BR0209034A

Core-glycosylated hcv envelope proteins

Abstract

"PROTECTION OF GLYCOSILATED HCV ENVIRONMENT IN NUCLEUS". The present invention relates to HCV envelope proteins, or to their parts, which are the product of expression in eukaryotic cells. More particularly, said HCV envelope proteins are characterized in that, on average, up to 80% of their N-glycosylation sites are glycosylated in the nucleus. Of these N-glycosylated sites, more than 70% are glycosylated with an oligomanose having a structure defined by Man (8 to 10) G1cNAc (2). Moreover, the ratio of the manganese (7) -G1cNAc (2) structure oligomanose on the Mann (8) G1cNAc (2) structure oligomanose is less than or equal to 0.45. Less than 10 of the oligomanes are terminated with a Î²1.3 linked mannose. The HCV envelope proteins of the invention are particularly suitable for diagnostic, prophylactic and therapeutic purposes. A eukaryotic cell suitable for the production of the HCV envelope proteins of the invention and a Hansenula cell.

BR0209034A, drawing sheet 1 — Sheet 1 of 70

Term

Term ended

Projected expiry passed 24 April 2022, 4.4 years ago.

33 claims: 23 independent, 10 dependent

1
REIVINDICAÇÕES 1. Proteína de envoltório fragmento da mesma, CARACTERIZADA por de HCV isolada ou um compreender pelo menos um sítio de N-glicosilação, a dita proteína ou fragmento da 5 mesma distinguida pelo fato de que ela é o produto da expressão em uma célula eucariótica e distinguida adicionalmente pelo fato de que em média até 80 % dos sítios de N. glicosilação são glicosilados no núcleo.
2
Proteína de envoltório de HCV isolada ou frag10 mento da mesma, de acordo com a reivindicação 1, CARACTERIZADA pelo fato de que mais do que 70 % dos ditos (j sítios glicosilados no núcleo são glicosilados com uma oli gomanose contendo 8 a 10 manoses. ’4
3
Proteína de envoltório de HCV isolada ou frag15 mento da mesma, de acordo com quaisquer das reivindicações 1 ou 2, CARACTERIZADA pelo fato de que a razão de sítios glicosilados no núcleo com uma oligomanose com uma estrutura definida por Man(7)-GlcNAc(2) sobre os sítios glicosilados no núcleo com uma oligomanose com uma estrutura definida por 20 Man(8)-GlcNAc(2) é menor do que ou igual a 0,45.
4
Proteína de envoltório de HCV isolada ou fragmento da mesma, de acordo com quaisquer das reivindicações 1 a 3, CARACTERIZADA pelo fato de que as ditas oligomanoses contêm menos do que 10% de al,3 manose terminal. 25
5
Proteína de envoltório de HCV isolada ou parte da mesma, de acordo com quaisquer das reivindicações 1 a 4, CARACTERIZADA pelo fato de que é o produto da expressão em uma célula de levedura.
6
Proteína de envoltório de HCV isolada ou parte da mesma, de acordo com a reivindicação 5, CARACTERIZADA pelo fato de que a dita célula de levedura é uma célula de Hansenula.
7
Proteína de envoltório de HCV isolada ou parte da mesma, de acordo com quaisquer das reivindicações 1 a 6, CARACTERIZADA pelo fato de que é derivada de uma proteína compreendendo um peptídeo líder de lisozima aviário ou uma variante funcional do mesmo unido à dita proteína de envoltório de HCV ou fragmento da mesma.
8
Proteína de envoltório de HCV isolada ou parte da mesma, de acordo com a reivindicação 7, CARACTERIZADA pelo fato de que é derivada de uma proteína distinguida pela estrutura CL-[(Al) a - (PSI) b - (A2 ) c ]-HCVENV-[ (A3 ) d - (PS2) e - (A4) f ] em que:CL é um peptídeo líder de lisozima aviário ou um seu equivalente funcional, Al, A2, A3 e A4 são peptídeos adaptadores que podem ser diferentes ou iguais, PS1 e PS2 são sítios de processamento que podem ser diferentes ou iguais, HCVENV é uma proteína de envoltório de HCV ou uma parte da mesma, a, b, c, d, e e f são 0 ou 1, e em que, opcionalmente, Al e/ou A2 são parte de PS1 e/ou em que A3 e/ou A4 são parte de PS2.
9
Proteína de envoltório de HCV isolada ou fragmento da mesma, de acordo com a reivindicação 8, CARACTERIZADA pelo fato de que o dito peptídeo líder de lisozima aviário CL tem uma sequência de aminoácidos definida por SEQ ID NO:1.
10
Proteína de envoltório de HCV isolada ou fragmento da mesma, de acordo com a reivindicação 8, CARACTERIZADA pelo fato de que A tem uma seqüência de aminoácidos escolhida a partir de SEQ ID NOs :63-65, 70-72 e 7482, em que PS tem uma seqüência de aminoácidos escolhida a partir de SEQ ID NOs :66-68 e 83-84 ou em que PS é um sítio dibásico tal como Lys-Lys, Arg-Arg, Lys-Arg e Arg-Lys ou um sítio monobásico tal como Lys, e em que HCVENV é escolhida a partir de SEQ ID NOs:85-98 e seus fragmentos.
11
Proteína de envoltório de HCV isolada ou fragmento da mesma, de acordo com quaisquer das reivindicações 1 a 10, CARACTERIZADA pelo fato de que está compreendida em uma estrutura escolhida a partir do grupo consistindo em monômeros, homodímeros, heterodímeros, homo-oligômeros e hetero-oligômeros.
12
Proteína de envoltório de HCV isolada ou fragmento da mesma, de acordo com quaisquer das reivindicações 1 a 10, CARACTERIZADA pelo fato de que está compreendida em uma partícula semelhante a um vírus.
13
Proteína de envoltório de HCV isolada ou fragmento da mesma, de acordo com quaisquer das reivindicações 1 a 12, CARACTERIZADA pelo fato de que os grupos tiol da cisteína são quimicamente modificados.
14
Proteína de envoltório de HCV isolada ou fragmento da mesma, de acordo com quaisquer das reivindicações 1 a 13, CARACTERIZADA pelo fato de que é antigênica.
15
Proteína de envoltório de HCV isolada ou fragmento da mesma, de acordo com quaisquer das reivindicações 1 a 13, CARACTERIZADA pelo fato de que é imunogênica.
16
Proteína de envoltório de HCV isolada ou fragmento da mesma, de acordo com quaisquer das reivindicações 1 a 13, CARACTERIZADA pelo fato de que compreende um epítopo de célula T.
17
Composição, CARACTERIZADA por compreender uma proteína de envoltório de HCV isolada ou fragmento da mesma de acordo com quaisquer das reivindicações 1 a 16.
18
Composição, de acordo com a reivindicação 17, CARACTERIZADA por adicionalmente compreender um carreador farmaceuticamente aceitável e que é um medicamento.
19
Composição, de acordo com a reivindicação 17, CARACTERIZADA por adicionalmente compreender um carreador farmaceuticamente aceitável e que é uma vacina.
20
Método para produzir a proteína de envoltório de HCV isolada ou fragmento da mesma de acordo com quaisquer das reivindicações 1 a 16.
21
Método para a detecção da presença de anticorpos anti-HCV em uma amostra suspeita de compreender anticorpos anti-HCV, o dito método sendo CARACTERIZADO pelo fato de que compreende:(i) contatar uma proteína de envoltório de HCV ou parte da mesma de acordo com quaisquer das reivindicações 1 a 16 • *5 ··· 4 0« J « ·*· com a dita amostra sob condições que permitam a formação de complexo da dita proteína de envoltório de HCV ou parte da mesma com os ditos anticorpos anti-HCV, (ii) detectar o complexo formado em (i) , e (iii) deduzir a partir de (ii) a presença dos ditos anticorpos anti-HCV na dita amostra.
22
Método, de acordo com a reivindicação 21, CARACTERIZADO pelo fato de que o dito contato na etapa (i) está ocorrendo sob condições competitivas.
23
Método, de acordo com a reivindicação 21, CARACTERIZADO pelo fato de que a dita proteína de envoltório de HCV ou parte da mesma está ligada a um suporte sólido.
24
Kit diagnóstico para a detecção da presença de anticorpos anti-HCV em uma amostra suspeita de compreender anticorpos anti-HCV, o dito kit sendo CARACTERIZADO por compreender uma proteína de envoltório de HCV ou parte da mesma de acordo com quaisquer das reivindicações 1 a 16.
25
Kit diagnóstico, de acordo com a reivindicação 24, CARACTERIZADO pelo fato de que a dita proteína de envoltório de HCV ou parte da mesma está ligada a um suporte sólido .
26
Medicamento, CARACTERIZADO por compreender uma proteína de envoltório de HCV ou parte da mesma de acordo com quaisquer das reivindicações 1 a 16.
27
Vacina, CARACTERIZADA por compreender uma proteína de envoltório de HCV ou parte da mesma, de acordo com quaisquer das reivindicações 1 a 16. ·Ο·· «β· *· «» · ί *·« « e 4 « « ♦ ♦ «*« 9 9 9 W · · »·· * · ·> · e ··* · ft · · · * «*.·· «·· * · 99 ·*·< »* ·« ·» «· · • ···
28
Composição farmacêutica para induzir uma resposta imune específica para HCV em um mamífero, a dita composição sendo CARACTERIZADA por compreender uma quantidade efetiva de uma proteína de envoltório de HCV ou parte da mesma de acordo com quaisquer das reivindicações 1 a 16 e, opcionalmente, um adjuvante farmaceuticamente aceitável.
29
Composição farmacêutica para induzir anticorpos específicos para HCV em um mamífero, a dita composição sendo CARACTERIZADA por compreender uma quantidade efetiva de uma proteína de envoltório de HCV ou parte da mesma de acordo com quaisquer das reivindicações 1 a 16 e, opcionalmente, um adjuvante farmaceuticamente aceitável.
30
Composição farmacêutica para induzir uma função de célula T em um mamífero, a dita composição sendo CARACTERIZADA por compreender uma quantidade efetiva de uma proteína de envoltório de HCV ou parte da mesma de acordo com quaisquer das reivindicações 1 a 16 e, opcionalmente, um adjuvante farmaceuticamente aceitável.
31
Composição farmacêutica, de acordo com quaisquer das reivindicações 28 a 30, CARACTERIZADA pelo fato de que é uma composição profilática.
32
Composição farmacêutica, de acordo com quaisquer das reivindicações 28 a 30, CARACTERIZADA pelo fato de que é uma composição terapêutica.
33
Composição farmacêutica, de acordo com quaisquer das reivindicações 28 a 32, CARACTERIZADA pelo fato de que o dito mamífero é um ser humano.

Independent claims33

5,107 paragraphs in 55 sections, as filed

Glycosylated HCV envelope proteins in

CORE

FIELD OF THE INVENTION

The present invention relates to the general field of recombinant protein expression, the diagnosis of HCV infection, the treatment or prevention of HCV infection, and the prognosis/monitoring of the clinical effectiveness of treatment in an individual with chronic hepatitis, or the prognosis/monitoring of the natural disease.

More specifically, the present invention relates to the expression of hepatitis C virus envelope proteins in yeast, to yeast strains for the expression of glycosylated viral envelope proteins in the core, and to the use in the diagnosis, prophylaxis or therapy of HCV envelope proteins according to the present invention.

BASIS OF THE INVENTION

Hepatitis C virus (HCV) infection is a major health problem in both developed and developing countries. It is estimated that approximately 1 to 5% of the world's population is affected by the virus. HCV infection appears to be the most important cause of transfusion-associated hepatitis and frequently progresses to chronic liver damage. Furthermore, there is evidence implicating HCV in the induction of hepatocellular carcinoma. Consequently, there is a high demand for reliable diagnostic methods and effective therapeutic agents. Sensitive and specific methods for examining blood products contaminated with HCV and improved methods for culturing HCV are also needed.

HCV is a positive-strand RNA virus of approximately 9,600 bases, which encode a single polyprotein precursor of about 3,000 amino acids. Proteolytic cleavage of the precursor linked to subsequent translational modifications has been shown to result in at least three structural and six non-structural proteins. Based on sequence homology, the structural proteins have been functionally designated as a single core protein and two envelope glycoproteins: El and E2. The El protein consists of 192 amino acids and contains 4 to 5 N-glycosylation sites, depending on the HCV genotype. The E2 protein consists of...

363 The E1 protein consists of 370 amino acids and contains 9 to 11 N-glycosylation sites, depending on the HCV genotype (for reviews, see: Major, M. E. and Feinstone, SM 1997, Maertens, G. and Stuyver, L. 1997). The E1 protein contains several variable domains (Maertens, G. and Stuyver, L. 1997). The E2 protein contains three hypervariable domains, of which the main domain is located at the N-terminus of the protein (Maertens, G. and Stuyver, L. 1997). HCV glycoproteins are predominantly located in the ER, where they are modified and assembled into oligomeric complexes.

<td colspan="2">In eukaryotes,</td><td>you</td><td>waste</td><td>of</td><td>sugar are</td>

<td>commonly linked</td><td colspan="2">four</td><td>waste</td><td>of</td><td>amino acids</td>

<td>different. These</td><td>waste</td><td>of</td><td>amino acids</td><td>they are</td><td>classifieds</td>

as linked to O (serine, threonine, and hydroxylysine) and N-linked (asparagine). The O-linked sugars are synthesized in the Golgi apparatus or the simple endoplasmic reticulum (ER) from nucleotide sugars. The N-linked sugars are synthesized from a common precursor and subsequently processed. It is believed that the envelope proteins of HCV are N-glycosylated. It is known in the art that the addition of N-linked carbohydrate chains is important for stabilizing the duplication of intermediates and thus for efficient duplication, prevention of poor duplication and degradation in the endoplasmic reticulum, oligomerization, biological activity, and transport of glycoproteins (see reviews by Rose et al., 1988, Doms et al. 1993; Helenius, 1994). The tripeptide sequences Asn-X-Ser and Asn-X-Thr (where X can be any amino acid) on the polypeptides are the consensus sites for the binding of N-linked oligosaccharides. After the addition of the N-linked oligosaccharide to the polypeptide, the oligosaccharide is further processed to the complex type (containing N-acetylglucosamine, mannose, fucose, galactose, and sialic acid) or to the high-mannose type (containing N-acetylglucosamine and mannose). The envelope proteins of HCV are believed to be of the high-mannose type. The processing of the N-linked oligosaccharide in yeast is very different from the processing in the Golgi apparatus of mammals. In yeast, oligosaccharide chains are elongated in the Golgi apparatus through the stepwise addition of mannose, resulting in elaborate high-mannose structures, referred to as hyperglycosylation. In contrast, proteins expressed in prokaryotes are never glycosylated.

The glycosylation patterns of high-mannose proteins or peptides have been determined for a variety of eukaryotic cells. In mammalian cells, an average of 5 to 9 mannose units are linked to two N-acetylglucosamine moieties in a glycosylation-type oligosaccharide in the nucleus (the structure represented in summary as Man(5-9)GlcNAc(2)). Glycosylation in the nucleus refers to a structure similar to the box-like structure in Figure 3 of Herscovics and Orleans (1993).

The methylotrophic yeast Pichia pastoris has been described as linking an average of 8 to 14 mannose units, i.e., Man(8-14)GlcNAc(2), per glycosylation site (Tschopp in EP0256421), and approximately 85% of the N-linked oligosaccharides are in the Man(8-14)GlcNAc(2) size range (Grinna and Tschopp 1989). Other researchers have published slightly different oligosaccharide structures linked to heterologous proteins expressed in P. pastoris: Man(8-9)GlcNAc(2) (Montesino et al. 1998), Man(914)GlcNAc(2) or Man(9-15)GlcNAc(2) (Kalidas et al. 2001), and Man(8-18)GlcNAc(2) with a preponderance of Man(912)GlcNAc(2) and with the main global oligosaccharide being Man(10)GlcNAc(2) (Miele et al. 1998). Trimble et al. (1991) reported an equal distribution of Man(8)GlcNAc(2) and Man(9)GlcNAc(2) in approximately 75% of the N-linked oligosaccharides, with an additional 17% of the N-glycosylation sites being occupied by Man(10)GlcNAc(2) and the remaining 8% of the sites by Man(11)GlcNAc(2). Hyperglycosylation of a protein expressed in P. pastoris has been occasionally described (Scorer et al. 1993).

Aspergillus niger is adding Man(510)GlcNAc(2) to the N-glycosylation sites (Panchal and Wodzinski 1998).

The glycosylation-deficient Saccharomyces cerevisiae mutant mnn9 differs from wild-type S. cerevisiae in that mnn9 cells produce glycosylated proteins with a modified oligosaccharide consisting of Man(9-13)GlcNAc(2) instead of hyperglycosylated proteins (Mackay et al. in US5,135,854 and Kniskern et al . in WO94/01132). Another S. cerevisiae mutant, ochlmnn9, has been described as adding Man(8)GlcNAc(2) to N-glycosylation sites in proteins (Yoshifumi et al.). JP06277086) .

A characteristic of the core oligosaccharides of S. cerevisiae (wild type and mnn9 mutant) is the presence of mannose residues linked at the α,3 terminals (Montesino et al. 1998). Oligosaccharides linked to the N-glycosylation sites of proteins expressed in P. pastoris or S. cerevisiae ochlmnnl lack such mannose-linked α,3 terminals (Gellissen et al. 2000). Mannose-linked α,3 terminals are considered to be allergenic (Jenkins et al. 1996). Therefore, proteins bearing mannose residues linked at the 11,3 terminals on their oligosaccharides are not suitable for diagnostic or therapeutic purposes.

The glycosylation pattern on proteins expressed in the methylotrophic yeast Hansenula polymorpha has not been studied in great detail, despite the use of this yeast for the production of a considerable number of heterologous proteins (see Table 3 in Gellissen et al. 2000). From the experiments of Janowicz et al. (1991) and Diminski et al. (1997), it appears that H. polymorpha is not, or is only unsatisfactorily, glycosylating the large or small hepatitis B viral surface antigen (HBsAg). Most likely this is due to the fact that HBsAg was expressed without the signal peptide, thus preventing the...

HBsAg produced enters the lumen of the endoplasmic reticulum (ER) and undergoes glycosylation. The limited addition of mono- or diexoses to G-CSF (granulocyte colony-stimulating factor) produced in H. polymorpha has been described (Fischer et al. in WO00/40727). On the other hand, hyperglycosylation of a heterologous α-galactosidase expressed in H. polymorpha cells has been observed (Fellinger et al. 1991).

To date, vaccination against the disease has proven to be the most cost-effective and efficient method for disease control. Despite promising results, efforts to develop an effective vaccine against HCV, however, have been plagued with difficulties. A sine qua non condition for vaccines is the induction of an immune response in patients. Consequently, HCV antigenic determinants must be identified and administered to patients in an appropriate setting. Antigenic determinants can be divided into at least two forms, i.e., linear and conformational epitopes. Conformational epitopes result from the duplication of a molecule in a three-dimensional space, including subsequent translational modifications such as glycosylation. In general, it is believed that conformational epitopes will yield the most effective vaccines, since they represent epitopes that resemble native-like HCV epitopes, and which may be better conserved than the true linear amino acid sequence. Therefore, the final degree of glycosylation of HCV envelope proteins is of paramount importance in generating native-like HCV antigenic determinants. However, there are seemingly insurmountable problems with HCV culture, resulting in only small quantities of virions. Furthermore, there are vast problems with the expression and purification of recombinant proteins, resulting in low protein yields, hyperglycosylated proteins, or proteins that are not glycosylated at all.

HCV envelope proteins have been produced by recombinant techniques in Escherichia coli, insect cells, yeast cells, and mammalian cells. However, expression in higher eukaryotes has been characterized by the difficulty in obtaining large quantities of antigens for final vaccine production. Expression in prokaryotes, such as E. coli, results in HCV envelope proteins that are not glycosylated. The expression of HCV envelope proteins in yeast resulted in hyperglycosylation. As already demonstrated by Maertens et al. in WO 96/04385, the expression of the HCV envelope protein E2 in Saccharomyces cerevisiae results in proteins that are densely glycosylated. This hyperglycosylation results in the shielding of protein epitopes. Although Mustilli et al. (Mustilli, A. c. 1999) claim that the expression of HCV E2 in S. While the results of intracellularly expressed material demonstrate that some of it is at least hyperglycosylated, the correct processing of the remainder of this material has not been shown. Furthermore, the hyperglycosylation observed by Mustilli et al. (1999) could only be prevented in the presence of tunicamycin, a glycosylation inhibitor, and thus does not reflect the glycosylation that occurs under normal, natural growth conditions. The need for HCV envelope proteins derived from an intracellular source is widely accepted (Maertens et al. in WO).

96/04385, Heile et al. 2000). This need is further exemplified by the unsatisfactory reactivity of yeast-derived E2 proteins secreted with sera from chimpanzees immunized with E2 proteins derived from mammalian cell cultures, as evidenced in Figure 5 of Mustilli et al. (1999). This is further documented by Rosa et al. (1996) who show that immunization with yeast-derived HCV envelope proteins fails to protect against provocation.

Consequently, there is a need for efficient expression systems that yield large quantities of protein at a cost-effective price, while simultaneously exhibiting a glycosylation pattern similar to the native form, devoid of mannoses linked at the 1α,3 terminals. In particular, such systems are needed for the production of HCV envelope proteins.

SUMMARY OF THE INVENTION

A first aspect of the present invention relates to an isolated HCV envelope protein, or a fragment thereof, comprising at least one N-glycosylation site, said protein, or its fragment, being distinguished in that it is the product of expression in a eukaryotic cell and further distinguished in that, on average, up to 80% of the N-glycosylation sites are glycosylated in the nucleus. In particular, more than 70% of said glycosylated sites in the nucleus are glycosylated with an oligomannose with a structure defined by Man(8 to 10)GlcNAc(2). Furthermore, the ratio of oligomannose with the Man(7)-GlcNAc(2) structure to oligomannose with the Man(8)-GlcNAc(2) structure is less than or equal to 0.45. More specifically, said oligomannoses contain less than 10% terminal al,3-mannose. The eukaryotic cell expressing the aforementioned isolated HCV envelope protein, or part thereof, could be a yeast cell, such as a Hansenula cell.

A further aspect of the present invention relates to an isolated HCV envelope protein, or part thereof, according to the invention, which is derived from a protein comprising an avian lysozyme leader peptide, or a functional variant thereof, attached to said HCV envelope protein, or a fragment thereof. More specifically, said isolated HCV envelope protein, or part thereof, is derived from a protein distinguished by its structure.

CL-[(Al)the - (PSl)b - (A2)w]-HCVENV-[ (A3)d - (PS2)and - (A4)fin which:

CL is an avian lysozyme-leading peptide or a functional equivalent thereof.

Al, A2, A3, and A4 are adaptor peptides that can be different or the same.

PS1 and PS2 are processing sites that may be different or the same.

HCVENV is an envelope protein of HCV or a part thereof, a, b, c, d, eef are 0 or 1, and optionally, Al and/or A2 are part of PS1 and/or A3 and/or A4 are part of PS2.

Another aspect of the invention covers an isolated HCV envelope protein, or a fragment thereof, according to the invention, which is comprised in a structure chosen from the group consisting of monomers, homodimers, heterodimers, homo-oligomers and hetero-oligomers. Alternatively, said isolated HCV envelope protein, or its fragment, according to the invention is comprised in a virus-like particle, specifically, any of the isolated HCV envelope protein, or its fragment, according to the invention may comprise cysteines, of which the thiol groups of the cysteines are chemically modified.

The specific aspects of the invention relate to isolated HCV envelope proteins, or fragments thereof according to the invention, which are antigenic or immunogenic and/or which comprise a T cell-stimulating epitope.

An additional aspect relates to a composition comprising an isolated HCV envelope protein, or a fragment thereof, according to the invention. Said composition may further comprise a pharmaceutically acceptable carrier and may be a medicament or a vaccine.

The invention also relates to a method for producing isolated HCV envelope protein, or a fragment thereof, according to the invention.

Another method of the invention is a method for detecting the presence of anti-HCV antibodies in a sample.

<td>suspected of understanding</td><td colspan="2">anti-HCV antibodies, the so-called method</td>

<td>understanding:</td><td></td><td></td>

<td>(i) contact</td><td>a protein of</td><td>HCV envelope,</td>

<td>or part</td><td colspan="2">of the same, according to any</td>

<td colspan="2">of claims 1 to</td><td>15, with the said</td>

<td>sample,</td><td>under conditions</td><td>that allow</td>

<td>training</td><td>of the complex of</td><td>said protein of</td>

<td></td><td>HCV envelope, or part</td><td>from the</td><td>same, with the</td>

<td></td><td>so-called anti-HCV antibodies,</td><td></td><td></td>

<td>(ü)</td><td>detect the complex formed</td><td>in</td><td>(i) , and</td>

<td>(Üi)</td><td>deduce from (ii)</td><td>the</td><td>presence of</td>

.5 said anti-HCV antibodies in said sample.

<td>More</td><td>specifically, the</td><td>said</td><td>the method can</td>

<td>to understand</td><td>stage (i), in which the</td><td>said</td><td>contact is</td>

<td>occurring under</td><td>competitive conditions.</td><td>In</td><td>In particular, the</td>

<td>said methods</td><td colspan="3">They can use a solid support to which the</td>

<td>said protein</td><td>HCV envelope, or</td><td>part</td><td>of the same, it is</td>

connected.

The invention further relates to a diagnostic kit for detecting the presence of anti-HCV antibodies in a sample suspected of containing anti-HCV antibodies, said kit comprising an HCV envelope protein, or part thereof, according to the invention. More specifically, said kit may comprise said HCV envelope protein, or part thereof, attached to a solid support.

The invention also relates to a medicament or vaccine comprising an HCV envelope protein, or part thereof, according to the invention.

Also covered by the invention is a pharmaceutical composition for inducing a specific immune response to

HCV in a mammal, said composition comprising an effective amount of an HCV envelope protein, or part thereof, according to the invention and, optionally, a pharmaceutically acceptable adjuvant. Said pharmaceutical composition may, alternatively, be capable of inducing specific antibodies to HCV in a mammal or of inducing T cell function in a mammal. Furthermore, the said pharmaceutical composition may be a prophylactic composition or a therapeutic composition. In particular, the said mammal is a human being.

FIGURE CAPTIONS

<td></td><td>Figure</td><td> 1.</td><td>Schematic map</td><td>of</td><td>vector</td><td>pGEMT-ElsH6RB,</td>

<td colspan="3">which has the sequence</td><td>as defined in</td><td>SEQ</td><td>ID no</td><td> :6.</td>

<td></td><td>Figure</td><td> 2 .</td><td>Schematic map</td><td>of</td><td>vector</td><td>pCHH-Hir, which</td>

<td>has</td><td>sequence</td><td>comc</td><td>i defined in SEQ</td><td>ID</td><td>NO: 9 .</td><td></td>

<td></td><td>Figure</td><td> 3.</td><td>Schematic map</td><td>of</td><td>vector</td><td>pFPMT121, which</td>

<td>has</td><td>sequence</td><td>comc</td><td>i defined in SEQ</td><td>ID</td><td>NO:12.</td><td></td>

<td></td><td>Figure</td><td> 4 .</td><td>Schematic map</td><td>of</td><td>vector</td><td>pFPMT-CHH-El-</td>

<td colspan="4">H6, which has the sequence as defined</td><td>in</td><td colspan="2">SEQ ID NO:13.</td>

<td></td><td>Figure</td><td> 5 .</td><td>Schematic map</td><td>of</td><td>vector</td><td>pFPMT-MFa-El-</td>

<td colspan="4">H6, which has the sequence as defined</td><td>in</td><td colspan="2">SEQ ID NO:16.</td>

<td></td><td>Figure</td><td> 6.</td><td>Schematic map</td><td>of</td><td>vector</td><td>pUC18-FMD-MFa-</td>

<td>E1-H6,</td><td>that has</td><td colspan="3">sequence as defined</td><td colspan="2">in SEQ ID NO:17.</td>

<td></td><td>Figure</td><td> 7 .</td><td>Schematic map</td><td>of</td><td>vector</td><td>pUC18-FMD-CL-</td>

E1-H6, which has the sequence as defined in SEQ ID NO:20.

Figure 8. Schematic map of the pFPMT-CL-ElH6 vector, which has the sequence as defined in SEQ ID NO:21.

Figure 9. Schematic map of the pSP72E2H6 vector, which has the sequence as defined in SEQ ID NO:22.

Figure 10. Schematic map of the pMPT121 vector, which has the sequence as defined in SEQ ID NO:23.

Figure 11. Schematic map of the pFPMT-MFa-E214 vector.

H6, which has the sequence as defined in SEQ ID NO:24.

Figure 12. Schematic map of the pMPT-MFa-E2H6 vector, which has the sequence as defined in SEQ ID NO:25.

Figure 13. Schematic map of the pMF30 vector, which has the sequence as defined in SEQ ID NO:28.

Figure 14. Schematic map of the pFPMT-CL-E2H6 vector, which has the sequence as defined in SEQ ID NO:32.

Figure 15. Schematic map of the vector puC18-FMD-CLEl, which has the sequence as defined in SEQ ID NO:35.

Figure 16. Schematic map of the pFPMT-CL-El vector, which has the sequence as defined in SEQ ID NO:36.

Figure 17. Schematic map of the vector pUC18-FMD-CLH6-E1-K-H6, which has the sequence as defined in SEQ ID

NO:39.

Figure 18. Schematic map of the pFPMT-CL-H6- vector.

<td colspan="2">K-El, which has the sequence</td><td colspan="2">as defined in</td><td colspan="2">SEQ ID NO:40.</td>

<td>Figure</td><td>19. Map</td><td>schematic</td><td>of</td><td>vector</td><td>pYIG5, which</td>

<td>has the sequence</td><td colspan="2">as defined in the SEQ ID</td><td>NODE:</td><td> 41.</td><td></td>

<td>Figure</td><td>20. Map</td><td>schematic</td><td>of</td><td>vector</td><td>pYIG5ElH6,</td>

which has the sequence as defined in SEQ ID NO:42.

Figure 21. Schematic map of the pSYl vector, which has the sequence as defined in SEQ ID NO:43.

Figure 22. Schematic map of the pSYlaMFElsH6a vector, which has the sequence as defined in SEQ ID.

NO:44.

Figure 23. Schematic map of the pBSK-E2sH6 vector, which has the sequence as defined in SEQ ID NO:45.

Figure 24. Schematic map of the pYIG5HCCL15 vector.

22aH6, which has the sequence as defined in SEQ ID NO:46.

Figure 25. Schematic map of the vector pYYIGSE2H6, which has the sequence as defined in SEQ ID NO:47.

Figure 26. Schematic map of the pYIG7 vector, which has the sequence as defined in SEQ ID NO:48.

Figure 27. Schematic map of the pYIG7El vector, which has the sequence as defined in SEQ ID NO:49.

Figure 28. Schematic map of the pSYlYIG7El vector, which has the sequence as defined in SEQ ID NO:50.

Figure 29. Schematic map of the pPICZalfaA vector, which has the sequence as defined in SEQ ID NO:51.

Figure 30. Schematic map of the vector pPICZalfaD', which has the sequence as defined in SEQ ID NO:52.

Figure 31. Schematic map of the vector pPICZalfaE', which has the sequence as defined in SEQ ID NO:53.

Figure 32. Schematic map of the pPICZalfaD'ElsH6 vector, which has the sequence as defined in SEQ.

ID NO:58.

Figure 33. Schematic map of the vector pPICZalfaE'ElsH6, which has the sequence as defined in SEQ.

ID NO:59.

Figure 34. Schematic map of the vector pPICZalfaD'E2sH6, which has the sequence as defined in SEQ.

ID NO: 60.

Figure 35. Schematic map of the vector pPICZalfaE'E2sH6, which has the sequence as defined in SEQ.

ID NO: 61.

Figure 36. Schematic map of the vector pUC18MFa, which has the sequence as defined in SEQ ID NO:62.

Figure 37. Elution profile of size exclusion chromatography of the E2-H6 protein purified by IMAC, expressed from Hansenula polymorpha expressing MFaE2-H6 (see Example 15). The X-axis indicates the elution volume (in ml). The vertical lines through the elution profile indicate the collected fractions. P1 = pooled fractions 4 to 9, P2 = pooled fractions 30 to 35, and P3 = pooled fractions 37 to 44. The Y-axis indicates the absorbance given in mAU (milliabsorbance units). The X-axis indicates the elution volume in ml.

Figure 38. The different assemblies and fractions collected after size exclusion chromatography (see Figure 37) were analyzed by SDS-PAGE under non-reduction, followed by silver staining of the polyacrylamide gel. The assemblies (P1, P2, and P3) and fractions (16 to 26) analyzed are indicated above the figure of the silver-stained gel. To the left (path M) are indicated the sizes of the molecular weight markers.

Figure 39. Fractions 17 to 23 from the size exclusion chromatography step, as shown in Figure 37, were pooled and alkylated. Following this, the protein material was subjected to Endo H treatment for deglycosylation. The untreated material and the Endo H-treated material were separated on an SDS-PAGE gel and stained onto a PVDF membrane. The stain was then stained with amide black.

Pathway 1: E2-H6 alkylated prior to treatment with

Endo H

Pathway 2: E2-H6 alkylated after treatment with Endo H

Figure 40. Western blot analysis of El cell lysates expressed in Saccharomyces cerevisiae. The Western blot was developed using the El-specific monoclonal antibody IGH 201.

Pathways 1-4: expression product after 2, 3, or 5 days of expression, respectively, in a Saccharomyces clone transformed with pSYlYIG7Els (SEQ ID NO:50, Figure 28) comprising the nucleotide sequence encoding the chicken lysozyme leader peptide bound to

E1-H6.

Pathways 5-7: expression product after 2, 3, or 5 days of expression, respectively, in a Saccharomyces clone transformed with pSYlaMFElsH6aYIG7 (SEQ ID NO:44, Figure 22) comprising the nucleotide sequence encoding the E1-H6-bound crossing factor α leader peptide.

Path 8: Molecular weight markers with sizes as indicated.

Path 9: These are purified, produced by mammalian cells infected with recombinant vaccinia virus (HCV).

Figure 41. Analysis of the purified E2-H6 protein by immobilized metal ion affinity chromatography (IMAC), expressed by and processed from CL-E2-H6 to E2-H6 by H. polymorpha (see Example 17). Proteins in different washout fractions (pathways 2 to 4) and elution fractions (pathways 5 to 7) were analyzed by SDS-PAGE under reduction followed by silver staining of the gel (A, top figure) or by western blotting using a specific monoclonal antibody directed against E2 (B, bottom figure). The sizes of the molecular weight markers are indicated on the left.

Figure 42. Elution profile of the first IMAC chromatography step on a Ni-IDA column (Sepharose FF chelating agent loaded with Ni).2+, Pharmacia) for the purification of sulfonated H6-K-E1 protein, produced by H. polymorpha (see Example 18). The column was equilibrated with buffer A (50 mM phosphate, 6 M GuHCl, 1% Empigen BB (v/v), pH 7.2) supplemented with 20 mM imidazole. After sample application, the column was washed sequentially with buffer A containing 20 mM and 50 mM imidazole, respectively (as indicated on the chromatogram). An additional washing and elution step of the His-labeled products was performed by sequentially applying buffer B (PBS, 1% Empigen BB, pH 7.2) supplemented with 50 mM imidazole and 200 mM imidazole, respectively (as indicated on the chromatogram). The following fractions were pooled: washing pool 1 (fractions 8 to 11, washing with 50 mM imidazole). The eluted material was collected as separate fractions 63 to 72 or an elution pool was performed (fractions 63 to 69). The Y-axis indicates the absorbance given in mAU (milliabsorbance units). The X-axis indicates the elution volume in ml.

Figure 43. Analysis of the H6-K-E1 protein purified by IMAC (see Figure 42), expressed by and processed from CL-H6-K-E1 to H6-K-E1 by H. polymorpha. The proteins in wash collection 1 (pathway 12) and in elution fractions 63 to 72 (pathways 2 to 11) were analyzed by SDS-PAGE under reduction, followed by gel staining with silver (A, top figure). The proteins present in the sample before IMAC (path 2), at the end-to-end flow meeting (path 4), at the wash meeting 1 (path 5), and at the elution meeting (path 6) were analyzed by western blotting using a specific monoclonal antibody directed against El (IGH201) (B, background figure; no sample was loaded in path 3). The sizes of the molecular weight markers (paths M) are indicated on the left.

Figure 44. Elution profile of the second IMAC chromatography step on a Ni-IDA column (Sepharose FF chelating agent loaded with Ni).2+, Pharmacia) for the purification of El resulting from the in vitro processing of H6-K-E1 (purification: see Figure 42) with Endo Lys-C. The end-to-end flow was collected in different fractions (1 to 40), which were examined for the presence of Eis products. Fractions (7 to 28), containing intact El processed from H6-K-E1, were pooled. The Y-axis indicates the absorbance given in mAU (milliabsorbance units). The X-axis indicates the elution volume in ml.

Figure 45. Western blot analysis showing bands of specific Eis proteins reacting with biotinylated heparin (see also Example 19). Eis preparations purified from mammalian cell cultures infected with recombinant vaccinia virus or expressed by H. polymorpha were analyzed. To the right of the panel from the vertical line shows a Western blot developed with the biotinylated Ei-specific monoclonal antibody IGH 200. To the left of the panel from the vertical line shows a Western blot developed with biotinylated heparin. From these results, it is concluded that the less glycosylated Eis, in particular, has a high affinity for heparin.

M pathways: molecular weight marker (molecular weights indicated on the left).

Pathways 1: These are derived from mammalian cells and alkylated during isolation.

<td></td><td>Paths</td><td>2: Els-H6 expressed</td><td>by H. polymorpha</td><td>and</td>

<td>sulfonated</td><td>during</td><td>isolation.</td><td></td><td></td>

<td></td><td>Paths</td><td>3: Els-H6 expressed</td><td>by H. polymorpha</td><td>and</td>

<td>located</td><td>during</td><td>isolation.</td><td></td><td></td>

<td></td><td>Paths</td><td>4: same material</td><td>as loaded</td><td>node</td>

Pathway 2, however, treated with dithiothreitol to convert the sulfonated Cys-thiol groups into Cys-thiol.

Figure 46. Size exclusion chromatography (SEC) profile of E2-H6 expressed by purified H. polymorpha in its sulfonated form, subjected to a run in PBS, 3% betaine, to force the formation of virus-like particles by exchanging betaine for Empigen BB. The pooled fractions containing the VLPs, used for further study, are indicated by o.

The Y-axis indicates the absorbance given in mAU (milliabsorbance units). The X-axis indicates the elution volume in ml. See also Example 20.

Figure 47. Size exclusion chromatography (SEC) profile of E2-H6 expressed by purified H. polymorpha in its alkylated form, subjected to a run in PBS, 3% betaine, to force the formation of virus-like particles by exchanging betaine for Empigen BB. The pooled fractions containing the VLPs are indicated by . The Y-axis indicates the absorbance given in mAU (milliabsorbance units). The X-axis indicates the elution volume in ml. See also Example 20.

Figure 48. Size exclusion chromatography (SEC) profile of El expressed by H. polymorpha purified in its sulfonated form, subjected to a run in PBS, 3% betaine, to force the formation of virus-like particles by exchanging betaine for Empigen BB. The pooled fractions containing the VLPs are indicated by . The Y-axis indicates the absorbance given in mAU (milliabsorbance units). The X-axis indicates the elution volume in ml. See also Example 20.

Figure 49. Size exclusion chromatography (SEC) profile of El expressed by H. polymorpha purified in its alkylated form, subjected to a run in PBS, 3% betaine, to force the formation of virus-like particles by exchanging betaine for Empigen BB. The pooled fractions containing the VLPs are indicated by √(2). The Y-axis indicates the absorbance given in mAU (milliabsorbance units). The X-axis indicates the elution volume in ml. See also Example 20.

Figure 50. SDS-PAGE (under reducing conditions) and western blot analysis of VLPs as isolated after size exclusion chromatography (SEC), as described in Figures 48 and 49. Left panel: silver-stained SDS-PAGE gel. Right panel: western blot using a specific monoclonal antibody directed against El (IGH201). Pathway 1: molecular weight markers (molecular weights indicated)

<td>on the left); paths</td><td> 2 :</td><td>meeting</td><td>of</td><td>VLPs containing El</td>

<td>sulfonated (see Figure</td><td> 48) ;</td><td>paths</td><td> 3 :</td><td>VLP meeting</td>

<td>containing El alkylated</td><td>(cf r.</td><td>Figure</td><td> 49)</td><td>See also</td>

Example 20.

Figure 51. El produced in mammalian cells (M) or El produced in Hansenula (H) were coated onto a solid ELISA support to determine the endpoint titer of antibodies present in sera after vaccination of mice with El produced in mammalian cells (top panel), or after vaccination of mice with El produced in Hansenula (bottom panel). The horizontal bar represents the mean antibody titer. Endpoint titles (multiple dilution) are indicated on the Y-axis. See also Example 22.

Figure 52. Hansenula-produced El was alkylated (A) or sulfonated (S) and coated onto a solid ELISA support to determine the endpoint titer of antibodies present in sera after vaccination of mice with alkylated Hansenula-produced El (top panel), or after vaccination of mice with sulfonated Hansenula-produced El (bottom panel). The horizontal bar represents the mean antibody titer.

The endpoints (multiple dilution) are indicated on the Y-axis. See also Example 23.

Figure 53. HCV El produced by mammalian cells infected with recombinant vaccinia virus and HCV El produced by H. polymorpha were directly coated onto ELISA plates. Endpoint antibody titers were determined in sera from chimpanzees vaccinated with mammalian cell-produced El (top panel) and from murine monoclonal antibodies produced against mammalian cell-produced El (bottom panel). The chimpanzees Yoran and Marti were vaccinated prophylactically. The chimpanzees Ton, Phil, Marcei, Peggy, and Femma were vaccinated therapeutically. Black-filled bars: ELISA plate coated with El produced by mammalian cells. Open bars: ELISA plate coated with

The one produced by Hansenula. The endpoint titles (multiple dilution) are indicated on the Y-axis. See also Example 24.

Figure 54. Carbohydrate gel electrophoresis aided by a fluorophore of oligosaccharides released from El produced by mammalian cells infected with recombinant vaccinia virus and E1-H6 protein produced by

Hansenula.

Pathway 1: Ladder glucose pattern with indication on the left of the number of monosaccharides (3 to 10, indicated by G3 to G10)

Pathway 2: 25 μρ of N-linked oligosaccharides released from (alkylated) El produced by mammalian cells.

Pathway 3: 25 μg of N-linked oligosaccharides released from E1-H6 (alkylated) produced by

Hansenula.

Path 4: 100 pmoles of maltotetraose.

DETAILED DESCRIPTION OF THE INVENTION

In the work that resulted in the present invention, it was observed that it was possible to express glycosylated HCV envelope proteins in Saccharomyces cerevisiae, Pichia pastoris and Hansenula polymorpha by expressing said HCV envelope proteins as proteins comprising a signal peptide sequence attached to said HCV envelope proteins.

However, the glycosylation of HCV envelope proteins expressed in these three yeast species was very different (see Examples 6, 10, 13 and 25).

The patterns, specifically expressed in

However, the envelope proteins of HCV in S. cerevisiae (glycosylation-deficient mutant) and in H. polymorpha were glycosylated in a manner resembling core glycosylation. The HCV envelope proteins expressed in Pichia pastoris were hyperglycosylated, despite initial reports that the proteins expressed in this yeast were hyperglycosylated.

<td>normally</td><td>no</td><td>They are hyperglycosylated</td><td>(Gellissen and</td>

<td>2000, Sugrue</td><td>and col</td><td> . 1997) .</td><td></td>

<td>With</td><td>the</td><td>further analysis</td><td>of the standards</td>

<td>glycosylation</td><td>of</td><td>HCV proteins</td><td>produced in</td>

In Hansenula cerevisiae (glycosylation-deficient strain), H. polymorpha, and in mammalian cells infected with recombinant vaccinia HCV-virus, it was surprisingly found that the HCV envelope proteins produced by Hansenula showed a glycosylation pattern that is very advantageous for the diagnostic, prophylactic, and therapeutic application of these HCV envelope proteins (see Examples 21-24 and 26-29). This unexpected finding is reflected in the different aspects and embodiments of the present invention, as presented below.

A first aspect of the invention relates to an isolated HCV envelope protein, or a fragment thereof, comprising at least one N-glycosylation site, said protein, or its fragment, being distinguished by the fact that it is the product of expression in

<td>one</td><td>eukaryotic cell</td><td>and distinguished</td><td>additionally</td><td>for the</td>

<td>fact</td><td>that, on average,</td><td>up to 50%, 51%,</td><td> 52%, 53%, 54%,</td><td> 55%,</td>

or 8 0

64%,

76%,

88% of N-glycosylated sites are glycosylated in the core; specifically, more than 60%, 61%, 62%, 63%

<td> 89%,</td><td> 90%,</td><td> 91%</td><td> , 92%</td><td> , 93%</td><td> , 94%</td><td>or</td><td> 95 %</td><td>of the</td><td>N- sites</td>

Glycosylated N-glycos ... Furthermore, more specifically for any of the N-glycosylation characteristics described above, said oligomannoses contain less than 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, or 5% of terminal al,3-mannose.

With N-glycosylated sites glycosylated with an oligomannose with a structure defined by Man(8 to 10)—GlcNAc(2) it is meant that said N-glycosylated sites are glycosylated with any one of Man(8)-GlcNAc(2), Man(9)-GlcNAc(2), or Man(10)-GlcNAc(2).

It will become clear that the same N-glycosylation site in two proteins can be occupied by a different oligomannose.

The term protein refers to a polymer of amino acids and does not refer to a specific length of the product; thus, peptides, oligopeptides, and polypeptides are included in the definition of protein. This term also does not refer to, or excludes, modifications of the protein after expression, for example, glycosylations, acetylations, phosphorylations, and the like. The definition includes, for example, polypeptides containing one or more analogs of an amino acid (including, for example, non-natural amino acids, PNA, etc.), polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-natural.

Pre-pro-protein or pre-protein, when used herein, means a protein comprising a pre-pro-sequence attached to a protein of interest or a protein comprising a pro-sequence attached to a protein of interest, respectively. As alternatives to presequence, the terms signal sequence, signal peptide, leader peptide, or leader sequence are used; all refer to an amino acid sequence that targets a pre-protein for the simple endoplasmic reticulum (ER), which is a prerequisite for (N)glycosylation. The signal sequence, signal peptide, leader peptide, or leader sequence is cleaved, i.e., removed from the protein comprising the signal sequence bound to a protein of interest, on the luminal side of this ER by host-specific proteases, referred to as signal peptidases. Also, a pre-proprotein is converted into a proprotein with translocation to the ER lumen. Depending on the nature of the amino acid prosequence, it may or may not be removed by the host cell expressing the preprosequence. A well-known amino acid preprosequence is the α-crossing factor preprosequence of S. cerevisiae.

By HCV envelope protein is meant an HCV E1 or E2 envelope protein of HCV or a part thereof, whereby said proteins may be derived from an HCV strain of any genotype. More specifically, HCVENV is chosen from the group of amino acid sequences consisting of SEQ ID NOs:85 to 98, amino acid sequences that are at least 90% identical to SEQ ID NOs:85 to 98, and fragments of any of these.

Identical amino acids are considered to be the conserved amino acid groups described above, i.e., the group consisting of Met, Ile, Leu, and Vai; the group consisting of Arg, Lys, and His; the group consisting of Phe, Trp, and Tyr; the group consisting of Asp and Glu; the group consisting of Asn and

<td>Gin; the group</td><td>consisting of Cys,</td><td>To be</td><td>and Thr; and the group</td>

<td>consisting of</td><td>Ala and Gly.</td><td></td><td></td>

<td>More</td><td>specifically, the</td><td colspan="2">term proteins</td>

<td>wrap</td><td>HCV is related to</td><td>one</td><td>polypeptide or a</td>

Analogues thereof (e.g., mimotopes) comprising an amino acid sequence (and/or amino acid analogues) defining at least one HCV epitope from the El or E2 region, in addition to a glycosylation site. These envelope proteins can be either monomeric, heterooligomeric, or homooligomeric forms of recombinantly expressed envelope proteins. Typically, the sequences defining the epitope correspond to the amino acid sequences of the El or E2 region of HCV (either identically or via substitutions of native amino acid residue analogs that do not destroy the epitope).

It will be understood that the HCV epitope can colocalize with the glycosylation site.

In general, the sequence that defines the epitope will be 3 or 4 amino acids long, more typically 5, 6, or 7 amino acids long, more typically 8 or 9 amino acids long, and even more typically 10 or more amino acids long. With regard to conformational epitopes, the length of the sequence that defines the epitope can be subject to wide variations, since it is believed that these epitopes are formed by the three-dimensional shape of the antigen (e.g., (replication). Thus, the amino acids defining the epitope may be relatively few in number, but widely dispersed along the length of the molecule being put into the correct epitope conformation via replication. The portions of the antigen between the residues defining the epitope may not be critical to the conformational structure of the epitope. For example, deletion or substitution of these intermediate sequences may not affect the conformational epitope, provided that the sequences critical to the epitope conformation are maintained (e.g., the cisternae involved in disulfide bonding, glycosylation sites, etc.). A conformational epitope may also be formed by 2 or more essential regions of subunits of a homo-oligomer or hetero-oligomer.

As used herein, an epitope of a designated polypeptide means epitopes with the same amino acid sequence as the epitope in the designated polypeptide, and their immunological equivalents. Such equivalents also include the strain, subtype (= genotype), or type-specific variants (e.g., of currently known sequences or strains belonging to genotypes la, lb, lc,

(and its subtypes), 12 (and its subtypes) or 13 (and its subtypes) or any other recently defined HCV (sub)type. It is to be understood that the amino acids constituting the epitope do not need to be part of a linear sequence, but may be interspersed with any number of amino acids, thus forming a conformational epitope.

The HCV antigens of the present invention comprise conformational epitopes from the El and/or E2 (envelope) domains of HCV. The El domain, which is believed to correspond to the viral envelope protein, is currently estimated to span amino acids 192-383 of the HCV polyprotein (Hijikata et al., 1991). With expression in a mammalian (glycosylated) system, it is believed to have an approximate molecular weight of 35 kDa, as determined via SDS-PAGE. The E2 protein, formerly called NS1, is believed to reach amino acids 384-809 or 384-746 (Grakoui et al., 1993) of the HCV polyprotein and also to be a sheath protein. When expressed in a vaccinia (glycosylated) system, it is believed to have an apparent gel molecular weight of about 72 kDa. It is understood that these protein endpoints are approximations (e.g., the carboxy-terminal end of E2 could be located somewhere in the region of amino acids 730-820, e.g.). ending at amino acids 730, 735, 740, 742, 744, 745, preferably 746, 747, 748, 750, 760, 770, 780, 790, 800, 809, 810, 820). The E2 protein can also be expressed together with El, and/or the core (aa 1-191), and/or P7 (aa 747-809), and/or NS2 (aa 810-1026), and/or NS3 (aa 102-742).

1657), and/or NS4A (aa 1658-1711) and/or NS4B (aa 1712-1972) and/or NS5A (aa 1973-2420), and/or NS5B (aa 2421-3011), and/or any part of any of these HCV proteins other than E2. Similarly, the El protein can also be expressed together with E2, and/or the core (aa 1-191), and/or P7 (aa 747-809), and/or NS2 (aa 810-1026), and/or NS3 (aa 1027-1657), and/or NS4A (aa 1658-1711) and/or NS4B (aa 1712-1972) and/or NS5A (aa 1973-2420), and/or NS5B (aa 2421-3011), and/or any part of any of these HCV proteins other than El. Expression together with these other HCV proteins may be important to achieve correct protein replication.

The term El, as used herein, also includes analogs and truncated forms that are immunologically cross-reactive with natural El, and includes El proteins of genotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, or any other newly identified type or subtype of HCV. The term Έ2', as used herein, also includes analogs and truncated forms that are immunologically cross-reactive with natural E2, and includes E2 proteins of genotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 or any other recently identified HCV type or subtype. For example, multiple codon insertions between codons 383 and 384, as well as deletions of amino acids 384–387, were described by Kato et al. (1992). It is thus also understood that the isolates used in the examples section of the present invention were not intended to limit the scope of the invention and that any isolate of

HCV types 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, or any other novel HCV genotype, are a suitable source of El and/or E2 sequences for the practice of the present invention. Similarly, as described above, the HCV proteins that are co-expressed with the HCV envelope proteins of the present invention can be derived from any HCV type, including the same type as the HCV envelope proteins of the present invention.

E1/E2, as used herein, refers to an oligomeric form of envelope proteins containing at least one E1 component and at least one E2 component.

The term specific oligomeric El and/or E2 and/or E1/E2 envelope proteins refers to all possible oligomeric forms of recombinantly expressed El and/or E2 envelope proteins that are not aggregates. Specific oligomeric El and/or E2 envelope proteins are also referred to as homo-oligomeric El or E2 envelope proteins (see below). 0 The term 'simple or oligomeric specific envelope proteins' refers to simple monomeric El and/or E2 proteins (simple in the strict sense of the word), as well as recombinantly expressed oligomeric El and/or E2 and/or E1/E2 proteins. These simple or oligomeric specific envelope proteins according to the present invention can be further defined by the following formula (El)x(E2)y, where x can be a number between 0 and 100, and y can be a number between 0 and 100, as long as x and y are not both 0.

With xey = 0, the so-called envelope proteins include monomeric El.

The term homo-oligomer, as used herein, refers to an El or E2 complex containing more than one El or E2 monomer, e.g., El/El dimers, E1/E1/E1 trimers or El/El/El/El tetramers and E2/E2 dimers, E2/E2/E2 trimers or E2/E2/E2/E2 tetramers, El pentamers and hexamers, E2 pentamers and hexamers or any higher-order homo-oligomers of El or E2 are all 'homo-oligomers' within the scope of this definition. Oligomers may contain one, two, or several different E1 or E2 monomers obtained from different types or subtypes of hepatitis C virus, including, for example, those described by Maertens et al. in WO 94/25601 and WO 96/13590, both by the present applicants. Such mixed oligomers are still homo-oligomers within the scope of this invention, and may allow for more universal diagnosis, prophylaxis, or treatment of HCV.

The El and E2 antigens used in the present invention may be full-size viral proteins, substantially full-size versions thereof, or functional fragments thereof (e.g., fragments comprising at least one epitope and/or glycosylation site). Furthermore, the HCV antigens of the present invention may also include other sequences that do not block or prevent the formation of the conformational epitope of interest. The presence or absence of a conformational epitope can be readily determined by examining the antigen of interest with an antibody (polyclonal or monoclonal serum to the conformational epitope) and comparing its reactivity with that of a denatured version of the antigen that retains only the linear epitopes (if any). In such an examination using polyclonal antibodies, it may be advantageous to adsorb the polyclonal serum first with the denatured antigen and see if it retains antibodies for the antigen of interest.

The HCV proteins of the present invention can be glycosylated. Glycosylated proteins mean proteins that contain one or more carbohydrate groups, in particular sugar groups. In general, all eukaryotic cells are capable of glycosylating proteins. After aligning the different envelope protein sequences of HCV genotypes, it can be inferred that not all 6 glycosylation sites on the HCV El protein are required for proper replication and reactivity. It is additionally known that the glycosylation site at position 325 is not modified by N-glycosylation (Fournillier-Jacob et al. 1996, Meunier et al. 1999). Furthermore, the El protein of the HCV lb subtype contains 6 glycosylation sites, however some of these glycosylation sites are absent in certain other (sub)types. The fourth carbohydrate motif (on Asn250), present in types lb, 6a, 7, 8, and 9, is absent in all other types known today. This sugar addition motif can be mutated to produce an lb-type El protein with improved reactivity. Also, type 2b sequences show an extra glycosylation site in the V5 region (on Asn299). Isolate S83, belonging to genotype 2c, does not have the first carbohydrate motif in the VI region (on Asn), although it is present on all other isolates (Stuyver et al., 1994). However, even among fully conserved sugar-added motifs, the presence of carbohydrate may not be required for duplication, but it may have a function in evading immune surveillance. Thus, identification of the glycosylation function can be further tested by mutagenesis of the glycosylation motifs. The mutagenesis of a glycosylation motif (NXS or NXT sequences) can be achieved by mutating the codons to N, S, or T, in such a way that these codons encode amino acids other than N in the case of N, and/or amino acids other than S or T in the case of S, and in the case of T.

T. Alternatively, position X can be mutated to P, since it is known that NPS or NPT are not frequently modified with carbohydrates. After establishing which carbohydrate addition motifs are required for duplication and/or reactivity and which are not, combinations of such mutations can be made. Such experiments were described extensively by Maertens et al. in Example 8 of WO 96/04385, which is included here specifically by reference.

The term glycosylation as used in the present invention refers to N-glycosylation, unless otherwise specified.

In particular, the present invention relates to HCV envelope proteins, or parts thereof that are glycosylated in the core. In this regard, the term glycosylation in the core refers to a structure similar to the structure as represented in the boxed structure in

Figure 3 from Herscovics and Orlean (Herscovics, A. and Orlean, P. 1993). Thus, the referred carbohydrate structure contains 10 or 11 monosaccharides. Notably, said disclosure is incorporated herein by reference. The like term means that no more than 4 additional monosaccharides have been added to the structure or that no more than about 3 monosaccharides have been removed from the structure.

Consequently, the glycosylated carbohydrate structure in the core referred to in the present invention consists of a minimum of 7 and a maximum of 15 monosaccharides and may consist of 8,

9, 10, 11, 12, 13 or 14 monosaccharides. The monosaccharides involved are preferentially glucose, mannose or N-acetylglucosamine.

An alternative aspect of the present invention relates to an isolated HCV envelope protein, or a fragment thereof, comprising at least one N-glycosylation site, said protein, or its fragment, being distinguished in that it is the product of expression in

<td>one</td><td>eukaryotic cell</td><td>and distinguished</td><td>additionally</td><td>for the</td>

<td> 91%,</td><td>92%, 93%, 94% or</td><td>95% of sites</td><td>N-glycosylated</td><td>they are</td>

glycosylated. with an oligomannose with a structure defined by Man(8 to 10)-GlcNAc(2). More specifically for the N-glycosylation feature described above, the ratio of glycosylated sites in the core with an oligomannose with the structure Man(7)-GlcNAc(2) to glycosylated sites in the core with an oligomannose with the structure Man(8)-GlcNAc(2) is less than or equal to 0.15, 0.2, 0.25, 0.30, 0.35, 0.40, 0.44, 0.45, or 0.50. Furthermore, more specifically for any of the N-glycosylation characteristics described above, said oligomannoses contain less than 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, or 5% of terminal al,3-mannose.

Another alternative aspect of the invention relates to an isolated HCV envelope protein, or a fragment thereof, comprising at least one N-glycosylation site, said protein, or its fragment, distinguished by the fact that it is the product of expression in a eukaryotic cell and further distinguished by the fact that the N-glycosylated sites are occupied by oligomannoses wherein the ratio of oligomannoses with the Man(7)-GlcNAc(2) structure to oligomannoses with the Man(8)-GlcNAc(2) structure is less than or equal to 0.15, 0.2,

0.25, 0.30, 0.35, 0.40, 0.44, 0.45, or 0.50. Furthermore, more specifically regarding the N-glycosylation characteristics described above, said oligomannoses contain less than 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%,

8%, 7%, 6%, or 5% otl.3 terminal mannose.

In another alternative aspect of the present invention, an isolated HCV envelope protein, or a fragment thereof, comprising at least one N-glycosylation site, is covered; said protein, or its fragment, is distinguished by the fact that it is the product of expression in a mammalian eukaryotic cell and distinguished...

<td>additionally</td><td>for the</td><td>the fact that</td><td>number</td><td>of</td><td>N- sites</td>

<td>glycosylated is</td><td>for the</td><td>minus 5%, 6%, 7%,</td><td> 8%, 9%,</td><td> 10%,</td><td> 11%, 12%,</td>

<td>13%, 14%, or</td><td> 15%,</td><td>smaller than</td><td>number</td><td>of</td><td>N- sites</td>

<td colspan="3">glycosylated within the same protein, or</td><td colspan="2">fragment</td><td>of the same,</td>

expressed from a vaccinia virus in a eukaryotic cell capable of being infected with said vaccinia virus. More specifically, the N-glycosylation characteristic.

<td>above</td><td>described, up to 50%, 51%,</td><td> 52%,</td><td> 53%,</td><td> 54%,</td><td> 55%,</td><td> 56%, 57%,</td>

<td>sayings</td><td>N-glycosylated sites</td><td>they are</td><td colspan="4">glycosylated in the nucleus.</td>

<td>More</td><td>Specifically, more than</td><td>what</td><td> 60%,</td><td> 61%,</td><td> 62%,</td><td> 63%, 64%,</td>

89%, 90%, 91%, 92%, 93%, 94% or 95% of the N-glycosylated sites are glycosylated with an oligomannose with a structure defined by Man(8 to 10)-GlcNAc(2). More specifically for any of the N-glycosylation features described above, the ratio of glycosylated sites in the core with an oligomannose with the structure Man(7)-GlcNAc(2) to glycosylated sites in the core with an oligomannose with the structure Man(8)-GlcNAc(2) is less than or equal to 0.15, 0.2, 0.25, 0.30, 0.35, 0.40, 0.45, or 0.50. Furthermore, more specifically for any of the N-glycosylation characteristics described above, said oligomannoses contain less than 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, or 5% of terminal al,3-mannose.

In another aspect of the invention, the isolated HCV envelope protein, or part thereof, according to the invention is the product of expression in a cell of

<td>yeast. More</td><td colspan="2">particularly</td><td>a</td><td colspan="2">outer layer protein</td>

<td>Isolated HCV, or</td><td>part of</td><td>same,</td><td>of</td><td>in accordance with</td><td>invention is the</td>

<td colspan="2">product of the expression</td><td>in</td><td>one</td><td>cell</td><td>strains of</td>

<td>Saccharomyces,</td><td>such</td><td>as</td><td colspan="2">Saccharomyces</td><td>cerevisiae,</td>

Saccharomyces kluyveri, or Saccharomyces uvarum, Schizosaccharomyces, such as Schizosaccharomyces pombe, Kluyveromyces, such as Kluyveromyces lactis, Yarrowia, such as Yarrowia lipolytica, Hansenula, such as Hansenula polymorpha, Pichia, such as Pichia pastoris, Aspergillus species, Neurospora, such as Neurospora crassa, or Schwanniomyces, such as Schwanniomyces occidentalis, or mutant cells derived from any of these. More specifically, the isolated HCV envelope protein, or part thereof, according to the invention is the product of expression in a Hansenula cell. Even more specifically, the isolated HCV envelope protein, or part thereof, according to the invention is the product of expression in a yeast cell, e.g., Hansenula, in the absence of glycosylation inhibitors, such as tunicamycin.

In another aspect of the invention, the isolated HCV envelope protein, or part thereof, is derived from a protein comprising an avian lysozyme leader peptide, or a functional variant thereof, attached to said HCV envelope protein, or a fragment thereof. More specifically, the isolated HCV envelope protein, or part thereof, according to the invention is derived from a protein distinguished by its structure.

CL-[(Al)the - (PSl)b - (A2)w]-HCVENV-[(A3)d - (PS2)and - (A4)fin which:

CL is an avian lysozyme-leading peptide or a functional equivalent thereof.

Al, A2, A3, and A4 are adaptor peptides that can be different or the same.

PS1 and PS2 are processing sites that may be different or the same.

HCVENV is an envelope protein of HCV or a part thereof, a, b, c, d, eef are 0 or 1, and optionally, Al and/or A2 are part of PS1 and/or A3 and/or A4 are part of PS2.

With an avian leader peptide, or a functional equivalent thereof, attached to an HCV envelope protein, or a part thereof, it means that the C-terminal amino acid of said leader peptide is covalently linked, via a peptide bond, to the N-terminal amino acid of said HCV envelope protein, or a part thereof. Alternatively, the C-terminal amino acid of said leader peptide is separated from the N-terminal amino acid of said HCV envelope protein, or part thereof, by a peptide or protein. Said peptide or protein may have the structure -[(Al)the- (PSl)b - (A2)was defined above.

The derivation of the HCV envelope protein of interest from the protein comprising an avian lysozyme leader peptide, or a functional equivalent thereof, attached to an HCV envelope protein, or part thereof, or from the protein characterized by the CL-[(Al) structure.the

- (PSl)b - (A2)w] -HCVENV- [ (A3)d - (PS2)and - (A4)fThis can be carried out in vivo by the proteolytic mechanism of the cells in which the pre-protein is expressed. More specifically, the step consisting of the removal of the avian leader peptide is preferably carried out in vivo by the proteolytic mechanism of the cells in which the pre-protein is expressed. The derivation can, however, also be carried out in vitro only after and/or during the isolation and/or purification of the pre-protein and/or protein from the cells expressing the pre-protein and/or from the culture fluid in which the cells expressing the pre-protein are grown. Alternatively, said in vivo derivation is carried out in combination with said in vitro derivation. Derivation of the HCV protein of interest from a recombinantly expressed pre-protein may further comprise the use of proteolytic enzyme(s) in a polishing step, wherein all, or most, of the contaminant proteins co-present with the protein of interest are degraded and wherein the protein of interest is resistant to the polishing proteolytic enzyme(s). Derivation and polishing are not mutually exclusive processes and can be achieved using the same single proteolytic enzyme. As an example, the HCV Eis protein from the HCV lb genotype (SEQ ID NO:2), which is devoid of Lys residues, is given here. By digesting a protein extract containing said HCV El proteins with Lys-C endoproteinase (endo-lys C), the El proteins will not be degraded, whereas contaminating proteins containing one or more Lys residues are degraded. Such a process can significantly simplify or enhance the isolation and/or purification of HCV El proteins. Furthermore, by including an additional Lys residue in a preprotein, e.g. Between a leader peptide and an HCV El protein, the additional advantageous possibility of correct in vitro separation of the leader peptide from the HCV El preprotein is obtainable. The other HCV El proteins may comprise a Lys residue at any one or more of the positions 4, 40, 42, 44, 61, 65, or 179 (where position 1 is the first natural N-terminal amino acid of the El protein, i.e., position 192 in the HCV polyprotein). In order to enable the use of endo-lys C as described above, said Lys residues can be mutated into another amino acid residue, preferably an Arg residue.

With a leader peptide correctly removed, it is meant that said leader peptide is removed from the protein comprising the signal sequence attached to a protein of interest with high efficiency, i.e., a large number of pre-(pro-)proteins are converted into pro-proteins or proteins, and with high fidelity, i.e., only the pre54 amino acid sequence is removed and not any amino acids from the protein of interest attached to said amino acid presequence. Removing a leader peptide with high efficiency means that at least approximately

40%, but more preferably around 50%, 55%, 60%,

65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or even

99% of pre-proteins are converted into the protein from which the pre-sequence is removed. Alternatively, if a substantial portion of the expressed pre-proteins is not converted into the protein from which the pre-sequence is removed, these pre-proteins can still be purified or removed during purification.

A functional equivalent of avian lysozyme (CL) leader peptide is meant a CL leader peptide in which one or more amino acids have been replaced by another amino acid, whereby said substitution is a conservative amino acid substitution. Conservative amino acid substitution means a substitution of an amino acid belonging to a conserved amino acid group by another amino acid belonging to the same conserved amino acid group. The following are considered conserved amino acid groups: the group consisting of Met, Ile, Leu, and Vai; the group consisting of Arg, Lys, and His; the group consisting of Phe, Trp, and Tyr; the group consisting of Asp and Glu; the group consisting of Asn and Gin; the group consisting of Cys, Ser, and Thr; and the group consisting of Ala and Gly. An illustrative conservative amino acid substitution in the CL leader peptide is the variation naturally occurring at position 6, the amino acid at this position being either Vai or Ile; another variation occurs at position 17, the amino acid at this position being, among others, Leu or Pro (see SEQ ID NO:1). The resulting CL leader peptides are thus to be considered functionally equivalent. Other functional equivalents of CL leader peptides include those leader peptides reproducing the same technical aspects of CL leader peptides as described throughout the present invention, including deletion variants and insertion variants.

With A or adapter peptide is meant a peptide (e.g. 1 to 30 amino acids) or a protein that can serve as a linker between, e.g., a leader peptide and a processing site (PS), a leader peptide and a protein of interest, a PS and a protein of interest, and/or a protein of interest and a PS; and/or can serve as an N- or C-terminal linker of, e.g., a leader peptide, a PS or a protein of interest. The adapter peptide A may have a certain three-dimensional structure, e.g., an α-helical or β-sheet structure, or a combination thereof. Alternatively, the three-dimensional structure of A is not well defined, e.g., a coiled spiral structure. The adapter A may be part of, for example, a presequence, a prosequence, a protein sequence of interest, or a processing site. The A adapter can serve as a marker enhancing or enabling the detection and/or purification and/or processing of the protein of which A is a part. An example of an A peptide is the his (HHHHHH; SEQ ID NO: 63) tag peptide Hn, where n is normally six, but can

<td>be 7, 8, 9,</td><td> 10,</td><td>11, or</td><td> 12 .</td><td>The others</td><td colspan="2">examples of peptides</td>

<td>They include</td><td>you</td><td colspan="2">peptides</td><td colspan="2">EEGEPK (Kjeldsen et al.</td><td>in</td>

<td>WO98/28429;</td><td>SEQ</td><td>ID NO:</td><td> : 64)</td><td>or EEAEPK</td><td>(Kjeldsen et al.</td><td>in</td>

<td>WO97/22706;</td><td>SEQ</td><td>ID</td><td>NO: 65</td><td>that,</td><td>when present</td><td>in</td>

<td>end</td><td>of</td><td>N of</td><td>one</td><td>protein</td><td colspan="2">of interest were</td>

The described methods increase fermentation yield, but also protect the N-terminus end of the protein of interest from processing by dipeptidyl aminopeptidase, thus resulting in a homogeneous N-terminus end of the polypeptide. At the same time, the in vitro maturation of the protein of interest, i.e. The removal of said peptides EEGEPK (SEQ ID NO:64) and EEAEPK (SEQ ID NO:65) from the protein of interest can be achieved using, for example, endo-lys C, which cleaves the C-terminus of the Lys residue in said peptides. Said peptides thus serve the function of

<td>adaptor peptide</td><td>(A) ,</td><td colspan="3">as well as processing site</td>

<td>(PS) , (see below) .</td><td>You</td><td>peptides</td><td>adapters are provided</td><td>in the</td>

<td>SEQ ID NOS: 63-65,</td><td> 70-72</td><td>and 74-82.</td><td>Another example of</td><td>one</td>

<td>adaptor peptide</td><td>and the</td><td>connector</td><td>G4S immunosilent.</td><td>You</td>

Other examples of adaptor peptides or adaptor proteins are listed in Table 2 of Stevens (Stevens et al. 2000).

With PS or processing site is meant a specific processing or processable site of protein. Said processing can occur enzymatically or chemically. Examples of processing sites prone to specific enzymatic processing include IEGr4<X (SEQ ID NO: 66), IDGr4<X (SEQ ID NO: 67), AEGr4<X (SEQ ID. NO: 68), all recognized by and cleaved between Arg and Xaa residues (any amino acid), as indicated by Φ, by bovine factor Xa protease (Nagai, K. and Thogersen, HC 1984). Another example of a PS site is a dibasic site, e.g. Arg-Arg, Lys-Lys, ArgLys or Lys-Arg, which is capable of being cleaved by yeast protease Kex2 (Julius, D. et al. 1984). The PS site can also be a monobasic Lys site. The aforementioned monobasic Lys PS site can also be included at the C-terminus of an A-peptide. Examples of A-peptides comprising a C-terminal monobasic Lys PS site are given by SEQ ID NOs: 64-65 and 74-76. Exoproteolytic removal of a His marker (HHHHHH; SEQ ID NO: 63) is possible by using dipeptidyl aminopeptidase I (DAPase) alone or in combination with glutamine cyclotransferase (Q-cyclase) and pyroglutamic aminopeptidase (pGAPase) (Pedersen, J. et al.). (1999). These exopeptidases comprising a recombinant His tag (which allows the peptidase to be removed from the reaction mixture by immobilized metal affinity chromatography, IMAC) are commercially available, e.g., as the TAGZyme System from Unizyme Laboratories (Horsholm, DK). Processing is thus generally meant any method or procedure by which a protein is specifically cleaved or capable of being cleaved at at least one processing site, when said processing site is present in said protein. A protein may be prone to endoproteolytic cleavage or it may be prone to exproteolytic cleavage; in either case the cleavage is specific, i.e. It does not extend to sites other than those recognized by the proteolytic processing enzyme. Several PS sites are given in the SEQ IDs.

Nos: 66-68 and 83-84.

The versatility of the [(Al/3) structurea/d - (PS1/2) b/e (A2/4)w/fThe structure described above is demonstrated through some examples. In a first example, said structure is present at the C-terminal end of a protein of interest comprised in a pre-protein and where A3 is the VIEGR peptide (SEQ ID NO:69), which is overlapping with the PS IEGRX site of factor Xa (SEQ ID NO:66) and where X = A4 is the histidine tag (SEQ ID NO:63) (d, eef, thus, are all 1 in this case). The HCV protein of interest can (optionally) be purified by IMAC. After processing with factor Xa, the (optionally purified) HCV protein of interest will carry at its C end a processed PS site, which is IEGR (SEQ ID NO: 70). The processed variant factor Xa processing site can be IDGR (SEQ ID NO: 71) or AEGR (SEQ ID NO: 72). In a further example, the structure

[(Al/3)the/d - (PSl/2)b/e “ (A2/4)w/f] is present at the N-terminus of the HCV protein of interest. Furthermore, Al is the histidine marker (SEQ ID NO: 63), PS is the factor Xa recognition site (any of SEQ ID NOs: 66-68), where X is the protein of interest, and where a 59 b - 1 ec = 0. With the correct removal of a leader peptide, e.g., by the host cell, the resulting HCV protein of interest can be purified by IMAC (optional). After processing with factor Xa, the protein of interest will be stripped of the [(Al) structure.the - (PSl)b - (A2)w].

Furthermore, it will be clear that any of Al, A2, A3, A4, PS1 and PS2, when present, can be present in a repetition structure. Such a repetition structure, when present, is in this context still counted as 1, i.e., a, b, c, d, e, or f are 1 even if, for example, Al is occurring as, for example, 2 repetitions (Al-Al).

Yet another aspect of the present invention relates to any isolated HCV envelope protein, or fragment thereof, according to the invention, in which the thiol groups of cysteine are chemically modified.

Yet another aspect of the present invention relates to any of the isolated HCV envelope protein, or fragment thereof, according to the invention, which is antigenic.

Yet another aspect of the present invention relates to any of the isolated HCV envelope protein, or fragment thereof, according to the invention, which is immunogenic.

Yet another aspect of the present invention relates to any of the isolated HCV envelope protein, or fragment thereof, according to the invention, which comprises a T-cell stimulating epitope.

Another aspect of the present invention relates to any of the isolated HCV envelope protein, or fragment thereof, according to the invention, which is comprised in a structure chosen from the group consisting of monomers, homodimers, heterodimers, homooligomers and hetero-oligomers.

Yet another aspect of the present invention relates to any of the isolated HCV envelope protein, or a fragment thereof, according to the invention, which is comprised within a virus-like particle.

In HCV envelope proteins, or parts thereof, as described herein, comprising at least one cysteine residue, but preferably two or more cysteine residues, the thiol groups of cysteine can be irreversibly protected by chemical or enzymatic means. In particular, irreversible protection or irreversible blocking by chemical means refers to alkylation, preferably alkylation of HCV envelope proteins by means of alkylating agents, such as, for example, active halogens, ethyleneimine or N-(iodoethyl)trifluoroacetamide. In this regard, it is to be understood that alkylation of cysteine thiol groups refers to the substitution of the thiol hydrogen by (CH3).2)nR, where n is 0, 1, 2, 3, or 4 and R = H, COOH, NH2, KNOWLEDGE2, phenyl, or any derivative thereof. Alkylation can be carried out by any method known in the art, such as, for example, halogen-activated X(CH2)nR, where X is a halogen, such as I, Br, Cl, or F. Examples of active halogens are methyl iodide, iodoacetic acid, iodoacetamide, and 2-bromoethylamine. Other alkylation methods include the use of NEM (Netylmaleimide) or Biotin-NEM, a mixture thereof, or ethyleneimine or N-(iodoethyl)trifluoroacetamide, both resulting in the substitution of -H by -CH2-CH2-NH2 (Hermanson, GT 1996). The term alkylating agents, as used herein, refers to compounds capable of effecting alkylation as described herein. Such alkylations ultimately result in a modified cysteine, which can mimic other amino acids. Alkylation by an ethyleneimine results in a structure resembling lysine, in such a way that new cleavage sites for trypsin are introduced (Hermanson, GT 1996). Similarly, the use of methyl iodide results in an amino acid resembling methionine, while the use of iodoacetate and iodoacetamide results in amino acids resembling glutamic acid and glutamine, respectively. By analogy, these amino acids are preferably used in the direct mutation of cysteine. Therefore, the present invention relates to HCV envelope proteins as described herein, wherein at least one cysteine residue of the HCV envelope protein as described herein is mutated to a natural amino acid, preferably to methionine, glutamic acid, glutamine, or lysine. The term mutated refers to site-directed mutagenesis of the nucleic acids encoding these amino acids, i.e. to methods well known in the art, such as, for example, site-directed mutagenesis via PCR or via oligonucleotide-mediated mutagenesis, as described in (Sambrook, J. et al. 1989). It should be understood that for the Examples section of the present invention, alkylation refers to the use of iodoacetamide as an alkylating agent, unless otherwise specified.

It is further understood that in the purification procedure, the thiol groups of cysteine in HCV proteins, or parts thereof, of the present invention can be reversibly protected. The purpose of the reversible protection is to stabilize the HCV protein, or part thereof. Specifically, after reversible protection, the sulfur-containing functional group (e.g., thiols and disulfides) is maintained in a non-reactive condition. 0 The sulfur-containing functional group is thus unsuitable for reacting with other compounds, e.g., it has lost its tendency to form or exchange disulfide bonds, such as, for example...

Ri-SH + R2-SH---X--->Rx-SSR2 ;

R1-SS-R2 + R3-SH---X--->Ri-SSR3 + R2-SH ;

R1-SS-R2 + r3-ssr4---X--->R!-SSR3 + R2-SSR4 ;

The reactions described between thiols and/or disulfide residues are not limited to intermolecular processes, but can also occur intramolecularly.

The term reversible protection or reversible blocking, as used herein, encompasses the covalent binding of modifying agents to the thiol groups of cysteine, as well as the manipulation of the HCV protein environment in such a way that the redox state of the cysteine thiol groups remains unaffected by all subsequent steps of the purification procedure (shielding). Reversible protection of cysteine thiol groups can be achieved chemically or enzymatically.

The term enzymatic reversible protection, as used herein, encompasses enzyme-mediated reversible protection, such as, for example, acyltransferases, e.g., acyltransferases involved in catalyzing thioesterification, such as palmitoyl acyltransferase (see below).

The term "reversible protection by chemical means," as used here, encompasses reversible protection:

1. By modifying agents that reversibly modify cysteinyl groups, such as, for example, by sulfonation and thioesterification;

Sulfonation is a reaction where the thiol or cysteines involved in disulfide bridges are modified to S-sulfonate: RSH -> RS-SO3' (Darbre, A. 1986) or RS-SR → RS-SO3” (sulfitolysis; (Kumar, N. et al. 1986)). Reagents for sulfonation include, for example, Na2SO3 or sodium tetrathionate. These sulfonation reagents are used at a concentration of 10-200 mM, and more preferably at a concentration of 50-200 mM. Optionally, sulfonation can be carried out in the presence of a catalyst, such as, for example, Cu.2+ (100 μΜ-1 mM) or cysteine (1-10 mM).

The reaction can be carried out under protein denaturation as well as native conditions (Kumar, N. et al. 1985,

Kumar, N. et al. 1986).

The formation of thioester bonds, or thioesterification, is characterized by:

RSH + R' COX RS-COR' where X is preferably a hayogen in the compound R'COX.

2. By modifying agents that reversibly modify the cysteinyls of the present invention, such as, for example, heavy metals, in particular Zn.2+,

CD2+, mono, dithio disulfide compounds (e.g.

Aryl and alkyl methanethiosulfonate, dithiopyridine, dithiomorpholine, dihydrolipoamide, aldrothiol® (Aldrich) (Rein, Ellmann reagent, A. et al. 1996), dithiocarbamates), or thiolating agents (e.g., glutathione, N-acetylcysteine, cysteineamine). Dithiocarbamates comprise a broad class of molecules possessing an R1R2NC(S)SR3 functional group, which gives them the ability to react with sulfhydryl groups. Thiol-containing compounds are preferably used at a concentration of 0.1-50 mM, more preferably at a concentration of 1-50 mM, and even more preferably at a concentration of 10-50 mM;

3. Due to the presence of modifying agents that preserve the thiol's state (stabilize it), in particular antioxidants, such as, for example, DTT, dihydroascorbate, vitamins and derivatives, mannitol, amino acids, peptides and derivatives (e.g., histidine, ergothioneine, carnosine, methionine), gallates, hydroxyanisole, hydroxytoluene, hydroquinone, hydroxymethylphenol and its derivatives in the concentration range of 10 μM-10 mM, most preferably at a concentration of 1-10 mM;

<td>as,</td><td>put</td><td>example,</td><td colspan="2">(i) cofactors such as</td><td>ions</td><td>of metals</td>

<td>(Zn2+,</td><td>Mg2+)</td><td>The ATP</td><td>(ü)</td><td>pH control (</td><td>e.g.</td><td>., for the</td>

<td colspan="2">proteins,</td><td>in the largest</td><td>part</td><td>In most cases, the pH</td><td> ~5</td><td>or the pH is</td>

preferably pKthe of thiol-2; e.g., for peptides purified by Reverse Phase Chromatography at pH ~2).

Reversible protection combinations as described in (1), (2), (3) and (4) can result in similarly pure and replicable HCV proteins. In fact, combination compounds such as, for example, Z103 (Zn carnosine) can be used, preferably at a concentration of 1-10 mM. It should be clear that reversible protection also refers to, in addition to the modification groups or shielding described above, any method of protecting the cysteinyl group that can be reversed enzymatically or chemically without breaking the peptide backbone. In this regard, the present invention specifically relates to peptides prepared by classical chemical synthesis (see above), in which, for example, thioester linkages are cleaved by thioesterase under basic buffer conditions (Beekman, NJ et al. 1997) or by treatment with hydroxylamine (Vingerhoeds, M. H. et al. 1996).

Thiol-containing HCV proteins can be purified, for example, on affinity chromatography resins containing (1) a cleavage-capable connector arm containing an immobilized disulfide linkage (e.g., 5,5'-dithiobis(2-nitrobenzoic acid)) (Jayabaskaran, C. et al. 1987), and covalent chromatography on activated thiolSepharose 4B (Pharmacia) or (2) an aminohexanoyl-4-aminophenylarsine as an immobilized ligand. This affinity matrix has been used for the purification of proteins that are subject to redox regulation, and dithiol proteins that are targets for oxidative stress (Kalef, E. et al.).

1993) .

Reversible protection can also be used to increase the solubilization and extraction of peptides (Pomroy, NC and Deber, (h M. 1998).

Compounds for reversible protection and stabilization of thiols can be presented in monomeric, polymeric, or liposomal form.

The reversible removal of the protective state from cysteine residues can be achieved chemically or enzymatically, for example:

- a reducing agent, in particular DDT, DTE, 2-mercaptoethanol, dithionite, SnCl2, sodium borohydride, hydroxylamine, TCEP, particularly at a concentration of 1-200 mM, more preferably at a concentration of 50-200 mM;

- removal of thiol stabilizing conditions or agents by, for example, increasing the pH;

- enzymes, in particular thioesterases, glutaredoxin, thioredoxin, particularly at a concentration of 0.01-5 μM, even more particularly in a concentration range of 0.1-5 μM;

- combinations of the chemical and/or enzymatic conditions described above.

The reversible removal of the protective state from cysteine residues can be carried out in vitro or in vivo, e.g., in a cell or in an individual.

It will be appreciated that in the purification procedure, cysteine residues may or may not be irreversibly blocked, or replaced by any reversible modifying agent, as listed above.

A reducing agent according to the present invention is any agent that achieves the reduction of sulfur in cysteine residues, e.g., SS disulfide bridges, desulfonation of cysteine residue (RS-SO).3_ (RSH). An antioxidant is any reagent that preserves the thiol state or minimizes the formation and/or exchange of SS. The reduction of SS disulfide bridges is a chemical reaction by which disulfides are reduced to thiol (—SH). The agents and methods for breaking the disulfide bridge disclosed by Maertens et al. in WO 96/04385 are hereby incorporated by reference into the present description. SS reduction can be achieved by (1) enzymatic cascade pathways or by (2) reducing compounds. Enzymes such as thioredoxin and glutaredoxin are known to be involved in the in vivo reduction of disulfides and have also been shown to be effective in reducing SS bridges in vitro. Disulfide bridges are rapidly cleaved by reduced thioredoxin at pH 7.0, with an apparent second-order rate of approximately 104 times greater than the corresponding rate constant for the reaction with DTT. The reduction kinetics can be dramatically increased by pre-incubating the protein solution with 1 mM DTT or dihydrolipoamide (Holmgren, A. 1979). Thiol compounds capable of reducing protein disulfide bridges include, for example, dithiothreitol (DTT), dithioerythritol (DTE), β-mercaptoethanol, thiocarbamates, bis(2-mercaptoethyl) sulfone, N,N'-bis(mercaptoacetyl)hydrazine, and sodium dithionite. Reducing agents without thiol groups, such as ascorbate or stannous chloride (SnCl2), have been shown to be very useful in reducing disulfide bridges in monoclonal antibodies (Thakur, ML et al.). (1991), can also be used for the reduction of HCV proteins. Furthermore, changes in pH values can influence the redox state of HCV proteins. Treatment with sodium borohydride has been shown to be effective in reducing disulfide bridges in peptides (Gailit, J. 1993). Tris(2-carboxyethyl)phosphine (TCEP) is capable of reducing disulfides at low pH (Burns, J. et al. 1991). Selenol catalyzes the reduction of disulfide to thiols when DTT or sodium borohydride is used as a reducing agent; selenocysteamine, a commercially available diselenide, was used as a catalyst precursor (Singh, R. and Kats, L. 1995).

The term immunogenic refers to the ability of a protein or substance to produce an immune response. An immune response is the body's overall response to the introduction of an antigen, including antibody formation, cellular immunity, immunoreactivity, or immunological tolerance. Cellular immunity refers to a response from helper T cells and/or CTLs.

The term antigenic refers to the ability of a protein or substance to cause the formation of an antibody or to trigger a cellular response.

The term T-cell stimulating epitope according to the present invention refers to an epitope capable of stimulating T cells or CTL cells, respectively. A T-helper cell stimulating epitope can be selected by monitoring the lymphoproliferative response to polypeptides that contain a (putative) T-cell stimulating epitope in their amino acid sequence. The aforementioned lymphoproliferative response can be measured by a T-helper assay comprising in vitro stimulation of peripheral blood mononuclear cells (PMBCs) from patient sera with varying concentrations of peptides to be tested for T-cell stimulating activity and counting the amount of radiolabeled thymidine uptake. A CLT-stimulating epitope can be selected via a cytotoxic T cell (CTL) assay measuring the lytic activity of cytotoxic cells using release of51Cr. Proliferation is considered positive when the stimulation index (average cpm of antigen-stimulated cultures/average cpm of control cultures) is more than 1, preferably more than 2, and even more preferably more than 3.

Another aspect of the invention relates to a composition comprising an isolated HCV envelope protein, or a fragment thereof, according to the invention. Said composition may further comprise a pharmaceutically acceptable carrier and may be a medicament or a vaccine.

A further aspect of the invention covers a medicament or vaccine comprising an HCV envelope protein, or part thereof, according to the invention.

Yet another aspect of the invention comprises a pharmaceutical composition for inducing a specific immune response to HCV in a mammal, said composition comprising an effective amount of an HCV envelope protein, or part thereof, according to the invention and, optionally, a pharmaceutically acceptable adjuvant. The said pharmaceutical composition comprising an effective amount of an HCV envelope protein, or part thereof, according to the invention, may also be capable of inducing specific antibodies to HCV in a mammal, or capable of inducing T cell function in a mammal. The said pharmaceutical composition comprising an effective amount of an HCV envelope protein, or part thereof, according to the invention, may be a prophylactic composition or a therapeutic composition. In a specific embodiment, said mammal is a human being.

A mammal is to be understood as any member of the class of higher vertebrates Mammalia, including humans; characterized by live birth, body hair, and mammary glands in females that secrete milk to feed the young. Mammals, therefore, also include non-human primates and trimerous mice (Zauberman et al. 1999).

A vaccine or medication is a composition capable of providing protection against a disease, whether partial or complete, whether acute or chronic; in this case, the vaccine or medication is a prophylactic vaccine or medication. A vaccine or medication may also be useful for treating an individual who is already ill, in which case it is called a therapeutic vaccine or medication. Similarly, a pharmaceutical composition can be used for prophylactic and/or therapeutic purposes, in which case it is a prophylactic and/or therapeutic composition, respectively.

The HCV envelope proteins of the present invention can be used as such, in a biotinylated form (as explained in WO 93/18054) and/or forming a complex with Neutralite Avidin (Molecular Probes Inc., Eugene, OR, USA), avidin or streptavidin. It should also be noted that a vaccine or a medicine may comprise, in addition to an active substance, a pharmaceutically acceptable carrier or pharmaceutically acceptable adjuvant, which may be a suitable excipient, diluent, carrier and/or adjuvant that, by itself, does not induce the production of harmful antibodies in the individual receiving the composition, nor does it cause protection to arise. Suitable carriers are typically large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Such carriers are well known to those skilled in the art. Preferred adjuvants for increasing the efficacy of the composition include, but are not limited to: aluminum hydroxide, aluminum in combination with 3-O-deacylated monophosphoryl lipid A, as described in WO 93/19780, aluminum phosphate, as described in WO 93/24148, N-acetyl-muramillyl-L-threonyl-D-isoglutamine, as described in US Patent No.£ 4,606,918, N-acetyl-normuramyl-L-alanyl-Disoglutamine, N-acetylmuramyl-L-alanyl-D-isoglutamyl-L-alanine 2-(1'2'dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)ethylamine, RIBI (ImmunoChem Research Inc., Hamilton, MT, USA), containing monophosphoryl lipid A, detoxified endotoxin, trehalose-6,6-dimycolate, and cell wall skeleton (MPL + TDM + CWS) in a 2% squalene/Tween 80 emulsion. Any of the three components MPL, TDM, or CWS can also be used alone or in combination 2 by 2. MPL can also be replaced by its synthetic analogue, referred to as RC-529. Additionally, adjuvants such as Stimulon (Cambridge Bioscience, Worcester, MA, USA),

SAF-1 (Syntex), or bacterial DNA-based adjuvants such as ISS (Dynavax) or CpG (Coley Pharmaceuticals), may be used, as well as adjuvants such as combinations of QS21 and monophosphoryl lipid A 3-de-O-acetylated (WO94/00153), or MF-59 (Chiron), or poly[di(carboxylatophenoxy)phosphazene]-based adjuvants (Virus Research Institute), or block copolymer-based adjuvants such as Optivax (Vaxcel, Cythx), or inulin-based adjuvants. such as Algamulin and Gamalnulin (Anutech), Incomplete Freund's Adjuvant (IFA) or Gerbu preparations (Gerbu Biotechnik). It is to be understood that Complete Freund's Adjuvant (CFA) can be used for non-human applications and research purposes as well. A vaccine composition may additionally contain excipients and diluents, which are inherently non-toxic and non-therapeutic, such as water, saline, glycerol, ethanol, wetting or emulsifying agents, pH buffering substances, preservatives, and the like. Typically, a vaccine composition is prepared as an injectable, liquid solution, or suspension. Injection can be subcutaneous, intramuscular, intravenous, intraperitoneal, intrathecal, or intradermal. Other administration methods include implantation, suppositories, oral ingestion, enteric application, inhalation, aerosolization, nasal spray, or drops. Solid forms, suitable for dissolving on or suspending in liquid vehicles before injection, may also be prepared. The preparation can also be emulsified or encapsulated in liposomes to enhance the effect of the adjuvant. Polypeptides can also be incorporated into Immune Stimulating Complexes along with saponins, for example Quil A (ISCOMS). Vaccine compositions comprise an effective amount of an active substance as well as any of the other components mentioned above. The effective amount of an active substance means that administering this amount to an individual, in a single dose or as part of a series, is effective for the prevention or treatment of a disease or for inducing a desired effect. This amount varies depending on the health and physical condition of the individual being treated, the taxonomic group of the individual being treated (e.g., human, non-human primate, primate, etc.), the ability of the individual's immune system to mount an effective immune response, the degree of protection desired, the vaccine formulation, the assessment of the treating physician, the strain of the infecting pathogen, and other relevant factors. The dosage is expected to fall within a relatively wide range that can be determined through routine assays. Typically, the dosage will range from 0.01 to 1000 pg/dose, more particularly from 0.1 to 100 pg/dose. Dosage treatment may be a single-dose program or a multiple-dose program. The vaccine may be administered in conjunction with other immunoregulatory agents.

Another aspect of the present invention relates to a method for producing the isolated HCV envelope protein, or a fragment thereof, according to the invention.

said method for producing an HCV envelope protein, or part thereof, includes, for example, transforming a host cell with a recombinant nucleic acid or vector comprising an open reading frame encoding said HCV envelope protein, or part thereof, and wherein said host cell is capable of expressing said HCV envelope protein, or part thereof. The said method may further comprise cultivating said host cells in a suitable medium to obtain the expression of said protein, isolating the expressed protein from a culture of said host cells, or from said host cells. Said isolation may include one or more of (i) lysis of said host cells in the presence of a chaotropic agent, (ii) chemical modification of the thiol groups of cysteine in the isolated proteins, wherein said chemical modification may be reversible or irreversible, and (iii) heparin affinity chromatography.

Illustrative chaotropic agents are guanidinium chloride and urea. In general, a chaotropic agent is a chemical substance that can disrupt the hydrogen bonding structure of water. In concentrated solutions, they can denature proteins because they reduce the hydrophobic effect.

Recombinant nucleic acid refers to nucleic acid of natural or synthetic origin that has undergone at least one recombinant DNA technical manipulation, such as restriction enzyme digestion, PCR, ligation, dephosphorylation, phosphorylation, mutagenesis, codon adaptation for expression in a heterologous cell, etc. In general, a recombinant nucleic acid is a fragment of a naturally occurring nucleic acid, or comprises at least two fragments of nucleic acids not naturally associated, or is an entirely synthetic nucleic acid.

The terms polynucleotide, polynucleic acid, nucleic acid sequence, nucleotide sequence, nucleic acid molecule, oligonucleotide, probe or primer, when used herein, refer to nucleotides, or ribonucleotides, deoxyribonucleotides, peptide nucleotides or closed nucleotides, or a combination thereof, in a polymeric form of any length or any shape (e.g., branched DNA). These terms also include double-stranded (ds) and single-stranded (ss) polynucleotides, as well as triple-stranded polynucleotides. These terms also include known modifications of

<td rowspan="2">nucleotides, 'coverings'</td><td colspan="2">such as methylation,</td><td rowspan="2">cycling one or more</td><td rowspan="2">and the of the</td>

<td>and the replacement</td><td>of</td>

<td>nucleotides</td><td>naturally occurring</td><td>put</td><td>an analogue, such</td><td>as</td>

Inosine, or by non-amplified monomers such as HEG (hexethylene glycol). Ribonucleotides are designated as NTPs, deoxyribonucleotides as dNTPs, and dideoxynucleotides as ddNTPs.

Nucleotides can generally be labeled radioactively, chemiluminescently, fluorescently, phosphorescently, or with infrared dyes, or with an enhanced Raman label on the surface, or with piasmonium resonant particle (PRP).

The terms polynucleotide, polynucleic acid, nucleic acid sequence, nucleotide sequence, nucleic acid molecule, oligonucleotide, probe, or primer also include nucleic peptide acids (NPAs), a DNA analog in which the backbone is a pseudopeptide consisting of N-(2-aminoethyl)-glycine units instead of a sugar. PNAs mimic the behavior of DNA and link complementary nucleic acid strands. The neutral backbone of PNA results in stronger binding and greater specificity than is normally achieved. Furthermore, the unique chemical, physical, and biological properties of PNA have been exploited to produce powerful biomolecular tools, nonsense agents and antigens, molecular probes, and biosensors. PNA probes can generally be shorter than DNA probes and are usually 6 to 20 bases in length and more optimally 12 to 18 bases in length (Nielsen, PE 2001). These terms additionally include hindered nucleic acids (LNAs), which are RNA derivatives in which the ribose ring is held together by a methylene bond between the 2' oxygen and the 4' carbon. LNAs show unprecedented binding affinity for target DNA or RNA sequences. LNA nucleotides can be oligomerized and incorporated into chimeric or mixed-meric LNA/DNA or LNA/RNA molecules. LNAs appear to be non-toxic to cultured cells (Orum, H. and Wengel, J. 2001, Wahlestedt, C. et al. 2000). In general, chimeras or mixed monomers of any DNA, RNA, PNA, and LNA are considered, as well as any of these in which thymine is replaced by uracil.

It is clear from the above description that the present invention also relates to the use of a glycosylated HCV envelope protein in the core according to the invention or a composition according to the invention for the

<td>manufacturing</td><td>of a composition</td><td>vaccine</td><td>of</td><td>HCV.</td><td>In</td>

<td>particular,</td><td>the present invention</td><td>relates</td><td>to the</td><td>use of</td><td>one</td>

<td>protein</td><td>HCV envelope</td><td>glycosylated</td><td>node</td><td>core</td><td>of</td>

in accordance with the invention to induce immunity against HCV in chronic HCV carriers. More specifically, the present invention relates to the use of a glycosylated HCV envelope protein in the core, as defined herein, to induce immunity against HCV in chronic HCV carriers before, simultaneously with, or after any other therapy, such as, for example, the well-known interferon therapy in combination with, or not, the administration of minor HCV-treating drugs, such as, for example, ribavirin. This composition can also be used before or after liver transplantation, or after a suspected infection, such as, for example, a needle stick injury.

Another aspect of the invention relates to a method for detecting the presence of anti-HCV antibodies in a sample suspected of containing anti-HCV antibodies, said method comprising:

(i) contacting an HCV envelope protein, or part thereof, according to the invention with said sample, under conditions that permit the formation of a complex of said HCV envelope protein, or part thereof, with said anti-HCV antibodies, (ii) detecting the complex formed in (i), and (iii) deducing from (ii) the presence of said anti-HCV antibodies in said sample.

In one specific embodiment, the contact in step (i) of said method is occurring under competitive conditions. In another specific embodiment of said method, said HCV envelope protein, or part thereof, is attached to a solid support. In a further embodiment, said sample suspected of comprising anti-HCV antibodies is a biological sample.

A further aspect of the invention relates to a diagnostic kit for detecting the presence of anti-HCV antibodies in a sample suspected of containing anti-HCV antibodies, said kit comprising an HCV envelope protein, or part thereof, according to the invention. In a specific embodiment thereof, said HCV envelope protein, or part thereof, is attached to a solid support. In a further embodiment, the said sample suspected of containing anti-HCV antibodies is a biological sample.

The term biological sample, as used herein, refers to a sample of tissue or fluid isolated from an individual, including, but not limited to, for example, serum, plasma, lymph fluid, external sections of skin, respiratory, intestinal or genitourinary tracts, oocytes, tears, saliva, milk, blood cells, tumors, organs, gastric secretions, mucus, spinal cord fluid, external secretions such as, for example, excrement. Urine, semen, and similar substances.

The HCV envelope proteins of the present invention, or parts thereof, are particularly suitable for incorporation into methods, such as immunoassay methods, for the detection of HCV, and/or the determination of HCV genotypes, for the prognosis/monitoring of HCV disease, or as a therapeutic agent.

The methods, such as immunoassay methods, according to the present invention utilize the HCV envelope proteins of the present invention that maintain linear (in the case of peptides) and conformational epitopes, recognized by antibodies in the sera of individuals infected with HCV. The HCV El and E2 antigens of the present invention can be employed in virtually any assay format that uses a known antigen to detect antibodies. Obviously, a format that denatures the conformational epitope of HCV should be avoided or adapted. A common feature of all these assays is that the antigen is contacted with the body component suspected of containing antibodies to HCV under conditions that allow the antigen to bind to any such antibody present on the component. Such conditions will typically be physiological temperature, pH, and ionic concentration using an excess of antigen. Incubation of the antigen with the specimen is followed by detection of the immune complexes comprised of the antigen.

The design of an immunoassay is subject to much variation, and many formats are known in the art. Protocols may, for example, use solid supports or immunoprecipitation. Most assays involve the use of labeled antibodies or polypeptides; the labels may be, for example, enzymatic, fluorescent, chemiluminescent, radioactive, or dye molecules. Assays that amplify immune complex signals are also known; examples include assays using biotin and avidin or streptavidin, and labeled and enzyme-mediated immunoassays, such as ELISA and RIA assays.

An immunoassay can be, without limitation, in a heterogeneous or homogeneous format, and of a standard or competitive type. In a heterogeneous format, the polypeptide is typically bound to a matrix or solid support to facilitate the separation of the sample from the polypeptide after incubation. Examples of solid supports that can be used are nitrocellulose (e.g., in the form of membranes or microtiter plates), polyvinyl chloride (e.g., in sheets or microtiter plates), polystyrene latex (e.g., in beads or microtiter plates), polyvinylidine fluoride (known as Immunolon®), diazotized paper, nylon membranes, activated beads, and Protein A beads. For example, Dynatech's Immunolon® 1 or Immunolon® 2 microtiter plates can be used in heterogeneous format. The solid support containing the antigenic polypeptides is typically washed after separation from the test sample and before detection of bound antibodies. Both standard and competitive formats are known in the art.

In a homogeneous format, the test sample is incubated with the antigen combination in solution. For example, it may be under conditions that will precipitate any antigen-antibody complexes that are formed. Both standard and competitive formats for these assays are known in the art.

In a standard format, the quantity of antibodies, such as anti-HCV antibodies, in antibody-antigen complexes is directly monitored. This can be done by determining whether labeled anti-xenogeneic (e.g., anti-human) antibodies, which recognize an epitope on said antibodies, such as said anti-HCV antibodies, will bind due to complex formation. In a competitive format, the quantity of said antibodies, such as said anti-HCV antibodies, in a sample is deduced by monitoring the competitive effect on the binding of a known quantity of (labeled) antibody (or other competing ligand) or antigen in the complex.

Antigen-antibody complexes can be detected by any of several known techniques, depending on the format. For example, unlabeled antibodies, such as anti-HCV antibodies, in the complex can be detected using an antixenogenic Ig conjugate forming a complex with a label (e.g., an enzyme label).

In an immunoprecipitation or agglutination assay, the reaction between an antigen and an antibody forms a clump of proteins that precipitates from the solution or suspension and forms a visible layer or film of

<td>precipitate.</td><td>If none</td><td>antibody</td><td>you are</td><td>present</td><td>node</td>

<td>specimen or</td><td>in the sample of</td><td colspan="2">test, none of that</td><td>precipitate</td><td>and</td>

<td>formed.</td><td></td><td></td><td></td><td></td><td></td>

<td>To the</td><td>proteins</td><td>wrap</td><td>of HCV</td><td colspan="2">or their</td>

Specific parts of the present invention, comprising conformational epitopes, will typically be packaged in the form of a kit for use in these immunoassays. The kit will normally contain, in separate containers, the native HCV antigen, control antibody formulations (positive and/or negative), the labeled antibody when the assay format requires it, and signal-generating reagents (e.g., enzyme substrate) if the label does not generate a signal directly. 0 Native HCV antigen may already be bound to a solid matrix or separated with reagents for matrix binding. Instructions (e.g., written, tape, CD-ROM, etc.) for performing the assay will usually be included in the kit.

The selected solid phase may include polymeric or glass beads, nitrocellulose, microparticles, microcavities of a reaction tray, test tubes, and magnetic beads. The signal-generating compound may include an enzyme, a luminescent compound, a chromogen, a radioactive element, and a chemiluminescent compound. Examples of enzymes include alkaline phosphatase, horseradish peroxidase, and beta-galactosidase. Examples of enhancing compounds include biotin, antibiotin, and avidin. Examples of enhancing compounds that bind elements include biotin, antibiotin, and avidin. In order to block the effects of rheumatoid factor-like substances, the test sample is subjected to conditions sufficient to block the effect of rheumatoid factor-like substances.

These conditions comprise contacting the test sample with a quantity of anti-human IgG to form a mixture, and incubating the mixture for a time and under conditions sufficient to form a reaction mixture product substantially free of rheumatoid factor-like substance.

In particular, the present invention relates to the use of an HCV envelope protein, or part thereof, according to the invention, for the preparation of a diagnostic kit.

Since the glycosylated HCV envelope proteins in the core according to the present invention are highly immunogenic, and stimulate both the nuchal and cellular immune response, the present invention further relates to a kit for detecting the HCV-related T cell response, comprising the oligomeric particle or the purified individual HCV envelope protein of the present invention. The T cell response to HCV can, for example, be measured as described by

Leroux-Roels et al. in WO95/12677.

A further aspect of the invention relates to a method of inducing a specific immune response to HCV in a mammal, said method comprising administering to said mammal an effective amount of an HCV envelope protein, or part thereof, according to the invention, optionally comprising a pharmaceutically acceptable adjuvant. 0 said method comprising administering to said mammal an effective amount of an HCV envelope protein, or part thereof, according to the invention, can also be used to induce specific antibodies to HCV in a mammal or to induce T cell function in a mammal. In said methods, said administration can be for prophylactic purposes,

i.e., prophylactic administration, or for therapeutic purposes, i.e., therapeutic administration.

Yet another aspect of the invention relates to a method of immunizing a mammal, said method comprising administering to said mammal an effective amount of an HCV envelope protein, or part thereof, according to the invention, optionally comprising a pharmaceutically acceptable adjuvant.

The present invention also relates to a method of treating a mammal infected with HCV, said method comprising administering to said mammal an effective amount of an HCV envelope protein, or part thereof, according to the invention, optionally comprising a pharmaceutically acceptable adjuvant.

Any aspects of the invention or specific embodiments for said aspects described above are also generally applicable to the proteins of interest, which are the product of expression in a eukaryotic cell and which are further characterized by the same glycosylation properties as described above for the two envelope proteins of

Different HCV types.

More specifically, the invention thus relates to an isolated protein of interest, or a fragment thereof, comprising at least one N-glycosylation site, said protein, or its fragment, distinguished in that it is the product of expression in a eukaryotic cell and further distinguished in that, on average, up to 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79% or 80% of N-glycosylated sites are glycosylated in the nucleus.

<td>specific</td><td>in addition</td><td>more than that</td><td>what</td><td> 60%,</td><td> 61%, 62%,</td><td> 63%</td>

<td> 89%, 90%,</td><td> 91%,</td><td> 92%, 93%, 94%</td><td>or</td><td> 95 %</td><td colspan="2">of the N sites</td>

<td>glycosylated</td><td>are glycosylated with</td><td>an oligomannose</td><td>with a</td>

<td colspan="2">structure defined by Man(8 a</td><td>10)-GlcNAc(2).</td><td>More</td>

<td>specific</td><td>for any of</td><td>characteristics</td><td>of N-</td>

<td>glycosylation</td><td>described above,</td><td>the reason for</td><td>sites</td>

glycosylated in the core with an oligomannose with the structure Man(7)-GlcNAc(2) over the glycosylated sites in the core with an oligomannose with the structure Man(8)-GlcNAc(2) is less than, or equal to, 0.15, 0.2, 0.25, 0.30, 0.35, 0.40, 0.45, or 0.50. In addition, more specifically for any of the N-glycosylation characteristics described above, said oligomannoses contain less than 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, or 5% of terminal al,3-mannose.

Another alternative aspect of the invention relates to an isolated protein of interest, or a fragment thereof, comprising at least one N-glycosylation site, said protein, or its fragment, distinguished by the fact that it is the product of expression in a eukaryotic cell and further distinguished by the fact that the N-glycosylated sites are occupied by oligomannoses wherein the ratio of oligomannoses with the Man(7)-GlcNAc(2) structure to oligomannoses with the Man(8)-GlcNAc(2) structure is less than or equal to 0.15, 0.2, 0.25, 0.30, 0.35, 0.40, 0.44, 0.45, or 0.50. Furthermore, more specifically regarding the N-glycosylation characteristics described above, said oligomannoses contain less than 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, or 5% of terminal al,3-mannose.

In particular, the said isolated protein of interest, or a fragment thereof, is the product of expression in a yeast cell, such as a Hansenula cell. The said isolated protein of interest, or a fragment thereof, may, for example, be a viral envelope protein, or a fragment thereof, such as an HCV envelope protein or an HBV (hepatitis B) envelope protein, or fragments thereof. In general, the said protein of interest, or its fragment, can be any protein requiring the N-glycosylation characteristics of the present invention. Other illustrative viral envelope proteins include the HIV (human immunodeficiency virus) envelope protein gpl20 and the viral envelope proteins of a virus belonging to the Flavirideae family. In general, the isolated protein of interest, or a fragment thereof, can be any protein that requires the N-glycosylation characteristics of the present invention.

Recombinant HCV vaccinia virus means a vaccinia virus comprising a nucleic acid sequence encoding an HCV protein or part thereof.

The terms HCV virus-like particle formed from an HCV envelope protein and oligomeric particles formed from HCV envelope proteins are defined herein as structures of a specific nature and shape containing several basic units of the HCV envelope proteins El and/or E2, which in themselves are believed to consist of one or two monomers of El and/or

E2, respectively. It should be clear that the particles of the present invention are defined as being devoid of infectious HCV RNA genomes. The particles of the present invention may be higher-order particles of a spherical nature, which may be hollow, consisting of an outer coating of envelope proteins into which lipids, detergents, HCV core protein, or adjuvant molecules may be incorporated. These particles can also be encapsulated by liposomes or apolipoproteins, such as, for example, apolipoprotein B or low-density lipoproteins, or by any other means of targeting said particles to a specific organ or tissue. In this case, such hollow spherical particles are often referred to as virus-like particles or VLPs. Alternatively, higher-order particles may be solid spherical structures, wherein the entire sphere consists of HCV envelope protein oligomers E1 or E2, into which lipids, detergents, HCV core protein, or adjuvant molecules may be further incorporated, or which, in turn, may themselves be encapsulated by liposomes or apolipoproteins, such as, for example, apolipoprotein B, low-density lipoproteins, or by any other means of targeting said particles to a specific organ or tissue, e.g., asialoglycoproteins. The particles may also consist of smaller structures (compared to the hollow or solid spherical structures indicated above), which are normally round in shape (see below) and which normally contain no more than a single layer of HCV envelope proteins. A typical example of such smaller particles are rosette-like structures, which consist of a smaller number of envelope proteins.

HCV, typically between 4 and 16. A specific example of these includes the smaller particles obtained with Eis in 0.2% CHAPS, as exemplified here, which apparently contain

8-10 Eis monomers. Such rosette-like structures are typically arranged in a plane and are round in shape, e.g., in the form of a wheel. Again, lipids, detergents, HCV core protein, or adjuvant molecules may be further incorporated, or smaller particles may be encapsulated by liposomes or apolipoproteins, such as, for example, apolipoprotein B or low-density lipoproteins, or by any other means of targeting said particles to a specific organ or tissue. Smaller particles can also form small spherical or globular structures consisting of a similarly smaller number of HCV envelope proteins E1 or E2 into which lipids, detergents, HCV core protein, or adjuvant molecules could be additionally incorporated, or which, in turn, could be encapsulated by liposomes or apolipoproteins, such as, for example, apolipoprotein B or low-density lipoproteins. or by any other means of targeting said particles to a specific organ or tissue. The size (i.e., the diameter) of the particles defined above, as measured by well-known dynamic light scattering practices in the art (see additionally in the examples section), is normally between 1 and 100 nm, more preferably between 2 and 70 nm, even more preferably between 2 and 40 nm, between 3 and 20 nm, between 5 and 16 nm, between 7 and 14 nm or between 8 and 12 nm.

In particular, the present invention relates to a method for purifying the core-glycosylated envelope proteins of hepatitis C virus (HCV), or any part thereof, suitable for use in an immunoassay or vaccine, this method comprising:

(i) develop negatively glycated strains of

Hansenula or Saccharomyces, transformed with an envelope gene encoding an HCV El and/or HCV E2 protein, or any part thereof, in a suitable culture medium;

(ii) cause the expression of said gene for El of

HCV and/or HCV E2, or any part thereof; and (iii) purify said HCV El and/or HCV E2 protein glycosylated in the nucleus, or any part thereof, from said cell culture.

The invention further relates to a method for purifying the core-glycosylated envelope proteins of hepatitis C virus (HCV), or any part thereof, suitable for use in an immunoassay or vaccine, this method comprising:

(i) develop negatively glycated strains of

Hansenula or Saccharomyces, transformed with an envelope gene encoding an HCV El and/or HCV E2 protein, or any part thereof, in a suitable culture medium;

(ii) cause the expression of said gene for El of

(i) develop glycosylated negative strains of Hansenula or Saccharomyces, transformed with an envelope gene encoding an HCV El and/or HCV E2 protein, or any part thereof, in a suitable culture medium, wherein said HCV El and/or HCV E2 protein, or any part thereof, comprises at least two amino acids

Cys;

(ii) cause the expression of said gene for HCV El and/or HCV E2, or any part thereof; and (iii) purify said HCV El and/or HCV E2 protein glycosylated in the core, or any part thereof, in which said Cys amino acids are reversibly protected by chemical and/or enzymatic means, from said culture.

(i) develop negatively glycosylated strains of Hansenula or Saccharomyces, transformed with a wrapper gene encoding a

<td>protein</td><td>El de</td><td>HCV and/or</td><td>E2 of</td><td>HCV,</td><td>or</td>

<td>any</td><td>part</td><td>of the same,</td><td>in a</td><td>quite</td><td>of</td>

<td>culture</td><td>adequate</td><td>in which the</td><td colspan="2">said protein</td><td>El</td>

of HCV and/or E2 of HCV, or any part thereof, comprises at least two amino acids.

Cys;

i i

(ii) cause the expression of said gene for El of

HCV and/or HCV E2, or any part thereof; and (iii) purify said HCV El and/or HCV E2 protein expressed intracellularly glycosylated in the nucleus, or any part thereof, by lysing the transformed host cell, in which said Cys amino acids are reversibly protected by chemical and/or enzymatic means, from said culture.

The present invention specifically relates to a method for purifying recombinant yeast HCV core glycosylated proteins, or any part thereof, as described herein, wherein said purification includes heparin affinity chromatography.

Therefore, the present invention also relates to a method for purifying recombinant yeast HCV core glycosylated proteins, or any part thereof, as described above, wherein said chemical means is sulfonation.

Therefore, the present invention also relates to a method for purifying recombinant yeast glycosylated HCV proteins, or any part thereof, as described above, wherein said irreversible chemical protection is NEM or Biotin-NEM or a mixture thereof.

The present invention also relates to a composition as defined above, which also comprises the core proteins El, E2, P7, NS2, NS3, NS4A, NS4B, NS5A and/or NS5B of HCV, or parts thereof. The glycosylated core proteins El, E2, and/or E1/E2 of the present invention may, for example, be combined with other HCV antigens, such as, for example, core, P7, NS3, NS4A, NS4B, NS5A and/or NS5B. The purification of these NS3 proteins will preferably include a reversible modification of the cysteine residues, and even more preferably the sulfonation of the cysteines. Methods for achieving such a reversible modification, including sulfonation, have been described for NS3 proteins in Maertens et al. (PCT/EP99/02547). It should be noted that the entire content, including all definitions, of this document is incorporated by reference into this application.

Also, the present invention relates to the use of a glycosylated envelope protein in the core, as described herein, to induce immunity against HCV, characterized in that said glycosylated envelope protein in the core is used as part of a series of timing compounds. In this regard, it should be understood that the term "a series of times and compounds" refers to administering, at time intervals, to an individual the compounds used to elicit an immune response.

These compounds may comprise any of the following components: a glycosylated envelope protein in the core, HCV DNA vaccine composition, polypeptides of

HCV.

In this respect, a series includes managing:

(i) an HCV antigen, such as, for example, a glycosylated envelope protein in the core, at different time intervals, or (ii) an HCV antigen, such as, for example, a glycosylated envelope protein in the core in combination with an HCV DNA vaccine composition, wherein said oligomeric particles of glycosylated envelope proteins in the core and said HCV DNA vaccine composition may be administered simultaneously, or at different time intervals, including at alternating time intervals, or

<td>(Üi)</td><td>(i) or</td><td>(ii), possibly in</td><td>combination</td><td>with</td>

<td></td><td>others</td><td>HCV peptides, with</td><td>intervals</td><td>of</td>

<td>With</td><td>relationship</td><td>to this, it must be</td><td>of course</td><td>one</td>

The composition of the HCV DNA vaccine comprises nucleic acids encoding the HCV envelope peptide, including the El, E2, E1/E2 peptides, the NS3 peptide, other HCV peptides, or parts thereof. Furthermore, it is to be understood that said HCV peptides comprise the HCV envelope peptides, including the El, E2, E1/E2 peptides, other HCV peptides, or parts thereof. The term other HCV peptides refers to any HCV peptide, or fragment thereof. In item (ii) of the scheme above, the HCV DNA vaccine composition preferably comprises nucleic acids encoding HCV envelope peptides. In item (ii) of the scheme above, the HCV DNA vaccine composition even more preferably consists of nucleic acids encoding HCV envelope peptides, possibly in combination with an HCV NS3 DNA vaccine composition. In this respect, it should be clear that an HCV DNA vaccine composition comprises a plasmid vector comprising a polynucleotide sequence encoding an HCV peptide as described above, operably linked to transcription regulatory elements. As used herein, a plasmid vector refers to a nucleic acid molecule capable of carrying another nucleic acid to which it is attached. Preferred vectors are those capable of autonomous replication and/or expression of the nucleic acids to which they are attached. In general, but not limited to these, plasmid vectors are circular, double-stranded DNA loops that, in their vector form, are not attached to the chromosome. As used herein, a polynucleotide sequence refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, RNA or DNA analogs made from nucleotide analogs, and single-stranded (sense or nonsense) and double-stranded polynucleotides. As used herein, the term transcriptional regulatory elements refers to a nucleotide sequence containing essential regulatory elements such that, upon introduction into a living vertebrate cell, it is capable of directing the cellular mechanism to produce translation products encoded by the polynucleotide. The term operably linked(s) refers to a juxtaposition in which the components are configured so as to perform their usual function. Thus, transcriptional regulatory elements, operably linked to a nucleotide sequence, are capable of effecting the expression of said nucleotide sequence. Those skilled in the art may appreciate that different transcriptional promoters, terminators, carrier vectors, or specific gene sequences can be successfully used.

Alternatively, the DNA vaccine can be distributed via a live vector, such as adenovirus, canary pox virus, MVA, and similar vectors.

The present invention is illustrated by the Examples presented below. These Examples are merely illustrative and are not to be construed as restricting or limiting the invention in any way.

EXAMPLES

EXAMPLE 1

CONSTRUCTION OF THE PFPMT-MFg-El-H6 SHUTTLE VECTOR 5 The piasmids for the Hansenula polymorpha transformation were constructed as follows. The pFPMT-MFa-El-H6 shuttle vector was constructed in a multi-step procedure. Initially, the nucleic acid sequence encoding the HCV Eis protein (SEQ ID N0:2) was cloned after a CHH leader sequence (CHH = hyperglycemic hormone from Carcinus maenas), which was subsequently replaced by an MFa leader sequence (MFa = crossing factor α from Saccharomyces cerevisiae).

First, a pUC18 derivative was constructed harboring the CHH-E1-H6 unit as an EcoRI/BamHI fragment by the seamless cloning method (Padgett, KA and Sorge, JA 1996). Furthermore, the DNA fragment encoding Els-H6 and the pCHHHir-derived receptor plasmid were generated by PCR, as described below.

Generation of DNA Fragment Encoding Els-H6

The DNA fragment for Els-H6 (encoding for the lb-type HCV Eis protein consisting of amino acids 192 to 326 of the elongated Eis with 6 His residues; SEQ ID NO:5) was isolated by PCR from the pGEMTelsH6 plasmid (SEQ ID

NO:6; Figure 1). The following primers were used for this purpose:

CHHE1-F: 5'-agttactcttca.aggtatgaggtgcgcaacgtgtccg-3' (SEQ ID NO:7);

100

The £amll04I site is underlined, the dot marks the splitting site. The bases printed in bold are complementary to those of the CHH-links primer. The unmarked bases ring within the El (1925 326) initiation region in the sense direction; and

- CHHE1-R:

5'-agttactcttca.caggga tcctccttaatggtgatggtggtggtgcc-3' (SEQ ID NO:8);

The EamllO4I site is underlined; the dot marks the splitting site. The bases printed in bold are complementary to those of the MF30-rechts primer. The bases forming the BamHI site, useful for subsequent cloning procedures, are printed in italics. The unmarked bases ring in a nonsense direction, within the end of the E1-H6 unit, including the stop codon and three additional bases between the stop codon and the BamHI site.

The reaction mixture was constituted as follows: total volume of 50 μL containing 20 ng of pGEMTElsH6 linearized with Bco31I, each 0.2 μM of CHHE1-F and CHHE1-R primers, dNTPs (each at 0.2 μM), 1 x buffer 2 (Long Expand Template PCR System; Boehringer; N- Cat. 1681 834), 2.5 U of polymerase mixture (Long Expand Template PCR System; Boehringer; N- Cat. 1681 834).

Program 1 was used, said program consisting of the following steps:

1. Denaturation: 5 min at 95°C;

2. 10 cycles of 30 seconds of denaturation at 95°C, 30

101 1 second of annealing at 65°C, and 130 seconds of elongation at 68°C.

3. finishing at 4°C.

Then 5 μL of 10 x buffer 2 (Long Expand Mold PCR System; Boehringer; Cat. 1681 834), 40 μL of H2O, and 5 μL of [dATP, dGTP, and dTTP (2 mM each); 10 mM of 5-methyl-dCTP] were added to the sample derived from program 1, and further amplification was performed following program 2, which consists of the following steps:

1. Denaturation: 5 min at 95°C

2. 5 cycles of 45 seconds of denaturation at 95°C, 30 seconds of annealing at 65°C, and 130 seconds at 68°C.

3. finishing at 4°C.

Generation of the pCHH-Hir derived receptor plasmid

The receptor fragment was made by PCR from the pCHH-Hir plasmid (SEQ ID NO:9; Figure 2) and consists of almost the complete pCHH-Hir plasmid, except that the Hir coding sequence is not present in the PCR product. The following primers were used for this PCR:

CHH-links: 51-agttactcttca.cctcttttccaacqqqtqtqtag-3 ' (SEQ ID NO:10);

The EamllO4I site is underlined; the dot marks the split site. The bases printed in bold are complementary to those of the CHHE1-F primer. The unmarked bases ring inside the end of the CHH sequence in the nonsense direction; and

MF30-rechts: 5'-aqtcactcttca.ctgcaggcatgcaagcttggcg-3' (SEQ ID NO:11);

102

The Eamll04I site is underlined; the dot marks the splitting site. The bases printed in bold are complementary to those of the CHHE1-R primer. The unmarked bases ring within the pUCl8 sequences behind the CHHHirudin HL20 cloned from pCHH-Hir, extending away from the insert.

The reaction mixture was constituted as follows: a total volume of 50 μL containing 20 ng of pCHH-Hir linearized with AspllQI, each 0.2 μM of CHH-links and MF30-rechts primers, dNTPs (each at 0.2 μM), 1 x buffer 2 (Long Expand Template PCR System; Boehringer; N- Cat. 1681 834), 2.5 U of polymerase mixture (Long Expand Template PCR System; Boehringer; N2 (from Cat. 1681 834).

Program 1, as described above, was used.

Then, 5 μL of 10 x buffer 2 (Expand Long Template PCR System; Boehringer; N2 of Cat. 1681 834), 40 μΐ of H20 and 5 μμΩ of [dATP, dGTP, and dTTP (2 mM each); 10 mM of 5-methyl-dCTP] were added to the sample derived from program 1, and further amplification was performed following program 2, as described above.

Vector generation pCHHEl

The DNA fragment encoding Els-H6 and the PCR-generated pCHH-Hir-derived receptor plasmid, as described above, were purified using the PCR product purification kit (Qiagen) according to the supplier's specifications. Subsequently, the purified fragments were digested separately with £amll04l. Subsequently, the DNA fragment for Els-H6 was ligated into the pCHH-Hir-derived receptor plasmid using

103 T4 ligase (Boehringer) following the supplier's specifications.

XL-Gold E. coli cells were transformed with the linking mixture, and plasmid DNA from several ampicillin-resistant colonies was analyzed by digestion with BcoRI and BamHI. A positive clone was selected and named pCHHEl.

Vector generation pFPMT-CHH-E!H6

The EcoRI/BamHI fragment of pCHHEl was ligated with the EcoRI/BamHI-digested vector pFPMT121 (SEQ ID NO:12; Figure 3). T4 ligase (Boehringer) was used according to the supplier's instructions. The ligation mixture was used to transform E. coli DH5aF' cells. Several transformants were analyzed using plasmid DNA restriction patterns, and one positive clone was retained, which was named pFPMT-CHH-ElH6 (SEQ ID NO:13; Figure 4).

pFPMT-MFa-El-H6 Generation

Finally, the shuttle vector pFPMT-MFa-El-H6 was generated by linking three fragments, said fragments being:

1. The pFPMT121 digested with EcoRI/BamHI of 6,961 kb (SEQ ID NO:12; Figure 3),

2. The fragment obtained by EcoRI/HindlII of pUC18-MFa of 0.245 (SEQ ID NO:62; Figure 36), and

3. The 0.442 kb BindIII/BamHI fragment of a 0.454 kb PCR product derived from pFPMT-CHH-ElH6.

The PCR product of 0.454 kb, giving rise to the N fragment.2 3, was obtained by PCR using the following

104 primers:

1. primer MFa-El f-Hi:

5'-aggggtaagcttggataaaaggtatgaggtgcgcaacgtgtccgggatgt-3' (SEQ ID NO:14); and

2. primer El back-Bam:

5'-agttacggatccttaatggtgatggtggtggtgccagttcat-3' (SEQ ID NO:15).

The reaction mixture was constituted as follows: Reaction mixture volume of 50 μL, pFPMT-CHH-El-H6 (linearized with EcoRI; 15 ng/μL), 0.5 μL; primer MFa-El fHi (50 μL), 0.25 μL; primer El back-Bam (50 μL), 0.25 μL;

dNTP's (all at 2 mM), 5 μΐ; DMSO, 5 μΐ; H20, 33.5 μL; Buffer 2 (10 x concentrate) of Long Expanding Template PCR System (Boeringer Mannheim; N- Cat. 1681 834), 5 μL; Polymerase mixture of Long Expanding Template PCR System (1 U/μL), 0.5 μL.

The PCR program used consisted of the following steps:

1. Denaturation: 5 min at 95°C

2. 29 cycles of 45 seconds of denaturation at 95°C, 45 seconds of annealing at 55°C, and 40 seconds of elongation at 68°C.

3. finishing at 4°C.

Based on the primers used, the resulting 0.454 kb PCR product contained the El codons (192-326) followed by six histidine codons and a taa stop codon, upstream flanked by the 22 3'-terminal base pairs of the MFa pre-pro sequence (including the relevant HindIII cloning site plus a projection of

105 six base pairs) and downstream flanked by a BamHI site (relevant for cloning) and a six base pair projection.

For the ligation reaction, T4 DNA ligase (Boehringer Mannheim) was used according to the supplier's conditions (sample volume 20 μL).

E. coli HB101 cells were transformed with the linking mixture, and positive clones were retained after restriction analysis of plasmids isolated from various transformants. One positive plasmid was selected and named pFPMT-MFa-El-H6 (SEQ ID NO:16; Figure 5).

EXAMPLE 2

CONSTRUCTION OF THE SHUTTLE-SHUTTLE VECTOR pFPMT-CL-El-H6

The plasmids for the transformation of Hansenula polymorpha were constructed as follows. The pFPMT-CL-El-H6 shuttle vector was constructed in three steps, starting from pFPMT-MFa-El-H6 (SEQ ID NO:16, Figure

5) .

In a first step, the MFaE1-H6 readframe of pFPMT-MFa-El-H6 was subcloned into the pUC18 vector. Then, a 1.798 kb fragment of pFPMT-MFaE1-H6 (containing the FMD promoter plus MFa-El-H6) was ligated to the pUC18 vector fragment using Sail/BamHI with T4 ligase (Boehringer) according to the supplier's conditions. This resulted in a plasmid that is represented in Figure 6 (SEQ ID NO:17), and additionally named pMal2-l (pUC18-FMD-MFa-El-H6). The linking mixture was used to transform the DH5aF' cells of E.

106 coli. Several ampicillin-resistant colonies were collected and analyzed by restriction enzyme digestion of plasmid DNA isolated from selected clones. One positive clone was additionally analyzed by determining the DNA sequence of the MFa-ElH6 coding sequence. A correct clone was used for PCR-directed mutagenesis to replace the MFa pre-prosequence with codons from the avian lysozyme presequence (CL; corresponding to amino acids 1 to 18 of avian lysozyme; SEQ ID NO:1). The principle of the applied PCR-directed mutagenesis method is based on the amplification of an entire plasmid with the desired alterations located at the 5' ends of the primers. In the downstream steps, the ends of the linear PCR product are modified before autoligation, resulting in the desired altered plasmid.

The following primers were used for the reaction of

PCR:

1. primer CL hin:

5'-tgttcctaccactagcagcactaggatatgaggtgcgcaacgtgtccggg-3' (SEQ ID NO:18);

2. primer CL her neu:

' -tagtacfcagrtattagtaggcttcgcatgaattcccgatgaaggcagagagcg-3' (SEQ ID NO: 19).

The underlined 5' regions of the primers contain the codons of approximately half of the avian lysozyme presequence. The CL her neu primer includes a Spel restriction site (italicized). The ununderlined regions of

107 The primers anneal to the codons for amino acid residues 192 to 199 of El (CL hin) or to the initiation codon atg on the FcoRI site up to position -19 (counted from the EcoRI site) of the FMD promoter. The primers are designed to amplify the complete pMal2-l, thereby replacing the MFa pre-prosequence codons with avian lysozyme pre-sequence codons.

The reaction mixture was composed as follows: pUC18-FMD-Mfa-El-H6 (pMal2-l; 1.3 ng/μL), 1 μL; primer CL hin (100 μL), 2 μL; primer CL her neu (100 μL), 2 μL; dNTPs (all at 2.5 mM), 8 μL; H2O, 76 μL; Buffer 2 (10x concentrated) from the Long Expanding Template PCR System (Boeringer; N- Cat. 1681 834), 10 μL; Polymerase mixture from the Long Expanding Template PCR System (1

U/μI), 0.75 μA.

The PCR program was applied, consisting of the following steps:

1. Denaturation: 15 min at 95°C

2. 35 cycles of 30 seconds of denaturation at 95°C, 1 minute of annealing at 60°C, and 1 minute of elongation at 72°C.

3. finishing at 4°C.

The resulting PCR product was checked by agarose gel electrophoresis for its correct size (3.5 kb). After this, the 3'-A projections of the PCR product were removed by a reaction with T4 polymerase, resulting in blunt ends with OH groups at 3' and 5'. Then the PCR product was treated with T4 polymerase (Boehringer; 1 ϋ/μΐ): the remaining 95 μΐ of the PCR reaction mixture was treated with the remaining 95 μΐ of the PCR reaction mixture.

108 One μg of T4 polymerase and four μg of dNTPs (all at 2.5 mM) were added. The sample was incubated for 20 min at 37°C. Subsequently, the DNA was precipitated with ethanol and absorbed in 16 μg of H20.

Subsequently, 5'-phosphates were added to the blunt-ended PCR product via a kinase reaction. Then, to 16 μL of blunt-ended PCR product, 1 μL of T4 polynucleotide kinase (Boehringer; 1 u/μL), 2 μL of 10-fold concentrated T4 polynucleotide kinase reaction buffer (Boehringer), and 1 μL of ATP (10 mM) were added. The sample was incubated for 30 min at 37 °C. Subsequently, the DNA was applied to a 1% agarose gel and the correct product band was isolated using the gel extraction kit (Qiagen) according to the supplier's conditions. Fifty (50) ng of the purified product were then autoligated using T4 ligase (Boehringer) according to the supplier's conditions. After incubation for 72 ha at 16°C, the DNA in the ligation mixture was precipitated with ethanol and dissolved in 20 μL of water.

E. coli DH5a-F' cells were subsequently transformed with 10 μL of the ligation sample. Plasmid DNA from several resistant clones

<td colspan="2">ampicillin was checked by</td><td>quite</td><td colspan="2">digestion</td><td>with enzyme</td>

<td>Restriction. A clone.</td><td>positive</td><td>he was</td><td>retained and</td><td colspan="2">designated p27d-3</td>

<td> (PUC18-FMD-CL-E1-H6,</td><td>SEQ</td><td>ID</td><td>NO:20,</td><td></td><td>Figure 7).</td>

<td>Subsequently, the</td><td>painting</td><td>of</td><td>reading</td><td>of</td><td>CL-E1-H6 was</td>

verified by DNA sequencing.

109

In a final step, the pFPMT-CLE1-H6 shuttle vector was constructed as described below. The 0.486 kb EcoRI/BamHI fragment of p27d-3 (hosting CL-E1(192326)-H6) was ligated with pFPMT121 digested with EcoRI/BamHI (SEQ ID NO: 12, Figure 3). For the reaction, T4 ligase (Boehringer) was used according to the supplier's recommendations. The DNA in the ligation sample was precipitated with ethanol and dissolved in 10 μL of H2O. E. coli DH5ot F' cells were transformed with 10 μL of the ligation sample, and plasmid DNA from several ampicillin-resistant colonies was analyzed by digestion with BcoRI and BamHI. The p37-5 plasmid clone (pFPMT-CL-El-H6; SEQ ID NO:21, Figure 8) showed the desired fragment sizes of 0.486 kb and 6.961 kb. The correct CL-E1-H6 sequence of p37-5 was verified by sequencing.

EXAMPLE 3

CONSTRUCTION OF VECTORS IN SHUTTLE-SHUTTLE pFPMT-MFa-E2-H6

E pMPT-MFa-E2-H6

The plasmids for the transformation of Hansenula polymorpha were constructed as follows. The DNA sequence encoding MFa-E2s (amino acids 384-673 of E2 of

HCV)-VIEGR-His6 (SEQ ID NO:5) was isolated as a 1,331 kb fragment by EcoRI/BgrIII from the pSP72E2H6 plasmid (SEQ ID NO:22, Figure 9). This fragment was ligated with BcoRI/BgrIII-digested vectors pFPMT121 (SEQ ID NO:12, Figure C+2) or pMPT121 (SEQ ID NO:23, Figure 10) using T4 DNA ligase (Boehringer Mannheim) according to the supplier's recommendations. After transformation of E.

110

[

1 coli and checking the plasmid DNA isolated from different transformants by restriction enzyme digestion, the positive clones were retained and the resulting shuttle vectors are named pFPMT-MFa-E2-H6 (SEQ ID NO:22,

Figure 11) and pMPT-MFa-E2-H6 (SEQ ID NO:23, Figure 12), respectively.

EXAMPLE 4

CONSTRUCTION OF THE SHUTTLE-SHUTTLE VECTOR pFPMT-CL-E2-H6

The pFPMT-CL-E2-H6 shuttle vector was assembled in a three-step procedure. An intermediate construct was prepared in which the E2 coding sequence was cloned behind the Schwanniomyces accidentalis α-amylase signal sequence. This was done by the seamless cloning method (Padgett, KA and Sorge, JA 1996).

Generation of the DNA Fragment Encoding E2s-H6

First, the DNA sequence encoding E2-H6 (amino acids 384 to 673 of HCV E2 extended with the VIEGR linker peptide and with 6 His residues, SEQ ID NO: 5) was amplified from the pSP72E2H6 plasmid (SEQ

(ID NO:24, Figure 11) by PCR. The primers used were named MF30E2/F and MF30E2/R and have the following sequences:

- primer MF30E2/F:

5'-aqtcactcttca.aqqcatacccqcqtqtcaqqaqqg-3' (SEQ ID

NO:26); the Eamll04l site is underlined, the dot marks the enzyme cleavage site; the last codon of the S. occidentalis signal sequence is printed in bold; unmarked bases anneal with E2 codons (amino acids)

111

384-390 of E2 of HCV);

- primer MF30E2/R:

5'-agtcactcttca.caqggafcccttagtgatggtggtgatg-3' (SEQ ID NO:27); the BamllO4I site is underlined, the dot marks the enzyme cleavage site; the bases printed in bold are complementary to the bases printed in bold of the MF30-rechts primer (see below); a BamHI site to be introduced into the construct is printed in italics; the unmarked sequence rings with the stop codon and the six terminal His codons of E2 (384-673)-VIEGR-H6 (SEQ

ID NO:5) .

The reaction mixture was constituted as follows: total volume of 50 μL containing 20 ng of the fragment per BcoRI/BçrlII of 1.33 kb of pSP72E2H6, each 0.2 μM of primers MF30E2/F and MF30E2/R, dNTPs (each at 0.2 μM), 1 x buffer 2 (Long Expand Template PCR System; Boehringer; Ndo Cat. 1681 834), 2.5 U of polymerase mixture (Long Expand Template PCR System; Boehringer; Ndo Cat. 1681 834).

The PCR 3 program was used, consisting of the following steps:

1. Denaturation: 5 min at 95°C;

2. 10 cycles of 30 seconds of denaturation at 95°C, 30 seconds of annealing at 65°C, and 1 minute of stretching at 68°C.

3. finishing at 4°C.

Then 10 μL of 10 x buffer 2 (Expand Long Template PCR System; Boehringer; N2 of Cat. 1681 834), 40 μΐ of H2O, and 5 μL of [dATP, dGTP, and dTTP (2 mM each); 10

112 [mcg of 5-methyl-dCTP] were added to the sample derived from PCR program 3, and it was continued with PCR program 4 consisting of the following steps:

1. Denaturation: 5 min at 95°C

2. 5 cycles of 45 seconds of denaturation at 95°C, 30 seconds of annealing at 65°C, and 1 minute of stretching at 68°C.

3. finishing at 4°C.

Generation of the pMF30-derived receptor plasmid: The second fragment originated from the pMF30 plasmid (SEQ ID NO:28, Figure 13). The amplicon was almost the complete pMF30 plasmid, excluding the codons for mature S. occidentalis α-amylase. The modifications relevant to cloning were introduced by primer design. The following primer group was used:

Primer MF30 - Links:

5'-agtcactcttca.cctcttqtcaaaaataatcqqttgag-3' (SEQ ID NO:29; the £amllO4I site is underlined, the dot marks the enzyme cleavage site, ctt printed in bold is complementary to agg printed in bold of the MF30E2/F primer (see above): the unmarked and bold printed bases anneal to the 26 terminal bases of the S. occidentalis α-Amylase codons in pMF30);

- primer MF30-Rechts:

5'-agtcactcttca.ctgcaggcatgcaagcttggcg-31 (SEQ ID NO:11; the EamllO4I site is underlined, the dot marks the enzyme cleavage site, the bold printed ctg is complementary to the bold printed cag of the MF30E2/R primer (see above); the unmarked bases anneal to the

113 pUC18 sequences upstream of the S. occidentalis α-amylase stop codon in pMF30);

The reaction mixture was constituted as follows: total volume of 50 μL containing 20 ng of pMF30 linearized with BglII, each 0.2 μM of MF30-Links and MF30-Rechts primers, dNTPs (each at 0.2 μM), lx buffer 1 (Long Expand Template PCR System; Boehringer; N- Cat. 1681 834), 2.5 U of polymerase mixture (Long Expand Template PCR System; Boehringer; N- Cat. 1681 834). The same PCR programs (programs 3 and 4) as described above were used, except for the stretching times which were increased from 1 minute to 4 minutes in both programs.

Generation of the pAMY-E2 vector

The DNA fragment encoding E2s-H6 and the pMF30-derived receptor plasmid obtained by PCR were size-controlled by gel electrophoresis on a 1% agarose gel. The PCR products were purified using a PCR product purification kit (Qiagen) according to the supplier's instructions. Subsequently, the purified fragments were digested separately with Ea/nll004I. The ligation of the E2sH6 fragment to the pMF30-derived receptor plasmid was performed using T4 ligase (Boehringer) according to the supplier's recommendations. The ligation mixture was used to transform E. coli DH5aF' cells, and the plasmid DNA from several clones was analyzed by digestion with EcoRI/BamHI. One positive clone was selected, its plasmid additionally designated pAMY-E2, and

114 Used for additional modifications, as described below.

The pUC18-CL-E2-H6 pAMY-E2 vector generation was subjected to 5-PCR-guided mutagenesis in order to replace the codons of the α-amylase signal sequence with codons from the avian lysozyme presequence. This is additionally referred to as CL, corresponding to the first 18 amino acids of the avian lysozyme ORF (SEQ ID NO:1). For this mutagenesis, the following primers were used:

- primer CL2 hin:

5'-tgcttcctaccactagcagcactaggacatacccgcgtgtcaggaggggcag-3' (SEQ ID NO:30); and

- primer CL2 her:

5 ' -tagtacfcagtattagtaggcttcgcatggraa ttcactggccgtcgttttacaacgtc-3' (SEQ ID NO:31).

The underlined 5' regions of the primers contain the DNA sequence of approximately half of the avian lysozyme presequence. The CL2 her primer includes the Spel (italicized) and EcoRI (italicized, double underlined) restriction sites. The ununderlined regions of the primers anneal to the codons at amino acid residues 384 to 392 of E2 (CL2 hin) or to the initiation codon atg on the EcoRI site up to position -19 (counted from the EcoRI site) of the FMD promoter. The primers are designed to amplify the complete pAMY-E2 vector, thereby replacing the codons of the α-amylase signal sequence with the codons of the avian lysozyme presequence.

115

The PCR reaction was performed according to the following program:

1. denaturation: 15 min at 95°C

2. 35 cycles of 30 seconds of denaturation at 95°C, 1 minute of annealing at 60°C, and 1 minute of elongation at 72°C.

3. finishing at 4°C.

The following reaction mixture was used: pAMY-E2 (1 ng/μL), 1 μL; primer CL2 hin (100 μL), 2 μL; primer CL2 her (100 μL), 2 μL; dNTPs (2.5 mM each), 8 μL; H2O, 76 μ1;

Buffer 2 (10x concentrate) of the Long Expanding Template PCR System (Boeringer; N- Cat. 1681 834), 10 μL; Polymerase mixture of the Long Expanding Template PCR System (1 U/μL), 0.75 μL.

The resulting PCR product was checked by gel electrophoresis on a 1% agarose gel. Before ligation, the PCR fragment was modified as follows. The 3'-A projections were removed by T4 polymerase, resulting in blunt ends with OH groups at 3' and 5'. Then, 1 μL of T4 polymerase (Boehringer, 1 U/μL) was added to the remaining 95 μL of PCR reaction mixture along with 4 μL of dNTPs (2.5 mM each). The sample was incubated for 20 min at 37°C. Subsequently, the DNA was precipitated with ethanol and dissolved in 16 μL of deionized water. This was followed by a kinase treatment to add the 5'-phosphates to the blunt-ended PCR product. To the 16 μL of dissolved blunt-ended PCR product, 1 μL of T4 polynucleotide kinase (Boehringer, 1 ϋ/μL) and 2 μL of buffer were added.

116 The sample was incubated for 30 min at 37°C using a 10-fold concentrated T4 polynucleotide kinase reaction (Boehringer) and 1 μL of ATP (10 mM).

The sample treated with kinase was subsequently separated on a 1% agarose gel. The product band was isolated. DNA was extracted from the agarose slice using the Gel Extraction Kit (Qiagen) according to the supplier's recommendations. Fifty (50) ng of the purified product were then autoligated using T4 ligase (Boehringer) according to the supplier's conditions. After incubation for 16 h at 16°C, the DNA in the binding mixture was precipitated with ethanol and dissolved in 20 μL of H₂O.2The (linking sample).

E. coli DH5aF' cells were transformed with 10 μL of the ligation sample. Several ampicillin-resistant clones were further characterized via restriction analysis of isolated plasmid DNA. One positive clone was designated pUC18-CL-E2-H6 and was used for further modifications as described below.

Vector generation in shuttle mode pFPMT-CL-E2-H6

A 0.966 kb fragment was isolated by EcoRI/BamHI from pUC18-CL-E2-H6 (harboring CL-E2(384-673)-VIEGRH6) and ligated to pFPMT121 digested with EcoRI/BamHI (SEQ ID NO: 12, Figure 3). For the reaction, T4 ligase (Boehringer) was used according to the supplier's conditions. The ligation sample was precipitated with ethanol and dissolved in 10 μL of water. This was used to transform DH5aF' cells of E. coli, a positive clone.

117 It was retained after restriction analysis and the respective plasmid is named pFPMT-CL-E2-H6 (SEQ ID NO:32, Figure

14)

EXAMPLE 5

CONSTRUCTION OF THE SHUTTLE-SHUTTLE VECTOR pFPMT-CL-K-Ho-El

The construction of the shuttle vector was comprised of two stages.

In the first step, the pUC18-FMDCL-H6-K-E1-H6 construct was built by site-directed mutagenesis. The pUC18-FMD-CL-E1-H6 was used as a template (SEQ ID NO:20; Figure 7). The following primers were used:

Primer H6K hin neu:

51-catcacaaatatgaggtgcgcaacgtgtccgggatgtac-3' (SEQ ID

NO:37) .

Primer H6KRK her neu:

5'-gtgatggtggtgtcctagtgctgctagtggtaggaagcatag-3' (SEQ ID

NO:38).

(Bases that provide additional codons are underlined.)

The PCR reaction mixture was composed as follows: pUC18-FMD-CL-El-H6 (2 ng/μL), 1 μL; primer H6K hin neu (100 μL), 2 μL; primer H6KRK her neu (100 μL), 2 μL;

dNTP's (2.5 mM each), 8 μΐ; H20.76 μL; Buffer 2 (10x concentrate) Long Expanding Template PCR System (Boeringer; N- Cat. 1681 834), 10 μL; Long Expanding Template PCR System polymerase mix (1 U/μL), 0.75 μL.

The PCR program used consisted of the following

118 steps:

1. Denaturation stage: 15 min at 95°C

2. 35 cycles of 30 seconds of denaturation at 95°C, 1 minute of annealing at 60°C, and 5 minutes of elongation at 72°C.

3. finishing at 4°C.

An aliquot of the PCR sample was analyzed on a 1% agarose gel to check its size, which was correct (-4.2 kb).

After this, the 3'-A projections of the PCR product were removed by a reaction with T4 polymerase, resulting in blunt ends with OH groups at 3' and 5'. Then, to the remaining 95 μL of the PCR reaction, 1 μL of T4 polymerase (Boehringer; 1 U/μL) and 4 μL of dNTPs (2.5 mM each) were added. The sample was incubated for 20 min at 37°C. Subsequently, the DNA in the sample was precipitated with ethanol and dissolved in 16 μL of H2THE.

Subsequently, 5'-phosphates were added to the blunt-ended PCR product via a kinase reaction. Then, to 16 μL of dissolved blunt-ended PCR product, 1 μL of T4 polynucleotide kinase (Boehringer; 1 U/μL), 2 μL of 10-fold concentrated T4 polynucleotide kinase reaction buffer (Boehringer), and 1 μL of ATP (10 mM) were added. The sample was incubated for 30 min at 37°C.

Subsequently, the sample was applied to a 1% agarose gel and the correct product band was isolated using the gel extraction kit (Qiagen) according to the supplier's conditions. Fifty (50) ng of

119 The purified product was then autoligated using T4 ligase (Boehringer) according to the supplier's recommendations. After incubation for 72 h at 16°C, the DNA in the ligation sample was precipitated with ethanol and dissolved in 10 μL of water.

E. coli DH5ocF' cells were transformed with 5 μL of the ligation sample. Plasmid DNA from several ampicillin-resistant colonies was analyzed by restriction enzyme digestion, one positive clone was retained, and the corresponding plasmid was named: pUC18-FMDCL-H6-E1-K-H6 (SEQ ID NO:39, Figure 17).

In a second step, the transfer vector was constructed by linking two fragments. In the subsequent construction, fragments with cohesive Bell ends were involved. Since Bell can cleave its site only on unmethylated DNA, an E. coli dam~ strain was transformed with the involved plasmids pUC18-FMD-CL-H6-K-El-H6 (SEQ ID NO:39, Figure 17) and pFPMT-CL-El (SEQ ID NO:36, Figure 16). From each transformation, an ampicillin-resistant colony was collected, grown in liquid culture, and the unmethylated plasmid DNAs were prepared for further use. The 1.273 kb Bell/Hindll fragment of the unmethylated plasmid pUCl8-FMD-CL-H6-K-El-H6 (containing the FMD promoter, the CL-H6-K codons, and the El start) and the 6.057 kb Bell/Hindll fragment of the plasmid pFPMT-CL-El (containing the missing part of the El reading frame starting from the Bell site, without the

120 The His C-terminal marker, as well as the elements located in pFPMT121, except for the FMD promoter, were prepared and ligated together for 72 h at 16°C using T4 ligase (Boehringer) in a total volume of 20 μL, according to the supplier's specifications. Subsequently, the binding mixture was placed on a piece of nitrocellulose membrane floating on sterile deionized water in order to desalinate the binding mixture (incubation for 30 min at room temperature). TOP10 E. coli cells were transformed by electroporation with 5 μL of the desalinate sample. Plasmid DNA from the various resulting ampicillin-resistant colonies was analyzed by restriction enzyme digestion. One positive clone was retained and named pFPMT-CL-H6-K-El (SEQ ID NO:40, Figure 18).

EXAMPLE 6

Transformation of Hansenula Polymorpha and Selection of Transformants

The H. polymorpha RB11 strain was transformed (PEG-mediated DNA uptake protocol essentially as described by (Klebe, RJ et al. 1983) with the modification of (Roggenkamp, R. et al. 1986) with different parental shuttle vectors as described in Examples 1 to 5. For each transformation, 72 prototrophic uracil colonies were selected and used for strain generation by the following procedure. For each colony, a 2 ml liquid culture was inoculated and grown in test tubes for 48 h (37°C; 160 rpm; 45° angle) in medium.

121 selective (YNB/glucose, Difco) first passage stage.

This step is defined as follows: A 0.150 μL aliquot of the cultures from the first passage step was used to inoculate 2 ml of fresh YNB/glucose medium. Again, the cultures were incubated as described above (second passage step). In total, eight such passage steps were performed. Aliquots of the cultures after the third and eighth passage steps were used to inoculate 2 ml of non-selective YPD medium (Difco). After 48 h of incubation at 37°C (160 rpm; 45° angle; the so-called first stabilization stage), 150 μL aliquots of these YPD cultures were used to inoculate new 2 ml YPD cultures, which were incubated as described above (second stabilization stage). Aliquots of the cultures from the second stabilization stage were then streaked onto plates containing YNB/selective agar. These plates were incubated for four days until macroscopic colonies became visible. A single well-defined colony from each separation was designated as the strain and used for further expression analysis.

The expression analysis was performed on small-scale flask cultures. A colony was collected from the YNB/agar plate mentioned above and inoculated into 2 ml of YPD and incubated for 48 h, as described above. This 2 ml aliquot was used as a seed culture for 20 ml of culture in a shaker flask. YPGlycerol (1%) was used as the medium, and the shaker flask was incubated on a rotary shaker (200 rpm, 37°C). After 48 h of

122 In the development phase, 1% MeOH was added to the culture to induce the expression cassette. At different time intervals, 1 ml aliquot cell pellets were collected and stored at -20°C until further analysis. Specific protein expression was analyzed by SDS-PAGE/Western transfer. Then, the cell pellets were solubilized in sample buffer (TrisHCl-SDS) and incubated for > 15 minutes at 95°C. Proteins were separated on a 15% polyacrylamide gel and stained (wet stain; bicarbonate buffer) on nitrocellulose membranes. The stains were revealed using a specific murine anti-El (IGH 201) or murine anti-E2 (IGH 216, described by Maertens et al. in WO96/04385) as the first antibody, and rabbit anti-AP was used as the second antibody. Staining was performed with NBTBCIP. Positive strains were retained for further investigation.

Five of these positive clones were used in a shake flask expression experiment. One colony of the respective strain was collected from the YNB plate and used to inoculate 2 ml of YPD. These cultures were incubated as described above. This cell suspension was used to inoculate a second seed culture of 100 ml of YPD medium in a 500 ml shake flask. This shake flask was incubated on a rotary shaker for 48 h at 37°C and 200 rpm. A 25 ml aliquot of this seed culture was used to inoculate 250 ml of YPGlicerol medium (1%) and was incubated in a 2 L shaker flask.

123 Under the conditions described above, 48 h after inoculation, 1% MeOH (promoter induction) was added and the shake flasks were further incubated under the conditions described above. 24 h after induction, the experiment was stopped and the cell pellets collected by centrifugation. The expression level of the five different clones was analyzed by SDS-PAGE/Western transfer (conditions as described above). A series of titrations from each clone was loaded onto the gel, and the most productive strain was selected for further fermentation and purification assays.

Surprisingly, H. polymorpha, a yeast strain closely related to Pichia pastoris (Gellissen, G. 2000), is able to express HCV proteins essentially without hyperglycosylation and thus with sugar moieties comparable in size to the HCV envelope proteins expressed by mammalian cells infected with recombinant vaccinia HCV-virus.

The Hansenula polymorpha RB11 strain was deposited on April 19, 2002, under the conditions of the Budapest Treaty, at the Mycothèque of l'UCL (MUCL), Université Catholique of Louvain, Laboratoire of mycologie, Place Croix du Sud 3 bte 6, B-1348 Louvain-la-Neuve, Belgium, and has the MUCL accession number MUCL43805.

EXAMPLE 7

CONSTRUCTION OF THE VECTOR pSYlaMFElsH6a

The S. cerevisiae expression plasmid was constructed as follows. A coding sequence of

124

El was isolated as a fragment by NsII/Eco52I from pGEMT-ElsH6 (SEQ ID NO:6, Figure 1), which was thickened at the end (using T4 DNA polymerase) and cloned into the pYIG5 vector (SEQ ID NO:41, Figure 19) using T4 DNA ligase (Boehringer) according to the supplier's specifications. The cloning was such that the coding fragment of Els-H6 was directly and frame-by-frame joined to the aMF coding sequence. The ligation mixture was transformed into DH5ocF' E. coli cells. Subsequently, plasmid DNA from several ampicillin-resistant clones was analyzed by restriction digestion, and one positive clone was retained and named pYIG5ElH6 (ICCG3470; SEQ ID NO:42, Figure 20).

The expression cassette (containing the aMF sequence and the Eis coding region with a His tag) was transferred, as a BamHI fragment (2790 bp) of pYIG5ElH6, to the BamHI-digested E. coli/S. cerevisiae pSYl shuttle vector (SEQ ID NO:21, Figure 43). Ligation was performed with T4 DNA ligase (Boehringer) according to the supplier's conditions. The ligated mixture was transformed into E. coli DH5aF' cells. coli, and plasmid DNA from several ampicillin-resistant colonies was

<td>analyzed</td><td>put</td><td>Restriction enzyme digestion.</td><td>A clone</td>

<td>positive</td><td>he was</td><td>retained and named pSYlAMFElsH6a</td><td>(ICCG3479;</td>

<td>SEQ ID NO</td><td> :44,</td><td>Figure 22).</td><td></td>

<td></td><td></td><td>EXAMPLE 8</td><td></td>

<td></td><td></td><td>CONSTRUCTION OF THE VECTOR pSYYIGSE2H6</td><td></td>

<td></td><td> 0</td><td>S. expression plasmid.</td><td>cerevisiae</td>

125 pSYYIGSE2H6 was constructed as follows. An E2 coding sequence was isolated as a fragment by Sall/Kpnl from pBSK-E2sH6 (SEQ ID NO:45, Figure 23), which was thickened at the end (using T4 DNA polymerase) and subsequently cloned into the pYIG5 vector (SEQ ID NO:41, Figure 19) using T4 DNA ligase (Boehringer) according to the vendor's specifications. The cloning was such that the E2-H6 coding fragment was directly and frame-by-frame joined to the aMF coding sequence. The linking mixture was then transformed into E. coli DH5aF' cells, plasmid DNA from several ampicillin-resistant clones was analyzed by restriction digestion, and one positive clone was retained and designated pYIG5HCCL-22aH6 (ICCG2424; SEQ IDNO:46, Figure 24).

The expression cassette (containing the aMF sequence and the E2 coding region (384-673) with a His tag) was transferred, as a BamHI fragment (3281 bp) of pYIG5HCCL-22aH6, to the BamHI-opened E. coli/S. cerevisiae pSYl shuttle vector (SEQ ID NO:43, Figure 21). Ligation was performed with T4 DNA ligase (Boehringer) according to the supplier's conditions. The ligated mixture was transformed into E. coli DH5aF' cells. E. coli and plasmid DNA from several ampicillin-resistant colonies were analyzed by restriction enzyme digestion. One restriction-positive clone was retained and named pSYYIGSE2H6 (ICCG2466; SEQ ID NO:47, Figure 25).

126

EXAMPLE 9

CONSTRUCTION OF THE VECTOR pSY!YIG7Els

The S. cerevisiae pSYlYIG7Els expression plasmid was constructed as follows. An El coding sequence was isolated as a fragment by NsII/Eco52I from pGEMT-Els (SEQ ID NO:6, Figure 1), which was thickened at the end and cloned into the pYIG7 vector (SEQ ID NO:48, Figure 26) using T4 DNA ligase (Boehringer) according to the vendor's specifications. The cloning was such that the El coding fragment was directly and frame-by-frame joined to the aMF coding sequence. The linking mixture was transformed into E. coli DH5aF' cells, plasmid DNA from several ampicillin-resistant clones was analyzed by restriction digestion, and one positive clone was retained and designated as PYIG7E1 (SEQ ID NO:49, Figure 27).

The expression cassette (containing the CL leader sequence and the El coding region (192-326)) was transferred, as a BamHI fragment (2790 bp) of pYIG7El, to the BamHI-digested E. coli/S. cerevisiae pSYl shuttle vector (SEQ ID NO:43, Figure 21). Ligation was performed with T4 DNA ligase (Boehringer) according to the supplier's conditions. The ligated mixture was transformed in E. coli DH5aF' cells. coli, and plasmid DNA from several ampicillin-resistant colonies was analyzed by restriction enzyme digestion. One positive clone was retained and named pSYlYIG7Els (SEQ ID NO:50, Figure 28).

127

EXAMPLE 10

TRANSFORMATION OF SACCHAROMYCES CEREVISIAE AND

TRANSFORMER SELECTION

In order to overcome the hyperglycosylation problems frequently described for overexpressed proteins in Saccharomyces cerevisiae, a mutant examination was constructed. This examination was based on the method of

Bailou (Bailou, L. et al. 1991), with which spontaneous recessive orthovanadate-resistant mutants were selected. The initial strain selection was based on the invertase glycosylation pattern, as observed after native gel electrophoresis. One strain, with reduced glycosylation capabilities, was retained for further recombinant protein expression experiments and named strain IYCC155. The nature of the mutation was not further studied.

The aforementioned glycosylation-deficient strain IYCC155 was transformed with plasmids as described in Examples 7 to 9, essentially by the lithium acetate method, as described by Elble (Elble, R. 1992). Several supplemented Ura strains were collected from a YNB + 2% selective agar (Difco) plate and used to inoculate 2 ml of

YNB + 2% glucose. These cultures were incubated for 72 h at 37°C, 200 rpm, on an orbital shaker, and the culture supernatant and intracellular fractions were analyzed for El expression by western blotting revealed with a murine monoclonal antibody specific for El (IGH 201). A high-throughput clone was

128 Held for further experimentation.

Protein expression in the glycosylation-deficient S. cerivisiae mutant used here is hampered by the suboptimal growth characteristics of such strains, resulting in lower biomass yield and thus lower yield of the desired proteins compared to wild-type S. cerivisiae strains. The yield of the desired proteins was still substantially higher than in mammalian cells.

EXAMPLE 11

CONSTRUCTION OF VECTORS pPICZalfaD'ElsH6 AND pPICZalfaE'ElsH6

The shuttle vector pPICZalfaE'ElsH6 was constructed starting from the pPICZalfaA vector (Invitrogen; SEQ ID NO:51, Figure 29). In a first step, said vector was adapted in order to enable cloning of the El coding sequence directly behind the cleavage site of the processing proteases KEX2 or STE13, respectively. Then, pPICZalfaA was digested with Xhol and Notl. The digestion was separated on a 1% agarose gel and the 3519 kb fragment (the larger part of the vector) was isolated and purified using a gel extraction kit (Qiagen). This fragment was then ligated using T4 polymerase (Boehringer) according to the supplier's conditions, in the presence of specific oligonucleotides, producing either pPICZalfaD' (SEQ ID NO: 52, Figure 30) or pPICZalfaE' (SEQ ID NO: 53, Figure 31).

The following oligonucleotides were used:

- for the construction of pPICZalfaD':

129

8822: 5'-TCGAGAAAAGGGGCCCGAATTCGCATGC-3' (SEQ ID NO:54); and

8823: 5'-GGCCGCATGCGAATTCGGGCCCCTTTTC-3' (SEQ ID NO:55) which, after annealing, produce the linker oligonucleotide: TCGAGAAAAAGGGGCCCGAATTCGCATGC (SEQ ID NO:54)

CTTTTCCCCGGGCTTAAGCGTACGCCGG (SEQ ID NO:55)

- for the construction of pPICZalfaE'

8649: 5'-TCGAGAAAAGAGAGGCTGAAGCCTGCAGCATATGC-3' (SEQ ID NO:

56)

8650: 5'-GGCCGCATATGCTGCAGGCTTCAGCCTCTCTTTTC-3' (SEQ ID NO:

57) which produce, after annealing, the linker oligonucleotide: TCGAGAAAAAGAGAGGCTGAAGCCTGCAGCATATGC (SEQ ID NO:56)

CTTTTCTCTCCGACTTCGGACGTCGTATACGCCGG (SEQ ID NO:57)

These shuttle vectors pPICZalfaD' and pPICZalfaE' recently introduced cloning sites directly behind the cleavage site of the respective processing proteases, KEX2 and STE13. The E1-H6 coding sequence was isolated as a fragment by NsII/Eco52I from pGEMT-ElsH6 (SEQ ID NO:6, Figure 1). The fragment was purified using a gel extraction kit (Qiagen) after separation of the digestion on a 1% agarose gel. The resulting fragment was thickened at the end (using T4 DNA polymerase) and ligated into pPICZalfaD' or pPICZalfaE' directly behind the respective processing protease cleavage site.

The linking mixtures were transformed into TOPIOF' cells of E. coli and the plasmid DNA from several zeocin-resistant colonies was analyzed by digestion with

130 Restriction enzyme. Positive clones were retained and named pPICZalfaD'ElsH6 (ICCG3694; SEQ ID NO:58, Figure 32) and pPICZalfaE'ElsH6 (ICCG3475; SEQ ID NO:59, Figure 33), respectively.

EXAMPLE 12

CONSTRUCTION OF THE VECTORS pPICZalfaD'E2sH6 AND pPICZalfaE'E2sH6

The shuttle vectors pPICZalfaD' and pPICZalfaE' were constructed as described in Example 11.

The E2-H6 coding sequence was isolated as a fragment by Sall/Kpnl from pGEMT-E2sH6 (SEQ ID NO:45, Figure 23). The fragment was purified with a gel extraction kit (Qiagen) after separation of the digestion on a 1% agarose gel. The resulting fragment was thickened at the end (using T4 DNA polymerase) and ligated into pPICZalfaD' or pPICZalfaE' directly behind the respective processing protease cleavage site.

The linking mixture was transformed into TOPIOF' cells of E. coli, and plasmid DNA from several zeocin-resistant colonies was analyzed by restriction enzyme digestion. Positive clones were retained and named pPICZalfaD'E2sH6 (ICCG3692; SEQ ID NO:60, Figure 34) and pPICZalfaE'E2sH6 (ICCG3476; SEQ ID NO:61, Figure 35), respectively.

EXAMPLE 13

Transformation of Pichia pastoris and selection of transformants

<td></td><td>Plasmids</td><td>in</td><td>back and forth</td><td>of P.</td><td colspan="2">pastoral, such</td>

<td>described</td><td>in the Examples</td><td> 11</td><td>and 12,</td><td>they were</td><td>transformed</td><td>in</td>

<td>cells</td><td>of P. pastoris</td><td>of</td><td>agreement</td><td>with</td><td>the conditions</td><td>of</td>

131 supplier (Invitrogen). One El-producing strain and one E2-producing strain were retained for further characterization.

HCV envelope proteins were expressed in P. pastoris, a yeast strain well known for the fact that hyperglycosylation is normally absent (Gellissen, G. 2000) and previously used to express the dengue virus E protein as a GST fusion (Sugrue, RJ et al. 1997). Notably, the resulting HCV envelope proteins expressed in P. pastoris showed comparable glycosylation as observed in wild-type Saccharomyces strains. More specifically, the HCV envelope proteins produced by P. pastoris are hyperglycosylated (based on the molecular weight of expression products detected in western blots of proteins isolated from transformed P. pastoris cells).

EXAMPLE 14

Culture conditions for Saccharomyces cerevisiae.

HANSENULA POLYMORPHA AND PICHIA PASTORIS

Saccharomyces cerevisiae

Cell bank

From the selected recombinant clone, a master cell bank and a working cell bank were prepared. Small cryoflasks were prepared from a semi-exponentially developed shake flask culture (incubation conditions as for fermentation seed cultures, see below). Glycerol was added (50% final concentration).

132 as a cryoprotectant.

Fermentation

Seed cultures were started from a small flask of cryopreserved working cell bank and grown in 500 ml of medium (YNB supplemented with 2% sucrose, Difco) in a 2 L Erlenmeyer shaker flask at 37°C, 200 rpm, for 48 h.

Fermentations were typically carried out in Biostat C fermenters with a working volume of 15 L (B.Braun Int., Melsungen, Germany). The fermentation medium contained 1% yeast extract, 2% peptone, and 2% sucrose as the carbon source. Polyethylene glycol was used as an antifoaming agent.

Temperature, pH, and dissolved oxygen were typically controlled during fermentation; applicable set points are summarized in Table 1. Dissolved oxygen was controlled in the cascade by agitation/aeration. pH was controlled by adding NaOH (0.5 M) or H3PO4 solution (8.5%).

TABLE 1. Typical parameter adjustments for S. cerevisiae fermentations

<td>Parameter</td><td>Setpoint</td>

<td>Temperature</td><td>33-37 °C</td>

<td>DO (growth phase)</td><td>10-40% air saturation</td>

<td>DO (induction)</td><td> 0-5%</td>

<td>Aeration</td><td>0.5-1.8 vvm*</td>

<td>Agitation</td><td>150-900 rpm</td>

133 * volume replacement per minute

Fermentation was initiated by adding 10% seed culture. During the growth phase, sucrose concentration was monitored off-row.

<td>5 through analysis</td><td>put</td><td>HPLC (</td><td>Polysphere Column</td><td>OAKC</td><td>Merck).</td>

<td>During</td><td>the</td><td>phase</td><td>growth,</td><td>the</td><td>oxygen</td>

<td>dissolved was</td><td colspan="2">controlled</td><td>by control</td><td>in</td><td>cascade</td>

<td>(agitation/aeration)</td><td></td><td>After</td><td>metabolization</td><td colspan="2">complete</td>

In the sucrose induction phase, heterologous protein production was driven by endogenously produced ethanol, supplemented with the stepwise addition of EtOH to maintain the concentration at approximately 0.5% (analysis by offline HPLC, OAKC polyester column). During this induction phase, dissolved oxygen was controlled below 5% air saturation by manually adjusting the air flow rate and stirrer speed.

Typically, fermentation was collected 48 to 72 h after induction by concentration via tangential flow filtration followed by centrifugation of the concentrated cell suspension to obtain cell pellets. If not analyzed immediately, the cell pellets were stored at -70°C.

Hansenula polymorpha

Cell bank

From the selected recombinant clone, a master cell bank and a working cell bank were prepared. The small cryoflasks were

134 Prepared from a semi-exponentially developed shake flask culture (incubation conditions as for fermentation seed cultures, see below). Glycerol was added (50% final concentration) as a cryoprotectant.

Fermentation

Seed cultures were started from a small flask of cryopreserved working cell bank (-70°C) and grown in 500 ml of medium (YNB, Difco) in a 2 L Erlenmeyer shaker flask at 37°C, 200 rpm, for 48 h.

Fermentations were typically carried out in Biostat C fermenters with a working volume of 15 L (B.Braun Int., Melsungen, Germany). The fermentation medium contained 1% yeast extract, 2% peptone, and 1% glycerol as the carbon source. Polyethylene glycol was used as an antifoaming agent.

Temperature, pH, and air and dissolved oxygen were typically controlled during fermentation; applicable set points are summarized in Table 2. Dissolved oxygen was controlled by stirring. pH was controlled by adding NaOH (0.5 M) or H3PO4 solution (8.5%).

TABLE 2. Typical parameter adjustments for H polymorpha fermentations

<td>Parameter</td><td>Setpoint</td>

<td>Temperature</td><td>30-40 °C</td>

135

<td>DO</td><td>10-40% air saturation</td>

<td>Aeration</td><td>0.5-1.8 vvm*</td>

<td>Agitation</td><td>150-900 rpm</td>

* volume replacement per minute

Fermentation was initiated by adding 10% seed culture. During the growth phase, glycerol concentration was monitored offline (Merck Polysphere OAKC column) and, 24 h after complete glycerol consumption, 1% methanol was added to induce heterologous protein expression. Fermentation was collected 24 h post-induction by concentration via tangential flow filtration, followed by centrifugation of the concentrated cell suspension to obtain cell pellets. If not analyzed immediately, the cell pellets were stored at -70°C.

Pichia pastoris

Small-scale protein production experiments with recombinant Pichia pastoris were established in shake flask cultures. Seed cultures were grown overnight in YPD medium (Difco). The initial pH of the medium was adjusted to 4.5. The shake flasks were incubated on a rotary shaker at 200-250 rpm, 37°C.

Small-scale production was typically carried out on a 500 ml scale in 2 L shaker flasks and was initiated with a 10% inoculation in expression medium containing 1% yeast extract, 2% peptone (both from...).

136

Difco), and 2% glycerol as the carbon source. Incubation conditions were the same as for seed culture. Induction was initiated by adding 1% MeOH approximately 72 h after inoculation. Cells were collected 24 h after induction by centrifugation. If not analyzed immediately, cell pellets were stored at -70°C.

EXAMPLE 15

REMOVAL OF THE LEADER PEPTIDE FROM MFg-El-H6 AND MFa-E2-H6 PROTEINS EXPRESSED IN SELECTED YEAST CELLS

The expression products in Hansenula polymorpha and a negative glycosylation strain of Saccharomyces cerevisiae of the HCV El and E2 protein constructs with the S. cerevisiae crossing factor α (aMF) leader sequence were further analyzed. Since both HCV Eis (aa 192-326) and HCV E2s (aa 383-673 extended by the VIEGR sequence (SEQ ID NO:69)) of genotype lb were expressed as C-terminal his-tagged proteins (H6, HHHHHH, SEQ ID NO:63; The aforementioned HCV proteins are additionally designated in this Example as aMF-ElH6 and aMF-E2-H6). A rapid and efficient purification of the expressed products was carried out after solubilization with guanidinium chloride (GuHCl) of yeast cells on Ni-IDA (Ni-iminodiacetic acid). In summary, the cell pellets were resuspended in 50 mM phosphate, 6M GuHCl, pH 7.4 (9 vol/g of cells). The proteins were sulfonated overnight at room temperature (RT) in the presence of 320 mM (4% w/v) sodium sulfite and 65 mM (2%)

137 (w/v) of sodium tetrathionate. The lysate was purified, after a freeze-thaw cycle, by centrifugation (10,000 g, 30 min, 4°C) and Empigen (Albright & Wilson, UK) and imidazole were added to the supernatant to final concentrations of 1% (w/v) and 20 mM, respectively. The sample was filtered (0.22 μM) and loaded onto a Sepharose FF Ni-IDA column, which was equilibrated with 50 mM phosphate, 6M GuHCl, 1% Empigen (buffer A) supplemented with 20 mM imidazole. The column was sequentially washed with buffer A containing 20 mM and 50 mM imidazole, respectively, until the absorbance at 280 nm reached the baseline level. The his-labeled products were eluted by applying buffer D, 50 mM phosphate, 6M GuHCl, 0.2% (for El) or 1% (for E2) Empigen, 200 mM imidazole. The eluted materials were analyzed by SDS-PAGE and western blotting using specific monoclonal antibodies directed against El (IGH201) or E2 (IGH212).

The El products were immediately analyzed using Edman degradation.

Since at this stage SDS-PAGE already revealed a very complex pattern of protein bands for HCV E2, further fractionation was performed using size exclusion chromatography. The Ni-IDA eluate was concentrated by ultrafiltration (MWCO 10 kDa, Centriplus, Amicron, Millipore) and loaded onto Superdex G200 (10/30 or 16/60; Pharmacia) in PBS, 1% Empigen or PBS, 3% Empigen. The elution fractions, containing the E2 products,

138 Samples with an Mr between ~80 kDa and ~45 kDa, i.e., fractions 17-23 of the elution profile in Figure 37 based on migration over SDS-PAGE (Figure 38), were pooled and alkylated (incubation with 10 mM DTT, 3 h, at room temperature, followed by incubation with 5 mM iodoacetamide for 3 hours, at room temperature). Samples for amino-terminal sequencing were treated with Endo H (Roche Biochemicals) or left untreated. Glycosylated and deglycosylated E2 products were stained on PVDF membranes for amino-terminal sequencing. A 10-color amide black stain of glycosylated and deglycosylated E2 is shown in Figure 39.

Sequencing of both purified El and E2 products resulted in the disappointing observation that removal of the signal sequence from the 15 HCV envelope proteins is occurring only partially (see Table 3). Furthermore, most of the side products (degradation products and products still containing the leader sequence or part of it) are glycosylated. This glycosylation is present, even in part, in the non-cleaved fragment of the 20 signal sequence, which also contains an N-site. These sites can be mutated in order to produce fewer glycosylated side products.

However, even more problematic is the finding that some alternatively cleaved products have only 1 to 4 amino acid differences compared to the desired intact protein. Consequently, the correct product is glycosylated.

resulting in a virtually impossible purification process due to a lack of features.

139 biochemical processes are sufficiently discriminating between the different expression products. Several of the degradation products may be a result of a cleavage similar to Kex-2 (e.g., the cleavage observed after the 196 amino acid of El, which is a cleavage after an arginine), which is also required for the cleavage of the leader of crossing factor α and which may, therefore, not be blocked without disrupting this essential process.

A high-producing clone of El, derived from the transformation of S. cerevisiae IYCC155 with pSYlYIG7Els (SEQ ID NO:50; Figure 28), was compared with a high-producing clone derived from the transformation of S. cerevisiae IYCC155 with pSYlaMFElsHôaYIGlEls (SEQ ID NO:44, Figure 22). Intracellular expression of the El protein was evaluated 2 to 7 days after induction, and this was assessed by Western blotting using the El-specific monoclonal antibody (IGH 201). As can be seen from Figure 40, maximum expression was observed after 2 days for both strains, however the expression patterns for both strains are completely different. Expression with the crossover factor leader α results in a very complex banding pattern, which is a consequence of the fact that leader processing is not efficient. This results in several expression products with different amino termini, some of which are modified by 1 to 5 N-glycosylations. However, for El expressed with the CL leader, a limited number of distinct bands are visible, reflecting the high level of correct removal of the CL leader.

140 and the fact that only this correctly processed material can be modified by N-glycosylation (1 to 5 chains), as observed for the Hansenula-derived El expressed with the same CL leader (see Example 16).

The hybridoma cell line producing the monoclonal antibody directed against El (IGH201) was deposited on March 12, 1998, under the conditions of the Budapest Treaty, in the European Collection of Cell Cultures, Centre for Microbiology and Applied Research, Salisbury, Wiltshire SP4 0JG, UK, and has the accession number ECACC 98031216. The monoclonal antibody directed against E2 (IGH212) was described as antibody 12D11F2 in Example 7.4 by Maertens et al., in WO96/04385.

TABLE 3. Identification of the N-terminal ends of the aMF-El-H6 and O.MF-E2-H6 proteins expressed in S. cerevisiae or H. polymorpha. Based on N-terminal sequencing, the number of N-terminal ends of the mature E1-H6 and E2-H6 proteins could be estimated (mature indicating correct removal of the aMF signal sequence). The total amount of protein products was calculated as pmol of protein based on the intensity of the peaks recovered by Edman degradation. Subsequently, for each specific protein (i.e., for each 'detected N end'), the molar percentage versus the total was estimated.

141

<td>Yeast</td><td>aMF-El-H6</td><td>aMF-E2-VIEGR-H6</td>

<td>S. cerevisiae</td><td>Experiment 1: 16% of proteins still containing aMF sequences - 18% of proteins cleaved between the years 195 and 196 of El 66% of proteins with aMF correctly removed Experiment 2 18% of proteins still containing aMF sequences - 33% of proteins cleaved between the years 195 and 196 of El 8% of other proteins other products of El's dive - 44% of proteins with aMF correctly removed</td><td></td>

<td>H. polymorpha</td><td>64% of proteins still</td><td>75% of proteins</td>

<td></td><td>containing aMF sequences</td><td>still containing</td>

<td></td><td>6% of the proteins were cleaved.</td><td>aMF sequences</td>

<td></td><td>between the years 192 and 193 of</td><td>- 25% of proteins with</td>

<td></td><td>El</td><td>aMF correctly</td>

<td></td><td>- 30% of proteins with aMF correctly removed</td><td>removed</td>

142

EXAMPLE 16

EXPRESSION OF A CONSTRUCTION OF El IN SUITABLE LEAVE-IN FOR

LARGE-SCALE PRODUCTION AND PURIFICATION

Several other leader sequences have been used to replace the aMF leader peptide from S. cerevisiae, including CHH (hyperglycemic hormone leader sequence from Carcinum maenas), Amyl (amylase leader sequence from S. occidentalis), and Gaml (glucoamylase leader sequence from S. occidentalis), Phy5 (fungal phytase leader sequence), phol (leader sequence from Pichia pastoris acid phosphatase), and CL (avian lysozyme C leader, 1,4-beta-N-acetylmuramis C), and linked to E1-H6 (i.e., El with C-terminal histological marker). All constructs were expressed in Hansenula polymorpha, and each of the resulting cell lysates was subjected to western blot analysis. This has already allowed us to conclude that the degree of removal of the leader or signal sequence or peptide was extremely low, except for the construct in which CL is used as the leader peptide. This was confirmed for the CHH-E1-H6 construct by Edman degradation of Ni-IDA purified material: no correctly cleaved product could be detected, although several different sequences were recovered (see Table 4).

Table 4. Identification of the N-terminal ends of CHH-E1-H6 proteins expressed in H. polymorpha, based on N-terminal amino acid sequencing of different protein bands after separation by SDS-PAGE and spot formation on a PVDF membrane.

143

<td>Molecular Size</td><td>N ends identified</td>

<td>45 kD</td><td>It starts at amino acid 27 of the CHH leader. only the cleaved presequence, the pro- sequence still connected</td>

<td>26 kD</td><td>- it begins partially in amino acid 1 of CHH leader = no removal of pre-pro-'' sequence - it begins partially at amino acid 9 of CHH leader = product of translation alternative starting at the second codon of AUG</td>

<td>24 kD</td><td>- it begins partially in amino acid 1 of CHH leader - no removal of pre-pro- sequence - it begins partially at amino acid 9 of CHH leader = product of translation alternative starting at the second codon of AUG</td>

As previously mentioned, western blots of cell lysates revealed a pattern of protein bands specific to El, indicative of a higher degree of correct removal of the CL leader peptide. This is surprising, given that this leader is not derived from yeast. 0 Amino acid sequencing by Edman degradation of the material solubilized in GuHCl and purified by NiIDA confirmed that 84% of the El proteins are correctly cleaved and the material is essentially free.

144 of degradation products. A further 16% of unprocessed material is still present; however, since this material is non-glycosylated, it can be easily removed from the mixture, allowing specific enrichment of correctly cleaved and glycosylated El. One such method for enrichment could be affinity chromatography on lectins; other alternatives are also given in Example 19. Alternatively, the greater hydrophobic character of the non-glycosylated material can be used to select and optimize other enrichment procedures. The correct removal of the CL leader peptide from the CL-E1-H6 protein was further confirmed by mass spectrometry, which also confirmed that up to 4 of the 5 N-glycosylation sites of the lb genotype Eis can be occupied, with the NNSS sequence (amino acids 233 to 236; SEQ ID NO:73) being considered to be a unique N-glycosylation site.

EXAMPLE 17

Purification and biochemical characterization of the E2 protein of

HCV expressed in Hansenula polymorpha from

CONSTRUCTION OF CL-E2-H6 CODING The efficiency of removing the CL leader peptide from the CL-E2-VIEGR-H6 protein (additionally referred to in this Example as CL-E2-H6), expressed in Hansenula polymorpha, was analyzed. Since HCV E2s (aa 383673) was expressed as a his-marked protein, a rapid and efficient purification of the expressed protein after solubilization with GuHCl of the collected cells was performed on Ni-IDA. In summary, the cell pellets were

145 resuspended in 30 mM phosphate, 6 M GuHCl, pH

7.2 (9 ml of buffer/g of cells). The protein was sulfonated overnight at room temperature in the presence of 320 mM (4% w/v) sodium sulfite and 65 mM (2% w/v) sodium tetrathionate. The lysate was purified after a freeze-thaw cycle by centrifugation (10,000 g, 30 min, 4°C). Empigen BB (Albright & Wilson) and imidazole were added to a final concentration of 1% (w/v) and 20 mM, respectively. All additional chromatographic steps were performed on an Akta FPLC workstation (Pharmacia). The sample was filtered through a 0.22 μm pore size membrane (cellulose acetate) and loaded onto a NiIDA column (Sepharose FF chelating agent loaded with Ni).2+(Pharmacia), which was equilibrated with 50 mM phosphate, 6 M GuHCl, 1% Empigen BB, pH 7.2 (buffer A) supplemented with 20 mM imidazole. The column was washed sequentially with buffer A containing 20 mM and 50 mM imidazole, respectively, until the absorbance at 280 nm reached the baseline level. The his-labeled products were eluted by applying buffer D, 50 mM phosphate, 6 M GuHCl, 0.2% Empigen BB (pH 7.2), 200 mM imidazole. The purified materials were analyzed by SDS-PAGE and western blotting using a specific monoclonal antibody directed against E2 (IGH212) (Figure 41). The E2-H6 protein purified by IMAC was also subjected to N-terminal sequencing by Edman degradation. Then, the proteins were treated with N-glucosidase F (Roche) (0.2 U/gg of E2, 1 h incubation at

146

The proteins were either treated at 37°C in PBS/3% Empigen BB) or left untreated. Glycosylated and deglycosylated E2-H6 proteins were subjected to SDS-PAGE and stained on a PVDF membrane for amino acid sequencing (analysis was performed on a PROCISE® 492 protein sequencer, Applied Biosystems). Since at this stage SDS-PAGE revealed some degradation products, further fractionation was performed using size exclusion chromatography. Then, the Ni-IDA eluate was concentrated by ultrafiltration (MWCO 10 kDa, Centriplus, Amicon, Millipore) and loaded onto a Superdex G200 (Pharmacia) in PBS, 1% Empigen BB. The elution fractions, containing mainly products related to intact E2s, with an Mr between ~30 kDa and ~70 kDa based on migration on SDS-PAGE, were pooled and finally alkylated (incubation with 5 mM DTT for 30 min at 37°C, followed by incubation with 20 mM iodoacetamide for 30 min at 37°C). The possible presence of degradation products after purification by IMAC can thus be overcome by further fractionation of the intact product by size exclusion chromatography. An unexpectedly good result was obtained. Based on N-terminal sequencing, it was possible to estimate the amount of E2 product from which the CL leader peptide is removed. The total amount of protein products is calculated as pmol of protein based on the intensity of the peaks recovered by Edman degradation. Subsequently, for each specific protein (i.e., for each 'detected N end') the molar percentage is estimated.

147 versus the total. In the present experiment, only the correct N-terminal end of E2-H6 was detected, and the other variants of E2-H6 lacking the amino acid of the E2 protein or containing N-terminal amino acids not included in the E2 protein were absent. In conclusion, the E2H6 protein, expressed by H. polymorpha as CL-E2-H6 protein, was isolated, without any further in vitro processing, as a protein >95% correctly cleaved. This is in stark contrast to the fidelity of leader peptide removal by H. polymorpha from the aMF-E2-H6 protein to the E2-H6 protein, which was estimated to occur in 25% of the isolated proteins (see Table 3).

EXAMPLE 18

Purification and biochemical characterization of the El protein

HCV expressed in Hansenula polymorpha from

CONSTRUCTION OF CL-H6-K-E1 CODING AND PROCESSING IN

VITRO ANALYSIS OF H6-CONTAINING PROTEINS The efficiency of removing the CL leader peptide from the CL-H6-K-E1 protein expressed in H. polymorpha was analyzed, as well as the efficiency of subsequent in vitro processing to remove the H6 adapter peptide (his-labeled) and the processing site by Endo Lys-C. Since the HCV Eis (aa 192-326) was expressed as a protein with the N-terminal His-K CL-H6-K-E1 marker, a rapid and efficient purification could be performed, as described in Example 17. The elution profile of the IMAC chromatographic purification of the H6-K-E1 proteins (and possibly the residual CL-H6-K-E1) is shown in Figure 17.

148

42. After SDS-PAGE and silver staining of the gel and analysis by western transfer using a specific monoclonal antibody, directed against El (IGH201) (Figure 43), the elution fractions (63-69) containing the recombinant Eis products were pooled ('IMAC pooling') and subjected to treatment with Lys-C Endoproteinase (Roche) (enzyme/substrate ratio of 1/50 (w/w), 37 °C) in order to remove the H6-K melting end. The removal of the unprocessed melt product was carried out by a negative IMAC chromatography step on a Ni-IDA column, whereby the proteins processed by Endo-Lys-C are collected in the end-to-end flow fraction. In this regard, the protein sample digested with Endoproteinase Lys-C was applied to a Ni-IDA column after a 10-fold dilution with 10 mM NaH₂PO₄.4.3H20.1% (v/v) Empigen B, pH 7.2 (buffer B), followed by washing with buffer B until the absorbance at 280 nm reached the baseline level. The tip-to-tip flow was collected in different fractions (1-40) which were examined for the presence of Eis products (Figure 44). Fractions (7-28), containing intact El from which the N-terminal H6-K end (and possibly residual CL-H6-K) is removed (with an Mr between ~15 kDa and ~30 kDa based on migration over SDS-PAGE, followed by silver staining or western blot analysis using a specific monoclonal antibody directed against El (IGH201)), were pooled and finally alkylated (incubation with 5 mM DTT for 30 minutes at 37°C, followed by incubation with 20 mM of

149 iodoacetamide for 30 minutes at 37°C).

This material was subjected to N-terminal sequencing (Edman degradation). Then, the protein samples were treated with N-glucosidase F (Roche) (0.2 U/pg of El, 1 h incubation at 37 °C in PBS/3% Empigen BB) or left untreated. Glycosylated and deglycosylated El proteins were then separated by SDS-PAGE and stained on a PVDF membrane for further analysis by Edman degradation (analysis was performed on a PROCISE® 492 protein sequencer, Applied Biosystems). Based on N-terminal sequencing, the amount of correctly processed El product could be estimated (processing includes correct cleavage of the H6K sequence). The total amount of protein products is calculated as pmol of protein based on the intensity of the peaks recovered by Edman degradation. Subsequently, for each specific protein (i.e., for each 'detected N-end'), the molar percentage versus the total is estimated. In the present experiment, only the correct N-end of

El was detected and not the N ends of other H6-K-E1 processing variants. Based on this, in vitro processing by Endo Lys-C of the H6-K-E1 El protein (and possibly residual CL-H6-K-E1) to the El protein was estimated to occur with a fidelity of more than 95%.

EXAMPLE 19

SPECIFIC REMOVAL OF POORLY GLYCOSYLATED FORMS OF HCV

BY HEPARIN

In order to find specific steps of

150 Purification of HCV envelope proteins from yeast cells, binding to heparin was evaluated. Heparin is known to bind to several viruses and, consequently, binding to the HCV envelope has already been suggested (Garson, JA et al. 1999). In order to analyze this potential binding, heparin was biotinylated and the interaction with HCV El analyzed in microtiter plates coated with sulfonated HCV El from H. polymorpha, HCV endoplasmic reticulum alkylated from H. polymorpha (both produced as described in Example 16), and HCV endoplasmic reticulum alkylated from a mammalian cell culture transfected with a vaccinia expression vector. Surprisingly, strong binding was only observed with sulfonated HCV endoplasmic reticulum from H. polymorpha, while binding with HCV endoplasmic reticulum from the mammalian cell culture was completely absent. Through western blotting, we were able to show that this binding was specific to the lower molecular weight bands of the HCV El protein mixture (Figure 45), corresponding to the mature, poorly glycosylated HCV Eis. Figure 45 also reveals that sulfonation is not essential for heparin binding, since with the removal of this sulfonation, binding is still observed for the low molecular weight El (pathway 4). Alternatively, alkylation is substantially reducing this bond; however, this may be caused by the specific alkylating agent (iodoacetamide) used in this example. This verification further demonstrated the applicability.

151 Industrial CL-HCV envelope expression cassettes for yeast, since we can specifically enrich HCV El preparations with respect to a preparation with HCV El proteins with a higher degree of glycosylation (i.e., more occupied glycosylation sites).

EXAMPLE 20

Formation and analysis of virus-like particles (VLPs)

The conversion of HCV envelope proteins El and E2, expressed in H. polymorpha (Examples 16 to 18), into VLPs was essentially performed as described by Depla et al. in WO99/67285 and by Bosman et al. in W001/30815. Briefly, after culturing the transformed H. polymorpha cells, during which the HCV envelope proteins were expressed, the cells were collected, lysed in GuHCl, and sulfonated as described in Example 17. The His-marked proteins were subsequently purified by IMAC and concentrated by ultrafiltration, as described in Example 17.

Formation of VLPs from HCV envelope proteins with sulfonated Cys-thiol groups.

Concentrated HCV envelope proteins, sulfonated during the isolation procedure, were not subjected to a reducing treatment and were loaded onto a size exclusion chromatography column (Superdex G200, Pharmacia), equilibrated with PBS, 1% (v/v) Empigen. The eluted fractions were analyzed by SDS-PAGE and western blotting. Fractions with a relative Mr ~29-~25 kD (based on migration on SDS-PAGE) were

152 The fractions were pooled, concentrated, and loaded onto Superdex G200, equilibrated with PBS containing 3% (w/v) betaine, to force the formation of virus-like particles (VLPs). The fractions were pooled, concentrated, and desalinated to PBS containing 0.5% (w/v) betaine.

Formation of VLPs from HCV envelope proteins with irreversibly modified Cys-thiol groups.

Concentrated HCV envelope proteins, sulfonated during the isolation procedure, were subjected to a reducing treatment (incubation in the presence of 5 mM DTT in PBS) to convert the sulfonated Cys-thiol groups into free Cys-thiol groups. Irreversible Cys-thiol modification was performed by (i) incubation for 30 min in the presence of 20 mM iodoacetamide, or by (ii) incubation for 30 min in the presence of 5 mM N-ethylmaleimide (NEM) and 15 mM biotin-N-ethylmaleimide. The proteins were subsequently loaded onto a size exclusion chromatography column (Superdex G200, Pharmacia), equilibrated with PBS, 1% (v/v) Empigen, in the case of iodoacetamide blocking, or with PBS, 0.2% CHAPS, in the case of NEM and biotin-NEM blocking. The eluted fractions were analyzed by SDS-PAGE and Western blotting. Fractions with a relative Mr ~29~15 kD (based on migration over SDS-PAGE) were pooled, concentrated, and, to force the formation of virus-like particles, loaded onto a Superdex G200 column equilibrated with PBS, 3% (w/v) betaine. The fractions were pooled, concentrated, and desalinated to PBS, 0.5%.

153 (p/v) of betaine, in the case of blockade with iodoacetamide, or with PBS, 0.05% CHAPS, in the case of blockade with NEM and biotin-NEM.

Formation of VLPs from HCV envelope proteins with reversibly modified Cys-thiol groups.

Concentrated HCV envelope proteins, sulfonated during the isolation procedure, were subjected to a reducing treatment (incubation in the presence of 5 mM DTT in PBS) to convert the sulfonated Cys-thiol groups into free Cys-thiol groups. Reversible Cys-thiol modification was performed by incubation for 30 min in the presence of dithiodipyridine (DTDP), dithiocarbamate (DTC), or cysteine. The proteins were subsequently loaded onto a size exclusion chromatography column (Superdex G200, Pharmacia), equilibrated with PBS, 1% (v/v) Empigen. The eluted fractions were analyzed by SDS-PAGE and Western blotting. Fractions with a relative Mr ~29-~15 kD (based on migration on SDS-PAGE) were pooled, concentrated, and loaded onto Superdex G200, equilibrated with PBS, 3% (w/v) betaine, to force the formation of virus-like particles (VLPs). The fractions were combined, concentrated, and desalinated to PBS, 0.5% (w/v) betaine.

Size exclusion chromatography elution profiles in PBS, 3% (w/v) betaine, to obtain VLPs of

E2-H6 expressed in H. polymorpha are shown in Figure 46 (sulfonated) and Figure 47 (alkylated with iodoacetamide).

Elution profiles of chromatography by exclusion

154 of size in PBS, 3% (w/v) betaine, to obtain VLPs of

The VLPs expressed in H. polymorpha are shown in Figure 48 (sulfonated) and Figure 49 (alkylated with iodoacetamide). The resulting VLPs were analyzed by SDS-PAGE and western blotting, as shown in Figure 50.

Analysis of the size of VLPs formed by HCV envelope proteins expressed in H. polymorpha

The particle size of the VLPs was determined by Dynamic Light Scattering. For the light scattering experiments, a particle size analyzer (Model Zetasizer 1000 HS, Malvern Instruments Ltd., Malvern, Worcester UK) was used, which was controlled by photon correlation spectroscopy (PCS) software. Photon correlation spectroscopy or dynamic light scattering (DLS) is an optical method that measures Brownian motion and relates it to particle size. The light from a continuous, visible laser beam is directed through a collection of macromolecules or particles in suspension that are moving in Brownian motion. Some of the laser light is scattered by the particles, and this scattered light is measured by a photomultiplier. Fluctuations in the intensity of the scattered light are converted into electrical pulses, which are fed to a correlator. This generates the autocorrelation function, which is passed to a computer where the appropriate data analysis is performed.

The laser used was a 10 mW monochromatic coherent He-Ne laser with a fixed wavelength of 633 nm. For each sample, three to six consecutive measurements were taken.

155

I took them.

The results of these experiments are summarized in

Table 5.

TABLE 5. Results of dynamic light scattering analysis 5 on the indicated VLP compositions of HCV envelope proteins expressed by H. polymorpha. VLP particle sizes are given as the average particle diameter.

<td>Cys-thiol Modification</td><td>E1-H6</td><td>E2-VIEGR-H6</td><td>El</td>

<td>Sulfonation</td><td>25-45 nm</td><td>20 nm</td><td>20-26 nm</td>

<td>Alkylation</td><td>23-56 nm</td><td>20-56 nm</td><td>21-25 nm</td>

<td>(iodoacetamide)</td><td></td><td></td><td></td>

The observation that the sulfonated HCV El, derived from H. polymorpha, still forms particles with a size in the same range as the alkylated HCV El from Hansenula is surprising. Such an effect was not expected, since a high net increase (up to 8 Cys-thiol groups can be modified on the HCV El) of negative charges as a consequence of sulfonation should induce an ionic repulsion between the subunits. The other reversible cysteine modifying agents tested also allowed particle formation; however, the HCV El produced in this mode proved to be less stable than the sulfonated material, resulting in aggregation of the disulfide-based HCV El. In order to use these other reversible blockers, further optimization of the process is required.

156 conditions,

EXAMPLE 21

HCV E1-H6 Antigene Equivalence Produced by

Hansenula and El of HCV produced by mammalian cells

INFECTED WITH VACCINE

The E1-H6 reactivity of HCV produced by

Hansenula with sera from chronic HCV carriers was compared to the reactivity of HCV El produced by mammalian cells infected with recombinant HCV-vaccinia virus, as described by Depla et al. in WO99/67285. Both HCV El preparations tested consisted of VLPs in which HCV El proteins were alkylated with NEM and biotinNEM. The reactivities of both VLP preparations of HCV El with sera from chronic HCV carriers were determined by ELISA. The results are summarized in Table 6. As can be deduced from Table 6, no difference in reactivity was observed between the HCV El expressed in mammalian cells infected with recombinant vaccinia HCV virus and the HCV El expressed in H. polymorpha.

TABLE 6. The antigenicity of El produced in a mammalian cell culture or produced in H. polymorpha was evaluated on a panel of sera from chronic human HCV carriers. For this purpose, biotinylated El was ligated to streptavidin-coated ELISA plates. Human sera were then added at a 1/20 dilution, and the immunoglobulins bound to the El-linked sera were detected with a secondary antibody.

157 Specific anti-human IgG-Fc in rabbit, labeled with peroxidase. Results are expressed as OD values.

The mean values are the averages of the OD values of all serum samples tested.

<td>Serum</td><td>Hansenula</td><td>Mammal</td><td>Serum</td><td>Hansenula</td><td>Mammal</td>

<td> 55333</td><td> 1,217</td><td> 1,168</td><td>average</td><td> 1,313</td><td> 1,245</td>

158

EXAMPLE 22

Immunogenic equivalence of HCV E1-H6 produced by

Hansenula and El of HCV produced by mammalian cells

INFECTED WITH VACCINE

The immunogenicity of HCV E1-H6 produced by Hansenula was compared to the immunogenicity of HCV El produced by mammalian cells infected with recombinant vaccinia HCV-virus, as described by Depla et al. in WO99/67285. Both HCV El preparations tested consisted of VLPs in which the HCV El proteins were alkylated with iodoacetamide. Both VLP preparations were formulated with alum and injected into Balb/c mice (3 intramuscular/subcutaneous injections with a three-week interval between each, each consisting of 5 μg of El in 125 μL containing 0.13% Alhydrogel, Superfos, Denmark). The mice were bled ten days after the third immunization.

The results of this experiment are shown in Figure 51. For the top part of Figure 51, the antibodies produced following immunization with VLPs of El produced in mammalian cells were determined. Antibody titers were determined by ELISA (see Example 21), where El produced in mammalian cells (M) or El produced in Hansenula (H) were coated directly onto the solid ELISA support, after which the ELISA plates were blocked with casein. For the background portion of Figure 51, antibodies produced following immunization with El VLPs produced in Hansenula were determined.

159

Antibody titers were determined by ELISA (see Example 21), wherein El produced in mammalian cells (M) or El produced in Hansenula (H) were coated directly onto the solid ELISA support, after which the ELISA plates were blocked with casein.

The antibody titers determined were the endpoint titers. The endpoint titer is determined as the serum dilution that results in an OD (as determined by ELISA) equal to twice the baseline assay mean.

Figure 51 shows that no significant difference was observed between the immunogenic properties of both El compositions and that the antibody titers determined are independent of the antigen used in the ELISA to perform the endpoint titration.

Yeast-derived HCV endoplasmic reticulum (El) induced a protective response upon vaccination similar to that obtained with alkylated HCV endoplasmic reticulum derived from mammalian cell culture. This response was able to prevent the chronic evolution of HCV after an acute infection.

EXAMPLE 23

Antigenic and immunogenic profile of E1-H6 of HCV produced by sulfonated Hansenula.

The E1-H6 reactivity of HCV produced by

Hansenula with sera from chronic HCV carriers was compared to the HCV El reactivity produced by mammalian cells infected with recombinant vaccinia HCV-virus.

160 as described by Depla et al. in WO99/67285. Both HCV El preparations tested consisted of VLPs in which Hansenula-produced HCV El proteins were sulfonated and mammalian cell-produced HCV El was

<td>alkylated.</td><td>You</td><td>results are</td><td>data in</td><td>Table 7.</td><td>Although</td>

<td>reactivity.</td><td colspan="2">global (average)</td><td>were</td><td>identical</td><td>, some</td>

<td>differences</td><td colspan="2">the main ones were</td><td colspan="2">observed for</td><td>serums</td>

<td>Individuals.</td><td></td><td>This implies</td><td>that</td><td>material</td><td>sulfonated</td>

<td colspan="2">presented by</td><td>less a few</td><td>of their</td><td>epitopes</td><td>in a mode</td>

<td>different from</td><td>El</td><td colspan="2">of alkylated HCV.</td><td></td><td></td>

The immunogenicity of sulfonated HCV E1-H6 produced by Hansenula was compared to the immunogenicity of alkylated HCV E1-H6 produced by Hansenula. Both HCV E1-H6 preparations tested consisted of VLPs. Both VLP preparations were formulated with alum and injected into Balb/c mice (3 intramuscular/subcutaneous injections with a three-week interval between each, each consisting of 5 μg of El in 125 μL containing 0.13% Alhydrogel, Superfos, Denmark). The mice were bled ten days after the third immunization.

Antibody titers were determined similarly to that described in Example 22. Surprisingly, immunization with the sulfonated material resulted in higher antibody titers, independent of the antigen used in the ELISA to assess these titers (Figure 51; top panel: titration of antibodies produced against alkylated El; bottom panel: titration of

161 antibodies produced against sulfonated El; A: Alkylated El coated on ELISA plate; S: Sulfonated El coated on ELISA plate). However, in this experiment, the individual titers are different, depending on the antigen used for analysis, which confirms the observation noted with the sera of patients with HCV. Consequently, the HCV epitope, in which the cysteine thiol groups are modified in a reversible manner, may be more immunogenic and thus have increased potency as a vaccine protecting against HCV (chronic infection). Furthermore, the induction of a response to neo-epitopes induced by irreversible blocking is less likely to occur.

TABLE 7. The antigenicity of alkylated El (produced in mammalian cell culture) or sulfonated E1-H6 (produced in H. polymorpha) was evaluated on a panel of sera from chronic human HCV carriers (patient sera) and a panel of control sera (blood donor sera). For this purpose, El was bound to ELISA plates, after which the plates were additionally saturated with casein. Human sera were added at a 1/20 dilution and bound immunoglobulins were detected with a specific rabbit anti-human IgGc secondary antibody labeled with peroxidase. Results are expressed as OD values. Mean values are the averages of the OD values of all serum samples tested.

162

Patient Serums

<td>Serum No.</td><td>Hansenula</td><td>Mammal</td>

<td>Average</td><td> 0,706</td><td> 0,691</td>

Blood Donor Serums

<td>Serum No.</td><td>Hansenula</td><td>Mammal</td>

163

<td>Average</td><td> 0,052</td><td> 0,054</td>

EXAMPLE 24

HCV-produced identical E1-H6 antigen reactivity

BY HANSENULA AND OF HCV PRODUCED BY MAMMALIAN CELLS

INFECTED WITH VACCINE MADE WITH SERUM FROM VACCINATED CHIMPANZEES

The reactivities of El produced by mammalian cells infected with HCV-vaccinia virus and of E1-H6 produced by Hansenula (both alkylated) were compared with sera from vaccinated chimpanzees and with monoclonal antibodies. For this purpose, the said El proteins were directly coated onto ELISA plates, followed by saturation of the plates with casein. The endpoint titers of antibodies binding to El proteins coated on ELISA plates were determined for chimpanzee sera and for specific murine monoclonal antibodies, all obtained from animals immunized with El produced by mammalian cells. The endpoint titer determination was performed as described in Example 22. The monoclonal antibodies used were IGH201 (see Example 15), IGH198 (IGH198 = 23C12 in Maertens et al.). no WO96/04385), the IGH203 (IGH203 = 15G6 on Maertens and col. in WO96/04385) and the IGH202 (IGH202 = 3F3 on Maertens and col. in WO99/50301).

As can be deduced from Figure 53, the

164 Reactivities of 7 different chimpanzees are identical when tested with the El protein produced by Hansenula or by mammalian cells. The reactivities of monoclonal antibodies against HCV El are also nearly identical. Two of the chimpanzees (Yoran and Marti) were involved in a prophylactic vaccine study and were able to clear an acute infection with provocation, while a control animal did not clear the infection. The five other chimpanzees (Ton, Phil, Marcei, Peggy, Femma) were involved in therapeutic vaccination studies and showed a reduction in liver damage, as measured by serum ALT and/or histological activity index on liver biopsy, with HCV El immunizations.

The results obtained in this experiment are clearly different from the findings of Mustilli and colleagues (Mustilli, AC et al. 1999), who expressed the HCV E2 protein in both Saccharomyces cerevisiae and Kluyveromyces lactis. However, the E2 produced by purified yeast differed from the HCV E2 produced by mammalian cells (CHO) in that lower reactivity was observed with sera from chimpanzees immunized with HCV E2 produced by mammalian cells, while reactivity with monoclonal antibodies was higher for HCV E2 produced by yeast.

EXAMPLE 25

HCV GLYCOPROFILE BY CARBOHYDRATE ELECTROPHORESIS

Assisted by fluorophore (face)

The glycosylation profiles were compared of El

165 HCV produced by Hansenula and HCV produced by mammalian cells infected with recombinant vaccinia HCV-virus, as described by Depla et al. in WO99/67285. This was done by fluorophore-assisted carbohydrate electrophoresis (FACE). For this purpose, oligosaccharides were released from Eis produced by mammalian cells or by Hansenula using peptide-N-glucosidase (PNGase F) and labeled with ANTS (the El proteins were alkylated with iodoacetamide before digestion with PNGase F). The ANTS-labeled oligosaccharides were separated by PAGE on a 21% polyacrylamide gel, at a current of 15 mA, at 4°C, for 2-3 h. From Figure 54, it was concluded that the oligosaccharides in El produced by mammalian cells and E1-H6 produced by Hansenula migrate like oligomaltose, with a degree of polymerization between 7 and 11 monosaccharides. This indicates that the Hansenula expression system surprisingly results in an El protein that is not hyperglycosylated and that has sugar chains with a length similar to the sugar chains added to El proteins produced in mammalian cells.

EXAMPLE 26

N-linked oligosaccharide sequencing derived from

It is produced in Saccharomyces and in Hansenula and of It is

Produced by mammalian cells infected with HCV-virus.

Recombinant vaccine.

Eis (225 ng) purified from a culture of Saccharomyces or Hansenula (see Examples 15-16) or from a culture of RK13 cells infected with an HCV-virus of

166 Recombinant vaccinia (see Maertens et al. in WO96/04385) and present in PBS, 0.5% betaine, was diluted with deglycosylation incubation buffer (50 mM Na2HPO4).4, 0.75% Nonidet P-40) to a final concentration of 140 μC/μL. The pH of the solution was adjusted to pH 5.5 with H3DUST4 concentrated solution. To this solution, 2 U of PNGase F (Peptide N) were added.4-(acetyl-beta-glucosaminyl)-asparagine amidase from Flavobacterium meningosepticum; EC 3.5.1.52; obtained from Roche) and the sample was incubated overnight at 37°C.

After overnight incubation, the pH of the solution was adjusted to pH 5.5 with H.3DUST4 concentrated. The proteins and oligosaccharides were subsequently precipitated by

<td>addition of 4</td><td>volumes of</td><td>acetone (at -20°C),</td><td>and</td><td>the mixtures</td>

<td colspan="2">were incubated at -20°C</td><td>for 15 min. As</td><td colspan="2">samples were</td>

<td>centrifuged</td><td>at 4°C, in</td><td colspan="2">13000 rpm, during</td><td>5 min. 0</td>

<td>supernatant</td><td>acetone</td><td>it was discarded and</td><td>the</td><td>ball was</td>

The mixture was incubated at -20°C for 1 hour after adding 150 μL of ice-cold 60% methanol. The methanol supernatant, containing the released oligosaccharides, was collected and dried by rotary evaporation (SpeedVac).

Dried Eis glycans, as well as the reference oligosaccharides (all from Glyko, Bicester, UK; see Figure 55), Man-9 (11 monosaccharide units), Man-8 (10 monosaccharide units),

Man-7 (9 monosaccharide units), Man-6 (8 monosaccharide units), and Man-5 (7 monosaccharide units) were dissolved in 5 μL of 2-aminobenzamide (2-AB) marker reagent (± 0.35 M 2-AB + ± 1 M NaCNBH3

167 in 30% HOAc / 70% DMSO) to obtain a final glycan concentration between 5 and 100 μM. The glycan solution was then incubated for 2 hours at 65°C. After 30 minutes, the sample was vortexed. After conjugation, the excess 2-AB was removed as follows. The sample was diluted with 16 μL of purified water (MilliQ) and applied to a Sephadex G-10 column (1 cm diameter, 1.2 cm height, Amersham Biosciences; connected to a VacElut system, Varian) after the column was extracted and dried.

Labeled oligosaccharides were eluted by applying 2 x 100 μL of purified water (MilliQ) to the column. The eluates of the reference carbohydrates (Man-9, Man-8, Man-7, and Man-6) were dried and stored at -70°C until HPLC analysis. The eluates of the Eis samples, as well as the reference glycan Man-9, were distributed onto 4 numbered and dried PCR tubes. The reactions, as summarized in Table 8, were carried out overnight at 37°C, except for the reaction in tube 3, which was terminated after 1 hour. The final concentrations of the exoglycosidase enzymes (all obtained from Glyko, Bicester, UK) used were: for α-2 Mannosidase (Aspergillus saitoi): 2 U/ml; for α-Mannosidase (Jack Bean): 50 U/ml; and for β-Mannosidase (Helix pomatia): 4 U/ml.

TABLE 8. Detailed view of reaction mixtures for the

168 sequencing of oligosaccharides.

<td>α 1-2 Mannosidase (pL)</td><td> -</td><td> 4</td><td> -</td><td> -</td><td> -</td>

<td>α Mannosidase (μΐι)</td><td></td><td> __</td><td> 5</td><td> 5</td><td> 5</td>

<td>β Mannosidase(gL)</td><td></td><td></td><td></td><td></td><td> 4</td>

<td>Incubation buffer 4x (pL)</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td>

<td>MiliQ H2The (pL)</td><td> 15</td><td> 11</td><td> 10</td><td> 10</td><td> 6</td>

Figure 56 shows a superior oligomannose consisting of 10 chitobiose-linked mannose moieties. Each terminal mannose residue is linked, via an α 1-3 linkage, to a non-terminal mannose residue. The oligomannose in Figure 56 is completely resistant to cleavage by the exoglycosidase α 1-2 mannosidase. Long-term incubation (overnight) of the oligomannose from Figure 56 with the exoglycosidase α-Mannosidase will result in the cleavage of all α linkages (α 1-2, α 1-3, α 1-6), but not the β linkages. The resulting oligosaccharide will thus be 4'-β-mannosyl chitobiose. This 4'-β-mannosyl chitobiose portion can be converted into mannose and chitobiose through the action of the exoglycosidase β-Mannosidase. According to the supplier's specifications (Glyko), α-Mannosidase converts the reference oligosaccharide Man-6 (see Figure 55.D) completely into 4'-β-mannosyl chitobiose, and further conversion of the latter into mannose and chitobiose by β-Mannosidase occurs.

169 It is also described as being complete.

Figure 57 shows a higher oligomannose consisting of 9 mannose moieties linked to chitobiose. In this oligomannose, a terminal mannose residue is linked, by an α 1-2 linkage, to the non-terminal mannose residue. With the action of the exoglycosidase α 1-2 Mannosidase, said α 1-2 linked mannose will be removed. With the subsequent action of α-Mannosidase and β-Mannosidase, the reaction products as described for the oligomannose in Figure 56 will be obtained. According to the supplier's specifications (Glyko), α 1-2 Mannosidase is capable of converting the reference oligosaccharides Man-9 and Man-6 into Man-5 (see Figure 55) with an efficiency of >90%.

Figure 58 shows the reference superior oligomannose Man-9 consisting of 9 mannose moieties linked to chitobiose. In this oligomannose, every terminal mannose residue is linked, by an α 1-2 linkage, to a non-terminal mannose residue. With the action of the exoglucosidase α 1-2 Mannosidase, Man-9 will thus be converted to Man-5, according to the supplier's specification, at > 90%. Subsequent digestion with α-Mannosidase will convert Man-5 to 4'-β-mannosyl chitobiose.

The contents of the different reaction tubes, as indicated in Table 8, were dried in a centrifugal vacuum evaporator or in a freeze dryer and stored at -70°C until HPLC analysis. Before applying to the column, each sample (Eis and reference) was dissolved in 25 μL of water and loaded onto a TSK gel-Amide-80 column (0.46 x 25 cm,

170

Tosoh Biosep), connected to a Waters HPLC station.

Alliance.

The separation of the oligosaccharide was carried out at room temperature, at 1.0 ml/min. Solvent A consisted of 0.1% acetic acid in acetonitrile and solvent B consisted of 0.2% acetic acid-0.2% triethylamine in water. The separation of the 2-AB labeled oligosaccharides was carried out using 28% isocratic B over 5 column volumes, followed by a linear increase to 45% B over 15 column volumes.

The reference oligosaccharide Man-6 is eluting at 53±1 min, Man-7 is eluting at 59±1 min, Man-8 at 67±2 min, and Man-9 at 70±1 min; 4'-β-mannosyl chitobiose is eluting at 10±1 min and chitobiose at 6±1 min (not shown). This is exemplified for the reaction products of Man-9 after overnight incubation without exoglucosidase (trace 1 of the chromatogram in Figure 63; Man-9 only), after overnight incubation with α 1-2 Mannosidase (trace 2 of the chromatogram in Figure 63; mixture of Man-5 and Man-6), after 1 h or overnight incubation with α-Mannosidase (traces 3 and 4, respectively, of the chromatogram in Figure 63; 4'-β-mannosyl chitobiose only), and after overnight incubation with α- and β-Mannosidase (trace 5 of the chromatogram in

<td>Figure 63; chitobiosis</td><td>only).</td><td> 0</td><td>trace 6 of the chromatogram</td>

<td>Figure 63 shows</td><td>indicating</td><td>the</td><td>solvent gradient</td>

<td>applied.</td><td></td><td></td><td></td>

<td>The products</td><td>of the reaction</td><td>of the</td><td>Eis oligosaccharides</td>

produced by Saccharomyces (obtained after treatment with

171

PNGaseF) without exoglycosidases were mainly four carbohydrates, present eluting at 59±1 min (15%), 67±1 min (45%), 70±1 min (25%) and 75±1 min (15%). The overall content of Man(8)-GlcNAc(2) and Man(9)GlcNAc(2) in Eis produced by Saccharomyces was ~65%. In the reaction with α 1-2 Mannosidase, only the carbohydrates with a retention time of 70±1 min had disappeared. The carbohydrate intensity with a retention time of 75±1 min remained the same, and the carbohydrate intensity with a retention time of 67±1 min was increased. This means that not all terminal mannose units have the α(l-2) configuration. After overnight incubation with α-Mannosidase, all carbohydrate chains were reduced to the 4'-β-mannosyl chitobiose portion. This means that the carbohydrate is high in mannose and that all mannose residues, except one, have the α configuration. The reduction of this 4'-β-mannosyl chitobiose portion to chitobiose was apparent after overnight incubation with β-mannosidase. The resulting chromatograms are shown in Figure 64, which were obtained under the same conditions as described for the chromatograms in Figure 63. The results are summarized in Table 9.

The same experiments were repeated with Eis produced by cells infected with vaccinia and surprisingly showed a completely different picture. In the enzyme-free reaction, a complex mixture of carbohydrates was present (see Figure 65 and Table 9). The overall content of monosaccharide(8)-GlcNAc(2) and monosaccharide(9)-GlcNAc(2) was 37%. After reaction with

172

1-2 Mannosidase, carbohydrates with retention times of 70±l and 59±1 min had disappeared. After overnight incubation with α Mannosidase, a substantial amount of monosaccharide(6)-GlcNAc(2) remained, in addition to the 4'-β-mannosyl chitobiose product. This is an indication that one of the oligosaccharide branches is resistant to degradation by α Mannosidase. This can be explained by the presence of 1 or 2 glucose residues linked to the Mana(1-2)-terminated branch of the N-linked oligosaccharide. A putative structure of such a glucose-containing oligosaccharide is shown in Figure 62. The possible reaction products of glucose-containing oligosaccharides are given in Table 10. Since no oligosaccharide equivalent to Man-7 (i.e., oligosaccharide consisting of 9 monosaccharides) remains after the reaction with α 1-2 Mannosidase, these glucose residues are most likely linked to branch B of the oligosaccharide structure shown in Figure 62. However, it cannot be excluded that both branches A and B of the oligosaccharide in Figure 62 are partially terminated by glucose.

The reduction of the 4'-β-mannosyl chitobiose moiety to chitobiose was apparent after overnight incubation with β-Mannosidase. The resulting chromatograms are shown in Figure 65, which were obtained under the same conditions as described for the chromatograms in Figures 63-64.

The results obtained are summarized in Table 9.

The same experiments were repeated with Eis.

173 produced by Hansenula and surprisingly showed a completely different picture. In the enzyme-free reaction, mainly two carbohydrates with retention times of 67±2 min and 70±1 min were present, corresponding, respectively, to Man-8 and Man-9. The overall content of Man(8)-GlcNAc(2) and Man(9)GlcNAc(2) in the enzyme produced by Hansenula was ~90%. After reaction with α 1-2 Mannosidase, the carbohydrates were reduced mainly to Man-5 with a retention time of 45±1 min and a Man-6 with a retention time of 53±1 min. After overnight incubation with α Mannosidase, all carbohydrate chains were reduced to the 4'-P~manosyl chitobiose moiety. This means that the carbohydrate is high in mannose and that all mannose residues, except one, have the α configuration. The reduction of this 4'-p-mannosyl chitobiose portion to chitobiose was apparent after overnight incubation with β-Mannosidase. The resulting chromatograms are shown in Figure 66, which were obtained under the same conditions as described for the chromatograms in Figures 63-65.

The results obtained are summarized in Table 9.

TABLE 9. Oligomannoses resulting from the digestion of oligomannoses derived from Eis produced by Saccharomyces (Sc) and Hansenula (Hp), as well as from Eis produced by mammalian cells infected with recombinant HCV-vaccinia (Vac). The different oligomannoses are indicated with their chromatographic retention times (Rt, in minutes) and the percentage of a given oligomannose in relation to the content.

174 The total oligomannose (top rows), as well as the most probable structure for each observed oligomannose, is indicated with reference to any of Figures 55-62. Oligomannoses with terminal α 1-3 mannoses were marked with a *. Oligomannoses with terminal glucoses were marked with a *, as any reference to 62* means that the structure may be derived from the structure given in Figure 62. 1 is the 'reaction' without exoglycosidases, 2 is the reaction with α 1-2 Mannosidase. Oligomannose with a retention time of 45±1 min is supposedly an oligomannose comprising 5 mannose residues linked to chitobiose. Oligomannose with a retention time of 75+1 min is supposedly an oligomannose comprising 10 mannose residues linked to chitobiose.

<td>Sc 1 Structure</td><td> /</td><td>1% 55, D</td><td>14% 55, C</td><td> 42% 59°</td><td> 23% 57° 61°</td><td> 18% 56°</td>

<td>Sc 2 Structure</td><td>17% 55,E</td><td> /</td><td> 8% 60°</td><td> 50% 59°</td><td> 6% 57° 61°</td><td> 16% 56°</td>

<td>Structure</td><td>55, E</td><td>62* and Table 10</td><td>55, C</td><td>62* and Table 10</td><td>62* and Table 10</td><td>62* and Table 10</td>

<td>Structure</td><td>55, E</td><td>of 62 and Table 10</td><td></td><td>62* and Table 10</td><td>62* and Table 10</td><td>62* and Table 10</td>

<td>HP 1 Structure</td><td> /</td><td>2% 55, D</td><td>7% 55, C</td><td>54% 55, B</td><td> 36% 58</td><td> /</td>

<td>HP 2 Structure</td><td>80% 55, E</td><td>20% 55, D</td><td> /</td><td> /</td><td> /</td><td> /</td>

TABLE 10.

N-linked oligosaccharide products

175 containing glucose after reaction with cc 1-2 Mannosidase or α

1-2 Mannosidase and α-Mannosidase.

<td></td><td>Equivalent to</td><td>Product of α 1-2</td><td>Product of α</td>

<td></td><td>Man</td><td>Mannosidase</td><td>Mannosidase (after</td>

<td>Branch A+</td><td>Man-10</td><td>Man-8</td><td>Man-6</td>

<td>Branch A+</td><td>Man-9</td><td>Man-7</td><td>Man-6</td>

<td>Branch A</td><td>Man-8</td><td>Man-5</td><td>4'-β-mannosyl</td>

<td>not Glc</td><td></td><td></td><td>chitobiose</td>

<td>Branch B +</td><td>Man-10</td><td>Man-9</td><td>Man-6</td>

<td>Branch B +</td><td>Man-9</td><td>Man-8</td><td>Man-6</td>

<td>Branch B</td><td>Man-8</td><td>Man-5</td><td>4'-β-mannosyl</td>

<td>not Glc</td><td></td><td></td><td>chitobiose</td>

EXAMPLE 27

Occupancy of N-glycosylation sites in recombinant HCV 5 eI

Depending on the number of occupied N-glycosylation sites, Ei shows different migration behavior in SDS-PAGE analysis. Based on this property, the average number of occupied N10 glycosylation sites in the Ei product could be estimated. With reference to this, the samples of the Ei product

176 The purified samples were subjected to SDS-PAGE and Coomassie Brilliant Blue staining (Figure 67) and additionally analyzed using the ImageMaster 1D Prime software package (Pharmacia). In summary, the gel was scanned and for each specific protein band, the percentage of occurrence (its intensity relative to the total intensity of the different bands, where the total of all bands equals 100%) was estimated (Table 11). It should be noted that each specific protein band represents Eis molecules with the same number of occupied N-glycosylation sites.

The results obtained indicated that the main part (> 90%) of the El product produced by Hansenula has one or more N-glycosylation sites less occupied than the Eis obtained from the vaccinia expression system (as described by Maertens et al. in WO96/04385). Assuming that in the vaccinia-derived El product all N-glycosylation sites are occupied (where the NNSS sequence (SEQ ID NO:73) at position 233-236 of El is considered as a glycosylation site), it is quite safe to conclude that the average number of occupied N-glycosylation sites in the El protein expressed in Hansenula does not exceed 80% of the total available N-glycosylation sites.

TABLE 11. Estimated average number of occupied N-glycosylation sites in El proteins obtained from Hansenula polymorpha and vaccinia/vero expression systems by SDS-PAGE intensity analysis and Coomassie Brilliant Blue staining. Protein bands are indicated by their molecular weight. See the

177

Figure 67.

<td>Here it is Alquilada</td><td colspan="2">% of Occurrence</td>

<td></td><td>(density</td><td>relative</td>

<td>Hansenula Polymorpha</td><td>Experiment 1</td><td>Experiment 2</td>

<td>MW 14-15</td><td>Not qualified</td><td>Not qualified</td>

<td>Vaccinia/Vero</td><td></td><td></td>

EXAMPLE 28

Occupancy of N-glycosylation sites in E2 of HCV

RECOMBINANT

Two hundred (200) μς of the E2-H6 protein produced by

Hansenula proteins were deglycosylated with PNGaseF. The deglycosylated E2s-H6 was loaded onto a mini-gel (10 μg/path). The protein bands were digested with trypsin and endo Asp-N. The masses of the resulting peptides were determined by MALDI-MS (dried droplet and thin-layer method). This method can be used to determine the degree of N-glycosylation: during deglycosylation with the

<td>enzyme</td><td>PNG-ase</td><td colspan="4">F, the entire sugar chain is cleaved.</td>

<td>outside,</td><td colspan="2">and at the same time asparagine</td><td>(N) is</td><td>hydrolyzed</td><td>to</td>

<td>15 acid</td><td>aspartic</td><td>(D) . The difference of</td><td>mass</td><td>among these</td><td>two</td>

<td colspan="2">amino acids is</td><td>1 Da, which can</td><td>to be</td><td>determined</td><td>put</td>

178 Mass spectrometry. Additionally, the hydrolysis of N to D creates new cleavage sites for the Asp-N enzyme.

Possible glycosylation sites in E2s are

N4Π, N423, N430, N448, N478, N532, N540, Ns55, N57S, Nβ23 θ N&45 (see Figure 68). Maldi-MS analysis showed for each of these glycosylation sites that N-glycosylation was not complete, because after deglycosylation with PNGaseF, the peptides were found with N or D in the glycosylation site (mass difference 1 Da). The ratio of the number of D residues to the number of N residues gives an indication of the average occupancy, across all E2 proteins expressed by Hansenula and present in the analyzed sample, of a single N-glycosylation site by a sugar chain. These results are summarized in Tables 12 to 14.

Based on these results, it was calculated that, on average, each glycosylation site was glycosylated by approximately 54%.

TABLE 12. Percentage of glycosylation determined from tryptic peptides containing an N-glycosylation site.

<td>N-glycosylation site</td><td>Glycosylated</td><td>Non-glycosylated</td>

TABLE 13. Percentage of glycosylation determined from

179 of tryptic peptides containing two N-glycosylation sites.

<td>N- sites</td><td>Both</td><td>1 of 2 sites</td><td>No site</td><td>Calculated</td>

<td>glycosylation</td><td>sites</td><td>glycosylated</td><td>glycosylated</td><td>for N</td>

<td></td><td>glycosylated</td><td></td><td></td><td>individual</td>

TABLE 14. Percentage of glycosylation determined for N478 in digestion with Asp-N.

<td>N-glycosylation site</td><td>Glycosylated</td><td>Non-glycosylated</td>

EXAMPLE 29

Reactivity of blood donor sera with HCV

Produced by Saccharomyces or Hansenula

The Els-Hβ produced by Saccharomyces (expressed with the α-MF leader) and the Els-Hβ produced by Hansenula (expressed with the CL leader) were both purified as described in Examples 15 and 16 and were finally subjected to alkylation and VLP formation, as described in Example 20. Both proteins were directly adsorbed onto a microtiter plate at 0.5 μg/ml (1 h, 37°C) and, after blocking the plate (PBS-0.1% casein, 1 h, 37°C), sera from blood donors tested for HCV and negative were incubated in a

180 1/20 dilution (PBS - 0.5% casein, 10% (w/v) sucrose, 0.2% (v/v) Triton X-705, 1 h, 37°C). Finally, binding was detected using a specific anti-IgG-F antiserum.w Human in rabbit secondary, peroxidase-linked (Dako, Denmark), at a 1/50000 dilution (0.1% casein PBS, 1 h, RT), followed by color development. Between all steps, the plates were washed 3 times with 0.05% (w/v) Tween-20 PBS. For comparison, sera were also analyzed in an identical manner on mammalian cell-derived Eis, produced and purified as described by Depla et al. in WO99/67285.

The cutoff for this ELISA was set at 2 times the baseline mean (i.e., the reactivity of all sera in an identical configuration, but with streptavidin adsorbed to the wells).

From Table 15, it can be judged that many (75%) sera show reactivity above the cutoff point with the El produced by Saccharomyces, while only some sera (6%) show some reactivity above the cutoff point with the El produced by Hansenula. This difference in reactivity was attributed to the presence of terminal α 1-3 mannoses linked to α 1-2 mannoses on the El produced by Saccharomyces, as evidenced in Example 26. Young and colleagues (1998) previously indicated that this type of mannose is also responsible for the reactivity of human sera with Saccharomyces-derived mannan. In order to further confirm that the reactivity with Saccharomyces-derived El can be attributed to this type of residue...

181 In the endoplasmic reticulum ELISA produced by Saccharomyces mannose, the ELISA was repeated with dilutions of blood donor sera pre-incubated (1a 37°C) with 1 or 5 mg/ml of mannan (Sigma) added to the dilution buffer. As can be seen from Table 16, pre-incubation with mannan reduced the reactivity of this endoplasmic reticulum with blood donor sera in a concentration-dependent manner down to baseline levels for all but one (F556) of the sera analyzed. (the average DO is reduced from 0.24, without competition for manna, to

0.06, using 5 mg mannan/ml).

TABLE 15. Reactivity of El produced in Hansenula, Saccharomyces and mammalian cells. Reactivities above the cutoff value are indicated in the cells shaded in black.

<td>Serum No.</td><td>El de Hansenula</td><td>El de Saccharomyces</td><td>El de Mammal</td><td></td><td>White</td>

182

<td>Average</td><td> 0.072</td><td> 0.242</td><td> 0.058</td><td>Court</td><td> 0.113</td>

<td>n2 serums</td><td> 2/36</td><td> 27/36</td><td> 0/36</td><td></td><td></td>

<td>above</td><td></td><td></td><td></td><td></td><td></td>

183

<td>court</td><td></td><td></td><td></td><td></td><td></td>

<td>n- of serums above court</td><td> 6</td><td> 75</td><td></td><td></td><td></td>

TABLE 16. Reactivity of El produced in Saccharomyces cells as in Table 15, but in the presence of 5 mg of mannan/ml. Reactivities above the cutoff value are indicated by the cells shaded in black.

<td rowspan="2">Serum No.</td><td colspan="3">Mannan Concentration</td>

184

<td>Average</td><td> 0.243</td><td> 0.089</td><td> 0.062</td>

185

List of References

Agaphonov,MO, Beburov,Μ.Y., Ter Avanesyan,MD, and Smirnov,VN (1995) A disruption-replacement approach for the targeted integration of foreign genes in Hansenula polymorpha. Yeast 11:1241-1247.

Agaphonov,MO, Trushkina,PM, Sohn,JH, Choi,ES, Rhee,SK, and Ter Avanesyan,MD (1999) Vectors for rapid selection of integrants with different plasmid copy numbers in the yeast Hansenula polymorpha DL1. Yeast 15:541-551.

Alber, T. and Kawasaki,G. (1982) Nucleotide sequence of the triose phosphate isomerase gene of Saccharomyces cerevisiae. J.Mol Appl.Genet 1:419-434.

Ammerer, G. (1983) Expression of genes in yeast using the ADCI promoter. Methods Enzymol. 101:192-201.

Bailou,L., Hitzeman,RA, Lewis,MS, and Bailou,CE (1991) Vanadate-resistant yeast mutants are defective in protein glycosylation. Proc.Natl.Acad.Sei.USA 88:3209-3212.

Beekman,NJ, Schaaper,WM, Tesser,GI, Dalsgaard,K., Kamstrup,S., Langeveld,JP, Boshuizen,RS, and Meloen,RH (1997) Synthetic peptide vaccines: palmitoylation of peptide antigens by a thioester bond increases immunogenicity. J.Pept.Res. 50:357-364.

186

Burns, J., Butler, J., and reduction of disulfides

J.Org.Chem. 56:2648-2650.

Whitesides, G. (1991) Selective by Tris(2-carboxyethyl)phosphine.

Cox,H., Mead,D., Sudbery,P., Eland,RM, Mannazzu,I., and Evans,L. (2000) Constitutive expression of recombinant proteins in the methylotrophic yeast Hansenula polymorpha using the PMA1 promoter. Yeast 16:1191-1203.

Cregg, JM (1999) Expression in the methylotophic yeast Pichia pastoris. In Gene expression systems: using nature for the art of expression, JMFernandez and JPHoeffler. eds (San Diego: Academic Press), pp. 157-191.

Darbre, A. (1986) Practical protein chemistry. the handbook. Whiley & Sons Ltd.

Diminsky,D., Schirmbeck,R., Reimann,J., and Barenholz,Y. (1997) Comparison between hepatitis B surface antigen (HBsAg) particles derived from mammalian cells (CHO) and yeast cells (Hansenula polymorpha): composition, structure and immunogenicity. Vaccine 15:637–647.

Doms, RW, Lamb, RA, Rose, JK, and Helenius, A. (1993) Folding and assembly of viral membrane proteins. Virology

193:545-562.

Elble, R. (1992) A simple and efficient procedure for

187 transformation of yeasts. Biotechniques 13:18-20.

Fellinger,AJ, Verbakel,JM, Veale,RA, Sudbery,PE, Bom,IJ, Overbeeke,N., and Verrips,CT (1991) Expression of the alpha-galactosidase from Cyamopsis tetragonoloba (guar) by Hansenula polymorpha. Yeast 7:463-473.

Fournillier,JA, Cahour,A., Escriou,N., Girad,M., and Wychowski,C. (1996) Processing of the El glycoprotein of hepatitis C virus expressed in mammalian cells. J.Gen Virol. 77 (Pt 5):1055-1064.

Gailit, J. (1993) Restoring free sulfhydryl groups in synthetic peptides. Anal.Biochem. 214:334-335.

Garson,JA, Lubach,D., Passas,J., Whitby,K., and Grant,PR (1999) Suramin blocks hepatitis C binding to human hepatoma cells in vitro. J.Med.Virol. 57:238-242.

Gatzke,R., Weydemann,U., Janowicz,ZA, and Hollenberg,CP (1995) Stable multicopy integration of vector sequences in Hansenula polymorpha. Appl.Microbiol-Biotechnol. 43:844-849.

Gellissen, G. (2000) Heterologous protein production in methylotrophic yeasts. Appl.Microbiol.Biotechnol. 54:741750.

Grakoui, A., Wychowski, C.

Lin,C., Feinstone,SM

188

Rice, CM (1993) Expression and identification of hepatitis C virus polyprotein cleavage products. J. Virol. 67:13851395.

Grinna,LS and Tschopp,JF (1989) Size distribution and general structural characteristics of N-linked oligosaccharides

<td>from the methylotrophic 115.</td><td>yeast, Pichia pastoris.</td><td>Yeast 5:107</td>

<td>Heile,JM, Fong,YL,</td><td>Rosa, D., Berger, K.,</td><td>Saletti, G.,</td>

<td>Campagnoli, S., Bensi, G.</td><td>, Capo,S., Coates,S.,</td><td>Crawford, K.,</td>

Dong,C., Wininger,M., Baker,G., Cousens,L., Chien,D., Ng,P., Archangel,P., Grandi,G., Houghton,M., and Abrignani,S. (2000) Evaluation of hepatitis C virus glycoprotein E2 for vaccine design: an endoplasmic reticulum-retained recombinant protein is superior to secreted recombinant protein and DNAbased vaccine candidates. J. Virol. 74:6885-6892.

Helenius, A. (1994) How N-linked oligosaccharides affect glycoprotein folding in the endoplasmic reticulum. Mole

Biol.Cell 5:253-265.

Hermanson, GT (1996) Bioconjugate techniques. San Diego:

Academic Press.

Herscovics, A. and Orleans, P. (1993) Glycoprotein biosynthesis in yeast. FASEB J. 7:540-550.

189

Hijikata,M., Kato,N., Ootsuyama,Y., Nakagawa,M., and Shimotohno,K. (1991) Gene mapping of the putative structural region of the hepatitis C virus genome by in vitro processing analysis. Proc.Natl.Acad.Sei.U . S. A 88:5547-5551.

Hitzeman, RA, Clarke, L., and Carbon, J. (1980) Isolation and characterization of yeast 3-phosphoglycerokinase gene (PGK) by an immunological screening technique. J.Biol.Chem.

255:12073-12080.

Hollenberg, CP and Gellissen, G. (1997) Production of recombinant proteins by methylotrophic yeasts. Curr.Opin.

Biotechnol. 8:554-560.

Holmgren, A. (1979) Thioredoxin catalyzes the reduction of insulin disulfides by dithiothreitol and dihydrolipoamide.

J.Biol.Chem. 254:9627-9632.

Janowicz,ZA, Melber,K., Merckelbach,A., Jacobs,E.,

Harford, N., Comberbach, M., and Hollenberg, C. P. (1991)

Simultaneous expression of the S and L surface antigens of hepatitis B, and formation of mixed particles in the methylotrophic yeast, Hansenula poiymorpha. Yeast 7:431-443.

Jayabaskaran,C., Davison,PF, and Paulus,H. (1987) Facile preparation and some applications of an affinity matrix with a cleavable connector arm containing a disulfide bond. Prep.Biochem. 17:121-141.

190

Jenkins,N., Parekh,RB, and James,DC (1996) Getting the glycosylation right: implications for the biotechnology industry. Nat.Biotechnol. 14:975-981.

Julius,D., Brake,A., Blair,L., Kunisawa,R., and Thorner,J. (1984) Isolation of the putative structural gene for the lysine-arginine-cleaving endopeptidase required for Processing of yeast prepro-alpha-factor. Cell 37:1075-1089.

Kalef,E., Walfish,PG, and Gitler,C. (1993) Arsenical-based affinity chromatography of vicinal dithiol-containing proteins: purification of L1210 leukemia cytoplasmic proteins and recombinant rat c-erb A beta 1 T3 receptor.

Anal.Biochem. 212:325-334.

Kalidas,C., Joshi,L., and Batt,C. (2001) Characterization of glycosylated variants of beta-lactoglobulin expressed in Pichia pastoris. Protein Eng 14:201–207.

Kato,N., Ootsuyama,Y., Tanaka,T., Nakagawa,M., Nakazawa,T., Muraiso,K., Ohkoshi,S., Hijikata,M., and Shimotohno,K. (1992) Marked sequence diversity in the putative envelope proteins of hepatitis C viruses. Virus Res 22:107-123.

Kawasaki, G. and Fraenkel,DG (1982) Cloning of yeast glycolysis genes by complementation. Biochem.Biophys. Res.Commun. 108:1107-1122.

191

Klebe,RJ, Harriss,JV, Sharp,ZD, and Douglas,MG (1983) A general method for polyethylene-glycol-induced genetic transformation of bacteria and yeast. Gene 25:333-341.

Kumar,N., Kella,D., and Kinsella,JE (1985) A method for the controlled cleavage of disulfide bonds in proteins in the absence of denaturants. J.Biochem.Biophys.Methods. 11:251263.

Kumar,N., Kella,D., and Kinsella,JE (1986) Anomalous effects of denaturants on sulfitolysis of protein disulfide bonds. Int.J.Peptide Prot.Res. 28:586-592.

Maertens, G. and Stuyver, L. (1997) Genotypes and genetic variation of hepatitis C virus. In the molecular medicine of viral hepatitis, TJ Harrison and AJ Zuckerman, eds John Wiley & Sons), pp. 183-233.

Major,ME and Feinstone,SM (1997) The molecular virology of hepatitis C. Hepatology 25:1527-1538.

Miele,RG, Nilsen,SL, Brito,T., Bretthauer,RK, and Castellino,FJ (1997) Glycosylation properties of the Pichia pastoris-expressed recombinant kringle 2 domain of tissue-type plasminogen activator. Biotechnol.Appl.Biochem. 25 (Pt 2):151-157 .

Meunier, JC,

Fournillier, A.,

Choukhi, A.,

Cahour, A.,

192

Cocquerel,L., Dubuisson,J., and Wychowski,C. (1999) Analysis of the gycosylation sites of hepatitis C virus (HCV) glycoprotein El and the influence of El glycans on the formation of the HCV glycoprotein complex. J.Gen Virol. 80 (Pt 4):887-896.

Montesino,R., Garcia,R., Quintero,0., and Cremata,JA (1998) Variation in N-linked oligosaccharide structures on heterologous proteins secreted by the methylolrophic yeast Pichia pastoris. Protein Expr.Purif. 14:197-207.

Mustilli,AC, Ιζζο,Ε., Houghton,M., and Galeotti,CL (1999) Comparison of secretion of a hepatitis C virus glycoprotein in Saccharomyces cerevisiae and Kluyveromyces lactis.

Res.Microbiol. 150:179-187.

Nagai, K. and Thogersen, HC (1984) Generation of bela-globin by sequence-specific proteolysis of a hybrid protein produced in Escherichia coli. Nature 309:810–812.

Nielsen, PE (2001) Targeting double stranded DNA with peptide nucleic acid (PNA). Curr Med Chem 8:545–550.

Okabayashi,K., Nakagawa,Y., Hayasuke,N., Ohi,H., Miura,M., Ishida,Y., Shimizu,M., Murakami,K., Hirabayashi,K., Minamino,H., and . (1991) Secretory expression of the human serum albumin gene in the yeasl, Saccharomyces cerevisiae. J. Biochem.(Tokyo) 110:103-110.

193

Orum, H. and Wengel, J. (2001) Locked nucleic acids: a promising molecular family for gene-function analysis and antisense drug development. Curr Opin.Mol.Ther. 3:239-243.

Padgett,KA and Sorge,JA (1996) Creating seamless junctions independent of restriction sites in PCR cloning. Gene

168:31-35.

Panchal, T. and Wodzinski,RJ (1998) Comparison of glycosylation patterns of phytase from Aspergillus niger (A. ficuum) NRRL 3135 and recombinant phytase. Prep.Biochem.

Biotechnol. 28:201-217.

Pedersen,J., Lauritzen,C., Madsen,MT, and Weis,DS (1999) Removal of N-terminal polyhistidine tags from recombinant proteins using engineered aminopeptidases. Protein Expr.Purif. 15:389-400.

Pomroy,NC and Deber,CM (1998) Solubilization of hydrophobic peptides by reversible cysteine PEGylation. Biochem.Biophys.Res.Commun. 245:618-621.

Raymond,CK (1999) Recombinant protein expression in Pichia methanolica. In Gene expression systems: using nature for the art of expression, JMFernandez and JPHoeffler, eds (San Diego: Academic Press), pp. 193-209.

Rein,A., Ott,DE, Mirro,J., Arthur,LO, Rice,W., and

194

Henderson, L.Ε. (1996) Inactivation of murine leukemia virus by compounds that react with the zinc finger in the viral nucleocapsid protein. J. Virol. 70:4966-4972.

Roggenkamp,R., Hansen,H., Eckart,M., Janowicz,Z., and Hollenberg,CP (1986) Transformation of the methylotrophic yeast Hansenula polymorpha by autonomous replication and integration vectors. Mol Gen Genet 202:302–308.

Rosa,D., Campagnoli,S., Moretto,C., Guenzi,E., Cousens,L., Chin,M., Dong,C., Weiner,AJ, Lau,JY, Choo,QL, Chien,D., Pileri,P., Houghton,M., and Abrignani,S. (1996) A quantitative test to estimate neutralizing antibodies to the hepatitis C virus: cytofluorimetric assessment of envelope glycoprotein 2 binding to target cells. Proc.Natl.

Acad.Sci.USA 93:1759-1763.

Rose,JK and Doms,RW (1988) Regulation of protein export from the endoplasmic reticulum. Annu.Rev.Cell Biol. 4:257288 .

Russell,DW, Smith,M., Williamson,VM, and Young,ET (1983) Nucleotide sequence of the yeast alcohol dehydrogenase II gene. J.Biol.Chem. 258:2674-2682.

Russell, PR (1983) Evolutionary divergence of the mRNA transcription initiation mechanism in yeasl. Nature 301:167169.

195

Russell, PR (1985) Transcription of the triose-phosphateisomerase gene of Schizosaccharomyces pombe initiates from a starting point different from that in Saccharomyces cerevisiae.

Gene 40:125-130.

Russell, PR and Hall, BD (1983) The primary structure of the alcohol dehydrogenase gene from the fission yeast Schizosaccharomyces pombe. J.Biol.Chem. 258:143-149.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory

Press.

Scorer,CA, Clare,JJ, McCombie,WR, Romanos,MA, and Sreekrishna,K. (1994). Rapid selection using G418 of high copy number transformants of Pichia pastoris for high-level foreign gene expression. Biotechnology (NY) 12:181-184.

Singh, R. and Kats, L. (1995) Catalysis of reduction of disulfide by selenol. Anal.Biochem. 232:86-91.

Sohn,JH, Choi,ES, Kang,HA, Rhee,JS, (1999) A family of telomereassociated replicating sequences and their functions recombination in Hansenula polymorpha DL-1.

and Rhee,SK

autonomously in targeted

J.Bacteriol.

181:1005-1013.

Stuyver, L.,

Van

Arnhem,W

Wyseur, A., Hernandez, F.,

196

Delaporte, E. , and Maertens,G. (1994) Classification of hepatitis C viruses based on phylogenetic analysis of the envelope 1 and nonstructural 5B regions and Identification of five additional subtypes. Proc.Natl.Acad.Sei.USA

91:10134-10138 .

<td>Sugrue, RJ.,</td><td>Cui,T., Xu,Q.,</td><td>Fu, J.,</td><td>and Chan, YC (1997</td><td>The</td>

<td>production</td><td>of recombinant</td><td>dengue</td><td>virus E protein</td><td>using</td>

Escherichia coli and Pichia pastoris. J.Virol.Methods

69:159-169.

Thakur, M.L., DeFulvio, J., Richard, M.D., and Park, C.H. (1991)

Technetium-99m labeled monoclonal antibodies: evaluation of reducing agents. Int.J.Rad.Appl.Instrum.B 18:227-233.

Trimble, RB, Atkinson, PH, Tschopp, JF, Townsend, RR, and Maley, F. (1991) Structure of oligosaccharides on Saccharomyces SUC2 invertase secreted by the methylotrophic yeast Pichia pastoris. J.Biol.Chem. 266:22807-22817.

Vingerhoeds,Μ.H., Haisma,HJ, Belliot,SO, Smit,RH, Crommelin,DJ, and Storm,G. (1996) Immunoliposomes as enzyme carriers (immuno-enzymosomes) for antibody-directed enzyme prodrug therapy (ADEPT): optimization of prodrug activating capacity. Pharm.Res. 13:604-610.

Wahlestedt,C., Salmi,P., Good,L., Kela,J., Johnsson,T., Hokfelt,T., Broberger,C., Porreca,F., Lai,J., Ren,K.,

197

Ossipov,M., Koshkin,A., Jakobsen,N., Skouv,J., Oerum,H., Jacobsen,Μ.H., and Wengel,J. (2000) Potent and nontoxic antisense oligonucleotides containing locked nucleic acids.

Proc Natl Acad Sei USA 97:5633-5638.

Weydemann,U., Keup,P., Piontek,M., Strasser,AW, Schweden,J., Gellissen,G., and Janowicz,ZA (1995) High-level secretion of hirudin by Hansenula polymorpha--authentic Processing of three different preprohirudins. Appl.

Microbiol.Biotechnol. 44:377-385.

Young, M., Davies, MJ, Bailey,D., Gradwell, MJ, SmestadPaulsen, B., Wold, JK, Barnes, RMR, Hounsell, E. (1998) Characterization of oligosaccharides from an antigenic mannan of Saccharomyces cerevisiae. Glycoconjugate Journal

15:815-822 .

Zauberman,A., Nussbaum,O., Ilan,E., Eren,R., Ben-Moshe,0.,

Arazi,Y., Berre,S., Lubin,I., Shouval,D., Galun,E., Reisner,Y., and Dagan,S. (1999) The trimera mouse system: a mouse model for hepatitis C infection and evaluation of therapeutic agents. 6th International Symposium on hepatitis C and related viruses. Bethesda June 6-9, 1998.

SEQUENCE LISTING <110> Innogenetics NV

<120> GLYCOSYLATED HCV ENVELOPE PROTEINS IN THE CORE <130> 135 PCT <160> 98 <170> Patent in version 3.1 <210> 1 <211> 18 <212> PRT <213> Avian lysozyme signal peptide <220>

<221> MISCELLANEOUS <222> (2) . . (2) <223> Xaa is Arg, Lys or Vai <220>

<221> MISCELLANEOUS <222> (3) . . (3) <223> Xaa is Ser, Ala, Vai, Arg or Met <220>

<221> MISCELLANEOUS <222> (4) . . (4) <223> Xaa is Leu or Phe <220>

<221> MISCELLANEOUS <222> (5) . . (5) <223> Xaa is Leu or Ala <220>

<221> MISCELLANEOUS <222> (6) . . (6) <223> Xaa is Ile, Thr, Phe or Vai <220>

<221> MISCELLANEOUS <222> (7) . . (7) <223> Xaa is Leu, Phe or Ala <220>

<221> MISCELLANEOUS <222> (8) . . (8) <223> Xaa is Vai, Ile, Ala, Leu or Cys <220>

<221> MISCELLANEOUS <222> (9) . . (9) <223> Xaa is Leu, Phe, Ala or Ile <220>

<221> MISCELLANEOUS <222> (10) . . (10) <223> Xaa is Cys, Phe, Ser or Leu <220>

<221> MISCELLANEOUS <222> (11) . . (11) <223> Xaa is Phe, Leu, Ser or Pro <220>

<221> MISCELLANEOUS <222> (12) . . (12) <223> Xaa is Leu, Ala or Met <220>

<221> MISCELLANEOUS <222> (13) . . (13) <223> Xaa is Pro, Ala or Ile <220>

<221> MISCELLANEOUS

<td> <221></td><td>MISCELLANEOUS</td><td></td>

<220>

<221> MISCELLANEOUS <222> (16) . . (16) <223> Xaa is Ala, Lys or Ser <220>

<221> MISCELLANEOUS <222> (17) . . (17) <223> Xaa is Leu, Pro, Gin or Ile <400> 1

Met Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa

Xaa Gly <210> 2 <211> 135 <212> PRT <213> Hepatitis C virus <400> 2

Tyr Glu Vai Arg Asn Vai Ser Gly Met Tyr His Vai Thr Asn Asp Cys 15 10 15

Ser Asn Ser Ser Ile Vai Tyr Glu Ala Ala Asp Met Ile Met His Thr 20 25 30

Pro Gly Cys Vai Pro Cys Vai Arg Glu Asn Asn Ser Ser Arg Cys Trp 35 40 45

Vai Ala Leu Thr Pro Thr Leu Ala Ala Arg Asn Ala Ser Vai Pro Thr 50 55 60

<td>Cys</td><td>To be</td><td>Allah</td><td>Net</td><td>Tyr</td><td>Go</td><td>Gly</td><td>Asp</td><td>He read</td><td>Cys</td><td>Gly</td><td>Ser Vai Phe Leu</td><td>Go</td>

<td>Cys</td><td>Asn</td><td>Cys</td><td>To be</td><td>Isle</td><td>Tyr</td><td>Pro</td><td>Gly</td><td>His</td><td>Isle</td><td>Thr</td><td>Gly His Arg Met</td><td>Allah</td>

130 135 <210> 3 <211> 290 <212> PRT

<td> <21:</td><td colspan="2">3> Virus</td><td>from 1</td><td colspan="2">hepatitis</td><td>W</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>His</td><td>Thr</td><td>Arg</td><td>Go</td><td>To be</td><td>Gly</td><td>Gly</td><td>Allah</td><td>Allah</td><td>Allah</td><td>To be</td><td>Asp</td><td>Thr</td><td>Arg</td><td>Gly</td><td>He read</td>

<td>Go</td><td>To be</td><td>He read</td><td>Phe</td><td>To be</td><td>Pro</td><td>Gly</td><td>To be</td><td>Allah</td><td>Gin</td><td>Lys</td><td>Isle</td><td>Gin</td><td>He read</td><td>Go</td><td>Asn</td>

<td>Thr</td><td>Asn</td><td>Gly</td><td>To be</td><td>Trp</td><td>His</td><td>Isle</td><td>Asn</td><td>Arg</td><td>Thr</td><td>Allah</td><td>He read</td><td>Asn</td><td>Cys</td><td>Asn</td><td>Asp</td>

<td>To be</td><td>He read</td><td>Gin</td><td>Thr</td><td>Gly</td><td>Phe</td><td>Phe</td><td>Allah</td><td>Allah</td><td>He read</td><td>Phe</td><td>Tyr</td><td>Lys</td><td>His</td><td>Lys</td><td>Phe</td>

<td>Asn</td><td>To be</td><td>To be</td><td>Gly</td><td>Cys</td><td>Pro</td><td>Glu</td><td>Arg</td><td>He read</td><td>Allah</td><td>To be</td><td>Cys</td><td>Arg</td><td>To be</td><td>Isle</td><td>Asp</td>

<td>Lys</td><td>Phe</td><td>Allah</td><td>Gin</td><td>Gly</td><td>Trp</td><td>Gly</td><td>Pro</td><td>He read</td><td>Thr</td><td>Tyr</td><td>Thr</td><td>Glu</td><td>Pro</td><td>Asn</td><td>To be</td>

<td>To be</td><td>Asp</td><td>Gin</td><td>Arg</td><td>Pro</td><td>Tyr</td><td>Cys</td><td>Trp</td><td>His</td><td>Tyr</td><td>Allah</td><td>Pro</td><td>Arg</td><td>Pro</td><td>Cys</td><td>Gly</td>

100 105 110

Ile Vai Pro Ala Ser Gin Vai Cys Gly Pro Vai Tyr Cys Phe Thr Pro 115 120 125

Ser Pro Go Go Go Gly Thr Thr Asp Arg Phe Gly Go Pro Thr Tyr

130 135 140

Asn Trp Gly Ala Asn Asp Ser Asp Vai Leu Ile Leu Asn Asn Thr Arg 145 150 155 160

Pro Pro Arg Gly Asn Trp Phe Gly Cys Thr Trp Met Asn Gly Thr Gly 165 170 175

Phe Thr Lys Thr Cys Gly Gly Pro Pro Cys Asn Ile Gly Gly Ala Gly 180 185 190

Asn Asn Thr Leu Thr Cys Pro Thr Asp Cys Phe Arg Lys His Pro Glu 195 200 205

Ala Thr Tyr Ala Arg Cys Gly Ser Gly Pro Trp Leu Thr Pro Arg Cys 210 215 220

Met Vai His Tyr Pro Tyr Arg Leu Trp His Tyr Pro Cys Thr Vai Asn 225 230 235 240

Phe Thr Ile Phe Lys Vai Arg Met Tyr Vai Gly Gly Vai Glu His Arg 245 250 255

Phe Gin Ala Ala Cys Asn Trp Thr Arg Gly Gin Arg Cys Asp Leu Glu 260 265 270

Asp Arg Asp Arg Ser Gin Leu Ser Pro Leu Leu Leu Ser Thr Thr Gin 275 280 285

Trp Gin 290 <200> 4 <211> 141 <212> PRT <213> Hepatitis C virus <400>4

Tyr Gin Vai Arg Asn Vai Ser Gly Met Tyr His Vai Thr Asn Asp Cys 15 10 15

Ser Asn Ser Ser Ile Vai Tyr Glu Ala Ala Asp Met Ile Met His Thr 20 25 30

<td>Go</td><td>Allah</td><td>He read</td><td>Thr</td><td>Pro</td><td>Thr</td><td>He read</td><td>Allah</td><td>Allah</td><td>Arg</td><td>Asn</td><td>Allah</td><td>To be</td><td>Go</td><td>Pro</td><td>Thr</td>

<td>Thr</td><td>Thr</td><td>Isle</td><td>Arg</td><td>Arg</td><td>His</td><td>Go</td><td>Asp</td><td>He read</td><td>He read</td><td>Go</td><td>Gly</td><td>Allah</td><td>Allah</td><td>Allah</td><td>Phe</td>

<td>Cys</td><td>To be</td><td>Allah</td><td>Met</td><td>Tyr</td><td>Go</td><td>Gly</td><td>Asp</td><td>He read</td><td>Cys</td><td>Gly</td><td>To be</td><td>Go</td><td>Phe</td><td>He read</td><td>Go</td>

<td>Cys</td><td>Asn</td><td>Cys</td><td>To be</td><td>Isle</td><td>Tyr</td><td>Pro</td><td>Gly</td><td>His</td><td>Isle</td><td>Thr</td><td>Gly</td><td>His</td><td>Arg</td><td>Met</td><td>Allah</td>

130 135 140 <210> 5 <211> 301 <212> PRT

<td colspan="3"><213> Virus</td><td colspan="3">hepatitis</td><td colspan="10">W</td>

<td>Asn</td><td>To be</td><td>To be</td><td>Giv</td><td>CVS</td><td>Pro</td><td>Gin</td><td>Arg</td><td>He read</td><td>Allah</td><td>To be</td><td>Cys</td><td>Arg</td><td>To be</td><td>Isle</td><td>Asp</td>

Ser Asp Gin Arg Pro Tyr Cys Trp His Tyr Ala Pro Arg Pro Cys Gly

100 105 110

Ile Vai Pro Ala Ser Gin Vai Cys Gly Pro Vai Tyr Cys Phe Thr Pro 115 120 125

Ser Pro Go Go Go Gly Thr Thr Asp Arg Phe Gly Go Pro Thr Tyr 130 135 140

Asn Trp Gly Ala Asn Asp Ser Asp Vai Leu Ile Leu Asn Asn Thr Arg 145 150 155 160

Pro Pro Arg Gly Asn Trp Phe Gly Cys Thr Trp Met Asn Gly Thr Gly 165 170 175

Phe Thr Lys Thr Cys Gly Gly Pro Pro Cys Asn Ile Gly Gly Ala Gly 180 185 190

Asn Asn Thr Leu Thr Cys Pro Thr Asp Cys Phe Arg Lys His Pro Gin 195 200 205

Ala Thr Tyr Ala Arg Cys Gly Ser Gly Pro Trp Leu Thr Pro Arg Cys 210 215 220

Met Vai His Tyr Pro Tyr Arg Leu Trp His Tyr Pro Cys Thr Vai Asn 225 230 235 240

Phe Thr Ile Phe Lys Vai Arg Met Tyr Vai Gly Gly Vai Gin His Arg 245 250 2S5

Phe Gin Ala Ala Cys Asn Trp Thr Arg Gly Gin Arg Cys Asp Leu Gin 260 26S 270

Asp Arg Asp Arg Ser Glu Leu Ser Pro Leu Leu Leu Ser Thr Thr Gin 275 280 285

Trp Gin Vai Ile Glu Gly Arg His His His His His His 290 295 300 <210> 6 <211> 3448 <212> DNA <213> Vector pGEMTElsH6 <400> 6

<td>aatcactagt</td><td>gcggccgcct</td><td>gcaggtcgac</td><td>catatgggag</td><td>agctcccaac</td><td>gcgttggatg</td><td> 60</td>

<td>catagcttga</td><td>gtattctata</td><td>gtgtcaccta</td><td>aatagcttgg</td><td>cgtaatcatg</td><td>gtcatagctg</td><td> 120</td>

<td>tttcctgtgt</td><td>gaaattgtta</td><td>tccgctcaca</td><td>attccacaca</td><td>acatacgagc</td><td>cggaagcata</td><td> 180</td>

<td>aagtgtaaag</td><td>cctggggtgc</td><td>ctaatgagtg</td><td>agctaactca</td><td>cattaattgc</td><td>gttgcgctca</td><td> 240</td>

<td>ctgcccgctt</td><td>tccagtcggg</td><td>aaacctgtcg</td><td>tgccagctgc</td><td>attaatgaat</td><td>cggccaacgc</td><td> 300</td>

<td>gcggggagag</td><td>ycggtttgcg</td><td>tattgggcgc</td><td>tcttccgctt</td><td>cctcgctcac</td><td>tgactcgctg</td><td> 360</td>

<td>cgctcggtcg</td><td>ttcggctgcg</td><td>gcgagcggta</td><td>tcagctcact</td><td>caaaggcggt</td><td>aatacggtta</td><td> 420</td>

<td>tccacagaat</td><td>cagggataa</td><td>cgcaggaaag</td><td>aacatgtgag</td><td>caaaaggcca</td><td>gcaaaaggcc</td><td> 480</td>

<td>aggaaccgta</td><td>aaaaggccgc</td><td>gttgctggcg</td><td>tttttcgata</td><td>ggctccgccc</td><td>ccctgacgag</td><td> 540</td>

<td>catcacaaaa</td><td>atcgacgctc</td><td>aagtcagagg</td><td>tggcgaaacc</td><td>cgacaggact</td><td>ataaagat</td><td> 600</td>

<td>caggcgtttc</td><td>cccctggaag</td><td>ctccctcgtg</td><td>cgctctcctg</td><td>ttccgaccct</td><td>gccgcttacc</td><td> 660</td>

<td>ggatacctgt</td><td>ccgccttct</td><td>ccccttcggga</td><td>agcgtggcgc</td><td>tttctcatag</td><td>ctcacgctgt</td><td> 720</td>

<td>aggtatctca</td><td>gttcggtgta</td><td>ggtcgttcgc</td><td>tccaagctgg</td><td>gctgtgtgca</td><td>cgaacccccc</td><td> 780</td>

<td>gttcagcccg</td><td>accgctgcgc</td><td>cttatccggt</td><td>aactatcgtc</td><td>ttgagtccaa</td><td>cccggtaaga</td><td> 840</td>

<td>cacgacttat</td><td>cgccactggc</td><td>agcagccact</td><td>ggtaacagga</td><td>ttagcagagc</td><td>gaggtatgta</td><td> 900</td>

<td>gggtgcta</td><td>cagagttctt</td><td>gaagtggtgg</td><td>cctaactacg</td><td>gctacactag</td><td>aaggacagta</td><td> 960</td>

<td>tttggtatct</td><td>gcgctctgct</td><td>gaagccagtt</td><td>accttcggaa</td><td>aaagagttgg</td><td>tagctcttga</td><td> 1020</td>

<td>tccggcaaac</td><td>aaaccaccgc</td><td>tggtagcggt</td><td>ggtttttttg</td><td>tttgcaagca</td><td>gcagattacg</td><td> 1080</td>

<td>cgcagaaaaa</td><td>aaggatctca</td><td>agaagatcct</td><td>ttgatctttt</td><td>ctacggggtc</td><td>tgacgctcag</td><td> 1140</td>

<td>tggaacgaaa</td><td>actcacgtta</td><td>agggattttg</td><td>gtcatgagat</td><td>tatcaaaaag</td><td>gatcttcacc</td><td> 1200</td>

<td>tagatccttt</td><td>taaattaaaa</td><td>atgaagtttt</td><td>aaatcaatct</td><td>aaagtatata</td><td>tgagtaaact</td><td> 1260</td>

tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt 1320

<td>cgttcatcca</td><td>tagttgcctg</td><td>actccccgtc</td><td>gtgtagataa</td><td>ctacgatacg</td><td>ggagggctta</td><td> 1380</td>

<td>ccatctggcc</td><td>ccagtgctgc</td><td>aatgataccg</td><td>cgaaacccac</td><td>gctcaccggc</td><td>tccagatta</td><td> 1440</td>

<td>tcagcaataa</td><td>accagccagc</td><td>cggaagggcc</td><td>gagcgcagaa</td><td>gtggtcctgc</td><td>aactttatcc</td><td> 1500</td>

<td>gcctccatcc</td><td>agtctattaa</td><td>ttgttgccgg</td><td>gaagctagag</td><td>taagtagttc</td><td>gccagttaat</td><td> 1560</td>

<td>agtttgcgca</td><td>acgttgttgg</td><td>cattgctaca</td><td>ggcatcgtgg</td><td>tgtcacgctc</td><td>gtcgtttggt</td><td> 1620</td>

<td>atggcttcat</td><td>tcagctccgg</td><td>ttcccaacga</td><td>tcaaggcgag</td><td>ttacatgatc</td><td>ccccatgttg</td><td> 1680</td>

<td>tgcaaaaaag</td><td>cggttagctc</td><td>cttcggtcct</td><td>ccgatcgttg</td><td>tcagaagtaa</td><td>gttggccgca</td><td> 1740</td>

<td>gtgttatcac</td><td>tcatggttat</td><td>ggcagcactg</td><td>cataattctc</td><td>ttactgtcat</td><td>gccatccgta</td><td> 1800</td>

<td>agatgctttt</td><td>ctgtgactgg</td><td>tgagtactca</td><td>accaagtcat</td><td>tctgagaata</td><td>ccgcgcccgg</td><td> 1860</td>

<td>cgaccgagtt</td><td>gctcttgccc</td><td>ggcgtcaata</td><td>cgggataata</td><td>gtgtatgaca</td><td>tagcagaact</td><td> 1920</td>

<td>ttaaaagtgc</td><td>tcatcattgg</td><td>aaaacgttct</td><td>tcggggcgaa</td><td>aactctcaag</td><td>gatcttaccg</td><td> 1980</td>

<td>ctgttgagat</td><td>ccagttcgat</td><td>gtaacccact</td><td>cgtgcaccca</td><td>actgatcttc</td><td>agcatctttt</td><td> 2040</td>

<td>actttcacca</td><td>gcgtttctgg</td><td>gtgagcaaaa</td><td>acaggaaggc</td><td>aaaatgccgc</td><td>aaaaaaggga</td><td> 2100</td>

<td>ataagggcga</td><td>cacggaaatg</td><td>ttgaatactc</td><td>atactcttcc</td><td>tttttcaata</td><td>ttattgaagc</td><td> 2160</td>

<td>atttatcagg</td><td>gttattgtct</td><td>catgagcgga</td><td>tacatatttg</td><td>aatgtattta</td><td>gaaaaataaa</td><td> 2220</td>

<td>caaatagggg</td><td>ttccgcgcac</td><td>atttccccga</td><td>aaagtgccac</td><td>ctgtatgcgg</td><td>tgtgaaatac</td><td> 2280</td>

<td>cgcacagatg</td><td>cgtaaggaga</td><td>aaataccgca</td><td>tcaggcgaaa</td><td>ttgtaaacgt</td><td>taatattttg</td><td> 2340</td>

<td>ttaaaattcg</td><td>cgttaaatat</td><td>ttgttaaatc</td><td>agctcatttt</td><td>ttaaccaata</td><td>ggccgaaatc</td><td> 2400</td>

<td>ggcaaaatcc</td><td>cttataaatc</td><td>aaaagaatag</td><td>accgagatag</td><td>ggttgagtgt</td><td>tgttccagtt</td><td> 2460</td>

<td>tggaacaaga</td><td>gtccactatt</td><td>aaagaacgtg</td><td>gactccaacg</td><td>tcaaagggcg</td><td>aaaaaccgtc</td><td> 2520</td>

<td>tatcagggcg</td><td>atggcccact</td><td>acgtgaacca</td><td>tcaccaaat</td><td>caagtttttt</td><td>gcggtcgagg</td><td> 2580</td>

<td>tgccgtaaag</td><td>ctctaaatcg</td><td>gaaccctaaa</td><td>gggagccccc</td><td>gatttagagc</td><td>ttgacgggga</td><td> 2640</td>

aagccggcga acgtggcgag aaaggaaggg aagaaagcga aaggagcggg cgctagggcg 2700

<td>ctggcaagtg</td><td>tagcggtcac</td><td>gctgcgcgta</td><td>accaccacac</td><td>ccgccgcgct</td><td>taatgcgccg</td><td> 2760</td>

<td>ctacagggcg</td><td>cgtccattcg</td><td>ccattcaggc</td><td>tgcgcaactg</td><td>ttgggaaggg</td><td>cgatcggtgc</td><td> 2820</td>

<td>gggcctcttc</td><td>gctattacgc</td><td>cagctggcga</td><td>aaggggatg</td><td>tgctgcaagg</td><td>cgattaagtt</td><td> 2880</td>

<td>gggtaacgcc</td><td>aggttttcc</td><td>cagtcacgac</td><td>gttgtaaaac</td><td>gacggccagt</td><td>gaattgtaat</td><td> 2940</td>

<td>acgactcact</td><td>atagggcgaa</td><td>ttgggcccga</td><td>cgtcgcatgc</td><td>tcccggccgc</td><td>catggccgcg</td><td> 3000</td>

<td>ggattccaat</td><td>gcatatgagg</td><td>tgcgcaacgt</td><td>gtccgggatg</td><td>taccatgtca</td><td>cgaacgactg</td><td> 3060</td>

<td>ctccaactca</td><td>agcattgtgt</td><td>atgaggcagc</td><td>ggacatgatc</td><td>atgcacaccc</td><td>ccgggtgcgt</td><td> 3120</td>

<td>gccctgcgtt</td><td>egggagaaca</td><td>actcttcccg</td><td>ctgctgggta</td><td>gcgctcaccc</td><td>ccacgctcgc</td><td> 3180</td>

<td>agctaggaac</td><td>gccagcgtcc</td><td>ccactacgac</td><td>aatacgacgc</td><td>cacgtcgatt</td><td>tgctcgttgg</td><td> 3240</td>

<td>gggctgct</td><td>ttctgttccg</td><td>ctatgtacgt</td><td>gggggatctc</td><td>tgcggatctg</td><td>tcttcctcgt</td><td> 3300</td>

<td>ctcccagctg</td><td>ttcaccatct</td><td>cgcctcgccg</td><td>gcatgagacg</td><td>gtgcaggact</td><td>gcaattgctc</td><td> 3360</td>

<td>aatctatccc</td><td>ggccacataa</td><td>caggtcaccg</td><td>tatggcttgg</td><td>gatatgatga</td><td>tgaactggca</td><td> 3420</td>

<td>ccaccaccat</td><td>caccattaag</td><td>gatccaag</td><td></td><td></td><td></td><td> 3448</td>

<210> 7 <211> 37 <212> DNA <213> Synthetic primer or probe <400> 7 agttactctt caaggtatga ggtgcgcaac gtgtccg 37 <210> 8 <211> 47 <212> DNA <213> Synthetic primer or probe <400> 8 agttactctt cacagggatc ctccttaatg gtgatggtgg tggtgcc <210> 9 <211> 3067 <212> DNA <213> pCHH-Hir vector <400> 9

<td>gcgcccaata</td><td>cgcaaaccgc</td><td>ctctccccgc</td><td>gcgttggccg</td><td>attcattaat</td><td>gcagctggca</td><td> 60</td>

<td>cgacaggttt</td><td>cccgactgga</td><td>aagcgggcag</td><td>tgagcgcaac</td><td>gcaattaatg</td><td>tgagttagct</td><td> 120</td>

<td>catcattag</td><td>gcaccccagg</td><td>ctttacactt</td><td>tatgcttccg</td><td>gctcgtatgt</td><td>tgtgtggaat</td><td> 180</td>

<td>tgtgagcgga</td><td>taacaatttc</td><td>acacaggaaa</td><td>cagctatgac</td><td>catgattacg</td><td>ccaagcttgc</td><td> 240</td>

<td>atgcctgcag</td><td>gtcgacccta</td><td>gatctctatt</td><td>actgcaggta</td><td>tttttccggg</td><td>atttcttcga</td><td> 300</td>

<td>agtcgccgtc</td><td>gttgtgagac</td><td>tgcggacgcg</td><td>gggtaccttc</td><td>gccagtaacg</td><td>cactggttac</td><td> 360</td>

<td>gttcgccttt</td><td>agagcccagg</td><td>atgcatttgt</td><td>tgccctggcc</td><td>gcaaacgtta</td><td>gagccttcgc</td><td> 420</td>

<td>acaggcacag</td><td>gttctgaccg</td><td>gattcagtgc</td><td>agtcagtgta</td><td>aacaaccctc</td><td>ttttccaacg</td><td> 480</td>

<td>ggtgtgtagt</td><td>tccattctcc</td><td>accgctaggg</td><td>ctgcgctggg</td><td>ctccattggc</td><td>gaggttttca</td><td> 540</td>

<td>aggccgctag</td><td>gatgcgatcc</td><td>atgcgtccgt</td><td>agccttgcgt</td><td>ggagcgtgcg</td><td>tgtgcgtgcg</td><td> 600</td>

<td>ggagtgcgca</td><td>taggtaggct</td><td>acggtgatga</td><td>ttgctagcat</td><td>ggggaata</td><td>gttttgctat</td><td> 660</td>

<td>acatgaattc</td><td>actggccgtc</td><td>gttttacaac</td><td>gtcgtgactg</td><td>ggaaaaccct</td><td>ggcgttaccc</td><td> 720</td>

<td>aacttaatcg</td><td>ccttgcagca</td><td>catccccctt</td><td>tcgccagctg</td><td>gcgtaatagc</td><td>gaagaggccc</td><td> 780</td>

<td>gcaccgatcg</td><td>cccttcccaa</td><td>cagttgcgca</td><td>gcctgaatgg</td><td>cgaatggcgc</td><td>ctgatgcggt</td><td> 840</td>

<td>gttttctcct</td><td>tacgcatctg</td><td>tgcggtattt</td><td>cacaccgcat</td><td>atggtgcact</td><td>ctcagtacaa</td><td> 900</td>

<td>tctgctctga</td><td>tgccgcatag</td><td>ttaagccagc</td><td>cccgacaccc</td><td>gccaacaccc</td><td>gctgacgcgc</td><td> 960</td>

<td>cttagacgggc</td><td>ttatctgctc</td><td>ccggcatccg</td><td>cttacagaca</td><td>agctgtgacc</td><td>gtctccggga</td><td> 1020</td>

<td>gctgcatgtg</td><td>tcagaggttt</td><td>tcaccgtcat</td><td>caccgaaacg</td><td>cgcgagacga</td><td>aagggcctcg</td><td> 1080</td>

<td>tgatacgcct</td><td>atttttatag</td><td>gttaatgtca</td><td>tgataataat</td><td>ggtttcttag</td><td>acgtcaggtg</td><td> 1140</td>

gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atatttcaa 1200

<td>atatgtatcc</td><td>gctcatgaga</td><td>caataaccct</td><td>gataaatgct</td><td>tcaataatat</td><td>tgaaaaagga</td><td> 1260</td>

<td>agagtatgag</td><td>tattcaacat</td><td>ttccgtgtcg</td><td>cccttattcc</td><td>cttttttgcg</td><td>gcattttgcc</td><td> 1320</td>

<td>ttcctgtttt</td><td>tgctcaccca</td><td>gaaacgctgg</td><td>tgaaagtaaa</td><td>agatgctgaa</td><td>gatcagttgg</td><td> 1380</td>

<td>gtgcacgagt</td><td>gggttacatc</td><td>gaactggatc</td><td>tcaacagcgg</td><td>taagatcctt</td><td>gagagttttc</td><td> 1440</td>

<td>gccccgaaga</td><td>acgttttcca</td><td>atgatgagca</td><td>cttttaaagt</td><td>tctgctatgt</td><td>ggcgcggtat</td><td> 1500</td>

<td>tatcccgtat</td><td>tgacgccggg</td><td>caagagcaac</td><td>tcggtcgccg</td><td>catacactat</td><td>tctcagaatg</td><td> 1560</td>

<td>acttggttga</td><td>gtactcacca</td><td>gtcacagaaa</td><td>agcatcttac</td><td>ggatggcatg</td><td>acagtaagag</td><td> 1620</td>

<td>aattatgcag</td><td>tgctgccata</td><td>accattagtg</td><td>ataacactgc</td><td>ggccaactta</td><td>cttctgacaa</td><td> 1680</td>

<td>cgatcggagg</td><td>accgaaggag</td><td>ctaaccgctt</td><td>ttttgcacaa</td><td>catgggggat</td><td>catgtaactc</td><td> 1740</td>

<td>gccttgatcg</td><td>ttgggaaccg</td><td>gagctgaatg</td><td>aagccatacc</td><td>aaacgacgag</td><td>cgtgacacca</td><td> 1800</td>

<td>cgatgcctgt</td><td>agcaatggca</td><td>acaacgttgc</td><td>gcaaactatt</td><td>aactggcgaa</td><td>ctacttactc</td><td> 1860</td>

<td>tagcttcccg</td><td>gcaacaatta</td><td>atagactgga</td><td>tggaggcgga</td><td>taaagttgca</td><td>ggaccacttc</td><td> 1920</td>

<td>tgcgctcggc</td><td>ccttccggct</td><td>ggctggtta</td><td>ttgctgataa</td><td>atctggagcc</td><td>ggtgagcgtg</td><td> 1980</td>

<td>ggtctcgcgg</td><td>tatcattgca</td><td>gcactggggc</td><td>cagatggtaa</td><td>gccctcccgt</td><td>atcgtagtta</td><td> 2040</td>

<td>tctacacgac</td><td>gggagtcag</td><td>gcaactatgg</td><td>atgaacgaaa</td><td>tagacagatc</td><td>gctgagatag</td><td> 2100</td>

<td>gtgcctcact</td><td>gattaagcat</td><td>tggtaactgt</td><td>cagaccaagt</td><td>ttactcatat</td><td>atactttaga</td><td> 2160</td>

<td>ttgattaaa</td><td>acttcatttt</td><td>taatttaaaa</td><td>ggatctaggt</td><td>gaagatcctt</td><td>tttgataatc</td><td> 2220</td>

<td>tcatgaccaa</td><td>aatcccttaa</td><td>cgtgagtttt</td><td>cgttccactg</td><td>agcgtcagac</td><td>cccgtagaaa</td><td> 2280</td>

<td>agatcaaagg</td><td>atctttctga</td><td>gatccttttt</td><td>ttctgcgcgt</td><td>aatctgctgc</td><td>ttgcaaacaa</td><td> 2340</td>

<td>aaaaaccacc</td><td>gctaccagcg</td><td>gtggtttgtt</td><td>tgccggatca</td><td>agagctacca</td><td>actctttttc</td><td> 2400</td>

<td>cgaaggtaac</td><td>tggcttcagc</td><td>agagcgcaga</td><td>taccaaatac</td><td>tgtccttcta</td><td>gtgtagccgt</td><td> 2460</td>

<td>agttaggcca</td><td>ccacttcaag</td><td>aactctgtag</td><td>caccgcctac</td><td>atacctcgct</td><td>ctgctaatcc</td><td> 2520</td>

tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac 2580

<td>gatagttacc</td><td>ggataaggcg</td><td>cagcggtcgg</td><td>gctgaacagg</td><td>gggttcgtgc</td><td>acacagccca</td><td> 2640</td>

<td>gcttggagcg</td><td>aacaacctac</td><td>accgaactga</td><td>gatacctaca</td><td>gcytgagcta</td><td>tgagaaagcg</td><td> 2700</td>

<td>ccacgcttcc</td><td>cgaagggaga</td><td>aaggcggaca</td><td>ggtatccggt</td><td>aagcggcagg</td><td>gtcggaacag</td><td> 2760</td>

<td>gagagcgcac</td><td>gagggagctt</td><td>ccagggggaa</td><td>acgcctggta</td><td>tctttatagt</td><td>cctgtcgggt</td><td> 2820</td>

<td>ttcgccacct</td><td>ctgacttgag</td><td>cgtcgatttt</td><td>tgtgatgctc</td><td>gtcagggggg</td><td>cggagcctat</td><td> 2880</td>

<td>ggaaaaacgc</td><td>cagcaacgcg</td><td>gccttttac</td><td>ggttcctggc</td><td>cttttgctgg</td><td>ccttttgctc</td><td> 2940</td>

<td>acatgttctt</td><td>tcctgcgtta</td><td>tcccctgatt</td><td>ctgtggataa</td><td>ccgtattacc</td><td>gcctttgagt</td><td> 3000</td>

<td>gagctgatac</td><td>cgctcgccgc</td><td>agccgaacga</td><td>ccgagcgcag</td><td>cgagtcagtg</td><td>agcgaggaag</td><td> 3060</td>

cggaaga 3067 <210> 10 <211> 35 <212> DNA <213> Synthetic primer or probe <400> 10 agttactctt cacctctttt ccaacgggtg tgtag 35 <210> 11 <211> 34 <212> DNA <213> Synthetic primer or probe <400> 11 agtcactctt cactgcaggc atgcaagctt ggcg 34 <210> 12 <211> 6973 <212> DNA <213> Vector pFPMT121 <400> 12 ggtaccctgc tcaatctccg gaatggtgat ctgatcgttc ctgaaaacct cgacattggc 60

<td>tccctcctga</td><td>cacaggtact</td><td>cgtacaggtt</td><td>ccaggtaaac</td><td>gagtcgtagt</td><td>tgtcgatcat</td><td> 120</td>

<td>gacaacgttc</td><td>ttagaagcgg</td><td>ccggcatttt</td><td>gaaggtgact</td><td>aatagcctaa</td><td>gaaaatattt</td><td> 180</td>

<td>aatttaattt</td><td>tcattaaatt</td><td>ttcctatact</td><td>cgctatttca</td><td>gcttttcatc</td><td>tcatcacttc</td><td> 240</td>

<td>ataaacgata</td><td>taaaccagaa</td><td>aaagaactat</td><td>tttcaaacac</td><td>gcttctcaaa</td><td>agcggtatgt</td><td> 300</td>

<td>ccttccacgt</td><td>ctccttagaa</td><td>tctggcaagt</td><td>ccgcgagggg</td><td>gatccagatc</td><td>tgaattcccg</td><td> 360</td>

<td>atgaagcaga</td><td>gagcgcagga</td><td>gggtattt</td><td>atagtgccat</td><td>tcccctctct</td><td>gagagacccg</td><td> 420</td>

<td>gatggtagtc</td><td>gagtgtatcg</td><td>gagacagctt</td><td>gagtagact</td><td>ccgtgcctgc</td><td>cggctcctct</td><td> 480</td>

<td>tattggcgga</td><td>caccagtgag</td><td>acaccccgga</td><td>acttgctgtt</td><td>tttctgcaaa</td><td>atccggggtg</td><td> 540</td>

<td>accagtggga</td><td>gcctatttgc</td><td>acacacgagc</td><td>gggacacccc</td><td>actctggtga</td><td>agagtgccaa</td><td> 600</td>

<td>agtcattttt</td><td>tttccgttg</td><td>cggggcagcc</td><td>gattgcatgt</td><td>tttaggaaaa</td><td>tattaccttt</td><td> 660</td>

<td>gctacaccct</td><td>gtcagatta</td><td>ccctccacac</td><td>atatatattc</td><td>cgtcacctcc</td><td>agggactatt</td><td> 720</td>

<td>attcgtcgtt</td><td>gcgccgccag</td><td>cggaagatat</td><td>ccagaagctg</td><td>ttttccgaga</td><td>gactcggttg</td><td> 780</td>

<td>gcgcctggta</td><td>tatttgatgg</td><td>atgtcgcgct</td><td>gcctcacgtc</td><td>ccggtaccca</td><td>ggaacgcggt</td><td> 840</td>

<td>gggatctcgg</td><td>gcccatcgaa</td><td>gactgtgctc</td><td>cagactgctc</td><td>gcccagcagg</td><td>tgtttcttga</td><td> 900</td>

<td>tcgccgcctc</td><td>taaattgtcc</td><td>gcgcatcgcc</td><td>ggtaacattt</td><td>ttccagctcg</td><td>gagtttgcgt</td><td> 960</td>

<td>ttagatacag</td><td>tttctgcgat</td><td>gccaaaggag</td><td>cctgcagatt</td><td>ataacctcgg</td><td>atgctgtcat</td><td> 1020</td>

<td>tcagcgcttt</td><td>taatttgacc</td><td>tccagatagt</td><td>tgctgtattt</td><td>ctgttcccat</td><td>tggctgctgc</td><td> 1080</td>

<td>gcagcttcgt</td><td>ataactcgag</td><td>ttattgttgc</td><td>gctctgcctc</td><td>ggcgtactgg</td><td>ctcatgatct</td><td> 1140</td>

<td>agatcttatc</td><td>cgtgtcgctt</td><td>ttcttcgagt</td><td>gtttctcgca</td><td>aacgatgtgc</td><td>acggcctgca</td><td> 1200</td>

<td>gtgtccaatc</td><td>ggagtcgagc</td><td>tggcgccgaa</td><td>actggcggat</td><td>ctgagcctcc</td><td>acactgccct</td><td> 1260</td>

<td>gtttctctat</td><td>ccacggcgga</td><td>accgcctcct</td><td>gccgtttcag</td><td>aatgttgttc</td><td>aagtggtact</td><td> 1320</td>

<td>ctgtgcggtc</td><td>aatgaaggcg</td><td>ttattgccgg</td><td>tgaaatcttt</td><td>gggaagcggt</td><td>tttcctcggg</td><td> 1380</td>

gaagattacg aaattccccg cgtcgttgcg cttcctggat ctcgaggaga tcgttctccg 1440

<td>cgtcgaggag</td><td>atcgttctcc</td><td>gcgtcgacac</td><td>cattccttgc</td><td>gggcggcggtg</td><td>ctcaacggcc</td><td> 1500</td>

<td>tcaacctact</td><td>actgggctgc</td><td>ttcctaatgc</td><td>aggagtcgca</td><td>taagggagag</td><td>cgtcgacaaa</td><td> 1560</td>

<td>cccgcgtttg</td><td>agaacttgct</td><td>caagcttctg</td><td>gtaaacgttg</td><td>tagtactctg</td><td>aaacaaggcc</td><td> 1620</td>

<td>ctagcactct</td><td>gatctgtttc</td><td>tcttgggtag</td><td>cggtgagtgg</td><td>tttattggag</td><td>ttcactggtt</td><td> 1680</td>

<td>tcagcacatc</td><td>tgtcatctag</td><td>acaatattgt</td><td>tactaaattt</td><td>ttttgaacta</td><td>caattgttcg</td><td> 1740</td>

<td>taattcatct</td><td>attattatac</td><td>atcctcgtca</td><td>gcaatttctg</td><td>gcagacggag</td><td>tttactaacg</td><td> 1800</td>

<td>tcttgagtat</td><td>gaggccgaga</td><td>atccagctct</td><td>gtggocatac</td><td>tcagtcttga</td><td>cagcctgctg</td><td> 1860</td>

<td>atgtggctgc</td><td>gttcaacgca</td><td>ataagcgtgt</td><td>cctccgactc</td><td>cgagttgtgc</td><td>tcgttatcgt</td><td> 1920</td>

<td>cgttctcatc</td><td>ctcggaaaaa</td><td>tcacacgaaa</td><td>gaacatactc</td><td>accagtaggc</td><td>tttctggtcc</td><td> 1980</td>

<td>ctggggcacg</td><td>gctgtttctg</td><td>acgtattccg</td><td>gcgttgataa</td><td>tagctcgaaa</td><td>gtgaacgccg</td><td> 2040</td>

<td>agtcgcggga</td><td>gtcgaccgat</td><td>gcccttgaga</td><td>gccttcaacc</td><td>cagtcagctc</td><td>cttccggtgg</td><td> 2100</td>

<td>gcgcggggca</td><td>tgactatcgt</td><td>cgccgcactt</td><td>atgactgtct</td><td>tctttatcat</td><td>gcaactcgta</td><td> 2160</td>

<td>ggacaggtgc</td><td>cggcagcgct</td><td>ctgggtcatt</td><td>ttcggcgagg</td><td>accgctttcg</td><td>ctggagcgcg</td><td> 2220</td>

<td>acgatgatcg</td><td>gcctgtcgct</td><td>tggtattc</td><td>ggaatcttgc</td><td>acgccctcgc(</td><td>, tcaagccttc</td><td> 2280</td>

<td>gtcactggtc</td><td>ccgccaccaa</td><td>acytttcggc</td><td>gagaagcagg</td><td>ccattatcgc</td><td>cggcatggcg</td><td> 2340</td>

<td>gccgacgcgc</td><td>tgggctacgt</td><td>cttgctggcg</td><td>ttcgcgacgc</td><td>gaggctggat</td><td>ggccttcccc</td><td> 2400</td>

<td>attatgattc</td><td>ttctcgcttc</td><td>cggcggcatc</td><td>gggatgcccg</td><td>cgttgcaggc</td><td>catgctgtcc</td><td> 2460</td>

<td>aggcaggtag.</td><td>atgacgacca</td><td>tcagggacag</td><td>cttcaaggat</td><td>cgctcggc</td><td>tcttaccagc</td><td> 2520</td>

<td>ctaacttcga</td><td>tcactggacc</td><td>gctgatcgtc</td><td>acggcgattt</td><td>atgccgcctc</td><td>ggcgagcaca</td><td> 2580</td>

<td>tggaacgggt</td><td>tggcatggat</td><td>tgtagggcgcc</td><td>gccctatacc</td><td>ttgtctgcct</td><td>ccccgcgttg</td><td> 2640</td>

<td>cgtcggtg</td><td>catggagccg</td><td>ggccacctcg</td><td>actgaatgg</td><td>aagccggcgg</td><td>cacctcgcta</td><td> 2700</td>

<td>acggattcac</td><td>cactccaaga</td><td>attggagcca</td><td>atcaattctt</td><td>gcggagaact</td><td>gtgaatgcgc</td><td> 2760</td>

aaaccaaccc ttggcagaac atatccatcg cgtccgccat ctccagcagc cgcacgcggc 2820

<td>gcatcgggg</td><td>ggggggggg</td><td>gggggggggc</td><td>aaacaattca</td><td>tcattttttt</td><td>tttattcttt</td><td> 2880</td>

<td>tttttgattt</td><td>cggtttcttt</td><td>gaaatttttt</td><td>tgattcggta</td><td>atctccgaac</td><td>agaaggaaga</td><td> 2940</td>

<td>acgaaggaag</td><td>gagcacagac</td><td>ttagattggt</td><td>atatatacgc</td><td>atatgtagtg</td><td>ttgaagaaac</td><td> 3000</td>

<td>atgaaattgc</td><td>ccagtattct</td><td>taacccaact</td><td>gcacagaaca</td><td>aaaacctgca</td><td>ggaaacgaag</td><td> 3060</td>

<td>ataaatcatg</td><td>tcgaaagcta</td><td>catataagga</td><td>acgtgctgct</td><td>actcatccta</td><td>gtcctgttgc</td><td> 3120</td>

<td>tgccaagcta</td><td>tttaatatca</td><td>tgcacgaaaa</td><td>gcaaacaaac</td><td>ttgtgtgctt</td><td>cattggatgt</td><td> 3180</td>

<td>tcgtaccacc</td><td>aaggaattac</td><td>tggagttagt</td><td>tgaagcatta</td><td>ggtcccaaaa</td><td>tttgtttact</td><td> 3240</td>

<td>aaaaacacat</td><td>gtggatatct</td><td>tgactgattt</td><td>ttccatggag</td><td>ggcacagtta</td><td>agccgctaaa</td><td> 3300</td>

<td>ggcattatcc</td><td>gccaagtaca</td><td>attention</td><td>cttcgaagac</td><td>agaaaatttg</td><td>ctgacattgg</td><td> 3360</td>

<td>taatacagtc</td><td>aaattgcagt</td><td>actctgcggg</td><td>tgtatacaga</td><td>atagcagaat</td><td>gggcagacat</td><td> 3420</td>

<td>tacgaatgca</td><td>cacggtgtgg</td><td>tggggcccagg</td><td>tattgttagc</td><td>ggtttgaagc</td><td>aggcggcaga</td><td> 3480</td>

<td>agaagtaaca</td><td>aaggaaccta</td><td>gaggcctttt</td><td>gatgttagca</td><td>gaattgtcat</td><td>gcaagggctc</td><td> 3540</td>

<td>cctatctact</td><td>ggagaatata</td><td>ctaagggtac</td><td>tgttgacatt</td><td>gcgaagagcg</td><td>acaaagattt</td><td> 3600</td>

<td>tgttatcggc</td><td>tttattgctc</td><td>aaagagacat</td><td>gggtggaaga</td><td>gatgaaggtt</td><td>acgattggtt</td><td> 3660</td>

<td>gattatgaca</td><td>cccggtgtgg</td><td>gtttagatga</td><td>caagggagac</td><td>gcattgggtc</td><td>aacagtatag</td><td> 3720</td>

<td>aaccgtggat</td><td>gatgtggtct</td><td>ctacaggatc</td><td>tgacattatt</td><td>attgttggaa</td><td>gaggactatt</td><td> 3780</td>

<td>tgcaaaggga</td><td>agggatgcta</td><td>aggtagaggg</td><td>tgaacgttac</td><td>agaaaagcag</td><td>gctgggaagc</td><td> 3840</td>

<td>atatttgaga</td><td>agatgggcc</td><td>agcaaaacta</td><td>aaaaactgta</td><td>ttataagtaa</td><td>atgcatgtat</td><td> 3900</td>

<td>actaaactca</td><td>caaattagag</td><td>cttcaattta</td><td>attatatcag</td><td>ttattacccg</td><td>ggaatctcgg</td><td> 3960</td>

<td>tcgtaatgat</td><td>ttttataatg</td><td>acgaaaaaaa</td><td>aaaaattgga</td><td>aagaaaagcc</td><td>cccccccccc</td><td> 4020</td>

<td>cccccccccc</td><td>cccccccccc</td><td>ccgcagcgtt</td><td>gggtcctggc</td><td>cacgggtgcg</td><td>catgatcgtg</td><td> 4080</td>

<td>ctcctgtcgt</td><td>tgaggacccg</td><td>gctaggctgg</td><td>cggggttgcc</td><td>ttactggtta</td><td>gcagaatgaa</td><td> 4140</td>

tcaccgatac gcgagcgaac gtgaagcgac tgctgctgca aaacgtctgc gacctgagca 4200

<td>acaacatgaa</td><td>tggtcttcag</td><td>tttccgtgtt</td><td>tcgtaaagtc</td><td>tggaaacgcg</td><td>gaagtcagcg</td><td> 4260</td>

<td>ccctgcacca</td><td>ttatgttccg</td><td>gatctgcatc</td><td>gcaggatgct</td><td>gctggctacc</td><td>ctgtggaaca</td><td> 4320</td>

<td>cctacatctg</td><td>tattaacgaa</td><td>gcgctggcat</td><td>tgaccctgag</td><td>tgattttttct</td><td>ctggtcccgc</td><td> 4380</td>

<td>cacatccaba</td><td>ccgccagttg</td><td>tttaccctca</td><td>caacgttcca</td><td>gtaaccgggc</td><td>atgttcatca</td><td> 4440</td>

<td>tcagtaaccc</td><td>gtatcgtgag</td><td>catcctctct</td><td>cgtttcatcg</td><td>gtatcattac</td><td>ccccatgaac</td><td> 4500</td>

<td>agaaattccc</td><td>ccttacacgg</td><td>aggcatcaag</td><td>tgaccaaaca</td><td>ggaaaaaacc</td><td>gcccttaaca</td><td> 4560</td>

<td>tggcccgctt</td><td>tatcagaagc</td><td>cagacattaa</td><td>cgcttctgga</td><td>gaaactcaac</td><td>gagctggacg</td><td> 4620</td>

<td>cggatgaaca</td><td>ggcagacatc</td><td>tgtgaatcgc</td><td>ttcacgacca</td><td>cgctgatgag</td><td>ctttaccgca</td><td> 4680</td>

<td>gctgcctcgc</td><td>gcgtttcggt</td><td>gatgacggtg</td><td>aaaacctctg</td><td>acacatgcag</td><td>ctcccggaga</td><td> 4740</td>

<td>cggtcacagc</td><td>ttgtctgtaa</td><td>gcggatgccg</td><td>ggagcagaca</td><td>agcccgtcag</td><td>ggcgcgtcag</td><td> 4800</td>

<td>cgggtgttgg</td><td>cgggtgtcgg</td><td>ggcgcagcca</td><td>tgacccagtc</td><td>acgtagcgat</td><td>agcggagtgt</td><td> 4860</td>

<td>atactggctt</td><td>aactatgcgg</td><td>catcagagca</td><td>gattgtactg</td><td>agagtgcacc</td><td>atatgcggtg</td><td> 4920</td>

<td>tgaaataccg</td><td>cacagatgcg</td><td>taaggagaaa</td><td>ataccgcatc</td><td>aggcgctctt</td><td>ccgcttcctc</td><td> 4980</td>

<td>gctcactgac</td><td>tcgctgcgct</td><td>cggtcgttcg</td><td>gctgcggcga</td><td>gcggtatcag</td><td>ctcactcaaa</td><td> 5040</td>

<td>gggtaata</td><td>cggttatcca</td><td>cagaatcagg</td><td>ggataacgca</td><td>ggaaagaaca</td><td>tgtgagcaaa</td><td> 5100</td>

<td>aggccagcaa</td><td>aaggccagga</td><td>accgtaaaaa</td><td>ggccgcgttg</td><td>ctggcgtttt</td><td>tccataggct</td><td> 5160</td>

<td>ccgcccccct</td><td>gacgagcatc</td><td>acaaaaatcg</td><td>acgctcaagt</td><td>cagaggtggc</td><td>gaaacccgac</td><td> 5220</td>

<td>aggactataa</td><td>agataccagg</td><td>cgttttccccc</td><td>tggaagctcc</td><td>ctcgtgcgct</td><td>ctcctgttcc</td><td> 5280</td>

<td>gaccctgccg</td><td>cttaccggat</td><td>acctccgc</td><td>ctttctccct</td><td>tcgggaagcg</td><td>tggcgctttc</td><td> 5340</td>

<td>tcatagctca</td><td>cgctgtaggt</td><td>atctcagttc</td><td>ggtgtaggtc</td><td>gttcgctcca</td><td>agctgggctg</td><td> 5400</td>

<td>tgtgcacgaa</td><td>ccccccgttc</td><td>agccgaccg</td><td>ctgcgcctta</td><td>tccggtaact</td><td>atcgtcttga</td><td> 5460</td>

<td>gtccaaccg</td><td>gtaagacacg</td><td>acttatcgcc</td><td>actggcagca</td><td>gccactggta</td><td>acaggattag</td><td> 5520</td>

cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta 5580

<td>cactagaagg</td><td>acagtatttg</td><td>gtatctgcgc</td><td>tctgctgaag</td><td>ccagttacct</td><td>tcggaaaaag</td><td> 5640</td>

<td>agttggtagc</td><td>tcttgatccg</td><td>gcaaacaaac</td><td>caccgctggt</td><td>agcggtggtt</td><td>tttttgtttg</td><td> 5700</td>

<td>caagcagcag</td><td>attacgcgca</td><td>gaaaaaaagg</td><td>atctcaagaa</td><td>gatcctttga</td><td>tctttttctac</td><td> 5760</td>

<td>ggggtctgac</td><td>gctcagtgga</td><td>acgaaaactc</td><td>acgttaaggg</td><td>atttggtca</td><td>tgagattatc</td><td> 5820</td>

<td>aaaaaggatc</td><td>ttcacctaga</td><td>tccttttaaa</td><td>ttaaaaatga</td><td>agttttaaat</td><td>caatctaaag</td><td> 5880</td>

<td>tatatatgag</td><td>taaacttggt</td><td>ctgacagtta</td><td>ccaatgctta</td><td>atcagtgagg</td><td>cacctatctc</td><td> 5940</td>

<td>agcgatctgt</td><td>ctatttcgtt</td><td>catccatagt</td><td>tgcctgactc</td><td>cccgtcgtgt</td><td>agataactac</td><td> 6000</td>

<td>gatacgggag</td><td>ggcttaccat</td><td>ctggccccag</td><td>tgctgcaatg</td><td>ataccgcgag</td><td>acccacgctc</td><td> 6060</td>

<td>accggctcca</td><td>gatttatcag</td><td>caataaacca</td><td>gccagccgga</td><td>agggccgagc</td><td>gcagaagtgg</td><td> 6120</td>

<td>tcctgcaact</td><td>ttatccgcct</td><td>ccatccagtc</td><td>tattaattgt</td><td>tgccgggaag</td><td>ctatagtaag</td><td> 6180</td>

<td>tagttcgcca</td><td>gttaatagtt</td><td>tgcgcaacgt</td><td>tgttgccatt</td><td>gctgcaggca</td><td>tcgtggtgtc</td><td> 6240</td>

<td>acgctcgtcg</td><td>tttggtatgg</td><td>cttcattcag</td><td>ctccggttcc</td><td>caacgatcaa</td><td>ggcgagttac</td><td> 6300</td>

<td>atgatccccc</td><td>atgttgtgca</td><td>aaaaagcggt</td><td>tagctccttc</td><td>ggtcctccga</td><td>tcgttgtcag</td><td> 6360</td>

<td>aagtaagttg</td><td>gccgcagtgt</td><td>tatcactcat</td><td>ggttatggca</td><td>gcactgcata</td><td>attctcttac</td><td> 6420</td>

<td>tgtcatgcca</td><td>tccgtaagat</td><td>gcttttctgt</td><td>gactggtgag</td><td>tactcaacca</td><td>agtcattctg</td><td> 6480</td>

<td>agaatagtgt</td><td>atgcggcgac</td><td>cgagttgctc</td><td>ttgcccggcg</td><td>tcaacacggg</td><td>ataataccgc</td><td> 6540</td>

<td>gccacatagc</td><td>agaactttaa</td><td>aagtgctcat</td><td>cattggaaaa</td><td>cgttcttcgg</td><td>ggggaaaact</td><td> 6600</td>

<td>ctcaaggatc</td><td>ttaccgctgt</td><td>tgagatccag</td><td>ttcgatgtaa</td><td>cccactcgtg</td><td>cacccaactg</td><td> 6660</td>

<td>atcttcagca</td><td>tcttttactt</td><td>tcaccagcgt</td><td>ttctgggtga</td><td>gcaaaaacag</td><td>gaaggcaaaa</td><td> 6720</td>

<td>tgccgcaaaa</td><td>aagggaataa</td><td>gggcgacacg</td><td>gaaatgttga</td><td>attackcatac</td><td>tcttcctttt</td><td> 6780</td>

<td>tcaatattat</td><td>tgaagcattt</td><td>atcagggtta</td><td>ttgtctcatg</td><td>agcggataca</td><td>tatttgaatg</td><td> 6840</td>

tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga 6900

<td>cgtctaagaa</td><td>accattatta</td><td>tcatgacatt</td><td>aacctataaa</td><td>aataggcgta</td><td>tcacgaggcc</td><td> 6960</td>

<td>ctttcgtctt</td><td>caa</td><td></td><td></td><td></td><td></td><td> 6973</td>

<td colspan="2"><210> 13 <211> 7591 <212> DNA <213> pFPMT-CHH- vector</td><td>-E1H6</td><td></td><td></td><td></td><td></td>

<td><400> 13 ggtaccctgc</td><td>tcaatctccg</td><td>gaatggtgat</td><td>ctgatcgttc</td><td>ctgaaaacct</td><td>cgacattggc</td><td> 60</td>

<td>tccctcctga</td><td>cacaggtact</td><td>cgtacaggtt</td><td>ccaggtaaac</td><td>gagtcgtagt</td><td>tgtcgatcat</td><td> 120</td>

<td>gacaacgttc</td><td>ttagaagcgg</td><td>ccggcatttt</td><td>gaaggtgact</td><td>aatagcctaa</td><td>gaaaatattt</td><td> 180</td>

<td>aatttaattt</td><td>tcattaaatt</td><td>ttcctatact</td><td>cgctatttca</td><td>gcttttcatc</td><td>tcatcacttc</td><td> 240</td>

<td>ataaacgata</td><td>taaaccagaa</td><td>aaagaactat</td><td>tttcaaacac</td><td>gcttctcaaa</td><td>agcggtatgt</td><td> 300</td>

<td>ccttccacgt</td><td>ctccttagaa</td><td>tctggcaagt</td><td>ccgcgagggg</td><td>gatccttaat</td><td>ggtgatggtg</td><td> 360</td>

<td>gtggtgccag</td><td>ttcatcatca</td><td>tatcccaagc</td><td>catacggtga</td><td>cctgttatgt</td><td>ggccgggata</td><td> 420</td>

<td>gattgagcaa</td><td>ttgcagtcct</td><td>gcaccgtctc</td><td>atgccggcga</td><td>ggcgagatgg</td><td>tgaacagctg</td><td> 480</td>

<td>ggagacgagg</td><td>aagacagatc</td><td>cgcagagatc</td><td>ccccacgtac</td><td>atagcggaac</td><td>agaaagcagc</td><td> 540</td>

<td>cgccccaacc</td><td>agcaaatcga</td><td>cgtggcgtcg</td><td>tattgtcgta</td><td>gtggggacgc</td><td>tggcgttcct</td><td> 600</td>

<td>agctgcgagc</td><td>gtgggggtga</td><td>gcgctaccca</td><td>gcagcgggaa</td><td>gagttgttct</td><td>cccgaacgca</td><td> 660</td>

<td>gggcacgcac</td><td>ccgggggtgt</td><td>gcatgatcat</td><td>gtccgctgcc</td><td>tcatacacaa</td><td>tgcttgagtt</td><td> 720</td>

<td>ggagcagtcg</td><td>ttcgtgacat</td><td>ggtacatccc</td><td>ggacacgttg</td><td>cgcacctcat</td><td>acctcttttc</td><td> 780</td>

<td>caacgggtgt</td><td>gtagttccat</td><td>tctccaccgc</td><td>tagggctgcg</td><td>ctgguctcca</td><td>ttggcgaggt</td><td> 840</td>

<td>tttcaaggcc</td><td>gctaggatgc</td><td>gatccatgcg</td><td>tccgtagcct</td><td>tgcgtggagc</td><td>gtgcgtgtgc</td><td> 900</td>

<td>gtgcgggagt</td><td>gcgcataggt</td><td>aggctacggt</td><td>gatgattgct</td><td>agcatggcgg</td><td>gaatagtttt</td><td> 960</td>

gctatacatg aattcccgat gaagcagaga gcgcaggagg cggtatttat agtgccattc 1020 ccctctctga gagacccgga tggtagtcga gtgtatcgga gacagcttga tgtagactcc 1080 gtgcctgccg gctcctctta ttggcggaca ccagtgagac accccggaac ttgctgtttt 1140 tctgcaaaat ccggggtgac cagtgggagc ctatttgcac acacgagcgg gacaccccac 1200 tctggtgaag agtgccaaag tcattctttt tcccgttgcg gggcagccga ttgcatgttt 1260 taggaaaata ttacctttgc tacaccctgt cagatttacc ctccacacat atatattccg 1320 tcacctccag ggactattat tcgtcgttgc gccgccagcg gaagatatcc agaagctgtt 1380 ttccgagaga ctcggttggc gcctggtata tttgatggat gtcgcgctgc ctcacgtccc 1440 ggtacccagg aacgcggtgg gatctcgggc ccatcgaaga ctgtgctcca gactgctcgc 1500 ccagcaggtg tttcttgatc gccgcctcta aattgtccgc gcatcgccgg taacattttt 1560 ccagctcgga gtttgcgttt agatacagtt tctgcgatgc caaaggagcc tgcagattat 1620 aacctcggat gctgtcattc agcgctttta atttgacctc cagatagttg ctgtatttct 1680 gttcccattg gctgctgcgc agcttcgtat aactcgagtt attgttgcgc tctgcctcgg 1740 cgtactggct catgatctgg atcttgtccg tgtcgctttt cttcgagtgt ttctcgcaaa 1800 cgatgtgcac ggcctgcagt gtccaatcgg agtcgagctg gcgccgaaac tggcggatct 1860 gagcctccac actgccctgt ttctctatcc acggcggaac cgcctcctgc cgtttcagaa 1920 tgttgttcaa gtggtactct gtgcggtcaa tgaaggcgtt attgccggtg aaatctttgg 1980 gaagcggttt tcctcgggga agattacgaa attccccgcg tcgttgcgct tcctggatct 2040 cgaggagatc gttctccgcg tcgaggagat cgttctccgc gtcgacacca ttccttgcgg 2100 cggcggtgct caacggcctc aacctactac tgggctgctt cctaatgcag gagtcgcata 2160 agggagagcg tcgacaaacc cgcgtttgag aacttgctca agcttctggt aaacgttgta 2220 gtactctgaa acaaggccct agcactctga tctgtttctc ttgggtagcg gtgagtggtt 2280 tattggagtt cactggtttc agcacatctg tcatctagac aatattgtta ctaaattttt 2340 ttgaactaca attgttcgta attcatctat tattatacat cctcgtcagc aatttctggc 2400

<td>agacggagtt</td><td>tactaacgtc</td><td>ttgagtatga</td><td>ggccgagaat</td><td>ccagctctgt</td><td>ggccatactc</td><td> 2460</td>

<td>agtcttgaca</td><td>gcctgctgat</td><td>gtggctgcgt</td><td>tcaacgcaat</td><td>aagcgtgtcc</td><td>tccgactccg</td><td> 2520</td>

<td>agttgtgctc</td><td>gttatcgtca</td><td>ttctcatcct</td><td>cggaaaaatc</td><td>acacgaaaga</td><td>acatactcac</td><td> 2580</td>

<td>cagtaggctt</td><td>tctggtccct</td><td>ggggcacggc</td><td>tgtttctgac</td><td>gtattccggc</td><td>gttgataata</td><td> 2640</td>

<td>gctcgaaagt</td><td>gaacgccgag</td><td>tcgcg ggagt</td><td>cgaccgatgc</td><td>ccttgagagc</td><td>cttcaaccca</td><td> 2700</td>

<td>gtcagctcct</td><td>tccggtgggc</td><td>gcggggcatg</td><td>actatcgtcg</td><td>ccgcacttat</td><td>gactgtcttc</td><td> 2760</td>

<td>tttatcatgc</td><td>aactcgtagg</td><td>acaggtgccg</td><td>gcagcgctct</td><td>gggtcatttt</td><td>cggcgaggac</td><td> 2820</td>

<td>cgctttcgct</td><td>ggagcgcgac</td><td>gatgatcggc</td><td>ctgtcgcttg</td><td>cggtattcgg</td><td>aatcttgcac</td><td> 2880</td>

<td>gccctcgctc</td><td>aagccttcgt</td><td>cactggtccc</td><td>gccaccaaac</td><td>gtttcggcga</td><td>gaagcaggcc</td><td> 2940</td>

<td>attatcgccg</td><td>gcatggcggc</td><td>cgacgcgctg</td><td>ggctacgtct</td><td>tgctggcgtt</td><td>cgcgacgcga</td><td> 3000</td>

<td>ggctggatgg</td><td>ccttccccat</td><td>tatgattctt</td><td>ctcgcttccg</td><td>gcggcatchgg</td><td>gatgcccgcg</td><td> 3060</td>

<td>ttgcaggcca</td><td>tgctgtccag</td><td>gcaggtagat</td><td>gacgaccatc</td><td>agggacagct</td><td>tcaaggatcg</td><td> 3120</td>

<td>ctcggggctc</td><td>ttaccagcct</td><td>aacttcgatc</td><td>actggaccgc</td><td>tgatcgtcac</td><td>ggcgattat</td><td> 3180</td>

<td>gccgcctcgg</td><td>cgagcacatg</td><td>gaacgggttg</td><td>gcatggattg</td><td>taggcgccgc</td><td>cctatacctt</td><td> 3240</td>

<td>gtctgcctcc</td><td>ccgcgttgcg</td><td>tcggtgca</td><td>tggagccggg</td><td>ccacctcgac</td><td>ctgaatggaa</td><td> 3300</td>

<td>gccggcggca</td><td>cctcgctaac</td><td>ggattcacca</td><td>ctccaagaat</td><td>tggagccaat</td><td>caattcttgc</td><td> 3360</td>

<td>ggagaactgt</td><td>gaatgcgcaa</td><td>accaaccctt</td><td>ggcagaacat</td><td>atccatcgcg</td><td>tccgccatct</td><td> 3420</td>

<td>ccagcagccg</td><td>cacgcggcgc</td><td>atcgggggg</td><td>ggggggggg</td><td>gggggggcaa</td><td>acaattcatc</td><td> 3480</td>

<td>attttttttt</td><td>tattcttttt</td><td>tttgatttcg</td><td>gtttctttga</td><td>aatttttttg</td><td>attcggtaat</td><td> 3540</td>

<td>ctccgaacag</td><td>aaggaagaac</td><td>gaaggaagga</td><td>gcacagactt</td><td>agattggtat</td><td>atatacgcat</td><td> 3600</td>

<td>atgtagtgtt</td><td>gaagaaacat</td><td>gaaattgccc</td><td>agtattctta</td><td>acccaactgc</td><td>acagaacaaa</td><td> 3660</td>

aacctgcagg aaacgaagat aaatcatgtc gaaagctaca tataaggaac gtgctgctac 3720

<td>tcatcctagt</td><td>cctgttgctg</td><td>ccaagctatt</td><td>taatatcatg</td><td>cacgaaaagc</td><td>aaacaaactt</td><td> 3780</td>

<td>gtgtgcttca</td><td>ttggatgttc</td><td>gtaccaccaa</td><td>ggaattactg</td><td>gagttagttg</td><td>aagcattagg</td><td> 3840</td>

<td>tcccaaaatt</td><td>tgtttactaa</td><td>aaacacatgt</td><td>ggatatcttg</td><td>actgattttt</td><td>ccatggaggg</td><td> 3900</td>

<td>cacagttaag</td><td>ccgctaaagg</td><td>cattatccgc</td><td>caagtacaat</td><td>tttttactct</td><td>tcgaagacag</td><td> 3960</td>

<td>aaaatttgct</td><td>gacattggta</td><td>atacagtcaa</td><td>attgcagtac</td><td>tctgcgggtg</td><td>tatacagaat</td><td> 4020</td>

<td>agcagaatgg</td><td>gcagacatta</td><td>cgaatgcaca</td><td>cggtgtggtg</td><td>ggcccaggta</td><td>ttgttagcgg</td><td> 4080</td>

<td>tttgaagcag</td><td>gcggcagaag</td><td>aagtaacaaa</td><td>ggaacctaga</td><td>ggccttttga</td><td>tgttagcaga</td><td> 4140</td>

<td>attgtcatgc</td><td>aagggctccc</td><td>tatctactgg</td><td>agaatatact</td><td>aagggtactg</td><td>ttgacattgc</td><td> 4200</td>

<td>gaagagcgac</td><td>aaagattttg</td><td>ttatcggctt</td><td>tattgctcaa</td><td>agagacatgg</td><td>gtggaagaga</td><td> 4260</td>

<td>tgaaggttac</td><td>gattggttga</td><td>tttatgacacc</td><td>cggtgtgggt</td><td>ttagatgaca</td><td>agggagacgc</td><td> 4320</td>

<td>attgggtcaa</td><td>cagtatagaa</td><td>ccgtggatga</td><td>tgtggtctct</td><td>acaggatctg</td><td>acattattat</td><td> 4380</td>

<td>tgttggaaga</td><td>ggactatttg</td><td>caaagggaag</td><td>ggatgctaag</td><td>gtagagggtg</td><td>aacgttacag</td><td> 4440</td>

<td>aaaagcaggc</td><td>tgggaagcat</td><td>atttgagaag</td><td>atgcggccag</td><td>caaaactaaa</td><td>aaactgtatt</td><td> 4500</td>

<td>ataagtaaat</td><td>gcatgtatac</td><td>taaactcaca</td><td>aattagagct</td><td>tcaatttaat</td><td>tatatcagtt</td><td> 4560</td>

<td>attacccggg</td><td>aatctcggtc</td><td>gtaatgattt</td><td>ttataatgac</td><td>gaaaaaaaaa</td><td>aaattggaaa</td><td> 4620</td>

<td>gaaaagcccc</td><td>cccccccccc</td><td>cccccccccc</td><td>cccccccccc</td><td>gcagcgttgg</td><td>gtcctggcca</td><td> 4680</td>

<td>cgggtgcgca</td><td>tgatcgtgct</td><td>cctgtcgttg</td><td>aggacccggc</td><td>taggctggcg</td><td>gggttgcctt</td><td> 4740</td>

<td>actggttagc</td><td>agaatgaatc</td><td>accgatacgc</td><td>gagcgaacgt</td><td>gaagcgactg</td><td>ctgctgcaaa</td><td> 4800</td>

<td>acgtctgcga</td><td>cttagcaac</td><td>aacatgaatg</td><td>gtcttcggtt</td><td>tccgtgtttc</td><td>gtaaagtctg</td><td> 4860</td>

<td>gaaacgcgga</td><td>agtcagcgcc</td><td>ctgcaccatt</td><td>atgttccgga</td><td>tctgcatcgc</td><td>aggatgctgc</td><td> 4920</td>

<td>tggctaccct</td><td>gtggaacacc</td><td>tacatctgta</td><td>ttaacgaagc</td><td>gctggcattg</td><td>accctgagtg</td><td> 4980</td>

<td>atttttctct</td><td>ggtcccgccg</td><td>catccatacc</td><td>gccagttgtt</td><td>taccctcaca</td><td>acgttccagt</td><td> 5040</td>

aaccgggcat gttcatcatc agtaacccgt atcgtgagca tcctctctcg tttcatcggt 5100 atcattaccc ccatgaacag aaattccccc ttacacggag gcatcaagtg accaaacagg 5160 aaaaaaccgc ccttaacatg gcccgcttta tcagaagcca gacattaacg cttctggaga 5220 aactcaacga gctggacgcg gatgaacagg cagacatctg tgaatcgctt cacgaccacg 5260 ctgatgagct ttaccgcagc tgcctcgcgc gtttcggtga tgacggtgaa aacctctgac 5340 acatgcagct cccggagacg gtcacagctt gtctgtaagc ggatgccggg agcagacaag 5400 cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg cgcagccatg acccagtcac 5460 gtagcgatag cggagtgtat actggcttaa ctatgcggca tcagagcaga ttgtactgag 5520 agtgcaccat atgcggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag 5580 gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc 5640 ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg 5700 aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct 5760 ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca 5820 gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct 5880 cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc 5940 gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt 6000 tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc 6060 cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc 6120 cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg 6180 gtggcctaac tacggctaca ctagaaggac agtatgtggt atctgcgctc tgctgaagcc 6240 agttaccttc ggaaaaagag ttggtagctc ttgatccgcc aaacaaacca ccgctggtag 6300 cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaaa 6360 tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat 6420 tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag 6480

<td>ttttaaatca</td><td>atctaaagta</td><td>tatatgagta</td><td>aacttggtct</td><td>gacagttacc</td><td>aatgcttaat</td><td> 6540</td>

<td>cagtgaggca</td><td>cctatctcag</td><td>cgatctgtct</td><td>atttcgttca</td><td>tccatagttg</td><td>cctgactccc</td><td> 6600</td>

<td>cgtcgtgtag</td><td>ataactacga</td><td>tacgggaggg</td><td>cttaccatct</td><td>ggccccagtg</td><td>ctgcaatgat</td><td> 6660</td>

<td>accgcgagac</td><td>ccacgctcac</td><td>cggctccaga</td><td>tttatcagca</td><td>ataaaccagc</td><td>cagccggaag</td><td> 6720</td>

<td>ggccgagcgc</td><td>agaagtggtc</td><td>ctgcaacttt</td><td>atccgcctcc</td><td>atccagtcta</td><td>ttaattgttg</td><td> 6780</td>

<td>ccgggaagct</td><td>agagtaagta</td><td>gttcgccagt</td><td>taatagtttg</td><td>cgcaacgttg</td><td>ttgccattgc</td><td> 6840</td>

<td>tgcaggcatc</td><td>gtggtgtcac</td><td>gctcgtcgtt</td><td>tggtatggct</td><td>tcattcagct</td><td>ccggttccca</td><td> 6900</td>

<td>acgatcaagg</td><td>cgagttacat</td><td>gatcccccat</td><td>gttgtgcaaa</td><td>aaagcggtta</td><td>gctccttcgg</td><td> 6960</td>

<td>tcctccgatc</td><td>gttgtcagaa</td><td>gtaagttggc</td><td>cgcagtgtta</td><td>tcactcatgg</td><td>ttatggcagc</td><td> 7020</td>

<td>actgcataat</td><td>tctcttactg</td><td>tcatgccatc</td><td>cgtaagatgc</td><td>ttttctgtga</td><td>ctggtgagta</td><td> 7060</td>

<td>ctcaaccaag</td><td>tcattctgag</td><td>aatagtgtat</td><td>gcggcgaccg</td><td>agttgctctt</td><td>gcccggcgtc</td><td> 7140</td>

<td>aacacgggat</td><td>aataccgcgc</td><td>cacatagcag</td><td>aactttaaaa</td><td>gtgctcatca</td><td>ttggaaaacg</td><td> 7200</td>

<td>tttttcgggg</td><td>cgaaaactct</td><td>caaggattctt</td><td>accgctgttg</td><td>agatccagtt</td><td>cgatgtaacc</td><td> 7260</td>

<td>cactcgtgca</td><td>cccaactgat</td><td>cttcágcatc</td><td>ttttactttc</td><td>accagcgttt</td><td>ctgggtgagc</td><td> 7320</td>

<td>aaaaacagga</td><td>aggcaaaatg</td><td>ccgcaaaaaa</td><td>gggaataagg</td><td>gcgacacgga</td><td>aatgttgaat</td><td> 7380</td>

<td>actcatactc</td><td>ttcctttttc</td><td>aatattattg</td><td>aagcatttat</td><td>cagggttatt</td><td>gtctcatgag</td><td> 7440</td>

<td>cggatacata</td><td>tttgaatgta</td><td>tttagaaaaa</td><td>taaacaaata</td><td>ggggttccgc</td><td>gcacatttcc</td><td> 7500</td>

<td>ccgaaaagtg</td><td>ccacctgacg</td><td>tctaagaaac</td><td>cattattatc</td><td>atgacattaa</td><td>cctataaaaa</td><td> 7560</td>

<td>taggcgtatc</td><td>acgaggccct</td><td>ttcgtcttca</td><td>the</td><td></td><td></td><td> 7591</td>

<210> 14 <211> 50 <212> DNA <213> Synthetic primer or probe <400> 14 aggggtaagc ttggataaaa ggtatgaggt gcgcaacgtg tccgggatgt 50 <210> 15 <211> 42 <212> DNA <213> Synthetic primer or probe <400> 15 agttacggat ccttaatggt gatggtggtg gtgccagttc at 42 <210> 16 <211> 7648 <212> DNA <213> Vector pFPMT-Mfalfa-El-H6 <400>16 ggtaccctgc tcaatctccg gaatggtgat ctgatcgttc ctgaaaacct cgacattggc 60 tccctcctga cacaggtact cgtacaggtt ccaggtaaac gagtcgtagt tgtcgatcat 120 gacaacgttc ttagaagcgg ccggcatttt gaaggtgact aatagcctaa gaaaatattt 180 aatttaattt tcattaaatt ttcctatact cgctatttca gcttttcatc tcatcacttc 240 ataaacgata taaaccagaa aaagaactat tttcaaacac gcttctcaaa agcggtatgt 300 ccttccacgt ctccttagaa tctggcaagt ccgcgagggg gatccttaat ggtgatggtg 360 gtggtgccag ttcatcatca tatcccaagc catacggtga cctgttatgt ggccgggata 420 gattgagcaa ttgcagtcct gcaccgtctc atgccggcga ggcgagatgg tgaacagctg 480 ggagacgagg aagacagatc cgcagagatc ccccacgtac atagcggaac agaaagcagc 540 cgccccaacg agcaaatcga cgtggcgtcg tattgtcgta gtggggacgc tggcgttcct 600 agctgcgagc gtgggggtga gcgctaccca gcagcgggaa gagttgttct cccgaacgca 660 gggcacgcac ccgggggtgt gcatgatcat gtccgctgcc tcatacacaa tgcttgagtt 720 ggagcagtcg ttcgtgacat ggtacatccc ggacacgttg cgcacctcat accttttatc 780 caagcttacc ccttcttctt tagcagcaat gctggcaata gtagtattta taaacaataa 840 cccgttattt gtgctgttgg aaaatggcaa aacagcaaca tcgaaatccc cttctaaatc 900 tgagtaaccg atgacagctt cagccggaat ttgtgccgtt tcatcttctg ttgtagtgtt 960 gactggagca gctaatgcgg aggatgctgc gaataaaact gcagtaaaaa ttgaaggaaa 1020 tctcatgaat tcccgatgaa gcagagagcg caggaggcgg tatttatagt gccattcccc 1080 tctctgagag acccggatgg tagtcgagtg tatcggagac agcttgatgt agactccgtg 1140 cctgccggct cctcttattg gcggacacca gtgagacacc ccggaacttg ctgtttttct 1200 gcaaaatccg gggtgaccag tgggagccta tttgcacaca cgagcgggac accccactct 1260 ggtgaagagt gccaaagtca ttctttttcc cgttgcgggg cagccgattg catgttttag 1320 gaaaatatta cctttgctac accctgtcag atttaccctc cacacatata tattccgtca 1380 cctccaggga ctattattcg tcgttgcgcc gccagcggaa gatatccaga agctgttttc 1440 cgagagactc ggttggcgcc tggtatattt gatggatgtc gcgctgcctc acgtcccggt 1500 acccaggaac gcggtgggat ctcgggccca tcgaagactg tgctccagac tgctcgccca 1560 gcaggtgttt cttgatcgcc gcctctaaat tgtccgcgca tcgccggtaa catttgtcca 1620 ggtcagagtt tgcgtttaga tacagtttct gcgatgccaa aggaacctgc agattataac 1680 gtcggatgct gtcattcagc gcttttaatt tgacctccag atagttgctg tatttctgtt 1740 cccattggct gctgcgcagc ttcgtataac tcgagtgatt gttgcgctct gcctcggcgt 1800 actggctcat gatctggatc ttgtccgtgt cgcttttctt cgagtgtttc tcgcaaacga 1860 tgtgcacggc ctgcagtgtc caatcggagt cgagctggcg ccgaaactgg cggatctgag 1920 cctccacact gccctgtttc tctatccacg gcggaaccgc ctcctgccat ttcagaatgt 1980 tgttcaagtg gtactctgtg cggtcaatga aggcgttatt gccggtgaaa tctttgggaa 2040 gcggttttcc tcggggaaga ttacgaaatt ccccgcgtcg ttgcgcttcc tggatctcga 2100 ggagatcgtt ctccgcgtcg aggagatcgt tctccgcgtc gacaccattc cttgcggcgg 2160 cggtgctcaa cggcctcaac ctactactgg gctgcttcct aatgcaggag tcgcataagg 2220

<td>gagagcgtcg</td><td>acaaacccgc</td><td>gtttgagaac</td><td>ttgctcaagc</td><td>ttctggtaaa</td><td>cgttgtagta</td><td> 2280</td>

<td>ctctgaaaca</td><td>aggccctagc</td><td>actctgatct</td><td>gtttctcttg</td><td>ggtagcggtg</td><td>agtggtttat</td><td> 2340</td>

<td>tggagttcac</td><td>tggtttcagc</td><td>acatctgtca</td><td>tctagacaat</td><td>attgttacta</td><td>aatttttttg</td><td> 2400</td>

<td>aactacaatt</td><td>gttcgtaatt</td><td>catctattat</td><td>tatacatcct</td><td>cgtcagcaat</td><td>ttctggcaga</td><td> 2460</td>

<td>cggagtttac</td><td>taacgtcttg</td><td>agtatgaggc</td><td>cgagaatcca</td><td>gctctgtggc</td><td>catactcagt</td><td> 2520</td>

<td>cttgacagcc</td><td>tgctgatgtg</td><td>gctgcgttca</td><td>acgcaataag</td><td>cgtgtcctcc</td><td>gactccgagt</td><td> 2580</td>

<td>tgtgctcgtt</td><td>atcgtcgttc</td><td>tcatcctcgg</td><td>aaaaatcaca</td><td>cgaaagaaca</td><td>tactcaccag</td><td> 2640</td>

<td>taggctttct</td><td>ggtccctggg</td><td>gcacggctgt</td><td>ttctgacgta</td><td>ttccggcgtt</td><td>gataatagct</td><td> 2700</td>

<td>cgaaagtgaa</td><td>cgccgagtcg</td><td>cgggagtcga</td><td>ccgatgccct</td><td>tgagagcctt</td><td>caacccagtc</td><td> 2760</td>

<td>agctccttcc</td><td>ggtgggcgcg</td><td>gggcatgact</td><td>atcgtcgccg</td><td>cacttatgac</td><td>tgtcttcttt</td><td> 2820</td>

<td>atcatgcaac</td><td>tcgtaggaca</td><td>ggtgccggca</td><td>gcgctctggg</td><td>tcattttcgg</td><td>cgaggaccgc</td><td> 2880</td>

<td>tttcgctgga</td><td>gcgcgacgat</td><td>gatcggcctg</td><td>tcgcttgcgg</td><td>tattcggaat</td><td>cttgcacgcc</td><td> 2940</td>

<td>ctcgctcaag</td><td>ccttcgtcac</td><td>tggtcccgcc</td><td>accaaacgtt</td><td>tcggcgagaa</td><td>gcaggcgatt</td><td> 3000</td>

<td>atcgccggca</td><td>tggcggccga</td><td>cgcgctgggc</td><td>tacgtcttgc</td><td>tggcgttcgc</td><td>gacgcgaggc</td><td> 3060</td>

<td>tggatggcct</td><td>tccccattat</td><td>gattcttctc</td><td>gcttccggcg</td><td>gcatcgggat</td><td>gcccgcgttg</td><td> 3120</td>

<td>caggccatgc</td><td>tgtccaggca</td><td>ggtagatgac</td><td>gaccatcaag</td><td>gacagcttca</td><td>aggatcgctc</td><td> 3180</td>

<td>gcggctctta</td><td>ccagcctaac</td><td>ttcgatcact</td><td>ggacgctga</td><td>tcgtcacggc</td><td>gatttatgcc</td><td> 3240</td>

<td>ccctcggcga</td><td>gcacatggaa</td><td>cgggttggca</td><td>tggattgtag</td><td>gcgccgccct</td><td>ataccttgtc</td><td> 3300</td>

<td>tgccgococg</td><td>cgttgcgtcg</td><td>cggtgcatgg</td><td>agccgggcca</td><td>cctcgacctg</td><td>aatggaagcc</td><td> 3360</td>

<td>gggcacct</td><td>cgctaacgga</td><td>ttcaccactc</td><td>caagaattgg</td><td>agccaatcaa</td><td>tttttgcgga</td><td> 3420</td>

<td>cgaactagaa</td><td>tgcgcaaacc</td><td>aacctttagc</td><td>agaacatatc</td><td>catcgcgtcc</td><td>gccatctcca</td><td> 3480</td>

<td>gcagccgcac</td><td>gcggcgcatc</td><td>ggggggggg</td><td>ggggggggg</td><td>ggggcaaaca</td><td>attcatcatt</td><td> 3540</td>

ttttttttat tctttttttt gatttcggtt tctttgaaat ttttttgatt cggtaatctc 3600

<td>cgaacagaag</td><td>gaagaacgaa</td><td>ggaaggagca</td>

<td>tagtgttgaa</td><td>gaaacatgaa</td><td>attgcccagt</td>

<td>ctgcaggaaa</td><td>cgaagataaa</td><td>tcatgtcgaa</td>

<td>tcctagtcct</td><td>gttgctgcca</td><td>agctatttaa</td>

<td>tgcttcattg</td><td>gatgttcgta</td><td>ccaccaagga</td>

<td>caaaatttgt</td><td>ttactaaaaa</td><td>cacatgtgga</td>

<td>agttaagccg</td><td>ctaaaggcat</td><td>tatccgccaa</td>

<td>atttgctgac</td><td>attggtaata</td><td>cagtcaaatt</td>

<td>agaatgggca</td><td>gacattacga</td><td>atgcacacgg</td>

<td>gaagcaggcg</td><td>gcagaagaag</td><td>taacaaagga</td>

<td>gtcatgcaag</td><td>ggctccctat</td><td>ctactggaga</td>

<td>gagcgacaaa</td><td>gattttgtta</td><td>tcggctttat</td>

<td>aggttacgat</td><td>tggttgatta</td><td>tgacacccgg</td>

<td>gggtcaacag</td><td>tatagaaccg</td><td>tggatgatgt</td>

<td>tggaagagga</td><td>ctatttgcaa</td><td>agggaaggga</td>

<td>agcaggctgg</td><td>gaagcatatt</td><td>tgagaagatg</td>

<td>agtaaatgca</td><td>tgtatactaa</td><td>actcacaaat</td>

<td>acccgggaat</td><td>cctgggtcgta</td><td>atgattttta</td>

<td>aagcccccc</td><td>cccccccccc</td><td>cccccccccc</td>

<td>gtgcgcatga</td><td>tcgtgctcct</td><td>gtcgttgagg</td>

<td>ggttagcaga</td><td>atgaatcacc</td><td>gatacgcgag</td>

<td>tctgcgacct</td><td>gagcaacaac</td><td>atgaatggtc</td>

cagacttaga ttggtatata tacgcatatg 3660 attcttaacc caactgcaca gaacaaaaac 3720 agctacatat aaggaacgtg ctgctactca 3780 tatcatgcac gaaaagcaaa caaacttgtg 3840 attactggag ttagttgaag cattaggtcc 3900 tatcttgact gatttttcca tggagggcac 3960 gtacaatttt ttactcttcg aagacagaaa 4020 gcagtactct gcgggtgtat acagaatagc 4080 tgtggtgggc ccaggtattg ttagcggttt 4140 acctagaggc cttttgatgt tagcagaatt 4200 atatactaag ggtactgttg acattgcgaa 4260 tgctcaaaga gacatgggtg gaagagatga 4320 tgtgggttta gatgacaagg gagacgcatt 4380 ggtctctaca ggatctgaca ttattattgt 4440 tgctaaggta gagggtgaac gttacagaaa 4500 cggccagcaa aaçtaaaaaa ctgtattata 4560 tagagcttca atttaattat atcagttatt 4620 taatgacgaa aaaaaaaaa ttggaaagaa 4680 cccccccgca gcgttgggtc ctggccacgg 4740 acccggctag gctggcgggg ttgccttact 4800 cgaacgtgaa gcgactgctg ctgcaaaacg 4860 ttcggtttcc gtgtttcgta aagtctggaa 4920 acgcggaagt cagcgccctg caccattatg ttccggatct gcatcgcagg atgctgctgg 4980

<td>ctaccctgtg</td><td>gaacacctac</td><td>atctgtatta</td><td>acgaagcgct</td><td>ggcattgacc</td><td>ctgagtgatt</td><td> 5040</td>

<td>tttctctggt</td><td>cccgccgcat</td><td>ccataccgcc</td><td>agttgtttac</td><td>cctcaoaacg</td><td>ttccagtaac</td><td> 5100</td>

<td>cgggcatgtt</td><td>catcatcagt</td><td>aacccgtatc</td><td>gtgagcatcc</td><td>tctctcgttt</td><td>catcggtatc</td><td> 5160</td>

<td>attaccccca</td><td>tgaacagaaa</td><td>ttccccctta</td><td>cacggaggca</td><td>tcaagtgacc</td><td>aaacaggaaa</td><td> 5220</td>

<td>aaaccgcccc</td><td>taacatgucc</td><td>cgctttatca</td><td>gaagccagac</td><td>attaacgctt</td><td>ctggagaaae</td><td> 5280</td>

<td>tcaacgagct</td><td>gaacgcgaat</td><td>gaacaggcag</td><td>acatcggtga</td><td>atcgcttcac</td><td>gaccacgctg</td><td> 5340</td>

<td>atgagcttta</td><td>ccgcagctgc</td><td>ctcgcgcgtt</td><td>tcggtgatga</td><td>cggtgaaaac</td><td>ctctgacaca</td><td> 5400</td>

<td>tgcagctccc</td><td>ggagacggtc</td><td>acagcttgtc</td><td>tgtaagcgga</td><td>tgccgggagc</td><td>agacaagccc</td><td> 5460</td>

<td>gtcagggcgc</td><td>gtcagcgggt</td><td>gttggcgggt</td><td>gtcggggcgc</td><td>agccatgacc</td><td>cagtcacgta</td><td> 5520</td>

<td>gcgatagcgg</td><td>agtgtatact</td><td>ggcttaacta</td><td>tgggcatca</td><td>gagcagattg</td><td>tactgagagt</td><td> 5580</td>

<td>gcaccatatg</td><td>cggtgtaaaa</td><td>taccgcacag</td><td>atgcgtaagg</td><td>agaaaatacc</td><td>gcatcaggcg</td><td> 5640</td>

<td>ctcttccgct</td><td>tcctcgctca</td><td>ctgactcgct</td><td>gcgctcggtc</td><td>gttcggctgc</td><td>ggcgagcggt</td><td> 5700</td>

<td>atcagctcac</td><td>tcaaaggcgg</td><td>taatacggtt</td><td>atccacagaa</td><td>tcaggggata</td><td>acgcaggaaa</td><td> 5760</td>

<td>gaacatgtga</td><td>gcaaaaggcc</td><td>agcaaaaggc</td><td>caggaaccgt</td><td>aaaaaggccg</td><td>cgttgctggc</td><td> 5820</td>

<td>gttttttccat</td><td>aggctccgcc</td><td>cccctgacga</td><td>gcatcacaaa</td><td>aatcgacgct</td><td>caagtcagag</td><td> 5880</td>

<td>gtggcgaaac</td><td>ccgacaggac</td><td>tataaagata</td><td>ccaggcgttt</td><td>ccccctggaa</td><td>gctccctcgt</td><td> 5940</td>

<td>gcgctctcct</td><td>gttccgaccc</td><td>tgccgcttac</td><td>cggatacctg</td><td>tccgcctttc</td><td>tccttcggg</td><td> 6000</td>

<td>aagcgtggcg</td><td>ctttctcata</td><td>gctcacgctg</td><td>taggtatctc</td><td>agttcggtgt</td><td>aggtcgttcg</td><td> 6060</td>

<td>ctccaagctg</td><td>ggctgtgtgc</td><td>acgaaccccc</td><td>cgttcagccc</td><td>gaccgctgcg</td><td>ccttatccgg</td><td> 6120</td>

<td>taactatcgt</td><td>cttgagtcca</td><td>acccggtaag</td><td>acacgactta</td><td>tcgccactgg</td><td>cagcagccac</td><td> 6180</td>

<td>tggtaacagg</td><td>attagcagag</td><td>cgaggtatgt</td><td>aggcggtgct</td><td>acagagttct</td><td>tgaagtggtg</td><td> 6240</td>

<td>gcctaactac</td><td>ggctacacta</td><td>gaaggacagt</td><td>atttggtatc</td><td>tgcgctctgc</td><td>tgaagccagt</td><td> 6300</td>

taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg 6360 tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc 6420

<td>tttgatcttt</td><td>tctacggggt</td><td>ctgacgctca</td><td>gtggaacgaa</td><td>aactcacgtt</td><td>aagggattt</td><td> 6480</td>

<td>ggtcatgaga</td><td>ttatcaaaaa</td><td>ggatcttcac</td><td>ctagatcctt</td><td>ttaaattaaa</td><td>aatgaagttt</td><td> 6540</td>

<td>taaatcaatc</td><td>taaagtatat</td><td>atgagtaaac</td><td>ttggtctgac</td><td>agttaccaat</td><td>gcttaatcag</td><td> 6600</td>

<td>tgaggcacct</td><td>atctcagcga</td><td>tctgtctatt</td><td>tcgttcatcc</td><td>atagttgcct</td><td>gactccccgt</td><td> 6660</td>

<td>cgtgtagata</td><td>actacgatac</td><td>gggagggctt</td><td>accatctggc</td><td>cccagtgctg</td><td>catgatacc</td><td> 6720</td>

<td>gcgagaccca</td><td>cgctcaccgg</td><td>ctccagattt</td><td>atcagcaata</td><td>aaccagccag</td><td>ccggaagggc</td><td> 6780</td>

<td>cgagcgcaga</td><td>agtggtcctg</td><td>caactttatc</td><td>cgcctccatc</td><td>cagtctatta</td><td>attgttgccg</td><td> 6840</td>

<td>ggaagctaga</td><td>gtaagtagtt</td><td>cgccagttaa</td><td>tagtttgcge</td><td>aacgttgttg</td><td>ccattgctgc</td><td> 6900</td>

<td>aggcatcgtg</td><td>gtgtcacgct</td><td>cgtcgtttgg</td><td>tatggcttca</td><td>ttcagctccg</td><td>gttcccaacg</td><td> 6960</td>

<td>atcaaggcga</td><td>gttacatgat</td><td>cccccatgtt</td><td>gtgcaaaaaa</td><td>gcggttagct</td><td>ccttcagtcc</td><td> 7020</td>

<td>tccgatcgtt</td><td>gtcagaacta</td><td>agttggccgc</td><td>agtgttatca</td><td>ctcatggtta</td><td>tggcagcact</td><td> 7080</td>

<td>gcataattct</td><td>cttactgtca</td><td>tgccagccgt</td><td>aagatgcttt</td><td>tctgtgactg</td><td>gtgagtactc</td><td> 7140</td>

<td>aaccaagtca</td><td>ttctgagaat</td><td>agtgtatgcg</td><td>gcgaccgagt</td><td>tgctcttgcc</td><td>cggcgtcaac</td><td> 7200</td>

<td>acgggataat</td><td>accgcgccac</td><td>atagcagaac</td><td>tttaaaagtg</td><td>ctcatcattg</td><td>gaaaacgttc</td><td> 7260</td>

<td>ttcggggcga</td><td>aaactctcaa</td><td>ggatcttacc</td><td>gctgttgaga</td><td>tccagttcga</td><td>tgtaacccac</td><td> 7320</td>

<td>tcgtgcaccc</td><td>aactgatctt</td><td>cagcatcttt</td><td>tactttcacc</td><td>agcgtttctg</td><td>ggtgagcaaa</td><td> 7380</td>

<td>aacaggaagg</td><td>caaaatgccg</td><td>caaaaaaggg</td><td>aataagggcg</td><td>acacggaaat</td><td>gttgaatact</td><td> 7440</td>

<td>catactcttc</td><td>ctttttcaat</td><td>attattgaag</td><td>catttatcag</td><td>ggttattgtc</td><td>tcatgagcgg</td><td> 7500</td>

<td>aLacatattt</td><td>gaatgtattt</td><td>agaaaaataa</td><td>acaaataggg</td><td>gttccgcgca</td><td>catttccccg</td><td> 7560</td>

<td>aaaagtgcca</td><td>cctgacgtct</td><td>aagaaaccat</td><td>tattatcatg</td><td>acattaacct</td><td>ataaaatag</td><td> 7620</td>

gcgtatcacg aggccctttc gtcttcaa

7648 <210> 17 <211> 4453 <212> DNA <213> pUC18-FMD-MFalpha-El-H6 Vector <220>

<221> MISCELLANEOUS <222> (1207) . . (1208) <223> N is any nucleotide <220>

<221> MISCELLANEOUS <222> (1386) . . (1387) <223> N is any nucleotide <400> 17

<td>gcgcccaata</td><td>cgcaaaccgc</td><td>ctctccccgc</td><td>gcgttggccg</td><td>attcattaat</td><td>gcagctggca</td><td> 60</td>

<td>cgacaggttt</td><td>cccgactgga</td><td>aagcgggcag</td><td>tgagcgcaac</td><td>gcaattaatg</td><td>tgagttagct</td><td> 120</td>

<td>catcattag</td><td>gcaccccagg</td><td>ctttacactt</td><td>tatgcttccg</td><td>gctcgtatgt</td><td>tgtgtggaat</td><td> 180</td>

<td>tgtgagcgga</td><td>taacaatttc</td><td>acacaggaaa</td><td>cagctatgac</td><td>catgattacg</td><td>aattcgagct</td><td> 240</td>

<td>cggtacccgg</td><td>ggatccttaa</td><td>tggtgatggt</td><td>ggtggtgcca</td><td>gttcatcatc</td><td>atatcccaag</td><td> 300</td>

<td>ccatacggtg</td><td>actgttatg</td><td>tggccgggat</td><td>agattgagca</td><td>attgcagtcc</td><td>tgcaccgtct</td><td> 360</td>

<td>catgccggcg</td><td>aggcgagatg</td><td>gtgaacagct</td><td>gggagacgag</td><td>gaagacagat</td><td>ccgcagagat</td><td> 420</td>

<td>cccccacgta</td><td>catagcggaa</td><td>cagaaagcag</td><td>ccgccccaac</td><td>gagcaaatcg</td><td>acgtggcgtc</td><td> 480</td>

<td>gtattgtcgt</td><td>agtggggacg</td><td>ctggcgttcc</td><td>tagctgcgag</td><td>cgtggggtg</td><td>agcgctaecc</td><td> 540</td>

<td>agcagcggga</td><td>agagttgttc</td><td>tcccgaacgc</td><td>agcgcacgca</td><td>ccccggggtg</td><td>tgcatgatca</td><td> 600</td>

<td>tgtccgctgc</td><td>ctcatacaca</td><td>atgcttgagt</td><td>gggagcagtc</td><td>gttcgtgaca</td><td>tggtacatcc</td><td> 660</td>

<td>cgaacacatt</td><td>gcgcacctca</td><td>taccttttat</td><td>gcaagcttac</td><td>cccttcttcg</td><td>ttagcagcaa</td><td> 720</td>

<td>tgctggcaat</td><td>agtagtatt</td><td>ataaacaata</td><td>accgttatt</td><td>tgtgctgttg</td><td>gaaaatggca</td><td> 780</td>

aaacagcaac atcgaaatcc ccttctaaat ctgagtaacc gatgacagct tcagccggaa 840

<td>tttgtgccgt</td><td>ttcatcttct</td><td>gttgtagtgt</td>

<td>cgaataaaac</td><td>tgcagtaaaa</td><td>attgaaggaa</td>

<td>cgcaaggagg</td><td>cggtattat</td><td>agtgccattc</td>

<td>gtgttatcgg</td><td>agacagcttg</td><td>atgtagactc</td>

<td>ccagtgagac</td><td>accccggaac</td><td>ttgctgtttt</td>

<td>ctatttgcac</td><td>acacgagcgg</td><td>gacaccccac</td>

<td>tcccgtnncg</td><td>gggcagccga</td><td>ttgcatgttt</td>

<td>cagatttacc</td><td>ctccacacat</td><td>atatattccg</td>

<td>cgccgccgcg</td><td>gaagatcc</td><td>agaagctgtg</td>

<td>tattnnagg</td><td>atgtcgcgct</td><td>gcctcacgtc</td>

<td>gcccatcgaa</td><td>gactgtgctc</td><td>cagactgctc</td>

<td>taaatagtcc</td><td>gcgcatcgcc</td><td>ggtaacattt</td>

<td>ttctgcgatg</td><td>ccaaaggagc</td><td>ctgcagatta</td>

<td>aatttgacct</td><td>ccagatagtt</td><td>gctgtatttc</td>

<td>ctcgagttat</td><td>tgttgcgctc</td><td>tgcctcggcg</td>

<td>tcgagtgttc</td><td>tcgcaacagg</td><td>acgcctgcag</td>

<td>cggatctgac</td><td>ctccacactg</td><td>ccctgtatct</td>

<td>cagaatgttg</td><td>ttcaagtggt</td><td>agctctgtgc</td>

<td>ctttgggaag</td><td>cggtttatcc</td><td>tcggggaaga</td>

<td>ctggatctcg</td><td>aggaagatcg</td><td>ttctccgcgt</td>

<td>ggcatgcaag</td><td>cttggcactg</td><td>gccgtcgttt</td>

<td>ttacccaact</td><td>taatcgcctt</td><td>gcagcacatc</td>

tgactggagc agctaatgcg gaggatgctg 900 atctcatgaa ttcccgatga aggcagagag 960 ccctctctga gagacccgga tggtagtcga 1020 cgtgcctgcc ggtcctctta ttggcggaca 1080 tctgcaaaat ccggggtgac cagtgggagc 1140 tctggtgaag agtgccaaag tcattctttt 1200 taggaaaata ttacctttgc tacaccctgt 1260 tcacctccag ggactattct tggctcgttg 1320 ttttccgaga gactcggttg gcgcctggta 1380 ccggtaccca ggaacgcggt gggatctcgg 1440 gcccagcagg tgtttcttga ttgccgcctc 1500 ttccagctcg gagtttgcgt ttagatacat 1560 taacctcgga tgctgtcatt cagcgctttt 1620 tgttccattg gctgctggac gttcgtataa 1680 tactggctca tgactgactg cggtcgcttc 1740 gtcatcgagt cgagctggcg ccgaaactgg 1800 ctatccaccg ggaaccgcct cctgccgttc 1860 ggtcaatgaa ggcgttattg ccggtgaaat 1920 ttacgaaatt cccgcgcgtc gttgcgcttc 1980 cgaggagatc gttctccgcg tcgacctgca 2040 tacaacgtcg tgactgggaa aaccctggcg 2100 cccctttcgc cagctggcgt aatagcgaag 2160 aggcccgcac cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa tggcgcctga 2220

<td>tgcggtattt</td><td>tctccttacg</td><td>catctgtgcg</td><td>gtatttcaca</td><td>ccgcatatgg</td><td>tgcactctca</td><td> 2280</td>

<td>gtacaatctg</td><td>ctctgatgcc</td><td>gcatagttaa</td><td>gccagccccg</td><td>acacccgcca</td><td>acaccgctg</td><td> 2340</td>

<td>acgcgccctg</td><td>acgggcttgt</td><td>ctgctcccgg</td><td>catccgctta</td><td>cagacaagct</td><td>gtgaccgtct</td><td> 2400</td>

<td>ccgggaactg</td><td>catgtgtcag</td><td>aagttttcac</td><td>cgtcatcacc</td><td>gaaacgcgcg</td><td>agacgaaagg</td><td> 2460</td>

<td>gcctcgtgaL</td><td>acgcctattt</td><td>ttataggtta</td><td>atgtcatgat</td><td>aataatggtt</td><td>tcttagacgt</td><td> 2520</td>

<td>caggtggcac</td><td>tttcgggga</td><td>aatgtgcgcg</td><td>gaacccctat</td><td>ttgtttattt</td><td>ttctaaatac</td><td> 2580</td>

<td>attcaaatat</td><td>gtatccgctc</td><td>atgagacaat</td><td>aaccctgata</td><td>aatgcttcaa</td><td>taatattgaa</td><td> 2640</td>

<td>aaaagaagag</td><td>tatgagtatt</td><td>caacatttcc</td><td>gtgtcgccct</td><td>tattcccttt</td><td>tttgggcat</td><td> 2700</td>

<td>tttgccttcc</td><td>tgtttttgct</td><td>cacccagaaa</td><td>cgctggtgaa</td><td>agtaaaagat</td>

<td>agttgggtgc</td><td>acgagtgggt</td><td>tacatcgaac</td><td>tggatctcaa</td><td>cagcggtaag</td>

<td>gttttcgccc</td><td>cgaagaacgt</td><td>tttccaatga</td><td>tgagcacttt</td><td>taaagttctg</td>

<td>cggtattatc</td><td>ccgtattgac</td><td>gccgggcaag</td><td>agcaactcgg</td><td>tcgccgcata</td>

<td>agaatgactt</td><td>ggttgagtac</td><td>tcaccagtca</td><td>cagaaaagca</td><td>tcttacggat</td>

<td>taagagaatt</td><td>atgcagtgct</td><td>gccataacca</td><td>tgagtgataa</td><td>cactgcggcc</td>

gctgaagatc 2760 atccttgaga 2820 ctatgtggcg 2880 cactattctc 2940 ggcatgacag 3000 aacttacttc 3060

<td>tgacaacgat</td><td>cggaggaccg</td><td>aaggagctaa</td><td>ccgctttttt</td><td>gcacaacatg</td><td>gggatcatg</td><td> 3120</td>

<td>taactcgcct</td><td>tgatcgttgg</td><td>gaaccggagc</td><td>tgaatgaagc</td><td>cataccaaac</td><td>gacgagcgtg</td><td> 3180</td>

<td>acaccacgat</td><td>gcctgtagca</td><td>atggcaacaa</td><td>cgttgcgcaa</td><td>actattaact</td><td>ggcgaactac</td><td> 3240</td>

<td>ttactctagc</td><td>ttcccggcaa</td><td>caattaatag</td><td>actggatgga</td><td>ggcggataaa</td><td>gttgcaggac</td><td> 3300</td>

<td>cacttctgcg</td><td>ctcggccctt</td><td>ccggctggct</td><td>ggtttattgc</td><td>tgataaatct</td><td>ggagccggtg</td><td> 3360</td>

<td>agcgtgggtc</td><td>tcggtatc</td><td>attgcagcac</td><td>tggggccaga</td><td>tggtaagccc</td><td>tcccgtatcg</td><td> 3420</td>

<td>tagttatcta</td><td>cacgacgggg</td><td>agtcaggcaa</td><td>ctatggatga</td><td>acgaaataga</td><td>cagatcgctg</td><td> 3480</td>

<td>agataggtgc</td><td>ctcactgatt</td><td>aagcattggt</td><td>aactgtcaga</td><td>ccaagtttac</td><td>tcatatatac</td><td> 3540</td>

tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg 3600 ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg 3660 tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc 3720 aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc 3780 tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt 3840 agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc 3900 taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact 3960 caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac 4020 agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag 4080 aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg 4140 gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg 4200 tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga 4260 gccgatggaa aaacgccagc aacgcggcct ttttacagtt cctggccttt tgctggcctt 4320 ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct 4380 ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg 4440 aggaagcgga aga 4453 <210> 18 <211> 51 <212> DNA <213> Synthetic primer or probe <400> 18 tgcttcctac cactagcagc actaggatat gaggtgcgca acgtgtccgg g 51 <210> 19 <211> 52 <212> DNA <213> Synthetic primer or probe <400> 19 tagtactagt attagtaggc ttcgcatgaa ttcccgatga aggcagagag cg 52 <210> 20 <211> 4252 <212> DNA <213> Vector puc18-FMD-CL-El-H6 <220>

<221> MISCELLANEOUS <222> (1006) . . (1007) <223> N is any nucleotide <220>

<221> MISCELLANEOUS <222> (1185) . . (1186) <223> N is any nucleotide

<td>gcgcccaata</td><td>cgcaaaccgc</td><td>ctctccccgc</td><td>gcgttggccg</td><td>attcattaat</td><td>gcagctggca</td><td> 60</td>

<td>cgacaggttt</td><td>cccgactgga</td><td>aagcgggcag</td><td>tgagcgcaac</td><td>gcaattaatg</td><td>tgagttagct</td><td> 120</td>

<td>catcattag</td><td>gcaccccagg</td><td>ctttacactt</td><td>tatgcttccg</td><td>gctcgtatgt</td><td>tgtgtggaat</td><td> 180</td>

<td>tgtgagcgga</td><td>taacaatttc</td><td>acacaygaaa</td><td>cagctatgac</td><td>catgattacg</td><td>aattcgagct</td><td> 240</td>

<td>cggtacccgg</td><td>ggatccttaa</td><td>tggtgatggt</td><td>ggtggtgcca</td><td>gttcatcatc</td><td>atatcccaag</td><td> 300</td>

<td>ccatacggtg</td><td>actgttatg</td><td>tggccgggat</td><td>agattgagca</td><td>attgcagtcc</td><td>tgcaccgtct</td><td> 360</td>

<td>catgccggcg</td><td>aggcgagatg</td><td>gtgaacagct</td><td>gggagacgag</td><td>gaagacagat</td><td>ccgcagagat</td><td> 420</td>

<td>cccccacgta</td><td>catagcggaa</td><td>cagaaagcag</td><td>ccgccccaac</td><td>gagcaaatcg</td><td>acgtggcgtc</td><td> 480</td>

<td>gtattgtcgt</td><td>aatggggacg</td><td>ctggcgttcc</td><td>tagctgcgag</td><td>cgtggggtg</td><td>agcgctaccc</td><td> 540</td>

<td>agcagcggga</td><td>agagttattc</td><td>Lcccgaaogc</td><td>aogacacgca</td><td>ccccggggtg</td><td>tgcatgatca</td><td> 600</td>

<td>tgtccgctac</td><td>ctcatacaca</td><td>atgcttgagt</td><td>tggagcagtc</td><td>gttcgtgaca</td><td>tggtacatcc</td><td> 660</td>

<td>cggacacgtt</td><td>gcgcacctca</td><td>tatcctagtg</td><td>ctgctagtgg</td><td>taggaagcat</td><td>agtactagta</td><td> 720</td>

ttagtaggct tcgcatgaat tcccgatgaa ggcagagagc gcaaggaggc ggtatttata 780

<td>gtgccattcc</td><td>cctctctgag</td><td>agacccggat</td>

<td>tgtagactcc</td><td>gtgcctgccg</td><td>gtcctcttat</td>

<td>tgctgttttt</td><td>ctgcaaaatc</td><td>cggggtgacc</td>

<td>acaccccact</td><td>ctggtgaaga</td><td>gtgccaaagt</td>

<td>tgcatgtttt</td><td>aggaaaatat</td><td>tacctttgct</td>

<td>tatattccgt</td><td>cacctccagg</td><td>gactattctt</td>

<td>gaagctgtgt</td><td>tttccgagag</td><td>actcggttgg</td>

<td>cctcacgtcc</td><td>cggtacccag</td><td>gaacgcggtg</td>

<td>agactgctcg</td><td>cccagcaggt</td><td>gtttcttgat</td>

<td>gtaacatttt</td><td>tccagctcgg</td><td>agtttgcgtt</td>

<td>tgcagattat</td><td>aacctcggat</td><td>gctgtcattc</td>

<td>ctgtatttct</td><td>gttccattgg</td><td>ctgctggacg</td>

<td>gcctcggcgt</td><td>actggctcat</td><td>gactgactgc</td>

<td>cgcctgcagg</td><td>tcatcgagtc</td><td>gagctggcgc</td>

<td>cctgtatctc</td><td>tatccaccgg</td><td>gaaccgcctc</td>

<td>gctctgtgcg</td><td>gtcaatgaag</td><td>gcgttattgc</td>

<td>cggggaagat</td><td>tacgaaattc</td><td>ccgcgcgtcg</td>

<td>tctccgcgtc</td><td>gaggagatcg</td><td>ttctccgcgt</td>

<td>ccgtcgtttt</td><td>acaacgtcgt</td><td>gactgggaaa</td>

<td>cagcacatcc</td><td>ccctttcgcc</td><td>agctggcgta</td>

<td>cccaacagtt</td><td>gcgcagcctg</td><td>aatggcgaat</td>

<td>atctgtgcgg</td><td>tattcacac</td><td>cgcatatggt</td>

ggtagtcgag tgttatcgga gacagcttga 840 tggcggacac cagtgagaca ccccggaact 900 agtgggagcc tatttgcaca cacgagcggg 960 cattcttttt cccgtnncgg ggcagccgat 1020 acaccctgtc agatttaccc tccacacata 1080 ggctcgttgc gccgccgcgg aagatatcca 1140 cgcctggtat atttnnagga tgtcgcgctg 1200 ggatctcggg cccatcgaag act9tgctcc 1260 tgccgcctct aaatagtccg cgcatcgccg 1320 tagatacatt tctgcgatgc caaaggagcc 1380 agcgctttta atttgacctc cagatagttg 1440 ttcgtataac tcgagttatt gttgcgctct 1500 ggtcgcttct cgagtgttct cgcaacagga 1560 cgaaactggc ggatctgacc tccacactgc 1620 ctgccgttcc agaatgttgt tcaagtggta 1680 cggtgaaatc tttgggaagc ggtttatcct 1740 ttgcgcttcc tggatctcga ggaagatcgt 1800 cgacctgcag gcatgcaagc ttggcactgg 1860 accctggcgt tacccaactt aatcgccttg 1920 atagcgaaga ggcccgcacc gatcgccctt 1980 ggcgcctgat gcggtatttt ctccttacgc 2040 gcactctcag tacaatctgc tctgatgccg 2100 catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc 2160

<td>tgctcccggc</td><td>atccgcttac</td><td>agacaagctg</td><td>tgaccgtctc</td><td>cgggagctgc</td><td>atgtgtcaga</td><td> 2220</td>

<td>ggttttcacc</td><td>gtcatcaccg</td><td>aaacgcgcga</td><td>gacgaaaggg</td><td>cctcgtgata</td><td>cgcctatttt</td><td> 2280</td>

<td>tataggttaa</td><td>tgtcatgata</td><td>ataatggttt</td><td>cttagacgtc</td><td>aggtggcact</td><td>tttcggggaa</td><td> 2340</td>

<td>atgtacgcgg</td><td>aacccctatt</td><td>tgtttatttt</td><td>tctaaataca</td><td>ttcaaatatg</td><td>tatccgctca</td><td> 2400</td>

<td>tgagacaata</td><td>accctgataa</td><td>atgcttcaat</td><td>aatatzgaaa</td><td>aaggaagagt</td><td>atgagtattc</td><td> 2460</td>

<td>aacatttccg</td><td>tgtcgcctt</td><td>attccctttt</td><td>ttgggcatt</td><td>ttgccttcct</td><td>gtttttgctc</td><td> 2520</td>

<td>acccagaaac</td><td>gctggtaaaa</td><td>gtaaaagatg</td><td>ctgaagatca</td><td>gttgggtgca</td><td>cgagtgggtt</td><td> 2580</td>

<td>acatcgaact</td><td>ggatctcaac</td><td>agcggtaaga</td><td>tccttgagag</td><td>ttttcgcccc</td><td>gaagaacgtt</td><td> 2640</td>

<td>ttccaatgat</td><td>gagcactttt</td><td>aaagttctgc</td><td>tatgtggcgc</td><td>ggtattatcc</td><td>cgtattgacg</td><td> 2700</td>

<td>ccgggcaaga</td><td>gcaactcggt</td><td>cgccgcatac</td><td>actattotca</td><td>gaatgacttg</td><td>gttgagtact</td><td> 2760</td>

<td>caccagtcac</td><td>agaaaagcat</td><td>cttacggatg</td><td>gcatgacagt</td><td>aagagaatta</td><td>tgcagtgctg</td><td> 2820</td>

<td>ccataaccat</td><td>gagtgataac</td><td>actgcggcca</td><td>acttacttct</td><td>gacaacgatc</td><td>ggaggaccga</td><td> 2880</td>

<td>aggagctaac</td><td>cgcttttttg</td><td>cacaacatgg</td><td>gggatcatgt</td><td>aactcgcctt</td><td>gatcgttggg</td><td> 2940</td>

<td>aaccggagct</td><td>gaatgaagcc</td><td>ataccaaacg</td><td>acgagcgtga</td><td>caccacgatg</td><td>cctgtagcaa</td><td> 3000</td>

<td>tggcaacaac</td><td>gttgcgcaaa</td><td>ctattaactg</td><td>gcgaactact</td><td>tactctagct</td><td>tcccggcaac</td><td> 3060</td>

<td>aattaataga</td><td>ctggatggag</td><td>gcggataaag</td><td>ttgcaggacc</td><td>acttctgcgc</td><td>tcggcccttc</td><td> 3120</td>

<td>cggctggctg</td><td>gtttattgct</td><td>gataaatctg</td><td>gagccggtga</td><td>gcgtgggtct</td><td>cggtatca</td><td> 3180</td>

<td>ttgcagcact</td><td>ggggccagat</td><td>ggtaagccct</td><td>cccgtatcgt</td><td>agttatctac</td><td>acgacgggga</td><td> 3240</td>

<td>gtcaggcaac</td><td>tatggatgaa</td><td>cgaaatagac</td><td>agatcgctga</td><td>gataggtgcc</td><td>tcactgatta</td><td> 3300</td>

<td>agcattggta</td><td>actgtcagac</td><td>caagtttact</td><td>catatact</td><td>ttagattgat</td><td>ttaaaacttc</td><td> 3360</td>

<td>atttttaatt</td><td>taaaaggatc</td><td>taggtgaaga</td><td>tccttttga</td><td>taatctcatg</td><td>accaaaatcc</td><td> 3420</td>

<td>cttaacgtga</td><td>gttttcgttc</td><td>cactgagcgt</td><td>cagaccccgt</td><td>agaaaagatc</td><td>aaaggatttt</td><td> 3480</td>

cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac 3540

<td>cagcggtggt</td><td>ttgtttgccg</td><td>gatcaagagc taccaactct ttttccgaag gtaactggct</td><td> 3600</td>

<td>tcagcagagc</td><td>gcagatacca</td><td>aatactgtcc ttctagtata gccgtagtta ggccaccact</td><td> 3660</td>

<td>tcaagaactc</td><td>tgtagcaccg</td><td>cctacatacc tcgctctgct aatcctgtta ccagtggctg</td><td> 3720</td>

<td>ctgccagtgg</td><td>cgataagtcg</td><td>tgtctztaccg ggttggactc aagacgatag ttaccggata</td><td>i 3780</td>

<td>aggcgcagcg</td><td>gtcgggctga</td><td>acggggggtt cgtgcacaca gcccagcttg gagcgaacga</td><td> 3840</td>

<td>cctacaccga</td><td>actgagatac</td><td>ctacagcgtg agctatgaga aagcgccacg cttcccgaag</td><td> 3900</td>

<td>ggagaaaggc</td><td>ggacaggtat</td><td>ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg</td><td> 3960</td>

<td>agcttccagg</td><td>gggaaacgcc</td><td>tggtatcttt atagtcctgt cgggtttcgc cacctctgac</td><td> 4020</td>

<td>ttgagcgtcg</td><td>atttttgtga</td><td>tgctcgtcag gggggcggag cctatggaa aacgccagca</td><td> 4080</td>

<td>acgcggcctt</td><td>tttacggttc</td><td>ctggcctttt gctggccttt tgctcacatg ttctttcctg</td><td> 4140</td>

<td>cgttatcccc</td><td>tgattctgtg</td><td>gataaccgta ttaccgcctt tgagtgagct gataccgctc</td><td> 4200</td>

<td>gccgcagccg</td><td>aacgaccgag</td><td>cgcaacgagt cagtgagcga ggaagcggaa ga</td><td> 4252</td>

<210> 21 <211> 7447 <212> DNA <213> pFPMT-CL-El-H6 Vector <400> 21

<td>ggtaccctgc</td><td>tcaatctccg</td><td>gaatggtgat</td><td>ctgatcgttc</td><td>ctgaaaacct</td><td>cgacattggc</td><td> 60</td>

<td>tccctcctga</td><td>cacaggtact</td><td>cgtacaggtt</td><td>ccaggtaaac</td><td>gagtcgtagt</td><td>tgtcgatcat</td><td> 120</td>

<td>gacaacgtt<?</td><td>“ttagaagcgg</td><td>ccggcatttt</td><td>gaaggtgact</td><td>aatagcctaa</td><td>gaaaatattt</td><td> 180</td>

<td>aatttaattt</td><td>tcattaaatt</td><td>ttcctatact</td><td>cgctatttca</td><td>gcttttcatc</td><td>tcatcacttc</td><td> 240</td>

<td>ataaacgata</td><td>taaaccagaa</td><td>aaagaactat</td><td>tttcaaacac</td><td>gcttctcaaa</td><td>agcggtatgt</td><td> 300</td>

<td>ccttccacgt</td><td>ctccttagaa</td><td>tctggcaagt</td><td>ccgcgagggg</td><td>gatccttaat</td><td>ggtgatggtg</td><td> 360</td>

gtggtgccag ttcatcatca tatcccaagc catacggtga cctgttatgt ggccgggata 420

<td>gattgagcaa</td><td>ttgcagtcct</td><td>gcaccgtctc</td><td>atgccggcga</td><td>ggcgagatgg</td><td>tgaacagctg</td><td> 480</td>

<td>ggagacgagg</td><td>aagacagatc</td><td>cgcagagatc</td><td>ccccacgtac</td><td>atagcggaac</td><td>agaaagcagc</td><td> 540</td>

<td>cgccccaacg</td><td>agcaaatcga</td><td>cgtggcgtcg</td><td>tattgtcgta</td><td>gtggggacgc</td><td>tggcgttcct</td><td> 600</td>

<td>agctgcgagc</td><td>gtgggggtga</td><td>gcgctaccca</td><td>gcagcgggaa</td><td>gagttgttct</td><td>cccgaacgca</td><td> 660</td>

<td>gggcacgcac</td><td>ccgggggtgt</td><td>gcatgatcat</td><td>gtccgctgcc</td><td>tcatacacaa</td><td>tgcttgagtt</td><td> 720</td>

<td>ggagcagtcg</td><td>ttcgtgacat</td><td>ggtacatccc</td><td>ggacacgttg</td><td>cgcacctcat</td><td>atcctagtgc</td><td> 780</td>

<td>tgctagtggt</td><td>aggaagcata</td><td>gtactagtat</td><td>tagtaggctt</td><td>cgcatgaatt</td><td>ccccatgaag</td><td> 840</td>

<td>cagagagcgc</td><td>aggaggcggt</td><td>atttatagtg</td><td>ccattcccct</td><td>ctctgagaga</td><td>cccggatggt</td><td> 900</td>

<td>agtcgagtgt</td><td>ateggagaca</td><td>gcttgatgta</td><td>gactccgtgc</td><td>ctgccggctc</td><td>ctcttattgg</td><td> 960</td>

<td>cggacaccag</td><td>tgagacaccc</td><td>cggaacttgc</td><td>tgtttttctg</td><td>caaaatccgg</td><td>ggtgaccagt</td><td> 1020</td>

<td>gggagcctat</td><td>ttgcacacac</td><td>gagcgggaca</td><td>ccccactctg</td><td>gtgaagagtg</td><td>ccaaagtcat</td><td> 1080</td>

<td>tctttttccc</td><td>gttgcggggc</td><td>agccgattgc</td><td>atgttttagg</td><td>aaaatattac</td><td>ctttgctaca</td><td> 1140</td>

<td>ccctgtcaga</td><td>tttaccctcc</td><td>acacatatat</td><td>attccgtcac</td><td>ctccagggac</td><td>tattattcgt</td><td> 1200</td>

<td>cgttgcgccg</td><td>ccagcggaag</td><td>atatccagaa</td><td>gctgttttcc</td><td>gagagactcg</td><td>gttggcgcct</td><td> 1260</td>

<td>ggtatatttg</td><td>atggatgtcg</td><td>cgctgcctca</td><td>cgtcccggta</td><td>cccaggaacg</td><td>cggtgggatc</td><td> 1320</td>

<td>tcgggcccat</td><td>cgaagactgt</td><td>gctccagact</td><td>gctcgcccag</td><td>caggtgtttc</td><td>ttgatcgccg</td><td> 1380</td>

<td>cctctaaatt</td><td>gtccgcgcat</td><td>cgccggtaac</td><td>atttttccag</td><td>ctcggagttt</td><td>gcgtttagat</td><td> 1440</td>

<td>acaatttctg</td><td>cgatgccaaa</td><td>gaagcctgca</td><td>gattataacc</td><td>tccgatgctg</td><td>gcattcagcg</td><td> 1500</td>

<td>cttttaattt</td><td>gacctccaga</td><td>tagttgctgt</td><td>atttctgttc</td><td>ccattggctg</td><td>ctgcgcagct</td><td> 1560</td>

<td>tcatataact</td><td>cgagttattg</td><td>ttgcgctctg</td><td>cctcggcgta</td><td>ctagctcatg</td><td>atctggatct</td><td> 1620</td>

<td>tgtccgtgtc</td><td>gcttttcttc</td><td>gagtatttct</td><td>cgcaaacgat</td><td>gtgcacggcc</td><td>tgcagtgtcc</td><td> 1680</td>

<td>aatcagagtc</td><td>gagctggcgc</td><td>cgaaactggc</td><td>ggatctgagc</td><td>ctccacactg</td><td>ccctgtttct</td><td> 1740</td>

ctatccacgg cggaaccgcc tcctgccgtt tcagaatgtt gttcaagtgg tactctgtgc 1800

<td>ggtcaatgaa</td><td>gggttattg</td><td>ccggtgaaat</td><td>ctttgggaag</td><td>cggttttcct</td><td>cggggaagat</td><td> 1860</td>

<td>tacgaaattc</td><td>cccgcgtcgt</td><td>tgcgcttcct</td><td>ggatctcgag</td><td>gagatcgttc</td><td>tccgcgtcga</td><td> 1920</td>

<td>ggagatcgtt</td><td>ctccgcgtcg</td><td>acaccattcc</td><td>ttgcggcggc</td><td>ggtgctcaac</td><td>ggcctcaacc</td><td> 1980</td>

<td>tactactggg</td><td>ctgcttccta</td><td>atgcaggagt</td><td>cgcataaggg</td><td>agagcgtcga</td><td>caaacccgcg</td><td> 2040</td>

<td>tttgagaact</td><td>tgctcaagct</td><td>tctggtaaac</td><td>gttgtagtac</td><td>tctgaaacaa</td><td>ggccctagca</td><td> 2100</td>

<td>ctctgatctg</td><td>tttctcttgg</td><td>gtagcggtga</td><td>gtggtttatt</td><td>ggagttcact</td><td>ggtttcagca</td><td> 2160</td>

<td>catctgtcat</td><td>ctagacaata</td><td>ttgttactaa</td><td>atttttttga</td><td>actacaattg</td><td>ttcgtaattc</td><td> 2220</td>

<td>atctattatt</td><td>atacatcctc</td><td>gtcagcaatt</td><td>tctggcagac</td><td>ggagtttact</td><td>aacgtcttga</td><td> 2280</td>

<td>gtatgaggcc</td><td>gagaatccag</td><td>ctctgtggcc</td><td>atactcagtc</td><td>ttgacagcct</td><td>gctgatgtgg</td><td> 2340</td>

<td>ctgcgttcaa</td><td>cgcaataagc</td><td>gtgtcctccg</td><td>actccgagtt</td><td>gtgctcgtta</td><td>tcgtcgttct</td><td> 2400</td>

<td>catcctcgga</td><td>aaaatcacac</td><td>gaaagaacat</td><td>actcaccagt</td><td>aggctttctg</td><td>gtccctgggg</td><td> 2460</td>

<td>cacggctgtt</td><td>tctgacgtat</td><td>tccggcgttg</td><td>ataatagctc</td><td>gaaagtgaac</td><td>gccgagtcgc</td><td> 2520</td>

<td>gggagtcgac</td><td>cgatgccctt</td><td>gagagccttc</td><td>aacccagtca</td><td>gctccttccg</td><td>gtgggcgcgg</td><td> 2580</td>

<td>ggcatgacta</td><td>tcgtcgccgc</td><td>acttatgact</td><td>gtcttcttta</td><td>tcatgcaact</td><td>cgtaggacag</td><td> 2640</td>

<td>gtgccggcag</td><td>cgctctgggt</td><td>cattttcggc</td><td>gaggaccgct</td><td>ttcgctggag</td><td>cgcgacgatg</td><td> 2700</td>

<td>atcggcctgt</td><td>cgcttgggt</td><td>attcggaatc</td><td>ttgcacgccc</td><td>tcgctcaagc</td><td>cttcgtcact</td><td> 2760</td>

<td>ggtcccgcca</td><td>ccaaacgttt</td><td>cggcgagaag</td><td>caggccatta</td><td>tcgccggcat</td><td>gggggccgac</td><td> 2820</td>

<td>gcgctgggct</td><td>acgtcttgct</td><td>ggcgttcgcg</td><td>acgcgaggct</td><td>ggatggcctt</td><td>ccccattatg</td><td> 2880</td>

<td>attcttctcg</td><td>cttccggcgg</td><td>catcgggatg</td><td>cccgcgttgc</td><td>aggccatgct</td><td>gtccaggcag</td><td> 2940</td>

<td>gtagatgacg</td><td>accattaggg</td><td>acagcttcaa</td><td>ggatcgctcg</td><td>cggctcttac</td><td>cagcctaact</td><td> 3000</td>

<td>tcgatcactg</td><td>gaccgctgat</td><td>cgtcacggcg</td><td>atttatgccg</td><td>cctcggcgag</td><td>cacatggaac</td><td> 3060</td>

<td>gggttggcat</td><td>ggattgtagg</td><td>cgccgcccta</td><td>taccttgtct</td><td>gcctccccgc</td><td>gttgcgtcgc</td><td> 3120</td>

ggtgcatgga gccgggccac ctcgacctga atggaagccg gcggcacctc gctaacggat 3180

<td>tcaccactcc</td><td>aagaattgga</td><td>gccaatcaat</td><td>tcttgcggag</td><td>aactgtgaat</td><td>gcgcaaacca</td><td> 3240</td>

<td>acccttggca</td><td>gaacatatcc</td><td>atcgcgtccg</td><td>ccatctccag</td><td>cagccgcacg</td><td>cggcgcatcg</td><td> 3300</td>

<td>gagggggaag</td><td>gggggggg</td><td>gggcaaacaa</td><td>ttcatcattt</td><td>tttttttatt</td><td>cttttttttg</td><td> 3360</td>

<td>atttcggttt</td><td>ctttgaaatt</td><td>tttttgattc</td><td>gataatctcc</td><td>gaacagaagg</td><td>aagaacgaag</td><td> 3420</td>

<td>gaaggagcac</td><td>agacttagat</td><td>tggtatatat</td><td>acgcatatgt</td><td>agtgttgaag</td><td>aaacatgaaa</td><td> 3480</td>

<td>ttgcccagta</td><td>tgcttaaccc</td><td>aactgcacag</td><td>aacaaaaacc</td><td>tgcaggaaac</td><td>gaagataaat</td><td> 3540</td>

<td>catgtcgaaa</td><td>cctacatata</td><td>aggaacgtgc</td><td>tgctactcat</td><td>cctagtcctg</td><td>ttgctgccaa</td><td> 3600</td>

<td>gctatttaat</td><td>atcatgcacg</td><td>aaaagcaaac</td><td>aaacttgtgt</td><td>gcttcattgg</td><td>atgttcgtac</td><td> 3660</td>

<td>caccaaggaa</td><td>ttactggagt</td><td>tagttgaagc</td><td>attaggtcc</td><td>aaaatttgtt</td><td>tactaaaaac</td><td> 3720</td>

<td>acatgtggat</td><td>atcttgactg</td><td>atttttccat</td><td>ggagggcaca</td><td>gttaagccgc</td><td>taaaggcatt</td><td> 3780</td>

<td>atccgccaag</td><td>tacaattttt</td><td>tactcttcga</td><td>agacagaaaa</td><td>tttgctgaca</td><td>ttggtaatac</td><td> 3840</td>

<td>agtcaaattg</td><td>cagtactctg</td><td>cgggtgtata</td><td>cagaatagca</td><td>gaatgggcag</td><td>acattacgaa</td><td> 3900</td>

<td>tgcacacggt</td><td>gtggtgggcc</td><td>caggtattgt</td><td>tagcggtttg</td><td>aagcaggcgg</td><td>cagaagaagt</td><td> 3960</td>

<td>aacaaaggaa</td><td>cctagaggcc</td><td>ttttgatgtt</td><td>agcagaattg</td><td>tcatgcaagg</td><td>gctccctatc</td><td> 4020</td>

<td>tactggagaa</td><td>tatactaagg</td><td>gtactgttga</td><td>cattgcgaag</td><td>agcgacaaag</td><td>atttgttat</td><td> 4080</td>

<td>cggctttatt</td><td>gctcaaagag</td><td>acatgggtgg</td><td>aagagatgaa</td><td>ggttacgatt</td><td>ggttgattat</td><td> 4140</td>

<td>gacacccggt</td><td>gtgggtttag</td><td>atgacaaggg</td><td>agacgcattg</td><td>ggtcaacagt</td><td>atagaaccgt</td><td> 4200</td>

<td>ggatgatgtg</td><td>gtctctacag</td><td>gatctgacat</td><td>tattattgtt</td><td>ggaagaggac</td><td>tatttgcaaa</td><td> 4260</td>

<td>gggaagggat</td><td>gctaaggtag</td><td>agggtgaacg</td><td>ttacagaaaa</td><td>gcaggctggg</td><td>aagcatattt</td><td> 4320</td>

<td>gagaagatgc</td><td>ggccagcaaa</td><td>actaaaaaac</td><td>tgtattataa</td><td>gtaaatgcat</td><td>gtatactaaa</td><td> 4380</td>

<td>ctcacaaatt</td><td>agagcttcaa</td><td>tttaattata</td><td>tcagttatta</td><td>cccgggaatc</td><td>tcggtcgtaa</td><td> 4440</td>

<td>tgattttttat</td><td>aatgacaaaa</td><td>aaaaaaaaat</td><td>tggaaagaaa</td><td>agcccccccc</td><td>cccccccccc</td><td> 4500</td>

cccccccccc ccccccgcag cgttgggtcc tggccacggg tgcgcatgat cgtgctcctg 4560

<td>tcgttgagga</td><td>cccggctagg</td><td>ctggcggggt</td><td>tgccttactg</td><td>gttagcagaa</td><td>tgaatcaccg</td><td> 4620</td>

<td>atacgcgagc</td><td>gaacgtgaag</td><td>cgactgctgc</td><td>tgcaaaacgt</td><td>ctgcgacctg</td><td>agcaacaaca</td><td> 4680</td>

<td>tgaatggtct</td><td>tcggtttccg</td><td>tgtttcgtaa</td><td>agtctggaaa</td><td>cgcggaagtc</td><td>agcgccctgc</td><td> 4740</td>

<td>accattatgt</td><td>tccggatctg</td><td>catcgcagga</td><td>tgctgctggc</td><td>taccctgtgg</td><td>aacacctaca</td><td> 4800</td>

<td>tctgtattaa</td><td>cgaagcgctg</td><td>gcattgaccc</td><td>tgagtgattt</td><td>ttctctggtc</td><td>ccgccgcatc</td><td> 4860</td>

<td>cataccgcca</td><td>gttgtttacc</td><td>ctcacaacgt</td><td>tccagtaacc</td><td>gggcatgttc</td><td>atcatcagta</td><td> 4920</td>

<td>accgtatca</td><td>tgagcatcct</td><td>ctctcgtttc</td><td>atcggtatca</td><td>ttacccccat</td><td>gaacagaaat</td><td> 4980</td>

tcccccttac acggaggcat caagtgacca aacaggaaaa aaccgccctt aacatggccc 5040 gctttatcag aagccagaca ttaacgcttc tggagaaact caacgagctg gacgcggatg 5100 aacagacaga catctatcaa tcgcttcacg accacgctga tgagctttac cgcagctgcc 5160 tcgcacattt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 5220 cagcttatct gtaagcggat gccgggagca gacaagcccg tcagggcgcg gcacgcgatg 5280 ttggcgggtg tcgagacgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg 5340 gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc ggtgtgaaat 5400 accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac 5460 tgactcgctg cgctcagtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 5520 aataccgtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 5580 gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 5640 ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 5700 ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 5760 gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 5820 ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 5880 cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 5940

<td>cccggtaaga</td><td>cacgacttat</td><td>cgccactggc</td>

<td>gaggtatgta</td><td>gggtgcta</td><td>cagagttctt</td>

<td>aaggacagta</td><td>tttggtatct</td><td>gcgctctgct</td>

<td>tagctcttga</td><td>tccggcaaac</td><td>aaaccaccgc</td>

<td>gcagattacg</td><td>cgcagaaaaa</td><td>aaggatctca</td>

<td>tgacgctcag</td><td>tggaacgaaa</td><td>actcacgtta</td>

<td>gatcttcacc</td><td>tagatccttt</td><td>taaattaaaa</td>

<td>tgagtaaact</td><td>tggtctgaca</td><td>gttaccaatg</td>

<td>ctgtctattt</td><td>cgttcatcca</td><td>tagttgcctg</td>

<td>ggagggctta</td><td>ccatctggcc</td><td>ccagtgctgc</td>

<td>tccagatta</td><td>tcagcaataa</td><td>accagccagc</td>

<td>aactttatcc</td><td>gcctccatcc</td><td>agtctattaa</td>

<td>gccagttaat</td><td>agtttgcgca</td><td>acgttgttgc</td>

<td>gtcgtttggg</td><td>atggcttcat</td><td>tcagctccgg</td>

<td>ccccatgttg</td><td>tgcaaaaaag</td><td>cggttagctc</td>

<td>gttggccgca</td><td>gtgttatcac</td><td>tcatggttat</td>

<td>gccatccgta</td><td>agatgctttt</td><td>ctgtgactgg</td>

<td>gtgtatgcgg</td><td>cgaccgagtt</td><td>cctcttgccc</td>

<td>tagcagaact</td><td>ttaaaagtgc</td><td>tcatcattgg</td>

<td>gatcttaccg</td><td>ctgttgagat</td><td>ccagttccat</td>

<td>agcatctttt</td><td>actttcacca</td><td>gcgtttctgg</td>

agcagccact ggtaacagga ttagcagagc 6000 gaagtggtgg cctaactacg gctacactag 6060 gaagccagtt accttcggaa aaagagttgg 6120 tggtagcggt ggtttttttg tttgcaagca 6180 agaagatcct ttgatctttt ctacggggtc 6240 agggattttg gtcatgagat tatcaaaaag 6300 atgaagtttt aaatcaatct aaagtatata 6360 cttaatcagt gaggcaccta tctcagcgat 6420 actccccgtc gtgtagataa ctacgatacg 6480 aatgataccg cgagacccac gctcaccggc 6540 cggaagggcc gagcgcagaa gtggtcctgc 6600 ttgttgccgg gaagctagag taagtagttc 6660 cattgctgca ggcatcgtgg tgtcacgctc 6720 ttcccaacga tcaaggcgag ttacatgatc 6780 cttcggtcct ccgatcgttg tcagaagtaa 6840 ggcagcactg cataattctc ttactgtcat 6900 tgagtactca accaagtcat tctgagaata 6960 ggcgtcaaca cgggataata ccgcgccaca 7020 aaaacgttct tcggggcgaa aactctcaag 7080 gtaacccact cgtgcaccca actgatcttc 7140 gtgagcaaaa acaggaaggc aaaatgccgc 7200 aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata 7260

<td>ttattgaacc</td><td>atttatcagg</td><td>gttattgtct</td><td>catgagcgga</td><td>tacatatttg</td><td>aatgtattta</td><td> 7320</td>

<td>gaaaaataaa</td><td>caaatagggg</td><td>ttccgcgcac</td><td>atttccccga</td><td>aaagtgccac</td><td>ctgacgtcta</td><td> 7380</td>

<td>agaaaccatt</td><td>attatcatga</td><td>cattaaccta</td><td>taaaaatagg</td><td>cgtatcacga</td><td>ggccctttcg</td><td> 7440</td>

<td>tcttcaa</td><td></td><td></td><td></td><td></td><td></td><td> 7447</td>

<210> 22 <211> 3730 <212> DNA <213> pSP72E2H6 Vector <400> 22

<td>gaactcgagc</td><td>agctgaagct</td><td>tgaattcatg</td><td>agatttcctt</td><td>caatttttac</td><td>tgcagtttta</td><td> 60</td>

<td>ttcgcagcat</td><td>cctccgcatt</td><td>agctgctcca</td><td>gtcaacacta</td><td>caacagaaaa</td><td>tgaaacggca</td><td> 120</td>

<td>caaattccgg</td><td>ctgaagctgt</td><td>catcggttac</td><td>tcagatttag</td><td>aaggggatt</td><td>cgatgttgct</td><td> 180</td>

<td>gttttgccat</td><td>tttccaacag</td><td>cacaaataac</td><td>gggttattgt</td><td>ttataaatac</td><td>tactattgcc</td><td> 240</td>

<td>agcattgctg</td><td>ctaaagaaga</td><td>aggggtatct</td><td>ctagataaaa</td><td>ggcatacccg</td><td>cgtgtcagga</td><td> 300</td>

<td>ggggcagcag</td><td>cctccgatac</td><td>caggggcctt</td><td>gtgtccctct</td><td>ttagccccgg</td><td>gtcggctcag</td><td> 360</td>

<td>aaaaXccagc</td><td>tcgtaaacac</td><td>caacggcagf-</td><td>tggcacatca</td><td>acaggactgc</td><td>cctgaactgc</td><td> 420</td>

<td>aacgactccc</td><td>tccaaacagg</td><td>gttctttgcc</td><td>gcactattct</td><td>acaaacacaa</td><td>attcaactcg</td><td> 480</td>

<td>tctggatgcc</td><td>cagagcgctt</td><td>ggccagctgt</td><td>cgctccatcg</td><td>acaagttcgc</td><td>tcaggggtgg</td><td> 540</td>

<td>ggtcccctca</td><td>cttacactga</td><td>gcctaacagc</td><td>tcggaccaga</td><td>ggccctactg</td><td>ctggcactac</td><td> 600</td>

<td>gcgcctcgac</td><td>cgtgtggtat</td><td>tgtacccgcg</td><td>tctcaggtgt</td><td>gcggtccagt</td><td>gtattgcttc</td><td> 660</td>

<td>accccgagcc</td><td>ctgttgtggt</td><td>gggacgacc</td><td>gatcggtttg</td><td>gtgtccccac</td><td>gtataactgg</td><td> 720</td>

<td>gggcgaacg</td><td>actcggatgt</td><td>gctgattctc</td><td>aacaacacgc</td><td>ggccgccgcg</td><td>aggcaactgg</td><td> 780</td>

<td>ttcggctgta</td><td>catggatgaa</td><td>tggcactggg</td><td>ttcaccaaga</td><td>cgtgtgggg</td><td>ccccccgtgc</td><td> 840</td>

<td>aacatggg</td><td>gggccggcaa</td><td>caacaccttg</td><td>actgcccca</td><td>ctgactgttt</td><td>tcggaagcac</td><td> 900</td>

<td>cccgaggcca</td><td>cttacgccag</td><td>atggttct</td><td>gggccctggc</td><td>tgacacctag</td><td>gtgtatggtt</td><td> 960</td>

<td>cattacccat</td><td>ataggctctg</td><td>gcactacccc</td><td>tgcactgtca</td><td>acttcaccat</td><td>cttcaaggtt</td><td> 1020</td>

<td>aggatgtacg</td><td>tggaggcgt</td><td>ggagcacagg</td><td>ttcgaagccg</td><td>catgcaattg</td><td>gactcgagga</td><td> 1080</td>

<td>gagcgttgtg</td><td>acttggagga</td><td>cagggataga</td><td>tcagagctta</td><td>gctcgctgct</td><td>gotgtctaca</td><td> 1140</td>

<td>acagagtggc</td><td>aggtgatcga</td><td>gggcagacac</td><td>catcaccacc</td><td>atcactaata</td><td>gttaattaac</td><td> 1200</td>

<td>gatctcgact</td><td>tggttgaaca</td><td>cgttgccaag</td><td>gcttaagtga</td><td>atttacttta</td><td>aagcttgca</td><td> 1260</td>

<td>tttaaataaa</td><td>ttttcttttt</td><td>atagctttat</td><td>gacttagttt</td><td>caatttatat</td><td>actattttaa</td><td> 1320</td>

<td>tgacattttc</td><td>gattcattga</td><td>ttgaaagcta</td><td>tcagatctgc</td><td>cggtctccct</td><td>atagtgagtc</td><td> 1380</td>

<td>gtattaattt</td><td>cgataagcca</td><td>ggttaacctg</td><td>cattaatgaa</td><td>tcggccaacg</td><td>cggggaga</td><td> 1440</td>

<td>gggtttgc</td><td>gtattgggcg</td><td>ctcttccgct</td><td>tcctcgctca</td><td>ctgactcgct</td><td>gcgctcggtc</td><td> 1500</td>

<td>gttcggctgc</td><td>ggcgagcggt</td><td>atcagctcac</td><td>tcaaaggcgg</td><td>taatacggtt</td><td>atccacagaa</td><td> 1560</td>

<td>tcaggggata</td><td>acgcaggaaa</td><td>gaacatgtga</td><td>gcaaaaggcc</td><td>agcaaaaggc</td><td>caggaaccgt</td><td> 1620</td>

<td>aaaaaggccg</td><td>cgttgctggc</td><td>gttttttccat</td><td>aggctccgcc</td><td>cccctgacga</td><td>gcatcacaaa</td><td> 1680</td>

<td>aatcgacgct</td><td>caagtcagag</td><td>gtggcgaaac</td><td>ccgacaggac</td><td>tataaagata</td><td>ccaggcgttt</td><td> 1740</td>

<td>ccccctggaa</td><td>gctccctcgt</td><td>gcgctctcct</td><td>gttccgaccc</td><td>tgccgcttac</td><td>cggatacctg</td><td> 1800</td>

<td>tccgcctttc</td><td>tccttcggg</td><td>aagcgtggcg</td><td>ctttctcaat</td><td>gctcacgctg</td><td>taggtatctc</td><td> 1860</td>

<td>agttcggtgt</td><td>aggtcgttcg</td><td>ctccaagctg</td><td>ggctgtgtgc</td><td>acgaaccccc</td><td>cgttcagccc</td><td> 1920</td>

<td>gaccgctgcg</td><td>ccttatccgg</td><td>taactatcgt</td><td>cttgagtcca</td><td>acccggtaag</td><td>acacgactta</td><td> 1980</td>

<td>tcgccactgg</td><td>cagcagccac</td><td>tggtaacagg</td><td>attagcagag</td><td>cgaggtat9t</td><td>aggcggtgct</td><td> 2040</td>

<td>acagagttct</td><td>tgaagtggtg</td><td>gcctaactac</td><td>ggctacacta</td><td>gaaggacagt</td><td>atttggtatc</td><td> 2100</td>

<td>tgcgctctgc</td><td>tgaagccagt</td><td>taccttcgga</td><td>aaaagagttg</td><td>gtagctcttg</td><td>atccggcaaa</td><td> 2160</td>

<td>caaaccaccg</td><td>ctggtagcgg</td><td>tggtttttttt</td><td>gtttgcaagc</td><td>agcagattac</td><td>gcgcagaaaa</td><td> 2220</td>

aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa 2280

<td>aactcacgtt</td><td>aagggattt</td><td>ggtcatgaga</td><td>ttatcaaaaa</td><td>ggatcttcac</td><td>ctagatcctt</td><td> 2340</td>

<td>ttaaattaaa</td><td>aatgaagttt</td><td>taaatcaatc</td><td>taaagtatat</td><td>atgagtaaac</td><td>ttggtctgac</td><td> 2400</td>

<td>agttaccaat</td><td>gcttaatcag</td><td>tgaggcacct</td><td>atctcagcga</td><td>tctgtctatt</td><td>tcgttcatcc</td><td> 2460</td>

<td>atagttgcct</td><td>gactccccgt</td><td>cgtgtagata</td><td>actacgatac</td><td>gggagggctt</td><td>accatctggc</td><td> 2520</td>

<td>cccagtgctg</td><td>catgatacc</td><td>gcgagaccca</td><td>cgctcaccgg</td><td>ctccagattt</td><td>atcagcaata</td><td> 2580</td>

<td>aaccagccag</td><td>ccggaagggc</td><td>cgagcgcaga</td><td>agtggtcctg</td><td>caactttatc</td><td>cgcctccatc</td><td> 2640</td>

<td>cagtctatta</td><td>attgttgccg</td><td>ggaagctaga</td><td>gtaagtagtt</td><td>cgccagttaa</td><td>tagtttgcgc</td><td> 2700</td>

<td>aacgttgttg</td><td>ccattgctac</td><td>aggcatcgtg</td><td>gtgtcacgct</td><td>cgtcgtttgg</td><td>tatggcttca</td><td> 2760</td>

<td>ttcagctccg</td><td>gttcccaacg</td><td>atcaaggcga</td><td>gttacatgat</td><td>cccccatgtt</td><td>gtgcaaaaaa</td><td> 2820</td>

<td>gcggttagct</td><td>ccttcggtcc</td><td>tccgatcgtt</td><td>gtcagaagta</td><td>agttggccgc</td><td>agtgttatca</td><td> 2880</td>

<td>ctcatggtta</td><td>tggcagcact</td><td>gcataattct</td><td>cttactgtca</td><td>tgccatccgt</td><td>aagatgcttt</td><td> 2940</td>

<td>tctctaactg</td><td>gtgagtactc</td><td>aaccaagtca</td><td>ttctgagaat</td><td>agtgtatgcg</td><td>gcgaccgagt</td><td> 3000</td>

<td>tgctcttgcc</td><td>cggcgtcaat</td><td>acgggataat</td><td>accgcgccac</td><td>atagcagaac</td><td>tttaaaaatg</td><td> 3060</td>

<td>ctcatcattg</td><td>gaaaacgttc</td><td>ttcggggcga</td><td>aaactctcaa</td><td>ggatcttacc</td><td>gctgttgaga</td><td> 3120</td>

<td>tccagttcga</td><td>tgtaacccac</td><td>tcgtgcaccc</td><td>aactgatctt</td><td>cagcatcttt</td><td>tactttcacc</td><td> 3180</td>

<td>agcgtttctg</td><td>ggtgagcaaa</td><td>aacaggaagg</td><td>caaaatgccg</td><td>caaaaaaggg</td><td>aataagggcg</td><td> 3240</td>

<td>acacggaaat</td><td>gttgaatact</td><td>catactcttc</td><td>ctttttcaat</td><td>attattgaag</td><td>catttatcag</td><td> 3300</td>

<td>ggttattgtc</td><td>tcatgagcgg</td><td>atacatattt</td><td>gaatgtattt</td><td>agaaaaataa</td><td>acaaataggg</td><td> 3360</td>

<td>gttccgcgca</td><td>catttccccg</td><td>aaaagtgcca</td><td>cctgacgtct</td><td>aagaaaccat</td><td>tattatcatg</td><td> 3420</td>

<td>acattaacct</td><td>ataaaatag</td><td>gcgtatcacg</td><td>aggccctttc</td><td>gtctcgcgcg</td><td>tttcggtgat</td><td> 3480</td>

<td>gacggtgaaa</td><td>accctgaca</td><td>catgcagctc</td><td>ccggagacgg</td><td>tcacagcttg</td><td>tctgtaagcg</td><td> 3540</td>

<td>gatgccggga</td><td>gcagacaagc</td><td>ccgtcagggc</td><td>gcgtcagcgg</td><td>gtgttggcgg</td><td>gtgtcggggc</td><td> 3600</td>

tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat ggacatattg 3660 tcgttagaac gcggctacaa ttaatacata accttatgta tcatacacat acgatttagg 3720 tgacactata 3730 <210> 23 <211> 7370 <212> DNA <213> Vector pMPT121 <220>

<221> MISCELLANEOUS <222> (778) . . (778) <223> N is any nucleotide <400> 23

<td>ggtaccctgc</td><td>tcaatctccg</td><td>gaatggtgat</td><td>ctgatcgttc</td><td>ctgaaaacct</td><td>cgacattggc</td><td> 60</td>

<td>tccctcctga</td><td>cacaggtact</td><td>cgtacaggtt</td><td>ccaggtaaac</td><td>gagtcgtagt</td><td>tgtcgatcat</td><td> 120</td>

<td>gacaacgttc</td><td>ttagaagcgg</td><td>ccggcatttt</td><td>gaaggtgact</td><td>aatagcctaa</td><td>gaaaatattt</td><td> 180</td>

<td>aatttaattt</td><td>tcattaaatt</td><td>ttcctatact</td><td>cgctatttca</td><td>gcttttcatc</td><td>tcatcacttc</td><td> 240</td>

<td>ataaacgata</td><td>taaaccagaa</td><td>aaagaactat</td><td>tttcaaacac</td><td>gcttctcaaa</td><td>agcggtatgt</td><td> 300</td>

<td>ccttccacgt</td><td>ctccttagaa</td><td>tctggcaagt</td><td>ccgcgagggg</td><td>gatccagatc</td><td>tgaattcgtt</td><td> 360</td>

<td>tttgtacttt</td><td>agattgatgt</td><td>caccaccgtg</td><td>cactggcagc</td><td>agtattata</td><td>gatggaccgt</td><td> 420</td>

<td>gtggggacgg</td><td>ttgggtacac</td><td>ttagcggcag</td><td>cgctgacccc</td><td>atctgtgatc</td><td>aagtagggca</td><td> 480</td>

<td>aaaactgggg</td><td>atgtcggagt</td><td>cgctgcacgg</td><td>tagcataaga</td><td>atttactttc</td><td>tggccggttc</td><td> 540</td>

<td>accgcattt</td><td>gcactgtgga</td><td>gaaacagcct</td><td>gtccgacacc</td><td>ccaccagttg</td><td>ccacatcggc</td><td> 600</td>

<td>cctctgctgc</td><td>tctggtgatt</td><td>ttctggtagc</td><td>aggcacagac</td><td>agcagtgggt</td><td>agcgccgtcc</td><td> 660</td>

<td>ggttaggcaa</td><td>ggtcacgttg</td><td>tacgctaccc</td><td>cagcaaacag</td><td>agcctcacat</td><td>gacaccatcc</td><td> 720</td>

<td>agctgcgtcc</td><td>tcgaagcgaa</td><td>aagttcggtt</td><td>gcggctgcag</td><td>aaccccctca</td><td>cttaccanat</td><td> 780</td>

<td>tcacaagttt</td><td>tacgcgacgg</td><td>ctaaagcgag</td><td>tgggttttaa</td><td>aaacttggg</td><td>tgcaaggatg</td><td> 840</td>

catgcggcaa caattaattg gtgcatccag cacagcaagc ccagtctcga gatgtccagt 900

<td>cgctacagag</td><td>tggagtacgc</td><td>actcaaggaa</td><td>caccgtcgag</td><td>atggcctcat</td><td>agaatggatc</td><td> 960</td>

<td>aagggcctgc</td><td>tggccacgcc</td><td>gttcgtcctg</td><td>tacgcggtga</td><td>agagcaacgg</td><td>catctctgca</td><td> 1020</td>

<td>gtggacgacc</td><td>tcatggtaaa</td><td>ctctgaggca</td><td>aaacgccgct</td><td>acgcggaaat</td><td>cttccacgac</td><td> 1080</td>

<td>ctcgaactcc</td><td>tcatcgacga</td><td>caacattgaa</td><td>atgaccaaag</td><td>ccggcacccc</td><td>cgaattgtct</td><td> 1140</td>

<td>cggctcgtgc</td><td>agctggttcc</td><td>gagcgttggc</td><td>agcttcttca</td><td>cgagactgcc</td><td>tctggaaaag</td><td> 1200</td>

<td>gccttctaca</td><td>tcgaggacga</td><td>gcgccgcgcc</td><td>atcagcaaac</td><td>gccggcttgt</td><td>ggccccctcg</td><td> 1260</td>

<td>ttcaacgacg</td><td>tccggctcat</td><td>tctcaacacg</td><td>gcccagctgt</td><td>tggagatgtc</td><td>gcggttcttc</td><td> 1320</td>

<td>cattccaaaa</td><td>ccatccgaga</td><td>tcgcaagctg</td><td>cagctcatta</td><td>cattcgatgg</td><td>tgacatcaca</td><td> 1380</td>

<td>ctgtacgacg</td><td>acggcaaaaa</td><td>tttcgatgcc</td><td>gagtcgccca</td><td>tcctgcccca</td><td>cctcatcaaa</td><td> 1440</td>

<td>ctaatggcca</td><td>aggacctcta</td><td>tgtgggtatc</td><td>gtcaccgcgg</td><td>ccggctacag</td><td>cgacggaaca</td><td> 1500</td>

<td>agtactacga</td><td>gcgcctcaag</td><td>ggcctcatcg</td><td>acgccgtcca</td><td>gacgtccccg</td><td>ctgctcacag</td><td> 1560</td>

<td>gccaccagaa</td><td>agagaacctg</td><td>ttcattatgg</td><td>gcggcgaggc</td><td>aaactacctc</td><td>ttccggtaca</td><td> 1620</td>

<td>gtaacgagga</td><td>gcagagatta</td><td>cgcttctact</td><td>ccaaagacag</td><td>atggctgctc</td><td>gagaacatgc</td><td> 1680</td>

<td>tgaattggtc</td><td>cgaggagac</td><td>attcatctga</td><td>cactus</td><td>tgcgcaggac</td><td>gttctaaacg</td><td> 1740</td>

<td>acctgttca</td><td>caaactgggc</td><td>tcgccagcca</td><td>ccgtggtccg</td><td>caaggagcgt</td><td>cgcgtcggcc</td><td> 1800</td>

<td>tggttccatt</td><td>accgggccac</td><td>aagctgatcc</td><td>gcgagcagct</td><td>cgaggagatc</td><td>gttctccgcg</td><td> 1860</td>

<td>tcgacaccat</td><td>tccttggc</td><td>gggtgctc</td><td>aacggcctca</td><td>actactact</td><td>gggctgcttc</td><td> 1920</td>

<td>ctaatgcagg</td><td>agtcgcataa</td><td>gggagagcgt</td><td>cgactcccgc</td><td>gactcggcgt</td><td>tcactttcga</td><td> 1980</td>

<td>gctattatca</td><td>acgccggaat</td><td>acgtcagaaa</td><td>cagccgtgcc</td><td>ccagggacca</td><td>gaaagcctac</td><td> 2040</td>

<td>tggtgagtat</td><td>gttctttcgt</td><td>gtgatttttc</td><td>cgaggatgag</td><td>aacgacgata</td><td>acgagcacaa</td><td> 2100</td>

<td>ctcggagtcg</td><td>gaggacacgc</td><td>ttattgcgtt</td><td>gaacgcagcc</td><td>acatcagcag</td><td>gctgtcaaga</td><td> 2160</td>

<td>ctgagtatgg</td><td>ccacagagct</td><td>ggattctcgg</td><td>cctcatactc</td><td>aagacgttag</td><td>taaactccgt</td><td> 2220</td>

ctgccagaaa ttgctgacga ggatgtataa taatagatga attacgaaca attgtagttc 2280

<td>aaaaaaattt</td><td>agtaacaata</td><td>ttgtctagat</td><td>gacagatgtg</td><td>ctgaaaccag</td><td>tgaactccaa</td><td> 2340</td>

<td>taaaccactc</td><td>accgctaccc</td><td>aagagaaaca</td><td>gatcagagtg</td><td>ctagggcctt</td><td>gtttcagagt</td><td> 2400</td>

<td>actacaacgt</td><td>ttaccagaag</td><td>cttgaacaag</td><td>ttctcaaacg</td><td>cgggtttgtc</td><td>gaccgatgcc</td><td> 2460</td>

<td>cttgagagcc</td><td>ttcaacccag</td><td>tcagctcctt</td><td>ccggtgoacg</td><td>cgaggcatga</td><td>ctatcgtcgc</td><td> 2520</td>

<td>cgcacttatg</td><td>actgtcttct</td><td>ttatcatgca</td><td>actcgtagga</td><td>caggtgccgg</td><td>cagcgctctg</td><td> 2580</td>

<td>ggtcattttc</td><td>ggcgaggacc</td><td>gctttcgctg</td><td>gagcgcgacg</td><td>atgatcggcc</td><td>tgtcgcttgc</td><td> 2640</td>

<td>ggtattcaga</td><td>atcttgcacg</td><td>ccctcgctca</td><td>agccttcgtc</td><td>actggtccg</td><td>ccaccaaacg</td><td> 2700</td>

<td>tttcggcgag</td><td>aagcaggcca</td><td>ttatcgccgg</td><td>catggcggcc</td><td>gacgcgctgg</td><td>gctacgtctt</td><td> 2760</td>

<td>gctggcgttc</td><td>gcgacgcgag</td><td>gctggatggc</td><td>cttccccatt</td><td>atgattcttc</td><td>tcgcttccgg</td><td> 2820</td>

<td>cggcatcggg</td><td>atgcccgcgt</td><td>tgcaggccat</td><td>gctgtccagg</td><td>caggtagatg</td><td>acgaccatca</td><td> 2880</td>

<td>gggacagctt</td><td>caaggatcgc</td><td>tcggctct</td><td>taccagccta</td><td>acttcgatca</td><td>ctggaccgct</td><td> 2940</td>

<td>gatcgtcacg</td><td>acgatttatg</td><td>ccgcctcggc</td><td>gagcacatgg</td><td>aacgggttgg</td><td>catggattgt</td><td> 3000</td>

<td>aggcgccgcc</td><td>ctataccttg</td><td>tctgcctccc</td><td>cgcgttgcgt</td><td>cgcggtgcat</td><td>ggagccgggc</td><td> 3060</td>

<td>cacctcgacc</td><td>tgaatggaag</td><td>ccggcggcac</td><td>ctcgctaacg</td><td>gattcaccac</td><td>tccaagaatt</td><td> 3120</td>

<td>ggagccaatc</td><td>aatttttgcg</td><td>gagaactgtg</td><td>aatgcgcaaa</td><td>ccaacccttg</td><td>gcagaacata</td><td> 3180</td>

<td>tccatcgcgt</td><td>ccgccatctc</td><td>cagcagccgc</td><td>acgcggcgca</td><td>tcgggggggg</td><td>ggggggggg</td><td> 3240</td>

<td>ggggggcaaa</td><td>caattcatca</td><td>tttttttttt</td><td>attctttttt</td><td>ttgatttcgg</td><td>tttctttgaa</td><td> 3300</td>

<td>atttttttga</td><td>ttcggtaatc</td><td>tccgaacaga</td><td>aggaagaacg</td><td>aaggaaggag</td><td>cacagactta</td><td> 3360</td>

<td>gattggtata</td><td>tatacgcata</td><td>tgtagtgttg</td><td>aagaaacatg</td><td>aaattgccca</td><td>gtattcttaa</td><td> 3420</td>

<td>cccaactgca</td><td>cagaacaaaa</td><td>acctgcagga</td><td>aacgaagata</td><td>aatcatgtcg</td><td>aaagctacat</td><td> 3480</td>

<td>ataaggaacg</td><td>tgctgctact</td><td>catcctagtc</td><td>ctgttgctgc</td><td>caagctattt</td><td>aatatcatgc</td><td> 3540</td>

<td>acgaaaagca</td><td>aacaaacttg</td><td>tgtgcttcat</td><td>tggatgttcg</td><td>taccaccaag</td><td>gaattactgg</td><td> 3600</td>

agttagttga agcattaggt cccaaaattt gtttactaaa aacacatgtg gatatcttga 3660 ctgatttttc catggagggc acagttaagc cgctaaaggc attatccgcc aagtacaatt 3720 ttttactctt cgaagacaga aaatttgctg acattggtaa tacagtcaaa TTGCAGTACT agggctccct atctactgga gaatatacta 3960 agggtactgt tgacattgcg aagagcgaca aagattttgt tatcggcttt attgctcaaa 4020 gagacatggg tggaagagat gaaggttacg attggttgat tatgacaccc ggtgtgggtt 4080 tagatgacaa gagagacgca ttgggtcaac agtatagaac cgtggatgat gtggtctcta 4140 caggatctga cattattatt gttggaagag gactatttgc aaagggaagg gatgctaagg 4200 tagagggtga acgttacaga aaagcaggct gggaagcata tttcagaaga tgcggccagc 4260 aaaactaaaa aactgtatta taagtaaatg catgtatact aaactcacaa attagagctt 4320 caatttaatt atatcagtta tgacccggga atctcggtcg taatgatttt tataataacg 4380 aaaaaaaaa aattcgaaag aaaagccccc cccccccccc cccccccccc cccccccccg 4440 cagcgttggg tcctggccac cggtgcgcat gatcgtgctc ctgtcgttga ggacccggct 4500 aggctggcgg ggttgcctta ctggttagca gaatgaatca ccgatacgcg agcgaacgtg 4560 aagcgactgc tgctgcaaa cgtctgcgac ctgagcaaca acatgaatgg tcttcggttt 4620 ccgtgtttcg taaagtctgg aaacgcggaa gtcagcgccc tgcaccatta tgttccggat 4680 ctgcatcgca ggatgctgct ggctaccctg tggaacacct acatctgtat taacgaagcg 4740 ctggcattga ccctgagtga tttttctctg gtcccgccgc atccataccg ccagttgttt 4800 accctcacaa cgttccagta accgggcatg ttcatcatca gtaacccgta tcgtgagcat 4860 cctctctcgt ttcatcggta tcattacccc catgaacaga aattccccct tacacggagg 4920 catcaagtga ccaaacagga aaaaaccgcc cttaacatgg cccgctttat cagaagccag 4980 acattaacgc ttctggagaa actcaacgag ctggacgcgg atgaacaggc agacatctgt 5040

<td>gaatcgcttc</td><td>acgaccacgc</td><td>tgatgagctt</td>

<td>gacggtgaaa</td><td>accctgaca</td><td>catgcagctc</td>

<td>gatgccggga</td><td>gcagacaagc</td><td>ccgtcagggc</td>

<td>gcagccatga</td><td>cccagtcacg</td><td>tagcgatagc</td>

<td>cagagcagat</td><td>tgtactgaga</td><td>gtgcaccata</td>

<td>ggagaaaata</td><td>ccgcatcagg</td><td>cgctcttccg</td>

<td>tcgttcggct</td><td>gcggcgagcg</td><td>gtatcagctc</td>

<td>aatcagggga</td><td>taacgcagga</td><td>aagaacatgt</td>

<td>gtaaaaaggc</td><td>cgcgttgctg</td><td>gcgtttttcc</td>

<td>aaaatcgacg</td><td>ctcaagtcag</td><td>aggtggcgaa</td>

<td>ttccccctgg</td><td>aagctccctc</td><td>gtgcgctctc</td>

<td>tgtccgcctt</td><td>tctccttcg</td><td>ggaagcgtgg</td>

<td>tcagttcggt</td><td>gtaggtcgtt</td><td>cgctccaagc</td>

<td>ccgaccgctg</td><td>cgccttatcc</td><td>ggtaactatc</td>

<td>tatcgccact</td><td>ggcagcagcc</td><td>actggtaaca</td>

<td>ctacagagtt</td><td>cttgaagtgg</td><td>tggcctaact</td>

<td>tctgcgctct</td><td>gctgaagcca</td><td>gttaccttcg</td>

<td>aacaaaccac</td><td>cgctggtagc</td><td>agtggttttt</td>

<td>aaaaaggatc</td><td>tcaagaagat</td><td>cctttgatct</td>

<td>aaaactcacg</td><td>ttaacggatt</td><td>ttggtcatga</td>

<td>ttttaaatta</td><td>aaaatgaagt</td><td>tttaaatcaa</td>

<td>acagttacca</td><td>atgcttaatc</td><td>agtgaggcac</td>

taccgcagct gcctcgcgcg tttcggtgat 5100 ccggagacgg tcacagcttg tctgtaagcg 5160 gcgtcagcgg gtgttggcgg gtgtcggggc 5220 ggagtgtata ctggcttaac tatgcggcat 5280 tgcggtgtga aataccgcac agatgcgtaa 5340 cttcctcgct cactgactcg ctgcgctcgg 5400 actcaaaggc ggtaatacgg ttatccacag 5460 gagcaaaagg ccagcaaaag gccaggaacc 5520 ataggctccg cccccctgac gagcatcaca 5580 accccgacagg actataaaga taccaggcgt 5640 ctgttccgac cctgccgctt accggatacc 5700 cgctttctca tagctcacgc tgtaggtatc 5760 tgggctgtgt gcacgaaccc cccgttcagc 5820 gtcttgagtc caacccggta agacacgact 5880 ggattagcag agcgaggtat gtaggcggtg 5940

<td>acggctacac</td><td>tagaaggaca</td><td>gtatttggta</td><td> 6000</td>

<td>gaaaaagagt</td><td>tggtagctct</td><td>tgatccggca</td><td> 6060</td>

<td>ttgtttgcaa</td><td>gcagcagatt</td><td>acgcgcagaa</td><td> 6120</td>

<td>tttctacggg</td><td>gtctgacgct</td><td>cagtggaacg</td><td> 6180</td>

<td>gattatcaaa</td><td>aaggattcttc</td><td>acctagatcc</td><td> 6240</td>

<td>tctaaagtat</td><td>atatgagtaa</td><td>acttggtctg</td><td> 6300</td>

<td>ctatctcagc</td><td>gatctgtcta</td><td>tttcgttcat</td><td> 6360</td>

ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg 6420

<td>gccccagtgc</td><td>tgcaatgata</td><td>ccgcgagacc</td><td>cacgctcacc</td><td>ggctccagat</td><td>ttatcagcaa</td><td> 6480</td>

<td>taaaccagcc</td><td>agccggaagg</td><td>gccgagcgca</td><td>gaagtggtcc</td><td>tgcaacttta</td><td>tccgcctcca</td><td> 6540</td>

<td>tccagtctat</td><td>taattgttgc</td><td>cgggaagcta</td><td>gagtaagtag</td><td>ttcgccagtt</td><td>aatagtttgc</td><td> 6600</td>

<td>gcaacgttct</td><td>tgccattgct</td><td>gcaggcatcg</td><td>tggtgtcacg</td><td>ctcgtcgttt</td><td>ggtatggctt</td><td> 6660</td>

<td>cattcagctc</td><td>cggttcccaa</td><td>cgatcaaggc</td><td>gagttacatg</td><td>atcccccatg</td><td>ttgtgcaaaa</td><td> 6720</td>

<td>aagcggttag</td><td>ctccttcggt</td><td>cctccgatcg</td><td>ttgtcagaag</td><td>taagttggcc</td><td>gcagtgttat</td><td> 6780</td>

<td>cactus</td><td>tatggcagca</td><td>ctgcataatt</td><td>ctcttactgt</td><td>catgccatcc</td><td>gtaagatgct</td><td> 6840</td>

<td>tttctgtgac</td><td>tggtgagtac</td><td>tcaaccaagt</td><td>cattctgaga</td><td>atagtgtatg</td><td>cggcgaccga</td><td> 6900</td>

<td>gttgctcttg</td><td>cccggcgtca</td><td>acacgggata</td><td>ataccgcgcc</td><td>acatagcaga</td><td>actttaaaag</td><td> 6960</td>

<td>tgctcatcat</td><td>tggaaaacgt</td><td>tctttcggggc</td><td>gaaaactctc</td><td>aaggacctta</td><td>ccgctgttga</td><td> 7020</td>

<td>gatccagttc</td><td>gatgtaaccc</td><td>actcgtgcac</td><td>ccaactgatc</td><td>ttcagcatct</td><td>tttactttca</td><td> 7080</td>

<td>ccagcgtttc</td><td>tgggtgagca</td><td>aaaacaggaa</td><td>ggcaaaatgc</td><td>cgcaaaaaag</td><td>ggaataaggg</td><td> 7140</td>

<td>cgacacggaa</td><td>atgttgaata</td><td>ctcatactct</td><td>tccttttca</td><td>atattattga</td><td>agcatttatc</td><td> 7200</td>

<td>aggttattg</td><td>tctcatgagc</td><td>ggatacatat</td><td>ttgaatgtat</td><td>ttagaaaaat</td><td>aaacaaatag</td><td> 7260</td>

<td>gggttccgcg</td><td>cacatttccc</td><td>cgaaaagtgc</td><td>cacctgacgt</td><td>ctaagaaacc</td><td>attattatca</td><td> 7320</td>

<td>tgacattaac</td><td>ctataaaaat</td><td>aggcgtatca</td><td>cgaggccctt</td><td>tcgtcttcaa</td><td></td><td> 7370</td>

<210> 24 <211> 8298 <212> DNA <213> pFMPT-MFalpha-E2-H6 Vector <400> 24

<td>ggtaccctgc</td><td>tcaatctccg</td><td>gaatggtgat</td><td>ctgatcgttc</td><td>ctgaaaacct</td><td>cgacattggc</td><td> 60</td>

<td>tccctcctga</td><td>cacaggtact</td><td>cgtacaggtt</td><td>ccaggtaaac</td><td>gagtcgtagt</td><td>tgtcgatcat</td><td> 120</td>

<td>gacaacgttc</td><td>ttagaagcgg</td><td>ccggcatttt</td><td>gaaggtgact</td><td>aatagcctaa</td><td>gaaaatattt</td><td> 180</td>

<td>aatttaattt</td><td>tcattaaatt</td><td>ttcctatact</td><td>cgctatttca</td><td>gcttttcatc</td><td>tcatcacttc</td><td> 240</td>

<td>ataaacgata</td><td>taaaccagaa</td><td>aaagaactat</td><td>tttcaaacac</td><td>gcttctcaaa</td><td>agcggtatgt</td><td> 300</td>

<td>ccttccacgt</td><td>ctccttagaa</td><td>tctggcaagt</td><td>ccgcgagggg</td><td>gatccagatc</td><td>tgatagcttt</td><td> 360</td>

<td>caatcaatga</td><td>atcgaaaatg</td><td>tcattaaaat</td><td>agtatataaa</td><td>ttgaaactaa</td><td>gtcataaagc</td><td> 420</td>

<td>tataaaaaga</td><td>aaatttatt</td><td>aaatgcaaga</td><td>ctttaaagta</td><td>aattcactta</td><td>aggcttggca</td><td> 480</td>

<td>acgtgttcaa</td><td>ccaagtcgag</td><td>atcgttaatt</td><td>aactattagt</td><td>gatggtggtg</td><td>atggtgtctc</td><td> 540</td>

<td>ccctcgatca</td><td>ctgccactc</td><td>tgttgtagac</td><td>agcagcagcg</td><td>agctaagctc</td><td>tgatctatcc</td><td> 600</td>

<td>ctgtcctcca</td><td>astcacaacg</td><td>ctctcctcga</td><td>gtccaattgc</td><td>atggggcttc</td><td>gaacctgtgc</td><td> 660</td>

<td>tccacgcccc</td><td>ccacgtacat</td><td>cctaaccttg</td><td>aagatggtga</td><td>agttgacagt</td><td>gcaggggtag</td><td> 720</td>

<td>tgccagagcc</td><td>tatatgggta</td><td>atgaaccata</td><td>cacctaggtg</td><td>tcagccaggg</td><td>cccagaaccg</td><td> 780</td>

<td>catctggcgt</td><td>aagtggcctc</td><td>ggggtgcttc</td><td>cgaaaacagt</td><td>cagtggggca</td><td>ggtcaaggtg</td><td> 840</td>

<td>ttgttgccgg</td><td>cccccccgat</td><td>gttgcacggg</td><td>gggcccccac</td><td>acgtcttggt</td><td>gaacccagtg</td><td> 900</td>

<td>ccattcatcc</td><td>atgtacagcc</td><td>gaaccagttg</td><td>ctcggcg</td><td>gccgcgtgtt</td><td>gttgagaatc</td><td> 960</td>

<td>agcacatccg</td><td>agtcgttcgc</td><td>cccccagtta</td><td>tacgtgggga</td><td>caccaaaccg</td><td>atcggtcgtc</td><td> 1020</td>

<td>cccaccacaa</td><td>caggctcgg</td><td>ggtgaagcaa</td><td>tacactggac</td><td>cgcacacctg</td><td>agacgcgggt</td><td> 1080</td>

<td>acaataccac</td><td>acggtcgagg</td><td>cgcgtagtgc</td><td>cagcagtagg</td><td>gcctctggtc</td><td>cgagctgtta</td><td> 1140</td>

<td>ggctcagtgt</td><td>aagtgagggg</td><td>accccacccc</td><td>tgagcgaact</td><td>tgtcgatgga</td><td>gcgacagctg</td><td> 1200</td>

<td>gccaagcgct</td><td>ctgggcatcc</td><td>agacgagttg</td><td>aatttgtgtt</td><td>tgtagaatag</td><td>tgcggcaaag</td><td> 1260</td>

<td>aaccctgttt</td><td>ggagggagtc</td><td>gttgcagttc</td><td>agggcagtcc</td><td>tgttgatgtg</td><td>ccaactgccg</td><td> 1320</td>

<td>ttggtgttta</td><td>cgagctggat</td><td>tttctgagcc</td><td>gacccggggc</td><td>taaagaggga</td><td>cacaaggccc</td><td> 1380</td>

<td>ctggtatcgg</td><td>aggctgctgc</td><td>ccctcctgac</td><td>acgcgggtat</td><td>gccttttatc</td><td>tagagatacc</td><td> 1440</td>

<td>ccttctttctt</td><td>tagcagcaat</td><td>gctggcaata</td><td>gtagtattta</td><td>taaacaataa</td><td>cccgttattt</td><td> 1500</td>

<td>gtgctgttgg</td><td>aaaatggcaa</td><td>aacagcaaca</td><td>tcgaaatccc</td><td>cttctaaatc</td><td>tgagtaaccg</td><td> 1560</td>

atgacagctt cagccggaat ttgtgccgtt tcatcttctg ttgtagtgtt gactggagca 1620

<td>gctaatgcgg</td><td>aggatgctgc</td><td>gaataaaact</td><td>gcagtaaaaa</td><td>ttgaaggaaa</td><td>tctcatgaat</td><td> 1680</td>

<td>tcccgatgaa</td><td>gcagagagcg</td><td>caggaggcgg</td><td>tatttatagt</td><td>gccattcccc</td><td>tctctgagag</td><td> 1740</td>

<td>acccggatgg</td><td>tagtcgagtg</td><td>tatcggagac</td><td>agcttgatgt</td><td>agactccgtg</td><td>ctgccggct</td><td> 1800</td>

<td>cctcttattg</td><td>gcggacacca</td><td>gtgagacacc</td><td>ccggaacttg</td><td>ctgtttttct</td><td>gcaaaatccg</td><td> 1860</td>

<td>gggtgaccag</td><td>tgggagccta</td><td>tttgcacaca</td><td>cgagcgggac</td><td>accccactct</td><td>ggtgaagagt</td><td> 1920</td>

<td>gccaaagtca.</td><td>ttctttttcc</td><td>cgttgcgggg</td><td>cagccgattg</td><td>catgttttag</td><td>gaaaatatta</td><td> 1980</td>

<td>cctttgctac</td><td>accctgtcag</td><td>atttaccctc</td><td>cacacatata</td><td>tattccgtca</td><td>cctccaggga</td><td> 2040</td>

<td>ctattattcg</td><td>tcgttgcgcc</td><td>gccagcggaa</td><td>gatatccaga</td><td>agctgttttc</td><td>cgagagactc</td><td> 2100</td>

<td>ggttggcgcc</td><td>tgctatattt</td><td>catggatgtc</td><td>gcgctgcctc</td><td>acgtcccggt</td><td>acccaggaac</td><td> 2160</td>

<td>gcggtgggat</td><td>ctccggccca</td><td>tcgaagactg</td><td>tgctccagac</td><td>tgctcgccca</td><td>gcaggtgttt</td><td> 2220</td>

<td>cttgatcgcc</td><td>gcctctaaat</td><td>tgtccgcgca</td><td>tcgccggtaa</td><td>catttttcca</td><td>gctcggagtt</td><td> 2280</td>

<td>tgcgtttaga</td><td>tacagtttct</td><td>gcgatgccaa</td><td>aggagcctgc</td><td>agattataac</td><td>ctcggatgct</td><td> 2340</td>

<td>gtcattcagc</td><td>gcttttaatt</td><td>tgacctccag</td><td>atagttgctg</td><td>tattctgtt</td><td>cccattggct</td><td> 2400</td>

<td>gctgcgcagc</td><td>ttcgtataac</td><td>tcgagttatt</td><td>gttgcgctct</td><td>gcctcggcgt</td><td>actggctcat</td><td> 2460</td>

<td>gatctggatc</td><td>ttgtccgtgt</td><td>cgctttttctt</td><td>cgagtgtttc</td><td>tcgcaaacga</td><td>tgtgcacggc</td><td> 2520</td>

<td>ctgcagtgtc</td><td>caatcggagt</td><td>cgagctggcg</td><td>ccgaaactgg</td><td>cggatctgag</td><td>cctccacact</td><td> 2580</td>

<td>gccctgtttc</td><td>tctatccacg</td><td>gcggaaccgc</td><td>ctcctgccgt</td><td>ttcagaatgt</td><td>tgttcaagtg</td><td> 2640</td>

<td>gtactctgtg</td><td>cggtcaatga</td><td>aggcgttatt</td><td>gccggtgaaa</td><td>tctttgggaa</td><td>gcggttttcc</td><td> 2700</td>

<td>tcggggaaga</td><td>ttachagaatt</td><td>ccccgcgtcg</td><td>ttgcgcttcc</td><td>tggatctcga</td><td>ggagatcgtt</td><td> 2760</td>

<td>ctccgcgtcg</td><td>aggagatcgt</td><td>tctccgcgtc</td><td>gacaccattc</td><td>cttggcggcgg</td><td>cggtgctcaa</td><td> 2820</td>

<td>cggcctcaac</td><td>ctactactag</td><td>gctgcttcct</td><td>aatgcaggag</td><td>tcgcataagg</td><td>gagagcgtcg</td><td> 2880</td>

<td>acaaacccgc</td><td>gtttgagaac</td><td>ttgctcaagc</td><td>ttctggtaaa</td><td>cgttgtagta</td><td>ctctgaaaca</td><td> 2940</td>

aggccctagc actctgatct gtttctcttg ggtagcggtg agtggtttat tggagttcac 3000 tggtttcagc acatctgtca tctagacaat attgttacta aatttttttg aactacaatt 3060 gttcgtaatt catctattat tatacatcct cgtcagcaat ttctggcaga cggagtttac 3120 taacgtcttg agtatgaggc cgagaatcca gctctgtggc catactcagt cttgacagcc 3180 tgctgatgtg gctgcgttca acgcaataag cgtgtcctcc gactccgagt tgtgctcgtt 3240 atcgtcgttc tcatcctcgg aaaaatcaca cgaaagaaca tactcaccag taggctttct 3300 ggtccctggg gcacggctgt ttctgacgta ttccggcgtt gataatagct cgaaagtgaa 3360 cgccgagtcg cgggagtcga ccgatgccct tgagagcctt caacccagtc agctccttcc 3420 ggtgggcgcg gggcatgact atcgtcgccg cacttatgac tgtcttcttt atcatgcaac 3480 tcgtaggaca ggtgccggca gcgctctggg tcattttcgg cgaggaccgc tttcgctgga 3540 gcgcgacgat gatcggcctg tcgcttgcgg tattcggaat cttgcacgcc ctcgctcaag 3600 ccttcgtcac tggtcccgcc accaaacgtt tcggcgagaa gcaggccatt atcgccggca 3660 tggcggccga cgcgctgggc tacgtcttgc tggcgttcgc gacgcgaggc tggatggcct 3720 tccccattat gattcttctc gcttccggcg gcatcgggat gcccgcgttg caggccatgc 3780 tgtccaggca ggtagatgac gaccatcagg gacagcttca aggatcgctc gcggctctta 3840 ccagcctaac ttcgatcact ggaccgctga tcgtcacggc gatttatgcc gcctcggcga 3900 gcacatggaa cgggttggca tggattgtag gcgccgccct ataccttgtc tgcctccccg 3960 cgttgcgtcg cggtgcatag agccgcgcca cctcgacctg aatagaagcc ggcggcacct 4020 cgctaacgga ttcaccactc caagaattgg agccaatcaa ttcttgcgga gaactgtgaa 4080 tgcgcaaacc aacccttggc agaacatatc catcgcgtcc gccatctcca gcagccgcac 4140 gcggcgcatc gggggggggg gggggggggg ggggcaaaca attcatcatt ttttttttat 4200 gaagaacgaa ggaaggagca cagacttaga ttggtatata tacgcatatg tagtgttgaa 4320 gaaacatgaa attgcccagt attcttaacc caactgcaca gaacaaaaac ctgcaggaaa 4380 cgaagataaa tcatgtcgaa agctacatat aaggaacgtg ctgctactca tcctagtcct 4440

<td>gttgctgcca</td><td>agctatttaa</td><td>tatcatgcac</td><td>gaaaagcaaa</td><td>caaacttgtg</td><td>tgcttcattg</td><td> 4500</td>

<td>gatgttcgta</td><td>ccaccaaaga</td><td>attactggag</td><td>ttagttaaag</td><td>cattaggtcc</td><td>caaaatttgt</td><td> 4560</td>

<td>ttactaaaaa</td><td>cacatgtgga</td><td>tatcttgact</td><td>gattttcca</td><td>tggaaggcac</td><td>agttaagccg</td><td> 4620</td>

<td>ctaaaggcat</td><td>tatccgccaa</td><td>gtacaatttt</td><td>ttactcttcg</td><td>aagacagaaa</td><td>atttgctgac</td><td> 4680</td>

<td>attggtaata</td><td>cagtcaaatt</td><td>gcagtactct</td><td>gcgggtgtat</td><td>acagaatagc</td><td>agaatgggca</td><td> 4740</td>

<td>gacattacga</td><td>atgcacacgg</td><td>tgtggtgggc</td><td>ccaggtattg</td><td>ttagcggttt</td><td>gaagcaggcg</td><td> 4800</td>

<td>gcagaagaag</td><td>taacaaagga</td><td>acctagaggc</td><td>cttttgatgt</td><td>tagcagaatt</td><td>gtcatgcaag</td><td> 4860</td>

<td>ggctccctat</td><td>ctactggaga</td><td>atatactaag</td><td>ggtactgttg</td><td>acattgcgaa</td><td>gagcgacaaa</td><td> 4920</td>

<td>gattttgtta</td><td>tcggctttat</td><td>tgctcaaaga</td><td>gacatgggtg</td><td>gaagagatga</td><td>aggttacgat</td><td> 4980</td>

tggttgatta tgacacccgg tgtgggttta gatgacaagg gagacgcatt gggtcaacag 5040 tatagaaccg tggatgatgt ggtctctaca ggatctgaca ttattattgt tggaagagga 5100 ctatttgcaa agggaaggga tgctaaggta gagggtgaac gttacagaaa agcaggctgg 5160 gaagcatatt tgagaagatg cggccagcaa aactaaaaaa ctgtattata agtaaatgca 5220 tgtatacta actcacaaat tagagcttca atttaattat atcagttatt acccgggaat 5280 ctcggtcgta atgattttta taatgacgaa aaaaaaaaa ttggaaagaa aagccccccc 5340 cccccccccc cccccccccc cccccccgca gcgttgggtc ctggccacgg gtgcgcatga 5400 tcgtgctcct gtcgttgagg acccggctag gctggcgggg ttgccttact ggttagcaga 5460 atgaatcacc gatacgcgag cgaacgtgaa gcgactgctg ctgcaaaacg tctgcgacct 5520 gagcaacaac atgaatggtc ttcggtttcc gtgtttcgta aagtctggaa acgcggaagt 5580 cagcgccctg caccattatg ttccggatct gcatcgcagg atgctgctgg ctaccctgtg 5640 gaacacctac atctgtatta acgaagcgct ggcattgacc ctgagtgatt tttctctggt 5700 cccgccgcat ccataccgcc agttgtttac cctcacaacg ttccagtaac cgggcatgtt 5760 catcatcagt aacccgtatc gtgagcatcc tctctcgttt catcggtatc attaccccca 5820

<td>tgaacagaaa</td><td>ttccccctta</td><td>cacggaggca</td><td>tcaagtgacc</td><td>aaacaggaaa</td><td>aaaccgccct</td><td> 5880</td>

<td>taacatggcc</td><td>cgctttatca</td><td>gaagccagac</td><td>attaacgctt</td><td>ctggagaaac</td><td>tcaacgagct</td><td> 5940</td>

<td>ggacgcgaat</td><td>gaacaggcag</td><td>acatctgtga</td><td>atcgcttcac</td><td>gaccacgctg</td><td>atgagcttta</td><td> 6000</td>

<td>ccgcagctgc</td><td>ctcgcgcgtt</td><td>tcggtgataa</td><td>cggtgaaaac</td><td>ctctgacaca</td><td>tgcagctccc</td><td> 6060</td>

<td>ggagacgctc</td><td>acagcttgtc</td><td>tgtaagcgga</td><td>tgccgggagc</td><td>agacaagccc</td><td>gtcagggcgc</td><td> 6120</td>

<td>gtcagcgggt</td><td>gttggcgggt</td><td>gtcggggcgc</td><td>agccatgacc</td><td>cagtcacgta</td><td>gcgatagcgg</td><td> 6180</td>

<td>agtgtatact</td><td>ggcttaacta</td><td>tgggcatca</td><td>gagcagattg</td><td>tactgagagt</td><td>gcaccatatg</td><td> 6240</td>

<td>cggtgtgaaa</td><td>taccgcacag</td><td>atgcgtaagg</td><td>agaaaatacc</td><td>gcatcaggcg</td><td>ctcttccgct</td><td> 6300</td>

<td>tcctcgctca</td><td>ctgactcgct</td><td>gcgctcggtc</td><td>gttcggctgc</td><td>ggcgagcggt</td><td>atcagctcac</td><td> 6360</td>

<td>tcaaaggcgg</td><td>taatacggtt</td><td>atccacagaa</td><td>tcaggggata</td><td>acgcaggaaa</td><td>gaacatgtga</td><td> 6420</td>

<td>gcaaaaggcc</td><td>agcaaaaggc</td><td>caggaaccgt</td><td>aaaaaggccg</td><td>cgttgctggc</td><td>gttttttccat</td><td> 6480</td>

<td>aggctccgcc</td><td>cccctgacga</td><td>gcatcacaaa</td><td>aatcgacgct</td><td>caagtcagag</td><td>gtggcgaaac</td><td> 6540</td>

<td>ccgacaggac</td><td>tataaagata</td><td>ccaggcgttt</td><td>ccccctggaa</td><td>gctccctcgt</td><td>gcgctctcct</td><td> 6600</td>

<td>gttccgaccc</td><td>tgccgcttac</td><td>cggatacctg</td><td>tccgcctttc</td><td>tccttcggg</td><td>aagcgtggcg</td><td> 6660</td>

<td>ctttctcata</td><td>gctcacgctg</td><td>taggtatctc</td><td>agttcggtgt</td><td>aggtcgttcg</td><td>ctccaagctg</td><td> 6720</td>

<td>ggctgtgtgc</td><td>acgaaccccc</td><td>cgttcagccc</td><td>gaccgctgcg</td><td>ccttatccgg</td><td>taactatcgt</td><td> 6780</td>

<td>cttgagtcca</td><td>acccggtaag</td><td>acacgactta</td><td>tcgccactgg</td><td>cagcagccac</td><td>tggtaacagg</td><td> 6840</td>

<td>attagcagag</td><td>cgaggtatgt</td><td>aggcggtgct</td><td>acagagttct</td><td>tgaagtggtg</td><td>gcctaactac</td><td> 6900</td>

<td>ggctacacta</td><td>gaaggacagt</td><td>atttggtatc</td><td>tgcgctctgc</td><td>tgaagccagt</td><td>taccttcgga</td><td> 6960</td>

<td>aaaagagttg</td><td>gtagctcttg</td><td>atccggcaaa</td><td>caaaccaccg</td><td>ctggtagcgg</td><td>tggtttttttt</td><td> 7020</td>

<td>gtttgcaagc</td><td>agcagattac</td><td>gcgcagaaaa</td><td>aaaggatctc</td><td>aagaagatcc</td><td>tttgatcttt</td><td> 7080</td>

<td>tctacggggt</td><td>ctgacgctca</td><td>gtggaacgaa</td><td>aactcacgtt</td><td>aagggattt</td><td>ggtcatgaga</td><td> 7140</td>

ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc 7200

<td>taaagtatat</td><td>atgagtaaac</td><td>ttggtctgac</td><td>agttaccaat</td><td>gcttaatcag</td><td>tgaggcacct</td><td> 7260</td>

<td>atctcagcga</td><td>tctgtctatt</td><td>tcgttcatcc</td><td>atagttgcct</td><td>gactccccgt</td><td>cgtgtagata</td><td> 7320</td>

<td>actacgatac</td><td>gggagggctt</td><td>accatctggc</td><td>cccagtgctg</td><td>catgatacc</td><td>gcgagaccca</td><td> 7380</td>

<td>cgctcaccgg</td><td>ctccagattt</td><td>atcagcaata</td><td>aaccagccag</td><td>ccggaagggc</td><td>cgagcgcaga</td><td> 7440</td>

<td>agtggtcctg</td><td>caactttatc</td><td>cgcctccatc</td><td>cagtctatta</td><td>attgttgccg</td><td>ggaagctaga</td><td> 7500</td>

<td>gtaagtagtt</td><td>cgccagttaa</td><td>tagtttgcgc</td><td>aacgttgttg</td><td>ccattgctgc</td><td>aggcatcgtg</td><td> 7560</td>

<td>gtgtcacgct</td><td>cgtcgtttgg</td><td>tatggcttca</td><td>ttcagctccg</td><td>gttcccaacg</td><td>atcaaggcga</td><td> 7620</td>

<td>gttacatgat</td><td>cccccatgtt</td><td>gtgcaaaaaa</td><td>gcggttagct</td><td>ccttcggtcc</td><td>tccgatcgtt</td><td> 7680</td>

<td>gtcagaagta</td><td>agttgaccgc</td><td>agtgttatca</td><td>ctcatggtta</td><td>tggcagcact</td><td>gcataattct</td><td> 7740</td>

<td>cttactgtca</td><td>tgccatccgt</td><td>aagatgcttt</td><td>tctgtcactg</td><td>gtgagtactc</td><td>aaccaagtca</td><td> 7800</td>

<td>ttctgagaat</td><td>aatgtatgcg</td><td>gcgaccgagt</td><td>tgctcttgcc</td><td>cggcgtcaac</td><td>acgggataat</td><td> 7860</td>

<td>accgcgccac</td><td>atagcagaac</td><td>tttaaaagtg</td><td>ctcatcattg</td><td>gaaaacgttc</td><td>ttcggggcga</td><td> 7920</td>

<td>aaactctcaa</td><td>ggatcttacc</td><td>gctgttgaga</td><td>tccagttcga</td><td>tgtaacccac</td><td>tcgtgcaccc</td><td> 7980</td>

<td>aactgatctt</td><td>cagcatcttt</td><td>tactttcacc</td><td>agcgtttctg</td><td>ggtgagcaaa</td><td>aacaggaagg</td><td> 8040</td>

<td>caaaatgccg</td><td>caaaaaaggg</td><td>aataagggcg</td><td>acacggaaat</td><td>gttgaatact</td><td>catactcttc</td><td> 8100</td>

<td>ctttttcaat</td><td>attattgaag</td><td>catttatcag</td><td>ggttattgtc</td><td>tcatgagcgg</td><td>atacatattt</td><td> 8160</td>

<td>gaatgtattt</td><td>agaaaaataa</td><td>acaaataggg</td><td>gttccgcgca</td><td>catttccccg</td><td>aaaagtgcca</td><td> 8220</td>

<td>cctgacgtct</td><td>aagaaaccat</td><td>tattatcatg</td><td>acattaacct</td><td>ataaaatag</td><td>gcgtatcacg</td><td> 8280</td>

<td>aggccctttc</td><td>gtcttcaa</td><td></td><td></td><td></td><td></td><td> 8298</td>

<210> 25 <211> 8695 <212> DNA <213> pMPT-Mfalfa-E2-H6 Vector <220>

<td colspan="7"><221> MISCELLANEOUS</td>

<td colspan="3"><222> (2103).. (2103) <223> N is any nucleotide</td><td></td><td></td><td></td><td></td>

<td><400> 25 ggtaccctgc</td><td>tcaatctccg</td><td>gaatggtgat</td><td>ctgatcgttc</td><td>ctgaaaacct</td><td>cgacattggc</td><td> 60</td>

<td>tCCCtCCtyâ</td><td>cacaggtact</td><td>cgtacaggtt</td><td>ccaggtaaac</td><td>gagtcgtagt</td><td>tgtcgatcat</td><td> 120</td>

<td>gacaacgttc</td><td>ttagaagcgg</td><td>ccggcatttt</td><td>gaaggtgact</td><td>aatagcctaa</td><td>gaaaatattt</td><td> 180</td>

<td>aatttaattt</td><td>tcattaaatt</td><td>ttcctatact</td><td>cgctatttca</td><td>gcttttcatc</td><td>tcatcacttc</td><td> 240</td>

<td>ataaacgata</td><td>taaaccagaa</td><td>aaagaactat</td><td>tttcaaacac</td><td>gcttctcaaa</td><td>agcggtatgt</td><td> 300</td>

<td>ccttccacgt</td><td>ctccttagaa</td><td>tctggcaagt</td><td>ccgcgagggg</td><td>gatccagatc</td><td>tgatagcttt</td><td> 360</td>

<td>caatcaatga</td><td>atcgaaaatg</td><td>tcattaaaat</td><td>agtatataaa</td><td>ttgaaactaa</td><td>gtcataaagc</td><td> 420</td>

<td>tataaaaaga</td><td>aaatttatt</td><td>aaatgcaaga</td><td>ctttaaagta</td><td>aattcactta</td><td>agccttggca</td><td> 480</td>

<td>acgtgttcaa</td><td>ccaagtcgag</td><td>atcgttaatt</td><td>aactattagt</td><td>gatggtggtg</td><td>atggtgtctg</td><td> 540</td>

<td>ccctcgatca</td><td>ctgccactc</td><td>tgttgtagac</td><td>agcagcagcg</td><td>agctaagctc</td><td>tgatctatcc</td><td> 600</td>

<td>ctgtcctcca</td><td>agtcacaacg</td><td>ctctcctcga</td><td>gtccaattgc</td><td>atggggcttc</td><td>gaacctgtgc</td><td> 660</td>

<td>tccacgcccc</td><td>ccacgtacat</td><td>cctaaccttg</td><td>aagatggtga</td><td>agttgacagt</td><td>gcaggggtag</td><td> 720</td>

<td>tgccagagcc</td><td>tacatgggta</td><td>atgaaccata</td><td>cacctaggtg</td><td>tcagccaggg</td><td>cccagaaccg</td><td> 780</td>

<td>catctggcgt</td><td>aagtggcctc</td><td>ggggtgcttc</td><td>cgaaaacagt</td><td>cagtggggca</td><td>ggtcaaggtg</td><td> 840</td>

<td>ttgttgccgg</td><td>cccccccgat</td><td>gttgcacggg</td><td colspan="3">ggcccccac acgtcttggt gaacccagtg !</td><td> 900</td>

<td>ccattcatcc</td><td>atgtacagcc</td><td>gaaccagttg</td><td>ctcggcg</td><td>gccgcgtgtt</td><td>gttgagaatc</td><td> 960</td>

<td>agcacatccg</td><td>agtcgttcgc</td><td>cccccagtta</td><td>tacgtgggga</td><td>caccaaaccg</td><td>atcggtcgtc</td><td> 1020</td>

<td>cccaccacaa</td><td>caggctcgg</td><td>ggtgaagcaa</td><td>tacactggac</td><td>cgcacacctg</td><td>agacgcgggt</td><td> 1080</td>

<td>acaataccac</td><td>acggtcgagg</td><td>cgcgtagtgc</td><td>cagcagtagg</td><td>gcctctggtc</td><td>cgagctgtta</td><td> 1140</td>

ggctcagtgt aagtctagggg accccacccc tgagcgaact tgtcgatgga gcgacagctg 1200 gccaagcgct ctgggcatcc agacgagttg aatttgtgtt tgtagaatag tgcggcaaag 1260 aaccctgttt ggagggagtc gttgcagttc agggcagtcc tgttgatgtg ccaactgccg 1320 ttggtgttta cgagctggat tttctgagcc gacccggggc taaagaggga cacaaggccc 1380 ctggtatcgg aggctgctgc ccctcctgac acgcgggtat gccttttatc tagagatacc 1440 ccttcttctt tagcagcaat gctggcaata gtagtattta taaacaataa cccgttattt 1500 gtgctgttgg aaaatggcaa aacagcaaca tcgaaatccc cttctaaatc tgagtaaccg 1560 atgacagctt cagccggaat ttgtgccgtt tcatcttctg ttgtagtgtt gactggagca 1620 gctaatgcgg aggatgctgc gaataaaact gcagtaaaaa ttgaaggaaa tctcatgaat 1680 tcgtttttgt actttagatt gatgtcacca ccgtgcactg gcagcagtat ttatagatgg 1740

<td>accgtgtggg</td><td>gacggttggg</td><td>tacacttagc</td><td>ggcagcgctg</td><td>accccatctg</td><td>tgatcaagta</td><td> 1800</td>

<td>gggcaaaaac</td><td>tcgggatgtc</td><td>ggagtcgctg</td><td>cacggtagca</td><td>taagaattta</td><td>ctttctggcc</td><td> 1860</td>

<td>ggttcacccg</td><td>catttgcact</td><td>gtggagaaac</td><td>agcctgtccg</td><td>acaccccacc</td><td>agttgccaca</td><td> 1920</td>

<td>tcggccctct</td><td>gctgctctgg</td><td>tgattttctg</td><td>gtagcaggca</td><td>cagacagcag</td><td>tgggtagcgc</td><td> 1980</td>

<td>cgtccggtta</td><td>ggcaaggtca</td><td>cgttgtaggc</td><td>taccccagca</td><td>aacagagcct</td><td>cacatgacac</td><td> 2040</td>

<td>catccagctg</td><td>cgtcctcgaa</td><td>gcgaaaagtt</td><td>cggttggcggc</td><td>tgcagaaccc</td><td>cctcagttgc</td><td> 2100</td>

<td>canattcaca</td><td>agttttacgc</td><td>gacggctaaa</td><td>gcgagtgggt</td><td>tttaaaaact</td><td>tgcggtgcaa</td><td> 2160</td>

<td>ggatgcatgc</td><td>ggcaacaatt</td><td>aattggtgca</td><td>tccagcacag</td><td>caagcccagt</td><td>ctcgagatgt</td><td> 2220</td>

<td>ccagtcgcta</td><td>cagagtggag</td><td>tacgcactca</td><td>aggaacaccg</td><td>tcgagatggc</td><td>ctcatagaat</td><td> 2280</td>

<td>ggatcaaggg</td><td>ctgctggcc</td><td>acgccgttcg</td><td>tcctgtacgc</td><td>ggtgaagagc</td><td>aacggcatct</td><td> 2340</td>

<td>ctgcagtgga</td><td>cgacctcatg</td><td>gtaaactctg</td><td>aggcaaaacg</td><td>ccgctacgcg</td><td>gaaatcttcc</td><td> 2400</td>

<td>acgacctcga</td><td>actcctcatc</td><td>gacgacaaca</td><td>ttgaaatgac</td><td>caaagccggc</td><td>acccccgaat</td><td> 2460</td>

<td>tgtctcggct</td><td>cgtgcagctg</td><td>gttccgagcg</td><td>ttggcagctt</td><td>cttcacgaga</td><td>ctgcctctgg</td><td> 2520</td>

aaaaggcctt ctacatcaag gacgagcgcc gcgccatcag caaacgccgg cttgtggccc 2580

<td>cctcgttcaa</td><td>cgacgtccgg</td><td>ctcattctca</td><td>acacgaccca</td><td>gctgttggag</td><td>atgtcgcggt</td><td> 2640</td>

<td>tcttccattc</td><td>caaaaccatc</td><td>cgagatcgca</td><td>agctgcagct</td><td>cattacattc</td><td>gatggtgaca</td><td> 2700</td>

<td>tcacactgta</td><td>cgacgacggc</td><td>aaaaatttcg</td><td>atgccgagtc</td><td>gcccatcctg</td><td>ccccacctca</td><td> 2760</td>

<td>tcaaactaat</td><td>ggccaaggac</td><td>ctctatgtgg</td><td>gtatcgtcac</td><td>cggccggc</td><td>tacagcgacg</td><td> 2820</td>

<td>gaacaagtac</td><td>tacgagcgcc</td><td>tcaagggcct</td><td>catcgacgcc</td><td>gtccagacgt</td><td>ccccgctgct</td><td> 2880</td>

<td>cacaggccac</td><td>cagaaagaga</td><td>actgttcat</td><td>tatggggcggc</td><td>gaggcaaact</td><td>accctttccg</td><td> 2940</td>

<td>gtacagtaac</td><td>gaggagcaga</td><td>gattacgctt</td><td>ctactccaaa</td><td>gacagatggc</td><td>tgctcgagaa</td><td> 3000</td>

<td>catgctgaat</td><td>tggtccgagg</td><td>aggacattca</td><td>tctgacactg</td><td>gactttgcgc</td><td>aggacgttct</td><td> 3060</td>

<td>aaacaacctc</td><td>gttcacaaac</td><td>tgggctcgcc</td><td>agccaccgtg</td><td>gtccgcaagg</td><td>agcgtcgcgt</td><td> 3120</td>

<td>cggcctggtt</td><td>ccattaccgg</td><td>gccacaagct</td><td>gatccgcgag</td><td>cagctcgagg</td><td>agatcgttct</td><td> 3180</td>

<td>ccgcgtcgac</td><td>accattcctt</td><td>gcggcggcgg</td><td>tgctcaacgg</td><td>cctcaaccta</td><td>ctactgggct</td><td> 3240</td>

<td>gcttcctaat</td><td>gcaggagtcg</td><td>cataagggag</td><td>agcgtcgact</td><td>cccgcgactc</td><td>ggcgttcact</td><td> 3300</td>

<td>ttcgagctat</td><td>tatcaacgcc</td><td>ggaatacgtc</td><td>agaaacagcc</td><td>gtgccccagg</td><td>gaccagaaag</td><td> 3360</td>

<td>cctactggtg</td><td>agtatgttct</td><td>ttcgtgtgat</td><td>ttttccgagg</td><td>atgagaacga</td><td>cgataacgag</td><td> 3420</td>

<td>cacaactcgg</td><td>agtcggagga</td><td>cacgcttatt</td><td>gcgttgaacg</td><td>cagccacatc</td><td>agcaggctgt</td><td> 3480</td>

<td>caagactgag</td><td>tatggccaca</td><td>gagctggatt</td><td>ctcggcctca</td><td>tactcaagac</td><td>gttagtaaac</td><td> 3540</td>

<td>tccgtctgcc</td><td>agaaattgct</td><td>gacgaggatg</td><td>tataataata</td><td>gatgaattac</td><td>gaacaattgt</td><td> 3600</td>

<td>agttcaaaaa</td><td>aatttagtaa</td><td>caatattgtc</td><td>tagatgacag</td><td>atgtgctgaa</td><td>accagtgaac</td><td> 3660</td>

<td>tccaataaac</td><td>cactcaccgc</td><td>tacccaagag</td><td>aaacagatca</td><td>gagtgctagg</td><td>gccttgtttc</td><td> 3720</td>

<td>agagtactac</td><td>aacgtttacc</td><td>agaagcttga</td><td>gcaagttctc</td><td>aaacgcgggt</td><td>ttgtcgaccg</td><td> 3780</td>

<td>atgcccttga</td><td>gagccttcaa</td><td>cccagtcagc</td><td>tccttccggt</td><td>gggcgcgggg</td><td>catgactatc</td><td> 3840</td>

<td>gtcgccgcac</td><td>ttatgactgt</td><td>cttctttatc</td><td>atgcaactcg</td><td>taggacaggt</td><td>gccggcagcg</td><td> 3900</td>

ctctgggtca ttttcggcga ggaccgcttt cgctggagcg cgacgatgat cggcctgtcg 3960 cttgcggtat tcggaatctt gcacgccctc gctcaagcct tcgtcactgg tcccgccacc 4020 aaacgtttcg gcgagaagca ggccattatc gccggcatgg cggccgacgc gctgggctac 4080 gtcttgctgg cgttcgcgac gcgaggctgg atggccttcc ccattatgat tcttctcgct 4140 tccggcggca tcgggatgcc cgcgttgcag gccatgctgt ccaggcaggt agatgacgac 4200 catcagggac agcttcaagg atcgctcgcg gctcttacca gcctaacttc gatcactgga 4260 ccgctgatcg tcacggcgat ttatgccgcc tcggcgagca catggaacgg gttggcatgg 4320 attgtaggcg ccgccctata ccttgtctgc ctccccgcgt tgcgtcgcgg tgcatggagc 4380 ccagccacct caacctgaat ggaaaccggc ggcacctcgc taacggattc accactccaa 4440 gaattggagc caatcaattc ttgcggagaa ctgtgaatgc gcaaaccaac ccttggcaga 4500 acatatccat cgcgtccgcc atctccagca gccgcacccg gcgcatcggg cggggggggg 4560 gggggggggg gcaaacaatt catcattttt tttttattct tttttttgat ttcggtttct 4620 ttgaaatttt tttgattcgg taatctccga acagaaggaa gaacgaagga aggagcacag 4680 acttagattg gtatatatac gcatatgtag tgttgaagaa acatgaaatt gcccagtatt 4740 cttaacccaa ctgcacagaa caaaaacctg caggaaacga agataaatca tgtcgaaagc 4800 tacatataag gaacgtgctg ctactcatcc tagtcctgtt gctgccaagc tatttaatat 4860 catgcacgaa aagcaaacaa acttgtgtgc ttcattggat gttcgtacca ccaaggaatt 4920 actggagtta gttgaagcat taggtcccaa aatttgttta ctaaaaacac atgtggatat 4980 cttgactgat ttttccatgg agggcacagt taagccgcta aaggcattat ccgccaagta 5040 caatttttta ctcttcgaag acagaaaatt tgctgacatt ggtaatacag tcaaattgca 5100 gtactctgcg ggtgtataca gaatagcaga atgggcagac attacgaatg cacacggtgt 5160 ggtgggccca ggtattgtta gcggtttgaa gcaggcggca gaagaagtaa caaaggaacc 5220 tagaggcctt ttgatgttag cagaattgtc atgcaagggc tccctatcta ctggagaata 5280 tactaagggt actgttgaca ttgcgaagag cgacaaagat tttgttatcg gctttattgc 5340

<td>tcaaagagac</td><td>atgggtggaa</td><td>gagatgaagg</td><td>ttacgattgg</td><td>ttgattatga</td><td>cacccggtgt</td><td> 5400</td>

<td>gggtttagat</td><td>gacaagggag</td><td>acgcattggg</td><td>tcaacagtat</td><td>agaaccgtgg</td><td>atgatgtggt</td><td> 5460</td>

<td>ctctacagga</td><td>tctgacatta</td><td>ttattgttgg</td><td>aagaggacta</td><td>tttgcaaagg</td><td>gaagggatgc</td><td> 5520</td>

<td>tagtagag</td><td>ggtgaacgtt</td><td>acagaaaagc</td><td>aggctgggaa</td><td>gcatatttga</td><td>gaagatggg</td><td> 5580</td>

<td>ccagcaaaac</td><td>taaaaaactg</td><td>tattataagt</td><td>aaatgcatgt</td><td>atactaaact</td><td>cacaaattag</td><td> 5640</td>

<td>agcttcaatt</td><td>taattatatc</td><td>agttattacc</td><td>cgggaatctc</td><td>ggtcgtaatg</td><td>atttttataa</td><td> 5700</td>

<td>tgacgaaaaa</td><td>aaaaaaattg</td><td>gaaagaaaag</td><td>cccccccccc</td><td>cccccccccc</td><td>cccccccccc</td><td> 5760</td>

<td>ccccgcagcg</td><td>ttgggtcctg</td><td>gccacgggtg</td><td>cgcatgatcg</td><td>tgctcctgtc</td><td>gttgaggacc</td><td> 5820</td>

<td>cggctaggct</td><td>gggggttg</td><td>ccttactggt</td><td>tagcagaatg</td><td>aatcaccgat</td><td>acgcgagcga</td><td> 5880</td>

<td>acgtgaagcg</td><td>actgctgctg</td><td>caaaacgtct</td><td>gcgacctgag</td><td>caacaacatag</td><td>aatggtcttc</td><td> 5940</td>

<td>ggtttccgtg</td><td>tttcgtaaag</td><td>tctggaaacg</td><td>cggaagtcag</td><td>cgccctgcac</td><td>cattatgttc</td><td> 6000</td>

<td>cggatctgca</td><td>tcgcaggatg</td><td>ctgctggcta</td><td>ccctgtggaa</td><td>cacctacatc</td><td>tgtattaacg</td><td> 6060</td>

<td>aagcgctggc</td><td>attgaccctg</td><td>agtgattttt</td><td>ctctggtccc</td><td>gccgcatcca</td><td>taccgccagt</td><td> 6120</td>

<td>tgtttaccct</td><td>cacaacgttc</td><td>cagtaaccgg</td><td>gcatgttcat</td><td>catcagtaac</td><td>ccgtatcgtg</td><td> 6180</td>

<td>aacatcctct</td><td>ctcgtttcag</td><td>cggtatcatt</td><td>acccccatga</td><td>acagaaattc</td><td>ccccttacac</td><td> 6240</td>

<td>ggagccatca</td><td>agtgaccaaa</td><td>caggaaaaaa</td><td>ccgcccttaa</td><td>catggcccgc</td><td>tttatcagaa</td><td> 6300</td>

<td>gccagacatt</td><td>aacacttctg</td><td>gaaaaactca</td><td>acgagctaga</td><td>cgcggatgaa</td><td>cacgcagaca</td><td> 6360</td>

<td>tctgtgaatc</td><td>gcttcacgac</td><td>cacgctgatg</td><td>agctttaccg</td><td>cagctgcctc</td><td>gcgcgtttcg</td><td> 6420</td>

<td>gtgatgacgg</td><td>tgaaaacctc</td><td>tgacacatgc</td><td>agctcccgga</td><td>gacggtcaca</td><td>gcttgtctgt</td><td> 6480</td>

<td>aagcggatgc</td><td>cgggagcaga</td><td>caagcccgtc</td><td>agggcgcgtc</td><td>agcgggtgtt</td><td>ggggtgtc</td><td> 6540</td>

<td>gggcgcagc</td><td>catgacccag</td><td>tcacgtagcg</td><td>atagcggagt</td><td>gtatactggc</td><td>ttaactatgc</td><td> 6600</td>

<td>ggcatcagag</td><td>cagattgtac</td><td>tgagagtgca</td><td>ccatatgcgg</td><td>tgtgaaatac</td><td>cgcacagatg</td><td> 6660</td>

cgtaaggaga aaataccgca tcaggcgctc ttccgcttcc tcgctcactg actcgctgcg 6720 ctcggtcgtt cggctgcgac gagcggtatc agctcactca aaggcggtaa tacggttatc 6780 cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag 6840 gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 6900 tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca 6960 ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 7020 atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag 7080

<td>gtatctcagt</td><td>tcggtgtagg</td><td>tcgttcgctc</td><td>caagctgggc</td><td>tgtgtgcacg</td><td>aaccccccgt</td><td> 7140</td>

<td>tcagcccgac</td><td>cgctgcgcct</td><td>tatccggtaa</td><td>ctatcgtctt</td><td>gagtccaacc</td><td>cggtaagaca</td><td> 7200</td>

<td>cgacttatcg</td><td>ccactggcag</td><td>cagccactgg</td><td>taacaggatt</td><td>agcagagcga</td><td>ggtatgtagg</td><td> 7260</td>

<td>cggtgctaca</td><td>gagttcttga</td><td>agtggtggcc</td><td>taactacggc</td><td>tacactagaa</td><td>ggacagtatt</td><td> 7320</td>

<td>tggtatctgc</td><td>gctctgctga</td><td>agccagttac</td><td>cttcggaaaa</td><td>agagttggta</td><td>gctcttgatc</td><td> 7380</td>

<td>cggcaaacaa</td><td>accaccgctg</td><td>gtagcggtgg</td><td>tttttttgtt</td><td>tgcaagcagc</td><td>agattacgcg</td><td> 7440</td>

<td>cagaaaaaaa</td><td>ggatctcaag</td><td>aagatcctt</td><td>gatctttttct</td><td>acggggtctg</td><td>acgctcagtg</td><td> 7500</td>

<td>gaacgaaaac</td><td>tcacgttaag</td><td>ggattttggt</td><td>catgagatta</td><td>tcaaaaagga</td><td>tcttcaccta</td><td> 7560</td>

<td>gatcctttta</td><td>aattaaaaat</td><td>gaagttttaa</td><td>atcaatctaa</td><td>agtatatatg</td><td>agtaaacttg</td><td> 7620</td>

<td>gtctgacagt</td><td>taccaatgct</td><td>taatcagtga</td><td>ggcacctatc</td><td>tcagcgatct</td><td>gtctatttcg</td><td> 7680</td>

<td>ttcatccata</td><td>gttgcctgac</td><td>tccccgtcgt</td><td>gtagataact</td><td>acgatacggg</td><td>agggcttacc</td><td> 7740</td>

<td>atctggcccc</td><td>agtgctgcaa</td><td>tgataccgcg</td><td>agacccacgc</td><td>tcaccggctc</td><td>cagattatc</td><td> 7800</td>

<td>agcaataaac</td><td>cagccagccg</td><td>gaagggccga</td><td>gcgcagaagt</td><td>ggtcctgcaa</td><td>ctttatccgc</td><td> 7860</td>

<td>ctccatccag</td><td>tctattaatt</td><td>gttgccggga</td><td>agctagagta</td><td>agtagttcgc</td><td>cagttaatag</td><td> 7920</td>

<td>tttgcgcaac</td><td>gttgttgcca</td><td>ttgctgcagg</td><td>catcgtggtg</td><td>tcacgctcgt</td><td>cgtttggtat</td><td> 7980</td>

<td>ggcttcattc</td><td>agctccggtt</td><td>cccaacgatc</td><td>aaggcgagtt</td><td>acatgatccc</td><td>ccatgttgtg</td><td> 8040</td>

caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt 8100

<td>gttatcactc</td><td>atggttatgg</td><td>cagcactgca</td><td>taattctctt</td><td>actgtcatgc</td><td>catccgtaag</td><td> 8160</td>

<td>atgcttttct</td><td>gtgactggtg</td><td>agtactcaac</td><td>caagtcattc</td><td>tgagaatagt</td><td>gtatgcggcg</td><td> 8220</td>

<td>accgagttgc</td><td>tcttgcccgg</td><td>cgtcaacacg</td><td>ggataatacc</td><td>gcgccacata</td><td>gcagaacttt</td><td> 8280</td>

<td>aaaagtgctc</td><td>atcattggaa</td><td>aacgttcttc</td><td>gggcgaaaa</td><td>ctctcaagga</td><td>tcttaccgct</td><td> 8340</td>

<td>gttgagatcc</td><td>agttcgatgt</td><td>aacccactcg</td><td>tgcacccaac</td><td>tgatcttcag</td><td>catcttttac</td><td> 8400</td>

<td>tttcaccagc</td><td>gtttctgggt</td><td>gagcaaaaac</td><td>aggaaggcaa</td><td>aatgccgcaa</td><td>aaaagggaat</td><td> 8460</td>

<td>aagggcgaca</td><td>cggaaatgtt</td><td>gaatactcat</td><td>actcttcctt</td><td>tttcaatatt</td><td>attgaagcat</td><td> 8520</td>

<td>ttatcagggt</td><td>tattgtctca</td><td>tgagcggata</td><td>catatttgaa</td><td>tgtatttaga</td><td>aaaataaaca</td><td> 8580</td>

<td>aataggggtt</td><td>ccgcgcacat</td><td>ttccccgaaa</td><td>agtgccacct</td><td>gacgtctaag</td><td>aaaccattat</td><td> 8640</td>

<td>tatcatgaca</td><td>ttaacctata</td><td>aaaataggcg</td><td>tatcacgagg</td><td>ccctttcgtc</td><td>ttcaa</td><td> 8695</td>

<210> 26 <211> 36 <212> DNA <213> Synthetic primer or probe <400> 26

<td>agtcactctt caaggcatac</td><td>ccgcgtgtca</td><td>ggaggg</td><td> 36</td>

<td colspan="3"><210> 27 <211> 39 <212> DNA <213> Synthetic primer or probe</td><td></td>

<td><400> 27 agtcactctt cacagggatc</td><td>cttagtgatg</td><td>gtggtgatg</td><td> 39</td>

<213> Vector pMF3O <400> 28

<td>gcgcccaata</td><td>cgcaaaccgc</td><td>ctctccccgc</td><td>gcgttggccg</td><td>attcattaat</td><td>gcagctggca</td><td> 60</td>

<td>cgacaggttt</td><td>cccgactgga</td><td>aagcgggcag</td><td>tgagcgcaac</td><td>gcaattaatg</td><td>tgagttagct</td><td> 120</td>

<td>catcattag</td><td>gcaccccagg</td><td>ctttacactt</td><td>tatgcttccg</td><td>gctcgtatgt</td><td>tgtgtggaat</td><td> 180</td>

<td>tgtgagcgga</td><td>taacaatttc</td><td>acacaggaaa</td><td>cagctatgac</td><td>catgattacg</td><td>ccaagcttgc</td><td> 240</td>

<td>atgcctgcag</td><td>ttgattgcag</td><td>atgccagatc</td><td>ccgaaagaac</td><td>agaggacgga</td><td>gcgtaaactt</td><td> 300</td>

<td>gtggcattcc</td><td>accagaaatt</td><td>gatacagata</td><td>agcttccgga</td><td>gtcaccagct</td><td>aaaacggaat</td><td> 360</td>

<td>tgcaagaaat</td><td>aatatcgata</td><td>actttatcac</td><td>cactus-garata</td><td>gccggtgttg</td><td>ctgacagtaa</td><td> 420</td>

<td>tatcctgtga</td><td>cccgtttgaa</td><td>cctaaattat</td><td>taaaaatgga</td><td>aatcaattga</td><td>ttagcatcgc</td><td> 480</td>

<td>tacccttcct</td><td>agtggctata</td><td>tagtggtctg</td><td>aagaagaaac</td><td>aactgaggat</td><td>ttgtaagttg</td><td> 540</td>

<td>aataggcaga</td><td>atccttctta</td><td>atagcttgat</td><td>ttcttatttg</td><td>atttagttta</td><td>ctgattagct</td><td> 600</td>

<td>cgtagtattc</td><td>tgaatcggta</td><td>ttatatccac</td><td>ttaaccataa</td><td>agcttctcta</td><td>ttggcaggat</td><td> 660</td>

<td>cggaaccacc</td><td>attgagacct</td><td>tgttcttggc</td><td>cataataaat</td><td>aattgggata</td><td>ccatcaccca</td><td> 720</td>

<td>aaattataaa</td><td>agccatgtca</td><td>ttcttaatca</td><td>aggatgtgtc</td><td>tgaggtaact</td><td>gatggaaatc</td><td> 780</td>

<td>taacttggtc</td><td>atggttttca</td><td>ataaagtttc</td><td>ccaacaaaga</td><td>gacgtccgaa</td><td>caagatgact</td><td> 840</td>

<td>gtaacgtgga</td><td>gatcattgaa</td><td>gttaactcac</td><td>tggaagtcgc</td><td>cgaagtatca</td><td>ctgaagaatc</td><td> 900</td>

<td>tatatactgg</td><td>atagtataat</td><td>ggatagttgg</td><td>taactccttt</td><td>catataattc</td><td>tgatatggac</td><td> 960</td>

<td>aagtataagt</td><td>tggatctcct</td><td>tgataaactt</td><td>cacctaagtt</td><td>ataaacacca</td><td>gaagcgtcct</td><td> 1020</td>

<td>caaacttcgt</td><td>taatgaagcg</td><td>gtatctacgt</td><td>gctttgcact</td><td>atcaattctt</td><td>aaaccatcga</td><td> 1080</td>

<td>ttgaatagtt</td><td>ttgaacaaaa</td><td>tctgacaccc</td><td>aagtttgaaa</td><td>tactcctata</td><td>acttcattat</td><td> 1140</td>

<td>cctcggtact</td><td>taaatctgga</td><td>agggagactt</td><td>cagtatcacc</td><td>ttcccaacaa</td><td>tcttcaacat</td><td> 1200</td>

<td>tggtttgatc</td><td>attataattt</td><td>gtaatcaaac</td><td>aataatcgtg</td><td>gaagtaagat</td><td>tgttgattga</td><td> 1260</td>

<td>atggagtgaa</td><td>actagaataa</td><td>tctacgcttg</td><td>aaccatctcc</td><td>gttccaagca</td><td>taatggttgt</td><td> 1320</td>

aaacaacgtc gaccatcaat aacatgcttc tggaatgcaa ttcgctagct aattgtttca 1380

<td>attcatcagc</td><td>ggtaccaaaa</td><td>ttagtgttca</td><td>attcatcaat</td><td>atttttcatc</td><td>caataaccat</td><td> 1440</td>

<td>ggtaagcata</td><td>accataagca</td><td>gtattgtcag</td><td>gaatttgctc</td><td>aacaactggg</td><td>gagatccaga</td><td> 1500</td>

<td>tcgcagtgaa</td><td>acccatacct</td><td>tgaatataat</td><td>ccaacttgtc</td><td>gataatccct</td><td>ttataagatc</td><td> 1560</td>

<td>caccacagta</td><td>cttgcgatca</td><td>ctcactaaac</td><td>agtcagctgt</td><td>ggtcgagcca</td><td>tcagatctgg</td><td> 1620</td>

<td>caaacctatc</td><td>agtaacgatt</td><td>tgataaatcg</td><td>attggtcttt</td><td>ccatttatca</td><td>gctgacgagc</td><td> 1680</td>

<td>taacatccct</td><td>cttgtcaaaa</td><td>ataatcggtt</td><td>gagcagatac</td><td>caatcttgag</td><td>aatgctaaaa</td><td> 1740</td>

<td>ttgctgcaac</td><td>aactttactt</td><td>gtaaatcctt</td><td>cagttgaaaa</td><td>tctcattgaa</td><td>ttcactggcc</td><td> 1800</td>

<td>gtcgttttac</td><td>aacgtcgtga</td><td>ctgggaaaac</td><td>cctggcgtta</td><td>cccaacttaa</td><td>tcgccttgca</td><td> 1860</td>

<td>gcacatcccc</td><td>ctttcgccag</td><td>ctggcgtaat</td><td>agcgaagagg</td><td>cccgcaccga</td><td>tcgccttcc</td><td> 1920</td>

<td>caacagttgc</td><td>gcagcctgaa</td><td>tggcgaatgg</td><td>cgcctgatgc</td><td>ggtattttct</td><td>ccttacgcat</td><td> 1980</td>

<td>ctgtgçggta</td><td>tttcacaccg</td><td>catatggtgc</td><td>actctcagta</td><td>caatctgctc</td><td>tgatgccgca</td><td> 2040</td>

<td>tagttaagcc</td><td>agccccgaca</td><td>cccgccaaca</td><td>cccgctgacg</td><td>cgccctgacg</td><td>ggcttgtctg</td><td> 2100</td>

<td>ctcccggcat</td><td>ccgcttacag</td><td>acaagctgtg</td><td>accgtctccg</td><td>ggagctgcat</td><td>gtgtcagagg</td><td> 2160</td>

<td>ttttcaccgt</td><td>catcaccgaa</td><td>acgcgcgaga</td><td>cgaaagggcc</td><td>tcgtgatacg</td><td>cctattttta</td><td> 2220</td>

<td>taggttaatg</td><td>tcatgataat</td><td>aatggtttct</td><td>tagacgtcag</td><td>gtggcacttt</td><td>tcggggaaat</td><td> 2280</td>

<td>gtgcgcgaaa</td><td>cccctatttg</td><td>tttatttttc</td><td>taaatacatt</td><td>caaatatgta</td><td>tccgctcatg</td><td> 2340</td>

<td>agacaataac</td><td>cctgataaat</td><td>gcttcaataa</td><td>tattgaaaaa</td><td>ggaaaagtat</td><td>gagtattcaa</td><td> 2400</td>

<td>catttccgtg</td><td>tcgcccttat</td><td>tccttttt</td><td>gcggcatttt</td><td>gccttcctgt</td><td>ttttgctcac</td><td> 2460</td>

<td>ccagaaacgc</td><td>tggtgaaagt</td><td>aaaagatgct</td><td>gaagatcagt</td><td>tgggtgcacg</td><td>agtgggttac</td><td> 2520</td>

<td>atcgaactgg</td><td>atctcaacag</td><td>cggtaagatc</td><td>cttgagagtt</td><td>ttcgccccga</td><td>agaacgtttt</td><td> 2580</td>

<td>ccaatgatga</td><td>gcacttttaa</td><td>agttctgcta</td><td>tgtggcgcgg</td><td>tattatccc</td><td>tattgacgcc</td><td> 2640</td>

<td>gggcaagagc</td><td>aactcggtcg</td><td>ccgcatacac</td><td>tattctcaga</td><td>atgacttggt</td><td>tgagtactca</td><td> 2700</td>

ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc 2760

<td>ataaccatga</td><td>gtgataacac</td><td>tgcggccaac</td><td>ttacttctga</td><td>caacgatcgg</td><td>aggaacgaag</td><td> 2820</td>

<td>sagctaaccg</td><td>cttttttgca</td><td>caacatgggg</td><td>gatcatgtaa</td><td>ctcgccttga</td><td>tcgttgggaa</td><td> 2880</td>

<td>ccggagctga</td><td>atgaagccat</td><td>accaaacgac</td><td>gagcgtgaca</td><td>ccacgatgcc</td><td>tgtagcaatg</td><td> 2940</td>

<td>gcaacaacgt</td><td>tgcgcaaact</td><td>attaactggc</td><td>gaactactta</td><td>ctctagcttc</td><td>ccggcaacaa</td><td> 3000</td>

<td>ttaatagact</td><td>ggatggaggc</td><td>ggataaagtt</td><td>gcaggaccac</td><td>ttctgcgctc</td><td>ggccttccg</td><td> 3060</td>

<td>gctggctggt</td><td>ttattgctga</td><td>taaatctgga</td><td>gccggtgagc</td><td>gtggtctcg</td><td>cggtatcatt</td><td> 3120</td>

<td>gcagcactgg</td><td>ggccagatgg</td><td>taagccctcc</td><td>cgtatcgtag</td><td>ttatctacac</td><td>gacggggagt</td><td> 3180</td>

<td>caggcaacta</td><td>tgaatgaacg</td><td>aaatagacag</td><td>atcgctgaga</td><td>taggtgcctc</td><td>actgattaag</td><td> 3240</td>

<td>cattggtaac</td><td>tgtcagacca</td><td>agttactca</td><td>tatatacttt</td><td>agattgatt</td><td>aaaacttcat</td><td> 3300</td>

<td>ttttaattta</td><td>aaaggaccta</td><td>ggtgaagatc</td><td>ctttttgata</td><td>atctcatgac</td><td>caaaatccct</td><td> 3360</td>

<td>taacgtgagt</td><td>tttcgttcca</td><td>ctgagcgtca</td><td>gaccccgtag</td><td>aaaagatcaa</td><td>aggatcttct</td><td> 3420</td>

<td>tgagatcctt</td><td>tttttctgcg</td><td>cgtaatctgc</td><td>tgcttgcaaa</td><td>caaaaaacc</td><td>accgctacca</td><td> 3480</td>

<td>gcggtggttt</td><td>gtttgccgga</td><td>tcaagagcta</td><td>ccaactcttt</td><td>ttccgaaggt</td><td>aactggcttc</td><td> 3540</td>

<td>agcagagcgc</td><td>agataccaaa</td><td>tactgtcctt</td><td>ctagtgtagc</td><td>cgtagttagg</td><td>ccaccacttc</td><td> 3600</td>

<td>aagaactctg</td><td>tagcaccgcc</td><td>tacatacctc</td><td>gctctgctaa</td><td>tcctgttacc</td><td>agtggctgct</td><td> 3660</td>

<td>gccagtggcg</td><td>ataagtcgtg</td><td>tcttaccggg</td><td>ttggactcaa</td><td>gacgatagtt</td><td>accggataag</td><td> 3720</td>

<td>gcgcagcggt</td><td>cgggctgaac</td><td>ggggggttcg</td><td>tgcacacagc</td><td>ccagcttgga</td><td>gcgaacgacc</td><td> 3780</td>

<td>tacaccgaac</td><td>tgagatacct</td><td>acagcgtgag</td><td>ctatgagaaa</td><td>gcgccacgct</td><td>tcccgaaggg</td><td> 3840</td>

<td>agaaaggcag</td><td>acaggtatcc</td><td>ggtaagcggc</td><td>agggtcggaa</td><td>caggagagcg</td><td>cacgagggag</td><td> 3900</td>

<td>cttccagggg</td><td>gaaacgcctg</td><td>gtatctttat</td><td>agtcctgtcg</td><td>ggtttcgcca</td><td>cctctgactt</td><td> 3960</td>

<td>gagcgtcgat</td><td>ttttgtgatg</td><td>ctcgtcaggg</td><td>gggcggagcc</td><td>tatggaaaaa</td><td>cgccagcaac</td><td> 4020</td>

<td>gcggcctttt</td><td>taggttcct</td><td>ggccttttgc</td><td>tggccttttg</td><td>ctcacatgtt</td><td>ctttcctgcg</td><td> 4080</td>

ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc 4140 cgcagccgaa cgaccgaacg cagcgagtca gtgagcgagg aagcggaaga 4190 <210> 29 <211> 38 <212> DNA <213> Primer or probe synthetic <400> 29 agtcactctt cacctcttgt caaaaataat cggttgag 38 <210> 30 <211> 52 <212> DNA <213> Synthetic primer or probe <400> 30 tgcttcctac cactagcagc actaggacat acccgcgtgt caggaggggc ag 52 <210> 31 <211> 57 <212> DNA <213> Synthetic primer or probe <400> 31 tagtactagt attagtaggc ttcgcatgga attcactggc cgtcgtttta caacgtc 57 <210> 32 <211> 7927 <212> DNA <213> Vector pFMPT-Cl-E2-H6 <400> 32

<td>ggtaccctgc</td><td>tcaatctccg</td><td>gaatggtgat</td><td>ctgatcgttc</td><td>ctgaaaacct</td><td>cgacattggc</td><td> 60</td>

<td>tccctcctga</td><td>cacaggtact</td><td>cgtacaggtt</td><td>ccaggtaaac</td><td>gagtcgtagt</td><td>tgtcgatcat</td><td> 120</td>

<td>gacaacgttc</td><td>ttagaagcgg</td><td>ccggcatttt</td><td>gaaggtgact</td><td>aatagcctaa</td><td>gaaaatattt</td><td> 180</td>

<td>aatttaattt</td><td>tcattaaatt</td><td>ttcctatact</td><td>cgctatttca</td><td>gcttttcatc</td><td>tcatcacttc</td><td> 240</td>

ataaacgata taaaccagaa aaagaactat tttcaaacac gcttctcaaa agcggtatgt 300 ccttccac9t ctccttagaa tctggcaagt ccgcgagggg gatccttagt gatggtggtg 360 atggtgtctg ccctcgatca cctgccactc tgttgtagac agcagcagcg agctaagctc 420 tgatctatcc ctgtcctcca agtcacaacg ctctcctcga gtccaattgc atgcggcttc 480 gaacctgtgc tccacgcccc ccacgtacat cctaaccttg aagatggtga agttgacagt 540 gcaggggtag tgccagagcc tatatgggta atgaaccata cacctaggtg tcagccaggg 600 cccagaaccg catctggcgt aagtggcctc ggggtgcttc cgaaaacagt cagtggggca 660 ggtcaaggtg ttgttgccgg cccccccgat gttgcacggg gggcccccac acgtcttggt 720 gaacccagtg ccattcatcc atgtacagcc gaaccagttg cctcgcggcg gccgcgtgtt 780 gttgagaatc agcacatccg agtcgttcgc cccccagtLa tacgtgggga caccaaaccg 840 atcggtcgtc cccaccacaa cagggctcgg ggtgaagcaa tacactggac cgcacacctg 900 agacgcgggt acaataccac acggtcgagg cgcgtagtgc cagcagtagg gcctctggtc 960 cgagctgtta ggctcagtgt aagtgagggg accccacccc tgagcgaact tgtcgatgga 1020 gcgacagctg gccaagcgct ctgggcatcc agacgagttg aatttgtgtt tgtagaatag 1080 tgcggcaaag aaccctgttt ggagggagtc gttgcagttc agggcagtcc tgttgatgtg 1140 ccaactgccg ttggtgttta cgagctggat tttctgagcc gacccggggc taaagaggga 1200 cacaaggccc ctggtatcgg aggctgctgc ccctcctgac acgcgggtat gtcctagtgc 1260 tgctagtggt aggaagcata gtactagtat tagtaggctg cgcatgaatt cccgatgaag 1320 cagagagcgc aggaggcggt atttatagtg ccattcccct ctctgagaga cccggatggt 1380 agtcgagtgt atcggagaca gcttgatgta gactccgtgc ctgccggctc ctcttattgg 1440 cggacaccag tgagacaccc cggaacttgc tgtttttctg caaaatccgg ggtgaccagt 1500 gggagcctat ttgcacacac gagcgggaca ccccactctg gtgaagagtg ccaaagtcat 1560 tctttttccc gttgcggggc agccgattgc atgttttagg aaaatattac ctttgctaca 1620 ccctgtcaga tttaccctcc acacatatat attccgtcac ctccagggac tattatcgt 1680

<td>cgttgcgccg</td><td>ccagcggaag</td><td>atatccagaa</td><td>gctgttttcc</td><td>gagagactcg</td><td>gttggcgcct</td><td> 1740</td>

<td>ggtatatttg</td><td>atggatgtcg</td><td>cgctgcctca</td><td>cgtcccggta</td><td>cccaggaacg</td><td>cggtgggatc</td><td> 1800</td>

<td>tcgggcccat</td><td>cgaagactgt</td><td>gctccagact</td><td>gctcgcccag</td><td>caggtgtttc</td><td>ttgatcgccg</td><td> 1860</td>

<td>cctctaaatt</td><td>gtccgcgcat</td><td>cgccggtaac</td><td>atttttccag</td><td>ctcggagttt</td><td>gcgtttagat</td><td> 1920</td>

<td>acagtttctg</td><td>cgatgccaaa</td><td>ggagcctgca</td><td>gattataacc</td><td>tcggatgctg</td><td>tcattcagcg</td><td> 1980</td>

<td>cttttaattt</td><td>gacctccaga</td><td>tagttgctgt</td><td>atttctgttc</td><td>ccattggctg</td><td>ctgcgcagct</td><td> 2040</td>

<td>tcgtataact</td><td>cgagttattg</td><td>ttgcgctctg</td><td>cctcggcgta</td><td>ctggctcatg</td><td>atctggatct</td><td> 2100</td>

<td>tgtccgtgtc</td><td>gcttttcttc</td><td>gagtgtttct</td><td>cgcaaacgat</td><td>gtgcacggcc</td><td>tgcagtgtcc</td><td> 2160</td>

<td>aatcggagtc</td><td>gagctggcgc</td><td>cgaaactggc</td><td>ggatctgagc</td><td>ctccacactg</td><td>ccctgtttct</td><td> 2220</td>

<td>ctatccacgg</td><td>cggaaccgcc</td><td>tcctgccgtt</td><td>tcagaatgtt</td><td>gttcaagtgg</td><td>tactctgtgc</td><td> 2280</td>

<td>ggtcaatgaa</td><td>gggttattg</td><td>ccggtgaaat</td><td>ctttgggaag</td><td>cggttttcct</td><td>cggggaagat</td><td> 2340</td>

<td>tacgaaattc</td><td>cccgcgtcgt</td><td>tgcgcttcct</td><td>ggatctcgag</td><td>gagatcgttc</td><td>tccgcgtcga</td><td> 2400</td>

<td>ggagatcgtt</td><td>ctccgcgtcg</td><td>acaccattcc</td><td>ttgcggcggc</td><td>ggtgctcaac</td><td>ggcctcaacc</td><td> 2460</td>

<td>tactactggg</td><td>ctgcttccta</td><td>atgcaggagt</td><td>cgcataaggg</td><td>agagcgtcga</td><td>caaacccgcg</td><td> 2520</td>

<td>tttgagaact</td><td>tgctcaagct</td><td>tctggtaaac</td><td>gttgtaatac</td><td>tctgaaacaa</td><td>ggccctagca</td><td> 2580</td>

<td colspan="3">gctgatctg tttctcttgg ctaacgggtga</td><td>gtggttLatt</td><td>ggagttcact</td><td>ggtttcagca</td><td> 2640</td>

<td>gtctgtcat <</td><td>ztzagacaata</td><td>ttgttactaa</td><td>atttttttga</td><td>actacaattg</td><td>ttcgtaattc</td><td> 2700</td>

<td>atctattatt</td><td>atacatcctc</td><td>gtcagcaatt</td><td>tctggcagac</td><td>ggagtttact</td><td>aacgtcttga</td><td> 2760</td>

<td>gtatgaggcc</td><td>gagaatccag</td><td>ctctgtggcc</td><td>atactcagtc</td><td>ttgaoagcct</td><td>gctgatgtgg</td><td> 2820</td>

<td>ctgcgttcaa</td><td>cgcaataagc</td><td>gtgtcctccg</td><td>actccgagtt</td><td>gtgctcgtta</td><td>tcgtcgttct</td><td> 2880</td>

<td>catcctcgga</td><td>aaaatcacac</td><td>gaaagaacat</td><td>actcaccagt</td><td>aggctttctg</td><td>ytccctgggg</td><td> 2940</td>

<td>cacggctgtt</td><td>tctgacgtat</td><td>tccggcgttg</td><td>ataatagctc</td><td>gaaagtgaac</td><td>gccgagtcgc</td><td> 3000</td>

gggagtcgac cgatgccctt gagagccttc aacccagtca gctccttccg gtgggcgcgg 3060 ggcatgacta tcgtcgccgc acttatgact gtcttcttta tcatgcaact cgtaggacag 3120 gtgccggcag cgctctgggt cattttcggc gaggaccgct ttcgctggag cgcgacgatg 3180 atcggcctgt cgcttgcggt attcggaatc ttgcacgccc tcgctcaagc cttcgtcact 3240 ggtcccgcca ccaaacgttt cggcgagaag caggccatta tcgccggcat ggcggccgac 3300 gcgctgggct acgtcttgct ggcgttcgcg acgcgaggct ggatggcctt ccccattatg 3360 attcttctcg cttccggcgg catcgggatg cccgcgttgc aggccatgct gtccaggcag 3420 gtagatgacg accatcaggg acagcttcaa ggatcgctcg cggctcttac cagcctaact 3480 tcgatcactg gaccgctgat cgtcacggcg atttatgccg cctcggcgag cacatggaac 3540 gggttggcat ggattgtagg cgccgcccta taccttgtct gcctccccgc 9ttgcgtcgc 3600 ggtgcatgga gccgggccac ctcgacctga atggaagccg gcggcacctc gctaacggat 3660 tcaccactcc aagaattgga gccaatcaat tcttgcggag aactgtgaat gcgcaaacca 3720 acccttggca gaacatatcc atcgcgtccg ccatctccag cagccgcacg cggcgcatcg 3780 gggggggggg gggggggggg gggcaaacaa ttcatcattt tttttttatt cttttttttg 3840 atttcggttt ctttgaaatt tttttgattc ggtaatctcc gaacagaagg aagaacgaag 3900 gaaggagcac agacttagat tggtatatat acgcatatgt agtgttgaag aaacatgaaa 3960 ttgcccagta ttcttaaccc aactgcacag aacaaaacc tgcaggaaac gaagataaat 4020 catgtcgaaa gctacatata aggaacgtgc tgctactcat cctagtcctg ttgctgccaa 4080 gctatttaat atcatgcacg aaaagcaaac aaacttgtgt gcttcattgg atgttcgtac 4140 caccaaggaa ttactggagt tagttgaagc attaggtccc aaaatttgtt tactaaaaac 4200 acatgtggat atcttgactg atttttccat ggagggcaca gttaagccgc taaaggcatt 4260 atccgccaag tacaattttt tactcttcga agacagaaaa tttgctgaca ttggtaatac 4320 agtcaaattg cagtactctg cgggtgtata cagaatagca gaatgggcag acattacgaa 4380 tgcacacggt gtggtgygcc caggtattgt tagcagtttg aagcaggcgg shitagaagt 4440

<td>aacaaaagaa</td><td>cctagaggcc</td><td>tgttgatgtt</td><td>agcagaattg</td><td>tcatgcaagg</td><td>gctccctatc</td><td> 4500</td>

<td>tactggagaa</td><td>tatactaagg</td><td>gtactgttga</td><td>cattgcgaag</td><td>agcgacaaag</td><td>atttgttat</td><td> 4560</td>

<td>cggctttatt</td><td>gctcaaagag</td><td>acatgggtgg</td><td>aagagatgaa</td><td>ggttacgatt</td><td>ggttgattat</td><td> 4620</td>

<td>gacacccggt</td><td>gtgggtttag</td><td>atgacaaggg</td><td>agacgcattg</td><td>ggtcaacagt</td><td>atagaaccgt</td><td> 4680</td>

<td>ggatgatgtg</td><td>gtctctacag</td><td>gatctgacag</td><td>tattattgtt</td><td>ggaagaggac</td><td>tatttgcaaa</td><td> 4740</td>

<td>gggaagggat</td><td>gctaaggtag</td><td>agggtgaacg</td><td>ttacagaaaa</td><td>gcaggctggg</td><td>aagcatattt</td><td> 4800</td>

<td>gagaagatgc</td><td>ggccagcaaa</td><td>actaaaaaac</td><td>tgtattataa</td><td>gtaaatgcat</td><td>gtatactaaa</td><td> 4860</td>

<td>ctcacaaatt</td><td>agagcttcaa</td><td>tttaattata</td><td>tcagttatta</td><td>cccgggaatc</td><td>tcggtcgtaa</td><td> 4920</td>

<td>tgattttttat</td><td>aatgacgaaa</td><td>aaaaaaaaat</td><td>tggaaagaaa</td><td>agcccccccc</td><td>cccccccccc</td><td> 4980</td>

<td>cccccccccc</td><td>ccccccgcag</td><td>cgttgggtcc</td><td>tggccacggg</td><td>tgcgcatgat</td><td>cgtgctcctg</td><td> 5040</td>

<td>tcgttgagga</td><td>cccggctagg</td><td>ctggcggggt</td><td>tgccttactg</td><td>gttagcagaa</td><td>tgaatcaccg</td><td> 5100</td>

<td>atacgcgagc</td><td>gaacgtgaag</td><td>cgactgctgc</td><td>tgcaaaacgt</td><td>ctgcgacctg</td><td>agcaacaaca</td><td> 5160</td>

<td>tgaatggtct</td><td>tcggtttccg</td><td>tgtttcgtaa</td><td>agtctggaaa</td><td>cgcggaagtc</td><td>agcgccctgc</td><td> 5220</td>

<td>accattatgt</td><td>tccggatctg</td><td>catcgcagga</td><td>tgctgctggc</td><td>taccctgtgg</td><td>aacacctaca</td><td> 5280</td>

<td>tctgtattaa</td><td>cgaagcgctg</td><td>gcattgaccc</td><td>tgagtgattt</td><td>ttctctggtc</td><td>ccgccgcatc</td><td> 5340</td>

<td>cataccgcca</td><td>gttgtttacc</td><td>ctcacaacgt</td><td>tccagtaacc</td><td>gggcatgttc</td><td>atcatcagta</td><td> 5400</td>

<td>accgtatcg</td><td>tgagcatcct</td><td>ctctcgtttc</td><td>atcggtatca</td><td>ttacccccat</td><td>gaacagaaat</td><td> 5460</td>

<td>tcccccttac</td><td>acggaggcat</td><td>caagtgacca</td><td>aacaggaaaa</td><td>aaccgccctt</td><td>aacatggccc</td><td> 5520</td>

<td>gctttatcag</td><td>aagccagaca</td><td>ttaacgcttc</td><td>tggagaaact</td><td>caacgagctg</td><td>gacgcggatg</td><td> 5580</td>

<td>aacaggcaga</td><td>catctgtgaa</td><td>tcgcttcacg</td><td>accacgctga</td><td>tgagctttac</td><td>cgcagctgcc</td><td> 5640</td>

<td>tcgcgcgttt</td><td>cggtgatgac</td><td>ggtgaaaacc</td><td>tctgacacat</td><td>gcagctcccg</td><td>gagacggtca</td><td> 5700</td>

<td>cagcttgtct</td><td>gtaagcggat</td><td>gccgggagca</td><td>gacaagcccg</td><td>tcaggcgcg</td><td>tcagcgggtg</td><td> 5760</td>

ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg 5820

<td>gcttaactat</td><td>gcggcatcag</td><td>agcagattgt</td><td>actgagagtg</td><td>caccatatgc</td><td>ggtgtgaaat</td><td> 5880</td>

<td>accgcacaga</td><td>tgcgtaagga</td><td>gaaaataccg</td><td>catcaggcgc</td><td>tcttccgctt</td><td>cctcgctcac</td><td> 5940</td>

<td>tgactcgctg</td><td>cgctcggtcg</td><td>ttcggctgcg</td><td>gcgagcggta</td><td>tcagctcact</td><td>caaaggcggt</td><td> 6000</td>

<td>aatacggtta</td><td>tccacagaat</td><td>cagggataa</td><td>cgcaggaaag</td><td>aacatgtgag</td><td>caaaaggcca</td><td> 6060</td>

<td>gcaaaaggcc</td><td>aggaaccgta</td><td>aaaaggccgc</td><td>gttgctggcg</td><td>tttttccata</td><td>ggctccgccc</td><td> 6120</td>

<td>ccctgacgag</td><td>catcacaaaa</td><td>atcgacgctc</td><td>aagtcagagg</td><td>tgacgaaacc</td><td>cgacaggact</td><td> 6180</td>

<td>ataaagat</td><td>caggcgtttc</td><td>cccctggaag</td><td>ctccctcgtg</td><td>cgctctcctg</td><td>ttoogaccct</td><td> 6240</td>

<td>gccgcttacc</td><td>ggatacctgt</td><td>ccgccttct</td><td>ccccttcggga</td><td>agcgtggcgc</td><td>tttctcatag</td><td> 6300</td>

<td>ctcacgctgt</td><td>aggtgtctca</td><td>gttcggtgta</td><td>ggtcgttcgc</td><td>tccaagctgg</td><td>gctgtgtgca</td><td> 6360</td>

<td>cgaacccccc</td><td>gttcagcccg</td><td>accgctgcgc</td><td>cttatccggt</td><td>aactatcgtc</td><td>ttgagtccaa</td><td> 6420</td>

<td>cccggtaaga</td><td>cacgacttat</td><td>cgccactggc</td><td>agcagccact</td><td>ggtaacagga</td><td>ttagcagagc</td><td> 6480</td>

<td>gaggtatgta</td><td>gggtgcta</td><td>cagagttctt</td><td>gaagtggtgg</td><td>cctaactacg</td><td>gctacactag</td><td> 6540</td>

<td>aaggacagta</td><td>tttggtatct</td><td>gcgctctgct</td><td>gaagccagtt</td><td>accttcggaa</td><td>aaagagttgg</td><td> 6600</td>

<td>tagctcttga</td><td>tccggcaaac</td><td>aaaccaccgc</td><td>tggtagcggt</td><td>ggtttttttg</td><td>tttgcaagca</td><td> 6660</td>

<td>gcagattacg</td><td>cgcagaaaaa</td><td>aaggatctca</td><td>agaagatcct</td><td>ttgatctttt</td><td>ctacggggtc</td><td> 6720</td>

<td>tgacgctcag</td><td>tggaacgaaa</td><td>actcacgtta</td><td>agggattttg</td><td>gtcatgagat</td><td>tatcaaaaag</td><td> 6780</td>

<td>gatcttcacc</td><td>tagatccttt</td><td>taaattaaaa</td><td>atgaagtttt</td><td>aaatcaatct</td><td>aaagtatata</td><td> 6840</td>

<td>tgagtaaact</td><td>tggtctgaca</td><td>gttaccaatg</td><td>cttaatcagt</td><td>gaggcaccta</td><td>tctcagcgat</td><td> 6900</td>

<td>ctgtctattt</td><td>cgttcatcca</td><td>tagttgcctg</td><td>actccccgtc</td><td>gtgtagataa</td><td>ctacgatacg</td><td> 6960</td>

<td>ggagggctta</td><td>ccatctggcc</td><td>ccagtgctgc</td><td>aatgataccg</td><td>cgagacccac</td><td>gctcaccggc</td><td> 7020</td>

<td>tccagatta</td><td>tcagcaataa</td><td>accagccagc</td><td>cggaagggcc</td><td>gagcgcagaa</td><td>gtggtcctgc</td><td> 7080</td>

<td>aactttatcc</td><td>gcctccatcc</td><td>agtctattaa</td><td>ttgttgccgg</td><td>gaagctagag</td><td>taagtagttc</td><td> 7140</td>

gccagttaat agtttgcgca acgttgttgc cattgctgca ggcatcgtgg tgtcacgctc 7200

<td>gtcgtttggt</td><td>atggcttcat</td><td colspan="5">tcagctccgg ttcccaacga tcaaggcgag ttacatgatc 7260</td>

<td>ccccatgttg</td><td>tgcaaaaaag</td><td>cggttagctc</td><td>cttcggtcct</td><td>ccgatcgttg</td><td>tcagaagtaa</td><td> 7320</td>

<td>gttggccgca</td><td>gtgttatcac</td><td>tcatggttat</td><td>ggcagcactg</td><td>cataattctc</td><td>ttactgtcat</td><td> 7380</td>

<td>gccatccgta</td><td>agatgctttt</td><td>ctgtgactgg</td><td>tgagtactca</td><td>accaagtcat</td><td>tctgagaata</td><td> 7440</td>

<td>gtgtatgcgg</td><td>cgaccgagtt</td><td>gctcttgccc</td><td>ggcgtcaaca</td><td>cgggataata</td><td>ccgcgccaca</td><td> 7500</td>

<td>tagcagaact</td><td>ttaaaagtgc</td><td>tcatcattgg</td><td>aaaacgttct</td><td>tcggggcgaa</td><td>aactctcaag</td><td> 7560</td>

<td>gatcttaccg</td><td>ctgttgagat</td><td>ccagttcgat</td><td>gtaacccact</td><td>cgtgcaccca</td><td>actgatcttc</td><td> 7620</td>

<td>agcatctttt</td><td>actttcacca</td><td>gcgtttctgg</td><td>gtgagcaaaa</td><td>acaggaaggc</td><td>aaaatgccgc</td><td> 7680</td>

<td>aaaaaaggga</td><td>ataagggcga</td><td>cacggaaatg</td><td>ttgaatactc</td><td>atactcttcc</td><td>tttttcaata</td><td> 7740</td>

<td>ttattgaagc</td><td>atttatcagg</td><td>gttattgtct</td><td>catgagcgga</td><td>tacatatttg</td><td>aatgtattta</td><td> 7800</td>

<td>gaaaaataaa</td><td>caaatagggg</td><td>ttccgcgcac</td><td>atttccccga</td><td>aaagtgccac</td><td>ctgacgtcta</td><td> 7860</td>

<td>agaaaccatt</td><td>attatcatga</td><td>cattaaccta</td><td>taaaaatagg</td><td>cgtatcacga</td><td>ggccctttcg</td><td> 7920</td>

<td>tcttcaa</td><td></td><td></td><td></td><td></td><td></td><td> 7927</td>

<210> 33 <211> 24 <212> DNA <213> Synthetic primer or probe <400> 33 taaggatccc cgggtaccga gctc 24 <210> 34 <211> 25 <212> DNA <213> Synthetic primer or probe <400> 34 ccagttcatc atcatatccc aagcc <210> 35 <211> 4234 <212> DNA <213> pUC18-FMD-CL-El vector <220>

<221> MISCELLANEOUS <222> (988) . . (989) <223> N is any nucleotide <220>

<221> MISCELLANEOUS <222> (1167) . . (1168) <223> Ν is any nucleotide <400> 35 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 60 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 120 cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 180 tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg aattcgagct 240 cggtacccgg ggatccttac cagttcatca tcatatccca agccatacgg tgacctgtta 300 tgtggccggg atagattgag caattgcagt cctgcaccgt ctcatgccgg cgaggcgaga 360 tggtgaacag ctgggagacg aggaagacag atccgcagag atcccccacg tacatagcgg 420 aacagaaagc agccgcccca acgagcaaat cgacgtggcg tcgtattgtc gtagtgggga 480 cgctggcgtt cctagctgcg agcgtggggg tgagcgctac ccagcagcgg gaagagttgt 540 tctcccgaac gcagggcacg cacccggggg tgtgcatgat catgtccgct gcctcataca 600 caatgcttga gttggagcag tcgttcgtga catggtacat cccggacacg ttgcgcacct 660 catatcctag tgctgctagt ggtaggaagc atagtactag tattagtagg cttcgcatga 720 attcccgatg aaggcagaga gcgcaaggag gcggtattta tagtgccatt cccctctctg 780 agagacccgg atggtagtcg agtgttatcg gagacagctt gatgtagact ccgtgcctgc 840 cgggcctctt attggcggac accaatgaga caccccggaa cttgctgttt gtctgcaaaa 900 tccggggtga ccagtgggag cctatttgca cacacgagcg ggacacccca ctctggtgaa 960 gagtgccaaa gtcattcttt ttcccgtnnc ggggcagccg attgcatgtt ttaggaaaat 1020 attacctttg ctacaccctg tcagatttac cctccacaca tatatattcc gtcacctcca 1080 gggactattc ttggctcgtt gcgccgccgc ggaagatatc cagaagctgt gttttccgag 1140 agactcggtt ggcgcctggt atatttnnag gatgtcgcgc tgcctcacgt cccggtaccc 1200 aggaacgcgg tgggatctcg ggcccatcga agactgtgct ccagactgct cgcccagcag 1260 gtgtttcttg attgccgcct ctaaatagtc cgcgcatcgc cggtaacatt tttccagctc 1320 ggagtttgcg tttagataca tttctgcgat gccaaaggag cctgcagatt ataacctcgg 1380 atgctgtcat tcagcgcttt taatttgacc tccagatagt tgctgtattt ctgttccatt 1440 ggctgctgga cgttcgtata actcgagtta ttgttgcgct ctgcctcggc gtactggctc 1500 atgactgact gcggtcgctt ctcgagtgtt ctcgcaacag gacgcctgca ggtcatcgag 1560 tcgagctggc gccgaaactg gcggatctga cctccacact gccctgtatc tctatccacc 1620 gggaaccgcc tcctgccgtt ccagaatgtt gttcaagtgg tagctctgtg cggtcaatga 1680 aggcgttatt gccggtgaaa tctttgggaa gcggtttatc ctcggggaag attacgaaat 1740 tcccgcgcgt cgttgcgctt cctggatctc gaggaagatc gttctccgcg tcgaggagat 1800 cgttctccgc gtcgacctgc aggcatgcaa gcttggcact ggccgtcgtt ttacaacgtc 1860 gtgactggga aaaccctggc gttacccaac ttaatcgcct tgcagcacat ccccctttcg 1920 ccagctggcg taatagcgaa gaggcccgca ccgatcgccc ttcccaacag ttgcgcagcc 1980 tgaatggcga atggcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac 2040 accgcatatg gtgcactctc agtacaatct gctctgatgc cgcatagtta agccagcccc 2100 gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg gcatccgctt 2160 acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca ccgtcatcac 2220 cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt tttataggtt aatgtcatga 2280

<td>taataatggt</td><td>ttcttagacg</td><td>tcaggtggca</td><td>cttttcgggg</td><td>aaatgtgcgc</td><td>ggaaccccta</td><td> 2340</td>

<td>tttgtttatt</td><td>tttctaaata</td><td>cattcaaata</td><td>tgtatccgct</td><td>catgagacaa</td><td>taaccctgat</td><td> 2400</td>

<td>aaatgcttca</td><td>ataatattga</td><td>aaaaggaaga</td><td>gtatgagtat</td><td>tcaacatttc</td><td>cgtgtcgccc</td><td> 2460</td>

<td>ttattccctt</td><td>ttttggcggca</td><td>ttttgccttc</td><td>ctgtttttgc</td><td>tcacccagaa</td><td>acgctggtga</td><td> 2520</td>

<td>aagtaaaaga</td><td>tgctgaagat</td><td>cagttgggtg</td><td>cacgagtggg</td><td>ttacatcgaa</td><td>ctggatctca</td><td> 2580</td>

<td>acagcggtaa</td><td>gatccttgag</td><td>agttttcgcc</td><td>ccgaagaacg</td><td>ttttccaatg</td><td>atgagcactt</td><td> 2640</td>

<td>ttaaagttct</td><td>gctatgtguc</td><td>gcagtattat</td><td>cccgtattga</td><td>cgccgggcaa</td><td>gagcaactcg</td><td> 2700</td>

<td>gtcgccgcat</td><td>acactattct</td><td>cagaatgact</td><td>tagttgagta</td><td>ctcaccagtc</td><td>acggaaaagc</td><td> 2760</td>

<td>atcttacgga</td><td>tggcatgaca</td><td>gtaagagaat</td><td>tatgcagtgc</td><td>tgccataacc</td><td>atgagtgata</td><td> 2620</td>

<td>acactgcggc</td><td>caacttactt</td><td>ctgacaacga</td><td>tcggaggacc</td><td>gaaggagcta</td><td>accgcttttt</td><td> 2880</td>

<td>tgcacaacat</td><td>gggggatcat</td><td>gtaactcgcc</td><td>ttgatcgttg</td><td>ggaaccggag</td><td>ctgaatgaag</td><td> 2940</td>

<td>ccataccaaa</td><td>cgacgagcgt</td><td>gacaccacga</td><td>tgcctgtagc</td><td>aatggcaaca</td><td>acgttgcgca</td><td> 3000</td>

<td>aactattaac</td><td>tggcgaacta</td><td>cttactctag</td><td>cttccccggca</td><td>acaattaata</td><td>gactggatgg</td><td> 3060</td>

<td>aggcggataa</td><td>agttgcagga</td><td>ccacttctgc</td><td>gctcggccct</td><td>tccggctggc</td><td>tggtttattg</td><td> 3120</td>

<td>ctgataaatc</td><td>tggagccggt</td><td>gagcgtgggt</td><td>ctcgcggtat</td><td>cattgcagca</td><td>ctggggccag</td><td> 3180</td>

<td>atggtaagcc</td><td>ctcccgtatc</td><td>gtagttatct</td><td>acacgacggg</td><td>gagtcaggca</td><td>actatggatg</td><td> 3240</td>

<td>aacgaaatag</td><td>acagatcgct</td><td>gagataggtg</td><td>cctcactgat</td><td>taagcattgg</td><td>taactgtcag</td><td> 3300</td>

<td>accaagttta</td><td>ctcatatata</td><td>ctttagattg</td><td>atttaaaact</td><td>tcatttttaa</td><td>tttaaaagga</td><td> 3360</td>

<td>tctagggtgaa</td><td>gatccttttt</td><td>gataatctca</td><td>tgaccaaaat</td><td>cccttaacgt</td><td>gagttttcgt</td><td> 3420</td>

<td>tccactgagc</td><td>gtcagacccc</td><td>gtagaaaaga</td><td>tcaaaggatc</td><td>tttttgagat</td><td>cctttttttc</td><td> 3480</td>

<td>tgcgcgtaat</td><td>ctgctgcttg</td><td>caaacaaaaa</td><td>aaccaccgct</td><td>accagcggtg</td><td>gtttgtttgc</td><td> 3540</td>

<td>cggatcaaga</td><td>gctaccaact</td><td>ctttttccga</td><td>aggtaactgg</td><td>cttcagcaga</td><td>gcgcagatac</td><td> 3600</td>

caaatactgt ccttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac 3660

<td>cgcctacata</td><td>cctcgctctg</td><td>ctaatcctgt</td><td>taccagtggc</td><td>tgctgccagt</td><td>ggggataagt</td><td> 3720</td>

<td>cgtgtcttac</td><td>cgggttggac</td><td>tcaagacgat</td><td>agttaccgga</td><td>taaggcgcag</td><td>cggtcgggct</td><td> 3780</td>

<td>gaacgggggg</td><td>ttcgtgcaca</td><td>cagcccagct</td><td>tggagcgaac</td><td>gacctacacc</td><td>gaactgagat</td><td> 3840</td>

<td>acctacagcg</td><td>tgagctatga</td><td>gaaagcgcca</td><td>cgcttcccga</td><td>agggagaaag</td><td>gcggacaggt</td><td> 3900</td>

<td>atccggtaag</td><td>cggcagggtc</td><td>ggaacaggag</td><td>agcgcacgag</td><td>ggagcttcca</td><td>gggggaaacg</td><td> 3960</td>

<td>cctggtatct</td><td>ttatagtcct</td><td>gtcgggtttc</td><td>gccacctctg</td><td>acttgagcgt</td><td>cgattttttgt</td><td> 4020</td>

<td>gatgctcgtc</td><td>aggggggcgg</td><td>agcctatgga</td><td>aaaacgccag</td><td>caacggcc</td><td>tttttacggt</td><td> 4080</td>

<td>tcctggcctt</td><td>ttgctggcct</td><td>tttgctcaca</td><td>tgttctttcc</td><td>tgcgttatcc</td><td>cctgattctg</td><td> 4140</td>

<td>tggataaccg</td><td>tattaccgcc</td><td>tttgagtgag</td><td>ctgataccgc</td><td>tcgccgcagc</td><td>cgaacgaccg</td><td> 4200</td>

<td>agcgcagcga</td><td>gtcagtgagc</td><td>gaggaagcgg</td><td>aaga</td><td></td><td></td><td> 4234</td>

<210> 36 <211> 7429 <212> DNA <213> pFPMT-CL-El Vector <400> 36

<td>ggtaccctgc</td><td>tcaatctccg</td><td>gaatggtgat</td><td>ctgatcgttc</td><td>ctgaaaacct</td><td>cgacattggc</td><td> 60</td>

<td>tccctcctga</td><td>cacaggtact</td><td>cgtacaggtt</td><td>ccaggtaaac</td><td>gagtcgtagt</td><td>tgtcgatcat</td><td> 120</td>

<td>gacaacgttc</td><td>ttagaagcgg</td><td>ccggcatttt</td><td>gaaggtgact</td><td>aatagcctaa</td><td>gaaaatattt</td><td> 180</td>

<td>aatttaattt</td><td>tcattaaatt</td><td>ttcctatact</td><td>cgctatttca</td><td>gcttttcatc</td><td>tcatcacttc</td><td> 240</td>

<td>ataaacgata</td><td>taaaccagaa</td><td>aaagaactat</td><td>tttcaaacac</td><td>gcttctcaaa</td><td>agcggtatgt</td><td> 300</td>

<td>ccttccacgt</td><td>ctccttagaa</td><td>tctggcaagt</td><td>ccgcgagggg</td><td>gatccttacc</td><td>agttcatcat</td><td> 360</td>

<td>catatcccaa</td><td>gccatacggt</td><td>gacctgttat</td><td>gtggccggga</td><td>tagattgagc</td><td>aattgcagtc</td><td> 420</td>

<td>ctgcaccgtc</td><td>tcatgccggc</td><td>gaggcgagat</td><td>ggtgaacagc</td><td>tgggagacga</td><td>ggaagacaga</td><td> 480</td>

tccgcagaga tcccccacgt acatagcgga acagaaagca gccgccccaa cgagcaaatc 540

<td>gacgtggcgt</td><td>cgtattgtcg</td><td>tagtggggac</td><td>gctggcgttc</td><td>ctagctgcga</td><td>gcgtgggggt</td><td> 600</td>

<td>gagcgctacc</td><td>cagcagcggg</td><td>aagagttgtt</td><td>ctcccgaacg</td><td>cagggcacgc</td><td>accgggggt</td><td> 660</td>

<td>gtgcatgatc</td><td>atgtccgctg</td><td>cctcatacac</td><td>aatgcttgag</td><td>ttggagcagt</td><td>cgttcgtgac</td><td> 720</td>

<td>atggtacatc</td><td>ccggacacgt</td><td>tgcgcacctc</td><td>atatcctagt</td><td>gctgctagtg</td><td>gtaggaagca</td><td> 780</td>

<td>tagtactagt</td><td>tagtaggc</td><td>ttcgcatgaa</td><td>ttccgatga</td><td>agcagagagc</td><td>gcaggaggcg</td><td> 840</td>

<td>gtatttatag</td><td>tgccattccc</td><td>ctctctgaga</td><td>gacccggatg</td><td>gtagtcgagt</td><td>gtatcggaga</td><td> 900</td>

<td>cagcttgatg</td><td>tagactccgt</td><td>gcctgccggc</td><td>tcctcttatt</td><td>ggcggacacc</td><td>agtgagacac</td><td> 960</td>

<td>cccggaactt</td><td>gctgtttttc</td><td>tgcaaaatcc</td><td>ggggtgacca</td><td>gtgggagcct</td><td>atttgcacac</td><td> 1020</td>

<td>acgagcggga</td><td>caccccactc</td><td>tggtgaagag</td><td>tgccaaagtc</td><td>attctttttc</td><td>ccgttgcggg</td><td> 1080</td>

<td>gcagccgatt</td><td>gcatgtttta</td><td>ggaaaatatt</td><td>acctttgcta</td><td>caccctgtca</td><td>gattaccct</td><td> 1140</td>

<td>ccacacatat</td><td>atattccgtc</td><td>acctccaggg</td><td>actattattc</td><td>gtcgttgcgc</td><td>cgccagcgga</td><td> 1200</td>

<td>agatatccag</td><td>aagctgtttt</td><td>ccgagagact</td><td>cggttggcgc</td><td>ctggtatatt</td><td>tgatggatgt</td><td> 1260</td>

<td>cgcgctgcct</td><td>cacgtcccgg</td><td>tacccaggaa</td><td>cggggg</td><td>tctcgggccc</td><td>atcgaagact</td><td> 1320</td>

<td>gtgctccaga</td><td>ctgctcgccc</td><td>agcaggtgtt</td><td>tcttgatcgc</td><td>cgcctctaaa</td><td>ttgtccgcgc</td><td> 1380</td>

<td>atcgccggta</td><td>acatttttcc</td><td>agctcggagt</td><td>ttgcgtttag</td><td>atacagtttc</td><td>tgcgatgcca</td><td> 1440</td>

<td>aaggagcctg</td><td>cagattataa</td><td>cctcggatgc</td><td>tgtcattcag</td><td>cgcttttaat</td><td>ttgacctcca</td><td> 1500</td>

<td>gatagttgct</td><td>gtatttctgt</td><td>tcccattggc</td><td>tgctgcgcag</td><td>cttcgtataa</td><td>ctcgagttat</td><td> 1560</td>

<td>tgttgcgctc</td><td>tgcctcggcg</td><td>tactggctca</td><td>tgatctggat</td><td>cttgtccgtg</td><td>tcgcttttct</td><td> 1620</td>

<td>tcgagtgttt</td><td>ctcgcaaacg</td><td>atgtgcacgg</td><td>cctgcagtgt</td><td>ccaatcggag</td><td>tcgagctggc</td><td> 1680</td>

<td>gccgaaactg</td><td>gcggatctga</td><td>gcctccacac</td><td>tgccctgttt</td><td>ctctatccac</td><td>gggaaccg</td><td> 1740</td>

<td>cctcctgccg</td><td>tttcagaatg</td><td>ttgttcaagt</td><td>ggtactctgt</td><td>gcggtcaata</td><td>aaggcgttat</td><td> 1800</td>

<td>tgccggtgaa</td><td>atctttggga</td><td>agccgttttc</td><td>ctcggggaag</td><td>attacgaaat</td><td>tccccgcgtc</td><td> 1860</td>

gttgcgcttc ctggatctcg aggagatcgt tctccccgtc gagagatcg ttctccgcgt 1520

<td>cgacaccatt</td><td>ccttgcggcg</td><td>gcggtgctca</td><td>acggcctcaa</td><td>cctactactg</td><td>ggctgcttcc</td><td> 1980</td>

<td>taatgcagga</td><td>gtcgcataag</td><td>ggagagcgtc</td><td>gacaaacccg</td><td>cgtttgagaa</td><td>cttgctcaag</td><td> 2040</td>

<td>cttctggtaa</td><td>acgttgtagt</td><td>actctgaaac</td><td>aaggccctag</td><td>cactctgatc</td><td>tgtttctctt</td><td> 2100</td>

<td>gggtagcggt</td><td>gagtggttta</td><td>ttggagttca</td><td>ctggtttcag</td><td>cacatctgtc</td><td>atctagacaa</td><td> 2160</td>

<td>tattgttact</td><td>aaattttttt</td><td>gaactacaat</td><td>tgttcgtaat</td><td>tcatctatta</td><td>ttatacatcc</td><td> 2220</td>

<td>tcgtcagcaa</td><td>tttctggcag</td><td>acggagttta</td><td>ctaacgtctt</td><td>gagtatgagg</td><td>ccgagaatcc</td><td> 2280</td>

<td>agctctgtgg</td><td>ccatactcag</td><td>tcttgacagc</td><td>ctgctgatgt</td><td>ggctgcgttc</td><td>aacgcaataa</td><td> 2340</td>

<td>gcgtgtcctc</td><td>cgactccgag</td><td>ttgtgctcgt</td><td>tatcgtcgtt</td><td>ctcatcctcg</td><td>gaaaaatcac</td><td> 2400</td>

<td>acgaaagaac</td><td>atactcacca</td><td>gtaggctttc</td><td>tggtccctgg</td><td>ggcacggctg</td><td>tttctgacgt</td><td> 2460</td>

<td>attccggcgt</td><td>tgataatagc</td><td>tcgaaagtga</td><td>acgccgagtc</td><td>gcgggagtcg</td><td>accgatgccc</td><td> 2520</td>

<td>ttgagagcct</td><td>tcaacccagt</td><td>cagctccttc</td><td>cggtgggcgc</td><td>ggggcatgac</td><td>tatcgtcgcc</td><td> 2580</td>

<td>gcacttatga</td><td>ctgtctttctt</td><td>tatcatgcaa</td><td>ctcgtaggac</td><td>aggtgccggc</td><td>agcgctctgg</td><td> 2640</td>

<td>gtcattttcg</td><td>gcgaggaccg</td><td>ctttcgctgg</td><td>agcgcgacga</td><td>tgatcggcct</td><td>gtcgcttgcg</td><td> 2700</td>

<td>gtattcggaa</td><td>tcttgcacgc</td><td>cctcgctcaa</td><td>gccttcgtca</td><td>ctggtcccgc</td><td>caccaaacgt</td><td> 2760</td>

<td>ttcggcgaga</td><td>agcaggccat</td><td>tatcgccggc</td><td>atggcggccg</td><td>acgcgctggg</td><td>ctacgtcttg</td><td> 2820</td>

<td>ctggcgttcg</td><td>cgacgcgagg</td><td>ctggatggcc</td><td>ttccccatta</td><td>tgattcttct</td><td>cgcttccggc</td><td> 2880</td>

<td>ggcatcggga</td><td>tgcccgcgtt</td><td>gcaggccatg</td><td>ctgtccaggc</td><td>aggtagatga</td><td>cgaccatcag</td><td> 2940</td>

<td>ggacagcttc</td><td>aaggatcgct</td><td>cggcggctctt</td><td>accagcctaa</td><td>cttcgatcac</td><td>tggaccgctg</td><td> 3000</td>

<td>atcgtcacgg</td><td>cgatttatgc</td><td>cgcctcggcg</td><td>agcacatgga</td><td>acgggttggc</td><td>atggattgta</td><td> 3060</td>

<td>ggcgccgccc</td><td>tataccttgt</td><td>ctgcctcccc</td><td>gcgttgcgtc</td><td>gcggtgcatg</td><td>gagccgggcc</td><td> 3120</td>

<td>acctgacct</td><td>gaatggaagc</td><td>cggcggcacc</td><td>tcgctaacgg</td><td>attcaccact</td><td>ccaagaattg</td><td> 3180</td>

<td>gagccaatca</td><td>attcttgcgg</td><td>agaactgtga</td><td>atgcgcaaac</td><td>caacccttgg</td><td>cagaacat</td><td> 3240</td>

<td>ccatcgcgtc</td><td>cgccatctcc</td><td>agcagccgca</td><td>cgcggcgcat</td><td>cgggggggg</td><td>ggggggggg</td><td> 3300</td>

<td>gggggcaaac</td><td>aattcatcat</td><td>ttttttttta</td><td>ttcttttttt</td><td>tgatttcggt</td><td>ttctttgaaa</td><td> 3360</td>

<td>tttttttgat</td><td>tcggtaatct</td><td>ccgaacagaa</td><td>ggaagaacga</td><td>aggaaggagc</td><td>acagacttag</td><td> 3420</td>

<td>attggtatat</td><td>atacgcatat</td><td>gtagtgttga</td><td>agaaacatga</td><td>aattgcccag</td><td>tattcttaac</td><td> 3480</td>

<td>ccaactgcac</td><td>agaacaaaaa</td><td>ctggacaggaa</td><td>acgaagataa</td><td>atcatgtcga</td><td>aagctacata</td><td> 3540</td>

<td>taaggaacgt</td><td>gctgctactc</td><td>atcctagtcc</td><td>tgttgctgcc</td><td>aagctattta</td><td>atatcatgca</td><td> 3600</td>

<td>cgaaaaacaa</td><td>acaaacttgt</td><td>gtgcttcatt</td><td>ggatgttcgt</td><td>accaccaagg</td><td>aattactgga</td><td> 3660</td>

<td>attagttgaa</td><td>gcattaggtc</td><td>ccaaaatttg</td><td>tttactaaaa</td><td>acacatgtgg</td><td>atatcttgac</td><td> 3720</td>

<td>tgattttttcc</td><td>atggagggca</td><td>cagttaagcc</td><td>gctaaaggca</td><td>tttatccgcca</td><td>agtacaattt</td><td> 3780</td>

<td>tttactcttc</td><td>gaagacagaa</td><td>aatttgctga</td><td>cattggtaat</td><td>acagtcaaat</td><td>tgcagtactc</td><td> 3840</td>

<td>tgcgggtgta</td><td>tacagaatag</td><td>cagaatgggc</td><td>agacattacg</td><td>aatgcacacg</td><td>gtgtggtggg</td><td> 3900</td>

<td>cccaggtatt</td><td>gttagcggtt</td><td>tgaagcaggc</td><td>ggcagaagaa</td><td>gtaacaaagg</td><td>aacctagagg</td><td> 3960</td>

<td>ccttttgatg</td><td>ttagcagaat</td><td>tgtcatgcaa</td><td>gggctcccta</td><td>tctactggag</td><td>aatatactaa</td><td> 4020</td>

<td>gggtactgtt</td><td>gacattgcga</td><td>agagcgacaa</td><td>agattttgtt</td><td>atcggcttta</td><td>ttgctcaaag</td><td> 4080</td>

<td>agacatgggt</td><td>ggaagagatg</td><td>aaggttacga</td><td>ttggttgatt</td><td>atgacacccg</td><td>gtgtgggttt</td><td> 4140</td>

<td>agatgacaag</td><td>ggagacgcat</td><td>tgggtcaaca</td><td>gtatagaacc</td><td>gtggatgatg</td><td>tggtctctac</td><td> 4200</td>

<td>aggatctgac</td><td>attattattg</td><td>ttggaagagg</td><td>actatttgca</td><td>aagggaaggg</td><td>atgctaaggt</td><td> 4260</td>

<td>agagggtgaa</td><td>cgttacagaa</td><td>aagcaggctg</td><td>ggaagcatat</td><td>ttgagaagat</td><td>gcggccagca</td><td> 4320</td>

<td>aaactaaaaa</td><td>actgtattat</td><td>aagtaaatgc</td><td>atgtatacta</td><td>aactcacaaa</td><td>ttagagcttc</td><td> 4380</td>

<td>aatttaatta</td><td>tatcagttat</td><td>tacccgggaa</td><td>tctcggtcgt</td><td>aatgattttt</td><td>ataatgacga</td><td> 4440</td>

<td>aaaaaaaaaa</td><td>attggaaaga</td><td>aaagcccccc</td><td>cccccccccc</td><td>cccccccccc</td><td>ccccccccgc</td><td> 4500</td>

<td>agcgttgggt</td><td>cctggccacg</td><td>ggtgcgcatg</td><td>atcgtgctcc</td><td>tgtcgttgag</td><td>gacccggcta</td><td> 4560</td>

<td>ggctggcggg</td><td>gttgccttac</td><td>tggttagcag</td><td>aatgaatcac</td><td>cgatacgga</td><td>gcgaacgtga</td><td> 4620</td>

agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa catgaatggt cttcggtttc 4680

<td>cgtgtttcgt</td><td>aaagtctgga</td><td>aacgcggaag</td><td>tcagcgccct</td><td>gcaccattat</td><td>gttccggatc</td><td> 4740</td>

<td>tgcatcgcag</td><td>gatgctgctg</td><td>gctaccctgt</td><td>ggaacaccta</td><td>catctgtatt</td><td>aacgaagcgc</td><td> 4800</td>

<td>tggcattgac</td><td>cctgagtgat</td><td>ttttctctgg</td><td>tcccgccgca</td><td>tccataccgc</td><td>cagttgttta</td><td> 4860</td>

<td>ccctcacaac</td><td>gttccagtaa</td><td>ccgggcatgt</td><td>tcatcatcag</td><td>taaccgtat</td><td>cgtgagcatc</td><td> 4920</td>

<td>ctctctcgtt</td><td>tcatcggtat</td><td>cattaccccc</td><td>atgaacagaa</td><td>attccccctt</td><td>acacggaggc</td><td> 4980</td>

<td>atcaagtgac</td><td>caaacaggaa</td><td>aaaaccgccc</td><td>ttaacatggc</td><td>ccgctttatc</td><td>agaagccaga</td><td> 5040</td>

<td>cattaacgct</td><td>tctggagaaa</td><td>ctcaacgagc</td><td>tggacgcgga</td><td>tgaacaggca</td><td>gacatctgtg</td><td> 5100</td>

<td>aatcgcttca</td><td>cgaccacgct</td><td>gatgagcttt</td><td>accgcagctg</td><td>cctcgcgcgt</td><td>ttcggtgatg</td><td> 5160</td>

<td>acggtgaaaa</td><td>cctctgacac</td><td>atgcagctcc</td><td>cggagacggt</td><td>cacagcttgt</td><td>ctgtaagcgg</td><td> 5220</td>

<td>atgccgggag</td><td>cagacaagcc</td><td>cgtcagggcg</td><td>cgtcagcggg</td><td>tgttggcggg</td><td>tgtcggggcg</td><td> 5280</td>

<td>cagccatgac</td><td>ccagtcacgt</td><td>agcgatagcg</td><td>gagtgtatac</td><td>tggcttaact</td><td>atgggcatc</td><td> 5340</td>

<td>agagcagatt</td><td>gtactgagag</td><td>tgcaccatat</td><td>gcggtgtgaa</td><td>ataccgcaca</td><td>gatgcgtaag</td><td> 5400</td>

<td>gagaaaatac</td><td>cgcatcaggc</td><td>gctcttccgc</td><td>ttcctcgctc</td><td>actgactcgc</td><td>tgcgctccgt</td><td> 5460</td>

<td>cgttcggctg</td><td>cggcgagcgg</td><td>tatcagctca</td><td>ctcaaaggcu</td><td>gtaatacggt</td><td>tatccacaga</td><td> 5520</td>

<td>atcacgggat</td><td>aacgcaggaa</td><td>agaacatgtg</td><td>agcaaaaagc</td><td>cagcaaaagg</td><td>ccaggaaccg</td><td> 5580</td>

<td>taaaaaggcc</td><td>gcattgctgg</td><td>cgtttttcca</td><td>taggctccgc</td><td>ccccctgacg</td><td>agcatcacaa</td><td> 5640</td>

<td>aaatcgacgc</td><td>tcaagtcaga</td><td>ggtggcgaaa</td><td>cccgacagga</td><td>ctataaagat</td><td>accaggcgtt</td><td> 5700</td>

<td>tccccctgga</td><td>agctccctcg</td><td>tgcgctctcc</td><td>tgttccgacc</td><td>ctgccgctta</td><td>ccggatacct</td><td> 5760</td>

<td>gtccgcctt</td><td>ctcccttccg</td><td>gaagcgtggc</td><td>gctttctcat</td><td>agctcacgct</td><td>gtaggtatct</td><td> 5820</td>

<td>cagttcggtg</td><td>taggtcgttc</td><td>gctccaagct</td><td>gggctgtgtg</td><td>cacgaacccc</td><td>ccgttcagcc</td><td> 5880</td>

<td>cgaccgctgc</td><td>gccttatccg</td><td>gtaactatcg</td><td>tcttgagtcc</td><td>aacccggtaa</td><td>gacacgactt</td><td> 5940</td>

<td>atcgccactg</td><td>gcagcagcca</td><td>ctggtaacag</td><td>gattagcaga</td><td>gcgaggtatg</td><td>taggcggtgc</td><td> 6000</td>

tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat 6060

<td>ctgcgctctg</td><td>ctgaagccag</td><td>ttaccttcgg</td><td>aaaaagagtt</td><td>ggtagctctt</td><td>gatccggcaa</td>

<td>acaaaccacc</td><td>gctggtagcg</td><td>gtggtttttt</td><td>tgtttgcaag</td><td>cagcagatta</td><td>cgcgcagaaa</td>

<td>aaaaggact</td><td>caagaagatc</td><td>ctttgatctt</td><td>ttctacgggg</td><td>tctgacgctc</td><td>agtggaacga</td>

<td>aaactcacgt</td><td>taagggattt</td><td>tggtcatgag</td><td>attatcaaaa</td><td>aggatcttca</td><td>cctagatcct</td>

<td>tttaaattaa</td><td>aaatgaagtt</td><td>ttaaatcaat</td><td>ctaaagtata</td><td>tatgagtaaa</td><td>cttggtctga</td>

<td>cagttaccaa</td><td>tgcttaatca</td><td>gtgaggcacc</td><td>tatctcagcg</td><td>atctgtctat</td><td>ttcgttcatc</td>

<td>catagttgcc</td><td>tgactccccg</td><td>tcgtgtagat</td><td>aactacgata</td><td>cgggagggct</td><td>taccatctgg</td>

<td>ccccagtgct</td><td>gcaatgatac</td><td>cgcgagaccc</td><td>acgctcaccg</td><td>gctccagatt</td><td>tatcagcaat</td>

<td>aaaccagcca</td><td>gccggaaggg</td><td>ccgagcgcag</td><td>aagtggtcct</td><td>gcaactttat</td><td>ccgcctccat</td>

<td>ccagtctatt</td><td>aattgttgcc</td><td>gggaagctag</td><td>agtaagtagt</td><td>tcgccagtta</td><td>atagtttgcg</td>

<td>caacgttgtt</td><td>gccattgctg</td><td>caggcatcgt</td><td>ggtgtcacgc</td><td>tcgtcgtttg</td><td>gtatggcttc</td>

<td>attcagctcc</td><td>ggttcccaac</td><td>gatcaaggcg</td><td>agttacatga</td><td>tcccccatgt</td><td>tgtgcaaaaa</td>

<td>agcggttagc</td><td>tccttcggtc</td><td>ctccgatcgt</td><td>tgtcagaagt</td><td>aagttggccg</td><td>cagtgttatc</td>

<td>actcatggtt</td><td>atggcagcac</td><td>tgcataattc</td><td>tcttactgtc</td><td>atgccatccg</td><td>taagatgctt</td>

<td>ttctgtgact</td><td>ggtgagtact</td><td>caaccaagtc</td><td>attctgagaa</td><td>tagtgtatgc</td><td>gggacccaggag</td>

<td>ttgctcttgc</td><td>ccggcgtcaa</td><td>cacgggataa</td><td>taccgcgcca</td><td>catagcagaa</td><td>ctttaaaagt</td>

<td>gctcatcatt</td><td>ggaaaacgtt</td><td>cttcggggcg</td><td>aaaactctca</td><td>aggatcttac</td><td>cgctgttgag</td>

<td>atccagttcg</td><td>atgtaaccca</td><td>ctcgtgcacc</td><td>caactgatct</td><td>tcagcatctt</td><td>ttactttcac</td>

<td>cagcgtttct</td><td>gggtgagcaa</td><td>aaacaggaag</td><td>gcaaaatgcc</td><td>gcaaaaaagg</td><td>gaataagggc</td>

<td>gacacggaaa</td><td>tgttgaatac</td><td>tcatactctt</td><td>cctttttcaa</td><td>tattattgaa</td><td>gcatttatca</td>

<td>gggttattct</td><td>ctcatgagcg</td><td>gatacatatt</td><td>tgaatgtatt</td><td>tagaaaaata</td><td>aacaaatagg</td>

<td>ggttccgcgc</td><td>acatttcccc</td><td>gaaaagtgcc</td><td>actgacgtc</td><td>taagaaacca</td><td>ttattatcat</td>

6120

6180

6240

6300

6360

6420

6480

6540

6600

6660

6720

6780

6840

6900

6960

7020

7080

7140

7200

7260

7320

7380 gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtcttcaa

7429 <210> 37 <211> 39 <212> DNA <213> Synthetic primer or probe <400> 37 catcacaaat atgaggtgcg caacgtgtcc gggatgtac 39 <210> 38 <211> 42 <212> DNA <213> Synthetic primer or probe <400> 38 gtgatggtgg tgtcctagtg ctgctagtgg taggaagcat ag 42 <210> 39 <211> 4273 <212> DNA <213> Vector pUC18-FMD-CL-El-H-K6 <220>

<221> MISCELLANEOUS <222> (1027) . . (1028) <223> N is any nucleotide <220>

<221> MISCELLANEOUS <222> (1206) . . (1207) <223> N is any nucleotide <400> 39 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 60 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 120 cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 180 tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg aattcgagct 240 cggtacccgg ggatccttaa tggtgatggt ggtggtgcca gttcatcatc atatcccaag 300 ccatacggtg acctgttatg tggccgggat agattgagca attgcagtcc tgcaccgtct 360 catgccggcg aggcgagatg gtgaacagct gggagacgag gaagacagat ccgcagagat 420 cccccacgta catagcggaa cagaaagcag ccgccccaac gagcaaatcg acgtggcgtc 480 gtattgtcgt agtggggacg ctggcgttcc tagctgcgag cgtgggggtg agcgctaccc 540 agcagcggga agagttgttc tcccgaacgc agggcacgca cccgggagtg tgcatgatca 600 tgtccgctgc ctcatacaca atgcttgagt tggagcagtc gttcgtgaca tggtacatcc 660 cggacacott gcgcacctca tatttgtgat ggtgatggtg gtgtcctagt gctgctagtg 720 gtaggaagca tagtactagt attagtaggc ttcgcatgaa ttcccgatga aggcagagag 780 cgcaaggagg cggtatttat agtgccattc ccctctctga gagacccgga tggtagtcga 840 gtgttatcgg agacagcttg atgtagactc cgtgcctgcc ggtcctctta ttggcggaca 900 ccagtgagac accccggaac ttgctgtttt tctgcaaaat ccggggtgac cagtgggagc 960 ctatttgcac acacgagcgg gacaccccac tctggtgaag agtgccaaag tcattctttt 1020 tcccgtnncg gggcagccga ttgcatgttt taggaaaata ttacctttgc tacaccctgt 1080 cagatttacc ctccacacat atatattccg tcacctccag ggactattct tggctcgttg 1140 cgccgccgcg gaagatatcc agaagctgtg ttttccgaga gactcggttg gcgcctggta 1200 tatttnnagg atgtcgcgct gcctcacgtc ccggtaccca ggaacgcggt gggatctcgg 1260 gcccatcgaa gactgtgctc cagactgctc gcccagcagg tgtttcttga ttgccgcctc 1320 taaatagtcc gcgcatcgcc ggtaacattt ttccagctcg gagtttgcgt ttagatacat 1380 ttctgcgatg ccaaaggagc ctgcagatta taacctcgga tgctgtcatt cagcgctttt 1440 aatttgacct ccagatagtt gctgtatttc tgttccattg gctgctggac gttcgtataa 1500 ctcgagttat tgttgcgctc tgcctcggcg tactggctca tgactgactg cggtcgcttc 1560 tcgagtgttc tcgcaacagg acgcctgcag gtcatcgagt cgagctggcg ccgaaactgg 1620 cggatctgac ctccacactg ccctgtatct ctatccaccg ggaaccgcct cctgccgttc 1680 cagaatgttg ttcaagtggt agctctgtgc ggtcaatgaa ggcgttattg ccggtgaaat 1740

<td>ctttgggaag</td><td>cggtttatcc</td><td>tcggggaaga</td><td>ttachagaatt</td><td>cccgcgcgtc</td><td>gttgcgcttc</td><td> 1800</td>

<td>ctggatctcg</td><td>aggaagatcg</td><td>ttctccgcgt</td><td>cgaggagatc</td><td>gttctccgcg</td><td>tcgacctgca</td><td> 1860</td>

<td>ggcatgcaag</td><td>cttggcactg</td><td>gccgtcgttt</td><td>tacaacgtcg</td><td>tgactgggaa</td><td>aaccctggcg</td><td> 1920</td>

<td>ttacccaact</td><td>taatcgcctt</td><td>gcagcacatc</td><td>cccctttcgc</td><td>cagctggcgt</td><td>aatagcgaag</td><td> 1980</td>

<td>aggcccgcac</td><td>cgatcgccct</td><td>tcccaacagt</td><td>tgcgcagcct</td><td>gaatggcgaa</td><td>tggcgcctga</td><td> 2040</td>

<td>tgcggtattt</td><td>tctccttacg</td><td>catctgtgcg</td><td>gtatttcaca</td><td>ccgcatatgg</td><td>tgcactctca</td><td> 2100</td>

<td>gtacaatctg</td><td>ctctgatgcc</td><td>gcatagttaa</td><td>gccagccccg</td><td>acacccgcca</td><td>acaccgctg</td><td> 2160</td>

<td>acgcgccctg</td><td>acgggcttgt</td><td>ctgctcccgg</td><td>catccgctta</td><td>cagacaagct</td><td>gtgaccgtct</td><td> 2220</td>

<td>ccgggagctg</td><td>catgtgtcag</td><td>aggttttcac</td><td>cgtcatcacc</td><td>gaaacgcgcg</td><td>agacgaaagg</td><td> 2280</td>

<td>gcctcgtgat</td><td>acgcctattt</td><td>ttataggtta</td><td>atgtcatgat</td><td>aataatggtt</td><td>tcttagacgt</td><td> 2340</td>

<td>caggtggcac</td><td>tttcgggga</td><td>aatgtgcgcg</td><td>gaacccctat</td><td>ttgtttattt</td><td>ttctaaatac</td><td> 2400</td>

<td>attcaaatat</td><td>gtatccgctc</td><td>atgagacaat</td><td>aaccctgata</td><td>aatgcttcaa</td><td>taatattgaa</td><td> 2460</td>

<td>aaaggaagag</td><td>gatgagtatt</td><td>caacatttcc</td><td>atgtcgccot</td><td>tattcccttt</td><td>tttgggcat</td><td> 2520</td>

<td>tttgccttcc</td><td>tgtttttgct</td><td>cacccagaaa</td><td>cgctggtgaa</td><td>agtaaaagat</td><td>gctgaagatc</td><td> 2580</td>

<td>agttgggtgc</td><td>acgagtgggt</td><td>tacatcgaac</td><td>tggatctcaa</td><td>cagcggtaag</td><td>atccttgaga</td><td> 2640</td>

<td>gttttcgccc</td><td>cgaagaacgt</td><td>tttccaatga</td><td>tgagcacttt</td><td>taaagttctg</td><td>ctatgtggcg</td><td> 2700</td>

<td>cggtattatc</td><td>ccgtattgac</td><td>gccgggcaag</td><td>agcaactcgg</td><td>tcgccgcata</td><td>cactattctc</td><td> 2760</td>

<td>agaatgactt</td><td>ggttgagtac</td><td>tcaccagtca</td><td>cagaaaagca</td><td>tcttacggat</td><td>ggcatgacag</td><td> 2820</td>

<td>taagagaatt</td><td>atgcagtgct</td><td>gccataacca</td><td>tgagtgataa</td><td>cactgcggcc</td><td>aacttacttc</td><td> 2880</td>

<td>tgacaacgat</td><td>cggaggaccg</td><td>aaggagctaa</td><td>ccgctttttt</td><td>gcacaacatg</td><td>gggatcatg</td><td> 2940</td>

<td>taactcgcct</td><td>tgatcgttgg</td><td>gaaccggagc</td><td>tgaatgaagc</td><td>cataccaaac</td><td>gacgagcgtg</td><td> 3000</td>

<td>acaccacgat</td><td>gcctgtagca</td><td>atggcaacaa</td><td>cgttgcgcaa</td><td>actattaact</td><td>ggcgaactac</td><td> 3060</td>

ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac 3120

<td>cacttctgcg</td><td>ctcggccctt</td><td>ccggctggct</td><td>ggtttattgc</td><td>tgataaatct</td><td>ggagccggtg</td><td> 3180</td>

<td>agcgtgggtc</td><td>tcggtatc</td><td>attgcagcac</td><td>tggggccaga</td><td>tggtaagccc</td><td>tcccgtatcg</td><td> 3240</td>

<td>tagttatcta</td><td>cacgacgggg</td><td>agtcaggcaa</td><td>ctatggatga</td><td>acgaaataga</td><td>cagatcgctg</td><td> 3300</td>

<td>agataggtgc</td><td>ctcactgatt</td><td>aagcattggt</td><td>aactgtcaga</td><td>ccaagtttac</td><td>tcatatatac</td><td> 3360</td>

<td>tttagattga</td><td>tttaaaactt</td><td>catttttaat</td><td>ttaaaaggat</td><td>ctaggtgaag</td><td>atccttttg</td><td> 3420</td>

<td>ataatctcat</td><td>gaccaaaatc</td><td>ccttaacgtg</td><td>agttttcgtt</td><td>ccactgagcg</td><td>tcagaccccg</td><td> 3480</td>

<td>tagaaaagat</td><td>caaaggatct</td><td>tcttgagatc</td><td>ctttttttct</td><td>gcgcgtaatc</td><td>tgctgcttgc</td><td> 3540</td>

<td>aaacaaaaaa</td><td>accaccgcta</td><td>ccagcggtgg</td><td>tttgtttgcc</td><td>ggatcaagag</td><td>ctaccaactc</td><td> 3600</td>

<td>tttttccgaa</td><td>ggtaactggc</td><td>ttcagcagag</td><td>cgcagatacc</td><td>aaatactgtc</td><td>cttctagtgt</td><td> 3660</td>

<td>agccgtagtt</td><td>aggccaccac</td><td>ttcaagaact</td><td>ctgtagcacc</td><td>gcctacatac</td><td>cctgctctgc</td><td> 3720</td>

<td>taatcctgtt</td><td>accagtggct</td><td>gctgccagtg</td><td>gcgataagtc</td><td>gtgtcttacc</td><td>gggttggact</td><td> 3780</td>

<td>caagacgata</td><td>gttaccggat</td><td>aaggcgcagc</td><td>ggtcgggctg</td><td>aacggggggt</td><td>tcgtgcacac</td><td> 3840</td>

<td>agcccagctt</td><td>ggagcgaacg</td><td>acctacaccg</td><td>aactgagata</td><td>cctacagcgt</td><td>gagctatgag</td><td> 3900</td>

<td>aaagcgccac</td><td>gcttcccgaa</td><td>gggagaaagg</td><td>cggacaggta</td><td>tccggtaagc</td><td>ggcagggtcg</td><td> 3960</td>

<td>gaacaggaga</td><td>gcgcacgagg</td><td>gagcttccag</td><td>ggggaaacgc</td><td>ctggtatctt</td><td>tatagtcctg</td><td> 4020</td>

<td>tcggttttcg</td><td>ccacctctga</td><td>cttgagcgtc</td><td>gtttttgtg</td><td>atgctcgtca</td><td>gggggcgga</td><td> 4080</td>

<td>gcctatggaa</td><td>aaacgccagc</td><td>aacgcggcct</td><td>ttttacggtt</td><td>cctggccttt</td><td>tgctggcctt</td><td> 4140</td>

<td>ttgctcacat</td><td>gttctttcct</td><td>gcgttatccc</td><td>ctgattctgt</td><td>ggataacct</td><td>attaccgcct</td><td> 4200</td>

<td>ttgagtgagc</td><td>tgataccgct</td><td>cgccgcagcc</td><td>gaacgaccga</td><td>gcgcagcgag</td><td>tcagtgagcg</td><td> 4260</td>

<td>aggaagcgga</td><td>aga</td><td></td><td></td><td></td><td></td><td> 4273</td>

<210> 40 <211> 7330 <212> DNA <213> pFPMT-CL-H6-K-El Vector <220>

<221> MISCELLANEOUS <222> (1098) . . (1099) <223> N is any nucleotide <220>

<221> MISCELLANEOUS <222> (1277) . . ¢1278) <223> N is any nucleotide <400> 40