CA2829472C

Gene expression markers for breast cancer prognosis

Abstract

The present invention provides gene sets the expression of which is important in the diagnosis and/or prognosis of breast cancer.

CA2829472C, drawing sheet 1 — Sheet 1 of 3

Term

Term ended

Expired 14 January 2024, 2.7 years ago.

1 claim: 1 independent, 0 dependent

1
CA 02829472 2013-10-03 SEQUENCE LISTING GENOMIC HEALTH, INC. RUSH UNIVERSITY MEDICAL CENTER COBLEIGH, Melody SHAK, Steven BAKER, Joffre CRONIN, Maureen GENE EXPRESSION MARKERS FOR BREAST CANCER PROGNOSIS 81436-61D2 PCT/US2004/ÛC0935 2004-01-14 US 60/440,861 2003-01-15 440 FastSEQ for Windows Version 4.0 1 81 DNA Artificial Sequence Amplicon 1 gcggcgagtt tccgatttaa agctgagctg cgaggaaaafc ggcggcggga ggatcaaaat 60 acttgctgga tggtggacce a 01 2 71 DNA Artificial Sequence Amplicon 2 cgcttctatg gcgctgagat tgtgtcagcc ctggactacc tgcactcgga gaagaacgtg 60 gtgtaccggg a 71 3 71 DNA Artificial Sequence Amplicon 3 tcctgccacc cttcaaacct caggtcacgt cegaggtcga cacaaggtac ctcgacgatg 60 aatttaccgc c 71 CA 02829472 2013-10-03 4 69 DNA Artificial Sequence Amplicon 4 ggaeagcagg aatgtgtttc tecatacagg cgagtgggt tcacggggag ccaatggttc agaeacaaat 60 69 5 82 DNA Artificial Sequence Amplicon 5 tgtgagtgaa atgccttcta gtagtgaacc gtcctcggga gccgactatg actactcaga 60 agagtatgat aacgaaccac aa 82 6 66 DNA Artificial Sequence amplicon 6 cagcagatgt ggatcagcaa gcaggagtat gacgagtccg gcccctccat cgtccaccgc 60 aaatgc 66 7 80 CNA Artificial Sequence Amplicon 7 ggctct ;tgtg cgtactgtcc ttcgggctgg tgacagggaa gacatcactg agcctgccat 60 ctgtgctctt cgtcatctga 80 8 73 DNA Artificial Sequence Amplicon 8 gggtcaggtg cctcgagatc qggcttgggc ccagegcatg ttccagatcc cagagtttga 60 gccgagtgag cag 73 CA 02829472 2013-10-03 9 ei CHS 9 cgttgtcagc acttggaata caagatggtt gccgggteat gtccacagga agaggttgaa c gttaattggg aaaaagaaca 60 81 10 S3 DNA Artificial Sequence Amplicon 10 cctggagggt cccgtacaat ctcaccatgg gactcctgcc cttacccagg ggccacagag 60 cccccgagat ggagcccaat tag 83 11 Amplicon 11 cagatggacc tagcacccac tgagatttcc acgccgaagg acagcgatgg gaaaaatgcc 60 cttaaatcat agg 73 12 DNA Artificial Sequence Ampliecn 12 atcctagccc tggtttttgg cctccttttt gctgtcacca gcgccgcgtt ccttgtgcag 60 atgagaaggc ag 72 13 84 DNA Artificial Sequence Amplicon 13 ttcaggttgt tgcaggagac catgtacatg actgtctcca ttattgatcg gttcatgcag 60 aataatcgtg tgcccaagaa gatg 84 CA 02829472 2013-10-03 14 69 DNA Artificial Sequence Amplicon 15 71 ONA Artificial Sequence Amplicon 16 82 DNA Artificial Sequence Amplicon 16 atgctgtggc tccttcctaa ctggggcttt cttgacatgt aggttgcttg gtaataacct 60 ttttgtatat cacaatttgg gt 82 17 65 DNA Artificial Sequence Amplicon 17 agatgaagtg gaaggcgctt ttcaccgcgg ccatcctgca ggcacagttg ccgattacag 60 aggca 65 18 74 DNA Artificial Sequence Amplicon 18 tggttcccag ccctgtgtcc acctccaagc ccagattcag attcgagtca tgtacacaac 60 ccagggtgga ggag 74 CA 02829472 2013-10-03 <210? 19 <211? 64 <212? DMA <213? Artificial Sequence <220? 22 gataaattgg tacaagggat cagcttttcc cagcccacat gtcctgatca tatgcttttg 60 aatagtcagt tacttggcac cc 82 <210? 23 <211? 72 <212? DNA <213? Artificial Sequence <220? <223? Amplicon <400? 23 tgcctgtggt gggâagctca gtaactggga accaaaggat gatgctatgt cagaacaccg 60 gaggcatttt cc 72 CA 02829472 2013-10-03 29 67 DNA Artificial Sequence Amplicon 29 tgtctcactg agcgagcaga atctggtgga caatggt ctgttcgcgt cctcaaggca atcagggctg 60 67 77 DNA Artificial Sequence Amplicon 30 cgctgacatc atgaatgttc ctcgaccggc tggaggcgag tttggatatg acaaagacac 60 atcgttgctg aaagaga 77 73 DNA Artificial Sequence Amplicon 32 84 DNA Artificial Sequence Amplicon 32 ctctgagaca gtgcttcgat gactttgcag acttggtgcc ctttgactcc tgggagccgc 60 tcatgaggaa gttgggcctc atgg 84 33 62 DNA Artificial Sequence Amplicon <400 33 tgtcgaagga cttccagaac cacctgggca gctgccaaaa gtgtgatcca agctgtccca 60 at 62 CA 02829472 2013-10-03 34 82 DNA Artificial Sequence Amplicon 35 69 DNA Artificial Sequence Amplicon 75 DNA Artificial Sequence Amplicon 37 76 DNA Artificial Sequence Amplicon 38 81 DNA Artificial Sequence Amplicon 38 cggttatgtc atgccagata cacacctcaa aggtactccc tcctcccggg aaggcaccct 60 trctteagtg ggtctcagtt c 81 CA 02829472 2013-10-03 39 68 DNA Artificial Sequence Amplicon 39 cgtggtgccc ctctatgacc tgctgctgga gatgctggac gcccaccgcc tacatgcgcc 60 cactagcc 66 90 DNA Artificial Sequence Amplicon 41 60 DNA Artificial Sequence Amplicon 41 cggtagtcaa gtccggatca agggcaagga gacggaattc tacctgtgca tgaaccgcaa 60 aggcaagc ' 68 42 74 DNA Artificial Sequence Amplicon 42 caegggacat tcaccacatc gactactata aaaagacaac caacggccga ctgcctgtga 60 agtggatggc accc 74 43 67 DNA Artificial Sequence Amplicon 43 ccagtggagc gcttccatga cctgcgtcct gatgaagtgg ccgatttgtt tcagacgacc 60 cagagag 67

819 paragraphs in 45 sections, as filed

CA 02029472 2013-10-03

Gene Expression Markers for Breast Cantor Prognosis

Field of the Invention

The present invention provides genes and gene sets the expression of which is important in the diagnosis and/or prognosis of breast cancer.

Description of the Related Art

Oncologists have a number of treatment options available to them, including different combinations of chemotherapeutic drugs that are characterized as standard of care, and a number of drugs that do not cany a label claim for particular cancer, but for which there is evidence of efficacy in that cancer. Best likelihood of good treatment outcome requires that patients be assigned Id optimal available cancer trcahnnnh and that this assignment be made as quickly as possible following diagnosis.

Currently, diagnostic tests used in clinical practice are single analyte, and therefore do not capture the potential value of knowing relationships between dozens of different markers. ‘ Moreover. diagnostic tests are frequently not quantitative, relying on immunohistochemistry. · This method often yields different results in different laboratories, in part because the reagents are not standardized, and in part because the interpretations are subjective and cannot be easily quantified. RNA-based tests have not often been used because of the problem of RNA degradation over time and the fact that it is difficult to obtain fresh tissue samples from patients for analysis. Fixed paraffin-embedded tissue is more readily available and methods have been established to detect RNA in fixed tissue. However, these methods typically do not allow for the study of large numbers of genes (DNA or RNA) from, small amounts of material. Thus, traditionally fixed tissue has been rarely used other than for inunuaobistochemistry detection of proteins.

Recently, several groups have published studies concerning the classification of various cancer types by microarray gene expression analysis (see, e.g. Golub et ai. Science

286:531-537 (1999); Bhattachaqae et a/., Proc. Natl. Acad. Sci. USA 98:13790-13795 (2001);

Chen-Hsiang et ai, Bioinformatics 17 (Suppl. 1):S316-S322 (2001); Ramaswamy et ai, Proc. Nad. Acad Sci USA 98:15149-15154 (2001)), Certain classifications of human breast

CA 02829472 2013-10-03 cancers based on gene expression patterns have also been reported (Martin et al, Cancer Res. 60:2232-2238 (2000); West et al, Proc. Natl Acad. Sci. USA 98:11462-11467 (2001); Sortie et al, Proc. Natl Acad. Sci. USA 98:10869-10874 (2001); Yan et al, Cancer Res. 61:83758380 (2001)). However, these studies mostly focus on improving and refining the already established classification of various types of cancer, including breas: cancer, and generally do not provide new insights into the relationships of the differentially expressed genes, and do not link the findings to treatment strategies in order to improve the clinical outcome of cancer therapy.

Although modem molecular biology and biochemistry have revealed hundreds of genes whose activities influence the behavior of tumor cells, state of their differentiation, and their sensitivity or resistance to certain therapeutic drugs, with a few exceptions, the status of these genes has not been exploited for the purpose of routinely making clinical decisions about drug treatments. One notable exception is the use of estrogen receptor (ER) protein expression in breast carcinomas to select patients to treatment with anti-estrogen drugs, such as tamoxifen. Another exceptional example is the use of ErbB2 (Her2) protein expression in breast carcinomas to select patients with the Her2 antagonist drug Herceptin® (Genentech, Inc., South San Francisco, CA).

Despite recent advances, the challenge of cancer treatment remains to target specific treatment regimens to pathogenically distinct tumor types, and ultimately personalize tumor treatment in order to maximize outcome. Hence, a need exists for tests that simultaneously provide predictive information about patient responses to the variety of treatment options. This is particularly true for breast cancer, the biology of which is poorly understood. B is clear that the classification of breast cancer into a few subgroups, such as EAB2+ subgroup, and subgroups characterized by low to absent gene expression of the estrogen receptor (ER) and a few additional transcriptional factors (Pérou et al, Nature 406:747-752 (2000)) does not reflect the cellular and molecular heterogeneity of breast cancer, and does not allow the design of treatment strategies maximizing patient response.

Summary of the Invention

The present invention provides a set of genes, the expression of which has prognostic value, specifically with respect to disease-free survival·

Various embodiments of this invention provide a method of predicting the likelihood of longterm survival of a breast cancer patient without the recurrence of hreast cancer, comprising: determining an expression level of an RNA transcript of MDM2 in a fixed, wax-embedded breast cancer tumor sample from the patient; normalizing said expression level to obtain a normalized expression level of MDM2; wherein increased normalized expression level of MDM2 indicates an increased likelihood of long-term survival without breast cancer recurrence.

Various embodiments of this invention provide a method of predicting the likelihood of longterm survival of a breast cancer patient without the recurrence of breast cancer, comprising: determining expression levels of RNA transcripts of a panel of genes comprising MDM2 and MYBL2 in a fixed, wax-embedded breast cancer tumor sample from the patient; normalizing said expression levels to obtain normalized expression levels of each gene; wherein increased normalized expression level of MDM2 indicates an increased likelihood of long-term survival without breast cancer recurrence, and wherein increased normalized expression level ofMYBL2 indicates a decreased likelihood of long-term survival without breast cancer recurrence.

Various embodiments of this invention provide a method of preparing a personalized genomics profile for a breast cancer patient, comprising: (a) subjecting RNA extracted from a fixed, waxembedded breast tissue sample of the patient to gene expression analysis; (b) determining an expression level of an RNA transcript of MDM2, wherein the expression level is normalized against the expression level of at least one reference gene to obtain normalized data, and optionally is compared to expression level of MDM2 in a breast cancer reference tissue set; and (c) creating a report summarizing the normalized data obtained by said gene expression analysis, wherein said report includes a prediction of the likelihood of long-term survival oflhe patient without recurrence of breast cancer, wherein increased normalized expression of MDM2 indicates an increased likelihood of long-term survival without breast cancer recurrence.

Various embodiments of this invention provide a method of preparing a personalized genomics profile for a breast cancer patient, comprising: (a) subjecting RNA extracted from a fixed, waxembedded breast tissue sample of the patient to gene expression analysis; (b) determining expression ievels of RNA transcripts of a panel of genes comprising MDM2 and MYBL2, wherein the expression levels are normalized against the expression level of at least one reference gene to obtain normalized data, and optionally are compared to expression levels of the genes in the panel in a breast cancer reference tissue set; and (c) creating a report summarizing the normalized data obtained by said gene expression analysis, wherein said report includes a prediction of the likelihood of long-term survival of the patient without recurrence of breast cancer, wherein increased normalized expression of MDM2

CA 2Θ29472 2017-12-01 indicates an increased likelihood of long-term survival without breast cancer recurrence, and wherein increased normalized expression of MYBL2 indicates an reduced likelihood of long-term survival without breast cancer recurrence.

Various embodiments of this invention provide a method of predicting the likelihood of longterm survival of a breast cancer patient without the recurrence of breast cancer, comprising: isolating RNA from a fixed, wax-embedded tissue sample obtained from a breast tumor of the patient; reverse transcribing an RNA transcript of MDM2 to produce a cDNA of MDM2; amplifying the cDNA of MDM2 to produce an amplicon of the RNA transcript of M DM2; assaying a level of the amplicon of the RNA transcript of MDM2; normalizing said level against a level of an amplicon of at least one reference RNA transcript in said tissue sample to provide a normalized MDM2 amplicon level; comparing the normalized MDM2 amplicon level to a normalized MDM2 amplicon level in reference breast tumor samples; and predicting the likelihood of long-term survival without the recurrence of breast cancer, wherein increased normalized MDM2 amplicon level is indicative of an increased likelihood of long-term survival without recurrence ofbreast cancer.

Various embodiments of this invention provide a method of predicting the likelihood of longterm survival of a breast cancer patient without the recurrence ofbreast cancer, comprising: determining expression levels of RNA transcripts of a panel of genes comprising MDM2 and MYBL2 in a breast cancer tumor sample from the patient, wherein the expression level of the RNA transcript of MYBL2 is obtained by reverse transcription with at least one primer comprising the nucleotide sequence of SEQ ID NO: 18, SEQ ID NO: 24, and SEQ ID NO: 27; normalizing said expression levels to obtain normalized expression levels of each gene; wherein increased normalized expression level of MDM2 indicates an increased likelihood of long-term survival without breast cancer recurrence, and wherein increased normalized expression level of MYBL2 indicates a decreased likelihood of long-term survival without breast cancer recurrence

Various embodiments of this invention provide a method of preparing a personalized genomics profile for a breast cancer patient, comprising: (a) subjecting RNA extracted from a breast tissue sample of the patient to gene expression analysis; (b) determining expression levels of RNA transcripts of a panel of genes comprising MDM2 and MYBL2, wherein the expression level of the RNA transcript of MYBL2 is obtained by reverse transcription with at least one primer comprising the nucleotide sequence of SEQ ID NO: 18, SEQ ID NO; 24, and SEQ ID NO: 27, and wherein the expression levels are normalized against the expression level of at least one reference gene to obtain normalized data, and optionally are compared to expression levels of the genes in the panel in a breast cancer reference tissue set; and (c) creating a report summarizing the normalized data obtained by said gene expression

CA 2Θ29472 2017-12-01 analysis, wherein said report includes a prediction of the likelihood of long-term survival of the patient without recurrence of breast cancer, wherein increased normalized expression of MDM2 indicates an increased likelihood of long-term survival without breast cancer recurrence, and wherein increased normalized expression of MYBL2 indicates an reduced likelihood of long-term survival without breast cancer recurrencc.

Various embodiments of this invention provide a method of predicting the likelihood of longterm survival of a breast cancer patient without the recurrence of breast cancer, comprising: isolating RNA from a tissue sample obtained from a breast tumor of the patient; reverse transcribing RNA transcripts of a panel of genes comprising MDM2 and M YDL2 to produce a cDNAs of the panel of genes, wherein reverse transcribing the RNA transcript of MYBL2 is performed with at least one primer comprising the nucleotide sequence of SEQ ID NO: 18, SEQ ID NO: 24, and SEQ ID NO: 27; amplifying the cDNAs to produce amplicons of the RNA transcripts; assaying levels of the amplicons of the RNA transcripts; normalizing said levels against a level of an amplicon of at least one reference RNA transcript in said tissue sample to provide normalized amplicon levels of the panel of genes comprising MDM2 and MYBL2; comparing the normalized amplicon levels to a normalized amplicon levels of the same genes in reference breast tumor samples; and predicting the likelihood of long-term survival without the recumence of breast cancer, wherein increased normalized MDM2 amplicon level is indicative of an increased likelihood of long-term survival without recurrence of breast cancer and increased normalized M YBL2 amplicon level is indicative of a reduced likelihood of long-term survival without recurrence of breast cancer.

The present invention accommodates the use of archived paraffin-embedded biopsy material for assay of all markers in the set, and therefore is compatible with the most widely

CA 2Θ29472 2017-12-01

CA 02829472 2013-10-03 e c

WO 20IHMJ583 PCT/liS20O4mi(O985 available type of biopsy material. It is also compatible with several different methods of tumor tissue harvest, for example, via core biopsy or fine needle aspiration. Further, for each member of the gene set, the invention specifies oligonucleotide sequences that can be used in the test.

In one aspect, the invention concents a method of predicting the likelihood of longterm survival of a breast cancer patient without the recurrence of breast cancer, comprising determining the expression level of one or more prognostic RNA transcripts or their expression products in a breast cancer tissue sample obtained from the patient, normalized against the expression level of all RNA transcripts or their products in the breast cancer tissue sample, or of a reference set of RNA transcripts or their expression products, wherein the prognostic RNA transcript is the transcript of one or more genes selected from the group consisting of: TP53BP2, GRB7, PR, CD68, BcI2, KRT14, IRS1, CTSL, EstRl, Chkl, 1GFBF2, BAGl, CEGP1, STK15, GSTM1, FHIT, RIZÏ, AIB1, SURV, BBC3,1GFIK, P27, GATA3, ZNF217, EGFR, CD9, MYBL2, HJFlo, PS2, ErhB3, TOP2B, MDM2, RAD51C, KRT19, TS, Her2, KLK10, β-Calenin, γ-Catenin, MCM?. PÏ3KC2A, 1GF1, TBP, CCNB1, FBXO5, and DR5, wherein expression of one or more of GRB7, CD68, CTSL, Chkl, AJB1, CCNB1, MCM2, FBXO5, Her2, STKI5, SVRV, FGFR, MYBL2, HlFlo, and TS indicates a decreased likelihood of long-tom survival without breast cancer recurrence, and the expression of one or more of TP53BP2, PR, Bcl2, KRT14, EstRl, IGFBP2, BAGl, CEGPÎ, KLK10, p-Catenin, γ-Catenin, DR5, PDKCA2, RAD51C, GSTM1, FHIT, R1Z1, BBC3, TBP, p27, IRS1, IGF1R, GATA3, ZNF217, CD9, pS2, ErbB3, TOP2B, MDM2, IGF1, and KRT19 indicates an increased likelihood of long-tom survival without breast cancer recurrence.

In a particular embodiment, the expression levels of at least two, or at least 5, or at least 10, or at least 15 of the prognostic RNA transcripts or their expression products are determined. In another embodiment, tire method comprises the determination of the expression levels of all prognostic RNA transcripts or their expression products.

In another particular embodiment, the breast cancer is invasive breast carcinoma.

In a further embodiment, RNA is isolated from a fixed, wax-embedded breast cancer tissue specimen of the patient. Isolation may be performed by any technique known in the art, for example from core biopsy tissue or fine needle aspirate cells.

CA 02829472 2013-10-03

C , j 20IM/Û65583

C

PCT/US2«(Mrtl0O98i.

In another aspect, the invention concerns an array comprising polynucleotides hybridizing to two or more of the following genes: u-Catenin, AIBI, AKT I, AKT2, β-actin, BAG1, BBC3, Bci2, CCNB1, CCNDI, CD68, CD9, CDH1, CEGP1, Chkl, CIAP1, cMet.2, Contig 27882, CTSL, DR5, EGTR, EIF4E, EPHX1, ErbB3, EstRl, FBXO5, FHIT1 FRPI, GAPDH, GATA3, G-Catenin, GRB7, GROÎ, GSTM1, GUS, HER2, HIF1A, HNF3A, 1GFÎR, IGFBP2, KIX10, KRT14, KRT17, KRT18, KRT19, KRT5, Maspin, MCM2, MCM3, MDM2, MMP9, MTA1, MYBL2, P14ARF, p27, P53, PI3KC2A, PR, FRAME, pS2, RAD51C,.3RB1, RIZ1, STK15, STMY3, SURV, TGFA, TOP2B, TP53BP2, TRAIL, TS, upa, VDR, VEGF, and ZNF217.

bi particular embodiments, the array comprises polynucleotides hybridising to at least 3, or at least 5, or at least 10, or at least 15, or at least 20, or all of the genes listed above.

In another specific embodiment, the array comprises polynucleotides hybridizing to the following genes: TP53BP2, GRB7, PR, CD68, Bcl2, KR.TÏ4, IRSI, CTSL, EstRl, Chkl, IGFBP2, BAG1, CEGP1, STK15, GSTM1, FHIT, RIZl, AIBI, SURV, BBC3, ÏGF1R, p27, GATA3, ZNF217, EGFR, CD9, MVBL2, HIFlo, pS2, RIZl, ErbB3, TQP2B, MDM2, RAD51C, KRT19, TS, Her2, KLK10, β-Catenin, γ-Catenin, MCM2, P13KC2A, IGF1, TBP, CCNBl,FBXO5andDR5.

The polynucleotides can be cDNAs, or oligonucleotides, and the solid surface on which they are displayed may, for example, be glass.

In another aspect, the invention concerns a method of predicting the likelihood of long-term survival of a patient diagnosed with invasive breast cancer, without the recurrence of breast cancer, comprising the steps of:

(1) determining the expression levels of the RNA transcripts or the expression products of gates or a gene set selected from the group consisting of (a) ΓΡ53ΒΡ2, Bcl2, BAD, EPHX1, PDGFRp, DIABLO, XIAP, YB1, CA9, and KRT8;

(b) GRB7, CD68, TOP2A, Bcl2, DIABLO, CD3, ©I, PPM1D, MCM6, and WBP1;

(d) CD68, GRB7, TOP2A, Bcl2, DIABLO, CD3, EDI, PPM1D, MCM6, and WISP1;

(e) Bcl2, TP53BP2, BAD, EPHX1, PDGFRp, DIABLO, XIAP, YB1, CA9, and KRT8;

(f) KRT14, KRT5, PRAME, TP53BP2, GUS1, AIBI, MCM3, CCNE1,MCM6, aitdIDl;

CA 02829472 2013-10-03

WO 2004/065583

PCTrtJS2004/wi0985 (g) PRAME, TP53BP2, EslRl, DIABLO, CTSL, PPM1D, GRB7, DAPK1, BBC3, and VEGFB;

(h) CTSL2, GRB7, T0P2A, CCNBI, Bcl2, DIABLO, PRAME, EMS1, CA9, and EpCAM;

(i) EstRl, TP53BP2, PRAME, DIABLO, CTSL, PPM1D, GRB7, DAPK1, BBC3, and

VEGFB;

(k) Chkl, PRAME, TP53BP2, GRB7, CAD, CTSL, CCNBI, T0P2A, tumor size, and IGFBP2;

(l) IGFBP2, GRB7, PRAME, DIABLO, CTSL, β-Catenin, PPM1D, Chkl, WISP1, and

LOTI;

(m) HER2, TP53BP2, Bcl2, DIABLO, TIMPl, EPHX1, T0P2A, TRAIL, CAD, and AREG;

(n) BAGl, TP53BP2, PRAME, IL6, CCNBI, ΡΑΠ, AREG, tumor size, CAD, and Ki67;

(o) CEGPÎ, TP53BP2, PRAME, DIABLO, Bcl2, COX2, CCNE1, STK15, and AK.T2, andFGF18;

(p) STK15, TP53BP2, PRAME, ©6, CCNBI, AKT2, DIABLO, cMet, CCNE2, and COX2;

(q) KLK10, EslRl, TP53BP2, PRAME, DIABLO, CTSL, PPM1D, GRB7, DAPR1, and BBC3;

(r) AIB1, TP53BP2, Bcl2, DIABLO, TIMPl, CD3, p53, CA9, GRB7, and EPHX1 (s) BBC3, GRB7, CD68, PRAME, T0P2A, CCNBI, EPHX1, CTSL GSTMl.andAPC;

(t) CD9, GRB7, CD68, TOP2A, BcI2, CCNB 1, CD3, DIABLO, ©1, and PPM1D;

(w) EGFR, KRT14, GRB7, TOP2A, CCNBI, CTSL, Bcl2, TP, KLK10, and CAD;

(x) HIFla, PR, DIABLO, PRAME, Chkl, AKT2, GRB7, CCNE1, TOP2A, and CCNBI;

(y) MDM2, TP53BP2, DIABLO, BcI2, AIB1, TIMPl, CD3, p53, CA9, and HER2;

(zj MYBL2, TP53BP2, PRAME, IL6, Bcl2, DIABLO, CCNE1, EPHX1, TIMPl, and

CA9;

(aa) P27, TP53BP2, PRAME, DIABLO, Bcl2, COX2, CCNBI, STK15, AKT2, and ©1; 30 (ab) RAD51, GRB7, CD68, T0P2A, CIAP2, CCNBI, BAGl, IL6, FGFR1, and TP53BP2;

(ac) SURV, GRB7, TOP2A, PRAME, CTSL, GSTM1, CCNBI, VDR, CA9; and CCNE2;

(ad) T0P2B, TP53BP2, DIABLO, Bcl2, TIMPl, AIB1, CA9, p53, KRT8, and BAD;

CA 02029472 2013-10-03 c c . jMNW FCT/USMIUmMK· (aej ZNF217, GRB7, TP53BP2, FRAME, DIABLO, Bcl2, CQX2, CCNE1, APC4, and βCatenin, in a breast cancer tissue sample obtained from the patient, normalized against the expression levels of all RNA transcripts or their expression products tn said breast cancer tissue sample, or of a reference set of RNA transcripts or their products;

(2) subjecting the data obtained in step (1) to statistical analysis; and (3) determining whether the likelihood of said long-term survival has increased or decreased.

In a further aspect, the invention concerns a method of predicting the likelihood of long-term survival of a patient diagnosed with estrogen receptor (ER)-positive invasive breast cancer, without the recurrence of breast cancer, comprising the steps of:

(1) determining the expression levels of the RNA transcripts or the expression products of genes of a gene set selected from the group consisting of CD68; CTSL; FBXO5; SURV; CCNB1; MCM2; Chkl; MYBL2; HIF1A; cMET; EGFR; TS; STK15, IGFR1; BC12; HNF3A; TP53BP2; GAT A3; BBC3; RAD51C; BAG1; IGFBP2; PR; CD9; RBI; EPHX1; CEGP1; TRAIL; DR5; p27; ρ53; MTA; RJZl; ΕΛΒ3; TOP2B; EIF4E, wherein expression of the following genes in ER-positive cancer is indicative of a reduced likelihood of survival without cancer recurrence following surgery: CD68; CTSL; FBXO5; SURV; CCNB1; MCM2; Chkl; MYBL2; HIFI A; cMET; EGER; TS; STK.15, and wherein expression of the following genes is indicative of a better prognosis for survival without cancer recurrence following surgery: ÏGFR1; BC12; HNF3A; TP53BP2; GATA3; BBC3; RAD51C; BAG1; IGFBP2; PR; CD9; RBI; EPHXl; CEGP1; TRAIL; DR5; p27; p53; MTA; RE1; ΕΛΒ3; TOP2B; ΕΠΝΕ.

¢2) subjecting the data obtained in step (1) to statistical analysis; and (3) determining whether the likelihood of said long-term survival has increased or decreased.

In yet another aspect, the invention concerns a method of predicting the likelihood of long-term survival of a patient diagnosed with estrogen receptor {ER)-negative invasive breast cancer, without the recurrence of breast cancer, comprising determining the expression levels of the RNA transcripts or the expression products of genes of the gene set CCNDI; UPA; HNF3A; CDH1; Her2; GRB7; AKT1; STMY3; α-Catenin; VDR; GRO1; KT14; KLK10; Maspin, TGFa, and FRP1, wherein expression of foe following genes is indicative of a

CA 02029472 2013-10-03 ( C

WO 2004/065583 PCTÆIS2004rt,(H>985 reduced likelihood of survival without cancer recurrence: CCND1 ; TJPA; HNF3A; CDH1 ; Her2; GRB7; AKT1; SÏMY3; α-Catenin; VDR; GRO1, and wherein expression of the following genes is indicative of a better prognosis for survival without cancer recurrence: KTI4; KLK10; Maspin, TGFa, and FRP1.

In a different aspect, the invention concerns a method of preparing a personalized genomics profile for a patient, comprising the steps of:

(a) subjecting RNA extracted from a breast tissue obtained from the patient to gene expression analysis;

(b) determining the expression level of one or more genes selected fiom the breast cancer gene set listed in any one of Tables 1-5, wherein the expression level is normalized against a control gene or genes and optionally is compared to the amount found in a breast cancer reference tissue set; and (c) creating a report summarizing the data obtained by tire gene expression analysis.

The report may, for example, include prediction of the likelihood of long term survival of the patient and/or recommendation for a treatment modality of said patient.

In a further aspect, the invention concerns a method for amplification of a gene listed in Tables 5A and B by polymerase chain reaction (PCR), comprising performing said PCR by using an amplicon listed in Tables 5A and B and a primer-probe set listed in Tables 6A-F.

In a still further aspect, the invention concerns a PCR amplicon listed in Tables 5A and B.

In yet another aspect, the invention concerns a PCR primer-probe set listed in Tables

6A-F.

The invention further concerns a prognostic method comprising:

(a) subjecting a sample comprising breast cancer cells obtained from a patient to quantitative analysis of the expression level of the RNA transcript of at least one gene selected from the group consisting of GRB7, CD68, CTSL, Chkl, AIB1, ÇCNB1, MCM2, FBXO5, Her2, STK15, SURV, EGFR, MYBL2, HIFIa, and TS, or their product, and (b) identifying the patient as likely to have a decreased likelihood of long-term survival without breast cancer recurrence if the normalized expression levels of (he gene or genes, or their products, are elevated above a defined expression threshold.

In a different aspect, the invention concerns a prognostic method comprising:

CA 02829472 2013-10-03

C- c . j 2004/065583 PC17ÜS2<W4 <Hl09ft?

CEGP1, KLK.10, β-Caîerun. γ-Catenin, DR5, PI3KCA2, RAD51C, GSTMl, FHIT, RIZ1, 5 BBC3, TBP, p27, KSI, IGF1R, GATA3, ZNF217, CD9, pS2, ErbB3, TOP2B, MDM2, IGF1, and KRT19, and (b) identifying the patient as likely to have an increased likelihood of long-term survival without breast cancer recurrence if the normalized expression levels of tire gene or genes, or their products, are elevated above a defined expression threshold.

The invention further concerns a kit comprising one or more of (1) extraction buffer/reagents and protocol; (2) reverse transcription buffer/reagents and protocol; and (3) qPCR huffer/reagents and protocol suitable for performing any of the foregoing methods.

CA 02829472 2013-10-03

Description of the Tables

Table 1 is a list of genes, expression of which correlate with breast cancer survival. Results from a retrospective clinical trial. Binary statistical analysis.

Table 2 is a list of genes, expression of which correlates with breast cancer survival in estrogen receptor (ER) positive patients. Results from a retrospective clinical trial. Binary statistical analysis.

Table 3 is a list of genes, expression of which correlates with breast cancer survival in esirogea receptor (ER) negative patients. Results from a retrospective clinical trial. Binary statistical analysis.

Table 4 ia a list of genes, expression of which correlates with breast cancer survival. Results from a retrospective clinical trial. Cox proportional hazards statistical analysis.

Tables 5A and B show a list of genes, expression of which correlate with breast cancer survival. Results from a retrospective clinical trial. The table includes accession numbers for the genes, and amplicon sequences used for PCR amplification.

Tables 6A-6F The table includes sequences for the forward and reverse primers (designated by f and r, respectively) and probes (designated by p) used for PCR amplification of the amplicons listed in Tables 5A-B,

Detailed Description of the Preferred Embodiment

A. Definitions

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, NY 1994), and March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, NY 1992), provide one skilled in the art with a general guide to many of the terms used in the present application.

One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.

CA 02829472 2013-10-03

C c . j 2004/065583 PCTÆJS2(I04/(I01W8l

The term microairay refers to an ordered arrangement of hybndizabk array elements, preferably polynucleotide probes, on a substrate.

The term polynucleotide, when used in singular or plural, generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA Thus, for instance, polynucleotides as defined herein include, without limitation, single- and double-stranded DNA, DNA including single- and doublestranded regions, single- and double-shanded RNA, and RNA including single- and doublestranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions. In addition, the term “polynucleotide” as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple-helical region often is an oligonucleotide. The term “polynucleotide” specifically includes cDNAs. The term includes DNAs (including cDNAs) and RNAs that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are polynucleotides as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritiated bases, are included within the term “polynucleotides” as defined herein. In general, the term “polynucleotide” embraces all chemically, enzymatically and/or metabolically modified foims of unmodified polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells.

The term oligonucleotide refers to a relatively short polynucleotide, including, without limitation, single-stranded deoxyiibonueleotides, single- or double-stranded ribonucleotides, RNA: DNA hybrids and double-stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms.

The terms “differentially expressed gene,” “differential gene expression” and their synonyms, which are used interchangeably, refer to a gene whose expression is activated to a higher or lower level in a subject suffering from a disease, specifically cancer, such as breast

CA 02829472 2013-10-03

WO 2(104/005583 PCTrtlS2WMAiO««5 cancer, relative to its expression in a normal or control subject. The terms also include genes whose expression is activated to a higher or lowest level at different stages of the same disease. It is also understood that a differentially expressed gene may be either activated or inhibited at the nucleic acid level or protein level, or may be subject to alternative splicing to result in a different polypeptide product Such differences may be evidenced by a change in raRNA levels, surface expression, secretion or offer partitioning of a polypeptide, for example. Differential gene expression may include a comparison of expression between two or more genes or their gene products, or a comparison of the ratios of the expression between two or more genes or their gene products, or even a comparison of two differently processed products of the same gene, which differ between normal subjects and subjects suffering from a disease, specifically cancer, or between various stages of the same disease. Differential expression includes both quantitative, as well as qualitative, differences in the temporal or cellular expression pattern in a gene or its expression products among, for example, normal and diseased cells, or among cells which have undergone different disease events or disease stages. For the purpose of this invention, “differential gene expression” is considered to be present when there is at least an about two-fold, preferably at least about four-fold, more preferably at least about six-fold, most preferably at least about ten-fold difference between the expression of a given gene in normal and diseased subjects, or in various stages of disease development in a diseased subject.

The phrase gene amplification*' refers to a process by which multiple copies of a gene or gene fragment are formed in a particular cel! or cell line. The duplicated region (a stretch of amplified DNA) is often referred to as amplicon. Usually, the amount of the messenger RNA (oiRNA) produced, Le., the level of gene expression, also increases in the proportion of the number of copies made of the particular gene expressed.

The term diagnosis is used herein to refer to the identification of a molecular or pathological state, disease or condition, such as the identification of a molecular subtype of head and neck cancer, colon cancer, or other type of cancer.

The term prognosis is used herein to refer to the prediction of the likelihood of cancer-attributable death or progression, including recurrence, metastatic spread, and drug resistance, of a neoplastic disease, such as breast cancer,

The term “prediction” is used herein to refer to the likelihood that a patient will respond either favorably or unfavorably to a drug or set of drugs, and also the extent of those

CA 02829472 2013-10-03

' ’ Μ<»4/«655β3 PCraJS2«04ffl(l(B8S responses, or that a patient will survive, following surgical removal or the primary tumor and/or chemotherapy for a certain period of time without cancer recurrence. The predictive methods of the present invention can be used clinically to make treatment decisions by choosing tlie most appropriate treatment modalities for any particular patient The predictive methods of the present invention are valuable tools in predicting if a patient is likely to respond favorably to a treatment regimen, such as surgical intervention, chemotherapy with a given drug or drug combination, and/or radiation therapy, or whether long-term survival of the patient, following stigery and/or termination of chemotherapy or other treatment modalities is likely.

The term “long-term” survival is used herein to refer to survival for at least 3 years, more preferably for at least 8 years, most preferably for at least 10 years following surgery or other treatment.

The term tumor, as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.

The terms cancer and cancerous refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, breast cancer, colon cancer, lung cancer, prostate cancer, hepatocellular cancer, gastric cancer,, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, melanoma, and brain cancer.

The pathology of cancer includes all phenomena that compromise the well-being of the patient. This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, neoplasia, premaliguancy, malignancy, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc.

Stringency'* of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration, hi general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired

CA 02829472 2013-10-03

WO 2004/065583

PCT/US2001/,>00985 homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current

Protocols in Molecular Biology. Wiley Înterscience Publishers, (1995).

Stringent conditions or Iiigh stringency conditions, as defined herein, typically: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with

0.1% bovine serum aIbumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/5QmM sodium phosphate huffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42eC; or ¢3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0,075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt’s solution, sonicated salmon sperm DNA (50 pg/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55°C, followed by a lugh-stnngency wash consisting of 0.1 x SSC containing EDTA at 55°C.

Moderately stringent conditions may be identified as described by Sainbrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent that those described above. An example of moderately stringent conditions is overnight incubation at 37°C in a solution comprising; 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt’s solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at ahout 37-50°C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the tike.

Tn the context of the present invention, reference to at least one, at least two, at least five, etc. of the genes listed in any particular gene set means any one or any and all combinations of the genes listed.

The terms “expression threshold,” and defined expression threshold are used interchangeably and refer to the level of a gene or gene product in question above which the gene or gene product serves as a predictive marker for patient survival without cancer

CA 02829472 2013-10-03 c c

K /2004/W.55KJ PCTrtJS2«U/ftee985 recurrence. The threshold is defined experimentally from clinical studies such as those described in the Example below. The expression threshold can be selected either for maximum sensitivity, or for maximum selectivity, or for minimum error. The determination of the expression threshold for any situation is well within the knowledge of those skilled in the art.

B. Detailed Description

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recomhinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, 2nd edition (Sambrook et al., 1989); “Oligonucleotide Synthesis” (M.J. Gait, ed., 1984); “Animal Cell Culture” (RL Freshney, ed., 1987); “Methods in Enzymology” (Academic Press, Inc.); “Handbook of Experimental Immunology”, 4th edition (D.M. Weir &

C. C. Blackwell, eds,, Blackwell Science Inc., 1987); “Gene Transfer Vectors for Mammalian Cells” (J.M. Miller & M.P. Calos, eds., 1987); “Current Protocols in Molecular Biology” (F.M. Ausubel et al., eds., 1987); and PCR: The Polymerase Chain Reaction”, (Mullis et al., eds., 1994).

1. Gene Expression Profiling

In general, methods of gene expression profiling can be divided into two large groups: methods based on hybridization analysis of polynucleotides, and methods based on sequencing of polynucleotides. The most commonly used methods known in the art for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization (Parker & Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNAse protection assays (Hod, Biotechniques 13:852-854 (1992)); and reverse transcription polymerase chain reaction (RT-PCR) (Weis ei ak. Trends in Genetics 8:263-264 (1992)). Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS).

2. Reverse Transcriptase PCR (RT-PCRl

CA 02829472 2013-10-03

WO 2004/065583

PCT/tFS2«h/tt00tW5

Of the techniques listed above, the most sensitive and most flexible quantitative method is RT-PCR, which can be used to compare mRNA levels in different sample populations, in normal and tumor tissues, with or without drug treatment, to characterize patterns of gene expression, to discriminate between closely related mRNAs, and to analyze RNA structure.

The first step is the isolation of mRNA from a target sample. The starting material is typically total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines, respectively. Thus RNA can be isolated from a variety of primary tumors, including breast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, testis, ovary, uterus, etc., tumor, or tumor cell lines, with pooled DNA from healthy donors, if the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples.

General methods for mRNA extraction are well known in the art and are disclosed in standard textbooks of molecular biology, including Ausubel et ai,, Current Protocols of Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, Lab Invest. 56:A67 (1987), and De Andrés et ai, BioTechniques 18:42044 (1995). In particular, RNA isolation can be performed using purification kit, buffer set and protease from commercial manufacturers, such as Qiagen, according to the manufacturer’s instructions. For example, total RNA from cells in culture cau be isolated using Qiagen RNcasy mini-columns. Other commercially available RNA isolation kits include MasterPnre™ Complete DNA and RNA Purification Kit (EPICENTRE®, Madison, WI), and Paraffin Block RNA Isolation Kit (Ambion, Inc.), Total RNA from tissue samples can be isolated using RNA Stat-60 (Tel-Test). RNA prepared from tumor can be isolated, for example, by cesium chloride density gradient centrifugation.

As RNA cannot serve as a template for PCR, the first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction. The two most commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukemia virus reverse transcriptase (MMLV-RT). The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling. For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, CA, USA), following the

CA 02829472 2013-10-03

C c ' -J «MM/WS583 PCT/US2«MrtMMI9to manufacturer’s instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction.

Although the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5’-3* nuclease activity but lacks a 3’-5’ proofreading endonuclease activity. Thus, TaqMan® PCR typically utilizes the 5’-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5’ nuclease activity can be used. Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located between die two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission front the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During (he amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unqucnched reporter dye provides the basis for quantitative interpretation of the data.

TaqMan® RT-PCR can be performed using commercially available equipment, such as, for example, ABI PRISM 7700™ Sequence Detection System™ (Peririn-Elmer-Applied Biosystems, Foster City, CA, USA), or Lightcyclcr (Roche Molecular Biochemicals, Mannheim, Germany). In a preferred embodiment, the 5' nuclease procedure is run on a realtime quantitative PCR device such as the ABI PRISM 7700™ Sequence Detection System™. The system consists of a thermocycler, laser, charge-coupled device (CCD), camera and computer. The system amplifies samples in a 96-well formai on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 96 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data,

5’-Nuclease assay data are initially expressed as CL or the threshold cycle. As discussed above, fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction. The point when the fluorescent signal is first recorded as statistically significant is the threshold cycle (Ct).

CA 02829472 2013-10-03

C c

WO 2004/065583 PCT/US2iHh,.HHI985

To minimize errors and the effect of sample-to-sample variation, RT-PCR is usually performed using an internal standard. The ideal internal standard is expressed at a constant level among different tissues, and is unaffected by the experimental treatment. RNAs most frequently used to normalize patterns of gene expression are niRNAs for the housekeeping genes glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and p-actin.

A more recent variation of the RT-PCR technique is the real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (i,e,f TaqMan® probe). Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. For further details see, e.g. Held et al., Genome Research 6:986-994(1996).

The steps of a representative protocol for profiling gene expression using fixed, paraffin-embedded tissues as the RNA source, including ruRNA isolation, purification, primer extension and amplification are given in various published journal articles {for example: T.E. Godfrey et al,. J. Molec. Diagnostics 2: 84-91 [2000]; K. Specht et al., Am. f. Pathol. 158: 419-29 [2001]}. Briefly, a representative process starts with cutting about 10 pm thick sections of pavaffin-emhedded tumor tissue samples. The RNA is then extracted, and protein . and DNA are removed. After analysis of the RNA concentration, RNA repair and/or amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by RT-PCR.

According to one aspect of fire present invention, PCR primers and probes are designed based upon intron sequences present in the gene to be amplified. In this embodiment, the first step in the primer/probe design is the delineation of intron sequences within the genes. This can be done by publicly available software, such as the DNA BLAT software developed by Kent, WT., Genome Res. 12(4):656-64 (2002), or by the BLAST software including its variations. Subsequent steps follow well established methods of PCR primer and probe design.

In order to avoid non-specific signals, it is important to mask repetitive sequences within the introns when designing the primers and probes. This can be easily accomplished by using the Repeat Masker program availahle on-line through the Baylor College of Medicine, which screens DNA sequences against a library of repetitive elements and returns a

CA 02829472 2013-10-03 query sequence in which the repetitive elements are masked. The masked intron sequences can then he used to design primer and probe sequences using any commercially or otherwise publicly available primer/probe design packages, such as Primer Express (Applied

Biosystems); MGB assay-by-design (Applied Biosystems); Primer3 (Steve Rozen and Helen

J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programment· In: Krawete S, Misener S (eds) Biowformatics Methods and Protocols; Methods in Molecular Biology. Humana Press, Totowa, NI, pp 365-386)

The most important factors considered in PCR. primer design include primer length, melting temperature (Tm), and G/C content, specificity, complementary primer sequences, and 3'-end sequence. In general, optimal PCR primers are generally 17-30 bases in length, and contain about 20-80%, such as, for example, about 50-60% G+C bases. Tin’s between 50 and 80 °C, e.g. about 50 to 70 °C are typically preferred.

For further guidelines for PCR primer and probe design see, e.g. Dieffenbach, C.W. et al., “General Concepts for PCR Primer Design” in: PCR Primer, À Laboratory Manual, Cold

Spring Harbor Laboratory Press, New York, 1995, pp. 133-155; Innis and Gelfand, “Optimization of PCRs” in: PC& Protocols, A Guide to Methods and Applications, CRC Press, London, 1994, pp. 5-11; and Plasterer, T.N, Primerselect: Primer and probe design. Methods Mol, Biol. 70:520-527 (1997).

3, Microarrays

Differential gene expression can also be identified, or confirmed using the microairay technique. Thus, the expression profile of breast cancer-associated genes can be measured in either fresh or paraffin-embedded tumor tissue, using microarray technology. In this method, polynucleotide sequences of interest (including cDNAs and oligonucleotides) are plated, or arrayed, on a microchip substrate. The arrayed sequences are then hybridized with specific DNA probes from, cells or tissues of interest lust as in the RT-PCR method, the source of mRNA typically is total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines. Thus RNA can be isolated from a variety of primary tumors or tumor cell fines. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalinfixed) tissue samples, which are routinely prepared and preserved in everyday clinical practice.

CA 02829472 2013-10-03

C ' c

WO 20(M/065?X3 PCT7ÜS2fl&M.«iW85 h a specific embodiment of the microarray technique, PCR amplified inserts of cDNA clones are applied to a substrate in a dense array. Preferably at least 10,000 nucleotide sequences are applied to the substrate. The mieroarrayed genes, immobilized on the microchip at 10,000 elements each, are suitable for hybridization under stringent conditions. Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from tissues of interest. Labeled cDNA probes applied to the chip hybridize with specificity to each spot of DNA on the array. After stringent washing to remove non-specifically bound probes, the chip is scanned by confocal laser microscopy or by another detection method, such as a CCD camera. Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance. With dual color fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously, The miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes. Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et al., Proc. Natl. Aead. Set. USA 93(2):106-149 (1996)). Microarray analysis can be performed by commercially available equipment, following manufacturer's protocols, such as by using the Asymetrix GenChip technology, or Incytc's microarray technology.

The development of microarray methods for large-scale analysis of gene expression makes it possible to search systematically for molecular markers of cancer classification and outcome prediction in a variety of tumor types.

4, Serial Analysis of Gene Expression fSAGE)

Serial analysis of gene expression (SAGE) is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without foe need of providing an individual hybridization probe for each transcript. First, a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript. Then, many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously. The expression pattern of any population of transcripts

CA 02829472 2013-10-03 c

J 2W4M558J c

PCT/US2004/00998;.

can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag. For more details see, e.g. Veleulescu et al., Science 270:484-487 (1995); and Veleulescu etai, Cell 88:243-51 (1997).

5. MassARRAY Technology

The MassARRAY (Sequenom, San Diego, California) technology is an automated, high-throughput method of gene expression analysis using mass spectrometry (MS) for detection. According to this method, following the isolation of RNA, reverse transcription and PCR amplification, the cDNAs are subjected to primer extension, The cDNA-derived primer extension products are purified, and dipensed on a chip array that is pre-loaded with the components needed for MALTI-TOF MS sample preparation. The various cDNAs present in the reaction are quantitated by analyzing the peak areas in the mass spectrum obtained.

6. Gene Expression Analysis bv Massively Parallel Sienature Sequencing fMPSS)

This method, described by Brenner ei a/., Nature Biotechnology 18:630-634 (2000), is a sequencing approach that combines non-gel-based signature sequencing with in vitro cloning of millions of templates on separate 5 pm diameter microbeads. First, a microbead library of DNA templates is constructed by in vitro cloning. This is followed by the assembly of a planar array of the template-containing microbeads in a flow cell at a high density (typically greater than 3x10* microbeads/cm2). The free ends of the cloned templates on each microbead are analyzed simultaneously, using a fluorescence-based signature sequencing method that does not require DNA fragment separation. This method has been shown to simultaneously and accurately provide, in a single operation, hundreds of thousands of gene signature sequences from a yeast cDNA library.

7. Immunohistochemistry

Immunohistochemistry methods are also suitable for detecting the expression levels of the prognostic markers of the present invention. Thus, antibodies or antisera, preferably polyclonal antisera, and most preferably monoclonal antibodies specific for each marker are used to detect expression. The antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase. Alternatively, unlabeled primary antibody is used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary

CA Ο2829Π2 2013-10-03

C c

WO 20U/Qfci5&) PCT/WSMtk/oWMS antibody. Immunohistochemistry protocols and kits are well known in the art and arc commercially available.

8. Proteoinics

The term “proteome” is defined as the totality of the proteins present in a sample (e.g, tissue, organism, or cell culture) at a certain point of time. Proteoinics includes, among other things, study of the global changes of protein expression in a sample (also referred to as “expression proteomics”). Proteomics typically includes the following steps: (1) separation of individual proteins in a sample by 2-D gel electrophoresis (2-D PAGE); (2) identification of the individual proteins recovered from the gel, e.g. my mass spectrometry or N-terminal sequencing, and (3) analysis of the data using bioinformatics. Proteomics methods are valuable supplements to other methods of gene expression profiling, and can be used, alone or in combination with other methods, to detect the products of the prognostic markers of the present invention.

9. General Description of the mRNA Isolation, Purification and Amplification

The steps of a representative protocol for profiling gene expression using fixed, paraffin-embedded tissues as the RNA source, including mRNA isolation, purification, primer extension and amplification are given in various published journal articles (for example: T.E. Godfrey et al. J. Molec. Diagnostics 2: 84-91 (2000]; K. specht et ah, Am. J. Pathol. 158: 419-29 [2001]}. Briefly, a representative process starts with cutting about 10 pm thick sections of paraffin-embedded tumor tissue samples. The RNA is then extracted, and protein and DNA are removed. After analysis of the RNA concentration, RNA repair and/or amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by RT-PCR. Finally, the data are analyzed to identify the best treatment option(s) available to the patient on the basis of the characteristic gene expression pattern identified in the tumor sample examined.

10. Breast Cancer Gene Set, Assayed Gene Subsequences, and Clinical

Application of Gene Expression Data

An important aspect of the present invention is to use the measured expression of certain genes by breast cancer tissue to provide prognostic information. For this purpose it is necessary to correct for (normalize away) both differences in the amount of RNA assayed and variability in the quality of the RNA used. Therefore, the assay typically measures and incorporates the expression of certain normalizing genes, including well known housekeeping

CA 02829472 2013-10-03 c c

.. J KW4/0Î5583 PCT/ÜS10ÎU/000985 genes, such as GAPDH and Çyp). Alternatively, normalization can be based on the mean or median signal (Ct) of all of the assayed genes or a large subset thereof (global normalization approach). On a gene-by-gene basis, measured normalized amount of a patient tumor mRNA is compared to the amount found in a breast cancer tissue reference set The number (N) of breast cancer tissues in this reference set should be sufficiently lugb to ensure that different reference sets (as a whole) behave essentially the same way. If this condition is met, the identity of the individual breast cancer tissues present in a particular set will have no significant impact on the relative amounts of the genes assayed. Usually, the breast cancer tissue reference set consists of at least about 30, preferably at least about 40 different FPE breast cancer tissue specimens. Unless noted otherwise, normalized expression levels for each mRNAAested tumor,'patient will be expressed as a percentage of the expression level measured in the reference set. More specifically, the reference set of a sufficiently high number (e.g, 40) of tumors yields a distribution of normalized levels of each mRNA species. The level measured in a particular tumor sample to be analyzed falls at some percentile within this range, which can be determined by methods well known in the art Below, unless noted otherwise, reference to expression levels of a gene assume normalized expression relative to the reference set although this is not always explicitly stated.

Further details of the invention will be described in the following non-limiting Example

Example

A Phase g Study of Gene Expression in 79 Malignant Breast Tumors

A gene expression study was designed and conducted with the primary goal to molecularly characterize gene expression in paraffin-embedded, fixed tissue samples of invasive breast ductal carcinoma, and to explore the correlation between such molecular profiles and disease-free survival.

Study design

Molecular assays were performed on paraffin-embedded, formalin-fixed primary breast tumor tissues obtained from 79 individual patients diagnosed with invasive breast cancer. All patients in the study had 10 or more positive nodes. Mean age was 57 years, and mean clinical tumor size was 4.4 cm. Patients were included in the study only if

CA Ο2829Π2 2013-10-03

WO Ζ«ΙΜ/β655Λ1

PCT/US2<HU,.tt>(W85 histopathologie assessment, performed as described in the Materials and Methods section, indicated adequate amounts of tumor tissue and homogeneous pathology.

Materials and Methods

Each representative tumor block was characterized by standard histopathology for diagnosis, semi-quantitative assessment of amount of tumor, and tumor grade. A total of 6 sections (10 microns in thickness each) were prepared and placed in two Costar Brand Microcentrifiige Tubes (Polypropylene, 1,7 mL tubes, clear; 3 sections in each tube). If the tumor constituted less than 30% of the total specimen area, the sample may have been crudely dissected by the pathologist, using gross microdissection, putting the tumor tissue directly into the Costar tube.

If more than one tumor block was obtained as part of the surgical procedure, the block most representative of the pathology was used for analysis.

Gene Expression Analysis mRNA was extracted and purified from fixed, paraffin-embedded tissue samples, and prepared for gene expression analysis as described in section 9 above.

Molecular assays of quantitative gene expression were performed by RT-PCit, using the ABI PRISM 7900™ Sequence Detection System™ (Perkin-Elmer-Applied Biosystems, Foster City, CA, USA). ABI PRISM 7900™ consists of a thermocycler, laser, charge-coupled device (CCD), camera and computer. The system amplifies samples in a 384-wefi format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 384 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data.

Analysis and Results

Tumor tissue was analyzed for 185 cancer-related genes and 7 reference genes. The threshold cycle (CT) values for each patient were normalized based on the median of the 7 reference genes for that particular patient. Clinical outcome data were available for ail patients from a review of registry data and selected patient charts.

Outcomes were classified as;

died due to breast cancer or to unknown cause or alive with breast cancer recurrence;

CA 02829472 2013-10-03 c c . JÎ(«MXI6»83 PCT/US2(MH/00fl9lfc, alive without breast cancer recurrence or died due to a cause other than breast cancer

Analysis was performed by:

1. Analysis of the relationship between normalized gene expression and the binary outcomes of 0 or 1.

2. Analysis of the relationship between normalized gene expression and the time to outcome (0 or 1 as defined above) where patients who were alive without breast cancer recurrence or who died due to a cause other than breast cancer were censored. This approach was used to evatnate the prognostic impact of individual genes and also sets of multiple genes.

Analysis of patients with invasive bi-east carcinoma by binary approach

In the first (binary) approach, analysis was performed on all 79 patients with invasive hreast carcinoma. A t test was performed on the groups of patients classified as either no recurrence and no breast cancer related death at three years, versus recurrence, or breast cancer-related death at three years, and the p-values for the differences between the groups for each gene were calculated.

Table 1 lists the 47 genes for which the p-value for the differences between the groups was <0.10. The first column of mean expression values pertains to patients who neither had a metastatic recurrence of nor died from breast cancer. The second column of mean expression values pertains to patients who either had a metastatic recurrence of or died from breast cancer.

Table 1

<td></td><td> Mean</td><td> Mean</td><td> t-value</td><td> df</td><td> P</td><td> Valid N</td><td> Valid N</td>

<td> EsIRI</td><td> -0.35531</td><td> -3.00699</td><td> 3.32190</td><td> 75</td><td> 0.001384</td><td> 35</td><td> 42</td>

<td> IGFBR2</td><td> -0.81181</td><td> -1.78398</td><td> 3.2415B</td><td> 75</td><td> 0.001774</td><td> 35</td><td> 42</td>

<td> EstRt</td><td> 3.67801</td><td> 1.64693</td><td> 3.01073</td><td> 75</td><td> 0.003550</td><td> 35</td><td> 42</td>

CA 02829472 2013-10-03

C c

WO 2804/065583 PCT/OSÎ004/W.0085

<td> PRAME</td><td> -6.40074 -7.70424</td><td> 2.08126</td><td> 75 0.040623</td><td> 35</td><td> 42</td>

<td> GAPDH</td><td> -0.35829 -0.02292</td><td> -1.94326</td><td> 75 0.055737</td><td> 35</td><td> 42</td>

<td> G* Catenin</td><td> 0.31875 -0.15524</td><td> 1.80823</td><td> 75 0.074580</td><td> 35</td><td> 42</td>

In the foregoing Table I, negative t-vahies indicate higher expression, associated with worse outcomes, and, inversely, higher (positive) t-values indicate higher expression associated with better outcomes. Thus, for example, elevated expression of the CD68 gene (t5 value - -3.41, CT mean alîve< CT mean deceased) indicates a reduced likelihood of disease free survival. Similarly, elevated expression of the BC12 gene (t-value = 4.00; CT mean alive> CT mean deceased) indicates an increased likelihood of disease free survival.

Based on the data set forth in Table 1, the expression of any of the following genes in breast cancer above a defined expression threshold indicates a reduced likelihood of survival without cancer recurrence following surgery: Gih7, CD68, CTSL, Cbkl, Her2, STK15, AEBI, SURV, EGFR, MYBL2, HIFla.

Based on the data set forth in Table 1, the expression of any of the following genes in breast cancer above a defined expression threshold indicates a better prognosis for survival

CA 02829472 2013-10-03 c c

.. 0 200-1/06^583 PCT/VS2Hft4/OOf|98;, without cancer recurrence following surgery: TP53BP2, PR, Bcl2, KRT14, EstRl, IGFBP2, BAG1, CEGPl, KLK.10, β Catemo, GSTM1, FHIT, Rizl, IGF1, BBC3, IGFR.1, TBP, p27, [RSI, IGF1R, GATA3, CEGPl, ZNF217, CD9, pS2, ErbB3, T0P2B, MDM2, RAD51, and KRT19.

Analysis of ER positive patients by binary approach patients with normalized CT for estrogen receptor (ER) X) (i.e., ER positive patients) were subjected to separate analysis. A t test was performed on the two groups of patients classified as either no recurrence and no breast cancer related death at three years, or recurrence or breast cancer-related death at three years, and the p-values for the differences between the groups for each gene were calculated. Table 2, below, lists the genes where the p-value for the differences between the groups was <0.105. The first column of mean expression values pertains to patients who neither had a metastatic recurrence nor died from breast cancer. The second column of mean expression values pertains to patients who either had a metastatic recurrence of or died from breast cancer.

Table 2

<td></td><td> Mean</td><td> Mean</td><td> t-vatue</td><td> df</td><td> P</td><td> Valid N</td><td> Valid N</td>

<td> TRAIL</td><td> 0.34893</td><td> -0.56574</td><td> 2.20372</td><td> 55</td><td> 0.031749</td><td> 30</td><td> 27</td>

CA 02829Π2 2013-10-03

C

WO 2004/065583

C

PCT/US2004/,ι«0985

For each gene, a classification algorithm was utilized to identify the best threshold value (CT) for using each gene alone in predicting clinical outcome.

Based on the data set forth in Table 2, expression of the following genes in ER5 positive cancer above a defined expression level is indicative of a reduced likelihood of survival without cancer recurrence following surgery: CD6S; CTSL; FBXO5; SURV; CCNB1; MCM2; Chkl; MYBL2; HtFlA; cMET; EGFR; TS; STK15. Many of these genes (CD6S, CTSL, SURV, CCNB1, MCM2, Chkl, MYBL2, EGFR, and STK15) were also identified as indicators of poor prognosis in the previous analysis, not limited to ER-positive breast cancer. Based on the data set forth in Table 2, expression of the following genes in ER-positive cancer above a defined expression level is indicative of a better prognosis for survival without cancer recurrence following surgery: IGFR1; BC12; HNF3A; TP53BP2; GATA3; BBC3; RAD51C; BAG1; ÎGFBP2; PR; CD9; RBI; EPHX1; CEGP1; TRAIL; DR5; P27; p53; MTA; RIZl; ErbB3; TOP2B; EIF4E. Ofthe latter genes, IGFR1; BC12; TP53BP2;

GATA3; BBC3; RAD51C; BAG1; IGFBP2; PR; CD9; CEGP1; KR5; p27; RIZl; ErbB3; TOP2B; EIF4E have also been identified as indicators of good prognosis in the previous analysis, not limited to ER-positive breast cancer.

Analysis of ER negative patients by binary approach

Twenty patients with normalized CT for estrogen receptor (ER) <1.6 (he., ER negative patients) were subjected to separate analysis. A t test was performed on the two groups of patients classified as either no recurrence and no breast cancer related death at three years, or recurrence or breast cancer-related death at three years, and the p-values for the differences between the groups for each gene were calculated. Table 3 lists the genes where the p-value for the differences between the groups was <0.118. The first column of mean expression values pertains to patients who neither bad a metastatic recurrence nor died from breast

CA 02829472 2013-10-03

C c j 2004/065Î8J P€T/US2M4/fKHM8..

cancer. The second column of mean expression values pertains to patients who either had a metastatic recurrence of or died from breast cancer.

Table 3

<td></td><td> Mean</td><td> Mean</td><td> t-vatue</td><td> df</td><td> P</td><td> Valid N</td><td> Valid N</td>

<td> Maspin</td><td> -3.56145</td><td> -6.18678</td><td> 2.40169</td><td> 18</td><td> 0.027332</td><td> 5</td><td> 15</td>

<td> Contig 27S82</td><td> 4.27585</td><td> -7.34338</td><td> 2.18700</td><td> 18</td><td> 0.042187</td><td> 5</td><td> 15</td>

<td> A-Catenin</td><td> 4,19790</td><td> -0.39085</td><td> -2.15624</td><td> 18</td><td> 0.044840</td><td> 5</td><td> 15</td>

<td> B-aclrn</td><td> 4.69672</td><td> 5.19190</td><td> -2.04951</td><td> 18</td><td> 0.055273</td><td> S</td><td> 15</td>

<td> FRAME</td><td> -4.95855</td><td> -7.41973</td><td> 1.86668</td><td> 18</td><td> 0.078322</td><td> 5</td><td> 15</td>

Based on the data set forth in Table 3, expression of the following genes in BRnegative cancer above a defined expression level is indicative of a reduced likelihood of survival without cancer recurrence (p<0.05); CCND1; UP A; HNF3A; CDH1; Her2; GRB7; AKT1; STMY3, α-Catenin; VDR; GRO1. Only 2 of these genes (Her2 and Grb7) were also identified as indicators of poor prognosis in the previous analysis, not limited to ER-negafive breast cancer. Based on tire data set forth in Table 3, expression of the following genes in

ER-negative cancer above a defined expression level is indicative of a better prognosis for survival without cancer recurrence (KT 14; KLK10; Maspin, TGFa, and FRP1. Of the latter genes, only KLK10 has been identified as an indicator of good prognosis in the previous analysis, not limited to ER-ncgafive breast cancer.

CA 02829Π2 2013-10-03 c c.

WO 2004/06.-V583 PCTflUS2fl04/,0»985

Analysis of multiple senes and indicators of outcome

Two approaches were taken in order to determine whether using multiple genes would provide better discrimination between outcomes.

First, a discrimination analysis was performed using a forward stepwise approach.

Models were generated that classified outcome with greater discrimination than was obtained with any single gene alone.

According to a second approach (time-to-event approach), for each gene a Cox Proportional Hazards model (see, e.g. Cox, D. R., and Oakes, D. (1984), Analysis of Survival Data, Chapman and Hall, London, New York) was defined with time to recurrence or death as the dependent variable, and the expression level of the gene as the independent variable. The genes that have a p-value < 0.10 in the Cox model were identified. For each gene, five Cox model provides the relative risk (RR) of recurrence or death for a unit change in the expression of the gene. One can choose to partition the patients into subgroups at any threshold value of the measured expression (on the CT scale), where all patients with expression values above the threshold have higher risk, and all patients with expression values below the threshold have lower risk, or vice versa, depending on whether the gene is an indicator of bad (RR>1.01) or good (RR<1.01) prognosis. Thus, any tlireshold value will define subgroups of patients with respectively increased or decreased risk. Hie results are summarized m Table 4. The third column, with the heading: exp(coef), shows RR values.

CA 02829472 2013-10-03 c c J 2064/065583 PCT/US2004/0«l9fb

Table 4

<td> Gene</td><td> eoef</td><td> exp(coef)</td><td> sefcoef)</td><td> z</td><td> P</td>

<td> PRAME</td><td> -0.13707</td><td> 0.871912</td><td> 0.054904</td><td> -2.49649</td><td> 0.0125</td>

<td> EstRt</td><td> -0.07686</td><td> 0.92601 B</td><td> 0.034848</td><td> -2.20561</td><td> 0.0274</td>

<td> IGFBP2</td><td> -0.2152</td><td> 0.806376</td><td> 0.099324</td><td> -2.16669</td><td> 0.0303</td>

<td> B.Catenin</td><td> 0.16536</td><td> 0.847586</td><td> Û.064796</td><td> -1.95013</td><td> 0.0512</td>

<td> DiABLO</td><td> 0.284336</td><td> 1.32886</td><td> 0.166556</td><td> 1.707148</td><td> 0.0878</td>

The binary and time-to-event analyses, with few exceptions, identified the same genes 5 as prognostic markers. For example, comparison of Tables 1 and 4 shows that 10 genes were represented in the top 15 genes in both lists. Furthermore, when both analyses identified the same gene at [p<0,10], which happened for 21 genes, they were always concordant with respect to the direction (positive or negative sign) of the correlation with survival/recurrence. Overall, these results strengthen the conclusion that die identified markers have significant prognostic value.

For Cox models comprising more than two genes (multivariate models), stepwise entry of each individual gene into the model is performed, where the first gene entered is preselected from among those genes having significant univariate p-values, and the gene selected

CA 02829472 2013-10-03

WO 2004/065583 c

PCr/US2flll4,O<iO985 for entry into the model at each subsequent step is the gene that best improves the fit of the model to the data. This analysis can be performed with any total number of genes. In the analysis the results of which are shown below, stepwise entry was performed for up to 10 genes.

Multivariate analysts is performed using the following equation:

RR=exp[coef[geneA) x Ct(geneA) +· coef(geneB) x Ct(geneB) + cocf(geneC) x Ct(geneC) +...............].

In this equation, coefficients for genes that are predictors of beneficial outcome are positive numbers and coefficients for genes that are predictors of unfavorable outcome are negative numbers. The “Ct” values in the equation are ACts, i.e. reflect the difference between the average normalized Ct value for a population and the normalized Ct measured for the patient in question. Ihe convention used in the present analysis has been that ACts below and above the population average have positive signs and negative signs, respectively (reflecting greater or lesser mRNA abundance). The relative risk (RR) calculated by solving this equation will indicate if the patient has an enhanced or reduced chance of long-term survival without cancer recurrence.

Multivariate gene analysis of 79 patients with invasive breast carcinoma

A multivariate stepwise analysis, using the Cox Proportional Hazards Model, was performed on the gene expression data obtained for all 79 patients with invasive breast carcinoma. The following ten-gene sets have been identified by this analysis as having particularly strong predictive value of patient survival :

(a) ΤΓ53ΒΡ2, BcI2, BAD, EPHXl, PDGFRp, DIABLO, XIAP, YB1, CAP, and KRT8.

(b) GRB7. CD68, TOP2A, Bcl2, DIABLO, CD3, 1D1, PPM1D, MCM6, aud WISP 1.

(d) CD68, GRB7, TOP2A, Bcl2, DIABLO, CD3, ID 1, PPM1D, MCM6, and WISPL (e) Bcl2, TP53BP2, BAD, EPHXl, PDGFRp, DIABLO, XIAP, YB1, CA9, and KRT8.

(1) KRT14, KRT5, PRAME, TP53BP2, GUS1, AJB1, MCM3, CCNE1, MCM6, and ©1.

(g) PRAME, TP53BP2, EstRl, DIABLO, CTSL, PPM1D, GRB7, DAPK1, BBC3, and

VEGFB.

(h) CTSL2, GRB7, TOP2A, CCNB1, Bcl2, DIABLO, PRAME, EMS1, CA9, and

EpCAM.

CA 02829472 2013-10-03

,. Ο 2004/065583 PCT/US2004/00098:· (i) EslRl, TP53BP2, FRAME, DIABLO, CTSL, PPMÎD, GRB7, DAPK.1, BBC3, and VEGFB.

(к) Chkl, PRAME, p53BP2, GRB7, CA9, CTSL, CCNB1, TOP2A, tumor size, and IGFBP2.

0) IGFBP2, GRB7, FRAME, DIABLO, CTSL, β-Catenin, PPM1D, Chkl, WISPt, and LOTL (m) HER2, TP53BP2, Bcl2, DIABLO, TTMP1, EPHX1, TOP2A, TRAIL, CAP, and AREG.

(n) BAG1, TP53BP2, PRAME, IL6, CCNB1, PAU, AREG, tumor size, CAP, and Ki67.

(o) CEGP1, TP53BP2, PRAME, DIABLO, Bcl2, COX2, CCNE1, STK15, and AKT2, andFGF18.

(p) STK.15, TP53BP2, PRAME, JL6, CCNE1, AKT2, DIABLO, cMet, CCNE2, and COX2.

(q) KLK10, EstRl, TP53BP2, PRAME, DIABLO, CTSL, PPMID, GRB7, DAPK1, and BBC3.

(r) AIB 1, TP53BP2, Bcl2, DIABLO, TIMPI, CD3, p53, CAP, GRB7, and EPHX1 (s) BBC3, GRB7, CD€8, PRAME TOP2 A CCNB1, EPHX1, CTSL GSTMl.andAPC.

(t) CD9, GRB7, CD68, T0P2A, Bôl2, CCNB1, CD3, DIABLO, ID1, and PPMID.

(w) EGFR, KRT14, GRB7, TOP2A, CCNB1, CTSL, Bcl2, TP, KLK10, and CA9.

(x) HIFlo, PR, DIABLO, PRAME, Chkl, AKT2, GRB7, CCNE1, TOP2A, and CCNB1.

(y) MDM2, TP53BP2, DIABLO, Bcl2, AIB1, TIMPI, CD3, p53, CA9, and HER2.

(z) MYBL2, TP53BP2, PRAME, IL6, Bct2, DIABLO, CCNE1, EPHX1, TIMP1, and CA9.

(аа) ρ27, TP53BP2, PRAME, DIABLO, Bcl2, COX2, CCNE1, STK15, AKT2, and ID1.

(ab) RAD51, GRB7, CD68, TOP2A, CIAP2, CCNB1, BAG1, IL6, FGFR1, and 1T53BP2.

(ac) SURV, GRB7, T0P2A, PRAME, CTSL, GSTMl, CCNB1, VDR, CAP, and CCNE2.

(ad) TOP2B, TP53BP2, DIABLO, Bcl2, TIMPI, AIB1, CA9,p53, KRTS, and BAD.

(ae) ZNF217, GRB7, p53BP2, PRAME, DIABLO, Bct2, ÇQX2, CCNE1, APC4, and βCateain.

CA 02829472 2013-10-03

While the present invention has been described with reference to what are considered to be fee specific embodiments, it is to be understood that the invention is not limited to such embodiments. To the contrary, the invention is intended to cover various modifications and équivalente included within the scope of the appended claims. For example, while the disclosure focuses on the identification of various breast cancer associated genes and gene sets, and on the personalized prognosis of breast cancer, similar genes, gene sets and methods concerning other types of cancer are specifically within the scope herein.

CA 02829472 2013-10-03

Table 5A

Gent ' MOBUHm Stq ·

A1BÎ «W.3O&524 GCGGCGAGTTTCCGATTTAAAGCTGAGCTGCGAGGAA\7TG30G3CCGGaGGATCAAAATACTTQCTGGATGGT15GA3TCA

WI M14.CO5163 CGCTTCTATGGCQCîGAGATfGTGTCAGCCCÎIÎGACTACCÎGCACTCGGAGAAGAACGTGGTeTACCGGGA

ΛΚΤΪ TCSTGCeACCCTrCMACCTMGCTCACGTCCGABaTCGACACAMKSTACneaATGATCAATTMCCSCC

APC 734.003039 GGACAOCAGGAATCTCTTTCTCCATACAGGTCACGGGGAGOCAA7GCTTCAÛAAACAAATCGAG7GG3T .AftfiG Nnjooies/ tgtgagtgaaatggcttctagtagtgmccgtcctggggagccgactatgagtactcagaagagtatgataaogaaccacaa

Milin «K1_M1101 CAeCAaATGTGGATCAGCAAGCAGGAeTAlGACGAOTCCGGCCCCTCCATCeTCCACCSCAAÀTGC· «toil NI4.W1&O4 GGCrCTTGTGCGTACTGTCCTTCGGQCTOGTGACAGGQAAGACATCACraAeCCTGCCArCTGTGCTOTTCGTCATCTQA BAD N14.MÎ99» eGeTCAeGTGCOTCGACATCGGGCTTGGGCCCAGAGCATSTTCCASATCiCAGAGTTTGAGCcaAGTeASCiS 3AG1 NtLMttU CGTTGTCAGGWGTTGGAATACAAGATCGTTGCCGGGTCATCTTAATTGGeAAAAAGAACAGrCCAGAGGAAGAGGTTGMG B lie 3 NM.61 m r CCIGGABGGTCCTGTACAATCTCAICATGGGACTCCTOCCCTTASC CAOGÛGCCACAGA0CCCCÛOAGATGGAGCCCAATTAÛ

ΒΛ HM.000939 CAflATOGACCTAGTÎMCACTOAGATnCCAeeeceAAGGACAGCjiAWGÛAAAAATiïGCÎTrAAKfCATAGG CAB ««4.OW213 AÎCeiAGCCCTGGrnTTGGCCTCCrrrrreCTGKACCAeCGTCGCGTTCCnGTOCAGATGAGAAGGCW;

CCN91 NHjai*» TTCA0eTTGTTGCAG5AGACCATCTACATGACTGTrTCCATT*T7GATC8GTTCATGCAaAATAATTGT5TGCCCAAGAAaAre CCN01 «14.001759 GCATGTTCGTGQCCrGTAAGATGAAGGAGAGCATfiCCCCTGACGGCCGAGAAGCTCTGGATGTAGACCG ,CCNE1 «M.C0123B AAAGAAGATeATTSAeCSGGTTTACOCAAACrCAAOGTGCAAGCGTCGGAnATraWCqATCeAGAlGGeTC ,

CCNÏ2 NM.05774» ATeCTeTGGCTCCnCCTAACTeaGGCTrrCrTGACATlîrAGlîrrGCTTGGTAATAACCTÎTÎTGTATAICACAATTTGÛGT

COii ««4.000754 AGATGAAGTGGAAGGCGCmTeACCGCOGCCATCCTQCAGGCACAGTrGCCGATrAOAOAGGCA (Wt HU.X1M1 TGSTTIXC*OCCCTGTGTCCACirnXWUÎCCCAGATTCAGArrCGAGrCAÎi}TACAC>ACCCAGaGTGSAGGAG

COI ««4.CIH76Î GGOûGTGGMGAGTTTATGTCAGACA'ïCTGCCCCAAGAAGûACGTACTCGAAACCTTCACCGÛ'Û

CDH1 Ν«4_ΟΟ49βΟ TGAOTGÏCCCCCGGTATCITCCCCaCCCTGCCAATCCCGATeAAATreOAAATnTATTGATCAAAATCTGAAAGCGeCTO

CSCP1 ««4.030974 TGACA=.TCAGCACACCTC;ArrîACCGCXGGAAeAGCqCCTCAecTeCATGAAT*>ueATCACGSi:TGÎAGKAC*

COM NM_KM274 GATAAATTGGTACAAGGGATCAGCT7TTCCCAGCCCACATGTÛCTGA7CATATGCTTnTîAATAGTCAGTTAGTTGGCA3CC -C1AP1 NALMUM TGCCTGTGOÎGGGAAGCTGAGTAACTGGÛAACGMAGGATüATGCTATGTCAGAACACCGGAGGCATTTTCC dAPî - «14.001«! GGATATrraGGTGGCTCrrATfCAAAfiCTCCATCAAATCCTarAAACTWAgAaCAAATCAAGATnTTWWeTTOATeAGAAe 4M HMJWQMf GACArrrceAGTCCîGCAGTCAATSCCTSTCTaCCCCACCCnTGTTCAGTGTGaCTGGrGCCACaACAAATGTGTQCGATCGGAO Con Us 271 AKCTO919 . TjGCATCCTGGCCCAAAGTTTCCCAAATOCAGQCGQCTAGAGGCCCACTGCTTCCCAACTACCAGCTGAGG GGGTC CGXî «*4.000X9 T'CTGCAQAQVTGQAa5CA£TCTATGGT3aCATCGAT3CTGtGGaî3CTÛÎ,ATCCTGCcCTTCVQGTAGAAAASCCT0gGC CTSL NM.W1912 GGGAGacTTATCTCAGTGAGTGAGCAGWTCTGGTAGACTGCTCTGGGCCTCAAÛGCMTGAAGaCTGCAATGG GTSll MA 009339 TeTClCACraAGCaAflrAGAATCTGGTCGAETCTTCGCGOCtTCAAGGCAATCAQGGCTGCAATGGT DAPKî MM.W4M9 CG0TGACA'TCATûAATGTTCCTGGACCG3CTGGAGGCGAGTTfGGATATGACAAAGACACA'iCGrTGCTGAAAGAGA OtABlC ' «M.01WS7 CACAATCDÇGGCÎÇTaAASAGrrGGÇinîTCGCCeAGeCTAACrrCATTCflfeAGGTACACACACTGTTTGrTGiT ORS 7(14.003942 CTCTGAGACAGTGGTTCGATGACnTGCAGACTIGGTGCCCITTeACraCTOGGAGCCGCTCATSAGaAAGTTGGGCCTCiTGG . EGFR «*4.0X220 TGTC3ATGGACTTCCAGAACCACC7GGGCAGÎ77GCCAAAAGT1STGATCCAAGCTBTCCCAAT £IF« KM.ÛC1KI ûAÎCTAAGATG3C5AÇTGÎGGAACCGGMaCGACCCÇÏACÏCÇÎAATCCCC0GAGÎACAGAAGA[3GAGAAAA3GGAATCÏAA E14SI ««4.005231 GQCAGTeTCACTGAGTCCTTGAAATCCTCCCCTGCCCCàCGGGTCTCTGGATragGAOaCACAaTeCA EpCAAA MM_aB554GGGCCCrCCAGAACAATGATGGGCTTTATGATCCTGACTGC3ATGAGAGCQGGCTCnTAAGGCCA«3CAlGrGCA EPHK1 . ««1.000120 ACCGTAGGCTClGCTCrGAATaACTCreCTOTGGaTC-rGGCTCCeVArATTCTASAGAAGTTTTCCACCTOGACCA ' Eftin WW.ansM CGGTTATGTCATGCCAGATAGACACCTrGAAAGGTACTCCCTGCTCGCGGQAAGGGACCCnTCITCAOTGGGTCTCAGTTG EtÎRI «71.000124 CGTGeTGCCCCTCTATGACCTOCTeCTGGAQATGOTGGACaCCCACCGCCTACATGOGCCGACTAGOC

F8X0Ï NWjH2177 GGCÏArreCTCATTTTCïCTACAAAOTGGCCTCAGTaAACATGAAGAAGGmGCCTCCÎGGAGGAeAATnCGGTGACftGTCTACAATCC F» 13 . «14,003992 cggtagtgaagtccggatgaaggsgaaggagacggaattctacgtotggatgaagcggaaagggaagc FGFR1 «14.123109 cacgggacattcaccagatcgactactataaaaagacaaccaacggccgagtgcctgtgaagtggatggcacqc FHtT «14.002013 CCAGTGaAOCGCnCCArGACCTGCGTCCTGATOAAGTGGCJGATnamCAGAC&ACiOACAe/Xl FRPt «14.003012 TTGGTACGTGnjGGTTAGCATGAAGTTCTCCCCAGGGTAGAATTGAATCAGAGCTCGAGnTGCATTTGGATGTQ Q-CataNn ΜΜ.ΜΠ230 TCAGCAOCAAGGGCATCATGGAGGAGGATOAGGCCTQCGGeCCCCAÛTACACaCTCAASAAAACCJ£C . GAPDH ««4.0021349 ATTCCACCCAT3GCAAATTCCATGûOaCCGTCAAGQCTGAGAACQGGAAGCTTGÎCA7CAATCGAAATCCCA7C GATAI «M.MTKÈl GAAAGGAGClCALCTGTCaTGTGTGTGTTCCAACCACTGAATCTQGAGGGCATCTGTGAATAAGCCATTCTGAGTG 37137 ««4.005310 CGATCTGCATCCATCTTGTTT3GGCTCCCCACCCTTGA0AAGTGCCTCAGATAATAÛCCTGGrrûGCC

CROi MU 001511 CGAAAAOATGCTCAACAGTCACAMTOlAAC?GACCAGAAGCGAG<MCt>AGcreACTGGTGGOTGTTCCÎeA G4TI41 MU 300591 AAGCTA7GAGGAAAAGAAGTACACGATGGGGGACGCTCCTaAT7ATGACAGAAGCCAGTGQCTGAATGAAAAATTCAAGCTGG3CC GUS NM 0001« CCCACTCAGTAGCCAAGTCACAATGTTTGGAAAACAGCCCGTTTACTTGAGCAAflACTGATACCACCTOCGTC HEftl «14.004441 CGGTaTGAGAAGTGCAGCAAaCCCTOrGCCOGAG'TGTGCTATGGrCTGGGCATGGAGCAGTTQCGAGAGS

HiFi A «14,031510 T5AACATAAAeTCTeeAACATiîGAAaGTATÎGGACTOCACAGGGCACAncACGTArATGATACCMCA5TAACCAACCTCA

HHF3A NM.0044B0 TCCAGGATGTrAGGAACTGTGAAGATÛGAAGaGCATGAAACCAGCGACTGGAACASCTACTAC&CAGACACGC

101 «44.002103 AGAACGGCAAGGTGAGCAAGaTGGAGATTCTCCAGCACGTOATCOAOTACATCAGQilACCnCAOTTGGA

CFI HM.W061S ICCeGAGCTOÏCATÇÎAAlSCWSGCTGGAGATeîAnGCGCACCWTCAAGCCTÎeCAAGTCAGCTCGCTCTSIÎce

IGF1R « I4.EOM75 GGATOSTAG CCGAAGATTTCACAGTCAMATCGGAGATTTTGGTATOACGCGAGATATCTATGAGACAGAGTATTAC CGGAAA

IGFBP2 «W.WW9T gtggacagcaccatgaacatgttgggcggoggaggcagtgctggccggaagcccctcaagtcgggtatoaagg

U9 «14.00X00 OCÏGAACCrrûOAPAGATOGCT5AAAJAOA'l3CATGCTTCC*ATDTGQÀTTCMTÛAGGAGACTOCCTGGT ’

R91 N14.0G5544 CCACAGCTCACCTTCTGTCAGQTGTCCATCCCAôCTCCAGCCAGCTCCCAGAGAGGAAGAGACTGGCACTGAGG «M? «14.002417 CGGACTTIQGGTGCGACnGACGAaCG3TGÛnCGACAAOTGeCCnGCaQGCCGÛATCaTCCCAGTGGAAÛAGTrGTM·

KIKIO «M 002770 GCCCACAGGCTCCATCGTCCATCCTCTTÙCTCCCCaGTCCQCTGAACTCTCCOCTTCTCTGCACTOTTCAAACCTCTG

ΑΚΠ4 NM.QOCB5M «OCCiacniAÛATCAAAaACTACAeTCCCrACnGAAGACCATTeAMACCTaAeaAACAAeATmTGACAeCCACA&TGÎiAC

0(717 NMJ0MIÎ CGAGGATTGGTTCTTCAGCAAQACAijAGGAACTGAACCGCGAGGTGGCCACCAAGAGTGAGGTGGTGCAGAGT nmt KM.OMUA AGAeATCGAaeC1CTtAA6GAaGAGC1GtTMTCATaAAaA*ÛAACCACGAAGAaQAA.âïAAAAG6CC

KRTit HM.caæ70 -GaSCGOCAGAATCAGGAOTACçaGCOOOTCATQGACAT^AAGTCGCGGGTGGAGCAGGAGATTGCCACCTACCGCA

WTÏ RM.KO414 TCAGTaGAGAAGGAGnGGACGAGTCAACATCTCTGnGTCACAAGCAeTamGGTGnMATATGGCA .

XAT4 NM.0O2271 GQATOAAÛCTTA3ATGAACAAGGTA3A3CTG3A3TCTCGCCTC3AAGOQC7CACCÛACÎ3AÛATCAACTTCCTCAG3CAÛCTATATG ίΟΠνκΕΝΚ.αηβΟΒ SGAAACACÎACCTGAAAAACCACCTCCAGaCÎCACGACCCCAACAAAATGGOCTTTBGGTGTGAGGaSTÛTGGCAAJÎAAGTAC Uttpin «14.0329» CAGATGGCGACTTTQAGAACATTTTAGCTûACAACAGTSTGAAGGAGGAGACCAAAATCCÎTGTGGTTAATQCTGCG MCU2 ««4.034929 GACnTraCCCGCTACCTTTCATTÙCGaCGTÏSAOAACAATOAGCTGTTOCTCTTCATAC'rGAAOCAarrAGTOGC «ο» «mjkîih aaACAACAAiccceTTGAaAeACAATATeeeeiTÎCT6TCTACAACGAÎCAecAaAeeATCAecATCeAoaAaAT *042 «04.0025« CTA£3AGG3*CMCATCSMTCCeGATCTTGATeCTGGTGTAAGTGAAGArTCAOGTCAT7atnTOOAT «4MPS «74.334394 GAGAACCAATCTCACCGAOAOGCAÛCTGSCAGA3GAATACCTGTACCGCTATGGT7ACAC7CGGGTG

74TA1 ««4.004990 CCGCCCTCACCTGAAGAGAAACecâCTecTTaGCSGAGACrGâaGGAGGAaUlGAAGAAOCGCGâOTAACTrATrCC

MYK.2 NM.W24H GGCaAGATCGCGAAûATGTÎGGCAGGGAGGACACACAATGGTGTGAAûAATCAGTûeAACTCTACCATGAAAAO

P14AAF 67BS7S CCCTCCTCCTCATGCT4JCTCAGGAQCCACCGTCTAG3GGAaCAGCCGCTTCCTAGA*GAOaGTCATGATG p2> ««4.BJ40S4 CSSTaGACCAeCAAGAGnAACCCSGGACTTGGAGAAGOASTGCAGAGACATâGAAGAGGCGAGCC

P93 «M 000140 CTTT^MarrTCCTTC«ATAGGnSTGCGTCAGAAG(l«CGAG(l»£TTCCATTTCCTrTGTCCCGGG

PAH «*4,00X02 CCaCAACGTGGTnTCTCACCCTATCC0aTaGCCTCG3TGnCGCCATGCTCCAaCT0ACAACAGaAGGAQAA«CCCW}CA

PDGFRh NM.OM&M eCAenGTÇÇîïCCAeCTACAÛMÏAATGTCCC7ÜTMSAareeTeîAeCTAACTeAGAGCCACCC '

P11KG2A «*4.032945 ATAIXAAFCACCGCACAAACCCAGGCTATnilnAAlGTCCAGTCACACCGCAMaAAAGATATGGGSAeAAAAlaCTÀGTGn PPM10 NMJMJ023 GCCATCCGCAAAGGCrfTC7COCTTGÎCACCTTCCCATGTBaAAGAAACTQGCGGAATG0OC

PR ««4,330929 OCAtCAeQOTeTCAÏTATÜGTIÎTCCTTACCTÛTGGGAGCiaTAAGGTeTTCTrTAAGAGeGCAATGGAPûaGOAaMCAACTAOT PRAMS 7-M.0M11I TCTCCATATCTaCCTrGGAGAaTCTCSTGCAeCACCTSATCQGGCTeAGGAATCTGAGCCACGTeC

PSI «M.X3Î25 GCCCTCCCAGraTiKAAATAAOGGCTGCTCTnCOACGACACGGTTCGTGGGlïrccCCTQGrGCrrCTATCCTAATACCATCÛACe «ACS1C «74.369219 GAA.CTTCTfGAeCACGAÛCATACCCAS0GCnCATAATCACCTTCTGTrCAaCA£7AGATQATO'nClTÛG3GCT5SA RII «74.000321 CCAAGCCCTTTtCAAGTTTCCTAGTTCACCCTTACGGATTCCTGGAGGÛAACATCTATATTTCTICCCCTGAAGtTGTCC RI21 ««4.012221 CCAGACGAGCGATTAGAAGCGGCAGCÏTGT3AGGÎGAATGAÎTTGûGGGAAGAGGAQGAGGA0GAAGAGGAGCA S7K1S «K001GM CATCTTüCAGGAGGACCACîCTCiGÎûGÙACCCTGGACÏACCraCCCCCTGAAATCATrGAA.GGïeiio*

STMfl ««4.305940 CCTGGAGGCTGOAACATACSTCAATCOTOHîeCAlîGcwiîATCCTCÇTGAALGCCeTTncWAeSACTGCTATCeTCCAAAGCCA'niïTA

CA 02829472 2013-10-03

Table 5B

SURV m4_0CUSi TGTTTTGATTCGCGSSCTTACCAGGTGAGAaGTGAeGSAGGAAeAAOGCAGÏGÎCCCTTTfSCTAGAGCraACAGtÎÎTG TBP NW_00aiM GCCGGAAACGGCGAATATAATCCCMGGGGTTTGGTGCGGTAATCATGAGGATMGAGAGCGAGG' .

TGFA N MJK3226 GGTGTBGCACAGaCCTTCCTACTTGGCGTGTAATCACGTGTGCAGCCTTTTGTGGGGCTTCAAAACTGTGTCAAGAAGTCCGT TWP1 MbLOCJKt TCGGTGCGGTCCCAGatAiGCCTGAA'TCCTGCCCGGAGTGGAACTGAaGCCTGCACAGTGTCCACCCTGTTCGCAC T0P1A NMJXlÛt? AATKAAGGGGGACAGTGATGAOTCCATATGSAGTTTGACTCAGCTSrGGCTCCTCGGGCAAAATCTGTAC ΤΟΡίΒ nmJWIMI TGTGaACATCrrCCCCTCAGACTrCCCTACTGAGCCACCTrcrCTGÛCACGMCCGGTCGGGCTAG TP ΝΜ,ΟΟΙίίΐ CTATATGOAGCCAGAGATGTGAÛAGCCACCGTGGACAGCCTGCCACTCATCACASCGÏCCaTTCTûAûTaa&AAACTCGTGG TPS3BP2 ΝΜ,ΟΟΜίΒ GGGCCAAATATTCAGAAGCTTTTATATCAGAGiiACCACCATAGGGGGCATGGAGACCATGTCTGTCCCATÇATAÇGCATCG TRAIL NMjOMIÛ CTTCACAGTGCTGCTGCAGTCrCTGTOTÎÏTGGCTGTAACTTAGGTGTACTrTACCAACGAGCTGAAGCAGATG Ta GCCTGeGTGTaSCrTCMCATCGGCAÛCTAOC-OCCTGCTCACGTACATGATTGùaCACATCACG upa WAJSæSÎ GTOGATGTGCCCTGMGGACMGCÇAGGCGTCTACACGrtGAGTCTÏACACTTCTTSCCCTGGATCCGCAG VDH NM 00tH7e GCCCTGGATTTCAGAAAGAQÇGAAGTCTiiGATCTGGGACCCTTTCCTTGCTTGCGTGÛCTTGTAACT VÊGF NMJX3Ï376 GTGCrGTCTTGGGTGCATTGGAGCCTrGCCTTGCTGGTCTACCTGCAGCATGCCAAÛTGGTCCCAGGCTGG VEGF* .NMJJ0MT7 TGAGGATGGGGTGGAGTGTGTGCCGACTGGGGAGCAGCAAGTGGGGATGGaGATGGTGATGATGGGGTACG WlSPI NM_Q03M2 AGAGGCATCCATGAACTTCACACTTGCGGSCTGCATCAGCACACGCTCCTATCAACCCAAGTACTGTGGAGTTTG XIAP MM_00I1S7 aCAGTTGGAAGACAEAGGAAAaTATCCCCAAAnGCAGATTTATCAACGGGmTATCnGAAMTAOTGCCACGCA TB-1 (tfH^OOt559 jWACTGTGGAiinTSATGTTGTTGMSGAGAMAGGGTGGSGACGGAGCMATC-lTACAGGTCCTCaTütTGTTÎC ZHF217 NMJX15S2G ACCCAOTAGCMGSAGAAGCCCACTCACTGCTCCGAGTeCGGCAAAGC TÎTCAGAACCTACCACCAGCTG

CA 02829472 2013-10-03

Table 6A

<td> Gene Α1Β1</td><td> Accession NM_005534</td><td> Probe Name 519S4/A1B1.I3</td><td> Set) ten GCGGCGAGTTTCCGATTTA ’</td><td> 19</td>

<td> AIB1</td><td> NM_0G6S34</td><td> Sl895/AIB1.r3</td><td> TÛAGTCCACCATCCAGCAAGT</td><td> 21</td>

<td> AIB1</td><td> NM 005534</td><td> 55055/4131.p3</td><td> ATGG CGGCGGGAGGATCAAAA</td><td> 21</td>

<td> ΑΚΠ</td><td> NMJJ05163</td><td> SÛ01Û/AKT1.Î3</td><td> cgcttctatggggctgagat</td><td> ’ 20</td>

<td> AKT1</td><td> NM_005163</td><td> S0012/AKT1.r3</td><td> tcccggtacaccacgttctt</td><td> 20</td>

<td> AKTt</td><td> NM 005163</td><td> S4776/AKT1.p3</td><td> CAGCCCTGGACTACCTGCACTCGG</td><td> 24</td>

<td> AKT2</td><td> NM 001626</td><td> S032S/AKT2.f3 </td><td> TCCTGCCACCCTTCAAACC</td><td> 19</td>

<td> ΑΚΤ2</td><td> NM_001626</td><td> SO029/AKT2.r3</td><td> GGCGGTAAATOATCATCâAA</td><td> 21</td>

<td> AK72</td><td> NMJ3Û1623</td><td> S4727/AKT2.p3</td><td> CAGGTCACGTCCGAGGTCGACACA .</td><td> 24</td>

<td> APÇ</td><td> MMJ30QG3S</td><td> S0022/APC.»</td><td> . GGACAGCAGGAATGTGTTTC</td><td> 20</td>

<td> APC</td><td> NM_000038</td><td> S0024/APC.r4</td><td> ACCCACTCGATKGTTTCTG</td><td> 20</td>

<td> ARC</td><td> NM_Q00038</td><td> S4i88/APC.p4</td><td> CAJTGGCTCCCCGTGACCTCTA</td><td> 22</td>

<td> AREG</td><td> NMJ3Q1657</td><td> S002S/AR£G.f2</td><td> TGTGAGTGAAATGCCTfCTAGTAGTGA</td><td> 27</td>

<td> AREG</td><td> NMJ3Q1657</td><td> S0Q27/AR33.r2</td><td> TTGTGGTTCGTTATCATACTCTTCTGA</td><td> 27</td>

<td> AREG</td><td> NMJ3O1657</td><td> ' S4B89i/AREG.p2</td><td> CCGTCCTCGGGAGCCGACTATGA</td><td> 23</td>

<td> 3-adirt</td><td> NM_001101</td><td> S0Q34/B-actl.f2-</td><td> CAGCAGATGTG5ATCAGCAAG</td><td> 21</td>

<td> B-actin</td><td> -NmZooiioi</td><td> S0036/B-acti.r2</td><td> GCATTTGCGGTGGACGAT</td><td> 16</td>

<td> B-actin</td><td> NM_001101</td><td> S4730/B-acti.p2</td><td> AGGAGÎATGACGAGTCCGGCCCC</td><td> 23</td>

<td> B-Catenln</td><td> NMJM1904</td><td> S2150/B-Cate.f3</td><td> GGCTCTTGTGCGTACTGTCCTT</td><td> 22</td>

<td> B-Catenin</td><td> NM_001904</td><td> S2l51/B-Cale.f3</td><td> TCAGATGACGAAGAGCACAGATG</td><td> 23</td>

<td> B-Catenin</td><td> NM_Q01904</td><td> ' S5046/B-Cata.p3</td><td> AGGCTCAGTGATGTCTTCCCTGTCACCAG ·</td><td> 29</td>

<td> BAD</td><td> NMJ3329Q9</td><td> S2Û11/BAD.Î1</td><td> GGGTCAGGTGCCTCGAGAT</td><td> 19</td>

<td> BAD</td><td> NM_032969</td><td> S2012/BAD.r1</td><td> CTGCTCACTCGGCTCAAACTC</td><td> 21</td>

<td> BAD</td><td> .NM_032969</td><td> ' SEC5fi/BAD.p1 ,</td><td> TGGGCCCAGAGCATGTTCCAGATC </td><td> 24</td>

<td> BAG1</td><td> NM 004323</td><td> S1386JBAG1J2 ·</td><td> , CGTTGTCAGCACTTGGAATACAA *</td><td> 23</td>

<td> BAG1</td><td> NM_004323</td><td> S1367/BAG1.r2</td><td> gttcaacctcttcctgtggactgt</td><td> 24</td>

<td> BAG1</td><td> . NMJ3Q4323</td><td> S4731/BAG1.p2 ·</td><td> CCCAATTAACATGACCCGGCAACCAT</td><td> 26</td>

<td> BBC3</td><td> NM_014417</td><td> S1584/BBC3.12</td><td> CCTGGAGGGTCCTGTACAAT '</td><td> 20</td>

<td> 0BC3</td><td> NM_Q14417</td><td> 51SS5/B3C3.r2 '</td><td> ' CTAATT3GGCTCCATCTCG</td><td> 19</td>

<td> BBC3</td><td> NMJD14417</td><td> S489Q®BC3.p2</td><td> CATCATGGGACTCCTGCCCTTACC </td><td> 24</td>

<td> 3cl2 .</td><td> ΝΜ_3ΟΟΘ33</td><td> S0043/Bd2.J2</td><td> CAGATGGACCTAGTACCCACTGAGA</td><td> 25</td>

<td> Bc)2</td><td> NMJ3OO633</td><td> S0045/Bd2.r2</td><td> CCIAl GA I l IAAGÜGCAI11 1 ICC ·-</td><td> 24</td>

<td> Bd2</td><td> NM_000633</td><td> S4732/Bd2.p2</td><td> TTCCACGCCGAAGGACAGCGAT ’</td><td> 22</td>

<td> CA9</td><td> NMJ3Q121S</td><td> S139B/CA9.Î3</td><td> ATCCTAGCCCTGGTTTTTGG</td><td> .20</td>

<td> CA9,</td><td> NMJ001216</td><td> S1399/CA9.r3</td><td> CTGCCTTCTCATCTGCACM</td><td> 20</td>

<td> CA9'</td><td> NMJM1216</td><td> S4S3B/CA9.p3</td><td> TTTGGTGTCACCAGCGTCGC</td><td> 20</td>

<td> CCNB1</td><td> ΝΜ__Ο31βθ6</td><td> S172O/CCNBl.f2</td><td> TTCAGGÏTGTTGCAGGAGAC .</td><td> 20</td>

<td> CCNB1</td><td> NM_031966</td><td> S1721/CCNB1.12</td><td> CATCTTCTTGGGCACACMT</td><td> 20</td>

<td> CCNB1</td><td> NM_O31906</td><td> S4733/CCNB1.p2</td><td> TGTCTCCATTATTGATCGGTTCATGCA</td><td> 27</td>

<td> CCND1</td><td> NM 001756</td><td> SO358/CCND1.0</td><td> GCATGTTGGTGGGCTCTAAGA</td><td> 21</td>

<td> CCND1 .</td><td> NMJXJ1758</td><td> S0060/CCND1 ,r3</td><td> CGGTGTAGATGCACAGCTTCTC</td><td> 22</td>

<td> CCND1 .</td><td> NM_001758</td><td> S49867CCND1 .p3</td><td> AAGGAGACCATCCCCCTGACGGC</td><td> 23</td>

<td> CCNE1</td><td> NMJM1298</td><td> S1446/CCNE1H</td><td> ' AAAGMGATGATGA.CCGGGTTTAC</td><td> 24</td>

<td> CCNE1</td><td> NM_001238</td><td> . S1447/CCNE1.rt</td><td> GAGCCTCTGGATGGTGGAAT</td><td> 20</td>

<td> CCNE1</td><td> NM_OO1230</td><td> S4944/CCNE1.p1</td><td> CAAACTCAACGTGCAAGCCTCGGA</td><td> 24</td>

<td> CCNE2</td><td> NM_05774S</td><td> Sl45fl/CCNE2.f2</td><td> atgctgtggctccttcctaact</td><td> 22</td>

<td> CCNE2</td><td> NM_057749</td><td> S1459/CCNE2.r£</td><td> acccaaattgtgatatacaaaaaggtt</td><td> 27</td>

<td> CGNE2</td><td> NMJ357749</td><td> 54945/CCNc2.p2</td><td> taccaagcaacctacatgtcaagaaagccc</td><td> 30</td>

<td> CD3i</td><td> NM 000734</td><td> S0064ZCD3i.fi</td><td> agatgaagtggaaggcgctt</td><td> 20</td>

<td> CD3z</td><td> NMJM0734</td><td> S00Se/CD3Lr1</td><td> tgcctctgtaatcggcaactg</td><td> 21</td>

<td> CD3i</td><td> NMJ300734</td><td> S4968/CD3c.p1</td><td> cagcgcggccatcctgga</td><td> 16</td>

<td> CD66</td><td> NM_001Z51</td><td> S0067/CD68.f2</td><td> tggttcccagccctgtgt</td><td> 18</td>

<td> CD66</td><td> NMJD01251</td><td> 50069/CO63.r2</td><td> CTCCTCCACCCTGGGTrGT</td><td> 19</td>

<td> CO68</td><td> NM_001251</td><td> S4734/CD68.p2</td><td> ctccaagcccagattcagattggagtga</td><td> 23</td>

<td> CDS</td><td> NMJ301759</td><td> S0686/CD9.f1</td><td> GGGCGTGGAACAGTTTATCT</td><td> 20</td>

<td> CD9</td><td> NMJ001769</td><td> S06B7/CD9.rt</td><td> cacggtgaaggtttcgagt</td><td> 19</td>

<td> CDS</td><td> NM_0017S9</td><td> S4792/CD9.p1</td><td> agacatctgccccaagaaggacgt</td><td> 24</td>

<td> CDH1</td><td> NM_0043S0</td><td> S0073/CDH1.I3</td><td> tgagtgtcccccggtatcttc</td><td> 21</td>

<td> CDH1</td><td> NM_004360</td><td> S0075/CDH1,r3</td><td> CAGCCGCTTTCAGATTTTCAT</td><td> 21</td>

<td> com</td><td> NMJM436Q</td><td> S4990/COH1.p3</td><td> tgccaatcccgatgaaattggaaattt</td><td> 27</td>

<td> CEGP1</td><td> Nf<020974</td><td> S1434/CEGP1J2</td><td> tgacaatcagcacacctgcat</td><td> 21</td>

CA 02829472 2013-10-03

Table 6B

<td> CÊGP1</td><td> MM ¢320974</td><td> S1405/CSGP1.r2</td><td> TGTGACTACAGCCGTGAÏCCTTA</td><td> 23 ·</td>

<td> CEGP1</td><td> NM„020974</td><td> S4735/C£GP1.p2</td><td> CAGGCCCTCTTCCGAGCGGT</td><td> 20</td>

<td> Chkl</td><td> NMJ3Q1274</td><td> S1422/ChktC</td><td> GATAAATTGGTACAAGGGATCAGCT7</td><td> 26</td>

<td> Chkl</td><td> NM_001274</td><td> S1423Ok1.r2</td><td> ' GGGTGCCAAGTAACTGACTATTCA</td><td> 24</td>

<td> Chkl</td><td> NMJ301274</td><td> $4941/Chk1.p2</td><td> CCAGCCCACATGTCCTGATCATATGC</td><td> 26</td>

<td> C1AP1</td><td> MM_001166 .</td><td> G0764/C1AP1J2</td><td> TGCCTGTGGTGGGAAGCT</td><td> 18</td>

<td> C1AP1</td><td> NMjxmee</td><td> SO705/CIAP1.r2</td><td> GGAAAATGCCTCCGGTGTT</td><td> 19</td>

<td> CtAPI</td><td> NM_0011S5</td><td> S4802/C1AP1.p2</td><td> TGACATAGCATCATCCTTTGGTTCCCAGTT</td><td> 30</td>

<td> c!AP2</td><td> NMJ3O1165</td><td> SOO76/clAP2,f2 ’</td><td> GGATATTTCCGTGGCTCTTATTCA</td><td> 24 .</td>

<td> C1AP2</td><td> NMJW1185</td><td> S0078/clAP2.r2</td><td> CTTCTCATCAAGGCAGAAAAATCTT .</td><td> 25</td>

<td> CIAP2</td><td> NMJ301165</td><td> S4991/CÎAP2.P2 ' '</td><td> TCTCCATCAAATCCTGTAAACTCCAGAGCA</td><td> 30</td>

<td> cMet</td><td> NMJXXJ245</td><td> SQO82/cMetf2 .</td><td> GACATTTCCAGTCCTGCAGTCA</td><td> 22</td>

<td> eMet</td><td> NM_000245</td><td> S0084/cMet.f2</td><td> CTCCGATCGCACACATTTGT</td><td> 20</td>

<td> cMerf</td><td> NMJJ00245</td><td> S4993/cMet.p2</td><td> TGCCTCTCTGCCCCACCCTTTGT</td><td> 23</td>

<td> Contig 27602</td><td> AK000618</td><td> $2S33/Contig.T3</td><td> GGCATCCTGGCCCAAAGT</td><td> 13'</td>

<td> Contig 27682</td><td> AK0Q0S18-</td><td> S2634/Contig.r3</td><td> GACCCCCTCAGCTGGTAGTTG</td><td> 21</td>

<td> Contig 27882</td><td> AK000618 .</td><td> S4977/Contig.p3</td><td> CCCAAATCCAGGCGGCTAGAGGC</td><td> 23</td>

<td> COX2</td><td> NM_000963</td><td> S0088/COX2.Î1</td><td> TCTGCAGAGTTGGAAGCACTCTA</td><td> 23</td>

<td> C0X2</td><td> NM_000963</td><td> S0Q90/CÛX2.r1</td><td> GGCGAGGCTTTTCTACCAGAA</td><td> 21</td>

<td> COX2</td><td> NM_000963</td><td> S4905/COX2.p1 </td><td> CAGGATACAGCTCCACAGCATCGATGTC ,</td><td> . 28</td>

<td> CTSL</td><td> NM_0Q1312</td><td> S1303/CTSL12</td><td> GGGAGGCTTATCTCACTGAGTGA .</td><td> 23</td>

<td> CTSL</td><td> NMJM1B12</td><td> Sl3CWCTSLr2</td><td> CCATTGCAGCCTTCATTGC</td><td> 19</td>

<td> CTSL</td><td> MMJ3O1912 </td><td> S489WCTSLp2</td><td> TTGAGGCCCAGAGCAGTCTACCAGATTCT</td><td> 29</td>

<td> CTSL2</td><td> NM 001333</td><td> . S4354/CTSL2.Î1</td><td> TGTCTCACTGAGCGAGCAGAA</td><td> 21</td>

<td> CTSL2</td><td> .NM 001333</td><td> ‘ S4355/CTSL2.ri</td><td> ACCATTGCAGCCCTGAKG</td><td> 19</td>

<td> CTSL2</td><td> ' NMJM1333</td><td> S4350ffiTSUp1</td><td> CTTGAGGACGÇGAACAGTCCACCA</td><td> 24</td>

<td> DAPK1</td><td> .NMJ304B38</td><td> . S1760/DAPK1.I3</td><td> CGCTGACATCATGAATGTTCCT</td><td> 22 </td>

<td> DAPK1</td><td> NM_004933</td><td> S1789/OAPKtr3</td><td> TCTCTTTCAGCAACGATGTGTCTT</td><td> 24</td>

<td> ,DAPKi;</td><td> NM 004838</td><td> S4927/DAPKtp3</td><td> TCATATCCAAACTÇGCCTCCAGCCG</td><td> 25</td>

<td> DIABLO '</td><td> .NM 019887</td><td> SO8O0/OIA8LO.M</td><td> CACAATGÇCGGCTCTGAAG</td><td> 19</td>

<td> DIABLO '.</td><td> NM 0198B7</td><td> SOB09/DlA9LO.r1</td><td> ACACAAACACTGTCTGTACCTGAAGA</td><td> 26</td>

<td> DIABLO</td><td> NM 019887 '</td><td> S4813OABL0.p1</td><td> MGTTACGCTGCGCGACAGCCAA .</td><td> 23</td>

<td> ORS</td><td> NMJ)Q3fl42</td><td> S2561/OR5.G</td><td> CTCTGAGACAGTGCTTC SATGACT</td><td> 24 </td>

<td> DR5</td><td> NMJW3842</td><td> S2552/DR5.r2</td><td> ccatgaggcccaacttcct</td><td> 19</td>

<td> DR5</td><td> NMJ303842</td><td> S4979/DR5.p2</td><td> CAGACTTGGTGCCCTTTGACTCC</td><td> 23</td>

<td> EGFR</td><td> . NMJW5228 .</td><td> SÛ103ÆGFR.Î2</td><td> TGTCGATG GACTTCCAGAAC</td><td> 20</td>

<td> EGFR</td><td> NM_CG522S</td><td> S0105/EGFR.f2</td><td> attgggacagcttggatca</td><td> 19</td>

<td> EGFR</td><td> NM_00S228</td><td> S4909/EGFR,p2 ‘</td><td> CACCTGGGCAGCTGCCAA</td><td> 18 .</td>

<td> EIF4E</td><td> NM_OO1S60</td><td> S0106/EIF4E.f1</td><td> GATCTAAGATGGCGACTGTCGAA</td><td> 23</td>

<td> EIF4E</td><td> NMJ3O1S63 </td><td> S0108/BF4E.f-1 ‘</td><td> TTAGATTCCGTTTTCTCCTCTTCTG</td><td> 25</td>

<td> E1F4E</td><td> NMJJ01968</td><td> S5000/E1F4E.p1</td><td> ACCACCCCTACTCCTAATGCCCCGACT</td><td> 27</td>

<td> EMS1</td><td> NM~005231</td><td> 82663/9481.ft</td><td> GGCAGTGTCACTGAGTCCTTGA</td><td> 22</td>

<td> EMS1</td><td> NMJJ05231</td><td> S2664/EMS1.r1</td><td> TGCACTGTGCQTCCCAAT</td><td> 10</td>

<td> EMS1 </td><td> NM_005231 ’</td><td> S4956/EMS1.p1</td><td> ATCCTCCCCTGCCCCGCG</td><td> 18</td>

<td> EpCAM </td><td> NM_Q02354</td><td> Sl8O7/EpCAM,f1</td><td> GGGCCCTCCAGAACAATGAT</td><td> 20</td>

<td> EpCAM</td><td> NMJJ02354</td><td> S1808/EpCAMj1</td><td> TGCACTGCTTGGCCTTAAAGA</td><td> 21</td>

<td> EpCAM</td><td> NM '002354</td><td> S4S84/EpCAM.p1</td><td> ccgctctcatcgcagtcaggatcat</td><td> 25</td>

<td> EPHXl</td><td> NMJXW120</td><td> S186$/EPHX1J2</td><td> accgtaggctctgctctgaa ·</td><td> 20</td>

<td> ËPHX1</td><td> NM„QOQ12Q</td><td> S18S6/EPHXT.r2</td><td> TGGTCCAGGTGGAAAACTTC</td><td> 20</td>

<td> EPHXl ‘</td><td> NM 000120</td><td> S47S4fEPHX1.p2</td><td> AGGCAGCCAGACCCACAGGA</td><td> 20</td>

<td> ErbS3</td><td> NM 001982</td><td> S0112/EftoB3.fl</td><td> CGGTTATGTCATQCCAGATACAC</td><td> 23</td>

<td> ErbB3</td><td> NM_0C1932</td><td> S0114/Erb33,r1</td><td> GAACTGAGACCCACTGAAGAAAGG</td><td> . 24</td>

<td> ErbB3</td><td> NMJMJ1982</td><td> S5002/Erb93,p1 ·</td><td> cctcaaaggtactccctcctcccgg</td><td> 25</td>

<td> EstR1</td><td> NM 000125</td><td> S0115/EstR1.f1</td><td> CGTGGTGCCCCTCTATGAC</td><td> 19</td>

<td> Es|R1</td><td> NM 000125</td><td> S0117/E5tR1.r1 1</td><td> ggctagtgggcgcatgtag</td><td> 19</td>

<td> EstR1</td><td> NM 000125</td><td> S4737/EstR1.p1</td><td> ctggagatgctggacgccc</td><td> 19</td>

<td> FBX05</td><td> NM_012177</td><td> S2017/FBXG5.r1</td><td> GGATTGTAGAÇTGTCACCGAAATTC '</td><td> ' 25</td>

<td> FSXO5</td><td> NMJ312177</td><td> S2018/FBXO5,f1</td><td> GGCTATTCCTCATTTTCTCTACAAAGTG</td><td> 28</td>

<td> FBXO5</td><td> NM~O12177</td><td> - S50S1/FSXO5.p1</td><td> CCTCCAGGAGGCTACCTTCTTCATGTTCAC</td><td> .30</td>

<td> FGF10</td><td> NM_OO3862</td><td> S1665/FGF 18,/2</td><td> CGGTAGTCAAGTCCGGATCAA</td><td> 21</td>

<td> FGF18</td><td> NMJ5O3862</td><td> SiaSB/FGF.ia.f2</td><td> GCTTGCCTTTGCGGTTCA</td><td> 10</td>

<td> FGF1S</td><td> NM_003862</td><td> S4914/FGF1S.p2</td><td> CAAGGAGACGGAATTCTACCTGTGC '</td><td> 25</td>

CA 02829472 2013-10-03

Table 6C

<td> FGFR1</td><td> NM_023109'</td><td> SDB18/FGFR1.f3</td><td> CACGGGACATTCACCACATC</td><td> 20 ·</td>

<td> FGFR1</td><td> NM 023109</td><td> S0619/FGFR1.r3</td><td> gggtgccatccacttcaca</td><td> 13</td>

<td> FGFR1</td><td> NM 023109</td><td> 54fl16fFGFR1.p3</td><td> ATAAAAAGACAACCAACGGSCGACTGC</td><td> 27</td>

<td> FHIT</td><td> NM_002012</td><td> S2443/FHIT.f1</td><td> CCAGTGGAGCGCTTCCAT </td><td> 16'</td>

<td> FHIT</td><td> NM 002012</td><td> S2444/FHrr,ri</td><td> CTCTCTGGGTÇGTCTGAAACAA</td><td> 22</td>

<td> FHIT</td><td> NMJ502012'</td><td> S2445ZFHIT.p1 ·</td><td> TCGGCCACTTCATCAGGACGCAG</td><td> 23</td>

<td> FHIT</td><td> NMJ5O2G12 '</td><td> S4921/FHlT.pl '</td><td> . TCGGCCACTTCATCAGGACGCAG</td><td> 23</td>

<td> FRP1</td><td> NMJ303Û12</td><td> S1604/FRP1.I3</td><td> TTGGTACCTGTGGGTTAGCA</td><td> 20</td>

<td> FRP1</td><td> NM 003012</td><td> S130S/FRP1.f3</td><td> cacatccaaatgcaaactgg</td><td> 20</td>

<td> FRP1</td><td> NMJ5O3O12</td><td> S4983/FRP1,p3</td><td> TCCCCAGGGTAGAATTCAATCAGAGC</td><td> ' 26</td>

<td> G-Catenirt</td><td> NM_002230</td><td> S21S3ZG-Cate,f1</td><td> TCAGCAGCAAGGGCATCAT ' , .</td><td> 19</td>

<td> 6-Catenlfi</td><td> NMJ30223Û ’</td><td> S2154/G-Caie.r1</td><td> GGTGGTTTTCTTGAGCGTGTACT</td><td> 23</td>

<td> G-Calertln</td><td> NMJW223Q</td><td> S6044/G-Cate.pl</td><td> CGGCCGCAGGCCTCATCCT '</td><td> 19</td>

<td> gapdh</td><td> NMJ)0204e</td><td> S0374/GAPDH.11</td><td> ATTCCACCCATGGCAAATTC</td><td> 20</td>

<td> GAPDH</td><td> NMJ302Q46 </td><td> S0375/GAPDH.r1</td><td> GATGGGATTTCCATTGAÏ3ACA</td><td> 22</td>

<td> GAPDH</td><td> NM_002046</td><td> - S473fi/GAPDH,p1</td><td> CCGTTCTCAGCCTTGACGGTGC</td><td> 22</td>

<td> GATA3</td><td> NM~002051</td><td> S0127/GATA3.I3</td><td> CAAAGGAGCTCACTGTGGTGTCT</td><td> 23</td>

<td> GATA3</td><td> NM_002051</td><td> S0129/GATA3.r3</td><td> gagtcagaatggcttattcacagatg '</td><td> 26</td>

<td> GATA3</td><td> NM_002051</td><td> S5005/GATA3.p3</td><td> TGTTCCAACCACTGAATCTGGACC</td><td> 24</td>

<td> GR37</td><td> NM_005310</td><td> S0130/GRB7.f2</td><td> CCATCTGCATCCATCTTGTT</td><td> 20</td>

<td> GRB7</td><td> NM_00S3Î0</td><td> SO132/GR07.f2</td><td> ggccaccagggtattatctg</td><td> 20</td>

<td> GRB7</td><td> Ν(/θΟ531Ο</td><td> S4726/GRB7.p2</td><td> CTCCCCACCCTTGAGAAGTGCCT</td><td> 23 .</td>

<td> GRCt</td><td> NMJ0015Ï1</td><td> SO1337GRO1Æ</td><td> CGAAAAGATGCTGAACAGTGACA</td><td> 23</td>

<td> GRO1</td><td> NM_0Q1511</td><td> S0135/GRD1,r2</td><td> tcaggaacagccaccagtga</td><td> 20</td>

<td> GRO1</td><td> NMJM1511</td><td> S50Q6/GRO1.P2</td><td> CTTCCTCCTCCCTTCTGGÏCAGTTGGAT</td><td> 26</td>

<td> GSTM1 ,</td><td> • NM_0D0501</td><td> S2026/GSTM1,r1</td><td> GGCCCAGCTTGAATTrTTCA</td><td> 20</td>

<td> GSTM1</td><td> NMJM05S1 ·</td><td> S2027/GSTM1.Î1</td><td> AAGCTATGAGGAAAAGAAGTACACGAT</td><td> 27</td>

<td> GSTM1</td><td> NMJM0561</td><td> S4739/GSTO1.p1</td><td> ' tcagccactggcttctgtcataatcaggag</td><td> 30</td>

<td> GUS</td><td> NM_000181</td><td> S0139/GUS.f1</td><td> ccgactcagtagccaagtga</td><td> 20</td>

<td> GUS</td><td> NMJM0161</td><td> S0141/GUS.r1 .</td><td> cacgcaggtggtatcagtct</td><td> 20</td>

<td> GUS</td><td> NM_OQO1S1 .</td><td> S474G/GUS.p1 </td><td> TCAAGTAAACGGGCTGTTTTCCAAACA</td><td> 27</td>

<td> HER2</td><td> NM_004446</td><td> S0142/HER2.I3</td><td> CGGTGTGAGÀAGTGCAGCAA</td><td> 20</td>

<td> HER2</td><td> NM_00444S</td><td> S0144/HER2.r3</td><td> CCTCTCGCAAGTGCTCGAT</td><td> 19</td>

<td> HER2 </td><td> NM_00444fl</td><td> S4729/HER2.p3</td><td> CCAGACCATAGCACACTCGGGCAC</td><td> • 24</td>

<td> HIF1A</td><td> NM_001530</td><td> S1207/HIF1A.f3</td><td> TGAACATAAAGTCTGCAACATGGA</td><td> 24</td>

<td> HIF1A</td><td> NM 0Û1530</td><td> S1208/HtF1A.r3</td><td> TGAGGTTGGTTACTGTTGGTATCATATA</td><td> 25</td>

<td> HIF1A</td><td> NM 001530</td><td> S4753/HIF1A.p3</td><td> TTGCACTGCACAGGCCACATTCAC</td><td> 24</td>

<td> HNF3A</td><td> NM_004496</td><td> S014AW3A.fi</td><td> tccaggatgttagqaactgtgaag</td><td> 24</td>

<td> HNF3A</td><td> NM 004496</td><td> S0150/HNF3A.r1</td><td> GCGTGTCTGCGTAGTAGCTGTT</td><td> 22</td>

<td> HNF3A</td><td> NM_004496</td><td> S50MW3A.p1</td><td> AGTCGCTGGTTTCATGCCCTTCCA</td><td> 24</td>

<td> !O1</td><td> NM_002165</td><td> SC320Z101.Î1</td><td> AGAACCGCAAGGTGAGCAA</td><td> 19</td>

<td> ID1</td><td> NM 002195</td><td> $0321401.r(</td><td> TCCAACTGAAGGTCCCTGATG</td><td> 21</td>

<td> 101</td><td> NMJW21S6</td><td> S4832/ID1,p1 </td><td> TGGAGATTCTCCAGCACGTCATCGAC</td><td> ’ 26</td>

<td> IGF1</td><td> NMJ>0061fl</td><td> SO1544GF1.f2</td><td> TCCGGAGCTGTGATCTAAGGA</td><td> 21</td>

<td> IGF1</td><td> NM.00D618</td><td> S01S64GF1/2</td><td> CGGACAGAGCGAGCTGACTT</td><td> 20</td>

<td> IGF1</td><td> NM_0006J8</td><td> S501Q/!GF1,p2</td><td> tgtattgcgcacccctcaagcctg</td><td> 24</td>

<td> 1GF1R</td><td> NMJ5OO075</td><td> S1249/IGF1R,f3</td><td> GCATGGTAGCCGAAGATTTCA</td><td> 21</td>

<td> IGF1R</td><td> NMJW0875</td><td> S125Q/IGF1R.f3</td><td> TTTCCGGTAATAGTCTGTCTCATAGATATC</td><td> 30</td>

<td> IGF1R</td><td> NMJHJ0B75</td><td> S43B5/IGF1R.p3</td><td> CGCGTCATACCAAAATCTCCGATTTTGA</td><td> 26</td>

<td> IGFBP2</td><td> NM_000597</td><td> Sl128/iGFBP2.f1</td><td> GTGGACAGCACCATGAACA</td><td> 19</td>

<td> IGFBP2</td><td> NM_000597</td><td> S1129flGFBP2,d</td><td> CCTTCATACCCGACTTGAGG</td><td> 20</td>

<td> IGFBP2</td><td> NM_000597</td><td> S4637/IGF8P2.p1</td><td> CTTCCGGCCAGCACTGCCTC</td><td> 20</td>

<td> H.6</td><td> NM_000000</td><td> S07SQf!LSJ3</td><td> CCTGAACCTTCCAAAGATGG</td><td> 20</td>

<td> ILS</td><td> NMl_OOD0OC</td><td> S0761/IL6.r3</td><td> ACCAGGCAAGTCTCCTCATT</td><td> 20</td>

<td> IL6</td><td> NM_000600</td><td> S480Q/IL6.p3</td><td> CCAGATTGGAAGCATCCATCTnTTCA</td><td> 27·</td>

<td> IRS1</td><td> NM_005544</td><td> S1B43ARS1.Q</td><td> CCACAGCTCACCTTCTGTCA</td><td> 20</td>

<td> IRS1</td><td> NM_005544</td><td> 61&44ARS1.f3</td><td> cctcagtgccagtctcttcc</td><td> 20-</td>

<td> IRS1</td><td> NM_005544</td><td> SS050/IRS1.p3</td><td> TCCATCCCAGCTCCAGOCAG</td><td> 20</td>

<td> Kf67</td><td> NM_002417</td><td> S0436/Kj-57.f2</td><td> CGGACTTTGGGTGCGACTT</td><td> 19</td>

<td> KLS7</td><td> NM 002417</td><td> S0437fKi-S7.r2</td><td> TTACAACTCTTCCACTGGGACGAT</td><td> 24</td>

<td> KL67</td><td> NM 002417</td><td> S4741/K-67.p2</td><td> CCACTTGTCGAACCACCGCTCGT</td><td> 23</td>

<td> KLK10</td><td> NM 002776</td><td> S2624/KLK10,f3</td><td> GCCCAGAGGCTCCATCGT</td><td> 10</td>

CA 02829472 2013-10-03

Table 6D

<td> KLK10 .</td><td> NM_0Q2778</td><td> S2S25/KLK10.r3</td><td> ' CA3AGGTTTGAACAGTGCAGACA</td><td> 23</td>

<td> KLK10</td><td> . NM_002776</td><td> S4978ZKLK10,p3 </td><td> CCTCTTCCTCCCCAGTCGGCTGA</td><td> 23</td>

<td> KRT14</td><td> NM_000526</td><td> S1953ZKRT14.f1</td><td> GGCCTGCTGAGATCAAAGAC</td><td> 20</td>

<td> KRT14</td><td> NM_00052S</td><td> Sie54ZKRT14.f1</td><td> GTCCACTGTGGCTGTGAGAA</td><td> 20</td>

<td> KRT14 .</td><td> NMJJQQ526</td><td> S5037ZKRT14.pt</td><td> TGTTCCfCAGGTCCTCAATGGTCTTG</td><td> 26</td>

<td> KRT17</td><td> NM 000422</td><td> S0172ZKRT17.Î2</td><td> CGAGGATTGGTTCTTCAGCAA</td><td> 21</td>

<td> KRT17</td><td> MM_000422</td><td> S0174ZKRT17.r2</td><td> ACTCTGCACCAGCTCACTGTTG</td><td> 22</td>

<td> KRT17</td><td> NM_0004Z2</td><td> S5013ZKRT17.p2</td><td> CACCTCGCGGTTCAGTTCCTCTGT</td><td> 24</td>

<td> KRT18</td><td> NM.000224</td><td> S1710ZKRT18.f2</td><td> AGAGATCGAGGGTCTCAAGG</td><td> 20</td>

<td> KRT18</td><td> NM_00Q224</td><td> S1711ZKRT16/2</td><td> GGCCTTTTACTTCCTCTTCG</td><td> 20</td>

<td> KRT1S</td><td> NM_000224</td><td> S4762ZKRT18.p2</td><td> 1 Güt IUI (LJ lUftTuAAüALjÜAüU 1 uu</td><td> 27</td>

<td> KRT19</td><td> NM_002276</td><td> S151E/KRTtS.f3</td><td> tgagcggcagaatcaggagta</td><td> 21</td>

<td> KRT19</td><td> NM_002276</td><td> Sl516/KRT19.r3</td><td> TGCGGTAGGTGGCAATCTC</td><td> 19</td>

<td> KRÎ19</td><td> NM_002276</td><td> S4866ZKRT10.p3</td><td> ctcatggacatcaagtcgcggctg</td><td> 24</td>

<td> KRT5</td><td> NM_000424</td><td> S0176/KRT5.Î3</td><td> tcagtggagaaggagttgga</td><td> 20</td>

<td> KRT5</td><td> NM 00Ô424</td><td> S0177ZKRT5,r3</td><td> tgccatatccagaggaaaca</td><td> 20</td>

<td> KRT5</td><td> NMJW0424</td><td> S5016/KRTS.p3</td><td> ccagtcaacatctctgttgtcacaagca</td><td> 28</td>

<td> KRT0</td><td> , NM 002273</td><td> S25S8/KRT8.Î3 ’</td><td> ggatgaagcttacatgaacaaggtaga</td><td> 27</td>

<td> KRT8</td><td> NM_pQ2273</td><td> S2569/KRT8,r3</td><td> catataggtgcctgasgaagttgat</td><td> 25</td>

<td> KRT8</td><td> NM_W2273</td><td> S4952/KRT9.p3</td><td> cgtcggtcagcccttccaggc</td><td> 21</td>

<td> L0T1 variant 1</td><td> NM 002556</td><td> SÛS92Æ.OT1 v,f2 .</td><td> GGAAAGACCACCTGAAAAACCA</td><td> 22</td>

<td> L0T1 variant 1</td><td> NM 002656</td><td> S0693ZLOT1 v,r2</td><td> GTACTTCTTCCCACACTCCTCACA</td><td> 24</td>

<td> LOTI variant 1</td><td> NMJ3Q2656 ·</td><td> S4793ZLOT1 v.p2</td><td> ACCCACGACCCCAACAAAATÇGC</td><td> 23</td>

<td> Maspin</td><td> NMJ302639</td><td> S0835ZMaspifl.f2</td><td> CAGATCGCCACTTTGAGAACATT</td><td> 23</td>

<td> Maspin</td><td> NMJ3O2539</td><td> SO837/Maspln,r2</td><td> GGCAGCATTAACCACAAGGATT</td><td> 22</td>

<td> Maspin</td><td> NM 002539</td><td> -, S4835/Maspln,p2 .</td><td> . AGCTGACAACAGTGTGAACGACCAGACC '</td><td> 28</td>

<td> UCM2</td><td> NM_ÛO4526</td><td> S1602/MCM2X!</td><td> GACTTTTGCCCGCTACCTTTe</td><td> 21</td>

<td> MCM2 </td><td> NML0O4526</td><td> S16Q3ZMCM2.r2</td><td> gccactaactgcttcagtatgaagaq</td><td> 28</td>

<td> MCM2</td><td> NMJ3Q4526</td><td> S4900ZMCM2.p2</td><td> acagctcattgttgtcacgccgga</td><td> 24</td>

<td> MÇM3</td><td> NM_OD2388</td><td> S1524ZMCM3.f3.</td><td> ggagaacaatccccttgaga</td><td> 20</td>

<td> MCM3</td><td> NMJ102388</td><td> S1525ZMCM3.f3 '</td><td> atctcctggatggtgatggt</td><td> 20</td>

<td> MCM3</td><td> NM_00238E</td><td> S4870/MCM3.p3</td><td> TGGCCTTTCTGTCTACAAGGATCACCA</td><td> 27</td>

<td> MCMS '</td><td> NM_005916</td><td> S1704/MCM6.Î3</td><td> tgatggtcctatgtgtcacattca</td><td> 24</td>

<td> MCM6</td><td> NMJM591S</td><td> S1705/MCM6.r3</td><td> tgggacaggaaacacaccaa</td><td> 20</td>

<td> MCMS</td><td> NM„005915</td><td> S4919ZMCM6.p3</td><td> caggtttcataccaacacaggcttcagcac</td><td> 30</td>

<td> MDM2</td><td> NM_002392</td><td> S0830ZMDM2.f1 ·</td><td> CTACAGGGACGCCATCGAA</td><td> 19</td>

<td> MDM2</td><td> NMJ002392</td><td> S0831ZMDM2.r1</td><td> ATCCAACCAATCACCTGAATGTT</td><td> 23</td>

<td> MDM2</td><td> NMJJ02392</td><td> S4834ZMDM2.pl</td><td> CTTACACCAGCATCAAGATCCGG</td><td> 23</td>

<td> MMP9</td><td> NM_0M994</td><td> S0656ZMMP9.fi</td><td> GAGAACCAATCTCACCGACA ·</td><td> . 20</td>

<td> MMP9</td><td> NM_004994 .</td><td> S0657ZMMPS.rf</td><td> CACCCGAGTGTAACCATAGC ‘</td><td> 20</td>

<td> MMP9</td><td> NM_004994</td><td> S476QZMMP9.p1</td><td> ACAGGTATTCCTCTGCCAGCTGCC · </td><td> 24</td>

<td> MTA1</td><td> NMJJ04639</td><td> 323SB.rMTA1.f1</td><td> CCGCCCTCACCTGAAGAGA</td><td> 19</td>

<td> M7A1</td><td> ΝΜ_004689</td><td> S2370/MTA1.r1</td><td> GGAATAAGTTAGCCGCGCTTCT</td><td> 22</td>

<td> MTA1</td><td> NMJ304639</td><td> 64β65ΜΓΑ1.ρ1</td><td> CCCAGTGTCCGCGAAGGAGCG .</td><td> 21</td>

<td> MYBL2</td><td> NM_00243S</td><td> S3270ZMYSL2.f1</td><td> gccgagatcgccaagatg</td><td> IB</td>

<td> MYBL2</td><td> NM 002466</td><td> S3271ZMY8L2,r1</td><td> CTnTGATGGTAGAGTTCCAGTGATTC</td><td> 27</td>

<td> MYBL2</td><td> NM 002456</td><td> S4742ZMY9L2.p1</td><td> CAGCATTCTCTGTCCTCCCTGGCA -</td><td> 24</td>

<td> P14ARF</td><td> S78535</td><td> S2342/P14ARF,f1</td><td> CCCTCGTGCTGATGCTACT </td><td> 19</td>

<td> P14ARF</td><td> S78535</td><td> S2843/P14ARF.r1</td><td> CATCATGACCTGGTCTTCTAGG</td><td> 22</td>

<td> P14ARF</td><td> S78535</td><td> S4971/P14ARF.p1</td><td> GTGCCCTAGACGCTGGCTCCTC</td><td> 22</td>

<td>P27</td><td> NMJW4064</td><td> S0205Zp27.f3</td><td> CGGTGGACCACGAAGAGTTAA</td><td> 21</td>

<td> p27</td><td> NJ<004064</td><td> S02Q7/p27.f3</td><td> GGCTCGCCTCTTCCATGTC</td><td> 19</td>

<td> p27</td><td> NMJ304084</td><td> S4750/p27.p3</td><td> ÇÇCGGACTTGGAGAAGCACTGCA ,</td><td> 23</td>

<td> P53</td><td> NMJM054S</td><td> S0208ZP53.Î2</td><td> CTTTGAACCCTTGCTTGCAA</td><td> 20</td>

<td> P53</td><td> NM_QQQ54S</td><td> S021Q/P53.r2</td><td> CÇCGGGACAAAGCAAATG</td><td> 18</td>

<td> P53 ‘</td><td> NM_000548</td><td> S5065ZP53,p2</td><td> AAGTCCTGGGTGCTTCTGACGCACA</td><td> 25</td>

<td> ΡΑΠ</td><td> NM„0G0602</td><td> SQ211ZPAM.f3</td><td> CCGCAACGTGGTTTTCTCA</td><td> 19</td>

<td> PAI1</td><td> NM_000602</td><td> SQ213/PA11,r3</td><td> TGCTGGGTTTCTCCTCCTGTT</td><td> 21</td>

<td> PAU</td><td> Nf<000602</td><td> S50es/PAI1.p3</td><td> CTCGGTGTTGGCCATGCTCCAG</td><td> 22</td>

<td> POGFRb</td><td> NMJM26Q9</td><td> S1346ZPDGFRb,f3</td><td> CCAGCTCTCCTTCCAGCTAC</td><td> 20</td>

<td> PDGFRb</td><td> MMJ3026Q9</td><td> S1347ZPDGFRb.f3</td><td> GfeGTGGCTCTCACTTAGCTC</td><td> 20</td>

<td> PDGrRb</td><td> NM_00260Û</td><td> S4931ZPDGFRb.p3</td><td> ATCAATGTCCCTGTCCGAGTGCTG</td><td> 24</td>

CA 02829472 2013-10-03

Table 6E

<td> PI3KC2A</td><td> NM_0Q2645</td><td> S2020/PI3KC2.r1</td><td> ÇACA STAG CATTTTCTC CGC ATA '</td><td> 23</td>

<td> PI3KC2A</td><td> NMJÎ02645</td><td> S202WI3KC2.f1</td><td> ATACCAATCACCGCACAAACC -</td><td> 21</td>

<td> PI3KC2A</td><td> ,NM_002645</td><td> S5O82/PI3KC2,p1 </td><td> tgcgctgtgàctggacttaacaaatagcct</td><td> 30</td>

<td> PPM1D</td><td> NM~003620</td><td> S315S/PPM1DJ1</td><td> GCCATCCGCAAAGGCTTT </td><td> 10</td>

<td> PPM1D</td><td> NM~0Q3620</td><td> S31SQ/PPM10.ri</td><td> GGCÇATTCCGCCAGT7TC</td><td> 18</td>

<td> PPM1O </td><td> NMJJQ3620</td><td> S4858iPPM1D.p1</td><td> TCGCTTGTCACCTTGCCaTGTGG</td><td> 23</td>

<td> PR</td><td> NMÎ000926</td><td> S133S/PR.IS</td><td> QCATCAGGCTGTCATTATGG ,</td><td> . 20</td>

<td> PR</td><td> NM_000926</td><td> S1337/PR.r6</td><td> AGTAGTTGTGCTGCCCTTCC</td><td> 20</td>

<td> PR</td><td> NMJÎ00926</td><td> 34743/PR.p6</td><td> TSTCCTTACCTGTGGGAGCTGTAAGGTC</td><td> 20,</td>

<td> PRAME</td><td> NMJW6115</td><td> S198S/PRAME.Î3</td><td> TCTCCATATCTGCCTTGCAGAGT</td><td> 23</td>

<td> PRAME</td><td> NMJW6115</td><td> S1906/PRAME.f3</td><td> GCACGTGGGTCAGATTGCT</td><td> 19</td>

<td> PRAME</td><td> NM_006115</td><td> S4755/PRAME.P3</td><td> TCCTGCAGCACCTCATCGGGCT '</td><td> ‘ 22</td>

<td> pS2</td><td> ' NM_003225</td><td> SO241/pS2.fZ</td><td> GCCCTCCCAGTGTGCAAAT</td><td> 19</td>

<td> pS2</td><td> NM_003225</td><td> 30243/pS2.r2</td><td> CGTCGATGGTATTAGGÂTAGAAGCA</td><td> 25</td>

<td> pS2</td><td> NMJXB225</td><td> S5026ZpS2.p2</td><td> TGCTGTnCGACGACACCGTTCG</td><td> 23</td>

<td> RAD51C</td><td> NM_058216 </td><td> 52606ZRA051C.Î3</td><td> GAACTTCTTGAGCAGGAGCATACC</td><td> 24</td>

<td> RAD51C</td><td> NMJJ58216 ;</td><td> S26O7/RAD31C.r3</td><td> TCCACCCCCAAGAATATCATCTAGT</td><td> 25</td>

<td> RAD51C</td><td> ·. NM_06B216</td><td> S4764/RAD51C.p3</td><td> AGGGCTTCATAATCACCTTCTGTTC</td><td> 25</td>

<td> RB1</td><td> NMJM0321</td><td> G2700ZRB1.fi</td><td> CGAAGCCCTTACAAGTTTCC</td><td> 20</td>

<td> RB1</td><td> NMJW0321</td><td> . S27Q1/RBl.r1</td><td> GGACTCTTCAGGGGTGAAAT</td><td> 20</td>

<td> RBI</td><td> NM_000321</td><td> S4765ZRB1.pl</td><td> CÛCTTACGGATTCCTGGAGGGAAC</td><td> 24</td>

<td> RŒ1</td><td> NM 012231</td><td> S1320/RI21.ÎZ</td><td> CCAGACGAGCGATTAGAAGC</td><td> 20</td>

<td> RIZ1</td><td> NM 012231</td><td> S132VRIZ1.r2</td><td> TCCTCCTC11CCTCCTCCTC</td><td> 20</td>

<td> RI21 </td><td> NM 012231</td><td> S4701/R!Z1.p2</td><td> TGTGAGGTGAATGATTTGGGGGA</td><td> 23</td>

<td> STK15</td><td> NM 003600</td><td> 30794737X15.(2</td><td> CATCTTCCAGGAGGACCACT</td><td> 20</td>

<td> STK15</td><td> NM_003600</td><td> S0795/STW5.(2</td><td> TCeGACCTTCAATCATTTCA </td><td> . 20</td>

<td> STK15</td><td> • NM 003600 '</td><td> S47457STK1S.p2</td><td> CTCTGTGGCACCCTGGACTACCTG</td><td> 24</td>

<td> STMY3</td><td> NMJ305940 ·</td><td> S2Œ7/STMY3.Î3</td><td> CCTGGAGGCTGCAACATACC</td><td> 20</td>

<td> STMY3</td><td> NM 005940</td><td> S2O68/STMY3,r3</td><td> TACAATGGCTTTGGAGGATAGCA</td><td> 23</td>

<td> STMY3</td><td> NMJJQS94Q</td><td> S4746/STMY3.p3</td><td> ATÇCTCCTGAAGCCCTTTTCGCAGC </td><td> 25</td>

<td> SURV</td><td> NM 001166 '</td><td> S0259/SURV.Î2 </td><td> TGTTTTGATTCCCGGGCTTA</td><td> 20</td>

<td> SURV</td><td> NM 001168 .</td><td> S0281/SURV,r2</td><td> CAAA5CTGTGAGGTCTAGCAAAAG</td><td> 24</td>

<td> SURV</td><td> NM_001168</td><td> S4747/SURV.p2</td><td> TGCCTTCTTCCTCCCTCACT7CTCACCT</td><td> 28</td>

<td> tsp</td><td> NM 003194 -</td><td> SG262/TBP.fl</td><td> GCCCGAAACGCCGAATATA</td><td> 19</td>

<td> TSP</td><td> NM_0Q3194</td><td> S0264/TBP.n -</td><td> CGTGGCTCTCTTATCCTCATGAT'</td><td> 23</td>

<td> TBP</td><td> NM 003194</td><td> ’ S4751/TBP.p1</td><td> TACCGCAGCAAACCGCTTGGG</td><td> 21</td>

<td> TGFA</td><td> NM_003236 -,</td><td> SQ4B9/TGFAJ2 .</td><td> GGTGTGCCACAGACCTTCCT</td><td> 20</td>

<td> TGFA</td><td> NMJJQ3236</td><td> S04SO7TGFA.f2</td><td> acggagttcttgacagagttttga</td><td> 24</td>

<td> TGFA</td><td> NMJQ03236</td><td> • S476BZTGFA.p2</td><td> TTGGCCTGTAATCACCTGTGCAGCCTT</td><td> 27</td>

<td> TIMPt</td><td> NMJ0O3254</td><td> S16S5/TIMP1.(3 -</td><td> TCCCTGCGGTCCCAGATAG</td><td> 19.</td>

<td> T1MP1</td><td> NMJ303254</td><td> S16S57TIMP1.r3</td><td> GTGGGAACAGGGTGGACACT</td><td> 20</td>

<td> ΓΙΜΡ1</td><td> NM_003254</td><td> S4918/TIMP1.p3</td><td> ATCCTGCCCGGAGTGGAACTGAAGC</td><td> 25</td>

<td> ΤΟΡ2Α</td><td> NM 001067</td><td> S0271ZTOP2AJ4</td><td> AATCCAAGG3GGAGAGTGAT</td><td> 20</td>

<td> TOP2A</td><td> NMJM1Q67</td><td> 5Q2737T0P2A,r4</td><td> GTACAGATTTTGCCCGAGGA</td><td> 20</td>

<td> TOP2A</td><td> .NMJ3O1C67</td><td> S4777ZTOP2A,p4</td><td> CATATGGACTTTGACTCAGCTGTGGC</td><td> 26</td>

<td> TOP2B</td><td> NMJXJ1068</td><td> S0274/TOP2B.f2</td><td> tgtggacatcttcccctcaga</td><td> . 21</td>

<td> TOP2B </td><td> NMJ3Q1G6S</td><td> SOZ78/TOP2B.f2</td><td> CTAGCCCGACCGGTTCGT</td><td> 18</td>

<td> TOP2B</td><td> ΝΜ_00106β</td><td> 64778/TOP2B,p2</td><td> TTCCCTACTGAGCCACCnCTCTG</td><td> 24</td>

<td> TP</td><td> NMJXJ1953</td><td> S0277/TP.f3</td><td> CTATATGCAGCCAGAGATGTGACA</td><td> 24</td>

<td> TP</td><td> NM 001353</td><td> S027S/TP.f3</td><td> ccacgagtttcttactgasaatgg</td><td> 24</td>

<td> TP</td><td> NM 001953</td><td> S4779/TP,p3</td><td> ACAGCCTGCCACTCATCACAGCC</td><td> 23</td>

<td> TP53BR2</td><td> NM 005426</td><td> S1831/TP53BP,(2</td><td> GGGCCAAATATTCAGAAGC</td><td> 19</td>

<td> TP53BP2</td><td> NMJ3Q5426</td><td> 51932/ΤΡ53ΒΡ.Γ2</td><td> ggatgggtatgatgggacag</td><td> 20</td>

<td> TP53SP2</td><td> NM 005426</td><td> S5049/TP53BP.p2</td><td> CGACCATAGCGGCCAÏGGAG</td><td> 20</td>

<td> TRAIL</td><td> NMJ1Q3810</td><td> S2539/TRA1L fl</td><td> cttcacagtgctcctgcagtct</td><td> 22</td>

<td> TRAIL</td><td> NM„O0361O ·</td><td> S2540/TRAILri</td><td> catctgcttcagctcgttggt</td><td> . 21</td>

<td> TRAIL</td><td> ' Nm2o03610</td><td> S49S0/TRAIL.p1</td><td> AAGTACACGTAAGTTACAGCCACACA</td><td> 26</td>

<td> TS</td><td> NMJW1O71</td><td> SO28OZTS.fi</td><td> GCCTCGGTGTGCCTTTCA</td><td> 18</td>

<td> TS</td><td> NMJ5O1O71</td><td> SO282/TS.rt</td><td> CGTGATGTGCGGAATCATG</td><td> 19</td>

<td> TS</td><td> NMJJ01071</td><td> S478QZTS.p1</td><td> CATCGCCAGCTACGCCCTGCTC</td><td> 22</td>

<td> upa</td><td> NM„OO205S</td><td> S0283Aipa.f3</td><td> GTGGATGTGCCCTGAAGGA</td><td> 13</td>

<td> ups</td><td> NM 002550</td><td> S0285/upa,r3</td><td> CTGCGGATCCAGGGTAAGAA '</td><td> 20</td>

CA 02829472 2013-10-03

Table 6F

<td> upa</td><td> NM_CO2658</td><td> S4769/upa.p3</td><td> aagccaggcgtctacacgagagtctcac</td><td> 28</td>

<td> VDR ·</td><td> NMJ00376</td><td> S2745/VDR.f2</td><td> GCCCTGGATTTCAGAAAGAQ</td><td> 20</td>

<td> VDR</td><td> NM__000376</td><td> S2746A/OR.f2</td><td> agttacaagccagggaagga</td><td> 20</td>

<td> VDR</td><td> NMJ00376</td><td> S4962A/DR.p2</td><td> CAAGTCTGGATCTGGGACCCTTTCC</td><td> 25</td>

<td> VEGF</td><td> NM_003376</td><td> S0286/VEGFJ1</td><td> CTGCTGTCTTGGGTGCATTG</td><td> 20</td>

<td> VEGF</td><td> NMJ30337S</td><td> SO20B/VEGF.rl</td><td> GCAGCCTGGGACCACTTG .</td><td> 19</td>

<td> VEGF</td><td> NM_QO3376 </td><td> S47B2/VEGF.p1</td><td> TTGCCTTGCTGCTCTACCTCCACCA</td><td> 25</td>

<td> VÊGF3</td><td> NM_Û03377</td><td> S2724/VEGF3.M</td><td> TGACGATGGCCTGGAGTGT ’</td><td> 19</td>

<td> VEGFS</td><td> NM_G03377</td><td> 52725/VEGFB.rl</td><td> GGTACCGGATCATGAGGATCTG</td><td> 22</td>

<td> VEGFB </td><td> NMJM337.7</td><td> S496OTEGF8.pl</td><td> CTGGGCAGCACCAAGTCCGÛA</td><td> 24</td>

<td> WISP1</td><td> NMJJO3062</td><td> S1671WISPl.il</td><td> agaggcatccatgmcttcaca</td><td> 22</td>

<td> WISP1</td><td> NM_0036B2</td><td> S1672WISP1 .Π</td><td> CAMCTCCACAGTACTTGGGTTGA</td><td> 24</td>

<td> WlSPI</td><td> NM_CQ3832</td><td> ' S4B15WISP1.p1</td><td> CGGGCTGCATCaGCACACGC</td><td> 20</td>

<td> XIAP</td><td> NMJJÛ1167</td><td> S02B9/XIAP.11 </td><td> gcagttggaagagacaggaaagt</td><td> . 23</td>

<td> XIAP</td><td> NM 001167</td><td> SG2Sl/XIAP.r1</td><td> TGCGTGGCACTATTTrCAAGA</td><td> 21</td>

<td> XIAP</td><td> NM 001167</td><td> S4752/X!AP,p1</td><td> TCCCCAAATTGCAGATTrATCAACGGC</td><td> 27</td>

<td> VB-1</td><td> NM__004559</td><td> S1194/YB-1.Î2 .</td><td> AGACTGTGGAGTTTGATGTTGTTGA</td><td> 25</td>

<td> YB-1</td><td> •NM 004559</td><td> Q1195ZYB-1.r2</td><td> GGAACACCACCAGGACCÎGTAA</td><td> 22</td>

<td> YB-1</td><td> NM 004559</td><td> S4843/YB-1.p2</td><td> TTGCTGCCTCCGCACCCTTTrCT</td><td> 23</td>

<td> ZNF217</td><td> NM_00S523 ·</td><td> S2739/ZNF217.f3</td><td> ACCCAGTAGCAAGGAGAAGC</td><td> 20</td>

<td> 2NF217</td><td> NM_OO652S</td><td> S2740/ZNF217.r3</td><td> CAGCTGGTGGTAGGTTCTGA</td><td> 20</td>

<td> ZNF217-</td><td> NM~OOe52S</td><td> S4961/ZNF217.p3</td><td> CACTCACTGCTCCGÀGTGCGG</td><td> 21</td>

CA 02829472 2013-10-03

DEMANDES OU BREVETS VOLUMINEUX

LA PRÉSENTE PARTIE DE CETTE DEMANDE OD CE BREVETS COMPREND PLUS DON TOME.

CECI EST LE TOME 1 DE 2

NOTE: Pour tes tomes additioneis, veillez contacter le Bureau Canadien des Brevets

JUMBO APPLICATIONS Z PATENTS

THIS SECTION OF THE APPLICATION f PATENT CONTAINS MORE THAN ONE VOLUME.

THIS IS VOLUME 1 OF 2

NOTE: For additional volumes piease contact the Canadian Patent Office

CA 02Θ29472 2013-10-03

DEMANDES OU BREVETS VOLUMINEUX

LA PRÉSENTE PARTIE DE CETTE DEMANDE OU CE BREVETS COMPREND PLUS D’UN TOME.

CECI EST LE TOME 2 DE 2

NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.

JUMBO APPLICATIONS / PATENTS

THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE THAN ONE VOLUME.

THIS ÏS VOLUME 2 OF 2

NOTE: For additional volumes please contact the Canadian Patent Office.

Contents45

53 members in 11 offices

This recordMember, by publication datePriority claim1 more office is in the list below

Priority claims9

Priority claims
Document	Office	Kind	Date
44086103	United States of America	P	2003-01-15
44086103	United States of America	P	2003-01-15
60440861	United States of America	–	2003-01-15
2513117	Canada	A	2004-01-14
2513117	Canada	A	2004-01-14
2513117	–	–	–
60440861	–	–	–
CA20042513117	–	–	–
US20030440861P	–	–	–

Members53

Family members, oldest first
Document	Office	Kind
AU2004205878A1	Australia	A1	2004-08-05
AU2004205878A8	Australia	A8	2004-08-05
CA2513117A1	Canada	A1	2004-08-05
CA2829472A1	Canada	A1	2004-08-05
CA2829476A1	Canada	A1	2004-08-05
CA2829477A1	Canada	A1	2004-08-05
CA3013889A1	Canada	A1	2004-08-05
WO2004065583A2	World Intellectual Property Organization (WIPO)	A2	2004-08-05
US2004209290A1	United States of America	A1	2004-10-21
US2004231909A1	United States of America	A1	2004-11-25
WO2004065583A3	World Intellectual Property Organization (WIPO)	A3	2005-03-03
EP1587957A2	European Patent Office (EPO)	A2	2005-10-26
JP2006516897A	Japan	A	2006-07-13
US7569345B2	United States of America	B2	2009-08-04
AU2004205878B2	Australia	B2	2009-08-27
AU2009238287A1	Australia	A1	2009-12-03
EP1587957B1	European Patent Office (EPO)	B1	2010-06-09
AT470723T	Austria	T	2010-06-15
DE602004027600D1	Germany	D1	2010-07-22
US2010222229A1	United States of America	A1	2010-09-02
EP2230318A1	European Patent Office (EPO)	A1	2010-09-22
EP2230319A2	European Patent Office (EPO)	A2	2010-09-22
DK1587957T3	Denmark	T3	2010-09-27
ES2346967T3	Spain	T3	2010-10-22
EP2230319A3	European Patent Office (EPO)	A3	2011-01-12
JP4723472B2	Japan	B2	2011-07-13
HK1148783A1	Hong Kong, China	A1	2011-09-16
US8034565B2	United States of America	B2	2011-10-11
US2011312532A1	United States of America	A1	2011-12-22
US8206919B2	United States of America	B2	2012-06-26
AU2009238287B2	Australia	B2	2012-06-28
AU2012206980A1	Australia	A1	2012-08-09
US2012225433A1	United States of America	A1	2012-09-06
CA2513117C	Canada	C	2014-02-25
US8741605B2	United States of America	B2	2014-06-03
US2014287421A1	United States of America	A1	2014-09-25
AU2012206980B2	Australia	B2	2015-02-05
AU2015202326A1	Australia	A1	2015-05-21
EP2230319B1	European Patent Office (EPO)	B1	2015-10-21
DK2230319T3	Denmark	T3	2016-01-25
ES2561179T3	Spain	T3	2016-02-24
EP3059322A1	European Patent Office (EPO)	A1	2016-08-24
AU2015202326B2	Australia	B2	2017-06-15
AU2017228522A1	Australia	A1	2017-09-28
US9944990B2	United States of America	B2	2018-04-17
CA2829476C	Canada	C	2018-07-10
CA2829477C	Canada	C	2018-07-10
CA2829472CThis record	Canada	C	2018-08-14
US2018230548A1	United States of America	A1	2018-08-16
EP3059322B1	European Patent Office (EPO)	B1	2019-04-10
DK3059322T3	Denmark	T3	2019-05-06
ES2725892T3	Spain	T3	2019-09-30
US11220715B2	United States of America	B2	2022-01-11

2 legal events, as the office reported them to INPADOC

Over the term

Point at a mark for the event

Events

Legal events, newest first
	Event	Code
2024-03-18	ExpiryMKEX	MKEX
2014-04-14	Examination requestEEER	EEER

Abstract

Term

CA 02029472 2013-10-03

CA 02829472 2013-10-03

C

CA 02829472 2013-10-03

WO 2004/065583

VEGFB;

LOTI;

CA9;

CA 02029472 2013-10-03 ( C

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

WO 2004/065583

CA 02829472 2013-10-03

WO 2004/065583

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

C

WO 2004/065583

C

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

CA 02829472 2013-10-03

DEMANDES OU BREVETS VOLUMINEUX

CECI EST LE TOME 1 DE 2

JUMBO APPLICATIONS Z PATENTS

THIS IS VOLUME 1 OF 2

DEMANDES OU BREVETS VOLUMINEUX

CECI EST LE TOME 2 DE 2

JUMBO APPLICATIONS / PATENTS

Priority claims9

Members53

Over the term

Events

Numbers

Titles2

Classification