Diagnosis of chronic myelogenous leukemia

1 334580 DIAGNOSIS OF CHRONIC MYELOGENOUS LEUKEMIA BACKGROUND OF THE INVENTION Chronic myelogenous leukemia is characterized by a reciprocal translocation between chromosomes 9 and 22 of man. This results in an abbreviated chromosome 22 termed the Philadelphia chromosome which is found in over 95 percent of patients with chronic myelogenous leukemia and in a minority of patients with acute lymphoblastic leukemia. In this translocation, the abl gene from chromosome 9 is spliced to a region on chromosome 22 called the breakpoint cluster region (bcr).

This fusion gene, bcr-abl, is transcribed into unique RNA transcript that is about 8kb in size.

Various aspects of the invention is as follows:

A synthetic oligonucleotide useful as a probe to detect the chronic myelogenous leukemia bcr-abl fusion mRNA, said synthetic oligonucleotide including the sequence:

5'CTGAAGGGCTTTTGAACTCT 3' or the sequence 5'CCGTGAAGGGCTTCTTCCTTATTG3'.

A synthetic oligonucleotide including the sequence 5'CTGAAGGGCTTTTGAACTCT 3' abl / bcr 3 or the sequence 5'CCGTGAAGGGCTTCTTCCTTATTG 3' abl / bcr 2.

DESCRIPTION OF THE INVENTION This invention pertains to primers and probes which can detect the bcr-abl RNA from blood or bone marrow of patients with chronic myelogenous leukemia.

The patient's RNA is amplified using unique primers homologous to flanking sequences to the bcr-abl splice sites. Oligonucleotide probes complementary to the two most common bcr-abl splice sequences are then used to detect the amplified DNA. The assay is useful to detect residual or relapsed chronic myelogenous leukemia and to distinguish between Philadelphia chromosome positive acute lymphoblastic leukemia and lymphoid blast crisis of chronic myelogenous leukemia.

1 334580 More particularly, the positions of the break points between the two genetic loci involved in the translocation (bcr and abl) are variable, but the fused genes produce two different, but distinct chimeric mRNA's which code for a fusion protein with an enhanced prote~in kinase activity. The primary transcript from this novel gene fusion is very large, while messenger splicing events pare this down to an 8.5 kilobase mRNA with a unique splice joint matching bcr exons 1,2 with abl exon 2, or bcr exons 1,2,3 with abl eson 2 and the remainder of the abl downstream sequences. Pursuant to this invention, synthetic DNA probes have been developed specifically to detect the CML bcr-abl fusion mRNA. In addition, this invention involves two synthetic oligodeoxyribonucleotide primers, one complementary to a sequence lin bcr exon 2, while the other is complementary to a sequence in labl exon 2. Beginning with less than one microgram of cells, the sequences including and in between the two primers are amplified, and the synthetic oligonucleotide probes are used to detect the amplified products (which are derived either from a splice which joined bcr 1,2 with abl 2, or bcr 1,2,3 with abl 2). The sequences of the probes and the positions in the fusion message are presented below.

bcr eson 2 / bcr exon 3 CAC AGC ATT CCG CTG ACC ATC AAT AAG GAA G/AT GAT GAG TCT CCG GGG 5~************~**********bcr primer 5 CTC TAT GGG TTT CTG AAT GTC ATC GTC CAC TCA GCC ACT GGA TTT AAG /~ unique fusion point abl exon 2 CAG AGT TCA A/AA GCC CTT CAG CGG CCA GTA GCA TCT GAC TTT GAG CCT CAG GGT CTG AGT GAA GCC GCT CGT TGG AAC TCC AAG GAA AAC CTT CTC g gaa gag ****~**~ GCT GGA CCC AGT G cga cct 999 tca c5' abl primer *******~******* Detection probes for bcr 3 /abl 2 splice junction=5'CTGAAGGGCTTTTGAACTCT 3' ~ abl / bcr 3 'for bcr 2 /abl 2 splice junction=5'CCGTGAAGGGCTTCTTCCTTATTG 3' ~ abl / bcr 2