Corn event DAS-59122-7 and methods for detection thereof
Abstract
The invention provides DNA compositions that relate to transgenic insect resistant maize plants. Also provided are assays for detecting the presence of the maize DAS-59122-7 event based on the DNA sequence of the recombinant construct inserted into the maize genome and the DNA sequences flanking the insertion site. Kits and conditions useful in conducting the assays are provided.
Term
Term ended
Expired 28 September 2025, 1 year ago.
- Priority
- Filed
- Granted
- Expired
- Today
6 claims: 5 independent, 1 dependent
- 1The claims defining the invention are as follows:An isolated DNA molecule comprising a nucleotide sequence selected from the group consisting of: a) the nucleotide sequence set forth in SEQ ID NO :23;b) the nucleotide sequence set forth in SEQ ID NO:21;and c) the nucleotide sequence set forth in SEQ ID NO:22.
- 2A kit for identifying event DAS-59122-7 in a biological sample which detects a 10 DAS-59122-7 specific region, said kit comprising primer pair capable of detecting a DAS-59122- 7 specific region, said primer pair comprising a first primer and a second primer , wherein said first primer and said second primer are selected from the group consisting of:a) a first primer that is capable of annealing to a nucleic acid molecule 15 comprising the nucleotide sequence set forth in SEQ ID NO;19 or the complement thereof and a second primer that is capable of annealing to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO :20 or the complement thereof;b) a first primer that is capable of annealing to a nucleic acid molecule 20 comprising the nucleotide sequence set forth in SEQ ID NO: 19 or the complement thereof and a second primer that is capable of annealing to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO;24 or the complement thereof;and c) a first primer that is capable of annealing to a nucleic acid molecule 25 comprising the nucleotide sequence set forth in SEQ ID NO:20 or the complement thereof and a second primer that is capable of annealing to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:24 or the complement thereof. 30 3. The kit of claim 2, wherein said first and second primers, respectively, comprise a pair of sequences selected from the group consisting of: a) the sequences of SEQ ID NO: 18 and SEQ ID NO: 1;b) the sequences of SEQ ID NO: 10 and SEQ ID NO:9;c) the sequences of SEQ ID NO:2 and SEQ ID NO: 17;COMS ID No: ARCS-305553 Received by IP Australia: Time (H:m) 16:26 Date (Y-M-d) 2011-01-10 10/01 2011 MON 16:24 FAi 61 3 9851 6004 HOULIHAN 2 MELB AUST Patent Office @007/032 2005292090 10 Jan 2011 d) the sequences of SEQ ID NO:8 and SEQ ID NO: 17;and e) the sequences of SEQ ID NO:36 and SEQ ID NO:37, 4. A DNA detection kit specific for junction DNA of maize event DAS-59122-7 5 and its progeny, said kit comprising at least one DNA molecule of a sufficient length of contiguous DNA polynucleotides to function in a DNA detection method, wherein said DNA molecule is capable of hybridizing to said junction DNA or complement thereof, and wherein said DNA molecule is homologous or complementary to a sequence selected from the group consisting of: 10 a) the nucleotide sequence set forth in SEQ ID NO:21;and b) the nucleotide sequence set forth in SEQ ID NO;22, 5. A kit for identifying event DAS-59122-7 in a biological sample, said kit comprising a specific probe capable of uniquely identifying event DAS-5912215 7, said specific probe comprising a sequence which hybridizes with a sequence selected from the group consisting of: a) a sequence comprising the contiguous sequences of SEQ ID NO:19 and SEQ ID NO:24;b) a sequence comprising the contiguous sequences of SEQ ID NO:20 and 20 SEQ TD NO:24;and c) a sequence that is the complement of the sequence of a) or b). 6. A DNA detection kit comprising at least a first and a second DNA molecule of a sufficient length of contiguous nucleotides homologous or complementary to 25 SEQ ID NO:21 or SEQ ID NO;22, wherein said first and said second DNA molecules comprise a DNA primer pair that is capable of amplifying in a polymerase chain reaction a DAS-59122-7 specific region from maize event DAS-59122-7 and its progeny, wherein said DAS-59122-7 specific region comprises at least one junction sequence. 7. A method for identifying event DAS-59122-7 in a biological sample, comprising detecting a DAS-59122-7 specific region by amplifying a DNA fragment from a nucleic acid present in said biological sample using a polymerase chain reaction with at least two primers, wherein a first primer and COMS ID No: ARCS-305553 Received by IP Australia: Time (H:m) 16:26 Date (Y-M-d) 2011-01-10 10/01 2011 MON 16:24 FAi 61 3 9851 6004 HOULIHAN 2 MELB ADST ™ Patent Office @008/032 2005292090 10 Jan 2011 a second primer of the at least two primers are selected from the group consisting of: a) a first primer that is capable of annealing to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO: 19 or the 5 complement thereof and a second primer that is capable of annealing to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO;20 or the complement thereof;b) a first primer that is capable of annealing to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO: 19 or the 10 complement thereof and a second primer that is capable of annealing to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO :24 or the complement thereof;and c) a first primer that is capable of annealing to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:20 or the 15 complement thereof and a second primer that is capable of annealing to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO :24 or the complemen t thereof. 9. The method of claim 7, wherein said first and second primers, respectively, comprise a pair of sequences selected from the group consisting of: i) the sequences of SEQ ID NO: 18 and SEQ IDNO:1;ii) the sequences of SEQ ID NO: 10 and SEQ ID NO:9;iii) the sequences of SEQ ID NO;2 and SEQ ID NO: 17;iv) the sequences of SEQ ID NO;8 and SEQ ID NO: 17;and v) the sequences of SEQ TD NO:36 and SEQ ID NO:37, The method of claim 8, comprising: i) using the primers of Claim S i) to amplify, a fragment of about 555 bp;or h) using the primers of Claim 8 ii) to amplify, a fragment of about 313 bp;or iii) using the primers of Claim 8 iii) to amplify, a fragment of about 547 bp;or iv) using the primers of Claim 8 iv) to amplify, a fragment of about 754 bp;or v) using the primers of Claim 8 v) to amplify, a fragment of about 104 bp. COMS ID No: ARCS-305553 Received by IP Australia: Time (H:m) 16:26 Date (Y-M-d) 2011-01-10 10/01 2011 MON 16:25 FAI 61 3 9851 6004 HOULIHAN 2 MELB AUST ™ Patent Office @009/032 2005292090 10 Jan 2011 10. A method of detecting the presence of maize event DAS-59122-7 or progeny thereof in a biological sample, comprising: (a) extracting a DNA sample from said biological sample;(b) providing a pair of DNA primer molecules selected from the group consisting of: i) the sequences of SEQ ID NO: 18 and SEQ ID NO:1;ii) the sequences of SEQ ID NO: 10 and SEQ ID NO:9;iii) the sequences of SEQ ID NO:2 and SEQ ID NO: 17;and iv) the sequences of SEQ ID NO:8 and SEQ ID NO: 17;(c) providing DNA amplification reaction conditions;(d) performing said DNA amplification reaction, thereby producing a DNA amplicon molecule;and (e) detecting said DNA amplicon molecule, wherein the detection of said DNA amplicon molecule in said DNA amplification reaction indicates the presence of maize event DAS-59122-7. 11. An isolated DNA molecule comprising any one of the amplicons produced by the method of claim 10. 20 12. A method of detecting the presence of DNA corresponding to the DAS-59122-7 event in a sample, the method comprising: (a) contacting the sample comprising maize DNA with a polynucleotide probe that hybridizes under stringent hybridization conditions with junction DNA from maize event DAS-59122-7 and does not hybridize under said 25 stringent hybridization conditions with a non-DAS-59122-7 maize plant DNA;(b) subjecting the sample and probe to stringent hybridization conditions;and (c) detecting hybridization of the probe to the junction DNA, wherein detection of hybridization indicates the presence of the DAS-59122-7 30 event. 13. An isolated DNA nucleotide primer sequence consisting of a sequence selected from the group consisting of: SEQ ID NOs:l, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 36 and 37, or its complement. COMS ID No: ARCS-305553 Received by IP Australia: Time (H:m) 16:26 Date (Y-M-d) 2011-01-10 10/01 2011 MON 16:25 FAi 61 3 9851 6004 HOULIHAN 2 MELB ADST ™ Patent Office 0010/032 2005292090 10 Jan 2011 14. An isolated DNA nucleotide primer sequence of claim 13 consisting of a sequence selected from the group consisting of: SEQ ID NO$;1, 2, 8, 9, 10, 17 and 18, or its complement, 15. A pair of DNA molecules comprising: a first DNA molecule and a second DNA molecule, wherein the DNA molecules are of a sufficient length of contiguous nucleotides of a sequence selected from the group consisting of: a) the sequence set forth in SEQ ID NO:21 or its complement;and 10 b) the sequence set forth in SEQ ED NO:22 or its complement;wherein the pair of DNA molecules is capable of amplifying in a polymerase chain reaction an amplicon comprising a DAS-59122-7 specific region from maize event DAS-59122-7 and its progeny, wherein said DAS-59122-7 specific region comprises at least one junction sequence. 16. An isolated DNA molecule comprising a junction sequence comprising a sequence selected from the group consisting of SEQ ID NO:32, 33, 34, and 35 and complements thereof. 20 17, A method for confirming seed purity, comprising detection of a DAS-59122-7 specific region with a specific primer or probe which specifically hybridizes under stringent hybridization conditions with a junction sequence within SEQ ID NO:2l, SEQ ID NO;22, or complement thereof, in a seed sample, and does not hybridize under said stringent hybridization conditions with DNA from a 25 non-DAS-59122-7 maize plant. 18. A method for screening seeds for the presence of event DAS-59122-7, comprising detection of a DAS-59122-7 specific region with a specific primer or probe which specifically hybridizes under stringent hybridization conditions 30 with a junction sequence within SEQ ID NO:21, SEQ ID NO:22, or complement thereof, in a sample of a seed lot, and does not hybridize under said stringent hybridization conditions with DNA from a non-DAS-59122-7 maize plant. COMS ID No: ARCS-305553 Received by IP Australia: Time (H:m) 16:26 Date (Y-M-d) 2011-01-10 10/01 2011 MON 16:25 FAX 61 3 9851 6004 HOULIHAN 2 MELB AUST Patent Office @011/032 2005292090 10 Jan 2011 19. A plant cell from an insect resistant com plant, or parts thereof, wherein DNA having at least one nucleotide sequence selected from the group consisting of SEQ ID NO:21, 22, 23, 32, 33, 34, and 35 and complements thereof forms part of the plant's genome. 20. A plant cell from a descent plant of the insect resistant corn plant of claim 19, wherein DNA having at least one nucleotide sequence selected from the group consisting of SEQ ID NQ:32, 33, 34, and 35 and complements thereof, forms part of the plant's genome. 21. A plant cell from a seed of a plant of claim 19 or 20, wherein said seed comprises said DNA, 22. A method of producing an insect resistant com plant comprising breeding with 15 a plant of claim 19 or 20, and selecting progeny by analyzing for at least one nucleotide sequence selected from the group consisting of SEQ ID NO:32, 33, 34, and 35 and complements thereof. 23. A pair of isolated DNA sequences, each comprising at least ten nucleotides and 20 which when used together in a DNA amplification procedure will produce an amplicon diagnostic for event DAS-59122-7. 24. The pair of isolated DNA sequences of claim 23, wherein each sequence is chosen from within a nucleotide sequence selected from the group consisting 25 of: (a) the sequence of SEQ ID NO:21;and (b) the sequence of SEQ ID NO:22. 25. A method of detecting the presence of the DAS-59122-7 event insertion in corn 30 tissue comprising: (a) selecting a primer pair each comprising at least ten nucleotides from SEQ ID NO:21 or SEQ ID NO:22 wherein each member of the pair is on opposite sides of a sequence diagnostic for said DAS-59122-7 event insertion;COMS ID No: ARCS-305553 Received by IP Australia: Time (H:m) 16:26 Date (Y-M-d) 2011-01-10 10/01 2011 MON 16:25 FAX 61 3 9851 6004 HOULIHAN 2 MELB AUST Patent Office @012/032 2005292090 10 Jan 2011 (b) contacting a sample of said com tissue with said primer pair;(c) performing DNA amplification and analyzing for an amplicons. 26, The method of claim 25 wherein said primer pair is selected from the group 5 consisting of SEQ ID NOs:l, 2, 3, 4, 5, 6, 7, 8, 9,10,11, 12, 13, 14, 15,16,17, 18, 36 and 37 or complements thereof. 27, A method of detecting the presence of the DAS-59122-7 event insertion in com tissue comprising: 10 (a) contacting a sample of said com tissue with a polynucleotide probe that hybridizes under stringent, hybridization conditions with one or more DNA sequence selected from the group consisting of SEQ ID NO:32, 33, 34, and 35 and complements thereof;(b) subjecting said sample and probe to stringent hybridization conditions;and 15 (c) analyzing for hybridization of the probe. 28, A DNA detection kit comprising a polynucleotide probe that hybridizes under stringent hybridization conditions with one or more DNA sequences selected from the group consisting of SEQ ID NO:32,33, 34, and 35 and complements 20 thereof. 29, A DNA detection kit comprising a primer pair each comprising at least 10 nucleotides from within SEQ ID NO:2l and SEQ ID NO:22, wherein each is on opposite sides of a sequence diagnostic for the DAS-59122-7 event insertion. 30, The DNA detection kit of claim 29 wherein said primer pair is selected from the group consisting of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 36 and 37 and complements thereof. 30 31. A kit for identifying event DAS-59122- 7 in a biological sample, said kit comprising a probe or primer that is capable of hybridizing under stringent hybridization conditions with a junction sequence within SEQ ID NO:23 or complement thereof and does not hybridize under said strigent hybridization conditions with DNA from a non-DAS-59122-7 maize plant. COMS ID No: ARCS-305553 Received by IP Australia: Time (H:m) 16:26 Date (Y-M-d) 2011-01-10 10/01 2011 MON 16:26 FAX 61 3 9851 6004 HOULIHAN 2 MELB AUST Patent Office @013/032 2005292090 10 Jan 2011 32, A method for identifying DAS-59122-7 in a biological sample, said method comprising detecting a DAS-59122-7 specific region within SEQ ID NO;23 with a probe or primer that is capable of hybridizing under stringent 5 hybridization conditions with a junction sequence within SEQ ID NO:23 or complement thereof and does not hybridize under said stringent hybridization conditions with DNA from a non-DAS-59122-7 maize plant. 33. A DNA molecule comprising a sufficient length of contiguous nucleotides to 10 function in a DNA detection method for junction DNA of maize event DAS59122-7 and its progeny, wherein said DNA molecule is capable of hybridizing to said junction DNA or complement thereof, and wherein said DNA molecule is homologous or complementary to a sequence selected from the group consisting of: 15 (a) the nucleotide sequence set forth in SEQ ID NO: 21;and (b) the nucleotide sequence set forth in SEQ ID NO: 22. COMS ID No: ARCS-305553 Received by IP Australia: Time (H:m) 16:26 Date (Y-M-d) 2011-01-10 WO 2006/039376 PCT/US2005/034947 Figure 1 1 CTGAGCGCAC AACAGCGAGT CGCATGGCAC CGGACGACAT GAGCGAGATT 51 TAGATCGGAG GGTGCGGACA TGGGGCAACC TGCGCAGCTA ACGCAGGGAT 101 CCACACGACC ACCAACGAAG CCAAGCCCGG GCACGTCCCC AGGCAGGTTG 151 GGCCCTGGTT CCACCAGCGG ATGCATGCAG TGAAGCGGGG ACGGAGAGAC 201 AAGCCGAGGG CGCGGGTGGG AATGGCGTCC GGGAGGACGA GTGGAGGAGA 251 AGAATCTAGA GGCATCGAGA TTCGAGAAGC CGACGGAGAC AAGATTCGTG 301 TGGGGGGAGA CAAACCGCGG GGCTGAGCGC CGTTGATATG GGATCAGACG 351 GTGTGGATAA AAAAAGTGAC GTTGATAGAA CGTCTGGCCA GTGAAAAAAC 401 AAAACAACTC CAACAAAATA CTTTAAAAGC TCTTATACCC TAAATGTAGG 451 GGATCAAACA CGTCTCTACA CTATTTAGCA GCGTCCTCTA AATGATCCTC 501 TAAATTTAGA GAACGCTACT AGATTCTCTA TATATAGTTT CTCTAAACGA 551 TCTTTTATCC ATTTAAATAC TTTAAATAAC CGGTTTAACA AAACTAAAAT 601 ATATACAATA CATTTGAGAG TATGACAAAT ACGTATGTAT AAAAATAAAA 651 AATAAAATAA TGTATTAGTC TACTTTGAAT CTTCTTTTCT TCATAATATA 701 ATGATGTATA GCTCTCATGT GCGTTGAGAA AAAAGTTAGA GCTAGACGTT 751 TAATGTGTAG TGACAGTCTT CGACGAAATC TCCCTAATGA GATGAATTAC 801 TGGAGGTTCC ATCAGAAAGT CCCCTGAAAA GAGGCATTTA TTTAGTTTAG 851 TCAGCAATTT CTGGGAACAC AAATATTCTT TTGTTATCAC CACTATTAAA 901 AATCTATGGT TATAACTTAT AATAACATGA AAAAATAATT TAGCATCCCA 951 TATATATAAA AACTGAAGGA AGCCATATAT ACTAACATAA GTTAGGAGAA 1001 ACTAAGAAGG TTGTGCAAAG CTTGCACTGC TCCAAAATAC TGCAAACAAC 1051 CACTCTCCTC TACCAACCAA AGAAACTCAT GTACTCCCTC CGTTCTTTTT 1101 TATTTGTCGC ATTTTAGTTT AAAAATGAAC TAGCAGTCGA CAAATATTCG 1151 AGAACAGATA TAGTATATAC TAACATAACT TAGGAGATAC TAAGAAAGTT 1201 GCGCAGAGCT TTCACTGTTC CAAATTACTG CAAAGCCTCT CCCCTCTGCC 1251 AGTACATCTA CGAGATGTTT CAGTTAAACA AAGATTCAGA CAAGTGATGA 1301 GCCACTTCTT GTCATAGATT GTGTGGTCAA CCAACCCATT GATGCCACGG 1351 TTTTTGTGCA TCCATGCTTT TGTATTAAAA CATCAGTTAT GTTTACCATG 1401 TCCGATATGC TCTACATAAT GACAATCAAC TTGGTGTTCA TTATATTTAC 1451 AATGTTAGGA ATTTCAATAG CTACGAACAC TTCAATAGAA GTGCCTTTGT 1501 GGGATCACCT TAATGTGTTG TTGATGTAAG GAGAAGAATC TTAATTTACT 1551 CTTGCTAAAT TTGAACTACA CAAAACCACT GCACTGAGGA TTGTCCTAAT 1601 AAATTACTGC TCATACACGT TAGCATCTGT TCAGATACTG AGCTAATCCC 1651 TAGGATTAAA GGATTTGTAA AAGATATGCC CAATCATTCA TTTTAGTTAT 1701 TTATTTCTTA GTTATCCACT TGAAGATTTA CATACATTTG AAATAAATTT 1751 CTTAGAGGTA AAGTGAAAAT CAGTTATTTA AATACATTTT AGTTATTTAT 1801 TTTCTTCTTT TTCCTAATTT TTCCTTGTAT TTGAAGTCTG AAAAGATAAC 1851 TTTGCCCTTA TACATATTTT ATCTTCTACG TACGCATCTG AACAACGTCT 1901 CTTTGTCCCC TGATCGTGCA GCAATTAGTG CTATGAATCG CGTTTAAGCG 1951 CTGCAAAATC ATGGCTGGGG CTTCGTCCTC GAGTCGTCCT GCTGCTCGAT 2001 GTCACCTCGA GTCCCGCACC GACCTCAGTG CTTGTTCTTG TTGGAGCCAC 2051 CTCTCTCGGA CGATCGCCAA AGACGGATAA GGCCGAAGCC GTCACTTCAG 2101 ACCGCGCTCA TGCGCCGTAG CAGACTCCTA CATAGCAGGG CCAGGGTATG 2151 TGGACCTTTG CAAGTTTAGG ATTGGAACCA GCGACCAGAA TCCACAAGAT 2201 TGGAGCAAAC GACCAAAAAT TCACAAGGAT TGGCGGCTGA CATTGCCAGC 2251 GCGGGATCGC ATGCGGCGGC GGCGGCCGGG GCGAGCACGG GAGCAGGCGA 2301 CAGTCGAGCT CCATTGGAAC GTAGAAATAC TTAAGGGCAA GGTCTCCAAA 2351 TACTTGAAAA AATAGGAAAA AGAAGAAAAT ACATGAAATG ATATTGAAAT 2401 CAATTGGAAG ATGTTATGAA TCTTGTTTTT GCAAAGCGAA CGATTCAGAT 2451 GGCAAAACTA TGAATCTTTT TGTTTGAAGT CCCAAATATA AAATTTTCTC 2501 GTACTCACCA ACATTGGTGC GCACCTGTGA TTGGCTCATA aaaattcttg 2551 GAGGGACGGA AGAAAGAGTG AAGGGATAAG CAAGTAAAAG CGCTCAAACA 2601 CTGATAGTTT AAACTGAAGG CGGGAAACGA CAATCTGATC ATGAGCGGAG 2651 AATTAAGGGA GTCACGTTAT GACCCCCGCC GATGACGCGG GACAAGCCGT 2701 TTTACGTTTG GAACTGACAG AACCGCAACG TTGAAGGAGC CACTCAGCAA 2751 GCTTACTAGT AGCGCTGTTT AAACGCTCTT CAACTGGAAG AGCGGTTACC 2801 CGGACCGAAG CTTGCATGCC TGCAGTGCAG CGTGACCCGG TCGTGCCCCT 2851 CTCTAGAGAT AATGAGCATT GCATGTCTAA GTTATAAAAA ATTACCACAT 2901 ATTTTTTTTG TCACACTTGT TTGAAGTGCA GTTTATCTAT CTTTATACAT 2951 ATATTTAAAC TTTACTCTAC GAATAATATA ATCTATAGTA CTACAATAAT 1 of 6 WO 2006/039376 PCT/US2005/034947 Figure 1 Con’t. 3001 ATCAGTGTTT TAGAGAATCA 3051 GACAATTGAG TATTTTGACA 3101 TGCATGTGTT CTCCTTTTTT 3151 CATCCATTTT ATTAGTACAT 3201 TAGACTAATT TTTTTAGTAC 3251 TAAGAAAACT AAAACTCTAT 3301 AAAATAGAAT AAAATAAAGT 3351 AATTAAAAAA ACTAAGGAAA 3401 GCCTGTTAAA CGCCGTCGAC 3451 CAGCGTCGCG TCGGGCCAAG 3501 GCCTCTGGAC CCCTCTCGAG 3551 TGTCGGCATC CAGAAATTGC 3601 GCAGGCGGCC TCCTCCTCCT 3651 TTTCCCACCG CTCCTTCGCT 3701 CACCCCCTCC ACACCCTCTT 3751 CACACACAAC CAGATCTCCC 3801 AGGTACGCCG CTCGTCCTCC 3851 GGCGTTCCGG TCCATGGTTA 3901 TGTGTTAGAT CCGTGTTTGT 3951 GGATGCGACC TGTACGTCAG 4001 TCTCTTTGGG GAATCCTGGG 4051 ATTTCATGAT TTTTTTTGTT 4101 CTTTATTTCA ATATATGCCG 4151 CTTTTTTTTG TCTTGGTTGT 4201 AGATCGGAGT AGAATTCTGT 4251 GGATCTGTAT GTGTGTGCCA 4301 TGGATGGAAA TATCGATCTA 4351 CTGATGCATA TACAGAGATG 4401 TGTGGTTGGG CGGTCGTTCA 4451 CAAACTACCT GGTGTATTTA 4501 CATCTTCATA GTTACGAGTT 4551 GGTATACATG TTGATGTGGG 4601 GCAGCATCTA TTCATATGCT 4651 ACAAGTATGT TTTATAATTA 4701 TATGCAGCAG CTATATGTGG 4751 TATTTGCTTG GTACTGTTTC 4801 TTACTTCTGC AGGTCGACTC 4851 GCGAGGTGCA CATCGACGTG 4901 GAGGACAAGA CCAAGCTCGA 4951 CGTGGCCAAC GACCAGATCA 5001 TGACCGGCAC CGAGGGCACC 5051 ATCAGCCTCT ACTTCGACAA 5101 CCACTCCAAC AAGTCCCAGT 5151 ACCAGTCCCA CGTGACCTAC 5201 CACAAGTCCT GAGTCATGAG 5251 CTTCTGGATT GGCCAACTTA 5301 TAGTGACATG CTAATCACTA 5351 GTAATTACTA GTTATCTGAA 5401 ATCCTAAATG AATGTCACGT 5451 ATTTCATTAA CCAAATCCAT 5501 ATATCAATTG GGTTAGCAAA 5551 GCGGCCGCGG ACCGAATTGG 5601 TGAACCGCAC CTTGTCACTT 5651 GGTGCTGCGG TCTAAGTGAG 5701 CTACAATTAG TTAGGCCAAA 5751 GCTGTATCGC CATCTGCAAT 5801 GAGATGAACC AATGATCGGG 5851 TAGTAGAGTA CGTGTTAGCT 5901 TTTAATTACC CCTACGTTAG 5951 AAGGCGATGA TGTCCTCTCC 6001 AAAATGTCAT ATAAAACATT 6051 ACGAAATGCT CGTGTAGCGG TATAAATGAA CAGTTAGACA TGGTCTAAAG ACAGGACTCT ACAGTTTTAT CTTTTTAGTG TTTGCAAATA GCTTCACCTA TATAATACTT CCATTTAGGG TTTAGGGTTA ATGGTTTTTA ATCTATTTTA TTCTATTTTA GCCTCTAAAT TTTAGTTTTT TTATTTAATA ATTTAGATAT GACTAAAAAT TAAACAAATA CCCTTTAAGA CATTTTTCTT GTTTCGAGTA GATAATGCCA GAGTCTAACG GACACCAACC AGCGAACCAG CGAAGCAGAC GGCACGGCAT CTCTGTCGCT AGTTCCGCTC CACCGTTGGA CTTGCTCCGC GTGGCGGAGC GGCAGACGTG AGCCGGCACG CTCACGGCAC CGGCAGCTAC GGGGGATTCC TTCCCTTCCT CGCCCGCCGT AATAAATAGA TCCCCAACCT CGTGTTGTTC GGAGCGCACA CCAAATCCAC CCGTCGGCAC CTCCGCTTCA CCCCCCCCCC CTCTCTACCT TCTCTAGATC GGGCCCGGTA GTTCTACTTC TGTTCATGTT GTTAGATCCG TGCTGCTAGC GTTCGTACAC ACACGTTCTG ATTGCTAACT TGCCAGTGTT ATGGCTCTAG CCGTTCCGCA GACGGGATCG TCGTTGCATA GGGTTTGGTT TGCCCTTTTC TGCACTTGTT TGTCGGGTCA TCTTTTCATG GATGATGTGG TCTGGTTGGG CGGTCGTTCT TTCAAACTAC CTGGTGGATT TATTAATTTT TACATATTCA TAGTTACGAA TTGAAGATGA GGATAGGTAT ACATGTTGAT GCGGGTTTTA CTTTTTGTTC GCTTGGTTGT GATGATGTGG TTCGTTCTAG ATCGGAGTAG AATACTGTTT TTAATTTTGG AACTGTATGT GTGTGTCATA TAAGATGGAT GGAAATATCG ATGTAGGATA TTTTACTGAT GCATATACAT GATGGCATAT CTAACCTTGA GTACCTATCT ATTATAATAA TTTTGATCTT GATATACTTG GATGATGGCA ATTTTTTTAG CCCTGCCTTC ATACGCTATT TTTTGTCGAT GCTCACCCTG TTGTTTGGTG TAGAGGATCC ACACGACACC ATGTCCGCCC AACAACAAGA CCGGCCACAC CCTCCAGCTG CGGCGGCAGG TGGCGCACCT CCCCGACCAA AGACCTTCGT GGCCGAATCC AACGGCTTCA ATCTACTACT CAATTAATGG CGAGGCCGAG CCCGTTCGCC GGCTCCAACA AATACGACGG ACGAGATCAT CACCCAGGGC GGCTCCGGCA ACCATCCAGA CCACCTCCTC CCGCTACGGC TCATGAGTCA GTTAACCTAG ACTTGTCCAT ATTAATGTAT GAAATAAAAG GATGCACACA TAATGTGGGC ATCAAAGTTG TGTGTTATGT TAAAAGAGAA AGAGATCATC CATATTTCTT GTCTTTATAA TTCTTTGATG AACCAGATGC AT ACATATAA ATATTAATCA TATATAATTA ACAAATCTAG TCTAGGTGTG TTTTGCGAAT GGATCTGCAT GAAAGAAACT GTCGCACTGC TCATCGAACA CGACCTGTGC CCAAGATGAC GCTGAATTGC CTTGGACAGA AGCGGACTCC CGGTGCATCC ATGTGTAGCT CCGGGCTCGG AGCATCCATG GAGCTCGTTC CATGTAGTTG CGT.GTGGACG TATGTTCCTG TGTACTCCGA CTTTCATGGT GCAAGTGAAA TTTGTGTTGG TTGCGGGACA GGAGACACAT CATGAATTTA TGTAATGTTA TTCTTTTGAT GTGATGAATC TGTTGCTCTT TAGTTAGGCC TGATCGTAGA GGCTACGAGC CTATGACGCA ATAACACTGG 2 of 6 WO 2006/039376 PCT/US2005/034947 Figure 1 Con’t. 6101 TTTGCCGGCC CGGAGTCGCT TGACAAAAAA AAGCATGTTA AGTTTATTTA 6151 CAATTCAAAA CCTAACATAT TATATTCCCT CAAAGCAGGT TCACGATCAC 6201 ACCTGTACCT AAAAAAAACA TGAAGAATAT ATTACTCCAT TATTATGAGA 6251 TGAACCACTT GGCAAGAGTG GTAAGCTATA TAAAAAAATG AACATTATTA 6301 CGAGATGTTA TATGCCATTA TATTGATTCG AAGATATATG TTTCTTTCTC 6351 CCACGGGCAC CTAACGGATA CATGATAAGG CCAAGGCAGA TCACGGGAAA 6401 TTATTCGAAT ACATGTTACG CCCTATTGCC GGAAAAAAAA TGCAGGGCAG 6451 GTGTTGGCCG TAGCGATTTA AGCACTTAAG CTGGAGGTTG CCACACTTGG 6501 ATGCAAGCGT CTGACCCTTC TAAAACATCG GCGGCTTTGT CCGTATCCGT 6551 ATCCCCTATC CGACATCTAG CTGGCCACAC GACGGGGCTG GGCAGATCGT 6601 GGATGCCGGG TCGACGTCGA TCGTCAGCCA TCATAGACCA ATCGACCATC 6651 TGTTATGGAT GCTTGCTAGC TAGACTAGTC AGACATAAAA TTTGGATACT 6701 TTCTCCCAAC TGGGAGACGG GGACTGATGT GCAGCTGCAC GTGAGCTAAA 6751 TTTTTCCCTA TAAATATGCA TGAAATACTG CATTATCTTG CCACAGCCAC 6801 TGCCACAGCC AGATAACAAG TGCAGCTGGT AGCACGCAAC GCATAGCTCT 6851 GGACTTGTAG CTAGGTAGCC AACCGGATCC ACACGACACC ATGCTCGACA 6901 CCAACAAGGT GTACGAGATC AGCAACCACG CCAACGGCCT CTACGCCGCC 6951 ACCTACCTCT CCCTCGACGA CTCCGGCGTG TCCCTCATGA ACAAGAACGA 7001 CGACGACATC GACGACTACA ACCTCAAGTG GTTCCTCTTC CCGATCGACG 7051 ACGACCAGTA CATCATCACC TCCTACGCCG CCAACAACTG CAAGGTGTGG 7101 AACGTGAACA ACGACAAGAT TAATGTGTCA ACCTACTCCT CCACCAACTC 7151 CATCCAGAAG TGGCAGATCA AGGCCAACGG CTCCTCCTAC GTGATCCAGT 7201 CCGACAACGG CAAGGTGCTC ACCGCCGGCA CCGGCCAGGC CCTCGGCCTC 7251 ATCCGCCTCA CCGACGAGTC CTCCAACAAC CCGAACCAGC AATGGAACCT 7301 GACGTCCGTG CAGACCATCC AGCTCCCGCA GAAGCCGATC ATCGACACCA 7351 AGCTCAAGGA CTACCCGAAG TACTCCCCGA CCGGCAACAT CGACAACGGC 7401 ACCTCCCCGC AGCTCATGGG CTGGACCCTC GTGCCGTGCA TCATGGTGAA 7451 CGACCCGAAC ATCGACAAGA ACACCCAGAT CAAGACCACC CCGTACTACA 7501 TCCTCAAGAA GTACCAGTAC TGGCAGAGGG CCGTGGGCTC CAACGTCGCG 7551 CTCCGCCCGC ACGAGAAGAA GTCCTACACC TACGAGTGGG GCACCGAGAT 7601 CGACCAGAAG ACCACCATCA TCAACACCCT CGGCTTCCAG ATCAACATCG 7651 ACAGCGGCAT GAAGTTCGAC ATCCCGGAGG TGGGCGGCGG TACCGACGAG 7701 ATCAAGACCC AGCTCAACGA GGAGCTCAAG ATCGAGTATT CACATGAGAC 7751 GAAGATCATG GAGAAGTACC AGGAGCAGTC CGAGATCGAC AACCCGACCG 7801 ACCAGTCCAT GAACTCCATC GGCTTCCTCA CCATCACCTC CCTGGAGCTC 7851 TACCGCTACA ACGGCTCCGA GATCCGCATC ATGCAGATCC AGACCTCCGA 7901 CAACGACACC TACAACGTGA CCTCCTACCC GAACCACCAG CAGGCCCTGC 7951 TGCTGCTGAC CAACCACTCC TACGAGGAGG TGGAGGAGAT CACCAACATC 8001 CCGAAGTCCA CCCTCAAGAA GCTCAAGAAG TACTACTTCT GAGTCATGAG 8051 TCATGAGTCA GTTAACCTAG ACTTGTCCAT CTTCTGGATT GGCCAACTTA 8101 ATTAATGTAT GAAATAAAAG GATGCACACA TAGTGACATG CTAATCACTA 8151 TAATGTGGGC ATCAAAGTTG TGTGTTATGT GTAATTACTA GTTATCTGAA 8201 TAAAAGAGAA AGAGATCATC CATATTTCTT ATCCTAAATG AATGTCACGT 8251 GTCTTTATAA TTCTTTGATG AACCAGATGC ATTTCATTAA CCAAATCCAT 8301 ATACATATAA ATATTAATCA TATATAATTA ATATCAATTG GGTTAGCAAA 8351 ACAAATCTAG TCTAGGTGTG TTTTGCGAAT TCCCATGGAG TCAAAGATTC 8401 AAATAGAGGA CCTAACAGAA CTCGCCGTAA AGACTGGCGA ACAGTTCATA 8451 CAGAGTCTCT TACGACTCAA TGACAAGAAG AAAATCTTCG TCAACATGGT 8501 GGAGCACGAC ACGCTTGTCT ACTCCAAAAA TATCAAAGAT ACAGTCTCAG 8551 AAGACCAAAG GGCAATTGAG ACTTTTCAAC AAAGGGTAAT ATCCGGAAAC 8601 CTCCTCGGAT TCCATTGCCC AGCTATCTGT CACTTTATTG TGAAGATAGT 8651 GGAAAAGGAA GGTGGCTCCT ACAAATGCCA TCATTGCGAT AAAGGAAAGG 8701 CCATCGTTGA AGATGCCTCT GCCGACAGTG GTCCCAAAGA TGGACCCCCA 8751 CCCACGAGGA GCATCGTGGA AAAAGAAGAC GTTCCAACCA CGTCTTCAAA 8801 GCAAGTGGAT TGATGTGATA TCTCCACTGA CGTAAGGGAT GACGCACAAT 8851 CCCACTATCC TTCGCAAGAC CCTTCCTCTA TATAAGGAAG TTCATTTCAT 8901 TTGGAGAGGA CAGGGTACCC GGGGATCCAC CATGTCTCCG GAGAGGAGAC 8951 CAGTTGAGAT TAGGCCAGCT ACAGCAGCTG ATATGGCCGC GGTTTGTGAT 9001 ATCGTTAACC ATTACATTGA GACGTCTACA GTGAACTTTA GGACAGAGCC 9051 ACAAACACCA CAAGAGTGGA TTGATGATCT AGAGAGGTTG CAAGATAGAT 9101 ACCCTTGGTT GGTTGCTGAG GTTGAGGGTG TTGTGGCTGG TATTGCTTAC 9151 GCTGGGCCCT GGAAGGCTAG GAACGCTTAC GATTGGACAG TTGAGAGTAC
- 33 of 6 WO 2006/039376 PCT/US2005/034947 Figure 1 Con’t. 9201 TGTTTACGTG TCACATAGGC ATCAAAGGTT GGGCCTAGGA TCCACATTGT 9251 ACACACATTT GCTTAAGTCT ATGGAGGCGC AAGGTTTTAA GTCTGTGGTT 9301 GCTGTTATAG GCCTTCCAAA CGATCCATCT GTTAGGTTGC ATGAGGCTTT 9351 GGGATACACA GCCCGGGGTA CATTGCGCGC AGCTGGATAC AAGCATGGTG 9401 GATGGCATGA TGTTGGTTTT TGGCAAAGGG ATTTTGAGTT GCCAGCTCCT 9451 CCAAGGCCAG TTAGGCCAGT TACCCAGATC TGAGTCGACC TGCAGGCATG 9501 CCCGCTGAAA TCACCAGTCT CTCTCTACAA ATCTATCTCT CTCTATAATA 9551 ATGTGTGAGT AGTTCCCAGA TAAGGGAATT AGGGTTCTTA TAGGGTTTCG 9601 CTCATGTGTT GAGCATATAA GAAACCCTTA GTATGTATTT GTATTTGTAA 9651 AATACTTCTA TCAATAAAAT TTCTAATTCC TAAAACCAAA ATCCAGGGCG 9701 AGCTCGGTAC CCGGGGATCC TCTAGAGTCG ACCTGCAGGC ATGCCCGCGG 9751 ATATCGATGG GCCCCGGCCG AAGCTTCGGT CCGGGCCATC GTGGCCTCTT 9801 GCTCTTCAGG ATGAAGAGCT ATGTTTAAAC GTGCAAGCGC TCAATTCGCC 9851 CTATAGTGAG TCGTATTACA ATCGTACGCA ATTCAGTACA TTAAAAACGT 9901 CCGCAATGTG TTATTAAGTT GTCTAAGCGT CAATTTTTCC CTTCTATGGT 9951 CCCGTTTGTT TATCCTCTAA ATTATATAAT CCAGCTTAAA TAAGTTAAGA 10001 GACAAACAAA CAACACAGAT TATTAAATAG ATTATGTAAT CTAGATACCT 10051 AGATTATGTA ATCCATAAGT AGAATATCAG GTGCTTATAT AATCTATGAG 10101 CTCGATTATA TAATCTTAAA AGAAAACAAA CAGAGCCCCT ATAAAAAGGG 10151 GTCAAGTGGA CACTTGGTCA CTCATTTAAT CCCTCCCTCT CCTCTTTTAT 10201 CCCTCTTTTT GGTGTATTCA CCAATAGTGG TGTGCACCTG TGATTGGCTC 10251 GTAAAAATTC TTGGACGGAT GGAAGAGTGA AGAGATAAGC AAGTCAAAGA 10301 AAAGTAACAA CGAAGCTTCA TCAGCTACAA ATTTTGGCCC AACTGGTTGC 10351 ACCAGCACCA AACTTACGTA TACATGATTA TCTCTGTTTC CCTCATTTCG 10401 AAGAAAAAAA CGGGTTTCAA AACCCACTGC TTTCAGGAGT AAAAAAAGAT 10451 AATAATCTGA AACATTGCTT CCACCTTGGC CCTTATTTGG TTACGTTGCA 10501 ATTCACCCCA ATCCACATGT GGATTGAGAT GGATTGCAGT GTAGCTAGAC 10551 AAACCCTTAG GCCCTGTTTG CATAGGAATA CACCAGGAAT TATTCCAGCT 10601 AATCAAAATT TATATAAATG AGAGAAACAA TTCGGATAGG AATTGTTCCA 10651 GGACTTCATT CTGCAGTAAC CGAACGGCCC CTTAATCCAC CCCAATACAC 10701 GTGGATTGGA GTGGATTGAG GTACAGCCAA ACAAGGCCTA AGTGCAGATC 10751 AAATAAATCA CCCGTCATAT TCTTCTACCT ACAAAAACAG CAATAAACAC 10801 CTGAATGAAG TTCTAATTTG CACAGTGTAG GTAGGATGAA AATAGTTACC 10851 TCCTCATGGT CAGTAACTCT TGGCACACAA CTTCACATGT AATCGATGTA 10901 CCACTTGGCT CTTGCCTGAA ACCCAATACA TCTTTAGCAT AAGAATAATA 10951 TTATGATGGC AAGGCATGAT CACCAGCACT CCTTTATTGT TTAGTAAGTC 11001 TATCACTCCC CAAAACAATT CAAATGAACA GAGATGCATT GCCCCCAATG 11051 AATTCTATTT CAATTAGCCG GAAAATTCTA CTTCATCAGA AGCATCCAAA 11101 TTGCCAGCAT CCCTACTAGA CTGACCATGA CCAGGCTGCC GCAGATGCCT 11151 CTTTTTCTGT CCTCTCCTCT TTGCCTTGAG TTTCTCTTCA AGATCCCTCA 11201 CCCCACGTCT CTTATACATC TTAAAGCTAA CATGTCTCTC CTCCGCCATC 11251 TTCCTAACCT TCTCAGTAAT CTCAGCAGCA ATCTGACGGT TGTACAACTT 11301 CTTCAGCCCC TTCATCAACT TTGCAAATGT GTCAGGCTGT GGCATCAGTC 11351 CTGCCTCTAG CATGTCTAAG CAATACAGGC AGGCCTCCTT GACATGTTTC 11401 TTCGCAAACA GTGCATGAAT CCAGATAGTC CATGCACTCA CATTGAGCTC 11451 ACAGCCTTTG CTCACAATAC ATTTCCAAAC ATCCTTTGCA AGCTCAAGTT 11501 TCTCATCTCT GACCAACGCA TTGAGGAGGT CCTTCAGCAC CCCATATTGC 11551 GGTACCACAA AGAGCCCCCT CCCAACCATG TCTTTAAAAT AACTACATGC 11601 CTCAATCAGC AAACCCTGCC CAACAAGGCC ACTCACCACG ATAGCAAATG 11651 TATCGACCAC AGGACTGAGC CCAGCACTTT CCATCTCATT CCACAATGTC 11701 ATGGCTTGCT TGGTCTCCCC AAGCCTGCAG GCCAACCGAA TCACCACATT 11751 GTATATCTTG AGATCTGGTG GACACCGGCA CTCCCGCATC CTCTCCATCA 11801 GCTCCAAGCA CTCCTCAAGC TGCTCCTTCT TCTCGTGTGC TACAAAGAAA 11851 CCATGGTACA CGGCAGCGTC CACCCGCAGG CCATCCCTCG ACATAGCATC 11901 CAAGAACTCG TACCCCTGGG AT
- 44 of 6 WO 2006/039376 PCT/US2005/034947 c/y34Ab1 c/y35Ab1
- 55 of 6 WO 2006/039376 PCT/US2005/034947 Figure 3
- 66 of 6 WO 2006/039376 PCT/US2005/034947 SEQUENCE LISTING Pioneer Hi-Bred International, Inc. Dow AgroSciences LLC E. I. DuPont de Nemours & Co. CORN EVENT DAS-59122-7 AND METHODS FOR DETECTION THEREOF 1895-PCT 60/614,225 2004-09-29 40 FastSEQ for Windows Version 4.0 1 28 DNA Artificial Sequence Oligonucleotide primer 1 gtggctcctt caacgttgcg gttctgtc 28 2 29 DNA Artificial Sequence Oligonucleotide primer 2 cgtgcaagcg ctcaattcgc cctatagtg 29 3 20 DNA Artificial Sequence Oligonucleotide primer 3 aattgagcgc ttgcacgttt 20 4 24 DNA Artificial Sequence WO 2006/039376 PCT/US2005/034947 Oligonucleotide primer 4 aacaacaaga ccggccacac cctc 24 5 25 DNA Artificial Sequence Oligonucleotide primer 5 gaggtggtct ggatggtgta ggtca 25 6 28 DNA Artificial Sequence Oligonucleotide primer 6 tacaacctca agtggttcct cttcccga 28 7 25 DNA Artificial Sequence Oligonucleotide primer 7 gaggtctgga tctgcatgat gcgga 25 8 23 DNA Artificial Sequence Oligonucleotide primer 8 aacccttagt atgtatttgt att 23 9 26 DNA Artificial Sequence Oligonucleotide primer 9 ctccttcaac gttgcggttc tgtcag 26 10 WO 2006/039376 PCT/US2005/034947 25 DNA Artificial Sequence Oligonucleotide primer 10 ttttgcaaag cgaacgattc agatg 25 11 23 DNA Artificial Sequence Oligonucleotide primer 11 gcgggacaag ccgttttacg ttt 23 12 25 DNA Artificial Sequence Oligonucleotide primer 12 gacgggtgat ttatttgatc tgcac 25 13 25 DNA Artificial Sequence Oligonucleotide primer 13 catctgaatc gttcgctttg caaaa 25 14 26 DNA Artificial Sequence Oligonucleotide primer 14 ctacgttcca atggagctcg actgtc 26 15 25 DNA Artificial Sequence Oligonucleotide primer WO 2006/039376 PCT/US2005/034947 15 ggtcaagtgg acacttggtc actca 16 25 DNA Artificial Sequence Oligonucleotide primer 16 gagtgaagag ataagcaagt caaag 17 25 DNA Artificial Sequence Oligonucleotide primer 17 catgtatacg taagtttggt gctgg 18 25 DNA Artificial Sequence Oligonucleotide primer 18 aatccacaag attggagcaa acgac 19 2593 DNA Artificial Sequence 5' flanking sequence of DAS 59122-7. 19 ctgagcgcac aacagcgagt cgcatggcac cggacgacat gagcgagatt ggtgcggaca tggggcaacc tgcgcagcta acgcagggat ccacacgacc ccaagcccgg gcacgtcccc aggcaggttg ggccctggtt ccaccagcgg tgaagcgggg acggagagac aagccgaggg cgcgggtggg aatggcgtcc gtggaggaga agaatctaga ggcatcgaga ttcgagaagc cgacggagac tggggggaga caaaccgcgg ggctgagcgc cgttgatatg ggatcagacg aaaaagtgac gttgatagaa cgtctggcca gtgaaaaaac aaaacaactc ctttaaaagc tcttataccc taaatgtagg ggatcaaaca cgtctctaca gcgtcctcta aatgatcctc taaatttaga gaacgctact agattctcta ctctaaacga tcttttatcc atttaaatac tttaaataac cggtttaaca atatacaata catttgagag tatgacaaat acgtatgtat aaaaataaaa tgtattagtc tactttgaat cttcttttct tcataatata atgatgtata gcgttgagaa aaaagttaga gctagacgtt taatgtgtag tgacagtctt tccctaatga gatgaattac tggaggttcc atcagaaagt cccctgaaaa tttagtttag tcagcaattt ctgggaacac aaatattctt ttgttatcac tagatcggag 60 accaacgaag 120 atgcatgcag 180 gggaggacga 240 aagattcgtg 300 gtgtggataa 360 caacaaaata 420 ctatttagca 480 tatatagttt 540 aaactaaaat 600 aataaaataa 660 gctctcatgt 720 cgacgaaatc 780 gaggcattta 840 cactattaaa 900 WO 2006/039376 PCT/US2005/034947 aatctatggt tataacttat aataacatga aaaaataatt tagcatccca tatatataaa 960 aactgaagga agccatatat actaacataa gttaggagaa actaagaagg ttgtgcaaag 1020 cttgcactgc tccaaaatac tgcaaacaac cactctcctc taccaaccaa agaaactcat 1080 gtactccctc cgttcttttt tatttgtcgc attttagttt aaaaatgaac tagcagtcga 1140 caaatattcg agaacagata tagtatatac taacataact taggagatac taagaaagtt 1200 gcgcagagct ttcactgttc caaattactg caaagcctct cccctctgcc agtacatcta 1260 cgagatgttt cagttaaaca aagattcaga caagtgatga gccacttctt gtcatagatt 1320 gtgtggtcaa ccaacccatt gatgccacgg tttttgtgca tccatgcttt tgtattaaaa 1380 catcagttat gtttaccatg tccgatatgc tctacataat gacaatcaac ttggtgttca 1440 ttatatttac aatgttagga atttcaatag ctacgaacac ttcaatagaa gtgcctttgt 1500 gggatcacct taatgtgttg ttgatgtaag gagaagaatc ttaatttact cttgctaaat 1560 ttgaactaca caaaaccact gcactgagga ttgtcctaat aaattactgc tcatacacgt 1620 tagcatctgt tcagatactg agctaatccc taggattaaa ggatttgtaa aagatatgcc 1680 caatcattca ttttagttat ttatttctta gttatccact tgaagattta catacatttg 1740 aaataaattt cttagaggta aagtgaaaat cagttattta aatacatttt agttatttat 1800 tttcttcttt ttcctaattt ttccttgtat ttgaagtctg aaaagataac tttgccctta 1860 tacatatttt atcttctacg tacgcatctg aacaacgtct ctttgtcccc tgatcgtgca 1920 gcaattagtg ctatgaatcg cgtttaagcg ctgcaaaatc atggctgggg cttcgtcctc 1980 gagtcgtcct gctgctcgat gtcacctcga gtcccgcacc gacctcagtg cttgttcttg 2040 ttggagccac ctctctcgga cgatcgccaa agacggataa ggccgaagcc gtcacttcag 2100 accgcgctca tgcgccgtag cagactccta catagcaggg ccagggtatg tggacctttg 2160 caagtttagg attggaacca gcgaccagaa tccacaagat tggagcaaac gaccaaaaat 2220 tcacaaggat tggcggctga cattgccagc gcgggatcgc atgcggcggc ggcggccggg 2280 gcgagcacgg gagcaggcga cagtcgagct ccattggaac gtagaaatac ttaagggcaa 2340 ggtctccaaa tacttgaaaa aataggaaaa agaagaaaat acatgaaatg atattgaaat 2400 caattggaag atgttatgaa tcttgttttt gcaaagcgaa cgattcagat ggcaaaacta 2460 tgaatctttt tgtttgaagt cccaaatata aaattttctc gtactcacca acattggtgc 2520 gcacctgtga ttggctcata aaaattcttg gagggacgga agaaagagtg aagggataag 2580 caagtaaaag cgc 2593 20 1986 DNA Artificial Sequence 3' flanking sequence of DAS 59122-7. 20 ttcccttcta tggtcccgtt tgtttatcct ctaaattata taatccagct taaataagtt 60 aagagacaaa caaacaacac agattattaa atagattatg taatctagat acctagatta 120 tgtaatccat aagtagaata tcaggtgctt atataatcta tgagctcgat tatataatct 180 taaaagaaaa caaacagagc ccctataaaa aggggtcaag tggacacttg gtcactcatt 240 taatccctcc ctctcctctt ttatccctct ttttggtgta ttcaccaata gtggtgtgca 300 cctgtgattg gctcgtaaaa attcttggac ggatggaaga gtgaagagat aagcaagtca 360 aagaaaagta acaacgaagc ttcatcagct acaaattttg gcccaactgg ttgcaccagc 420 accaaactta cgtatacatg attatctctg tttccctcat ttcgaagaaa aaaacgggtt 480 tcaaaaccca ctgctttcag gagtaaaaaa agataataat ctgaaacatt gcttccacct 540 tggcccttat ttggttacgt tgcaattcac cccaatccac atgtggattg agatggattg 600 cagtgtagct agacaaaccc ttaggccctg tttgcatagg aatacaccag gaattattcc 660 agctaatcaa aatttatata aatgagagaa acaattcgga taggaattgt tccaggactt 720 cattctgcag taaccgaacg gccccttaat ccaccccaat acacgtggat tggagtggat 780 tgaggtacag ccaaacaagg cctaagtgca gatcaaataa atcacccgtc atattcttct 840 acctacaaaa acagcaataa acacctgaat gaagttctaa tttgcacagt gtaggtagga 900 tgaaaatagt tacctcctca tggtcagtaa ctcttggcac acaacttcac atgtaatcga 960 tgtaccactt ggctcttgcc tgaaacccaa tacatcttta gcataagaat aatattatga 1020 tggcaaggca tgatcaccag cactccttta ttgtttagta agtctatcac tccccaaaac 1080 aattcaaatg aacagagatg cattgccccc aatgaattct atttcaatta gccggaaaat 1140 tctacttcat cagaagcatc caaattgcca gcatccctac tagactgacc atgaccaggc 1200 tgccgcagat gcctcttttt ctgtcctctc ctctttgcct tgagtttctc ttcaagatcc 1260 ctcaccccac gtctcttata catcttaaag ctaacatgtc tctcctccgc catcttccta 1320 WO 2006/039376 PCT/US2005/034947 accttctcag taatctcagc agcaatctga cggttgtaca acttcttcag ccccttcatc 1380 aactttgcaa atgtgtcagg ctgtggcatc agtcctgcct ctagcatgtc taagcaatac 1440 aggcaggcct ccttgacatg tttcttcgca aacagtgcat gaatccagat agtccatgca 1500 ctcacattga gctcacagcc tttgctcaca atacatttcc aaacatcctt tgcaagctca 1560 agtttctcat ctctgaccaa cgcattgagg aggtccttca gcaccccata ttgcggtacc 1620 acaaagagcc ccctcccaac catgtcttta aaataactac atgcctcaat cagcaaaccc 1680 tgcccaacaa ggccactcac cacgatagca aatgtatcga ccacaggact gagcccagca 1740 ctttccatct cattccacaa tgtcatggct tgcttggtct ccccaagcct gcaggccaac 1800 cgaatcacca cattgtatat cttgagatct ggtggacacc ggcactcccg catcctctcc 1860 atcagctcca agcactcctc aagctgctcc ttcttctcgt gtgctacaaa gaaaccatgg 1920 tacacggcag cgtccacccg caggccatcc ctcgacatag catccaagaa ctcgtacccc 1980 tgggat 1986 21 3594 DNA Artificial Sequence Sequence that represents part of the PHI17662A insert as well as flanking sequence 5' to the insert. 21 ctgagcgcac aacagcgagt cgcatggcac cggacgacat gagcgagatt tagatcggag 60 ggtgcggaca tggggcaacc tgcgcagcta acgcagggat ccacacgacc accaacgaag 120 ccaagcccgg gcacgtcccc aggcaggttg ggccctggtt ccaccagcgg atgcatgcag 180 tgaagcgggg acggagagac aagccgaggg cgcgggtggg aatggcgtcc gggaggacga 240 gtggaggaga agaatctaga ggcatcgaga ttcgagaagc cgacggagac aagattcgtg 300 tggggggaga caaaccgcgg ggctgagcgc cgttgatatg ggatcagacg gtgtggataa 360 aaaaagtgac gttgatagaa cgtctggcca gtgaaaaaac aaaacaactc caacaaaata 420 ctttaaaagc tcttataccc taaatgtagg ggatcaaaca cgtctctaca ctatttagca 480 gcgtcctcta aatgatcctc taaatttaga gaacgctact agattctcta tatatagttt 540 ctctaaacga tcttttatcc atttaaatac tttaaataac cggtttaaca aaactaaaat 600 atatacaata catttgagag tatgacaaat acgtatgtat aaaaataaaa aataaaataa 660 tgtattagtc tactttgaat cttcttttct tcataatata atgatgtata gctctcatgt 720 gcgttgagaa aaaagttaga gctagacgtt taatgtgtag tgacagtctt cgacgaaatc 780 tccctaatga gatgaattac tggaggttcc atcagaaagt cccctgaaaa gaggcattta 840 tttagtttag tcagcaattt ctgggaacac aaatattctt ttgttatcac cactattaaa 900 aatctatggt tataacttat aataacatga aaaaataatt tagcatccca tatatataaa 960 aactgaagga agccatatat actaacataa gttaggagaa actaagaagg ttgtgcaaag 1020 cttgcactgc tccaaaatac tgcaaacaac cactctcctc taccaaccaa agaaactcat 1080 gtactccctc cgttcttttt tatttgtcgc attttagttt aaaaatgaac tagcagtcga 1140 caaatattcg agaacagata tagtatatac taacataact taggagatac taagaaagtt 1200 gcgcagagct ttcactgttc caaattactg caaagcctct cccctctgcc agtacatcta 1260 cgagatgttt cagttaaaca aagattcaga caagtgatga gccacttctt gtcatagatt 1320 gtgtggtcaa ccaacccatt gatgccacgg tttttgtgca tccatgcttt tgtattaaaa 1380 catcagttat gtttaccatg tccgatatgc tctacataat gacaatcaac ttggtgttca 1440 ttatatttac aatgttagga atttcaatag ctacgaacac ttcaatagaa gtgcctttgt 1500 gggatcacct taatgtgttg ttgatgtaag gagaagaatc ttaatttact cttgctaaat 1560 ttgaactaca caaaaccact gcactgagga ttgtcctaat aaattactgc tcatacacgt 1620 tagcatctgt tcagatactg agctaatccc taggattaaa ggatttgtaa aagatatgcc 1680 caatcattca ttttagttat ttatttctta gttatccact tgaagattta catacatttg 1740 aaataaattt cttagaggta aagtgaaaat cagttattta aatacatttt agttatttat 1800 tttcttcttt ttcctaattt ttccttgtat ttgaagtctg aaaagataac tttgccctta 1860 tacatatttt atcttctacg tacgcatctg aacaacgtct ctttgtcccc tgatcgtgca 1920 gcaattagtg ctatgaatcg cgtttaagcg ctgcaaaatc atggctgggg cttcgtcctc 1980 gagtcgtcct gctgctcgat gtcacctcga gtcccgcacc gacctcagtg cttgttcttg 2040 ttggagccac ctctctcgga cgatcgccaa agacggataa ggccgaagcc gtcacttcag 2100 accgcgctca tgcgccgtag cagactccta catagcaggg ccagggtatg tggacctttg 2160 WO 2006/039376 PCT/US2005/034947 caagtttagg attggaacca gcgaccagaa tccacaagat tggagcaaac tcacaaggat tggcggctga cattgccagc gcgggatcgc atgcggcggc gcgagcacgg gagcaggcga cagtcgagct ccattggaac gtagaaatac ggtctccaaa tacttgaaaa aataggaaaa agaagaaaat acatgaaatg caattggaag atgttatgaa tcttgttttt gcaaagcgaa cgattcagat tgaatctttt tgtttgaagt cccaaatata aaattttctc gtactcacca gcacctgtga ttggctcata aaaattcttg gagggacgga agaaagagtg caagtaaaag cgctcaaaca ctgatagttt aaactgaagg cgggaaacga atgagcggag aattaaggga gtcacgttat gacccccgcc gatgacgcgg tttacgtttg gaactgacag aaccgcaacg ttgaaggagc cactcagcaa agcgctgttt aaacgctctt caactggaag agcggttacc cggaccgaag tgcagtgcag cgtgacccgg tcgtgcccct ctctagagat aatgagcatt gttataaaaa attaccacat attttttttg tcacacttgt ttgaagtgca ctttatacat atatttaaac tttactctac gaataatata atctatagta atcagtgttt tagagaatca tataaatgaa cagttagaca tggtctaaag tattttgaca acaggactct acagttttat ctttttagtg tgcatgtgtt tttgcaaata gcttcaccta tataatactt catccatttt attagtacat tttagggtta atggttttta tagactaatt tttttagtac atctatttta gcctctaaat taagaaaact aaaactctat tttagttttt ttatttaata aaaatagaat aaaataaagt gactaaaaat taaacaaata ccctttaaga actaaggaaa catttttctt gtttcgagta gataatgcca gcctgttaaa gagtctaacg gacaccaacc agcgaaccag cagcgtcgcg tcgggccaag ggcacggcat ctctgtcgct gcctctggac ccctctcgag agttccgctc cttgctccgc tgtcggcatc cagaaattgc gtggcggagc ggcagacgtg 22 2987 DNA Artificial Sequence Sequence that represents part of the PHI17662A insert as well as flanking sequence 3' to the insert. 22 ctccggagag gagaccagtt gagattaggc cagctacagc agctgatatg gtgatatcgt taaccattac attgagacgt ctacagtgaa ctttaggaca caccacaaga gtggattgat gatctagaga ggttgcaaga tagataccct ctgaggttga gggtgttgtg gctggtattg cttacgctgg gccctggaag cttacgattg gacagttgag agtactgttt acgtgtcaca taggcatcaa taggatccac attgtacaca catttgctta agtctatgga ggcgcaaggt tggttgctgt tataggcctt ccaaacgatc catctgttag gttgcatgag acacagcccg gggtacattg cgcgcagctg gatacaagca tggtggatgg gtttttggca aagggatttt gagttgccag ctcctccaag gccagttagg agatctgagt cgacctgcag gcatgcccgc tgaaatcacc agtctctctc tctctctcta taataatgtg tgagtagttc ccagataagg gaattagggt tttcgctcat gtgttgagca tataagaaac ccttagtatg tatttgtatt ttctatcaat aaaatttcta attcctaaaa ccaaaatcca gggcgagctc gatcctctag agtcgacctg caggcatgcc cgcggatatc gatgggcccc tcggtccggg ccatcgtggc ctcttgctct tcaggatgaa gagctatgtt agcgctcaat tcgccctata gtgagtcgta ttacaatcgt acgcaattca aacgtccgca atgtgttatt aagttgtcta agcgtcaatt tttcccttct ttgtttatcc tctaaattat ataatccagc ttaaataagt taagagacaa cagattatta aatagattat gtaatctaga tacctagatt atgtaatcca atcaggtgct tatataatct atgagctcga ttatataatc ttaaaagaaa cccctataaa aaggggtcaa gtggacactt ggtcactcat ttaatccctc tttatccctc tttttggtgt attcaccaat agtggtgtgc acctgtgatt aattcttgga cggatggaag agtgaagaga taagcaagtc aaagaaaagt cttcatcagc tacaaatttt ggcccaactg gttgcaccag caccaaactt gaccaaaaat 2220 ggcggccggg 2280 ttaagggcaa 2340 atattgaaat 2400 ggcaaaacta 2460 acattggtgc 2520 aagggataag 2580 caatctgatc 2640 gacaagccgt 2700 gcttactagt 2760 cttgcatgcc 2820 gcatgtctaa 2880 gtttatctat 2940 ctacaataat 3000 gacaattgag 3060 ctcctttttt 3120 ccatttaggg 3180 ttctatttta 3240 atttagatat 3300 aattaaaaaa 3360 cgccgtcgac 3420 cgaagcagac 3480 caccgttgga 3540 agcc 3594 gccgcggttt 60 gagccacaaa 120 tggttggttg 180 gctaggaacg 240 aggttgggcc 300 tttaagtctg 360 gctttgggat 420 catgatgttg 480 ccagttaccc 540 tacaaatcta 600 tcttataggg 660 tgtaaaatac 720 ggtacccggg 780 ggccgaagct 840 taaacgtgca 900 gtacattaaa 960 atggtcccgt 1020 acaaacaaca 1080 taagtagaat 1140 acaaacagag 1200 cctctcctct 1260 ggctcgtaaa 1320 aacaacgaag 1380 acgtatacat 1440 WO 2006/039376 PCT/US2005/034947 gattatctct gtttccctca tttcgaagaa aaaaacgggt ttcaaaaccc actgctttca 1500 ggagtaaaaa aagataataa tctgaaacat tgcttccacc ttggccctta tttggttacg 1560 ttgcaattca ccccaatcca catgtggatt gagatggatt gcagtgtagc tagacaaacc 1620 cttaggccct gtttgcatag gaatacacca ggaattattc cagctaatca aaatttatat 1680 aaatgagaga aacaattcgg ataggaattg ttccaggact tcattctgca gtaaccgaac 1740 ggccccttaa tccaccccaa tacacgtgga ttggagtgga ttgaggtaca gccaaacaag 1800 gcctaagtgc agatcaaata aatcacccgt catattcttc tacctacaaa aacagcaata 1860 aacacctgaa tgaagttcta atttgcacag tgtaggtagg atgaaaatag ttacctcctc 1920 atggtcagta actcttggca cacaacttca catgtaatcg atgtaccact tggctcttgc 1980 ctgaaaccca atacatcttt agcataagaa taatattatg atggcaaggc atgatcacca 2040 gcactccttt attgtttagt aagtctatca ctccccaaaa caattcaaat gaacagagat 2100 gcattgcccc caatgaattc tatttcaatt agccggaaaa ttctacttca tcagaagcat 2160 ccaaattgcc agcatcccta ctagactgac catgaccagg ctgccgcaga tgcctctttt 2220 tctgtcctct cctctttgcc ttgagtttct cttcaagatc cctcacccca cgtctcttat 2280 acatcttaaa gctaacatgt ctctcctccg ccatcttcct aaccttctca gtaatctcag 2340 cagcaatctg acggttgtac aacttcttca gccccttcat caactttgca aatgtgtcag 2400 gctgtggcat cagtcctgcc tctagcatgt ctaagcaata caggcaggcc tccttgacat 2460 gtttcttcgc aaacagtgca tgaatccaga tagtccatgc actcacattg agctcacagc 2520 ctttgctcac aatacatttc caaacatcct ttgcaagctc aagtttctca tctctgacca 2580 acgcattgag gaggtccttc agcaccccat attgcggtac cacaaagagc cccctcccaa 2640 ccatgtcttt aaaataacta catgcctcaa tcagcaaacc ctgcccaaca aggccactca 2700 ccacgatagc aaatgtatcg accacaggac tgagcccagc actttccatc tcattccaca 2760 atgtcatggc ttgcttggtc tccccaagcc tgcaggccaa ccgaatcacc acattgtata 2820 tcttgagatc tggtggacac cggcactccc gcatcctctc catcagctcc aagcactcct 2880 caagctgctc cttcttctcg tgtgctacaa agaaaccatg gtacacggca gcgtccaccc 2940 gcaggccatc cctcgacata gcatccaaga actcgtaccc ctgggat 2987 23 11922 DNA Artificial Sequence The sequence represents the complete sequence of the insert and flanking regions of event DAS 59122-7 . 23 ctgagcgcac aacagcgagt cgcatggcac cggacgacat gagcgagatt tagatcggag 60 ggtgcggaca tggggcaacc tgcgcagcta acgcagggat ccacacgacc accaacgaag 120 ccaagcccgg gcacgtcccc aggcaggttg ggccctggtt ccaccagcgg atgcatgcag 180 tgaagcgggg acggagagac aagccgaggg cgcgggtggg aatggcgtcc gggaggacga 240 gtggaggaga agaatctaga ggcatcgaga ttcgagaagc cgacggagac aagattcgtg 300 tggggggaga caaaccgcgg ggctgagcgc cgttgatatg ggatcagacg gtgtggataa 360 aaaaagtgac gttgatagaa cgtctggcca gtgaaaaaac aaaacaactc caacaaaata 420 ctttaaaagc tcttataccc taaatgtagg ggatcaaaca cgtctctaca ctatttagca 480 gcgtcctcta aatgatcctc taaatttaga gaacgctact agattctcta tatatagttt 540 ctctaaacga tcttttatcc atttaaatac tttaaataac cggtttaaca aaactaaaat 600 atatacaata catttgagag tatgacaaat acgtatgtat aaaaataaaa aataaaataa 660 tgtattagtc tactttgaat cttcttttct tcataatata atgatgtata gctctcatgt 720 gcgttgagaa aaaagttaga gctagacgtt taatgtgtag tgacagtctt cgacgaaatc 780 tccctaatga gatgaattac tggaggttcc atcagaaagt cccctgaaaa gaggcattta 840 tttagtttag tcagcaattt ctgggaacac aaatattctt ttgttatcac cactattaaa 900 aatctatggt tataacttat aataacatga aaaaataatt tagcatccca tatatataaa 960 aactgaagga agccatatat actaacataa gttaggagaa actaagaagg ttgtgcaaag 1020 cttgcactgc tccaaaatac tgcaaacaac cactctcctc taccaaccaa agaaactcat 1080 gtactccctc cgttcttttt tatttgtcgc attttagttt aaaaatgaac tagcagtcga 1140 caaatattcg agaacagata tagtatatac taacataact taggagatac taagaaagtt 1200 gcgcagagct ttcactgttc caaattactg caaagcctct cccctctgcc agtacatcta 1260 cgagatgttt cagttaaaca aagattcaga caagtgatga gccacttctt gtcatagatt 1320 gtgtggtcaa ccaacccatt gatgccacgg tttttgtgca tccatgcttt tgtattaaaa 1380 WO 2006/039376 PCT/US2005/034947 catcagttat gtttaccatg tccgatatgc tctacataat gacaatcaac ttggtgttca 1440 ttatatttac aatgttagga atttcaatag ctacgaacac ttcaatagaa gtgcctttgt 1500 gggatcacct taatgtgttg ttgatgtaag gagaagaatc ttaatttact cttgctaaat 1560 ttgaactaca caaaaccact gcactgagga ttgtcctaat aaattactgc tcatacacgt 1620 tagcatctgt tcagatactg agctaatccc taggattaaa ggatttgtaa aagatatgcc 1680 caatcattca ttttagttat ttatttctta gttatccact tgaagattta catacatttg 1740 aaataaattt cttagaggta aagtgaaaat cagttattta aatacatttt agttatttat 1800 tttcttcttt ttcctaattt ttccttgtat ttgaagtctg aaaagataac tttgccctta 1860 tacatatttt atcttctacg tacgcatctg aacaacgtct ctttgtcccc tgatcgtgca 1920 gcaattagtg ctatgaatcg cgtttaagcg ctgcaaaatc atggctgggg cttcgtcctc 1980 gagtcgtcct gctgctcgat gtcacctcga gtcccgcacc gacctcagtg cttgttcttg 2040 ttggagccac ctctctcgga cgatcgccaa agacggataa ggccgaagcc gtcacttcag 2100 accgcgctca tgcgccgtag cagactccta catagcaggg ccagggtatg tggacctttg 2160 caagtttagg attggaacca gcgaccagaa tccacaagat tggagcaaac gaccaaaaat 2220 tcacaaggat tggcggctga cattgccagc gcgggatcgc atgcggcggc ggcggccggg 2280 gcgagcacgg gagcaggcga cagtcgagct ccattggaac gtagaaatac ttaagggcaa 2340 ggtctccaaa tacttgaaaa aataggaaaa agaagaaaat acatgaaatg atattgaaat 2400 caattggaag atgttatgaa tcttgttttt gcaaagcgaa cgattcagat ggcaaaacta 2460 tgaatctttt tgtttgaagt cccaaatata aaattttctc gtactcacca acattggtgc 2520 gcacctgtga ttggctcata aaaattcttg gagggacgga agaaagagtg aagggataag 2580 caagtaaaag cgctcaaaca ctgatagttt aaactgaagg cgggaaacga caatctgatc 2640 atgagcggag aattaaggga gtcacgttat gacccccgcc gatgacgcgg gacaagccgt 2700 tttacgtttg gaactgacag aaccgcaacg ttgaaggagc cactcagcaa gcttactagt 2760 agcgctgttt aaacgctctt caactggaag agcggttacc cggaccgaag cttgcatgcc 2820 tgcagtgcag cgtgacccgg tcgtgcccct ctctagagat aatgagcatt gcatgtctaa 2880 gttataaaaa attaccacat attttttttg tcacacttgt ttgaagtgca gtttatctat 2940 ctttatacat atatttaaac tttactctac gaataatata atctatagta ctacaataat 3000 atcagtgttt tagagaatca tataaatgaa cagttagaca tggtctaaag gacaattgag 3060 tattttgaca acaggactct acagttttat ctttttagtg tgcatgtgtt ctcctttttt 3120 tttgcaaata gcttcaccta tataatactt catccatttt attagtacat ccatttaggg 3180 tttagggtta atggttttta tagactaatt tttttagtac atctatttta ttctatttta 3240 gcctctaaat taagaaaact aaaactctat tttagttttt ttatttaata atttagatat 3300 aaaatagaat aaaataaagt gactaaaaat taaacaaata ccctttaaga aattaaaaaa 3360 actaaggaaa catttttctt gtttcgagta gataatgcca gcctgttaaa cgccgtcgac 3420 gagtctaacg gacaccaacc agcgaaccag cagcgtcgcg tcgggccaag cgaagcagac 3480 ggcacggcat ctctgtcgct gcctctggac ccctctcgag agttccgctc caccgttgga 3540 cttgctccgc tgtcggcatc cagaaattgc gtggcggagc ggcagacgtg agccggcacg 3600 gcaggcggcc tcctcctcct ctcacggcac cggcagctac gggggattcc tttcccaccg 3660 ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt 3720 tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac 3780 ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc ctctctacct 3840 tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt 3900 tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc 3960 tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg 4020 atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata 4080 gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca 4140 tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct 4200 agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat 4260 gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta 4320 ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc 4380 gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag 4440 aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 4500 catcttcata gttacgagtt taagatggat ggaaatatcg atgtaggata ggtatacatg 4560 ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct 4620 ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt 4680 gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc 4740 atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 4800 ttacttctgc aggtcgactc tagaggatcc acacgacacc atgtccgccc gcgaggtgca 4860 catcgacgtg aacaacaaga ccggccacac cctccagctg gaggacaaga ccaagctcga 4920 cggcggcagg tggcgcacct ccccgaccaa cgtggccaac gaccagatca agaccttcgt 4980 ggccgaatcc aacggcttca tgaccggcac cgagggcacc atctactact caattaatgg 5040 WO 2006/039376 PCT/US2005/034947 cgaggccgag atcagcctct acttcgacaa cccgttcgcc ggctccaaca aatacgacgg 5100 ccactccaac aagtcccagt acgagatcat cacccagggc ggctccggca accagtccca 5160 cgtgacctac accatccaga ccacctcctc ccgctacggc cacaagtcct gagtcatgag 5220 tcatgagtca gttaacctag acttgtccat cttctggatt ggccaactta attaatgtat 5280 gaaataaaag gatgcacaca tagtgacatg ctaatcacta taatgtgggc atcaaagttg 5340 tgtgttatgt gtaattacta gttatctgaa taaaagagaa agagatcatc catatttctt 5400 atcctaaatg aatgtcacgt gtctttataa ttctttgatg aaccagatgc atttcattaa 5460 ccaaatccat atacatataa atattaatca tatataatta atatcaattg ggttagcaaa 5520 acaaatctag tctaggtgtg ttttgcgaat gcggccgcgg accgaattgg ggatctgcat 5580 gaaagaaact gtcgcactgc tgaaccgcac cttgtcactt tcatcgaaca cgacctgtgc 5640 ccaagatgac ggtgctgcgg tctaagtgag gctgaattgc cttggacaga agcggactcc 5700 ctacaattag ttaggccaaa cggtgcatcc atgtgtagct ccgggctcgg gctgtatcgc 5760 catctgcaat agcatccatg gagctcgttc catgtagttg gagatgaacc aatgatcggg 5820 cgtgtggacg tatgttcctg tgtactccga tagtagagta cgtgttagct ctttcatggt 5880 gcaagtgaaa tttgtgttgg tttaattacc cctacgttag ttgcgggaca ggagacacat 5940 catgaattta aaggcgatga tgtcctctcc tgtaatgtta ttcttttgat gtgatgaatc 6000 aaaatgtcat ataaaacatt tgttgctctt tagttaggcc tgatcgtaga acgaaatgct 6060 cgtgtagcgg ggctacgagc ctatgacgca ataacactgg tttgccggcc cggagtcgct 6120 tgacaaaaaa aagcatgtta agtttattta caattcaaaa cctaacatat tatattccct 6180 caaagcaggt tcacgatcac acctgtacct aaaaaaaaca tgaagaatat attactccat 6240 tattatgaga tgaaccactt ggcaagagtg gtaagctata taaaaaaatg aacattatta 6300 cgagatgtta tatgccatta tattgattcg aagatatatg tttctttctc ccacgggcac 6360 ctaacggata catgataagg ccaaggcaga tcacgggaaa ttattcgaat acatgttacg 6420 ccctattgcc ggaaaaaaaa tgcagggcag gtgttggccg tagcgattta agcacttaag 6480 ctggaggttg ccacacttgg atgcaagcgt ctgacccttc taaaacatcg gcggctttgt 6540 ccgtatccgt atcccctatc cgacatctag ctggccacac gacggggctg ggcagatcgt 6600 ggatgccggg tcgacgtcga tcgtcagcca tcatagacca atcgaccatc tgttatggat 6660 gcttgctagc tagactagtc agacataaaa tttggatact ttctcccaac tgggagacgg 6720 ggactgatgt gcagctgcac gtgagctaaa tttttcccta taaatatgca tgaaatactg 6780 cattatcttg ccacagccac tgccacagcc agataacaag tgcagctggt agcacgcaac 6840 gcatagctct ggacttgtag ctaggtagcc aaccggatcc acacgacacc atgctcgaca 6900 ccaacaaggt gtacgagatc agcaaccacg ccaacggcct ctacgccgcc acctacctct 6960 ccctcgacga ctccggcgtg tccctcatga acaagaacga cgacgacatc gacgactaca 7020 acctcaagtg gttcctcttc ccgatcgacg acgaccagta catcatcacc tcctacgccg 7080 ccaacaactg caaggtgtgg aacgtgaaca acgacaagat taatgtgtca acctactcct 7140 ccaccaactc catccagaag tggcagatca aggccaacgg ctcctcctac gtgatccagt 7200 ccgacaacgg caaggtgctc accgccggca ccggccaggc cctcggcctc atccgcctca 7260 ccgacgagtc ctccaacaac ccgaaccagc aatggaacct gacgtccgtg cagaccatcc 7320 agctcccgca gaagccgatc atcgacacca agctcaagga ctacccgaag tactccccga 7380 ccggcaacat cgacaacggc acctccccgc agctcatggg ctggaccctc gtgccgtgca 7440 tcatggtgaa cgacccgaac atcgacaaga acacccagat caagaccacc ccgtactaca 7500 tcctcaagaa gtaccagtac tggcagaggg ccgtgggctc caacgtcgcg ctccgcccgc 7560 acgagaagaa gtcctacacc tacgagtggg gcaccgagat cgaccagaag accaccatca 7620 tcaacaccct cggcttccag atcaacatcg acagcggcat gaagttcgac atcccggagg 7680 tgggcggcgg taccgacgag atcaagaccc agctcaacga ggagctcaag atcgagtatt 7740 cacatgagac gaagatcatg gagaagtacc aggagcagtc cgagatcgac aacccgaccg 7800 accagtccat gaactccatc ggcttcctca ccatcacctc cctggagctc taccgctaca 7860 acggctccga gatccgcatc atgcagatcc agacctccga caacgacacc tacaacgtga 7920 cctcctaccc gaaccaccag caggccctgc tgctgctgac caaccactcc tacgaggagg 7980 tggaggagat caccaacatc ccgaagtcca ccctcaagaa gctcaagaag tactacttct 8040 gagtcatgag tcatgagtca gttaacctag acttgtccat cttctggatt ggccaactta 8100 attaatgtat gaaataaaag gatgcacaca tagtgacatg ctaatcacta taatgtgggc 8160 atcaaagttg tgtgttatgt gtaattacta gttatctgaa taaaagagaa agagatcatc 8220 catatttctt atcctaaatg aatgtcacgt gtctttataa ttctttgatg aaccagatgc 8280 atttcattaa ccaaatccat atacatataa atattaatca tatataatta atatcaattg 8340 ggttagcaaa acaaatctag tctaggtgtg ttttgcgaat tcccatggag tcaaagattc 8400 aaatagagga cctaacagaa ctcgccgtaa agactggcga acagttcata cagagtctct 8460 tacgactcaa tgacaagaag aaaatcttcg tcaacatggt ggagcacgac acgcttgtct 8520 actccaaaaa tatcaaagat acagtctcag aagaccaaag ggcaattgag acttttcaac 8580 aaagggtaat atccggaaac ctcctcggat tccattgccc agctatctgt cactttattg 8640 tgaagatagt ggaaaaggaa ggtggctcct acaaatgcca tcattgcgat aaaggaaagg 8700 WO 2006/039376 PCT/US2005/034947 ccatcgttga agatgcctct gccgacagtg gtcccaaaga tggaccccca cccacgagga 8760 gcatcgtgga aaaagaagac gttccaacca cgtcttcaaa gcaagtggat tgatgtgata 8820 tctccactga cgtaagggat gacgcacaat cccactatcc ttcgcaagac ccttcctcta 8880 tataaggaag ttcatttcat ttggagagga cagggtaccc ggggatccac catgtctccg 8940 gagaggagac cagttgagat taggccagct acagcagctg atatggccgc ggtttgtgat 9000 atcgttaacc attacattga gacgtctaca gtgaacttta ggacagagcc acaaacacca 9060 caagagtgga ttgatgatct agagaggttg caagatagat acccttggtt ggttgctgag 9120 gttgagggtg ttgtggctgg tattgcttac gctgggccct ggaaggctag gaacgcttac 9180 gattggacag ttgagagtac tgtttacgtg tcacataggc atcaaaggtt gggcctagga 9240 tccacattgt acacacattt gcttaagtct atggaggcgc aaggttttaa gtctgtggtt 9300 gctgttatag gccttccaaa cgatccatct gttaggttgc atgaggcttt gggatacaca 9360 gcccggggta cattgcgcgc agctggatac aagcatggtg gatggcatga tgttggtttt 9420 tggcaaaggg attttgagtt gccagctcct ccaaggccag ttaggccagt tacccagatc 9480 tgagtcgacc tgcaggcatg cccgctgaaa tcaccagtct ctctctacaa atctatctct 9540 ctctataata atgtgtgagt agttcccaga taagggaatt agggttctta tagggtttcg 9600 ctcatgtgtt gagcatataa gaaaccctta gtatgtattt gtatttgtaa aatacttcta 9660 tcaataaaat ttctaattcc taaaaccaaa atccagggcg agctcggtac ccggggatcc 9720 tctagagtcg acctgcaggc atgcccgcgg atatcgatgg gccccggccg aagcttcggt 9780 ccgggccatc gtggcctctt gctcttcagg atgaagagct atgtttaaac gtgcaagcgc 9840 tcaattcgcc ctatagtgag tcgtattaca atcgtacgca attcagtaca ttaaaaacgt 9900 ccgcaatgtg ttattaagtt gtctaagcgt caatttttcc cttctatggt cccgtttgtt 9960 tatcctctaa attatataat ccagcttaaa taagttaaga gacaaacaaa caacacagat 10020 tattaaatag attatgtaat ctagatacct agattatgta atccataagt agaatatcag 10080 gtgcttatat aatctatgag ctcgattata taatcttaaa agaaaacaaa cagagcccct 10140 ataaaaaggg gtcaagtgga cacttggtca ctcatttaat ccctccctct cctcttttat 10200 ccctcttttt ggtgtattca ccaatagtgg tgtgcacctg tgattggctc gtaaaaattc 10260 ttggacggat ggaagagtga agagataagc aagtcaaaga aaagtaacaa cgaagcttca 10320 tcagctacaa attttggccc aactggttgc accagcacca aacttacgta tacatgatta 10380 tctctgtttc cctcatttcg aagaaaaaaa cgggtttcaa aacccactgc tttcaggagt 10440 aaaaaaagat aataatctga aacattgctt ccaccttggc ccttatttgg ttacgttgca 10500 attcacccca atccacatgt ggattgagat ggattgcagt gtagctagac aaacccttag 10560 gccctgtttg cataggaata caccaggaat tattccagct aatcaaaatt tatataaatg 10620 agagaaacaa ttcggatagg aattgttcca ggacttcatt ctgcagtaac cgaacggccc 10680 cttaatccac cccaatacac gtggattgga gtggattgag gtacagccaa acaaggccta 10740 agtgcagatc aaataaatca cccgtcatat tcttctadct acaaaaacag caataaacac 10800 ctgaatgaag ttctaatttg cacagtgtag gtaggatgaa aatagttacc tcctcatggt 10860 cagtaactct tggcacacaa cttcacatgt aatcgatgta ccacttggct cttgcctgaa 10920 acccaataca tctttagcat aagaataata ttatgatggc aaggcatgat caccagcact 10980 cctttattgt ttagtaagtc tatcactccc caaaacaatt caaatgaaca gagatgcatt 11040 gcccccaatg aattctattt caattagccg gaaaattcta cttcatcaga agcatccaaa 11100 ttgccagcat ccctactaga ctgaccatga ccaggctgcc gcagatgcct ctttttctgt 11160 cctctcctct ttgccttgag tttctcttca agatccctca ccccacgtct cttatacatc 11220 ttaaagctaa catgtctctc ctccgccatc ttcctaacct tctcagtaat ctcagcagca 11280 atctgacggt tgtacaactt cttcagcccc ttcatcaact ttgcaaatgt gtcaggctgt 11340 ggcatcagtc ctgcctctag catgtctaag caatacaggc aggcctcctt gacatgtttc 11400 ttcgcaaaca gtgcatgaat ccagatagtc catgcactca cattgagctc acagcctttg 11460 ctcacaatac atttccaaac atcctttgca agctcaagtt tctcatctct gaccaacgca 11520 ttgaggaggt ccttcagcac cccatattgc ggtaccacaa agagccccct cccaaccatg 11580 tctttaaaat aactacatgc ctcaatcagc aaaccctgcc caacaaggcc actcaccacg 11640 atagcaaatg tatcgaccac aggactgagc ccagcacttt ccatctcatt ccacaatgtc 11700 atggcttgct tggtctcccc aagcctgcag gccaaccgaa tcaccacatt gtatatcttg 11760 agatctggtg gacaccggca ctcccgcatc ctctccatca gctccaagca ctcctcaagc 11820 tgctccttct tctcgtgtgc tacaaagaaa ccatggtaca cggcagcgtc cacccgcagg 11880 ccatccctcg acatagcatc caagaactcg tacccctggg at 24 211 7390 212 DNA 213 Artificial Sequence 11922 210 220 WO 2006/039376 PCT/US2005/034947 This sequence represents the DNA molecule used to transform maize line DAS59122-7 and represents insert PHI 17662A. misc_feature (1)... ¢25) T-DNA right border misc_feature (7366)...(7390) T-DNA left border 24 gtttacccgc caatatatcc tgtcaaacac tgatagttta aactgaaggc gggaaacgac 60 aatctgatca tgagcggaga attaagggag tcacgttatg acccccgccg atgacgcggg 120 acaagccgtt ttacgtttgg aactgacaga accgcaacgt tgaaggagcc actcagcaag 180 cttactagta gcgctgttta aacgctcttc aactggaaga gcggttaccc ggaccgaagc 240 ttgcatgcct gcagtgcagc gtgacccggt cgtgcccctc tctagagata atgagcattg 300 catgtctaag ttataaaaaa ttaccacata ttttttttgt cacacttgtt tgaagtgcag 360 tttatctatc tttatacata tatttaaact ttactctacg aataatataa tctatagtac 420 tacaataata tcagtgtttt agagaatcat ataaatgaac agttagacat ggtctaaagg 480 acaattgagt attttgacaa caggactcta cagttttatc tttttagtgt gcatgtgttc 540 tccttttttt ttgcaaatag cttcacctat ataatacttc atccatttta ttagtacatc 600 catttagggt ttagggttaa tggtttttat agactaattt ttttagtaca tctattttat 660 tctattttag cctctaaatt aagaaaacta aaactctatt ttagtttttt tatttaataa 720 tttagatata aaatagaata aaataaagtg actaaaaatt aaacaaatac cctttaagaa 780 attaaaaaaa ctaaggaaac atttttcttg tttcgagtag ataatgccag cctgttaaac 840 gccgtcgacg agtctaacgg acaccaacca gcgaaccagc agcgtcgcgt cgggccaagc 900 gaagcagacg gcacggcatc tctgtcgctg cctctggacc cctctcgaga gttccgctcc 960 accgttggac ttgctccgct gtcggcatcc agaaattgcg tggcggagcg gcagacgtga 1020 gccggcacgg caggcggcct cctcctcctc tcacggcacc ggcagctacg ggggattcct 1080 ttcccaccgc tccttcgctt tcccttcctc gcccgccgta ataaatagac accccctcca 1140 caccctcttt ccccaacctc gtgttgttcg gagcgcacac acacacaacc agatctcccc 1200 caaatccacc cgtcggcacc tccgcttcaa ggtacgccgc tcgtcctccc cccccccccc 1260 tctctacctt ctctagatcg gcgttccggt ccatggttag ggcccggtag ttctacttct 1320 gttcatgttt gtgttagatc cgtgtttgtg ttagatccgt gctgctagcg ttcgtacacg 1380 gatgcgacct gtacgtcaga cacgttctga ttgctaactt gccagtgttt ctctttgggg 1440 aatcctggga tggctctagc cgttccgcag acgggatcga tttcatgatt ttttttgttt 1500 cgttgcatag ggtttggttt gcccttttcc tttatttcaa tatatgccgt gcacttgttt 1560 gtcgggtcat cttttcatgc ttttttttgt cttggttgtg atgatgtggt ctggttgggc 1620 ggtcgttcta gatcggagta gaattctgtt tcaaactacc tggtggattt attaattttg 1680 gatctgtatg tgtgtgccat acatattcat agttacgaat tgaagatgat ggatggaaat 1740 atcgatctag gataggtata catgttgatg cgggttttac tgatgcatat acagagatgc 1800 tttttgttcg cttggttgtg atgatgtggt gtggttgggc ggtcgttcat tcgttctaga 1860 tcggagtaga atactgtttc aaactacctg gtgtatttat taattttgga actgtatgtg 1920 tgtgtcatac atcttcatag ttacgagttt aagatggatg gaaatatcga tgtaggatag 1980 gtatacatgt tgatgtgggt tttactgatg catatacatg atggcatatg cagcatctat 2040 tcatatgctc taaccttgag tacctatcta ttataataaa caagtatgtt ttataattat 2100 tttgatcttg atatacttgg atgatggcat atgcagcagc tatatgtgga tttttttagc 2160 cctgccttca tacgctattt atttgcttgg tactgtttct tttgtcgatg ctcaccctgt 2220 tgtttggtgt tacttctgca ggtcgactct agaggatcca cacgacacca tgtccgcccg 2280 cgaggtgcac atcgacgtga acaacaagac cggccacacc ctccagctgg aggacaagac 2340 caagctcgac ggcggcaggt ggcgcacctc cccgaccaac gtggccaacg accagatcaa 2400 gaccttcgtg gccgaatcca acggcttcat gaccggcacc gagggcacca tctactactc 2460 aattaatggc gaggccgaga tcagcctcta cttcgacaac ccgttcgccg gctccaacaa 2520 atacgacggc cactccaaca agtcccagta cgagatcatc acccagggcg gctccggcaa 2580 ccagtcccac gtgacctaca ccatccagac cacctcctcc cgctacggcc acaagtcctg 2640 agtcatgagt catgagtcag ttaacctaga cttgtccatc ttctggattg gccaacttaa 2700 ttaatgtatg aaataaaagg atgcacacat agtgacatgc taatcactat aatgtgggca 2760 tcaaagttgt gtgttatgtg taattactag ttatctgaat aaaagagaaa gagatcatcc 2820 atatttctta tcctaaatga atgtcacgtg tctttataat tctttgatga accagatgca 2880 WO 2006/039376 PCT/US2005/034947 tttcattaac caaatccata tacatataaa tattaatcat atataattaa tatcaattgg 2940 gttagcaaaa caaatctagt ctaggtgtgt tttgcgaatg cggccgcgga ccgaattggg 3000 gatctgcatg aaagaaactg tcgcactgct gaaccgcacc ttgtcacttt catcgaacac 3060 gacctgtgcc caagatgacg gtgctgcggt ctaagtgagg ctgaattgcc ttggacagaa 3120 gcggactccc tacaattagt taggccaaac ggtgcatcca tgtgtagctc cgggctcggg 3180 ctgtatcgcc atctgcaata gcatccatgg agctcgttcc atgtagttgg agatgaacca 3240 atgatcgggc gtgtggacgt atgttcctgt gtactccgat agtagagtac gtgttagctc 3300 tttcatggtg caagtgaaat ttgtgttggt ttaattaccc ctacgttagt tgcgggacag 3360 gagacacatc atgaatttaa aggcgatgat gtcctctcct gtaatgttat tcttttgatg 3420 tgatgaatca aaatgtcata taaaacattt gttgctcttt agttaggcct gatcgtagaa 3480 cgaaatgctc gtgtagcggg gctacgagcc tatgacgcaa taacactggt ttgccggccc 3540 ggagtcgctt gacaaaaaaa agcatgttaa gtttatttac aattcaaaac ctaacatatt 3600 atattccctc aaagcaggtt cacgatcaca cctgtaccta aaaaaaacat gaagaatata 3660 ttactccatt attatgagat gaaccacttg gcaagagtgg taagctatat aaaaaaatga 3720 acattattac gagatgttat atgccattat attgattcga agatatatgt ttctttctcc 3780 cacgggcacc taacggatac atgataaggc caaggcagat cacgggaaat tattcgaata 3840 catgttacgc cctattgccg gaaaaaaaat gcagggcagg tgttggccgt agcgatttaa 3900 gcacttaagc tggaggttgc cacacttgga tgcaagcgtc tgacccttct aaaaaatcgg 3960 cggctttgtc cgtatccgta tcccctatcc aacatctagc tggccacacg acggggctgg 4020 gcagatcgtg gatgccgggt cgacgtcgat cgtcagccat catagaccaa tcgaccatct 4080 gttatggatg cttgctagct agactagtca gacataaaat ttggatactt tctcccaact 4140 gggagacggg gactgatgtg cagctgcacg tgagctaaat ttttccctat aaatatgcat 4200 gaaatactgc attatcttgc cacagccact gccacagcca gataacaagt gcagctggta 4260 gcacgcaacg catagctctg gacttgtagc taggtagcca accggatcca cacgacacca 4320 tgctcgacac caacaaggtg tacgagatca gcaaccacgc caacggcctc tacgccgcca 4380 cctacctctc cctcgacgac tccggcgtgt ccctcatgaa caagaacgac gacgacatcg 4440 acgactacaa cctcaagtgg ttcctcttcc cgatcgacga cgaccagtac atcatcacct 4500 cctacgccgc caacaactgc aaggtgtgga acgtgaacaa cgacaagatt aatgtgtcaa 4560 cctactcctc caccaactcc atccagaagt ggcagatcaa ggccaacggc tcctcctacg 4620 tgatccagtc cgacaacggc aaggtgctca ccgccggcac cggccaggcc ctcggcctca 4680 tccgcctcac cgacgagtcc tccaacaacc cgaaccagca atggaacctg acgtccgtgc 4740 agaccatcca gctcccgcag aagccgatca tcgacaccaa gctcaaggac tacccgaagt 4800 actccccgac cggcaacatc gacaacggca cctccccgca gctcatgggc tggaccctcg 4860 tgccgtgcat catggtgaac gacccgaaca tcgacaagaa cacccagatc aagaccaccc 4920 cgtactacat cctcaagaag taccagtact ggcagagggc cgtgggctcc aacgtcgcgc 4980 tccgcccgca cgagaagaag tcctacacct acgagtgggg caccgagatc gaccagaaga 5040 ccaccatcat caacaccctc ggcttccaga tcaacatcga cagcggcatg aagttcgaca 5100 tcccggaggt gggcggcggt accgacgaga tcaagaccca gctcaacgag gagctcaaga 5160 tcgagtattc acatgagacg aagatcatgg agaagtacca ggagcagtcc gagatcgaca 5220 acccgaccga ccagtccatg aactccatcg gcttcctcac catcacctcc ctggagctct 5280 accgctacaa cggctccgag atccgcatca tgcagatcca gacctccgac aacgacacct 5340 acaacgtgac ctcctacccg aaccaccagc aggccctgct gctgctgacc aaccactcct 5400 acgaggaggt ggaggagatc accaacatcc cgaagtccac cctcaagaag ctcaagaagt 5460 actacttctg agtcatgagt catgagtcag ttaacctaga cttgtccatc ttctggattg 5520 gccaacttaa ttaatgtatg aaataaaagg atgcacacat agtgacatgc taatcactat 5580 aatgtgggca tcaaagttgt gtgttatgtg taattactag ttatctgaat aaaagagaaa 5640 gagatcatcc atatttctta tcctaaatga atgtcacgtg tctttataat tctttgatga 5700 accagatgca tttcattaac caaatccata tacatataaa tattaatcat atataattaa 5760 tatcaattgg gttagcaaaa caaatctagt ctaggtgtgt tttgcgaatt cccatggagt 5820 caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa cagttcatac 5880 agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg gagcacgaca 5940 cgcttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg gcaattgaga 6000 cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca gctatctgtc 6060 actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat cattgcgata 6120 aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat ggacccccac 6180 ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt 6240 gatgtgatat ctccactgac gtaagggatg acgcacaatc ccactatcct tcgcaagacc 6300 cttcctctat ataaggaagt tcatttcatt tggagaggac agggtacccg gggatccacc 6360 atgtctccgg agaggagacc agttgagatt aggccagcta cagcagctga tatggccgcg 6420 gtttgtgata tcgttaacca ttacattgag acgtctacag tgaactttag gacagagcca 6480 caaacaccac aagagtggat tgatgatcta gagaggttgc aagatagata cccttggttg 6540 WO 2006/039376 PCT/US2005/034947 gttgctgagg ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg 6600 aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca tcaaaggttg 6660 ggcctaggat ccacattgta cacacatttg cttaagtcta tggaggcgca aggttttaag 6720 tctgtggttg ctgttatagg ccttccaaac gatccatctg ttaggttgca tgaggctttg 6780 ggatacacag cccggggtac attgcgcgca gctggataca agcatggtgg atggcatgat 6840 gttggttttt ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt 6900 acccagatct gagtcgacct gcaggcatgc ccgctgaaat caccagtctc tctctacaaa 6960 tctatctctc tctataataa tgtgtgagta gttcccagat aagggaatta gggttcttat 7020 agggtttcgc tcatgtgttg agcatataag aaacccttag tatgtatttg tatttgtaaa 7080 atacttctat caataaaatt tctaattcct aaaaccaaaa tccagggcga gctcggtacc 7140 cggggatcct ctagagtcga cctgcaggca tgcccgcgga tatcgatggg ccccggccga 7200 agcttcggtc cgggccatcg tggcctcttg ctcttcagga tgaagagcta tgtttaaacg 7260 tgcaagcgct caattcgccc tatagtgagt cgtattacaa tcgtacgcaa ttcagtacat 7320 taaaaacgtc cgcaatgtgt tattaagttg tctaagcgtc aatttgttta caccacaata 7380 tatcctgcca 7390 2501 DNA Artificial Sequence PCR Amplicon 221-1 25 gcgggacaag ccgttttacg tttggaactg acagaaccgc aacgttgaag gagccactca 60 gcaagcttac tagtagcgct gtttaaacgc tcttcaactg gaagagcggt tacccggacc 120 gaagcttgca tgcctgcagt gcagcgtgac ccggtcgtgc ccctctctag agataatgag 180 cattgcatgt ctaagttata aaaaattacc acatattttt tttgtcacac ttgtttgaag 240 tgcagtttat ctatctttat acatatattt aaactttact ctacgaataa tataatctat 300 agtactacaa taatatcagt gttttagaga atcatataaa tgaacagtta gacatggtct 360 aaaggacaat tgagtatttt gacaacagga ctctacagtt ttatcttttt agtgtgcatg 420 tgttctcctt tttttttgca aatagcttca cctatataat acttcatcca ttttattagt 480 acatccattt agggtttagg gttaatggtt tttatagact aattttttta gtacatctat 540 tttattctat tttagcctct aaattaagaa aactaaaact ctattttagt ttttttattt 600 aataatttag atataaaata gaataaaata aagtgactaa aaattaaaca aatacccttt 660 aagaaattaa aaaaactaag gaaacatttt tcttgtttcg agtagataat gccagcctgt 720 taaacgccgt cgacgagtct aacggacacc aaccagcgaa ccagcagcgt cgcgtcgggc 780 caagcgaagc agacggcacg gcatctctgt cgctgcctct ggacccctct cgagagttcc 840 gctccaccgt tggacttgct ccgctgtcgg catccagaaa ttgcgtggcg gagcggcaga 900 cgtgagccgg cacggcaggc ggcctcctcc tcctctcacg gcaccggcag ctacggggga 960 ttcctttccc accgctcctt cgctttccct tcctcgcccg ccgtaataaa tagacacccc 1020 ctccacaccc tctttcccca acctcgtgtt gttcggagcg cacacacaca caaccagatc 1080 tcccccaaat ccacccgtcg gcacctccgc ttcaaggtac gccgctcgtc ctcccccccc 1140 ccccctctct accttctcta gatcggcgtt ccggtccatg gttagggccc ggtagttcta 1200 cttctgttca tgtttgtgtt agatccgtgt ttgtgttaga tccgtgctgc tagcgttcgt 1260 acacggatgc gacctgtacg tcagacacgt tctgattgct aacttgccag tgtttctctt 1320 tggggaatcc tgggatggct ctagccgttc cgcagacggg atcgatttca tgattttttt 1380 tgtttcgttg catagggttt ggtttgccct tttcctttat ttcaatatat gccgtgcact 1440 tgtttgtcgg gtcatctttt catgcttttt tttgtcttgg ttgtgatgat gtggtctggt 1500 tgggcggtcg ttctagatcg gagtagaatt ctgtttcaaa ctacctggtg gatttattaa 1560 ttttggatct gtatgtgtgt gccatacata ttcatagtta cgaattgaag atgatggatg 1620 gaaatatcga tctaggatag gtatacatgt tgatgcgggt tttactgatg catatacaga 1680 gatgcttttt gttcgcttgg ttgtgatgat gtggtgtggt tgggcggtcg ttcattcgtt 1740 ctagatcgga gtagaatact gtttcaaact acctggtgta tttattaatt ttggaactgt 1800 atgtgtgtgt catacatctt catagttacg agtttaagat ggatggaaat atcgatgtag 1860 gataggtata catgttgatg tgggttttac tgatgcatat acatgatggc atatgcagca 1920 tctattcata tgctctaacc ttgagtacct atctattata ataaacaagt atgttttata 1980 attattttga tcttgatata cttggatgat ggcatatgca gcagctatat gtggattttt 2040 ttagccctgc cttcatacgc tatttatttg cttggtactg tttcttttgt cgatgctcac 2100 cctgttgttt ggtgttactt ctgcaggtcg actctagagg atccacacga caccatgtcc 2160 gcccgcgagg tgcacatcga cgtgaacaac aagaccggcc acaccctcca gctggaggac 2220 WO 2006/039376 PCT/US2005/034947 aagaccaagc tcgacggcgg caggtggcgc acctccccga ccaacgtggc caacgaccag 2280 atcaagacct tcgtggccga atccaacggc ttcatgaccg gcaccgaggg caccatctac 2340 tactcaatta atggcgaggc cgagatcagc ctctacttcg acaacccgtt cgccggctcc 2400 aacaaatacg acggccactc caacaagtcc cagtacgaga tcatcaccca gggcggctcc 2460 ggcaaccagt cccacgtgac ctacaccatc cagaccacct c 2501 26 3027 DNA Artificial Sequence PCR Amplicon 221-2. 26 aacaacaaga ccggccacac cctccagctg gaggacaaga ccaagctcga cggcggcagg 60 tggcgcacct ccccgaccaa cgtggccaac gaccagatca agaccttcgt ggccgaatcc 120 aacggcttca tgaccggcac cgagggcacc atctactact caattaatgg cgaggccgag 180 atcagcctct acttcgacaa cccgttcgcc ggctccaaca aatacgacgg ccactccaac 240 aagtcccagt acgagatcat cacccagggc ggctccggca accagtccca cgtgacctac 300 accatccaga ccacctcctc ccgctacggc cacaagtcct gagtcatgag tcatgagtca 360 gttaacctag acttgtccat cttctggatt ggccaactta attaatgtat gaaataaaag 420 gatgcacaca tagtgacatg ctaatcacta taatgtgggc atcaaagttg tgtgttatgt 480 gtaattacta gttatctgaa taaaagagaa agagatcatc catatttctt atcctaaatg 540 aatgtcacgt gtctttataa ttctttgatg aaccagatgc atttcattaa ccaaatccat 600 atacatataa atattaatca tatataatta atatcaattg ggttagcaaa acaaatctag 660 tctaggtgtg ttttgcgaat gcggccgcgg accgaattgg ggatctgcat gaaagaaact 720 gtcgcactgc tgaaccgcac cttgtcactt tcatcgaaca cgacctgtgc ccaagatgac 780 ggtgctgcgg tctaagtgag gctgaattgc cttggacaga agcggactcc ctacaattag 840 ttaggccaaa cggtgcatcc atgtgtagct ccgggctcgg gctgtatcgc catctgcaat 900 agcatccatg gagctcgttc catgtagttg gagatgaacc aatgatcggg cgtgtggacg 960 tatgttcctg tgtactccga tagtagagta cgtgttagct ctttcatggt gcaagtgaaa 1020 tttgtgttgg tttaattacc cctacgttag ttgcgggaca ggagacacat catgaattta 1080 aaggcgatga tgtcctctcc tgtaatgtta ttcttttgat gtgatgaatc aaaatgtcat 1140 ataaaacatt tgttgctctt tagttaggcc tgatcgtaga acgaaatgct cgtgtagcgg 1200 ggctacgagc ctatgacgca ataacactgg tttgccggcc cggagtcgct tgacaaaaaa 1260 aagcatgtta agtttattta caattcaaaa cctaacatat tatattccct caaagcaggt 1320 tcacgatcac acctgtacct aaaaaaaaca tgaagaatat attactccat tattatgaga 1380 tgaaccactt ggcaagagtg gtaagctata taaaaaaatg aacattatta cgagatgtta 1440 tatgccatta tattgattcg aagatatatg tttctttctc ccacgggcac ctaacggata 1500 catgataagg ccaaggcaga tcacgggaaa ttattcgaat acatgttacg ccctattgcc 1560 ggaaaaaaaa tgcagggcag gtgttggccg tagcgattta agcacttaag ctggaggttg 1620 ccacacttgg atgcaagcgt ctgacccttc taaaacatcg gcggctttgt ccgtatccgt 1680 atcccctatc cgacatctag ctggccacac gacggggctg ggcagatcgt ggatgccggg 1740 tcgacgtcga tcgtcagcca tcatagacca atcgaccatc tgttatggat gcttgctagc 1800 tagactagtc agacataaaa tttggatact ttctcccaac tgggagacgg ggactgatgt 1860 gcagctgcac gtgagctaaa tttttcccta taaatatgca tgaaatactg cattatcttg 1920 ccacagccac tgccacagcc agataacaag tgcagctggt agcacgcaac gcatagctct 1980 ggacttgtag ctaggtagcc aaccggatcc acacgacacc atgctcgaca ccaacaaggt 2040 gtacgagatc agcaaccacg ccaacggcct ctacgccgcc acctacctct ccctcgacga 2100 ctccggcgtg tccctcatga acaagaacga cgacgacatc gacgactaca acctcaagtg 2160 gttcctcttc ccgatcgacg acgaccagta catcatcacc tcctacgccg ccaacaactg 2220 caaggtgtgg aacgtgaaca acgacaagat taatgtgtca acctactcct ccaccaactc 2280 catccagaag tggcagatca aggccaacgg ctcctcctac gtgatccagt ccgacaacgg 2340 caaggtgctc accgccggca ccggccaggc cctcggcctc atccgcctca ccgacgagtc 2400 ctccaacaac ccgaaccagc aatggaacct gacgtccgtg cagaccatcc agctcccgca 2460 gaagccgatc atcgacacca agctcaagga ctacccgaag tactccccga ccggcaacat 2520 cgacaacggc acctccccgc agctcatggg ctggaccctc gtgccgtgca tcatggtgaa 2580 cgacccgaac atcgacaaga acacccagat caagaccacc ccgtactaca tcctcaagaa 2640 gtaccagtac tggcagaggg ccgtgggctc caacgtcgcg ctccgcccgc acgagaagaa 2700 gtcctacacc tacgagtggg gcaccgagat cgaccagaag accaccatca tcaacaccct 2760 WO 2006/039376 PCT/US2005/034947 cggcttccag atcaacatcg acagcggcat gaagttcgac atcccggagg tgggcggcgg 2820 taccgacgag atcaagaccc agctcaacga ggagctcaag atcgagtatt cacatgagac 2880 gaagatcatg gagaagtacc aggagcagtc cgagatcgac aacccgaccg accagtccat 2940 gaactccatc ggcttcctca ccatcacctc cctggagctc taccgctaca acggctccga 3000 gatccgcatc atgcagatcc agacctc 3027 27 2830 DNA Artificial Sequence PCR Amplicon 221-3. 27 tacaacctca agtggttcct cttcccgatc gacgacgacc agtacatcat cacctcctac 60 gccgccaaca actgcaaggt gtggaacgtg aacaacgaca agattaatgt gtcaacctac 120 tcctccacca actccatcca gaagtggcag atcaaggcca acggctcctc ctacgtgatc 180 cagtccgaca acggcaaggt gctcaccgcc ggcaccggcc aggccctcgg cctcatccgc 240 ctcaccgacg agtcctccaa caacccgaac cagcaatgga acctgacgtc cgtgcagacc 300 atccagctcc cgcagaagcc gatcatcgac accaagctca aggactaccc gaagtactcc 360 ccgaccggca acatcgacaa cggcacctcc ccgcagctca tgggctggac cctcgtgccg 420 tgcatcatgg tgaacgaccc gaacatcgac aagaacaccc agatcaagac caccccgtac 480 tacatcctca agaagtacca gtactggcag agggccgtgg gctccaacgt cgcgctccgc 540 ccgcacgaga agaagtccta cacctacgag tggggcaccg agatcgacca gaagaccacc 600 atcatcaaca ccctcggctt ccagatcaac atcgacagcg gcatgaagtt cgacatcccg 660 gaggtgggcg gcggtaccga cgagatcaag acccagctca acgaggagct caagatcgag 720 tattcacatg agacgaagat catggagaag taccaggagc agtccgagat cgacaacccg 780 accgaccagt ccatgaactc catcggcttc ctcaccatca cctccctgga gctctaccgc 840 tacaacggct ccgagatccg catcatgcag atccagacct ccgacaacga cacctacaac 900 gtgacctcct acccgaacca ccagcaggcc ctgctgctgc tgaccaacca ctcctacgag 960 gaggtggagg agatcaccaa catcccgaag tccaccctca agaagctcaa gaagtactac 1020 ttctgagtca tgagtcatga gtcagttaac ctagacttgt ccatcttctg gattggccaa 1080 cttaattaat gtatgaaata aaaggatgca cacatagtga catgctaatc actataatgt 1140 gggcatcaaa gttgtgtgtt atgtgtaatt actagttatc tgaataaaag agaaagagat 1200 catccatatt tcttatccta aatgaatgtc acgtgtcttt ataattcttt gatgaaccag 1260 atgcatttca ttaaccaaat ccatatacat ataaatatta atcatatata attaatatca 1320 attgggttag caaaacaaat ctagtctagg tgtgttttgc gaattcccat ggagtcaaag 1380 attcaaatag aggacctaac agaactcgcc gtaaagactg gcgaacagtt catacagagt 1440 ctcttacgac tcaatgacaa gaagaaaatc ttcgtcaaca tggtggagca cgacacgctt 1500 gtctactcca aaaatatcaa agatacagtc tcagaagacc aaagggcaat tgagactttt 1560 caacaaaggg taatatccgg aaacctcctc ggattccatt gcccagctat ctgtcacttt 1620 attgtgaaga tagtggaaaa ggaaggtggc tcctacaaat gccatcattg cgataaagga 1680 aaggccatcg ttgaagatgc ctctgccgac agtggtccca aagatggacc cccacccacg 1740 aggagcatcg tggaaaaaga agacgttcca accacgtctt caaagcaagt ggattgatgt 1800 gatatctcca ctgacgtaag ggatgacgca caatcccact atccttcgca agacccttcc 1860 tctatataag gaagttcatt tcatttggag aggacagggt acccggggat ccaccatgtc 1920 tccggagagg agaccagttg agattaggcc agctacagca gctgatatgg ccgcggtttg 1980 tgatatcgtt aaccattaca ttgagacgtc tacagtgaac tttaggacag agccacaaac 2040 accacaagag tggattgatg atctagagag gttgcaagat agataccctt ggttggttgc 2100 tgaggttgag ggtgttgtgg ctggtattgc ttacgctggg ccctggaagg ctaggaacgc 2160 ttacgattgg acagttgaga gtactgttta cgtgtcacat aggcatcaaa ggttgggcct 2220 aggatccaca ttgtacacac atttgcttaa gtctatggag gcgcaaggtt ttaagtctgt 2280 ggttgctgtt ataggccttc caaacgatcc atctgttagg ttgcatgagg ctttgggata 2340 cacagcccgg ggtacattgc gcgcagctgg atacaagcat ggtggatggc atgatgttgg 2400 tttttggcaa agggattttg agttgccagc tcctccaagg ccagttaggc cagttaccca 2460 gatctgagtc gacctgcagg catgcccgct gaaatcacca gtctctctct acaaatctat 2520 ctctctctat aataatgtgt gagtagttcc cagataaggg aattagggtt cttatagggt 2580 ttcgctcatg tgttgagcat ataagaaacc cttagtatgt atttgtattt gtaaaatact 2640 tctatcaata aaatttctaa ttcctaaaac caaaatccag ggcgagctcg gtacccgggg 2700 atcctctaga gtcgacctgc aggcatgccc gcggatatcg atgggccccg gccgaagctt 2760 WO 2006/039376 PCT/US2005/034947 cggtccgggc catcgtggcc tcttgctctt caggatgaag agctatgttt aaacgtgcaa 2820 gcgctcaatt 2830 28 136 DNA Artificial Sequence PCR Amplicon 0784/0564 28 aatccacaag attggagcaa acgaccaaaa attcacaagg attggcggct gacattgcca 60 gcgcgggatc gcatgcggcg gcggcggccg gggcgagcac gggagcaggc gacagtcgag 120 ctccattgga acgtag 136 29 263 DNA Artificial Sequence PCR Amplicon 0784/0543 29 aatccacaag attggagcaa acgaccaaaa attcacaagg attggcggct gacattgcca 60 gcgcgggatc gcatgcggcg gcggcggccg gggcgagcac gggagcaggc gacagtcgag 120 ctccattgga acgtagaaat acttaagggc aaggtctcca aatacttgaa aaaataggaa 180 aaagaagaaa atacatgaaa tgatattgaa atcaattgga agatgttatg aatcttgttt 240 ttgcaaagcg aacgattcag atg 263 30 227 DNA Artificial Sequence PCR Amplicon 0569/0577 30 ggtcaagtgg acacttggtc actcatttaa tccctccctc tcctctttta tccctctttt 60 tggtgtattc accaatagtg gtgtgcacct gtgattggct cgtaaaaatt cttggacgga 120 tggaagagtg aagagataag caagtcaaag aaaagtaaca acgaagcttc atcagctaca 180 aattttggcc caactggttg caccagcacc aaacttacgt atacatg 227 31 492 DNA Artificial Sequence PCR Amplicon 0570/0542 31 gagtgaagag ataagcaagt caaagaaaag taacaacgaa gcttcatcag ctacaaattt 60 tggcccaact ggttgcacca gcaccaaact tacgtataca tgattatctc tgtttccctc 120 atttcgaaga aaaaaacggg tttcaaaacc cactgctttc aggagtaaaa aaagataata 180 atctgaaaca ttgcttccac cttggccctt atttggttac gttgcaattc accccaatcc 240 acatgtggat tgagatggat tgcagtgtag ctagacaaac ccttaggccc tgtttgcata 300 ggaatacacc aggaattatt ccagctaatc aaaatttata taaatgagag aaacaattcg 360 gataggaatt gttccaggac ttcattctgc agtaaccgaa cggcccctta atccacccca 420 WO 2006/039376 PCT/US2005/034947 atacacgtgg attggagtgg attgaggtac agccaaacaa ggcctaagtg cagatcaaat 480 aaatcacccg tc 492 32 555 DNA Artificial Sequence PCR Amplicon 0784/0215 32 aatccacaag attggagcaa acgaccaaaa attcacaagg attggcggct gacattgcca 60 gcgcgggatc gcatgcggcg gcggcggccg gggcgagcac gggagcaggc gacagtcgag 120 ctccattgga acgtagaaat acttaagggc aaggtctcca aatacttgaa aaaataggaa 180 aaagaagaaa atacatgaaa tgatattgaa atcaattgga agatgttatg aatcttgttt 240 ttgcaaagcg aacgattcag atggcaaaac tatgaatctt tttgtttgaa gtcccaaata 300 taaaattttc tcgtactcac caacattggt gcgcacctgt gattggctca taaaaattct 360 tggagggacg gaagaaagag tgaagggata agcaagtaaa agcgctcaaa cactgatagt 420 ttaaactgaa ggcgggaaac gacaatctga tcatgagcgg agaattaagg gagtcacgtt 480 atgacccccg ccgatgacgc gggacaagcc gttttacgtt tggaactgac agaaccgcaa 540 cgttgaagga gccac 555 33 547 DNA Artificial Sequence PCR Amplicon 0219/0577 33 cgtgcaagcg ctcaattcgc cctatagtga gtcgtattac aatcgtacgc aattcagtac 60 attaaaaacg tccgcaatgt gttattaagt tgtctaagcg tcaatttttc ccttctatgg 120 tcccgtttgt ttatcctcta aattatataa tccagcttaa ataagttaag agacaaacaa 180 acaacacaga ttattaaata gattatgtaa tctagatacc tagattatgt aatccataag 240 tagaatatca ggtgcttata taatctatga gctcgattat ataatcttaa aagaaaacaa 300 acagagcccc tataaaaagg ggtcaagtgg acacttggtc actcatttaa tccctccctc 360 tcctctttta tccctctttt tggtgtattc accaatagtg gtgtgcacct gtgattggct 420 cgtaaaaatt cttggacgga tggaagagtg aagagataag caagtcaaag aaaagtaaca 480 acgaagcttc atcagctaca aattttggcc caactggttg caccagcacc aaacttacgt 540 atacatg 547 34 243 DNA Artificial Sequence PCR Amplicon 0506/0476 34 tctcgtactc accaacattg gtgcgcacct gtgattggct cataaaaatt cttggaggga 60 cggaagaaag agtgaaggga taagcaagta aaagcgctca aacactgata gtttaaactg 120 aaggcgggaa acgacaatct gatcatgagc ggagaattaa gggagtcacg ttatgacccc 180 cgccgatgac gcgggacaag ccgttttacg tttggaactg acagaaccgc aacgttgaag 240 gag 243 35 754 DNA WO 2006/039376 PCT/US2005/034947 Artificial Sequence PCR Amplicon 0447/0577 35 aacccttagt atgtatttgt atttgtaaaa tacttctatc aataaaattt ctaattccta 60 aaaccaaaat ccagggcgag ctcggtaccc ggggatcctc tagagtcgac ctgcaggcat 120 gcccgcggat atcgatgggc cccggccgaa gcttcggtcc gggccatcgt ggcctcttgc 180 tcttcaggat gaagagctat gtttaaacgt gcaagcgctc aattcgccct atagtgagtc 240 gtattacaat cgtacgcaat tcagtacatt aaaaacgtcc gcaatgtgtt attaagttgt 300 ctaagcgtca atttttccct tctatggtcc cgtttgttta tcctctaaat tatataatcc 360 agcttaaata agttaagaga caaacaaaca acacagatta ttaaatagat tatgtaatct 420 agatacctag attatgtaat ccataagtag aatatcaggt gcttatataa tctatgagct 480 cgattatata atcttaaaag aaaacaaaca gagcccctat aaaaaggggt caagtggaca 540 cttggtcact catttaatcc ctccctctcc tcttttatcc ctctttttgg tgtattcacc 600 aatagtggtg tgcacctgtg attggctcgt aaaaattctt ggacggatgg aagagtgaag 660 agataagcaa gtcaaagaaa agtaacaacg aagcttcatc agctacaaat tttggcccaa 720 ctggttgcac cagcaccaaa cttacgtata catg 754 36 25 DNA Artificial Sequence Oligonucleotide primer 36 cgtattacaa tcgtacgcaa ttcag 25 37 25 DNA Artificial Sequence Oligonucleotide primer 37 ggataaacaa acgggaccat agaag 25 38 104 DNA Artificial Sequence Amplicon of SEQ ID NOs:36 and 37 38 cgtattacaa tcgtacgcaa ttcagtacat taaaaacgtc cgcaatgtgt tattaagttg 60 tctaagcgtc aatttttccc ttctatggtc ccgtttgttt atcc 104 39 25 DNA Artificial Sequence WO 2006/039376 PCT/US2005/034947 IVR1 (0197) Primer used to generate a 226 bp amplicon as an internal positive control 39 ccgctgtatc acaagggctg gtacc 25 40 25 DNA Artificial Sequence IVR2 (0198) Primer used to generate a 226 bp amplicon as an internal positive control 40 ggagcccgtg tagagcatga cgatc 25
Independent claims6
257 paragraphs in 63 sections, as filed
The invention provides DNA compositions that relate to transgenic insect resistant maize plants. Also provided are assays for detecting the presence of the maize DAS-59122-7 event based on the DNA sequence of the recombinant construct inserted into the maize genome and the DNA sequences flanking the insertion site. Kits and conditions useful in conducting the assays are provided.
WO 2006/039376 A3 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIM
NZ, OM, PG, PH, PL, PT, RO, RU, SC, SD, SE, SG, SK, SL, SM, SY, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, YU, ZA, ZM, ZW.
(84) Designated States (unless otherwise indicated, for every kind of regional protection available)·. ARIPO (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HU, IE, IS, IT, LT, LU, LV, MC, NL, PL, PT,
RO, SE, SI, SK, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG).
Published:
— with international search report (88) Date of publication of the international search report:
January 2007
For two-letter codes and other abbreviations, refer to the Guidance Notes on Codes and Abbreviations appearing at the beginning of each regular issue of the PCT Gazette.
WO 2006/039376
PCT/US2005/034947
CORN EVENT DAS-59122-7 AND METHODS FOR DETECTION THEREOF
FIELD OF INVENTION
Embodiments of the present invention relate to the field of plant molecular biology, specifically an embodiment of the invention relates to a DNA construct for conferring insect resistance to a plant. Embodiments of the invention more specifically relate to an insect resistant com plant DAS-59122-7 and to assays for detecting the presence of com plant DAS-59122-7 DNA in a sample and compositions thereof.
BACKGROUND OF INVENTION
An embodiment of this invention relates to the insect resistant corn (Zea mays') plant DAS-59122-7, also referred to as maize line DAS-59122-7 or maize event DAS59122-7, and to the DNA plant expression construct of corn plant DAS-59122-7 and the detection of the transgene/flanking insertion region in corn plant DAS-59122-7 and progeny thereof.
Corn is an important crop and is a primary food source in many areas of the world. 20 Damage caused by insect pests is a major factor in the loss of the world’s corn crops, despite the use of protective measures such as chemical pesticides. In view of this, insect resistance has been genetically engineered into crops such as corn in order to control insect damage and to reduce the need for traditional chemical pesticides. One group of genes which have been utilized for the production of transgenic insect resistant crops are the delta-endotoxins from Bacillus thuringiensis (B.t.). Delta-endotoxins have been successfully expressed in crop plants such as cotton, potatoes, rice, sunflower, as well as corn, and have proven to provide excellent control over insect pests. (Perlak, F.J et al. (1990) Bio/Technology 8, 939-943; Perlak, F.J. et al. (1993) Plant Mol. Biol. 22: 313-321; Fujimoto H. et al. (1993) Bio/Technology 11: 1151-1155; Tu et al. (2000) Nature
Biotechnology 18:1101-1104; PCT publication number WO 01/13731; and Bing JW etal. (2000) Efficacy of Cry IF Transgenic Maize, 14<sup>th</sup> Biennial International Plant Resistance to Insects Workshop, Fort Collins, CO).
The expression of foreign genes in plants is known to be influenced by their location in the plant genome, perhaps due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) close to the
WO 2006/039376
PCT/US2005/034947 integration site (Weising et al., Ann. Rev. Genet 22:421-477, 1988). At the same time the presence of the transgene at different locations in the genome will influence the overall phenotype of the plant in different ways. For this reason, it is often necessary to screen a large number of events in order to identify an event characterized by optimal expression of an introduced gene of interest. For example, it has been observed in plants and in other organisms that there may be a wide variation in levels of expression of an introduced gene among events. There may also be differences in spatial or temporal patterns of expression, for example, differences in the relative expression of a transgene in various plant tissues, that may not correspond to the patterns expected from transcriptional regulatory elements present in the introduced gene construct. For this reason, it is common to produce hundreds to thousands of different events and screen those events for a single event that has desired transgene expression levels and patterns for commercial purposes. An event that has desired levels or patterns of transgene expression is useful for introgressing the transgene into other genetic backgrounds by sexual outcrossing using conventional breeding methods. Progeny of such crosses maintain the transgene expression characteristics of the original transformant. This strategy is used to ensure reliable gene expression in a number of varieties that are well adapted to local growing conditions.
It would be advantageous to be able to detect the presence of a particular event in order to determine whether progeny of a sexual cross contain a transgene of interest. In addition, a method for detecting a particular event would be helpful for complying with regulations requiring the pre-market approval and labeling of foods derived from recombinant crop plants, for example, or for use in environmental monitoring, monitoring traits in crops in the field, or monitoring products derived from a crop harvest, as well as for use in ensuring compliance of parties subject to regulatory or contractual terms.
It is possible to detect the presence of a transgene by any nucleic acid detection method known in the art including, but not limited to, the polymerase chain reaction (PCR) or DNA hybridization using nucleic acid probes. These detection methods generally focus on frequently used genetic elements, such as promoters, terminators, marker genes, etc., because for many DNA constructs, the coding region is interchangeable. As a result, such methods may not be useful for discriminating between different events, particularly those produced using the same DNA construct or very similar constructs unless the DNA sequence of the flanking DNA adjacent to the inserted heterologous DNA is known. For example, an event-specific PCR assay is described in U.S. Patent No. 6,395,485 for the
WO 2006/039376
PCT/US2005/034947 detection of elite event GAT-ZM1. Accordingly, it would be desirable to have a simple and discriminative method for the identification of event DAS-59122-7.
SUMMARY OF INVENTION
Embodiments of this invention relate to methods for producing and selecting an insect resistant monocot crop plant. More specifically, a DNA construct is provided that when expressed in plant cells and plants confers resistance to insects. According to one aspect of the invention, a DNA construct, capable of introduction into and replication in a host cell, is provided that when expressed in plant cells and plants confers insect resistance to the plant cells and plants. The DNA construct is comprised of a DNA molecule named PHI17662A and it includes three (3) transgene expression cassettes. The first expression cassette comprises a DNA molecule which includes the promoter, 5’ untranslated exon, and first intron of the maize ubiquitin (Ubi-1) gene (Christensen et al. (1992) Plant Mol. Biol. 18:675-689 and Christensen and Quail (1996) Transgenic Res. 5:213-218) operably connected to a DNA molecule encoding a B.t. δ-endotoxin identified as Cry34Abl (U.S. Pat. Nos. 6,127,180, 6,624,145 and 6,340,593) operably connected to a DNA molecule comprising a Pin II transcriptional terminator isolated from potato (Gyheung An et al. (1989) Plant Cell. 1:115-122). The second transgene expression cassette of the DNA construct comprises a DNA molecule encoding the wheat peroxidase promoter (Hertig et al. (1991) Plant Mol. Biol. 16:171-174) operably connected to a DNA molecule encoding a B.t. δ-endotoxin identified as Cry35Abl (U.S. Pat. Nos. 6,083,499, 6,548,291 and 6,340,593) operably connected to a DNA molecule comprising a Pin II transcriptional terminator isolated from potato (Gyheung An et al. (1989) Plant Cell. 1:115-122). The third transgene expression cassette of the DNA construct comprises a DNA molecule of the cauliflower mosaic virus (CaMV) 35S promoter (Odell J.T. et al. (1985) Nature 313: 810-812; Mitsuhara et al. (1996) Plant Cell Physiol. 37: 49-59) operably connected to a DNA molecule encoding a phosphinothricin acetyltransferase (PAT) gene (Wohlleben W. et al. (1988) Gene 70: 25-37) operably connected to a DNA molecule comprising a 3’ transcriptional terminator from (CaMV) 35S (see Mitsuhara et al. (1996) Plant Cell Physiol. 37: 49-59). Plants containing the DNA construct are also provided.
According to another embodiment of the invention, compositions and methods are provided for identifying a novel corn plant designated DAS-59122-7, which methods are based on primers or probes which specifically recognize the 5’ and/or 3’ flanking sequence
WO 2006/039376
PCT/US2005/034947 of DAS-59122-7. DNA molecules are provided that comprise primer sequences that when utilized in a PCR reaction will produce amplicons unique to the transgenic event DAS59122-7. These molecules may be selected from the group consisting of: 5’-GTGGCTCCTTCAACGTTGCGGTTCTGTC-3’ (SEQ ID NO: 1);
5’-CGTGCAAGCGCTCAATTCGCCCTATAGTG-3’ (SEQ ID NO: 2);
5’-AATTGAGCGCTTGCACGTTT-3’ (SEQ ID NO: 3);
5’-AACAACAAGACCGGCCACACCCTC-3’ (SEQ ID NO: 4);
5’-GAGGTGGTCTGGATGGTGTAGGTCA-3’ (SEQ ID NO: 5);
5’-TACAACCTCAAGTGGTTCCTCTTCCCGA-3’ (SEQ ID NO: 6);
5’-GAGGTCTGGATCTGCATGATGCGGA-3’ (SEQ ID NO: 7);
5’-AACCCTTAGTATGTATTTGTATT-3’ (SEQ ID NO: 8);
5’-CTCCTTCAACGTTGCGGTTCTGTCAG-3’ (SEQ ID NO: 9);
5’-TTTTGCAAAGCGAACGATTCAGATG-3’ (SEQ ID NO: 10);
5’-GCGGGACAAGCCGTTTTACGTTT-3’ (SEQ ID NO: 11);
5’-GACGGGTGATTTATTTGATCTGCAC-3’ (SEQ ID NO: 12);
5’-CATCTGAATCGTTCGCTTTGCAAAA-3’ (SEQ ID NO: 13);
5’-CTACGTTCCAATGGAGCTCGACTGTC-3’ (SEQ ID NO: 14);
5’-GGTCAAGTGGACACTTGGTCACTCA-3’ (SEQ ID NO: 15);
5’-GAGTGAAGAGATAAGCAAGTCAAAG-3’ (SEQ ID NO: 16);
5’-CATGTATACGTAAGTTTGGTGCTGG-3’ (SEQ ID NO: 17);
5’-AATCCACAAGATTGGAGCAAACGAC-3’ (SEQ ID NO: 18)
5’-CGTATTACAATCGTACGCAATTCAG-3’ (SEQ ID NO: 36);
5’-GGATAAACAAACGGGACCATAGAAG-3’ (SEQ ID NO: 37) and complements thereof. The corn plant and seed comprising these molecules is an embodiment of this invention. Further, kits utilizing these primer sequences for the identification of the DAS59122-7 event are provided.
An additional embodiment of the invention relates to the specific flanking sequences of DAS-59122-7 described herein, which can be used to develop specific identification methods for DAS-59122-7 in biological samples. More particularly, the invention relates to the 5’ and/or 3’ flanking regions of DAS-59122-7, SEQ ID NO: 19, 5’ flanking and SEQ ID NO: 20, 3’ flanking, respectively, which can be used for the development of specific primers and probes. A further embodiment of the invention relates to identification methods for the presence of DAS-59122-7 in biological samples based on the use of such specific primers or probes.
WO 2006/039376
PCT/US2005/034947
According to another embodiment of the invention, methods of detecting the presence of DNA corresponding to the corn event DAS-59122-7 in a sample are provided. Such methods comprise: (a) contacting the sample comprising DNA with a DNA primer set, that when used in a nucleic acid amplification reaction with genomic DNA extracted from corn event DAS-59122-7 produces an amplicon that is diagnostic for com event DAS-59122-7; (b) performing a nucleic acid amplification reaction, thereby producing the amplicon; and (c) detecting the amplicon.
DNA molecules that comprise the novel transgene/flanking insertion region, SEQ ID NO: 21,5’ flanking plus 1000 internal and SEQ ID NO: 22, 3’ flanking plus 1000 internal and are homologous or complementary to SEQ ID NO: 21 and SEQ ID NO: 22 are an embodiment of this invention.
DNA sequences that comprise the novel transgene/flanking insertion region, SEQ ID NO: 21 are an embodiment of this invention. DNA sequences that comprise a sufficient length of polynucleotides of transgene insert sequence and a sufficient length of polynucleotides of maize genomic and/or flanking sequence from maize plant DAS59122-7 of SEQ ID NO: 21 that are useful as primer sequences for the production of an amplicon product diagnostic for maize plant DAS-59122-7 are included.
In addition, DNA sequences that comprise the novel transgene/flanking insertion region, SEQ ID NO: 22 are provided. DNA sequences that comprise a sufficient length of polynucleotides of transgene insert sequence and a sufficient length of polynucleotides of maize genomic and/or flanking sequence from maize plant DAS-59122-7 of SEQ ID NO: 22 that are useful as primer sequences for the production of an amplicon product diagnostic for maize plant DAS-59122-7 are included.
According to another embodiment of the invention, the DNA sequences that comprise at least 11 or more nucleotides of the transgene portion of the DNA sequence of SEQ ID NO: 21 or complements thereof, and a similar length of 5’ flanking maize DNA sequence of SEQ ID NO: 21 or complements thereof are useful as DNA primers in DNA amplification methods. The amplicons produced using these primers are diagnostic for maize event DAS-59122-7. Therefore, embodiments of the invention also include the amplicons produced by DNA primers homologous or complementary to SEQ ID NO: 21.
According to another embodiment of the invention, the DNA sequences that comprise at least 11 or more nucleotides of the transgene portion of the DNA sequence of SEQ ID NO: 22 or complements thereof, and a similar length of 3’ flanking maize DNA sequence of SEQ ID NO: 22 or complements thereof are useful as DNA primers in DNA
WO 2006/039376
PCT/US2005/034947 amplification methods. The amplicons produced using these primers are diagnostic for maize event DAS-59122-7. Therefore, embodiments of the invention also include the amplicons produced by DNA primers homologous or complementary to SEQ ID NO: 22.
More specifically, a pair of DNA molecules comprising a DNA primer set, wherein the DNA molecules are identified as SEQ ID NO: 18 or complements thereof and SEQ ID NO: 1 or complements thereof; SEQ ID NO: 2 or complements thereof and SEQ ID NO:
or complements thereof; SEQ ID NO: 10 or complements thereof and SEQ ID NO: 9 or complements thereof; SEQ ID NO: 8 or complements thereof and SEQ ID NO: 17 or complements thereof; and SEQ ID NO: 36 or complements thereof and SEQ ID NO: 37 or complements thereof are embodiments of the invention.
Further embodiments of the invention include the amplicon comprising the DNA molecules of SEQ ID NO: 18 and SEQ ID NO: 1; the amplicon comprising the DNA molecules of SEQ ID NO: 2 and SEQ ID NO: 17; the amplicon comprising the DNA molecules of SEQ ID NO: 10 and SEQ ID NO: 9; the amplicon comprising the DNA molecules of SEQ ID NO: 8 and SEQ ID NO: 17; and the amplicon comprising the DNA molecules of SEQ ID NO: 36 and SEQ ID NO: 37.
Further embodiments of the invention include the following primers, which are useful in detecting or characterizing event DAS-59122-7: SEQ ID NO: 11 or complements thereof; SEQ ID NO: 5 or complements thereof; SEQ ID NO: 4 or complements thereof; SEQ ID NO: 7 or complements thereof; SEQ ID NO: 6 or complements thereof; SEQ ID NO: 3 or complements thereof; SEQ ID NO: 18 or complements thereof; SEQ ID NO: 14 or complements thereof; SEQ ID NO: 13 or complements thereof; SEQ ID NO: 15 or complements thereof; SEQ ID NO: 17 or complements thereof; SEQ ID NO: 16 or complements thereof; and SEQ ID NO: 12 or complements thereof. Further embodiments also include the amplicons produced by pairing any of the primers listed above.
According to another embodiment of the invention, methods of detecting the presence of a DNA molecule corresponding to the DAS-59122-7 event in a sample, such methods comprising: (a) contacting the sample comprising DNA extracted from a corn plant with a DNA probe, molecule that hybridizes under stringent hybridization conditions with DNA extracted from corn event DAS-59122-7 and does not hybridize under the stringent hybridization conditions with a control corn plant DNA; (b) subjecting the sample and probe to stringent hybridization conditions; and (c) detecting hybridization of the probe to the DNA. More specifically, a method for detecting the presence of a DNA
WO 2006/039376
PCT/US2005/034947 molecule corresponding to the DAS-59122-7 event in a sample, such methods, consisting of (a) contacting the sample comprising DNA extracted from a corn plant with a DNA probe molecule that consists of sequences that are unique to the event, e.g. junction sequences, wherein said DNA probe molecule hybridizes under stringent hybridization conditions with DNA extracted from corn event DAS-59122-7 and does not hybridize under the stringent hybridization conditions with a control corn plant DNA; (b) subjecting the sample and probe to stringent hybridization conditions; and (c) detecting hybridization of the probe to the DNA.
In addition, a kit and methods for identifying event DAS-59122-7 in a biological sample which detects a DAS-59122-7 specific region within SEQ ID NO: 23 are provided.
DNA molecules are provided that comprise at least one junction sequence of DAS59122-7 selected from the group consisting of SEQ ID NO: 32, 33, 34, and 35 and complements thereof; wherein a junction sequence spans the junction between heterologous DNA inserted into the genome and the DNA from the com cell flanking the insertion site, i.e. flanking DNA, and is diagnostic for the DAS-59122-7 event.
According to another embodiment of the invention, methods of producing an insect resistant corn plant that comprise the steps of: (a) sexually crossing a first parental corn line comprising the expression cassettes of the invention, which confers resistance to insects, and a second parental corn line that lacks insect resistance, thereby producing a plurality of progeny plants; and (b) selecting a progeny plant that is insect resistant. Such methods may optionally comprise the further step of back-crossing the progeny plant to the second parental corn line to producing a true-breeding com plant that is insect resistant.
A further embodiment of the invention provides a method of producing a com plant that is resistant to insects comprising transforming a com cell with the DNA construct PHI17662A (SEQ ID NO: 24), growing the transformed com cell into a com plant, selecting the com plant that shows resistance to insects, and further growing the corn plant into a fertile corn plant. The fertile com plant can be self pollinated or crossed with compatible corn varieties to produce insect resistant progeny.
Another embodiment of the invention further relates to a DNA detection kit for identifying maize event DAS-59122-7 in biological samples. The kit comprises a first primer which specifically recognizes the 5’ or 3’ flanking region of DAS-59122-7, and a second primer which specifically recognizes a sequence within the foreign DNA of DAS59122-7, or within the flanking DNA, for use in a PCR identification protocol. A further embodiment of the invention relates to a kit for identifying event DAS-59122-7 in
WO 2006/039376
PCT/US2005/034947 biological samples, which kit comprises a specific probe having a sequence which corresponds or is complementary to, a sequence having between 80% and 100% sequence identity with a specific region of event DAS-59122-7. The sequence of the probe corresponds to a specific region comprising part of the 5’ or 3’ flanking region of event DAS-59122-7.
The methods and kits encompassed by the embodiments of the present invention can be used for different purposes such as, but not limited to the following: to identify event DAS-59122-7 in plants, plant material or in products such as, but not limited to, food or feed products (fresh or processed) comprising, or derived from plant material; additionally or alternatively, the methods and kits can be used to identify transgenic plant material for purposes of segregation between transgenic and non-transgenic material; additionally or alternatively, the methods and kits can be used to determine the quality of plant material comprising maize event DAS-59122-7. The kits may also contain the reagents and materials necessary for the performance of the detection method.
A further embodiment of this invention relates to the DAS-59122-7 corn plant or its parts, including, but not limited to, pollen, ovules, vegetative cells, the nuclei of pollen cells, and the nuclei of egg cells of the com plant DAS-59122-7 and the progeny derived thereof. The corn plant and seed DAS-59122-7 from which the DNA primer molecules provide a specific amplicon product is an embodiment of the invention.
The foregoing and other aspects of die invention will become more apparent from the following detailed description and accompanying drawing.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. DNA sequence (SEQ ID NO: 23) showing the transgenic insert PHI17662A, as well as the sequences flanking the transgenic insert. The 5’ and 3’ border regions, bp 1 to bp2593 and bp 9937 to bp 11922, respectively, are underlined. Two nucleotide differences (bp 6526 and bp 6562) based on comparison to the transforming plasmid PHP 17662 are noted in bold and underlined.
FIG. 2. Schematic diagram of the B.t. Cry34/35Abl event DAS-59122-7 insert region is divided into three separate sections; the 5’ border region with corn genomic DNA, the intact T-DNA insert, and the 3’ border region with corn genomic DNA. The two arrows beneath the diagram of the insert indicate the start and end points of the sequence derived from 5’ and 3’ genome walking fragments. Other boxes beneath the diagram of the insert represent PCR fragments that were amplified from genomic DNA of
WO 2006/039376
PCT/US2005/034947 event DAS-59122-7 and sequenced to cover the intact T-DNA insert and the 5’ and 3’ insert/border junction regions.
FIG. 3. Schematic diagram of the B.t. Cry34/35Abl event DAS-59122-7 insert region is divided into three separate sections; the 5’ border region with corn genomic DNA, the intact T-DNA insert, and the 3’ border region with com genomic DNA. Boxes beneath the diagram of the insert represent PCR fragments located in either the genomic border regions or across the 5’ and 3’ junction regions of the T-DNA insert with com genomic DNA that were amplified from genomic DNA from event DAS-59122-7.
DETAILED DESCRIPTION
The following definitions and methods are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. Definitions of common terms in molecular biology may also be found in Rieger et al., Glossary of Genetics: Classical and Molecular, 5<sup>th</sup> edition, Springer-Verlag; New York, 1991; and Lewin, Genes V, Oxford University Press: New York, 1994. The nomenclature for DNA bases as set forth at 37 CFR § 1.822 is used.
As used herein, the term “comprising” means “including but not limited to”.
As used herein, the term “com” means Zea mays or maize and includes all plant varieties that can be bred with corn, including wild maize species.
As used herein, the term “DAS-59122-7 specific” refers to a nucleotide sequence which is suitable for discriminatively identifying event DAS-59122-7 in plants, plant material, or in products such as, but not limited to, food or feed products (fresh or processed) comprising, or derived from plant material.
As used herein, the terms “insect resistant” and “impacting insect pests” refers to effecting changes in insect feeding, growth, and/or behavior at any stage of development, including but not limited to: killing the insect; retarding growth; preventing reproductive capability; inhibiting feeding; and the like.
As used herein, the terms “pesticidal activity” and “insecticidal activity” are used synonymously to refer to activity of an organism or a substance (such as, for example, a protein) that can be measured by numerous parameters including, but not limited to, pest mortality, pest weight loss, pest attraction, pest repellency, and other behavioral and physical changes of a pest after feeding on and/or exposure to the organism or substance
WO 2006/039376
PCT/US2005/034947 for an appropriate length of time. For example “pesticidal proteins” are proteins that display pesticidal activity by themselves or in combination with other proteins.
“Coding sequence” refers to a nucleotide sequence that codes for a specific amino acid sequence. As used herein, the terms “encoding” or “encoded” when used in the context of a specified nucleic acid mean that the nucleic acid comprises the requisite information to guide translation of the nucleotide sequence into a specified protein. The information by which a protein is encoded is specified by the use of codons. A nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid or may lack such intervening non-translated sequences (e.g., as in cDNA).
“Gene” refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5’ non-coding sequences) and following (3’ non-coding sequences) the coding sequence. “Native gene” refers to a gene as found in nature with its own regulatory sequences. “Chimeric gene” refers any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. “Endogenous gene” refers to a native gene in its natural location in the genome of an organism. “Foreign” refers to material not normally found in the location of interest.
Thus “foreign DNA” may comprise both recombinant DNA as well as newly introduced, rearranged DNA of the plant. A “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes.
A “transgene” is a gene that has been introduced into the genome by a transformation procedure. The site in the plant genome where a recombinant DNA has been inserted may be referred to as the “insertion site” or “target site”.
As used herein, “insert DNA” refers to the heterologous DNA within the expression cassettes used to transform the plant material while “flanking DNA” can exist of either genomic DNA naturally present in an organism such as a plant, or foreign (heterologous) DNA introduced via the transformation process which is extraneous to the original insert DNA molecule, e.g. fragments associated with the transformation event. A “flanking region” or “flanking sequence” as used herein refers to a sequence of at least twenty (20) base pair, preferably at least fifty (50) base pair, and up to five thousand (5000) base pair
WO 2006/039376
PCT/US2005/034947 which is located either immediately upstream of and contiguous with or immediately downstream of and contiguous with the original foreign insert DNA molecule. Transformation procedures leading to random integration of the foreign DNA will result in transformants containing different flanking regions characteristic and unique for each transformant. When recombinant DNA is introduced into a plant through traditional crossing, its flanking regions will generally not be changed. Transformants will also contain unique junctions between a piece of heterologous insert DNA and genomic DNA, or two (2) pieces of genomic DNA, or two (2) pieces of heterologous DNA. A junction is a point where two (2) specific DNA fragments join. For example, a junction exists where insert DNA joins flanking DNA. A junction point also exists in a transformed organism where two (2) DNA fragments join together in a manner that is modified from that found in the native organism. “Junction DNA” refers to DNA that comprises a junction point.
As used herein, “heterologous” in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous nucleotide sequence can be from a species different from that from which the nucleotide sequence was derived, or, if from the same species, the promoter is not naturally found operably linked to the nucleotide sequence. A heterologous protein may originate from a foreign species, or, if from the same species, is substantially modified from its original form by deliberate human intervention.
“Regulatory sequences” refer to nucleotide sequences located upstream (5’ noncoding sequences), within, or downstream (3 ’ non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
“Promoter” refers to a nucleotide sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3' to a promoter sequence. The promoter sequence consists of proximal and more distal upstream elements, the latter elements are often referred to as enhancers. Accordingly, an “enhancer” is a nucleotide sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or
WO 2006/039376
PCT/US2005/034947 tissue-specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleotide segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Promoters that cause a nucleic acid fragment to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okamuro and Goldberg (1989)
Biochemistry of Plants 15:1-82. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, nucleic acid fragments of different lengths may have identical promoter activity.
The “translation leader sequence” refers to a nucleotide sequence located between the promoter sequence of a gene and the coding sequence. The translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence. The translation leader sequence may affect numerous parameters including, processing of the primary transcript to mRNA, mRNA stability and/or translation efficiency. Examples of translation leader sequences have been described (Turner and Foster (1995) Mol. Biotechnol. 3:225-236).
The “3’ non-coding sequences” refer to nucleotide sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3’ end of the mRNA precursor. The use of different 3’ non-coding sequences is exemplified by Ingelbrecht et al. (1989) Plant Cell 1:671-680.
A “protein” or “polypeptide” is a chain of amino acids arranged in a specific order determined by the coding sequence in a polynucleotide encoding the polypeptide.
A DNA construct is an assembly of DNA molecules linked together that provide one or more expression cassettes. The DNA construct may be a plasmid that is enabled for self replication in a bacterial cell and contains various endonuclease enzyme restriction sites that are useful for introducing DNA molecules that provide functional genetic elements, i.e., promoters, introns, leaders, coding sequences, 3’ termination regions, among others; or a DNA construct may be a linear assembly of DNA molecules, such as an expression cassette. The expression cassette contained within a DNA construct
WO 2006/039376
PCT/US2005/034947 comprise the necessary genetic elements to provide transcription of a messenger RNA.
The expression cassette can be designed to express in prokaryote cells or eukaryotic cells. Expression cassettes of the embidoments of the present invention are designed to express in plant cells.
The DNA molecules of embodiments of the invention are provided in expression cassettes for expression in an organism of interest. The cassette will include 5’ and 3’ regulatory sequences operably linked to a coding sequence. “Operably linked” means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame. Operably linked is intended to indicate a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. The cassette may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple expression cassettes or multiple DNA constructs.
The expression cassette will include in the 5’ to 3’ direction of transcription: a transcriptional and translational initiation region, a coding region, and a transcriptional and translational termination region functional in the organism serving as a host. The transcriptional initiation region (i.e., the promoter) may be native or analogous, or foreign or heterologous to the host organism. Additionally, the promoter may be the natural sequence or alternatively a synthetic sequence. The expression cassettes may additionally contain 5’ leader sequences in the expression cassette construct. Such leader sequences can act to enhance translation.
It is to be understood that as used herein the term “transgenic” includes any cell, cell line, callus, tissue, plant part, or plant, the genotype of which has been altered by the presence of a heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic. The term “transgenic” as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
A transgenic “event” is produced by transformation of plant cells with a heterologous DNA construct(s), including a nucleic acid expression cassette that comprises a transgene of interest, the regeneration of a population of plants resulting from the
WO 2006/039376
PCT/US2005/034947 insertion of the transgene into the genome of the plant, and selection of a particular plant characterized by insertion into a particular genome location. An event is characterized phenotypically by the expression of the transgene. At the genetic level, an event is part of the genetic makeup of a plant. The term “event” also refers to progeny produced by a sexual outcross between the transformant and another variety that include the heterologous DNA. Even after repeated back-crossing to a recurrent parent, the inserted DNA and flanking DNA from the transformed parent is present in the progeny of the cross at the same chromosomal location. The term “event” also refers to DNA from the original transformant comprising the inserted DNA and flanking sequence immediately adjacent to the inserted DNA that would be expected to be transferred to a progeny that receives inserted DNA including the transgene of interest as the result of a sexual cross of one parental line that includes the inserted DNA (e.g., the original transformant and progeny resulting from setting) and a parental line that does not contain the inserted DNA.
An insect resistant DAS-59122-7 com plant can be bred by first sexually crossing a first parental corn plant consisting of a corn plant grown from the transgenic DAS-59122-7 com plant and progeny thereof derived from transformation with the expression cassettes of the embodiments of the present invention that confers insect resistance, and a second parental corn plant that lacks insect resistance, thereby producing a plurality of first progeny plants; and then selecting a first progeny plant that is resistant to insects; and selling the first progeny plant, thereby producing a plurality of second progeny plants; and then selecting from the second progeny plants an insect resistant plant. These steps can further include the back-crossing of the first insect resistant progeny plant or the second insect resistant progeny plant to the second parental com plant or a third parental corn plant, thereby producing a corn plant that is resistant to insects.
As used herein, the term plant includes reference to whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds, plant cells, and progeny of same. Parts of transgenic plants understood to be within the scope of the invention comprise, for example, plant cells, protoplasts, tissues, callus, embryos as well as flowers, stems, fruits, leaves, and roots originating in transgenic plants or their progeny previously transformed with a DNA molecule of the invention and therefore consisting at least in part of transgenic cells, are also an embodiment of the present invention.
As used herein, the term plant cell includes, without limitation, seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. The class of plants that can be used in the methods
WO 2006/039376
PCT/US2005/034947 of the invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants.
“Transformation” refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” organisms.
Examples of methods of plant transformation include Agrobacterium-vaQ&\.ate& transformation (De Blaere et al. (1987) Meth. Enzymol. 143:277) and particle-accelerated or “gene gun” transformation technology (Klein et al. (1987) Nature (London) 327:70-73; U.S. Patent No. 4,945,050, incorporated herein by reference). Additional transformation methods are disclosed below.
Thus, isolated polynucleotides of the invention can be incorporated into recombinant constructs, typically DNA constructs, which are capable of introduction into and replication in a host cell. Such a construct can be a vector that includes a replication system and sequences that are capable of transcription and translation of a polypeptideencoding sequence in a given host cell. A number of vectors suitable for stable transfection of plant cells or for the establishment of transgenic plants have been described in, e.g., Pouwels et al., (1985; Supp. 1987) Cloning Vectors: A Laboratory Manual, Weissbach and Weissbach (1989) Methods for Plant Molecular Biology, (Academic Press, New York); and Flevin et al., (1990) Plant Molecular Biology Manual, (Kluwer Academic Publishers). Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5’ and 3’ regulatory sequences and a dominant selectable marker. Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
It is also to be understood that two different transgenic plants can also be mated to produce offspring that contain two independently segregating added, exogenous genes. Selfing of appropriate progeny can produce plants that are homozygous for both added, exogenous genes. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in one of several references, e.g., Fehr, in Breeding Methods for Cultivar Development, Wilcos J. ed., American Society of Agronomy, Madison Wis. (1987).
WO 2006/039376
PCT/US2005/034947
A “probe” is an isolated nucleic acid to which is attached a conventional detectable label or reporter molecule, e.g., a radioactive isotope, ligand, chemiluminescent agent, or enzyme. Such a probe is complementary to a strand of a target nucleic acid, in the case of the present invention, to a strand of isolated DNA from corn event DAS-59122-7 whether from a com plant or from a sample that includes DNA from the event. Probes according to the present invention include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that bind specifically to a target DNA sequence and can be used to detect the presence of that target DNA sequence.
“Primers” are isolated nucleic acids that are annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a polymerase, e.g., a DNA polymerase. Primer pairs of the invention refer to their use for amplification of a target nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-acid amplification methods. “PCR” or “polymerase chain reaction” is a technique used for the amplification of specific DNA segments (see, U.S. Patent Nos. 4,683,195 and 4,800,159; herein incorporated by reference).
Probes and primers are of sufficient nucleotide length to bind to the target DNA sequence specifically in the hybridization conditions or reaction conditions determined by the operator. This length may be of any length that is of sufficient length to be useful in a detection method of choice. Generally, eleven (11) nucleotides or more in length, eighteen (18) nucleotides or more, and twenty-two (22) nucleotides or more, are used. Such probes and primers hybridize specifically to a target sequence under high stringency hybridization conditions. Probes and primers according to embodiments of the present invention may have complete DNA sequence similarity of contiguous nucleotides with the target sequence, although probes differing from the target DNA sequence and that retain the ability to hybridize to target DNA sequences may be designed by conventional methods. Probes can be used as primers, but are generally designed to bind to the target DNA or RNA and are not used in an amplification process.
Specific primers can be used to amplify an integration fragment to produce an amplicon that can be used as a “specific probe” for identifying event DAS-59122-7 in biological samples. When the probe is hybridized with the nucleic acids of a biological sample under conditions which allow for the binding of the probe to the sample, this binding can be detected and thus allow for an indication of the presence of event DAS59122-7 in the biological sample. Such identification of a bound probe has been described
WO 2006/039376
PCT/US2005/034947 in the art. In an embodiment of the invention the specific probe is a sequence which, under optimized conditions, hybridizes specifically to a region within the 5’ or 3’ flanking region of the event and also comprises a part of the foreign DNA contiguous therewith. The specific probe may comprise a sequence of at least 80%, between 80 and 85%, between 85 and 90%, between 90 and 95%, and between 95 and 100% identical (or complementary) to a specific region of the event.
Methods for preparing and using probes and primers are described, for example, in Molecular Cloning: A Laboratory Manual, 2<sup>nd</sup> ed, vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989 (hereinafter, “Sambrook et al., 1989”); Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates) (hereinafter, “Ausubel et al., 1992”); and Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990. PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as the PCR primer analysis tool in Vector NTI version 6 (Informax Inc., Bethesda MD); PrimerSelect (DNASTAR Inc., Madison, WI); and Primer (Version 0.5®, 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.). Additionally, the sequence can be visually scanned and primers manually identified using guidelines known to one of skill in the art.
A “kit” as used herein refers to a set of reagents for the purpose of performing the method embodiments of the invention, more particularly, the identification of the event DAS-59122-7 in biological samples. The kit of the invention can be used, and its components can be specifically adjusted, for purposes of quality control (e.g. purity of seed lots), detection of event DAS-59122-7 in plant material, or material comprising or derived from plant material, such as but not limited to food or feed products. “Plant material” as used herein refers to material which is obtained or derived from a plant.
Primers and probes based on the flanking DNA and insert sequences disclosed herein can be used to confirm (and, if necessary, to correct) the disclosed sequences by conventional methods, e.g., by re-cloning and sequencing such sequences. The nucleic acid probes and primers of the present invention hybridize under stringent conditions to a target DNA sequence. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA from a transgenic event in a sample. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. As used herein, two nucleic
WO 2006/039376
PCT/US2005/034947 acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure.
A nucleic acid molecule is said to be the “complement” of another nucleic acid molecule if they exhibit complete complementarity. As used herein, molecules are said to exhibit “complete complementarity” when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional “low-stringency” conditions. Similarly, the molecules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional “high-stringency” conditions. Conventional stringency conditions are described by Sambrook et al., 1989, and by Haymes et al., In: Nucleic Acid Hybridization, a Practical Approach, IRL Press, Washington, D.C. (1985), departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure. In order for a nucleic acid molecule to serve as a primer or probe it need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and salt concentrations employed.
In hybridization reactions, specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. The thermal melting point (Tm) is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Tm is reduced by about 1°C for each 1% of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the Tm for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the Tm; moderately stringent conditions can utilize a hybridization and/or
WO 2006/039376
PCT/US2005/034947 wash at 6, 7, 8, 9, or 10°C lower than the Tm; low stringency conditions can utilize a hybridization and/or wash at 11,12, 13,14,15, or 20°C lower than the Tm.
Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45°C (aqueous solution) or 32°C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).
As used herein, a substantially homologous sequence is a nucleic acid molecule that will specifically hybridize to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions. Appropriate stringency conditions which promote DNA hybridization, for example, 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2X SSC at 50°C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), 6.3.1-6.3.6. Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of a destabilizing agent such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to lXSSCat55to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C. A nucleic acid of the invention may specifically hybridize to one or more of the nucleic acid molecules unique to the DAS-59122-7 event or complements thereof or fragments of either under moderately stringent conditions.
WO 2006/039376
PCT/US2005/034947
Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm. Non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller (1988) CABIOS 4:11-17; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453; the search-forsimilarity-method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85:2444-2448; the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.
Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0); the ALIGN PLUS program (version 3.0, copyright 1997); and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 10 (available from Accelrys, 9685 Scranton Road, San Diego, CA 92121, USA). Alignments using these programs can be performed using the default parameters.
The CLUSTAL program is well described by Higgins and Sharp, Gene 73:
237-244 (1988); Higgins and Sharp, CABIOS 5: 151-153 (1989); Corpet, et al., Nucleic Acids Research 16: 10881-90 (1988); Huang, et al., Computer Applications in the Biosciences 8: 155-65 (1992), and Pearson, etal., Methods in Molecular Biology 24: 307331 (1994). The ALIGN and the ALIGN PLUS programs are based on the algorithm of Myers and Miller (1988) supra. The BLAST programs of Altschul et al. (1990) J. Mol. Biol. 215:403 are based on the algorithm of Karlin and Altschul (1990) supra. The BLAST family of programs which can be used for database similarity searches includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995). Alignment may also be performed manually by visual inspection.
To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described in Altschul et al. (1997) Nucleic Acids Res.
WO 2006/039376
PCT/US2005/034947
25:3389. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used. See www.ncbi.hlm.nih.gov.
As used herein, “sequence identity” or “identity” in the context of two nucleic acid or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have “sequence similarity” or “similarity”. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).
As used herein, “percentage of sequence identity” means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
WO 2006/039376
PCT/US2005/034947
Regarding the amplification of a target nucleic acid sequence (e.g., by PCR) using a particular amplification primer pair, “stringent conditions” are conditions that permit the primer pair to hybridize only to the target nucleic-acid sequence to which a primer having the corresponding wild-type sequence (or its complement) would bind and preferably to produce a unique amplification product, the amplicon, in a DNA thermal amplification reaction.
The term “specific for (a target sequence)” indicates that a probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target sequence.
As used herein, “amplified DNA” or “amplicon” refers to the product of nucleic acid amplification of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a corn plant resulting from a sexual cross contains transgenic event genomic DNA from the com plant of the invention, DNA extracted from the corn plant tissue sample may be subjected to a nucleic acid amplification method using a DNA primer pair that includes a first primer derived from flanking sequence adjacent to the insertion site of inserted heterologous DNA, and a second primer derived from the inserted heterologous DNA to produce an amplicon that is diagnostic for the presence of the event DNA. Alternatively, the second primer may be derived from the flanking sequence. The amplicon is of a length and has a sequence that is also diagnostic for the event. The amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair to any length of amplicon producible by a DNA amplification protocol. Alternatively, primer pairs can be derived from flanking sequence on both sides of the inserted DNA so as to produce an amplicon that includes the entire insert nucleotide sequence of the PHI17662A expression construct as well as the sequence flanking the transgenic insert, see FIG. 1 (SEQ ID NO: 23), approximately twelve (12) Kb in size. A member of a primer pair derived from the flanking sequence may be located a distance from the inserted DNA sequence, this distance can range from one nucleotide base pair up to the limits of the amplification reaction, or about twenty thousand nucleotide base pairs. The use of the term “amplicon” specifically excludes primer dimers that may be formed in the DNA thermal amplification reaction.
Nucleic acid amplification can be accomplished by any of the various nucleic acid amplification methods known in the art, including the polymerase chain reaction (PCR). A variety of amplification methods are known in the art and are described, inter alia, in U.S. Pat. Nos. 4,683,195 and 4,683,202 and in PCR Protocols: A Guide to Methods and
WO 2006/039376
PCT/US2005/034947
Applications, ed. Innis et al., Academic press, San Diego, 1990. PCR amplification methods have been developed to amplify up to 22 Kb of genomic DNA and up to 42 Kb of bacteriophage DNA (Cheng et al., Proc. Natl. Acad. Sci. USA 91:5695-5699, 1994).
These methods as well as other methods known in the art of DNA amplification may be used in the practice of the embodiments of the present invention. It is understood that a number of parameters in a specific PCR protocol may need to be adjusted to specific laboratory conditions and may be slightly modified and yet allow for the collection of similar results. These adjustments will be apparent to a person skilled in the art.
The amplicon produced by these methods may be detected by a plurality of techniques, including, but not limited to, Genetic Bit Analysis (Nikiforov, et al. Nucleic Acid Res. 22:4167-4175, 1994) where a DNA oligonucleotide is designed which overlaps both the adjacent flanking DNA sequence and the inserted DNA sequence. The oligonucleotide is immobilized in wells of a microwell plate. Following PCR of the region of interest (using one primer in the inserted sequence and one in the adjacent flanking sequence) a single-stranded PCR product can be hybridized to the immobilized oligonucleotide and serve as a template for a single base extension reaction using a DNA polymerase and labeled ddNTPs specific for the expected next base. Readout may be fluorescent or ELIS A-based. A signal indicates presence of the insert/flanking sequence due to successful amplification, hybridization, and single base extension.
Another detection method is the Pyrosequencing technique as described by Winge (Innov. Pharma. Tech. 00: 18-24, 2000). In this method an oligonucleotide is designed that overlaps the adjacent DNA and insert DNA junction. The oligonucleotide is hybridized to a single-stranded PCR product from the region of interest (one primer in the inserted sequence and one in the flanking sequence) and incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5’ phosphosulfate and luciferin. dNTPs are added individually and the incorporation results in a light signal which is measured. A light signal indicates the presence of the transgene insert/flanking sequence due to successful amplification, hybridization, and single or multi-base extension.
Fluorescence Polarization as described by Chen et al., (Genome Res. 9:492-498, 1999) is also a method that can be used to detect an amplicon of the invention. Using this method an oligonucleotide is designed which overlaps the flanking and inserted DNA junction. The oligonucleotide is hybridized to a single-stranded PCR product from the region of interest (one primer in the inserted DNA and one in the flanking DNA sequence)
WO 2006/039376
PCT/US2005/034947 and incubated in the presence of a DNA polymerase and a fluorescent-labeled ddNTP. Single base extension results in incorporation of the ddNTP. Incorporation can be measured as a change in polarization using a fluorometer. A change in polarization indicates the presence of the transgene insert/flanking sequence due to successful amplification, hybridization, and single base extension.
Taqman® (PE Applied Biosystems, Foster City, Calif.) is described as a method of detecting and quantifying the presence of a DNA sequence and is fully understood in the instructions provided by the manufacturer. Briefly, a FRET oligonucleotide probe is designed which overlaps the flanking and insert DNA junction. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage and release of the fluorescent moiety away from the quenching moiety on the FRET probe. A fluorescent signal indicates the presence of the flanking/transgene insert sequence due to successful amplification and hybridization.
Molecular Beacons have been described for use in sequence detection as described in Tyangi et al. (Nature Biotech. 14:303-308, 1996). Briefly, a FRET oligonucleotide probe is designed that overlaps the flanking and insert DNA junction. The unique structure of the FRET probe results in it containing secondary structure that keeps the fluorescent and quenching moieties in close proximity. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Following successful PCR amplification, hybridization of the FRET probe to the target sequence results in the removal of the probe secondary structure and spatial separation of the fluorescent and quenching moieties. A fluorescent signal results. A fluorescent signal indicates the presence of the flanking/transgene insert sequence due to successful amplification and hybridization.
A hybridization reaction using a probe specific to a sequence found within the amplicon is yet another method used to detect the amplicon produced by a PCR reaction.
Embodiments of the present invention are further defined in the following Examples. It should be understood that these Examples are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the embodiments of the
WO 2006/039376
PCT/US2005/034947 invention to adapt it to various usages and conditions. Thus, various modifications of the embodiments of the invention, in addition to those shown and described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.
The disclosure of each reference set forth herein is incorporated herein by reference in its entirety.
EXAMPLES
Example 1. Transformation of Maize by Agrobacterium transformation and Regeneration of Transgenic Plants Containing the Cry34Abl and Cry35Abl (Cry34/35Abl) Genes
A DNA molecule of approximately 7.4 Kb, designated PHI17662A (SEQ ID NO: 24), which includes a first transgene expression cassette comprising a DNA molecule which includes the promoter, 5’ untranslated exon, and first intron of the maize ubiquitin (Ubi-1) gene (Christensen et al. (1992) Plant Mol. Biol. 18:675-689 and Christensen and • Quail (1996) Transgenic Res. 5:213-218) operably connected to a DNA molecule encoding a B.t. δ-endotoxin identified as Cry34Abl (U.S. Pat. Nos. 6,127,180, 6,624,145 and 6,340,593) operably connected to a DNA molecule comprising a Pin II transcriptional terminator isolated from potato (Gyheung An et al. (1989) Plant Cell. 1:115-122). The second transgene expression cassette of the DNA construct comprises a DNA molecule encoding the wheat peroxidase promoter (Hertig et al. (1991) Plant Mol. Biol. 16:171-174) operably connected to a DNA molecule encoding a B. t. δ-endotoxin identified as Cry35Abl (U.S. Pat. Nos. 6,083,499, 6,548,291 and 6,340,593) operably connected to a DNA molecule comprising a Pin II transcriptional terminator isolated from potato (Gyheung An et al. (1989) Plant Cell. 1:115-122). The third transgene expression cassette of the DNA construct comprises a DNA molecule of the cauliflower mosaic virus (CaMV) 35S promoter (Odell J.T. et al. (1985) Nature 313: 810-812; Mitsuhara et al. (1996) Plant Cell Physiol. 37: 49-59) operably connected to a DNA molecule encoding a phosphinothricin acetyltransferase (PAT) gene (Wohlleben W. et al. (1988) Gene 70: 2537) operably connected to a DNA molecule comprising a 3’ transcriptional terminator from (CaMV) 35S (see Mitsuhara et al. (1996) Plant Cell Physiol. 37: 49-59) was used to transform maize embryo tissue.
B.t. Cry34/35 Abl maize plants were obtained by Agrobacterium transformation, the method of Zhao was employed (U.S. Patent No. 5,981,840, and PCT patent publication
WO 2006/039376
PCT/US2005/034947
WO98/32326; the contents of which are hereby incorporated by reference). Briefly, immature embryos were isolated from maize and the embryos contacted with a suspension of Agrobacterium, where the bacteria was capable of transferring PHI17662 DNA (SEQ ID NO:24) to at least one cell of at least one of the immature embryos (step 1: the infection step). Specifically, in this step the immature embryos were immersed in an Agrobacterium suspension for the initiation of inoculation. The embryos were co-cultured for a time with the Agrobacterium (step 2: the co-cultivation step). Specifically, the immature embryos were cultured on solid medium following the infection step. Following this co-cultivation period a resting step was provided. In this resting step, the embryos were incubated in the presence of at least one antibiotic known to inhibit the growth of Agrobacterium without the addition of a selective agent for plant transformants (step 3: resting step). In particular, the immature embryos are cultured on solid medium with antibiotic, but without a selecting agent, for elimination of Agrobacterium and for a resting phase for the infected cells. Next, inoculated embryos were cultured on medium containing a selective agent and growing transformed callus was recovered (step 4: the selection step). Specifically, the immature embryos were cultured on solid medium with a selective agent resulting in the selective growth of transformed cells. The callus was then regenerated into plants (step 5: the regeneration step), and, specifically, call! grown on selective medium were cultured on solid medium to regenerate the plants. Individual embryos were kept physically separate during culture, and the majority of explants died on the selective medium.
Those embryos that survived and produced healthy, glufosinate-resistant callus tissue were assigned unique identification codes representing putative transformation events, and continually transferred to flesh selection medium. Plants were regenerated from tissue derived from each unique event and transferred to the greenhouse. Leaf samples were taken for molecular analysis to verify the presence of the transgene by PCR and to confirm expression of the Cry34/35Abl protein by ELISA. Plants were then subjected to a whole plant bioassay using western corn rootworm insects. Positive plants were crossed with inbred lines to obtain seed from the initial transformed plants. A number of lines were evaluated in the field. The DAS-59122-7 event was selected from a population of independent transgenic events based on a superior combination of characteristics, including insect resistance and agronomic performance.
WO 2006/039376
PCT/US2005/034947
Example 2. Identification of Bacillus thuringiensis Cry34/35Abl maize line DAS-59122-7
Seed from event DAS-59122-7 was evaluated. The T1S2 seed represents transformation into the Hi-II background, followed by a cross with inbred line PH09B and two rounds of self-crossing. All seed were obtained from Pioneer Hi-Bred (Johnston, IA). Primary characterization was conducted on plant leaf tissue during the study by confirmation of phosphinothricin acetyltransferase (PAT) activity via herbicide leaf painting and Cry34Abl expression using lateral flow devices.
Control substances in this study were defined as unmodified seed representative of the test substance background. Control seeds of Hi-II and PH09B backgrounds were used as negative controls. These unmodified seed do not contain the plant transcription units for the cry34Abl, cry35Abl, and pat genes. All seed were obtained from Pioneer Hi-Bred (Johnston, IA).
DNA samples from two additional B.t. Cry34/35Abl events^ event DAS-45214-4 and event DAS-45216-6, were used as negative controls for event specific PCR analysis. The two events were produced through Agrobacterium transformation using the same vector used to produce event DAS-59122-7 and therefore contained the plant transcription units for the cry34Abl, cry35Abl, and pat genes. However, the insertions sites of the TDNA in events DAS-45214-4 and DAS-45216-6, including genomic DNA border regions, were different from that in event DAS-59122-7. DNA samples from event DAS-45214-4 and event DAS-45216-6 were isolated and characterized by Southern blot analysis. (Data not shown.)
Corn seed for event DAS-59122-7 and unmodified control seed (Hi-II and PH09B) were planted in growth chambers at the DuPont Experimental Station (Wilmington, DE) to produce sufficient numbers of plants for DNA analysis. For characterization of event DAS-59122-7, ten (10) T1S2 seeds were planted. Ten (10) seeds were also planted for each unmodified control line. One (1) seed was planted per pot, and the pot was uniquely identified. Planting and growing conditions were conducive to healthy plant growth including regulated light and water.
Leaf samples were collected for each of the control and event DAS-59122-7 plants. For each sample, sufficient leaf material from above the growing point was collected and placed in a pre-labeled sample bag. The samples were placed on dry ice and were transferred to an ultralow freezer following collection. All samples were maintained 27
WO 2006/039376
PCT/US2005/034947 frozen until processing. All leaf samples were uniquely labeled with the plant identifier and the date of harvest.
To confirm the expression of the Cry34Abl protein in event DAS-59122-7 and the absence of expression in the controls, leaf samples were collected from all event
DAS-59122-7 and control plants, and screened for transgenic protein using lateral flow devices specific for Cry34Abl (Strategic Diagnostics, Inc., Newark, DE). Leaf punches were taken from each plant and ground in a phosphate buffered saline solution with Tween 20 to crudely extract the protein. A strip device was dipped into the extract to determine the presence or absence of the Cry34Abl protein. The immunoassay results were used to confirm the identity of the test substance plants prior to molecular analysis as shown in
Table 1.
To confirm the expression of phosphinothricin acetyltransferase (PAT) in event DAS-59122-7 plants, herbicide leaf painting was conducted. All plants used in this study were leaf painted to confirm plant identity. Plants were assayed prior to the RI growth stage. Assays were conducted following a standard procedure known in the art for herbicide leaf painting for the identification of PAT-expressing transgenic plants. Specifically, a portion of one leaf of each plant was treated with approximately 2% solution of glufosinate herbicide, Basta® (Bayer CropScience) in water and visually checked for brown or necrotic tissue in the painted leaf area 4-12 days after application.
Results for each plant were recorded and used to determine expression of PAT in each test plant as shown in Table 1. As shown in Table 1, of the ten (10) plants tested for event DAS-59122-7 T1S2 generation, six (6) plants expressed both Cry34Abl and PAT, while four (4) plants did not express either protein. All unmodified controls tested negative for both Cry Ab 1 And PAT assays (data not shown).
WO 2006/039376
PCT/US2005/034947
Table 1: Cry34Abl and PAT Protein Expression and Southern Hybridization Data for Kt Cry34/35Abl Event DAS-59122-7
<td> Plant ID</td><td> Sample ID</td><td> Cry34Abl and PAT Expression<sup>1</sup></td><td> Southern Blot cry 3 4 Ab 1 Probe<sup>2</sup></td><td> Southern Blot cry 3 5 Ab 1 Probe<sup>2</sup></td><td> Southern Blot pat Probe<sup>2</sup></td>
<td> 02-122C 1</td><td> DAS59122-7 T1S2 1</td><td> positive</td><td> +</td><td> +</td><td> +</td>
<td> 02-122C 2</td><td> DAS59122-7 T1S2 2</td><td> positive</td><td> +</td><td> +</td><td> +</td>
<td> 02-122C 3</td><td> DAS59122-7 T1S2 3</td><td> positive</td><td> +</td><td> +</td><td> +</td>
<td> 02-122C 4</td><td> DAS59122-7 T1S2 4</td><td> negative</td><td> -</td><td> -</td><td> -</td>
<td> 02-122C 5</td><td> DAS59122-7 T1S2 5</td><td> positive</td><td> +</td><td> +</td><td> +</td>
<td> 02-122C 6</td><td> DAS59122-7 T1S2 6</td><td> negative</td><td> -</td><td> -</td><td> -</td>
<td> 02-122C 7</td><td> DAS59122-7 T1S2 7</td><td> positive</td><td> +</td><td> +</td><td> +</td>
<td> 02-122C 8</td><td> DAS59122-7 T1S2 8</td><td> negative</td><td> -</td><td> -</td><td> -</td>
<td> 02-122C 9</td><td> DAS59122-7 T1S2 9</td><td> negative</td><td> -</td><td> -</td><td> -</td>
<td> 02-122C 10</td><td> DAS59122-7 T1S2 10</td><td> positive</td><td> +</td><td> +</td><td> +</td>
<sup>1</sup>' Positive Cry34Abl expression indicates detection of protein expression as determined by the immunoassay-based lateral flow device specific for Cry34Abl protein detection. Negative indicates no detection of the Cry34Abl protein. Positive PAT expression indicates plants that were tolerant to the herbicide treatment and negative indicates plants that were sensitive to the herbicide.
<sup>2</sup>· + indicates hybridization signal on Southern blot; - indicates no hybridization signal on Southern blot. The cry34Abl gene probe hybridized to the expected internal T-DNA fragment of 1.915 kb, the cry35Abl gene probe hybridized to the expected internal T-DNA fragment of 2.607 kb, and the pat gene probe hybridized to a 3.4 kb border fragment consistent with a single intact T-DNA insertion as determined by Southern blot analysis.
Example 3. Southern Blot Analysis of Bacillus thuringiensis Cry34/35Abl maize line DAS-59122-7
One gram quantities of leaf samples were ground under liquid nitrogen, and the genomic DNA was isolated using DNeasy® Plant Mini Kit (Qiagen, Valencia, CA) or using a standard Urea Extraction Buffer procedure. Following extraction, the DNA was visualized on an agarose gel to determine the DNA quality, and was quantified using Pico Green® reagent (Molecular Probes, Inc., Eugene, OR) and spectrofluorometric analysis.
WO 2006/039376
PCT/US2005/034947
The 1 Kb DNA Ladder (Invitrogen, Carlsbad, CA) was used to estimate DNA fragment sizes on agarose gels.
Genomic DNA isolated from event DAS-59122-7 plants was digested with Neo I and electrophoretically separated, transferred to nylon membranes, and hybridized to the cry34Abl, cry35 Abl and pat gene probes using standard procedures known in the art. Blots were exposed to X-ray film for one or more time periods to detect hybridizing fragments and to visualize molecular weight standards. Images were then digitally captured by photographing X.-ray films and/or by detection with a Lumi-Imager™ instrument (Roche, Indianapolis, IN). The sizes of detected bands were documented for each probe. Southern blot analysis was used as a means of verifying the presence of the insertion in the test plants and confirming that all plants from event DAS-59122-7 contained the same insertion as shown in Table 1. (Southern blots not shown.) Southern blot analysis indicated that event DAS-59122-7 contained a single insertion consisting of an intact copy of the T-DNA region from plasmid PHP17662, while the null segregants, as determined by the protein expression analysis did not hybridize to the gene probes.
Further, event DAS-59122-7 plants expressing the two proteins exhibited identical hybridization patterns on Southern blots (data not shown). Specifically, the cry34Abl gene probe hybridized to the expected internal T-DNA fragment of 1.915 kb, the cry35Abl gene probe hybridized to the expected internal T-DNA fragment of 2.607 kb, and the pat gene probe hybridized to a 3.4 kb border fragment consistent with a single intact T-DNA insertion as determined by Southern blot results.
Example 4. T-DNA Insert and Flanking Border Region Sequencing of Bacillus thuringiensis Cry34/35Abl maize line DAS-59122-7
The T-DNA insert and flanking border regions were cloned from B.t. Cry34/35Abl event DAS59122-7 using PCR based methods as diagramed in Figures 2 and 3. Specifically, sequences bordering the 5’ and 3’ ends of the insert in event DAS-59122-7 were obtained using two genome walking techniques. The first walking method was essentially the method as described for the Universal Genome Walker Kit (BD Biosciences Clontech, Palo Alto, CA), and the second method was conducted according to the splinkerette protocol outlined in Devon et al., (1995) Nucleic Acids Research 23 (9):16441645, with modifications as described by Stover (2001), U.C. Irvine (personal communication).
WO 2006/039376
PCT/US2005/034947
Briefly, genomic DNA was digested with various restriction enzymes (Dra I, AcoR V, Pvu II, Sma I and Stu I for the Universal Genome Walker method and BamR I, EcoR I, Hind III, and Xba I for the splinkerette method) and then ligated to blunt-end adaptors for the Genome Walker method and to adaptors specific for the restriction enzyme used for the splinkerette method. The adaptors for both genome walking methods were designed to prevent extension of the 3’ end of the adaptor during PCR and thus reduce or eliminate nonspecific amplification. The adaptor-ligated genomic DNA fragments were then referred to as genome walker libraries or splinkerette libraries, one library for each restriction enzyme. Libraries were prepared from genomic DNA isolated from three individual T1S2 plants of B.t. Cry34/35Abl event DAS-59122-7; plants DAS-59122-7 T1S2 1, DAS-59122-7 T1S2 2 and DAS-59122-7 T1S2 10, and from one Hi-II and one PH09B control plant.
Following construction of the libraries, nested PCR amplifications were completed to amplify the target sequence using Advantage™-GC Genomic PCR kit (BD Biosciences Clontech, Palo Alto, CA). The primary PCR amplification used one primer with identity to the adaptor and one gene specific primer. The adaptor primer will not amplify a product in the first cycle of the primary PCR and only products from the gene specific primer will be produced. Annealing and amplification from the adaptor primer only occurs after the
I complementary strand has been produced ftom the gene specific primer. Following primary PCR amplification, a secondary nested PCR reaction was performed to increase the specificity of the genomic PCR reactions. The nested primers consisted of genespecific and adaptor-specific sequences internal to the respective primers used in the primary PCR.
For 5’ flanking border sequences, nested PCR was initiated using primers specific to the 5’ end of the inserted T-DNA along with primers complementary to the adaptor sequence ligated onto the digested DNA. Similarly, cloning of the 3 ’ flanking border sequence started with a primer specific for the 3’ end of the inserted T-DNA and a primer complementary to the adaptor sequence. DNA sequences internal to the T-DNA Right Border and Left Border sequences within the T-DNA region were used as the starting points for “walking out” to the maize genomic sequence, because they represented unique sequence (not homologous to endogenous maize genomic sequences) from which to anchor the genome walking primers.
WO 2006/039376
PCT/US2005/034947
The products produced by the nested PCR were analyzed by agarose gel electrophoresis (data not shown). Fragments visible in libraries prepared from one or more of the event DAS-59122-7 DNA samples and absent in libraries prepared from the Hi-II and PH09B genomic DNA samples were identified for further characterization. The identified PCR amplified fragments were separated by preparatory gel electrophoresis, isolated using a QIAquick Gel Extraction Kit (Qiagen), and sent directly for sequencing or cloned into a pGEM-T Easy plasmid vector using the pGEM-T Easy Vector System I (Promega Corp., Madison, WI) prior to DNA sequencing. Sequencing reactions were carried out with primers used for the nested PCR amplification or with primers specific for use with the pGEM-T Easy vector. The sequence obtained was used to design additional gene specific primers to continue “walking out” into the unknown maize genomic sequence. Multiple rounds of genome walking were performed until at least 500 bp of border sequence from the ends of the T-DNA insert were obtained.
To ensure validity of the flanking border sequences, additional event-specific PCR amplifications on genomic DNA from event DAS-59122-7 were performed. The amplified fragments were sequenced in order to further extend the region of sequence overlap from the T-DNA insert region into the 5’ and 3’ bordering genomic DNA.
Primers, shown in Table 2, were designed based on the sequence obtained from the genome walking experiments to amplify a fragment spanning the unique junction of the T20 DNA with the com genomic DNA. Primer set 03-0-506/02-0-476 (SEQ ID NO: 10/SEQ ID NO :9) spanned the 5’ junction and amplified a 313 bp fragment (from bp 2427 to bp 2739, see Figure 1), and primer set 02-0-447/03-0-577 (SEQ ID NO: 8/SEQ ID NO: 17) spanned the 3’ junction and amplified a 754 bp fragment (from bp 9623 to bp 10376, see Figure 1).
WO 2006/039376
PCT/US2005/034947
Table 2. Primer Sequences
<td> Primer Name</td><td> Sequence (5’ - 3’)</td><td> Target Sequence Location (bp to bp)<sup>1</sup></td>
<td> 02-0-215</td><td> (SEQ ID NO: 1) GTGGCTCCTTCAACGTTGCGGTTCTGTC</td><td> 2743-2716</td>
<td> 02-0-219</td><td> (SEQ ID NO: 2) CGTGCAAGCGCTCAATTCGCCCTATAGTG</td><td> 9830-9858</td>
<td> 02-0-227</td><td> (SEQ ID NO: 3) AATTGAGCGCTTGCACGTTT</td><td> 9846-9827</td>
<td> 02-0-370</td><td> (SEQ ID NO: 4) AACAACAAGACCGGCCACACCCTC</td><td> 4871-4894</td>
<td> 02-0-371</td><td> (SEQ ID NO: 5) GAGGTGGTCTGGATGGTGTAGGTCA</td><td> 5187-5163</td>
<td> 02-0-372</td><td> (SEQ ID NO: 6) TACAACCTCAAGTGGTTCCTCTTCCCGA</td><td> 7017-7044</td>
<td> 02-0-373</td><td> (SEQ ID NO: 7) GAGGTCTGGATCTGCATGATGCGGA</td><td> 7897-7873</td>
<td> 02-0-447</td><td> (SEQ ID NO: 8) AACCCTTAGTATGTATTTGTATT</td><td> 9623-9645</td>
<td> 02-0-476</td><td> (SEQ ID NO: 9) CTCCTTCAACGTTGCGGTTCTGTCAG</td><td> 2739-2714</td>
<td> 03-0-506</td><td> (SEQ ID NO: 10) TTTTGCAAAGCGAACGATTCAGATG</td><td> 2427-2451</td>
<td> 03-0-514</td><td> (SEQ ID NO: 11) GCGGGACAAGCCGTTTTACGTTT</td><td> 2687-2709</td>
<td> 03-0-542</td><td> (SEQ ID NO: 12) GACGGGTGATTTATTTGATCTGCAC</td><td> 10766-10742</td>
<td> 03-0-543</td><td> (SEQ ID NO: 13) CATCTGAATCGTTCGCTTTGCAAAA</td><td> 2451-2427</td>
<td> 03-0-564</td><td> (SEQ ID NO: 14) CTACGTTCCAATGGAGCTCGACTGTC</td><td> 2324-2299</td>
<td> 03-0-569</td><td> (SEQ ID NO: 15) GGTCAAGTGGACACTTGGTCACTCA</td><td> 10150-10174</td>
<td> 03-0-570</td><td> (SEQ ID NO: 16) GAGTGAAGAGATAAGCAAGTCAAAG</td><td> 10275-10299</td>
<td> 03-0-577</td><td> (SEQ ID NO: 17) CATGTATACGTAAGTTTGGTGCTGG</td><td> 10376-10352</td>
<td> 03-0-784</td><td> (SEQ ID NO: 18) AATCCACAAGATTGGAGCAAACGAC</td><td> 2189-2213</td>
<td> 67609</td><td> (SEQ ID NO: 36) CGTATTACAATCGTACGCAATTCAG</td><td> 9862-9886</td>
<td> 69240</td><td> (SEQ ID NO: 37) GGATAAACAAACGGGACCATAGAAG</td><td> 9941-9965</td>
<td colspan="2"> '· Location in sequence of Event DAS-59122-7 (see Figure 1). '</td><td> Bases 1 - 2593 = 5’</td>
border, bases 2594 - 9936 = T-DNA insert, bases 9937 - 11922 = 3’ border.
WO 2006/039376
PCT/US2005/034947
For verification of the DNA sequence that inserted into the maize genome, PCR was performed to amplify, clone, and sequence the inserted T-DNA from event DAS-59122-7. PCR primer sets, (SEQ ID NO: 11/SEQ ID NO:5); (SEQ ID NO: 4/SEQ ID NO:7); and (SEQ ID NO: 6/SEQ ID NO:3) shown in Table 3 were used to amplify three overlapping fragments labeled 221-1 (SEQ ID NO: 25), 221-2 (SEQ ID NO: 26), and 221-3 (SEQ ID NO: 27) representing sequence from the 5’ region of the T-DNA running through to the 3’ region of the T-DNA insert from bp 2687 to bp 9846 for event DAS59122-7 (see Figure 1). PCR amplicon information is reported in Table 3 and primer sequences are listed in Table 2.
Table 3. PCR Primer and Amplicon Descriptions
<td> PCR Amplicon</td><td> Size (bp)</td><td> Target Sequence</td><td> Forward Primer</td><td> Reverse Primer</td><td> Location of PCR Amplicon (bp to bp)<sup>1</sup></td>
<td> 221-1 (SEQ ID NO:25)</td><td> 2501</td><td> T-DNA insert</td><td> 03-0-514 (SEQ ID NO: 11)</td><td> 02-0-371 (SEQ ID NO :5)</td><td> 2687-5187</td>
<td> 221-2 (SEQ ID NO:26)</td><td> 3027</td><td> T-DNA insert</td><td> 02-0-370 (SEQ ID NO :4)</td><td> 02-0-373 (SEQ ID N0:7)</td><td> 4871 -7897</td>
<td> 221-3 (SEQ ID NO :27)</td><td> 2830</td><td> T-DNA insert</td><td> 02-0-372 (SEQ ID N0:6)</td><td> 02-0-227 (SEQ ID N0:3)</td><td> 7017 - 9846</td>
<td> 0784/0564 (SEQ ID NO:28)</td><td> 136</td><td> 5’ genomic border</td><td> 03-0-784 (SEQ ID NO: 18)</td><td> 03-0-564 (SEQ ID NO: 14)</td><td> 2189-2324</td>
<td> 0784/0543 (SEQ ID NO:29)</td><td> 263</td><td> 5’ genomic border</td><td> 03-0-784 (SEQ ID NO: 18)</td><td> 03-0-543 (SEQ ID NO.T3)</td><td> 2189 -2451</td>
<td> 0569/0577 (SEQ ID NO:30)</td><td> 227</td><td> 3’ genomic border</td><td> 03-0-569 (SEQ ID N0:15)</td><td> 03-0-577 (SEQ ID NO: 17)</td><td> 10150 - 10376</td>
<td> PCR Amplicon</td><td> Size (bp)</td><td> Target Sequence</td><td> Forward Primer</td><td> Reverse Primer</td><td> Location of PCR Amplicon (bp to bp)<sup>1</sup></td>
<td> 0570/0542 (SEQ ID N0:31)</td><td> 492</td><td> 3’ genomic border</td><td> 03-0-570 (SEQ ID NO: 16)</td><td> 03-0-542 (SEQ ID NO: 12)</td><td> 10275-10766</td>
<td> 0784/0215 (SEQ ID NO:32)</td><td> 555</td><td> 5’ junction</td><td> 03-0-784 (SEQ ID NO: 18)</td><td> 02-0-215 (SEQ ID NO:1)</td><td> 2189-2743</td>
<td> 0219/0577 (SEQ ID NO:33)</td><td> 547</td><td> 3’junction</td><td> 02-0-219 (SEQ ID N0:2)</td><td> 03-0-577 (SEQ ID NO: 17)</td><td> 9830- 10376</td>
<td> 0506/0476 (SEQ ID</td><td> 313</td><td> 5’ junction</td><td> 03-0-506 (SEQ ID</td><td> 02-0-476 (SEQ ID</td><td> 2427 - 2739</td>
WO 2006/039376
PCT/US2005/034947
<td> NO:34)</td><td></td><td></td><td> NO: 10)</td><td> NO:9)</td><td></td>
<td> 0447/0577 (SEQ ID NO:35)</td><td> 754</td><td> 3’ junction</td><td> 02-0-447 (SEQ ID NO:8)</td><td> 03-0-577 (SEQ ID NO: 17)</td><td> 9623 - 10376</td>
<td> 67609/69240 (SEQ ID NO:38)</td><td> 104</td><td> 3’ junction</td><td> 67609 (SEQ ID NO:36)</td><td> 69240 (SEQ ID NO:37)</td><td> 9862-9965</td>
<sup>L</sup> Location in sequence of Event DAS-59122-7 (see Figure 1). Bases 1 - 2593 = 5’ border, bases 2594 - 9936 = T-DNA insert, bases 9937 - 11922 = 3’ border.
PCR GC2 Advantage™ Polymerase kit (BD Biosciences Clontech, Inc.) was used according to manufacturer’s instructions to amplify the insert fragments (221-1 (SEQ ID NO: 25), 221-2 (SEQ ID NO: 26), and 221-3 (SEQ ID NO: 27)). Briefly, a 50pL reaction contained 5’ and 3’ primers at a final concentration of 0.2μΜ and 40 ng of genomic DNA. PCR reactions were set up in duplicate using genomic DNA preparation from plants DAS-59122-7 T1S2 1 and DAS-59122-7 T1S2 2. PCR conditions were as follows: initial denaturation at 95°C for 1 min, followed by 35 cycles of 94°/95°C for 30 sec, 55°C for 30 sec, and 68°C for 5 min, with final extension at 68°C for 6 min. PCR amplification products were visualized under UV light, following electrophoresis through a 1% agarose gel in IX TBE (89mM Tris-Borate, 2mM EDTA, pH 8.3) stained with ethidium bromide.
PCR fragments 221-1 (SEQ ID NO: 25), 221-2 (SEQ ID NO: 26), and 221-3 (SEQ ID NO: 27) were purified by excising the fragments from 0.8% agarose gel in IX TBE stained with ethidium bromide, and purifying the fragment from the agarose using a QIAquick Gel Extraction Kit (Qiagen). PCR fragments were cloned into a pGEM-T Easy plasmid vector using the pGEM-T Easy Vector System I (Promega Corp.). Cloned fragments were verified by minipreparation of the plasmid DNA (QIAprep Spin Miniprep Kit, Qiagen) and restriction digestion with Not I. Plasmid clones and/or purified PCR insert fragments were then sent for sequencing of the complete insert. Sequencing reactions were carried with primers designed to be specific for known T-DNA sequences or with primers specific for use with the pGEM-T Easy vector. Sigma-Genosys, Inc. (The Woodlands, TX) synthesized all PCR primers, which were used at a final concentration of 0.2 - 0.4 μΜ in the PCR reactions.
PCR reactions with genomic DNA isolated from B.t. Cry34/35Abl events DAS-59122-7, DAS-45214-4, and DAS-45216-6, and unmodified control lines Hi-II and PH09B were used to confirm (1) the presence of maize genomic DNA in the sequenced
WO 2006/039376
PCT/US2005/034947 border regions of event DAS-59122-7, and (2) event specific amplification across the junctions of the T-DNA insert and genomic DNA borders in event DAS-59122-7.
PCR primers designed to amplify the border sequence flanking the insert in event DAS-59122-7 were used to confirm the presence of those regions in unmodified control lines as well as in event DAS-59122-7. Two (2) sets of primers each, for the 5’ and 3’ borders (four (4) sets total) were tested. Primer sets 03-0-784/03-0-564 (SEQ ID NO: 18/SEQ ID NO: 14) and 03-0-784/03-0-543 (SEQ ID NO: 18/SEQ ID NO: 13) were used to amplify 136 bp and 263 bp fragments, respectively, from border sequence 5’ to the T-DNA insert in event DAS-59122-7 (Figures 2 and 3). Similarly, primer sets 03-0569/03-0-577 (SEQ ID NO: 15/SEQ ID NO:17) and 03-0-570/03-0-542 (SEQ ID NO: 16/SEQ ID NO: 12) were used to amplify 227 bp and 492 bp fragments, respectively, from the 3’ genomic border (Figures 2 and 3).
Primers designed to amplify fragments across the junction of the border sequence and T-DNA insert were used to establish event-specific PCR fragments for event DAS-59122-7. One primer set was selected for each of the two junctions. Primer set 030-784/02-0-215 (SEQ ID NO: 18/SEQ ID NO:1) was designed to amplify a 555 bp fragment across the 5’ junction, and primer set 02-0-219/03-0-577 (SEQ ID NO: 2/SEQ ID NO: 17) was designed for amplification of a 547 bp fragment at the 3 ’ junction. A set of primers, IVR1(O197) (SEQ ID NO: 39) 5’- CCGCTGTATCACAAGGGCTGGTACC3’ and IVR2(O198) (SEQ ID NO: 40) 5’- GGAGCCCGTGTAGAGCATGACGATC-3’, based on the endogenous maize invertase gene (Hurst et al., (1999) Molecular Breeding 5 (6):579-586), was used to generate a 226 bp amplification product as an internal positive control for all maize genomic DNA samples.
All PCR primers were synthesized by Sigma-Genosys, Inc. and used at a final concentration of 0.2 - 0.4 μΜ in the PCR reactions. PCR primer sequences are listed in the Table 2. For PCR amplifications, Advantage™-GC 2 PCR kit (BD Biosciences) was used according to manufacturer’s instructions. Approximately 10-100 ng of genomic DNA template was used per 50 pL PCR reaction. PCR conditions were as follows: initial template denaturation at 94°C for 5 min, followed by 35 cycles of 95°C for 1 minute, 60°C for 2 minutes, and 72°C for 3 min, with final extension at 72°C for 7 min. The PCR amplification products were visualized under UV light following electrophoresis through a 1% agarose gel with IX TBE and ethidium bromide.
Sequence data obtained for the T-DNA insert and border regions of event DAS-59122-7 was reviewed and assembled using Seqman II™ software Version 4.0.5
WO 2006/039376
PCT/US2005/034947 (DNAStar, Inc., Madison, WI). The 5’ and 3’ border sequences flanicing the insexl present in event DAS-59122-7 were used for homology searching against the GenBank public databases in order to further characterize the site of insertion in the maize genome.
Analysis to identify open reading frames in the junction regions between the flanking borders and T-DNA insert in event DAS-59122-7 was conducted using Vector NTI 8.0 (InforMax™, Inc., Frederick, MD).
In total, 11922 bp of sequence from genomic DNA of event DAS-59122-7 was confirmed (see Figure 1). At the 5’ end of the T-DNA insert, 2593 bp of flanking border sequence was identified, and 1986 bp of flanking border sequence was obtained on the 3’ end from fragments derived from genome walking experiments. A total of 7160 bp of the T-DNA insert was cloned and sequenced using PCR primer sets designed to amplify three overlapping fragments labeled 221-1 (2501 bp) (SEQ ID NO:25), 221-2 (3027 bp) (SEQ ID NO:26), and 221-3 (2830 bp) (SEQ ID NO:27) representing sequence from the 5’ region of the T-DNA running through to the 3’ region of the T-DNA insert for event DAS-59122-7 from bp 2687 to bp 9846 (see Figure 1). The remainder of the T-DNA insert region was sequenced from two PCR fragments, 0506/0476 (SEQ ID NO: 10/SEQ ID NO:9) and 0447/0577 (SEQ ID NO: 8/SEQ ID NO: 17) that spanned the 5’ and 3’ junctions, respectively, of the T-DNA insert with corn genomic DNA. Primers used were designed based on the sequence obtained from the genome walking experiments to amplify a fragment spanning the unique junction of the T-DNA with the corn genomic DNA. Primer set 03-0-506/03-0-476 (SEQ ID NO: 10/SEQ ID NO:9) spanned the 5’ junction and amplified a 313 bp fragment (from bp 2427 to bp 2739) and primer set 03-0-447/03-0577 (SEQ ID NO: 8/SEQ ID NO: 17) spanned the 3’ junction and amplified a 754 bp fragment (from bp 9623 to bp 10376). Combined, a total of 7343 bp of the T-DNA insert in event DAS-59122-7 was cloned and sequenced (from bp 2594 to bp 9936, see Figure 1) and compared to the sequence of the transforming plasmid, PHP 17662. Two nucleotide differences at bp 6526 and bp 6562 were observed in the non-translated wheat peroxidase promoter region of the T-DNA insert (see Figure 1). Neither of the observed base changes affected the open reading frame composition of the T-DNA insert. Both the 3’ and 5’ end regions of the T-DNA insert were found to be intact, except for deletion of the last 22 bp at the 5’ end and 25 bp at the 3’ end encompassing the Right and Left T-DNA Border regions, respectively. While T-DNA border sequences are known to play a critical role in T-DNA insertion into the genome, this result is not unexpected since insertions are often
WO 2006/039376
PCT/US2005/034947 imperfect, particularly at the Left T-DNA Border (Tinland (1996) Trends in Plant Science 1(6):178-184).
BLAST (Basic Local Alignment Search Tool) analysis of the genomic border regions of event DAS-59122-7 showed limited homology with publicly available sequences (Release 138.0 GenBank, Oct 25, 2003). Analysis of the 5’ border region found two areas with significant homology to maize genomic and EST (Expressed Sequence Tag) sequences. The first area encompasses 179 bp (bp 477 to bp 655 of the border sequence) and displays similarity to several molecular markers, chromosomal sequences, and consensus sequences obtained by alignment of various ESTs. The second area occurs at bp 1080 to bp 1153 (74 bp) of the 5’ border sequence, and shows similarity to a number of different maize ESTs and genomic sequences. The 3’ border region also had two small non-contiguous regions of similarity to plant DNA sequences. The inner 3’ region of 162 bp (bp 9954 to bp 10115) showed similarity to the 3’ untranslated end of two genomic Zea mays alcohol dehydrogenase (adhT) genes as well as to several EST consensus sequences. A smaller region (57 bp) in the middle of the 3’ border (bp 10593 to bp10649) showed similarity to non-coding regions from multiple maize genomic sequences.
Overall, no homologous regions greater than 179 base pairs were identified in either of the genomic border sequences, nor was more than one homologous region from the same known sequence found. Individual accessions displaying similarity to the event DAS-59122-7 border sequences were examined to determine if the insertion in event DAS-59122-7 occurred in a characterized protein coding sequence. None of the regions of similarity occurred within any known protein coding sequences. Local alignment of the entire transformation plasmid sequence, PHP17662, with the event DAS-59122-7 border sequences showed no significant homologies, indicating that the border regions flanking the T-DNA insert did not contain fragments of the transforming plasmid. Therefore, identification and characterization of the genomic sequence flanking the insertion site in event DAS-59122-7 was limited due to the absence of significant regions of homology to known sequences.
The 5’ and 3’ junction regions between the maize genomic border sequence and the T-DNA insert in event DAS-59122-7 were analyzed for the presence of novel open reading frames. No open reading frames of significant size (> 100 amino acids) were identified in the 5’ or 3’ border junction regions, indicating that no novel open reading frames were generated as a result of the T-DNA insertion. Additionally, the homology searches did not indicate the presence of endogenous maize open reading frames in the
WO 2006/039376
PCT/US2005/034947 border regions that might have been interrupted by the T-DNA insertion in B.t. Cry34/35Abl event DAS-59122-7.
Example 5. PCR Primers
DNA event specific primer pairs were used to produce an amplicon diagnostic for DAS-59122-7. These event primer pairs include, but are not limited to, SEQ ID NO: 18 and SEQ ID NO: 1; SEQ ID NO: 2 and SEQ ID NO: 17; SEQ ID NO: 10 and SEQ ID NO: 9; and SEQ ID NO: 8 and SEQ ID NO: 17; and SEQ ID NO: 36 and SEQ ID NO: 37. In addition to these primer pairs, any primer pair derived from SEQ ID NO: 21 and SEQ ID NO: 22 that when used in a DNA amplification reaction produces a DNA amplicon diagnostic for DAS-59122-7 is an embodiment of the present invention. Any modification of these methods that use DNA primers or complements thereof to produce an amplicon DNA molecule diagnostic for DAS-59122-7 is within the ordinary skill of the art. In addition, control primer pairs, which include IVR1(O197)/IVR2(O198) (SEQ ID NO: 39/SEQ ID NO: 40) for amplification of an endogenous com gene are included as internal standards for the reaction conditions.
The analysis of plant tissue DNA extracts to test for the presence of the DAS59122-7 event should include a positive tissue DNA extract control (a DNA sample known to contain the transgenic sequences). A successful amplification of the positive control demonstrates that the PCR was run under conditions that allow for the amplification of target sequences. A negative, or wild-type, DNA extract control in which the template DNA provided is either genomic DNA prepared from a non-transgenic plant, or is a nonDAS-59122-7 transgenic plant, should also be included. Additionally a negative control that contains no template corn DNA extract will be a useful gauge of the reagents and conditions used in the PCR protocol.
Additional DNA primer molecules of sufficient length can be selected from SEQ ID NO: 21 and SEQ ID NO: 22 by those skilled in the art of DNA amplification methods, and conditions optimized for the production of an amplicon diagnostic for event DAS59122-7. The use of these DNA primer sequences with modifications to the methods shown in these Examples are within the scope of the invention. The amplicon wherein at least one DNA primer molecule of sufficient length derived from SEQ ID NO: 21 and SEQ ID NO: 22 that is diagnostic for event DAS-59122-7 is an embodiment of the invention. The amplicon wherein at least one DNA primer of sufficient length derived from any of the genetic elements of PHI17662A that is diagnostic for event DAS-59122-7
22/03 2007 THU 16:09 FM 61 3 9851 6004 HOULIHAN 2 HELB AUST «·. Patent Office @017/018
2005292090 22 Mar 2007 is an embodiment of the invention. The assay ίοτ the DAS-59122-7 amplicon can be performed by using a Stratagenc Robocycler, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermocyoler, or by methods and apparatus known to those skilled in the art.
Having illustrated and described the principles of the present invention, it should be apparent to persons skilled in the art that the invention, can be modified in arrangement and detail without departing from such principles. We claim all modifications that are within the spirit and scope of the appended claims.
All publications and published patent documents cited in this specification axe incorporated herein by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Where the terms “comprise”, “comprises”, “comprised” or “comprising” are used in this specification, they are to be inlctprcled as specifying the presence of the stated features, integers, stops or components referred to, but not to preclude the presence or addition of one or more other feature, integer, step, component or group thereof.
Further, any prior art reference or statement provided in the specification is not to be taken as an admission that such art constitutes, or is to be understood as constituting, part of the common general knowledge in Australia.
COMS ID No: SBMI-06717326 Received by IP Australia: Time (H:m) 16:03 Date (Y-M-d) 2007-03-22
10/01 2011 MON 16:24 FAi 61 3 9851 6004 HOULIHAN 2 MELB AUST +» Patent Office @006/032
2005292090 10 Jan 2011
Contents63
Every citation, both ways
| Document | Relation | Office | Cited during |
|---|---|---|---|
| WO0114417A2 | Cites | World Intellectual Property Organization (WIPO) | Search report |
| WO8402913A1 | Cites | World Intellectual Property Organization (WIPO) | Search report |
| WO1984002913A1 | Cites | World Intellectual Property Organization (WIPO) | – |
| WO2001014417A2 | Cites | World Intellectual Property Organization (WIPO) | – |
| HUNST, P. L. & ROOD, T. U.S. Department of Agriculture, Animal and Plant Health Inspection Service. 7 Service. 7 September 2004, pages 1-237. Retrieved from http://www.agbios.com/docroot/decdocs/05-242-046.pdf | Non-patent | – | Search report |
| EMBL Accession No. CG069192 28 August 2003 | Non-patent | – | Search report |
| RICKER, K. U.S. Food and Drug Administration. 28 September 2004, pages 1-6. Retrieved from http://cfsan.fda.gov/rdb/bnfm081.html | Non-patent | – | Search report |
| EMBL Accession No. CG069192 28 August 2003 | Non-patent | – | – |
| HUNST, P. L. & ROOD, T. U.S. Department of Agriculture, Animal and Plant Health Inspection Service. 7 Service. 7 September 2004, pages 1-237. Retrieved from http://www.agbios.com/docroot/decdocs/05-242-046.pdf | Non-patent | – | – |
| RICKER, K. U.S. Food and Drug Administration. 28 September 2004, pages 1-6. Retrieved from http://cfsan.fda.gov/~rdb/bnfm081.html | Non-patent | – | – |
55 members in 15 offices
Priority claims3
| Document | Office | Kind | Date |
|---|---|---|---|
| 60614225 | United States of America | – | |
| 61422504 | United States of America | P | |
| 2005034947 | United States of America | W |
Members55
| Document | Office | Kind | |
|---|---|---|---|
| US2006070139A1 | United States of America | A1 | |
| AU2005292090A1 | Australia | A1 | |
| CA2588243A1 | Canada | A1 | |
| WO2006039376A2 | World Intellectual Property Organization (WIPO) | A2 | |
| TW200630033A | Taiwan Province of China | A | |
| AR050891A1 | Argentina | A1 | |
| WO2006039376A3 | World Intellectual Property Organization (WIPO) | A3 | |
| KR20070059196A | Republic of Korea | A | |
| EP1794308A2 | European Patent Office (EPO) | A2 | |
| US7323556B2 | United States of America | B2 | |
| JP2008514233A | Japan | A | |
| US2008166725A1 | United States of America | A1 | |
| US2008166726A1 | United States of America | A1 | |
| US2008167455A1 | United States of America | A1 | |
| US2008171333A1 | United States of America | A1 | |
| US2008171334A1 | United States of America | A1 | |
| US2008176235A1 | United States of America | A1 | |
| US2008177052A1 | United States of America | A1 | |
| US2008178323A1 | United States of America | A1 | |
| US2008178357A1 | United States of America | A1 | |
| US2008182256A1 | United States of America | A1 | |
| BRPI0515922A | Brazil | A | |
| NZ554035A | New Zealand | A | |
| US7695914B2 | United States of America | B2 | |
| US7696341B2 | United States of America | B2 | |
| US7875429B2 | United States of America | B2 | |
| US7875430B2 | United States of America | B2 | |
| AU2005292090B2This record | Australia | B2 | |
| US2011030086A1 | United States of America | A1 | |
| US7888023B2 | United States of America | B2 | |
| US7888495B2 | United States of America | B2 | |
| US7897342B2 | United States of America | B2 | |
| US7932033B2 | United States of America | B2 | |
| US7956246B2 | United States of America | B2 | |
| UA97088C2 | Ukraine | C2 | |
| USRE43373E | United States of America | E | |
| JP2012245004A | Japan | A | |
| CA2588243C | Canada | C | |
| EP1794308B1 | European Patent Office (EPO) | B1 | |
| TWI414236B | Taiwan Province of China | B | |
| US8592653B2 | United States of America | B2 | |
| ES2432749T3 | Spain | T3 | |
| KR101337016B1 | Republic of Korea | B1 | |
| PL1794308T3 | Poland | T3 | |
| US8952223B2 | United States of America | B2 | |
| JP5685228B2 | Japan | B2 | |
| US2015167076A1 | United States of America | A1 | |
| US9879321B2 | United States of America | B2 | |
| US2018057878A1 | United States of America | A1 | |
| BRPI0515922B1 | Brazil | B1 | |
| CL2018002146A1 | Chile | A1 | |
| US11053544B2 | United States of America | B2 | |
| US2022010374A1 | United States of America | A1 | |
| BRPI0515922B8 | Brazil | B8 | |
| US2024124934A1 | United States of America | A1 |
5 legal events, as the office reported them to INPADOC
Over the term
Point at a mark for the eventEvents
| Event | Code | |
|---|---|---|
| Patent ceased section 143(a) (annual fees not paid) or expiredExpiredMK14 | MK14 | |
| Alteration of name in registerHB | HB | |
| Alteration of name in registerHB | HB | |
| Alteration of name in registerHB | HB | |
| Letters patent sealed or granted (standard patent)GrantedFGA | FGA |
Numbers
- Publication
- 2005292090
- Application
- 292090
Titles
- English
- Corn event DAS-59122-7 and methods for detection thereof
Classification
- CPC, 8
- C12Q1/6895
- C07K14/415
- C12Q1/6876
- C12N15/8277
- C12N15/8286
- Y02A40/146
- C12N15/11
- C12Q2600/13
- IPC, 2
- C12N15 82
- C12Q1 68