Oligonucleotides which target and inhibit micrornas

Short oligonucleotides which incorporate LNA are known from the in vitro reagents area, (see for example W02005/098029 and WO 2006/069584). However the molecules designed for diagnostic or reagent use are very different in design than those for in vivo or pharmaceutical use. For example, the terminal nucleotides of the reagent oligos are typically not LNA, but DNA, and the intemucleoside linkages are typically other than phosphorothioate, the preferred linkage for use in the oligonucleotides of the present invention. The invention therefore provides for a novel class of oligonucleotides (referred to herein as oligomers) per se.

The following embodiments refer to certain embodiments of the oligomer of the invention, which may be used in a pharmaceutical composition. Aspects which refer to the oligomer may also refer to the contiguous nucleotide sequence, and vice versa.

The Oligomer

The oligomer of the invention is a single stranded oligonucleotide which comprises nucleotide analogues, such as LNA, which form part of, or the entire contiguous nucleotide sequence of the oligonucleotide. The nucleotide sequence of the oligomer consists of a contiguous nucleotide sequence.

The term “oligonucleotide” (or simply “oligo”), which is used interchangeably with the term “oligomer” refers, in the context of the present invention, to a molecule formed by covalent linkage of two or more nucleotides. When used in the context of the oligonucleotide of the invention (also referred to the single stranded oligonucleotide), the term “oligonucleotide” may have, in one embodiment, for example have between 7-10 nucleotides, such as in individual embodiments, 7, 8, 9, or 10.

The term ‘nucleotide’ refers to nucleotides, such as DNA and RNA, and nucleotide analogues. It should be recognised that, in some aspects, the term nucleobase may also be used to refer to a nucleotide which may be either naturally occurring or non-naturally occurring — in this respect the term nucleobase and nucleotide may be used interchangeably herein.

In some embodiments, the contiguous nucleotide sequence consists of 7 nucleotide analogues. In some embodiments, the contiguous nucleotide sequence consists of 8 nucleotide

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 analogues. In some embodiments, the contiguous nucleotide sequence consists of 9 nucleotide analogues.

In one embodiment at least about 50% of the nucleotides of the oligomer are nucleotide analogues, such as at least about 55%, such as at least about 60%, or at least about 65% or at least about 70%, such as at least about 75%, such as at least about 80%, such as at least about 85%, such as at least about 90%, such as at least about 95% or such as 100%. It will also be apparent that the oligonucleotide may comprise of a nucleotide sequence which consists of only nucleotide analogues. Suitably, the oligomer may comprise at least one LNA monomer, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 LNA monomers. As described below, the contiguous nucleotide sequence may consist only of LNA units (including linkage groups, such as phosphorothioate linkages), or may conists of LNA and DNA units, or LNA and other nucleotide analogues. In some embodiments, the contiguous nucleotide sequence comprises either one or two DNA nucleotides, the remainder of the nucleotides being nucleotide analogues, such as LNA unit.

In some embodiments, the contiguous nucleotide sequence consists of 6 nucleotide analogues and a single DNA nucleotide. In some embodiments, the contiguous nucleotide consists of 7 nucleotide analogues and a single DNA nucleotide. In some embodiments, the contiguous nucleotide sequence consists of 8 nucleotide analogues and a single DNA nucleotide. In some embodiments, the contiguous nucleotide sequence consists of 9 nucleotide analogues and a single DNA nucleotide. In some embodiments, the contiguous nucleotide sequence consists of 7 nucleotide analogues and two DNA nucleotides. In some embodiments, the contiguous nucleotide sequence consists of 8 nucleotide analogues and two DNA nucleotides.

The oligomer may consist of the contiguous nucleotide sequence.

In a specially preferred embodiment, all the nucleotide analogues are LNA In a further preferred embodiment, all nucleotides of the oligomer are LNA. In a further preferred embodiment, all nucleotides of the oligomer are LNA and all intemucleoside linkage groups are phosphothioate.

Herein, the term “nitrogenous base” is intended to cover purines and pyrimidines, such as the DNA nucleobases A, C, T and G, the RNA nucleobases A, G, U and G, as well as nonDNA/RNA nucleobases, such as 5-methylcytosine (^MeC), isocytosine, pseudoisocytosine, 5bromouracil, 5-propynyluracil, 5-propyny-6-fluoroluracil, 5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, 7-propyne-7-deazaadenine, 7-propyne-7deazaguanine and 2-chloro-6-aminopurine, in particular “θΟ. It will be understood that the actual selection of the non-DNA/RNA nucleobase will depend on the corresponding (or matching) nucleotide present in the microRNA strand which the oligonucleotide is intended to target For example, in case the corresponding nucleotide is G it will normally be necessary to select a

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 non-DNA/RNA nucleobase which is capable of establishing hydrogen bonds to G. In this specific case, where the corresponding nucleotide is G, a typical example of a preferred nonDNA/RNA nucleobase is ^MeC.

It should be recognised that the term in ‘one embodiment’ should not necessarily be limited to refer to one specific embodiment, but may refer to a feature which may be present in ‘some embodiments’, or even as a generic feature of the invention. Likewise, the use of the term ‘some emboidments’ may be used to describe a feature of one specific embodiment, or a collection of embodiments, or even as a generic feature of the invention.

The terms corresponding to and corresponds to refer to the comparison between the nucleotide sequence of the oligomer or contiguous nucleotide sequence (a first sequence) and the equivalent contiguous nucleotide sequence of a further sequence selected from either i) a sub-sequence of the reverse complement of the microRNA nucleic acid target (such as a microRNA target selected from SEQ ID 40 - SEQ ID 976, and/or ii) the sequence of nucleotides provided herein such as the group consisting of SEQ ID NO 977 — 1913, or SEQ ID NO 19142850, or SEQ ID NO 2851 - 3787. Nucleotide analogues are compared directly to their equivalent or corresponding nucleotides. A first sequence which corresponds to a further sequence under i) or ii) typically is identical to that sequence over the length of the first sequence (such as the contiguous nucleotide sequence).

When referring to the length of a nucleotide molecule as referred to herein, the length corresponds to the number of monomer units, i.e. nucleotides, irrespective as to whether those monomer units are nucleotides or nucleotide analogues. With respect to nucleotides or nucleobases, the terms monomer and unit are used interchangeably herein.

It should be understood that when the term “about” is used in the context of specific values or ranges of values, the disclosure should be read as to include the specific value or range referred to.

As used herein, “hybridisation” means hydrogen bonding, which may be Watson-Crick, Hoogsteen, reversed Hoogsteen hydrogen bonding, etc., between complementary nucleoside or nucleotide bases. The four nucleobases commonly found in DNA are G, A, T and C of which G pairs with C, and A pairs with T. In RNA T is replaced with uracil (U), which then pairs with A. The chemical groups in the nucleobases that participate in standard duplex formation constitute the Watson-Crick face. Hoogsteen showed a couple of years later that the purine nucleobases (G and A) in addition to their Watson-Crick face have a Hoogsteen face that can be recognised from the outside of a duplex, and used to bind pyrimidine oligonucleotides via hydrogen bonding, thereby forming a triple helix structure.

In the context of the present invention “complementary” refers to the capacity for precise pairing between two nucleotides sequences with one another. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 corresponding position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The DNA or RNA strand are considered complementary to each other when a sufficient number of nucleotides in the oligonucleotide can form hydrogen bonds with corresponding nucleotides in the target DNA or RNA to enable the formation of a stable complex. To be stable in vitro or in vivo the sequence of an oligonucleotide need not be 100% complementary to its target microRNA. The terms “complementary” and “specifically hybridisable” thus imply that the oligonucleotide binds sufficiently strong and specific to the target molecule to provide the desired interference with the normal function of the target whilst leaving the function of non-target RNAs unaffected. However, in one preferred embodiment the term complementary shall mean 100% complementary or fully complementary.

In a preferred example the oligonucleotide of the invention is 100% complementary to a miRNA sequence, such as a human microRNA sequence, or one of the microRNA sequences refered to herein.

In a preferred example, the oligonucleotide of the invention comprises a contiguous sequence, which is 100% complementary to the seed region of the human microRNA sequence.

Preferably, the term “microRNA” or “miRNA”, in the context of the present invention, means an RNA oligonucleotide consisting of between 18 to 25 nucleotides in length. In functional terms miRNAs are typically regulatory endogenous RNA molecules.

The terms “target microRNA” or “target miRNA” refer to a microRNA with a biological role in human disease, e.g. an upregulated, oncogenic miRNA or a tumor suppressor miRNA in cancer, thereby being a target for therapeutic intervention of the disease in question.

The terms “target gene” or “target mRNA” refer to regulatory mRNA targets of microRNAs, in which said “target gene” or “target mRNA” is regulated post-transcriptionally by the microRNA based on near-perfect or perfect complementarity between the miRNA and its target site resulting in target mRNA cleavage; or limited complementarity, often conferred to complementarity between the so-called seed sequence (nucleotides 2-7 of the miRNA) and the target site resulting in translational inhibition of the target mRNA.

In the context of the present invention the oligonucleotide is single stranded, this refers to the situation where the oligonucleotide is in the absence of a complementary oligonucleotide —

i.e. it is not a double stranded oligonucleotide complex, such as an siRNA. In one embodiment, the composition according ot the invention does not comprise a further oligonucleotide which has a region of complementarity with the oligomer of 5 or more, such as 6, 7, 8, 9, or 10 consecutive nucleotides, such as eight or more.

CA 02701547 2016-02-01

WO 2009/043353 PCT/DK2008/000344

Length

Surprisingly we have found that such short 'antimiRs' provide an improved specific inhibition of microRNAs in vivo, whilst retaining remarkable specificity for the microRNA target. A further benefit has been found to be the ability to inhibit several microRNAs simultaneously 5 due to the conservation of homologous short sequences between microRNA species — such as the seed regions as described herein. According to the present invention, it has been found that it is particularly advantageous to have short oligonucleotides of 7, 8, 9,10 nucleotides, such as 7, 8 or 9 nucleotides.

Sequences

The contiguous nucleotide sequence is complementary (such as 100% complementary i.e. perfectly complementary) to a corresponding region of a mammalian, human or viral microRNA (miRNA) sequence, preferably a human or viral miRNA sequence.

The microRNA sequence may suitably be a mature microRNA. In some embodiments the microRNA may be a microRNA precursor.

The human microRNA sequence may be selected from SEQ ID No 1 — 558 as disclosed in W02008/046911. As described in W02008/046911, these microRNAs are associated with cancer.

The viral microRNA sequence may, in some embodiments, be selected from the group consisting of Herpes simplex virus 1, Kaposi sarcoma-associated herpesvirus, Epstein Barr 20 virus and Human cytomegalovirus.

In one embodiment, the contiguous nucleotide sequence is complementary (such as 100% complementary) to a corresponding region of a miRNA sequence selected from the group of miRNAs listed in table 1. Table 1 provides 7mer, 8mer and 9mer oligomers which target human and viral microRNAs published in miRBase.

In some embodiments, the oligomers according to the invention may consist of or comprise a contiguous nucleotide sequence which is complementary to a corresponding microRNA sequence selected from the group consisting of miR-1, miR-10b, miR-17-3p, miR-18, miR-19a, miR-19b, miR-20, miR-21, miR-34a, miR-93, miR-106a, miR-106b, miR-122, miR-133, 30 miR-134, miR-138, miR-155, miR-192, miR-194, miR-221, miR-222, miR-375.

Therefore, in one embodiment, the miRNA (i.e target miRNA) is selected from the group consisting of miR-1, miR-10b, miR-17-3p, miR-18, miR-19a, miR-19b, miR-20, miR-21, miR34a, miR-93, miR-106a, miR-106b, miR-122, miR-133, miR-134, miR-138, miR-155, miR-192, miR-194, miR-221, miR-222, and miR-375.

In one embodiment, the miRNA target is a member of the miR 17-92 cluster, such as miR 17, miR 106a, miR 106b, miR 18, miR 19a, miR 19b/1, miR 19b/2, miR20/93, miR92/1, miR92/2 and miR25.

CA 02701547 2010-04-01

WO 2009/043353 PC17DK2008/000344

In some embodiments the contiguous nucleotide sequence is complementary to a corresponding region of a microRNA (miRNA) sequence selected from the group consisting of miR-21, miR-155, miR-221, mir-222, and mir-122.

In some embodiments said miRNA is selected from the group consisting of miR-1, miR10miR-29, miR-125b,miR-126, miR-133, miR-141, miR-143, miR-200b, miR-206, miR-208, miR302, miR-372, miR-373, miR-375, and miR-520c/e.

In some embodiments the contiguous nucleotide sequence is complementary to a corresponding region of a microRNA (miRNA) sequence present in the miR 17-92 cluster, such as a microRNA selected from the group consisting of miR-17-5p, miR-20a/b, miR-93, miR-106a/b, miR-18a/b, miR-19a/b, miR-25, miR-92a,, miR-363.

In one embodiment, the miRNA (i.e target miRNA) is miR-21, such as hsa-miR-21. In one embodiment, the miRNA (i.e target miRNA) is miR-122, such as hsa-miR-122. In one embodiment, the miRNA (i.e target miRNA) is miR-19b, such as hsa-miR-19b. In one embodiment, the miRNA (i.e target miRNA) is miR-155, such as hsa-miR-155. In one embodiment, the miRNA (i.e target miRNA) is miR-375, such as hsa-miR-375. In one embodiment, the miRNA (i.e target miRNA) is miR-375, such as hsa-miR-106b.

Suitably, the contiguous nucleotide sequence may be complementary to a corresponding region of the microRNA, such as a hsa-miR selected from the group consisting of 19b, 21,122, 155 and 375.

The Seed Region and Seedmers

The inventors have found that carefully designed short single stranded oligonucleotides comprising or consisting of nucleotide analogues, such as high affinity nucleotide analogues such as locked nucleic acid (LNA) units, show significant silencing of microRNAs, resulting in reduced microRNA levels. It was found that tight binding of said oligonucleotides to the socalled seed sequence, typically nucleotides 2 to 8 or 2 to 7, counting from the 5’ end, of the target microRNAs was important. Nucleotide 1 of the target microRNAs is a non-pairing base and is most likely hidden in a binding pocket in the Ago 2 protein. Whilst not wishing to be bound to a specific theory, the present inventors consider that by selecting the seed region sequences, particularly with oligonucleotides that comprise LNA, preferably LNA units in the region which is complementary to the seed region, the duplex between miRNA and oligonucleotide is particularly effective in targeting miRNAs, avoiding off target effects, and possibly providing a further feature which prevents RISC directed miRNA function.

The inventors have found that microRNA silencing is even more enhanced when LNAmodified single stranded oligonucleotides do not contain a nucleotide at the 3’ end corresponding to this non-paired nucleotide 1. It was further found that at least two LNA units in the 3’ end of the oligonucleotides according to the present invention made said oligonucleotides highly nuclease resistant.

CA 02701547 2010-04-01

WO 2009/043353 PC17DK2008/000344

In one embodiment, the first or second 3’ nucleotide of the oligomer corresponds to the second 5’ nucleotide of the microRNA sequence, and may be a nucleotide analogue, such as LNA.

In one embodiment, nucleotide units 1 to 6 (inclusive) of the oligomer as measured from the 3’ end the region of the oligomer are complementary to the microRNA seed region sequence, and may all be nucleotide analogues, such as LNA.

In one embodiment, nucleotide unite 1 to 7 (inclusive) of the oligomer as measured from the 3’ end the region of the oligomer are complementary to the microRNA seed region sequence, and may all be nucleotide analogues, such as LNA.

In one embodiment, nucleotide unite 2 to 7 (inclusive) of the oligomer as measured from the 3’ end the region of the oligomer are complementary to the microRNA seed region sequence, and may all be nucleotide analogues, such as LNA.

In one embodiment, the oligomer comprises at least one nucleotide analogue unit, such as at least one LNA unit, in a position which is within the region complementary to the miRNA seed region. The oligomer may, in one embodiment comprise at between one and 6 or between 1 and 7 nucleotide analogue units, such as between 1 and 6 and 1 and 7 LNA units, in a position which is within the region complementary to the miRNA seed region.

In one embodiment, the contiguous nucleotide sequence consists of or comprises a sequence which is complementary (such as 100% complementary) to the seed sequence of said microRNA.

In one embodiment, the contiguous nucleotide sequence consists of or comprises a sequence selected from any one of the seedmer sequences listed in table 1.

In one embodiment, the 3’ nucleotide of the seedmer forms the 3’ most nucleotide of the contiguous nucleotide sequence, wherein the contiguous nucleotide sequence may, optionally, comprise one or two further nucleotide 5’ to the seedmer sequence.

In one embodiment, the oligomer does not comprise a nucleotide which corresponds to the first nucleotide present in the microRNA sequence counted from the 5’ end.

In one embodiment, the oligonucleotide according to the invention does not comprise a nucleotide at the 3’ end that corresponds to the first 5’ end nucleotide of the target microRNA. Nucleotide Analogues

According to the present invention, it has been found that it is particularly advantageous to have short oligonucleotides of 7, 8, 9,10 nucleotides, such as 7, 8 or 9 nucleotides, wherein at least 50%, such as 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or such as 100% of the nucleotide units of the oligomer are (preferably high affinity) nucleotide analogues, such as a Locked Nucleic Acid (LNA) nucleotide unit.

In some embodiments, the oligonucleotide of the invention is 7, 8 or 9 nucleotides long, and comprises a contiguous nucleotide sequence which is complementary to a seed region of a

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 human or viral microRNA, and wherein at least 75 %, such as at least 80 %, such as at least 85%, such as at least 90%, such as at least 95%, such as 100% of the nucleotides are are Locked Nucleic Add (LNA) nucleotide units.

In such oligomers, in some embodiments, the linkage groups are other than phosphodiester linkages, such as are phosphorothioate linkages.

In one embodiment, all of the nucleotide units of the contiguous nucleotide sequence are LNA nucleotide units.

In one embodiment, the contiguous nucleotide sequence comprises or consists of 7, 8, 9 or 10, preferably contiguous, LNA nucleotide units.

In a further preferred embodiment, the oligonudeotide of the invention is 7, 8 or 9 nucleotides long, and comprises a contiguous nucleotide sequence which is complementary to a seed region of a human or viral microRNA, and wherein at least 80 % of the nucleotides are LNA, and wherein at least 80%, such as 85%, such as 90%, such as 95%, such as 100% of the intemucleotide bonds are phosphorothioate bonds. It will be recognised that the contiguous nucleotide sequence of the oligmer (a seedmer) may extend beyond the seed region.

In some embodiments, the oligonucleotide of the invention is 7 nucleotides long, which are all LNA.

In some embodiments, the oligonucleotide of the invention is 8 nucleotides long, of which up to 1 nucleotide may be other than LNA. In some embodiments, the oligonudeotide of the invention is 9 nudeotides long, of which up to 1 or 2 nudeotides may be other than LNA. In some embodiments, the oligonudeotide of the invention is 10 nudeotides long, of which 1, 2 or 3 nucleotides may be other than LNA. The nucleotides Other than LNA, may for example, be DNA, or a 2’ substituted nucleotide analogues.

High affinity nucleotide analogues are nudeotide analogues which result in oligonucleotides which has a higher thermal duplex stability with a complementary RNA nucleotide than the binding affinity of an equivalent DNA nucleotide. This may be determined by measuring the T_m.

In some embodiments, the nucleotide analogue units present in the contiguous nudeotide sequence are selected, optionally independently, from the group consisting of 2’-O_alkyl-RNA unit, 2-OMe-RNA unit, 2’-amino-DNA unit, 2’-fluoro-DNA unit, LNA unit, PNA unit, HNA unit, INA unit, and a 2’MOE RNA unit

In some embodiments, the nucleotide analogue units present in the contiguous nudeotide sequence are selected, optionally independently, from the group consisting of 2’-O_alkyl-RNA unit, 2’-OMe-RNA unit, 2’-amino-DNA unit, 2-fluoro-DNA unit, LNA unit, and a 2’MOE RNA unit.

The term 2’fluoro-DNA refers to a DNA analogue with a substitution to fluorine at the 2’ position (2’F). 2’fluoro-DNA is a preferred form of 2’fluoro-nucleotide.

CA 02701547 2010-04-01

WO 2009/043353 PC17DK2008/000344

In some embodiments, the oligomer comprises at least 4 nucleotide analogue units, such as at least 5 nucleotide analogue units, such as at least 6 nucleotide analogue units, such as at least 7 nucleotide analogue units, such as at least 8 nucleotide analogue units, such as at least 9 nucleotide analogue units, such as 10, nucleotide analogue units.

In one embodiment, the oligomer comprises at least 3 LNA units, such as at least 4 LNA units, such as at least 5 LNA units, such as at least 6 LNA units, such as at least 7 LNA units, such as at least 8 LNA units, such as at least 9 LNA units, such as 10 LNA.

In one embodiment wherein at least one of the nucleotide analogues, such as LNA units, is either cytosine or guanine, such as between 1 -10 of the of the nucleotide analogues, such as LNA units, is either cytosine or guanine, such as 2, 3, 4, 5, 6, 7, 8, or 9 of the of the nucleotide analogues, such as LNA units, is either cytosine or guanine.

In one embodiment at least two of the nucleotide analogues such as LNA units are either cytosine or guanine. In one embodiment at least three of the nucleotide analogues such as LNA units are either cytosine or guanine. In one embodiment at least four of the nucleotide analogues such as LNA units are either cytosine or guanine. In one embodiment at least five of the nucleotide analogues such as LNA units are either cytosine or guanine. In one embodiment at least six of the nucleotide analogues such as LNA units are either cytosine or guanine. In one embodiment at least seven of the nucleotide analogues such as LNA units are either cytosine or guanine. In one embodiment at least eight of the nucleotide analogues such as LNA units are either cytosine or guanine.

In a preferred embodiment the nucleotide analogues have a higher thermal duplex stability for a complementary RNA nucleotide than the binding affinity of an equivalent DNA nucleotide to said complementary RNA nucleotide.

In one embodiment, the nucleotide analogues confer enhanced serum stability to the single stranded oligonucleotide.

Whilst the specific SEQ IDs in the sequence listing and table 1 refer to oligomers of LNA monomers with phosphorothioate (PS) backbone, it will be recognised that the invention also encompasses the use of other nucleotide analogues and/or linkages, either as an alternative to, or in combination with LNA. As such, the sequence of nucleotides (bases) shown in the sequence listings may be of LNA such as LNA/PS, LNA or may be oligomers containing alternative backbone chemistry, such as sugar/linkage chemistry, whilst retaining the same base sequence (A, T, C or G).

Whilst it is envisaged that other nucleotide analogues, such as 2’-MOE RNA or 2’-fluoro nucleotides may be useful in the oligomers according to the invention, it is preferred that the oligomers have a high proportion, such as at least 50%, LNA. nucleotides.

The nucleotide analogue may be a DNA analogue such as a DNA analogue where the 2'-H group is substituted with a substitution other than -OH (RNA) e.g. by substitution with -O-CH₃, CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

O-CH2-CH2-O-CH3, -O-CH2-CH2-CH2-NH2, -O-CH2-CH2-CH2-OH or -F. The nucleotide analogue may be a RNA analogues such as a RNA analogue which have been modified in its 2’-OH group, e.g. by substitution with a group other than —H (DNA), for example -O-CH3, -OCH2-CH2-O-CH3, -O-CH2-CH2-CH2-NH2, -O-CH2-CH2-CH2-OH or -F. In one emdodiment the nucleotide analogue is “ENA”.

LNA

When used in the present context, the terms “LNA unit”, “LNA monomer”, “LNA residue”, “locked nucleic acid unit”, “locked nucleic acid monomer or “locked nucleic acid residue, refer to a bicyclic nucleoside analogue. LNA units are described in inter alia \NO 99/14226, WO 00/56746, WO 00/56748, WO 01/25248, WO 02/28875, WO 03/006475 and WO 03/095467. The LNA unit may also be defined with respect to its chemical formula. Thus, an “LNA unit”, as used herein, has the chemical structure shown in Scheme 1 below:

Scheme 1

<img file="CA2701547C_D0001.tif" />

<img file="CA2701547C_D0002.tif" />

wherein

X is selected from the group consisting of O, S and NR^H, where R^H is H or Ci-4-alkyl; Y is (-CH2)_r. where r is an integer of 1-4; and B is a nitrogenous base.

In a preferred embodiment of the invention, r is 1 or 2, in particular 1, i.e. a preferred LNA unit has the chemical structure shown in Scheme 2 below:

Scheme 2

<img file="CA2701547C_D0003.tif" />

<img file="CA2701547C_D0004.tif" />

wherein X and B are as defined above.

In an interesting embodiment, the LNA units incorporated in the oligonucleotides of the invention are independently selected from the group consisting of thio-LNA units, amino-LNA units and oxy-LNA units.

Thus, the thio-LNA unit may have the chemical structure shown in Scheme 3 below:

Scheme 3

CA 02701547 2010-04-01

WO 2009/043353

PCT7DK2008/000344

<img file="CA2701547C_D0005.tif" />

<img file="CA2701547C_D0006.tif" />

wherein B is as defined above.

Preferably, the thio-LNA unit is in its beta-D-form, i.e. having the structure shown in 3A above, likewise, the amino-LNA unit may have the chemical structure shown in Scheme 4 below:

Scheme 4

<img file="CA2701547C_D0007.tif" />

<img file="CA2701547C_D0008.tif" />

wherein B and R^H are as defined above.

Preferably, the amino-LNA unit is in its beta-D-form, i.e. having the structure shown in 4A above.

The oxy-LNA unit may have the chemical structure shown in Scheme 5 below:

<img file="CA2701547C_D0009.tif" />

wherein B is as defined above.

Preferably, the oxy-LNA unit is in its beta-D-form, i.e. having the structure shown in 5A above. As indicated above, B is a nitrogenous base which may be of natural or non-natural origin. Specific examples of nitrogenous bases include adenine (A), cytosine (C), 5methylcytosine (^C), isocytosine, pseudoisocytosine, guanine (G), thymine (T), uracil (U), 5bromouracil, 5-propynyluracil, 5-propyny-6, 5-methylthiazoleuracil, 6-aminopurine, 2aminopurine, inosine, 2,6-diaminopurine, 7-propyne-7-deazaadenine, 7-propyne-7deazaguanine and 2-chloro-6-aminopurine.

The term “thio-LNA unit” refers to an LNA unit in which X in Scheme 1 is S. A thio-LNA unit can be in both the beta-D form and in the alpha-L form. Generally, the beta-D form of the thio-LNA unit is preferred. The beta-D-form and alpha-L-form of a thio-LNA unit are shown in Scheme 3 as compounds 3A and 3B, respectively.

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

The term “amino-LNA unit” refers to an LNA unit in which X in Scheme 1 is NH or NR^H, where R^H is hydrogen or Cw-alkyl. An amino-LNA unit can be in both the beta-D form and in the alpha-L form. Generally, the beta-D form of the amino-LNA unit is preferred. The beta-D-form and alpha-L-form of an amino-LNA unit are shown in Scheme 4 as compounds 4A and 4B, respectively.

The term “oxy-LNA unit” refers to an LNA unit in which X in Scheme 1 is O. An Oxy-LNA unit can be in both the beta-D form and in the alpha-L form. Generally, the beta-D form of the oxy-LNA unit is preferred. The beta-D form and the alpha-L form of an oxy-LNA unit are shown in Scheme 5 as compounds 5A and 5B, respectively.

In the present context, the term “C^-alkyl” is intended to mean a linear or branched saturated hydrocarbon chain wherein the longest chains has from one to six carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl and hexyl. A branched hydrocarbon chain is intended to mean a Ci^-alkyl substituted at any carbon with a hydrocarbon chain.

In the present context, the term “C^-alkyl” is intended to mean a linear or branched saturated hydrocarbon chain wherein the longest chains has from one to four carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl. A branched hydrocarbon chain is intended to mean a C^-alkyl substituted at any carbon with a hydrocarbon chain.

When used herein the term “C^-alkoxy” is intended to mean C^-alkyl-oxy, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, pentoxy, isopentoxy, neopentoxy and hexoxy.

In the present context, the term ^uC₂^-alkenyl” is intended to mean a linear or branched hydrocarbon group having from two to six carbon atoms and containing one or more double bonds. Illustrative examples of C^-alkenyl groups include allyl, homo-allyl, vinyl, crotyl, butenyl, butadienyi, pentenyl, pentadienyl, hexenyl and hexadienyl. The position of the unsaturation (the double bond) may be at any position along the carbon chain.

In the present context the term “C₂^-alkynyl” is intended to mean linear or branched hydrocarbon groups containing from two to six carbon atoms and containing one or more triple bonds. Illustrative examples of C₂.₆-alkynyl groups include acetylene, propynyl, butynyl, pentynyl and hexynyl. The position of unsaturation (the triple bond) may be at any position along the carbon chain. More than one bond may be unsaturated such that the “C₂^-alkynyl” is a di-yne or enedi-yne as is known to the person skilled in the art.

When referring to substituting a DNA unit by its corresponding LNA unit in the context of the present invention, the term “corresponding LNA unit” is intended to mean that the DNA unit has been replaced by an LNA unit containing the same nitrogenous base as the DNA unit that it has replaced, e.g. the corresponding LNA unit of a DNA unit containing the nitrogenous base A

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344 also contains the nitrogenous base A. The exception is that when a DNA unit contains the base C, the corresponding LNA unit may contain the base C or the base ***0, preferably ^C.

Herein, the term “non-LNA unit refers to a nucleoside different from an LNA-unit, Le. the term “non-LNA unit’ includes a DNA unit as well as an RNA unit A preferred non-LNA unit is a DNA unit.

The terms “unit”, “residue” and “monomer” are used interchangeably herein.

The term “at least one” encompasses an integer larger than or equal to 1, such as 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 and so forth.

The terms “a” and “an” as used about a nucleotide, an agent, an LNA unit, etc., is intended to mean one or more. In particular, the expression “a component (such as a nucleotide, an agent, an LNA unit, or the like) selected from the group consisting of...” is intended to mean that one or more of the cited components may be selected. Thus, expressions like “a component selected from the group consisting of A, B and C” is intended to include all combinations of A, B and C, i.e. A, B, C, A+B, A+C, B+C and A+B+C.

Internucleoside Linkages

The term “intemucleoside linkage group” is intended to mean a group capable of covalently coupling together two nucleotides, such as between DNA units, between DNA units and nucleotide analogues, between two non-LNA units, between a non-LNA unit and an LNA unit, and between two LNA units, etc. Examples include phosphate, phosphodiester groups and phosphorothioate groups.

In some embodiments, at least one of, such as all of the intemucleoside linkage in the oligomer is phosphodiester. However for in vivo use, phosphorothioate linkages may be preferred.

Typical intemucleoside linkage groups in oligonucleotides are phosphate groups, but these may be replaced by intemucleoside linkage groups differing from phosphate. In a further interesting embodiment of the invention, the oligonucleotide of the invention is modified in its intemucleoside linkage group structure, i.e. the modified oligonucleotide comprises an intemucleoside linkage group which differs from phosphate. Accordingly, in a preferred embodiment, the oligonucleotide according to the present invention comprises at least one intemucleoside linkage group which differs from phosphate.

Specific examples of intemucleoside linkage groups which differ from phosphate (-Ο-Ρ(Ο)ζ-Ο-) include -O-P(O,S)-O-, -O-P(S)₂-O-, -S-P(O)2-O-, -S-P(O,S)-O-, -S-P(S)2-O-, -O-P(O)2-S-, -O-P(O,S)-S-, -S-P(O)₂-S-, -O-PO(R^h)-O-, O-PO(OCH3)-O-, -O-PO(NR^h)-O-, -oPO(OCH2CH₂S-R)-O-, -O-PO(BH₃)-O-, -O-PO(NHR^h)-O-, -O-P(O)2-NR^h-, -NR^h-P(O)2-O-, -NR^h-CO-O-, -NR^h-CO-NR^h-, -O-CO-O-, -O-CO-NR^h-, -NR^h-CO-CH2-, -o-ch2-co-nr^h-, O-CH2-CH2-NR^h-, -CO-NR^h-CH2-, -CH2-NR^h-CO-, -O-CH₂-CH₂-S-, -S-CH2-CH2-O-, -s-ch₂-ch₂CA 02701547 2010-04-01

WO 2009/043353 PC17DK2008/000344

S-, -CH2-SO2-CH₂-, -CH2-CO-NR^h-, -O-CH2-CH2-NR^h-CO -, -CH2-NCH3-O-CH2-, where R^H is hydrogen or C^-alkyl.

When the intemucleoside linkage group is modified, the intemucleoside linkage group is preferably a phosphorothioate group (-O-P(O.S)-O- ). In a preferred embodiment, all intemucleoside linkage groups of the oligonucleotides according to the present invention are phosphorothioate.

The intemucleoside linkage may be selected form the group consisting of: -O-P(O)₂-O-, -O-P(O,S)-O-, -O-P(S)2-O-, -S-P(O)2-O-, -S-P(O,S)-O-, -S-P(S)2-O-, -O-P(O)₂-S-, -O-P(O,S)-S-, -S-P(O)₂-S-, -O-PO(R^h)-O-, O-PO(OCH3)-O-, -O-PO(NR^h)-O-, -0-P0(OCH2CH₂S-R)-O-, -O-PO(BH₃)-O-, -O-PO(NHR^h)-O-, -O-P(O)2-NR^h-, -NR^h-P(O)2-O-, -nr^h-co-o-, -NR^h-CO-NR^h-, and/or the intemucleoside linkage may be selected form the group consisting of: -O-CO-O-, -O-CO-NR^h-, -NR^h-CO-CH2-, -O-CH2-CO-NR^h-, -O-CH2-CH2-NR^h-, -CO-NR^hCH2-, -CH2-NR^h-CO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2-SO2-CH2-, -CH2CO-NR^h-, -O-CH2-CH₂-NR^h-CO -, -CH₂-NCH₃-O-CH₂-, where R^H is selected from hydrogen and C^-alkyl. Suitably, in some embodiments, sulphur (S) containing intemucleoside linkages as provided above may be preferred. The intemucleoside linkages may be independently selected, or all be the same, such as phosphorothioate linkages.

In one embodiment, at least 75%, such as 80% or 85% or 90% or 95% or all of the intemucleoside linkages present between the nucleotide units of the contiguous nucleotide sequence are phosphorothioate intemucleoside linkages.

Micromir oligonucleotides targeting more than one microRNA

In one embodiment, the contiguous nucleotide sequence is complementary to the corresponding sequence of at least two miRNA sequences such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA sequence,. The use of a single universal base may allow a single oligomer of the invention to target two independant microRNAs which either one or both have a single mismatch in the region which corresponds to oligomer at the position where the universal nucleotide is positioned.

In one embodiment, the contiguous nucleotide sequence consists of or comprises a sequence which is complementary to the sequence of at least two miRNA seed region sequences such as 2, 3,4, 5, 6, 7, 8, 9, or 10 miRNA seed region sequences.

In one embodiment, the contiguous nucleotide sequence is complementary to the corresponding region of both miR-221 and miR-222.

In one embodiment, the contiguous nucleotide sequence is complementary to the corresponding region of more than one member of the miR-17-92 cluster - such as two or more or all of miR-17-5p, miR-20a/b, miR-93, miR-106a/b; or two or more or all of miR-25, miR-92a and miR-363.

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344

In one embodiment, the contiguous nucleotide sequence consists of or comprises a sequence that is complementary to 5’GCTACAT3’.

Oligomer Design

In one embodiment, the first nucleotide of the oligomer according to the invention, counting from the 3' end, is a nucleotide analogue, such as an LNA unit In one embodiment, which may be the same or different, the last nucleotide of the oligomer according to the invention, counting from the 3* end, is a nucleotide analogue, such as an LNA unit.

In one embodiment, the second nucleotide of the oligomer according to the invention, counting from the 3' end, is a nucleotide analogue, such as an LNA unit.

In one embodiment, the ninth and/or the tenth nucleotide of the oligomer according to the invention, counting from the 3' end, is a nucleotide analogue, such as an LNA unit.

In one embodiment, the ninth nucleotide of the oligomer according to the invention, counting from the 3' end is a nucleotide analogue, such as an LNA unit

In one embodiment, the tenth nucleotide of the oligomer according to the invention, counting from the 3’ end is a nucleotide analogue, such as an LNA unit.

In one embodiment, both the ninth and the tenth nucleotide of the oligomer according to the invention, calculated from the 3’ end is a nucleotide analogue, such as an LNA unit.

In one embodiment, the oligomer according to the invention does not comprise a region of more than 3 consecutive DNA nucleotide units. In one embodiment, the oligomer according to the invention does not comprise a region of more than 2 consecutive DNA nucleotide units.

In one embodiment, the oligomer comprises at least a region consisting of at least two consecutive nucleotide analogue units, such as at least two consecutive LNA units.

In one embodiment, the oligomer comprises at least a region consisting of at least three consecutive nucleotide analogue units, such as at least three consecutive LNA units.

Other Patterns of Nucleotide Analogues such as LNA in the Oligomer

Whilst it is envisaged that oligomers containing at least 6 LNA, such as at least 7 nucleotide units may be preferable, the discovery that such short oligomers are highly effective at targeting microRNAs in vivo can be used to prepare shorter oligomers of the invention which comprise other nucleotide analogues, such as high affinity nucleotide analogues. Indeed, the combination of LNA with other high affinity nucleotide analogues are considered as part of the present invention.

Modification of nucleotides in positions 1 to 2, counting from the 3' end. The nucleotide at positions 1 and/ or 2 may be a nucleotide analogue, such as a high affinity nucleotide analogue, such as LNA, or a nucleotide analogue selected from the group consisting of 2’-O-alkyl-RNA unit, 2'-OMe-RNA unit, 2’-amino-DNA unit, 2’-fluoro-DNA unit, 2-MOE-RNA unit, LNA unit, PNA unit, HNA unit, INA unit. The two 3’ nucleotide may therefore be

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

Xx, xX, XX or xx, wherein: In one embodiment X is LNA and x is DNA or another nucleotide analogue, such as as a 2’ substituted nucleotide analogue selected from the group consisting of 2’-O_alkyl-RNA unit, 2’-OMe-RNA unit, 2’-amino-DNA unit, 2’-fluoro-DNA unit, LNA, and a 2’MOE RNA unit. Said non-LNA unit (x) may therefore be 2’MOE RNA or 2’-fluoro-DNA. Alternatively X is a nucleotide analogue, and x is DNA.

The above modification at the 2 3’ terminal nucleotides may be combined with modification of nucleotides in positions 3 — 8 counting from the 3’ end, as described below. In this respect nucleotides designated as X and x may be the same throughout the oligomer. It will be noted that when the oligomer is only 7 nucleotides in length the 8^th nucleotide counting from the 3’ end should be discarded.In the following embodiments which refer to the modification of nucleotides in positions 3 to 8, counting from the 3' end, the LNA units, in one embodiment, may be replaced with other nucleotide anlogues, such as those referred to herein. “X” may, therefore be selected from the group consisting of 2’-O-alkyl-RNA unit, 2’-OMe-RNA unit, 2’-amino-DNA unit, 2’-fluoro-DNA unit, 2-MOE-RNA unit, LNAunit, PNA unit, HNA unit, INA unit, “x” is preferably DNA or RNA, most preferably DNA. However, it is preferred that X is LNA.

In one embodiment of the invention, the oligonucleotides of the invention are modified in positions 3 to 8, counting from the 3’ end. The design of this sequence may be defined by the number of non-LNA units present or by the number of LNA units present In a preferred embodiment of the former, at least one, such as one, of the nucleotides in positions three to eight, counting from the 3' end, is a non-LNA unit In another embodiment, at least two, such as two, of the nucleotides in positions three to eight, counting from the 3' end, are non-LNA units. In yet another embodiment, at least three, such as three, of the nucleotides in positions three to eight, counting from the 3’ end, are non-LNA units. In still another embodiment, at least four, such as four, of the nucleotides in positions three to eight, counting from the 3' end, are nonLNA units. In a further embodiment, at least five, such as five, of the nucleotides in positions three to eight, counting from the 3’ end, are non-LNA units. In yet a further embodiment, all six nucleotides in positions three to eight, counting from the 3' end, are non-LNA units.

Alternatively defined, in an embodiment, the oligonucleotide according to the present invention comprises at least three LNA units in positions three to eight, counting from the 3’ end. In an embodiment thereof, the oligonucleotide according to the present invention comprises three LNA units in positions three to eight, counting from the 3' end. The substitution pattern for the nucleotides in positions three to eight, counting from the 3’ end, may be selected from the group consisting of XXXxxx, xXXXxx, xxXXXx, xxxXXX, XXxXxx, XXxxXx, XXxxxX, xXXxXx, xXXxxX, xxXXxX, XxXXxx, XxxXXx, XxxxXX, xXxXXx, xXxxXX, xxXxXX, xXxXxX and XxXxXx, wherein “X” denotes an LNA unit and “x denotes a non-LNA unit In a preferred embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of XXxXxx, XXxxXx, XXxxxX, xXXxXx, xXXxxX, xxXXxX,

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344

XxXXxx, XxxXXx, XxxxXX, xXxXXx, xXxxXX, xxXxXX, xXxXxX and XxXxXx, wherein “X denotes an LNA unit and “x” denotes a non-LNA unit. In a more preferred embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3’ end, is selected from the group consisting of xXXxXx, xXXxxX, xxXXxX, xXxXXx, xXxxXX, xxXxXX and xXxXxX, wherein “X” denotes an LNA unit and “x” denotes a non-LNA unit. In an embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is xXxXxX or XxXxXx, wherein “X” denotes an LNA unit and “x” denotes a non-LNA unit In an embodiment the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is xXxXxX, wherein “X” denotes an LNA unit and “x” denotes a non-LNA unit.

In a further embodiment, the oligonucleotide according to the present invention comprises at least four LNA units in positions three to eight, counting from the 3' end. In an embodiment thereof, the oligonucleotide according to the present invention comprises four LNA units in positions three to eight, counting from the 3’ end. The substitution pattern for the nucleotides in positions three to eight, counting from the 3’ end, may be selected from the group consisting of xxXXXX, xXxXXX, xXXxXX, xXXXxX, xXXXXx, XxxXXX, XxXxXX, XxXXxX, XxXXXx, XXxxXX, XXxXxX, XXxXXx, XXXxxX, XXXxXx and XXXXxx, wherein “X” denotes an LNA unit and “x” denotes a non-LNA unit.

In yet a further embodiment, the oligonucleotide according to the present invention comprises at least five LNA units in positions three to eight, counting from the 3' end. In an embodiment thereof, the oligonucleotide according to the present invention comprises five LNA units in positions three to eight, counting from the 3’ end. The substitution pattern for the nucleotides in positions three to eight, counting from the 3* end, may be selected from the group consisting of xXXXXX, XxXXXX, XXxXXX, XXXxXX, XXXXxX and XXXXXx, wherein “X” denotes an LNA unit and “x” denotes a non-LNA unit.

Preferably, the oligonucleotide according to the present invention comprises one or two LNA units in positions three to eight, counting from the 3’ end. This is considered advantageous for the stability of the A-helix formed by the oligo:microRNA duplex, a duplex resembling an RNA:RNA duplex in structure.

In yet a further embodiment, the oligonucleotide according to the present invention comprises at least six LNA units in positions three to eight, counting from the 3' end. In an embodiment thereof, the oligonucleotide according to the present invention comprises at from three to six LNA units in positions three to eight, counting from the 3' end, and in addition from none to three other high affinity nucleotide analogues in the same region, such that the total amount of high affinity nucleotide analogues (including the LNA units) amount to six in the region from positions three to eight, counting from the 3’ end.

In some embodiments, such as when X is LNA, said non-LNA unit (x) is another nucleotide analogue unit, such as a 2’ substituted nucleotide analogue selected from the group consisting

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 of 2’-O_alkyl-RNA unit, 2’-OMe-RNA unit, 2’-amino-DNA unit, 2’-fluoro-DNA unit, LNA, and a 2’MOE RNA unit. Said non-LNA unit (x) may therefore be 2’MOE RNA or 2’-fluoro-DNA.

For oligomers which have 9 or 10 nucleotides, the nucleotide at positions 9 and/ or 10 may be a nucleotide analogue, such as a high affinity nucleotide analogue, such as LNA, or a nucleotide analogue selected from the group consisting of 2-O-alkyl-RNA unit, 2-OMe-RNA unit, 2’-amino-DNA unit, 2’-fluoro-DNA unit, 2’-MOE-RNA unit, LNA unit, PNA unit, HNA unit, INA unit. The two 5’ nucleotides may therefore be

Xx, xX, XX or xx, wherein: In one embodiment X is LNA and x is DNA or another nucleotide analogue, such as as a 2’ substituted nucleotide analogue selected from the group consisting of 2’-O_alkyl-RNA unit, 2'-OMe-RNA unit, 2’-amino-DNA unit, 2-fluoro-DNA unit, LNA, and a 2’MOE RNA unit. Said non-LNA unit (x) may therefore be 2’MOE RNA or 2’-fluoro-DNA. Alternatively X is a nucleotide analogue, and x is DNA.

The above modification at the 2 5’ terminal nucleotides may be combined with modification of nucleotides in positions 3 — 8 counting from the 3’ end, and/or the 2 3’ nucleotitides as described above. In this respect nucleotides designated as X and x may be the same throughout the oligomer.

In a preferred embodiment of the invention, the oligonucleotide according to the present invention contains an LNA unit at the 5' end. In another preferred embodiment, the oligonucleotide according to the present invention contains an LNA unit at the first two positions, counting from the 5’ end.

In one embodiment, the invention further provides for an oligomer as described in the context of the pharmaceutical composition of the invention, or for use in vivo in an organism, such as a medicament, wherein said oligomer (or contiguous nucleotide sequence) comprises either

i) at least one phosphorothioate linkage and/or ii) at least one 3’ terminal LNA unit, and/or iii) at least one 5’ teriminal LNA unit.

The oligomer may therefore contain at least one phosphorothioate linkage, such as all linkages being phosphorthioates, and at least one 3’ terminal LNA unit, and at least one 5’ teriminal LNA unit.

It is preferable for most therapeutic uses that the oligonucleotide is fully phosphorothiolated — an exception being for therapeutic oligonucleotides for use in the CNS, such as in the brain or spine where phosphorothioation can be toxic, and due to the absence of nucleases, phosphodiester bonds may be used, even between consecutive DNA units.

As referred to herein, other in one aspect of the oligonucleotide according to the invention is that the second 3’ nucleotide, and/or the 9^th and 10^th (from the 3’ end), if present, may also be LNA.

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344

In one embodiment, the oligomer comprises at least five nucleotide analogue units, such as at least five LNA units, in positions which are complementary to the miRNA seed region.

In one embodiment, the nucleotide sequence of the oligomer which is complementary to the sequence of the microRNA seed region, is selected from the group consisting of (X)xXXXXX, (X)XxXXXX, (X)XXxXXX, (X)XXXxXX, (XJXXXXxX and (X)XXXXXx, wherein “X” denotes a nucleotide analogue, such as an LNA unit, (X) denotes an optional nucleotide analogue, such as an LNA unit, and “x” denotes a DNA or RNA nucleotide unit.

In one embodiment, the oligomer comprises six or seven nucleotide analogue units, such as six or seven LNA units, in positions which are complementary to the miRNA seed region.

In one embodiment, the nucleotide sequence of the oligomer which is complementary to the sequence of the microRNA seed region, is selected from the group consisting of XXXXXX, XxXXXXX, XXxXXXX, XXXxXXX, XXXXxXX, XXXXXxX and XXXXXXx, wherein “X” denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and “x” denotes a DNA or RNA nucleotide unit.

In one embodiment, the two nucleotide motif at position 7 to 8, counting from the 3’ end of the oligomer is selected from the group consisting of xx, XX, xX and Xx, wherein “X” denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and “x” denotes a DNA or RNA nucleotide unit.

In one embodiment, the two nucleotide motif at position 7 to 8, counting from the 3’ end of the oligomer is selected from the group consisting of XX, xX and Xx, wherein “X” denotes a nucleotide analogue, such as an LNÀ unit, such as an LNA unit, and “x” denotes a DNA or RNA nucleotide unit.

In one embodiment the oligomer comprises at 12 nucleotides and wherein the two nucleotide motif at position 11 to 12, counting from the 3’ end of the oligomer is selected from the group consisting of xx, XX, xX and Xx, wherein “X” denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and “x” denotes a DNA or RNA nucleotide unit.

In one embodiment the oligomer comprises 12 nucleotides and wherein the two nucleotide motif at position 11 to 12, counting from the 3’ end of the oligomer is selected from the group consisting of XX, xX and Xx, wherein “X” denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and “x” denotes a DNA or RNA nucleotide unit, such as a DNA unit.

In one embodiment the oligomer comprises a nucleotide analogue unit, such as an LNA unit, at the 5' end.

In one embodiment the nucleotide analogue units, such as X, are independently selected form the group consisting of: 2’-O-alkyl-RNA unit, 2’-OMe-RNA unit, 2’-amino-DNA unit, 2‘fluoro-DNA unit, 2-MOE-RNA unit, LNA unit, PNA unit, HNA unit, INA unit.

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344

In one embodiment, all the nucleotides of the oligomer of the invention are nucleotide analogue units.

In one embodiment, the nucleotide analogue units, such as X, are independently selected form the group consisting of: 2’-OMe-RNA units, 2’-fluoro-DNA units, and LNA units,

In one embodiment, the oligomer comprises said at least one LNA analogue unit and at least one further nucleotide analogue unit other than LNA.

In one embodiment, the non-LNA nucleotide analogue unit or units are independently selected from 2’-OMe RNA units and 2’-fluoro DNA units.

In one embodiment, the oligomer consists of at least one sequence XYX or YXY, wherein X is LNA and Y is either a 2’-OMe RNA unit and 2-fluoro DNA unit.

In one embodiment, the sequence of nucleotides of the oligomer consists of alternative X and Y units.

In one embodiment, the oligomer comprises alternating LNA and DNA units (Xx) or (xX).

In one embodiment, the oligomer comprises a motif of alternating LNA followed by 2 DNA units (Xxx), xXx or xxX.

In one embodiment, at least one of the DNA or non-LNA nucleotide analogue units are replaced with a LNA nucleotide in a position selected from the positions identified as LNA nucleotide units in any one of the embodiments referred to above. In one embodiment,“X” donates an LNA unit.

Further Designs for Oligomers of the invention

Table 1 below provides non-limiting examples of short microRNA sequences that could advantageously be targeted with an oligonucleotide of the present invention.

The oligonucleotides according to the invention, such as those disclosed in table 1 may, in one embodiment, have a sequence of 7, 8, 9 or 10 LNA nucleotides 5’ - 3’ LLLLLLL(L)(L)(LXL), or have a sequence of nucleotides selected form the group consisting of, the first 7, 8, 9 or 10 nucleotides of the following motifs:

LdLddL(L)(dXd)(L)(dXLXd)(L)(L), LdLdLL(LXdXdXLXLXL)(dXLXL), LMLMML(LXMXMXLXMXLXMXLXL), LMLMLL(LXM)(MXL)(LXLXM)(LXL), LFLFFL(LXFXFXLXFXLXFXLXL), LFLFLL(L)(FXFXLXLXLXF)(LXL), and every third designs such as; LddLdd(LXdXdXLXdXdXLXdXdXLXd) ‘dLddLd(dXLXdXdXLXdXdXLXdXdXL), ddLddL(dXdXLXdXdXLXdXdXLXdXd), LMMLMM(LXM)(M)(LXMXMXLXMXMXLXM), MLMMLM(MXLXMXMXLXMXMXLXMXMXL), MMLMML(M)(MXLXMXMXL)(MXMXLXMXM), LFFLFF(L)(F)(FXL)(FXFXLXFXFXLXF), FLFFLF(FXLXF)(FXLXF)(FXLXFXFXL), FFLFFL(FXFXLXFXFXLXFXFXLXFXF), and dLdLdL(dXLXdXLXdXLXdXLXdXLXd) and an every second design, such as; LdLdLd(LXdXL)(dXLXdXL)(dXL)(dXL), MLMLML(M)(LXM)(LXMXLXMXLXMXL)(M), LMLMLM(LXMXLXMXLXMXLXMXLXMXL), FLFLFL(FXLXFXLXFXL)(FXLXF)(LXF), and LFLFLF(LXFXLXFXLXFXLXFXLXFXL); wherein L = LNA unit, d= DNA units, M = 2’MOE RNA, F = 2’F1uoro and residues in brackets are optional.

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

Pharmaceutical Composition and Medical Application

The invention provides for a pharmaceutical composition comprising the oligomer according to the invention, and a pharmaceutically acceptable diluent, carrier, salt or adjuvant

The invention further provides for the use of an oligonucleotide according to the invention, such as those which may form part of the pharmaceutical composition, for the manufacture of a medicament for the treatment of a disease or medical disorder associated with the presence or over-expression (upregulation) of the microRNA.

The invention further provides for a method for the treatment of a disease or medical disorder associated with the presence or over-expression of the microRNA, comprising the step of administering a composition (such as the pharmaceutical composition) according to the invention to a person in need of treatment.

The invention further provides for a method for reducing the effective amount of a miRNA in a cell or an organism, comprising administering a composition (such as the pharmaceutical composition) according to the invention or a oligomer according to the invention to the cell or the organism. Reducing the effective amount in this context refers to the reduction of functional miRNA present in the cell or organism. It is recognised that the preferred oligonucleotides according to the invention may not always significantly reduce the actual amount of miRNA in the cell or organism as they typically form very stable duplexes with their miRNA targets. The reduction of the effective amount of the miRNA in a cell may, in one embodiment, be measured by detecting the level of de-repression of the miRNA’s target in the cell.

The invention further provides for a method for de-repression of a target mRNA of a miRNA in a cell or an organism, comprising administering a composition (such as the pharmaceutical composition) or a oligomer according to the invention to the cell or the organism.

The invention further provides for the use of a oligomer of between 7 — 10 such as 7, 8, 9, or 10 nucleotides in length, for the manufacture of a medicament for the treatment of a disease or medical disorder associated with the presence or over-expression of the microRNA.

In one embodiment the medical condition (or disease) is hepatitis G (HCV), and the miRNA is miR-122.

In one embodiment, the pharmaceutical composition according to the invention is for use in the treatment of a medical disorder or disease selected from the group consisting of: hepatitis C virus infection and hypercholesterolemia and related disorders, and cancers.

In one embodiment the medical disorder or disease is a CNS disease, such as a CNS disease where one or more microRNAs are known to be indicated.

In the context of hypercholesterolemia related disorders refers to diseases such as atherosclerosis or hyperlipidemia. Further examples of related diseases also include different types of HDL/LDL cholesterol imbalance; dyslipidemias, e.g., familial combined hyperlipidemia

CA 02701547 2016-02-01

WO 2009/043353 PCT/DK2008/000344 (FCHL), acquired hyperlipidemia, statin-resistant hypercholesterolemia; coronary artery disease (CAD) coronary heart disease (CHD), atherosclerosis.

In one embodiment, the pharmaceutical composition according to the invention further comprises a second independent active ingredient that is an inhibitor of the VLDL assembly pathway, such as an ApoB inhibitor, or an MTP inhibitor (such as those disclosed in US 60/977,497).

The invention further provides for a method for the treatment of a disease or medical disorder associated with the presence or over-expression of the microRNA, comprising the step of administering a composition (such as the pharmaceutical composition) comprising a oligomer of between between 7-10 such as 7, 8, 9, or 10 nucleotides in length, to a person in need of treatment.

The invention further provides for a method for reducing the effective amount of a miRNA target (i.e. ‘available’ miRNA) in a cell or an organism, comprising administering a composition (such as the pharmaceutical composition) comprising a oligomer of between 6 7-10 such as 7, 8, 9, or 10 nucleotides in length, to the cell or the organism.

It should be recognised that “reducing the effective amount of one or more microRNAs in a cell or organism, refers to the inhibition of the microRNA function in the call or organism. The cell is preferably a mammalian cell or a human cell which expresses the microRNA or microRNAs.

The invention further provides for a method for de-repression of a target mRNA of a miRNA in a cell or an organism, comprising a oligomer of 7 -10 such as 7, 8, 9, or 10 nucleotides in length, or (or a composition comprising said oligonucleotide) to the cell or the organism.

As mentioned above, microRNAs are related to a number of diseases. Hence, a fourth aspect of the invention relates to the use of an oligonucleotide as defined herein for the manufacture of a medicament for the treatment of a disease associated with the expression of microRNAs selected from the group consisting of spinal muscular atrophy, Tourette’s syndrome, hepatitis C, fragile X mental retardation, DiGeorge syndrome and cancer, such as in non limiting example, chronic lymphocytic leukemia, breast cancer, lung cancer and colon cancer, in particular cancer.

Methods of Synthesis

The invention further provides for a method for the synthesis of an oligomer targeted against a human microRNA, such as an oligomer described herein, said method comprising the steps of:

a. Optionally selecting a first nucleotide, counting from the 3’ end, which is a nucleotide analogue, such as an LNA nucleotide.

b. Optionally selecting a second nucleotide, counting from the 3’ end, which is a nucleotide analogue, such as an LNA nucleotide.

CA 02701547 2010-04-01

WO 2009/043353 PC17DK2008/000344

c. Selecting a region of the oligomer which corresponds to the miRNA seed region, wherein said region is as defined herein.

d. Selecting a seventh and optionally an eight nucleotideas defined herein.

e. Optionally selecting one or two further 5’ terminal of the oligomer is as defined herein;

wherein the synthesis is performed by sequential synthesis of the regions defined in steps a - e, wherein said synthesis may be performed in either the 3’-5’ ( a to f) or 5’ — 3’ (e to a)direction, and wherein said oligomer is complementary to a sequence of the miRNA target The invention further provides for a method for the preparation of an oligomer (such as an oligomer according to the invention), said method comprising the steps of a) comparing the sequences of two or more miRNA sequences to identifiy two or more miRNA sequences which comprise a common contiguous nucleotide sequence of at least 7 nucleotides in length, such as 7, 8, 9 or 10 nucleotides in length (i.e. a sequence found in both non-idnetical miRNAs), b) preparing an oligomer sequence which consists or comprises of a contiguous nucleotide sequence with is complementary to said common contiguous nucleotide sequence, wherein said oligomer is, as according to the oligomer of the invention. In a preferred example, the common contiguous nucleotide sequence consists or comprises of the seed region of each of said two or more miRNA sequences (which comprise a common contiguous nucleotide seqeunce of at least 6 nucleotides in length). In one embodiment, the seed regions of the two or more miRNAs are identical. Suitably the oligomer consists or comprises a seedmer sequence of 7 or 8 nucleotides in length which comprises of a seqeunce which is complementary to said two or more miRNAs. This method may be used in conjunction with step c of the above method.

The method for the synthesis of the oligomer according to the invention may be performed using standard solid phase oligonucleotide systhesis.

In one embodiment, the method for the synthesis of a oligomer targeted against a human microRNA, is performed in the 3’ to 5’ direction a - e.

A further aspect of the invention is a method to reduce the levels of target microRNA by contacting the target microRNA to an oligonucleotide as defined herein, wherein the oligonucleotide (i) is complementary to the target microRNA sequence (ii) does not contain a nucleotide at the 3’ end that corresponds to the first 5’ end nucleotide of the target microRNA. Duplex stability and T_m

In one embodiment, the oligomer of the invention is capable of forming a duplex with a complementary single stranded RNA nucleic acid molecule (typically of about the same length of said single stranded oligonucleotide) with phosphodiester intemucleoside linkages, wherein the duplex has a T_m of between 30°C and and 70°C or 80°C, such as between 30°C and 60°C ot 70°C, or between 30°C and 50°C or 60°C. In one embodiment the T_m is at least 40°C. T_mmay be determined by determining the T_m of the oligomer and a complementary RNA target in

CA 02701547 2016-02-01

WO 20()9/043353 PCT/DK2008/000344 the following buffer conditions: 100mM NaCl, 0.1mM EDTA, 10mM Na-phosphate, pH 7.0 (see examples for a detailed protocol). A high affinity analogue may be defined as an analogue which, when used in the oligomer of the invention, results in an increase in the T_mof the oligomer as compared to an identicial oligomer which has contains only DNA bases.

Conjugates

In one embodiment, said oligomer is conjugated with one or more non-nucleotide (or polynucleotide) compounds.

In the context the term conjugate is intended to indicate a heterogenous molecule formed by the covalent attachment (“conjugation) of the oligomer as described herein to one or more non-nucleotide, or non-polynucleotide moieties. Examples of non-nucleotide or nonpolynucleotide moieties include macromolecular agents such as proteins, fatty acid chains, sugar residues, glycoproteins, polymers, or combinations thereof. Typically proteins may be antibodies for a target protein. Typical polymers may be polyethylene glycol.

Therefore, in various embodiments, the oligomer of the invention may comprise both a polynucleotide region which typically consists of a contiguous sequence of nucleotides, and a further non-nucleotide region. When referring to the oligomer of the invention consisting of a contiguous nucleotide sequence, the compound may comprise non-nucleotide components, such as a conjugate component.

In various embodiments of the invention the oligomeric compound is linked to ligands/conjugates, which may be used, e.g. to increase the cellular uptake of oligomeric compounds. W02007/031091 provides suitable ligands and conjugates.

The invention also provides for a conjugate comprising the compound according to the invention as herein described, and at least one non-nucleotide or non-polynucleotide moiety covalently attached to said compound. Therefore, in various embodiments where the compound of the invention consists of a specified nucleic acid or nucleotide sequence, as herein disclosed, the compound may also comprise at least one non-nucleotide or nonpolynucleotide moiety (e.g. not comprising one or more nucleotides or nucleotide analogues) covalently attached to said compound.

Conjugation (to a conjugate moiety) may enhance the activity, cellular distribution or cellular uptake of the oligomer of the invention. Such moieties include, but are not limited to, antibodies, polypeptides, lipid moieties such as a cholesterol moiety, cholic acid, a thioether,

e.g. Hexyl-s-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-ohexadecyl-rac-glycero-3-h-phosphonate, a polyamine or a polyethylene glycol chain, an adamantane acetic acid, a palmityl moiety, an octadecylamine or hexylamino-carbonyloxycholesterol moiety.

CA 02701547 2016-02-01

WO 2009/043353

PCT/DK2008/000344

The oligomers of the invention may also be conjugated to active drug substances, for example, aspirin, ibuprofen, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

In certain embodiments the conjugated moiety is a sterol, such as cholesterol.

In various embodiments, the conjugated moiety comprises or consists of a positively charged polymer, such as a positively charged peptides of, for example between 1 -50, such as 2-20 such as 3 - 10 amino acid residues in length, and/or polyalkylene oxide such as polyethylglycol(PEG) or polypropylene glycol - see WO 2008/034123.

Suitably the positively charged polymer, such as a polyalkylene oxide may be attached to the oligomer of the invention via a linker such as the releasable inker described in WO 2008/034123.

By way of example, the following conjugate moieties may be used in the conjugates of the invention:

5'- OLIGOMER -3' o

JLo- 5'- OLIGOMER -3'

Activated oligomers

The term “activated oligomer,” as used herein, refers to an oligomer of the invention that is covalently linked (i.e., functionalized) to at least one functional moiety that permits covalent linkage of the oligomer to one or more conjugated moieties, i.e., moieties that are not themselves nucleic acids or monomers, to form the conjugates herein described. Typically, a functional moiety will comprise a chemical group that is capable of covalently bonding to the oligomer via, e.g., a 3’-hydroxyl group or the exocyclic NH₂ group of the adenine base, a spacer that is preferably hydrophilic and a terminal group that is capable of binding to a conjugated moiety (e.g., an amino, sulfhydryl or hydroxyl group). In some embodiments, this terminal group is not protected, e.g., is an NH₂ group. In other embodiments, the terminal group is protected, for example, by any suitable protecting group such as those described in “Protective Groups in Organic Synthesis by Theodora W Greene and Peter G M Wuts, 3rd edition (John Wiley &amp; Sons, 1999). Examples of suitable hydroxyl protecting groups include esters such as acetate ester, aralkyl groups such as benzyl, diphenylmethyl, or triphenylmethyl, and tetrahydropyranyl. Examples of suitable amino protecting groups include benzyl, alpha-methylbenzyl, diphenylmethyl, triphenylmethyl, benzyioxycarbonyl, tert-butoxycarbonyl, and acyl groups such as trichloroacetyl or trifluoroacetyl. In some embodiments, the functional moiety is self-cleaving. In other embodiments, the functional moiety is biodegradable. See e.g., U.S. Patent No. 7,087,229.

CA 02701547 2016-02-01

WO 2009/043353 PCT/DK2008/000344

In some embodiments, oligomers of the invention are functionalized at the 5’ end in order to allow covalent attachment of the conjugated moiety to the 5' end of the oligomer. In other embodiments, oligomers of the invention can be functionalized at the 3’ end. In still other embodiments, oligomers of the invention can be functionalized along the backbone or on the heterocyclic base moiety. In yet other embodiments, oligomers of the invention can be functionalized at more than one position independently selected from the 5’ end, the 3’ end, the backbone and the base.

In some embodiments, activated oligomers of the invention are synthesized by incorporating during the synthesis one or more monomers that is covalently attached to a 10. functional moiety. In other embodiments, activated oligomers of the invention are synthesized with monomers that have not been functionalized, and the oligomer is functionalized upon completion of synthesis. In some embodiments, the oligomers are functionalized with a hindered ester containing an aminoalkyl linker, wherein the alkyl portion has the formula (CH₂)_W, wherein w is an integer ranging from 1 to 10, preferably about 6, wherein the alkyl portion of the 15 alkylamino group can be straight chain or branched chain, and wherein the functional group is attached to the oligomer via an ester group (-O-C(O)-(CH₂)_WNH).

In other embodiments, the oligomers are functionalized with a hindered ester containing a (CH₂)w-sulfhydryl (SH) linker, wherein w is an integer ranging from 1 to 10, preferably about 6, wherein the alkyl portion of the alkyiamino group can be straight chain or branched chain, and 20 wherein the functional group attached to the oligomer via an ester group (-O-C(O)-(CH₂)_WSH).

In some embodiments, sulfhydryl-activated oligonucleotides are conjugated with polymer moieties such as polyethylene glycol or peptides (via formation of a disulfide bond).

Activated oligomers containing hindered esters as described above can be synthesized by any method known in the art, and in particular by methods disclosed in PCT Publication No. WO 25 2008/034122 and the examples therein.

In still other embodiments, the oligomers of the invention are functionalized by introducing sulfhydryl, amino or hydroxyl groups into the oligomer by means of a functionalizing reagent substantially as described in U.S. Patent Nos. 4,962,029 and 4,914,210, i.e.. a substantially linear reagent having a phosphoramidite at one end linked through a hydrophilic spacer chain to 30 the opposing end which comprises a protected or unprotected sulfhydryl, amino or hydroxyl group. Such reagents primarily react with hydroxyl groups of the oligomer. In some embodiments, such activated oligomers have a functionalizing reagent coupled to a 5'-hydroxyl group of the oligomer. In other embodiments, the activated oligomers have a functionalizing reagent coupled to a 3’-hydroxyl group. In still other embodiments, the activated oligomers of 35 the invention have a functionalizing reagent coupled to a hydroxyl group on the backbone of the oligomer. In yet further embodiments, the oligomer of the invention is functionalized with more than one of the functionalizing reagents as described in U.S. Patent Nos. 4,962,029 and

CA 02701547 2016-02-01

WO 2009/043353

PCT/DK2008/000344

4,914,210. Methods of synthesizing such functionalizing reagents and incorporating them into monomers or oligomers are disclosed in U.S. Patent Nos. 4,962,029 and 4,914,210.

In some embodiments, the 5'-terminus of a solid-phase bound oligomer is functionalized with a dienyl phosphoramidite derivative, followed by conjugation of the deprotected oligomer with, e.g., an amino acid or peptide via a Diels-Alder cycloaddition reaction.

In various embodiments, the incorporation of monomers containing 2'-sugar modifications, such as a 2’-carbamate substituted sugar or a 2’-(O-pentyl-N-phthalimido)deoxyribose sugar into the oligomer facilitates covalent attachment of conjugated moieties to the sugars of the oligomer. In other embodiments, an oligomer with an amino-containing linker at the 2'-position of one or more monomers is prepared using a reagent such as, for example, 5'-dimethoxytrityl-2'-0-(e-phthalimidylaminopentyl)-2‘-deoxyadenosine-3’— Ν,Ν-diisopropylcyanoethoxy phosphoramidite. See, e.g., Manoharan, et al., Tetrahedron Letters, 1991, 34, 7171.

In still further embodiments, the oligomers of the invention may have amine-containing functional moieties on the nucleotide, including on the N6 purine amino groups, on the exocyclic N2 of guanine, or on the N4 or 5 positions of cytosine. In various embodiments, such functionalization may be achieved by using a commercial reagent that is already functionalized in the oligomer synthesis.

Some functional moieties are commercially available, for example, heterobifunctional and homobifunctional linking moieties are available from the Pierce Co. (Rockford, ill.). Other commercially available linking groups are 5'-Amino-Modifier C6 and 3'-Amino-Modifier reagents, both available from Glen Research Corporation (Sterling, Va.). 5'-Amino-Modifier C6 is also available from ABI (Applied Biosystems Inc., Foster City, Calif.) as Aminolink-2, and 3'-AminoModifier is also available from Clontech Laboratories Inc. (Palo Alto, Calif.).

Therapy and pharmaceutical compositions - formulation and administration

As explained initially, the oligonucleotides of the invention will constitute suitable drugs with improved properties. The design of a potent and safe drug requires the fine-tuning of various parameters such as affinity/specificity, stability in biological fluids, cellular uptake, mode of action, pharmacokinetic properties and toxicity.

Accordingly, in a further aspect the present invention relates to a pharmaceutical composition comprising an oligonucleotide according to the invention and a pharmaceutically acceptable diluent, carrier or adjuvant. Preferably said carrier is saline or buffered saline.

In a still further aspect the present invention relates to an oligonucleotide according to the present invention for use as a medicament.

CA 02701547 2016-02-01

WO 2009/043353 PCT/DK2008/000344

As will be understood, dosing is dependent on severity and responsiveness of the disease state to be treated, and the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Optimum dosages may vary depending on the relative potency of individual oligonucleotides. Generally it can be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 pg to 1 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 10 years or by continuous infusion for hours up to several months. The repetition rates for dosing can be estimated based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state.

As indicated above, the invention also relates to a pharmaceutical composition, which comprises at least one oligonucleotide of the invention as an active ingredient. It should be understood that the pharmaceutical composition according to the invention optionally comprises a pharmaceutical carrier, and that the pharmaceutical composition optionally comprises further compounds, such as chemotherapeutic compounds, anti-inflammatory compounds, antiviral compounds and/or immuno-modulating compounds.

The oligonucleotides of the invention can be used “as is” or in form of a variety of pharmaceutically acceptable salts. As used herein, the term “pharmaceutically acceptable salts” refers to salts that retain the desired biological activity of the herein-identified oligonucleotides and exhibit minimal undesired toxicological effects. Non-limiting examples of such salts can be formed with organic amino acid and base addition salts formed with metal cations such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, potassium, and the like, or with a cation formed from ammonia, /\/,A/-dibenzylethylene-diamine, D-glucosamine, tetraethylammonium, or ethylenediamine.

In one embodiment of the invention, the oligonucleotide may be in the form of a prodrug. Oligonucleotides are by virtue negatively charged ions. Due to the lipophilic nature of cell membranes the cellular uptake of oligonucleotides aro reduced compared to neutral or lipophilic equivalents. This polarity “hindrance can be avoided by using the pro-drug approach (see e.g. Crooke, R. M. (1998) in Crooke, S. T. Antisense research and Application. Springer-Verlag, Berlin, Germany, vol. 131, pp. 103-140).

Pharmaceutically acceptable binding agents and adjuvants may comprise part of the formulated drug.

Examples of delivery methods for delivery of the therapeutic agents described herein, as well as details of pharmaceutical formulations, salts, may are well described elsewhere.

CA 02701547 2016-02-01

WO 2009/043353 PCT/DK2008/000344

Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self- emulsifying solids and self-emulsifying semisolids. Delivery of drug to tumour tissue may be enhanced by carrier-mediated delivery including, but not limited to, cationic liposomes, cyclodextrins, porphyrin derivatives, branched chain dendrimers, polyethylenimine polymers, nanoparticles and microspheres (Dass CR. J Pharm Pharmacol 2002; 54(1):3-27). The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels and suppositories. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers. The compounds of the invention may also be conjugated to active drug substances, for example, aspirin, ibuprofen, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

In another embodiment, compositions of the invention may contain one or more oligonucleotide compounds, targeted to a first microRNA and one or more additional oligonucleotide compounds targeted to a second microRNA target Two or more combined compounds may be used together or sequentially.

The compounds disclosed herein are useful for a number of therapeutic applications as indicated above. In general, therapeutic methods of the invention include administration of a therapeutically effective amount of an oligonucleotide to a mammal, particularly a human. In a certain embodiment, the present invention provides pharmaceutical compositions containing (a) one or more compounds of the invention, and (b) one or more chemotherapeutic agents. When used with the compounds of the invention, such chemotherapeutic agents may be used individually, sequentially, or in combination with one or more other such chemotherapeutic agents or in combination with radiotherapy. All chemotherapeutic agents known to a person skilled in the art are here incorporated as combination treatments with compound according to the invention. Other active agents, such as anti-inflammatory drugs, including but not limited to

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344 nonsteroidal anti-inflammatory drugs and corticosteroids, antiviral drugs, and immunomodulating drugs may also be combined in compositions of the invention. Two or more combined compounds may be used together or sequentially.

Examples of therapeutic indications which may be treated by the pharmaceutical compositions of the invention:

<td> microRNA</td><td> Possible medical indications</td>

<td> miR-1</td><td> Cardiac arythmia</td>

<td> miR-21</td><td> Glioblastoma, breast cancer, hepatocellular carcinoma, colorectal cancer, sensitization of gliomas to cytotoxic drugs, cardiac hypertrophy</td>

<td> miR-21, miR-200b and miR-141</td><td> Response to chemotherapy and regulation of cholangiocarcinoma growth</td>

<td> miR-122</td><td> hypercholesterolemia, hepatitis C infection, hemochromatosis</td>

<td> miR-19b</td><td> lymphoma and other tumour types</td>

<td> miR-26a</td><td> Osteoblast differentiation of human stem cells</td>

<td> miR-155</td><td> lymphoma, pancreatic tumor development, breast and lung cancer</td>

<td> miR-203</td><td> Psoriasis</td>

<td> miR-375</td><td> diabetes, metabolic disorders, glucose-induced insulin secretion from pancreatic endocrine cells</td>

<td> miR-181</td><td> myoblast differentiation, auto immune disorders</td>

<td> miR-10b</td><td> Breast cancer cell invasion and metastasis</td>

<td> miR-125b-1</td><td> Breast, lung, ovarian and cervical cancer</td>

<td> miR-221 and 222</td><td> Prostate carcinoma, human thyroid papillary car, human hepatocellular carcinoma</td>

<td> miRNA-372 and - 373</td><td> testicular germ cell tumors.</td>

<td> miR-142</td><td> B-cell leukemia</td>

<td> miR-17-19b cluster</td><td> B-cell lymphomas, lung cancer, hepatocellular carcinoma</td>

Tumor suppressor gene tropomysin 1 (TPM1) mRNA has been indicated as a target of miR-21. Myotrophin (mtpn) mRNA has been indicated as a target of miR 375.

In an even further aspect, the present invention relates to the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of a disease selected from the group consisting of: atherosclerosis, hypercholesterolemia and hyperlipidemia: cancer, glioblastoma, breast cancer, lymphoma, lung cancer; diabetes, metabolic disorders: myoblast differentiation; immune disorders.

The invention further refers to oligonucleotides according to the invention for the use in the treatment of from a disease selected from the group consisting of: atherosclerosis, hypercholesterolemia and hyperlipidemia; cancer, glioblastoma, breast cancer, lymphoma, lung cancer; diabetes, metabolic disorders; myoblast differentiation; immune disorders.

The invention provides for a method of treating a subject suffering from a disease or condition selected from from the group consisting of: atherosclerosis, hypercholesterolemia and hyperlipidemia; cancer, glioblastoma, breast cancer, lymphoma, lung cancer; diabetes,

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344 metabolic disorders; myoblast differentiation; immune disorders, the method comprising the step of administering an oligonucleotide or pharmaceutical composition of the invention to the subject in need thereof.

The invention further provides for a kit comprising a pharmaceutical composition according to the invention, and a second independent active ingredient that is an inhibitor of the VLDL assembly pathway, such as an ApoB inhibitor, or an MTP inhibitor.

Cancer

In an even further aspect, the present invention relates to the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of cancer. In another aspect, the present invention concerns a method for treatment of, or prophylaxis against, cancer, said method comprising administering an oligonucleotide of the invention or a pharmaceutical composition of the invention to a patient in need thereof.

Such cancers may include lymphoreticular neoplasia, lymphoblastic leukemia, brain tumors, gastric tumors, plasmacytomas, multiple myeloma, leukemia, connective tissue tumors, lymphomas, and solid tumors.

In the use of a compound of the invention for the manufacture of a medicament for the treatment of cancer, said cancer may suitably be in the form of a solid tumor. Analogously, in the method for treating cancer disclosed herein said cancer may suitably be in the form of a solid tumor.

Furthermore, said cancer is also suitably a carcinoma. The carcinoma is typically selected from the group consisting of malignant melanoma, basal cell carcinoma, ovarian carcinoma, breast carcinoma, non-small cell lung cancer, renal cell carcinoma, bladder carcinoma, recurrent superficial bladder cancer, stomach carcinoma, prostatic carcinoma, pancreatic carcinoma, lung carcinoma, cervical carcinoma, cervical dysplasia, laryngeal papillomatosis, colon carcinoma, colorectal carcinoma and carcinoid tumors. More typically, said carcinoma is selected from the group consisting of malignant melanoma, non-small cell lung cancer, breast carcinoma, colon carcinoma and renal cell carcinoma. The malignant melanoma is typically selected from the group consisting of superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, acral melagnoma, amelanotic melanoma and desmoplastic melanoma.

Alternatively, the cancer may suitably be a sarcoma. The sarcoma is typically in the form selected from the group consisting of osteosarcoma, Ewing’s sarcoma, chondrosarcoma, malignant fibrous histiocytoma, fibrosarcoma and Kaposi’s sarcoma.

Alternatively, the cancer may suitably be a glioma.

A further embodiment is directed to the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of cancer, wherein said

CA 02701547 2016-02-01 medicament further comprises a chemotherapeutic agent selected from the group consisting of adrenocorticosteroids, such as prednisone, dexamethasone or decadron™; altretamine (hexalen™, hexamethylmelamine (HMM)); amifostine (ethyol™); aminoglutethimide (cytadren™); amsacrine (MAMSA); anastrozole (arimidex™); androgens, such as testosterone; asparaginase (elspar™); bacillus calmette-gurin; bicalutamide (casodex™); bleomycin (blenoxane™); busulfan (myleran™); carboplatin (paraplatin™); carmustine (BCNU, BiCNU™); chlorambucil (leukeran™); chlorodeoxyadenosine (2CDA, cladribine, leustatin™); cisplatin (platinol™); cytosine arabinoside (cytarabine); dacarbazine (DTIC™); dactinomycin (actinomycin-D, cosmegen™); daunorubicin (cerubidine™); docetaxel (taxotere™); doxorubicin (adriamycin™); epirubicin; estramustine (emcyt™); estrogens, such as diethylstilbestrol (DES); etopside (VP-16, VePesid™, etopophos™); fludarabine (fludara™); flutamide (eulexin™); 5-FUDR (floxuridine); 5-fluorouracil (5-FU), gemcitabine (gemzar™); goserelin (zodalex™); herceptin™ (trastuzumab); hydroxyurea (hydrea™); idarubicin (idamycin™); ifosfamide; IL-2 (proleukin™, aldesleukin); interferon alpha (intron A™, roferon A™); irinotecan (camptosar™); leuprolide (lupron™); levamisole (ergamisol™); lomustine (CCNU); mechlorathamine (mustargen™, nitrogen mustard); melphalan (alkeran™); mercaptopurine (purinethol™, 6-MP); methotrexate (mexate™); mitomycin-C (mutamucin); mitoxantrone (novantrone™); octreotide (sandostatin™); pentostatin (2-deoxycoformycin, nipent™); plicamycin (mithramycin, mithracin™); prorocarbazine (matulane™); streptozocin; tamoxifin (nolvadex™); taxol™ (paclitaxel); teniposide (vumon™, VM-26); thiotepa; topotecan (hycamtin™); tretinoin (vesanoid™, all-trans retinoic acid); vinblastine (velban™); vincristine (oncovin™) and vinorelbine (navelbine™). Suitably, the further chemotherapeutic agent is selected from taxanes such as Taxol™, Paclitaxel or Docetaxel.

Similarly, the invention is further directed to the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of cancer, wherein said treatment further comprises the administration of a further chemotherapeutic agent selected from the group consisting of adrenocorticosteroids, such as prednisone, dexamethasone or decadron™; altretamine (hexalen™, hexamethylmelamine (HMM)); amifostine (ethyol™); aminoglutethimide (cytadren™); amsacrine (M-AMSA); anastrozole (arimidex™); androgens, such as testosterone; asparaginase (elspar™); bacillus calmette-gurin; bicalutamide (casodex™); bleomycin (blenoxane™); busulfan (myleran™); carboplatin (paraplatin™); carmustine (BCNU, BiCNU™); chlorambucil (leukeran™); chlorodeoxyadenosine (2-CDA, cladribine, leustatin™); cisplatin (platinol™); cytosine arabinoside (cytarabine™); dacarbazine (DTIC™); dactinomycin (actinomycin-D, cosmegen™); daunorubicin (cerubidine™); docetaxel (taxotere™); doxorubicin (adriamycin™); epirubicin; estramustine (emcyt™); estrogens, such as diethylstilbestrol (DES); etopside (VP-16, VePesid™, etopophos™); fludarabine (fludara™); flutamide (eulexin™); 5-FUDR (floxuridine); 5-fluorouracil (5-FU); gemcitabine (gemzar™); goserelin (zodalex™); herceptin™ (trastuzumab); hydroxyurea (hydrea™); idarubicin (idamycin™); ifosfamide; IL-2 (proleukin™, aldesleukin); interferon alpha (intron A™, roferon A™); irinotecan (camptosar™); leuprolide (lupron™); levamisole (ergamisol™);

CA 02701547 2016-02-01 lomustine (CCNU); mechlorathamine (mustargen™. nitrogen mustard); melphalan (alkeran™); mercaptopurine (purinethol™, 6-MP); methotrexate (mexate™); mitomycin-C (mutamucin); mitoxantrone (novantrone™); octreotide (sandostatin™); pentostatin (2-deoxycoformycin, nipent™); plicamycin (mithramycin, mithracin™); prorocarbazine (matulane™); streptozocin; tamoxifin (nolvadex™); taxol™ (paclitaxel); teniposide (vumon™, VM-26); thiotepa; topotecan (hycamtin™); tretinoin (vesanoid™, all-trans retinoic acid); vinblastine (velban™); vincristine (oncovin™) and vinorelbine (navelbine™). Suitably, said treatment further comprises the administration of a further chemotherapeutic agent selected from taxanes, such as Taxol™, Paclitaxel or Docetaxel.

Alternatively stated, the invention is furthermore directed to a method for treating cancer, said method comprising administering an oligonucleotide of the invention or a pharmaceutical composition according to the invention to a patient in need thereof and further comprising the administration of a further chemotherapeutic agent. Said further administration may be such that the further chemotherapeutic agent is conjugated to the compound of the invention, is present in the pharmaceutical composition, or is administered in a separate formulation.

Infectious diseases

It is contemplated that the compounds of the invention may be broadly applicable to a broad range of infectious diseases, such as diphtheria, tetanus, pertussis, polio, hepatitis B, hepatitis C, hemophilus influenza, measles, mumps, and rubella.

Hsa-miR122 is indicated in hepatitis C infection and as such oligonucleotides according to the invention which target miR-122 may be used to treat Hepatitus C infection.

Accordingly, in yet another aspect the present invention relates the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of an infectious disease, as well as to a method for treating an infectious disease, said method comprising administering an oligonucleotide according to the invention or a pharmaceutical composition according to the invention to a patient in need thereof.

In a preferred embodiment, the invention provides for a combination treatment providing an anti miR-122 oligomer in combination with an inhibitor of VLDL assembly, such as an inhibitor of apoB, or of MTP.

Inflammatory diseases

The inflammatory response is an essential mechanism of defense of the organism against the attack of infectious agents, and it is also implicated in the pathogenesis of many acute and chronic diseases, including autoimmune disorders. In spite of being needed to fight pathogens, the effects of an inflammatory burst can be devastating. It is therefore often necessary to restrict the symptomatology of inflammation with the use of anti-inflammatory drugs. Inflammation is a complex process normally triggered by tissue injury that includes activation of a large array of enzymes, the increase in vascular permeability and extravasation

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 of blood fluids, cell migration and release of chemical mediators, all aimed to both destroy and repair the injured tissue.

In yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of an inflammatory disease, as well as to a method for treating an inflammatory disease, said method comprising administering an oligonucleotide according to the invention or a pharmaceutical composition according to the invention to a patient in need thereof.

In one preferred embodiment of the invention, the inflammatory disease is a rheumatic disease and/or a connective tissue diseases, such as rheumatoid arthritis, systemic lupus erythematous (SLE) or Lupus, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn’s disease, vasculitis, psoriatic arthritis, exfoliative psoriatic dermatitis, pemphigus vulgaris and Sjorgren’s syndrome, in particular inflammatory bowel disease and Crohn's disease.

Alternatively, the inflammatory disease may be a non-rheumatic inflammation, like bursitis, synovitis, capsulitis, tendinitis and/or other inflammatory lesions of traumatic and/or sportive origin.

Metabolic diseases

A metabolic disease is a disorder caused by the accumulation of chemicals produced naturally in the body. These diseases are usually serious, some even life threatening. Others may slow physical development or cause mental retardation. Most infants with these disorders, at first, show no obvious signs of disease. Proper screening at birth can often discover these problems. With early diagnosis and treatment, metabolic diseases can often be managed effectively.

In yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a medicament for the treatment of a metabolic disease, as well as to a method for treating a metabolic disease, said method comprising administering an oligonucleotide according to the invention or a conjugate thereof, or a pharmaceutical composition according to the invention to a patient in need thereof.

In one preferred embodiment of the invention, the metabolic disease is selected from the group consisting of Amyloidosis, Biotinidase, OMIM (Online Mendelian Inheritance in Man), Crigler Najjar Syndrome, Diabetes, Fabry Support &amp; Information Group, Fatty acid Oxidation Disorders, Galactosemia, Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency, Glutaric aciduria, International Organization of Glutaric Acidemia, Glutaric Acidemia Type I, Glutaric Acidemia, Type II, Glutaric Acidemia Type 1, Glutaric Acidemia Type-ll, F-HYPDRR - Familial Hypophosphatemia, Vitamin D Resistant Rickets, Krabbe Disease, Long chain 3 hydroxyacyl CoA dehydrogenase deficiency (LCHAD), Mannosidosis Group, Maple Syrup Urine Disease,

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344

Mitochondrial disorders, Mucopolysaccharidosis Syndromes: Niemann Pick, Organic acidemias, PKU, Pompe disease, Porphyria, Metabolic Syndrome, Hyperlipidemia and inherited lipid disorders, Trimethylaminuria: the fish malodor syndrome, and Urea cycle disorders.

Liver disorders

In yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a medicament for the treatment of a liver disorder, as well as to a method for treating a liver disorder, said method comprising administering an oligonucleotide according to the invention or a conjugate thereof, or a pharmaceutical composition according to the invention to a patient in need thereof.

In one preferred embodiment of the invention, the liver disorder is selected from the group consisting of Biliary Atresia, Alagille Syndrome, Alpha-1 Antitrypsin, Tyrosinemia, Neonatal Hepatitis, and Wilson Disease.

Other uses

The oligonucleotides of the present invention can be utilized for as research reagents for diagnostics, therapeutics and prophylaxis. In research, the oligonucleotide may be used to specifically inhibit the synthesis of target genes in cells and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. In diagnostics the oligonucleotides may be used to detect and quantitate target expression in cell and tissues by Northern blotting, in-situ hybridisation or similar techniques. For therapeutics, an animal or a human, suspected of having a disease or disorder, which can be treated by modulating the expression of target is treated by administering the oligonucleotide compounds in accordance with this invention. Further provided are methods of treating an animal particular mouse and rat and treating a human, suspected of having or being prone to a disease or condition, associated with expression of target by administering a therapeutically or prophylactically effective amount of one or more of the oligonucleotide compounds or compositions of the invention.

Therapeutic use of oligonucleotides targeting miR-122a

We have demonstrated that a LNA-antimiR, targeting miR-122a reduces plasma cholesterol levels. Therefore, another aspect of the invention is use of the above described oligonucleotides targeting miR-122a as medicine.

Still another aspect of the invention is use of the above described oligonucleotides targeting miR-122a for the preparation of a medicament for treatment of increased plasma cholesterol levels (or hypercholesterolemia and related disorders). The skilled man will appreciate that increased plasma cholesterol levels is undesireable as it increases the risk of various conditions, e.g. atherosclerosis.

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

Still another aspect of the invention is use of the above described oligonucleotides targeting miR-122a for upregulating the mRNA levels of Nrdg3, Aldo A, Bckdk or CD320. EMBODIMENTS

The following embodiments of the present invention may be used in combination with the other embodiments described herein.

1. A pharmaceutical composition comprising an oligomer of between 6-12 nucleotides in length, wherein said oligomer comprises a contiguous nucleotide sequence of a total of between 6-12 nucleotides, such as 6, 7, 8, 9, 10, 11 or 12 nucleotide units, wherein at least 50% of the nucleobase units of the oligomer are high affinity nucleotide analogue units, and a pharmaceutically acceptable diluent, carrier, salt or adjuvant.

2. The pharmaceutical composition according to embodiment 1, wherein the contiguous nucleotide sequence is complementary to a corresponding region of a mammalian, human or viral microRNA (miRNA) sequence.

3. The pharmaceutical composition according to embodiment 2, wherein the contiguous nucleotide sequence is complementary to a corresponding region of a miRNA sequence selected from the group of miRNAs listed in any one of tables 3, 4 or 5.

4. The pharmaceutical composition according to embodiment 2 or 3, wherein the contiguous nucleotide sequence consists of or comprises a sequence which is complementary to the seed sequence of said microRNA.

5. The pharmaceutical composition according to any one of embodiments 2-4, wherein the contiguous nucleotide sequence consists of or comprises a sequence selected from any one of the sequences listed in table 3 or 4.

6. The pharmaceutical composition according to embodiment 4 or 5, wherein the 3’ nucleobase of the seedmer forms the 3’ most nucleobase of the contiguous nucleotide sequence, wherein the contiguous nucleotide sequence may, optionally, comprise one or two further 5’ nucleobases.

7. The pharmaceutical composition according to any one of embodiments 1-6, wherein said contiguous nucleotide sequence does not comprise a nucleotide which corresponds to the first nucleotide present in the micro RNA sequence counted from the 5’ end.

8. The pharmaceutical composition according to any one of embodiments 1-7, wherein the contiguous nucleotide sequence is complementary to a corresponding nucleotide sequence present in a miRNA selected from those shown in table 3 or 4 or 5.

9. The pharmaceutical composition according to embodiment 8, wherein said miRNA is selected from the group consisting of miR-1, miR-10b, miR-17-3p, miR-18, miR-19a, miR-19b, miR-20, miR-21, miR-34a, miR-93, miR-106a, miR-106b, miR-122, miR-133, miR-134, miR-138, miR-155, miR-192, miR-194, miR-221, miR-222, and miR-375.

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

10. The pharmaceutical composition according to any one of embodiments 1-9, wherein at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or all of the nucleobase units of the contiguous nucleotide sequence are nucleotide analogue units.

11. The pharmaceutical composition according to embodiment 10, wherein the nucleotide analogue units are selected from the group consisting of 2’-O_alkyl-RNA unit, 2’-OMe-RNA unit 2-amino-DNA unit, 2-fluoro-DNA unit, LNA unit, PNA unit, HNA unit INA unit, and a 2’MOE RNA unit

12. The pharmaceutical composition according to embodiment 10 or 11, wherein at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or all of the nucleobase units of the contiguous nucleotide sequence are Locked Nucleic Acid (LNA) nucleobase units.

13. The pharmaceutical composition according to embodiment 12, wherein all of the nucleobase units of the contiguous nucleotide sequence are LNA nucleobase units.

14. The pharmaceutical composition according to any one of embodiments 1-13, wherein the contiguous nucleotide sequence comprises or consists of 7, 8, 9 or 10, preferably contiguous, LNA nucleobase units.

15. The pharmaceutical composition according to any one of embodiments 1-14, wherein the oligomer consist of 7, 8, 9 or 10 contiguous nucleobase units and wherein at least 7 nucleobase units are nucleotide analogue units.

16. The pharmaceutical composition according to embodiment 15, wherein the nucleotide analogue units are Locked Nucleic Acid (LNA) nucleobase units.

17. The pharmaceutical composition according to embodiment 15, wherein the nucleotide analogue units in the molecule consists of a mixture of at least 50% LNA units and up to 50 % other nucleotide analogue units.

18. The pharmaceutical composition according to any one of embodiments 1-17, wherein at least 75%, such as 80% or 85% or 90% or 95% or all of the intemucleoside linkages present between the nucleobase units of the contiguous nucleotide sequence are phosphorothioate intemucleoside linkages.

19. The pharmaceutical composition according to any one of embodiments 1-18, wherein said oligomer is conjugated with one or more non-nucleobase compounds.

20. The pharmaceutical composition according to any one of embodiments 1-19, wherein the contiguous nucleotide sequence is complementary to the corresponding sequence of at least two miRNA sequences such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA sequences.

21. The pharmaceutical composition according to any one of embodiments 1 - 20, wherein the contiguous nucleotide sequence consists or comprises of a sequence which is complementary to the sequence of at least two miRNA seed region sequences such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA seed region sequences.

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344

22. The pharmaceutical composition according to any one of embodiments 20 or 21, wherein the contiguous nucleotide sequence is complementary to the corresponding region of both miR-221 and miR-222.

23. The pharmaceutical composition according to embodiment 22, wherein the contiguous nucleotide sequence consists or comprises of a sequence that is complementary to 5’GCUACAU3’.

24. The pharmaceutical composition according to any one of embodiments 1 - 23, wherein the oligomer is constituted as a prodrug.

25. The pharmaceutical composition according to any one of embodiments 1 - 24, wherein the contiguous nucleotide sequence is complementary to a corresponding region of has-miR122.

26. The pharmaceutical composition according to embodiment 25, for use in the treatment of a medical disorder or disease selected from the group consisting of: hepatitis C virus infection and hypercholesterolemia and related disorders.

27. The pharmaceutical composition according to embodiment 25 or 26, wherein the composition further comprises a second independent active ingredient that is an inhibitor of the VLDL assembly pathway, such as an ApoB inhibitor, or an MTP inhibitor.

28. A kit comprising a pharmaceutical composition according to embodiment 25 or 26, and a second independent active ingredient that is an inhibitor of the VLDL assembly pathway, such as an ApoB inhibitor, or an MTP inhibitor.

29. A method for the treatment of a disease or medical disorder associated with the presence or overexpression of a microRNA, comprising the step of administering a the pharmaceutical composition) according to any one of embodiments 1 - 28 to a patient who is suffering from, or is likely to siffer from said disease or medical disorder.

30. An oligomer, as defined according to anyone of embodiments 1 - 25.

31. A conjugate comprising the oligomer according to embodiment 30, and at least one nonnucleobase compounds.

32. The use of an oligomer or a conjugate as defined in any one of embodiments 30 - 31, for the manufacture of a medicament for the treatment of a disease or medical disorder associated with the presence or over-expression of the microRNA.

33. A method for reducing the amount, or effective amount, of a miRNA in a cell, comprising administering an oligomer, a conjugate or a pharmaceutical composition, according to any one of the proceeding embodiments to the cell which is expressing said miRNA so as to reduce the amount, or effective amount of the miRNA in the cell.

34. A method for de-repression of a mRNA whose expression is repressed by a miRNA in a cell comprising administering an oligomer, a conjugate or a pharmaceutical composition,

CA 02701547 2016-02-01

WO 2009/943353

PCT/DK2008/000344 according to any one of the proceeding embodiments to the cell to the cell which expressed both said mRNA and said miRNA, in order to de-repress the expression of the mRNA. References: Details of the reference are provided in the priority documents.

EXAMPLES

LNA Monomer and oligonucleotide synthesis were performed using the methodology referred to in Examples 1 and 2 of W02007/112754. The stability of LNA oligonucletides in human or rat plasma is performed using the methodology referred to in Example 4 of W02007/112754. The treatment of in vitro cells with LNA anti-miR antisense oligonucleotide (targeting miR-122) is performed using the methodology referred to in Example 6 of W02007/112754. The analysis of Oligonucleotide Inhibition of miR expression by microRNA specific quantitative PCR in both an in vitro and in vivo model is performed using the methodology referred to in Example 7 of W02007/112754. The assessment of LNA antimir knock-down specificity using miRNA microarray expression profiling is performed using the methodology referred to in Example 8 of W02007/112754. The detection of microRNAs by in situ hybridization is performed using the methodology referred to in Example 9 of W02007/112754. The Isolation and analysis of mRNA expression (total RNA isolation and cDNA synthesis for mRNA analysis) in both an in vitro and in vivo model is performed using the methodology referred to in Example 10 of

W02007/112754. In vivo Experiments using Oligomers of the invention targeting microRNA122. and subsequent analysis are performed using the methods disclosed in Examples 11-27 of W02007/112754.

Example 1: Design of the LNAantimiR oligonucleotides and melting temperatures

Table 2 - Oligomers used in the examples and figures. The SEQ# is an identifier used throughout the examples and figures — the SEQ ID NO which is used in the sequence listing is also provided.

<td> Example/Figure SEQ#</td><td> SEQ ID NO</td><td> Compound Sequence</td><td> Comment -</td>

<td> #3204</td><td> 1</td><td> TcAGtCTGaTaAgCT</td><td></td>

<td> #3205</td><td> 2</td><td> GATAAGCT</td><td></td>

<td> #3206</td><td> 3</td><td> TcAcAATtaGCAtTA</td><td></td>

<td> #3207</td><td> 4</td><td> TAGCATTA</td><td></td>

<td> #4</td><td> 5</td><td> CcAttGTcaCaCtCC</td><td></td>

<td> _#3208____ #3209</td><td> I I I I I I</td><td> CACACTCC_ TAAGCT</td><td> „—,------------— -----</td>

<td> #3210</td><td> 8</td><td> ATAAGCT</td><td></td>

<td> #3211</td><td> 9</td><td> TGATAAGCT</td><td></td>

<td> #3212</td><td> 10</td><td> CTGATAAGCT</td><td></td>

<td> #3213</td><td> 11</td><td> GTCTGATAAGCT</td><td></td>

<td> #2114</td><td> 12</td><td> CAGTCTGATAAGCT</td><td></td>

CA 02701547 2010-04-01

WO 2009/043353

PCT7DK2008/000344

<td> #3215</td><td> 13</td><td> TCTGATAA</td><td></td>

<td> #3216</td><td> 14</td><td> ATCAGTCT</td><td></td>

<td> #3217</td><td> 15</td><td> TCAACATC</td><td></td>

<td> #3218/#3230</td><td> 16</td><td> GGTAAACT</td><td> Underline = mismatch</td>

<td> #3219</td><td> 17</td><td> CGTAATGA</td><td> Underline = mismatch</td>

<td> #3220</td><td> 18</td><td> TCAgtctgataaGCTa</td><td> 5’ fluorescent label (FAM)</td>

<td> #3221</td><td> 19</td><td> AGCACTTT</td><td></td>

<td> #3222</td><td> 20</td><td> ATTTGCAC</td><td></td>

<td> #3223</td><td> 21</td><td> AgCagACaaTgTaGC</td><td> 5’ fluorescent label (FAM)</td>

<td> #3224</td><td> 22</td><td> GtAgcCAgaTgTaGC</td><td> 5’ fluorescent label (FAM)</td>

<td> #3225</td><td> 23</td><td> ATGTAGC</td><td></td>

<td> #3226</td><td> 24</td><td> ACa AcCTacTaCcTC</td><td></td>

<td> #3227</td><td> 25</td><td> ACTACCTC</td><td></td>

<td> #3228</td><td> 26</td><td> CaCtgTCagCaCtTT</td><td></td>

<td> #3229</td><td> 27</td><td> TgCatAGatTtGcAC</td><td></td>

<td> #3231</td><td> 28</td><td> GTAGACT</td><td></td>

<td> #3232</td><td> 29</td><td> TACCTC</td><td></td>

<td> #3233</td><td> 30</td><td> CTACCTC</td><td></td>

<td> #3234</td><td> 31</td><td> TNCTACCTC</td><td> N = universal base.</td>

<td> #3235</td><td> 32</td><td> TNCTACCTC</td><td> N = universal base.</td>

<td> #3236</td><td> 33</td><td> OCa AcCTacTaCcT C</td><td></td>

<td> #3237</td><td> 34</td><td> ACaAcCT ccTaCcTC</td><td></td>

<td> #3238</td><td> 35</td><td> ACaAaCTacTaCcTC</td><td></td>

<td> #3239</td><td> 36</td><td> CTACCTC</td><td></td>

<td> #3240</td><td> 37</td><td> CTAACTC</td><td></td>

<td> #3241</td><td> 38</td><td> TTAGCATTA</td><td></td>

<td> #3242</td><td> 39</td><td> CGATTAGCATTA</td><td></td>

<td> #3243</td><td> 977</td><td> CACGATTAGCATTA</td><td></td>

<td> #3244</td><td> 978</td><td> GCATTA</td><td></td>

<td> #3245</td><td> 979</td><td> AGCATTA</td><td></td>

<td> #3246</td><td> 980</td><td> ATTAGCATTA</td><td></td>

<td colspan="4"> Capital and lower case letters denote LNA and DNA, respectively. LNA cytosines are preferably methyl cytosine/5’methyl-cytosine* All intemucleoside linkages are preferably phosphorothioate* All LNA may, for example, be beta-D-oxy LNA* *Used in the specific examples.</td>

Example 2: In vitro model: Cell culture

The effect of LNA oligonucleotides on target nucleic acid expression (amount) can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. Target can be expressed endogenously or by transient or stable transfection of a nucleic 5 acid encoding said nucleic acid.

The expression level of target nucleic acid can be routinely determined using, for example, Northern blot analysis (including microRNA northern), Quantitative PCR (including microRNA qPCR), Ribonuclease protection assays. The following cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the 10 cell type chosen.

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

Cells were cultured in the appropriate medium as described below and maintained at 37°C at 95-98% humidity and 5% CO₂. Cells were routinely passaged 2-3 times weekly.

15PC3: The human prostate cancer cell line 15PC3 was kindly donated by Dr. F. Baas, Neurozintuigen Laboratory, AMC, The Netherlands and was cultured in DMEM (Sigma) + 10% fetal bovine serum (FBS) + Glutamax I + gentamicin.

PC3: The human prostate cancer cell line PC3 was purchased from ATCC and was cultured in F12 Coon’s with glutamine (Gibco) + 10% FBS + gentamicin.

518A2: The human melanoma cancer cell line 518A2 was kindly donated by Dr. B. Jansen, Section of experimental Oncology, Molecular Pharmacology, Department of Clinical Pharmacology, University of Vienna and was cultured in DMEM (Sigma) + 10% fetal bovine serum (FBS) + Glutamax I + gentamicin.

HeLa: The cervical carcinoma cell line HeLa was cultured in MEM (Sigma) containing 10% fetal bovine serum gentamicin at 37°C, 95% humidity and 5% CO₂.

MPC-11: The murine multiple myeloma cell line MPC-11 was purchased from ATCC and maintained in DMEM with 4mM Glutamax+ 10% Horse Serum.

DU-145: The human prostate cancer cell line DU-145 was purchased from ATCC and maintained in RPMI with Glutamax + 10% FBS.

RCC-4 +/- VHL: The human renal cancer cell line RCC4 stably transfected with plasmid expressing VHL or empty plasmid was purchased from ECACC and maintained according to manufacturers instructions.

786-0: The human renal cell carcinoma cell line 786-0 was purchased from ATCC and maintained according to manufacturers instructions

HUVEC: The human umbilical vein endothelial cell line HUVEC was purchased from Camcrex and maintained in EGM-2 medium.

K562: The human chronic myelogenous leukaemia cell line K562 was purchased from ECACC and maintained in RPMI with Glutamax + 10% FBS. U87MG: The human glioblastoma cell line U87MG was purchased from ATCC and maintained according to the manufacturers instructions.

B16: The murine melanoma cell line B16 was purchased from ATCC and maintained according to the manufacturers instructions.

LNCap: The human prostate cancer cell line LNCap was purchased from ATCC and maintained in RPMI with Glutamax + 10% FBS

Huh-7: Human liver, epithelial like cultivated in Eagles MEM with 10 % FBS, 2mM Glutamax I, 1x non-essential amino acids, Gentamicin 25 pg/ml

CA 02701547 2016-02-01

WO 2009/043353 PCT7DK2008/000344

L428: (Deutsche Sammlung für Mikroorganismen (DSM, Braunschwieg, Germany))·. Human B cell lymphoma maintained in RPMI1640 supplemented with 10% FCS, L-glutamine and antibiotics.

L1236: (Deutsche Sammlung fur Mikroorganismen (DSM, Braunschwieg, Germany)): Human B cell lymphoma maintained in RPMI 1640 supplemented with 10% FCS, L-glutamine and antibiotics.

Example 3: Design of a LNA antimiR library for ail human microRNA sequences in miRBase microRNA database.

The miRBase version used was version 12, as reported in Griffiths-Jones, S., Grocock, R.J., van Dongen, S., Bateman, A., Enright, A.J. 2006. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 34: D140-4.

Table 1 shows 7, 8 and 9mer nucleotide sequences comprising the seedmer sequence of micro RNA’s according to the miRBase micro RNA database. The seedmer sequence comprises the reverse complement of the microRNA seed region. In some emboidments the oligomer of the invention has a contiguous nucleotide sequence selected from the 7mer, 8mer or 9mer sequences. With respect to the 7mer, 8mer and 9mer sequences, in some embodiments, all the internucleoside linkages are phosphorothioate. The 7mer, 8mer and 9mer nucleotide sequences may consist of sequence of nucleotide analogues as described herein, such as LNA nucleotide analogues. LNA cytosines may be methyl-cytosine (5'methyi-cytosine). In some embodiments, the LNA is beta-D-oxy-LNA.

Table 3 provides a list of microRNAs grouped into those which can be targeted by the same seedmer oligomers, such as the 7, 8 or 9mers provided herein (see table 1 ).

<td> Table 3</td>

<td> hsa-let-7a*, hsa-let-7f-1 *</td>

<td> hsa-let-7a, hsa-)el-7b, hsa-let-7c, hsa-let-7d, hsa-let-7f, hsa-miR-98, hsa-let-7g, hsa-let-7i</td>

<td> hsa-miR-1, hsa-miR-206</td>

<td> hsa-miR-103, hsa-miR-107</td>

<td> hsa-miR-10a, hsa-rniR-10b</td>

<td> hsa-miR-125b, hsa-miR-125a-5p</td>

<td> hsa-miR-129*. hsa-miR-129-3p</td>

<td> hsa-miR-130a, hsa-miR-301a, hsa-miR-130b, hsa-miR-454, hsa-miR-301b</td>

<td> hsa-miR-133a, hsa-miR-133b</td>

<td> hsa-miR-135a, hsa-miR-135b</td>

<td> hsa-miR-141, hsa-miR-200a</td>

<td> hsa-miR-146a, hsa-miR-146b-5p</td>

<td> hsa-miR-152, hsa-miR-148b</td>

<td> hsa-miR-154*, hsa-miR-487a</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT7DK2008/000344

<td> hsa-miR-15a, hsa-miR-16, hsa-miR-15b, hsa-miR-195, hsa-miR-497</td>

<td> hsa-miR-17, hsa-miR-20a, hsa-miR-93, hsa-miR-106a, hsa-miR-106b, hsa-miR-20b, hsa-miR-526b*</td>

<td> hsa-miR-181a, hsa-miR-181c</td>

<td> hsa-miR-181b, hsa-miR-181d</td>

<td> hsa-miR-18a, hsa-miR-18b</td>

<td> hsa-miR-190, hsa-miR-190b</td>

<td> hsa-miR-192, hsa-miR-215</td>

<td> hsa-miR-196a, hsa-miR-196b</td>

<td> hsa-miR-199a-3p, hsa-miR-199b-3p</td>

<td> hsa-miR-199a-5p, hsa-miR-199b-5p</td>

<td> hsa-miR-19a*, hsa-miR-19b-1*, hsa-miR-19b-2*</td>

<td> hsa-miR-19a, hsa-miR-19b</td>

<td> hsa-miR-200b, hsa-miR-200c</td>

<td> hsa-miR-204, hsa-miR-211</td>

<td> hsa-miR-208a, hsa-miR-208b</td>

<td> hsa-miR-212, hsa-miR-132</td>

<td> hsa-miR-23a* hsa-miR-23b*</td>

<td> hsa-miR-23a, hsa-miR-23b, hsa-miR-130a*</td>

<td> hsa-miR-24-1*, hsa-miR-24-2*</td>

<td> hsa-miR-25, hsa-miR-92a, hsa-miR-367, hsa-miR-92b</td>

<td> hsa-miR-26a, hsa-miR-26b</td>

<td> hsa-miR-26a-1*, hsa-miR-26a-2*</td>

<td> hsa-miR-27a, hsa-miR-27b</td>

<td> hsa-miR-29a, hsa-miR-29b, hsa-miR-29c</td>

<td> hsa-miR-302a, hsa-miR-302b, hsa-miR-302c, hsa-miR-302d, hsa-miR-373, hsa-miR-520e, hsa-miR520a-3p, hsa-miR-520b, hsa-miR-520c-3p, hsa-miR-520d-3p</td>

<td> hsa-miR-302b*, hsa-miR-302d*</td>

<td> hsa-miR-30a*. hsa-miR-30d*, hsa-miR-30e*</td>

<td> hsa-miR-30a, hsa-miR-30c, hsa-miR-30d, hsa-miR-30b, hsa-miR-30e</td>

<td> hsa-miR-330-5p, hsa-miR-326</td>

<td> hsa-miR-34a, hsa-miR-34c-5p, hsa-miR-449a, hsa-miR-449b</td>

<td> hsa-miR-362-3p, hsa-miR-329</td>

<td> hsa-miR-374a, hsa-miR-374b</td>

<td> hsa-miR-376a, hsa-miR-376b</td>

<td> hsa-miR-378, hsa-miR-422a</td>

<td> hsa-miR-379*, hsa-miR-411*</td>

<td> hsa-miR-381, hsa-miR-300</td>

<td> hsa-miR-509-5p, hsa-miR-509-3-5p</td>

<td> hsa-miR-515-5p, hsa-miR-519e*</td>

<td> hsa-miR-516b*, hsa-miR-516a-3p</td>

<td> hsa-miR-517a, hsa-miR-517c</td>

<td> hsa-miR-518a-5p, hsa-miR-527</td>

<td> hsa-miR-518f, hsa-miR-518b, hsa-miR-518c, hsa-miR-518a-3p, hsa-miR-518d-3p</td>

<td> hsa-miR-519c-3p, hsa-miR-519b-3p, hsa-miR-519a</td>

<td> hsa-miR-519c-5p, hsa-miR-519b-5p, hsa-miR-523*, hsa-miR-518f*, hsa-miR-526a, hsa-miR-520c-</td>

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

5p, hsa-miR-518e*, hsa-miR-518d-5p, hsa-miR-522*, hsa-miR-519a* hsa-miR-519e, hsa-miR-33b* hsa-miR-520a-5p, hsa-miR-525-5p hsa-miR-520g, hsa-miR-520h hsa-miR-524-5p, hsa-miR-520d-5p hsa-miR-525-3p, hsa-miR-524-3p hsa-miR-548b-5p, hsa-miR-548a-5p, hsa-miR-548c-5p, hsa-miR-548d-5p hsa-miR-7-1*, hsa-miR-7-2* hsa-miR-99a, hsa-miR-100, hsa-miR-99b

We have constructed an 8-mer LNA-antimiR against miR-21, miR-155 and miR-122 (designated here as micromiR) that is fully LNA modified and phosphorothiolated (see figure 1 and Table 6). Our results from repeated experiments in MCF-7, HeLa, Raw and Huh-7 cells using a luciferase sensor plasmid for miR-21, miR-155 and miR-122 demonstrate that the fully LNA-modified short LNA-antimiRs are highly potent in antagonizing microRNAs.

<td colspan="4"> Table 4. LNA_antimiR &amp; MicromiR sequences and predicted T_ms</td>

<td> SEQ ID #</td><td> microRNA</td><td> sequence</td><td> T_m (°C)</td>

<td> 3204</td><td> miR-21</td><td> TcAGtCTGaTaAgCT</td><td> 73</td>

<td> 3205</td><td></td><td> GATAAGCT</td><td> 33</td>

<td> 3206</td><td> miR-155</td><td> TcAcAATta G CAtTA</td><td> 63</td>

<td> 3207</td><td></td><td> TAGCATTA</td><td> 45</td>

<td> 4</td><td> miR-122</td><td> CcAttGTcaCaCtCC</td><td> 73</td>

<td> 3208</td><td></td><td> CACACTCC</td><td> 62</td>

<td colspan="4"> Capital letters are LNA units, such as beta-D-oxy LNA. Lower case letters are DNA units. Intemucleoside linkages are preferably phosphorothioate. LNA cytosines are all preferably methylated/5-methyl cytosine.</td>

The melting temperatures can be assessed towards the mature microRNA sequence, using a synthetic microRNA oligonucleotide (typically consisting of RNA nucleotides with a phosphodiester backbone). Typically measured TmS are higher than predicted T_ms when using LNA oligomers against the RNA target.

Example 4: Assessment of miR-21 antagonism by SEQ ID #3205 LNA-antimiR in MCF-7 cells using a luciferase sensor assay.

In order to assess the efficiency of a fully LNA-modified 8-mer LNA-antimiR (SEQ ID #3205) oligonucleotide in targeting and antagonizing miR-21, luciferase sensor constructs were made containing a perfect match target site for the mature miR-21 and as control, a target site with two mutations in the seed (Fig. 6). In order to monitor microRNA-21 inhibition, the breast carcinoma cell line MCF-7 was transfected with the different luciferase constructs together with the miR-21 antagonist SEQ ID #3205 at varying concentrations in comparison with a 15-mer LNA-antimiR SEQ ID #3204 against miR-21. After 24 hours, luciferase activity was measured.

Results: As seen in Figure 2, the new fully LNA-modified 8-mer LNA-antimiR (SEQ ID #3205) shows two-fold higher potency compared to SEQ ID #3204, as shown by de-repression of the

CA 02701547 2016-02-01

WO 2009/043353 PCT/DK2008/000344 luciferase activity. By contrast, the control miR-21 sensor construct with two mismatches in the miR-21 seed did not show any de-repression of the firefly luciferase activity, thereby demonstrating the specificity of the perfect match miR-21 sensor in monitoring miR-21 activity in cells. The de-repression of luciferase activity by the 8-mer LNA-antimiR is clearly dosedependent, which is not seen with SEQ ID #3204. Moreover, the new 8-mer is also much more potent at lower doses than SEQ ID #3204.

To conclude, the 8-mer LNA-antimiR (SEQ ID #3205) shows significantly improved potency in inhibition of miR-21 in vitro compared to the 15-mer LNA-antimiR SEQ ID #3204 targeting miR-

21.

Materials and Methods:

Cell line: The breast carcinoma cell line MCF-7 was purchased from ATCC (#HTB-22™). MCF7 cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 400.000 cells were seeded per well in a 6-well plate the day before transfection in order to receive 50-70% confluency the next day. On the day of transfection, MCF-7 cells were transfected with 0.8 ug miR-21 perfect match/psiCHECK2, miR-21.mm2/psiCHECK2 or empty psiCHECK2 vector (SDS Promega™) together with 1 pl Lipofectamine2000™ (Invitrogen™) according to manufacturer’s instructions. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and harvested with cell scraper, after which cells were centrifugated for 5 min at 10.000 rpm. The supernatant was discarded and 50 ,ul 1 x Passive Lysis Buffer (Promega™) was added to the cell pellet, after which cells were put on ice for 30 min. The lysed cells were spinned at 10.000 rpm for 30 min after which 20 μΙ were transferred to a 96 well plate and luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 5: Assessment of miR-21 antagonism by SEQ ID #3205 LNA-antimiR in HeLa cells using a luciferase sensor assay.

To further assess the efficiency of the fully LNA-modified 8-mer LNA-antimiR SEQ ID #3205 in targeting miR-21, the cervix carcinoma cell line HeLa was also transfected with the previously described miR-21 luciferase sensor constructs alongside SEQ ID #3205 at varying concentrations as described in the above section (Figure 3).

Results: The SEQ ID #3205 shows complete de-repression of the miR-21 luciferase sensor construct in HeLa cells already at 5 nM compared to SEQ ID #3204, which did not show complete de-repression until the highest dose (50 nM). In addition, antagonism of miR-21 by the 8-mer SEQ ID #3205 LNA-antimiR is dose-dependent. To demonstrate the specificity of the

CA 02701547 2016-02-01

WO 2009/043353 PCT/1JK2008/000344 miR-21 luciferase sensor assay, a mismatched miR-21 target site (2 mismatches in seed) was also transfected into HeLa cells, but did not show any de-repression of the firefly luciferase activity.

To conclude, the fully LNA-modified SEQ ID #3205 shows significantly improved potency in inhibition of miR-21 in vitro, in both MCF-7 and HeLa cells compared to the 15-mer LNA-antimiR SEQ ID #3204.

Materials and Methods:

Cell line: The human cervix carcinoma cell line HeLa was purchased from ECACC (#93021013). HeLa cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 60.000 cells were seeded per well in a 24 well plate the day before transfection in order to receive 50-70% confluency the next day. On the day of transfection, HeLa cells were transfected with 0.2 ug miR-21perfect match/psiCHECK2™, miR-21.mm2/psiCHECK2™ or empty psiCHECK2™ vector together with 0,7 μΙ Lipofectamine2000 (Invitrogen) according to manufacturer’s instructions. After 24 hours, cells were harvested for luciferase measurements. Luciferase assay: The cells were washed with PBS and 100 μ! 1 x Passive Lysis Buffer (Promega) was added to each well, after which the 24 well plates was put on an orbital shaker for 30 min. The cells were collected and transferred to an eppendorf tube and spinned at 10.000 rpm for 30 min after which 10 μΙ were transferred to a 96 well plate and luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 6*. Assessment of miR-155 antagonism by SEQ ID #3207 LNA-antimiR in mouse RAW cells using a luciferase sensor assay.

To ask whether a fully LNA-modified 8-mer LNA-antimiR can effectively antagonize miR-155, a perfect match target site for miR-155 was cloned into the same luciferase vector (psiCHECK2™) and transfected into the mouse leukaemic monocyte macrophage RAW cell line. Because the endogenous levels of miR-155 are low in the RAW cell line, the cells were treated with 100 ng/ml LPS for 24 hours in order to induce miR-155 accumulation.

Results: Luciferase measurements showed that the fully LNA-modified 8-mer LNA-antimiR SEQ ID #3207 targeting miR-155 was similarly effective in antagonizing miR-155 compared to the 15-mer LNA-antimiR SEQ ID #3206 (Figure 4). Both LNA-antimirs showed a &gt;50% derepression of the miR-155 luciferase sensor at 0.25 nM concentration and inhibited miR-155 in a dose-dependent manner.

Conclusion; These data further support the results from antagonizing miR-21, as shown in examples 1 and 2, demonstrating that a fully thiolated 8-mer LNA-antimiR is highly potent in microRNA targeting.

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344

Materials and Methods:

Cell line: The mouse leukaemic monocyte macrophage RAW 264.7 was purchased from ATCC (TIB-71). RAW cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 4 mM Glutamax and 25 ug/ml Gentamicin.

Transfection: 500.000 cells were seeded per well in a 6 well plate the day before transfection in order to receive 50% confluency the next day. On the day of transfection, MCF-7 cells were transfected with 0.3 ug miR-155 or empty psiCHECK2 vector together with 10 μΙ Lipofectamine2000 (Invitrogen) according to manufacturer's instructions. In order to induce miR155 accumulation, LPS (100 ng/ml) was added to the RAW cells after the 4 hour incubation with the transfection complexes. After another 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and harvested with cell scraper, after which cells were centrifugated for 5 min at 2.500 rpm. The supernatant were discarded and 50 μΐ 1 x Passive Lysis Buffer (Promega) was added to the cell pellet, after which cells were put on ice for 30 min. The lysed cells were spinned at 10.000 rpm for 30 min after which 20 μΙ were transferred to a 96 well plate and luciferase measurments were performed according to manufacturer’s instructions (Promega).

Example 7: Assessment of miR-122 antagonism by SEQ ID #3208 LNA-antimiR in HuH-7 cells using a luciferase sensor assay.

The potency of the fully modified 8-mer LNA-antimiR SEQ ID #3208 against miR-122 was assessed in the human hepatoma cell line HuH-7. The HuH-7 cells were transfected with luciferase sensor construct containing a perfect match miR-122 target site. After 24 hours luciferase measurements were performed (Figure 5).

Results: The fully LNA-modified 8-mer LNA-antimiR SEQ ID #3208 is more potent than the 15mer LNA-antimiR SEQ ID #4 at low concentration, as shown by de-repression of the miR-122 luciferase sensor. Both LNA-antimiRs inhibit miR-122 in a dose-dependet manner (Figure 5). Conclusion: The fully LNA-modified 8-mer LNA-antimiR SEQ ID #3208 targeting miR-122 shows improved potency in inhibition of miR-122 in vitro.

Materials and Methods:

Cell line: The human hepatoma cell line HuH-7 was a kind gift from R. Bartenschlager, Heidelberg. Huh-7 cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 8.000 cells were seeded per well in a 96 well plate the day before transfection in order to receive 50-70% confluency the next day. On the day of transfection, HuH-7 cells were transfected with 57 ng miR-122 or empty psiCHECK2 vector together with 1 μΙ

CA 02701547 2010-04-01

WO 2009/043353 PC17DK2008/000344

Lipofectamine2000 (Invitrogen). After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: 50 μΙ 1 x Passive Lysis Buffer (Promega) was added to each well, after which the 96 well plate was put on an orbital shaker for 30 min. To each well the Dual-luciferase Reporter assay system (Promega) was added and luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 8. Assessment of miR-21 antagonism by comparing an 8-mer (SEQ ID #3205) versus a 15-mer (SEQ ID #3204) LNA-antimiR in human prostate carcinoma cells (PC3).

We have previously shown (patent application 1051), that an 8-mer LNA-antimiR that is fully LNA-modified and phosphorothiolated is able to completely de-repress the miR-21 luciferase reporter levels in the human cervix carcinoma cell line HeLa and partly de-repress the miR-21 luciferase reporter levels in the human breast carcinoma cell line MCF-7. We next extended this screening approach to the human prostate cancer cell line PC3. To assess the efficiency of the different LNA-antimiR oligonucleotides against miR-21, luciferase reporter constructs were generated in which a perfect match target site for the mature miR-21 and a target site with two mismatches in the seed were cloned in the 3’UTR of Renilla luciferase gene (Figure 7). In order to monitor miR-21 inhibition, PC3 cells were transfected with the different luciferase constructs together with the miR-21 antagonist SEQ ID #3205 (8-mer) and for comparison with the 15-mer LNA-antimiR perfect match SEQ ID #3204 at varying concentrations. After 24 hours, luciferase activity was measured.

Results: The luciferase reporter experiments showed a dose-dependent de-repression of the luciferase miR-21 reporter activity with the 15-mer LNA-antimiR against miR-21 (SEQ ID #3204). However, complete de-repression of the luciferase reporter was not obtained even at the highest concentrations (Figure 7). In contrast, the cells that were transfected with the 8-mer fully LNA substituted LNA-antimiR showed complete de-repression already at 1 nM, indicating significantly improved potency compared to the 15-mer LNA-antimiR. The luciferase control reporter harboring a mismatch target site for miR-21 was not affected by either LNA-antimiR, demonstrating high specificity of both LNA-antimiRs.

Conclusion: The micromer is far more potent than the 15-mer LNA-antimiR in targeting miR-21 and has so far shown to be most potent in prostate carcinoma cells.

Materials and Methods:

Cell line: The human prostate carcinoma PC3 cell line was purchased from ECACC (#90112714). PC3 cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax and 25 ug/ml Gentamicin.

Transfection: 100.000 cells were seeded per well in a 12-well plate the day before transfection in order to receive 50% confluency the next day. On the day of transfection, PC3 cells were

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 transfected with 0.3 μρ miR-21 or empty psiCHECK2 vector together with 1,2 μΙ Lipofectamine2000 (Invitrogen) according to manufacturer’s instructions. Transfected was also varying concentrations of LNA-antimiRs. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and 250 μΙ 1 x Passive Lysis Buffer (Promega) was added to the wells. The plates were placed on a shaker for 30 min., after which the cell lysates were transferred to eppendorf tubes. The cell lysate was centrifugated for 10 min at 2.500 rpm after which 20 μΙ were transferred to a 96 well plate and luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 9. Specificity assessment of miR-21 antagonism by an 8-mer LNA-antimiR

To investigate the specificity of our short LNA-antimiR targeting miR-21, we designed an 8-mer mismatch control LNA-antimiR (SEQ ID #3218) containing 2 mismatches in the seed recognition sequence (see Figure 8). The luciferase reporter constructs described in example 1 were transfected into the human cervix carcinoma cell line HeLa together with the LNA mismatch control oligo SEQ ID #3218 and its efficacy was compared with the 8-mer LNAantimiR (SEQ ID #3205) targeting miR-21. After 24 hours, luciferase activity was measured. Results: As shown in Figure 8, transfection of the fully LNA-modified 8-mer LNA-antimiR in HeLa cells resulted in complete de-repression of the luciferase miR-21 reporter already at 5 nM. In contrast, when the cells were transfected with the 8-mer LNA mismatch control oligo, combined with the results obtained with the control miR-21 luciferase reporter having two mismatches in the miR-21 seed, these data demonstrate high specificity of the fully LNAsubsituted 8-mer LNA-antimiR in targeting miR-21 in Hela cells.

Analysis of the miRBase microRNA sequence database showed that the miR-21 recognition sequence, of the LNA-antimiR SEQ ID #3205 is unique for microRNA-21. However, when decreasing the micromer length to 7 nt, it is not specific for only miR-21, since ath-miR-844, mmu-miR-590-3p and has-miR-590-3p are also targeted.

Conclusion:Exhanging two nucleotide positions within the 8-mer LNA-antimiR with two mismatching nucleotides completely abolished the antagonizing activity of the LNA-antimiR for miR-21.

Materials and Methods:

Cell line: The human cervix carcinoma cell line HeLa was purchased from ECACC (#93021013). HeLa cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 60.000 cells were seeded per well in a 24-well plate the day before transfection in order to receive 50-70% confluency the next day. On the day of transfection, HeLa cells were

CA 02701547 2016-02-01

WO 2009/043353 PCT7DK2008/000344 transfected with 0.2 ug miR-21 perfect match/psiCHECK2, miR-21.mm2/psiCHECK2 or empty psiCHECK2 vector together with 0,7 μ| Lipofectamine2000 (Invitrogen) according to manufacturer’s instructions. Transfected was also varying concentrations of LNA-antimiRs. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and 100 μ11 x Passive Lysis Buffer (Promega) was added to each well, after which the 24-well plates were put on an orbital shaker for 30 min. The cells were collected and transferred to an eppendorf tube and spinned at 10.000 rpm for 30 min after which 10 μΙ were transferred to a 96-well plate and luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 10. Assessment of the shortest possible length of a fully LNA-modified LNAantimiR that mediates effective antagonism of miR-21.

To further investigate the LNA-antimiR length requirements, we designed a 7-mer and a 6-mer LNA-antimiR targeting miR-21, both fully LNA-modified and phosphorothiolated oligonucleotides. The miR-21 luciferase reporter constructs were transfected into HeLa cells along with the LNA-antimiRs at varying concentrations. Luciferase measurements were performed after 24 hours.

Results: As seen in Figure 9, the 7-mer LNA-antimiR mediates de-repression of the miR-21 luciferase reporter plasmid, but at lower potency compared to the 8-mer LNA-antimiR (SEQ ID #3205). Nevertheless, a dose-dependent trend can still be observed. By contrast, the 6-mer LNA-antimiR did not show any inhibitory activity.

Conclusion: To conclude, the shortest possible length of an LNA-antimiR which is able to mediate miR-21 inhibition is 7 nucleotides. However, the 7-mer LNA-antimiR is less potent compared to the 8-mer LNA-antimiR for miR-21.

Materials and Methods:

Cell line: The human cervix carcinoma cell line HeLa was purchased from ECACC (#93021013). HeLa cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 60.000 cells were seeded per well in a 24 well plate the day before transfection in order to receive 50-70% confluency the next day. On the day of transfection, HeLa cells were transfected with 0.2 ug miR-21 perfect match/psiCHECK2, miR-21 .mm2/psiCHECK2 or empty psiCHECK2 vector together with 0,7 μΙ Lipofectamine2000™ (Invitrogen) according to manufacturer’s instructions. Transfected was also varying concentrations of LNA-antimiRs. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and 100 μΙ 1 x Passive Lysis Buffer (Promega) was added to each well, after which the 24-well plates was put on an orbital shaker

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 for 30 min. The cells were collected and transferred to an eppendorf tube and spinned at 10.000 rpm for 30 min after which 10 μΙ were transferred to a 96-well plate and luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 11. Length assessment of fully LNA-substituted LNA-antimiRs antagonizing miR-21

Next, we investigated the effect of increasing the length from a 9-mer to a 14-mer fully LNA substituted LNA-antimiRs on antagonizing miR-21 in HeLa cells. The resulting LNA-antimiRs were transfected into HeLa cells together with the miR-21 luciferase reporter constructs (Figure 10). Luciferase measurements were performed after 24 hours.

Results: The 9-mer LNA-antimiR SEQ ID #3211 (9-mer) showed dose-dependent derepression of the miR-21 luciferase reporter which did not reach complete de-repression, as demonstrated for the 7-mer LNA-antimiR (SEQ ID #3210). Increasing the length to 10-mer to

14-mer (SEQ ID #3212, SEQ ID #3213 and SEQ ID #3214) decreased the potency as shown by less efficient de-repression of the miR-21 reporter.

Conclusion: As shown in Figure 10, the longest folly LNA-modified and phosphorothiolated LNA-antimiR which is still able to mediate miR-21 inhibition is a 9-mer LNA-antimiR SEQ ID #3211. However, it is clearly less efficient than the 7-mer and 8-mer LNA-antimiRs.

Materials and Methods: Ceil line: The human cervix carcinoma cell line HeLa was purchased from ECACC (#93021013). HeLa cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 60.000 cells were seeded per well in a 24-well plate the day before transfection in order to achieve 50-70% confluency the next day. On the day of transfection, HeLa cells were transfected with 0.2 ug miR-21 perfect match/psiCHECK2, miR-21.mm2/psiCHECK2 or empty psiCHECK2 control vector without target site together with 0,7 μ! Lipofectamine2000 (Invitrogen) according to manufacturer’s instructions. Transfected was also varying concentrations of LNA-antimiRs. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and 100 μ11 x Passive Lysis Buffer (Promega) was added to each well, after which the 24-well plates were put on an orbital shaker for 30 min. The cells were collected and transferred to an eppendorf tube and spinned at 10.000 rpm for 30 min after which 10 μΙ were transferred to a 96-well plate and luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 12. Determination of the most optimal position for an 8-mer LNA-antimiR within the miR target recognition sequence.

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

Our experiments have shown that the most potent fully LNA-modified phosphorothiolated LNAantimiR is 8 nucleotides in length. To assess the most optimal position for an 8-mer LNAantimiR within the miR target recognition sequence, we designed four different fully LNAmodified 8-mer LNA-antimiRs tiled across the mature miR-21 sequence as shown in Figure 11. The different LNA-antimiRs were co-transfected together with the miR-21 luciferase reporter constructs into HeLa cells. Luciferase measurements were performed after 24 hours.

Results: The only LNA-antimiR that mediated efficient silencing of miR-21 as measured by the luciferase reporter was SEQ ID #3205, which targets the seed region of miR-21. Neither SEQ ID #3215 which was designed to cover the 3’end of the seed (50% seed targeting) did not show any effect, nor did the other two LNA-antimiRs SEQ ID #3216 or SEQ ID #3217, which were positioned to target the central region and the 3'end of the mature miR-21, respectively. Conclusion: The only 8-mer LNA-antimiR mediating potent silencing of miR-21 is the one targeting the seed of the miR-21.

Materials and Methods:

Cell line: The human cervix carcinoma cell line HeLa was purchased from ECACC (#93021013). HeLa cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Giutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 60.000 cells were seeded per well in a 24-well plate the day before transfection in order to achieve 50-70% confluency the next day. On the day of transfection, HeLa cells were transfected with 0.2 ug miR-21 perfect match/psiCHECK2, miR-21 .mm2/psiCHECK2 or empty psiCHECK2 vector together with 0,7 μΐ Lipofectamine2000 (Invitrogen) according to the manufacturer's instructions. Transfected was also varying concentrations of LNA-antimiRs. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and 100 μ11 x Passive Lysis Buffer (Promega) was added to each well, after which the 24-well plates was put on an orbital shaker for 30 min. The cells were collected and transferred to an eppendorf tube and spinned at 10.000 rpm for 30 min after which 10 μΙ were transferred to a 96 well plate and luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 13. Validation of interaction of the miR-21 target site in the Pdcd4-3'-UTR and miR-21 using the 8-mer SEQ ID #3205 LNA-antimiR.

The tumour suppressor protein Pdcd4 inhibits TPA-induced neoplastic transformation, tumour promotion and progression. Pdcd4 has also been shown to be upregulated in apoptosis in response to different inducers. Furthermore, downregulation of Pdcd4 in lung and colorectal cancer has also been associated with a poor patient prognosis. Recently, Asangani etal and Frankel et al showed that the Pdcd4-3'-UTR contains a conserved target site for miR-21, and

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 transfecting cells with an antimiR-21, resulted in an increase in Pdcd4 protein. We therefore constructed a luciferase reporter plasmid, harboring 313 nt of the 3'UTR region of Pdcd4 encompassing the aforementioned miR-21 target site, which was co-transfected together with different LNA-antimiRs into HeLa cells. The different LNA-antimiRs were; SEQ ID #3205 (8-mer, perfect match) or SEQ ID #3218 (8-mer, mismatch). Luciferase measurements were performed after 24 hours.

Results: As shown in Figure 12, in cells transfected with the Pdcd4 3’UTR luciferase reporter and SEQ ID #3205, an increase in luciferase activity was observed, indicating interaction between the Pdcd4 3'UTR and miR-21. However, transfecting the cells with the mismatch compound, SEQ ID #3218, no change in luciferase activity was observed, which was expected since the compound does not antagonize miR-21. When comparing the 8-mer LNA-antimiR against two longer designed LNA-antimiRs, the short fully LNA-modified and phosphorothiolated LNA-antimiR was significantly more potent, confirming previous luciferase assay data. Conclusion: These data conclude that SEQ ID #3205, which antagonizes miR-21, can regulate the interaction between Pdcd4 3'UTR and miR-21.

Materials and Methods:

Cell line: The human cervix carcinoma cell line HeLa was purchased from ECACC (#93021013). HeLa cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 60.000 cells were seeded per well in a 24-well plate the day before transfection in order to achieve 50-70% confluency the next day. On the day of transfection, HeLa cells were transfected with 0.2 ug Pdcd4-3'UTR/psiCHECK2 or empty psiCHECK2 vector together with 0,7 μΙ Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. Varying concentrations of the LNA-antimiR oligonucleotides were also transfected. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and 100 μ11 x Passive Lysis Buffer (Promega) was added to each well, after which the 24-well plates was put on an orbital shaker for 30 min. The cells were collected and transferred to an eppendorf tube and spinned at 10.000 rpm for 30 min after which 10 μΙ were transferred to a 96 well plate and luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 14. Comparison of an 8-mer LNA-antimiR (SEQ ID #3207) with a 15-mer LNAantimiR (SEQ ID #3206) in antagonizing miR-155 in mouse RAW cells.

To ask whether our approach of using short LNA-antimiRs could be adapted to targeting other miRNAs we designed a fully LNA-modified 8-mer LNA-antimiR against microRNA-155. A perfect match target site for miR-155 was cloned into the 3’UTR of the luciferase gene in the reporter

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 plasmid psiCHECK2 and transfected into the mouse RAW macrophage cell line together with an 8-mer or a 15-mer LNA-antimiR. Because the endogenous levels of miR-155 are low in the RAW cell line, the cells were treated with 100 ng/ml LPS for 24 hours in order to induce miR155 accumulation. After 24 hours, luciferase analysis was performed.

Results: Luciferase measurements showed that the fully LNA-modified 8-mer LNA-antimiR SEQ ID #3207 targeting miR-155 was similarly effective in antagonizing miR-155 compared to the 15-mer LNA-antimiR SEQ ID #3206 (Figure 13). Both LNA-antimiRs showed a &gt;50% derepression of the miR-155 luciferase sensor at 0.25 nM concentration and inhibited miR-155 in a dose-dependent manner.

Analysis of the miRBase microRNA sequence database showed that the miR-155 recognition sequence, of the LNA-antimiR SEQ ID #3207 is unique for microRNA-155. However, when decreasing the LNA-antimiR length to 7 nt, it is not specific for only miR-155, mdv1-miR-M4 and kshv-miR-K12-11 is also targeted.

.Conclusion: A fully LNA-modified and phosphorothiolated 8-mer LNA-antimiR is equally potent compared with a 15-mer LNA-antimiR of a mixed LNA/DNA design in antagonizing miR-155. Thus, our approach of using short LNA-antimiRs can be readily adapted to targeting of other miRNAs

Materials and Methods:

Cell line: The mouse macrophage RAW 264.7 cell line was purchased from ATCC (TIB-71). RAW cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 4 mM Glutamax and 25 ug/ml Gentamicin.

Transfection: 500.000 cells were seeded per well in a 6-weli plate the day before transfection in order to receive 50% confluency the next day. On the day of transfection, RAW 264.7 cells were transfected with 0.3 ug miR-155 perfect match/psiCHECK2 or empty psiCHECK2 vector together with 10 μΙ Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. Transfected was also varying concentrations of LNA-antimiRs. In order to induce miR-155 accumulation, LPS (100 ng/ml) was added to the RAW cells after the 4 hour incubation with the transfection complexes. After another 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and harvested with cell scraper, after which cells were spinned for 5 min at 2.500 rpm. The supernatant was discarded and 50 μ11 x Passive Lysis Buffer (Promega) was added to the cell pellet, after which cells were put on ice for 30 min. The lysed cells were spinned at 10.000 rpm for 30 min after which 20 μΙ were transferred to a 96-well plate and luciferase measurements were performed according to the manufacturer’s instructions (Promega).

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

Example 15. Assessment of c/ΕΒΡβ protein levels as a functional readout for miR-155 antagonism by short LNA-antimiR (SEQ ID #3207).

As a functional readout for miR-155 antagonism by short LNA-antimiR (SEQ ID #3207) we determined the protein levels of a novel miR-155 target, c/ΕΒΡβ. The mouse macrophage RAW cell line was transfected together with either an 8-mer (SEQ ID #3207) or a 15-mer (SEQ ID #3206) LNA-antimiR in the absence or presence of pre-miR-155. As mismatch controls for the

15-mer, SEQ ID #4 was used, which targets miR-122 and for the 8-mer SEQ ID #3205 was used, which targets miR-21. These two control miRNAs do not regulate c/ΕΒΡβ expression levels. LPS was used to induce miR-155 accumulation and cells were harvested after 16 hours with LPS. c/ΕΒΡβ has three isoforms; LIP, LAP and LAP* that were detected by Western blot analysis and the same membranes were re-probed with beta-tubulin as loading control. Results: Ratios were calculated for c/ΕΒΡβ LIP and beta-tubulin as indicated in Figure 14. RAW cells that were transfected with the 15-mer LNA-antimiR and no pre-miR-155 all showed equal c/ΕΒΡβ LIP/beta-tubulin ratios, due to inhibition of miR-155 increases the c/ΕΒΡβ LIP levels (Figure 14, left panel). By comparison, transfection of pre-miR-155 in RAW cells resulted in decreased c/ΕΒΡβ LIP levels as expected, if c/ΕΒΡβ was a miR-155 target, as shown in lanes with protein extracts from RAW cells treated with no LNA or a mismatch. However, protein extracts from RAW cells transfected with LNA-antimiR against miR-155, showed an increase of c/ΕΒΡβ LIP levels. The same experiments were also carried out with the 8-mer LNA-antimiR155 (SEQ ID #3207) and as shown in Figure 14 (right panel) comparable results to those with the 15-mer LNA-antimiR SEQ ID #3206 were obtained.

Conclusion: Antagonism of miR-155 using either an 8-mer or a 15-mer LNA-antimiR leads to de-repression of the direct target c/ΕΒΡβ.

Materials and Methods:

Cell line: The mouse macrophage RAW 264.7 cell line was purchased from ATCC (TIB-71). RAW cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 4 mM Glutamax and 25 ug/ml Gentamicin.

Transfection: 500.000 cells were seeded per well in a 6-well plate the day before transfection in order to achieve 50% confluency the next day. On the day of transfection, RAW 264.7 cells were transfected with 5 nmol pre-miR-155 (Ambion) and/or 5 nM LNA-antimiR together with 10 μΙ Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. Transfected was also varying concentrations of LNA-antimiRs. In order to induce miR-155 accumulation, LPS (100 ng/ml) was added to the RAW cells after the 4 hour incubation with the transfection complexes. After 16 hours, cells were harvested for protein extraction and western blot analysis. Western blot: Cells were washed with PBS, trypsinated, transferred to eppendorf tubes and 250 μΐ lysis buffer (IxRIPA) was added. The cell lysate was placed on ice for 20 min and spinned at

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

10.000 rpm for 10 minutes. The protein concentration was measured with Coomassie Plus according to the manufacturer's instructions and 80 ug was loaded onto a 4-12% BIS-TRIS gel. The membrane was incubated overnight at 4°C with the primary monoclonal mouse antibody C/EBP β (Santa Cruz) with a 1:100 concentration. Immunoreactive bands were visualized with ECL Plus (Amersham).

Example 16. Antagonism of miR-106b by a fully LNA-modified 8-mer (SEQ ID #3221) LNAantimiR

To confirm that our approach of using short LNA-antimiRs could be adapted to targeting of other miRNAs we designed a fully LNA-modified 8-mer LNA-antimiR against microRNA-106b. A perfect match target site for miR-106b was cloned into the 3’UTR of the luciferase gene in the vector (psiCHECK2) and transfected into the human cervix carcinoma HeLa cell line together with a short LNA-antimiR (SEQ ID #3221) or with a 15-mer LNA-antimiR (SEQ ID #3228) at varying concentrations. Luciferase measurements were performed after 24 hours.

Results: Transfection of the 8-mer LNA-antimiR SEQ ID #3221 against miR-106b resulted in dose-dependent inhibition of miR-106b as shown by de-repression of the luciferase reporter, which was completely de-repressed at 1 nM LNA-antimiR concentration (Figure 15).

Comparable results were obtained using the 15-mer LNA-antimiR SEQ ID #3228 demonstrating that an 8-mer LNA-antimiR is similarly potent to a 15-mer.

Conclusion: Targeting of miR-106b in HeLa cells shows that an 8-mer fully LNA-modified and phosphorotiolated LNA-antimiR is equally potent compared with a 15-mer LNA/DNA mixmer LNA-antimiR.

Materials and Methods:

Cell line: The human cervix carcinoma cell line HeLa was purchased from ECACC (#93021013). HeLa cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 5.200 cells were seeded per well in a 96-well plate the day before transfection in order to achieve 50-70% confluency the next day. On the day of transfection, HeLa cells were transfected with 57 ng miR-21 perfect match/psiCHECK2, miR-21 .mm2/psiCHECK2 or empty psiCHECK2 vector together with 0,14 μΙ Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. Transfected was also varying concentrations of LNA-antimiRs. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and 30 μ11 x Passive Lysis Buffer (Promega) was added to each well, after which the 24-well plates was put on an orbital shaker for 30 min. The cells were collected and transferred to eppendorf tubes and spinned at 10.000

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 rpm for 30 min after which luciferase measurements were performed according to the manufacturer’s instructions (Promega).

Example 17. Antagonism of miR-19a by a fully LNA-modified 8-mer (SEQ ID #3222) LNAantimiR

To further confirm that our approach of using short LNA-antimiRs can be readily adapted to targeting of other miRNAs we designed a fully LNA-modified 8-mer LNA-antimiR against microRNA-19a. A perfect match target site for miR-19a was cloned in the 3’UTR of the luciferase gene in the psiCHECK2 vector. The reporter plasmid was transfected into the human cervix carcinoma HeLa cell line together with a short LNA-antimiR (SEQ ID #3222) or with a 15mer LNA-antimiR (SEQ ID #3229) targeting miR-19a at varying concentrations. Luciferase measurements were performed after 24 hours.

Results: As shown in Figure 16, transfection of the 15-mer LNA-antimiR SEQ ID #3229 into HeLa efficiently antagonizes miR-19a as demonstrated by complete de-repression at 1 nM LNA-antimiR concentration. By comparison, transfection of the 8-mer LNA-antimiR SEQ ID #3222 resulted in effective miR-19a antagonism already at 0.5 nM concentration, indicating that this 8-mer LNA-antimiR is at least equally potent compared with a 15-mer LNA-antimiR in HeLa cells.

Conclusion: Targeting of miR-19a in HeLa cells shows that an 8-mer fully LNA-modified and phosphorothiolated LNA-antimiR is at least equally potent compared with a 15-mer LNA/DNA mixmer LNA-antimiR.

Materials and Methods: Cell line: The human cervix carcinoma cell line HeLa was purchased from ECACC (#93021013). HeLa cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 5.200 cells were seeded per well in a 96-well plate the day before transfection in order to achieve 50-70% confluency the next day. On the day of transfection, HeLa cells were transfected with 57 ng miR-21 perfect match/psiCHECK2, miR-21 .mm2/psiCHECK2 or empty psiCHECK2 vector together with 0,14 μΙ Lipofectamine2000 (Invitrogen) according to manufacturer’s instructions. Transfected was also varying concentrations of LNA-antimiRs. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and 30 μ11 x Passive Lysis Buffer (Promega) was added to each well, after which the 24-well plates was put on an orbital shaker for 30 min. The cells were collected and transferred to eppendorf tubes and spinned at 10.000 rpm for 30 min after which luciferase measurements were performed according to the manufacturer’s instructions (Promega).

Example 18. Targeting of a microRNA family using short, fully LNA-substituted LNAantimiR.

CA 02701547 2010-04-01

WO 2009/043353 PC17DK2008/000344

Next, we investigated whether it is possible to target a microRNA family using a single short 7mer LNA-antimiR complementary to the seed sequence that is common for all family members (see Figure 17). In this experiment, we focused on miR-221 and miR-222 that are overexpressed in solid tumors of the colon, pancreas, prostate and stomach. It has also been shown that miR-221 and miR-222 are the most significantly upregulated microRNAs in glioblastoma multiforme. Furthermore, overexpression of miR-221 and miR-222 may contribute to the growth and progression of prostate carcinoma, at least in part by blocking the tumor suppressor protein p27. A perfect match target site for both miR-221 and miR-222, respectively, was cloned into the 3’UTR of the luciferase gene resulting in two reporter constructs. These constructs were then transfected either separate or combined into the prostate carcinoma cell line, PC3. In addition to the 7-mer, targeting both miR-221 and miR-222, we also co-transfected a 15-mer LNA-antimiR (15mer) targeting either miR-221 (SEQ ID #3223) or miR-222 (SEQ ID #3224), each transfected separately or together (see Figure 18 left). Results: As shown in Figure 18, transfection of PC3 cells with the LNA-antimiR SEQ ID #3223 against miR-221 resulted in efficient inhibition of miR-221 at 1 nM LNA-antimiR concentration. An inhibitory effect is also observed when using the luciferase reporter plasmid for miR-222 as well as when co-transfecting both luciferase reporters for miR-221 and miR-222 simultaneously into PC3 cells. This inhibitory effect is most likely due to the shared seed sequence between miR-221 and miR-222. Similarly, transfection of PC3 cells with the LNA-antimiR SEQ ID #3224 against miR-222 resulted in efficient inhibition of miR-222 at 1 nM LNA-antimiR concentration as shown by complete de-repression of the luciferase reporter for miR-222. An inhibitory effect is also observed when using the luciferase reporter plasmid for miR-222 as well as when cotransfecting both luciferase reporters for miR-221 and miR-222 simultaneously into PC3 cells. Co-tranfection of both LNA-antimiR compounds SEQ ID #3223 and SEQ ID #3224 against miR221 and miR-222, respectively, (see Figure 18 left), resulted in effective inhibition of both miRNAs as shown by complete de-repression of the luciferase reporter plasmids both when separately transfected and when co-transfected into PC3 cells. Interestingly, transfection of a single fully LNA-modified 7-mer LNA-antimiR (SEQ ID #3225) targeting the seed sequence of miR-221 and miR-222 into PC3 cells resulted in efficient, dose-dependent antagonism of miR221 and miR-222 simultaneously as shown by complete de-repression of the luciferase reporter plasmids both when separately transfected and when co-transfected into PC3 cells. This demonstrates that a single, short LNA-substituted LNA-antimiR can effectively target seed sequences thereby antagonizing entire microRNA families simultaneously. Analysis of the miRBase microRNA sequence database showed that the miR-221/222 seed recognition sequence, of the LNA-antimiR SEQ ID #3225 is unique for both miRNAs.

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

Conclusion: Our results demonstrate that LNA enables design and synthesis of short fully LNA-substituted LNA-antimiR oligonucleotides that can effectively target microRNA seed sequences thereby antagonizing entire microRNA families simultaneously.

Materials and Methods:

Cell line: The human prostate carcinoma PC3 cell line was purchased from ECACC (#90112714) PC3 cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax and 25 ug/ml Gentamicin.

Transfection: 100.000 cells were seeded per well in a 12-well plate the day before transfection in order to receive 50% confluency the next day. On the day of transfection, PC3 cells were transfected with 0.3 ug of luciferase reporter plasmid for miR-221 or for miR-222 or with empty psiCHECK2 vector without miRNA target site as control together with 1,2 μΙ Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and 250 μ11 x Passive Lysis Buffer (Promega) was added to the wells. The plates were placed on a shaker for 30 min., after which the cell lysates was transferred to eppendorf tubes. The cell lysate was spinned for 10 min at 2.500 rpm after which 20 μΙ were transferred to a 96-well plate and luciferase measurements were performed according to the manufacturer’s instructions (Promega).

Example 19. Assessment of p27 protein levels as a functional readout for antagonism of the miR-221/222 family by the 7-mer SEQ ID #3225 LNA-antimiR.

Previous work has shown (le Sage et al. 2007, Galardi et al. 2007) that miR-221 and miR-222 post-transcriptionally regulate the expression of the tumour suppressor gene p27, which is involved in cell cycle regulation. In these studies, down-regulation of miR-221 and miR-222 was shown to increase expression levels of p27. Thus, as a functional readout for antagonism of the miR-221/222 family by the 7-mer SEQ ID #3225 LNA-antimiR we determined the protein levels of p27 after transfection of the LNA-antimiR SEQ ID #3225 into PC3 cells in comparison with an 8-mer LNA mismatch control. After 24 hours the cells were harvested for western blot analysis (Figure 19).

Results: As shown in Figure 19, transfection of the 7-mer LNA-antimiR SEQ ID #3225 targeting the seed sequence in miR-221 and miR-222 resulted in dose-dependent increase of the p27 protein levels compared to either untransfected or LNA mismatch control transfected PC3 cells. These results clearly demonstrate that the 7-mer LNA-antimiR is able to effectively antagonize the miR-221/222 family leading to de-repression of the direct target p27 at the protein level.

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344

Conclusion: A fully LNA-modified 7-mer LNA-antimiR targeting the seed sequence in the miR221/222 family effectively antagonized both miRNAs leading to de-repression of the direct target p27 at the protein level.

Materials and Methods:

Cell line: The human prostate carcinoma PC3 cell line was purchased from ECACC (#90112714) PC3 cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax and 25 ug/ml Gentamicin.

Transfection: 250.000 cells were seeded per well in a 6-well plate the day before transfection in order to receive 50% confluency the next day. On the day of transfection, PC3 cells were transfected with LNA-antimiRs at varying concentrations with Lipofectamine2000. Cells were harvested after 24 hours for protein extraction and western blot analysis.

Western blot: Cells were washed with PBS, trypsinated, transferred to eppendorf tubes and 250 μΙ lysis buffer (IxRIPA) was added. The cell lysate was placed on ice for 20 min, then spinned at 10.000 rpm for 10 minutes. The protein concentration was measured with Coomassie Plus according to the manufacturer's instructions and 100 ug was loaded onto a 4-12% BIS-TRIS gel. The membrane was incubated overnight at 4°C with the primary monoclonal mouse antibody p27 (BD Biosciences) at a 1:1000 dilution. Immunoreactive bands were visualized with ECL Plus (Amersham).

Example 20. Duplex melting temperatures (T_m) of the LNA-antimiRs.

As shown in Table 5, T_m values increase with increasing the length of short fully modified LNAantimiRs (see T_m values for SEQ ID #3205, SEQ ID #3209-3214 in Table 7). Most optimal inhibitory effect was achieved with the 8-mer LNA-antimiR SEQ ID #3205 against miR-21, whereas the very low Tm of the 6-mer SEQ ID #3209 is most likely not sufficient to mediate antagonism of the miR-21 target On the other hand, increasing the length beyond a 10-mer (SEQ ID #3212) significantly increases the T_m, while simultaneously decreasing the inhibitory activity as measured using the luciferase miR-21 reporter, which is most likely due to high propensity of the fully modified 12- and 14-mer LNA-antimiRs to form homodimers. The experiments using a sliding window of fully LNA-modified 8-mer LNA-antimirs across the mir-21 recognition sequence clearly demonstrate that in addition to adequate T_m value of the LNAantimiR, the seed region is most critical for miRNA function and, thus, the most optimal region to be targeted by an LNA-antimiR.

CA 02701547 2016-02-01

WO 2009/043353

PCT/D K200K/000344

Table 5: T_m values for miR-21 LNA-antimiRs, measured against a complementary RNA oligonucleotide

<td> SEQ ID #</td><td> microRN A</td><td> Length (bp)</td><td> Sequence</td><td> Measured T_m(RNA) °C</td>

<td> 3205</td><td> miR-21</td><td> 8</td><td> 5’- GATAAGCT -3'</td><td> 64,0</td>

<td> 3209</td><td> miR-21</td><td> 6</td><td> 5 - TAAGCT -3’</td><td> 32,0</td>

<td> 3210</td><td> miR-21</td><td> 7</td><td> 5’- ATAAGCT -3’</td><td> 45.0</td>

<td> 3211</td><td> miR-21</td><td> 9</td><td> 5'- TGATAAGCT -3’</td><td> 65,0</td>

<td> 3212</td><td> miR-21</td><td> 10</td><td> 5 - CTGATAAGCT -3’</td><td> 63,0</td>

<td> 3213</td><td> miR-21</td><td> 12</td><td> 5’- GTCTGATAAGCT -3'</td><td> 86,8</td>

<td> 3214</td><td> miR-21</td><td> 14</td><td> 5’- CAGTCTGATAAGCT -3’</td><td> 89,9</td>

<td> 3215</td><td> miR-21</td><td> 8</td><td> 5'- TCTGATAA - 3'</td><td> 56,0</td>

<td> 3216</td><td> miR-21</td><td> 8</td><td> 5'- ATCAGTCT - 3</td><td> 72,0</td>

<td> 3217</td><td> miR-21</td><td> 8</td><td> 5'- TCAACATC - 3</td><td> 48,0</td>

Conclusion: The T_m values along with experimental data obtained with luciferase reporters show that potent antagonism by LNA-antimiR is not only dependent on T_m but also depends on the positioning of the LNA-antimiR within the microRNA recognition sequence.

Materials and Methods:

Tm measurements: The oligonucleotide:miR-21 RNA duplexes were diluted to 3 μΜ in 500 μΙ RNase free H₂0 and mixed with 500 μΙ 2x T_m-buffer (200 mM NaCI, 0.2 mM EDTA, 20 mM Naphosphate, pH 7,0). The solution was heated to 95°C for 3 min and then allowed to anneal in RT for 30 min. The duplex melting temperatures (T_m) were measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier™ temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature was ramped up from 20°C to 95°C and then down to 25°C, recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing were used to assess the duplex melting temperatures.

Example 21. Assessment of m»R-21 antagonism by comparing an 8-mer (SEQ ID #3205) versus a 15-mer (SEQ ID #3204) LNA-antimiR in human hepatocytic ceil line HepG2.

We have previously shown in this application, that an 8-mer LNA-antimiR that is fully LNAmodified and phosphorothiolated effectively antagonizes miR-21 in the human cervix carcinoma cell line HeLa, the human breast carcinoma cell line MCF-7 and the human prostate cancer cell line PC3. We extended this screening approach to the human hepatocellular cancer cell line HepG2. To assess the efficiency of the 8-mer LNA-antimiR oligonucleotide against miR-21, luciferase reporter constructs were generated in which a perfect match target site for the mature miR-21 was cloned into the 3’UTR of the Renilla luciferase gene. In order to monitor miR-21 inhibition, HepG2 cells were transfected with the luciferase constructs together with the miR-21 antagonist SEQ ID #3205 (8-mer) and for comparison of specificity with the 8-mer LNA-antimiR

CA 02701547 2010-04-01

WO 2009/043353 PC17DK2008/000344 mismatch (SEQ ID #3218) and for comparison of potency together with the 15-mer (SEQ ID #3204) at varying concentrations. After 24 hours, luciferase activity was measured.

Results: The luciferase reporter experiments showed a dose-dependent de-repression of the luciferase miR-21 reporter activity with the 15-mer LNA-antimiR against miR-21 (SEQ ID #3204). However, complete de-repression of the luciferase reporter was not obtained, not even at the higher concentrations (Figure 20). In contrast, the cells that were transfected with the 8mer fully LNA modified LNA-antimiR (SEQ ID #3205) showed complete de-repression already at 5 nM, indicating significantly improved potency compared to the 15-mer LNA-antimiR. Comparing the specificity of the 8-mer perfect match and the 8-mer mismatch, the mismatch LNA-antimiR (SEQ ID #3218) did not show any de-repression at all, demonstrating high specificity of the LNA-antimiR compound against miR-21.

Conclusion: The 8-mer (SEQ ID #3205) is more potent than the 15-mer LNA-antimiR in targeting miR-21 and antagonism of miR-21 by SEQ ID #3205 is specific.

Materials and Methods:

Cell line: The human hepatocytic HepG2 cell line was purchased from ECACC (#85011430). HepG2 cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax and 25 ug/ml Gentamicin.

Transfection: 650.000 cells were seeded per well in a 6-well plate and reverse transfection were performed. HepG2 cells were transfected with 0.6 pg miR-21 or empty psiCHECK2 vector together with 2,55 μΙ Lipofectamine2000 (Invitrogen) according to manufacturer’s instructions. Transfected was also varying concentrations of LNA-antimiRs. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and 300 μΐ 1 x Passive Lysis Buffer (Promega) was added to the wells. The plates were placed on a shaker for 30 min., after which the cell lysates were transferred to eppendorf tubes. The cell lysate was centrifugated for 10 min at 2.500 rpm after which 50 μΙ were transferred to a 96 well plate and luciferase measurements were performed according to the manufacturer’s instructions (Promega).

Example 22. Validation of interaction of the miR-21 target site in the Pdcd4 3'UTR and miR-21 using the 8-mer SEQ ID #3205 LNA-antimiR in human hepatocellular cell line Huh7.

The tumour suppressor protein Pdcd4 inhibits tumour promotion and progression. Furthermore, downregulation of Pdcd4 in lung and colorectal cancer has also been associated with poor patient prognosis. Recently, Asangani et al (Oncogene 2007) and Frankel et al (J Biol Chem 2008) showed that the Pdcd4 3'UTR contains a conserved target site for miR-21, and transfecting cells with an antimiR-21, resulted in an increase in Pdcd4 protein. We therefore

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344 constructed a luciferase reporter plasmid, harboring 313 nt of the 3'UTR region of Pdcd4 encompassing the aforementioned miR-21 target site, which was co-transfected together with different LNA-antimiRs and pre-miR-21 (10 nM) into Huh-7 cells. The different LNA-antimiRs were; SEQ ID #3205 (8-mer, perfect match), SEQ ID #3218 (8-mer, mismatch) and SEQ ID #3204 (15-mer, DNA/LNA mixmer). Luciferase measurements were performed after 24 hours. Results: As shown in Figure 21, cells transfected with the Pdcd4 3’UTR luciferase reporter and SEQ ID #3205, an increase in luciferase activity was observed, indicating interaction between the Pdcd4 3'UTR and miR-21. However, transfecting the cells with the mismatch compound, SEQ ID #3218, no change in luciferase activity was observed, which was expected since the compound does not antagonize miR-21. When comparing the 8-mer LNA-antimiR against the 15-mer LNA-antimiR (SEQ ID #3204), the short fully LNA-modified and phosphorothiolated LNA-antimiR was significantly more potent, confirming previous data.

Materials and Methods:

Cell line: The human hepatoma cell line Huh-7 was a kind gift from R. Bartinschlager (Dept Mol Virology, University of Heidelberg). Huh-7 cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 11.000 cells were seeded per well in a 96-well plate the day before transfection in order to achieve 50-70% confluency the next day. On the day of transfection, Huh-7 cells were transfected with 20 ng Pdcd4 3'UTR/psiCHECK2 or empty psiCHECK2 vector together with 10 nM pre-miR-21 (Ambion) and 0,14 μΙ Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. Varying concentrations of the LNA-antimiR oligonucleotides were also transfected. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: Cells were washed and 30 μ11 x Passive Lysis Buffer (Promega) was added to each well, after which the 96-well plates was put on an orbital shaker. After 30 min., 50 μΐ luciferase substrate dissolved in Luciferase Assay Buffer II (Dual-Luciferase Reporter Assay System from Promega, Cat# E1910) was added to the wells with lysated cells and luciferase measurements were performed according to the manufacturer’s instructions (Promega).

Example 23. Assessment of Pdcd4 protein levels as a functional readout for miR-21 antagonism by the 8-mer LNA-antimiR (SEQ ID #3205).

In addition, we also transfected HeLa cells with SEQ ID #3205 (perfect match), SEQ ID #3218 (mismatch), SEQ ID #3219 (scrambled) and analyzed Pdcd4 protein levels after 24 hours with Western blot (Figure 22). As shown, in the protein extracts from cells where SEQ ID #3205 had been added, the Pdcd4 protein levels increase, due to antagonism of mir-21 by SEQ ID #3205 in contrast to the two control LNA oligonucleotides.

CA 02701547 2016-02-01

WO 2009/043353 PCT/DK2008/000344

Conclusion: Antagonism of miR-21 using an 8-mer (SEQ ID #3205) leads to derepression of the direct target Pdcd4ntagonism of miR-21

Materials and Methods:

Cell line: The human cervix carcinoma cell line HeLa was purchased from ECACC (#93021013). HeLa cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 200.000 cells were seeded per well in a 6-well plate the day before transfection in order to receive 50-70% confluency the next day. On the day of transfection, HeLa cells were transfected with 5 nM LNA oligonucleotides and 2,5 pg/ml Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. After 24 hours, cells were harvested for Western blot analysis.

Western blot: Cells were washed with PBS, trypsinated, transferred to eppendorf tubes and 50 μΙ lysis buffer (IxRIPA) was added. The cell lysate was placed on ice for 20 min and spinned at 10.000 rpm for 10 minutes. Equal amounts (15 μΙ cell lysate) were loaded onto a 4-12% BISTRIS gel. The proteins were transferred to a nitrocellulose membrane using iBlot™ (Invitrogen) according to manufacturers instructions. The membrane was incubated overnight at 4°C with the primary affinity purified rabbit serum antibody Pdcd4 (Rockland) with a 1:2000 concentration. As control, anti- beta tubulin antibodies (Thermo Scientific) were used at a 1:5000 dilution. Immunoreactive bands were visualized with ECL Plus™ (Amersham).

Example 24. Assessment of potential hepatotoxicity of the 8-mer perfect match LNAantimiR SEQ ID #3205 and the LNA mismatch control SEQ ID #3218.

Each compound was injected into female NMRI mice, at doses of 25 mg/kg, 5 mg/kg and 1 mg/kg, every other day for 2 weeks. The animals were sacrificed and serum was collected from whole blood for ALT and AST analyses. As seen in Figure 23, the ALT and AST levels were not elevated for SEQ ID #3205 compared to saline or SEQ ID #3218 (mismatch control). However, one mouse showed increased levels (marked red), since the serum samples were contaminated with red blood cells, which contain 6-8 times higher levels of ALT and AST compared to plasma. The mice that received 5 mg/kg and 1 mg/kg were also analyzed for ALT and AST levels and showed no changes compared to saline treated control animals (data not shown).

Materials and Methods:

Experimental design:

<td>^!Gr. no.</td><td> Animal IDno.</td><td> No. of mice</td><td> Compound Dose level per day</td><td> Cone, at dose vol. 10 ml/ kg</td><td> Adm. Route</td><td> Dosing j</td>

<td> 1</td><td> 1 - 10</td><td> 10</td><td> NaCI 0.9%</td><td></td><td> i.v</td><td> 0, 2, 4, 7, 9 S _______________________________J</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

<td> 2</td><td> 11-15</td><td> 5</td><td> SEQ ID # 3205 25mg/kg</td><td> 2.5mg/ml</td><td> i.v</td><td> 0, 2, 4, 7, 9</td>

<td> 3</td><td> 16-20</td><td> 5</td><td> SEQ ID # 3205 5mg/kg</td><td> 0.5mg/ml</td><td> i.v</td><td> 0, 2, 4, 7, 9</td>

<td> 4</td><td> 21-25</td><td> 5</td><td> SEQ ID # 3205 1mg/kg</td><td> O.lmg/ml</td><td> i.v</td><td> 0, 2, 4, 7, 9</td>

<td> 5</td><td> 26-30</td><td> 5</td><td> SEQ ID # 3230 25mg/kg</td><td> 2.5mg/ml</td><td> i.v</td><td> 0, 2, 4, 7, 9</td>

<td> 6</td><td> 31-35</td><td> 5</td><td> SEQ ID # 3230 5mg/kg</td><td> 0.5mg/ml</td><td> i.v</td><td> 0, 2, 4, 7, 9</td>

Sacrifice: The animals was sacrificed by cervical dislocation.

Sampling of serum for ALT/AST: The animals were anaesthetised with 70% CO₂-30% O₂ before collection of retro orbital sinus blood. The blood was collected into S-monovette Serum-Gel vials. The serum samples were harvested and stored from each individual mouse. The blood samples were stored at room temperature for two hours and thereafter centrifuged 10 min, 3000 rpm, at room temp. The serum fractions were harvested into Eppendorf tubes on wet ice. ALT and AST measurements: ALT and AST measurements were performed in 96-well plates using ALT and AST reagents from ABX Rentra (A11A01627 - ALT, A11A01629 - AST) according to the manufacturer’s instructions. In short, serum samples were diluted 2.5 fold with H₂O and each sample was assayed in duplicate. After addition of 50 μΙ diluted sample or standard (multical from ABX Pentra - A11A01652) to each well, 200 μΙ of 37 °C AST or ALT reagent mix was added to each well. Kinetic measurements were performed for 5 min with an interval of 30s at 340 nm and 37 °C.

Example 25. Assessment of PU.1 protein levels as a functional readout for miR-155 antagonism by short LNA-antimiR (SEQ ID #3207).

We have previously shown that the 8-mer (SEQ ID #3207) antagonizing miR-155 leads to derepression of the miR-155 target c/EBPbeta in the mouse macrophage RAW cells. To further verify the potency of SEQ ID #3207 we determined the protein levels of another miR-155 target, PU.1 As a functional readout for miR-155 antagonism by short LNA-antimiR (SEQ ID #3207) we performed Western blot The antagonism was verified in the human monocytic THP-1 cell line which was transfected together with either an 8-mer (SEQ ID #3207) perfect match or a 8-mer control LNA in the absence or presence of pre-miR-155. LPS was used to induce miR-155 accumulation and cells were harvested after 24 hours.

Results: THP-1 cells that were transfected with pre-miR-155 shows a decrease in PU.1 levels (Figure 24). Transfecting the cells with the fully LNA-modified and phosphorothiolated SEQ ID #3207 effectively antagonizes miR-155, leading to unaltered levels of PU.1 protein. By comparison, transfecting the cells with an 8-mer LNA control, PU.1 levels decreased, indicating that antagonism of miR-155 by SEQ ID #3207 LNA-antimiR is specific.

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344

Conclusion: Antagonism of miR-155 using an 8-mer leads to de-repression of the direct target PU.1 in human THP-1 cells.

Materials and Methods:

Cell line: The human monocytic THP-1 cell line was purchased from ECACC (#88081201). THP-1 cells were cultured in RPMI with L-glutamine, supplemented with 10% fetal bovine serum.

Transfection: 200.000 cells were seeded per well in a 12-well plate the day before. On the day of transfection, THP-1 cells were transfected with 5 nmol pre-miR-155 (Ambion) and/or 5 nM LNA-antimiR together with Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. LPS (100 ng/ml) was added to the cells after the 4 hour incubation with the transfection complexes. After 24 hours, cells were harvested for protein extraction and western blot analysis.

Western blot: Cells were washed with PBS, trypsinated, transferred to eppendorf tubes and 50 μΙ lysis buffer (IxRIPA) was added. The cell lysate was placed on ice for 20 min and spinned at 10.000 rpm for 10 minutes. Equal amounts (15 μΙ cell lysate) were loaded onto a 4-12% BISTRIS gel. The proteins were transferred to a nitrocellulose membrane using IBIot (Invitrogen) according to manufacturers instructions The membrane was incubated overnight at 4°C with the rabbit monoclonal PU.1 antibody (Cell Signaling) with a 1:2000 concentration. As equal loading, Tubulin (Thermo Scientific) was used at a 1:5000 dilution. Immunoreactive bands were visualized with ECL Plus (Amersham).

Example 26. Assessment of p27 protein levels as a functional readout for antagonism of the miR-221/222 family by the 7-mer SEQ ID #3225 LNA-antimiR.

Previous work has shown (le Sage et al. 2007, Galardi et al. 2007) that miR-221 and miR-222 post-transcriptionally regulate the expression of the tumour suppressor gene p27, which is involved in cell cycle regulation. In these studies, down-regulation of miR-221 and miR-222 was shown to increase expression levels of p27. Thus, as a functional readout for antagonism of the miR-221/222 family by the 7-mer SEQ ID #3225 LNA-antimiR we determined the protein levels of p27 after transfection of the LNA-antimiR SEQ ID #3225 into PC3 cells.

Results: As shown in Figure 25, transfection of the 7-mer LNA-antimiR SEQ ID #3225 targeting the seed sequence of miR-221 and miR-222 resulted in dose-dependent increase of the p27 protein levels compared to either untransfected or our LNA scrambled control transfected PC3 cells. These results clearly demonstrate that the 7-mer LNA-antimiR is able to effectively antagonize the miR-221/222 family leading to de-repression of the direct target p27 at the protein level at concentrations as low as 5 nM.

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

Conclusion: A fully LNA-modified 7-mer LNA-antimiR targeting the seed sequence in the miR221/222 family at 5 nM can effectively antagonize both miRNAs leading to de-repression of the direct target p27 at protein level.

Materials and Methods:

Cell line: The human prostate carcinoma PC3 cell line was purchased from ECACC (#90112714). PC3 cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax and 25 ug/ml Gentamicin.

Transfection: 250.000 cells were seeded per well in a 6-well plate the day before transfection in order to receive 50% confluency the next day. On the day of transfection, PC3 cells were transfected with LNA-oligonucleotides at varying concentrations (see Figure 25) with Lipofectamine2000. Cells were harvested after 24 hours for protein extraction and western blot analysis.

Western blot: Cells were washed with PBS, trypsinated, transferred to eppendorf tubes and 50 μΐ lysis buffer (IxRIPA) was added. The cell lysate was placed on ice for 20 min, then spinned at 10.000 rpm for 10 minutes. Equal amounts (15 μΙ cell lysate) were loaded onto a 4-12% BISTRIS gel. The proteins were transferred to a nitrocellulose membrane using iBIot (Invitrogen) according to manufacturers instructions. The membrane was incubated overnight at 4°C with the primary monoclonal mouse antibody p27 (BD Biosciences) at a 1:1000 dilution. As loading control, Tubulin (Thermo Scientific) was used at a 1:5000 dilution. Immunoreactive bands were visualized with ECL Plus (Amersham).

Example 27. Knock-down of miR-221/222 by the 7-mer SEQ ID #3225 LNA-antimiR reduces colony formation of PC3 cells

A hallmark of cellular transformation is the ability for tumour cells to grow in an anchorageindependent way in semisolid medium. We have therefore performed soft agar assay which is a phenotypic assay that is relevant for cancer, given that it measures the decrease of tumour cells. We transfected SEQ ID #3225 (perfect match) and SEQ ID #3231 (scrambled) into PC3 cells, and after 24 hours plated cells in soft agar. Colonies were counted after 12 days. We show in Figure 26 that inhibition of miR-221 and miR-222 by SEQ ID #3225 can reduce the amount of colonies growing in soft agar compared to the scrambled control LNA-antimiR, indicating decrease of tumour cells.

Conclusion: The 7-mer (SEQ ID #3225) targeting the miR-221/222 family reduces the number of colonies in soft agar, indicating proliferation arrest of PC3 cells.

Materials and Methods:

Cell line: The human prostate carcinoma PC3 cell line was purchased from ECACC (#90112714). PC3 cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax and 25 ug/ml Gentamicin.

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344

Transfection: 250.000 cells were seeded per well in a 6-well plate the day before transfection in order to receive 50% confluency the next day. On the day of transfection, PC3 cells were transfected with 25 nM of different LNA oligonucleotides with Lipofectamine2000.

Clonogenic growth in soft agar: 2.5x10³ PC3 cells were seeded in 0.35% agar on the top of a base layer containing 0.5% agar. Cells were plated 24 hours after transfection. Plates were incubated in at 37°C, 5%CO₂ in a humified incubator for 12 days and stained with 0.005% crystal violet for 1 h, after which cells were counted. The assay was performed in triplicate.

Example 28: Assessment of let-7 antagonism by 6-9-mer LNA-antimiRs in Huh-7 cells transfected with let-7a precursor miRNA, and a luciferase sensor assay.

In order to assess the efficiency of fully LNA-modified 6-9-mer oligonucleotides in targeting and antagonizing the let-7 family of miRNAs, a luciferase sensor construct was made, containing some 800 bp of the HMGA2 3’UTR. The sequence cloned into the vector contains four out of seven functional let-7 binding sites (sites 2-5), as previously demonstrated by Mayr et al. (Science, 2007) and Lee and Dutta (Genes Dev, 2007). In order to monitor let-7 inhibition, the hepatocellular carcinoma cell line Huh-7 (with low to non-existing levels of endogenous let-7) was transfected with the luciferase sensor construct, with let-7a precursor miRNA, and with the 6-9 mer let-7 antagonists SEQ ID #3232, -3233, -3227, -3234, -3235; see Figure 27) at increasing concentrations. The 6-9-mer LNA-antimiRs were compared with SEQ ID #3226, a 15-mer against let-7a as a positive control. After 24 hours, luciferase activity was measured. Results: As seen in Figure 28, the fully LNA-modified 8- and 9-mer LNA-antimiRs (SEQ ID #3227, SEQ ID #3234, and SEQ ID #3235) show similar potencies in de-repressing the let-7 targets in the luciferase sensor assay, as the positive control 15-mer SEQ ID #3226. Full target de-repression for these highly potent compounds is achieved already at 1-5 nM, whereas the 7mer SEQ ID #3233 needs to be present at slightly higher concentrations (10 nM) to generate the same effect However, the 6-mer SEQ ID #3232 shows no effect even at as high concentrations as 50 nM. The de-repression of luciferase activity by the 7-9- and the 15-mer LNA-antimiRs is dose-dependent, which is particularly clear in the case of the slightly less potent SEQ ID #3233.

Conclusion: To conclude, the 8-9-mer LNA-antimiRs (SEQ ID #3227, SEQ ID #3234, and SEQ ID #3235) show equal antagonist potencies in inhibition of let-7a in vitro compared to the 15mer LNA-antimiR SEQ ID #3226 targeting let-7a. A potent effect, albeit at slightly higher concentrations is also seen for the 7-mer SEQ ID #3233, whereas a 6-mer has no effect at tested concentrations.

Materials and Methods:

Cell line: The hepatocellular carcinoma cell line Huh-7 was a kind gift from R. Bartinschlager (Dept Mol Virology, University of Heidelberg).Huh-7 cells were cultured in DMEM medium,

CA 02701547 2010-04-01

WO 2009/043353 PC17DK2008/000344 supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 8,000 cells were seeded per well in a 96-well plate the day before transfection in order to receive 60-80% confluency the next day. On the day of transfection, Huh-7 cells in each well were transfected with 20 ng HMGA2 3’UTR/psiCHECK2 plasmid, let-7a precursor miRNA (Dharmacon; 10 nM end-concentration), LNA-antimiRs SEQ ID #3232, -3233, -3227, 3234, -3235, -3226; 0-50 nM end concentrations) together with 0.17 μΙ Lipofectamine2000 (Invitrogen) according to manufacturer’s instructions. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: Growth media was discarded and 30 μΙ 1x Passive Lysis Buffer (Promega) was added to each well. After 15-30 minutes of incubation on an orbital shaker, renilla and firefly luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 29: Assessment of entire let-7 family antagonism by 8-, and 15-mer LNAantimiRs in Huh-7 cells transfected with a luciferase sensor assay.

In order to assess the efficiency of a fully LNA-modified 8-mer oligonucleotide in antagonizing the entire let-7 family of miRNAs, the same luciferase sensor construct as described in the previous example was used. Again, Huh-7 cells (with low to non-existing levels of endogenous let-7) were transfected with the sensor construct, with one of the family-representative let-7a, let-7d, let-7e, or let-7i precursors, and with the antagonist SEQ ID #3227 at increasing concentrations. The 8-mer LNA-antimiR was compared to SEQ ID #3226, a 15-mer against let73 as a positive and potent control. After 24 hours, luciferase activity was measured.

Results: As seen in Figure 29 the fully LNA-modified 8-mer LNA-antimiRs (SEQ ID #3227) show similar potencies in de-repressing the various let-7 targets in the luciferase sensor assay, as the positive control 15-mer SEQ ID #3226. Nearly full target de-repression for the 8-mer is achieved already at 0.5-1 nM, except in the case with let-7e premiR (Fig. 29C), to which only 7 out of 8 nucleotides of SEQ ID #3227 hybridizes to the target However, despite the terminal mismatch in this case, SEQ ID #3227 generates full target de-repression at 5 nM. The positive control 15-mer shows potent antagonism of all precursors and gives nearly full de-repression at 0.5 nM. The de-repression of luciferase activity by both the 8- and the 15-mer LNA-antimiRs is clearly dose-dependent, as seen in all four panels (Fig 29A-D).

Conclusion: To conclude, the 8-mer LNA-antimiR (SEQ ID #3227), is a potent antagonist against four representative let-7 family members in vitro, and thus likely against the entire family. Compared to a 15-mer positive control antagonist, SEQ ID #3226, the 8-mer is equally potent for three of four targets, and slightly less potent for the fourth target, let-7e, explained by a terminal mismatch in this case.

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

Materials and Methods:

Cell line: The hepatocellular carcinoma cell line Huh-7 was a kind gift from R. Bartinschlager (Dept Mol Virology, University of Heidelberg). Huh-7 cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 8,000 cells were seeded per well in a 96-well plate the day before transfection in order to receive 60-80% confluency the next day. On the day of transfection, Huh-7 cells in each well were transfected with 20 ng HMGA2 3’UTR/psiCHECK2 plasmid, with let-7a, -7d, -7e, or -7i precursor miRNA (Dharmacon; 10 nM end-concentration), and with LNA-antimiRs SEQ ID #3227 and SEQ ID #3226; 0-50 nM end concentrations) together with 0.17 μΙ Lipofectamine2000 (Invitrogen) according to manufacturer’s instructions. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: Growth medium was discarded and 30 μΙ 1x Passive Lysis Buffer (Promega) was added to each well. After 15-30 minutes of incubation on an orbital shaker, renilla and firefly luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 30. Assessment of endogenous let-7 antagonism by SEQ ID #3227, an 8-mer LNA-antimiRs, in HeLa cells transfected with a luciferase sensor assay.

In order to determine the efficiency of a fully LNA-modified 8-mer oligonucleotide in targeting and antagonizing endogenous let-7, the same luciferase sensor construct as described in previous two examples, was co-transfected with SEQ ID #3227 into the cervical cancer cell line HeLa (that expresses moderate to high levels of let-7 as determined by Q-PCR; data not shown). Empty psiCHECK-2 vector was included as a negative control.

Results: As seen in Figure 30, the fully LNA-modified 8-mer LNA-antimiR SEQ ID #3227 shows potent antagonism of endogenous let-7, and gives full target de-repression at concentrations of 5-10 nM. The de-repression of luciferase activity is dose-dependent, starting around 1 nM and reaching a plateau at approximately 10 nM.

Conclusion: To conclude, the 8-mer LNA-antimiR (SEQ ID #3227), is a potent antagonist against also endogenous let-7 in vitro, and thus provides definite evidence that entire miRNA families can be successfully targeted by short and fully LNA-modified antagonists.

Materials and Methods:

Cell line: The cervical cancer cell line HeLa was purchased from ATCC (#CCL-2™). HeLa cells were cultured in Eagle’s MEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax, 1x NEAA and 25 ug/ml Gentamicin.

Transfection: 8,000 cells were seeded per well in a 96-well plate the day before transfection in order to receive 50-70% confluency the next day. On the day of transfection, HeLa ceils in each

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344 well were co-transfected with 20 ng HMGA2 3’UTR/psiCHECK2 plasmid or psiCHECK-2 (empty vector), and with LNA-antimiR SEQ ID #3227 (0-50 nM, end concentrations) together with 0.17 μΙ Lipofectamine2000 (Invitrogen) according to manufacturer’s instructions. After 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: Growth media was discarded and 30 μΙ 1x Passive Lysis Buffer (Promega) was added to each well. After 15-30 minutes of incubation on an orbital shaker, renilla and firefly luciferase measurements were performed according to manufacturer’s instructions (Promega).

Example 31. Assessment of miR-21 antagonism by an 8-mer LNA-antimiR-21 (#3205) versus an 8-mer (#3219) scrambled control LNA in the human colon carcinoma cell line HCT116.

We have previously shown in this application, that an 8-mer LNA-antimiR that is fully LNAmodified and phosphorothiolated effectively antagonizes miR-21 in the human cervix carcinoma cell line HeLa, the human breast carcinoma cell line MCF-7, the human prostate cancer cell line PC3 and human hepatocellular carcinoma HepG2 cell line. We extended this screening approach to the human colon carcinoma cell line HCT116. To assess the efficiency of the 8-mer LNA-antimiR oligonucleotide against miR-21, luciferase reporter constructs were generated in which a perfect match target site for the mature miR-21 was cloned into the 3’UTR of the Renilla luciferase gene. In order to monitor miR-21 inhibition, HCT116 cells were transfected with the luciferase constructs together with the miR-21 antagonist #3205 (8-mer) and for comparison of specificity with the 8-mer LNA scrambled control (#3219). After 24 hours, luciferase activity was measured.

Results:The luciferase reporter experiments showed a dose-dependent de-repression of the luciferase miR-21 reporter activity with the 8-mer LNA-antimiR against miR-21 (#3205) and complete de-repression was obtained at 5 nM (Figure 31 ). When comparing the specificity of the 8-mer perfect match and the 8-mer scrambled control, the scrambled control LNA-antimiR (#3219) did not show any de-repression at all, demonstrating high specificity of the LNA-antimiR compound against miR-21.

Conclusion: The 8-mer (#3205) is potent in targeting miR-21 and antagonism of miR-21 by #3205 is specific.

Materials and Methods:

Cell line: The human colon carcinoma HCT116 cell line was purchased from ATCC (CCL-247). HCT116 cells were cultured in RPMI medium, supplemented with 10% fetal bovine serum, and 25 ug/ml Gentamicin.

CA 02701547 2010-04-01

WO 2009/043353 PC17DK2008/000344

Transfection: 110.000 cells were seeded per well in a 12-well plate and transfection was performed. HCT116 cells were transfected with 0.3 pg miR-21 luciferase sensor plasmid or empty psiCHECK2 vector together with 1.2 μΙ Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. Transfected were also varying concentrations of LNA-antimiR and control oligonucleotides. After 24 hours, cells were harvested for luciferase measurements. Luciferase assay: The cells were washed with PBS and 250 μ! 1 x Passive Lysis Buffer (Promega) was added to the wells. The plates were placed on a shaker for 30 min., after which the cell lysates were transferred to eppendorf tubes. The cell lysate was centrifugated for 10 min at 2.500 rpm after which 50 μΐ were transferred to a 96 well plate and luciferase measurements were performed according to the manufacturer’s instructions (Promega).

Example 32. Knock-down of miR-21 by the 8-mer #3205 LNA-antimiR reduces colony formation of PC3 cells.

A hallmark of cellular transformation is the ability for tumour cells to grow in an anchorageindepëndent way in semisolid medium. We therefore performed soft agar assay which is a phenotypic assay that is relevant for cancer, given that it measures the decrease of tumour cells. We transfected #3205 (perfect match LNA-antimiR-21 ) and #3219 (LNA scrambled control) into PC3 cells, and after 24 hours plated cells in soft agar. Colonies were counted after 12 days. We show in Figure 32 that inhibition of miR-21 by #3205 can reduce the amount of colonies growing in soft agar compared to the scrambled control LNA treated or untreated control (transfected, but with no LNA), demonstrating decrease of tumour cells.

Conclusion: The 8-mer (#3205) targeting the miR-21 family reduces the number of colonies in soft agar, demonstrating proliferation arrest of PC3 cells.

Materials and Methods:

Cell line: The human prostate carcinoma PC3 cell line was purchased from ECACC (#90112714). PC3 cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax and 25 ug/ml Gentamicin.

Transfection: 250.000 cells were seeded per well in a 6-well plate the day before transfection in order to receive 50% confluency the next day. On the day of transfection, PC3 cells were transfected with 25 nM of different LNA oligonucleotides with Lipofectamine2000.

Clonogenic growth in soft agar: 2.5x10³ PC3 cells were seeded in 0.35% agar on the top of a base layer containing 0.5% agar. Cells were plated 24 hours after transfection. Plates were incubated in at 37°C, 5% CO₂ in a humified incubator for 12 days and stained with 0.005% crystal violet for 1 h, after which cells were counted. The assay was performed in triplicate.

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344

Example 33. Silencing of miR-21 by the 8-mer #3205 LNA-antimiR reduces colony formation of HepG2 cells. miR-21 is overexpressed in the human hepatocellular carcinoma cell line HepG2 and we have previously shown that we are able to regulate the luciferase activity of a miR-21 sensor plasmid with #3205 in these cells. HepG2 cells were transfected with #3205 and #3219 (scrambled 8-mer), and after 24 hours plated into soft agar. Colonies were counted after 17 days with a microscope.

Results: We show in Figure 33 that inhibition of miR-21 by #3205 can reduce the amount of colonies growing in soft agar, showing that proliferation arrest has occurred. In addition, our scrambled 8-mer control, #3219, had no significant effect on the number of colonies. Conclusion: The 8-mer (#3205) targeting the miR-21 reduces the number of colonies in soft agar, indicating proliferation arrest of HepG2 cells.

Materials and Methods:

Cell line: The human hepatocytic HepG2 cell line was purchased from ECACC (#85011430). HepG2 cells were cultured in EMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax and 25 ug/ml Gentamicin.

Transfection: 650.000 cells were seeded per well in a 6-well plate and reverse transfection was performed. HepG2 cells were transfected with 0.6 gg miR-21 luciferase sensor plasmid or empty psiCHECK2 vector together with 2,55 μΙ Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. Transfected were also LNA-antimiR and control oligonucleotides as varying concentrations. After 24 hours, the cells were harvested for luciferase measurements. Clonogenic growth in soft agar: 2.0x10³ HepG2 cells were seeded in 0.35% agar on the top of a base layer containing 0.5% agar. Cells were plated 24 hours after transfection. Plates were incubated in at 37°C, 5% CO₂ in a humified incubator for 17 days and stained with 0.005% crystal violet for 1 h, after which cells were counted. The assay was performed in triplicate.

Example 34. Silencing of miR-21 by the 8-mer #3205 LNA-antimiR inhibits cell migration in PC3 cells.

Cell migration can be monitored by performing a wound healing assay (=scratch assay) where a scratch is made in a cell monolayer, and images are captured at the beginning and at regular intervals during cell migration. By comparing the images, quantification of the migration rate of the cells can be determined. This was done in the human prostate cancer cell line PC3. Cells were seeded, and on day 3 the cells were transfected, and the next day, when 100% confluency was reached, a scratch (=wound) was made. When the scratch was made, pictures were taken in order to document the initial wound. Afterwards the area of the wound closure is measured at different time points with the free software program Image J. As shown in Figure 34A, PC3 cells had been treated with 25 nM #3205 (perfect match, miR-21), the control #3219 or left untransfected. Pictures were taken after 24 hours, and the area was calculated for the wound

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344 closure at respective time-point. The wound closure for the untransfected cells and for the control, #3219, was faster as compared to our LNA-antimiR against miR-21, #3205, indicating that #3205 inhibits miR-21 and prevents the cells from migrating (Figure 34B).

Conclusion: The 8-mer (#3205) targeting miR-21 inhibits the cell migration of PC3 cells compared to untransfected and control transfected cells.

Materials and Methods:

Cell line: The human prostate carcinoma PC3 cell line was purchased from ECACC (#90112714). PC3 cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 2 mM Glutamax and 25 ug/ml Gentamicin.

Scratch assay: 150.000 cells were seeded per well in a 6-well plate three days before transfection in order to receive 100% confluency the next day. At 24 hours after transfection, a scratch was made in the cell monolayer with a 200 μΙ tip. Pictures were taken at 0 h and after 24 hours by using a digital camera coupled to a microscope. The software program Image J was used to determine wound closure.

Example 35. Length assessment of fully LNA-substituted LNA-antimiRs antagonizing miR-155.

We have previously shown a length assessment for miR-21 regarding fully LNA-substituted LNA-antimiRs, and showed that the most potent LNA-antimiRs are 7-, 8- or 9 nt in length. The same experiment was repeated with miR-155. A perfect match target site for miR-155 was cloned into the 3’UTR of the luciferase gene in the reporter plasmid psiCHECK2 and transfected into the mouse RAW macrophage cell line together with fully LNA-substituted LNA-antimiRs of different lengths. Because the endogenous levels of miR-155 are low in the RAW cell line, the cells were treated with 100 ng/ml LPS for 24 hours in order to induce miR-155 accumulation. After 24 hours, luciferase analysis was performed.

Results: As shown in Figure 35, the most potent LNA-antimiRs are #3207(8 nt) and #3241 (9 nt), reaching almost a 80% de-repression at only 0.25 nM LNA concentration. The 6-mer (#3244) shows no significant de-repression. Increasing the length to 12-mer to 14-mer (#3242 and #3243) decreased the potency as shown by less efficient de-repression of the miR-155 reporter.

Conclusion:The most potent fully LNA-substituted LNA-antimiRs targeting miR-155 were an 8and 9-mer (#3207and #3241 ).

Materials and Methods:

Cell line: The mouse macrophage RAW 264.7 cell line was purchased from ATCC (TIB-71). RAW cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum, 4 mM Glutamax and 25 ug/ml Gentamicin.

CA 02701547 2016-02-01

WO 2009/043353 PC17DK2008/000344

Transfection: 500.000 cells were seeded per well in a 6-well plate the day before transfection in order to receive 50% confluency the next day. On the day of transfection, RAW 264.7 cells were transfected with 0.3 ug miR-155 perfect match/psiCHECK2 or empty psiCHECK2 vector together with 10 μΙ Lipofectamine2000 (Invitrogen) according to the manufacturer's instructions. Transfected was also varying concentrations of LNA-antimiRs. In order to induce miR-155 accumulation, LPS (100 ng/ml) was added to the RAW cells after the 4 hour incubation with the transfection complexes. After another 24 hours, cells were harvested for luciferase measurements.

Luciferase assay: The cells were washed with PBS and harvested with cell scraper, after which cells were spinned for 5 min at 2.500 rpm. The supernatant was discarded and 50 μΙ 1 x Passive Lysis Buffer (Promega) was added to the cell pellet, after which cells were put on ice for 30 min. The lysed cells were spinned at 10.000 rpm for 30 min after which 20 μΙ were transferred to a 96-well plate and luciferase measurements were performed according to the manufacturer's instructions (Promega).

Example 36. Plasma protein binding for the fully LNA-substituted 8-mer #3205 targeting miR-21 (LNA-antimiR-21).

The plasma proteins are not saturated with #3205 at the plasma concentrations in the experiment shown in Figure 36A. In a wide range of #3205 concentrations in the plasma the protein binding is around 95% of the #3205 LNA-antimiR-21 in Figure 36B. At #3205 concentrations 50.1 μΜ (174 pg/mL) the binding capacity of plasma proteins for FAM-labeled #3205 has not been saturated.

Materials and Methods: Mouse plasma (100 pL) was spiked with FAM-labeled #3205 to 0.167, 1.67, 5.01, 10.02,16.7, 25.05 and 50.1 pM concentrations. The solutions were incubated at 37°C for 30 minutes. The solutions were transferred to a Microcon Ultracel YM-30 filter (regenerated cellulose 30.000 MWCO). The filters were spun for 20 minutes at 2000g and at room temperature in a microcentrifuge. The filtrate was diluted 5, 10 and 20 times and 100pL samples were transferred to a microtiter plate (Polystyrene Black NUNO-237108). The fluorescence was detected using a FLUOstar Optima™ elisa reader with excitation 458 nm and emission 520 nm. The amount of unbound FAM-labeled #3205 was calculated from a standard curve derived from filtrated plasma spiked with FAM-labeled #3205 at 12 different (0.45 - 1000 nM) concentrations. The numbers were corrected with the recovery number established from filtration experiments with #3205 concentrations 0.167, 1.67, 5.01, 10.02, 16.7, 25.05 and 50.1 pM in filtrated plasma. The recovery of FAM-labeled #3205 was 86%.

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

Example 37. Quantitative whole body autoradiography study in female pigmented mice after single intravenous administration of ^S-labelled #3205 LNA-antimiR-21.

In order to determine the biodistribution of a short fully LNA-modified LNA-antimiR (#3205, 8mer) a whole body tissue distribution of radioactively labeled compound was done in mice. ^S5 labelled #3205 was dosed to mice with a single intravenous administration and mice were sacrificed at different time-points, ranging from 5 min to 21 days.

Table 6(i). Individual tissue concentrations (pg #3205/g tissue) after a single intravenous administration of ³⁵S- labelled #3205 in female pigmented mice. The figures are mean values of three measurements for each tissue and ratio. The coefficient of variation (CV) is generally about 10%.

<td> Tissue</td><td> Max. Cone, of oligo pg #3205/g tissue</td><td> Time of max cone, hours</td><td> TA hours</td>

<td> Adrenal gi.</td><td> 13.6</td><td> 0,083</td><td> 374</td>

<td> Bile</td><td> 4</td><td> 1</td><td></td>

<td> Bone marrow</td><td> 7,2</td><td> 0,083</td><td> 411</td>

<td> Brain</td><td> 0.4</td><td> 0,083</td><td></td>

<td> Brown fat</td><td> 8.8</td><td> 0,083</td><td></td>

<td> Gastric muc.</td><td> 10,1</td><td> 0,083</td><td></td>

<td> Heart blood</td><td> 26,2</td><td> 0,083</td><td> 10,3</td>

<td> Kidney ctx.</td><td> 58,7</td><td> 24</td><td> 104</td>

<td> Liver</td><td> 11,8</td><td> 0,083</td><td> 588</td>

<td></td><td> 10,7</td><td> 24</td><td></td>

<td> Lung</td><td> 13,2</td><td> 0,083</td><td> 289</td>

<td> Lymph node</td><td> 5</td><td> 0,083</td><td> 262</td>

<td></td><td> 2,4</td><td> 48</td><td></td>

<td> Lymph</td><td> 18,8</td><td> 4</td><td></td>

<td></td><td> 20,8</td><td> 168</td><td></td>

<td> Myocardium</td><td> 8,1</td><td> 0,083</td><td> 662</td>

<td> Ovary</td><td> 13</td><td> 0,083</td><td> 198</td>

<td> Pancreas</td><td> 5</td><td> 0,083</td><td></td>

<td> Pituitary ql.</td><td> 6.7</td><td> 0,083</td><td></td>

<td> Salivary gl.</td><td> 8,6</td><td> 0,083</td><td> 405</td>

<td></td><td> 5,5</td><td> 168</td><td></td>

<td> skel. Muscle</td><td> 4,8</td><td> 0,083</td><td></td>

<td> Skin pig.</td><td> 5,4</td><td> 0,25</td><td></td>

<td> Spleen</td><td> 9,8</td><td> 0,083</td><td> 564</td>

<td> Thymus</td><td> 3.8</td><td> 0,083</td><td> 185</td>

<td> Thyroid gl.</td><td> 10,9</td><td> 0,083</td><td> 592</td>

<td> Urine</td><td> 328,9</td><td> 0,083</td><td></td>

<td> Uterus</td><td> 9.6</td><td> 0,25</td><td> 177</td>

<td> Uvea of the eye</td><td> 13,6</td><td> 0,083</td><td></td>

<td> LOQ</td><td> 0,045</td><td> 0,083</td><td></td>

<td></td><td> 0,033</td><td> 24</td><td></td>

<td></td><td> 0,03</td><td> 168</td><td></td>

Table 6(ii) Tissue to liver ratios after single intravenous administration of æS- labelled #3205 in female pigmented mice.

<td>^ÆS-#3205</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Animal no</td><td> 10</td><td> 11</td><td> 12</td><td> 13</td><td> 14</td><td> 15</td><td> 16</td><td> 17</td><td> 18</td>

<td> Surv. Time (h)</td><td> 0,083</td><td> 0,25</td><td> 1h</td><td> 4h</td><td> 24h</td><td> 48h</td><td> 96h</td><td> 168</td><td> 504</td>

<td> Organ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Adrenal gl</td><td> liver</td><td> liver</td><td> liver</td><td> liver</td><td> liver</td><td> liver</td><td> liver</td><td> liver</td><td> liver</td>

<td> Bile</td><td> 1,15</td><td> 1,08</td><td> 0,52</td><td> 0,27</td><td> 0,24</td><td> 0,26</td><td> 0,23</td><td> 0,18</td><td> 0,17</td>

<td> Bone marrow</td><td> 0,03</td><td> 0,11</td><td> 0,55</td><td> 0,10</td><td> 0,03</td><td> 0,07</td><td> 0,04</td><td> 0,03</td><td> 0,04</td>

CA 02701547 2016-02-01

WO 20(19/043353

PCT/DK2008/000344

<td> Brain</td><td> 0,61</td><td> 0.81</td><td> 0,55</td><td> 0,45</td><td> 0.40</td><td> 0.48</td><td> 0.43</td><td> . Jù±L i</td><td> 0,34</td><td rowspan="22"></td>

<td> Brown fat</td><td> 0,03</td><td> 0,03</td><td> 0,01</td><td> 0,00</td><td> 0,00</td><td> 0.00</td><td> 0,00</td><td> 0,00</td><td> 0,00</td>

<td> Gastric muc</td><td> 0,75</td><td> 0.57</td><td> 0,29</td><td> 0,12</td><td> 0.07</td><td> 0.12</td><td> 0,08</td><td> 0,10</td><td> 0.07</td>

<td> Heart blood</td><td> 0,86</td><td> 0.71</td><td> 0,31</td><td> 0,22</td><td> 0,10</td><td> 0,21</td><td> 0,15</td><td> 0,16</td><td> 0,12</td>

<td> Kidney ctx</td><td> 2,23</td><td> 1.91</td><td> 0,74</td><td> 0.11</td><td> 0,01</td><td> 0,00</td><td> 0,00</td><td> 0,00</td><td> 0,00</td>

<td> Liver</td><td> 2,87</td><td> 3.94</td><td> 6.45</td><td> 6,95</td><td> 5.51</td><td> 6.68</td><td> 3.92</td><td> 2,24</td><td> 0,40</td>

<td> Lung</td><td> 1,00</td><td> 1,00</td><td> 1,00</td><td> 1,00</td><td> 1,00</td><td> 1.00</td><td> 1,00</td><td> 1,00</td><td> 1,00</td>

<td> Lymph node</td><td> 1,12</td><td> 0,97</td><td> 0.63</td><td> 0,09</td><td> 0,04</td><td> 0,04</td><td> 0,03</td><td> 0,02</td><td> 0,02</td>

<td> Lymph</td><td> 0,43</td><td> 0.30</td><td> 0,25</td><td> 0,19</td><td> 0,11</td><td> 0,32</td><td> 0,20</td><td> 0,17</td><td> 0,12</td>

<td> Myocardium</td><td> 0,82</td><td> 1,09</td><td> 1.78</td><td> 2,78</td><td> 1,03</td><td> 2,05</td><td> 1,62</td><td> 3.17</td><td> 1,89</td>

<td> Ovary</td><td> 0,69</td><td> 0,63</td><td> 0,30</td><td> 0,13</td><td> 0,10</td><td> 0,15</td><td> 0,09</td><td> 0,11</td><td> 0,12</td>

<td> Pancreas</td><td> 1,10</td><td> 1,40</td><td> 0,61</td><td> 0,31</td><td> 0,27</td><td> 0,28</td><td> 0,21</td><td> 0,21</td><td> 0,08</td>

<td> Pituitary gland</td><td> 0,42</td><td> 0,37</td><td> 0,22</td><td> 0.18</td><td> 0,12</td><td> 0.17</td><td> 0,12</td><td> 0,15</td><td> 0,11</td>

<td> Salivary gland</td><td> 0,57</td><td> 0.54</td><td> 0.28</td><td> 0,11</td><td> 0,15</td><td> 0,16</td><td> 0,12</td><td> 0,10</td><td> 0.08</td>

<td> Skel, muscle</td><td> 0,73</td><td> 0.81</td><td> 0,38</td><td> 0,25</td><td> 0,25</td><td> 0.42</td><td> 0,23</td><td> 0,85</td><td> 0,24</td>

<td> Skin, pigm.</td><td> 0,40</td><td> 0,28</td><td> 0,14</td><td> 0,04</td><td> 0,02</td><td> 0.04</td><td> 0,03</td><td> 0,03</td><td> 0,03</td>

<td> Spleen</td><td> 0,34</td><td> 0,69</td><td> 0,65</td><td> 0,36</td><td> 0,20</td><td> 0,26</td><td> 0,20</td><td> 0,19</td><td rowspan="2"> 0,13 0.31</td>

<td> Thymus</td><td> 0,83</td><td> 0,86</td><td> 0.44</td><td> 0,32</td><td> 0.24</td><td> 0,34</td><td> 0,35</td><td> 0,29</td>

<td> Thyroid gland</td><td> 0,32</td><td> 0,31</td><td> 0,14</td><td> 0,07</td><td> 0.09</td><td> 0,08</td><td> 0,05</td><td> 0,04</td><td> 0,02</td>

<td> Urine</td><td> 0.9</td><td> 1.2</td><td> 0,43</td><td> 0,28</td><td> 0,25</td><td> 0,34</td><td> 0,19</td><td> 0,26</td><td> 0,25</td>

<td> Uterus</td><td> 27,96</td><td> 39,48</td><td> 9.90</td><td> 5,44</td><td> 0,24</td><td> 0,39</td><td> 0,12</td><td> 0,15</td><td> 0,03</td>

<td> Uvea of the eye</td><td> 0,56</td><td> 1,23</td><td> 0,65</td><td> 0,30</td><td> 0,30</td><td> 0,07</td><td> 0,27</td><td> 0,16</td><td> 0,08</td>

<td colspan="11"> Conclusions: #3205 shows blood clearance of radioactivity with elimination half-lives of 8-10</td>

hours. High levels of radioactivity were registered in the kidney cortex, lymph, liver, bone marrow, spleen, ovary and uterus. The highest level of radioactivity was registered in the kidney cortex showing five times higher levels than that of the liver for #3205. A strong retention of radioactivity was noticed in the kidney cortex, lymph, liver, bone marrow and spleen for #3205 LNA-antimiR-21.

Materials and Methods:

Dose administration: Al) mice were weighed before administration. Nine female mice were given 10 mg/kg of ³⁵S-#3205 intravenously in a tail vein. The volume given to each animal was 10 mL/kg of the test formulation. The specific activity 75.7 pCi/mg. Individual mice were killed 5 min, 15 min, 1 hour, 4 hours, 24 hours, 2 days, 4 days, 7 days and 21 days after administration of #3205.Whole body autoradiography: The mice were anaesthetized by sevoflurane, and then immediately immersed in heptane, cooled with dry ice to -80°C, ABR-SOP-0130. The frozen carcasses were embedded in a gel of aqueous carboxymethyl cellulose (CMC), frozen in ethanol, cooled with dry ice (-80°C) and sectioned sagittaly for whole body autoradiography, according to the standard method, ABR-SOP-0131. From each animal 20 pm sections were cut at different levels with a cryomicrotome (Leica CM 3600™) at a temperature of about -20°C. The obtained sections were caught on tape (Minnesota Mining and Manufacturing Co., No. 810) and

CA 02701547 2010-04-01

WO 2009/043353 PCI7DK2008/000344 numbered consecutively with radioactive ink. After being freeze-dried at -20°C for about 24 hours, selected sections were covered with a thin layer of mylar foil, and put on imaging plates (Fuji, Japan). Exposure took place in light tight cassettes in a lead shielding box at -20°C, to protect the image plates from environmental radiation. After exposure the imaging plates were scanned at a pixel size of 50 pm and analyzed by radioluminography using a bioimaging analysis system (Bas 2500, Fuji, Japan), and described in ABR-SOP-0214. A water-soluble standard test solution of radioactivity was mixed with whole blood and used for production of a calibration scale, ABR-SOP-0251. However, the different blood standards were dissolved in 500 uL Soluene-35. 4.5 mL Ultima Gold was then added to the dissolved samples. As ³⁵S and ¹⁴C have very similar energy spectra, a standard ¹⁴C-programme (Packard 2200CA) was used when the radioactivity for the different blood samples was settled.

Pharmacokinetic calculations: The ³⁵S radioactivity measured in whole blood and tissues was expressed as nCi/g tissue and recalculated to nmol equiv/g tissue for the pharmacokinetic evaluation. The pharmacokinetic parameters Cmax&gt; tv2 and AUG were determined for the whole blood and tissues by non-compartmental analysis using WinNonlin Professional (Pharsight Corporation, Mountain View, CA, USA). After intravenous administration, the concentration was extrapolated back to zero and expressed as (Co). The elimination rate constant λ was estimated by linear regression analysis of the terminal slope of the logarithmic plasma concentration-time curve. The elimination half-life, t_1/2, was calculated using the equation, t_1/2 = Ιη2/λ. The last three time-points above LOQ were used in the elimination half-life calculations, if not stated otherwise.

Example 38. Assessment of let-7 inhibition in vivo by an 8-mer LNA-antimiR, as determined through Ras protein quantification in mouse lung and kidney

In order to investigate the possibility to antagonize the abundantly expressed let-7 family in vivo, mice were intravenously (i.v.) injected with an 8-mer LNA-antimiR antagonist or with saline. To measure treatment effect, proteins were isolated from lungs and kidneys. Because the Ras family of proteins (N-Ras, K-Ras, and Η-Ras), in particular N-Ras and K-Ras, has previously been shown to be regulated (repressed) by the let-7 family by Johnson et al. (Cell, 2005), the aim was to analyze whether these let-7 targets could be de-repressed in vivo.

Results: As seen in Figure 37, the 8-mer LNA-antimiR potently de-repressed Ras protein levels in the kidneys of treated mice, normalized against saline controls. The up-regulation in this organ was more than 3-fold, showing a clear in vivo effect. In the lungs, however, only a minimal (1.2-fold) Ras de-repression was observed (Fig 1B), suggesting that insufficient amounts of LNA-antimiR has entered this organ in order to inhibit its massive amounts of let-7, as previously described by Johnson et al. (Cancer Research, 2007).

CA 02701547 2016-02-01

WO 2009/043353 PCT/DK2008/000344

Conclusion: The 8-mer LNA-antimiR shows a clear effect in regulating target let-7 miRNA in vivo, as evaluated based on Ras protein levels in treated vs. control mice. Whereas the effect seems to be smaller in lungs, Ras levels in the kidney show a substantial up-regulation upon antimiRs-treatment.

Materials and Methods: Animals and dosing: C57BL/6 female mice were treated with 10 mg/kg LNA-antimiR or saline for three consecutive days (0,1, and 2) and sacrificed on day 4. Tissue samples from lungs and kidneys were snapfrozen and stored at -80°C until further processing.

Western blot analysis: Lung and kidney proteins from saline and LNA-antimiR-treated mice were separated on NuPAGE™ Bis Tris 4-12% (Invitrogen), using 100 pg per sample. The proteins were transferred to a nitrocellulose membrane using iBIot (invitrogen) according to the manufacturer’s instructions. Blocking, antibody dilution and detection was performed according to the manufacturer’s specifications. For Ras detection, a primary rabbit-anti Ras antibody (SC3339, Santa Cruz Biotechnology) and a secondary HRP-conjugated swine-anti-rabbit antibody (P0399, Dako) was used, and for tubulin detection, a primary tubulin alpha (MS-581-P1, Neomarkers) and a secondary HRP-conjugated goat-anti-mouse antibody (P0447, Dako) was used.

Example 40. In vivo efficacy assessment of the 8-mer LNA-antimiR (#3205) in targeting miR-21, as determined by Pdcd4 protein up-regulation in mouse kidney.

We have shown that an 8-mer LNA-antimiR that is fully LNA-modified antagonizes miR-21 and has the ability to regulate the protein levels of the miR-21 target Pdcd4 in vitro. We therefore injected the LNA-antimiR into mice to determine the effects of the LNA-antimiR in vivo. The mice received 25 mg/kg of #3205 by i.v. injection every other day for 14 days (a total of 5 doses). The mice were sacrificed on day 14, the kidney was removed, and protein was isolated. In order to determine target regulation, Western blot analysis was performed.

Results: As shown in Figure 37, treating mice with #3205 showed significantly increased Pdcd4 protein levels as compared to the saline control. While the normalized Pdcd4 versus Gapdh ratio was consistent in both saline samples, the protein up-regulation in the two LNAantimiR-treated (#32059 mice were measured to 3.3- and 6.3-fold, respectively, demonstrating an in vivo pharmacological effect of the #3205 8-mer LNA-antimiR.

Conclusion: The fully LNA-modified 8-mer LNA-antimiR #3205 antagonizes miR-21 in vivo, as demonstrated through its ability to de-repress (up-regulate) mouse kidney levels of Pdcd4, a validated miR-21 target.

Materials and Methods:

Animals and dosing: C57BL/6 female mice with average of 20 g body weight at first dosing were used in all experiments and received regular chow diet (Altromin no 1324, Brogaarden, Gentofte, Denmark). Substances were formulated in physiological saline (0.9% NaCl). The

SUBSTITUTE SHEET (RULE 26)

CA 02701547 2010-04-01

WO 2009/043353 PCT/DK2008/000344 animals were dozed with LNA-antimiR or saline (0.9% NaCI), receiving an injection of 25 mg/kg every other day for 14 days, a total of 5 doses. Animals were sacrificed on day 14.

Western blot analysis: 80 pg kidney tissue from saline or LNA-treated mice was separated on NuPAGE Bis Tris 4-12% (Invitrogen). The proteins were transferred to a nitrocellulose membrane using iBIot (Invitrogen) according to the manufacturer’s instructions. The membrane was incubated with Pdcd4 antibody (Bethyl Laboratories), followed by HRP-conjugated swineanti-rabbit antibody (Dako). As equal loading control, GAPDH (Abeam) was used, followed by HRP-conjugated swine-anti-mouse antibody. The membranes were visualized by chemiluminiscence (ECL, Amersham).

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

<td colspan="9"> Table 1</td>

<td> microRNA</td><td> biicroRNASoquence</td><td> SEQ ID NO</td><td> 9-mer</td><td> SEQ ID NO</td><td> 8-mez</td><td> SEQ ID NO</td><td> 7-mer</td><td> SEQ ID NO</td>

<td> ebv-miR-BARTl-3p</td><td> OAGCACCGCUAUCCACUAUGOC</td><td> 40</td><td> AGCGGTGCT</td><td> 977</td><td> GCGGTGCT</td><td> 1914</td><td> CGGTGCT</td><td> 2851</td>

<td> ebv-miR-BARTl-5p</td><td> ÜCOOAGÜGGAAGOGACGÜGCUGUG</td><td> 41</td><td> TCCACTAAG</td><td> 978</td><td> CCACTAAG</td><td> 1915</td><td> CACTAAG</td><td> 2852</td>

<td> ebv—miR—BART10</td><td> OACAUAACCAUGGAGUÜGGCUGO</td><td> 42</td><td> TGGTTATGT</td><td> 979</td><td> GGTTATGT</td><td> 1916</td><td> GTTATGT</td><td> 2853</td>

<td> ebv-miR-BARTl0 *</td><td> GCCACCOCUUÜGGUUCOGUACA</td><td> 43</td><td> AAGAGGTGG</td><td> 980</td><td> AGAGGTGG</td><td> 1917</td><td> GAGGTGG</td><td> 2854</td>

<td> ebv—miR—BARTH—3p</td><td> ACGCACACCAGGCÜGACÜGCC</td><td> 44</td><td> TGGTGTGCG</td><td> 981</td><td> GGTGTGCG</td><td> 1918</td><td> GTGTGGG</td><td> 2855</td>

<td> ebv-miR-BARTll-5p</td><td> UCAGACAGÜÜÜGGOGCGCUAGUÜG</td><td> 45</td><td> AACTGTCTG</td><td> 982</td><td> ACTGTCTG</td><td> 1919</td><td> CTGTCTG</td><td> 2856</td>

<td> ebv-miR-BART12</td><td> ÜCCÜGUGGUGÜÜOGGUGÜGGUU</td><td> 46</td><td> CACCACAGG</td><td> 983</td><td> ACCACAGG</td><td> 1920</td><td> CCACAGG</td><td> 2857</td>

<td> ebv—miR—Bart13</td><td> UGUAACÜUGCCAGGGACGGCUGA</td><td> 47</td><td> GCAAGTTAC</td><td> 984</td><td> CAAGTTAC</td><td> 1921</td><td> AAGTTAC</td><td> 2858</td>

<td> ebv—miR—BART13*</td><td> AACCGGCOCGÜGGCÜCGUACAG</td><td> 48</td><td> CGAGCCGGT</td><td> 985</td><td> GAGCCGGT</td><td> 1922</td><td> AGCCGGT</td><td> 2859</td>

<td> ebv—miR—BART14</td><td> UAAAÜGCOGCAGUAGOAGGGAU</td><td> 49</td><td> GCAGCATTT</td><td> 986</td><td> CAGCATTT</td><td> 1923</td><td> AGCATTT</td><td> 2860</td>

<td> ebv—miR—BART14*</td><td> UACCCUACGCUGCCGAUUUACA</td><td> 50</td><td> GCGTAGGGT</td><td> 987</td><td> CGTAGGGT</td><td> 1924</td><td> GTAGGGT</td><td> 2861</td>

<td> ebv-miR-BART15</td><td> GUCAGÜGGOÜÜÜGÜÜÜCCUUGA</td><td> 51</td><td> AACCACTGA</td><td> 988</td><td> ACCACTGA</td><td> 1925</td><td> CCACTGA</td><td> 2862</td>

<td> ebv-miR-BARTl6</td><td> ÜUAGAUAGAGOGGGOGOGUGCUCÜ</td><td> 52</td><td> CTCTATCTA</td><td> 989</td><td> TCTATCTA</td><td> 1926</td><td> CTATCTA</td><td> 2863</td>

<td> ebv-miR-BART17-3p</td><td> UGUAÜGCCOGGÜGUCCCCÜÜAGO</td><td> 53</td><td> CAGGCATAC</td><td> 990</td><td> AGGCATAC</td><td> 1927</td><td> GGCATAC</td><td> 2864</td>

<td> ebv-miR-BART17-5p</td><td> ÜAAGAGGACGCAGGCAUACAAG</td><td> 54</td><td> CGTCCTCTT</td><td> 991</td><td> GTCCTCTT</td><td> 1928</td><td> TCCTCTT</td><td> 2865</td>

<td> ebv-miR-BART18-3p</td><td> ÜAÜCGGAAGÜUOGGGCÜUCGÜC</td><td> 55</td><td> ACTTCCGAT</td><td> 992</td><td> CTTCCGAT</td><td> 1929</td><td> TTCCGAT</td><td> 2866</td>

<td> ebv-miR-BART18-5p</td><td> OCAAGOUCGCACOUCCÜAÜACA</td><td> 56</td><td> GCGAACTTG</td><td> 993</td><td> CGAACTTG</td><td> 1930</td><td> GAACTTG</td><td> 2867</td>

<td> ebv-miR-BART19-3p</td><td> ÜÜÛÜGOUÜGCUUGGGAAUGCO</td><td> 57</td><td> GCAAACAAA</td><td> 994</td><td> CAAACAAA</td><td> 1931</td><td> AAACAAA</td><td> 2868</td>

<td> ebv-miR-BART19-5p</td><td> ACAÜÜCCCCGCAAACAOGACAÜG</td><td> 58</td><td> CGGGGAATG</td><td> 995</td><td> GGGGAATG</td><td> 1932</td><td> GGGAATG</td><td> 2869</td>

<td> ebv-miR-BART2-3p</td><td> AAGGAGCGAUUUGGAGAAAAÛAAA</td><td> 59</td><td> ATCGCTCCT</td><td> 996</td><td> TCGCTCCT</td><td> 1933</td><td> CGCTCCT</td><td> 2870</td>

<td> ebv—miR—BART2—5p</td><td> ÜAUÜÜUCÜGCAÜUCGCCCÜÜGC</td><td> 60</td><td> GCAGAAAAT</td><td> 997</td><td> CAGAAAAT</td><td> 1934</td><td> AGAAAAT</td><td> 2871</td>

<td> ebv-miR-BART20-3p</td><td> CAÜGAAGGCACAGCCÜGOOACC</td><td> 61</td><td> TGCCTTCAT</td><td> 998</td><td> GCCTTCAT</td><td> 1935</td><td> CCTTCAT</td><td> 2872</td>

<td> ebv—miR—BART20—5p</td><td> OAGCAGGCAOGUCUOCAÜUCC</td><td> 62</td><td> ATGCCTGCT</td><td> 999</td><td> TGCCTGCT</td><td> 1936</td><td> GCCTGCT</td><td> 2873</td>

<td> ebv-miR-BART3</td><td> CGCACCACUAGÜCACCAGGOGÜ</td><td> 63</td><td> TAGTGGTGC</td><td> 1000</td><td> AGTGGTGC</td><td> 1937</td><td> GTGGTGC</td><td> 2874</td>

<td> ebv-miR-BART3*</td><td> ACCUAGÜGOUAGÜGUOGUGCÜ</td><td> 64</td><td> AACACTAGG</td><td> 1001</td><td> ACACTAGG</td><td> 1938</td><td> CACTAGG</td><td> 2875</td>

<td> ebv-miR-BART4</td><td> GACCÜGAOGCOGCOGGÜGÜGCÜ</td><td> 65</td><td> GCATCAGGT</td><td> 1002</td><td> CATCAGGT</td><td> 1939</td><td> ATCAGGT</td><td> 2876</td>

<td> ebv-miR-BART5</td><td> CAAGGOGAAÜAUAGCÜGCCCAUCG</td><td> 66</td><td> ATTCACCTT</td><td> 1003</td><td> TTCACCTT</td><td> 1940</td><td> TCACCTT</td><td> 2877</td>

<td> ebv-miR-BART6-3p</td><td> CGGGGAUCGGACUAGCCOUAGA</td><td> 67</td><td> CCGATCCCC</td><td> 1004</td><td> CGATCCCC</td><td> 1941</td><td> GATCCCC</td><td> 2878</td>

<td> ebv—miR—BART6—5p</td><td> OAAGGÜOGGÜCCAAÜCCAUAGG</td><td> 68</td><td> ACCAACCTT</td><td> 1005</td><td> CCAACCTT</td><td> 1942</td><td> CAACCTT</td><td> 2879</td>

<td> ebv—miR—BART7</td><td> CAÜCAÜAGUCCAGÜGUCCAGGG</td><td> 69</td><td> GACTATGAT</td><td> 1006</td><td> ACTATGAT</td><td> 1943</td><td> CTATGAT</td><td> 2880</td>

<td> ebv—miR—BART7*</td><td> CCÜGGACCUUGACÜAUGAAACA</td><td> 70</td><td> AAGGTCCAG</td><td> 1007</td><td> AGGTCCAG</td><td> 1944</td><td> GGTCCAG</td><td> 2881</td>

<td> ebv-miR-BART8</td><td> ÜACGGUOOCCOAGAÜÜGOACAG</td><td> 71</td><td> GGAAACCGT</td><td> 1008</td><td> GAAACCGT</td><td> 1945</td><td> AAACCGT</td><td> 2882</td>

<td> ebv-miR-BART8 *</td><td> GÜCACAAOCUAÜGGGGOCGÜAGA</td><td> 72</td><td> AGATTGTGA</td><td> 1009</td><td> GATTGTGA</td><td> 1946</td><td> ATTGTGA</td><td> 2883</td>

<td> ebv-miR-BART 9</td><td> OAACACOUCAUGGGOCCCGUAGU</td><td> 73</td><td> TGAAGTGTT</td><td> 1010</td><td> GAAGTGTT</td><td> 1947</td><td> AAGTGTT</td><td> 2884</td>

<td> ebv-miR-BART9*</td><td> ÜACUGGACCCÜGAAOUGGAAAC</td><td> 74</td><td> GGGTCCAGT</td><td> 1011</td><td> GGTCCAGT</td><td> 1948</td><td> GTCCAGT</td><td> 2885</td>

<td> ebv-miR-BHRFl-1</td><td> ÛAACCUGAUCAGCCCCGGAGUU</td><td> 75</td><td> GATCAGGTT</td><td> 1012</td><td> ATCAGGTT</td><td> 1949</td><td> TCAGGTT</td><td> 2886</td>

<td> ebv-miR-BHRFl-2</td><td> ÛAOCÜÜÜUGCGGCAGAAAÜOGA</td><td> 76</td><td> GCAAAAGAT</td><td> 1013</td><td> CAAAAGAT</td><td> 1950</td><td> AAAAGAT</td><td> 2887</td>

<td> ebv-miR-BHRF1-2*</td><td> AAAUUCÜGUÜGCAGCAGAÜAGC</td><td> 77</td><td> AACAGAATT</td><td> 1014</td><td> ACAGAATT</td><td> 1951</td><td> CAGAATT</td><td> 2888</td>

<td> ebv-miR-BHRFl-3</td><td> ÜAACGGGAAGUGÜGÜAAGCACA</td><td> 78</td><td> CTTCCCGTT</td><td> 1015</td><td> TTCCCGTT</td><td> 1952</td><td> TCCCGTT</td><td> 2889</td>

<td> hcmv-miR-UL112</td><td> AAGUGACGGOGAGAÜCCAGGCÜ</td><td> 79</td><td> ACCGTCACT</td><td> 1016</td><td> CCGTCACT</td><td> 1953</td><td> CGTCACT</td><td> 2890</td>

<td> hcmv-miR-ÜL14 8 D</td><td> ÜCGUCCUCCCCOUCÜUCACCG</td><td> 80</td><td> GGGAGGACG</td><td> 1017</td><td> GGAGGACG</td><td> 1954</td><td> GAGGACG</td><td> 2891</td>

<td> hcmv-miR-0I»22A</td><td> ÜAACÜAGCCOOCCCGUGAGA</td><td> 81</td><td> AGGCTAGTT</td><td> 1018</td><td> GGCTAGTT</td><td> 1955</td><td> GCTAGTT</td><td> 2892</td>

<td> hcmv-miR“UL22A*</td><td> UCACCAGAAÜGCUAGÜOUGOAG</td><td> 82</td><td> ATTCTGGTG</td><td> 1019</td><td> TTCTGGTG</td><td> 1956</td><td> TCTGGTG</td><td> 2893</td>

<td> hcmv-miR-UL36</td><td> UCGOOGAAGACACCOGGAAAGA</td><td> 83</td><td> TCTTCAACG</td><td> 1020</td><td> CTTCAACG</td><td> 1957</td><td> TTCAACG</td><td> 2894</td>

<td> hcmv-miR-Ol&gt;3 6*</td><td> ÜOOCCAGGUGOÜOOCAACGOGC</td><td> 84</td><td> CACCTGGAA</td><td> 1021</td><td> ACCTGGAA</td><td> 1958</td><td> CCTGGAA</td><td> 2895</td>

<td> hcmv-miR-UL70-3p</td><td> GGGGAUGGGCOGGCGCGCGG</td><td> 85</td><td> GCCCATCCC</td><td> 1022</td><td> CCCATCCC</td><td> 1959</td><td> CCATCCC</td><td> 2896</td>

<td> hcmv-miR-Uli70-5p</td><td> OGCGÜCOCGGCCOCGÜCCAGA</td><td> 86</td><td> CCGAGACGC</td><td> 1023</td><td> CGAGACGC</td><td> 1960</td><td> GAGACGC</td><td> 2897</td>

<td> hcxav-miR-US2S-l</td><td> AACCGCÜCAGUGGCÜCGGACC</td><td> 87</td><td> CTGAGCGGT</td><td> 1024</td><td> TGAGCGGT</td><td> 1961</td><td> GAGCGGT</td><td> 2898</td>

<td> hcmv-miR-OS25-1*</td><td> UCCGAACGCUAGGOCGGÜOCUC</td><td> 88</td><td> AGCGTTCGG</td><td> 1025</td><td> GCGTTCGG</td><td> 1962</td><td> CGTTCGG</td><td> 2899</td>

<td> hcmv-miR-ÜS25-2- 3P </td><td> AÜCCACOOGGAGAGCÜCCCGCGG</td><td> 89</td><td> CCAAGTGGA</td><td> 1026</td><td> CAAGTGGA</td><td> 1963</td><td> AAGTGGA</td><td> | 2900</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

<td> hcmv-miR-0S25-25p</td><td> AGCGGUCÜGUUCAGGOGGAÜGA</td><td> 90</td><td> ACAGACCGC</td><td> 1027</td><td> CAGACCGC</td><td> 1964</td><td> AGACCGC</td><td> 2901</td>

<td> hcmv-miR-QS33-3p</td><td> ÜCACGGÜCCGAGCACAÜCCA</td><td> 91</td><td> CGGACCGTG</td><td> 1028</td><td> GGACCGTG</td><td> 1965</td><td> GACCGTG</td><td> 2902</td>

<td> hcmv-miR-US33-5p</td><td> GAUÜGUGCCCGGACCGÜGGGCG</td><td> 92</td><td> GGGCACAAT</td><td> 1029</td><td> GGCACAAT</td><td> 1966</td><td> GCACAAT</td><td> 2903</td>

<td> hcmv-miR-0S4</td><td> CGACAUGGACGUGCAGGGGGAÜ</td><td> 93</td><td> GTCCATGTC</td><td> 1030</td><td> TCCATGTC</td><td> 1967</td><td> CCATGTC</td><td> 2904</td>

<td> hcmv-miR-OS5-1</td><td> UGACAAGCCUGACGAGAGCGO</td><td> 94</td><td> AGGCTTGTC</td><td> 1031</td><td> GGCTTGTC</td><td> 1968</td><td> GCTTGTC</td><td> 2905</td>

<td> hcrav-miR-US5-2</td><td> UÜAÜGAUAGGUGUGACGAÜGÜC</td><td> 95</td><td> CCTATCATA</td><td> 1032</td><td> CTATCATA</td><td> 1969</td><td> TATCATA</td><td> 2906</td>

<td> hsa-let-7a</td><td> OGAGGÜAGUAGGOOGUAUAGÜO</td><td> 96</td><td> TACTACCTC</td><td> 1033</td><td> ACTACCTC</td><td> 1970</td><td> CTACCTC</td><td> 2907</td>

<td> hsa-let-7a*</td><td> COAÜACAAÜCÜACOGOCOOOC</td><td> 97</td><td> GATTGTATA</td><td> 1034</td><td> ATTGTATA</td><td> 1971</td><td> TTGTATA</td><td> 2908</td>

<td> hsa-let-7b</td><td> OGAGGUAGUAGGUOGUGOGGUÜ</td><td> 98</td><td> TACTACCTC</td><td> 1035</td><td> ACTACCTC</td><td> 1972</td><td> CTACCTC</td><td> 2909</td>

<td> hsa-let-7b*</td><td> CUAOACAACCÜACUGCCÜÜCCC</td><td> 99</td><td> GGTTGTATA</td><td> 1036</td><td> GTTGTATA</td><td> 1973</td><td> TTGTATA</td><td> 2910</td>

<td> hsa-let-7c</td><td> UGAGGUAGÜAGGÜUGOAÜGGÜU</td><td> 100</td><td> TACTACCTC</td><td> 1037</td><td> ACTACCTC</td><td> 1974</td><td> CTACCTC</td><td> 2911</td>

<td> hsa-let-7c*</td><td> OAGAGÜÜACACCCOGGGAGOOA</td><td> 101</td><td> TGTAACTCT</td><td> 1038</td><td> GTAACTCT</td><td> 1975</td><td> TAACTCT</td><td> 2912</td>

<td> hsa-let-7d</td><td> AGAGGUAGÜAGGOOGCAÜAGOU</td><td> 102</td><td> TACTACCTC</td><td> 1039</td><td> ACTACCTC</td><td> 1976</td><td> CTACCTC</td><td> 2913</td>

<td> hsa-let-7d*</td><td> CÜAOACGACCOGCOGCCÜUUCÜ</td><td> 103</td><td> GGTCGTATA</td><td> 1040</td><td> GTCGTATA</td><td> 1977</td><td> TCGTATA</td><td> 2914</td>

<td> hsa-let-7e</td><td> UGAGGUAGGAGGnUGnAOAGDU</td><td> 104</td><td> TCCTACCTC</td><td> 1041</td><td> CCTACCTC</td><td> 1978</td><td> CTACCTC</td><td> 2915</td>

<td> hsa-let-7e*</td><td> COAOACGGCCOCCOAGCOUUCC</td><td> 105</td><td> GGCCGTATA</td><td> 1042</td><td> GCCGTATA</td><td> 1979</td><td> CCGTATA</td><td> 2916</td>

<td> hsa-let-7f</td><td> ÜGAGGÜAGUAGAOOGUAOAGÜÜ</td><td> 106</td><td> TACTACCTC</td><td> 1043</td><td> ACTACCTC</td><td> 1980</td><td> CTACCTC</td><td> 2917</td>

<td> hsa-let-7f-l*</td><td> CUAUACAAUCOAOÜGCCÜOCCC</td><td> 107</td><td> GATTGTATA</td><td> 1044</td><td> ATTGTATA</td><td> 1981</td><td> TTGTATA</td><td> 2918</td>

<td> hsa-let-7 f-2*</td><td> CUAÜACAGUCUACOGUCUUUCC</td><td> 108</td><td> GACTGTATA</td><td> 1045</td><td> ACTGTATA</td><td> 1982</td><td> CTGTATA</td><td> 2919</td>

<td> hsa-let-7g</td><td> UGAGGUAGOAGOOÜGUACAGUU</td><td> 109</td><td> TACTACCTC</td><td> 1046</td><td> ACTACCTC</td><td> 1983</td><td> CTACCTC</td><td> 2920</td>

<td> hsa-let-7g*</td><td> CUGUACAGGCCACÜGCCÜUGC</td><td> 110</td><td> GCCTGTACA</td><td> 1047</td><td> CCTGTACA</td><td> 1984</td><td> CTGTACA</td><td> 2921</td>

<td> hsa-let-7i</td><td> UGAGGUAGUAGOUOGUGCUGOO</td><td> 111</td><td> TACTACCTC</td><td> 1048</td><td> ACTACCTC</td><td> 1985</td><td> CTACCTC</td><td> 2922</td>

<td> hsa-let-7i*</td><td> CUGCGCAAGCUACUGCCUOGCÜ</td><td> 112</td><td> GCTTGCGCA</td><td> 1049</td><td> CTTGCGCA</td><td> 1986</td><td> TTGCGCA</td><td> 2923</td>

<td> hsa-miR-1</td><td> UGGAAUGUAAAGAAGUAUGÜAÜ</td><td> 113</td><td> TTACATTCC</td><td> 1050</td><td> TACATTCC</td><td> 1987</td><td> ACATTCC</td><td> 2924</td>

<td> hsa-miR-100</td><td> AACCCGUAGAUCCGAACOUGOG</td><td> 114</td><td> TCTACGGGT</td><td> 1051</td><td> CTACGGGT</td><td> 1988</td><td> TACGGGT</td><td> 2925</td>

<td> hsa-miR-100*</td><td> CAAGCÜOGÜAUCUAÜAGGUAÜG</td><td> 115</td><td> TACAAGCTT</td><td> 1052</td><td> ACAAGCTT</td><td> 1989</td><td> CAAGCTT</td><td> 2926</td>

<td> hsa-miR-101</td><td> ÜACAGUACÜGOGAÜAACOGAA</td><td> 116</td><td> CAGTACTGT</td><td> 1053</td><td> AGTACTGT</td><td> 1990</td><td> GTACTGT</td><td> 2927</td>

<td> hsa-miR-101*</td><td> CAGÜOAUCACAGUGCUGAOGCU</td><td> 117</td><td> GTGATAACT</td><td> 1054</td><td> TGATAACT</td><td> 1991</td><td> GATAACT</td><td> 2928</td>

<td> hsa-miR-103</td><td> AGCAGCAUUGUACAGGGCUAOGA</td><td> 118</td><td> CAATGCTGC</td><td> 1055</td><td> AATGCTGC</td><td> 1992</td><td> ATGCTGC</td><td> 2929</td>

<td> hsa-miR-103-as</td><td> OCAOAGCCCUGUACAAUGCÜGCU</td><td> 119</td><td> AGGGCTATG</td><td> 1056</td><td> GGGCTATG</td><td> 1993</td><td> GGCTATG</td><td> 2930</td>

<td> hsa-miR-105</td><td> UCAAAÜGCUCAGACUCCÜGUGGU</td><td> 120</td><td> GAGCATTTG</td><td> 1057</td><td> AGCATTTG</td><td> 1994</td><td> GCATTTG</td><td> 2931</td>

<td> hsa-miR-105*</td><td> ACGGAUGÜÜÜGAGCAUGÜGCÜA</td><td> 121</td><td> AAACATCCG</td><td> 1058</td><td> AACATCCG</td><td> 1995</td><td> ACATCCG</td><td> 2932</td>

<td> hsa-miR-106a</td><td> AAAAGÜGCÜOACAGUGCAGGÜAG</td><td> 122</td><td> AAGCACTTT</td><td> 1059</td><td> AGCACTTT</td><td> 1996</td><td> GCACTTT</td><td> 2933</td>

<td> hsa-miR-106a*</td><td> CÜGCAAÜGÜAAGCACUÜCUUAC</td><td> 123</td><td> TACATTGCA</td><td> 1060</td><td> ACATTGCA</td><td> 1997</td><td> CATTGCA</td><td> 2934</td>

<td> hsa-miR-106b</td><td> UAAAGUGCÜGACAGUGCAGAÜ</td><td> 124</td><td> CAGCACTTT</td><td> 1061</td><td> AGCACTTT</td><td> 1998</td><td> GCACTTT</td><td> 2935</td>

<td> hs a-miR-10 6b *</td><td> CCGCACUGUGGGOACUÜGCOGC</td><td> 125</td><td> CACAGTGCG</td><td> 1062</td><td> ACAGTGCG</td><td> 1999</td><td> CAGTGCG</td><td> 2936</td>

<td> hsa-miR-107</td><td> AGCAGCAUÜGUACAGGGCUAÜCA</td><td> 126</td><td> CAATGCTGC</td><td> 1063</td><td> AATGCTGC</td><td> 2000</td><td> ATGCTGC</td><td> 2937</td>

<td> hsa-miR-lOa</td><td> ÜACCCUGÜAGAÜCCGAAÜÜOGÜG</td><td> 127</td><td> CTACAGGGT</td><td> 1064</td><td> TACAGGGT</td><td> 2001</td><td> ACAGGGT</td><td> 2938</td>

<td> hsa-miR-lOa*</td><td> CAAAUUCGÜAUCUAGGGGAAOA</td><td> 128</td><td> TACGAATTT</td><td> 1065</td><td> ACGAATTT</td><td> 2002</td><td> CGAATTT</td><td> 2939</td>

<td> hsa-miR-lOb</td><td> ÜACCCUGÜAGAACCGAAUUUGOG</td><td> 129</td><td> CTACAGGGT</td><td> 1066</td><td> TACAGGGT</td><td> 2003</td><td> ACAGGGT</td><td> 2940</td>

<td> hsa-miR-lOb*</td><td> ACAGAUOCGAUUCÜAGGGGAAÜ</td><td> 130</td><td> TCGAATCTG</td><td> 1067</td><td> CGAATCTG</td><td> 2004</td><td> GAATCTG</td><td> 2941</td>

<td> hsa-miR-1178</td><td> UUGCÜCACOGÜÜCÜÜCCCÜAG</td><td> 131</td><td> CAGTGAGCA</td><td> 1068</td><td> AGTGAGCA</td><td> 2005</td><td> GTGAGCA</td><td> 2942</td>

<td> hsa-miR-1179</td><td> AAGCAUOCUOUCAÜUGGOUGG</td><td> 132</td><td> AAGAATGCT</td><td> 1069</td><td> AGAATGCT</td><td> 2006</td><td> GAATGCT</td><td> 2943</td>

<td> hsa-miR-1180</td><td> OOÜCCGGCÜCGCGÜGGGÜGUGÜ</td><td> 133</td><td> GAGCCGGAA</td><td> 1070</td><td> AGCCGGAA</td><td> 2007</td><td> GCCGGAA</td><td> 2944</td>

<td> hsa-miR-1181</td><td> CCGÜCGCCGCCACCCGAGCCG</td><td> 134</td><td> GCGGCGACG</td><td> 1071</td><td> CGGCGACG</td><td> 2008</td><td> GGCGACG</td><td> 2945</td>

<td> hsa-miR-1182</td><td> GAGGGUCUOGGGAGGGAÜGOGAC</td><td> 135</td><td> CAAGACCCT</td><td> 1072</td><td> AAGACCCT</td><td> 2009</td><td> AGACCCT</td><td> 2946</td>

<td> hsa-miR-1183</td><td> CACUGUAGGÜGAÜGGUGAGAGÜGGGCA</td><td> 136</td><td> ACCTACAGT</td><td> 1073</td><td> CCTACAGT</td><td> 2010</td><td> CTACAGT</td><td> 2947</td>

<td> hsa-miR-1184</td><td> CCOGCAGCGACUUGAUGGCOÜCC</td><td> 137</td><td> TCGCTGCAG</td><td> 1074</td><td> CGCTGCAG</td><td> 2011</td><td> GCTGCAG</td><td> 2948</td>

<td> hsa-miR-1185</td><td> AGAGGAÜACCCOOOGOAUGÜU</td><td> 138</td><td> GGTATCCTC</td><td> 1075</td><td> GTATCCTC</td><td> 2012</td><td> TATCCTC</td><td> 2949</td>

<td> hsa-miR-1197</td><td> ÜAGGACACAÜGGOCUACÜUCÜ</td><td> 139</td><td> ATGTGTCCT</td><td> 1076</td><td> TGTGTCCT</td><td> 2013</td><td> GTGTCCT</td><td> 2950</td>

<td> hsa-miR-1200</td><td> COCCUGAGCCAÜOCUGAGCCÜC</td><td> 140</td><td> GGCTCAGGA</td><td> 1077</td><td> GCTCAGGA</td><td> 2014</td><td> CTCAGGA</td><td> 2951</td>

<td> hsa-miR-1201</td><td> AGCCÜGAUOAAACACAÜGCÜCOGA</td><td> 141</td><td> TAATCAGGC</td><td> 1078</td><td> AATCAGGC</td><td> 2015</td><td> ATCAGGC</td><td> 2952</td>

<td> hsa-miR-1202</td><td> GOGCCAGCOGCAGÜGGGGGAG</td><td> 142</td><td> CAGCTGGCA</td><td> 1079</td><td> AGCTGGCA</td><td> 2016</td><td> GCTGGCA</td><td> 2953</td>

<td> hsa-miR-1203</td><td> CCCGGAGCCAGGAüGCAGCOC</td><td> 143</td><td> TGGCTCCGG</td><td> 1080</td><td> GGCTCCGG</td><td> 2017</td><td> GCTCCGG</td><td> 2954</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

<td> hsa-miR-1204</td><td> UCGÜGGCCÜGGÜCOCCAUUAÜ</td><td> 144</td><td> CAGGCCACG</td><td> 1081</td><td> AGGCCACG</td><td> 2018</td><td> GGCCACG</td><td> 2955</td>

<td> hsa-miR-1205</td><td> UCÜGCAGGGÜÜÜGCÜOUGAG</td><td> 145</td><td> ACCCTGCAG</td><td> 1082</td><td> CCCTGCAG</td><td> 2019</td><td> CCTGCAG</td><td> 2956</td>

<td> hsa-miR-1206</td><td> ÜGUÜCAOGUAGAUGUOOAAGC</td><td> 146</td><td> TACATGAAC</td><td> 1083</td><td> ACATGAAC</td><td> 2020</td><td> CATGAAC</td><td> 2957</td>

<td> hsa-miR-1207-3p</td><td> UCAGCÜGGCCCÜCAUUUC</td><td> 147</td><td> GGCCAGCTG</td><td> 1084</td><td> GCCAGCTG</td><td> 2021</td><td> CCAGCTG</td><td> 2958</td>

<td> hsa-miR-1207-5p</td><td> UGGCAGGGAGGCÜGGGAGGGG</td><td> 148</td><td> CTCCCTGCC</td><td> 1085</td><td> TCCCTGCC</td><td> 2022</td><td> CCCTGCC</td><td> 2959</td>

<td> hsa-miR-1208</td><td> UCACüGüUCAGACAGGCGGA</td><td> 149</td><td> TGAACAGTG</td><td> 1086</td><td> GAACAGTG</td><td> 2023</td><td> AACAGTG</td><td> 2960</td>

<td> hsa-miR-122</td><td> UGGAGÜGÜGACAAÜGGOGUÜÜG</td><td> 150</td><td> TCACACTCC</td><td> 1087</td><td> CACACTCC</td><td> 2024</td><td> ACACTCC</td><td> 2961</td>

<td> hsa-miR-122*</td><td> AACGCCAUUAÜCACACÜAAAOA</td><td> 151</td><td> TAATGGCGT</td><td> 1088</td><td> AATGGCGT</td><td> 2025</td><td> ATGGCGT</td><td> 2962</td>

<td> hsa-miR-1224-3p</td><td> CCCCACCUCCÜCOCÜCCOCAG</td><td> 152</td><td> GGAGGTGGG</td><td> 1089</td><td> GAGGTGGG</td><td> 2026</td><td> AGGTGGG</td><td> 2963</td>

<td> hsa-miR-1224-5p</td><td> GÜGAGGACOCGGGAGGUGG</td><td> 153</td><td> GAGTCCTCA</td><td> 1090</td><td> AGTCCTCA</td><td> 2027</td><td> GTCCTCA</td><td> 2964</td>

<td> hsa-miR-1225-3p</td><td> OGAGCCCCOGÜGCCGCCCCCAG</td><td> 154</td><td> CAGGGGCTC</td><td> 1091</td><td> AGGGGCTC</td><td> 2028</td><td> GGGGCTC</td><td> 2965</td>

<td> hsa-miR-1225-5p</td><td> GUGGGUACGGCCCAGUGGGGGG</td><td> 155</td><td> CCGTACCCA</td><td> 1092</td><td> CGTACCCA</td><td> 2029</td><td> GTACCCA</td><td> 2966</td>

<td> hsa-miR-1226</td><td> UCACCAGCCCOGUGUOCCCUAG</td><td> 156</td><td> GGGCTGGTG</td><td> 1093</td><td> GGCTGGTG</td><td> 2030</td><td> GCTGGTG</td><td> 2967</td>

<td> hsa-miR-1226*</td><td> GOGAGGGCAUGCAGGCCUGGAUGGGG</td><td> 157</td><td> atgccctca</td><td> 1094</td><td> TGCCCTCA</td><td> 2031</td><td> GCCCTCA</td><td> 2968</td>

<td> hsa-miR-1227</td><td> CGÜGCCACCCUÜÜÜCCCCAG</td><td> 158</td><td> GGGTGGCAC</td><td> 1095</td><td> GGTGGCAC</td><td> 2032</td><td> GTGGCAC</td><td> 2969</td>

<td> hsa-miR-1228</td><td> UCACACCOGCCÜCGCCCCCC</td><td> 159</td><td> GCAGGTGTG</td><td> 1096</td><td> CAGGTGTG</td><td> 2033</td><td> AGGTGTG</td><td> 2970</td>

<td> hsa-miR-1228*</td><td> GOGGGCGGGGGCAGGUGUGUG</td><td> 160</td><td> CCCCGCCCA</td><td> 1097</td><td> CCCGCCCA</td><td> 2034</td><td> CCGCCCA</td><td> 2971</td>

<td> hsa-miR-1229</td><td> COCOCACCACUGCCCUCCCACAG</td><td> 161</td><td> GTGGTGAGA</td><td> 1098</td><td> TGGTGAGA</td><td> 2035</td><td> GGTGAGA</td><td> 2972</td>

<td> hsa-miR-1231</td><td> GUGOCUGGGCGGACAGCOGC</td><td> 162</td><td> GCCCAGACA</td><td> 1099</td><td> CCCAGACA</td><td> 2036</td><td> CCAGACA</td><td> 2973</td>

<td> hsa-miR-1233</td><td> UGAGCCCÜGUCCOCCCGCAG</td><td> 163</td><td> ACAGGGCTC</td><td> 1100</td><td> CAGGGCTC</td><td> 2037</td><td> AGGGCTC</td><td> 2974</td>

<td> hsa-miR-1234</td><td> ÜCGGCCUGACCACCCACCCCAC</td><td> 164</td><td> GTCAGGCCG</td><td> 1101</td><td> TCAGGCCG</td><td> 2038</td><td> CAGGCCG</td><td> 2975</td>

<td> hsa-miR-1236</td><td> CCUCUUCCCCÜUGUCÜCOCCAG</td><td> 165</td><td> GGGGAAGAG</td><td> 1102</td><td> GGGAAGAG</td><td> 2039</td><td> GGAAGAG</td><td> 2976</td>

<td> hsa-miR-1237</td><td> ÜCCÜÜCUGCUCCGUCCCCCAG</td><td> 166</td><td> AGCAGAAGG</td><td> 1103</td><td> GCAGAAGG</td><td> 2040</td><td> CAGAAGG</td><td> 2977</td>

<td> hsa-miR-1238</td><td> CUUCCOCGüCüGOCUGCCCC</td><td> 167</td><td> GACGAGGAA</td><td> 1104</td><td> ACGAGGAA</td><td> 2041</td><td> CGAGGAA</td><td> 2978</td>

<td> hsa-miR-124</td><td> ÜAAGGCACGCGGOGAAOGCC</td><td> 168</td><td> GCGTGCCTT</td><td> 1105</td><td> CGTGCCTT</td><td> 2042</td><td> GTGCCTT</td><td> 2979</td>

<td> hsa-miR-124*</td><td> CGUGUUCACAGCGGACCOÜGAO</td><td> 169</td><td> TGTGAACAC</td><td> 1106</td><td> GTGAACAC</td><td> 2043</td><td> TGAACAC</td><td> 2980</td>

<td> hsa-miR-1243</td><td> AACUGGAÜCAAOÜAÜAGGAGOG</td><td> 170</td><td> TGATCCAGT</td><td> 1107</td><td> GATCCAGT</td><td> 2044</td><td> ATCCAGT</td><td> 2981</td>

<td> hsa-miR-1244</td><td> AAGÜAGUÜGGUUÛGÜAÜGAGAÜGGUÜ</td><td> 171</td><td> CCAACTACT</td><td> 1108</td><td> CAACTACT</td><td> 2045</td><td> AACTACT</td><td> 2982</td>

<td> hsa-miR-1245</td><td> AAGÜGAUCÜAAAGGCCÜACAO</td><td> 172</td><td> TAGATCACT</td><td> 1109</td><td> AGATCACT</td><td> 2046</td><td> GATCACT</td><td> 2983</td>

<td> hsa-miR-1246</td><td> AAUGGAUUÜUÜGGAGCAGG</td><td> 173</td><td> AAAATCCAT</td><td> 1110</td><td> AAATCCAT</td><td> 2047</td><td> AATCCAT</td><td> 2984</td>

<td> hsa-miR-1247</td><td> ACCCGOCCCGUÜCGÜCCCCGGA</td><td> 174</td><td> CGGGACGGG</td><td> 1111</td><td> GGGACGGG</td><td> 2048</td><td> GGACGGG</td><td> 2985</td>

<td> hsa-miR-1248</td><td> ACCUÜCUUGOAÜAAGCACUGÜGCÜAAA</td><td> 175</td><td> ACAAGAAGG</td><td> 1112</td><td> CAAGAAGG</td><td> 2049</td><td> AAGAAGG</td><td> 2986</td>

<td> hsa-miR-1249</td><td> ACGCCCUÜCCCCCCCUÜCUOCA</td><td> 176</td><td> GGAAGGGCG</td><td> 1113</td><td> GAAGGGCG</td><td> 2050</td><td> AAGGGCG</td><td> 2987</td>

<td> hsa-miR-1250</td><td> ACGGOGCÜGGAOGOGGCCÜÜÜ</td><td> 177</td><td> CCAGCACCG</td><td> 1114</td><td> CAGCACCG</td><td> 2051</td><td> AGCACCG</td><td> 2988</td>

<td> hsa-miR-1251</td><td> ACÜCUAGCUGCCAAAGGCGCO</td><td> 178</td><td> CAGCTAGAG</td><td> 1115</td><td> AGCTAGAG</td><td> 2052</td><td> GCTAGAG</td><td> 2989</td>

<td> hsa-miR-1252</td><td> AGAAGGAAAUUGAAOTJCAUÜOA</td><td> 179</td><td> ATTTCCTTC</td><td> 1116</td><td> TTTCCTTC</td><td> 2053</td><td> TTCCTTC</td><td> 2990</td>

<td> hsa-miR-1253</td><td> AGAGAAGAAGAÜCAGCCUGCA</td><td> 180</td><td> CTTCTTCTC</td><td> 1117</td><td> TTCTTCTC</td><td> 2054</td><td> TCTTCTC</td><td> 2991</td>

<td> hsa-miR-1254</td><td> AGCCÜGGAAGCÜGGAGCCÜGCAGU</td><td> 181</td><td> CTTCCAGGC</td><td> 1118</td><td> TTCCAGGC</td><td> 2055</td><td> TCCAGGC</td><td> 2992</td>

<td> hsa-miR-1255a</td><td> AGGAUGAGCAAAGAAAGOAGAUU</td><td> 182</td><td> TGCTCATCC</td><td> 1119</td><td> GCTCATCC</td><td> 2056</td><td> CTCATCC</td><td> 2993</td>

<td> hsa-miR-1255b</td><td> CGGAOGAGCAAAGAAAGÜGGUU</td><td> 183</td><td> TGCTCATCC</td><td> 1120</td><td> GCTCATCC</td><td> 2057</td><td> CTCATCC</td><td> 2994</td>

<td> hsa-miR-1256</td><td> AGGCAÜUGACÜOCÜCACOAGCÜ</td><td> 184</td><td> GTCAATGCC</td><td> 1121</td><td> TCAATGCC</td><td> 2058</td><td> CAATGCC</td><td> 2995</td>

<td> hsa-miR-1257</td><td> AGUGAAÜGAOGGGÜUCÜGACC</td><td> 185</td><td> ATCATTCAC</td><td> 1122</td><td> TCATTCAC</td><td> 2059</td><td> CATTCAC</td><td> 2996</td>

<td> hsa-miR-1258</td><td> AGOOAGGAÜÜAGGÜCGOGGAA</td><td> 186</td><td> AATCCTAAC</td><td> 1123</td><td> ATCCTAAC</td><td> 2060</td><td> TCCTAAC</td><td> 2997</td>

<td> hsa-miR-1259</td><td> AUAUAOGAOGACÜÜAGCUUUU</td><td> 187</td><td> CATCATATA</td><td> 1124</td><td> ATCATATA</td><td> 2061</td><td> TCATATA</td><td> 2998</td>

<td> hsa-miR-125a-3p</td><td> ACAGGOGAGGUÜCtTOGGGAGCC</td><td> 188</td><td> CCTCACCTG</td><td> 1125</td><td> CTCACCTG</td><td> 2062</td><td> TCACCTG</td><td> 2999</td>

<td> hsa-miR-125a-5p</td><td> OCCCOGAGACCCOÜUAACCUGOGA</td><td> 189</td><td> GTCTCAGGG</td><td> 1126</td><td> TCTCAGGG</td><td> 2063</td><td> CTCAGGG</td><td> 3000</td>

<td> hsa-miR-125b</td><td> ÜCCCOGAGACCCOAACOÜGÜGA</td><td> 190</td><td> GTCTCAGGG</td><td> 1127</td><td> TCTCAGGG</td><td> 2064</td><td> CTCAGGG</td><td> 3001</td>

<td> hsa-miR-125b-l*</td><td> ACGGGÜUAGGCÜCtTOGGGAGCU</td><td> 191</td><td> CCTAACCCG</td><td> 1128</td><td> CTAACCCG</td><td> 2065</td><td> TAACCCG</td><td> 3002</td>

<td> hsa-miR-125b-2*</td><td> ÜCACAAGOCAGGCÜCÜOGGGAC</td><td> 192</td><td> TGACTTGTG</td><td> 1129</td><td> GACTTGTG</td><td> 2066</td><td> ACTTGTG</td><td> 3003</td>

<td> hsa-miR-126</td><td> UCGUACCGOGAGUAAÜAAÜGCG</td><td> 193</td><td> CACGGTACG</td><td> 1130</td><td> ACGGTACG</td><td> 2067</td><td> CGGTACG</td><td> 3004</td>

<td> hsa-miR-126*</td><td> CAOÜAÜÛACUUUOGGOACGCG</td><td> 194</td><td> AGTAATAAT</td><td> 1131</td><td> GTAATAAT</td><td> 2068</td><td> TAATAAT</td><td> 3005</td>

<td> hsa-miR-12 60</td><td> AÜCCCACCÜCUGCCACCA</td><td> 195</td><td> GAGGTGGGA</td><td> 1132</td><td> AGGTGGGA</td><td> 2069</td><td> GGTGGGA</td><td> 3006</td>

<td> hsa-miR-1261</td><td> AUGGAOAAGGCÜUUGGCUO</td><td> 196</td><td> CCTTATCCA</td><td> 1133</td><td> CTTATCCA</td><td> 2070</td><td> TTATCCA</td><td> 3007</td>

<td> hsa-miR-1262</td><td> AOGGGOGAAOOÜGUAGAAGGAO</td><td> 197</td><td> ATTCACCCA</td><td> 1134</td><td> TTCACCCA</td><td> 2071</td><td> TCACCCA</td><td> 3008</td>

<td> hsa-miR-1263</td><td> AOGGOACCCüGGCAUACOGAGU</td><td> 198</td><td> AGGGTACCA</td><td> 1135</td><td> GGGTACCA</td><td> 2072</td><td> GGTACCA</td><td> 3009</td>

CA 02701547 2010-04-01

WO 2009/043353

PCI7DK2008/000344

<td> hsa-miR-1264</td><td> CAAGÜCÜUAÜÜÜGAGCACCUGÜU</td><td> 199</td><td> ATAAGACTT</td><td> 1136</td><td> TAAGACTT</td><td> 2073</td><td> AAGACTT</td><td> 3010</td>

<td> hsa-miR-1265</td><td> CAGGAOGÜGGUCAAGÜGOÜGUÜ</td><td> 200</td><td> CCACATCCT</td><td> 1137</td><td> CACATCCT</td><td> 2074</td><td> ACATCCT</td><td> 3011</td>

<td> hsa-miR-1266</td><td> CCUCAGGGCÜGUAGAACAGGGCO</td><td> 201</td><td> AGCCCTGAG</td><td> 1138</td><td> GCCCTGAG</td><td> 2075</td><td> CCCTGAG</td><td> 3012</td>

<td> hsa-miR-1267</td><td> CCUGOUGAAGÜGUAAOCCCCA</td><td> 202</td><td> CTTCAACAG</td><td> 1139</td><td> TTCAACAG</td><td> 2076</td><td> TCAACAG</td><td> 3013</td>

<td> hsa-miR-1268</td><td> CGGGCGUGGUGGUGGGGG</td><td> 203</td><td> ACCACGCCC</td><td> 1140</td><td> CCACGCCC</td><td> 2077</td><td> CACGCCC</td><td> 3014</td>

<td> hsa-miR-1269</td><td> CUGGACüGAGCCGUGCOACUGG</td><td> 204</td><td> CTCAGTCCA</td><td> 1141</td><td> TCAGTCCA</td><td> 2078</td><td> CAGTCCA</td><td> 3015</td>

<td> hsa-miR-127-3p</td><td> UCGGAÜCCGÜCOGAGCÜÜGGCO</td><td> 205</td><td> ACGGATCCG</td><td> 1142</td><td> CGGATCCG</td><td> 2079</td><td> GGATCCG</td><td> 3016</td>

<td> hsa-miR-127-5p</td><td> CÜGAAGCUCAGAGGGCÜCÜGAÜ</td><td> 206</td><td> TGAGCTTCA</td><td> 1143</td><td> GAGCTTCA</td><td> 2080</td><td> AGCTTCA</td><td> 3017</td>

<td> hsa-miR-1270</td><td> CUGGAGAÜAÜGGAAGAGCÜGOGÜ</td><td> 207</td><td> ATATCTCCA</td><td> 1144</td><td> TATCTCCA</td><td> 2081</td><td> ATCTCCA</td><td> 3018</td>

<td> hsa-miR-1271</td><td> CÜOGGCACCÜAGCAAGCACUCA</td><td> 208</td><td> AGGTGCCAA</td><td> 1145</td><td> GGTGCCAA</td><td> 2082</td><td> GTGCCAA</td><td> 3019</td>

<td> hsa-miR-1272</td><td> GAOGAOGAUGGCAGCAAAÜOCUGAAA</td><td> 209</td><td> CATCATCAT</td><td> 1146</td><td> ATCATCAT</td><td> 2083</td><td> TCATCAT</td><td> 3020</td>

<td> hsa-miR-1273</td><td> GGGCGACAAAGCAAGACÜCÜÜUCUU</td><td> 210</td><td> TTTGTCGCC</td><td> 1147</td><td> TTGTCGCC</td><td> 2084</td><td> TGTCGCC</td><td> 3021</td>

<td> hsa-miR-1274a</td><td> GÜCCCUGUOCAGGCGCCA</td><td> 211</td><td> GAACAGGGA</td><td> 1148</td><td> AACAGGGA</td><td> 2085</td><td> ACAGGGA</td><td> 3022</td>

<td> hsa-miR-1274b</td><td> OCCCOGUUCGGGCGCCA</td><td> 212</td><td> CGAACAGGG</td><td> 1149</td><td> GAACAGGG</td><td> 2086</td><td> AACAGGG</td><td> 3023</td>

<td> hsa-miR-127 5</td><td> GUGGGGGAGAGGCUGÜC</td><td> 213</td><td> TCTCCCCCA</td><td> 1150</td><td> CTCCCCCA</td><td> 2087</td><td> TCCCCCA</td><td> 3024</td>

<td> hsa-miR-1276</td><td> OAAAGAGCCCÜGUGGAGACA</td><td> 214</td><td> GGGCTCTTT</td><td> 1151</td><td> GGCTCTTT</td><td> 2088</td><td> GCTCTTT</td><td> 3025</td>

<td> hsa-miR-1277</td><td> ÜACGÜAGAUAÜAUAÜGUAUUOO</td><td> 215</td><td> TATCTACGT</td><td> 1152</td><td> ATCTACGT</td><td> 2089</td><td> TCTACGT</td><td> 3026</td>

<td> hsa-miR-1278</td><td> OAGÜACUGOGCAUAUCAOCÜAU</td><td> 216</td><td> CACAGTACT</td><td> 1153</td><td> ACAGTACT</td><td> 2090</td><td> CAGTACT</td><td> 3027</td>

<td> hsa-miR-1279</td><td> UCAUAUUGCUUCUÜUCU</td><td> 217</td><td> AGCAATATG</td><td> 1154</td><td> GCAATATG</td><td> 2091</td><td> CAATATG</td><td> 3028</td>

<td> hsa-miR-128</td><td> UCACAGOGAACCGGUCÜCOUU</td><td> 218</td><td> TTCACTGTG</td><td> 1155</td><td> TCACTGTG</td><td> 2092</td><td> CACTGTG</td><td> 3029</td>

<td> hsa-miR-1280</td><td> ÜCCCACCGCÜGCCACCC</td><td> 219</td><td> AGCGGTGGG</td><td> 1156</td><td> GCGGTGGG</td><td> 2093</td><td> CGGTGGG</td><td> 3030</td>

<td> hsa-miR-1281</td><td> UCGCCÜCCUCCUCÜCCC</td><td> 220</td><td> GAGGAGGCG</td><td> 1157</td><td> AGGAGGCG</td><td> 2094</td><td> GGAGGCG</td><td> 3031</td>

<td> hsa-miR-1282</td><td> ÜCGUUUGCCÜÜUUÜCUGCOU</td><td> 221</td><td> AGGCAAACG</td><td> 1158</td><td> GGCAAACG</td><td> 2095</td><td> GCAAACG</td><td> 3032</td>

<td> hsa-miR-1283</td><td> UCÜACAAAGGAAAGCGCOUUCU</td><td> 222</td><td> CCTTTGTAG</td><td> 1159</td><td> CTTTGTAG</td><td> 2096</td><td> TTTGTAG</td><td> 3033</td>

<td> hsa-miR-1284</td><td> UCÜAÜACAGACCCÜGGCUUÜUC</td><td> 223</td><td> TCTGTATAG</td><td> 1160</td><td> CTGTATAG</td><td> 2097</td><td> TGTATAG</td><td> 3034</td>

<td> hsa-miR-1285</td><td> UCÜGGGCAACAAAGUGAGACCÜ</td><td> 224</td><td> GTTGCCCAG</td><td> 1161</td><td> TTGCCCAG</td><td> 2098</td><td> TGCCCAG</td><td> 3035</td>

<td> hsa-miR-1286</td><td> UGCAGGACCAAGAÜGAGCCCÜ</td><td> 225</td><td> TGGTCCTGC</td><td> 1162</td><td> GGTCCTGC</td><td> 2099</td><td> GTCCTGC</td><td> 3036</td>

<td> hsa-miR-1287</td><td> UGCUGGAOCAGÜGGÜUCGAGUC</td><td> 226</td><td> TGATCCAGC</td><td> 1163</td><td> GATCCAGC</td><td> 2100</td><td> ATCCAGC</td><td> 3037</td>

<td> hsa-miR-1288</td><td> UGGACÜGCCCUGAÜCUGGAGA</td><td> 227</td><td> GGGCAGTCC</td><td> 1164</td><td> GGCAGTCC</td><td> 2101</td><td> GCAGTCC</td><td> 3038</td>

<td> hsa-miR-1289</td><td> UGGAGOCCAGGAAOCÜGCAOUUU</td><td> 228</td><td> CTGGACTCC</td><td> 1165</td><td> TGGACTCC</td><td> 2102</td><td> GGACTCC</td><td> 3039</td>

<td> hsa-miR-129*</td><td> AAGCCCÜUACCCCAAAAAGOAO</td><td> 229</td><td> GTAAGGGCT</td><td> 1166</td><td> TAAGGGCT</td><td> 2103</td><td> AAGGGCT</td><td> 3040</td>

<td> hsa-miR-129-3p</td><td> AAGCCCÜUACCCCAAAAAGCAÜ</td><td> 230</td><td> GTAAGGGCT</td><td> 1167</td><td> TAAGGGCT</td><td> 2104</td><td> AAGGGCT</td><td> 3041</td>

<td> hsa-miR-129-5p</td><td> CUÜUOUGCGGUCUGGGCÜÜGC</td><td> 231</td><td> CCGCAAAAA</td><td> 1168</td><td> CGCAAAAA</td><td> 2105</td><td> GCAAAAA</td><td> 3042</td>

<td> hsa-miR-1290</td><td> UGGAUUOUUGGAÜCAGGGA</td><td> 232</td><td> CAAAAATCC</td><td> 1169</td><td> AAAAATCC</td><td> 2106</td><td> AAAATCC</td><td> 3043</td>

<td> hsa-miR-1291</td><td> UGGCCCOGACOGAAGACCAGCAGÜ</td><td> 233</td><td> GTCAGGGCC</td><td> 1170</td><td> TCAGGGCC</td><td> 2107</td><td> CAGGGCC</td><td> 3044</td>

<td> hsa-miR-1292</td><td> UGGGAACGGGUUCCGGCAGACGCUG</td><td> 234</td><td> CCCGTTCCC</td><td> 1171</td><td> CCGTTCCC</td><td> 2108</td><td> CGTTCCC</td><td> 3045</td>

<td> hsa-miR-1293</td><td> UGGGUGGüCUGGAGAUUOGOGC</td><td> 235</td><td> AGACCACCC</td><td> 1172</td><td> GACCACCC</td><td> 2109</td><td> ACCACCC</td><td> 3046</td>

<td> hsa-miR-1294</td><td> UGUGAGGÜUGGCAÜÜGUOGOCÜ</td><td> 236</td><td> CAACCTCAC</td><td> 1173</td><td> AACCTCAC</td><td> 2110</td><td> ACCTCAC</td><td> 3047</td>

<td> hsa-miR-1295</td><td> UUAGGCCGCAGAUCÜGGGUGA</td><td> 237</td><td> TGCGGCCTA</td><td> 1174</td><td> GCGGCCTA</td><td> 2111</td><td> CGGCCTA</td><td> 3048</td>

<td> hsa-miR-1296</td><td> UÜAGGGCCCUGGCÜCCAOCOCC</td><td> 238</td><td> AGGGCCCTA</td><td> 1175</td><td> GGGCCCTA</td><td> 2112</td><td> GGCCCTA</td><td> 3049</td>

<td> hsa-miR-1297</td><td> UUCAAGOAAUUCAGGüG</td><td> 239</td><td> ATTACTTGA</td><td> 1176</td><td> TTACTTGA</td><td> 2113</td><td> TACTTGA</td><td> 3050</td>

<td> hsa-miR-1298</td><td> UUCAUUCGGCOGUCCAGAOGÜA</td><td> 240</td><td> GCCGAATGA</td><td> 1177</td><td> CCGAATGA</td><td> 2114</td><td> CGAATGA</td><td> 3051</td>

<td> hsa-miR-1299</td><td> UUCUGGAAÜOCUGOGÜGAGGGA</td><td> 241</td><td> AATTCCAGA</td><td> 1178</td><td> ATTCCAGA</td><td> 2115</td><td> TTCCAGA</td><td> 3052</td>

<td> hsa-miR-1300</td><td> OUGAGAAGGAGGCÜGCUG</td><td> 242</td><td> TCCTTCTCA</td><td> 1179</td><td> CCTTCTCA</td><td> 2116</td><td> CTTCTCA</td><td> 3053</td>

<td> hsa-miR-1301</td><td> ÜUGCAGCOGCCÜGGGAGUGACÜÜC</td><td> 243</td><td> GCAGCTGCA</td><td> 1180</td><td> CAGCTGCA</td><td> 2117</td><td> AGCTGCA</td><td> 3054</td>

<td> hsa-miR-1302</td><td> ÜUGGGACAUACÜUAOGCUAAA</td><td> 244</td><td> TATGTCCCA</td><td> 1181</td><td> ATGTCCCA</td><td> 2118</td><td> TGTCCCA</td><td> 3055</td>

<td> hsa-miR-1303</td><td> ÜUUAGAGACGGGGOCÜUGCÜCO</td><td> 245</td><td> CGTCTCTAA</td><td> 1182</td><td> GTCTCTAA</td><td> 2119</td><td> TCTCTAA</td><td> 3056</td>

<td> hsa-miR-1304</td><td> ÜUÜGAGGCOACAGÜGAGAÜGUG</td><td> 246</td><td> TAGCCTCAA</td><td> 1183</td><td> AGCCTCAA</td><td> 2120</td><td> GCCTCAA</td><td> 3057</td>

<td> hsa-miR-1305</td><td> OÜÜOCAACOCOAAOGGGAGAGA</td><td> 247</td><td> GAGTTGAAA</td><td> 1184</td><td> AGTTGAAA</td><td> 2121</td><td> GTTGAAA</td><td> 3058</td>

<td> hsa-miR-1306</td><td> ACGÜÜGGCOCOGGUGGÜG</td><td> 248</td><td> GAGCCAACG</td><td> 1185</td><td> AGCCAACG</td><td> 2122</td><td> GCCAACG</td><td> 3059</td>

<td> hsa-miR-1307</td><td> ACUCGGCGOGGCGUCGGÜCGÜG</td><td> 249</td><td> CACGCCGAG</td><td> 1186</td><td> ACGCCGAG</td><td> 2123</td><td> CGCCGAG</td><td> 3060</td>

<td> hsa-miR-1308</td><td> GCAUGGGÜGGÜÜCAGUGG</td><td> 250</td><td> CCACCCATG</td><td> 1187</td><td> CACCCATG</td><td> 2124</td><td> ACCCATG</td><td> 3061</td>

<td> hsa-miR-130a</td><td> CAGOGCAAOGÜOAAAAGGGCAO</td><td> 251</td><td> CATTGCACT</td><td> 1188</td><td> ATTGCACT</td><td> 2125</td><td> TTGCACT</td><td> 3062</td>

<td> hsa-miR-130a*</td><td> ÜÜCACAÜÜGUGCUACOGÜCUGC</td><td> 252</td><td> ACAATGTGA</td><td> 1189</td><td> CAATGTGA</td><td> 2126</td><td> AATGTGA</td><td> 3063</td>

<td> hsa-miR-130b</td><td> CAGOGCAAÜGAUGAAAGGGCAO</td><td> 253</td><td> CATTGCACT</td><td> 1190</td><td> ATTGCACT</td><td> 2127</td><td> TTGCACT</td><td> 3064</td>

CA 02701547 2010-04-01

WO 2009/043353

PCI7DK2008/000344

<td> hsa-miR-130b*</td><td> ACOCÜÜOCCCUGOOGCACÜAC</td><td> 254</td><td> gggaaagag</td><td> 1191</td><td> GGAAAGAG</td><td> 2128</td><td> GAAAGAG</td><td> 3065</td>

<td> hsa-miR-132</td><td> UAACAGOCUACAGCCAUGGOCG</td><td> 255</td><td> TAGACTGTT</td><td> 1192</td><td> AGACTGTT</td><td> 2129</td><td> GACTGTT</td><td> 3066</td>

<td> hsa-miR-132*</td><td> ACCGUGGCOUÜCGAUUGUÜACO</td><td> 256</td><td> AAGCCACGG</td><td> 1193</td><td> AGCCACGG</td><td> 2130</td><td> GCCACGG</td><td> 3067</td>

<td> hsa-miR-1321</td><td> CAGGGAGGUGAAUGUGAÜ</td><td> 257</td><td> CACCTCCCT</td><td> 1194</td><td> ACCTCCCT</td><td> 2131</td><td> CCTCCCT</td><td> 3068</td>

<td> hsa-miR-1322</td><td> GAUGAUGCOGCOGAUGCOG</td><td> 258</td><td> CAGCATCAT</td><td> 1195</td><td> AGCATCAT</td><td> 2132</td><td> GCATCAT</td><td> 3069</td>

<td> hsa-miR-1323</td><td> UCAAAACÜGAGGGGCAUOÜÜCÜ</td><td> 259</td><td> TCAGTTTTG</td><td> 1196</td><td> CAGTTTTG</td><td> 2133</td><td> AGTTTTG</td><td> 3070</td>

<td> hsa-miR-1324</td><td> CCAGACAGAAUÜCOAUGCACÜÜÜC</td><td> 260</td><td> TTCTGTCTG</td><td> 1197</td><td> TCTGTCTG</td><td> 2134</td><td> CTGTCTG</td><td> 3071</td>

<td> hsa-miR-133a</td><td> ÜOÜGGUCCCCUUCAACCAGCÜG</td><td> 261</td><td> GGGGACCAA</td><td> 1198</td><td> GGGACCAA</td><td> 2135</td><td> GGACCAA</td><td> 3072</td>

<td> hsa-miR-133b</td><td> ÜÜÜGGÜCCCCUÜCAACCAGCÜA</td><td> 262</td><td> GGGGACCAA</td><td> 1199</td><td> GGGACCAA</td><td> 2136</td><td> GGACCAA</td><td> 3073</td>

<td> hsa-miR-134</td><td> ÜGÜGACUGGUUGACCAGAGGGG</td><td> 263</td><td> ACCAGTCAC</td><td> 1200</td><td> CCAGTCAC</td><td> 2137</td><td> CAGTCAC</td><td> 3074</td>

<td> hsa-miR-135a</td><td> ÜAÜGGCUÜUUÜAOUCCÜAUGÜGA</td><td> 264</td><td> AAAAGCCAT</td><td> 1201</td><td> AAAGCCAT</td><td> 2138</td><td> AAGCCAT</td><td> 3075</td>

<td> hsa-miR-135a*</td><td> ÜAOAGGGAOOGGAGCCGUGGCG</td><td> 265</td><td> AATCCCTAT</td><td> 1202</td><td> ATCCCTAT</td><td> 2139</td><td> TCCCTAT</td><td> 3076</td>

<td> hsa-miR-135b</td><td> UAÜGGCUUOUCAUOCCÜAÜGDGA</td><td> 266</td><td> AAAAGCCAT</td><td> 1203</td><td> AAAGCCAT</td><td> 2140</td><td> AAGCCAT</td><td> 3077</td>

<td> hsa-miR-135b*</td><td> AUGOAGGGCÜAAAAGCCAUGGG</td><td> 267</td><td> AGCCCTACA</td><td> 1204</td><td> GCCCTACA</td><td> 2141</td><td> CCCTACA</td><td> 3078</td>

<td> hsa-miR-136</td><td> ACÜCCAUUUGUÜUUGAOGAUGGA</td><td> 268</td><td> CAAATGGAG</td><td> 1205</td><td> AAATGGAG</td><td> 2142</td><td> AATGGAG</td><td> 3079</td>

<td> hsa-miR-136*</td><td> CAUCAÜCGOCUCAAAOGAGUCÜ</td><td> 269</td><td> GACGATGAT</td><td> 1206</td><td> ACGATGAT</td><td> 2143</td><td> CGATGAT</td><td> 3080</td>

<td> hsa-miR-137</td><td> UÜAÜUGCOOAAGAAÜACGCGUAG</td><td> 270</td><td> TAAGCAATA</td><td> 1207</td><td> AAGCAATA</td><td> 2144</td><td> AGCAATA</td><td> 3081</td>

<td> hsa-miR-138</td><td> AGCUGGUGOOGUGAAÜCAGGCCG</td><td> 271</td><td> AACACCAGC</td><td> 1208</td><td> ACACCAGC</td><td> 2145</td><td> CACCAGC</td><td> 3082</td>

<td> hsa-miR-138-1*</td><td> GCUACÜUCACAACACCAGGGCC</td><td> 272</td><td> GTGAAGTAG</td><td> 1209</td><td> TGAAGTAG</td><td> 2146</td><td> GAAGTAG</td><td> 3083</td>

<td> hsa-miR-138-2*</td><td> GCÜAÜOUCACGACACCAGGGÜÜ</td><td> 273</td><td> GTGAAATAG</td><td> 1210</td><td> TGAAATAG</td><td> 2147</td><td> GAAATAG</td><td> 3084</td>

<td> hsa-miR-139-3p</td><td> GGAGACGCGGCCCOGUÜGGAGÜ</td><td> 274</td><td> CCGCGTCTC</td><td> 1211</td><td> CGCGTCTC</td><td> 2148</td><td> GCGTCTC</td><td> 3085</td>

<td> hsa-miR-139-5p</td><td> ÜCOACAGÜGCACGOGÜCOCCAG</td><td> 275</td><td> GCACTGTAG</td><td> 1212</td><td> CACTGTAG</td><td> 2149</td><td> ACTGTAG</td><td> 3086</td>

<td> hsa-miR-140-3p</td><td> UACCACAGGGUAGAACCACGG</td><td> 276</td><td> CCCTGTGGT</td><td> 1213</td><td> CCTGTGGT</td><td> 2150</td><td> CTGTGGT</td><td> 3087</td>

<td> hsa-miR-140-5p</td><td> CAGOGGÜUOOACCCOAÜGGÜAG</td><td> 277</td><td> AAAACCACT</td><td> 1214</td><td> AAACCACT</td><td> 2151</td><td> AACCACT</td><td> 3088</td>

<td> hsa-miR-141</td><td> UAACACÜGOCOGGOAAAGAÜGG</td><td> 278</td><td> GACAGTGTT</td><td> 1215</td><td> ACAGTGTT</td><td> 2152</td><td> CAGTGTT</td><td> 3089</td>

<td> hsa-miR-141*</td><td> CAÜCOUCCAGUACAGÜGÜUGGA</td><td> 279</td><td> CTGGAAGAT</td><td> 1216</td><td> TGGAAGAT</td><td> 2153</td><td> GGAAGAT</td><td> 3090</td>

<td> hsa-miR-142-3p</td><td> OGOAGÜGÜÜUCCÜACUUOAUGGA</td><td> 280</td><td> AAACACTAC</td><td> 1217</td><td> AACACTAC</td><td> 2154</td><td> ACACTAC</td><td> 3091</td>

<td> hsa-miR-142-5p</td><td> CAÜAAAGÜAGAAAGCACÜACU</td><td> 281</td><td> CTACTTTAT</td><td> 1218</td><td> TACTTTAT</td><td> 2155</td><td> ACTTTAT</td><td> 3092</td>

<td> hsa-miR-143</td><td> UGAGAUGAAGCACÜGÜAGCÜC</td><td> 282</td><td> CTTCATCTC</td><td> 1219</td><td> TTCATCTC</td><td> 2156</td><td> TCATCTC</td><td> 3093</td>

<td> hsa-miR-143*</td><td> GGOGCAGÜGCUGCAUCÜCÜGGO</td><td> 283</td><td> GCACTGCAC</td><td> 1220</td><td> CACTGCAC</td><td> 2157</td><td> ACTGCAC</td><td> 3094</td>

<td> hsa-miR-144</td><td> UACAGUAUAGAOGAOGÜACÜ</td><td> 284</td><td> CTATACTGT</td><td> 1221</td><td> TATACTGT</td><td> 2158</td><td> ATACTGT</td><td> 3095</td>

<td> hsa-miR-144*</td><td> GGAUAUCAÜCAÜAÜACUGÜAAG</td><td> 285</td><td> GATGATATC</td><td> 1222</td><td> ATGATATC</td><td> 2159</td><td> TGATATC</td><td> 3096</td>

<td> hsa-miR-145</td><td> GUCCAGUÜOOCCCAGGAAOCCCU</td><td> 286</td><td> AAAACTGGA</td><td> 1223</td><td> AAACTGGA</td><td> 2160</td><td> AACTGGA</td><td> 3097</td>

<td> hsa-miR-145*</td><td> GGAÜOCCOGGAAAOACUGUÜCO</td><td> 287</td><td> CCAGGAATC</td><td> 1224</td><td> CAGGAATC</td><td> 2161</td><td> AGGAATC</td><td> 3098</td>

<td> hsa-miR-1468</td><td> CUCCGUUUGCCUGOtroCGCOG</td><td> 288</td><td> GCAAACGGA</td><td> 1225</td><td> CAAACGGA</td><td> 2162</td><td> AAACGGA</td><td> 3099</td>

<td> hsa-miR-1469</td><td> CUCGGCGCGGGGCGCGGGCUCC</td><td> 289</td><td> CCGCGCCGA</td><td> 1226</td><td> CGCGCCGA</td><td> 2163</td><td> GCGCCGA</td><td> 3100</td>

<td> hsa-miR-146a</td><td> OGAGAACUGAAOÜCCAÜGGGUÜ</td><td> 290</td><td> TCAGTTCTC</td><td> 1227</td><td> CAGTTCTC</td><td> 2164</td><td> AGTTCTC</td><td> 3101</td>

<td> hsa-miR-146a*</td><td> CCUCUGAAAÜÜCAGOTCÜÜCAG</td><td> 291</td><td> ATTTCAGAG</td><td> 1228</td><td> TTTCAGAG</td><td> 2165</td><td> TTCAGAG</td><td> 3102</td>

<td> hsa-miR-146b-3p</td><td> UGCCCÜGUGGACÜCAGOUCUGG</td><td> 292</td><td> CCACAGGGC</td><td> 1229</td><td> CACAGGGC</td><td> 2166</td><td> ACAGGGC</td><td> 3103</td>

<td> hsa-miR-14 6b-5p</td><td> OGAGAACÜGAAÜÜCCAUAGGCO</td><td> 293</td><td> TCAGTTCTC</td><td> 1230</td><td> CAGTTCTC</td><td> 2167</td><td> AGTTCTC</td><td> 3104</td>

<td> hsa-miR-147</td><td> GÜGOGUGGAAAÜGCUÜCÜGC</td><td> 294</td><td> TTCCACACA</td><td> 1231</td><td> TCCACACA</td><td> 2168</td><td> CCACACA</td><td> 3105</td>

<td> hsa-miR-147 0</td><td> GCCCOCCGCCCGOGCACCCCG</td><td> 295</td><td> GGCGGAGGG</td><td> 1232</td><td> GCGGAGGG</td><td> 2169</td><td> CGGAGGG</td><td> 3106</td>

<td> hsa-miR-1471</td><td> GCCCGCGÜGUGGAGCCAGGUGU</td><td> 296</td><td> ACACGCGGG</td><td> 1233</td><td> CACGCGGG</td><td> 2170</td><td> ACGCGGG</td><td> 3107</td>

<td> hsa-miR-147b</td><td> GÜGÜGCGGAAAOGCUUCOGCUA</td><td> 297</td><td> TTCCGCACA</td><td> 1234</td><td> TCCGCACA</td><td> 2171</td><td> CCGCACA</td><td> 3108</td>

<td> hsa-miR-148a</td><td> OCAGUGCACUACAGAACUOÜGD</td><td> 298</td><td> AGTGCACTG</td><td> 1235</td><td> GTGCACTG</td><td> 2172</td><td> TGCACTG</td><td> 3109</td>

<td> hsa-miR-148a*</td><td> AAAGÜÜCÜGAGACACÜCCGACD</td><td> 299</td><td> TCAGAACTT</td><td> 1236</td><td> CAGAACTT</td><td> 2173</td><td> AGAACTT</td><td> 3110</td>

<td> hsa-miR-148b</td><td> ÜCAGUGCAOCACAGAACOOOGO</td><td> 300</td><td> GATGCACTG</td><td> 1237</td><td> ATGCACTG</td><td> 2174</td><td> TGCACTG</td><td> 3111</td>

<td> hsa-miR-148b*</td><td> AAGüüCUGUOAUACACUCAGGC</td><td> 301</td><td> AACAGAACT</td><td> 1238</td><td> ACAGAACT</td><td> 2175</td><td> CAGAACT</td><td> 3112</td>

<td> hsa-miR-149</td><td> OCUGGCUCCGUGOCÜUCACUCCC</td><td> 302</td><td> CGGAGCCAG</td><td> 1239</td><td> GGAGCCAG</td><td> 2176</td><td> GAGCCAG</td><td> 3113</td>

<td> hsa-miR-149*</td><td> AGGGAGGGACGGGGGCUGÜGC</td><td> 303</td><td> GTCCCTCCC</td><td> 1240</td><td> TCCCTCCC</td><td> 2177</td><td> CCCTCCC</td><td> 3114</td>

<td> hsa-miR-150</td><td> ÜCÜCCCAACCCÜÜGOACCAGÜG</td><td> 304</td><td> GGTTGGGAG</td><td> 1241</td><td> GTTGGGAG</td><td> 2178</td><td> TTGGGAG</td><td> 3115</td>

<td> hsa-mxR-150 *</td><td> CUGGÜACAGGCCOGGGGGACAG</td><td> 305</td><td> CCTGTACCA</td><td> 1242</td><td> CTGTACCA</td><td> 2179</td><td> TGTACCA</td><td> 3116</td>

<td> hsa-miR-151-3p</td><td> CÜAGACUGAAGCÜCCUUGAGG</td><td> 306</td><td> TTCAGTCTA</td><td> 1243</td><td> TCAGTCTA</td><td> 2180</td><td> CAGTCTA</td><td> 3117</td>

<td> hsa-miR-151-5p</td><td> ÜCGAGGAGCUCACAGUCÜAGO</td><td> 307</td><td> AGCTCCTCG</td><td> 1244</td><td> GCTCCTCG</td><td> 2181</td><td> CTCCTCG</td><td> 3118</td>

<td> hsa-miR-152</td><td> OCAGOGCAÜGACAGAACUUGG</td><td> 308</td><td> CATGCACTG</td><td> 1245</td><td> ATGCACTG</td><td> 2182</td><td> TGCACTG</td><td> 3119</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

<td> hsa-miR-153</td><td> UUGCAUAGDCACAAAAGUGAUC</td><td> 309</td><td> GACTATGCA</td><td> 1246</td><td> ACTATGCA</td><td> 2183</td><td> CTATGCA</td><td> 3120</td>

<td> hsa-miR-1537</td><td> AAAACCGUCÜAGOOACAGÜOGÜ</td><td> 310</td><td> AGACGGTTT</td><td> 1247</td><td> GACGGTTT</td><td> 2184</td><td> ACGGTTT</td><td> 3121</td>

<td> hsa-miR-1538</td><td> CGGCCCGGGCOGCÜGCOGÜUCCÜ</td><td> 311</td><td> GCCCGGGCC</td><td> 1248</td><td> CCCGGGCC</td><td> 2185</td><td> CCGGGCC</td><td> 3122</td>

<td> hsa-miR-1539</td><td> ÜCCÜGCGCGUCCCAGAÜGCCC</td><td> 312</td><td> ACGCGCAGG</td><td> 1249</td><td> CGCGCAGG</td><td> 2186</td><td> GCGCAGG</td><td> 3123</td>

<td> hsa-miR-154</td><td> OAGGOÜAOCCGOGÜÜGCCÜUCG</td><td> 313</td><td> GGATAACCT</td><td> 1250</td><td> GATAACCT</td><td> 2187</td><td> ATAACCT</td><td> 3124</td>

<td> hsa-miR-154*</td><td> AAOCAUACACGGUOGACCUAUU</td><td> 314</td><td> GTGTATGAT</td><td> 1251</td><td> TGTATGAT</td><td> 2188</td><td> GTATGAT</td><td> 3125</td>

<td> hsa-miR-155</td><td> UUAAOGCUAAOCGÜGAUAGGGGÜ</td><td> 315</td><td> TTAGCATTA</td><td> 1252</td><td> TAGCATTA</td><td> 2189</td><td> AGCATTA</td><td> 3126</td>

<td> hsa-miR-155*</td><td> CUCCÜACAÜAUUAGCAUUAACA</td><td> 316</td><td> TATGTAGGA</td><td> 1253</td><td> ATGTAGGA</td><td> 2190</td><td> TGTAGGA</td><td> 3127</td>

<td> hsa-miR-15a</td><td> UAGCAGCACAÜAAUGGUUÜGÜG</td><td> 317</td><td> TGTGCTGCT</td><td> 1254</td><td> GTGCTGCT</td><td> 2191</td><td> TGCTGCT</td><td> 3128</td>

<td> hsa-miR-15a*</td><td> CAGGCCAOAOOGÜGCOGCCÜCA</td><td> 318</td><td> ATATGGCCT</td><td> 1255</td><td> TATGGCCT</td><td> 2192</td><td> ATGGCCT</td><td> 3129</td>

<td> hsa-miR-15b</td><td> ÜAGCAGCACAÜCAUGGUUÜACA</td><td> 319</td><td> TGTGCTGCT</td><td> 1256</td><td> GTGCTGCT</td><td> 2193</td><td> TGCTGCT</td><td> 3130</td>

<td> hsa-miR-15b*</td><td> CGAAÜCAÜUAUUUGCÜGCUCOA</td><td> 320</td><td> TAATGATTC</td><td> 1257</td><td> AATGATTC</td><td> 2194</td><td> ATGATTC</td><td> 3131</td>

<td> hsa-miR-16</td><td> OAGCAGCACGOAAAUAÜUGGCG</td><td> 321</td><td> CGTGCTGCT</td><td> 1258</td><td> GTGCTGCT</td><td> 2195</td><td> TGCTGCT</td><td> 3132</td>

<td> hsa-miR-16-1*</td><td> CCAGÜAÜUAACOGUGCOGCÜGA</td><td> 322</td><td> TTAATACTG</td><td> 1259</td><td> TAATACTG</td><td> 2196</td><td> AATACTG</td><td> 3133</td>

<td> hsa-miR-16-2*</td><td> CCAAUAÜUACUGOGCOGCÜUOA</td><td> 323</td><td> GTAATATTG</td><td> 1260</td><td> TAATATTG</td><td> 2197</td><td> AATATTG</td><td> 3134</td>

<td> hsa-miR-17</td><td> CAAAGÜGCÜÜACAGÜGCAGGOAG</td><td> 324</td><td> AAGCACTTT</td><td> 1261</td><td> AGCACTTT</td><td> 2198</td><td> GCACTTT</td><td> 3135</td>

<td> hsa-miR-17*</td><td> ACUGCAGüGAAGGCACUOGÜAG</td><td> 325</td><td> TCACTGCAG</td><td> 1262</td><td> CACTGCAG</td><td> 2199</td><td> ACTGCAG</td><td> 3136</td>

<td> hsa-miR-181a</td><td> AACAÜUCAACGCÜGÜCGGÜGAGU</td><td> 326</td><td> GTTGAATGT</td><td> 1263</td><td> TTGAATGT</td><td> 2200</td><td> TGAATGT</td><td> 3137</td>

<td> hsa-miR-181a*</td><td> ACCAUCGACCGÜÜGAOÜGUACC</td><td> 327</td><td> GGTCGATGG</td><td> 1264</td><td> GTCGATGG</td><td> 2201</td><td> TCGATGG</td><td> 3138</td>

<td> hsa-miR-181a-2*</td><td> ACCACÜGACCGÜUGACUGÜACC</td><td> 328</td><td> GGTCAGTGG</td><td> 1265</td><td> GTCAGTGG</td><td> 2202</td><td> TCAGTGG</td><td> 3139</td>

<td> hsa-miR-18lb</td><td> AACAOÜCAOOGCUGUCGGUGGGÜ</td><td> 329</td><td> AATGAATGT</td><td> 1266</td><td> ATGAATGT</td><td> 2203</td><td> TGAATGT</td><td> 3140</td>

<td> hsa-miR-181c</td><td> AACAOOCAACCÜGÜCGGÜGAGO</td><td> 330</td><td> GTTGAATGT</td><td> 1267</td><td> TTGAATGT</td><td> 2204</td><td> TGAATGT</td><td> 3141</td>

<td> hsa-miR-181c*</td><td> AACCAÜCGACCGOUGAGÜGGAC</td><td> 331</td><td> GTCGATGGT</td><td> 1268</td><td> TCGATGGT</td><td> 2205</td><td> CGATGGT</td><td> 3142</td>

<td> hsa-miR-181d</td><td> AACAÜUCAÜOGUOGOCGGÜGGGÜ</td><td> 332</td><td> AATGAATGT</td><td> 1269</td><td> ATGAATGT</td><td> 2206</td><td> TGAATGT</td><td> 3143</td>

<td> hsa-miR-182</td><td> OUÜGGCAAOGGÜAGAACUCACACÜ</td><td> 333</td><td> CATTGCCAA</td><td> 1270</td><td> ATTGCCAA</td><td> 2207</td><td> TTGCCAA</td><td> 3144</td>

<td> hsa-miR-182*</td><td> ÜGGÜUCOAGACUUGCCAACUA</td><td> 334</td><td> TCTAGAACC</td><td> 1271</td><td> CTAGAACC</td><td> 2208</td><td> TAGAACC</td><td> 3145</td>

<td> hsa-miR-1825</td><td> UCCAGUGCCCUCCUCÜCC</td><td> 335</td><td> GGGCACTGG</td><td> 1272</td><td> GGCACTGG</td><td> 2209</td><td> GCACTGG</td><td> 3146</td>

<td> hsa-miR-1826</td><td> AUOGAUCAUCGACACÜOCGAACGCAAÜ</td><td> 336</td><td> GATGATCAA</td><td> 1273</td><td> ATGATCAA</td><td> 2210</td><td> TGATCAA</td><td> 3147</td>

<td> hs a-miR-1827</td><td> OGAGGCAGOAGAUUGAAU</td><td> 337</td><td> TACTGCCTC</td><td> 1274</td><td> ACTGCCTC</td><td> 2211</td><td> CTGCCTC</td><td> 3148</td>

<td> hsa-miR-183</td><td> ÜAUGGCACOGGUAGAAOÜCACU</td><td> 338</td><td> CAGTGCCAT</td><td> 1275</td><td> AGTGCCAT</td><td> 2212</td><td> GTGCCAT</td><td> 3149</td>

<td> hsa-miR-183*</td><td> GOGAAÜÜACCGAAGGGCCAÜAA</td><td> 339</td><td> GGTAATTCA</td><td> 1276</td><td> GTAATTCA</td><td> 2213</td><td> TAATTCA</td><td> 3150</td>

<td> hsa-miR-184</td><td> ÜGGACGGAGAACÜGAUAAGGGO</td><td> 340</td><td> TCTCCGTCC</td><td> 1277</td><td> CTCCGTCC</td><td> 2214</td><td> TCCGTCC</td><td> 3151</td>

<td> hsa-miR-185</td><td> OGGAGAGAAAGGCAGUUCCUGA</td><td> 341</td><td> TTTCTCTCC</td><td> 1278</td><td> TTCTCTCC</td><td> 2215</td><td> TCTCTCC</td><td> 3152</td>

<td> hsa-miR-185*</td><td> AGGGGCUGGCUOOCCÜCOGGÜC</td><td> 342</td><td> GCCAGCCCC</td><td> 1279</td><td> CCAGCCCC</td><td> 2216</td><td> CAGCCCC</td><td> 3153</td>

<td> hsa-miR-186</td><td> CAAAGAAÜUCÜCCÜUUUGGGCU</td><td> 343</td><td> GAATTCTTT</td><td> 1280</td><td> AATTCTTT</td><td> 2217</td><td> ATTCTTT</td><td> 3154</td>

<td> hsa-miR-186*</td><td> GCCCAAAGGUGAAUÜÜUÜUGGG</td><td> 344</td><td> ACCTTTGGG</td><td> 1281</td><td> CCTTTGGG</td><td> 2218</td><td> CTTTGGG</td><td> 3155</td>

<td> hsa-miR-187</td><td> OCGOGÜCÜÜGUGÜUGCAGCCGG</td><td> 345</td><td> CAAGACACG</td><td> 1282</td><td> AAGACACG</td><td> 2219</td><td> AGACACG</td><td> 3156</td>

<td> hsa-miR-187*</td><td> GGCOACAACACAGGACCCGGGC</td><td> 346</td><td> TGTTGTAGC</td><td> 1283</td><td> GTTGTAGC</td><td> 2220</td><td> TTGTAGC</td><td> 3157</td>

<td> hsa-miR-188-3p</td><td> CÜCCCACAÜGCAGGGUUUGCA</td><td> 347</td><td> CATGTGGGA</td><td> 1284</td><td> ATGTGGGA</td><td> 2221</td><td> TGTGGGA</td><td> 3158</td>

<td> hsa-miR-188-5p</td><td> CAUCCCÜUGCAUGGUGGAGGG</td><td> 348</td><td> GCAAGGGAT</td><td> 1285</td><td> CAAGGGAT</td><td> 2222</td><td> AAGGGAT</td><td> 3159</td>

<td> hsa-miR-18a</td><td> ÜAAGGOGCAÜCÜAGÜGCAGAÜAG</td><td> 349</td><td> ATGCACCTT</td><td> 1286</td><td> TGCACCTT</td><td> 2223</td><td> GCACCTT</td><td> 3160</td>

<td> hsa-miR-18a*</td><td> ACOGCCCÜAAGUGCUCCÜUCUGG</td><td> 350</td><td> TTAGGGCAG</td><td> 1287</td><td> TAGGGCAG</td><td> 2224</td><td> AGGGCAG</td><td> 3161</td>

<td> hsa-miR-18b</td><td> ÜAAGGUGCAÜCUAGOGCAGOÜAG</td><td> 351</td><td> ATGCACCTT</td><td> 1288</td><td> TGCACCTT</td><td> 2225</td><td> GCACCTT</td><td> 3162</td>

<td> hsa-miR-18b*</td><td> UGCCCUAAAUGCCCCUÜCÜGGC</td><td> 352</td><td> ATTTAGGGC</td><td> 1289</td><td> TTTAGGGC</td><td> 2226</td><td> TTAGGGC</td><td> 3163</td>

<td> hsa-miR-190</td><td> UGAOAÜGÜUUGAUAÜAÜUAGGÜ</td><td> 353</td><td> AAACATATC</td><td> 1290</td><td> AACATATC</td><td> 2227</td><td> ACATATC</td><td> 3164</td>

<td> hsa-miR-1908</td><td> CGGCGGGGACGGCGAÜÜGGOC</td><td> 354</td><td> GTCCCCGCC</td><td> 1291</td><td> TCCCCGCC</td><td> 2228</td><td> CCCCGCC</td><td> 3165</td>

<td> hsa-miR-1909</td><td> CGCAGGGGCCGGGOGCÜCACCG</td><td> 355</td><td> GGCCCCTGC</td><td> 1292</td><td> GCCCCTGC</td><td> 2229</td><td> CCCCTGC</td><td> 3166</td>

<td> hsa-miR-1909*</td><td> ÜGAGÜGCCGGOGCCUGCCCOG</td><td> 356</td><td> CCGGCACTC</td><td> 1293</td><td> CGGCACTC</td><td> 2230</td><td> GGCACTC</td><td> 3167</td>

<td> hsa-miR-190b</td><td> üGAOAUGtroUGAOAUUGGGUO</td><td> 357</td><td> AAACATATC</td><td> 1294</td><td> AACATATC</td><td> 2231</td><td> ACATATC</td><td> 3168</td>

<td> hsa-miR-191</td><td> CAACGGAAÜCCCAAAAGCAGCÜG</td><td> 358</td><td> GATTCCGTT</td><td> 1295</td><td> ATTCCGTT</td><td> 2232</td><td> TTCCGTT</td><td> 3169</td>

<td> hsa-miR-191*</td><td> GCUGCGCÜÜGGAUOOCGÜCCCC</td><td> 359</td><td> CAAGCGCAG</td><td> 1296</td><td> AAGCGCAG</td><td> 2233</td><td> AGCGCAG</td><td> 3170</td>

<td> hsa-miR-1910</td><td> CCAGUCCUGÜGCCOCCCGCCU</td><td> 360</td><td> ACAGGACTG</td><td> 1297</td><td> CAGGACTG</td><td> 2234</td><td> AGGACTG</td><td> 3171</td>

<td> hsa-miR-1911</td><td> ÜGAGUACCGCCAOGüCÜGOUGGG</td><td> 361</td><td> GCGGTACTC</td><td> 1298</td><td> CGGTACTC</td><td> 2235</td><td> GGTACTC</td><td> 3172</td>

<td> hsa-miR-1911*</td><td> CACCAGGCAUUGOGGÜCOCC</td><td> 362</td><td> ATGCCTGGT</td><td> 1299</td><td> TGCCTGGT</td><td> 2236</td><td> GCCTGGT</td><td> 3173</td>

<td> hsa-miR-1912</td><td> QACCCAGAGCAÜGCAGOGUGAA</td><td> 363</td><td> GCTCTGGGT</td><td> 1300</td><td> CTCTGGGT</td><td> 2237</td><td> TCTGGGT</td><td> 3174</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

<td> hsa-miR-1913</td><td> UCUGCCCCCOCCGCUGCUGCCA</td><td> 364</td><td> AGGGGGCAG</td><td> 1301</td><td> GGGGGCAG</td><td> 2238</td><td> GGGGCAG</td><td> 3175</td>

<td> hsa-miR-1914</td><td> CCCOGOGCCCGGCCCACÜÜCÜG</td><td> 365</td><td> GGGCACAGG</td><td> 1302</td><td> GGCACAGG</td><td> 2239</td><td> GCACAGG</td><td> 3176</td>

<td> hsa-miR-1914*</td><td> GGAGGGGÜCCCGCACUGGGAGG</td><td> 366</td><td> GGACCCCTC</td><td> 1303</td><td> GACCCCTC</td><td> 2240</td><td> ACCCCTC</td><td> 3177</td>

<td> hsa-miR-1915</td><td> CCCCAGGGCGACGCGGCGGG</td><td> 367</td><td> CGCCCTGGG</td><td> 1304</td><td> GCCCTGGG</td><td> 2241</td><td> CCCTGGG</td><td> 3178</td>

<td> hsa-miR-1915*</td><td> ACCÜOGCCOÜGCÜGCCCGGGCC</td><td> 368</td><td> AAGGCAAGG</td><td> 1305</td><td> AGGCAAGG</td><td> 2242</td><td> GGCAAGG</td><td> 3179</td>

<td> hsa-miR-192</td><td> CÛGACCOAÜGAAUÙGACAGCC</td><td> 369</td><td> CATAGGTCA</td><td> 1306</td><td> ATAGGTCA</td><td> 2243</td><td> TAGGTCA</td><td> 3180</td>

<td> hsa-miR-192*</td><td> CUGCCAAUÜCCAUAGGÜCACAG</td><td> 370</td><td> GAATTGGCA</td><td> 1307</td><td> AATTGGCA</td><td> 2244</td><td> ATTGGCA</td><td> 3181</td>

<td> hsa-miR-193a-3p</td><td> AACÜGGCCÜACAAAGOCCCAGÜ</td><td> 371</td><td> TAGGCCAGT</td><td> 1308</td><td> AGGCCAGT</td><td> 2245</td><td> GGCCAGT</td><td> 3182</td>

<td> hsa-miR-193a-5p</td><td> UGGGUCUUOGCGGGCGAGAOGA</td><td> 372</td><td> CAAAGACCC</td><td> 1309</td><td> AAAGACCC</td><td> 2246</td><td> AAGACCC</td><td> 3183</td>

<td> hsa-miR-193b</td><td> AACOGGCCCÜCAAAGUCCCGCÜ</td><td> 373</td><td> AGGGCCAGT</td><td> 1310</td><td> GGGCCAGT</td><td> 2247</td><td> GGCCAGT</td><td> 3184</td>

<td> hsa-miR-193b*</td><td> CGGGGOÜÜOGAGGGCGAGAUGA</td><td> 374</td><td> CAAAACCCC</td><td> 1311</td><td> AAAACCCC</td><td> 2248</td><td> AAACCCC</td><td> 3185</td>

<td> hsa-miR-194</td><td> ÜGÜAACAGCAACÜCCAOGUGGA</td><td> 375</td><td> TGCTGTTAC</td><td> 1312</td><td> GCTGTTAC</td><td> 2249</td><td> CTGTTAC</td><td> 3186</td>

<td> hsa-miR-194*</td><td> CCAGÜGGGGCÜGCÜGOÜAUCÜG</td><td> 376</td><td> GCCCCACTG</td><td> 1313</td><td> CCCCACTG</td><td> 2250</td><td> CCCACTG</td><td> 3187</td>

<td> hsa-miR-195</td><td> OAGCAGCACAGAAAÜAÜÜGGC</td><td> 377</td><td> TGTGCTGCT</td><td> 1314</td><td> GTGCTGCT</td><td> 2251</td><td> TGCTGCT</td><td> 3188</td>

<td> hsa-miR-195*</td><td> CCAAÜAÜOGGCOGÜGCOGCÜCC</td><td> 378</td><td> CCAATATTG</td><td> 1315</td><td> CAATATTG</td><td> 2252</td><td> AATATTG</td><td> 3189</td>

<td> hsa-miR-196a</td><td> OAGGÜAGÜÜÜCAUGOOGÜÜGGG</td><td> 379</td><td> AAACTACCT</td><td> 1316</td><td> AACTACCT</td><td> 2253</td><td> ACTACCT</td><td> 3190</td>

<td> hsa-miR-196a*</td><td> CGGCAACAAGAAACUGCCUGAG</td><td> 380</td><td> CTTGTTGCC</td><td> 1317</td><td> TTGTTGCC</td><td> 2254</td><td> TGTTGCC</td><td> 3191</td>

<td> hsa-miR-196b</td><td> OAGGÜAGOUÜCCÜGUUGUÜGGG</td><td> 381</td><td> AAACTACCT</td><td> 1318</td><td> AACTACCT</td><td> 2255</td><td> ACTACCT</td><td> 3192</td>

<td> hsa-miR-197</td><td> UÜCACCACCUOCÜCCACCCAGC</td><td> 382</td><td> AGGTGGTGA</td><td> 1319</td><td> GGTGGTGA</td><td> 2256</td><td> GTGGTGA</td><td> 3193</td>

<td> hsa-miR-198</td><td> GGÜCCAGAGGGGAGAÜAGGÜUC</td><td> 383</td><td> CCTCTGGAC</td><td> 1320</td><td> CTCTGGAC</td><td> 2257</td><td> TCTGGAC</td><td> 3194</td>

<td> hsa-miR-199a-5p</td><td> CCCAGUGÜUCAGACUACCOGÜUC</td><td> 384</td><td> GAACACTGG</td><td> 1321</td><td> AACACTGG</td><td> 2258</td><td> ACACTGG</td><td> 3195</td>

<td> hsa-miR-199b-3p</td><td> ACAGUAGUCUGCACAÜUGGÜUA</td><td> 385</td><td> AGACTACTG</td><td> 1322</td><td> GACTACTG</td><td> 2259</td><td> ACTACTG</td><td> 3196</td>

<td> hsa-miR-199b-5p</td><td> CCCAGÜGOUÜAGACÜAOCUGÜUC</td><td> 386</td><td> AAACACTGG</td><td> 1323</td><td> AACACTGG</td><td> 2260</td><td> ACACTGG</td><td> 3197</td>

<td> hsa-miR-19a</td><td> UGUGCAAAUCUAÜGCAAAACUGA</td><td> 387</td><td> GATTTGCAC</td><td> 1324</td><td> ATTTGCAC</td><td> 2261</td><td> TTTGCAC</td><td> 3198</td>

<td> hsa-miR-19a*</td><td> AGUUUUGCAUAGOUGCACOACA</td><td> 388</td><td> ATGCAAAAC</td><td> 1325</td><td> TGCAAAAC</td><td> 2262</td><td> GCAAAAC</td><td> 3199</td>

<td> hsa-miR-19b</td><td> ÜGUGCAAAUCCAÜGCAAAACUGA</td><td> 389</td><td> GATTTGCAC</td><td> 1326</td><td> ATTTGCAC</td><td> 2263</td><td> TTTGCAC</td><td> 3200</td>

<td> hsa-miR-19b-l*</td><td> AGOUUÜGCAGGUUUGCAUCCAGC</td><td> 390</td><td> CTGCAAAAC</td><td> 1327</td><td> TGCAAAAC</td><td> 2264</td><td> GCAAAAC</td><td> 3201</td>

<td> hsa-miR-19b-2*</td><td> AGUUUOGCAGGUUUGCAUUOCA</td><td> 391</td><td> CTGCAAAAC</td><td> 1328</td><td> TGCAAAAC</td><td> 2265</td><td> GCAAAAC</td><td> 3202</td>

<td> hsa-miR-200a</td><td> OAACACOGÜCOGGÜAACGAÜGÜ</td><td> 392</td><td> GACAGTGTT</td><td> 1329</td><td> ACAGTGTT</td><td> 2266</td><td> CAGTGTT</td><td> 3203</td>

<td> hsa-miR-200a*</td><td> CAUCUUACCGGACAGüGCüGGA</td><td> 393</td><td> CGGTAAGAT</td><td> 1330</td><td> GGTAAGAT</td><td> 2267</td><td> GTAAGAT</td><td> 3204</td>

<td> hsa-miR-200b</td><td> ÜAAUACUGCCUGGUAAÜGAOGA</td><td> 394</td><td> GGCAGTATT</td><td> 1331</td><td> GCAGTATT</td><td> 2268</td><td> CAGTATT</td><td> 3205</td>

<td> hsa-miR-200b*</td><td> CAUCÜÜACUGGGCAGCAUOGGA</td><td> 395</td><td> CAGTAAGAT</td><td> 1332</td><td> AGTAAGAT</td><td> 2269</td><td> GTAAGAT</td><td> 3206</td>

<td> hsa-miR-200c</td><td> OAAOACÜGCCGGGUAAÜGAÜGGA</td><td> 396</td><td> GGCAGTATT</td><td> 1333</td><td> GCAGTATT</td><td> 2270</td><td> CAGTATT</td><td> 3207</td>

<td> hsa-miR-200c*</td><td> CGUCÜUACCCAGCAGÜGÜÜUGG</td><td> 397</td><td> GGGTAAGAC</td><td> 1334</td><td> GGTAAGAC</td><td> 2271</td><td> GTAAGAC</td><td> 3208</td>

<td> hsa-miR-202</td><td> AGAGGÜAUAGGGCAOGGGAA</td><td> 398</td><td> CTATACCTC</td><td> 1335</td><td> TATACCTC</td><td> 2272</td><td> ATACCTC</td><td> 3209</td>

<td> hsa-miR-202*</td><td> ÜUCCUAUGCAOAUACUUCÜÜUG</td><td> 399</td><td> TGCATAGGA</td><td> 1336</td><td> GCATAGGA</td><td> 2273</td><td> CATAGGA</td><td> 3210</td>

<td> hsa-miR-203</td><td> GÜGAAAÜGÜUÜAGGACCACÜAG</td><td> 400</td><td> AACATTTCA</td><td> 1337</td><td> ACATTTCA</td><td> 2274</td><td> CATTTCA</td><td> 3211</td>

<td> hsa-miR-204</td><td> ÜUCCCÜOÜGUCAOCCÜAÜGCCÜ</td><td> 401</td><td> ACAAAGGGA</td><td> 1338</td><td> CAAAGGGA</td><td> 2275</td><td> AAAGGGA</td><td> 3212</td>

<td> hsa-miR-205</td><td> OCCUUCAÜUCCACCGGAGÜCUG</td><td> 402</td><td> GAATGAAGG</td><td> 1339</td><td> AATGAAGG</td><td> 2276</td><td> ATGAAGG</td><td> 3213</td>

<td> hsa-miR-206</td><td> ÜGGAAOGÜAAGGAAGÜGÜGÜGG</td><td> 403</td><td> TTACATTCC</td><td> 1340</td><td> TACATTCC</td><td> 2277</td><td> ACATTCC</td><td> 3214</td>

<td> hsa-miR-208a</td><td> AÜAAGACGAGCAAAAAGCUOGU</td><td> 404</td><td> CTCGTCTTA</td><td> 1341</td><td> TCGTCTTA</td><td> 2278</td><td> CGTCTTA</td><td> 3215</td>

<td> hsa-miR-208b</td><td> AUAAGACGAACAAAAGGUUÜGÜ</td><td> 405</td><td> TTCGTCTTA</td><td> 1342</td><td> TCGTCTTA</td><td> 2279</td><td> CGTCTTA</td><td> 3216</td>

<td> hsa-miR-20a</td><td> UAAAGOGCUÜAOAGUGCAGGÜAG</td><td> 406</td><td> AAGCACTTT</td><td> 1343</td><td> AGCACTTT</td><td> 2280</td><td> GCACTTT</td><td> 3217</td>

<td> hsa-miR-20a*</td><td> ACOGCAUUAUGAGCACOUAAAG</td><td> 407</td><td> ATAATGCAG</td><td> 1344</td><td> TAATGCAG</td><td> 2281</td><td> AATGCAG</td><td> 3218</td>

<td> hsa-miR-20b</td><td> CAAAGOGCUCAUAGUGCAGGUAG</td><td> 408</td><td> GAGCACTTT</td><td> 1345</td><td> AGCACTTT</td><td> 2282</td><td> GCACTTT</td><td> 3219</td>

<td> hsa-miR-20b*</td><td> ACÜGÜAGÜAUGGGCACÜUCCAG</td><td> 409</td><td> ATACTACAG</td><td> 1346</td><td> TACTACAG</td><td> 2283</td><td> ACTACAG</td><td> 3220</td>

<td> hsa-miR-21</td><td> ÜAGCÜUAÜCAGACOGAUGOÜGA</td><td> 410</td><td> TGATAAGCT</td><td> 1347</td><td> GATAAGCT</td><td> 2284</td><td> ATAAGCT</td><td> 3221</td>

<td> hsa-miR-21*</td><td> CAACACCAGÜCGAÜGGGCOGU</td><td> 411</td><td> ACTGGTGTT</td><td> 1348</td><td> CTGGTGTT</td><td> 2285</td><td> TGGTGTT</td><td> 3222</td>

<td> hsa-miR-210</td><td> COGOGCGUGUGACAGCGGCÜGA</td><td> 412</td><td> ACACGCACA</td><td> 1349</td><td> CACGCACA</td><td> 2286</td><td> ACGCACA</td><td> 3223</td>

<td> hsa-miR-211</td><td> ÜÜCCCUUUGÜCAUCCUUCGCCU</td><td> 413</td><td> ACAAAGGGA</td><td> 1350</td><td> CAAAGGGA</td><td> 2287</td><td> AAAGGGA</td><td> 3224</td>

<td> hsa-miR-212</td><td> ÜAACAGUCÜCCAGUCACGGCC</td><td> 414</td><td> GAGACTGTT</td><td> 1351</td><td> AGACTGTT</td><td> 2288</td><td> GACTGTT</td><td> 3225</td>

<td> hsa-miR-214</td><td> ACAGCAGGCACAGACAGGCAGÜ</td><td> 415</td><td> TGCCTGCTG</td><td> 1352</td><td> GCCTGCTG</td><td> 2289</td><td> CCTGCTG</td><td> 3226</td>

<td> hsa-miR-214*</td><td> UGCCUGOCUACACUUGCÜGUGC</td><td> 416</td><td> TAGACAGGC</td><td> 1353</td><td> AGACAGGC</td><td> 2290</td><td> GACAGGC</td><td> 3227</td>

<td> hsa-miR-215</td><td> AOGACCÜAÜGAAUUGACAGAC</td><td> 417</td><td> CATAGGTCA</td><td> 1354</td><td> ATAGGTCA</td><td> 2291</td><td> TAGGTCA</td><td> 3228</td>

<td> hsa-miR-216a</td><td> ÜAAUCÜCAGCÜGGCAACÜGÜGA</td><td> 418</td><td> GCTGAGATT</td><td> 1355</td><td> CTGAGATT</td><td> 2292</td><td> TGAGATT</td><td> 3229</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

<td> hsa-miR-216b</td><td> AAAUCÜCUGCAGGCAAAUGÜGA</td><td> 419</td><td> GCAGAGATT</td><td> 1356</td><td> CAGAGATT</td><td> 2293</td><td> AGAGATT</td><td> 3230</td>

<td> hsa-miR-217</td><td> UACUGCAUCAGGAACÜGAUÜGGA</td><td> 420</td><td> TGATGCAGT</td><td> 1357</td><td> GATGCAGT</td><td> 2294</td><td> ATGCAGT</td><td> 3231</td>

<td> hsa-miR-218</td><td> ÜUGOGCOUGAUCOAACCAOGÜ</td><td> 421</td><td> TCAAGCACA</td><td> 1358</td><td> CAAGCACA</td><td> 2295</td><td> AAGCACA</td><td> 3232</td>

<td> hsa-miR-218-1*</td><td> AOGGÜUCCGOCAAGCACCAÜGG</td><td> 422</td><td> ACGGAACCA</td><td> 1359</td><td> CGGAACCA</td><td> 2296</td><td> GGAACCA</td><td> 3233</td>

<td> hsa-miR-218-2*</td><td> CAUGGUÜCUGOCAAGCACCGCG</td><td> 423</td><td> CAGAACCAT</td><td> 1360</td><td> AGAACCAT</td><td> 2297</td><td> GAACCAT</td><td> 3234</td>

<td> hsa-miR-219-l-3p</td><td> AGAGOOGAGüCOGGACGUCCCG</td><td> 424</td><td> ACTCAACTC</td><td> 1361</td><td> CTCAACTC</td><td> 2298</td><td> TCAACTC</td><td> 3235</td>

<td> hsa-miR-219-2-3p</td><td> AGAAOÜGUGGCÜGGACAOCOGÜ</td><td> 425</td><td> CCACAATTC</td><td> 1362</td><td> CACAATTC</td><td> 2299</td><td> ACAATTC</td><td> 3236</td>

<td> hsa-miR-219-5p</td><td> UGAÜÜGUCCAAACGCAAUUCÜ</td><td> 426</td><td> TGGACAATC</td><td> 1363</td><td> GGACAATC</td><td> 2300</td><td> GACAATC</td><td> 3237</td>

<td> hsa-miR-22</td><td> AAGCÜGCCAGUÜGAAGAACUGU</td><td> 427</td><td> CTGGCAGCT</td><td> 1364</td><td> TGGCAGCT</td><td> 2301</td><td> GGCAGCT</td><td> 3238</td>

<td> hsa-miR-22*</td><td> AGÜÜCUUCAGUGGCAAGCUUÜA</td><td> 428</td><td> CTGAAGAAC</td><td> 1365</td><td> TGAAGAAC</td><td> 2302</td><td> GAAGAAC</td><td> 3239</td>

<td> hsa-miR-220a</td><td> CCACACCGÜAOCUGACACUUU</td><td> 429</td><td> TACGGTGTG</td><td> 1366</td><td> ACGGTGTG</td><td> 2303</td><td> CGGTGTG</td><td> 3240</td>

<td> hsa-miR-220b</td><td> CCACCACCGOGUCUGACACUÜ</td><td> 430</td><td> ACGGTGGTG</td><td> 1367</td><td> CGGTGGTG</td><td> 2304</td><td> GGTGGTG</td><td> 3241</td>

<td> hsa-miR-220c</td><td> ACACAGGGCOGÜUGÜGAAGACU</td><td> 431</td><td> AGCCCTGTG</td><td> 1368</td><td> GCCCTGTG</td><td> 2305</td><td> CCCTGTG</td><td> 3242</td>

<td> hsa-miR-221</td><td> AGCÜACAUÜGOCUGCUGGGUUUC</td><td> 432</td><td> CAATGTAGC</td><td> 1369</td><td> AATGTAGC</td><td> 2306</td><td> ATGTAGC</td><td> 3243</td>

<td> hsa-miR-221*</td><td> ACCOGGCAUACAAÜGUAGAUUU</td><td> 433</td><td> TATGCCAGG</td><td> 1370</td><td> ATGCCAGG</td><td> 2307</td><td> TGCCAGG</td><td> 3244</td>

<td> hsa-miR-222</td><td> AGCUACAUCÜGGCÜACOGGGÜ</td><td> 434</td><td> AGATGTAGC</td><td> 1371</td><td> GATGTAGC</td><td> 2308</td><td> ATGTAGC</td><td> 3245</td>

<td> hsa-miR-222*</td><td> CUCAGUAGCCAGUGUAGAUCCU</td><td> 435</td><td> GGCTACTGA</td><td> 1372</td><td> GCTACTGA</td><td> 2309</td><td> CTACTGA</td><td> 3246</td>

<td> hsa-miR-223</td><td> UGOCAGUUOGÜCAAAUACCCCA</td><td> 436</td><td> CAAACTGAC</td><td> 1373</td><td> AAACTGAC</td><td> 2310</td><td> AACTGAC</td><td> 3247</td>

<td> hsa-miR-223*</td><td> CGUGUAÜUUGACAAGCüGAGUU</td><td> 437</td><td> CAAATACAC</td><td> 1374</td><td> AAATACAC</td><td> 2311</td><td> AATACAC</td><td> 3248</td>

<td> hsa-miR-224</td><td> CAAGÜCACUAGÜGGÜOCCGÜU</td><td> 438</td><td> TAGTGACTT</td><td> 1375</td><td> AGTGACTT</td><td> 2312</td><td> GTGACTT</td><td> 3249</td>

<td> hsa-miR-23a</td><td> AOCACAOÜGCCAGGGAOÜÜCC</td><td> 439</td><td> GCAATGTGA</td><td> 1376</td><td> CAATGTGA</td><td> 2313</td><td> AATGTGA</td><td> 3250</td>

<td> hsa-miR-23a*</td><td> GGGGUOCCUGGGGAOGGGAOUO</td><td> 440</td><td> CAGGAACCC</td><td> 1377</td><td> AGGAACCC</td><td> 2314</td><td> GGAACCC</td><td> 3251</td>

<td> hsa-miR-23b</td><td> AÜCACAÜUGCCAGGGAÜOACC</td><td> 441</td><td> GCAATGTGA</td><td> 1378</td><td> CAATGTGA</td><td> 2315</td><td> AATGTGA</td><td> 3252</td>

<td> hsa-miR-23b*</td><td> UGGGÜOCCOGGCAÜGCUGAÜÜÜ</td><td> 442</td><td> CAGGAACCC</td><td> 1379</td><td> AGGAACCC</td><td> 2316</td><td> GGAACCC</td><td> 3253</td>

<td> hsa-miR-24</td><td> ÜGGCÜCAGUÜCAGCAGGAACAG</td><td> 443</td><td> AACTGAGCC</td><td> 1380</td><td> ACTGAGCC</td><td> 2317</td><td> CTGAGCC</td><td> 3254</td>

<td> hsa-miR-2 4-1*</td><td> ÜGCCÜACÜGAGCÜGAOAUCAGÜ</td><td> 444</td><td> TCAGTAGGC</td><td> 1381</td><td> CAGTAGGC</td><td> 2318</td><td> AGTAGGC</td><td> 3255</td>

<td> hsa-miR-24-2*</td><td> UGCCÜACUGAGCÜGAAACACAG</td><td> 445</td><td> TCAGTAGGC</td><td> 1382</td><td> CAGTAGGC</td><td> 2319</td><td> AGTAGGC</td><td> 3256</td>

<td> hsa-miR-25</td><td> CAOÜGCACOÜGÜCUCGGÜCOGA</td><td> 446</td><td> AAGTGCAAT</td><td> 1383</td><td> AGTGCAAT</td><td> 2320</td><td> GTGCAAT</td><td> 3257</td>

<td> hsa-miR-25*</td><td> AGGCGGAGACOOGGGCAAÜOG</td><td> 447</td><td> GTCTCCGCC</td><td> 1384</td><td> TCTCCGCC</td><td> 2321</td><td> CTCCGCC</td><td> 3258</td>

<td> hsa-miR-26a</td><td> UUCAAGUAAUCCAGGAOAGGCU</td><td> 448</td><td> ATTACTTGA</td><td> 1385</td><td> TTACTTGA</td><td> 2322</td><td> TACTTGA</td><td> 3259</td>

<td> hsa-miR-2 6a-l*</td><td> CCÜAÜUCUUGGÜOACOOGCACG</td><td> 449</td><td> CAAGAATAG</td><td> 1386</td><td> AAGAATAG</td><td> 2323</td><td> AGAATAG</td><td> 3260</td>

<td> hsa-miR-26a-2*</td><td> CCUAUUCUUGAÜOACÜÜGUUUC</td><td> 450</td><td> CAAGAATAG</td><td> 1387</td><td> AAGAATAG</td><td> 2324</td><td> AGAATAG</td><td> 3261</td>

<td> hsa-miR-26b</td><td> ÜOCAAGOAAUUCAGGAUAGGU</td><td> 451</td><td> ATTACTTGA</td><td> 1388</td><td> TTACTTGA</td><td> 2325</td><td> TACTTGA</td><td> 3262</td>

<td> hsa-miR-26b*</td><td> CCUGUUCUCCAÜÜACÜÜGGCUC</td><td> 452</td><td> GGAGAACAG</td><td> 1389</td><td> GAGAACAG</td><td> 2326</td><td> AGAACAG</td><td> 3263</td>

<td> hsa-miR-27a</td><td> UUCACAGOGGCÜAAGÜÜCCGC</td><td> 453</td><td> CCACTGTGA</td><td> 1390</td><td> CACTGTGA</td><td> 2327</td><td> ACTGTGA</td><td> 3264</td>

<td> hsa-miR-27a*</td><td> AGGGCUUAGCÜGCUUGOGAGCA</td><td> 454</td><td> GCTAAGCCC</td><td> 1391</td><td> CTAAGCCC</td><td> 2328</td><td> TAAGCCC</td><td> 3265</td>

<td> hsa-miR-27b</td><td> OUCACAGOGGCUAAGOÜCÜGC</td><td> 455</td><td> CCACTGTGA</td><td> 1392</td><td> CACTGTGA</td><td> 2329</td><td> ACTGTGA</td><td> 3266</td>

<td> hsa-miR-27b*</td><td> AGAGCÜÜAGCÜGAÜÜGGÜGAAC</td><td> 456</td><td> GCTAAGCTC</td><td> 1393</td><td> CTAAGCTC</td><td> 2330</td><td> TAAGCTC</td><td> 3267</td>

<td> hsa-miR-28-3p</td><td> CACÜAGAÜÜGUGAGCUCCÜGGA</td><td> 457</td><td> CAATCTAGT</td><td> 1394</td><td> AATCTAGT</td><td> 2331</td><td> ATCTAGT</td><td> 3268</td>

<td> hsa-miR-28-5p</td><td> AAGGAGCÜCACAGÜCUAÜUGAG</td><td> 458</td><td> TGAGCTCCT</td><td> 1395</td><td> GAGCTCCT</td><td> 2332</td><td> AGCTCCT</td><td> 3269</td>

<td> hsa-miR-2 9 6-3p</td><td> GAGGGÜOGGGÜGGAGGCUCÜCC</td><td> 459</td><td> CCCAACCCT</td><td> 1396</td><td> CCAACCCT</td><td> 2333</td><td> CAACCCT</td><td> 3270</td>

<td> hsa-miR-296-5p</td><td> AGGGCCCCCCCOCAAOCCUGU</td><td> 460</td><td> GGGGGGCCC</td><td> 1397</td><td> GGGGGCCC</td><td> 2334</td><td> GGGGCCC</td><td> 3271</td>

<td> hsa-miR-297</td><td> AOGOAUGÜGOGCAÜGÜGCAÜG</td><td> 461</td><td> ACACATACA</td><td> 1398</td><td> CACATACA</td><td> 2335</td><td> ACATACA</td><td> 3272</td>

<td> hsa-miR-298</td><td> AGCAGAAGCAGGGAGGUÜCOCCCA</td><td> 462</td><td> TGCTTCTGC</td><td> 1399</td><td> GCTTCTGC</td><td> 2336</td><td> CTTCTGC</td><td> 3273</td>

<td> hsa-miR-299-3p</td><td> ÜAÜGÜGGGAUGGOAAACCGCUU</td><td> 463</td><td> ATCCCACAT</td><td> 1400</td><td> TCCCACAT</td><td> 2337</td><td> CCCACAT</td><td> 3274</td>

<td> hsa-miR-299-5p</td><td> ÜGGÜUOACCGOCCCACAÜACAU</td><td> 464</td><td> CGGTAAACC</td><td> 1401</td><td> GGTAAACC</td><td> 2338</td><td> GTAAACC</td><td> 3275</td>

<td> hsa-miR-29a</td><td> ÜAGCACCAUCOGAAAÜCGGOOA</td><td> 465</td><td> GATGGTGCT</td><td> 1402</td><td> ATGGTGCT</td><td> 2339</td><td> TGGTGCT</td><td> 3276</td>

<td> hsa-miR-29a*</td><td> ACUGAÜOUCOOUOGGÜGUÜCAG</td><td> 466</td><td> AGAAATCAG</td><td> 1403</td><td> GAAATCAG</td><td> 2340</td><td> AAATCAG</td><td> 3277</td>

<td> hsa-miR-29b</td><td> UAGCACCAUUUGAAAÜCAGÜGOU</td><td> 467</td><td> AATGGTGCT</td><td> 1404</td><td> ATGGTGCT</td><td> 2341</td><td> TGGTGCT</td><td> 3278</td>

<td> hsa-miR-29b-l*</td><td> GCUGGÜÜUCAÜAOGGÜGGUÜOAGA</td><td> 468</td><td> TGAAACCAG</td><td> 1405</td><td> GAAACCAG</td><td> 2342</td><td> AAACCAG</td><td> 3279</td>

<td> hsa-miR-29b-2*</td><td> COGGUUÜCACAÜGGÜGGCUÜAG</td><td> 469</td><td> GTGAAACCA</td><td> 1406</td><td> TGAAACCA</td><td> 2343</td><td> GAAACCA</td><td> 3280</td>

<td> hsa-miR-29c</td><td> ÜACCACCAÜÜÜGAAAÜCGCUÜA</td><td> 470</td><td> AATGGTGCT</td><td> 1407</td><td> ATGGTGCT</td><td> 2344</td><td> TGGTGCT</td><td> 3281</td>

<td> hsa-miR-29c*</td><td> OGACCGAUOOCUCCüGGUGüOC</td><td> 471</td><td> AAATCGGTC</td><td> 1408</td><td> AATCGGTC</td><td> 2345</td><td> ATCGGTC</td><td> 3282</td>

<td> hsa-miR-300</td><td> UAÜACAAGGGCAGACOCUCOCO</td><td> 472</td><td> CCCTTGTAT</td><td> 1409</td><td> CCTTGTAT</td><td> 2346</td><td> CTTGTAT</td><td> 3283</td>

<td> hsa-miR-301a</td><td> CAGÜGCAAÜAGÜAUOGUCAAAGC</td><td> 473</td><td> TATTGCACT</td><td> 1410</td><td> ATTGCACT</td><td> 2347</td><td> TTGCACT</td><td> 3284</td>

CA 02701547 2010-04-01

WO 2009/043353

PCI7DK2008/000344

<td> tisa-miR-301b</td><td> CAGOGCAAUGAUAÜUGUCAAAGC</td><td> 474</td><td> CATTGCACT</td><td> 1411</td><td> ATTGCACT</td><td> 2348</td><td> TTGCACT</td><td> 3285</td>

<td> hsa-miR-302a</td><td> UAAGOGCÜOCCAUGÜÜÜÜGGUGA</td><td> 475</td><td> GAAGCACTT</td><td> 1412</td><td> AAGCACTT</td><td> 2349</td><td> AGCACTT</td><td> 3286</td>

<td> hsa-miR-302a*</td><td> ACUÜAAACGÜGGAOGUACOUGCU</td><td> 476</td><td> ACGTTTAAG</td><td> 1413</td><td> CGTTTAAG</td><td> 2350</td><td> GTTTAAG</td><td> 3287</td>

<td> hsa-miR-302b</td><td> ÜAAGUGCUUCCAUGÜUÜOAGUAG</td><td> 477</td><td> GAAGCACTT</td><td> 1414</td><td> AAGCACTT</td><td> 2351</td><td> AGCACTT</td><td> 3288</td>

<td> tisa-miR-302b*</td><td> ACÜUUAACAÜGGAAGUGCOÜUC</td><td> 478</td><td> ATGTTAAAG</td><td> 1415</td><td> TGTTAAAG</td><td> 2352</td><td> GTTAAAG</td><td> 3289</td>

<td> tlsa-miR-302c</td><td> ÜAAGUGCÜÜCCAÜGUUOCAGUGG</td><td> 479</td><td> GAAGCACTT</td><td> 1416</td><td> AAGCACTT</td><td> 2353</td><td> AGCACTT</td><td> 3290</td>

<td> hsa-miR-302c*</td><td> UUÜAACAUGGGGGUACCUGCUG</td><td> 480</td><td> CCATGTTAA</td><td> 1417</td><td> CATGTTAA</td><td> 2354</td><td> ATGTTAA</td><td> 3291</td>

<td> hsa-miR-302d</td><td> ÜAAGUGCUOCCAUGUUUGAGUGÜ</td><td> 481</td><td> GAAGCACTT</td><td> 1418</td><td> AAGCACTT</td><td> 2355</td><td> AGCACTT</td><td> 3292</td>

<td> hsa-miR-302d*</td><td> ACÜUUAACAOGGAGGCACOÜGC</td><td> 482</td><td> ATGTTAAAG</td><td> 1419</td><td> TGTTAAAG</td><td> 2356</td><td> GTTAAAG</td><td> 3293</td>

<td> hsa-miR-302e</td><td> UAAGUGCüOCCAüGCüü</td><td> 483</td><td> GAAGCACTT</td><td> 1420</td><td> AAGCACTT</td><td> 2357</td><td> AGCACTT</td><td> 3294</td>

<td> hsa-miR-302f</td><td> UAAUUGCUUCCAUGUUU</td><td> 484</td><td> GAAGCAATT</td><td> 1421</td><td> AAGCAATT</td><td> 2358</td><td> AGCAATT</td><td> 3295</td>

<td> hsa-miR-30a</td><td> UGUAAACAUCCUCGACUGGAAG</td><td> 485</td><td> GATGTTTAC</td><td> 1422</td><td> ATGTTTAC</td><td> 2359</td><td> TGTTTAC</td><td> 3296</td>

<td> hsa-miR-30a*</td><td> CUUUCAGUCGGAÜGÜUOGCAGC</td><td> 486</td><td> CGACTGAAA</td><td> 1423</td><td> GACTGAAA</td><td> 2360</td><td> ACTGAAA</td><td> 3297</td>

<td> hsa-miR-30b</td><td> ÜGUAAACAUCCUACACUCAGCU</td><td> 487</td><td> GATGTTTAC</td><td> 1424</td><td> ATGTTTAC</td><td> 2361</td><td> TGTTTAC</td><td> 3298</td>

<td> hsa-miR-30b*</td><td> CUGGGAGGUGGAÜGOOÜACOUC</td><td> 488</td><td> CACCTCCCA</td><td> 1425</td><td> ACCTCCCA</td><td> 2362</td><td> CCTCCCA</td><td> 3299</td>

<td> hsa-miR-30c</td><td> ÜGOAAACAÜCCÜACACUCOCAGC</td><td> 489</td><td> GATGTTTAC</td><td> 1426</td><td> ATGTTTAC</td><td> 2363</td><td> TGTTTAC</td><td> 3300</td>

<td> hsa-miR-30c-l*</td><td> CUGGGAGAGGGOOGOÜÜACÜCC</td><td> 490</td><td> CCTCTCCCA</td><td> 1427</td><td> CTCTCCCA</td><td> 2364</td><td> TCTCCCA</td><td> 3301</td>

<td> hsa-miR-30c-2*</td><td> CÜGGGAGAAGGCÜGOUÜACÜCU</td><td> 491</td><td> CTTCTCCCA</td><td> 1428</td><td> TTCTCCCA</td><td> 2365</td><td> TCTCCCA</td><td> 3302</td>

<td> hsa-miR-30d</td><td> ÜGÜAAACAOCCCCGACUGGAAG</td><td> 492</td><td> GATGTTTAC</td><td> 1429</td><td> ATGTTTAC</td><td> 2366</td><td> TGTTTAC</td><td> 3303</td>

<td> hsa-miR-30d*</td><td> CÜÜÜCAGOCAGAUGÜUOGCUGC</td><td> 493</td><td> TGACTGAAA</td><td> 1430</td><td> GACTGAAA</td><td> 2367</td><td> ACTGAAA</td><td> 3304</td>

<td> hsa-miR-30e</td><td> OGUAAACAUCCUUGACOGGAAG</td><td> 494</td><td> GATGTTTAC</td><td> 1431</td><td> ATGTTTAC</td><td> 2368</td><td> TGTTTAC</td><td> 3305</td>

<td> hsa-miR-30e*</td><td> CUOUCAGUCGGAUGUUUACAGC</td><td> 495</td><td> CGACTGAAA</td><td> 1432</td><td> GACTGAAA</td><td> 2369</td><td> ACTGAAA</td><td> 3306</td>

<td> hsa-miR-31</td><td> AGGCAAGAOGCUGGCAOAGCU</td><td> 496</td><td> CATCTTGCC</td><td> 1433</td><td> ATCTTGCC</td><td> 2370</td><td> TCTTGCC</td><td> 3307</td>

<td> hsa-miR-31*</td><td> OGCUAUGCCAACAUAUUGCCAU</td><td> 497</td><td> TGGCATAGC</td><td> 1434</td><td> GGCATAGC</td><td> 2371</td><td> GCATAGC</td><td> 3308</td>

<td> hsa-miR-32</td><td> ÜAOOGCACAUUACUAAGUÜGCA</td><td> 498</td><td> ATGTGCAAT</td><td> 1435</td><td> TGTGCAAT</td><td> 2372</td><td> GTGCAAT</td><td> 3309</td>

<td> hsa-miR-32*</td><td> CAAUUUAGUGUGOGUGAUAUUU</td><td> 499</td><td> CACTAAATT</td><td> 1436</td><td> ACTAAATT</td><td> 2373</td><td> CTAAATT</td><td> 3310</td>

<td> hsa-miR-320a</td><td> AAAAGCÜGGGOUGAGAGGGCGA</td><td> 500</td><td> CCCAGCTTT</td><td> 1437</td><td> CCAGCTTT</td><td> 2374</td><td> CAGCTTT</td><td> 3311</td>

<td> hsa-miR-320b</td><td> AAAAGCUGGGUOGAGAGGGCAA</td><td> 501</td><td> CCCAGCTTT</td><td> 1438</td><td> CCAGCTTT</td><td> 2375</td><td> CAGCTTT</td><td> 3312</td>

<td> hsa-miR-320c</td><td> AAAAGCOGGGOOGAGAGGGO</td><td> 502</td><td> CCCAGCTTT</td><td> 1439</td><td> CCAGCTTT</td><td> 2376</td><td> CAGCTTT</td><td> 3313</td>

<td> hsa-miR-320d</td><td> AAAAGCOGGGÜUGAGAGGA</td><td> 503</td><td> CCCAGCTTT</td><td> 1440</td><td> CCAGCTTT</td><td> 2377</td><td> CAGCTTT</td><td> 3314</td>

<td> hsa-miR-323-3p</td><td> CACAUUACACGGÜCGACCÜCÜ</td><td> 504</td><td> GTGTAATGT</td><td> 1441</td><td> TGTAATGT</td><td> 2378</td><td> GTAATGT</td><td> 3315</td>

<td> hsa-miR-323~5p</td><td> AGGÜGGÜCCGÜGGCGCGUUCGC</td><td> 505</td><td> CGGACCACC</td><td> 1442</td><td> GGACCACC</td><td> 2379</td><td> GACCACC</td><td> 3316</td>

<td> hsa-miR-324~3p</td><td> ACOGCCCCAGGUGCÜGCUGG</td><td> 506</td><td> CTGGGGCAG</td><td> 1443</td><td> TGGGGCAG</td><td> 2380</td><td> GGGGCAG</td><td> 3317</td>

<td> hsa-miR-324-5p</td><td> CGCAUCCCCÜAGGGCAÜUGGÜGU</td><td> 507</td><td> AGGGGATGC</td><td> 1444</td><td> GGGGATGC</td><td> 2381</td><td> GGGATGC</td><td> 3318</td>

<td> hsa-miR-325</td><td> CCOAGÜAGGÜGOCCAGUAAGÜGU</td><td> 508</td><td> ACCTACTAG</td><td> 1445</td><td> CCTACTAG</td><td> 2382</td><td> CTACTAG</td><td> 3319</td>

<td> hsa-miR-326</td><td> CCUCÜGGGCCCUUCCUCCAG</td><td> 509</td><td> GGCCCAGAG</td><td> 1446</td><td> GCCCAGAG</td><td> 2383</td><td> CCCAGAG</td><td> 3320</td>

<td> hsa-miR-328</td><td> CÜGGCCCÜCUCUGCCCOÜCCGO</td><td> 510</td><td> AGAGGGCCA</td><td> 1447</td><td> GAGGGCCA</td><td> 2384</td><td> AGGGCCA</td><td> 3321</td>

<td> hsa-miR-329</td><td> AACACACCOGGUÜAACCOCÜÜÜ</td><td> 511</td><td> CAGGTGTGT</td><td> 1448</td><td> AGGTGTGT</td><td> 2385</td><td> GGTGTGT</td><td> 3322</td>

<td> hsa-miR-330-3p</td><td> GCAAAGCACACGGCCUGCAGAGA</td><td> 512</td><td> TGTGCTTTG</td><td> 1449</td><td> GTGCTTTG</td><td> 2386</td><td> TGCTTTG</td><td> 3323</td>

<td> hsa-miR-330-5p</td><td> UCUCUGGGCCUGÜGÜCUOAGGC</td><td> 513</td><td> GGCCCAGAG</td><td> 1450</td><td> GCCCAGAG</td><td> 2387</td><td> CCCAGAG</td><td> 3324</td>

<td> hsa-miR-331-3p</td><td> GCCCCÜGGGCCÜAUCCOAGAA</td><td> 514</td><td> GCCCAGGGG</td><td> 1451</td><td> CCCAGGGG</td><td> 2388</td><td> CCAGGGG</td><td> 3325</td>

<td> hsa-miR-331-5p</td><td> COAGGOAUGGÜCCCAGGGAUCC</td><td> 515</td><td> CCATACCTA</td><td> 1452</td><td> CATACCTA</td><td> 2389</td><td> ATACCTA</td><td> 3326</td>

<td> hsa-miR-335</td><td> OCAAGAGCAAUAACGAAAAAOGU</td><td> 516</td><td> TTGCTCTTG</td><td> 1453</td><td> TGCTCTTG</td><td> 2390</td><td> GCTCTTG</td><td> 3327</td>

<td> hsa-miR-335*</td><td> ÜUÜÜUCAOOAUOGCÜCCUGACC</td><td> 517</td><td> TAATGAAAA</td><td> 1454</td><td> AATGAAAA</td><td> 2391</td><td> ATGAAAA</td><td> 3328</td>

<td> hsa-miR-337-3p</td><td> CÜCCUAOAUGAÜGCCOÜUCÜÜC</td><td> 518</td><td> CATATAGGA</td><td> 1455</td><td> ATATAGGA</td><td> 2392</td><td> TATAGGA</td><td> 3329</td>

<td> hsa-miR-337-5p</td><td> GAACGGCUÜCAOACAGGAGÜÜ</td><td> 519</td><td> GAAGCCGTT</td><td> 1456</td><td> AAGCCGTT</td><td> 2393</td><td> AGCCGTT</td><td> 3330</td>

<td> hsa-miR-338-3p</td><td> UCCAGCAÜCAGUGAOÜÜOGUOG</td><td> 520</td><td> TGATGCTGG</td><td> 1457</td><td> GATGCTGG</td><td> 2394</td><td> ATGCTGG</td><td> 3331</td>

<td> hsa-miR-338-5p</td><td> AACAAÜAUCCUGGUGCOGAGOG</td><td> 521</td><td> GGATATTGT</td><td> 1458</td><td> GATATTGT</td><td> 2395</td><td> ATATTGT</td><td> 3332</td>

<td> hsa-miR-339-3p</td><td> ÜGAGCGCCUCGACGACAGAGCCG</td><td> 522</td><td> GAGGCGCTC</td><td> 1459</td><td> AGGCGCTC</td><td> 2396</td><td> GGCGCTC</td><td> 3333</td>

<td> hsa-miR-339-5p</td><td> ÜCCCUGÜCCUCCAGGAGCÜCACG</td><td> 523</td><td> AGGACAGGG</td><td> 1460</td><td> GGACAGGG</td><td> 2397</td><td> GACAGGG</td><td> 3334</td>

<td> hsa-miR-33a</td><td> GÜGCAUOGÜAGUUGCAOUGCA</td><td> 524</td><td> TACAATGCA</td><td> 1461</td><td> ACAATGCA</td><td> 2398</td><td> CAATGCA</td><td> 3335</td>

<td> hsa-miR-33a*</td><td> CAAOGOUUCCACAGUGCAUCAC</td><td> 525</td><td> GGAAACATT</td><td> 1462</td><td> GAAACATT</td><td> 2399</td><td> AAACATT</td><td> 3336</td>

<td> hsa-miR-33b</td><td> GOGCAÜÜGCOGOÜGCAUÜGC</td><td> 526</td><td> AGCAATGCA</td><td> 1463</td><td> GCAATGCA</td><td> 2400</td><td> CAATGCA</td><td> 3337</td>

<td> hsa-miR-33b*</td><td> CAGÜGCCÜCGGCAGOGCAGCCC</td><td> 527</td><td> CGAGGCACT</td><td> 1464</td><td> GAGGCACT</td><td> 2401</td><td> AGGCACT</td><td> 3338</td>

<td> hsa-miR-340</td><td> OÜAOAAAGCAAOGAGACÜGAOO</td><td> 528</td><td> TGCTTTATA</td><td colspan="2"> 1465|GCTTTATA</td><td> 2402</td><td> CTTTATA</td><td> 3339</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

<td> hsa-miR-340*</td><td> UCCGÜCOCAGOÜACÜUÜAUAGC</td><td> 529</td><td> CTGAGACGG</td><td> 1466</td><td> TGAGACGG</td><td> 2403</td><td> GAGACGG</td><td> 3340</td>

<td> hsa-miR-342-3p</td><td> ÜCOCACACAGAAAUCGCACCCGÜ</td><td> 530</td><td> CTGTGTGAG</td><td> 1467</td><td> TGTGTGAG</td><td> 2404</td><td> GTGTGAG</td><td> 3341</td>

<td> hsa-miR-342-5p</td><td> AGGGGOGCUAÜCUGÜGAUÜGA</td><td> 531</td><td> TAGCACCCC</td><td> 1468</td><td> AGCACCCC</td><td> 2405</td><td> GCACCCC</td><td> 3342</td>

<td> hsa-miR-345</td><td> GCUGACÜCCÜAGOCCAGGGCÜC</td><td> 532</td><td> AGGAGTCAG</td><td> 1469</td><td> GGAGTCAG</td><td> 2406</td><td> GAGTCAG</td><td> 3343</td>

<td> hsa-miR-346</td><td> UGUCÜGCCCGCAÜGCCÜGCCÜCO</td><td> 533</td><td> CGGGCAGAC</td><td> 1470</td><td> GGGCAGAC</td><td> 2407</td><td> GGCAGAC</td><td> 3344</td>

<td> hsa-miR-34a</td><td> UGGCAGUGUCUUAGCÜGGÜUGO</td><td> 534</td><td> GACACTGCC</td><td> 1471</td><td> ACACTGCC</td><td> 2408</td><td> CACTGCC</td><td> 3345</td>

<td> hsa-miR-34a*</td><td> CAAÜCAGCAAGÜAÛACÜGCCCO</td><td> 535</td><td> TTGCTGATT</td><td> 1472</td><td> TGCTGATT</td><td> 2409</td><td> GCTGATT</td><td> 3346</td>

<td> hsa-miR-34b</td><td> CAAÜCACUAACÜCCACÜGCCAO</td><td> 536</td><td> TTAGTGATT</td><td> 1473</td><td> TAGTGATT</td><td> 2410</td><td> AGTGATT</td><td> 3347</td>

<td> hsa-miR-34b*</td><td> UAGGCAGUGÜCAÜÜAGCUGAUÜG</td><td> 537</td><td> ACACTGCCT</td><td> 1474</td><td> CACTGCCT</td><td> 2411</td><td> ACTGCCT</td><td> 3348</td>

<td> hsa-miR-34c-3p</td><td> AAUCACUAACCACACGGCCAGG</td><td> 538</td><td> GTTAGTGAT</td><td> 1475</td><td> TTAGTGAT</td><td> 2412</td><td> TAGTGAT</td><td> 3349</td>

<td> hsa-miR-34c-5p</td><td> AGGCAGOGÜAGOOAGCUGAUUGC</td><td> 539</td><td> TACACTGCC</td><td> 1476</td><td> ACACTGCC</td><td> 2413</td><td> CACTGCC</td><td> 3350</td>

<td> hsa-miR-361-3p</td><td> UCCCCCAGGUGÜGAUUCUGAUUÜ</td><td> 540</td><td> ACCTGGGGG</td><td> 1477</td><td> CCTGGGGG</td><td> 2414</td><td> CTGGGGG</td><td> 3351</td>

<td> hsa-miR-361-5p</td><td> ÜÜAÜCAGAAOCUCCAGGGGUAC</td><td> 541</td><td> ATTCTGATA</td><td> 1478</td><td> TTCTGATA</td><td> 2415</td><td> TCTGATA</td><td> 3352</td>

<td> hsa-miR-362-3p</td><td> AACACACCUAOUCAAGGAUÜCA</td><td> 542</td><td> TAGGTGTGT</td><td> 1479</td><td> AGGTGTGT</td><td> 2416</td><td> GGTGTGT</td><td> 3353</td>

<td> hsa-miR-3 62-5p</td><td> AAUCCOUGGAACCÜAGGUGUGAGÜ</td><td> 543</td><td> TCCAAGGAT</td><td> 1480</td><td> CCAAGGAT</td><td> 2417</td><td> CAAGGAT</td><td> 3354</td>

<td> hsa-miR-363</td><td> AAUUGCACGGUAOCCAUCOGÜA</td><td> 544</td><td> CCGTGCAAT</td><td> 1481</td><td> CGTGCAAT</td><td> 2418</td><td> GTGCAAT</td><td> 3355</td>

<td> hsa-miR-363*</td><td> CGGGÜGGAOCACGAUGCAAÜUU</td><td> 545</td><td> GATCCACCC</td><td> 1482</td><td> ATCCACCC</td><td> 2419</td><td> TCCACCC</td><td> 3356</td>

<td> hsa-miR-365</td><td> OAAUGCCCCÜAAAAAUCCUUAÜ</td><td> 546</td><td> AGGGGCATT</td><td> 1483</td><td> GGGGCATT</td><td> 2420</td><td> GGGCATT</td><td> 3357</td>

<td> hsa-miR-367</td><td> AAUUGCACUOUAGCAAUGGÜGA</td><td> 547</td><td> AAGTGCAAT</td><td> 1484</td><td> AGTGCAAT</td><td> 2421</td><td> GTGCAAT</td><td> 3358</td>

<td> hsa-miR-367*</td><td> ACÜGUUGCÜAAUAOGCAACÜCO</td><td> 548</td><td> TAGCAACAG</td><td> 1485</td><td> AGCAACAG</td><td> 2422</td><td> GCAACAG</td><td> 3359</td>

<td> hsa-miR-369-3p</td><td> AAUAAÜACAOGGOÜGAOCÜUÜ</td><td> 549</td><td> ATGTATTAT</td><td> 1486</td><td> TGTATTAT</td><td> 2423</td><td> GTATTAT</td><td> 3360</td>

<td> hsa-miR-369-5p</td><td> AGAUCGACCGOGOÜAUAUUCGC</td><td> 550</td><td> CGGTCGATC</td><td> 1487</td><td> GGTCGATC</td><td> 2424</td><td> GTCGATC</td><td> 3361</td>

<td> hsa-miR-370</td><td> GCCUGCUGGGGÜGGAACCÜGGÜ</td><td> 551</td><td> CCCAGCAGG</td><td> 1488</td><td> CCAGCAGG</td><td> 2425</td><td> CAGCAGG</td><td> 3362</td>

<td> hsa-miR-371-3p</td><td> AAGUGCCGCCAÜCUÜÜUGAGOGU</td><td> 552</td><td> GGCGGCACT</td><td> 1489</td><td> GCGGCACT</td><td> 2426</td><td> CGGCACT</td><td> 3363</td>

<td> hsa-miR-371-5p</td><td> ACÜCAAACUGOGGGGGCACU</td><td> 553</td><td> CAGTTTGAG</td><td> 1490</td><td> AGTTTGAG</td><td> 2427</td><td> GTTTGAG</td><td> 3364</td>

<td> hsa-miR-372</td><td> AAAGUGCUGCGACAÜUÜGAGCGO</td><td> 554</td><td> GCAGCACTT</td><td> 1491</td><td> CAGCACTT</td><td> 2428</td><td> AGCACTT</td><td> 3365</td>

<td> hsa-miR-373</td><td> GAAGOGCÜUCGAUUÜUGGGGUGÜ</td><td> 555</td><td> GAAGCACTT</td><td> 1492</td><td> AAGCACTT</td><td> 2429</td><td> AGCACTT</td><td> 3366</td>

<td> hsa-miR-373*</td><td> ACüCAAAAUGGGGGCGCOUUCC</td><td> 556</td><td> CATTTTGAG</td><td> 1493</td><td> ATTTTGAG</td><td> 2430</td><td> TTTTGAG</td><td> 3367</td>

<td> hsa-miR-374a</td><td> OUAUAAOACAACCUGAUAAGUG</td><td> 557</td><td> TGTATTATA</td><td> 1494</td><td> GTATTATA</td><td> 2431</td><td> ΤΆΤΤΑΤΑ</td><td> 3368</td>

<td> hsa-miR-374a*</td><td> CÜUAÜCAGAÜÜGÜAÜUGOAAÜO</td><td> 558</td><td> ATCTGATAA</td><td> 1495</td><td> TCTGATAA</td><td> 2432</td><td> CTGATAA</td><td> 3369</td>

<td> hsa-miR-374b</td><td> AÜAUAAOACAACCÜGCÜAAGUG</td><td> 559</td><td> TGTATTATA</td><td> 1496</td><td> GTATTATA</td><td> 2433</td><td> TATTATA</td><td> 3370</td>

<td> hsa-miR-374b*</td><td> CUUAGCAGGÜÜGUAOÜAUCAOU</td><td> 560</td><td> ACCTGCTAA</td><td> 1497</td><td> CCTGCTAA</td><td> 2434</td><td> CTGCTAA</td><td> 3371</td>

<td> hsa-miR-375</td><td> UUÜGOUCGUUCGGCOCGCGOGA</td><td> 561</td><td> AACGAACAA</td><td> 1498</td><td> ACGAACAA</td><td> 2435</td><td> CGAACAA</td><td> 3372</td>

<td> hsa-miR-376a</td><td> AÜCAUAGAGGAAAAÛCCACGU</td><td> 562</td><td> CCTCTATGA</td><td> 1499</td><td> CTCTATGA</td><td> 2436</td><td> TCTATGA</td><td> 3373</td>

<td> hsa-miR-37 6a*</td><td> GUAGAOUCOCCUUCÜAÜGAGUA</td><td> 563</td><td> GAGAATCTA</td><td> 1500</td><td> AGAATCTA</td><td> 2437</td><td> GAATCTA</td><td> 3374</td>

<td> hsa-miR-37 6b</td><td> AUCAUAGAGGAAAAOCCAUGÜO</td><td> 564</td><td> CCTCTATGA</td><td> 1501</td><td> CTCTATGA</td><td> 2438</td><td> TCTATGA</td><td> 3375</td>

<td> hsa-miR-37 6c</td><td> AACAÜAGAGGAAAOOCCACGU</td><td> 565</td><td> CCTCTATGT</td><td> 1502</td><td> CTCTATGT</td><td> 2439</td><td> TCTATGT</td><td> 3376</td>

<td> hsa-miR-377</td><td> AUCACACAAAGGCAACÜUÜÜGU</td><td> 566</td><td> TTTGTGTGA</td><td> 1503</td><td> TTGTGTGA</td><td> 2440</td><td> TGTGTGA</td><td> 3377</td>

<td> hsa-miR-377*</td><td> AGAGGUÜGCCCÜOGGÜGAAUOC</td><td> 567</td><td> GGCAACCTC</td><td> 1504</td><td> GCAACCTC</td><td> 2441</td><td> CAACCTC</td><td> 3378</td>

<td> hsa-miR-378</td><td> ACUGGACÜOGGAGÜCAGAAGG</td><td> 568</td><td> CAAGTCCAG</td><td> 1505</td><td> AAGTCCAG</td><td> 2442</td><td> AGTCCAG</td><td> 3379</td>

<td> hsa-miR-378*</td><td> CUCCUGACÜCCAGGUCCUGÜGÜ</td><td> 569</td><td> GAGTCAGGA</td><td> 1506</td><td> AGTCAGGA</td><td> 2443</td><td> GTCAGGA</td><td> 3380</td>

<td> hsa-miR-379</td><td> OGGOAGACÜAUGGAACGOAGG</td><td> 570</td><td> TAGTCTACC</td><td> 1507</td><td> AGTCTACC</td><td> 2444</td><td> GTCTACC</td><td> 3381</td>

<td> hsa-miR-379*</td><td> OAOGUAACAÜGGUCCACÜAACÜ</td><td> 571</td><td> ATGTTACAT</td><td> 1508</td><td> TGTTACAT</td><td> 2445</td><td> GTTACAT</td><td> 3382</td>

<td> hsa-miR-380</td><td> OAUGUAAOAÜGGÜCCACAÜCÜÜ</td><td> 572</td><td> ATATTACAT</td><td> 1509</td><td> TATTACAT</td><td> 2446</td><td> ATTACAT</td><td> 3383</td>

<td> hsa-miR-380*</td><td> OGGUUGACCAÜAGAACAÜGCGC</td><td> 573</td><td> TGGTCAACC</td><td> 1510</td><td> GGTCAACC</td><td> 2447</td><td> GTCAACC</td><td> 3384</td>

<td> hsa-miR-381</td><td> OAUACAAGGGCAAGCÜCüCOGO</td><td> 574</td><td> CCCTTGTAT</td><td> 1511</td><td> CCTTGTAT</td><td> 2448</td><td> CTTGTAT</td><td> 3385</td>

<td> hsa-miR-382</td><td> GAAGÜÜGOUCGÜGGOGGAUUCG</td><td> 575</td><td> GAACAACTT</td><td> 1512</td><td> AACAACTT</td><td> 2449</td><td> ACAACTT</td><td> 3386</td>

<td> hsa-miR-383</td><td> AGAÜCAGAAGGÜGAUÜGOGGCU</td><td> 576</td><td> CTTCTGATC</td><td> 1513</td><td> TTCTGATC</td><td> 2450</td><td> TCTGATC</td><td> 3387</td>

<td> hsa-miR-384</td><td> AtJUCCÜAGAAAUUGUÜCAÜA</td><td> 577</td><td> TTCTAGGAA</td><td> 1514</td><td> TCTAGGAA</td><td> 2451</td><td> CTAGGAA</td><td> 3388</td>

<td> hsa-miR-409-3p</td><td> GAAOGÜOGCOCGGÜGAACCCCO</td><td> 578</td><td> AGCAACATT</td><td> 1515</td><td> GCAACATT</td><td> 2452</td><td> CAACATT</td><td> 3389</td>

<td> hsa-miR-409-5p</td><td> AGGUUACCCGAGCAACÜÜOGCAU</td><td> 579</td><td> CGGGTAACC</td><td> 1516</td><td> GGGTAACC</td><td> 2453</td><td> GGTAACC</td><td> 3390</td>

<td> hsa-miR-410</td><td> AAOAUAACACAGAUGGCCUGÜ</td><td> 580</td><td> GTGTTATAT</td><td> 1517</td><td> TGTTATAT</td><td> 2454</td><td> GTTATAT</td><td> 3391</td>

<td> hsa-miR-411</td><td> ÜAGÜAGACCGUAUAGCGÜACG</td><td> 581</td><td> CGGTCTACT</td><td> 1518</td><td> GGTCTACT</td><td> 2455</td><td> GTCTACT</td><td> 3392</td>

<td> hsa-miR-411*</td><td> OAUGUAACACGGUCCACUAACC</td><td> 582</td><td> GTGTTACAT</td><td> 1519</td><td> TGTTACAT</td><td> 2456</td><td> GTTACAT</td><td> 3393</td>

<td> hsa-miR-412</td><td> ACUÜCACCÜGGUCCACUAGCCGO</td><td> 583</td><td> CAGGTGAAG</td><td> 1520</td><td> AGGTGAAG</td><td> 2457</td><td> GGTGAAG</td><td> 3394</td>

CA 02701547 2010-04-01

WO 2009/043353

PCI7DK2008/000344

100

<td> hsa-miR-421</td><td> AUCAACAGACAUUAAUUGGGCGC</td><td> 584</td><td> GTCTGTTGA</td><td> 1521</td><td> TCTGTTGA</td><td> 2458</td><td> CTGTTGA</td><td> 3395</td>

<td> hsa-miR-422a</td><td> ACÜGGACOOAGGGÜCAGAAGGC</td><td> 585</td><td> TAAGTCCAG</td><td> 1522</td><td> AAGTCCAG</td><td> 2459</td><td> AGTCCAG</td><td> 3396</td>

<td> hsa-miR-423-3p</td><td> AGCÜCGGÜCÜGAGGCCCCUCAGU</td><td> 586</td><td> AGACCGAGC</td><td> 1523</td><td> GACCGAGC</td><td> 2460</td><td> ACCGAGC</td><td> 3397</td>

<td> hsa-miR-423-5p</td><td> UGAGGGGCAGAGAGCGAGACÜUU</td><td> 587</td><td> CTGCCCCTC</td><td> 1524</td><td> TGCCCCTC</td><td> 2461</td><td> GCCCCTC</td><td> 3398</td>

<td> hsa-miR-424</td><td> CAGCAGCAAUUCAOGUUUUGAA</td><td> 588</td><td> ATTGCTGCT</td><td> 1525</td><td> TTGCTGCT</td><td> 2462</td><td> TGCTGCT</td><td> 3399</td>

<td> hsa-miR-424*</td><td> CAAAACGUGAGGCGCUGCOAU</td><td> 589</td><td> TCACGTTTT</td><td> 1526</td><td> CACGTTTT</td><td> 2463</td><td> ACGTTTT</td><td> 3400</td>

<td> hsa-miR-425</td><td> AAÜGACACGAÜCACOCCCGUUGA</td><td> 590</td><td> TCGTGTCAT</td><td> 1527</td><td> CGTGTCAT</td><td> 2464</td><td> GTGTCAT</td><td> 3401</td>

<td> hsa-miR-425*</td><td> AOCGGGAADGUCGOGUCCGCCC</td><td> 591</td><td> CATTCCCGA</td><td> 1528</td><td> ATTCCCGA</td><td> 2465</td><td> TTCCCGA</td><td> 3402</td>

<td> hsa-miR-429</td><td> ÜAAUACOGÜCÜGGUAAAACCGÜ</td><td> 592</td><td> GACAGTATT</td><td> 1529</td><td> ACAGTATT</td><td> 2466</td><td> CAGTATT</td><td> 3403</td>

<td> hsa-miR-431</td><td> OGUCÜUGCAGGCCGOCAUGCA</td><td> 593</td><td> CTGCAAGAC</td><td> 1530</td><td> TGCAAGAC</td><td> 24 67</td><td> GCAAGAC</td><td> 3404</td>

<td> hsa-miR-431*</td><td> CAGGOCGUCÜUGCAGGGCUÜCO</td><td> 594</td><td> AGACGACCT</td><td> 1531</td><td> GACGACCT</td><td> 2468</td><td> ACGACCT</td><td> 3405</td>

<td> hsa-miR-432</td><td> UCUUGGAGÜAGGUCAOUGGGOGG</td><td> 595</td><td> TACTCCAAG</td><td> 1532</td><td> ACTCCAAG</td><td> 2469</td><td> CTCCAAG</td><td> 3406</td>

<td> hsa-miR-432*</td><td> CÜGGAOGGCÜCCUCCAÜGOCÜ</td><td> 596</td><td> AGCCATCCA</td><td> 1533</td><td> GCCATCCA</td><td> 2470</td><td> CCATCCA</td><td> 3407</td>

<td> hsa-miR-433</td><td> AOCAÜGAÜGGGCÜCCÜCGGUGÜ</td><td> 597</td><td> CCATCATGA</td><td> 1534</td><td> CATCATGA</td><td> 2471</td><td> ATCATGA</td><td> 3408</td>

<td> hsa-miR-448</td><td> ÜUGCAOAOGÜAGGAOGUCCCAO</td><td> 598</td><td> ACATATGCA</td><td> 1535</td><td> CATATGCA</td><td> 2472</td><td> ATATGCA</td><td> 3409</td>

<td> hsa-miR-449a</td><td> UGGCAGÜGÜAOÜGOÜAGCOGGU</td><td> 599</td><td> TACACTGCC</td><td> 1536</td><td> ACACTGCC</td><td> 2473</td><td> CACTGCC</td><td> 3410</td>

<td> hsa-miR-449b</td><td> AGGCAGÜGÜAOOGUÜAGCOGGC</td><td> 600</td><td> TACACTGCC</td><td> 1537</td><td> ACACTGCC</td><td> 2474</td><td> CACTGCC</td><td> 3411</td>

<td> hsa-miR-450a</td><td> UUÜÜGCGAÜGÜGUÜCCUAAUAU</td><td> 601</td><td> CATCGCAAA</td><td> 1538</td><td> ATCGCAAA</td><td> 2475</td><td> TCGCAAA</td><td> 3412</td>

<td> hsa-miR-450b-3p</td><td> UÜGGGAÜCAÛUOOGCAUCCAUA</td><td> 602</td><td> ATGATCCCA</td><td> 1539</td><td> TGATCCCA</td><td> 2476</td><td> GATCCCA</td><td> 3413</td>

<td> hsa-miR-450b-5p</td><td> OÜOÜGCAAÜAUGUUCCUGAAOA</td><td> 603</td><td> TATTGCAAA</td><td> 1540</td><td> ATTGCAAA</td><td> 2477</td><td> TTGCAAA</td><td> 3414</td>

<td> hsa-miR-451</td><td> AAACCGUUACCAUOACUGAGUU</td><td> 604</td><td> GTAACGGTT</td><td> 1541</td><td> TAACGGTT</td><td> 2478</td><td> AACGGTT</td><td> 3415</td>

<td> hsa-miR-452</td><td> AACOGUUUGCAGAGGAAACÜGA</td><td> 605</td><td> GCAAACAGT</td><td> 1542</td><td> CAAACAGT</td><td> 2479</td><td> AAACAGT</td><td> 3416</td>

<td> hsa-miR-452*</td><td> CUCAUCOGCAAAGAAGUAAGUG</td><td> 606</td><td> TGCAGATGA</td><td> 1543</td><td> GCAGATGA</td><td> 2480</td><td> CAGATGA</td><td> 3417</td>

<td> hsa-miR-453</td><td> AGGÜUGUCCGUGGUGAGUUCGCA</td><td> 607</td><td> CGGACAACC</td><td> 1544</td><td> GGACAACC</td><td> 2481</td><td> GACAACC</td><td> 3418</td>

<td> hsa-raiR-454</td><td> OAGÜGCAAUAUÜGCUÜAUAGGGO</td><td> 608</td><td> TATTGCACT</td><td> 1545</td><td> ATTGCACT</td><td> 2482</td><td> TTGCACT</td><td> 3419</td>

<td> hsa-miR-454*</td><td> ACCCUAUCAAÜAUÜGUCUCÜGC</td><td> 609</td><td> TTGATAGGG</td><td> 1546</td><td> TGATAGGG</td><td> 2483</td><td> GATAGGG</td><td> 3420</td>

<td> hsa-miR-455-3p</td><td> GCAGUCCAUGGGCAUAUACAC</td><td> 610</td><td> CATGGACTG</td><td> 1547</td><td> ATGGACTG</td><td> 2484</td><td> TGGACTG</td><td> 3421</td>

<td> hsa-miR-455-5p</td><td> UAUGUGCCUDUGGACUACAOCG</td><td> 611</td><td> AAGGCACAT</td><td> 1548</td><td> AGGCACAT</td><td> 2485</td><td> GGCACAT</td><td> 3422</td>

<td> hsa-miR-483-3p</td><td> OCACUCCÜCOCCÜCCCGUCUO</td><td> 612</td><td> AGAGGAGTG</td><td> 1549</td><td> GAGGAGTG</td><td> 2486</td><td> AGGAGTG</td><td> 3423</td>

<td> hsa-miR-483-5p</td><td> AAGACGGGAGGAAAGAAGGGAG</td><td> 613</td><td> CTCCCGTCT</td><td> 1550</td><td> TCCCGTCT</td><td> 2487</td><td> CCCGTCT</td><td> 3424</td>

<td> hsa-miR-484</td><td> ÜCAGGCUCAGUCCCCÜCCCGAU</td><td> 614</td><td> CTGAGCCTG</td><td> 1551</td><td> TGAGCCTG</td><td> 2488</td><td> GAGCCTG</td><td> 3425</td>

<td> hsa-miR-485-3p</td><td> GUCAOACACGGCÜCÜCCUCÜCU</td><td> 615</td><td> CGTGTATGA</td><td> 1552</td><td> GTGTATGA</td><td> 2489</td><td> TGTATGA</td><td> 3426</td>

<td> hsa-miR-485-5p</td><td> AGAGGCUGGCCGÜGAUGAAÜUC</td><td> 616</td><td> GCCAGCCTC</td><td> 1553</td><td> CCAGCCTC</td><td> 2490</td><td> CAGCCTC</td><td> 3427</td>

<td> hsa-miR-486-3p</td><td> CGGGGCAGCÜCAGUACAGGAU</td><td> 617</td><td> AGCTGCCCC</td><td> 1554</td><td> GCTGCCCC</td><td> 2491</td><td> CTGCCCC</td><td> 3428</td>

<td> hsa-miR-486-5p</td><td> ÜCCÜGUACOGAGCUGCCCCGAG</td><td> 618</td><td> CAGTACAGG</td><td> 1555</td><td> AGTACAGG</td><td> 2492</td><td> GTACAGG</td><td> 3429</td>

<td> hsa-miR-487a</td><td> AAÜCAUACAGGGACAOCCAGÜÜ</td><td> 619</td><td> CTGTATGAT</td><td> 1556</td><td> TGTATGAT</td><td> 2493</td><td> GTATGAT</td><td> 3430</td>

<td> hsa-miR-487b</td><td> AAUCGÜACAGGGUCAUCCACUU</td><td> 620</td><td> CTGTACGAT</td><td> 1557</td><td> TGTACGAT</td><td> 2494</td><td> GTACGAT</td><td> 3431</td>

<td> hsa-miR-488</td><td> ÜÜGAAAGGCUAUUÜCUUGGÜC</td><td> 621</td><td> AGCCTTTCA</td><td> 1558</td><td> GCCTTTCA</td><td> 2495</td><td> CCTTTCA</td><td> 3432</td>

<td> hsa-miR-488*</td><td> CCCAGAÜAAÜGGCACUCÜCAA</td><td> 622</td><td> ATTATCTGG</td><td> 1559</td><td> TTATCTGG</td><td> 2496</td><td> TATCTGG</td><td> 3433</td>

<td> hsa-miR-489</td><td> GUGACAUCACAÜAUACGGCAGC</td><td> 623</td><td> GTGATGTCA</td><td> 1560</td><td> TGATGTCA</td><td> 2497</td><td> GATGTCA</td><td> 3434</td>

<td> hsa-miR-490-3p</td><td> CAACCÜGGAGGACUCCAÜGCUG</td><td> 624</td><td> CTCCAGGTT</td><td> 1561</td><td> TCCAGGTT</td><td> 2498</td><td> CCAGGTT</td><td> 3435</td>

<td> hsa-miR-490-5p</td><td> CCAÜGGAÜCÜCCAGGUGGGU</td><td> 625</td><td> AGATCCATG</td><td> 1562</td><td> GATCCATG</td><td> 2499</td><td> ATCCATG</td><td> 3436</td>

<td> hsa-miR-491-3p</td><td> CÜÜAÜGCAAGAUUCCCÜÜCOAC</td><td> 626</td><td> CTTGCATAA</td><td> 1563</td><td> TTGCATAA</td><td> 2500</td><td> TGCATAA</td><td> 3437</td>

<td> hsa-miR-491-5p</td><td> AGÜGGGGAACCCUOCCAOGAGG</td><td> 627</td><td> GTTCCCCAC</td><td> 1564</td><td> TTCCCCAC</td><td> 2501</td><td> TCCCCAC</td><td> 3438</td>

<td> hsa-miR-492</td><td> AGGACCüGCGGGACAAGAUUCUU</td><td> 628</td><td> CGCAGGTCC</td><td> 1565</td><td> GCAGGTCC</td><td> 2502</td><td> CAGGTCC</td><td> 3439</td>

<td> hsa-miR-493</td><td> UGAAGGüCUACUGQGUGCCAGG</td><td> 629</td><td> TAGACCTTC</td><td> 1566</td><td> AGACCTTC</td><td> 2503</td><td> GACCTTC</td><td> 3440</td>

<td> hsa-miR-493*</td><td> UUGUACAUGGUAGGCUUUCAUU</td><td> 630</td><td> CCATGTACA</td><td> 1567</td><td> CATGTACA</td><td> 2504</td><td> ATGTACA</td><td> 3441</td>

<td> hsa-miR-494</td><td> ÜGAAACAÜACACGGGAAACCÜC</td><td> 631</td><td> GTATGTTTC</td><td> 1568</td><td> TATGTTTC</td><td> 2505</td><td> ATGTTTC</td><td> 3442</td>

<td> hsa-miR-495</td><td> AAACAAACAÜGGUGCACÜOCÜO</td><td> 632</td><td> ATGTTTGTT</td><td> 1569</td><td> TGTTTGTT</td><td> 2506</td><td> GTTTGTT</td><td> 3443</td>

<td> hsa-miR-496</td><td> UGAGUAUUACAUGGCCAAÜCOC</td><td> 633</td><td> GTAATACTC</td><td> 1570</td><td> TAATACTC</td><td> 2507</td><td> AATACTC</td><td> 3444</td>

<td> hsa-miR-497</td><td> CAGCAGCACACÜGUGGOUOGU</td><td> 634</td><td> TGTGCTGCT</td><td> 1571</td><td> GTGCTGCT</td><td> 2508</td><td> TGCTGCT</td><td> 3445</td>

<td> hsa-miR-497*</td><td> CAAACCACACUGÜGGUGUOAGA</td><td> 635</td><td> GTGTGGTTT</td><td> 1S72</td><td> TGTGGTTT</td><td> 2509</td><td> GTGGTTT</td><td> 3446</td>

<td> hsa-miR-498</td><td> UÜUCAAGCCAGGGGGCGUUUÜUC</td><td> 636</td><td> TGGCTTGAA</td><td> 1573</td><td> GGCTTGAA</td><td> 2510</td><td> GCTTGAA</td><td> 3447</td>

<td> hsa-miR-499-3p</td><td> AACAUCACAGCAAGÜCUGÜGCÜ</td><td> 637</td><td> CTGTGATGT</td><td> 1574</td><td> TGTGATGT</td><td> 2511</td><td> GTGATGT</td><td> 3448</td>

<td> hsa-miR-499-5p</td><td> OÜAAGACUÜGCAGOGAÜGUUÜ</td><td> 638</td><td> CAAGTCTTA</td><td> 1575</td><td> aagtctta</td><td> 2512</td><td> AGTCTTA</td><td> 3449</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

101

<td> hsa-miR-500</td><td> OAAOCCUOGCUACCUGGGUGAGA</td><td> 639</td><td> GCAAGGATT</td><td> 1576</td><td> CAAGGATT</td><td> 2513</td><td> AAGGATT</td><td> 3450</td>

<td> hsa-miR-500*</td><td> AÜGCACCOGGGCAAGGAOÜCOG</td><td> 640</td><td> CCAGGTGCA</td><td> 1577</td><td> CAGGTGCA</td><td> 2514</td><td> AGGTGCA</td><td> 3451</td>

<td> hsa-miR-501-3p</td><td> AAUGCACCCGGGCAAGGAÜÜCO</td><td> 641</td><td> CGGGTGCAT</td><td> 1578</td><td> GGGTGCAT</td><td> 2515</td><td> GGTGCAT</td><td> 3452</td>

<td> hsa-miR-501-5p</td><td> AAOCCÜÜÜGUCCCUGGGUGAGA</td><td> 642</td><td> ACAAAGGAT</td><td> 1579</td><td> CAAAGGAT</td><td> 2516</td><td> AAAGGAT</td><td> 3453</td>

<td> hsa-miR-502-3p</td><td> AAUGCACCÜGGGCAAGGAÜUCA</td><td> 643</td><td> CAGGTGCAT</td><td> 1580</td><td> AGGTGCAT</td><td> 2517</td><td> GGTGCAT</td><td> 3454</td>

<td> hsa-miR-502-5p</td><td> AUCCÜÜGCÜAUCUGGGOGCÜA</td><td> 644</td><td> TAGCAAGGA</td><td> 1581</td><td> AGCAAGGA</td><td> 2518</td><td> GCAAGGA</td><td> 3455</td>

<td> hsa-miR-503</td><td> ÜAGCAGCGGGAACAGUUCUGCAG</td><td> 645</td><td> CCCGCTGCT</td><td> 1582</td><td> CCGCTGCT</td><td> 2519</td><td> CGCTGCT</td><td> 3456</td>

<td> hsa-miR-504</td><td> AGACCCOGGÜCÜGCACÜCUAÜC</td><td> 64 6</td><td> ACCAGGGTC</td><td> 1583</td><td> CCAGGGTC</td><td> 2520</td><td> CAGGGTC</td><td> 3457</td>

<td> hsa-miR-505</td><td> CGUCAACACÜÜGCÜGGÜÜUCCU</td><td> 647</td><td> AGTGTTGAC</td><td> 1584</td><td> GTGTTGAC</td><td> 2521</td><td> TGTTGAC</td><td> 3458</td>

<td> hsa-miR-505*</td><td> GGGAGCCAGGAAGÜAÜUGAUGU</td><td> 648</td><td> CCTGGCTCC</td><td> 1585</td><td> CTGGCTCC</td><td> 2522</td><td> TGGCTCC</td><td> 3459</td>

<td> hsa-miR-506</td><td> ÜAAGGCACCCOOCÜGAGUAGA</td><td> 649</td><td> GGGTGCCTT</td><td> 1586</td><td> GGTGCCTT</td><td> 2523</td><td> GTGCCTT</td><td> 3460</td>

<td> hsa-miR-507</td><td> ÜUUOGCACCOÜÜÜGGAGUGAA</td><td> 650</td><td> AGGTGCAAA</td><td> 1587</td><td> GGTGCAAA</td><td> 2524</td><td> GTGCAAA</td><td> 3461</td>

<td> hsa-miR-508-3p</td><td> OGAÜOGÜAGCCOÜUUGGAGUAGA</td><td> 651</td><td> GCTACAATC</td><td> 1588</td><td> CTACAATC</td><td> 2525</td><td> TACAATC</td><td> 3462</td>

<td> hsa-miR-508-5p</td><td> OACOCCAGAGGGCGOCACÜCAOG</td><td> 652</td><td> CTCTGGAGT</td><td> 1589</td><td> TCTGGAGT</td><td> 2526</td><td> CTGGAGT</td><td> 3463</td>

<td> hsa-miR-509-3-5p</td><td> OACÜGCAGACGUGGCAAUCAOG</td><td> 653</td><td> GTCTGCAGT</td><td> 1590</td><td> TCTGCAGT</td><td> 2527</td><td> CTGCAGT</td><td> 3464</td>

<td> hsa-miR-509-3p</td><td> ÜGAUUGGUACGUCÜGUGGGUAG</td><td> 654</td><td> GTACCAATC</td><td> 1591</td><td> TACCAATC</td><td> 2528</td><td> ACCAATC</td><td> 3465</td>

<td> hsa-miR-509-5p</td><td> ÜACÜGCAGACAGUGGCAAOCA</td><td> 655</td><td> GTCTGCAGT</td><td> 1592</td><td> TCTGCAGT</td><td> 2529</td><td> CTGCAGT</td><td> 3466</td>

<td> hsa-miR-510</td><td> UACÜCAGGAGAGUGGCAAOCAC</td><td> 656</td><td> CTCCTGAGT</td><td> 1593</td><td> TCCTGAGT</td><td> 2530</td><td> CCTGAGT</td><td> 3467</td>

<td> hsa-miR-511</td><td> GUGUCUUUUGCÜCUGCAGUCA</td><td> 657</td><td> CAAAAGACA</td><td> 1594</td><td> AAAAGACA</td><td> 2531</td><td> AAAGACA</td><td> 3468</td>

<td> hsa-miR-512-3p</td><td> AAGUGCUGUCAUAGCUGAGGUC</td><td> 658</td><td> GACAGCACT</td><td> 1595</td><td> ACAGCACT</td><td> 2532</td><td> CAGCACT</td><td> 3469</td>

<td> hsa-miR-512-5p</td><td> CACÜCAGCCOUGAGGGCACÜUUC</td><td> 659</td><td> AGGCTGAGT</td><td> 1596</td><td> GGCTGAGT</td><td> 2533</td><td> GCTGAGT</td><td> 3470</td>

<td> hsa-miR-513a-3p</td><td> OAAAUUUCACCUUUCUGAGAAGG</td><td> 660</td><td> GTGAAATTT</td><td> 1597</td><td> TGAAATTT</td><td> 2534</td><td> GAAATTT</td><td> 3471</td>

<td> hsa-miR-513a-5p</td><td> UUCACAGGGAGGÜGUCAU</td><td> 661</td><td> TCCCTGTGA</td><td> 1598</td><td> CCCTGTGA</td><td> 2535</td><td> CCTGTGA</td><td> 3472</td>

<td> hsa-miR-513b</td><td> UUCACAAGGAGGUGUCAÜÜUAÜ</td><td> 662</td><td> TCCTTGTGA</td><td> 1599</td><td> CCTTGTGA</td><td> 2536</td><td> CTTGTGA</td><td> 3473</td>

<td> hsa-miR-513c</td><td> UUCUCAAGGAGGUGÜCGUUUAU</td><td> 663</td><td> TCCTTGAGA</td><td> 1600</td><td> CCTTGAGA</td><td> 2537</td><td> CTTGAGA</td><td> 3474</td>

<td> hsa-miR-514</td><td> AOUGACACUUCÜGUGAGOAGA</td><td> 664</td><td> AAGTGTCAA</td><td> 1601</td><td> AGTGTCAA</td><td> 2538</td><td> GTGTCAA</td><td> 3475</td>

<td> hsa-miR-515-3p</td><td> GAGOGCCüüCUUUUGGAGCGOO</td><td> 665</td><td> GAAGGCACT</td><td> 1602</td><td> AAGGCACT</td><td> 2539</td><td> AGGCACT</td><td> 3476</td>

<td> hsa-miR-515-5p</td><td> OÜCÜCCAAAAGAAAGCACÜÜÜCÜG</td><td> 666</td><td> TTTTGGAGA</td><td> 1603</td><td> TTTGGAGA</td><td> 2540</td><td> TTGGAGA</td><td> 3477</td>

<td> hsa-miR-516a-3p</td><td> OGCUUCCOÜOCAGAGGGÜ</td><td> 667</td><td> AAAGGAAGC</td><td> 1604</td><td> AAGGAAGC</td><td> 2541</td><td> AGGAAGC</td><td> 3478</td>

<td> hsa-miR-516a-5p</td><td> UÜCUCGAGGAAAGAAGCACOUOC</td><td> 668</td><td> TCCTCGAGA</td><td> 1605</td><td> CCTCGAGA</td><td> 2542</td><td> CTCGAGA</td><td> 3479</td>

<td> hsa-miR-516b</td><td> AÜCUGGAGGOAAGAAGCACUUÜ</td><td> 669</td><td> ACCTCCAGA</td><td> 1606</td><td> CCTCCAGA</td><td> 2543</td><td> CTCCAGA</td><td> 3480</td>

<td> hsa-miR-517*</td><td> CCÜCOAGAÜGGAAGCACÜGOCO</td><td> 670</td><td> CATCTAGAG</td><td> 1607</td><td> ATCTAGAG</td><td> 2544</td><td> TCTAGAG</td><td> 3481</td>

<td> hsa-miR-517a</td><td> AÜCGÜGCAUCCCÜUUAGAGÜGO</td><td> 671</td><td> GATGCACGA</td><td> 1608</td><td> ATGCACGA</td><td> 2545</td><td> TGCACGA</td><td> 3482</td>

<td> hsa-miR-517b</td><td> ÜCGÜGCAUCCCUUÜAGAGUGÜO</td><td> 672</td><td> GGATGCACG</td><td> 1609</td><td> GATGCACG</td><td> 2546</td><td> ATGCACG</td><td> 3483</td>

<td> hsa-miR-517c</td><td> AÜCGÜGCAUCCUÜÜOAGAGOGO</td><td> 673</td><td> GATGCACGA</td><td> 1610</td><td> ATGCACGA</td><td> 2547</td><td> TGCACGA</td><td> 3484</td>

<td> hsa-miR-518a-3p</td><td> GAAAGCGCUUCCCOÜÜGCUGGA</td><td> 674</td><td> AAGCGCTTT</td><td> 1611</td><td> AGCGCTTT</td><td> 2548</td><td> GCGCTTT</td><td> 3485</td>

<td> hsa-miR-518b</td><td> CAAAGCGCUCCCCOUUAGAGGÜ</td><td> 675</td><td> GAGCGCTTT</td><td> 1612</td><td> AGCGCTTT</td><td> 2549</td><td> GCGCTTT</td><td> 3486</td>

<td> hsa-miR-518c</td><td> CAAAGCGCOUCÜCÜUUAGAGOGU</td><td> 676</td><td> AAGCGCTTT</td><td> 1613</td><td> AGCGCTTT</td><td> 2550</td><td> GCGCTTT</td><td> 3487</td>

<td> hsa-miR-518c*</td><td> ÜCUCOGGAGGGAAGCACÜUÜCOG</td><td> 677</td><td> CCTCCAGAG</td><td> 1614</td><td> CTCCAGAG</td><td> 2551</td><td> TCCAGAG</td><td> 3488</td>

<td> hsa-miR-518d-3p</td><td> CAAAGCGCUOCCCUUÜGGAGC</td><td> 678</td><td> AAGCGCTTT</td><td> 1615</td><td> AGCGCTTT</td><td> 2552</td><td> GCGCTTT</td><td> 3489</td>

<td> hsa-miR-518d-5p</td><td> CUCÜAGAGGGAAGCACÜÜUCÜG</td><td> 679</td><td> CCCTCTAGA</td><td> 1616</td><td> CCTCTAGA</td><td> 2553</td><td> CTCTAGA</td><td> 3490</td>

<td> hsa-miR-518e</td><td> AAAGCGCÜUCCCÜÜCAGAGÜG</td><td> 680</td><td> GAAGCGCTT</td><td> 1617</td><td> AAGCGCTT</td><td> 2554</td><td> AGCGCTT</td><td> 3491</td>

<td> hsa-miR-518f</td><td> GAAAGCGCOOCUCÜUUAGAGG</td><td> 681</td><td> AAGCGCTTT</td><td> 1618</td><td> AGCGCTTT</td><td> 2555</td><td> GCGCTTT</td><td> 3492</td>

<td> hsa-miR-518f*</td><td> CUCUAGAGGGAAGCACOÜUCÜC</td><td> 682</td><td> CCCTCTAGA</td><td> 1619</td><td> CCTCTAGA</td><td> 2556</td><td> CTCTAGA</td><td> 3493</td>

<td> hsa-miR-519a</td><td> AAAGUGCAUCCUUÜUAGAGOGO</td><td> 683</td><td> GATGCACTT</td><td> 1620</td><td> ATGCACTT</td><td> 2557</td><td> TGCACTT</td><td> 3494</td>

<td> hsa-miR-519a*</td><td> CÜCOAGAGGGAAGCGCUÜOCUG</td><td> 684</td><td> CCCTCTAGA</td><td> 1621</td><td> CCTCTAGA</td><td> 2558</td><td> CTCTAGA</td><td> 3495</td>

<td> hsa-miR-519b-3p</td><td> AAAGOGCAUCCÜÜUOAGAGGÜU</td><td> 685</td><td> GATGCACTT</td><td> 1622</td><td> ATGCACTT</td><td> 2559</td><td> TGCACTT</td><td> 3496</td>

<td> hsa-miR-519c-3p</td><td> AAAGOGCAÜCÜUOÜUAGAGGAO</td><td> 686</td><td> GATGCACTT</td><td> 1623</td><td> ATGCACTT</td><td> 2560</td><td> TGCACTT</td><td> 3497</td>

<td> hsa-miR-519d</td><td> CAAAGÜGCCUCCCOUUAGAGÜG</td><td> 687</td><td> AGGCACTTT</td><td> 1624</td><td> GGCACTTT</td><td> 2561</td><td> GCACTTT</td><td> 3498</td>

<td> hsa-miR-519e</td><td> AAGUGCCOCCUÜOUAGAGÜGÜO</td><td> 688</td><td> GGAGGCACT</td><td> 1625</td><td> GAGGCACT</td><td> 2562</td><td> AGGCACT</td><td> 3499</td>

<td> hsa-miR-519e*</td><td> UUCUCCAAAAGGGAGCACÜÜOC</td><td> 689</td><td> TTTTGGAGA</td><td> 1626</td><td> TTTGGAGA</td><td> 2563</td><td> TTGGAGA</td><td> 3500</td>

<td> hsa-miR-S20a-3p</td><td> AAAGÜGCUUCCCOUUGGACÜGÜ</td><td> 690</td><td> GAAGCACTT</td><td> 1627</td><td> AAGCACTT</td><td> 2564</td><td> AGCACTT</td><td> 3501</td>

<td> hsa-miR-520a-5p</td><td> COCCAGAGGGAAGÜACUUÜCO</td><td> 691</td><td> CCCTCTGGA</td><td> 1628</td><td> CCTCTGGA</td><td> 2565</td><td> CTCTGGA</td><td> 3502</td>

<td> hsa-miR-520b</td><td> AAAGOGCUÜCCOOUUAGAGGG</td><td> 692</td><td> GAAGCACTT</td><td> 1629</td><td> AAGCACTT</td><td> 2566</td><td> AGCACTT</td><td> 3503</td>

<td> hsa-miR-520c-3p</td><td> AAAGÜGCUÜCCÜÜUUAGAGGGÜ</td><td> 693</td><td> GAAGCACTT</td><td> 1630</td><td> AAGCACTT</td><td> 2567</td><td> AGCACTT</td><td> 3504</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

102

<td> hsa-miR-520d-3p</td><td> AAAGÜGCOÜCUCOUOGGUGGGO</td><td> 694</td><td> GAAGCACTT</td><td> 1631</td><td> AAGCACTT</td><td> 2568</td><td> AGCACTT</td><td> 3505</td>

<td> hsa-miR-520d-5p</td><td> CUACAAAGGGAAGCCCÜÜDC</td><td> 695</td><td> CCCTTTGTA</td><td> 1632</td><td> CCTTTGTA</td><td> 2569</td><td> CTTTGTA</td><td> 3506</td>

<td> hsa-miR-520e</td><td> AAAGUGCÜUCCÜUUOUGAGGG</td><td> 696</td><td> GAAGCACTT</td><td> 1633</td><td> AAGCACTT</td><td> 2570</td><td> AGCACTT</td><td> 3507</td>

<td> hsa-miR-520f</td><td> AAGÜGCÜUCCUÜOUAGAGGGOÜ</td><td> 697</td><td> GGAAGCACT</td><td> 1634</td><td> GAAGCACT</td><td> 2571</td><td> AAGCACT</td><td> 3508</td>

<td> hsa-miR-520g</td><td> ACAAAGOGCUUCCCOUUAGAGUGU</td><td> 698</td><td> AGCACTTTG</td><td> 1635</td><td> GCACTTTG</td><td> 2572</td><td> CACTTTG</td><td> 3509</td>

<td> hsa-miR-520h</td><td> ACAAAGOGCOUCCCUUUAGAGO</td><td> 699</td><td> AGCACTTTG</td><td> 1636</td><td> GCACTTTG</td><td> 2573</td><td> CACTTTG</td><td> 3510</td>

<td> hsa-miR-521</td><td> AACGCACOOCCCOUUAGAGÜGÜ</td><td> 700</td><td> GAAGTGCGT</td><td> 1637</td><td> AAGTGCGT</td><td> 2574</td><td> AGTGCGT</td><td> 3511</td>

<td> hsa-miR-522</td><td> AAAAÜGGOÜCCCUUUAGAGUGO</td><td> 701</td><td> GAACCATTT</td><td> 1638</td><td> AACCATTT</td><td> 2575</td><td> ACCATTT</td><td> 3512</td>

<td> hsa-miR-523</td><td> GAACGCGCÜUCCCÜAÜAGAGGGÜ</td><td> 702</td><td> AAGCGCGTT</td><td> 1639</td><td> AGCGCGTT</td><td> 2576</td><td> GCGCGTT</td><td> 3513</td>

<td> hsa-miR-524-3p</td><td> GAAGGCGCÜÜCCCUUUGGAGU</td><td> 703</td><td> AAGCGCCTT</td><td> 1640</td><td> AGCGCCTT</td><td> 2577</td><td> GCGCCTT</td><td> 3514</td>

<td> hsa-miR-524-5p</td><td> CÜACAAAGGGAAGCACÜUÜCOC</td><td> 704</td><td> CCCTTTGTA</td><td> 1641</td><td> CCTTTGTA</td><td> 2578</td><td> CTTTGTA</td><td> 3515</td>

<td> hsa-miR-525-3p</td><td> GAAGGCGCÜUCCCUUUAGAGCG</td><td> 705</td><td> AAGCGCCTT</td><td> 1642</td><td> AGCGCCTT</td><td> 2579</td><td> GCGCCTT</td><td> 3516</td>

<td> hsa-miR-525-5p</td><td> CÜCCAGAGGGAOGCACUOUCO</td><td> 706</td><td> CCCTCTGGA</td><td> 1643</td><td> CCTCTGGA</td><td> 2580</td><td> CTCTGGA</td><td> 3517</td>

<td> hsa-miR-526b</td><td> CUCÜÜGAGGGAAGCACOOÜCÜGU</td><td> 707</td><td> CCCTCAAGA</td><td> 1644</td><td> CCTCAAGA</td><td> 2581</td><td> CTCAAGA</td><td> 3518</td>

<td> hsa-miR-526b*</td><td> GAAAGOGCOUCCÜUUUAGAGGC</td><td> 708</td><td> AAGCACTTT</td><td> 1645</td><td> AGCACTTT</td><td> 2582</td><td> GCACTTT</td><td> 3519</td>

<td> hsa-miR-527</td><td> CUGCAAAGGGAAGCCCUUUC</td><td> 709</td><td> CCCTTTGCA</td><td> 1646</td><td> CCTTTGCA</td><td> 2583</td><td> CTTTGCA</td><td> 3520</td>

<td> hsa-miR-532-3p</td><td> CCUCCCACACCCAAGGCUUGCA</td><td> 710</td><td> GTGTGGGAG</td><td> 1647</td><td> TGTGGGAG</td><td> 2584</td><td> GTGGGAG</td><td> 3521</td>

<td> hsa-miR-532-5p</td><td> CAUGCCUUGAGOGOAGGACCGU</td><td> 711</td><td> TCAAGGCAT</td><td> 1648</td><td> CAAGGCAT</td><td> 2585</td><td> AAGGCAT</td><td> 3522</td>

<td> hsa-miR-539</td><td> GGAGAAAOUAÜCCOUGGOGÜGO</td><td> 712</td><td> TAATTTCTC</td><td> 1649</td><td> AATTTCTC</td><td> 2586</td><td> ATTTCTC</td><td> 3523</td>

<td> hsa-miR-541</td><td> UGGOGGGCACAGAAÜCOGGACU</td><td> 713</td><td> GTGCCCACC</td><td> 1650</td><td> TGCCCACC</td><td> 2587</td><td> GCCCACC</td><td> 3524</td>

<td> hsa-miR-541*</td><td> AAAGGAÜOCUGCOGUCGGUCCCACÜ</td><td> 714</td><td> AGAATCCTT</td><td> 1651</td><td> GAATCCTT</td><td> 2588</td><td> AATCCTT</td><td> 3525</td>

<td> hsa-miR-542-3p</td><td> ÜGUGACAGAOUGAUAACÜGAAA</td><td> 715</td><td> ATCTGTCAC</td><td> 1652</td><td> TCTGTCAC</td><td> 2589</td><td> CTGTCAC</td><td> 3526</td>

<td> hsa-miR-542-5p</td><td> UCGGGGAUCAUCAOGÜCACGAGA</td><td> 716</td><td> TGATCCCCG</td><td> 1653</td><td> GATCCCCG</td><td> 2590</td><td> ATCCCCG</td><td> 3527</td>

<td> hsa-miR-543</td><td> AAACAÜUCGCGGUGCACÜOCUU</td><td> 717</td><td> GCGAATGTT</td><td> 1654</td><td> CGAATGTT</td><td> 2591</td><td> GAATGTT</td><td> 3528</td>

<td> hsa-miR-544</td><td> AUUCÜGCAÜUUÜUAGCAAGUUC</td><td> 718</td><td> AATGCAGAA</td><td> 1655</td><td> ATGCAGAA</td><td> 2592</td><td> TGCAGAA</td><td> 3529</td>

<td> hsa-miR-545</td><td> UCAGCAAACAUÜÜAQÜGOGUGC</td><td> 719</td><td> TGTTTGCTG</td><td> 1656</td><td> GTTTGCTG</td><td> 2593</td><td> TTTGCTG</td><td> 3530</td>

<td> hsa-iuiR-545*</td><td> UCAGUAAAOGUOÜAOOAGAÜGA</td><td> 720</td><td> CATTTACTG</td><td> 1657</td><td> ATTTACTG</td><td> 2594</td><td> TTTACTG</td><td> 3531</td>

<td> hsa-miR-548a-3p</td><td> CAAAACÜGGCAAUÜACOÜUÜGC</td><td> 721</td><td> GCCAGTTTT</td><td> 1658</td><td> CCAGTTTT</td><td> 2595</td><td> CAGTTTT</td><td> 3532</td>

<td> hsa-miR-548a-5p</td><td> AAAAGÜAAOUGCGAGUOOÜACC</td><td> 722</td><td> AATTACTTT</td><td> 1659</td><td> ATTACTTT</td><td> 2596</td><td> TTACTTT</td><td> 3533</td>

<td> hsa-miR-548b-3p</td><td> CAAGAACCOCAGÜOGCÜUÜÜGO</td><td> 723</td><td> GAGGTTCTT</td><td> 1660</td><td> AGGTTCTT</td><td> 2597</td><td> GGTTCTT</td><td> 3534</td>

<td> hsa-miR-548b-5p</td><td> AAAAGUAAUüGüGGüOOÜGGCC</td><td> 724</td><td> AATTACTTT</td><td> 1661</td><td> ATTACTTT</td><td> 2598</td><td> TTACTTT</td><td> 3535</td>

<td> hsa-miR-548c-3p</td><td> CAAAAAOCOCAAÜOACOUÜOGC</td><td> 725</td><td> GAGATTTTT</td><td> 1662</td><td> AGATTTTT</td><td> 2599</td><td> GATTTTT</td><td> 3536</td>

<td> hsa-miR-548c-5p</td><td> AAAAGUAAUOGCGGÜÜUUÜGCC</td><td> 726</td><td> AATTACTTT</td><td> 1663</td><td> ATTACTTT</td><td> 2600</td><td> TTACTTT</td><td> 3537</td>

<td> hsa-miR-548d-3p</td><td> CAAAAACCACAGÜÜUCÜUOOGC</td><td> 727</td><td> GTGGTTTTT</td><td> 1664</td><td> TGGTTTTT</td><td> 2601</td><td> GGTTTTT</td><td> 3538</td>

<td> hsa-miR-548d-5p</td><td> AAAAGÜAAUUGUGGUUUUUGCC</td><td> 728</td><td> AATTACTTT</td><td> 1665</td><td> ATTACTTT</td><td> 2602</td><td> TTACTTT</td><td> 3539</td>

<td> hsa-miR-548e</td><td> AAAAACUGAGACUACUUOUGCA</td><td> 729</td><td> CTCAGTTTT</td><td> 1666</td><td> TCAGTTTT</td><td> 2603</td><td> CAGTTTT</td><td> 3540</td>

<td> hsa-miR-548f</td><td> AAAAACUGOAAOOACUUÜÜ</td><td> 730</td><td> TACAGTTTT</td><td> 1667</td><td> ACAGTTTT</td><td> 2604</td><td> CAGTTTT</td><td> 3541</td>

<td> hsa-miR-548g</td><td> AAAACÜGÜAAUUACOÜUÜGOAC</td><td> 731</td><td> TTACAGTTT</td><td> 1668</td><td> TACAGTTT</td><td> 2605</td><td> ACAGTTT</td><td> 3542</td>

<td> hsa-miR-548h</td><td> AAAAGÜAAOCGCGGÜÜÜÜUGOC</td><td> 732</td><td> GATTACTTT</td><td> 1669</td><td> ATTACTTT</td><td> 2606</td><td> TTACTTT</td><td> 3543</td>

<td> hsa-miR-548i</td><td> AAAAGÜAAÜÜGCGGAUUOÜGCC</td><td> 733</td><td> AATTACTTT</td><td> 1670</td><td> ATTACTTT</td><td> 2607</td><td> TTACTTT</td><td> 3544</td>

<td> hsa-miR-548j</td><td> AAAAGUAAÜÜGCGGOCUOÜGGÜ</td><td> 734</td><td> AATTACTTT</td><td> 1671</td><td> ATTACTTT</td><td> 2608</td><td> TTACTTT</td><td> 3545</td>

<td> hsa-miR-548k</td><td> AAAAGUACÜUGCGGAÜÜUÜGCO</td><td> 735</td><td> AAGTACTTT</td><td> 1672</td><td> AGTACTTT</td><td> 2609</td><td> GTACTTT</td><td> 3546</td>

<td> hsa-miR-5481</td><td> AAAAGUAOUÜGCGGGÜUUUGOC</td><td> 736</td><td> AAATACTTT</td><td> 1673</td><td> AATACTTT</td><td> 2610</td><td> ATACTTT</td><td> 3547</td>

<td> hsa-miR-548m</td><td> CAAAGGÜAUUUGÜGGQUUUÜG</td><td> 737</td><td> AATACCTTT</td><td> 1674</td><td> ATACCTTT</td><td> 2611</td><td> TACCTTT</td><td> 3548</td>

<td> hsa-miR-548n</td><td> CAAAAGUAAUÜGOGGAOUÜOGÜ</td><td> 738</td><td> ATTACTTTT</td><td> 1675</td><td> TTACTTTT</td><td> 2612</td><td> TACTTTT</td><td> 3549</td>

<td> hsa-miR-548o</td><td> CCAAAACÜGCAGUUACUUUUGC</td><td> 739</td><td> GCAGTTTTG</td><td> 1676</td><td> CAGTTTTG</td><td> 2613</td><td> AGTTTTG</td><td> 3550</td>

<td> hsa-miR-548p</td><td> ÜAGCAAAAACUGCAGÜOACUUU</td><td> 740</td><td> GTTTTTGCT</td><td> 1677</td><td> TTTTTGCT</td><td> 2614</td><td> TTTTGCT</td><td> 3551</td>

<td> hsa-miR-549</td><td> UGACAACUAUGGAÜGAGCUCU</td><td> 741</td><td> ATAGTTGTC</td><td> 1678</td><td> TAGTTGTC</td><td> 2615</td><td> AGTTGTC</td><td> 3552</td>

<td> hsa-miR-550</td><td> AGUGCCUGAGGGAGÜAAGAGCCC</td><td> 742</td><td> CTCAGGCAC</td><td> 1679</td><td> TCAGGCAC</td><td> 2616</td><td> CAGGCAC</td><td> 3553</td>

<td> hsa-miR-550*</td><td> ÜGUCOUACÜCCCÜCAGGCACAO</td><td> 743</td><td> GAGTAAGAC</td><td> 1680</td><td> AGTAAGAC</td><td> 2617</td><td> GTAAGAC</td><td> 3554</td>

<td> hsa-miR-551a</td><td> GCGACCCACÜCOÜGGÜÜOCCA</td><td> 744</td><td> AGTGGGTCG</td><td> 1681</td><td> GTGGGTCG</td><td> 2618</td><td> TGGGTCG</td><td> 3555</td>

<td> hsa-miR-551b</td><td> GCGACCCAUACUOGGÜUOCAG</td><td> 745</td><td> TATGGGTCG</td><td> 1682</td><td> ATGGGTCG</td><td> 2619</td><td> TGGGTCG</td><td> 3556</td>

<td> hsa-miR-551b*</td><td> GAAAÜCAAGCGUGGGUGAGACC</td><td> 746</td><td> GCTTGATTT</td><td> 1683</td><td> CTTGATTT</td><td> 2620</td><td> TTGATTT</td><td> 3557</td>

<td> hsa-miR-552</td><td> AACAGGÜGACÜGGUUAGACAA</td><td> 747</td><td> GTCACCTGT</td><td> 1684</td><td> TCACCTGT</td><td> 2621</td><td> CACCTGT</td><td> 3558</td>

<td> hsa-miR-553</td><td> AAAACGGUGAGAÜUUUGUUUU</td><td> 748</td><td> TCACCGTTT</td><td> 1685</td><td> CACCGTTT</td><td> 2622</td><td> ACCGTTT</td><td> 3559</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

103

<td> hsa-miR-554</td><td> GCUAGÜCCUGACUCAGCCAGÜ</td><td> 749</td><td> CAGGACTAG</td><td> 1686</td><td> AGGACTAG</td><td> 2623</td><td> GGACTAG</td><td> 3560</td>

<td> hsa-miR-555</td><td> AGGGOAAGCOGAACCüCUGAU</td><td> 750</td><td> AGCTTACCC</td><td> 1687</td><td> GCTTACCC</td><td> 2624</td><td> CTTACCC</td><td> 3561</td>

<td> hsa-miR-556-3p</td><td> AOAOOACCAUUAGCUCAUCUÜU</td><td> 751</td><td> ATGGTAATA</td><td> 1688</td><td> TGGTAATA</td><td> 2625</td><td> GGTAATA</td><td> 3562</td>

<td> hsa-miR-556-5p</td><td> GAOGAGCÜCAUOGOAAUAOGAG</td><td> 752</td><td> TGAGCTCAT</td><td> 1689</td><td> GAGCTCAT</td><td> 2626</td><td> AGCTCAT</td><td> 3563</td>

<td> hsa-miR-557</td><td> GÜÜUGCACGGGÜGGGCCUÜGÜCÜ</td><td> 753</td><td> CCGTGCAAA</td><td> 1690</td><td> CGTGCAAA</td><td> 2627</td><td> GTGCAAA</td><td> 3564</td>

<td> hsa-miR-558</td><td> UGAGCUGCÜGÜACCAAAAÜ</td><td> 754</td><td> CAGCAGCTC</td><td> 1691</td><td> AGCAGCTC</td><td> 2628</td><td> GCAGCTC</td><td> 3565</td>

<td> hsa-miR-559</td><td> OAAAGUAAAOAÜGCACCAAAA</td><td> 755</td><td> atttacttt</td><td> 1692</td><td> TTTACTTT</td><td> 2629</td><td> TTACTTT</td><td> 3566</td>

<td> hsa-miR-561</td><td> CAAAGUGUAAGAUCCUUGAAGU</td><td> 756</td><td> TTAAACTTT</td><td> 1693</td><td> TAAACTTT</td><td> 2630</td><td> AAACTTT</td><td> 3567</td>

<td> hsa-miR-562</td><td> AAAGUAGCÜGÜACCAUUUGC</td><td> 757</td><td> CAGCTACTT</td><td> 1694</td><td> AGCTACTT</td><td> 2631</td><td> GCTACTT</td><td> 3568</td>

<td> hsa-miR-563</td><td> AGGÜÜGACAUACGUUUCCC</td><td> 758</td><td> ATGTCAACC</td><td> 1695</td><td> TGTCAACC</td><td> 2632</td><td> GTCAACC</td><td> 3569</td>

<td> hsa-miR-564</td><td> AGGCACGGÜGÜCAGCAGGC</td><td> 759</td><td> CACCGTGCC</td><td> 1696</td><td> ACCGTGCC</td><td> 2633</td><td> CCGTGCC</td><td> 3570</td>

<td> hsa-miR-566</td><td> GGGCGCCOGUGAUCCCAAC</td><td> 760</td><td> ACAGGCGCC</td><td> 1697</td><td> CAGGCGCC</td><td> 2634</td><td> AGGCGCC</td><td> 3571</td>

<td> hsa-miR-567</td><td> AGUAUGUÜCUUCCAGGACAGAAC</td><td> 761</td><td> AGAACATAC</td><td> 1698</td><td> GAACATAC</td><td> 2635</td><td> AACATAC</td><td> 3572</td>

<td> hsa-miR-568</td><td> AÜGOAUAAAOGÜAOACACAC</td><td> 762</td><td> ATTTATACA</td><td> 1699</td><td> TTTATACA</td><td> 2636</td><td> TTATACA</td><td> 3573</td>

<td> hsa-miR-569</td><td> AGUÜAAÜGAAUCCUGGAAAGO</td><td> 763</td><td> TTCATTAAC</td><td> 1700</td><td> TCATTAAC</td><td> 2637</td><td> CATTAAC</td><td> 3574</td>

<td> hsa-miR-570</td><td> CGAAAACAGCAAUUACCÜOUGC</td><td> 764</td><td> gctgttttc</td><td> 1701</td><td> CTGTTTTC</td><td> 2638</td><td> TGTTTTC</td><td> 3575</td>

<td> hsa-miR-571</td><td> ÜGAGÜUGGCCAUCUGAGOGAG</td><td> 765</td><td> GGCCAACTC</td><td> 1702</td><td> GCCAACTC</td><td> 2639</td><td> CCAACTC</td><td> 3576</td>

<td> hsa-miR-572</td><td> GÜCCGCUCGGCGGUGGCCCA</td><td> 766</td><td> CCGAGCGGA</td><td> 1703</td><td> CGAGCGGA</td><td> 2640</td><td> GAGCGGA</td><td> 3577</td>

<td> hsa-miR-573</td><td> CÜGAAGOGAÜGÜGÜAACUGAOCAG</td><td> 767</td><td> ATCACTTCA</td><td> 1704</td><td> TCACTTCA</td><td> 2641</td><td> CACTTCA</td><td> 3578</td>

<td> hsa-miR-574-3p</td><td> CACGCUCAÜGCACACACCCACA</td><td> 768</td><td> CATGAGCGT</td><td> 1705</td><td> ATGAGCGT</td><td> 2642</td><td> TGAGCGT</td><td> 3579</td>

<td> hsa-miR-574-5p</td><td> OGAGÜGÜGÜGOGUGOGAGUGOGÜ</td><td> 769</td><td> CACACACTC</td><td> 1706</td><td> ACACACTC</td><td> 2643</td><td> CACACTC</td><td> 3580</td>

<td> hsa-tniR-575</td><td> GAGCCAGOUGGACAGGAGC</td><td> 770</td><td> CAACTGGCT</td><td> 1707</td><td> AACTGGCT</td><td> 2644</td><td> ACTGGCT</td><td> 3581</td>

<td> hsa-miR-57 6-3p</td><td> AAGAUGUGGAAAAAUUGGAAUC</td><td> 771</td><td> TCCACATCT</td><td> 1708</td><td> CCACATCT</td><td> 2645</td><td> CACATCT</td><td> 3582</td>

<td> hsa-miR-57 6-5p</td><td> AUUCÜAAÜOÜCOCCACGUCUOU</td><td> 772</td><td> AAATTAGAA</td><td> 1709</td><td> AATTAGAA</td><td> 2646</td><td> ATTAGAA</td><td> 3583</td>

<td> hsa-miR-577</td><td> OAGAUAAAAOAUUGGUACCUG</td><td> 773</td><td> ATTTTATCT</td><td> 1710</td><td> TTTTATCT</td><td> 2647</td><td> TTTATCT</td><td> 3584</td>

<td> hsa-miR-578</td><td> COUCÜUGÜGCÜCÜAGGAUUGU</td><td> 774</td><td> GCACAAGAA</td><td> 1711</td><td> CACAAGAA</td><td> 2648</td><td> ACAAGAA</td><td> 3585</td>

<td> hsa-miR-579</td><td> ÜOCAUUUGGÜAOAAACCGCGAUU</td><td> 775</td><td> ACCAAATGA</td><td> 1712</td><td> CCAAATGA</td><td> 2649</td><td> CAAATGA</td><td> 3586</td>

<td> hsa-miR-580</td><td> OÜGAGAAÜGAUGAAUCAUÜAGG</td><td> 776</td><td> TCATTCTCA</td><td> 1713</td><td> CATTCTCA</td><td> 2650</td><td> attctca</td><td> 3587</td>

<td> hsa-miR-581</td><td> ÜCOOGÜGUUCÜCUAGAÜCAGU</td><td> 777</td><td> GAACACAAG</td><td> 1714</td><td> AACACAAG</td><td> 2651</td><td> ACACAAG</td><td> 3588</td>

<td> hsa-miR-582-3p</td><td> UAACÜGGÜUGAACAACUGAACC</td><td> 778</td><td> CAACCAGTT</td><td> 1715</td><td> AACCAGTT</td><td> 2652</td><td> ACCAGTT</td><td> 3589</td>

<td> hsa-miR-582-5p</td><td> UUACAGUUGOUCAACCAGÜÜACÜ</td><td> 779</td><td> ACAACTGTA</td><td> 1716</td><td> CAACTGTA</td><td> 2653</td><td> AACTGTA</td><td> 3590</td>

<td> hsa-miR-583</td><td> CAAAGAGGAAGGUCCCAÜUAC</td><td> 780</td><td> TTCCTCTTT</td><td> 1717</td><td> TCCTCTTT</td><td> 2654</td><td> CCTCTTT</td><td> 3591</td>

<td> hsa-miR-584</td><td> UÜAOGGÜUUGCCÜGGGACÜGAG</td><td> 781</td><td> CAAACCATA</td><td> 1718</td><td> AAACCATA</td><td> 2655</td><td> AACCATA</td><td> 3592</td>

<td> hsa-miR-585</td><td> UGGGCGOAUCOGOAUGCUA</td><td> 782</td><td> GATACGCCC</td><td> 1719</td><td> ATACGCCC</td><td> 2656</td><td> TACGCCC</td><td> 3593</td>

<td> hsa-miR-586</td><td> OAÜGCAÜÜGÜAÜÜUOUAGGÜCC</td><td> 783</td><td> ACAATGCAT</td><td> 1720</td><td> CAATGCAT</td><td> 2657</td><td> AATGCAT</td><td> 3594</td>

<td> hsa-miR-587</td><td> OÜÜCCAÜAGGOGAÜGAGOCAC</td><td> 784</td><td> CCTATGGAA</td><td> 1721</td><td> CTATGGAA</td><td> 2658</td><td> TATGGAA</td><td> 3595</td>

<td> hsa-miR-588</td><td> UUGGCCACAAÜGGGOTAGAAC</td><td> 785</td><td> TTGTGGCCA</td><td> 1722</td><td> TGTGGCCA</td><td> 2659</td><td> GTGGCCA</td><td> 3596</td>

<td> hsa-miR-589</td><td> ÜGAGAACCACGUCUGCUCÜGAG</td><td> 786</td><td> GTGGTTCTC</td><td> 1723</td><td> TGGTTCTC</td><td> 2660</td><td> GGTTCTC</td><td> 3597</td>

<td> hsa-miR-589*</td><td> ÜCAGAACAAAUGCCGGÜUCCCAGA</td><td> 787</td><td> TTTGTTCTG</td><td> 1724</td><td> TTGTTCTG</td><td> 2661</td><td> TGTTCTG</td><td> 3598</td>

<td> hsa-miR-590-3p</td><td> UAAtroUUAÜGÜAÜAAGCÜAGÜ</td><td> 788</td><td> CATAAAATT</td><td> 1725</td><td> ΑΤΑΆΑΑΤΤ</td><td> 2662</td><td> TAAAATT</td><td> 3599</td>

<td> hsa-miR-590-5p</td><td> GAGCOUAÜUCAUAAAAGUGCAG</td><td> 789</td><td> GAATAAGCT</td><td> 1726</td><td> AATAAGCT</td><td> 2663</td><td> ATAAGCT</td><td> 3600</td>

<td> hsa-miR-591</td><td> AGACCAÜGGGUÜCUCAOOGU</td><td> 790</td><td> CCCATGGTC</td><td> 1727</td><td> CCATGGTC</td><td> 2664</td><td> CATGGTC</td><td> 3601</td>

<td> hsa-miR-592</td><td> ÜUGÜGÜCAAUAÜGCGAÜGAUGÜ</td><td> 791</td><td> ATTGACACA</td><td> 1728</td><td> TTGACACA</td><td> 2665</td><td> TGACACA</td><td> 3602</td>

<td> hsa-miR-593</td><td> ÜGOCÜCOGCÜGGGGUUÜCU</td><td> 792</td><td> AGCAGAGAC</td><td> 1729</td><td> GCAGAGAC</td><td> 2666</td><td> CAGAGAC</td><td> 3603</td>

<td> hsa-miR-593*</td><td> AGGCACCAGCCAGGCAÜUGCOCAGC</td><td> 793</td><td> GCTGGTGCC</td><td> 1730</td><td> CTGGTGCC</td><td> 2667</td><td> TGGTGCC</td><td> 3604</td>

<td> hsa-miR-595</td><td> GAAGÜGÜGCCGOGGUGÜGUCO</td><td> 794</td><td> GGCACACTT</td><td> 1731</td><td> GCACACTT</td><td> 2668</td><td> CACACTT</td><td> 3605</td>

<td> hsa-miR-596</td><td> AAGCCÜGCCCGGCÜCCÜCGGG</td><td> 795</td><td> GGGCAGGCT</td><td> 1732</td><td> GGCAGGCT</td><td> 2669</td><td> GCAGGCT</td><td> 3606</td>

<td> hsa-miR-597</td><td> UGÜGÜCACÜCGAÜGACCACUGO</td><td> 796</td><td> GAGTGACAC</td><td> 1733</td><td> AGTGACAC</td><td> 2670</td><td> GTGACAC</td><td> 3607</td>

<td> hsa-miR-598</td><td> UACGUCAÜCGÜÜGUCAÜCGUCA</td><td> 797</td><td> CGATGACGT</td><td> 1734</td><td> GATGACGT</td><td> 2671</td><td> ATGACGT</td><td> 3608</td>

<td> hsa-miR-599</td><td> GUOGOGOCAGÜÜÜAUCAAAC</td><td> 798</td><td> CTGACACAA</td><td> 1735</td><td> TGACACAA</td><td> 2672</td><td> GACACAA</td><td> 3609</td>

<td> hsa-miR-600</td><td> ACOOACAGACAAGAGCCUUGCOC</td><td> 799</td><td> GTCTGTAAG</td><td> 1736</td><td> TCTGTAAG</td><td> 2673</td><td> CTGTAAG</td><td> 3610</td>

<td> hsa-miR-601</td><td> OGGOCUAGGAUÜGUÜGGAGGAG</td><td> 800</td><td> TCCTAGACC</td><td> 1737</td><td> CCTAGACC</td><td> 2674</td><td> CTAGACC</td><td> 3611</td>

<td> hsa-miR-602</td><td> GACACGGGCGACAGCUGCGGCCC</td><td> 801</td><td> CGCCCGTGT</td><td> 1738</td><td> GCCCGTGT</td><td> 2675</td><td> CCCGTGT</td><td> 3612</td>

<td> hsa-miR-603</td><td> CACACACÜGCAAOOACÜÜOUGC</td><td> 802</td><td> GCAGTGTGT</td><td> 1739</td><td> CAGTGTGT</td><td> 2676</td><td> AGTGTGT</td><td> 3613</td>

<td> hsa-miR-604</td><td> AGGCOGCGGAAÜÜCAGGAC</td><td> 803</td><td> TCCGCAGCC</td><td> 1740</td><td> CCGCAGCC</td><td> 2677</td><td> CGCAGCC</td><td> 3614</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

104

<td> hsa-miR-605</td><td> UAAAÜCCCAUGGÜGCCUUCUCCU</td><td> 804</td><td> ATGGGATTT</td><td> 1741</td><td> TGGGATTT</td><td> 2678</td><td> GGGATTT</td><td> 3615</td>

<td> hsa-miR-606</td><td> AAACUACUGAAAAUCAAAGAU</td><td> 805</td><td> TCAGTAGTT</td><td> 1742</td><td> CAGTAGTT</td><td> 2679</td><td> AGTAGTT</td><td> 3616</td>

<td> hsa-miR-607</td><td> GUOCAAAUCCAGAUCUAUAAC</td><td> 806</td><td> GGATTTGAA</td><td> 1743</td><td> GATTTGAA</td><td> 2680</td><td> ATTTGAA</td><td> 3617</td>

<td> hsa-miR-608</td><td> AGGGGOGGUGOÜGGGACAGCÜCCGU</td><td> 807</td><td> CACCACCCC</td><td> 1744</td><td> ACCACCCC</td><td> 2681</td><td> CCACCCC</td><td> 3618</td>

<td> hsa-miR-609</td><td> AGGGÜGOUUCUCÜCAOCOCU</td><td> 808</td><td> GAAACACCC</td><td> 1745</td><td> AAACACCC</td><td> 2682</td><td> AACACCC</td><td> 3619</td>

<td> hsa-miR-610</td><td> ÜGAGCUAAAUGOGÜGCÜGGGA</td><td> 809</td><td> ATTTAGCTC</td><td> 1746</td><td> TTTAGCTC</td><td> 2683</td><td> TTAGCTC</td><td> 3620</td>

<td> hsa-miR-611</td><td> GCGAGGACCCCUCGGGGÜCOGAC</td><td> 810</td><td> GGGTCCTCG</td><td> 1747</td><td> GGTCCTCG</td><td> 2684</td><td> GTCCTCG</td><td> 3621</td>

<td> hsa-miR-612</td><td> GCOGGGCAGGGCUUCOGAGCÜCCÜU</td><td> 811</td><td> CCTGCCCAG</td><td> 1748</td><td> CTGCCCAG</td><td> 2685</td><td> TGCCCAG</td><td> 3622</td>

<td> hsa-miR-613</td><td> AGGAAÜGÜUCCUÜCUUUGCC</td><td> 812</td><td> GAACATTCC</td><td> 1749</td><td> AACATTCC</td><td> 2686</td><td> ACATTCC</td><td> 3623</td>

<td> hsa-miR-614</td><td> GAACGCCÜGUUCUUGCCAGGÜGG</td><td> 813</td><td> ACAGGCGTT</td><td> 1750</td><td> CAGGCGTT</td><td> 2687</td><td> AGGCGTT</td><td> 3624</td>

<td> hsa-miR-615-3p</td><td> ÜCCGAGCCUGGGÜCÜCCCUCÜO</td><td> 814</td><td> CAGGCTCGG</td><td> 1751</td><td> AGGCTCGG</td><td> 2688</td><td> GGCTCGG</td><td> 3625</td>

<td> hsa-miR-615-5p</td><td> GGGGGÜCCCCGGÜGCUCGGAUC</td><td> 815</td><td> GGGGACCCC</td><td> 1752</td><td> GGGACCCC</td><td> 2689</td><td> GGACCCC</td><td> 3626</td>

<td> hsa-miR-616</td><td> AGUCAÜÜGGAGGGUOUGAGCAG</td><td> 816</td><td> TCCAATGAC</td><td> 1753</td><td> CCAATGAC</td><td> 2690</td><td> CAATGAC</td><td> 3627</td>

<td> hsa-miR-616*</td><td> ACÜCAAAACCCOUCAGOGACÜU</td><td> 817</td><td> GGTTTTGAG</td><td> 1754</td><td> GTTTTGAG</td><td> 2691</td><td> TTTTGAG</td><td> 3628</td>

<td> hsa-miR-617</td><td> AGACUÜCCCAÜOUGAAGGÜGGC</td><td> 818</td><td> TGGGAAGTC</td><td> 1755</td><td> GGGAAGTC</td><td> 2692</td><td> GGAAGTC</td><td> 3629</td>

<td> hsa-miR-618</td><td> AAACÜCÜACÜUGOCCUUCÜGAGU</td><td> 819</td><td> AGTAGAGTT</td><td> 1756</td><td> GTAGAGTT</td><td> 2693</td><td> TAGAGTT</td><td> 3630</td>

<td> hsa-miR-619</td><td> GACCUGGACAOGOÜÜGÜGCCCAGO</td><td> 820</td><td> TGTCCAGGT</td><td> 1757</td><td> GTCCAGGT</td><td> 2694</td><td> TCCAGGT</td><td> 3631</td>

<td> hsa-miR-620</td><td> AÜGGAGAOAGAOAUAGAAAU</td><td> 821</td><td> CTATCTCCA</td><td> 1758</td><td> TATCTCCA</td><td> 2695</td><td> ATCTCCA</td><td> 3632</td>

<td> hsa-miR-621</td><td> GGCUAGCAACAGCGCUUACCU</td><td> 822</td><td> GTTGCTAGC</td><td> 1759</td><td> TTGCTAGC</td><td> 2696</td><td> TGCTAGC</td><td> 3633</td>

<td> hsa-miR-622</td><td> ACAGUCUGCUGAGGOTGGAGC</td><td> 823</td><td> AGCAGACTG</td><td> 1760</td><td> GCAGACTG</td><td> 2697</td><td> CAGACTG</td><td> 3634</td>

<td> hsa-miR-623</td><td> AUCCCUUGCAGGGGCOGUUGGGü</td><td> 824</td><td> TGCAAGGGA</td><td> 1761</td><td> GCAAGGGA</td><td> 2698</td><td> CAAGGGA</td><td> 3635</td>

<td> hsa-miR-624</td><td> CACAAGGUAUUGGUAUUACCU</td><td> 825</td><td> ATACCTTGT</td><td> 1762</td><td> TACCTTGT</td><td> 2699</td><td> ACCTTGT</td><td> 3636</td>

<td> hsa-miR-624*</td><td> ÜAGUACCAGUACCUUGUGÜÜCA</td><td> 826</td><td> ACTGGTACT</td><td> 1763</td><td> CTGGTACT</td><td> 2700</td><td> TGGTACT</td><td> 3637</td>

<td> hsa-miR-625</td><td> AGGGGGAAAGOOCÜAÜAGUCC</td><td> 827</td><td> CTTTCCCCC</td><td> 1764</td><td> TTTCCCCC</td><td> 2701</td><td> TTCCCCC</td><td> 3638</td>

<td> hsa-miR-625*</td><td> GACUAUAGAACÜÜÜCCCCCÜCA</td><td> 828</td><td> TTCTATAGT</td><td> 17 65</td><td> TCTATAGT</td><td> 2702</td><td> CTATAGT</td><td> 3639</td>

<td> hsa-miR-626</td><td> AGCUGÜCOGAAAAUGUCÜÜ</td><td> 829</td><td> TCAGACAGC</td><td> 1766</td><td> CAGACAGC</td><td> 2703</td><td> AGACAGC</td><td> 3640</td>

<td> hsa-miR-627</td><td> GUGAGOCUCUAAGAAAAGAGGA</td><td> 830</td><td> AGAGACTCA</td><td> 17 67</td><td> GAGACTCA</td><td> 2704</td><td> AGACTCA</td><td> 3641</td>

<td> hsa-miR-628-3p</td><td> UCÜAGUAAGAGOGGCAGÜCGA</td><td> 831</td><td> TCTTACTAG</td><td> 17 68</td><td> CTTACTAG</td><td> 2705</td><td> TTACTAG</td><td> 3642</td>

<td> hsa-miR-628-5p</td><td> AÜGCOGACAUAÜUUACÜAGAGG</td><td> 832</td><td> ATGTCAGCA</td><td> 1769</td><td> TGTCAGCA</td><td> 2706</td><td> GTCAGCA</td><td> 3643</td>

<td> hsa-miR-629</td><td> UGGGUUOACGÜUGGGAGAACO</td><td> 833</td><td> CGTAAACCC</td><td> 1770</td><td> GTAAACCC</td><td> 2707</td><td> TAAACCC</td><td> 3644</td>

<td> hsa-miR-629*</td><td> GOUCUCCCAACGÜAAGCCCAGC</td><td> 834</td><td> TTGGGAGAA</td><td> 1771</td><td> TGGGAGAA</td><td> 2708</td><td> GGGAGAA</td><td> 3645</td>

<td> hsa-miR-630</td><td> AGUAOUCÜGUACCAGGGAAGGO</td><td> 835</td><td> ACAGAATAC</td><td> 1772</td><td> CAGAATAC</td><td> 2709</td><td> AGAATAC</td><td> 3646</td>

<td> hsa-miR-631</td><td> AGACCUGGCCCAGACCUCAGC</td><td> 836</td><td> GGCCAGGTC</td><td> 1773</td><td> GCCAGGTC</td><td> 2710</td><td> CCAGGTC</td><td> 3647</td>

<td> hsa-miR-632</td><td> GÜGUCUGCÜUCCUGOGGGA</td><td> 837</td><td> AAGCAGACA</td><td> 1774</td><td> AGCAGACA</td><td> 2711</td><td> GCAGACA</td><td> 3648</td>

<td> hsa-miR-633</td><td> CUAAOAGUAUCÜACCACAAÜAAA</td><td> 838</td><td> ATACTATTA</td><td> 1775</td><td> TACTATTA</td><td> 2712</td><td> ACTATTA</td><td> 3649</td>

<td> hsa-miR-634</td><td> AACCAGCACCCCAACOOUGGAC</td><td> 839</td><td> GGTGCTGGT</td><td> 1776</td><td> GTGCTGGT</td><td> 2713</td><td> TGCTGGT</td><td> 3650</td>

<td> hsa-miR-635</td><td> ACUOGGGCACüGAAACAAUGUCC</td><td> 840</td><td> GTGCCCAAG</td><td> 1777</td><td> TGCCCAAG</td><td> 2714</td><td> GCCCAAG</td><td> 3651</td>

<td> hsa-miR-636</td><td> ÜGUGCUÜGCUCGÜCCCGCCCGCA</td><td> 841</td><td> AGCAAGCAC</td><td> 1778</td><td> GCAAGCAC</td><td> 2715</td><td> CAAGCAC</td><td> 3652</td>

<td> hsa-miR-637</td><td> ACÜGGGGGCUOÜCGGGCÜCUGCGU</td><td> 842</td><td> AGCCCCCAG</td><td> 1779</td><td> GCCCCCAG</td><td> 2716</td><td> CCCCCAG</td><td> 3653</td>

<td> hsa-miR-638</td><td> AGGGAOCGCGGGCGGGUGGCGGCCÜ</td><td> 843</td><td> CGCGATCCC</td><td> 1780</td><td> GCGATCCC</td><td> 2717</td><td> CGATCCC</td><td> 3654</td>

<td> hsa-miR-639</td><td> AUCGCUGCGGÜOGCGAGCGCUGÜ</td><td> 844</td><td> CCGCAGCGA</td><td> 1781</td><td> CGCAGCGA</td><td> 2718</td><td> GCAGCGA</td><td> 3655</td>

<td> hsa-miR-640</td><td> AUGAOCCAGGAACCUGCCUCÜ</td><td> 845</td><td> CCTGGATCA</td><td> 1782</td><td> CTGGATCA</td><td> 2719</td><td> TGGATCA</td><td> 3656</td>

<td> hsa-miR-641</td><td> AAAGACAÜAGGAÜAGAGUCACCÜC</td><td> 846</td><td> CTATGTCTT</td><td> 1783</td><td> TATGTCTT</td><td> 2720</td><td> ATGTCTT</td><td> 3657</td>

<td> hsa-miR-642</td><td> GUCCCUCUCCAAAÜGÜGÜCÜUG</td><td> 847</td><td> GGAGAGGGA</td><td> 1784</td><td> GAGAGGGA</td><td> 2721</td><td> AGAGGGA</td><td> 3658</td>

<td> hsa-miR-643</td><td> ACUUGUAÜGCUAGCOCAGGÜAG</td><td> 848</td><td> GCATACAAG</td><td> 1785</td><td> CATACAAG</td><td> 2722</td><td> ATACAAG</td><td> 3659</td>

<td> hsa-miR-644</td><td> AGUGUGGCÜUUCUUAGAGC</td><td> 849</td><td> AAGCCACAC</td><td> 1786</td><td> AGCCACAC</td><td> 2723</td><td> GCCACAC</td><td> 3660</td>

<td> hsa-miR-645</td><td> ÜCÜAGGCUGGOACÜGCÜGA</td><td> 850</td><td> CCAGCCTAG</td><td> 1787</td><td> CAGCCTAG</td><td> 2724</td><td> AGCCTAG</td><td> 3661</td>

<td> hsa-miR-646</td><td> AAGCAGCUGCCUCOGAGGC</td><td> 851</td><td> GCAGCTGCT</td><td> 1788</td><td> CAGCTGCT</td><td> 2725</td><td> AGCTGCT</td><td> 3662</td>

<td> hsa-miR-647</td><td> GÜGGCÜGCACUCACUOCCUOC</td><td> 852</td><td> GTGCAGCCA</td><td> 1789</td><td> TGCAGCCA</td><td> 2726</td><td> GCAGCCA</td><td> 3663</td>

<td> hsa-miR~648</td><td> AAGUGUGCAGGGCACOGGU</td><td> 853</td><td> CTGCACACT</td><td> 1790</td><td> TGCACACT</td><td> 2727</td><td> GCACACT</td><td> 3664</td>

<td> hsa-miR-649</td><td> AAACCUGUGOUGUOCAAGAGOC</td><td> 854</td><td> ACACAGGTT</td><td> 1791</td><td> CACAGGTT</td><td> 2728</td><td> ACAGGTT</td><td> 3665</td>

<td> hsa-miR-650</td><td> AGGAGGCAGCGCOCÜCAGGAC</td><td> 855</td><td> GCTGCCTCC</td><td> 1792</td><td> CTGCCTCC</td><td> 2729</td><td> TGCCTCC</td><td> 3666</td>

<td> hsa-miR-651</td><td> UOUAGGAUAAGCUUGACÜÜOÜG</td><td> 856</td><td> TTATCCTAA</td><td> 1793</td><td> TATCCTAA</td><td> 2730</td><td> ATCCTAA</td><td> 3667</td>

<td> hsa-miR-652</td><td> AAUGGCGCCACTAGGGUOGUG</td><td> 857</td><td> TGGCGCCAT</td><td> 1794</td><td> GGCGCCAT</td><td> 2731</td><td> GCGCCAT</td><td> 3668</td>

<td> hsa-miR-653</td><td> GÜGÜÜGAAACAAUCÜCOACÜG</td><td> 858</td><td> GTTTCAACA</td><td> 1795</td><td> TTTCAACA</td><td> 2732</td><td> TTCAACA</td><td> 3669</td>

CA 02701547 2010-04-01

WO 2009/043353

PCI7DK2008/000344

105

<td> hsa-miR-654-3p</td><td> UAUGUCÜGCOGACCAÜCACCÜÜ</td><td> 859</td><td> AGCAGACAT</td><td> 1796</td><td> GCAGACAT</td><td> 2733</td><td> CAGACAT</td><td> 3670</td>

<td> hsa-miR-654-5p</td><td> UGGUGGGCCGCAGAACAÜGÜGC</td><td> 860</td><td> CGGCCCACC</td><td> 1797</td><td> GGCCCACC</td><td> 2734</td><td> GCCCACC</td><td> 3671</td>

<td> hsa-miR-655</td><td> AÜAAÜACAUGGUUAACCÜCUUU</td><td> 861</td><td> CATGTATTA</td><td> 1798</td><td> ATGTATTA</td><td> 2735</td><td> TGTATTA</td><td> 3672</td>

<td> hsa-miR-656</td><td> AAÜAOÜAÜACAGOCAACCÜCÜ</td><td> 862</td><td> GTATAATAT</td><td> 1799</td><td> TATAATAT</td><td> 2736</td><td> ATAATAT</td><td> 3673</td>

<td> hsa-miR-657</td><td> GGCAGGÜUCUCACCCÜCÜCUAGG</td><td> 863</td><td> AGAACCTGC</td><td> 1800</td><td> GAACCTGC</td><td> 2737</td><td> AACCTGC</td><td> 3674</td>

<td> hsa-miR-658</td><td> GGCGGAGGGAAGOAGGUCCGUUGGÜ</td><td> 864</td><td> TCCCTCCGC</td><td> 1801</td><td> CCCTCCGC</td><td> 2738</td><td> CCTCCGC</td><td> 3675</td>

<td> hsa-miR-659</td><td> CUÜGGUUCAGGGAGGGÜCCCCA</td><td> 865</td><td> CTGAACCAA</td><td> 1802</td><td> TGAACCAA</td><td> 2739</td><td> GAACCAA</td><td> 3676</td>

<td> hsa-miR-660</td><td> ÜACCCAÜÜGCAOAÜCGGAGÜUG</td><td> 866</td><td> GCAATGGGT</td><td> 1803</td><td> CAATGGGT</td><td> 2740</td><td> AATGGGT</td><td> 3677</td>

<td> hsa-miR-661</td><td> UGCCUGGGUCUCUGGCCÜGCGCGO</td><td> 867</td><td> GACCCAGGC</td><td> 1804</td><td> ACCCAGGC</td><td> 2741</td><td> CCCAGGC</td><td> 3678</td>

<td> hsa-miR-662</td><td> UCCCACGÜÜGOGGCCCAGCAG</td><td> 868</td><td> CAACGTGGG</td><td> 1805</td><td> AACGTGGG</td><td> 2742</td><td> ACGTGGG</td><td> 3679</td>

<td> hsa-miR-663</td><td> AGGCGGGGCGCCGCGGGACCGC</td><td> 869</td><td> CGCCCCGCC</td><td> 1806</td><td> GCCCCGCC</td><td> 2743</td><td> CCCCGCC</td><td> 3680</td>

<td> hsa-miR-663b</td><td> GGUGGCCCGGCCGÜGCCÜGAGG</td><td> 870</td><td> CCGGGCCAC</td><td> 1807</td><td> CGGGCCAC</td><td> 2744</td><td> GGGCCAC</td><td> 3681</td>

<td> hsa-miR-664</td><td> OAUOCAUUUAÜCCCCAGCCÜACA</td><td> 871</td><td> TAAATGAAT</td><td> 1808</td><td> AAATGAAT</td><td> 2745</td><td> AATGAAT</td><td> 3682</td>

<td> hsa-miR-664*</td><td> ACOGGCÜAGGGAAAAUGAOÜGGAÜ</td><td> 872</td><td> CCTAGCCAG</td><td> 1809</td><td> CTAGCCAG</td><td> 2746</td><td> TAGCCAG</td><td> 3683</td>

<td> hsa-miR-665</td><td> ACCAGGAGGCÜGAGGCCCCÜ</td><td> 873</td><td> GCCTCCTGG</td><td> 1810</td><td> CCTCCTGG</td><td> 2747</td><td> CTCCTGG</td><td> 3684</td>

<td> hsa-miR-668</td><td> OGUCACÜCGGCUCGGCCCACUAC</td><td> 874</td><td> CCGAGTGAC</td><td> 1811</td><td> CGAGTGAC</td><td> 2748</td><td> GAGTGAC</td><td> 3685</td>

<td> hsa-miR-671-3p</td><td> OCCGGOOCOCAGGGCÜCCACC</td><td> 875</td><td> GAGAACCGG</td><td> 1812</td><td> AGAACCGG</td><td> 2749</td><td> GAACCGG</td><td> 3686</td>

<td> hsa-miR-671-5p</td><td> AGGAAGCCCOGGAGGGGCÜGGAG</td><td> 876</td><td> agggcttcc</td><td> 1813</td><td> GGGCTTCC</td><td> 2750</td><td> GGCTTCC</td><td> 3687</td>

<td> hsa-miR-675</td><td> OGGOGCGGAGAGGGCCCACAGÜG</td><td> 877</td><td> CTCCGCACC</td><td> 1814</td><td> TCCGCACC</td><td> 2751</td><td> CCGCACC</td><td> 3688</td>

<td> hsa-miR-675b</td><td> CUGUAUGCCCUCACCGCOCA</td><td> 878</td><td> GGGCATACA</td><td> 1815</td><td> GGCATACA</td><td> 2752</td><td> GCATACA</td><td> 3689</td>

<td> hsa-miR-7</td><td> ÜGGAAGACUAGÜGAÜUUUGUOGÜ</td><td> 879</td><td> TAGTCTTCC</td><td> 1816</td><td> AGTCTTCC</td><td> 2753</td><td> GTCTTCC</td><td> 3690</td>

<td> hsa-miR-7-1*</td><td> CAACAAAÜCACAGÜCÜGCCAOA</td><td> 880</td><td> TGATTTGTT</td><td> 1817</td><td> GATTTGTT</td><td> 2754</td><td> ATTTGTT</td><td> 3691</td>

<td> hsa-miR-7-2*</td><td> CAACAAAÜCCCAGOCÜACCUAA</td><td> 881</td><td> GGATTTGTT</td><td> 1818</td><td> GATTTGTT</td><td> 2755</td><td> ATTTGTT</td><td> 3692</td>

<td> hsa-miR-708</td><td> AAGGAGCÜOACAAUCÜAGCUGGG</td><td> 882</td><td> TAAGCTCCT</td><td> 1819</td><td> aagctcct</td><td> 2756</td><td> AGCTCCT</td><td> 3693</td>

<td> hsa-miR-708*</td><td> CAACÜAGACÜGÜGAGCUUCÜAG</td><td> 883</td><td> AGTCTAGTT</td><td> 1820</td><td> GTCTAGTT</td><td> 2757</td><td> TCTAGTT</td><td> 3694</td>

<td> hsa-miR-720</td><td> UCUCGCUGGGGCCUCCA</td><td> 884</td><td> CCCAGCGAG</td><td> 1821</td><td> CCAGCGAG</td><td> 2758</td><td> CAGCGAG</td><td> 3695</td>

<td> hsa-miR-744</td><td> UGCGGGGCOAGGGCÜAACAGCA</td><td> 885</td><td> TAGCCCCGC</td><td> 1822</td><td> AGCCCCGC</td><td> 2759</td><td> GCCCCGC</td><td> 3696</td>

<td> hsa-miR-744*</td><td> CDGOUGCCACUAACCUCAACCn</td><td> 886</td><td> GTGGCAACA</td><td> 1823</td><td> TGGCAACA</td><td> 2760</td><td> GGCAACA</td><td> 3697</td>

<td> hsa-miR-758</td><td> UUUGÜGACCOGGÜCCACaAACC</td><td> 887</td><td> AGGTCACAA</td><td> 1824</td><td> GGTCACAA</td><td> 2761</td><td> GTCACAA</td><td> 3698</td>

<td> hsa-miR-760</td><td> CGGCÜCUGGGÜCÜGUGGGGA</td><td> 888</td><td> CCCAGAGCC</td><td> 1825</td><td> CCAGAGCC</td><td> 2762</td><td> CAGAGCC</td><td> 3699</td>

<td> hsa-miR-765</td><td> UGGAGGAGAAGGAAGGÜGAÜG</td><td> 889</td><td> TTCTCCTCC</td><td> 1826</td><td> TCTCCTCC</td><td> 2763</td><td> CTCCTCC</td><td> 3700</td>

<td> hsa-miR-766</td><td> ACUCCAGCCCCACAGCCOCAGC</td><td> 890</td><td> GGGCTGGAG</td><td> 1827</td><td> GGCTGGAG</td><td> 2764</td><td> GCTGGAG</td><td> 3701</td>

<td> hsa-miR-7 67-3p</td><td> OCOGCOCAUACCCCAUGGUÜOCU</td><td> 891</td><td> TATGAGCAG</td><td> 1828</td><td> ATGAGCAG</td><td> 2765</td><td> TGAGCAG</td><td> 3702</td>

<td> hsa-miR-7 67-5p</td><td> UGCACCAOGGUUGOCÜGAGCAÜG</td><td> 892</td><td> CCATGGTGC</td><td> 1829</td><td> CATGGTGC</td><td> 2766</td><td> ATGGTGC</td><td> 3703</td>

<td> hsa-miR-7 69-3p</td><td> CÜGGGAÜCÜCCGGGGUCUUGGUU</td><td> 893</td><td> GAGATCCCA</td><td> 1830</td><td> AGATCCCA</td><td> 2767</td><td> GATCCCA</td><td> 3704</td>

<td> hsa-miR-769-5p</td><td> UGAGACCOCOGGGOUCUGAGCU</td><td> 894</td><td> AGAGGTCTC</td><td> 1831</td><td> GAGGTCTC</td><td> 2768</td><td> AGGTCTC</td><td> 3705</td>

<td> hsa-miR-770-5p</td><td> UCCAGÜACCACGUGUCAGGGCCA</td><td> 895</td><td> TGGTACTGG</td><td> 1832</td><td> GGTACTGG</td><td> 2769</td><td> GTACTGG</td><td> 3706</td>

<td> hsa-miR-802</td><td> CAGÜAACAAAGAÜOCAUCCUUGU</td><td> 896</td><td> TTTGTTACT</td><td> 1833</td><td> TTGTTACT</td><td> 2770</td><td> TGTTACT</td><td> 3707</td>

<td> hsa-miR-873</td><td> GCAGGAACÜÜGUGAGUCÜCCÜ</td><td> 897</td><td> AAGTTCCTG</td><td> 1834</td><td> AGTTCCTG</td><td> 2771</td><td> GTTCCTG</td><td> 3708</td>

<td> hsa-miR-874</td><td> CUGCCCOGGCCCGAGGGACCGA</td><td> 898</td><td> GCCAGGGCA</td><td> 1835</td><td> CCAGGGCA</td><td> 2772</td><td> CAGGGCA</td><td> 3709</td>

<td> hsa-miR-875-3p</td><td> CCOGGAAACACUGAGGUOGUG</td><td> 899</td><td> TGTTTCCAG</td><td> 1836</td><td> GTTTCCAG</td><td> 2773</td><td> TTTCCAG</td><td> 3710</td>

<td> hsa-miR-875-5p</td><td> ÜAOACCUCAGOUÜÜAOCAGGUG</td><td> 900</td><td> CTGAGGTAT</td><td> 1837</td><td> TGAGGTAT</td><td> 2774</td><td> GAGGTAT</td><td> 3711</td>

<td> hsa-miR-876-3p</td><td> UGGUGGUUUACAAAGÜAAUUCA</td><td> 901</td><td> TAAACCACC</td><td> 1838</td><td> AAACCACC</td><td> 2775</td><td> AACCACC</td><td> 3712</td>

<td> hsa-miR-87 6-5p</td><td> ÜGGAVUUCUOUGÜGAAÜCACCA</td><td> 902</td><td> AAGAAATCC</td><td> 1839</td><td> AGAAATCC</td><td> 2776</td><td> GAAATCC</td><td> 3713</td>

<td> hsa-miR-877</td><td> GUAGAGGAGAUGGCGCAGGG</td><td> 903</td><td> TCTCCTCTA</td><td> 1840</td><td> CTCCTCTA</td><td> 2777</td><td> TCCTCTA</td><td> 3714</td>

<td> hsa-miR-877*</td><td> UCCUCUUCUCCCOCCOCCCAG</td><td> 904</td><td> GAGAAGAGG</td><td> 1841</td><td> AGAAGAGG</td><td> 2778</td><td> GAAGAGG</td><td> 3715</td>

<td> hsa-miR-885-3p</td><td> AGGCAGCGGGGOGUAGOGGAOA</td><td> 905</td><td> CCCGCTGCC</td><td> 1842</td><td> CCGCTGCC</td><td> 2779</td><td> CGCTGCC</td><td> 3716</td>

<td> hsa-miR-885-5p</td><td> ÜCCAUUACACÜACCCÜGCCUCÜ</td><td> 906</td><td> GTGTAATGG</td><td> 1843</td><td> TGTAATGG</td><td> 2780</td><td> GTAATGG</td><td> 3717</td>

<td> hsa~miR-886-3p</td><td> CGCGGGÜGCUÜACUGACCCUÜ</td><td> 907</td><td> AGCACCCGC</td><td> 1844</td><td> GCACCCGC</td><td> 2781</td><td> CACCCGC</td><td> 3718</td>

<td> hsa-miR-886-5p</td><td> CGGGÜCGGAGUÜAGCÜCAAGCGG</td><td> 908</td><td> CTCCGACCC</td><td> 1845</td><td> TCCGACCC</td><td> 2782</td><td> CCGACCC</td><td> 3719</td>

<td> hsa-miR-887</td><td> GüGAACGGGCGCCAUCCCGAGG</td><td> 909</td><td> GCCCGTTCA</td><td> 1846</td><td> CCCGTTCA</td><td> 2783</td><td> CCGTTCA</td><td> 3720</td>

<td> hsa-miR-888</td><td> OACUCAAAAAGCÜGUCAGUCA</td><td> 910</td><td> TTTTTGAGT</td><td> 1847</td><td> TTTTGAGT</td><td> 2784</td><td> TTTGAGT</td><td> 3721</td>

<td> hsa-miR-888*</td><td> GACOGACACCUCUUÜGGGOGAA</td><td> 911</td><td> GGTGTCAGT</td><td> 1848</td><td> GTGTCAGT</td><td> 2785</td><td> TGTCAGT</td><td> 3722</td>

<td> hsa-miR-889</td><td> UOAAUAOCGGACAACCAOUGU</td><td> 912</td><td> CCGATATTA</td><td> 1849</td><td> CGATATTA</td><td> 2786</td><td> GATATTA</td><td> 3723</td>

<td> hsa-miR-890</td><td> UACÜUGGAAAGGCAUCAGÜUG</td><td> 913</td><td> TTTCCAAGT</td><td> 1850</td><td> TTCCAAGT</td><td> 2787</td><td> TCCAAGT</td><td> 3724</td>

CA 02701547 2010-04-01

WO 2009/043353

PCI7DK2008/000344

106

<td> tisa-miR-891a</td><td> ÜGCAACGAACCUGAGCCACÜ GA</td><td> 914</td><td> GTTCGTTGC</td><td> 1851</td><td> TTCGTTGC</td><td> 2788</td><td> TCGTTGC</td><td> 3725</td>

<td> hsa-miR-891b</td><td> UGCAACÜUACCUGAGUCAUÜGA</td><td> 915</td><td> GTAAGTTGC</td><td> 1852</td><td> TAAGTTGC</td><td> 2789</td><td> AAGTTGC</td><td> 3726</td>

<td> hsa-miR-892a</td><td> CACÜGOGUCCÜUUCUGCGOAG</td><td> 916</td><td> GGACACAGT</td><td> 1853</td><td> GACACAGT</td><td> 2790</td><td> ACACAGT</td><td> 3727</td>

<td> hsa-miR-892b</td><td> CACUGGCUCCÜUUCUGGGOAGA</td><td> 917</td><td> GGAGCCAGT</td><td> 1854</td><td> GAGCCAGT</td><td> 2791</td><td> AGCCAGT</td><td> 3728</td>

<td> hsa-iaiR-9</td><td> UCÜUUGGUÜAÜCUAGCUGUAUGA</td><td> 918</td><td> TAACCAAAG</td><td> 1855</td><td> AACCAAAG</td><td> 2792</td><td> ACCAAAG</td><td> 3729</td>

<td> hsa-miR-9*</td><td> AÜAAAGCUAGAÜAACCGAAAGÜ</td><td> 919</td><td> CTAGCTTTA</td><td> 1856</td><td> TAGCTTTA</td><td> 2793</td><td> AGCTTTA</td><td> 3730</td>

<td> hsa-miR-920</td><td> GGGGAGCÜGÜGGAAGCAGUA</td><td> 920</td><td> ACAGCTCCC</td><td> 1857</td><td> CAGCTCCC</td><td> 2794</td><td> AGCTCCC</td><td> 3731</td>

<td> hsa-miR-921</td><td> CÜAGÜGAGGGACAGAACCAGGAÜÜC</td><td> 921</td><td> CCCTCACTA</td><td> 1858</td><td> CCTCACTA</td><td> 2795</td><td> CTCACTA</td><td> 3732</td>

<td> hsa-miR-922</td><td> GCAGCAGAGAAUAGGACUACGÜC</td><td> 922</td><td> TCTCTGCTG</td><td> 1859</td><td> CTCTGCTG</td><td> 2796</td><td> TCTGCTG</td><td> 3733</td>

<td> hsa-miR-923</td><td> GUCAGCGGAGGAAAAGAAACÜ</td><td> 923</td><td> CTCCGCTGA</td><td> 1860</td><td> TCCGCTGA</td><td> 2797</td><td> CCGCTGA</td><td> 3734</td>

<td> hsa-miR-924</td><td> AGAGÜCÜUGÜGAOGOCUUGC</td><td> 924</td><td> ACAAGACTC</td><td> 1861</td><td> CAAGACTC</td><td> 2798</td><td> AAGACTC</td><td> 3735</td>

<td> hsa-miR-92a</td><td> UAOÜGCACÜOGÜCCCGGCCUGU</td><td> 925</td><td> AAGTGCAAT</td><td> 1862</td><td> AGTGCAAT</td><td> 2799</td><td> GTGCAAT</td><td> 3736</td>

<td> hsa-miR-92a-l*</td><td> AGGUÜGGGAUCGGUÜGCAAUGCU</td><td> 926</td><td> ATCCCAACC</td><td> 1863</td><td> TCCCAACC</td><td> 2800</td><td> CCCAACC</td><td> 3737</td>

<td> hsa-miR-92a-2*</td><td> GGGÜGGGGAOÜÜGUÜGCAUÜAC</td><td> 927</td><td> ATCCCCACC</td><td> 1864</td><td> TCCCCACC</td><td> 2801</td><td> CCCCACC</td><td> 3738</td>

<td> hsa-miR-92b</td><td> UAÜÜGCACÜCGÜCCCGGCCOCC</td><td> 928</td><td> GAGTGCAAT</td><td> 1865</td><td> AGTGCAAT</td><td> 2802</td><td> GTGCAAT</td><td> 3739</td>

<td> hsa-miR-92b*</td><td> AGGGACGGGACGCGGOGCAGÜG</td><td> 929</td><td> TCCCGTCCC</td><td> 1866</td><td> CCCGTCCC</td><td> 2803</td><td> CCGTCCC</td><td> 3740</td>

<td> hsa-miR-93</td><td> CAAAGOGCUGÜUCGÜGCAGGUAG</td><td> 930</td><td> CAGCACTTT</td><td> 1867</td><td> AGCACTTT</td><td> 2804</td><td> GCACTTT</td><td> 3741</td>

<td> hsa-miR-93*</td><td> ACÜGCUGAGCÜAGCACÜUCCCG</td><td> 931</td><td> GCTCAGCAG</td><td> 1868</td><td> CTCAGCAG</td><td> 2805</td><td> TCAGCAG</td><td> 3742</td>

<td> hsa-miR-933</td><td> UGÜGCGCAGGGAGACCÜCUCCC</td><td> 932</td><td> CCTGCGCAC</td><td> 1869</td><td> CTGCGCAC</td><td> 2806</td><td> TGCGCAC</td><td> 3743</td>

<td> hsa-miR-934</td><td> UGOCUACUACUGGAGACACüGG</td><td> 933</td><td> GTAGTAGAC</td><td> 1870</td><td> TAGTAGAC</td><td> 2807</td><td> AGTAGAC</td><td> 3744</td>

<td> hsa-miR-935</td><td> CCAGÜUACCGCUUCCGCUACCGC</td><td> 934</td><td> CGGTAACTG</td><td> 1871</td><td> GGTAACTG</td><td> 2808</td><td> GTAACTG</td><td> 3745</td>

<td> hsa-miR-936</td><td> ACAGÜAGAGGGAGGAAUCGCAG</td><td> 935</td><td> CCTCTACTG</td><td> 1872</td><td> CTCTACTG</td><td> 2809</td><td> TCTACTG</td><td> 3746</td>

<td> hsa-miR-937</td><td> AUCCGCGCOCÜGACUCÜCUGCC</td><td> 936</td><td> GAGCGCGGA</td><td> 1873</td><td> AGCGCGGA</td><td> 2810</td><td> GCGCGGA</td><td> 3747</td>

<td> hsa-miR-938</td><td> UGCCCUOAAAGGOGAACCCAGÜ</td><td> 937</td><td> TTTAAGGGC</td><td> 1874</td><td> TTAAGGGC</td><td> 2811</td><td> TAAGGGC</td><td> 3748</td>

<td> hsa-miR-939</td><td> ÜGGGGAGCUGAGGCÜCÜGGGGGÛG</td><td> 938</td><td> CAGCTCCCC</td><td> 1875</td><td> AGCTCCCC</td><td> 2812</td><td> GCTCCCC</td><td> 3749</td>

<td> hsa-miR-940</td><td> AAGGCAGGGCCCCCGCÜCCCC</td><td> 939</td><td> GCCCTGCCT</td><td> 1876</td><td> CCCTGCCT</td><td> 2813</td><td> CCTGCCT</td><td> 3750</td>

<td> hsa-miR-941</td><td> CACCCGGCUGUGOGCACAÜGÜGC</td><td> 940</td><td> CAGCCGGGT</td><td> 1877</td><td> AGCCGGGT</td><td> 2814</td><td> GCCGGGT</td><td> 3751</td>

<td> hsa-miR-942</td><td> ÜCOUCÜCÜGÜUOUGGCCAOGOG</td><td> 941</td><td> ACAGAGAAG</td><td> 1878</td><td> CAGAGAAG</td><td> 2815</td><td> AGAGAAG</td><td> 3752</td>

<td> hsa-miR-943</td><td> COGACUGUOGCCGUCCüCCAG</td><td> 942</td><td> CAACAGTCA</td><td> 1879</td><td> AACAGTCA</td><td> 2816</td><td> ACAGTCA</td><td> 3753</td>

<td> hsa-miR-944</td><td> AAAOOAÜUGUACAUCGGAUGAG</td><td> 943</td><td> ACAATAATT</td><td> 1880</td><td> CAATAATT</td><td> 2817</td><td> AATAATT</td><td> 3754</td>

<td> hsa-miR-95</td><td> ÜOCAACGGGUAUUUAUUGAGCA</td><td> 944</td><td> ACCCGTTGA</td><td> 1881</td><td> CCCGTTGA</td><td> 2818</td><td> CCGTTGA</td><td> 3755</td>

<td> hsa-miR-96</td><td> ÜUUGGCACÜAGCACAOUUUÜGCÜ</td><td> 945</td><td> TAGTGCCAA</td><td> 1882</td><td> AGTGCCAA</td><td> 2819</td><td> GTGCCAA</td><td> 3756</td>

<td> hsa-miR-96*</td><td> AAUCAUGUGCAGOGCCAAUAOG</td><td> 946</td><td> GCACATGAT</td><td> 1883</td><td> CACATGAT</td><td> 2820</td><td> ACATGAT</td><td> 3757</td>

<td> hsa-miR-98</td><td> UGAGGOAGUAAGÜÜGÜAOÜGÜO</td><td> 947</td><td> TACTACCTC</td><td> 1884</td><td> ACTACCTC</td><td> 2821</td><td> CTACCTC</td><td> 3758</td>

<td> hsa-miR-99a</td><td> AACCCGOAGAÜCCGAUCUUGUG</td><td> 948</td><td> TCTACGGGT</td><td> 1885</td><td> CTACGGGT</td><td> 2822</td><td> TACGGGT</td><td> 3759</td>

<td> hsa-miR-99a*</td><td> CAAGCÜCGCÜÜCOAÜGGGUCUG</td><td> 949</td><td> AGCGAGCTT</td><td> 1886</td><td> GCGAGCTT</td><td> 2823</td><td> CGAGCTT</td><td> 3760</td>

<td> hsa-miR-99b</td><td> CACCCGUAGAACCGACCÜÜGCG</td><td> 950</td><td> TCTACGGGT</td><td> 1887</td><td> CTACGGGT</td><td> 2824</td><td> TACGGGT</td><td> 3761</td>

<td> hsa-miR-99b*</td><td> CAAGCUCGUGUCUGUGGGÜCCG</td><td> 951</td><td> CACGAGCTT</td><td> 1888</td><td> ACGAGCTT</td><td> 2825</td><td> CGAGCTT</td><td> 3762</td>

<td> hsvl-miR-Hl</td><td> ÜGGAAGGACGGGAAGÜGGAAG</td><td> 952</td><td> CGTCCTTCC</td><td> 1889</td><td> GTCCTTCC</td><td> 2826</td><td> TCCTTCC</td><td> 3763</td>

<td> hsvl-miR-H2-3p</td><td> CCOGAGCCAGGGACGAGUGCGACU</td><td> 953</td><td> CTGGCTCAG</td><td> 1890</td><td> TGGCTCAG</td><td> 2827</td><td> GGCTCAG</td><td> 3764</td>

<td> hsvl-miR-H2-5p</td><td> UCGCACGCGCCCGGCACAGACO</td><td> 954</td><td> GCGCGTGCG</td><td> 1891</td><td> CGCGTGCG</td><td> 2828</td><td> GCGTGCG</td><td> 3765</td>

<td> hsvl-miR-H3</td><td> COGGGACUGUGCGGÜUGGGA</td><td> 955</td><td> ACAGTCCCA</td><td> 1892</td><td> CAGTCCCA</td><td> 2829</td><td> AGTCCCA</td><td> 3766</td>

<td> hsvl-miR-H4-3p</td><td> CÜUGCCÜGOCUAACÜCGCÜAGU</td><td> 956</td><td> GACAGGCAA</td><td> 1893</td><td> ACAGGCAA</td><td> 2830</td><td> CAGGCAA</td><td> 3767</td>

<td> hsvl-miR-H4-5p</td><td> GGOAGAGÜOOGACAGGCAAGCA</td><td> 957</td><td> AAACTCTAC</td><td> 1894</td><td> AACTCTAC</td><td> 2831</td><td> ACTCTAC</td><td> 3768</td>

<td> hsvl-miR-H5</td><td> GOCAGAGAÜCCAAACCCUCCGG</td><td> 958</td><td> GATCTCTGA</td><td> 1895</td><td> ATCTCTGA</td><td> 2832</td><td> TCTCTGA</td><td> 3769</td>

<td> hsvl-miR-H6</td><td> CACOOCCCGüCCOÜCCAUCCC</td><td> 959</td><td> ACGGGAAGT</td><td> 1896</td><td> CGGGAAGT</td><td> 2833</td><td> GGGAAGT</td><td> 3770</td>

<td> kshv-miR-K12-l</td><td> AÜÜACAGGAAACÜGGGÜGÜAAGC</td><td> 960</td><td> TTCCTGTAA</td><td> 1897</td><td> TCCTGTAA</td><td> 2834</td><td> CCTGTAA</td><td> 3771</td>

<td> kshv-miR-K12-10a</td><td> ÜAGÜGÜUGÜCCCCCCGAGÜGGC</td><td> 961</td><td> GACAACACT</td><td> 1898</td><td> ACAACACT</td><td> 2835</td><td> CAACACT</td><td> 3772</td>

<td> kshv-miR-K12-10b</td><td> UGGÜGOÜGOCCCCCCGAGOGGC</td><td> 962</td><td> GACAACACC</td><td> 1899</td><td> ACAACACC</td><td> 2836</td><td> CAACACC</td><td> 3773</td>

<td> kshv-miR-K12-ll</td><td> UÜAAOGCÜOAGCCOGÜGOCCGA</td><td> 963</td><td> TAAGCATTA</td><td> 1900</td><td> AAGCATTA</td><td> 2837</td><td> AGCATTA</td><td> 3774</td>

<td> kshv-miR-K12-12</td><td> ACCAGGCCACCAOOCCÜCUCCG</td><td> 964</td><td> GTGGCCTGG</td><td> 1901</td><td> TGGCCTGG</td><td> 2838</td><td> GGCCTGG</td><td> 3775</td>

<td> kshv-ra±R-K12-2</td><td> AACUGUAGOCCGGGUCGAÜCUG</td><td> 965</td><td> GACTACAGT</td><td> 1902</td><td> ACTACAGT</td><td> 2839</td><td> CTACAGT</td><td> 3776</td>

<td> kshv-miR-K12-3</td><td> ÜCACAOÜCUGAGGACGGCAGCGA</td><td> 966</td><td> CAGAATGTG</td><td> 1903</td><td> AGAATGTG</td><td> 2840</td><td> GAATGTG</td><td> 3777</td>

<td> kshv-miR-K12-3*</td><td> OCGCGGUCACAGAAÜGÜGACA</td><td> 967</td><td> GTGACCGCG</td><td> 1904</td><td> TGACCGCG</td><td> 2841</td><td> GACCGCG</td><td> 3778</td>

<td> kshv-miR-K12-4-3p</td><td> ÜAGAAÜACUGAGGCCÜAGCÜGA</td><td> 968</td><td> CAGTATTCT</td><td> 1905</td><td> AGTATTCT</td><td> 2842</td><td> GTATTCT</td><td> 3779</td>

CA 02701547 2010-04-01

WO 2009/043353

PCT/DK2008/000344

107

<td> kshv-miR-K12-4-5p</td><td> AGCÜAAACCGCAGUACÜCÜAGG</td><td> 969</td><td> CGGTTTAGC</td><td> 1906</td><td> GGTTTAGC</td><td> 2843</td><td> GTTTAGC</td><td> 3780</td>

<td> kshv-miR-K12-5</td><td> ÜAGGAÜGCCUGGAACÜUGCCGG</td><td> 970</td><td> AGGCATCCT</td><td> 1907</td><td> GGCATCCT</td><td> 2844</td><td> GCATCCT</td><td> 3781</td>

<td> kshv-miR-K12-6-3p</td><td> UGAUGGOÜUUCGGGCUGÜUGAG</td><td> 971</td><td> AAAACCATC</td><td> 1908</td><td> AAACCATC</td><td> 2845</td><td> AACCATC</td><td> 3782</td>

<td> kshv-raiR-K12-6-5p</td><td> CCAGCAGCACCUAAUCCAUCGG</td><td> 972</td><td> GTGCTGCTG</td><td> 1909</td><td> TGCTGCTG</td><td> 2846</td><td> GCTGCTG</td><td> 3783</td>

<td> kshv-miR-K12-7</td><td> UGAUCCCAUGUUGCUGGCGCÜ</td><td> 973</td><td> CATGGGATC</td><td> 1910</td><td> ATGGGATC</td><td> 2847</td><td> TGGGATC</td><td> 3784</td>

<td> kshv-miR-K12-8</td><td> □AGGCGCGACOGAGAGAGCACG</td><td> 974</td><td> GTCGCGCCT</td><td> 1911</td><td> TCGCGCCT</td><td> 2848</td><td> CGCGCCT</td><td> 3785</td>

<td> kshv-miR-K12-9</td><td> COGGGUAUACGCAGCOGCGUAA</td><td> 975</td><td> GTATACCCA</td><td> 1912</td><td> TATACCCA</td><td> 2849</td><td> ATACCCA</td><td> 3786</td>

<td> kshv-miR-K12-9*</td><td> ACCCAGCUGCGOAAACCCCGCU</td><td> 976</td><td> GCAGCTGGG</td><td> 1913</td><td> CAGCTGGG</td><td> 2850</td><td> AGCTGGG</td><td> 3787</td>

108