene expression rate and/or the activity of the enzymes encoded by said polynucleotides to be reduced or increased.CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685For genetically modifying bacteria or fungi, the polynucleotides encoding an enzyme as defined above or parts of these molecules can be introduced into plasmids which permit mutagenesis or sequence modification by recombination of DNA sequences.

Standard methods (see Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA) allow base exchanges to be performed or natural or synthetic sequences to be added. DNA fragments can be connected to each other by applying adapters and linkers to the fragments.

Moreover, engineering measures which provide suitable restriction sites or remove surplus DNA or restriction sites can be used.

In those cases, in which insertions, deletions or substitutions are possible, in vitro mutagenesis, "primer repair", restriction or ligation can be used.

In general, a sequence analysis, restriction analysis and other methods of biochemistry and molecular biology are carried out as analysis methods.Thus, in accordance with the present invention a recombinant microorganism can be produced by genetically modifying fungi or bacteria comprising introducing the above-described polynucleotides, nucleic acid molecules or vectors into a fungus or bacterium.The invention relates to recombinant microorganisms, in particular bacteria and fungi, genetically modified with the above-described polynucleotides, nucleic acid molecules or vectors or obtainable by the above-mentioned method for producing genetically modified bacteria or fungi, and to cells derived from such transformed bacteria or fungi and containing a polynucleotide, nucleic acid molecule or vector as defined above.

In a preferred embodiment the host cell is genetically modified in such a way that it contains the polynucleotide stably integrated into the genome.The polynucleotide is expressed so as to lead to the production of a polypeptide having any of the activities described above.

An overview of different expression systems is for instance contained in Methods in Enzymology 153 (1987), 385-516, in Bitter et al. (Methods in Enzymology 153 (1987), 516-544) and in Sawers et al. (Applied Microbiology and Biotechnology 46 (1996), 1-9), Billman-Jacobe (Current Opinion in Biotechnology 7 (1996), 500-4), Hockney (Trends in Biotechnology 12 (1994), 456-463), Griffiths et al., (Methods in Molecular Biology 75 (1997), 427-440).

An overview of yeast expression systems is for instance given by Hensing et al. (Antonio van Leuwenhoek 67 (1995), 261-279), Bussineau et al. (Developments inBiological Standardization 83 (1994), 13-19), Gellissen et al. (Antonie vanLeuwenhoek 62 (1992), 79-93, Fleer (Current Opinion in Biotechnology 3 (1992), 486-496), Vedvick (Current Opinion in Biotechnology 2 (1991), 742-745) and Buckholz (Bio/Technology 9(1991), 1067-1072).21CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685Expression vectors have been widely described in the literature.

As a rule, they contain not only a selection marker gene and a replication-origin ensuring replication in the host selected, but also a bacterial or viral promoter, and in most cases a termination signal for transcription.

Between the promoter and the termination signal there is in general at least one restriction site or a polylinker which enables the insertion of a coding DNA sequence.

The DNA sequence naturally controlling the transcription of the corresponding gene can be used as the promoter sequence, if it is active in the selected host organism.

However, this sequence can also be exchanged for other promoter sequences.

It is possible to use promoters ensuring constitutive expression of the gene and inducible promoters which permit a deliberate control of the expression of the gene.

Bacterial and viral promoter sequences possessing these properties are described in detail in the literature.

Regulatory sequences for the expression in microorganisms (for instance E. coli, S. cerevisiae) are sufficiently described in the literature.

Promoters permitting a particularly high expression of a downstream sequence are for instance the T7 promoter (Studier et al., Methods in Enzymology 185 (1990), 60-89), lacUV5, trp, trp-lacUV5 (DeBoer et al., in Rodriguez and Chamberlin (Eds), Promoters, Structure and Function; Praeger, New York, (1982), 462-481; DeBoer et al., Proc.

Natl.

Acad.

Sci. USA (1983), 21-25), !pi, rac (Boros et al., Gene 42 (1986), 97-100).

Inducible promoters are preferably used for the synthesis of polypeptides.

These promoters often lead to higher polypeptide yields than do constitutive promoters.

In order to obtain an optimum amount of polypeptide, a two-stage process is often used.

First, the host cells are cultured under optimum conditions up to a relatively high cell density.

In the second step, transcription is induced depending on the type of promoter used.

In this regard, a tac promoter is particularly suitable which can be induced by lactose or IPTG (=isopropyl-R-D-thiogalactopyranoside) (deBoer et al., Proc.

Natl.

Acad.

Sci. USA 80 (1983), 21-25).

Termination signals for transcription are also described in the literature.The transformation of the host cell with a polynucleotide or vector according to the invention can be carried out by standard methods, as for instance described in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA; Methods in Yeast Genetics, A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, 1990.

The host cell is cultured in nutrient media meeting the requirements of the particular host cell used, in particular in respect of the pH value, temperature, salt concentration, aeration, antibiotics, vitamins, trace elements etc.In another aspect of the present invention, the recombinant microorganism is further characterized in that it is capable of converting acetyl-CoA into acetone.

Methods for22CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685providing such a recombinant microorganism are for instance disclosed in EP 2 295 593.

The term "which is capable of converting acetyl-CoA into acetone" in the context of the present invention means that the organism/microorganism has the capacity to produce acetone within the cell due to the presence of enzymes providing enzymatic activities allowing the production of acetone from acetyl-CoA.Acetone is produced by certain microorganisms, such as Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium cellulolyticum, Bacillus polymyxa and Pseudomonas putida.

The synthesis of acetone is best characterized in Clostridium acetobutylicum.

It starts out with a reaction (reaction step 1) in which two molecules of acetyl-CoA are condensed into acetoacetyl-CoA.

This reaction is catalyzed by acetyl-CoA acetyltransferase (EC 2.3.1.9).

Acetoacetyl-CoA is then converted into acetoacetate by a reaction with acetic acid or butyric acid resulting also in the production of acetyl-CoA or butyryl-CoA (reaction step 2).

This reaction is catalyzed e.g. by acetoacetylCoA transferase (EC 2.8.3.8).

AcetoacetylCoA transferase is known from various organisms, e.g. from E. coli in which it is encoded by the atoAD gene or from Clostridium acetobutylicum in which it is encoded by the ctfAB gene.

However, also other enzymes can catalyze this reaction, e.g. 3-oxoacid CoA transferase (EC 2.8.3.5) or succinate CoA Iigase (EC 6.2.1.5).Finally, acetoacetate is converted into acetone by a decarboxylation step (reaction step 3) catalyzed by acetoacetate decarboxylase (EC 4.1.1.4).The above described reaction steps 1 and 2 and the enzymes catalyzing them are not characteristic for the acetone synthesis and can be found in various organism.

In contrast, reaction step 3 which is catalyzed by acetoacetate decarboxylase (EC 4.1.1.4) is only found in those organisms which are capable of producing acetone.In a preferred embodiment the recombinant microorganism of the present invention is a microorganism, which naturally has the capacity to produce acetone.

Thus, preferably the microorganism belongs to the genus Clostridium, Bacillus or Pseudomonas, more preferably to the species Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium cellulolyticum, Bacillus polymyxa or Pseudomonas putida.In another preferred embodiment, the recombinant microorganism of the present invention is a microorganism, derived from an organism/microorganism which naturally does not produce acetone but which has been genetically modified so as to produce acetone, i.e. by introducing the gene(s) necessary for allowing the production of acetone in the microorganism.

In principle any microorganism can be genetically modified in this way.

The enzymes responsible for the synthesis of acetone have been described above.

Genes encoding corresponding enzymes are23CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685known in the art and can be used to genetically modify a given microorganism so as to produce acetone.

As described above, the reaction steps 1 and 2 of the acetone synthesis occur naturally in most organisms.

However, reaction step 3 is characteristic and crucial for acetone synthesis.

Thus, in a preferred embodiment, a genetically modified microorganism derived from a microorganism which naturally does not produce acetone is modified so as to contain a nucleotide sequence encoding an enzyme catalyzing the conversion of acetoacetate into acetone by decarboxylation, e.g. an acetoacetate decarboxylase (EC 4.1.1.4).

Nucleotide sequences from several organisms encoding this enzyme are known in the art, e.g. the adc gene from Clostridium acetobutylicum (Uniprot accession numbers P23670 and P23673), Clostridium beijerinckii (Clostridium MP; Q9RPK1), Clostridium pasteurianum (Uniprot accession number P81336), Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182; Uniprot accession number A5EBU7), Burkholderia mallei (ATCC 10399 A9LBSO), Burkholderia mallei (Uniprot accession number A3MAE3), Burkholderia mallei FMH A5XJB2, Burkholderia cenocepacia (Uniprot accession number A0B471), Burkholderia ambifaria (Uniprot accession number Q0b5P1), Burkholderia phytofirmans (Uniprot accession number B2T319), Burkholderia spec. (Uniprot accession number Q38ZU0), Clostridium botulinum (Uniprot accession number B2TLN8), Ralstonia pickettii (Uniprot accession number B2UIG7), Streptomyces nogalater (Uniprot accession number Q9EYI7), Streptomyces avermitilis (Uniprot accession number Q82NF4), Legionella pneumophila (Uniprot accession number Q5ZXQ9), Lactobacillus salivarius (Uniprot accession number Q1WVG5), Rhodococcus spec. (Uniprot accession number Q0S7W4), Lactobacillus plantarum (Uniprot accession number Q890G0), Rhizobium leguminosarum (Uniprot accession number Q1M911), Lactobacillus casei (Uniprot accession number Q03B66), Francisella tularensis (Uniprot accession number QOBLC9), Saccharopolyspora erythreae (Uniprot accession number A4FKR9), Korarchaeum cryptofilum (Uniprot accession number B1L3N6), Bacillus amyloliquefaciens (Uniprot accession number A7Z8K8), Cochliobolus heterostrophus (Uniprot accession number Q8NJQ3), Sulfolobus islandicus (Uniprot accession number C3ML22) and Francisella tularensis subsp. holarctica (strain OSU18).More preferably, the microorganism is genetically modified so as to be transformed with a nucleic acid molecule encoding an enzyme capable of catalyzing the above mentioned reaction step 2 of the acetone synthesis, i.e. the conversion of acetoacetyl CoA into acetoacetate.Even more preferably, the microorganism is genetically modified so as to be transformed with a nucleic acid molecule encoding an enzyme capable of catalyzing24CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685the above mentioned reaction step 1 of the acetone synthesis, i.e. the condensation of two molecules of acetyl CoA into acetoacetatyl CoA.In a particularly preferred embodiment the microorganism is genetically modified so as to be transformed with a nucleic acid molecule encoding an enzyme capable of catalyzing the above mentioned reaction step 1 of the acetone synthesis and with a nucleic acid molecule encoding an enzyme capable of catalyzing the above mentioned reaction step 2 of the acetone synthesis or with a nucleic acid molecule encoding an enzyme capable of catalyzing the above mentioned reaction step 1 of the acetone synthesis and with a nucleic acid molecule encoding an enzyme capable of catalyzing the above mentioned reaction step 3 of the acetone synthesis or with a nucleic acid molecule encoding an enzyme capable of catalyzing the above mentioned reaction step 2 of the acetone synthesis and with a nucleic acid molecule encoding an enzyme capable of catalyzing the above mentioned reaction step 3 of the acetone synthesis or with a nucleic acid molecule encoding an enzyme capable of catalyzing the above mentioned reaction step 1 of the acetone synthesis and with a nucleic acid molecule encoding an enzyme capable of catalyzing the above mentioned reaction step 2 of the acetone synthesis and with a nucleic acid molecule encoding an enzyme capable of catalyzing the above mentioned reaction step 3 of the acetone synthesis.Methods for preparing the above mentioned genetically modified microorganisms are well known in the art.

Thus, generally, the microorganism is transformed with a DNA construct allowing expression of the respective enzyme in the microorganism.

Such a construct normally comprises the coding sequence in question linked to regulatory sequences allowing transcription and translation in the respective host cell, e.g. a promoter and/enhancer and/or transcription terminator and/or ribosome binding sites etc.

The prior art already describes microorganisms which have been genetically modified so as to be able to produce acetone.

In particular genes from, e.g., Clostridium acetobutylicum have been introduced into E. coli thereby allowing the synthesis of acetone in E. coli, a bacterium which naturally does not produce acetone (Bermejo et al., Appl.

Environ.

Microbiol. 64 (1998); 1079-1085; Hanai et al., App!.

Environ.

Microbiol. 73 (2007), 7814-7818).

In particular Hanai et al. (loc. cit.) shows that it is sufficient to introduce a nucleic acid sequence encoding an acetoacetate decarboxylase (such as that from Clostridium acetobutylicum) in order to achieve acetone production in E. coli indicating that the endogenous enzymes in E. coli catalyzing the above-mentioned reaction steps 1 and 2 (i.e. the expression products of the E. coli atoB and atoAD genes) are sufficient to provide substrate for the acetone production.CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685In another aspect of the present invention, the recombinant microorganism is further characterized in that it is capable of converting acetyl-CoA into acetone and converting acetone into isobutene.

Methods for providing such a recombinant microorganism are for instance disclosed in EP-A 2 295 593 (EP 09 17 0312), WO 2010/001078 and EP 10 18 8001.In another aspect of the present invention, the recombinant microorganism is characterized in that it is capable of converting acetyl-CoA into acetone and converting acetone into propene.

Methods for providing such a recombinant microorganism are for instance disclosed in Hanai et al., Appl.

Environ.

Microbiol. 73 (2007), 7814-7818.One skilled in the art would recognize that further genetic modifications to the microorganisms of the present invention could lead to improvements in the efficacy by which the microorganisms of the present invention convert feedstock to product.

For example, natural microorganisms commonly produce products such as formate, acetate, lactate, succinate, ethanol, glycerol, 2,3-butanediol, methylglyoxal and hydrogen; all of which would be deleterious to the production of, e.g., acetone, isobutene or propene from sugars.

Elimination or substantial reduction of such unwanted by-products may be achieved by elimination or reduction of key enzymes activities leading their production.

Such activities include, but are not limited to, the group consisting of:- acetyl-CoA + formate = CoA + pyruvate (for example, catalyzed by formate C-acetyltransferase, also known as pyruvate formate-lyase (EC 2.3.1.54); for E. coli- pflB, NCBI-GenelD: 945514);- ATP + acetate = ADP + acetyl phosphate (for example, catalyzed by acetate kinase (EC 2.7.2.1); for E. coil- ackA, NCBI-GenelD: 946775);- (R)-lactate + NAD+ = pyruvate + NADH + H+ (for example, catalyzed by L-lactate dehydrogenase (EC 1.1.1.28); for E. coil- IdhA, NCBI-GenelD: 946315);- phosphate + oxaloacetate = phosphoenolpyruvate + HCO3- (for example, catalyzed by phosphoenolpyruvate carboxylase (EC 4.1.1.31); for E. coil- ppc, NCBI-GenelD: 948457);- ATP + oxaloacetate = ADP + phosphoenolpyruvate + CO2 (for example, catalyzed by phosphoenolpyruvate carboxykinase (ATP) (EC 4.1.1.49); for E. coil- pck, NOBI-GenelD: 945667);- succinate + acceptor = fumarate + reduced acceptor (for example, catalyzed by succinate dehydrogenase (EC 1.3.99.1); for E. coil- comprising frdA and frdB, NCBI-GenelD: 948667 and 948666, respectively);26CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685- a 2-oxo carboxylate (e.g. pyruvate) = an aldehyde (e.g. acetaldehyde + CO2 (for example, catalyzed by pyruvate decarboxylase (EC 4.1.1.1));- acetaldehyde + CoA + NAD+ = acetyl-CoA + NADH + H4 (for example, catalyzed by acetaldehyde dehydrogenase (acetylating) (EC 1.2.1.10); for E. coil- adhE, NOBI-GenelD: 945837);- sn-glycerol 3-phosphate + NA 0(P)4 = glycerone phosphate + NAD(P)H + H+ (for example, catalyzed by glycerol-3-phosphate dehydrogenase [NAD(P)+] (EC 1.1.1.94); for E. coli- gpsA, NCBI-GenelD: 948125);- 2 pyruvate = 2-acetolactate + CO2 (for example, catalyzed by acetolactate synthase (EC 2.2.1.6); for E. coil- ilvH and i/v/, NCBI-GenelD: 947267 and 948793, respectively);- glycerone phosphate = methyl glyoxal + phosphate (for example, catalyzed by methylglyoxal synthase (EC 4.2.3.3); for E. coil- mgsA, NCBI-GenelD:945574); and- formate + I-1+ = CO2 + H2 (for example, catalyzed by formate hydrogenlyase (EC 1.2.1.2 together with EC 1.12.1.2); for E. coil- fdhF (EC 1.2.1.2), NCBI-GenelD: 948584).Thus, in a preferred embodiment, the microorganism according to the invention is characterized in that one or more of the above listed enzyme activities are eliminated or reduced.One skilled in the art would further recognize that genetic modifications to regulatory elements in the microorganisms of the present invention could lead to improvements in the efficacy by which the microorganisms of the present invention convert feedstock to product.

Within E. coil, such genetic modifications include, but are not limited to, the group consisting of:- deleting the fnr gene (NOBI-GenelD: 945908), a global regulator of anaerobic growth; and- deleting the rpoS gene (NCBI-GenelD: 947210), a RNA polymerase, sigma S (sigma 38) factor.Thus, in another preferred embodiment the microorganism according to the invention shows at least one of these deletions.A further aspect of the present invention is the use of the recombinant microorganism of the present invention for the conversion of glucose into acetyl-CoA.

Acetyl CoA (also known as acetyl Coenzyme A) in chemical structure is the thioester between coenzyme A (a thiol) and acetic acid and is an important precursor molecule for the production of useful metabolites.

Acetyl-CoA can then be further converted by the27CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685recombinant microorganism into useful metabolites such as L-glutamic acid, L-glutamine, L-proline, L-arginine, L-leucine, succinate and polyhydroxybutyrate.Another aspect of the present invention is the use of the recombinant microorganism of the present invention that is capable of converting acetyl-CoA into acetone for the conversion of glucose into acetone.A further aspect of the present invention is the use of the recombinant microorganism of the present invention that is capable of converting acetyl-CoA into acetone and acetone into isobutene for the conversion of glucose into isobutene.Again a further aspect of the present invention is the use of the recombinant microorganism of the present invention that is capable of converting acetyl-CoA into acetone and acetone into propene for the conversion of glucose into propene.Accordingly, the present invention also relates to a method for the production of acetone and/or isobutene and/or propene from glucose in which the above-mentioned recombinant microorganism is cultivated under conditions allowing for the production of acetone and/or isobutene and/or propene and in which the acetone and/or isobutene and/or propene is isolated.

The microorganisms are cultivated under suitable culture conditions allowing the occurrence of the enzymatic reaction(s).

The specific culture conditions depend on the specific microorganism employed but are well known to the person skilled in the art.

The culture conditions are generally chosen in such a manner that they allow the expression of the genes encoding the enzymes for the respective reactions.

Various methods are known to the person skilled in the art in order to improve and fine-tune the expression of certain genes at certain stages of the culture such as induction of gene expression by chemical inducers or by a temperature shift.In another preferred embodiment the method according to the invention furthermore comprises the step of collecting gaseous products, in particular isobutene or propene, degassing out of the reaction, i.e. recovering the products which degas, e.g., out of the culture.

Thus in a preferred embodiment, the method is carried out in the presence of a system for collecting isobutene or propene under gaseous form during the reaction.As a matter of fact, short alkenes such as isobutene and propene adopt the gaseous state at room temperature and atmospheric pressure.

The method according to the invention therefore does not require extraction of the product from the liquid culture medium, a step which is always very costly when performed at industrial scale.

The evacuation and storage of the gaseous hydrocarbons and their possible subsequent28CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685physical separation and chemical conversion can be performed according to any method known to one of skill in the art.The present invention is further described by reference to the following non-limiting figures and examples.Figure 1 shows two schemes for the production of acetyl-CoA from glucose-6-phosphate via the phosphoketolase pathway using either one or both phosphoketolase activities EC 4.1.2.9 and EC 4.1.2.22.EXAMPLESGENERAL METHODS AND MATERIALS Procedure for ligations and transformations are well known in the art.

Techniques suitable for use in the following examples may be found in Sambrook J., et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y., 1989, and Sambrook J., supra.Materials and methods suitable for the maintenance and growth of bacterial cultures are well known in the art.

Techniques suitable for use in the following examples may be found in Manual of Methods for General Bacteriology (Philipp Gerhardt, R.G.E.

Murray, Ralph N.

Costilow, Eugene W.

Nester, Willis A.

Wood, Noel R.

Krieg and G.

Briggs Philips, eds).All reagents and materials used for the growth and maintenance of bacterial cells were obtained from Sigma-Aldrich Company (St.

Louis, MO) unless otherwise specified.Table 1 : Plasmids used and constructed Plasmid Name DescriptionpKD46 Datsenko KA.

And Wanner BL., Proceedings of the National Academyof Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645pCP20 Datsenko KA.

And Wanner BL., Proceedings of the National Academyof Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645 pGBE0687 Plasmid pGBE0687 presents a resistance gene to apramycin placedunder the control of its own promoterpGBE0688 Plasmid pGBE0688 presents a resistance gene to spectinomycin placedunder the control of its own promoterpGBE0421 Plasmid from GeneArt (Invitrogen ) that encodes for L. lactisphosphoketolasepGBE0123 A modified version of the plasmid pUC18 (New England Biolabs) which29CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685contains a modified Multiple Cloning Site (MCS)pGBE0457 Plasmid that allows expression of the L. lactis phosphoketolasepGBE0689 pBluescript II phagemids, Agilent TechnologiespGBE0690 ctfA and ctfB genes from Clostridium acetobutylicum cloned intopGBE0689pGBE0691 adc gene from Clostridium acetobutylicum cloned into pGBE0690pGBE0051 pUC19, New England BiolabspGBE0692 ctfA, ctfB and adc genes from Clostridium acetobutylicum cloned intopGBE0051pGBE0693 thl gene from from Clostridium acetobutylicum cloned into pGBE0692pGBE0124 A modified version of the plasmid pSU18 (Borja Bartolome, YolandaJubete, Eduardo Martinez and Fernando de la Cruz, Gene, 1991, Vol. 102, Issue 1, pp. 75-78)pGBE0096 thl, ctfA, ctfB and adc genes from Clostridium acetobutylicum clonedinto pGBE0124pGBE0928 Plasmid that allows expression of the L. lactis phosphoketolasepGBE1020 Plasmid that allows expression of the L. lactis phosphoketolase andacetone productionpGBE1021 Plasmid that allows acetone productionTable 2 : Strains used and constructed. FRT : FLP recognition targetStrain Genotype Strain ofname originConstruction GBE0129 F- lambda- ilvG- rfb-50 rph-1 Escherichia coil K12 wild-type MG1655 GBE0170 pKD46 GBE0129 Transformation of the strainGBE0129 with the pKD46plasmid GBE0329 pGBE0096 GBE0129 Transformation of the strainGBE0129 with thepGBE0096 plasmid GBE0901 AptsHI::FRT GBE0129 GBE0902 AptsHI::FRT pKD46 GBE0901 Transformation of the strainGBE0901 with the pKD46plasmid GBE0903 AptsHI::FRT Azwf_edd_eda::aad+ GBE0902 GBE0929 AptsHI::FRT GBE0901 Selection of the strainGBE0901 on MS medium with glucose as the source of carbon. GBE1000 AptsHI::FRT Azwf_edd_eda:: GBE0903.

Selection of the strainaad+ GBE0903 on MS mediumwith glucose as the source of carbon. GBE1001 AptsHI::FRT A7wf_edd_eda:: GBE1000 Transformation of the strainaad+ pKD46 GBE1000 with the pKD46plasmid GBE1005 AptsHI::FRT Azwf_edd_eda:: GBE1001pKD46 aad+ ApfkA::aac+ GBE1005 AptsHI::FRT Azvvf_edd_eda:: GBE1005 The loss of the pKD46 CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685aad+ ApfkA::aac+ _ pKD46. plasmid has been verified. GBE1005_ AptsH1::FRT A7vvf edd eda:: GBE1005 Transformation of the strainaad+ dpfkA::aac+ ¨pCP2-0 GBE1005 with the pCP20plasmid GBE1006 AptsHI::FRT A7wf_edd_eda::FRT GBE1005 The loss of the pCP20ApfkA::FRT _p plasmid has been verified. GBE1010 dptsH1::FRT dzwf edd_eda::FRT GBE1006 Transformation of the strainApfkA::FRT pKD46 GBE1006 with the pKD46plasmid GBE1014_dptsH1::FRT dzwf edd eda::FRT GBE1010pKD46 ApfkA::FRT dpfkl:aad+ GBE1014 AptsH1::FIRT A7vvf edd eda::FRT GBE1014 The loss of the pKD46dpfkA::FRT LpfkB:: aad+ _ pKD46. plasmid has been verified. GBE1283 AptsH1::FRT GBE0929 Successive cultures of theGBE0929 in MS medium with glucose as the source of carbon. GBE1284 AptsHI::FRT pKD46 GBE1283 Transformation of the strainGBE1283 with the pKD46plasmid GBE1287 dptsH1::FRT A7wf_edd_eda::aad+ GBE1284 GBE1337 LptsH1::FRT Lzvvf_edd_eda::aad+ GBE1287 Transformation of the strainpKD46 GBE1287 with the pKD46plasmid GBE1339 Lzwf_edd_eda::aac+ GBE0170 GBE1340 Lzwf_edd_eda::aac+ pKD46 GBE1339 Transformation of the strainGBE1339 with the pKD46plasmid GBE1341 dzwf_edd_eda::aac+ dpfkA:: aad+ GBE1340pKD46 GBE1341 dzwf_edd_eda::aac+ ApfkA:: aad+ GBE1341 The loss of the pKD46 ______________________________________ _pKD46 plasmid has been verified. GBE1341 dzwf_edd_eda::aac+ dpfkA:: aad+ GBE1341 Transformation of the strainpCP20 GBE1341 with the pCP20plasmid GBE1342 Lzwf_edd_eda::FRT dpfkA::FRT GBE1341 The loss of the pCP20_10 plasmid has been verified. GBE1343 dzwf edd_eda::FRT dpfkA::FRT GBE1342 Transformation of the strainpKD46 GBE1342 with the pKD46plasmid GBE1344 dzwf edd eda::FRT ApfkA::FRT GBE1343pKD46 ApfkB:: aad+ GBE1344 Azwf_edd eda::FRT LpfkA::FRT GBE1344 The loss of the pKD46dpfkB:: aad+ _pKD46 plasmid has been verified. GBE1345 A7wf edd eda::FRT ApfkA::FRT GBE1344 Transformation of the straindpfkB:: aad+ pGBE457 GBE1344 with both pGBE96pGBE0096 and pGB457 plasmids GBE1346 pGBE0096 GBE0329 Adaptation of the strainGBE0329 to the MS medium + glucose (2g/L) + Chloramphenicol (25ug/m1) GBE1347 Lzwf edd eda::FRT ApfkA::FRT GBE1345 Adaptation of the strainApfkB:: aad+ pGBE457 pGBE96 GBE1345 to the MS medium+ glucose (2g/L) +Chloramphenicol (25ug/m131CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685GBE1348 AptsH1::FRT pGB96 GBE0929 Transformation of the strainGBE0929 with both pGBE96 and pGB457 plasmids GBE1349 AptsH1::FRT dzvvf edd eda::FRT GBE1014 Transformation of the straindpfkA::FRT ApfkB:: aaa+ GBE1014 with both pGBE96pGBE457 pGBE0096 and pGB457 plasmids GBE1350 AptsH1::FRT pGB96 GBE1348 Adaptation of the strainGBE1348 to the MS medium + glucose (2g/L) + Chloramphenicol (25ug/m1) GBE1351 AptsH1::FRT dzwf edd eda::FRT GBE1349 Adaptation of the strainLpfkA::FRT LpfkB:: aad+ GBE1349 to the MS mediumpGBE457 pGBE0096 + glucose (2g/L) +Chloramphenicol (25ug/m1) GBE1353_ dpts1-11::FRT GBE1337pKD46 dzwf_edd_eda::aad+ ApfkA::aac+ GBE1353 dptsH1::FRT GBE1353 The loss of the pKD46Lzwf_edd_eda::aad+ ,LpfkA:: _pKD46 plasmid has been verified.aac+ GBE1353_ dptsH1::FRT GBE1353 Transformation of the straindzwi_edd eda::aad+ ApfkA:: GBE1353 with the pCP20aac+ pC1:0 plasmid GBE1368 LptsH1::FRT A7wf_edd_eda:: GBE1353 The loss of the pCP20FRT ApfkA:: FRT p plasmid has been verified. GBE1371 AptsH1::FRT dzwf_edd eda:: GBE1368 Transformation of the strainFRT dpfkA:: FRT pKD46 GBE1368 with the pKD46plasmid GBE1420_ AptsH1::FRTdzwf_edd eda:: GBE1371pKD46 FRT ApfkA:: FRT LpfkE: aad+ GBE1420 AptsH1::FRT dzwf edd eda:: GBE1420 The loss of the pKD46FRT ApfkA:: FRT A.pfk6:: aad+ _pKD46 plasmid has been verified. GBE1433 AptsHI::FRT Azwf:: aad+ GBE1284 GBE1436 ,LptsHI::FRT dzwf:: aad+ pKD46 GBE1433 Transformation of the strainGBE1433 with the pKD46plasmid GBE1441 AptsHI::FRT aad+ ApfkA:: GBE1436pKD46 aac+ GBE1441 LptsH1::FRT Azwf:: aad+ ApfkA:: GBE1441 The loss of the pKD46aac+ _pKD46 plasmid has been verified. GBE1441_ dptsH1::FRT A7vvf:: aad+ dpfkA:: GBE1441 Transformation of the strainaac+ pCP20 GBE1441 with the pCP20plasmid GBE1448 AptsH1::FRT Azwf:: FRT dpfkA:: GBE1441 The loss of the pCP20FRT _p plasmid has been verified. G3E1449 AptsHI::FRT ADA: FRT dpfkA:: GBE1448 Transformation of the strainFRT pKD46 GBE1448 with the pKD46plasmid GBE1518_ LptsH1::FRT dzwf:: FRT ApfkA:: GBE1449pKD46 FRT dpfkB:: aad+ GBE1518 AptsH1::FRT dzwf:: FRT ApfkA:: GBE1518 The loss of the pKD46FRT aad+ _pKD46 plasmid has been verified. GBE2252 AptsH1::FRT .ApfkA:: aad+ GBE1284pKD46 GBE2252 AptsH1::FRT dpfkA:: aad+ GBE2252 The loss of the pKD46 32CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685_______________________________________ _pKD46 _plasmid has been verified. GBE2253 AptsHI::FRT ApfkA:: aad+ pKD46 GBE2252 Transformation of the strainGBE2252 with the pKD46plasmid GBE2256 AptsHI::FRT ApfkA:: aad+ ApfkB:: GBE2253pKD46 aac+ GBE2256 AptsH1::FRT ApfkA:: aad+ ApfkB:: GBE2256 The loss of the pKD46aac+ _pKD46 plasmid has been verified. GBE2262 F- lambda- ilvG- rfb-50 rph-1 GBE0129 Transformation of the strainpGB1021 GBE0129 with pGB1021plasmid GBE2263 Azwf_edd eda::FRT ApfkA::FRT GBE1344 Transformation of the strainApfkB:: aad+ pGB1020 GBE1344 with pGB1020plasmid GBE2264 F- lambda- ilvG- rfb-50 rph-1 GBE2262 Adaptation of the strainpGB1021 GBE2262 to the MS medium+ glucose (2g/L) + ampicilline (10Oug/m1). GBE2265 Azwf edd eda::FRT ApfkA::FRT GBE2263 Adaptation of the strainApfkB:: aad+ pGB1020 GBE2263 to the MS medium+ glucose (2g/L) + ampicilline (10Oug/m1). GBE2266 AptsHI::FRT pGB1021 GBE1283 Transformation of the strainGBE1283 with pGB1021plasmid GBE2267 AptsHI::FRT Azwf_edd eda:: GBE1420 Transformation of the strainFRT ApfkA:: FRT Apfk1:3-:: aad+ GBE1420 with pGB1020pGB1020 plasmid GBE2268 AptsH1::FRT pGB1021 GBE2266 Adaptation of the strainGBE2266 to the MS medium+ glucose (2g/L) + ampicilline (10Oug/m1). GBE2269 AptsHI::FRT Azwf_edd eda:: GBE2267 Adaptation of the strainFRT ApfkA:: FRT ApfkB:: aad+ GBE2267 to the MS mediumpGB1020 + glucose (2g/L) + ampicilline(10Oug/m1). GBE2270 AptsH1::FRT ApfkA:: aad+ ApfkB:: GBE2256 Transformation of the strainaac+ pGB1020 GBE2256 with pGB1020plasmid GBE2271 AptsHI::FRT Azwf:: FRT ApfkA:: GBE1518 Transformation of the strainFRT ApfkB:: aad+ pGB1020 GBE1518 with pGB1020plasmid GBE2272 AptsHI::FRT ApfkA:: aad+ ApfkB:: GBE2270 Adaptation of the strainaac+ pGB1020 GBE2270 to the MS medium+ glucose (2g/L) + ampicilline (10Oug/m1). GBE2273 AptsHI::FRT Azwf:: FRT ApfkA:: GBE2271 Adaptation of the strainFRT ApfkB:: aad+ pGB1020 GBE2271 to the MS medium+ glucose (2g/L) + ampicilline (10Oug/m1).

Table 3 : Sequences of bacterial chromosomal regions, genes used, plasrnids regions. 3317Se66n6oe6le6e6oee6B6606e6Teolo6e61o661e6o15eoo53lo6o36le6o61eebee6o6le656366e6eoo600leo6 Toopie bilboole be boo 666peealbbbpoobeoe bo6616 peoe bo 6330135031e 611663136m33Eleol66oi6eool66e eb6ee6e3n036e6ee6e6ee3l366166e0e66365n3366.o be 616p 6peo3e6TeeEse53pepe 60160 6oe166116 eeoMiebbeopolleooeobloeoe be boo 6166561e1330116 beeeo 661e5llbe boo bpleo 6p5oe boeo eeoo bie5oeo e 56616366opoppoe166e36651e6opeebieool5lb0005 a1660006eeo5loo6o1oeo1ooeoa5T00006peooie5piole ole6eo 6e beobbeoeop65663 beobbobipooblneaoleoa obobeobofteelbleeeoo6loobobbiolleoeoeoppiEn6 e66poe663oeoen60006oi5oeop6poie6oll6006e6oe boe66p166e016516opoobieolbolo6oe666e66600lbb 613:50613616o bpoo 66e6olebToebbipeooMble 6e e bo poo3563316obeT5oonoopbeoeooibblobp5151660563 0000ei16666i1oaeeolo11o6eo166oleop6e6o36eeee5o 66iee6oeleeo615ol61eeo6T6e66166o6eoleol6ie6ioe6 pau!papun olebleio616ole6nbooblbeoeeobinepebooepoeolemb anasseo C000 ale suqbal eeTe6Te66b5eeeeobeoleoop6eo6i6Teop6663ipeeb aauelsisalOs jj beleebebepffioelepopeebb6o5ooeoo6o36Eobebe uptweJdvo6leieo6eo6oea6leo6olf5Tffbbeiee6ebe131110eleponbeebeeleeoo6eo36166m6peeell6eo6e e6lel6ee516oileeeneo1o6o65356166eo1e563616olo6 000 6iliellebee bee beeo 6661pieno 666obeeooblee5; 16pole3336eoleoeeo1o6e3o61135oeo66Teeo656ipeo361361161e66eeeoo6o6o1e6eeo6600eeo6eo5opeael6 6plel6opibmoelp bi6eiblee563 be6le5o6663666ne beaoboo6opeeb6leio6ee6pioeiebooMpeobbeeop e1o1e6o5eee6e3ool6e3p6eono1o1e66ee6a6eo6eon6 beo661pEolbobeleoeeobeeeobbeeeoeepElope6o5 5noe6Toile600eeoeoob000bebonoieo656o6nooleoe Eeeeo6o6eo66i6e6e66a116eoEpee656366e33515331 ep6obbipoel6oleoebTbeoeo616316oleooe516eeMpo Ea boopeoMeeoe eeeoo bbp000p5eom66e bbnop 6o16olo 6poo beeo 66o 6163351e5leeolo booeoElo 6e Ape bibblo6ffie 611ele 616eoel600eee blie 663561e bbpeoboopo6oelelpleo616336613611Boebolbebopaeoo 6o6b5alealboeeopeo beeoeoiepeeo5166oille be boo 6.003616eeeee616e61eleoep6ee66ee1o6e66eoTine6 e6ale116e6TmlleTbo6b600epeole6eeleee6iee1eooeo moeeoolibbeeeiboeo66ole6116oebe6ieeee5obEimoeeoo666poo5ee66600ele6il6i3oo161661oa1eee1eee lee 6eo boppeole beebboe biblooeieeelee boo bo 6upe paupepun oboeb000eoleooeoMibeelbeoleeepeoeTeolemeoe apasseo000 eie suo!bai Beeeopoeobe66peoofte6eoeeebeie6p5eopoeeb apueTs!sai05 _odd be1eebebelomoe1e1ooilbeeb6636oaeoo60066o6e6e upiCwouqoadsOL9 1.C9Z01 9SL 1.S9Zai!ed aseq wopaupapun 51eleone1e66e66eepee66e1ee66omeeb6 I.o6o2se1,000 s! ewe bebelomaelepoilbeenop6TobeMobbei515eoe wo aouan bagOs uqbai ieee5655pbeeiepoeeepeoeeoeoonbeffioebelo66v apRoaionuON CH025 uoqdpsaa aouanbas apnoalonN aweNS8990/ZIOZcI1L13c1 98LLOONIOZ OM8O-TO-T03 SC:F[17830 'VDCA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685ggggcaaggtcgcgctgattgctggggcaacacgtggagcggatc ggggattgtctttcttcagctcgctgatgatatgctg acgctcaatgcc daaottcctatactttctadaciaataocoacttcgcatgcacgcagc atatgc MCS of the AAGCTTGCGGCCGCGGGGTTAATTAACCTCCT The SQpGB0123 TAGTTTAAACCTAGGCATGCCTCTAGAGGATC restriction 0004plasmid CCCGGGTACCGAGCTCGAAttaCCTGCAGGAAT sites forTO Hindl andEcoRI areunderlined.

Optimized TTAATTAATGCATCATCACCACCATCACATGAC The SQLactococcus CGAATATAACAGCGAAGCCTATCTGAAAAAACT restriction 0005lactis GGATAAATGGTGGCGTGCAGCAACCTATCTGG sites forphosphoketolase GTGCAGGTATGATTTTTCTGAAAGAAAATCCGC Pad l and gene flanked by TGTTTAGCGTTACCGGCACCCCGATTAAAGCA Notl are Pad l and Notl GAAAATCTGAAAGCCAATCCGATTGGTCATTG underlined.restriction sites GGGCACCGTTAGCGGTCAGACCTTTCTGTATGCACATGCAAATCGCCTGATTAACAAATATAACC AGAAAATGTTTTATATGGGTGGTCCGGGTCAT GGTGGTCAGGCAATGGTTGTTCCGAGCTATCT GGATGGTAGCTATACCGAAGCATATCCGGAAA TTACCCAGGATCTGGAAGGTATGAGCCGTCTG TTTAAACGTTTTAGCTTTCCGGGTGGTATTGGT AGCCACATGACCGCACAGACACCGGGTAGCC TGCATGAAGGTGGTGAACTGGGTTATGTTCTG AGCCATGCAACCGGTGCAATTCTGGATCAGCC GGAACAAATTGCATTTGCAGTTGTTGGTGATG GTGAAGCAGAAACCGGTCCGCTGATGACCAG CTGGCATAGCATCAAATTTATCAACCCGAAAAA CGATGGTGCCATTCTGCCGATTCTGGATCTGA ATGGCTTTAAAATCAGCAATCCGACCCTGTTTG CACGTACCAGTGATGTTGATATCCGCAAATTTT TCGAAGGTCTGGGTTATAGTCCGCGTTATATT GAAAACGATGACATCCATGACTACATGGCCTA TCATAAACTGGCAGCAGAAGTTTTTGACAAAG CCATTGAAGATATCCATCAGATTCAGAAAGATG CCCGTGAAGATAATCGCTATCAGAATGGTGAA ATTCCGGCATGGCCGATTGTTATTGCACGTCT GCCGAAAGGTTGGGGTGGTCCTCGTTATAATG ATTGGAGCGGTCCGAAATTTGATGGTAAAGGT ATGCCGATCGAACATAGCTTTCGTGCACATCA GGTTCCGCTGCCGCTGAGCAGCAAAAACATG GGCACCCTGCCGGAATTTGTTAAATGGATGAC CAGCTATCAGCCGGAAACCCTGTTTAATGCAG ATGGTAGCCTGAAAGAAGAACTGCGCGATTTT GCACCGAAAGGTGAAATGCGTATGGCAAGCAA TCCGGTTACCAATGGTGGTGTTGATTATAGCA ATCTGGTTCTGCCGGATTGGCAAGAATTTGCA AATCCGATTAGCGAAAACAATCGTGGTAAACT GCTGCCGGATACCAATGATAATATGGATATGA ACGTGCTGAGCAAATATTTCGCCGAAATTGTTA AACTGAACCCGACCCGTTTTCGTCTGTTTGGT CCGGATGAAACCATGAGCAATCGITTITGGGA GATGTTTAAAGTGACCAATCGTCAGTGGATGC AGGTTATCAAAAATCCGAACGATGAGTTTATTA GTCCGGAAGGTCGCATTATTGATAGCCAGCTG CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685AGCGAACATCAGGCAGAAGGTTGGCTGGAAG GTTATACCCTGACCGGTCGTACCGGTGTTTTT GCAAGCTATGAAAGTTTTCTGCGTGTTGTTGAT AGCATGCTGACCCAGCACTTTAAATGGATTCG TCAGGCAGCAGATCAGAAATGGCGTCATGATT ATCCGAGCCTGAATGTTATTAGCACCAGCACC GTTTTTCAGCAGGATCATAATGGTTATACCCAT CAAGATCCGGGTATGCTGACCCATCTGGCAGA GAAAAAAAGCGATTTTATTCGTCAGTATCTGCC TGCAGATGGTAATACCCTGCTGGCCGTTTTTG ATCGTGCATTTCAGGATCGCAGCAAAATTAAC CATATTGTTGCAAGCAAACAGCCTCGTCAGCA GTGGTTTACCAAAGAAGAAGCAGAAAAACTGG CCACCGATGGTATTGCAACCATTGATTGGGCA AGCACCGCAAAAGATGGTGAAGCCGTTGATCT GGTTTTTGCAAGTGCCGGTGCAGAACCGACCA TTGAAACCCTGGCAGCACTGCATCTGGTTAAT GAAGTTTTTCCGCAGGCCAAATTTCGCTATGTT AATGTTGTTGAACTGGGTCGTCTGCAGAAAAA GAAAGGTGCACTGAATCAAGAACGCGAACTGA GTGATGAAGAGTTCGAAAAATACTTTGGTCCG AGCGGTACACCGGTTATTTTTGGTTTTCATGGC TATGAAGATCTGATCGAGAGCATCTTTTATCAG CGTGGTCATGATGGTCTGATTGTTCATGGTTAT CGTGAAGATGGTGATATTACCACCACCTATGA TATGCGTGTTTATAGCGAACTGGATCGTTTTCA TCAGGCAATTGATGCAATGCAGGTTCTGTATG TGAATCGTAAAGTTAATCAGGGTCTGGCCAAA GCATTTATTGATCGTATGGAACGTACCCTGGT GAAACATTTTGAAGTTACCCGTAATGAAGGCG TTGATATTCCGGAATTTACCGAATGGGTTTGGA GCGATCTGAAAAAGTAATGAGCGGCCGCMCS of the GAATTCGAGCTCGGTACCCGGGGATCCTCTAG SQpGB0124 AGGCATGCCTAGGTTTAAACTAAGGAGGTTAA 0006plasmid TTAACCCCGCGGCCGCAAGCTTTable 4 : Primer sequence Name Sequence Description SEQ IDNO: 0635 Ggttcaattcttcctttagcggc Primer for sequencing the E.coli RC0001chromosomal region including theptsHlgenes. 0638 Ccgcaaaaacgacatccggcacg Primer for sequencing the E.coli RC0002chromosomal region including theptsHl genes. 0633 caagtataccctggcttaagtaccgggttagttaa Primer for deletion of the RC0003 cttaaggagaatgacAGAGCGGCCGCC zwf edd eda genes.ACCGCGGG 0634 gcaaaaaaacgctacaaaaatgcccgatcctc Primer for deletion of the RC0004 gatcgggcattttgacttGCATATGCTGCG zwf edd eda genes.TGCATGCG 1036 Ccgcactttgcgcgcttttccc Primer for sequencing the E.coli R00005chromosomal region including the zwf edd eda genes. 36CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/0636851037 Ggtgattttcagtgaggtctcccc Primer for sequencing the E.coli R00006chromosomal region including thezwf edd eda genes. 0629 agacttccggcaacagatttcattttgcattccaa Primer for deletion of the pfkA RC0007agttcagaggtagtcAGAGCGGCCGCC gene.ACCGCGGG 0630 gcttctgtcatcggtttcagggtaaaggaatctgc Primer for deletion of the pfkA RC0008ctttttccgaaatcaGCATATGCTGCGTG gene.CATGCG 0619 Ggcgctcacgatcttcgcacgcggc Primer for sequencing the E.coli RC0009chromosomal region including thepfkA gene. 0620 Ccgcctcatattgctgacaaagtgcgc Primer for sequencing the E.coli R00010chromosomal region including thepfkA gene. 0631 actttccgctgattcggtgccagactgaaatcagc Primer for deletion of the pfkB RC0011ctataggaggaaatgAGAGCGGCCGCC gene.ACCGCGGG 0632 gttgccgacaggttggtgatgattcccccaatgct Primer for deletion of the pfkB R00012gggggaatgtttttgGCATATGCTGCGT gene.GCATGCG 0621 Ccacagcgaccaggcagtggtgtgtcc Primer for sequencing the E.coli RC0013chromosomal region including thepfkB gene. 0622 Gcactttgggtaagccccgaaacc Primer for sequencing the E.coli R00014chromosomal region including thepfkB gene. pUC1 Ccattcaggctgcgcaactg Primer for sequencing the RC00158_24 phosphoketolase gene from6 Lactococcus lactis cloned into thepGB0123. pUC1 Gcgcgttggccgattcattaatgc Primer for sequencing the RC00168_38 phosphoketolase gene fromDty e Lactococcus lactis cloned into thepGB0123.

Pktlacto CAATCCGACCCTGTTTGCACGTA Primer for sequencing the R00017700 C phosphoketolase gene fromdir Lactococcus lactis cloned into thepGB0123.

Pkt I GCTGCCGGATACCAATGATAATA Primer for sequencing the R00018acto TGG phosphoketolase gene frommil_di Lactococcus lactis cloned into thepGB0123.

Pkt I CCATATTATCATTGGTATCCGGCA Primer for sequencing the RC0019acto_ GC phosphoketolase gene frommil_re Lactococcus lactis cloned into the _____________________________________ pGB0123. 0070 CCCGGGGGATCCAGAATTTAAAA Primer for amplifying the ctfA and R00020GGAGGGATT ctfB genes from Clostridiumacetobutylicum ATCC 824 strain. 0071 CTCGAGGATATCAAGAATTCTTTT Primer for amplifying the ctfA and R00021TAAACAGCCATGGGTC ctfB genes from Clostridiumacetobutylicum ATCC 824 strain. 37CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/0636851066 TGTAAAACGACGGCCAGT General primer for sequencing RC00221067 CAG GAAACAG CTATGACC General primer for sequencing RC0023 0072 CTCGAGGATATCAGGAAGGTGAC Primer for amplifying the adc gene RC0024TTTTATGTTAAAGG from the Clostridiumacetobutylicum ATCC 824 strain.0073 GCATGCGTCGACATTAAAAAAATA Primer for amplifying the adc gene RC0025AGAGTTACC from Clostridium acetobutylicumATCC 824 strain1068 CCTCACGGCAAAGTCTCAAGC Primer for sequencing the ctfA and R00026ctfB genes1069 GCCATGGGTCTAAGTTCATTGG Primer for sequencing the ctfA and R00027ctfB genes0074 CATGATTTTAAGGGGGGTACCAT Primer for amplifying the thl gene R00028AT G CATAAG TTT AA from Clostridium acetobutylicumATCC 824 strain0075 GTTATTTTTAAGGATCCTTTTTAG Primer for amplifying the thl gene R00029CACTTTTCTAGC from Clostridium acetobutylicumATCC 824 strain1070 GGCAGAAAGGGAGAAACTGTAG Primer for sequencing the acetone RC0030operon from Clostridiumacetobutylicum (ATCC 824)1071 TGGAAAGAATACGTGCAGGCGG Primer for sequencing the acetone RC0031operon from Clostridiumacetobutylicum (ATCC 824)1072 GATTACGCCAAGCTTGCATGCC Primer for sequencing the acetone RC0032operon from Clostridiumacetobutylicum (ATCC 824)1073 CCGGCCTCATCTACAATACTACC Primer for sequencing the acetone RC0033operon from Clostridiumacetobutylicum (ATCC 824)1074 CCCATTATTGCTGGGTCAACTCC Primer for sequencing the acetone R00034operon from Clostridiumacetobutylicum (ATCC 824)1516 CCCGGTACCTCATTACTTTTTCAG Primer for amplifying the RC0035ATCGCTCCAAACCC phosphoketolase gene(YP 003354041.1) fromLactococcus fact/s.1517 GGGGAATTCAGGAGGTGTACTAG Primer for amplifying the RC0036ATGCATCATCACCACCATCACAT phosphoketolase geneGACC (YP 003354041.1) fromLactococcus fact/s. 1994 CCATAGCTCCACCCATACCAGAG Primer for sequencing the acetone RC0037AGC operon from Clostridiumacetobutylicum (ATCC 824) 1995 GCTATTATTACGTCAGCATCTCCT Primer for sequencing the acetone R00038GC operon from Clostridiumacetobutylicum (ATCC 824) 1996 GCAGGCGAAGTTAATGGCGTGC Primer for sequencing the acetone RC0039operon from Clostridiumacetobutylicum (ATCC 824)1997 GATACGGGGTAACAGATAAACCA Primer for sequencing the acetone R00040TTTC operon from Clostridiumacetobutylicum (ATCC 824)1998 CCCTTTCTGCCTITAATTACTACA Primer for sequencing the acetone RC0041GG operon from C/ostridium38CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685acetobutylicum (ATCC 824)1999 GCATCAGGATTAAATGACTGTGC Primer for sequencing the acetone RC0042AGO operon from Clostridiumacetobutylicum (ATCC 824) 2000 GGACTAGCGCCCATTCCAACTAT Primer for sequencing the acetone R00043TOO operon from Clostridiumacetobutylicum (ATCC 824)2001 GCTGCAAGGCGATTAAGTTGGGT Primer for sequencing the acetone R00044AACGCC operon from Clostridiumacetobutylicum (ATCC 824)2002 GCATTGCGTGTACAAGAGTAACG Primer for sequencing the acetone R00045AG operon from Clostridiumacetobutylicum (ATCC 824)2003 CCTGTCCAAGCTTCATGTACGG Primer for sequencing the acetone R00046operon from Clostridiumacetobutylicum (ATCC 824)1109 GCGCAAGATCATGTTACCGGTAA Primer for deletion of the zwf gene. R00047 AATAACCATAAAGGATAAG C G CAGATAGCATATGCTGCGTGCATGC1110 CGCCTGTAACCGGAGCTCATAGG Primer for sequencing the E.coli R00048chromosomal region including the zwf gene.Chromosomal Integration for Gene Knockouts.

To integrate DNA into a specific region of the chromosome, homology of the inserting DNA to the targeted chromosomal site and a selectable marker are required.

It is advantageous if the marker can be easily removed after integration.

The FRT/Flp recombinase system provides a mechanism to remove the marker.

The FRT sites are recognition sites for the Flp recombinases.

Flp is a site specific recombinase, which excises the intervening DNA from the directly repeated recognition sites.The integration cassette containing homologous arms to the targeted chromosomal site and encoding a selectable marker flanked by FRT (Datsenko KA.

And Wanner BL., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645) sites is transformed into target cells harboring pKD46 (Datsenko KA.

And Wanner BL., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645).

Successful integrants are selected by growth of the cells in the presence of the antibiotic.

Subsequently, pKD46 is cured from the cells and the recombinase plasmid is then introduced into the integrants for removal of the antiobiotic gene.

Strains containing a FRT cassette are transformed with the pCP20 plasmid that encodes Flp recombinase (Datsenko KA.

And Wanner BL., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645).

After removal of the integrated marker, the recombinase plasmids are cured from the strain.39CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685EXAMPLE 1 : Construction of strain GBE1014The purpose of this section is to describe the construction of an Escherichia colt strain, named GBE1014, for which the PEP-dependent glucose uptake is inactivated by deletion of the PTS transport genes, the ATP-dependent glucose uptake is enabled, the Embden-Meyerhof-Parnas pathway (EMPP) is inactivated by deletion of the phosphofructokinase genes, and the pentose phosphate pathway (PPP) is inactivated by deletion of the glucose-6-phosphate dehydrogenase gene.Construction started with strain GBE0901. GBE0901 is an Escherichia coil, (Migula) Castellani and Chalmers, strain MG1655 (ATCC #700926) where the original nucleotidic sequence, from bp 2531736 to 2533865 (NCBI genome database), included the ptsH and ptsl genes, was replaced by SEQ S00001.

This deletion affects the PEP-dependent phosphotransferase system (PTS), resulting in the PEP-dependent glucose uptake to be inactivated in strain GBE0901.

Deletion of the ptsHI genes was verified by PCR and oligonucleotides 0635 and 0638 (given as SEQ R00001 and R00002, respectively) were used as primers.

The resulting 0.4 Kbp PCR product was sequenced using the same primers.Strain GBE0901 was cultivated in LB medium and GBE0901 cells were made electrocompetent.

Electroconnpetent GBE0901 cells were transformed with a plasmid named pKD46 (Datsenko KA.

And Wanner BL., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645) and then plated on LB plates containing ampicilline (10Oug/m1).

Plates were incubated overnight at 30 C.

Transformation of GBE0901 cells with plasmid pKD46 generated strain GBE0902.

The plasmid pGBE0688 presents a resistance gene to spectinomycin placed under the control of its own promoter.

The sequence of this resistance cassette is indicated in table 3 (SEQ SQ0002).Plasmid pGBE0688 was used as a template with primers 0633 and 0634 (given as SEQ R00003 and RC0004, respectively) to generate a 1.3Kbp PCR product.

This 1.3 Kbp PCR product was transformed into electrocompetent GBE0902 bacteria and the transformation mixture was then plated on LB plates containing spectinomycin (50ua/m1) and incubated overnight at 37 C to generate strain GBE0903.

In strain GBE0903 the DNA sequence composed by the zwf, edd, and eda genes were deleted.

These genes respectively code for a glucose-6-phosphate dehydrogenase, a 6- phosphogluconate dehydratase, and a 2-keto-3-deoxy-6-phosphogluconate aldolase.

This deleted DNA sequence including the zwf, edd, and eda genes was replaced by a spectinomycin resistance cassette.

In order to check the effective deletion of the zwf, edd, and eda genes, a PCR amplification was performed with primers 1036 and 1037 (given as SEQ RC0005 and R00006, respectively). A finalCA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/0636851.9 Kbp PCR product was obtained.

This 1.9 Kbp FOR product was sequenced with the same primers 1036 and 1037.Strain GBE0903 was then plated on LB plates, incubated at 37 C and isolated colonies were screened on MS plates (Richaud C., Mengin-Leucreulx D., Pochet S., Johnson EJ., Cohen GN. and Marhere P; The Journal of Biological Chemistry; 1993; Vol. 268; No. 36; pp. 26827-26835) with glucose as the source of carbon (2g/L).

After 48 hours of incubation at 37 C, colonies became visible and were transferred to an MS liquid medium supplied with glucose (2g/L).

This overnight incubation at 37 C induced the loss of the pKD46 plasmid.

One isolate had a doubling time of 7 hours and was named GBE1000.Strain GBE1000 was made electrocompetent. GBE1000 electrocompetent cells were transformed with plasmid pKD46, and then plated on LB plates supplied with ampicilline (10Oug/m1).

Plates were incubated overnight at 30 C.

Transformation of GBE1000 cells with plasmid pKD46 generated strain GBE1001.The plasmid pGBE0687 presents a resistance gene to apramycin placed under the control of its own promoter.

The sequence of this resistance cassette is indicated in table 3 (SEQ SQ0003).The plasmid pGBE0687 was used as a template along with primers 0629 and 0630 (given as SEQ R00007 and R00008, respectively) to generate a 1.2 Kbp FOR product.

The resulting 1.2 Kbp FOR product was transformed into electrocompetent GBE1001 bacteria and the transformation mixture was plated on LB plates containing apramycin (5Oug/m1).

Plates were then incubated overnight at 37 C to generate a new strain named GBE1005_pKD46.

In Strain GB1005_pKD46 the phosphofructokinase gene pfkA, was deleted and was replaced by the apramycin resistance cassette.

To check that the deletion of the pfkA gene occured, a FOR amplification was performed with primers 0619 and 0620 (given as SEQ R00009 and R00010, respectively).

This 1.7 Kbp FOR product was sequenced with the same primers 0619 and 0620.

In order to check the loss of the plasmid pKD46, the strain GBE1005_pKD46 was plated on LB plates and incubated overnight at 42 C.

The loss of the plasmid pKD46 was verified by plating isolated colonies on LB plates containing ampicilline (10Oug/m1), incubated overnight at 30 C, and on LB plates incubated overnight at 37 C.

The resulting strain grew on LB plates incubated at 37 C and was named GBE1005. GBE1005 cells did not grow on LB plates supplied with ampicilline (10Oug/m1).The spectinomycin cassette was located at the corresponding loci of the zwf edd eda genes and the apramycin cassette was located at the corresponding loci of the pfkA genes.

In order to excise the resistant cassettes containing the spectinomycin and apramycin resistance genes, the strain GBE1005 was transformed with the plasmid pCP20 (Datsenko KA.

And Wanner BL., Proceedings of41CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645) to obtain the strain GBE1005_p.

After overnight incubation on LB plates containing ampicilline (10Oug/m1) at 30 C, isolated colonies were restreaked on LB plates supplied with ampicilline (10Oug/m1) and incubated overnight at 30 C.

Isolated colonies were then plated on LB plates and incubated overnight at 42 C which caused the loss of the pCP20 plasmid.

Then, in order to check the effective excision of the two resistant cassettes and the loss of the pCP20 plasmid, isolated colonies were streaked out on LB plates containing spectinomycin (50ug/m1), incubated overnight at 37 C, on LB plates containing apramycin (50 ug/ml), incubated overnight at 37 C, on LB plates containing ampicilline (100 ug/ml), incubated overnight at 30 C and on LB plates, incubated overnight at 37 C.

The resulting strain grew on LB plates incubated at 37 C and was named GBE1006. GBE1006 cells did not grow on LB plates containing spectinomycin (5Oug/m1), on LB plates containing apramycin (50 ug/ml), and on LB plates supplied with ampicilline (10Oug/m1).Strain GBE1006 was made electrocompetent, and GBE1006 electrocompetent cells were transformed with plasmid pKD46.

Transformant cells were then plated on LB plates containing ampicilline (10Oug/m1) and plates were incubated overnight at 30 C to obtain a new strain named GBE1010. A PCR product was generated by using the plasmid pGBE0688 as a template and the oligonucleotides 0631 and 0632 (given as SEQ R00011 and RC0012, respectively) as primers.

The resulting 1.3 Kbp PCR product was transformed into electrocompetent GBE1010 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (5Oug/m1).

Plates were incubated overnight at 37 C to generate strain GBE1014_ pKD46.

In Strain GBE1014_ pKD46 the phosphofructokinase gene pfkB, was deleted and the deleted DNA sequence was replaced by a cassette containing the spectinomycin resistance gene.

To check that the deletion of the pfkB gene occured, a PCR amplification was performed with primers 0621 and 0622 (given as SEQ R00013 and RC0014, respectively).

This final 2.2 Kbp FOR product was sequenced by using the same primers 0621 and 0622.In order to induce the loss of the plasmid pKD46, strain GBE1014_ pKD46 was plated on LB plates and plates were incubated overnight at 42 C.

The loss of the plasmid pKD46 was checked by plating isolated colonies on LB plates supplied with ampicilline (10Oug/m1), incubated overnight at 30 C, and on LB plates incubated overnight at 37 C.

The resulting strain growing on LB plates incubated at 37 C was named GBE1014. GBE1014 cells did not grow on LB plates supplied with ampicilline (10Oug/m1).42CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685EXAMPLE 2: Construction of strain GBE0929Strain GBE0901 was plated on LB plates at 37 C and isolated colonies were screened on MS plates with glucose as the source of carbon (2g/L).

After 48 hours of incubation at 37 C, colonies became visible.

One isolate had a doubling time of 5 hours and was named GBE0929.EXAMPLE 3 : Construction of strain GBE1344Construction started with the strain named GBE0129. GBE0129 is an MG1655 Escherichia coil bacteria (ATCC #700926).Strain GBE0129 was cultivated in LB medium and GBE0129 cells were made electrocompetent.

Electrocompetent GBE0129 cells were transformed with plasmid pKD46, and then transformants were plated on LB plates containing ampicilline (10Oug/m1).

Plates were incubated overnight at 30 C to generate a new strain named GBE0170.A PCR product was generated using plasmid pGBE0687 as a template and oligonucleotides 0633 and 0634 (given as SEQ R00003 and R00004, respectively)as primers. The resulting 1.2 Kbp PCR product was transformed intoelectrocompetent GBE0170 bacteria and the transformation mixture was plated on LB plates containing apramycin (5Oug/m1).

Plates were incubated overnight at 37 C.

This incubation triggered the loss of the pKD46 plasmid and led to the creation of a new strain named GBE1339.

In Strain GBE1339 the glucose-6-phosphate dehydrogenase encoded by the zwf gene, the 6-phosphogluconate dehydratase encoded by the edd gene and the 2-keto-3-deoxy-6-phosphogluconate aldolase encoded by the eda gene were inactive.

The sequential zwf, edd, and eda genes were deleted and replaced by a cassette containing the apramycin resistance gene.

To check that the deletion of the zwf, edd, and eda genes was effective, a PCR amplification was performed with primers 1036 and 1037 (given as SEQ RC0005 and RC0006, respectively).

This 1.8 Kbp PCR product was sequenced with the same primers 1036 and 1037.Strain GBE1339 was made electrocompetent, and GBE1339 electrocompetent cells were transformed with plasmid pKD46.

Transformants were then plated on LB plates supplied with ampicilline (10Oug/m1).

Plates were incubated overnight at 30 C to generate strain GBE1340. A PCR product was performed by using plasmid pGBE0688 as a template and oligonucleotides 0629 and 0630 (given as SEQ RC0007 and RC0008, respectively) as primers.

The resulting 1.3 Kbp PCR product was transformed into electrocompetent GBE1340 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (5Oug/m1).

Plates wereincubated overnight at 37 C to generate strain GBE1341_pKD46. In Strain43CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685GB1341_pKD46 the pfka gene coding for a phosphofructokinase was replaced by the spectinomycin resistance gene.

To check that the deletion of the pfkA gene was effective, a PCR amplification was performed with primers 0619 and 0620 (given as SEQ R00009 and R00010, respectively).

This 1.8 Kbp PCR product was sequenced with the same primers 0619 and 0620.

In order to induce the loss of the plasmid pKD46 for the strain GBE1341_pKD46, GBE1341 pKD46 cells were plated on LB plates and incubated at 42 C.

The loss of the plasmid pKD46 was verified by plating isolated colonies on LB plates supplied with ampicilline (100ug/m1), incubated overnight at 30 C and on LB plates incubated overnight at 37 C.

The resulting strain growing on LB plates incubated at 37 C was GBE1341. GBE1341 did not grow on LB plates supplied with ampicilline (10Oug/m1).In order to excise the resistant cassettes containing the apramycin and spectinomycin resistance genes, which were respectively located in the former loci of the zwf edd eda and pfkA genes, the strain GBE1341 was transformed with plasmid pCP20 to obtain a new strain named GBE1341_p.

After overnight incubation on LB plates containing ampicilline (10Oug/m1) at 30 C, isolated colonies were restreaked on LB plates supplied with ampicilline (10Oug/m1) for another overnight incubation at 30 C.

Isolated colonies were then plated on LB plates and incubated overnight at 42 C.

This incubation at 42 C triggered the loss of the pCP20 plasmid.

Eventually in order to check excision of the two resistant cassettes and the loss of the pCP20 plasmid, isolated colonies were streaked out on LB plates containing spectinomycin (5Oug/m1) and incubated overnight at 37 C, on LB plates supplied with apramycin (5Oug/m1) and incubated overnight at 37 C, on LB plates containing ampicilline (10Oug/m1) and incubated overnight at 30 C and on LB plates incubated overnight at 37 C.

The generated strain growing on LB plates incubated at 37 C was named GBE1342. GBE1342 cells did not grow on LB plates supplied with spectinomycin (5Oug/m1), on LB plates supplied with apramycin (5Oug/m1) and on LB plates containing ampicilline (10Oug/m1).Strain GBE1342 was made electrocompetent, and GBE1342 cells were transformed with plasmid pKD46.

Transformants were then plated on LB plates supplied with ampicilline (10Oug/m1) and incubated overnight at 30 C to obtain strain GBE1343. A FOR product was performed and used the plasmid pGBE0688 as a template and oligonucleotides 0631 and 0632 (given as SEQ R00011 and RC0012, respectively)as primers. The resulting 1.3 Kbp PCR product was transformed intoelectrocompetent GBE1343 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (5Oug/m1) followed by an overnight incubation at 37 C. A new strain was generated and named GBE1344_ pKD46.

In Strain GBE1344_ pKD46 the pfkb gene coding for a phosphofructokinase was deleted and replaced by the spectinomycin resistance cassette.

To check that the deletion of the44CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685pfkB gene was effective, a FOR amplification was performed with primers 0621 and 0622 (given as SEQ RC0013 and R00014, respectively).

The 2.2 Kbp PCR product obtained was sequenced with the same primers 0621 and 0622.In order to induce the loss of the plasmid pKD46, the strain GBE1344_ pKD46 was plated on LB plates and incubated overnight at 42 C.

The loss of the plasmid pKD46 was checked by plating isolated colonies on LB plates containing ampicilline (10Oug/m1) and incubated overnight at 30 C and on LB plates incubated overnight at 37 C.

The generated strain growing on LB plates incubated at 37 C was named GBE1344. GBE1344 cells did not grow on LB plates containing ampicilline (10Oug/m1).EXAMPLE 4: Construction of plasmid pGBE0457The purpose of this section is to describe the construction of a plasmid that allows the expression of phosphoketolase YP_003354041.1 from Lactococcus lactis in E. coli strains.The plasmid pGBE0123 is a modified version of the plasmid pUC18 (New England Biolabs) and contains a modified Multiple Cloning Site (MCS).

The original MCS from pUC18 (from HindlIl restriction site to EcoRI restriction site) was replaced by the sequence SQ0004 (table 3).

The plasmid pGB0123 allows expression of two recombinant proteins under the control of the Plac promoter.Phosphoketolase Phosphoketolase Organism of Plasmid fromgene ID protein ID origin GeneArt (Invitrogen)8679043 YP 003354041.1 Lactococcus pGBE0421lactis subsp.lactis KF147The L. lactis phosphoketolase gene was codon-optimized by GeneArt0 (lnvitrogen) for optimal expression in Escherichia coil.

In addition, a His-tag was added at the 5' position of the gene and an additional stop codon was added at the 3' position (SQ0005).

The gene construction is flanked by Pad l and Notl restriction sites and provided within plasmid pGBE0421.For cloning experiment, FOR products and restriction fragments were gel purified using QIAquick gel Extraction kit (Qiagen).

Restriction enzymes and T4 DNA ligase (New England Biolabs, Beverly, MA) were used according to manufacturer's recommendations.Plasmid pGBE0421 was digested with the restriction enzymes Pad l and Notl to create a 2.6 Kbp product.

The pGB0123 plasmid was digested as well with restriction enzymes, Pad l and Notl and ligated to the 2.6 Kbp restriction fragment.

The resultingCA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685plasmid (pGBE0457) was sequenced with primers 1061, 1062, 1063, 1064 and 1065 (given as SEQ RC0015, R00016, R00017, R00018 and R00019 respectively).The expression of the phosphoketolase from Lactococcus lactis was checked on a protein gel, after purification of the recombinant protein using a His trap (Protino Ni-IDA 1000 kit, Macherey Nagel).

Purification was processed according to the manufacturer's recommendations.

Enzymatic assay, with purified enzyme, was also performed in order to detect phosphoketolase activity on two different substrates: xylulose-5-phosphate and fructose-6-phosphate.

The experimental procedure was the same than the one used by Leo Meile et al., (Journal of Bacteriology, May 2001, p.2929-2936), except that the pH of the solution was 7.5 and 1mM of MgCl2 was added.

For this enzymatic assay, 10 pg of purified protein was added to the 75 pl of the reaction.

The specific activity (pmol of Acetyl-P formed/min/mg protein) was 2815 pmol/min/mg protein and 1941 pmol/min/mg protein for D-xylulose-5-phosphate and D-fructose-6-phosphate, respectively.EXAMPLE 5: Construction of plasmid pGBE0096The construction of the plasmids responsible for acetone production in E.coli was based on the plasmid construction described in Bermejo LL., Welker NE. and Papoutsakis ET., Applied and Environmental Microbiology, 1998, Vol. 64, No. 3, pp. 1076-1085.The strain Clostridium acetobutylicum was ordered (ATCC 824).

The genomic DNA from this strain is made up of a bacterial chromosome and a plasmid named pSOL1.

The ctfA and ctfB genes were PCR amplified from the pSOL1 plasmid with primers 0070 and 0071 (given as SEQ R00020 and R00021, respectively). A BamHI restriction site at the 5' end of the FOR product and an EcoRV restriction site at the 3' end of the PCR product were introduced.

The resulting 1.3 Kbp PCR product was digested with the restriction enzymes BamHI and EcoRV, then ligated with the pGB0689 (pBluescript II phagemids, Agilent Technologies) which was digested as well with restriction enzymes, BamHi and EcoRV.

The resulting plasmid (pGBE0690) was sequenced with primers 1066 and 1067 (given as SEQ R00022 and R00023, respectively).The adc gene and the gene terminator were FOR amplified from the pSOL1 plasmid with primers 0072 and 0073 (given as SEQ R00024 and R00025, respectively). PCR amplification allowed inserting an EcoRV restriction site at the 5' end and a Sall restriction site at the 3' end.

The resulting 0.8 Kbp FOR product was digested with the restriction enzymes EcoRV and Sall.

The pGBE0690 plasmid was digested as well with restriction enzymes, EcoRV and Sall and then ligated with the 0.8 Kbp FOR product.

The resulting plasmid (pGBE0691) was sequenced with primers 1066, 1067,46CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/0636851068 and 1069 (given as SEQ R00022, R00023, R00026 and R00027, respectively).Plasmid pGBE0691 was digested with the restriction enzymes BamHI and Sall to create a 2.2 Kbp product.

The 2.2 Kbp restriction fragment contained the ctfA, ctfB and adc genes.

The pGBE0051 plasmid (pUC19, New England Biolabs) was digested as well with restriction enzymes, BamHI and Sall, and was then ligated with the 2.2 Kbp restriction fragment.

The resulting plasmid (pGBE0692) was sequenced with primers 1066, 1067, 1068 and 1069 (given as SEQ RC0022, R00023, R00026 and R00027, respectively).The thl gene and its corresponding thl promoter from Clostridium acetobutylicum (ATCC 824) genomic DNA were FOR amplified with primers 0074 and 0075 (given as SEQ R00028 and R00029, respectively). FOR amplification allowed inserting a Kpnl restriction site at the 5' end and a BamHI restriction site at the 3' end.

The resulting 1.4 Kbp FOR product was digested with the restriction enzymes Kpnl and BamHI, and likewise for the plasmid pGBE0692.

The digested pGBE0692 plasmid was ligated with the 1.4 Kbp PCR product.

The resulting plasmid, pGBE0693, was sequenced with primers 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073 and 1074 (given as SEQ R00022, R00023, R00026 R00027, R00030, R00031, R00032, R00033 and R00034, respectively).The plasmid pGBE0124 is a modified version of the plasmid pSU18 (Borja Bart tome, Yolanda Jubete, Eduardo Martinez and Fernando de la Cruz, Gene, 1991, Vol. 102, Issue 1, pp. 75-78) and it contains a modified Multiple Cloning Site (MCS).

The original MCS from pSU18 (from EcoRI restriction site to HindlIl restriction site) was replaced by the sequence SEQ S00006 (table 3).

The plasmid pGB0124 allows expression of two recombinant proteins under the control of the Plac promoter.

Plasmid pGBE0693 was digested with the restriction enzymes Kpnl and Sall to create a 3.5 Kbp product.

The pGBE0124 plasmid was digested as well with restriction enzymes Kpnl and Sall, and then ligated to the 3.5 Kbp restriction fragment.

The resulting plasmid (pGBE0096) was sequenced with primers 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073 and 1074 (given as SEQ R00022, R00023, R00026 R00027, R00030, R00031, R00032, RC0033 and R00034, respectively).EXAMPLE 6 : Acetone production by the strains GBE1346 and GBE1347.

Description of plasmid transformation into relevant strainsThe strain GBE0129 was made electrocompetent, and GBE0129 electrocompetent cells were transformed with plasmid pGBE0096.

Transformants were then plated on47CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685LB plates containing chloramphenicol (25ug/m1) and plates were incubated overnight at 30 C to generate strain GBE0329.Strain GBE1344 was made electrocompetent, and GBE1344 electrocompetent cells were transformed with both plasmids pGBE0457 and pGBE0096.

Transformants were then plated on LB plates supplied with ampicilline (10Oug/m1) and chloramphenicol (25ug/m1).

Plates were incubated overnight at 30 C to obtain strain GBE1345.Isolated colonies from strains GBE0329 and GBE1345 were screened on MS plates containing glucose as the source of carbon (2g/L) and chloramphenicol (25ug/m1).

These plates were incubated at 30 C to obtain strains GBE1346 and GBE1347 respectively.

After 4 days of incubation at 30 C, colonies were transferred to MS liquid medium containing glucose (2g/L) and chloramphenicol (25ug/m1) and incubated 3 days at 30 C.Description of flasks conditionsFor the fermentation experiments, a MS medium with 200 mM of dipotassium phosphate was used instead of 50 mM dipotassium phosphate.

The resulted medium was named MSP.400 ml of MSP liquid medium containing glucose (10g/L) and chloramphenicol (25ug/m1), were inoculated either with pre culture of strain GBE1346 or with pre culture of strain GBE1347.

The initial 0D600 was 0.1.

The 400 ml of culture were incubated in 500 ml bottles, sealed with a screw cap, at 30 C, 170 rpm of speed. 2 ml aliquots were taken after 1 day, 2 days, 3 days, 6 days, 7 days and 8 days.

For each aliquot samples, bottles were open during 10 seconds.Description of analytical methodsAliquots were filtered and the glucose concentration was determined with the glucose (HK) Assay kit (GAHK20-1KT, Sigma) according to manufacturer's recommendations.

The acetone concentration was determined by gas chromatography using Gas chromatograph 450-GC (Bruker) and the following program:- Column: DB-WAX (123-7033, Agilent Technologies)- Injector Split/Splitless : T = 250 C- Oven:o 80 C for 6 minuteso 10 C per minutes until 220 CO 220 C for 7 minuteso Column flow: 1,5ml/minute (Nitrogen)- Detector FID : T = 300 C48CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685ResultsThe ratio [acetone]produced (mM) / [glucose]consumed (mM) is higher for the strain GBE1347 than for the strain GBE1346.EXAMPLE 7 : Acetone production by the strains GBE1350 and GBE1351.

Description of plasmid transformation into relevant strainsStrain GBE0929 was made electrocompetent, and GBE0929 electrocompetent cells were transformed with a plasmid named pGBE0096.

Transformants were then plated on LB plates supplied with chloramphenicol (25ug/m1) and plates were incubated overnight at 30 C to obtain strain GBE1348.Strain GBE1014 were made electrocompetent, transformed with both plasmids pGBE0457 and pGBE0096.

Transformants were then plated on LB plates supplied with ampicilline (10Oug/m1) and chloramphenicol (25ug/m1) and plates were incubated overnight at 30 C to obtain strain GBE1349.Isolated colonies from strains GBE1348 and GBE1349 were screened on MS plates containing glucose as the source of carbon (2g/L) and chloramphenicol (25ug/m1).

These plates were incubated 4 days at 30 C to obtain strain GBE1350 and GBE1351 respectively.

Isolated colonies were then transferred to MS liquid medium containing glucose (2g/L) and chloramphenicol (25ug/m1). GBE1350 and GBE1351 Cells were incubated at 30 C.Description of flasks conditions400 ml of MSP medium containing glucose (10g/L) and chloramphenicol (25ug/m1) were inoculated either with pre-culture of strain GBE1350 or with pre-culture of strain GBE1351.

The initial 0D600 was 0.1.

The 400 ml of culture were incubated in 500 ml bottles, sealed with a screw cap, at 30 C, 170 rpm of speed. 2 ml aliquots were taken after 1 day, 2 days, 3 days, 6 days, 7 days and 8 days.

For each aliquot samples, bottles were opened during 10 seconds.Description of analytical methodsAliquots were filtered and the glucose concentration was determined with the glucose (HK) Assay kit (GAHK20-1KT, Sigma) according to manufacturer's recommendations.

The acetone concentration was determined by gas chromatography using Gas chromatograph 450-GC (Bruker) and the following program:- Column : DB-WAX (123-7033, Agilent Technologies)- Injector Split/Splitless : T = 250 C49CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685- Oven:o 80 C for 6 minutesO 10 C per minutes until 220 CO 220 C for 7 minuteso Column flow: 1,5m1/minute (Nitrogen)- Detector FID : T = 300 CResultsThe ratio [acetone]produced (mM) / [glucose]consumed (mM) was higher for the strain GBE1351 than for the strain GBE1350.TABLE OF RESULTS I0w=(44GBE1346 GBE1347 GBE1350 GBE1351 'a=-1-1 oe c,PEP dependent glucose uptake(ptsHI) + + - -Heterologous phosphoketolase(pkt) - + - +EMPP (pfkAB) + - + ,-,PPP (zwf edd eda) + + 0-I.,0HHeterologous fructose H-CAbisphosphatase (fbp) - - -I.,0 H FPHeterologous acetone pathway 10(thl ctfAB adc) + + + + Hi00[acetone]produced[g IUCOSe]consumed 0.02 >0.02 0.04 0.14 .o n,-im.o w=w'a c,(440100CACA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685EXAMPLE 8: Construction of the plasmid pGBE1020The purpose of this section is to describe the construction of a plasmid that allows the expression of phosphoketolase YP_003354041.1 from Lactococcus lactis and also allows the production of acetone in E. coli strains.The L.

Lactis phosphoketolase gene was PCR amplified from the pGBE0421 plasmid with primers 1516 and 1517 (given as SEQ R00035 and R00036, respectively).FOR amplification allowed inserting an EcoRI restriction site and a Ribosome Binding Site (RBS) at the 5' end and a Kpnl restriction site at the 3' end.

The resulting 2.5 Kbp PCR product was digested with the restriction enzymes EcoRI and Kpnl.

The pGBE0123 plasmid was digested as well with restriction enzymes, EcoRI and Kpnl and then ligated with the 2.5 Kbp FOR product.

The resulting plasmid (pGBE0928) was sequenced with primers 1061, 1062, 1063, 1064 and 1065 (given as SEQ RC0015, R00016, R00017, R00018 and R00019, respectively).Plasmid pGBE0096 was digested with the restriction enzymes Kpnl and Notl to create a 3.6 Kbp product.

The pGBE0928 plasmid was digested as well with restriction enzymes, Kpnl and Notl and ligated to the 3.6 Kbp restriction fragment.

The resulting plasmid (pGBE1020) was sequenced with primers 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002 and 2003 (given as SEQ R00037, R00038, R00039, R00040, R00041, R00042, R00043, R00044, R00045 and R00046, respectively).EXAMPLE 9: Construction of the plasmid pGBE1021The purpose of this section is to describe the construction of a plasmid that allows the production of acetone in E. coil strains.Plasmid pGBE0096 was digested with the restriction enzymes Kpnl and Not! to create a 3.6 Kbp product.The pGBE0123 plasmid was digested as well with restriction enzymes, Kpnl and Notl and then ligated with the 3.6 Kbp FOR product.

The resulting plasmid (pGBE1021) was sequenced with primers 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002 and 2003 (given as SEQ R00037, R00038, R00039, R00040, R00041, R00042, R00043, R00044, R00045 and R00046, respectively).EXAMPLE 10 : Acetone production by the strains GBE2264 and GBE2265.

Description of plasmid transformation into relevant strainsThe strain GBE0129 was made electrocompetent, and GBE0129 electrocompetent cells were transformed with plasmid pGB1021.

Transformants were then plated on52CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685LB plates containing ampicilline (10Oug/m1) and plates were incubated overnight at 30 C to generate strain GBE2262.Strain GBE1344 was made electrocompetent, and GBE1344 electrocompetent cells were transformed with the plasmid pGBE1020.

Transformants were then plated on LB plates supplied with ampicilline (10Oug/m1).

Plates were incubated overnight at 30 C to obtain strain GBE2263.Isolated colonies from strains GBE2262 and GBE2263 were screened on MS plates containing glucose as the source of carbon (2g/L) and ampicilline (10Oug/rn1).

These plates were incubated at 30 C to obtain strains GBE2264 and GBE2265, respectively.

After 4 days of incubation at 30 C, colonies were transferred to MS liquid medium containing glucose (2g/L), yeast extract (0,1g/L) and ampicilline (10Oug/m1) and incubated 3 days at 30 C.Description of flasks conditionsMSP liquid medium (200 ml) containing glucose (10g/L), yeast extract (0,1g/L) and ampicilline (10Oug/m1), were inoculated either with pre culture of strain GBE2264 or with pre culture of strain GBE2265.

The initial 0D600 was 0.1.

The 200 ml of culture was incubated in 250 ml bottles, sealed with a screw cap, at 30 C, 170 rpm of speed.

Aliquots (2 ml) were taken after 1 day, 2 days, 4 days, 5 days and 6 days.

For each aliquot sample, the bottle was open for 10 seconds.Description of analytical methodsAliquots were filtered and the glucose concentration was determined by HPLC analysis using the Agilent HPLC (1260 Infinity) and a Hi-Flex Colomn (Agilent, PL1170-6830) with a guard column (Agilent, PL Hi-Flex H Guard Column, PL1170-1830).- Volume of injection : 20 pl- Solvent composition : [1-12SO4] : 5.5 mM- Temperature of the columns : 65 C- RID (G1362A) : temperature set: 35 CAcetone was extracted from the filtered aliquots by mixing with methyl acetate (1 volume of methyl acetate for 2 volumes of filtered aliquot).

Acetone concentration was determined by gas chromatography using Gas chromatograph 450-GC (Bruker) and the following program:- Column: DB-WAX (123-7033, Agilent Technologies)- Injector:o Split ratio: 10o T = 250 C- Oven:53CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685o 50 C for 9 minuteso 20 C per minute until 180 Co 180 C for 5 minuteso Column flow: 1,5nri1/minute (Nitrogen)- Detector FID : T = 300 CResultsThe ratio [acetone] produced (mM) / [glucose] consumed (mM) was higher for the strain GBE2265 than for the strain GBE2264.EXAMPLE 11: Construction of the strain GBE1283Strain GBE0929 was plated on MS plates containing glucose as the source of carbon (2g/L).

An isolated colony was transferred to MS liquid medium containing glucose (2g/L) and incubated 3 days at 30 C. MS liquid medium (100 ml) containing glucose (2g/L) was inoculated with pre culture of strain GBE0929.

The initial 00600 was 0.1.

The 100 ml of culture was incubated in a 1L erlenmeyer, at 30 C, 170 rpm of speed.

When the 00600 was superior to 1, an aliquot of the culture was taken and used as inoculum for a fresh culture (100 ml of culture incubated in 1L erlenmeyer, at 30 C, 170 rpm of speed).

Strain GBE0929 was sub-cultured 10 times to obtain strain GBE1283.EXAMPLE 12: Construction of the strain GBE2256.Strain GBE1283 was cultivated in LB medium and GBE1283 cells were made electrocompetent.

Electrocompetent GBE1283 cells were transformed with the pKD46 plasmid and then plated on LB plates containing ampicilline (10Oug/m1).

Plates were incubated overnight at 30 C.

Transformation of GBE1283 cells with plasmid pKD46 generated strain GBE1284.The plasmid pGBE0688 was used as a template along with primers 0629 and 0630 (given as SEQ RC0007 and RC0008, respectively) to generate a 1.2 Kbp PCR product.

The resulting 1.2 Kbp PCR product was transformed into electroconnpetent GBE1284 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (5Oug/m1).

Plates were then incubated overnight at 37 C to generate a new strain named GBE2252_pKD46.

In Strain GB2252_pKD46 the phosphofructokinase gene pfkA, was deleted and was replaced by the spectinomycin resistance cassette.

To check that the deletion of the pfkA gene occured, a PCR amplification was performed with primers 0619 and 0620 (given as SEQ RC0009 and RC0010, respectively).

This 1.7 Kbp PCR product was sequenced with the same primers 0619 and 0620.

In order to check the loss of the plasmid pKD46, the strain GBE2252_pKD46 was plated on LB plates and incubated overnight at 42 C.

The loss54CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685of the plasmid pKD46 was verified by plating isolated colonies on LB plates containing ampicilline (10Oug/m1), incubated overnight at 30 C, and on LB plates incubated overnight at 37 C.

The resulting strain grew on LB plates incubated at 37 C and was named GBE2252. GBE2252 cells did not grow on LB plates supplied with ampicilline (10Oug/m1).Strain GBE2252 was made electrocompetent, and GBE2252 electrocompetent cells were transformed with plasmid pKD46.

Transformant cells were then plated on LB plates containing ampicilline (10Oug/m1) and plates were incubated overnight at 30 C to obtain a new strain named GBE2253.A PCR product was generated by using the plasmid pGBE0687 as a template and the oligonucleotides 0631 and 0632 (given as SEQ RC0011 and R00012, respectively) as primers.

The resulting 1.3 Kbp PCR product was transformed into electrocompetent GBE2253 bacteria and the transformation mixture was plated on LB plates containing apramycin (50ug/m1).

Plates were incubated overnight at 37 Cto generate strain GBE2256_pKD46. In Strain GBE2256_pKD46 thephosphofructokinase gene pfkB, was deleted and the deleted DNA sequence was replaced by a cassette containing the apramycin resistance gene.

To check that the deletion of the pfkB gene occured, a PCR amplification was performed with primers 0621 and 0622 (given as SEQ RC0013 and RC0014, respectively).

This final 2.2 Kbp PCR product was sequenced by using the same primers 0621 and 0622.In order to induce the loss of the plasmid pKD46, strain GBE2256_ pKD46 was plated on LB plates and plates were incubated overnight at 42 C.

The loss of the plasmid pKD46 was checked by plating isolated colonies on LB plates supplied with ampicilline (10Oug/m1), incubated overnight at 30 C, and on LB plates incubated overnight at 37 C.

The resulting strain growing on LB plates incubated at 37 C was named GBE2256. GBE2256 cells did not grow on LB plates supplied with ampicilline (10Oug/m1).EXAMPLE 13: Construction of the strain GBE1518Plasmid pGBE0688 was used as a template with primers 0633 and 1109 (given as SEQ RC0003 and RC0047, respectively) to generate a 1.3Kbp PCR product.

This 1.3 Kbp PCR product was transformed into electrocompetent GBE1284 bacteria and the transformation mixture was then plated on LB plates containing spectinomycin (5Oug/m1) and incubated overnight at 37 C to generate strain GBE1433.

In strain GBE1433 the DNA sequence composed by the zwf gene were deleted.

This deleted DNA sequence including the zwf gene was replaced by a spectinomycin resistancecassette. In order to check the effective deletion of the zwf gene, a PCRamplification was performed with primers 1036 and 1110 (given as SEQ RC0005 andCA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685RC0048, respectively). A final 1.5 Kbp PCR product was obtained.

This 1.5 Kbp PCR product was sequenced with the same primers 1036 and 1110.Strain GBE1433 was made electrocompetent. GBE1433 electrocompetent cells were transformed with plasmid pKD46, and then plated on LB plates supplied with ampicilline (10Oug/m1).

Plates were incubated overnight at 30 C.

Transformation of GBE1433 cells with plasmid pKD46 generated strain GBE1436.The plasmid pGBE0687 was used as a template along with primers 0629 and 0630 (given as SEQ R00007 and R00008, respectively) to generate a 1.2 Kbp FOR product.

The resulting 1.2 Kbp PCR product was transformed into electrocompetent GBE1436 bacteria and the transformation mixture was plated on LB plates containing apramycin (5Oug/m1).

Plates were then incubated overnight at 37 C to generate a new strain named GBE1441_pKD46.

In Strain GB1441_pKD46 the phosphofructokinase gene pfkA, was deleted and was replaced by the apramycin resistance cassette.

To check that the deletion of the pfkA gene occured, a PCR amplification was performed with primers 0619 and 0620 (given as SEQ R00009 and R00010, respectively).

This 1.7 Kbp FOR product was sequenced with the same primers 0619 and 0620.

In order to check the loss of the plasmid pKD46, the strain GBE1441_pKD46 was plated on LB plates and incubated overnight at 42 C.

The loss of the plasmid pKD46 was verified by plating isolated colonies on LB plates containing ampicilline (10Oug/m1), incubated overnight at 30 C, and on LB plates incubated overnight at 37 C.

The resulting strain grew on LB plates incubated at 37 C and was named GBE1441. GBE1441 cells did not grow on LB plates supplied with ampicilline (10Oug/m1).The spectinomycin cassette was located at the corresponding loci of the zwf gene and the apramycin cassette was located at the corresponding loci of the pfkA gene.

In order to excise the resistant cassettes containing the spectinomycin and apramycin resistance genes, the strain GBE1441 was transformed with the plasmid pCP20 to obtain the strain GBE1441_p.

After overnight incubation on LB plates containing ampicilline (10Oug/m1) at 30 C, isolated colonies were restreaked on LB plates supplied with ampicilline (10Oug/m1) and incubated overnight at 30 C.

Isolated colonies were then plated on LB plates and incubated overnight at 42 C which caused the loss of the pCP20 plasmid.

Then, in order to check the effective excision of the two resistant cassettes and the loss of the pCP20 plasmid, isolated colonies were streaked out on LB plates containing spectinomycin (5Oug/m1), incubated overnight at 37 C, on LB plates containing apramycin (50 ug/ml), incubated overnight at 37 C, on LB plates containing ampicilline (100 ug/ml), incubated overnight at 30 C and on LB plates, incubated overnight at 37 C.

The resulting strain grew on LB plates incubated at 37 C and was named GBE1448. GBE1448 cells did not grow on LB56CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685plates containing spectinomycin (5Oug/m1), on LB plates containing apramycin (50 ug/ml), and on LB plates supplied with ampicilline (10Oug/m1).Strain GBE1448 was made electrocompetent, and GBE1448 electrocompetent cells were transformed with plasmid pKD46.

Transformant cells were then plated on LB plates containing ampicilline (10Oug/m1) and plates were incubated overnight at 30 C to obtain a new strain named GBE1449. A FOR product was generated by using the plasmid pGBE0688 as a template and the oligonucleotides 0631 and 0632 (given as SEQ R00011 and RC0012, respectively) as primers.

The resulting 1.3 Kbp FOR product was transformed into electrocompetent GBE1449 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (5Oug/m1).

Plates were incubated overnight at 37 C to generate strain GBE1518_ pKD46.

In Strain GBE1518_ pKD46 the phosphofructokinase gene pfkB, was deleted and the deleted DNA sequence was replaced by a cassette containing the spectinomycin resistance gene.

To check that the deletion of the pfkB gene occured, a FOR amplification was performed with primers 0621 and 0622 (given as SEQ R00013 and R00014, respectively).

This final 2.2 Kbp FOR product was sequenced by using the same primers 0621 and 0622.In order to induce the loss of the plasmid pKD46, strain GBE1518_ pKD46 was plated on LB plates and plates were incubated overnight at 42 C.

The loss of the plasmid pKD46 was checked by plating isolated colonies on LB plates supplied with ampicilline (10Oug/m1), incubated overnight at 30 C, and on LB plates incubated overnight at 37 C.

The resulting strain growing on LB plates incubated at 37 C was named GBE1518. GBE1518 cells did not grow on LB plates supplied with ampicilline (10Oug/m1).EXAMPLE 14: Construction of the strain GBE1420Plasmid pGBE0688 was used as a template with primers 0633 and 0634 (given as SEQ R00003 and R00004, respectively) to generate a 1.3Kbp FOR product.

This 1.3 Kbp PCR product was transformed into electrocompetent GBE1284 bacteria and the transformation mixture was then plated on LB plates containing spectinomycin (5Oug/m1) and incubated overnight at 37 C to generate strain GBE1287.

In strain GBE1287 the DNA sequence composed by the zwf, edd, and eda genes were deleted.

This deleted DNA sequence including the zwf, edd, and eda genes was replaced by a spectinomycin resistance cassette.

In order to check the effective deletion of the zwf, edd, and eda genes, a FOR amplification was performed with primers 1036 and 1037 (given as SEQ R00005 and R00006, respectively). A final 1.9 Kbp FOR product was obtained.

This 1.9 Kbp FOR product was sequenced with the same primers 1036 and 1037.57CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685Strain GBE1287 was made electrocompetent. GBE1287 electrocompetent cells were transformed with plasmid pKD46, and then plated on LB plates supplied with ampicilline (10Oug/m1).

Plates were incubated overnight at 30 C.

Transformation of GBE1287 cells with plasmid pKD46 generated strain GBE1337.The plasmid pGBE0687 was used as a template along with primers 0629 and 0630 (given as SEQ RC0007 and RC0008, respectively) to generate a 1.2 Kbp PCR product.

The resulting 1.2 Kbp PCR product was transformed into electrocompetent GBE1337 bacteria and the transformation mixture was plated on LB plates containing apramycin (5Oug/m1).

Plates were then incubated overnight at 37 C to generate a new strain named GBE1353_pKD46.

In Strain GB1353_pKD46 the phosphofructokinase gene pfkA, was deleted and was replaced by the apramycin resistance cassette.

To check that the deletion of the pfkA gene occured, a PCR amplification was performed with primers 0619 and 0620 (given as SEQ R00009 and R00010, respectively).

This 1.7 Kbp PCR product was sequenced with the same primers 0619 and 0620.

In order to check the loss of the plasmid pKD46, the strain GBE1353_pKD46 was plated on LB plates and incubated overnight at 42 C.

The loss of the plasmid pKD46 was verified by plating isolated colonies on LB plates containing ampicilline (10Oug/m1), incubated overnight at 30 C, and on LB plates incubated overnight at 37 C.

The resulting strain grew on LB plates incubated at 37 C and was named GBE1353. GBE1353 cells did not grow on LB plates supplied with ampicilline (10Oug/m1).The spectinomycin cassette was located at the corresponding loci of the zwf odd eda genes and the apramycin cassette was located at the corresponding loci of the pfkA genes.

In order to excise the resistant cassettes containing the spectinomycin and apramycin resistance genes, the strain GBE1353 was transformed with the plasmid pCP20 to obtain the strain GBE1353_p.

After overnight incubation on LB plates containing ampicilline (10Oug/m1) at 30 C, isolated colonies were restreaked on LB plates supplied with ampicilline (10Oug/m1) and incubated overnight at 30 C.

Isolated colonies were then plated on LB plates and incubated overnight at 42 C which caused the loss of the pCP20 plasmid.

Then, in order to check the effective excision of the two resistant cassettes and the loss of the pCP20 plasmid, isolated colonies were streaked out on LB plates containing spectinomycin (5Oug/m1), incubated overnight at 37 C, on LB plates containing apramycin (50 ug/ml), incubated overnight at 37 C, on LB plates containing ampicilline (100 ug/ml), incubated overnight at 30 C and on LB plates, incubated overnight at 37 C.

The resulting strain grew on LB plates incubated at 37 C and was named GBE1368. GBE1368 cells did not grow on LB plates containing spectinomycin (5Oug/m1), on LB plates containing apramycin (50 ug/ml), and on LB plates supplied with ampicilline (10Oug/m1).58CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685Strain GBE1368 was made electrocompetent, and GBE1368 electrocompetent cells were transformed with plasmid pKD46.

Transformant cells were then plated on LB plates containing ampicilline (100ug/m1) and plates were incubated overnight at 30 C to obtain a new strain named GBE1371. A FOR product was generated by using the plasmid pGBE0688 as a template and the oligonucleotides 0631 and 0632 (given as SEQ R00011 and R00012, respectively) as primers.

The resulting 1.3 Kbp PCR product was transformed into electrocompetent GBE1371 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (5Oug/m1).

Plates were incubated overnight at 37 C to generate strain GBE1420_ pKD46.

In Strain GBE1420_ pKD46 the phosphofructokinase gene pfkB, was deleted and the deleted DNA sequence was replaced by a cassette containing the spectinomycin resistance gene.

To check that the deletion of the pfkB gene occured, a FOR amplification was performed with primers 0621 and 0622 (given as SEQ R00013 and R00014, respectively).

This final 2.2 Kbp FOR product was sequenced by using the same primers 0621 and 0622.In order to induce the loss of the plasmid pKD46, strain GBE1420_ pKD46 was plated on LB plates and plates were incubated overnight at 42 C.

The loss of the plasmid pKD46 was checked by plating isolated colonies on LB plates supplied with ampicilline (10Oug/m1), incubated overnight at 30 C, and on LB plates incubated overnight at 37 C.

The resulting strain growing on LB plates incubated at 37 C was named GBE1420. GBE1420 cells did not grow on LB plates supplied with ampicilline (10Oug/m1).EXAMPLE 15: Acetone production by the strains GBE2268 and GBE2269.

Description of plasmid transformation into relevant strainsThe strain GBE1283 was made electrocompetent, and GBE1283 electrocompetent cells were transformed with plasmid pGB1021.

Transformants were then plated on LB plates containing ampicilline (10Oug/m1) and plates were incubated overnight at 30 C to generate strain GBE2266.Strain GBE1420 was made electrocompetent, and GBE1420 electrocompetent cells were transformed with the plasmid pGBE1020.

Transformants were then plated on LB plates supplied with ampicilline (10Oug/m1).

Plates were incubated overnight at 30 C to obtain strain GBE2267.Isolated colonies from strains GBE2266 and GBE2267 were screened on MS plates containing glucose as the source of carbon (2g/L) and ampicilline (10Oug/m1).

These plates were incubated at 30 C to obtain strains GBE2268 and GBE2269 respectively.

After 4 days of incubation at 30 C, colonies were transferred to MS liquid medium59CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685containing glucose (2g/L), yeast extract (0,1g/L) and ampicilline (100ug/m1) and incubated 3 days at 30 C.Description of flasks conditionsMSP liquid medium (200 ml) containing glucose (10g/L), yeast extract (0,1g/L) and ampicilline (10Oug/m1), were inoculated either with pre culture of strain GBE2268 or with pre culture of strain GBE2269.

The initial 0D600 was 0.1.

The 200 ml of culture was incubated in 250 ml bottles, sealed with a screw cap, at 30 C, 170 rpm of speed.

Aliquots (2 ml) were taken after 1 day, 2 days, 4 days, 5 days, 6 days, 7 days and 8 days.

For each aliquot sample, the bottle was open for 10 seconds.Description of analytical methodsAliquots were filtered and the glucose concentration was determined by HPLC analysis using the Agilent HPLC (1260 Infinity) and a Hi-Flex Colomn (Agilent, PL1170-6830) with a guard column (Agilent, PL Hi-Flex H Guard Column, PL1170-1830).- Volume of injection : 20 pl- Solvent composition : [H2SO4] : 5.5 mM- Temperature of the columns: 65 C- RID (G1362A) : temperature set: 35 CAcetone was extracted from the filtered aliquots by mixing with methyl acetate (1 volume of methyl acetate for 2 volumes of filtered aliquot).

Acetone concentration was determined by gas chromatography using Gas chromatograph 450-GC (Bruker) and the following program:- Column: DB-WAX (123-7033, Agilent Technologies)- Injector:o Split ratio: 10o T = 250 C- Oven:o 50 C for 9 minutesO 20 C per minute until 180 CO 180 C for 5 minuteso Column flow: 1,5m1/minute (Nitrogen)- Detector FID : T = 300 CResultsThe ratio [acetone] produced (mM) / [glucose] consumed (mM) was higher for the strain GBE2269 than for the strain GBE2268.EXAMPLE 16 : Acetone production by the strains GBE2272 and GBE2273.CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685Description of plasmid transformation into relevant strainsThe strain GBE2256 was made electrocompetent, and GBE2256 electrocompetent cells were transformed with plasmid pGB1020.

Transformants were then plated on LB plates containing ampicilline (100ug/m1) and plates were incubated overnight at 30 C to generate strain GBE2270.Strain GBE1518 was made electrocompetent, and GBE1518 electrocompetent cells were transformed with the plasmid pGBE1020.

Transformants were then plated on LB plates supplied with ampicilline (10Oug/m1).

Plates were incubated overnight at 30 C to obtain strain GBE2271.Isolated colonies from strains GBE2270 and GBE2271 were screened on MS plates containing glucose as the source of carbon (2g/L) and ampicilline (10Oug/m1).

These plates were incubated at 30 C to obtain strains GBE2272 and GBE2273, respectively.

After 4 days of incubation at 30 C, colonies were transferred to MS liquid medium containing glucose (2g/L), yeast extract (0,1g/L) and ampicilline (10Oug/m1) and incubated 3 days at 30 C.Description of flasks conditionsMSP liquid medium (200 ml) containing glucose (10g/L), yeast extract (0,1g/L) and ampicilline (10Oug/m1), were inoculated either with pre culture of strain GBE2272 or with pre culture of strain GBE2273.

The initial 00600 was 0.1.

The 200 ml of culture was incubated in 250 ml bottles, sealed with a screw cap, at 30 C, 170 rpm of speed.

Aliquots (2 ml) were taken after 1 day, 2 days, 4 days, 5 days and 6 days.

For each aliquot sample, the bottle was open for 10 seconds.Description of analytical methodsAliquots were filtered and the glucose concentration was determined by HPLC analysis using the Agilent HPLC (1260 Infinity) and a Hi-Flex Colomn (Agilent, PL1170-6830) with a guard column (Agilent, PL Hi-Flex H Guard Column, PL1170-1830).- Volume of injection : 20 pl- Solvent composition : [H2SO4] : 5.5 mM- Temperature of the columns: 65 C- RID (G1362A) : temperature set: 35 CAcetone was extracted from the filtered aliquots by mixing with methyl acetate (1 volume of methyl acetate for 2 volumes of filtered aliquot).

Acetone concentration was determined by gas chromatography using Gas chromatograph 450-GC (Bruker) and the following program:61CA 02841175 2014-01-08WO 2013/007786 PCT/EP2012/063685- Column: DB-WAX (123-7033, Agilent Technologies)- Injector:o Split ratio: 10o T = 250 C- Oven:o 50 C for 9 minuteso 20 C per minute until 180 Co 180 C for 5 minuteso Column flow: 1,5m1/minute (Nitrogen)- Detector FID : T = 300 CResultsThe ratio [acetone] produced (mM) / [glucose] consumed (mM) was higher for the strain GBE2273 than for the strain GBE2272.620 n.)o1¨,o¨.1¨.1TABLE OF RESULTS II oecAGBE2264 GBE2265 GBE2268 GBE2269 GBE2268 GBE2273 GBE2272 GBE2273PEP dependent glucose uptake (ptsHI) + +- - -Heterologous phosphoketolase (pkt)- + - + - + + +0 EMPP (pfkAB) +- - + +-- -PPP (zwf) + - - + + - 4- - 0iv coEDP (edd eda) +- + + + + + .i.H H-.1.Heterologous acetone pathway (thl ctfAB inch + + 4- + + + 1.)La adc) 0H FPI[acetone]produced (m10)/ tg I U COS elconsumed (mM) 0,03 0,21 0,01 0,22 0,01 0,51 1 0,05 0,51 0HI0the reported ratio was the maximum coobservedIVn ,-im,-o t..,=t..,e--,cA cAoe un