Avian herpesvirus-based live recombinant avian vaccine, in particular against Gumboro disease

Attorney or Agent

DAVIES COLLISON CAVE , 1 Little Collins Street, MELBOURNE VIC 3000 (57)

A live recombinant avian vaccine comprises, as vector, an avian herpesvirus which includes at least one nucleotide sequence which encodes, and expresses, an antigenic polypeptide of an avian pathogen and which is inserted in the UL43 gene under the control of the CMV immediate early promoter.

S .mu ...... ii min.......·........nmHi.!

<img file="AU4063095A_D0001.tif" />

AUSTRALIA PATENTS ACT 1990 COMPLETE SPECIFICATION

NAME OF APPLICANT(S): Rhone Merieux ft ft O 0 0 ft

SV’. ADDRESS FOR SERVICE:

β ’ - - f DAVIES COLLISON CAVE ·““'*· Patent Attorneys ο 1 Little Collins Street, Melbourne, 3000.

b ft β ’° INVENTION TITLE:

ft o 4 β ft 0 eft ft

Avian herpesvirus-based live recombinant avian vaccine, in particular against „ . Gumboro disease ft ft ft ft ft ft * β I ft a w ft 4 ft

The following statement is a full description of this invention, including the best method of performing it known to me/us:V

I la

The present invention relates to vaccines for avian use which are based on live recombinant avian herpesviruses namely, and in particular, Marek's disease virus (MDV) and, more especially, HVT virus (herpesvirus of turkey) , in which has been inserted, by genetic recombination, at least one nucleotide sequence which encodes, and expresses, an antigenic polypeptide of an avian pathogen under conditions which ensure an immunization leading to efficient protection of the vaccinated animal against the said pathogen. It also applies to infectious laryngotracheitis virus (ILTV) and to duck herpesvirus .

A certain number of recombinant avian viral vectors have already been proposed for the purpose of vaccinating birds against avian pathogens, especially viral pathogens, including the viruses of Marek's disease (MDV), of Newcastle disease (NDV), of infectious laryngotracheitis (ILTV), of Gumboro disease (infectious bursal disease, IBDV), of infectious bronchitis (IBV) and of avian anemia (CAV).

The viral vectors employed include avipox viruses, in particular fowlpox (EP-A-0 517 292;

H.-G. Heine et al., Arch. Virol. 1993, 131: 277-292;

D.B. Boyle et al. , Veterinary Microbiology 41, 1994, 173181; C.D. Bayliss et al., Arch. Virol. 1991, 120: 193205), Marek's viruses, especially serotypes 2 and 3 (HVT) (WO-A-87 04463; WO-A-89 01040; WO-A-93 25665;

EP-A-0 513 921; J. McMillen, Poultry Condemnation Meeting, October 1994, 359-363; P.J.A. Sondermeijer et al., Vaccine 1993, al., Avian Diseases 36;

11.

349-357; R.W. Morgan et

858-870, 1992 and 37: 1032-1040, 1993) and also ILTV virus and avian adenovirus.

When used for vaccination, these recombinant viruses induce varying, in general weak or partial, levels of protection, even if a substantial degree of protection can be demonstrated in rare specific

J ο ο □

β &gt; ο β

Ο β 0 3

Ο 0 3 Ο Ο

3 0 0 ο ο ο ο ο © ο ο ο ο ο

ο ο ο ο ο ο ο ο ο ο ο ο β ο

0 0 ο ο β ο ο Ο Ο θ

0 ο «« ο 0 0 9 β © β ί»#90 0 ο ο • ο ο Ο Ο θ • ·» * ins tances .

Gumboro disease virus, or IBDV virus, is one of the most difficult tc protect against using live recombinant avian vaccines. Thus, although effective conventional live attenuated or inactivated vaccines against this disease are available, no live recombinant vaccine has yet been demonstrated to have suitable efficacy.

The genome of Gumboro disease virus consists of a double-stranded RNA. The largest segment (segment A) encodes a polyprotein of 115 kDa, which is secondarily cleaved into three proteins, VP2 (41 kDa), VP4 (28 kDa) and VP3 (32 kDa) . VP4 would appear to be a protease which is involved in the maturation of the 115 kDa polyprotein. The position of the cleavage site between VP2 and VP4 has only been determined approximately (M. Jagadish, J. Virol. 1988, 62, 1084-1087) . The VP2 protein is an immunogen which induces neutralizing antibodies and protection against Gumboro disease.

It has already been proposed to insert genes encoding immunogenic IBDV proteins into various live vectors: EP-A-0 517 292 (insertion of sequences encoding VP2 or the polyprotein into an avipox); C.D. Bayliss 1991, H.-G. Heine 1993 and D.B. Boyle 1994 above (VP2 in fowlpox); WO-A-90 02802 (MDV vector); WO-A-90 02803 (HVT and ILTV vectors); French patent applications Nos. 90 03105, 90 11146 and 92 13109 (HVT vector) .

Patent applications WO-A-89 01040 and WO-A-93 25655 describe the construction of an HVT avian viral vector in which a sequence permitting expression of the native VP2 protein of the IBDV virus, known as the prime polypeptide candidate for vaccinating against Gumboro disease, has been inserted into the Xhol insertion site which is present in the HVT UL43 gene, identify ed in the first of these two applications under the designation BamHI fragment #16, under the control of an exogenous promoter. However, despite obtaining a native VP2 protein, it was not possible to obtain any induction of neutralizing antibodies or protection when the v

i—

<img file="AU4063095A_D0002.tif" />

' vaccinated animals were challenged with virulent IBDV virus .

This is why the idea of using this site has not been pursued, and it has instead been proposed, in

WO-A-93 25655, to insert sequences which permit . expression of the IBDV VP2 protein, still under the ' control of an exogenous promoter, into the unique Stul site of the HVT US2 gene. The expression of the VP2 protein was characterized in vitro, without demonstrating any activity or protection in vivo. It may also be noted that insertions of other genes in this US2 Stul site, namely the MDV gB gene, accompanied or not accompanied by the gC gene (termed gA in this earlier document) , and linked to its own promoter, or the gB and gC genes together with the F gene of NDV linked to the immediate early (IE) HCMV promoter, or the gB and gC genes together with the NDV HN gene linked to the PRV promoter gX, have made it possible to obtain protection against challenges with the corresponding virulent viruses. Similarly, protection is reported for constructs in which the gB and gD genes of the ILTV virus are inserted into this same site. These results contrast with the total absence of protection, and the n-&gt;.ive assumptions, in application WO-A-89 01040.

Various promoters, including those which are generally available commercially, have been used in the different constructs of the prior art, including the PRV gX promoter, the HCMV IE (human CMV immediate early) promoter, the herpes simplex alpha-4 promoter, the

FPV Ρ.Ξ/L promoter (fowlpox promoter) (H. Heine et al. , 1993 , Arch. Virol. 131, 277-292), P7.5 (C. Bayliss et al · , 1991, Arch. Virol. 120, 193-205) and Pll (D. Boyle et al., 1994, Vet. Microb. 41, 173-181) promoters of vaccinia virus, originating from the LTR sequence of RSV (Rous sarcoma virus) and the early SV40 promoter, as well as the MDV or HVT promoters, such as the promoters of the genes gB, gC, TK, RR2, etc., without any consistent pattern emerging, especially as regards constructs in HVT. The sequences of certain promoters can inhibit the ο ο ο ο 0 &lt; ο ο ο ο replication, of the HVT or MDV recombinant vectors (D.R. Marshall et al. , J. Meth. 1992, 40, 195-204 and

Virology 1993, 195, 638-648). Among the cited promoters, a certain number, such as, for example, SV40,

LTR RSV and PRV gX, have displayed a certain degree of efficacy, as have certain native promoters of certain genes of the Marek's viruses, especially serotype 3.

There still exists, therefore, due to the technical and economic constraints imposed by inactivated vaccines and the safety problems associated with the use of live attenuated vaccines, the need for a live recombinant vaccine which is effective against Gumboro disease virus (IBDV). Such a vaccine, which is based on a recombinant HVT vector and which would be truly effective against Gumboro disease, could, moreover, open the way to vaccines which were very effective against other avian diseases, in view of the fact that it is particularly difficult to achieve protection against Gumboro disease.

0 The invention has now, surprisingly, made it possible to develop an HVT vector-based live recombinant vaccine in which at least one' sequence encoding the IBDV VP2 protean is inserted and which ensures total protection of animals against Gumboro disease, namely protection against death and against lesions of the bursa of Fabricius. Furthermore, the efficacy of this vaccine proves to be such that it has become possible even to vaccinate one-day-old chicks effectively and without any secondary effects (especially the absence of local lesions at the point of injection and the absence of any lesion in the bursa of Fabricius), something which was not even possible using inactivated vaccines. In addition, the doses which are required are astonishingly low.

The subject of the present invention is a live recombinant avian vaccine which comprises, as vector, an avian herpesvirus which includes at least one nucleotide sequence which encodes, and expresses, an antigenic polypeptide of an avian pathogen and which is inserted in • « 0 • ο a e ♦ ·

Ο β « » 0 0 the UL43 gene under the control of the CMV immediate early promoter.

The avian herpesviruses according to the invention are preferably the Marek's disease viruses, especially HVT, infectious laryngotracheitis virus ILTV and duck herpesvirus. The Marek's disease viruses and, more particularly, HVT virus are preferred.

Insertion into the UL43 gene is understood to mean both simple insertion into this site without deleting it and insertion following total or partial deletion. Insertion after partial deletion is preferred.

CMV immediate early (IE) promoter is understood to mean the fragment given in the examples as well as its subfragments which retain the same promoter activity.

The CMV IE promoter can be the human promoter (HCMV IE) or the murine promoter (MCMV IE) , or else a CMV IE promoter of different origin, for example from the rat or from the guinea-pig.

The nucleotide sequence which is inserted into

0 the Marek vector in order to be expressed can be any sequence encoding an antigenic polypeptide of an avian pathogen, which polypeptide is capable, once expressed under the favorable conditions procured by the invention, of ensuring an immunization which leads to effective protection of the vaccinated animal against the pathogen. It will be possible, therefore, under the conditions of the invention, to insert nucleotide sequences which encode antigens of interest for a given disease. In particular, the characteristics of the recombinant

0 according to the invention, permit vaccination in ovo and vaccination of 1-day old-chicks, as well as vaccination of older chicks and adults.

The typical case of the invention is the insertion of a nucleotide sequence which expediently

5 encodes the VP2 polypeptide of the IBDV virus. In this way, a live recombinant vaccine is obtained which ensures, in addition to protection against Marek's disease, total protection against Gumboro disease. If desired, a sequence encoding another IBDV antigen, such on oa οο ο ο ο

<img file="AU4063095A_D0003.tif" />

099 9 ο ο ο ο ο ο

Ο η Ο ο (I «&lt;ι«

Ο ο ο οο ο ββ ο Ο Ο f&gt; ο β «

0909«« ο ο • «* ο Ο 0 0

Jas VP3 or even the polyprotein VP2+VP4+VP3, can also be inserted, with these other possibilities not being preferred.

The recombinant vaccine against Gumboro disease 5 will preferably be administered within the range of from . 10 to 10⁴ PFU/dose, more especially of from 10² to 10³

PFU/dose, and even between 10 and 10² PFU/dose, approximately.

Other preferred cases of the invention are the 10 insertion of nucleotide sequences which encode antigens of Marek's disease virus, in particular genes gB, gC, gD and gH+gL (WO-A-90 02803), of Newcastle disease virus, in particular genes F and HN, of infectious bronchitis virus (IBV), in particular genes S and Μ (M. Binns et al., J.

Gen. Virol. 1985, 65, 719-726; M. Boursnell et al., Virus Research 1984, 1, 303-313), of avian anemia virus (CAV), in particular VP1(52kDa)+VP2(24kDa) (N.H.M. Noteborn et al. , J. Virol. 1991, 65, 3131-3139) and of infectious laryngotracheitis virus (ILTV), in particular genes gB (WO-A-90 02802), gC, gD and gH+gL.

The doses will preferably be the same as those which are indicated for the Gumboro vaccine. 1

According to an advantageous development of the invention, the CMV IE promoter is linked to another promoter in a head-to-foot orientation, making it possible to insert two nucleotide sequences into the insertion site, one under the control of the CMV IE promoter and the other under the control of the linked promoter.

This construct is remarkable for the fact that the presence of the CMV IE promoter, and especially of its enhancer part, activates the transcription which is !

induced by the linked promoter. A preferred linked promoter is the Marek 1.8 RNA promoter, whose transcriptional activity is found to be increased 4.4 fold under these conditions.

The typical case of the invention is a vaccine comprising a nucleotide sequence which encodes IBDV VP2 under the control of CMV IE and a nucleotide sequence which encodes an antigen of another avian disease.

ο

C ft ο ο « « ο ΰ 9

Ο Ο &lt;5 Ο

0*00

Ο 9

9 β β α β «

9 · ο · α « β • especially those cited above, under the control of another promoter.

Two CMV IE promoters of different origins can also be arranged in a head-to-foot orientation.

It will also be possible to use the 1.8 RNA promoter on its own in place of the CMV IE promoter, especially for vaccines against Marek's disease, Newcastle disease, infectious laryngotracheitis, infectious bronchitis and avian anemia.

The present invention also relates to a multivalent vaccine formulation which comprises, in a mixture or to be mixed, at least two live recombinant avian vaccines such as defined above, with these vaccines containin'; different inserted sequences, especially from different pathogens.

The present invention also relates to a method of avian vaccination which comprises administering a live recombinant vaccine or a multivalent vaccine formulation such as defined above. It particularly relates to such a method for vaccinating in ovo, for vaccinating chicks of 1 day of age or older, and for vaccinating adults.

The invention will now be described in more detail with the aid of non-limiting exemplary embodiments and by reference to the drawings in which: List of the dra25 wings and of the sequences of the constructs in the UL43 site

<td> Figure 1:</td><td> Sequence of the HVT U₃ gl region</td>

<td> Figure 2 :</td><td> Construction of the plasmids pRD022 and</td>

<td></td><td> pRD027</td>

<td> Figure 3 :</td><td> Construction of the plasmids pRD023 and</td>

<td></td><td> pRD029</td>

<td> Figure 4 :</td><td> plasmid pCMV/3</td>

<td> Figure 5 :</td><td> plasmid pEL022</td>

<td> Figure 6:</td><td> plasmid pEL023</td>

<td> Figure 7:</td><td> plasmid pEL024</td>

<td> Figure 8:</td><td> plasmid pEL025</td>

<td> Figure 9:</td><td> Sequence of the HVT BamHI M fragment and</td>

<td></td><td> ORF UL43</td>

<td> Figure 10:</td><td> Construction of the plasmids pMBOlO and</td>

pMB016 ρ

V·------- - . 0 ϋβ 0 0 0

Ο ^ζ ο 1} «3 ο β «3 Ο 0 ο ο

Ο 0 4

Ο

4 4 β « ο 0 0

Ο Off Ο 0 4

4 0

0 4 · 4 δ

<td></td><td> Figure 11; Figure 12« Figure 13: Figure 14i</td><td> plasmid plasmid plasmid plasmid</td><td> PEL026 PEL027 pE',L042 pCDOO'J</td>

<td> 5</td><td> Figure 15i</td><td> pl asmid</td><td> pCD009</td>

<td></td><td> Figure 16i</td><td> plasmid</td><td> pEL068</td>

<td></td><td> Figure 17«</td><td> plasmid</td><td> PEL070</td>

<td></td><td> Figure 18i</td><td> plasmid</td><td> pEL072</td>

<td></td><td> Figure 19 i</td><td> plasmid</td><td> pCDOll</td>

<td> 10</td><td> Figure 20:</td><td> plasmid</td><td> PCD012</td>

<td></td><td> Figure 21:</td><td colspan="2"> Sequenoe of the Νυν hn gene</td>

<td></td><td> Figure 22;</td><td> plasmid</td><td> pEDO28</td>

<td></td><td> Figure 23:</td><td> piasmid</td><td> pEL029bi s</td>

<td></td><td> Figure 24:</td><td> piaemid</td><td> pEL030</td>

<td> 15</td><td> Figure 25:</td><td> plasmid</td><td> PEL032</td>

<td></td><td> Figure 26:</td><td> piaemid</td><td> pBl.043</td>

<td></td><td> Figure 27:</td><td> pi asmid</td><td> pBL033</td>

<td></td><td> Figure 28:</td><td> plasmid</td><td> PEL034</td>

<td></td><td> Figure 29»</td><td> plasmid</td><td> pEL044</td>

<td> 20</td><td> Figure 30:</td><td> 1.8 kbp</td><td> RNA promote!· sequence</td>

<td></td><td> Figure 31;</td><td> plasmid</td><td> pBS002</td>

<td></td><td> Figure 32;</td><td> piaemid</td><td> pEl.069</td>

<td></td><td> Figure 33;</td><td> pl asmid</td><td> pELOeO</td>

<td></td><td> Figure 34:</td><td> plasmid</td><td> pEL081</td>

<td> 25</td><td> Figure 35;</td><td> plasmid</td><td> PEL082</td>

<td></td><td> Figure 36:</td><td> plasmid</td><td> pBL096</td>

/

<img file="AU4063095A_D0004.tif" />

List of the SEQ ID sequences of the constructs in the UL43 Bite

<td> SKQ</td><td> ID</td><td> NO.</td><td> 1</td><td> 01igonucleotide</td><td> RD04 5</td><td></td>

<td> SKQ</td><td> ID</td><td> NO.</td><td> 2</td><td> 01igonucleotide</td><td> pBRPst-</td><td></td>

<td> SEQ</td><td> ID</td><td> NO.</td><td> 3</td><td> Sequence of the</td><td> HVT U, gl</td><td> reqion</td>

<td> SKQ</td><td> ID</td><td> NO.</td><td> 4</td><td> 01igonucleotide</td><td> RU04 8</td><td></td>

<td> SKQ</td><td> ID</td><td> NO.</td><td> 5</td><td> 01igonucleotide</td><td> RD04 9</td><td></td>

<td> SKQ</td><td> ID</td><td> NO.</td><td> 6</td><td> Sequence of the</td><td> BVT BamHI</td><td> M fragment</td>

<td> SKQ</td><td> ID</td><td> NO.</td><td> 7</td><td> 01igonucleotide</td><td> MB014</td><td></td>

<td> SKQ</td><td> ID</td><td> NO.</td><td> 8</td><td> Oligonucleotide</td><td> MB015</td><td></td>

<td> SKQ</td><td> ID</td><td> NO.</td><td> 9</td><td> 01igonucleotide</td><td> MB07O</td><td></td>

<td> SKQ</td><td> ID</td><td> NO.</td><td> 10</td><td> 01igonucleotide</td><td> MB073</td><td></td>

ί

I ί

ί

<img file="AU4063095A_D0005.tif" />

ί;

j j

C ft β Ο 0 β ε ο ο ο

0 ο«

Ο Ο β ο « ο 0 9 ο ο ο β 9 « « β 9 9 • 9 «09« β

ΜίΙ till • « β

0 9

9 0 4

0 0 9 a ο « »» « β ο ο ft β »090»«

Ο · • Ο ·

Ο β I ο β « «β β 4 » ·

Ο · ·

<td></td><td> SEQ SEQ SEQ SEQ</td><td> ID ID ID ID</td><td> NO. NO. NO. NO.</td><td> 11 12 13 14</td><td> Oligonucleotide Oligonucleotide Oligonucleotide Oligonucleotide</td><td> CD001 CD002 CD0 0 3 CD004</td>

<td> 5</td><td> SEQ</td><td> ID</td><td> NO.</td><td> 15</td><td> Sequence of the</td><td> NDV HN gene</td>

<td></td><td> SEQ</td><td> ID</td><td> NO.</td><td> 16</td><td> Oligonucleotide</td><td> EL071</td>

<td> -</td><td> SEQ</td><td> ID</td><td> NO.</td><td> 17</td><td> Oligonucleotide</td><td> EL073</td>

<td></td><td> SEQ</td><td> ID</td><td> NO.</td><td> 18</td><td> Oligonucleotide</td><td> EL074</td>

<td></td><td> SEQ</td><td> ID</td><td> NO.</td><td> 19</td><td> Oligonucleotide</td><td> EL075</td>

<td> 10</td><td> SEQ</td><td> ID</td><td> NO.</td><td> 20</td><td> Oligonucleotide</td><td> EL076</td>

<td></td><td> SEQ</td><td> ID</td><td> NO.</td><td> 21</td><td> Oligonucleotide</td><td> EL077</td>

<td></td><td> SEQ</td><td> ID</td><td> NO.</td><td> 22</td><td> Sequence of the</td><td> 1.8 kbp RNA promoter</td>

<td></td><td> SEQ</td><td> ID</td><td> NO.</td><td> 23</td><td> Oligonucleotide</td><td> MB047</td>

<td></td><td> SEQ</td><td> ID</td><td> NO.</td><td> 24</td><td> Oligonucleotide</td><td> MB048</td>

<td> 15</td><td> SEQ</td><td> ID</td><td> NO.</td><td> 25</td><td> Oligonucleotide</td><td> MB072</td>

2. EXAMPLES

All the plasmid constructions were carried out using standard molecular biological techniques described by Sambrook J. et al. (Molecular Cloning·; A Laboratory

Manual. 2nd Edition. Cold Spring Harbor Laboratory. Cold Spring Harbor. New York. 1989). All the restriction fragments which were employed for the present invention were isolated using the Geneclean kit (BI0101 Inc. La Jolla, CA) .

5 The virus which was used as parent virus is the turkey herpesvirus (HVT) strain FC126, which was isolated by Dr. Witter of the Regional Poultry Research Laboratory (USDA, East Lansing, Michigan) in a 23-week old flock of turkeys (Witter R.L. efc al. Am. J. Vet. Res. 1970. 31.

525-538) . The conditions for culturing this virus are those described elsewhere (French patent application 90 03105) .

Example 1: Extraction of the DNA of Marek's disease virus;

The whole blood of a chicken which was challenged at 7 days with the strain MDV RB1B is collected with a syringe on to anticoagulant (100 IU/ml heparin solution) • at 14 days after infection. The blood is then centrifuged at 30 g for 15 minutes and at ambient temperature. The plasma as well as the buffy coat are removed and diluted in sterile PBS up to a final volume of 10 ml. After centrifuging at 150 g for 15 minutes, the cell pellet is . resuspended in 2 ml of 19 9 culture medium (Gibco-BRL

- Cat#042-01183M) containing 2% fetal calf serum (FCS).

The total DNA of the infected lymphocytes is then extracted using the technique described by R. Morgan et

a.1. (Avian Diseases. 1990. 34. 345-351) and can be used directly as a template for PCR experiments. In order to clone genomic fragments of the MDV virus, the RB1B strain _o . was cultured on CEC and the viral. DNA was prepared from o o · viral particles which were purified as described by Lee °° ’ 15 Y. et al. (J. Gen. Virol. 1980. 51. 245-253).

ο a © p “ - o r ·- v © o o

Example 2: Preparation of the genomic DNA of the MCMV

Ci«e (mouse cytomecfalovirus) virus , _oo The Smith MCMV virus strain was obtained from the

O O 0 ,&lt;»♦ American Type Culture Collection, Rockville, Maryland, © 0 0

USA (ATCC No. VR-194). This virus was cultured on Balb/C « mouse embryo cells, and the viral DNA of this virus was

0 0 &lt;» P « prepared as described by Ebeling A. et al. (J. Virol.

° ’ 1983 . 47. 421-433) .

« 0 β O 0

0 1 „&gt;·„ ! Example 3: Preparation of the oenomic DNA of the BVT « «

5 virus for the transfection experiments:

The viral DNA which was used for the transfection experiments was prepared, in accordance with the technique described by R. Morgan et al. (Avian Diseases. 1990. 34. 345-351), using a culture of secondary CEC (CEC

II) which was infected with the HVT virus FC126 strain.

Construction of the recombinant viruses

Example 4: Construction and isolation of vHVTl

The construction of the donor plasmid pGHOlO, and the isolation and purification of the recombinant virus 35 vHVTl were described in French patent application

92.13109. This recombinant HVT virus contains the gene encoding the VP2 capsid protein of Gumboro disease virus (IBDV virus) placed under the control of the promoter of the RR2 gene of the HVT virus. In this recombinant virus, the VP2 gene was inserted in place of the HVT RR2 gene.

o c « o &gt; β • O 90

0 0

0 4 oeo e ο e ο o o o « o e 4 • Example 5: Construction of the donor plasmid pEL025 anH isolation of vHVT2

5.2. Construction of the donor plasmid pEL025

The 2 9 kbp BamHI A fragment of the HVT virus strain FC126 (Igarashi T. et al. Virology. 1989. 70.

1789-1804) was cloned into the BamHI site of the vector pBR322 to give the plasmid pRDOOl. Plasmid pRDOOl was digested with Pstl and the 2.8 kbp and 5.7 kbp PstlPstl fragment were cloned into the Pstl site of vector pBR322 to give the plasmids pRD006 and pRD007, respectively. Plasmid pRD006 was digested with Pstl and Sacl in order to isolate the Pstl/Sacl fragment of 340 bp ( fragment A) .

A PCR was carried out using the oligonucleotides:

RD045 (SEQ ID NO. 1)

5' TGCTGGTACCGTCGACAAGCTTGGATCCGTGCAGATAACACGTACTGGC 3' pBRPst- (SEQ ID NO. 2) 5' CATGTAACTCGCCTTGATC 3' and the pRD007 template, in order to obtain a fragment of 550 bp (positions 339 to 831 in Figure 1 (SEQ ID NO. 3) (positions 6491 to 6980 in the HVT U_s sequence (Zelnik V. et al. J. Gen. Virol. 1993. 74. 2151-2162). The PCR fragment of 520 bp was then digested with Kpnl and Pstl in order to isolate a Pstl/Kpnl fragment of 520 bp (fragment B). Fragments A and B were ligated both at once to the vector pBS-SK+ (Stratagene), which had previously been digested with Kpnl and Sacl, to give the plasmid pRD022 (Figure 2). Plasmid pRD007 was digested with Sail and Xhol in order to isolate the Sall/Xhol fragment of 730 bp (positions 1876 to 2608 in SEQ ID NO. 1) (posi35 tions 6491 to 6980 in the HVT U_s sequence (Zelnik V. et al. J. Gen. Virol. 1993. 74. 2151-2162). This fragment was cloned into the Sail site of vector pBS-SK+ to give the plasmid pRD027 (Figure 2).

e (I

A-

<img file="AU4063095A_D0006.tif" />

A synthetic double-stranded oligonucleotide was obtained by hybridizing the two following oligonucleotides:

RD048 (SEQ ID NO. 4) 5' GATCCAGCTGAATTCAGCTA 3'

RD049 (SEQ ID NO. 5) 5' AGCTTAAGCTGAATTCAGCTG 3'

This oligonucleotide was cloned between the BamHI and Hindlll sites of plasmid pRD022 to give the plasmid pRD023 (Figure 3) . The plasmid pCMV/3 (Clontech Cat#6177-1) (Figure 4) was digested with EcoRI and Sail in order to isolate the EcoRI/Sall fragment of 4500 bp which contains the HCMV-IE = lacZ expression cassette (fragment C) . Plasmid pRD027 was digested with Hindlll and Xhol in order to isolate the Hindlll/Xhol fragment of 730 bp (fragment D) . Fragments C and D were ligated both at once to plasmid pRD023, which had previously been digested with EcoRI and Hindlll, give the plasmid pRD029 of 8973 bp (Figure 3). This plasmid contains the HCMV-IE = lacZ expression cassette in the gl site (complete deletion) of the HVT virus.

The plasmid pEL004 (= plasmid pGH004 described in

French patent application 92.13109), which contains the IBDV VP2 gene in the form of a BamHI/Hindlll cassette, was digested with BamHI and Xbal in order to isolate the BamHI/Xbal fragment (truncated VP2 gene) of 1104 bp. This fragment was cloned into vector pBS-SK+ (Stratagene), which had previously been digested with Xbal and BamHI, to give the plasmid pEL022 of 4052 bp (Figure 5). Vector pBS-SK+ was digested with EcoRV and Xbal and then ligated to itself in order to give pBS-SK* (modified) . Plasmid pEL004 was digested with Kpnl and Hindlll in order to

0 isolate the KpnI/Hindlll fragment of 13 87 bp, which contains the complete IBDV VP2 gene. This fragment was cloned into vector pBS-SK*, which had previously been digested with Kpnl and Hindlll, to give the plasmid pEL023 of 4292 bp (Figure 6) . Plasmid pEL022 was digested

5 with BamHI and Notl in order to isolate the BamHl/Notl fragment of 1122 bp (fragment A) . Plasmid pEL023 was digested with BamHI and Notl in order to isolate the BamHI/Notl fracjment of 333 bp (fragment B) . Fragments A and B were ligated both at once to vector pBS-SK+, which a' i

ii

u.

- 13 had previously been digested with Notl and treated with alkaline phosphatase, to give the plasmid pEL024 of 4369 bp (Figure 7). Plasmid pEL024 was then digested with Notl in order to isolate the Notl/Notl fragment of

1445 bp. This fragment was cloned in plasmid pRD029, . which had previously been digested with Notl and treated with alkaline phosphatase, to give the plasmid pEL025 of 6904 bp (Figure 8).

<img file="AU4063095A_D0007.tif" />

Οβββ ο o

O 5» © 0

0 0 0 0 0

0 0 9

0 0 0 0 0 0

0 0

0 0 0 ft 0

9 0

0*000 0 0

<img file="AU4063095A_D0008.tif" />

5.2. Isolation and purification of the recombinant vHVT2

Plasmid pEL025 was digested with Sail to linearize it, then extracted with a phenol/chloroform (19:1) mixture, precipitated with absolute ethanol and taken up once again in sterile water. 24-hour primary CEC cells were then transfected with the following mixture:

1 /zg of linearized plasmid pEL025 + 5 /xg of HVT viral DNA in 300 μΐ of OptiMEM medium (Gihco BRL Cat#041 -01985H) and 100 μς of LipofectAMINE diluted in 300 μΐ of medium (final volume of the medium = 600 μΐ). These 600 μΐ were then diluted in 3 ml (final volume) of medium and plated out on 3.10^s CEC I. The mixture was left in contact with the cells for 5 hours and then removed and replaced with 5 ml of culture medium. The cells were then cultured at 37°C for 3 days and, after that, they were pronased, mixed with fresh CEC II (3:1 mixture) and replated out 1

96-well plate. This plate was cultured for 3 days and, after that, the cells were pronased, mixed with fresh CEC II and respread on 2 96-well plates, with one initial well giving 2 sister wells. The 96-well plates were cultured until a cytopathic effect appeared. After 72 hours of culture, one of the two 96-well plates was fixed with 95% acetone for 30 minutes and an indirect immunofluorescence (IIF) reaction was carried out using a monoclonal anti-VP2 antibody to screen for plaques expressing the VP2 protein. The sister wells of the wells displaying positive plaques in IIF were pronased, mixed with fresh CEC II, and deposited, in limiting dilution, on 96-well plates. After 3 days of culture, the wells displaying a cytopathic effect were pronased, mixed ii

I

Ή * }ί k

- 13 had previously been digested with Notl and treated with alkaline phosphatase, to give the plasmid pEL024 of 4369 bp (Figure 7) . Plasmid pEL024 was then digested with Notl in order to isolate the Notl/Notl fragment of

1445 bp. This fragment was cloned in plasmid pRD029, . which had previously been digested with Notl and treated ' with alkaline phosphatase, to give the plasmid pEL025 of 6904 bp (Figure 8).

β O 9 o o a «9 o &lt;5

O « ¢5 a o c o o o oc 0 0 0

O « ·&gt; 9

9 9 0 0 0 0 6 it o

0 9 « ««00

O 0 0 0 0

0 9 0

0 9 0 0 0 O

0 0 o

« « « e · o 0 o

<img file="AU4063095A_D0009.tif" />

5.2. Isolation and purification of the recombinant vHVT2

Plasmid pEL025 was digested with Sail to linearize it, then extracted with a phenol/chloroform (19:1) mixture, precipitated with absolute ethanol and taken up once again in sterile water. 24-hour primary CEC cells were then transfected with the following mixture:

1 gg of linearized plasmid pEL025 + 5 gg of HVT viral DNA in 300 gl of OptiMEM medium (Gibco BRL Cat#041-01985H) and 100 gg of LipofectAMINE diluted in 300 gl of medium (final volume of the medium = 600 gl) . These 600 gl were then diluted in 3 ml (final volume) of medium and plated out on 3.10^s CEC I. The mixture was left in contact with the cells for 5 hours and then removed and replaced with 5 ml of culture medium. The cells were then cultured at 37 °C for 3 days ind, after that, they were pronased, mixed with fresh CEC II (3:1 mixture) and replated out 1

5 96-well plate. This plate was cultured for 3 days and, after that, the cells were pronased, mixed with fresh CEC II and respread on 2 96-well plates, with one initial well giving 2 sister wells. The 96-well plates were cultured until a cytopathic effect appeared. After 72 hours of culture, one of the two 96-well plates was fixed with 95% acetone for 30 minutes and an indirect immunofluorescence (IIF) reaction was carried out using a monoclonal anti-VP2 antibody to screen for plaques expressing the VP2 protein. The sister wells of the wells displaying positive plaques in IIF were pronased, mixed with fresh CEC II, and deposited, in limiting dilution, on 96-well plates. After 3 days of culture, the wells displaying a cytopathic effect were pronased, mixed

- -ft v«

<img file="AU4063095A_D0010.tif" />

ft ο β β β « « ο β •

« 9 « β « β with CEC II, and replated out on 96-well plates, with one initial well giving 2 sister wells. 3 days later, screening took place once again, using IIF as before, for the plaques expressing the VP2 protein on one of the 2 sister plates. In general, 4 consecutive cycles of isolation (harvesting a well, replating out, checking with IIF, subculturing a sister well, etc.) are sufficient to obtain recombinant viruses all of whose progeny display a specific fluorescence. One viral plaque which gave plaques all of which were positive by IIF using a monoclonal anti-VP2 antibody was designated vHVT2. The genomic DNA of this recombinant virus was characterized at the molecular level by conventional PCR and Southern blot techniques using the appropriate oligonucleotides and DNA probes. This recombinant contains a HCMV-IE/IBDV VP2 cassette in place of the gl gene of the HVT virus.

Example 6: Construction of the donor plasmid pEL042 and isolation of the vHVT4

6.1. Construction of the donor plasmid pEL042

The BamHI M fragment of 3.3 kbp from the genome of the HVT virus strain FC126 (Igarashi T. et al. Virology. 1989. 70. 1789-1804) was cloned into the BamHI site of the vector pBR322 to give the plasmid pRD002. The sequence of the BamHI M fragment was established in its entirety (3336 bp) (SEQ ID NO. 6 and Figure 9) . This sequence contains an ORF encodes a protein which is homologous to the product of the HSV-1 UL43 gene (positions 1306 to 2511) (end of the stop codon) in the sequence SEQ ID NO. 6, Figure 9) . The protein which is

0 theoretically encoded by this ORF is 401 amino acids (aa) in size. Plasmid pRD002 was digested with Sacl and Sail in order to isolate the Sacl/Sall fragment of 2620 bp. This fragment was ligated into vector pBS-SK+, which had previously been digested with Sacl and Xhol, to give the plasmid pMBOlO of 5506 bp (Figure 10) . Plasmid pMBOlO was then digested with Ncol and Xhol in order to isolate the Ncol/Xhol fragment of 4650 bp. This fragment was ligated to a double-stranded synthetic oligonucleotide which was ii

L.........._.............

ί obtained by hybridizing the 2 following oligonucleotides:

• · « β a « • a « • β « Β ο β • 9 4

ΜΒ014 (SEQ ID NO. 7)

5' TCGAGAATTCAGATCTGATATCAAGCTTGGTACCGTCGAC 3'

MB015 (SEQ ID NO. 8)

5' CATGGTCGACGGTACCAAGCTTGATATCAGATCTGAATTC 3' to give the plasmid pMB016 of 4698 bp (Figure 10) . The inserted oligonucleotide contains restriction sites which allow the insertion of an expression cassette between the two flanking arms of the UL43 locus. The 5' flanking arm has a size of 800 bp (position 523 to position 1323 in the sequence of the BamHI M fragment (SEQ ID NO. 6) . The 3' arm has a size of 981 bp (positions 2171 to 3152 in SEQ ID NO. 6). The deletion which is thus obtained in the HVT UL43 gene extends from position 1324 to position 2170 (deletion of 847 nucleotides, that is 282 aa out of a total of 401 aa) . Plasmid pEL024 (see Example 5) was digested with Notl in order to isolate the Notl/Notl fragment of 1445 bp. This fragment was ligated to plasmid pCMV/3, which had previously been digested with Notl, to give the plasmid pEL026 of 5095 bp (Figure 11). Plasmid pEL026 was digested with EcoRI, Sail and XmnI in order to isolate the EcoRI/Sall fragment of 2428 bp. This fragment was ligated to vector pBS-SK+, which had previously been digested with EcoRI and Sail, to give the plasmid pEL027 of 5379 bp (Figure 12). Plasmid pEL027 was digested with EcoRI, Sail and XmnI in order to isolate the EcoRI/Sall fragment of 242 8 bp. This fragment was ligated into plasmid pMB016, which had previously been digested with EcoRI and Sail, to give the plasmid pEL042 of 7110 bp (Figure 13) .

6.2. Isolation and purification of recombinant vHVT4

A cotransfection of CEC II with plasmid pEL042, linearized with Kpnl, and HVT viral DNA was carried out Example 5. The conditions for for isolating and purifying the plaques which resulted from this cotransfection were those described in Example 5.

as described in 35 transfection, and recombinant viral k

i- *

U k, β « Ο ί ft « »000 • « a ·ο?ι

Hit «««tit ft « 1 ft ( ( t .

<img file="AU4063095A_D0011.tif" />

- 16 A viral plaque which gave plaques all of which were positive by IIF using a monoclonal anti-IBDV VP2 anH/hndy was designated vHVT4. The genomic DNA of this recombinant virus was characterized at the molecular level by the conventional techniques of PCR and Southern blot using . the appropriate oligonucleotides and DNA probes.

Example 7: Construction of the donor plasmid pEL072 and isolation of vHVT6

Plasmid pCMV/3 (Figure 4) was digested with Sail and Smal in order to isolate the Sall/Smal fragment of 3679 bp, which fragment contained the lacZ gene as well as the polyadenylation signal of. the late gene of the SV40 virus. This fragment was inserted into vector pBSSK+, which had previously been digested with Sail and

EcoRV, to give the plasmid pCD002 of 6625 bp (Figure 14). This plasmid contains the lacZ reporter gene, but no promoter is situated upstream of this gene. The viral genomic DNA of the MCMV virus was prepared as described in Example 2 and digested with Pstl in order to isolate the Pstl/Pstl fragment of 2285 bp. This fragment was cloned into vector pBS-SK+, which had previously been digested with Pstl and treated with alkaline phosphatase, to give the plasmid pCD004. Plasmid pCD004 was digested with Hpal and Pstl in order to isolate the Hpal/Pstl fragment of 1389 bp, which contains the promoter/enhancer region of the immediate early gene of murine cytomegalovirus (MCMV) (Dorsch-Hasler K. et al. Proc. Natl. Acad. Sci. 1985. 82. 8325-8329, and patent application WO-A-87/03905). This fragment was cloned into plasmid pCD002, which had previously been digested with Pstl and Smal, to give the plasmid pCD009 of 8007 bp (Figure 15) .

A double-stranded oligonucleotide was obtained by hybridizing the two following oligonucleotides:

MB070 (SEQ ID NO. 9) ’ CGAATTCACTAGTGTGTGTCTGCAGGCGGC.CGCGTGTGTGTCGACGGTAC 3 ' MB071 (SEQ ID NO. 10) ' CGTCGACACACACGCGGCCGCCTGCAGACACACACTAGTGAATTCGAGCT 3 ' ρ

L·.—

This double-stranded, oligonucleotide was ligated to vector pBS-SK+, which had previously been digested with Kpnl and Sacl, to give the plasmid pEL067.

' Plasmid pCD009 was digested with Pstl and Spel in order to isolate the Pstl/Spel fragment of 1396 bp. This fragment was ligated to plasmid pEL067, which had previously been digested with Pstl and Spel, to give the plasmid pEL068 of 4297 bp (Figure 16) . Plasmid pEL024 (see Example 5) was digested with HindHI and Notl in order to isolate the HindHI/Notl fragment of 1390 bp (fragment A) . Plasmid pEL027 (see Example 6) was digested with HindHI and Sail in order to isolate the ο:”:.. Hindm/sall fragment of 235 bp (fragment B) . Fragments “Λ”. A and B were ligated both at once to plasmid pEL068, which had previously been digested with Notl and Sail, to give the plasmid pEL070 of 5908 bp (Figure 17). Plasmid pEL07 0 was digested with EcoRI, Sail and XmnI in order to isolate the EcoRI/Sall fragment of 3035 bp. This fragment ’ was ligated to plasmid pMB016 (see Example 6) , which had ·».· ; 20 previously been digested with EcoRI and Sail, to give the plasmid pEL072 of 7702 bp (Figure 18) . This plasmid © 0 · .I permits the insertion of the MCMV-IE/IBDV VP2 expression cassette into the UL43 locus of the HVT virus.

A cotransfection which was carried out, as described in

0« t ’· 25 Example 5, with plasmid pEL072 and genomic DNA of the HVT β &lt; &lt;

*· ’·! virus led to the isolation and purification of the vHVT6 recombinant.

Example 8: Construction of the donor plasmid pCD012 and isolation of vHVT7

0 The EcoRI/Sall fragment of 3.9 kbp from the genomic DNA of the MDV virus strain RB1B, which fragment contains the MDV gB gene (sequence published by Ross N. et al. J. Gen. Virol. 1989. 70. 1789-1804), was ligated to the vector pUC13, which had previously been digested with EcoRI and Sail, to give the plasmid pCD007. This plasmid was digested with Sacl and Xhol in order to isolate the Sacl/Xhol fragment of 2260 bp (central portion of the gB gene = fragment A). A PCR was carried out using the following oligonucleotides:

CD001 (SEQ ID NO. 11) ' GACTGGTACCGCGGCCGCATGCACTTTTTAGGCGGAATTG 3 '

CD002 (SEQ ID NO. 12) 5' TTCGGGACATTTTCGCGG 3' and the pCD0 07 template in order to produce a PCR fragment of 222 pb. This fragment was digested with Kpnl and Xbal in order to isolate a KpnI/Xbal fragment of 190 bp (5' end of the gB gene = fragment B) . Another PCR was carried out using the following oligonucleotides:

CD0 03 (SEQ ID NO. 13) 5' TATATGGCGTTAGTCTCC 3'

CD004 (SEQ ID NO. 14) ' TTGCGAGCTCGCGGCCGCTTATTACACAGCATCATCTTCTG 3 ' and the pCD007 template in order to produce a PCR fragment of 195 bp. This fragment was digested with Sacl and SacII in orde to isolate the Sacl/SacII fragment of 162 bp (3' end of the gB gene = fragment C) . Fragments A,

B and C were ligated both at once to vector pBS-SK+, which had previously been digested with Kpnl and Sacl, to give the plasmid pCDOll of 5485 bp (Figure 19). Plasmid pCDOll was digested with Notl in order to isolate the Notl/Notl fragment of 2608 bp (entire MDV gB gene = fragment D) . Plasmid pEL042 (see Example 6) was digested with Notl and treated with alkaline phosphatase in order to isolate the Notl/Notl fragment of 5706 bp (fragment

5 E) . Fragments D and E were then ligated together to give the plasmid pCD012 of 8314 bp (Figure 20). This plasmid permits insertion of the HCMV-IE/MDV gB cassette into the UL43 locus of the HVT virus.

A cotransfection which was carried out, as described in

0 Example 5, using plasmid pCD012 and genomic DNA of the

HVT virus led to the isolation and purification of the vHVT7 recombinant.

Example 9: Construction, of the donor plasmid pEL043 and isolation of vHVT8

5 Construction of a complementary DNA library of the genome of Newcastle disease virus (NDV), strain Texas, was carried out as described by Taylor J. et al. (J. Virol. 1990. 64. 1441-1450). A pBR322 clone which o do a β Ο (,ΟΟβ β ο ο ο 0 0 ο ο ο ο βο 0 Ο Ο

S6O0 ο ο η ο ο ο • contained the end of the fusion (F) gene, the whole of the hemagglutinin neuraminidase (HN) gene and the beginning of the polymerase gene was identified and termed pHNOl. The sequence of the NDV HN gene contained in this clone is depicted in Figure 21 (SEQ ID NO. 15).

. Plasmid pHNOl was digested with SphI and Xbal in order to

- isolate the Sphl/Xbal fragment of 2520 bp. This fragment was ligated with vector pUC19, which had previously been digested with SphI and Xbal, to give the plasmid pHN02 of

5192 bp. Plasmid pHN02 was digested with Clal and Pstl in order to isolate the Clal/Pstl fragment of 700 bp (fragment A). A PCR was carried out using the following oligonucleotides: .

<td></td><td> EL071</td><td> (SEQ ID NO.</td><td> 16) 5'</td><td> CAGACCAAGCTTCTTAAATCCC 3 '</td>

<td> 15</td><td> EL073</td><td> (SEQ ID NO.</td><td> 17) 5'</td><td> GTATTCGGGACAATGC 3'</td>

<td></td><td colspan="3"> and the pHN02 template in</td><td> order to produce a PCR fragment</td>

<img file="AU4063095A_D0012.tif" />

ί

Ο 64 θ 0 Ο

090 ο

00 6 ο ο ο β

Ο *6 Ο Ο οο

Ο β tg &gt;» «* * ο Ο β

<img file="AU4063095A_D0013.tif" />

of 27 0 bp. This fragment was digested with Hindlll and Pstl in order to isolate a Hindlll/Pstl fragment of 220 bp (fragment B). Fragments A and B were ligated both

0 at once to vector pBS-SK+, which had previously been digested with Clal and Hindlll, to give the plasmid pEL028 of 3872 bp (Figure 22). Plasmid pHN02 was digested with BsphI and Clal in order to isolate the Bsphl/Clal fragment of 425 bp (fragment C) . A PCR was carried out using the following oligonucleotides:

EL074 (SEQ ID NO. 18) 5' GTGACATCACTAGCGTCATCC 3'

EL075 (SEQ ID NO. 19)

5' CCGCATCATCAGCGGCCGCGATCGGTCATGGACAGT 3' and the pHN02 template in order to produce a PCR fragment

0 of 465 bp. This fragment was digested with BsphI and Notl in order to isolate the Bsphl/Notl fragment of 390 bp (fragment D) . Fragments C and D were ligated both at once to vector pBS-SK+, which had previously been digested with Clal and Notl, to give the plasmid pEL02 9bis of

3727 bp (Figure 23) . Plasmid pEL028 was digested with

Clal and SacII in order to isolate the Clal/SacII fragment of 960 bp (fragment E) . Plasmid pEL029bis was digested with Clal and Notl in order to isolate the Clal/Notl fragment of 82 0 bp (fragment F) . Fragments E $ Q « Φ 4 β

Π φ

Ο Ο 0 0 Ο Ο ο ο ο ο · ο ο ο ο ο η ο &lt;5 Ο

Ο Ο φ ο θ σ

Ο Ο 0 ο ο

Ο ο ο ο 0 0 9 9

Ο 9 9 0 0 « β ο ο «

0 0 9 Φ β ·

Οβ &lt;

9« · « 9 9 β · « β

Ο 4 · 0 0 β 4 • and F were ligated both at once to vector pBS-SK+, which had previously been digested with Notl and SacII, to give the plasmid pEL030 of 4745 bp (Figure 24) . Plasmid pEL030 was digested with Notl in order to isolate the Notl/Notl fragment of 1780 bp (entire NDV HN gene). This fragment . was ligated, in place of the lacZ gene, to plasmid pCMVjS, • which had previously been digested with Notl and treated with alkaline phosphatase, to give the plasmid pEL032 of 5471 bp (Figure 25) . Plasmid pEL032 was digested with

EcoRI and Clal in order to isolate the EcoRI/Clal fragment of 1636 bp (Fragment G). Plasmid pEL032 was digested with Clal and Sail in order to isolate the Clal/Sall fragment of 1182 bp (Fragment H) . Fragments G and H were ligated both at once to plasmid pMB016 (see Example 6), which had previously been digested with EcoRI and Sail, to give the plasmid pEL043 of 7486 bp (Figure 26). This plasmid permits insertion of the HCMV-IE/NDV HN expression cassette into the UL43 locus of the HVT virus.

A cotransfection which was carried out, as described in

Example 5, using plasmid pEL043 and genomic DNA of the HVT virus led to the isolation and purification of the vHVT8 recombinant.

Example 10: Construction of the donor plasmid pEL044 and isolation of vHVT9

5 A clone deriving from the complementary DNA library of the genome of Newcastle disease virus (see Example 9) , and containing the whole of the fusion (F) gene, was termed pNDV81. This plasmid has been described previously and the sequence of the NDV F gene which is present in this clone has been published (Taylor J. efc al . J. Virol. 1990. 64. 1441-1450). Plasmid pNDV81 was digested with Narl and Pstl in order to isolate the Narl/Pstl fragment of 187 0 bp (fragment A) . A PCR was carried out using the following oligonucleotides:

5 EL07 6 (SEQ ID NO. 20) 5' TGACCCTGTCTGGGATGA 3'

EL077 (SEQ ID NO. 21) ' GGATCCCGGTCGACACATTGCGGCCGCAAGATGGGC 3' and the pNDV81 template in order to produce a fragment of β «Ofl β ο ρ Λ β ί

9 0 9

0 Ο

Ο

Ο 69 Ο Ο ο ο ο ο ο

9 0 0 0 Ο

9 0 0 β

«60 9

4 0 0 β 0 0 0 0 «

0 «

0 0 0 Ο 0 0

0 I

0« β Ο 0 0

0 « •

Ο0044· 0 4

160 pb. This fragment was digested with Pstl and Sail in order to isolate the Pstl/Sall fragment of 130 bp (fragment B). Fragments A and B were ligated both at once to vector pBS-SK+, which had previously been digested with Clal and Sail, to give the plasmid pEL033 of 4846 bp . (Figure 27) . Plasmid pEL033 was digested with Notl in order to isolate the Notl/Notl fragment of 193 5 bp (entire F gene) . This fragment was ligated to plasmid pCMV/3, which had previously been digested with Notl and treated with alkaline phosphatase, to give the plasmid pEL034 of 5624 bp (the NDV F gene has replaced the la.cZ gene) (Figure 28). Plasmid pEL034 was digested with EcoRI and Kpnl in order to isolate the EcoRI/Kpnl fragment of 866 pb (Fragment C) . Plasmid pEL034 was digested with

Kpnl and Sail in order to isolate the Kpnl/Sall fragment of 2114 bp (Fragment D). Fragments C and D were ligated both at once to plasmid pMB016 (see Example 6), which had previously been digested with EcoRI and Sail, to give the plasmid pEL044 of 7639 bp (Figure 29) . This plasmid permits insertion of the HCMV-IE/ IDV F expression cassette into the UL43 locus of the HVT virus. A cotransfection which was carried out, as described in Example 5, using plasmid pEL044 and genomic DNA of the HVT virus led to the isolation and purification of the vHVT9 recombinant.

Example 11: Construction of the donor plasmid pEL082 and isolation of vHVTIO

The sequences situated upstream of the MDV 1.8 Icbp RNA gene are described in Bradley G, et al. (J.

Virol. 1989. 63. 2534-2542) (Figure 30 and SEQ ID NO.22). A PCR amplification was carried out on DNA extracted from lymphocytes which were harvested from chicks infected with the MDV RB1B strain (see Example 1) using the following oligonucleotides:

MB047 (SEQ ID NO. 23)

5' GGTCTACTAGTATTGGACTCTGGTGCGAACGC 3'

MB048 (SEQ ID NO. 24) ' GTCCAGAATTCGCGAAGAGAGAAGGAACCTC 3 '

The PCR fragment of 163 bp thus obtained was digested with EcoRT and Spel and then ligated to plasmid pCD002 (see Example 7), which had previously been digested with

EcoRI and Spel, to give the plasmid pBS002 of 6774 bp (Figure 31). Plasmid pBS002 contains the promoter of the MDV 1.8 kb RNA gene clone upstream of the lacZ gene.

A PCR was carried out using the oligonucleotides:

MB047 (SEQ ID NO. 23) and

MB072 (SEQ ID NO. 25)

5' GTGTCCTGCAGTCGCGAAGAGAGAAGGAACCTC 3' and the pBS002 template. The PCR fragment thus obtained was digested with Pstl and Spel in order to isolate a Pstl/Spel fragment of 200 bp. This fragment was ligated to plasmid pEL067 (see Example 7), which had previously been digested with Pstl and Spel, to give the plasmid pEL069 (Figure 32). Plasmid pCD007 (see Example 8) was digested with EcoRI and Xbal in order to isolate the EcoRI/Xbal fragment of 2670 bp (fragment A) . Plasmid pCDOll (see Example 8) was digested with Notl and Xbal in order to isolate the Notl/Xbal fragment of 180 bp (fragment B). Plasmid pEL069 was digested with Notl and Spel in order to isolate the Notl/Spel fragment of 180 bp (fragment C). Fragments A, B and C were ligated both at once to plasmid pEL067 (see Example 7), which had previously been digested with EcoRI and Spel, to give the plasmid pEL080 of 5939 bp (Figure 33) . Plasmid pED070 (see Example 7) was digested with Kpnl and Spel in order to isolate the Kpnl/Spel fragment of 1345 bp (fragment

D). Plasmid pEL070 was also digested with Kpnl and Sail in order to isolate the KpnI/Sall fragment of 1658 bp (fragment E) . Fragments D and Ξ were ligated both at once to plasmid pEL080, which had previously been digested with Sail and Spel, to give the plasmid pEL081 of 8938 bp (Figure 34). Plasmid pEL081 was digested with EcoRI and Sail in order to isolate the EcoRI/Sall fragment of 6066 bp. This fragment was ligated to plasmid pMB016 (see Example 6) , which had previously been digested with EcoRI and Sail, finally to give the plasmid pEL082 of 10732 bp (Figure 35) . This plasmid makes it possible to insert the double VP2/MCMV-IE.//1.8 kbp RNA/MDV gB expression cassette into the UL43 locus of the HVT virus.

A cotransfection which was carried out, as described in 5 Example 5, using plasmid pEL082 and the genomic DNA of . the HVT virus led to the isolation and purification of • the vHVTIO recombinant.

0»«6 0 9 rt *» η «

<img file="AU4063095A_D0014.tif" />

u o « o 0 © « 9 «6 0 0 0 ooo o

0*9 0 o o o oo «

0 o Ο Θ «

60

Ο«ί oeo

Example 12: Construction of the donor plasmid pEL096 and isolation of vHVT22

Plasmid pEL080 (see Example 11) was digested with

EcoRI and Sail in order to isolate the EcoRI/Sall fragment of 3040 bp (1.8 kbp RNA/MDV gB cassette) . This fragment was ligated to plasmid pMB016 (see Example 6), which had previously been digested with EcoRI and Sail, to give the plasmid pEL096 of 7733 bp (Figure 36) . This plasmid makes it possible to insert the 1.8 kbp RNA/MDV gB expression cassette into the UL43 locus of the HVT virus .

A cotransfection which was carried out, as described in

0 Example 5, using plasmid pEL0 9 6 and the genomic DNA of the HVT virus led to the isolation and purification of the vHVT22 recombinant.

ft o o ·· Example 13: Construction of donor plasmids for inserting • ” IBV M and S expression cassettes into the UD43 locus of the HVT virus

Using the same strategy as that which is described above for inserting expression cassettes (genes placed under the control of the HCMV-ΙΞ or MCMV-IE promoters or the MCMV-IE//1.8 kbp RNA double promoter) into the UL43 locus, it is possible to produce recombinant HVT viruses which express the membrane (M) or spike (S) proteins of avian infectious bronchitis virus (IBV) at an elevated level. A construct is preferably produced in which the IBV S gene is dependent on the HCMV-IE promoter or the MCMV-IE promoter, or else a construct in which the IBV M and IBV S genes are inserted together with the MCMV-IE/1.8 kbp RNA double promoter in the UL43 ο ο ο η «3 0

Ο β on ο σ ο ο ο a a «3 9

O 9 a ο o ft β a β

4 O e oo

0 9 o

4 4 0 « « ο o β « 0

O 0 0

Oft ft 0 · ft ft ft

O ft · locus, the M gene being under the control of the 1.8 kbp RNA promoter and the S gene being under the control of the MCMV-IE promoter. In this configuration, the 1.8 kbp RNA promoter is activated by the enhancer region of the MCMVIE.

Example 14 : Preparation of a vaccine according to the invention :

The preparation of vaccines according to the present invention may be carried out with any usual technic known by the skilled artisan, e.g. by culture in rolling bottles. Rolling bottles (175 cm2) _are seeded with 200.10⁶pfu/ml of chicken primary embryo cells and inoculated after 24 hours incubation at 37 °C with 1 ml of a viral solution of recombinant HVT having a titer of 10⁵ pfu/ml. After 4 days incubation at 37 °C, the supernatant is eliminated, the cells are dissociated with a trypsin versene solution, then recovered. The infected cells are then centrifuged. The supernatant is eliminated and the cells are recovered in a 20 ml solution comprising a freeze-drying stabilizer (e.g. SPGA sucrose, phosphate, glutamate, albumine). This mixture is then sonicated, distributed in bottles under 1 ml fractions and finally freeze-dried.

If need be, the vaccine may also be distributed and frozen in place of freeze-dryinc’.

Conclusion :

Protection assays by vaccinating chickens with different recombinant HVT viruses according to the present invention and expressing the VP2 gene of IBDV shown that these recombinants were able to induce an excellent level of protection against a virulent IBDV challenge.

«. e « ο ο β ο β » ο © β Ο 9 ρ Ο 9 Ο 4

Ο 0 9 0 0 Ο

Ο © 9 β © © © β Ο ο © · » β ο

« © β © »909

Ο Ο © ©ο · » Ο € β © Ο Φ © &lt;* ο ο © ο Φ

5