CA2425208C

Rna aptamers and methods for identifying the same

Abstract

RNA aptamers and methods for identifying the same are disclosed. The RNA aptamers selectively bind coagulation factors, E2F family members, Ang1 or Ang2, and therapeutic and other uses for the RNA aptamers are also disclosed.

CA2425208C, drawing sheet 1 — Sheet 1 of 34

Term

Term ended

Expired 26 September 2021, 5 years ago.

49 claims: 5 independent, 44 dependent

1
CA 02425208 2011-05-10 -100 CLAIMS:1. An RNA aptamer which binds to the coagulation pathway factor IXa, the RNA aptamer comprising a secondary structure wherein the secondary structure consists of, in a 5' to 3' direction, a first stem region, a first loop region, a second stem region, a second loop region, and a third loop region, wherein the first loop region comprises a consensus sequence comprising NNAUA, wherein N is selected from the group consisting of A, U, G, and C.
6
An RNA aptamer comprising a nucleotide sequence selected from SEQ ID NO:3 or a truncate thereof.
9
A pharmaceutical composition comprising a RNA aptamer which binds to the coagulation pathway factor IXa, in a pharmaceutically acceptable diluent or vehicle, the RNA aptamer comprising a secondary structure wherein the secondary structure consists of, in a 5' to 3' direction, a first stem region, a first loop region, a second stem region, a second loop region, and a third loop region, wherein CA 02425208 2009-12-15 - 101 the first loop region comprises consensus sequence comprising NNAUA, wherein N is selected from the group consisting of A, U, G, and C.
28
30. An RNA aptamer comprising a nucleotide sequence at least 80% homologous to a nucleotide sequence selected from SEQ ID NO:3 or a truncate thereof.
48
50. A pharmaceutical composition comprising a RNA aptamer which binds to the coagulation pathway factor IXa, the aptamer comprising a nucleotide sequence at least 80% homologous to a nucleotide sequence selected from SEQ ID NO:3 or a truncate thereof.

Independent claims5

1,813 paragraphs in 357 sections, as filed

CA 02425208 2009-12-15

-1Description

RNA APTAMERS AND METHODS FOR IDENTIFYING THE SAME

Technical Field

The present invention relates generally to compositions and methods for identifying oligonucleotide sequences that specifically bind biomolecules, including peptides, hydrophobic molecules, and target features on cell surfaces, in particular extracellular proteins, and the use of these sequences to detect and/or isolate the target molecules and the resulting compositions. The instant invention is exemplified by obtaining compositions, through the use of disclosed methods, that comprise oligonucleotide sequences that bind to coagulation factors, E2F family transcription factors, Ang1, Ang2, and fragments or peptides thereof. Even more particularly, the present invention is directed towards ribonucleic add (RNA) aptamers, and to methods of identifying them.

Table of Abbreviations

<td> I-XII</td><td> coagulation factors</td>

<td> a</td><td> activated, as in factor Vila, IXa, Xa, etc.</td>

<td> ACT</td><td> activated clotting time</td>

<td> Ang1</td><td> Angiopoietin-1</td>

CA 02425208 2003-03-26

WO 02/026932 PCT/US01/30004

<td></td><td> Ang1* Ang2 Ang2* aPTT</td><td> activated Angiopoietin-1 Angiopoietin-2 activated Angiopoietin-2 Activated Partial Thromboplastin Time</td>

<td> 5</td><td> DNA</td><td> deoxyribonucleic acid</td>

<td></td><td> DP</td><td> diphosphate</td>

<td></td><td> FB</td><td> fraction bound</td>

<td></td><td> GTP</td><td> guanidine triphosphate</td>

<td></td><td> Kd</td><td> dissociation constant</td>

<td> 10</td><td> M7G</td><td> 5-adenosyl-L-methonine substituted GTP</td>

<td></td><td> MP</td><td> monophosphate</td>

<td></td><td> nM</td><td> nanomolar</td>

<td></td><td> PAG</td><td> phenoxyacetyl</td>

<td></td><td> pM</td><td> picomolar</td>

<td> 15</td><td> PT</td><td> Prothrombin Time</td>

<td></td><td> RNA</td><td> ribonucleic acid</td>

<td></td><td> SELEX</td><td> Systematic Evolution of Ligands by Exponential Enrichment</td>

<td></td><td> sem</td><td> standard error for mean</td>

PCT/US01/30004

-6less, to a vertebrate subject suffering from cardiovascular disease, whereby cardiovascular disease in the vertebrate subject is treated.

A method of modulating E2F activity in a warm-blooded vertebrate in which said modulation is desired is also provided. The method comprises:

. (a) administering to the warm-blooded vertebrate an effective amount of an

RNA aptamer that selectively binds an E2F family member, the RNA aptamer having a dissociation constant for the E2F family member of about 20 nM or less; and (b) modulating E2F in the warm-blooded vertebrate through the administering of the RNA aptamer of step (a).

A method of modulating Ang1 or Ang2 activity in a warm-blooded vertebrate in which said modulation is desired is also provided. The method comprises: (a) administering to the warm-blooded vertebrate an effective amount of an RNA aptamer that selectively binds Ang1 or Ang2, the RNA aptamer having a dissociation constant for Ang1 or Ang2 of about 20 nM or less; and (b) modulating Ang1 or Ang2 in the warm-blooded vertebrate through the administering of the RNA aptamer of step (a).

A method of identifying a ligand to a target from a candidate mixture of potential ligands is also provided in accordance with the present invention. Products, i.e., ligands, produced or identified via the method are also provided in accordance with the present invention.

In a preferred embodiment the method comprises: (a) preparing a candidate mixture of potential ligands; (b) contacting the candidate mixture with a target in a lower stringency buffer, wherein ligands having increased affinity to the target relative to the candidate mixture bind to the target; (c) removing unbound candidate mixture; and (d) collecting the ligands that are bound to the target to produce a first collected ligand mixture. More preferably, the method further comprises: (e) contacting the first collected ligand mixture with the target in a higher stringency buffer, wherein ligands having increased affinity to the target relative to the first collected ligand mixture bind to the target; (f) removing unbound ligands; and (g) collecting the ligands that are bound to the target to produce a second collected ligand mixture to thereby identify ligands to the target. Even more preferably,

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-7ligands in the first or second collected ligand mixture are enriched or expanded by any suitable technique, e.g. amplification, prior to contacting the first collected ligand mixture with the target in the higher stringency buffer, after collecting the ligands that bound the target in the higher stringency buffer, or both. Optionally, the contacting and expanding or enriching steps are repeated as necessary to produce a desired ligand. Thus, it is possible that the second collected ligand mixture can comprise a single ligand.

Another embodiment of a method of identifying a ligand to a target from a candidate mixture of potential ligands is provided in accordance with the present invention. Products, i.e., ligands, produced or identified via the method are also provided in accordance with the present invention.

The method preferably comprises: (a) providing a target selected from a first species of organism; (b) preparing a candidate mixture of potential ligands; (c) contacting the candidate mixture with the target, wherein ligands having increased affinity to the target from the first species of organism relative to the candidate mixture bind to the target from the first species of organism; (d) removing unbound candidate mixture; (e) collecting the ligands that are bound to the target from the first species of organism to produce a first collected ligand mixture for the target; (f) contacting the first collected ligand mixture with a target from a second species of organism, the target from the second species having at least a portion thereof that is substantially , homologous to the same portion in the target from the first species, wherein ligands having increased affinity to the target from the second species relative to the first collected ligand mixture bind to the target; (g) removing unbound first collected ligand mixture; and (h) collecting the ligands that are bound to the target from the second species of organism to form a second collected ligand mixture thereby identify ligands to the target.

Preferably, ligands in the first or second collected ligand mixture are enriched or expandèd by any suitable technique, e.g. amplification, prior to contacting the first collected ligand mixture with the target from the second species of organism, after collecting the ligands that bound the target from the second species of organism, or both. Optionally, the contacting and

CA 02425208 2012-04-13 expanding or enriching steps are repeated as necessary to produce a desired ligand. Thus, it is possible that the second collected ligand mixture can comprise a single ligand.

It is therefore an object of the present invention to provide novel RNA aptamers that selectively bind coagulation factors, an E2F family member, Ang1 or Ang2. The object is achieved in whole or in part by the present invention.

An object of the invention having been stated hereinabove, other objects will become evident as the description proceeds, when taken in connection with the accompanying Figures and Laboratory Examples as best described herein below.

It is provided an RNA aptamer which binds to the coagulation pathway factor IXa, the RNA aptamer comprising a secondary structure wherein the secondary structure consists of, in a 5' to 3' direction, a first stem region, a first loop region, a second stem region, a second loop region, and a third loop region, wherein the first loop region comprises a consensus sequence comprising NNAUA, wherein N is selected from the group consisting of A, U, G, and C.

It is provided an RNA aptamer comprising a nucleotide sequence selected from SEQ ID NO:3 or a truncate thereof.

It is provided a pharmaceutical composition comprising a RNA aptamer which binds to the coagulation pathway factor IXa, in a pharmaceutically acceptable diluent or vehicle, the RNA aptamer comprising a secondary structure wherein the secondary structure consists of, in a 5' to 3' direction, a first stem region, a first loop region, a second stem region, a second loop region, and a third loop region, wherein the first loop region comprises consensus sequence comprising NNAUA, wherein N is selected from the group consisting of A, U, G, and C.

It is provided an RNA aptamer comprising a nucleotide sequence at least 80% homologous to a nucleotide sequence selected from SEQ ID NO:3 or a truncate thereof.

It is provided a pharmaceutical composition comprising a RNA aptamer which binds to the coagulation pathway factor IXa, the aptamer comprising a nucleotide sequence at least 80%. homologous to a nucleotide sequence selected from SEQ ID NO:3 or a truncate thereof.

CA 02425208 2012-04-13

Brief Description ofthe Drawings

Figure 1A depicts sequences (SEQ ID NOs: 1-12) of representative RNA aptamers ofthe present invention that bind to and inhibit the activity of coagulation factor IXa.

Figure 1B depicts sequences (SEQ ID NOs: 13-22) of representative RNA aptamers of the present invention that bind to and inhibit the activity of coagulation factor IXa.

Figure 2A is a plot of data points showing that RNA 9.3 (SEQ ID NO:3) inhibits the FIXa/FVIlla catalyzed activation of FX, thereby demonstrating that RNA 9.3 (SEQ ID NO:3) inhibits the activity of coagulation factor IXa. Factor IXa (0.5 nM) was equilibrated with no RNA (A), 10 nM control RNA (), or 10 nM RNA 9.3 (SEQ ID NO:3) (·), the FX activation reaction was initiated by the addition of FVIIIa (1 nM), PC/PS vesicles (100 pM) and FX (200 pM), and the amount of FXa formed over time at 37“C was measured.

Figure 2B is a bar graph showing that RNA 9.3 (SEQ ID NO:3) prolongs the clotting time of human plasma, thereby demonstrating RNA 9.3 (SEQ ID NO:3) inhibits the activity of coagulation factor IXa. The clotting time of normal human plasma was measured in an aPTT assay in the absence of RNA (striped bar), or in the presence of increasing concentrations of control

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-9RNA (solid bar) or RNA 9.3 (SEQ ID NO:3) (open bar). The clotting time is expressed as the mean + sem for duplicate measurements.

Figures 3A-3C show that aptamer 9.3t (SEQ ID NO:70) inhibits FIXa activity in pigs.

Figure 3A is a plot showing in vitro anticoagulant activity of aptamer

9.31 in porcine plasma. ·, 9.31 APTT; □, 9.31 PT; ·, 9.3™ APTT; O, 9.3™ PT. Data is presented as the mean±sem.

Figure 3B is a line graph showing in vivo anticoagulant activity of aptamer 9.3t in pigs following IV bolus injection, Activated Clotting Time (ACT) assays. , 1.0 mg/kg 9.31; □, 0.5 mg/kg 9.31; ·, 1.0 mg/kg 9.3™; O, Vehicle. Data is presented as the mean±sem. The ACT increase is the ratio of the (pre-injection ACT/post injection ACT) for each time point, 1.0=no change (time O=pre-injection).

PCT/US01/30004

-12aptamer (SEQ ID NO: 56). Control aptamer had no effect on APTT at these concentrations.

Figure 15 is a schematic of a proposed structure of a 25-MER truncate of TOG 25 (TOG 25 short, SEQ ID NO: 57). The “wild-type” truncate binds human thrombin with a Kd of about 1 nM. The binding affinity of various mutants designed to disrupt the stem (no stem, SEQ ID NO: 58), BULGE (BULGE Us, SEQ ID NO: 59), and loop sequence (loop U1, SEQ ID NO: 60, and loop U2, SEQ ID NO: 61) are also shown.

Figure 16 is a line graph depicting activation of human platelets by 1 nM human thrombin in the presence of increasing concentrations of full length TOG 25 (TOGFL, SEQ ID NO:55, solid diamonds), truncated TOG 25 (TOG 25 short, SEQ ID NO: 57, solid squares), or a non-binding mutant truncate (BULGE Us, SEQ ID NO: 59, solid triangles).

Figure 17 depicts sequences (SEQ ID NOs:64-69) of RNA aptamers that bind to and inhibit the activity of E2F. The aptamers were produced after 10 rounds of the SELEX method and each primer includes an oligonucleotide sequence (SEQ ID NO:62) at the 5’ end and at the 3’ end (SEQ ID NO:63) as noted. In Figure 17, and in other parts of the application, if a T is observed in an RNA sequence it should be construed as a U, in that the inclusion of the T is an unintended artifact of a sequencing approach.

Figure 18 is a table depicting the alignment of a family of FIX/FIXA aptamers of the present invention and depicting a proposed secondary structure of truncated form 9.3‘ (SEQ ID NO:70) of aptamer 9-3 (SEQ ID NO: 3) of Figure 1. in Figure 18, S1 equals stem 1, L1 equals loop 1, S2 equals stem 2, L2 equals loop 2, and L3 equals loop 3.

Figure 19A is a line graph depicting that RNA 16.3 (SEQ ID NO: 41) inhibits the FVIIa/TF catalyzed activation of FX. Factors Vila and X were equilibrated with no RNA (□), 1 μΜ RNA 16.3 m4 (), or 1 μΜ RNA 16.3 (A). The FX activation reaction was initiated by the addition of lipidated tissue factor, and the amount of FXa formed over time at 25°C was measured. The amount of FXa formed over time is expressed as the mean ± sem for three more experiments.

CA 02425208 2003-03-26

PCT/US01/30004

-20affinities of the antibodies for crossreactive materials as compared to targets should be in the range of 5-fold to 100-fold, generally about 10-fold.

In general, aptamers preferably comprise about 10 to about 100 nucleotides, preferably about 15 to about 40 nucleotides, more preferably about 20 to about 40 nucleotides, in that oligonucleotides of a length that falls within these ranges are readily prepared by conventional techniques. Optionally, aptamers can further comprise a minimum of approximately 6 nucleotides, preferably 10, and more preferably 14 or 15 nucleotides, that are necessary to effect specific binding. The only apparent limitations on the binding specificity of the target/oligonucleotide couples of the invention concern sufficient sequence to be distinctive in the binding oligonucleotide and sufficient binding capacity of the target substance to obtain the necessary interaction. Aptamers of binding regions containing sequences shorter than 10, e.g., 6-mers, are feasible if the appropriate interaction can be obtained in the context of the environment in which the target is placed. Thus, if there is little interference by other materials, less specificity and less strength of binding can be required.

As used herein, aptamer refers in general to either an oligonucleotide of a single defined sequence or a mixture of said oligonucleotides, wherein the mixture retains the properties of binding specifically to the target molecule. Thus, as used herein aptamer denotes both singular and plural sequences of oligonucleotides, as defined hereinabove. The term aptamer is meant to refer to a single- or double- stranded nucleic acid which is capable of binding to a protein or other molecule, and thereby disturbing the protein's or other molecule's function.

Structurally, the aptamers of the invention are specifically binding oligonucleotides, wherein oligonucleotide is as defined herein. As set forth herein, oligonucleotides include not only those with conventional bases, sugar residues and internucleotide linkages, but also those that contain modifications of any or all of these three moieties.

CA 02425208 2003-03-26

Preferably, the binding affinity for the RNA aptamer for the coagulation pathway factor is represented by dissociation constant of about 20 nanomolar (nM) or less, more preferably about 10 nanomolar (nM) or less. Optionally, the coagulation pathway factor is selected from the group including but not limited to prothrombin, thrombin, IX, IXa, X, Xa, VII, Vila, V, Va, VIII, Villa, tissue factor, XI, Xla and combinations thereof. Most preferably, the RNA aptamers bind activated coagulation factors.

Thus, improved nucleic acid ligands to coagulation factors, to E2F family members, and to Ang1 or Ang2 are disclosed and claimed herein. This invention includes the specific nucleic acid ligands identified herein. The scope of the ligands covered by the invention extends to all ligands of a coagulation factor, to E2F family members, and to Ang1 or Ang2 identified according to the procedures described herein. More specifically, this

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-24invention includes nucleic acid sequences that are substantially homologous to and that have substantially the same ability to bind coagulation factors, E2F family members, or Angl or Ang2, under physiological conditions, as the nucleic acid ligands identified herein. By substantially homologous, it is meant, a degree of homology in excess of 70%, most preferably in excess of 80%. Alignment techniques are disclosed herein below. Substantially homologous also includes base pair flips in those areas of the nucleic acid ligands that include base pairing regions. Substantially the same ability to bind a coagulation factor, an E2F family member, or Angl or Ang2 means that the affinity is within two orders of magnitude of the affinity of the nucleic acid ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence is substantially homologous to and has substantially the same ability to bind a coagulation factor, an E2F family member, or Angl or Ang2 as the sequences identified herein.

II.A. Coagulation Factor IX Aptamers

In one embodiment, an RNA aptamer of the present invention selectively binds an activated coagulation factor IXa (FIXa) or inactive form thereof, i.e. (Factor IX). Preferably, the dissociation constant ranges from about 100 pM to about 10 nM. More preferably, the dissociation constant ranges from about 400 pM to about 10nM, and can optionally comprise any value within the range, e.g. about 500 pM, about 600 pM, about 700 pM, about 800 pM, about 900 pM, about 1 nM, about 2.5 nM, or about 5 nM. Even more preferably, the Kd is established using a double-filter nitrocellulose filter binding assay such as that disclosed by Wong and Lohman, 1993,

Proc. Natl. Acad. Sci. USA 90, 5428-5432.

Referring now to Figs. 1A-1B, representative sequences of RNA aptamers of the present invention that bind to and inhibit the activity of FIXa are disclosed. In a preferred embodiment' of each of the sequences of Figs. 1A-1B, all cytidines are 2’-deoxy-2’ fluoro cytidine and all uridines are 2’30 deoxy-2’-fluorouridine. Binding data for the aptamers of Figs. 1A and 1B are presented in Tables 1 and 2.

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-25TABLE 1

Affinities (expressed as apparent dissociation constants) of FIX/FIXa Aptamers for FIXa as determined by Double-Filter Nitrocellulose Filter Binding Assays

<td> Sequence</td><td> Kd(pM)</td><td> SEQ ID NO:</td>

TABLE 2

Primary sequence of the minimal or truncated FIXa aptamers 9.31 and

9.20u

9.31: 5’ AUG GGG ACU AUA CCG CGU AAU GCU GCC UCC CCA U 3’ (SEQ ID NO: 70)

Table 4

SEQ ID NO:

FVII/FVIla Aptamers SELEX ROUND

AND SPECIE Random Region of Aptamer Sequence

11-15 AAAGUAeCGACUAGGUCCCACUGUUUAAGCAUCCCCGAAC

10-15 AAGCUCCAUCCAAGCGACGACACGCUCGUCCCGAAAAGAAU 10-1,

10- 5,

11- 19 AAGCUCCGUCCAAGCGACGACACGUUCGUCCCGAAAAGAAU 11-6,

11-27 ACAACGCCACCUUCCGCGCGACGCCGCGCCGACGAUAACU

10- 7 ACAACGCCACCUUCCGCGCGACGCCGCGCCGACGUAUAACU

11- 1 ACGAAAAUAUCUCCGUCAAGGACCUCCUGCCCCAAACACU

11-17 AGACGACACAUCCAAGCGUGAGAGAUCACCCGACAAGAAU

11-2 OAUUUUUUCACACAUUCUUAAUUUUCACUUACCCGUCCCGAUC

10-9 CAAAGCACCCGUCCAAGCGACAGACAUGUCCCGCAGCCCU

10-13 CACCAUUUAUUCUUCAUUUUUCUUCGCCCAGUUCCUCCAA

10- 14 CAUAAGCCGCCUCAGCUGACAAAGCCCUCCGCUUAGGCC

11- 23 CCAAAGUGCUUCCGCGAAGUUCGACCAUUCGCCGCCUGCA

10-11 CCCCUCCGCCAACUUGGCCGCCUCAGGCACCAUCACCAAC

10- 2 CCCGAUCUCCCCGAGGACCUCCACGGCCCGUCCGCCAGUUU

11- 3 CCGCCUCAGCAAUCUAGCCCUCCGCCCGACCCUUCCGCUG 11-12,

11-13 CCGCCUCAGCGAGAUCUUCGCCCUCCGCCCAAGCCUCAAC

11-25 CCGCCUCAGGACGACACCGGUCCCCUCCGCCCGUCCGCGC

10-3 CCGCCUCAGGCAUCAGCCCCUCCGCCCGCCCACUUCAUCA

10-12 CCGCCUCAGUUACUUGAUAACCCUCCGCCCGCCCGCAGCU

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-2993

100

101

11-18 CUUUACAUAUUACUUACUACAUUUUCAUAACACCACACGC

11-7 GACACCAUCCAAGCGACCAACCAAGGUCCCGCACAUAACU

10-10 GAUGCAACUCGAAAUGGCCGCCUCGCGUCAGCGUUCCGC

10- 4 GCUUAUCUUAUAUCACUUUUUCUUCCCAAUCCUUCAAGU 10-6,

11- 5 UAACCAACCAAGCGUCCAAAAACCUGGACCCGCCAAGAAU

11-14 UAACCAACCAAGCGUCCAAAAAUCUGGACCCGCCAAGAAU

11-10 UCUGACGUUCCACCGUCCUCGAAGGCGACCAGAGCGUUAC

11-8,

11-16 UGCCGCCUCAGCCACACGGCCCUCCGCGCCCGCCACAAGC

II.C. Coagulation FactorX Aptamers

In another embodiment, an RNA aptamer of the present invention selectively binds activated coagulation factor Xa (FXa) or an inactive form thereof, i.e. (Factor X). Preferably, the dissociation constant ranges from about 100 pM to about 10 nM. More preferably, the dissociation constant ranges from about 400 pM to about 10nM, and can optionally comprise any value within the range, e.g. about 500 pM, about 600 pM, about 700 pM, about 800 pM, about 900 pM, about 1 nM, about 2.5 nM, or about 5 nM.

Even more preferably, the Ka is established using a double-filter nitrocellulose filter binding assay such as that disclosed by Wong and Lohman, 1993, Proc. Natl. Acad. Sci. USA 90, 5428-5432.

Referring now to Figs. 6A-6B, representative sequences of RNA aptamers of the present invention that bind to and inhibit the activity of FXa are disclosed. In a preferred embodiment of each of the sequences of Figs. 6A-6B, all cytidines are 2’-deoxy-2’ fluorocytidine and all uridines are 2’deoxy-2’-fluorouridine. Binding data for the aptamers of Figs. 6A and 6B are presented in the Laboratory Examples.

Table 5 shows additional sequences of RNA aptamers isolated to coagulation factor X/Xa. Binding data for the aptamers of Table 5 are presented in the Laboratory Examples, including Example 12. In Table 5, the numerals “10” and “11 ” refer to the fact the aptamer was isolated after ten

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-30(10) rounds or eleven (11) rounds of SELEX, respectively. The FXa sequences listed in table 5 are flanked by fixed sequences that are the same as the fixed sequences described in the preceding section on aptamers to factor Vila. That is, the 5’ and 3’ flanking sequences are, respectively, SEQ

ID NQs:102and 103.

TABLE 5

SEQ ID SELEX

Round_and

Specie No.

<td> NO:</td><td> Clone</td><td> Sequence</td><td> (nM)</td>

<td> 104</td><td> F11-8</td><td> AgAuuAGCCCCAGCGAGAuAAuACuuGGCCCC GCuACuAC</td><td> 2.2</td>

<td> 105</td><td> D7-9</td><td> uAAAuAGCCCCAGCGAGAuucuACuuGGCCCC GCuACuAC</td><td> 2.633</td>

<td> 106</td><td> D6-6</td><td> AAAAuAcgCCannCGAGAuuAuACuuGGCCCCG CuAauAC</td><td> 3.1</td>

<td> 107</td><td> F11-7</td><td> AAAAuAGCCCCAGCGAGAuAAuACuuGGCCCC GCuAuuAC</td><td> 3.6</td>

<td> 108</td><td> D7-6</td><td> AAAAuAGCCCCAGCGAGAuAAuACuuGGCCCC GCuAgcAC</td><td> 3.8</td>

<td> 109</td><td> D6-2</td><td> AAAAuAGCCCCAGCGAGAuAAuACuuGGCCCC GCuACaAC</td><td> 4.6</td>

<td> 110</td><td> D7-1</td><td> AgAAugGCCCCAGCGAGAuuAuACuuGGCCCC GCcAauAC</td><td> 4.7</td>

<td> 111</td><td> D6-1</td><td> AAAAuAGCCCCAGCGAGAugAuACuuGGCCCC GCuAauAC</td><td> 4.8</td>

<td> 112</td><td> D7-7</td><td> AgAAuAcgCCuAGCGAGAagAuACuuGGCCCCC</td><td> 5.8</td>

CA 02425208 2003-03-26

PCT/US01/30004

-31GugCaAC

AAAAuAGCCCCAGCGAGAuAAuACuuGGCCCC D6-3 GCuguuAC 5.9

AAAuuuGCCCCAGCGAGAuAAuACuuGGCCCC D6-9 GCaACuAC 6.5 similar

AuAAuAGCCCCAGCGAGAuAAuACuuGGCCCC to 10D4-7 GCuACuAa 14

AgAAuAGCCCCAGCGAGAuAAuACuuGGCCCC D7-2 GCuAauAC 8.1

AAAuuuGCCCuAGCGAGAuuAuACuuGGCCCCG D6-4 CgAaaaAC 8.5

AAAAuAGCCCCAGCGAGAuAAuACuuGGCCCC E10-12 GCgAacAC 11.7 ugcAuAGCCCCAGCGAGAuAAuACuuGGCCCC D6-7 GCuACaAC 13.2 ngAuuAGCCCnAGCGAGAuAnuACuuGGCCCCG D7-8 CuACnuC 14.49

AAAAuAaCCaCAGCGAGAucAuACuuGGCCCCG 2 fold D4-8 uuACuAC higher

AAAAuAGCCCuAGCGAGAuAAuACuuGGCCCC 2 fold D4-10 GCcACaua higher cAgAuAGCCaCAGCGAGAucAuACuuGGCCCCG D6-10 CuACuAC 18.7

AgAAuAGCCCCAGCGAGAuAAucCuuGGCCCC D4-5 GCuACugC 21.66

AAncuAGCCCnAGCGAGAuAuuACuuGGCCCCG 3 fold D4-6 CnACuAC higher

AAAcuAGCCuCAGCGAGAuAAuACuuGGCCCC D7-5 GCuACuAC 26.1

E10-11 CCAGAAGCGCuCACuACAACGuuGAACCCCCC 27.11

CA 02425208 2003-03-26

PCT/US01/30004

-32E10-8

E9-8

F11-6

E10-4

D7-4

E9-3

E10-1

E9-9

E9-5

E9-2

E9-4

D4-3

E10-7

F11-10

E10-6

GuCCACAC

CCAAAAGCGGACuGAAGACGuGuuuCCCCCAu CuCCGuGA 28.38

CCAGAAGGAACuAAACACCuGAACCCCCCAuC GCGAGAGA 29.81

CCAGCAACGuCACACGAACGGAAuACCCCCC AuuGAAAAC 33.6 u C u u AG Au Au AG AACu CC G AG AG G ACu G ACC G uACAGAAC 37.44

AgAAuAGCCCCAGCGAGAucguACuuGGCCCC GCuAguAC 39.3

CCAAAAGCGCAuACACCuGCGuGuuuCCCCCG CCAACAGu 46.55

CCAuuGCuNCCCuGAACANGGGCNCCACNCC GCCuNCACAGu 51.7

CCAGAACACCAGuGAACCCCCCAGCCCCuuCu CACCAGAu 52.81

CCAGAAGCGACACuAACGCuGAACCCCCCAG uCCCuuCACGuG 53.5

AuACCGAGCACGCAAAACACACAAuGCCCAAG CAGGACu 58.6

AGCCCGAGAAAAuAACGCGuuCCACCAuACuA CuAAGC 65 u AAAu AG C C C C AG C G AG Au AAu AC uuGGCCCC GCaACuAC 65.5

AGuCCGACuGGAGAACANGuACuCuAuAAGCA CuuNCAuNCAN 69.45

CuCGGCAGAAGACACGCAuuCACCuGGuGCCA CCuCGuAA 84.43

GCCGuCGCCAGGAAuCAAACuGCuACuCCAuC 85.7

CA 02425208 2003-03-26

WO 02/026932 PCT/US01/30004

<td> 143</td><td> E9-6</td><td> CCGGGCA CCAGAAGCuAAACACuCAuAACCACGCuGAAC CCCCCAAC</td><td> 95.1</td>

<td> 144</td><td> E9-10</td><td> CCAGAACCAACuGCGGuGAACCCCCCAuACC GCGACACAu</td><td> 130.4</td>

<td> 145</td><td> D4-2</td><td> AAcuuAGCCuGAGCGAGAuAAcgCuuGGCCCCG CuAagAC</td><td> 540</td>

<td> 146</td><td> D4-9</td><td> uAAguuGCCCCAGCGAGAuAguACuuGGCCCCG CuACuAa</td><td> >240</td>

<td> 147</td><td> E9-1</td><td> AAAAuAGCCCCAGCGAGAuAAuACuuGGCCCC GCuACuAA</td><td></td>

<td></td><td> II.D.</td><td> Thrombin Aptamers</td><td></td>

In another embodiment, an RNA aptamer of the present invention selectively binds coagulation factor thrombin (activated) (Factor Ila (Fila)), or an inactive form thereof (i.e. prothrombin, factor VII). Preferably, the dissociation constant ranges from about 100 pM to about 10 nM. More preferably, the dissociation constant ranges from about 400 pM to about 10nM, and can optionally comprise any value within the range, e.g. about 500 pM, about 600 pM, about 700 pM, about 800 pM, about 900 pM, about 1 nM, about 2.5 nM, or about 5 nM. Even more preferably, the Kd is established using a double-filter nitrocellulose filter binding assay such as that disclosed by Wong and Lohman, 1993, Proc. Natl. Acad. Sci. USA 90, 5428-5432.

Referring now to Figure 11, representative full-length thrombin aptamer sequences are disclosed, along with dissociation constants (Kd) for human and porcine thrombin. Significantly, 13 rounds of the toggle SELEX method disclosed herein in accordance with the present invention produced these aptamers. A preferred consensus sequence of these aptamers comprises AACAA. A preferred embodiment of a thrombin aptamer sequences comprises the sequence referred to as toggle 25 (TOG25; SEQ

ID NO: 55). A truncated form of this aptamer was also prepared, and the truncate is referred to herein as TOG 25 short (SEQ ID NO: 57).

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-34As shown in Figure 15, a thrombin RNA aptamer of the present invention preferably comprises about 3 pair forming nucleotides followed by the AACAA consensus sequence and two additional pair forming nucleotides. As shown in Fig. 15, the pair forming nucleotides form pairs with complementary nucleotides proximate to the 3’ end of the TOG 25 short aptamer.

11.E. E2F Aptamers

In another embodiment, an RNA aptamer of the present invention selectively binds E2-F, also referred to as “an E2F family member”. Thus, the terms “E2-F” and “E2-F family member” encompass any E2F family member, whether now known or hereafter identified. Representative E2F family members include but are not limited to E2F-1, E2F-2, E2F-3, E2F-4, E2F-5 and E2F-6. Preferably, the dissociation constant ranges from about 100 pM to about 50 nM. More preferably, the dissociation constant ranges from about 400 pM to about 10nM, and can optionally comprise any value within the range, e.g. about 500 pM, about 600 pM, about 700 pM, about 800 pM, about 900 pM, about 1 nM, about 2.5 nM, about 5 nM, or about 10 nM. Even more preferably, the Kd is established using a double-filter nitrocellulose filter binding assay such as that disclosed by Wong and Lohman, 1993, Proc. Natl.

Acad. Sci. USA 90, 5428-5432.

Referring now to Fig. 17, representative sequences of RNA aptamers (SEQ ID NO: 62-69) that bind to and inhibit the activity of E2F family members including E2F-3 are disclosed. Each of the aptamers (SEQ ID NO: 64-69) are preferably bounded at their 5’ end by the 5 primer sequence 5’P of

SEQ ID NO: 62 and are preferably bounded at their 3’ end by the 3 primer sequence 3’P of (SEQ ID NO: 63). Jhese primers were identified after 10 rounds of SELEX wherein the SELEX method was modified in accordance with the matrix conditions described in Examples 1 and 2. The approximate Kd’s for these aptamers are set forth in Table 6.

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-35Table 6A

Approximate Kd’s for E2F Aptamers

<td> Aptamer No.</td><td> SEQ ID NO.</td><td> Kd</td>

Thus, RNA aptamer ligands that selectively bind to an E2F family member, e.g. E2F-3, are disclosed herein. Among other utilities as disclosed herein, these aptamers have utility in the control of cell proliferation, which is of central importance to the proper development of a multi-cellular organism, the homeostatic maintenance of tissues, and the ability of certain cell types to respond appropriately to environmental cues. E2F is a family of transcription factors and modulation of E2F activity is envisioned to be particularly effective in repeating a wide variety of proliferative events in view of the control of E2F activity occurring as the end result of Gi cyclin dependent kinase regulatory cascades that involve the Rb family of proteins. See, e.g., Sherr, C.J., Cell,

73:1059-1065 (1993); Hunter, T„ Cell 75:839-841 (1993); Nevins J.R.,

Science, 258:424-429 (1992); Helin, K. and Harlow, E., Trends Cell Biol. 3:43-46 (1993); La Thangue, N.B., Trends Biochem. Sci. 19:180-114 (1994); Sherr, C.J. and Roberts, J.M., Genes Dev. 9:1149-1143 (1995); Weinberg, R.A. Cell 81:323-330 (1995) Harbour, J.W. and Dean, D.C., Genes and

Development 14:2393-2409 (2000); and Black, A.R. and Azizkhan-Clifford, J., Gene 237:281-302(1999).

Table 6B shows additional sequences of RNA aptamers isolated to an E2F family member. Shown are the random-region derived sequences (5’ to 3’) of aptamers resulting from the selection against E2F. In a preferred

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-3610 embodiment, all pyrimidines are 2’fluoro-modified. The random region derived sequences are flanked by fixed sequences from the library as shown: 5’ GGG GGA AUU CUA AUA CGA CUC ACU AUA GGG AGA GAG GAA GAG GGA UGG G (SEQ ID NO:188) -random region- C AUA ACC CAG AGG UCG AUA GUA CUG GAU CCC CCC 3’ (SEQ ID NO:63). Binding data in the form of Kd values are also shown.

Table 6B E2F Aptamers

SEQ ID

NO:_Random Region of Aptamer Sequence_Kd

189 GCUGCCGCGCCUGGACCCCACCCACAUAUGGGCCACACAC

1.5 nM

190 AAUGACAAUUGACUCGGAAACCCUC AUGUUCCAACACCGG

191 CCUACUCUCCACACCUGGUUUUAUGCUCUACAC ACCUC AC

192 CUGCCCCGACCACAAAGGACGGAACCCUACCCACAGUGGG

193 CAUAAAAGCAAUUUGCCACCGGCGUACGGCACCCCAAUAU

194 CACCUAUGCCAUCAGGCCUCAAUCUCCGGCAGCGACUCUA

195 AUCAACCACAGGAAGAGUGCAGCCAUAGCACACAGACCA

196 GCGACAUACCCCACCCACACUGGCACAACGCGCAAUGCCG

197 CUUCAAAGGUCCUGUAUCCAGCCACCCCACUGACAGGA

198 CUACCCAGCAAGGUCAACCÇUACCCACACUGG

1.75 nM

199 AUCUUAAAGAUCACCGGCGUUCGGCAACACCCGACCCAAA

200 GCACUAAACUUCGAUUACCCCCCACCCACACUGGCUGCAC 4nM

201 CAGAUUACCCUACCCACACUGCGUGCGGACAACCAUUGGC 0.4 nM

202 GCACAAAUGAGAACACGAGUUCACCCCGCCCACACUGGA

203 GCGCAGAUCAACCCUACCCAUACUGGGCUCCUUGUGAAGG

204 CAAGCGCUGAAACCAAUGCACCCCACCCCACACUGGUGUAC

1.25 nM

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-37205 AUGUGAAACACAGAAGCCCUGUACAGACCGCCGACUGUCA

206 CAAACUCACAGACACCAACUGCAGGAGCACCCACCACGAC

207 CGAACGAACUGUGGACCCUACCCACACUGGGCCAAGCGAU 0.4 nM

208 CGCCCUGGAACGAGAUUCCUGUAAACCCCCAUCUAGUAGA

209 CAAGGUGACCGCGAACCCUACCCGCCGCACGGUAACAGCG

210 CAUCC AGACUACUGGCCCAACCCGCCGCUCC AACCCCGUG

211 CUCUCUCCGUAACCAACAAGUCCCAAUGAACAACCACCAU

212 CACUGAACGAAUGGCAACCGCCAAACCCUACCCACACUGG * 0.2 nM

213 C AAGCGUAUACCCUACCCAC ACUGAGCUACAUUGCGCUGA 8nM

214 GCCGAGAGUGAGUGACCACAACCCCGCCCACACUGGAAUA

1.5 nM

215 UUUCCUAUGGCGAUAACUUCAGCCACGCCGGCGCCCCGUG 30 nM

216 CGÜCACUCCGUCCCAGCCGACGAAGUCCGUAAUUCCUCCA 45 nM

217 CCACCCGAAGCAAAUCAAGCCCGACGGCGCUCGGACCAAC i

218 CGAACUGAAGCUAGCGUAACCCUACCCACACUGCACGUG 0.5-4 nM

219 ACCUCGACCCUUCACCUGACUCUCCCAGAAGUUCUGUUUC 2nM

220 CAAUCCAUACGCACCCGGUCCACACUGGGUUGG AGCNNN 1-40 nM

221 AAUGGAAUCACUGAAGGCCCUCCGUAGCACCUAACACAGU *

1.5 nM

222 GCAUCCUGCCAGCGGCGACGGACCUUCGCCCACAGGCCUC 2nM

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-38223 UUAUAUAGCACACUGAAGCCCUCAGCAAAACCUCCACAGG *

1.5 nM

224 UAUGAAAUCACAGAAGCCCGCGUUCGACACCUCCACUGUU *

3nM

225

CAAACUCACAGACUCCAACUGCAGGAGCACCCACCCACACUGGGACAG 0.25-2.5 nM

226 AUCCCCGCCGUAAGCCGUCCUGAUGGACACCACACGCCGC * 2nM

II.F. Angiopoietin-1 (Ang1) and Anqiopoietin-2 (Anq2) Aptamers

Tie2 is an endothelial receptor tyrosine kinase (RTK) that is required for both embryonic vascular development and pathological angiogenesis. Tie2 is unique among RTKs in that it has two ligands with apparently opposing actions. Angiopoietin-1 (Ang1) is an activating ligand while Angiopoietin-2 (Ang2) is thought to be a naturally occurring antagonist for Tie2. Mice lacking Tie2 or Ang1 die midway through gestation due to abnormalities of vascular morphogenesis characterized by deficient recruitment of supporting smooth muscle cells and pericytes. Moreover,

Ang1 promotes endothelial cell survival and blocks the increases in vascular permeability induced by vascular endothelial growth factor (VEGF), supporting a role for Ang1 in the stabilization and maintenance of the adult vasculature. In contrast, Ang2 is required for VEGF-mediated angiogenesis, and in the absence of endothelial mitogens Ang2 may induce vascular regression.

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-39However, it is unclear whether these effects are due to inhibition of the effects of Ang1 or Ang2, since a soluble receptor would bind both ligands. Specific inhibitors of these ligands have the potential to more precisely modulate Tie2 signaling and serve as valuable therapeutic agents. The present invention provides RNA aptamer ligands for Ang1 and Ang2.

A random library of 2’-fluoro modified RNA was created with the following sequence:

GGGAGAGAGGAAGAGGGAUGGG (SEQ ID NO:149) -N40CAUAACCCAGAGGUCGAUAGUACUGGAUCCCCCC (SEQ ID 10 NO: 150), where N40 is a random region.

In vitro selection was performed using recombinant human angiopoietin-1* (ANG1*; Regeneron Pharmaceuticals, Tarrytown, New York). After 9 rounds of SELEX, the pool was cloned and sequenced, and a single random region sequence (ANG9-4-SEQ ID NO: 151) was identified:

ACUCGAACAUUUCCACUAACCAACCAUACUAAAGCACCGC.

In Figure 24, direct binding (corrected fraction bound) of ANG9-4 RNA is plotted as a function of protein concentration. ANG9-4 binds Ang1 with a Kd of ~10 nM and binds the related antagonist Ang2 with a Kd of >1 μΜ (>100-fold specificity). Additional data pertaining to Ang1 aptamers is 20 presented in the Laboratory Examples.

Table 7 sets forth additional representative Ang1 aptamers. Analysis of earlier SELEX rounds revealed several unique clones with random region sequences bearing similarities to ANG9-4. Aptamer sequences are as follows: GGGAGAGAGGAAGAGGGAUGGG (SEQ ID NO:149) -N40CAUAACCCAGAGGUCGAUAGUACUGGAUCCCCCC (SEQ ID NQ:150).

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

Anq1 Aptamers

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-41For Angiopoietin-2 (Ang2) Aptamers, a random library of 2’-fluoro modified RNA was created with the sequence:

GGGAGGACGAUGCGG(SEQ ID NO:166)-N40CAGACGACUCGCUGAGGAUCCGAGA (SEQ ID NO: 167).

In vitro selection was performed using recombinant human angiopoietin-2 (Ang2; R&D Systems, Minneapolis, Minnesota). To enhance the specificity of the Ang2 selection, molecules that bound the related agonist Angiopoietin-1* (Ang1*; Regeneron Pharmaceuticals) were discarded (negative selection) prior to rounds of positive selection for Ang2. After 11 rounds, the pool was cloned and sequenced, and a family of RNAs with a 12nucleotide consensus region (italics) was identified and was represented by one dominant random region sequence (ANG11-1): ACVAGCCUCAUCAGCUCAUG UGCCCCUCCGCCUGGAUCAC (SEQ ID NO: 168). As shown in Figure 27, direct binding (corrected fraction bound) of ANG11-1 RNA is plotted as a function of protein concentration. ANG11-1 binds Ang2 with a Kd of <10 nM and binds Ang1* with a Kd of ~1 μΜ (> 100fold specificity).

Table 8 sets forth additional representative Ang2 aptamers. Analysis of clones from rounds 9 and 11 revealed several unique random region sequences containing at least one of two conserved motifs, indicated by italics or underlining. Aptamer sequences are as follows: GGGAGGACGAUGCGG (SEQ ID NO: 166) -N40CAGACGACUCGCUGAGGAUCCGAGA (SEQ ID NO:167).

CA 02425208 2003-03-26

Table 8

Anq2 Aptamers

<td> Frequency 1_</td><td> 10 of 26</td><td> | 1 of 26 I_</td><td> 1 of 26</td><td> 1 of 26</td><td> 1 of 26</td><td> 1 of 26</td><td> 1 of26 _I</td><td> 1 of 26 _i</td><td> 1 of 26</td><td> 1 of 26</td><td> 1 Of26</td><td> 1 of 26</td>

<td> Random region (N40)</td><td> 0 < O 0 < 0 0 0 0 O 0 o o 0 o o 0 o 0 0 0 0 δ 0 0 0 δ = 0 0 O 0 < 0 O <</td><td> UGACCAAGCCUCACGUUGAACCUGCCAGUAGACCCCGCCCA I</td><td> O < O Ü < 0 0 s o 0 O 0 0 Ü 0 0 2) 0 0 0 0 0 0 25 δ 2) 0 0 δ 2) δ 0 ί 2) 25</td><td> 0 0 0 δ < 0 0 0 δ 25 0 0 0 0 0 0 25 3 25 0 0 δ 25 δ 0 0 0 0 δ 0 < 0</td><td> GGAGCGCAAUUCGCCUCGCAAGUUGAACUCCGCUGGCGG</td><td> UAAGCL/CUUUGGCUUAGCCCGACACGUUGAACUCCAGAGU</td><td> CACGGUACCACCAAGUCACACGUUGAACUCCAUGCAGCUG</td><td> < 0 0 0 0 0 0 < 0 0 0 0 25 0 0 0 0 0 0 25 δ 25 O 0 δ 25 2 0 0 2) < 0 0 O < 0 0</td><td> 2) < 0 0 0 0 0 0 25 0 0 0 0 «Ç 0 2» δ § 0 O 0 0 0 0 0 O 0 O 2) 0 25 25 0 O < 0 < 0 0</td><td> < 0 0 0 < 0 0 o o 0 0 0 0 0 0 0 0 ί 0 0 δ 0 0 < 0 0 0 0 < 0 0 < 0 0 < 0</td><td> CACUCAGCGCCCUGCGAAACGUUGCCGCCUCCCAACGUCU</td><td> 0 < 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 δ 0 o 0 δ 0 δ 0 < 0 0 0 < 0 0 < 0 0 0 <</td>

<td> Clone -SELEX round number and specie</td><td> 11-1 I</td><td> 11-2 I</td><td> 11-3</td><td> Ύ χ—</td><td> 11-6</td><td> 11-9</td><td> 11-10</td><td> I 11-15 I</td><td> 11-19</td><td> 11-26</td><td> 11-30</td><td> ! 11-32 I</td>

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

<td> CUCUUUUUGUCCCCGCACGUUGAACUCCUGUCCCUCUACU</td><td> =) < 0 0 0 o 0 0 o 0 0 0 0 0 0 0 =) 0 r» o o 0 o 0 o =) o 0 0 o 0 0 0 0 o < 0 0</td><td> 0 O 0 O =) < o o o 0 o $ 0 0 0 0 0 < 0 0 O O < 0 o 0 o δ o 0 0 0 0 0 0</td><td> 0 3 0 0 0 0 0 § < 0 0 0 0 0 0 0 0 0 0 δ 0 0 0 δ 0 δ 0 S 0 0 0</td><td> CAUGUCUACAACAAUCUCGCCCGUUGAGUCUCGUCGAAUU</td><td> CGAUCUUUUCGUCAACCGCACGUUGAACUCGGCUCGGCAC</td><td> CACCCGUCCGUCCAAAUCCGCUUCGUUGGACCCCAUCUU</td>

CA 02425208 2003-03-26

II.G.1. Techniques for Identifying Improved Nucleic Acid Ligands

In order to produce nucleic acids desirable for use as a pharmaceutical, it is preferred that the nucleic acid ligand binds to the target in a manner capable of achieving the desired effect on the target; be as small as possible to obtain the desired effect; be as stable as possible; and be a specific ligand to the chosen target. In most, if not all, situations it is preferred that the nucleic acid ligand has the highest possible affinity to the target. Modifications or derivatizations of the ligand that confer resistance to degradation and clearance in situ during therapy, the capability to cross various tissue or cell membrane barriers, or any other accessory properties that do not significantly interfere with affinity for the target molecule can also be provided as improvements.

One of the uses of nucleic acid ligands derived by SELEX or another approach is to find ligands that alter target molecule function. Thus, it is a good procedure to first assay for inhibition or enhancement of function of the target protein. One could even perform such functional tests of the combined ligand pool prior to cloning and sequencing. Assays for the biological function

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-48of the chosen target are generally available and known to those skilled in the art, and can be easily performed in the presence of the nucleic acid ligand to determine if inhibition occurs.

Enrichment will supply a number of cloned ligands of probable variable affinity for the target molecule. Sequence comparisons can yield consensus secondary structures and primary sequences that allow grouping of the ligand sequences into motifs. Although a single ligand sequence (with some mutations) can be found frequently in the total population of cloned sequences, the degree of representation of a single ligand sequence in the cloned population of ligand sequences cannot absolutely correlate with affinity for the target molecule. Therefore mere abundance is not the sole criterion for judging winners after SELEX and binding assays for various ligand sequences (adequately defining each motif that is discovered by sequence analysis) are required to weigh the significance of the consensus arrived at by sequence comparisons. The combination of sequence comparison and affinity assays should guide the selection of candidates for more extensive ligand characterization.

An important avenue for narrowing down what amount of sequence is relevant to specific affinity is to establish the boundaries of that information within a ligand sequence. This is conveniently accomplished by selecting end-labeled fragments from hydrolyzed pools of the ligand of interest so that 5' and 3' boundaries of the information can be discovered. To determine a 3' boundary, one can perform a large-scale in vitro transcription of the PCR’d ligand, gel purifies the RNA using UV shadowing on an intensifying screen, phosphatases the purified RNA, phenol extracts extensively, labels by kinasing with 32P, and gel purifies the labeled product (using a film of the gel as a guide). The resultant product can then be subjected to pilot partial digestions with RNase T1 (varying enzyme concentration and time, at 50°C. in a buffer of 7M urea, 50 mM sodium citrate pH 5.2) and alkaline hydrolysis (at 50 mM NaCO3, adjusted to pH 9.0 by prior mixing of 1M bicarbonate and carbonate solutions; test over ranges of 20 to 60 minutes at 95°C). Once optimal conditions for alkaline hydrolysis are established (so that there is an

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-49even distribution of small to larger fragments) one can scale up to provide enough material for selection by the target (usually on nitrocellulose filters).

One then sets up binding assays, varying target protein concentration from the lowest saturating protein concentration to that protein concentration at which approximately 10% of RNA is bound as determined by the binding assays for the ligand. One should vary target concentration (if target supplies allow) by increasing volume rather than decreasing absolute amount of target; this provides a good signal to noise ratio as the amount of RNA bound to the filter is limited by the absolute amount of target. The RNA is eluted as, for example, in SELEX and then run on a denaturing gel with T1 partial digests so that the positions of hydrolysis bands can be related to the ligand sequence.

The 5' boundary can be similarly determined. Large-scale in vitro transcriptions are purified as described above. There are two methods for labeling the 3' end of the RNA. One method is to kinase Cp with 32P (or purchase 32P-Cp) and ligate to the purified RNA with RNA ligase. The labeled RNA is then purified as above and subjected to very identical protocols. An alternative is to subject unlabeled RNÂs to partial alkaline hydrolyses and extend an annealed, labeled primer with reverse transcriptase as the assay for band positions. One of the advantages over pCp labeling is the ease of the procedure, the more complete sequencing ladder (by dideoxy chain termination sequencing) with which one can correlate the boundary, and increased yield of assayable product. A disadvantage is that the extension on eluted RNA sometimes contains artifactual stops, so it can be important to control by spotting and eluting starting material on nitrocellulose filters without washes and assaying as the input RNA.

The result is that it is possible to find the boundaries of the sequence information required for high affinity binding to the target.

H.G.2. Assessment of Nucleotide Contributions to Affinity

Once a minimal high affinity ligand sequence is identified, it can be useful to identify the nucleotides within the boundaries that are crucial to the interaction with the target molecule. One method is to create a new random

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-50template in which all of the nucleotides of a high affinity ligand sequence are partially randomized or blocks of randomness are interspersed with blocks of complete randomness for use in a SELEX method for example, preferably a modified or toggle SELEX method as disclosed herein. Such secondary SELEXes produce a pool of ligand sequences in which crucial nucleotides or structures are absolutely conserved, less crucial features preferred, and unimportant positions unbiased. Secondary SELEXes can thus help to further elaborate a consensus that is based on relatively few ligand sequences. In addition, even higher-affinity ligands can be provided whose sequences were unexplored in the original SELEX.

Another method is to test oligo-transcribed variants (i.e. nucleotide substituion) where the consensus sequence can be unclear.

Another useful set of techniques are inclusively described as chemical modification experiments. Such experiments can be used to probe the native structure of RNAs, by comparing modification patterns of denatured and nondenatured states. The chemical modification pattern of an RNA ligand that is subsequently bound by target molecule can be different from the native pattern, indicating potential changes in structure upon binding or protection of groups by the target molecule. In addition, RNA ligands will fail to be bound by the target molecule when modified at positions crucial to either the bound structure of the ligand or crucial to interaction with the target molecule. Such experiments in which these positions are identified are described as chemical modification interference experiments.

There are a variety of available reagents to conduct such experiments that are known to those skilled in the art (see, Ehresmann et al., Nuc. Acids. Res., 15:9109-9128, (1987)). Chemicals that modify bases can be used to modify ligand RNAs. A pool is bound to the target at varying concentrations and the bound RNAs recovered (much as in the boundary experiments) and the eluted RNAs analyzed for the modification. An assay can be by subsequent modification-dependent base removal and aniline scission at the baseless position or by reverse transcription assay of sensitive (modified) positions. In such assays bands (indicating modified bases) in unselected

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-51RNAs appear that disappear relative to other bands in target protein-selected RNAs. Similar chemical modifications with ethylnitrosourea, or via mixed chemical or enzymatic synthesis with, for example, 2'-methoxys on ribose or phosphorothioates can be used to identify essential atomic groups on the backbone. In experiments with 2'-methoxy vs. 2'-OH mixtures, the presence of an essential OH group results in enhanced hydrolysis relative to other positions in molecules that have been stringently selected by the target.

Comparisons of the intensity of bands for bound and unbound ligands can reveal not only modifications that interfere with binding, but also modifications that enhance binding. A ligand can be made with precisely that modification and tested for the enhanced affinity. Thus chemical modification experiments can be a method for exploring additional local contacts with the target molecule, just as walking (see below) is for additional nucleotide level contacts with adjacent domains.

A consensus of primary and secondary structures that enables the chemical or enzymatic synthesis of oligonucleotide ligands whose design is based on that consensus is provided herein via a SELEX method, preferably a modified or toggle SELEX method as disclosed herein. Because the replication machinery of SELEX requires that rather limited variation at the subunit level (ribonucleotides, for example), such ligands imperfectly fill the available atomic space of a target molecule's binding surface. However, these ligands can be thought of as high-affinity scaffolds that can be derivatized to make additional contacts with the target molecule. In addition, the consensus contains atomic group descriptors that are pertinent to binding and atomic group descriptors that are coincidental to the pertinent atomic group interactions. Such derivatization does not exclude incorporation of cross-linking agents that will give specifically directly covalent linkages to the target protein. Such derivatization analyses can be performed at but are not limited to the 2' position of the ribose, and thus can also include derivatization at any position in the base or backbone of the nucleotide ligand.

The present invention thus includes nucleic acid ligands wherein certain chemical modifications have been made in order to increase the in

CA 02425208 2009-12-15

-52vivo stability of the ligand or to enhance or mediate the delivery of the ligand. Examples of such modifications include chemical substitutions at the ribose and/or phosphate positions of a given RNA sequence. See, e.g.. Cook et ai., PCT Application WO 9203568; U.S. Pat. No. 5,118,672 to Schinazi et ai.: Hobbs et al., Biochem 12:5138 (1973); Guschlbauer et al., Nucleic Acids Res. 4:1933 (1977); Shibahara et al., Nucl. Acids. Res. 15:4403 (1987); Pieken et al., Science 253:314 (1991).

A logical extension of this analysis is a situation in which one or a few nucleotides of the polymeric ligand is used as a site for chemical derivative exploration. The rest of the ligand serves to anchor in place this monomer (or monomers) on which a variety of derivatives are tested for non-interference with binding and for enhanced affinity. Such explorations can result in small molecules that mimic the structure of the initial ligand framework, and have significant and specific affinity for the target molecule independent of that nucleic acid framework. Such derivatized subunits, which can have advantages with respect to mass production, therapeutic routes of administration, delivery, clearance or degradation than the initial ligand, can become the therapeutic and can retain very little of the original ligand. Thus, the aptamer ligands of the present invention can allow directed chemical exploration of a defined site on the target molecule known to be important for the target function.

H.F.3. Walking Experiments

After a minimal consensus ligand sequence has been determined for a given target, it is possible to add random sequence to the minimal consensus ligand sequence and evolve additional contacts with the target, perhaps to separate but adjacent domains. This procedure has been referred to in the art as walking.

A walking experiment can involve two experiments performed sequentially. A new candidate mixture is produced in which each of the members of the candidate mixture has a fixed nucleic acid region that corresponds to a nucleic add ligand of interest Each member of the

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-53candidate mixture also contains a randomized region of sequences. According to this method it is possible to identify what are referred to as extended nucleic acid ligands, which contain regions that can bind to more than one binding domain of a target.

1I.F.4. Covariance Analysis

PCT/US01/30004

-56instead of the three (x,y,z) coordinates typically considered. Interatomic distances between every atom are recorded in an N-by-N distance matrix. A complete and precise distance matrix is easily transformed into a 3 by N Cartesian coordinates, using matrix algebra operations. The trick of distance geometry as applied to NMR is dealing with incomplete (only some of the interatomic distances are known) and imprecise data (distances are known to a precision of only a few angstroms at best). Much of the time of distance geometry-based structure calculation is thus spent in pre-processing the distance matrix, calculating bounds for the unknown distance values based on the known ones, and narrowing the bounds on the known ones. Usually, multiple structures are extracted from the distance matrix that are consistent with a set of NMR data; if they all overlap nicely, the data were sufficient to determine a unique structure. Unlike NMR structure determination, covariance gives only imprecise distance values; but also only probabilistic rather than absolute knowledge about whether a given distance constraint should be applied.

Restrained molecular dynamics can also be employed, albeit in a more ad hoc manner. Given an empirical force field that attempts to describe the forces that all the atoms feel (van der Waals, covalent bonding lengths and angles, electrostatics), one can simulate a number of femtosecond time steps of a molecule's motion, by assigning every atom at a random velocity (from the Boltzmann distribution at a given temperature) and calculating each atom's motion for a femtosecond using Newtonian dynamical equations; that is molecular dynamics. In restrained molecular dynamics, one assigns extra ad hoc forces to the atoms when they violate specified distance bounds.

With respect to RNA aptamers, the probabilistic nature of data with restrained molecular dynamics can be addressed. The covariation values can be transformed into artificial restraining forces between certain atoms for certain distance bounds; varying the magnitude of the force according to the magnitude of the covariance.

NMR and covariance analysis generates distance restraints between atoms or positions, which are readily transformed into structures through

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-57distance geometry or restrained molecular dynamics. Another source of experimental data which can be utilized to determine the three dimensional structures of nucleic acids is chemical and enzymatic protection experiments, which generate solvent accessibility restraints for individual atoms or positions.

ll.H. Utility of the Aptamers

The aptamers and modified aptamers of the invention are useful in diagnostic, research and therapeutic contexts. For diagnostic applications, aptamers are particularly well suited for binding to biomolecules that are identical or similar between different species. Classes of molecules such as coagulation factors and transcription factors generally do not serve as good antigens because they are not easily recognized as foreign by the immune systems of animals that can be used to generate antibodies. Antibodies are generally used to bind analytes that are detected or quantitated in various diagnostic assays. Aptamers represent a class of molecules that can be used in place of antibodies for diagnostic and purification purposes.

The aptamers of the invention are therefore particularly useful as diagnostic reagents to detect the presence or absence of the target substances to which they specifically bind. Such diagnostic tests are conducted by contacting a sample with the specifically binding oligonucleotide to obtain a complex that is then detected by conventional techniques. For example, the aptamers can be labeled using radioactive, fluorescent, or chromogenic labels and the presence of label bound to solid support to which the target substance has been bound through a specific or nonspecific binding means detected. Alternatively, the specifically binding aptamers can be used to effect initial complexation to the support. Techniques for conducting assays using such oligomers as specific binding partners are generally known to track those for standard specific binding partner based assays.

This invention also permits the recovery and deduction of oligomeric sequences that bind specifically to target proteins and specific portions thereof. Therefore, these oligonucleotides can be used as a separation tool

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-58for retrieving the substances to which they specifically bind. By coupling the oligonucleotides containing the specifically binding sequences to a solid support, for example, proteins or other cellular components to which they bind can be recovered in useful quantities. In addition, these oligonucleotides can be used in diagnosis by employing them in specific binding assays for the target substances. When suitably labeled using detectable moieties such as radioisotopes, the specifically binding oligonucleotides can also be used for in vivo imaging or histological analysis.

It can be commented that the mechanism by which the specifically binding oligomers of the invention interfere with or inhibit the activity of a target substance is not always established, and is not a part of the invention. The oligomers of the invention are characterized by their ability to target specific substances regardless of the mechanisms of targeting or the mechanism of the effect thereof.

For use in research, the specifically binding oligonucleotides of the invention are especially helpful in effecting the isolation and purification of substances to which they bind. For this application, typically, the oligonucleotide containing the specific binding sequences is conjugated to a solid support and used as an affinity ligand in chromatographic separation of the target substance. The affinity ligand can also be used to recover previously unknown substances from sources that do not contain the target substance by virtue of binding similarity between the intended target and the unknown substances. Furthermore, as data accumulate with respect to the nature of the nonoligonucleotide/oligonucleotide-specific binding, insight can be gained as to the mechanisms for control of gene expression.

The aptamers described herein can be used as a separation reagent for retrieving the targets to which they specifically bind. By coupling the oligonucleotides containing the specifically binding sequences to a solid support, for example, the target substances can be recovered in useful quantities. In addition, these oligonucleotides can be used in diagnosis by employing them in specific binding assays for the target substances. When suitably labeled using detectable moieties including radioisotopes such as

CA 02425208 2009-12-15

-5919F, 99mTc, 1811, Y, 111ln, 123l, 1SN, 32P or 33P, the specifically binding oligonucleotides can also be used for in vivo or in vitro diagnosis, imaging or histological analysis by techniques known in the art.

For application in such various uses, the aptamers of the invention can be coupled to auxiliary substances that enhance or complement the function of the aptamer. Such auxiliary substances include, for example, labels such as radioisotopes, fluorescent labels, enzyme labels and the like; specific binding reagents such as antibodies, additional aptamer sequence, cell surface receptor ligands, receptors per se and the like; toxins such as diphtheria toxin, tetanus toxin or ricin; drugs such as antiinflammatory, antibiotic, or metabolic regulator pharmaceuticals, solid supports such as chromatographic or electrophoretic supports, and the like. Suitable techniques for coupling of aptamers to desired auxiliary substances are generally known for a variety of such auxiliary substances, and the specific nature of the coupling procedure will depend on the nature of the auxiliary substance chosen. Coupling can be direct covalent coupling or can involve the use of synthetic linkers such as those marketed by Pierce Chemical Co., Rockford, Illinois.

Thus, the aptamers or modified aptamers of the invention can be used alone in therapeutic applications or can be used as targeting agents to deliver pharmaceuticals or toxins to desired targets. The aptamers can be used in diagnostic procedures and advantageously in this application include label. They can be used as reagents to separate target molecules from contaminants in samples containing the target molecules in which application they are advantageously coupled to solid support

Ut Synthesis of RNA Aptamers

In a representative embodiment of the present invention, an RNA aptamer is synthesized on a solid support column, using conventional techniques such as those described by Beaucage et ai. (1981) Tetrahedr. Letters 22:1859-1862 and Sinha et al., (1984) Nucleosides and Nucleotides 3:157-171. The final DMT-group is removed from the resulting RNA aptamer. Alternately, if large-scale

CA 02425208 2009-12-15

-60synthesis is used, the RNA aptamer can be made by scale-up of the solid support method or the RNA aptamer can be made by using solution phase techniques, particularly if the desired end-product is a relatively short oligonucleotide. A starting material for the synthesis process can be a 5'-nontritylated RNA oiigoribo-nucieotide or analog of the desired primary structure, which preferably can have protected bases, and which is preferably bound to a solid-support. Any conventionally used protecting groups can be used. Typically Ne -benzoyl is used for adenine, N4 -benzoyl for cytosine, N2 isobutyryl for guanine and N2 -benzoyl for 2-amino purine. Other useful protecting groups include phenoxyacetyi (PAC) and t-butoxyacetyi (TAC). Conveniently, the more base labile protection groups should be used for the synthesis of the RNA or analog fragment; those of ordinary skill in the art know these groups. Such groups can help to prevent hydrolysis of the generated tri- or diphosphates, which are generally- quite stable under basic conditions, but could be subject to some hydrolysis. Other envisioned modifications are disclosed in U.S. Patent No. 6,011,020, and include but are not limited to the incorporation of bioavailability enhancing molecules such as PEG or cholesterol via a covalent linkage.

A capped RNA or analog of this invention can be of any length, the only limit being that of the synthesis technique employed to prepare the RNA or analog. Currently, a preferred length Is ranges from approximately 15 to 100 bases, but with improvements in synthetic technology the length of the oligonucleotide is expected to increase. For purposes of this invention, it is preferred that the capped RNA or analog be less than approximately 100 bases in length, and preferably less than about 40 bases in length.

In addition, nucleoside analogs such as 2’-deoxy, 2'-halo, 2’-amino (not substituted or mono- or disubstituted), 2'-mono, di- or trihaiomethyf, 2*-Oaikyi, 2'-O-halo-substituted alkyl, 2*-alkyl, azido, phosphorothioate, sulfhydryi, methylphosphonate, fluorescein, rhodamine, pyrene, biotin, xanthine, hypoxanthine, 2,6-diamino purine, 2-hydroxy-6-meFcaptopurine and pyrimidine bases substituted at the 6-position with sulfur or 5 position with

CA 02425208 2009-12-15

-61-.

halo or C1.5 alkyl groups, abasic linkers, 3’-deoxy-adenosine as well as other available chain terminator or non-extendible analogs (at the 3'-end of the RNA), and the like can be incorporated during the RNA synthesis. Further, various labels such as 32P or MP and the like can likewise be incorporated during the synthesis, resulting in novel RNA analogs produced by this process. Other envisioned modifications are disclosed in U.S. Patent No. 6,011,020, and include but are not limited to the incorporation of 3’ caps, such an inverted DT cap, or an inverted abasic cap, or combination thereof.

IV. Therapeutic Methods

A method of modulating tiie biological activity of a coagulation pathway factor is provided in accordance with the present invention. In a preferred embodiment, the method comprises: (a) administering to a warm blooded vertebrate in need thereof an effective amount of an RNA aptamer that selectively binds a coagulation pathway factor, the RNA aptamer having a dissociation constant for the coagulation pathway factor of about 20 nM or less; and (b) modulating the biological activity of the coagulation pathway factor in the warm-blooded vertebrate through the administering of the RNA aptamer in step (â).

A method cf modulating E2F activity in a warm-blooded vertebrate in which such modulation is desired is also provided. The method comprises: (a) administering to the warm-blooded vertebrate an effective amount of an RNA aptamer that selectively binds an E2F family member, the RNA aptamer having a dissociation constant for the E2F family member of about 20 nM or

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-62less; and (b) modulating E2F in the warm-blooded vertebrate through the administering of the RNA aptamer of step (a).

The patient treated in the present invention in its many embodiments is desirably a human patient, although it is to be understood that the principles of the invention indicate that the invention is effective with respect to all vertebrate species, including warm-blood vertebrates (e.g. birds and mammals), which are intended to be included in the term patient. In this context, a mammal is understood to include any mammalian species in which treatment of cardiovascular disease is desirable, particularly agricultural and domestic mammalian species.

Contemplated is the treatment of mammals such as humans, as well as those mammals of importance due to being endangered (such as Siberian tigers), of economical importance (animals raised on farms for consumption by humans and/or social importance (animals kept as pets or in zoos) to humans, for instance, carnivores other than humans such as cats and dogs), swine (pigs, hogs, and wild board), ruminants (such as cattle, oxen, sheep, giraffes, deer goats, bison, and camels), and horses. Also contemplated is the treatment of birds, including the treatment of those kinds of birds that are endangered, kept in zoos, as well as fowl, and more particularly domesticated fowl, i.e., poultry, such as turkeys, chickens, ducks, geese, guinea fowl, and the like, as they are also of economical importance to humans.

The present method for treating cardiovascular disease in a tissue contemplates contacting a tissue in which cardiovascular disease is occurring, or is at risk for occurring, with a composition comprising a therapeutically effective amount of an RNA aptamer capable of binding a coagulation factor. Thus, the method comprises administering to a patient a therapeutically effective amount of a physiologically tolerable composition containing the RNA aptamer.

The dosage ranges for the administration of the RNA aptamer depend upon the form of the modulator, and its potency, as described further herein, and are amounts large enough to produce the desired effect in which coagulation is modulated, which can correspondingly ameliorate

CA 02425208 2003-03-26

For liquid forms the active drug component can be combined in suitably flavored suspending or dispersing agents such as the synthetic and natural gums, for example, tragacanth, acacia, methyl-cellulose and the like. Other dispersing agents that can be employed include glycerin and the like. For parenteral administration, sterile suspensions and solutions are desired. Isotonic preparations that generally contain suitable preservatives are employed when intravenous administration is desired.

Topical preparations containing the active drug component can be admixed with a variety of carrier materials well known in the art, such as, e.g., alcohols, aloe vera gel, allantoin, glycerine, vitamin A and E oils, mineral oil, PPG2 myristyl propionate, and the like, to form, e.g., alcoholic solutions, topical cleansers, cleansing creams, skin gels, skin lotions, and shampoos in cream or gel formulations.

The compounds of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine or phosphatidylcholines.

The compounds of the present invention can also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinyl-pyrrolidone, pyran copolymer, polyhydroxypropylmethacrylamidephenol, polyhydroxy-ethylaspartamidephenol, or polyethyleneoxidepolylysine substituted with palmitoyl residues. Furthermore, the compounds of the present invention can be coupled (preferably via a covalent

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-69linkage) to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polyethylene glycol (PEG), polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydro-pyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels. Cholesterol and similar molecules can be linked to the aptamers to increase and prolong bioavailability.

V. Methods of Identifying Aptamers

A method of identifying a ligand to a target from a candidate mixture of potential ligands is also provided in accordance with the present invention. Products, i.e. ligands, produced or identified by a method of the present invention are also provided.

In one embodiment the method preferably comprises: (a) preparing a candidate mixture of potential ligands; (b) contacting the candidate mixture with a target substrate in a lower stringency buffer, wherein ligands having increased affinity to the target relative to the candidate mixture bind to the target; (c) removing unbound candidate mixture; and (d) collecting the ligands that are bound to the target to produce a first collected ligand mixture. More preferably, the method further comprises: (e) contacting the first collected ligand mixture with the target in a higher stringency buffer, wherein ligands having increased affinity to the target relative to the first collected ligand mixture bind to the target; (f) removing unbound ligands; and (g) collecting the ligands that are bound to the target to produce a second collected ligand mixture to thereby identify ligands to the target. Even more preferably, ligands in the first or second collected ligand mixture are enriched or expanded by any suitable technique, e.g. amplification, prior to contacting the first collected ligand mixture with the target in the higher stringency buffer, after collecting the ligands that bound the target in the higher stringency buffer, or both. Optionally, the contacting and expanding or enriching steps are repeated as necessary to produce a desired ligand.

In an alternative embodiment, the method comprises: (a) immobilizing a target on a substrate; (b) preparing a candidate mixture of

CA 02425208 2009-12-15

-70potential ligands; (c) passing the candidate mixture over the substrate in a lower stringency buffer, wherein ligands having increased affinity to the immobilized target relative to the candidate mixture bind to the immobilized target; (d) passing a wash buffer over the substrate to remove unbound candidate mixture; (e) passing an eluting buffer over the substrate to elute the ligands that are bound to the immobilized target to produce an eluted ligand mixture; (f) passing the eluted ligand mixture over a substrate comprising immobilized target in a higher stringency buffer, wherein ligands having increased affinity to the immobilized target relative to the eluted ligand mixture bind to the immobilized target; (g) passing a wash buffer over the substrate to remove unbound ligands; and (h) passing an eluting buffer over the substrate to elute the ligands that are bound to the immobilized target to thereby identify ligands to the target With respect to the alternative embodiment, it also preferred that ligands in the eluted ligand mixture are enriched or expanded by any suitable technique, e.g. amplification, prior to contacting the eluted ligand mixture with the target in the higher stringency buffer, after eluting ligands that bound the target in the higher stringency buffer, or both. Optionally, the contacting and expanding or enriching steps are repeated as necessary to produce as desired ligand. Thus, it is possible that the second collected ligand mixture can comprise a single ligand.

The method is applicable to any target as defined herein for which a ligand is sought. Representative targets are also disclosed in U.S. Patent Nos. 5,756,291 and 5,817,785. In a preferred embodiment, the method further comprises amplifying the eluted ligand to yield a ligand-enriched mixture, whereby a ligand to the target is identified. The ligand mixture can comprise a candidate mixture of any ligand as defined herein, including but not limited to nucleic acids. In this case, the candidate mixture of nucleic acids comprises single strand nucleic adds. The single stranded nudeic adds can comprise deoxyribonudeic adds.

Preferably, the single stranded nudeic adds are ribonudeic adds. In this case amplification can be accomplished, for example, via reverse transcriptase PCR reactions, as disdosed In U.S. Patent No. 5,817,785.

WO 02/026932

PCT/US01/30004

-74(5) By repeating the partitioning and amplifying steps above, the newly formed candidate mixture contains fewer and fewer unique sequences, and the average degree of affinity of the nucleic acids to the target will generally increase. Taken to its extreme, the SELEX process will yield a candidate mixture containing one or a small number of unique nucleic acids representing those nucleic acids from the original candidate mixture having the highest affinity to the target molecule.

The desired characteristics for a given nucleic acid ligand can vary. All nucleic acid ligands are capable of forming a complex with the target. In some cases, it is desired that the nucleic acid ligand will serve to inhibit one or more of the biological activities of the target. In other cases, it is desired that the nucleic acid ligand serves to modify one or more of the biological activities of the target. In other cases, the nucleic acid ligand serves to identify the presence of the target, and its effect on the biological activity of the target is irrelevant.

In order to identify conditions that are preferred for the initiation of the SELEX process (i.e., signal to noise ratio >2) a matrix strategy to test for target dependent versus target independent binding of the library under different conditions is provided in accordance with the present invention. While this strategy is employed to identify SELEX conditions that are physiologic or that approach physiologic for the target protein, it could readily be applied to identify very non-physiologic conditions if one desired to use an aptamer in downstream processes that require solvents that are nonphysiologic.

In one embodiment of the matrix, the monovalent salt concentration and pH of the binding buffer are varied in combination to test monovalent salt concentrations from 10 (low stringency) to 150 mM (high stringency) and a pH range from 7.0-8.0 in binding reactions with radiolabeled randomized library RNA and varying concentrations of target protein. All binding buffers also contain physiologic concentrations of the appropriate divalent metal ions (depends on the in vivo compartment of the target) and excipient as needed to maintain the protein in solution in a native state. This systematic variation

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-75of these critical parameters allows for the rapid identification of the buffer conditions and target concentration under which the SELEX process can be successfully initiated. In some cases, the initial conditions are nonphysiologic with respect to the monovalent salt concentration, the pH, or both. In these cases, the matrix strategy can be employed again in subsequent rounds of the SELEX process to determine when the conditions (i.e. binding buffer) of the SELEX can be changed. This strategy is repeated every few rounds until the SELEX process can be continued under physiologic conditions.

V.B. Toggle Method

The method preferably comprises: (a) providing a target selected from a first species of organism; (b) preparing a candidate mixture of potential ligands; (c) contacting the candidate mixture with the target, wherein ligands having increased affinity to the target from the first species of organism relative to the candidate mixture bind to the immobilized target from the first species of organism; (d) removing unbound candidate mixture; (e) collecting the ligands that are bound to the target from the first species of organism to produce a first collected ligand mixture for the target; (f) contacting the first collected ligand mixture with a target from a second species of organism, the target from the second species having at least a portion thereof that is substantially homologous to the same portion in the target from the first species, wherein ligands having increased affinity to the target from the second species relative to the first collected ligand mixture bind to the target; (g) removing unbound first collected ligand mixture; and (h) collecting the ligands that are bound to the target from the second species of organism to form a second collected ligand mixture thereby identify ligands to the target.

Preferably, ligands in the first or second collected ligand mixture are enriched or expanded by any suitable technique, e.g. amplification, prior to

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-76contacting the first collected ligand mixture with the target from the second species of organism, after collecting the ligands that bound the target from the second species of organism, or both. Optionally, the contacting and expanding or enriching steps are repeated as necessary to produce a desired ligand. Thus, it is possible that the second collected ligand mixture can comprise a single ligand.

Another embodiment of a method of identifying a ligand to a target from a candidate mixture of potential ligands in accordance with the present invention comprises: (a) immobilizing a target on a substrate, the target comprising a target selected from a first species of organism; (b) preparing a candidate mixture of potential ligands; (c) passing the candidate mixture over the substrate, wherein ligands having increased affinity to the immobilized target from the first species of organism relative to the candidate mixture bind to the immobilized target from the first species of organism; (d) passing a wash buffer over the substrate to remove unbound candidate mixtures; (e) passing an eluting buffer over the substrate to elute the ligands that are bound to the immobilized target from the first species of organism to produce an eluted ligand mixture; (f) passing the eluted ligand mixture over a substrate comprising an immobilized target from a second species of organism, the target from the second animal species contacting the first collected ligand mixture, the target from the second species having at least a portion thereof that is substantially homologous to the same portion in the target from the first species, wherein ligands having increased affinity to the target from the second species relative to the first collected ligand mixture bind to the immobilized target; (g) passing a wash buffer over the substrate to remove unbound eluted ligand mixture; and (h) passing an eluting buffer over the substrate to elute the ligands that are bound to the immobilized target from the second species of organism to thereby identify ligands to the target.

Preferably, ligands in the first or second collected ligand mixture are enriched or expanded by any suitable technique, e.g. amplification, prior to contacting the first collected ligand mixture with the target from the second species of organism, after collecting the ligands that bound the target from

CA 02425208 2009-12-15

-77the second species of organism, or both. Optionally, the contacting and expanding or enriching steps are repeated as necessary to produce a desired ligand. Thus, it is possible that the second collected ligand mixture can comprise a single ligand.

Optionally, the method can further comprise further comprising step (i): repeating steps (f), (g) and (h) one or more times, wherein each additional time alternates between the target from the first species and the target from the second species. The method can also further comprise amplifying the eluted iigand to yield a ligand-enriched mixture, whereby a figand to the target is identified.

The method is applicable to any target and to any ligand as defined herein for which a ligand is sought Representative targets are also disclosed in U.S. Patent No. 5,756,291 - Alternation of the target between homologous proteins of different species ensures that the products of selection will bind to both proteins, most likely to domains conserved between the two proteins. Because conserved domains tend to be functionally important, driving the selection with homologous proteins can be advantageous even when species cross-reactivity is not necessarily sought. Similarly, the toggle approach is generalizable to homologous proteins of different viral strains and to related proteins of the same species (such as receptor or ligand families with redundant or overlapping function), where cross-reactivity can improve in vivo efficacy. Thus, the phrase “the target from the second species having at least a portion thereof that is substantially homologous to the same portion in the target from the first species includes but is not limited to conserved domains.

The term “substantially homologous in the context of two or more polypeptide sequences is measured by polypeptide sequences having about 35%, or 45%, or preferably from 45-55%, or more preferably 55-65%, or most preferably 65% or greater amino adds which are identical or functionally equivalent Percent “identity” and methods for determining identity are defined herein below. Further, this term also encompasses proteins typically

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-78referred to in the art as homologues, e.g. porcine and human thrombin as disclosed in the Examples.

Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman (1981) Adv Appl Math 2:482, by the homology alignment algorithm of Needleman and Wunsch (1970) J Mol Biol 48:443, by the search for similarity method of Pearson and Lipman (1988) Proc Natl Acad Sci USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, WI), or by visual inspection (See generally, Ausubel et al. (1992)).

A preferred algorithm for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al. (1990) J Mol Biol 215: 403-410. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positivevalued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached. The BLAST algorithm

CA 02425208 2009-12-15

-79parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength W=11, an expectation E=10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino add sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. See Henikoff and Henikoff (1989) Proc Natl Acad Sci USA 89:10915.

In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences. See, e.g., Karlin and Altschul (1993) Proc Natl Acad Sci USA 90:5873-5887. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nudeotide or amino add sequences would occur by chance. For example, a test nudeic add sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nudeic add sequence to the reference nudeic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

In a preferred embodiment, the method further comprises amplifying the eluted ligand to yield a ligand-enriched mixture, whereby a ligand to the target is identified. The ligand mixture can comprise a candidate mixture of nudeic adds. In this case, the candidate mixture of nudeic adds can comprise single strand nudeic adds. The single stranded nudeic adds can comprise deoxyribonudeic adds.

Preferably, the single stranded nudeic adds are ribonudeic adds. In this case amplificatiori can be accomplished, for example, via reverse transcriptase PCR reactions, as dlsdosed in U.S. Patent No. 5,817,785.

Even more preferably, the candidate mixture of nudeic adds comprises 2’-modified ribonucleic adds. Even more preferably, the 2'-modified ribonudeic adds comprise 2’-fluoro (2*-F) modified nudeic adds.

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-80Contemplated species of organism include plants, animals, bacteria, fungi, viruses or other organism. Preferred species of animals include warmblooded vertebrates, including but not limited to humans, rats, mice, pigs, apes, monkeys, cats, dogs, cattle, oxen, sheep, goats and horses, or other mammal typically used in experiments. Additional species include domesticated fowl, i.e., poultry, such as turkeys, chickens, ducks, geese, guinea fowl, and the like, as they are also of economical importance to humans. Thus, the term “avian” as used herein refers to any avian species, including but not limited to Gallinacea sp., chicken, turkey, duck, goose, quail and pheasant. Chicken is currently preferred.

Fish represent a category of animais of interest for agricultural and ecological reasons. Representative fish species include, but are not limited to, trout, salmon, carp, shark, ray, flounder, sole, tilapia, medaka, goldfish, guppy, molly, platyfish, swordtail, zebrafish, loach, catfish, and the like. Representative general techniques that are applicable to fish have been described by Ozato et al, Cell Differ., 19:237-244 (1986), Inoue et al, Cell Differ. Dev., 29:123-128 (1990), Rokkones et al, J. Comp. Physiol. B, 158:751-758 (1989), and Guyomard et al, Biochimie, 71:857-863 (1989), describing preparation of transgenic medaka, medaka, salmon and trout, respectively.

Laboratory Examples

The following Laboratory Examples have been included to illustrate preferred modes of the invention. Certain aspects of the following Laboratory Examples are described in terms of techniques and procedures found or contemplated by the present inventors to work well in the practice of the invention. These Laboratory Examples are exemplified through the use of standard laboratory practices of the inventors. In light of the present disclosure and the general level of skill in the art, those of skill will appreciate that the following examples are intended to be exemplary only and that numerous changes, modifications and alterations can be employed without departing from the spirit and scope of the invention.

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-81Example 1

Initial condition matrix to coagulation factor Vila

Referring now to Figure 8, radiolabeled 2’fluoropyrimidine-modified library RNA was incubated with varying concentrations of coagulation factor Vila in 9 different buffers, and target-bound versus free RNA was determined using the double-filter nitrocellulose filter binding assay (Wong and Lohman, 1993, Proc. Natl. Acad. Sci. USA 90, 5428-5432). For all conditions, the binding buffers contain 20 mM Hepes at the pH shown, 2 mM CaCl2, and NaCl at the concentration shown. From the left to right in each set of 4, the factor Vila concentration is 5 μΜ, 1.67 μΜ, 0.56 μΜ and no target. The fraction of the pool that binds factor Vila decreases dramatically as the monovalent salt increases, but is relatively unaffected by the change of pH at a given NaCl concentration. In addition, the fraction of RNA bound in the absence of target is much greater at lower NaCl concentrations and lower pH.

In this Example, there is essentially no target binding above background under physiologic conditions (pH 7.4, 150 mM NaCl). Thus, if the SELEX process were initiated under these conditions it would fail outright. Likewise, at pH 7.0, 50 mM NaCl, there is significant target dependent binding, but also significant target independent binding. Were the SELEX initiated under these conditions, it would also likely fail. Preferred initiating conditions are pH 7.4, 50 mM NaCl, with a relatively high (μΜ) concentration of factor Vila.

Example 2

Initial Condition Matrix to Coagulation Factor IXa.

Referring now to Figure 9, radiolabeled 2’fluoropyrimidine-modified library RNA was incubated with varying concentrations of coagulation factor IXa in 6 different buffers, and target-bound versus free RNA was determined using the double-filter nitrocellulose filter binding assay. For all conditions, the binding buffers contain 20 mM Hepes at the pH shown, 2 mM CaCI2, and NaCl at the concentration shown. From left to right in sets of 6, the FIXa

CA 02425209 2003-03-26

WO 02/026932

PCT/US01/30004

-82concentration decreases 2 fold at each point from 5 μΜ to 0.31 μΜ, and the sixth point is the no target control.

PCT/US01/30004

-88interest followed by selection against a homologous molecule from another species. This process yields compounds that can be evaluated in a predetermined preclinical animal model by isolating molecules that crossreact with the species that is of interest.

As disclosed in this Example, an aptamer to human thrombin that cross reacts with human porcine thrombin has been produced using this method. Moreover, this toggle selection approach is expected to yield compounds that interact with functionally conserved regions of the target molecule that are likely to be the functionally important regions on the target.

Example 4

-91pig is clearly longer following injection of the cholesterol modified aptamer, RNA 9.3 truncated aptamer 9.3*'c (SEQ ID NO:70)-C, versus RNA 9.3 truncated aptamer 9.31 (SEQ ID NO:70). Following treatment with 9.3*, the effect persists out to between 15 to 20 minutes post injection, while following treatment with RNA 9.3 truncated aptamer 9.3*'c (SEQ ID NO:70)-C, the ACT is still elevated at the conclusion of the experiment (about 180 minutes). Data is presented in Figures 5A and 5B is the average of duplicate measurements at each time point.

Referring now to Figure 5C, the change in the PT and aPTT following treatment with cholesterol-modified aptamer is depicted. The increase in the PT or aPTT is the ratio of the (pre-injection clot time/post injection clot time) for each time point, 1.0=no change (time 0=pre-injection). The PT is sensitive to inhibitors of coagulation factors II, V, VII, and X, but not to inhibitors of factors VIII or IX. The aPTT is sensitive to inhibitors of factor IX/IXa. There is a clear dose-dependent increase in the aPTT of aptamer treated animals with the peak increase occurring at the earliest time point taken (1 minute); whereas the PT is unaffected by either aptamer (see also Figure 3C).

Continuing with Figure 5C, following treatment with RNA 9.3 truncated aptamer 9.3* (SEQ ID NO:70), the effect persists out to between about 30 minutes post injection (see also Figure 3C), while following treatment with RNA 9.3 truncated aptamer 9.3*'c (SEQ ID NO:70)-C, the aPTT is still elevated at the conclusion of the experiment (about 180 minutes). In addition, although both aptamers give a similar initial aPTT increase, the increase in the aPTT of the pig following injection of RNA 9.3 truncated aptamer 9.3*'c (SEQ ID NO:70)-C is greater than that increase following treatment with RNA 9.3 truncated aptamer 9.3* (SEQ ID NO:70). This indicates that the plasma concentration of RNA 9.3 truncated aptamer 9.3* (SEQ ID NO:70)-C decreases more slowly than the plasma concentration of RNA 9.3 truncated aptamer 9.3* (SEQ ID NO:70) following intravenous injection. Data is presented in Figure 5C is the average of duplicate measurements at each time point.

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-92Example 7

Inhibition of the Activity of Coagulation Factor Xa

RNA 10.14 (SEQ ID NO:73) inhibits the FXa/FVa catalyzed activation of prothrombin. As shown in Figure 7A, factor Xa (0.5 nM) was equilibrated with no RNA (A), 100 nM control RNA (), or 100 nM RNA 10.14 (·), the prothrombin activation reaction was initiated by the addition of FVa (1 nM), PC/PS vesicles (100 μΜ) and prothrombin (200 nM), and the amount of thrombin formed over time at 37°C was measured.

Referring now to Figure 7B, the clotting time of normal human plasma was measured in a PT assay in the absence of RNA (striped bar), or in the presence of increasing concentrations of control RNA (solid bar) or RNA 10.14 (open bar). The clotting time is expressed as the mean ± sem for duplicate measurements.

Example 8

Inhibition of Platelet Activation Using Thrombin RNA Aptamers

In this Example the ability of a thrombin RNA aptamer produced by the toggle SELEX method described in Example 3 to inhibit platelet activation was evaluated. Referring to Figs. 11 and 12, human platelets were isolated and activated by 1 nM human thrombin, in the presence of 30 nM toggle 25 (TOG 25, SEQ ID NO: 55) RNA aptamer or nitrocellulose-binding control RNA aptamer. The protease activated receptor-1 (PAR-1) peptide ligand, SFLLRN (SEQ ID NO: 72), was used as a positive control. As shown in Figure 12, the TOG 25 aptamer inhibited platelet activation to about 10%, which compared favorably to the platelet samples that included no activator.

Referring now to Figure 13, porcine platelets were isolated and activated by 2 nM porcine thrombin in the presence of the 20 nM TOG 25 RNA aptamer or nitrocellulose-binding control RNA aptamer. As shown in Figure 13, the TOG 25 aptamer was also able to inhibit pig thrombin in that the activation of the pig platelets was maintained at levels compared to that observed in samples where thrombin was not present.

Referring now to Figure 14, activated partial thromboplastin time (aPTT) assays were performed on human and pig plasma in the presence of

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-93increasing concentrations of the toggle 30 (TOG 30, SEQ ID NO: 56) RNA aptamer that was also prepared using the toggle SELEX method described in Example 3. As shown in Figure 14, comparable effects were observed in both human and pig plasma with the TOG 30 RNA aptamer. A control aptamer had no effect on aPTT at these concentrations.

The data presented in this Example and in Figs. 11-14 clearly indicate that the toggle SELEX method disclosed herein to provide aptamers that exhibit selectivity for multiple species. The toggle SELEX method of the present invention thus provides a methodology wherein an aptamer that is selected for a test species as well as an ultimate species in which the treatment is to be applied (e.g., pigs and humans) can be identified. This compatibility facilitates the identification of aptamers or other ligands that have activity in a test animal will also have activity in a subject that will ultimately be treated with the aptamer or other ligand.

Example 9

Mutation Analysis of Antithrombin RNA Aptamer

A proposed secondary structure of a 25 mer truncate of TOG 25 (TOG 25 short, SEQ ID NO: 57), is shown in Figure 15. The nonmutated or “wildtype” truncate binds human thrombin with a Kd of approximately 1 nM. Continuing with Figure 15, the binding affinity of various mutants designed to disrupt the proposed stem region, the BULGE region, and the LOOP sequences are shown and are summarized as follows. In the NO STEM mutant, wherein cytosines are mutated to guanidine, the binding affinity is approximately 1 micromolar. In the BULGEUs region, uracil moieties are mutated to adenine and the resulting dissociation constant is much greater than 1 nM. These mutations thus substantially impair the binding affinity of the TOG 25 short aptamer to thrombin. In the LOOPU1 mutation, uracil to adenine, produces an aptamer having a dissociation constant of about 250 nM. The LOOPU2 mutation, also uracil to adenine, produces an aptamer having a dissociation constant of about 1 nM. Thus, the mutations in the STEM and BULGE regions have greater impact than those in the LOOP regions.

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-94Referring now to Figure 16, the ability of the full-length TOG 25 RNA aptamer, the TOG 25 short RNA aptamer, and the BULGEUs RNA aptamer to inhibit platelet activation is analyzed. Human platelets were isolated and activated by 1 nM human thrombin, in the presence of increasing combination of full length TOG 25 (TOG 25 FL, SEQ ID NO: 55), truncated TOG 25 (TOG 25 short, SEQ ID NO: 57), or a non-binding human truncate (BULGEUs, SEQ ID NO: 59). Both the TOG 25 FL and TOG 25 short aptamers substantially inihibit platelet activation, with observed levels of platelet activation below 20%. In contrast, the mutant BULGEUs aptamer did not demonstrate an ability to inhibit platelet activation, with activation levels of approximately 90%. These data thus provide guidance to the design and selection of aptamers that provide the desired modulator effects.

Example 10

Inhibition of the Activity of Coagulation Factor Vila

Referring now to Figs. 19A-19B, a factor Vila aptamer RNA 16.3 (SEQ ID NO: 41) inhibits the activity of coagulation factor Vila. RNA 16.3 inhibits the Vlla/TF catalyzed activation of FX. Factors Vila and X were equilibrated with no RNA (□), 1 mM mutated non-binding RNA 16.3 m4 () as a composition control, or 1 μΜ RNA 16.3 (A), and the FX activation was initiated by the addition of lapidated tissue factor. The amount of FXa formed over time at 25°C was measured. The amount of FXa formed over time is expressed as the mean + sem for three or more experiments.

In Figure 19B, it is shown that RNA 16.3 prolongs the tissue factor induced clotting time of human plasma. The clotting time of human plasma was measured in a PT assay in the absence of RNA (striped bar), wherein the presence of varying concentrations of RNA 16.3 mutated non-binding M4 (solid bar) or 16.3 (open bar). The clotting time is expressed as the mean + sem for duplicate experiments.

Example 11 inhibition of the Activity of Coagulation Factor Vila

A nuclease-resistant 2’amino pyrimidine-modified RNA aptamer that can block tissue factor/FVIIa catalyzed FX activation, and that can prolong

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-95the clotting time of human plasma are disclosed herein above in Section II.B., in Figure 10, and in Example 10. While a potent antagonist at room temperature, it was discovered that this antagonist is much less potent at physiologic temperature (likely due to the reduced stability of duplexes containing the 2’amino modification). Therefore, this Example pertains to the generations of additional FVIIa antagonists by performing SELEX using a 2’fluoropyrimidine-modified RNA library at 37°C (this modification yields duplexes with enhanced stability compared to standard RNA). Eleven (11) rounds of the SELEX experiment were completed.

Following completion of 11 rounds of SELEX against FVIIa, cDNAs from the rounds 10 and 11 pools were cloned and sequenced. Representative sequences are set forth in Table 4 above. The round 11 pool binds FVIIa with a KD of ~10 nM under physiologic conditions, which represents a >1000 fold enrichment in binding activity for FVIIa over the course of the SELEX process.

The highest affinity aptamers, sequences 10.15 (SEQ ID NO:75) and 11.12 (SEQ ID NO:88), both bind FVIIa tightly, with apparent Kd’s of ~5-8 nM under physiologic conditions (Figure 23A). Both aptamers bind the zymogen FVIi with similar affinity. Aptamers 10.15 and 11.12 are both potent anticoagulants of human plasma in vitro as demonstrated by their ability to prolong Prothrombin Time (PT) clotting assays (Figure 23B). The in vitro anticoagulant activity of both aptamers is comparable to the anticoagulant activity of the most potent FVIIa antagonists currently available in the art. In addition, neither aptamer prolongs the clotting time of human plasma in Activated Partial Thromboplastin Time (APTT) clotting assays, as expected for specific FVIIa antagonists. Generating active truncates of both of these aptamers allows production of these aptamers by chemical synthesis for in vivo analysis.

Example 12

Inhibition of the Activity of Coagulation Factor Xa

This Example pertains to the isolation of active truncates of aptamers generated against coagulation factor Xa (FXa). Shown in Figure 21 is the

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-96predicted secondary structure of a fully active 36 nucleotide version of aptamer 11.F7 (SEQ ID NO: 148), a sequence related to the aptamer 10.14 (SEQ ID NO:73) described above. This aptamer, termed 11.F7l, binds FXa with an apparent Kd of ~1.5 nM, and exhibits at least several hundred fold specificity for FXa versus related coagulation factors Vila, IXa, Xla, APC and thrombin. This truncate is a potent anticoagulant of human plasma in vitro as demonstrated by its ability to prolong both the PT (Figure 22A) and APTT (Figure 22B) clotting times. Based upon comparison to the in vitro anticoagulant activity of other FXa inhibitors described in the art, this aptamer is one of most potent FXa antagonists described. The activity of this aptamer in animal models of systemic anticoagulation and thrombosis is also provided, in accordance with the in vivo experiments disclosed in previous Examples.

Example 13

Modulation of the Activity of Anq1

This Example pertains to an analysis of the modulation of Ang1 by Ang1 RNA aptamers. To determine whether ANG9-4 (SEQ ID NO:151) binding inhibited Ang1 activity, 293 cells expressing human Tie2 were incubated with 13 nM Ang1* with or without a molar excess of 9-4 or control aptamer. ANG9-4 completely abrogated Tie2 autophosphorylation as detected by Western blotting with an antibody specific for phospho-Tie2 (pTie2)(see Figure 25).

As shown in Figure 26, cultured human endothelial cells were serumstarved and treated with TNFa (50 ng/ml) for 3 hours while being incubated with 3.5 nM Ang1* and either ANG9-4 or control aptamer. Apoptosis (DNA fragmentation) was measured by Cell Death Detection ELISA kit (Roche Molecular Biochemicals). ANG9-4, but not control aptamer, increased apoptosis in a dose-dependent manner. Neither 9-4 nor control RNA increased apoptosis in un-starved, un-treated cells.

CA 02425208 2009-12-15

-97Example 14

Modulation of the Activity of Anq2

As shown in Figure 28, cultured human endothelial cells were serumstarved and treated with TNFa (50 ng/ml) for 3 hours while being incubated with 15 nM Ang2 and either ANG11-1 or control aptamer. Apoptosis (DNA fragmentation) was measured by Cell Death Detection ELISA kit (Roche Molecular Biochemicals). ΑΝΘ11-1, but not control aptamer, increased apoptosis to a levels above those seen in the absence of exogenous Ang2, suggesting inhibition of both exogenous and endogenous (autocrine) Ang2, which is known to be released by endothelial cells. Neither ANG11-1 nor control RNA increased apoptosis in non-lrradiated cells.

As in Figure 29, the ability of ANG11-1 (SEQ ID NO:168) and a 41nucleotide truncate (ANG11-1.41) (SEQ ID NO:189) to compete for binding to ANG2 (normalized to binding in the absence of competitor) Is plotted as a function of competitor concentration. ANG11-1.41 competes for ANG2 binding with an affinity (Kd ~ 5 nM) only slightly worse that of the full-length RNA aptamer (~ 1 nM).

REFERENCES

Chung et al. in Fibrinogen, Thrombosis, Coagulation and Fibrinolysis (Liu and Chien, eds.) Lemon Press, New York, pp. 39-48 (1990).

Sherr, C.J., Ceil, 73:1059-1065 (1993)

Hunter, T., Cell 75:839-841 (1993)

Nevins J.R., Science, 258:424-429 (1992)

Helin, K. and Harlow, E., Trends Cell Biol. 3:43-46 (1993)

La Thangue, N.B., Trends Biochem. Sci. 19:180-114 (1994)

Sherr, C.J. and Roberts, J.M., Genes Dev. 9:1149-1143 (1995)

Weinberg, RA Ce//81:323-330 (1995)

Oligonucleotide Synthesis (M. J. Gait ed. 1984)

CA 02425208 2003-03-26

WO 02/026932

PCT/US01/30004

-98Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984) Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989)

Methods in Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.).

Chou, P. Y. and Fasman, G. D. (1978) Biochemistry, 13:222-245 Gamier et al. (1978) J. Mol. Biol., 120:97-120 Beaucage etal. (1981) Tetrahedr. Letters22:1859-1862 Sinha et al., (1984) Nucleosides and Nucleotides 3:157-171 R. Iwase et al., (1992), Nucl. Acids Res. 20(7):1643-1648 Fukuoda et al., (1993) Nucleic Acids Symposia 29:25-26 Remington's Pharmaceutical Sciences Ozato et al, Cell Differ., 19:237-244 (1986)

Inoue et al, Cell Differ. Dev., 29:123-128 (1990)

Rokkones etal, J. Comp. Physiol. B, 158:751-758 (1989)

Guyomard et al, Biochimie, 71:857-863 (1989)

Wong and Lohman, 1993, Proc. Natl. Acad. Sci. USA 90, 5428-5432 Hobbs et al. Biochem 12:5138 (1973)

Guschlbauer et al. Nucleic Acids Res. 4:1933 (1977)

Shibahara etal. Nucl. Acids. Res. 15:4403 (1987)

Pieken et al. Science 253:314 (1991)

Zuker (1989) Science 244:48-52

Stormo and Gutell (1992) Nucleic Acids Research 29:5785-5795

U.S. Patent No. 4,244,946

U.S. Patent No. 5,118,672.

U.S. Patent No. 5,260,203

U.S. Patent No. 5,270,162

U.S. Patent No. 5,475,096

U.S. Patent No. 5,567,588

U.S. Patent No. 5,580,722

U.S. Patent No. 5,580,737

U.S. Patent No. 5,582,981

CA 02425208 2003-03-26

WO 02/026932 PCT/US01/30004

-99U.S. Patent No. 5,627,158 U.S. Patent No. 5,639,940 U.S. Patent No. 5,660,985 U.S. Patent No. 5,707,796 U.S. Patent No. 5,734,033 U.S. Patent No. 5,756,921 U.S. Patent No. 5,817,785 U.S. Patent No. 5,846,720 U.S. Patent No. 5,849,578 U.S. Patent No. 5,861,254 U.S. Patent No. 5,861,501 U.S. Patent No. 6,011,020 PCT Application WO 9203568

It will be understood that various details of the invention can be changed without departing from the scope of the invention. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation-the invention being defined by the claims.

CA 02425208 2004-06-08

Sequence Listing

<td> <110></td><td> Sullenger, Bruce A. Rusconi, Christopher P. White, Rebekah Kontos, Christopher</td>

<td> <120></td><td> RNA APTAMERS AND METHODS FOR IDENTIFYING THE SAME</td>

<td> <170></td><td> Patentln version 3.1</td>

<td> <213></td><td> oligonucleotide</td>

gggagagagg aagagggaug ggccgccagu gggaagcuau acccaacgcc ccagccccag 60 agcauaaccc agaggucgau aguacuggau cccccc 96

<td> <213></td><td> oligonucleotide</td>

gggagagagg aagagggaug ggcuauauac acgcugguga ucccaucuca auugaaacaa 60 cacauaaccc agaggucgau aguacuggau cccccc 96

<td> <213></td><td> oligonucleotide</td>

CA 02425208 2004-06-08 <400> 3

<td colspan="5"> gggagagagg aagagggaug gggacuauac cgcguaaugc ugccucccca uuccggaacg</td><td> 60</td>

<td colspan="2"> cucauaaccc agaggucgau aguacuggau</td><td> cccccc</td><td></td><td></td><td> 96</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggcacuauac</td><td> gcaucuugcu</td><td> gccugcccgc</td><td> gagucaaauu</td><td> 60</td>

<td colspan="2"> gcauaaccca gaggucgaua guacuggauc</td><td> ccccc</td><td></td><td></td><td> 95</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggccuaccag</td><td> uucguggcua</td><td> gcgugacgua</td><td> ccacccaggg</td><td> 60</td>

<td colspan="2"> accauaaccc agaggucgau aguacuggau</td><td> cccccc</td><td></td><td></td><td> 96</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggcgauaacc</td><td> aacaugguga</td><td> ucccauucau</td><td> cauacccuac</td><td> 60</td>

<td colspan="2"> aacauaaccc agaggucgau aguacuggau</td><td> cccccc</td><td></td><td></td><td> 96</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

CA 02425208 2004-06-08 <400> 7 gggagagagg aagagggaug gggccaccua cuauaccggu caucgugcau aggucgcugc 60 cacauaaccc agaggucgau aguacuggau cccccc 96

<td> <213></td><td> oligonucleotide</td>

gggagagagg aagagggaug ggucucacac ccgaagaugg ccaaagaggg agaugaguuu 60 ccauaaccca gaggucgaua guacuggauc ccccc 95

<td> <213></td><td> oligonucleotide</td>

gggagagagg aagagggaug ggacuauauu cggaaucugg acucccaccu gccugcccca 60 gacauaaccc agaggucgau aguacuggau cccccc 96

<td> <213></td><td> oligonucleotide</td>

gggagagagg aagagggaug ggcgauauac acauugguga ucccacccac augaaaccac 60 agcauaaccc agaggucgau aguacuggau cccccc 96

<td> <213></td><td> oligonucleotide</td>

<td> <221></td><td> mise feature</td>

CA 02425208 2004-06-08 <222>

(54)..(56) <223>

n=g, c, u or a <400>

gggagagagg aagagggaug ggcucaucac aggcgaagug aacaacacua ccgncnaguu accauaaccc agaggucgau aguacuggau cccccc <210> 12 <211> 95 <212> RNA <213> oligonucleotide <400> 12 gggagagagg aagagggaug gggacuauac gugaacgacu gcauccacuu ccccgccaug 60 gcauaaccca gaggucgaua guacuggauc ccccc 95 <210> 13 <211> 96 <212> RNA <213> oligonucleotide <400> 13 gggagagagg aagagggaug ggccauacgu ggacgacugc acccgacccu ucagcccagg 60 uccauaaccc agaggucgau aguacuggau cccccc 96 <210> 14 <211> 96 <212> RNA <213> oligonucleotide <400> 14 gggagagagg aagagggaug ggaccauacg cacauugcug aaucccccuc aauagcaccu 60 accauaaccc agaggucgau aguacuggau cccccc 96 <210> 15 <211> 96

CA 02425208 2004-06-08 <212> RNA <213> oligonucleotide <221> misc_feature <222> (54)..(54) <223> n=c or u <400> 15

<td colspan="4"> gggagagagg aagagggaug ggccauaacc acuuugguga acccacccag</td><td> cucnugugau</td><td> 60</td>

<td colspan="2"> ugcauaaccc agaggucgau aguacuggau</td><td> CCCCCC</td><td></td><td></td><td> 96</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggaccauaac</td><td> gacuacucgu</td><td> gaaucccacc</td><td> aucagcgcac</td><td> 60</td>

<td colspan="2"> aacauaaccc agaggucgau aguacuggau</td><td> CCCCCC</td><td></td><td></td><td> 96</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug gggacuauac</td><td> cggcaaucgu</td><td> gcauccccug</td><td> gaccuaacaa</td><td> 60</td>

<td colspan="2"> uacauaaccc agaggucgau aguacuggau</td><td> cccccc</td><td></td><td></td><td> 96</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggaacaccau</td><td> uaaugcucgg</td><td> ccagguaacc</td><td> ccggcgcaua</td><td> 60</td>

cucauaaccc agaggucgau aguacuggau cccccc 96

CA 02425208 2004-06-08 <210> 19 <211> 94 <212> RNA <213> oligonucleotide <400> 19 gggagagagg aagagggaug gggaccauaa cucuaacggg ugaaucccgc aucucgacaa 60 uacauaaccc agaggucgau aguacuggau cccc 94 <210> 20 <211> 95 <212> RNA <213> oligonucleotide <400> 20 gggagagagg aagagggaug ggugauaacc acucugguga accccucccg acuugcucgc 60 acauaaccca gaggucgaua guacuggauc ccccc 95 <210> 21 <211> 96 <212> RNA <213> oligonucleotide <400> 21 gggagagagg aagagggaug gguaauaacu guauggugaa cccacccaaa cucccauggc 60 uacauaaccc agaggucgau aguacuggau cccccc 96 <210> 22 <211> 95 <212> RNA <213> oligonucleotide <400> 22 gggagagagg aagagggaug ggcgccauac gcacauugcu gcaucgccuu cccguaagaa 60 ccauaaccca gaggucgaua guacuggauc ccccc 95

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggaaaauagc</td><td> cccagcgaga</td>

<td colspan="2"> accauaaccc agaggucgau aguacuggau</td><td> cccccc</td>

<td> <213></td><td> oligonucleotide</td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggccagaagg</td><td> aacuaaacac</td>

<td colspan="2"> gaccauaacc cagaggucga uaguacugga</td><td> ucccccc</td>

<td> <213></td><td> oligonucleotide</td><td></td>

<td> <221></td><td> raise feature</td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggaugucacu</td><td> uggccccucg</td>

<td colspan="2"> uaacccagag gucgauagua cuggaucccc</td><td> cc</td>

CA 02425208 2004-06-08 <213> oligonucleotide <400> 26

<td colspan="2"> gggagagagg aagagggaug ggacacgccc</td><td> agcgagcuca</td><td> aacuuggccc</td><td> ccgugcauca</td><td> 60</td>

<td colspan="2"> ccccauaacc cagaggucga uaguacugga</td><td> ucccccc</td><td></td><td></td><td> 97</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggaagugcca</td><td> cagcgagcac</td><td> augacuuggc</td><td> cccgcauugc</td><td> 60</td>

<td colspan="2"> acccauaacc cagaggucga uaguacugga</td><td> ucccccc</td><td></td><td></td><td> 97</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggaaacuaau</td><td> gcccuagcga</td><td> gcauacccgg</td><td> acuggccccg</td><td> 60</td>

<td colspan="2"> ccauaaccca gaggucgaua guacuggauc</td><td> ccccc</td><td></td><td></td><td> 95</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggaaaauagc</td><td> cccagcgaga</td><td> uaauacuugg</td><td> ccccgcuacu</td><td> 60</td>

<td colspan="2"> acccauaacc cagaggucga uaguacugga</td><td> ucccccc</td><td></td><td></td><td> 97</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

CA 02425208 2004-06-08 <400> 30

<td colspan="2"> gggagagagg aagagggaug ggcgacccca</td><td> cuggcggaaa</td><td> ccgacaauca</td><td> cuccccacga</td><td> 60</td>

<td colspan="2"> ccauaaccca gaggucgaua guacuggauc</td><td> ccccc</td><td></td><td></td><td> 95</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggcagcccag</td><td> cgagggacac</td><td> uuaacccccu</td><td> gucccccauc</td><td> 60</td>

<td colspan="2"> caaaccauaa cccagagguc gauaguacug</td><td> gaucccccc</td><td></td><td></td><td> 99</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggccagaagu</td><td> caccgcgacg</td><td> guacugaacc</td><td> ccccacccaa</td><td> 60</td>

<td colspan="2"> acccauaacc cagaggucga uaguacugga</td><td> ucccccc</td><td></td><td></td><td> 97</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

gggagagagg aagagggaug ggccagaagu gcucacuaca acgcuuugac ccccccaucc 60 acaucccaua acccagaggu cgauaguacu ggaucccccc 100

<td> <213></td><td> oligonucleotide</td>

CA 02425208 2004-06-08 <400> 34

<td colspan="2"> gggagagagg aagagggaug ggccagcaac</td><td> cgaagggcgg</td><td> aauacccccc</td><td> gucuccacau</td><td> 60</td>

<td colspan="2"> acccauaacc cagaggucga uaguacugga</td><td> ucccccc</td><td></td><td></td><td> 97</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggacgcgacu</td><td> caggcagcac</td><td> uugacuuggc</td><td> cccuugcgau</td><td> 60</td>

<td colspan="2"> caccauaacc cagaggucga uaguacugga</td><td> ucccccc</td><td></td><td></td><td> 97</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggccagcaac</td><td> gcuaacacgg</td><td> aauacccccc</td><td> accccaacgu</td><td> 60</td>

<td colspan="2"> gcccauaacc cagaggucga uaguacugga</td><td> ucccccc</td><td></td><td></td><td> 97</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggcuucucaa</td><td> ccgaaauaca</td><td> acuuuaaauc</td><td> auuuaucacu</td><td> 60</td>

<td colspan="2"> uaccauaacc cagaggucga uaguacugga</td><td> ucccccc</td><td></td><td></td><td> 97</td>

<td> <213></td><td> oligonucleotide</td>

CA 02425208 2004-06-08

<td colspan="2"> gggagagagg aagagggaug ggauacgccg</td><td> augcaagcau</td><td> guccacacac</td><td> cgcaugccgu</td><td> 60</td>

<td colspan="2"> acccauaacc cagaggucga uaguacugga</td><td> ucccccc</td><td></td><td></td><td> 97</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug gguacagagg</td><td> aguacaagua</td><td> gcaugguccc</td><td> cucguguaaa</td><td> 60</td>

<td colspan="2"> aacauaaccc agaggucgau aguacuggau</td><td> cccccc</td><td></td><td></td><td> 96</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug ggugcaaaag</td><td> agcuucuugu</td><td> aguaugaucc</td><td> cucaaccgca</td><td> 60</td>

<td colspan="2"> agcauaaccc agaggucgau aguacuggau</td><td> cccccc</td><td></td><td></td><td> 96</td>

<td> <213></td><td> oligonucleotide</td><td></td><td></td><td></td><td></td>

<td colspan="2"> gggagagagg aagagggaug gguacagagg</td><td> aguacaagua</td><td> gcaugauccc</td><td> cucguguaaa</td><td> 60</td>

<td colspan="2"> aacauaaccc agaggucgau aguacuggau</td><td> cccccc</td><td></td><td></td><td> 96</td>

<td> <213></td><td> oligonucleotide</td>

CA 02425208 2004-06-08 gggagagagg aagagggaug ggagccuaug uaacagaugc agaucccuag ucgucccaac 60 accauaaccc agaggucgau aguacuggau cccccc 96 <210> 43 <211> 96 <212> RNA <213> oligonucleotide <400> 43 gggagagagg aagagggaug ggcacaacga acaccgcauc ccuugacaga aagagcacgc 60 cucauaaccc agaggucgau aguacuggau cccccc 96 <210> 44 <211> 96 <212> RNA <213> oligonucleotide <400> 44 gggagagagg aagagggaug gguacagagg aguacaagua acaugauccc cucguguaaa 60 aacauaaccc agaggucgau aguacuggau cccccc 96 <210> 45 <211> 96 <212> RNA <213> oligonucleotide <400> 45 gggagagagg aagagggaug ggcacaacga acaccgcauc ccuugacaga aagaacacgc 60 cucauaaccc agaggucgau aguacuggau cccccc 96 <210> 46 <211> 96 <212> RNA <213> oligonucleotide <400> 46 gggagagagg aagagggaug ggcacaagga acaccgcauc ccuugacaga aagaacacgc

CA 02425208 2004-06-08 cucauaaccc agaggucgau aguacuggau cccccc 96

<td> <213></td><td> oligonucleotide</td>

gggagagagg aagagggaug ggagccuaug uaacagaugc agaucccuag acgacccaac 60 accauaaccc agaggucgau aguacuggau cccccc 96

<td> <213></td><td> oligonucleotide</td>

gggagagagg aagagggaug gg 22

<td> <213></td><td> oligonucleotide</td>

cauaacccag aggucgauag uacuggaucc cccc 34

<td> <213></td><td> oligonucleotide</td>

ugcgaacaaa gcugaaguac uuacgcacaa cccguagaau 40 <210> 51 <211> 37

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

aacaacugaa gaacuacccu ucuuacugac gaauuaa 37

<td> <213></td><td> oligonucleotide</td>

aaacaaagcu gaaguacuua uuccaucacc acgccggaa 39

<td> <213></td><td> oligonucleotide</td>

uauuuggcuu cucagugccg cagagacagc aacaauuagu 40

<td> <213></td><td> oligonucleotide</td>

acaaagcugg agaacuuacc guucccucuc cagagaucaa 40

<td> <213></td><td> oligonucleotide</td>

gaacaaagcu gaaguacuua cccaagauca ucccgaacga 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

aacaaagcug gagaacuuaa cgucccucuc ccagcgguaa 40

<td> <213></td><td> oligonucleotide</td>

gggaacaaag cugaaguacu uaccc 25

<td> <213></td><td> oligonucleotide</td>

gggaacaaag cugaaguacu uaggg 25

<td> <213></td><td> oligonucleotide</td>

gggaacaaag cugaaguaca aaccc 25

<td> <213></td><td> oligonucleotide</td>

CA 02425208 2004-06-08 <400> 60 gggaacaaag cagaaguacu uaccc 25

<td> <213></td><td> oligonucleotide</td>

gggaacaaag cugaagaacu uaccc 25

<td> <213></td><td> oligonucleotide</td>

gggagagagg aagagggagg g 21

<td> <213></td><td> oligonucleotide</td>

caaacccaga ggcgaagacg gacccccc 28

<td> <213></td><td> oligonucleotide</td>

aaggaacacg aaggcccccg agcaccaaca cag 33 <210> 65 <211> 35

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

gcaccgccag cggcgacgga cccgcccaca ggccc 35

<td> <213></td><td> oligonucleotide</td>

aaagcacacg aagccccagc aaaaccccac agg 33

<td> <213></td><td> oligonucleotide</td>

agaaacacag aagcccgcgc gacaccccac g 31

<td> <213></td><td> oligonucleotide</td>

caaaccacag acccaacgca ggagcaccca cccacacggg acag 44

<td> <213></td><td> oligonucleotide</td>

accccgccga agccgccgag gacaccacac ccgc 34

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

auggggacua uaccgcguaa ugcugccucc ccau 34

<td> <213></td><td> oligonucleotide</td>

ggggacuaua ccggcaaucg ugcaucccc 29

<td> <213></td><td> peptide ligand</td>

Ser Phe Leu Leu Arg Asn

<td> <213></td><td> oligonucleotide</td>

gggagagagg aagagggaug ggaaaauagc cccagcgaga uaauacuugg ccccgcuacu 60 accauaaccc agaggucgau aguacuggau cc 92

CA 02425208 2004-06-08 <213> oligonucleotide <400> 74 aaaguaccga cuagguccca cuguuuaagc auccccgaac 40

<td> <213></td><td> oligonucleotide</td>

aagcuccauc caagcgacga cacgcucguc ccgaaaagaa u 41

<td> <213></td><td> oligonucleotide</td>

aagcuccguc caagcgacga cacguucguc ccgaaaagaa u 41

<td> <213></td><td> oligonucleotide</td>

acaacgccac cuuccgcgcg acgccgcgcc gacgauaacu 40

<td> <213></td><td> oligonucleotide</td>

acaacgccac cuuccgcgcg acgccgcgcc gacguauaac u 41 <210> 79

CA 02425208 2004-06-08 <211> 40 <212> RNA <213> oligonucleotide <400> 79 acgaaaauau cuccgucaag gaccuccugc cccaaacacu <210> 80 <211> 40 <212> RNA <213> oligonucleotide <400> 80 agacgacaca uccaagcgug agagaucacc cgacaagaau <210> 81 <211> 42 <212> RNA <213> oligonucleotide <400> 81 auuuuuucac acauucuuaa uuuucacuua cccgucccga uc <210> 82 <211> 40 <212> RNA <213> oligonucleotide <400> 82 caaagcaccc guccaagcga cagacauguc ccgcagcccu <210>

<211>

<212>

<213>

<400>

RNA oligonucleotide caccauuuau ucuucauuuu ucuucgccca guuccuccaa

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

cauaagccgc cucagcugac aaagcccucc gcuuaggcc 39

<td> <213></td><td> oligonucleotide</td>

ccaaagugcu uccgcgaagu ucgaccauuc gccgccugca 40

<td> <213></td><td> oligonucleotide</td>

ccccuccgcc aacuuggccg ccucaggcac caucaccaac 40

<td> <213></td><td> oligonucleotide</td>

cccgaucucc ccgaggaccu ccacggcccg uccgccaguu u 41

CA 02425208 2004-06-08 <213> oligonucleotide <400> 88 ccgccucagc aaucuagccc uccgcccgac ccuuccgcug 40

<td> <213></td><td> oligonucleotide</td>

ccgccucagc gagaucuucg cccuccgccc aagccucaac 40

<td> <213></td><td> oligonucleotide</td>

ccgccucagg acgacaccgg uccccuccgc ccguccgcgc 40

<td> <213></td><td> oligonucleotide</td>

ccgccucagg caucagcccc uccgcccgcc cacuucauca 40 <210> 92

<td> <213></td><td> oligonucleotide</td>

ccgccucagu uacuugauaa cccuccgccc gcccgcagcu 40 <210> 93

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

cuuuacauau uacuuacuac auuuucauaa caccacacgc 40

<td> <213></td><td> oligonucleotide</td>

gacaccaucc aagcgaccaa ccaagguccc gcacauaacu 40

<td> <213></td><td> oligonucleotide</td>

gaugcaacuc gaaauggccg ccucgcguca gcguuccgc 39

<td> <213></td><td> oigonucleouide</td>

gcuuaucuua uaucacuuuu ucuucccaau ccuucaagu 39

<td> <213></td><td> oligonucleotide</td>

CA 02425208 2004-06-08 uaaccaacca agcguccaaa aaccuggacc cgccaagaau 40

<td> <213></td><td> oligonucleotide</td>

uaaccaacca agcguccaaa aaccuggacc cgccaagaau 40

<td> <213></td><td> oligonucleotide</td>

uaaccaacca agcguccaaa aaucuggacc cgccaagaau 40

<td> <213></td><td> oligonucleotide</td>

ucugacguuc caccguccuc gaaggcgacc agagcguuac 40

<td> <213></td><td> oligonucleotide</td>

ugccgccuca gccacacggc ccuccgcgcc cgccacaagc 40

<td> <213></td><td> oligonucleotide</td>

CA 02425208 2004-06-08 <400> 102 gggagagagg aagagggaug gg 22

<td> <213></td><td> oligonucleotide</td>

cauaacccag aggucgau 18

<td> <213></td><td> oligonucleotide</td>

agauuagccc cagcgagaua auacuuggcc ccgcuacuac 40

<td> <213></td><td> oligonucleotide</td>

uaaauagccc cagcgagauu cuacuuggcc ccgcuacuac 40

<td> <213></td><td> oligonucleotide</td>

<td> <221></td><td> misc_feature</td>

CA 02425208 2004-06-08 aaaauacgcc anncgagauu auacuuggcc ccgcuaauac <210> 107 <211> 40 <212> RNA <213> oligonucleotide

<td colspan="2"> aaaauagccc cagcgagaua auacuuggcc</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> aaaauagccc cagcgagaua auacuuggcc</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> aaaauagccc cagcgagaua auacuuggcc</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> <400> 110 agaauggccc cagcgagauu auacuuggcc</td>

<td> <213></td><td> oligonucleotide</td>

ccgcuauuac ccgcuagcac ccgcuacaac ccgccaauac

CA 02425208 2004-06-08 <400> 111 aaaauagccc cagcgagaug auacuuggcc ccgcuaauac 40

<td> <213></td><td> oligonucleotide</td>

agaauacgcc uagcgagaag auacuuggcc cccgugcaac 40

<td> <213></td><td> oligonucleotide</td>

aaaauagccc cagcgagaua auacuuggcc ccgcuguuac 40

<td> <213></td><td> oligonucleotide</td>

aaauuugccc cagcgagaua auacuuggcc ccgcaacuac 40

<td> <213></td><td> oligonucleotide</td>

auaauagccc cagcgagaua auacuuggcc ccgcuacuaa 40 <210> 116 <211> 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

agaauagccc cagcgagaua auacuuggcc ccgcuaauac 40

<td> <213></td><td> oligonucleotide</td>

aaauuugccc uagcgagauu auacuuggcc ccgcgaaaaa c 41

<td> <213></td><td> oligonucleotide</td>

aaaauagccc cagcgagaua auacuuggcc ccgcgaacac 40

<td> <213></td><td> oligonucleotide</td>

ugcauagccc cagcgagaua auacuuggcc ccgcuacaac 40

<td> <213></td><td> oligonucleotide</td>

<td> <221></td><td> mise feature</td>

CA 02425208 2004-06-08 <400> 120 ngauuagccc nagcgagaua nuacuuggcc ccgcuacnuc <210> 121 <211> 40 <212> RNA <213> oigonucleouide <400> 121 aaaauaacca cagcgagauc auacuuggcc ccguuacuac <210> 122 <211> 40 <212> RNA <213> oligonucleotide <400> 122 aaaauagccc uagcgagaua auacuuggcc ccgccacaua <210> 123 <211> 40 <212> RNA <213> oligonucleotide <400> 123 cagauagcca cagcgagauc auacuuggcc ccgcuacuac <210> 124 <211> 40 <212> RNA <213> oligonucleotide <400> 124 agaauagccc cagcgagaua auccuuggcc ccgcuacugc <210> 125 <211> 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

<td> <221></td><td> mise feature</td>

aancuagccc nagcgagaua uuacuuggcc ccgcnacuac 40

<td> <213></td><td> oligonucleotide</td>

aaacuagccu cagcgagaua auacuuggcc ccgcuacuac 40

<td> <213></td><td> oligonucleotide</td>

ccagaagcgc ucacuacaac guugaacccc ccguccacac 40

<td> <213></td><td> oligonucleotide</td>

ccaaaagcgg acugaagacg uguuuccccc aucuccguga 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td><td></td>

<td colspan="2"> ccagaaggaa cuaaacaccu gaacccccca</td><td> ucgcgagaga</td>

<td> <213></td><td> oligonucleotide</td><td></td>

<td colspan="2"> ccagcaacgu cacacgaacg gaauaccccc</td><td> cauugaaaac</td>

<td> <213></td><td> oligonucleotide</td><td></td>

<td colspan="2"> ucuuagauau agaacuccga gaggacugac</td><td> cguacagaac</td>

<td> <213></td><td> oligonucleotide</td><td></td>

<td colspan="2"> agaauagccc cagcgagauc guacuuggcc</td><td> ccgcuaguac</td>

<td> <213></td><td> oligonucleotide</td><td></td>

<td colspan="2"> ccaaaagcgc auacaccugc guguuucccc</td><td> cgccaacagu</td>

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

<td> <221></td><td> raise feature</td>

<222> (9)..(36) <223> n=g, c, u or a <400> 134 ccauugcunc ccugaacang ggcnccacnc cgccuncaca gu <210> 135 <211> 40 <212> RNA <213> oligonucleotide <400> 135 ccagaacacc agugaacccc ccagccccuu cucaccagau <210> 136 <211> 43 <212> RNA <213> oligonucleotide <400> 136 ccagaagcga cacuaacgcu gaacccccca gucccuucac gug <210> 137 <211> 39 <212> RNA <213> oligonucleotide <400> 137 auaccgagca cgcaaaacac acaaugccca agcaggacu <210> 138 <211> 38

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

agcccgagaa aauaacgcgu uccaccauac uacuaagc 38

<td> <213></td><td> oligonucleotide</td>

uaaauagccc cagcgagaua auacuuggcc ccgcaacuac 40

<td> <213></td><td> oligonucleotide</td>

<td> <221></td><td> misc_feature</td>

aguccgacug gagaacangu acucuauaag cacuuncaun can 43

<td> <213></td><td> oligonucleotide</td>

cucggcagaa gacacgcauu caccuggugc caccucguaa 40

CA 02425208 2004-06-08 <213> oligonucleotide <400> 142 gccgucgcca ggaaucaaac ugcuacucca ucccgggca 39

<td> <213></td><td> oligonucleotide</td>

ccagaagcua aacacucaua accacgcuga accccccaac 40

<td> <213></td><td> oligonucleotide</td>

ccagaaccaa cugcggugaa ccccccauac cgcgacacau 40

<td> <213></td><td> oligonucleotide</td>

aacuuagccu cagcgagaua acgcuuggcc ccgcuaagac 40

<td> <213></td><td> oligonucleotide</td>

uaaguugccc cagcgagaua guacuuggcc ccgcuacuaa 40 <210> 147

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

aaaauagccc cagcgagaua auacuuggcc ccgcuacuaa 40

<td> <213></td><td> oligonucleotide</td>

gagagcccca gcgagauaau acuuggcccc gcucuu 36

<td> <213></td><td> oligonucleotide</td>

gggagagagg aagagggaug gg 22

<td> <213></td><td> oligonucleotide</td>

cauaacccag aggucgauag uacuggaucc cccc 34

<td> <213></td><td> oligonucleotide</td>

acucgaacau uuccacuaac caaccauacu aaagcaccgc 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

acucgaacau uuccacuaac caaccauacu aaagcaccgc 40

<td> <213></td><td> oligonucleotide</td>

gaccaccaac acaccacaua cugcuuugua ccaacauuc 39

<td> <213></td><td> oligonucleotide</td>

cccagcgaac acacaacaga acacgaacgg auccgagcaa 40

<td> <213></td><td> oligonucleotide</td>

gucacaaacu accuucaucc uucgcuugau acaacauuc 39

<td> <213></td><td> oligonucleotide</td>

CA 02425208 2004-06-08 <400> 156 acaccaagga cccaacgacc cucgcuugac acagucauuc 40

<td> <213></td><td> oligonucleotide</td>

augaacaaca cccaaacuug cuucaaccgc auccaca 37

<td> <213></td><td> oligonucleotide</td>

gaccucacgc acugcuaagc ggcucugaug gagcucuaug 40

<td> <213></td><td> oligonucleotide</td>

ccaccuccga aaaaucacaa ucugcccuug acaccagcua g 41

<td> <213></td><td> oligonucleotide</td>

ccucauuggc ccugccacgc ucggacaacc guuccgcuca 40 <210> 161

CA 02425208 2004-06-08 <211> 40 <212> RNA <213> oligonucleotide <400> 161 uccagugcag uuccauaacc gcuacucagc gcgugauuag <210> 162 <211> 40 <212> RNA <213> oligonucleotide <400> 162 uuucgagcaa ccucccaaca aucuaaccgu aacccuccag <210> 163 <211> 40 <212> RNA <213> oligonucleotide <400> 163 caacaucagc acgccugaac cuucgcuugc aacagcauuc <210> 164 <211> 41 <212> RNA <213> oligonucleotide <400> 164 ccaccuccga aaaaucacaa ucugcccuug acaccagcua g <210> 165 <211> 40 <212> RNA <213> oligonucleotide <400> 165 uuacaccauc gaccaaacua ugcgccguac cacuauacga

CA 02425208 2004-06-08 <210> 166 <211> 15 <212> DNA <213> oligonucleotide <400> 166 gggaggacga ugcgg <210> 167 <211> 25 <212> DNA <213> oligonucleotide <400> 167 cagacgacuc gcugaggauc cgaga <210> 168 <211> 40 <212> RNA <213> oligonucleotide <400> 168 acuagccuca ucagcucaug ugccccuccg ccuggaucac <210> 169 <211> 41 <212> RNA <213> oligonucleotide <400> 169 ugaccaagcc ucacguugaa ccugccagua gaccccgccc a <210> 170 <211> 40 <212> RNA

CA 02425208 2004-06-08 <213> oligonucleotide <400> 170 uuaaccauca gcucauggcc ccugcccucu caaggaccac 40

<td> <213></td><td> oligonucleotide</td>

caccagaccg acaucagcuu auggccccuc acccacaccg 40

<td> <213></td><td> oligonucleotide</td>

ggagcgcaau ucgccucgca aguugaacuc cgcuggcgg 39

<td> <213></td><td> oligonucleotide</td>

uaagcucuuu ggcuuagccc gacacguuga acuccagagu 40

<td> <213></td><td> oligonucleotide</td>

cacgguacca ccaagucaca cguugaacuc caugcagcug 40 <210> 175

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

ccaccgaucg caucagcuca uggccccucc cgacccgcca 40

<td> <213></td><td> oligonucleotide</td>

ccagacguuc ucgccccgcc gaucaucagc gcuggcccua u 41

<td> <213></td><td> oligonucleotide</td>

cacuaccacg ccauaucagc uaauggcccc ucccuacgca 40

<td> <213></td><td> oligonucleotide</td>

cacucagcgc ccugcgaaac guugccgccu cccaacgucu 40

<td> <213></td><td> oligonucleotide</td>

acucaccagu caccaucagc ucaugcgccc cucccccgac 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

cucuuuuugu ccccgcacgu ugaacuccug ucccucuacu 40

<td> <213></td><td> oligonucleotide</td>

ugacgguucu ucucucgccu cuggagcucu cgucucgau 39

<td> <213></td><td> oligonucleotide</td>

cacuuuagcu cacgccaccg cacguugaac gcccaucccg 40

<td> <213></td><td> oligonucleotide</td>

caaugcagca ucagcucaug gccccuccac aagcgcgaau 40

<td> <213></td><td> oligonucleotide</td>

CA 02425208 2004-06-08 <400> 184 caugucuaca acaaucucgc ccguugaguc ucgucgaauu 40

<td> <213></td><td> oligonucleotide</td>

cgaucuuuuc gucaaccgca cguugaacuc ggcucggcac 40

<td> <213></td><td> oligonucleotide</td>

cacccguccg uccaaauccg cuucguugga ccccaucuu 39

<td> <213></td><td> oligonucleotide</td>

gaggacgaug cggacuagcc ucaucagcuc augugccccu c 41

<td> <213></td><td> oligonucleotide</td>

gggggaauuc uaauacgacu cacuauaggg agagaggaag agggauggg 49 <210> 189 <211> 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

gcugccgcgc cuggacccca cccacauaug ggccacacac 40

<td> <213></td><td> oligonucleotide</td>

aaugacaauu gacucggaaa cccucauguu ccaacaccgg 40

<td> <213></td><td> oligonucleotide</td>

ccuacucucc acaccugguu uuaugcucua cacaccucac 40

<td> <213></td><td> oligonucleotide</td>

cugccccgac cacaaaggac ggaacccuac ccacaguggg 40

<td> <213></td><td> oligonucleotide</td>

cauaaaagca auuugccacc ggcguacggc accccaauau 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> caccuaugcc aucaggccuc aaucuccggc</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> aucaaccaca ggaagagugc agccauagca</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> gcgacauacc ccacccacac uggcacaacg</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> cuucaaaggu ccuguaucca gccaccccac</td>

<td> <213></td><td> oligonucleotide</td>

agcgacucua cacagacca cgcaaugccg ugacagga

CA 02425208 2004-06-08 <400> 198 cuacccagca aggucaaccc uacccacacu gg <210> 199 <211> 40 <212> DNA <213> oligonucleotide <400> 199 aucuuaaaga ucaccggcgu ucggcaacac ccgacccaaa <210> 200 <211> 40 <212> DNA <213> oligonucleotide <400> 200 gcacuaaacu ucgauuaccc cccacccaca cuggcugcac <210> 201 <211> 40 <212> DNA <213> oligonucleotide <400> 201 cagauuaccc uacccacacu gcgugcggac aaccauuggc <210> 202 <211> 39 <212> DNA <213> oligonucleotide <400> 202 gcacaaauga gaacacgagu ucaccccgcc cacacugga <210> 203 <211> 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

gcgcagauca acccuaccca uacugggcuc cuugugaagg 40

<td> <213></td><td> oligonucleotide</td>

caagcgcuga aaccaaugca ccccacccca cacuggugua c 41

<td> <213></td><td> oligonucleotide</td>

augugaaaca cagaagcccu guacagaccg ccgacuguca 40

<td> <213></td><td> oligonucleotide</td>

caaacucaca gacaccaacu gcaggagcac ccaccacgac 40

<td> <213></td><td> oligonucleotide</td>

cgaacgaacu guggacccua cccacacugg gccaagcgau 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> cgcccuggaa cgagauuccu guaaaccccc</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> caaggugacc gcgaacccua cccgccgcac</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> cauccagacu acuggcccaa cccgccgcuc</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> cucucuccgu aaccaacaag ucccaaugaa</td>

<td> <213></td><td> oligonucleotide</td>

aucuaguaga gguaacagcg caaccccgug caaccaccau

CA 02425208 2004-06-08 cacugaacga auggcaaccg ccaaacccua cccacacugg 40

<td> <213></td><td> oligonucleotide</td>

caagcguaua cccuacccac acugagcuac auugcgcuga 40

<td> <213></td><td> oligonucleotide</td>

gccgagagug agugaccaca accccgccca cacuggaaua 40

<td> <213></td><td> oligonucleotide</td>

uuuccuaugg cgauaacuuc agccacgccg gcgccccgug 40

<td> <213></td><td> oligonucleotide</td>

cgucacuccg ucccagccga cgaaguccgu aauuccucca 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> ccacccgaag caaaucaagc ccgacggcgc</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> cgaacugaag cuagcguaac ccuacccaca</td>

<td> <213></td><td> oligonucleotide</td>

<td colspan="2"> accucgaccc uucaccugac ucucccagaa</td>

<td> <213></td><td> oligonucleotide</td>

<td> <221></td><td> misc_feature</td>

<td colspan="2"> caauccauac gcacccgguc cacacugggu</td>

<td> <213></td><td> oligonucleotide</td>

ucggaccaac cugcacgug guucuguuuc uggagcnnn

CA 02425208 2004-06-08 <400> 221 aauggaauca cugaaggccc uccguagcac cuaacacagu 40

<td> <213></td><td> oligonucleotide</td>

gcauccugcc agcggcgacg gaccuucgcc cacaggccuc 40

<td> <213></td><td> oligonucleotide</td>

uuauauagca cacugaagcc cucagcaaaa ccuccacagg 40

<td> <213></td><td> oligonucleotide</td>

uaugaaauca cagaagcccg cguucgacac cuccacuguu 40

<td> <213></td><td> oligonucleotide</td>

caaacucaca gacuccaacu gcaggagcac ccacccacac ugggacag 48 <210> 226 <211> 40

CA 02425208 2004-06-08

<td> <213></td><td> oligonucleotide</td>

auccccgccg uaagccgucc ugauggacac cacacgccgc 40

<td> <213></td><td> oligonucleotide</td>

<td> <221></td><td> mise feature</td>

acaaagcugr agwacuua

Contents357

126 members in 13 offices

This recordMember, by publication datePriority claim3 more offices are in the list below

Priority claims7

Priority claims
Document	Office	Kind	Date
23565400	United States of America	P	2000-09-26
60235654	United States of America	–	2000-09-26
0130004	United States of America	W	2001-09-26
60235654	–	–	–
PCTUS2001030004	–	–	–
US20000235654P	–	–	–
WO2001US30004	–	–	–

Members126

Family members, oldest first
Document	Office	Kind
US948136A	United States of America	A	1910-02-01
CA2425208A1	Canada	A1	2002-04-04
WO0226932A2	World Intellectual Property Organization (WIPO)	A2	2002-04-04
AU9630501A	Australia	A	2002-04-08
WO0226932A3	World Intellectual Property Organization (WIPO)	A3	2002-06-27
WO0226932A9	World Intellectual Property Organization (WIPO)	A9	2003-03-20
EP1330544A2	European Patent Office (EPO)	A2	2003-07-30
US2003175703A1	United States of America	A1	2003-09-18
EP1330544A4	European Patent Office (EPO)	A4	2005-04-06
US2006087186A1	United States of America	A1	2006-04-27
US2006087188A1	United States of America	A1	2006-04-27
WO2006047401A2	World Intellectual Property Organization (WIPO)	A2	2006-05-04
WO2006047499A2	World Intellectual Property Organization (WIPO)	A2	2006-05-04
US7061152B2	United States of America	B2	2006-06-13
US2006145555A1	United States of America	A1	2006-07-06
US2006152099A1	United States of America	A1	2006-07-13
TW200627759A	Taiwan Province of China	A	2006-08-01
TW200631280A	Taiwan Province of China	A	2006-09-01
EP1706934A1	European Patent Office (EPO)	A1	2006-10-04
WO2006047401A3	World Intellectual Property Organization (WIPO)	A3	2006-12-07
US2007075593A1	United States of America	A1	2007-04-05
US7205693B2	United States of America	B2	2007-04-17
US2007085442A1	United States of America	A1	2007-04-19
WO2007044680A2	World Intellectual Property Organization (WIPO)	A2	2007-04-19
US2007126303A1	United States of America	A1	2007-06-07
AU2007201745A1	Australia	A1	2007-06-21
US7239058B2	United States of America	B2	2007-07-03
MX2007005012A	Mexico	A	2007-07-09
CN1998124A	China	A	2007-07-11
EP1810391A2	European Patent Office (EPO)	A2	2007-07-25
WO2007095209A2	World Intellectual Property Organization (WIPO)	A2	2007-08-23
JP2007525937A	Japan	A	2007-09-06
US2007205675A1	United States of America	A1	2007-09-06
US7294948B2	United States of America	B2	2007-11-13
KR20070111447A	Republic of Korea	A	2007-11-21
AU2001296305B2	Australia	B2	2007-12-06
US7312325B2	United States of America	B2	2007-12-25
WO2007095209A3	World Intellectual Property Organization (WIPO)	A3	2008-04-17
JP2008104354A	Japan	A	2008-05-01
JP2008518579A	Japan	A	2008-05-29
US2008182809A1	United States of America	A1	2008-07-31
JP2008187887A	Japan	A	2008-08-14
US2008200413A1	United States of America	A1	2008-08-21
US2008207546A1	United States of America	A1	2008-08-28
US2008221053A1	United States of America	A1	2008-09-11
BRPI0517020A	Brazil	A	2008-09-30
EP1987583A2	European Patent Office (EPO)	A2	2008-11-05
US2008278022A1	United States of America	A1	2008-11-13
WO2008154358A1	World Intellectual Property Organization (WIPO)	A1	2008-12-18
KR20080110731A	Republic of Korea	A	2008-12-19
CN101385227A	China	A	2009-03-11
WO2006047499A3	World Intellectual Property Organization (WIPO)	A3	2009-04-16
WO2007044680A3	World Intellectual Property Organization (WIPO)	A3	2009-04-23
CN101438486A	China	A	2009-05-20
US2009163429A1	United States of America	A1	2009-06-25
JP2009527213A	Japan	A	2009-07-23
JP2009178038A	Japan	A	2009-08-06
US7573170B2	United States of America	B2	2009-08-11
JP4312245B2	Japan	B2	2009-08-12
US7576468B2	United States of America	B2	2009-08-18
EP1706934A4	European Patent Office (EPO)	A4	2009-11-11
EP1810391A4	European Patent Office (EPO)	A4	2009-11-11
US7719159B2	United States of America	B2	2010-05-18
US7741307B2	United States of America	B2	2010-06-22
US7776836B2	United States of America	B2	2010-08-17
US7776837B2	United States of America	B2	2010-08-17
US7812001B2	United States of America	B2	2010-10-12
EP1706934B1	European Patent Office (EPO)	B1	2010-11-24
EP1810391B1	European Patent Office (EPO)	B1	2010-11-24
AT489761T	Austria	T	2010-12-15
AT489762T	Austria	T	2010-12-15
ATE489761T1	Austria	T1	2010-12-15
ATE489762T1	Austria	T1	2010-12-15
US7858591B2	United States of America	B2	2010-12-28
DE602005024916D1	Germany	D1	2011-01-05
DE602005025006D1	Germany	D1	2011-01-05
US7884522B1	United States of America	B1	2011-02-08
AU2007201745B2	Australia	B2	2011-02-17
BRPI0707776A2	Brazil	A2	2011-05-10
EP2322648A1	European Patent Office (EPO)	A1	2011-05-18
CN1998124B	China	B	2011-05-25
EP2325337A1	European Patent Office (EPO)	A1	2011-05-25
AU2011202290A1	Australia	A1	2011-06-09
US2011160443A1	United States of America	A1	2011-06-30
US7982350B2	United States of America	B2	2011-07-19
EP2351855A1	European Patent Office (EPO)	A1	2011-08-03
US2011234037A1	United States of America	A1	2011-09-29
US8072106B2	United States of America	B2	2011-12-06
JP4898692B2	Japan	B2	2012-03-21
US8143233B2	United States of America	B2	2012-03-27
US2012104890A1	United States of America	A1	2012-05-03
KR101146540B1	Republic of Korea	B1	2012-05-30
US2012178917A1	United States of America	A1	2012-07-12
CN101438486B	China	B	2012-07-18
US2012228976A1	United States of America	A1	2012-09-13
US2012228978A1	United States of America	A1	2012-09-13
US2012228979A1	United States of America	A1	2012-09-13
WO2012122554A1	World Intellectual Property Organization (WIPO)	A1	2012-09-13
WO2012122556A1	World Intellectual Property Organization (WIPO)	A1	2012-09-13
US2012248917A1	United States of America	A1	2012-10-04

Showing 100 of 126

2 legal events, as the office reported them to INPADOC

Over the term

Point at a mark for the event

Events

Legal events, newest first
	Event	Code
2017-11-07	LapsedLapsedMKLA	MKLA
2006-09-26	Examination requestEEER	EEER