Isolated polypeptides, polynucleotides useful for modifying salinity stress tolerance in plants

(54) Title: METHOD OF IMPROVING TOLERANCE TO THE ABIOTIC STRESS OF A PLANT, METHOD OF IMPROVING THE EFFICIENCY OF USE OF WATER, EFFICIENCY OF USE OF FERTILIZER, BIOMASS, VIGOR AND / OR PRODUCTION OF A PLANT, POLYCLE, UNDER CONTAINER NUCLEIC, INSULATED POLYPEPTIDE, PLANT CELL (51) Int. Cl .: C07K 14/415; C12N 15/82; A01H 5/00 (30) Unionist Priority: 8/20/2008 US 61 / 136,238, 8/20/2008 US 61/136, 23827/12/2007 US 61 / 009,166 (73) Holder (s): EVOGENE LTD ( 72) Inventor (s): GIL RONEN; BASIA JUDITH VINOCUR; ALEX DIBER; SHARON AYAL; HAGAI KARCHI; YOAV HERSCHKOVITZ (74) Attorney (s): TINOCO SOARES & FILHO LTDA (86) International Application: PCT IL2008001657 of 12/23/2008 (87) International Publication: WO 2009/083958 of 09/07/2009

1/175

METHOD OF IMPROVING THE

TOLERANCE TO THE ABIOTIC STRESS OF A PLANT, METHOD OF IMPROVING THE EFFICIENCY OF USE OF WATER, EFFICIENCY OF THE USE OF FERTILIZER, BIOMASS, VIGOR AND / OR PRODUCTION OF A PLANE, POLYCLEOTIDE ISOLATED, ISOLATED, NAPOLEOUS, WINE

INVENTION AREA AND BACKGROUND parts, refers to new aquaporin polynucleotides and polypeptides and, more specifically, but not limited to, methods of using them to increase tolerance to abiotic stress, water use efficiency (WUE), efficiency of the use of biomass fertilizer, vigor and / or production of a plant.

Abiotic stress conditions such as salinity, drought, flood, sub-ideal temperature and toxic / chemical pollution, cause substantial damage to agricultural plants. Most plants have developed strategies to protect themselves against the severity and duration of these stress conditions are very large, the effects on the development, growth and production of the harvest plants are profound. In addition, most cultivated plants are highly susceptible to abiotic stress (ABS) and thus require ideal growing conditions for commercial production. The continued exposure to stress causes major changes in the plant's metabolism, which ultimately leads to cell death and, consequently, production losses.

2/175

The global scarcity of water supply is one of the most serious agriculture problems affecting plant growth and harvesting and efforts are made to minimize the damaging effects of desertification and salinisation of the world's arable land. Thus, agricultural biotechnology companies try to create new cultivation varieties that are tolerant to different abiotic stresses, focusing mainly on the development of new varieties that can tolerate the lack of water for longer periods.

Studies have shown that the plant's adaptations to adverse environmental conditions are complex genetic traits with a polygenic nature. When water supply is limited, the plant's WUE is critical for crop survival and production. Since water scarcity is increasing and water quality is decreasing worldwide, it is important to increase the plant's water productivity and WUE. Most environmental abiotic stresses such as drought, low temperature or high salt content, decrease the hydraulic conductivity of the root, affect plant growth and decrease crop productivity.

The genetic improvement of FUE in plants can be generated by traditional generation or by

<td>genetic engineering.</td><td>Attempts</td><td>in</td><td>improve</td><td>The</td><td>FUE on</td>

<td>transgenic plants</td><td>are described</td><td>at the</td><td>Request</td><td>in</td><td>Patent</td>

<td>American 20020046419</td><td>for Choo, et</td><td>al.</td><td>,· Request</td><td>in</td><td>Patent</td>

<td>American 20030233670</td><td>Edgerton et</td><td>al.</td><td>; Request</td><td>in</td><td>Patent</td>

3/175

American 20060179511 to Chomet et al. ; Yanagisawa et al.

[Proc. Natl. Acad. Know. USA 2004, 101 (20): 7833 - 8]; Good

AG et al. [Trends Plant I know. 2004, 9 (12): 597-605]; and Patent to Good et al.

American

No.

6.084.153

<td> 5</td><td></td><td></td><td></td><td>At</td><td>aquaporins</td><td>(AQPs), the</td>

<td>proteins</td><td>of</td><td>channel</td><td>in</td><td>water, are</td><td colspan="2">involved in transportation</td>

<td>of water</td><td>per</td><td>middle</td><td>in</td><td>membranes,</td><td>maintenance of</td><td>balance</td>

<td>water i</td><td>gives</td><td>cell</td><td>and</td><td>homeostasis</td><td>in environment</td><td>variable and</td>

<td>conditions</td><td>in</td><td colspan="4">development [Maurel C. Plant</td><td>aquaporins ·:</td>

<td colspan="3">10 Novel functions and</td><td colspan="3">regulation properties. FÈBS</td><td>Lett. 2007,</td>

581 (12).-2227-36]. These proteins are considered to be the main passage allowing the transport of water and small neutral solutes, such as urea and CO₂ across the membrane. [Maurel C. Plant aquaporins: Novel functions and regulation properties. FEBS Lett. 2007 Jun 12; 581 (12): 2227-36]. In plants, AQPs are present as four subfamilies of intrinsic proteins: plasma membrane (PIP), tonoplast (TIP), small and basic (SIP) and similar to N0D26 (NIP).

total AQP members in plants, compared to animals, appear to be surprisingly high [Maurel C., 2007 (Supra)]. For example, 35 AQP genes have been identified in the Arabidopsis genome [Quigley F, et al. , From genome to function: the Arabidopsis aquaporins. Genome Biol. 2002, (1): RESEARCH0001.1 -1.17], 36 in corn [Chaumont F, et al. ,

2001, Aquaporins constitute a large and highly divergent protein family in maize. Plant Physiol, 125 (3): 1206-15], and 33 in rice [Sakurai, J., et a., 2005, Ident if ication of 33 rice aquaporin genes and analysis of their expression and

4/175 function.

Plant Cell Physiol. 46, 1568-1577]. The high number of AQPs in plants suggests a diversified role and differential regulation under varying environmental conditions [Maurel C.

, 2007 (Supra)].

W02004 / 104162 to current inventors, teaches sequences to use them to improve polynucleotides and the tolerance of a plant methods to abiotic stresses and / or to improve a plant's biomass.

W02007 / 020638 to current inventors, teaches polynucleotide sequences and use them to improve the tolerance of an abiotic stress and / or improve a plant's production.

Lian

PIP1

16: 651-60) of AQPs in plant methods to biomass, vigor and / or

HL, et al., 2006 (Cell overexpressed rice. Aharon R.,

439-47) overexpressed members et al.

of a subgroup of

2003 (Plant Cell, Arabisopsis plasma membrane aquaporin, PIPlb in

SUMMARY OF THE INVENTION

According to some parts of the present invention, tobacco plants with improved tolerance to abiotic stress involving the expression of a method aspect of a plant, within the plant of an exogenous polynucleotide encoding a polypeptide involving a sequence of at least 80 amino acids % homologous to the amino acid sequence selected from the group consisting of a SEQ ID No.: 33, 34, 30, 27-29, 31, 32, 355/175

52, 1401-1403, 1405-1435, 1437-1494,

1496-1542,

1544-1553,

1555-1559,

1561- 1827,

-1827-1866,

1868-2450

2453-2458,

2460-2463,

2465-2481, 2483, 2485-2746,

2765-2769

3052-3065 and

3067-3259, thus increasing the tolerance to abiotic stress some improve the plant.

According to a part aspect of the present invention, the efficiency of using a plant fertilizer (FUE), involving the polynucleotide involving homologous to a method of exogenous a sequence of a sequence in a SEQ ID

52, 1401-1403, 1405-1435, water use (WUE) biomass efficiency, vigor and / or expression production within the plant encoding a d 'of an amino acid polypeptide at least 80% amino acid

No. 33, 34,

1437-1494, selected from the group

30, 27-29, 31, 32, 351496-1542, 1544-1553,

1555-1559, 1561-1827, 1829-1866, 1868-2450, 2453-2458, 24602463, 2465-2481, 2483, 2485-2746, 2765-2769, 3052-3065 and

3067-3259, thus increasing water use efficiency (WUE), fertilizer use efficiency (FUE), biomass, vigor and / or production of a plant.

According to an aspect of some parts of the present invention, there is an isolated polynucleotide involving a nucleic acid sequence at least 80% identical to the nucleic acid sequence selected from the group consisting of SEQ ID NO: 7, 8, 4, 1 -3, 5, 6, 9-26,

53-55, 57-87, 89-147, 149-195, 197-206, 208-212, 214-480, 482519, 521-1103, 1106-1111, 1113-1116, 1118-1134, 1136, 11381400, 2748-2764, 2843-2857 and 2859-3051.

6/175

<td></td><td>In</td><td>a deal with</td><td>one</td><td>aspect</td><td>in</td>

<td>some parts of this</td><td colspan="2">invention, there is a</td><td colspan="2">construct</td><td>in</td>

<td>nucleic acid, involving</td><td>The</td><td colspan="2">polynucleotide</td><td>isolated</td><td>gives</td>

<td colspan="3">invention and a promoter to direct the</td><td colspan="2">transcription</td><td>gives</td>

<td>nucleic acid sequence.</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td>In</td><td>a deal with</td><td>one</td><td>aspect</td><td>in</td>

In some parts of the present invention, there is an isolated polypeptide, involving an amino acid sequence at least 80% identical to the amino acid sequence selected from the group consisting of a SEQ ID No. 33, 34, 30, 27-29, 31, 32, 3552 , 1401-1403, 1405-1435, 1437-1494, 1496-1542, 1544-1553, 1555-1559, 1561-1827, 1829-1866, 1868-2450, 2453-2458, 24602463, 2465-2481, 2483, 2485 -2746, 2765-2769, 3052-3065 and 3067-3259.

According to an aspect of some parts of the present invention, there is a plant cell involving an exogenous polypeptide with an amino acid sequence at least 80% homologous to the amino acid sequence selected from the group consisting of a SEQ ID NO: 33, 34 , 30, 27-29, 31, 32, 35-52, 1401-1403, 1405-1435, 1437-1494, 1496-1542, 1544-1553, 1555-1559, 1561-1827, 1829-1866, 18682450, 2453 -2458, 2460-2463, 2465-2481, 2483, 2485-2746, 27652769, 3052-3065 and 3067-3259.

According to an aspect of some parts of the present invention, there is a plant cell involving an exogenous polypeptide with an amino acid sequence at least 80% homologous to the amino acid sequence selected from the group consisting of SEQ ID NO: 33, 34,

7/175

30, 27-29,

31, 32, 35-52, 1401-1403, 1405-1435, 1437-1494,

1496-1542,

1544-1553, 1555-1559, 1561-1827,

1829-1866,

18682450,

2453-2458,

2460-2463,

2465-2481, 2483,

2485-2746 ,

27652769, 3052-3065

3067- 3259

According to an aspect of some parts involving sequence sequence in an ID one of the present invention, there is an exogenous nucleic acid polynucleotide in the minimum nucleic acid selected from the

SEQ No. 7, 8, 4, 1-3,

147, 149-195,

197-206, 208-212, , 6, 9-26,

1106-1111

2843-2857 some improve

1113-1116, 1118-1134 and 2859-3051.

Plant cell involving a

80% group

53-55 homologous to consisting

57-87, 89214-480, 482-519

1136, according to parts of the present invention the tolerance to involving the polynucleotide involving

SEQ No. 33,

1435, 1437

1829-1866,

2485-2746, increasing, plant.

some

521-1103, a

34,

1494

1138-1400 with a

2748-2764, aspect of there is an exogenous sequence of expression method

30, 27-29, , 1496-1542,

1868-2450,

2765-2769 thus, parts of the plant's abiotic stress, within the plant of an encoding an amino acid polypeptide determined by ID

31, 32, 35-52, 1401-1403, 14051544-1553, 1555-1559, 1561-1827

2453-2458, 2460-2463, 2465-2481,

2483

3052-3065,

3067-3258

OR

3259 tolerance to abiotic stress of

According to an aspect of the present invention, there is a method of improving water use efficiency (WUE),

8/175 biomass, a plant, involving the expression within the plant of an exogenous polynucleotide encoding a polypeptide involving an amino acid sequence determined in ID

SEQ No. 33, 34,

30, 27-29

31, 32, 35-52, 1401-1403, 14051435, 1437-1494,

1496-1542 , 1544-1553, 1555-1559, 1561-1827

1829-1866,

1868-2450,

2453-2458, 2460-2463, 2465-2481,

2483

2485-2746,

2765-2769

3052-3065/

3067-3258 or

3259 thus increasing the efficiency of the use of water (WUE) efficiency of the use of fertilizer (FUE), biomass, vigor and / or production of a plant.

According to an aspect of some parts of the present invention, there is an isolated polynucleotide involving a nucleic acid sequence determined in SEQ ID NO:

7, 8,

4, 1-3,

6, 9-26, 53-55

57-87, 89-147, 149-195, 197-206,

208-212,

214-480, 482-519

521-1103,

1106-1111,

1113-1116,

1118-1134,

1136,

1138-1400

2843-2857

2859-3050 or 3051.

t

2748-2764,

<td></td><td>According</td><td>one</td><td>aspect</td><td>in</td>

<td>some parts of this</td><td colspan="3">invention, there is a construct</td><td>in</td>

<td>nucleic acid, involving</td><td colspan="2">the polynucleotide</td><td>isolated</td><td>gives</td>

<td colspan="2">invention and a promoter to direct the</td><td colspan="2">transcription</td><td>gives</td>

<td>nucleic acid sequence.</td><td></td><td></td><td></td><td></td>

<td></td><td>According</td><td>one</td><td>aspect</td><td>in</td>

<td>some parts of this</td><td>invention, there</td><td>one</td><td colspan="2">polypeptide</td>

certain amino acid involving

1401-1403, an isolate sequence,

32, 35-52 by SEQ ID No.: 33,

34, 30, 27-29, 31,

1405-1435, 1437-1494, 1496-1542, 1544-1553, 1555-1559, 15619/175

1827,

1829-1866,

1868-2450

2453-2458,

2460-2463

2465-2481,

2483 ,

2485-2746,

2765-2769

3052-3065,

3067-3258 or 3259.

According to an aspect of some parts of this there is a plant cell involving amino acid

32, 35-52, an exogenous polypeptide, with a sequence determined by SEQ ID NO:

1401-1403, 1405-1435, 1437

1553, 1555-1559, 1561-1827

2460-2463, 2465-2481, 2483

3067-3258 or 3259.

some parts of this

1829-1866

2485-2746

33, 34, 30, 27-29, 31,

-1494, 1496-1542, 15441868-2450

2765-2769

According to the invention, there is involving a polynucleotide sequence

4, 1-3, 5

208-212,

1118-1134 or 3051.

with an exogenous nucleic acid determined in, 6, 9-26

214-480,, H36, some parts, 53-55,

482-519,

521-1103,

1138-1400,

2748-2764, of this

2453-2458,

3052-3065, plant cell aspect involving

SEQ ID

149-195

According to the invention, a

N °: 7, 8, 197-206

1113-1116

2843-2857 with a

2859-3050 polynucleotide aspect selected from a group consisting of the

ID

SEQ No. 7, 8,

4,

1-3, 5,

208-212,

1118-1134

3051 .

6, 9-26,

214-480,

1136, from SEQ ID

53-55, 57-87, 89-147,

149-195, 197-206,

482-519,

521-1103, 1106-1111, 1113-1116,

1138-1400, 2748-2764 polypeptide is

N °: 33, 34, 30,

According selected

27-29, 31,, 2843-2857 and 2859with

32, some parts of the group consisting of

35-52, 1401-1403,

10/175

1405-1435, 1437-1494, 1496-1542, 1544-1553, 1555-1559, 15611827, 1829-1866, 1868-2450, 2453-2458, 2460-2463, 2465-2481, 2483, 2485-2746, 2765- 2769, 3052-3065 and 3067-3259.

According to some parts of the invention, the polypeptide is selected from the group consisting of SEQ ID NO: 33, 34, 30, 27-29, 31, 32, 35-52, 1401-1403, 1405-1435, 1437-1494 , 1496-1542, 1544-1553, 1555-1559, 15611827, 1829-1866, 1868-2450, 2453-2458, 2460-2463, 2465-2481, 2483, 2485-2746, 2765-2769, 3052-3065 and 3067 -3259.

According to some parts of the invention, abiotic stress is selected from the group consisting of salinity, lack of water, low temperature, high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, excess nutrient, air pollution and irradiation UV.

According to some parts of the invention, the method also involves plant growth by expressing the exogenous polynucleotide under abiotic stress.

According to some parts of the invention, the promoter is a constitutive promoter.

According to some parts of the invention, the plant cell forms a part of a plant.

Unless otherwise defined, all technical and / or scientific terms used in the present have the same meaning commonly understood by one of the ordinary skills in the art to which the invention belongs. Although similar methods and materials or

11/175 equivalent to those described herein can be used in the practice or testing of parts of the invention, exemplification methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will prevail. In addition, the materials, methods and examples are illustrative only and are not intended to be limiting. BRIEF DESCRIPTION OF THE DRAWINGS

Some parts of the invention are described herein, by way of example only, with reference to the related drawings. With regard to specific drawings in detail, it is emphasized that the particularities shown as

<td>examples and with the</td><td>goal</td><td>to illustrate the</td><td colspan="2">discussions of</td>

<td>parts of the invention</td><td>Thus, the</td><td>description together</td><td colspan="2">to drawings</td>

<td colspan="3">clear to those skilled in the art of how</td><td>at</td><td>parts of</td>

<td>invention can be</td><td>practiced.</td><td></td><td></td><td></td>

<td>In the drawings:</td><td></td><td></td><td></td><td></td>

<td>figure 1 is a</td><td>illustration</td><td>schematic</td><td>of</td><td>plasmid</td>

<td>binary</td><td>pGI used</td><td>to express</td><td>at</td><td>strings</td>

polynucleotides isolated from the invention. RB T-DNA right margin; LB - T-DNA left margin; H- HindIII restriction enzyme; X restriction enzyme Xbal; B - restriction enzyme BamHI; S - restriction enzyme Sal; Sm - restriction enzyme Smal; RI - EcoRI restriction enzyme; Sc - SaciI / SstI / Ecll361I; (numbers) - Length in base pairs; NOS pro = promoter of nopaline synthesis; NPT-II = neomycin phosphotransferase gene; WE

12/175 ter = nopaline synthesis terminator; Poly-A signal

Classification GUS and polynucleotides isolated from some parts of the GUSintron reporter gene;

Figures 2A-B are images showing the root development of plants grown on transparent agar plates. The different transgenes were grown on transparent agar plates for 10-15 days and the plates were photographed every 2-5 'days starting on day 1. figure 2A An example image of plants obtained after 12 days on agar plates. figure 2B - An example image of the root analysis in which the measured root length is represented by a red arrow;

Figures 3A-F are histograms showing total economic fruit production, plant biomass and harvest index of TOM-ABST36 (black bar) vs. control plants (white bar) growing in a commercial greenhouse under irrigation with 200 mM sodium chloride (NaCl) (figures 3A-C, respectively), or under two different water stress regimes (WLI-1 and WLI -2; figure 3D-F, respectively). Yield was compared to plants growing under irrigation conditions

13/175 standard (0 mM NaCl and WLI-0). The results are the average of the four independent events. * Significantly different with P &lt;0.05;

Figures 3G-J are photographs of transgenic tomato plants or control plants under different conditions. Figure 3G - TOM-ABST36 plants growing under regular irrigation conditions; figure 3H - control plants growing under irregular irrigation conditions; figure 31 TOM-ABST36 plants after growing under irrigation with 200-mM NaCl throughout the growing season, - FIG. 3J - control plants after growing under irrigation with 200-mM NaCl throughout the growing season.

DESCRIPTION OF SPECIFIC PARTS OF THE INVENTION

The present invention, in certain parts, relates to new aquaporin polynucleotides and polypeptides and, more specifically, but not limited to, methods of using them to increase tolerance to abiotic stress, efficiency of water use, efficiency of use of fertilizer, biomass, vigor and / or production of a plant.

Before explaining at least part of the invention in detail, it should be understood that the invention is not necessarily limited in its application to the details determined in the following descriptions or exemplifications by the Examples. The invention is capable of having other parts or being practiced or performed in various ways

14/175 shapes.

By reducing the invention to practice, the inventors identified new polynucleotides and coded aquaporin polypeptides (AQP).

Thus, as shown in the Examples section below, the inventors employed a bioinformatics approach that combines comparative digital and genomic expression analysis between species and selected 7.2 million express sequence tags (ESTs) from 1,195 collections of relevant species ESTs of monocotyledonous and dicotyledonous plants. Using this approach, 1,114 different AQP genes were identified and were then classified into 11 subgroups (Table 1). Further analysis revealed that ESTs in the TIP2 subgroup are significantly overrepresented in plant roots and in plants exposed to abiotic stress (ABS), and polypeptides (eg, SEQ ID No.: 27-28, 45-48, Table 2) encoded by polynucleotides from the TIP2 subgroup (eg, SEQ ID No.: 1, 2, 19-22, Table 2) share a common consensus sequence TLXFXFAGVGS (SEQ ID No.; 2826). Based on over-representation in the roots, the conditions of ABS and tissues with low water levels (such as seed and pollen), additional polynucleotides of the aquaporin gene family have been identified (SEQ ID N °: 3-18, 23-26, Table 2), as well as their counterparts or orthologs (SEQ ID No.: 53-1400, 28443051 for polynucleotides and SEQ ID No.: 1401-2746, 3052-3259 for polypeptides; Table 3). In addition, quantitative RT-PCR analyzes demonstrated high expression of AQP genes

15/175 representative (eg, SEQ ID No.: 5, 6 and 7) under salt stress, which was higher in plants exhibiting salt tolerance compared to plants that are sensitive to salt stress (Table 5, Example 2 of the Examples section below). As described in Examples 34 of the Examples section below, the representative AQP polynucleotides were cloned (Tables 7, 8 and 9) and transgenic plants with their overexpression were generated (Example 4). These plants have been shown to exhibit high tolerance to various abiotic stresses such as osmotic stress (Tables 10-14; Example 5) and salinity stress (Tables 30-45; Example 6), efficiency of fertilizer use (under nitrogen-limiting conditions, Tables 59-68, Example 7) and higher growth, biomass and subnormal results (Tables 15-29 (Example 5), 46-58 (Example 6)) or abiotic stress conditions (Examples 5-8). Overall, these results suggest the use of polynucleotides and AQP polypeptides of the invention to increase tolerance to abiotic stress, water use efficiency, fertilizer use efficiency, biomass, vigor and / or plant production.

It should be noted that the polypeptides or polynucleotides that affect (eg, increase) the metabolism, growth, reproduction and / or viability under stress of the plant, can also affect growth, biomass, production and / or plant vigor under ideal conditions.

Thus, according to one aspect of the invention, there is a method of increasing the tolerance

16/175 to abiotic stress, the efficiency of water use, the efficiency of fertilizer use, growth, biomass, production and / or vigor of a plant. The method is carried out by expressing, within the plant, an exogenous polynucleotide encoding a polypeptide involving a consensus amino acid sequence TLXFXFAGVGS as determined in SEQ ID No. 2826, in which 'the expression of the polypeptide promotes biomass / vigor and / or production of plant under normal or stress conditions.

It is suggested that polypeptide activity is structurally associated with the integrity of the consensus sequence above (SEQ ID No.: 2826). In some parts of this aspect of the present invention, activity is a water channel activity that typically resides in the vacuolar 'membrane (tonoplasto) and / or plasma membrane of the plant cell and allows the transport of water and / or small neutral solutes such as urea, nitrates and carbon dioxide (CO₂) through the membrane.

as used at present, adverse on metabolism, phrase abiotic stress, refers to any viability effect of the plant. Thus, abiotic stress can be induced by suboptimal environmental growth conditions such as, for example, salinity, lack of water, floods, frost, low or high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, air pollution or UV irradiation. The implications of abiotic stress are discussed in the History section.

17/175

The phrase abiotic stress tolerance, as used in the present, refers to a plant's ability to withstand abiotic stress without undergoing a substantial change in metabolism, growth, productivity and / or viability.

As used at present, the phrase water use efficiency (WUE) refers to the level of organic matter per unit of water 'consumed by the plant, that is, the dry weight of the plant in relation to the plant's water use, for example. example, biomass produced by unit transpiration.

As used at present, the phrase efficiency of fertilizer use refers to uptake, dispersion, absorption, accumulation, relocation (within the plant) and use of one or more of the minerals and organic components absorbed from the soil such as nitrogen, phosphate and / or potassium.

As used at present, the phrase biomass of the plant refers to the quantity (measured in grams of dry tissue in air) of a tissue produced by the plant in a growing season, which could also determine or affect the plant's production or production by cultivation area.

As used at present, the back production of the plant refers to the quantity (as determined by weight / size) or quantity (numbers) of tissue produced by the plant or by growing season. Thus, greater production could affect the benefit

18/175 economic value that someone could obtain from the plant in a certain cultivation area and / or cultivation time.

As used at present, the phrase plant vigor refers to the amount (measured by weight) of tissue produced by the plant at a given time. Thus, the increase in vigor could determine or affect plant production or production by cultivation time or cultivation area.

As used herein, the term increase refers to at least about 2%, to at least about 3%, to at least about 4%, to at least about 5%, to at least about 10% , at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80% increase in tolerance to abiotic stress, water use efficiency, efficiency of fertilizer use, growth, biomass, production and / or vigor of the plant compared to the native plant [i.e., a plant not modified by the biomolecules (polynucleotides or polypeptides) of the invention, e.g. ex. , an unprocessed plant of the same species that is grown under the same growing conditions).

As used herein, the phrase exogenous polynucleotide refers to a heterologous nucleic acid sequence that may not be naturally expressed within the plant or whose overexpression in the plane is desired. The exogenous polynucleotide can be introduced into the

19/175 plant permanently or temporarily, in order to produce a molecule of ribonucleic acid (RNA) and / or a polypeptide molecule.

It should be noted that the exogenous polynucleotide may involve a nucleic acid sequence that is identical or partially homologous to a plant's endogenous nucleic acid sequence.

According to some parts of the invention, the exogenous polynucleotide of the invention encodes a polypeptide containing a nucleic acid sequence of at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least at least about 97%, at least about 98%, at least about 99%, or 100% homologous to the amino acid sequence selected from the group consisting of a SEQ ID

N ° S: 27-28, 45-48, 1401-1403, 1405-1435, 1437-1494, 14961542, 1544-1553, 1555-1559, 1561, 2449-2450, 2453-2458,

2460-2463, 2465-2481, 2483, 2484 and 2765.

Homology (eg, percentage homology) can be determined using any homology comparison software, including, for example, the BlastP or TBLASTN software from the National Center of Biotechnology Information (NCBI), such as when using standard parameters when

20/175 start from a polypeptide sequence; or the tBLASTX algorithm (available via NCBI), as when using standard parameters, which compares the products of the conceptual translation of six structures of. a nucleotide sequence (two strands) compared to a protein sequence database.

Homologous sequences include sequences - orthologous and parallel.

The term parallels refers to genetic duplications within the genome of a species leading to paragon genes. The term orthologist refers to homologous genes in different organisms due to ancestral relationship.

An option to identify orthologists in monocotyledonous plant species is by doing a reciprocal blast search. This can be done by a first blast involving blasting the sequence of interest with any sequence database, such as the publicly available NCBI database, which can be found at: Hypertext

Transfer Protocol: // World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov.

If orthologists were sought in rice, the sequence of interest would pass through the blast comparing, for example, cDNA clones of 28,469 of total

Oryza sativa

Nipponbare available on

NCBI. The blast results can be filtered.

The total sequences of the filtered results or unfiltered results 'then go through a new blast (according to' blast) with the sequences of the organism from which the sequence of interest is derived. The results of the first and

21/175

Second blast are then compared. An orthologist is identified when the sequence resulting in the highest score (best hit) in the first blast identifies, in the second blast, the query sequence (the original sequence of interest) as the best hit. Using the same reasoning, a parallel is identified (homologous to a gene in the same organism). In the case of large sequence families, * the ClustalW program can be used [Hypertext Transfer Protocol: // World Wide Web (dot) ebi (dot) ac (dot) uk / Tools / clustalw2 / index (dot). html], followed by a neighbor-joining tree (Hypertext Transfer Protocol: // en (dot) wikipedia (dot) org / wiki / Neighbor-joining) that helps visualize clustering.

According to some parts of the invention, the exogenous polynucleotide encodes a polypeptide containing an amino acid sequence determined by SEQ ID No. s: 27-28, 45-48, 1401-1403, 14051435, 1437-1494, 1496-1542, 1544 -1553, 1555-1559, 1561, 2449-2450, 2453-2458, 2460-2463, 2465-2481, 2483, 2484 or 2765.

According to some parts of the invention, the exogenous polynucleotide involves a nucleic acid sequence of at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80 %, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87% at least about 88%, at least about 89%, at least

22/175 less than about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96% at least about 97%, at least about 98%, at least about 99%, or

100% identical to the nucleic acid sequence selected from the group consisting of SEQ ID NO:

1, 2, 19,

20-22, 53-55,

57-87, 89-141, 143-147, 149-195,

197-206,

208-212, 214,

1102-1103, 1106-1111, 1113-1116, 1118-1134, 1136, 2751-2752 and 2748-2750.

Identity (eg, percentage homology) can be determined using any homology comparison software, including, for example, the BlastN software from the National Center of Biotechnology Information (NCBI), such as when using standard parameters.

According to some parts of the invention, the exogenous polynucleotide is determined by ID

<td>SEQ No. s: 1, 2, 19, 20-22, 53-55, 57-87,</td><td> 89-141, 143-147,</td>

<td> 149-195, 197-206, 208-212, 214, 1102-1103,</td><td> 1106-1111, 1113-</td>

<td> 1116, 1118-1134, 1136, 2751-2752, 2748-2749</td><td>OR 2750.</td>

However, other AQP polynucleotides and polypeptides encoded in this document are covered by current teachings.

According to some parts of the invention, the exogenous polynucleotide encodes a polypeptide with an amino acid sequence of at least about 60%, at least about 65%, at least about

70%, at least about 75%, at least about 80%, at least about 85%, at least about 86%, at least

23/175 about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% homologous to SEQ ID N^Qs: 33, 34, 30, 27-29, 31, 32, 35-52, 1401-1403, 1405-1435, 1437-1494, 1496-1542, 1544-1553, 1555-1559, 1561-1827, 1829- 1866, 18682450, 2453-2458, 2460-2463, 2465-2481, 2483, 2485-2746,

2765-2769,

3052-3065, 3067-3258 or 3259.

According to some parts of the invention, the exogenous polynucleotide encodes a polypeptide consisting of an amino acid sequence determined by ID

SEQ No. S: 33, 34, 30, 27-29,

31, 32, 35-52, 1401-1403, 1405

1435, 1437-1494, 1496-1542,

1544-1553, 1555-1559, 1561-1827

1829-1866,

1868-2450,

2453-2458,

2460-2463,

2465-2481, 2483

2485-2746,

2765-2769,

3052-3065,

3067-3258

OR 3259.

In an exemplary part, the exogenous polynucleotide does not encode a polypeptide with the amino acid sequence selected from the group consisting of the

<td>SEQ ID No. s</td><td> 1828 ,</td><td> 1867,</td><td> 1404 ,</td><td> 1436, 1495, 1543, 1554, 1560,</td>

<td> 2451, 2452,</td><td> 2459,</td><td> 2464 ,</td><td> 2482 ,</td><td>2484 and 3066.</td>

<td></td><td></td><td></td><td></td><td>According to some parties</td>

of the invention, the exogenous polynucleotide is at least about%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least

24/175 minus about 90%, at least about 91%, at least about 92%, at least about 93%, at least about

94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or

100% identical to

SEQ ID NO: 7, 8, 4

1-3

5, 6,

9-26, 53-55 , 57-87,

89-147,

149-195, 197-206, 208-212

214-480, 482-519,

521-1103

1106-1111,

1113-1116, 1118-1134

1136, 1138-1400,

2748-2764

2843-2857,

2859-3050 OR 3051.

According to some parts of the invention, the polynucleotide is determined by SEQ ID No. s:

7,

8, 4,

1-3,

5, 6 , 9-26,

53-55, 57-87, 89-147, 149-195, 197208-212, 214-480,

482-519, 521-1103, 1106-1111, 11131116,

1118-1134, 1136 , 1138-1400,

2748-2764, 2843-2857,

2859-3050 or 3051.

In an exemplary part, the exogenous polynucleotide is not the polynucleotide determined by SEQ ID No. s: 481, 520, 56, 88, 148, 196, 207, 213, 1104, 1105, 1112, 1117, 1135, 1137 or 2858.

As used herein, the term polynucleotide refers to a single or double nucleic acid sequence that is isolated and presented in the form of an RNA sequence, a complementary polynucleotide (cDNA) sequence, a genomic and / or polynucleotide sequence composite polynucleotide sequences (eg, a combination of the above).

As used herein, complementary polynucleotide sequence refers to a sequence that results from the reverse transcription of an RNA

25/175 messenger using reverse transcriptase or any other RNA-dependent DNA polymerase. Such a sequence can subsequently be amplified in vivo or in vitro using a DNA-dependent DNA polymerase.

As used at present, a genomic polynucleotide sequence refers to a sequence derived (isolated) from a chromosome and thus represents a part close to a chromosome.

As used herein, the phrase compound polynucleotide sequence refers to a sequence that is at least partially complementary and at least partially genomic. A composite sequence can include some exon sequences necessary to encode the polypeptide of the present invention, as well as some interpolated intronic sequences. The intronic sequences can be from any source, including other genes, and will typically include conserved join signal sequences. These intronic sequences can also include regulatory elements of cis-action expression.

According to some parts of the invention, the polynucleotide of the invention involves no more than 5000 nucleic acids in length. According to some parts of the invention, the polynucleotide of the invention involves no more than 4000 nucleic acids in extension, e.g. ex. , no more than 3000 nucleic acids, p. ex. , no more than 2,500 nucleic acids.

26/175

The nucleic acid sequences encoding the polypeptides of the present invention can be optimized for expression. A non-limiting example of a nucleic acid sequence is provided in SEQ ID No.: 2751, which encodes an optimized polypeptide involving the sequence and amino acid determined by SEQ ID No.: 27. Examples of such sequence modifications include, but are not limited to, a modified G / C content to more closely match what is typically found in the plant species of interest and the removal of atypical codons found in plant species commonly referred to as codon optimization.

The phrase codon optimization refers to the selection of appropriate DNA nucleotides for use within a structural gene or fragment that addresses the use of the codon within the plant of interest. Thus, an optimized gene or nucleic acid sequence refers to a gene in which the nucleotide sequence of a native or naturally occurring gene has been modified to use statistically preferred or statistically favorable codons within the plant. The nucleotide sequence is typically examined at the DNA level and the coding region for expression in the plant species determined using any suitable procedure, for example, as described by Sardana et al. (1996, Plant

Cell Reports 15: 677-681). In this method, the standard deviation of codon usage, a measure of the trend in codon usage, can be calculated by first finding the proportional deviation

27/175 square of the use of each codon of the native gene relative to that of the genes of plants with great expression, followed by the calculation of the mean square deviation. The formula used is: 1 SDCU = η = 1 N [(Xn-Yn) / Yn] 2 / N, where Xn refers to the frequency of use of the codon in high-expression plant genes, where Yn

<td>refers to</td><td colspan="2">the frequency of use of</td><td>codon</td><td>in the gene</td><td>in</td><td>interest</td>

<td colspan="2">and N - refers to</td><td colspan="2">the total number of</td><td>codons</td><td>at the</td><td>gene of</td>

<td>interest</td><td>An</td><td>usage table</td><td colspan="3">codon of genes</td><td>with high</td>

<td>expression</td><td colspan="3">of dicotyledonous plants is</td><td colspan="3">compiled using the</td>

<td colspan="2">Murray data</td><td>et al. (1989, Nuc</td><td>Acids</td><td>Res. 17</td><td> : 477</td><td> -498).</td>

<td></td><td></td><td>a</td><td colspan="2">method of</td><td colspan="2">optimize</td>

<td>sequence</td><td colspan="2">of nucleic acid from</td><td>wake up</td><td>like</td><td>use</td><td>from Codó</td>

<td>preferred</td><td>for</td><td colspan="2">a type of cell</td><td>plant</td><td colspan="2">specific is</td>

based on the direct use, without performing any extra statistical calculation, of Codon Optimization Tables, such as those provided online in the Codon Use Database by the DNA bank of the NIAS (National Institute of Agrobiological Sciences) in Japan (Hypertext Transfer Protocol : // World Wide Web (dot) kazusa (dot) or (dot) jp / codon /). The Codon Usage Database contains codon usage tables for a number of different data present on GenBank.

Using the Tables above to determine the preferred or favorable codons for each amino acid in a specific species (for example, rice), a naturally occurring nucleotide sequence encoding a protein of interest can be codon-optimized for that specific plant species. This is done

28/175 when replacing codons that may have a lower statistical incidence in the genome of specific species with corresponding codons, in relation to an amino acid, which are statistically more favorable. However, one or more less favorable codons can be selected to delete existing restriction sites, to create new ones with potentially useful junctions (5 'and 3' terminations to add signal peptide or termination cassettes, internal sites that can be used to cut and join segments to generate a correct total sequence) or eliminate nucleotide sequences that can negatively affect mRNA stability or expression.

The naturally occurring coding nucleotide sequence may, before any modification, already contain a number of codons that correspond to a statistically favorable codon in certain plant species. Thus, codon optimization of the native nucleotide sequence may involve determining which codons, within the native nucleotide sequence, are not statistically favorable in relation to a specific plant, and modifying these codons according to a usage table. of a specific plant to generate an optimized codon derivative. A modified nucleotide sequence can be wholly or partially optimized for the use of plant codon as long as the protein encoded by the modified nucleotide sequence is produced at a higher level than the protein encoded by the native gene or occurs naturally. The construction of

29/175 synthetic genes by altering the use of codon is described, for example, in PCT Patent Application 93/07278.

Thus, the invention involves the nucleic acid sequences described above; their fragments, hybridizable sequences, homologous sequences, sequences encoding similar polypeptides using. different codons, altered sequences - characterized by mutations such as suppression, insertion or substitution of one or more nucleotides, occurring naturally or induced by man, in a random or objective way.

As mentioned, the inventors did not cover previously uncharacterized polypeptides that share the consensus amino acid sequence determined by SEQ ID NO: 2826.

Thus, the invention provides an isolated polypeptide containing an amino acid sequence of at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least at least about 81%, at least about 82%, at least

<td colspan="2">any less</td><td colspan="2">about</td><td> 83%</td><td>, fur</td><td colspan="2">any less</td><td>fence</td><td>in</td><td> 84%</td><td colspan="2">, at least</td><td>fence</td>

<td>in</td><td> 85%</td><td>, fur</td><td colspan="2">any less</td><td>fence</td><td>in</td><td> 86%</td><td>, fur</td><td colspan="2">any less</td><td>fence</td><td>87%,</td><td>fur</td>

<td colspan="2">any less</td><td>fence</td><td>in</td><td> 88%</td><td>, fur</td><td colspan="2">any less</td><td>fence</td><td>in</td><td> 89%</td><td>, fur</td><td>any less</td><td>fence</td>

<td>in</td><td> 90%</td><td>, fur</td><td colspan="2">any less</td><td>fence</td><td>in</td><td> 91%</td><td>, fur</td><td colspan="2">any less</td><td>fence</td><td>92%,</td><td>fur</td>

<td colspan="2">any less</td><td>fence</td><td>in</td><td> 93%</td><td>, fur</td><td colspan="2">any less</td><td>fence</td><td>in</td><td> 94%</td><td>, fur</td><td>any less</td><td>fence</td>

<td>in</td><td> 95%</td><td>, fur</td><td colspan="2">any less</td><td>fence</td><td>in</td><td> 96%</td><td>, fur</td><td colspan="2">any less</td><td>fence</td><td>97%,</td><td>fur</td>

<td colspan="2">any less</td><td>fence</td><td>in</td><td> 98%</td><td>, fur</td><td colspan="2">any less</td><td>fence</td><td>in</td><td> 99%</td><td>, or 1</td><td colspan="2">00% homologous</td>

<td>The</td><td colspan="2">sequence</td><td>in</td><td colspan="5">selected amino acid</td><td colspan="5">. of the group consisting of</td>

<td>ID</td><td colspan="2">SEQ NO:</td><td> 27</td><td> -28 ,</td><td colspan="2"> 45-48,</td><td colspan="2"> 1401-1403</td><td>t</td><td> 1405</td><td> -1435,</td><td> 1437-</td><td> 1494 ,</td>

30/175

1496-1542, 1544-1553, 1555-1559,

1561, 2449-2450, 2453-2458,

2460-2463, 2465-2481,

2483 ,

2484 and 2765.

According to the same parts of the invention, the invention provides an isolated polypeptide containing an amino acid sequence of at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least at least about 98%, at least about 99%, or 100% homologous to the selected amino acid sequence of the group consisting of SEQ ID NO:

33, 34, 30, 27-29, 31, 32, 35-52,

1401-1403, 1405-1435,

1437-1494, 1496-1542, 1544-1553, 1555-1559, 1561-1827, 18291866, 1868-2450, 2453-2458, 2460-2463, 2465-2481, 2483, 2485-2746, 2765-2769, 3052- 3065 and 3067-3259.

According to some parts of the invention, the polypeptide is determined by SEQ ID No. s: 33, 34, 30, 27-29, 31, 32, 35-52, 1401-1403, 1405-1435, 1437

1494, 1496-1542, 1544-1553, 1555-1559, 1561-1827, 1829-1866, 1868-2450, 2453-2458, 2460-2463, 2465-2481, 2483, 2485-2746, 2765-2769, 3052- 3065, 3067-3258 or 3259.

In an exemplary part, the polypeptide is not the polypeptide determined by SEQ ID

31/175

No. S: 1828, 1867, 1404, 1436, 1495, 1543, 1554, 1560, 2451, 2452, 2459, 2464, 2482, 2484 OR 3066.

The invention also involves fragments of the polypeptides described above and polypeptides with mutations such as suppression, insertion or replacement of one or more amino acids, occurring naturally or induced by man, either randomly or objectively.

The term plant used in this document involves whole plants, progenitors and descendants of plants and parts of plants, including seeds, branches, trunk, roots (including tubers) and plant cells, tissues and organs. The plant can, in any way, including suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophyte, sporophyte, pollen and microsporas. Plants that are particularly useful in the methods of the invention include all plants that belong to the superfamily Viridiplantae, particularly monocotyledonous and dicotyledonous plants including a forage vegetable, ornamental plants, agriculture, tree or shrubs selected from the list involving Acacia spp. , Acer spp. , Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga, Birch spp.,

Brassica spp., Bruguiera gymnorrhiza,

African Burkea

Leafy Butea,

Cadin farinosa,

Calliandra spp, Camellia sinensis,

Canna indica, Capsicum spp.,

Cassia spp. ,

Centroema pubescens, Chacoomeles spp., Cinnamomum cassia,

32/175

Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneaster serotina, Crataegus spp., Cucumis spp., Cupressus spp., Cyathea dealbata, Cydonia oblonga, Cryptomeria japonica, Cymbopogon spp., Cynthea dealbata, Cydonia divia,

Desmodium spp. ,

Dicksonia squarosa,

Dibeteropogon amplectens,

Dioclea spp, Dolichos spp., Dorycnium rectum,

Echinochloa pyramidalis, Ehraffia spp., Eleusine coracana,

Eragrest is spp., Erythrina spp.,

Eucalypfus spp., Euclea schimperi,

Eulalia vi / losa,

Pagopyrum spp.,

Feijoa sellowlana,

Fragaria spp., Flemingia spp, Freycinetia banksli, Geranium thunbergii, GinAgo biloba,

Glycine javanica, Gliricidia spp, Gossypium hirsutum,

Grevillea spp., Guibourtia coleosperma, Hedysarum spp.,

Very high hemaffhia,

Heteropogon contof fus,

Hordeum vulgare,

Hyparrhenia rufa,

Hypericum erectum, Hypeffhelia dissolute, indigo incamata, iris spp., Leptarrhena pyrolifolia,

Lespedizes. spp.,

Lettuca spp., Leucaena leucocephala,

Loudetia simplex,

Lotonus bainesli, Lotus spp., Macrotyloma axillare, Malus spp., Manihot esculenta, Medicago saliva,

Metasequoia glyptostroboides, Musa sapientum, Nicotianura spp., Onobrychis spp., Ornithopus spp., Oryza spp.,

Peltophorum africanum, Pennisetum spp., Persea gratíssima,

Petunia spp., Phaseolus 5 spp., Phoenix canadensis, Phormium cookianum,

Photinia spp. ,

Picea glauca,

Pinus spp. ,

Pisum sativam,

Podocarpus totara,

Pogonarthria flecki i,

Pogonaffhria squarrosa,

Pseudotsuga menziesii,

Populus spp. ,

Pterolobium

Prosopis cineraria, stellatum,

Pyrus

33/175 communis,

Quercus

Rhaphiolepsis umbellata,

Rhopalostylis sapida,

Rhus natalensis,

Ribes grossularia,

Ribes spp., Robinia pseudoacacia,

Rosa spp. ,

Rubus spp. ,

Salix spp. ,

Schyzachyrium sanguineum,

Sciadopi tys vefficillata,

Sequoia sempervirens,

Sequoiadendron giganteum, Sorghum bicolor, S.pinacia spp., Sporobolus fimbriatus, Stiburus alopecuroides ,. Stylosanthos humilis, · Tadehagi spp, Taxodium distichum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga hetérophylla, Vaccinium spp., Vicia spp., Vitis vinifera, Watsonia pyramidata, Zantedeschia aethiopica, maea, broccoli, brussels sprouts, cabbage, canola, carrots, cauliflower, celery, leaf sprouts, flax, kale, lentils, rapeseed, okra, onion, potatoes, rice, soy, straw, sugar beet, sugar cane , sunflower, tomato, pumpkin, corn, wheat, barley, rye, oats, peanuts, peas, lentils and alfalfa, cotton, rapeseed, canola, pepper, sunflower, tobacco, eggplant, eucalyptus, a tree, ornamental plant, grass and forage.

Alternatively, algae and other non-Viridiplantae plants can be used for the methods of this invention.

According to some parts of the invention, the plant used by the method of the invention are cultivation plants such as rice, corn, wheat, barley, peanuts, potatoes, sesame, olive, oil palm, banana, soy, sunflower, canola, cane sugar, alfalfa, millet, legumes (beans, peas), flax, lupine, rapeseed, tobacco, cholpo and cotton.

34/175 of the invention transforming one or

Expression in the plant can more cells of the polynucleotide be carried out plant with the exogenous polynucleotide, followed by the generation of a mature plant from the transformed cells and cultivating the mature plant under conditions suitable to express the exogenous polynucleotide within the mature plant.

According to some parts of the invention, transformation is effected by introducing into the plant cell a nucleic acid construct that includes the exogenous polynucleotide from some parts of the invention and at least one promoter capable of directing the

More details on the proper transformation approach are provided below.

As used herein, the term promoter refers to a region of the

DNA that is above the site of the start of a gene to which the polymer is

RNA if

1iga to start transcribing the

RNA.

promoter cont rolls where (p.

which part of a plant) and / or when at which stage the gene is expressed.

Any suitable promoter sequence can be used by the acid construct of this invention. Preferably, the promoter is a nucleic constitutive promoter, a tissue specific promoter or an abiotic stress inducible.

35/175

Suitable constitutive promoters include, for example, the CaMV 35S promoter (SEQ ID NO: 2825; Odell et al., Nature 313. · 810 - 812, 1985); district Attorney

Arabidopsis At6669 (SEQ ID No.: 2823; see PCT Publication No.

W004081173A2); Corn Ubi-1 (Christensen et al., Plant Sol. Biol. 18: 675-689, 1992); rice actin (McElroy et al., Plant Cell 2: 163-171, 1990); pEMU (Last et al., Theor.

Appl. Genet. 81: 581-588, 1991); CaMV 19S (Nilsson et al. ',

Physiol. Plant 100: 456-462, 1997); GOS2 (by Pater et al,

Plant J Nov; 2 (6): 837-44, 1992); ubiquitin (Christensen et al, Plant Mol. Biol. 18: 675-689, 1992); rice cyclophylline (Bucholz et al, Plant Mol Biol. 25 (5): 837-43, 1994);

Corn histone H3 (Lepetit et al, Mol. Gen. Genet. 231: 276-285, 1992); Actin 2 (An et al, Plant J. 10 (1), - 107-121,

1996) and MAS Super Sintético (Ni et al., The Plant Journal 7: 661-76, 1995). Other constitutive promoters include those of Pat. Amer. No. 5,659,026, 5,608,149; 5,608,144;

5,604,121; 5,569,597: 5,466,785; 5,399,680; 5,268,463; and

5,608,142.

Suitable tissue-specific promoters include, but are not limited to, leaf-specific promoters [as described, for example, by Yamamoto et al. , Plant J. 12: 255-265, 1997; Kwon et al. ,

Plant Physiol. 105: 357-67, 1994; Yamamoto et al., Plant Cell

Physiol. 35: 773-778, 1994; Gotor et al. , Plant J. 3: 509-18,

1993; Orozco et al-, Plant Mol. Biol. 23: 1129-1138, 1993; and

Matsuoka et al. , Proc. Natl. Acad. Know. USA 90:95 86-9590, 1993], seed preference promoters [p. ex. , in

36/175 specific seed genes (Simon, et al., Plant Mol. Biol. 5. 191, 1985; Scofield, et al., J. Biol. Chem. 262: 12202, 1987; Baszczynski, et al., Plant Mol. Biol. 14: 633,

1990), Brazil nut albumin (Pearson¹ et al. , Plant

Mol. Biol. 18: 235-245, 1992), legumin (Ellis, et al.

Plant Mol. Biol. 10: 203-214, 1988), Glutelin (rice) (Takaiwa, et al., Mol. Gen. Genet. 208: 15-22, 1986;

Takaiwa, et al., FEBS Letts. 221: 43-47, 1987), Zèína (Matzke et al Plant Mol Biol, 143) .323-32 1990), napA (Stalberg, et al, (Albanietal, Plant sunflower (Cummins,

Plant 199: 515-519

Cell, 9: 171- 184, et al., Plant Mol.

, 1996), SPA wheat

1997), oleosin from

Biol. 19: 873-876,

1992)], specific endosperm promoters [p. ex. , LMW and

Wheat HMW, glutenin-1 (Mol Gen Genet 216: 81-90, 1989;

NAR 17: 461-2), gliadins a, wheat beg (EMBO3: 1409-15, 1984), barley ltrl promoter, BI, C hordein, barley D (Theor Appl Gen 98: 1253-62, 1999; Plant J 4: 343-55, 1993;

Mol Gen Genet 250: 750-60, 1996), DOF of barley (Mena et al,

The Plant Journal, 116 (1): 53- 62, 1998), Biz2 (EP99106056.7), synthetic promoter (Vicente-Carbajosa et al., Plant J. 13: 629-640, 1998), NRP33 rice prolamine, Glb-1 rice globulin (Wu et al, Plant Cell Physiology 39 (8) 885-889, 1998), rice alpha-globulin REB / OHP-1 (Nakase et al. Plant Mol. · Biol. 33: 513-S22, 1997), ADPglucose PP from rice (Trans Res 6: 157-68, 1997), ESR gene family of corn (Plant J 12: 235-46, 1997), sorghum gamma-kafirine (PMB 32: 1029-35, 1996)], embryo-specific promoters [p. ex. , OSH1 of rice (Sato et al, Proc. Nati.

37/175

Acad. Know. USA, 93: 8117-8122), KNOX (Postma-Haarsma et al,

Plant Mol. Biol.

39: 257-71, 1999), rice oleosin (Wu et at, J. Biochem.,

123: 386, 1998)], and specific flower promoters [p. ex.,

AtPRP4, chalene synthase (chsA) (Van der

Meer, et al. , Plant Mol. Biol.

15, 95-109, 1990), LAT52 (Twe11 et al Mol. Gen Genet. 217: 240-245,1989), apetalaSuitable inducible promoters of abiotic stress include, among others, inducible salt promoters such as RD2 9A (Yamaguchi

Shinozalei et al., Mol.

Gen. Genet. 236: 331-340, 1993);

inducible drought promoters, such as the corn rabl7 gene promoter (Pia et.

al., Plant Mol. Biol. 21: 259-266,

1993), promoter of the corn rab28 gene (Busk et. Al., Plant J. 11:12 8 5-1295, 1997) and promoter of the corn Ivr2 gene (Pelleschi et. Al., Plant Mol. Biol. 39: 373-380, 1999);

inducible heat promoters, such as hsp80 promoter of heat tomato (American Pat. No. 5,187.2 67).

The nucleic acid construct of some parts of the invention may also include a selectable marker and / or an origin of replication. According to some parts of the invention, the nucleic acid construct used is a shuttle vector, which can propagate in E. coli (where the construct involves an appropriate selectable marker and the origin of replication) and be compatible with propagation in cells. The construct according to the present invention for being, for example, a plasmid, a baemid, a phagemid, a cosmid, a phage,

38/175 a virus or an artificial chromosome.

The nucleic acid construct of some parts of the invention can be used to transform plant cells permanently or temporarily. In stable transformation, the exogenous polynucleotide is integrated into the plant's genome and thus represents a stable and inherited trait. In transient transformation, the exogenous polynucleotide is expressed by the transformed cell, but it is not integrated into the genome and thus represents a temporary feature.

There are several methods of introducing foreign genes to monocot and dicot plants (Potrykus, I., Annu. Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42: 205-225; Shimamoto et al.,

Nature (1989) 338: 274-276).

The principles of methods of causing permanent integration of exogenous DNA into plant DNA include two main approaches:

(i) Agrobacterial-mediated gene transfer: Klee et al. (1987) Annu. Rev. Plant Physiol. 38: 467-486; Klee and

Rogers in Cell Culture and Somatic Cell Genetics of Plants,

Vol. 6,

Molecular Biology of Plant Nuclear Genes, eds.

Schell,

J., and Vasil,

L.

K., Academic Publishers, San

Diego,

Calif.

(1989)

P·

2-25;

Gatenby, in Plant

Biotechnology, eds. Kung, and Arntzen, CJ

Butterworth

Publishers, Boston, Mass.

(1989) p. 93-112.

(ii) Direct DNA uptake: Paszkowski et al. ,

Cell Culture and Somatic Cell Genetics of Plants, Vol.

6, Molecular

39/175

Biology of Plant Nuclear Genes eds. Schell, J., and Vasil, LK, Academic Publishers, San Diego ,. Calif. (1989) p. 5268; including direct DNA capture methods in protoplasts, Toriyama, K. et al. (1988) Bio / Technology

6: 1072-1074. DNA uptake induced by brief electrical shock from plant cells: Zhang et al. Plant Cell Rep. (1988) 7: 379-384. Fromm et al. Nature (1986) 319: 791-793.

Injection of DNA into plant cells or tissues by particle bombardment, Klein et al. Bio / Technology (198 8) 6: 559-563; McCabe et al. Bio / Technology (1988) 6: 923-926;

Sanford, Physiol. Plant. (1990) 79: 206-209; by the use of micropipette systems; Neuhaus et al. , Theor. Appl. Genet. (1987) 75: 30-36; Neuhaus and Spangenberg, Physiol.

Plant. (1990) 79: 213-217; transformation of fiberglass or silicon carbide from cell cultures, embryos or callus tissue, Pat. Am. No. 5,464,765 or by direct DNA incubation with germinating pollen, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, GP and Mantell, SH and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad. Know. USA (1986) 83: 715-719.

<td></td><td>THE</td><td>system</td><td>in</td><td colspan="2">agrobacterium</td>

<td>includes use</td><td colspan="3">of plasmid vectors that contain</td><td>segments</td><td>in</td>

<td>Defined DNA</td><td>that integrate with the</td><td colspan="2">Genomic DNA</td><td>of the plant.</td><td>The</td>

<td colspan="2">inoculation methods. of the fabric</td><td>of the plant</td><td colspan="3">vary depending on</td>

<td>of the species</td><td>of the plant and the</td><td>system</td><td>in</td><td>delivery</td><td>in</td>

<td>agrobacteria.</td><td>Approach</td><td colspan="2">widely</td><td>used is</td><td>The</td>

<td>procedure</td><td>leaf disk,</td><td>that can</td><td>to be</td><td>accomplished</td><td>with</td>

40/175 any fabric that provides a good source for starting a total plant differentiation. See, for example, Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the agrobacterial delivery system in combination with vacuum infiltration. The agrobacterium system is especially viable in the creation of transgenic dicotyledonous plants.

There are several methods of direct DNA transfer in plant cells. In electroporation, protoplasts are briefly exposed to a strong electric field. In microinjection, DNA is mechanically injected directly into cells using very small micropipettes. In the bombardment of microparticles, DNA is adsorbed onto microprojectiles, such as magnesium sulfate crystals or tungsten particles, and microprojectiles are physically accelerated in plant cells or tissues.

After the fixed transformation, the

<td>propagation</td><td>gives</td><td>plant</td><td>Is made. THE</td><td>method</td><td>more common</td><td>in</td>

<td>propagation</td><td>gives</td><td>plant</td><td colspan="2">it is by seed. THE</td><td>regeneration</td><td>per</td>

<td>propagation</td><td>in</td><td>seed,</td><td>However,</td><td>have the</td><td>defect,</td><td>in</td>

Due to heterozygosity, there is a lack of uniformity in cultivation, since the seeds are produced by plants according to the genetic variations controlled by the rules of Mendel's laws. Basically, each seed is genetically different and will grow with its own specific traits. Thus, it is preferable that the transformed plant is produced in such a way that the regenerated plant

41/175 has traits and characteristics identical to those of the plant preferable that the transformed plant be regenerated because it generates a rapid and consistent reproduction of the transformed plants.

process of cultivating micropropagation plants a new generation from a single piece of tissue, which was obtained from a selected original plant or cultivar. This process allows the mass reproduction of plants that have the preferred tissue expressing the fusion protein. The plants of the new generation that are produced are genetically identical and have the same characteristics allows the mass production of quality plant material in a short period of time and offers a rapid multiplication of cultivars selected in the preservation of the characteristics of the original transformed or transgenic plant . The advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of the plants produced.

Micropropagation is a multi-step procedure that requires changing the culture medium or growing conditions between steps.

Thus, the micropropagation process involves four basic steps: Step one, initial tissue culture; step two, multiplication of tissue culture; step three, differentiation and plant formation; and step four, greenhouse cultivation and hardening. During step one, initial culture

42/175 of the tissue, the tissue culture is established and certified to be free of contaminant. During step two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production targets. During step three, the tissue samples grown in step two are divided and grown on individual seedlings. In the fourth stage, the transformed seedlings are transferred to a greenhouse to undergo hardening, in which the plants' tolerance to light is gradually increased, so that it can be grown in the natural environment.

According to some parts of the invention, transgenic plants are generated by transient transformation of leaf cells, meristematic cells or the entire plant.

Temporary transformation can be affected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.

Viruses that have been shown to be useful for the transformation of plant hosts include, CaMV, tobacco mosaic virus (TMV), bromine mosaic virus (BMV) and common bean mosaic virus (BV or BCMV). Plant transformation using plant viruses described in U.S. Pat. American No. 4,855,237 (golden bean mosaic virus; BGV), EP-A 67,553 (TMV), Published Japanese Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV) and Gluzman, Y et al. ,

43/175

Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172 189 (1988). Pseudovirus particles for use in the expression of foreign DNA in many hosts, including plants, are described in WO 87/06261.

According to some parts of the invention, the virus used for transient transformations is avirulent and is thus unable to cause severe symptoms, such as reduced growth rate, mosaic, annular spot, leaf curl, yellowing, streaks, bubble formation, formation of tumors and holes. A suitable avirulent virus can be a naturally occurring avirulent virus or an artificially attenuated virus; The attenuation of the virus can be carried out using methods well known in the art including, among others, sublethal heating, chemical treatment or by direct mutagenesis techniques, as described, for example, by Kurihara and Watanabe (Molecular Plãnt Pathology 4: 259-269, 2003), Galon et al. (1992), Atreya et al. (1992) and Huet et al. (1994).

Suitable virus strains can be obtained from available sources, such as the American Type culture Collection (ATCC) or by isolating infected plants. Isolation of the virus from the tissues of the infected plant can be done by techniques well known as described, for example, by Foster and Tatlor, Eds. Plant Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), Vol 81), Humana Press, 1998. In short,

44/175 tissues from an infected plant believed to have a high concentration of a suitable virus, preferably young leaves and flower petals, are grounded in a buffer solution (eg, phosphate buffered solution) to generate sap infected virus that can be used in future inoculations. The construction of the plant RNA virus for the introduction and expression of exogenous non-viral sequences in plants is demonstrated by the references above, as well as' by Dawson, WO et al. , Virology (1989) 172: 285-292; Takamatsu et al. EMBO J. (1987) 6: 307-311; French et al. Science (1986) 231: 1294-1297; Takamatsu et al. FEBS Letters (1990) 269: 73-76; and Pat. Am. No. 5,316,931.

When the virus is a DNA virus, appropriate modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid to facilitate the construction of the desired viral vector with the foreign DNA. The virus can then be removed from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. The transcription and translation of this DNA will generate the coat protein that will encapsulate the viral DNA. If the virus is an RNA virus, the virus is usually cloned as cDNA and inserted into a plasmid. The plasmid is then used to form all of the constructs. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translating the viral genes to produce the coat protein (s) that encapsulate the viral RNA.

45/175

In one part, a plant viral polynucleotide is given in which the coding sequence for the native coating protein has been deleted from a viral polynucleotide, a coding sequence for the non-native plant viral coating protein and a non-native promoter, preferably the subgenomic promoter of the non-native coating protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral polynucleotide and guarantee of systemic infection of the host by the recombinant plant viral polynucleotide was inserted. Alternatively, the coat protein gene can be inactivated by inserting the non-native polynucleotide sequence into it, so that a protein is produced. The viral polynucleotides of the recombinant plant may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or polynucleotide sequences in the plant host and unable to recombine with each other and with native subgenomic promoters. Non-native (foreign) polynucleotide sequences can be inserted adjacent to the native plant viral subgenomic promoter or the non-native and native plant viral subgenomic promoters if more than one polynucleotide sequence is included. The sequences of non-native polynucleotides are transcribed or expressed in the host plant under the control of the subgenomic promoter to produce the desired products.

46/175

In a second part, a recombinant plant viral polynucleotide is given as in the first part, except that the coding sequence of the native coat protein is positioned adjacent to one of the subgenomic promoters of the non-native coat protein instead of a coding sequence of non-native coating protein.

In a third part, a recombinant plant viral polynucleotide is given in which the native coat protein gene is adjacent to its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral polynucleotide. The inserted non-native subgenomic promoters are able to transcribe or express adjacent genes in a plant host and are unable to recombine with each other and with native subgenomic promoters. Sequences of non-native polynucleotides can be inserted, adjacent to non-native subgenomic plant viral promoters, so that the sequences are transcribed or expressed in the host plant under the control of the subgenomic promoters to produce the desired product.

In a fourth part, a recombinant plant viral polynucleotide is given as in the third part, except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.

47/175

Viral vectors are encapsulated by the coat proteins encoded by the recombinant plant's viral polynucleotide to produce a recombinant plant virus. The recombinant plant viral polynucleotide or the recombinant plant virus is used to infect the appropriate host plants. The recombinant plant viral polynucleotides are capable of replication in the host, systemic dispersion in the host, and transcription or expression of foreign gene (s) (exogenous polynucleotide) in the host to generate the desired protein.

Techniques for inoculating viruses in plants can be found in Foster and Taylor, eds. Plant Virology Protocols:

From Virus Isolation to

Molecular Biology (Human

Pr), Vol 81), Humana Press, 1998;

Maramorosh and Koprowski, eds. Methods in Virology vols,

Academic Press, New York

1967-1984 ;

Hill, SA

Methods in Plant Virology,

Blackwell,

Oxford, 1984;

Walkey,

DGA Applied Plant

Virology,

Wiley, New York, 1985;

and Kado and Agrawa, eds.

Principies and Techniques in Plant

Virology, Van

NostrandReinhold, New York.

In addition to the above, the polynucleotide of the present invention can also be introduced into a chloroplast genome, thus allowing expression of chloroplast.

A technique for introducing exogenous polynucleotide sequences into the genome of

48/175 chloroplast is already known. This technique involves the following procedures. First, plant cells are chemically treated to reduce the number of chloroplasts per cell to one. Then, the exogenous polynucleotide is introduced by means of particle bombardment in the cells with the objective of introducing at least one exogenous polynucleotide molecule into the chloroplasts. The exogenous polynucleotides are selected so that they can be integrated into the chloroplast genome via homologous recombination, which is readily made by enzymes inherent to the chloroplast. For this purpose, the exogenous polynucleotide includes, in addition to a gene of interest, at least one extension of polynucleotide, which is derived from the chloroplast genome. In addition, the exogenous polynucleotide includes a selectable marker, which serves, through sequential selection procedures, to determine whether all or almost all copies of the chloroplast genomes after this selection will include the exogenous polynucleotide. More details related to this technique are found in Pat. American No. 4,945,050 and 5,693,507, which are hereby incorporated by reference. A polypeptide can thus be produced by the chloroplast protein expression system and become integrated into the chloroplast inner membrane.

Since tolerance to abiotic stress, water use efficiency, fertilizer use efficiency, growth, biomass, production and / or vigor in plants can involve multiple

49/175 genes acting additively or in synergy (see, for example, Quesda et al., Plant Physiol. 130: 951-063, 2002), the present invention also contemplates the expression of several exogenous polynucleotides in a single host plant in order to achieve a superior effect on the tolerance to abiotic stress, the efficiency of water use, the efficiency of fertilizer use, growth, biomass, production and / or vigor.

polynucleotides can be made from single polynucleotide constructs. The cell

The expression of exogens in a single plant by the concomitant introduction of nucleic acid, different exogenous, transformed can, multiple hosts each in one, then one including a plant cell be regenerated into a mature plant, using the methods described above. Alternatively, the expression of several exogenous polynucleotides in a single host plant can be done by concomitantly introducing, in a single plant cell, a single nucleic acid construct, including several different exogenous polynucleotides. Such a construct can be made with a single promoter sequence, which can transcribe a polycistronic messenger RNA, including all exogenous polynucleotide sequences. To allow the concomitant translation of the different polypeptides encoded by the polycistronic messenger RNA, the polynucleotide sequences can be interconnected via an internal ribosome entry site (IRES) sequence, which facilitates the

50/175 translation of polynucleotide sequences positioned below the IRES sequence. In that case, a polycistronic RNA molecule transcribed encoding the different polypeptides described above will be translated from the 5 'coated termination and the two internal IRES sequences of the polycistronic RNA molecule to thus produce all the different polypeptides in the cell. Alternatively, the construct can include different promoter sequences, each linked to a different exogenous polynucleotide sequence.

The plant cell transformed with the construct including several different exogenous polynucleotides can be regenerated in a mature plant, using the methods described above.

Alternatively, the expression of several exogenous polynucleotides in a single host plant can different nucleic acid constructs, including different exogenous polynucleotides, in several plants.

The regenerated transformed plants can then be crossed and result in the selected generation to show superior features of tolerance to abiotic stress, water use efficiency, fertilizer use efficiency, growth, biomass, production and / or vigor, using techniques conventional plant generation.

Thus, the invention encompasses plants expressing exogenously (as described above) the polynucleotide (s) and / or polypeptide (s) of the invention.

51/175

Once expressed in the plant cell or the entire plant, the level of polypeptide encoded by the exogenous polynucleotide can be determined by well-known methods such as, activity assays, Western blots using antibodies capable of specific polypeptide binding, enzyme-linked immunosorbent assay ( ELISA), Radioimmunoassays (RIA), immunohistochemistry, immunocytochemistry, immunofluorescence and the like.

Methods of plant level RNA transcribed from the exogenous polynucleotide are well known and include, for example, Northern blot analysis, polymerase chain reaction analysis via reverse transcription (RT-PCR) (including

Quantitative, semi-quantitative or real-time RT-PCR) in situ hybridization of RNA.

As mentioned, polypeptide, according to some, functions as a water channel. Thus, the invention, according to some parts, involves functional equivalents of the polypeptide (eg, polypeptides capable of the biological activity of a channel by functional assays (eg, being able to transport water in a plant), using , for example, a cell expansion test (Meng, QX

et al. 2008. Cell Physiol Biochem,.

pp. 123-128).

The polynucleotides and polypeptides described above can be used in a wide range of

52/175

The effect of the transgene (the exogenous polynucleotide encoding the polypeptide) on tolerance to abiotic stress, on the efficiency of water use, on the efficiency of fertilizer use, on growth, on biomass, on production and / or on vigor can be determined using methods known.

Tolerance to abiotic stress - Transformed (ie, expressing transgene) and untransformed (wild type) plants are exposed to an abiotic stress condition, such as lack of water, sub-ideal temperature (low and high temperature), deficiency of nutrient, excess nutrient, salt stress condition, osmotic stress, salinity metal toxicity

Test

Transgenic plants with very high concentrations of salt, germination, vigor or salinity growth. Stress to salt can with tolerance tolerance show seedlings with many ways being carried out at best, such as, for example, irrigating plants with a hyperosmotic solution, cultivating the plants hydroponically in a hyperosmotic culture solution (e.g. , Hoaglan's solution) or growing the plants in a hyperosmotic culture medium (eg, 50% Murashige-

<td>Skoog [medium</td><td>MS]). An</td><td>turn</td><td>what plants</td><td>different vary</td>

<td colspan="2">considerably in</td><td>your</td><td>tolerance</td><td>salinity, the</td>

<td>concentration</td><td>of salt in</td><td>Water</td><td>irrigation,</td><td>cultivation solution</td>

<td>or means of</td><td>cultivation</td><td>can</td><td colspan="2">be adjusted according to</td>

53/175 specific characteristics of the specific cultivar or variety of the plant, in order to have a mild or moderate effect on the physiology and / or morphology of the plants (for guidelines on appropriate concentration, see Bernstein and Kafkafi, Root Growth Under Salinity Stress In : Plant Roots, The Hidden Half 3rd ed. Waisel Y, Eshel A and Kafkafi U. (editors) Marcei Dekker Inc., New York, 2002, and their references).

For example, a salinity tolerance test can be done by irrigating plants in development stages with increasing concentrations of sodium chloride (eg 50 mM, 100 mM, 200 mM, 400 mM NaCl) applied from below and from above to ensure an even dispersion of the salt. After exposure to the stress condition, plants are often monitored until substantial physiological and / or morphological effects appear on wild type plants. Thus, the external phenotypic appearance, degree to which the plant withered and the general success in reaching maturity and result are compared between control and transgenic plants. The quantitative parameters of tolerance measured include, among others, the average wet and dry weight, the weight of the seeds generated, the average size of the seeds and the number of seeds produced by the plant. Transformed plants that do not exhibit substantial physiological and / or morphological effects, or exhibit greater biomass than that of wild type plants, are identified as plants tolerant to abiotic stress.

54/175

Osmotic tolerance test Osmotic stress tests (including sodium chloride and mannitol tests) are performed to determine whether an osmotic phenotype was specific to sodium chloride or whether it was a phenotype related to general osmotic stress. Plants that are tolerant to osmotic stress may be more tolerant of drought and / or frost. For germination experiments with saline and osmotic stress, the medium is provided, for example, with 50 mM, 100 mM, 200 mM NaCl or 100 mM, 200 mM NaCl, 400 mM mannitol. See also

Example 5 of the example section below.

Drought tolerance test / osmotic test - Drought tolerance is done to identify the genes generating better plant survival after acute water shortage. To analyze whether transgenic plants are more tolerant to drought, an osmotic stress generated by the non-ionic osmolyte sorbitol in the medium can be performed. Control and transgenic plants are germinated and grown on plant agar plates for 4 days, after which they are transferred to plates containing 500mM sorbitol. The treatment causes growth retardation, so the control and transgenic plants are compared, measuring the weight of the plant (wet and dry), the production and the growth rates measured at the time of flowering.

<td></td><td></td><td></td><td>To</td><td>contrary,</td><td>are</td><td>made</td>

<td>selections</td><td>gives</td><td>dry</td><td>based</td><td>on the ground</td><td>with</td><td>plants</td>

overexpressing the polynucleotides detailed above. At

55/175 seeds of the Arabidopsis control plants, or other transgenic plants overexpressing the polypeptide of the invention are germinated and transferred to pots. Drought stress is obtained after irrigation ceases, followed by placing the pots on absorbent paper to increase the rate of soil drying. Transgenic and control plants are compared to each other when most 'control plants develop severe wasting'. ' The plants are irrigated again after obtaining a significant fraction of the control plants showing severe withering. Plants are classified by comparing them to controls in each of the two criteria: tolerance to drought conditions and recovery (survival) after new irrigation.

Cold stress tolerance

- To analyze day stress) are transferred to weeks, with elementary light.

cold, mature plants (with 25 chambers of 4 ° C for 1 or 2 Later, the plants are transferred to the greenhouse. Two weeks later, the damage from the cold period, resulting in growth retardation and other phenotypes, are compared between control and transgenic plants, measuring the weight of the plant (wet and dry) and comparing the growth rates measured at the time of flowering, the size of the plant, the production, among others.

Tolerance to heat stress - Tolerance to heat stress is achieved by exposing plants to temperatures above 34 ° C for a period

56/175 determined. The tolerance of the plant is examined after transferring them again at 22 ° C for recovery and evaluation after 5 days in relation to internal controls (non-transgenic plants) or plants not exposed to cold or heat stress.

Germination tests - Germination tests 'compare the percentage of seeds of transgenic plants that can perform the process of' germination to the percentage of seeds of control plants that are treated in the same way. Normal conditions are considered, for example, incubations at 22 ° C during daily cycles of 22 hours of light and 2 hours without light. The evaluation of germination and seedling vigor is made between 4 and 14 days after planting. The baseline average is 50% of MS medium (Murashige and Skoog, 1962 Plant Physiology 15, 473-497).

Germination is also verified in unfavorable conditions, such as cold (incubating at temperatures below 10 ° C instead of 22 ° C) or using containing high concentrations of an osmolyte, such as sorbitol (in concentrations of 50 mM, 100 mM, 200 mM , 300 mM, 500 mM and up to 1000 mM) or mM,

100 mM,

200 mM, 300 mM, 500 mM NaCl)

Water use efficiency can be determined as the biomass generated by the transpiration unit. To analyze the WUE, the relative water content of the leaf can be measured in control and transgenic plants. The fresh weight (FW) is immediately recorded;

57/175 then, the leaves are soaked for 8 hours in distilled water at room temperature, in the dark, and the turgid weight (TW) is recorded. The total dry weight (DW) is recorded after drying the leaves at 60 ° C at constant weight. The relative water content (RWC) is calculated according to the following formula I: Formula I (FW - DW / TW - DW) x 100 ....... '' '

Efficiency of using fertilizer - To analyze whether transgenic plants are more responsive to fertilizers, plants are grown on agar plates or pots with a limited amount of fertilizer, as described, for example, in Example 6 below and in Yanagisawa et al (Proc Natl Acad Sei USA. 2004; 101: 7833-8). The plants are analyzed for their general size, flowering time, production, protein content of the branch and / or grain. The parameters verified are the general size of the mature plant, its wet and dry weight, the weight of the seeds generated, the average size of the seeds and the number of seeds produced per plant. Other parameters that can be tested are: the chlorophyll content of the leaves (since the nitrogen status and the degree of greenness of the leaf are correlated), amino acid content and total protein of the seeds or other parts of the plants, such as leaves or branches, oil content, etc. Similarly, instead of providing nitrogen in limited quantities, phosphate or potassium can be added in high concentrations. Again, the same

58/175 measured parameters are the same as listed above. Thus, the efficiency of the use of nitrogen (NUE), the efficiency of the use of phosphate (PUE) and the efficiency of the use of potassium (KUE) are evaluated, verifying the capacity of the plants

<td>transgenic</td><td>in</td><td>flourish under strict conditions</td><td>in</td>

<td>nutrients.</td><td></td><td></td><td></td>

<td></td><td></td><td>Determination of nitrogen -</td><td> 0</td>

<td>procedure</td><td>in</td><td>determination of the concentration of</td><td>N</td>

<td>(nitrogen)</td><td>in</td><td>structural parts of plants involves</td><td>The</td>

digestion method with potassium persulfate to convert organic N to NO₃ (Purcell and King 1996 Argon. J. 88: 111113, the modified Cd mediated reduction of NO₃ to NO₂(Vodovotz 1996 Biotechniques 20: 390-394) and the measurement of nitrite by the Griess test (Vodovotz 1996, supra). Absorbance values ​​are measured at 550nm compared to a standard NaN0 curve₂. The procedure is described in detail in Samonte et al. 2006 Agron. J. 98: 168-176.

Grain protein concentration - The protein content of the grain (g protein grain m ²) is estimated as the product of the mass of grain N (g grain N m '²) multiplied by the N-protein conversion ratio of k-5.13 (Mosse 1990, supra). The protein concentration of the grain is estimated as the ratio of the protein content of the grain per unit / mass of the grain (g grain protein kg¹ grain).

Oil content - The oil content of a plant can be determined by extracting oil from the seed or vegetative portion of the plant. In short, lipids (oil) can be removed from the plant (eg,

59/175 seed) by cutting the plant tissue in the presence of specific solvents (eg hexane or petroleum ether) and extracting the oil in a continuous extractor. Analysis of the indirect oil content can be done using several known methods, such as Nuclear Magnetic Resonance Spectroscopy (NMR), which measures the resonance energy absorbed by the hydrogen atoms in the liquid state of the sample [See, for example, 'Cõnwãy TF . and Earle FR. , 1963, Journal of the American Oil Chemists¹ Society; Springer Berlin / Heidelberg, ISSN: 0003-021X (Print) 1558-9331 (Online)]; . Near Infrared Spectroscopy (NIR), which uses the absorption of near infrared energy by the sample;

and a method described in

WO / 2001/023884, which is based on oil, solvent, evaporating the solvent in a gas stream that forms oil particles and directing a light to the gas stream and oil particles that form a detectable reflected light.

Plant vigor can be calculated by increasing growth parameters, such as leaf area, fiber length, rosette diameter, fresh weight of the plant and the like in the period.

to be

The index of measurement using digital growth analysis can of growing plants. For example, images of plants growing in greenhouses at the base of the land can be obtained every 3 days and the area of ​​the rosette can be calculated by digital analysis. The growth of the rosette area is calculated using

60/175 the difference in the rosette area between the sampling day divided by the difference in the days between the samples.

The measurement of seed production can be done by collecting the total seeds of 8-16 plants together, weighing them using an analytical balance and dividing the total weight by the number of plants. The number of seeds per growth area can be calculated in the same way, taking into account the growth area given to a single plant. The increase in seed production per growth area can be achieved by increasing seed production per plant and / or increasing the number of plants capable of growing in a given area.

The evaluation of seed production per plant can be done by measuring the quantity (weight or size) or quantity (that is, number) of dry seeds produced and harvested from 8-16 plants and divided by the number of plants.

The growth index assessment can be done by measuring the biomass of the plant produced, rosette area, leaf size or root length by time (can be measured in cm per day of the leaf area).

The length of the fiber can be measured using a fibrograph. The fibrograph system was used to compute the length in terms of average length of the upper half The average of the upper half (UHM) is the average length of the longest half of the fiber distribution. The fibrograph measures the length in lengths

61/175 dimensions at a certain percentage point (Hypertext Transfer Protocol: // World Wide Web (dot) cottoninc (dot) com / ClassificationofCotton /? Pg = 4 # Length).

Thus, this invention is of great value to agriculture as it promotes the production of commercially desired crops (eg, biomass of the vegetative organ such as poplar wood or reproductive organ, such as number of seeds or seed biomass).

As used herein, the term about refers to + 10%.

The terms involves, involves, includes, including, have and their conjugations mean including, but not limited to.

The term consisting of means including and limited to.

The term essentially consisting of means that the composition, method or structure may include additional ingredients, steps and / or parts, but only if the additional ingredients, steps and or part do not materially alter the basic and new characteristics of the composition, method or structure re claimed.

As used in the present, the singular form one and the include references in the plural unless the context clearly dictates otherwise. For example, the term a compound or at least one compound can include several compounds, including mixtures thereof.

62/175

During this application, several parts of this invention can be presented in a limited format. It should be understood that the description in limited format is merely for convenience and conciseness to be taken as an inflexible limitation of the scope and the description of a limit should be considered as having specifically revealed all possible 'sublimits', as well as, the numerical values within that limit. For example, the description of a limit of type 1 to 6 should be considered to have specifically revealed sublimits 1 to 3, 1 to 4, 1 to 5,

<td>from 2 to 4,</td><td>from 2 to 6,</td><td>from 3 to</td><td>6, etc.,</td><td>good</td><td>like numbers</td>

<td>individual</td><td>inside that</td><td>1 imitate,</td><td colspan="2">for example,</td><td> 1, 2, 3, 4, 5</td>

<td>and 6. This</td><td>applies</td><td colspan="2">independently</td><td>gives</td><td>variety of</td>

<td>1 limit.</td><td></td><td></td><td></td><td></td><td></td>

Whenever a numerical limit is indicated in the present, it is intended to include any number mentioned (fractional or whole) within the 'indicated limit. The phrases varying / varies between a first indicated number and a second indicated number varying / varies from a first indicated number up to a second indicated number are used here interchangeably and are intended to include the first and second indicated number and all whole fractional numbers between them.

As used herein, the term method refers to ways, techniques and procedures to perform a given task

63/175 including, among others, the forms, means, techniques and procedures known, or readily developed in ways, means, techniques and procedures known, by practitioners of chemistry, pharmacology, biology, biochemistry and medicine.

It is envisaged that some features of the invention, which are, for clarity, described in the context of separate parts, can also be provided in combination in a single part. In contrast, various features of the invention, which are, by reduction, described in the context of a single part, can be provided separately or in some suitable subcombination or as appropriate elsewhere described in the invention. Certain characteristics described in the context of several parts are not to be considered essential characteristics of those parts, unless the part is inoperative without these elements.

Various parts and aspects of the present invention, as outlined above and claimed in the claims section below, find experimental support in the following examples.

EXAMPLES Reference is made to the following examples, which, together with the above descriptions, illustrate some parts of the invention in a non-limiting way.

In general, the nomenclature used at present and the laboratory procedures used in the

64/175 the present invention includes recombinant DNA techniques; molecular, biochemical and microbiological. These techniques are widely explained in the literature. See, for example, Molecular Cloning: A laboratory Manual Sambrook et al. , (1989); Current Protocols in Molecular Biology Volumes IIII Ausubel, RM, ed. (1994); Ausubel et al. , Current

Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley &amp; Sons, New York (1988); Watson et al., Recombinant DNA, Scientific American Books,

New York; Birren et al. (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies determined in Pat. American No. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cell Biology: A Laboratory Handbook, Volumes IIII Cellis,

JE, ed. (1994); Current

Protocols

Immunology

Volumes I-III Coligan (1994); Stites

Appleton &amp;

, Basic and Clinicai

Immunology

Lange, Norwalk, CT (1994);

Mishell and Shiigi (eds), Selected Methods in Cellular

Immuno1ogy, W. H.

Freeman and Co., New York (19890);

the available immunoassays are extensively described in the scientific and patent literature.

see, for example, Pat. Am. No.

3,791,932;

3,867,517;

3,996,345;

3,839,153;

3,879,262;

4,034,074;

3,850,752;

3,901,654;

4,098,876;

3,850,578 ;

3,935,074 ;

4,879,219;

3,853,987;

3,984,533 ;

5,011,771 and

5,281,521; 01igonucleotide Synthesis ed.

(1984) ;

Nucleic Acid Hybridization Hames,

BD, and

65/175

Higgins SJ, eds. (1985); Transcription and Translation Hames, BD, and Higgins SJ, Eds. (1984); Animal Cell Culture Freshney, RI, ed. (1986); Immobilized Cells and Enzymes IRL Press, (1986); A Practical Guide to Molecular Cloning Perbal, B., (1984) and Methods in Enzymology Vol. 1-317, Academic Press; PCR Protocols: A Guide To Methods And Applications, Academic Press, San Diego, CA (1990);

Marshak et al. *, ¹¹ Strategies - * for Protein Purification. and Characterization - A Laboratory Course Manual CSHL Press (1996); all incorporated as .reference as if totally determined in the present. Other general references are provided throughout this document. Its procedures are believed to be well known and are provided for bed convenience. All information contained therein is incorporated herein by reference.

EXAMPLE 1

IDENTIFICATION OF AQP GENES USING COMPARATIVE DIGITAL AND GENOMIC EXPRESSION ANALYSIS BETWEEN SPECIES

The large number of AQPs in plants and the contradictory results obtained when AQPs were overexpressed in plants demonstrate the need to selectively identify AQP genes that can improve the efficiency of water use (WUE) in plants, leading to greater production and biomass under abiotic stress as well as under favorable conditions.

Under unfavorable stress conditions, some biological activities of plants are interrupted or reduced, while others are not active

66/175 previously, start. Still, some of the activities, which are vital for plant survival, are maintained. One hypothesis is that the main genes necessary for plants to maintain vital activities under unfavorable conditions would be active under a wide spectrum of biotic and abiotic stresses.

To test this hypothesis and identify the main AQP genes. with. . biotic and / or abiotic potential (eg, saline or drought stress), a combination of digital expression analysis (also known as electronic Northern blot) and comparative genomics between species was performed. The database used was available at

NCBI (Hypertext

Transfer

Protocol: // World Wide

Web (dot) ncbi (dot) nlm (dot) nih (dot) gov / dbEST /) and included

7.2 million express sequence tags (ESTs) from 1,195 relevant EST collections from 15 different species including monocot and dicot species, namely: Arabidopsis, barley, Brassica-rapa, cotton, grape, corn, medicago, poplar, potato , rice, sorghum, soy, sugar cane, tomatoes and wheat.

Tomato plants were selected as a model plant based on the high quality database of several tomato species, which can be used for data mining, and the experience of current inventors in using the tomato genome as a model plant . In addition, the high salt tolerance exhibited by several tomato species makes the genome of the

67/175 tomato an excellent candidate to identify new mechanisms of stress tolerance. Furthermore, the tomato is not only used as a model plant for genetic studies, it is also used as an important group with well-defined production parameters, which can be used to differentiate genes affecting stress tolerance

<td>abiotic</td><td>and the genes</td><td>avoiding loss under</td><td>conditions</td><td>in</td>

<td>stress</td><td>abiotic. -</td><td></td><td></td><td>ϊ</td>

<td></td><td></td><td>Gene analysis and</td><td>mining</td><td>in</td>

<td>Dice -</td><td colspan="2">For gene analysis and mining</td><td>of data,</td><td>The</td>

The bioinformatics filter approach used had three phases:

1. Grouping and organization: The EST and mRNA sequences for each of the 15 species were extracted from GenBanck versions 157, 160, 161, 162, 164, 165, 166 were grouped and organized using Compugen's LEADS grouping and organization platform (Compugen Ltd., Tel Aviv, Israel; Yelin et al. 2003, Nature Biotechnology 21, 379-85). The notes from the automatically extracted EST collections were manually evaluated and classified by anatomy, stage of development, treatment of abiotic / biotic stress and cultivars. The results were loaded into the Oracle database. The predicted proteins were then annotated using InterPro (2) (Hypertext Transfer Protocol: // World Wide Web (dot) ebi (dot) ac (dot) uk / interpro /).

2. Group selection [clusters] - All groups that contained the main intrinsic protein domain (IPR000425) were selected for further analysis (n = 1,114).

68/175. Obtaining the expression profile of the groups - Using the digital expression approach, the expression profile of all groups was obtained in terms of the anatomy of the plant (ie, in which tissues / organs the gene was expressed), stage of development (ie that is, the stages of development at which a gene was found) and treatment profile (provides the physiological conditions under which a gene is expressed, such as drought, cold, pathogen infection, etc.).

The computation of digital expression was calculated as follows: Overexpression was computed as m / (n * M / N), where N is the total number of ESTs of specific organisms; M is the number of ESTs in a given collection / fabric / category; n is the total number of ESTs in a given contig; m is the number of ESTs in the collection / fabric / category in the contig; the P value was computed using Fisher's Exact Test statistics. The combined P-value for overexpression under abiotic and root stress conditions was computed as 1 - (1-pl) x (1p2). 1,114 different AQP genes have been identified in the transcriptional databases between species. For the data mining process, the inventors used a combination of two approaches; selection of AQP groups showing significant overexpression (EST versus normal distribution is more than twice; statistical significance of overexpression - p value &lt;0.05) in the roots compared to branches or under various abiotic stresses (including drought, cold, salinity heat treatments

69/175 chemicals, etc.), compared to stress-free control. It was identified that the ESTs of about 9% of the AQP genes were significantly overrepresented in the roots and 3.5% of them were induced under different abiotic stresses. The AQP genes that are highly over-represented in the roots have been selected, since plants with an efficient root system are expected to capture more water from a soil that is drying out. Furthermore, AQP genes that are overrepresented in various abiotic stresses, such as nutrient deficiency, heat, salinity and heavy metal stresses and biotic stresses, such as application of inductors and pathogens, have been selected considering that they can provide high tolerance to a wide range stress spectrum.

The same group of 1,114 AQPs was classified according to the accepted groups known in the literature: first in the four main subgroups: PIPs, TIPs, NIPs and SIPs, and a second classification divided these four subgroups into eleven subgroups according to their sequence homology of amino acids. A Fisher's exact test was then used to identify subgroups with a significant over-representation of EST in the roots and under exposure to different abiotic stresses. As shown in Table 1 below, of the eleven subgroups, only the TIP2 subgroup showed a significant over-representation of EST, in the roots and under exposure to abiotic stresses (P value 1.7 X 10 ⁵ and 1.6 X 10 ³, respectively).

70/175

Table 1

AQP type distribution and overexpression in roots and abiotic stresses

<td></td><td></td><td colspan="4">Roots</td><td colspan="3">Exposure to abiotic stresses</td>

<td>Type AQP</td><td>Total number of genes in the database</td><td>No. of overexpressed genes</td><td colspan="2">% overexpressed / all</td><td>P-value</td><td>Number of overexpressed genes</td><td>% super expressed / all</td><td>P-value</td>

<td>PIP1</td><td> 243</td><td> 26</td><td> 10,7</td><td colspan="2"> 0,13</td><td> 10</td><td> 4,1</td><td> 0,34</td>

<td>PIP2</td><td> 336</td><td> 25</td><td> 7,4</td><td colspan="2"> 0,87</td><td> 12</td><td> 3,6</td><td> 0,53</td>

<td>PIP3</td><td> 11</td><td> 0</td><td> 0,0</td><td colspan="2"> 1</td><td> 0</td><td> 0</td><td> 1</td>

<td>SIP1</td><td> 39</td><td> 0</td><td> 0,0</td><td colspan="2"> 1</td><td> 0</td><td> 0</td><td> 1</td>

<td>SIP2. .</td><td> 16</td><td> 0</td><td> 0,0</td><td colspan="2"> 1</td><td> 0</td><td> 0</td><td> 1</td>

<td>TIP1</td><td> 152</td><td> 11</td><td> 7,2</td><td colspan="2"> 0,8</td><td> 3</td><td> 2 ’</td><td> 0,92 </td>

<td>TIP2</td><td> 101</td><td> 22</td><td> 21,8</td><td colspan="2">1.70E-05</td><td> 10</td><td> 9,9</td><td>1.6E-0.3</td>

<td>TIP3</td><td> 29</td><td> 0</td><td> 0,0</td><td colspan="2"> 1</td><td> 0</td><td> 0</td><td> 1</td>

<td>TIP4</td><td> 48</td><td> 5</td><td> 10,4</td><td colspan="2"> 0,41</td><td> 1</td><td> 2,1</td><td> 0,83</td>

<td>TIP5</td><td> 3</td><td> 0</td><td> 0,0</td><td colspan="2"> 1</td><td> 0</td><td> 0</td><td> 1</td>

<td>NIP</td><td> 136</td><td> 8</td><td> 5,9</td><td colspan="2"> 0,93</td><td> 3</td><td> 2,2</td><td> 0,88</td>

<td>TOTAL</td><td> 1114</td><td> 97</td><td></td><td colspan="2"></td><td> 39</td><td></td><td></td>

Table 1. '

These results suggest that overexpression and / or over-accumulation of protein in the Tip2 subgroup may improve the efficiency of plant water use, ABST and production.

Genes of the Tip2 subgroup are highly expressed in roots and in abiotic stresses As shown in Table 1 above, the TIP2 subgroup (or subfamily) is highly expressed in roots and in abiotic stresses. The subgroup TIP2 is found in 3 8 species of plants and other organisms (nucleic acid SEQ ID No.: 1,2, 19, 20-22; Table 2), available in public databases [Hypertext Transfer Protocol -. / / World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov / dbEST /]. In tomatoes, the TIP2 gene was highly expressed in roots (6 times, p &lt;1.01 E24) and in biotic stresses (2 times, p - 4.6 E-02) and abiotic (4.5 times, p E- 02) (data not shown).

71/175

Identification of a short consensus sequence of the Tip2 subfamily - When comparing the consensus amino acid sequences of Aquaporins, a short consensus sequence was identified, which is exclusive to proteins of the Tip2 subfamily. The inventors suggested that this theme has an important treatment of water use efficiency (WUE) and, when overexpressed in a plant, it can produce. The consensus sequence for conferring ABST and identified best amino acid is TLXFXFAGVGS (SEQ ID NO: 2826), where X corresponds to any amino acid.

In addition, other genes of the aquaporin gene family have been identified, by bioinfomatic tools, for improving ABST and production, based on the expression profile of the combined digital gene in the roots, tissues with low water levels (such as seed and pollen) and under abiotic stress conditions. This includes SEQ ID No. s: 3-18, 23-26 (Table 2).

Table 2

Aquaporin genes identified

<td>IDSEQ Ν ': (Polynucleotide)</td><td>Gene name</td><td>Group's name</td><td>Body</td><td>IDSEQN °: (Polypeptide)</td>

<td> 1</td><td>MAB54</td><td>tomato | gbl64 | BG125449</td><td>tomato</td><td> 27</td>

<td> 2</td><td>MAB55</td><td>tomato | gbl64 | BG134896</td><td>tomato</td><td> 28</td>

<td> 3</td><td>MAB56</td><td>tomato | gbl64 | AW218990</td><td>tomato</td><td> 29</td>

<td> 4</td><td>MAB57</td><td>tomato | gbl64 | AA824812</td><td>tomato</td><td> 30</td>

<td> 5</td><td>MAB58</td><td>tomato | gbl64 | BP881534</td><td>tomato</td><td> 31</td>

<td> 7</td><td>MAB69</td><td>tomato | gbl64 | AI637360</td><td>tomato</td><td> 33</td>

<td> 8</td><td>MAB70</td><td>tomato | gbl64 | BG133531</td><td>tomato</td><td> 34</td>

<td> 9</td><td>MAB71</td><td>tomato | gbl64 | BG629975</td><td>tomato</td><td> 35</td>

<td> 10</td><td>MAB72</td><td>tomato | gbl64 | BG136017</td><td>tomato</td><td> 36</td>

<td> 11</td><td>MAB73</td><td>tomato | gbl64 | BG131871</td><td>tomato</td><td> 37</td>

<td> 12</td><td>MAB74</td><td>tomato | gbl64 | AI775489</td><td>tomato</td><td> 38</td>

<td> 13</td><td>MAB75</td><td>tomato | gbl64 | BG136239</td><td>tomato</td><td> 39</td>

<td> 14</td><td>MAB76</td><td>tomato | gbl64 | BG134058</td><td>tomato</td><td> 40</td>

<td> 15</td><td>MAB77</td><td>tomato | gb! 64 | BG629900</td><td>tomato</td><td> 41</td>

72/175

<td colspan="5">Continuation of Table 2</td>

<td> 16</td><td>MAB78</td><td>tomato | gbl64 | BG130774</td><td>tomato</td><td> 42</td>

<td> 17</td><td>MAB79</td><td>tomato | g blS4 | BG124486</td><td>tomato</td><td> 43</td>

<td> 18</td><td>MAB80</td><td>tomato | gbl64 | AI483521</td><td>tomato</td><td> 44</td>

<td> 19</td><td>MAB81</td><td>tomato | gbl64 | C0751453</td><td>tomato</td><td> 45</td>

<td> 20</td><td>MAB115</td><td>barley | gbl57.2 | BF626376</td><td>barley</td><td> 46</td>

<td> 22</td><td>MAB117</td><td>barley | gbl57.2 | BE412516</td><td>barley</td><td> 48</td>

<td> 23</td><td>MAB119</td><td>tomato | gbl64 | BG134199</td><td>tomato '</td><td> 49</td>

<td> 24</td><td>MAB176</td><td>tomato | gbl64 | CO635830</td><td>tomato</td><td> 50</td>

<td> 25</td><td>MAB177</td><td>tomato | gbl64 | CO751496</td><td>tomato</td><td> 51</td>

<td> 26</td><td>MAB178</td><td>tomato | gbl64 | CO751374</td><td>tomato</td><td> 52</td>

Table 2.

Sequences that are homologous [showing at least 80% protein sequence identity in 80% of the global hit or query length, as calculated using the National Center of Biotechnology Information (NCBI) BlastP and tBlastN algorithms or orthologs of the genes of AQP described in Table 2 and expected to have the same function in ABST and improved production in plants, are revealed in Table 3 below 10 (SEQ ID No. 6, 215-1101 and 1138-1400; Table 3). In addition, Table 3 also includes counterparts and orthologs from the TQ2 subfamily of AQP (SEQ ID No. s: 21, 53-214, 1102-1137) and additional counterparts and orthologs (SEQ ID No. s: 2844-3051).

Table 3

Sequences of polynucleotides and polypeptides from omologists and orthologists from AQP

<td>Polinuc ID SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SEO.N-:</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 53</td><td>apple | gb157.3 | CN883304 T1</td><td>Apple</td><td> 1401</td><td> 27</td><td> 84</td><td> 92.3387097</td><td> 100</td><td>blastp</td>

<td> 54</td><td>app1e | gb157.3 | CN489003_T1</td><td>Apple</td><td> 1402</td><td> 27</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 55</td><td>apple | gb157.3 | DR915168 T1</td><td>columbine</td><td> 1403</td><td> 27</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 56</td><td>for bidops is | g b165 | AT3G16240 T1</td><td>arabidopsis</td><td> 1404</td><td> 27</td><td> 81</td><td> 99.1935484</td><td> 988</td><td>blastp</td>

<td> 57</td><td>artemisia | gb164 | EY035829 T1</td><td>artemisia</td><td> 1405</td><td> 27</td><td> 80</td><td> 98.7903226</td><td> 99.1902834</td><td>blastp</td>

<td> 58</td><td>riemisia | gb 1641E Y113320 T 1</td><td>artemisia</td><td> 1406</td><td> 27</td><td> 85</td><td> 62.9032258</td><td> 100</td><td>blastp</td>

<td> 59</td><td>artemisia | gb164 | EY070770 T1</td><td>artemisia</td><td> 1407</td><td> 27</td><td> 81</td><td> 98.7903226</td><td> 99.1902834</td><td>blastp</td>

73/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SEO.N ':</td><td>Hom. From ID</td><td>% Irient</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 60</td><td>avocado | gb164 | CV002132_T1</td><td>avocado</td><td> 1408</td><td> 27</td><td> 84</td><td> 50</td><td> 100</td><td>blastp</td>

<td> 61</td><td>bjuncea | gb164 | E VG N00333108491419_T1</td><td>bjuncea</td><td> 1409</td><td> 27</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 62</td><td>bjuncea | gb164 | EVGN00503709641655_T1</td><td>bjuncea</td><td> 1410</td><td> 27</td><td> 82</td><td> 53.6290323</td><td> 97.0588235</td><td>blastp</td>

<td> 63</td><td>bjuncea | gb164 | E.VGN01003711220.829JT1</td><td>bjuncea</td><td> 1411</td><td> 27</td><td> 84</td><td> 63.7096774</td><td> 100</td><td>blastp</td>

<td> 64</td><td>b_ oleracea | gb161 | AM059585_T1</td><td>b_oleracea</td><td> 1412</td><td> 27</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 65</td><td>b_oleracea | gb161 | AM385334_T1</td><td>b_oleracea</td><td> 1413</td><td> 27</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 66</td><td>b_oleracea | gb161 | AM385915_T 1</td><td>b_oleracea</td><td> 1414</td><td> 27</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 67</td><td>b_rapa | gb162 | BG543171_T1</td><td>b_rapa</td><td> 1415</td><td> 27</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 68</td><td>b_rapa | gb162 | BG543223_T1</td><td>b_rapa</td><td> 1416</td><td> 27</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 69’</td><td>b_rapa | gb162) L37478_T1 - - -</td><td>b_rapa</td><td> 1417 </td><td> 27</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 70</td><td>banana | gb160 | DN238689_T1</td><td>banana</td><td> 1418</td><td> 27</td><td> 83</td><td> 76.6129032</td><td> 100</td><td>blastp</td>

<td> 71</td><td>bean | gb164 | CB540614_T1</td><td>bean</td><td> 1419</td><td> 27</td><td> 83</td><td> 98.7903226</td><td> 98.7903226</td><td>blastp</td>

<td> 72</td><td>canola | gb161 | EV092237_T1</td><td>canola</td><td> 1420</td><td> 27</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 73</td><td>canola | gb161 | CN828178_T1</td><td>canola</td><td> 1421</td><td> 27</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 74</td><td>canola | gb161 | CX188169_T1</td><td>canola</td><td> 1422</td><td> 27</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 75</td><td>canola | gb161 | CD840590_T1</td><td>canola</td><td> 1423</td><td> 27</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 76</td><td>cassava | gb164 | CK650415_T1</td><td>manioc</td><td> 1424</td><td> 27</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 77</td><td>castorbean | gb160 | EE254645_T1</td><td>seed of mamnna</td><td> 1425</td><td> 27</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 78 .</td><td>centaurea | gbÍ61 | EH725826_T1</td><td>centaurea</td><td> 1426</td><td> 27</td><td> 84</td><td> 95.9677419</td><td> 84.3971631</td><td>blastp</td>

<td> 79</td><td>centaurea | gb161 | EL932474_T1</td><td>centaurea</td><td> 1427</td><td> 27</td><td> 88</td><td> 89.1129032</td><td> 97.7876106</td><td>blastp</td>

<td> 80</td><td>cherry | g b157.2 | EE488049_T 1</td><td>cherry</td><td> 1428</td><td> 27</td><td> 80</td><td> 69.3548387</td><td> 100</td><td>blastp</td>

<td> 81</td><td>cichorium] gb161 | DT211633_T1</td><td>cichorium</td><td> 1429</td><td> 27</td><td> 80</td><td> 100</td><td> 92,8571429</td><td>blastp</td>

<td> 82</td><td>cichorium | gb161 | EH672622_T1</td><td>cichorium</td><td> 1430</td><td> 27</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 83</td><td>citrus | gb157.2 | CX663669_T1</td><td>citrus</td><td> 1431</td><td> 27</td><td> 88</td><td> 98.7903226</td><td> 99.1902834</td><td>blastp</td>

<td> 84</td><td>citrus | gb157.2 | CF417983_T1</td><td>citrus</td><td> 1432</td><td> 27</td><td> 88</td><td> 98.7903226</td><td> 99.1902834</td><td>blastp</td>

<td> 85</td><td>citrus | gb157.2 | CK665344_T1</td><td>citrus</td><td> 1433</td><td> 27</td><td> 88</td><td> 98.7903226</td><td> 99.1902834</td><td>blastp</td>

<td> 86</td><td>citrus | gb157.2 | CK665344_T2</td><td>citrus</td><td> 1434</td><td> 27</td><td> 87</td><td> 82.2580645</td><td> 100</td><td>blastp</td>

<td> 87</td><td>clover | gb162 | BB908328 T1</td><td>clove of india</td><td> 1435</td><td> 27</td><td> 81</td><td> 69.7580645</td><td> 100</td><td>blastp</td>

<td> 88</td><td>cotton | gb164 | AF009567_T1</td><td>cotton</td><td> 1436</td><td> 27</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 89</td><td>cowpea | gb166 | FF397761_T1</td><td>black beans</td><td> 1437</td><td> 27</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 90</td><td>cowpea | gb166 | FC457059_T1</td><td>black beans</td><td> 1438</td><td> 27</td><td> 83</td><td> 98.7903226</td><td> 98.7903226</td><td>blastp</td>

<td> 91</td><td>dandelion | gb161 | DY818755_T1</td><td>dandelion</td><td> 1439</td><td> 27</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 92</td><td>ginger | gb164 | DY358186 T1</td><td>ginger</td><td> 1440</td><td> 27</td><td> 80</td><td> 98.3870968</td><td> 99.1836735</td><td>blastp</td>

<td> 93</td><td>ginger [gb164 | DY351866 T1</td><td>ginger</td><td> 1441</td><td> 27</td><td> 80</td><td> 98.3870968</td><td> 99.1836735</td><td>blastp</td>

<td> 94</td><td>iceplant | gb164 | AF133532 T1</td><td>crybaby beaches</td><td> 1442</td><td> 27</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 95</td><td>ipomoea | gb157.2 | BJ576630 T1</td><td>morning glory</td><td> 1443</td><td> 27</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 96</td><td>lettuce | gb157.2 | DWO74363 T1</td><td>lettuce</td><td> 1444</td><td> 27</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 97</td><td>lettuce [gb157.2 [DWO74363 T2</td><td>lettuce</td><td> 1445</td><td> 27</td><td> 85</td><td> 50.8064516</td><td> 90.647482</td><td>blastp</td>

74/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N “·</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 98</td><td>lettuce | gb157.2 | DW145132_T1</td><td>lettuce</td><td> 1446</td><td> 27</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 99</td><td>lettuce | gb157.2 | DW043760_T1</td><td>lettuce</td><td> 1447</td><td> 27</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 100</td><td>lettuce | gb157.2 | DW104999_T1</td><td>lettuce</td><td> 1448</td><td> 27</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 101</td><td>lotus | gb157.2 | BI420407_T1</td><td>lotus</td><td> 1449</td><td> 27</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 102</td><td>lotus | gb157.2 | BF177457_T1</td><td>lotus</td><td> 1450</td><td> 27</td><td> 86</td><td> 98.7903226</td><td> 98.7951807</td><td>blastp</td>

<td> 103</td><td>medicago | gb157.2 | A1974300_T 1</td><td>medicago</td><td> 1451</td><td> 27</td><td> 83</td><td> 89.1129032</td><td> 94.8497854</td><td>blastp</td>

<td> 104</td><td>medicago | gb157.2 | AA660400_T 1</td><td>medicago</td><td> 1452</td><td> 27</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 105</td><td>nicotiana_benthamiana | gb162 | CN741988_T1</td><td>benthamian nicotian</td><td> 1453</td><td> 27</td><td> 86</td><td> 98.7903226</td><td> 98.7903226</td><td>blastp</td>

<td> 106</td><td>nicotiana_benthamiana | gb162 | CN655366_T 1</td><td>Henthamian nicotian</td><td> 1454</td><td> 27</td><td> 92</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 107 -</td><td>nícotiana_benthamiana | gb162 | CN741998_T1</td><td>nicotiana hfinfhamiana</td><td> 1455</td><td> 27</td><td> 89....</td><td> 98.7903226</td><td> 98.7903226</td><td>blastp</td>

<td> 108</td><td>nicotiana_benthamiana | gb162 | CN742343_T1</td><td>benthamian nicotian</td><td> 1456</td><td> 27</td><td> 93</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 109</td><td>peach | gb157.2 | BU045214_T1</td><td>peach</td><td> 1457</td><td> 27</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 110</td><td>pepper | gb157.2CO776446_T1</td><td>chili</td><td> 1458</td><td> 27</td><td> 84</td><td> 61.6935484</td><td> 100</td><td>blastp '</td>

<td> 111</td><td>pepper | gb157.2 | CA518313_T1</td><td>chili</td><td> 1459</td><td> 27</td><td> 86</td><td> 63.3064516</td><td> 100</td><td>blastp</td>

<td> 112</td><td>periwinkle | gb164 | EG555051_T1</td><td>myrtle</td><td> 1460</td><td> 27</td><td> 88</td><td> 99.1935484</td><td> 99.1935484</td><td>blastp</td>

<td> 113</td><td>petunia | gb157.2 | CV296219_T1</td><td>petunia</td><td> 1461</td><td> 27</td><td> 84</td><td> 63.7096774</td><td> 85.2517986</td><td>tblastn</td>

<td> 114</td><td>poplar | gb157.2 | BI129443_T1</td><td>poplar</td><td> 1462</td><td> 27</td><td> 86</td><td> 100 .</td><td> 100</td><td>blastp</td>

<td> 115</td><td>poplar | gb157.2 | AI166943_T2</td><td>poplar</td><td> 1463</td><td> 27</td><td> 83</td><td> 61.6935484</td><td> 100</td><td>blastp</td>

<td> 116</td><td>poplar | gb157.2 | AI166943_T1</td><td>poplar</td><td> 1464</td><td> 27</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 117</td><td>poplar | gb157.2 | BI127662_T1</td><td>poplar</td><td> 1465</td><td> 27</td><td> 89</td><td> 79.0322581</td><td> 100</td><td>blastp</td>

<td> 118</td><td>potato | gb157.2 | BQ513382_T1</td><td>potato</td><td> 1466</td><td> 27</td><td> 97</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 119</td><td>potato | gb157.2 | BQ513382_T2</td><td>potato</td><td> 1467</td><td> 27</td><td> 97</td><td> 50.8064516</td><td> 96.1832061</td><td>blastp</td>

<td> 120</td><td>radish | gb164 | EV538411_T1</td><td>radish</td><td> 1468</td><td> 27</td><td> 82</td><td> 92.3387097</td><td> 100</td><td>blastp</td>

<td> 121</td><td>radish | gb164 | AB010416_T1</td><td>radish</td><td> 1469</td><td> 27</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 122</td><td>radish | gb164 | EW725945_T1</td><td>radish</td><td> 1470</td><td> 27</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 123</td><td>radish | gb164 | EV527946 T1</td><td>radish</td><td> 1471</td><td> 27</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 124</td><td>rose | gb157.2 | BQ104096 T1</td><td>rose</td><td> 1472</td><td> 27</td><td> 85</td><td> 85.0806452</td><td> 95.045045</td><td>blastp</td>

<td> 125</td><td>safflower | gb162 | EL374001 T1</td><td>safflower</td><td> 1473</td><td> 27</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 126</td><td>safflower | gb162 | E L406178_T 1</td><td>safflower</td><td> 1474</td><td> 27</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 127</td><td>sesame | gb157.2 | BU668161_T1</td><td>Sesame</td><td> 1475</td><td> 27</td><td> 81</td><td> 61.2903226</td><td> 86.3636364</td><td>tblastn</td>

<td> 128</td><td>soybean | gb166 | AW349399_T1</td><td>Soy</td><td> 1476</td><td> 27</td><td> 84</td><td> 98.7903226</td><td> 98.7903226</td><td>blastp</td>

<td> 129</td><td>soybean | gb166 | CD416937_T1</td><td>Soy</td><td> 1477</td><td> 27</td><td> 85</td><td> 75.4032258</td><td> 100</td><td>blastp</td>

<td> 130</td><td>soybean | gb166 | CA786095_T1</td><td>Soy</td><td> 1478</td><td> 27</td><td> 84</td><td> 98.7903226</td><td> 98.7903226</td><td>blastp</td>

<td> 131</td><td>soybean | gb166 | AW350817 T1</td><td>Soy</td><td> 1479</td><td> 27</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 132</td><td>spruce | gb162 | CO216479_T1</td><td>fir</td><td> 1480</td><td> 27</td><td> 80</td><td> 98.7903226</td><td> 98.4</td><td>blastp</td>

<td> 133</td><td>strawberry | gb164 | DV438565 T1</td><td>Strawberry</td><td> 1481</td><td> 27</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 134</td><td>sunflower | gb162 | X95952 T1</td><td>sunflower</td><td> 1482</td><td> 27</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 135</td><td>sunflower | gb162 | CD847513 T 1</td><td>sunflower</td><td> 1483</td><td> 27</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

75/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SEON⁰:</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 136</td><td>sunflower | gb162 | CD845750_T 1</td><td>sunflower</td><td> 1484</td><td> 27</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 137</td><td>sunflower | gb162CD848081_T 1</td><td>sunflower</td><td> 1485</td><td> 27</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 138</td><td>sunflower | gb162 | CD849577_T1</td><td>sunflower</td><td> 1486</td><td> 27</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 139</td><td>tobacco | gb1.62 | CV016921_T1</td><td>tobacco</td><td> 1487</td><td> 27</td><td> 88</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 140</td><td>tobacco | gb162 | CV018684_T1</td><td>tobacco</td><td> 1488</td><td> 27</td><td> 93</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 141</td><td>tobacco | gb162 | CV019641_T1</td><td>tobacco</td><td> 1489</td><td> 27</td><td> 91</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 142</td><td>tomato | gb164 | AW626247_T1</td><td>tomato</td><td>Nopredicte dnrotein</td><td> 27</td><td> 83</td><td> 50</td><td> 88.3610451</td><td>tblastn</td>

<td> 143</td><td>triphysaria [gb164 [EX999390_T1</td><td>triphysaria</td><td> 1490</td><td> 27</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 144</td><td>triphysaria | gb164 | BM356478_T1</td><td>triphysaria</td><td> 1491</td><td> 27</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 145</td><td>triphysaria | gb164 | BM356478_T2 </td><td>triphysaria</td><td> 1492</td><td> 27</td><td> 81</td><td> 81.0483871</td><td> 98.0487805</td><td>blastp</td>

<td> 146</td><td>aquilegia | gb157.3 | DR922172_T1</td><td>columbine</td><td> 1493</td><td> 28</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 147</td><td>arabidopsis | gb165 | AT5G47450_T1</td><td>arabidopsis</td><td> 1494</td><td> 28</td><td> 82</td><td> 98.8</td><td> 98.8</td><td>blastp</td>

<td> 148</td><td>Arabidopsis | gb165 | AT4G17340_T1</td><td>arabidopsis</td><td> 1495</td><td> 28</td><td> 85</td><td> 99.6</td><td> 99.6</td><td>blastp</td>

<td> 149</td><td>artemisia | gb164 | EY080612_T1</td><td>artemisia</td><td> 1496</td><td> 28</td><td> 83</td><td> 69.2</td><td> 100</td><td>blastp</td>

<td> 150</td><td>b_rapa | gb162 | EX104899_T1</td><td>b_rapa</td><td> 1497</td><td> 28</td><td> 84</td><td> 95.2</td><td> 99.1666667</td><td>blastp</td>

<td> 151</td><td>canola | gb161 | EE430505_T1</td><td>canola</td><td> 1498</td><td> 28</td><td> 85</td><td> 95.2</td><td> 94.8207171</td><td>blastp</td>

<td> 152</td><td>canolajgb 161 | DY017904_T1</td><td>canola</td><td> 1499</td><td> 28</td><td> 82</td><td> 98.8</td><td> 98.8.</td><td>blastp</td>

<td> 153</td><td>canola | gb161 | EL590702_T1</td><td>canola</td><td> 1500</td><td> 28</td><td> 84</td><td> 99.6</td><td> 99.6</td><td>blastp</td>

<td> 154</td><td>canola | gb161 | CD818320_T1</td><td>canola</td><td> 1501</td><td> 28</td><td> 85</td><td> 99.6</td><td> 99.6</td><td>blastp</td>

<td> 155</td><td>cassava | gb164 | DB923860_T 1</td><td>manioc</td><td> 1502</td><td> 28</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 156</td><td>centaurea | gb161] EL932179.T1</td><td>centaurea</td><td> 1503</td><td> 28</td><td> 84</td><td> 98.8</td><td> 99.1935484</td><td>blastp</td>

<td> 157</td><td>centaurea | gb161 | EH718862_T1</td><td>centaurea</td><td> 1504</td><td> 28</td><td> 82</td><td> 87.6</td><td> 88.9795918</td><td>blastp</td>

<td> 158</td><td>cichorium | gb161 | EH689841_T1</td><td>cichorium</td><td> 1505</td><td> 28</td><td> 86</td><td> 88.8</td><td> 64.7230321</td><td>tblastn</td>

<td> 159</td><td>citrus | gb157.2 | C0913277_T1</td><td>citrus</td><td> 1506</td><td> 28</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 160</td><td>citrus | gb157.2 | C0912449_T1</td><td>citrus</td><td> 1507</td><td> 28</td><td> 82</td><td> 95.6</td><td> 75.2360965</td><td>tblastn</td>

<td> 161</td><td>cotton | gb164 | DV437956_T1</td><td>cotton</td><td> 1508</td><td> 28</td><td> 88</td><td> 50.8</td><td> 100</td><td>blastp</td>

<td> 162</td><td>cotton [gb164 | CD486503_T1</td><td>cotton</td><td> 1509</td><td> 28</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 163</td><td>dandelion | gb161 | DY827614_T1</td><td>dandelion</td><td> 1510</td><td> 28</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 164</td><td>dandelion | gb161 | DY822865 T1</td><td>dandelion</td><td> 1511</td><td> 28</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 165</td><td>dandelion | gb161 | DY819O43_T1</td><td>dandelion</td><td> 1512</td><td> 28</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 166</td><td>iceplant | gb164 | AF133533_Tl</td><td>crybaby □ skates</td><td> 1513</td><td> 28</td><td> 82</td><td> 82</td><td> 99.5145631</td><td>blastp</td>

<td> 167</td><td>lettuce | gb157.2 | DW057721 T1</td><td>lettuce</td><td> 1514</td><td> 28</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 168</td><td>lettuce | gb157.2 | DW045203 T1</td><td>lettuce</td><td> 1515</td><td> 28</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 169</td><td>Iettuce | gb157.2 | DW046133.T 1</td><td>lettuce</td><td> 1516</td><td> 28</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 170</td><td>lettuce | gb157.2 | DW080742 T1</td><td>lettuce</td><td> 1517</td><td> 28</td><td> 85</td><td> 85.6</td><td> 100</td><td>blastp</td>

<td> 171</td><td>lettuce | gb157.2 | DW075611 T1</td><td>lettuce</td><td> 1518</td><td> 28</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 172</td><td>lettuce | gb157.2 | DW123899 T1</td><td>lettuce</td><td> 1519</td><td> 28</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 173</td><td>Iettuce | gb157.2 | DW103468 T1</td><td>lettuce</td><td> 1520</td><td> 28</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

76/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N⁰·</td><td>Hom. From ID</td><td>% Irlent</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 174</td><td>lettuce | gb157.2 [DW161237_T1</td><td>lettuce</td><td> 1521</td><td> 28</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 175</td><td>lettuce | gb 157.2 | DW079798_T 1</td><td>lettuce</td><td> 1522</td><td> 28</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 176</td><td>lettuce | gb157.2 | DW079554_T1</td><td>lettuce</td><td> 1523</td><td> 28</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 177</td><td>lettuce | gb157.2 | DW147378_T1</td><td>lettuce</td><td> 1524</td><td> 28</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 178</td><td>lettuce | gb157.2 | DW052373_T1</td><td>lettuce</td><td> 1525</td><td> 28</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 179</td><td>lettuce | gb157.2 | DW105592_T1</td><td>lettuce</td><td> 1526</td><td> 28</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 180</td><td>lettuce | gb157.2 [DW075384_T1</td><td>lettuce</td><td> 1527</td><td> 28</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 181</td><td>lettuce | gb157.2 | DW155153_T1</td><td>lettuce</td><td> 1528</td><td> 28</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 182</td><td>lettuce | gb157.2 | CV699993_T1</td><td>lettuce</td><td> 1529</td><td> 28</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> '183 </td><td>lettuce | gb157.2 | DW078166J1 -,. ...</td><td>lettuce</td><td> 1530</td><td> 28</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 184</td><td>lotus | gb157.2 | AV409092_T1</td><td>lotus</td><td> 1531</td><td> 28</td><td> 80</td><td> 53.2</td><td> 100</td><td>blastp</td>

<td> 185</td><td>medicago | gb157.2 | AI974377_T1</td><td>medicago</td><td> 1532</td><td> 28</td><td> 81</td><td> 98.8</td><td> 99.5951417</td><td>blastp</td>

<td> 186</td><td>melon | gb165 | AM725511_T1</td><td>melon</td><td> 1533</td><td> 28</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 187</td><td>nicotiana_benthamiana | gb162 | EH370474_T1</td><td>Henthamian nicotian</td><td> 1534</td><td> 28</td><td> 90</td><td> 70.4</td><td> 100</td><td>blastp</td>

<td> 188</td><td>onion | gb162 | BE205571_T1</td><td>onion</td><td> 1535</td><td> 28</td><td> 83</td><td> 99.6</td><td> 99.5967742</td><td>blastp</td>

<td> 189</td><td>onion | gb162AA601764_T1</td><td>onion</td><td> 1536</td><td> 28</td><td> 86</td><td> 95.2</td><td> 96.3414634</td><td>blastp</td>

<td> 190</td><td>papaya | gb165 [EX255759_T1</td><td>papaya '</td><td> 1537</td><td> 28</td><td> 82</td><td> 99.6</td><td> 99.5983936</td><td>blastp</td>

<td> 191</td><td>peanut | gb161 | EH043676_T1</td><td>peanut</td><td> 1538</td><td> 28</td><td> 82</td><td> 99.6</td><td> 99.5967742</td><td>blastp</td>

<td> 192</td><td>pepper | gb157.2 | CK901741_T1</td><td>chili</td><td> 1539</td><td> 28</td><td> 94</td><td> 86.4</td><td> 100</td><td>blastp</td>

<td> 193</td><td>periwin kle | gb1641FD423620_T 1</td><td>myrtle</td><td> 1540</td><td> 28</td><td> 86</td><td> 64.4</td><td> 96.4071856</td><td>blastp</td>

<td> 194</td><td>poplar | gb157.2 | BU886993_T1</td><td>poplar</td><td> 1541</td><td> 28</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 195</td><td>poplar | gb157.2 | CA826065_T1</td><td>poplar</td><td> 1542</td><td> 28</td><td> 85</td><td> 86.8</td><td> 100</td><td>blastp</td>

<td> 196 ·</td><td>potato | gb157.2 | BG591546_T2</td><td>potato</td><td> 1543</td><td> 28</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 197</td><td>radish | gb164 | EV531940_T1</td><td>radish</td><td> 1544</td><td> 28</td><td> 83</td><td> 94.8</td><td> 94.8</td><td>blastp</td>

<td> 198</td><td>radish | gb164 | EV527785_T1</td><td>radish</td><td> 1545</td><td> 28</td><td> 84</td><td> 92.8</td><td> 95.473251</td><td>blastp</td>

<td> 199</td><td>radish | gb164 | EV550763_T1</td><td>radish</td><td> 1546</td><td> 28</td><td> 84</td><td> 95.2</td><td> 94.8207171</td><td>blastp</td>

<td> 200</td><td>radish | gb164 | EX902593 T1</td><td>radish</td><td> 1547</td><td> 28</td><td> 85</td><td> 95.2</td><td> 99.58159</td><td>blastp</td>

<td> 201</td><td>radish | gb164 | EV535199 T1</td><td>radish</td><td> 1548</td><td> 28</td><td> 84</td><td> 95</td><td> 98.7654321</td><td>blastp</td>

<td> 202</td><td>radish | gb164 | EV525705 T1</td><td>radish</td><td> 1549</td><td> 28</td><td> 85</td><td> 96</td><td> 98.7654321</td><td>blastp</td>

<td> 203</td><td>safflower | gb162 | EL399548 T1</td><td>safflower</td><td> 1550</td><td> 28</td><td> 86</td><td> 86.8</td><td> 100</td><td>blastp</td>

<td> 204</td><td>safflower | gb162 | EL376421_T1</td><td>safflower</td><td> 1551</td><td> 28</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 205</td><td>spurge | gb161 | DV127241_T1</td><td>euphorbia</td><td> 1552</td><td> 28</td><td> 85</td><td> 88.4</td><td> 99.103139</td><td>blastp</td>

<td> 206</td><td>strawberry | gb164 | GFXDQ178022X1 T1</td><td>Strawberry</td><td> 1553</td><td> 28</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 207</td><td>sunflower | gb162 | X95953 T1</td><td>sunflower</td><td> 1554</td><td> 28</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 208</td><td>sunflower | gb162 | DY911049 T1</td><td>sunflower</td><td> 1555</td><td> 28</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 209</td><td>sunflower | gb162 | DY921796 T1</td><td>sunflower</td><td> 1556</td><td> 28</td><td> 81</td><td> 88.8</td><td> 98.2300885</td><td>blastp</td>

<td> 210</td><td>sunflower | gb162 | DY918762 T1</td><td>sunflower</td><td> 1557</td><td> 28</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 211</td><td>sunflower | gb162 | DY906198 T1</td><td>sunflower</td><td> 1558</td><td> 28</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

77/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N⁰·</td><td>Hom. From ID</td><td>% Irinnt</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 212</td><td>sunflower | gb162 | DY932268_T1</td><td>sunflower</td><td> 1559</td><td> 28</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 213</td><td>tobacco | gb162 | GFXS45406X1_T1</td><td>tobacco</td><td> 1560</td><td> 28</td><td> 93</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 214</td><td>tobacco | gb162EB445911_T1</td><td>tobacco</td><td> 1561</td><td> 28</td><td> 89</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 215</td><td>apricot | gb157.2 | CB818493_T1</td><td>Damascus</td><td> 1562</td><td> 29</td><td> 81</td><td> 54.5454545</td><td> 95.8333333</td><td>blastp</td>

<td> 216</td><td>arabidopsis | gb165 | AT4G01470_T1</td><td>arabidopsis</td><td> 1563</td><td> 29</td><td> 80</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 217</td><td>avocado | gb164 | CK760396_T 1</td><td>avocado</td><td> 1564</td><td> 29</td><td> 81</td><td> 54.5454545</td><td> 93.877551</td><td>blastp</td>

<td> 218</td><td>b_rapa | gb162 | EX017183_T1</td><td>b_rapa</td><td> 1565</td><td> 29</td><td> 83</td><td> 69.5652174</td><td> 94.1176471</td><td>blastp</td>

<td> 219</td><td>bariey | gb157.3 | BE413237_T1</td><td>barley</td><td> 1566</td><td> 29</td><td> 81</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 220</td><td>cassava | gb164 | CK644827_T1</td><td>manioc</td><td> 1567</td><td> 29</td><td> 90</td><td> 57.312253</td><td> 99.3150685</td><td>blastp</td>

<td> 221</td><td>cassava | gb164 | BM259770_Tl</td><td>manioc</td><td> 1568</td><td> 29</td><td> 82</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 222</td><td>cassava | gb164 | CK645124_T1</td><td>manioc</td><td> 1569</td><td> 29</td><td> 80</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 223</td><td>castorbean | gb160 | EG666198_T1</td><td>seed of castor</td><td> 1570</td><td> 29</td><td> 84</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 224</td><td>cas to rbea n | gb 1601A J 605571 _T 1</td><td>seed of castor</td><td> 1571</td><td> 29 -</td><td> 82</td><td> 99.2094862</td><td> 99.6015936</td><td>blastp</td>

<td> 225</td><td>castorbean | gb160 | AJ605570_T1</td><td>seed of mamnna. . .</td><td> 1572</td><td> 29</td><td> 83</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 226</td><td>centaurea | gb161JEL931525 _] _ T1</td><td>centaurea</td><td> 1573</td><td> 29</td><td> 88</td><td> 74.7035573</td><td> 97.9274611</td><td>blastp</td>

<td> 227</td><td>cichorium | gb 1611E H707617_T 1</td><td>cichorium</td><td> 1574</td><td> 29</td><td> 87</td><td> 65.6126482</td><td> 99.4011976</td><td>blastp</td>

<td> 228</td><td>citrus | gb157.2 | CF834233_T1</td><td>citrus</td><td> 1575</td><td> 29</td><td> 80</td><td> 94.4664032</td><td> 94.4444444</td><td>blastp</td>

<td> 229</td><td>citrus | gb157.2 | BQ624227_T1</td><td>citrus</td><td> 1576</td><td> 29</td><td> 87</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 230</td><td>citrus | gb157.2 | BQ623O56_T1</td><td>citrus</td><td> 1577</td><td> 29</td><td> 87</td><td> 97.2332016</td><td> 98.4</td><td>blastp</td>

<td> 231</td><td>citrus | gb157.2 | BQ624617_T1</td><td>citrus</td><td> 1578</td><td> 29</td><td> 87</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 232</td><td>cotton | gb164 | CD486523_T1</td><td>cotton</td><td> 1579</td><td> 29</td><td> 81</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 233</td><td>cotton | gb164 | AI729919_T1</td><td>cotton</td><td> 1580</td><td> 29</td><td> 82</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp '</td>

<td> 234</td><td>cotton | gb164 | BG442315_T1</td><td>cotton</td><td> 1581</td><td> 29</td><td> 86</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 235</td><td>cotton | gb164 | EX167179J</td><td>cotton</td><td> 1582</td><td> 29</td><td> 84</td><td> 56.916996</td><td> 100</td><td>blastp</td>

<td> 236</td><td>cotton | gb164 | AI726375_T1</td><td>cotton</td><td> 1583</td><td> 29</td><td> 82</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 237</td><td>cowpea | gb166 | FF384697_T1</td><td>black beans</td><td> 1584</td><td> 29</td><td> 84</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 238</td><td>dandelion | gb161 | DY825779_T1</td><td>dandelion</td><td> 1585</td><td> 29</td><td> 88</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 239</td><td>fescue | gb161 | CK802772_T1</td><td>fescue</td><td> 1586</td><td> 29</td><td> 80</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 240</td><td>grape | gb160 | BQ796B48_T1</td><td>grape</td><td> 1587</td><td> 29</td><td> 84</td><td> 99.2094862</td><td> 99.6015936</td><td>blastp</td>

<td> 241</td><td>grape [gb160 | CF605030_T1</td><td>grape</td><td> 1588</td><td> 29</td><td> 82</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 242</td><td>ipomoea | gb157.2 [EE883704_T1</td><td>morning glory</td><td> 1589</td><td> 29</td><td> 85</td><td> 53.7549407</td><td> 100</td><td>blastp</td>

<td> 243</td><td>ipomoea | gb157.2 | BJ554617_T1</td><td>morning glory</td><td> 1590</td><td> 29</td><td> 85</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 244</td><td>lettuce | gb157.2 | DW074608_T1</td><td>lettuce</td><td> 1591</td><td> 29</td><td> 87</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 245</td><td>fettuce | gb157.2 | DY977540_T1</td><td>lettuce</td><td> 1592</td><td> 29</td><td> 87</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 246</td><td>lotus | gb157.2 | BW615882_T1</td><td>lotus</td><td> 1593</td><td> 29</td><td> 80</td><td> 50.1976285</td><td> 100</td><td>blastp</td>

<td> 247</td><td>maize | gb164 | DQ245749_T1</td><td>corn</td><td> 1594</td><td> 29</td><td> 81</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 248</td><td>medication | gb157.2 | BI266516 T1</td><td>medicago</td><td> 1595</td><td> 29</td><td> 82</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 249</td><td>benthamian nicotian | gb162 | CN743053 T1</td><td>nicotiana hanthamiana</td><td> 1596</td><td> 29</td><td> 94</td><td> 83.0039526</td><td> 99.5260664</td><td>blastp</td>

78/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SEO.N:</td><td>Hom. From ID</td><td>% Idenf</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 250</td><td>papaya | gb165 | EX256526_T1</td><td>papaya</td><td> 1597</td><td> 29</td><td> 80</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 251</td><td>papaya | gb165 | EX255270_T1</td><td>papaya</td><td> 1598</td><td> 29</td><td> 86</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 252</td><td>peach | gb157.2 | AF367456_T1</td><td>peach</td><td> 1599</td><td> 29</td><td> 84</td><td> 53.7549407</td><td> 100</td><td>blastp</td>

<td> 253</td><td>pepper | gb157.2 | CK902019_T1</td><td>chili</td><td> 1600</td><td> 29</td><td> 81</td><td> 73.1225296</td><td> 98.9304813</td><td>blastp</td>

<td> 254</td><td>poplar | gb157.2 | AI163470_T1</td><td>poplar</td><td> 1601</td><td> 29</td><td> 81</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 255</td><td>poplar | gb157.2 | AI166549_T1</td><td>poplar</td><td> 1602</td><td> 29</td><td> 82</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 256</td><td>poplar | gb157.2 | BU887722_T1</td><td>poplar</td><td> 1603</td><td> 29</td><td> 81</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 257</td><td>poplar | gb157.2 | BU875073_T1</td><td>poplar</td><td> 1604</td><td> 29</td><td> 83</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 258</td><td>popla r | gb157.2 | CA823737_T 1</td><td>poplar</td><td> 1605</td><td> 29</td><td> 88</td><td> 53.3596838</td><td> 99.2647059</td><td>blastp</td>

<td> 259</td><td>poplar | gb157.2 | AI166136_T1</td><td>poplar</td><td> 1606</td><td> 29</td><td> 80</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp.</td>

<td> 260</td><td>radish | gb164 | EV544876 „T1</td><td>radish</td><td> 1607</td><td> 29</td><td> 80</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 261</td><td>rice | gb157.2 | AA752956_T1</td><td>rice</td><td> 1608</td><td> 29</td><td> 80</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 262</td><td>soybean | gb166 | CX703984_T 1</td><td>Soy</td><td> 1609</td><td> 29</td><td> 80</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 263</td><td>soybean | gb166 | SOYNODB_T1</td><td>Soy</td><td> 1610</td><td> 29</td><td> 86</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 264</td><td>spurge | gb161 | DVI46067_T1</td><td>euphorbia</td><td> 1611</td><td> 29</td><td> 84</td><td> 87.3517787</td><td> 100</td><td>blastp</td>

<td> 265</td><td>spurge | gb161 | AW990927_T1</td><td>euphorbia</td><td> 1612</td><td> 29</td><td> 80</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 266</td><td>sunflower | gb162 | DY919534_T1</td><td>sunflower</td><td> 1613</td><td> 29</td><td> 86</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 267</td><td>tobacco | gb162 | EB443312_T1</td><td>tobacco</td><td> 1614</td><td> 29</td><td> 92</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 268</td><td>tobacco | gb162 | CV019217_T1</td><td>tobacco</td><td> 1615</td><td> 29</td><td> 81</td><td> 98.0237154</td><td> 99.5967742</td><td>blastp</td>

<td> 269</td><td>lobacco | gb162 | EB443618_T1</td><td>tobacco</td><td> 1616</td><td> 29</td><td> 92</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 270</td><td>tobacco | gb162 | CV018899_T1</td><td>tobacco</td><td> 1617</td><td> 29</td><td> 81</td><td> 98.0237154</td><td> 99.5967742</td><td>blastp</td>

<td> 271</td><td>wheat | gb164 | BE418306_T1</td><td>wheat</td><td> 1618</td><td> 29</td><td> 80</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 272</td><td>wheat | gb164 | BE404792_T1</td><td>wheat</td><td> 1619</td><td> 29</td><td> 82</td><td> 52.9644269</td><td> 99.2592593</td><td>blastp</td>

<td> 273</td><td>wheat | gb164 | BE216922_T1</td><td>wheat</td><td> 1620</td><td> 29</td><td> 81</td><td> 99.2094862</td><td> 99.6031746</td><td>blastp</td>

<td> 274</td><td>artemisia | gb164 | EY083433_T1</td><td>artemisia</td><td> 1621</td><td> 30</td><td> 80</td><td> 79.6</td><td> 100</td><td>blastp</td>

<td> 275</td><td>banana | gb160 | ES432704 T1</td><td>banana</td><td> 1622</td><td> 30</td><td> 81</td><td> 88.8</td><td> 93.6708861</td><td>blastp</td>

<td> 276</td><td>banana | gb160 | DN238541_T1</td><td>banana</td><td> 1623</td><td> 30</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 277</td><td>barley | gb157.3 | BE412510 T1</td><td>barley</td><td> 1624</td><td> 30</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 278</td><td>cotton [gb164 | AI726168 T1</td><td>cotton</td><td> 1625</td><td> 30</td><td> 80</td><td> 98.8</td><td> 99.5983936</td><td>blastp</td>

<td> 279</td><td>cotton [gb164 | AI731742 T1</td><td>cotton</td><td> 1626</td><td> 30</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 280</td><td>cotton | gb164 | AI055329 T1</td><td>cotton</td><td> 1627</td><td> 30</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 281</td><td>grape | gb160 | BQ794219 T1</td><td>grape</td><td> 1628</td><td> 30</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 282</td><td>ipomoea | gb157.2 | BJ554855 T 1</td><td>morning glory</td><td> 1629</td><td> 30</td><td> 81</td><td> 98</td><td> 100</td><td>blastp</td>

<td> 283</td><td>ipomoea | gb157.2 | BM878761 T1</td><td>morning glory</td><td> 1630</td><td> 30</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 284</td><td>lettuce | gb157.2 | DW045084 T1</td><td>lettuce</td><td> 1631</td><td> 30</td><td> 80</td><td> 86.8</td><td> 98.1981982</td><td>blastp</td>

<td> 285</td><td>lettuce | gb157.2 | DW114621 T1</td><td>lettuce</td><td> 1632</td><td> 30·</td><td> 80</td><td> 88</td><td> 99.103139</td><td>blastp</td>

<td> 286</td><td>lettuce | gb157.2 | DW078778 T1</td><td>lettuce</td><td> 1633</td><td> 30</td><td> 81</td><td> 50.8</td><td> 100</td><td>blastp</td>

<td> 287</td><td>maize | gb164 | C0528320 T1</td><td>corn</td><td> 1634</td><td> 30</td><td> 82</td><td> 69.6</td><td> 100</td><td>blastp</td>

79/175

<td>Polinuc ID SEO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N^0,</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 288</td><td>maize | gb164 | AW257922_T1</td><td>corn</td><td> 1635</td><td> 30</td><td> 80</td><td> 52.4</td><td> 100</td><td>blastp</td>

<td> 289</td><td>maize | gb164 | BI675058_T1</td><td>corn</td><td> 1636</td><td> 30</td><td> 80</td><td> 54</td><td> 99.2592593</td><td>blastp</td>

<td> 290</td><td>maizè] gb164 | AW352518_T1</td><td>corn</td><td> 1637</td><td> 30</td><td> 80</td><td> 51.2</td><td> 100</td><td>blastp</td>

<td> 291</td><td>maize | gb164 | AF037061_T1</td><td>corn</td><td> 1638</td><td> 30</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 292</td><td>nicotrana_benthamiana | gb162 | CN655062_T1</td><td>Henthamian nicotian</td><td> 1639</td><td> 30</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 293</td><td>nicotiana_benthamiana | gb162 | CN741621_T1</td><td>Henthamian nicotian</td><td> 1640</td><td> 30</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 294</td><td>oil_palm | gb166 | CN599861_T1</td><td>oil palm</td><td> 1641</td><td> 30</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 295</td><td>papaya | gb165 | EX24615O_T1</td><td>papaya</td><td> 1642</td><td> 30</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 296</td><td>pepper | gb157.2 | BM060520_T1</td><td>chili</td><td> 1643</td><td> 30</td><td> 91</td><td> 99.2</td><td> 98.8</td><td>blastp</td>

<td> .297</td><td>Periwinkle | gb164 | EG554262 T1</td><td>mirta ~</td><td> 1644</td><td> 30 -</td><td> 82-</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 298</td><td>petunia | gb157.2 | AF452015_T1</td><td>petunia</td><td> 1645</td><td> 30</td><td> 89</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 299</td><td>potato | gb157.2 | CK853059_T1</td><td>potato</td><td> 1646</td><td> 30</td><td> 96</td><td> 92</td><td> 91.3043478</td><td>blastp</td>

<td> 300</td><td>potato | gb157.2 | CK852742_T1</td><td>potato</td><td> 1647</td><td> 30</td><td> 82</td><td> 60.4</td><td> 100</td><td>blastp</td>

<td> 301</td><td>potato | gb157.2 | BM407759_T1</td><td>potato</td><td> 1648</td><td> 30</td><td> 99</td><td> 81.2</td><td> 97.5961538</td><td>blastp</td>

<td> 302</td><td>potato | gb157.2 | CK718033_T1</td><td>potato</td><td> 1649</td><td> 30</td><td> 98</td><td> 65.2</td><td> 92.0903955</td><td>blastp</td>

<td> 303</td><td>potato | gb157 2 | CK717899_T1</td><td>potato</td><td> 1650</td><td> 30</td><td> 100</td><td> 62</td><td> 95.0920245</td><td>blastp</td>

<td> 304</td><td>potato | gb157.2 | CV472240_T1</td><td>potato</td><td> 1651</td><td> 30</td><td> 97</td><td> 79.6</td><td> 95.215311</td><td>blastp</td>

<td> 305</td><td>potato | gb157.2 | BG098199_T1</td><td>potato</td><td> 1652</td><td> 30</td><td> 95</td><td> 93.2</td><td> 99.5726496</td><td>blastp</td>

<td> 306</td><td>rice | gb157.2 | U37925_T1</td><td>rice</td><td> 1653</td><td> 30</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 307</td><td>rye | gb164 | BE494266_T1</td><td>rye</td><td> 1654</td><td> 30</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 308</td><td>sorghum | gb161, xeno | AF037061__T1</td><td>sorghum</td><td> 1655</td><td> 30</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 309</td><td>sugarcane | gb157.2 | BQ535365_T 1</td><td>sugar cane</td><td> 1656</td><td> 30</td><td> 80</td><td> 80.4</td><td> 100</td><td>blastp</td>

<td> 310</td><td>switchgrass | gb165 | DN 141449_T 1</td><td>switchgrass</td><td> 1657</td><td> 30</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 311</td><td>switchgrass | gb165 | DN142089_T1</td><td>switchgrass</td><td> 1658</td><td> 30</td><td> 81</td><td> 100 '</td><td> 100</td><td>blastp</td>

<td> 312</td><td>tobacco | gb162 | CN824S66 T1</td><td>tobacco</td><td> 1659</td><td> 30</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 313</td><td>tobacco | gb162 | CV017118 T1</td><td>tobacco</td><td> 1660</td><td> 30</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 314</td><td>wheat | gb164 | TAU86762_T1</td><td>wheat</td><td> 1661</td><td> 30</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 315</td><td>wheat | gb164 | BE499589 T1</td><td>frigo</td><td> 1662</td><td> 30</td><td> 80</td><td> 72</td><td> 100</td><td>blastp</td>

<td> 316</td><td>lettuce | gb157.2 | DW087170 T1</td><td>lettuce</td><td> 1663</td><td> 31</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 317</td><td>tobacco | gb162 | EH616288 T1</td><td>tobacco</td><td> 1664</td><td> 32</td><td> 87</td><td> 50.7692308</td><td> 85.1612903</td><td>blastp</td>

<td> 318</td><td>apple | gb157.3 | CO068608 T1</td><td>Apple</td><td> 1665</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 319</td><td>apple | gb157.3 | AB100869 T1</td><td>Apple</td><td> 1666</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 320</td><td>apple | gb157.3 | AB100870 T1</td><td>Apple</td><td> 1667</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 321</td><td>apple | gb157.3 | CN860225 T1</td><td>Apple</td><td> 1668</td><td> 33</td><td> 86</td><td> 54.8611111</td><td> 90.2857143</td><td>blastp</td>

<td> 322</td><td>apple | gb157.3 | CK900645 T1</td><td>Apple</td><td> 1669</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 323</td><td>apricot | gb157.2 | CB822297 T1</td><td>Damascus</td><td> 1670</td><td> 33</td><td> 89</td><td> 51.0416667</td><td> 98.6577181</td><td>blastp</td>

<td> 324</td><td>apricot | gb157.2 | CB819647 T1</td><td>Damascus</td><td> 1671</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9655172</td><td>blastp</td>

<td> 325</td><td>aquileg ia | gb157.3 | DR917005 T 1</td><td>columbine</td><td> 1672</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

80/175

<td>Polinuc ID SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SEO N ° -</td><td>Hom. From ID</td><td>% Idpnt</td><td>Cob. Query</td><td>% ind. Cob.</td><td>Algorithm</td>

<td> 326</td><td>arabidopsis | gb165 | AT4G00430_T2</td><td>arabidopsis</td><td> 1673</td><td> 33</td><td> 84</td><td> 73.6111111</td><td> 97.260274</td><td>blastp</td>

<td> 327</td><td>arabidopsis | gb165 | AT2G45960_T3</td><td>arabidopsis</td><td> 1674</td><td> 33</td><td> 86</td><td> 88.1944444</td><td> 84.3853821</td><td>blastp</td>

<td> 328</td><td>arabidopsis | gb165 | AT4G23400_T1</td><td>arabidopsis</td><td> 1675</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 329</td><td>arabidopsis | gb165 | AT2G45960_T1</td><td>arabidopsis</td><td> 1676</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 330</td><td>arabidopsis | gb165 | AT4G00430_T 1</td><td>arabidopsis</td><td> 1677</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 331</td><td>arabidopsis | gb165 | A_T1G01620_T1</td><td>arabidopsis</td><td> 1678</td><td> 33</td><td> 88</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 332</td><td>arabidopsis] gb165) AT3G61430_T1</td><td>arabidopsis</td><td> 1679</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 333</td><td>arabidopsis | gb165 | AT2G45960_T4</td><td>arabidopsis</td><td> 1680</td><td> 33</td><td> 86</td><td> 88.1944444</td><td> 92.7007299</td><td>blastp</td>

<td> 334</td><td>artemisia | gb164 | EY046087_T1</td><td>mugwort</td><td> 1681</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 335</td><td>arternisia | gb164 | EY046310_T1 ..</td><td>artemisia</td><td> .1682 .</td><td> 33'</td><td> 87.</td><td> 73.61.11111</td><td> 99.0697674</td><td>blastp_____</td>

<td> 336</td><td>artemisia | gb164 | EY032836_T1</td><td>mugwort</td><td> 1683</td><td> 33</td><td> 84</td><td> 97.5694444</td><td> 98.2758621</td><td>blastp</td>

<td> 337</td><td>artemisia | gb164 | EY031810_T1</td><td>artemisia</td><td> 1684</td><td> 33</td><td> 84</td><td> 89.2361111</td><td> 99.2307692</td><td>blastp</td>

<td> 338</td><td>avocado | gb164 | CK751385_T 1</td><td>avocado</td><td> 1685</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 339</td><td>avocado | gb164 | CK745633_T 1</td><td>avocado</td><td> 1686</td><td> 33</td><td> 91</td><td> 73.6111111</td><td> 99.0654206</td><td>blastp</td>

<td> 340</td><td>bJuncea | gb164 | EVGN00081008450640_T1</td><td>b_juncea</td><td> 1687</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 341</td><td>b_juncea | gb164 | EVGN00515811862066_T1</td><td>bjuncea</td><td> 1688</td><td> 33</td><td> 90</td><td> 60.4166667</td><td> 96.1325967</td><td>blastp</td>

<td> 342</td><td>bjuncea | gb164EVGN00230716760965_T1</td><td>bjuncea</td><td> 1689</td><td> 33</td><td> 89 </td><td> 73.6111111</td><td> 99.0654206</td><td>blastp</td>

<td> 343</td><td>bjuncea | gb164 | EVGNO1776308261252_T 1</td><td>bjuncea</td><td> 1690</td><td> 33</td><td> 84</td><td> 66.3194444</td><td> 96.4646465</td><td>blastp</td>

<td> 344</td><td>bJuncea | gb164 | EVGN00910030360678_T1</td><td>bjuncea</td><td> 1691</td><td> 33</td><td> 91</td><td> 65.2777778</td><td> 98.9473684</td><td>blastp</td>

<td> 345</td><td>b_juncea | gb 164 | EVGN03812526911787_T1</td><td>bjuncea</td><td> 1692</td><td> 33</td><td> 88</td><td> 51.0416667</td><td> 98.6577181</td><td>blastp</td>

<td> 346</td><td>b_juncea | gb164 | EVGN00227203510305_T1</td><td>bjuncea</td><td> 1693</td><td> 33</td><td> 91</td><td> 65.2777778</td><td> 98.9473684</td><td>blastp</td>

<td> 347</td><td>bJuncea | gb164 | EVGN00452518410866_T1</td><td>bjuncea</td><td> 1694</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 348</td><td>bJunceA | gb164 | EVGN00248411120906_T1</td><td>bjuncea</td><td> 1695</td><td> 33</td><td> 89</td><td> 73.2638889</td><td> 99.0610329</td><td>blastp</td>

<td> 349</td><td>bJuncea | gb164 (EF471211_T1</td><td>bjuncea</td><td> 1696</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.2638889</td><td>blastp</td>

<td> 350</td><td>b_juncea | gb164 | EVGN00440012650683_T1</td><td>bjuncea</td><td> 1697</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 351</td><td>bJuncea | gb164 | EVGN00452211183349 T1</td><td>bjuncea</td><td> 1698</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 352</td><td>bJuncea | gb164EVGN03595331210044 T1</td><td>bjuncea</td><td> 1699</td><td> 33</td><td> 89</td><td> 57.6388889</td><td> 93258427</td><td>blastp</td>

<td> 353</td><td>bjuncea | gb164 | EVGN00088009631302 T1</td><td>bjuncea</td><td> 1700</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 354</td><td>bjuncea | gb164 | EVGN00512912541009JT1</td><td>bjuncea</td><td> 1701</td><td> 33</td><td> 85</td><td> 51.7361111</td><td> 93.907563</td><td>tblastn</td>

<td> 355</td><td>bJuncea | gb164 | EVGN00756014550623 T1</td><td>bjuncea</td><td> 1702</td><td> 33</td><td> 84</td><td> 69.0972222</td><td> 90.3177005</td><td>tblastn</td>

<td> 356</td><td>b oleracea] gb161 | AF299051 T1</td><td>b_oleracea</td><td> 1703</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 357</td><td>b oleracea | gb161 | AM391520 T1</td><td>b_oleracea</td><td> 1704</td><td> 33</td><td> 87</td><td> 75.3472222</td><td> 99.5412844</td><td>blastp</td>

<td> 358</td><td>b_oleracea | gb161 | AM058918_T1</td><td>b_oleracea</td><td> 1705</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 359</td><td>b oleracea | gb161 | AF299050 T1</td><td>b_oleracea</td><td> 1706</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 360</td><td>b oleracea | gb161 | DY029936 T 1</td><td>b.oleracea</td><td> 1707</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 361</td><td>b oleracea | gb161 | EH422530 T 1</td><td>b_oleracea</td><td> 1708</td><td> 33</td><td> 87</td><td> 78.4722222</td><td> 100</td><td>blastp</td>

<td> 362</td><td>b rapa | gb162 | CV546930 T1</td><td>b boy</td><td> 1709</td><td> 33</td><td> 84</td><td> 71.5277778</td><td> 99.5169082</td><td>blastp</td>

<td> 363</td><td>b rapa | gb162 | BG544387 T 1</td><td>b boy</td><td> 1710</td><td> 33</td><td> 86</td><td> 95.4861111</td><td> 99.2779783</td><td>blastp</td>

81/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO.N⁰:</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 364</td><td>b_rapa | gb162 | CA992432_T1</td><td>b boy</td><td> 1711</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 365</td><td>b_rapa | gb162 | CV546129_T2</td><td>b_rapa</td><td> 1712</td><td> 33</td><td> 83</td><td> 54.8611111</td><td> 99.3710692</td><td>blastp</td>

<td> 366</td><td>b.rapa | gb162 | EE526280_T1</td><td>b_rapa</td><td> 1713</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 367</td><td>b_rapa | gb162 | L33552_T1</td><td>b_rapa</td><td> 1714</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 368</td><td>b_rapa | gb162 | BG543719_T1</td><td>b_rapa</td><td> 1715</td><td> 33</td><td> 84</td><td> 77.0833333</td><td> 99.5515695</td><td>blastp</td>

<td> 369</td><td>b_rapa] gb162] AF004293_T1</td><td>b_rapa</td><td> 1716</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 370</td><td>b_rapa | gb162 | BG544086_T1</td><td>b_rapa</td><td> 1717</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 371</td><td>b_rapa | gb162 [CX267412_T1</td><td>b_rapa</td><td> 1718</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 99 2982456</td><td>blastp</td>

<td> 372</td><td>b_rapa | gb162 | CV546129_T1</td><td>b_rapa</td><td> 1719</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.2638889</td><td>blastp</td>

<td> 373</td><td>b.rapa | gb162 | CV545634_T1</td><td>b_rapa</td><td> .1720</td><td> 33 .</td><td> 83</td><td> 56.5972222</td><td> 90.5555556.</td><td>blastp</td>

<td> 374</td><td>banana | gb160 | DN238827_T1</td><td>banana</td><td> 1721</td><td> 33</td><td> 84</td><td> 60.7638889</td><td> 99.4285714</td><td>blastp</td>

<td> 375</td><td>banana | gb160 | ES431094_T1</td><td>banana</td><td> 1722</td><td> 33</td><td> 89</td><td> 63.8888889</td><td> 98.9247312</td><td>blastp</td>

<td> 376</td><td>barley | gb157.3 | BE412959_T2</td><td>barley</td><td> 1723</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 377</td><td>bariey | gb157.3 | AL507831_T1</td><td>barley</td><td> 1724</td><td> 33</td><td> 85</td><td> 99.3055556</td><td> 99.6551724</td><td>blastp</td>

<td> 378</td><td>barley | gb157.3 | BE412959_T1</td><td>barley</td><td> 1725</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 379</td><td>barley | gb157.3 | BE412959_T5</td><td>barley</td><td> 1726</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 98.9830508</td><td>blastp</td>

<td> 380</td><td>barley | gb157.3 | BE412959_T4</td><td>barley</td><td> 1727</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 98.9830508</td><td>blastp</td>

<td> 381</td><td>barley | gb157.3 | AL502020_T1</td><td>barley</td><td> 1726</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 382</td><td>barley | gb157.3 | BE412972_T1</td><td>barley</td><td> 1729</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 383</td><td>basilicum | gb157.3 | DY340092 T1</td><td>basilicum</td><td> 1730</td><td> 33</td><td> 88</td><td> 61.8055556</td><td> 99.4413408</td><td>blastp</td>

<td> 384</td><td>basilicum | gb157.3 | DY332264_T1</td><td>basilicum</td><td> 1731</td><td> 33</td><td> 87</td><td> 73.9583333</td><td> 99.5327103</td><td>blastp</td>

<td> 385</td><td>bean | gb164 | CB543592_T1</td><td>bean</td><td> 1732</td><td> 33</td><td> 88</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 386</td><td>bean | gb164 [PVU97023_T1</td><td>bean</td><td> 1733</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 387</td><td>bean [gb164 [CB542193_Γ1</td><td>bean</td><td> 1734</td><td> 33</td><td> 84</td><td> 98.6111111</td><td> 99.6539792</td><td>blastp</td>

<td> 388</td><td>beet | gb162 | BVU60149 T1</td><td>beet</td><td> 1735</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 389</td><td>brachypodium | gb161 xeno | BE443278 T 1</td><td>brachypodium</td><td> 1736</td><td> 33</td><td> 83</td><td> 82.9861111</td><td> 95.6521739</td><td>blastp</td>

<td> 390</td><td>brachypodium | gb161.xeno | BE216990 T1</td><td>brachypodium</td><td> 1737</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 391</td><td>brachypodium | gb161.xeno | BE403307 T1</td><td>brachypodium</td><td> 1738</td><td> 33</td><td> 82</td><td> 86.8055556</td><td> 72.7011494</td><td>blastp</td>

<td> 392</td><td>canola | gb161 | CN731957 T1</td><td>canola</td><td> 1739</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 393</td><td>canola | gb161 | CX194503 T1</td><td>canola</td><td> 1740</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 394</td><td>ca no Ia (gb 161 | CD814405 T 1</td><td>canola</td><td> 1741</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 395</td><td>canola | gb161 | EG020906 T1</td><td>canola</td><td> 1742</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 396</td><td>canola | gb161 | H74720_T1</td><td>canola</td><td> 1743</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 397</td><td>canola | gb161 | CN831315_T1</td><td>canola</td><td> 1744</td><td> 33</td><td> 86</td><td> 84.0277778</td><td> 93.4362934</td><td>blastp</td>

<td> 398</td><td>canola | gb161 | CD817408 T1</td><td>canola</td><td> 1745</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 399</td><td>canola | gb161 | EE502121 T1</td><td>canola</td><td> 1746</td><td> 33</td><td> 89</td><td> 52.7777778</td><td> 98.7096774</td><td>blastp</td>

<td> 400</td><td>canola | gb161 | CX187544 T1</td><td>canola</td><td> 1747</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 401</td><td>canola | gb161 | CD822064 T1</td><td>canola</td><td> 1748</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

82/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N °:</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 402</td><td>canola | gb161 | CD824965_T1</td><td>canola</td><td> 1749</td><td> 33</td><td> 81</td><td> 92.0138889</td><td> 93.0313589</td><td>blastp</td>

<td> 403</td><td>carrola | gb161 | EE485551_T1</td><td>canola</td><td> 1750</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 404</td><td>canola | gb161 | CB686274_T1</td><td>canola</td><td> 1751</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 405</td><td>canola | gb161 | CD814573_T1</td><td>canola</td><td> 1752</td><td> 33</td><td> 83</td><td> 76.3888889</td><td> 94.0425532</td><td>blastp</td>

<td> 406</td><td>canola | gb161 | CX193398_T1</td><td>canola</td><td> 1753</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.2638889</td><td>blastp</td>

<td> 407</td><td>canola | gb161 | CD818853_T1</td><td>canola</td><td> 1754</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 408</td><td>canola | gb161 | DY005979_T1</td><td>canola</td><td> 1755</td><td> 33</td><td> 85</td><td> 78.4722222</td><td> 99.5594714</td><td>blastp</td>

<td> 409</td><td>canola | gb161 [EE464964_T1</td><td>canola</td><td> 1756</td><td> 33</td><td> 85</td><td> 81.5972222</td><td> 99.5762712</td><td>blastp</td>

<td> 410</td><td>cassava | gb164 | BM260264_T1</td><td>manioc</td><td> 1757</td><td> 33</td><td> 85</td><td> 97.9166667</td><td> 99.3031359</td><td>blastp</td>

<td> 411</td><td>cassava | gb164 | CK9O1165_T1</td><td>manioc</td><td> 1758</td><td> 33 .</td><td> 87 .</td><td> 73.6111.111</td><td> .99.0697674</td><td>blastp</td>

<td> 412</td><td>cassava | gb164 | CK642415_T 1</td><td>manioc</td><td> 1759</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 413</td><td>cassava | gb164 | DV455398_T 1</td><td>manioc</td><td> 1760</td><td> 33</td><td> 85</td><td> 97.9166667</td><td> 99.3031359</td><td>blastp</td>

<td> 414</td><td>castorbean | gb160 | T14819_T1</td><td>seed of mamnna</td><td> 1761</td><td> 33</td><td> 89</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 415</td><td>castorbean | gb160 | EG691229_T1</td><td>seed of mamnna</td><td> 1762</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 416</td><td>castorbean | gb160 | AJ605566_T 1</td><td>seed of mamnna</td><td> 1763</td><td> 33</td><td> 87</td><td> 97.9166667</td><td> 99.3031359</td><td>blastp</td>

<td> 417</td><td>castorbean | gb160 | MDL29969M000266_T1</td><td>seed of mamnna</td><td> 1764</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3055556</td><td>blastp</td>

<td> 418</td><td>castorbean | gb160 | AJ605574_T 1</td><td>seed of mamnna</td><td> 1765</td><td> 33</td><td> 87</td><td> 97.9166667</td><td> 98.9583333</td><td>blastp</td>

<td> 419</td><td>centaurea | gb161 | EH732068_T1</td><td>centaurea</td><td> 1766</td><td> 33</td><td> 82</td><td> 97.5694444</td><td> 98.6062718</td><td>blastp</td>

<td> 420</td><td>cichorium | gb161 | EH673032_T1</td><td>dchorium</td><td> 1767</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 421</td><td>dchorium | gb161 | EH7C6808_T1</td><td>cichorium</td><td> 1768</td><td> 33</td><td> 90</td><td> 51.7361111</td><td> 98.6842105</td><td>blastp</td>

<td> 422</td><td>cichorium | gb161 | EH701938_T1</td><td>dchorium</td><td> 1769</td><td> 33</td><td> 86</td><td> 64.9305556</td><td> 95.4314721</td><td>blastp</td>

<td> 423</td><td>dtrus | gb157.2 | CO91247LT1</td><td>citrus</td><td> 1770</td><td> 33</td><td> 82</td><td> 69.4444444</td><td> 99.5098039</td><td>blastp</td>

<td> 424</td><td>citrus | gb157.2 | BQ624312 T1</td><td>citrus</td><td> 1771</td><td> 33</td><td> 88</td><td> 98.2638889</td><td> 98,9547038</td><td>blastp</td>

<td> 425</td><td>citrus | gb157.2 | CN182376 T1</td><td>citrus</td><td> 1772</td><td> 33</td><td> 84</td><td> 92.7083333</td><td> 94.0559441</td><td>blastp</td>

<td> 426</td><td>dtnjs [gb157.2 | CB291370 T1</td><td>citrus</td><td> 1773</td><td> 33</td><td> 89</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 427</td><td>citrus | gb157.2 | CF833327 T1</td><td>citrus</td><td> 1774</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 428</td><td>citrus | gb157.2 | BQ624860 T1</td><td>citrus</td><td> 1775</td><td> 33</td><td> 85</td><td> 97.9166667</td><td> 99.6503497</td><td>blastp</td>

<td> 429</td><td>citrus | gb157.2] CF508404 T1</td><td>citrus</td><td> 1776</td><td> 33</td><td> 81</td><td> 97.9166667</td><td> 99.6503497</td><td>blastp</td>

<td> 430</td><td>citrus | gb157.2 | CB293694 T1</td><td>dtricos</td><td>mi</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 431</td><td>citnjs | gb157.2 | BQ622975 T1</td><td>citrus</td><td> 1778</td><td> 33</td><td> 85</td><td> 97.9166667</td><td> 99.6503497</td><td>blastp</td>

<td> 432</td><td>a'trus | gb157.2 | BE213453 T1</td><td>citrus</td><td> 1779</td><td> 33</td><td> 86</td><td> 73.6111111</td><td> 99.5305164</td><td>blastp</td>

<td> 433</td><td>citrus | gb157.2 | CF828110 T1</td><td>dtricos</td><td> 1780</td><td> 33</td><td> 85</td><td> 98.6111111</td><td> 99.6527778</td><td>blastp</td>

<td> 434</td><td>dtrus | gb157.2 | BQ623397 T1</td><td>citrus</td><td> 1781</td><td> 33</td><td> 86</td><td> 93.4027778</td><td> 99.6336996</td><td>blastp</td>

<td> 435</td><td>dover | gb162 | BB903117 T1</td><td>clove</td><td> 1782</td><td> 33</td><td> 85</td><td> 98.6111111</td><td> 99.6539792</td><td>blastp</td>

<td> 436</td><td>coffea | gb157.2 | BQ449035 T1</td><td>coffea</td><td> 1783</td><td> 33</td><td> 88</td><td> 98.9583333</td><td> 99.3055556</td><td>blastp</td>

<td> 437</td><td>coffea | gb157.2 | DV663743 T 1</td><td>coffea</td><td> 1784</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9473684</td><td>blastp</td>

<td> 438</td><td>cotton] gb164 | CD486529 T1</td><td>cotton</td><td> 1785</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 99.3055556</td><td>blastp</td>

<td> 439</td><td>cotton | gb164 | 0EO52445 T1</td><td>cotton</td><td> 1786</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

83/175

<td>Polinuc ID SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N ° -</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 440</td><td>cotton | gb164 | AI726690_T1</td><td>cotton</td><td> 1787</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 441</td><td>cotton | gb164 | DN803576_T1</td><td>cotton</td><td> 1788</td><td> 33</td><td> 83</td><td> 87.8472222</td><td> 98.828125</td><td>blastp</td>

<td> 442</td><td>cotton | gb164 | BM358242_T1</td><td>cotton</td><td> 1789</td><td> 33</td><td> 81</td><td> 98.2638889</td><td> 99.2882562</td><td>blastp</td>

<td> 443</td><td>cotton | gb164 | CO085369_T1</td><td>cotton</td><td> 1790</td><td> 33</td><td> 81</td><td> 52.7777778</td><td> 99.3506494</td><td>blastp</td>

<td> 444</td><td>cotton | gb164 | CO098674_T1</td><td>cotton</td><td> 1791</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3055556</td><td>blastp</td>

<td> 445</td><td>cotton | gb164 | CO070796_T1</td><td>cotton</td><td> 1792</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 446</td><td>cotton | gb164 | AI729945_T1</td><td>cotton</td><td> 1793</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 447</td><td>cotton | gb164 | DW496760_T1</td><td>cotton</td><td> 1794</td><td> 33</td><td> 86</td><td> 80.5555556</td><td> 98.3122363</td><td>blastp</td>

<td> 448</td><td>cowpea | gb166 | FF384916_T1</td><td>black beans</td><td> 1795</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 449</td><td>cowpea | gb166 | FF555791 T1 '.</td><td>black beans</td><td> 1796</td><td> 33</td><td> 82 _</td><td> 98.6111111</td><td> 99.6539792</td><td>blastp.</td>

<td> 450</td><td>cowpea | gb166 | FC457489_T1</td><td>black beans</td><td> 1797</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 451</td><td>cowpea | gb166 | AB037241_T1</td><td>black beans</td><td> 1798</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 452</td><td>cryptomeria [gb166 | DC429824_T1</td><td>cryptomeria</td><td> 1799</td><td> 33</td><td> 84</td><td> 71.5277778</td><td> 99.5215311</td><td>blastp</td>

<td> 453</td><td>cryptomeria | gb166 | AU036730_T1</td><td>cryptomeria</td><td> 1800</td><td> 33</td><td> 85</td><td> 98.6111111</td><td> 99.6515679</td><td>blastp</td>

<td> 454</td><td>dandelion | gb161 | DY814032_T1</td><td>dandelion</td><td> 1801</td><td> 33</td><td> 84 .</td><td> 82.2916667</td><td> 93.7007874</td><td>blastp</td>

<td> 455</td><td>dandelion | gb161 | DY802714_T1</td><td>dandelion</td><td> 1802</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 456</td><td>dandelion | gb161 | DY822683_T1</td><td>dandelion</td><td> 1803 -</td><td> 33</td><td> 84</td><td> 95.8333333</td><td> 99.6415771</td><td>blastp</td>

<td> 457</td><td>dandelion | gb 1611 DY806788_T1</td><td>dandelion</td><td> 1804</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 458</td><td>dandelion | gb161 | DY808781_T1</td><td>dandelion</td><td> 1805</td><td> 33</td><td> 84</td><td> 84.0277778</td><td> 99.5918367</td><td>blastp</td>

<td> 459</td><td>dandelion | gb161 | DY810613_T1</td><td>dandelion</td><td> 1806</td><td> 33</td><td> 81</td><td> 76.3888889</td><td> 94.8497854</td><td>blastp</td>

<td> 460</td><td>fescue | gb161 | CK803261_T1</td><td>fescue</td><td> 1807</td><td> 33</td><td> 85</td><td> 97.9166667</td><td> 98.6111111</td><td>blastp</td>

<td> 461</td><td>fescue | gb161 | DT682664_T1</td><td>fescue</td><td> 1808</td><td> 33</td><td> 84</td><td> 67.3611111</td><td> 99.4923858</td><td>blastp</td>

<td> 462</td><td>fescue | gb161 | DT677062_T1</td><td>fescue</td><td> 1809</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9655172</td><td>blastp</td>

<td> 463</td><td>fescue | gb161 | DT679061_T1</td><td>fescue</td><td> 1810</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9619377</td><td>blastp</td>

<td> 464</td><td>flax | gb157.3 | CV478314_T1</td><td>linen</td><td> 1811</td><td> 33</td><td> 84</td><td> 71.875</td><td> 99.5260664</td><td>blastp</td>

<td> 465</td><td>ginger | gb164 | DY345344 T1</td><td>ginger</td><td> 1812</td><td> 33</td><td> 88</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 466</td><td>ginger | gb164 | DY358322 T1</td><td>ginger</td><td> 1813</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9473684</td><td>blastp</td>

<td> 467</td><td>ginger | gb164 | DY36O757 T1</td><td>ginger</td><td> 1814</td><td> 33</td><td> 84</td><td> 98.6111111</td><td> 99.6478873</td><td>blastp</td>

<td> 468</td><td>ginger | gb164 | DY345596_T1</td><td>ginger</td><td> 1815</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9473684</td><td>blastp</td>

<td> 469</td><td>grape | gb160 | AF188844 T1</td><td>grape</td><td> 1816</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 470</td><td>grape | gb160) AF188843 T1</td><td>grape</td><td> 1817</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 471</td><td>grape | gb16O | AF188843 T3</td><td>grape</td><td> 1818</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 472</td><td>grape | gb160 | CB971128 T1</td><td>grape</td><td> 1819</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 99.3006993</td><td>blastp</td>

<td> 473</td><td>grape (gb160 | AF188843 T4</td><td>grape</td><td> 1820</td><td> 33</td><td> 84</td><td> 72.2222222</td><td> 86.3070539</td><td>blastp</td>

<td> 474</td><td>iceplant | gb164 [MCU26537_T1</td><td>crybaby nraias</td><td> 1821</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9473684</td><td>blastp</td>

<td> 475</td><td>iceplant | gb164CIPMIPA T1</td><td>crybaby nraias</td><td> 1822</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 99.2957746</td><td>blastp</td>

<td> 476</td><td>iceplant | gb164 | CIPMIP8 T1</td><td>crybaby nraias</td><td> 1823</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9473684</td><td>blastp</td>

<td> 477</td><td>ipomoea | gb157.2 | BM878883 T 1</td><td>morning glory</td><td> 1824</td><td> 33</td><td> 87</td><td> 98.9583333</td><td> 99.3031359</td><td>blastp</td>

84/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO No.:</td><td>Hom. From IO</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 478</td><td>ipomoea | gb157.2 | BJ553988_T 1</td><td>morning glory</td><td> 1825</td><td> 33</td><td> 85</td><td> 98.6111111</td><td> 99.6491228</td><td>blastp</td>

<td> 479</td><td>ipomoea | gb157.2 | BJ553369_T1</td><td>morning glory</td><td> 1826</td><td> 33</td><td> 84</td><td> 98.6111111</td><td> 99.6478873</td><td>blastp</td>

<td> 480</td><td>ipomoea | gb157.2 | BJ553198_T1</td><td>morning glory</td><td> 1827</td><td> 33</td><td> 89</td><td> 98.9583333</td><td> 99.3031359</td><td>blastp</td>

<td> 481</td><td>Iettuce | gb157.2JDW079915_T 1</td><td>lettuce</td><td> 1828</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 97.9310345</td><td>blastp</td>

<td> 482</td><td>lettuce | gb157.2 | DW043941_T1</td><td>lettuce</td><td> 1829</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 483</td><td>lettuce | gb157.2 | DW047538_T1</td><td>lettuce</td><td> 1830</td><td> 33</td><td> 87</td><td> 96.875</td><td> 98.245614</td><td>blastp</td>

<td> 484</td><td>lettuce | gb157.2 | DW104582_T1</td><td>lettuce</td><td> 1831</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 485</td><td>lettuce | gb157.2 | DW044606_T1</td><td>lettuce</td><td> 1832</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 486</td><td>lettuce | gb157.2 | DW148209_T1</td><td>lettuce</td><td> 1833</td><td> 33</td><td> 85</td><td> 89.2361111</td><td> 94.1605839</td><td>blastp</td>

<td> 487</td><td>lettuce | gb157.2 | DW148478_T1</td><td>lettuce ·</td><td> 1834</td><td> 33</td><td> 83</td><td> 98.611.1111</td><td> 95.3333333.</td><td>blastp - -</td>

<td> 488</td><td>leít (Jce | gb157.2 | DW108503_T1</td><td>lettuce</td><td> 1835</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 489</td><td>lettuce | gb157.2 | DW046100_T1</td><td>lettuce</td><td> 1836</td><td> 33</td><td> 86</td><td> 96.875</td><td> 99.6441281</td><td>blastp</td>

<td> 490</td><td>lettuce | gb157.2 | DW075079_T1</td><td>lettuce</td><td> 1837</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 491</td><td>lettuce | gb157.2 | DW076402_T1</td><td>lettuce</td><td> 1838</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 492</td><td>lettuce | gb157.2 | DW084041_T1</td><td>lettuce</td><td> 1839</td><td> 33</td><td> 86</td><td> 89.5833333</td><td> 92.8315412</td><td>blastp</td>

<td> 493</td><td>lettuce | gb157.2 | DW145601_T1</td><td>lettuce</td><td> 1840</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 494</td><td>lettuce | gb157.2 | CV699980_T1</td><td>lettuce</td><td> 1841</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 495</td><td>letfuce | gb157.2 [DW064849_T1</td><td>lettuce</td><td> 1842</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 496</td><td>lettuce | gb157.2 | DW147179_T1</td><td>lettuce</td><td> 1843</td><td> 33</td><td> 83</td><td> 98.6111111</td><td> 89.0965732</td><td>blastp</td>

<td> 497</td><td>lettuce | gb157.2 | DW045991_T1</td><td>lettuce</td><td> 1844</td><td> 33</td><td> 83</td><td> 98.6111111</td><td> 97.2789116</td><td>blastp</td>

<td> 498</td><td>lotus | gb157.2 | AF145707_T1</td><td>lotus</td><td> 1845</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 499</td><td>lotus | gb157.2 | AI967594_T1</td><td>lotus</td><td> 1846</td><td> 33</td><td> 86</td><td> 96.875</td><td> 98.245614</td><td>blastp</td>

<td> 500</td><td>lotus | gb157.2 | AF145708_T1</td><td>lotus</td><td> 1847</td><td> 33</td><td> 87</td><td> 66.6666667</td><td> 100</td><td>blastp</td>

<td> 501</td><td>maize | gb164 | EC881658_T1</td><td>corn</td><td> 1848</td><td> 33</td><td> 86</td><td> 54.5138889</td><td> 98.7421384</td><td>blastp</td>

<td> 502</td><td>maize | gb164 | AI372377_T1</td><td>corn</td><td> 1849</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 503</td><td>maize | gb164 | AF145706_T1</td><td>corn</td><td> 1850</td><td> 33</td><td> 83</td><td> 60.7638889</td><td> 100</td><td>blastp</td>

<td> 504</td><td>maize | gb164 | AI855222_T1</td><td>corn</td><td> 1851</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 505</td><td>maize] gb164 | AI619392 T1</td><td>corn</td><td> 1852</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9619377</td><td>blastp</td>

<td> 506</td><td>maize | gb164 | AI861086_T1</td><td>corn</td><td> 1853</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 507</td><td>medicago | gb157 2 | AW684000 T1</td><td>medicago</td><td> 1854</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 508</td><td>medicago | gb157.2 [AI974398 T1</td><td>medicago</td><td> 1855</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 509</td><td>medicago | gb157.2 | AL366983_T1</td><td>medicago</td><td> 1856</td><td> 33</td><td> 88</td><td> 97.5694444</td><td> 98.6062718</td><td>blastp</td>

<td> 510</td><td>medicago | gb157.2 | AI737528 T1</td><td>medicago</td><td> 1857</td><td> 33</td><td> 84</td><td> 98.6111111</td><td> 99.3103448</td><td>blastp</td>

<td> 511</td><td>medicago | gb157.2 | BQ151876 T1</td><td>medicago</td><td> 1858</td><td> 33</td><td> 84</td><td> 82.2916667</td><td> 87.2262774</td><td>blastp</td>

<td> 512</td><td>melor&gt; | gb165 | DV632745 T1</td><td>melon</td><td> 1859</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 99.3150685</td><td>blastp</td>

<td> 513</td><td>mek&gt; n | gb165] CF674915 T1</td><td>melon</td><td> 1860</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 99.3150685</td><td>blastp</td>

<td> 514</td><td>melon | gb165 | DV632772 T1</td><td>melon</td><td> 1861</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 515</td><td>millet | gb161 | CD724341 T1</td><td>millet</td><td> 1862</td><td> 33</td><td> 83</td><td> 57.2916667</td><td> 92.1787709</td><td>blastp</td>

85/175

<td>Polinuc ID SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO.N »:</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 516</td><td>benthamian nicotian | gb162 | ES885295 T1</td><td>nicotiana henfhamíana</td><td> 1863</td><td> 33</td><td> 84</td><td> 66.6666667</td><td> 97.9487179</td><td>blastp</td>

<td> 517</td><td>oil palm | gb166 | CN600863 T1</td><td>oil palm</td><td> 1864</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 518</td><td>oil_palm | gb166 | CN600797_T1</td><td>oil palm</td><td> 1865</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 519</td><td>onion | gb162 | AF255796 T1</td><td>onion</td><td> 1866</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 520</td><td>papaya | gb165 | EX228092_T1</td><td>papaya</td><td> 1867</td><td> 33</td><td> 84</td><td> 72.2222222</td><td> 93.2735426</td><td>blastp</td>

<td> 521</td><td>papaya | gb165 | AJ000031 T1</td><td>papaya</td><td> 1868</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 522</td><td>papaya | gb165 | EX257869 T1</td><td>papaya</td><td> 1869</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 523</td><td>papaya | gb165 | AM903842_T1</td><td>papaya</td><td> 1870</td><td> 33</td><td> 90</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 524</td><td>peach | gb157.2 | BU039203_T1</td><td>peach</td><td> 1871</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 98.9655172</td><td>blastp</td>

<td> 525</td><td>peach | gb157.2 | BU040913_T1</td><td>peach</td><td> 1872</td><td>³³</td><td> 90</td><td> 51..3888889</td><td> 98.6666667.</td><td>blastp .....-</td>

<td> 526</td><td>péanut | gb161 | CD038184 T1</td><td>peanut</td><td> 1873</td><td> 33</td><td> 83</td><td> 98.6111111</td><td> 99.6539792</td><td>blastp</td>

<td> 527</td><td>peanut | gb161 | ES490696_T1</td><td>peanut</td><td> 1874</td><td> 33</td><td> 82</td><td> 73.9583333</td><td> 99.5348837</td><td>blastp</td>

<td> 528</td><td>peanut | gb161 | CD038104_T 1</td><td>peanut</td><td> 1875</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 529</td><td>pepper | gb157.2 | CA523071_T1</td><td>chili</td><td> 1876</td><td> 33</td><td> 97</td><td> 96.875</td><td> 100</td><td>blastp</td>

<td> 530</td><td>pepper | gb157.2 | BM063708_T1</td><td>chili</td><td> 1877</td><td> 33</td><td> 95</td><td> 99.3055556</td><td> 100</td><td>blastp</td>

<td> 531</td><td>periwinkle | gb164 | EG554502_T1</td><td>myrtle</td><td> 1878</td><td> 33</td><td> 88</td><td> 98.9583333</td><td> 99.3031359</td><td>blastp</td>

<td> 532</td><td>periwinkle | gb164 | EG554518 T1</td><td>myrtle</td><td> 1879</td><td> 33</td><td> 87</td><td> 98.9583333</td><td> 99.3031359</td><td>blastp</td>

<td> 533</td><td>periwinkle | gb164 [EG556773_T1</td><td>myrtle</td><td> 1880</td><td> 33</td><td> 83</td><td> 84.0277778</td><td> 96.8</td><td>blastp</td>

<td> 534</td><td>petunia | gb157.2 | AF452010_T1</td><td>petunia</td><td> 1881</td><td> 33</td><td> 93</td><td> 99.3055556</td><td> 100</td><td>blastp</td>

<td> 535</td><td>petunia | gb157.2 | CV292775_T1</td><td>petunia</td><td> 1882</td><td> 33</td><td> 92</td><td> 61.8055556</td><td> 100</td><td>blastp</td>

<td> 536</td><td>petunia | gb157.2 | AF452011 T1</td><td>petunia</td><td> 1883</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 99.3006993</td><td>blastp</td>

<td> 537</td><td>pine | gb157.2 | AL751335 T1</td><td>Pine</td><td> 1884</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 538</td><td>pine | gb157.2 | AA556193_T1</td><td>Pine</td><td> 1885</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 539</td><td>pine | gb157.2 | AL750485_T1</td><td>Pine</td><td> 1886</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 540</td><td>pineapple | gb157.2 | DT335964 T1</td><td>pineapple</td><td> 1887</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 97.9452055</td><td>blastp</td>

<td> 541</td><td>pineapple | gb157.2] DT338557 T 1</td><td>pineapple</td><td> 1888</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 542</td><td>poplar | gb157.2 [BU817536 T1</td><td>poplar</td><td> 1889</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 99.3031359-</td><td>blastp</td>

<td> 543</td><td>popla r | gb 157.2 | A1162483 T 1</td><td>poplar</td><td> 1890</td><td> 33</td><td> 88</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 544</td><td>poplar | gb157.2 | BI122420 T1</td><td>poplar</td><td> 1891</td><td> 33</td><td> 87</td><td> 97.9166667</td><td> 99.3031359</td><td>blastp</td>

<td> 545</td><td>poplar | gb157.2 | A1165418 T1</td><td>poplar</td><td> 1892</td><td> 33</td><td> 85</td><td> 97.9166667</td><td> 99.3031359</td><td>blastp</td>

<td> 546</td><td>poplar | gb157.2 | BU817536 T3</td><td>poplar</td><td> 1893</td><td> 33</td><td> 82</td><td> 88.1944444</td><td> 92.0863309</td><td>blastp</td>

<td> 547</td><td>poplar | gb157.2 | BU881784 T1</td><td>poplar</td><td> 1894</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 548</td><td>potato | gti157.2 | BE923816 T1</td><td>potato</td><td> 1895</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 99.3006993</td><td>blastp</td>

<td> 549</td><td>potato | gb157.2 | CK260061 T1</td><td>potato</td><td> 1896</td><td> 33</td><td> 91</td><td> 62.5</td><td> 98.9010989</td><td>blastp</td>

<td> 550</td><td>potato | gb157.2 | BE924585 T1</td><td>potato</td><td> 1897</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9473684</td><td>blastp</td>

<td> 551</td><td>potato | gb157.2 | BF153976 T1</td><td>potato</td><td> 1898</td><td> 33</td><td> 86</td><td> 61.1111111</td><td> 100</td><td>blastp</td>

<td> 552</td><td>potato | gb157.2 | AJ487323 T1</td><td>potato</td><td> 1899</td><td> 33</td><td> 97</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 553</td><td>potato | gb157.2 | BF154021 T1</td><td>potato</td><td> 1900</td><td> 33</td><td> 92</td><td> 99.3055556</td><td> 100</td><td>blastp</td>

86/175

<td>Polinuc 10 SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFQ N «·</td><td>Hom. Γιρ ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 554</td><td>pota to | gb157.2 | 8G599633_T1</td><td>potato</td><td> 1901</td><td> 33</td><td> 95</td><td> 98.9583333</td><td> 99.3031359</td><td>blastp</td>

<td> 555</td><td>potato | gb157.2 | BE922307_T1</td><td>potato</td><td> 1902</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 99.3006993</td><td>blastp</td>

<td> 556</td><td>radish | gb164 [EV536875_T1</td><td>radish</td><td> 1903</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 557</td><td>radish | gb164 | EW726189_T1</td><td>radish</td><td> 1904</td><td> 33</td><td> 83</td><td> 60.0694444</td><td> 96.1111111</td><td>blastp</td>

<td> 558</td><td>radish | gb164 | EX756217_T1</td><td>radish</td><td> 1905</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 559</td><td>radish | gb164 | AB030696_T1</td><td>radish</td><td> 1906</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 560</td><td>radish | gbí64 | AB030695 T1</td><td>radish</td><td> 1907</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 561</td><td>radiso | gb1S4 | AB012044_T1</td><td>radish</td><td> 1908</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 562</td><td>radish | gb164 | EV567230_T1</td><td>radish</td><td> 1909</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 563</td><td>radish | gb164 | EY936735_T1</td><td>radish</td><td> 1910</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.951049.</td><td>blastp ...</td>

<td> 564</td><td>rice | gb157.2 | U37951_T1</td><td>rice</td><td> 1911</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9619377</td><td>blastp</td>

<td> 565</td><td>rice | gb157.2 | U40140_T1</td><td>rice</td><td> 1912</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 566</td><td>rice | gb157.2 | BE039992_T1</td><td>rice</td><td> 1913</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 567</td><td>rice | gb157.2 | U37951_T2</td><td>rice</td><td> 1914</td><td> 33</td><td> 86</td><td> 73.6111111</td><td> 99.0654206</td><td>blastp</td>

<td> 568</td><td>rose | gb157.2 | BQ104887_T1</td><td>rose</td><td> 1915</td><td> 33</td><td> 83</td><td> 97.5694444</td><td> 98.6206897</td><td>blastp</td>

<td> 569</td><td>rose | gb157.2 | BQ103877_T1</td><td>rose</td><td> 1916</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 570</td><td>rose | gb157.2 | EC586734_T1</td><td>rose</td><td> 1917</td><td> 33</td><td> 80</td><td> 62.1527778</td><td>99.4444AAA</td><td>blastp</td>

<td> 571</td><td>rye | gb164 | BE586240J1</td><td>rye</td><td> 1918</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 572</td><td>safflower | gb162 | EL407054_T1</td><td>safflower</td><td> 1919 .</td><td> 33</td><td> 86</td><td> 89.5833333</td><td> 94.5454545</td><td>blastp</td>

<td> 573</td><td>safflower | gb162 | EL400504_T1</td><td>safflower</td><td> 1920</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 92.5081433</td><td>blastp</td>

<td> 574</td><td>safflower | gb162 | EL400004_T1</td><td>safflower</td><td> 1921</td><td> 33</td><td> 83</td><td> 84.375</td><td> 99.5934959</td><td>blastp</td>

<td> 575</td><td>sesame | gb157.2 | BU668587_T1</td><td>Sesame</td><td> 1922</td><td> 33</td><td> 91</td><td> 57.2916667</td><td> 100</td><td>blastp</td>

<td> 576</td><td>sesame | gb157.2BU669929_T1</td><td>Sesame</td><td> 1923</td><td> 33</td><td> 87</td><td> 55.2083333</td><td> 99.375</td><td>blastp</td>

<td> 577</td><td>sorghum | gb161 .xeno | AI372377_T 1</td><td>sorghum</td><td> 1924</td><td>³³</td><td> 85</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 578</td><td>sorghum | gb161, xeno | AI861086_T 1</td><td>sorghum</td><td> 1925</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 98.9655172</td><td>blastp</td>

<td> 579</td><td>sorghum | gb161, xeno | SBU87981 __T 1</td><td>sorghum</td><td> 1926</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9619377</td><td>blastp</td>

<td> 580</td><td>soybean | gb166 | CD401115 T 1</td><td>Soy</td><td> 1927</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 99.3031359</td><td>blastp</td>

<td> 581</td><td>soybean | gb166 | AW348556 T1</td><td>Soy</td><td> 1928</td><td> 33</td><td> 84</td><td> 98.6111111</td><td> 99.6539792</td><td>blastp</td>

<td> 582</td><td>soybean | gb166 | BE352670 T1</td><td>Soy</td><td> 1929</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 583</td><td>soybean | gb166 | BI967765 T1</td><td>Soy</td><td> 1930</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9619377</td><td>blastp</td>

<td> 584</td><td>soybean | gb166 [BE661219 T 1</td><td>Soy</td><td> 1931</td><td> 33</td><td> 82</td><td> 98.2638889</td><td>99.3079Ι5Θ5</td><td>blastp</td>

<td> 585</td><td>soybean | gb166 | BE352747 T5</td><td>Soy</td><td> 1932</td><td> 33</td><td> 81</td><td> 88.1944444</td><td> 98.4732824</td><td>blastp</td>

<td> 586</td><td>soybean | gb166 | CD416359 T1</td><td>Soy</td><td> 1933</td><td> 33 ·</td><td> 85</td><td> 97.5694444</td><td> 98.6013986</td><td>blastp</td>

<td> 587</td><td>soybean | gb1661AW350352 T1</td><td>Soy</td><td> 1934</td><td> 33</td><td> 84</td><td> 97.5694444</td><td> 98.6013986</td><td>blastp</td>

<td> 588</td><td>soybean | gb166 | BE352747 T1</td><td>Soy</td><td> 1935</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 99.3079585</td><td>blastp</td>

<td> 589</td><td>soybean | gb166 | BE820629 T1</td><td>Soy</td><td> 1936</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 99.2957746</td><td>blastp</td>

<td> 590</td><td>spikemoss | gb165 | ON838148 T4</td><td>spikemoss</td><td> 1937</td><td> 33</td><td> 82</td><td> 51.0416667</td><td>99.3243I243</td><td>blastp</td>

<td> 591</td><td>spruce | gb162 | CO224550 T1</td><td>fir</td><td> 1938</td><td> 33</td><td> 80</td><td> 96.875</td><td> 98.9473684</td><td>blastp</td>

87/175

<td>Polinuc IC SEO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SEO N ··</td><td>Hom. From ID</td><td>% Irlenl</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 592</td><td>spruce | gb162 | C0216100_T1</td><td>fir</td><td> 1939</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 593</td><td>spnjce | gb162 | CO216028_T1</td><td>fir</td><td> 1940</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 594</td><td>spurge) gb161 | BG354070_T 1</td><td>euphorbia</td><td> 1941</td><td> 33</td><td> 87</td><td> 97.9166667</td><td> 98.2638889</td><td>blastp</td>

<td> 595</td><td>strawberry | gb164 | CO378647_T1</td><td>Strawberry</td><td> 1942</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 99.3103448</td><td>blastp</td>

<td> 596 '</td><td>strawberry | gb 164 | CX661400_T 1</td><td>Strawberry</td><td> 1943</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 597</td><td>strawberry | gb164 [DV438296_T1</td><td>Strawberry</td><td> 1944</td><td> 33</td><td> 83.</td><td> 98.2638889</td><td> 98.951049</td><td>blastp</td>

<td> 598</td><td>sugarcane | gb157.2] CA264801_T 1</td><td>sugar cane</td><td> 1945</td><td> 33</td><td> 80</td><td> 60.0694444</td><td> 88.8888889</td><td>blastp</td>

<td> 599</td><td>sugarcane | gb157.2 | CA086058_T1</td><td>sugar cane</td><td> 1946</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 600</td><td>sugarcane | gb157.2 | CA071197_T1</td><td>sugar cane</td><td> 1947</td><td> 33</td><td> 84</td><td> 97.2222222</td><td> 98.2638889</td><td>blastp</td>

<td> 601</td><td>sugarcane | gb157.2 | BQ530399_T1</td><td>sugar cane</td><td> 1948</td><td> 33</td><td> 84</td><td> 91.6666667</td><td> 99.253.7313</td><td>blastp -</td>

<td> 602</td><td>sugarcane | gb157.2 | CA085969_T 1</td><td>sugar cane</td><td> 1949</td><td> 33</td><td> 82</td><td> 74.3055556</td><td> 99.5391705</td><td>blastp</td>

<td> 603</td><td>sugarcane | gb157.2 | CA074778_T1</td><td>sugar cane</td><td> 1950</td><td> 33</td><td> 84</td><td> 71.1805556</td><td> 93.6936937</td><td>blastp</td>

<td> 604</td><td>sugarcane | gb157.2 | CA130651_T1</td><td>sugar cane</td><td> 1951</td><td> 33</td><td> 81</td><td> 62.1527778</td><td> 99.4505495</td><td>blastp</td>

<td> 605</td><td>sugarcane | gb157.2 | AA525652_T1</td><td>sugar cane</td><td> 1952</td><td> 33</td><td> 88</td><td> 53.4722222</td><td> 98.7179487</td><td>blastp</td>

<td> 606</td><td>sugarcane | gb157.2 | BQ536359_T1</td><td>sugar cane</td><td> 1953</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9619377</td><td>blastp</td>

<td> 607</td><td>sunflower | gb162 | DY909123_T1</td><td>sunflower</td><td> 1954</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 608</td><td>sunflower | gb162lCD846367_T1</td><td>sunflower</td><td> 1955</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 609</td><td>sunf! ower | gb162 | CD846084_T1</td><td>sunflower</td><td> 1956</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9547038</td><td>blastp</td>

<td> 610</td><td>sunflôwer | gb162 | DY915760 TÍ '</td><td>sunflower</td><td> 1957</td><td> 33</td><td> 84</td><td> 72.2222222</td><td> 100</td><td>blastp</td>

<td> 611</td><td>sunflower | gb162 | CF080940_T1</td><td>sunflower</td><td> 1958</td><td> 33</td><td> 83</td><td> 73.6111111</td><td> 99.5327103</td><td>blastp</td>

<td> 612</td><td>sunflower | gb162 | CF087907_T1</td><td>sunflower</td><td> 1959</td><td> 33</td><td> 83</td><td> 96.875</td><td> 97.5694444</td><td>blastp</td>

<td> 613</td><td>sunflower | gb162 | CX946986_T1</td><td>sunflower</td><td> 1960</td><td> 33</td><td> 84</td><td> 98.2638889</td><td> 98.6111111</td><td>blastp</td>

<td> 614</td><td>sunflower | gb162 | DY918780_T1</td><td>sunflower</td><td> 1961</td><td> 33</td><td> 87</td><td> 73.6111111</td><td> 99.0697674</td><td>blastp</td>

<td> 615</td><td>switchgrass | gb165 [FE619753_T1</td><td>switchgrass</td><td> 1962</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 616</td><td>switchgrass | gb165 | DN142591 T1</td><td>rass switchg</td><td> 1963</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 617</td><td>switchgrassJgb165 | DN141716 T1</td><td>switchgrass</td><td> 1964</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9619377</td><td>blastp</td>

<td> 618</td><td>switchg rass | gb 165 | DN141343 T 1</td><td>switchgrass</td><td> 1965</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 619</td><td>switchgrass | gb165 | DN142037 T1</td><td>switchgrass</td><td> 1966</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 98.9619377</td><td>blastp</td>

<td> 620</td><td>theHungiella [gb157.2 | DN774595 T1</td><td>thellungiella</td><td> 1967</td><td> 33</td><td> 85</td><td> 982638889</td><td> 98.951049</td><td>blastp</td>

<td> 621</td><td>thellungiella | gb157.2 | BM986095 T1</td><td>thellungiella</td><td> 1968</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98951049</td><td>blastp</td>

<td> 622</td><td>thellungiella [gb157.2] BI698563 T1</td><td>thellungiella</td><td> 1969</td><td> 33</td><td> 85</td><td> 72.5694444</td><td> 99.5238095</td><td>blastp</td>

<td> 623</td><td>tobacco | gb162 | EB426225 T1</td><td>tobacco</td><td> 1970</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.2578397</td><td>blastp</td>

<td> 624</td><td>tobacco | gb162 | CK720591 T1</td><td>tobacco</td><td> 1971</td><td> 33</td><td> 95</td><td> 99.3055556</td><td> 99.6515679</td><td>blastp</td>

<td> 625 ·</td><td>tobacco | gb162 | CK720595 T1</td><td>abacus</td><td> 1972</td><td> 33</td><td> 96</td><td> 73.6111111</td><td> 99.0654206</td><td>blastp</td>

<td> 626</td><td>! obacco | gb162 | EB427872_T1</td><td>abacus</td><td> 1973</td><td> 33</td><td> 88</td><td> 98.2638889</td><td> 99.2982456</td><td>blastp</td>

<td> 627</td><td>obacco | gb162 | CK720593 T1</td><td>abacus</td><td> 1974</td><td> 33</td><td> 87</td><td> 97.9166667</td><td> 98.9473684</td><td>blastp</td>

<td> 628</td><td>obacco | gb162 | AF024511 T1</td><td>tobacco</td><td> 1975</td><td> 33</td><td> 95</td><td> 99.3055556</td><td> 99.6515679</td><td>blastp</td>

<td> 629</td><td>obacco | gb162 (CK720596_T1</td><td>labaco |</td><td> 1976</td><td> 33</td><td> 96</td><td> 98.9583333</td><td> 99.3031359</td><td>blastp</td>

88/175

<td>Polinuc 10 SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N ° ·</td><td>Hom. From ID</td><td>% Irient</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 630</td><td>tobacco | gb162 | NTU62280_T1</td><td>tobacco</td><td> 1977</td><td> 33</td><td> 96</td><td> 98.9583333</td><td> 99.3031359</td><td>blastp</td>

<td> 631</td><td>tomato | gb164 | AW622243_T1</td><td>tomato</td><td> 1978</td><td> 33</td><td> 94</td><td> 98.9583333</td><td> 99.3031359</td><td>blastp</td>

<td> 632</td><td>tomato | gb164 | BG123213_T1</td><td>tomato</td><td> 1979</td><td> 33</td><td> 94</td><td> 99.3055556</td><td> 100</td><td>blastp</td>

<td> 633</td><td>tomato | gb164 | AI637363_T1</td><td>tomato</td><td> 1980</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 98.9473684</td><td>blastp</td>

<td> 634</td><td>tomato | gb164 | BG123955_T1</td><td>tomato</td><td> 1981</td><td> 33</td><td> 85</td><td> 98.2638889</td><td> 99.3006993</td><td>blastp</td>

<td> 635</td><td>tomato | gb164 | BP876517_T1</td><td>tomato</td><td> 1982</td><td> 33</td><td> 80</td><td> 55.9027778</td><td> 86.8705036</td><td>tblastn</td>

<td> 636</td><td>triphysaria | gt&gt; 164 | BM357654_T1</td><td>triphysaria</td><td> 1983</td><td> 33</td><td> 86</td><td> 73.6111111</td><td> 99.5305164</td><td>blastp</td>

<td> 637</td><td>lriph / saria | gb164 | EY1412O7_T1</td><td>triphysaria</td><td> 1984</td><td> 33</td><td> 90</td><td> 65.625</td><td> 99.4736842</td><td>blastp</td>

<td> 638</td><td>triphysaria | gb164 | DR174621_T1</td><td>triphysaria</td><td> 1985</td><td> 33</td><td> 87</td><td> 69.0972222</td><td> 100</td><td>blastp</td>

<td> 639</td><td>triphysaria | gb164 | BM356761_T1</td><td>triphysaria</td><td> 1986</td><td> 33 ......</td><td>8θ _</td><td> 88..5416667 .</td><td> 99.6108949</td><td>blastp, -</td>

<td> 640 ~</td><td>triphysaria | gb164 | DR169763_T1</td><td>triphysaria</td><td> 1987</td><td> 33</td><td> 87</td><td> 98.2638889</td><td> 99.6466431</td><td>blastp</td>

<td> 641</td><td>triphysaria | gb164 | BM356902_T1</td><td>triphysaria</td><td> 1988</td><td> 33</td><td> 86</td><td> 96.5277778</td><td> 99.6428571</td><td>blastp</td>

<td> 642</td><td>triphysaria | gb164 | DR174271_T1</td><td>triphysaria</td><td> 1989</td><td> 33</td><td> 86</td><td> 92.7083333</td><td> 97.4545455</td><td>blastp</td>

<td> 643</td><td>triphysaria | gb164 | DR 171777_T1</td><td>triphysaria</td><td> 1990</td><td> 33</td><td> 88</td><td> 100</td><td> 99.6539792</td><td>blastp</td>

<td> 644</td><td>wheat | gb164 | BE406715_T1</td><td>wheat</td><td> 1991</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 645</td><td>wheat | gb164 | BQ838456_T1</td><td>wheat</td><td> 1992</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 989726027</td><td>blastp</td>

<td> 646</td><td>wheat | gb164 | BE426386_T1</td><td>wheat</td><td> 1993</td><td> 33</td><td> 82</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 647</td><td>wheat | gb164 | BE403388_T1</td><td>wheat</td><td> 1994</td><td> 33</td><td> 88</td><td> 51.0416667</td><td> 98.6577181</td><td>blastp</td>

<td> 648</td><td>wheat | gb164 | BE403307_T1</td><td>wheat</td><td> 1995</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 549</td><td>wheat | gb164 | BE498268_T1</td><td>wheat</td><td> 1996</td><td> 33</td><td> 81</td><td> 60.4166667</td><td> 96.7213115</td><td>blastp</td>

<td> 650</td><td>wheat | gb164 | AL828763_T1</td><td>wheat</td><td> 1997</td><td> 33</td><td> 84</td><td> 84.7222222</td><td> 96.4705882</td><td>blastp</td>

<td> 651</td><td>wheat | gb164 | AF139816_T1</td><td>wheat</td><td> 1998</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 652</td><td>wheat | gb164JBE216990_T1</td><td>wheat</td><td> 1999</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 653</td><td>wheat | gb164 | BE403886_T1</td><td>wheat</td><td> 2000</td><td> 33</td><td> 85</td><td> 99.3055556</td><td> 99.6551724</td><td>blastp</td>

<td> 654</td><td>wheat | gb164 | BE430165_T1</td><td>wheat</td><td> 2001</td><td> 33</td><td> 85</td><td> 99.3055556</td><td> 99.6551724</td><td>blastp</td>

<td> 655</td><td>wheat | gb164 | CA484202 T1</td><td>wheat</td><td> 2002</td><td> 33</td><td> 87</td><td> 56.9444444</td><td> 97.6190476</td><td>blastp</td>

<td> 656</td><td>wheat | gb164 | BE404199 T1</td><td>wheat</td><td> 2003</td><td> 33</td><td> 86</td><td> 98.2638889</td><td> 98.9583333</td><td>blastp</td>

<td> 657</td><td>wheat | gb164 | BE406086 T1</td><td>wheat</td><td> 2004</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9726027</td><td>blastp</td>

<td> 658</td><td>wheat | gb164 | BF293776 T1</td><td>wheat</td><td> 2005</td><td> 33</td><td> 83</td><td> 98.2638889</td><td> 98.9655172</td><td>blastp</td>

<td> 659</td><td>wheat | gb164 | CK193386 T1</td><td>wheat</td><td> 2006</td><td> 33</td><td> 81</td><td> 97.2222222</td><td> 96.6216216</td><td>blastp</td>

<td> 660</td><td>castorbean | gb160 | AJ605572 T1</td><td>seed of castor</td><td> 2007</td><td> 34</td><td> 80</td><td> 99.1902834</td><td> 98.7854251</td><td>blastp</td>

<td> 661</td><td>citrus | gb157.2 | CK740163_T1</td><td>citrus</td><td> 2008</td><td> 34</td><td> 80</td><td> 99.1902834</td><td> 98.7854251</td><td>blastp</td>

<td> 662</td><td>coffea | gb157.2 | DV664793 T1</td><td>coffea</td><td> 2009</td><td> 34</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 663</td><td>lettuce | gb157.2 | DW074942 T1</td><td>lettuce</td><td> 2010</td><td> 34</td><td> 80</td><td> 99.1902834</td><td> 99.5934959</td><td>blastp</td>

<td> 664</td><td>pepper | gb157.2 | BM063938 T1</td><td>chili</td><td> 2011</td><td> 34</td><td> 95</td><td> 76.1133603</td><td> 100</td><td>blastp</td>

<td> 665</td><td>periwinkle | gb164 | EG558295 T1</td><td>myrtle</td><td> 2012</td><td> 34</td><td> 81</td><td> 99.1902834</td><td> 98.7903226</td><td>blastp</td>

<td> 666</td><td>pofato [gb157.2 (BMI12462 T1</td><td>potato</td><td> 2013</td><td> 34</td><td> 98</td><td> 94.7368421</td><td> 99.5744681</td><td>blastp</td>

<td> 667</td><td>tobacco | gb162 | AJ237751 T1</td><td>tobacco</td><td> 2014</td><td> 34</td><td> 95</td><td> 100</td><td> 100</td><td>blastp</td>

89/175

<td>Polinuc ID SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N ° -</td><td>Hom. Dr ID</td><td>% Idant</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 668</td><td>tobacco | gb162 | EB425012_T1</td><td>tobacco</td><td> 2015</td><td> 34</td><td> 93</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 669</td><td>nicotiana_benthamiana | gb162 | CK284579_T1</td><td>nicotiana bAnthamiana</td><td> 2016</td><td> 35</td><td> 86</td><td> 74.617737</td><td> 97.5903614</td><td>blastp</td>

<td> 670</td><td>potato | gb157 2 | BG594926_T 1</td><td>potato</td><td> 2017</td><td> 35</td><td> 96</td><td> 100</td><td> 96.4497041</td><td>blastp</td>

<td> 671</td><td>tomato | gb164 | DB679435_T1</td><td>tomato</td><td> 2018</td><td> 35</td><td> 90</td><td> 76.146789</td><td> 100</td><td>blastp</td>

<td> 672</td><td>tobacco | gb162 | CK72Ó588 T1</td><td>tobacco</td><td> 2019</td><td> 36</td><td> 81</td><td> 53.5580524</td><td> 100</td><td>blastp</td>

<td> 673</td><td>apple | gb157.3 | CN494715_T1</td><td>Apple</td><td> 2020</td><td> 37</td><td> 84</td><td> 85.7142857</td><td> 94.7368421</td><td>blastp</td>

<td> 674</td><td>apple | gb157.3 | CO066689_T1</td><td>Apple</td><td> 2021</td><td> 37</td><td> 81</td><td> 94.2857143</td><td> 76.1538462</td><td>blastp</td>

<td> 675</td><td>castorbean | gb160 | MDL30026M001488_T1</td><td>seed. in ma mona</td><td> 2022</td><td> 37</td><td> 90</td><td> 95.2380952</td><td> 36.900369</td><td>blastp</td>

<td> 676</td><td>citrus | gb157.2 | CX300349_T1</td><td>citrus</td><td> 2023</td><td> 37</td><td> 83</td><td> 99.047619</td><td> 72.7272727</td><td>blastp</td>

<td> 677</td><td>coffea | gb157.2 | DV663640_T1</td><td>coffea</td><td> 2024</td><td> 37</td><td>⁸⁰</td><td> 93.3333333</td><td> 34.5070423.</td><td>blastp. · -.....</td>

<td> 678</td><td>cowpeajgb166 (FF395821_T 1</td><td>black beans</td><td> 2025</td><td> 37</td><td> 82</td><td> 93.3333333</td><td> 95.1456311</td><td>blastp</td>

<td> 679</td><td>cowpea | gb166 | FF395821_T2</td><td>black beans</td><td> 2026</td><td> 37</td><td> 82</td><td> 94.2857143</td><td> 13.2450331</td><td>tblastn</td>

<td> 680</td><td>Ípomoea | gb157.2 | C J769054_T 1</td><td>morning glory</td><td> 2027</td><td> 37</td><td> 87</td><td> 100</td><td> 59.3220339</td><td>blastp</td>

<td> 681</td><td>lettuce | gb157.2 | CV699989_T1</td><td>lettuce</td><td> 2028</td><td> 37</td><td> 83</td><td> 98.0952381</td><td> 36.5248227</td><td>blastp</td>

<td> 682</td><td>medicago | gb157.2 | AW208262_T 1</td><td>medicago</td><td> 2029</td><td> 37</td><td> 80</td><td> 95.2380952</td><td> 37.1747212</td><td>blastp</td>

<td> 683</td><td>melon | gb165 | AM727408_T1</td><td>melon</td><td> 2030</td><td> 37</td><td> 82</td><td> 97.1428571</td><td> 36.9565217</td><td>blastp</td>

<td> 684 ·</td><td>poplar | gb157.2 | CN517706_T1</td><td>poplar</td><td> 2031</td><td> 37</td><td> 84</td><td> 96.1904762</td><td> 36.5942029.</td><td>blastp</td>

<td> 685</td><td>poplar | gb157.2 | BU813630_T1</td><td>poplar</td><td> 2032</td><td> 37</td><td> 84</td><td> 99.047619</td><td> 37.6811594</td><td>blastp</td>

<td> 686</td><td>potato | gb157.2 | DN587628_T1</td><td>potato</td><td> 2033</td><td> 37</td><td> 90</td><td> 96.1904762</td><td> 93.5185185</td><td>blastp</td>

<td> 687</td><td>rice | gb157.2 | BI805522_T1</td><td>rice</td><td> 2034</td><td> 37</td><td> 80</td><td> 97.1428571</td><td> 35.915493</td><td>blastp</td>

<td> 688</td><td>soybean | gb166 | FK397604_T1</td><td>Soy</td><td> 2035</td><td> 37</td><td> 82</td><td> 54.2857143</td><td> 98.2758621</td><td>blastp</td>

<td> 689</td><td>sunflower | gb162 | DY951259_T1</td><td>sunflower</td><td> 2036</td><td> 37</td><td> 82</td><td> 98.0952381</td><td> 39.0151515</td><td>blastp</td>

<td> 690</td><td>sunflower | gb162 | DY942645_T1</td><td>sunflower</td><td> 2037</td><td> 37</td><td> 83</td><td> 98.0952381</td><td> 37.3188406</td><td>blastp</td>

<td> 691</td><td>triphysaria | gb164 | EY130232_T1</td><td>triphysaria</td><td> 2038</td><td> 37</td><td> 85</td><td> 99.047619</td><td> 37.6811594</td><td>blastp</td>

<td> 692</td><td>arabidopsis | gb165 | AT4G10380_T1</td><td>arabidopsis</td><td> 2039</td><td> 38</td><td> 80</td><td> 97.6271186</td><td> 96.0526316</td><td>blastp</td>

<td> 693</td><td>artemisia | gb164 | EY089420_T1</td><td>artemisia</td><td> 2040</td><td> 38</td><td> 87</td><td> 55.5932203</td><td> 100</td><td>blastp</td>

<td> 694</td><td>artemisia | gb164 | EY113317 T1</td><td>artemisia</td><td> 2041</td><td> 38</td><td> 89</td><td> 51.8644068</td><td> 100</td><td>blastp</td>

<td> 695</td><td>b oleracea | gb161 | AM391026 T1</td><td>b.oleracea</td><td> 2042</td><td> 38</td><td> 81</td><td> 93.8983051</td><td> 95.862069</td><td>blastp</td>

<td> 696</td><td>b rapa | gb162 | CV545128 T1</td><td>b_rapa</td><td> 2043</td><td> 38</td><td> 81</td><td> 97.6271186</td><td> 96.013289</td><td>blastp</td>

<td> 697</td><td>canola | gb161 | ES903871 T1</td><td>canola</td><td> 2044</td><td> 38</td><td> 85</td><td> 52.2033898</td><td> 100</td><td>blastp</td>

<td> 698</td><td>cassava | gb164 | CK641734_T1</td><td>manioc</td><td> 2045</td><td> 38</td><td> 89</td><td> 93.8983051</td><td> 98.9247312</td><td>blastp</td>

<td> 699</td><td>castorbean [| gb160 | EG668085_T 1</td><td>seed of castor</td><td> 2046</td><td> 38</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 700</td><td>castorbean [| gb160 | EG668085_T2</td><td>seed of castor</td><td> 2047</td><td> 38</td><td> 90</td><td> 62.0338983</td><td> 100</td><td>blastp</td>

<td> 701</td><td>centaurea | gb161 | EH739099 T1</td><td>centaurea</td><td> 2048</td><td> 38</td><td> 83</td><td> 69.1525424</td><td> 980487805</td><td>blastp</td>

<td> 702</td><td>centaurea | gb161 | EH710762_T1</td><td>centaurea</td><td> 2049</td><td> 38</td><td> 89</td><td> 80.6779661</td><td> 95.9677419</td><td>blastp</td>

<td> 703</td><td>citrus | gb157.2 | CX299695 T1</td><td>citrus</td><td> 2050</td><td> 38</td><td> 98</td><td> 62.0338983</td><td> 100</td><td>blastp</td>

<td> 704</td><td>citrus | gb157.2 | CO912981 T1</td><td>citrus</td><td> 2051</td><td> 38</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 705</td><td>citnjs | gb157.2] CO912981 T2</td><td>citrus</td><td> 2052</td><td> 38</td><td> 81</td><td> 78.3050847</td><td> 95.5465587</td><td>blastp</td>

90/175

<td>Polinuc ΙΕ SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N ° '</td><td>Hom. r&gt; p in</td><td>% Irlsnl</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 706</td><td>cotton | gb164 | CO071578_T1</td><td>cotton</td><td> 2053</td><td> 38</td><td> 90</td><td> 77.9661017</td><td> 95.4356846</td><td>blastp</td>

<td> 707</td><td>cotton | gb164 | BE052767_T1</td><td>cotton</td><td> 2054</td><td> 38</td><td> 88</td><td> 86.440678</td><td> 100</td><td>blastp</td>

<td> 708</td><td>grape | gb160 [CB350030_T1</td><td>grape</td><td> 2055.</td><td> 38</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 709</td><td>lettuçe | gb157.2 | DW123895_T1</td><td>lettuce</td><td> 2056</td><td> 38</td><td> 86</td><td> 97.6271186</td><td> 96.6555184</td><td>blastp</td>

<td> 710</td><td>melon | gb165 | AM726471_T1</td><td>melon</td><td> 2057</td><td> 38</td><td> 80</td><td> 78.6440678</td><td> 92.8</td><td>blastp</td>

<td> 711</td><td>nicotiana_benthamiana | gb162 | C K281387_T1</td><td>nicotiana bRnfhamiana</td><td> 2058</td><td> 38</td><td> 94</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 712</td><td>onion | gb162 | CF436356_Tl</td><td>onion</td><td> 2059</td><td> 38</td><td> 83</td><td> 86.1016949</td><td> 98.0988593</td><td>blastp</td>

<td> 713</td><td>poplar | gb157.2 | BU895174_T1</td><td>poplar</td><td> 2060</td><td> 38</td><td> 84</td><td> 97.6271186</td><td> 96.3333333</td><td>blastp</td>

<td> 714</td><td>poplar | gb157.2 | BI126692_T1</td><td>poplar</td><td> 2061</td><td> 38</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 715</td><td>radish | gb164 | EX772276_T1</td><td>radish</td><td> 2062</td><td>³⁸</td><td> 87</td><td> 62.0338983</td><td> 100_ ..</td><td>blastp - -</td>

<td> 716</td><td>safflower | gb162 | EL376221 TÍ</td><td>safflower</td><td> 2063</td><td> 38</td><td> 87</td><td> 55.5932203</td><td> 94.2528736</td><td>blastp</td>

<td> 717</td><td>soybean | gb 166 | AW351195_T 1</td><td>Soy</td><td> 2064</td><td> 38</td><td> 83</td><td> 57.2881356</td><td> 100</td><td>blastp</td>

<td> 718</td><td>spurge | gb161 | DV120704_T1</td><td>euphorbia</td><td> 2065</td><td> 38 ‘</td><td> 81</td><td> 66.1016949</td><td> 100</td><td>blastp</td>

<td> 719</td><td>strawberry | gb164 | EX663538_T1</td><td>Strawberry</td><td> 2066</td><td> 38</td><td> 87</td><td> 73.559322</td><td> 100</td><td>blastp</td>

<td> 720</td><td>sunflower | gb162 | BQ915292_T 1</td><td>sunflower</td><td> 2067</td><td> 38</td><td> 83</td><td> 69.8305085</td><td> 95.0636943</td><td>tblastn</td>

<td> 721</td><td>tobacco | gb162 | EB426773_T1</td><td>tobacco</td><td> 2068</td><td> 38</td><td> 94</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 722</td><td>triphysaria | gb164 | EY008469_T 1</td><td>tripbysaria</td><td> 2069</td><td> 38</td><td> 90</td><td> 67.7966102</td><td> 100</td><td>blastp</td>

<td> 723</td><td>pepper | gb157.2 | BM066463_T1</td><td>chili</td><td> 2070</td><td> 39</td><td> 91</td><td> 60</td><td> 100</td><td>blastp</td>

<td> 724</td><td>tobacco | gb162 | EB445778_T1</td><td>tobacco</td><td> 2071</td><td> 39</td><td> 88</td><td> 85.8333333</td><td> 100</td><td>blastp</td>

<td> 725</td><td>pepper | gb157.2 | CA515996_T 1</td><td>chili</td><td> 2072</td><td> 40</td><td> 82</td><td> 64.4628099</td><td> 100</td><td>blastp</td>

<td> 726</td><td>potato | gb157.2 | BE341068_T1</td><td>potato</td><td> 2073</td><td> 40</td><td> 92</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 727</td><td>potato | gb157.2 | BG887984_T1</td><td>potato</td><td> 2074</td><td> 41</td><td> 100</td><td> 79.4238683</td><td> 91.4691943</td><td>blastp</td>

<td> 728</td><td>apple | gb157.3 | CN898142_T1</td><td>Apple</td><td> 2075</td><td> 42</td><td> 86</td><td> 70.9677419</td><td> 98.0582524</td><td>blastp</td>

<td> 729</td><td>apple | gb157.3 | CN492544_T1</td><td>Apple</td><td> 2076</td><td> 42 ·</td><td> 82</td><td> 99.6415771</td><td> 98.9399293</td><td>blastp</td>

<td> 730</td><td>apple | gb157.3 | CN495819 T1</td><td>Apple</td><td> 2077</td><td> 42</td><td> 84</td><td> 99.6415771</td><td> 989547038</td><td>blastp</td>

<td> 731</td><td>apple | gb157.3 | CN869175 T1</td><td>Apple</td><td> 2078</td><td> 42</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 732</td><td>apple | gb157.3 | CN488973 T1</td><td>Apple</td><td> 2079</td><td> 42</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 733</td><td>apricot | gb157.2 | CB820380 T1</td><td>Damascus</td><td> 2080</td><td> 42</td><td> 88</td><td> 69.8924731</td><td> 98.4848485</td><td>blastp</td>

<td> 734</td><td>aquilegia | gb157.3 [DR921860 T1</td><td>columbine</td><td> 2081</td><td> 42</td><td> 85</td><td> 94.9820789</td><td> 100</td><td>blastp</td>

<td> 735</td><td>arabidopsis | gb 165 | AT2G37170_T 1</td><td>arabidopsis</td><td> 2082</td><td> 42</td><td> 80</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 736</td><td>arabidopsis | gb165 | AT3G54820 T 1</td><td>arabidopsis</td><td> 2083</td><td> 42</td><td> 81</td><td> 95.6989247</td><td> 94.7552448</td><td>blastp</td>

<td> 737</td><td>arabidopsis | gb165 | AT3G53420_T1</td><td>arabidopsis</td><td> 2084</td><td> 42</td><td> 81</td><td> 100</td><td> 99.3031359</td><td>blastp</td>

<td> 738</td><td>arabidopsis | gb165 | AT5G60660 T 1</td><td>arabidopsis</td><td> 2085</td><td> 42</td><td> 80</td><td> 99.2831541</td><td> 97.2508591</td><td>blastp</td>

<td> 739</td><td>artemisia | gb164 | EY056827 T1</td><td>artemisia</td><td> 2086</td><td> 42</td><td> 89</td><td> 79.5698925</td><td> 100</td><td>blastp</td>

<td> 740</td><td>artemisia | g b164 [EY033689 T 1</td><td>artemisia</td><td> 2087</td><td> 42</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 741</td><td>artemisia | gb164 | EY032199 T1</td><td>artemisia</td><td> 2088</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 742</td><td>artemisia | gb164 | EY042731 T1</td><td>artemisia</td><td> 2089</td><td> 42</td><td> 88</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 743</td><td>artemisia | gb164] EX980079 T 1</td><td>artemisia</td><td> 2090</td><td> 42</td><td> 82</td><td> 99.6415771</td><td> 98.9473684</td><td>blastp</td>

91/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SEO Ν ':</td><td>Hom. From ID</td><td>% Irlent</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 744</td><td>avocado | gb164 | CK754546JF1</td><td>avocado</td><td> 2091</td><td> 42</td><td> 86</td><td> 51.6129032</td><td> 97.2972973</td><td>blastp</td>

<td> 745</td><td>bjuncea | gb164 | EVGN00454408761136JT1</td><td>bjuncea</td><td> 2092</td><td> 42</td><td> 81</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 746</td><td>bjuncea | gbl64 | EVGN00454408761136 T2</td><td>bjuncea</td><td> 2093</td><td> 42</td><td> 81</td><td> 98.9247312</td><td> 97.9020979</td><td>blastp</td>

<td> 747</td><td>bjunceA | gb164 | EVGN00748222952488 T2</td><td>bjuncea</td><td> 2094·</td><td> 42</td><td> 80</td><td> 100</td><td> 88.7850467</td><td>blastp</td>

<td> 748</td><td>bJunceA | gb164 | EVGN00204411253360_T1</td><td>bjuncea</td><td> 2095</td><td> 42</td><td> 84</td><td> 82.078853</td><td> 97.8991597</td><td>blastp</td>

<td> 749</td><td>bjuncea | gb164 | EVGN000542086C0715.T1</td><td>bjuncea.</td><td> 2096</td><td> 42</td><td> 80</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 750</td><td>bJuncea | gb164EVGN00049614332152_T1</td><td>bjuncea</td><td> 2097</td><td> 42</td><td> 83</td><td> 64.516129</td><td> 96.2566845</td><td>blastp</td>

<td> 751</td><td>bJurtcea | gb164 | EVGN01023711071914_T1</td><td>bjuncea</td><td> 2098</td><td> 42</td><td> 85</td><td> 58.4229391</td><td> 100</td><td>blastp</td>

<td> 752</td><td>bjuncea | gb164 | EVGN00247216171316_T1</td><td>bjuncea</td><td> 2099</td><td> 42</td><td> 81</td><td> 100</td><td> 99.3031359</td><td>blastp</td>

<td> 753</td><td>bjuncea | gb164 | EVGN00778009020884JT1</td><td>bjuncea</td><td> 2100</td><td> 42</td><td> 88</td><td> 64.1577061</td><td> 100</td><td>blastp - -</td>

<td> 754</td><td>bjuncea | gb164jEVGN02648808940517_T1</td><td>bjuncea</td><td> 2101</td><td> 42</td><td> 85</td><td> 53.4050179</td><td> 98.6754967</td><td>blastp</td>

<td> 755</td><td>bJunceA | gb164 | EVGN00316414413452_T1</td><td>bjuncea</td><td> 2102</td><td> 42</td><td> 82</td><td> 82.7956989</td><td> 100</td><td>blastp</td>

<td> 756</td><td>bjuncea | gb164 | DT317706_T1</td><td>bjuncea</td><td> 2103</td><td> 42</td><td> 81</td><td> 100</td><td> 99.3031359</td><td>blastp</td>

<td> 757</td><td>bJunceA | gb164 | EVGN00748222952488JT1</td><td>bjuncea</td><td> 2104</td><td> 42</td><td> 81</td><td> 100</td><td> 99.3031359</td><td>blastp</td>

<td> 758</td><td>b_oleracea] gb161 | AM386520_T1</td><td>b_oleracea</td><td> 2105</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 759</td><td>b_oleracea | gb161 | AM058395_T1</td><td>b.oleracea</td><td> 2106</td><td> 42</td><td> 83</td><td> 57.3476703</td><td> 91.954023</td><td>blastp</td>

<td> 760</td><td>b_oleracea | gb161 | AM385504_T1</td><td>b_oleracea</td><td> 2107</td><td> 42</td><td> 81</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 761</td><td>0rapa | gb162 | BG544498_T1</td><td>b_rapa</td><td> 2108</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 762</td><td>b_rapa | gb162 | BQ791962_T2</td><td>b_rapa</td><td> 2109</td><td> 42</td><td> 81</td><td> 100</td><td> 99.2982456'</td><td>blastp</td>

<td> 763</td><td>b_rapa | gb162 | BQ791962_T1</td><td>b.rapa</td><td> 2110</td><td> 42</td><td> 81</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 764</td><td>b_rapa | gb162 | EX065729_T1</td><td>b_rapa</td><td> 2111</td><td> 42</td><td> 81</td><td> 92.1146953</td><td> 100</td><td>blastp</td>

<td> 765</td><td>b_rapa | gb162 | CA992278_T1</td><td>b_rapa</td><td> 2112</td><td> 42</td><td> 83</td><td> 89.9641577</td><td> 98.8372093</td><td>blastp</td>

<td> 766</td><td>b_rapa | gb162 | CO749284_T1</td><td>b.rapa</td><td> 2113</td><td> 42</td><td> 81</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 767</td><td>barley | gb157.3 | BE412486_T1</td><td>barley</td><td> 2114 </td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 768</td><td>bean | gb164 | CB542746 T1</td><td>bean</td><td> 2115</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 769</td><td>bean | gb164 | CB280567 T1</td><td>bean</td><td> 2116</td><td> 42</td><td> 86</td><td> 99.6415771</td><td> 98.9473684</td><td>blastp</td>

<td> 770</td><td>bean | gb164 | BQ481649 T1</td><td>bean</td><td> 2117</td><td> 42</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 771</td><td>bean [gb164 | CV532291 T1</td><td>bean</td><td> 2118</td><td> 42</td><td> 86</td><td> 99.6415771</td><td> 98.9547038</td><td>blastp</td>

<td> 772</td><td>brachypodium | gb161.xeno | BE416137 T1</td><td>brachypodium</td><td> 2119</td><td> 42</td><td> 80</td><td> 94.9820789</td><td> 100</td><td>blastp</td>

<td> 773</td><td>brachypodium | gb161.xeno | AF139814_T1</td><td>brachypodium</td><td> 2120</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 774</td><td>canola | gb161 | CN729066 T1</td><td>canola</td><td> 2121</td><td> 42</td><td> 81</td><td> 100</td><td> 99.3031359</td><td>blastp</td>

<td> 775</td><td>canola | gb161 | DQ068169 T1</td><td>canola</td><td> 2122</td><td> 42</td><td> 81</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 776</td><td>canola (gb161 | AF118382 T1</td><td>canola</td><td> 2123</td><td> 42</td><td> 81</td><td> 100</td><td> 99.3031359</td><td>blastp</td>

<td> 777</td><td>canola | gb161 | AF118 383 T1</td><td>canola</td><td> 2124</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 778</td><td>canola | gb161 | CD819509 T1</td><td>canola</td><td> 2125</td><td> 42</td><td> 80</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 779</td><td>canola | gb161 | EE419467 T1</td><td>canola</td><td> 2126</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 780</td><td>canola | gb161 | EE459735 T1</td><td>canola</td><td> 2127</td><td> 42</td><td> 81</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 781</td><td>canola (gb161 | CX192356 T1</td><td>canola</td><td> 2128</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

92/175

<td>Polinuc IC SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO.N “:</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 782</td><td>canola | gb161 | CN827413_T1</td><td>canola</td><td> 2129</td><td> 42</td><td> 81</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 783</td><td>canola | gb161 | EE432011_T1</td><td>canola</td><td> 2130</td><td> 42</td><td> 81</td><td> 100</td><td> 99.2982456</td><td>blastp</td>

<td> 784</td><td>cassava | gb164 | DB922106_T1</td><td>manioc</td><td> 2131</td><td> 42</td><td> 81</td><td> 93.90681</td><td> 92.5266904</td><td>blastp</td>

<td> 785</td><td>cassava | gb164 | CK640888_T1 '</td><td>manioc</td><td> 2132</td><td> 42</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 786</td><td>cassava | gb164 | CK642866_T1</td><td>manioc</td><td> 2133</td><td> 42</td><td> 84</td><td> 99.6415771</td><td> 98.951049</td><td>blastp</td>

<td> 787</td><td>cassava | gb164 | CK642551_T 1</td><td>manioc</td><td> 2134</td><td> 42</td><td> 86</td><td> 100</td><td> 99.3055556</td><td>blastp</td>

<td> 788</td><td>castorbean | gb160 | AJ605565_T 1</td><td>seed of ma mona</td><td> 2135</td><td> 42</td><td> 86</td><td> 100</td><td> 99.3055556</td><td>blastp</td>

<td> 789</td><td>castorbean | gb160 | A J605568_T 1</td><td>seed of mamnna</td><td> 2136</td><td> 42</td><td> 87</td><td> 99.6415771</td><td> 98.9399293</td><td>blastp</td>

<td> 790</td><td>castorbean | gb160 | EE259660_T 1</td><td>seed of mamnna</td><td> 2137</td><td> 42</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 791</td><td>centaurea | gb161 | EL933765_T1</td><td>centaurea</td><td> 2138</td><td> 42</td><td>⁸⁴ :</td><td> 87.0967742</td><td> 92.8571429</td><td>blastp .....</td>

<td> 792</td><td>centaurea | gb16T | EL93Í761_T1</td><td>centaurea</td><td> 2139</td><td> 42</td><td> 82</td><td> 75.9856631</td><td> 89.2561983</td><td>blastp</td>

<td> 793</td><td>cichorium | gb161 | DT212328_T1</td><td>cichorium</td><td> 2140</td><td> 42</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 794</td><td>citrus | gb157.2 | BQ625054 T1</td><td>citrus</td><td> 2141</td><td> 42</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 795</td><td>citrus | gb157.2 | CF509045_T1</td><td>citrus</td><td> 2142</td><td> 42</td><td> 86</td><td> 100</td><td> 99.303135 9</td><td>blastp</td>

<td> 796</td><td>citrus | gb157.2 | CB291797_T1</td><td>citrus</td><td> 2143</td><td> 42</td><td> 80</td><td> 100</td><td> 84.070796 5</td><td>blastp</td>

<td> 797</td><td>citrus | gb157.2 | BQ623325 T1</td><td>citrus</td><td> 2144</td><td> '42</td><td> 86</td><td> 100</td><td> 99.303135 9</td><td>blastp</td>

<td> 798</td><td>citrus | gb157.2 | BQ623742 T1</td><td>citrus</td><td> 2145</td><td> 42</td><td> 88</td><td> 94.9820789</td><td> 99.261992 6 </td><td>blastp</td>

<td> 799</td><td>citrus | gb157.2 | CF417769_T1</td><td>citrus</td><td> 2146</td><td> 42</td><td> 83</td><td> 100</td><td> 99.303135 9</td><td>blastp</td>

<td> 800</td><td>citrus | gb157.2 | BQ623128_T1</td><td>citrus</td><td> 2147</td><td> 42</td><td> 88</td><td> 68.4587814</td><td>98.963730 ü</td><td>blastp</td>

<td> 801</td><td>citrus | gb157.2 | CB293000_T1</td><td>citrus</td><td> 2148</td><td> 42</td><td> 82</td><td> 93.1899642</td><td> 98.884758 4</td><td>blastp</td>

<td> 802</td><td>citrus | gb157.2 | BQ622991_T1</td><td>citrus</td><td> 2149</td><td> 42</td><td> 84</td><td> 96.4157706</td><td> 98.555956 7</td><td>blastp</td>

<td> 803</td><td>citrus | gb157.2 | CF503882_T1</td><td>citrus</td><td> 2150</td><td> 42</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 804</td><td>cotton | gb164 | BE052942_T1</td><td>cotton</td><td> 2151</td><td> 42</td><td> 84</td><td> 99.2831541</td><td>98.581560 J</td><td>blastp</td>

<td> 805</td><td>cotton | gb164 | AF064467_T1</td><td>cotton</td><td> 2152</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 806</td><td>cotton | gb164 | BG443494 T1</td><td>cotton</td><td> 2153</td><td> 42</td><td> 85</td><td> 100</td><td> 99.298245 6</td><td>blastp</td>

<td> 807</td><td>cotton | gb164 | C0086106 T1</td><td>cotton</td><td> 2154</td><td> 42</td><td> 88</td><td> 70.2508961</td><td> 100</td><td>blastp</td>

<td> 808</td><td>cotton | gb164 | BQ406033 T1</td><td>cotton</td><td> 2155</td><td> 42</td><td> 82</td><td> 100</td><td> 99.298245 .6</td><td>blastp</td>

<td> 809</td><td>cotton | gb164 | CO109551 T1</td><td>cotton</td><td> 2156</td><td> 42</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 810</td><td>cotton | gb164 | DV437970 T1</td><td>cotton</td><td> 2157</td><td> 42</td><td> 80</td><td> 64.1577061</td><td> 95.360824 7</td><td>blastp</td>

<td> 811</td><td>cotton | gb164 | AI725803 T1</td><td>cotton</td><td> 2158</td><td> 42</td><td> 84</td><td> 100</td><td>99.298245 s</td><td>blastp</td>

<td> 812</td><td>cotton | gb164 | CD486305 T1</td><td>cotton</td><td> 2159</td><td> 42</td><td> 81</td><td> 98.9247312</td><td> 94.019933 6</td><td>blastp</td>

<td> 813</td><td>cowpea | gb166 | ES884222_T2</td><td>black beans</td><td> 2160</td><td> 42</td><td> 85</td><td> 86.3799283</td><td> 93.560606 1</td><td>blastp</td>

<td> 814</td><td>cowpea | gb166 | ES884222_T1</td><td>black beans</td><td> 2161</td><td> 42</td><td> 86</td><td> 99.6415771</td><td> 98.954703 3</td><td>blastp</td>

<td> 815</td><td>cowpea | gb166 | FF538675 T1</td><td>black beans</td><td> 2162</td><td> 42</td><td> 89</td><td> 52.688172</td><td> 98</td><td>blastp</td>

<td> 816</td><td>cowpea | gb166 | FC458151 T1</td><td>black beans</td><td> 2163</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 817</td><td>cowpea | gb166 | FC458381 T1</td><td>black beans</td><td> 2164</td><td> 42</td><td> 85</td><td> 99.6415771</td><td> 98.947368 4</td><td>blastp</td>

<td> 818</td><td>cryptomeria | gb166 | AU036821 T1</td><td>cryptomeria</td><td> 2165</td><td> 42</td><td> 83</td><td> 95.6989247</td><td> 93.639576</td><td>blastp</td>

<td> 819</td><td>cryptomeria | gb166 | BW995927 T 1</td><td>cryptomeria</td><td> 2166</td><td> 42</td><td> 81</td><td> 53.046595</td><td> 98.013245</td><td>blastp</td>

93/175

<td>Polinuc ID IF THE</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N '·</td><td>Hom. From ID</td><td>% Idenf</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 820</td><td>dandelion | gb 161 | DY827637_T1</td><td>dandelion</td><td> 2167</td><td> 42</td><td> 87</td><td> 93.90681</td><td> 88.963210 7</td><td>blastp</td>

<td> 821</td><td>dandelion | gb161 | DY814583_T1</td><td>dandelion</td><td> 2168</td><td> 42</td><td> 85</td><td> 93.5483871</td><td> 93.286219 1</td><td>blastp</td>

<td> 822</td><td>dandelionjgb 161 jDY828216_T1</td><td>dandelion</td><td> 2169</td><td> 42</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 823</td><td>dandefion | gb 1611DY818322_T 1</td><td>dandelion</td><td> 2170</td><td> 42</td><td> 80</td><td> 85.3046595</td><td> 98.765432 1</td><td>blastp</td>

<td> 824</td><td>dandelion | gb 161 | DY805523_T 1</td><td>dandelion</td><td> 2171</td><td> 42</td><td> 82</td><td> 98.9247312</td><td> 98.245614</td><td>blastp</td>

<td> 825</td><td>fescue | gb161 | DT675934_T1</td><td>fescue</td><td> 2172</td><td> 42</td><td> 82</td><td> 61.2903226</td><td> 93.922651 9</td><td>blastp</td>

<td> 826</td><td>ginger | gb164 | DY345807 T1</td><td>ginger</td><td> 2173</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 827</td><td>ginger | gb164 | DY373920_T1</td><td>ginger</td><td> 2174</td><td> 42</td><td> 88</td><td> 69.5340502</td><td> 100</td><td>blastp</td>

<td> 828</td><td>grape | gb160] BQ792080_T1</td><td>grape</td><td> 2175</td><td> 42</td><td> 81</td><td> 100</td><td> 99.303135 9</td><td>blastp</td>

<td> 829</td><td>grape | gb160 | C8973593_T1</td><td>grape</td><td> 2176</td><td> 42 ..</td><td> .84</td><td> .100. -- -</td><td> 100</td><td>blastp -</td>

<td> 830</td><td>grape | gb160 | BM437196_T1</td><td>grape</td><td> 2177</td><td> 42</td><td> 84</td><td> 100</td><td> 99.295774 6</td><td>blastp</td>

<td> 831</td><td>iceplant | gb164 | CIPMIPC_T1</td><td>crybaby nráias</td><td> 2178</td><td> 42</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 832</td><td>iceplant | gb164 | BE035661_T1</td><td>crybaby nraias</td><td> 2179</td><td> 42</td><td> 82</td><td> 99.6415771</td><td>98.625429 J</td><td>blastp</td>

<td> 833</td><td>ipomoea | gb157.2 | BM878800_T1</td><td>morning glory</td><td> 2180</td><td> 42</td><td> 80</td><td> 99.6415771</td><td> 100</td><td>blastp</td>

<td> 834</td><td>ipomoea | g b157.2 | AU224434_T2</td><td>morning glory</td><td> 2181</td><td> 42</td><td> 90</td><td> 86.7383513</td><td> 93.233082 7</td><td>blastp</td>

<td> 835</td><td>ipomoea | gb157.2 | BJ553793_T1</td><td>morning glory</td><td> 2182</td><td> 42</td><td> 82</td><td> 100</td><td> 99.295774 6</td><td>blastp</td>

<td> 836</td><td>ipomoea | gb157.2 | AU224434 „T1</td><td>morning glory</td><td> 2183</td><td> .42</td><td> 89</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 837</td><td>letíuce | gb157.2 | DW115660_T1</td><td>lettuce</td><td> 2184</td><td> 42</td><td> 85</td><td> 99.2831541</td><td> 98.596491 2</td><td>blastp</td>

<td> 838</td><td>lettuce | gb 157.2 | DW113963_T 1</td><td>lettuce</td><td> 2185</td><td> 42</td><td> 80</td><td> 97.8494624</td><td> 95.789473 7</td><td>blastp</td>

<td> 839</td><td>lettuce | gb157.2 | DW110249_T1</td><td>lettuce</td><td> 2186</td><td> 42</td><td> 84</td><td> 99.6415771</td><td> 98.939929 3</td><td>blastp</td>

<td> 840</td><td>lettuce | gb157.2 | DW051453_T1</td><td>lettuce</td><td> 2187</td><td> 42</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 841</td><td>lettuce | gb157.2 | DW076507 TÍ</td><td>lettuce</td><td> 2188</td><td> 42</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 842</td><td>lettuce | gb157.2 | DW127617_T1</td><td>lettuce</td><td> 2189</td><td> 42</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 843</td><td>lettuce | gb157.2 | AJ937963_T1</td><td>lettuce</td><td> 2190</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 844</td><td>lettuce | gb157.2 | DW049421_T1</td><td>lettuce</td><td> 2191</td><td> 42</td><td> 83</td><td> 92.8315412</td><td>98.501872 J.</td><td>blastp</td>

<td> 845</td><td>lettuce | gb157.2] DW114305_T1</td><td>lettuce</td><td> 2192</td><td> 42</td><td> 87</td><td> 99.2831541</td><td> 98.947368 4</td><td>blastp</td>

<td> 846</td><td>lettuce | gb157.2 | DW053722 T1</td><td>lettuce</td><td> 2193</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 847</td><td>lettuce | gb157.2 | DW146178 T1</td><td>lettuce</td><td> 2194</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 848</td><td>lettuce | gb157.2 | DW077710 T1</td><td>lettuce</td><td> 2195</td><td> 42</td><td> 85</td><td> 99.2831541</td><td> 98.596491 2</td><td>blastp</td>

<td> 849</td><td>lettuce | gb157.2 | DW070566__T1</td><td>lettuce</td><td> 2196</td><td> 42</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 850</td><td>lettuce | gb157.2 | DW093078 T1</td><td>lettuce</td><td> 2197</td><td> 42</td><td> 85</td><td> 94.9820789</td><td> 100</td><td>blastp</td>

<td> 851</td><td>lettuce | gb157.2 | DW074446_T1</td><td>lettuce</td><td> 2198</td><td> 42</td><td> 84</td><td> 97.4910394</td><td>96.167247 J</td><td>blastp</td>

<td> 852</td><td>lettuce | gb157.2 | DW153482_T1</td><td>lettuce</td><td> 2199</td><td> 42</td><td> 83</td><td> 99.6415771</td><td> 98.939929 3</td><td>blastp</td>

<td> 853</td><td>lettuce | gb157.2 | DW080306 T1</td><td>lettuce</td><td> 2200</td><td> 42</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 854</td><td>lettuce | gb157.2 | DW043674 T1</td><td>lettuce</td><td> 2201</td><td> 42</td><td> 84</td><td> 99.6415771</td><td> 98.939929 3</td><td>blastp</td>

<td> 855</td><td>lettuce [gb157.2] DW095979 T1</td><td>lettuce</td><td> 2202</td><td> 42</td><td> 83</td><td> 97.1326165</td><td> 98.555956 7</td><td>blastp</td>

<td> 856</td><td>lettuce | gb157.2 | DW077206 T1</td><td>lettuce</td><td> 2203</td><td> 42</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 857</td><td>lettuce | gb157.2 | DW047573 T1</td><td>lettuce</td><td> 2204</td><td> 42</td><td> 86</td><td> 98.9247312</td><td>99.645390 J</td><td>blastp</td>

94/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SEQ No.</td><td>Hom. From ID</td><td>% Idenf</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 858</td><td>lettuce | gb157.2 | DW096304_T1</td><td>lettuce</td><td> 2205</td><td> 42</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 859</td><td>lettuce | gb157.2 | DW075191_T1</td><td>lettuce</td><td> 2206</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 860</td><td>lotus | gb157.2 | AI967757_T1</td><td>lotus</td><td> 2207</td><td> 42</td><td> 85</td><td> 99.6415771</td><td> 98.954703 8</td><td>blastp</td>

<td> 861</td><td>lotus | gb157.2 | AI967387_T2</td><td>lotus</td><td> 2208</td><td> 42</td><td> 80</td><td> 99.6415771</td><td> 99.651567 9</td><td>blastp</td>

<td> 862</td><td>lotus | gb157.2 | BG662315_T1</td><td>lotus</td><td> 2209</td><td> 42</td><td> 82</td><td> 99.6415771</td><td> 98.961937 7</td><td>blastp</td>

<td> 863</td><td>maize | gb164 | BE552783_T1</td><td>corn</td><td> 2210</td><td> 42</td><td> 80</td><td> 97.4910394</td><td> 95.890411</td><td>blastp</td>

<td> 864</td><td>maize | gb164 | AI622334_T1</td><td>corn</td><td> 2211</td><td> 42</td><td> 83</td><td> 97.4910394</td><td> 95.862069</td><td>blastp</td>

<td> 865</td><td>maize | gb164 | AI855280_T1</td><td>corn</td><td> 2212</td><td> 42</td><td> 81</td><td> 96.7741935</td><td> 95.155709 3</td><td>blastp</td>

<td> 866</td><td>medicago | gb157.2 | AW981259 T1</td><td>medicago</td><td> 2213</td><td> 42</td><td> 80</td><td> 100</td><td> 99.303135 9</td><td>blastp</td>

<td> 867------</td><td>medicago | gb157.2 | AA660788_T1 .....</td><td>medicago</td><td> 2214</td><td> 42</td><td> 83</td><td> 99:6415771-</td><td> .98.954703 .. 8</td><td>blastp</td>

<td> 868</td><td>melon | gb165 | DV631824_T1</td><td>melon</td><td> 2215</td><td> 42</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 869</td><td>melon | gb165 | DV633977_T1</td><td>melon</td><td> 2216</td><td> 42</td><td> 83</td><td> 64.516129</td><td> 100</td><td>blastp</td>

<td> 870</td><td>melon | gb165 | AM720039_T1</td><td>melon</td><td> 2217</td><td> 42</td><td> 81</td><td> 86.0215054</td><td> 100</td><td>blastp</td>

<td> 871</td><td>nicotiana_benthamiana | gb162 | CN743200_T1</td><td>Henthamian nicotian</td><td> 2218</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 872</td><td>nicotiana_benthamiana | gb162 | CK294539_T1</td><td>Henthamian nicotian</td><td> 2219</td><td> 42</td><td> 80</td><td> 98.2078853</td><td> 96.864111 5</td><td>blastp</td>

<td> 873</td><td>onion | gb162 | AF255795_T1</td><td>onion</td><td> 2220</td><td> 42</td><td> 82</td><td> 97.1326165</td><td> 95.532646</td><td>blastp</td>

<td> 874</td><td>onion | gb162 | CF434704_T1</td><td>onion</td><td> 2221</td><td> 42</td><td> 80</td><td> 99.2831541</td><td> 99.295774 6</td><td>blastp</td>

<td> 875</td><td>papãya | gb165 | EL784273_T1</td><td>papaya</td><td> 2222</td><td> 42</td><td> 82</td><td> 82.078853</td><td> 97.520661 2</td><td>blastp</td>

<td> 876</td><td>papaya | gb165 | AM904340_T1</td><td>papaya</td><td> 2223</td><td> 42</td><td> 84</td><td> 100</td><td> 99.288256 2</td><td>blastp</td>

<td> 877</td><td>peach | gb157.2 | AF367458_T1</td><td>peach</td><td> 2224</td><td> 42</td><td> 84</td><td> 87.0967742</td><td> 100</td><td>blastp</td>

<td> 878</td><td>peach | gb157.2 | BU040116_T1</td><td>peach</td><td> 2225</td><td> 42</td><td> 83</td><td> 99.6415771</td><td> 98.954703 8</td><td>blastp</td>

<td> 879</td><td>peach | gb157.2 | AF367460_T1</td><td>peach</td><td> 2226</td><td> 42</td><td> 86</td><td> 87.0967742</td><td> 100</td><td>blastp</td>

<td> 880</td><td>peanut | gb161 | CD037924_T1</td><td>peanut</td><td> 2227</td><td> 42</td><td> 86</td><td> 99.6415771</td><td> 98.954703 8</td><td>blastp</td>

<td> 881</td><td>peanut | gb161 | CDO38296_T1</td><td>peanut</td><td> 2228</td><td> 42</td><td> 85</td><td> 99.6415771</td><td> 98.954703 8</td><td>blastp</td>

<td> 882</td><td>peanut | gb161 | CD037924_T2</td><td>peanut</td><td> 2229</td><td> 42</td><td> 86</td><td> 99.6415771</td><td>98.954703 J</td><td>blastp</td>

<td> 883</td><td>peanut | gb161 | CDO37884_T1</td><td>peanut</td><td> 2230</td><td> 42</td><td> 88</td><td> 51.2544803</td><td> 97.945205 _</td><td>blastp</td>

<td> 884</td><td>pepperfgb 157.2 | BM061612 T1</td><td>chili</td><td> 2231</td><td> 42</td><td> 96</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 885</td><td>pepper | gb157.2 | BM061611 T1</td><td>chili</td><td> 2232</td><td> 42</td><td> 97</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 886</td><td>pepper | gb 157.2 | BM061005 T1</td><td>chili</td><td> 2233</td><td> 42</td><td> 81</td><td> 92.4731183</td><td> 97.397769 5</td><td>blastp</td>

<td> 887</td><td>petuniA | gb157.2 | AF452014 T1</td><td>petunia</td><td> 2234</td><td> 42</td><td> 83</td><td> 97.4910394</td><td> 98.233215 5</td><td>blastp</td>

<td> 888</td><td>petunia | gb157.2 | CV295523 T1</td><td>petunia</td><td> 2235</td><td> 42</td><td> 95</td><td> 53.046595</td><td> 93.670886 1</td><td>blastp</td>

<td> 889</td><td>petunia | gb157.2 | CV293001_T1</td><td>petunia</td><td> 2236</td><td> 42</td><td> 83</td><td> 55.5555556</td><td> 100</td><td>blastp</td>

<td> 890</td><td>pine | gb157.2 | AI813221_T1</td><td>Pine</td><td> 2237</td><td> 42</td><td> 81</td><td> 96.0573477</td><td> 94.326241 1</td><td>blastp</td>

<td> 891</td><td>pine | gb157.2 | CA844411 T1</td><td>Pine</td><td> 2238</td><td> 42</td><td> 81</td><td> 56.6308244</td><td> 98.75</td><td>blastp</td>

<td> 892</td><td>popla r | g b157.2 | B 1130501 T3</td><td>poplar</td><td> 2239</td><td> 42</td><td> 85</td><td> 100</td><td> 99.298245 6</td><td>blastp</td>

<td> 893</td><td>poplar [gb157.2 | AI165755 T1</td><td>poplar</td><td> 2240</td><td> 42</td><td> 86</td><td> 99.6415771</td><td> 98.947368 4</td><td>blastp</td>

<td> 894</td><td>poplar | gb157.2 | BU835712 T1</td><td>poplar</td><td> 2241</td><td> 42</td><td> 85</td><td> 99.6415771</td><td> 98.947368 4</td><td>blastp</td>

<td> 895</td><td>popla r | gb157.2 | BI130501 T1</td><td>poplar</td><td> 2242</td><td> 42</td><td> 85</td><td> 100</td><td> 99.298245 6</td><td>blastp</td>

95/175

<td>Polinuc ID SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N ° ·</td><td>Hom. From ID</td><td>% Idnnt</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 896</td><td>poplar | gb157.2 | BI130501_T4</td><td>poplar</td><td> 2243</td><td> 42</td><td> 85</td><td> 100</td><td> 99.298245 6</td><td>blastp</td>

<td> 897</td><td>poplar | gb157.2 | AI162288_T1</td><td>poplar</td><td> 2244</td><td> 42</td><td> 86</td><td> 99.2831541</td><td> 98.596491 2</td><td>blastp</td>

<td> 898</td><td>poplar | gb157.2 | AJ534524_T1</td><td>poplar</td><td> 2245</td><td> 42</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 899</td><td>potato | gb157.2 | BG096672_T1</td><td>potato</td><td> 2245</td><td> 42</td><td> 96</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 900</td><td>potato | gb157.2 | BM109370_T1</td><td>potato</td><td> 2247</td><td> 42</td><td> 80</td><td> 98.2078853</td><td> 96.864111 5</td><td>blastp</td>

<td> 901</td><td>potato | gb157.2 | BG589618_T1</td><td>potato</td><td> 2248</td><td> 42</td><td> 80</td><td> 98.2078853</td><td> 96.864111 5</td><td>blastp</td>

<td> 902</td><td>potato | gb157.2 | CK261080_T1</td><td>potato</td><td> 2249</td><td> 42</td><td> 83</td><td> 70.2508961</td><td> 100</td><td>blastp</td>

<td> 903</td><td>potato | gb157.2 | BG098124_T1</td><td>potato</td><td> 2250</td><td> 42</td><td> 97</td><td> 99.2831541</td><td> 100</td><td>blastp</td>

<td> 904</td><td>potato | gb157.2 | BI406400_T1</td><td>potato</td><td> 2251</td><td> 42</td><td> 80</td><td> 98.2078853</td><td> 96.864111 5</td><td>blastp</td>

<td> 905</td><td>potato | gb157_I2 | BE920139_T1</td><td>potato ·--··-</td><td> -2252 -- -</td><td> 42</td><td> 90 -</td><td> 100 -</td><td> 100 ’ ··</td><td>blastp</td>

<td> 906</td><td>potato | gb157.2 | BM112017_T1</td><td>potato</td><td> 2253</td><td> 42</td><td> 80</td><td> 98.2078853</td><td> 96.864111. 5</td><td>blastp</td>

<td> 907</td><td>potato | gb157.2 | BE921679_T1</td><td>potato</td><td> 2254</td><td> 42</td><td> 96</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 908</td><td>potato | gb157.2 | BG600158_T1</td><td>potato</td><td> 2255</td><td> 42</td><td> 80</td><td> 98.2078853</td><td> 96.864111 5</td><td>blastp</td>

<td> 909</td><td>potato | gb157.2 | B1406047_T1</td><td>potato</td><td> 2256</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 910</td><td>potato | gb157.2 | CK719282_T1</td><td>potato</td><td> 2257</td><td> 42</td><td> 80</td><td> 98.2078853</td><td> 96.864111 5</td><td>blastp</td>

<td> 911</td><td>radish | gb164 | EV545956_T1</td><td>radish</td><td> 2258</td><td> 42</td><td> 81</td><td> 100</td><td> 99.298245 6</td><td>blastp</td>

<td> '912</td><td>radish | gb164 | EX904869_T1</td><td>radish</td><td> 2259</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 913 </td><td>radish | gb164 | EV545247_T1</td><td>radish</td><td> 2260</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 914</td><td>radish | gb164 | EX756889_T1</td><td>radish</td><td> 2261</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 915</td><td>radish | gb164 | EV539533_T1</td><td>radish</td><td> 2262</td><td> 42</td><td> 81</td><td> 100</td><td> 99.303135 9</td><td>blastp</td>

<td> 916</td><td>radish | gb164 | EV546186_T1</td><td>radish</td><td> 2263</td><td> .42</td><td> 82</td><td> 55.5555556</td><td> 95.679012 3</td><td>blastp</td>

<td> 917</td><td>radish | gb164 | AB012045_T1</td><td>radish</td><td> 2264</td><td> 42</td><td> 81</td><td> 100</td><td> 99.303135 9</td><td>blastp</td>

<td> 918</td><td>radish | gb164 | EV573001_T1</td><td>radish</td><td> 2265</td><td> 42</td><td> 83</td><td> 62.0071685</td><td> 98.857142 9</td><td>blastp</td>

<td> 919</td><td>radish | gb164 | AB030698_T1</td><td>radish</td><td> 2266</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 920</td><td>radish | gb164 | EX749049_T1</td><td>radish</td><td> 2267</td><td> 42</td><td> 83</td><td> 78.4946237</td><td> 100</td><td>blastp</td>

<td> 921</td><td>radish | gb164 | AB030697_T1</td><td>radish</td><td> 2268</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 922</td><td>radish | gb164 | EW735060_T1</td><td>radish</td><td> 2269</td><td> 42</td><td> 80</td><td> 96.4157706</td><td> 95.454545 5</td><td>blastp</td>

<td> 923</td><td>radish | gb164 | FD936119_T1</td><td>radish</td><td> 2270</td><td> 42</td><td> 83</td><td> 50.5376344</td><td> 100</td><td>blastp</td>

<td> 924</td><td>radish | gb164 | EV543747_T1</td><td>radish</td><td> 2271</td><td> 42</td><td> 81</td><td> 100</td><td> 99 303135 9</td><td>blastp</td>

<td> 925</td><td>rice] gb157.2 | BE040651_T2</td><td>rice</td><td> 2272</td><td> 42</td><td> 80</td><td> 86.7383513</td><td> 94.382022 5</td><td>blastp</td>

<td> 926</td><td>rice | gb157.2 | BE040651_T1</td><td>rice</td><td> 2273</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 927</td><td>rice | gb157.2 | AA754435_T5</td><td>rice</td><td> 2274</td><td> 42</td><td> 80</td><td> 85.6630824</td><td> 87.719298 2</td><td>blastp</td>

<td> 928</td><td>rice | gb157.2 | AA754435_T1</td><td>rice</td><td> 2275</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 929</td><td>rose | gb157.2 | BI977420_T1</td><td>rose</td><td> 2276</td><td> 42</td><td> 84</td><td> 69.8924731</td><td> 91.627907</td><td>blastp</td>

<td> 930</td><td>rose | gb157.2 [BI977750_T1</td><td>rose</td><td> 2277</td><td> 42</td><td> 84</td><td> 77.7777778</td><td> 100</td><td>blastp</td>

<td> 931</td><td>rose | gb157.2 | BI978110_T1</td><td>rose</td><td> 2278</td><td> 42</td><td> 83</td><td> 64.516129</td><td> 98.378378 4</td><td>blastp</td>

<td> 932</td><td>safflower | gb162 | EL406648_T1</td><td>safflower</td><td> 2279</td><td> 42</td><td> 81</td><td> 98.5663082</td><td> 100</td><td>blastp</td>

<td> 933</td><td>safílower | gb 162 | EL411110 T1</td><td>safflower</td><td> 2280</td><td> 42</td><td> 86</td><td> 92.4731183</td><td> 97 761194</td><td>blastp</td>

96/175

<td>Polinuc ID SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SEON:</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 934</td><td>safflower | gb162 | EM01452_T1</td><td>safflower</td><td> 2281</td><td> 42</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 935</td><td>safflower | gb162 | EM02424_T1</td><td>safflower</td><td> 2282</td><td> 42</td><td> 83 '</td><td> 97.1326165</td><td> 100</td><td>blastp</td>

<td> 936</td><td>safflower | gb162 | EM00227_T1</td><td>safflower</td><td> 2283</td><td> 42</td><td> 85</td><td> 86.7383513</td><td> 67.919340 1</td><td>tblastn</td>

<td> 937</td><td>sorghum | gb161, xeno | AI622334_T 1</td><td>sorghum</td><td> 2284</td><td> 42</td><td> 83</td><td> 97.4910394</td><td> 95.862069</td><td>blastp</td>

<td> 938</td><td>soybean | gb166 | CD393286_T1</td><td>Soy</td><td> 2285</td><td> 42</td><td> 80</td><td> 99.6415771</td><td> 99.651567 9</td><td>blastp</td>

<td> 939</td><td>soybean | g b166 | GMU27347_T1</td><td>Soy</td><td> 2286</td><td> 42</td><td> 86</td><td> 99.6415771</td><td> 98.947368 4</td><td>blastp</td>

<td> 940</td><td>soybean | gb166 | AW349289_T1</td><td>Soy</td><td> 2287</td><td> 42</td><td> 85</td><td> 99.6415771</td><td> 98.947368 4</td><td>blastp</td>

<td> 941</td><td>soybean | gb166 | BE823946_T1</td><td>Soy</td><td> 2288</td><td> 42</td><td> 87</td><td> 99.6415771</td><td> 98.943662</td><td>blastp</td>

<td> 942</td><td>soybean | g b1661B E352729_T2</td><td>Soy</td><td> 2289</td><td> 42</td><td> 80</td><td> 56.2724014</td><td> 100</td><td>blastp</td>

<td> 943 - '</td><td>soybean | gbt66 | AW350475_TT ........</td><td>Soy</td><td> 2290</td><td> 42</td><td> 85 </td><td> '99.6415771</td><td> 98.954703 8</td><td>blastp</td>

<td> 944</td><td>soybean | gb166 | BI119558_T1</td><td>Soy</td><td> 2291</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 945</td><td>soybean | gb166 | AW349392_T1</td><td>Soy</td><td> 2292</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 946</td><td>spruce | gb162 | AF051202_T1</td><td>fir</td><td> 2293</td><td> 42</td><td> 81</td><td> 96.0573477</td><td> 94.326241 1</td><td>blastp</td>

<td> 947</td><td>spruce | gb162 | CO227554_T1</td><td>fir</td><td> 2294</td><td> 42</td><td> 80</td><td> 96.0573477</td><td> 93.661971 8</td><td>blastp</td>

<td> 948</td><td>spruce | gb162 | CO220480_T1</td><td>fir</td><td> 2295</td><td> 42</td><td> 80</td><td> 96.4157706</td><td>94.680851 J</td><td>blastp</td>

<td> 949</td><td>spruce | gb162 | CO217151_T1</td><td>fir</td><td> 2296</td><td> 42</td><td> 80</td><td> 96.0573477</td><td> 94.326241 1</td><td>blastp</td>

<td> 950</td><td>spurge | gb161 | AW990929_T1</td><td>euphorbia</td><td> 2297</td><td> 42</td><td> 80</td><td> 59.8566308</td><td> 91.534391 5</td><td>blastp</td>

<td> 951</td><td>spunge | gb161 | BG354126_T1</td><td>euphorbia</td><td> 2298</td><td> 42</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 952</td><td>spurge | gb161 | DV125176_T1</td><td>euphorbia</td><td> 2299</td><td> 42</td><td> 87</td><td> 83.5125448</td><td> 99.578059 1</td><td>blastp</td>

<td> 953</td><td>strawberry | gb164 | DV438166_T1</td><td>Strawberry</td><td> 2300</td><td> 42</td><td> 85</td><td> 99.6415771</td><td> 98.947368 4</td><td>blastp</td>

<td> 954</td><td>strawberry | gb164 | EX665494_T 1</td><td>Strawberry</td><td> 2301</td><td> 42</td><td> 86</td><td> 100</td><td> 99.295774 6</td><td>blastp</td>

<td> 955</td><td>strawberry | gb164 | CO817390_T 1</td><td>Strawberry</td><td> 2302</td><td> 42</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 956</td><td>sugarcane | gb157.2 | B Q536871_T2</td><td>sugar cane</td><td> 2303</td><td> 42</td><td> 85</td><td> 70.2508961</td><td> 100</td><td>blastp</td>

<td> 957</td><td>sugarcane | gb157.2 | BU103568_T1</td><td>sugar cane</td><td> 2304</td><td> 42</td><td> 83</td><td> 97.4910394</td><td> 92.666666 7</td><td>blastp</td>

<td> 958</td><td>sugarcane | gb157.2 | BQ536871 T1</td><td>sugar cane</td><td> 2305</td><td> 42</td><td> 81</td><td> 97.4910394</td><td> 95.862069</td><td>blastp</td>

<td> 959</td><td>sugarcane | gb157.2 | BQ535332 T 1</td><td>sugar cane</td><td> 2306</td><td> 42</td><td> 84</td><td> 97.4910394</td><td> 95.862069</td><td>blastp</td>

<td> 950</td><td>sunflower | gb162 | CD849689 T1</td><td>sunflower</td><td> 2307</td><td> 42</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 951</td><td>sunflower | gb162 | CD849494 T1</td><td>sunflower</td><td> 2308</td><td> 42</td><td> 83</td><td> 94.9820789</td><td>95.070422 Δ</td><td>blastp</td>

<td> 962</td><td>sunflower | gb162 | CF091932 T1</td><td>sunflower</td><td> 2309</td><td> 42</td><td> 81</td><td> 83.5125448</td><td> 98.75</td><td>blastp</td>

<td> 963</td><td>sunflower | gb162 | DY915644 T1</td><td>sunflower</td><td> 2310</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 964</td><td>sunflower | gb162 | EL462160 T1</td><td>sunflower</td><td> 2311</td><td> 42</td><td> 81</td><td> 78.4946237</td><td> 88.844621 5</td><td>blastp</td>

<td> 965</td><td>sunflower | gb162 | DY918039 T1</td><td>sunflower</td><td> 2312</td><td> 42</td><td> 87</td><td> 95.6989247</td><td> 100</td><td>blastp</td>

<td> 966</td><td>sunflower | gb162 | DY951506 T1</td><td>sunflower</td><td> 2313</td><td> 42</td><td> 87</td><td> 89.961577</td><td> 95.522388 1</td><td>blastp</td>

<td> 967</td><td>sunflower | gb162 | DY933519 T1</td><td>sunflower</td><td> 2314</td><td> 42</td><td> 84</td><td> 99.6415771</td><td> 98.947368 4</td><td>blastp</td>

<td> 968</td><td>sunflower | gb162 | DY917102 T1</td><td>sunflower</td><td> 2315</td><td> 42</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 969</td><td>sunflower | gb162 | DY932916 T1</td><td>sunflower</td><td> 2316</td><td> 42</td><td> 86</td><td> 58.0645161</td><td> 100</td><td>blastp</td>

<td> 970</td><td>sunflower | gb162 | CD857425 T1</td><td>sunflower</td><td> 2317</td><td> 42</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 971</td><td>sunflower | gb162 | CD846314 T1</td><td>sunflower</td><td> 2318</td><td> 42</td><td> 85</td><td> 53.4050179</td><td> 97.468354 4</td><td>blastp</td>

97/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO.N⁰:</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 972</td><td>sunflower | gb162 | CX944368_T1</td><td>sunflower</td><td> 2319</td><td> 42</td><td> 88</td><td> 68.1003584</td><td> 89.622641 5</td><td>blastp</td>

<td> 973</td><td>sunflower | gb162 | DY908592 T1</td><td>sunflower</td><td> 2320</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 974</td><td>swi tchg rass | gb 165 | D N141399_T 1</td><td>switchgrass</td><td> 2321</td><td> 42</td><td> 81</td><td> 96.7741935</td><td> 98.920863 3</td><td>blastp</td>

<td> 975</td><td>switchgrass | gb165 | FE621421_T1</td><td>switchgrass</td><td> 2322</td><td> 42</td><td> 86</td><td> 51.9713262</td><td> 99.315068 5</td><td>blastp</td>

<td> 976</td><td>switchgrass | gb165 | DN 145656_T 1</td><td>switchgrass</td><td> 2323</td><td> 42</td><td> 83</td><td> 97.4910394</td><td> 95.862069</td><td>blastp</td>

<td> 977</td><td>switchgrass | g b165 | FE637674_T 1</td><td>switchgrass</td><td> 2324</td><td> 42</td><td> 81</td><td> 82.437276</td><td> 100</td><td>blastp</td>

<td> 978</td><td>swrtchgrass | gb165 | DN141334_T1</td><td>switchgrass</td><td> 2325</td><td> 42</td><td> 83</td><td> 77.0609319</td><td> 94.849785 4</td><td>blastp</td>

<td> 979</td><td>switchgrass | gb165 | FE621578_T1</td><td>switchgrass</td><td> 2326</td><td> 42</td><td> 83</td><td> 85.6630824</td><td> 100</td><td>blastp</td>

<td> 980</td><td>thellungiella | gb157.2 | DN775526_T1</td><td>thellungiella</td><td> 2327</td><td> 42</td><td> 81</td><td> 72.4014337</td><td> 100</td><td>blastp</td>

<td> 981 -</td><td>tobacco | gb162 | CK720599_T1- - -</td><td>Tobacco ·</td><td> 2328 ' -</td><td> '42'</td><td> '95'</td><td> 100 ~</td><td> 100</td><td>'blastp</td>

<td> 982</td><td>tobacco | gb162 | CK720599_T2</td><td>tobacco</td><td> 2329</td><td> 42</td><td> 94</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 983</td><td>tobacco | gb162 | EB445427_T1</td><td>tobacco</td><td> 2330</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 984</td><td>tobacco | gb162 | EB443112_T1</td><td>tobacco</td><td> 2331</td><td> 42</td><td> 89</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 985</td><td>tobacco | gb162 | AF154641_T1</td><td>tobacco</td><td> 2332</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 986</td><td>tobacco | gb162 | EB425288_T1</td><td>tobacco</td><td> 2333</td><td> 42</td><td> 94</td><td> 98.2078853</td><td> 100</td><td>blastp</td>

<td> 987</td><td>tomato | gb164 | BG123951_T2</td><td>tomato</td><td> 2334</td><td> 42</td><td> 81</td><td> 92.8315412</td><td> 97.407407 4</td><td>blastp</td>

<td> 988</td><td>tomato | gb164 | BG123951_T1</td><td>tomato</td><td> 2335</td><td> 42</td><td> 80</td><td> 98.2078853</td><td> 96.864111 5</td><td>blastp</td>

<td> 989</td><td>tomato | gb164 | BG713781_T1</td><td>tomato</td><td> 2336</td><td> 42</td><td> 92</td><td> 53.4050179</td><td> 98.051948 1</td><td>blastp</td>

<td> 990</td><td>tomato | gb164 | AW219533_T1</td><td>tomato</td><td> 2337</td><td> 42</td><td> 81</td><td> 97.1326165</td><td> 98.214285 7</td><td>blastp</td>

<td> 991</td><td>triphysaria | gb164 | DR170852_T 1</td><td>triphysaria</td><td> 2338</td><td> 42</td><td> 88</td><td> 99.2831541</td><td> 99.285714 3</td><td>blastp</td>

<td> 992</td><td>triphysaria | gb 164 | BM356582 „T 1</td><td>triphysaria</td><td> 2339</td><td> 42</td><td> 88</td><td> 64.874552</td><td> 100</td><td>blastp</td>

<td> 993</td><td>triphysaria | gb164 | BE574767_T1</td><td>triphysaria</td><td> 2340</td><td> 42</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 994</td><td>wheat | gb164 | BE444481_T1</td><td>wheat</td><td> 2341</td><td> 42</td><td> 82</td><td> 55.5555556</td><td> 100</td><td>blastp</td>

<td> 995</td><td>wheat | gb164 | BE398316_T1</td><td>wheat</td><td> 2342</td><td> 42</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 996</td><td>wheat | gb164 | BE404002_T1</td><td>wheat</td><td> 2343</td><td> 42</td><td> 82</td><td> 51.6129032</td><td> 99.305555 6</td><td>blastp</td>

<td> 997</td><td>apple | gb157.3 | CN892655_T1</td><td>Apple</td><td> 2344</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 998</td><td>apple | gb157.3 | AU223658_T1</td><td>Apple</td><td> 2345</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 999</td><td>columbine | gb157.3 | DR914359 T1</td><td>columbine</td><td> 2346</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1000</td><td>arabidopsis | gb165 | AT2G16850 T1</td><td>arabidopsis</td><td> 2347</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1001</td><td>a rabidopsis | g b165 | AT4G35100 T 1</td><td>arabidopsis</td><td> 2348</td><td> 43</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1002</td><td>avocado | gb164 | CK753629 T1</td><td>avocado</td><td> 2349</td><td> 43</td><td> 85</td><td> 66.4310954</td><td> 92.610837 4</td><td>blastp</td>

<td> 1003</td><td>avocado | gb164 | CK752541 T1</td><td>avocado</td><td> 2350</td><td> 43</td><td> 84</td><td> 621.908127</td><td> 100</td><td>blastp</td>

<td> 1004</td><td>bjuncea | gb164 | EVGN01060535361904 T1</td><td>bjuncea</td><td> 2351</td><td> 43</td><td> 86</td><td> 67.1378092</td><td> 100</td><td>blastp</td>

<td> 1005</td><td>bjuncea | gb164 | EVGN00138211060167_T1</td><td>bjuncea</td><td> 2352</td><td> 43</td><td> 86</td><td> 85.1590106</td><td> 100</td><td>blastp</td>

<td> 1006</td><td>bJuncea | gb164 | EVGN01177009332048 T1</td><td>bjuncea</td><td> 2353</td><td> 43</td><td> 86</td><td> 66.0777385</td><td> 100</td><td>blastp</td>

<td> 1007</td><td>bJuncea | gb164 | EVGN00071418640425 T1</td><td>bjuncea</td><td> 2354</td><td> 43</td><td> 86</td><td> 90.459364</td><td> 100</td><td>blastp</td>

<td> 1008</td><td>bJuncea | gb164 | EVGN01391814101746 T1</td><td>bjuncea</td><td> 2355</td><td> 43</td><td> 92</td><td> 53.0035336</td><td> 100</td><td>blastp</td>

<td> 1009</td><td>bjunceajgbl 64 | E VGN00206114600060 T 1</td><td>bjuncea</td><td> 2356</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

98/175

<td>Polinuc ID .SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFQ N '·</td><td>Hom. From ID</td><td>% Ident</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 1010</td><td>b_oleracea | gb161 | AF314656_T1</td><td>b_oleracea</td><td> 2357</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1011</td><td>b_oleracea | gb161 | DY029187_T1</td><td>b_oleracea</td><td> 2358</td><td> 43</td><td> 86</td><td> 100 </td><td> 100</td><td>blastp</td>

<td> 1012</td><td>b_oleracea | gb161 | DY014978_T1</td><td>b_oleracea</td><td> 2359</td><td> 43</td><td> 87</td><td> 54.770318</td><td> 100</td><td>blastp</td>

<td> 1013</td><td>b_rapa | gb162 | BQ791230_T1</td><td>b_rapa</td><td> 2360</td><td> 43</td><td> 86</td><td> 77.0318021</td><td> 97.737556 6</td><td>blastp</td>

<td> 1014</td><td>b_rapa | gb162 | EX033370_T1</td><td>b_rapa</td><td> 2361</td><td> 43</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1015</td><td>b_rapa | gb162] CV432651_T1</td><td>b_rapa</td><td> 2362</td><td> 43</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1016</td><td>b_rapa | gb162 | BG543906_T1</td><td>b_rapa</td><td> 2363</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1017</td><td>bean | gb164 | CB539790_T1</td><td>bean</td><td> 2364</td><td> 43</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1018</td><td>beet | gb162 | BVU60148_T1</td><td>beet</td><td> 2365</td><td> 43</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1019 ..</td><td>canola | gb1 &amp; l | DY007064_i.1 .............. '</td><td>canola -</td><td> 2366.....</td><td> 43 -</td><td> 86</td><td> 100- ‘ -</td><td> 100</td><td>blastp- - -</td>

<td> 1020</td><td>canola | gb161 | CD815284_T1 -</td><td>canola</td><td> 2367</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1021</td><td>canola | gb161 | CD817684_T1</td><td>canola</td><td> 2368</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1022</td><td>canola | gb161 | CD821191_T1</td><td>canola</td><td> 2369</td><td> 43</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1023</td><td>canola | gb161 | CD820375_71</td><td>canola</td><td> 2370</td><td> 43</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1024</td><td>cassava | gb164 | BM259748_T1</td><td>manioc</td><td> 2371</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1025</td><td>castorbean | gb160 | AJ605569_T1</td><td>seed of ma mona</td><td> 2372</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1026</td><td>castorbean | gb160 | AJ605569_T2</td><td>seed of castor</td><td> 2373</td><td> 43</td><td> 84</td><td> 69.9646643</td><td> 95.121951 2</td><td>blastp</td>

<td> 1027</td><td>cichorium | gb161IEH704748_T1</td><td>cichorium</td><td> 2374</td><td> 43</td><td> 89</td><td> 67.1378092</td><td> 100</td><td>blastp</td>

<td> 1028</td><td>citrus | gb157.2 | BQ623127_T1</td><td>citrus</td><td> 2375</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1029</td><td>citrus | gb157.2 | CX664964_T1</td><td>citrus</td><td> 2376</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1030</td><td>clover | gb162jBB911260_T1</td><td>clove</td><td> 2377</td><td> 43</td><td> 82</td><td> 54.0636042</td><td> 100</td><td>blastp</td>

<td> 1031</td><td>coffea | gb157.2 | BQ448890_T1</td><td>coffea</td><td> 2378</td><td> 43</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1032</td><td>cotton | gb164 | AI726086_T1</td><td>cotton</td><td> 2379</td><td> 43</td><td> 84</td><td> 97.8798587</td><td> 88.02589</td><td>blastp</td>

<td> 1033</td><td>cotton | gb164 | CO098535_T1</td><td>cotton</td><td> 2380</td><td> 43</td><td> 82</td><td> 92.2261484</td><td> 95.571955 7</td><td>blastp</td>

<td> 1034</td><td>cotton | gb164 | BE051956_T1</td><td>cotton</td><td> 2381</td><td> 43</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1035</td><td>cotton | gb164 | BQ414250_T1</td><td>cotton</td><td> 2382</td><td> 43</td><td> 85</td><td> 59.0106007</td><td> 100</td><td>blastp</td>

<td> 1035</td><td>cotton [gb164 | BF268907_T1</td><td>cotton</td><td> 2383</td><td> 43</td><td> 87</td><td> 90.1060071</td><td> 100</td><td>blastp</td>

<td> 1037</td><td>cotton | gb164 | CO075847_T1</td><td>cotton</td><td> 2384</td><td> 43</td><td> 84</td><td> 62.5441696</td><td> 100</td><td>blastp</td>

<td> 1038</td><td>cotton | gb164 | BQ405584_T1</td><td>cotton</td><td> 2385</td><td> 43</td><td> 82</td><td> 95.4063604</td><td> 95.714285 7</td><td>blastp</td>

<td> 1039</td><td>cotton] gb164 | AI055551_T1</td><td>cotton</td><td> 2386</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1040</td><td>cowpea | gb166FC456786_T1</td><td>black beans</td><td> 2387</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1041</td><td>dandelion | gb161 | DY803814 T1</td><td>dandelion</td><td> 2388</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1042</td><td>ginger | gb164 | DY347270 T1</td><td>ginger</td><td> 2389</td><td> 43</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1043</td><td>ginger | gb164 | DY347296 T1</td><td>ginger</td><td> 2390</td><td> 43</td><td> 84</td><td> 94.6996466</td><td> 92.733564</td><td>blastp</td>

<td> 1044</td><td>ginger | gb164 | DY358056 T1</td><td>ginger</td><td> 2391</td><td> 43</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1045</td><td>ginger | gb164 | DY347277 T1</td><td>ginger</td><td> 2392</td><td> 43</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1046</td><td>ginger | gb164 | DY360032 T1</td><td>ginger</td><td> 2393</td><td> 43</td><td> 81</td><td> 81.9787986</td><td> 93.902439</td><td>blastp</td>

<td> 1047</td><td>grape | gb160 | BM437910 T1</td><td>grape</td><td> 2394</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

99/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N ”·</td><td>Hom. Dp in</td><td>% liffenf</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 1048</td><td>iceplant | gb164 | MCU26538_T1</td><td>crybaby n lanes</td><td> 2395</td><td> 43</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1049</td><td>ipomoea | gb157.2IBJ553491_T 1</td><td>morning glory</td><td> 2396</td><td> 43</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1050</td><td>lettuce [gb157.2 | DW046509_T1</td><td>lettuce</td><td> 2397</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1051</td><td>Iettuce | gb157.2 | DW106553_T1</td><td>lettuce</td><td> 2398</td><td> 43</td><td> 84</td><td> 97.8798587</td><td> 100</td><td>blastp</td>

<td> 1052</td><td>Iettuce | gb157.2] DW 146059_T 1</td><td>lettuce</td><td> 2399</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1053</td><td>lettuce | gb157.2 | DW110223_T1</td><td>lettuce</td><td> 2400</td><td> 43</td><td> 83</td><td> 97.1731449</td><td> 100</td><td>blastp</td>

<td> 1054</td><td>lettuce | gb157.2 | DW079482_T1</td><td>lettuce</td><td> 2401</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1055</td><td>lettuce | gb157.2 | DW094572_T1</td><td>lettuce</td><td> 2402</td><td> 43</td><td> 83</td><td> 97.5265018</td><td> 92.832764 5</td><td>blastp</td>

<td> 1056</td><td>lotus | gb157.2 | AW163949_T1</td><td>lotus</td><td> 2403</td><td> 43</td><td> 85</td><td> 54.4169611</td><td> 93.902439</td><td>blastp</td>

<td> 1057</td><td>lotus | gb157.2 | AI967574_T1</td><td>lotus</td><td> 2404</td><td> 43</td><td> 82</td><td> 98.5865724</td><td> 97.535211 3</td><td>blastp</td>

<td> 1058</td><td>melon | gb165 | DV632217_T1</td><td>melon</td><td> 2405</td><td> '4 3 ’</td><td> 83</td><td> 100</td><td> 100 </td><td>blastp</td>

<td> 1059</td><td>oil_palm | gb166 | CN600073_T1</td><td>oil palm</td><td> 2406</td><td> 43</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1060</td><td>papaya | gb165 | EX227970_T1</td><td>papaya</td><td> 2407</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1061</td><td>peach | gb157.2 | AF367457_T1</td><td>peach</td><td> 2408</td><td> 43</td><td> 85</td><td> 85.1590106</td><td> 99.583333 · 3</td><td>blastp</td>

<td> 1062</td><td>pepper | gb157.2 | BM066074_T1</td><td>chili</td><td> 2409</td><td> 43</td><td> 96</td><td> 67.4911661</td><td> 98.963730 6</td><td>blastp</td>

<td> 1063</td><td>pepper | gb157.2 | CA518686_T1</td><td>chili</td><td> 2410</td><td> 43</td><td> 88</td><td> 53.7102473</td><td> 100</td><td>blastp</td>

<td> 1064</td><td>periwinklejgb164 | AM232518_T1</td><td>myrtle</td><td> 2411</td><td> 43</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1065</td><td>petunia | gb157.2 | AF452013_T1</td><td>petunia</td><td> 2412</td><td> 43</td><td> 89</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1066</td><td>poplar | gb157.2 | A1163573_T1</td><td>poplar</td><td> 2413</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1067</td><td>poplar | gb157.2 | A1162424_T 1</td><td>poplar</td><td> 2414</td><td> 43</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1068</td><td>potato | gb157.2 | BF053675_T1</td><td>potato</td><td> 2415</td><td> 43</td><td> 89</td><td> 83.745583</td><td> 100</td><td>blastp</td>

<td> 1069</td><td>potato | gb157.2 | BF459952_T1</td><td>potato</td><td> 2416</td><td> 43</td><td> 97</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1070</td><td>radish | gb164 | EV526465_T1</td><td>radish</td><td> 2417</td><td> 43</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1071</td><td>radish | gb164 | EV539317_T1</td><td>radish</td><td> 2418</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1072</td><td>radish | gb164 | EV525026_T1</td><td>radish</td><td> 2419</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1073</td><td>rose | gb157.2 | BQ103996_T1</td><td>rose</td><td> 2420</td><td> 43</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1074</td><td>safflower | gb162 (EL372747_T1</td><td>safflower</td><td> 2421</td><td> 43</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1075</td><td>sesame | gb157.2 | BU669158_T1</td><td>Sesame</td><td> 2422</td><td> 43</td><td> 88</td><td> 50.8833922</td><td> 100</td><td>blastp</td>

<td> 1076</td><td>sesame | gb157.2 | BU668646_T1</td><td>Sesame</td><td> 2423</td><td> 43</td><td> 87</td><td> 51.9434629</td><td> 100</td><td>blastp</td>

<td> 1077</td><td>soybean | gb166 | BE823128_T1</td><td>Soy</td><td> 2424</td><td> 43</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1078</td><td>soybean | gb166 | BE3527_6_T 1</td><td>Soy</td><td> 2425</td><td> 43</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1079</td><td>spruce | gb162 | CO217407_T1</td><td>fir</td><td> 2426</td><td> 43</td><td> 80</td><td> 93.2862191</td><td> 93.571428 6</td><td>blastp</td>

<td> 1080</td><td>spurge | gb161 | AW821924_T1</td><td>euphorbia</td><td> 2427</td><td> 43</td><td> 84</td><td> 100</td><td> 97.212543 6</td><td>blastp</td>

<td> 1081</td><td>strawberry | gb164 | CX661107_T1</td><td>Strawberry</td><td> 2428</td><td> 43</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1082</td><td>sunflower || gb162 | CD853582_T1</td><td>sunflower</td><td> 2429</td><td> 43</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1083</td><td>sunflower | gb162 | DY939653_T1</td><td>sunflower</td><td> 2430</td><td> 43</td><td> 80</td><td> 97.1731449</td><td> 97.833935</td><td>blastp</td>

<td> 1084</td><td>sunflowerjgbl 62 | CD849663 T1</td><td>sunflower</td><td> 2431</td><td> 43</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1085</td><td>thellungiella | gb157.2 | DN777165_T1</td><td>thellungiella</td><td> 2432</td><td> 43</td><td> 86</td><td> 72.0848057</td><td>90.582959 S</td><td>blastp</td>

100/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N⁰·</td><td>Hom. From ΙΓ)</td><td> %</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 1086</td><td>tobacco | gb162 | C K720587_T 1</td><td>tobacco</td><td> 2433</td><td> 43</td><td> 90</td><td> 99.6466431</td><td> 100</td><td>blastp</td>

<td> 1087</td><td>tobacco | gb162 | CK720585_T1</td><td>tobacco</td><td> 2434</td><td> 43</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1088</td><td>tobacco | gb162 | CV016422_T1</td><td>tobacco</td><td> 2435</td><td> 43</td><td> 96</td><td> 59.7173145</td><td> 100</td><td>blastp</td>

<td> 1089</td><td>tobacco | gb162 | CK720589_T1</td><td>tobacco</td><td> 2436</td><td> 43</td><td> 94</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1090</td><td>tomato | gb164 | BG124140_T1</td><td>tomato</td><td> 2437</td><td> 43</td><td> 88</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1091</td><td>triphysaría [gb164 | EY018490_T1</td><td>triphysaria</td><td> 2438</td><td> 43</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1092</td><td>triphysaria | gb164 ΙΕΎ007858 — T1</td><td>triphysaria</td><td> 2439</td><td> 43</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1093</td><td>apple | gb157.3 | CN494428_T1</td><td>Apple</td><td> 2440</td><td> 44</td><td> 80</td><td> 79.1390728</td><td> 93.023255 8</td><td>blastp</td>

<td> 1094</td><td>castorbean | gb160 | EG696741_T1</td><td>seed of castor</td><td> 2441</td><td> 44</td><td> 82</td><td> 99.0066225</td><td> 97.727272 7</td><td>blastp</td>

<td> 1095 -</td><td>citrus | gb157.2 | CX074332_T1</td><td>citrus</td><td> 2442</td><td> 44</td><td> 82</td><td> 99.0066225</td><td> 97.697368 4</td><td>blastp</td>

<td> 1096</td><td>citrus | gb157.2 | CX674035_T1</td><td>citrus</td><td> 2443</td><td> 44'</td><td> 80’</td><td> 86.7549669</td><td> 85.808580 9</td><td>blastp</td>

<td> 1097</td><td>cotton | gb164 | DW234737_T1</td><td>cotton</td><td> 2444</td><td> 44</td><td> 80</td><td> 99.6688742</td><td> 98.333333 3</td><td>blastp</td>

<td> 1098</td><td>lettuce | gb157.2 | DW066284_T1</td><td>lettuce</td><td> 2445</td><td> 44</td><td> 80</td><td> 95.0331126</td><td> 100</td><td>blastp</td>

<td> 1099</td><td>petunia | gb157.2 | C V298254_T 1</td><td>petunia</td><td> 2446</td><td> 44</td><td> 84</td><td> 65.8940397</td><td> 100</td><td>blastp</td>

<td> 1100</td><td>potatojgbl57.2 | C V500020_T 1</td><td>potato</td><td> 2447</td><td> 44</td><td> 94</td><td> 72.1854305</td><td> 99.543379</td><td>blastp</td>

<td> 1101</td><td>tobacco | gb162 | EB426672_T1</td><td>tobacco</td><td> 2448</td><td> 44</td><td> 89</td><td> 99.0066225</td><td> 97.689769</td><td>blastp</td>

<td> 1102</td><td>brachypodium | gb161 .xeno | BE415047_T 1</td><td>brachypodium</td><td> 2449</td><td> 46</td><td> 92</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1103</td><td>maize | gb164 | CF244342_T1</td><td>corn</td><td> 2450</td><td> 46</td><td> 90</td><td> 90.7630522</td><td> 100</td><td>blastp</td>

<td> 1104</td><td>maize | gb164 | AF057183_T1</td><td>corn</td><td> 2451</td><td> 46</td><td> 89</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1105</td><td>sorghum | gb161.xeno | AF057183_T1</td><td>sorghum</td><td> 2452</td><td> 46</td><td> 88</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1106</td><td>sugarcane | gb 15 7.21 CA 132045_T 1</td><td>sugar cane</td><td> 2453</td><td> 46</td><td> 89</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1107</td><td>switchgrass | gb165 | FE617713_T1</td><td>switchgrass</td><td> 2454</td><td> 46</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1108</td><td>wheat | gb164 | BE430088_T1</td><td>wheat</td><td> 2455</td><td> 46</td><td> 95</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1109</td><td>apple | gb157.3 | DT001281_T1</td><td>Apple</td><td> 2456</td><td> 47</td><td> 81</td><td> 87.9518072</td><td> 100</td><td>blastp</td>

<td> 1110</td><td>brachypodiumgb161 .xeno | BE402447_T 1</td><td>brachypodium</td><td> 2457</td><td> 47</td><td> 95</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1111</td><td>ginger | gb164 | DY364894_T1</td><td>ginger</td><td> 2458</td><td> 47</td><td> 88</td><td> 64.2570281</td><td> 98.765432 1</td><td>blastp</td>

<td> 1112</td><td>maize | gb164 | AI855402_T 1</td><td>corn</td><td> 2459</td><td> 47</td><td> 89</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1113</td><td>maize | gb164 | AWO17703_T1</td><td>corn</td><td> 2460</td><td> 47</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1114</td><td>onion | gb162 | ACU58207_T1</td><td>onion</td><td> 2461</td><td> 47</td><td> 83</td><td> 99.5983936</td><td> 99.596774 7</td><td>blastp</td>

<td> 1115</td><td>onion | gb162 | CF437464_T1</td><td>onion</td><td> 2462</td><td> 47</td><td> 85</td><td> 95.9839357</td><td> 98.75</td><td>blastp</td>

<td> 1116</td><td>onion | gb162 | CF435351_T1</td><td>onion</td><td> 2463</td><td> 47</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1117</td><td>rice | gb157.2 | AU031632_T1</td><td>rice</td><td> 2464</td><td> 47</td><td> 91</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1118</td><td>rice [gb157.2 | CA756239_T1</td><td>rice</td><td> 2465</td><td> 47</td><td> 87</td><td> 97.5903614</td><td> 31.640625</td><td>blastp</td>

<td> 1119</td><td>sorghum | gb161, xeno | AI855402_T 1</td><td>sorghum</td><td> 2466</td><td> 47</td><td> 89</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1120</td><td>sugarcane | gb157 2 | CA 132045_T2</td><td>sugar cane</td><td> 2467</td><td> 47</td><td> 90</td><td> 99.5983936</td><td> 99.596774 2</td><td>blastp</td>

<td> 1121</td><td>switchgrass | gb165 | FE624217_T1</td><td>switchgrass</td><td> 2468</td><td> 47</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1122</td><td>wheat | gb164 | BE404100 T1</td><td>wheat</td><td> 2469</td><td> 47</td><td> 97</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1123</td><td>fescue | gb161 | DT700572 T1</td><td>fescue</td><td> 2470</td><td> 48</td><td> 94</td><td> 100</td><td> 100</td><td>blastp</td>

101/175

<td>Polinuc ID -SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD I SEO.N⁰·</td><td>Hom. From ID</td><td>% Irlenf</td><td>Ccb. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 1124</td><td>ginger | gt&gt; 164 | DY361836_T1</td><td>ginger</td><td> 2471</td><td> 48</td><td> 80</td><td> 95.1612903</td><td> 96734693 9</td><td>blastp</td>

<td> 1125</td><td>rice | gb157.2 | U37952_T1</td><td>rice</td><td> 2472</td><td> 48</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1126</td><td>rice | gb157.2 | U37952_T3</td><td>rice</td><td> 2473</td><td> 48</td><td> 89</td><td> 51.6129032</td><td> 89.510489 5</td><td>blastp</td>

<td> 1127</td><td>rye | gb164 | BE495605_T1</td><td>rye</td><td> 2474</td><td> 48</td><td> 98</td><td> 80.6451613</td><td> 100</td><td>blastp</td>

<td> 1128</td><td>sorg hu m [g bf 61, xeno | A 1724211_T 1</td><td>sorghum</td><td> 2475</td><td> 48</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1129</td><td>sugarcane | gb157.2 | CA110414.T1</td><td>sugar cane</td><td> 2476</td><td> 48</td><td> 82</td><td> 92.3387097</td><td> 100</td><td>blastp</td>

<td> 1130</td><td>sugarcane | gb157.2 | CA065356_T 1</td><td>sugar cane</td><td> 2477</td><td> 48</td><td> 83</td><td> 90.3225806</td><td> 96.551724 1</td><td>blastp</td>

<td> 1131</td><td>sugarcane | gb 157.2 | C A143208_T 1</td><td>sugar cane</td><td> 2478</td><td> 48</td><td> 83</td><td> 71.3709677</td><td> 95.675675 7</td><td>blastp</td>

<td> 1132</td><td>sugarcane | gb157.2 | CA101765_T1</td><td>sugar cane</td><td> 2479</td><td> 48</td><td> 91</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1133</td><td>sugarcane | gb157.2 | CA133231_T1</td><td>sugar cane</td><td> 2480</td><td> 48</td><td> 90.</td><td> 83.4677419</td><td> 95.833333 3</td><td>blastp</td>

<td> 1134</td><td>switchg rass | g b165 | FE605472_T 1</td><td>switchgrass</td><td> 2481</td><td> 48</td><td> 91</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1135</td><td>wheat | gb164 | BE489764_T1</td><td>wheat</td><td> 2482</td><td> 48</td><td> 95</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1136</td><td>wheat | gb164 | TAU8S763 „T1</td><td>wheat</td><td> 2483</td><td> 48</td><td> 95</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1137</td><td>wheat | gb164 | BE415001_T1</td><td>wheat</td><td> 2484</td><td> 48</td><td> 95</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 1138</td><td>bjuncea | gb164 | EVGN00504508791211 _T1</td><td>bjuncea</td><td> 2485 .</td><td> 50</td><td> 80</td><td> 85.0931677</td><td> 100</td><td>blastp</td>

<td> 1139</td><td>bJuncea | gbt64 | EVGNO1684214261870_T1</td><td>bjuncea</td><td> 2486</td><td> 50</td><td> 84</td><td> 50.931677</td><td> 91.954023</td><td>blastp</td>

<td> 1140</td><td>banana | gb160DN239388_T1</td><td>banana</td><td> 2487</td><td> 50</td><td> 84</td><td> 80.1242236</td><td> 91.970802 9</td><td>blastp</td>

<td> 1141</td><td>bariey | gb157.3 | BF253694_T1</td><td>barley</td><td> 2488</td><td> 50</td><td> 91</td><td> 58.3850932</td><td> 98.969072 2</td><td>blastp</td>

<td> 1142</td><td>ba rley | gb157.3 | BE412959_T3</td><td>barley</td><td> 2489</td><td> 50</td><td> 95</td><td> 100</td><td> 62.692307 7</td><td>blastp</td>

<td> 1143</td><td>bean | gb164 (FD793482_T1</td><td>bean</td><td> 2490</td><td> 50</td><td> 82</td><td> 100</td><td> 91.907514 5</td><td>blastp</td>

<td> 1144</td><td>canola | gb161 | CX193398_T3</td><td>canola</td><td> 2491</td><td> 50</td><td> 83</td><td> 99.378882</td><td> 66.952789 7</td><td>blastp</td>

<td> 1145</td><td>canola | gb161 | EV123336_T1</td><td>canola</td><td> 2492</td><td> 50</td><td> 81</td><td> 52.7950311</td><td> 91.208791 2</td><td>blastp</td>

<td> 1146</td><td>centaurea | gb161 | EL931277_T1</td><td>centaurea</td><td> 2493</td><td> 50</td><td> 81</td><td> 98.136646</td><td> 62.248996</td><td>blastp</td>

<td> 1147</td><td>cichorium | gb161 | DT213939_T1</td><td>cichorium</td><td> 2494</td><td> 50</td><td> 83</td><td> 64.5962733</td><td> 95.327102 8</td><td>blastp</td>

<td> 1148</td><td>fescue | gb161 | DT703843_T1</td><td>fescue</td><td> 2495</td><td> 50</td><td> 99</td><td> 100</td><td> 94.152046 8</td><td>blastp</td>

<td> 1149</td><td>lotus | gb157.2 | BI418499_T1</td><td>lotus</td><td> 2496</td><td> 50</td><td> 86</td><td> 98.136646</td><td> 88.700565</td><td>blastp</td>

<td> 1150</td><td>onion | gb162 | BQ579939_T1</td><td>onion</td><td> 2497</td><td> 50</td><td> 86</td><td> 100</td><td> 57.194244 6</td><td>blastp</td>

<td> 1151</td><td>peach | gb157.2 | BU040795_T1</td><td>peach</td><td> 2498</td><td> 50</td><td> 82</td><td> 98.136646</td><td> 56.204379 6</td><td>blastp</td>

<td> 1152</td><td>peach | gb157.2 | DW351857_T 1</td><td>peach</td><td> 2499</td><td> 50</td><td> 83</td><td> 98.136646</td><td> 91.812865 5</td><td>blastp</td>

<td> 1153</td><td>rye | gb164 | BF429463_T1</td><td>rye</td><td> 2500</td><td> 50</td><td> 88</td><td> 93.1677019</td><td> 100</td><td>blastp</td>

<td> 1154</td><td>soybean | gb166 | BE352747_T4</td><td>Soy</td><td> 2501</td><td> 50</td><td> 81</td><td> 98.136646</td><td> 70.720720 7</td><td>blastp</td>

<td> 1155</td><td>sug rcane | gb 157.2 [C A194640_T 1</td><td>sugar cane</td><td> 2502</td><td> 50</td><td> 81</td><td> 98.136646</td><td> 56.678700 4</td><td>blastp</td>

<td> 1156</td><td>sugarcane | gb157.2 | CA103332_T1</td><td>sugar cane</td><td> 2503</td><td> 50</td><td> 84</td><td> 96.2732919</td><td> 87.005649 7</td><td>blastp</td>

<td> 1157</td><td>sugarcane | gb157.2 | CA167616 T1</td><td>sugar cane</td><td> 2504</td><td> 50</td><td> 82</td><td> 93.7888199</td><td> 74.257425 7</td><td>blastp</td>

<td> 1158</td><td>sugarcane | gb157.2 | CA103740_T 1</td><td>sugar cane</td><td> 2505</td><td> 50</td><td> 90</td><td> 100</td><td> 68.534482 8</td><td>blastp</td>

<td> 1159</td><td>sugarcane | gb157.2 | CA184547 T1</td><td>sugar cane</td><td> 2506</td><td> 50</td><td> 82</td><td> 97.515528</td><td> 77.483443 7</td><td>tblastn</td>

<td> 1160</td><td>sunflower | gb162 | CF089373 T1</td><td>sunflower</td><td> 2507</td><td> 50</td><td> 87</td><td> 98.136646</td><td> 87.5</td><td>blastp</td>

<td> 1161</td><td>wheat | gb164 | CA484201.T1</td><td>wheat</td><td> 2508</td><td> 50</td><td> 89</td><td> 96.8944099</td><td> 65.957446 .8</td><td>blastp</td>

102/175

<td>Polinuc ID SFQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFQ N^0,</td><td>Hom, De ΙΠ</td><td>% IrJont</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 1162</td><td>apricot | gb157,2CV049856_T 1</td><td>Damascus</td><td> 2509</td><td> 51</td><td> 86</td><td> 100</td><td>65.957446 R</td><td>blastp</td>

<td> 1163</td><td>arabidopsis | gb165 | AT2G371801</td><td>arabidopsis</td><td> 2510</td><td> 51</td><td> 89</td><td> 100</td><td> 32.631578 9</td><td>blastp</td>

<td> 1164</td><td>arabidopsis | gb165 | AT2G39010_T1</td><td>arabidopsis</td><td> 2511</td><td> 51</td><td> 92</td><td> 100</td><td> 32.179930 8</td><td>blastp</td>

<td> 1165</td><td>bjuncea | gb164 | EVGN00130608921231_T1</td><td>bjuncea</td><td> 2512</td><td> 51</td><td> 87</td><td> 100</td><td> 86.915887 9</td><td>blastp</td>

<td> 1166-</td><td>bjuncea | gb164 | EVGN00605203140273_T1</td><td>bjuncea</td><td> 2513</td><td> 51</td><td> 86</td><td> 90.3225806</td><td> 86.597938 1</td><td>blastp</td>

<td> 1167</td><td>b_juncea | gb164 | EVGN21262514941904_T1</td><td>bjuncea</td><td> 2514</td><td> 51</td><td> 86</td><td> 56.9892473</td><td> 91.379310 3</td><td>blastp</td>

<td> 1168</td><td>b_juncea | gb 164 | E VGN0073331415 2324_T 1</td><td>bjuncea</td><td> 2515</td><td> 51</td><td> 86</td><td> 100</td><td> 85.321100 9</td><td>blastp</td>

<td> 1169</td><td>bjuncea | gb164EVGN00041211340240_F1</td><td>bjuncea</td><td> 2516</td><td> 51</td><td> 86</td><td> 89.2473118</td><td> 49.404761 9</td><td>blastp</td>

<td> 1170</td><td>b _juncea | gb164 | DT317704_T 1</td><td>bjuncea</td><td> 2517</td><td> 51</td><td> 91</td><td> 100</td><td> 80.172413 8</td><td>blastp</td>

<td> 1171</td><td>bjuncea | gb164 | EVGN00208014701957_T1</td><td>bjuncea</td><td> 2518</td><td> 51 .</td><td> 85.</td><td> 89.2473118</td><td> 79.807692 3</td><td>blastp</td>

<td> 1172</td><td>bjuncea | gb164EVGN00550314491066_T1</td><td>bjuncea</td><td> 2519</td><td> 51</td><td> 90</td><td> 100</td><td> 36.328125</td><td>blastp</td>

<td> 1173</td><td>bjuncea | gb164 | EVGNO1267508262672_T1</td><td>bjuncea</td><td> 2520</td><td> 51</td><td> 90</td><td> 90.3225806</td><td> 95.454545 5</td><td>blastp</td>

<td> 1174</td><td>b Juncea | gb164 | EVGNO1803715320789._T 1</td><td>bjuncea</td><td> 2521</td><td> 51</td><td> 89</td><td> 100</td><td> 51.381215 5</td><td>blastp</td>

<td> 1175</td><td>b_juncea | gb164 | EVGN00397011681539_T1</td><td>bjuncea</td><td> 2522</td><td> 51</td><td> 91</td><td> 100</td><td> 34.401972 9</td><td>tblastn</td>

<td> 1176</td><td>b_rapa | gb162 | DN965016_T1</td><td>b_rapa</td><td> 2523</td><td> 51</td><td> 88</td><td> 100</td><td> 69.402985 1</td><td>blastp</td>

<td> 1177</td><td>b_rapa | gb162 | EX025548_T 1</td><td>b_rapa</td><td> 2524</td><td> 51</td><td> 87</td><td> 100</td><td> 32.517482 5</td><td>blastp</td>

<td> 1178</td><td>b_rapa | gb162 | BG543764_T1</td><td>b_rapa</td><td> 2525</td><td> 51</td><td> 92-</td><td> 100</td><td> 32.291666 7</td><td>blastp</td>

<td> 1179</td><td>bananA | gb160 | DN238638_T1</td><td>banana</td><td> 2526</td><td> 51</td><td> 89</td><td> 100</td><td> 27.872127 9</td><td>tblastn</td>

<td> 1180</td><td>banana | gb160 | DN238638_T2</td><td>banana</td><td> 2527</td><td> 51</td><td> 89</td><td> 100</td><td> 30.592105 .3</td><td>tblastn</td>

<td> 1181</td><td>bartey | gb157.3 | BE42129_T1</td><td>barley</td><td> 2528</td><td> 51</td><td> 87</td><td> 100</td><td> 32.746478 9</td><td>blastp</td>

<td> 1182</td><td>barley | gb157.3 | BJ446923_T1</td><td>barley</td><td> 2529</td><td> 51</td><td> 83</td><td> 100</td><td> 64.583333 3</td><td>blastp</td>

<td> 1183</td><td>beet | gb162 | BQ488455_T1</td><td>beet</td><td> 2530</td><td> 51</td><td> 81</td><td> 100</td><td> 26.686217</td><td>blastp</td>

<td> 1184</td><td>beet | gb162 | SVU60147_T1</td><td>beet</td><td> 2531</td><td> 51</td><td> 84</td><td> 100</td><td> 32.291666 7</td><td>blastp</td>

<td> 1185</td><td>canola | gb161 | CX189721_T1</td><td>canola</td><td> 2532</td><td> 51</td><td> 87</td><td> 100</td><td> 32.517482 5</td><td>blastp</td>

<td> 1186</td><td>canola | gb161 | CB686155_T1</td><td>canola</td><td> 2533</td><td> 51</td><td> 92</td><td> 100</td><td> 32.291666 7</td><td>blastp</td>

<td> 1187</td><td>canolA | gb161 | D Y007249. T1</td><td>canola</td><td> 2534</td><td> 51</td><td> 87</td><td> 100</td><td> 32.517482 5</td><td>blastp</td>

<td> 1188</td><td>canola | gb161 | ES986486_T1</td><td>canola</td><td> 2535</td><td> 51</td><td> 86</td><td> 96.7741935</td><td> 87.378640 8</td><td>blastp</td>

<td> 1189</td><td>canola | gb161 | EV203446_T1</td><td>canola</td><td> 2536</td><td> 51</td><td> 82</td><td> 100</td><td> 38.010899 2</td><td>tblastn</td>

<td> 1190</td><td>cassava | gb164 | DN740353_T1</td><td>manioc</td><td> 2537</td><td> 51</td><td> 93</td><td> 100</td><td> 62.837837 8</td><td>blastp</td>

<td> 1191</td><td>cassava | gb164 | DV449516_T1</td><td>manioc</td><td> 2538</td><td> 51</td><td> 94</td><td> 100</td><td> 68.888888 9</td><td>blastp</td>

<td> 1192</td><td>cassava | gb164 | BM259717_T1</td><td>manioc</td><td> 2539</td><td> 51</td><td> 81</td><td> 100</td><td> 32.862190 8</td><td>blastp</td>

<td> 1193</td><td>castorbean | gb160 | EE257493 T2</td><td>seed of ma mona ·</td><td> 2540</td><td> 51</td><td> 81</td><td> 100</td><td> 46.5</td><td>blastp</td>

<td> 1194</td><td>castorbean | gb160 | EE257493_T 1</td><td>seed of castor</td><td> 2541</td><td> 51</td><td> 81</td><td> 100</td><td>34.444444 THE</td><td>blastp</td>

<td> 1195</td><td>cichorium | gb161 ΙΕ H706421_T1</td><td>cichorium</td><td> 2542</td><td> 51</td><td> 94</td><td> 100</td><td> 80.859565 2</td><td>blastp</td>

<td> 1196</td><td>cichorium | gb161 IEH708948 T 1</td><td>cichorium</td><td> 2543</td><td> 51</td><td> 90</td><td> 100</td><td> 32.555425 9</td><td>tblastn</td>

<td> 1197</td><td>cichorium | gb161) EH692078 T 1</td><td>cichorium</td><td> 2544</td><td> 51</td><td> 90</td><td> 100</td><td> 246.68435</td><td>tblastn</td>

<td> 1198</td><td>citrus | gb157.2 | CB291468 T1</td><td>citrus</td><td> 2545</td><td> 51</td><td> 82</td><td> 100</td><td> 86.111111 1</td><td>blastp</td>

<td> 1199</td><td>citrus | gb157.2 | BQ624699 T1</td><td>citrus</td><td> 2546</td><td> 51</td><td> 90</td><td> 100</td><td> 27.56917</td><td>tblastn</td>

103/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SEQ N ° -</td><td>Hom. □ and go&gt;</td><td> %</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 1200</td><td>clover | gb162 | BB903718_T1</td><td>clove</td><td> 2547</td><td> 51</td><td> 91</td><td> 100</td><td> 32.631573 9</td><td>blastp</td>

<td> 1201</td><td>clover | gb162 | BB930902_T1</td><td>clove</td><td> 2548</td><td> 51</td><td> 88</td><td> 100</td><td> 32.404181 2</td><td>blastp</td>

<td> 1202</td><td>clover | gb162 | BB911526_T1</td><td>clove</td><td> 2549</td><td> 51</td><td> 91</td><td> 92.4731183</td><td> 80.373331 8</td><td>blastp</td>

<td> 1203</td><td>clover | gb162 | BB913405_T1</td><td>clove of india</td><td> 2550</td><td> 51</td><td> 90</td><td> 96.7741935</td><td> 81.081081 1</td><td>blastp</td>

<td> 1204</td><td>cotton | gb164 | ES804497_T1</td><td>cotton</td><td> 2551</td><td> 51</td><td> 86</td><td> 100</td><td> 58.490566</td><td>blastp</td>

<td> 1205</td><td>cottcn | gb164 | EX172153_T1</td><td>cotton</td><td> 2552</td><td> 51</td><td> 89</td><td> 90.3225806</td><td> 41.515650 7</td><td>tblastn</td>

<td> 1206</td><td>cowpea | gb166FF384339_T1</td><td>black beans</td><td> 2553</td><td> 51</td><td> 89</td><td> 90.3225806</td><td> 80</td><td>blastp</td>

<td> 1207</td><td>cowpea | gb166FF396241_T1</td><td>black beans</td><td> 2554</td><td> 51</td><td> 82</td><td> 97.8494624</td><td> 88.349514 6</td><td>blastp</td>

<td> 1208</td><td>cowpea | gb166ES884224_T 1</td><td>black beans</td><td> 2555</td><td> 51</td><td> 88</td><td> 100</td><td> 32.404181 2</td><td>blastp</td>

<td> 1209</td><td>cowpea | gb166FG857474_T1</td><td>cowpeas *</td><td> 2556 .</td><td> 51.</td><td> 89</td><td> 100</td><td> 68.888888 9 .</td><td>blastp</td>

<td> 1210</td><td>cryptomeria | gb166 | BY902595_T 1</td><td>cryptomeria</td><td> 2557</td><td> 51</td><td> 81</td><td> 100</td><td> 78.813559 3</td><td>blastp</td>

<td> 1211</td><td>cryptome ria | gb 1661BJ9 37695_T 1</td><td>cryptomeria</td><td> 2558</td><td> 51</td><td> 83</td><td> 100</td><td> 31.740614 3</td><td>blastp</td>

<td> 1212</td><td>cryptomeria | gb166 | BW993227_T1</td><td>cryptomeria</td><td> 2559*</td><td> 51</td><td> 82</td><td> 88.172043</td><td> 86.315789 5</td><td>blastp</td>

<td> 1213</td><td>dandelion jgb161 DY802675.T1</td><td>dandelion</td><td> 2560</td><td> 51</td><td> 87</td><td> 91.3978495</td><td> 75.221238 9</td><td>blastp</td>

<td> 1214</td><td>fescue | gb161 | OT674412_T1</td><td>fescue ·</td><td> 2561</td><td> 51</td><td> 82</td><td> 84.9462366</td><td> 85.869565 2</td><td>blastp</td>

<td> 1215</td><td>fescue | gb161 | DT695652_T1</td><td>fescue</td><td> 2562</td><td> 51</td><td> 84</td><td> 100</td><td> 76.859504 1</td><td>blastp</td>

<td> 1216</td><td>fescue | gb161 | DT702501_T1</td><td>fescue</td><td> 2563</td><td> 51</td><td> 83</td><td> 95.6989247</td><td> 96.739130 4</td><td>blastp</td>

<td> 1217</td><td>fescue | gb16l | DT688112_T1</td><td>fescue</td><td> 2564</td><td> 51</td><td> 83</td><td> 100</td><td> 85.321100 9</td><td>blastp</td>

<td> 1218</td><td>fescue | gb161 | DT688728_T1</td><td>fescue</td><td> 2565</td><td> 51</td><td> 92</td><td> 100</td><td> 815.78947 4</td><td>blastp</td>

<td> 1219</td><td>ginger | gb164 | DY358169_T1</td><td>ginger</td><td> 2566</td><td> 51</td><td> 87</td><td> 100</td><td> 32.978723 4</td><td>blastp</td>

<td> 1220</td><td>ginger | gb164 (DY366672_T1</td><td>ginger</td><td> 2567</td><td> 51</td><td> 82</td><td> 93.5483871</td><td> 87</td><td>blastp</td>

<td> 1221</td><td>ginger | gb164 | DY360033_T1</td><td>ginger</td><td> 2568</td><td> 51</td><td> 91</td><td> 100</td><td> 27.788844 6</td><td>tblastn</td>

<td> 1222</td><td>grape | gb160 | AFI88843_T5</td><td>grape</td><td> 2569</td><td> 51</td><td> 82</td><td> 100</td><td> 32.517482 5</td><td>blastp</td>

<td> 1223</td><td>ipomoea | gb157.21B J 556470_T 1</td><td>morning glory</td><td> 2570</td><td> 51</td><td> 88</td><td> 100</td><td> 32.404181 2</td><td>blastp</td>

<td> 1224</td><td>lettuce [gb157.2 | DW158018_T1</td><td>lettuce</td><td> 2571</td><td> 51</td><td> 90</td><td> 100</td><td> 32.631578 9</td><td>blastp</td>

<td> 1225</td><td>lettuce | gb157.2 | DW091407_T1</td><td>lettuce</td><td> 2572</td><td> 51</td><td> 90</td><td> 100</td><td> 34.701492 5</td><td>blastp</td>

<td> 1226</td><td>lettuce | gb157.2 | DW060777_T1</td><td>lettuce</td><td> 2573</td><td> 51</td><td> 89</td><td> 89.2473118</td><td> 32.677165 4</td><td>blastp</td>

<td> 1227</td><td>IOtus | gb157.2 | AV775277_T1</td><td>lotus</td><td> 2574</td><td> 51</td><td> 83</td><td> 100</td><td> 88.571428 6</td><td>blastp</td>

<td> 1228</td><td>lotus | gb157.2 | AI967387_T1</td><td>lotus</td><td> 2575</td><td> 51</td><td> 84</td><td> 100</td><td> 32.404181 2</td><td>blastp</td>

<td> 1229</td><td>IOtus | gb157.2 | AV774377_T1</td><td>lotus</td><td> 2576</td><td> 51</td><td> 81</td><td> 100</td><td> 88.571428 6</td><td>blastp</td>

<td> 1230</td><td>lotus | gb157.2 | BP059122_T1</td><td>lotus</td><td> 2577</td><td> 51</td><td> 80</td><td> 73.1182796</td><td> 85</td><td>blastp</td>

<td> 1231</td><td>lotus | gb157.2 | BI419853_T1</td><td>lotus</td><td> 2578</td><td> 51</td><td> 81</td><td> 94.6236559</td><td> 88</td><td>blastp</td>

<td> 1232</td><td>lotus | gb157.2 | 8P049219 T1</td><td>lotus</td><td> 2579</td><td> 51</td><td> 81</td><td> 100</td><td> 76.229508 2</td><td>blastp</td>

<td> 1233</td><td>lotus | gb157.2 | AV775053 T1</td><td>lotus</td><td> 2580</td><td> 51</td><td> 82</td><td> 84.9462366</td><td> 86.813186 8</td><td>blastp</td>

<td> 1234</td><td>lotus | gb157.2 | AV775249 T1</td><td>lotus</td><td> 2581</td><td> 51</td><td> 85</td><td> 95.6989247</td><td>80.909090 J</td><td>blastp</td>

<td> 1235</td><td>maize | gb164 | AF326496 T1</td><td>corn</td><td> 2582</td><td> 51</td><td> 88</td><td> 100</td><td> 32.404181 2</td><td>blastp</td>

<td> 1236</td><td>maize | gb164 | AY107589 T1</td><td>corn</td><td> 2583</td><td> 51</td><td> 84</td><td> 100</td><td> 32.862190 8</td><td>blastp</td>

<td> 1237</td><td>medicago | gb157.2 | AI974409 T 1</td><td>medicago</td><td> 2584</td><td> 51</td><td> 87</td><td> 100</td><td> 32.404181 2</td><td>blastp</td>

104/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N »·</td><td>Hom. From ID</td><td> %</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 1238</td><td>medicago | gb157.2 | AI974231_T1</td><td>medicago</td><td> 2585</td><td> 51</td><td> 89</td><td> 100</td><td>32.631578 A</td><td>blastp</td>

<td> 1239</td><td>meton | gb165 | E8715587_T 1</td><td>melon</td><td> 2586</td><td> 51</td><td> 86</td><td> 100</td><td> 23.484848 5</td><td>tblastn</td>

<td> 1240</td><td>oat | gb164 | CN816056_T1</td><td>oats</td><td> 2587</td><td> 51</td><td> 82</td><td>YEAH</td><td> 84.545454 5</td><td>blastp</td>

<td> 1241.</td><td>oil_palm | gb166 | CN601069_T1</td><td>oil palm</td><td> 2588</td><td> 51</td><td> 89</td><td> 100</td><td> 32.978723 4</td><td>blastp</td>

<td> 1242</td><td>oil_palm | gb166 | EL686181_T1</td><td>oil palm</td><td> 2589</td><td> 51</td><td> 84</td><td> 100</td><td> 32.978723 4</td><td>blastp</td>

<td> 1243</td><td>peanut | gb161 | CD037823_T1</td><td>peanut</td><td> 2590</td><td> 51</td><td> 82</td><td> 100</td><td> 31.849315 1</td><td>blastp</td>

<td> 1244</td><td>peanut | gb161 | CD038014_T1</td><td>peanut</td><td> 2591</td><td> 51</td><td> 88</td><td> 100</td><td> 32.179930 8</td><td>blastp</td>

<td> 1245</td><td>periwinkle | gb164 | AM232518_T2</td><td>myrtle</td><td> 2592</td><td> 51</td><td> 87</td><td> 100</td><td> 65.957446 8</td><td>blastp</td>

<td> 1246</td><td>physcomitrella | gbl57 | BI436955__T1</td><td>physcomitrella</td><td> 2593</td><td> 51</td><td> 89</td><td> 100</td><td> 33.333333 3</td><td>blastp</td>

<td> 1247</td><td>physcomitrellAgbl57 | BJ198543 TÍ ~ </td><td>physcomitrella</td><td> 2594 -</td><td> 51 .. .</td><td> 82 -</td><td> 100</td><td> 32.517482 5 </td><td>blastp</td>

<td> 1248</td><td>physcomitrella | gbl57 | AW4Z6973_T3</td><td>physcomitrella</td><td> 2595</td><td> 51</td><td> 90</td><td> 100</td><td> 33.214285 7</td><td>blastp</td>

<td> 1249</td><td>physcomi trella | gbl57 [BJ962015__T1</td><td>physcomitrella</td><td> 2596</td><td> 51</td><td> 82</td><td> 100</td><td> 32.525951 6</td><td>blastp</td>

<td> 1250</td><td>pine | gb157.2 | AW870138_T1</td><td>Pine</td><td> 2597</td><td> 51</td><td> 82</td><td> 100</td><td> 34.701492 5</td><td>blastp</td>

<td> 1251</td><td>pine | gb157.2 | AI813147_T1</td><td>Pine</td><td> 2598</td><td> 51</td><td> 87</td><td> 100</td><td> 33.096085 4</td><td>blastp</td>

<td> 1252</td><td>pine | gb157.2 | AA739836_T1</td><td>Pine</td><td> 2599</td><td> 51</td><td> 87</td><td> 100</td><td> 33.096085 4</td><td>blastp</td>

<td> 1253</td><td>pine | gb157.2 | AL750425_T1</td><td>Pine.</td><td> 2600</td><td> 51</td><td> 88</td><td> 100</td><td> 33.096085 4</td><td>blastp</td>

<td> 1254</td><td>pine | gb157.2 | BG038984_T1</td><td>Pine</td><td> 2601</td><td> 51</td><td> 80</td><td> .100 .</td><td> 32.862190 8</td><td>blastp</td>

<td> 1255</td><td>pine | gb57.2 | AW225939_T1</td><td>Pine</td><td> 2602</td><td> 51</td><td> 80</td><td> 100</td><td> 34.191176 5</td><td>blastp</td>

<td> 1256</td><td>pine | gb157.2 | BQ696500_T1</td><td>Pine</td><td> 2603</td><td> 51</td><td> 81</td><td> 100</td><td> 32.862190 8</td><td>blastp</td>

<td> 1257</td><td>pine | gb157.2 | AL751198_T1</td><td>Pine</td><td> 2604</td><td> 51</td><td> 87</td><td> 100</td><td> 33.333333 3</td><td>blastp</td>

<td> 1258</td><td>pine | gb157.2 | BQ695693_T1</td><td>Pine</td><td> 2605</td><td> 51</td><td> 82</td><td> 100</td><td> 32.862190 8</td><td>blastp</td>

<td> 1259</td><td>pine | gb157.2 | 8F517326_T1</td><td>Pine</td><td> 2606</td><td> 51</td><td> 80</td><td> 100</td><td> 60.389610 4</td><td>blastp</td>

<td> 1260</td><td>pine | gb157.2 | AA73962_T1</td><td>Pine</td><td> 2607</td><td> 51</td><td> 81</td><td> 100</td><td> 34.701492 5</td><td>blastp</td>

<td> 1261</td><td>pine | gb157.2 | BG317873_T1</td><td>Pine</td><td> 2608</td><td> 51</td><td> 82</td><td> 100</td><td> 32.862190 8</td><td>blastp</td>

<td> 1262</td><td>pine | gb157.2 | AI813147_T2</td><td>Pine</td><td> 2609</td><td> 51</td><td> 87</td><td> 100</td><td> 32.978723 4</td><td>blastp</td>

<td> 1263</td><td>pine | gb157.2 | CF388120_T1</td><td>Pine</td><td> 2610</td><td> 51</td><td> 87</td><td> 100</td><td> 33.333333 3</td><td>blastp</td>

<td> 1264</td><td>pine | gb157.2 | BE662590_T1</td><td>Pine</td><td> 2611</td><td> 51</td><td> 81</td><td> 100</td><td> 35.769230 8</td><td>blastp</td>

<td> 1265</td><td>pine | gb157.2 | BG318657_T1</td><td>Pine</td><td> 2612</td><td> 51</td><td> 82</td><td> 100</td><td> 32.862190 8</td><td>blastp</td>

<td> 1266</td><td>pine | gb157.2 | AA557104_T1</td><td>Pine</td><td> 2613</td><td> 51</td><td> 88</td><td> 100</td><td> 33.333333 3</td><td>blastp</td>

<td> 1267</td><td>pine | gb157.2 [AW870138_T2</td><td>Pine</td><td> 2614</td><td> 51</td><td> 82</td><td> 100</td><td> 32.862190 8</td><td>blastp</td>

<td> 1268</td><td>pine | gb157.2 | AW289749 T1</td><td>Pine</td><td> 2615</td><td> 51</td><td> 82</td><td> 100</td><td> 32.862190 8</td><td>blastp</td>

<td> 1269</td><td>pine | gb157.2 | H75016 T1</td><td>Pine</td><td> 2616</td><td> 51</td><td> 88</td><td> 100</td><td> 32.746478 9</td><td>blastp</td>

<td> 1270</td><td>pine | gb157.2] AA740005 J1</td><td>Pine</td><td> 2617</td><td> 51</td><td> 80</td><td> 100</td><td> 35.094339 6</td><td>blastp</td>

<td> 1271</td><td>pine | gb157.2 [CA305579 T1</td><td>Pine</td><td> 2618</td><td> 51</td><td> 91</td><td> 100</td><td> 75.609756 1</td><td>blastp</td>

<td> 1272</td><td>pine | gb157.2 | BE187350_T1</td><td>Pine</td><td> 2619</td><td> 51</td><td> 83</td><td> 100</td><td> 32.862190 .8</td><td>blastp</td>

<td> 1273</td><td>pine | gb157.2 | CF473539_T1</td><td>Pine</td><td> 2620</td><td> 51</td><td> 84</td><td> 100</td><td> 32.978723 .4</td><td>blastp</td>

<td> 1274</td><td>pine | gb157.2] AW290370_T1</td><td>Pine</td><td> 2621</td><td> 51</td><td> 83</td><td> 100</td><td> 32.746478 9</td><td>blastp</td>

<td> 1275</td><td>pine | gb157.2 | AW290691_T1</td><td>Pine</td><td> 2622</td><td> 51</td><td> 82</td><td> 75.2688172</td><td> 88.607594 9</td><td>blastp</td>

105/175

<td>Polinuc ID SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFON ° -</td><td>Hom. From ID</td><td> %</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 1276</td><td>pine | gb157.2 | BG318695_T1</td><td>Pine</td><td> 2623</td><td> 51</td><td> 82</td><td> 100</td><td> 34.701492 5</td><td>blastp</td>

<td> 1277</td><td>pineapple | gb157.2 | DT339628_T1</td><td>pineapple</td><td> 2624</td><td> 51</td><td> 91</td><td> 98.9247312</td><td> 78.632478 6</td><td>blastp</td>

<td> 1278</td><td>poplar | gb157.2 | AI162483_T2</td><td>poplar</td><td> 2625</td><td> 51</td><td> 86</td><td> 100</td><td> 24.345549 7</td><td>tblastn</td>

<td> 1279</td><td>poplar | gb157.2 | BU817536_T4</td><td>poplar</td><td> 2626</td><td> 51</td><td> 87</td><td> 100</td><td> 22.609400 3</td><td>tblastn</td>

<td> 1280</td><td>potato | gb157.2 | BQ515617_T1</td><td>potato</td><td> 2627</td><td> 51</td><td> 80</td><td> 98.9247312</td><td> 36.653386 5</td><td>blastp</td>

<td> 1281</td><td>potato | gb157.2 | BE920139_T2</td><td>potato</td><td> 2628</td><td> 51</td><td> 90</td><td> 100</td><td> 41.517857 1</td><td>blastp</td>

<td> 1282</td><td>radish | gb164 | ÊV526963_T1</td><td>radish</td><td> 2629</td><td> 51</td><td> 87</td><td> 100</td><td> 32.517482 5</td><td>blastp</td>

<td> 1283</td><td>radish | gb164 | EV567230_T2</td><td>radish</td><td> 2630</td><td> 51</td><td> 84</td><td> 100</td><td> 46.039604</td><td>blastp</td>

<td> 1284</td><td>radish | gb164 | EV551004_T1</td><td>radish</td><td> 2631</td><td> 51</td><td> 92</td><td> 100</td><td> 32.291666 7</td><td>blastp</td>

<td> 1285</td><td>radish | gb164 | EX756464_T1</td><td>radish '</td><td> 2632</td><td> -51</td><td> 86</td><td> 100’</td><td> 48.186528 -5</td><td>blastp</td>

<td> 1286</td><td>radish | gb164 | EY910551_T1</td><td>radish</td><td> 2633</td><td> 51</td><td> 91</td><td> 100</td><td> 31.958762 9</td><td>blastp</td>

<td> 1287</td><td>radish | gb164 | EW730466_T1</td><td>radish</td><td> 2634</td><td> 51</td><td> 84</td><td> 98.9247312</td><td>87.619047 fi</td><td>blastp</td>

<td> 1288</td><td>radish | gb164 | AF051128_T1</td><td>radish</td><td> 2635</td><td> 51</td><td> 81</td><td> 87.0967742</td><td> 48.6</td><td>tblastn</td>

<td> 1289</td><td>radish | gb164 | EX756028_T1</td><td>radish</td><td>Nopredict edProtein</td><td> 51</td><td> 86</td><td> 100</td><td> 40.028694 4</td><td>tblastn</td>

<td> 1290</td><td>rice | gb157.2 | BE229418_T1</td><td>rice</td><td> 2636</td><td> 51</td><td> 90</td><td> 100</td><td> 32.978723 4</td><td>blastp</td>

<td> 1291</td><td>rice | gb157.2 | BE229418_T3</td><td>rice</td><td> 2637</td><td> 51</td><td> 90</td><td> 100</td><td> 38.589211 6</td><td>blastp</td>

<td> 1292</td><td>rice | gb157.2 | AK107700_T1</td><td>rice</td><td> 2638</td><td> 51</td><td> 91</td><td> 100</td><td> 68.888888 9</td><td>blastp</td>

<td> 1293</td><td>rice [gb157.2 | 8E229418_T4</td><td>rice</td><td> 2639</td><td> 51</td><td> 90</td><td> 100</td><td> 54.069767 4</td><td>blastp</td>

<td> 1294</td><td>rice | gb157.2 | NM001066078_T1</td><td>rice</td><td> 2640</td><td> 51</td><td> 92</td><td> 100</td><td> 41.704035 9</td><td>blastp</td>

<td> 1295</td><td>rice | gb157.2 | AW155505_T1</td><td>rice</td><td> 2641</td><td> 51</td><td> 83</td><td> 100</td><td> 32.068965 5</td><td>blastp</td>

<td> 1296</td><td>rice | gb157.2 | AW155505_T2</td><td>rice</td><td> 2642</td><td> 51</td><td> 83</td><td> 98.9247312</td><td> 35.797665 4</td><td>blastp</td>

<td> 1297</td><td>rice | gb157.2 | AK106746_T1</td><td>rice</td><td> 2643</td><td> 51</td><td> 83</td><td> 100</td><td> 22.646103 9</td><td>tblastn</td>

<td> 1298</td><td>sorghum | gb161, xeno | AY 107589_T 1</td><td>sorghum</td><td> 2644</td><td> 51</td><td> 86</td><td> 100</td><td> 33.333333 3</td><td>blastp</td>

<td> 1299</td><td>sorghum | gb161, xeno | AI947598_T 1</td><td>sorghum</td><td> 2645</td><td> 51</td><td> 92</td><td> 100</td><td> 32.517482 5</td><td>blastp</td>

<td> 1300</td><td>sorghum | gb161, xeno | AI855413__T1</td><td>sorghum</td><td> 2646</td><td> 51</td><td> 80</td><td> 100</td><td> 31.418918 9</td><td>blastp</td>

<td> 1301</td><td>sorghum | gb161, xeno | AW565915_T 1</td><td>sorghum</td><td> 2647</td><td> 51</td><td> 81</td><td> 100</td><td> 31.141868 5</td><td>blastp</td>

<td> 1302</td><td>sorghum | gb161, xeno | CF481617__T1</td><td>sorghum</td><td> 2648</td><td> 51</td><td> 90</td><td> 100</td><td> 79.661016 9</td><td>blastp</td>

<td> 1303</td><td>soybean [gb166 | BU549322 T1</td><td>Soy</td><td> 2649</td><td> 51</td><td> 89</td><td> 100</td><td> 32.517482 5</td><td>blastp</td>

<td> 1304</td><td>soybean | gb166 | BE352729_T1</td><td>Soy</td><td> 2650</td><td> 51</td><td> 88</td><td> 100</td><td> 32.404181 2</td><td>blastp</td>

<td> 1305</td><td>soybean | gb166 | B1974981_T1</td><td>Soy</td><td> 2651</td><td> 51</td><td> 91</td><td> 100</td><td> 71.538461 5</td><td>blastp</td>

<td> 1306</td><td>soybean | gb166 | BE658685_T1</td><td>Soy</td><td> 2652</td><td> 51</td><td> 89</td><td> 100</td><td> 32.631578 9</td><td>blastp</td>

<td> 1307</td><td>soybean | gb166 | BE352747_T3</td><td>Soy</td><td> 2653</td><td> 51</td><td> 81</td><td> 100</td><td> 20.590405 9</td><td>tblastn</td>

<td> 1308</td><td>spikemoss | gb165 | DN838269 T1</td><td>spikemoss</td><td> 2654</td><td> 51</td><td> 88</td><td> 100</td><td> 32.068965 5</td><td>blastp</td>

<td> 1309</td><td>spikemoss | gt&gt; 165 | FE434019 T1</td><td>spikemoss</td><td> 2655</td><td> 51</td><td> 88</td><td> 100</td><td> 32.068965 .5</td><td>blastp</td>

<td> 1310</td><td>spruce | gb162 | CO225164 T1</td><td>fir</td><td> 2656</td><td> 51</td><td> 89</td><td> 100</td><td>32.862190 a</td><td>blastp</td>

<td> 1311</td><td>spruce | gb162 | CO258147 T1</td><td>fir</td><td> 2657</td><td> 51</td><td> 81</td><td> 100</td><td> 33.818181 8</td><td>blastp</td>

<td> 1312</td><td>spruce | gb162 | CO230791 T1</td><td>fir</td><td> 2658</td><td> 51</td><td> 88</td><td> 100</td><td> 46.039604</td><td>blastp</td>

<td> 1313</td><td>spntce | gb162 | DR546674 T 1</td><td>fir</td><td> 2659</td><td> 51</td><td> 82</td><td> 100</td><td> 32.5</td><td>blastp</td>

106/175

<td>Polinuc ID .SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO No. ·</td><td>Hom. From ID</td><td>% Ictent</td><td>Cob. Query</td><td>% Ind. Cob. '</td><td>Algorithm</td>

<td> 1314</td><td>spruce | gb162 | DR560237.T1</td><td>fir</td><td> 2660</td><td> 51</td><td> 81</td><td> 100</td><td> 34,191176 5</td><td>blastp</td>

<td> 1315</td><td>spurge | gb161 | DVI16550_T1</td><td>euphorbia</td><td> 2661</td><td> 51</td><td> 83</td><td> 100</td><td> 86.111111 1</td><td>blastp</td>

<td> 1316</td><td>sugarcane | gb157.2 | CA088464_T1</td><td>sugar cane</td><td> 2662</td><td> 51</td><td> 87</td><td> 88.172043</td><td> 81.188118 8</td><td>blastp</td>

<td> 1317</td><td>sugarcane | gb157.2 | CA086583_T1</td><td>sugar cane</td><td> 2663</td><td> 51</td><td> 92</td><td> 100</td><td> 62.416107 4</td><td>blastp</td>

<td> 1318</td><td>sugarcane | gb157.2 | CA234165_T1</td><td>sugar cane</td><td> 2664</td><td> 51</td><td> 86</td><td> 62.3655914</td><td> 100</td><td>blastp</td>

<td> 1319</td><td>sugarcane | gb157.2 | CA107998_T1</td><td>sugar cane</td><td> 2665</td><td> 51</td><td> 89</td><td> 100</td><td> 32.517482 5</td><td>blastp</td>

<td> 1320</td><td>sugarcane | gb157.2 | CA204327_T 1</td><td>sugar cane</td><td> 2666</td><td> 51</td><td> 95</td><td> 100</td><td> 34.191176 5</td><td>tblastn</td>

<td> 1321</td><td>sugarcane | gb157.2 | CA067786_T1</td><td>sugar cane</td><td> 2667</td><td> 51</td><td> 92</td><td> 86.0215054</td><td> 18.648018 6</td><td>tblastn</td>

<td> 1322</td><td>sunflower | gb162 | DY944685_T1</td><td>sunflower</td><td> 2668</td><td> 51</td><td> 81</td><td> 100</td><td> 31.958762 9</td><td>blastp</td>

<td> 1323</td><td>sunflower | gb162 | BQ96859Ó T1</td><td>sunflower</td><td> -2669 </td><td> .51 . ..</td><td> 87 .</td><td> 52.688172</td><td> 100</td><td>blastp</td>

<td> 1324</td><td>sunflower | gb162 | C D848850_T1</td><td>sunflower</td><td> 2670</td><td> 51</td><td> 89</td><td> 98.9247312</td><td> 41.317365 3</td><td>tblastn</td>

<td> 1325</td><td>tobacco | gb162 | EB445876 T1</td><td>tobacco</td><td> 2671</td><td> 51</td><td> 90</td><td> 100</td><td> 32.404181 2</td><td>blastp</td>

<td> 1326</td><td>tobacco | gb 162 | E B445188_T 1</td><td>tobacco</td><td> 2672</td><td> 51</td><td> 88</td><td> 100</td><td> 32.404181 2</td><td>blastp</td>

<td> 1327</td><td>tobacco | gb162 | CK720586_T1</td><td>tobacco</td><td> 2673</td><td> 51</td><td> 81</td><td> 100</td><td> 34.701492 5</td><td>blastp</td>

<td> 1328</td><td>tomato | gb164 | C0750818_T1</td><td>tomato</td><td> 2674</td><td> 51</td><td> 92</td><td> 88.172043</td><td> 82.828282 8</td><td>blastp</td>

<td> 1329</td><td>tomato | gb164 | AI772191_T1</td><td>tomato</td><td> 2675</td><td> 51</td><td> 81</td><td> 98.9247312</td><td> 33.699633 7</td><td>blastp</td>

<td> 1330</td><td>tomato | gb164 | AW219533_T2</td><td>tomato'</td><td> 2676</td><td> 51</td><td> 89</td><td> 100</td><td> 39.240506 3</td><td>tblastn</td>

<td> 1331</td><td>triphysaria | gb 164] D R173305_T 1</td><td>triphysaria</td><td> 2677</td><td> 51</td><td> 88</td><td> 95.6989247</td><td> 80.909090 9</td><td>blastp</td>

<td> 1332</td><td>triphysaria | gb 164 | E X984185_T 1</td><td>triphysaria</td><td> 2678</td><td> 51</td><td> 90</td><td> 100</td><td> 75.609756 1</td><td>blastp</td>

<td> 1333</td><td>triptiysaria | gb164 | DR174019_T1</td><td>triphysaria</td><td> 2679</td><td> 51</td><td> 91</td><td> 100</td><td> 67.883211 7</td><td>blastp</td>

<td> 1334</td><td>wheat | gb164 | CA609068_T1</td><td>wheat</td><td> 2680</td><td> 51</td><td> 94</td><td> 100</td><td> 67.391304 3</td><td>blastp</td>

<td> 1335</td><td>wheat | gb164 | BE430411_T1</td><td>wheat</td><td> 2681</td><td> 51</td><td> 86</td><td> 100</td><td> 32.404181 2</td><td>blastp</td>

<td> 1336</td><td>wheat | gb164 | CK208980_T1</td><td>wheat</td><td> 2682</td><td> 51</td><td> 80</td><td> 100</td><td> 30</td><td>blastp</td>

<td> 1337</td><td>wheat; gb164 | CA620153 T1</td><td>wheat</td><td> 2683</td><td> 51</td><td> 96</td><td> 95.6989247</td><td> 87.254902</td><td>blastp</td>

<td> 1338</td><td>wheat | gb164 | BE405395_T1</td><td>wheat</td><td> 2684</td><td> 51</td><td> 88</td><td> 100</td><td> 32.746478 9</td><td>blastp</td>

<td> 1339</td><td>wheat | gb164 | CA647310_T1</td><td>wheat</td><td> 2685</td><td> 51</td><td> 80</td><td> 77.4193548</td><td> 93.506493 5</td><td>blastp</td>

<td> 1340</td><td>wheat | gb164 | 8E492099_T1</td><td>wheat</td><td> 2686</td><td> 51</td><td> 87</td><td> 100</td><td> 32746478 9</td><td>blastp</td>

<td> 1341</td><td>wheat | gb164 | BE402029_T1</td><td>wheat</td><td> 2687</td><td> 51</td><td> 87</td><td> 100</td><td> 32746478 9</td><td>blastp</td>

<td> 1342</td><td>wheat | gb164 | CA618130_T1</td><td>wheat</td><td> 2688</td><td> 51</td><td> 86</td><td> 88.172043</td><td> 73.214285 7</td><td>blastp</td>

<td> 1343</td><td>wheat | gb164 | CJ605707_T1</td><td>wheat</td><td> 2689</td><td> 51</td><td> 82</td><td> 100</td><td> 69.402985 1</td><td>blastp</td>

<td> 1344</td><td>wheat | gb164 | CA614209_T1</td><td>wheat</td><td> 2690</td><td> 51</td><td> 98</td><td> 59.1397849</td><td> 98.214285 7</td><td>blastp</td>

<td> 1345</td><td>wheat | gb164] CA701714_T1</td><td>wheat</td><td> 2691</td><td> 51</td><td> 82</td><td> 100</td><td> 77.5</td><td>blastp</td>

<td> 1346</td><td>wheat | gb164 | BE403921_T1</td><td>wheat</td><td> 2692</td><td> 51</td><td> 93</td><td> 967741935</td><td> 82.568807 3</td><td>blastp</td>

<td> 1347</td><td>wheat | gb164 | BE217049 T1</td><td>wheat</td><td> 2693</td><td> 51</td><td> 83</td><td> 100</td><td> 31.958762 9</td><td>blastp</td>

<td> 1348</td><td>wheat | gb164 | CA602649_T1</td><td>wheat</td><td> 2694</td><td> 51</td><td> 84</td><td> 100</td><td> 30.032292 8</td><td>tblastn</td>

<td> 1349</td><td>wheat | gb164 | CA486220_T1</td><td>wheat</td><td> 2695</td><td> 51</td><td> 82</td><td> 96.7741935</td><td> 33.375959 1</td><td>tblastn</td>

<td> 1350</td><td>b juncea | gb164 | EVGN00044413933329 T1</td><td>bjuncea</td><td> 2696</td><td> 52</td><td> 85</td><td> 54.3835615</td><td> 99.295774 6</td><td>blastp</td>

<td> 1351</td><td>b juncea | gb164 | EVGN00137910990746 T1</td><td>bjuncea</td><td> 2697</td><td> 52</td><td> 90</td><td> 53.4246575</td><td> 99.152542 4</td><td>blastp</td>

107/175

<td>Polinuc ID SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO.N⁰·</td><td>Hom. From ID</td><td>% Irlent</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 1352</td><td>barley | gb157.3 | BE413268_T1</td><td>barley</td><td> 2698</td><td> 52</td><td> 81</td><td> 96.803653</td><td> 73.448275 9</td><td>blastp</td>

<td> 1353</td><td>bar1ey | gb157.3 | AJ433979_T1</td><td>barley</td><td> 2699</td><td> 52</td><td> 81</td><td> 96.803653</td><td> 73.448275 9</td><td>blastp</td>

<td> 1354</td><td>barley | gb157.3 | BE412979_T1</td><td>barley</td><td> 2700</td><td> 52</td><td> 82</td><td> 96.803653</td><td> 74.125874 1</td><td>blastp</td>

<td> 1355</td><td>brachypodium | gb161 .xeno | AF 139815_T 1</td><td>.bracbypodium</td><td> 2701</td><td> 52</td><td> 83</td><td> 96.803653</td><td> 73.611111 1</td><td>blastp</td>

<td> 1356</td><td>citrus | gb 157.2 | CX052950_T1</td><td>citrus</td><td> 2702</td><td> 52</td><td> 84</td><td> 50.2283105</td><td> 100</td><td>blastp</td>

<td> 1357</td><td>clover | gb162 | B8913131_T1</td><td>clove</td><td> 2703</td><td> 52</td><td> 93</td><td> 52.5114155</td><td> 99.137931</td><td>blastp</td>

<td> 1358</td><td>clover | gb162 | BB918704_T1</td><td>clove</td><td> 2704</td><td> 52</td><td> 82</td><td> 63.9269406</td><td> 99.295774 6</td><td>blastp</td>

<td> 1359</td><td>cotton | gb164 | CO103246_T1</td><td>cotton</td><td> 2705</td><td> 52</td><td> 91</td><td> 56.6210046</td><td> 93.939393 9</td><td>blastp</td>

<td> 1360</td><td>cowpea | gb166 | FG883860_T1</td><td>black beans</td><td> 2706</td><td> 52</td><td> 83</td><td> 51.1415525</td><td> 99.115044 2</td><td>blastp</td>

<td> 1361</td><td>fescue | gb161 | DT702489_T1</td><td>stink</td><td> 2707 - .</td><td> 52 .</td><td> 96.</td><td> 57.0776256</td><td> 93.283582 1</td><td>blastp</td>

<td> 1362</td><td>fescue | gb161 | DT702846_T1</td><td>fescue</td><td> 2708</td><td> 52</td><td> 96</td><td> 57.0776256</td><td> 96.899224 8</td><td>blastp</td>

<td> 1363</td><td>ipomoea | gb157.2 | BU691146_T1</td><td>morning glory</td><td> 2709</td><td> 52</td><td> 81</td><td> 87.2146119</td><td> 74.703557 3</td><td>blastp</td>

<td> 1364</td><td>maize | gb164 | AI939909_T1</td><td>corn</td><td> 2710</td><td> 52</td><td> 80</td><td> 96.803653</td><td> 73.611111 1</td><td>blastp</td>

<td> 1365</td><td>maize | gb164 | AF130975_T1</td><td>corn</td><td> 2711</td><td> 52</td><td> 83</td><td> 96.803653</td><td> 74.385964 9</td><td>blastp</td>

<td> 1366</td><td>maize | gb164 [AI947831_T1</td><td>corn</td><td> 2712</td><td> 52</td><td> 83</td><td> 96.803653</td><td> 73.611111 1</td><td>blastp</td>

<td> 1367</td><td>oil_palm | gb166 | EL692065_T1</td><td>oil palm</td><td> 2713</td><td> 52</td><td> 80</td><td> 96.803653</td><td> 75.177305</td><td>blastp</td>

<td> 1368</td><td>physcomitrella | gbl57 | AW476973_T1</td><td>physcomitrella</td><td> 2714</td><td> 52</td><td> 80</td><td> 93.6073059</td><td> 73.476702 5</td><td>blastp</td>

<td> 1369</td><td>physcomitrella | gbl57 | BI894596__T1</td><td>physcomitrella</td><td> 2715</td><td> 52</td><td> 80</td><td> 96.347032</td><td> 73.010380 6</td><td>blastp</td>

<td> 1370</td><td>physcomitrella | gbl57 | AW476973_T2</td><td>physcomitrella</td><td> 2716</td><td> 52</td><td> 80</td><td> 93.6073059</td><td> 73.476702 5</td><td>blastp</td>

<td> 1371</td><td>pine | gb157.2 | CF387570_T1</td><td>Pine</td><td> 2717</td><td> 52</td><td> 88</td><td> 51.1415525</td><td> 99.115044 2</td><td>blastp</td>

<td> 1372</td><td>radish | gb164 | EY904434_T2</td><td>radish</td><td> 2718</td><td> 52</td><td> 88</td><td> 54.3378995</td><td> 99.166666 7</td><td>blastp</td>

<td> 1373</td><td>radish | gb164 | FD960377_T1</td><td>radish</td><td> 2719</td><td> 52</td><td> 84</td><td> 63.0136986</td><td> 99.280575 5</td><td>blastp</td>

<td> 1374</td><td>rice | gb157.2 | AU093957_T1</td><td>rice</td><td> 2720</td><td> 52</td><td> 81</td><td> 96.803653</td><td> 74.125874 1</td><td>blastp</td>

<td> 1375</td><td>rice | gb157.2 | BE039992_T2</td><td>rice</td><td> 2721</td><td> 52</td><td> 92</td><td> 57.0776256</td><td> 97.65625</td><td>blastp</td>

<td> 1376</td><td>rice | gb157.2 | BE530955_T1</td><td>rice</td><td> 2722</td><td> 52</td><td> 80</td><td> 96.803653</td><td> 73.103448 3</td><td>blastp</td>

<td> 1377</td><td>rye | gb164 | BE586469_T1</td><td>rye</td><td> 2723</td><td> 52</td><td> 82</td><td> 61.1872146</td><td> 97.810219</td><td>blastp</td>

<td> 1378</td><td>sorghum | gb161.xeno | AW922622_T1</td><td>sorghum</td><td> 2724</td><td> 52</td><td> 83</td><td> 96.803653</td><td>72.602739 Z</td><td>blastp</td>

<td> 1379</td><td>sorghum | gb161 xeno | BE344582__T1</td><td>sorghum</td><td> 2725</td><td> 52</td><td> 80</td><td> 85.3881279</td><td> 74.8</td><td>blastp</td>

<td> 1380</td><td>sorghum | gb161.xeno | AI855280__T1</td><td>sorghum</td><td> 2726</td><td> 52</td><td> 82</td><td> 96.803653</td><td> 73.356401 4</td><td>blastp</td>

<td> 1381</td><td>spikemoss | gb165 | DN838148_T 1</td><td>spikemoss</td><td> 2727</td><td> 52</td><td> 83</td><td> 91.7808219</td><td> 71.530249 1</td><td>blastp</td>

<td> 1382</td><td>spikemoss | gb165 | DN838057_T1</td><td>spikemoss</td><td> 2728</td><td> 52</td><td> 83</td><td> 91.7808219</td><td> 71.530249 1</td><td>blastp</td>

<td> 1383</td><td>sugarcane | gb157.2 | CA139573_T 1</td><td>sugar cane</td><td> 2729</td><td> 52</td><td> 82</td><td> 90.4109589</td><td> 71.897810 2</td><td>blastp</td>

<td> 1384</td><td>sugarcane | gb157.2 | CA145403 T1</td><td>sugar cane</td><td> 2730</td><td> 52</td><td> 90</td><td> 57.0776256</td><td> 99.206349 2</td><td>blastp</td>

<td> 1385</td><td>sunflower | gb162 | CF083179 T1</td><td>sunflower</td><td> 2731</td><td> 52</td><td> 80</td><td> 57.0776256</td><td> 93.283582 1</td><td>blastp</td>

<td> 1386</td><td>sunflower | gb162 | BU035823 T1</td><td>sunflower</td><td> 2732</td><td> 52</td><td> 86</td><td> 56.6210046</td><td>89.208633 J</td><td>blastp</td>

<td> 1387</td><td>switchgrass | gb165 | DN140790 T1</td><td>switchgrass</td><td> 2733</td><td> 52</td><td> 83</td><td> 61.6438356</td><td> 99.264705 9</td><td>blastp</td>

<td> 1388</td><td>switchgrass | gb165 | FE631354 T 1</td><td>switchgrass</td><td> 2734</td><td> 52</td><td> 81</td><td> 66.2100457</td><td>96.666666 Z</td><td>blastp</td>

<td> 1389</td><td>tobacco | gb162 | DV159802 T1</td><td>tobacco</td><td> 2735</td><td> 52</td><td> 81</td><td> 87.6712329</td><td> 48.772226 9</td><td>tblastn</td>

108/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFON »·</td><td>Hom. From ID</td><td> %</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 1390</td><td>wheat | gb164 | AF139815_T1</td><td>wheat</td><td> 2736</td><td> 52</td><td> 82</td><td> 96.803653</td><td> 74.125874 1</td><td>blastp</td>

<td> 1391</td><td>wheat | gb164 | BE406301_T1</td><td>wheat</td><td> 2737</td><td> 52</td><td> 81</td><td> 96.803653</td><td> 73.448275 9</td><td>blastp</td>

<td> 1392</td><td>wheat | gb164 | BE404904_T1</td><td>wheat</td><td> 2738</td><td> 52</td><td> 81</td><td> 96.803653</td><td> 73.448275 9</td><td>blastp</td>

<td> 1393</td><td>wheat | gb164 | BE400219_T1</td><td>wheat</td><td> 2739</td><td> 52</td><td> 81</td><td> 96.803653</td><td> 73.448275 9</td><td>blastp</td>

<td> 1394</td><td>wheat (gb164 | CA619093_T1</td><td>wheat</td><td> 2740</td><td> 52</td><td> 81</td><td> 54.7945205</td><td> 90.151515 2</td><td>blastp</td>

<td> 1395</td><td>wheat | gb164 | BE60505_T1</td><td>wheat</td><td> 2741</td><td> 52</td><td> 88</td><td> 56.6210046</td><td> 93.233082 7</td><td>blastp</td>

<td> 1396</td><td>wheat | gb164 | BQ245211_T1</td><td>wheat</td><td> 2742</td><td> 52</td><td> 82</td><td> 96.803653</td><td> 74.125874 1</td><td>blastp</td>

<td> 1397</td><td>wheat | gb164 | BE497487_T1</td><td>wheat</td><td> 2743</td><td> 52</td><td> 81</td><td> 96.803653</td><td> 73.448275 9</td><td>blastp</td>

<td> 1398</td><td>wheat | gb164 | BQ295206_T1</td><td>wheat</td><td> 2744</td><td> 52</td><td> 89</td><td> 64.8401826</td><td> 100</td><td>blastp</td>

<td> 1399</td><td>wheat | gb164 | BE499954_T1</td><td>wheat ' - ' </td><td> 2745</td><td> 52 . .</td><td> 80</td><td> 98.630137</td><td> 74.827586 2 ..·</td><td>blastp</td>

<td> 1400</td><td>wheat | gb164 | BE405794_T1</td><td>wheat</td><td> 2746</td><td> 52</td><td> 81</td><td> 96.803653</td><td> 73.448275 9</td><td>blastp</td>

<td> '6</td><td>tomato | gb164 | AW934056_T1</td><td>tomato</td><td> 32</td><td> 31</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 21</td><td>bariey | gb157.3 | AL501410_T1</td><td>barley</td><td> 47</td><td> 46</td><td> 87</td><td> 98.3935743</td><td> 98.795180 72</td><td>blastp</td>

<td> 2844</td><td>antirrhinum | gb166 | AJ559427_T1</td><td>antirrhinum</td><td> 3052</td><td> 25</td><td> 88</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2845</td><td>antirrhi num | gb166 | A J791214_T1</td><td>antirrhinum</td><td> 3053</td><td> 25</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2846</td><td>brug u iera | gb 1661 BP939664_T 1</td><td>bruguiera</td><td> 3054</td><td> 25</td><td> 82</td><td> 61.2903225 8</td><td> 100</td><td>blastp</td>

<td> 2847</td><td>centaurea | gb166 | EL931601_T1</td><td>centaurea</td><td> 3055</td><td> 25</td><td> 84</td><td> 98.7903225 8</td><td> 100</td><td>blastp</td>

<td> 2848</td><td>eucalyptus | gb166 | CD668425_T1</td><td>eucalyptus</td><td> 3056</td><td> 25</td><td> 85</td><td> 98.7903225 8</td><td> 98.790322 58</td><td>blastp</td>

<td> 2849</td><td>kiwi | gb166 | FG409998_T1</td><td>Kiwi</td><td> 3057</td><td> 25</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2850</td><td>kiwi | gb166 | FG453166_T1</td><td>Kiwi</td><td> 3058</td><td> 25</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2851</td><td>kiwi | gb166 | FG401585_T1</td><td>Kiwi</td><td> 3059</td><td> 25</td><td> 87</td><td> 99.5967741 9</td><td> 100</td><td>blastp</td>

<td> 2852</td><td>kiwi | gb166 | FG419790_T1</td><td>Kiwi</td><td> 3060</td><td> 25</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2853</td><td>liriodendron | gb165 | FD495170_T1</td><td>liriodendron</td><td> 3061</td><td> 25</td><td> 82</td><td> 99.1935483 9</td><td> 98.795180 72</td><td>blastp</td>

<td> 2854</td><td>poppy | gb166 | FG607362_T1</td><td>poppy</td><td> 3062</td><td> 25</td><td> 82</td><td> 82.6612903 2</td><td> 99.514563 11</td><td>blastp</td>

<td> 2855</td><td>soybean | gb167AA660186_T1</td><td>Soy</td><td> 3063</td><td> 25</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2856</td><td>soybean | gb167 | CA990807_T 1</td><td>Soy</td><td> 3064</td><td> 25</td><td> 82</td><td> 95.5645161 3</td><td> 100</td><td>blastp</td>

<td> 2857</td><td>wa! nuts | gb166 | CVI96664 T1</td><td>nuts</td><td> 3065</td><td> 25</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2858</td><td>antirrhinum | gb166 | X70417_T1</td><td>antirrhinum</td><td> 3066</td><td> 26</td><td> 90</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2859</td><td>banana | gb167 | FF560721_T1</td><td>banana</td><td> 3067</td><td> 26</td><td> 86</td><td> 77.6</td><td> 99.487179 49</td><td>blastp</td>

<td> 2860</td><td>centaurea | gb166 | EL932548_T 1</td><td>centaurea</td><td> 3068</td><td> 26</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2861</td><td>antirrhinum | gb166 | AJ789802_T1</td><td>antirrhinum</td><td> 3069</td><td> 27</td><td> 86</td><td>90.9090909 J</td><td> 100</td><td>blastp</td>

<td> 2862</td><td>bruguiera | gb166 | BP938735_T1</td><td>bruguiera</td><td> 3070</td><td> 27</td><td> 81</td><td>69.9604743 J</td><td> 100</td><td>blastp</td>

<td> 2863</td><td>eucalyptus | gb166 | ES589574_T1</td><td>eucalyptus</td><td> 3071</td><td> 27</td><td> 82</td><td> 90.9090909 1</td><td> 100</td><td>blastp</td>

<td> 2864</td><td>kiwi | gb166 | FG427735_T1</td><td>Kiwi</td><td> 3072</td><td> 27</td><td> 86</td><td> 50.1976284 6</td><td> 99.21875</td><td>blastp</td>

<td> 2865</td><td>tówi | gb166 | FG406415_T1</td><td>Kiwi</td><td> 3073</td><td> 27</td><td> 81</td><td> 54.1501976 3</td><td> 100</td><td>blastp</td>

<td> 2866</td><td>kiwi | gb166 | FG406885 T1</td><td>Kiwi</td><td> 3074</td><td> 27</td><td> 84</td><td>99.2094861 Z</td><td> 99.603174 6</td><td>blastp</td>

<td> 2867</td><td>liriodend ron | gb 166 | CK744430 T 1</td><td>liriodendron</td><td> 3075</td><td> 27</td><td> 81</td><td>99.2094861 J.</td><td> 99.603174 6</td><td>blastp</td>

<td> 2868</td><td>poppy | gb166 | FG608493 T1</td><td>poppy</td><td> 3076</td><td> 27</td><td> 84</td><td>83.0039525 J</td><td> 99.526066 35</td><td>blastp</td>

109/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N “-</td><td>Hom. Dp ID</td><td> %</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 2869</td><td>soybean | gb167 | EV269611_T1</td><td>Soy</td><td> 3077</td><td> 27</td><td> 86</td><td>60.0790513 R</td><td> 96.202531 65</td><td>blastp</td>

<td> 2870</td><td>amborella | gb166 | CD482678_T1</td><td>amborella</td><td> 3078</td><td> 28</td><td> 82</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2871</td><td>cenchrus | gb166 | BM084541_T1</td><td>cenchrus</td><td> 3079</td><td> 28</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2872</td><td>leymus | gb16S | EG376267_T1</td><td>leymus</td><td> 3080</td><td> 28</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2873</td><td>leymus | gb166 | EG386149_T1</td><td>leymus</td><td> 3081</td><td> 28</td><td> 80·</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2874</td><td>walnuts | gb166 | EL895384_T1</td><td>nuts</td><td> 3082</td><td> 28</td><td> 83</td><td> 82</td><td> 94.495412 84</td><td>blastp</td>

<td> 2875</td><td>amborella | gb166 | CD481950_T1</td><td>amborella</td><td> 3083</td><td> 30</td><td> 88</td><td> 98.2638888 9</td><td>98.954703 R3</td><td>blastp</td>

<td> 2876</td><td>an tirrh in um | GB 166 | AJ796874_T 1</td><td>antirrhinum</td><td> 3084</td><td> 30</td><td> 86</td><td> 93.4027777 8</td><td> 100</td><td>blastp</td>

<td> 2877</td><td>antirrhinum | gb166 | AJ798039_T 1</td><td>antirrhinum</td><td> 3085</td><td> 30</td><td> 84</td><td> 73.2638888 9</td><td> 99.526066 35</td><td>blastp</td>

<td> 2878</td><td>antirrhinum | gb166 | AJ792331 T1 '' -</td><td>ãntírrhinum ~ -</td><td> 3086 -</td><td> 30 . ..</td><td> 88</td><td> 85.0694444 4</td><td> 100</td><td>blastp</td>

<td> 2879</td><td>antirrhinum | gb166 | AJ558770_T1</td><td>antirrhinum</td><td> 3087</td><td> 30</td><td> 86</td><td> 98.2638888 9</td><td> 99.300699 3</td><td>blastp</td>

<td> 2880</td><td>banana] gb167 | FF558844_T1</td><td>banana</td><td> 3088</td><td> 30</td><td> 88</td><td> 98.2638888 9</td><td> 98.951048 95</td><td>blastp</td>

<td> 2881</td><td>bean | gb167 | CA898412_T1</td><td>be a n</td><td> 3089</td><td> 30</td><td> 81</td><td> 98.2638888 9</td><td> 99.303135 89</td><td>blastp</td>

<td> 2882</td><td>bruguiera | gb166 | BP941115_I1</td><td>bruguiera</td><td> 3090</td><td> 30</td><td> 86</td><td> 52.7777777 8</td><td> 95</td><td>blastp</td>

<td> 2883</td><td>bruguiera | gb166 | BP939033_T1</td><td>bruguiera</td><td> 3091</td><td> 30</td><td> 85</td><td> 97.9166666 7</td><td> 99.303135 89</td><td>blastp</td>

<td> 2884</td><td>cenchrus | gb166 | EB656428_T1</td><td>cenchrus</td><td> 3092</td><td> 30</td><td> 85</td><td>98Í2638888 9</td><td> 98.958333 33</td><td>blastp</td>

<td> 2885</td><td>centaureajgb166 | EH767475_T1</td><td>centaurea</td><td> 3093</td><td> 30</td><td> 86</td><td> 98.2638888 9</td><td> 98.954703 83</td><td>blastp</td>

<td> 2886</td><td>centaurea | gb166 | EL935569_T 1</td><td>centaurea</td><td> 3094</td><td> 30</td><td> 86</td><td> 98.2638888 9</td><td> 98.958333 33</td><td>blastp</td>

<td> 2887</td><td>cycas | gb166 | CB089724_T1</td><td>conical</td><td> 3095</td><td> 30</td><td> 84</td><td> 98.2638888 9</td><td> 98.954703 83</td><td>blastp</td>

<td> 2888</td><td>cycas | gb166 | CB088798_T1</td><td>conical</td><td> 3096</td><td> 30</td><td> 83</td><td> 98.2638888 9</td><td> 98.269896 19</td><td>blastp</td>

<td> 2889</td><td>eucalyptus | gb166 | CD668044_T1</td><td>eucalyptus</td><td> 3097</td><td> 30</td><td> 84</td><td> 98.2638888 9</td><td> 99.305555 56</td><td>blastp</td>

<td> 2890</td><td>eucalyptus | gb166 | AW191311_T1</td><td>eucalyptus</td><td> 3098</td><td> 30</td><td> 87</td><td> 98.2638888 9</td><td> 98.954703 83</td><td>blastp</td>

<td> 2891</td><td>kiwi | gb166 | FG403284_T1</td><td>Kiwi</td><td> 3099</td><td> 30</td><td> 85</td><td> 98.2638888 9</td><td> 99.300699 3</td><td>l_blastp</td>

<td> 2892</td><td>kiwi | gb166 | FG404130_T1</td><td>Kiwi</td><td> 3100</td><td> 30</td><td> 86</td><td> 98.2638888 9</td><td> 99,300699 3</td><td>blastp</td>

<td> 2893</td><td>kiwi | gb166 | FG396354_T1</td><td>Kiwi</td><td> 3101</td><td> 30</td><td> 90</td><td> 98.2638888 9</td><td> 98.951048 95</td><td>blastp</td>

<td> 2894</td><td>kiwi | gb166 | FG404890_T1</td><td>Kiwi</td><td> 3102</td><td> 30</td><td> 85</td><td> 72.2222222 2</td><td> 99.521531 1</td><td>blastp</td>

<td> 2895</td><td>kiwi | gb166 | FG417962_T1</td><td>Kiwi</td><td> 3103</td><td> 30</td><td> 87</td><td> 62.1527777 8</td><td> 99.444444 .44</td><td>blastp</td>

<td> 2896</td><td>kiwi | gb166 | FG403188_T1</td><td>Kiwi</td><td> 3104</td><td> 30</td><td> 89</td><td> 98.2638888 .9</td><td> 96.917808 22</td><td>blastp</td>

<td> 2897</td><td>kiwi | gb166 | FG403647_T1</td><td>Kiwi</td><td> 3105</td><td> 30</td><td> 85</td><td> 68.0555555 6</td><td> 99.492385 79</td><td>blastp</td>

<td> 2898</td><td>kiwi | gb166 | FG397405_T1</td><td>Kiwi</td><td> 3106</td><td> 30</td><td> 85</td><td> 98.2638888 9</td><td> 99.300699 3</td><td>blastp</td>

<td> 2899</td><td>leymus | gb166 | EG384635_T1</td><td>leymus</td><td> 3107</td><td> 30</td><td> 85</td><td> 99.3055555 6</td><td> 99.655172 41</td><td>blastp</td>

<td> 2900</td><td>leymus | gb166 | CN466016_T1</td><td>leymus</td><td> 3108</td><td> 30</td><td> 83</td><td> 98.2638888 9</td><td>989.72627 J</td><td>blastp</td>

<td> 2901</td><td>leymus | gb166 | CN466006_T1</td><td>leymus</td><td> 3109</td><td> 30</td><td> 83</td><td> 98.2638888 9</td><td>98.972602 Z4</td><td>blastp</td>

<td> 2902</td><td>leymus | gb166 | EG376500_T1</td><td>leymus</td><td> 3110</td><td> 30</td><td> 83</td><td> 98.2638888 .2</td><td> 98.972602 74</td><td>blastp</td>

<td> 2903</td><td>liriodendron | gb166 | CK749885 T1</td><td>liriodendron</td><td> 3111</td><td> 30</td><td> 89</td><td> 98.2638888 9</td><td> 98.954703 .83</td><td>blastp</td>

<td> 2904</td><td>liriod dill n | gb166 | CV002697 T 1</td><td>liriodendron</td><td> 3112</td><td> 30</td><td> 88</td><td> 98.2638888 9</td><td> 98.954703 .83</td><td>blastp</td>

<td> 2905</td><td>lovegrass | g b167 | DN480914 T 1</td><td>lovegrass</td><td> 3113</td><td> 30</td><td> 85</td><td> 98.2638888 9</td><td>98.961937 J2</td><td>blastp</td>

<td> 2906</td><td>nuphar | gb166 | CD472824 T1</td><td>nuphar</td><td> 3114</td><td> 30</td><td> 86</td><td>98.2638888 J</td><td>98.947368 A2</td><td>blastp</td>

110/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFQ N «·</td><td>Hom. From ID</td><td>% Iripnt</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> .2907</td><td>nuphar | gb166 | CD472574_T1</td><td>nuphar</td><td> 3115</td><td> 30</td><td> 86</td><td> 98.2638888 9</td><td> 98.947368 42</td><td>blastp</td>

<td> 2908</td><td>nuphar | gb166 | CD473614_T1</td><td>nuphar</td><td> 3116</td><td> 30</td><td> 84</td><td> 51.7361111 1</td><td> 98.026315 79</td><td>blastp</td>

<td> 2909</td><td>peanut | gb167 | ES759056_T1</td><td>peanut</td><td> 3117</td><td> 30</td><td> 83</td><td> 64.2361111 1</td><td> 100</td><td>blastp</td>

<td> 2910</td><td>poppy | gb166 | FE966578_T1</td><td>poppy</td><td> 3118</td><td> 30</td><td> 83</td><td> 98.6111111 1</td><td> 98.620689 66</td><td>blastp</td>

<td> 2911</td><td>pseudoroegneria || gb167 | FF344096_T1</td><td>pseudoroegneri The</td><td> 3119</td><td> 30</td><td> 82</td><td> 98.2638888 9</td><td> 98.972602 74</td><td>blastp</td>

<td> 2912</td><td>pseudoroegneria |] gb167 | FF346975_T1</td><td>pseudoroegneri a</td><td> 3120</td><td> 30</td><td> 85</td><td> 98.6111111 1</td><td> 98.625429 55</td><td>blastp</td>

<td> 2913</td><td>pseudoroegneria || gb167 | FF342094_T1</td><td>pseudoroegneri a</td><td> 3121</td><td> 30</td><td> 83</td><td> 98.2638888 9</td><td> 98.972602 74</td><td>blastp</td>

<td> 2914</td><td>soybean [gb167CA898412_T 1</td><td>Soy</td><td> 3122</td><td> 30</td><td> 84</td><td> 94.4444444 4</td><td> 95.087719 3</td><td>blastp</td>

<td> 2915</td><td>switchgrass | gb167 | FE621985_T1</td><td>switchgrass</td><td> 3123</td><td> 30</td><td> 87</td><td> 52.4305555 6</td><td> 98.692810 46</td><td>blastp</td>

<td> 2916</td><td>switchgrass | gb167 | DN141371 T1 ''</td><td>switchgrass</td><td> 3124 .</td><td> 30 </td><td> 86</td><td> 98.2638888 9- </td><td> 989.58333 33. .</td><td>blastp</td>

<td> 2917</td><td>tamarix | gb166 | CF199714_T1</td><td>tamarix</td><td> 3125</td><td> 30</td><td> 88</td><td> 78.4722222 2</td><td> 99.122807 02</td><td>blastp</td>

<td> 2918</td><td>tamarix | gb166 | CF226851_T1</td><td>tamarix</td><td> 3126</td><td> 30</td><td> 85</td><td> 98.2638888 9</td><td> 99.303135 89</td><td>blastp</td>

<td> 2919</td><td>walnuts | gb166 | CB303847_T1</td><td>nuts</td><td> 3127</td><td> 30</td><td> 84</td><td> 98.2638888 9</td><td> 99.310344 83</td><td>blastp</td>

<td> 2920</td><td>walnuts (gb166 | CV194951_T1</td><td>nuts</td><td> 3128</td><td> 30</td><td> 86</td><td> 98.2638888 9</td><td> 99.303135 89</td><td>blastp</td>

<td> 2921</td><td>walnuts | gb166 | CV196162_T1</td><td>nuts</td><td> 3129</td><td> 30</td><td> 85</td><td> 98.2638888 9</td><td> 99.315068 49</td><td>blastp</td>

<td> 2922</td><td>zamia | gb166 | FD765004_T1</td><td>zamia</td><td> 3130</td><td> 30</td><td> 84</td><td> 98.2638888 9</td><td> 98.954703 83</td><td>blastp</td>

<td> 2923</td><td>antirrhinum | gb166 | AJ799752_T1</td><td>an tirrhinum</td><td> 3131 -</td><td> 31</td><td> 80</td><td> 987.854251</td><td> 100</td><td>blastp</td>

<td> 2924</td><td>kiwi | gb166 | FG400670_T1</td><td>Kiwi</td><td> 3132</td><td> 31</td><td> 82</td><td> 74.0890688 3</td><td> 100</td><td>blastp</td>

<td> 2925</td><td>kiwi | gb166 | FG418275_T1</td><td>Kiwi</td><td> 3133</td><td> 31</td><td> 83</td><td> 98.7854251</td><td> 98.387096 77</td><td>blastp</td>

<td> 2926</td><td>centaurèa | gb166 | El_931588_T1</td><td>centaurea</td><td> 3134</td><td> 34</td><td> 83</td><td> 88.5714285 7</td><td> 32.740213 52</td><td>blastp</td>

<td> 2927</td><td>soybean | gb167 | AWI19586_T1</td><td>Soy</td><td> 3135</td><td> 34</td><td> 83</td><td> 94.2857142 9</td><td> 36.263736 26</td><td>blastp</td>

<td> 2928</td><td>soybean | gb167 | AW573764_T1</td><td>Soy</td><td> 3136</td><td> 34</td><td> 83</td><td> 94.2857142 9</td><td> 36.666666 67</td><td>blastp</td>

<td> 2929</td><td>amborella | gb166 | FD44O187_T1</td><td>amborella</td><td> 3137</td><td> 35</td><td> 81</td><td> 65.7627118 6</td><td> 100</td><td>blastp</td>

<td> 2930</td><td>centaurea | gb166EL931433_T 1</td><td>centaurea</td><td> 3138</td><td> 35</td><td> 82</td><td> 97.6271186 4</td><td> 96.610169 49</td><td>blastp</td>

<td> 2931</td><td>euca lyptus | gb 166 jC D668486 „T 1</td><td>eucalyptus</td><td> 3139</td><td> 35</td><td> 85</td><td> 73.8983050 8</td><td> 100</td><td>blastp</td>

<td> 2932</td><td>petunia | gb166 | DC243166_T1</td><td>petunia</td><td> 3140</td><td> 36</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2933</td><td>amborella | gb166 | CD482946_T1</td><td>amborella</td><td> 3141</td><td> 39</td><td> 82</td><td> 99.6415770 6</td><td> 98.939929 33</td><td>blastp</td>

<td> 2934</td><td>antirrhinum | gb166 | AJ559435_T1</td><td>antirrhinum</td><td> 3142</td><td> 39</td><td> 88</td><td> 99.2831541 2</td><td> 98.576512 46</td><td>blastp</td>

<td> 2935</td><td>antirrhinum | gb166 | AJ793990_T1</td><td>antirrhinum</td><td> 3143</td><td> 39</td><td> 89</td><td> 71.3261648 7</td><td> 100</td><td>blastp</td>

<td> 2936</td><td>antirrhinum | gb166 | AJ559760_T1</td><td>antirrhinum</td><td> 3144</td><td> 39</td><td> 83</td><td> 61.2903225 8</td><td>87.244897 9fi</td><td>blastp</td>

<td> 2937</td><td>antirrhinum [gb166 | AJ558545_T1</td><td>antirrhinum</td><td> 3145</td><td> 39</td><td> 88</td><td> 88.5304659 5</td><td> 100</td><td>blastp</td>

<td> 2938</td><td>bear&gt; | gb167 | FE682762_T1</td><td>bean</td><td> 3146</td><td> 39</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2939</td><td>beanjgb167 | CV531088_T1</td><td>bean</td><td> 3147</td><td> 39</td><td> 86</td><td> 99.6415770 6</td><td> 98.947368 .42</td><td>blastp</td>

<td> 2940</td><td>bean | gb167 | CA907460_T1</td><td>bean</td><td> 3148</td><td> 39</td><td> 86</td><td> 99.6415770 6</td><td> 98.947368 42</td><td>blastp</td>

<td> 2941</td><td>cenchrus | gb166 | EB655519 T 1</td><td>cenchrus</td><td> 3149</td><td> 39</td><td> 83</td><td> 97.4910394 3</td><td>95.862068 âZ</td><td>blastp</td>

<td> 2942</td><td>centaurea | gb166 | EL934360 T1</td><td>centaurea</td><td> 3150</td><td> 39</td><td> 88</td><td> 53.7634408 6</td><td>96.153846 J5</td><td>blastp</td>

<td> 2943</td><td>centaurea | gb166 | EH751120 T1</td><td>centaurea</td><td> 3151</td><td> 39</td><td> 80</td><td> 88.5304659 5</td><td> 100</td><td>blastp</td>

<td> 2944</td><td>centaurea | gb166 | EH752971 T1</td><td>centaurea</td><td> 3152</td><td> 39</td><td> 87</td><td> 83.5125448</td><td> 100</td><td>blastp</td>

111/175

<td>Polinuc IC SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N⁰·</td><td>Hom. Da ΙΓ</td><td> %</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 2945</td><td>centaurea | gb166 | EH768434_T1</td><td>centaurea</td><td> 3153</td><td> 39</td><td> 80</td><td> 91.7562724</td><td> 99.616858 94</td><td>blastp</td>

<td> 2946</td><td>centaurea | gb166EH767287_T1</td><td>centaurea</td><td> 3154</td><td> 39</td><td> 83</td><td> 83.1541218 6</td><td>1G0</td><td>blastp</td>

<td> 2947</td><td>cichorium | gb166IDT212008_T1</td><td>cichorium</td><td> 3155</td><td> 39</td><td> 82</td><td> 89.9641577 1</td><td> 100</td><td>blastp</td>

<td> 2948</td><td>cichorium | gb166IEL354583_T1</td><td>cichorium</td><td> 3156</td><td> 39</td><td> 84</td><td> 86.7383512 5</td><td>97.619047 fi2</td><td>blastp</td>

<td> 2949</td><td>eucalyptus | gb166 | CD668553_T 1</td><td>eucalyptus</td><td> 3157</td><td> 39</td><td> 87</td><td> 83.8709677 4</td><td> 100</td><td>blastp</td>

<td> 2950</td><td>eucalyptus | gb166 | CD668534_T1</td><td>eucalyptus</td><td> 3158</td><td> 39</td><td> 80</td><td> 69.8924731 2</td><td> 100</td><td>blastp</td>

<td> 2951</td><td>eucalyptus | gb166 | CD668523U1</td><td>eucalyptus</td><td> 3159</td><td> 39</td><td> 88</td><td> 100</td><td> 99.300699 3</td><td>blastp</td>

<td> 2952</td><td>eucalyptus | gb166 | CD669942_T1</td><td>eucalyptus</td><td> 3160</td><td> 39</td><td> 83</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2953</td><td>kiwi | gb166 | FG405216_T1</td><td>Kiwi</td><td> 3161</td><td> 39</td><td> 84</td><td> 100</td><td> 99.293286 22</td><td>blastp.</td>

<td> 2954</td><td>kiwi | gb166 | FG495821_T1</td><td>Kiwi</td><td> 3162</td><td> 39</td><td> 86</td><td> 50.1792114 7</td><td> 100</td><td>blastp</td>

<td> 2955</td><td>kiwi | gb166 | FG417997_T1</td><td>Kiwi</td><td> 3163</td><td> 39</td><td> 86</td><td> 64.5161290 .3</td><td> 100</td><td>blastp</td>

<td> 2956</td><td>kiwt | gb166 | FG4O3725_T1</td><td>Kiwi</td><td> 3164</td><td> 39</td><td> 83</td><td> 73.1182795 7</td><td> 100</td><td>blastp</td>

<td> 2957</td><td>kiwi | gb166 | FG397310_T1</td><td>Kiwi</td><td> 3165</td><td> 39</td><td> 88</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2958</td><td>kiwi | gb166 | FG408531_T1</td><td>Kiwi</td><td> 3166</td><td> 39</td><td> 83</td><td> 100</td><td> 99.303135 89</td><td>blastp</td>

<td> 2959</td><td>leymus | gb166 | EG381236_T1</td><td>leymus</td><td> 3167</td><td> 39</td><td> 81</td><td> 55.5555555 6</td><td> 97.468354 43</td><td>blastp</td>

<td> 2960</td><td>leymus | gb166 | EG376087_T1:</td><td>leymus</td><td> 3168</td><td> 39</td><td> 80</td><td> 96.7741935 5</td><td> 96.551724 14</td><td>blastp</td>

<td> 2961</td><td>leymus | gb166CD808804_T1</td><td>leymus</td><td> 3169</td><td> 39</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2962</td><td>leymus | gb166 | EG378918_T1</td><td>leymus</td><td> 3170</td><td> 39</td><td> 86</td><td> 51.2544802 9</td><td> 100</td><td>blastp</td>

<td> 2963</td><td>! iriodendron | gb166 | CK761396 — T1</td><td>liriodendron</td><td> 3171</td><td> 39</td><td> 81</td><td> 99.6415770 6</td><td> 98.961937 72</td><td>blastp</td>

<td> 2964</td><td>nuphar | gb166 | ES730700_T1</td><td>nuphar</td><td> 3172</td><td> 39</td><td> 81</td><td> 61.2903225 8</td><td> 98.275862 07</td><td>blastp</td>

<td> 2965</td><td>poppy | gb166 | FE965621_T1</td><td>poppy</td><td> 3173</td><td> 39</td><td> 84</td><td> 88.5304659 5</td><td> 100</td><td>blastp</td>

<td> 2966</td><td>pseudoroegneria || gb167 | FF340233_T1</td><td>pseudoroegneri a</td><td> 3174</td><td> 39</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2967</td><td>switchg rass | gb167 | F E638368_T 1</td><td>switchgrass</td><td> 3175</td><td> 39</td><td> 80</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2968</td><td>switchgrass | gb167 | FE657460_T 1</td><td>rass switchg</td><td> 3176</td><td> 39</td><td> 80</td><td> 99.2831541 2</td><td> 98.958333 33</td><td>blastp</td>

<td> 2969</td><td>switchg rass | gb167JFE641178_T1</td><td>switchgrass</td><td> 3177</td><td> 39</td><td> 82</td><td> 78.8530465 9</td><td>86.590038 H</td><td>blastp</td>

<td> 2970</td><td>switchg rass | gb167 | FE619224_T1</td><td>switchgrass</td><td> 3178</td><td> 39</td><td> 82</td><td> 94.2652329 7</td><td> 95.729537 37</td><td>blastp</td>

<td> 2971</td><td>switchgrass | gb167 | FE657460_T2</td><td>switchgrass</td><td> 3179</td><td> 39</td><td> 81</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2972</td><td>tamarix | gb166EH051524 T1</td><td>tamarix</td><td> 3180</td><td> 39</td><td> 82</td><td> 56.2724014 3</td><td>98.742138 3Ê</td><td>blastp</td>

<td> 2973</td><td>walnuts | gb166 | CB304207 T1</td><td>nuts</td><td> 3181</td><td> 39</td><td> 84</td><td> 100</td><td> 99.303135 32</td><td>blastp</td>

<td> 2974</td><td>walnuts | gb166] CB303561 T 1</td><td>nuts</td><td> 3182</td><td> 39</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2975</td><td>walnuts | gb166 | EL892579 T1</td><td>nuts</td><td> 3183</td><td> 39</td><td> 84</td><td> 89.6057347 7</td><td> 98.823529 41</td><td>blastp</td>

<td> 2976</td><td>zamia | gb166 | DY032141 T1</td><td>zamia</td><td> 3184</td><td> 39</td><td> 80</td><td> 96.0573476 7</td><td>94.326241 J3</td><td>blastp</td>

<td> 2977</td><td>zamiA | gb166 | FD764669 T1</td><td>zamia</td><td> 3185</td><td> 39</td><td> 80</td><td> 99.6415770 6</td><td>98.924731 ja</td><td>blastp</td>

<td> 2978</td><td>zamia | gb166 | DY034152 T1</td><td>zamia</td><td> 3186</td><td> 39</td><td> 80</td><td> 94.6236559 1</td><td>92.253521 JL3</td><td>blastp</td>

<td> 2979</td><td>antirrhinum | gb166 | AJ568195 T 1</td><td>antirrhinum</td><td> 3187</td><td> 40</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2980</td><td>antirrhinum) | gb166 | AJ568110 T1</td><td>antirrhinum</td><td> 3188</td><td> 40</td><td> 87</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2981</td><td>bananA | gb167 | FL657842_T1</td><td>banana</td><td> 3189</td><td> 40</td><td> 81</td><td>83.0388692 J</td><td> 92.490118 58</td><td>blastp</td>

<td> 2982</td><td>bruguiera | gb166 | EF126757_T1</td><td>bruguiera</td><td> 3190</td><td> 40</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

112/175

<td>Polinuc IC SFO</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N ° ·</td><td>Hom. Dp in</td><td> %</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 2983</td><td>centaurea | gb166 | EH765776_T1</td><td>centaurea</td><td> 3191</td><td> 40</td><td> 84</td><td> 92.5795053</td><td> 100</td><td>blastp</td>

<td> 2984</td><td>eucalyptus | gb166 | AJ627837_T1</td><td>eucalyptus</td><td> 3192</td><td> 40</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2985</td><td>kiwi | gb166 | FG411924_T1</td><td>Kiwi</td><td> 3193</td><td> 40</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2986</td><td>kiwi | gb166 | FG400706_T1</td><td>Kiwi</td><td> 3194</td><td> 40</td><td> 85</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2987</td><td>kiwi] gb166 | FG418898_T1</td><td>Kiwi</td><td> 3195</td><td> 40</td><td> 84</td><td> 71.0247349 8</td><td> 98.5</td><td>blastp</td>

<td> 2988</td><td>klwi | gb166 | FG420187_T1</td><td>Kiwi</td><td> 3196</td><td> 40</td><td> 85</td><td> 72.7915194 3</td><td> 100</td><td>blastp</td>

<td> 2989</td><td>kiwi | gb166 | FG398010_T1</td><td>Kiwi</td><td> 3197</td><td> 40</td><td> 86</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2990</td><td>petunia | gb166AF452012_T1</td><td>petunia</td><td> 3198</td><td> 40</td><td> 88</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2991</td><td>tamarix | gb166 | CV12177211</td><td>tamarix.</td><td> 3199</td><td> 40</td><td> 83</td><td> 100</td><td> 100 ,</td><td>blastp</td>

<td> 2992</td><td>walnuts | gb166 | EL893208_T1</td><td>nuts</td><td> 3200</td><td> 40</td><td> 84</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 2993</td><td>bean | gb167 | FD786218_T1</td><td>bean</td><td> 3201</td><td> 41</td><td> 83</td><td> 58.6092715 2</td><td> 100</td><td>blastp</td>

<td> 2994</td><td>citrus | gb166 | CX074333_T2</td><td>citrus</td><td> 3202</td><td> 41</td><td> 81</td><td> 72.5165562 9</td><td> 99.541284 4</td><td>blastp</td>

<td> 2995</td><td>citrus | gb166 | CX074333_T1</td><td>citrus</td><td> 3203</td><td> 41</td><td> 83</td><td> 96.0264900 7</td><td> 91.428571 43 -</td><td>blastp</td>

<td> 2996</td><td>kiwi [gb166 | FG420468_T2</td><td>Kiwi</td><td> 3204</td><td> 41</td><td> 84</td><td> 87.0860927 2</td><td> 97.047970 48</td><td>blastp</td>

<td> 2997</td><td>kiwi | gb166 | FG420468_T1</td><td>Kiwi</td><td> 3205</td><td> 41</td><td> 83</td><td> 58.9403973 5</td><td> 95.698924 7.3</td><td>blastp</td>

<td> 2998</td><td>tamarix | gb166 | EG972096_T1</td><td>tamarix</td><td> 3206</td><td> 42</td><td> 82</td><td> 60.9756097 6 '</td><td> 95.238095 24</td><td>blastp</td>

<td> 2999</td><td>pseudoroegneria || gb167 | FF353501_T1</td><td>pseudoroegneri a</td><td> 3207</td><td> 43</td><td> 86</td><td> 98.3935743</td><td> 98.795180 72</td><td>blastp</td>

<td> 3000</td><td>switchgrass | gb167 | FE646459_T1</td><td>switchgrass</td><td> 3208</td><td> 43</td><td> 86</td><td> 98.7951807 2</td><td> 99.196787 15</td><td>blastp</td>

<td> 3001</td><td>switchgrass | gb167 | FL887003_T1</td><td>switchgrass</td><td> 3209</td><td> 43</td><td> 84</td><td> 71.4859437 8</td><td> 93.229166 67</td><td>blastp</td>

<td> 3002</td><td>wheat | gb164 | BE403397_T1</td><td>wheat</td><td> 3210</td><td> 43</td><td> 86</td><td> 98.3935743</td><td> 98.795180 72</td><td>blastp</td>

<td> 3003</td><td>leymus | gb166 | EG381168_T1</td><td>leymus-</td><td> 3211</td><td> 44</td><td> 96</td><td> 52.0161290 3</td><td> 100</td><td>blastp</td>

<td> 3004</td><td>pseudoroegneria || gb167 | FF341567_T1</td><td>pseudoroegneri a</td><td> 3212</td><td> 44</td><td> 97</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 3005</td><td>switchgrass | gb167 | FE618822_T1</td><td>switchgrass</td><td> 3213</td><td> 44</td><td> 91</td><td> 100</td><td> 100</td><td>blastp</td>

<td> 3006</td><td>switchgrass | gb167 | FE633786_T1</td><td>switchgrass</td><td> 3214</td><td> 44</td><td> 92</td><td> 78.2258064 5</td><td> 100</td><td>blastp</td>

<td> 3007</td><td>euca lyptusjg b 166 | C B967586_T 1</td><td>eucalyptus</td><td> 3215</td><td> 46</td><td> 84</td><td> 97.5155279 5</td><td> 60.784313 73</td><td>blastp</td>

<td> 3008</td><td>liriodendron | gb166 | CK762443_T1</td><td>liriodendron</td><td> 3216</td><td> 46</td><td> 80</td><td> 74.5341614 2</td><td> 100</td><td>blastp</td>

<td> 3009</td><td>switchgrass | gb167 | FE615387 T 1</td><td>switchgrass</td><td> 3217</td><td> 46</td><td> 90</td><td> 100</td><td> 61.389961 30</td><td>blastp</td>

<td> 3010</td><td>walnuts | gb166 | EL893973 T1</td><td>nuts</td><td> 3218</td><td> 46</td><td> 82</td><td> 97.5155279 5</td><td> 55.474452 .55</td><td>blastp</td>

<td> 3011</td><td>bean | gb167 | FD782805_T1</td><td>bean</td><td> 3219</td><td> 47</td><td> 91</td><td> 88.1720430 1</td><td> 79.611650 49</td><td>blastp</td>

<td> 3012</td><td>bean | gb167 | EY457935_T1</td><td>bean</td><td> 3220</td><td> 47</td><td> 82</td><td> 100</td><td> 38.589211 62</td><td>blastp</td>

<td> 3013</td><td>cichorium [gb166 | EH685648 T2</td><td>cichorium</td><td> 3221</td><td> 47</td><td> 80</td><td> 100</td><td>67.391304 J5</td><td>blastp</td>

<td> 3014</td><td>cichorium | gb166 | EH685648 T1</td><td>cichorium</td><td> 3222</td><td> 47</td><td> 80</td><td> 100</td><td> 32.179930 8</td><td>blastp</td>

<td> 3015</td><td>citrus | gb166 | CK701147 T1</td><td>citrus</td><td> 3223</td><td> 47</td><td> 90</td><td> 100</td><td>76.859504 J5</td><td>blastp</td>

<td> 3016</td><td>citrus | gb166 | CX544905 T1</td><td>citrus</td><td> 3224</td><td> 47</td><td> 81</td><td> 79.5698924 7</td><td> 88.095238 1</td><td>blastp</td>

<td> 3017</td><td>cycas | gb166 | CB088978_T1</td><td>conical</td><td> 3225</td><td> 47</td><td> 82</td><td>87.0967741 J</td><td> 30.681818 18</td><td>blastp</td>

<td> 3018</td><td>cycas | gb166EX920749_T1</td><td>conical</td><td> 3226</td><td> 47</td><td> 88</td><td> 100</td><td> 76.229508 2</td><td>blastp</td>

<td> 3019</td><td>kiwi | gb166 | FG429765_T1</td><td>Kiwi</td><td> 3227</td><td> 47</td><td> 84</td><td>98.9247311 J</td><td> 77.966101 69</td><td>blastp</td>

<td> 3020</td><td>leymus | gb166 | CN456394_I1</td><td>leymus</td><td> 3228</td><td> 47</td><td> 87</td><td> 100</td><td> 79.487179 49</td><td>blastp</td>

113/175

<td>Polinuc ID SEQ</td><td>Group's name</td><td>Body</td><td>Polipep.lD SFO N⁰·</td><td>Hom. From ID</td><td>% lítent</td><td>Cob. Query</td><td>% Ind. Cob.</td><td>Algorithm</td>

<td> 3021</td><td>leymus | gb166 | EG376019_T1</td><td>leymus</td><td> 3229</td><td> 47</td><td> 88</td><td> 100</td><td> 32.746478 87</td><td>blastp</td>

<td> 3022</td><td>leymus | gb166 | EG390723_T1</td><td>leymus</td><td> 3230</td><td> 47</td><td> 81</td><td> 100</td><td> 31.958762 89</td><td>blastp</td>

<td> 3023</td><td>leymus | gb166 | EG387193_T1</td><td>leymus</td><td> 3231</td><td> 47</td><td> 81</td><td> 100</td><td> 32.179930 8</td><td>blastp</td>

<td> 3024</td><td>nuphar | gb166 | CD473277_T1</td><td>nuphar</td><td> 3232</td><td> 47</td><td> 91</td><td> 100</td><td> 75.609756 1</td><td>blastp</td>

<td> 3025</td><td>nuphar | gb166FD384794_T1</td><td>nuphar</td><td> 3233</td><td> 47</td><td> 86</td><td> 96.7741935 5</td><td> 81.081081 08</td><td>blastp</td>

<td> 3026</td><td>nuphar | gb166CD475538_T1</td><td>nuphar</td><td> 3234</td><td> 47</td><td> 89</td><td> 100</td><td> 69.924812 03</td><td>blastp</td>

<td> 3027</td><td>nuphar | gb166CD472711_T1</td><td>nuphar</td><td> 3235</td><td> 47</td><td> 91</td><td> 100</td><td> 48.947368 42</td><td>blastp</td>

<td> 3028</td><td>petunia | gb166DC240378_T1</td><td>petunia</td><td> 3236</td><td>V</td><td> 92</td><td> 58.0645161 3</td><td> 98.181818 18</td><td>blastp</td>

<td> 3029</td><td>pseudoroegneria || gb167 | FF344283_T1</td><td>pseudoroegneri The</td><td> 3237</td><td> 47</td><td> 87</td><td> 100</td><td> 32.746478 87</td><td>blastp</td>

<td> 3030</td><td>sorghum | gb161.crp | Al724931 T1</td><td>sorghum</td><td> 3238</td><td> 47</td><td> 92</td><td> 100</td><td> 32.517482 52</td><td>blastp</td>

<td> 3031</td><td>switchgrass | gb167 | FL923354_T1</td><td>switchgrass</td><td> 3239</td><td> 47</td><td> 82</td><td> 100</td><td> 33.695652 17</td><td>blastp</td>

<td> 3032</td><td>switchgrass | gb167 | FE657461_T1</td><td>switchgrass</td><td> 3240</td><td> 47</td><td> 92</td><td> 98.9247311 8</td><td> 74.796747 97</td><td>blastp</td>

<td> 3033</td><td>switchgrass | gb167 | FL765830_T1</td><td>switchgrass</td><td> 3241</td><td> 47</td><td> 82</td><td> 100</td><td> 72.222222 22</td><td>blastp</td>

<td> 3034</td><td>switchgrass | gb167 | FL915169_T1</td><td>switchgrass</td><td> 3242</td><td> 47</td><td> 83</td><td> 97.8494623 7</td><td> 87.5</td><td>blastp</td>

<td> 3035</td><td>tamarix | gb166 | EH054604_T1</td><td>tamarix</td><td> 3243</td><td> 47</td><td> 83</td><td> 100</td><td> 65.647058 82</td><td>tblastn</td>

<td> 3036</td><td>walnuts | gb166 | CB303798 T1</td><td>nuts</td><td> 3244</td><td> 47</td><td>⁹¹</td><td> 100</td><td> 80.172413 79</td><td>blastp</td>

<td> 3037</td><td>bruguiera | gb166 | BP942548_T 1</td><td>bruguiera</td><td> 3245</td><td> 48</td><td> 32</td><td> 52.0547945 2</td><td> 100</td><td>blastp</td>

<td> 3038</td><td>bruguiera | gb166 | BP938825_T 1</td><td>bruguiera</td><td> 3246</td><td> 48</td><td> 39</td><td> 56.6210045 7</td><td> 91.176470 59</td><td>blastp</td>

<td> 3039</td><td>centaurea | gb 166] E H739326_T1</td><td>centaurea</td><td> 3247</td><td> 48</td><td> 83</td><td> 87.2146118 7</td><td> 50</td><td>tblastn</td>

<td> 3040</td><td>eucalyptus | gb 166 | C D669176 T 1</td><td>eucalyptus</td><td> 3248</td><td> 48</td><td> 87</td><td> 56.1643835 .6</td><td> 91.791044 78</td><td>blastp</td>

<td> 3041.</td><td>leymus | gb166 | EG382428 T1</td><td>leymus</td><td> 3249</td><td> 48</td><td> 80</td><td> 52.0547945 2</td><td> 90.476190 48</td><td>blastp</td>

<td> 3042</td><td>liriodendron | gb166 | CK743477 T1</td><td>liriodendron</td><td> 3250</td><td> 48</td><td> 81</td><td> 94.0639269 4</td><td> 54.545454 55</td><td>tblastn</td>

<td> 3043</td><td>marchantia | gb166 | BJ840587 T 1</td><td>marchant ia</td><td> 3251</td><td> 48</td><td> 83</td><td> 94.0639269 4</td><td> 72.535211 27</td><td>blastp</td>

<td> 3044</td><td>marchantia | gb166 | C96070 71</td><td>marchant ia</td><td> 3252</td><td> 48</td><td> 83</td><td> 93.1506849 3</td><td> 71.578947 37</td><td>blastp</td>

<td> 3045</td><td>nuphar | gb166 | CK748374 T1</td><td>nuphar</td><td> 3253</td><td> 48</td><td> 82</td><td> 65.7534246 6</td><td> 99.310344 83</td><td>blastp</td>

<td> 3046</td><td>pse udoroeg neria | | g b167 | FF34004 7 T 1</td><td>pseudoroegneri a</td><td> 3254</td><td> 48</td><td> 81</td><td>96.8036529 Ί</td><td> 73.448275 86</td><td>blastp</td>

<td> 3047</td><td>pseudoroegneria || gb167 | FF340899 T1</td><td>pseudoroegneri The</td><td> 3255</td><td> 48</td><td> 81</td><td> 96.8036529 7</td><td> 73.448275 86</td><td>blastp</td>

<td> 3048</td><td>pseudoroegneria || gb167 | FF352644 T1</td><td>pseudoroegneri The</td><td> 3256</td><td> 48</td><td> 82</td><td> 96.8036529 7</td><td> 74.125874 13</td><td>blastp</td>

<td> 3049</td><td>sorghum | gb161.crp | SBGWP030188 T1</td><td>sorghum</td><td> 3257</td><td> 48</td><td> 80</td><td> 96.80365297</td><td>74.1258741 J</td><td>blastp</td>

<td> 3050</td><td>switchgrass | gb167 [FL718379 T1</td><td>switctigrass</td><td> 3258</td><td> 48</td><td> 81</td><td> 96.80365297</td><td> 74.1258741 3</td><td>blastp</td>

<td> 3051</td><td>switchgrass | gb167 | FE639195 T1</td><td>switchgrass</td><td> 3259</td><td> 48</td><td> 82</td><td> 96.80365297</td><td> 73.1034482 £</td><td>blastp</td>

Table 3: AQP protein homologues and orthologs are provided. Homology was calculated as% of identity on the aligned sequences. Polynuc = Polynucleotide; Polipep. = Polypeptide; Hom. = Homologues / Orthologists; %

Ident. = percentage identity; Cob. = coverage.

114/175

EXAMPLE 2.

EXPRESSION OF IN-SILICO EXPRESSED POLYNUCLEOTIDE MRNA

The levels of messenger RNA were determined using reverse transcription assay followed by real-time PCR analysis (qRT-PCR). RNA levels were compared between 20 day old seedlings of tomato plants grown under saline water.Correlation analysis between the levels of mRNA in different genetic contexts / experimental conditions was carried out in order to determine the function of the gene in the plant.

Experimental Materials and Methods

Quantitative Real-Time RT-PCR (qRT-PCR) - To verify the level of expression, specificity and association of traits, the Reverse Transcription followed by Quantitative Real-Time PCR (qRTPCR) was performed on the total RNA extracted from the leaves of 2 tomato varieties called YO361 (salt tolerant variety) and FA191 (salt sensitive variety). The levels of messenger RNA (mRNA) were determined by AQP genes, expressed under normal and stress conditions.

Twenty-day tomato seedlings were grown in the soil and wetted with 300 mM NaCl for 0, 1, 6, 24, 118 hours. The leaves were harvested and frozen in liquid nitrogen and then kept at -80 ° C until RNA extraction. Total RNA was extracted from the leaves using the RNeasy plant mini kit (Qiagen, Hilden, Germany) and using the protocol provided by the manufacturer. Reverse transcription

115/175 was made using 1 pg of total RNA, using 200 U Super Script II Reverse Transcriptase enzymes (Invitrogen), 150 ng random hexagons of deoxynucleotides (Invitrogen), 500 μΜ mixture of triphosphate deoxynucleotides (dNTPs) (Takara, Japan), 0.2 volume of reverse transcriptase (RT) buffer x5 (Invitrogen), 0.01 M dithiothreitol (DTT), 40 U RNAsin (Promega), double treated distilled water (DDW) with diethylpyrocarbonate (DEPC) was added up to 24 μΐ.

The mixture of RNA, random hexanes deoxynucleotides, mixture of dNTPs and DDW treated with DEPC was incubated at 65 ° C for 5 minutes, followed by 4 ° C for 5 minutes. The mixture of the reverse transcriptase buffer (RT), dithiotrite (DTT) and RNAsin was added to the RT reactions followed by incubation at 25 ° C for 10 minutes and at 42 ° C for 2 minutes after that. Finally, the Super Script II Reverse Transcriptase enzyme was added to RT reactions which were further incubated for 50 minutes at 42 ° C, followed by 70 ° C for 15 minutes.

The cDNA was diluted 1:20 in Tris EDTA, pH = 7.5 for MAB69 and control genes. For MAB58 and MAB59, the cDNA was diluted 1: 2 due to very weak expression and, consequently, the control gene cDNA was diluted 1: 8 in order to insert the Ct values ​​in the range of the calibration curve. 5μ1 of the diluted cDNA was used for qPCR.

For amplification by qPCR, the primers of the AQP genes were designed, as summarized in Table 4 below. The level of expression of the control genes:

116/175

Actin (SEQ ID No.: 2841), GAPDH (SEQ ID No.: 2842) and RPL19 (SEQ ID No.: 2747) was determined to normalize the level of expression between different tissues.

Table 4

Primers for qPCR amplification____________________________

<td>Gene</td><td>IDSEQ Direct Primer • AT THE:</td><td>Direct primer sequence (5 '- * 3j</td><td>Reverse Primer SEQID NO:</td><td>Reverse primer string</td>

<td>MAB58</td><td> 2829</td><td>CTTTTGGTAGGGCCGATGA AG</td><td> 2830</td><td>CGAAGATGAAGGTGG ATAAGAGCT</td>

<td>MAB59</td><td> 2831</td><td>CAGTATGAACGTCTCCGGT GG</td><td> 2832</td><td>CAACAGCACCTAGCAA CTGACC</td>

<td>MAB69</td><td> 2833</td><td>TGTCTTGGATTCCATTGAG ' CACT</td><td> 2834</td><td>GTTTGAGCTGCTGTCC CCA</td>

<td>Actin (SEQ IDN: 2841)</td><td> 2835</td><td>CCACATGCCATTCTCCGTC T</td><td> 2836</td><td>GCTTTTCTTTCACGTCC CTGA</td>

<td>GAPD H (ID SEQ No.: 2842)</td><td> 2837</td><td>TTGTTGTGGGTGTCAACGA GA</td><td> 2838</td><td>ATGGCGTGGACAGTGG TCA</td>

<td>RPL19 (SEQ IDN °: 2747)</td><td> 2839</td><td>CACTCTGGATATGGTAAGC GTAAGG</td><td> 2840</td><td>TTCTTGGACTCCCTGTA CTTACGA.</td>

Table 4.

Experimental Results

Changes in the mRNA levels of the AQP genes in the leaves of plants under saline tolerance 10 The steady-state levels of the AQP genes in tomatoes in the leaves of tolerant lines versus sensitive lines, under salinity conditions, are summarized in Table 5 below. In all 3 cases, the expression of the aquaporin gene was elevated after the plant was exposed to salt stress. The 15 peak gene expression was higher in the tomato strain with salt tolerance (YO361) versus the sensitive strain (FA191). THE

117/175 high gene expression demonstrates the involvement of the AQP genes tested in tomato plants tolerating high salinity.

Table 5

Expression levels of tomato AQP genes

<td>Origin name (cDNA)</td><td>MAB58 '</td><td>MAB59</td><td>MAB69 *</td>

<td>sheet FA191 Oh</td><td> 2.86</td><td> 5.97</td><td> 875</td>

<td>FA191 sheet 1h</td><td> 4.56</td><td> 5.73</td><td> 597</td>

<td>FA191 sheet 6h</td><td> 5.34</td><td> . 8.2</td><td> 945</td>

<td>FA191 sheet 24h</td><td> 42.7</td><td> 62.4</td><td> 613</td>

<td>FA191 sheet 118 h</td><td> 55.4</td><td> 22.2</td><td> 1800</td>

<td>sheet Y0361 0 h</td><td> 1.96</td><td> 2.81</td><td> 638</td>

<td>Y0361 sheet 1 h</td><td> 2.33</td><td> 0.517</td><td> 583</td>

<td>Y0361 6h sheet</td><td> 2.88</td><td> 5.66</td><td> 464</td>

<td>Y0361 sheet 24h</td><td> 75.4</td><td> 139</td><td> 513</td>

<td>Y0361 sheet 118 h</td><td> 26.3</td><td>Not determined</td><td> 2300</td>

Table 5: Steady-state levels of tomato AQP genes provided under salinity conditions [saline incubation periods are given in hours (h)]. Different dilutions of cDNA were used (1:20 for MAB6 9 and 1: 2 for MAB5 8 and MAB 5 9). Numbers are provided after normalization for each sample.

EXAMPLE 3

GENETIC CLONING AND GENERATION OF BINARY VECTORS FOR EXPRESSION OF PLANTS

To validate their role in improving ABST and production, the AQP genes were overexpressed in plants, as follows.

Cloning strategy

The genes selected from those presented in Example 1 were cloned into binary vectors for the generation of transgenic plants. To the

118/175 cloning, the total open reading phases (ORFs) were identified. EST groups and, in some cases, mRNA sequences were analyzed to identify the total open reading phase by comparing the results of several translation algorithms with known proteins from other plant species. In case the full coding sequence is not identified, RACE kits from Ambion or Clontech (RACE = Quick Access to cDNA Terminations) were used to prepare the RNA of the plant samples to then access the complete transcription of the gene .

In order to clone the complete cDNAs, the Reverse Transcription followed by PCR (RT-PCR) was performed on the total RNA extracted from leaves, roots or other plant tissues, growing under normal conditions or deficient in nutrients. RNA extraction, cDNA production and PCR amplification were done using standard protocols described elsewhere (Sambrook J., EF Fritsch, and T. Maniatis. 1989. Molecular Cloning. A Laboratory Manual., 2nd Ed. Cold Spring Harbor Laboratory Press, New York.), And are basic for those skilled in the art. The PCR products were purified using the PCR purification kit (Qiagen) and the amplified PCR was performed, 377 (Applied Biosystems).

Primers were requested for ê via nested PCR (meaning sequencing of the products using general ABI sequencer, 2 amplification sets of each gene, first the amplification of the gene using external primers and then the use of PCR products

19/175 produced as a model for a second PCR reaction, in which the internal set of primers is used). Alternatively, one or two of the internal primers - were used for genetic amplification, both in the first and second PCR reaction (which means that only 2-3 primers determined for a gene). To facilitate additional cloning of the cDNAs, an 8-12 extension is added to the primer termination. 5 '-from each internal primer. The primer extension includes an endonuclease restriction site. The sites. restriction 'are .10 selected using two parameters: (a) the restriction site does not exist in the cDNA sequence; and (b) the restriction sites on the forward and reverse primers are determined so that the digested cDNA is inserted into the sense formation in the binary vector used for transformation. In Table 6 below, the primers used for cloning AQP of tomatoes and barley are provided.

Table 6

Primers used for gene cloning &amp; AQP of tomatoes and barley

<td>MAB Gene No.</td><td>5 '- »3' external direct primer sequence (SEQ ID N °)</td><td>5 '-&gt; 3' internal direct primer sequence (IDSEQN⁰)</td><td>5 '-&gt; 3' reverse reverse primer sequence (SEQ ID No.)</td><td>5 * -&gt; 3 'internal reverse primer sequence (SEQ ID No.)</td>

<td> 55</td><td>GGAGTCGACGACCAT CAAGTTTTAAGTGAC TTC (2770)</td><td>GGAGTCGACTT AAGTACATTCTT TAGTGAGAGCC (2771)</td><td>TGAGCTCACTTC AAAACCATCCG TTGTC (2772)</td><td>TGAGCTCCCATCC GTTGTCAAAATGA AC (2773)</td>

<td> 56</td><td></td><td>GGAGTCGACGT AAGAAACAATA ATGCCAATTTC (2774)</td><td>CGAGCTCGTAAA GCCAAGTTTTG AAAGAC (2775)</td><td>CGAGCTCAAGAC AAACAAAGAGAA GAGGG (2776)</td>

<td> 57</td><td></td><td>GTTAAAAATGC CGATCAACC (2777)</td><td>GCGATATCTAAA TAACAAAAGC CGTCCG (2778)</td><td>GCGATATCAGCCG TCCGAATAAACAA AG (2779)</td>

<td> 58</td><td>AATGTCGACCGAATT GATCTCCTTCTTGATC (2780)</td><td>TATGTCGACTTC ATTTCTTGGGTC ACTCG (2781)</td><td>TTTCTAGAGGTC TGGGATTATCGT CTTG (2782)</td><td>TTTCTAGAGATGTG CAGGCAGCTAC ATAC (2783)</td>

120/175

<td colspan="5">Continued from Table 6</td>

<td> 59</td><td>AATGTCGACTTTAAGCGGTGTG TTTTGTG (2784)</td><td>AATGTCGACTC ACAATTATGCA GCCACG (2785)</td><td></td><td>AATCTAGATTAGACCCAAACAT ACAAACTTCAC (2786))</td>

<td> 69</td><td>TAAGTCGACACAAAC CTTATCCTGGTCTCAT C (2787)</td><td>AATGTCGACCTT GGATTCCATTGA GCACTC (2788)</td><td></td><td>TGAGCTCTGGAGA AAGAAAACTTTAG ATACA (2789)</td>

<td> 70</td><td>AACTGCAGAGCTGTA CATGGTCCTCCTCC (2790)</td><td>AACTGCAGTGT ACATGGTCCTCC TCCG (2791)</td><td>TCCCGGGCCAG ACAAAACTTCA ATTTCATC (2792)</td><td>TCCCGGGCTTCAA TTTCATCTTCTGA TTTC (2793)</td>

<td> 71</td><td>AAAGTCGACGGAAAA TGCATTAAAACCTTA AG (2794)</td><td>TTTGTCGACCTT AGTTTTCTCCCA CATATGG (2795)</td><td>AATCTAGACAA GTAGAGGTACT AGGTAGGGAC (2796)</td><td>AATCTAGAGTACT AGGTAGGGACAA TATGATATG (2797)</td>

<td> 72</td><td>AATGTCGACGTGGAG GAGGAGTCTTTGATA C (2798)</td><td>AATGTCGACCTC .. CAACACTCTTAT CAATTACCA (2799)</td><td></td><td>TATCTAGAGGATG CAACTACAAAGA AATTG (2800)</td>

<td> 74</td><td></td><td>TTCTGCAGGTTT GGGAGTTATTG ATCTAAGATG (2801)</td><td></td><td>TCCCGGGGCATAG TTCACACAGAGC AAATC (2802)</td>

<td> 76</td><td>AATGTCGACCTGTATCCTCTTA AGTATGAATCG (2803)</td><td>AATGTCGACGTCGTCT TGTATGTATTTGTACTA CTG (2804)</td><td>TTTCTAGACTAGTGGTA TAGATCATTTTATGGTG AC (2805)</td><td>AATCTAGATTAGA GCTGGAGAATGA ACTGAAGC (2806)</td>

<td> 77</td><td>AACTGCAGCTTCTTT CACCGAGTGGGAG (2807)</td><td>AACTGCAGCTTT CACCGAGTGGG AGAG (2808)</td><td>ACCCGGGAATT CCAACTAGCTGT TATGATTC (2809)</td><td>TCCCGGGTCCAAC TAGCTGTTATGAT TCTG (2810)</td>

<td> 79</td><td>AAGATATCAAAAAAA TGTCGAAGGACGTG (2811)</td><td>AAGATATCAAC AATGTCGAAGG ACGTGATTGA (2812)</td><td></td><td>AAGATATCGACCA CCAACTCTAGTCT CATACC (2813)</td>

<td> 115</td><td>AGATTCGAATCTTTA GCCTG (2814)</td><td>AATCTAGAGAA GTCACAGAGAA AACAGTCGAG (2815)</td><td></td><td>AGAGCTCTTAAGG GAAATTCATCACA CAAGG (2816)</td>

<td> 116</td><td>AAAGTCGACCTCATC AGTGTTAAAGCCATA AG (2817)</td><td>TTTGTCGACCAT AAGCCCTCTTTG AGTGTG (2818)</td><td>TATCTAGAATTG AATCGAAAGGG AAACAC (2819)</td><td>TTTCTAGAGACCG TGACACACCATTT GTAC (2820)</td>

<td> 117</td><td></td><td>TTTCTAGACTCA GCGACAACATT TCATCTC (2821)</td><td></td><td>TGAGCTCCAGATA GAGAAGCATGCA TCATC (2822)</td>

Table 6.

The PCR products were purified (PCR Purification Kit, Qiagen, Germany) and digested with endonuclease restriction (Roche, Switzerland) according to the design of the primer sites (Tables 8 and 9 below). Each of the digested PCR products was cloned

121/175 first in high copy of plasmid pBlue-script KS [Hypertext Transfer Protocol: // World Wide Web (dot) stratagene (dot) com / manuals / 212205 (dot) pdfj], which was digested with the same restriction enzymes . In some cases (Table 8, below), the Nopaline Synthase (NOS) terminator originated from the binary vector pBI101.3 [nucleotide coordinates 4417-4693 in GenBank Access No. U12640 (SEQ ID

N ° -.2824)] is already cloned in pBlue-script KS, between the restriction endonuclease site Saci and EcoRl, so that the gene is introduced above the terminator. In other cases (Table 9, below), the At6669 promoter (SEQ ID No.: 2823) is already cloned into pBlue-script KS, so that the gene is introduced below the promoter. The digested PCR products and the linearized plasmid vector were ligated using T4 DNA ligase enzyme (Roche, Switzerland). The sequencing of the 15 inserted genes was done using the ABI 377 sequencer (Applied Biosystems). The sequences of some of the cloned AQP genes, as well as their encoded proteins are listed in Table 7 below.

Table 7: Cloned strings

<td>Serial Numbers</td><td>Gene name</td><td>Polynucleotide SEQ ID NO:</td><td>Polypeptide SEQ ID NO:</td>

<td> 1</td><td>MAB115</td><td> 2743</td><td> 2765</td>

<td> 2</td><td>MAB116</td><td> 2749</td><td> 47</td>

<td> 3</td><td>MAB117</td><td> 2750</td><td> 48</td>

<td> 4</td><td>MAB54</td><td> 2751</td><td> 27</td>

<td> 5</td><td>MAB55</td><td> 2752</td><td> 28</td>

<td> 6</td><td>MAB56</td><td> 2753</td><td> 29</td>

<td> 7</td><td>MAB57</td><td> 2754</td><td> 30</td>

<td> 8</td><td>MAB58</td><td> 2755</td><td> 2766</td>

<td> 9</td><td>MAB59</td><td> 2756</td><td> 2767</td>

<td> 10</td><td>MAB69</td><td> 2757</td><td> 33</td>

<td> 11</td><td>MAB70</td><td> 2758</td><td> 34</td>

<td> 12</td><td>MAB71</td><td> 2759</td><td> 2768</td>

<td> 13</td><td>MAB72</td><td> 2760</td><td> 2769</td>

<td> 14</td><td>MAB72 (Perfect for expression in Arabidopsis, Tomato and Corn)</td><td> 2843</td><td> 2769</td>

122/175

<td colspan="4">Continuation of Table Ί</td>

<td> 15</td><td>MAB74</td><td> 2761</td><td> 38</td>

<td> 16</td><td>MAB76</td><td> 2762</td><td> 40</td>

<td> 17</td><td>MAB77</td><td> 2763</td><td> 41</td>

<td> 18</td><td>MAB79</td><td> 2764</td><td> 43</td>

Table 7.

The genes were digested again and ligated into binary plasmids pPI or pGI, harboring the At 6669 promoter (between the restriction endonuclease site. HindIII-and Sallj (Table

<img file="BRPI0819476A2_D0001.tif" />

Enzyme restriction sites used to clone the MAB AQP genes into high copy plasmid pKs + NOS followed by cloning the binary vector pGI + promoter

At6669.

<td>Gene MAB No. s (SEQ ID No. :)</td><td>Enzymes of restriction used for cloning into high copy plasmid DIRECT</td><td>Enzymes give restriction used for cloning into high-reverse REVERSE plasmid</td><td>Enzymes of constraint used for direct binary vector cloning</td><td>Enzymes of restriction used for cloning into binary vector REVERSE</td><td>Restriction enzymes used to digest the binary vector</td>

<td>54 (SEQ ID N °: 2751)</td><td>Xbal</td><td>Saci</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

<td>55 (SEQ ID N °: 2752)</td><td>Salt!</td><td>Saci</td><td>Sal</td><td>EcoRI</td><td>Sali / EcoRI</td>

<td>56 (SEQ ID N °: 2753)</td><td>Sal</td><td>Saci</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

<td>58 (SEQ ID N °: 2755)</td><td>Sal</td><td>Xbal</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

<td>59 (SEQ ID N °: 2756)</td><td>Sal</td><td>Xbal</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

<td>69 (SEQ ID N ': 2757)</td><td>Sal</td><td>Saci</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

<td>71 (SEQ ID No.: 2759)</td><td>Sal</td><td>Xbal</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

<td>72 (SEQ ID N °: 2760)</td><td>Sal</td><td>Xbal</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

<td>76 (SEQ ID N °: 2762)</td><td>Sail</td><td>Xbal</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

123/175

<td colspan="6">Continuation of Table 8</td>

<td>115 (SEQ ID N °: 2748)</td><td>Xbal</td><td>Saci</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

<td>116 (SEQ ID No.: 2749)</td><td>Sal</td><td>Xbal</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

<td>117 (SEQ ID No.: 2750)</td><td>Xbal</td><td>Saci</td><td>Sal</td><td>EcoRI</td><td>Sall / EcoRI</td>

Table 8: MAB AQP cloned into high copy plasmid pKs + NOS, followed by cloning the binary vector pGI + At6669 promoter.

Table 9 .... ·

Enzyme restriction sites used to clone genes

MAB AQP in high copy plasmid pKs + At6669 promoter, followed by cloning the promoter + gene into binary vector pGI.

<td>MAB N 's gene (SEQ ID N °)</td><td>Restriction enzymes used to cloning in high copy plasmid DIRECT</td><td>Restriction enzymes used to cloning in high copy plasmid REVERSE</td><td>Restriction enzymes used to cloning in binary vector DIRECT</td><td>Restriction enzymes used. for cloning in binary vector- REVERSE</td><td>Restriction enzymes used to digest the binary vector</td>

<td>57 (SEQ ID N °: 2754)</td><td>Blunt</td><td>EcoRV</td><td>Sal</td><td>EcoRV</td><td>Sall / Ecll36 II</td>

<td>70 (SEQ ID N °: 2758)</td><td>Pstl</td><td>Smal</td><td>BamHI</td><td>Smal</td><td>BamHI / Ecll36ll</td>

<td>74 (SEQ ID N ': 2761)</td><td>Pstl</td><td>Smal</td><td>BamHI</td><td>Smal</td><td>BamHI / Ecll36ll</td>

<td>77 (SEQ ID N °: 2763)</td><td>Pstl</td><td>Smal</td><td>BamHI</td><td>Smal</td><td>BamHI / Ecll36ll</td>

<td>79 (SEQ ID N °: 2764)</td><td>EcoRI</td><td>EcoRV</td><td>Sal</td><td>Smal</td><td>Sall / Ecll36 II</td>

Table 9: The MAB AQP genes cloned into high copy plasmid pKs + At6669 promoter, followed by cloning the promoter + gene into binary vector pGI.

124/175

The plasmid vector pPI was constructed by inserting a synthetic poly- (A) signal sequence, originating from the basic plasmid vector pGL3 (Promega, Acc. No. U47295; bp 4658-4811) at the HindIII restriction site of the binary vector pBI101.3 (Clontech, Acc. No. U12640). pGI (Figure 1) is similar to pPI, but the original gene for the column is GUS-Intro, rather than GUS. The genes. cloned were sequenced.

The synthetic sequences (such as MAB54, nucleotide ID SEQ No.: 2751, which encodes protein SEQ ID No.: 27; or MAB72 ID SEQ No.: 2843, which encodes SEQ ID No.: 2769) of some of the cloned polynucleotides were requested from a commercial supplier (GeneArt, GmbH). To optimize the coding sequence, the Tables of 'codon usage calculated from plant transcriptomes were used [example of these Tables can be found in the Database and Codon Usage available online at Hypertext Transfer Protocol: // World Wide Web (dot) kazusa (dot) or (dot) jp / codon /]. The optimized coding sequences were designed in such a way that no change was introduced in the encoded amino acid sequence when using the preferred codons for expression in dicotyledonous plants mainly tomatoes and Arabidopsis; and flat monocotyledons, such as corn. These optimized sequences promote a better translation index and, therefore, higher levels of protein protection. For the flank of the optimized sequences, additional exclusive restriction enzyme sites have been included to facilitate the cloning of

125/175 genes in the binary vectors.

Promoters used: CaMV 35S promoter (SEQ ID N °: 2825) and Arabidopsis promoters

At6669 (SEQ ID No.: 2823; that is, SEQ ID No.: 61 from W004081173 to Evogene Ltd.).

EXAMPLE 4

GENERATION OF TRANSGENIC PLANTS EXPRESSING AQP GENES Experimental Results

Transformation of Arabisopsis - The transformation of Arabidopsis of the following MAB and ortholog genes: MAB115,

MAB54, MAB55, MAB56, MAB57, MAB58, MAB59 (MAB58 orthologist), MAB69, MAB70, ΜΆΒ71, MAB72, MAB74, MAB76, MAB77, ΜΆΒ79, MAB116 (MAB115 and MAB55 orthologist), and MAB117 (the sequence identifiers of the cloned polynucleotides and their expressed polypeptides are provided in Table 7 above) was made according to Clough SJ, Bent AF. (1998)

Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16 (6): 735-43; and Desfeux C, Clough SJ, Bent AF. (2000) Female reproductive tissues are the primary targets of Agrobacterium-mediated transformation by the Arabidopsis floral-dip method. Plant Physiol. 123 (3): 895-904; with minor modifications. In short, the Arabidopsis thaliana Columbia (ColO) T plants_The were sown in 250 ml pots filled with a moist peat-based culture mixture. The pots were covered with aluminum foil and a plastic dome, kept at 4 ° C for 3-4 days, and then discovered and incubated in a chamber at 18-24 ° C under cycles

126/175 of 16/8 hours of light / dark. The T plants_The were ready for transformation six days before. before and. Individual colonies of agrobacteria carrying the binary vectors harboring the AQP genes are grown in LB medium supplemented with kanamycin (50 mg / L) and gentamycin (50 mg / L). The cultures were incubated at 28 ° C for 48 hours under intense agitation and centrifuged at 4000 rpm for 5 minutes. The pellets covering the Agrobacterium cells were resuspended in a transformation medium that contained half-power (2.15 g / L) of Murashige-Skoog (Duchefa); 0.044 μΜ benzylamino purine (Sigma); 112 / ig / L Gamborg B5 vitamins (Sigma); 5% sucrose and 0.2 ml / L Silwel L-77 (OSI Specialists, CT) in double distilled water, with a pH of 5.7.

was carried out by inverting each plant in an agrobacterial suspension, so that the trunk of the submerged by